diff --git "a/merges.txt" "b/merges.txt" new file mode 100644--- /dev/null +++ "b/merges.txt" @@ -0,0 +1,199744 @@ +#version: 0.2 - Trained by `huggingface/tokenizers` +Ġ Ġ +ĠĠ ĠĠ +ĠĠ Ġ +ĠĠĠĠ ĠĠĠĠ +i n +e r +o r +o n +a t +r e +ĠĠĠĠ ĠĠĠ +s e +Ċ ĠĠĠ +Ġ = +s t +e n +Ċ ĠĠĠĠĠĠĠĠ +Ċ ĠĠĠĠĠĠĠ +Ġ t +a r +a l +d e +l e +a n +Ġ i +- - +m e +Ġ ' +r o +t i +m p +Ġ c +Ġ p +Ġ f +Ġ " +h e +# # +i t +Ġ a +l o +0 0 +g e +ĊĠĠĠĠĠĠĠĠ ĠĠĠ +or t +c e +' , +Ġ n +Ġ s +u t +u r +s s +Ġ in +Ġ re +se l +sel f +mp ort +in g +a me +Ġ o +Ġ d +l i +c t +p e +u n +Ġ m +r a +Ġ e +l a +-- -- +at e +i on +( ) +f i +u e +en t +ti on +a d +" , +c o +r i +Ġt he +Ġ b +Ġ 1 +Ġ # +e d +1 1 +ro m +u m +ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +in t +i d +Ġ ( +Ġ 0 +Ġ w +## ## +c h +t e +d i +de f +) : +an d +at a +Ċ ĊĠĠĠ +Ġ [ +m a +Ġ self +u l +Ġi mport += = +] , +f rom +Ġi f +o t +c k +Ġf or +" " +o l +e l +ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +' : +) , +ur n +y pe +e s +t urn +Ċ Ċ +Ġ + +o de +i s +v al +_ _ +n ame +at ion +ge t +on e +( ' +) ) +se t +at h +Ġ - +Ġt o +Ġ T +x t +i l +t h +u s +i mport +st r +Ġre turn +c on +Ġ 2 +er s +( " +p p +' ) +a s +ĉ ĉ +[ ' +i z +---- ---- +e t +ar g +o p +v e +Ġ { +Ġi s +c tion +Ġ 7 +Ġ S +a b +N one +Ġo f +Ġ C +i g +h t +u p +" ) +Ġ= = +r int +Ġ def +Ġ g +f or +t er +Ġ r +Ġ l +" : +en d +d ata +Ġ A +s p +ul t +v er +a ge +' ] +0 1 +p ut +#### #### +Ġc on +ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +i c +k e +a m +t o +9 9 +Ġ : +it h +p ar +p ath +Ġ and +i le +i st +t ype +== == +Ġ F +o d +s c +q u +lo g +li st +o m +val ue +v i +s er +ode l +Ġ h +* * +ĠĠĠĠ Ġ +al l +p o +t a +Ġ P +Ċ ĊĠĠĠĠĠĠĠ +Ġa s +d er +Ġ I +fi le +Ġ L +u b +re s +t r +iz e +Ġt h += ' +Ġ st +Ġ de +in e +p ro +e st +00 00 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +Ġ" "" +p t +for m +e x +Ġn ot +i m +Ġe x +ab le +fi g +Ġ 3 +arg s +p tion +1 0 +Ġp rint +a se +e ct +o ut +o w +Ġ D +a c +Ġ u +] ) +er t +R e +it e +a pp +s h +m ent +Ġd ata +Ġ M +n t +ti me +č Ċ +Ġ None +o un +r ue +i f +ke y +la b +x f +r or +č ĊĠĠĠ += " +Ġ v +0 2 +e w +e xt +Ġ _ +Ġ y +Ġn p +Ċ Ġ +Ġ O +d s +Ġ * +Ġp ar +Ġ x +al se +o s +Ġ se +Ġm a +Ċ ĠĠĠĠĠ +q ue +a ck +la ss +te st +Ġ or +Ġw ith +ad d +Ċ ĉĉ +[ " +j ect +E R +I N +Ġ str +x e +. . +Ġe l +x b +an ge +u re +11 11 +mp le +lo ad +or e +m s +Ġ % +Ġ me +' ], +O N +Ġel se +-------- -------- +t ra +ss ert +an ce +Ġf ile +o ur +Ġp ro +en s +p y +ar t +x c +p re +de x +ma ge +ce ss +l s +a p +0 7 +an g +x d +lab el +at ch +en se +E S +b er +Ġb e +a re +Ċ ĉ +" ] +Ġ B +a ult +Ġo s +1 2 +Ġn ame +y s +Ġ E +Ġ j +. _ +i me +c i +o b +"" " +w or +Ġ < +l y +te xt +A T +Ġ ) +x a +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +lo w +s ize +č ĊĠĠĠĠĠĠĠ +co m +m odel +an s +Ġ N +d ate +} , +i r +l en +n um +######## ######## +Ġre s +us er +b o +Ġ 4 +g er +f f +X X +Ġa ssert +la y +Ġ get +l u +di r +9 2 +t p +co l +I n +==== ==== +in d +app end +lo t +que st +Ġ R +m o +e p +ra y +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +Ġ un +O R +f o +u le +re ad +re ate +Ġt est +um ent +li c +Ġ log +3 2 +ct or +p er +o c +ó ł +p h +s on +/ / +Ġ G +ce s +Ġc o +Ġ on +Ġt ype +form at +E N +Ġ W +t ri +h o +it y +lo c +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ur l +Ġo ut +C on +Ġl en +b u +A R +Ġ V +Ġ U +co de +ss age +ar y +r ror +r y +di ct +Ġn um +Ġ value +p rint +par am +Ġ 5 +Ġ he +m b +) . +ig ht +i b +ss ion +a pe +Ġ an +Ġ __ +Ġf rom +ic ense +Ġ en +i se +i re +ar d +c he +m in +99 9 +at or +I T +Ġt ime +E rror +sc ri +Ġ > +1 8 +1 6 +Ġ list +l ine +Ġ ], +T rue +co un +ar ray +g ht +f t +s a +c ur +d a +' ), +Ġ k +Ġc ol +2 5 +() : +Ġ ro +S t +Ġp y +con fig +Ġ 6 +l t +Ġ set +en er +a g +ół ģ +u mp +t s +ht tp +0 4 +un ction +Ġm odel +1 3 +o g +li b +0 6 +at us +Ġw h +l l +c lass +ig n +our ce +1 5 +li f +ers ion +S E +S T +ĠT rue +e c +ce pt +a ce +1 00 +ĠL icense +ma x +a ss +0 5 +Ġth is +0 3 +or m +Ġin t +F alse +] . +c s +j o +w e +u ti +i p +r ite +Ġo p +el d +ut e +tra in +Ġc h +a x +ĠĠĠĠ ĠĠ +1 7 +Ġ al +on se +re nt +d d +9 3 +vi ce +val id +ĊĠĠĠĠĠĠĠĠ Ġ +l it +se d +r ame +1 4 +ro up +ar i +st ance +Ġp re +Ġres ult +ut h +n e +Ġ" ", +Ġ / +or d +Ġ at +o k +Ġb y +** ** +um n +v ent +6 4 +ri ght +Ġo b +in dex +er ror +ing s +en ti +Ġr ange +' ' +Ġ ra +Ġdef ault +b ase +Ġ+ = +Ġ[ ] +o u +( [ +g ra +ĠF alse +en ce +07 6 +: // +in fo +lo at +p lot +ar get +coun t +ation s +i ti +L E +T ype +R E +Ġt ra +li ent +jo in +th on +I C +th od +0 8 +arg ument +ma in +A N +t y +ð Ł +p i +2 2 +Ġe lif +Ġ \ +u st +m and +Ġ . +Ġ H +Ġ Re +a y +ta in +s ub +Ġ{ } +od ule +m l +in put +lo b +n p +er i +] [ +m at +Ġs h +Ġd i +s k +d f +d b +m it +L L +U T +wor k +Ġth at +8 8 +l p +de d +a st +Ġ args +1 9 +e at +out put +l in +i mage +co mp +I D +( ( +Ġs c +Ġ ` +and om +3 4 +st art +po s +Ġ[ " +u il +Ġw e +re e +ate d +0 9 +8 4 +ĠI n +w rite +er y +w ith +er e +I ON +2 7 +or ch +ow n +up date +as k +Ġ key +n d +int er +op y +an t +g s +b y +b in +sh ape +lo ck +Ġ le +il l +ĠT he +res ult +tion s +an n +ar ch +a ve +g ing +Ġa x +sp onse +Ġcon fig +2 4 +oun d +Ġ 999 +3 7 +Ġp ath +Ġa re +a k +ump y +P ro +he ck +st ate +e m +po int +ar k +ma p +Ġout put +or y +Ġ @ +Ġp o +Ġc om +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠ +Ġ- > +Ġs ub +Ġs o +la ce +v el +y n +al s +Ġ{ ' +re p +ce ption +A M +9 6 +Ġex cept +Ġa c +ac he +i eld +Ġco mp +se s +al iz +ĠC on +Ġn ew +re ss +Ġ all +Ġin put +5 5 +[ : +9 4 +c lu +Ġc ur +Ġ } +3 3 +Ċ ĠĠĠĠ +ar n +D E +R O +Ġa pp +j son +() ) +sp lit +f er +N ame +n ode +Ġ label +ro w +a mple +a v +j ang +Ġn o +8 7 +mp l +n o +Ġl ine +A L +2 0 +Ġc lass +fi c +al ue +ex p +u ct +() , +C T +---------------- ---------------- +ens or +D ata +A S +i v +Ġ la +' . +g th +Ġs ys +t ers +8 5 +i ve +" . +9 7 +ri d +jang o +() . +b ack +m i +{ } +k en +n et +Ġra ise +r ans +======== ======== +3 6 +Ġs pe +čĊ č +b ut +ction s +r on +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +ul l += [ +Ġu se +ct ed +0 11 +Ġop en +qu ery +Ġi d +Ġ K +uti ls +Ġ user +9 5 +ad er +o ck +92 3 +Ġnum ber +re turn +wor d +l at +Ġi t +Ġ' - +ot al +Ġd ist +vi ew +it s +Ġcon t +Ġi mage +Ġre quest +r un +Ġt ry +c ri +0000 0000 +in stance +8 6 +st ra +2 6 +Ġma x +ens ion +s um +Ġt orch +m on +Ġd o +Ġd ate +č ĊĠĠĠĠĠĠĠĠĠĠĠ +de scri +f a +Ġ z +id th +################ ################ +pro cess +076 923 +Ġj son +in it +Ġp lt +H E +r it +Ġpar ser +Ġh as +str ing +Ġin dex +Ġtra in +def ault +A G +. __ +Ġ }, +5 7 +Ġhe lp +Ġ ! +oun t +h is +c le +Ġ[ ' +P ar +.. . +Ġ 8 +Ġe xt +st er +w w +param s +XX XX +al ize +Ġ | +c reate +" ), +E D +I S +re g +Ġt f +R es +Ġn umpy +num ber +i x +Ġb o +u res +d o +Ġp er +me ssage +par se +i tion +qu ire +al e +a u +g roup +s pe +lay er +Ġn e +e le +T ext +Ġo ption +Ġf il +en v +", " +Ġ1 0 +pt or +Ġc reate +tr y +r c +L ist +w are +Ġ! = +cur rent +__ ( +C O +t le +http s +Ġf unction +ol d +col or +u pp +Ġun der +p ort +m an +a ch +m d +v ersion +Ġlog ging +Ġ lo +9 0 +ap i +tr ans +st atus +6 6 +2 3 +re quest +ctor y +Ġd x +un c +A C +ame ters +ari able += ( +Ġc heck +IN G +Ġst art +la g +Ġt e +ti ve +Ġm at +w args +p s +Ġ li +ul d +4 4 +Ċĉĉ ĉ +ut f +ðŁ ı +f rame +con t +ate s +n s +un d +I M +Ġd is +ul ti +* - +Ġ ** +EN T +ob ject +8 0 +A P +l er +Ġa dd +D es +7 5 +n ew +res h +id x +st ri +Ġt ext +Ġ- *- +f loat +Ċ ĊĊĠĠĠ +c or +ma il +i o +a it +Ġr un +O T +] : +Ġn ode +00 0 +ol s +il d +Ġ url +c lo +ment s +e f +'] ) +y st +E n +C o +, - +a uth +1111 1111 +2 8 +R I +Ġ end +value s +E x +te m +E T +I d +Ġ -- +ra w +v ar +fi x +s o +Ġw ill +c al +th er +Ġd jango +Ġme ssage +5 6 +g o +t ings +9 8 +Ġp ass +Ġs p +~ ~ +c lient +F I +loc al +d ing +3 8 +mo ve +m y +ob j +Ġdi ct +Ġm in +p op +Ġob ject +**** **** +L O +ĠU n +P o +Ġ( ' +bo x +Ġ( " +Ġy ou +che ck +b atch +par ser +ent s +ti tle +ri x +M e +m odule +S e +u c +< / +A c +me thod +b e +Ġc an +U R +ĠO R +te s +model s +Ġ Q +2 00 +im g +Ġcol or +P T +up le +o f +t arget +3 5 +i ck +sa mple +A B +ol u +Des cri +v is +u d +Ġcon tain +C ol +re f +quire d +st ep +V alue +er n +Ġw or +ol der +or g +ht ml +stra int +Ċĉĉ ĉĉ +B uil +Ġ us +data set +sp ace +ate g +Ġm o +F ile +a in +b s +Ġre sponse +p ri +Ġc opy +3 0 +2 01 +A D +u al +r an +mb da +on t +A r +sa ve +Ġt arget +ĊĠĠĠĠ ĊĠĠĠ +ti m +c re +Ġi m +mi ssion +Ġd f +are nt +d oc +)) ) +yst em +', ' +st at +f low +ĠS e +Ġa d +Ġcur rent +n n +g in +n orm +ĠT his +tri b +4 5 +ĠA N +7 7 +a mp +Ġ valid +n g +P O +fi l +mpl ate +t able +z er +at tr +i ch +c ent +ite m +q l +t he +i es +ĊĊ Ġ +ann el +i de +to ken +Ġdate time +Ġis instance +f unction +bu g +v ed +Ġ error +at ter +Ġdist ri +e y +n oun +Ġ Y +ft ware +type s +Ġin ter +fi len +a ct +ä ¸ +ind ow +f eat +" ], +Ġf loat +Ġma y +Ġspe ci +u age +Ġr andom +Buil der +Ġ X +se nt +fi er +` ` +Ġt rans +Ġro w +Ġ arg +Ġb ase +C H +c c +filen ame +in al +ti es +c all +4 7 +on g +in iti +] ] +Ġc ode +cs v +i ct +Ġen um +e vent +Ġ , +c ore +1 01 +a ction +f ace +Ġ ĊĠĠĠĠĠĠĠĠĠ +com mand +we ight +ack age +S tr +col umn +ĠE x +w idth +ur ation +ort ed +[: , +Ġg o +t f +and ler +file s +ang uage +la s +name s +ct s +Ġp os +p ert +Ġ 9 +t op +re am +rep lace +' s +Ġ< = +Ġ load +f ind +as h +c y +po ch +St atus +S et +n ing +ib Builder +Ġpy thon +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +p l +ite ms +. """ +I L +c ord +Ġme thod +t on +ĠO F +lab le +di re +Ġs k +Ġre g +a ger +ver t +5 0 +T est +' )) +me an +Ġg ener +lob al +H O +id s +k wargs +lic ense +Ġs er +8 3 +Ġp d +Ġstr ing +r ange +Ġe vent +pert y +Ġ one +w ait +Ġm ibBuilder +I B +ame ter +ir st +Ġma in +Ġa g +len gth +Ġ ver +Ġ2 01 +ig h +C h +w h +re sponse +Ġs ize +n der +n er +le d +> > +d u +Ġvalue s +Ġl in +m ark +clu de +r andom +a i +ro p +U N +qu al +g en +ĠI N +clo se +s g +fil ter +f unc +r t +ĠRe turn +key s +en ame +8 2 +e ar +} ) +Ġe ach +Ġfile s +am s +or s +´ ółģ +S g +ho st +or der +fi ed +Ġ ar +Ġcom mand +it er +4 6 +P E +Ġ J +t xt +low er +Ġc v +10 7 +load Text +L og +b g +N um +ot h +loadText s +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +L o +ra ph +y le +8 9 +op tions +s ource +Ġcol umn +Ġu sed +ti v +le ct +but ed +D I +Ġ ] +sc he +o me +Ġlog ger +lo ss +uti l +y p +ĠS t +": " +F ield +Ġc al +le ction +c p +[ - +Ġde scri +label s +7 0 +k s +) ] +l d +Ġd ire +a il +4 0 +n x +Ġm odule +op en +f g +el ds +AM E +a ssert +opy right +Ġf eat +Ġre ad +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +ro ot +Ġ update +pe cted +AN T +ist s +Ġfor mat +vi ron +U n +p k +T he +ma sk +Ġ q +te mp +Ġv ersion +T H +ta g +T R +descri ption +Ġh ave +ho uld +aliz ed +ad ata +s ys +ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ +ist er +U L +a ir +w ard +T o +Ġon ly +čĊ čĊĠĠĠ +ĠI f +n ect +ĠO ption +ĠP y +Ġ' '' +sc ore +all y +le t +C ON +D O +O b +Ġre quired +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +g ener +D e +o st +ex ec +gra m +fi eld +Ġb atch +Con fig +. ') +s ign +Ġc od +Ġwh ich +2 9 +n ot +Ġwh ile +U S +Ġ` ` +] * +Ġ ĊĠĠĠĠĠĠĠ +di m +Ġs eri +076923 076 +Ġ val +T ime +Ð ¾ +ES S +â Ģ +Ġb uil +oun ds +b lock +'] [' +loc ation +076923076 93 +c ul +076923 07692307693 += { +ro und +Ġt able +Ġd oc +us r +el l +6 5 +o ff +Ġst ate +g n +Ġd b +gra ph +g rid +M P +6 7 +c at +4 3 +sh ow +b ot +n al +re ak +Ġi tem +he ad +Ġ{ " +m ary +lay ers +Ġcod ing +Ġs ource +c l +u se +las ses +ĠC ON +py thon +de vice +Ġ up +Ġs hould +iz er +Ġc or +ĠP ro +Ġdata set +result s +le vel +T able +C L +Ġp lot +F F +2 1 +v id +se arch +co pe +Ġ: : +u id +ĠL ist +ĠF lag +Ġcont in +ół Ģ +Ġdistri buted +lin es +Ġ1 00 +IN T +in s +fi r +v o +: : +de p +0000 00 +fer ence +Ġn et +Ġpo int +S I +u g +Ġm atch +ĠC opyright +ck et +ent ry +( { +Ġs ample +c u +Ġo ther +p age +'] . +tr ue +d own +st d +Ġa ction +ta il +Ġresult s +stri p +P I +'' ' +con text +4 8 +ðŁı ´ółģ +s v +i e +) * +Ġ qu +Par ser +) ): +Ġoption s +ĠReturn s +st ore +Ġim g +E X +yn c +9 1 +ĠD ata +# ! +ww w +on ly +ic al +F A +ing le +er r +p ass +t ing +p lt +ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +' t +Ġan y +f e +Ġfil ename +at ing +re d +Ð ° +iv en +6 0 +Ġf irst +p lace +N o +t otal +z e +Ġ' . +\ \ +m ode +se ssion +Ġ array +ã ģ +r ate +cont ent +ang le +ĠA r +Ġ utf +4 2 +if y +T T +Ġte mp +] )) +ms g +t adata +ne ction +ust om +Ġg roup +l ta +Ġ query +ĠOption al +arn ing +od y +la st +qu ence +ph a +descri ptor +st amp +co py +M A +P ath +Ġ right +ĠEx ception +lic y +le ft +pro ject +ib le +log ger +E L +' ): +Ġp ri +ic s +M odel +nx M +nxM bg +vi de +ES T +lin k +Sg w +Ġcon text +Ġpro cess +nxMbg Sgw +) / +t ask +ut ure +Ġcontin ue +Ġli mit +N AME +ółģ ¿ +Ð µ +ff er +de bug +c a +pro to +mb ed +(' -- +" )) +Ġ http +exp r +â Ķ +i ss +) ), +Ġax is +b ounds +D AT +bo ard +â ĸ +ï ¼ +ax is +Ġ ), +Ġf ig +Ġf ull +id d +Ġu ti +t en +ĠI S +le te +sp an +ĠV alue +ser ver +me tri +m t +at ive +Ġwor k +fic ation +le ase +Ġ Ð +" > +F rame +an ts +#! / +to ols +Ġin st +og le +M ax +po st +c li +k in +Ġt otal +Ġb ack +ĠAN Y +on ent +Ġm ust +o us +11 1 +p onse +con d +w o +che s +ro l +tra cts +pe d +" ]) +lic ation +Ġex p +Ġun it +p arent +Ġt ag +Ġc ount +point s +di c +G et +g ame +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġw rit +U M +N ode +ĠP ar +m atch +t x +ĠW AR +and le +Ġ> = +re ct +7 6 +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +x y +Ġ' / +t ed +Ġdescri ption +che d +8 1 +ĊĊ Ċ +la mbda +Ġb ut +re en +ER S +( - +3 9 +y mb +e val +Ġc lient +n y +Ġc all +b le +olu tion +čĊ ĉĉ +i ce +Ġb reak +t d +Ġs um +Ġ argument +Me ssage +mp ty +add ress +00 1 +A dd +p c +Ġs ave +Ġo ver +Ġf a +. ") +ION S +r and +et a +Ġ" , +initi alize +b ar +ĠT HE +Ġt ensor +Ġe le +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +b l +Ġa ss +f older +Ġi ter +pp er +mat rix +ut o +un i +uc cess +Ġt yp +( __ +il ity +p lay +.. / +ch ar +================ ================ +ol low +f ter +Ġma ke +Ġext ension +str uct +con f +bu ild +Descri ptor +Ġbo ol +Ġ & +" ): +li mit +ch o +ern el +Num ber +a w +( \ +t ensor +-- - +Ġe d +Ġla st +er ate +Ġch ar +t mp +Ġto ken +d ump +an ti +Ġn orm +T O +Ġw ord +re n +Ġcontain ing +ĠSe e +ES C +R ANT +Ġf ound +i k +d uct +con v +"] [" +3 1 +u i +čĊ čĊ +s rc +ĊĊ ĉ +ĠWAR RANT +f uture +Ġm ode +Ġ ## +enti ty +sc ale +our ces +P AT +mple ment +ateg ory +m er +ĠCon straint +5 4 +di tion +trib ute +p ng +ch annel +s he +T ra +~~ ~~ +i al +form ation +10 11 +Col umn +Ġf rame +7 9 +K ey +Ġf la +I ES +Ġus ing +Ġin to +Ġpar ams +te mplate +Ġa uth +g ine +Ġg iven +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +ulti p +zer os +s cope +V i +Ġof f +it le +c v +con st +7 4 +ĠV ar +ith er +o se +with in +set tings +D ict +c md +f y +ro ll +plot lib +n ow +Ġd im +RI PT +ti ck +M IB +Ġob j +e poch +ex it +ction ary +M O +Ġ' , +di ces +Ġst ep +ve ctor +ĠT one +ĠS kin +Ġto p +me m +ent er +Ġ' __ +Ġwh en +ĠC o +le ss +Ġpy test +enti fier +0 1111 +le ep +f n +Ġex pected +] ), +7 3 +g ment +e mail +ith ub +ver age +Ġf ind +or age +Ġso ftware +di s +f it +Ġi mp +Ġd if +date time +Ġd type +Ġv ariable +ĠValue Error +pro perty +Ġ ... +EN SE +trans form +L I +Ġn ext +Str ing +b lob +li ed +ĊĠĠĠĠĠĠĠĠ ĠĠ +Ob ject +arg v +C om +F T +resh old +Co mp +ec tive +Ġper mission +en viron +com mon +Ġ https +l ation +Ġor der +c ache +te ger +Ġde vice +Descri ption +B o +st ack +lu gin +da y +se nd +IC ENSE +us h +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +Ġun i +ann ot +f ul +ad j +ĠĠĠĠĠĠĠĠ ĠĠĠĠ +01 01 +Ġenum erate +Ġtyp ing +pre d +object s +ri ver +un k +Ġfil ter +Ġspeci fic +v ariable +Ġrequest s +n ext +ĠT O +Ġsh ape +F orm +Res ponse +ver se +im um +ĠM ib +a ke +Ġmodel s +i um +fir st +view s +de v +k er +] [' +L e +el se +Ġe val +at s +UL T +le an +O L +o ver +C lass +Ġ> >> +ro le +vis ion +co ding +******** ******** +In put +P P +t ree +Ġin iti +Ġbuil d +ed ge +Ġa b +Ġs upp +Ġm ath +ĠY ou +5 8 +or es +for e +pt s +St ate +AR T +Ġin stance +ĠW IT +Ġf ield +w er +ile d +ðŁ ij +c lasses +ac cess +tri but +p r +S er +g r +and as +ex ists +Ġ1 2 +di st +ai lable +Con t +le arn +7 8 +O P +O ut +Ġset tings +ĠT est +man ager +Re g +re q +. ", +c ase +Ð ¸ +Ġ local +. , +Ġs ign +LL LL +ã Ĥ +Ġde st +" \ +Ġ1 6 +Ġlo ss +DI R +Ġ .. +(" \ +p ol +ĠN o +bo se +ESC RIPT +str u +Ġb in +Ġwe ight +Ġb ot +j ob +Ġa wait +ch ange +U ser +Ġm an +Ġe ither +et ch +feat ures +s ystem +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +li m +5 9 +Ġex pre +') . +PAT H +en ces +id get +âĢ į +ra ise +Ġpar se +Ġro ot +XXXX XXXX +up er +se q +Ġp ort +Ġal low +Ġarg parse +S S +ator s +Ġhe ad +que ue +Ġl anguage +ĠD e +IT Y +p en +s w +Ġpro ject +C A +st yle +Ġset up +Ġex ec +spe c +5 3 +s i +Vi ew +Re als +ti cle +r ule +li ance +Ġfor m +s or +de lta +Ġ2 00 +he ight +g ithub +Ġlen gth +it or +Ġ lib +Ġf ollow +lat form +Ġde p +čĊ ĉ +Ex ception +å ı +6 8 +AT ION +ĠR es +set Status +ĠWARRANT IES +"] . +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +Ġst atus +Ġext ra +T Y +co der +Ġb u +net work +T rans +stat ic +ab s +ĠG ener +OR T +p ache +IN D +op tion +Ġmat plotlib +C E +qu i +Ġpar ameters +ã ĥ +ct x +con nect +Ġg lobal +per im +n umpy +Ġa v +weight s +L icense +at er +Ac cess +Ġdire ctory +ç ļ +xf f +y m +Ġlabel s +p ackage +Ġp age +ser vice +T h +oun ter +p b +__ ': +et we +Ġse ssion +In dex +par ms +i a +auth or +Ġst d +ac c +x x +par ameters +Ġseri alized +Ġ' -- +Ġ2 0 +Ġw idth +çļ Ħ +Ġne ed +ĠPy thon +etwe en +A t +P L +p ack +Ġb lock +Ġla mbda +K E +Ġpar ameter +l ate +in ser +rit er += _ +f s +i an +ord in +un it +( _ +M an +Ġch ange +en cy +Ġob tain +5 2 +et s +end s +Ġ" / +ce ll +sche ma +ĠU ser +O f +pos ition +Q U +AT E +ers on +s q +I f +6 2 +U p +an k +lu ster +W AR +ĠC reate +Ġfeat ures +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Ċ ĠĠĠĠĠĠ +n ap +ext ension +) [ +Ġm sg +column s +Ċ ĠĠ +Ñ Ĥ +) ; +Ġh ere +S h +re move +Ġ2 55 +op t +Ġy our +Ġre nder +ub lic +G H +x ml +Ġ1 1 +Ġc ase +Ġex ist +Ġt itle +pre sent +b a +pre fix +Ġa bs +I mage +at ure +ex ception +pp ing +atter n +ok en +license s +f ra +ĊĊ ĊĊ +I nt +iz ation +I P +um i +xe c +d ot +ĠS o +ESCRIPT OR +li p +di sp +ver y +Ġdo es +: ] +AG E +Ġt mp +4 9 +R ES +p u +ra di +Ġw as +olu me +bo ok +Ñ Ģ +Ġp ackage +Ġma p +ĠP ath +HO UT +wor ds +D B +Ġ3 00 +UR L +he ader +D ef +Ġt uple +Ġm ask +01 00 +01 2 +Ġg raph +xa f +In fo +-------------------------------- -------------------------------- +en e +Ġ" . +L oc +inter nal +B U ++ ' +par t +ar ds +ex ample +Ġme tri +E M +Ġt er +Ġ2 02 +de code +S C +ti c +Ġm ore +log ging +s u +g ument +ĠV ersion +ĠA pache +Ġs orted +ĠS et +P RO +ab el +Con text +о Ð +s im +Ġ" " +Ġ" \ +to m +2 02 +con ds +Ġoff set +Ġ -------- +Ġf i +} \ +vi ces +Ġor ig +6 3 +Re quest +Ġop tim +T his +ĠW e +st ream +Ġ1 5 +pass word +âĸ Ī +Ġser ver +se ed +bin ary +tail s +C C +In ter +Ġg l +Ġf ont +ul umi +sample s +ser v +ĠG et +op s +* ( +pe line +le cted +ymb ol +7 2 +ĠWIT HOUT +con trib +pe c +fi elds +clu ster +de lete +ĠA ll +} ") +A A +a ded +I O +Ġth en +node s +as ure +n a +ist ory +ac y +3 00 +: \ +ĠI D +( * +sh ot +w d +perim ent +D IT +k ens +do main +it ch +A SE +å Ī +N ot +__ ) +ext ra +Ġt ask +C K +me d +set up +in ed +C reate +Ġm y +re sp +pro t +4 1 +i as +Ġ" __ +B ase +Ġt ri +me tadata +ver b +Ġcont ent +Ġdoc ument +Ġlin es +T x +Ġs im +Ġex ample +Ġk wargs +Ġp h +Ġa pi +Log ger +Ġs a +h andler +ro ss +Ġle vel +H andler +g it +Ġnet work +f la +AP I +t orch +Ġj nxMbgSgw +m c +Ġg rid +A Y +xf e +u de +Ġcon st +input s +Ġle ft +Ġuti ls +f ont +en u +'] [ +ĠK IND +ar s +A l +re ed +") ; +Ġse nt +D ESCRIPTOR +ma ke +y ear +Ġ' ' +exec ute +âĶ Ģ +Ġen v +g g +Q u +aliz er +au se +vide o +ke ep += - +Ġs ame +B y +du ce +O ption +Ġpar ms +ĠF or +Ġhe ight +Ġid x +################################ ################################ +Ġtrain ing +w indow +f p +g round +Ġse arch +Ġtrans form +Ġ entry +am ma +100 0 +de c +Ġs rc +Q L +C lient +' \ +Ġsc ri +6 9 +pe ct +m od +Ġw rite +A pp +in k +ul ar +: ` +me di +Ð ½ +Ġp andas +on ents +able d +d t +" { +Z E +bo ol +Ġfollow ing +T E +iti ve +Ġwith out +G tp +" }, +% ( +(' \ +Ġwh ere +ex cept +ad min +Ġo per +Ġ' \ +Ġs u +Ġso me +Ġ" -- +Ġd own +as ic +f ull +R x +li ce +h as +xf b +L ICENSE +st op +di ff +tribut es +ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ += [' +25 6 +er a +b ody +Ġgo ver +set s +is ion +ultip le +F a +ĠC h +ay load +p atch +le ctions +am l +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +image s +ĠN OT +Ġapp lic +Ġimp lied +s leep +u ff +reg ister +r ary +ĠM ed +Ġsh ow +head ers +n own +Ġm ark +op tim +ci es +ĠLicense d +ĠMib Table +sc al +Ġmat rix +oth er +a a +te x +Ġpermission s +by tes +Ġcon vert +A d +ra p +ĠI mage +ho me +Ñ ģ +data base +v en +P y +in st +ï¼ Į +ĠA ny +test s +Ġme an +res ource +Ġ3 70 +Ġargument s +set Description +add ing +Ġhe ader +la ck +s ing +") . +a z +per ties +l an +he d +ap ache +w ise +or ig +Ġ[ [ +ĠT h +che ma +': ' +Ġc sv +Ġra w +F or +h ash +TY PE +čĊ čĊĠĠĠĠĠĠĠ +Ġv is +ä º +xe f +tra ck +ĠT ype +ul ation +ĠS im +xf c +are d +p g +S ize +load er +di v +xf a +'] : +xb c +user name +me ta +cle an +ĠD ict +' }, +à © +er o +ge st +s ort +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠ +de s +ĠSo ftware +ur ls +S p +ce l +dire ctory +Ġunit test +Ġwrit ing +set Max +Ġm ock +Ġin formation +Ġm on +Ġn on +vid er +Ġoption al +p air +ta gs +cul ate +s m +Ġin fo +Ġh ost +ne ss +KE Y +. \ +li sh +Gtp V +Ġ loc +Ġc lo +Ġed ge +## # +w in +Ġp i +ta x +dir name +Data Frame +/ { +i tions +he lp +CO L +setMax Access +se lect +Ġmo di +Ġ ): +Ġre f +igh b +c ls +æ ķ +b est +le s +Ġsub process +F L +tr an +s in +on es +po ol +ĠL o +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +feat ure +AB LE +v m +cu da +a ys +Ġname s +b it +g y +i str +he l +P R +Ġa fter +ĠD ef +ĠM e +scri pt +G roup +x ed +Ġre t +__ ": +if t +_ { +ac tive +F O +in es +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +v es +ĠD E +en code +Ġfi elds +or ds +Ġin clude +__ __ +step s +e e +d rop +Ġch annel +Ġapplic able +V E +ä » +ar r +Ġa ct +Ġexpre ss +a ctions +resh ape +Ġ ge +and ard +bu tion +N et +P re +D S +Ġdata base +rep ort +read y +Ġpo st +P U +c ry +i ent +G R +we b +Ġb etween +sq rt +à § +ion s +Ġth an +] ]) +ock et +tiv ity ++ + +---- --- +V ER +Ġf in +c ast +ol ute +l r +m ath +al id +Ġgener ate +S ub +ĠA PI +xc f +aliz ation +Ġr and +xd f +Res ult +} " +r at +metri cs +s ide +ele ment +Ġ< / +FA ULT +Ġme m +M L +u int +Ġcomp liance +)) . +xb e +AS IS +Ġ $ +ĠAr gs +DIT IONS +co mple +Ġla w +doc s +Ġbo x +x ce +go ogle +row s +s ql +A uth +S ER +il y +s ig +a f +d m +d at +LO G +g ress +off set +d type +DAT A +Ġsc ore +Ġ Z +adj ective +, ' +Ġtensor flow +g or +ra m +N O +Ġj ob +ĠB ASIS +G ener +Ġth ere +ĠB ase +Ġ5 0 +Ġp arent +Ġ // +ĠCON DITIONS +ĠE n +i fier +Ġc li +Ġth read +U P +n on +Ġ ì +r s +Ġno ti +Ġsk learn +Ġgover ning +6 1 +Ġc fg +read only +xd b +ĠMed ium +(' / +æ ľ +W S +in dices +Ġc md +vi ous +IC s +upp er +to col +d jango +di tions +Ġs ql +di o +xb f +P os +coun ts +li ght +f in +ER R +g b +Ġt wo +idd en +G B +A LL +iz ed +En try +Ġc ell +() ). +Ġag reed +Ġc luster +u x +qui res +GH T +start s +se ction +Ġre move +xe b +čĊ čĊč +cur acy +{ " +xa e +Ġsp lit +Ġpoint s +Ġin it +con tain +> \ +ti ty +g lobal +à £ +Ġ ans +TH ER +ge d +IN E +al pha +Ġv ar +ĠM an +CT ION +e qual +ra pper +Ġlimit ations +F P +le g +train ing +Ġz ip +stat s +: % +Ġpar t +- % +} . +he x +Ġb est +00000000 00000000 +ĠS tr +ĠS O +mplement ed +D is +n b +c an +am era +] + +N E +z ip +on s +ra in +T ensor +Ġd ir +ab ility +Ġscri pt +e lif +t t +Ġc ho +R un +ran k +h a +M E +ol ve +Ġdi ctionary +se n +ĊĊ ĉĉ +re al +C heck +e mbed +x de +Ġcolumn s +i mple +ĠF ile +time stamp +ĠPar ameters +P ort +U D +pre dict +IL ITY +gra d +fa ctor +p x +FI LE +fi ll +] ): +Ġ1 90 +Ġw indow +H e +Ġe poch +EN D +Ġte mplate +lay out +o id +ĠA dd +c fg +g t +in clude +di stance +us ers +Re turn +enti al +Ġ{} ". +ĠMibTable Column +T oken +s upp +xf d +ow er +ci p +AC K +Ġp ack +R L +ã o +R ule +ĠTO DO +Q t +Ġpos ition +å ħ +Ġj o +eri es +Ġ' % +Ġk ernel +5 1 +an y +ĠUn less +cent er +inser t +pri ce +âĶĢ âĶĢ +b ound +re cord +th reshold +Ġpar ti +lo y +vi ded +en gine +Ġ6 6 +d raw +al og +Ġco mple +op er +ĠC al +end ing +Ġ" - +u uid +Ġ1 3 +Ġ1 4 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +sum mary +Ġse e +Ġal pha +Con straint +Ġhead ers +) \ +ĠR el +ac count +ys is +T e +m ount +te ms +idd le +load s +gor ith +á ĥ +Ġn n +get Logger +der r +1 0000 +Ġi gn +ur i +ĊĊ ĊĠĠĠĠĠĠĠ +tra ct +Ġst at +path s +U B +Po int +SI ZE +b r +F unction +s d +Ġ layer +ĠAN D +ĠC heck +OR M +Ġex it +. ', +c ut +Ġg ame +Ġtest s +Ġcol lections +/ ' +re l +ĠĠĠĠĠĠĠĠ Ġ +L ib +Ġstr uct +disp lay +Ġ[ ], +Ar gument +di ction +im al +xc b +cp u +Ġi ts +ra ys +WAR E +h er +Ġp ick +Ġele ment +G S +en gth +Ġy ield +v ate +ro t +' } +M ode +Ġ license +ĠĠĠĠĠĠĠĠ ĠĠĠ +tran sp +ĠA pp +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +Ġme ta +starts with +var s +V AL +f lag +Ġt ree +è ¯ +Ġn ow +Ġauth or +ext end +25 5 +Ġc ustom +Ġde te +RO M +Ġimage s +P er +ign ment +Col or +O r +(" -- +xb d +x ad +co ls +e ff +x el +00 11 +Ġs w +xc c +zer o +. " +e ed +yn tax +d x +Ġspe c +; \ +. * +Ġ vi +app ing +G ET +c m +à ¡ +Ġfla sk +P e +xb a +al le +xc d +Ġinst all +E vent +TT P +ra d +I tem +ve c +log in +ĠK ey +metri c +G I +Ġc tx +c ard +xe a +b ers +(' - +ĠL e +tiv ation +Ġspeci fied +nap shot +e k +ci al +sub plot +ĠCon fig +ve lo +Ġver bose +L abel +Ġs ci +Ġre sp +Ġlin k +âĸĪ âĸĪ +de st +ĠCo mp +Ġ-------- -- +Ġst ri +Ġse nd +process ing +pos it +x ab +Ġdist ance +id entifier +Ġ( ( +dire ct +dump s +i mp +Ġb lob +, " +ch ild +L ine +Ġsc ale +a pt +W e +Ġm er +Ġ1 8 +Ġreturn s +M S +xd d +ateg or +7 1 +f alse +u ation +Ġc ache +int e +as on +h and +Ġbe fore +" } +t tp +å IJ +ce iv +Ġfunction s +C ode +| \ +dep th +D ate +P UT +S ON +xb b +v ing +ti l +oc ab +Ġav ailable +ix el +Lo ad +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +c f +le x +call back +m m +ad o +ast ype +N A +yn am +11 0 +ser ved +c ap +Ġs ingle +c ision +app lication +] [" +ar m +Ġo pt +Ġconfig uration +Ar ray +th read +Re f +um my +Ġadd ress +Ġpass word +ĠUn ion +Ġfeat ure +se quence +Ġf unc +ma g +Ġme tadata +æķ ° +mo te +ut ton +Ġre st +la p +id a +di ms +pro b +xe e +group s +Ġse cond +ble m +Ġpar am +arn ings +C I +ri es +Ġst op +S im +. / +co s +ĠC ol +Ġp e +ĠR un +roll er +st orage +in ation +Ġlo op +F il +o o +Ċĉĉĉĉ ĉ +' { +O UT +ã Ģ +Ġ err +Ġpro vided +M at +Ġ" ) +Ġl ong +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +St art +Ġwe b +AB ILITY +mo ck +ern al +Ġ location +xd a +it ude +Ġe st +ĠF OR +AS S +######## #### +FT WARE +B L +Ġ3 0 +li ke +10 8 +Ġpro gram +color s +Ġ' _ +: . +M C +j nxMbgSgw +S D +f c +.. .. +r l +} ') +ur face +j e +o te +Ġre present +p layer +fi lt +ta ct +m ulti +n one +pre ssion +comp ile +b x +doc ument +Ġ4 0 +Ġac cess +Ġm c +ERR OR +i er +coun ter +W OR +Ġh andle +ug h +Ġs uper +po licy +=[ ], +C ount +but ton +ix ed +li ties +Ġin clu +Pro cess +s ingle +Ġe mail +Se ssion +PO ST +l ong +ĠĠĠĠĠĠĠĠ ĠĠ +v ers +ĠP RO +XX X +ĠRel ation +ĠN ot +Ġc pp +, \ +con nection +se c +: ", +ĠT ime +py plot +N N +d river +Ġat tr +i fication +bo ve +ser i +ĠO r +å ¤ +av g +h x +Ġg en +ĠI mport +c la +m k +Ġs uccess +Ġo ld +pro file +ordin ates +Po inter +Ġ[ - +Ġst yle +ran ch +! ! +end er +mo di +EX T +ch ain +ari es +raise s +c d +re qu +ĠD T +Ġbe en +an el +ĠP o +âĢį ðŁij +P ri +ma ster +ath er +xd c +com mit +$ \ +l ing +() )) +FI G +Ġcontain s +di ctions +sche d +ĠC om +ut es +ST R +Ġdif fer +ĠT e +ĠSO FTWARE +norm al ++ " +co st +C D +re ssion +re nder +h andle +Ġ vector +Ġinput s +A ll +x ac +re t +Bo x +n an +are a +Ġli ke +w s +al y +а Ð +o ci +Ġf inal +Ġe mpty +B O +Ġp ub +Ġdim ension +Ġ" % +Ġa bove +al ance +ut er +to ur +Ġright s +Ġst ream +T EST +w ay +Ġs m +wh ere +lo op +p ad +c er +p lugin +ĠL og +1111 11 +Ġen coding +S o +m ing +r al +Ġsci py +d r +} ' +Ġ keep +Ċĉĉĉĉ ĉĉ +v ari +Ġallow ed +AG S +frame work +IM E +M o +-------- ---- +ta ck +p ub +l on +re set +O n +Com mand +Ġs ystem +Ġtype s +å ® +Ġc ls +Value s +error s +~~~~ ~~~~ +se g +to kens +Ġchar act +a uto +bu ffer +Ġtra ck +Out put +stru ction +r m +bu il +Ġdis play +Ġkey s +Ġal ready +S c +in ition +viron ment += \ +E qual +ter m +Ġcon n +OR S +ĠL I +xa a +L ay +c ustom +Ġ% ( +xa mple +nd array +inter val +/ ( +s ite +A CT +Ġ views +lu x +ĠUn it +q a +Ġre cord +Ġ6 0 +Ġbin ary +exception s +std out +di stri +ol y +par ti +Man ager +"] [ +Field Descriptor +stra ct +N orm +R o +ge x +o uld +output s +spe ct +ro ugh +ĠM odel +ĠE X +Ġp layer +ä ½ +in f +Ġin d +time out +100 11 +r b +ĠH ttp +æ ĸ +() [ +Ġcomp ute +E d +Le vel +ç Ķ +sp ath +Ġch ild +e mpty +rid ge +cli ck +ceiv ed +C RE +t c +t uple +Ġpick le +posit ory +t k +99 02 +lo aded +ĠN ame +UT H +BU G +he ther +ta ch +Ġcon f +Ġsc al +y label +ar ange +ro py +Ġser vice +Ġiniti al +ss ible +Ġweight s +T P +Ġcon nection +enti c +Ġw ait +ne g +] ], +pro p +е Ð +Ġcreate d +IM IT +è ¿ +ĠC ounter +j s +u tion +U RE +Ġb l +Ġj s +Ġnode s +so le +Ġ" _ +M ap +)/ ( +` . +Ġt x +A IN +th is +con cat +ome try +gener ate +gorith m +s uccess +en ded +ul er +Ġe mbed +Ġg lob +IN FO +z one +Ġm ulti +DE FAULT +S V +Ġ ---------------------------------------------------------------- +cur ity +M M +M et +O K +Ġ{} '. +w riter +fa il +æ ĺ +am ily +sc ores +event s +G L +B e +D o +^ \ +ub e +static method +Ġex ception +E le +à ¤ +mp t +Ġthe m +T ag +Ġ html +Ġw ant +fla gs +s ers +er as +ker as +variable s +ens ity +Res ource +time s +Ġal so +Ġign ore +( [' +O per +Ġres ource +Ġvariable s +S pec +P S +y per +G G +Ġp ad +Ġdo main +f name +v ol +xc a +Ġf older +{ ' +Ġy ear +x F +Ġmo ve +u sed +Ġ1 000 +bu cket +p attern +Ġ_ , +ĠSim Type +? \ +f lat +Ġt rue +I s +J o +Ġp adding +IC E +Ġbase d +Ġpro duct +ag ent +$ ', +U E +ĠU RL +O S +Ġoutput s +dition al +ti cal +po se +({ " +iss ue +clo ud +_ \ +q dm +or ed +to ol +x label +ĠA c +Ġobject s +in ary +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +Ġuni que +sk ip +D R +ol ver +100 1 +comp onents +uff le +f etch +cre t +Ġa ut +un its +mon th +Ġorig inal +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +(" - +sh ip +12 8 +P ORT +Ġ2 6 +re quired +ĠI t +Ġlo ok +an e +Ġc ard +Ġby tes +Ġne g +C ore +D F +E xt +v s +in ner +Ġro t +qu are +pro duct +valid ate +Ġsupp ort +â ķ +com m +Option s +E nd +en ch +Ġj ust +` \ +th ing +Ġpy game +F ound +l ang +á » +Ġdis able +D ir +F R +L C +sh ort +ĠN um +sub type +reg ion +er ature +Ġd raw +ĠA uth +edge s +node type +Ġabs olute +Me thod +( ** +E num +Ġr ule +ĠF ROM +filt ers +P h +Ġmetri cs +F ORM +Ġs chema +Ġas ync +Ġtag s +add r +man tic +Ġg r +Ġcor rect +c r +ĠDef ault +Ġ' ../ +fig ure +ĠT o +de te +ĠL anguage +z y +is hed +ĠO THER +S H +Ġi tems +00 01 +iss ing +Ġ[ ( +Ġ3 2 +g h +ent ries +Ġre port +ex periment +uni que +tick s +g re +Ġc ore +ĠQ t +Ġp air +con vert +G E +Ġ' ) +ti le +ex pected +"] : +module s +al ysis +ss ue +(" % +Ġde l +comp at +Ġs ig +lat ive += [" +V alid +c ategory +h at +ĠA t +H ER +b n +11 5 +T otal +/ " +P AR +p latform +Ġde tails +bu f +p df +LE CT +se conds +k nown +Ġc ms +om an +Ġpre dict +Ġ view +03 3 +C ase +] \ +Ġde lete +app ly +resp on +t ab +col lection +iz es +Ġpre fix +CON FIG +Ġh igh +> < +Ġd on +I R +Ġ ------- +ĠT uple +eri al +Pro tocol +Ġsh util +Ġreg ion +T ree +W indow +u ate +line ar +âĶ Į +S O +ces sed +my func +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +g a +est im +Ġsk ip +f fix +name d +cor ds +Ġnoti ce +Ġhas h +state s +M in +Ġcon nect +valid ation +s ocket +čĊ Ġ +B utton +: , +A V +T ER +re st +Ġt r +he s +is h +Ġse quence +Ġhas attr +Ser ver +il ar +Ġurl lib +A n +Ġ- = +Ġgener ated +Ġreg ister +V ID +Ġs he +tra ce +Ġreturn ed +ĠU p +p us +Ġex ists +US ER +x s +ist ri +Ġerror s +Ch ar +D i +g pu +Ġo w +Ġde bug +du ction +={ ' +m u +al low +ic ro +est ed +Str uct +am ount +Ġtime out +no ti +: - +Ġ ve +se mantic +al o +ateg y +up lic +rat io +Ġe very +ĠB o +Lo ader +Ġ## # +r ation +ro po +01 0 +Ġrun ning +Ġro le +Ġcom mon +dep end +! \ +a ut +Ġp ixel +ma c +cur sor +Qu ery +Ġcli ck +à ® +val s +ub le +I p +T ask +Ġcon ditions +0000 0 +test ing +mem ory +Ġf un +Ġget attr +/ ', +ĠA l +quest ion +k ernel +99 99 +au ss +D X +st ers +[: - +Ġdiffer ent +v a +{ \ +Ġs in +fi ci +h our +à ° +Pro gram +train ed +Ġac count +f inal +é Ģ +Ġa st +fi d +h ist +Ġp erson +Ġpre vious +MO DE +E E +G N +S ource +l int +AC E +p ulumi +v olume +Ġp ulumi +Ġd at +Ġse lected +Ġf ra +Ġr ate +ob s +per i +Ser vice +e ded +co me +Ġrow s +e ad +se cond +i i +Ġac c +mem ber +Ġs ort +H el +Ġt qdm +cho ice +h istory +Ġpo ol +Ġso cket +ì Ŀ +Ġc ap +ĠO b +comp onent +Ġf it +f l +ock er +Ġcommand s +Add ress +al k +Ġc lasses +Ġh ow +Argument Parser +G raph +_ , +f r +Ġ1 80 +sc reen +C HE +Ġre q +Ġre place +ele ct +Ġmetri c +iddle ware +C ur +Ġpro b +Ġoptim izer +or k +ti ces +ist ic +Ġv ari +di a +Ġass ign +Ġ' ', +ĠP re +assert Equal +l anguage +ĠS h +Ġan not +L ength +Ġf ail +__ , +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +Ġus ers +Ġevent s +leg end +Ġde lta +ĠW oman +' + +* \ +p a +Ġc ir +12 5 +package s +Ġst ack +Ġcomp onent +ns or +o lean +Ġ queue +Ġb ound +Ġf ast +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Se arch +Ġcopy right +Ġ: , +ched ule +rule s +W N +u me +ĠP er +ynam ic +Ġfa ctor +å Ĭ +channel s +Ġd t +Ġb ody +Ġ202 0 +9902 84 +ter min +Ġse ction +b i +æ Ī +Ġc t +Ġat tribute +b its +Ġre verse +Ġ1 7 +( [" +) + +ĠStr ing +im er +com ment +atter ns +ä¸ Ģ +down load +rand int +g an +å Ń +Po licy +Ġuni code +m ut +Data set +requ ency +ex c +ari o +DE BUG +cont rol +Ġwor ds +ire d +) ** +v v +], [ +pro perties +PO INT +å ° +che my +Ġt k +at ches +fo o +[ \ +h s +} '. +Ġvalid ation +log y +ĠP lot +sum er +) ]) +} ". +me sh +p ayload +w ays +de tails +k ed +ri ft +Ġk eras +) } +B ASE +Ġ' { +Ġf ree +Ġin dices +Ġst ore +f req +is ode +) ', +Con v +Ġag ent +velo p +M odule +Y X +te ch +ver bose +Ġvalid ate += % +W idget +d uration +Ġro und +st age +Ġin dic +Ġun its +96 27 +ro s +Ġthe se +D own +V ar +le ar +ran sp +R ow +b ind +è ¡ +Ġa verage +ĠA d +re ference +istr y +b b +ĠF unction +Ġpath lib +L A +at om +Ġmessage s +initi al +ropo ut +p id +Ġi p +cle ar +alle l +M B +V ersion +Ġc lean +op ts +mb ers +Ġre served +l and +it ed +g amma +y aml +ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +M IN +and id +ĉĉ ĉĉ +ĠO ut +we et +p d +t n +ST AT +sign ed +MA X +v as +Ã Ń +el ls +ap ter +ci o +ĠR E +âĶĮ âĶĮ +k g +Ġa mount +IT E +C al +Ġ' + +Ġp as +ri c +: ', +Ġ ë +Ġpre d +ik i +ĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Ġf lag +AN D +Ġcur sor +const ants +) - +O ff +S P +De vice +epoch s ++ \ +V ENT +b eta +bl ue +c ar +z z +"" ", +res ources +02 5 +{} '. +OL D +C R +db p +Ġfa iled +supp ort +' ^ +/ \ +j pg +Ġ{ }, +b asic +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠ +urn al +Ġ2 5 +Ġth rough +ĠE rror +Ġsp ace +æĺ ¯ +S cri +@ \ +un ch +ĠS er +ab spath +Ġsample s +for ce +ir d +ST ART +Tra in +M ENT +le ctor +ĠA n +Ġse lect +G EN +le v +Ġp op +Ġname space +Ġtra ce +ĠIn put +s ync +Ġc oun +exp and +Ġre al +_ % +Ġre ference +Ġcor respon +m enu +s orted +en cies +st derr +co ords +Ġl at +ĠIn c +back end +Ġass oci +I Z +b ed +ser ies +pi peline +< < +H as +Ñ ĥ +Ġc l +comp ute +Ġse conds +/ % +Ġ201 9 +({ ' +Ġfont size +Ġthe y +St ream +message s +O B +p ublic +Ġm od +ax es +T C +ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +Ġp latform +en um +D oc +Ġ" + +// // +Ġpo licy +ab c +Ġra di +011 011 +re lu +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠ +92 5 +84 0 +Par ams +gener ator +**************** **************** +O p +c ause +Ġal ign +ad s +In valid +w arning +Ġ sel +Ġse q +or iz +00 2 +dataset s +O ver +mo ved +Ġad ded +Ġ2 60 +Ġno qa +form s +Ġin teger +Ġd one +) ') +U SE +Ġde c +s ses +Ġd ay +11111111 11111111 +Id entifier +lo ur +ĠIn teger +& \ +B lock +cor rect +Ġuti l +Ġsign al +a fter +Ġgo ogle +st ock +so ft +Ġs av +Ġcon s +Ġ arch +ot o +wh ite +sign al +co ver +ĠM IT +Ġen tity +save fig +d uc +ma pping +eri od +h igh +Ġdef ined +ure d +box es +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +Ġextra ct +} / +in ds +g ree +l ers +Ġt ick +ight s +N UM +enti als +check point +N ew +Ġ video +Ġo ur +Ġm ultiple +Ġthe ir +< \ +it es +Ġa uto +ĠT rans +ç ão +s ymbol +Ġm ig +Q ue +g u +Ġse c +R ange +p la +at tribute +Ġ1 20 +ac ity +Ġmer ge +F rom +b lack +Up date +n i +Ġp lace +Ġax es +Ġ XXXX +re quires +fa ct +frame s +M sg +de sc +Ġf ill +ect or +P RE +s ym +qu anti +RI GHT +ud ent +Ġ' # +Ġf p +e v +Ob j +modi fied +peri od +B r +b us +w ards +at ic +B inary +Ð » +Ġi o +Ġf eed +() ] +ĠL O +pi ck +Ġdif f +Fil ter +ï ¸ +) ( +j a +Ġcon v +fe ed +( "" +e q +av a +Ġcal culate +U U +s lice +re a +CON T +Cont rol +id er +(" / +Ġbe cause +92 18 +fa ctory +990284 09 +read er +Ġsum mary +Ġact ual +pre v +{} ". +Ġuser name +ART IC +ï¸ ı +u la +Ġc enter +j ust +Ġ æ +Ġc m +00 4 +Ġre l +Ġpro p +! ") +Ġd a +Pe er +] - +o ols +ĠS ub +~ \ +å Ľ +bo ot +j or +s r +Ġ2 4 +Ġse ed +ut or +as ync +ron t +N U +S L +al f +pro xy +12 6 +ho ok +Ġpre v +V ERS +ex pression +ĠD is +Ġdep th +P Y +Ġl ang +Ġh and +lit er +Ġ} ) +bot tom +Ġ1 9 +čĊ ĠĠĠĠ +02 2 +ele te +Ġapp ro +T IME +1111 1 +ĠQ u +âĸ ij +Ġab out +D ire +CL UD +99028409 012 +ĠN O +06 57 +Z YX +ul ate +Ġth reshold +mpl ing +å º +ĠL oc +ymb ols +J E +M ET +R ed +ĠF la +py test +99028409012 25 +4 012 +Ġi prot +12 3 +4 04 +G O +Ġ" { +12 7 +s n +v ocab +gra de +Ġclo se +I SE +M T +AT A +Ġsh ort +C S +ĠO pen +ie ce +CLUD ING +ĠO n +Ġnum bers +mpl ates +wh ile +ZYX EL +e a +Ġin ser +di git +par ameter +ir s +s uper +Ġw arnings +ch unk +FI L +ighb or +g al +Ġp atch +Ġstd out +m ar +ĠR ed +Ġ201 8 +G T +I F +t w +il er +con n +ĠI P +S U +Ġ ? +S QL +re po +Re ad +da ys +Ġch unk +h idden +ch ine +Ġfor ce +end or +8 90 +Ġ um +end ar +Ġx ml +ĠW h +Ġtime stamp +Class ifier +202 0 +ĠHttp Response +S cal +ul ator +ag g +Ġcont rol +... ") +5 00 +Ġb it +ab i +lu g +Ġpy lint +Ġle t +M AP +i ces +In teger +G ui +g lob +Ġc ategory +mo st +av ailable +Ġdown load +Ġp r +Ġupdate d +Ġmon th +ma ss +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +res sed +Ġse par +ak es +auss ian +sh ift +Ġmodi fy +f ast +Ġf ace +pi xel +ĠIn ter +C M +Ġ Ċ +per cent +čĊĉĉ ĉ +f un +ç » +al th +ĠU se +b all +âĢį â +re ward +cur s +Ġ202 1 +f time +OT A +0657 840 +m is +} : +Ġ low +Ġf n +Ġs ide +pro vider +Ġ< < +pk g +create d +Ġag ain +s lot +Ġst ats +N C +W ith +p n +Ġre direct +const ant +inst all +I mplemented +N B +]) . +Ġdistri bution +Ġw hether +B u +Ġ lower +ĠT ensor +Ġpar sed +d ash +Ġdi vision +D U +E G +St ats +Ġwor ld +ĠNum ber +s napshot +(' % +Def ault +P ER +02 4 +module Name +p are +w t +Ġsub ject +c b +å ĩ +Con st +Ġcol lection +Ġpo ssible +Ġad min +Ġinter face +u ally +task s +} ', +Ġ: ] +ase s +fer ences +Ġ XXXXXXXX +Ġpath s +9218 108 +Ġre ceived +Ġbe gin +Program ming +9627 75 +à ³ +Ġs imple +ut ed +Ġ2 20 +HER E +i ma +Ġc op +Ġo prot +Ġz ero +Ġter ms +ĠLo ad +f d +Ä ± +ur ing +Ġmethod s +Cont ent +æ Ĺ +Ġ angle +Ġin te +ĠD o +Ġ6 4 +jo int +. ' +å į +al g +ĠE N +mpl er +S A +å ľ +target s +Ġcall back +M em +å ¼ +ar ge +RO OT +Ġc re +Ġare a +Pro perty +mi ss +Ġcal led +Ġest im +( (" +E C +L ight +w b +å ¾ +Ġd s +ĠT H +Ġapp ly +uni form +Ġdocument ation +B ack +S a +Ġw in +Ġexist ing +n ull +Ġp lugin +ĠA R +Ġen vironment +AG ES +1 92 +ist ics +ĠF ield +Ġde sc +- \ +or n +Ġs ure +') [ +Ġu uid +SE T +Ġmo st +Ġc ut +I ST +Y ou +g ger +Ġ layers +Ġg ra +cl one +si mple +D et +V er +g l +([ [ +sched ule +> = +Ġv olume +Ġpro perty +exp ort +cre d +ked irs +S um +Ġ mp +Ġback end +A UTH +at tributes +the ta +ro id +00 5 +di vid +Ġ[ (' +log s +Ġac tive +Ele ment +u dio +ro ute +Ġto kens +-------------------------------- ---------------- +function s +Ġjo in +G o +Ø § +se lected +Ġde v +Ġco ordinates +RE CT +Ġassoci ated +re lation +ac curacy +ticle s +é ĩ +al t +co gn +RE AD +ĠRe quest +contain er +Lay er +P H +[ ... +ser vices +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +w rap +te p +bin s +no te +spe ci +Ġn b +as is +ĠRelation Field +ĠOr der +B UT +vo id +N ING +ol ds +ĠD jango +Ġwh at +Ġac tivation +u ch +ĠL IMIT +ĠH TTP +Ġper form +Ġcolor s +cel ls +1 99 +V ariable +fi ers +ĠI MP +yn cio +E O +O pen +o v +Ġc at +Ġm issing +ä¸ ª +optim izer +Ġthread ing +Ġc ounter +AR Y +je ction +> +Ġ' {} +Return s +ategor ies +Ġp ayload +Ġmax imum +³ ółģ +ign ore +top ic +Ġ" < +M AN +d ings +() ): +\ "\ +re lease +Ġwith in +Ġpackage s +inte ger +c rit +re duce +Ġw ho +ĠC O +all back +Ġele ments +OP Y +] } +b and +cur r +N S +O ne +e ve +con tour +Ġr ank +im show +let ed +No ti +Ġsupp orted +y cle +Ġat tributes +ĠRe g +Po ol +Implemented Error +( ? +A s +B R +sh a +radi us +FL AGS +transp ose +F LO +or ity +ct ools +======== ==== +sa fe +SE LECT +Ġs leep +ma kedirs +eat ure +DE F +G e +M on +Ġi mplement +ĠC OPY +Ġpar a +ĠG o +ator y +aw s +) " +k w +DAT E +Loc al +O PT +for ward +proto buf +D D +[ ( +Ġp a +ad ded +wor ld +ends with +Ed it +quee ze +# \ +d c +d y +Ġa p +Py thon +Ġpas sed +S FP +ut able +ĠM y +rep r +Ġmem ory +Ġ' ') +0000 000 +Ċĉ Ċ +cli p +char ge +scal ar +T op +Ġp ower +lo ok +) ", +comple te +4 00 +Ġt ile +radi ent +P i +r r +Ġex c +ty p +Ġac cept +Ġexec ute +B ar +r ations +Ġd river +ĠS T +Ġg amma +row ser +serv ation +cry pt +en coding +ĠL ICENSE +au dio +Ġinst ead +struct ure +she et +W E +h i +r f +Ġne eded +PO SE +A nd +C ategory +V als +a o +in valid +re c +se gment +de l +Ġb oth +Ġfla gs +çĶ ¨ +hex rays +ench mark +fa ces +è ® +ur al +mo oth +loc ity +pl an +range s +LI ED +G rid +Ġtime s +% \ +] = +g reen +sc atter +Ġ> > +asure ment +VERS ION +L S +k es +Comp onent +unit test +N ESS +a ces +h ot +JE CT +B B +D A +in v +Ġgroup s +9 16 +D IS +dir s +Ġbot tom +s ame +ar ti +name space +Ġco st +sub ject +p atterns +Ñ Į +Ġp attern +work ers +b ig +f lo +di g +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġy aml +UL AR +dim ension +> ', +T A +c amera +Ġse gment +'] )) +Ċĉĉ Ċĉ +DE V +CO MP +block s +Ġstep s +Ġin valid +end point +if est +Ġman y +fid ence +P age +en ate +per mission +ak er +ĠGener ated +duc er +T RI +ul lable +Ġar r +f lux +Ġ 90 +B atch +a ctor +á º +se p +Ġconst ants +b alance +d l +pol y +Fa ctory +} } +om ent +ĠJ SON +={ " +Ġback ground +ĠFla sk +li er +HO ST +R U +c ert +f old +ro uter +Ġde s +OR E +A ction +ĠE xt +base name +late st +ordin ate +6 00 +K EN +c wd +Ġ201 7 +entic ation +ĠOb ject +: " +S ystem +as array +A g +ci pe +N OT +g z +Ġapp lication +hel lo +ro ad +as ci +ĠM o +bu tions +pri vate +> , +Ġs cope +ĠB UT +d ense +Ġc ent +Ġe ps +ER CH +lib rary +lin ks +Trans form +f ound +ext ernal +internal Type +% % +m ul +help ers +FORM AT +ERCH ANT +ad a +ri de +app s +Ġpro vide +################################ ################ +UR POSE +ĠCol umn +b ute +me s +di sk +get ter +Ġ2 2 +ĠD es +Ġno te +Ġexpre ssion +) ' +R Y +Ġm s +us ion +Ġ) . +201 9 +P C +Ġf low +Ġ1 28 +201 8 +Ġpi peline +Ġmeta var +Ġp l +co ur +Ġwrit er +____ ____ +s y +Ġ )) +al an +par ts +10 1111 +mk dir +un e +'] ] +g ray +de tail +ĠF IT +Ġpre dictions +Ġiter tools +Ġcom mit +H TTP +s queeze +ĠP ublic +lev ant +Ġc annot +for med +17 85 +Ġle arning +S eri +li she +age ment +01 011 +pro c +Ġind ent +ERCHANT ABILITY +D ist +F irst +S N +m ultiple +sp y +Ġv m +Ġbu f +Ġcharact er +d ummy +Ġ ]) +Ġf etch +00 6 +et te +Form at +str ument +ĠL ight +ĠO UT +ep s +ä ¿ +Ġc lear +Ġd rop +te am +Ġl on +ĠD AM +lic it +T arget +æ į +Ġh andler +by te +LLLL LLLL +Ġfun ctools +f ree +h ic +se lection +ĠC lass +10 11111111 +OR Y +Ġlist ener +og ram +Ġ8 0 +CHE CK +^ ^ +al led +ce i +so me +ĠType Error +O M +s ources +er gy +ss l +di sc +ĠT ext +ĠP URPOSE +ĠD i +ac ing +RE QU +ed it +ĠI ter +scri ption +Ġmodule s +ĠÐ ¿ +Ġlib rary +Ġ26 36 +er m +it ter +to list +I A +P ass +w idget +01 0000 +ten tion +flat ten +M ix +ĠS ystem +time Error +ON E +In stance +Ġhe l +gen e +medi a +C V +at ient +ch or +Ġ2 30 +ff ect +inser tion +Ġshe ll +* . +N e +t age +Ġs chedule +sel ine +---- - +Ġb eta +Ġl r +sc an +ĠP ARTIC +Ġex periment +88 8 +Ġextension s +ĠIMP LIED +Ġi mplemented +Ġc ar +Ġsu ch +ĠLIMIT ED +2 05 +re verse +Ġby te +ĠPARTIC ULAR +W h +Ġh ist +Ġas yncio +Ġv ol +ib ility +WOR D +ort h +Ġn ested +Ġnorm al +Net work +K e +at ial +Ġcontain er +Ġother wise +ĠCal lable +Ġi ssue +Ġ( _ +ĊĊ ĊĊĠĠĠ +ółĢ ± +ĠOut put +U C +Ġ ri +'] ), +Ġdata frame +pre t +argument s +ĠNot ImplementedError +d om +p ast +æ ł +ĠM ERCHANTABILITY +ĠN ode +config uration +Ġnorm alize +orig in +ãĢ Ĥ ++ = +S k +Ġp or +Ġme ans +limit er +s yntax +Ġto ol +Re q +Ġbu ffer +Ġparti al +_ ( +c n +í ķ +Ġs olution +ful ly +at o +Ġcur r +d p +} ", +Ġm apping +Ġe qual +Ġ1 50 +Ġex pect +num er +ä¸ į +pair s +a h +m g +pe at +ĠS H +ING S +Enum Value +liter als +asci i +5 12 +c ing +} { +} /{ +re quire +Ġre ward +un ks +__ . +Ġl ater +Ġinter val +ĠPo int +\ " +t wo +se mb +Ġse g +Ġid enti +extra ct +Ġans wer +ar is +Ġp eriod +ĠN e +clean er +hand lers +> " +č ĊĠĠĠĠĠĠĠĠ +set ter +Ġcon tract +ĠN ew +LI ST +Ġsent ence +a j +z en +at io +id entity +h older +Not Found +EnumValue Descriptor +. ) +Ġb order +as c +Ġend point +9218108 1785 +> . +_ . +g ate +con straint +Ġstr ings +"> ", +M ark +Ġ( - +ser ial +Ġpro perties +Ġpro blem +plugin s +B ACK +V ector +b d +n py +Ġt urn +de lay +Ġf ixed +un der +Ġw idget +ma jor +sp h +=[ ] +a verage +Ġpos itive +velop ment +er ved +par sed +Ġdefault dict +sub mit +mark down +CL ASS +čĊčĊ čĊčĊ +d h +l c +log its +ef fici +Th read +Doc ument +0 11111111 +f ri +se nsor +Ġd ot +pro gram +pre ss +pre dictions +ep isode +ĠG roup +AC C +Ġad ditional +Ġneg ative +miss ing +e ms +Ġs yntax +Ġ2 10 +10 24 +Ġma ster +en abled +Ġre po +iti es +[... , +A X +F ixed +P N +re at +Ġs q +ĠT ra +pi e +HE AD +ĠSt art +ï¼ ļ +stru ctions +C ell +R mt +Ġo c +all close +EN G +AN G +Ġsm all +R ate +Ġw ere +ĠC or +Ġsh uffle +Pro file +Ġper mit +MODE L +d q +Ð ² +Ġ 00 +Ġc red +Ġu pper +Ġexec ution +ĠRes ponse +DX GI +ä ¹ +te l +ĠE VENT +char act +ĠDe vice +Ġsetup tools +M ock +Ġp print +li s +ĠPro ject +ren cy +andid ate +H istory +w all +in i +de ps +{} . +2 16 +u it +Ġre stri +un ic +xt ure +bu y +Ġnum er +clu sters +MESS AGE +" + +u ses +Ġf o +pro cessed +Ġpro gress +pos itions +Ġline ar +E xec +Ġ" ") +Ġn x +ent ropy +riter ion +Ġradi us +dig its +E crit +Ġf alse +fig size +PR ESS +D elete +S urface +g ui +w i +pro blem +Ġ3 10 +gener ic +ĠPro cess +Te mp +g i +Ġst ates +Ġlist s +trans late +cry ption +ĠCom mand +S ample +é Ļ +ib ration +U LL +f fic +00 100 +Ġn args +ver ter +out h +buil t +9 17 +B l +C md +F older +c ity +t l +de vices +(' _ +)) ). +Type s +dep loy +concat enate +M D +V al +Ġ è +10 2 +12 0 +20 11 +CO UNT +201 7 +Ġver tex +Ġtop ic +seri alize +Ġtrace back +T S +e th +S ingle +w arn +y y +di ffer +ä¸ º +A rea +æ Ń +ĠG e +eff ect +c ss +r strip +ê ° +Ġp ol +ĠM on +fic ations +Ġoper ation +Fa iled +S ign +å ½ +re mote +an aly +is o +gra di +cont ents +2 94 +ot ype +Ġx y +ĠR ights +do uble +lan e +++ ++ +h ip +y l +Ġnum s +pos itive +state ment +vo te +MA IN +Ġdest ination +2 14 +c enti +g p +Ġpri vate +a res +__ )) +Ġ% . +ho od +ĠH OLD +æľ ī +1 93 +x is +00 3 +ge ometry +ĠL abel +ĠD ate +Ġedge s +ĠMe ssage +M ulti +p adding +s quare +Ġf ix +ĠR andom +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +ðŁ ĩ +Ġmin imum +P lease +P ASS +V c +W ork +r type +v l +v endor +y lim +ç İ +re cords +en g +um an +con s +con sole +Ch ange +h y +al let +ct sp +ann er +Ġbo ok +transform s +We b +x lim +Ġtemp file +ĠTH IS +E A +T uple +w ave +pro mpt +Ġ{} ) +33 33 +function al +ail s +ĠRes erved +xx xx +subtype Spec +M y +Ġre quires +ĠL ine +ĠG NU +Ġset ting +Ġver ify +neg ative +lishe d +Ecrit ure +2 000 +D ER +G D +d en +Ġe v +ed Dict +op le +Ġstruct ure +ółĢ° ółĢ +L U +N AM +W riter +ra g +Ġ2 7 +ĠO f +ĠE nd +Con tain +LE D +cont in +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +Ġf c +Ġtarget s +Ġframe s +CIS CO +B A +R A +b c +w rapper +lo sses +Ġg ene +Ġ* = +os ition +arch ive +stra p +CD OTA +2 34 +Ġ XXX +Ġc ause +Ġre lease +ĠA nd +10 4 +pre vious +MP L +Ġchange s +V S +W R +i ed +p tr +æ ŀ +en c +di an +Ġ2 56 +Ġcon straint +list s +Ġpro mpt +config s +IC T +Ġiniti alize +s l +Ġe ven +ĠI s +trans lation +Ġwork ing +è¡ Į +STAT US +C P +M apping +m n +o logy +en ario +al i +Ġc p +Ġe qu +con dition +ap er +Ġac tivity +ĠIN CLUDING +ategor ical +------------ -- +ĠPROVID ED +M ain +t an +z on +æ Ŀ +in cip +Ġb r +es h +il la +ĠC ode +Ġme sh +sub process +back ground +Ġcurrent ly +Gener ator +âĸij âĸij +p erson +st im +ĠD et +dic ator +Ġ ~ +str ings +Ġv o +ne ctions +annot ation +At tribute +Ġter min +B F +d one +Ġp ublic +scri pts +sche me +ĠSt ate +Ġepoch s +A v +O W +y es +in a +Ġre main +ad os +Ġ2 8 +ci r +In struction +L INE +Ġf req +Ġe s +co ord +MA IL +Ġcho ices +TRI BUT +æį ® +Ñ ĩ +Ġp ut +Ġ1 70 +ĠM at +ys ql +ph i +Ġob s +{} / +CO DE +Ġchange d +Ġinser t +Journal Lib +C F +R S +j i +are st +Ġcom m +AS K +Ġte am +proto col +Ro le +Ġc amera +ra ft +Ecriture Lib +' " +É Ļ +Ġ entries +an o +et ter +ver tex +cont roller +Test s +ĠDE FAULT +Ġd ump +Ġno ise +Ġstat ic +om ial +22 4 +Ġstart ing +c pp +ci rc +Seri alizer +I t +or ph +Ġc os +Ġp t +am b +EN S +cul ar +Dire ctory +B al +w alk +def ined +], " +01 000000 +ĠB SD +St at +ĠSe quence +Ġinter nal +~~~~~~~~ ~~~~~~~~ +! ') +( ', +9 15 +L V +ĠT oken +Ġle ast +CO MM +ĠDAM AGES +87300 948 +6 025 +R C +j ava +k ind +Ġs n +ĠM ulti +Ġpro xy +org an +aris on +B I +e mp +Ġf lat +ter n +project s +Ad min +m iddleware +ff ff +Ġen able +abi lities +âĢįâ Ļ +) ") +2 18 +er ance +pro bs +Ġen ti +09 6 +cal c +200 6 +host name +Ġchannel s +uplic ate +ransp ort +_ ) +u ck +Ġc ells +li der +sp arse +class method +Ġcal c +Ġtk inter +F ail +P A +Ġ ensure +ĠP IL +lin alg +Ġsc an +ĠWh en +/ < +W H +15 0 +Ġline width +IS ING +environ ment +adj ust +At tr +Ġdimension s +fl ush +Ġ" $ +Ġn a +Ġre moved +16 4 +Pro ducer +200 5 +Ġmatch ing +Ġeval uate +case s +u di +Ġb s +ĠB Y +yst ems +File s +Ġ201 6 +ĠEX PRESS +2 64 +è ¦ +in x +te mplates +res id +our se +Ġdefault s +Po st +Ġexp and +Ġt ab +Ġp kg +ĠI d +ex e +mo ves +Con f +back ends +CRE T +le c +Ġc map +Ġp s +Ġp la +ph er +ĠG L +annot ations +ä» ¶ +lap sed +Scal ar +flo or +P l +å Į +Ġc er +res ses +12 34 +read lines +HE THER +version s +Ġinter pol +äº º +ient ation +Piece Ref +C an +Ġre mote +AT T +Ġan aly +comple x +hour s +M IT +Ġt z +Ġthe ta +il ls +port s +Ġcomple x +Ke ys +T EXT +¡ ółģ +el low +Ġdef inition +cess ary +ise d +Ġ@ @ +A nal +ti cs +ce d +Ġ2 40 +16 3 +ĠCON TRACT +Ġneed s +Ġrot ation +G ER +U rl +\ ' +ç ½ +Ġs lice +ĠD ATA +uti ful +trans action +201 0 +pl us +ĠLI ABLE +E xecution +W ISE +or ary +re pository +Ġ' " +IN PUT +Ġres ources +Ġco ords +ĠData set +F in +F loat +f x +h ub +Ġc dbp +== " +ver tices +Ġpre cision +fix ed +Ġbuil t +Ġbuil der +ĠNo ti +font size +WOR K +ĠSH ALL +C opyright +[ [ +se e +he m +ing er +Ġ: " +Ġan alysis +Ġro spy +E xample +U G +me mbers +Ġs ymbol +Ġre ader +Ġl ate +ĠA s +Set tings +Ġdoc s +Trans action +medi an +Be gin +PAR AM +C re +T ri +ue st +Ġb ig +ĠW HETHER +Ġeval uation +vari ance +Ġpair s +ĠAR ISING +2 06 +d ocker +p as +æ İ +Ġin ner +Re ader +Ġro bot +Name d +ref resh +Ġad just +ä¸ Ń +Ġup load +serv ations +pub lish +A ny +ar c +Ġp p +00 101 +00 0101 +Ġo pts +Ġb asic +Lo op +Cur rent +2 08 +b ri +Ġf requency +pe t +13 7 +av ing +go od +tim er +page s +ĠWARRANT Y +åľ ¨ +d z +ot er +Ġpar ts +quest ions +ak age +Ġgo od +Ġwrit ten +ched uler +Rule Context +Scri pt +Ġimplement ation +n ed +ro zen +Ġp lease +ĠT ORT +con ditions +ist ant +ĠI O +... ') +åı ĸ +2 17 +C N +u k + ł +se nder +Ġe tc +Ġb ranch +11 7 +ĠSt atus +2 32 +a e +m q +y g +Ġm enu +ĠO N +Ġan other +we ek +Ġcomp onents +Ġbot o +FLO AT +aise s +2 97 +D Q +re lative +int s +all en +Ġ4 00 +Ġal ong +cy cle +Ġar ti +S ec +s olution +Ġto o +Ġcomp are +56 7 +ick ness +XXXXXXXX XXXXXXXX +parti tion +: ], += "" +D T +Ġde limiter +Re al +pre ds +mo ving +ele m +Y PE +k m +n r +Ġm is +app ro +sh uffle +Ġk now +LO AD +Constraint s +] ]: +w arnings +Ġd uring +() ; +Ġdef s +ĠD O +cu it +оР² +t b +Ġc la +Ġb n +ĠM ax +Ar g +Ġconst ant +ĠQt Gui +5 01 +b ert +g ri +de t +ĊĊ ĠĠĠĠĠ +ĠS olution +ĠP h +Ġu ses +ĠOTHER WISE +3 115 +A I +c ards +ra se +Ġ[ { +Ġfor ward +Ġma g +19 7 +200 9 +Result s +B ER +D ep +M enu +d og +f amily +p ush +Ġm d +str ategy +Ġg re +Ġde cor +Ġor d +Ġcol s +ant ed +Ġdis k +LO CK +200 1 +3 01 +Y Y +å Ĩ +ë ĭ +log ical +ĠG raph +fa ke +Load Bal +Sc ale +ĠRed istri +$ $ +O EO +pro ps +ys ical +Ġapp end +Ġwor ks +Ġexample s +istr ation +L ast +w atch +', '. +Ġs yn +one y +Ġh ref +`` . +Node s +1 32 +Ġc lip +qu ot +12 4 +St op +200 7 +Ġus age +proto c +b ranch +d n +t ot +w ers +Ġ XX +Ġ" "], +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +Ġv ocab +ax y +Ġper cent +option al +Ġmodi fied +Que ue +a ur +à ¯ +Ġre gex +11 4 +11 8 +-------- -- +ĠP rint +Ġout file +16 5 +Ġle ss +Ext ra +curs ive +ĠGo ogle +g ers +Ġp ur +he el +Ġ2 50 +Ġg rad +Ġde leted +Ġpro tocol +13 3 +we ep +pi pe +Ġli ght +9 06 +ge o +Ġde al +ĠM odule +loc ations +Ġ-- - +exec ution +åĩ º +Ġs ol +Ġst ored +pos al +Ġscal ar +alo ader +look up +, )) +0 32 +b p +h ang +å İ +Ġs y +Ġe m +AT TR +com bin +[: ] +Sp ace +Scri pts +havi or +B ot +G en +S Y +Ġf e +Ġs napshot +Ġin side +Re cord +sh are +plot s +INT ER +Ġtask s +ier arch +Ġannot ations +ĠDes cri +e mb +re es +Ġn s +Ġm u +add le +Ġcont ents +table s +101 0 +æķ° æį® +f mt +de g +Ġre d +arg max +14 7 +Ġiter ation +change d +sin h +rot ation +J ob +S tep +l f +ur ations +co ordinates +Ġw rap +Ġfor ms +qu ote +mat ches +vel y +202 1 +He ader +S ymbol +b order +m en +p in +¬ ółģ +st it +un ity +11 3 +get env +ense mb +process or +initi alizer +и Ð +Ġcoun ts +ame tri +ri o +qu ential +14 6 +ast er +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠ +of s +Ġtrans action +last ic +Ġprocess ing +ĠLoc ation +9 05 +m ultip +ut ation +IM AGE +Ġman ager +æĸ ĩ +("" ) +] ( +c am +c dbp +s ur +us age +back ward +instance s +201 5 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +Ġblob s +r p +Ġ' )) +get cwd +vi e +16 7 +AD DR +PI PE +ĠLe akage +Ġchild ren +Ġs ur +ĠW ith +contain s +ĠSer vice +ĠFL AGS +C luster +d id +h w +s qu +} _{ +set ting +sp aces +ver ts +ire ct +LE TE +Ġext ernal +be gin +Ġgener ator +>> > +TR AIN +æĪ IJ +B ind +Ġb ins +ĠM in +Ġ[" ", +reg istry +66 66 +dis able +Ġtransform s +ĠHOLD ERS +D ig +R M +f lip +Ġi r +Ġd ays +Ġcon dition +qu ic +read line +ĠV AL +By tes +ĠAuth or +8 00 +A K +u ator +Ġ Ñģ +Ġ layout +al ity +ss h +Ġ1 10 +set Level +Ġen ergy +UT C +ĠPy Qt +C AR +H ost +S chema +Ġf l +ĠF amily +em on +Ġver tices +cl us +ĠPar ameter +hic le +F eature +P art +V M +m icro +s yn +â ŀ +Ġcon sole +ĠM O +format ter +vent ory +new s +:: :: +incip al +W rapper +z o +ed u +is dir +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +to day +13 6 +19 8 +Ġso up +Se quence +UR CE +ãģ ® +Gener ated +oper ator +cour se +H W +S tack +b re +Ġf id +Ġ( % +(' < +(" [ +Ġg round +Ġg radient +Ġse nsor +scri be +ĠIn valid +fa cts +Ġag g +Le ft +g m +i os +l ite +s b +à º +ĠĠĠĠ ĊĠĠĠ +se par +Ġ{ : +ac cept +ph one +comp are +comp any +200 4 +qual ity +DI RECT +sv g +App lication +Ġpack ets +Ġaut omatic +m itive +in itions +ri s +ind ent +find all +Ġele m +ĠWe b +can vas +speci fic +A E +C ache +E val +h d +ur a +Ġin spect +set default +") ), +Ġth ree +10 6 +ID TH +Ġarg v +Test Case +vo ice +Ġchar ge +äº Ĩ +NE CTION +issue s +M iddleware +en ium +ro i +(' [ +ĠF ind +config ure +base d +([ ]) +200 2 +ug gest +Ġpri or +../ ../ +RES ULT +f b +à ¼ +Ġa udio +Ġ1 024 +(" < +sc i +Ġun til +13 4 +Fa ctor +tific ate +h ar +Ø ± +re main +(" . +ĠS imple +eri um +Value Error +extension s +A b +h n +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +def ine +ĠC ur +ĠP ri +if f +En coder +ä¸ Ĭ +abs olute +EM ENT +ĠAuth ors +2 07 +2 03 +l b +con tract +ĠS ave +Ġres id +IT S +we ets +dest ination +, ( +N ET +ç ī +Ġ4 5 +In d +AC HE +Ex ist +200 3 +200 8 +uni code +Ġblock s +jnxMbgSgw PP +road cast +2 95 +D P +Ġ= ================================================================ +me t +Ġf d +11 9 +def inition +ĠF il +Ġth ose +Ġ3 5 +13 5 +En v +Ġstri de +ĠOrder edDict +Ġre duce +Ġb ridge +um en +as y +=' ', +form ance +key word +Ġpro vider +mo id +Ġsh ift +Pro p +iv ers +vis ible +ĠWIT H +jnxMbgSgw If +ĠPer mission +2 99 +f ollow +w Vc +st anti +ro u +Ġc ast +11 6 +th resh +Ġ\ " +(). __ +Col lection +So up +3 15 +V ideo +l V +st udent +Ġm ac +Ġse ss +Ġma de +per m +ref lection +re tri +he st +lo se +Ġre c +ĠC an +Ġr atio +ĠF I +Ġ""" """, +SE CRET +Ġbo olean +man y +G RO +H A +e ver +s urface +Ù ħ +ç ¬ +11 100 +Ġw rong +Ġ{ :. +om erium +ĠM ock +In iti +class ification +Co uld +go al +pri me +blob s +ĠRelation ship +9 04 +L P +L AB +al ert +Ġc apt +Ġre ct +ver ify +Ġh istory +Ġme asure +St orage +cor es +Ġtemp erature +Ġcase s +9 84 +W arning +g res +n u +Ġ" [ +Ġ1 40 +ma chine +ĠT Type +age s +Ġde code +sa ved +RE D +Ġar rays +Un i +temp t +Ġlook up +! = +D K +c um +à ¤ +ta u +ĠI tem +pro j +sh ould +17 6 +85 7 +Par ameters +ors ion +C AP +D IM +O C +lo pe +il li +Ġk ind +е н +Ġpredict ed += {} +L im +x A +Ġ č +he at +sel l +li o +co very +Re ference +AR G +Ġro ute +ag in +cal culate +mark et +.... .... +decor ators +B Y +U Int +at tach +ac le +93 4 +19 5 +lin ux +pri mary +gener al +Ġrepresent ation +term ine +G PU +P K +f lu +estim ator +Off set +//// //// +Ġhel per +ĠNet work +/ ", +3 06 +M ask +P ower +c ube +e g +g c +g ence +Ġ ._ +or ies +ce il +0000 0100 +ĠD oc +AT ED +Ġpre pare +Ġline style +fa iled +ud y +Ġpos itions +Ġdete ct +PASS WORD +g rate +i fied +r st +ä ¼ +ch an +th rift +com ments +ĠW indow +ress or +fer red +vis it +host s +let ter +ĠTe mplate +ĠSimType Int +ĠOn ly +REQU EST +2 25 +b t +k o +me ans +ti les +Ġb a +Ġg ot +ac tivation +Ġv s +ject ory +Un known +pk l +Ġinst alled +åħ ¥ +ĠAt tribute +3 05 +F la +^ { +u ous +z ed +as set +OR IENT +ĠCon vert +011 0 +Config uration +utiful Soup +F low +R ender +d w +r aries +à ª +Ġf s +ser ve +tri p +St yle +ĠGener ate +Valid ation +2 12 +AR CH +ĠTest Case +depend encies +Ġcons ider +8 96 +M esh +n av +y e +Ù Ħ +ĠP erson +Ġco ver +eri als +update d +thread s +OUT PUT +ĠFound ation +Ġ 99 +Ġin place +co ef +Ġ1 0000 +01 6 +tr uth +Ġy et +ĠB e +work flow +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +ĠData Frame +L R +Ġp ot +Ġf h +ak s +run ner +Trans lation +Pass word +F S +Ġs quare +') ] +": {' +ĠB ea +com b +Ġkey words +ENT RY +cor r +fra c +Ġvis u +sd k +cut s +Contain er +2 96 +P rint +Ġ ut +Ġb ad +ĠT ask +us ing +Ġh yper +Ġma ss +bo olean +eval uate +Ġsw itch +------------ - +NAM ES +9 08 +b len +c map +£ ółģ +Ġb and +ex cel +]) ] +AN S +ĠRe move +34 7 +spe cial +cal led +pri or +"> < +01111 1 +Ġge o +SER VER +basic Config +4 56 +S UB +d ropout +p ot +q s +Ġd ue +-------- --- +coun try +Ġpre trained +with out +ref s +role s +Ġcho ice +87300948 126 +Named Values +M Y +h yper +00 1111 +Ġw ell +ĠT able +par allel +ex pect +=" ", +ĠB l +ĠE ng +Ġon ce +Ġuse ful +ðŁı´ółģ ³ółģ +STR ING +âĶĮâĶĮ âĶĮâĶĮ +: { +L T +N T +c ategories +st e +fi es +Ġimport s +32 7 +Ġwh ite +{} _ +Ġadd r +Ġwork er +Ġab c +f ront +(' .') +Ġto ols +ID ENT +map s +Ġar ticle +Inter val +C ap +E P +E mail +T wo +U K +b on +l ar +é ģ +Ġn one +Ġm id +Ġb ias +pro te +15 7 +011 1 +ĠComp ute +Line ar +å® ļ +Ġrule s +depend ent +ORIENT ATION +h it +p layers +p anel +t orsion +an ks +li cies +di alog +as sets +") [ +Ġse p +34 5 +De te +extend able +Constraints Union +R est +U se +an cy +Ġpro c +SE C +cal endar +Ġiter ations +]]) ] +SER V +cei ver +C or +C all +W IDTH +s lug +x FF +ti ght +Ġn d +ma s +') ), +Ġg it +ne ighbor +Value Constraint +Ġgener al +vari ant +GEN E +3 08 +D C +b etween +Ġc rop +Ġre ason +Ġe t +ĠS P +ĠW rite +19 6 +Ġkey word +cord ing +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +aw ay +ial og +schema s +Ġstri p +3 04 +s up +t cp +st andard +ch dir +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +date s +mon itor +Ġar ound +xy z +âŀ ĸ +I mport +P r +X Y +x ticks +10 9 +max imum +14 4 +14 8 +)* ( +sm all +Ġow n +DEF INE +W IT +] ', +Ġ lock +Ġn u +Ġd p +co in +ĠS V +hes is +R ot +p ur +ri ces +Ġb ul +method s +ä¸ ĭ +Dis play +Pri ce +gre es +Ġhash lib +dash board +à µ +st o +Ġt akes +Ġa ir +Ġin line +13 8 +temp erature +Ġsu ffix +ĠTime stamp +[ _ +f w +æ Į +Ġre cords +ĠA CTION +Ġcon tact +IN ST +text s +trans fer +Tra p +Ag ent +>, < +G lobal +b enchmark +de m +de mo +ro ject +Ġp k +ent e +ad v +(" { +par sers +ĠI nt +ff t +ctor ies +18 6 +St andard +Ġjson ify +medi ate +Widget s +Ġsel l +4 24 +n ick +ĠA UTH +Ġme t +ant um +Sg t +iter ations +sched uler +' }) +3 97 +U ID +ç ® +st ick +Ġs imp +(" {} +Ġ3 6 +oun ts +ĠO p +De bug +Ġfilter ed +. ". +B ody +E Y +R et +m x +num bers +Ch ild +Ġlin ks +filter ed +Ġve locity +5 37 +I GN +h alf +on y +Ġs ym +and atory +ĠS um +Ġcon struct +=' ') +act ual +Ġ201 5 +Ġdec imal +oment um +> ' +T itle +c lock +u do +Ġre fer +tra de +Ġid entity +е ÑĢ +allow ed +2 86 +F i +Ġ #### +se ns +Ġre lation +co eff +ĠT EST +cur ve +19 4 +Ġapp lied +MS G +B ATCH +W A +d ensity +it ing +it ation +Con nect +17 7 +Ġdis cip +level s +oper ation +distri bution +Ġlate st +yg us +F Q +R ight +S to +Ġc c +Ġ" ' +Ġ" * +ab y +Ġtorch vision +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +åĪ ° +Fixed Surface +ensemb le +ĠBea utifulSoup +Ġdiscip line +i fiers +p od +de gree +Ġd en +Ġd ash +ph ab +sa mpling +Ġ/ = +Sg acl +ble ms +Ġparameter Number +Ġparameter Category +åĪ Ĩ +WS MAN +Hel per +Bu ffer +ygus Parser +E MAIL +L IN +in c +se lector +ce ive +un pack +time delta +ĠN orm +DE X +Ġtrain ed +Window s +Ġappro x +ĠDescri ption +( ", +f tp +¢ ółģ +æ ³ +ro ls +Ġs v +ĠC ustom +Ġde termine +0000 1111 +ĠM et +Ġcont roller +AP P +Ġ-- > +Ch annel +Cont roller +dt uple +Op tim +D iv +e cho +n z +Ġ question +Ġsh are +ðŁı´ółģ Ńółģ +Te mplate +V EL +g w +st ation +Ġt weet +Ġ' * +Ġa z +Ġ( { +ma ker +)) ] +ĠS pe +ig en +ĠE d +AN CE +sent ences +Ġfa ke +gr ation +Sh ape +è¡ ¨ +OPT IONS +- { +C ells +h r +v or +é Ĺ +Ġ é +pe dia +Ġl st +Ġcon tribut +ine ss +ĠD ynamic +sa y +Ġset s +rep ly +Ġcheck s +DAT AB +So ftware +9 64 +Ġ Ċĉĉ +Ġ ---------------- +ĥ ½ +Ġa m +Ġn or +Ġ[ ]) +ĊĊ ĊĠ +us ic +able s +Ġse cret +15 6 +ĠData Loader +ðŁij ¨ðŁı +ðŁij ©ðŁı +alan cer +p db +Ġd ummy +__ .__ +ĉĉ ĉ +sp ark +ĠP ost +be am +Ġvalid ator +sg Parser +Ġlocal ctx +################################################################ ################ +Met adata +âķ IJ +ĠNoti fication +4 03 += ', +A pi +P ES +V K +b undle +d ark +n l +Ġf ri +co d +ig hest +15 5 +ĠSt d +angle s +Ñģ ÑĤ +Ġsql ite +Uti ls +2 87 +M eta +P ON +re peat +00 7 +ss o +Ġan n +18 7 +ĠÐ ² +Ġsim ulation +Ġindic ator +READ ME +Ġsq rt +t weet +v in +di gest +Ġde termin +Re move +ĠB lock +ry pt +Ġz one +std in +L in +O FF +U sage +h ref +Ġ ĉ +Ġt xt +Ġd id +(' ') +ĠM ark +cor pus +Ex pression +Ġpi pe +9 07 +H I +O O +S AM +k i +se ct +ut ron +Ġne cessary +Ġdistri bute +ey e +Ġinstance s +Ġph ase +M R +[ ] +li ces +Ġ3 1 +ĠB uild +16 9 +100 1111 +17 4 +011 10000 +Ġ"/ " +ãĢ ģ +- > +H D +é Ŀ +Ġf lux +ce ed +li ck +ad or +Ġ1 05 +ĠI F +Ġst ock +Ġex act +02 3 +Ġma chine +pre processing +ass ignment +Ġne ighbor +Ġrel ated +ĠQu ery +Ġdes ired +esc ape +C Y +a vel +p th +Ġb g +Ġ1 60 +ĠA nal +ĠP lease +18 5 +Single ValueConstraint +cir cle +S elect +b asis +Ġo cc +Ġe c +ul ated +par ametri +im gs +Ġsh ared +Res p +Ac lV +cl f +Ġ'/ ' +оР» +andid ates +Ġrestri ction +centi le +P oly +h old +Ġ Ø +st s +Ġ1 30 +Ġg uess +Ġsub mission +Se gment +Ġtable s +err Handler +10011 1011 +ĠDefault s +uplic ates +Ġlet ter +P lugin +S cre +_ ' +Ġ í +de coder +ce ler +() } +con cept +Ac tive +ĠMib Scalar +Ġinv ok +SimType Char +A uto +F UN +W or +n lp +Û Į +å ¹ +Ġ Ċĉ +re name +02 7 +Ġac cording +Buil d +Ġreg ular +Message Type +Com mon +Ġvis itor +Ġfin ished +Ġgr anted +A li +Q P +b old +å · +Ġa void +Ġst ill +run time +201 6 +( """ +. ': +2 84 +3 07 +C ho +D ense +f fi +Ġf uture +Ġb lack +vi ation +Ġload er +session s +eval uation +2 33 +4 27 +T AG +à ¥ +re vision +ro ved +ist o +Ġx range +pre trained +37 5 +sign als +âĢ Ļ +Ġsign ature +ĠjnxMbgSgw GtpV +ĠEn tity +Ġcir cuit +ĠjnxMbgSgwPP GtpV +############################################################################ ### +_ " +i li +Ġ â +in dicator +re et +Ġ" : +he alth +Ġa sc +ue s +), ( +Ġr gb +res olve +Ġname d +tiv ate +tick labels +ãĤ Ĵ +sin ce +Ġdete cted +PRE FIX +a ção +k y +r ing +ver sed +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +par k +par ty +ub i +Ġor gan +Ġpro cessed +16 6 +Pro vider +Ġformat ter +mask s +To ol +ĠCal culate +Process ing +rup t +2 36 +a is +e ach +µ ółģ +re cv +ĠS U +In st +ĠCon v +DE L +wh en +01111 00 +ĠRes ource +Ġstri des +Ġexception s +permission s +abstract method +ç½ ® ++ ', +4 06 +C B +G C +æ Ľ +Ġp in +Ġf bx +Ġre pository +Ġm andatory +ve y +Ġstr ategy +ass istant +sub mission +Ġsc ra +UN K +Ġdep loy +ighb our +8 08 +D ialog +P air +p ic +le tion +Ġb all +ĠS c +qu eries +min or +14 5 +19 0 +Ġclass ification +En tity +FI EL +ĠStr uct +!! !! +2 92 +O pt +T k +è ¾ +ct ype +um b +ch i +sc ra +ER Y +St ore +ag ic +work space +inter pol +а ÑĤ +ĠMib Identifier +soft max +Ġarch ive +NotFound Error +ĠjnxMbgSgwIf GtpV +' % +O F +U til +b ridge +n f +x l +Ġt ak +Ġf lo +is ik +Ġfile path +lu sters +ec ast +Ġpre ds +ółĢ ² +Lay out +Train ing +note book +Top ic +semb ly +ierarch y +isik let +b rain +Ġ ------------------------------------------------ +re wards +ver gence +load ing +Ġtype Of +([ - +85 4 +Ex pr +yp ot +ĠCON TRIBUT +ĠAr ray +LOG GER +Ġmulti processing +2 09 +pe ar +ri st +Ġ1 01 +ile s +sc ene +im read +valid ator +sub net +ĠSe arch +Ġgo al +Ġstate ment +Oper ation +FIL ES +>. < +âŀĸ âŀĸ +) }, +L i +L en +U RI +a wait +b rowser +Ð ´ +qu it +ĠN ON +comp liance +man ifest +mark s +He ad +parti al +# ---------------------------------------------------------------- +A WS +C ard +D rop +p ay +Ġ âĢ +er ing +Ġc ycle +Ġm ultip +ĠF etch +ord ers +Ġsh all +PE CI +ĠJ o +1011 1011 +Ġge ometry +cogn ition +Ġautomatic ally +? ", +S K +U ES +u z +æ Ģ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +-------- - +Ġpro to +ĠV i +Ġk nown +lit ude +sub set +Ġrun s +En abled +Ġproduct s +gradi ent +D raw +E mbed +S ymbols +® ółģ +è ĩ +Ġ' ': +01 7 +am ing +ĠL ay +Ġde coder +ĠM ain +ls o +ĠE num +Ġco ordinate +class ifier +14 0 +Ġhelp ers +Id entity +length s +gener ated +rand n +Option al +2 88 +o auth +x es +Ġ ĊĠĠĠĠĠ +qu ad +app er +Ġse lection +12 1 +ðŁ Ĵ +Ġdi ag +Co mple +mark er +Ġup grade +=\ " +ĠExt ra +3 34 +M BL +` ", +l or +m ig +p andas +s ock +an ded +Ġs lot +fi cial +ON T +ob o +Ġop s +ĠH el +Mo di +Protocol MessageType +cred entials +Register Message +charact er +Generated ProtocolMessageType +' m +H ub +_ [ +f h +z ation +Ð ¿ +å ± +Ġt ol +me try +Ġ' $ +Ġ2 9 +ĠO ther +min imum ++' / +UP DATE +$ ", +4 22 +C ounter +C ACHE +G ame +e very +u ro +æ ¯ +se udo +Ġs ync +Ġd ic +Ġw ave +ĠA b +'] = +ĠP i +Ġ3 4 +"] )) +ip ment +64 7 +cat alog +vo ke +PI O +Ġwork flow +tick er +PRO TO +b one +r v +in her +00 8 +sp read +01 3 +time zone +os m +reg ions +fra ction +P layer +V ec +s olver +ç § +é ¡ +Ġe q +ĠS ER +ig ure +ĠF irst +32 5 +RE F +top ics +supp orted +Peer Stats +F lip +M I +O D +b tn +e ch +re try +Ġ' '. +Ġa ug +Ġin her +data frame +Ġen abled +14 2 +cri pt +DO MAIN +Ġtoken izer +rel ated +FR ING +M ed +R ect +² ółģ +re nd +Ġre lay +__ ), +ĠB atch +ci pi +Ġdis cla +Ġspeci al +User Msg +hist ogram +Hel lo +ĠString IO +First FixedSurface +LAB EL +A verage +F Y +L B +å ij +me asure +Ġs ources +ue l +ĠC HE +up y +lif e +mat plotlib +Ġread ing +ĠOption s +tensor flow +Point s +õ es +3 94 +s z +t v +Ġde vices +12 2 +process ors +PT ION +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Un able +su ite +Ġconvert ed +ĠTh read +ìĿ ´ +ĠPlot Scripts +Pl us +FRING EMENT +d os +r ust +v c +Ġ ent +po inter +os ite +ap on +ho use +we bs +17 8 +Data base +Ġtrans lation +Ġload ing +Ġone ofs +Ġseri al +Ġbox es +Ġbl ue +Ġbound ary +æ Ķ +it ers +Ġb i +is m +Ġcon fidence +po le +Ġ* , +com ing +EN V +ip s +ax s +local ctx +Ġupdate s +su do +rou ped +4 36 +9 87 +n or +à ł +Ġd ensity +and o +ĠC LI +res net +pro d +ms gs +ir th +ĠG iven +mon go +Ġad dition +unk nown +connect ed +embed dings +named Values +pie ce +f fici +i inter +v d +å ¸ +res olution +Ġv el +17 2 +LE VEL +ĠUn i +ĠCON NECTION +Ġ'. / +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +sim ulation +Mem ber +ĠIter able +Ġdiscla imer +N R +i fic +m argin +Ù Ī +ti p +Ġf mt +ri ch +)) )) +ĠT YPE +Ġy y +amp a +Ġconnect ed +Ġcm ds +gal axy +æĹ ¶ +ĠCor p +9 03 +V IS +{ : +Ġ" ": +def s +ĠT R +ab br +Ġex clude +mo use +lt k +ST ATE +stri de +Ġad j +Ġdim s +vector s +sql ite +Pe ak +Binary Protocol +allen ge +parametri ze +' d +Ġt i +me th +Ġs izes +Ġm ight +Ġh alf +tra st +nn ot +DO WN +ĠÐ ½ +On ly +Ġsel enium +Const ant +asc time +PON SE +- ', +3 88 +A U +N G +Ġ er +Ġ' [ +ur on +ad apt +int ain +ch rom +'] ): +0000 01 +=" / +ĠB ack +reg ular +CH AN +âĸĪâĸĪ âĸĪâĸĪ +å¤ § +87300948126 07 +ĠCONTRIBUT ORS +2 37 +m ore +er tion +de tach +Ġp ending +Ġf ront +Ġb its +Ġ7 5 +######## ## +Ġ4 4 +Me an +Ġdirect ly +D river +N ext +g uess +n dim +æ ĭ +Ġ lab +at ype +ar ly +la m +Ġb alance +Ġ3 3 +ir ror +ĠV d +18 4 +Ġtrain er +ren gth +ĊĊĊĊ ĊĊĊĊ +H B +L ines +V EN +W rite +y a +Ġt b +Ġp df +Ġs ns +sp acing +IN CLUDING +mat mul +Ġcomp at +Par am +spe cies +TH RES +exec utable +copy right +change s +Qt Gui +bound ary +Ġstat istics +V o +r nn +ti f +Ġa ctor +ot s +ol ved +ĠS ign +Ġg ive +vi rtual +Ġde epcopy +xa xis +Ġle x +WAR NING +ĠDec imal +N V +Q K +U sing +d jang +x path +Ġ ur +in ja +or a +re call +Ġs s +Ġre try +un ion +() ]) +ul se +ic a +ĠN ULL +gra ms +wh ich +Ġhere by +Sp lit +Ġcre ating +ĠStd Method += (' +r x +å ī +Ġm ar +Ġe lect +fi ler +Ġ1 09 +id ity +Ġh it +Ġclo ud +noti fication +noti fy +k t +r h +r se +Ġb ra +ist ent +ac counts +ci a +ĠR out +ĠG ame +18 8 +pi x +disp atch +ĠTh ere +Ġdete ction +Ġrepresent ing +010 11111111 +mac ro +4 26 +z illa +at tack +an te +Ġc u +Ġs olver +Ġre levant +un til +ĠF ree +ĠO ne +tri gger +Ġen coder +Ch ain +iter items +cho ol +AA AA +short cuts +Ġprob ability +RU LE +Ġep isode +2 93 +3 03 +T un +h p +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ri gin +um bn +Ġname dtuple +32 6 +27 7 +Ġsub set +Ġclass ifier +VAL UE +åŃ Ĺ +Ġagg reg +A lt +] ))) +b oth +ł ģ +on ical +Ġf type +Ġs che +Ġb py +set Label +Ġr c +ĠE ach +Ġ5 12 +update s +201 3 +Ġow ner +Ġpor tions +ĠIniti alize +P D +T X +h df +Ġ 96 +Ġe ffect +ĠS ample +ĠL ib +čĊ ĠĠĠĠĠ +IN FRINGEMENT +Ġres olution +ax on +eat ures +inter p +ĠQ ue +ĠSt andard +Ġplot s +ĠRes ult +Ċĉĉĉĉĉĉ ĉ +Ġperson s +avel ength +H R +S ite +s fp +z h +ar ticle +al most +11 01 +ch er +ĠS ource +10 111111 +Ġme mbers +pre process +Ġ4 2 +url patterns +Con vert +ðŁı » +Ġadd ing +Ac cept +level name +Ġlimit ation +ca pt +ĠÐ º +limit s +ĠCh ange +dest roy +åĢ ¼ ++ / +. % +3 85 +9 00 +B S +y ellow +on al +se ctions +Ġc a +Ġc y +Ġf old +ad verb +and roid +key patch +ap s +Ġlog its +ag ents +Ġwh om +IC ATION +descri be +ðŁı ½ +ðŁı ¿ +Se e +CL IENT +place ment +Ġallow s +Ġobtain ing +Red irect +^^ ^^ +8 95 +on ce +al gorithm +Ġc andidate +Ġf our +Ġin di +ch ron +01 4 +log o +Ġ5 5 +au x +place holder +tmp dir +anti c +UD A +seg ments +å° ı +kp nt +F ont +S imple +b right +d ns +s mooth +Ġre pe +li hood +Ġ1 33 +as ing +Ġl arge +ĠF rame +qu is +Ġpar allel +Ġ4 8 +loc ale +Ġtime zone +ump tion +13 1 +Ġdi v +Ġclass ifiers +ðŁı ¼ +ðŁı ¾ +scal ed +ĊĊĉĉ ĉ +ĠFile s +CRE ATE +c nn +k k +m ysql +o lo +q V +à ± +er min +(" # +om in +02 6 +ache d +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠDef ine +("" ). +Mem ory +c g +d rift +s at +t m +w n +w ater +li g +Ġm l +Ġw i +der iv +ĠW ork +Ġid entifier +IB LE +ãĤ ĭ +mut ation +: ') +re dis +re levant +Ġc nt +Ġc wd +iter al +iter ator +Ġscal ed +Ġagain st +čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +GRO UP +) +' +a N +h its +Ġt en +Ġp ush +fi ce +Ġb b +11 2 +int o +UT E +pl ane +serv ers +COL UM +('/ ') +gorith ms +dete ct +lec ule +3 95 +9 14 +: / +C red +C ustom +D Y +E mpty +K ind +b ank +i co +n ative +Ġt imer +00 04 +op roject +ĠS tep +ĠF ace +Ġpro per +col lect +cor re +TH ON +exist ing +differ ence +Ġconstraint s +ĠRedistri butions +M IS +M EM +m al +Ġa ge +Ġs age +ur ther +Ġin strument +Ġd y +ĠD IS +ir l +ĠR aises +17 3 +eri or +Ġapp s +Ġrequest ed +Ġ201 4 +а н +Ġtuple s +non zero +Load ing +åŃ IJ +Ġprovide s +CDOTA UserMsg +C annot +G ate +H H +I FI +P ack +R UN +i j +§ ółģ +Ð ¼ +Ġ= > +Ġt ransp +Ġp c +la re +ĠC A +ĠB ar +AR D +ĠCon struct +Ġrun time +Ġmin utes +Ġcho ose +Ġpixel s +Ġsepar ate +ĠConst ant +djang oproject +3 92 +i mpl +æ µ +ĠC H +Ġse nder +ĠH TML +AS H +cre te +ðŁı´ółģ ´ółģ +Ġab stract +F D +S core +e b +w m +se quences +Ġp id +ĠC LA +Ġh old +Ġpy plot +{} ) +Ġoper ations +Qt Core +dete ction +3 96 +4 57 +M ac +f requency +h pp +s olve +at ar +Ġin dividual +Ġd r +11 101 +pro jection +ĠD elete +Re lease +Ġme dia +cur rency +write Field +iv o +Ġbo ot +HO ME +Ġsent ences +ĠDE AL +Ġembed ding +ĠSer ver +Ġperform ance +crypt ed +Ġleg end +clus ive +8 97 +A mount +H z +J son +M N +] ') +l arge +y axis +³ ółģ¿ +Ł ¥ +Ġs mooth +urn ished +Ġ% % +bo ost +uti lities +ĠH ow +Ġstart s +sign ature +aw n +gr pc +ĠAttribute Error +ĠCLA IM +3 37 +3 87 +h am +Ù Ĩ +in p +Ġt ar +al es +la unch +list en +ĠV er +ry pto +au c +obj ective +Se q +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +char s +Ġfla sh +:` ~ +еР¼ +agg reg +è¦ ģ +4 37 +? ', +D one +V ol +Z Z +h um +h dr +s ure +v r +Ð · +re ason +un ds +Ġb etter +id ent +99 6 +Ġde t +Ġpro duce +ĠR O +Ġ5 1 +Ġch unks +ne ighbors +Ġsub mit +ĊĠĠĠĠ ĊĠĠĠĠĠĠĠ +DE LETE +Ġsome thing +Norm al +ĠValid ation +DATAB ASE +ĠNON INFRINGEMENT +F OR +L F +b at +en a +me ter +Ġin f +Ġ1 27 +th at +Ġv ars +IN DEX +12 9 +). __ +Ġsub license +Ġmo ving +SER T +vol tage +Ġannot ation +Ver tex +Sum mary +require ments +å¯ ¹ +ĠDEAL INGS +! " += ", +I tems +M dq +U V +n m +Ġ 84 +ro ve +id enti +') ( +ĠA uto +Re port +Ġco effici +ĠH O +vis u +ç ões +eps ilon +constraint s +":[ {" +P open +h ow +Ġs urface +Ġo k +Ġd Mdq +Ġw atch +ch unks +(' # +th ickness +ĠO ver +15 8 +Ġat t +Pro duct +Ġsub stanti +rep lic +Ġpage s +ĠTh at +Ġref resh +real path +velop ers +Ġindic ates +ĠLoc al +Dist ance +prec ated +ĠFil ter +] { +c art +n el +å ¦ +Ġc ri +Ġc ube +Ġc ourse +Ġe scape +ĊĊ ĊĊĊ +Ġg reen +Ġas set +Ġv a +ob servation +min utes +Ġtra de +[: :- +Ġcheck out +Ġ** * +Ġtrans fer +Add r +Reg ression +ãĥ ¼ +PL AY +Ġmer ged +åIJ į +Ġsuccess fully +Ġregister ed +Ġvari ant +" ' +" }) +B ranch +E r +P W +S W +V lan +j ar +è § +ì Ħ +Ġt ot +ut down +Ġg u +'] } +Ġor g +ob ile +Ġhe x +feat s +TY PES +Th ere +CC ESS +rot ate +F lag +H igh +c x +o tes +re direct +"" ") +(' ../ +01 001 +Ġh app +Ġ3 7 +ĠM em +IT ION +Type Error +ðŁı´ółģ ¬ółģ +ca de +Ġdif ference +Sub threshold +Ġcred entials +Ġremain ing +phab et +( ': +M a +c ategorical +f m +¥ ółģ +à ¸ +å Ĵ +Ġ 88 +al ty +it ect +co ok +Ġw arning +ch a +el y +get attr +Ġg ate +ĠP ort +[" __ +py torch +Ġlog s +sa mpler +RE EN +split s +back up +23 5 +ĠMe asure +callback s +Ġcl f +( % +3 86 +9 88 +< = +L ong +l g +Ñ ħ +Ġ" )) +Ġre cipe +Ġw s +sp atial +pro g +ĠM icro +Ġ6 5 +Ġexp r +dis abled +perim ents +0000000000000000 0000000 +ĠConfig uration +feed back +pixel s +æĹ ¥ +LOC AL +4 25 +D uration +H C +M K +S uccess +W ord +k ill +Ġ () +Ġ' @ +co verage +)) )). +con fidence +'] ], +Ġde lay +13 0 +ĠThe se +ĊĠĠĠĠ ĊĠĠĠĠ +ele d +fil led +Ġlevel s +Ġact ually +distri bute +bul k +ĠDoc ument +Ġsubstanti al +4 55 +d ynamic +f its +y b +al ignment +ti d +Ġp db +Ġp layers +Ġe th +la zy +ion e +fi sh +xt ures +ĠF eature +sc yl +Re quired +Re pository +ext ent +oc c +Con s +man ual +ĠSe ssion +cent ral +Set ting +qui val +fra gment +fail ure +quanti ty +Ġhour s +scyl la +" ', +E l +S end +b id +d ri +s weep +Ġt p +an chor +Ġs olve +Ġb ounds +Ġr v +ĠM ap +Ġen code +93 6 +PP ORT +Image s +part ment +extra ctor +ĠCol or +Ġnote book +9 55 +P G +R F +b atches +d j +d as +k l +t ty +è ½ +re cipe +de epcopy +ti tem +Ġs parse +** * +Ġex pl +Ġma il +ho le +ne arest +group by +ĠData base +pack et +fetch all +named number +Ġfra g +second ary +Ġassign ed +dh cp +' > +/ * +C la +t un +Ġc riterion +pe er +ri cs +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +vi a +Ġde gree +Ġpar sing +27 6 +IL D +Ġformat ted +Ġpri mary +cv t +0000000000000000 000000 +"} ]," +Mon itor +Del ta +ĠArgument s +ëĭ ¤ +$ { +E VENT +S B +w ar +in crement +ul ary +ĠS ci +ĠS ET +ĠC ar +age d +form ula +ap is +Ġal i +14 3 +man agement +ĠSt orage +ĠNOT E +FL AG +Ġvector s +ä¿ ¡ +Ġcombin ed +ĠBl ue +umbn ail +) == +? ? +C allback +H TML +S u +c df +s ound +en cryption +ot a +Ġ2 000 +Ġx s +ĠG PU +13 9 +34 8 +09 7 +Ar r +Ġqu bits +Ġloc ations +CONT RO +3 32 +C at +D ay +M ON +S m +b z +b ro +p time +ar row +ra ps +Ġb ro +Ġh ard +ĠD istri +pre pare +ĠN ow +AR GET +06 5 +Ġsh a +Ġ201 3 +dic ate +Ġcall s +PRO JECT +Ġtri gger +gg le +Sa mpler +ACC ESS +FIEL D +# %% +C OR +H Y +T ransport +Ġf g +Ġb rowser +iz ers +ĠL in +Con n +34 6 +Ġcomp iler +olu tions +exec utor +Ġfilename s +ba seline +Ġph i +cry pto +He ight +Ġshe et +Ġcoun try +ĠDis play +éĿ ¢ +5 000 +E rr +s uc +à ¶ +Ġ ; +Ġa i +ur b +ra vel +Ġimport lib +ot ing +(' {} +ĠT ag +il ing +(" ./ +Ġst ar +ĠO per +25 0 +93 7 +Ġwe ek +ĠSt ore +Ġcal endar +Ġversion s +window s +rel ations +âĸĪâĸĪ âķ +Ġpop ulation +Rout e +/ + +9 18 +i pping +p dist +Ŀ ¤ +Ġp lane +pe g +ch r +and s +Ġg s +ĠG rid +tri es +lat itude +ET H +Ġcode s +dat aloader +æĸ ¹ +è¿ Ļ +ä¸Ģ 个 +Anal ysis +åĴ Į +E stim +F o +W T +s il +z M +Ġc b +Ġc am +import s +ĠC loud +ĠA lso +99 7 +ST M +93 5 +94 7 +Ġdo uble +pri ate +Ġver y +Ġnorm alized +track ed +Ro ot +Range Constraint +/ ') +F ore +Q os +] ; +b m +Ġ ----- +re view +Ġt ele +Ġ5 4 +av es +Des c +idx s +gn itude +ĠPar se +Sh ow +ä» ¥ +ĠAUTH ORS +P ACE +W ait +g ap +i ou +l n +æ ¬ +ç Ĥ +Ġi con +Ġa ws +ad ing +ext ended +mo us +no tes +Ġdate s +Me asurement +UR N +pri ority +NO DE +âĢįâ Ŀ¤ +mis c +Ġdepend encies +âĢįâĿ¤ ï¸ı +9 86 +B IN +R T +v et +Å Ł +le y +co okie +el f +ĠT ree +as ures +ve st +Ġcon sumer +Ċĉ ĠĠĠ +Ġsc ene +rep are +no st +Ġad v +ĠIN T +Ġover ride +Ġ... , +Ġform ula +TE MPL +Ġthread s +mag ic +distri buted +Ġeps ilon +Ġoc cur +ĠCorp oration +, :] +9 32 +B GR +s un +u f +Ġ ^ +ti t +ti ment +Ġre tain +Ġ1 92 +ck pt +)) [ +ĠT op +tr l +ang er +64 4 +LE X +spe cs +Ġsp atial +ĠJ son +mt ree +D b +L ock +L IB +N EL +V A +m f +m se +q q +ë ¡ +in h +Ġf lex +__ () +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +ĠP ass +line width +lif y +Ġ\ \ +Ġ'- ', +AC L +track er +dimension s +ĠDi ctionary +Ġbr ush +Scre en +agic Mock +M er +W i +Y E +Ġ 85 +Ġc um +ĊĊ ĠĠ +str ptime +tr on +out file +ly ph +Ġso ft +run c +HE IGHT +Ġover write +ĠCo mple +è¯ ģ +á rio +çĶ Ł +Ass ignment +ĠQue ue +cvt Color += (" +I mp +L IC +V e +ç ¤ +ç ± +Ġ ê +ut ter +con struct +Ġcon cat +ĠR et +ĠV m +we ather +Ġstart ed +cl ar +Ġqu ote +tensor s +PRO C +Ġsa mpling +Ġjo int +Valid ator +éĩ ı +Pi peline +4 08 +D J +F unc +X ML +j wt +p ace +v n +v ity +re pe +Ġs pi +fi re +Ġw ire +#### ## +as m +ver ti +ver ity +ĠB utton +Ġle arn +row n +Ac c +о ÑĢ +Ġcor pus +over flow +åı ¯ +SC HE +) > +A Z +B asic +V olume +V oid +Ä ĥ +ĠB aby +ĠR ES +ĠV M +Ġlist a +Ġconfig ure +au d +temp ts +FA IL +Ġwork space +Ġsign ed +ĠTh en +sig moid +cap acity +Fil ename +document s +PROTO COL +ampa ign +C UR +] " +a co +p v +w ire +¤ ółģ +se ason +Ġc ity +ct l +ĠA ction +po w +Ġu int +Ġdata classes +pre ad +col lections +ag raph +Ġat tach +Ġass ume +Out er +Ġpe er +Ġrepresent s +ĠTe mp +ĠSh ow +SN MP +ółĢ± ółĢ +Ġderi ved +inger print +m r +Ġ mpl +Ġw all +ĠD ire +Ġat tack +right s +Ġob servations +IC S +UT F +Ġsub net +94 6 +File Name +[:, :, +CL A +Ġword List +åĪ Ĺ +Ġappro priate +TIME OUT +fast a +under lying +8 92 +E u +K p +Q A +d T +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +de ep +ad i +co lour +Ġb ind +pro f +ER T +"] ] +Ġen coded +run s +... " +Ġreg ions +Ġcal lable +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +01111 11 +æĸ ° +aut og +Ġп ÑĢ +Ġhome assistant +' [ +R sp +o pp +p atient +Ġ -------------------------------- +st and +me l +)) * +Ġ2 70 +Ġst udent +]) [ +Ġco ord +ĠW or +dict s +ET ER +pop ulation +ESS ION +Ġass ignment +over lap +Run ner +Ġparti tion +ENG TH +4 05 +6 87 +L IMIT +e mo +h u +n ment +s ymbols +µ ółģ¿ +Ñ Ĩ +è · +in ches +Ġc i +Ġc lusters +Ġre pr +() [' +import Symbols +Ġ2 24 +ĠC SV +In v +bu ff +AR K +04 8 +Ġax s +åı Ĥ +sm art +Ġjob s +/' + +Di ctionary +Over hang +Ġenti ties +agin ator +C G +C m +M ED +N on +W q +å ¿ +Ġa da +Ġre dis +un squeeze +Ġm ol +10 111 +16 2 +Type d +]] ): +Ġcomple ted +Met ric +' /> +/ # +C ar +E nt +R AN +g d +Ġ 888 +de leted +Ġc lock +Ġre pro +Ġd pi +ra ck +Ġ[ {' +ĠS TR +čĊ čĊčĊĠĠĠ +Ġon es +List ener +Ġinter p +000000 11 +Ġfa ces +percent age +å¾ Ĺ +ا Ø +Ġwho le +ENG INE +æĸĩ 件 +' ( +' ll +3 55 +B ad +c ancel +w x + · +Ġ ang +at tention +Ġt t +Ġp ast +Ġf ire +Ġl s +sc enario +]) ), +AT H +Ġan chor +sk y +Ġreg ist +0101 011 ++' _ +Ġans ible +circ uit +Ġdocs LoadBal +SERV ICE +å¦ Ĥ +> ") +A ng +L AN +M F +U sed +f v +h orizontal +w p +er os +ĠT ry +ve locity +Ġth ird +Ġpro jection +ĠW hether +Ġal ias +Ġurl parse +ĠX ML +Time out +present ation +appro x +nick name +4 07 +9 12 +B N +Q Q +r ho +x ls +ç ķ +č ĊĠĠĠĠĠĠĠĠĠ +Ġ 86 +İ · +Ġa ux +ur tle +Ġe mp +ĠT F +Ġl w +16 0 +Ġro ll +17 1 +Ġcomp uted +ĠCon text +row se +26 7 +Ġz o +ĠUn ivers +Ġgener ation +Ġpack et +Ġatom s +contin ue +Ġgre ater +Ġdecor ator +b alancer +y ticks +é ¢ +in line +al ive +ing State +Ġb us +con verter +ĠA LL +vi sed +fo lio +Ġcol lect +Res ources +DEV ICE +________ ________ +ĠVi ew +& & +F eatures +T ED +p w +æ Ĭ +Ġt vm +Ġc s +Ġb on +is ation +Ġcon tour +99 8 +Ġ5 6 +work load +RES PONSE +experiment al +MET HO +widget s +utc now +ypot hesis +_ : +Ġp m +et c +Ġg pu +Ġr hs +po licies +02 1 +'' '' +split lines +Ġresponse s +AD D +norm alization +Ġdocument s +Ġsim ilar +We ight +writer ow +boot strap +Noti f +rag ma +3 64 +V N +w c +« ółģ +re m +Ġm i +Ġw ater +set Objects +con ti +con structor +(" _ +Ġv Column +ĠU sing +Ġac ross +ĠCon nection +token izer +ĠPro perty +ãģ « +sw ap +distance s +Ġfra ction +åĬ ¨ +Ġcut off +Ġinterpol ation +IFI ER +3 14 +t or +v port +Ġ urls +Ġc ategories +Ġ1 23 +ul ative +Ġg ain +to s +]) ): +pre p +ĠR GB +Ġen ough +´ółģ ¿ +roll ers +Ġsign als +QU E +oper ations +Ġign ored +Lib rary +ĠBo y +Det ail +Batch Norm +ADDR ESS +ĠSP DX +B AL +E PS +m aries +p le +v t +Ġ' : +Ġs r +Ġis n +") ]), +ĠM apping +os ity +Ġme dian +train er +index es +base s +Ġraise s +00000000 0000000 +Ġmark et +az ard +Ġmon itor +Ġdir s +seri alizers +estim ate +wi res +D N +D im +F ROM +P attern +æ ģ +on line +Ġt ail +Ġf oo +Ġn ltk +ur istic +Ġ{ { +ĠC all +Ġde tail +args ort +Ġpro te +son g +tri als +ĠU sed +Ġch art +17 9 +sub scribe +work ing +Ġcur ve +Ex it +Ġcontext lib +оР´ +Ġsa fe +æľ ¬ +custom er +dete ctor +Ġtr uth +åĬ ł +ama zon +Lim it +ĠLay er +F OLD +S yn +d g +w ik +Ġs i +ad ow +get her +ĠD own +per f +ĠG irl +Pro perties +Ġcom ments +Ġ`` ' +ESCRIPT ION +comple ted +Per cent +Hel p +ĠCHE MBL ++ '. +D ele +D istri +F ull +S R +U A +[ @ +e gg +p ending +in verse +Ġt m +le m +Ġp addle +Ġf lu +ol l +ĠM AX +Ġma ps +ject ed +lib s +ST RE +03 5 +ĠK e +au gment +ENT IAL +âĢ Ķ +ĠGener ator +ãĥ ³ +sim ilarity +Ġdete ctor +atom s +udi ence +èĩ ª +CLA IM +3 09 +O URCE +P od +P RI +S ygusParser +i or +k n +r g +me ga +Ġc pu +Ġp od +is nan +sc Mod +im ize +Ġor ientation +ph ere +ðŁ ¤ +ĠRe ference +ID X +Ġlo sses +HO LD +Ġar c +Ġqu at +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +Pre fix +Ref resh +éĢ ² +Back end +Ġ================================================================= ============ +O w +P M +h b +h q +h ere +x i +ç º +Ģ ï¸ı +in ct +in ity +or er +Ġp ip +Ġa mp +Ġw ar +th ird +ĠS upp +ance s +Ġk w +Ġwe bs +ann ing +gen es +Ġfig size +Ġmock er +Ġattr s +Ġfast binary +Noti fication +Transform er +frag One +âĢįâĻ Ģï¸ı +B ound +F ind +P itch +Q q +b lit +h alo +m ime +ç ´ +se ek +st one +Ġf urnished +Ġre call +ct rl +#### # +di f +ĠT otal +Ġr l +ist ed +Ġ_ ( +Ġget s +ph p +36 5 +env s +SS L +Ġscri pts +н о +Auth entication +ĠTe ch +æİ ¥ +PECI AL +L EN +P k +S ING +f j +h g +p ca +ç łģ +é ħ +Ġ 95 +or tion +Ġp g +Ġm en +ĠS pec +Ġr ho +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +ĠP Y +=' / +AT URE +ign ed +over ride +Ad am +ida de +Mat erial +Ġ'_ ' +ä½ ľ +Ġast ropy +Ġfail ure +Supp ort +Ġba seline +/ $', +3 57 +C fg +b ian +z A +ì ŀ +lo s +Ġs at +la sh +ĊĊ ĊĊĊĠĠĠ +th ree +Ġde grees +Ġv tk +1111 111 +Ġpro j +ĠB oo +Ġun known +Ġco lour +Ġpy g +ag ate +Ġpre process +mat erial +yn omial +trans l +En vironment +To ols +Class ification +Ġtri al +SER IAL +Ġcache d +Oper ator +ú mer +u als +v ile +x p +de sign +Ġre ferences +ad apter +Ġl l +tr ust +Ġse en +ĠU N +Ġ{} \ +34 4 +Data Loader +she lf +Ġobj ective +Ġcustom er +Parse Tree +2 85 +X L +] ") +g ain +n v +u u +é Ĥ +at al +de letion +ro duction +un g +Ġm x +Ġ1 06 +get Typed +Ġse quences +IT EM +cre ts +predict ed +Ġdistance s +inte grate +åŃ ĺ +pla in +ĠLO G +ĠSE LECT +Ġwidget s +Ġaug ment +g as +h ard +p ull +ç Ļ +ë Ĭ +Ġ ################ +Ĥ ï¸ı +lo pen +Ġd ynamic +=" % +ĠB u +AT OR +Ġ5 7 +RE PL +pri ces +Ġqu eries +parent s +Reg ion +Run time +long itude +IZ ER +cover ed +åº ¦ +Exec ute +++++ ++++ +âĢįâĻ Ĥï¸ı +௠į +lite xt +' %( +P ub +Q y +V cs +d ue +g uid +o sed +x min +at ched +Ġa io +Ġin correct +Ġd ocker +Ġm ix +fi xture +Ġb asis +ĠS w +ĠS chema +ĠA T +99 5 +EN AME +05 5 +22 7 +comp iler +36 0 +ĠÐ ´ +Ġexp licit +Ġeval u +clean up +âĢįðŁij ¦ +âĢįðŁij § +Sc ene +Ġsupport s +Ġseg ments +Fla gs +' `` +. """, +/ ") +9 02 +A ST +f bx +h op +k ale +on to +Ġt un +Ġre size +co co +ck s +(' { +arg parse +ex change +py game +OR DER +read s +Ġco verage +ec tivity +CT OR +Ġbuil ding +Ġcall ing +Ġiter able +gr al +Ġvi rtual +âĢįðŁij ¶ +Ġacc um +Ġinte gers +Ġcre ation +Ġdig its +çĤ ¹ +ç¤ º +scMod Vcs +' ", ++ ') +C ent +S F +S he +b ag +h c +j j +r ng +ì Ĺ +Ġr g +po ses +Ġu id +Ġres olve +18 3 +33 5 +Ġdis abled +iter ation +\\ \\ +style s +Ġpub lished +Do main +åī į +Ġsche me +' ))) +D est +H andle +L ENGTH +W C +\ "> +° ółģ +re ferences +ar ing +ed itor +Ġ( [ +Ġh ighest +sh o +Ġma kes +are f +ĠE val +mb ic +05 7 +ne ed +96 5 +33 6 +reg ression +Co st +Ġsample d +post gres +SC RIPT +ĠID s +Ġsim ilarity +ĠAdd ress +SP ACE +Ġho ok +numer ic +ĠLine ar +Ġnd array +ĠNotification Type +Ġinvok ingState +D AY +E poch +M ake +P ick +Q i +S ensor +V ars +p ip +Î ± +ç IJ +Ġc k +ra b +con nections +ĠS UB +ĠP e +Ġst ation +0000 11 +=" # +ĠO SI +In te +Ġ5 2 +Ġal ert +Ġpre ss +IC K +22 9 +Ġcom b +ran ches +Ġsk y +cp wVc +Ġplot ting +ie q +post s +chain s +ä½ ¿ +Ġ'+ ', +ĠHttpResponse Redirect +Ġestim ate +assign ments +numer ical +âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢ +ä¾ Ĩ +Fail ure +ĠWindow s +æ³ ķ +/ ? +E CO +S ave +] ' +g ent +m ult +s f +y ml +z i +Ġi de +ro ke +Ġre v +ĠS elect +Ġg ui +'] ). +** ( +ta ke +out er +ĠD I +if ar +Ġpro cesses +Ġon to +18 1 +03 7 +Ġ} ], +RO I +check out +ĠBoo lean +L ANG +d ra +m iddle +r mtree +t EX +w a +it o +Ġb enchmark +') ], +ĠS top +ir ation +Ġal t +En able +the me +ai lab +ins ide +ba z +ĠAt tributes +1111111111111111 1 +cei pt +çİ ĭ +) ? +A gg +G Y +M ib +i am +p f +or se +se en +Ġt ex +Ġd ropout +ata ble +ĠC Y +") ] +Ġl b +pro be +pro cesses +ON G +tra j +ari a +26 5 +Ġcreate s +Ġmat ched +Ġcor re +е ÑĤ +Trans fer +Def inition +BU ILD +ĠApp roved +jnxMbgSgw GtpV +ĠTrain ing +æŀ ľ +Ġtermin al +jnxMbgSgwPP GtpV +C PU +P ixel +] ", +h stack +i ke +j mp +r n +u fact +un used +Ġm m +co ordinate +end ants +to c +par ticle +om y +07 7 +ĠE T +sub scription +inter faces +Ġle d +Ġmat rices +cal ib +ðŁı´ółģ £ółģ +ĠÐ ¸ +TO DO +fla sh +Event s +entic ated +Ġyear s +Ġderi v +LIN K +éĹ ´ +drift s +itect ure +getTyped RuleContext +8 99 +F c +G P +H ash +S IM +T imer +a ffer +c isco +f our +Ñ Ī +è ĥ½ +an im +Ġc hem +Ġp ersist +Ġs cheduler +Ġd uplicate +ĠA udience +######## # +ĠI M +ĠD ep +app lic +IN SERT +Ġhe at +64 6 +Ġpo se +CT F +Ġli g +56 5 +Ġfa ctory +Ġ", " +è¯ · +estim ators +sph ere +4 09 +R aw +m z +y u +© ółģ +in ference +or ientation +ma y +ĊĊ ĠĠĠĠ +ĠT ri +ĠB inary +AT IONS +EN ABLE +ts v +SE QU +ip pet +iti ves +87 5 +97 7 +Ġdo ing +cal cul +SI G +Parser RuleContext +ãģ Ļ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +xaf J +ĠMe thod +Ġparti cip +Oper ating +CHECK POINT +D ICT +P omerium +S lider +T CL +w ind +Ù Ĭ +Ġ 92 +in ce +Ġin crease +ĠT ABLE +Ġg ray +Ġg ym +01 8 +od b +Ġh ar +im ing +Ġ3 40 +ĠM ac +07 5 +15 3 +Ġsp aces +ĠCON F +Ġwork ers +tx n +CA SE +ĠSet up +scal ing +Ġinclude s +cut off +ĠApp ly +Per mission +Ġpe ople +åĽ ŀ +Ġcat alog +Ġcalcul ated +ĠExample s +Ġretri eve +jnxMbgSgwIf GtpV +* ', +2 98 +I ZE +L a +O G +P ress +b log +z s +å ¥ +ç « +ì § +in place +al loc +ti fy +Ġp atterns +Ġn av +Ġb undle +ab ly +Ġg d +ĠL ink +ph ys +ĠG aussian +valid ators +Ġob servation +RE M +ill ing +95 7 +ach er +Ġmat erials +clo sed +Ġcan vas +Ġexec uted +Ġwindow s +DU LE +gate way +Ġrep ly +ament o +sph inx +Ġcontribut ors +3 02 +p ly +de serialize +Ġp aper +Ġs an +un ct +__ ' +Ġth ings +Ġde mo +04 5 +Co lour +pl ate +Ġ] ), +ular ity +Ġmark down +âĢįðŁij ¨ðŁı +âĢįðŁij ©ðŁı +Ġcorrect ly +Ġevery thing +lis ion +9 13 +S ocket +U ns +t ls +é Ľ +Ġ ray +ar rays +Ġin ference +Ġre cursive +': [ +__ _ +######## ### +os a +IN VALID +ĠE mail +ll ite +ĠIn st +37 6 +ĠEx p +Ġpri ority +Reg istry +Sh ader +ASE T +CK ET +nb tc +product s +STAT IC +lst m +CHECK ING +ffi li +ç± » +FOLD ER +" %( +' $ +E qu +N F +S te +W IN +h h +h l +u aliz +à ¨ +Ġ ĊĠ +re store +le ts +ti tion +ig ation +Ġr s +01 5 +Ġh a +ans wers +18 9 +au g +Int ended +Inter rupt +rap pe +äº İ +USE D +Ġum a +âķIJ âķIJ +B ig +K B +R R +S erial +j sgParser +p run +y ou +č ĊĠĠĠĠĠĠĠĠĠĠĠĠ +it a +Ġm argin +ra c +(' " +ĠA le +list ener +Ġde ep +text ure +92 7 +ĠH ome +Ġad der +norm alized +cat ing +cache d +acc um +For est +ĠPre dictor +çĽ ® +C enter +S PE +c raft +m ust +v k +at ives +en ing +Ġt au +Ġp v +ma pper +sp litext +Ġcon d +ic ally +15 2 +Ġpre p +IC AL +88 7 +AM P +Ġcomp any +AC COUNT +ps i +Ġqu it +ĠWAR NING +Ġrand int +Ġgen es +åĽ ¾ +hook s +tEX t +v x +è Ģ +Ġ čĊĠĠĠ +Ġp lan +ge om +Ġin p +') ): +ĠC ount +Ġdef ines +par ticles +ĠF a +list a +ĠE xec +Ġ4 6 +bu d +eri a +19 1 +Ġunder lying +23 9 +Ġrun ner +so up +35 0 +Ġcode cs +Ġ201 2 +order ed +Log in +build ing +Ġed itor +Ġmon keypatch +Token izer +Process or +Mo ve +Ġbound ing +ê° Ģ +> & +C opy +N D +S nap +g old +s ites +Ġ vec +on gs +re pos +ar th +Ġre view +(' ', +ĠC re +ĠP R +0000 1 +Ġ3 8 +ir t +Ġro ut +14 1 +ok up +Ġcomp ile +clu ded +AL CAR +cal ibration +77 6 +ĠJ ob +о ÑĤ +Ġover lap +optim ize +Ġmodi fication +Ġgen ome +NUM BER +}: { +Author ization +Ġquanti ty +ĠEng ine +ĠSER V +quival ent +ĠBlue print +ALCAR ECO +4 66 +9 09 += . +C osm +I J +S q +T ARGET +i py +se ctor +Ġp ts +ri sk +ĠC er +ĠA pi +ver tical +Ġth resh +Ġst and +Ġget ting +Ġch r +33 3 +exp l +00000000 000000 +86 7 +LO W +Me asure +ud it +Ġinter vals +Ġval s +ĠSet tings +aa aa +ĠLo op +NO WN +Label s +expand user +Obj Pointer +SU CCESS +Ġcapt ure +kpnt Trap +İ· åıĸ +ailab ility +4 32 +A W +L ane +O VER +P a +S G +U CT +n ested +} $ +å » +å ŀ +le ment +Ġi i +Ġs ymbols +Ġm k +co sh +ab orn +ist ance +ON LY +Ġ4 04 +16 1 +Ġmat erial +Ġadd resses +Ġuni form +ĠEN D +Ġrequire ments +Ġcer tain +Real m += """ +C amera +h ing +y r +ar gest +ĠS ome +Ġj ax +In ser +03 4 +Ġch at +Ġla unch +36 8 +cre ation +token ize +Set up +Ġsk image +TR UST +ALL OW +modi fy +built in +ë¡ ľ +5 66 +E B +M ER +P V +P DF +p ause +r er +ç Ń +Ġp ragma +00 02 +Ġs ong +Ġ3 9 +Ġse curity +comp arison +Ġlo st +Ġtrans late +filename s +mark ers +gn ore +SI GN +ĠData Field +ï¼ ī +Ġmap ped +Ġtr ust +Ġcalcul ation +fold ers +tol erance +HEAD ER +ffici ent +) [' +3 12 +Q C +d ry +p atches +w u +á Ħ +Ġ 97 +in strument +ch ase +il ation +Ġcon nections +im s +Ġout er +da de +22 6 +Ġconfig s +Ġconfig urations +87 6 +color bar +ach ine +go ing +cre asing +PO LIC +Ġreg ard +Ġge om +Do es +blue print +FIL TER +REQU I +âĢĶ âĢĶ +ĠSpec ify +ëĬ Ķ +B T +B in +B its +D ESC +g aussian +g uild +s lim +w rong +å § +æ ¨ +é Ķ +Ġb el +ĠA P +log out +Ġse ns +label size +ans ion +Ġ4 1 +ĠU UID +03 6 +Value RangeConstraint +ï¼ Ī +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +================================ ================ +LLLL LL +Ġhost name +ĠDE BUG +prob ability +Ġ? , +Ġcent ral +Ġdig it +Ġenti re +Cosm ics +POLIC Y +K A +K I +L ow +b io +f type +p ersist +re me +st em +Ġp ull +Ġs d +Ġre peat +Ġ1 04 +') ; +ĠA RE +ĠF ore +tr unc +=' \ +ance d +Ġbe havior +ph ot +ph rase +25 7 +og raph +17 0 +Ġat tempt +Ġdist utils +Ġindex es +check s +ern ion +CH AR +Ġval or +Ġph one +encode d +web driver +Ġsuccess ful +******************************** ******************************** +ĠXXXX XXX +ISE D +ĠMicro soft +/ . +9 11 +A ns +D iff +L M +T ABLE +a G +m M +x C +in fer +Ġn ative +Ġm uch +ma pp +__ ). +[' _ +Ġl and +ĠA WS +99 999 +Ġde ps +08 6 +ach ing +Se curity +FF ER +Ġiter ate +čĊčĊ ĉ +Ġ', ' +By te +App s +ĠType Var +Ġembed dings +GG ER +ĠCur rent +ertion Error +A UT +M ULT +P B +b ash +k E +u ce +ç ľ +in y +in vert +en es +Ġm ouse +() [" +-------- ------- +ta ched +pre ter +ĠB ig +ep ic +EN CE +bu st +Ġ5 9 +64 5 +22 2 +AM L +Ġte mplates +Ġser vices +az ure +fin ished +еР» +vv vv +DEV ICES +Ġhel lo +çIJ Ĩ +" % +B ridge +P lace +h params +v ation +å Ŀ +ì ł +in ing +al ect +mp y +Ġf ew +Ġf rappe +Ġa ffili +Ġs il +Ġ0 1 +Ġw on +Ġg c +ta cts +Ġnot hing +ĠM ay +da ily +Ġal tern +93 8 +pi res +mand atory +comp osition +96 6 +av or +ale Parser +spe ction +En ergy +ĠPro duct +ten ant +connect or +tt l +0011 100 +comm unic +Ġcir cle +################################################ ############ +· · +' / +O rigin +R a +b eat +u j +× ķ +æ ° +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +re v +Ġt runc +Ġ2 90 +(" ../ +ĠS PECIAL +ĠF loat +ĠF ail +sc r +oc s +18 2 +Ġ6 7 +Ġtra ffic +ĠRe port +87 7 +Ġcheck ing +stat istics +ðŁı´ółģ ¢ółģ +Ġpri ces +Ġcho sen +Ġhigh er +ó n +cid ent +ĠReg ister +Cre ating +Ġpercent age +CAP S +Sto ck +9 85 +> | +C ES +Q S +f ew +g yp +ss er +ch ip +Ġ7 2 +ĠA ut +Ġ5 8 +Ġresult ing +Ġat ol +ou cher +ay es +ann ed +Ġconfig ured +Pro gress +ĠK EY +Ġit self +cent ers +Ġtrans l +ĠIN TO +fe e +Th reshold +year s +Ġnoti fication +}. { +Ġsuper visor +ĠLog ger +entic ate +ĠQt Widgets +Ġvari ance +PARAM S +A IL +[ { +m Z +v stack +Ġ' ( +Ġs qu +Ġs low +li ef +la ve +ri ds +ri des +oc us +ĠV ector +da g +Ġ. / +work s +shape s +Ġnew line +97 5 +trans actions +No te +transform er +seq s +ĠKey board +Ġgr pc +ìĿ ĺ +gu ide +Back ground +(', ') +C SS +D en +V q +o y +Ġc d +Ġre cent +Ġw allet +ck o +ĠA ns +ĠF in +ta int +ĠP age +Ġv max +per centile +ĠV is +14 9 +37 7 +000 1111 +Ġar m +Bo ol +pol l +af ka +ĠEn vironment +Ġscal ing +USER MSG +ĠTrans form +Br ush +Ġlet ters +Ge ometry +wiki pedia +ĠArgument Parser +ĠCont rol +reat ment +CDOTA USERMSG +gri ds +Optim izer +8 94 +K J +O X +R ATE +S ur +W F +e pe +o ct +} ), +¡ ółģ¿ +æ ı +lo sing +Ġin structions +Ġre vision +ri er +et le +qu at +ĠL E +pro posal +ĠD ESCRIPTOR +start ed +ĊĠĠĠĠ Ċ +DE D +95 6 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Ġorder ed +Ġdown loaded +Run ning +Start ing +Ext ension +ĠIndex Error +built ins +ĠIO Error +C ir +C NN +F N +L et +N P +N t +d rive +se m +Ġf lip +Ġ" ". +00 2019 +ĠT arget +et y +ĠD ense +92 14 +05 6 +37 4 +55 5 +sample d +IB i +oth ing +Ġdire ctories +PI m +Ġqu ick +Ġany thing +111 0000 +ÑĢ аР+æľ Ģ +seri alizer +ĠAc count +ółĢ± ółģ¿ +ĠOS Error +Ġflat ten +æ¬ ¡ +åıĤ æķ° +ĠUnivers ity +tEXt date +bud get +åŀ ĭ +M ut +T erm +X FP +p ayment +Ġ ################################ +an i +li very +ĠS ymbol +Ġr ng +Ġh orizontal +ĠL LC +ment e +ĠG it +Ġ5 205 +we e +Ġal ignment +08 7 +Ġsh if +Ġconfig parser +mon ic +weight ed +Set s +Ġq t +ĠÐ · +rect angle +čĊĉĉ ĉĉĉĉ +Comp onents +STR UCT +URE MENT +ship s +PY THON +ĠInter face +Iter ation +zo om +ç¬ ¬ +éģ ĵ +intain er +5 09 +B LOCK +C lock +E I +E p +F ire +M issing +Y ear +e j +è µ +at trib +ar di +Ġp ayment +Ġre comm +Ġre distribute +li ers +__ } +)) ; +om dog +ci se +tri al +Ġtrans formed +>> >> +cho ices +0101 01111 +ĠCreate d +Ġvis ited +fri ends +lastic search +Ġfl ush +æģ ¯ +, , +B it +B and +Y our +c ms +e o +j ump +t weets +¯ ółģ +Ġc f +Ġs ch +Ġre versed +pe ak +pe ople +Ġe ff +Ġw t +th an +ĠS ingle +Ġdata class +tra ction +22 0 +clu ir +Ġz eros +rc Params +23 8 +Ġver tical +iter able +Ġcal ibration +xy gen +и ÑĤ +ĠLe vel +gan ization +æł ĩ +charact ers +ĠtypeOf FirstFixedSurface +TEMPL ATE +2 10 +L anguage +Q d +c riterion +w r +x max +Ù ĩ +Ġ uri +or acle +re cover +ti ce +Ġl argest +ĠP oly +ac ion +ac tivate +92 4 +ĠG affer +Ġro i +aliz ing +new axis +Ġtext s +Ġpri me +View Set +ĊĠĠ ĊĠ +Ġmark ers +hic les +å½ ķ +ĠDet ails +Ġconsider ed +Ġtak en +PROC ESS +METHO D +STRE AM +ĠAle mbic +B M +C AL +L at +T i +h uman +p wd +u ds +re stri +he ap +Ġto day +et ing +ĠS k +res ume +Ġde sign +ac cent +32 8 +Ġhe ap +St age +24 8 +act er +Ġreg istry +assert True +Ġab ort +ĠSim Struct +Ġfra gment +čĊčĊčĊčĊ čĊčĊčĊčĊ +: < +J J +M AC +P latform +S ide +e mit +g pus +w arp +¨ ółģ +Ġ 94 +re start +en et +Ġp alette +Ġo pp +li ve +ĊĊ ĊĊĠĠĠĠĠĠĠ +is instance +ĠP art +Ġpro be +Ġco ok +loc ator +AR B +Ġen c +df s +ID s +24 7 +57 6 +Ġext ent +`` ` +gen et +ail y +De velopment +ca ption +Ġsu do +Ġclo sed +ĠComp onent +åIJ İ +ĠPo ol +SU PPORT +[... ] +Sele ction +mn ist +combin ed +heat map +ðŁı´ółģ³ółģ © +( . += < +B D +W K +d antic +h int +æ ® +ut ures +ate llite +Ġ# -------------------------------- +to o +Ġh ad +ta pe +Ġde m +IN IT +ff f +Ġ6 8 +ag ger +ud ge +ĠSe quential +101 0000 +Ġgo ing +Ġman ifest +shot s +.* ? +Ġbl ank +Spe ed +Dep loy +multip ly += __ +A nnot +C EL +E MPL +O H +k b +l umen +Ġ 98 +st al +le ton +ur er +Ġe as +get text +ĠC OL +Ġr x +Ġl arg +to wer +key words +loc s +05 8 +uc lide +Ġmay be +mask ed +enter Outer +lip se +RES OURCE +ĠXXXX XX +Ġwho se +Req Tx +Req Rx +ĠExtra ct +cipi ent +Ġaio http +enterOuter Alt +( (' +C lick +K it +S UM +T Z +k v +q n +u y +w g +Ġc e +Ġp iece +Ġ1 11 +con firm +ĠO K +Ġx x +ang ing +ec ycle +ID E +lock ed +Ġspeci es +Ġq ml +sv c +Ġtemp orary +Ġsu ite +lap se +Mo zilla +distri butions +Ed ge +åį ķ +Det ails +ĠMon go +åĮ ĸ +Dig ite +QP alette +: [ +D ESCRIPTION +X C +b la +w est +Ø ª +ê ³ +ar a +he t +ge titem +Ġn ão +Ġin fer +)) / +ĠC a +Ġ: ], +Ġh ass +ĠP I +ĠB asic +ĠN EG +Ġ4 7 +ĠR est +96 7 +go v +ðŁı´ółģ ¡ółģ +Frame s +Ġtensor s +Ġweight ed +network s +Al chemy +áĥ Ķ +ĠTe am +/( ? +oriz on +Scal er +Sele ctor +writ el +Av g +amb da +squ ared +retri eve +xls x +úmer o +ĠDI RECT +G AT +K Z +P eriod +S pect +c rs +k c +l x +m orph +o sp +w arm +Ġ" ( +he ss +Ġd ns +li ct +Ġm ut +ra sh +la in +ad ir +co pi +Ġto gether +Ġ7 13 +ĠA v +ĠA verage +ke leton +am i +Ġh s +Ġj np +Ġlog ic +min ute +SE TT +jo urnal +([ ( +LE FT +Ġ{} : +lin eno +comp ress +Ġsc r +dis count +State ment +ram id +inf os +fri end +: ]: +C loud +D Z +N a +S ta +V V +d ating +f z +q r +´ ółĢ +Ġ 87 +Ġc el +Ġp anel +he uristic +00 1011 +Ġs lim +Ġs lope +li z +Ġw av +Ġfor e +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +Ġu i +que s +np z +Ġso ck +Ġauth entication +Comp liance +ĠDe velopers +UB LE +0011 101 +ĠPRO C +ĠAc cess +past e +Ġpot ential +' $\ +8 18 +C lose +D L +F B +F ITS +M ag +T ON +T orch +T URN +] }, +b um +c mp +d types +g ather +s co +Ġ ĊĊĠĠĠ +Ġp rom +lo od +Ġn r +ra ms +Ġe cho +id o +ĠS eries +ĠC AR +sp dy +vi rt +Ġy s +92 9 +ðŁ § +comp ressed +wait Key +ĠPro gram +Ġlimit s +MO DULE +PL ES +0100 011 +medi um +ĠEn try +CONT AIN +Ġ'{} ' +Ġtol erance +ĠDIS CLAIM +ĠTech no +2 19 +R ob +] == +f ab +m J +Ġt d +ti al +Ġ" ` +li a +Ġg ap +Ġr cl +data class +Ġh y +Ġh uman +=' % +Ġ3 600 +Re mote +add Handler +AR R +Ġhe alth +Ġ6 3 +06 7 +Par ticle +Ġag ree +learn er +LLLL L +Tx Params +=- =- +docs LoadBal +Jo int +FR AME +Row Status +Ġhand ling +Ġho pe +WH ITE +Inst all +C ENT +D ump +P op +S ort +S ESSION +h m +h z +in file +st able +Ġc ards +Ġf rozen +Ġs al +Ġs alt +li min +Ġ1 08 +ĊĊ Ċĉ +99 4 +Ġst ick +pro blems +ang o +Ġbe am +ĠG OO +start ing +Ġ'- ' +reg istration +client s +ĠIN PUT +={ }, +game s +mer ged +WAR N +Ġtransform ers +ĠApp lication +Ġweb driver +ĠAl low +CONT ENT +ĠId enti +stick er +IGN ORE +CHAN NEL +Ġaffili ates +: ]. +B G +F ONT +W ave +] ][ +Ġ ################################################################ +Ġ ERROR +į ç½® +Ġ' \\ +ch ors +ve ster +ĠC PU +Ġg aussian +Ġst uff +Ġpro duction +Ġj ump +ID D +Pro xy +ĠCon tain +36 7 +au ge +ud get +ran ks +annot ate +ĠLo ss +GR AM +еР´ +è¿ Ľ +come s +Ġsepar ated +å¼ ı +ĠAD V +Ġpermit ted +WIT H +M apper +b roadcast +h ide +· ółģ¿ +Å ¼ +É ¤ +Ġt ran +an imation +ro utes +Ġp en +ct est +Ġm ount +la ps +ĠT w +ac i +Re c +Ġ4 3 +ĠW ord +ĠU ti +15 9 +right ness +ĠH ere +Ġsh own +27 5 +24 4 +96 8 +Ġcomp arison +97 6 +Str ategy +IB ILITY +Ġiniti alization +ĠDe te +track s +fin ite +NE CT +Ġ---------------------------------------------------------------- -------------- +Met rics +/" + +ĠLO SS +Bu cket +arti st +čĊĉĉĉĉ ĉ +ĠMat rix +uggest ions +ĠLin ux +Ġrepro duce +H yper +N Z +Q CTF +S ome +W rit +¶ ółģ¿ +Ġ ]: +se cs +ar ity +ti ssue +Ġa ble +ad ditional +sp o +ub ic +ĠD on +Con tact +mit ted +inter section +97 8 +ull er +au sed +Ġend s +call s +iss on +Ġnorm alization +Bo ok +Gener ate +åIJ ¦ +TER N +upy ter +×ķ × +, [ +; "> += ") +C l +H w +I UM +L AY +M J +P ART +T ASK +V ari +p ing +é ł +Ġ čĊĠĠĠĠĠĠĠ +Ġp si +Ġs uc +ct r +ma zon +et une +ke w +Ġh is +Ġpar ticles +ap tive +ang ular +ph inx +15 1 +100 11111111 +AM ETER +{} \ +86 5 +26 6 +Ġne ighbors +Ġte ch +ear er +Time stamp +ĠPro file +she s +Ġstd in +Ad apter +Ġì Ŀ +contain ing +sec ure +Down loaded +enum s +ĠMo di +4 35 += / +> / +C LO +G AM +W L +c url +j Y +s ch +u med +y our +º ółģ +in structions +00 101111 +Ġd c +set Text +Ġdef initions +Ġg al +Ġro uter +ign Key +03 8 +spe aker +Ġinter est +]] ), +ãģ Ĺ +link ed +match ing +fy ing +Ġexec utable +Ġtri angle +clean ed +áĥ ĺ +Ġpe ak +termin al +Pool ing +íķ ĺ +Mark er +Ang le +" / +H RESULT +W in +a de +b j +c andidates +d ut +k M +u um +} }, +à ī +è ª +ar o +le af +ul ly +et ree +ĠS m +Ġl it +to k +ase d +ĠV e +ader board +')) . +Ġag ents +graph s +Ġlength s +Ġlicense d +ARTIC LE +Ġestim ator +Ġspect rum +="" ) +COLUM NS +tit ude +SNMP v +A xes +P F +R X +T HE +T ick +V I +b ow +e u +f k +m usic +w allet +in formation +Ġ= ================ +Ġc isco +Ġs un +Ġs ho +to do +ĠD raw +Ġpro bs +92 6 +In f +ĠG lobal +Ġco okie +format s +ag ation +04 7 +88 6 +57 7 +upp orted +66 6 +ns ure +ome ga +vo xel +Ġproject s +dot env +fla sk +initial ised +ites pace +slot s +orn ado +Ġtw isted +ĠForm at +Ġnumer ic +tan h +Cla use +2 13 +4 28 +> [ +I con +e ven +f em +} -{ +æ Ļ +Ġf allback +ur ons +Ġb ri +)) ), +iz ing +for ecast +Ġma king +tra jectory +ĠB uil +88 88 +AM PLE +ran ty +win ning +Ġparti cular +ĠRE AD +effect s +CONTRO L +SCHE MA +, :, +. '. +N ONE +Y A +d X +k top +at las +Ġt a +Ġn y +Ġin crement +Ġd pg +Ġ# ---------------------------------------------------------------- +Ġ( ` +ath s +up ancy +ance st +pre view +In cluir +ph en +da emon +84 6 +Ġcomp utation +55 6 +av y +86 6 +mon g +ĠIN C +Ġread s +let ters +Ġlocal param +ãĥ Ī +GR AY +åħ ³ +Function s +OB JECT +Ġdec ay +Ġissue s +ĠHe art +åİ » +ĠOther wise +3 98 +A FT +B OT +C lean +U LE +U AL +] ]. +` ) +e ast +f path +j peg +p omerium +q c +u lo +Ñ Ħ +é ĸ +Ġ åĪ +de ad +Ġd cc +Ġm ul +fi xtures +def initions +ĠC ache +for d +Ġcon version +Ġcon structor +Ġst o +Ġde que +ĠR ow +per formance +ĠU ns +AG C +led ge +ãģ Ħ +vide os +Ġwait ing +bind ing +Ġutil ity +Ġfeed back +NU LL +Ġsmall er +deploy ment +ĠVAL UES +Ali gn +Fc st +# ================================================================ +4 38 +B a +F ace +P ackage +R ENT +T W +Ä Ļ +at ural +Ġt weets +Ġp atient +ch ord +th ers +(" .") +ĠS a +im write +ĠM er +ĠM ar +ĠE l +ĠN UM +ir m +Ġ4 9 +Ġset attr +mat ched +24 0 +24 5 +00000000 00 +... ", +Ġne ver +000 111111 +Ġsp an +Se es +Ġgener ic +gn u +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Input Tag +BU FFER +dec imal +ven tion +Met er +ìĿ Ħ +Ġcap acity +fun cs +Ġtile s +resid ual +Ġarti fact +SEQU ENTIAL +M is +N L +Y S +c ern +l lo +t ro +w heel +æ Ł¥ +in ning +ar ticles +Ġf urther +Ġm icro +Ġe asy +Ġ# : +ed er +is y +') ]) +Ġl ua +out ube +32 0 +ag o +Pro to +CO M +77 7 +ĠIN DIRECT +CON NECT +Ġ202 2 +Ġì ł +fin ish +ãĢ Ģ +æĪ · +SP FA +01011 101 +Ġ:" ", +" ; +. ], +3 93 +4 34 +L AT +T r +c ion +g f +m ic +p an +p ressed +v iz +x E +Ä Ł +ç ¨ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +re moved +Ġp b +ction aries +Ġ7 3 +ĠC at +Ġh p +ĠL a +Ġde crease +ĠD NA +lab eled +Ġpro d +Ġ4 03 +fo od +ph ysical +03 0 +Ġch rom +**** * +88 5 +DE P +Ġne ighbour +Ġmo lecule +initi alized +89 03 +ell ar +Ġqu ad +EX P +Message s +Key board +Ġoptim ization +Ġvari ous +pn ic +Ho ok +ufact urer +ipy nb +ĠKeyboard Interrupt +> ` +D ot +Q m +W W +b N +b et +c andidate +d I +d ater +e z +f D +j k +m w +n nodes +} ; +¶ ółģ +Î ¹ +ì ĭ +Ġ 93 +Ġ ठ+pe aks +Ġw inner +ĠA B +Ġde viation +Ġpar ticle +ĠE VEN +mo vie +ĠG PIO +da mage +Ġ6 1 +08 5 +ĠRe f +84 5 +RO P +cor relation +Ġarg parser +gen ome +ĠSt ream +ĠCON SEQUENTIAL +Bo ard +stack overflow +Ġsupp ress +Ġport s +Ġlib raries +ordin ator +Ġcl one +Rout er +ĠRo le +ĠGe cko +567 89 +stit ute +remain ing +//////// //////// +mig rate +- ') +8 93 +> ( +C AN +C lasses +E V +R W +r ating +s an +å Ļ +ê ¸ +Ġ  +re dd +Ġ' '). +Ġp x +Ġf ar +ri eve +ch kpntTrap +Ġ7 6 +ab out +ĠC ho +ĠC ategory +Ġr tol +end points +ĠP ins +Ġas k +=" \ +Ġ_ (' +Ġse ason +ĠN on +lu a +Ġun pack +ĠU P +25 4 +ne uron +Ġdi alog +sk ill +ak y +Ġraise d +Text ure +new line +CH AT +pl ant +sg i +tiv es +Ġ'. ' +ĠGener ic +scal es +END POINT +apt ure +Cal cul +GEN CE +ĠLO GGER +Open Sees +1011111111 1111 +BACK END +Ġbuilt ins +Ġfri end +Ġabstract method +Ġada pt +Does Not +æ¨ ¡ +áĥĶ áĥ +) }) +D M +F G +F ree +K ernel +M ost +P ACK +d ro +g ca +p al +é « +ro gram +ti er +Ġc are +Ġe tree +Ġb atches +te le +Ġ[ [' +is digit +con da +ĠC L +Ġl umen +list ed +out dir +ĠM eta +ĠB ot +Ġon line +scri ber +64 8 +Ġcomp ression +Ġnew s +Ġdis patch +ENT S +vid ers +Ġsupp lied +Ġbu ff +PRO P +sim ulator +include s +ĠLog in +<< < +quanti le +Sk ip +('_ ') +è¾ ĵ +ĠAb stract +ĠPi peline +'`` : ++ ': +d uplicates +f ac +r w +Ä ħ +è ¨ +er k +ro c +Ġs f +Ġs sh +Ġs ay +int ent +ĠS to +Ġg ithub +ta iled +Ġst e +fig ures +06 6 +Ġz y +Ġ8 1 +obj s +Ġread y +000000 10000 +common s +ãĥ « +QU ERY +EM PT +math rm +Ġlink ed +011011 011 +Ġangle s +COMP LEX +disc ard +gradi ents +ĠMax imum +4 85 +4 75 +F ill +H ttp +M ultiple +O IN +Q R +h id +t rees +Ġ" @ +Ġin struction +Ġo u +Ġd u +Ġe lapsed +ĠF ire +ĠP V +sh m +92 8 +In it +Ġpre vent +24 6 +Ġext end +66 5 +AP E +OT E +check box +AD MIN +]] )) +ĠCON FIG +mplement ation +æľ Ł +Sim Struct +BL ACK +like lihood +ĠPRO FITS +compat ible +Ġcallback s +AUTH OR +Mon th +Ġvisu alize +celer ated +ä¿¡ æģ¯ +ĠNEG LI +3 99 +I X +K L +M X +M Z +M aster +b K +b w +b as +c as +d up +e lapsed +h f +l U +s lices +s aref +è ´ +Ġ ÑĤ +ro ids +Ġd d +Ġm omentum +ra ce +um in +as n +Ġ7 7 +ĠS hould +par s +po ssible +Ġas sembly +sh op +ph oto +iti ze +37 8 +Name space +36 6 +si mp +hel f +ĠTrans l +Ġap pear +organ ization +ĠFI LE +ony mous +Ġlex er +ĠValidation Error +ĠNEGLI GENCE +G u +N ORM +S i +S chedule +T L +b al +i ra +w ell +ë ¥ +Ġf act +ame l +li day +pe p +Ġm otor +ad am +Ġw arn +Ġ+ \ +__ ): +up grade +Ġx r +Ġun less +ph y +format ted +Ġ5 3 +Ġpy torch +og ene +ST ER +ari al +Ex port +Se ction +Ġus b +pri m +`` , +âĢ Ŀ +context s +Ġframe work +Ġmask ed +Ġzip file +NE W +ĠKey word +аР» +111111 100 +ĠQt Core +åĬ Ł +FIL ENAME +ç» ĵ +km uller +men tion +Ġwar ranty +C SV +H P +_ = +b v +c are +g ot +p C +y min +| '\ +ar ter +Ġb ug +get value +ab e +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ +Ġ3 60 +Ġthis Component +ĠH and +iv y +lat ten +Ġ| | +AP H +io us +Ex ists +Ġinter action +top k +Un its +Ġseri alizer +nap s +track ing +Ġhost s +sen ger +xF C +Down load +Ġplace d +Ġpr incipal +Ġlow est +011111111 111111 +Ġmag ic +pipe lines +Validation Error +mapp ings +DoesNot Exist +é« ĺ +/ {}/ +7 27 +C W +G UI +H ow +H ome +P ARTICLE +b isiklet +c ro +d on +n es +r q +x FA +y max +É ¯ +Î µ +Ġp run +Ġn uage +Ġre start +Ġre cogn +Ġ1 15 +11 1011 +op ens +ĠC allback +Ġl hs +if e +02 8 +ĠB isiklet +loc als +St mt +ĠCon tact +94 5 +av atar +Ġne utron +Ġsp acing +Ac tivity +Ġtrans formation +čĊčĊ čĊč +ãĤ ¹ +Ġextra cted +scal er +áĥ IJ +cer tificate +parti cip +UU ID +Ġri sk +ĠBy tes +frag Two +Ġequ ation +Fi elds +å§ ĭ +epe y +N ow +S lot +V IE +d ms +j u +j et +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +er g +Ġp ic +Ġf lt +ĠI E +out s +Ġse ver +Ġse lector +ag tail +ass is +RE E +pos ix +ĠIn tel +011 00100 +cri tical +Ċĉĉĉ Ċĉĉ +45 4 +Ġformat s +Ġcor ner +CE PT +Ġ". / +Al arm +ERR U +hex digest +yntax Error +Ġdisplay ed +EG IN +ĠSpe ci +VIS IBLE +irt ual +) '), +H K +M ar +O v +P J +S ys +T N +T IM +V endor +b ench +m time +n op +o ser +s lope +Ñ ĸ +ro is +Ġf x +li ms +Ġe arly +Ġ1 18 +Ġ1 13 +Ġw alk +Ġ[ % +from timestamp +qu bits +Ġme asurement +ĠE mbed +state Mut +57 8 +Ġ8 00 +do or +DI AMETER +Ġuti lities +MO D +PL UG +Ġoptim al +TE MP +ĠBo x +005 02 +ĠIniti al +Uti lities +PN G +(", ") +capt ure +Ġgate way +ĠJson Response +taint y +uclide an +åĻ ¨ +stateMut ability +C lear +F igure +K ER +T I +` : +l ens +m oney +v an +or ient +Ġ# ( +11 00 +0000 011 +ĠM a +Ġ* / +Ġx i +Ġma jor +ject ories +Ġres pec +bo lic +OR D +Ġat tention +ĠH E +][ - +84 8 +33 8 +85 6 +return code +so cial +ud ents +CH AIN +Ġver b +DO UBLE +DAT ASET +roll ing +Ġshape s +ĠCal cul +ĠCom mon +è¿ Ķ +MET A +éĩ į +MAN AG +FFFF FFFF +ĠPO SS +episode s +Sign al +Ġvo xel +multip lier +IDENT IFIER +æµ ĭ +ì§ Ģ +ĠDISCLAIM ED ++ ) +9 01 +9 19 +F IN +G aussian +O ID +P omdog +T ok +b ranches +i ro +k U +l w +m om +n w +s nap +or ange +Ġt ax +Ġ' {" +Ġc r +id en +el come +Ġg ram +Re view +app le +sh utdown +ĠO Data +IN ESS +pre dictor +ap ers +ag ination +ST IT +em y +Ġfunction ality +auth ors +title s +Ġmo tion +Ġad apter +fil ing +gener ation +ĠDe velopment +FL Z +report s +åº ı +Ġinte gr +011100 11111111 +curr ing +Ġlon ger +ç® Ĺ +Ġsimp ly +A CTION +h ave +j it +s ystems +} +) | +B Box +G REEN +N I +P erson +h al +l bl +r ubi +t ang +w f +Ī ĺ +Ġre wards +li ding +Ġm n +pp ath +Ġh aving +ub er +res olver +Ġst s +ĠD ummy +oun try +Ġos lo +Ġpre tty +eri o +34 3 +27 4 +Ġsub parsers +26 3 +vis a +ateg ies +AD ATA +cre ator +ĠSe curity +101 01000000 +Ġdb c +cluster ing +dec rypt +Ġloc ale +Ġ"_ " +Ġglob als +éĢ ļ +Ġfra c +Search CV +Ġhand lers +tw itter +ĠOUT PUT +ĠDAM AGE +1011111111 11 +Spe ci +COMM AND +THRES HOLD +Snap List +ĠPOSS IBILITY +ĠINCIDENT AL +! ' ++ ", +M AT +R aises +Z ero +b rand +c amp +f out +s mo +t Session +w G +y t +ĠĠ ĊĠĠĠ +in spection +st rength +un tracked +th umbnail +con struction +ab o +10 11111111111111111 +lab s +SE D +index ed +Ġne arest +44 7 +Ac celerated +stat uses +Ġcontin uous +MO VE +Ġvis it +alle st +ynam ics +noti fications +CR Y +Ġlat itude +Ġsav ing +joint s +Ġnumer ical +cons istent +('.') [ +adapt ation +ĠINT ERRU +MED IA +ParseTree Listener +Ġgd al +TRUST SEC +SETT INGS +ĠADV ISED +7 00 +A fter +H U +L ES +M ARK +S ig +_ | +g iven +Å Ĥ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +on ential +re cursive +me as +Ġp ys +Ġp ay +ce eded +un a +Ġ1 03 +ul us +Ġr ubi +}, { +ĠU sage +Ġ6 9 +back bone +Ġspe aker +Ex periment +Ar ch +cent roid +Ch g +wh at +ren ce +Ġiniti alizer +âĢį ðŁĴ +Ġexec utor +xx x +Up load +Ġtri m +vers al +month s +trace back +ĠAd min +Ġtick er +analy ze +Ġresid ual +ĠSU CH +interpol ate +Modi fied +ĠSTR ICT +å» º ++ - +G radient +T BinaryProtocol +] | +u zz +v V +à ´ +æ ± +in ventory +or i +me mo +ort ho +Ġre ally +() - +ri cal +Ġg as +Ġg ating +pro files +app ings +add resses +ĠB ad +ĠB USINESS +ĠN eed +read Field +read Struct +url lib +Ġ/ > +ðŁ ļ +write Struct +27 8 +24 3 +Ġno va +00000000 0 +Ġmo vie +Ġad ds +Ġ& & +she ets +Tra de +Tra ce +åı ª +Inter nal +Al gorithm +Ġcluster ing +leg al +æĪ ij +ĠTensor Flow +Const ants +Ġbutton s +Ġ"{} " +WE VER +ament e +mq tt +ĠHO WEVER +LANG U +Ġregard ing +communic ate +CONTAIN ER +ARR AY +ĠINTERRU PTION +TBinaryProtocol Accelerated +B alance +F e +F old +G IT +P atient +X R +[ [' +f ort +g oto +} % +} )) +Ġ aria +Ġt gt +an on +Ġc art +Ġf amily +Ġs atellite +un t +Ġimport ed +Ġfor ecast +ĠS DK +ĠC ent +ĠF ast +log ic +ĠP AR +Ġde precated +time steps +ĊĠ ĉ +are as +In formation +Ġkey board +ĠCon s +95 4 +... , +TR ANS +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +database s +Token Kind +cla use +ĠEX EMPL +USER NAME +stock s +Ġclose st +============ == +sal es +ENS OR +Ġpur poses +Ġindi cating +('/') [- +ĠSUB STITUTE +Ġlarg er +ĠPROC UREMENT +ĠGOO DS +ĠEXEMPL ARY +, )), +D OTA +F un +G iven +T D +X y +\ . +c ite +d uplicate +h ierarchy +r df +é ĺ +Ġ ht +Ġ licenses +in voke +at tle +de ck +us b +con j +ĠS ent +sp ot +vi ties +ĠP ack +Ġse aborn +Ġma gnitude +AT TRIBUT +min i +Ġpy mongo +db s +84 7 +List Response +File Path +Ġseri alize +ĠTHE ORY +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +PAT CH +Com ment +pr incipal +ĠNo tes +ĠCreate s +BU CKET +AA A +ret ch +Graph ics +arti fact +å½ ĵ +flu id +A udio +B W +B us +F ra +M achine +O ct +R PC +T issue +U AV +b ing +m omentum +s low +å ĵ +é ľ +en tion +Ġt c +ro unds +Ġa u +ra cle +'] ]) +ĠP ATH +ĠD ocker +IN ET +Ċĉ Ċĉ +ĠN E +fo x +St ar +AN Y +22 8 +comp ose +(( ( +AS ES +97 4 +26 8 +23 0 +Ġmin ute +PO CH +Sp an +drop na +Gener ating +velo pe +tuple s +Ip Address +9999 9999 +æĺ¯ åIJ¦ +ima genet +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġhist ogram +Sele cted +############################################################################ ## +Exec utor +Ġcomm unic +Ġcer tificate +sci py +Ġfri ends +ĠCA USED +shm allow +) # +C ross +I ds +M V +b k +d D +e ved +g ates +h cp +r V +s and +æ ¸ +re ceived +ti con +Ġo l +Ġd er +Ġ1 25 +el t +Ġreturn ing +con version +ĠC ir +ĠF igure +od o +sc roll +ĠP ower +=' # +Ġst udy +im ate +ac s +min us +ml in +Ġcur rency +44 8 +Se cond +35 3 +Ġsk ills +Ġar row +over write +gr p +CE LL +ĠCh rome +ĠMe an +Qt Widgets +POS ITION +1234 56 +Fin ished +Bot tom +cdbp PeerStats +webs ocket +ĠSERV ICES +6 04 +@ @ +N ull +d pi +d ust +d na +f ers +h an +p z +p itch +w ins +¸ ółģ¿ +al go +() ( +ri a +Ġw heel +(' // +Ġto do +Ġ7 8 +ĠS ize +") ( +") }, +Ġas pect +ĠL i +key board +Ġy es +"] / +ir ing +Ġout side +Ġpo ss +Ġno me +Ġdis p +Ġtrans ition +top ology +Th ing +Ġtmp dir +domain s +ĠMibTable Row +Ġhandle s +Ġconf usion +Ġdat aloader +sn mp +pn m +Ġcop ied +è® ¾ +ĠExt ension +VAR I +iso format +WR ITE +ENS ION +ĠSum mary +Ġamp litude +. ''' +B IT +J Z +N v +c ros +d nn +m h +w k +y an +Ġ qual +ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +on ic +re ceiver +st ub +al ter +Ġo thers +fi df +di ce +ĠT EXT +con trast +ĠS ensor +ht ag +Ġg zip +Re vision +Ġget opt +32 3 +Con tour +37 9 +Ġcom ma +av ed +iv ot +Ġz order +Ex pected +response s +DI ST +ĠÐ ¼ +ERS ON +dist s +и Ñģ +Ġloc ated +Ġ$ { +sql alchemy +factor s +ĠApp le +Ġlong itude +Ġtick s +pla ces +ĠCO MM +OPT ION +æł ¼ +king dom +Ġcomm unity +Ġcdbp PeerStats +ĠUni code +Ġadj ac +Ġali ases +Ġck pt +G W +G AN +l h +m irror +s am +å Ł +re di +se x +Ġt or +al hes +ti vely +Ġc x +Ġc id +Ġc as +Ġc nn +Ġc andidates +Ġn lp +Ġs po +Ġin file +Ġre ceive +Ġd uplicates +li ver +Ġm iddle +Ġe igen +Ġb p +Ġb roadcast +Ġ1 12 +Ġ( : +set attr +ĠA M +ĠA SC +list ing +Re LU +Ġv min +ens ive +07 4 +ĠB O +dir path +ĠV n +St d +Ġ8 2 +Ġne ar +Ġlo s +trans ition +Ġli ve +Ac tivation +Ġload s +TR AP +Message Route +rand range +åı · +inte gration +Ġtrack er +mut ations +Que st +éĩ Į +ĠMo ve +ners hip +press ure +Temp erature +~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~ +Ġinterpol ate +Ġaz ure +ółĢ² ółģ¿ +Realm MessageRoute +opens ource +è¿Ķ åĽŀ +MANAG ER +6 26 +B P +P ol +U Y +] }) +c L +f lex +m v +å ģ +ti ca +Ġp ants +Ġs z +Ġd l +ot hed +Ġ+ ' +(' * +)) ( +pp ers +Ġg ives +Ġr t +==== === +log ies +ĠL td +oc ê +ĠG UI +Ġk ivy +Ġ6 2 +gra ma +08 8 +22 1 +95 8 +Ġ8 3 +66 7 +CH O +46 5 +Get s +part ner +å¤ ļ +render er +interval s +End point +Ġreplace ment +IZ ED +Ġdepend ency +ĠSQL Alchemy +CLASS ES +Temp orary +éĻ ¤ +æŃ £ +âĸijâĸij âĸijâĸij +dem isto +Cho ice +çĶŁ æĪIJ +ĠFail ure +! ", +A p +B lob +C er +D CC +D ummy +E lect +G reen +G PIO +M G +M ass +R ON +S aving +W hat +b ur +i als +k ely +v f +v cf +v tk +² ółģ¿ +Ú © +é ļ +in str +Ġre ceiver +Ġm ime +Ġ1 34 +arg min +'] ]. +Ġh um +Ġh ypothesis +Ġde ck +Ġse ctions +ĠRe cord +Ġno se +56 8 +pri v +ä¸ ī +cp us +Ġiter ator +na ive +Ġdir name +spect ra +exc iting +Ġclean up +Ġmonth s +Ġsepar ator +Ġbegin ning +disc ord +Ġvol tage +íķ ľ +Ġsen se +åĨ ħ +ĠRedistri bution +Connect or +A sync +B H +B RO +D g +O h +P ING +X q +c ampaign +Ġ life +re ach +Ġt tk +le ars +Ġi ms +Ġc rit +Ġs up +Ġd ry +': {' +str y +con tra +ĠS end +ĠS ec +ĠC S +od d +po sed +ĠP layer +ĠP lugin +tri m +ho ver +25 8 +ax ies +Ġal gorithms +Ġpre processing +Ġ/ * +Ġ[] : +comp ression +ID GE +27 3 +Ġac tiv +Ġac counts +row th +Ġmin i +Ac curacy +35 8 +Ġim gs +Ġ201 0 +vid ing +dic ion +dic ates +1011 0011 +Ġnetwork s +gre y +SO URCE +ĠXXXX X +л и +super visor +è® ¡ +erm ine +UNK NOWN +Ġten ant +Ow ner +ç¨ ĭ +redd it +) +" +/ %( +C ut +D ES +E Q +O ther +T ab +W ER +p aper +v y +Ñ İ +ç © +Ġt ransport +mp eg +Ġf requ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠ +ction al +ĠS uccess +Ġr ather +ĠF rom +ac p +load txt +ĠE lement +loc ate +da o +we apon +Ġdi e +Ġ` `` +Ġmin or +UR ES +pri mitive +Tra ined +Th ings +оР± +Group s +ä» ĸ +Dis k +BO OL +ä½ ł +Ġpad y +elect ron +Wh ite +Ġmis c +aur ant +Ġmac ro +inher ited +ĠFrame work +Ġzo om +B SD +C r +D NA +R i +T ry +V y +d v +d ers +p res +u tions +Ġ lot +Ġi ss +Ġs ing +is er +Ġ7 1 +ĠC lean +ĠC luster +ke mon +ĠE qu +ĠE DIT +ĠR ender +04 6 +ST OR +Ġra ster +22 3 +sk top +ĠK iss +view er +26 0 +Ġfunction al +ET ERS +LO BAL +ĠPro duction +Ġstri ct +fr uit +Row s +REG EX +Ġspecify ing +bra cket +Initi al +Ġdeploy ment +ĠPass word +emo ji +Tok ens +G g +O U +O UR +T K +T urn +U DE +Y es +] > +_ {}'. +_ {}. +h ack +r ms +t gt +w W +z Z +¦ ¬ +Ø Ń +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +in der +on nx +st udy +en n +um ing +#### ### +Ġ7 4 +ĠS M +Ġth ickness +ex pires +Ġy min +[" _ +ĠB io +col lector +ĠU RI +SE CON +cs rf +LE ASE +RE GI +ĠRe quired +{} > +AG G +Ġcheck ed +44 5 +Ac comp +Ġcan onical +vis ual +Ar ti +Ġspeci fies +dire cted +Ġauth ors +Ġtop ics +оР³ +Ġoptim ize +н Ñĭ +inst alled +Ġvis ual +ä» £ +10000 0 +åIJ Ī +fetch one +depend ency +éĢ ī +Ġprob ably +mis match +ĠAss ertionError +HEAD ERS +ĠIs land +Role Assignment +ĠHow ever +BIN ARY +Ġsever al ++ ] +4 16 +9 10 +P ur +b ol +b idden +f P +n di +p key +z W +} ` +å ķ +re load +de mand +le e +le ave +me ss +Ġd ense +Ġe quivalent +la x +Ġw b +ch rome +ch allenge +ĠS ur +ĠC lose +Ġr f +01 00000000 +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ +ĠI Python +sh p +Ġse m +Ġco v +RE DIS +Ġwe apon +Ġsub scription +57 5 +Ġ[' -- +IM G +AP PS +check points +of ficial +Test ing +ear th +Lo okup +block ed +fir med +čĊčĊ ĠĠ +Ġeval uator +äº Į +ĠEn ter +Ġnoti fications +ĠMan agement +ĠPo licy +uplic ated +Ġfast er +OB J +Ġplace holder +("/ ") +Dire ction +ĠXXXXXXXX XXXXXXXXXXXXXXXX +pret ty +bul let +Cre ation +Ans wer +æ® µ +naps ack +: # +H AL +S Z +U uid +W AY +b or +f an +g id +g rouped +j d +p seudo +s lack +v ot +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +se crets +al phabet +Ġp sy +Ġf ully +Ġa ffect +Ġn om +Ġs ound +Ġin verse +Ġre name +Ġd ark +un ded +Ġm ne +ri ent +and a +ul ations +is kit +data store +ult y +qu ent +ect ed +ĠB it +min ator +Ġk ill +64 0 +AN GO +net s +Ġ8 9 +trans itions +ud nn +ng r +Ġfeat ur +CA LE +can onical +Ġ---------------------------------------------------------------- ------------- +Min imum +MET ADATA +ĠEN G +poly gon +lishe s +ĠCont ent +Main Window +ĠAnal y +pay able +suc c +ĠRES ULT +PLUG IN +7 85 +; " +B AD +C Z +F bx +G i +H g +L ONG +Q a +S rc +T ail +U i +i et +u ario +on omy +en k +ar ound +de limiter +ti vities +Ġ" \\ +Ġ" ../ +Ġin coming +)) /( +th rough +Ġg p +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ +am er +to ggle +ĠD IR +čĊ ĠĠ +model ing +fo oter +ĠU I +ĠU TF +sa vet +lt as +84 4 +24 2 +AG IC +Ġtext wrap +so ftware +({ }, +ĠCo uple +Sh ort +RES ET +Request s +Ġph oto +For ce +PR ITE +af ari +fill na +Ġ"- " +spect rum +termin ate +к а +ĠIter ator +çĽ ¸ +LOC ATION +Document s +ĠTra ck +Ġanaly ze +TEXT URE +Dep th +00001111 00001111 +ĠSign al +^^^^ ^^^^ +Ġcum ulative +ĠAns ible +éľ Ģ +ĠENG INE ++ ". +1 000000 +E F +F eed +H ot +M i +O k +P arent +b link +c w +c bar +f X +g uest +n os +s chool +t re +x B +x iv +Ġ ES +in dividual +re cogn +st ress +Ġi ma +Ġc ategorical +lo ve +Ġo ct +Ġd ag +Ġm or +Ġm se +Ġm scModVcs +Ġw arm +di vision +and b +ĠS chedule +Ġdef er +Ġg rids +ĠA gent +vi er +=' ?', +ex er +Ġy label +ER ATION +ĠB etween +Ġres olved +Ġun ion +ĠW ait +Con dition +Ġrange s +Ġsc oring +55 8 +Ġindex ing +dire ctories +Ġup loaded +Ġcor relation +ðŁı´ółģ ®ółģ +ie ve +bl ank +PAT TERN +fit ness +Ġhead ing +=_ (" +radi ents +202 2 +Qu anti +Check point +Norm alize +Ġfast api +Ġfactor s +Ġplugin s +free ze +ä¾ ĭ +æŃ ¤ +ali ases +separ ator +Util ity +Ġinher it +277 47 +# @ +E LL +J P +S ql +S ync +d raft +e h +v ic +w ill +x D +z m +ç ħ +Ġt ape +Ġm orph +Ġ# ------------------------------------------------ +Ġ( ? +"" . +__ [ +set ta +Ġ2 05 +as pect +om aly +čĊ ĠĠĠĠĠĠ +ci ties +AT OM +sa mp +25 3 +ĠRe cognition +09 4 +Ġno inspection +Par allel +... ) +De code +ðŁı´ółģ ²ółģ +String IO +User name +Ġman agement +QU EST +Ġoffset s +dat atype +gre di +ĠBo ok +period s +Ġrep lic +ĠSp lit +Can vas +Ġasc ending +Ġdem isto +A ctions +B V +C a +F requency +H DR +I ssue +R t +b es +f olds +j x +y i + ² +Ð ³ +Ġ ub +at ures +st pid +Ġi b +Ġi l +Ġ" ), +Ġre ach +", ' +co pg +Ġb old +Ġr d +qu ick +Ġh its +ĠM IN +ĠM agicMock +Ġv oucher +ĠN v +ind x +ĠG ET +Ġclass Name +reg ressor +44 4 +vis ibility +47 6 +order ing +vid ence +Ġback up +dic ators +Ġdep ending +Ġkeep dims +click ed +ĠName d +Read ing +IST S +ółĢ° ółģ¿ +plan es +Ġcombin ation +Sample s +ĠEng lish +ĠNorm alize +Ġexact ly +Head ers +aggreg ate +autog rad +' ") +E POCH +G rp +H ist +M s +M ngr +N x +X V +_ '+ +c us +c rt +f esc +n ct +s x +Ø ¨ +er ry +re ceive +Ġ= ', +st pnm +Ġp atches +Ġn cols +ut ral +Ġo sp +is a +il ton +ĠP DF +Re set +Ġy max +mple ments +ĠB ASE +train able +ne ar +Ġle af +iv ing +cal lable +pop up +ĠOR DER +norm alizer +cent ration +ãģ Ł +Path s +Ġback ward +ãĤ ¤ +Ġobtain ed +Ġabs l +Ġsa mpler +Ġnetwork x +Te am +åIJ Į +Ġpad x +à® ķ +Ġfree ze +Ġpoly gon +Av ailable +Ġsy mpy +Wor ld +dri vers +ĠBytes IO +' ve +' +' +B eta +F etch +H UB +M W +e ma +f ar +k h +m or +n ft +p or +w sgi +Ġ ens +ľ ë +er al +ti cket +Ġd os +ra s +ri al +Ġb rightness +arg types +Ġh f +all ery +Ġex change +ĠD ropout +os ome +ap se +Ġj sgParser +ĠR ule +ĠR ULE +Ġlog ged +Ġco me +Ġch ord +Ġsh ader +ĠCon tract +lat ent +00000000 000 +Ġext ended +Ġper formed +ĠQ uest +norm als +vo tes +Cont rols +Ġman ually +author ization +dat al +contain ers +sen timent +Per f +cap s ++" / +Ġ---------------------------------------------------------------- ---------------- +Ġlook ing +å¼ ł +BUT TON +Ġidenti fy +čĊĠĠĠĠĠĠĠĠ čĊĠĠĠ +effici ent +Stat istics +pas sed +Arg Mngr +sb j +........ ........ +ĠOp ArgMngr +Su ite +ê¸ ° +H ex +O J +Q CA +d H +m otor +q i +s ink +u á» +v it +É Ľ +æ ĥ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġc ancel +Ġp ie +Ġ" ^ +it r +Ġre store +un link +Ġe mb +Ġ1 22 +Ġ1 21 +Ġ{ \ +sp awn +Ġu gettext +]) / +os id +AT TT +ĠN or +Ġun signed +Ġlist en +Ġro les +cept ual +Ġal ter +AN AL +(( - +Ġpo inter +au li +Ġne ural +check er +ĠTest s +DIR S +Ġ.. .. +duce d +fin der +Ġsend ing +cap it +############ # +seri alized +dr ug +rest ype +va e +åĬ ¡ +å° Ĩ +ı n +Ġinte gration +ĠST ART +Ġlon gest +éĻ IJ +åĨ Ļ +иР¼ +Ab stract +cum sum +Child ren +ĠEd ge +!!!! !!!! +ĠDire ctory +shelf Idx +ĠFa iled +áĥIJ áĥ +B est +I LED +S ent +a max +n om +s lide +s lider +v lan +y olo +Ġ ĊĊ +in sum +or al +re cent +Ġi x +Ġf all +Ġf ac +he et +ut s +Ġre cur +Ġm al +ch k +Ġ[ {} +ve hicle +ĠC ore +Ġ: = +vi r +ĠP os +=' ./ +pro x +ac tiv +ĠM L +nt he +Ġpro g +tri bution +che m +min s +Ġch apter +27 0 +av as +Ġdis count +cor ners +obj Prop +UR ITY +Ġgener ating +DO C +Ġseri alizers +âĸ Ĵ +over lay +PU BL +Pri ority +success ful +Ġcore hq +ĠTrans action +semb le +wav es +ced ure +week day +Left Overhang +Dete ctor +XY Z +Thing Producer +savet xt +3 11 +3 13 +4 19 +5 64 +6 02 +> { +A ug +A tom +H i +R ST +V P +g un +} ], +å ĥ +Ġc au +Ġn c +sel ines +Ġo mega +fi o +Ġ1 07 +Ġ1 26 +Ġ1 35 +te ll +set Formatter +Ġ7 9 +Ġcon ver +ser if +ĠP ur +pro ba +Ġex periments +ĊĠ ĊĠĠĠ +Ġpar agraph +ĠW ill +Ġpy dantic +34 2 +09 8 +Ġtext ure +Log ging +Ġman ual +Ġlib s +Of Things +оР¼ +Ġclo sing +ee k +comm unity +à® ª +EE E +Ġreplace d +ĠFunction s +ĠField Panel +Go ogle +Ne g +equ als +bri ef +ĠOp tim +SAM PLE +Ġwi res +Ġproper ly +âĢįâĿ¤ï¸ı âĢįðŁĴ +ĠTree Node +Ġci pher +GAM UT +ĠTransl ators +ĠFIX ME +âĢįâĿ¤ï¸ıâĢįðŁĴ ĭ +: ])) +; ', +A ctor +A FF +B lack +C apture +E cho +G U +H ASH +R B +V OL +c z +d O +e ti +m oment +v oter +x W +at tempt +re presentation +de termin +ti g +Ġf f +Ġs pread +Ġre duction +ing redi +Ġd aily +Ġe mo +Ġw f +Ġw avelength +def ines +ĊĊ ĠĠĠĠĊĠĠĠ +set ype +th ro +pp o +pp rint +ĠC opy +sc orer +vi es +ĠL ED +ĠM atch +ĠM ust +Ċĉĉ Ċ +Ġj inja +oc p +Ġ5 000 +ne e +ĠRe quires +mat rices +Ġwe ather +24 57 +Ġser vers +mark up +82 17 +sv m +ãģ ¯ +eval s +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ãĤ ¯ +Sh ift +Ġnoti fy +Ġsplit s +ĠLe arning +Ġopt parse +document ation +аР· +BO X +Ġtrack ing +zy AclV +à° ¿ +volume s +Ġcorrespon ds +Ġlat ent +bus iness +åº ĵ +cert s +Wh en +differ ent +ê n +âĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮâĶĮ +æĮ ĩ +Ġflo or +brain visa +Ġflu id +EMPT Y +VIE W +reion mod +) ]. +3 000 +E s +G round +H G +L W +S OL +c D +e uler +v F +v b +Ø ¬ +æ ¡ +é ĥ +é ķ +Ġ ------ +in n +er ation +on der +le et +an ies +Ġc trl +Ġp f +Ġf b +Ġn úmero +Ġs lices +Ġre shape +Ġw raps +__ ", +str ate +Ġg g +": { +Ġcon current +om b +Ġde clar +======== === +read ing +ĠV Base +ĠV ideo +25 2 +iti vity +34 0 +Ġjson string +44 6 +clo uds +so lid +err no +mer ic +Loc List +sim ilar +Ġvis ible +Ġsecond ary +Ġdebug ging +ÃŃ do +Cal lable +reduce d +crop ped +Ġvo ice +INTER VAL +FUN CTION +omin ator +ìĹ IJ +Uns upported +éĽ Ĩ +Ġstand ardi +ALLOW ED +ĠIE Core +3 16 +4 77 +7 36 +G it +M Q +M ASK +W ords +p q +Û ģ +ì ľ +Ĥ ¬ +Ġc bar +Ġf ine +it able +pe s +ra da +co g +Ġto k +ĠA BC +qu id +ĠP ub +ĠL et +im als +app a +ER N +Ġme mo +ĠN ational +ĠR ot +Ġen vi +100 101 +ari os +([ ], +ĠRe lease +mat ic +ast e +Ġ` { +Pro b +Ġdo ctest +Ġend points +ĠJ OIN +head s +ãģ ª +ERS ION +uni If +Com bin +BO SE +Tag s +ĠTo ol +IZ ATION +Ġtick et +л Ñı +ĠDo main +sess ment +squ ares +attach ment +ол ÑĮ +LABEL S +dispatch er +quis ition +Ġled ger +NORM AL +avas cript +OfThings Producer +C li +F ER +H azard +V X +c nbtc +n rows +u er +Ġ entropy +Ġt rees +Ġ' & +Ġa way +Ġs lug +Ġm appings +di alect +Ġto po +con ver +sp rite +ist ical +ĠP lay +ĠL ast +]) ]) +Re moved +ĠM ode +ĠM ultiple +Ċĉĉ ĠĠĠ +"] ): +ir y +Con verter +06 8 +sub s +Pro blem +Ġdf s +sent ropy +Test Model +PE G +sign up +ðŁı´ółģ «ółģ +ĠException s +Max imum +ik a +itor ies +Check er +Fil ters +parti tions +Di ag +Cal culate +Ġhand led +Ġgra ds +WE IGHT +çĶ¨ æĪ· +ä¿ Ŀ +Ġspect ra +æĿ ¥ +coeff s +interpol ation +è§ £ +Ġhapp en +nost ic +Pub lish +AUT O +inning ThingProducer +- ' +C ri +G as +K S +P lay +P ERSON +S an +S up +T EX +i mag +n T +n ational +p ulse +u ss +w raps +ª ółģ +at tempts +st re +ar b +Ġs lack +Ġm illi +co dings +11 66 +int ext +Ġ( . +from string +"" ) +ĠS ort +ĠS PRITE +Ġr m +Ġl xml +Ġ: - +Ġth ing +Ġth ink +02 57 +ĠB ut +oc ore +SE ARCH +Ġint ro +Ġat ual +pi ct +inter net +Ġare as +IS H +do es +UR ATION +sent s +ĠJ an +util ity +а ÑĢ +čĊĉĉ čĊĉ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +Com mit +ĠDe ep +si vely +ĠCh annel +win ner +'} }, +ĠURL s +Ġclick ed +Ġassign ments +POINT ER +utor ial +sn ake +Ġfo od +analy zer +cycle s +Ġcontribut or +Ġcompat ible +Ġfold ers +ĠDistri buted +ĠRet rieve +PRI V +çº ¿ +HAL F +( {}) ++ "\ +6 55 +C ounts +E g +I LL +Y Z +b ib +k Z +q ty +v il +v min +x z +y aw +¦ ółģ +Æ ° +Ġ × +Ġ ################################################ +en crypt +Ġt v +Ġi ou +Ġ' | +ro uting +Ġc sr +', ) +Ġs ystems +Ġin c +co vid +Ġimport ant +Ġto wer +Ġg radients +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ +Ġh ouse +=' %( +Ġde cla +Re ceived +Ġme l +ĠE nsure +ĠR EST +Ġlog file +Ġco ef +��py tz +ass oci +cs r +ðŁ Ļ +ĠIn formation +Ġcomp ressed +94 4 +clu ding +85 8 +ĠUn its +Ġdescri be +assert Raises +The ta +Ġcor r +Ġpri m +play list +Ġ', '. +и Ñı +pen alty +Ġbu y +оРº +dec ision +ĠNOT ICE +GR APH +è¯ ķ +mag ent +xF D +Ph one +Struct ure +Ġve h +ÃŃ vel +Stream Handler +Ġface color +slot Idx +BR IDGE +disc re +mg mt +sol ar +204 8 +equ ipment +æ¯ ı +ĠDown load +Ġevalu ated +baz el +4 33 +D UM +L STM +S HE +T U +T ol +g ender +p ct +p alette +v gg +} - +é ĥ½ +Ġc ert +Ġp ow +Ġp seudo +lo ops +Ġ1 14 +ot strap +Ġto ggle +us al +ĠS G +Ġg rouped +ĠA z +ser t +Ġh lp +Ġh params +Ġst ores +pro filer +Re quire +ĠE ner +oc al +lib raries +Ġob served +LE AN +Ġsc atter +aliz able +Ġ} } +Ġcont rollers +trans formation +cor der +35 4 +atter y +Ġ9 1 +wait ing +yp ical +Ġdescri bed +UL ES +Config Parser +graph ics +"]) . +tensor board +Ġ". " +Create s +Ġwant ed +Ġskip ped +ĠXXXXXXXX X +Element Tree +UST ER +ä¹ ĭ +Ġpol l +Web Kit +Ġpla ces +Fin der +Extra ct +é¡ µ +Ġinher ited +ĠRout e +corre ction +Forest Classifier +) % +3 56 +A ut +J S +K HTML +M agicMock +O z +X i +d ap +f all +f ingerprint +m ob +r ates +s ns +x r +Û Ĵ +Ġ à +at tn +en hum +Ġt cp +al a +ro ut +it ations +Ġn an +Ġm oment +urn ament +Ġ+ " +is ing +ve x +ĠS an +ĠS tack +ĠA li +put Text +ĠP ol +Ġde g +=" < +ĠO ct +Ġx max +ĠR ob +EN C +ĠV ERSION +ST ORE +plot ting +ĠH andle +sub dir +Data Type +color ed +Co ord +101 011 +Ġsk ill +46 7 +ĠJ ust +off line +Ġfilter ing +ĠMe asurement +button s +Be am +SH AR +Ġcorrespon d +CM D +(? : +RA W +retri es +Ġbul k +æĶ ¹ +Ġcoeffici ent +BatchNorm alization +éĤ £ +SIM PLE +Sta mp +' ; +F ULL +G TT +H a +O j +Q n +Q ual +S cope +T MP +W o +d N +h ass +l k +n ight +y c +Ð ¶ +Ø ³ +å ¢ +æ £ +æ ² +Ċ ĊĠĠĠĠĠĠĠĠĠ +re comm +re cognition +Ġt l +Ġn t +Ġd om +pe ts +Ġe mit +Ġ1 17 +ĠS cript +ĠS ince +ig ate +Ġr sp +ĠA da +'] }, +ub es +Ġpro ps +ob servations +ĠN orth +Ġget pass +32 2 +per ms +ST EM +index er +gra ds +RE Q +ĠH as +34 9 +Ġcomp ress +Ġtry ing +Ġdate util +Ġend orse +check sum +Ġus d +Ġmo ves +nn nn +not s +ãģ Į +ca o +ĠÐ ± +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ +Ġfla vor +Ġfollow s +prefix es +012 34 +report File +ĠZ ero +Ġjob lib +sen ce +eff ective +ĠEX ISTS +è¿ ĩ +Ġhigh light +Ġpop ulate +<< << +ا ÙĦ +ĠST AT +Ġsen timent +WA IT +âŀĸâŀĸ âŀĸâŀĸ +Rsp Tx +Rsp Rx +Ġwebs ite +å¥ ½ +ĠCre ating +ĠCer tain +Ġprom ote +IGNORE CASE +çħ § +% . +5 85 +5 86 +A IS +G ra +H S +H ERS +N Y +P atch +R atio +S n +U r +Z one +[ ~ +b an +k u +m I +n ut +t bl +Å ¡ +Ï ĥ +é » +de grees +mp ath +it ches +Ġa o +Ġs park +li ps +co ins +Ġ1 24 +Ġ1 95 +ma ch +__ ', +ĠS ystems +ĠA CL +Ġh i +ĠP ackage +time line +Ġos g +ans ible +ĠG en +AR GS +Ġhe art +ag ue +Ġint ensity +CT IONS +mi xed +23 1 +=( - +En coding +bs d +du ces +block ing +а Ñģ +No ise +ĠPar ser +roll ment +оР½ +Ġtransform er +cel ery +Sub ject +Ġans wers +è¯ ¥ +Ġpe sso +ĠGe o +Ġarti facts +Menu Item +ĠMO DEL +Cap acity +Cons umption +âĸĪâĸĪâķ ij +nost ics +ĠComple x +Dim ension +ĠAT TR +Ġzy AclV +STOR AGE +åĥ ı +# : +) [- +? ' +A udit +F X +G w +M ay +R D +T V +f ps +f utures +g is +g ons +m il +m illi +s ix +v DataFrame +Ê · +ì ĸ +de leg +le ast +me asurement +ro bust +Ġp at +Ġp bar +Ġs sl +Ġd rive +Ġm ult +rom ium +id ata +Ġ[ (" +(" :") +ĠS afari +ĠP rop +ĠI I +Ġde coded +sh if +ĠG EN +we ak +UT ION +88 4 +AM A +exp iration +97 45 +{} : +__( * +LO Y +Se par +PO OL +ĠPy Torch +FA ILED +Ġtensor board +LI GHT +Of FirstFixedSurface +Def ine +serv ing +åĪ « +Ġshow s +Ġmock ed +bit rary +FO UND +Pre dict +Pre diction +rad ar +ĠConfig Parser +dete ctions +Ġow nership +å° ± +pla ys +MET R +Ġaccept ed +Project s +Ġè İ·åıĸ +Ġvocab ulary +Ġrelation ship +Plus Tail +( = +) ': ++ ( +: ( +B ro +B irth +C AT +C ancel +H N +O I +S lice +[ (' +b boxes +c ifar +j alan +m obile +v j +é ª +al tern +ce ptr +Ġd m +ad b +ad as +Ġ1 000000 +Ġw ind +iz ations +ĠA L +ĠF it +Ġh ub +ĠL ang +sh ard +ĠM AC +ĠM PI +Ġor ient +ĠB eta +Ġres pect +Ġlist ed +Ġpy lab +config urations +RE TURN +08 4 +inter action +em i +()) [ +20 93 +the docs +Ġbase name +Ġclient s +OP EN +At tributes +fla vor +Ġedge color +rat ic +ä½ ĵ +âķ Ŀ +istic Regression +Ġcons ist +pla za +Ġconv olution +curs ion +room s +balance d +åĮ ħ +pas ses +comb ine +Poly gon +ॠĩ +ĠHel per +ìĦ ľ +unct uation +WIN DO +Ġtrust ee +gover nment +åı² éĢ² +ometri c +" < +4 096 +D r +N ac +N av +N DQ +P ayload +T w +V s +Y ES +f T +g if +h ue +p ron +č čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ rom +Ġ ĊĠĠĠĠĊĠĠĠ +ĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġt n +de clar +Ġ' ; +Ġs l +Ġo d +Ġo m +Ġ1 00000 +Ġ( {}) +ĠT k +ĠS at +") ): +Ġg uild +par sing +ĠP latform +time step +add Widget +ĠN T +ff e +ĠG u +ĠW H +max len +ĠH yper +ĠIn dependent +ĠCon sole +no vel +Ġper centile +trans formed +AB C +AD AP +PO MER +Ġspeci fication +call y +47 4 +Ġread able +29 1 +ĠPro blem +late x +ATE G +IP S +extra ction +App l +Ġvis ibility +åIJ ij +Mat ches +Pri mary +аРº +Cur ve +mut ex +GEN ER +Ġprop agate +åį ģ +ĠReg ion +decor ator +aur us +Right Overhang +cipi ents +ific ant +Ġcompat ibility +Ġrepe ated +replic a +çľ ĭ +Ġrecomm ended +Writ ing +ĠApple WebKit +POMER IUM +) // +3 17 +6 77 +8 02 +8 98 +B J +C UDA +D l +F g +H L +K x +P lan +R q +T aleParser +V B +i elds +o h +r ated +t st +Ì Ĩ +ĠĠ ĊĠĠĠĠĠĠĠ +re duction +al arm +Ġf ault +ur is +ss id +Ġw ins +ul s +set Index +con tacts +as a +et o +ĠS ygusParser +ĠC ap +ĠC RE +Ġh ack +ĠP open +ex periments +Ġ3 000 +ĠM DB +ĠN aN +Ġres ume +Ġtest ed +Ġal le +Ġ\ ' +011 101 +HE LP +LO S +Log Level +ĠSt ates +67 4 +ðŁı´ółģ µółģ +ðŁı´ółģ ©ółģ +ze ug +mode s +ãģ ¨ +cho ose +sw agger +CA LL +ba setype +ĊĊĊĊ ĊĊ +radi ans +Ġparent s +nb sp +аР² +Ġalign ed +Update d +dimension al +Ġidenti fiers +ĠRo om +transport s +contin uous +rich let +ĠTemp erature +Ġderiv ative +Chg Over +ceptr on +) """ +, . +/ _ +5 38 +R en +S olution +c j +c dot +k mer +m os +o x +Ä ĩ +Ï Ħ +ð IJ +or ator +re w +Ġi g +Ġc dot +Ġf irm +Ġs nap +Ġin tr +Ġo auth +li me +ri e +ri z +Ġb an +str at +(" * +et String +ĠC li +sp ital +log file +Ġh dr +pro viders +sh uff +oun ce +AT ORS +ĠR ange +read able +ST EPS +AN K +CT T +Ġopen ed +Ġne uron +Ġend ing +45 8 +Ġinter section +inal ity +101 00 +close st +TR AN +tribut ors +Sh ared +Ġ"" ", +Ġ$ $ +è¯ ¢ +Ġerr no +fail ures +Ġve hicle +Ġcir q +ĠAd am +ĉĉĉĉ ĉĉĉĉ +glob als +align ed +Sign ature +publish er +PROCESS ING +ĠUns igned +×Ļ × +uber ne +Ġfeatur ization +$ ") +, _ +? ") +B ERS +C y +G x +J I +P AGE +k r +n ss +r fc +Ġ ĊĊĠĠĠĠĠĠĠ +on sor +at an +st ations +en h +ar ith +ti e +Ġf tp +Ġn ick +ut r +ra ppers +Ġe pi +() ))) +ri os +int roduction +Ġ0 9 +(' '' +ve al +ĠA C +par a +ĠF UN +Ġh am +ĠL ength +Ġ""" \ +Ġv k +"] }, +ĠB C +len code +IT LE +aliz ations +55 4 +RO LE +default Check +Ġfil led +Co okie +auth enticated +pl ans +DO UT +struct ures +Le arning +req s +Ġ-------- ------ +ĠImport s +SH A +Ge o +mix ins +Ġpur pose +Render er +Dete ction +ctype s +inher it +THRES H +ĠLib rary +Ġwi fi +ĠFace book +Repository Apps +Ġexpl oration +Ġbro ken +ĠGrid SearchCV +Ent ropy +èĩª åĬ¨ +Annot ation +ĠEner gy +! ', +) }') +5 99 +5 22 +A pache +B EGIN +M ATCH +P Z +f u +l us +m outh +t abs +Ñ ī +Ġ Ãł +Ġt bl +al ways +Ġc atch +Ġp aginator +00 10111 +ur lopen +ss a +Ġin gredi +Ġre load +ad m +Ġb ash +ch apter +Ġ[ {" +ĠT ile +ĠS cheduler +==== = +ĠF low +Ġh ierarchy +ĠL ambda +0000 02 +sh ards +ĠM ET +load balancer +ĠW hat +cept s +Ġpre serve +([ ^ +sk ills +aliz es +Ġspe cs +Ġbo keh +75 8 +38 3 +Se quential +Str ings +UN IT +TR UE +limit ed +const s +Ġfind ing +Bo ost +ãĥ ª +Ġph y +ĠFor ward +Dis able +NE UT +Cur sor +Ġda mage +cred ential +segment ation +Ġpl us +Rout ine +=', ') +ĠAnal ysis +Ġorgan ization +Distri bution +ĠInst all +Ġrout ine +LANGU AGE +Accomp lishes +. + +. ')) +/ *. +6 01 +7 07 +> ') +E ffect +J y +R K +Z ip +b am +h or +i prot +t qdm +} ( +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ar xiv +ur s +Ġm f +ra do +Ġe ta +() / +(" // +Ġde velopment +Ġde serialize +out lier +ĠB ert +Ġget Rule +ĠR aw +32 9 +min der +cur tain +ST EP +03 1 +we i +Ġop acity +LE TED +Ġsh ip +Ġspe ak +ps f +stri ct +Ġpass ing +Ġsp ider +Ġrandom ly +Ch art +Ch unk +Ġplot ted +Ġass umed +WAR D +Ġsim ulate +des ired +report Error +Process Error +Ċĉĉĉĉĉĉ ĉĉĉ +noti ce +speci fied +Edit ar +Ġsegment ation +ä¿ ® +Ġenter ed +writ ten +Ġpla in +Tri gger +bon us +æĽ ´ +è· ¯ +ĠKe ys +may be +copi es +éľĢ è¦ģ +éª Į +setIndex Names +uberne tes +4 02 +8 000 +N W +O E +S CALE +U q +Y T +Z a +b en +f L +g le +g pc +h ape +p at +p url +r us +s om +s uggest +ë § +Ł © +in spect +er ce +er cise +on ts +st a +Ġt ornado +Ġp ing +Ġ" :" +ent o +co ol +Ġb ench +)) ): +Ġ2 011 +as numpy +ĠC ell +Ġl n +ĠA cc +ĠF ra +sc oring +qu otes +Ġth row +Ġ_ (" +IN S +"] ], +Ġ) ; +======== == +ph as +ire ctional +class Name +SE G +ax i +Ġat ualiz +sk i +Ġwe ak +map ped +Ġla zy +Ġdist inct +HE Y +Ġ| = +Se ss +iter rows +open ssl +tag ged +std dev +ĠSet ting +ĠAll Vars +mod ity +Ġmon go +UP LOAD +ĠMan ager +He alth +velo per +inte gr +Ġtrack ed +Ġembed ded +Ġprob abilities +============ === +Ġperiod s +ĠNe ither +Ġcred ential +Ġcos ine +ĠPh idget +Ġmeasure ments +INST ALL +Ġscra py +å¦Ĥ æŀľ +Help Formatter +CRY PT +ĠRecognition Exception +ĠgetRule Index +! ': +" [ +; +A x +C ountry +C lears +E ach +F amily +H ar +H ard +J O +L K +N gamma +P AY +Q Color +U Z +W M +X G +Y M +h ints +o sc +v ado +y scale +z ione +¹ ółģ +Î ¿ +ç ¦ +ç Ħ +Ġ ensemble +Ġt y +ri dd +Ġ# ' +Ġ[ _ +ot ed +is ol +Ġto pk +Ġ2 07 +(" ~ +(" ", +ĠS un +ĠS park +end a +sp ines +'] }) +99 3 +log it +ĠL ab +res olved +Ġfile Name +Ġj wt +dir ty +oc ation +tri angle +Ġpy spark +SE Q +][ : +37 2 +AL LED +AS IC +AS SI +Ġne cess +28 9 +30 92 +ĠSe ction +Ġinter sect +files ystem +Ġdire ctions +De coder +67 6 +EX AMPLE +Ġimp rove +Cont in +Ġrender ing +book s +meta class +tab ular +language s +Ġë ° +START ED +ni que +Ġda emon +ç» Ħ +Default s +Ġestim ated +wrap ped +cross ings +UST OM +Work flow +:::: :::: +Ġtak ing +Ġdiag onal +2013 0101 +DJ ANGO +ĠWor ker +vile ges +ĠExec ute +tStart Refresh +! ". +) ` +6 05 +A bs +B g +H eat +P ersist +T er +i y +i la +t g +re boot +Ġt iming +me ters +Ġ' ^ +Ġ' $', +Ġin ject +Ġre ceiv +Ġd ask +li fied +Ġb d +Ġ1 47 +Ġ( \ +Ġw erk +el s +__ : +ĠS ele +ĠC y +ĠC ost +for k +Ġcon trast +Ġde ad +Ġprint er +Ġx p +ys ics +ci pher +ĠN P +ĠR ate +ĠG R +ĠV al +SE ED +ec ause +Ġat tached +ast ic +Ġcomp uter +spe ak +mission ing +Ġinter active +Ġinter faces +gen re +gener alized +cat s +Ġquery set +ĠValue s +Message Box +OL S +åı ij +Ġextra ctor +0100 101 +seed s +Ġgover ned +ç o +cast or +BL END +bucket s +Ġclean ed +support s +contour s +FLO W +å¯ Ĩ +eng lish +pot ential +scra pe +identi fiers +occ up +ĠSci ence +Ġcorre ction +Pomerium Service +9214 0257 +CEL ERY +ĠMongo Client +F ACE +N orth +N enhum +Q N +T mp +_ * +_ () +_ (" +c en +c ab +o F +o e +t up +y outube +| ') +´ ë +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ íķ +de conv +an onymous +Ġp wd +ss ss +Ġo dd +ct ree +ra ster +ri g +ch ant +ol in +th res +str and +Ġ2 15 +ĠC ity +Ġg ather +Ġcon ven +vi ps +Ġh ide +ĠP lace +ĠL at +ub ble +Ġst ations +key points +Ġx label +Ġpro files +"] } +ob served +col late +OR IG +cur ate +85 94 +ron Dump +color map +35 1 +Ġcontain ed +Value Type +Ġim mediate +gin es +Ġtrans it +Ġar ticles +open cv +ĠPro tocol +link age +Ġprocess or +UM ENT +struct ured +Com m +Not None +Ġemail s +STR Y +ĠName Error +Ġdomain s +aff inity +è® ¤ +åĢ ĭ +Ho liday +Ġrestri cted +Factor s +Ġrect angle +Rest ri +Display String +Ġdetermin ed +webs ite +Ġboot strap +Pk ts +She ll +Ġsil ent +Origin al +ancest or +pC ronDump +assertIs NotNone +ĠQuest ion +HERS HEY +# . +) = +2 80 +7 05 +? " +A Q +A ck +B i +E st +I END +K C +K N +L u +P n +Z I +a W +b il +f ed +f use +m ibBuilder +n ia +r ss +s ma +x m +z ones +æ Ħ +è İ +Ġ Ñĩ +in et +re search +st ored +Ġt This +le aky +Ġc ad +Ġin s +Ġo ci +li x +pe m +ra us +import er +Ġdef ining +ĠA PP +type d +log ged +ĠL iteral +ac quire +Ġv oid +02 0 +Ġme di +Ġbe etle +ĠG ets +Ġco variance +ĠW atch +AR E +ST D +93 3 +ĠH o +comp uted +inter sect +no on +AL CHE +IM S +OT AL +28 64 +ĠQ U +pri se +ict ure +ĠEx pected +ĠEx periment +find ings +DO M +ãģ ¾ +vide s +Ġoper ators +Lay ers +1111111111111111 11111111 +Ġmig ration +MAP E +Ġgra b +cid r +Top ology +Vis itor +equ ation +ĠEvent s +Rel ation +Bl end +Ġut t +HI GH +uro pe +ENABLE D +TCL Script +Ġlit tle +dI HDR +123456 78 +ĠSty le +ĠtThis Flip +ALCHE MY +, ): +: ** +A z +F M +F ri +I Q +O pts +R ank +S at +T J +W rap +Y W +e os +o led +v w +Ġa pt +Ġe ye +() ` +Ġ1 41 +Ġ0 2 +val ia +(' __ +ĠT wo +Ġh ue +Ġde ci +Re p +ĠM ask +Ġstr and +py pi +pre fs +ap d +ĠB us +col lected +ĠR ect +ĠG T +ĠU S +Ġen cryption +IT OR +Ġtime it +ne utron +ðŁ ĺ +mat lab +AM PLES +Ġac company +33 1 +AS F +... ', +port al +45 17 +call er +Ġsk in +open stack +67 8 +Add ing +play ing +Com missioning +и е +Man ifest +Ġph rase +äº ¤ +Ġpost gres +Ġpack ed +åħ ¬ +åħ Ī +ĠCom ment +cost s +vari ants +xF E +Ġreport s +Ġfit ting +ĠSh ape +Cal led +SA VE +Ġchain s +WE B +plan ation +":[ ]," +ĠDate Time +adjust ed +udi es +çī ĩ +ĠMet adata +Ġ'* ' +OFF SET +Err Rx +æĸ¹ æ³ķ +QUE UE +æı IJ +wee py +Ġagree ments +>( < +Ġpsy copg +. : +. { +D x +D ST +F ix +M ore +R adi +S ol +T ermin +X r +X s +b anner +c raw +h om +i po +p ore +r hs +r fio +t as +w ho +½ æķ° +É Ķ +in fra +ar cs +Ġa k +Ġs ob +Ġin vert +ing dom +pe cts +Ġ1 85 +Ġ1 29 +int ensity +ch astic +il s +Ġ2 04 +ĠS te +ĠS outh +") ], +end ant +ĠA I +sp ike +99 2 +sc af +sc enes +qu bit +Ġth umbnail +im o +Ġprint s +Ġv p +IN ED +ĠE stim +text wrap +ep h +32 1 +Ġco in +EN CY +ĠW in +ST ANT +03 175 +:// { +:// /? +ĠRe set +inter active +als o +sum maries +man age +RI X +File Handler +Ar ticle +65 4 +ĠCON T +ĠAr ticle +Ġpri mitive +âĶ ¤ +bl ur +0101 0000 +Loc alized +Ġtri p +Ġsim ulator +optim izers +Ad j +PR IMIT +Ġret val +Pre cision +rat ings +Gener al +Check ing +Ġjo urnal +Ġsee ms +cm scaf +ĠCol lection +ठ° +ĠNum Py +éĢ ģ +Stream ALCARECOTkAl +Ġmig rate +Ġæ ī +super vised +Ġxml ns +åĩ ½æķ° +aff e +Ġcent ers +prec ation +members hip +ĠGraph QL +åİ ĭ +ä¼ ļ +ç§ ° +åij ¨ +COLUM N +Pack et +writeField End +writeField Begin +Ġgu ar +Ġoccur red +ĠWor ld +Inser ted +Ġcook ies +svc Class +StreamALCARECOTkAl Cosmics +" * +) /< +C lip +D s +D if +G ATE +G MT +H and +M al +M icro +N y +O Z +R ad +V l +X S +b ps +d B +f del +g pl +h up +h ighest +l ng +l strip +m ri +t ml +³ ółĢ +· ółģ +-- ') +he ll +00 9 +Ġd types +Ġb f +__ )), +Ġ2 14 +Ġg y +am in +om ic +ub untu +Ġth rift +Re gex +ĠN V +In ner +25 9 +Ġwh itespace +ST ACK +ðŁ İ +ĠRe place +Pro be +rep lay +Ġcomp uting +33 9 +00000000 1 +Ġper f +spe ech +66 8 +go als +obj ec +ĠUn known +check ed +Me asures +Se ed +be low +Buil ding +To String +Le arn +ÑĢ а +ĠGet ting +verb osity +Per formance +ynam odb +Sim ulation +seri alization +аР¿ +Ġpub lication +Ġsig moid +Conv olution +land scape +Dire ct +Ġtimestamp s +Det alhes +3333 3333 +è¦ ĭ +௠ģ +separ ate +é¡ ¹ +chron ous +YE AR +aud it +ÑĨ и +Ġpyg let +++++++++ ++++++++ +ĠUti ls +Contour s +Trained Model +Ġwerk zeug +; ") +A o +B IND +C U +C amp +D d +G M +L x +P ayment +S al +S napshot +S quare +T or +f ety +t ETH +x AB +í Ħ +in ge +in come +in vest +Ġ= ================================================ +st mt +Ġt ell +mp c +Ġa mb +un o +Ġm r +Ġthe me +ma ven +Ġfor est +es p +es is +as ons +Ġr anks +ĠA sync +'] * +Ġcon vergence +log gers +pro duction +Ġpar ty +art ment +Ġos d +fo cus +ĠV ol +ĠU AV +code c +IT ER +ag ers +ID S +nd r +24 9 +37 1 +Ġcom bo +ĊĠĠĠĠ ĊĊĠĠĠ +011 1011 +Ġtf learn +AC A +und les +IM P +clo sure +38 9 +PT H +ĠSt atic +ðŁı´ółģ §ółģ +FA CT +No via +dic ation +eval u +Ġauth enticate +now ledge +Ġman age +Ġsa ver +API View +has hes +google apis +Dis patch +Argument s +je ctions +handle s +ACT IVE +mut able +Ġpas ses +Ġpop up +Ġarch itecture +sr v +Ġmonth ly +Ġchain er +Ġcar ry +ĠPROVID ERS +chart s +POS IT +Bytes IO +æĮ ģ +ĠSc ale +measure ments +Long Tensor +ĠTop ic +Ġlearn er +FAIL URE +prun ing +éĶ ® +ATTRIBUT E +capit alize +éĥ ¨ +B uff +F W +G pu +H M +I m +P j +P p +P s +P repare +R AT +S yntaxError +U nder +X K +b illing +d ur +d mag +f ma +f requ +g AMA +h ort +j ack +n h +n id +s df +s now +¬ ółģ¿ +à ¢ +å ĸ +ì ķ +er man +re served +st ones +st ellar +Ġt ro +Ġ' '), +mp i +Ġ" +ve cs +ĠP CA +Ġ3 20 +]) ; +Ġx ls +ens ing +ens ities +ber g +ĠE C +per form +St ates +Ġra d +LE CTION +22 22 +ml p +37 3 +em u +Ġsub traction +87 3 +AG ENT +IS O +ENT ER +75 43 +cor s +flow s +mark ed +TR Y +De ath +ins ics +е ÑģÑĤ +Frame works +Ġback bone +Ġcall er +dis covery +Ġstd dev +0100 1111 +PRO FILE +Ġmean ing +For ward +COL ORS +ĠBase Model +ĊĊĉĉ ĉĉ +Te mplates +Ġrepresent ed +All Windows +Ġlike lihood +ä½ į +Ġaut om +Ġbound aries +stage s +Block s +Ġ"# / +Mark et +Ġpol ynomial +æĮ ī +ĠEd it +å¹ ¶ +аÑĤ ÑĮ +ółĢ² ółĢ +Comple ted +ĠHel p +æ¯ Ķ +ĠTR AIN +CHAN GE +Ġwatch er +687 896 +Ġsr cs +Mib Table +scr atch +Ġcel ery +bK GD +DCC SI +0100000000 00000 +ilton ian +( .* +C ERT +H Z +Q T +R y +S RC +T ile +T ele +V m +e insum +h mm +j vp +k an +l var +n Z +v ap +x FFFFFFFF +å ¡ +in crease +re cipient +al gorithms +Ġp ca +00 111 +Ġn engo +Ġre use +Ġm apper +Ġe e +() * +is k +set Style +Ġto ok +th ere +ĠA fter +'] ])] +Ġth ough +Ġex e +]) ** +Ġx array +test case +tra cer +Ġj itter +mo le +18 13 +Ġk napsack +Ġro unds +Ġal go +Ġpre dictor +Ġtra vel +mat erials +Ġsub stit +RO W +CO UN +]] ] +ĠEx port +bot o +Ġ{" $ +Ġpri v +EST AMP +Ġover lapping +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ +Tra ffic +Column s +MO V +PP ER +dist inct +PATH S +static files +Context Result +Inter pol +stop ped +Sp rite +_{ \ +Ġ$ ( +light s +can o +Ġdete ctions +ĠRun ning +BL UE +CD F +BO ARD +âķ ļ +TER M +Di ameter +ĠAl pha +Ġ"{ { +Ġmp i +Ġcent re +Ġcombin ations +Vis ual +ĠHe ader +ĠValid ate +Ġsn ippet +Sec ret +çī ¹ +Ġur lopen +destroy AllWindows +:`~ . +ðŁı´ółģ¬ółģ ¶ +applic ations +Ġsens ors +IDD LE +ìĬ ¤ +nthe tic +" $ +4 95 +E FF +H CP +I ET +L Z +O s +P AD +Y s +d ct +e igen +i q +j h +n lu +} | +à « +è Ĭ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +re gs +re ceipt +se mi +en arios +Ġt issue +al is +de livery +Ġi e +Ġp ep +Ġf out +Ġa max +Ġin ds +li k +li ze +() `` +Ġb et +Ġ( (' +as yncio +ĠS C +Ġof ten +ht m +for ma +Ġl p +Ġh over +res ample +out come +ĠM ig +ĠM od +our s +ĠB earer +ĠE nt +com ma +read me +read create +Ġnum ero +Ġen force +Ġro uting +IC RO +27 1 +97 3 +{} {} +26 9 +AG A +IM PORT +RI BUT +Ġsp rite +38 2 +ĠPy Side +ĠAr ch +post erior +adj ac +0101 0100 +ĠDe bug +Ġ200 9 +Ġextra ction +Ġrender ed +Sp d +Ġpost s +Ġinstall ation +å¤ ± +ĠName space +è¿ ŀ +9999 999 +GO OG +assign ed +к и +ĠAss ign +Change d +ĠIO Standard +æ³ ¨ +Ġasc ii +ĠBatch Norm +corre cted +ĠOper ation +sil ent +Cent ral +çİĭ éĢ² +âĢĶâĢĶ âĢĶâĢĶ +Ġsqu ares +Den ied +è¿Ľ è¡Į +æĻ Ĥ +è¾ĵ åħ¥ +Ġgram mar +abo ve +Decode Error +ĠSG ACL +æ² ¡ +! `", +4 14 +C i +G re +G CT +K T +N ON +P g +P MIB +_ ): +p value +w asm +Ġ âĸij +or ical +ro g +Ġa pache +Ġn ib +Ġs olutions +Ġe fficient +la ci +Ġb x +di scri +ĠT IME +(" @ +sp am +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠF ix +ĠI tems +ĠM c +xf ca +Ġv l +Ġv ote +pre f +ĠB ound +Ġname spaces +""" . +bo ards +ĠU Int +ĠU sers +16 6666 +Ġlist dir +100 0110 +05 0 +05 4 +sed ing +enti ally +ĠH ar +Ġno hup +Ġext reme +Ġnode op +Po ssible +Me mbers +File Type +ĠY AML +Ġver ified +Un less +graph y +ĠPro gress +cho ols +dis connect +Cont ents +ãĤ ¿ +si i +qui et +IP v +Base PMIB +gg ers +az y +LOG IN +Ġjo ints +xba Q +modi fier +å® ¢ +ठ¾ +SH ORT +Ġdat os +ìĿ Ģ +åĬ Ľ +rea ctor +Ġinser tion +GT erm +Ġ"{} / +TA IL +Format Error +ati ence +Ġps util +Ġsyn apse +Ġsur vey +Embed ding +nor mpath +hum idity +01001 0000 +è½ ¬ +HY s +Ġrg ba +phys ics +**************************************************************** ******** +Ġatual mente +ĠAz ure +Diameter BasePMIB +) [:, +4 17 +4 80 +7 06 +D t +F y +I FT +N j +O bs +P ush +P ublic +P Vals +S em +Y t +Z ONE +b W +e ss +k f +n itro +s it +w hole +x o +y o +z n +z t +z fill +á Ĩ +Ġ Ñĥ +in el +in ode +Ġt up +de lim +de precated +Ġa e +lo v +Ġd bs +co or +rom ent +te e +il t +th inningThingProducer +str ong +ĠS pect +Ġg i +ĠA mazon +Ġh or +ĠL ock +=' +', +Ġst oring +pro ducer +.. ") +Ġj vm +com bo +ise ct +ard own +Ġro c +08 0 +88 3 +Ġle aderboard +av ailability +36 3 +cri minator +... ' +ix s +CO PY +AC H +Ġmat lab +cent roids +Ġbase s +Ġver ification +ĠJ ava +root s +gram mar +US B +US AGE +Ġstate ments +Ġcor es +cu i +FA CTOR +Ġcontext manager +Ġcontinue Routine +proto s +bl end +**************** ******** +ÑĢ Ñĥ +ĠLo ader +ĠEn able +Ġscale Factor +cos ine +prop agate +Ph ysical +Ġcons istent +IF ICATION +mid i +DIS PLAY +ĠRo ot +Iter ator +иР¹ +Initi alize +alert s +Ġair flow +sens itive +Ġmar shmallow +åı¯ 以 +Ġpast e +IDX GI +éħ įç½® +REPL Y +çŃ ī +Ġtransl ated +ĠTechno logies +Quest ion +8217 776 +' < +0 92 +4 92 +; ') +A ct +D f +D m +P lug +S can +T B +a el +d anger +i lo +i ence +k afka +p HYs +s id +t al +t one +u o +} ). +° ĥ +æ ĵ +ç Ī +ë © +Ġ ul +st acle +Ġt ang +Ġc H +Ġf r +Ġf an +Ġf ive +Ġin dx +Ġd ados +Ġb log +Ġb rain +Ġb udget +__ ))) +us d +ĠS GT +up ling +for est +Ġr df +Ġcon su +am big +ĠF ull +log dir +ĠL IB +ub y +ĠD el +os g +add on +ep i +Ġco eff +ĠW OR +loc ated +Ġout dir +AR M +Ġan imation +Ġen emy +Ġk m +Ġch anging +Ġal ive +sub parsers +88 2 +start up +with draw +27 2 +=[ [ +Ġtrain able +ele vation +Ġlo ops +so ma +Ġsp acy +Po se +Me ans +Ċĉĉĉĉ Ċĉĉĉ +Ġus r +Ġgener ates +dep ends +Ġqu bit +ĠAr ti +Ġover all +Ġab ility +CA A +present s +DIT ION +åĪ ¶ +KEY S +ä» » +ĠApp Config +å® ¶ +еРº +ĠAc tivity +Ġprob es +æĪ ĸ +LA ST +Cal endar +gu ard +Ġinser ted +CM eta +Go od +aff old +SM I +Ġspect ral +INPUT S +ä¼ ł +à± ģ +Pick le +·· ·· +Ġfore ground +Ġcommunic ation +01234 56789 +ADAP TER +íĦ ° +B AR +D y +D ash +G RE +G CC +K K +M ul +N H +N tw +R AM +S parse +U ri +e lo +g ym +g lyph +k d +k nn +o ti +p addle +u ge +v Z +v oc +¥ ółģ¿ +® ółģ¿ +Ľ 建 +er ver +re ci +se verity +Ġt dk +Ġ' *. +Ġc amp +Ġc ampaign +Ġn est +Ġd z +li mb +Ġm ens +Ġb ert +ma ze +], ' +import ance +ĠS EC +Ġr nn +to ms +Ġh ot +ĠI BM +file Name +form er +Re cords +ĠM P +oun ded +Ġel f +load ers +len ame +Ġnum ba +line style +Ġpy units +ĠH ost +Ġdi vide +Ġac tivate +87 93 +36 2 +86 01 +44 3 +Co mplement +of fice +vis ited +ud p +doc string +amp litude +47 61 +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +46 2 +CON NECTION +exec file +Ġfig ures +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ +Number Of +License d +Ġ'-- ', +ĠWe ight +dec lare +Ġmark ed +track OfThingsProducer +ĠLo ok +web hook +rat ios +ĠLe sser +############ ### +On Flip +ĠUnit ed +Ġscal er +Ph i +990284 08 +å¾ Į +ru it +010000 11 +FE ED +FE ATURE +Ġsn ake +AK ED +Eval uation +chan ism +Ġvisu alization +monitor ing +Ġsym metric +Ġblack list +obo library +Ġca ption +Mac ro +Ġsmooth ing +Ġtar file +ç´ ¢ +postgres ql +expl oration +ĠSpecify ing +ĠFore ignKey +vvvv vvvv +avor ite +Wave Length +æīĢ æľī +Ġmne monic +ìľ ¼ +ç³ » +Ġappe ars +ORIG IN +" ') +5 96 +D W +K G +N i +R n +S GD +e ck +m ute +t IME +x gb +} [ +Ø ¹ +á ħ +de posit +ti ff +Ġp code +Ġf ps +Ġin cident +pe x +Ġb c +Ġb la +Ġ1 75 +Ġ1 38 +Ġw d +ĠT CP +us c +Ġis ol +ĠS ets +ĠC lear +Ġr y +ĠA udio +Ġh yp +ĠP L +ĠL STM +=' ' +est i +Ġprint ing +ĠM AGIC +time series +Ġse cs +Ġor acle +Ġpro posal +ĠE lect +ĠR a +Ġun expected +ĠU INT +Ġ\ : +Ġ{} . +Ġle ading +arch itecture +DE C +DE PTH +Ġapp lies +ron dump +26 2 +sum s +Ġmat ter +ler ations +28 2 +FI RST +Ġcolor bar +35 2 +83 34 +UN I +Ġar bitrary +Ġcal ib +)] )) +Ġqu antum +conv olution +1011 100 +Input s +Ġbot ocore +); ', +PRO DU +ons ible +å¤ © +å¤ Ħ +cla im +Ġsm allest +Ġrecord ing +æĸ Ń +fail s +Do uble +Ġgr p +gre ater +Ġve hicles +Ġprevious ly +bind ings +Ver ify +>= /', +C p +E ff +F w +G LOBAL +N aN +R ating +T q +T ypical +W I +b ird +j t +m nt +n ll +u h +v pn +Ð ¹ +å ĭ +é Ĵ +ì ĥ +on ym +de tailed +Ġf ingerprint +Ġ1 37 +Ġ[ -- +)) ** +iz ação +ab a +ĠC OR +ĠC enter +up loaded +ĠA DD +ac ci +Re gs +app y +sh adow +ĠM ag +Ġy lim +Ġx lim +Ġma ior +ĠB L +AT AT +ĠR ED +oc r +ĠU til +line styles +17 41 +df a +output File +lin ed +ak ing +Ġcomp utes +DE T +av en +Data Source +Ġla m +011 01011 +Ġper mutation +Ġstart up +clo sing +Se verity +ĠQ Color +File Descriptor +inal g +Str Opt +ĠEx it +Ġver ts +Ġdoc string +ðŁı´ółģ ¤ółģ +MA LL +1011 011011 +Ġimp licit +Ġ... ] +0101 010000 +Ġ200 6 +Ġ200 8 +pec tive +mc Rmt +has hed +Size Constraint +('/ ', +0011 010000 +0011 10111111111111 +BO DY +ĠLog ging +Jo hn +ĠAc curacy +dete cted +0001 0000010011 +Valid ate +respon d +freq s +Ġcons umption +ĠInter net +å¼ ķ +Seri alize +Ġep ic +Ġrelative delta +0101111 10111111 +Ġctsp Def +havi our +çİ ĩ +xxxx xx +sci ence +Video Capture +984 5 +^{ - +coef s +Ġsimp lify +Ġ'* ', +10111011 01000000 +Comple te +å± ħ +central ity +Ġbro ker +Ġprote in +Ġeas ier +Rob ot +00101111 01111 +eder ated +æ± Ĥ +Temporary File +ĠRequires ContextResult +WINDO W +PomeriumService Account +tlen eck +100010000 111111 +62670 934 +* ] +4 87 +6 12 +: ]] +? ') +C am +E mp +I OR +P tr +Q J +S s +Y r +b q +c ron +d ad +h orizon +j ac +j inja +l te +l hs +m int +m ber +u df +v arn +x v +© ółģ¿ +Å Ľ +ç ¾ +è Ĥ +Ġ âĶĢâĶĢ +ĠĠĠ ĊĠĠĠ +er c +se a +ro sa +00 14 +ce a +ce ph +', \ +', ), +Ġre moving +Ġre curring +Ġo id +Ġd n +la d +Ġb ank +es quis +set Value +ĠT aleParser +et er +for ge +Ġl bl +Ġl inalg +end ency +sp ring +ic u +am ber +Ġ: ]. +sc f +om it +Ġh int +ĠP RE +ĠP ress +ĠI T +ĠI p +ub class +ex press +out side +]) * +Ġv ary +Ġy hat +os d +tra ctor +Ġj et +In ventory +ĠW est +Con version +min imize +line age +Ġk l +ener ated +ne tic +ok lyn +ak ed +yn Ov +Ġac l +36 00 +... ] +44 44 +Ġurl patterns +Se g +cre ti +Ġtrans actions +Test Obj +gen otype +":" + +Ġformat ting +Time s +65 8 +Ġqu otes +Ġqu iet +pass wd +1011 00 +over all +Ġbin ascii +Ġsession s +Man age +QU AL +disp lace +0100 011011011 +Ġconvert ing +Ġjo ined +ĠCom m +10011 010000 +white list +mis phere +ĠCont roller +0101111 10000 +ati vely +ĠRandom ForestClassifier +Example s +ĠAs set +æİ Ĵ +ä¸Ń çļĦ +00101 01110011111111 +dz lu +ĠNetwork s +Ġcrop ped +sto pping +1001111 011110101 +bz l +trust ee +èĢ ħ +ĠAv ailable +01011101 01110000 +ĠCho ose +模 åŀĭ +Ġmor ning +bsd conv +ĠLang Types +10001111 1010000 +Ġjvm gen +íĬ ¸ +101110110100 01110000 +" ` +4 86 +: > +C CT +E LE +F s +F IC +F uture +N K +Q w +V eri +X I +Y AML +[ ^ +_ "+ +c Y +e asy +f A +f ine +k its +m gr +n od +p agination +s oc +u da +v R +v u +ı Ħ +on a +de ltas +Ġc ry +Ġf t +Ġa mong +Ġn rows +Ġs us +Ġs uggest +li ft +Ġm ixed +ra ses +ch assis +def jvp +ul ff +(" | +(" __ +ĠC AN +ĠA ssert +sp i +par ing +ta c +ment o +ĠM i +02 9 +ĠO racle +Ġx min +ER E +07 1 +In clude +ĠR t +SE P +100 10111111 +64 2 +inter mediate +Ġsub list +CT RL +Ġper mutations +Ġcheck points +44 1 +Ġadd on +cc c +TT T +project ed +UM E +Ġsign ificant +Ġ200 7 +github usercontent +Ġfollow ed +ãĥ ĥ +decode d +н а +az ione +ç a +non y +æľ Ī +'} ], +Or ganization +thread ing +Ġ---------------------------------------------------------------- ---------- +Ġ---------------------------------------------------------------- --------- +Ġmove ment +An im +sn ippet +cred its +Ġcalcul ations +Ass oci +Ass istant +LLLLLLLL LLLLLLLL +dom in +00011 01001 +Match er +Bl ur +Loop back +ĠMin imum +Eval uator +front end +stick ers +00001111 001 +Ġann ual +Ġdetermin es +Poly Log +100111011 01110000 +Ġscra ped +scra ped +10111111 0011010000 +Ġhold ing +repe ated +Syn th +rg ba +âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ +Ġparticip ant +010101111 01 +Ġce il +Spect rum +Ġdispatch er +727 25 +Ġprun e +Ġrespec tively +Ġsear ched +Ġmn ist +Ġpie ces +Ġemo ji +0010111 000001 +8594 276 +687896 8594276 +010010000 101111 +1010011100 01010111101 +000111111011 00000100 +ktron ix +011101110011 000101 +" '+ +G CELL +J WT +K H +O AUTH +P Set +S uggestions +T ITLE +W l +c T +d yn +f ault +f ly +f ns +i python +j ni +m ate +t ur +t urtle +} ": +} \\ +¯ ółģ¿ +ì Īĺ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ= ' +st ops +en velope +Ġt ls +Ġt ip +ro des +ti ties +Ġc df +00 111111100 +Ġin ventory +Ġre lat +ct an +Ġe lasticsearch +int ro +ch ro +el le +(' > +th umb +str ates +ĠC C +ĠC annot +ĠC ORS +ĠC hem +ĠA V +ĠA ct +ĠF LO +ĠF IL +od ds +qu ant +Ġh b +Ġth us +Ġst ub +Ġu c +Re ferences +ĠM ass +Ġme th +Ġpro filer +Ġj udge +Ġget Logger +mo val +tri eq +Ġtime step +25 37 +ax v +AN DS +sub tract +Ġclass name +lat in +HE D +Ġ8 90 +au ction +IM AL +Ġdis covery +stri ke +11111111 111 +98 9 +Ġmo ved +AD O +gin x +45 0 +Ġinter preter +Ġlin ker +ĠIN TE +iter ate +[- ] +ðŁı´ółģ ¨ółģ +EX PORT +ca ffe +111 0000000000 +Ġtoken ized +ren ces +dev s +и л +ba selines +оР¹ +1000 11111111 +has htag +stop words +Gener ic +0000000000000000 00 +He avy +bound aries +Ġexit Rule +VAL UES +imp lied +ado op +аР´ +9902 818 +Ġaut os +Ph rase +Ġfast a +Ġsec ure +feed s +Scal ing +962775 917 +/> . +ĠCOPY ING +1011111111 111 +Ġenter Rule +REG ION +ĠVariable s +Area Dictionary +æŀ ª +Ġbuilt in +æķ°æį® åºĵ +separ ated +Ġ{: < +11100 01 +Ġmeasure d +00000100 011100 +Connect ed +1001111 011111111111111 +rist or +Ġlab eled +Ġaggreg ation +11101 000101 +Ġcri tic +åIJį 称 +________________ ________________ +wik imedia +缮 å½ķ +0011100 010111110000 +ĠContain er +10111111111111 011 +01100100 010101111 +æĥ ħ +DUM M +11000011 0101111 +0001010101010011100 101111 +00010000010011 0101 +1011101101000000 1110001 +nony mous +010010000101111 0010110 +011101110011000101 011111 +6 16 +A y +B Z +B TC +C ity +E CT +E thernet +G ot +H it +J ar +O Auth +S cheduler +S pread +W g +W eek +X Q +Y u +_ )) +a ver +b h +b irth +l ons +m st +n q +n grams +p ins +r find +z ing +å ł +æ · +è º +ë ³ +re aded +an other +Ġc g +Ġf ft +Ġ" %( +Ġn rd +Ġs light +Ġin flu +Ġre act +Ġd ut +Ġd data +Ġm obj +Ġ1 65 +def er +ation Type +(' + +et ag +ĠC ross +ĠL ong +Ġst em +Ġde mon +0000 1011111111 +Ġ""" ) +Ġex clu +ĠD ESC +ac a +ac cel +]) + +oun tain +que t +Ġstr ategies +pre dicate +Ġbe come +Ġ4 80 +92 154 +ĠR FC +ĠW S +scri bed +sa ver +Ġk o +og rams +ST Y +100 100111011 +Ġ[] ; +Ġdi ce +comp osite +ĠIn fo +ĠIn struction +Ġso ma +av oid +Ġno vo +87 297 +011 0011101 +Ġopen ing +Ġz lib +AG T +List a +Ġtext variable +be e +77 8 +Ġsk ipping +Log s +ĠSt at +open api +Un expected +bot tle +Ġexp ressed +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ +Ġass uming +Ġchar set +Ġtoken ize +ose Version +MO DI +Ġ... ") +edge color +Ġlib ssl +radi i +åĪ © +################################################################ ########## +æķ ´ +vm Instance +0000000000000000 00000 +timestamp s +åħ ĥ +rel path +Ġest ab +BO O +rb f +Ġrot ated +Method s +tech s +Que ens +Ġprop ortion +ĠDo es +divid uals +sha res +cour ses +alan cing +SimType Pointer +SimType Bottom +0101111 1110000 +writ ing +Match ing +00100 1110000 +LINE AR +ffff ff +ffff fff +ĠPh one +Ġsnapshot s +follow ing +prote cted +ĠMark et +Ġocc upancy +æĽ ° +adapt ers +ĠMeasure Duration +Success fully +yb rid +Dest ination +Ġide al +Ġnav igation +čĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊ +ĠContain s +èª ª +Ġ'.. ', +Cross Entropy +VARI ABLE +åŁ º +011101 0011101 +ĠGRO UP +0001011100 1011111111111 +001110111111111111 01011 +0001101001 00000000000000 +00011111101100000100 1111111 +00111111100 011 +000100000100110101 011111 +" - +) < ++ )/ +- ( +4 12 +4 20 +A ff +B earer +D V +E w +F Z +F n +H IP +H orizontal +M ust +O l +O rient +P ure +P ID +R MS +T idx +V a +V irtual +a vi +c amel +d J +f re +i us +j l +j avascript +l xml +o int +r split +s us +w it +è © +ê ² +Ġ rid +Ń ółģ¿ +re h +st retch +en dif +Ġt ier +Ġi da +Ġp ert +Ġd ont +la ys +ad verti +Ġ1 93 +11 011 +11 929 +ch ore +Ġ- ( +ĠS u +ĠA TT +par dir +Ġh olds +Ġh orizon +ĠP r +ĠP ER +Ġas m +ub ar +im m +Ġex if +Ġprint ed +Ġv y +Ġv an +Ġv cf +ext reme +Ġx g +ĠE xecution +Ġj og +user id +ĠR F +ĠR over +Ġout liers +Con sole +coun tries +Ġk ingdom +100 0111 +ne al +Ġtra jectories +join path +08 3 +pi vot +Ġle ase +Ġsub plots +unc er +Ġmin imal +box score +ref lect +mission s +dire cts +Ch rome +US H +000000 10011111111 +total C +ĠPar am +Message History +Ġover lay +Ġframe N +Object Name +Reg isters +0100 0101011 ++' \ +Base d +Ġconst s +non ce +ICs Un +Ġauthor ization +0011 00000010000 +ida des +SD K +Sc atter +Ġwait info +Ġbl ur +Ġaut og +Ġview er +Ġconnect or +Ġdat al +Ġfail ures +pa ired +atom ic +Ġprop agation +ĠXXXXXXXX XX +ĠCO MP +DIS ABLE +Ġplay list +Ġspect rogram +Ġfo i +ĠHOLD ER +ç½ ij +="" ): +ĠModule s +combin ations +Host name +ĠPri vate +ARG IN +Rot ation +INST ALLED +Resp Tx +Resp Rx +FUN C +å· ² +10111011 01 +lor ida +Ġaggreg ate +Wait ing +Ġspi ke +0111111 0101111 +&& && +conti gs +Percent age +ãĥ³ ãĥ +hard ware +Ġtun nel +=-=- =-=- +Vari ant +ìĭ ľ +111011 01110011 +ĠLim ited +Publish er +Dl Data +0100101 01011111111 +01010000 10110011 +Spd Mode +ĠscaleFactor OfFirstFixedSurface +inten ance +011011111111 1111111 +è± ¡ +10110000011100 011100 +62670934 8793 +0010101110011111111 11111 +100011111010000 10000 +10011101101110000 11100 +1110000000000 1011101101 +00000100011100 100101 +' * +) { +4 99 +5 84 +8 38 +A sc +B ank +C g +H F +J C +K i +L p +P IN +Q s +T OTAL +V F +W y +Z o +a io +b J +b is +c atch +f H +f usion +g file +g auss +m ation +t Stop +u ary +z ier +Ï ģ +Ø ´ +ç Ĭ +è ģ +Ġ Ċĉĉĉĉ +Ġ videos +in coming +de partment +de aths +mp ts +Ġc n +Ġ" ")) +lo an +lo id +Ġs phere +Ġre play +ate ver +um idity +Ġw ish +(' | +ĠT ake +ĠT imer +ĠT Transport +Ġ2 22 +(" ( +ĠS ame +ĠS ync +ĠS uper +par m +ĠF actor +vi p +Ġh pnicf +Re fer +Re ason +Ġbe comes +col lide +ĠR R +ĠR aise +reate d +per c +ĠV LAN +). """ +Ġen counter +Ġcol lected +St udent +03 9 +Ġint ended +ip pets +Ġch ance +Ġal location +Ġtra j +ĠRe pository +LL L +map cells +Ġcomp ared +Ġ} }" +Ġlabel size +run k +26 56 +mon keypatch +Ġ| \ +Res ume +Co in +LO SS +Ġcolor map +Ġus uario +Ġdistri butions +ä¸ ¤ +Ġbase string +47 3 +101 011100 +Ġq iskit +round ing +ĠPar allel +bl k +ĠConstraint s +Comp ile +Comp ose +Ġab i +access ion +pr m +View s +Ġparameter ized +Sh uffle +GH I +0100 01 +Inter section +ĠID ENT +Not ImplementedError +Ġtransform ations +Ġgover nment +Ġnon zero +Sub scription +real m +Ġcomple tion +Ġstop ped +ĠLog isticRegression +еР¹ +Ġbl end +convert ed +PAR EN +Ġdat atype +Ġreference d +("/ ", +åĽ ł +Ġappro ach +conn ectivity +Ġinte grate +ĠUpdate d +Ġretri eved +Ġtw ice +writ es +00011 001111 +çİ ° +ctsp Def +aur ants +men tions +PK T +hyper params +pur ple +Ġdash board +100111011 00 +ĠJo hn +Ġslot s +deriv ative +ĠWork flow +ìĦ ± +Ġfrag ments +Ġfrag Two +Pixel s +repos itories +ìł ķ +Ġwt forms +åĬŁ èĥ½ +ç»ĵ æŀľ +particip ant +å½ĵ åīį +ANAL Y +SIMPLE X +shuff led +001100 011011 +Radi us +AVAIL ABLE +011001 00000010000 +101111000101 00100 +01101011 001111 +0100011011011 10011101100 +72725 8903 +vmInstance Uuid +# ~ +5 83 +6 88 +7 16 +; ' +B ert +B IG +C PP +N p +Q I +Q INT +S UR +S outh +T en +T AB +T AD +U pper +V g +X o +m W +m us +n H +z u +¤ æĸŃ + ° +Ġ о +st udents +Ġt em +al one +al location +Ġi mpl +me tron +me eting +Ġre cipient +Ġd rift +Ġw andb +and oc +one ofs +Ġ2 25 +as er +Ġ7 00 +ĠS tri +up stream +Ġg uest +Ġr ates +Ġl c +data s +am ounts +Ġh d +Ġh id +Ġh ier +ĠP arent +=' < +Ġst able +app engine +Ġma intain +Ġ% - +Ġ% { +tra its +ĠR ight +mo tif +Ġan chors +05 2 +'' ') +AN C +ĠH eat +Ġ[" - +arch ar +CO OK +101 011011 +Ġlin ux +ĠOption Parser +let ing +De lay +EX CEPTION +total NC +\\ . +Ġwork load +Ġsum s +Ġorder ing +Ser v +OP S +Ġlocal host +At tach +оР¶ +Ġsome times +Ġcsv file +gest ion +sm iles +comple tion +Ġì ķ +0000000000000000 000000000 +Ġstruct ures +ĠApp end +tool kits +à® ± +kernel s +ĠPre dict +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +ĠQu antum +Red uce +SQL ALCHEMY +Page s +ĠSystem Exit +Ġbyte order +watch er +Ġ--- # +Storage Type +PK G +00000100 010000000000000 +trip le +Translation MessageHistory +Ġwhite list +sup title +Ġ"* " +Ġmultip ly +pole on +ĠRO I +Ġstar let +Estim ate +Fore ignKey +RAN GE +ĠBu cket +éĶ Ļ +writel n +phen otype +101111111111 10011 +å¼ł æĺ¯ +Æ° á» +METR ICS +Ġguar ante +Ġtdk TestObj +01000011 011011011 +1011100 111111100 +101101001111 00011001111 +962775917 0879 +èº « +0110011101 01000101011 +0111010011101 00100 +10110000011100011100 11111 +001100011011 101111 +4 84 +4 96 +A VE +B reak +C he +J B +M OR +N X +N z +P ad +S hould +Z G +b S +d F +d set +f rm +h ero +h pnicf +j U +t une +v ac +w ide +è Ļ +ë ¶ +ĠĠ Ċ +Ġi dade +ro ps +Ġc affe +Ġp ulse +lo it +Ġd ol +Ġm qtt +co uld +Ġb tn +Ġ1 42 +id b +Ġw arp +di tive +from array +ol f +el li +ab b +ĠA F +Ġcon verts +ĠD if +ĠM enu +čĊ čĊĉĉ +Ġv in +test app +ER C +Ġme ter +Ġpro of +In dividual +ep ics +Ġun cer +Ġun used +ĠW ed +Ġout come +Con structor +ĠU ses +Ġ6 55 +05 9 +Ġtra ces +ðŁ į +Ġsh utdown +work ed +34 202 +ĠIn strument +Ġle s +rep s +94 2 +Ġopen pyxl +stra in +... ". +do i +unc ased +Ġmessage box +act s +CH UNK +wh m +du i +Ġar cs +CON DITION +MP C +cl ub +CL UDE +\\ \ +ĠCo lour +01111 10011 +Ġdif fic +Comp any +dist ro +čĊĉ čĊ +ä» İ +Ġì ĭ +WS Man +Dis abled +factor ies +imp licit +ĠOr gan +å¤ ĸ +Ċĉĉĉĉĉĉ ĉĉ +lon gest +ä½ ķ +Spec ify +SL ICE +Ġshort cut +Ġperform ing +band width +Noti fications +ä¿ ħ +ĠForm ats +History Control +Stat istical +æĪIJ åĬŁ +Ġut terance +SK IP +Modi fier +ĠLib raries +0000000000000000000000 1 +è¿Ļ æĺ¯ +ĠStop Iteration +REQUI RED +#================================================================ ============== +bas ics +ĠChar acter +Ġcrit eria +PUBL IC +Separ ator +Ġaccompany ing +GATE WAY +consum ers +ĠWebDriver Wait +rypton ite +101010000001111 0111100 +10010111111 101011100 +0010111000001 000000001 +001100000010000 11111111 +011001110101000101011 01 +) ]: +0 93 +1 00000000000000000000000 +5 04 +6 03 +6 56 +7 13 +A m +E AR +L is +N u +P x +R pc +T p +T y +Y m +b rid +f light +g cf +j q +j upyter +m ile +n E +o log +q cut +t te +y z +y un +y ond +Ġ xf +Ġ EST +Ġ ../ +or B +at ura +re views +en codings +de e +Ġ' [" +Ġ' ). +ro graph +Ġf ish +Ġs on +ss im +11 10 +ch ance +), ' +val i +ers pective +ĠS N +ĠS ong +Ġdef ense +Ġl int +'] + +Ġcon vers +to wn +ĠF P +sc anner +qu er +om al +om ials +ĠP ose +ĠP OS +ĠD rop +ĠM ath +Ġ_ ) +ĠB a +Ġ4 16 +ff mpeg +ĠR NN +Ġlog out +oc cur +Ġco co +Ġk lass +06 3 +Ġ[] ), +ou ght +:// / +RE LEASE +IC H +ĠRe mote +Ġsh ots +ĠIn clude +em ale +Ġsub scribe +96 854 +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +sum techs +Ġdo copt +IS S +ele v +man agers +En g +Ġmin imize +Col Name +45 1 +dire c +46 9 +:: - +ug ging +char set +roll back +Ġ12 34 +OP ER +åı ° +QU IT +ĠFor ce +App end +Py ramid +tran script +ĠAPI s +xel AclV +GI E +"} ), +WOR LD +Ġconn ectivity +éĢ Ļ +peri ence +ĠAd just +Ġlower case +æĹ ł +Ġdesc ending +ĠExt ernal +ĠIter ate +011111111 111 +å½ ¢ +Ġxy text +ENS IONS +ierarch ical +agin ate +visit Children +Ġsubmission s +100111011 1010000 +å¹ ´ +0111100 11111 +Vo xel +ãĥ¼ ãĥ +Ġhapp ens +è½ ½ +buff ers +å¿ ħ +00000011 1011111111 +amazon aws +ParseTree Visitor +ÑĢаР² +Ġeas ily +mong odb +åģ ļ +Ġiss ubclass +pron oun +олÑĮз ов +010111110111111 101100 +10111011010001110000 0111111 +11101000101 00000000000 +0011100010111110000 111 +00111111100011 000111111 +01100100000010000 1000111 +01101011001111 011111111 +010111110111111101100 11111 +# ' +4 97 +7 97 +8 34 += > +F ee +H h +H ero +I LE +K a +M m +M IDDLE +N m +P in +S ong +S PL +S helf +` ): +e ager +f uel +l M +é ĵ +Ġ art +or ge +or bit +ar win +an z +-- ', +Ġ' {}'. +ro unded +Ġp ed +Ġp late +Ġ" & +Ġn m +Ġre search +Ġd ilation +Ġm om +fi m +ent d +Ġb or +Ġimport ance +ot t +__ / +(' ~ +Ġ2 17 +Ġ2 048 +ĠS SH +od ock +Ġde tailed +0000 111111 +Ġ3 02 +Re minder +sh ield +Ġma intainer +add ons +1111 1011111111111111111 +tra jectories +pre processor +"] ', +ĠN N +Ġres ample +Ġ4 096 +ĠW arning +ĠV ari +Ġan im +St atic +cept or +gra fi +22 14 +eri v +Ġsc roll +ĠIn line +ask et +Ġare n +Pro posal +96 2093 +Ġcomp iled +33 0 +RO UND +exp ansion +net loc +sum mer +Ġsp line +ĠY ear +find ing +bg r +sys log +rol lo +ren ch +Ġ... ) +transform ers +SS S +SC REEN +serv able +(* [ +med river +mod al +Ġshow ing +Ġmark s +sm tp +istr ator +Ġge op +Ġ$ \ +Run timeError +ĠAdd ing +á rios +We ights +ĠTo ols +CR IT +Stream s +abc def +Range s +pla cing +Msg Rx +ç» Ł +EG ER +962775 916 +ĠLoad ing +ru ped +ĠCO UNT +Ġexpression s +Parse Options +ĠOf fice +87300948 11929 +Ġcdbp Peer +00101 01001 +har vester +dem ic +964 11 +SAM PLES +å· ¦ +ĠSU PPORT +808 0 +Ġcycle s +Ġexpl ore +CONTRO LLER +Ġconcat enate +é¢ ĺ +vile ge +Fire wall +IDD EN +Tick s +01100100 011 +Bul k +ĠDAT AB +Arch ive +ä¿Ŀ åŃĺ +ALPH A +00010000 101011011 +ridd en +92140257 96854 +ĠSEC URITY +0010111101111 01011 +1001111011110101 0001111 +0101110101110000 011111111 +9902818 27 +001001110000 11111111111 +01111110101111 011 +10111100010100100 1000110 +001100011011101111 001111 +' - +' (? +; : +A i +A mazon +C Readable +G IS +G PL +L t +N J +P AN +R EST +V k +W Z +W all +b G +c time +e es +e con +h oc +i for +m ann +n U +n ce +p om +s olute +s olutions +s kew +v dui +w an +y ticklabels +} .") +Ù ī +er ator +at z +at is +Ġt tl +al lo +Ġp al +Ġp ix +Ġe gg +Ġb w +Ġb ath +Ġb am +Ġ1 99 +Ġw est +ot ential +ol ling +set ObjectName +Ġto dos +as l +ĠS FP +up s +Ġg reat +Ġr w +Ġr ing +Ġl t +qu as +Ġh azard +Ġse x +Ġma is +ER ATURE +Ġ% = +Ġpro viding +py g +ĠB i +ĠR AM +Ġtest Obj +lic ity +EN UM +100 10011 +join s +ðŁ Į +ĠH ead +ast ro +start Date +inter preter +ant ages +ak a +rep air +ĠCon tributors +no se +lat s +Ġz ones +man ent +auth enticate +File System +',' -- +45 2 +>> ", +46 3 +Ġup stream +ins n +content types +111 0000000000000000000000 +Ġover view +01111 1011111111111111111 +Le g +author perm +Up on +Ġgraph ene +extra s +optim al +GR ID +]+ " +Rule s +Ġstat istic +display Name +Ġweb hook +`. ` +ĠAc cept +à® ¿ +Ip v +ĠRed uce +fast binary +Ġestim ates +flux es +æī ĵ +rup ted +Ġplay ing +Ġplay ed +VALID ATORS +Track ing +Work space +Ġrelease d +Ġanaly zer +WORK ER +dz dmag +allen ges +Ġarti st +ĠDO MAIN +Ġir rel +800 4517 +456 2864 +Ġam ounts +æĢ ģ +lig ible +0004 6297 +writeField Stop +bat tle +ĠSET T +Ġregist ers +Dele ted +Ġheat map +trunc ate +ograph y +ĠCOL UM +ĠTechno logy +é«ĺ ä¿ħ +readField End +readField Begin +readStruct End +readStruct Begin +writeStruct End +writeStruct Begin +Oct etString +ĠNor ris +Ġenvi roment +magent a +å¯Ĩ çłģ +Buff ers +nitro gen +99028408 96411 +1010100011 000000000000000 +secuti ve +10111111111111011 0101011 +01011111110000 100011111111 +00000100011100100101 001 +01000011011011011 011111 +0111110011 01000000 +990281827 3092 +CReadable Transport +4562864 8004517 +# ------------------------------------------------ +% ', +) [: +5 07 +5 93 +B ITS +C rop +C trl +D og +D ia +D TYPE +I h +M ail +S ep +S fp +S ending +T rust +V Q +V OC +V LAN +W rong +Z s +c A +c X +c ti +c one +g reedy +g rowth +n est +n ullable +r na +¢ ółģ¿ +ç Ŀ +ë ł +ð ¥ +re cur +st ac +de composition +me tic +Ġp are +ut os +ur ch +Ġin str +sel enium +un et +ra ken +Ġe ver +Ġe limin +() ' +Ġb boxes +Ġ1 52 +ul ls +ol lower +(' @ +set Attr +Ġto c +Ġ2 001 +iz z +ĠS i +Ġg ran +Ġg ender +Ġr st +ĠA UT +Ġh op +po isson +ĠP in +ĠP ut +ex am +Ġex cluded +Ġ3 12 +Ġu dp +ĠM IS +Ġy ellow +os o +Ġpro cedure +12 28 +In correct +ĠR ET +mo lecule +OR ATION +ĠV P +Ġ5 62 +array T +04 0 +08 00 +Ġsh ot +Ġdi alect +pos ure +Pro cur +yn chronous +Ġno isy +36 1 +26 1 +ED Producer +au di +IM UM +uc ation +Ġvalid ators +item getter +ä¸ İ +UN ITS +To Pre +Max Pooling +cli ff +send all +At tention +Al g +scal ars +äº ĭ +æķ Ļ +ĠDE LETE +ME AN +è¯ Ń +ĠLe ft +108 36 +Ġdiffer ences +å® Į +Ed itor +Ġ---------------------------------------------------------------- ------------ +Ġreq s +stage d +9627 736 +ĠAd ds +desc endants +ĠSub ject +åĽ Ľ +SA CTION +ĠRequest s +Ge om +ĠNe ural +ĠClient Error +ati fied +ĠAD AP +ä¾ ¿ +mix in +ĠAss ume +cdbp Local +Sto pping +Ġsv g +ĠCustom er +表 示 +Inst alled +submission s +notebook s +Li ke +#---------------------------------------------------------------- -------------- +Ġmultip lier +MEM BERS +Ġtot als +Ġ^ = +Ġwebs ocket +transl ated +åŃĺ åľ¨ +Ġcentral ity +ĠPI PE +CENT ER +aci ón +PARTICLE MANAGER +01110011111111 111 +HAND LE +smo othed +ðŁı´ółģ²ółģ µółģ +Ġcau ses +å¢ ŀ +è·¯ å¾Ħ +1813 9845 +ìľ¼ ë¡ľ +ashing ton +uniV cl +APPL ICATION +0101010000 01110011111111111 +10011010000 01011111111 +axv line +92154 18139845 +87297 315 +ĠIDENT IFIER +727258903 8903 +10010111111101011100 111 +1001110111010000 1001110 +000000111011111111 11111 +00010000101011011 011111111111 +ifor nia +6 18 +A u +A re +A ES +A cts +D EST +F ig +F oo +H x +H AT +I k +L and +Q B +R J +S tri +T ot +T LS +V ocê +e tition +f V +f uniIf +g x +g ft +h ind +h yp +k lo +n k +s lave +u q +v sd +£ ółģ¿ +² ółĢ +è °ĥ +Ġ á +in di +on om +at ivo +Ġt axon +de veloper +Ġ' ? +Ġc ada +lo sed +Ġs om +Ġs oc +Ġin come +Ġd hw +ent y +co ut +ri fied +ri cul +Ġ1 53 +id le +Ġw y +ma de +ath ena +il led +Ġof ficial +01 0000000000000000000000 +am ba +ĠF o +qu ivo +vi ri +po em +ine ar +10 80 +=" ./ +Ġv ers +ĊĠ ĊĠĠĠĠĠĠĠ +Ġpro t +py sal +"] = +ĠB N +ĠB ro +Ġj ar +// / +ĠG pu +Con sumer +AR EA +cur ves +ag a +ts k +og gle +ĠH AS +Ġac p +Ġac cs +AL I +Ġspe ll +Ġdate fmt +default dict +spe ll +IM AGES +Ġdis placement +75 4 +38 1 +Ġmin im +pop en +be ar +Col lector +77 2309 +top LeftOverhang +Ch at +ĠJ S +ld ap +Ġq r +67 2 +ĠPro xy +fir ms +Max Pool +eval uator +Comp iler +Comp osite +over laps +Ġsign ing +Ġexec uting +Man agement +Request ed +Ġoptim ized +Ġsu itable +drop down +rat os +sen se +Ġparti tions +cd c +аР¹ +Ġ"% . +Ed ges +Ġconf lict +SV C +115 34202 +Char acter +ĠOb j +Ġsav es +sym metric +Sa int +Ġ"# " +subject s +Target s +íķ ´ +Ġrequire ment +Ġdot s +dq n +('_ ')[ +Ġ"$ { +ĠId entifier +Float ing +Translation Messages +Ret ry +Ġrefer rer +Lin ker +Active TranslationMessages +Ve hicle +aud rate +Ġattach ment +SPE C +ĠCurrent ly +00101111 011111111111111 +ĠMer ge +01011101 001 +particip ants +TIM ESTAMP +Ġaff inity +MAT RIX +Null Argument +ĠSummary Writer +Ġadjac ent +ог о +101011 011111001101000000 +ĠCRE ATE +Ġalle le +ĠTile Pyramid +ĠMig rate +ĠBatchNorm alization +PECT ED +ĠInstanti ate +1011100111111100 01011101001 +Statistical Processing +00110000001000011111111 11111 +962775916 1741 +ricul um +11534202 07 +" }\ +& # +. ] +6 85 +7 15 +E ye +K D +L exer +N h +O A +P X +R SA +S UP +T CHA +U PPER +W heel +Z v +b ic +c ds +d temp +e se +g U +g ist +h repr +i ec +m list +m ale +n othing +z k +Ð ¡ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ùħ +in er +in ame +se quent +Ġ' )[ +ro pping +ti ll +Ġa w +lo de +ur t +Ġre lu +Ġre scale +li des +ra form +Ġe a +Ġe h +Ġe os +ion i +() ') +ent h +th row +(" $ +ĠS ie +Ġof fer +ĠC rypto +ĠA lex +Ġcon ditional +Ġh w +Ġst udents +Ġde coding +ine craft +Re verse +nt s +ject or +Ġpro vision +py units +ĠE ast +AT L +AT ER +lot s +mo vies +per mit +ssage s +SE L +ari ties +ne ural +'' . +count y +LE AR +Ġ{} ' +Ġall en +[: ])) +'. / +ock ets +lat ency +stra ined +Ġindex ed +... \ +Res olution +rc nn +Ġli mb +Co ords +ä¸ » +Ġar cade +To o +gener ators +âĢ ľ +No tes +Ġwork book +wo od +Get Status +Ġsum maries +Ġshape ly +ãĤ Ĭ +åı £ +Th rough +font Size +Sp ot +ĠMe mo +ĠDE V +nb cr +mock er +Ġ---------------------------------------------------------------- ------ +comm unities +Ġdraw n +Ġ'../ ../ +à® ³ +Ġhow ever +screen shot +Ġplatform s +ĠWh ite +ç» ĥ +024 0845 +AUTH ORS +Ġpa inter +Grid Point +COMP LETED +Ġquanti le +Order edDict +VALID ATION +BI KA +Ġcdbp RealmMessageRoute +Ġcla use +ivers al +perm ute +Render System +dw g +å®ļ ä¹ī +MON GO +Ġfire wall +ograph ic +ĠTw itter +Ba seline +æµĭ è¯ķ +Private Key +ndi mage +ĠAli gn +æĦ ı +IET F +ë© ´ +å¤Ħ çIJĨ +110000110101111 0000111111 +11101101110011 101111111111 +962093 0240845 +1001101000001011111111 11111 +87297315 10836 +) ". ++ ---------------- +6 11 +6 36 +6 57 +F J +F latten +H pr +K P +K nown +L VC +M PT +M usic +N othing +O i +P GIE +S orted +T IC +V t +W ire +X J +X PATH +Y G +b rown +c ff +c func +e ks +f wd +g ran +i ot +i ans +o pe +p up +s ap +s vo +s outh +t docs +u ang +x Pos +z G +® ółĢ +re lay +le aves +Ġp w +Ġf m +he ses +ce p +Ġs chool +Ġs liding +Ġin voice +Ġre lax +un tos +Ġm b +Ġm it +Ġm ist +ra x +la w +co t +Ġb k +Ġ1 43 +int a +Ġw ent +Ġ[ [" +)) + +il enet +Ġ2 06 +as p +op stress +ĠS W +ĠS ound +ĠS TE +ĠF ake +ĠF ront +Ġh h +Ġst reet +Ġde posit +ĠD a +ĠD ay +Re pr +Ġse u +add GridPoint +ĠB OT +ĠB ridge +format ters +Ġout line +Con vention +ĠV irtual +ĠU TC +ST O +max ima +dd dd +Ġra dio +sub stit +work sheet +ĠCon verts +33 35 +no isy +Ġspe ech +Ġext ern +List s +Ġunder stand +local es +Ġmin ima +ich i +sg d +FA ST +Ġgroup ing +ik es +conv ers +ðŁij ¨ +Ġ200 4 +---------------------------------------------------------------- ----------- +na ma +Ġscri bus +Sub Element +leg acy +0000000000000000 10010011 +fill er +transp arent +ĠConfig ure +hand led +ĠCol lect +ä½ įç½® +vol ved +1001 000000000000000000 +ane se +Ġ') ' +Min i +Ġow l +pa int +Ġstack ed +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Ġradi al +From String +ا ر +Ass ign +Ġpresent ed +tific ates +vl rep +hy dro +lec tive +cdbp RealmMessageRoute +ü r +={} ): +Ġshare x +health y +åŃŠ符 +Ġseparate ly +ĠKe ep +ĠSw itch +ĠHome Assistant +phot os +MULT I +sser act +quat ernion +ðŁı´ółģ³ółģ© ółĢ°ółĢ +Multiple Locator +abe tes +Ġflt Stmt +Trade Que +GIT HUB +çĶŁæĪIJ çļĦ +Pur chase +Ġtopo logy +Ġtrt l +Ġimmediate ly +å¡ « +ðŁı´ółģ¬ółģ¶ ółĢ°ółĢ +没 æľī +Heavy Test +0101000010110011 0101011 +#~ #~ +01100100011 011110011111 +ĠADAP TED +* [@ +. ': +A ir +A da +C pu +M ad +N r +P as +S MS +T ape +W G +W s +W atch +W ind +W hether +X z +Z r +b ay +b road +d V +d ynamodb +g te +i log +j R +k nots +k ryptonite +o ol +o xygen +s keleton +v q +ç ¥ +Ġ (), +en gines +an cial +Ġ' ] +A rial +B K +B w +B US +D on +D st +E K +I Y +I i +L ang +M ig +M oney +N AL +O V +S age +S po +S ites +W est +W ins +Z t +b urn +c ensus +d A +d Y +e uclidean +m V +n sp +o i +q N +t reatment +u w +u its +v X +v z +v pc +x scale +µ ółĢ +à ° +â ĺ +ì ĺ +í Ļ +Ġ Å +Ġ (): +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +in omial +st udies +en otype +Ġt an +Ġt fill +ar ms +Ġc bl +00 42 +Ġn ic +Ġs ched +Ġre construct +Ġo file +un te +un supported +Ġm utation +Ġ( # +ch op +di com +get Name +set Color +ĠT r +op Panel +ĠS can +ĠC el +Ġl iteral +end ance +sp ar +01 011100 +am an +sc ikit +ĠP as +im uth +out going +out liers +ac ao +Re po +ĠM AIN +oun ty +Ġ_ ('[ +Ġma ch +.. ", +'], [' +ĠE poch +ĠE inf +ĠN S +tp u +ep ub +read out +lic er +per io +oc ations +ph ases +ĠG pCronDump +ag ram +06 9 +enti st +db name +Ġsub plot +Ġsub tract +Ġso cial +Ġ{' _ +Ġac curate +mpl ers +AL SE +Ġla ser +'. ' +Ġbo id +Ġlin eno +82 1 +To List +De gree +ãģ ķ +Ġover rides +ðŁij © +Ġav ailability +RES PROCESSING +SC ORE +Ġtri als +Handler Hive +Ġoper and +optim ized +Auth enticated +Pos itive +аР± +Be fore +âķ ° +âķ Ń +FORM ATION +Ġreport ed +IR ON +An chor +Ġfit ness +åŃ ¦ +Ġip v +MB A +Ġcoun ty +åĽ ĺ +ĠDis able +agg le +Sa ver +relation ship +Variable s +Ġrank ings +Ạ¡ +Ġcommit ter +Ġcomplete ly +Ġtw itter +ĠValid ator +Rel ative +Ġadjust ed +geo json +çī Ī +ðŁij¨ðŁı » +ðŁij¨ðŁı ¼ +ðŁij¨ðŁı ½ +ðŁij¨ðŁı ¾ +ðŁij¨ðŁı ¿ +ðŁij©ðŁı » +ðŁij©ðŁı ¼ +ðŁij©ðŁı ½ +ðŁij©ðŁı ¾ +ðŁij©ðŁı ¿ +Scre ener +DEL AY +0111100 11111111111111111 +Ġscra pe +ĠtypeOf StatisticalProcessing +ðŁı´ółģ´ółģ ¨ +MON ITOR +âĸĪâĸĪâķ Ķ +âĸĪâĸĪâķ Ĺ +æĬ Ĭ +Dele tion +REPL ACE +Ġsan itize +Inser t +REQUI RE +Hyper Par +Ġbuff ers +ĠSto ck +ĠInte gr +Ġbracket s +Ġcid r +SHE LL +Called ProcessError +uncer tainty +0010101001 000000000000000 +ToPre sto +HandlerHive ToPresto +$ ' +( & +) ^ ++ )\ +/ {} +4 10 +6 37 +6 86 +B OLD +C AM +C AS +C ols +D ONE +D WORD +F ocus +M H +N ative +O LO +S l +S PECI +\ ": +] < +a D +f O +g ar +g ro +h ance +h resh +h ypothesis +m ib +n dims +p las +p lug +p seud +t B +t ens +t rend +v g +v h +z p +} < +} $', +Ø ® +Ġ ]. +Ġ ***** +į ° +or ail +re covery +le cts +Ġi aa +Ġ' ')) +00 10 +00 13 +Ġn atural +Ġs aml +Ġre boot +un ched +ra ge +Ġe ts +Ġb ib +Ġw a +from txt +ot onic +th s +pp able +ve hicles +Ġof fice +ĠC lick +up dater +Ġg ens +par i +ĠF lood +Ġh om +Ġh ero +po ster +ĠP E +ĠP iece +=' + +ĠM IB +ĠM esh +Ġv archar +os ing +Ġwith draw +tra cing +"] \ +ĠB ri +In spect +mo v +Ġco g +Con cat +Con tract +Ġan omaly +13 07 +class name +15 00 +100 0100011 +Ġch erry +64 1 +08 9 +ðŁ IJ +sub sets +lob by +eri an +Pro c +Pro j +Ġsub classes +96 3 +()) ): +fer mi +Ġline age +return ed +86 147 +Ġmax len +fa de +Ġhelp s +Ġ! !! +trans fers +66 9 +Ċĉĉĉ Ċĉ +be lief +Ġcolor ama +Ġmo le +ä¸ ² +Ġtrans fers +ĠEx cel +Ġ9 00 +dire ctor +wh itespace +iter tools +Lo aded +CL K +Ġqu ant +а ем +copy file +Ġtag ged +Ġcount ing +access or +Reg ular +Th ree +fra ppe +PRO B +App Adv +Ġoper ating +ision Tree +ĠImage Draw +Ġloc s +report er +ĠBase Command +]+ ) +rank ing +UB E +rot tle +cap abilities +cla w +spect ral +Ġscal es +Ġcap sys +Ġvari ants +land marks +enum erate +quanti zer +abi li +ĠMy Custom +aj ax +asc ending +Ġvo tes +Tri al +Ġbig ger +301 538 +Ġsol ved +åİ Ł +Part s +ĠPri ce +DIM ENSION +Fla sk +0110 111111111111111111111 +Print er +Div ision +Enabled Status +DOWN LOAD +01011111111 1 +ĠChange s +deriv ed +RUN NING +æµ ģ +PLAY ER +ĠSci entific +Ġassume s +Ent ries +Cir cle +Ġgal axy +ĠAB CMeta +HAND LER +ĠWOR K +PRODU CT +Exclu ir +Ġslight ly +9627736 301538 +9218108157 347 +$ " +. - +4 93 +5 43 +6 99 +6 35 +7 84 +8 37 +B x +C e +C ORE +D ING +E lt +F K +F b +G ain +H ouse +I FF +J K +J PEG +P en +R Q +S z +S ame +X g +Y j +\ ". +a head +b ob +d U +d um +f urther +g love +h on +i ris +k de +m ind +q ml +» åĬł +è ¢ +è ī +ê · +ë Ĥ +Ċ ĊĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠ +Ġ Ú© +in complete +st ro +st ds +Ġt al +Ġt alk +ar ctan +Ġc mp +Ġf ly +Ġ" (" +ce x +ur ity +ss d +Ġre action +Ġo mitted +() ") +Ġ1 57 +Ġ1 56 +id os +di ameter +is finite +one t +ĠT W +(" ' +Ġr an +'] ==' +Ġcon tra +Ġcon struction +Ġcon verter +to string +ĠF inal +sc affold +om en +ĠP ID +ĠI gn +out ine +ĠD ynOv +ac cs +ac man +sh ake +Ġy t +ĠO ff +Ġpar m +ĠB its +tp l +Ġun d +Ġlog it +ĠV o +ĠU SA +RE MOVE +ĠRe ply +Ġsh p +db pedia +LL OW +work book +Ġpo kemon +Ġsub p +Ġsub title +Ġ} ] +RO T +Ġapp ended +Ġuse cols +create Object +CO MB +man ip +AC CA +98 2 +98 3 +))) *( +PO D +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +ĠIN FO +46 1 +Ġval ores +ell ation +Ġcor ners +Ġcor relations +Ġback wards +MO USE +over rides +OP ort +Ġ200 2 +At tack +PL AN +Base Prot +diff s +Ġfin ds +Sub scriber +ĠAPI Router +LOG Y +Ġì Īĺ +æľ ª +Ġposition al +è¯ į +ĠComp utes +apt ers +Ġstyle s +Ele v +Ġconnect ing +VID IA +Ġacc ident +Ġreal m +quanti ties +quanti ze +éĩ ij +%% %% +Sk y +ati os +Random State +Rel ated +ĠTra de +hy brid +Cluster ing +Eval uate +("< @{}> +expect ations +Ma jor +ĠDire ction +Ġchart s +Dest roy +Ġide a +Ġpersist ent +10011111111 111111 +,:, :] +Ġ#---------------------------------------------------------------- ---- +ancest ors +erg ies +Ġrespec tive +Ġke pt +ĠPAR AM +Nv API +Ġrecur sively +Ground GHI +deleg ate +alla uth +è¿ŀ æİ¥ +Ŀå§ĭ åĮĸ +energ ies +000001100101 010111111111 +Dia BaseProt +772309 86147 +# ---------------- +* (- +2 0000 +6 84 +8 35 += ': +A J +A LE +C sv +C ROSS +D PT +H V +H azards +I mm +N g +V el +X Z +X l +Y L +Z M +b D +d in +d mp +j an +j np +l le +n D +p ump +u las +v env +} ')) +à ½ +Ø · +â ľ +Ġ ĉĉ +Į Ģ +Ĵ åŃIJ +st ype +en cing +Ġc one +Ġc raw +Ġ" {}". +Ġa ch +Ġa data +00 16 +Ġn v +Ġn ie +Ġs id +Ġs weep +Ġre ar +Ġd hcp +ad og +Ġ1 79 +11 01111 +di p +di ffic +di vergence +): \ +es sel +__ \ +(' {}/ +str ategies +Ġ2 27 +(" ^ +pp y +Ġ{ ** +ĠS ta +ĠS ql +ĠS GD +ab ling +ĠC R +data path +ĠA nn +ĠA ng +ĠF ixed +Ġ3 26 +Ġ3 53 +ĠD ist +ĠD avid +]) - +sh util +sh tein +ĠM C +ĠM is +ĠO NN +tra it +Ġpro v +07 9 +Ġ) [ +In vert +Ġlog o +ph ones +Ġ__ _ +min ant +da mp +Ġro setta +Ġal phas +lit tle +ne my +ĠRe al +Ġsh op +Ġdi visor +db r +ĠIn stitute +Ġkey points +inter actions +ill ate +ill um +55 9 +55 55 +Ġcur ves +RO LL +-------------------------------- -- +Ġla s +=[ - +Ġdist s +Ġmax ima +reg isters +Ġbo ost +do o +do ctype +66 3 +75 0 +45 9 +77 4 +ide s +Ġinter pret +Ġenum s +Ġgo als +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ +}) " +TH IS +67 3 +48 1 +Ġhttp lib +ĠPar ams +Add Task +mer cial +scope d +CA Y +ĠGener ates +book mark +0100 0101 +ops is +Ġtri ple +git lab +Ġoper ate +ven shtein +ĠLo oseVersion +ä» ¤ +VER BOSE +upper case +fin ity +Dis p +ha ust +Ġexit ing +è¯ ¯ +mm r +Ġstream s +inf lu +Ext ended +Enum eration +ĠUp load +Ġplace ment +åĽ ½ +Red is +ĠInter val +install er +ĠAR G +schedule s +DEF INED +Component Def +NOT E +ĠDes ign +Ġdrop ped +FIX ED +ĠCont in +Ġctsp Downloaded +éĻ Ħ +Work ing +æŀ IJ +Ġequ als +Cre ator +Ġmis match +Ġcla im +cum ulative +Ġpot entially +lar gest +Ġnu cle +Remove Task +DEL TA +Drop box +Tun able +sat is +MN IST +Ġai ida +Ġtele metry +horizontal Slider +Weight ed +Ġquat ernion +Bound ing +ç´ ł +ĠTransform er +PACK AGE +è¾ĵ åĩº +erio dic +Sig ma +snmp labs +prox ies +ĠPur pose +Ġstandardi ze +æĿĥ éĻIJ +Ġsob re +Learn er +10001111101000010000 011 +01111110101111011 000001 +Ġallen nlp +COLO UR +ĠONN X +* ' +* / +, ** +- '+ +6 19 +8 03 +8 64 += + += {}'. +A IT +B ED +F FIX +F rozen +M ultip +O ld +P CT +S CO +S ales +U m +W V +W x +W ill +[ ]. +b lo +b ate +d xf +d ock +f le +h en +j E +k lass +n J +o a +o Helper +q h +r si +x w +x Auth +¤ ółģ¿ +Ġ ÑĢ +in fe +at ernion +re present +Ġt g +Ġt el +Ġt reat +le aderboard +Ġi ce +Ġc le +Ġf utures +Ġ" "), +Ġs lave +ur df +Ġin cre +Ġre corded +Ġd ual +un ge +un ravel +Ġm iss +la ser +() + +ri ed +Ġb anner +ul der +set Auto +ĠT ermin +th anks +(" \\ +up l +Ġr b +ĠA G +Ġcon ti +am t +ĠF oo +qu iz +Ġh ip +ĠP C +out line +ĠD ele +ĠD river +Re quires +ĠM al +ĠM ON +ĠM akes +Ġme et +tra versal +pre set +ap ons +ĠB ATCH +ĠE ither +xa vier +ĠN av +mo c +fo v +ĠW ater +ĠV ARCH +che me +min max +Ġtime d +ag ain +13 01 +og o +ðŁ ĵ +ðŁ ķ +pi ot +UT IL +comp ounds +comp iled +84 2 +Ġ} )) +stra ight +mon orail +IS HED +Ġte ams +47 2 +ai ro +Ġar p +FF A +ðŁı´ółģ ªółģ +Ġexp ired +čĊčĊ čĊ +Ġobj s +ĠRes Net +ÑĤ и +extra cted +################################################################ ###### +admin s +Ġì ĺ +WS GI +Pos itions +Ġstat uses +alle le +multi processing +ĠPRO JECT +NN CF +Sc roll +æĺ İ +ĠAuth entication +SO CIAL +Ġfun cs +Ñĥ Ñĩ +duc ing +high light +desc r +fast q +ĠCO DE +ĠDi ameter +Ġshell code +Ne ighbors +diag ram +ĠAss oci +æŃ ¦ +Change s +æĿ ¡ +ĠPh ase +cdbp Peer +micro soft +RESULT S +11100 010000 +ste in +Ġstrip ped +adv anced +Ġrelation ships +Ġapprox imation +æĽ ¸ +аÑĤ ел +Med ian +Ġepisode s +COR D +Bad Request +ìŀ IJ +ĠLinear Regression +èµ · +__} .") +friend ly +ĠDete ction +LAY ER +FIN AL +ĠNE W +yan dex +Ġfrequ encies +datal ake +ingredi ent +emi ssion +Disable Collision +Squ ares +ACTIV ITY +Solid Pattern +ĠINTE GER +Ġencounter ed +COOK IE +001011110111101011 001 +curac ies +è®Ń ç»ĥ +ĠVARCH AR +, < +5 14 +5 08 +5 24 +6 13 +6 75 +7 31 +G F +G h +G y +G lyph +H alf +H IST +M EN +P f +P ut +Q o +Q ubit +S un +S ources +X M +c H +k means +k appa +m dao +n cols +t iny +u ction +v ista +y thon +{ % +ª ¨ +Ù ĥ +Ġ ĊĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +at ten +re tention +ĊĠĠĠ ĊĠĠĠ +en cia +ti tions +Ġc te +Ġf avor +Ġ" '" +Ġa go +ort e +Ġn z +Ġn pt +Ġs ales +Ġin ts +Ġin fra +Ġd ust +Ġd yn +pe ek +un defined +Ġm v +() ==" +Ġ1 94 +Ġ# ---------------- +11 05 +ma k +ul ating +es o +set Input +Ġto uch +il arities +(" >>> >>>> +bla de +ê³ ł +Ġ'{}' ". +ĠFire fox +ĠHE AD +"""" """" +Elect ron +Ġims ave +ĠIsland s +MISS ION +ĠDel ta +çĻ» å½ķ +1011011011 01110000 +PKT LOG +ĠAUT O +( "," +) ([ +, : +, :], +3 90 +3 91 +7 32 +8 05 +> # +C w +E q +E VAL +F AR +H q +K M +L ife +Q Application +T IO +T issues +V ect +X a +] != +a er +a qu +d L +d S +e D +f B +g cc +h il +i sel +i mplemented +m ort +m arg +n th +p V +r in +u der +u ating +v N +v acc +w at +w agtail +| {} +Î ¯ +Ú º +æ » +Ġ vert +ĺ 认 +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +re cursion +en i +Ġt stamp +al ta +al ice +Ġi ris +Ġ' ` +Ġc ot +Ġp an +Ġp il +Ġp res +Ġn tw +Ġs ma +Ġs ali +ur k +Ġre moves +Ġd set +() ': +co o +Ġb urn +Ġb ranches +Ġ1 73 +11 23 +id om +Ġif ace +"" + +el u +get D +(' %( +iz ard +et sys +ĠS elf +ig ma +Ġg ir +Ġl g +Ġl x +ĠA ctions +ĠA xes +Ġcon cept +path name +ĠF i +ĠF ORM +qu arter +vi o +tr s +Ġde crypt +ac er +ĠM aster +Ġv env +ĠO VER +tra vel +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠN L +Ġun label +ĠG reen +Ġout File +Ġan ti +Ġan onymous +IT IES +St ash +Ġ6 44 +06 25 +Ġwh atever +93 0 +ne y +Ġ[] } +AN GE +19 48 +Ġpo ses +Ġsub dir +AM ES +Ġac ados +Ġinput Tag +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +86 3 +Ġdo or +rc l +Ġli dar +']) ): +PT R +AB S +Col lect +File Writer +ome tries +Ġread ings +down loaded +EX IT +ĠData Keys +mer c +mer ce +fore ver +åı Ĭ +Ġtitle s +su it +ĠMed ia +Ġheader Lines +ee e +Ġpost fix +web app +cip itation +è¯ Ĩ +NA VX +Ġstop words +vol atile +Ġaut odock +Ġjust ify +Ġunicode data +Ġmod s +)( ? +SM TP +Iter able +Mark up +ctsp Downloaded +emp loyee +1234 5 +bri cks +LOAD BALANC +ĠÑģ ÑĤ +syn th +nav igation +ony ms +åij Ĭ +Ġblue print +nor med +Ġrepe ats +Ġdiv mod +ij k +fire wall +autog ui +SR V +ĠPY THON +éĤ ® +gold en +ĠSERV ICE +Measure d +99999 8 +chip type +ĠPoly axon +Ġbri ck +ĠBuil ding +Tr uth +Ġprojected X +代 çłģ +Hex Bytes +æĮĩ å®ļ +Prob ability +é» ĺ认 +Zip File +ĠTE MP +ÑĨи и +166666 6666 +golds berry +ĠVER BOSE +ìĥ ģ +# - +) `` +* ) +* , +/ {}". +5 15 +6 93 +7 17 +7 96 +A mt +A ux +B tn +C art +F q +F atal +G ene +K Y +K o +L am +O DE +Q k +S leep +S imp +V j +V ED +Z i +\ ", +_ ') +b B +b ine +c rc +c ql +g ol +g db +g pm +j b +j y +l ut +l ars +r pt +s ans +w sa +w hether +à ² +è Ń +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ å¦Ĥæŀľ +Ĩ Ĵ +ł éĻ¤ +en emy +ro per +Ġf air +00 25 +00 20 +ce vap +Ġn col +Ġs lide +Ġre con +Ġd ise +Ġm ip +ra de +Ġe ma +Ġe tag +() [: +ent al +co b +co lo +Ġb unch +Ġ1 66 +Ġ1 54 +Ġ1 59 +set Geometry +(" + +ĠC ard +ĠC ourse +ig gy +Ġg lyph +Ġl u +end encies +'] [:] +ĠF lorida +=' '): +Ġ3 84 +ĠD istance +ĠM ost +Ġ_ : +Ġse verity +ĠB R +ĠB er +ĠN VIDIA +Ġres ized +bo id +ĠR AT +ĠR ich +Ġun ders +ĠG i +ho u +Ġout f +ag het +enti re +iti zed +RE CE +IC ON +ĠRe ferences +Ġ{} ), +][ :- +ĠK Means +do ub +Ġper c +CO VID +und ant +Ġmin s +title d +ĠQ MessageBox +ref ine +77 2 +item id +find All +HO P +HO UR +Ġser ving +temp s +exec uted +Ġseri alization +Ġval uenum +Ġplot ter +INT EGER +fe j +\\ / +Ġnorm alizer +ĠTest Model +pol ynomial +Ġlib rosa +fs m +PRO PER +sim ulate +Inter action +Al ert +Al ready +ĠCh at +inst ead +bit wise +VE CTOR +Pre dictor +GR ESS +Gener ation +Dis position +supp ly +('- ', +ĠPo ssible +master DataDirectory +Method Descriptor +ĠOb tain +ĠSh ort +Ġaverage d +Off ence +gree ment +ĠRed is +ç» Ļ +Bu y +Ġapply ing +Ġho spital +ÑĮ но +byte code +ĠOutput s +čĊĉĉĉĉ Ġ +ĠHe alth +deploy ments +Contain s +Ġ'" ' +Ġcla zz +OEO HW +иР· +Ġmac ros +Uni que +SERVER MESSAGE +mig ration +å± Ĥ +æ¯ į +æĶ ¶ +ĠCLI Error +æĭ © +identi fy +COR RECT +Ġconcat en +å¿ ĥ +Ġprote cted +augment ation +çĻ ¾ +Ġhook s +rab bit +sector s +LOW ER +############################################################ ### +ĠVis u +Cir cuit +,, ,, +иÑĤ ÑĮ +LAT EST +ĠLa unch +prim itives +uzz le +æł¼ å¼ı +éĢī æĭ© +Sent ence +DOC UMENT +1166 13 +Ġingredi ent +neighbour s +ĠtThisFlip Global +Members hip +dad guide +STY LE +éĵ ¾ +į° ìĿ´íĦ° +Ġets ys +moud le +PLAT FORM +101101101101110000 11011 +" # +. '), +4 13 +6 32 +6 34 +6 27 +7 11 +7 12 +7 57 +8 12 +8 06 +B ron +B alancer +F lux +G s +G ray +I x +I y +I z +J u +M DB +M ARGIN +O o +O cc +R at +S np +S uch +T ip +U Registers +W ALL +X F +Y g +] }" +b read +d E +d eno +m ist +o va +p ager +r ts +u ing +w ang +w tf +w elcome +y f +Å ¾ +Ð Ķ +Ð Ŀ +Ñ Ĭ +Ø µ +ç Ł¥ +í ĺ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +or b +at ore +re in +re tain +Ġ= == +st ic +Ġi mag +me cti +Ġ' ] +ti lt +Ġc ats +Ġp ure +Ġf re +Ġf uel +he app +', ', +Ġs lider +ing ers +Ġd nn +Ġm lp +Ġe md +ate ly +ad r +Ġb isect +Ġ1 76 +id ents +Ġw ants +ma e +ul ers +ĠT MA +Ġ2 12 +et ype +Ġg uid +Ġr tr +ĠA CC +ĠF F +Ġh l +Ġh alo +Ġde liver +pro per +0000 100 +Ġex pose +Ġ3 86 +Ġ3 43 +10 11111 +ĠD ash +ĠD IST +sh ant +ĠM u +Ġv acc +Ġse quential +.. ... +Ġme ss +tra ding +ob G +AT G +xa ct +ĠN umpy +col l +In line +Ġun supported +Ġtest case +ho ue +Ġout s +Ġout lier +Ġout going +print er +mb l +Ġan os +Ġpy ramid +Ġ6 40 +ump tions +og ra +ass andra +we aks +Ġal g +RE AL +IC ATE +work dir +start Time +uil ds +ask s +Ġsub string +Ġsub graph +96 0 +94 46 +av ail +number Of +current Text +CO DES +trans Axes +Ġli s +44 0 +ET S +Ġinter net +Ġinter actions +]] ], +[:, ' +IL ON +Ġsk u +UN DEFINED +Ġdire cted +open id +sign er +ĠList Node +Ġany way +Ġgroup by +ble u +tmp file +TO OLS +54 9 +01111 111 +Bo otstrap +send Transaction +pol ar +raise d +Loc ations +Al tern +full name +Ad ditional +bit coin +VER T +Ġfin ite +Ġdir path +embed ded +draw ing +á li +imp act +imp rove +depth s +Ġrest aurants +Sim s +CD C +nan mean +ä½ ı +rest ful +Di h +Di richlet +noti fier +alo aders +Ġcap abilities +Ġreplace ments +ĠPre fix +ĠAd ded +Ġclean ing +land s +Device Cdc +zz le +Control led +ĠOn ce +digit al +Sa mpling +Ġbottom Most +ĠClass ification +ĠFL AG +Ġfo ot +Fin ish +bri ck +Ġsyn chron +Ġlight s +ĠVAL ID +Ġresid uals +Ġbul lets +Ġdetermin istic +escape d +Ġbg color +Cho ose +ili ary +Ġfbx Node +10111011 011 +{: < +Gate way +Pack ets +Ñħ од +occ upancy +ĠTag s +Ġfraction al +ìŀ ¥ +subscription s +prun e +('" '+ +REQUI RES +æ° ij +Ġtrunc ated +ĠPoly gon +éĸ ĭ +Exists Error +$$$$ $$$$ +Ġadjac ency +("/") [- +Ġens ures +Ġ[{} ], +Aug ment +associ ation +Ġpesso a +Bro oklyn +PROVID ER +ĠIp Address +00001111001 00000011 +010010101011111111 1101111 +Ġski prows +ãĥķ ãĤ +readout err +ĠScre en +ORmt Port +1110001000001011100 1111 +aghet ti +$ % +) "," +5 18 +7 03 +8 14 +8 36 +: {}'. +B IO +C u +G IN +I r +J w +M ICRO +N ome +P v +P ull +Q H +R m +R AR +R ARY +U O +W D +W elcome +a L +c gi +d R +d ual +d uplicated +e lastic +j m +k ld +m ir +m ware +n ier +p auli +v oting +à ¬ +é ¦¬ +ë ¦¬ +IJ ĺ +in consistent +in cluding +at tached +re use +re servation +se ment +st uff +Ġt min +Ġt cl +Ġt une +al titude +Ġp ul +Ġp tr +Ġf v +Ġf aker +Ġn g +Ġs co +ing u +Ġe uclidean +fi ber +ad ult +Ġb ond +11 84 +Ġw al +ol ar +urn ame +con gestion +ĠC DF +up o +data file +ĠA H +ĠA g +sp k +'] ]], +ĠF ill +ĠF IG +vi al +po ss +ĠI R +=' . +Ġde position +pt ables +Ġprint error +ĠD LL +ĠM oney +ĠM achine +=" +", +ĠO PT +Ġx gb +Ġse mi +IN F +pre dicates +"] }) +ĠE very +ci e +ind ptr +ĠW AIT +ise s +Ġk k +Ġro is +ag ency +Ġal fa +Ġal bum +ok c +ok er +ou ch +08 2 +ĠRe cipe +Ġsc Sim +ĠIn dicator +Ġsub lime +mi ce +{} ] +Ġdo ub +Res Net +Ġdis c +Ġdis plays +75 2 +yst ream +Id enti +FI ED +Ġ(' % +Ġim db +Ġinter pre +UN E +tiv o +DI O +temp orary +DO MO +graph ql +place ments +ĠAr g +])) . +descriptor s +âĸ ĵ +rol led +send Message +Le ss +pr ing +Reg istration +ãĤ ¸ +Ġav atar +Th at +Ġsession maker +QU I +Sh are +BU F +keep er +äº ļ +pair wise +PU B +dat um +ĠCheck ing +Ġweb app +fc n +cd k +Ġdiffer enti ++" _ +Output s +Sc ra +skip if +Ġdat adir +ĠPre diction +ĠPer cent +Ġ'{ { +utor ials +ĠFla gs +fun ctools +curs os +uch db +ĠHTTP Status +199 5 +band it +Ạ¿ +Ġissue d +ĠPoint s +Vis ible +cnt l +ĠSQL ite +Supp ly +ĠGroup s +Ġpol ar +Ġev olution +Ġsn mp +PARAM ETER +ов еÑĢ +Dig is +ĠAUTH OR +Ġ'$ '],[' +ĠSER VER +ĠUni form +chrom osome +Cred ential +listen ers +Ġweek day +TEMPL ATES +YE LLOW +RAN DOM +Ġaccum ulate +âķIJâķIJ âķIJâķIJ +Labels Entry +KI LL +trunc ated +CLO UD +Align ment +(".") [ +Ġdisp on +Ġaffect ed +^^^^^^^^ ^^^^^^^^ +Hot Encoder +Tol erance +ĠPol ynomial +utr ino +Voice If +ç¡ ® +varn ode +SPL IT +Tensorflow Model +Wifi Bridge +ivari ate +iggy back +- \\ +5 11 +5 27 +6 22 +8 07 +8 25 += & +D NS +F r +G Z +G UID +G rids +L os +P Q +Q Rect +S MALL +T z +T FT +W w +X B +Z ERO +_ ] +b ath +d olu +e jected +f li +g ib +i mplementation +k ine +n ans +o ss +s ale +t fidf +w v +w gt +z E +z w +z OR +{ \\ +} `` +} }) +à ¥ +Ð Ĺ +å Ĥ +ç ° +ì ² +ĉ Ċĉ +Ġ âĶ +Ġ à° +į ä½ľ +ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +at ol +st dev +en rich +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ +Ġt rend +de co +Ġi v +Ġi map +ro setta +ti s +Ġc and +Ġc url +Ġp et +Ġp sd +Ġf olds +it ched +Ġa ck +Ġs am +Ġs dk +Ġs rv +Ġs kew +Ġre ce +Ġre jected +Ġo v +pe ed +Ġm h +Ġe fficiency +11 85 +um s +Ġw k +di go +ul li +__ " +set Units +ĠT PU +us uario +(" ---------------- +(" '", +as cade +ve is +Ġ7 20 +ĠS ch +") \ +Ġg hub +Ġr q +01 25 +Ġcon secutive +Ġh r +ĠP ark +=' * +pro ton +ĠM ED +Ġv ac +Ġv ae +Ġx xx +Ġse qu +Ġj p +Ġj upyter +ĠN Number +Ġ4 50 +ĠR ound +Ġlog arith +per ceptron +ĠW rap +ĠV K +Ġmodel ing +SE CTION +ec an +Ġpre view +Ġtra ding +ĠH z +ĠRe ads +sub reddit +lin ha +09 1 +ĠIn voice +()) ] +()) ), +exp onential +97 2 +{} ' +Ġ'- ': +run ners +57 3 +Ġ[' _ +OT HER +Ex cel +ĠQ gs +ĠQ Widget +Ġmo v +ash ion +Log ical +DI FF +De ferred +not OK +US ERS +67 9 +ãģ Ĩ +ãģ ı +ï¼ Ľ +Ġimp act +OP ERATION +ÑĤ о +ĠWe bs +App liance +:` . +ĠType s +é m +hel ter +0000000000000000 0000 +Port s +æķ° éĩı +ĠRun s +Ġkeep dim +å® ī +еР¿ +Ġ---------------------------------------------------------------- ----------- +æĺ ¾ +Oper ational +comm ut +à° ¨ +Ġcap ac +ĠRE G +Ġë ³ +Ġrel ations +Ġseed s +bottom LeftOverhang +ĠOpen API +å¾ ħ +Ġgra des +AUTH ENT +Ġatom ic +Ġpa int +actor s +Ġп олÑĮзоваÑĤел +Ġexperiment al +Connection Error +å¯ ¼ +Ġdump s +pher ical +Bind ings +bre w +Import er +286 6 +Sgacl Monitor +Ġsv n +ĠSpe cial +Ġdeploy ed +åŃĹ æ®µ +0004 23 +Ġdr ug +SW AP +Estim ated +é¢ ij +çº § +cpwVc Perf +La unch +LLLLLL L +Let alis +ani el +Ti po +Deploy Options +ĠAllow ed +tele gram +è´ ¥ +Allow ed +Da emon +cite key +Ġhum idity +ĠElement Tree +ĠAnsible Module +robust ness +shif ts +ĠAnnot ation +bil inear +elo quent +sear ched +agree ment +ĠUtil ity +01100100010101111 1011111 +00001011111111 00011 +Aff ine +perio dic +è¢ « +houe tte +) & +- ]+ +/ {}. +3 80 +6 07 +7 75 +8 32 +B h +B ounds +B ond +C c +C s +D MP +F our +G CN +H SV +J x +K U +K l +M l +M AR +N s +N EXT +Q G +S AN +Y i +Z H +Z L +_ =" +_ [" +a es +b R +b row +c ate +c fi +c aching +e L +f F +f used +h line +o ssible +p tive +q id +t fill +u E +x code +y data +× Ķ +á ¼ +ë ² +í ĸ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ��ĠĠĠĠĠĠĠĠ +Ġ lifecycle +Ġ ************************************************************************ +ģ ¬ +at ility +re ts +re construction +Ġt u +Ġt reated +ar ded +de velopment +Ġc make +Ġp our +Ġp fx +Ġf y +Ġf use +Ġf ov +Ġ" ). +Ġ" .", +Ġ" *. +Ġa udit +00 66 +Ġs ap +Ġs ans +Ġin vent +Ġre m +Ġre nt +Ġre named +Ġre asons +un titled +ri age +Ġ1 88 +Ġ1 46 +Ġw orth +Ġ[ '. +Ġ[ %( +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +get Node +ĠT P +con ditional +Ġis file +ĠS em +ĠS imp +ĠS IG +ĠS VC +ĠC he +ĠC ri +end Date +Ġcon tig +type def +ĠF FT +Ġh ence +file Path +Ġ3 27 +Ġu v +]) +' +Ġdata file +ĠO w +ĠO NE +ds ource +tra p +py c +ap anese +ĠB en +AT GG +user ID +92 2 +In crement +Ġtype def +url resolvers +bu gs +ĠV ec +ator ial +Ġtime line +Ġlist e +Ġk h +Ġpy autogui +93 1 +Ġ[] ): +plot ter +LE G +22 33 +sub title +sub Dist +Ġ{} } +mat ics +Ġsh lex +24 24 +Ġcom ing +55 2 +exp lor +iv ar +{} ** +=[ ]): +word List +HE V +AG CT +Ġfil t +trans act +Ġdis creti +stri des +Ġsp am +ĠQ A +Ġad verti +77 77 +Ġvalid ity +the se +Ġinter ested +`` ) +47 9 +ĠEx change +Ġload balancer +83 9 +gen fromtxt +ĠIN ST +Ob server +pass ing +76 96 +Message Options +Ġover laps +Int ensity +ĠCh romium +ines is +'} ). +ĠComp any +Code s +Ref lection +Ref lector +Ġest e +Ġkeep s +å® ¹ +rm ar +è¿ IJ +cr u +ĠAt tach +Tree Map +Ġcap ital +CHE MBL +elect rified +ĠPlot ly +ĠInc ident +bottom RightOverhang +SU FFIX +Ġsimple json +Ġcre ator +199 8 +ov f +Noti fy +Ġscope d +Ġms at +Ke ep +cnt s +Ġexport ed +Rel ates +gi ai +comb at +prote ct +Ġbul ge +Ġair port +FQ q +Ġapprox imate +Optim ization +Expr Parser +regular izer +ĠRout er +Ġmembers hip +MIS SING +how to +Conn ectivity +è· Ŀ +å¿ Ĺ +çķ ¶ +à¯į ', +onto logy +Place holder +Ġз ап +ĠAverage Meter +Ġìł ķ +SCAL ING +autom l +Ġ-------------------------------------------------------------------------------- ------------ +Ġdecla re +nnnn nnnn +Amp litude +intr insics +çĦ ¶ +20130101 010101 +ĠEstim ate +precation Warning +Physical Gpu +Ġtang ent +Dash board +管 çIJĨ +FEAT URES +0111100011011 10111011011 +Sus p +00000010011111111 010001 +MEMBERS HIP +Division Error +Revi ses +HAV IOR +Ġsali ency +! ) +* : +; ", +A DE +B oth +C ategories +E ast +F REQ +F ALSE +H tml +I PP +I EEE +M AG +P aging +S ENT +S PI +S IDE +T OR +` - +b omb +b attery +c PP +g nd +g cp +g allery +i is +k J +n ltk +p atients +q b +q w +q radar +r ings +u L +x or +} `", +§ ółģ¿ +¨ ółģ¿ +« ółģ¿ +æ Ĵ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ 000 +at ório +se ver +Ġ= ================================ +Ġt st +an c +an za +Ġi c +Ġi eq +-- > +ti ps +Ġc ru +Ġp ds +Ġf path +Ġf esc +Ġ" // +Ġa es +Ġn dim +ur us +Ġre covery +sel ves +li est +li able +Ġe b +Ġe vidence +", ') +co her +co erce +Ġ1 72 +11 06 +id u +di l +Ġ[ "" +ma f +ul um +is bn +__ | +get int +get pid +(' "', +import ed +Ġ2 11 +(" : +as r +ĠS L +ĠC isco +Ġg w +Ġg row +Ġg luon +ĠA ctor +ĠA tom +sp ks +ist ro +ĠF IN +sc rap +sc ii +Ġh x +Ġh apd +ta re +ĠP attern +ĠL ow +Ġst ds +ĠD ynam +Re ject +Re ads +ĠM ini +Ġ* ); +Ġse em +IN K +Ġpro ton +Ġpro ducer +ĠB U +ĠB and +Ġj it +ob server +date Time +ep g +ph on +ĠG ate +ĠG LOBAL +tri butions +Ġ5 0000 +Ġpy vista +lib virt +class ified +15 26 +jo hn +Ġpre defined +index ing +Ġra st +Ġ[] )) +ĠH ERE +Ġsh ares +sk a +88 9 +comp s +comp uter +inter n +Ġnew type +87 2 +ĠK ratos +Ġz en +Ġne o +AC ES +AC AA +75 3 +Ex pl +var x +56 9 +FI RE +Ġ(' - +ref name +ide al +ä¸ Ķ +IL ES +89 1 +ĠSt ar +pk t +temp oral +67 1 +Ġcontin uum +EX PECTED +ĠValue RangeConstraint +ĠÐ » +Ġinst al +post al +Ġexp iration +TO PO +Comp arison +ĠDe coder +Trans ition +ãĥ Ń +author ize +acc ard +Ġ15 1 +serv es +Ġsa id +ĠFor est +н и +æķ ¸ +ĠCal ibration +Ġresp onsible +Ġprogram ming +ĠNot Found ++" /"+ +buil ds +ठ¿ +ĠSimType Function +fetch er +gre mlin +ĠPer formance +mut ed +å° ī +Module Compliance +Down loads +land ing +)- > +'^ $', +Ġcons ists +pla intext +quanti zed +quanti zation +Ġ'# ' +sr f +Ġsepar ators +ĠXXXXXXXX XXXXXXXX +ı r +å¾ ģ +EO F +cross ing +è® ° +BB BB +Ġscope s +ĠClass ifier +semb ler +Dec orator +icon s +sal ary +ĠPO SIX +ĠProcess Utilities +Ġè § +WH IT +Ġ'" '+' +Ġlate x +ĠModule Identity +syn chron +ĠTemplate View +001111 0 +sup Dist +Ġnor med +Ġк ол +Ġfour th +)+' "'+ +Ġinstrument Type +ales ce +Fore cast +Ø§Ø ª +Ġpyg ments +transl ations +Inte gration +Ġgray scale +ĠPR IMARY +Ġtransl ations +Sur vey +oct et +æľĢ 大 +osp f +ãģĹ ãģ¦ +even odd +,:, :, +Keyboard Button +pep ulator +Ġenviron ments +Ġsatellite Number +Ġsatellite Series +Cer tificate +Ġraster ized +ĠNv PhysicalGpu +'+' ",') +vil le +аÑģ Ñģ +altern ate +Ġconsist ency +×Ļ× Ŀ +Ġingredi ents +æĽ´ æĸ° +ĠFra ction +{}{} {}'. +laci an +limb s +ĠOrigin al +Procur ar +ATL AS +çĬ¶ æĢģ +01000101 00011 +éĻĦ 件 +)+'"'+ ":"+ +' # +6 94 +: {}". +? ': +B RIGHT +B udget +C n +C rt +E LECT +F lood +G Regs +J U +K b +K AN +K Fold +M ID +M obile +P b +Q z +T a +V p +W X +Z h +b ject +b cs +b rowse +c G +c Conf +c rash +d rag +f ds +f onts +g ens +k ills +m ols +n ag +n pts +q d +r X +s ight +w O +y Pos +µ ¬ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ł ¨ +on acci +re directs +se aborn +st i +st ash +ĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠ +Ġt start +Ġt iny +an omaly +ti po +Ġc pk +Ġn ex +Ġs ão +Ġre construction +Ġo t +Ġd w +Ġe lastic +la mb +() " +Ġb low +Ġ1 77 +Ġ( @ +Ġw er +Ġ+ -- +__ ') +ĠT ARGET +str ation +(" .", +et r +Ġ{ ( +ĠC M +ĠC art +Ġst ay +Ġst ory +Ġde x +pro cal +Ġ3 80 +ac ados +sh d +ĠM agic +Ġv x +Ġx c +Ġx xd +Ġse s +ack er +py cuda +ap id +ĠB ul +ĠB lack +ĠB oston +Ġj e +ime d +Ġ< !-- +num ero +92 0 +ĠU SING +16 00 +line sep +Ġro unded +04 1 +lib ri +Ġch ip +Ġal locate +Ġra sa +RE T +AN N +22 01 +ĠH ist +ĠH ave +ĠH old +mat izer +27 857 +bin aries +rep l +AM B +Ġnew Text +DE CAY +json Data +json ify +exp ire +85 0 +97 1 +95 2 +AG AA +ED IT +frame N +Ġ** _ +AP N +float x +]: . +Ex pect +ET DOMO +56 3 +Ġsp in +Ġ(' \ +Se conds +Ġcopy file +77 9 +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +Test er +Log ic +Field Panel +Un kn +Ġq c +Ġq sfp +tag ger +CON N +CON SUM +CON STANT +ĠData frame +ãģ £ +last name +iss ub +mt z +cond or +aw ards +first name +Ġbin ned +Ġhead s +connect wise +62 92 +IO HeavyTest +åĪ Ľå»º +Create Sess +Client Session +ĠSim ulator +Ġmodi fications +Ġref ers +ä» · +ä» Ĭ +Pre dicate +GR U +cast le +ĠBase Provider +ICs C +ICs PT +ICs No +ICs Man +ICs Req +ICs Pk +ICs TFT +gb m +ĠStr atis +record ings +ĠRel ative +card inality +SD L +Ġaccess ing +Ġsuper seding +å¤ į +ĠCom mit +pub lication +ĠLI KE +ĠModel s +ĠName s +Ġinitial ise +еР· +ठķ +DR AW +à® µ +MODE LS +Cur rency +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ +ĠError HandlerHiveToPresto +Br Res +Ġfeed s +Ġæ Ĺ +ĠSub mit +Ġforce d +åį Ĭ +个 人 +ĠUpdate s +Ge V +Mon go +Ġexpect ation +numer os +Del Sess +Del IndTun +Del ConnSet +IE In +att entivefp +Ġdepend ent +Interface Slider +RGB A +211 02 +Ġpoly gons +Rel Acs +lc gp +problem type +week ly +Ġdecor ate +Ġworks heet +sur vey +TRAIN ED +Ġgeo json +Ġrefer ent +ĠMark down +Ġinvok ed +Ġproto cols +å± ± +ç§ į +into sh +ĠOver hang +Ġatt entivefp +Er TAD +Fo ot +âĢįâĿ¤ï¸ı âĢįðŁij¨ðŁı +âĢįâĿ¤ï¸ı âĢįðŁij©ðŁı +ĠComple te +ĠTemp orary +ĠSupp orted +ĠDep ends +ç« ĭ +>& # +Nt Sup +discount ed +Ġtran script +ĠìĿ ´ +CLO SE +ĠSm art +ĠCat alog +ĠSpeci fies +ĠCalcul ates +Ġaff ine +Ġ"{}" '. +conj unction +Ġcas cade +Ġmime type +Cr IndTun +OBJ ETDOMO +âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij¨ðŁı +âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij©ðŁı +Ġnick name +Upd Br +Upd ConnSet +FlrInd Tx +FlrInd Rx +Dif ference +еÑģÑĤ в +çī¹ å¾ģ +Complement ary +Ġsmo othed +áĥĶáĥij áĥĺ +attri bs +PRIOR ITY +æ°´ æŀª +nod ename +Ġcry stal +éĶĻ 误 +mile stones +Ranges View +SUP ER +factual InterfaceSlider +cPP Po +Crt Br +ICsPk Flt +RelAcs Br +lcgp bs +4 000 +5 33 +6 39 +7 99 +7 88 +7 37 +7 33 +7 28 +A k +A sk +B p +B ang +E U +K y +M gr +M ouse +R g +R w +S AS +V G +V SI +W v +Y b +c if +c bl +f allback +f wave +g at +k ron +m db +n able +r F +s uggestions +s chools +w anted +} ? +} '] +} ?", +¹ æį® +Ð ł +â Ł© +è ı +ë ° +ì Ĩ +Ġ ******************************** +Ġ âĸĴ +Ġ atexit +re y +re ener +se y +Ġ= " +Ġi k +me ls +me asures +mp p +Ġc ame +Ġf uniIf +Ġf cntl +it u +Ġa cts +Ġn ms +Ġin ode +li on +Ġm g +Ġm type +() }) +co pic +ri ck +Ġb anned +Ġ1 96 +Ġ1 71 +ch allenges +name dtuple +ĠT or +ĠT ue +ĠT ab +Ġ2 34 +Ġ2 29 +ab sent +ĠC lo +Ġg pd +Ġr u +ĠA A +sp her +'] [- +ĠF requency +sc ar +Ġh sv +po i +ĠP od +ĠP ayment +ĠP aginator +ĠI mplementation +ĠL u +Ġst ops +Ġde ltas +0000 01111 +ĠD QN +Re moving +Ġdata s +ĠM S +Ġy axis +ĠO B +add str +ES IS +"] * +ĠE t +AT C +AT CT +92 65 +col n +OR A +lic ations +ĠG B +Ġen ded +Ġk ubernetes +Ġro bo +Ġpy rax +ST L +'' ', +base ball +Ġtra p +08 1 +sk ia +db ot +27 54 +lock s +Ġle aves +37 32 +iv ed +Ġjson schema +rit es +Ġne urons +ele ction +rc p +current ly +Ġlo ve +23 02 +23 12 +Ġcheck sum +IM PLE +org ia +stat istic +ä¸ ĩ +ĠX YZ +tf lite +top o +ĠIN DEX +rt d +Ġcolumn span +open ed +âĢ ĵ +ĠPro posal +EX AMPLES +tx id +char m +čĊčĊ čĊĠĠĠĠĠĠĠ +she d +Dict Reader +Ġ... ') +LI ABILITY +Ġspecific ations +58 33333333 +State ful +Reg Net +Ġsign atures +Ġallow ing +ĠRes id +ĠRes hape +Access Bindings +ĠUser name +position al +su ch +IO US +extra p +By Tag +Client Error +App le +ĠImage Font +ĠEn v +loy ees +br ush +CI I +Ġdimension al +On line +~~~~~~~~ ~~~~~~ +ĠModel Deletion +click s +("- " +Ġrot ations +âķ Ĺ +Ph idget +:, } +Ġstack convert +([" - +CR S +Ġassoci ation +Ġradi i +Over lay +Update s +SL OT +åĩ Ģ +199 6 +============ = +plan et +ĠObject Group +OM IC +sol ved +æī ¾ +Ġdig ital +MESS AGES +Ġquanti ze +ĠCommand Results +yy d +Ġna pari +Ġpla intext +Ġanaly tics +ĠAs sessment +adv ance +ftp lus +ĠAnal og +Chain Lock +Ġindi ce +Ġinf os +war ded +é¢ Ħ +prep ared +wik idata +Ġdynamic ally +onto wn +Ġlig ation +ĠMethod s +Equ ipment +Serial Number +Ġgenome s +Ep isode +Spect ral +Ġcisco DiameterBasePMIB +Ġlua L +cas cade +simp lify +Ġconfirm ation +bracket s +Ġgrids pec +Neg ative +Git Hub +ĠPub lish +Ġmilli seconds +Ġcoef s +Ġrsp s +ĠTk inter +ABC DEF +Ġdeci de +失 è´¥ +Soft max +ĠAmeric an +Ġstarlet te +Ġ655 35 +omal ies +MIDDLE WARE +ĠDATAB ASE +ĠSETT INGS +åŃĹ符 串 +ðŁı´ółģ´ółģ¨ ółĢ +assertRoleAssignment InListResponse +AMO UNT +æĺ¾ ç¤º +0000101111111100011 01111111 +. ` +6 10 +6 95 +A dicionar +C aching +D ates +H UM +H uman +L MB +M OT +N q +P ed +P rom +R G +R N +R j +R IC +R amp +S cheme +W z +Z A +Z w +b nd +c is +e Y +e Z +f Y +h U +h v +h ive +k ms +k ir +m E +m md +o ints +p ir +q os +q rst +r ctx +s ymb +t F +u ity +v ard +w cs +x n +y d +y ing +° ółģ¿ +¸ µ +à ¼ +â ģ +ç ¶ +ç Ł© +í ĥ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ľ IJ +in format +in ks +re veal +se quential +en za +de coding +an tes +Ġi se +Ġi st +ti cally +Ġc it +Ġc eph +Ġp ear +Ġp apers +Ġ" )[ +Ġn f +Ġs or +Ġd eno +un da +ra mp +() \ +ri ichi +Ġb ars +Ġb az +Ġ1 67 +ed a +ed ata +um a +Ġ0 3 +ol ded +Ġto urnament +con str +con versions +con tributor +Ġ2 33 +op h +op code +ĠS nap +") ]) +Ġg if +Ġg rep +Ġg rowth +Ġr ub +Ġr fc +ĠA gg +ver ification +ver more +par quet +ĠF eatures +qu reg +vi val +ĠP A +Ġst ress +Ġst aging +pro vided +fig s +Ġ3 30 +ĠD at +ĠD AG +ac tivities +]) } +Ġdata proc +ĠM AP +ĠM ichael +=" + +Ġv c +Ġv gg +Ġv DataFrame +Ġx axis +add Data +---------------- -------------- +Ġpro duces +ang led +ĠB ang +ĠE xclu +Ġ) ), +ĠR n +ĠR ay +ĠR ank +Ġun able +ĠG P +ĠG PL +ĠV ital +ib i +Ġen ergies +Error Kind +16 04 +Ġro ster +Ġpy xel +Ġop code +Ġch assis +Ġpre fer +([ [- +gra b +gra ss +RE PO +ĠRe verse +ay ed +sub graph +mat iq +Ġsh adow +ast al +ĠIn ference +27 25 +inter est +arch ives +24 45 +Pro jection +map c +Ġsub sequent +Ġso on +yn omials +Ġcomp anies +94 3 +94 9 +ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +87 4 +Ġla g +Ġla mb +Ġimage io +Ġmax im +AG TT +Par ti +Par sed +Ġext r +Ġper forms +Ġlo an +23 37 +Ġstart Time +Ġurl join +']) [ +Ġend region +56 2 +38 27 +ĠQ Application +ick en +Ġim utils +77 3 +the us +call ing +HO OK +rt c +ĠSt reet +":" _ +65 1 +65 2 +entry point +Ġqu iz +Ġ'. ', +ãģ Ĥ +"> { +Ġtag ger +Get Output +Add Text +TO L +čĊčĊ ĠĠĠĠ +74 83 +MO Z +annot ator +si a +si us +Trans l +ãĥ ĩ +pack ets +Ġyour self +ĊĊĊĊ ĊĊĠĠĠ +sim ulated +prot otype +Ġ'' ', +н Ñı +full path +ĠCh ild +orig ins +comple ter +Gener ates +-% - +]+ [ +ME AS +10000 000 +jnxMbgSgw Gtp +CRE D +SV D +cloud watch +thing Producer +compat ibility +platform s +SO CKET +à° ° +Ġaccount ing +ĠRE FER +Ġcl us +Ġmod name +Ġdec imals +1111111111111111 111 +ĠNO QA +åº ľ +Read y +Ġworld mapc +ı ÅŁ +åį ³ +export er +Go al +aff ine +Ġ'{} / +DIS K +balance s +ĠNe utron +NotFound Exception +lm nop +tu lo +87300 94 +Ġoc ticon +294 3 +çİ ¯ +Web Socket +ali en +Ġtermin ated +WH M +Conf lict +Ġfe es +ĠFil ename +Could n +Ġdiag ram +Ġent rada +大 å°ı +Ġfront end +Ġbalance d +ĠThere fore +Ġca usal +dj connectwise +dhcp Snp +Ġadv anced +Basic Rule +Distri buted +Ġderiv atives +Permission s +aaaa aaaa +Ġaltern ate +ĠAut onomy +ĠFin ally +Ġshif ty +bla h +Pop ulation +ĠAllow s +ĠDete ct +×ķ× ª +Ġsuc ceeded +tro ops +san itize +Ġadapt ed +Skip ped +ç¼ © +ç¼ ĸ +Ġposs ibly +ĠCOMM AND +Ġnom bre +æ£ Ģ +ĠPhidget Support +Defaults HelpFormatter +speak ers +æĵ įä½ľ +ĠscaledValue Of +ĠSu ite +Ġxg boost +olog ist +Ġconvers ation +Amazon Review +Inher iting +ĠMyCustom AmazonReview +èī ² +damp ing +STAND ARD +PERIM ENT +LOADBALANC ING +) }\ +/ ) +4 91 +5 10 +5 28 +5 89 +6 50 +7 66 +7 46 +8 27 +A mb +A orB +B q +B ET +D ic +E c +G ases +H n +H int +I gn +J Y +K NOWN +L ESS +M r +M en +M es +N d +N IC +O ffer +O EE +P m +P ay +R H +R ESS +S J +S chool +T ier +T rend +X p +Z O +Z X +c J +e vidence +g mm +h ms +j am +k le +m ne +n as +p ings +r sp +s xd +s Request +t win +v nc +} & +à ĩ +Ġ ()) +Ġ 9999 +ĠĠĠĠĠĠĠĠ ĊĠĠĠ +re act +re named +Ġ= [] +en coders +Ġt range +ar ant +an ime +Ġi ç +ro gate +ti de +Ġc ubic +Ġf ed +he er +he ast +Ġa us +Ġa db +Ġs py +Ġin complete +Ġre fs +Ġre veal +sel y +Ġo cs +Ġd ynamics +un zip +Ġm iddleware +ra z +Ġe arth +la mp +co efficients +Ġ1 64 +Ġ1 86 +Ġ1 91 +11 55 +um bs +id f +id r +Ġ( {} +urn als +Ġ+ /- +(' ( +set tle +ĠS parse +ĠS UN +ĠS olve +ĠS hell +ĠC l +ig a +Ġg ri +Ġr te +Ġr ms +Ġr nd +Ġl ane +ĠA pr +sp ans +'] ]: +ĠF O +ĠF AIL +Ġde creasing +Ġde composition +im ento +ĠD rive +Ġu z +Re presents +if name +if th +Ġv en +Ġy data +Ġx forms +Ġstr ftime +load mat +ance led +py lint +art s +ap an +Ċĉ ĠĠĠĠĠĠĠ +ĠB reak +ĠB ody +ĠB ecause +ob ot +model name +ĠN ested +ind u +ĠR EL +OR GAN +ph rases +ĠG amma +ĠW rapper +Ġen riched +Ġk afka +Ġpy qt +lib c +ST S +ec Base +max es +dd d +22 15 +ĠIn sert +27 34 +by e +ak ao +Ġac cessed +Ġcomp artment +Ġnew Po +no logy +exp ired +=[ ]) +lat eral +23 01 +AC CEPT +Ġdis ambig +En tities +Co ol +38 95 +Ġmin us +Ac counts +nn z +gin ary +}) \ +46 36 +Ġdescri bes +)] ), +CON FIRM +De mo +о ÑģÑĤ +65 9 +bot tleneck +CL U +Ġnet CDF +Ġpoint ing +EX TRA +pass phrase +content Transfer +ĠAr m +Ġimp roved +Input Stream +Ġab spath +Ser vers +Ġ16 9 +pol ling +ĠNo v +Ġroot s +ãĥ ¡ +ia o +pack s +=_ (' +ĊĠĠĠĠĠĠ ĊĠĠĠĠĠ +); ' +оР¿ +Ġmy py +App ro +ĠCh ain +Ad ds +Ad just +Ñģ Ñı +inst anti +Ġcli que +Check box +oper and +hand s +Load s +oo v +ĠNot ationType +]], [[ +Ġgr r +PAR SER +AV G +à® Ł +EE K +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ +å° ij +ros copic +lev ance +Ġlat tice +bus car +Sa fe +Sum maries +ov od +Ġ'{} ') +ĠCO M +]} ), +flo od +Ġdrop down +ĠNe g +Spe ech +Ġroom s +Ġ'< ( +BE HAVIOR +Ġpoly axon +Document ation +tel lo +yy y +LV ecBase +COMM ENT +1234 56789 +gri pper +Ġsol ar +^{ ( +Cap s +åĪĨ ç±» +ĠEd itor +âķIJ âķĿ +SAM L +circle s +ues sed +ĠConv olution +bridge s +åij ½ +life time +ĠOne HotEncoder +mal ware +Long itude +due ls +Cent re +ĠIM AGE +calcul ation +calcul ated +åĿ Ģ +ayes ian +Ġscr atch +Mapper Status +CAN CEL +Ġphot os +ìĬ µ +Arti fact +æ¡ Ĩ +æ£ Ĵ +Capacity Gases +ðŁı´ółģµółģ ³ółģ +ĠCli Runner +ç² ĴåŃIJ +ĠBus iness +Ġperf ect +Ġbet as +FIT NESS +plex ity +Ġdele tes +PIX EL +ĠATT RIBUT +Ġgeop andas +cPPPo ES +Inheriting Object +ĠnewPo em +% ", +( $ +) [:- +5 13 +5 06 +5 36 +6 92 +6 09 +6 28 +7 25 +7 22 +7 34 +7 67 +7 48 +8 24 +B er +B TS +B ORDER +C ert +C ast +G lobals +H am +I US +I GH +J wt +L g +O g +Q W +R b +S x +S mecti +T ENSOR +V ault +[ [" +] +' +b iz +b anned +c andle +c fp +e T +e ight +g pt +j f +j v +j in +j unit +k W +l cl +n ical +t OK +v nd +{ }, +Î ´ +æ º +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ê°Ģ +Ġ å°Ĩ +ļ ĥ +in ic +in dividuals +er un +er oute +re z +se titem +en rollment +Ġt il +Ġt pr +ar man +Ġ' ), +ro d +ro ster +Ġc ite +Ġc pc +Ġc ategor +Ġ" ; +Ġin finite +Ġre agent +Ġre cipients +Ġd v +Ġd omin +un expected +Ġm ort +Ġb q +Ġb atched +Ġb attery +Ġ1 83 +id ir +Ġ( < +di mage +is numeric +get Elements +(' ; +)) ], +set env +ĠT ER +ĠT ransport +str ar +Ġ2 08 +Ġ2 19 +ĠC lasses +Ġr si +data center +'] ") +Ġcon vex +ist ency +Ġh xl +ĠP ixel +=' '' +Ġde velop +Ġ""" < +Ġ3 115 +ac q +sh al +key point +Ġpar alle +Ġx data +Ġme chanism +Ġpro jections +ls q +"] ]) +ĠB ag +Ġres olver +In strument +ĠR ou +reate st +32 15 +ĠG radient +ĠW ire +25 00 +25 24 +jo ke +14 75 +Ġresult ado +:// % +:// ' +iti gnore +LE M +Type Id +sub sample +sk etch +LL A +Ġ` ~ +Pro duction +96 00 +Ġac quisition +DE CL +no op +{} - +95 9 +################################ ############# +Ġhas htag +Ġne utral +Ġmat riz +Ġdis card +Co verage +Ġsp l +Ġsp ent +obj verts +ĠUn comment +CH ANG +IL INE +sche mes +Ġcal lee +assert Equals +air s +use ful +ĠData Set +fe a +fe ssion +fe asible +ĠÐ Ł +Max Scaler +Ġexp onential +ny m +struct s +1011 10 +Ġab stra +fore ground +и в +ãĤ ³ +53 64 +Man aged +Int Type +na poleon +Ġtri angles +Qu ad +drop box +ĠZ ip +ĠZ ope +]+ )\ +rank ings +ĠCal ifornia +velo cities +Ġaccess ible +ĠOr g +TEST S +dr one +æĸ Ļ +Ġ---------------------------------------------------------------- ----- +Ele m +Is Exist +("- ") +á» ĭ +Ph ot +gh ijk +ĠRE PORT +ĠTrans formation +bus y +ĠLO CAL +pick er +Ġæ Ł¥ +expression s +With out +READ Y +Ġcalcul ates +Ñĭ л +Ġrank ed +Ġpa ired +COMP LETE +}} } +>, # +SN R +ital ic +arp Inspect +ĠAD DR +mix er +Ġturn s +('_ ', +ĠMulti FieldPanel +人 åĥı +appro val +ametri c +ен ие +ceil ing +Ġband width +Cor pus +pur pose +Ġsym metry +Fi xture +sens itivity +ĠSc enario +è¾ ¹ +prod utos +VEN ICE +AAAA AAAA +ĠWork space +Cred it +Mac intosh +LF N +ĠGPU s +Ġê ³ +RAN K +Notification Group +éħ Ĵ +uu ids +Ġд лÑı +Epoch s +ĠPe ak +ĠMac OS +ĠInst ead +čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +Ġrout ines +Pa inter +persist ence +Band width +Some thing +ĠìĿ ´ë +BOT H +chkpntTrap OID +ĠCL ASS +ĠLim it +Bul let +éĢļ è¿ĩ +Ġsing ularity +åķ Ĩ +ĠNamed Tuple +!!!!!!!! !!!!!!!! +LABELS ENTRY +Ġham ming +ĠBC API +ĠMET HO +suggest ed +ĠÑĩ иÑģ +12345678 12345678 +ĠRect angle +craw ler +Micro soft +Tor que +IMP LIED +Ġflood ing +å±ħ æ°ij +Ġuncer tainty +;: & +ĠDEV ICE +Ġgens im +ĠPARAM ETERS +Ġè¾ ĵ +ĠLAB EL +uder a +getD ll +人åĥı éĿ¢ +' â +) ][ +- ") +0 1111111111111111 +4 98 +5 0000 +5 26 +7 01 +> % +C X +C ORS +G al +G AME +I ll +K VM +L X +L r +N úmero +P or +R ights +T f +T rx +U x +U ART +V T +_ ") +b mp +c M +c ubic +e ur +g age +h od +h ib +h ale +k ar +k now +k ws +l arg +l proj +o S +o q +p waves +s fx +t ube +w xyz +w ildcard +x form +z f +| '.' +à ¸ +Î º +Î Ń +Õ ¡ +ç ¸ +è « +ì Ĥ¬ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ اÙĦ +or atory +at ings +re cipients +Ġt ie +Ġt utorial +de part +an to +me theus +Ġc row +Ġc nx +Ġc sl +Ġc amel +Ġp q +Ġp eriodic +Ġf obj +it on +Ġn i +Ġn ump +Ġin cid +Ġre la +Ġre ject +Ġre views +Ġre placing +pe di +un ter +un register +un subscribe +Ġm arg +Ġm ile +fi b +co efficient +ri co +Ġfor get +Ġ- . +ĠT IM +us able +Ġ2 16 +(" =") +[' -- +et ry +ĠS y +ĠS CHE +Ġg arbage +Ġl ens +data points +ĠA ST +ĠA LU +am ut +99 1 +par alle +ĠF l +od ge +vi ations +Ġh ints +** : +all Keys +ĠP ush +=' >= +0000 110 +ex if +Ġ3 15 +ĠD ag +Re call +Re ward +if ft +=" ` +os aurus +tra des +ĠB as +ĠE arth +ĠN u +ĠR A +EN DS +Con verts +ĠU SB +min ing +min imal +18 75 +Ġk s +St and +we apons +Ġch k +ax hline +Ġal most +ne igh +ord an +LE TT +Ġtra verse +22 04 +ĠRe po +19 86 +19 76 +Ġ` _ +84 9 +24 12 +Ġoutput File +ĠCon dition +CT YPE +ull an +Ġ8 6400 +Ġtf x +Ġper ceptual +28 12 +Ġ(' + +check ing +check list +Ġcopy ing +Ar rays +Ġim read +PO LY +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +Ġsize of +du o +Lo st +nx os +De mand +sign ing +Ġitem getter +Ġarray T +ãģ į +Ġpri vileges +Ġbreak s +uni prot +build Transaction +OL UTION +over nment +queue s +çļĦ æķ°æį® +PL ACE +pack aging +Ġblock ing +Ġexist ed +Ġmask ing +PRO GRAM +na ire +ĠjnxMbgSgw Gtp +ĠSim Union +sort ing +rat o +Ġsplit ting +END ER +gt k +Function Descriptor +Ġest a +mk dtemp +BO OT +Mo tion +this Component +PAR ENT +Char ge +à° ² +Ġcap it +Ġcap ability +ĠString Var +vv v +tech nique +Down loading +car ry +Block Headers +Ġæ Į +ĠDis cord +schedule d +band s +ĠMy Text +inv ocations +Dec lar +FFFF FF +Vis u +lid ar +ĠRead ing +Ġfo oter +wi fi +deploy ed +ĠEnd point +Attribute Error +BF UINT +ĠMat plotlib +Ġ"$ ( +resid ent +ĠNoti fy +YY Y +pipe s +emb s +ü n +ä¸Ĭ ä¼ł +Ġhyper parameter +éģ İ +Ġpk t +Ġĉ Ġ +Ġ------------------------------------------------ -------- +#---------------------------------------------------------------- --------------- +Ġescape d +recipe s +bro ken +suc ceed +986 88 +Ve locity +repe ats +METHO DS +Lat itude +Pop up +PART ITION +ãģĹ ãģŁ +ĠSeq IO +å¼Ģ å§ĭ +åĵ ģ +10110011 0000011 +Rt Stats +thro ats +WEIGHT S +Ur ls +Ġsnap ped +ĠAC CEPT +Mal formed +Ġconsu med +"` { +Ġexclu ÃŃdo +Ġestab lish +tStop Refresh +Ġhazard Body +ð¥ ļĥ +UNIC ODE +读 åıĸ +ĠLaw rence +;, & +TOPO LOGY +ByTag Name +MOZ ART +getElements ByTagName +ghijk lmnop +" ------- +# " +. "), +4 30 +5 05 +7 30 +7 45 +7 47 +B AN +C INE +C hem +D uplicate +E very +E nsure +F p +G K +G l +J z +J OR +L m +M id +O t +O u +P ic +P DB +P adding +R z +S elf +T al +T ran +V U +V r +X v +Z b +Z IP +[ < +] ._ +a K +b tc +c B +g lo +g ive +g rand +l vl +n Q +o la +o file +q bal +s Out +t S +w atched +y k +à ĥ +× ľ +à ¦ +è » +ì ¹ +ĉ Ċ +Ġ ######## +Ġ ancestor +or um +re scale +re ceiv +Ġt sv +ar ator +an et +Ġi on +ro bo +ti x +Ġc ra +Ġp atience +Ġf und +lo st +ge l +ce t +Ġin items +Ġin vest +Ġre lief +Ġo doo +Ġd ra +pe ers +ra io +la v +Ġb id +Ġ1 84 +Ġ1 48 +Ġ1 78 +Ġ# [ +Ġw l +Ġw rappers +ul ators +Ġfor ces +': [' +), ) +), \ +Ġ+ "\ +is i +is im +is her +get ting +get Future +)) **( +Ġto wards +con tracts +con centration +Ġ2 52 +ig i +") [" +Ġl ut +Ġl ats +ĠA CT +sp ore +put s +ic ious +ĠF N +ĠF R +ĠF ollow +od oc +ĠP S +tr ange +Ġst ars +pro filing +form ers +ĠD NS +ĠM ul +ĠM sg +nt w +if ace +=" %( +02 00 +Ġy Pos +Ġme me +pre train +Ġbe ar +ĠB all +ĠE igen +ĠE urope +ob e +AT HER +ĠN othing +ir ty +Ġ4 000 +92 1 +ĠR PC +32 09 +ĠG ot +Ġco ins +ity Error +Ġhe misphere +Ġan chore +Ġen rollment +04 9 +ass er +Ġat tri +Ġat trib +vent s +Ġra iden +22 06 +ĠH uman +input file +Ġsh uff +88 0 +output Dir +34 34 +ĠIn v +ĠIn ser +27 98 +by ref +ann y +Pro pose +em ies +Ġcomp osed +Ġcomp aring +55 0 +87 65 +ron tier +95 3 +26 26 +Par sing +Ġ8 000 +Res hape +AC Y +so ftplus +56 1 +be heer +Ġus u +]] ]) +Ġpos ix +ĠIN IT +ĠIN SERT +Config SgaclMapping +ðŁı´ółģ ¦ółģ +Ġquery ing +Ġpri mes +proto cols +Max T +Ġele vation +Ġmake element +Comp ound +pr d +Trans late +Up dating +SC R +serv os +åĪ łéĻ¤ +Ġdocument ed +Ġph enotype +1000 1111111111111111111 +ĠCh uck +sing ularity +Sp ider +ä» ½ +DS A +Ġpost ing +GR AD +LOG O +NO K +UP DAT +light WifiBridge +fin ance +0000000000000000 0 +ĠFile System +center ed +Ġauthor ized +åIJ Ħ +Start ed +rl lib +ĠNot Implemented +EXT ERN +ĠDT OR +ĠCom modity +ĠCom bine +ĠModel Checkpoint +ĠEX T +9902 633 +tool box +ĠAt tr +Ip Addr +ĠAl ready +)+ ". +pid er +zz z +MENT ED +Ġalign ments +Over view +ĠDis k +CS RF +PER IOD +Ġadmin istr +Ġinte gral +199 0 +ĠReg ular +As In +As Out +rr p +inv ite +tu f +ĠMon itor +ĠMulti Index +åĨ į +Ġsol ving +TRAIN ING +HW C +iff ness +ĠPermission Denied +Lim its +ĠSV G +Ġzone Id +Ali ve +å· ® +health check +ĠSU CCESS +ĠSc ra +scra per +manifest s +spread sheet +Flip Time +Ġyy d +regular ization +ya hoo +Ġaggreg ator +GROUP S +extractor s +tun ing +Ġali yun +Su ffix +urb an +æĸ¹ å¼ı +elf file +Ġ192 0 +Ġada fruit +Ġregist rado +Ġemp loyee +Ġdocker file +sho pping +Ġck an +calcul ator +DICT ION +Ġregard less +Ġsens itivity +åĿ Ĺ +grids pec +9214 2537 +èµ Ħ +иÑĤ е +ê³ ¼ +Ġ################################################################ ################################################ +Ġchrom osome +Binding Term +Binding GTerm +ĠDAT ASET +Ġforecast s +DIST INCT +GW P +reach able +through put +Ġ[{} ] +VOL UME +Ġdeclar ation +clouds dk +Require ment +(":") [ +Predict ed +declar ation +Ġintr p +Ġatualiz ado +太 åħ¬ +cad ence +forma ções +uby te +缴 æİ¥ +NacAppl Authentication +10111111111110011 0011110 +convers ation +IRON MENT +Ġprac tice +Ġè§ £ +getFuture FlipTime +# --- +5 32 +5 30 +7 18 +7 29 +8 10 +? : +B k +B ed +B io +B ASIC +D ri +E W +E MP +E OS +E arth +G J +G p +G uid +H IC +H DF +I mplementation +J ump +L on +L amp +M UT +M ale +M ARY +N umpy +O m +P ing +R ates +R ich +S AL +S now +S izes +T PU +T ICK +V W +V z +V ote +V AE +W iki +W allet +X H +X f +X u +X GI +Y ellow +\ '\ +a que +a ec +c W +c ra +c up +c sc +d C +e ment +e lasticsearch +e limin +f urnished +f uzzy +g lt +h UK +n dirs +r ar +r nd +r angle +s name +s lab +s ie +w gs +x array +y M +Ï Ĥ +Ú ¯ +á ı +å £ +è ² +Ġ ][ +Ġ áĥ +Ġ ÙĦ +Ġ об +Ġt on +al fa +de que +Ġi a +Ġi py +Ġi ps +Ġc w +Ġc ue +Ġc aging +Ġc aching +Ġp waves +it z +00 07 +ce e +Ġn cs +Ġs x +Ġre tention +Ġd J +Ġm dl +Ġe u +Ġ1 58 +Ġ1 49 +um or +id p +Ġ( ..., +Ġw c +Ġw ww +ch ats +def ense +Ġ+ - +is lower +val ence +(' $ +ath on +th ough +Ġ2 44 +Ġ2 35 +Ġ2 73 +as GRegs +ĠS Y +ĠS uch +ĠS aving +ab atic +ĠC v +ĠC FG +Ġg n +Ġg ds +'] ][' +'] }") +Ġcon fidences +ĠF W +ĠF our +ĠF TP +qu il +log istic +Ġh al +all ing +ĠP ype +ĠP UB +ĠP ASS +ĠP crit +ub a +pro fit +out comes +ĠD en +=" ' +Ġy a +Ġy ields +ĊĠ Ċ +ĊĠ ĉĉ +ĠO ur +Ġ* . +Ġse mantic +Ġor den +Ġpro fit +label ing +ĠB ob +ĠB EGIN +ĠE le +ĠE OF +ob el +ob stacle +user Name +col lision +read ings +ĠG rad +EN K +EN ER +ĠW R +ĠV PN +). ', +Ġen contra +sa v +Ġcol lector +ag enda +ec g +]. ") +88 1 +19 12 +ere um +Pro te +Ġsub scriber +AM S +96 2 +Ġcomp ound +split ter +node Name +no ulli +Data Generator +ron ic +=[ ( +Ġuser id +Ġz mq +Ġne ither +90 92 +und ance +Co pper +pop left +ĠUn der +Me mo +uc er +vis itor +ud oku +Ġim show +fil m +cent ric +las se +Ġser v +ai a +Ġq f +Config s +29 87 +Time Stamp +âĢ ¦ +Ġup dater +ins ic +EX IST +Ġtemp er +EL D +debug ging +post fix +Ġ'/ '. +Ġover flow +Ġover ridden +conf lict +Key Constraint +Com ments +Ġuni verse +ĠTest Client +Ġ16 1 +ĠDe mo +Th en +QU ANT +URL CONF +Ġsim s +################################################################ ################################ +has attr +=[' * +äº Ľ +æľ į +fin ally +Dis crete +ĊĊĉĉ ĉĉĉ +uri ed +('- ') +ocab ulary +prob es +CI FAR +Sim ulator +Ġ") " +Ġinclu ÃŃdo +Pri or +Box Points +å® ĺ +ठ¸ +á» į +LC G +DX Y +Service Client +ĠPre cision +ĠSh ared +Ġannot ated +pa id +)+ ( +ĠAd v +car box +Ġarch ivo +Ġfp tr +Ġæ Ń +tw enty +Ġmost ly +gon al +firm ware +typ ename +NOT ICE +ffect s +cn f +Ġexpect ations +decor ation +Plot Scripts +sess ments +Ġsen ds +break s +Ġctsp Vlan +211 01 +ĠAss ignment +ĠForm atter +":[ [' +Ġ{}) ". +Ġfc st +ĠDet ail +Ġ~ / +ĠToken Type +COMM ANDS +Ġenable s +resid uals +Post Processing +DQ N +={} ) +Ġhyper parameters +SUB JECT +MY SQL +SEC URITY +ç® ĩ +Ġconstruct ed +ĠJo urnal +Modi fy +Med ium +æĶ ¯ +Ġmar ble +Ġindi co +Ġparallel formers +ham ming +itect ures +('{} {}{}{}'. +ĠVM ware +("_ ") +Ġmonitor ing +lem ma +çĻ ½ +Ġmix ins +need s +Ġmm cv +ĠLink ed +STATIC FILES +('" ') +persist ent +ĠRest ri +voxel s +ĠBuil der +ĠUns upported +ĠSa int +Calcul ating +Ġadapt ation +ĠCons ists +Bus iness +ĠCir cle +AGG REG +Ġspread sheet +thro at +ĠMatch ing +线 ç¨ĭ +Ġweak ref +ASIC AP +åıij éĢģ +Ġamb ig +ĠRa ioni +EXEC UT +Ġmind spore +CATEG ORY +ë³ ´ +011101001110100100 101110 +ĠDif fer +infe ction +è·Ŀ 离 +CONSUM ER +qrst uv ++ ? +5 16 +7 64 +7 94 +7 98 +8 16 +8 22 +8 26 +@ { +A ssert +A UG +B UL +B ands +D z +D id +F MA +G LE +G auge +H J +H p +L J +L j +M ont +N atural +P al +Q X +R k +R otor +S cores +T iming +W AN +\ "" +^ - +a Z +a cted +a ware +b ell +c ch +c ers +c ash +d P +g v +g df +h ir +n R +n se +n ex +n samples +o axis +o Prop +t ns +v out +y G +} ^ +± ółģ +· ółĢ +Î · +Ø º +â Ľ +æ ¼ +ç ¢ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ########## +Ġ ÑĦ +Ŀ ¼ +ĠĠĠ ĊĠĠĠĠĠĠĠ +or o +or tions +on o +re ject +st m +en queue +Ġt re +Ġt ens +de z +Ġi am +Ġ' ! +Ġ' +' +Ġf ds +Ġf used +Ġ" ? +Ġ" ] +it ors +lo mb +ge ometric +ce ls +', )) +Ġs ct +Ġd up +ct a +ct u +Ġm db +ra dm +Ġe f +Ġ1 87 +Ġ1 89 +Ġ# -- +ma cs +"" : +es ome +is ine +__ "] +ĠT ak +ĠT rust +th rust +Ġ2 03 +op erate +ĠS al +ĠC ountry +Ġg h +Ġg er +ĠA tt +ic ago +am d +am ble +Ġ: [] +ĠF un +Ġh g +Ġh ypot +Ġh aven +ĠP ed +ĠP ure +=' { +Ġst aff +Ġ3 04 +Ġ3 52 +out let +ĠD ot +ĠM E +ĠM Y +Ġv it +Ġy err +Ġse d +Ġme s +ON S +ĠB lob +date d +In ference +In cident +ĠG C +ĠG auge +AR ES +ĠU pper +ĠU su +Ġro idb +Ġal phab +93 75 +ne o +RE DIRECT +ðŁ ¥ +ĠH tml +sub parser +88 77 +19 87 +output dir +ID ER +27 86 +inter act +ann o +clu st +AS C +85 1 +85 9 +rid ing +lat er +57 1 +Ġtf p +ware house +mail s +28 164 +38 13 +38 37 +pri l +Ġmay a +ict ures +Ch n +iter bi +tag ging +De partment +sign atures +Frame work +74 9 +mem ristor +String Var +send ing +ãĤ ° +Man ip +Of fice +QU INT +Sh adow +RES H +(* ) +Ġmy db +################################################################ ######## +Ġsu it +tax onomy +COL S +æķ Ī +ĠLo ads +bit set +Pre view +af fi +fin alize +Ġcell ular +Run s +Mode s +è¯ ¦ +Ġcustom ization +Ġvi ol +Event Query +cap ital +æķ° ç»Ħ +cla uses +еР¶ +short est +Ġreport ing +estim ated +Min or +ration al +à® ¾ +Ġpool ing +ìĿ Į +Search Results +ĠPlot s +Ġë ¶ +Ġë ¹ +Ġë į°ìĿ´íĦ° +Ġgoogle cloudsdk +Ġextract ing +Update Particle +sym metry +percent ages +mis p +As sets +charge s +flo ps +Ġpl ant +Wh ich +ĠBy te +ĠGTP v +Ġedit ing +chart Data +fri ction +Val or +COMM ON +DT ranspose +ĠMO DE +accept ed +accept able +ĠPri mitive +ste el +('.') [- +Ġmid point +Rot ate +Sgt Mapping +ĠMet rics +Pair LocList +ĠJo int +ĠCHE CK +æĭ ī +ĠSign ature +ðŁı´ółģ´ółģ ²ółĢ +cart pole +Ġdelay ed +LIB RARY +Cm Status +Ġang ular +Ġbenchmark s +four cc +Uns igned +accum ulate +markers ize +åĿ IJ +############################################################ # +Ġз а +Ġopp onent +ĠCOL OR +ĠModi fy +ĠPack et +æ¸ ¬ +ĠContract Function +Ġcipher text +SOL VER +mob ilenet +milli seconds +POMERIUM SERVICE +Boost ing +ĠPhidget Exception +端 çİĭ +Restri ct +Ġtro op +COUN TER +Interpol ator +ĠWeight ed +æ¶ Ī +ãģĭ ãĤī +Ġ`{} ` +ANCH OR +COMPON ENT +æ· »åĬł +Orient ation +reh ension +pseud ogene +nume l +è¯Ĩ åĪ« +1666666666 67 +AUTHENT ICATION +Ġrast erio +0100010100011 01011 +ĠStratis Cli +01111111111111111 111111 +ĠhazardBody Phrase +Ġ:[] ''' +" ", +# , +) ',' +) $', +/ ** +7 26 +8 15 +A toms +B ag +C lay +C DATA +C alo +D aily +E xc +E CI +F u +F ar +F lat +G TP +J h +J q +L N +N b +N CH +O x +P IC +P red +Q sfp +R p +S v +S ym +T b +V an +Y C +Z j +_ - +` .""" +a H +a J +b kg +b olds +e O +f W +f one +f names +h aps +h kl +k pi +k not +m sc +n C +o ses +o asis +p atience +s liding +v ms +w ich +Å © +Ġ ER +Ġ è¿ĶåĽŀ +in ject +in ations +re fix +re login +Ġ= \ +al gebra +me g +Ġ' =' +Ġc ars +Ġp lug +Ġf er +Ġn orth +Ġin ferred +Ġo h +Ġo mit +Ġd h +Ġd q +un lock +un less +un stack +Ġm ir +Ġe min +Ġe mission +la ke +() }, +Ġb re +11 18 +Ġ[ ...] +__ [' +get Text +Ġto ur +ĠT orch +us a +str ata +(" --- +(" ../../ +Ġ{ ! +ĠS ENSOR +ĠC I +ĠC la +ht oken +Ġg pus +Ġg auss +Ġg aps +for bidden +Ġr ss +Ġr yu +data source +data Length +sp acy +sp lash +sp onsor +Ġcon crete +ith ley +ĠF eb +ĠF AST +om i +om ics +vi con +Ġh mm +ĠL and +pt une +ex changes +ac ls +ac ings +Re lay +Re ports +ĠM or +key space +=" . +Ġv sd +Ġse per +Ġma Utils +'], \ +pre ferences +ap or +ĠE p +ĠE PS +92 17 +ĠR us +Ġun labeled +OR IZ +fo cal +ĠG al +IT UDE +'), (' +class if +ST UD +jo co +Ġch an +Ġpre sence +ĠRe moves +ml piot +Ġdi vider +19 55 +19 57 +Ġsc orer +Ġ` ' +34 56 +27 27 +Ġkey stone +inter pret +Ġsub command +Ġac quire +Ġcomp s +Ġcomp osite +Name List +AL TH +Data sets +AS CII +Ġla unched +{} " +Ġnumber Of +run ch +Ġz u +23 11 +Ġte acher +Ċĉĉĉ Ċ +und red +Ġdis co +new lines +000 11111111 +Ġsp onsor +Ġsp inta +38 32 +Po le +be en +Ġus ual +Ar t +sent inel +cc l +cc ion +initi alization +du ctor +}) ') +Ġar ange +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +UL ATION +ug a +mt x +ĠÐ ³ +UM an +Ġ'/ ') +Ġcall data +Ġele v +--- + +now led +MIB Compliance +Ġ... ], +Com bo +ush Button +State Machine +Ġ12 80 +Ġsign er +sw ig +si qbal +Ġlib t +Ġav ail +Th an +Index er +ĠSo ft +:] ): +BU IL +binary Data +åĪ ¤æĸŃ +Ġtri ed +Ġtri ggers +Ġph ases +mc mc +Al bedo +Ġsu a +ĠCh unk +é e +Ġnon local +Sub mit +non linear +Ġì § +('/ ')[ +ĠMan age +Te X +Ġsci kit +ĠComp are +"} }, +cost ing +All Vars +buffer Length +Be a +ठ¨ +Ġcard inality +LC S +estim ates +Address Length +Ġ'{ % +Ġround ing +ĉĉĉĉ ĉ +Ġcoun tries +Over all +ĠTrans fer +л ÑĮ +ĠSub scription +Ġshort er +super user +tw ist +SU PP +available Items +Ġfn match +åĩ » +Ġwin ning +Ġcut ting +IST ICS +к аз +OPT IM +ĠObject DoesNotExist +external ID +sy ms +Spe cial +AF KA +SimType Int +Thread s +AX IS +tl b +æŃ ¥ +GD P +ĠState ment +Ġanaly tical +ĠON LY +Ġclip board +Dig it +Ġfl ame +ĠPermission Error +ен иÑı +agin ated +Ġв Ñĭ +ол ÑĥÑĩ +Ġaccording ly +QP ushButton +Ġâ Ī +Head ing +Param Registry +CLIENT MESSAGE +lig and +392 4 +=", ") +Ġhapp y +Success ful +Ø§Ø ¨ +EPS ILON +estimate Gas +Ġflu entd +oll ars +mime type +trust ed +SIG TERM +Press ure +ĠFa ctory +morph ology +morph ologist +irm ware +Mis c +Patient Num +Generating Process +bur g +Ġsing ular +SECON D +нÑĭ Ñħ +mess aging +Ġdag ster +à®ķ ள +nom inal +ĠZero DivisionError +ĠWH ITE +GENER ATED +ðIJ ³ +abbre v +abbre viation +Ġreceiv ing +_* _ +Comm unity +Dispatch er +âĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶ +ĠPL OT +ĠCOR P +Ġreact ant +ĠStri ct +Ġdiffic ulty +WSMan DataType +OPER ATOR +1228 17 +diffic ulty +Ġunic ast +ogra fi +VoiceIf Cfg +indu stry +Õ¡ Õ +92142537 28164 +bolds ymbol +' ` +( ~ +( {} +* ") +. ")) +4 82 +5 35 +7 86 +7 65 +7 42 +8 33 +C losed +D q +D yn +F MT +H our +H OT +H At +I U +I ma +K F +L igate +M irror +N M +P an +P ix +P IL +P iggyback +Q E +R ock +S phere +V h +V w +V x +V in +X train +] ? +] }") +` " +b se +b ir +b etter +c Z +e ce +f M +f S +f pr +f dr +f ana +f usc +g ang +g ps +h in +i ção +j H +k rb +n B +n M +n ation +p list +p lat +p bs +s se +s mi +t doc +t vm +w ine +w lt +w ulff +} ': +£ ¼ +Î ³ +Ġ Ċĉĉĉĉĉĉ +in fix +in cluded +on i +at mo +at least +re co +Ġt ur +an alog +Ġi state +Ġi ÅŁ +Ġ' ~ +ti re +Ġf whm +Ġ" [" +he mer +Ġn th +Ġs bol +Ġin ches +Ġre cover +ing ress +Ġo tp +Ġd il +Ġd na +ct f +un modified +Ġm ine +ra re +ent ro +Ġb son +Ġ1 98 +Ġ1 74 +te c +from hex +is ot +(' ) ". +A UC +B RE +B Tag +C Q +C f +C LOCK +F ake +G Q +G SE +H its +H ierarchy +I so +L TE +M iddle +M AGIC +M inecraft +O mega +P ED +P lane +Q l +R h +R and +S ince +S pring +T rees +U b +V AC +X x +X test +Y y +Z y +a ic +b E +c ant +d ps +d rain +e quivalent +f ur +f av +f avorite +f uniVcl +f amilies +g cs +h dl +i contains +j ug +k el +l just +o ids +p X +q y +s lip +t utorial +w file +x ena +| * +} ;\ +Ï ħ +Ø ¦ +à ¹ +Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +Ġ ç +Ġ Ñį +in iz +in cident +in dice +or gs +or row +re ction +re vert +Ġt ds +Ġt uf +de crease +le ader +an imal +me ld +Ġ' ãĢģ +ro b +ti tan +Ġc itation +Ġc udnn +Ġp value +Ġp eri +Ġp unctuation +Ġf alcon +Ġf abric +Ġ" ]" +Ġs box +Ġre cursion +Ġo up +Ġd G +li gate +Ġm us +Ġb ur +te ardown +from file +Ġfor bidden +get s +get opt +)) } +ĠT Ac +str path +Ġ2 32 +Ġ2 37 +Ġ2 23 +pp as +') " +Ġis dir +ĠS lack +ĠC os +ĠC ounty +Ġg an +Ġg cd +Ġl mbda +end ars +data flow +01 011011 +to y +to urnament +ĠF ort +ĠF IR +log info +ĠP ad +ĠP atch +ĠP ull +der e +file list +Ġth r +=' - +=' --') +Ġde veloped +out look +ac ross +sh ap +sh arp +time it +oun g +ĠO cc +ds l +Ċĉĉ Ċĉĉ +Ġme ld +tra cted +ap pe +Ġos id +Ġj a +AT I +ĠN y +ĠR m +ĠR ack +mo grafi +Ġun iversal +lic ing +ĠG O +ĠW idth +tri ck +mb lock +Ġan on +Ġen rich +18 00 +Ġlist ening +Ġk size +Ġk appa +Ġcol on +Ġpre cedence +([ \ +Type Checker +Ġtra c +Ġtra it +22 11 +ĠH AP +sub types +eri ed +lin ation +ĠIn dividual +27 47 +ann a +24 97 +37 37 +{} , [< +UC g +æł ¸ +Spe cies +lm db +Ġretri evals +align ments +|' (' +Multi Index +ółĢ°ółĢ ³ółģ¿ +Ġfreq s +orph an +Ġna ive +arc cos +BER T +OEO Qsfp +Ġpur chase +Ġred undant +rst p +Cor r +Ġlock ed +ĠSpe ed +Lin ks +(""" \ +Ġâ Ĭ +xl arge +pear son +Li quid +#---------------------------------------------------------------- ------------- +Ġmultip lied +Ġproto buf +REF ER +house hold +Ġbi ases +Ġн е +Ġelect rum +hdf s +sat uration +Ġsage maker +MN OP +ĠMeasure ments +Cla im +Ġflex ible +utter ance +Ġrl HistoryControl +úmer os +\\\\ \\\\ +Ġalert s +Forest Regressor +instrument s +Ġland scape +ĠBig Integer +Ġquick ly +docsLoadBal ChgOver +ż e +íķĺ ëĬĶ +Ġfact s +Ġprun ing +ĠCalcul ating +Gaussian Blur +iÉĻ w +ĠLi vermore +Combin ation +Phone Number +Beam Monitor +ÌĨ ', +ĠFUN CTIONS +Dat um +Ġmanip ulation +Contin ue +Nenhum a +|') ' +Fri end +Termin al +frequ entist +èĬ Ĥ +resample d +vvvvvvvv vvvvvvvv +esti val +ĠOP EN +owners hip +xk cd +ðŁı´ółģ¤ółģ º +oint ment +metron ome +MOR PH +AppAdv ToPeer +dum mies +Ġnucle oti +ðŁı´ółģŃółģ« ółĢ +å¼¹ ç° +TIO CM +aer on +ĠGate way +ĠALU s +ĠCv Bridge +010001010001101011 0111111 +TICData SelectorIfBit +Ġ'ãĢģ ' +IpTraffic Type +å¼¹ç° § +) '] +) '. +* [ +5 17 +5 19 +7 23 +8 021 +; & += ') +A IR +B z +C rypto +D IC +E j +E uler +F req +F ORE +G j +G ender +H X +H old +H MAC +J M +L k +Q j +Q p +Q ot +Q Size +R SS +W t +Z z +] _ +a A +c itations +d sp +e P +g tf +g cd +g uilds +h rep +i otype +k ick +k ern +m L +o dir +o uti +p lease +r ance +r ang +r anger +s is +s ib +s we +w ing +w info +w andb +y cb +z es +z eta +Ð ļ +æ Ł +ì ¶ +Ġ ################################################################################ +Ġ ÑĢаР+ij £ +in centi +er ci +re scaled +se qu +se ng +st h +Ġt info +Ġt ilt +de viation +de velopers +de bian +de compress +an at +an th +Ġi is +me x +Ġ' '] +Ġc mt +Ġc ev +Ġp untos +Ġp uzzle +Ġf im +Ġ" > +Ġ" ..", +Ġa ov +00 08 +Ġs mb +ss on +Ġre mo +Ġre cv +Ġo gr +li os +pe ering +un label +Ġm obile +Ġe ligible +ri l +Ġb en +Ġb le +Ġb il +ed x +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +int ypes +te ktronix +di vider +ma rend +], \ +from isoformat +es poem +is na +ĠT i +ĠT ampa +il inx +us hes +Ġ2 18 +et un +ĠS IM +ĠS cal +ĠS aref +ĠS IZE +ĠC ACHE +ĠC ELL +Ġdef ect +Ġg uesses +Ġr atios +ĠA SN +put ation +Ġcon tacts +ĠF ed +ĠF atal +sc v +Ġh ou +ĠI V +ĠI ts +ĠL INE +Ġst orm +est er +Ġ""" . +ex r +fig ht +Ġ3 07 +ĠD b +ac ct +ac celer +ĠM g +add rs +cess ing +Ġbe hind +12 10 +ĠN a +ir rel +len coded +mo op +ĠG re +ĠG auss +Ġco lo +tri angles +AR N +ĠU rl +Ġk de +Ġk illed +St ub +St encil +Ġpy type +Ġset Name +05 1 +03 65 +rent al +Ġpre set +ou is +AN A +22 13 +22 65 +Ġdi ameter +ĠIn crement +27 02 +27 39 +own ed +nd o +Pro ps +Pro filer +96 12 +33 14 +Ġuser ID +26 88 +26 87 +mon otonic +Ġindex er +create Grids +CO S +66 2 +']) ] +Id le +ĠUn ix +AB LES +pri ors +Ar m +tim ers +Ġerror Responder +ĠY OLO +Ġinter cept +Ġtrans itions +]] > ' +Ġback ends +Ġover written +ren ds +ESC APE +conv olve +mer ica +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +roll up +Ġfield names +и ÑģÑĤ +ãĤ ģ +Ġ16 3 +User Name +åı į +ĠRes ize +radi ance +SC EN +Ġ"\ " +cluster Name +Ġmy Screener +Qu it +Sp atial +gy pi +side s +side bar +ML P +Ġsql Content +Check ed +supp ress +UB IC +Ġmer ging +til de +æķ° åŃĹ +Ġloop back +ret ty +ret weet +Ġfinal Result +Output data +spect rograph +Do D +Case s +SO AP +Server Message +aut oc +à® ° +hour ly +elect rodes +MIN OR +pd p +Ġtrace d +New ton +Control Config +chine se +Ġdownload ing +fast er +fun ds +ĠTensor Board +DU PL +Ġcre ds +Ġdesc r +Ver tical +Ver tices +éĩ ĩ +Ġinv ocation +Ġ'{} _ +Ġexc info +WE EN +Ġflow cell +sy nthetic +flatten ed +Ġschedule d +extract all +Ġenter ing +sol v +Vis a +ĠAD J +Ġctsp If +éĻ ³ +ctsp Vlan +ółĢ°ółĢ ´ółģ¿ +ółĢ°ółĢ ²ółģ¿ +ĠAnd roid +Ġequ ipment +orph ic +Ġproxy client +Ġadjust ment +appro ved +Ġknow ledge +Ġcla mp +SY N +CAR D +Cache d +Uni prot +Ġnone bot +Ġpk l +ĠPost gres +ĠØ ¯ +ॠĢ +ĠStruct Field +Ġ'$ ( +nonzero y +Ġtar ball +Ġescape Squares +ĠDocument ation +Cm ts +å¾Ĺ åĪ° +ĠConnection Error +Ġprote ct +Ġsi ÄĻ +ENTIAL S +Ġsat uration +dra matiq +ĠMac ro +accum ulator +çŃ ¾ +ĠFin ished +Ġopp osite +Ġhealth y +Ġagree ment +Ġsuc ceed +Tick et +ogene ous +ĠEmbed ding +tang ent +Ġtor que +posed ge +ĠTrack er +ĠSTART ED +activ ations +activ ated +à°¿ à°Ĥ +ðŁı´ółģ«ółģ ¥ +Ġcsr f +dN dzdmag +recomm ender +May a +POMERIUM SESSION +Ġspeak ers +ĠWrit ten +ĠBound ing +Aggreg ate +ĠTele gram +Ġear lier +DISABLE D +ĠMIS SING +,? ,? +plas mid +ðŁı´ółģªółģ ° +MEN U +Ġintern ally +gol ang +Bron x +ĠFIG URE +8730094 609308 +Ġiç in +ĠÑĩиÑģ л +ĠALLOW ED +# -------------------------------- +( .*? +, :]) +5 23 +5 46 +6 30 +7 43 +8 13 +B enchmark +D EN +D GRAM +E v +E urope +E QUAL +H op +H AS +H umidity +I K +L em +O Q +P andas +P enn +Q Y +S il +S am +T axon +V D +V H +W ay +X k +Y l +\ ; +] ==" +a Y +b M +c mb +c runch +d K +d M +g E +j id +j sp +j unction +k q +l j +m env +n ib +n atural +p H +p it +p Desc +p uls +q emu +v are +v cp +v fc +x range +z b +} ): +° ¨ +× ŀ +æ ¥ +é ½ +Ġ ا +Ġ ú +ĠĠĠĠ ĊĊĠĠĠ +in active +in clusive +er ed +re current +Ġ= ==== +st y +le id +Ġi th +Ġ' (' +ro spy +Ġc lu +Ġc ros +Ġc ities +Ġp lat +Ġf ns +Ġf ram +it é +Ġn os +Ġn gram +Ġn dimage +Ġn úmeros +Ġs lm +ur lencoded +Ġin form +Ġo o +Ġd ip +li r +Ġe sc +la do +Ġ# " +ed ited +Ġ0 7 +di visor +di pole +Ġfor ever +ode tic +get Value +(' -------------------------------- +)) ))) +ĠT LS +ĠT AX +ĠT LV +ĠT DXY +Ġ2 99 +Ġ2 88 +Ġ2 48 +(" => +et Address +ĠS ense +ĠS now +ĠS MS +ab r +ĠC i +ĠC uda +Ġ== > +Ġg x +Ġg allery +Ġl ing +end Time +ĠA ES +ĠA rc +sp ikes +'] ; +'] [: +to e +to bs +om bs +ĠP df +ĠP eriod +ĠP Bind +ĠP NG +=' $ +Ġde ath +im ity +Ġ3 01 +ĠD ES +Re comm +Re presentation +sh ire +time course +if n +if def +Ġv oting +Ġnp r +ĠO k +Ġse at +ĊĠĠĠĠĠ ĊĠĠĠ +test er +IN CLUDE +Ġme tron +Ġme eting +ON ES +---------------- ---------- +art in +pre cip +ĠB IP +ĠB GR +ob serve +ly mp +Ġres ampling +ĠR ain +ĠR DF +ĠR SA +ĠR ational +Con d +AR GE +ĠU ID +). " +Ġk means +St rength +Ġpy b +ag it +og en +05 18 +dd f +64 5833333333 +RE JECT +Ġtra versal +ĠH ub +ĠRe ason +eri alize +][ ::- +Ġdi pole +df g +19 32 +19 82 +19 65 +ĠIn vent +with Column +ere quis +27 11 +27 07 +Ġle ader +Ġle ague +Ġconfig file +Ġpo le +Ġsub sets +94 0 +AL IGN +Ġopen api +Ġid ent +ĠK afka +26 57 +26 75 +Ġjson object +create s +List en +CO DER +md p +api key +23 18 +Ġte ktronix +ps nr +Ġdis ks +Ġdis covered +AP L +Co ver +28 02 +28 08 +ther mal +56 77 +cre st +Ġdistri ct +Ġtrans mission +Ġreg enerated +bg color +89 13 +ĠSt ation +Ġdire ctive +root dir +De g +US SI +cul ation +ĠPro viding +FF T +ug ar +ze bo +ï¼ Ł +(- ( +conf s +čĊčĊ čĊčĊč +Ġmode m +LI R +stack ed +Ġspecific ally +Form ula +over lapping +pr p +Ġ16 2 +Ġbin aries +ĠDe vices +CA ST +author ity +ian a +unit tests +pu zzle +Ġgl m +ĠID XGI +Ġmy list +Qu ick +Ġ[[ ] +gest ure +Ġmon key +FO OT +Pre set +]]) . +Sub set +æľ ± +hex lify +Check Box +Port Status +Ġ'% . +ĠApp ro +Ġsw ift +.* , +We ak +Ġerr s +multi class +cla zz +EXT ENSION +nan o +Oper and +Oper ations +GG T +Ġ26 20 +lang s +á» ¥ +á» ģ +á» ĥ +PAR SE +gpu array +à° ¸ +fid ential +termin als +bb b +Ġip address +Cal c +ĠError s +Ġlat ency +1111111111111111 1111111 +Ġplace holders +PRE C +ja co +SU JI +ó w +ĠField Value +ĠHTTP Server +Ñı ем +:" + +%% " +mes senger +Ġpl ans +sy mlink +ĠPublic Key +ółĢ± ółĢ°ółģ¿ +Ġrep lication +star ships +dq m +TS F +Ġpol ling +ĠMon th +ĠMessage s +Contain ers +exe mpt +Transaction Fee +åıĸ å¾Ĺ +Ġcla de +ensemb ling +Ġ================================================================= =========== +Ġband s +Ġsuffix es +INST ST +Ġsimp lified +éĿ ŀ +Ġball s +quad ratic +Hub Port +dos age +lig ated +aggreg ator +PW D +ìĦ ¸ +central Widget +Ġtrigger ed +Ġadv ance +rack er +00000011 00000011 ++'_ '+ +ìŀ ħ +ĠPe ople +GP US +ĠDep endencies +èĢ ĥ +Measure Node +Ġfew er +STREAM S +hess ian +Ġhy dro +FRAME WORK +CHANNEL S +Wave Number +Ġ################################################################ ################################ +Ġneighbour s +Ġvoxel s +ìļ Ķ +ĠcpwVc Perf +MARK S +éļ ı +ĠSM TP +Ġreplic a +ĠNamed TemporaryFile +Fetch er +Ġconver ged +Ġparagraph s +Ġdeclar ative +ìĹIJ ìĦľ +Qual ity +ĠAda pt +ĠSTAT IC +Tw itter +rie ves +Geo DataFrame +isol ate +cipher text +åİĭ 缩 +evalu ated +Central WaveNumber +discri minant +ĠPa ul +COMPON ENTS +åĭ ķ +ĠMeasureDuration Next +Ġautog rad +ĠSN MP +ugging face +å®Į æĪIJ +ĠCUR RENT +çīĪ æľ¬ +é¦ ĸ +éĵ¾ æİ¥ +commut ator +Estimated TransactionFee +è®° å½ķ +KAN SUJI +Stateful Function +7483 647 +Ġnump oints +BlockHeaders WithChainLock +æIJľ ç´¢ +sali ency +Cmts CmStatus +" ``` +" âŀĸâŀĸâŀĸâŀĸ +' & +) ''' +, ", +- ]) +4 89 +7 92 +8 17 +8 28 +B all +B ill +C rit +D LOG +F z +G a +G EM +G PS +G amut +H ID +I mpl +J W +J obs +L ST +M or +M ult +M IST +P addle +P kt +R ig +S keleton +T t +T LV +W ake +Y w +Y PES +[ / +] () +a B +a C +a E +a X +a ções +b L +b colors +c E +d cc +e R +f get +f red +g M +h space +i Q +j un +m tick +m ars +n F +n bins +q we +s j +s nd +t ck +t utorials +u data +v D +v ors +v oucher +w rist +} ({ +æ ħ +ç ¿ +é Ł³ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ æķ°æį® +Ġ ĉĉĉ +in ux +in clusion +se cts +de cess +de em +de mon +le ague +an ine +Ġi ot +Ġ' ))) +ti an +mp lot +Ġp ct +Ġp th +Ġp format +Ġp su +ce le +Ġn h +Ġs ist +Ġs sim +ur g +ss r +Ġin a +Ġre fit +Ġm w +Ġm gr +Ġm ua +Ġe k +ad y +co ind +co hort +Ġb er +Ġb ay +Ġ1 82 +Ġ# @ +rom acs +di se +ul ates +ot p +': - +ĊĊ ĊĊĠ +__ (' +__ ") +get mtime +set point +set Enabled +set Joint +ĠT el +Ġ2 0000 +Ġ2 13 +(" ! +') ][ +as semble +ve ct +Ġ{ _ +ĠS IGN +ĠC ts +ĠC AS +ig an +for ces +Ġr na +ĠA p +'] [:, +'] ]): +ic lient +to array +path String +ist io +ĠF er +ĠF loor +od le +Ġh du +po ke +ĠP hi +ĠP addle +Ġth ermal +Ġde crypted +0000 0111 +form set +Ġu E +key value +=" [ +Ġv v +ĠO mega +os itions +Ġma kedirs +Ġme ant +pre sence +Ġbe yond +Ċĉ ĊĉĊ +"] ]. +ĠB oth +ĠB roadcast +12 35 +ĠE FF +ĠE duc +Ġj acobian +""" \ +ĠN C +Ġ4 09 +Ġget env +ĠR AW +Ġun ary +OR ES +ĠG IN +ĠG tk +Ġco arse +url retrieve +Con tig +Con cepts +bu fs +ĠV CF +ĠU DP +Ġen codings +min o +line Edit +Ġk ine +25 84 +ST E +ec s +ip a +Ġch kpntTrap +ne uro +enti d +enti ment +22 05 +22 64 +22 35 +ĠH i +ĠH ands +ĠRe quire +Ġ{} .'. +input Port +df rame +comp artment +Ġ` % +27 14 +ant age +by pass +bin omial +ann ual +24 25 +point cloud +ache s +Ġcomp as +Ġcomp ose +55 00 +33 06 +ample s +87 9 +(), ' +AS Y +57 2 +do xygen +layer norm +Ġlo ser +66 1 +Ġli m +Ġtext box +28 13 +raw data +Ġsp lice +38 18 +AD J +save z +ĠX Y +ĠEx iting +Ġser vi +UN ITE +ĠIN TER +ĠJ un +ĠJ WT +To Keys +To Reference +ost a +not ation +'][' @ +Ġdb t +CL IM +21 99 +Ġ:: - +context manager +Ġqu oted +iss uer +âĸ Ħ +Ġback off +dic tive +bar code +uni verse +Ġchar ges +54 1 +next hop +Form ID +Ġiniti alizes +åı Ī +Int Opt +ĠSo cial +Ġmap a +Ġgl ue +(* , +Tx link +Ġmark up +ĠTh us +ee ded +lr u +}" ') +Ġì ĥ +Port Table +UD P +He ap +END C +'} ] +Color Ramp +Ġrest ored +Ġweb page +MC SCRIPT +Ġmc IP +Ġmc QCA +Session Middleware +POST GRES +å¤ ´ +å¤ ĩ +Ġ[- ] +modi fiers +render ing +Ġsm iles +ĠLog Level +term ux +Norm alized +`. '. +Resource Id +á» ı +zy xelAclV +SH OT +Ġreport lab +>< ![ +ĠAl ert +Ġperson al +Ġfactor ies +Ġ'{ :. +Down loader +Cal ibration +Over lap +Over ride +Obj ective +Ġdiff lib +gal axies +IF EST +ç» Ń +Ġside s +ima ger +å¾ Ģ +Ġdesc ent +simple filter +ĠRequest Context +room ID +Register FileDescriptor +ĠReg istration +Ġimplement ing +And Wait +poly gons +Ġms rest +ółĢ± ółĢ±ółģ¿ +Ġquanti zation +Vis ibility +IV RY +Cmd Tx +Cmd Rx +Ġbook s +ółĢ°ółĢ ¶ółģ¿ +01000000 01000000 +Ġsn ippets +PA IR +Ġanaly se +Ġgre mlin +Ġdecor ators +quot ed +иР± +ĠWeb Socket +ĠBe gin +Cap Lam +Ġmid i +SERV ICES +Ġreason able +âŀĸ \ +benchmark s +Ġв Ñģ +Ġí Į +Ġinvok er +ĠLay ers +å¸ « +)))) /( +Constant Option +âĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪâĸĪ +æĭ ¿ +è§ Ĩ +Ġgu ard +tracked Cells +оÑĢ м +åı¯ èĥ½ +Ġrepro du +Notif Tx +Notif Rx +Ġarc py +Ġmx net +Ġonto logy +osa Outputdata +SIGN ATURE +Ġtrunc ation +STRUCT URE +west ern +Ġcisco DiaBaseProt +ĠåĪ Ľå»º +ĠåĪ Ŀå§ĭåĮĸ +tro op +Calcul ator +ĠSto kes +Month ly +Motor Control +Ġpay in +ĠCir cuit +604 166666666667 +drug bank +ĠOptim izer +Combin ed +ĠOct etString +Stamp ed +âŀĸâŀĸâŀĸâŀĸ âŀĸ\ +lips is +åĮħ åIJ« +Primary KeyConstraint +677 9 +Ter rain +Ack Tx +Ack Rx +++++++++++++++++ ++++++++++++++++ +Prepare Node +Ġsubstit utions +ìĬ¤ íĬ¸ +Ġrdf lib +Ġcoeff s +···· ···· +ĠConcat enate +Ġinflu ence +åħĥ ç´ł +mW avelength +ĠFo od +ĠSTE P +8894 47 +Mig ration +ìĺ ¤ +REQUIRE MENTS +ĠIntegr ityError +Ġheter ogeneity +Ġbea utiful +}`` `", +íĸ ī +ĠOw ner +explor er +ĠscaledValueOf CentralWaveNumber +Ãĥ O +Chn Pairs +Combo Box +ILAR ITY +645833333333 3335 +æľ± æѦ +"âŀĸâŀĸâŀĸâŀĸ âŀĸâŀĸâŀĸâŀĸâŀĸ\ +setJoint MotorControl +inputPort ByName +# [ +% ' +' ^\ +' ãĢģ +( ([ +) [::- ++ )', +, ... +. ( +/ $", +: ")) += $ += (( +> [\ +C t +C um +C rv +C LEAN +D hcp +D URATION +D eriv +E xact +F H +F irmware +G t +G z +G EST +H f +J l +J eff +L arge +O d +O q +P et +P EN +P DT +Q D +R ain +R eroute +S j +S ink +T om +T ERS +U w +Z e +a fs +a je +b T +b V +b are +b br +b ecause +c K +c U +c ars +c ategor +c itation +d ont +d pa +d uring +d umb +f N +h E +i id +i row +k B +k max +m iller +n I +n ail +o tion +p on +p ile +p unct +q v +r U +r j +s ds +t Z +v ag +w space +z j +z hi +} ={ +à Ł +Ä ° +× © +Ø ¶ +Ù ¾ +á ½ +é ² +ì ĽIJ +Ġ ç +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ 计ç®Ĺ +at mos +re actions +re construct +st ill +Ġt ight +al phas +Ġ' [' +ti fs +Ġc tr +Ġc ubes +Ġp aginate +Ġf max +Ġf sw +he it +Ġa IBi +Ġa dicion +lo u +00 94 +ge mm +Ġs dist +Ġs hel +Ġs ieve +ur day +Ġin de +Ġre ver +Ġo cr +Ġd ynam +Ġd rag +Ġd raft +Ġd anger +li cts +li gence +() }") +co a +Ġb lo +Ġb audrate +ed its +rom an +te en +di late +ot ation +ot to +Ġfor k +ol lo +one of +Ġto ml +ĠT ax +il ers +th ings +th readed +con vex +op ener +ĠS lot +ĠS calar +Ġdef lection +Ġg pcd +Ġr mse +Ġl ons +ĠA void +sp n +'] ))) +01 03 +Ġcon form +Ġcon tribution +am en +sc m +Ġh im +ĠP D +ĠP UT +ĠL B +ĠL if +=' *', +Ġde ve +Ġde part +Ġde livery +Ġde aths +ex ion +ex cla +im save +im mutable +Ġex clusive +Ġex haust +Ġ3 82 +ĠD M +ac ility +Re ceive +ĠM utable +time d +ew ard +Ġy outube +ĠO RI +Ġ% } +Ġ% }' +Ġpro f +Ġpro ble +Ġpro mpts +pre processed +cess o +ĠB enchmark +ĠE q +ĠE arly +Ġj j +ci ble +ob i +ans i +user info +bo ston +Ġ4 11 +Ġget ter +In dicators +ind a +ind o +ĠR ename +ĠR obo +per mutations +ĠG est +ĠG round +ĠG ather +Ġco vid +Ġco alesce +Ġout bound +ĠV ision +Ġan t +min sn +IT AL +18 99 +Ġk mer +Ġpy bullet +http server +jo y +Ġop ener +base path +RE CORD +22 02 +22 07 +22 24 +22 23 +22 63 +ĠH ouse +ĠH osp +image Canvas +comp uting +comp arisons +34 53 +27 05 +27 37 +27 33 +ĠThe ta +96 72 +ĠCon version +arn ed +Ġno v +Ġla mp +ron ym +86 2 +26 33 +26 72 +Ġdo fs +rit ory +57 0 +Ġper imeter +Ġne mo +ele ms +"," + +List Resource +23 52 +ps ilon +Ġ** { +cor n +mail box +28 14 +RI P +Ġpass wd +Ġsp aghetti +38 35 +Se quences +ĠX test +`` ). +Ch i +rt ol +Num eric +Ġdire c +To x +Config Option +29 16 +29 06 +Ġdoc x +bot s +:: : +EX PL +Ġany more +place holders +Ġ'. ': +mt l +pc ap +Ġtyp ical +tick ers +fit ted +Com bat +cache s +Ġuni q +Class Name +Input Transform +Ġsupp osed +ãĤ · +change key +Ġ200 3 +ãĥ ¥ +Up grade +ĊĠĠ ĊĠĠĠ +IP A +ÑĢ Ñĭ +Request ing +Inter faces +Ġsa fety +Qu eries +Ñģ п +äº Ķ +Ġloc us +bit mask +Pre tty +DS M +++ + +è¯ Ħ +Ġfunc ion +Ġloop ing +Ġprogram me +Ġ'_ ') +single ton +аР¶ +pad x +}' " +Output Stream +еР² +SV G +GL ES +á» § +short cut +Ġpredict ing +AV IS +An imal +mu R +ĠBo ot +Ip Sw +Ip Hw +Ġfun ção +{\ " +à° ¦ +elect ric +ĠString Field +ÃŃ a +Ġpop ular +Msg Type +VERS IONS +Ġdepth s +pytest mark +ĠOpen CV +Ġsepar ation +ı z +miss ive +Ġestim ators +Ġdesc endants +gl canvas +Open ed +ółĢ° ółĢ±ółģ¿ +WE ATHER +Ġcommit s +Ġcommit ment +ah an +ĠSE ARCH +regex p +submit ted +unic ip +Multi physics +ĠRandom ized +contin uum +(', ', +Ġtab u +Ġpla ys +Current ly +124 89193 +ĠModule NotFoundError +146 12489193 +Ġsur rounding +ĠMin MaxScaler +Exist ing +={} & +Ġlinestyle s +Ġba selines +ĠBl ender +dialog ue +Ġden om +sso a +Common Middleware +ili ar +008 14612489193 +nor ms +ĠBack ground +âĸĪâĸĪâĸĪâĸĪ âĸĪ +Ġк оÑĤоÑĢ +Custom er +DY NAM +aggreg ation +(': ')[ +ĠMeasure d +æĹ¥ å¿Ĺ +Ġlearn ed +Basic Auth +stand alone +kn ob +Ġpod s +SING LE +Ġи з +Ġlig ase +Ġparticip ants +PV T +recover ies +restri ct +copi ed +Ġtech nique +Ġsho pping +Ġ#---------------------------------------------------------------- ----------- +cion es +Ġsay ı +Month s +ç»ĵ æŀĦ +smo ke +ATTRIBUT ES +Second FixedSurface +Ġmime types +DNA s +ĠEqu ation +datatype s +Ġreplic as +Ġrd kit +................ ................ +页 éĿ¢ +nut nr +Ġpesso as +ĠComplex ity +Ġorient ations +Ġban ker +ĠFUN CTION +åıĺ éĩı +ĠCred entials +ĠJava Script +æĪĸ èĢħ +Ġisol ated +UNI FORM +è¶ ħ +Docker file +ĠRi ver +Ġ`{} `.'. ++-+- +-+- +DRI VER +åĽł 为 +ë¶ Ħ +Dog s +elly fish +ĠIgn ite +Multip ly +consu me +DETAIL S +|{} |{} +rmar ry +ĠKratos Multiphysics +ĠRou ge +>,# < +pedi gree +STRA INT +GHIJKL MNOP +BTag MIST +ligate PostProcessing +Ġcev ap +DLOG P +00814612489193 6779 +% ; +* = +2 90 +6 29 +> - +> : +A spect +B an +B CM +C d +E k +E gg +E lapsed +F ET +G ri +I v +K w +K AFKA +L cl +N k +N or +N ational +O CI +P w +P UR +P ref +P inf +Q Z +Q MessageBox +R ATION +T RE +U tf +W Y +W k +W ashington +W EEK +Y x +^ {\ +` ). +a P +a S +b A +b X +b ones +c se +c ust +e A +e C +e F +e H +e vice +g lass +j og +k raus +l la +m A +m rstp +n terms +o ke +p ink +s Response +s fr +t mx +u ar +w et +z ers +z mq +{ ! +} }" +¸ ë +¸ ółģ +× ¤ +× § +Ú ¾ +č č +Ġ čĊĉĉ +Ġ ĊĠĠĠĠĠĠ +Ġ ZE +Ġ ############ +Ġ ancestors +ĵ Ŀ +ĠĠ č +ĠĠ čĊĠĠĠĠĠĠĠ +in ned +in secure +er ode +at ur +re cs +ĠĠĠ��ĠĠĠ ĊĠĠĠĠĠĠĠ +st ed +st ars +le ap +an neal +ti sh +Ġc inder +ge m +ort ex +Ġn w +Ġn ll +Ġn ÃŃvel +Ġs par +Ġs chools +ur ator +Ġin compatible +Ġre ly +Ġd av +Ġd é +un es +un official +Ġe id +ion al +", ) +Ġb read +Ġb alancer +Ġ# { +11 86 +Ġw p +ma sters +ck g +is hes +(' {: +(" ================ +ĠS OL +ĠS ESSION +ab lock +ĠC UI +ig lm +Ġg b +Ġg df +for me +Ġl ha +Ġl cd +sp r +'] ._ +ic ence +99 0 +sc a +sc at +Ġh uge +Ġh ybrid +ĠP RI +ĠP ART +ĠP eter +ĠI C +ĠL int +ĠL ex +ĠL ap +ĠL ike +Ġst y +Ġst ones +out path +ĠD F +Ġu handle +]) ], +if old +key stone +=" ?", +Ġv ul +ĊĠ ĊĠ +ĠO ld +ds n +art hek +are house +"] (" +ĠE m +ĠE asy +Ġj t +Ġj enkins +ci as +ob R +wor m +Ġ4 05 +lu gg +col name +ĠR and +ĠR EM +ĠR Pi +Ġun available +Ġlog dir +ph o +ĠG PT +ĠW ind +ĠW idget +ĠW iki +ĠW ATCH +ĠV GG +Ġ5 50 +mb ro +ard en +ard Table +Ġk n +25 97 +25 36 +og g +06 14 +Ġal ist +ou sel +gra vity +RE TR +ðŁ Ľ +ĠH at +sub class +Ġ{} )) +Ġ` . +34 47 +pos als +Ġwe eks +09 0 +27 01 +27 16 +27 08 +27 36 +27 77 +24 01 +37 09 +Pro cesses +Pro vides +Ġsub tree +rep lies +Ġnew lines +Ġinput File +Ġinput Image +55 1 +33 65 +AL TER +exp onent +exp iry +CT R +iv ity +mi xture +ron s +=[ (' +ĠK a +95 1 +26 97 +fa ir +fa vicon +Ġz f +Ġz stack +HE ALTH +Ġ! / +... '. +Ġ| _| +IS PACE +Ġne uro +23 07 +Ġli ft +44 14 +Ġdis connect +28 03 +28 37 +Ġpass phrase +38 24 +pop t +LO OD +PO P +PO LL +ä¸ ļ +Ġarg Dict +Ġreg ressor +wh it +led ger +du stry +Log isticRegression +Ġdescri ptive +open ing +ĠPy TypeChecker +Ġseri alizable +Time Ticks +48 02 +fe arthek +ãģ Ŀ +copy tree +Model Keys +post process +Get PriceReminder +76 2 +Ġiter items +TO M +mer ger +54 32 +const ellation +enter prise +fn a +Ġdif fs +Comp are +PP ED +job lib +queue d +Ġlib virt +ĠGener ation +qui libri +Man ual +Request Error +Al location +Ġ'' ') +Ġentry point +Ġsome one +ĠMed al +Ġclo uds +FO O +ĠDE C +VER IFICATION +Ġì ľ +NE ED +ha o +factor ial +áĥ £áĥ +VAL ISPACE +Ġcustom ize +á vel +ĠComp uter +Sim ilarity +Ġgen re +Ġvector izer +framework s +Command Handler +ĠLI ST +SV M +ठ¯ +used BatchNorm +á» ħ +SH ADER +Ġreport er +TER MIN +à® ® +ìĿ ¼ +Ġcap log +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġfactor ial +GEN ESIS +ev rmarry +Ver bose +199 1 +ĠReg ions +============ =") +clip board +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġpl ural +alan cers +ĠNe ighbor +Ġquanti les +############################################################################ # +Unit Event +mix up +equ iv +Random ForestClassifier +delay ed +Ġsq s +Ġupper case +yy yy +analy ses +cons istency +ółĢ°ółĢ ·ółģ¿ +WR AP +RS Protocol +ĠToken izer +Constraints Intersection +ĠMax Pooling +௠Ī +Ġsy mlink +Ġfe asible +met as +Ġbridge s +Initi alizing +nav rep +hyper parameters +pod s +Ġocc ure +FUN I +rist ian +д а +Embed dings +èĩ ³ +ĠLay out +å± ķ +ç§ » +ENV IRONMENT +Ġbalance s +Split ter +Ġcloud watch +ðŁı» âĢįâĻĢï¸ı +ðŁı½ âĢįâĻĢï¸ı +ðŁı¿ âĢįâĻĢï¸ı +ðŁı¼ âĢįâĻĢï¸ı +ðŁı¾ âĢįâĻĢï¸ı +Empty String +MIS C +ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠ +war der +ĠStorage Functions +Callback s +Ġadv antages +Ġattach ments +circuit Components +vile ged +Ġevalu ating +Ġaccum ulator +CHAR ACT +ĠMay be +æı ı +æľĢ å°ı +čĊĉĉĉĉĉĉ ĉ +qr code +Ġfore ign +Install er +ĠMeta Data +ãĤ¹ ãĥĪ +ĠInte grate +å®ŀ ä½ĵ +ĠImp act +Speci fication +MARK ER +Ġtrim med +ĠNeed s +Ġol dest +DIST ANCE +Hist ogram +Ġcau ght +Ġstandardi zed +Ġslug ify +ENC IES +<<<< <<<< +GENER AL +SEG MENT +ãĢĢãĢĢ ãĢĢãĢĢ +xg boost +Ġnecess arily +Ġreceiv es +âķļ âķIJâķĿ +ĠArti st +(',' )) +Ġlh ablock +DEPLOY OPTIONS +Ġsatis fied +Ġexceed s +èĦ ļ +ĠBL ACK +ðŁı´ółģ¨ółģ µółģ +Leg end +ĠAlign ment +substit utions +HIST ORY +4546 368 +Ġhay stack +alta z +ĠPolyaxon Client +roper ly +DOCUMENT ATION +heapp ush +Ġlogarith mic +Letalis ce +ĠCalibration Error +Ġкол иÑĩеÑģÑĤв +issub set +ABCDEF GHIJKLMNOP +=['* ']) +BUL K +abcdefghijklmnop qrstuvwxyz +incenti ves +FOOT ER +UNITE VENT +889447 4546368 +Ġlha code +fearthek raken +quilibri um +" '{ +/ @ +4 326 +5 29 +5 31 +6 20 +7 19 +9 000 +< _| += (), +> ) +> '. +> `. +? > +B rightness +C J +C pp +C od +C ats +C srf +E nemy +F ront +G k +G ar +I PT +I ATE +J ust +J UN +K r +L an +M b +P ie +R aster +R PAREN +S X +S HO +S QU +S LA +T ar +T el +T xt +U MP +V Log +W p +W alk +X ml +Y p +Y UV +Z l +Z u +\ - +_ ': +a V +a post +b py +b ates +b ble +b ssid +c rl +d str +d ance +g dp +i U +i pe +i ri +i vely +j unk +l ti +n The +n ie +p mid +p fx +s rt +s Resource +u ci +w get +w ares +x tick +z g +| ',' +¯ ¸ +Æ ¡ +Î ¸ +Ð ŀ +â Ŀ +è į +ì łģ +Ċ ĊĠĠĠĠĠĠĠĠĠĠ +re build +ĊĠĠĠ ĊĠĠ +al yst +Ġ' }', +ro ver +Ġc ash +Ġc lon +Ġf q +Ġf am +Ġf arm +Ġf ocal +Ġf etched +Ġ" ): +Ġs ine +Ġs nd +Ġs now +ss ian +Ġin set +Ġre ci +Ġre write +Ġo vers +li sp +li sm +un able +Ġm ad +Ġm time +Ġm iller +ra pping +Ġe ine +Ġe ight +Ġ( $ +Ġ0 4 +Ġw ird +ot ors +)) # +Ġto wn +ĠT AG +ĠT Up +th rows +us hed +con ts +con tribution +ers ic +iz able +iz za +ve z +Ġ{ ', +ĠS am +ĠS cope +ĠS lice +ĠC ut +Ġg id +Ġg amer +Ġr python +Ġl f +ĠA str +Ġcon tracts +ĠF inds +od a +sc ans +log Tag +list ic +ĠP seudo +Ġas ynchronous +ĠI mplement +ĠL A +res i +res lice +Ġth ro +Ġth rown +=' _ +=' ../ +Ġst im +Ġ3 81 +args pec +out File +Re ceiver +Ġdata source +ĠM D +ĠM ol +ĠM LP +Ġv et +IN CRE +ance ll +pre sen +ang a +Ġbe g +Ġbe have +12 01 +ĠE mp +ĠE uler +ob tain +Ġ4 51 +92 00 +ĠR AD +Ġun zip +oc id +ĠG MT +tri ggers +Ġout path +bu oy +ĠV ul +ry o +Ġ5 08 +ard Entry +Ġtime series +cur ses +Ġk shape +25 16 +Ġset tle +04 99 +ST AR +Ġch apters +dd b +dd y +dd ft +ari um +Ġpre cise +Ġra ce +gra v +RE P +22 08 +ĠH er +ĠH umidity +ĠRe call +ĠRe ward +ay lor +ml m +mat ria +Ġdi ver +Ġdi vergence +db g +ast ime +19 17 +lin der +Ġwe ird +ĠIn fer +ĠIn flux +27 32 +27 96 +27 26 +27 74 +inter pre +inter rupt +Pro cessed +em d +ĠCon ditional +Ġnew ton +[: ]) +33 99 +no Letalisce +". / +Ġopen v +Ġdist ortion +86 0 +86 9 +mon d +Ġ[' / +reg ress +CO ME +md l +=( ',', +ps util +IM READ +Ġdis criminator +AP PROX +idx max +]: +> .* +A AC +A lex +B road +C op +C ategorical +D ol +D arwin +G CM +L ive +L asso +L PAREN +M SC +P ot +Q h +R u +R fc +R ULES +R isk +S ch +S izer +S trip +T ho +T REE +U GH +V en +W J +X N +Y q +Z N +b undles +c ny +e N +e ither +f ld +f inger +f ederated +g ff +j ss +k al +k et +k nowledge +m box +m jd +n im +n uc +n PIm +o DB +p andoc +p aginate +r ds +r arity +s db +t cl +t IA +u ations +w ps +x istent +y in +z lib +} '][' +¼ '), +Î ² +å ĺ +é Į +ê ± +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ċĉĉĉĉĉ +Ġ čĊĉĉĉ +Ġ åľ¨ +Ġ α +Ħ ë +in bound +er mo +at u +re ds +re moval +re putation +se at +se is +st ores +st ories +st iffness +en roll +de con +an cia +Ġ' |' +ti k +Ġp las +Ġp unct +Ġf pr +00 15 +Ġn lu +Ġs au +Ġs sd +Ġin active +Ġe yes +co es +co tt +co oldown +Ġ1 81 +Ġ( __ +Ġ0 5 +Ġw rt +ch in +di vergences +is cal +__ ()) +__ "): +get Time +get pass +ĠT V +th y +us m +us ive +import lib +str tab +con crete +(" -------------------------------- +op ti +op rot +ve o +ve ction +ĠS ide +ĠS mooth +ĠS VM +ĠS ky +ab ri +ab stra +ĠC apture +ig bee +Ġg love +Ġl k +ĠA lice +ĠA UC +ver ifier +ke hl +to logy +ist or +ĠF ranklin +sc all +sc iss +vi mg +all ure +ĠP ACK +ĠI PP +res istance +Ġth rows +Ġde partment +pro mpts +pro cedures +Ġex posed +Ġ3 03 +ow ski +ĠD y +ĠD ol +ĠD arwin +ac quisition +Re ceipt +ite xt +ĠM ut +ĠM EM +ĠM SB +key file +lab or +=" ../ +Ġv oter +ext remities +Ġor m +add option +Ġel l +tra pz +ense es +ĠB P +ĠB LE +ĠB alance +ĠE v +ĠE lastic +################ ###### +lu ck +ĠR IGHT +Ġun sorted +Ġun safe +OR ED +Ġtest only +32 93 +32 46 +ph iloc +ĠG ri +ĠG ene +ĠG lobals +Ġco uple +Ġco ordinator +ho tel +ĠU sd +Ġ5 40 +ib ull +Ġen h +IT ED +18 17 +18 55 +18 95 +18 76 +cur y +Ġcol l +25 32 +Ġro b +Ġro llo +Ġset Up +http d +og Chain +ip c +Ġop ent +valid ated +lit s +Ġat tn +ok ernel +error bar +Ġrange Min +Ġra re +pi er +22 12 +22 37 +22 97 +ust ic +ĠRe ader +ĠRe presents +sub classes +sub domain +sub scriber +eri ved +mat gen +Ġsh allow +Ġdi vid +19 15 +19 05 +19 77 +Ġ` [ +34 02 +34 35 +27 38 +27 67 +27 48 +27 52 +nd vi +Ġle aving +Ġpo isson +yn opsis +Ġac me +ĠCon fidence +ĠCon structor +94 1 +33 57 +RO S +()) ; +row field +20 92 +mi pt +95 0 +Ġhelp ful +IS ON +Ġtf d +Ġbo ards +Ġper ceptron +CO UR +66 0 +66 20 +75 1 +idx min +ef it +28 04 +28 26 +RI O +so lete +38 34 +pop s +Buil ds +bs z +77 0 +PO L +token ization +token ized +cc f +]] ]: +face t +ĠEx planation +Ġgener ally +Ġver nier +du ck +host config +cp d +Un defined +To First +ĠPy torch +ĠPy Charm +CON ST +field set +29 05 +Ġdoc utils +MP I +ĠPro perties +ĠData Type +link er +Ġcount ed +Ġfa de +Ġele ms +Ġiter ative +MO UNT +mem ories +Comp utes +ãĤ Ī +seq eval +ĠDe precationWarning +pen e +ĠRes ources +sq s +Def initions +Ġ-------- ----- +Ġfont weight +*( ? +Ġmy cursor +fp n +':' + +Group Id +_{ :. +cast er +light ed +ĠMan ifest +ĠSO UND +Function al +diction aries +è¯ ´ +mm ing +Ġparam iko +ĠTime Ticks +Ġsuccess or +sched ulers +ret ta +nan max +Ġdimension ality +Mo ving +Norm alizer +Ġmulti cast +GG G +Ġaut oc +zy me +éĢ £ +GN D +Ġaverage s +Over rides +PRE TRAINED +Ġdiff use +("" . +Ġappro ved +Ġ"{ :. +ĠWh ile +install ation +NB PKG +([[ [ +ov n +Ġ'{} . +OPT S +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ +ĠExt ended +Ġexpression path +cour age +HTTP S +LLLLLLLL LLLLL +ĠText ure +Exp onents +åĢ Ļ +answer ed +bra ins +program me +Fixed LT +ĠCor rect +Ġnumer ator +Ġfix es +ðŁĩ ² +wave form +ółĢ°ółĢ ¸ółģ¿ +Ġbr ute +Ġ~ /. +organ isation +emp lo +WH EN +Ġanaly zed +appro ve +Ġclip ped +Gen es +Wrapper DF +Ġrect angles +trip les +WIT CH +WIT TER +ĠSV D +ki pping +CY AN +ĠØ ª +ĠØ ¬ +FUN CTIONS +Ġâ ī +Ġflo py +ĠâĢ ĵ +MI X +webs ockets +Ġlex icon +ĠVer tical +FOR CE +ĠOver write +ĠOper ator +mf cc +SCHE D +[:,:, :, +Ġbind ings +Ġregist ro +çķ Ļ +Pod Resource +IDX GIS +Material Expression +Mib Scalar +ĠIM G +accum ulation +ĠApi Client +communic ation +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġinterest ing +åħ³ éĶ® +DEP END +è¨ Ń +Ġzy xelAclV +AUTHOR IZED +Ġflt Spec +Ġcrypto graphy +fort un +Fra ction +kingdom s +Temporary Directory +нÑĭ е +Ġwb ia +ĠContent Type +ĠAnaly tical +ãĤ¤ ãĥ« +Ġalter ed +yolo v +METR IC +Ġìŀ Ī +Ġmanip ulate +MISS IONS +EXAMPLE xxxxxx +Wrap ped +Ġæī §è¡Į +jack ing +ĠTRAIN ING +ĠSC RIPT +Ġvl rep +ĠSpect rum +convolution al +xxxxxx EXAMPLExxxxxx +Seg ments +è© ¦ +loid y +ForeignKey Constraint +Rpc Error +ĠInline KeyboardButton +Ġá rea +Ġì¶ Ķ +fram erate +Ġreconstruct ed +ãģķ ãĤĮ +sst ables +ĠAbs olute +Ġdise ase +ãĥķãĤ ¡ +Ġinterpre ted +00000000000000000000 010 +ĠполÑĮзоваÑĤел Ñı +Ġrent al +Ġise qual +CRED ENTIALS +Ign oring +ìĬµ ëĭĪëĭ¤ +ä¸Ĭä¼ł çļĦ +openv switch +USSI AN +ĠEduc ation +ĠZE Logger +astime zone +tIA EA +kehl chen +ĠIPP ROTO +" ** +) @ +, ] +- {}'. +. ]* +/ "): +5 47 +5 00000 +6 98 +6 379 +B ri +B link +B AND +B asis +D avid +E arly +F rag +G ap +G pCronDump +H ours +I AS +J D +L d +M x +M argin +O VS +S OR +S ib +S LE +S dk +T ro +T ax +T AL +T UN +T IES +V CV +W a +W ar +X j +b aby +b ckg +c upy +d port +e E +e er +f E +f us +g Q +g row +h ad +h rs +m ux +m osaic +n K +n j +o li +p ter +p ids +p unch +p ypeit +q k +s bin +s old +t N +t end +u F +x Length +y j +à ¦ +æ ¹ +æ ¾ +è Į +é İ +ë ª +ë IJĺ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ~~~~~~~~~~~~~~~~ +Ġ ä¸ĭ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ķ ë +in lines +in gest +in sensitive +or che +at l +re ar +re train +re connect +Ġt ap +Ġt ill +Ġt cod +ar ma +al ph +de sk +an h +an ford +Ġi dir +Ġc ate +Ġc sc +Ġc ow +Ġc ust +Ġc andle +Ġc ó +Ġp atients +Ġf light +Ġf ancy +Ġ" "] +Ġ" +" +he ld +he misphere +Ġa ea +ge odetic +ce mber +Ġs lower +Ġs queeze +Ġs pherical +ur ance +ur ahan +Ġre cs +Ġd W +li l +li quid +Ġm int +Ġm ars +Ġe in +() == +Ġb right +Ġb kg +Ġb ird +Ġ1 999 +ed ger +Ġw space +Ġw fr +di abetes +es se +__ '): +get output +(' ! +ĠT weet +il ds +th rottle +Ġ2 26 +Ġ2 54 +[' < +op tes +ve mber +ĠS el +ĠS ys +ĠC AP +ĠC ached +up time +up loader +Ġg lo +Ġg loss +Ġr bf +Ġl d +ĠA sk +sp a +ult aneous +ver bs +to dict +99 37 +Ġ: ) +ĠF ran +ĠF req +qu ist +log var +Ġh max +Ġh ull +ĠP ulumi +ĠP retty +ĠL ot +ĠL YS +=' --', +Ġst retch +Ġ3 75 +Ġ3 39 +ĠD an +ĠD ialog +Ġu d +Ġv D +IN ATION +.. ') +---------------- -- +Ġfile type +Ġfile dialog +07 55 +ĠB inder +12 06 +ĠE s +Ġ< { +size of +ĠN A +Ġres ol +In active +ĠR L +ĠR ing +mo ke +mo jo +Ġun necessary +read I +Ġtest er +Ġlog uru +ĠG REEN +ĠG erman +EN O +tri angular +ĠU C +Ġ5 55 +ib ase +che ss +che bi +18 34 +25 64 +13 37 +05 88 +Ġ/ >< +Ġat ri +Ġat tempting +Ġra ck +Ġra dar +22 16 +22 84 +22 87 +ĠH W +ĠH SV +ĠRe view +ay er +Ġsh ield +Ġdi visible +work place +19 02 +19 85 +34 2214 +27 84 +Ġkey code +37 96 +ak o +state ful +rep lication +ĠCon firm +Ġ} \ +ĊĠĠĠĠ ĊĊ +Ġno ob +exp lainer +97 97 +lat tice +stra pping +26 73 +Ġmax imal +mon ition +Ġdate string +Ġz er +rit z +number ing +Ġbo dies +23 05 +ps ql +ps wd +Ġdis cover +Ġtext o +OT H +auth s +28 06 +28 96 +so li +Ġsp end +38 11 +38 16 +38 04 +38 15 +my py +be zier +be yond +ĠQ Label +Ġmo vies +AD R +',' - +45 85 +fil tr +ich io +Ġrandom ize +cc w +47 44 +ĠEx ercise +Test Suite +Ġser á +Ġevent ually +host ing +Ġcommand line +ĠJ upyter +Ġcal vin +Ġread only +To File +29 02 +29 15 +not a +graph ene +Table Request +cu its +)/ (( +ca ke +Ġ'/ ': +81 92 +39 55 +Ġsum marize +Message Middleware +Ġass umptions +mer chant +Ġobj ec +vector ized +Object Identity +Bo ot +Le ast +Ġiniti alizing +fore ign +Ġbin ning +CA DE +View Middleware +IND ER +ãĥ Ĩ +Ġstd scr +At tempting +ĠUser Profile +ATE GY +opt Error +Image Message +Image PatientNum +Ġwas n +ÑĢ ан +ĠPath s +Def SgtPolicy +Ġ". ". +Ġgl fw +Not Sup +CK ER +Ġmy file +Ġmy dict +Tx Power +Rx Power +ĠMed ical +hed ral +':' @ +pg m +Ġloc ator +Ġref ine +Ġrand range +Auth ors +ICs New +gb f +]+ = +Port folio +cip ant +åħ ¸ +oper ons +ĠCal c +áĥ ł +Ġsw itched +ĠComp osite +Ġpe ers +ĠRun ner +ĠTime Series +Ġstream lit +Mo vie +auto escape +Ġrecord ings +Norm als +Oper SgaclMapping +respon ding +Ġprefix ed +Cur WorkMode +mut ually +ĠPlot ting +Module Identity +pd k +ÃŃ n +Ġë ª¨ +zz a +zz anine +force d +menu item +({' _ +stock idx +Ġcons ult +Msg Tx +desc endant +ĠSub set +Dire ctive +Ġbit coind +ĠTensor flow +åį ĸ +relation ships +FLO WS +çĶ¨ äºİ +flo ors +HOST NAME +ĠObject Identity +################################################ ## +Ġfetch ing +Ġtool tip +sol vers +Ġcould n +ond on +Ġterm color +ĠPO INTER +Link ed +ĠAD MIN +Ġorigin ally +BACK UP +Exec utable +ĠIs Authenticated +person s +amb ridge +Pl ant +æİ § +Loop Detected +ĠPrint s +SY MB +ĠSimple Namespace +ĠPri ority +BY TES +workflow s +Translation External +Ġband it +qs fp +sto od +adv antages +Ġshare y +pic ious +ĠSc ene +Ġmultip lication +ĠAb ort +142 90 +ÙĪ ر +AU DIO +Ġelect rodes +Release Type +è§ Ĵ +ĠPort folio +Qos Queue +è¯ģ 人åĥıéĿ¢ +Imp act +Imp uter +ółĢ±ółĢ ´ółģ¿ +stand ing +ĠdocsLoadBal Grp +å¦Ĥ ä½ķ +çķ ¥ +Notification Type +Adam Optimizer +Ġsens itive +Deploy ment +Inf ected +Ġta xa +Ġquad ratic +rw Motor +Ġprun ed +åºı åĪĹ +bounding Rect +Ġgdal test +Ġqual quer +Revision s +CHO OL +Elect ric +ĠEqu ipment +Yes No +ĠNv API +ın da +Ġfac ility +PUBL ISH +æīĭ æĮģ +ĠFeed Version +prom otes +xxxxxxxx xxxxxxxx +ĠSpark Session +Ġimprove ment +Tmp Reg +Ġ214 7483647 +客 æĪ· +èĪ ĩ +NotSupp Tx +NotSupp Rx +Ġdri vers +ĠscaledValue OfFirstFixedSurface +èĤ ¡ +ĠIT EM +âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ +SUR F +LEAR NING +MONGO DB +âĸĪâĸĪâķĶ âķIJâķIJ +mib s +ĠTW ENT +POD RESOURCE +VIR T +lun gs +VBox Layout +Ġimb alance +#- *- +ingu ish +TensorflowModel Performance +ĠWebs ite +IEIn cor +èı ¯ +ĠREFER ENCES +ĠZip File +Elem wise +详 æĥħ +fusc ate +ĠOh io +ĠâĬ Ĺ +Lem matizer +ĠPaddle Paddle +Contig ID +excla mation +apost rophe +æĬ¤ çħ§ +ICsNew PT +TranslationExternal Suggestions +" ({ +" `. +# -- +# "+ +( ...) +) $ ++ (\ +- $ +B en +B ID +B attle +C z +D GET +E mb +E VER +F IND +F lex +H j +H ORIZ +K ING +K inesis +L v +L ex +N OR +N LP +P c +P value +P AS +P ivot +Q M +R aise +S low +S tem +S ESS +S inh +V J +V Z +V v +W ed +W ell +W ould +X Frame +Y D +Y k +Y OUR +\ "] +_ ), +a I +b F +b ake +b cm +b ubble +c N +c V +c ue +c fn +d lib +d psf +e B +e W +g test +g arbage +h lines +i B +i E +j ud +k ia +l q +l arch +m ro +m obj +m hd +n A +n spath +o ber +p ch +p am +p omdog +p anda +q F +q o +q sub +r B +r Y +r ps +s ift +s Req +t ornado +t ddft +u D +u N +u Z +u art +v uint +w ake +x on +x pr +x ia +y w +z arr +Ð ĺ +á µ +â ± +æ Ĥ +é ¾ +ï ½ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ï¼Į +Ġ **************************************************************** +Ġ âĸĪâĸĪâķij +ĠĠ ĊĊĠĠĠ +ĠĠĠ Ċ +in box +in dependent +er p +re ceptor +re serves +en y +en emies +Ġt ells +Ġt ao +de velop +an de +Ġi file +me v +Ġ' "+ +ti co +ti ary +Ġc wt +Ġp rm +Ġp agination +Ġp snr +Ġ" ;\ +he avy +Ġa wk +lo h +00 12 +00 92 +00 62 +ut ors +Ġre covered +Ġre bate +pe l +pe z +un labeled +Ġm dp +ra ke +Ġe fs +Ġb at +Ġb link +Ġb colors +id ian +Ġ( (), +Ġ0 11 +Ġw avg +Ġimport er +ol ation +Ġ+ + +is alpha +name Auth +get LocalizedString +set path +ĠT ran +xt ype +con c +con no +Ġ2 28 +Ġ2 45 +pp r +ĠS I +ĠS ig +ĠS AT +ĠS ho +ĠS AL +ĠS kipping +ab d +ĠC G +ĠC SA +ĠC MD +Ġg db +Ġg uessed +Ġr mtree +ĠA nt +sp ent +ĠF C +om inal +ta o +ĠP WM +ĠL exer +est ado +im ent +im balance +Ġex planation +Ġ3 74 +10 37 +ĠD r +ĠD ESCRIPTION +ĠD hcp +Ġu art +]) ( +Re corder +ĠM AN +ĠM ix +ĠM ATCH +if rame +Ġv n +Ġv t +Ġv nc +02 32 +Ġy ap +Ġy Sorted +test file +Ġor ange +add Link +Ġel v +'], ' +Ġpro viders +ĠB AR +ĠB ill +ĠB ank +ĠB rowser +ir an +num b +user data +ĠR ts +ĠR adi +ep c +32 54 +format ting +EN VAR +ĠW i +ĠW IDTH +Con fidence +Con nections +print f +Ġ5 02 +ib li +Ġk ullan +25 02 +25 18 +St udy +13 96 +15 53 +100 2 +max imize +ass ertion +03 12 +cs d +Ġop ens +ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġal ta +Ġal ice +Ġal gor +Ġal titude +Ġal bedo +93 66 +Ġpre dicates +'' '. +Ġra m +:// {}: +22 36 +22 47 +ĠH H +ĠH ot +ml flow +19 07 +19 16 +19 06 +19 47 +(( ? +34 77 +Ġ[" -- +ann ote +24 15 +37 16 +Ġcomp ri +33 96 +no x +fic a +exp lode +AS M +". ') +mi um +net cap +Ġid le +26 85 +26 95 +26 76 +26 68 +57 07 +57 46 +Ġ8 192 +do fs +man ufacturer +api list +23 34 +23 86 +und ers +Ġdis counts +En hance +28 18 +28 16 +tem ber +56 0 +38 29 +be come +AB BI +File Dialog +AD A +',' '). +Ġad ditive +table Name +`` .* +Ġ, ' +command desc +ĠEx pl +las hes +pert urb +find ers +find Contours +cy ber +Set Background +ĠJ aco +ĠJ apanese +cp g +cp m +CON V +29 13 +29 84 +29 55 +43 64 +Ġ100 1 +а Ñĩ +а еÑĤ +ãģ Ľ +])) ), +('-- - +expr s +Ġexp iry +Ġexp loit +Get optError +Ġwrit able +xy text +39 05 +Ġover riding +uni q +build ers +Ġed ited +she l +cmd line +Ġtop Most +Ġwhen ever +ĠCo in +Object Type +Comp at +Comp uter +ãĤ ¢ +pol arity +pen as +pen up +pen ded +Ġlib pysal +Ġextra cts +ãĥ Ĺ +late au +DB C +BU Y +ASE TS +Ġsim ilarities +Ġsa f +year ly +ĠImage DataGenerator +ĠTh ree +ĠTh reshold +For All +For bidden +hash lib +é ri +sm allest +Ġpi per +help s +ves sel +ä» ħ +++ ) +google ads +dm g +Ġcli pping +non free +('/ '): +fin Dummy +Ġsplit ted +Dis connect +Token Type +Ġjo ins +Ġign oring +Ġpick ed +rot ations +Ġinstall er +ĠLe af +Ġweb server +Ġrepresent ations +mk time +ĠPo isson +Ġtrack Tag +click house +prop het +è¿ ij +DEFAULT S +Tag ger +short name +FORM ANCE +Ġow ned +aut omatic +ĠAl ways +Ġdat aloaders +Ġcir cum +exc itation +Ġround Int ++\ .\ +car lo +car rier +OB S +Doc s +******************************** ******** +Ġarch ives +ĠTrans ition +Control List +Ġæ ł +Ġrel path +Ġappro val +ó rios +Open GL +assign ee +kit ti +Ġ"{} ", +к Ñĥ +Register ed +Ġimplement ations +ĠST D +DA Q +NOT IFICATION +Ġcar acter +Ġvol up +Network Id +ah l +Ġidenti fies +Ġidenti fying +>" + +LD AP +215 8 +Ġcombin ing +att endance +pm f +writ ers +Parse Error +scape s +|' =' +211 4 +bad ge +Iter ations +Ġderi ve +Fixed Len +в ед +216 7 +eth ereum +æŃ ¢ +æŃ Į +ĠMon te +ctsp If +amb ient +Tri angle +Named TemporaryFile +pet scii +Real nameAuth +ĠPh oto +Ġmag netic +Dep endency +dog s +Ġdeal ing +åİ Ĩ +SY NC +met ros +Ġshift Marker +Uni mplemented +ĠNetwork Id +Mask ed +chan ic +comb os +expect ation +Dete ct +Rest art +Cor rect +ðŁı´ółģŃółģ ´ółĢ +Meta Data +Wor ks +307 2 +every thing +ç§ Ĵ +REF RESH +Write Line +Ġretry ing +ĠCH AR +Ġboot camp +boost s +Qos If +ółĢ±ółĢ ³ółģ¿ +stand ardi +Ø§Ø ¯ +Ø§Ø ³ +Ġang r +ĠUnivers al +tor que +Exit Code +plain er +Ġд ÑĢÑĥ +Ġevalu ations +ĠIM URegisters +è re +čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +Ġplan es +Ġrout ers +312 22 +CHAR S +ĠBig Query +ÑĢаР¼ +Mis match +eder ation +Ġfriend ly +ĠSpeci fic +éĩį æĸ° +Fun cs +ĠDocker file +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +Ġhum mingbot +Ġlife time +contra il +REGI STER +ĠNv Method +ĠRot ation +Ġà Ģ +cao conno +Ġheart beat +shif ted +TRAN SL +Ġlm ks +ssss ssss +Ġmedi um +项 缮 +evalu ations +ĠProgress Bar +Act ual +éķ¿ 度 +ĠRad io +ëĵ ¤ +Ġoccup ied +FU ZZ +Ġprox ies +Ġcomput ations +TAB LES +Individual RealnameAuth +rollo ut +quas ar +ENUM ERATION +Trust Sec +è°ĥ çĶ¨ +STO CK +Ut ter +è£ ħ +ĠLookup Error +Ġach ieve +Ġretrie ving +8600 3388 +Ġmention ed +Ġads k +Ġconcaten ated +rabbit mq +Los ses +è« ĭ +Ġgds factory +Csrf ViewMiddleware +VEHIC LE +342214 86003388 +IndividualRealnameAuth sReq +' (\ +( ... +( \\ +. ": +2 102 +3 011 +5 48 +5 42 +7 89 +9 154 +: * +> """ +B ay +B idirectional +C NOT +D ry +D ial +D raft +E lastic +F em +F mt +F lour +H ull +H IDDEN +K v +K ine +L n +N pu +O tp +P ump +P AG +P ause +Q x +R ABBIT +S ay +S mooth +S lave +T u +T v +U z +X e +Z p +] <= +_ {} +b ab +b ac +b ill +b isect +b uried +c Q +d ss +d Loss +e J +e vm +f K +f stab +g name +g loss +g itignore +h V +h ap +h len +h ierarchical +i M +i Z +i ver +i que +i col +i ded +i fications +i SEG +j M +k ip +l sp +m other +n uage +p ine +p att +r tr +r peaks +s me +t Requesting +w en +w ild +y ang +z gal +| [ +} }\ +È Ļ +Ð ¢ +ë ¬¸ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ čĊčĊĠĠĠ +Ġ ĊĠĠ +Ġ æĺ¯ +Ġ ر +Ġ åĴĮ +in load +re lat +Ġ= ======= +st k +st un +Ġt end +Ġt pl +Ġt fidf +ar on +an atom +ro f +Ġc ub +Ġc aused +Ġp ypeit +Ġf min +Ġf orth +Ġf iring +Ġ" ! +Ġ" ~ +Ġ" .") +it Ãł +Ġa wa +lo uvain +Ġn id +Ġn ul +Ġs ms +ur andom +li days +ct c +ct g +un ions +Ġm é +Ġe at +Ġe speci +Ġe missions +co mplement +co upling +ri stop +Ġb rown +Ġb pf +Ġb undles +Ġ# . +ed ucation +int el +Ġ( ~ +Ġ[ . +ma cos +from keys +ol n +': " +), " +is am +get App +Ġto ward +ĠT ex +il ons +th ink +Ġ2 66 +op ath +op ml +ve g +ĠS ol +ĠS EM +ĠS olver +ĠC lock +ĠC ASE +ĠC Python +Ġg ps +ĠA mp +sp os +ult ra +ver e +01 05 +Ġcon test +Ġcon ans +am o +to on +ĠF ULL +ĠF rozen +ĠF ruit +Ġh ab +ĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +all er +ĠP at +ĠP EP +ĠI G +ĠL ONG +Ġth umb +Ġde tach +form al +Ġnot a +Ġex ceeded +Ġex posure +Ġex emplo +ĠD S +ĠD eriv +Re co +Ġv r +Ġv ision +Ġnp u +ĠO range +Ġpar s +Ġme lt +py py +pre co +ls f +Ċĉ Ġ +ĠB r +ĠB on +ĠB RO +ĠB AD +ĠB LOOD +ys mt +ĠE st +text Align +ĠN F +ĠN IC +################ ########### +OR G +lic ated +32 87 +32 73 +Ġco erce +ĠV O +ĠV IE +Ġ5 87 +Ġhe uristic +Ġan o +IT IZE +18 12 +sa urus +Ġk om +25 25 +Ġpy pi +ag s +04 00 +og r +lib curl +06 92 +SE PARATOR +ST ICK +03 11 +we ka +ne ver +22 25 +22 09 +22 27 +22 95 +ĠH y +Ġ{} % +Ġdi abetes +19 11 +19 64 +19 88 +start time +27 97 +27 43 +27 42 +Ġle ap +Ġle ia +ann ounce +37 34 +aliz ar +55 076 +DE G +Data Object +Ġla p +Ġopen moc +Ġuser data +run Params +run nable +cri mes +26 66 +26 89 +26 39 +Ġmax Value +57 08 +"," -- +try ing +current frame +23 99 +23 58 +AC ING +Ġte ar +44 67 +cor al +Co sh +28 11 +28 25 +56 78 +Ġpass words +38 17 +38 26 +LO OP +of ing +pri mes +30 93 +))) * +ĠSe g +the ano +Ġtrans mit +Ġcode stream +replace ments +random ize +UN AUTHORIZED +iter dir +46 09 +ĠJ ames +open filename +open cl +Ob servation +29 64 +21 93 +search sorted +vo ids +cu sed +down s +down loader +strip ped +sv Filter +EX CLU +ãģ ł +Ġfull path +mt bx +Ġexp lainer +Add resses +Ġsave path +ren cies +ik u +Ġdim m +String List +stack s +first ScreenText +Ġiniti ate +Ġiniti ally +Ġbuild ers +gr at +Ġbot s +system d +sw da +style sheet +ĠRes olution +Trans actions +Index es +PL TE +inser ted +Ġchange log +Ġchange Degree +Ġtmp T +Ġgraph ics +EM D +PRO GRESS +tom ine +QL abel +Ġsome where +ĠCh arge +Ad aptive +ven io +äº § +win reg +Ġpi er +_{ : +drop ped +Ġge ology +Ġthan ks +Dis card +nb r +Tensor Holder +ME I +åħ ± +åħ ĭ +Ġjo ke +oper ating +ĠRel ates +sd l +.* \ +Ġvi v +Line Qubit +Ġmer chant +"} } +Ġsingle ton +nan min +ĠEX AMPLES +click jacking +Ġthem selves +(** { +gh z +bn f +Button Text +aut htoken +Ġast ro +hist orical +Ġacc idents +ĠOb servation +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ +ä¸Ģ 次 +control led +ĠPlot SnapList +Ġindic ated +Ġip db +Ġflag ged +car bon +******************************** **************** +Ġmultiple s +Ġsec fs +("" ), +ĠQu aternion +ĠNO DE +Ġinser ts +mar izer +IF IC +Ġstats models +pare to +ĠTH EN +speci fication +199 2 +199 3 +aff ected +ĠText IO +Exp onential +JSON DecodeError +åĢ ¤ +Parameter Set +TOKEN S +ĠSp atial +Ġctsp IpSgt +CIS ION +under line +ĠCor pus +lis ions +216 2 +ĠGe orge +centi ve +Ġprivate Key +ółĢ°ółĢ ¹ółģ¿ +zon a +Ġes col +(', ')] +uck y +PA WN +Attr Data +udi fy +Ġtab la +mq p +Sec AuditLog +tot als +Ġless on +6666 66 +Ab ort +çī Į +984 1948 +ен ÑĤ +ĠBe am +SERV O +ĠNorm alized +Ġ({ :. +Ġ---------------- -------- +ĠMark er +Ġfbx Mesh +å± ŀ +åij ĺ +Member Id +regular izers +å°ı 人 +Pack ed +Mac Address +Ġgu ide +ĠCar lo +Sm art +zM z +RT V +fire fox +ĠпÑĢ о +emo j +Ġmi light +egg BoxPoints +Ġpod man +Pub Key +Inte gr +Ġalt Camp +iam at +rn as +Ġpersist ence +409 4 +Raw DescriptionHelpFormatter +ĠApply IndividualRealnameAuthsReq +___ / +ĠCount Vectorizer +arth ur +Ġflatten ed +ĠMongo DB +Ġpanel s +AFT ER +Align ed +bet as +jk stra +jet brains +å®ŀ çİ° +LANGU AGES +CONTAINER MESSAGE +Second ary +OPTION AL +bur st +electron s +åķ ı +Ġconver ge +æ¯ı 个 +Cancel led +declar ative +urs day +integr ations +太 å°ī +Django Templates +ĠCred ential +]+)/ $', +Persist ent +HIGH EST +infra structure +Rad io +RAT IO +èĬ ± +Gre y +KT BW +discri minator +Public Key +IDXGI Output +Ġconsu me +à±ģ ', +reci procal +ç´¢ å¼ķ +bayes ian +Ħì ¸µ +enci as +wal ks +Ġutiliz ar +ĠComm unic +aca demic +ĠStat istics +čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ +Ġhd rs +Ġguarante ed +hpnicf dot +ëł ¥ +stac les +Ġsoc at +#~#~ #~#~ +COORD IN +unte er +ĠGpCronDump TestCase +SPECI FIED +ëĤ ĺ +opro j +ĠTun nel +áli do +Ġsvn test +intern als +Ġwer den +IMPLE MENTED +é¢Ħ æµĭ +ĠSnap List +ibi lities +POMERIUMSERVICE ACCOUNT +ĠFAST A +ĠTfidf Vectorizer +Unresolved References +éĢŁ 度 +Ġpyle ecan +Disco Mode +0365 31222 +ĠCuda TensorHolder +PREC ATED +ãĥķãĤ¡ ãĤ¤ãĥ« +ĠTWENT Y +TrustSec Policy +036531222 9841948 +" ( +) `. +/ -- +2 133 +5 20 +6 21 +B rowser +C UT +C ards +D ur +D RO +D ns +F ort +F usedBatchNorm +G v +G OT +G uess +G rouped +H ave +I q +J AVA +K ED +L l +L etter +M and +M CTF +N n +N AS +P aste +S uc +S CHOOL +T j +T m +T od +T weet +T oggle +T WITTER +U a +U o +U su +V rrp +Y v +Z UR +b ys +b ary +b rato +c il +f C +f arm +f ancy +f whm +g io +g host +h mac +j Äħ +k A +l ue +m ens +n Y +n é +n itude +o up +p rt +q z +r just +s ac +t min +t body +u ic +u ros +v ps +v tx +x H +x Z +| >\ +} "] +¡ ° +¸ ółĢ +Ä © +ç ģ +è ¼ +Ġ ort +Ġ lay +Ġ lif +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ĥ ° +ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +or ent +se al +st u +en riched +Ġt ir +ar im +al ist +de ath +le ge +an ta +an ci +an tos +Ġ' ): +Ġc gi +Ġc StringIO +Ġf at +Ġf val +Ġf ruit +it tle +Ġa ver +Ġa im +00 09 +00 010011 +ge e +ge xf +Ġn as +Ġs pars +Ġin consistent +Ġre build +Ġre moval +Ġo lymp +Ġd B +Ġd ans +Ġd mg +un discounted +Ġm ols +Ġm fc +Ġe j +Ġe ase +la k +() ', +", "" +co la +Ġ# % +ed ition +Ġ( (- +ch ina +te t +te mpl +di lation +el lip +urn e +ĊĊ ĊĠĠĠĠĠ +get data +(' ;') +ĠT M +ĠT YPES +con tributors +con fidences +con strained +con sensus +Ġ2 43 +(" ================================ +(" ------------------------------------------------ +(" {}. +pp ler +ve ys +ĠS HO +ĠS PAR +ĠC N +ĠC am +ĠC ategorical +ig mp +for get +end time +end ente +data gen +ĠA TH +ĠA WA +ĠA greement +sp end +sp lice +Ġcon gru +ic ao +ith metic +ĠF ifth +om o +Ġh á +ĠP ep +ĠP oll +file obj +ĠL en +ĠL AT +ĠL ife +Ġst ories +pro grams +Ġ3 85 +ĠD C +ac curacies +ert ure +Re connect +ĠM G +ĠM iss +ĠM ultip +ĠM ARK +nt hes +Ġv ic +Ġv ault +02 15 +ew m +Ġse lects +IN HER +Ġel lip +1111 0000111100001111 +tra il +ens ation +py tz +py dantic +pre vs +ls st +12 05 +ĠE E +ĠE ffects +Ġj sii +ob by +text ures +ir c +num forms +In come +In jection +In centive +ĠR atio +Ġun et +fo g +32 76 +ĠG mb +ces fully +tri g +loc idade +bu mp +ĠV ir +ĠU E +ĠU r +mb le +). \ +Ġan alog +Ġan imals +Ġen roll +min w +18 64 +da des +25 08 +ag c +06 0 +ST ATION +max h +cs l +Ġal ex +valid ity +ari an +Ġpre fetch +RE USE +22 99 +Ġ\ | +ĠH EL +ĠRe LU +ay a +Ġ{} " +mat o +db tool +19 70 +Ġsc ans +Ġsc anning +34 27 +34 65 +pos y +ĠIn vert +ere o +27 15 +27 88 +27 46 +bin ar +24 37 +24 53 +37 97 +ak ota +Ġsub options +Ġsub section +Ġ} }, +33 07 +33 84 +ĊĠĠĠĠ ĊĠ +Ġlabel spacing +87 1 +87 427 +iv a +97 57 +ĠK al +Ġit ens +run e +26 24 +26 53 +mon key +Ġz z +au ght +trans it +trans mission +23 16 +23 95 +Ġdx l +AC LE +44 16 +Ġ** {}** +float y +']) +' +28 93 +28 36 +Ġsp aw +~~ ~ +38 19 +LO O +be an +ĠQ Graphics +ĠQ VBoxLayout +Col l +File Reader +Ġim mutable +Ġad r +ide a +Ġarg max +Ġbase dir +Set ConfigOption +wait able +Ġver ific +}) ") +Ġeach Hazard +ĠJ ose +89 64 +DI V +Ġ] )) +air mass +let t +CON CEPT +gener ations +29 11 +29 03 +Ġwork around +cli ps +Ġexp onent +39 32 +39 13 +folder name +conf test +Key Value +vector izer +send to +over la +Class Instances +pr j +dist ort +dist utils +dist illate +Ġsign up +ĠNo ise +ãĥ £ +pb ind +ordin ation +pping Site +Int ent +radi x +Loc ale +BU DGET +su la +CC S +IO U +300 8 +Client Message +medi cal +Ġsu fficient +diff use +scal a +home assistant +ĠTh u +Ġnon ce +ä» ¬ +reshape d +Ġfin alize +ALL Y +0000000000000000 00000000 +zip kin +ons ive +Ġcho osing +Ġjo ystick +cut ter +rel lo +Ġpick led +Ġcustom ized +Color map +.* ', +á n +('- ')[ +Ġresp on +"} ] +oo o +Ġerr msg +commit ment +STR ATEGY +pad y +site map +Ġ"_ ". +Options Middleware +cr ates +gre et +ĠAt tempt +AV W +Ġshe ets +fici ency +à° ļ +fl ame +elect rode +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ++\ . +bed tools +ev ada +Ġcenter ed +boot camp +super seding +GT D +Ġwin reg +cross Val +BR ACK +ĠGo al +Ġms b +SN AP +ĠClass Var +ĠText Input +Ġп еÑĢ +Ne ighbor +Ġhist orical +Ġhist ograms +Network s +æł ¹æį® +ä¸į èĥ½ +Exp ired +UND ER +Ġdescriptor s +ĠArgument Error +bul ge +Plot ter +ĠDec lare +sage maker +Unit Selector +ĠDB Session +384 6 +bad ges +bra vado +II I +ĠGe ometry +cons ider +234 5 +Attribute Type +Ġtermin ation +ĠMat erial +COMM IT +Attr s +Ġps f +217 3 +Ġmis sed +push Button +Ġsyn th +Ġregex p +INTER FACE +Part y +:::: : +accept or +Eval uating +har vest +Ab out +Ab ility +ĠPermission s +Ġcast le +Style s +SUB NETWORK +Ġnd ctl +Ġpk mn +Ġ#### ### +pod cast +ðŁı´ółģŃółģ ¤ółģ +station ary +eye brow +pay in +Ġworkflow s +ĠCLI ENT +Ġsche mes +ĠSample s +Ġdr one +ĠRO LE +identi fied +Ġok c +ĠOver ride +Er rs +Required Mixin +Sm iles +Ġê ¸ +Ġquote char +colour s +Ġdetector s +Ġll db +'`` , +示 ä¾ĭ +sho ulder +ufact ure +Ġprep end +ĠCre ation +AUT OT +MULT ILINE +Place ment +ìł Ħ +Ġcircle s +Ġrecent ly +Ġ################################ ######## +Year s +CAL C +éĸ Ģ +ĠåĪ ¤æĸŃ +ĠSa mpling +funcs ynopsis +YS IS +ĠLa TeX +è¨ Ī +ĠCONFIG URATION +erg ens +van illa +gover n +Ġeng lish +},{ },{ +æ¸ ¯ +æ¸ ħ +sam ba +åĨħ 容 +ли ÑĨ +ĠAnaly tics +ĠWait ing +ðŁı´ółģ®ółģ §ółģ +ĠBook ID +Ġlisten ers +Ġff mpeg +Ġgg rc +Ġintro duced +Wo od +Ġconsist ing +Ġintr insics +suggest ion +ë§ ģ +ĠPop ulation +Abs olute +ĠGR APH +Blend Shape +Ġ02 110 +Ġinvert ed +ĠCONT RO +Ġæī ĵ +MibTable Column +MibTable Row +eigen values +Ġhover template +ĠFix It +ĠBound ary +ĠSpect ral +Ġbla h +RAD IUS +paragraph s +ĠProb ability +wap Chain +ĠFE AT +åħ¶ ä»ĸ +ðŁı´ółģ¶ółģ ®ółĢ +Ġear liest +phan um +ELE C +FIC ATIONS +Ġautos pec +ĠBa seline +ÑĢав ил +rollo uts +Ġpare to +Ġxbmc gui +Watch er +sport s +ĠSta ff +AddTask Admin +AddTask Owner +influ xdb +RemoveTask Admin +RemoveTask Owner +Tunable Type +åIJ¯ åĬ¨ +éĹ® é¢ĺ +ĠMED IA +ĠSem antic +Connectivity Test +ĠProposal Id +GetOutput Port +ĠNeg ative +Bandwidth Conf +ĠDag ster +ĠINIT IAL +ĠFW Core +ĠPype It +ĠTak en +SetInput Connection +ĠFIR ST +ĠRack space +Visa UnitSelector +ĠHosp ital +ĠPRI V +ichio metry +XFrame OptionsMiddleware +ĠGmb H +# _ +# ", +$ '], +' ') +' [\ +* (( +* ']), ++ =' +, ', +. "] +/ ~ +3 113 +4 90 +A KE +B X +B order +B rain +C ascade +D PR +E J +E rf +G V +G b +G n +G un +G ED +H idden +J H +J OIN +L Q +M DO +N l +P ending +Q OS +Q Gradient +R ing +R EN +R DD +R olling +S ed +S ock +S UN +S olve +S FR +S ector +S ENTRY +T ake +T indices +W ho +[ \\/ +] '] +a F +a os +b Y +b Z +b ak +b logs +b elt +b asket +b audrate +c F +c in +c ax +e min +f on +f msg +f paths +g end +h M +h inge +h appy +i C +j r +j vm +k on +l sh +l mb +l angle +l gb +m type +m ounts +n il +n where +p N +p and +p vd +r R +s ad +s ic +s max +s lp +s ized +s lc +t max +u je +v cs +v string +w q +w dir +w izard +w deployments +} ]} +× ¢ +è ¥ +è ¸ +è IJ +é Ĭ +í Į +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ 第 +Ģ ìŀ¥ +in direct +at k +re defined +st or +Ġt et +ar ri +ar as +Ġi h +Ġi ocs +mp o +mp rop +Ġc rt +Ġp ins +Ġf ock +Ġf cn +Ġf ür +Ġ" == +it m +Ġa ve +Ġa ft +ge op +Ġn k +Ġn er +Ġn oc +Ġn map +Ġs lash +Ġs bj +Ġo cp +Ġd fa +Ġd urations +li zed +li kely +un handled +Ġm z +Ġm ate +Ġm im +Ġm istr +Ġm utable +Ġm outh +Ġm iles +Ġe trans +ion a +ad dition +", ". +co upl +Ġb are +Ġ1 200 +Ġw ing +Ġw get +Ġw cs +Ġw ildcard +], [- +Ġfor med +el la +is ations +Ġto mor +il le +il ink +con test +(" ** +(" ... +(" ..") +as g +ve sters +Ġis bn +ĠS po +ĠS ym +ĠS urface +ab la +ab cd +ĠC AL +ĠC md +ĠC LO +Ġg requests +Ġl iter +ĠA bri +'] +' +'] }" +Ġcon c +Ġcon sum +ke ley +ke ithley +to x +Ġ: ]), +od bc +Ġh ap +Ġh lines +all Lines +ta a +ta xa +ĠP al +ĠP LAT +ĠI ll +ĠI mm +ĠL uc +ĠL ua +ĠL ANG +0000 03 +Ġex cluding +Ġ3 77 +Ġ3 31 +out name +ac ific +time ToFirst +if lags +=" >= +ext ends +Ġy ticks +Ġx bm +os f +ER ON +IN O +IN EMENT +IN CIP +Ġstr at +.. \ +ms vs +Ġpro cur +py smi +pre scription +pre serve +ES E +ES PACE +ĠB B +ĠB iking +Ġname handler +Ġj avascript +ob b +Ġ< -> +AT O +ĠN ONE +ir r +len et +bo o +92 09 +In verse +append SF +ĠR ock +ep ort +read ers +lic an +32 64 +per formed +Ġco hort +EN CH +EN CODING +Ġnum Rows +min h +Ġtime frames +18 000 +Ġk t +Ġk grid +Ġcol lapsed +25 57 +25 46 +25 39 +25 49 +Ġro ugh +St reet +04 49 +04 984 +15 07 +max s +max w +max imal +cs m +17 17 +Ġpre ference +Ġpre ferences +([ (' +count down +pi v +22 68 +mat r +mat ter +Ġsh ar +Ġsh ipment +Ġdi ed +lp adding +19 04 +19 83 +34 14 +34 08 +34 95 +34 48 +27 99 +27 12 +27 04 +27 17 +27 19 +27 94 +opy thon +Ġconfig ura +24 92 +24 32 +24 65 +37 92 +37 88 +37 24 +37 45 +Pro mpt +Pro cedure +em g +Ġcom mas +yn th +ĠCon struction +ĠCon sumer +94 93 +94 0066 +33 12 +33 53 +Ġno tion +Ġno cover +mpl erate +AL S +Data Size +AS SET +=[ _ +=[ (" +Ġid p +ĠK it +Ġdist illate +view port +26 77 +57 92 +Ġ[' ', +Ġext ends +Ġ| ' +IS SU +Res er +Res erved +group ing +23 13 +AC CT +44 06 +Ġ** {' +ENT ION +75 9446 +Ġtext ual +float X +float w +cor tical +Co eff +Co ordinator +56 25 +38 38 +Ġmin idom +ĠUn til +Po isson +ĠQ oS +AD C +ran e +Ġad am +Ġvalid ating +ich t +ey es +ĠX OR +Ġpos itives +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ +UN C +gen res +func Name +ear ing +ĠSt and +Un ary +Ġq emu +temp ted +TR AVIS +ĠPy SNMP +Config Ext +29 07 +US ID +]* \ +gn a +ĠPro vides +Ġcontin uation +INT E +SI Z +EX E +link rowfield +DAT ASETS +Ġwork ed +ĠPar ses +ĠPar sing +ren heit +Ġfla ir +ĠCo ver +String Path +Ġorder Information +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +gr n +Ġweight ing +âĢį ðŁİ +Ġhead line +ĠDe code +Th inned +PL US +(_ ) +(_ (' +Ġ"/ ": +Image Folder +ĊĊĊĊ ĊĠĠĠĠĠĠĠ +Ġ-------- ------- +CC SD +Inter active +Option Parser +ĠCh art +Ñģ к +inst itution +Ġraw data +hash ers +Ġclo ser +tax on +best h +best w +tran scripts +feature names +bit map +PR S +PR IMARY +Ġge m +Pre paring +web m +NE WS +Ġdir names +ĠFile ExistsError +Port Conf +âĶĢâĶĢ âķŃ +ĠCal ib +ĠCal endar +áĥ ķ +Ġnn cf +'} }) +Per mit +Or ders +0011 01 +rad os +ĠComp ose +ĠComp uting +cf gs +cap log +ĠPRO GRAM +å¤ Ł +аР³ +TEST ING +vari ation +auto scale +auto complete +Ġkeys ToReference +ĠEX IT +CRE AT +loaded ACL +neg ate +neg atives +Oper Sgacl +cloud y +ĠAc quire +Ġdraw er +cr f +gre at +Ġhigh way +Tree Node +ish ing +allow s +Ġqueue d +MAX IMUM +ĠRE GI +Off sets +Ġpop ulated +Ġcoun ters +ni pe +("/ ")[ +Ġ"{ : +ĠInter national +ç» ľ +Stats Table +ó du +Content Type +å¾ ª +192 7 +export s +divid end +Ġcounter factualInterfaceSlider +ĠNote book +contour Area +Ġpa ssages +Ġap iname +flo ath +Ġsegment ed +ĠJSON DecodeError +006 25 +LLLLLLLL LLL +Ġп од +Instance Id +Ne ighbour +Req sts +íķ ł +IE Core +204 9 +Plot ting +ĠDB Manager +IV S +ä¾ Ľ +Track OfThingsProducer +Ġproblem type +BACK ENDS +dh w +ĠStart s +unic orn +Cmd Context +294 7 +193 1 +My SQL +den om +den orm +ĠAnd rew +person al +Ġcos mo +ĠAs sets +uest a +good s +km ers +sur rogate +RM SE +ĠÑģ л +Feature Set +ĠMO D +chan ical +ARCH IVE +Ġgeo tiff +NT Name +pod name +ĠNorm alization +lick r +ĠQuery Set +hold ing +Segment ation +ॠĭ +vey or +notebook id +brain rat +Ġ------------------------------------------------ ------- +ĠSearch Query +Drop down +æĢ Ŀ +ĠHel vetica +UPDATE PARTICLE +REF INEMENT +426 7 +Release Level +ĠVer tex +FOR WARD +bat ched +UV W +ĠAuto ML +COR R +LIB STR +asm ota +Volume s +ĠпÑĢ овеÑĢ +ĠdocsLoadBal BasicRule +writerow s +Ġproj ek +Ġcolour s +Ġcolour space +Mib Identifier +Transfer Function +cisco Dot +anim ations +ĠTri gger +ĠEmail Message +Camera Conf +Bridge Lamp +QS fp +ĠAccount ing +Fire fox +Language s +restri ction +åIJİ çļĦ +Ġcel lpadding +Rob ust +Writ ten +×ķ× ¨ +LAY ERS +Ġfx n +Ġintegr ity +Worker Stats +pend ulum +autom ation +ìļ ° +Ġbag s +Ġpys mi +Fra gment +âĸijâĸijâĸijâĸij âĸijâĸijâĸijâĸij +Ġmini max +Creation Form +ĠES MP +vic er +ENC IL +ĠSTAT US +Dr ug +ĠGu ard +ðŁı´ółģ©ółģ ®ółģ +CALL BACK +Ġfirm ware +arith metic +Ġatualiz ada +ĠTer raform +MSE Loss +ĠXXXXXXXXXXXX XX +Squ ared +Hard ware +Contin uous +invest ment +POSIT ORY +sit ename +ĠLIB STR +oti ent +å¹³ åı° +ĠDig it +PROVID ERS +dol lar +èİĬ 客 +ç¾ ¤ +æķ´ æķ° +ç½ij 绾 +Zo om +Firewall Rule +Ġaccs fp +Ġconflict ing +ç¥ ¨ +setColor At +ĠVo ice +illum ina +xAuth ConfigExt +Ġìĺ Ī +appear ance +dan cing +usel ah +Coded InputStream +Ġfair seq +Ġunders core +еп ÑĢавил +LEG ACY +ĠHold ing +ãģ£ ãģ¦ +unda i +Ġuz avg +Tal lies +Ġusu ário +DICTION ARY +ENER GY +ĠiÅŁ le +Recogn izer +éļı æľº +Ġsist ema +ĠEarly Stopping +ĠGest uring +Ġzstack lib +roperly Configured +fortun ately +FixedLen Feature +Otp Blob +55076 3924 +ZUR ICH +timeToFirst Frame +appendSF NTName +04984 759446 +940066 550763924 +04984759446 376 +! }] +> :< +A bove +B IC +B ATTLE +C XX +D u +D UT +D ie +D MS +D DEV +F EN +F ICATION +G rand +H AP +I ron +I PE +I EM +L DA +M w +M ip +M AL +M ount +N HWC +O HD +P ast +P oll +P ENDING +S pi +S AV +T ransp +T akes +U e +U ARY +W as +X m +X t +Y ield +\ ', +_ *. +a ire +a ż +b ld +b msg +b ish +b alancers +d shape +f Q +g Y +g ly +g ts +g lib +h dir +h du +h orse +i K +i N +i Y +i ptables +j A +j Q +j en +j av +n log +n acl +n particles +o vs +p type +s N +s ine +t V +t ts +v log +v fs +v ature +v lex +y Jog +z l +z score +| -- +¹ ółĢ + « + » +á ¹ +â ² +â Ļ +è ¬ +é ¼ +ë ıĦ +ë Ŀ¼ +ì Ļ +ð ŀ +Ġ ari +Ġ 001 +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ä¸į +Ġ ä¸Ń +Ġ ########### +Ġ æĺ¯åIJ¦ +Ġ Ûģ +ĠĠĠĠ čĊĠĠĠ +in path +or ot +re new +re curring +re lax +re liability +st rom +st udio +en ough +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ +ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġt pu +al to +Ġi sess +Ġc out +Ġc pg +Ġp val +Ġp cluster +Ġp lex +Ġp gm +Ġp esquisa +Ġf usion +Ġa sp +Ġa head +Ġa qui +lo ver +00 99 +', [ +Ġn at +Ġn od +Ġn ans +Ġs sr +Ġs dbc +ss ql +Ġin k +Ġin volved +Ġo il +Ġd g +Ġd rm +Ġd ensities +un ame +Ġm Dict +Ġm ystream +Ġm otors +Ġm mtbx +ra i +Ġe lo +() +" +ue ls +ad ict +co ast +id ad +Ġ( """ +Ġw rist +Ġw omen +def in +ot vm +ol c +ol ina +es i +is mo +is land +__ = +__ '] +get All +get Transaction +set Revisions +Ġto d +Ġto y +Ġto das +ĠT s +ĠT om +ĠT erm +ĠT iny +xt er +Ġ2 76 +(" ; +') } +as df +arg where +ĠS B +ĠS us +ĠS pi +ĠS SD +ĠS pread +ĠC T +ĠC p +ig ar +up loads +Ġg rand +Ġg Vals +Ġg RPC +Ġg reatest +ter ior +Ġr val +Ġr atings +data IO +data proc +ĠA mount +sp rop +ver is +01 42 +Ġcon str +am f +to u +Ġand roid +ĠF aker +ĠF AI +ĠF rench +qu ar +ĠP or +ĠP et +ĠP rep +ĠP atient +ĠP esquisa +ĠI GN +ĠL C +ĠL D +ĠL y +ĠL ane +res n +tr uck +ex clusion +Ġex perience +Ġ3 09 +Ġ3 56 +10 88 +ow y +ĠD IM +ĠD ie +ĠD EL +Re cur +Re views +Re cipe +app hosting +ĠM ad +ĠM arch +ĠM PL +key frame +=" $ +=" -- +=" {} +Ġv j +Ġv on +Ġv pc +Ġv endors +test ed +test mod +Ġstr s +load Error +tra iling +py qt +ĠB el +ĠB ACK +ĠB udget +ĠE VAL +ci de +ĠN AMES +bo keh +ĠR M +ĠR ating +mo on +ep sg +Ġun e +Ġlog p +32 32 +32 84 +per centiles +ĠG QL +Ġco mplement +ĠW alk +ĠW ILL +loc us +ĠV IMS +Ġ__ __ +Ġen dian +IT IVE +Error Type +Ġcol name +25 12 +25 86 +25 77 +25 58 +St roke +Ġpy asn +Ġpy matgen +ag n +lib pysal +ST K +ace lle +05 04 +Ġop aque +17 55 +Ġal ine +14 16 +ne k +iti vo +RE TRI +08 06 +22 18 +22 48 +ĠRe cur +sub scri +LL O +19 09 +Ġ` / +34 11 +34 05 +34 67 +Ġ[" / +84 24 +ĠIn ner +write I +write String +27 03 +27 22 +27 09 +27 87 +27 29 +27 73 +27 53 +27 017 +bin ned +result ado +37 06 +37 15 +37 17 +37 19 +37 36 +37 66 +37 44 +37 98 +37 76 +Pro d +Ġcom mercial +Ġsub directories +96 15 +Ġcomp arisons +Ġnew est +Ġnew Path +33 02 +RO UGH +node pathString +AL G +exp s +exp id +exp ert +iv l +'. \ +36 13 +=[ ]), +ĠK ind +ĠK NeighborsClassifier +26 22 +26 94 +26 63 +mon ics +57 06 +Ġext ensive +IS R +reg amento +do ctest +Ġper centiles +spe cular +Ġne utrino +CO CO +Ġlo se +23 32 +23 15 +23 14 +44 17 +und ancy +ulti part +new ton +Co coa +RI ES +Id Mapping +so ap +56 55 +Ġsp anning +38 33 +38 28 +box plot +be ep +UR CES +ĠQ Size +PT IONS +ref lections +AD VS +Ar row +',' % +token Id +ĠY YYY +"], " +]] [' +Ġenum er +Status Code +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +')) ] +Ġver se +du ino +}) '. +Ġar ches +Num Bytes +DI RECTION +To Include +DO CKER +De aths +Ġbatch size +29 18 +US R +gn ed +MP P +43 92 +43 88 +show s +head ings +ĠPro vision +000000 1 +cu isine +Ġqu as +fe et +42 02 +])) )) +EL IST +Model Mixin +task Id +Ġhttp d +post ing +kin a +Ġexp lain +81 93 +Ġiter ates +build ings +Ġtoken ization +TO OL +ui main +čĊčĊ čĊčĊĠĠĠ +Ġmode lo +Tra jectory +Vi T +Ġoff line +cv cConf +fn c +first Name +State Name +ãĤ Ń +Ġdest dir +job id +Ġhead less +CA AC +CA AA +Ġlib c +ĠGener ating +IND IC +ãĥ ģ +Ġ"/ ") +Ġ"/ ". +GH z +RES OLUTION +Ġmap type +Loc s +Ġter rain +SC P +su fficient +Ġnetwork ing +gg i +Ġtransform ing +TE LE +ĠTh ings +div or +Ġmon omial +Ġloc aliz +bit rate +PR ICE +VE LO +lr d +Sub plot +LOG LEVEL +ĠEn code +Entry point +Dis cord +supp lier +Rule Default +Ġparti r +Ġ"- ", +Ġexit ed +cut mix +her oku +transp arency +xad V +Ġsw ig +Ġsw itches +Ġspec gram +login User +ĠLe arn +Label Metrics +Ġlink age +ĠComp ound +ĠComp iler +cap ac +Ġfunc name +CI E +CI R +CI RC +Ċĉĉĉĉĉ Ċĉĉĉĉ +BL ANK +multi part +ĠImport ing +So cial +Ċĉĉĉĉĉĉ ĉĉĉĉ +rm dir +Sc anning +custom ers +ACT IONS +tk var +Ġconf Path +Ġbl k +Oper Status +("- ")[ +Ġrot kehlchen +Ġsupport ing +FR AG +ĠNum eric +Ġdraw s +filters Values +Ph y +Ġgr upo +aut os +à° ¬ +Ġdat adog +CHE D +legend size +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ +bi ased +mut ual +Conv Net +ĠRE QUI +IZ ZI +Ġmod o +002 0365312229841948 +high er +ni h +sym bolic +ula ção +Peer Mapping +NU tils +ĠDis crete +åº Ħ +Ġshort name +ea map +ĠIP V +abi listic +Ġpr incip +ç» ı +snapshot file +ima gined +Ġcre acion +EC DSA +orn ia +Det ermine +export Symbols +Sum mer +Ġmp img +199 7 +ĠCO CO +big int +poly lines +ĠMo tion +ĠColumn s +ĠFIT S +Ġvm ware +Ġequal ity +Ġexpect ing +ĠSH A +Ġidenti ties +ĠNew ton +ĠSE Q +ĠIniti alization +att ure +Ġquanti zed +star ter +TF Record +384 3 +ĠSp an +Ġctsp PeerPolicy +ANG ES +warn s +ĠLabel Metrics +ðŁĩ ¬ +ðŁĩ ¸ +ctsp IpSgt +wave function +illa ge +Ġdump ed +Ġinternal Failure +LV M +218 7 +lec ion +Ġpla za +ATT ACK +Execution er +208 1 +bri di +ĠPh ysics +ĠGraph ics +Extra ction +Extra cts +lookup s +stit ution +ĠWith out +har monic +ر ÙĪ +met al +retri ever +Ġcapt cha +:{ }, +LT K +ste er +Ġmet al +ç® Ģ +Debug Info +Ret ri +Ġrefer ring +Ġ"* ", +Ġden orm +Ġsv c +say i +Ġí Ļ +Ġí ģ¬ +Ġdiag nostic +ONT AL +ĠPi pe +measure d +å¸ ¦ +âĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪâĸĪâĸĪ +Ġaggreg ated +Convert ing +Ġten ants +Ġinstrument s +ĠCH AIN +aggreg ated +ĠRO UND +Distance s +Er fi +High way +tit ch +Mer ged +Assignment Body +gd al +Ġang B +Ġfire base +EPS G +ĠUN I +ĠSw ap +bag s +Ġrev oc +Ġи н +':[ ], +ĠLoop back +}$ ') +Ġentire ly +persist ed +Ġsil ence +Ġtransl ator +Ġflip ped +ĠGaffer Scene +Annot ations +ðŁı´ółģ¡ółģ ¦ółģ +ĠPROC ESS +Ġjump s +Ġtech niques +>[ ^ +éĸ ĵ +>` _ +ìĭ Ŀ +ĠRef resh +模 åĿĹ +Ġste el +orient ed +social account +Ġcr ud +ĠImp roperlyConfigured +Speci fied +fort ran +éĺ ¿ +usb DeviceCdc +ĠBO ARD +ĠSec AuditLog +Ġactiv ated +Depth Stencil +ELL IPS +Ġib R +Ġdiscount ed +à°¿ ', +LW AL +MQ TT +rout ers +recomm endation +ĠGeo DataFrame +Ġrom an +Ġmf cc +mine craft +Il legal +isol ated +Ġtro uble +æĮī çħ§ +COUN TRY +Ġenforce ment +ORIGIN AL +Ġkv magent +('.. ') +ĠVehicle Position +æİĴ åºı +Veri fication +ĠLong itude +MODI FICATIONS +Refer er +身 份 +Ġìĭ ľ +Ġlint hresh +åı° æ¹ +quas ars +ĠSW IG +Ġsand box +Spo ofing +íĻ Ķ +aman ho +Concat enate +COMB INED +ĠAng le +Ġcle ared +emission s +bea con +Cos ine +alex net +Ġconfigur able +ег о +marg ins +ĠTEMP ERATURE +cob js +Ġov lp +è¿IJ è¡Į +bject s +åįĬ å¾Ħ +ĠPUB LIC +Manip ulator +affi liation +("================================================ =============") +ĠCTR L +pcolor mesh +urnit ure +ĠStratified KFold +BRE AK +èĬĤ çĤ¹ +Ġnucleoti des +hrep rt +outi d +Jeff erson +ĠORI GIN +{! }', +courage ments +æ¾ ³ +rwMotor Voltage +Ġtomor row +Wick Theorem +IMEM ultipart +Documented RuleDefault +>}] {!}', +ĠFAI LED +ADVS Inputs +ELLIPS IS +åı°æ¹ ¾ +! ] +( *( +* ') +. ; +. ). +1 0000000000000000000000 +2 128 +2 105 +2 135 +5 91 +; ^{ +? (? +A nt +A DED +B log +B OR +C PT +D ou +D HW +D ARK +E FL +F V +F re +F Re +F ault +F ocal +G er +G est +G ill +G ive +G LO +G AA +G rab +G reedy +H al +I c +L ip +M f +M as +M TE +M DA +N all +N AN +O jo +O CT +P u +Q r +Q ty +R SI +R AA +S tim +S ystems +S MAPE +T d +T weaks +U ne +U ses +U ATE +V ocab +W u +W al +X iv +Z J +] }') +] `. +a R +b U +b ang +c ns +c bs +c math +c NS +c annon +c insn +d op +e S +e vi +f num +f obj +f ashion +g q +h po +h ls +h param +h av +h ypot +i file +i ang +k id +k config +k vm +k ubernetes +l mer +p is +p format +p atched +q str +q ry +r ses +s ul +t j +t q +t arg +v U +v maf +x ED +x samples +y Z +z Y +{ :. +} __ +} ]) +à ģ +æ ij +ç · +ç Į +ç ĸ +ð ¦ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠ +Ġ ÅŁ +Ġ 设置 +Ġ åŁº +Ġ velocities +in se +or is +on ed +re id +re mark +re lief +se ded +Ġ= ========= +st eve +Ġt docs +al ing +Ġ' ** +Ġc j +Ġc z +Ġc type +Ġc annon +Ġp om +Ġf le +Ġf bs +Ġf ich +Ġf ru +he y +Ġa y +Ġa pe +00 84 +Ġn ui +Ġn ational +Ġs ds +Ġs we +ur able +ss m +Ġre pairs +Ġre liability +sel ler +Ġd ar +Ġd ll +Ġd ill +Ġd ai +Ġd gm +Ġd vc +un real +Ġm il +Ġm ute +Ġm anner +Ġe i +Ġe tr +Ġe quipe +() ", +fi ps +ent r +ad io +ad ores +co lab +Ġb z +Ġb gr +Ġb reed +Ġb ubble +Ġ# , +ed f +11 12 +rom iss +um ann +ch io +ch ases +ch icken +di sh +ma re +urn ey +__ (), +get Data +get Keys +get ConfigFile +(' (' +Ġto pi +ĠT MP +ĠT runc +Ġ2 87 +Ġ2 38 +Ġ2 62 +arg ing +op u +Ġis close +ĠS il +ĠS ales +ab eth +ĠC E +ig ree +up on +up scale +up sert +") } +Ġdef n +Ġdef late +Ġg nd +ter raform +Ġl mb +Ġl vl +end all +data ble +ĠA m +ĠA ge +sp anner +'] - +Ġcon sensus +am bi +am qp +to d +to mo +ĠF H +log space +om s +Ġh mac +** - +ĠP ing +ĠP IC +ĠP OP +ĠP ayload +ĠP inf +ĠP Vals +Ġas ym +Ġas semb +ĠI AM +file type +Ġth res +Ġth ick +pro vide +pt clouds +ex hale +Ġ3 22 +ĠD J +ĠD uration +ĠD CC +ĠD ensity +ĠD WORD +ĠD aniel +Re current +sh ar +Ġdata flow +ĠM SG +if d +if er +Ġv pn +Ġy p +Ġy Jog +Ġpar ses +Ġx dr +tra vers +Ġfile obj +py yaml +ls a +ang ent +xd g +ĠB IG +ob ank +xa o +ĠR S +ĠR OT +ĠR TE +ĠR OS +ĠR idge +Ġun seen +Ġun successful +32 55 +32 53 +ĠG ui +Ġon p +ĠW EB +ho g +ho liday +AR IES +ĠV IS +ĠV ocabulary +Ġ5 76 +Ġhe ating +Ġan imal +Ġan imate +Ġen caps +ise ctor +che mprop +18 97 +16 05 +25 67 +ec c +max lon +Ġint ents +17 28 +17 77 +93 47 +14 00 +Ġpre cipitation +AN NOT +22 34 +22 85 +22 44 +22 75 +ĠH an +ĠRe cords +Ġsh adingEngine +Ġdi vers +sk image +mit ter +88 87 +19 13 +19 14 +19 43 +19 68 +19 72 +Ġsc enarios +34 32 +34 03 +pos its +Ġ[" # +ree k +27 57 +27 66 +27 56 +27 35 +27 76 +gs x +Ġle ads +ill ar +24 16 +24 66 +24 28 +37 75 +Ġare na +Pro vide +em er +Ġpo i +Ġsub graphs +Ġcur riculum +33 11 +33 94 +Ġapp ending +no ob +iv istic +97 05 +back off +Ġuse less +26 16 +26 84 +26 55 +26 71 +sum marize +Ġz e +Ġz h +57 24 +Ġext s +XXXX XX +Ġ| _ +"," \ +List PomeriumSession +status Code +23 84 +23 94 +Ġte mpl +Ġli quid +AP IS +Ġrun files +98 04 +38 22 +LO OK +batch Size +ĠQ Q +img r +File Exception +30 99 +save path +PO UT +Ġinter national +ĠX L +47 68 +Ġcode c +top os +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +dire ctive +Test JobType +Ch ars +ner ability +Ġlin space +UN CH +UN DS +UN ORM +UN SPECIFIED +qual ified +iter values +ĠJ ul +ĠJ enkins +Ġdire ctor +temp file +29 88 +not null +US i +ell ing +off ers +Ġcor outine +CL UST +CL ICK +FF E +vid o +ug g +true div +sv p +Ġqu eried +EX PERIMENT +ãģ ij +Ġtemp or +ody ne +"> \ +cli m +bl ind +--- ') +ĊĊĉ Ċ +cv s +Ġ... " +send mail +Ġuni fied +Le ase +Ġ12 345 +lim ate +SS D +delta Peak +Trans forms +acc ident +At titude +ĠUser Actions +ĊĠĠĠĠĠĠ ĊĠĠĠ +Ġmsg pack +ÑĤ аÑĤ +fra structure +EM BED +sim ilarities +ĠWe ek +CC CC +41 99 +âĶĢ âķŃ +Qu ant +mod s +Ġdown stream +ĠCh ina +ĠMed ian +ĠImage Net +Py Qt +az imuth +Ġ[[ ], +Ġcsv mware +Sp am +KEY WORD +win ners +æķ ¢ +bit ration +gy ro +ĠDef ining +DS RL +Ġpost process +web hooks +Ġ$ -$ +ĠZ hang +ĠEn coding +NE GAT +tt ng +sen try +real cubes +Port Entry +supp ression +Ġ"- ": +10000 01111 +Ġstruct log +Ġmeta class +Or g +imp roved +"} ', +åIJ ī +multi label +multi cast +ĠTime s +Ġvector ization +Mo ves +å® ¡ +Ġwait OnFlip +è¿ ĺ +Ġbl ender +Be low +ठ² +Jo ints +Ġaut of +Core Application +vs is +á» ĵ +ĠTo gether +Ġpredict s +CONFIG URE +IR D +An imate +aut odoc +Ġcir cuits +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠString Type +å° Ķ +ĠRE F +Cal ib +Ġë Ħ +menu Item +Ñĥ ÑĢ +gu a +Ġæ ı +Ġprop ag +ĠDis patch +MET RY +GO AL +ball s +Stats Entry +pare n +Ġinte l +åį ¡ +å¼ Ĥ +simple gui +Det ermin +Ġmp h +gon ometric +Ñĭ й +Ġ"{} _ +SELECT OR +Ġap is +ĠMy Resource +clip se +ĠFlask Form +LLLLLLLL LLLL +Ne ver +Ġcar tesian +Ġnormal ise +ĠPoint ing +>" +"\ +ĠSE CTION +Exp iration +384 7 +Ġcross ing +ä¾ Ŀ +Supp lier +mix ing +FC ST +Rel atório +Ġrestri ct +Exec uting +294 5 +Ġfix ing +ĠRandom ly +ðŁĩ ¦ +BA UD +æĿ ± +Ġremain s +ÉĻ r +BI J +BI LL +Ġpkg util +Ġbuilder name +WORK ERS +WORK SPACE +000101 0100 +217 7 +297 5 +ĠDO WN +301 6 +Ġpercent ages +иР¿ +setdefault encoding +Ġ================================================================= ================ +299 5 +ĠCan vas +many body +nu clear +flu ence +296 2 +----------- + +NT U +ste am +{}_ {}_ +Call ing +small er +Ġnu f +stick y +("{} \ +Ġdecimal Separator +clock wise +Ġcc q +sso as +SAM PL +Card Objects +Card Idx +Drop ped +Ġdiag nostics +ĠOptions Screen +piece wise +å¸ ĥ +Ġer c +æĭ ľ +Ġelect rical +Chain s +umbn ails +onal d +Ġrepe titions +)+' _ +ĠAuto Tokenizer +('# ') +PLAY ERS +LOCAL IZED +dri ving +ĠDistri ct +approx imation +Ġbus car +Ġmi xture +tor rent +Pod Options +ITEM S +('{ :. +Ġide ological +ðŁı´ółģ£ółģ ¯ółģ +SEQU ENCE +ĠCer tificate +432 1 +Ġland marks +Security Middleware +MULT IP +Ùĩ ا +ĠRest ore +Ġslim med +liz abeth +Ġsal ary +Ġmount ed +CLO SED +ĠBuil t +Ġta int +RW Voltage +ĠCho ice +lua L +simp lified +NEW LINE +nes day +ç®Ĺ æ³ķ +pend own +Fra is +Ġeigen vectors +Ap pear +Ġima ginary +ĠmscModVcs E +Ġtape s +Ġil legal +ĠNor ri +åĨĻ åħ¥ +Dimension s +ĠProp het +Birth day +Ġ({}) ". +Ġ'// *[@ +ativ a +ĠSeri alizer +ĠSeri alizable +ĠWrit es +ĠmcRmt E +ĠLab oratory +valia ções +Ġpostgres ql +âķļ âķIJâķIJâķIJâķIJ +Ġpep ulator +Ġamax List +转 æį¢ +Push Button +Ġquantum cat +èĭ ± +Ġê² ½ +BOUND ARY +nP lateau +ĠAmeric ans +ê² Į +Ġida api +Ġdiffic ult +occur rence +Ġcoco a +Shelf Idx +ĠAccept ed +VOC AB +funiIf Conf +onom ous +ĠGENER ATED +Ġcaps ule +spar ql +ê· ¸ +cex pr +Ġparm Dict +fle ur +ĠTermin al +again st +Scroll Bar +Ġëĭ ¤ +ĠIo U +åħ© åĢĭ +对åºĶ çļĦ +Jack son +ĠTen cent +Ġpul led +ĠOB JECT +Appro val +cPPPoES erver +LETT ER +Declar ation +ĠEigen Array +Alive Exception +ĠEOF Error +Ġencontra do +AUG MENT +åĿIJ æłĩ +Ġdeleg ate +æľįåĬ¡ åĻ¨ +ĠCos ine +Ġenrich ment +sib ling +EXPL ORATION +unicip ality +DYNAM IC +sted olan +Ġopenv ino +顺 åºı +SetBackground Colour +evm os +SNAP SHOT +ódu lo +UVW XYZ +LRO nPlateau +ĠCMT S +ĠUserActions Info +' ãĢ +) >= +* (\ ++ { +- {}". +. [ +2 999 +2 076 +2 137 +3 111 +3 131 +4 167 +7 10 +: ]), +> _ +> {:< +@ ' +B on +B ur +B unch +C q +C el +C nt +C og +C LE +C AD +C UD +F UL +F ish +F ingerprint +F REE +G c +G PT +G TC +I W +K q +L q +L if +L AND +M h +M ASS +N f +N ut +O y +O WN +P ow +P ops +P erspective +R ay +S ens +S PECIAL +T n +T RO +U np +V GG +W rote +Z x +_ ()) +a ac +b I +b st +b un +b bs +b las +b ctype +c pt +d ti +d path +d box +d td +d gm +e ids +g B +g og +g best +g cn +h j +h us +h ail +h az +h uggingface +j ian +j ane +l é +m im +m arr +n from +n ine +n pt +n ik +o od +o ok +o cean +p nt +p ls +r ature +s if +s ftp +t L +v Y +v Column +w ed +w orth +x Y +x st +x la +} .') +¡ ółĢ +º ółģ¿ + º +à ¯ +à ľ +Å Ħ +Ð IJ +Ø « +è Ĺ +ð ij£ +č čĊč +Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ü +Ġ ######### +ij ľ +ĺ ìĿ´ +in basics +or oll +re ets +se cho +en tions +Ġt col +Ġt runk +de serializer +Ġi ronic +Ġ' (': +Ġc lr +Ġc cd +Ġc yl +Ġc argo +Ġc assandra +Ġp add +Ġp ron +Ġp sql +Ġp tc +Ġp ssl +Ġp aused +Ġf ight +Ġf ather +Ġf emale +Ġa partment +Ġa uf +lo ot +00 75 +00 48 +00 1000 +ge ar +Ġs lo +Ġs df +ss fr +Ġin sp +Ġin lines +Ġin direct +Ġin spector +Ġre create +Ġre order +Ġre connect +Ġre dbot +Ġo attr +Ġd in +Ġd vid +Ġd gl +li ch +li con +li ked +un roll +Ġm angled +Ġe specific +la ces +ad vent +", "") +co er +co uchdb +Ġb ids +11 64 +int ra +int ensities +id l +Ġ( %( +Ġ0 10 +Ġw ine +ch urn +ch rm +ch kpnt +): ", +ma z +from buffer +), - +ode Plot +__ ==' +get Datetime +(' }')) +ĠT re +con ll +(" :", +') ]), +et tes +op end +op hi +Ġ{ % +ĠS A +ĠS K +ab in +ĠC tr +ĠC ast +ĠC EL +ĠC ORE +Ġg cs +Ġg pio +Ġl atter +ĠA LT +sp acings +01 06 +01 23 +Ġcon ta +Ġcon duct +ke p +am on +to ks +ĠF ig +ĠF lip +sc anned +vi m +vi ol +po file +ta che +Ġas king +ĠL ists +res a +=' [ +Ġst itch +Ġst rain +Ġde activate +ex perience +Ġex pert +Ġ3 76 +10 75 +out flow +ĠD est +ĠD og +ĠD uplicate +]) /( +ĠM UST +ĠM DP +ĠM ICRO +ĠM idi +time table +oun cing +ext ents +Ġx k +Ġx m +Ġse a +ack ets +test Obj +Ċĉĉ ĠĠĠĠ +ure ment +---------------- ---- +tra ci +tra js +ES M +ES MP +12 57 +AT AG +len g +bo om +Ġ4 41 +======== =") +ĠR P +Ġun set +Ġun real +Ġun wind +32 25 +32 96 +32 95 +32 86 +// ...', +ĠG IT +ĠG rant +Ġco uchdb +loc atable +AR A +ĠV an +ĠV OC +print ing +ib ot +Ġan omalies +che t +che ls +18 15 +18 37 +line Width +da k +Ġk nots +25 92 +St retch +Ġpy asl +lt s +ll vm +15 02 +SE X +SE LL +ass ume +ass istance +ass umed +05 06 +Ġch kpnt +ax ial +93 97 +14 36 +Ġpre f +ne es +ne mo +64 02 +Ġob serv +Ġob stacle +Ġ[] ] +RE C +pi an +ĠH ACK +sub dirs +Ġsh ut +db t +88 74 +19 56 +ID F +Ġsc anner +34 39 +34 73 +84 17 +ĠIn dicates +27 85 +27 23 +ill ation +24 07 +24 17 +24 95 +24 75 +24 35 +24 42 +37 99 +37 28 +37 67 +Ġpath o +Ġpath name +ak h +Ġsub type +96 88 +33 87 +33 66 +Ġlabel encoder +AL ARM +CT C +CT L +AS ON +AS SIGN +mi stry +36 93 +run files +26 92 +26 64 +26 65 +26 54 +Ġmax y +Ġmax val +Ġdo se +Ġhas n +AG UC +Ġ! ! +Ġ! ") +Ġ| ____ +IS ATION +do se +Text Node +90 93 +23 06 +23 85 +Ġli ves +frame on +IM AG +float s +io loop +En semble +auth z +28 05 +Id List +raw ler +38 12 +38 05 +38 03 +38 08 +38 09 +38 96 +38 21 +38 39 +Ġwor st +Ar b +Ġad versarial +gin a +45 44 +amp ion +Ġinter rupt +ĠX MF +initi ator +Ġ, " +101 7 +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ +pl anner +83 95 +rt t +Ġar ity +46 75 +ĠJ start +ĠJ acobian +Log out +Num Buffers +Field Def +open xml +Un lock +Ġq id +temp est +Ġversion added +To Transfer +CON S +De ck +29 12 +US A +Ġval i +Time d +67 04 +21 32 +search able +ug ate +page able +down stream +FA o +pass words +fe ather +red shift +а ÑĨии +42 88 +42 87 +copy to +Ġprocess ors +iss er +ĠÐ ľ +Max Spread +cli que +cli mate +ĠPar sed +39 09 +ny der +Ġover head +Ġass umption +Column Info +Key Press +Ġauth enticated +Dict Writer +Response Error +PP P +access ible +"\ " +ĠNo vo +ãĥ ij +Index Reg +çļĦ åıĤæķ° +Of State +Of Day +ĊĊĊĊ ĊĊĊĠĠĠ +URL s ++' - +part OfState +tom orrow +Create ContainerMessage +resp onsible +41 93 +execute many +н Ñĸ +TE AM +full StateName +ĠCh anging +Py Number +Ġloc ais +feature space +arr aro +DS V +GR ATION +VER TEX +af ety +dat os +ĠEn abled +Ġvar x +Ġpack aging +âĶĢâĶĢ âķ° +ORM Base +Per Point +Ġsci ence +imp ute +MS GS +inte gers +hand joints +depth wise +cos mo +Ġ") ], +ĠFOR E +seri alizable +commit ter +Output Folder +Sc enario +entic ator +prop ortions +js chart +)/( ? +Be lief +Core RPC +End Time +á» ¯ +Ġtr n +Char Field +à° Ĺ +Ġdat lim +second ScreenText +Graph DebugInfo +Ġreq Id +pa ces +)]) . +Module LogLevel +MIN UTE +MIN IMUM +zz o +Ġthrough out +Ġassoci ate +Ñĥ ж +ni co +Msg Name +PRE PAR +Ġactual GroundGHI +GO EO +Read Only +ĠTensor Dataset +åį ĥ +Ġgra sp +Ass ertion +Mon ster +BB B +Ġsegment Text +COMP UT +poly fit +################################################ ###### +ĠDi richlet +UC gU +Sk el +ĠNew Cell +Exp licit +Spe ll +215 5 +åĢ ij +rup o +ĠRo berta +IG D +ough lin +Ġsen ha +ĠClient Configuration +Sw aps +break down +lc g +Ġrestri ctions +ĠCommand Handler +ĠGe orgia +å½ ± +294 6 +ðŁĩ ¹ +hy undai +rag ged +RA FT +æĿ ¿ +âĸijâĸij âĸij +Av atar +Av ailability +264 1 +264 2 +Transaction Response +æİ ī +PIPE LINE +Dig its +Part Coords +micro scope +micro second +syn apse +gm Electron +ĠCur sor +295 6 +225 9 +Ġconsider ing +Print s +ĠTask s +éģ į +Linear Regression +Cor ner +ĠInt Enum +Ġapprox im +ĠCustom User +ðŁı´ółģŃółģ ¸ółģ +Ġam end +233 5 +Tool bar +ais ing +pic ard +Ġ------------------------------------------------ --- +Ġmultip lic +uz zer +ĠExtra ctor +Param Attr +Ġelect ric +macro Network +293 8 +tm db +ĠDIS PLAY +RUN TIME +Release d +Addr Bits +Vlan Map +è§ Ħ +è½ ® +éĿ¢ çļĦ +ö l +peg as +sil ver +Ġtele bot +è¯ģ 件 +Ġê µ¬ +Ġwire less +CUR R +pow der +ółĢ±ółĢ µółģ¿ +Ġappropriate ly +æĸ° å¢ŀ +'[ { +åıĤ èĢĥ +cancel led +BN L +İ· å¾Ĺ +Syn chron +Pod s +Ġpod cast +los ion +ĠUN KNOWN +Ġaugment ed +Pub lication +Ġmix in +wind ll +èĢ ģ +ĠExec utes +ĠJob Status +ĠEngine ering +çľ Ł +åĿ ĩ +ĠAut umn +Note book +Bool ExprParser +ĠSingle ValueConstraint +tape s +copi a +docsLoadBal Grp +aci lities +Hyper volume +åIJ¦ åĪĻ +Cl one +Ġfallback s +Ġunpack ed +Calcul ates +Ġmotor dir +Ġeg gs +éĢļ è¡Į +After Restore +ĠAdmin istration +ĠBad Request +Ġcart opy +PATCH LIST +trim med +нÑĭ й +Fbx Node +ĠTrack ing +Mi lightWifiBridge +ĠSchedule Block +vic orn +Ġ(? , +Ġil lu +Statistics Group +Ġfac ilit +eti o +thro tt +pulse io +Ġprim itives +discre ti +DUM MY +SHE ET +Ġб Ñĭ +Ġpat ent +ĠProp Limit +å°± æĺ¯ +ĠRegion al +POMERIUM SESSIONS +VB INSTST +Ġepi log +inherit Cell +ben z +snp s +Ġê° Ĵ +Heat ing +92140257 87427 +Restri cted +lix mpp +æıIJ 交 +Sol ar +craw l +ĠEstim ator +Ġgy ro +objec tid +ITER ATIONS +Ġxls x +Ġmeaning ful +Ġtang led +Calendar Query +adaptive Predict +ëĵ ľ +Rename d +Īë ıĦ +provision ing +å±ħ ä½ı +ãĥĥ ãĥĪ +ĠFLO AT +åł ´ +wit ness +ĠHeat CapacityGases +ISS UE +Ġbor row +grafi co +recur sively +ĠObj ective +ĠSound Cloud +ĠÅ ł +ĠBri tish +Proj ec +stro kes +UTIL S +ĠHam iltonian +extrapol ation +hou ght +RECE IPT +PROPER TY +Bootstrap Core +Scra per +Ġë³ Ģ +éĻĦ件 为 +nag ios +frameN Start +spher ical +HUM AN +MEAS UREMENT +Offer ed +ĠFO UND +æº IJ +å±ħæ°ij å±ħä½ı +ĠRestri cted +STUD ENT +hemer al +0294 118 +cosm os +Ġmetron ome +dqm BeamMonitor +Rig id +dise ase +Ġìĥ Ŀ +dumb cpm +BTagMIST AG +<_| <_| +JUN IPER +INCRE MENT +ĠInflux DB +ê± ° +Ġlk ml +è¨Ń å®ļ +ä¸Ĭä¼łçļĦ éĻĦ件为 +港 æ¾³ +ĠFEAT URES +ĠCHAN NEL +审 æł¸ +odePlot Width +getDatetime IST +# + +$ , +% ': +' -- +' ## ++ =[ ++ )? +, }, +, "], +, "\ +. ]), +/ '), +2 123 +2 175 +2 104 +2 196 +3 109 +6 90 +< ! +> ''' +> {}>>> >>> +Ġmut ually +Sta ff +Ġecho Log +TASK SPEC +aro ot +Ġ================= === +Mis sed +COM MA +EXP AND +erk at +QR ST +Init Tech +Ġusb DeviceCdc +care er +CW D +Ġmajor ity +ĠHE ADER +éĩį å¤į +ĠCent re +han cer +('* ') +BRO W +åķ Ł +缸 åħ³ +nos kip +Ġdefer red +Ġreach ability +caps ule +Ġcancel led +ANAL YSIS +Ġomega conf +âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ +Ġcert s +Extract ing +Nav igation +ак аз +uris diction +tagged item +Dat atype +³³ Âł +Har vester +Rep lica +Fix es +Sol v +ĠSouth ern +Dif fer +Probe Bundle +à¯ģ ', +frequ ent +Ġsubstit ution +Ġenforce d +ĠArch ive +Ci pher +ĠLIB SEL +Ġcamp o +Ġmens agem +ĠTho se +Ġsatis fy +heter ogeneity +ĠìĹ ° +DETE CT +ĠMySQL db +éĴ ® +Emp loyee +ELE MENT +Associ ation +åł ± +Ġdemon strates +ĠPhone Number +ĠPr incipal +èģ Ķ +Ġhpnicf VoiceIfCfg +EAR TH +ãĥ¼ãĥ ī +Ġped ido +Ġgran ularity +Ġtaxon omy +Eye lid +Ġì¶ ľëł¥ +bay Stack +PRESENT ATION +SPECI FIC +Ġwithdraw al +ComponentDef Request +Ġincre ases +unge on +cib ility +senti ally +Ġretrie ves +ĠdocsLoadBalChgOver Status +crow d +ROUT ING +Coded OutputStream +recursion limit +merce des +PROPER TIES +shant in +Ġtcl fp +Ġ["" ] +AccessBindings Request +dhcpSnp Db +Ġven ue +inic ial +CHANG ED +è¾¹ çķĮ +hod noLetalisce +ĠChuck a +å£ « +ĠEle ments +æĶ¯ æĮģ +COMPONENT DEF +Bea utifulSoup +Pix map +psy copg +meet ings +ĠWIN DO +REFER ENCE +é½ IJ +demon strate +ĠFer net +vag rant +CHARACT ER +ĠTUp Bound +Ġvet or +MODIFI ER +ĠTruth Value +COUR SE +Ġâī ¤ +客æĪ· 端 +Sinh Integral +áµ § +anatom ist +Ġmelt ing +Cosh Integral +Ġolymp ia +ĠSHO ULD +LOO SE +##---------------------------------------------------------------- ----------## +pathology Dict +ĠNORM AL +DDEV CAPS +atture incloud +NEGAT IVE +ĠNorri sa +__==' __ +ĠXMF file +openxml formats +depVar Comp +noskip ws +" (? +( # +) ._ +* )\ +- {}. +. %( +2 125 +4 186 +5 39 +6 89 +@ % +B ale +B NC +B undles +C x +C lu +C fn +C ITY +C MB +E ta +E CH +E ither +F all +F nd +F und +F NAME +G ro +G XFP +H b +H u +H Box +H ARD +I j +J X +K X +K z +K wargs +L c +M LE +M pc +M ichael +N tuple +N ested +O CC +P ICK +P auli +Q F +R pt +R Pr +R KJ +R PROP +S d +S el +S AT +S cor +S PAR +S weep +S lope +T cs +T ors +T iles +T mr +T Inc +U EN +V LD +W avelength +] '. +] =[ +_ ", +` ' +a M +a ims +b om +b abel +c I +c lt +c mt +c provider +c argo +c mice +c ambridge +d pl +e U +f to +f no +f rog +g ss +h olds +h azard +i T +j on +k aggle +m yst +m cc +m ystream +n fs +o lic +p int +q e +q j +r dd +s lo +t gs +v B +v ad +v able +v layer +v switch +w intypes +x ception +x ref +x pa +y A +y er +y al +y out +| '' +¦ ółģ¿ +Ï ĩ +Ð ľ +â ļ +å ¨ +å Ķ +ë Ł +ì °¨ +Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ åĩĢ +in set +in as +in del +at im +re la +re write +re balance +se no +st ime +st emp +Ġt ent +Ġt bin +Ġt umor +ar v +ar med +de pt +de stri +le sky +an chore +me ds +mp Det +Ġc ab +Ġp ika +Ġp ushed +Ġf url +Ġf uzz +Ġf uzzy +Ġf attureincloud +he v +he mat +Ġa is +Ġa cs +ge ometries +Ġn acl +Ġs vo +ut en +Ġin l +Ġin tra +Ġin dividuals +Ġre n +Ġre actions +Ġre bulk +Ġre directs +ame d +Ġo ic +Ġd an +Ġd um +Ġd ynamodb +li co +un sorted +un locked +Ġm anti +Ġe z +Ġe lib +Ġe pub +Ġe quival +la place +fi fo +ri b +11 02 +11 45 +11 00100 +int vw +Ġ( '. +Ġw rote +ch y +te or +te achers +di abatic +Ġ[ * +ma ph +ck le +es b +es m +Ġ+ ------------- +is q +is r +is ance +__ ==" +name list +(' & +set p +Ġto mo +ĠT ypical +con sent +con currency +Ġ2 58 +(" & +op i +Ġ{ $ +ĠS ah +ĠS aved +ĠS helter +ab Page +ĠC ra +ĠC ERN +ig er +ig ra +ig ator +ig MM +up sampling +") ') +Ġ== ' +Ġg lt +Ġg fp +Ġg erman +Ġr ated +Ġr map +Ġr mt +Ġl j +Ġl name +data File +data classes +ĠA Z +sp iders +'] }\ +Ġcon traction +am ar +to file +to gg +to wers +99 5677 +ĠF X +qu iring +log path +list ings +om er +Ġh at +Ġh cal +Ġh cl +Ġh pc +Ġh abit +ĠP N +ĠP ay +ĠP LU +ĠP DN +ĠP aste +ĠI ce +file Changes +ĠL ouis +res ids +Ġth l +Ġde limited +Ġde dicated +Ġ3 06 +Ġ3 55 +Ġ3 66 +10 93 +out ing +out bound +out heast +ow a +ĠD ue +ĠD id +ĠD RAFT +ert y +Re j +Re ci +Re cent +Re levant +Re peat +Re covery +Re FRe +ĠM OR +ĠM ouse +ĠM arc +ĠM IMEMultipart +nt p +lab orator +xf fff +=" -", +Ġv rs +02 99 +ext s +Ġy f +ĠO uter +ds o +Ġx d +Ġx Pos +ER x +IN Rat +ms ds +Ġpro ba +Ġpro posed +"] =" +ĠB ranch +ĠB NUtils +12 12 +ĠE OS +ĠE nemy +ob fuscate +wor st +com ic +ĠN LU +################ ######### +Ġ4 02 +Ġ4 40 +col dtype +In to +In cr +In verter +In stanti +In Use +In ReFRe +ind ers +ĠR is +ĠR aising +Ġun install +OR IT +32 18 +32 74 +32 78 +ĠG S +ĠG RU +Ġco oper +ĠW ave +Con struction +Con dI +ĠV E +ĠV oting +ry ant +print messages +Ġ5 01 +Ġ5 09 +min lat +IT Ãī +Ġtime table +16 03 +16 36 +line Nav +sa x +Ġk on +Ġk ar +Ġk raus +25 47 +25 48 +25 59 +St orm +Ġpy th +config file +13 99 +13 16 +lib gexf +class Tissue +ec al +05 47 +cs Den +ip latform +Ġop codes +17 46 +dd pg +93 34 +14 05 +Ġpre ce +Ġpre train +ord en +'' )) +iti zer +RE V +RE MOV +Ġtra cer +08 77 +22 66 +22 72 +ust o +ĠH L +ĠH ill +ĠRe pe +ĠRe comm +sub str +19 62 +output Executioner +34 82 +34 76 +34 78 +pos x +09 57 +27 13 +27 58 +27 69 +27 61 +24 18 +24 13 +24 38 +24 48 +24 58 +37 33 +37 87 +37 35 +Ġ@ % +Ġsub directory +AM D +Ġcomp act +Ġinput file +33 15 +RO B +Ġapp le +fer mion +Name To +no v +20 32 +Ġclass ical +exp Rpt +CT S +Ġsys inv +97 0 +97 18 +back wards +but or +011 01011011 +query history +ĠK nown +ĠK iki +ĠK uge +Ġimage m +86 13 +86 67 +26 32 +26 18 +26 23 +26 98 +26 83 +fa q +57 02 +Ġext remities +XXXX XXX +ED GE +ED ATA +IS M +IS igMM +Res olve +Res TInc +ix Path +do ctor +Ġne ck +man tics +Ġli ving +44 03 +AP NA +yst e +En crypted +28 07 +28 22 +28 94 +Ġend Point +38 55 +obj c +Ġmin er +Ġ(" % +uc ciones +UR DF +ĠQ Vector +35 44 +AB B +AB CMeta +Col NW +step size +pri vileged +45 43 +ich r +noun ce +Ġrow Item +CH N +ĠEx pect +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ +Ġpd p +wait info +Ġmain ly +Ġlin has +host byname +PE M +cp lugin +To Thinned +ĠOption ally +DO CTYPE +De act +Ġcod on +29 85 +Ġ`` " +о Ñĩ +43 94 +vid or +ółĢ ³ółĢ +std lib +PI P +err back +Ġany one +No v +No Vis +42 12 +last Name +iss calar +Ġuti lization +ous al +Node Data +tx Not +Ġbut ter +address Spoofing +31 99 +Key Nt +Dict List +Ġ', ', +Ġexpected Collection +dis counts +FT UE +Comp ression +cache dir +dev null +Le akyReLU +Ġiniti ated +Ġab orted +access ories +Ser vo +User AUTH +Ġport Access +ĠDe ck +Ġform ation +Trans Code +ãĥ ī +connect Attr +Th ird +Th anks +Th inningThingProducer +ia f +ĠUser CreationForm +Up stream +Sh utdown +ba idu +fra mer +IP C +disp osition +:] + +RES ER +Ġgraph ql +EM s +su ites +PRO BE +sim d +Ġoffset ToThinned +ĠWe ave +serv ic +300 3 +åĪ Ŀå§ĭåĮĸ +Not Allowed +resp condition +Base Model +ĠjnxMbgSgw V +mc CardIdx +mc ShelfIdx +Al most +Ġdown loader +diff usive +=[' / +ĠCh inese +For ces +For Sequence +For NtSup +div ers +meta gene +Ġhost apd +KEY WORDS +Ġret weet +Pre dictions +PU LL +VER IFY +Result Found +element wise +Ġparent hesis +Ġcli ps +Ġcli ques +Ġì ¤ +ICs UE +ICs Ver +ICs NOT +ICs RM +ICs Unknown +ICs Opt +ICs Accept +ICs Syn +ICs EI +ICs Mis +ICs Proto +ICs Sys +ICs IMS +ICs RAT +ICs Dt +ICs Sem +ICs GRE +ICs APN +ICs Lcl +ICs ISR +ICs Reloc +ICs RPr +ICs UEN +ICs InReFRe +ICs CondI +ICs APNA +ICs ColNW +ICs UserAUTH +GB M +Ġcluster ed +ĠStr ategy +Dis criminator +Dis carded +]+ ', +ĊĊĉĉ ĉĉĉĉ +layout V +mount ed +áĥ Ľ +uri fication +rot ter +cm intvw +á s +Pe ople +rad as +MS ISigMM +Ġcache s +"} ' +cf r +arm or +Ref uses +Ġfeature map +Ġpe lo +Start up +mock ed +.... ... +ĠTime d +STR ATION +Ġempty List +cer tainty +ĠUnit TypeId +Ro les +Ġind ptr +Ed ucation +CRE DIT +è¿ ½ +Ġembed s +fail ing +æĺ ĵ +à¤ Ĺ +times lots +GG TT +End ing +End points +End Marker +á» Ń +FR NC +LC J +SH UT +Protocol ErrRx +SO URCES +:, :] +trace d +mu joco +à® ² +ead y +Cur SpdMode +ĠPre print +language code +ĠSh adow +Ġannot ators +ĠPer p +bi os +bi oproj +)} { +Device Type +Ġlat in +ni cos +Msg Text +Msg Fmt +desc ending +Ġfill style +PRE V +Filter ed +Ġæ ¨ +Ġæ ¯ +Ġæ Ľ +sn ippets +MT L +Ġ? ?? +MAP EStd +Ġpr g +Ġmodify ing +Ġface colors +ç» § +ball Dark +OTA UserMsg +ĠTensor Train +cb f +åį ´ +ĠTH AT +ĠTH RES +ĠAR GS +simple x +Det ach +Ver NotSup +roid b +Ġlogin User +Register EnumDescriptor +MAN IFEST +ĠCO UN +Ġpa id +ĠMy Vm +COMP AT +dl g +FORMAT S +################################################ ########## +Ġms du +sy mpy +LLLLLLLL L +LLLLLLLL LLLLLLL +íķ ¨ +ĠjnxMbgSgwPP V +ĠjnxMbgSgwIf V +Exp Rx +exist ence +215 9 +SM F +SM ANT +Ġrep lies +sal cano +204 3 +204 7 +Ġhome page +ĠDec isionTreeClassifier +211 2 +211 3 +average d +ACC UM +ĠCor relation +216 6 +ĠCommand s +Val Rcv +ê° Ħ +Ġpol ynomials +analy se +hy th +BA IB +condition var +æĿ İ +Attribute Description +Ġes sential +RS MA +218 4 +Fail Tx +Fail Rx +Ġna poleon +264 4 +Transaction Request +206 2 +arc py +Sec s +Ġsyn ced +Stop Paging +Ġ--- ') +032 5844 +Ġsy mp +Gen otype +instances ToTransfer +Ġagg info +203 8 +Ġresid ential +Ind Tx +Ind Rx +ĠFI ELD +Ġlookup s +OC ID +ен ий +306 6 +REQUEST S +212 9 +ĠBe fore +296 8 +ANS IBLE +Email s +Email Backend +308 7 +Pr Tx +Pr Rx +Channel s +ĠSpe ech +spark line +287 5 +ĠMark up +Ġstock s +Resp Tmr +ол ж +292 8 +umb el +Len Tx +Len Rx +ĠJo in +UES us +èĩ ´ +288 6 +every one +ĠBack ward +大 äºİ +NV DA +åī ² +293 1 +293 7 +ĠLib virt +Ġcnt s +ðŁı´ółģ´ółģ º +387 3 +=", ", +ĠAuto Model +ãĥ¼ ãĥ« +Branch ing +æĹ¥ æľŁ +HC Bytes +El lipse +dri ll +Sm ith +ĠRet ry +ĠAction Chains +mel ho +ĠWor ks +Inv ocation +Ġregist rada +Resources Entry +æĬ ķ +Detail View +Full Loader +ĠReference FormID +Ġrl History +æİ¥ åı£ +Ġincorrect ly +Sensor s +Failure Notif +cisco DiaBaseProt +ÑĪ е +Ġchem ical +请 è¾ĵåħ¥ +calcul ations +ĠApply ToKeys +ç« ł +Ġsan ic +缮 æłĩ +èĢ Į +Pa int +rer un +xC ast +Ġland ing +MULT ANS +ĠLE VEL +NP ref +BLOCK HEADERS +Ġsch olarly +æłĩ çŃ¾ +ĠGaffer UI +Ġregistry mixin +ðŁı´ółģ³ółģ© ółĢ± +infos ys +ĠGOO GLE +è¿Ľ ç¨ĭ +ĠTw ist +Bucket s +Book mark +ÑĦ оÑĢм +ĠRow Status +ãģĦ ãĤĭ +eder al +san ity +Ġadapt ers +Ġflt Stat +CHAIN LOCK +frozen set +Balance sResource +éĺ µ +@@ @@ +Ġwheel s +('// *[@ +Cer cano +ĠCluster ing +Arti facts +WAY S +² ³ +Ġmal icious +Echo ReqTx +Echo ReqRx +Echo RespTx +Echo RespRx +dialect s +解 æŀIJ +Ġmilli on +assertRaises Regex +Ġpow ers +ĠNorth ern +à¥ĩ à¤Ĥ +Cy ber +Ġtracked Cells +Ġconj unto +stan ford +ICsInv Tot +ICsInv MsgFmt +Ġíķ © +Restri ction +Ġtrip les +Sal cano +frequ encies +Ġautom ated +HCP ackets +注 æĦı +Pg UESus +Ġnib abel +Ġhor as +ä¼ł åħ¥ +å¾Į çĶŁ +Ġsnp s +è¶ ³ +ĠDig ital +Ġacceler ator +ĠBool ExprParser +incid ents +Ġutiliz ado +DETE CTION +SHARED SET +ĠPlan et +PomeriumServiceAccount Response +PomeriumServiceAccount Request +ĠChem ical +ĠAct ual +ĠFIL ES +Ġexclu ÃŃda +ICsUn abPage +ICsUn expRpt +ICsUn PgUESus +Ġdatal ake +=-=-=-=- =-=-=-=- +DlData Noti +('| ', +Ġguarante e +011101001110100100 101111 +ĠNN TP +Ġwest ern +pyg let +molecule s +Stri ct +permit s +ĠBOT LOG +545 1526 +Ġbib li +ĠìĦ ¤ +Ġabbre viation +ĠCalled ProcessError +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ��ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +("," ): +vacc ine +ĠFi xture +deno ise +Ġdoub les +chromosome s +Ġcapac idade +Ġaes ara +coher ence +scrap ers +ĠDynam oDB +Unkn APN +Ġqsfp Acc +Ġqsfp Ntw +ICsC mpDet +ICsC txNot +ICsPT MSISigMM +ICsNo Res +ICsNo Mem +ICsMan IEM +ICsReq Accept +ICsReq Rej +ICsTFT Sys +ICsTFT SMANT +ErTAD Tx +ErTAD Rx +ICsPkFlt Man +ICsPkFlt Syn +ĠTab ular +âģ ´ +磩 éĺµ +Ġlamb das +ãģĤ ãĤĭ +Amb ient +Smecti tes +ĠBas ilisk +ì¹ ĺ +UPDAT ED +ĠSY STEM +ĠWR ITE +ĠMatching Result +測 試 +Restrict Cm +Dyn Ad +ĠìĤ¬ ìļ© +ICsServ Denied +ĠBOOK STORE +erci ses +etun ing +vare qual +é² ¸ +Ġbread th +æıı è¿° +SIA dbr +3975 353 +VIRT UAL +ICsNewPT NPref +ĠдÑĢÑĥ з +Ġespeci ally +caff old +ðŀ ¤ +ivl set +INDIC ATOR +ĠíĻ ķ +CLUST ERS +INot Kn +ĠUt terance +ĠèĵĿ 鲸 +åĮ¹ éħį +__==" __ +995677 47116 +KeyNt Fd +ĠexpectedCollection Size +FTUE CTX +ĠoffsetToThinned Key +diffusive flux +ForSequence Classification +ICsUE Refuses +ICsNOT FTUECTX +ICsRM ValRcv +ICsAccept Part +ICsEI FRNC +ICsMis UnknAPN +ICsProto NtSup +ICsIMS INotKn +ICsRAT Chg +ICsDt ForNtSup +ICsGRE KeyNtFd +ICsAPN ResTInc +ICsLcl Det +ICsISR Deact +ICsRPr Nt +ICsUEN ot +ICsCondI EMs +ICsAPNA csDen +ICsUserAUTH Fl +0325844 99567747116 +RespTmr ExpRx +ICsUnabPage U +5451526 3975353 +ICsCtxNot Fnd +ICsManIEM iss +ICsEIFRNC En +# // +' _ +( ! +) (\ +) }' +) != +, # +. > +. ): +. )/ +. *( +/ | +2 106 +2 857 +2 194 +3 0000 +4 097 +9 076 +: ')) +; """) += ${ +@ ( +A In +A lice +B el +B ids +B ibli +C j +C one +C MS +D ue +D NN +D PS +E e +E CD +F t +F es +F AT +F eat +F ranklin +G X +G d +G MC +G reat +G allery +H or +H ue +H ybrid +I pt +J un +J AN +K u +L ON +L ID +L CD +M orph +N mult +O ST +P lc +P USH +R oll +S ing +S RESPONSE +S inks +S entiment +V d +V n +W EST +X h +Y J +Y Q +Z U +Z V +Z k +\ .\ +` ') +a Q +a fi +b C +b art +b ip +b pm +c de +c dist +c zy +e of +e gress +e tical +f df +f lying +g F +g wei +h max +h ann +h ua +h adm +h abit +i J +i ÅŁ +j sd +j accard +k agit +l ds +m S +n ur +n ob +n ump +n Enter +n vd +p j +p acman +q A +q time +r file +s I +s To +s dist +s atellite +t H +u Y +v G +v net +v sphere +w il +w off +w cet +w sdl +x AA +y et +y rs +z J +} ")) +} }' +} @{ +Å Ļ +Ø © +ç ¯ +é º +ê µ +Ġ Ì +Ġ ï +Ġ ĊĠĠĠĠĠĠĠĠĠĠ +Ġ à® +Ġ ä¿ĿåŃĺ +in cr +in Range +er ant +or ic +at ty +re ti +Ġ= [ +Ġ= === +st ale +st akes +Ġt list +ar ches +de bt +de precation +an as +an ia +Ġi python +Ġi ptables +me k +ro k +Ġc math +Ġp plot +Ġp raw +Ġp ores +Ġp acman +Ġf inger +Ġa pex +Ġa mqp +lo om +00 34 +00 98 +00 46 +Ġs me +Ġs name +Ġs mat +Ġs Name +Ġs io +Ġs rs +ut ch +ur ich +Ġin er +Ġin gress +Ġre co +Ġre nd +Ġre factor +Ġre lies +Ġre cursos +mport s +Ġd une +li an +pe ci +Ġm fem +Ġe ulerian +() )). +fi able +Ġb ary +Ġb gp +Ġb idirectional +11 88 +te ur +def orm +): . +ma intenance +== \ +ck t +ck er +ol tz +), )) +val ores +__ (" +__ "][" +get Num +get Result +(' =' +(' *. +)) ', +set Organization +set WindowTitle +ĠT ASK +ĠT odo +ĠT ipo +import ances +str uc +Ġ2 42 +(" *** +(" [-] +pp s +as d +as sessment +Ġis Complementary +ĠS AN +ĠS ends +ĠS IO +ĠC lay +ĠC ube +ĠC andidate +ig th +Ġg ist +Ġg oto +Ġg bS +Ġr z +Ġl un +Ġl ttng +ĠA ck +ĠA gain +ĠA pril +'] +'/ +01 22 +01 37 +to mb +ile y +ĠF ACT +ĠF urther +ĠF ields +od us +value d +vi se +Ġh param +Ġh orse +Ġh ierarchical +Ġh unter +ĠP F +ĠP OL +file types +ĠL edger +ĠL LVM +pro duce +pro grama +Ġ""" [ +im i +Ġex ons +able Alt +Ġ3 38 +Ġ3 21 +10 36 +ĠD R +ĠD ice +ĠD HW +ĠD akota +]) \ +]) +" +Ġdata f +ĠM ir +ĠM ESS +time check +time tuple +if ty +key List +Ġv card +Ġy dk +ĠO pt +ĠO ID +ĠO DE +ĠO CL +os x +test bed +IN Y +IN EL +IN FORMATION +Ġel t +ms du +Ġfile input +py src +ap a +07 0 +ang ulo +ES ME +ber to +ĠB re +12 09 +12 96 +12 74 +12 578 +ĠE MPT +ĠE thereum +Ġ< % +AT R +}, ' +Ġ4 0000 +Ġ4 294 +ff ee +In fer +In side +In direction +Ġtest file +Ġtest suite +lic al +32 75 +32 82 +32 79 +32 58 +32 41 +oc sp +ĠG ar +ĠG nu +ĠG reedy +EN SO +tri age +ho using +AR ROW +AR ISON +ĠV s +ĠU i +mb ing +IT ERS +Error Code +18 06 +18 05 +18 56 +18 83 +cur ated +Ġk i +25 21 +25 51 +25 71 +St ress +Ġpy mol +Ġpy rogram +13 05 +13 94 +ll ong +15 01 +15 16 +15 45 +100 6 +train ers +17 84 +Ġal e +Ġal la +Ġal loc +93 93 +Ġpre served +Ġpre decess +ne go +'' ): +Ġra mp +Ġra il +ðŁ Ĺ +22 00 +22 17 +22 69 +Ġ\ "{ +ĠH ypothesis +ĠRe ports +sub st +sub strate +Ġ{} /{} +lob j +Ġsh aring +work tree +19 44 +19 42 +19 78 +output data +comp osed +34 13 +34 06 +34 17 +34 24 +34 36 +34 79 +34 52 +Ġ[" % +ĠIn dices +ĠIn crease +27 06 +27 64 +27 68 +24 82 +24 46 +37 02 +37 64 +37 27 +37 95 +37 57 +37 38 +37 77 +37 47 +37 59 +37 62 +em ons +Ġ@ ( +vel s +96 03 +94 14 +94 84 +33 58 +()) ]) +20 99 +exp orted +85 95 +97 00 +mi ch +{} {}". +95 64 +95 44 +95 47 +ock opt +lat o +view sets +Ġcont rolling +26 15 +26 21 +26 79 +26 58 +Ġmax Length +Ġdo xygen +################################ ######### +Ġ[' # +Par ses +Ġper muted +spe arman +ele c +Text File +current Direction +CO ST +port stat +man a +90 99 +23 55 +23 51 +Ġte la +44 77 +Ġdis aster +ulti mate +new lisp +cor o +En code +En velope +28 33 +28 97 +28 23 +cal lee +Ġsp ans +Ġsp ots +38 01 +38 99 +Ġmin max +Ac ct +UR NING +ĠQ AE +img ur +Ġcolor ize +35 03 +Ġmo on +gin ia +ng f +table au +ä¸ ĥ +`` : +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +pl and +Ġgener ations +iter ative +iter ables +ĠJ AN +107 2 +89 32 +DI VID +DI rregular +ome gas +ĠSt anford +open mm +air flow +DO I +29 01 +US DT +Ġ`` ( +Ġ`` _ +block At +MP S +show error +Ġup datable +INT S +vo lo +Ġpoint ers +cu la +true type +ðŁı´ółģ ºółģ +ie ved +red ucer +\\ ' +42 06 +42 64 +TT L +Ġtemp dir +")) ), +âĶ ģ +ten ess +Ġback filled +"]) ), +parent hesis +Get ter +39 17 +Ġ", \ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Vi ableAlt +dis charge +dis ruption +Form View +over ridden +Ġab undance +Ġdest path +ĠNo ViableAlt +style sheets +spec grams +åı ĥ +ãĥ ł +Access or +Th ank +çļĦ è·¯å¾Ħ +Int l +Def ined +SC Y +CK M +41 92 +Base Reg +API GATEWAY +mc ast +Al gorithms +Qu ota +fp d +sets ockopt +ĠTh ing +hash ing +Ġmon o +select box +Ġref und +FL ASK +vm ss +ves pene +Net If +Ġpost al +web cam +Result ado +ĠEn crypt +æľ Ľ +light ing +GB Classifier +Ġvar type +equal ity +Ġzip ped +embed s +grad cam +oid c +Te acher +UB ERON +('- '* +ĠConfig Manager +mm m +110 11111111 +thread Count +Fil mografi +OUT UBE +ote l +Ġaccess ory +Ġmc Cm +Process Id +ranch ise +commit log +STR AP +ĠTe ams +ĠTe acher +Ġconf licts +Do or +Do jo +ठŁ +({" _ +á» ± +PAR ITY +Min Max +ĠUp grade +Ġevery one +question naire +éĢ ¹ +éĢ ł +ĠSh are +Ġannot ate +Length s +'+ "\ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +)+ \ +)+ ") +Ġ'{ ', +atom ical +Ġë ĮĢ +zz are +expand vars +Ġcl n +Ġradi ance +Over write +Ġday Of +ĠInteger Type +white listed +quanti t +proxy check +chunk size +Ġbit array +shift state +mis sed +DU MP +PER MISSION +ĠDo D +ĠDo xygen +åį Ī +ĠRequest ed +contour f +As sembly +Ġsleep ing +Ġpower ful +}} }, +router Vrrp +1011111111 1 +numer ator +LIST POMERIUMSESSIONS +exist ent +215 6 +215 7 +401 4 +Ġquanti dade +GA w +Ġspect rograph +roy alty +('. '): +VAR S +VAR CHAR +BE AT +ĠForm ula +Track ed +ä¹ ¦ +216 3 +216 4 +Ġlinear ly +Bl ank +Bl ues +å½ Ĵ +214 8 +__)) )) +ctsp PeerPolicy +Ġrelease s +Ġput ting +BI AS +emp loy +PA USE +264 6 +è¦ ª +Ġcdbp AppAdvToPeer +pas cal +232 3 +232 5 +DQ a +Ġgre vlex +Ġlight on +иР´ +ĠInvalid FileException +295 4 +295 8 +DP G +ĠCan ada +Initi alizer +Ġrect angular +UInt Ptr +general Tracks +306 3 +Ġfh kb +296 3 +296 6 +Ġproc Man +Import ing +ä¸ĭ è½½ +Ġair mass +Trap Host +ç® ± +ðŁı´ółģŃółģ ´ +ĠNotification Group +Lin coln +ĠMark ov +Ġflux es +Ġneighbor ing +ĠAnal isis +307 1 +233 9 +Ġcircuit Components +Ġfbx Layer +292 1 +umb ia +Ġ------------------------------------------------ ----------- +SK Y +Ġproto c +Ġ'$ '] +catalog ue +PROTO BUF +Ġbi jector +VIS OR +ĠTR AN +Ġexclude s +åŃĹ åħ¸ +Ġк лаÑģÑģ +Ġcnt k +)+' \ +ðŁı´ółģ´ółģ ² +Ġlegend group +listen ing +Ġok ay +('../ ') +ðŁı´ółģ¬ółģ ´ +936 34 +arrow style +Ġsha de +('{} : +Ġoccur rence +Ġspi ce +season ality +Ġattack er +hu ge +rack space +Ġaux iliary +Ġsafe guard +309 8 +Ġkw ds +ä½ľ 为 +Ġaccum ulation +ìĹ ¬ +Ġpersist ed +Ġgenes is +00001 000000 +aaaa aa +å» ¶ +Realm Known +ĠSome times +Ġlaunch er +blueprint s +Bool Opt +oct ets +Ġ################################ ######### +.*? )\ +hess ians +friend ship +Install s +laps ible +Vari ous +Ġsuc cesfully +Timestamp s +Ġlit ex +8888 8888 +ĠStream ing +ĠLogin Manager +Ġselector s +ĠVAR I +å¼Ģ åħ³ +camp Run +Ġcart s +VARI ANT +onic alize +Endpoint Descriptor +ĠSuccess fully +ĠClean up +Ġstrict ly +IMG SIZE +recogn izer +Ġoct ets +QUEST ION +Ġib G +ATTT T +éĻIJ åĪ¶ +VOL T +determin ed +Ġdeclar ations +TestModel Branching +Ġintro duce +ILL UMINA +fall ing +ĠSan ity +Ġб Ñĥ +Capacity Gas +ĠGu ide +Shared Set +ĠAcc ord +nat cap +ĠGra de +æĮī éĴ® +EFF ECT +ĠEnt ries +ACH ES +tal ents +paddle hub +è³ ĩ +Sci ence +Ġimplicit ly +Asc endente +ĠConstraints Union +ĠConstraints Intersection +Compile Operation +10111111111110011 0010111 +Ġìĭ ¤ +ĠSUPPORT ED +recur se +Are as +Vt Group +cot ta +fund ing +GEO METRY +ĠCel sius +Fb las +\". ", +ĠMis c +ĠVeri fication +ĠdeÄŁ er +èŃ ¦ +Ġwal ks +ë² Ī +FIRE WALL +Ġinstal lable +ĠBul k +ĠExclu de +ĠMyCustomAmazonReview DataLoader +åij½ 令 +ĠæŁ¥ 询 +Ġè¾ĵ åĩº +hib ited +ĠæĮ ī +asser tions +Ġshuff led +ĠFour ier +Webs ocket +Referenced InheritingObject +Ġperi pheral +fight er +éĻ³ éĢ¹ +Ġling vo +ĠOmega Conf +ĠвÑģ е +ĠMutable Mapping +9672 95 +FET CH +Ġclon ed +ĠMaze Attitude +Ġrollo ut +SCHED UL +SLE EP +SYMB OL +Stem mer +Ġaver aging +Ġxbm cplugin +Permit Pkts +ðĿ ħ +PRINCIP AL +Ġìŀħ ëł¥ +è¬ Ŀ +BLANK LINE +LOCALIZED STRING +QRST UVWXYZ +Ġmelting pot +1100100 010101111 +01101011011 00101 +ĠTHRES HOLD +ĠgbS izer +ĠNoViableAlt Exception +RealmKnown Peers +! =' +! =" +" (\ +% } +) "], +) """) +, + +, ]) +2 168 +2 134 +2 139 +3 104 +4 171 +4 153 +7 40 +7 39 +< ? +B la +B AM +B old +B BOX +C v +C us +C oun +C ER +C ID +C itation +C yan +D ust +D SS +D NO +E aj +E asy +F f +F m +F inds +F estival +G em +G ift +G rams +G rammar +G romacs +H an +H alo +H uang +I IC +I mplement +K an +K IT +K eras +L w +L ng +L vl +M d +M ind +N w +N uc +N jY +N Locator +O zs +P ct +P late +R d +R r +R od +R FI +R AF +S US +S MO +S caffold +T ur +T num +T LE +T ING +T alk +T ranspose +T ISSUE +U ATION +V iz +V oting +W inner +Z S +Z n +] ?\ +a id +a Cell +b ore +b ast +b ef +c ve +c ave +c pix +c airo +d min +d ados +d Space +d urations +e en +e la +e ulerian +f co +f ran +f ather +f bb +g ir +g map +h atch +h base +i ge +j V +k ph +k ube +k akao +l li +l cm +m F +m le +m Test +m va +n mp +n ak +n iter +n unique +n regions +o tick +p name +p ension +p illow +p aga +q U +s W +s X +t data +t rends +t rello +u ght +v tc +v gm +v aci +w itch +x mp +x pos +x sd +x GI +y W +y ms +y arn +z x +z hang +~ = +» ¿ +à Ħ +à Ķ +Ä ij +Î ¬ +ç ı +è ĥ +è ħ +ê µ¬ +ë IJľ +í ģ¬ +ï »¿ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ESS +Ġ ĊĊĉ +Ġ ä¸Ĭ +Ġ Ñħ +Ġ 使çĶ¨ +in ction +at v +at on +at to +re index +re map +re moving +re corded +re liable +st itch +en ed +Ġt mpl +de creasing +le go +an ç +Ġi bound +me zzanine +ro cket +ti que +ti tulo +mp ro +mp ot +Ġc time +Ġc order +Ġc dc +Ġc airo +Ġp z +Ġp key +Ġp ly +Ġp color +Ġp wm +Ġf on +Ġf sr +Ġf bp +Ġf tv +Ġ" .. +Ġ" *** +he ets +he aps +Ġa val +Ġa oc +Ġn db +Ġn eat +Ġn iter +Ġn br +Ġs ip +Ġs mi +Ġs old +Ġs igh +Ġs rt +Ġs licer +Ġs udoku +ut m +ut ar +ss i +ss ip +Ġin box +Ġin spection +Ġre map +Ġre ferred +Ġo vn +Ġd uck +li ves +ct n +un ny +un directed +Ġm inter +ra k +Ġe type +la z +ent rust +co e +co arse +Ġb og +11 04 +11 87 +um mary +um ble +Ġ( (" +Ġ( .*)", +Ġw ake +ch ol +te k +Ġ[ < +ma kes +es per +Ġ+ ------- +__ (): +get response +(' *', +(' |') +)) \ +)) [: +set Last +ath ers +ĠT X +ĠT SC +ĠT ower +us ually +Ġ2 67 +Ġ2 21 +Ġ2 68 +(" *. +as i +as semb +et f +Ġ{ ") +ĠS ing +ĠS weep +ĠS LM +ĠS NP +ab il +ab ic +ĠC F +ĠC u +ĠC DC +up id +") ', +Ġg ts +Ġg mail +Ġg ols +ter rain +ĠA J +ĠA udit +sp m +ĠF ist +ĠF air +ĠF lux +ĠF REE +ĠF acility +om Flag +Ġh z +Ġh vm +** (- +po wers +ta kes +ĠP T +ĠP AGE +ĠP ier +ĠP ages +ĠP SF +der ive +ĠI ma +file dialog +ĠL R +ĠL ines +ĠL ee +ĠL asso +ĠL icence +ub ly +tr uss +Ġth ought +pro vince +ex ons +im stats +Ġ3 32 +Ġ3 79 +Ġ3 72 +Ġprint able +Ġu a +Ġu f +Re boot +ĠM ik +ĠM andatory +ĠM ountain +Ġv net +Ġx ticklabels +Ġma i +ER A +Ġel bow +load module +Ġme chan +---------------- - +tra verse +Ġpro vince +py d +ls b +07 03 +07 17 +"] + +ĠB al +ĠB ow +ĠB asis +Ġos r +12 14 +12 08 +12 55 +12 168 +ĠE LF +Ġj ellyfish +ob solete +AT AA +AT ACT +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠN MS +bo urne +Ġ4 42 +ger e +col lapsible +In List +ĠR BF +mo x +Ġun ity +lic ant +Ġlog g +32 94 +32 44 +32 98 +32 59 +32 72 +per ceptual +// + +ĠG AME +Ġon t +ĠW ay +ĠW arnings +ĠW allet +tri bu +tri vial +Con ditional +Con versions +Con tacts +ĠV AE +Ġhe avy +mb re +Ġan c +Ġan tes +Ġen abling +min x +IT ERATION +18 92 +18 87 +18 86 +18 74 +18 73 +ft alarm +cur G +da vid +Ġk th +Ġk od +25 93 +25 96 +25 55 +25 75 +Ġpy ro +Ġpy tesseract +ener e +ag ens +ag gr +ag nostic +Ġmodel dir +13 97 +13 95 +lib ndr +15 57 +SE LECTION +100 111 +03 03 +Ġint ention +we ide +Ġop ção +ax arr +Ġal one +Ġal gebra +Ġpre computed +Ġat r +Ġat las +right R +enti able +enti cating +LE MENT +main ing +AN DOM +pi per +22 96 +22 94 +22 26 +22 98 +22 21 +Ġ\ _ +ĠH R +ĠH idden +sub section +Ġ{} ', +Ġ{} ): +Ġdi com +88 33 +Ġargs ort +19 84 +19 89 +19 73 +19 58 +19 69 +lin er +34 12 +09 07 +ĠIn sight +27 89 +27 21 +Ġkey pair +Ġle ct +37 84 +37 56 +37 74 +Ġoutput Path +Ġsub j +Ġsub id +Ġsub menu +Ġ{' )) +Ġcomp rehension +Ġnew sol +33 17 +33 08 +33 34 +33 67 +DE CODER +RO K +RO UTE +row var +av l +CT G +85 04 +36 200 +čĊč ĊĠĠĠĠĠĠĠĠ +ĠK h +86 55 +26 27 +26 74 +26 78 +Ġmax x +Ġdo ql +################################ ############## +Par ticles +Ġ8 080 +layer wise +CO OL +Ġunder stood +trans ient +66 67 +23 87 +23 57 +AC AT +44 01 +44 05 +ns ide +28 91 +Ġend Time +ther mo +98 55 +38 92 +38 23 +Ġmin iglm +check info +Me th +UR AL +vis o +html color +pri sm +))) ] +flow Monitor +ĠSe par +Ġad cp +45 14 +zer vaci +the mes +call count +ong odb +Ġcode gen +action Bar +las hed +Set Button +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġsk time +gen SQL +ĠJ uly +Log Data +Log Norm +Num Views +)] ]) +40 32 +Ġmodule str +open File +assert Not +Un named +Un authorized +Ġq y +To Process +To One +CON DITIONS +29 19 +Ġval ve +âĢ ĺ +block Size +Ġdoc strings +Ġdb us +43 87 +ĠPro vince +vo y +Ġnet run +Ġqu ar +EX TRACT +ĠData API +pass ive +Ġany where +fe el +])) [ +left R +Ġcontinue s +ca fe +Ġhttp server +kin ds +"]) ] +"]) ): +ĠPar tial +tx s +Ġ'/ ', +Ġass ertion +Ġiter ated +mer gency +Ġframe on +Key words +cmd Line +Ġnext hop +FT P +Comp utation +Le ave +pr f +78 33 +OP CAPS +Out going +ãĤ ª +pol ys +ĠNo Such +ĠNo ResultFound +job types +Ġman hole +Ġsetup s +ĠRes olve +network ing +connect ors +Access Binding +Ġneed le +pack er +cell ml +IP ROP +book ing ++' "'+ +Ġ202 101 +300 5 +300 7 +Ġtri e +Ġtri s +fla ir +Ġleft most +Ġsrc path +Client Id +:` ( +TE nd +Fa ces +ĠCh ristop +rap ing +ĠImage ChooserPanel +Py game +ĠAny DataObject +az i +ĠSim ilar +sort er +KEY DOWN +Ġloc alization +PR IM +ĠDef ined +arr s +Ġact ing +Net flowMonitor +sql formula +SER VE +Ġcli ff +Ġcmd line +FP N +Dis plays +]+ \. +layout s +Ġjo urnals +engine ering +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠRel ated +Argument Type +Argument TypeError +'} )) +Per imeter +á gina +alle y +Event Manager +ĠComp ut +Ġstri ke +cap sys +mag ma +Mat ched +MC ell +modi fication +ĠCom ments +Mo sso +å® Ĺ +Ġscal ars +js ke +Map E +zone Id +Ġmulti line +Met ers +ठ¦ +Resource Description +OS Error +Ġaut okernel +á» © +á» ī +Ġgr n +Ġ') ', +IR A +Window Text +Ġshe ar +mu a +aut ore +aut omatically +Ġfun ds +hist ograms +GN U +Ġsocket s +ĠSh uffle +Ġcir rus +Search ing +Ġfactor ization +bi ge +ĠFunction Of +MIN IMAL +Ġselect inload +public URL +Ġmod al +Ġradi x +Ġradi ation +Ġalign er +Ġseq no +Ġarch itectures +gu ar +attribute Prop +From Peer +desc ent +Ġ'# ': +pick up +Ġæ µ +Ġæ · +Ġæ Ĭ +expression path +Ġdepth wise +ĠNO C +Classifier IPv +Ġcontrol led +MAP P +Ġpr d +Ġsubject s +ó s +ĠEN T +Property Registry +Ġgra ss +selected Index +speci e +к о +sha ft +clip ped +ĠST FT +è® ¢ +LS Conn +hot key +dig i +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ +TRI ANGLES +ĠObject s +ĠObject Type +sy nthesis +Ġindent ed +SN IPE +Format ting +Ġclear art +Ġclear logo +scription s +Ġcar rier +ĠNode s +ãĢĤ | +Ġtool chain +íķ © +ĠSE ED +Dec ision +bul ent +bul lets +GA USSIAN +ĠSQL ALCHEMY +Ġctsp ConfigSgaclMapping +Supp ress +211 9 +Rel u +major ity +в а +в од +Ġcred its +History Resource +éĻ Ĩ +differ ences +294 9 +214 1 +214 5 +ĠEnd Time +Ġgene tic +WR IT +ano i +COMM ENTS +Post al +ATT ACH +Ġslice d +232 7 +Ġarti ficial +Ġcla ims +åĩº åĬĽ +Ġir radiance +Ġlayout s +Host Utilities +Ġfl ds +Ġ(% . +Eval u +äºĨ ä¸Ģ +ĠSimple Imputer +Ġshift width +Ġ\" % +retri eval +ä h +ä n +flu idity +305 5 +ê s +212 2 +truth s +Ġvisu alizations +Ġdue l +ĠBl end +Call Back +("{} : +("{} ", +еÑĢ а +operation Context +Sgacl Ipv +Ġ---------------- -- +Ġ---------------- ------- +concept s +æĽ ² +209 4 +Drop NetflowMonitor +Game s +ĠAb ility +ĠSER VERS +å¸ § +Ġelect rode +ĠChange d +Ġfold ing +à± Ĩ +ÙĨ ÛĮ +对 é½IJ +identi fication +cart s +455 7 +Ġhard coded +Show s +LEX ER +ë¡ Ŀ +utter ances +ĠRet rieves +fire base +Acc Sfp +ółĢ±ółĢ ¶ółģ¿ +ĠпÑĢ ав +è· ³ +Cm ds +Ġclock wise +("_ ")[ +Ġtruth s +wik ibot +HOLD ER +Ġwar ped +Ġд ан +Handle s +ĠEval uator +pf am +Transfer From +getTypedRuleContext s +Ġlig and +calcul ating +ualiz ar +Snap Z +ĠAP IClient +CHAR GE +Ans ible +Security Group +ðŁı´ółģ¢ółģ § +ĠVis ual +æı Ľ +次 æķ° +Ġз аказ +acion es +Lat n +ĠPart y +ĠRest art +Hyper bolic +tissue s +Vari ance +THE FT +Clean up +ĠSa fe +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġprod uto +ez dxf +ι κ +chkpntTrap Category +chkpntTrap Severity +chkpntTrap MsgText +Export ing +ал ÑĮно +care t +ĠCallback Context +ĠCallback Property +TIM ES +MOD UL +lens fun +orient ations +ĠPrepare ADVSInputs +Ġphot on +hal py +Sig moid +æ± ł +unt ário +ĠPATH S +bk data +mlin ks +Ġarrow props +ĠCOMM ENT +mirror ed +Ġminor ticks +代 表 +Pur pose +lee py +ĠAnaly zer +Gi B +iet f +Ġima genet +Ġfall s +Ġrecur so +VP DB +Ġwavelength s +æ¡ Ī +Diag nostics +Beam Spot +Ġusd Utils +PlusTail Context +Bro ker +ĠCap ital +ðŁı´ółģ©ółģ ² +Effect s +ĠBert Tokenizer +Chunk Node +integr ator +owl nets +空 éĹ´ +Mg mt +TRACK ING +PAY MENT +ĠLat itude +Relation ship +ĠMask ed +Ġsob el +ÑĢа Ñī +åĸ ľ +ìķ ¼ +ìķ Ħ +xFFFFFFFF FFFFFFFF +ĠTIME OUT +áĨ ¯ +IDXGI Factory +UNI QUE +ν α +Ġbir ds +æł· æľ¬ +inde cies +Ann ih +CATEG ORIES +DRI VE +оз в +оз д +Instr ucciones +ĠSegment ation +tac tics +на Ñĩ +00001111001 00000111 +caffe model +Ġestab lished +extreme RtStats +å¼łæĺ¯ æīĭæĮģ +ë¶ Ģ +ĠSong request +occur rences +Ġrw Motor +Ġelimin ate +ĠBro ker +ALI AS ++---------------- + +substit ution +miner als +Pas sed +AppAdv FromPeer +Trial Component +COMB AT +ĠIndi co +ĠTrace back +Ġortho gonal +Look s +ĠCombin ed +Ġlan Mode +ĠHOST NAME +"""""""" """""""" +ĠBR DF +íĺ Ħ +Ġadverti sing +nnnnnnnn nnnnnnnn +Ġcru ft +磩 å½¢ +Ġcit dl +Parti cipant +twin x +instanti ate +ĠTER M +chkpntTrapOID Value +know s +ĠTIM ESTAMP +AGGREG ATED +æ¼ ¢ +Ġë¶ Ģ +Ġë¹ ĪëıĦ +Calo Stage +ĠEp isode +nowled ged +ografi a +nation alization +ACCESSBIND INGS +PhoneNumber Desc +Friend ly +æ¥ Ĭ +ĠInvent ário +jaco bian +ìĦ¸ ìļĶ +Crit eria +Ġkine tic +muR fac +lugg age +Ġthro ats +Dol lar +abri el +ĠBLE U +IDXGIS wapChain +Works heet +Fem Resp +ĠSEM I +grat ulations +orent z +ĠPLAT FORM +ĠImm utable +xAuthConfigExt n +gned in +Ġfich ier +topos ort +å¼Ĥ 常 +ophi licity +ĠFORE IGN +ĠìĥĿ ìĦ± +RELAT IVE +DTEX OPCAPS +incron ização +xpa eport +maph ore +qtime tadata +ĠEMPT Y +Ġ4294 967295 +ĠHypothesis Test +Tnum segments +( < +* =\ +, ") +. '], +1 00000000 +2 126 +2 127 +2 934 +2 195 +3 012 +3 105 +3 096 +3 097 +4 195 +6 000 +8 0000000 +: $ +B j +B EG +B roadcast +B IBLE +C are +C ords +C riterion +D AG +D ao +D HT +D etailed +E z +E ol +E dition +E Ag +F ib +F EM +F arm +F eb +F loor +G f +G ran +G AIN +H at +H over +J e +J PG +K c +K t +K ick +K raus +L H +L z +L TR +L FP +L azy +L ondon +M n +M ort +M ine +M AD +M utation +M omentum +N im +N AC +N Content +N ATIVE +O db +O pa +P la +P df +P DO +P CM +P aper +Q Vector +R l +R om +R ING +S MA +T uesday +U H +V Co +W n +W ik +Y a +Y f +Z ones +] /( +a us +a ab +b ss +c S +c able +c ag +c rm +d Q +d ac +d ob +d ff +d scp +e in +e bs +e igh +f en +f ax +f ant +f uzz +g ard +g usm +h ci +h ay +h ana +i P +i S +i path +i lio +j es +j query +k Y +k ub +l um +m ers +m idx +m sec +n ces +n ec +n ings +n ww +n cc +o sh +o Target +o hm +p erspective +q G +q R +r vs +s H +s Z +s igh +s ld +t log +t test +t ender +u R +u in +v on +y ah +y uv +z ap +z label +z ave +z mc +} > +} }. +£ Ģ +Å ĭ +Ð £ +× ª +à ¾ +ç ĭ +ç Ł +ê Ŀ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ]] +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ############## +Ġ å®ļä¹ī +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +on set +on aut +Ġt ort +Ġt ts +Ġt ots +ar let +de lays +le afs +an ol +Ġi tr +me tab +mp ip +mp ted +Ġc en +Ġc ta +Ġp po +Ġp ai +Ġp anda +Ġp auli +Ġp uls +Ġp ileup +Ġf reed +Ġf ired +Ġf ederated +Ġa ware +Ġa udi +Ġa hr +Ġa valiação +lo ser +lo Ve +00 83 +00 72 +ort heast +ce f +Ġn icht +Ġs la +Ġs orry +Ġin order +Ġre cts +Ġre liable +ing Policy +Ġo x +Ġo cean +Ġd ad +Ġd amp +Ġd Space +Ġd lg +Ġm Config +ra v +Ġe dition +Ġe jected +la int +fi co +ent ral +ri mir +Ġb line +Ġb aby +Ġb zt +Ġ1 0000000 +ed o +ed ance +11 15 +11 03 +11 65 +Ġw id +Ġw af +Ġw atched +ch ap +ch ris +ma kina +from Utf +el bow +), ), +is class +__ ()]) +set Visible +set recursionlimit +xt b +xt h +th ena +th ought +Ġ2 86 +Ġ2 57 +Ġ2 77 +Ġ2 65 +Ġ2 39 +et rade +Ġis land +Ġis Reverse +ĠS R +ĠS tra +ĠS low +ĠS PI +Ġof a +ĠC D +ĠC e +ĠC s +ĠC pp +ig s +up dating +Ġg ro +Ġg reedy +ter y +Ġr ings +Ġl ars +Ġl dap +data structures +ĠA U +01 24 +01 62 +01 6292 +Ġcon strained +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ic m +am mo +to wards +99 87 +99 57 +ĠF S +ĠF PS +od l +qu ids +Ġh ls +Ġh ps +ĠĠĠĠĠ ĊĠĠĠ +po x +ĠP la +ĠP DB +ĠP otential +ĠI mg +ĠL abs +ĠL USID +=' +') +Ġst ash +Ġde li +Ġde dup +Ġde veloper +Ġ""" ! +Ġnot ation +Ġ3 16 +Ġ3 05 +Ġ3 23 +10 22 +10 95 +10 68 +ase g +ow s +ĠD UT +ĠD urch +ac me +Ġu json +]) < +ment al +Ġdata points +ĠM T +ĠM ur +ĠM AE +nt l +xf fffffff +=" - +=" .", +Ġv ad +Ġ* (_ +add Item +add Parameter +IN C +ore an +ore tical +tra vis +Ġpro cs +Ġpro gra +py fun +pre cond +pre computed +ap h +ap ore +ap dev +07 00 +ES R +"] ') +ĠB idirectional +Ġos f +ĠE D +Ġj d +Ġj nt +ci ti +ci ety +ans ions +ĠN FT +ĠN ÃŃvel +len n +Ġ4 43 +Ġ4 48 +lu ence +92 97 +In voice +ĠR V +ĠR olling +mo vi +mo ji +Ġun register +OR B +Ġtest cases +Ġlog Tag +32 99 +32 13 +32 08 +32 34 +32 89 +32 29 +32 48 +per p +ĠG M +ĠG Common +EN AR +ĠW s +ĠW ar +bu ck +ĠU rn +code cs +Ġ5 44 +Ġhe t +). ", +ib a +ib ble +Ġ__ | +999 8 +Error Handle +18 02 +18 36 +18 35 +18 67 +18 8877 +16 75 +line plot +25 19 +25 31 +Ġpy name +13 03 +13 64 +13 56 +SE CS +ST AGE +100 5 +100 011 +100 0100 +max lat +Ġthis Loop +03 75 +Ġint ensive +jo kes +jo urnals +we igh +ip address +17 75 +Ġal to +RE PEAT +22 32 +22 67 +22 39 +ĠH Y +ĠH a +ĠH ive +ĠH AND +ĠH AVE +ĠH VAC +ĠRe peat +ĠRe cursive +ĠRe ceipt +ay ette +sub path +sub list +sub strates +Ġ{} ; +Ġ{} ...". +input File +][ ~ +Ġdi vergences +sk ipping +df w +19 81 +19 41 +output Data +ID ITY +Ġsc p +34 97 +34 74 +Ġwe igh +09 09 +ĠIn frastructure +write List +27 59 +inter leave +Ġle gs +ill ator +24 05 +24 36 +24 47 +24 54 +37 04 +37 93 +37 08 +37 89 +37 39 +37 31 +37 54 +37 52 +37 41 +Pro duced +em iss +Ġsub str +[: ,- +94 87 +33 03 +33 52 +arn o +av arii +87 08 +fic ar +exp lan +CT A +CT TT +ensor ing +". " +". * +97 77 +back log +net list +36 94 +36 75 +Ġopen fermion +Ġuser guide +word net +Ġcont ador +26 05 +26 09 +26 81 +26 69 +26 558 +sum mon +mon t +Ġdate Time +Ġz oo +Ġ[' '] +Ġext def +Ġ| * +Ġ| - +Ġbo ss +Ġne utr +List Node +AC G +AC P +Ġli e +44 12 +44 66 +44 65 +IM e +new ick +En riched +Co ok +28 17 +28 09 +28 24 +ET F +Ġsp rites +FI LL +local ity +obj corners +pop ulated +Ġ(' _ +uc ing +UR G +img t +of p +35 04 +ĠSe ed +Ġcurrent Size +45 96 +45 89 +amp s +amp hora +item List +the y +the ad +ide l +47 36 +101 0111 +Ġver ses +wh ites +du ate +rt u +}) ', +Ġar rows +46 12 +46 04 +Ġcv b +ĠSt ub +)] = +)] ): +40 93 +Ġformat o +Ġq ry +ĠPy Installer +let te +CON TRACT +DO F +De viation +43 85 +Ġ{" _ +ĠCON STRAINT +Ġup roject +Ġup sert +ĠPro ceed +Ġ:: = +ins ight +cu a +ie u +session id +42 95 +42 80 +left L +EL Y +Ġpri mer +Ġlimit ing +DAT AD +ĠValue SizeConstraint +Max Pkt +Max TEnd +Ġback track +UM B +Node Name +39 14 +Ġsum mer +Message Handler +cho lesky +aw iki +Ġword TreeMap +ren te +Tra it +Ġtop down +Ġdif er +annot ators +Ġeval s +Cont rolling +ãĤ µ +pol ls +âĢį ðŁļ +Ġroot dir +CA U +ãĥ ĸ +Access Key +Ġwidth s +çļĦ åĢ¼ +Up dater +lip id +Ġdoes nt +ÑĢ ем +ÑĢ ед +stream er +Inter est +Ġgl Bind +Ġfont name +Ġfont dict +300 2 +Create File +API Resource +dec imals +mod ern +Ġoper ational +ĠCh en +rap id +ven tions +sing ular +az el +ĠSim ulate +é n +ĠDE P +ee ee +Ġact uator +Pre processor +GR AN +ĠAPI Key +LOG S +ĠZ IP +Ġì £¼ +Ġans atz +ĠMan ufacturer +åħ « +åħ Ń +Ġstruct ural +display ed +her es +Ġelement os +è¯ Ŀ +Ġsw agger +dx l +Ġvi brato +cm marr +Ġinstall ing +vec tive +"} }' +cf fi +ãĢ IJ +ãĢ ij +mock s +document ed +å¤ ¹ +cla imed +Pri vileges +Ġpub sub +On ce +å® Ŀ +seg m +rm sprop +Ġconn exion +ä½ İ +æĸ ¯ +prop ensity +Ġmulti label +product Type +short ening +Ġ'../ _ +Ġ') ') +Ġhash able +AV ES +Server Info +Ġve ga +Ġclick ing +peri pheral +Ġcap able +Ġassign ee +ĠSh ipment +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +channels resource +)+ ", +],[ [' +å° ¼ +ĠAd dition +ĠAd apter +bb ed +land mark +ÃŃ s +âĶĮâĶĮ âĶĮ +Ġpas senger +Ġë ¡ +Ġë ĵ +Ñĥ ÑĪ +Ñĥ Ñİ +Block ing +quanti les +Ġdiff usion +Filter ing +just ify +ĠOn Off +mar shal +Ġ? " +Ġ? ', +Ġadmin ist +Ġadmin istrator +Ġenvironment al +chat bot +sigma s +Ġinv itation +к л +ĠCO O +Ġpa usr +typ ically +ĠST DOUT +rf m +è® º +LS B +DIS COVER +COMP ARISON +ĠMo ving +%% .. +Ġdrop block +IA I +Mix In +----- ") +scan code +Ġcar ro +Wh ile +Ġhist o +Ġnormal ised +Ġri o +ĠSE CONDS +------ ") +icon o +icon da +204 1 +Ġ'< % +Ho pping +diag s +čĊĉĉĉĉ ĠĠ +Ġtw it +384 2 +384 5 +Link age +Ġctsp Stats +equ ip +":[ ], +utc fromtimestamp +MODEL META +в Ñĭ +éĻ ¢ +为 空 +ĠGe om +Sign ed +294 2 +294 4 +ctsp Stats +EA ST +contin uation +Ġes se +circ uits +walk Tree +organ ized +emp irical +Admin String +uck s +Ġtab stop +ATT GG +208 4 +pet ual +åıĸ åĩº +217 8 +217 9 +232 4 +AI OPS +åĨ µ +watch ers +Ġsyn set +Ġlight ing +åĩº çİ° +,)) ; +æĸĩ æľ¬ +Ġsur vival +squ ad +6666 6666 +ĠÑģ о +separ ators +207 5 +295 1 +295 9 +met ro +illi ams +Lim ited +Mask Width +305 4 +Render ing +296 9 +Ġhyper params +Ġswitch ing +NT Def +prote ins +Cor rection +308 2 +Pr sa +ä¸ĭ æłĩ +INST ANCES +dem os +Sto kes +Ġ"' {}' +pod man +(", ")] +Shape s +Ġ---------------- ------ +403 4 +Api Client +cod on +âĢĻ , +ãĤĴ ä½ľ +Tool Bar +Processing Job +ĠResource Type +Ġdeploy er +292 4 +chi ef +Ġ------------------------------------------------ - +209 7 +ĠâĢ ¢ +ĠâĢ Ķ +ĠMain Window +fh ir +436 7 +987 5 +LEVEL S +æŶ åĢĻ +293 3 +Tun ing +Ġcwd mWavelength +Ġdr ink +Ġflash er +Ġdet alhes +FOR WAR +ĠOver flow +ãĥ¼ ãĤ¿ +cook iecutter +ĠConfiguration Error +ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ +Send Command +bid irectional +suc ceeded +ĠTag ged +ĠOper ating +ĠStore Result +sil houette +=(" ( +=(" ", +repe ating +Ġattack s +Ġ-------------------------------- --------------- +Ġpartition ing +æĸĩ件 夹 +Ġemp loyees +augment ed +309 838 +kn ife +ĠUN SET +nv me +hard share +\\\\ \\ +mult inomial +calib rate +ĠTri angle +ĠBinary Tree +298 1 +å¥ Ĺ +alloc ator +':[ ]} +___ ") +Shader Fixes +Ġplan et +SG W +MER GE +ï¼ī ï¼Į +çľ ¼ +ìł ľ +ðŁı´ółģ¢ółģ ²ółģ +Ġrevision s +Let ters +Ġeff ec +Deploy ed +Deploy Status +ê³ ± +lain Text +Install ing +ĠCPU s +éł ĺ +Ġsuc c +Ġbri ef +Ġincrement al +åħ³ éĹŃ +CONNECT IONS +Ġठ¸ +pal ettes +bas in +KER NEL +Ġphot ons +æīĢ 以 +fq it +decrypt ed +CRY PTION +ĠCons umption +contrast CH +åŁ Ł +ĠBO OL +æŃ£ åľ¨ +âĸijâĸijâĸijâĸij âĸij +Accomp lished +ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX +fan art +vot ers +Ġaffect s +Ġfreeze gun +nft s +æĥ ³ +Ġmal ware +Ġfb las +FUNCTION DESCRIPTOR +Diag onal +pict ures +snake make +associ ated +GRAPH ICS +Aut om +Ġusd Mesh +ban ana +milli on +ĠGEN OMIC +Ġtensorboard X +declar ations +Ġ'; ' +Ġsl urm +Ġban ana +YT ICS +Ġbas in +01000100 01000100 +extern als +Replace Options +ENTITY SCHEMA +PAY LOAD +occup ied +Comm unic +705 0499 +fed learner +ĠQU ANT +ĠHelp ers +Tele gram +Sprite Id +Ġextreme RtStats +glyph s +Ġsnake make +usc enes +VO ICE +ðŁı´ółģ¥ółģ §ółģ +ĠAug ment +Ġcool ing +IDAT x +0111100011011 10111111111 +SEND ER +phan tom +éĴ Ł +ãĥĥ ãĤ¯ +Ġcg tsvg +Ġdemon strate +audi ence +ĠGpu Elemwise +gran ts +Air port +1307 2943 +ĠSql ite +ĠREQUEST ED +Winter Festival +ĠDiag nostic +cau ght +implement ations +ĠÄ ij +ĠTick et +ĠAUTO GENERATED +etsys NacApplAuthentication +ental Data +doub les +ĠVisu alize +ĠVisu alization +Ġetsys NacApplAuthentication +Ġrq st +ĠQgs Processing +SENT INEL +TOR CH +.` % +ĠVital ErrorHandle +cloudwatch log +Trend ing +Ãĩ ÃĥO +Ġcite key +Ġspl unk +Ġè¾ĵ åħ¥ +BOOT STRAP +ĠMsg Type +MaxT Begin +Ġadministr ative +ENK INS +ARES IZE +msc n +Ġì§ Ģ +2953 93634 +Ġterra cotta +ĠTyped Dict +ĠFed ora +ester day +ĠBounding Box +ĠRequire ment +ASY NC +âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪ âķĹ +Ġreprodu cibility +Cum ulative +Ġdynam ical +Ġdirec tives +Aspect Ratio +Gri pper +Ġspar ql +ABCDEFGHIJKLMNOP QRSTUVWXYZ +Pie ces +Tho mas +Ġobjec tives +pgm var +HORIZ ONTAL +uros ynth +Ġcongru ence +ĠPep ulator +phanum eric +éĬ Ģ +Ġkt ó +itud inal +bey az +ATTEMPT S +Ġfru its +Ġdivers ity +ĠCEL ERY +isser and +Americ an +ĠusbDeviceCdc Component +ĠSah ana +åıĥ æķ¸ +Ġ'$'] ],[[' +SCHEDUL ER +setLast Updated +12168 1553 +36200 171 +MAPP INGS +COMBAT LOG +æ¥Ĭ æĺ¥ +BIBLE UTILS +Ġahr spos +ĠdSpace ID +188877 36200171 +26558 121681553 +MaxPkt Len +cmmarr hx +309838 295393634 +7050499 13072943 +# / +$ . +) ": ++ (? +, -- +- < +- ] +2 925 +2 948 +2 103 +2 131 +3 025 +3 857 +3 121 +3 129 +4 567 +6 70 +6 81 +: ': +< % +< ( +A a +A ID +B re +B AS +B IL +C andidate +C losing +C UBE +D up +D to +D é +D HCP +E sc +E xe +E rc +E ns +E MA +E CE +F acing +G Qy +H d +H ip +H IV +H ADOOP +I jo +K ron +K UR +L s +L ite +L atest +L AMBDA +M IL +M pk +M ixed +M hz +M bps +M aking +N FD +N ominal +O de +O ur +O range +P q +P ulse +P ADD +Q b +R f +R mon +R DF +R BR +S in +S ell +T g +U PL +W Qy +W ATER +X or +Y n +Z q +[ | +[ (" +] ^ +` { +a ea +b lu +b matrix +b ounce +b ounded +c ce +c ct +c ub +c ere +d ow +d ens +d rc +d rs +d theta +e pp +f es +f os +f db +f cc +g am +g px +g kl +g Term +h artree +k ant +k ins +l list +m B +m Y +m di +n S +n ar +n ba +n You +o main +p unk +p ane +r N +r te +r rs +r syslog +s F +s ire +s ı +s ppas +t type +t ld +v ndr +x j +y B +y or +y am +z Q +| ] +} .", +ª ółģ¿ +¸ ¡ +¿ éĹ® +Ä Ĺ +Õ ¥ +Õ ¾ +æ ĩ +ë į +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ 0000 +Ġ vice +Ġ ride +Ġ ############################################################################## +Ġ çĶŁæĪIJ +ĭ 转 +in l +at en +re db +se o +st ft +st ud +st ability +en ne +ar f +ar range +al bert +le ta +an m +an cies +Ġi col +Ġi df +Ġi ous +Ġi OS +-- · +me cab +ti se +ti linear +Ġc ro +Ġc print +Ġc fp +Ġc px +Ġc lang +Ġc pus +Ġc anceled +Ġp type +Ġp pos +Ġp pc +Ġp att +Ġp ictures +Ġf onts +Ġ" ')) +Ġ" ;" +it ons +Ġa set +Ġa py +Ġa ci +Ġa do +Ġa wards +00 87 +00 54 +00 74 +00 53 +Ġn il +Ġn ao +Ġn dof +Ġs os +Ġs format +Ġs weet +Ġs urname +ut to +Ġin jected +Ġre balance +Ġre directed +Ġre parm +Ġo pe +Ġo obG +Ġd I +Ġd it +Ġd rops +ct e +un load +un ches +un bound +Ġm ic +ra iden +Ġe w +Ġe cr +() ]. +() ;\ +fi cs +ad oc +co li +co vs +ri f +ri gid +Ġb dg +Ġ1 998 +11 08 +11 83 +int Div +int erior +Ġw v +Ġw ulff +ch g +): ") +ma id +ul ong +== - +== > +Ġfor ge +Ġfor cing +ol en +el ded +el vin +is le +is able +get C +get Status +get Device +get Property +get Attribute +(' ** +(' ================ +(' === +ĠT im +ĠT OTAL +il U +th irty +Ġ2 94 +Ġ2 49 +Ġ2 61 +(" === +(" )") +pp le +') ", +op o +op codes +ĠS in +ĠS ay +ĠS UM +ĠS LP +ĠS chool +ĠS AVE +ĠC K +ĠC op +ht t +Ġg ib +Ġg ave +Ġr n +Ġr sa +Ġl arch +Ġl gb +ĠA ra +ĠA ff +ĠA PN +sp ice +sp aw +ult s +ver melho +'] ( +Ġcon di +Ġcon tr +Ġcon dense +ic ion +ke e +to f +path sep +od river +qu a +log raph +log Resource +vi f +ser y +Ġh ora +po li +ĠP EM +ĠP lane +Ġas ks +ĠL P +=' .', +Ġde da +pro du +est e +0000 2 +Ġ""" """ +im v +im me +able Conv +Ġ3 83 +ĠD NN +ac curate +app id +app able +ĠM F +ĠM el +ĠM il +ĠM EN +ĠM otor +ĠM utation +ĠM MR +lab oration +ew ee +ew lett +Ġ_ *_ +Ġy an +ĠO PER +ĠO PTION +os r +test cases +IN I +ure au +load URDF +ON US +py th +py task +py dev +ap r +ense s +ĠB at +ĠB ur +ĠB IT +ĠB alancing +ĠB ayesian +12 07 +12 04 +12 84 +ĠE xc +ĠE ns +ĠE lev +ĠE lf +ĠE lem +Ġj pg +ci x +ci an +ci are +text box +AT S +Ġ) ): +com ms +}, " +len gine +bo y +Ġ4 15 +Ġ4 36 +ff c +ff set +92 55 +In coming +In secure +In depVarComp +ind ust +ĠR W +ĠR ace +ĠR SS +ĠR IP +ĠR NA +ĠR oman +ĠR OC +ĠR ANDOM +ep hem +Ġun k +Ġun balanced +Ġun wanted +Ġtest utils +32 06 +32 88 +32 36 +32 45 +ph ers +ph fqit +Ġon mouse +ĠW arp +ho spit +Ġout p +AR C +ĠV T +ĠU Q +ĠU V +print able +Ġ5 20 +Ġen queue +Ġen dif +ard Objects +che st +18 08 +18 84 +18 57 +18 45 +18 77 +18 47 +line ages +array ScaleT +cur riculum +Ġk b +Ġk x +Ġk ube +Ġk akao +Ġcol n +25 33 +25 95 +25 72 +St ator +St aged +Ġ6 0000 +ener ate +ag max +ag ged +06 36 +15 65 +max hp +]. __ +we ed +train set +Ġch ap +17 56 +Ġal though +93 07 +93 05 +14 84 +ord ot +Ġat m +right L +Ġ[] ], +gra ded +Type List +22 92 +22 45 +22 77 +22 82 +22 89 +22 73 +Ġ\ "" +ĠH D +ĠH or +ĠH int +ĠRe action +sub traction +ml eri +np x +88 55 +lp m +19 67 +19 63 +Ġsc arlet +34 96 +34 55 +34 87 +34 86 +34 57 +34 98 +34 43 +34 58 +34 59 +34 63 +Ġ[" . +ĠIn ception +ĠIn no +ĠIn direct +ĠIn correct +27 95 +27 31 +27 62 +27 51 +bin count +Ġle ak +arch ivo +ging Classifier +24 08 +24 33 +24 85 +24 44 +24 62 +37 13 +37 42 +37 58 +37 53 +37 68 +ak i +em os +em isto +Ġpo etry +Ġcom ms +Ġsub sequence +yn om +AM ILY +Ġac quired +Ġcomp os +Ġcomp ares +Ġcomp licated +94 99 +94 56 +33 05 +arn am +DE LETED +RO Y +RO IN +split ed +87 94 +exp lain +Ġla ke +mi e +mi ered +36 57 +Ġopen rc +ĠK E +ĠK ubernetes +Ġdist inguish +86 06 +86 84 +26 11 +26 07 +26 25 +26 06 +26 29 +26 91 +Ġmax lat +Ġdo is +Ġz samples +HE L +AG GT +Par ametric +ster esis +ww ww +IS A +ix x +do ors +Text ures +"," % +List Issue +List ComponentDef +current Position +CO H +upp ort +man ifold +ach i +trans mit +23 92 +Ġstart Date +Ġmat ters +ps g +44 07 +44 04 +ns g +und reds +IM URegisters +new est +float ing +28 98 +28 31 +Ex pert +fix er +56 76 +98 96 +FI p +move axis +my list +my group +LO B +batch norm +Se ason +Ac tivate +be aring +ĠQ Image +PT IME +target ed +AB I +vis ão +ud call +tim ings +doc format +',' ', +stat combine +45 64 +Ġinter ior +"], ' +Ġspeci e +Ġcode d +Str Var +Ġ9 000 +cy linder +cord ance +Test Result +Ġgener ics +Ġstring ify +Ġver tically +Ch unks +Ġsize Tuples +mark ing +rop Tors +UN et +Ġcv cConf +89 04 +89 55 +yp us +cp f +)] [' +assert In +root Dir +Un ordered +tag statcombine +ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ċ +Ġbatch norm +Config Error +43 84 +43 96 +Ġcor al +ĠPro te +ĠPro filer +CL R +vo x +)* | +Ġqu otation +EX CLUDE +42 96 +42 85 +msg str +MA Y +Ġright most +ible s +EL F +ca fee +iss pace +DAT AS +ĠÐ Ń +ped antic +Ġtag id +Get Block +Get Desc +Ġwrit ers +39 04 +39 03 +Ġfa z +bar rier +Ġtyp ename +Ġlast name +74 1 +ĠCo okie +Ġ... ' +LI F +LI ER +Response V +Le Net +Le af +Input Field +58 07 +access Token +pr á +ãĤ » +Ġ.. _ +seq name +Ġfollow ers +Trans ient +IND ICES +ym al +At tempt +KE EP +Ġ"/ ", +erson ate +62 84 +Sh ade +Ġexist ente +IP Address +Ġtmp Pat +RES P +book id +Def Cmd +internal Failure +SC loud +su itable +CC JC +300 4 +ĠID XG +åĪ ĩ +Ġmy group +Ġph p +Ġph ys +torch vision +mc Cm +keep ing +Ġidx set +################################################################ ##### +tests ocket +ĠTh anks +TYPE LESS +win Width +win Height +Ġpi co +feature d +Pre c +}" '. +gress ive +Ġscore board +Ġì Ī +Ġcmd class +contain ed +Ġvar args +ĠMan y +leg ends +ĠSO AP +ĠSO CK +ĠSO CI +rain bow +ĠFile Path +Rule Engine +Ġsee ing +áĥ ľ +Ġelement o +Per Line +Per Primitive +til ing +lap lacian +ĠCol ors +OUT H +SD N +å¤ ľ +!! ") +chain er +sched uling +cost e +Box Mesh +cer tificates +ĠLog s +buffer ed +ACT UAL +tk n +Ġtx s +this Week +Ġ---------------------------------------------------------------- - +Met al +Met atype +ठ¬ +Tag ged +PORT S +Ext end +á» ķ +á» Ĺ +FR AMES +Ġgr lex +Ġcorrect ness +ĠTo x +zy f +hat E +seconds PerPoint +SO UND +:, . +Server Status +An other +An neal +Di vide +Ġow ns +Ġdebug ger +Ġcommon ly +Query Users +Query Groups +Query Uniprot +à° Ł +Source Code +Ġdat atable +Ġsort s +pa inter +Search T +freq ghz +Widget Item +MIN US +Ġë © +Ġspace craft +ĠAn imation +Ġpop size +Ñĥ б +Ġmod ulus +oto ols +black listed +Ġæ İ +Ġæ £Ģ +004 07 +SL M +alf red +bottom Most +åº Ĺ +mar ry +tw ice +ĠIP A +SQL Alchemy +Ġpr erequis +CM ake +ç» Ĩ +ç» Ī +created At +Default Position +cb c +Ġbegin s +ı m +SA FE +ĠTH L +ĠAR M +192 8 +orn ers +SET UP +ĠRequest Exception +Ġnb rs +mid point +ĠUpdate View +к ов +/> ` +Ġ'{} ', +Ġ'{} {}'. +topic Name +band structure +One of +DD D +Ġaccept ance +And Dogs +è® ¿éĹ® +hot as +Ġcost e +TA U +DEV NULL +áº Ń +balance Of +poly line +asci ic +ĠMo on +ĠColumn Expr +Ġpl anner +cour t +HTTP Server +Ġcar regamento +205 7 +Ġtool box +ä¸į æĺ¯ +aj es +Ġendpoint List +215 1 +215 4 +qt bot +VC p +ĠClient Session +Ġretri eval +RGB n +Parse FromString +ä¾ § +Ġctsp Layer +bra ce +ĠEvent Settings +čĊčĊčĊčĊ čĊč +PN L +ĠTra ding +193 6 +193 7 +ĠDate time +ðŁĩ § +çİ ī +ctsp ConfigSgaclMapping +234 7 +Ġpublic ations +(', ')[ +PA I +Ġlinewidth s +264 5 +Ġexpand user +see also +217 2 +232 9 +Real loc +Arg us +ĠPh ysical +Ġmag ma +Ġgre eting +301 9 +132 8 +ĠModule Compliance +Ġsy nthesis +æķ°æį® éĽĨ +Symbol Pair +men ubar +æĸĩ åŃĹ +ĠMO V +('< @{}> +Ġagg Reports +('[ ^ +Encoder Policy +Ġresid ues +299 7 +follow s +315 5 +HA VE +saved ir +visit ors +225 2 +225 8 +ko i +Render Target +trip let +212 1 +Translation Bundles +LT I +prote ction +308 4 +ĠInt ent +424 2 +397 1 +mx net +286 7 +Ġcc j +Ġcc rs +Ġ"* ": +Ġden ied +Ġaz imuth +Ġ---------------- --------------- +cod able +ĠBlock chain +[] "," +ĠQuery Privileges +Ġí ħ +284 1 +233 8 +292 7 +д ал +ĠExtra cts +334 8 +sock s +ç§ ij +é¡ » +upy text +VIS ION +Ġer ro +regular ized +Ġelect odePlotWidth +Convert ed +Ġcy ber +Ġcy thon +Ġrepe ating +lig ibility +Mac OS +Ġwatch ing +Ġcri me +ภ£ +à¸ Ń +dri ven +Ġnotebook s +tty USB +/* ', +Monitor ing +Sampler Transformer +ĠOper ational +Fore ground +ĠParse Error +Ġcum sum +XML Schema +wire less +ółĢ±ółĢ ¸ółģ¿ +'[ ^ +emo tion +MED IUM +gd rive +ĠdocsLoadBal ChnPairs +LAN DS +ĠTry ing +é¢ Ŀ +prep end +Ġsat ur +ĠUN IT +Ġvirtual env +middle wares +ðŁı´ółģ£ółģ ¤ółģ +ðŁı´ółģ£ółģ ¨ółģ +ðŁı´ółģ£ółģ ®ółĢ +ĠIM AGES +298 2 +NF KD +ĠApi Exception +Measure ments +Lane No +Ġtrust ed +epe st +Let BindingTerm +Let BindingGTerm +Lat ent +Ġ#-------------------------------- --------- +Avg Loc +Ġgap ic +WITH CHAINLOCK +ż y +ĠìĿ ¸ +èª Ń +music Directory +AGC AGC +TW O +Ġ ° +CHAT ID +Ġfriend ship +PACK AGES +ĠLogin RequiredMixin +ADMIN S +bv dev +ĠIntel ligence +TI LE +aren te +Ġeg onet +ðŁı´ółģ°ółģ ¥ółģ +hal os +ĠAdmin istr +Ġamplitude s +Ġqual ified +Std out +éļ Ķ +reach ability +ĠBit size +Ġoct et +Ġ#------------------------------------------------ --- +ãģŁ ãĤģ +Fetch ing +efficient net +slider Released +ĠRot ate +San ta +associ ations +mob i +ĠPackage s +该 åŃĹ段 +Audit Engine +ĠWH AT +ĠWH EN +Ġalle les +ав лÑı +Ġban co +ãĥª ãĤ¹ãĥĪ +Health Check +ALPH ABET +ĠAre as +¹ółģ ¥ółģ +ĠSpark Context +Decoder Policy +ĠCy thon +æıIJ ä¾Ľ +éĥ¨ åĪĨ +ĠMc Gill +SHORT ANS +ilo meter +çĪ ¶ +epi log +Ġcalib rated +(',' ): +Quantum Tape +Ins ights +heter o +IDAT X +Ġdestroy ed +ĠTimeout Error +èİĬ ä¸Ĭ +ÐŁ ÑĢ +Eff Var +ÅĽ Äĩ +æİĴ åĪĹ +mst pX +Ġreact ants +Ġdut host +RMS F +å¿ħ é¡» +pyg ments +tsk dict +ĠMigrate Command ++---------------- -----------+ +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXX +Mad ison +Elt wise +ĠOff set +ROT ATION +%%%% %%%% +influ ence +ĠIndi cating +ĠBootstrap Core +extrapol ate +Ġtit ulo +ĠIo T +æ¢ Ŀ +Ġgir iniz +ĠRich ard +ĠDash board +shant ins +$$$$$$$$ $$$$$$$$ +^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^ +kine tics +Operational Error +导 åĩº +WHIT ELIST +SUPER VISOR +9265 35 +ĠGB OL +Pay ments +Ġaus pex +ORGAN IZATION +Smecti te +Quad ratic +ĠADDR ESS +Tran Power +receiv ers +ĠEurope an +ðŁı´ółģ¦ółģ ²ółģ +èµĦ æĸĻ +ĠDetail View +EXECUT ABLE +cels ius +BUIL DS +ĠStrict Version +ĠMembers hip +Decl Cmd +ĠAggreg ate +ĠMAT RIX +2497 8387 +Ġdefect s +åİĭ缩 åĮħ +GEST URE +Ġhuge ctr +âĿ Į +ancell ation +åĺ į +sciss ors +DEPEND ENCIES +Ġzer oth +é¾ į +ï½ ŀ +Ġkullan ı +ĠTex as +Ġmols ysmt +è¥ ¿ +ĠAbri go +Ñĥн к +è´¦ åı· +loadError Json +RETRI ES +subscri bers +romiss o +ĠDJ ANGO +1000001111 00011111111 +Ġæı IJ +æĿ± 京 +Ġhaz Name +Recv Power +Ġvertica py +dhcpSnpDb Stat +Ġ+------------- +---------------------------+ +ĠMOR NING +NameTo Id +Almost Equal +Ġæ¨ ¡ +BLOCKHEADERS WITHCHAINLOCK +ĠAccord ing +0110101101100101 0101111 +016292 24978387 +intDiv Val +ListIssue Templates +PerPrimitive UnitCell +mstpX st +01629224978387 3558 +' """ +' "{ +) '], +) $') +) $") +- _ +2 107 +3 024 +3 117 +3 133 +4 173 +5 21 +6 0000 +6 80 +7 38 +7 83 +8 0000 +8 2656 +9 100 +9 146 +? (\ +A h +A sh +A IB +A na +A ov +B urn +C lo +C our +C CO +C IB +C apt +C LEAR +D an +D pt +E ste +E igen +F ac +F act +G AS +H c +H LL +H flow +H Num +H TT +H KEY +I ED +I OT +I mag +J G +J j +J t +K Q +K WARGS +L eta +L AMP +M el +M ats +N LL +N FT +P atterns +P refs +P agination +R ts +R cd +R PN +S tra +S ends +S REQUEST +S IBLE +S WITCH +T c +T AR +T PI +T runc +T runk +U Qi +V ap +V ci +V pi +W m +Y R +Y e +Z F +Z Q +[ +] +] ')) +a U +a as +a im +a ep +a ov +b P +b fs +b reed +b unch +b osity +c ass +c fa +c ale +d or +d al +d am +d der +d tr +d rt +e M +e str +e ther +e ligible +g ig +g reg +g fp +g Rpc +g Sfp +h B +h Q +h R +h ire +h anced +h EI +h undred +h renheit +h ysds +i O +i R +i ag +j ay +k z +k ers +k size +k df +l umi +l relu +m mi +m vr +m ountain +n file +n points +n rb +n vidia +p val +p ac +p ens +p bar +p cluster +p vc +p lugs +r G +r ch +s ct +s op +s ab +s da +s zz +s lugs +t E +t put +t value +t weaks +u pe +u co +v lines +v center +v ana +v endors +w M +w N +w U +w is +x link +y proxy +z ion +z el +z order +| : +} ]: +~ { +Î ¾ +Ñ ij +à § +â Ĥ +â ħ +â Ĩ +ã Ħ +è İ·å¾Ĺ +ë ŀ +ì ¸¡ +ð ¨ +ĉ čĊ +Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠ +Ġ ance +Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ñı +Ġ 为 +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ãī +Ġ åħ¨ +Ġ çĤ¹åĩ» +Ħ ภ+ı Ļ +ķ Į +ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +er ical +on Button +at m +at NameList +re du +re deem +en p +Ġt def +Ġt ube +Ġt issues +de activate +de limited +le xe +Ġi bm +Ġ' --- +ti o +Ġc nf +Ġp u +Ġp ch +Ġp and +Ġp pp +Ġp iles +Ġp ágina +Ġf em +Ġf av +Ġf avorite +he me +it rix +Ġa pk +Ġa pr +lo la +00 55 +ce c +Ġs se +Ġs ce +Ġs ich +Ġs ane +Ġs mac +Ġs cour +Ġs naps +ur q +Ġin jection +Ġre gs +Ġre used +Ġd ps +Ġd sn +un if +un install +un quote +Ġm cast +Ġe ur +Ġe cc +Ġe du +() }" +", \ +co uri +co lare +ri ers +Ġb is +Ġb cb +Ġb lood +Ġ1 065 +Ġ# _ +ed dl +11 97 +11 28 +um ar +um ination +int bv +int elli +Ġ( + +Ġw aves +ch ang +ch lor +ch anging +te i +te o +ata b +Ġ[ (- +ma j +ma v +ma ima +ma ya +ol ink +el ve +is Valid +is Opened +get frame +get boolean +get Setting +(' ` +(' [-] +(' =') +)) >>>>>>> >>>>>>>> +("," )) +Collect ing +ĠVALID ATION +fiber flat +Ġalbum s +ì² ´ +enrich ment +proton s +cpwVcPerf Interval +Ġinvent ed +ĠINST ALL +Reflection Pad +Ġapproximate ly +Ġзап ÑĢоÑģ +管çIJĨ åijĺ +ĠDynam ixel +lamb das +ĠHist ogram +IOHeavyTest In +个人 èµĦæĸĻ +Ðł еÑģ +åĩĢ æµģåħ¥ +ĠVital ID +Ġextr usion +æ£Ģ æµĭ +ĠMyCustomAmazonReview ACLDataLoader +BET WEEN +ĠFAIL URE +Ġpyqt graph +Ġmort ality +paralle lism +Ġmeme ber +ĠFileSystem Loader +ĠDiffer ential +ĠAtt entiveFP +ĠSoft max +Piggyback MsgRx +Piggyback MsgTx +bir ds +Ġpem file +ĠRedirect View +Ġarrange d +docsLoadBalChgOver Status +éĩĩ æł· +puls ars +LST MCell +Ġbay Stack +zhi hu +ĠRobo tics +ĠRandomized SearchCV +ĠRand Augment +Cats AndDogs +ĠÑģп иÑģ +ĠFran cisco +æݧ åĪ¶ +Ġsaf ely +Dial ect +Npu NumberFor +bys hev +ĠHEL P +favor ites +ĠPersist ent +Above Elev +SAV ED +FRAG MENT +Ġetr m +Below Elev +Monster Behavior +éģį åİĨ +CEE DED +ORIT HM +ĠKiki Pos +SCY LLA +1100100010101111 100111 +Ġ+------- +----------------+ +ĠENT ITY +озв ÑĢаÑī +ĠrwMotor Torque +ĠTERM IOS +ĠisReverse Complementary +Rmon Control +--· --· +isle mleri +lograph ic +ĠUQ py +zyf lie +Oneof Descriptor +ï½ŀ ï½ŀ +Ġbcb io +ĠSCRE EN +ĠSCY LLA +addIndex Value +ĠatLeast OneRequestDone +FileCopyright Text +ENSEMB LE +NpuNumberFor Drop +! ? +% ) +) _ ++ -------------------------------- +, ))) +- * +. {}'. +1 923 +2 096 +2 124 +3 168 +3 103 +3 137 +3 106 +3 119 +3 112 +3 162 +4 103 +4 146 +4 156 +4 235 +4 139 +5 81 +7 82 +7 60 +8 6400 +9 325 +A FL +A sia +A APL +A rena +B b +B ans +B ins +B sm +C le +C ant +C US +C PL +C GI +C ategor +D j +D ar +D PI +D CI +D ASH +D tlb +E y +E VEN +F AC +F AB +F ids +F lorida +F ollower +G m +G el +G ho +G lob +H oc +H AD +H ey +I FACT +I tlb +J nt +K d +L uc +L RS +L ARGE +L ittle +M q +M ars +M illi +N PT +N Bo +O VE +P end +P cs +P LL +P ressed +P ae +P otential +R ID +R AL +R SFP +R apid +S ter +S mo +S ongs +S LOW +S Ãī +S ensing +T out +T cp +T ouch +U ED +U ndo +V qt +\ ( +] }. +] +'_ +a ft +b O +b last +b ial +b ets +b plus +d gl +e book +e Source +f val +f acing +h N +h os +i L +i ap +i fies +i ÉĽ +j ds +j dk +j dbc +k S +k ur +k ps +k var +l val +l ush +l shift +m set +m tr +m art +m inter +m angle +m ush +m fc +n ch +n col +n pi +n arr +n asa +o ve +o vi +o fa +p U +p de +p ig +p ong +p jax +q g +q us +r A +r ut +r ndr +s dict +s io +t T +t mpl +t gz +t instead +u func +u fe +v H +v at +v rs +v lad +v iterbi +w Q +w ant +w kt +x V +x h +x ray +y v +y test +z ef +| ', +} * +} """ +} (\ +} '). +½ ij +× ij +â Ł¨ +ç ĵ +è ŀ +é ¥ +ê Ļ +ì ħ +ð ¤ +ĉ Ċĉĉ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ quest +Ġ ))) +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ö +Ġ æľĢ +Ġ Ïĥ +Ġ ä»İ +in ch +in fty +or re +on ia +at tractor +st in +st uck +st deriv +en ic +en ow +Ġt test +Ġt ink +Ġt mx +ar l +ar able +de fi +de lt +de coders +de posits +le gs +le ading +an cho +Ġi loc +Ġi cs +Ġ' > +ro se +ti zer +ti ous +mp AdminString +Ġc B +Ġc up +Ġc if +Ġc ob +Ġc cs +Ġc rypt +Ġc lears +Ġc rops +Ġc AddrBits +Ġp name +Ġp am +Ġp par +Ġp ump +Ġp erspective +Ġp aginated +Ġf u +Ġf ul +Ġf ingers +Ġ" ', +Ġ" (% +Ġa ic +00 24 +ge ology +Ġn j +Ġn ation +Ġn df +Ġn row +Ġn vars +Ġn itro +Ġs ul +Ġs lab +Ġs lc +Ġin ch +Ġin ic +Ġin finity +Ġre ti +Ġre da +Ġre levance +sel inux +self Test +ing o +Ġo vs +Ġo obR +Ġd T +Ġd ones +un as +un publish +un seen +ra sp +Ġe gress +Ġe qs +la c +la red +() `. +fi fty +ent ree +co se +co ustic +Ġb ml +Ġb ps +Ġb orn +Ġb road +Ġb orders +Ġb illing +Ġb ombs +11 99 +11 17 +Ġ( :: +Ġw gs +ch air +te ta +te kit +ma a +Ġfor am +is wap +is atty +val e +get Element +(' ---------------- +(' {}. +)) *( +set mode +set Current +Ġ- * +ĠT f +ĠT x +ĠT isserand +con tr +Ġ2 64 +Ġ2 97 +Ġ2 75 +Ġ2 82 +Ġ2 59 +arg er +ve led +ve locidade +Ġis r +Ġis lice +Ġ7 84 +Ġ7 50 +ĠS on +ĠS py +ĠS uc +ĠS IDE +ĠC SR +Ġg name +Ġg file +Ġg lu +Ġg ates +Ġg mtime +Ġl una +end ent +end Of +data frames +data sources +ĠA mb +ĠA LI +ĠA FT +ĠA SS +ĠA waitable +01 32 +01 94 +01 35 +01 65 +Ġcon sent +ic mp +99 00 +99 92 +99 75 +path o +ĠF OLD +od on +qu ench +log log +list e +Ġh u +po b +ta cc +ĠP G +ĠP norm +ĠP ants +ĠP mod +ĠP ink +ĠP anel +ĠP SL +ĠP oker +Ġas yn +ĠI IS +ĠL OS +res on +Ġth ermo +Ġst p +Ġst ator +Ġst eward +Ġde sp +Ġde vs +est he +ex clusions +im ming +Ġ3 36 +10 55 +10 63 +ĠD ry +Ġu ic +Ġu fl +sh u +sh all +ĠM ID +ĠM ich +ĠM DS +ĠM atches +ĠM ah +ĠM usic +ĠM aps +key code +key press +Ġv ap +Ġ_ | +Ġ* ' +Ġ* \ +os u +Ġse gs +Ġse ja +test set +Ċĉĉ Ġ +ER IAL +Ġel m +Ġel ite +ms k +ms vc +tra c +Ġfile List +py n +py dicom +py bedtools +pre order +pre sets +pre proc +ls l +07 87 +07 26 +label Slider +ES SED +Ċĉ ĠĠ +ĠB K +ĠB S +ĠB an +ĠB ra +ĠB ed +ĠB ET +ĠB ug +ĠB rand +ĠB undle +12 16 +12 15 +12 64 +ĠE PAN +Ġj est +Ġj ew +Ġ< > +ly de +AT ATT +xa xes +ĠN x +ĠN ut +ĠN ight +ĠN EC +ĠN inja +ĠN evada +num Pixels +################ #### +Ġres i +Ġ4 08 +Ġ4 20 +ff o +lu de +lu tion +col ha +col lie +In fin +In vest +append left +ĠR am +ĠR MSE +Ġun load +Ġun do +32 05 +32 03 +32 85 +32 56 +32 768 +per plexity +oc aml +ĠG W +ĠG f +ĠG el +ĠG lob +ces o +Ġco o +Ġco digo +Ġon set +ĠW al +ĠW riter +ĠW ALL +ĠW CS +ĠW omen +ĠV endor +ĠU ART +code point +Ġ5 53 +ib e +Ġen gines +18 01 +18 85 +18 44 +18 69 +16 66 +16 54 +sa uce +da veo +'), ' +Ġk inds +Ġk ills +25 07 +25 27 +25 94 +25 68 +25 41 +(): . +Ġ6 000 +13 04 +13 75 +og rad +og LeNet +06 97 +lif x +ec tiv +ass ador +Ġch mod +ĠĠĠĠĠĠ ĊĠĠĠ +17 06 +17 08 +17 36 +93 55 +14 11 +14 17 +14 40 +ne u +ok es +Ġra z +Ġra ys +ou lomb +gra fana +:// ', +RE POSITORY +Ġtra cing +Ġtra bal +08 05 +ðŁ ¦ +22 29 +22 62 +Ġ\ ____ +ĠH ack +ĠH over +ĠH ADOOP +ĠRe member +ĠRe presentation +ĠRe curring +sub directories +ml vq +Ġsh ap +db i +88 44 +19 08 +19 79 +comp ilation +comp eti +Ġsc ls +Ġsc enes +Ġ` -- +34 84 +34 45 +34 83 +34 68 +pos dis +09 06 +nd ctl +inter conv +ant in +gs E +bin list +arch itectures +Ġax i +Ġconfig uring +24 04 +24 84 +24 96 +24 55 +24 26 +24 52 +37 46 +37 43 +37 69 +Pro x +Pro ceed +em ulator +Ġsub module +Ġsub system +rep orted +Ġcomp ass +ĠCon an +94 98 +33 13 +33 37 +33 56 +33 54 +DE AD +RO WS +av o +av is +no data +AL LE +Ġclass method +Data Class +AS Rs +{} * +36 99 +36 64 +36 36 +36 76 +36 79 +011 000000 +Ġopen mc +ĠK M +return List +word tag +86 92 +stra ction +26 12 +26 13 +26 38 +26 31 +26 59 +26 62 +Ġmax v +Ġmax size +Ġmax lon +Ġmax Version +57 93 +57 64 +57 37 +Ġext er +ED X +Ġper plexity +group dict +ele e +ele phant +Text Stim +23 54 +23 59 +AC CC +AC Rs +Ġli p +44 11 +44 15 +44 09 +44 62 +44 72 +IM O +Ġdis connected +80 92 +cor relations +Ġrun times +']) ), +En forcement +28 19 +28 38 +28 35 +28 29 +ET ASK +so v +cal cular +56 93 +98 64 +38 14 +my db +pop ularity +******** ** +Ac tiv +Ac cessed +Ac quisition +UR S +UR ANCE +ĠQ SFP +ĠQ ubit +ĠQ LineEdit +Ġcolor Space +35 17 +AB L +AB ORT +AB OUT +olu ção +Descri be +Value Suggestions +pri vileges +))) / +Ġad m +Ġcurrent ID +Ġcurrent Time +45 47 +45 29 +ĠAN ION +ĠAN SIBLE +Ġarg us +Ġbase ball +ong ue +]] = +core g +command er +top obank +Ġsk f +Ġone hot +Ch icago +}) ; +Sg acls +host ed +46 97 +ĠJ ar +ĠJ SD +Log Trx +Num Samplers +Num ClassInstances +ome d +Ġdire cao +assert Command +Un recognized +Ġq i +Ġq q +TH READ +tag Name +TR ICT +TR UNC +ost ream +Config Value +Config Dict +Config Ipv +sign alling +graph Types +MP NN +Ġup grate +Ġcor related +Ġcor rupted +ĠPro c +CL ib +search ing +sv ps +Ġqu ando +Ġimg w +Ġimg ui +ĠData Generator +ze isel +TT A +TT S +('-- -') +iss ame +Ġfull name +Ġwork dir +post code +cli ques +parent dir +Get NumberOf +Get EstimatedTransactionFee +game events +rect angles +Add NodeOptions +31 92 +src dir +mer id +Key Suggestions +Ġobj eto +vector ize +ĠCo ordinate +Form Set +OL ane +edge pair +Ġab ri +ART IFACT +Ġfield name +Out line +Reg istro +Ġlocal time +Ġsign s +ãĤ ¨ +Ġdest e +Ġdest file +Ġ16 00 +Ġbin ar +User Data +User Warning +Ġman ila +âĢį ðŁĶ +ĠDe mand +pen di +ĠRes olver +Th erm +PL N +Ġblock devs +ĠUser Serializer +If Not +Up loaded +Sh op +Sh adingEngine +xml ns +fra ctions +ĊĊĊĊ ĊĊĊĊĊ +dot ControlConfig +49 64 +DB lob +sim o +202 9 +}\ ' +binary Object +Ġfont properties +300 9 +åĪ Ŀ +Ġtri vial +ĠjnxMbgSgw DelBr +ĠjnxMbgSgw ModBr +gg Number +App Config +App roved +TE CH +era ise +Ad dition +Ñģ Ñĭл +inst agram +az a +hed Types +':' ', +For Question +Ġref dict +Ġref lected +PR F +Ġret orno +ä» Ģ +Net V +Net Lemmatizer +Pre ferences +Ġpost ag +GR Q +ç amento +Ġfin Dummy +Result Status +sig y +dat atable +dat aloaders +dat aroot +LOG FILE +Ġ// = +Ġì ² +Ġsql model +light bus +gb ncc +GB P +Ġcluster Id +Ġvar name +]+ )? +sen ior +FILE PATH +supp lies +Ġsee also +Ġstat istical +br ute +Ġauthor ize +Or tho +dx i +Ġvi olin +Ġresp rocessing +ĠComp uted +ĠComp arison +imp ropTors +"} ') +SON ATA +xbb v +Load Q +cf Query +Ġest i +none xistent +Ġsuper cell +vers ation +,\ ; +ĠTime slot +cla de +mk ccj +Ġold Map +!! !") +ĠPo inter +ĠPo lice +FIG URE +normal ise +å® Ł +neg ated +js ch +MM M +Do ing +vol ving +region al +Method Type +cr ust +zy x +Ġcore g +Ġsig s +ĠAt tack +Min us +Ġtr j +istri bution +Char ges +ĠAl m +ĠAl ter +Source Sgt +ii i +Ġreq parse +elect ra +Ġfast q +bi li +å° ģ +freq Arr +è¡ Ĩ +ĠAd aptive +initial ise +Version s +Ġ'+ ': +SP ACING +Ġcoun ties +Ġreal path +Stream er +Stream Encryption +Ġmod ulo +ĠTrans late +Ġfill er +ev in +Ġfeed ing +Ġconv olve +Ġactual result +SL Z +404 1 +ĠOpen ing +Ġxml rpc +Classifier Inner +agg io +Ġbit coin +âĢįâ ļ +mis matches +Ġstats d +9218108 169 +192 9 +ĠField Handler +Layer Name +Ġnb format +MAN AGE +Ge orge +)" /> +And Time +plan ets +namespace d +COMP RESS +Page d +Ạ§ +Ạ« +Ag ents +Ġeps ilons +found ation +sy mp +sy scall +Ġcommit ted +ĠLight ning +æį Ł +ĠDi amond +Ġп олÑĥÑĩ +Pass port +Ġri f +Ġtool kit +ä¸į åĪ° +ĠjnxMbgSgwPP DelBr +ĠjnxMbgSgwPP ModBr +ĠjnxMbgSgwIf DelBr +ĠjnxMbgSgwIf ModBr +lm n +215 3 +tar iff +orizont ally +Ġmarker facecolor +Ġbar rier +384 8 +å¯ ¨ +|' # +security hub +ĠAss uming +Track bar +Rel Model +Thread PoolExecutor +Ġdot ted +Ġmaster Inventory +ĠResponse s +Ġè °ĥ +Ġvertex Id +Sign er +positive Rate +214 9 +ĠLabel s +Ġbook ing +Ġev ds +Ġ27 017 +LED GER +234 6 +Ġtermin ating +Role Method +ENS ORS +walk ing +218 2 +Ġna Test +Ġps mooth +Ġpla so +floor div +plus plus +publish ing +232 2 +Sec ure +301 4 +OEO Cfg +OEO Loopback +OEO CurSpdMode +Last Update +Ġsyn onym +Ġsyn onyms +114 9209 +Ġem cc +deg F +Ġsur faces +ĠWith in +hw nd +begin ning +micro phone +syn opsis +("[ +] +Ġ{: > +fb k +207 3 +299 1 +Ġcapt uring +306 8 +306 2445 +ĠDoc s +305 9 +dw ell +nav bar +ye ast +Translation ValueSuggestions +Translation KeySuggestions +corr coef +ste ering +front al +benchmark ing +Debug LogLevel +EY j +Ġrefer encing +286 9 +Connect ing +Sgacl GenId +APP LI +Ġ'* ': +Ġaz ul +Ġaz py +Ġam ber +pdb x +Ġann ulus +Ġ105 7 +hold ings +ĠØ ³ +307 7 +233 3 +revision s +Ġâ Ĥ¬ +236 1 +ĠResource NotFound +Ġfbx Anim +minor ticks +Entity Schema +Tk Agg +Store Q +ółĢ² ółĢ±ółģ¿ +Expr Context +Drop Pkts +pay er +Hub ble +п ÑĢав +REF s +tv db +436 3 +436 5 +Constant Buffers +388 5 +ĠBack hand +237 2 +Ġlab or +THRES HOL +Ġactor s +attack ed +TX LOS +385 3 +aux iliary +omin atim +396 5 +voltage s +ãĥ¼ ãĤ¸ +fm arno +ภģ +cha os +manual Seed +El Right +Monitor Pkts +EVENT S +ĠStorage Profile +bro oklyn +ö nn +ĠOper ations +repe titions +CUR ITÃī +deep lab +RAN CH +Ġinterp QLF +ĠdocsLoadBal Policy +QQ w +("_ ", +314 9 +Ġgain ed +285 6 +Ġ################ # +Ġtun ed +Dest Sgt +WC z +ĠBoolean Field +çİĭ éĥ½ +Hash able +four ier +anim ate +Ġmarkdown s +âĢįðŁij¨ðŁı » +âĢįðŁij¨ðŁı ¼ +âĢįðŁij¨ðŁı ½ +âĢįðŁij¨ðŁı ¾ +âĢįðŁij¨ðŁı ¿ +âĢįðŁij©ðŁı » +âĢįðŁij©ðŁı ¼ +âĢįðŁij©ðŁı ½ +âĢįðŁij©ðŁı ¾ +âĢįðŁij©ðŁı ¿ +Login Status +expl ored +AW SCloud +TRUST EE +LM Head +Ġsil ly +ĠVis ualiz +heap List +æ® ¿ +ĠRest aurant +ðŁı´ółģ¡ółģ ²ółģ +Close st +CONTAIN ERS +Joint State +ĠIdenti fy +968 3895 +Hyper parameter +>[ < +dX V +Ġta iga +Ġ#---------------------------------------------------------------- -------------- +åİ» äºĨ +éĸ ¢ +Face book +food s +ĠCho ices +)}) " +tele metry +ë¥ ł +ç»ĵ æĿŁ +/{}/ ". +/{}/ {}/ +Signal Array +apple seed +ĠPOST GRES +jI y +Fit ted +fq dn +ĠImp rove +ĠEmpty Page +Person al +Experiment al +Gradient BoostingClassifier +Ġmovie py +TRANS FER +99999999 999 +MV OC +ĠCir cular +Ġcas o +Ġspo iler +Ġ+' _ +instr s +priv acy +ç¨ĭ åºı +ØŃ ÙĬ +ĠURI Ref +REGI STRATION +Ġima ging +Ġreplic ate +quick en +ticket s +datal ist +ANAL YTICS +SOL ID +Combin ations +æĿ¥ å¾Ģ +uss ian +Ġclicked Pos +ĠHandle s +éĤ£ éĩĮ +Scope s +å¢ ĥ +Å¡ no +FX LOS +mil lis +åIJij éĩı +ðIJ IJ +strat um +Ġhdr dict +ounce ment +OE OS +OE OLane +ç² ¾ +Ġwiki pedia +³³ ³³³ +ativ ity +Confirm ation +stan za +foot print +osc illator +ASSI STANT +Ġreceiv ers +ĠSele ctor +ĠSele cted +Ġcontrast CH +Ġconven ient +认 è¯ģ +Clip board +Ġ================================================= =============== +Ġcarry ing +â n +åĸ Ŀ +ĠHelp Panel +laci ón +ĠHar vard +Ġhor ovod +ĠArti fact +ĠMP NN +Ġbc value +ĠElect ron +ĠBin omial +ðŁı´ółģ¥ółģ £ółģ +uÉĻ j +Ġê² ĥ +Ġcnbtc TradeQue +Ġcool neighbor +Swap Chain +PRIOR ITIZE +Ġorbit al +WI KI +ĠPRE FIX +ĠPress ure +Ġjoined List +("| ") +æĥħ åĨµ +defer red +reh end +Ġnonzero x +ìĦ± ê³± +Ten ant +Æ°á» £ +dee med +绣 计 +GPL v +ĠHead ers +FileSystem Loader +cone ct +ĠRET URN +æķĻ éłŃ +Ġprot otype +convers ations +tR NS +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX +ĠDimension s +íĻ ĺ +CAS CADE +accs fp +MOUSE BUTTON +PLAN ET +Ġconti guous +ĠMON GO +ĠAssoci ating +Ġinfra structure +Ġtit an +Ġill uminant +ĠDiag nostics +OEOHW Loopback +OEOHW SpdMode +bread cr +deno ised +ĠDIST INCT +Ġmess aging +Dih At +Dih HAt +ĠOPT IONS +Ġsequ ana +ĠWrap ped +Ġзап иÑģ +çĦ¶ åIJİ +MID I +Ġnex infosys +ĠMagic DAQ +ĠCommit ment +⣩ ⣨ +ĠfuniIf Conf +Ġdigital io +ĠPublish er +íĥ ľ +æ£Ģ æŁ¥ +Ham iltonian +å±ħæ°ij æĿ¥å¾Ģ +Ġincid ents +Ġrela xed +Ġmarg inal +Ġinvest igate +Ġdra gon +ĠMul an +ntw Type +ĠScra pe +Bed Tool +sie ves +Ġtemper atura +conflict ing +ĠUsu ally +Ġseper ated +Ġlibt bx +âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ +uproject s +Ġdiscri minant +wing Lib +withColumn Renamed +qwe qwe +STE WARD +ĠíĮ Į +Ġant lr +Numeric PasswordValidator +ĠWiki pedia +Similarity Validator +Cod ing +SLA VE +decon z +Ġsau v +VCV S +éİ Ĺ +Ġcó digo +Ġfancy box +æĬ¤çħ§ 个人èµĦæĸĻ +pez oid +getApp ointment +ĠAmp litude +bnf Suffix +ĠprivateKey Selection +ĠMultip ly +Ġvic tim +Incentive Proposal +Ġê¸ ° +ĠLANG U +Ġrab bit +ĠEXEC UTION +ĠNAMES PACE +Entrypoint Options +;^{ ;^{ +Gest ure +ĠMyResource Group +Ġamend ment +éĢļè¡Į è¯ģ +åł´ åIJĪ +çĹ ħ +Ġ*| ", +åķŁ çĶ¨ +Gro File +Relevant Status +ĠæĽ ´ +Cyber CP +Ġíķ© ìĦ±ê³± +Ġbary centric +Ġalla uth +LISTPOMERIUMSESSIONS REQUEST +Gromacs GroFile +anç as +Ġminter ms +cmdLine Vars +bige vents +Ġæµ ĭ +Opa que +ĠUrn en +KUR AI +ĠElem wise +Unordered Access +ĠSOCI ALE +00407 3062445 +82656 1149209 +couri er +UserAttribute SimilarityValidator +Locus Filters +Ġbelon ging +ĠLEAR NING +00000010011111111011 000 +Fids InList +SÃī CURITÃī +ĠEPAN OS +daveo ù +ForQuestion Answering +OEOCfg SpdMode +AWSCloud Formation +æĬ¤çħ§ä¸ªäººèµĦæĸĻ 页 +004073062445 9683895 +826561149209 74 +" [\ +# ; +# ************************************************ +' {" +, }) +. ]]) +. '+ +. `", +/ (\ +/ >< +2 256 +2 888 +2 109 +3 033 +3 114 +3 116 +3 161 +4 002 +4 168 +5 90 +8 999 +9 097 +: {}: +> ))> >" +UN IMPLEMENTED +}) { +Ġar ms +46 15 +46 98 +ĠJ une +Num Val +options Form +source forge +ĠSt ores +ail er +open moc +assert False +Ġformat ters +Un til +Ob servations +Config Group +Config ura +29 32 +29 09 +Ġ`` . +Time slot +Time Step +43 02 +bot ocore +ĠCON STANT +Ġup d +ĠPro site +ĠPro mpt +CL US +INT X +SI E +Ġmatch ers +down cast +91 92 +No Such +ãģ Ĭ +MA INT +е Ñĩ +idd ens +ten nis +Ġwork tree +"> % +post ings +Ġexp ensive +Get Name +Get PomeriumSession +game Node +UM ENTS +xy file +(- \ +39 08 +Ġbreak ing +Ġ", ") +bar o +bar plot +conf ounds +conf ined +aw esome +anti s +cv l +Ġfind ings +dis co +dis sever +LI P +Comp et +send Request +Le et +58 02 +ART S +pr incip +ĠTest Run +ãĤ ´ +Ġbot tleneck +User Time +Ġman im +SS SS +ĠDe ad +ĠDe gree +Ġexec utes +View Data +View port +åı ¤ +ãĥ ¢ +ĠPython Operator +unit ary +ĠUser Mixin +Up loader +ank a +IP ython ++' -'+ +PRO M +202 4 +Request Context +Request Warning +Ġoptim iser +IO MIT +Ġmy func +Ġsim bo +make element +gg plot +Qu otes +Qu antos +################################################################ #### +################################################################ ####### +App lications +=[' -- +ĠCh i +Ġmark ing +optim iser +Ad ditive +lack py +az ine +tax id +feature list +ĠMe V +VE C +}" ' +}" } +Ġ$ " +ĠBase TestCase +ĠMan ual +tt t +ĠAdd resses +åħ į +Ġparti das +Ġign ite +Or More +Ġopt parser +ĠCol lector +Ġpe la +multi line +single band +POST S +mk stemp +ĠTe mplates +ret ro +loop back +vari ability +Mo on +seg u +Output File +ĠLI R +custom ize +ĠEX AMPLE +Ġwait er +prop ag +Map Entry +Ġtx id +success fully +Ġglob ally +æĺ ł +ठ® +Ġpad s +ĠAc counts +Ġunique s +á» Ł +FR ONT +Ph s +Ph enotype +cr h +ĠDefault Router +0001 01111 +Total Sim +Protocol Error +SO LE +Ġhash ing +Min imap +Ġconnect ors +Struct ured +ropo lis +Ġast ute +Ġast node +Ġdat adict +Graph QL +CHE BI +ĠSh ift +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +SP OT +car la +Over flow +high way +PRE CISION +prev dir +004 1666667 +åĽ ī +boot loader +ĠQu at +Red shift +Ġ"{ (' +Ġ? ", +mis matched +pn l +åį ł +Property ParamRegistry +EC P +å¾ ® +Sa hana +192 4 +Ġmost re +------------------------------------------------ ------ +éĩ Ĭ +Open AL +Ġcat an +cid rs +Ġ'{} _{}'. +safe string +Ge ometric +Ge orgia +dy lib +plan ar +inv olve +916 8 +COMP UTE +Ạ¹ +Ạ» +ĠMo vie +ĠMo zilla +%% ' +################################################ # +ĠColumn Transformer +Ġfetch er +OM IT +ĠText ualConvention +Ne utron +205 1 +numer ics +Ġpresent ation +Dec rypt +rup ts +ĠIniti ate +ĠRo ad +Parameter ised +Plot SnapList +}] ' +}] ") +ĠDec ision +ĠConst Tree +Ġexport s +Ġexport ing +IV O +384 4 +Mod Sec +nc bi +211 6 +regex es +equ alize +reat he +ĠTra kt +Ġupper bound +ä¹ ĺ +ä¹ Ŀ +buy ing +Bl k +Cmd Status +Ġè ½ +193 3 +193 4 +Change Form +NAM RES +234 9 +Ġeven ly +è¡Į æķ° +Ġstatic method +Serializer Mixin +Stat uses +218 8 +Fin ance +206 7 +206 8 +Ġmenu Text +297 9 +appro ach +dog park +Stop ped +Ġ--- " +bp f +Symbol Context +Ġsur vi +ĠParameter Name +âŀ ŀ +Left HoppableLocList +ĠWeb hook +AE P +../../ ../ +NET LINK +Ġprovider Lines +Ùħ ÙĨ +ARG UMENT +BY L +306 9 +ko on +305 6 +305 7 +nav igate +------------- ") +SUB MISSION +Email User +UK h +Linear SVC +Cor elli +mas ke +ĠInt Var +424 0 +LIN UX +Ġsv d +ðŁı´ółģŃółģ ¥ +Api Exception +287 6 +MR R +ĠØ ® +Auto ML +ÛĮ ا +233 1 +Ġorgan isation +406 9 +ĠMain Engine +422 2 +Ġdic cion +uel le +å¸ Ĥ +executable s +ĠSign ed +macro state +426 9 +303 9 +Ġк аж +385 9 +CREATE CONTAINERMESSAGE +mal loc +ан и +ĠCA ST +ĠBar ry +ðŁı´ółģ´ółģ ¤ółģ +HOME ASSISTANT +Product s +ĠFilter ed +ãĥ¼ ãĥĪ +ĠMem Box +386 1 +occ ure +dj f +Ġmail box +ĠSci py +?? ? +Day light +ĠLin ks +Fo od +Fo oter +Qos MIB +gap ic +Ġretain ed +Ġsoft tabstop +verti ble +ółĢ±ółĢ ·ółģ¿ +deep ct +adi abatic +opp ortunity +Ġ-------------------------------- ------------ +Ġpartition ed +ÑĨ иÑı +Ġones ided +Ġregist rados +çķ ª +Ġ56 24 +Ġpm ids +Ġwater fall +perf ect +Ġrl lab +285 2 +Ġ################ ############ +ĠBu y +ĠSw ift +Make file +çİĭ åĽĽ +Ġи м +SIM ILARITY +ĠDep loyment +Ġincrease d +Ġnav igate +302 8 +Ġsan itized +Equ il +prun ed +SPE ECH +ĠPR INT +ĠEngine Client +expl ores +Ġuniform ly +ĠAP IT +Ġ104 0 +phot ometry +**************************************************************** **************** +ĠProduct s +Ġcd na +æı Ĵ +Cir cular +Ġqt py +ships Api +Ġvertical alignment +restri ctions +Click House +morph o +Ġhuman ize +='% . +Ġtran sect +Ġexecutable s +íķĺ 기 +Ġ================= ======= +Ġincrement ed +GRAY SCALE +438 3 +Package s +Ġìł Ħ +Ġcare ful +ĠAbstract User +ĠTransl ator +ал ÑĮ +cro uch +ε ι +ĠInte gral +å®ŀ ä¾ĭ +autom ator +MAT ERIAL +Ġpys at +Ġpay ments +TRANS FORM +éĺ ĪåĢ¼ +Star shipsApi +Ġcommunic ate +stub ber +Ġlongitude s +ĠUnicode DecodeError +campaign s +Ġlot s +ĠClean ing +ĠSM OTE +缸 åIJĮ +ĠSchedule d +ELL OW +Ġreach able +Hist os +ın ız +ĠLearning Rate +æĮĩ 令 +éĽĨ åIJĪ +ĠPub Med +conver ge +ĠJan uary +Commit ment +Ġhouse hold +æ¯ı 次 +Aut omatic +ĠAli as +éĤ£ å¾ĮçĶŁ +lk ml +recomm end +POOL ING +Ġrepeated ly +ÏĦ α +MATCH ES +.+ ? +integr ity +ĠPop ulate +ï¼ģ ') +Fl ush +ĠSeri alize +nic ity +ĠSun day +Ter ms +Ġíķ ¨ +Sat uration +Ġdeci ded +交 æĺĵ +ÑĢа ÑĦ +Tor rent +ĠSC ORE +FileType Code +çŃī å¾ħ +çĪ ¬ +ambig uous +ĠArti ficial +ĠElect rical +æ¶ ² +Ġmirror ed +sear ches +Ġoccup ants +Ġinteract ing +Ġlic ence +heter odyne +Backup Info +Ġsector s +Ġvary ing +fine x +Ġsus pend +domin ated +åĪ© äºļ +Ġproportion al +Ġpert urbation +ĠPER FORMANCE +aio http +Ten cent +Ġо Ñĩ +implicit ly +ssim ilarity +Ġresample d +Ġegg BB +Leg acy +ĠJS Class +iner tia +Through put +paint Result +Ada pt +Tape Sites +Ġyolo v +unte ers +REPLACE OPTIONS +Ġrear range +ĠMal ware +ĠMON TH +ĠAssoci ated +Ġgm sh +//////////////////////////////// //////////////////////////////// +Ġwik ilink +ĠIMPORT S +ĠIMPORT ANT +Ġimb learn +Life Cycle +éĤ® ç®± +Simp lify +Ġunders cores +refine ment +pager ank +Altern atives +VERT ICAL +Identi fication +é¢ij çİĩ +Expect ing +Foot Control +Ġrobo tide +Transl ator +mne monic +flood Reason +Caps ule +ĠPixel StarshipsApi +Ġcrow dsource +Visu alization +Ġ解 åİĭ +Dri ven +Guid er +TICK ET +ĠAdv anced +Ġhypot heses +Ġvit rage +Ġë¶ Ħ +Ġlibt cod +krb cred +entro pi +ĠWik idata +comput ational +sth rough +Ġhou ses +ĠÑĩиÑģл о +Ġú lti +Ġfram erate +ifn def +Ġhydro gen +categor ized +lou is +Ġnov amente +Pretty Printer +Ban ana +Ġstones oup +áĥ£áĥ ļ +ĠEmp loyee +Ġdiver ged +ä¼ĺ åĮĸ +Ġatri bu +bake Directory +Ġcaracter es +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~ +Grey Scale +Tod ay +Ġspars ity +("================================ =========") +ĠCONTRO LLER +Ġæīĵ åį° +è¸ ¢ +ĠìĺĪ 측 +æ¤ ľ +5683 1817 +NacAppliance MIB +="-- ", +Ġdai lies +ĠDispatch er +Projec tile +destri an +Ġmanti ssa +ĠPreprint View +ĠGnu Painter +generalTracks L +rackspace cloud +ubly Robust +Ġæ· »åĬł +ĠSongrequest Queue +Ġë¶Ģ ë¶Ħ +IMe ssages +Hopping Rate +Ġeffec tively +PADD ING +redb lackpy +ĠOperational Error +drt Time +maima i +Ġmovet obin +éĢĢ åĩº +ĠAFT ER +DataClass DictMixin +ĠQubit Operator +ĠLANGU AGE +IFIX C +ISYM DU +ListPomeriumService Accounts +" `` +) ")) +* } ++ =" ++ )", +, :]. +- ']. +- %( +/ '): +3 128 +3 022 +3 124 +3 345 +4 175 +4 102 +4 118 +4 136 +4 196 +4 155 +4 375 +4 161 +6 31 +8 30 +9 126 +: "): +; ; += $( +? < +@ [ +A bc +B SE +B ug +B ONE +B ubble +B IDDEN +B mV +C it +C CL +C CA +C hess +C ounty +C ACHES +C orners +D LL +D FA +D CAPS +E CC +E Qi +E fficient +E lasticsearch +E EXIST +F UT +F usion +F inger +G RI +G affer +H INE +H dr +H emi +H inge +I b +I ss +J L +J BIJ +L abs +L HK +M ob +M ERCHANTABILITY +M arc +N IL +P AL +P ear +R AY +R DK +R ANGES +S b +S helter +T l +T ac +U W +U rban +V ac +V DI +V END +V oo +W HE +X U +X b +Y B +Z P +_ < +a hat +a Images +a via +a vier +b org +c def +c name +c nx +d vid +d cer +d On +f ut +f url +f ef +f sw +g lu +g ql +g auge +h J +h air +h ui +h rm +h orn +i op +j N +j our +k X +k ka +k ali +l da +m Q +n lat +o eo +p ck +p ype +p allet +p onder +r hel +r fft +s ok +s Type +s net +t M +t am +t ally +t reen +t reat +t ango +u M +u ale +v W +v dir +v hash +v nf +w nd +x en +x ing +y elp +z L +z pos +| _ +| --- +} '\ +¢ ħ +± оÑĤ +¿ ½ +à ĸ +È Ľ +Ï Į +Ö ¼'), +Ú Ĩ +ð ł +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ents +Ġ ESC +Ġ čĊĉ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ############### +Ġ ç»Ļ +Ĵ Ģ +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ ĊĠ +in j +in id +in volved +in finity +in spector +in dependence +er ow +er vice +er tions +or na +at rix +re tail +re loader +re voke +re levance +en vi +en cial +Ġt fo +Ġt ors +Ġt amb +Ġt asmota +ar quivo +al ian +al phab +al arms +le ds +Ġi row +Ġi sso +-- \ +Ġ' ### +Ġ' )\ +Ġ' >' +Ġ' =', +Ġ' ?', +ro of +mp qa +Ġc fn +Ġc opts +Ġc igar +Ġp ue +Ġp int +Ġp set +Ġp num +Ġp gs +Ġp tree +Ġp rs +Ġp loidy +Ġf k +Ġf ol +Ġf ts +Ġf parser +Ġ" ...", +Ġ" {\" +it en +it cho +Ġa mi +Ġa iplatform +lo o +00 85 +00 97 +00 89 +ge of +ge ographic +ort el +ce pth +Ġn im +Ġn oun +Ġn arr +Ġn samp +Ġs dp +Ġs inger +Ġs lixmpp +Ġs leepy +ss ors +Ġin lined +Ġin venio +Ġre in +Ġre index +Ġre loading +Ġre ordered +Ġre places +Ġo me +Ġo grid +Ġd E +Ġd ow +Ġd cor +Ġd du +Ġd ado +Ġd uplic +un u +Ġm ongodb +ra h +ra der +Ġe ep +Ġe book +() ][' +ad ditions +", ), +Ġthe tas +Ġb one +Ġb ic +Ġb sc +Ġb os +Ġb fs +11 57 +rom s +um it +um ina +Ġw it +Ġw dir +Ġw env +Ġw rapping +ch isq +te a +te ss +di ll +and ro +and um +ma ked +ma ko +ma intain +ol ine +ol dest +': ( +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +get url +get Position +get members +(' ## +(' {" +(' {}'. +set var +set ResultStatus +ĠT u +ĠT ranspose +th in +us o +Ġ2 89 +Ġ2 41 +ers hip +pp i +pp in +as dict +as any +as ibility +et V +et os +et cd +ve p +ve ga +ĠS he +ĠS qu +ĠS tim +ĠS PL +ĠS QU +ĠS trip +ĠS igma +ĠS incronização +ab und +ĠC AT +ĠC rop +ĠC ATEG +Ġg z +Ġg ol +for cing +for warded +end Point +data Dir +ĠA ux +ĠA SM +sp ots +ver ses +ver ilog +01 09 +01 77 +ic n +to ok +to Ordinal +to REFs +ĠF re +ĠF lu +ĠF SM +ĠF isher +ĠF rance +sc or +log a +list Pieces +Ġh air +Ġh dfs +** ") +ĠP AN +ĠP PO +ĠP ratio +ĠP ERSON +Ġas sessment +Ġas sembler +ĠI con +file Id +file Dir +ĠL S +ĠL ET +Ġth readed +Ġst ands +Ġde compress +Ġde lays +pro ven +im in +im sd +im ulator +Ġex cl +Ġ3 97 +Ġ3 78 +Ġ3 51 +10 77 +out lets +ow r +ĠD ET +ac id +ac cording +Ġu k +Ġu gly +Re moves +sh adingEngine +sh strtab +Ġdata File +ĠM M +ĠM es +ĠM age +ĠM ic +ĠM ary +ĠM APE +ĠM RIO +nt rack +time Period +ĠNone Type +if o +=" @ +Ġv ous +Ġv sphere +Ġv álido +Ġ_ / +Ġy Max +Ġx n +Ġx link +Ġx Jog +Ġma e +Ġma int +que da +test e +add Callback +xe p +.. >> +ms i +Ġ% > +ON NX +tra iler +Ġfile handle +our ite +xc df +pre parate +pre amble +ap cat +ap tic +ap ages +Ċĉ ĠĠĠĠ +ĠB ell +ĠB ayes +ĠB unny +12 97 +Ġname Split +ĠE th +ĠE Client +ĠE ye +ly t +ĠN im +ĠN ick +bo go +Ġ4 18 +Ġ4 06 +Ġ4 65 +Ġ4 63 +ff tw +Ġget Data +In MsgName +ep oll +Ġun mask +Ġun linked +Ġun recognized +OR ICAL +Ġlog like +Ġlog normal +Ġlog istic +32 00 +32 07 +32 14 +32 24 +32 33 +32 66 +32 67 +ph ia +ĠG G +ĠG ran +ĠG uid +ĠG ym +ĠG Polygon +Ġco gn +Ġon s +ĠW il +ĠW ashington +tri l +tri s +tri tion +tri ang +ho ma +Ġout ros +ĠV ID +ĠV OL +ĠV oter +ĠU l +print out +Ġ5 04 +mb ros +ib G +Ġan nounce +Ġtime slots +18 78 +18 53 +18 68 +16 93 +ft c +sa w +cur dir +cur rencies +Ġk ur +25 03 +Ġpy c +Ġpy py +http log +04 35 +13 35 +13 52 +13 63 +06 12 +06 35 +06 65 +ST RI +max iter +ass ist +03 06 +03 66 +]. ') +ip ype +17 97 +17 74 +Ġal uno +93 64 +ok E +Ġby pass +base Path +gra u +gra pe +count ing +Ġtra des +22 91 +Ġ\ \" +ĠH it +ĠH IGH +ĠRe actor +ĠRe ceiver +np a +eri alizer +][ ( +mat text +sk m +db a +db e +db ref +88 03 +comp utes +Ġsc f +34 07 +34 75 +34 28 +34 46 +start date +09 00 +84 57 +nd Connector +inter fer +bin file +shape d +ann os +24 14 +24 83 +37 01 +37 29 +37 51 +Ġpo em +Ġsub script +Ġsub tracted +96 64 +96 84 +96 56 +96 67 +Ġall close +55 44 +[: ], +Ġcur tain +Ġ} }' +33 04 +33 69 +DE PS +json l +json s +row ning +87 55 +87 87 +AL WAYS +'. " +Ġsys root +85 67 +85 76 +97 08 +97 66 +back prop +net run +36 29 +36 68 +cted Graph +Ġopen cv +Ġopen procurement +ĠK ill +95 12 +95 92 +Ġnumber ing +Ġnumber ed +word press +cri me +00000000 001 +00000000 00000 +86 85 +86 56 +26 82 +26 51 +Ġmax iter +Ġz tp +Ġz max +Ġz mat +Ġz ha +Ġjson Mode +string Value +Ġtrain s +57 36 +57 75 +Ġ[' ',' +Ġtf ds +Res Type +number ed +ix y +Ġbo a +Ġne arly +Ġne ptune +List Of +List Containers +man de +44 22 +44 95 +44 23 +44 45 +44 79 +44 68 +IM A +object Id +RI L +RI ER +Ġend ere +Ex plainer +ET YPE +var name +cal endars +98 92 +FI FO +obj attr +Ġ(' {} +Me chanism +Se a +Ġcan al +35 08 +35 85 +AB c +Col lapse +AD DED +nn x +45 13 +45 87 +45 66 +45 82 +45 42 +amp ire +cent rations +the matic +the ftalarm +ĠY UV +Ġspeci alized +cc a +initi alizing +[:, :] +Ġpos X +pert ure +cy to +Set Color +Set Element +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Test case +Ġevent Queue +Ġone gov +IB M +Ġag ency +wh y +ai able +ai ida +UN ARY +UN IX +UN SIGNED +close ness +rt l +82 06 +PE ER +Log o +ome stic +ĠSt one +ĠSt ory +open gl +root path +Un available +pk a +Ġq rl +TH EN +UL ATED +To Image +To urnament +ĠPy Query +CON SOLE +field name +field label +field entry +sign in +29 86 +Ġ`` [ +43 14 +43 37 +show warning +Ġitem id +Ġcontin uar +ins ula +48 03 +ðŁı´ółģ ¹ółģ¥ółģ +ĠData sets +ĠData Pipeline +42 99 +42 93 +42 86 +Ġright x +Ġpri vilege +Ġpri pis +DAT ETIME +Ġfig SM +ĠÐ Ŀ +Ġinst ant +Max wellCC +post eriors +Ġexp lo +Get X +Get Size +39 12 +39 16 +39 19 +Ġover time +bar rage +bl ing +limit ers +(\ " +"][" $ +ui automator +she ar +Ġframe Dir +Dict Cursor +cmd sh +tick length +MO W +ĠCo verage +less ness +ĠTO pt +Ġshape let +Response s +first Iteration +PP ING +edge width +Ġsupp ression +58 36 +Ser vicer +gr upo +Out Dir +ãĤ ± +ãĤ ½ +Ġ16 000 +User Id +User Form +Ġallow able +CA Q +CA UTION +Ġdep set +åı ī +åı Į +qui ver +cell ent +QU OT +ba a +DB A +URL Y +0100 1011 +(* _ +(* (), +Ġtri ang +Tx n +Ġleft x +Ġsearch er +dec ls +medi ated +dt t +Ġwhere as +256 1 +ĠCh urch +ĠImage Name +Py charm +ĠSim ulated +sort Expr +Ġnon response +FL ASH +ĠLo aded +vm V +active View +drop block +Ġge opy +Pre trained +DS N +------- ") +VER DI +Ġmem ó +dat an +ĠZ urich +non lin +Dis placement +]+ ", +real time +Check out +xde sc +br ing +Function Type +Lib s +display Mesh +VAL S +Or bit +.* )\ +á c +Event Handler +imp urity +Line Search +hand shake +arm up +ĠFOR WARD +Ġmc Ntw +vers or +ĠPRO B +NN P +ling ual ++" ' ++" \\ +ret val +nan std +Ġpub hits +Ġstream link +On tology +Command Line +auto commit +Ġbinary IO +çĶ ³ +tk et +Ġ---------------------------------------------------------------- --- +DR Y +Ġaut otvm +Ġneg ativo +Dir ty +Ph eno +Ph ysics +gh ub +tab u +Ġskip s +xs ct +Ġow ners +ĠAl gorithms +à° µ +EE G +Ġvari ances +Ġassign ing +ĠPre processing +Ġstack s +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ +ĠPer missive +)+ ": +ä¸Ģ è¡Į +ä¸Ģ èĩ´ +å° Ħ +)} ` +)} ', +BASE LINE +gamma s +ĠRE PLACE +car to +basic Preset +IZ ABLE +ĠInteger Field +correct ly +New ValueType +ĠTrans actions +Update View +ev olve +Br Speed +Ġæ °´ +ĠSub scribe +åĽ º +SL UG +Ġlang s +Ġhand s +Ġ19 00 +ĠQu ote +ĠLoc ale +404 5 +CS Nodes +FIL LED +IF ICATE +hidden L +Ġbit fields +ĠInter active +ĠNumber Of +å¼ µ +miss ile +192 2 +192 6 +Ġuuid utils +IST IC +Ġmp atches +Element Exception +Ġho les +Ġho lidays +Ġcomment ed +DEF ER +Ge cko +Mon te +)" ', +Ġpa ssage +Ġap lic +ĠST OR +WE AP +DA I +inv itation +arti al +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ +Ạ© +Ạ½ +}} ", +Ġdes apare +NOT ES +ĠMo lecule +ada ptor +################################################ #### +ĠDes ired +________ ____ +sy ft +Ne ural +Ne arest +205 2 +Ġri gid +origin ator +Req s +ĠNe arest +ĠNe utrino +Ġsigma s +Ġ'< ' +lid ers +eno ise +ĠCont rols +ĠHe ights +âĶĢâĶĢâĶĢâĶĢ âķ° +Ġtw ist +384 9 +Mod flow +tific ado +ĠTra jectory +Ġfo lium +MD P +Single ton +ĠGe V +ê° ģ +analy zers +294 1 +214 3 +214 6 +Multi Scale +ðŁĩ ® +ðŁĩ ° +ðŁĩ ± +3333 34 +yes no +Ġes sentially +Directory Path +(', '. +264 3 +resid ues +Conf usion +Ġinterpol ator +Ġanaly ses +¡ółģ ²ółģ¿ +Transaction Internal +206 1 +Script ing +217 6 +232 8 +297 1 +297 3 +ĠMax Pool +Ġgre et +Last Modified +dn f +pipe lined +>>> ' +Dig i +:::: :: +gm sh +har bor +har vesters +(". // +Ġprovider Name +299 4 +rou ght +Ġmac s +ĠMock ed +//////// // +306 7 +Render Window +ĠPerson al +sdk Driver +Container Options +NAMES IZ +Ġwhite listed +Call Filters +ĠSP ACE +304 9 +Rot atingFileHandler +Ġbul ges +fft shift +Standard Sequences +Ġmet as +Ġsimp li +FQ g +Ġcc xt +Ġ"' % +Ġden y +åĪĨ åĪ« +(", ")[ +ðŁı´ółģŃółģ ® +Ġ---------------- ---- +Ġ---------------- ----------- +################################################################################ ############ +dark red +Meta Info +007 87 +ĠBuild CallFilters +lick ey +parametri c +Ġí Ĩ +307 5 +427 2 +Ġâ ľ +ãĤĴ åıĸå¾Ĺ +recv from +Ġdeploy ments +292 9 +interpol ator +ółĢ² ółĢ²ółģ¿ +Ġ------------------------------------------------ ----- +ĠArray Datatype +ĠJo ined +lso ap +ĠAb out +OD ES +Plus Context +vc cs +Ġbi jectors +ism ic +388 1 +AU DIT +Ġer ase +303 7 +à± ĭ +corre ctions +ан иÑı +ðŁı´ółģ´ółģ ·ółģ +('# '): +Ġcri mes +Ġhex val +ðŁı´ółģ¬ółģ ¹ółģ +425 9 +/* ; +cdf s +Sm Length +latitude s +Qos CW +Ġadv antage +Mer chant +Imp ersonate +ç¤ ¾ +ółĢ±ółĢ ¹ółģ¿ +opp osite +Ġ-------------------------------- ---- +Ġ-------------------------------- --- +Ġ-------------------------------- ---------- +Ġ-------------------------------- ----------- +å¿ ½ +407 4 +Ġemp loy +Ġroll up +Ġbus y +swap axes +Ġmonitor ings +Ġ{{ { +Ġprote ction +wik itext +Ġsi mpler +Help ers +lem mas +309 5 +ĠReference d +çº ¦ +Ġvtk modules +285 1 +sho oting +Save FeatureSet +ĠDep loy +Ġhar bor +302 9 +ĠEmail Send +ualiz ado +KB QK +Ġchat bot +Ġ104 9 +ел и +############################################################ ## +uj u +}.{ { +CSS S +Sur vi +oct op +caption s +ê³ Ħ층 +SETT ING +]}, { +ĠDISCLAIM S +Ġhy dra +docsLoadBal BasicRule +ĠWord NetLemmatizer +Writ es +Contact Info +PART S +435 8 +GAM MA +linked in +Ġsho ck +Ġsho ulder +ĠDraw ing +428 2 +ĠBuil ds +Ġmicro second +320 99 +Ġठķ +Ġdialog ue +Calcul ation +Kernel Pheno +fac ility +è¨ ĺ +Http Response +umin osity +got Result +cro pland +ORD ENAR +Ġintegr ator +Fit ting +pend ant +ðŁı´ółģ°ółģ §ółģ +æ± ĩ +ĠCons ult +TRANS PORT +Oct ets +99999999 99999999 +ĠCir klo +scroll Height +Ġposs ibility +ĠExtension s +åŁ İ +æŃ£ ç¡® +Elect rode +discord bot +BH mass +mess a +ĠBit coin +г г +ãĤ¤ ãĥ³ +Ġemb s +prox imity +FER ENCE +Play ing +аÑĢ ÑĥÑĪ +PRIV MSG +433 9 +ä¹ĭ åIJİ +Aut omatically +<<<< <<< +celery project +Ê· ÉĽ +Separ ableConv +ак Ñģ +uls ion +Ġvk Type +707 107 +hor ovod +Primitive Statement +Ġê° Ļ +Hard Drive +Ġë° ĺ +ĠSele cts +ĠVal ores +BLEND FACTOR +xm lsoap +12345678 90 +Az ure +æıIJ 示 +Vl ans +ðŁı´ółģ§ółģ ´ółģ +Ġchainer x +POSIT IVE +ółĢ²ółĢ ³ółģ¿ +Tele metry +Ġpriv acy +Ġ"{}/ {}". +Sem antic +IDXGI Adapter +Ġmens agens +Ġisol ate +ĠElect ric +ä¿®æĶ¹ 为 +(',' ))) +ÏĢ ο +NotSupp orted +hol m +mscModVcs E +rz sm +variate Normal +è³ ŀ +Ġê² °ê³¼ +Ġstamp s +ĠTimeout Exception +jw ks +ĠcdbpLocal Appl +ĠBL UE +mcRmt E +lad der +ĠMi lightWifiBridge +________________________________ ________________________________ +Jar Location +è© ± +adverti sed +Ġvan illa +å·² ç»ı +ãĥ³ãĥ ī +mus l +èĻ ķ +abb ix +Ġconvers ations +Mm Length +('~ / +econ omy +Ġpal av +Alg os +Ġvers a +Ġminim ized +Management Zone +GetStatus Response +ĠDa emon +ĠDetermin istic +ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ +ĠTS NE +tens ordot +abili dades +Ġtalk ing +Ġcraw ler +Ġinterpret ation +ĠContin uous +ĠctspDownloaded SgtPolicy +satis faction +Ġtel lo +ĠAG AIN +Ġìĺ ¤ +ñ o +Ġmeas uring +Ġrain bow +merc MapE +Balancer Exchange +mist yproxy +heapp op +ĠDIST RIBUT +UO US +poss ibly +Ġdispon ÃŃvel +proton ated +cpwVcPerf Total +Increment al +Ġpds olve +coher ent +dil ated +Ġproton ation +ĠBU ILD +RegNet X +RegNet Y +âģ Ħ +Ġreveal ed +raz as +ĠConvolution al +ĠCLASS ES +1234567812345678 1234567812345678 +Ġincid ence +Ġmile stones +ĠNu clear +lav ni +Ġ解 æŀIJ +Snow Amt +Copper Length +":[[' - +Ġambig uous +ĠMY SQL +Ġmes senger +ĠGal axy +Ġdese ja +ĠEL SE +ACCESSBIND ING +Ġoup ut +ĠFort ran +ĠGO val +Datum Lis +ì¶ ľ +anth ill +ĠSIM ILARITY +SCEN E +retweet ed +messenger g +Bill To +cele ba +ĠHi Seq +Deriv ative +Ġshel ve +Ġconform ing +ĠBoot campRun +ãģĿ ãģ® +WRAP PER +Ġcloudwatch log +interpre ters +Ġíĺ ķ +Frag ments +filtr ation +ĠMedical Example +ĠAbort ing +NOR TH +Wed nesday +ĠSAL ES +iran lms +Ġæł ¹æį® +вед иÑĤе +aller gen +ĠDeriv ative +TrustSecPolicy MIB +Mand y +Usu ario +INHER ITED +ĠSpo tify +ĠCAL C +Ġconfigura ção +ĠVoice Activity +Ġvot ers +Ġaccom mod +Transp arency +é¼ ł +ĠSpread sheet +ĠUNI QUE +Ġин ÑĦоÑĢм +ĠXL Net +Ġtempor arily +0001010100 010000000000000 +Lif ecycle +pian oroll +ĠFv Regress +ĠPhy lo +tmpEle Loc +ĠPLU GIN +divers ity +Ġæ¯ ı +ĠLibvirt EventManager +iÅŁ ken +Dojo Family +Scaffold Guider +ĠпÑĢав он +qtimetadata field +ESR GAN +Ġë¡ ľ +ĠOnOff blockSize +ĠGeom Combination +åĺį åĽī +Ġmcast ControlList +("========== > +NoFrame skip +Milli seconds +getElement ById +ĠæĽ´ æĸ° +ĠUNT IL +dcer pc +itcho ver +asany array +ĠStim ulus +apcat br +Pycharm Projects +Ġæ°´ æŀª +! ( +" +" +# % +# ', +$ ')) +% " +' \\ ++ ',' +- {}- +. )* +/ "). +/ >\ +2 101 +2 108 +3 076 +3 001 +3 165 +3 166 +3 854 +3 026 +4 224 +4 169 +4 172 +4 182 +7 000 +9 007 +: '+ +; / +; '. += "," +> :", +? ] +A j +A OO +A pril +C ine +C pk +C FLAGS +C SEARCH +C idr +D PO +E H +E fficiency +F j +F ot +F gs +F DF +F ov +F SM +F urther +F LEX +G auss +H ide +H acker +I u +I w +I ATION +I Unknown +K k +K m +K MS +K NN +K Means +K ONA +L Point +L GN +M v +M IME +M HP +N od +N ag +N ord +N ick +N ets +N FC +O dd +O ops +O GRAM +Q e +Q ry +Q CoreApplication +R ail +R DS +R ational +R TS +R IDE +S IN +S av +S AP +S ORT +S rv +S till +T ap +T au +T ERR +T odo +U c +V IN +V ery +V apor +W ide +Y O +Y mJ +Y STEM +Y OUTUBE +Z B +Z R +[ . +] # +] `` +^ [ +_ ]. +_ '): +_ ${ +a op +a po +a key +a arch +a ero +a mpler +b od +c py +c Type +c group +d ht +d ts +d max +d orm +d Base +d cm +d odge +e li +e em +e ather +f user +f submission +f rontier +g V +g ou +g als +g rep +h A +h I +h W +h all +h nn +h cc +h pc +h ysical +h QK +i pt +i com +i ops +i peline +i ota +j urisdiction +k un +k net +k ornia +l ci +l tp +m N +m T +m X +m ot +m cp +n X +n bytes +n rem +n ically +n uels +o U +o è +p F +p Z +p ent +p doc +p du +p fn +q ti +r M +r line +r ug +r pg +s obre +t sp +t node +t batch +t stamp +t LS +t reated +u B +u vs +v le +v int +v ts +v api +v ital +v cpus +v soma +w A +w T +w ot +w ux +x lm +y axes +y ama +´ ółĢ±ółģ¿ +¹ Ħ +Î £ +Ð § +× ¦ +× Ŀ +â ³ +ç ĥ +ç Ĩ +è ĵ +é § +í ģ +ð £ +Ġ ĊĊĠ +Ġ velo +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ çĶ¨ +Ġ ############################################################################ +Ġ ðŁĴ +Ġ 以 +Ġ ÑĨ +Ġ ãģ§ +Ġ å¼Ģ +Ġ íķľ +Ġ athena +Ġ 读åıĸ +Ġ ensembling +Ľ Ħ +in ho +or skip +or tit +on ad +on na +re lic +re do +re compute +Ġ= ============ +Ġ= ===== +st arg +en couragements +Ġt arg +Ġt ty +Ġt ca +Ġt ë +ar an +ar ra +ar quia +al co +al ab +de qu +de vi +de ta +de cib +le weide +an di +an che +Ġi list +Ġi ca +Ġi pc +Ġi zip +Ġi otype +me lon +ti ers +mp loyment +Ġc rc +Ġc lasse +Ġc vimg +Ġp es +Ġp ension +Ġp io +Ġp norm +Ġp opt +Ġp andoc +Ġp ecan +Ġf en +Ġf dr +Ġf acing +Ġf ounded +Ġf etches +Ġf iona +Ġ" '' +Ġ" );\ +Ġ" [-] +he matics +it ative +Ġa id +Ġa cess +Ġa ml +Ġa md +Ġa seg +lo on +00 56 +ge y +ge ars +Ġn ine +Ġn ii +Ġn ume +Ġs ph +Ġs var +Ġs amp +Ġs mt +Ġs job +Ġs sb +Ġs ppas +Ġs licing +ur ri +Ġin comp +Ġin fe +Ġin car +Ġre dd +Ġre direction +Ġre aches +sel ls +ame se +Ġo he +Ġd xf +Ġd db +Ġd Loss +li pp +ct uation +ct ransfer +pe cc +un set +un ite +un ay +un wind +un staged +Ġm yst +Ġm hd +Ġm vn +Ġe con +Ġe print +ion ization +() ([ +ent ly +ent ric +ad xv +ad ditive +co ck +co var +ri der +Ġb h +Ġb st +Ġb es +Ġb name +Ġb ns +Ġb ell +Ġb allo +Ġb öl +Ġ1 173 +Ġ1 996 +11 95 +11 44 +11 001 +11 59 +int eriors +id ing +Ġ( [" +Ġw fh +ch opy +te ff +te lp +te go +ma st +ma xf +ma sses +Ġfor wards +"" ): +ol t +ode d +__ ')) +__ }" +get option +get Info +get vlrep +(' .* +(' =', +set Coordinate +ĠT B +ĠT et +ĠT ic +ĠT OR +ĠT ok +ĠT oo +ĠT ransp +ĠT iles +ĠT urtle +ĠT ELL +import orskip +str error +Ġ2 98 +Ġ2 53 +Ġ2 51 +ers phinx +(" ..", +') * +') }) +as ca +et ape +arg p +arg on +Ġis ql +ĠS PECI +ĠS TOP +ĠS MAPE +ĠC ID +ĠC SC +ĠC ALL +ĠC ancel +ĠC NV +ĠC itrix +ht ype +Ġg am +Ġg olds +Ġr ds +Ġr ts +Ġr inse +Ġl sp +��A MP +ĠA CK +ĠA rab +ĠA nonymous +age marry +01 44 +put header +Ġcon cepts +ic p +ic ity +ke k +ke Train +am iento +to String +to pping +Ġ: ', +Ġ: ') +par ties +par andum +ist e +ist ivity +ĠF B +ĠF all +ĠF ACE +ĠF lor +ĠF WHM +ĠF rowning +sc re +qu eness +list Of +om nis +ser um +Ġh repr +Ġh adoop +ta w +ĠP AT +ĠI m +ĠI LL +ĠI OS +ĠI Hero +ĠL UT +ub k +res nel +res nest +=' {} +=' ${ +=' -') +Ġst one +Ġst anza +Ġde comp +Ġde cl +Ġde compressed +pro duces +pro vides +pro posals +est o +est ate +0000 1011 +form Stash +ex us +im ated +Ġex changes +Ġ3 25 +Ġ3 08 +Ġ3 35 +10 92 +10 84 +10 56 +10 35 +out str +out group +out box +out break +ow away +ĠD iff +ĠD FS +ĠD omin +ĠD DPG +ac tic +Ġu reg +Ġu fw +Ġu uids +]) ', +]) == +]) ])) +Re actor +Re Lu +sh in +sh ops +sh ading +ĠM us +ĠM AY +ĠM ARGIN +key type +key Mgr +lab us +Ġv g +Ġv out +Ġv oc +Ġv cs +Ġv ai +Ġv wo +Ġv stack +02 01 +ext r +Ġy tick +ĠO pp +ĠO WL +Ġ* [ +Ġx z +Ġx ray +os cope +Ġse es +ack nowledged +add Edge +ER V +load Model +Ġme cab +Ġme dication +Ġfile types +Ġpro ducing +Ġpro metheus +Ġpro hibited +ens on +art hest +xc en +pre duce +ES G +ber keley +Ġbe havi +"] +" +ĠB W +ĠB ind +ĠB ED +ĠB ond +ĠB ORDER +ĠE ight +ĠE TH +ĠE dition +ĠE TA +Ġj object +ime k +""" # +com merce +model Name +ĠN AC +ir er +################ ########## +Ġ4 25 +Ġ4 30 +92 77 +tp r +col d +col ate +col lapsed +In Out +In gress +In finity +ĠR OR +ĠR SE +ĠR TR +ĠR BR +Ġun parse +Ġun masked +Ġun limited +Ġun marked +fo obar +32 39 +32 31 +32 69 +ĠG Object +ĠG ram +ĠG rammar +Ġco data +Ġco herence +Ġon de +EN DED +ĠW rong +ĠW WW +Ġout ro +Con cept +ĠU K +ĠU b +Ġ5 93 +Ġ5 70 +ib ile +ise n +che mistry +18 32 +18 82 +18 42 +18 63 +16 14 +16 67 +line Tokens +array Peak +sa int +Ġk it +Ġcol lide +25 09 +25 98 +25 38 +25 43 +Ġro ck +St one +St ores +Ġpy ss +Ġpy dap +Ġpy atv +Ġ6 90 +Ġ6 50 +ag ar +http client +04 04 +13 55 +13 65 +13 54 +lib dcerpc +class ic +class path +15 12 +15 46 +05 00 +05 07 +03 05 +03 55 +03 77 +we cook +ip addr +ip Address +Ġop cua +17 47 +dd o +dd qn +93 36 +93 65 +93 76 +14 02 +14 64 +14 47 +14 54 +Ġpre load +Ġpre scription +Ġresult NContent +ne ck +ok ia +64 89 +error Message +Ġra pid +Ġra ising +gra sp +iti alize +RE CO +08 58 +22 88 +22 28 +22 49 +22 71 +ust ay +Ġ. __ +ĠH EO +ĠRe ce +ĠRe lay +ĠRe public +sub group +sub modules +sub routine +][ :] +Ġsh words +Ġdi a +Ġdi al +Ġdi es +Ġdi str +88 97 +88 56 +19 74 +(( \ +Ġsc aly +Ġsc anned +34 18 +34 26 +34 62 +34 72 +09 88 +09 86 +84 55 +ĠIn etAddress +27 65 +own ing +nd of +inter op +inter actor +Ġle v +ill uminant +arch s +24 27 +24 23 +24 39 +24 31 +24 79 +24 74 +24 72 +24 71 +37 55 +37 94 +point patterns +Ġsub domain +Ġsub strings +Ġsub routine +rep ortit +96 99 +96 10 +96 85 +Ġnew Graph +Ġall hub +94 08 +94 47 +94 73 +Ġ} ' +Ġ} [ +33 01 +33 93 +33 89 +DE MO +DE ATH +RO ID +87 75 +AL OG +exp iring +CT As +Data Parser +AS YS +Ġla x +Ġla pla +85 14 +97 55 +net mask +36 14 +but ter +011 8 +query Cells +ĠK i +ĠK y +ĠK on +ĠK MS +Ġuser Name +Ġuser bot +95 07 +95 08 +return ing +word list +Ġcont en +cri ption +86 08 +26 04 +26 08 +mon itors +Ġdo i +Ġdo me +Ġz entral +################################ ## +Ġjson utils +AG ATT +57 01 +57 45 +Ġ[' < +Ġ| / +Ġ| __ +create Element +ED NESS +reg ar +reg rs +Ġper ms +Ġper haps +CO LL +version ing +Ġlo l +90 32 +api pe +api index +unc or +Ġstart project +Ġte k +Ġmat ri +Ġli ked +44 85 +44 26 +Ġdis ruption +AP Y +AP PRO +cor responding +OT k +ef d +En rollment +Co V +Co v +Co ef +28 34 +RI VER +56 79 +98 15 +Ġsp f +38 93 +move To +my resource +Ġmin Value +Ġmin length +Ġ(" -- +uc a +be ams +be hind +Ġcan on +ĠQ Dialog +ĠQ Icon +ĠQ ComboBox +Ġcolor maps +PT P +35 86 +org Name +Ġus ar +Ġmo strar +Ġmo że +File Metadata +doc us +doc strings +))) ; +Ġad vice +45 07 +45 19 +45 23 +45 35 +Ġvalid ates +Ġinter op +]] \ +Ġ, {' +command map +tf lux +Ġpos ição +Ġ9 16 +Set Table +pl ants +IL ER +Test Mixin +Test Support +Test CreateFile +Ch ip +Ch lor +Ch allenge +ai res +82 95 +ear m +Ġar xiv +46 54 +ĠJ ones +ĠJ uan +89 15 +89 14 +Ġ] \ +":" / +)] * +ANT IAL +Ġq x +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +To Test +To Delete +score board +CON STRUCT +DO OR +Ob js +De precationWarning +field names +29 04 +]* )\ +'][' $ +MP SS +67 03 +43 17 +43 93 +show Label +Ġup sample +Ġup grades +Ġcor rupt +vo us +:: \ +000000 02 +SI FT +SI OC +48 97 +EX PRESS +ĠData Array +ĠData Required +FA oF +fe cha +No vo +42 11 +42 07 +42 17 +42 14 +MA E +Ġpri ors +Model Instance +Model Stick +ï¼ IJ +ĠIS K +mt urk +Ġwork loads +parent heses +Get Color +Get Item +ĠPar ti +39 07 +ny quist +bl urb +Ġiter ables +play book +PAT IAL +Tra des +Column Family +Vi olation +74 22 +Dict Model +fy ra +ĠCo ords +dis connected +fit params +Ġimp rover +Ġorder List +Description s +first Child +Le e +Class Linkage +Ġab a +Ġfield set +ĠTest App +Ġsign ificance +ĠNo va +Ġbin omial +User Input +Ġman aging +Ġlanguage Style +Ġexec utions +sor ry +github assets +qui er +ãĥ ļ +ym orphic +Ġstd lib +At tached +(_ , +Of z +If Index +Sh ares +Sh ots +prefix ed +Image Data +:] ]) +Ġtmp Array +pu Device +DB Manager +DB Obj +Def Context +Ġ"\ "" +202 7 +Ġfi ber +Inter mediate +Ġfont Tools +pec an +cluster map +Create Dummy +prot ot +Ġtri ps +fla kes +API Result +Ġsent inel +Qu at +ĠFor ces +window Background +fp tr +Ġsrc file +mod l +medi o +н ого +Ġsome what +stop Activity +diff usion +=[' - +Ġshow legend +aa S +Ad verti +Py dantic +é o +Sp awn +Ġmon itors +Ġloc alizations +COL LECT +Ġref name +istr ations +script en +ines ses +ä» ĵ +Ġpost ed +web p +++ ', +Ġfin etune +lr s +ĠZ ERO +ram fs +NO UN +Ġì Ĩ +rs ync +Ġsplit ter +ĠSO M +]+ )', +ĠFile Type +Port State +Ġwindow ed +Token Mapping +RL F +âĶĢâĶĢ // +draw downs +Ġ"- ") +Ġsee k +ĠRel atório +cpu set +Or New +.* )') +Ġvi r +á l +ĠKey Value +ĠLe ast +ĠLe ague +ĠConfig urations +Ġresp onder +imp u +Line age +SON G +Ġrest oring +prob ed +CI LL +Ġpe lican +Ġpe ewee +storage s +Ġweb cam +Ġest ão +fc ntl +multi Proc +vers o +vers ing +ĠTime OfDay +Ġattr getter +Ġvector ize +All But +ws man +vari ational +reset JointState +Ġsystem d +auto discover +=\ ""+ +ĠEX PECTED +ä½ Ļ +inf lux +TP C +еР± +IMIT ER +js r +GL M +Do e +Ele vation +Oper atableStateMachine +Ġyear ly +Ġneg ate +ĠNum bers +Enum Type +Ġ') [- +Ġview ed +apply map +Ġhigh ly +SO EVER +ga e +Min utes +Ġtr g +ĠUp dater +Char Match +Di pole +Struct ural +ĠBo at +ĠBo iler +aut onomy +Ip Protocol +Task Name +va ex +éĢ Ĵ +EE II +ii ii +ĠOb servable +fl ds +Graph s +termin ated +Ġtk list +Ġclean er +MIN UTES +Ġë Ķ +Ġë ¬¸ +bed s +Ñĥ м +enum ber +******************************** ************************ +Ġsel ling +Ġgoogle apiclient +Ġarch ived +Msg Finished +PRE CAUTION +bus ca +ĠDis placement +ĠQu ad +åº ķ +GO O +MT U +Ġshort ening +ĠOpen Shift +IF NAMESIZ +Ġ? ? +Ġbit mask +ĠTensor board +Ġdivision s +Stats Total +ĠNumber Normalizer +Default Cnt +024 34 +cb d +Ġinte iro +.' ", +åį · +Back SH +Ġgra v +Ġgra fo +divid ers +Ġjoin ing +Go ogLeNet +ĠRequest Message +ru z +ĠUpdate Expression +Ñĭ Ñħ +Ġho ppingSite +Ġ"# ": +speed s +dy dx +ĠMy Class +ĠST RE +del item +inv ocation +camera Tweaks +TRI GGER +dl c +RU AL +multiple s +ĠClass ify +205 3 +Ġ(_ ) +Ġri der +ãĢĤ ãĢĤ +ĠNe o +215 2 +åĢ Ĵ +æī į +æī ĺ +ĠRo les +204 2 +Parameter Context +tol erant +Ġway points +wav file +GA AC +384 1 +writ able +('. ')) +tific ations +phase d +Ġpublish ing +Engine Error +HEAD S +ĠStart ed +Rate Limit +Profile Name +193 5 +ĠLabel List +ĠRandom State +ðŁĩ µ +ðŁĩ · +cons ult +3333 33 +Ġeven ing +ali ens +ĠCode s +Ġtermin als +It alic +Stat en +organ izer +BI AN +Ġflat land +pher es +¡ółģ ®ółģ¿ +Fin ancial +206 3 +ä¸Ń æĸĩ +208 2 +208 6 +tb W +Ġord inal +ëĭ ¨ +combin atorial +Ġred shifts +Ġwrap Width +pin yin +Ġsur ge +Dig itizer +ĠÑģ еÑĢ +Part ner +syn onym +ĠMO DULE +ios o +203 6 +Ġshift state +Prop agation +299 3 +follow ed +general Tissue +225 3 +296 1 +Ġbad ger +ðŁı´ółģ³ółģ ¥ółģ +bon a +Linear Projectile +Cor p +304 2 +Ġnu ke +Ġnu im +Ġair craft +424 1 +424 8 +397 9 +286 3 +ĠTEST ING +operation Id +ĠSpe cies +Ġ---------------- --------- +################################################################################ ######## +HD x +å· ´ +284 4 +307 4 +427 6 +Ġorgan izations +Ġorgan ização +406 3 +Ġfbx Material +ĠSc atter +OF VERSION +xl net +Ġflo ps +ółĢ² ółĢ°ółģ¿ +209 5 +ĠSearch Result +ĠâĢ ŀ +288 4 +388 6 +Ġer os +Next Token +æĭ ¬ +executable Path +ĠGame s +385 1 +385 2 +Ġcy to +bright Red +bright Blue +bright Green +bright White +bright Black +bright Yellow +bright Cyan +bright Magenta +kk k +water fall +Ġml piot +ĠWork book +395 7 +mal icious +RUN NER +392 1 +ĠHTML Parser +396 3 +Mac Addr +437 2 +FOR BIDDEN +visu alizations +Ġwatch dog +Ġatt endance +replic ated +Ġtrade mark +Vlan Table +Ma intenance +Ġ88 1 +ĠPort al +prog ression +ĠCar olina +Callback Query +332 8 +sil ence +Ġcb or +Ġcam eras +vet or +magic daq +Screen shot +Ġjoint Index +408 5 +verti ca +deep gmap +Ġ-------------------------------- - +æĸĩ件 çļĦ +ãģ« å¤ī +Ġgain s +detector s +Ġtm db +èĩª å·± +309 1 +Ġquat DMP +Ġrecall s +Cfg Group +Cfg SkippedGroup +Ġ################ ###### +longitude s +fbx Scene +ìĹ ´ +ìĹ Ń +pip env +Ġgui args +calib bit +LINK S +four th +Ġcatalog s +298 9 +La Images +éĽ ¢ +NF KC +è s +Ġpv BackSH +åĽ¾ åĥı +Ġreview board +Ġstand alone +OVER WRITE +áĦ ĭ +ĠAP IS +Low est +99999 7 +kE g +ĠMay a +tenant Id +beat s +chip R +ĠAut omatically +KJ VK +Ġeff ort +JJ NJ +(. + +Ġ#-------------------------------- ---------- +ĠCOL ORS +Ġrx n +Ġce ilometer +Ġrcl py +Pop ularity +laps ing +Book s +dut host +RX SS +Ġsho ot +}-{ : +æĻ ļ +,:, :]) +438 9 +TW Light +ĠEl lipse +Ġठ® +Ġste em +ĠFire wall +cro ft +Ġpic amera +ĠSpeci fication +Sys Font +TIM ER +Review Rating +ĠConnect or +smo other +Ġlatitude s +Arch interiors +ĠAdmin istrator +ô ng +Trace back +æĪij 们 +Fe es +anon ym +éĺ ² +Selected Text +stub s +Ġм аÑģÑģ +ĠCOMM ON +Ġnear by +Pol ar +åģ ı +ĠCS RF +ĠPassword Field +hack s +éĢī 项 +Lookup Error +ĠEnter prise +ĠAnaly ze +ĠRESULT S +PLUGIN S +Ġgp map +Requests Mock +exer cise +ðŁı´ółģ®ółģ ¯ +Ġ#------------------------------------------------ ---- +Issue s +ın ı +8217 77 +ãĤ¯ ãĥ© +éķ · +Play list +PERSON S +PERSON AL +Ġtv di +ĠSan ta +ĠSTAT ISTICS +é» ij +Ġorient ed +Ġhack y +Ġintr insic +ĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉ +Geo JSON +Boost Classifier +flt Stat +Ġbas erow +Ùģ ÙĬ +Ġly ric +oẠ¹ +oẠ» +oẠ½ +åıĺ æį¢ +Asset Type +ĠSkip ped +Ġnecess ário +Ġcontrast ive +Ġdead line +cab inet +Fri day +Ġguar dian +IMP ÃĶ +nowledge ment +mole cular +semi logy +silent ly +Gre ys +laci er +éħįç½® æĸĩ件 +ĠAudio Segment +ĠPL US +UNI VERS +Ġche ese +KV Part +èĪ ¬ +Ġsmo other +Ġdog s +Ġexam ine +Ġlem ma +ðŁı´ółģ¶ółģ ® +éłŃ éłĺ +ĠcdbpLocal Vendor +RNN Cell +ĠNB PKG +Ġcomput ational +ĠMag nitude +ĠctspDef Downloaded +lhs Node +Ġsuggest ion +tac acs +ðŁı´ółģ¨ółģ ² +缮å½ķ ä¸ĭ +00001011111111 000100 +ê² ½ +Ġdatal ine +Ġabi lities +Subscription s +Ġuncer tainties +ĠCharacter Model +713 57206 +ĠInclude s +ISS ION +Ġ'{}'. ". +Ġped idos +Ġmom ents +('~ /. +ĠcdbpPeer Vendor +ĠMIS P +Procur a +DEST ROY +gran ularity +ار ج +é£ İ +Ġmusic score +SMS User +Ġcron tab +Ġhom enet +Ce iling +Ġach ieved +ĠctspDownloaded DefSgtPolicy +Ġtel net +æĿ¡ 件 +atten tions +ĠFunc Def +ĠQuanti ty +Ġfrequent ly +çµ IJ +ãģĵ ãģ® +Ġpup pet +Follow ing +Tex as +Ġmob ilenet +etsys NacAppl +vio let +merc ator +Already Exists +Ġetsys NacAppl +Occ upancy +bread th +ĠACC RUAL +Ġdeliver ed +Altern ative +Ġsynchron izer +Ġwal ker +Ġsnmp mib +ĠRound ingPolicy +Ġ************************************************************************ ***** +Ġ327 68 +Ġìłķ ë³´ +sever e +scrap ing +Ġproton ated +Ġzen odo +ELECT IONS +ĠæĹ ¥ +ìĨ į +ĠAnalog ous +Ped ido +Prom o +kir bi +ãĥĩ ãĥ¼ãĤ¿ +åį³ åı¯ +aaaaaaaa aaaaaaaa +ĠÐŁ ÑĢ +Ġabstra cts +ĠæŁ¥ çľĭ +åķĨ åĵģ +ĠMETHO DS +PLACE HOLDER +Ġshuff ling +Ġphenotype s +ĠMonitor ing +ĠDen ied +steel blue +Ġfer mi +اب Ø· +ĠNET WORK +Ġativ os +vvvvvvvvvvvvvvvv vvvvvvvvvvvvvvvv +ĠCvBridge Error +DIC OM +ĠTi pos +Ġد ÛĮ +ĠPdf FileReader +ĠAdapt ed +ĠLif ting +|{}|{} |{} +ĠLap lacian +pho sph +Ġclouds im +å±ķ 示 +Front SH +Ġovers ampling +################################################################################################################ ######## +multiplex er +enroll ments +ĠSky Coord +ĠEv olution +Ġج ات +ĠAnalytical ModelStick +èĤ¡ 票 +Lex icon +unders core +shel ves +**************************************** ****** +sme ll +Ġkom bu +ĠMiss ile +ĠPRIV ATE +Cascade Classifier +Ġmistr al +Ġprocur a +Neighbour s +achability ServiceClient +ĠChrom osome +Ġgrace fully +ĠIGN ORE +heroku app +CIRC LE +titch ing +>[^ / +Ġcj mx +ĠROT L +ugg ling +Ġpropag ated +Ġê²½ ìļ° +ččĊč č +tache ment +ĠGIT HUB +dak ota +6704 31 +Belief Event +PREPAR EDNESS +ĠVin cent +fess or +Ġsimultaneous ly +OnOff start +ĠKuge l +ACCUM ULATION +NVDA Object +assertRaisesRegex p +FAT AL +ĠMESS AGE +Ġlighton ml +VOLT AGE +LOCALIZEDSTRING TOKEN +ĠNoSuch ElementException +ĠChristop her +Postal Address +Ġpuls ar +Ġprogra my +outputData Name +ĠQgsProcessing Parameter +ĠInno DB +COH ORT +hetero sphere +ĠSING LE +ĠGlyph s +assertValidRole ListResponse +Bans al +ALLE L +ä»Ģ ä¹Ī +å®Ł è¡Į +9218108169 88 +APPLI ANCE +leop ard +ãĤ´ ãĥª +Ġcatan DBObj +Ġкаж д +ĴĢ ë§ģ +ĠSTOR AGE +ðŁı´ółģŃółģ® ółĢ°ółĢ +Ġaccommod ate +é¼ł æłĩ +ĠпÑĢавон аÑĢÑĥÑĪ +onad ash +Ġredd it +Ġdxf attribs +ĠTELL STICK +ĠIHero Types +Ġscaly r +Ġlapla cian +ANTIAL IAS +MPSS imulator +CharMatch Ind +PRECAUTION ARY +Archinteriors Vol +ĠмаÑģÑģ ив +00001011111111000100 1000110 +71357206 670431 +! =- +$ & +$ _{ +' | +( ("% ++ : ++ ":"+ +. )), +/ '. +2 923 +2 198 +2 138 +3 948 +3 888 +3 102 +3 327 +3 023 +3 122 +4 0000 +4 201 +4 107 +4 165 +4 157 +4 177 +4 178 +4 183 +4 141 +8 937 +9 107 +; """ += } +? ?\ +A UR +A ward +A ws +B t +B as +B ES +B eat +B IS +B EST +B rand +B MI +B LOB +C tx +C ATION +C VE +C ATTLE +D v +D ed +D eri +D Array +D uring +D rops +E th +E UR +E QU +E II +F ns +F ram +F REQU +F onts +F rench +G AP +G az +G tk +G rd +G ndConnector +H t +H er +H ack +H PP +H LT +H ANK +I deal +J on +J ul +K en +L b +L st +L HE +L PC +M ES +M IC +M zM +M secs +M appings +N Q +N Number +N LU +N eeded +N Phases +N MVOC +O e +O SC +P ype +P US +P seudo +P eter +Q SC +Q Icon +Q ScrollBar +R v +R ap +R ifle +S it +S PR +S uit +S uggest +S emi +S ALT +S afety +S OUTH +T Factor +U ZZ +V EST +V CC +V OI +W c +W rist +W rV +X form +X we +X GROUP +Y U +Z D +Z Y +Z ER +Z DJ +[ __ +[ ]( +\ ) +\ ]" +] "). +] _. +` ; +a qK +b arch +b GR +c ame +c label +c gs +c mpl +c vimg +d pc +d stack +d ollars +e K +e Q +e ef +e af +f key +f resh +f comm +f orth +g G +g K +g j +g ds +g IC +g las +g mt +g rounds +h K +h Z +h size +h ier +i en +j X +j is +j as +j ailer +k F +k K +k is +k layout +k oda +l Z +l tr +l Mode +m G +m ant +n par +n po +n ite +n ds +n fe +n ics +n features +n Context +n inja +o V +o ot +o ob +o ak +o zone +o Options +o obG +p ra +p ers +p ds +p test +p add +p gs +p led +q O +q ds +q rt +q iskit +q oe +r zy +r partition +s key +s fm +t G +t W +t keep +t Found +t lm +t cex +v end +w mi +w WC +x add +x size +x edges +y os +y err +y dl +z ib +z samples +z na +} ** +} $", +} ${ +~ / +³ ółĢ²ółģ¿ +Î ¶ +Ð ¦ +× ĺ +× ł +å ² +ç ij +ë ¦ +ì Ĥ° +í ijľ +ĉ Ġ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ river +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ÙĨ +Ġ æľ¬ +Ġ åIJĮ +Ġ åħĪ +Ġ оп +Ġ اس +Ī ìĬµëĭĪëĭ¤ +in ia +er tia +or med +or Pos +on call +on ERC +at ri +at son +re constructor +re structured +re bates +se mp +Ġ= ( +st w +st ake +en os +ĊĠĠĠĠĠĠĠĠ ĉ +Ġt ies +Ġt stop +Ġt yper +Ġt ropo +Ġt iff +Ġt ango +al d +de position +de select +le iden +le aved +an omalies +an terior +Ġi co +Ġi te +me ms +me xp +Ġ' ## +ro bin +ti um +mp f +Ġc box +Ġc ropping +Ġc ctbx +Ġp ile +Ġp iv +Ġp ps +Ġp ager +Ġp ids +Ġp cl +Ġp lastic +Ġp itches +Ġp seud +Ġp lugs +Ġf unk +Ġf olded +Ġ" >", +he xa +it os +it ance +it zer +Ġa vec +Ġa mino +lo co +ge on +ge ll +Ġn am +Ġn aff +Ġn dc +Ġn ama +Ġn vidia +Ġs sc +Ġs lit +Ġs ie +Ġs yl +Ġs lashes +ur d +ur st +Ġin ps +Ġin secure +Ġre duces +Ġo y +Ġo cur +Ġo led +Ġd U +Ġd mp +Ġd ream +Ġd boxes +Ġd ropping +li q +li ab +ct al +ct ls +pe lu +pe ll +pe vent +un parse +un classified +Ġm I +Ġm app +Ġm ason +Ġm wi +Ġm inecraft +Ġe arned +() > +() }\ +() }') +fi ces +fi bon +ad cp +ad visor +ad igm +co us +co ordination +Ġthe Event +Ġb ent +Ġb ump +Ġb ays +Ġb ios +Ġb ought +Ġb asket +Ġ1 345 +Ġ1 000000000 +Ġ# ") +11 79 +11 0011 +id py +Ġw m +Ġw di +Ġw ise +Ġw arehouse +ch apters +di co +di ma +ul u +ot f +ot one +Ġfor ma +Ġfor warded +el v +el ong +el urahan +urn ika +Ġ+ ---------+ +get list +get args +get Server +get tfill +(' = +)) - +set Reference +set Setting +ĠT on +ĠT ar +ĠT FT +ĠT AU +ĠT aylor +xt ools +th ur +Ġreturn as +Ġ2 69 +(" ) +as u +as ury +ĉĉ Ċ +op us +op tical +Ġis ce +Ġis Stable +ĠS AM +ĠS ED +ĠS ha +ĠS lider +None Type +ĠC nd +ĠC UB +ĠC GI +ĠC MS +ĠC CS +ĠC RY +ĠC ubic +ig able +up ce +Ġdef orm +Ġg ca +Ġg BB +Ġl bs +Ġl cm +Ġl prob +end zone +ĠA IS +sp ars +'] [" +'] }. +01 36 +01 76 +ic ing +ic ustay +am ide +99 03 +99 08 +99 84 +Ġ: ") +ith ium +ĠF D +ĠF ear +ĠF ish +ĠF ONT +ĠF uel +ĠF Comm +od ate +od om +log p +log scale +list Key +om History +vi ated +Ġh n +Ġh rs +po ur +ta mp +ĠP air +ĠP ause +ĠP LAYER +ĠP SNR +ĠP outing +Ġas name +Ġas sess +ĠI l +ĠI DE +ĠI CON +ĠL L +ĠL ag +ĠL DA +tr Y +Ġde viations +ine Edit +Ġex plan +fig title +Ġ3 0000 +Ġ3 47 +Ġ3 69 +10 87 +10 97 +10 86 +10 57 +10 98 +10 21 +10 39 +ĠD ask +ĠD EST +Re base +Re covered +Ġdata Dir +ĠM ount +ĠM ixed +ĠM omentum +ĠM RR +ĠM AIL +ĠM cD +ĠM artin +time wait +time dia +time Series +xf er +Ġv ent +Ġv cp +Ġv fc +Ġv entilation +02 06 +02 08 +Ġy c +Ġy l +Ġy test +Ġy dim +ĠO C +ĠO CI +ĠO LS +ĠO PF +Ġ* ", +Ġpar lai +Ġx o +Ġx st +Ġx mf +Ġx xxx +Ġse xo +Ġse lecion +test X +test utils +test bot +add Object +Ġstr t +.. ', +xb ridge +Ġme mc +Ġfile paths +Ġfile Names +xc bar +pre load +ls r +ls rc +07 76 +ense d +ber ish +"] [' +ĠB x +ĠB Mode +ĠB Plus +12 54 +Ġname ly +ĠE ff +ĠE mb +ĠE pic +Ġj th +Ġj unk +Ġj á +ci k +ob stacles +""" { +Ġ) ]) +ĠN g +ĠN ak +ĠN IST +ĠN ico +ĠN SF +ĠN orte +ĠN LTK +################ ############ +################ ############# +Ġ4 10 +Ġ4 90 +ff in +Ġget All +Ġget hostname +col V +col pm +In ception +In dication +ind P +ĠR H +ĠR X +ĠR pc +ĠR TL +ĠR atings +OR ING +Ġlog norm +32 01 +32 37 +32 77 +32 43 +ĠG ain +ĠG rand +ĠG IAI +Ġtype Name +ĠW OW +ĠW ORD +tri cs +Ġout car +Ġout dated +Con c +Con current +AR S +AR ED +ĠV ers +ĠU M +code build +ry stal +ry lov +Ġ5 13 +Ġhe mis +Ġan ime +Ġfrom config +Ġen voy +che at +min y +min length +IT ES +IT IONS +Ġtime wait +Ġtime slot +Ġtime codes +18 11 +18 18 +18 25 +18 72 +16 16 +16 84 +16 97 +coun tp +sa i +sa audio +Ġk d +Ġk ing +Ġk not +Ġk önn +25 06 +25 52 +Ġro d +St as +Ġpy mel +Ġpy dicom +Ġ6 47 +lt t +ag t +04 84 +13 98 +og re +15 92 +15 15 +ec aster +05 01 +03 04 +03 94 +we ar +train val +17 07 +17 92 +17 15 +17 87 +17 95 +17 86 +17 82 +17 54 +dd p +valid s +14 99 +14 04 +14 09 +14 98 +14 74 +ok a +base url +base URL +([ _ +([ { +Type Var +RE MO +RE ASON +Ġtra ct +22 19 +22 38 +22 74 +22 61 +Ġ\ ""+ +ust ext +ĠH K +ĠH ide +ĠH ugging +ĠRe cogn +ĠRe places +sub folders +sub lime +Ġdi viding +df e +mit Mode +LL R +88 75 +comp ar +Ġsc n +34 04 +34 15 +34 85 +34 23 +34 38 +34 51 +start IOHeavyTestIn +Ġwe aver +Ġkey ring +nd deriv +bin ning +Ġle ar +Ġax arr +24 86 +24 68 +37 12 +37 03 +Ġare kit +Pro files +em ice +Ġsub dirs +yn q +AM Mode +96 16 +96 05 +96 55 +96 97 +Ġac ad +ĠCon da +ĠCon cept +ĠCon verter +Ġall reduce +94 94 +94 67 +33 92 +33 97 +33 31 +DE M +DE mote +RO IP +RO BOT +()) + +split Str +node sel +87 36 +AL O +AL ESC +Data Item +AS ER +iv os +85 86 +mi o +net disk +36 78 +36 52 +=[ [' +=[ {' +Ġuse tex +ĠK ong +95 06 +95 87 +Ġnumber Columns +lat ents +view Count +cri spy +26 01 +Ġdo e +Ġdo it +Ġz arr +rit ton +57 55 +57 54 +Ġtf b +do it +Text Product +"," - +List Type +__( ** +port Access +man ta +trans itive +23 97 +23 82 +request Params +request Body +AC AG +Ġcheck in +44 19 +44 75 +44 73 +44 58 +44 69 +Ġdis joint +Ġadd To +Ġadd rs +Ġnode Type +Ġurl El +Co ins +Ex if +56 84 +98 95 +Ġpass port +Ġsp conv +pop ulations +LO CALE +ĠUn ity +Ġ(' +', +Ġ(" + +Ġ(" @ +Ġ(" \\ +UR ER +ĠQ s +ĠQ MainWindow +ĠQ HBox +img H +img W +35 00 +ud r +ref und +ern ary +Ġmo stra +File List +AD ING +cre ators +Ġad visory +45 11 +45 38 +Ġvalid ations +ng rid +fil tra +the m +the ws +Ġerror String +Ġerror Code +act ers +act uator +ĠX new +ĠX GBClassifier +47 12 +47 94 +47 26 +47 66 +]] * +csv File +101 6 +face ts +command Prop +top level +Set Point +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġsk etch +Test Event +Test Struct +')) ). +HO LE +83 56 +Ch ina +ai e +gen ame +gen ius +ĠIN VALID +ear lier +Ġar Xiv +iter m +46 92 +46 93 +46 88 +46 96 +46 76 +ĠJ a +ĠJ OB +ĠJ apan +89 06 +89 08 +Ġcolumn a +DI Z +loss al +ĠSt orm +ks i +assert s +assert AlmostEqual +Ġq last +temp o +TR N +sys config +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +To Int +ĠPy PI +Ob served +De posit +De precated +exec Path +exec utions +Config uring +Config Factors +Config urator +US ING +ESS ource +gn c +43 15 +43 86 +head line +use cols +ĠPro to +ĠPro per +entry config +down scaling +PI A +48 08 +FA LL +ingle s +\\ ": +Ġarray Peak +rate limit +angle ment +42 04 +42 19 +42 37 +Ġquery string +stamp s +EL SE +EL IX +Ġpri cing +Model ID +е ÑĪ +ï¼ ĵ +ĠIS AMMode +mt k +mt ab +ĠÐ ļ +Max AddressLength +Ġexp tools +Ġexp lode +Ġexp lained +parent Node +Get Node +game event +game over +39 84 +ny c +Ġsum a +pc ion +Ġsave point +Ġfa zer +play lists +Descriptor Size +TO S +Ġword net +Ġmode li +Tra ces +Tra ding +Ġobj Type +ĠCo lab +Ġimp ute +Ġfilter Statement +Response Wrapper +Le ad +Ġeval ml +Ġeval Str +Class Instance +tree map +Ġsupp lies +Ġmath utils +ĠYou Tube +58 35 +State Trap +ĠTest Env +ĠNo vember +Ġweight ings +User Profile +SS A +style gan +Ġlib cloud +Trans mitMode +IND ENT +ctx s +Ġav lMode +çļ ® +Th rows +Th ursday +çļĦ æŶåĢĻ +At ten +PL ATE +PL AIN +fs coer +ets Bar +ĠUser Warning +Up Notif +Sh ard +49 87 +RES UME +RES TRICT +Ġwas m +Ġgraph ical +Ġgraph viz +decode Binary +Context s +Ġ"\ [ +}\ " +CC D +CC APS +Ġfont Size +AA U +(* ' +Ġtri mesh +Ġdocument o +Ġsa mplerate +fla p +fla vors +API Key +Al ways +"); ', +gg hh +dec lared +QL ineEdit +69 06 +admin istrator +Ġsu as +other wise +hed ra +For ms +ĠDict Mode +é simo +gest ures +Sp in +Ġnon dominated +Ġclo udify +FL C +sin av +hel m +ee ks +drop level +Ġge ar +PU D +math cal +google url +Auth Server +Auth ority +,' |') +ĠBase Estimator +ĠEn ables +Ġthread pool +UP ER +non an +Ġì Ļ +('/ ')) +ICs All +ICs Page +ICs Den +ICs NPT +Pos ixPath +ĠMan ip +ĠMan aged +Dis count +can e +can cer +ha arc +sen ha +Check sum +ĠFile Lock +fill ment +Ġpack ing +threshold ing +áĥ Ĵ +sd p +Ġstruct s +Ġpick s +transp osed +ĠApp lies +Ġmeta func +.* ", +Ġvi rt +alle us +Item List +ĠLe ss +We apon +Array Wrapper +OUT DUPL +Mat Mul +ĠFOR CE +jnxMbgSgw V +fc ulty +Ġsuper set +Ġgen omic +Box es +uter onom +ĠLog ical +lon d +Command Error +Ġconf test +js Apdu +Ġbl una +success ors +sers ic +times lot +PS F +tool tips +ĠAc celer +DR AFT +Ġaut ore +("- ", +âķ ij +á» £ +short Name +cr bug +Ġsig num +collection List +Min AddressLength +čĊĠ č +VID IAN +={' ': +Ġcommon s +aut y +aut or +Query Set +DX L +à° ® +à° ¯ +GN SS +Service Descriptor +screen cast +Ġvari ational +Ġassign s +Ġstack er +hs l +Ġ'{ :< +Down Notif +Row Counts +bb ing +ĠFunction al +SP HER +ĠSer vers +duc tivity +high res +high lights +ĠTrans mission +ĠLO OP +pick led +CONT INUE +Ġæ Ķ +Ġæ Ŀ +Peer Name +Peer Sgt +boot strapping +Ġ19 16 +Dire ctories +GO V +GO OD +Ġclose ness +Ġclose Enemy +IF D +Ġchunk ing +Ġpr j +Ġface tool +ĠInter action +With Time +dash if +åĩ ı +Ġsimple st +Ġsimple gui +åį ĩ +alg os +EC B +Ġds P +Ġwin ners +gl Enable +Element Type +Go ing +ĠHTTP S +ka iming +lst sq +Ġ"{} : +³ółģ ¡ółģ¿ +ĠReg ents +Mon key +Mon day +dc n +SFP Info +SFP Vendor +look back +rr d +rr r +WE LL +And Output +big Ntuple +router Domain +Ġdes kew +ĠObject Msg +ĠDes ktop +01011 1 +proc man +edit able +Ġп ол +010000 111 +Ne o +Ġcar act +205 6 +reverse Complement +Ġbyte code +Ġvol atility +Ġri p +æł ¹ +ĠNode Clustering +Ġbuffer ed +cn v +}/{ :. +Ġanswer ed +ĠNe uro +Exp iry +Spe ak +original Egg +Dec isionTreeClassifier +Ġdig ite +ĠIniti alizing +Loss Alarm +}] " +Ġts utils +pm ids +ino is +REG IONS +Interface List +ĠHe ssian +Ġexport er +IV s +å¯ ¾ +Ġcross over +ideo logical +ĠAD T +Ġorigin ator +Ġdiscord bot +ĠNet CDF +Engine ServiceClient +under linen +parsed Args +dh od +ACC AG +в еÑĤ +ĠProject parameters +ĠProcess or +éĻ į +Val ve +Ġè ´ +eth anol +eth nicity +iso ma +214 2 +æľī æķĪ +cons umption +Ġbook worm +Ġverify ing +LU A +NAM ED +phi Rb +RS K +It ens +ENS ITY +915 8 +organ ic +PA E +Ġexpand tab +Ġtab index +Anal og +ä¸Ń åĽ½ +arc sec +Current Dir +208 5 +208 9 +good names +ĠIO HeavyTest +CN RM +297 2 +Dep endencies +Ġgre yscale +watch dog +Ġsyn chronous +Stop Iso +906 7 +åİ ® +SY M +ĠDescri be +иР¶ +sur vi +sur faces +micro states +micro bial +syn set +HW Pri +("[ *] +gm x +ĠFind ing +ü k +ü ck +207 7 +203 7 +jnxMbgSgwPP V +295 0 +DP MIS +jnxMbgSgwIf V +315 3 +Initi alized +proj id +DIM M +306 1 +ä¼ Ĭ +visit Lexer +305 3 +Ġfs leyes +nav igator +ye arn +ÙĦ Ùħ +Ġcover ing +ĠBe havior +hit object +Rest aurant +304 1 +304 8 +Import s +Ġlock s +pur ity +Ġair foil +demo graphics +("{ : +424 5 +397 4 +FQ o +aby tes +Sgacl Enforcement +åĪĨ æŀIJ +åĪĨ åī² +Optim al +Optim ize +Ġ---------------- -------------- +dark orange +dark cyan +287 1 +ĠBlock Row +Poly Data +Poly axon +ĠØ ´ +Ali g +284 6 +307 3 +427 5 +Ġorgan ized +236 6 +236 7 +Inst ant +406 4 +GC G +ĠStruct ured +è¾ ¾ +interpol ated +rist mas +subnet s +#---------------------------------------------------------------- ---------------- +SK IN +288 2 +334 9 +sock sr +Hub Message +Ġ'$ { +422 8 +Ġent ão +436 9 +ÙĪ ÙĨ +rich ii +STATE MENT +Ġti pos +Ġti ene +388 4 +Ġ44 100 +426 1 +426 8 +303 1 +Ġaggreg ates +Site Map +Ġк оÑĢ +385 6 +385 8 +cg f +water mark +corre late +MIS P +м еÑĤ +Ġhold ers +457 2 +457 7 +457 9 +boost ing +337 9 +ham crest +Product Type +ìĦ Ŀ +fish er +Send Text +ĠStorage Type +MON STER +æĸ¹ åIJij +vet ype +ĠTop level +ç± į +Ġsampling Time +Func ion +Acc XFP +AZ URE +Volume Claim +CUR SOR +aco te +Ġ-------------------------------- -------------- +405 4 +Non Zero +æĸĩ件 åIJį称 +Ġcutoff s +314 1 +DN X +Dim Shuffle +Ġprote ins +Exit Error +Pod To +ðŁ¤ · +ĠSupp ose +но е +но ÑģÑĤ +Ġ################ ########## +Ġ################ ######### +Ġ################ ############# +ĠEval u +ĠPe ssoa +cpwVc IdMapping +cpwVc PeerMapping +Ġide mpot +ĊĊĠĠĠĠ Ċ +ĠBinary IO +ì§ Ħ +Colour s +è me +ĠĊĠ ĉ +缮 çļĦ +Ġpv FrontSH +Bin ar +å§ ĵ +infer no +Sur rounding +Ġ################################ #### +иÑĤ ел +PROCESS OR +emit ter +Ġopp osed +Ġ#-------------------------------- ----------- +ĠSequential Sampler +kv magent +åįķ åĩĢæµģåħ¥ +Cloud FS +ĠAccess Token +Rob ert +Ġsal a +Ġsal do +ĠTw isted +Vari ational +ĠVe hicles +Axes Subplot +bow l +ĠBuil tin +,:, :], +åİ» éĻ¤ +ãģĦ ãģ¦ +Ġmicro scope +('_') [- +Fill er +QR ad +bas arim +nes ota +ε Ïĥ +ãĤ¹ ãĤ¿ +MOD ES +ĠCalcul ation +ĠCalcul ations +ĠCommon s +Ġfits io +Ġphot ometry +Analy ze +Ġperm ute +Modified AccessConditions +})) }, +ĠFast Ethernet +ĠPAR AMETER +Ġht m +conj ure +slow queryhistory +æĺ¯åIJ¦ 为 +sam tools +Quest ions +Ġrt na +CHO ICE +vtk Image +discord app +ĠPlugin s +zZ s +ØŃ ÙĪ +bol t +äºĮ 人 +Src Port +ľë ĮĢ +ĠEdge Sampler +Ġfac ial +nthe size +Atom ic +ĠPur chase +eti cally +ĠLED s +Ground SH +Ġreshape d +Ġmemo ize +ĠTool kit +Cli Format +Ġtopo logical +ĠSort ing +Ġ################################################ ### +Ġbuy ing +ä¹ĭ éĹ´ +Ġemit ting +ĠGeo JSON +ĠAL TER +ĠNaN s +rie ving +ĠCli mbing +shuff ling +maybe Deferred +sta fi +unix time +ĠFri day +_{}_ {}. +Ġindependent ly +Ġonnx runtime +joined List +Adv anced +ĠXXXXXXXXXXXX X +Unicode Type +ĠHash Mode +isol ation +:::::::: :::::::: +Ġíķ Ħ +rig ation +Ġconven tions +认 为 +æĦ Ł +Ġcad ena +ĠHo liday +:** __\ +Fri ends +Sat urday +hom ogeneous +dB m +â ng +ENTER ASYS +CERT IFICATE +setStyle Sheet +TERM IOS +çĪ ² +Sparse Tensor +voc abs +Ġnest e +DEC IMATE +Quantum EngineServiceClient +Mol From +è¶ Ĭ +ĠAug ust +Ġher mes +Ġacceler ometer +ĠSS PI +ĠHigh lands +èĦ ¸ +Ġtim ings +Eff ective +éĴ Ī +Ġsus picious +tac tic +projected X +Ġsignificant ly +domin ance +Ġscraped title +101111110011010000 100 +Spectrum Analysis +fault s +ĠAct ually +mst p +('+ _ +Horizontal Flip +Hostname Str +collide point +Ġо ÑģÑĤ +ĠHeat CapacityGas +ĠPredict ed +Ġguarante es +Should ExitError +hpnicf VoiceIfCfg +Ġdol t +Ġdol fin +å¤ĸ éĥ¨ +å¿ħ è¦ģ +ĠInline KeyboardMarkup +å·¦ 侧 +Bulk Update +Tracking Only +WORKER STATS +Ġelimin ar +Alg Error +Ġprovision s +âĢľ , +Ġmist ake +asp berry +Ġ"** :: +Ġaf et +ĠGENER AL +Ġdeco y +West ern +burn in +Ġsched uling +PROB LEM +CORE WORKERSTATS +Elt s +ëĤ ¨ +Ġtal ib +Ġcontra ctions +Sky ConfigFactors +#---------------- ---------- +dip loid +ĠAnn ual +ĠAnn ouncement +ĠMC MC +Invert ed +Ġdefin ite +ĠWE IGHT +rub ika +Ġëĭ ¨ +crow dsource +EXPI RE +ê°ľ ìĿĺ +æ» ¤ +åijĬ èѦ +Ġblueprint s +ĠPolyaxon ShouldExitError +ĠBer noulli +,,,, ,,,, +Ġalg os +áli da +Ġdifferenti ate +nans um +='* ') +Ġcapac ities +Ġpaint ed +brow sing +Ġsap HostnameStr +ĠINST ALLED +Reflector Dist +Placeholder Text +IPP ING +Forecast Manager +IOHeavyTest Event +ICsMan IEIncor +ĠSubmit Field +IEIn corr +Ġcite keys +Ġcategor ia +ĠBag gingClassifier +CHANG ES +ĠìĿ´ë ¯¸ +Bullet List +Gal axy +Ill uminant +Ġtie mpo +ĠæĮ ĩ +Pic Url +asser stein +Ġattri bs +################################################################################################ ### +nex us +thrust ers +COMMON TAIL +æ¶Ī æģ¯ +interpret ation +morphology Ex +isot ropy +ãĤ« ãĥĨ +Webs ite +'''''''''''''''' '''''''''''''''' +ì¤ ij +ĠCCACHE OctetString +observ ables +ToDo List +aic vals +kel urahan +Ġ################################################################################ #### +ĠÑĢаР· +Ġble u +ĠScal ing +ĠGre aterThan +autoc rop +vcp kg +ADJ AC +ĠciscoDiaBaseProt Enable +Ġfsw RWVoltage +PUR PLE +jog ador +ĠLex Token +ĠPolyaxonClient Exception +PERCENT AGE +Ven ice +Ġplas mid +ĠGene tic +说 æĺİ +Ġglo m +Linked List +qsfp Acc +qsfp Ntw +Ġï¼Į / +ĠRadi us +ĠJaco bi +ÑĢам м +Pump kin +ĠIG MP +Ġ{}% ". +DRO POUT +né es +Ġellip tical +fog lamp +REUSE ADDR +overla id +govern ments +ĠorderInformation BillTo +ĠпÑĢовеÑĢ Ñıем +ĠiÅŁle mi +REMA INDER +ĠWalk ing +ALG ORITHM +ãĥģ ãĥ£ +Une mployment +CLICK HOUSE +Appear ances +Fingerprint er +ĺìĿ´ ì§Ģ +COMPUT ER +thrott ler +SMT BF +ĠTEMPL ATE +ENCRYPT ED +metter ling +BROW SER +Cfn Stream +PICK LE +ICsOpt IEIncor +继 ç»Ń +Genotype Phenotype +ĠìĦ¤ ìłķ +DynAd Occ +Ġiner tial +ĠLedger jsApdu +ĠMir antis +Acct Server +SMO OTH +mTest e +Ġbog us +Mosso CloudFS +Ġfreed om +summon er +ĠAddition ally +ĠQUANT AXIS +ëį ¸ +DATAS OURCE +Ġpico script +ĠWHAT SOEVER +daat And +Improve ment +Ġaic vals +ĠFOLD ER +æįŁ 失 +Fitted Error +Ġpyang bind +avat ars +ĠCONSTANT S +液 ä½ĵ +WHE EL +cepth ook +Ġddu Consumption +ĠVoter MemberId +interfer ogram +dBase Port +SetTable Value +ColumnFamily Request +protot xt +HANK AKU +barch art +restructured text +Ġvcp kg +ĠBPlus Mode +ROIP hysical +ALESC E +ĠQHBox Layout +etsBar Space +ICsDen INRat +ICsNPT SIAdbr +uteronom ium +VIDIAN etV +underlinen av +DPMIS CCAPS +ãĤ«ãĥĨ ãĤ´ãĥª +GenotypePhenotype Map +! : +" âŀŀ +# { +# *** +# ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +' // +( ` +) "). +) ?\ +* "], +* [\ ++ | ++ )* ++ ]( ++ )/(? +, { +, {' +- *- +. '} +/ +/ +1 925 +2 255 +2 115 +2 191 +3 107 +3 147 +3 167 +4 256 +4 163 +4 145 +4 142 +4 189 +4 152 +4 928 +6 011 +6 91 +9 80 +; $ += # += ()) +> '] +? ( +A st +A ware +A merica +B id +B os +B arn +B SC +B ird +B UND +B asin +C k +C ra +C BE +C tl +D ub +D ag +D AV +D asy +D omin +D ynOv +E f +E co +E ther +E gress +E scape +E pic +E quipe +E lizabeth +F unds +F ruit +G host +G ym +H CO +H UE +H appy +I AC +J T +J ET +J ets +K IND +L ig +L UT +L aw +L ik +L ater +M arg +M sc +M ah +N pt +N AT +N ortel +O pp +O UI +P ag +P si +P URPOSE +P BE +P ENSION +P icture +P ictures +R ent +R io +R obo +R TX +R atios +S en +S ine +S AR +S CT +S AC +S DS +S afari +S obel +S PATIAL +T an +T IT +T yp +U art +U FF +U aj +V it +V SC +V rf +V FD +V BN +V BD +V IMS +W O +W U +W il +W AS +W IES +W edge +W arnings +Y QQ +Z c +Z EL +Z TP +[ {}] +] % +] ': +^ _ +_ ')) +_ ]* +` ") +a ap +a CT +a demic +b lab +b db +b mi +b idx +b ca +b cast +b Cell +c lic +c ba +c ables +c anceled +d name +d ls +d pd +d HR +d runk +f am +f est +f uj +g O +g ad +g ith +g ift +g cm +g unicorn +h art +h ob +h alt +i time +i ão +j O +j ek +j ordan +k T +k te +k ot +k ay +k ai +k dl +k owski +l B +l I +l vars +l ı +l ncRNA +m ight +m uc +m ni +m gz +m ubar +m cafee +n L +n N +n iz +n ml +n Number +n ake +n This +n atom +n rd +n ica +n amer +n reps +o ere +o pec +p Y +p lo +p act +p ants +p inv +q VS +r Q +r ão +s G +s mp +s iz +s fc +t J +t P +t um +t pos +t é +t series +t cod +t MER +t Stage +u H +u U +u set +u ced +v K +v key +v rt +w C +w el +w ife +w agta +x G +x O +x Q +x q +x ar +y ar +y edges +z N +z P +z T +z v +z mb +z std +| |\ +} /" +} {\ +¥ ółĢ +´ ��łĢ²ółģ¿ +Å ŀ +Ï į +× ¡ +â ĨĴ +æ ¦ +æ IJ +ç į +ê ŀ +í ħ +ï ª +ĉ ĊĊĉ +Ċ ³³³³³ +Ġ Õ +Ġ urn +Ġ arn +Ġ **************** +Ġ ĉĉĉĉ +Ġ 对 +Ġ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ +Ġ ÏĦ +Ġ åij¨æľŁ +Ġ еÑģли +ĥ åĽ´ +į ãĥ« +ı ¬ +ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠ ĊĊĠĠĠ +in z +in File +in jection +in ferred +in tial +er f +er ative +or ca +or enz +on ing +at y +at iling +re k +re ma +re base +re starts +re moves +se ti +se as +se ms +se ven +se asons +st p +Ġt old +Ġt graph +Ġt ctx +Ġt axes +al and +al Ä±ÅŁ +de ter +de volo +an ch +an je +an ça +Ġi data +me Account +Ġ' ...' +Ġ' >': +ti fied +Ġc gn +Ġc itations +Ġc ensus +Ġp on +Ġp nt +Ġp join +Ġp ops +Ġf os +Ġf ir +Ġf abs +Ġf submission +Ġf ugue +Ġf iscal +Ġ" >= +Ġ" ?" +he i +lo d +lo py +00 91 +ge fyra +ce u +', " +Ġn ur +Ġn ats +Ġn bits +Ġn atom +Ġs ac +Ġs print +Ġs ib +Ġs ou +Ġs so +ut put +ut ting +ur f +ur sen +ss aging +Ġin spe +Ġin validate +Ġin sensitive +Ġre format +Ġre base +Ġre calculate +sel lers +Ġo ss +Ġo cid +Ġo posite +Ġd ens +Ġd orm +Ġd rf +Ġd cg +li are +li eve +ct t +un named +un bind +un cio +un selected +un marked +un necessary +Ġm ss +Ġm sec +Ġm tl +ra f +ra ze +Ġe dict +Ġe cal +Ġe of +la unay +() # +() ])) +() }/ +ent rez +co u +co gs +ri m +ri scv +Ġb cs +Ġb other +Ġb logs +Ġb anks +Ġb rowsers +ed en +11 13 +11 36 +11 21 +11 42 +rom ag +um ap +id as +Ġ( $\ +Ġ( *. +ch au +ch allen +ch amber +te aser +di ci +): ', +and re +ma king +ul ink +== { +ol ite +ol ly +el b +el ine +el ler +': { +is ci +is link +__ =' +__ [" +__ }") +get Symbol +get sock +get Vertex +get Associated +(' ? +(' ... +(' {}_ +(' ='* +set opt +set Position +set Font +set Vertex +ĠT AB +ĠT AGS +ĠT axon +ĠT aste +ĠT aurus +ĠT ouch +xt ypes +il lo +th ic +th ick +us i +str un +Ġreturn code +con es +con formance +Ġ2 85 +Ġ2 95 +(" ;") +pp a +') [- +') }]", +as pending +as contiguous +op md +ve m +ve v +Ġis i +ĠS ending +ĠS tell +ab lish +ĠC B +ĠC X +ĠC UT +ĠC riterion +ĠC RS +ĠC USTOM +up os +up hin +Ġg is +Ġg ff +Ġr state +Ġr tt +Ġl er +Ġl relu +data iku +ĠA i +ĠA x +ĠA VA +sp f +sp ro +sp ine +sp acer +sp iral +'] ** +01 34 +01 46 +Ġcon ds +Ġcon sec +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ic lo +to bool +to csr +99 66 +Ġ: { +path Item +path way +ĠF T +ĠF le +ĠF EN +ĠF und +ĠF ocus +ĠF acilities +ĠF ELIX +qu ark +qu ina +log This +om l +value Type +vi v +vi ctory +Ġh ik +po lish +po gre +ĠP s +ĠP AD +ĠP adding +ĠP ending +ĠP auli +ĠP rune +ĠI MM +file h +file sets +ĠL AN +ĠL AY +ĠL hc +ub s +res amp +res hed +Ġth ous +Ġde w +Ġde conv +0000 1001 +Ġ""" .""", +pt op +ex ico +im u +Ġex pt +Ġex cess +Ġex peri +Ġ3 18 +Ġ3 87 +Ġ3 90 +Ġ3 45 +Ġ3 67 +Ġ3 63 +10 44 +ase q +out f +ĠD G +ĠD s +ĠD ARK +ĠD CG +ĠD XL +ĠD ynamics +ac ent +Ġu time +Ġu ży +ert z +Re pe +Re fs +Re cipients +app en +app name +sh it +sh ad +sh im +sh dr +sh ipping +Ġdata point +ĠM ult +ĠM aker +ĠM unicipality +if config +xf ex +xf cu +Ġv or +Ġv data +Ġv map +Ġv npy +02 55 +02 75 +02 54 +ext def +ĊĠ ĉĉĉ +ĠO SD +ĠO ffic +Ġpar ametri +Ġx lrd +Ġse cp +Ġse lections +Ġse gu +ack s +Ġor bits +add Attribute +ER CE +IN NER +IN ACTIVE +tra cis +Ġfile mode +Ġpro posals +Ġpro ficiency +py data +py module +py cache +py curl +art ers +pre defined +pre emp +ls N +07 02 +07 05 +ang ling +xd av +label led +ber ny +Ġbe an +Ġbe aring +Ċĉ ĠĠĠĠĠ +"] ][" +"] ==" +ĠB il +ĠB ush +ĠB IO +ĠB rowse +ĠB ento +Ġname scope +ĠE LE +ĠE rd +ĠE TF +ĠE psilon +Ġj av +Ġj upytext +ci rr +ob is +Ġ< -- +text o +AT ING +AT MENT +AT GT +AT TA +xa en +ans as +ĠN U +ĠN LL +ĠN ome +date util +ir it +len ght +################ ##### +Ġ4 24 +Ġ4 55 +92 07 +92 57 +In dependent +In dicates +In Seconds +In sira +ĠR G +ĠR I +ĠR od +ep rint +Ġun link +Ġun subscribe +Ġun resolved +Ġun suitable +OR N +read file +32 57 +32 23 +32 28 +32 38 +32 83 +32 68 +32 63 +per manent +per petual +ĠG A +ĠG st +ĠG ro +ĠG as +ĠG AS +ĠG old +ĠW rest +ĠW heel +tri u +tri mming +Con str +ĠV S +ĠV ampire +ĠU s +Ġvalue d +Ġ5 80 +Ġ5 60 +ib ili +Ġan alis +Ġan atomical +Ġan omFlag +Ġfrom list +Ġfrom string +Ġen i +Ġen er +min hash +IT HER +Ġtime frame +Ġ> >= +18 04 +18 22 +18 28 +18 65 +18 91 +18 31 +18 41 +16 87 +sa ves +cur vetype +Ġk illing +Ġcol lisions +25 04 +25 82 +Ġro lls +Ġpy open +Ġpy rado +ag u +04 64 +04 74 +og ue +06 06 +15 04 +15 05 +15 64 +SE LF +ST T +ST RIP +max x +ass umptions +03 08 +03 67 +jo u +we D +we aver +we ibull +ip sec +17 05 +17 64 +17 88 +17 09 +17 50 +17 65 +17 67 +Ġal ph +dd t +dd le +dd ing +14 34 +14 94 +Ġpre ci +Ġpre cord +Ġpre paring +ne utr +Ġat é +64 09 +Ġob serving +Ġra gged +Ġdefault Value +([ {' +count NonZero +RE CONNECT +Ġtra js +08 09 +main der +22 41 +Ġ. \ +ĠH A +ĠH en +ĠH ue +ĠH ST +ĠH air +ĠH ybrid +ĠRe cent +sub command +sub stage +sub graphs +88 67 +19 46 +19 71 +output Path +lin Tox +image Path +comp arator +comp rehend +34 99 +34 22 +34 33 +34 54 +34 49 +34 155 +start Ep +84 15 +84 08 +84 47 +ĠIn voke +write log +ere z +27 91 +Ġkey tab +bin size +Ġle akage +ill ary +24 98 +24 67 +24 43 +24 49 +24 61 +37 05 +Pro ble +Pro vided +em an +Ġ-> " +Ġsub titles +Ġso lo +96 22 +Ġcomp oser +Ġcomp liant +ĠCon tacts +Ġnew L +33 86 +33 82 +33 62 +33 51 +json data +Name Text +node map +row dsource +av b +87 97 +Ġline list +AL GO +Ġclass ified +Ġclass Tissue +fic ação +CT GCT +Data Path +85 06 +97 84 +97 56 +back test +36 12 +36 16 +36 86 +Ġspe arman +011 10 +Ġopen ssl +ĠK ri +ĠK im +95 76 +95 74 +lat ing +Ġ'- >', +86 99 +86 15 +86 68 +26 19 +Ġmax sum +Ġdo ctree +Ġjson OK +init Array +HE P +HE LLO +AG AT +57 14 +57 09 +Ġ| ( +reg on +reg num +reg istrar +Ġtf lite +Res lice +ix z +do y +Ġfil tr +CO OR +man us +ach ines +trans ferred +23 93 +23 88 +AC GG +Ġstart date +lag o +Ġli pid +44 24 +44 87 +44 57 +ðŁı ĥ +Ġdis allowed +80 93 +Ġtext ures +cor rs +mail to +']) ]) +En ds +En dian +En zyme +Co UC +Co VC +28 21 +Ex ceeded +ET D +ET V +so lo +56 87 +56 75 +Ġpass lib +Ġsp c +Ġsp acings +client e +client Name +client Id +38 20 +my dict +my token +ĠUn ivariate +check udata +title size +uc sc +Ac quire +ĠQ FileDialog +ĠQ VisaUnitSelector +AB BR +AB IDE +ud antes +Buil t +Ġus aspending +space token +Ġmo tifs +AD B +',' / +',' \ +Ġad anet +45 04 +45 84 +45 97 +amp amento +cent os +Ġerror code +atter bot +ĠY outube +ĠY ELLOW +act ing +ĠX ml +ĠX ilinx +CH ART +cc cc +call Path +47 65 +]] ]]: +Ġcode points +Ġenum eration +Ġenum erator +101 000000 +tf gen +Ġpos Y +Ġ9 02 +Status Indication +Set Draw +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +pl r +')) ), +Ġgener alized +83 15 +Ġver tice +ĠIN FRINGEMENT +ĠIN NER +46 16 +46 13 +46 22 +46 55 +PE P +ĠJ inja +Lo BES +89 84 +ĠSt uff +ĠSt udy +ld st +Ġread file +Ġread line +Ġread ability +Un iversal +Un certainty +Ġq b +Ġq sub +Ġq keras +UL A +To Ret +De li +ost o +Ġseri e +Ġseri alizing +cat l +43 12 +cl ing +ĠPro grama +CL AMP +search from +Ġcontin uing +vo ir +Ġpoint ed +SI R +SI US +SI GHT +ug rup +Ġqu er +EX F +ĠData Source +а Ñı +total Matrix +ãģ ĺ +Path o +debug Log +Ġhttp x +âĸ Ģ +ĠIS S +ĠÐ ŀ +game Id +Ġ'/ . +Ġ'/ ../ +(- _ +39 11 +39 15 +39 85 +Ġsave Path +Ġ", ", +bl r +================================ === +(\ "\ +tmp Name +tmp Array +31 93 +PAT CHED +Ġframe buffer +Key Mask +Ġauth enticating +Dict s +now ait +Ġ', \ +Ġtop lam +ĠCo efficient +Ġimp ression +Ġ... ]) +String Query +argv s +Comp ress +Comp lier +stack frame +OL T +Ġiniti alizers +58 99 +58 55 +Ġ12 94 +Ġ12 87 +Out bound +ĠTest Show +Ġlocal ity +Ġdest inations +Ġbin file +Ġbot toms +raise load +Ġroot fs +ĠDe al +sw arm +Ġproject or +sor tium +ĠRes ol +Th ickness +Th umb +PL ANT +fs x +cell setpath +ĠUser Error +QU ER +Up loading +Sh k +ba as +Int ro +49 14 +Ġmap Dict +URL FromList +---------------------------------------------------------------- -------------------------------- +---------------------------------------------------------------- -------------------------- +202 3 +Request V +CC FLAGS +Inter actions +Inter vals +*( .*? +Not An +resp onsive +Ġph ones +Ġapi key +################################################################ ## +69 01 +н ÑĪ +TE C +Ġ'\ ". +rap heme +inst ant +lan es +des ol +Ġmon ster +sm ile +Ġclo sure +Ġref ined +ĠLo an +bit bucket +Ġret code +Ġret ornar +Ġge de +Ġge ese +Pre v +GR PC +Sub class +ĠAPI Exception +Ġlaw s +Auth enticate +af fix +NO p +NO x +NO wG +ĠEn crypted +Dis creti +can v +]+ '. +tt k +ĠFile Name +Ġepoch len +cip d +Ġpack s +Ġ'% ' +any thing +center grid +engine er +Constraint Cmd +Ġnn abla +Ġgame Main +Mode Keys +ĠApp s +Per m +Per forms +Or Create +Ġspec show +cm n +á metros +alle les +Event Loop +ĠKey ed +ĠKey words +ĠLe akyReLU +Ġresp ons +ĠComp et +ĠComp etition +ĠComp rehension +xab W +Ġmer ger +Ġ18 00 +"} ): +"} ). +åIJ ĥ +Load Module +cf m +Array Size +mag netic +æķ° ãģ® +cos ity +ĠCol umbia +'{ %( +Ġest ar +rl HistoryControl +none mpty +Ġaccess or +ĠImport ant +cla des +!! !') +EXT URE +commit ted +ret amente +BO M +BO S +Mo ved +=\ "" +ĠLI GHT +ACT OR +ĠModel ing +ĠEX P +çĶ ļ +CRE ATION +è¿ Ń +js ns +AIN ER +Ġmulti part +Met ro +ठ§ +Resource NotFoundException +GG A +vol atility +ĠURL Error +ĠAc tivate +ĠAc cepts +skip If +DR A +Ġneg ated +á» Ľ +á» Ŀ +Ph en +gh i +Ġcore ml +Ġ') ': +("% . +bn ds +PAR ALLEL +CONFIG ENTRY +ga zebo +named Window +rest api +rest aurants +aut oref +Query Class +à® © +Ip Mask +ĠAl bum +Ġdat atest +Ġfra se +ii DA +Hel vetica +fl x +Graph Def +fr q +Ġvari ety +ĠPre view +ĠPre sets +ĠSh r +Ġfail ing +pa ssages +Search er +åĬ © +termin ator +)+ ','+ +ä¸Ģ åĢĭ +åŃ ¸ +exc info +)} } +Ġ'{ ': +ros msg +Var Type +Var Desc +ĠRE CE +Ġë ª +Ġë ½ij +car tesian +unch oked +MENT UM +expand ables +Ñĥ лÑĮ +public ations +Ġplatform io +duc ers +Ġfeed er +CONT RIBUT +("/ "): +Ġcenter ing +ĠSub missions +ĠDis pose +ĠNO W +MET ER +Red ucer +Red undancy +ĠFla vor +ĠOn tology +super seded +super pmi +mar ily +GT I +tw isted +ĠIP Addr +Ġbit rate +ĠInter pol +percent maxhp +With Logits +åĩ ¦ +ima get +å¾ Ī +ĠRequest Id +PH D +Ġcat álogo +Ġcat alyst +个 æķ° +cross over +Ass igned +ka j +Ġchain ing +Ġpayload Dict +One Drive +Mon roe +forward ing +Ġap iclient +Ġexecute SQL +And G +DIS CORD +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ +poly axon +################################################ ######## +ĠDes erialize +Target Obj +CHECK S +CHECK OUT +ĠDi vide +Ne umann +Ġcar ried +205 8 +205 9 +pret tify +æł ¡ +ĠNe ptune +>" ; +čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠ +Ġborder width +ĠSE P +Exp Now +sol n +ĠRo ss +sal do +204 6 +kp is +star Data +}] '. +diag nostic +ĠDec lar +ĠBE LOW +VC q +Sw ift +ĠCont ents +ana conda +ĠPO OL +ua is +Ġcross refs +ĠSp awn +00011 01 +Ġorigin als +POS Map +BE FORE +FC N +bra ke +ems dk +ĠTra ined +ANG PATH +Ġexecution Time +216 9 +Ġfo ol +Delete PomeriumSession +city scapes +ĠMon omial +Failed Error +analy tic +yl ko +214 7 +__)) [ +ĠRandom Sampler +hy dra +den itialize +234 1 +WR RR +Ġequ ity +Main URLFromList +CF Bundle +COMM ERCE +Ġsn r +PA USED +Files Array +264 8 +resid ential +Ġanaly zing +¡ółģ ¬ółģ¿ +Fin ite +Transaction Event +206 5 +pas sengers +208 8 +217 4 +297 8 +Ġarti sts +="" : +Real Time +Ġmis ses +LOAD ER +301 7 +åĨ Į +௠ĩ +Ġdeal er +Ġsol vers +Ġsnapshot file +men or +905 7 +]( / +cdbp AppAdvToPeer +ĠMin os +flip ud +ĠÑģ каз +Host s +sb ag +separ ador +Ġ{: }". +ü l +ü m +Ab orted +207 9 +DP BLEND +Ġ================================================================= ========== +299 6 +299 8 +Ġcast ing +315 2 +315 6 +DK J +Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠ +flu ency +ĠDoc With +225 1 +305 1 +296 7 +456 6402 +ĠTable s +ĠEng land +ste ak +UK A +Ġproc man +Call s +308 6 +between ness +stick s +Ġsimp licity +Ġconstruct s +Ġrefer er +286 1 +Ġden oting +(", ". +¢ółģ ¡ółģ¿ +ĠMet er +403 8 +Ġdetermin ant +ĠQuery Modifier +284 7 +Ġâ ĺ +236 2 +236 5 +406 6 +è¾ ĥ +209 8 +FILES YSTEM +Li quids +Ġdiag rams +422 3 +394 5 +tv showtitle +Ġbi ased +å¸ Ń +meth uselah +大 åĸľ +237 6 +lam da +Ġpdf miner +ĠSign er +NV API +Ġbra ce +426 2 +Ġк ом +395 1 +395 6 +ан ие +ĠBar rier +Release s +387 2 +387 5 +387 8 +ham mer +437 9 +ĠAuto Scaling +Ma intainer +ภ§ +ĠMap a +ĠSET UP +ĠCar ousel +Ġ; """) +Root Node +bm v +NODE OPTIONS +Mer ging +construct ed +PROC ED +repe tition +Ġwire frame +ĠRES OLUTION +opp ers +Ġ-------------------------------- ------------- +buff s +smart plots +Ġang A +ĠdocsLoadBal CmtsCmStatus +å¦Ĥ ä¸ĭ +å¦Ĥ æѤ +Timeout s +inline Callbacks +ĠvColumn s +Ġflu idity +Ow nership +ĠSupp ly +ĠSupp lies +Ġvtk Transform +design er +Ġll vm +ĠUN ION +285 3 +ëĬ ¥ +Ġ################ ## +Ġ################ #### +AST IC +Ġsky All +Ġtex Coord +Ġderiv ation +applic ator +Ġhar monics +Press ures +accum ulated +vx lan +geom s +Sq rt +OVER LAY +OVER RIDE +Ġlaunch ing +SIGN AL +áĦ Į +ilation Rate +FILTER CAPS +å§ Ķ +Ġdigit ado +scr ub +Ġslow est +ĠFin ite +ĠFin ance +ĠPage NotAn +Sur f +Extension s +PYTHON PATH +èµ ĸ +ĠSingle ton +``` ' +ðŁı´ółģ³ółģ© ółĢ° +Ġ#-------------------------------- ------ +ت ب +Spect ra +Na ive +´ółĢ ³ółģ¿ +Ġhy phen +docsLoadBal ChnPairs +Ġsal ine +ĠINPUT S +Ġtran scription +Ġmount point +ĠTw ython +ĠDete ctive +Book ed +TASK S +éł Ĩ +10011111111 00011111111 +Ġtech nology +ĠModi fier +435 4 +VI OL +music xml +ĠDraw s +Ġbri cks +forecast day +ĠRow ing +ĠEl lipsis +CONNECT ED +Ġìł ľ +ÄŁ er +Hook Option +Calcul ated +模 å¼ı +ĠBot tom +ĠSto chastic +Fill Box +è´ Ł +umin ance +ë¥ ĺ +phy Addr +bv h +ε ί +Ġrecogn izer +Slot s +HK DF +Ġwalk ing +snap ped +Ġcr bug +ĠConnect ed +ç¼ Ģ +Ġinstanti ation +Ġsear chels +ðŁı´ółģ°ółģ ´ +)| ( +éĢļ çŁ¥ +camp us +Ġcontinuous ly +ortho gonal +åıª æĺ¯ +fort une +}% ", +TRANS ITION +Ġmagnitude s +åĵ į +sand y +POSITION AL +Ġposs ibilities +snmp Trap +ĠSensor Entity +Std in +Pol k +Pol ynomials +Choice Field +priv key +ä¸ī 人 +åĨħ åŃĺ +Oh io +ли ка +Ñİ ÑĤ +Disk Image +ĠRender er +Initial Stock +Turn s +hack athon +ĠSM ILES +Lookup Table +Creation TaskSpec +Ġaffect ing +Src Addr +čĊĠĠ čĊĠ +0000111100001111 0000 +0000111100001111 00001111 +1000000 1000000 +Ġmse val +ĠmscModVcs Wins +Ġ#------------------------------------------------ - +gredi ent +Ms Carrier +Ġabsl test +ĠRule s +Abstract Item +nom bre +ĠML MD +tell er +Google Earth +GU ESS +Ġsecondary Track +ãģª ãĤĭ +TestModel Eltwise +Diag ram +Cri ar +uss r +rout ines +Ġhighlight s +Ġhighlight ed +çħ§ çīĩ +NY C +ĠFit ting +802 11 +ðŁı´ółģµółģ ¹ółģ +Ġhdr lines +ãĥª ãĥ³ +ĠBert For +Health checks +integr ated +Deep Lab +Need s +prom ise +TRACK ER +à±į ', +intr insic +foot note +Contin uum +iy z +North ern +Tmp Site +Ġsilent ly +ĠQU IT +Sat is +ðŁĺ ģ +WEB HOOK +hom enet +ĠSte ps +membership s +ĠGraphQL InputField +GMT CLib +Ġchainer cv +cors headers +ĠRunning Stage +ðŁı´ółģ¬ółģ¶ ółĢ° +semi colon +Ġefficient ly +tal ent +Kn ob +LET ION +ĠSecond ary +ðŁı´ółģ¥ółģ ³ółģ +wal ker +Ġdri ving +('.. ',' +ĠAir port +Ġfai lover +Ġfai lobj +Io U +Ġosc ar +Ġga zebo +æŁ¥è¯¢ æĿĥéĻIJ +Ġdas hes +Ġdigest ed +ĠìĹ Ĩ +Ann ual +ç¡ Ģ +Ġesp net +ison ed +ici ado +dG col +Ġlam da +Yr EY +ç¾ © +Veri fied +LLLLLLLLLLLLLLLL LLLL +Ġrelat ivistic +ĠAV G +ĠCross Entropy +Rotation Matrix +Asc ii +èģ ½ +ctspDef Downloaded +Ġmaintain ed +Ġìķ Ī +Ġwarp ing +ĠOrgan ização +ĠPose Stamped +ĠPOS ITIVE +direc tives +ĠVari ant +å·¦ åı³ +econ omics +ĠRAM STK +`.` % +æīĵ åį° +ĠSETT ING +selenium hq +å¢ŀ åĬł +Ġqr code +é£ Ł +ç¥ ŀ +Ġviz ier +BUS CAR +Money ness +åѦ ä¹ł +\": \" +Ġwa its +Ġfly tekit +Ġaccident ally +=': ') +DPT FILTERCAPS +ĠSql Alchemy +dbr errno +blo om +("\\ ", +ĠDele ted +Ġros lib +ĠRuntime Warning +ĠQuanti le +Ġë§ Į +çµ Ĥ +implement er +ĠFe bruary +ROUT ER +Ġog Chain +ĠDepartment Calendar +aqu arium +ctspDownloaded SgtPolicy +ctspDownloaded DefSgtPolicy +Simp lified +Ġlu igi +Membership Factory +Ġ=== ") +Ġsynchron ization +ĠfbxNode Attribute +Ñħод им +ĠâĶ ĥ +Ġlogarith m +ĠWebs ocket +导 åħ¥ +ĠSimp ly +ĠChe etah +ĠMini GoogLeNet +ĠTemporary Directory +scar f +HUM IDITY +reveal Square +Ġgif ts +prototype s +Men or +Mes hes +ACCEPT ED +Ġê°Ģ ìł¸ +ILINE AR +("-") [- +!!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!! +ĠRA ISED +Ġcapit alize +ĠACT IV +ðŁı´ółģ¦ółģ © +elimin ation +sav ings +ĠæŃ £ +ĠLinked List +Mont gom +Calo Analyzer +Ġbre vity +BUIL T +gang str +CLASSI FICATION +ĠBOOK MARKS +adjacency list +é© ¬ +Ġativ idades +не ÑĪ +hdl n +Ġç alÄ±ÅŁ +Ġaov Nodes +acceler ation +SCEN ED +Ev olution +Sil ver +junction s +ĠPhi lip +ĠNC BI +Ġservi ço +Ġadicion ado +Ġproble matic +Ġnov os +ĠкоÑĤоÑĢ ого +anneal ing +ĠNeighbor List +SQU ARESIZE +presen ta +ĠVul kan +Ġportfo lios +Rfc Sdk +abstra cts +ĠfltSpec Version +Ġì¶Ķ ê°Ģ +ëª » +ĠLot us +áĥł áĥIJáĥ +Ġ모 ëį¸ +âĸĪâĸĪâķĶâķIJâķIJ âĸĪâĸĪâķĹ +æĤ ¨ +Ġalta ir +ĠHot keyMgr +Compat ibility +VEHICLE API +Flour Grams +wild cards +EXCLU DED +emoj ize +ĠCommunic ation +ĠSPAR QL +ĠKal man +Ġspaw ned +ĠJose ph +UNDER LINE +acceptor Number +Ġliter als +Reser vation +ĠREGI STRY +ãĥ§ ãĥ³ +VertexAttrib Enum +SortPair Star +ĠÑĤаблиÑĨ Ñĭ +ìĻ Ģ +Ġink scape +ĠREQUI RED +ListPomeriumSession sRequest +ÑĥÑĢ Ñģ +ä¾Ŀ èµĸ +SAMPL ER +Ãľ mit +Ġinsp ired +Ġdvid env +ĠÐľ аÑĢ +羣 å®ŀ +ĠIni Config +ĠIND ICES +непÑĢавил ÑĮно +GNB StatusIndication +ShaderResource View +Upstream Healthchecks +ĠloginUser Ob +æĿİ åIJī +ĠSAN CAI +ĠAck nowledgement +quantit ation +è³ĩ æĸĻ +ReferencedInheritingObject T +mpro xy +Ġlect ure +assertNot Equal +THEFT ALARM +алÑĮно е +ĠDurch gang +DATAD IR +phantom js +Airport Camera +punk t +ĠVT BL +Ġcyber pi +lexe ma +EXCEPT IONS +zef ace +esthe tics +ĠBET WEEN +ĠKM ERS +pendi cular +Ġè°ĥ çĶ¨ +Ġamber ResType +çİĭéĥ½ å°ī +ĠVisualiz ing +ĠPRED ICT +Ġíķ¨ ìĪĺ +LifeCycle HookOption +VEND OR +geof eather +ListContainers Options +dtt ColName +Ġmemó ria +DEFER RED +MetaInfo Class +ĠAGAIN ST +ĠинÑĦоÑĢм аÑĨии +keTrain Array +omnis ci +ĠILL UMINA +ĠUb untu +fibon acci +Ġkönn en +SPHER ICAL +Polyaxon HTTPError +ĠAnnouncement Downloader +Msc Passport +WIES MN +tMER CK +getsock name +ascontiguous array +ĠStell ar +logThis Message +cirr us +Ġpyopen project +SetDraw Color +NOwG LoBES +WRRR RR +DPBLEND CAPS +ĠPageNotAn Integer +Montgom ery +! , +" ?> +# $% +$ '" +& ' +& . +' @ +' ``. +( ('', +) "), +) ']. +) "> +) <= +) âĶĢâĶĢâķŃ +* $', ++ _ ++ ). +, __ +3 999 +3 154 +3 176 +3 138 +3 027 +4 101 +4 105 +5 011 +5 004 +9 101 +: ][ +; % += ? += ./ +> '+"\ +@ {} +A ble +A pr +A OUT +A frica +B ath +B il +B et +B are +B AT +B LE +B ake +B ars +B ENCH +C ro +C up +C atch +C ores +C NB +C ru +D al +D TR +D AA +D ONT +D SCP +E b +E HR +E CLIP +E COMMERCE +F IM +F wd +F ails +F INGERPRINT +G ell +G PP +G xs +G LOW +H um +H ol +H ant +H SET +H NF +I RE +J d +J et +J AR +J aco +K ali +L IT +L dap +M FA +M DS +M IR +M USE +M GD +M agic +M ike +N os +N aming +N mz +O ws +P ers +P rep +P CI +P alette +P WR +Q v +Q VisaUnitSelector +R is +R TE +R CI +R NG +S Log +S ony +T ie +T URE +T INY +U CH +U IB +V pc +V PORT +V FS +V MOV +V ocabulary +W j +W no +W izard +X LA +Y K +Y c +Y d +Z d +Z PL +\ / +\ (\ +\ "") +] ". +] '). +] `, +] >', +_ (' +a ho +a fa +a Id +a hs +b ard +b ns +b cc +c ile +c sa +c class +c cs +c ann +c api +c ents +c rate +c anti +c ı +c ino +d lp +d pg +d ork +d vr +d pdk +e ab +e og +e fici +e uro +e asing +f leet +g I +g path +g ta +g ross +g tex +g flags +g uessed +h X +h one +h ong +h alls +i F +i phase +i exact +j W +j se +j os +j eff +k I +k N +k ri +k learn +k bd +l F +l W +m Config +m lir +n O +n tr +n ac +n ep +n line +n rof +o obR +p E +p K +p ist +p ap +p code +p rac +p illar +p desol +q P +q W +q as +q am +r H +r W +r als +r pn +r FY +r datatype +s Name +s rid +s field +s izer +s ni +t ort +t ent +t def +t ta +t ener +t angle +t ca +u O +u itive +v ig +w ashington +y L +y te +z U +z ent +z min +z ia +z idColName +{ %( +| " +| . +} "> +} ]\ +} [{ +} ].") +} }.{{ +~ ' +³ ółĢ±ółģ¿ +µ ľëĮĢ +½ Ķ + µ +à » +Ð ķ +Ð Ľ +Õ Ń +Ø ° +Ø ¸ +Ù ¹ +æ © +ç ¹ +ë Ħ +ì Ī +𠪨 +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ðŁij +Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠ +Ġ 该 +Ġ åIJij +Ġ ****** +Ġ âĸĵ +Ġ Ú¯ +Ġ gesture +ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +in ated +er fc +er tos +or ial +at W +at ime +re ne +se per +se ner +ĊĠĠĠ ĊĠĠĠĠĠĠĠ +Ġ= ====== +st ap +st ereo +st eady +en use +en ets +en hancer +Ġt ff +Ġt iling +ar bre +ar ousal +al pine +de a +de w +de serializers +de cide +an u +an om +Ġi w +Ġi y +Ġi eee +me ch +me aly +Ġ' )] +ti mo +mp Session +Ġc in +Ġc name +Ġc ure +Ġc class +Ġc nv +Ġp le +Ġp ore +Ġp vc +Ġf ut +Ġf int +Ġf key +he brew +it ary +Ġa q +Ġa ment +lo p +00 95 +00 59 +00 1001 +', )), +Ġn sh +Ġn sg +Ġn pts +Ġs lips +Ġs mach +ss ing +Ġin version +Ġin directions +Ġin forma +Ġin dustry +Ġre ta +Ġre train +Ġre servation +Ġre define +Ġre corder +Ġre venue +Ġo mn +Ġd od +Ġd ure +Ġd ime +Ġd frame +Ġd sm +Ġd dof +Ġd entro +li h +li en +li ou +pe e +pe so +pe destrian +un ta +un successful +un assigned +Ġm B +Ġm ds +Ġm sk +Ġm values +Ġm yp +Ġm cls +Ġm ódulo +ra gon +Ġe o +Ġe ce +Ġe cs +Ġe db +Ġe igh +Ġe thernet +Ġe tique +la h +la de +la ins +ate xt +fi rec +ent ucky +ad ne +ad abn +co di +co ach +ri mento +Ġb ow +Ġb lit +Ġb Cell +Ġ1 136 +Ġ1 348 +Ġ1 265 +Ġ1 078 +Ġ1 322 +Ġ# + +ed uc +ed itions +11 14 +11 35 +11 77 +11 47 +11 89 +11 76 +11 54 +11 53 +um ich +int able +id ml +Ġ( ...) +Ġw inds +ch yna +te al +te enth +di k +di richlet +Ġ[ './ +ma pi +ma ble +ul p +from bytes +Ġif m +ol k +el m +es ponse +es ia +ĊĊ ĊĊĉ +is ub +is lice +val uation +__ '], +__ ]: +__ }) +name Split +get user +get Segment +get Player +(' >> +(' (\ +(' '). +set field +set Property +set Layout +set Spread +set Transparency +ĠT A +ĠT L +ĠT RI +ĠT ail +ĠT ipping +ĠT urban +xt r +th or +th reat +th umbnails +us gs +con current +con fid +con veyor +Ġ2 96 +Ġ2 74 +Ġ2 71 +(" =" +(" '" +pp m +as ize +[' '] +et t +Ġ{ (" +Ġis ot +Ġ7 77 +ĠS AS +ĠS MA +ĠS her +ĠS yntax +ĠS FR +ĠS uit +ĠS rp +ĠS AMPLES +ĠS cott +ĠS cripts +ab f +ĠC our +ĠC ash +ĠC sv +ĠC NO +ĠC affe +ĠC ABBI +ht able +Ġg lass +Ġg ft +Ġg ö +Ġg itignore +Ġg abriel +Ġr at +Ġl ale +Ġl ns +ĠA y +ĠA CCESS +sp aghetti +'] \ +'] ][ +01 93 +01 88 +01 95 +01 54 +01 306 +Ġcon currency +am mal +to mato +99 58 +99 408 +type Of +ĠF ault +ĠF og +ĠF CN +ĠF emale +ĠF iscal +od der +sc s +log reg +list funds +vi ande +Ġh un +Ġh mc +Ġh wt +** , +all ink +po etry +ta h +ta py +ĠP H +ĠP AC +ĠP ET +ĠP HA +ĠP agination +ĠP resident +Ġas ize +Ġas dict +der t +ĠI ds +ĠI II +ĠL F +ĠL x +ĠL ar +ĠL ite +ĠL CS +ĠL atest +res next +tr g +Ġst ro +Ġst ret +Ġde compose +Ġde serialization +Ġde epp +pro metheus +0000 10 +pt on +pt bx +im bra +Ġ3 99 +Ġ3 57 +Ġ3 91 +10 43 +ow pal +ĠD u +ĠD ic +ĠD FA +ĠD AY +ac d +Ġu ppers +]) > +]) ", +]) [:, +ert able +Re placement +app ar +app Name +app lied +sh oppers +Ġdata Analysis +ĠM x +ĠM ime +ĠM ale +ĠM RB +ĠM aking +nt anglement +xf ail +Ġv b +Ġv ndr +02 04 +02 09 +02 96 +ew aż +Ġ_ . +Ġy pos +Ġnp c +Ġnp z +ĠO s +ĠO AUTH +ĠO VN +Ġ* {}* +Ġx form +Ġse ats +Ġse same +Ġor che +Ċĉĉ ĊĉĊ +[" + +IN CENT +IN JA +Ġstr ange +xb in +Ġ% ') +Ġme ch +Ġme sa +Ġfile in +Ġfile size +Ġfile sets +pre made +pre cipitation +ang STR +Ċĉ ĠĠĠĠĠĠĠĠĠĠĠ +"] ' +"] }' +ĠB T +ĠB max +ĠB eat +ĠB BB +ĠB ouncing +ĠB lond +Ġos x +12 93 +12 19 +12 94 +12 87 +12 95 +Ġname list +ĠE AR +ĠE qual +ĠE ars +ĠE VE +ĠE limin +Ġj id +Ġj ds +ci ale +text Infos +AT N +AT TC +ĠN AS +ĠN gamma +ĠN ominatim +date fmt +len na +num Of +################ ####### +Ġres TapeSites +Ġ4 64 +Ġ4 70 +Ġget Macro +tp ch +In forme +ĠR Q +ĠR y +ĠR aster +ĠR TX +ĠR apid +mo vin +Ġun lock +Ġun selected +Ġun directed +Ġun official +OR ANGE +ule s +Ġlog scale +32 12 +32 22 +per fil +oc ument +oc entric +ĠG DB +ĠG uild +ĠG Hz +ĠG olf +ĠG loVe +Ġco uch +Ġco variates +Ġtype defs +Ġtype Constant +ĠW earing +ho pper +Ġout Dir +Con j +ĠV iv +ĠV illage +Ġvalue Type +print s +param Name +param iko +Ġ5 14 +mb led +ib R +Ġan ci +Ġan neal +Ġ__ ________ +Ġen joy +min ed +Ġtime Period +18 88 +18 26 +18 48 +18 58 +18 61 +16 01 +16 44 +ft v +da f +Ġk line +Ġk ps +Ġk raken +Ġcol d +Ġcol lective +25 10 +25 13 +Ġro ss +Ġpy excel +Ġpy upgrade +Ġpy parsing +Ġpy opencl +config parser +config urator +Ġ6 08 +Ġset Object +ag on +ag le +ump s +04 05 +13 02 +13 15 +13 33 +13 66 +13 76 +og enerated +15 34 +15 85 +15 67 +ST F +ec f +ec lipse +05 92 +05 44 +05 75 +03 07 +03 92 +03 13 +03 76 +Ġop u +train data +Ġch amp +Ġch amber +Ġch icken +17 03 +17 66 +17 76 +93 16 +93 96 +93 35 +14 67 +14 43 +14 78 +14 68 +Ġpre di +Ġresult ados +ne tid +vent h +vent ure +64 97 +64 75 +Ġdefault Keyboard +base Url +gra ins +:// '): +plot box +Ġtra vis +Ġtra versed +IC O +IC U +AN IMAL +pi co +pi lot +22 83 +22 31 +22 79 +ĠH X +ĠH r +ĠH al +ĠH um +ĠH olds +ĠH uang +ĠRe current +ĠRe play +sub key +sub header +sub tractor +lob ject +np f +eri alization +mat urity +Ġsh ipping +Ġdi visão +db y +88 08 +lp s +ast a +ast o +comp ass +ID LE +34 91 +start Pt +Ġ[" < +Ġ[" _ +84 00000000 +ĠIn jection +update id +ask ell +ant alla +Ġle a +ann ulus +24 03 +24 94 +24 91 +37 14 +37 21 +37 49 +37 63 +Ġpath way +Pro g +point ers +point less +map able +map Dict +Ġoutput Dict +Ġpo lish +Ġcom mission +Ġsub schema +Ġsub control +Ġsub sampling +Ġsub scribed +Ġso il +Ġso licit +rep ack +96 93 +96 86 +96 57 +96 65 +Ġac cel +Ġac ademic +ĠCon ditions +ĠCon venience +Ġinput Args +94 69 +Ġcur shader +Ġ} ; +33 09 +33 83 +DE UR +DE CODE +fer mis +node info +Ġlabel map +av r +no vo +Ġline cache +AL ist +Ġclass ic +Ġclass wise +Data File +Data store +Ġla i +85 01 +97 92 +97 85 +97 76 +{} ` +{} \" +36 06 +36 83 +36 53 +36 63 +ron yms +ull ong +011 2 +011 3 +Ġopen pype +ĠK C +ĠK P +ĠK S +ĠK er +ĠK inesis +95 34 +Ġcont role +run id +run dramatiq +86 54 +26 00 +mon omial +Ġdo ctor +fa ded +fa fq +Ġz i +Ġz ub +Ġz avg +Ġz uz +################################ ### +Ġjson s +rit on +Ġtrain loader +AG o +AG TA +57 98 +57 65 +Ġ! []( +create Table +create Setting +reg r +group By +Ġfil er +Ġfil en +List Result +List Tables +md v +trans mitted +23 19 +Ġmat mul +44 25 +44 84 +44 28 +44 48 +44 76 +44 78 +ðŁı Ħ +ðŁı Ĭ +ðŁı ĭ +ðŁı Į +ns stack +IM PL +Ġdis charge +AP ID +new user +cor Comp +ef low +']) } +']) ], +28 39 +Ġend ings +Ġend ExpNow +values ort +Ex periments +Ex odus +Id String +raw l +raw db +raw Data +56 86 +56 56 +56 73 +98 16 +98 06 +98 05 +98 94 +Ġpass ive +Ġsp k +Ġsp n +Ġsp litext +Ġmin y +Ġmin utos +pop size +LO UD +Se ctions +Se ek +uc id +uc ch +Ac tivities +be h +ĠQ Text +ĠQ Table +ĠQ UE +ĠQ UAL +img code +target Name +35 05 +35 36 +Value Set +Ċĉĉĉĉ Ġ +File Lines +File Clip +pri et +AD DT +save Status +cre ative +Ġdf w +Ġdf datetime +flow corr +ĠSe quences +45 16 +45 37 +45 33 +45 31 +ng rok +fil mografi +the st +Ġdistri bu +ĠY ields +Ġrandom ness +cc ccc +47 11 +csv map +core ir +column Merge +top s +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +pl z +items ize +ton es +Test Option +Ġser ved +83 85 +Ġevent Name +IB P +Ch c +Ġvalues D +ai i +gen A +sg c +filter ing +82 88 +82 85 +Sg Aq +order Id +46 06 +46 17 +46 27 +46 26 +ĠJ IT +ĠJ obs +ĠJ AX +ĠJ udge +ĠJ ulia +ĠJ uggling +107 1 +89 18 +89 16 +Ġ] ; +40 92 +Ġmodule author +Ġread Json +root fs +Un ix +The Ordinal +Ġq p +Ġq z +Ġq types +Ġq Pos +Ġq Neg +TH ES +TH REE +To e +To Task +To Ge +To Use +gener ics +Ġbatch Size +Ġval ence +location Name +={ \ +={ :. +={ "": +round trip +Ġtable Name +Ġdb i +Ġdb help +graph viz +67 37 +43 04 +43 06 +43 09 +Ġcor onadash +ĠPro cessed +CL D +CL ONE +Ġplot Mode +ĠList en +Ġnet loc +SI O +std scr +48 55 +48 0692 +91 32 +ĠData Error +а Ñħ +No ToGe +42 05 +42 34 +42 97 +TT k +Ġtemp Dic +])) ]) +Ġpri marily +Model Data +Model Backend +Model ToTask +")) ] +DAT AT +ĠIS BN +ĠÐ ĵ +ĠÐ Ķ +ĠÐ ĺ +post processing +post Match +ous ing +cond uct +cond Visibility +wo z +Ġexp Res +Ġexp ansions +Get Value +tx hash +xy y +eval Str +čĊĉĉ čĊ +Ġbreak er +Add on +Add ModelToTask +Ġ", ": +uni fied +struct ural +Ġlast TreeMap +Ġword list +ial Gradient +1011 101 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +Ġ', ( +Ġstep mode +ĠCo ol +ĠCo ordinates +dis covered +LI VE +Object Bounding +Ġspecific Tissue +over load +Class Id +PP ort +ðŁij ® +ðŁij ¯ +ðŁij ± +ðŁij ³ +ðŁij · +gr ind +Ġ12 92 +Ġ12 90 +learn ers +OP A +Out let +Out Key +Reg Key +и ÑĦ +и ÑĢов +ãĤ £ +ãĤ Ħ +Ġbin walk +job type +Ġhead ings +queue Size +53 15 +option ally +Ġav ro +service List +Th resh +acc Type +acc idents +Ġ'-- ' +çļĦ æĸĩ件 +pack ing +Ġblock size +ian Inverter +Man ufacture +cell ular +Ġrender ers +xml rpc +Ġtmp s +RES IZE +RES SED +DB S +0100 1101 +Ġ". * +Ġ". ": ++' " +EM NN +EM PTION +SC F +SC ROLL +SC ORES +PRO J +202 8 +Inter actor +Ġfont forge +cluster Id +åĪ Ŀå§ĭ +Not a +Base Index +Ġsim ulating +ĠjnxMbgSgw S +mc d +xfe v +Ġconst itu +Al bum +Al titude +By Requested +Option Menu +dec ry +mod eration +mod erator +medi as +medi ans +"{ ' +Ġoper ación +full match +full screen +ĠCh apter +ĠImage Enhance +home s +az ette +é rie +Ġhost ed +tax es +PR EN +script PubKey +Ġpost ion +Ġfin etuning +dat lim +ĠZ PL +Ġthere of +æľ « +æľ ĥ +WS cript +Pos itives +GB g +Ġcluster ization +Ġcluster Credentials +leg numbering +Ġpart ners +Dis cover +nb format +NE C +zip file +zip ped +Tensor Board +Run Time +ha ar +ME ANS +He art +Return ed +áĥ ļ +Point Grid +ĠCheck Byte +Ġexit code +ĠApp lications +Per mutation +." + +Event Type +Ġlink DatumLis +imp ulse +MS O +MS FT +Date Offset +Load Balancer +Ġfeature d +mag i +Sim ulate +Start Grd +ote ca +ĠNot AliveException +sec ured +å¤ « +mk v +Ġsuccess ors +ĠPo lo +Pri vilege +BO B +BO p +plugin Name +Ċĉĉĉĉĉĉ Ċĉĉĉĉĉ +Mo lecule +Command List +å® ´ +auto locate +Sc r +oly tics +ĠModel Base +click able +Ġinitial state +Map ped +this Annotation +Ġmulti class +SV R +GL ISH +Do xygen +Ġexception Message +ठ« +Tag Pattern +GG EST +Ġmove it +tool set +ĠAc tivities +Ġaut op +Ġaut oref +("- > +ĠIt ens +Ġlook ed +DF LOW +Found ation +á» ¡ +Dir Path +FR U +Ġdraw Point +Ġgr u +cr n +cr v +ĠAt tention +Total Time +Total Amount +Total Frames +pdf s +Ġview able +rest py +Ġtr k +Ġtr Str +mu on +Ġtimeout s +Ġfun ct +kernel Size +9999 998 +Ġsin cron +Ġacc ross +Ġsocket server +Ġfit params +Address A +Ġprob abilistic +Ġvari ável +ĠPre vious +ĠSh op +Ġevents ourcing +Ġfast est +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +)+ ':'+ +å° ¾ +Ġtk i +Ġvalidation Input +)} : +Ġround up +ros lib +reference d +bb on +bb bb +Ġip fs +ÃŃ tulo +Ġë ķĮ +Off line +SP AN +SP AM +Device Values +Device Child +GEN OMIC +lev sq +ĠInput Transform +Ñĥ ÑĢа +Ñĥ й +Ġmod ern +Ġmod SecInstalled +Doc string +Op IfNot +Invalid Usage +Ġsel L +Ġday u +Ġtick ets +Ġmig rated +From File +From Image +PRE COND +PRE EMPTION +sym log +SL AM +ĠDis count +ĠDis abled +ĠDis card +ĠDis covery +GO Protos +sn ip +ISE Q +tw i +Read Error +Ġxml schema +Integer Field +fast Anchor +curs ors +ĠTensor Type +Property Change +å¾ ½ +ĠTH ROUGH +Ġcut Category +PH op +speci alized +cross ref +:]) / +ĠReg istro +BR USH +400 7 +400 8 +è® © +Grid Layout +hot mail +inv mass +Page Factory +poly ak +ĠFlask Client +cwd mWavelength +ĠMo h +ĠMo tif +################################################ ########### +sy mtab +LLLLLLLL LLLLLL +Ġп оÑģ +Pass ive +Pass Through +010000 011 +205 5 +Ġvol t +Ġri g +cn c +cn tr +ä¸į è¦ģ +Ġseg undo +extract file +aj i +Ġengine er +qt py +sol vent +401 9 +SM ART +ĠIniti alizes +ament os +sentence pos +Ġbar code +Ġsen lin +Ġsen ses +Sele cts +ĠOS X +ĠVariable Filter +čĊĉĉĉĉ čĊĉĉĉ +break out +ĠCont ato +Ġspect roscopic +cnt k +å¯ ¸ +FC x +bra f +Ġpoly list +Ġpoly lines +Ġpoly mer +Iter ate +Random Variable +Piece Type +Vector Data +ĠTra cks +ï¼ļ " +ĠCor rection +216 0 +buy er +buy hold +"+ "\ +gui ded +Temp oral +ĠCommand Line +Ġè Ģ +Ġè ĭ +为 äºĨ +gp odder +003 0547 +Multi DiGraph +ðŁĩ º +hy phen +hy bridi +Ġev il +RA ISE +RA ISED +previous ly +mn li +Ġmesh grid +stim ulus +ĠMat erials +Stat istic +ĠToken Value +ĠToken Types +organ isations +218 3 +cases For +Ġtab lename +ATT G +Ġ'" ', +hub er +208 3 +åıĸ åĢ¼ +117 647 +Ġmis matched +ов аÑĢ +Ġcla v +ëĭ ¹ +ĠGraph Q +ĠGraph ene +OEO CardTable +OEO CardEntry +Queue d +aur sen +Ġ--- > +Ġsy mlinks +combin ator +Ġns bx +Header Item +men us +pin ned +multip lication +]( # +167 187 +hw c +ĠMin ing +news groups +gm time +sb ol +specific ity +Cache Manager +203 5 +Ind ent +Video Stream +Ġrec Taxon +Ġcapt ures +ен о +market place +306 2 +Power Supply +ĠConvert ing +212 01 +ĠTestCase Error +ÙĦ Ø· +Password Hasher +Ġbad ge +blen ded +456 1 +pot entials +ðŁı´ółģ³ółģ ¤ółģ +ðŁı´ółģ³ółģ ¯ółģ +:{ :. +Ġaddr L +Interval li +lar Camp +éģ Ķ +Call er +308 5 +DC IM +304 7 +Global Light +424 9 +397 3 +397 8 +Ret rans +Ret rieves +286 2 +286 5 +286 8 +Ġrelation Obj +Sto cks +Ġ"' ") +Ġ({ }, +403 7 +nl g +Ġfri ction +287 3 +287 4 +287 8 +ĠQuery Dict +ĠØ ¢ +Auto Reconnect +Ġblack out +427 4 +ॠģ +ili arity +Ġ": ". +406 8 +æĽ ¿ +292 2 +ĠArray Type +subnet Interface +#---------------------------------------------------------------- ---------------------------------- +æĢ İ +quad rante +ðŁĴ ģ +ðŁĴ Ĥ +ðŁĴ Ĩ +ðŁĴ ĩ +334 1 +sock etio +obo ok +æ¯ ¬ +Ġwave front +ĠPi lot +uel ve +ĠOptions Fingerprinter +436 8 +ific ação +388 9 +237 1 +ĠSign up +virtual file +virtual IP +Ġbra ces +ĠGame State +attack er +attack ers +AAAA AAA +Tun er +Ġ96 0 +ĠQue en +sfp TranPower +sfp RecvPower +ĠFace pal +ĠDIS ABLE +ан Ñĭ +ан нÑı +åŃIJ æ¯į +392 9 +457 3 +387 9 +launch pad +437 4 +ĠHO USE +visu als +ĠFilter ing +('../ ', +ðŁı´ółģ¬ółģ ¡ółģ +Ma de +ภ² +Ġgate ways +æĹ¥ ä»ĺ +425 3 +455 4 +è½ ī +/* ", +065 06 +935 39 +Ġtele fone +以 ä¸Ĭ +URN AL +BIN S +RT L +,:] = +sun set +Mer ger +Imp licit +Imp ossible +408 3 +408 6 +ĠButton s +Acc QSfp +SCHE ME +ĠRES PONSE +FAIL URES +mel ds +405 7 +LIMIT ED +Car bon +Ø§Ø ´ +407 1 +________________ ____ +Ġrhs Node +Ġwater img +Ġfraction ation +Dim s +ĠDown link +lem mat +ðŁ¤ ¦ +ðŁ¤ ¸ +ðŁ¤ ¹ +ðŁ¤ ¼ +ðŁ¤ ½ +ðŁ¤ ¾ +hb W +ç´ ¯ +SERIAL IZED +gain s +éĤ » +çĻ ¼ +REPL ACEMENT +Ġmix er +ĠSw iss +ĠSw imming +Ġд олж +fbx Mesh +Domain Name +Ġgui ded +ĠStop PointGrid +Ġlb ry +Ġmm det +calib rations +ĠIM AG +ĠTri al +å¥ ³ +osa Cent +ĠExp licit +ç±» åĪ« +âķIJâķIJ âķĿ +Serial Command +Ġcond or +Copy Options +ĠCre ator +466 7 +SUCCESS FUL +Lane Number +Pa ul +Camera Position +Bin omial +Ġpull ing +Energy Incr +ĠReport ing +ðŁı´ółģ¢ółģ ©ółģ +ĠRegister ed +sem iring +Ġ################################ # +éģĵ æĪij +éģĵ ä½ł +BLOCK S +Ep ist +Ep ics +Year NoToGe +ĠGaffer Dispatch +human ize +Ġabort ing +Platform Hardware +warp Perspective +Speed Sensor +ĠExtract ing +ĠCa SO +ĠCa Cl +ðŁı´ółģ¡ółģ ¯ółģ +Na HCO +Ġcel sius +Ġwav file +Mag netic +ðŁ§ ķ +ðŁ§ ĸ +ðŁ§ Ĺ +ðŁ§ ĺ +ðŁ§ Ļ +ðŁ§ ļ +ðŁ§ Ľ +ðŁ§ ľ +ðŁ§ Ŀ +mJ y +docsLoadBal CmtsCmStatus +968 3447 +TERN AL +PART IAL +íķĺ ë©´ +íķĺ ìŬ +ĠSm iling +ĠVe ga +Tick er +Ġ================= = +Ġ================= ==== +398 3 +ĠåĪ Ļ +ĠRow s +#================================================================ ================ +ÄĻ ż +Mis cellaneous +wheel ing +Ġìł ij +434 1 +ìĭ ł +Ġठ¬ +redd its +Ġseason ality +neuron group +roc ery +Ġste er +475 8 +Http Client +dup s +è´ ¹ +ĠÑĤ о +bal loon +ĠHand ball +ĠCallback LifeCycleHookOption +slope s +ĠMa ssage +ĠCalcul ator +ĠInte gration +ĠInstance Id +åı² 家 +Ġ136 3 +ometri cs +Speci fies +ÅĤ a +ðŁļ £ +ðŁļ ´ +ðŁļ µ +ðŁļ ¶ +åıª è¦ĭ +unt ários +ĠPAR SER +ĠNE ED +Null Handler +Ġdisp ersion +Ġdl train +('* '), +å¤ļ 个 +Ú© Ú¾ +Ñİ Ñĩ +electron ic +ог ÑĢаÑĦ +vot ed +ĠRESULT ING +Mi xture +ĠmscModVcs X +ðŁı´ółģ®ółģ ¬ółģ +ðŁı´ółģ²ółģ ³ +popup s +kh on +Ġdos ya +caps ul +yolo x +Ġfall ing +ப à®Ł +brief description +eti tive +ĠPub lication +ERN p +олÑĮ ко +NORMAL IZE +Publish Entry +nT Def +({}) '. +Ġ× Ĵ +Ġ'| '. +ðŁĻ ħ +ðŁĻ Ĩ +ðŁĻ ĩ +ðŁĻ ĭ +ðŁĻ į +ðŁĻ İ +Ġscatter ing +mob ilkit +Ha ired +yc lic +Ġemit ter +ku ka +é» Ħ +Ġpesso al +Ê· a +Ġ'; ') +ĠCap abilities +ðŁı´ółģµółģ ¡ółĢ +ðŁı´ółģ©ółģ ±ółģ +ox ide +("* ", +ĉĉĉĉĉĉĉĉ ĉ +atan h +wei bo +Ġbas ics +ĠTer ritory +psu util +æĿĥ éĩį +Hy Par +ativ as +ĠActive Arena +neighbour hood +ĠXXXXXXXXXXXX XXX +Äį e +JO INT +JO KE +oF Ar +Est ablished +KN label +ĠWatch er +noon an +hom oph +Packet Size +amin ated +separate ly +873 02434 +ISO DE +Ġautom l +ółĢ²ółĢ ´ółģ¿ +Traffic Class +ë r +ĠMod bus +ĠArch itecture +注 åĨĮ +Gre ater +discri m +ĠMc Stas +Yt W +zn á +ек ÑĤ +ĠActivity Rights +RAM AN +Ġmens ajes +Ġbla ze +deal er +Ġnice ly +Ġyb TradeQue +Ins ight +album s +('.. ', +DEPLOY ED +Ġgold en +Sound System +ĠPick le +00000000000000000000000000000000 0000000000000000 +ÐĴ ведиÑĤе +News Popularity +SEND GRID +ĠProvider TestOption +Datetime Index +ĠRED IS +ĠExit Stack +100010000111111 000001 +QUAL ITY +tur bulent +ðŁı´ółģ¨ółģ ®ółģ +Ġautos ummary +Ġdemon str +bottle s +åŁº ç¡Ģ +Pure es +ĠSuper vised +Coin Game +Ġblend Shape +Delay ed +Pad Spread +vac uum +èĻ Ł +elev ations +Ġped igree +ĠVari ance +Firewall Group +olling er +ĠHead scarf +battle s +arrayT MAPE +ðŁı´ółģ²ółģµółģ «ółģ +funiIf Tx +funiIf Rx +Ġá gua +iner tial +south ern +cep tible +Jan uary +Ġey etrack +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Lang Box +ĠIntegr ated +PROB ABILITY +JPEG Images +Pen alty +hon or +ê· ¼ +ĠTrade marks +835 480692 +=': ', +DPT EXTURE +ĠTermin ate +ðŁķ µ +HIST OGRAM +Reply KeyboardMarkup +bea utiful +BOOK MARKS +Ġcorp ora +Ġ"... |* +Ġب ار +ĠUnique Constraint +Java Script +Ġeuler Rot +ĠAltern ative +Tex Coord +æ¢ ¯ +ĠTen ant +Ġanno ying +EVAL UATE +Life Time +ĠPYTHON PATH +0025 4566402 +HOUR S +íĺ ķ +Ġvacc ination +QUI RE +åĤ ¨ +ì² Ń +Ġsequ entially +ĠREG ARD +ZL NZ +Ġpfx file +Ġinvent ário +Ġkh ông +rmar ital +ĠAttach ment +phon opy +ĠCart wheeling +ä»· æł¼ +Mongo Client +Ask s +AccessBindings Metadata +æī¾ åĪ° +ĠAnalog SignalArray +ĠDat adog +ãģĤ ãĤĬ +Transl ations +ĠREFER ENCE +ĠCl one +ORGAN ISATION +Cool ing +CLU DED +Safe Loader +Jwt Rule +ĠTER MIN +3215 4609 +Phot os +Ġmile stone +Stand by +Stand off +BAN NER +Ġattri bu +Vote LogTrx +Ġipy widgets +ĠUnder lineNav +Ġtemper atures +Ġambig uity +ĠDiffer ent +غ ÙĦØ· +⼠¹ +Ġ"] ": +ĠDot ted +Ġalphab etical +Ġalphab etically +ĠEPS G +Ġelev ator +nonlinear ity +SUPP RESS +Ima ging +Xtrain Pos +ĠAu stralia +Ġmolecular DataFrame +MIP MAP +Pep ulator +obar ic +ĠGer many +funiVcl Tx +funiVcl Rx +Ġsmb us +ĠMg SO +ĠMg Cl +ĠNa ive +Ġinform ations +8913 48 +ìŀħ ëĭĪëĭ¤ +ĠcpwVcPerf Interval +Mult inomial +ç¿ Ĵ +zj lx +Ġdepart ure +âĸĪâĸĪâĸĪâĸĪâĸĪ âķĹ ++-+-+-+- +-+-+-+- +ĠLap lace +Ġìľ Ħ +ĠколиÑĩеÑģÑĤв Ñĥ +éĮ ¢ +ĠčĊĉĉĉ ĠĠĠĠĠ +ĠPACK AGE +Ġopent rons +NBPKG INFO +ĠPretty Table +Ġ555 32 +soli date +Plant Sample +åºıåĪĹ åĮĸ +Well bore +Ġcompri mento +Masked LM +ĠBon us +ogr no +Ġtear Down +å±ŀ æĢ§ +Integr ator +#~#~#~#~ #~#~#~#~ +FusedBatchNorm V +xH xW +çģ « +Ġej ec +erture Sensor +Ġenroll ments +Ġalex net +BRACK ETS +DPR ASTER +[\\/ ] +}]} $', +Ġ"== ") +SIZ ES +×ķר ×Ļ×Ŀ +Ġnsp hi +ĠAst Parser +regard ing +hacker rank +RESOURCES ENTRY +coast lines +Recur sively +ĠORIGIN AL +}__ { +ĠFH IR +mim ic +ĠDest ination +Ġobserv atory +pegas us +Ġfacilit ate +ĠInfluxDB Client +Ġplen um +ика ÑĨии +Ġ---------------------------------------------------------------------------------------------------------------- --------- +Bytecode Length +ĠWINDO WS +HARD WARE +ĠAZ URE +ĠRepe ated +RESER VED +Ġì¤ ij +à¥ĩà¤Ĥ ", +GMC Port +ĠбÑĥ д +ĠFair y +ĠBow ing +ĠæĬ Ĭ +ACCESSBINDINGS REQUEST +Kick Offset +sigh an +URG ENT +ÑĢем Ñı +DISCOVER Y +ĠTriangle Scheme +kant or +ĠAra koon +Ġdeda ux +ROIN umber +intelli gence +ĠTyp ically +ĠSteam y +ĠPow TestModel +clou dd +Ġíİ ĺìĿ´ì§Ģ +IDXGID evice +ĠSurf ing +Bsm ModelInstance +FAB RIC +Little Endian +RID ES +ĠHover Tool +Ġabri go +jsch uh +è¡Ĩ 人 +OEOS FP +breadcr umbs +getAppointment Dates +DAM AGE +pSrc Data +delims ize +FUT URE +Ġtamb ém +ĠLET TER +ĠNeutrino Flux +忽 çķ¥ +lavni Menu +decib el +setCoordinate Mode +Ġzentral en +Chlor ite +windowBackground White +Ġeros ion +Ġtelnet lib +ĠпÑĢавонаÑĢÑĥÑĪ ений +Ġisce obj +spars ity +countp lot +ĠHugging Face +QRad ialGradient +âng ulo +ĠìĿ´ë¯¸ ì§Ģ +ADJAC ENCY +pogre Å¡no +ĠOffic er +ĠHair cut +34155 06506 +Ġcoreml tools +ĠShr ugging +åĩ¦ çIJĨ +1001111111100011111111 1 +WRRRRR W +ECLIP SE +𪨠Ĩ +Ġdure e +firec racker +99408 3415506506 +ĠMRB rain +ĠGolf ing +Ġzuz avg +createSetting Row +ADDT ASK +creative commons +ObjectBounding Mode +ByRequested Time +ĠCheckByte Conversions +OpIfNot Empty +0030547 9683447 +ĠFacepal ming +YearNoToGe matria +835480692 93539 +DPTEXTURE CAPS +00254566402 87302434 +32154609 891348 +DPRASTER CAPS +BsmModelInstance Info +00305479683447 6292 +! ="": +" __ +" >>> +$ / +$ ']) +% ',' +' âĪ +( @ +) "] +) """, +) `, +* )? ++ [' ++ $', +, )): +, != +- "+ +/ = +2 136 +3 164 +3 163 +3 118 +3 148 +3 172 +3 143 +4 011 +4 133 +4 134 +4 345 +4 174 +4 149 +7 91 +8 128 +9 127 +9 148 +9 185 +: ": +< - +< !-- += ; +> "] +> '), +? % +A e +A ce +A ve +A greement +B f +B v +B at +B box +B FR +B rowse +B ILINEAR +C ass +C AC +C SI +C SC +C ULL +C ABBI +C ORMBase +D k +D ock +D FL +E h +E idxs +E limin +F os +F lu +F ou +F light +F avorite +F acts +G ON +G yr +G reatest +H v +H ou +H ATCH +H ASSI +I ce +J f +J n +J as +J RI +J ames +J uly +K DE +L es +L ag +L AM +L ERS +L ouis +L aursen +M om +M ari +M ill +M ai +M dt +M ML +N c +N an +N br +N fr +N ano +N MI +N fX +O CR +O Vy +O cean +O nnx +P il +P AP +P OT +P FP +Q O +Q ig +R ast +R NS +R anks +R ND +S ans +S ud +S lack +S olutions +S QS +S STL +T FL +U d +U j +U tt +V f +V or +V ST +V IA +W mi +W ays +W MS +W CS +X OR +X Audio +Y H +Y Pos +Y DA +Z MO +[ $ +] ": +] \\ +_ } +_ '), +_ "): +_ (\ +_ (? +` "%( +a al +a ad +a par +a xe +a achen +b sp +b ite +b float +b ie +b orders +b kt +c im +c no +c var +c ElementTree +c anny +d ab +d time +d ml +d nd +e fa +e uc +e lia +f data +f rt +f ences +f fill +f qn +g ust +g ids +g cloud +g Clock +g lsl +h C +h ht +h oun +h lt +h db +h ops +h sm +h oriz +h Go +h iddens +i H +i el +i ers +j te +j ab +j ie +k H +k im +k STL +l K +l ings +l ale +l led +l fn +m H +m ve +m sh +m arch +m gt +m vs +m vir +n G +n st +n row +n ix +n Sec +n mpc +n ortheast +n uscenes +o ma +o á +o Ãł +p J +p au +p rc +p cl +p ics +p ción +p aginated +q name +q FA +q FQq +r J +r S +r ze +r xdesc +s V +s as +s yst +s mote +s RGB +s bp +s izing +s ugar +t th +t to +t art +t dir +t Reading +u G +u W +u ino +u ities +v O +v S +w D +w K +w ls +w his +w vl +x L +x X +x os +x info +x dim +x inx +x WA +y F +y X +y de +y metry +z ss +z ens +z ob +z pk +z ie +} /' +£ Į +± ółģ¿ +³ ółĢ°ółģ¿ + ¬ +Ä ģ +É ² +Ï İ +Ð ĵ +Õ ¸ +â ı +â ij +å µ +æ § +æ Ł³ +č ĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ��ĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ù +Ġ ate +Ġ xfb +Ġ 个 +Ġ æĸĩ +Ġ ãģ® +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ å½ĵ +Ġ ад +Ġ 主 +Ġ że +ĩ ண +Ķ © +ŀ Ħ +ŀ ĺ +ĠĠ ĊĊ +in dir +in let +in validate +in compatible +in directions +in voices +in coh +or en +or ous +or rect +on click +at r +re charge +re cons +re configure +re marks +st ay +st eward +en st +en de +en ix +Ġt ti +Ġt data +Ġt ac +Ġt sk +Ġt ally +Ġt ylko +ar abic +al li +al ou +al ties +de ley +le b +le man +an cer +Ġi le +Ġi oc +Ġi ron +Ġi ii +Ġi InstrTest +ro ha +ti py +Ġc lt +Ġc Grid +Ġc rd +Ġp de +Ġp ac +Ġp exp +Ġp ssh +Ġp vt +Ġp ulls +Ġf li +Ġf og +Ġf amilies +Ġf ifth +Ġ" = +Ġ" } +he a +he al +Ġa ce +Ġa ot +Ġa ster +Ġa Cell +Ġa inda +Ġa priori +lo x +lo sure +lo licon +00 64 +00 88 +00 57 +ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ort unities +', ] +', )( +Ġn it +Ġn ut +Ġn ile +Ġn ap +Ġs le +Ġs ate +Ġs ps +Ġs yst +Ġs fe +Ġs aw +Ġs imgr +ut ely +ur bed +ur istics +Ġin format +Ġre ch +Ġre loaded +Ġre serve +Ġre scaling +Ġre written +Ġre quiring +Ġo dir +Ġo dhod +Ġd ro +Ġd sp +Ġd min +Ġd qn +li que +li ved +li za +ct ry +pe st +pe cs +pe ech +un fold +un escape +un mute +un paired +Ġm file +Ġm dates +Ġm ountain +ra it +Ġe ss +Ġe ve +Ġe ster +Ġe qui +Ġe ssa +la ma +la ire +la homa +la ptop +ion ic +ue m +ue stra +ent index +ad ler +co author +Ġthe mes +Ġb ip +Ġb last +Ġb Interface +Ġb fnc +Ġ1 168 +Ġ1 992 +ed t +11 07 +11 09 +11 37 +11 43 +11 73 +11 63 +11 854 +rom ise +um l +int ention +Ġ( [[ +Ġ( ° +Ġ0 12 +Ġw is +Ġw il +Ġw sp +Ġw ls +Ġw intypes +ch ao +ch ampion +te ira +di ver +di so +def n +ma gn +], - +from sample +Ġif rame +ot ter +ot os +el ines +es ar +Ġ+ '/ +__ ]) +__ (). +__ =""" +get max +get batch +get Register +get Child +get Duration +get tempdir +get OrCreate +(' }') +(' )') +(' ?') +)) +' +set Up +set Pixel +set Icon +Ġ- ", +Ġto list +Ġto ks +Ġto gg +ĠT od +ĠT AL +ĠT ell +ĠT SV +ĠT reat +ĠT Low +ĠT ornado +ĠT ilt +xt al +us g +import ers +con ns +con tributions +Ġ2 91 +Ġ2 00000 +(" ? +(" ## +(" }") +(" >>> +(" (", +(" =", +(" +") +pp os +') + +') ") +as ym +[' % +iz ione +et l +et to +op tics +Ġis ort +ĠS ON +ĠS av +ĠS AV +ĠS MT +ĠS cour +ĠS phere +ĠS lave +ab normal +ĠC au +ĠC OS +ĠC IA +ĠC BE +ĠC LR +up d +Ġg un +Ġg host +Ġg era +Ġg onna +Ġr line +Ġr cv +Ġr dx +Ġr dr +Ġr tc +Ġr eraise +Ġl ma +Ġl list +Ġl fn +Ġl ret +Ġl umber +Ġl erp +data f +ĠA val +ĠA na +ĠA toms +ĠA orB +sp s +sp aper +sp rts +ver nier +'] > +'] =" +01 07 +01 97 +01 26 +01 75 +01 000 +01 74 +01 73 +01 59 +ic loud +ke pt +am ine +Ġ: ( +Ġ: \ +par te +ĠF A +ĠF ib +ĠF ive +ĠF act +ĠF lex +ĠF ingerprint +ĠF AKE +ĠF INGERPRINT +od er +sc ent +qu arantine +log ist +log norm +log ia +vi png +ser ini +Ġh k +Ġh on +Ġh undred +ĠP ode +ĠP ip +ĠP AS +ĠP ROM +ĠP lus +Ġas array +Ġas sessments +ĠI r +ĠI np +ĠI CS +ĠI mplements +ĠL c +ĠL IC +ĠL SB +ĠL ady +ub m +ub ot +=' " +=' ^ +=' \' +=' ;', +=' ;') +Ġst k +Ġst opp +Ġde als +est a +ex cepthook +able APIResource +Ġ3 93 +Ġ3 24 +Ġ3 89 +Ġ3 48 +Ġprint WithTime +ect ors +ĠD D +ĠD RAW +ac cessed +Ġu it +Ġu float +Ġu vs +]) *( +ert urbation +Re pair +Re bate +ĠM X +ĠM ST +time dist +if ur +=" *", +Ġv I +Ġv ow +Ġv cc +Ġv iterbi +02 22 +02 65 +Ġy new +Ġy rs +ĊĠ ĊĠĠĠĠĠ +ĠO re +ĠO SM +ĠO BJ +ĠO ROT +Ġ* /") +Ġx v +Ġx box +Ġx dim +Ġse is +Ġse asons +Ġma pe +Ġma ker +Ġma cos +Ġma Attr +test list +Ġor gs +Ġor io +add Segment +ER OUT +IN J +IN STR +IN ITION +IN CORRECT +xe L +Ġel bo +load balancers +ms a +ms d +ms o +ms dk +ON TO +---------------- ------- +tra s +ens u +py lib +py mongo +pre processors +pre miered +07 83 +atch mo +ES SE +are fa +"] ._ +ĠB AM +ĠB ACE +ĠB unch +ĠB oto +ĠB FS +ĠB OO +ĠB OX +ĠB ashOperator +Ġos m +12 18 +12 37 +12 36 +12 47 +12 76 +12 31 +12 51 +ĠE r +ĠE xe +ĠE POCH +Ġj ni +Ġ< # +AT AR +Ġ) \ +low ski +ans atz +ĠN G +ĠN ative +ĠN LP +ir un +################ ## +################ ######## +################ ############## +Ġres istor +user Rating +bo ss +Ġ4 14 +Ġ4 95 +Ġ4 35 +Ġ4 52 +Ġassert s +Ġget Manifest +lu cose +92 85 +In vent +ind rical +ĠR B +ĠR as +ĠR os +ĠR PP +ĠR é +ĠR BL +ĠR oll +ĠR entalData +ĠR aspberry +mo tifs +ep NumberBulk +Ġun bound +Ġun likely +Ġtest Parse +Ġtest suit +ument ations +Ġlog var +Ġlog msg +Ġlog gamma +32 81 +32 49 +32 61 +ph ens +son s +ĠG r +ĠG ir +ĠG FF +ĠG reat +Ġco di +Ġco ast +EN ET +ĠW AV +ĠW atson +tri e +ho a +ho lic +ho uses +loc alize +Ġout let +Ġlen ght +bu ys +ĠV a +ĠV t +Ġ5 10 +Ġ5 07 +Ġhe ar +Ġhe app +Ġan onym +Ġen codes +che f +Error HandlerHiveToPresto +18 16 +18 33 +18 79 +16 06 +16 08 +16 34 +16 57 +16 65 +Ġlist ings +Ġlist Postfix +sa mplers +cur ation +Ġk er +Ġk al +Ġk its +Ġk aggle +25 85 +25 000 +25 89 +25 69 +Ġpy gal +Ġpy misp +Ġpy odbc +Ġpy modbus +ts ne +04 86 +04 857 +Ġmodel ling +13 57 +13 44 +13 67 +og a +lib ro +lib device +lib ssl +06 66 +ll l +ll r +15 22 +15 09 +15 76 +15 907 +SE EK +ST AC +ass ault +ass oc +ass uming +05 76 +orm al +False Positives +ip si +Ġop md +Ġch ia +Ġch inese +Ġch airs +Ġch imsd +17 27 +17 26 +17 83 +17 91 +17 78 +17 52 +93 92 +93 84 +93 63 +ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠ +Ġpre order +Ġpre cip +Ġpre lude +ne gs +ord o +Ġat an +Ġat tribut +ok http +64 04 +64 65 +index ers +Ġra id +Ġra zer +Ġdefault Graph +Type Name +RE CV +Ġtra pz +08 88 +08 75 +Ġ\ , +Ġ\ \\ +Ġ\ '{ +ĠH om +ĠH ence +ĠH ID +ĠH EM +ĠH ours +ĠRe cursos +sub module +sub system +sub tests +sub menu +lob ber +][ ..., +mat riz +Ġsh ards +Ġsh arp +Ġsh antin +Ġdi ve +Ġdi ction +Ġdi ssimilarity +df lt +db f +db l +db user +db session +work loads +work spaces +88 83 +output Dict +output FilePath +image Id +comp as +ID ENCE +34 09 +34 89 +pos filename +09 87 +84 04 +84 95 +ĠIn f +ĠIn dication +own s +inter sections +gs m +bin ance +bin ascii +lock file +ĠThe me +ann set +ann ers +arch ived +24 99 +24 19 +24 78 +24 41 +24 69 +37 71 +map Wrapper +Ġoutput Parsed +Ġcom ando +96 17 +96 33 +96 87 +Ġac id +Ġcomp ar +Ġcomp vert +aliz ado +ĠCon fusion +Ġnew state +[: ( +94 95 +Ġcur Obj +Ġcur vature +Ġ} ); +Ġ} }', +33 19 +33 81 +33 61 +DE COR +RO OK +()) ], +row col +row Type +av gs +Ġno sec +87 35 +no tion +no aa +Ġline stop +Ġclass path +exp k +exp lo +CT TG +Data Reader +Ġla ursen +85 92 +85 19 +85 85 +97 99 +97 32 +back bones +mi ko +{} {}'. +net stat +36 34 +36 85 +36 65 +but t +query Idx +ĠK NN +ĠK NOWN +95 04 +95 88 +95 68 +return Type +return Message +lat lon +Ġrequest ing +Ġrequest data +run way +run times +run ei +00000000 0001 +86 98 +Ġmax results +sum mation +fa a +fa hr +Ġz OR +################################ # +################################ #### +HE T +HE ART +rit ório +57 03 +57 19 +57 95 +57 43 +Ġ! ') +cle i +cle ared +cle andoc +Par ity +Par aG +Ġ8 32 +ww z +ED DN +ED IATE +IS Y +reg ist +Ġtf s +Res net +Ġper l +group name +Text o +Text Input +List APIView +current dir +current Size +CO B +CO P +color print +man ually +api Key +request data +request ID +AC I +Ġcheck list +Ġcheck pdesol +Ġli v +44 64 +44 55 +44 46 +44 21 +44 74 +IM F +ENT H +ler p +cor rupt +mail ing +Ġrun nable +ef g +']) ; +Ġend time +fix its +56 74 +go o +38 31 +my Screener +Ġmin size +ĠUn directed +check Box +Se u +ĠOR M +ĠQ Node +Ġcolor RGB +Ġus o +pri cing +ran ts +Ġtarget Position +ĠSe ctions +nn adapter +gin i +45 27 +45 86 +45 45 +45 21 +45 41 +amp ton +PO SS +fil li +the ory +Ġinter rupted +ä¸ ¾ +ĠX s +ĠX u +`` \ +Ġbase Path +CH R +47 07 +47 25 +47 84 +47 95 +]] ]]): +ĠEx plainer +tf d +tf r +tf s +Ġpos itivo +find text +Set Data +Ġsk t +Ġreg rets +')) [' +Ġser vic +Ġone flow +Ch a +Ch assis +wh atever +>> \ +82 64 +ear liest +Ġfiles ys +´ółģ ¡ółģ¿ +Ġar rive +46 07 +46 08 +46 34 +46 74 +ĠJ er +ĠJ ack +ĠJ uli +107 6 +Log Options +Num s +Lo oseVersion +89 88 +ĠSt rength +Field Value +)] ; +fg abe +pk i +Ġq str +TH IRD +sys root +To Add +To Put +To BlockHeadersWithChainLock +ĠPy g +ĠPy ro +ĠPy Py +ĠPy PDF +let or +let BindingTerm +let BindingGTerm +CON STRAINT +De part +De compose +Config Name +not na +block map +Ġdb nd +43 34 +show base +Ġsource Layer +ĠPro g +search er +Ġnet addr +page Num +Ġaction lib +48 05 +48 33 +sv brdf +ĠData Reader +red de +red it +а ÑĪ +а ÑĢам +60 32 +No Sp +\\ { +ãģ © +42 15 +42 84 +42 36 +Ġgroup Sync +Model Form +EST IM +NAME ID +ca res +ï¼ Ķ +Ġfig Size +metri cal +Max NLocator +Ġback test +cond ensed +"]) * +Ġexp on +Ġtag y +Ġtag ging +Get Info +Get Layer +game object +ĠPar ámetros +ched uling +ERS C +39 01 +39 88 +Ġbreak down +Ġsum med +Add Node +Ġover hang +Ġover fitting +.") ; +Ġass istance +build root +Number ing +aw stin +Ġword cloud +src file +Tra ins +Key Event +Dict Key +exit code +MO C +MO MENTUM +mem cache +ĠCo astal +01111 0011 +]), ( +dis f +fit ter +Ġdif fculty +Object Command +Comp arator +ush ort +Ġuni prot +annot s +Form Context +Response Model +dev ops +dist orted +OP REN +ĠTest er +ĠTest Is +ãĤ ı +Ġbin i +job ID +59 05 +59 84 +ĠDe lay +ĠDe cember +sw d +sw ing +si er +si an +Ġlib name +åı ¸ +ĠGener ative +CE P +ãĥ Ķ +Th rift +PL P +52 09 +cell X +ĠUser Factory +QU AD +Ġabs ol +Ġtmp Index +radi an +book Info +ÑĢ аÑĤ +DB w +DB Cluster +Ġgraph ic +Loc Info +EM BER +decode Protocol +SC QS +SC aT +ĠSet point +PRO D +PRO TE +Context Support +Ġ"\ "\ +202 6 +Inter net +Inter ior +72 84 +Ġmy name +Base Segment +Ġtri angular +Ġph on +By Index +fp ga +mod ulus +Ġwrite File +TE AC +Ġsu cess +Ġsu ites +Ġdown sampled +has MEI +ĠCh ris +other dbref +Ñģ л +track lets +ĠSim Manager +pg f +win Layout +bit mex +FO CUS +Ġge ographic +Pre mium +ient e +GR ATE +GR UC +GR ADE +VER DICT +Ġfin n +Sub string +Sub scribed +Ġrand U +ML ANGPATH +gress or +ĠZ I +ĠZ oom +,' - +ĠBase Non +ĠEn vi +ĠEn codes +ĠEn semble +UP p +non local +Ġ�� ´ +Ġì ļ +gb k +gb ind +Ġcell ar +Ġcell spath +}. '. +Ġbest route +ĠStr ong +ĠSO CIAL +nb ath +]+ ( +]+ ". +NE VER +Tensor Shape +sen ds +ĠAdd on +draw er +Ġcomple teness +Ġ14 07 +Ġ14 27 +Ġ14 56 +Te ams +áĥ ij +Ġign ores +br ushes +rel la +her mes +'} : +Mode Enabled +Ġmeta file +.* ') +cm u +Pe ssoa +Event Id +rad ky +GI ZMO +ĠLe ad +ĠLe venshtein +Label ing +Ġresp ident +Ġresp osta +Ġresp onsive +Ġsend To +direct ly +ason ic +Code c +Date Type +lex ers +NA gent +Array Type +Ref ValueType +Sim ilar +./ ( +oo oo +OUT SIDE +Ġest ados +player id +Ġmc script +vers ification +ĠPRO BE +Ġgen py +cla v +requ encies ++" }") ++" /" +ĠLog out +}' ". +pub lickey +custom log +ACT T +Norm alization +Norm LT +Ro i +Ro ots +ĠEX ER +è¿ İ +Ġbl ind +success or +Be zier +Do ublyRobust +GG ING +used datasets +ĠAc quisition +Ġaut or +product name +á» · +FR ACTION +ĠAuth z +Enum erator +cr its +ĠDefault Dict +SH R +GE o +Ġskip initial +Min imal +rest plus +ĠUp dating +USER INFO +mu ch +Ġve get +à® ¯ +à® ħ +Ip EI +fici ally +final Result +Ġselected Path +Ġsort er +ĠOb server +Cur r +ĠPre conditions +ĠSh ar +pa ho +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ +Search Domain +ĠPer f +bi partite +æĪ ¿ +ä¸Ģ å®ļ +ä¸Ģ æĿ¡ +å° į +)} ", +ĠFunction Error +LA UNCH +MIN I +andid at +car ousel +'^ ', +Ġreal ity +menu Edit +<< \ +Ñĥ Ñģ +Stream Bank +Ġ"+ ", +Invalid Input +oriz ations +Ġdec im +Block chain +Ġsav ings +symbol Pair +Ġmerge s +From Local +л а +Ġfeed parser +)( = +feed er +Ġæ ± +ĠSub sector +sr p +Ġ19 86 +TIME ZONE +ĠQu ant +ĠLoc ations +ea h +mar co +Read ings +Read VariableOp +Ġcontrol lable +Ġface book +ĠInter preter +CM U +Ġ<< = +pkg build +With draw +With Examples +Bu f +Bu zz +ĠTensor s +DU ST +('% . +PER SIST +9218108 178 +æĹ ĭ转 +ĠDo e +å¼ º +å¾ ŀ +Ġds l +Back test +Ġcut x +Ġcut y +export ing +relation al +ĠRequest Factory +PH YS +Ġnb convert +mid points +upload file +Ġ"{} /{}/ +/> " +Ġ"< " +release d +]} _ +Noti ce +(? < +DEF INITION +DD z +look ing +Bar Chart +audio FileType +ao h +inv itations +916 6 +ÑĮ Ñı +big ip +dig itize +TRI AL +Ġdes de +PC s +Ġpl ants +HTTP BasicAuth +01011 10000 +Ġbuf size +Format StrFormatter +Target Type +disc r +disc uss +205 4 +UC U +origin ating +fully typed +ä¸į å¾Ĺ +ä¸į åŃĺåľ¨ +ĠSH AP +ĠNew Type +ĠSE QU +ĠSE COND +Dark ening +401 8 +progress bar +Ġbar f +ama elia +tz al +çĽ ij +REG EXP +ĠClient s +break point +shell code +direction al +bf b +IV ES +ua ção +('. /{ +ĠSp in +Ġctsp SgtCaching +Ġctsp AuthorizationSgaclFail +Track let +prec ate +bd g +lc q +ACC EL +ĠTra verse +Cell Type +в еÑĢ +ĠCommand Context +Sample Batch +00100 101 +tl v +Ġè ¦ +Ġpol arity +Multi variateNormal +Ġbook marks +Tuple List +Ġev olve +Ġequ iv +person a +ĠMat hemat +ji ra +Ġcomm unities +Role Member +organ iser +Admin istrator +218 1 +ĠBY TE +complex es +complex Type +Ġ'" ') +Float Type +fx n +==" -- +206 4 +206 9 +Ġadjust ing +ĠTORT IOUS +ĠIO U +297 7 +DQ M +nr pe +Ġmis matches +Ġmis classified +ĠMax well +gri fy +Ġdecor ation +301 3 +åĨ Ĩ +132 4 +௠Ĩ +weep er +Ġem ulator +ATTR S +INTER POL +ĠDescri pción +иР³ +usage s +squ ash +Host Name +ĠMO VE +ĠMO DFLOW +har a +ر ÛĮ +Ab straction +ĠCur so +ĠCur riculum +ĠPri or +203 685 +ACHE D +295 2 +Ġ\" {}\ +Ùħ Ùħ +Storage Account +ä t +lio pe +........ ... +ĠNetwork X +306 4 +306 5 +305 8 +Ġ99 999 +296 296 +Print ing +456 5 +dropout s +ste alth +{}_ {}. +('.') ] +EP G +EP ISODE +éģ ¸ +SERV ING +308 9 +109 100 +148 148 +397 6 +397 7 +ĠSum mer +ĠTEST S +Ġden ote +(", ", +ðŁı´ółģŃółģ £ółģ +ðŁı´ółģŃółģ µółģ +ĠSpe aker +表 åįķ +Ġam f +dark blue +287 2 +PON G +digest s +Ġ105 6 +CY CLE +ĠØ ¹ +284 2 +307 8 +ĠEntity Query +Ġorgan ize +Tool Tip +236 3 +ĠSc roll +Ġ------------------------------------------------ ------------ +209 1 +д Ñĭ +д ел +#---------------------------------------------------------------- --------- +288 3 +288 7 +288 9 +п Ñĥб +Ġ'$ ' +422 9 +catalog s +DOMAIN S +Med ical +FY h +394 1 +394 3 +394 4 +394 7 +394 9 +ĠTR ACK +Ġhalf pi +Ġн Ñĥж +388 7 +NG Key +237 3 +237 8 +NV q +Ġelect rified +Ġcloud rail +426 5 +AAAA A +293 6 +interp QLF +capt ured +å°ı åĺįåĽī +deriv atives +detect MultiScale +395 4 +392 6 +ðŁı´ółģ´ółģ ®ółĢ +396 6 +396 9 +Ġboot strapping +337 7 +387 1 +437 3 +hdr names +Ġcri ar +Ġtrade marks +Ġ*** ") +ãĥ¼ ãĤ¹ +PW C +PW M +Ġ88 88 +386 6 +ĊĠĠĠĠĊĠĠĠĠ Ċ +455 2 +455 8 +bid der +332 4 +Cat álogo +Ġbro ke +Ġhard ness +('{} \ +ĠOper ate +Route Entry +Qos Notif +ĠVM s +ĠпÑĢ од +Ġang ulo +ĠdocsLoadBal RestrictCm +Used Amount +horizontal Layout +407 5 +407 7 +407 9 +é¢ ľ +ĠView s +364 5 +åĬ¨ æĢģ +æģ IJ +song request +STRE ET +kn ight +Ġquat ControlConfig +xi K +third party +Ġkw param +halo mass +Ġmen us +ĠUN IX +nv ml +Ġevalu ates +Ġtun er +Ġtun able +SF U +SCRIPT S +ĠLinear SVC +Make MetadataLine +çIJ ĥ +Ġstation ary +Ġpress ing +Ġcomb os +Ġide as +GY z +Ġcorre ctions +ðŁı´ółģ£ółģ ¦ółģ +Ġи ли +Ġи Ñģп +ÑĪ иб +409 5 +Raw TextHelpFormatter +ĠApply LocusFilters +298 3 +Ġexecuted Cmd +Ste ven +Ġpv b +Ġpv pc +466 2 +Sq US +vertical Layout +ĠAP IMessages +stem mer +phot on +mapp ers +Ġaltern atively +Ra WAN +Ġtrunc ations +ĠFail ing +guide s +ĠFin ish +次 æĹ¥ +Mut ex +Ġ################################ ## +ĠGit lab +Ġqt bot +MAC RO +(. +? +=< - +æ® º +Ġ#-------------------------------- --- +Ġ#-------------------------------- ------- +bla ze +ت Ùħ +Ġmut ated +´ółĢ ´ółģ¿ +´ółĢ ¶ółģ¿ +docsLoadBal Policy +hm mer +ĠAllow Any +Ġpen nylane +MJ s +Ġtech nical +Ġdc gm +ãģĹ ãģ¾ãģĻ +eu ros +Ġsho e +åħ³ ç³» +Clean Up +ãģĦ ãģ¾ãģĻ +ĠSa mpler +Ġmicro seconds +mic ul +Ġquad rature +WW W +ĠEVEN ING +ĠRole Assignment +tele gra +ĠLogin Form +ĠAbstract Base +Äħ d +Ġste am +Ġste ering +BLACK LIST +MZ j +ĠHand ling +ju da +erg ia +Ġsever e +Mar ion +ãģ§ ãģį +Blue print +ĠSeq Parser +Da mage +ĠEmpty LocInfo +Ġ136 9 +ðŁı´ółģ°ółģ ¨ +tang ente +Ġpretty table +Zero Padding +Upload Limits +建 ç«ĭ +Gradient Descent +}% ". +============== ") +éĺ Ł +conj ugate +Fra gs +åĵ ª +åĵ Ī +dD od +Ġcas adi +åģ ľ +å¤ļ å°ij +Ġsup erior +об Ñħодим +ĠEqu ations +OU GH +ĠURI s +{}> '. +bol geler +åķ Ĭ +Fbx Criteria +Src DataSize +ĠES P +Ġmor p +ðŁı´ółģ®ółģ ©ółģ +ðŁı´ółģ®ółģ ºółģ +ATOM IC +Ca ption +Ġub untu +ب ÛĮ +near by +Available Amount +motor dir +ın ın +vir sh +Aug ust +gun ta +ом Ñĥ +brief Description +BOX ES +ĠRelease d +ĠDomain s +ðŁı´ółģ«ółģ ºółģ +ĠDeep CT +Æ° Æ¡ +Ġ× © +Ġcorr coef +mob ili +ĠRob ust +Beam Fitter +SHAR E +å¢ Ļ +好 çļĦ +deleg ated +Bro ken +gif s +Ġwins ound +ðŁı´ółģ©ółģ ´ółĢ +×Ļ× © +Ġham crest +adm ind +ĠAnalysis Session +ĠBert Config +som ename +servo ir +Ġconj unction +Mu on +oẠ¡ +oẠ£ +flower blue +符 åı· +Estimator Spec +spl rep +ĠMetric Meta +ĠHash F +ãĤĮ ãģ¦ +Ġmanip ulating +Ġë° © +Ġë° Ľ +ila dmin +Ġgather ing +#. # +Est imation +STD ERR +Ġgrab acion +ĠCONT ENT +BIND ING +FACT ORY +jack son +åĸ ļ +Ġlikelihood s +Tile Drain +Tele fone +Interpol ate +ĠEnt rez +Ġvl ans +ãĤ¿ ãĤ¤ +************************************************************************ ***** +ilo metry +ä»» ä½ķ +Ġgrp cio +ACTIV ATION +å¹³ åĿĩ +Ħì Ĥ° +ĠProb ably +Aggreg ates +管 éģĵ +Complex ity +Ġoccup ations +DEPLOY MENT +ĠIssue s +ĠCOR RECT +John son +Cam Info +ç¾ İ +esquis ar +Ġmeth uselah +ĠStat istical +Ġoccupancy Dict +Ġrid x +Ġautog enerated +Ġdatal ist +ãĥ³ãĥ Ĺ +ãĥ³ãĥ įãĥ« +Ġcn st +blk io +prm Dict +Shuffle Split +Ġnonzero y +ìłķ ë³´ +BIG QUERY +phenotype s +Æ°á» Ľ +Æ°á» Ŀ +Ġdol lar +Company Name +ĠOrgan isation +Nu clei +vali able +Ġresearch er +Ġbor ough +ĠYear s +PAN EL +REST ART +Sfp Cmd +nest erov +äºĭ 件 +ĠNeural Network +Land mark +Floating Point +bic ubic +ĠÙħ ÛĮÚº +ĠEast ern +Ġlimb s +ĠMemo State +ĠAlign IO +Nothing ToDo +Ġpw ned +filler words +Mini Kill +ĠfltStmt Arb +Arc min +ĠÎ ³ +æŀĦ éĢł +IY QQ +âĺ Ĩ +ãģķ ãģĦ +Positive Number +Ġcapsys bin +Ġtal ent +âľ ħ +Ġcone x +Ġcraw ll +ĠContin uum +satis fies +Frozen Amount +ĠÑĢ ез +ĠAuthentication Form +Ùĥ ÙĦ +eso lowski +Ġyi elded +senti als +ñ a +Ġill umination +Ġrespond ent +åľĨ ä¸ĭæłĩ +mad lib +ĠPan optes +emann ian +TRACE POINT +EXPI RATION +ìĥģ ìłģ +\", \" +Ġslide List +ĠGi B +RECE IVE +Ġconcaten ation +Bron ze +Ġ=== > +åĤ ³ +åĤ Ļ +commut ative +ĠSIG INT +])+' -'+ +Ġdiscreti ze +cru ise +cru ft +john son +ни к +ĠNotFound Error +ĠBul let +EDIT AR +Expect ation +issub dtype +Ġ******************************** ************************ +informat ive +2337 203685 +Men tions +ĠCl ub +ĠREL ATED +ĠCOM MA +kW rist +inic io +('; ')[ +DECL ARE +Ġhashtag s +arpInspect Log +larg er +ÎŃ ÏĤ +Ġrela cion +Ġmarg ins +ĠFl ush +neigh s +Ġcapit alized +Visu alizer +Ġcra shes +SAL ES +hUK h +Ú¯ ر +ĠPASS WORD +Prote ction +ĠPrecision Type +Pal indrome +ĠFun ção +Exc l +---+ ---+ +MIBCompliance s +Xtrain All +isot ropic +Ġhang man +Ġomni hash +ĠCCACHE Principal +ĠOrient ation +ĠdG col +ĠOcc upancy +appe ared +appe tizer +Newton LineSearch +solv ency +ĠctspIf SgtMapping +éĻ³ éģĶ +ĠCi pher +Recomm endation +ĠTel lo +neuro imaging +Ġreprodu cible +········ ········ +CLEAN UP +Pet Images +Tom ato +Ġexhaust ive +obi eta +corn flowerblue +0614 141 +Ġlift ing +Ġoccure nces +ĠколиÑĩеÑģÑĤв о +obtain ium +æĬ¥ åijĬ +Associated With +ĠMut ual +luck y +MOUNT S +ãĤĪ ãģĨ +ëª ħ +Ġä¸ĭ åįĪ +Ġcandle s +9937 00787 +ako on +ÑĢан и +Ġelv DOWN +ĠWi fi +TRANSL ATION +ssssssss ssssssss +Flour Percent +ĠFruit Branch +ĠBRO ADCAST +ĠVIE W +ĠVIE WS +COORDIN ATE +Ability Id +ĠSpectral Shape +ĠINITIAL IZE +Ġrough ly +Ñģк ий +BCE WithLogits +nir vana +pul ses +dele tions +ĠBlink y +Ġqm la +applicable To +Ġasp ose +defin ite +ĠQSize Policy +Ġlocaliz ação +DepthStencil View +aling Data +Ġswe eps +ĠSales force +ĠshadingEngine Lis +gog data +haz mat +ĠSK IP +ãĥij ãĤ¹ +hought on +ĠPLAY FIELD +Ġenhance ment +Ġê· ¸ë +ĠпÑĢед меÑĤ +COMPONENTDEF REQUEST +ëŁ ¬ +arv ud +CHN GN +servic er +Discarded Frames +追 åĬł +SHUT DOWN +ĠдÑĢÑĥз ÑĮÑı +AIn Scan +czy zna +Ġrend ers +ĠClay ful +tomb stone +Ġpredecess or +ĠJAN UARY +书 ç±į +huge ctr +Ġpcolor Opts +Ġfbp cs +ĠComput ational +íķ© ëĭĪëĭ¤ +çŁ Ń +ĠImg ur +explan ation +MaxPktLen Conf +ĠEns ures +ĠÐŃ Ð» +Ġprerequis ite +ĠIntent WithExamples +авлÑı ем +HLL HC +NFT Collection +ĠçĤ¹åĩ» 左侧 +SSign alingData +ÐłÐµÑģ пÑĥб +ĠÑģпиÑģ ок +Ster eo +nch w +èŀ į +Ġinic ial +fifty one +Ġxmlrpc lib +MANAGE MENT +LMHead Model +ân cia +MOUSEBUTTON DOWN +Ġtitan ic +YMO US +Ġdesa stre +ĠRh ino +ouw ens +ANON YMOUS +Ġsimbo lo +000101111 000000 +occure nce +Ġим Ñı +//////////////////////////////////////////////////////////////// ////////// +sok et +çĶ³ 请 +åĽº å®ļ +约 æĿŁ +акÑģ им +Ġìĺ¤ ë¥ĺ +iÅŁken in +Ġballo on +Ġdome stic +ãĤ¯ãĥ© ãĤ¹ +stw ister +gell ert +ĠEpic Serializer +filtra do +lossal ai +ĠJacobi Polynomials +ãĥģãĥ£ ãĥ³ãĥįãĥ« +ĠIMM EDIATE +preemp ted +Ġpreci sely +è¿Ń 代 +ÑĥлÑĮ ÑĤаÑĤ +AndG reed +ĠÐľÐ°ÑĢ ий +Gell ert +jse iler +liou ville +INCENT IVE +angSTR Call +ĠEAR LY +RunTime Params +qtpy vcp +ÄĻż czyzna +HASSI O +PFP upp +Ġsfe py +setPixel Color +ĠInp lace +Ġstopp oint +EROUT ING +ĠgetManifest Template +ToPut In +ToBlockHeadersWithChainLock s +аÑĢам еÑĤ +GRUC ell +Ġskipinitial space +NothingToDo Exception +MiniKill CamInfo +åľĨä¸ĭæłĩ buff +993700787 401 +ĠçĤ¹åĩ»å·¦ä¾§ æĮīéĴ® +ÐłÐµÑģпÑĥб лика +" ? +" _ +" '. +" ../ +" '). +# **************************************************************** +' /' +* > ++ % ++ , ++ .*)') +- (? +. -- +. ## +. (\ +/ (( +3 146 +3 134 +3 142 +3 171 +3 021 +4 255 +4 124 +4 198 +4 106 +4 176 +4 148 +4 138 +4 162 +4 151 +5 105 +8 23 +8 948 +9 0000 +9 175 +9 147 +: '): +; *. +; :{ +; '/> += * +> [- +@ _ +A ds +A IC +A ust +A UD +A rab +A diabatic +A thena +B c +B ps +B service +B ACE +B KB +B ONUS +C IT +C ANT +C Msg +C arraro +D type +D istr +D TYPES +D ynamics +D aniel +D erived +E ID +E MO +E quivalent +E CHO +E EXF +F er +F path +F RI +F air +F allback +F qt +F illing +F acility +G st +G ad +G ING +G DB +G OLD +G erman +G rupo +H ans +H cal +H CI +H ASS +I e +I on +J pi +J AV +J acobian +K nots +K lineEdit +L f +L ICATION +L acp +L aser +M il +M ING +M fg +M ik +M oment +M organ +N at +N est +N ear +N MS +N wc +N REM +N atl +O am +O Qk +P ts +P ET +P PO +P CH +P layers +P ier +P added +Q c +Q CheckBox +R ho +R TC +R pm +R idxs +R ental +R agged +S ense +S IS +S ale +S PO +S IB +S ie +S xx +S MB +S ua +T ow +T CI +V ING +V aj +V IJ +V wu +W on +W AG +X DG +Y F +Y un +Y aml +Z GR +Z mZ +[ , +[ ', +\ : +^ & +^ ( +_ ], +_ '] +_ |\ +` :: +` .\ +a O +a file +a ag +a ef +a Mag +b ies +b dist +b alancing +c un +c di +c da +c lp +c ses +c pl +c groups +c ione +c arraro +d to +d sc +d art +d Type +d ali +e on +e an +e go +e bar +f min +f pi +f é +f beta +f estival +f lashed +g X +g ue +g ai +g cr +g irs +g proj +g aps +g kE +g topk +g Xz +h re +h cl +h ift +h anded +h aves +i D +i W +i ad +i ud +j pl +j si +k at +k th +k ow +k cs +k rpc +l xc +l ph +l inter +l ant +l mbda +l prob +l una +l ÉĻr +m ds +m ys +m code +m ard +m uti +m List +m call +m Dict +m ssql +n ore +n og +n bin +n ell +n ones +n uv +n procs +n ccl +o D +o J +o mp +o map +o ster +o las +o SM +p D +p ite +p sk +p board +p next +p rase +p nts +q X +q be +q td +q NB +r ct +r ta +r ws +r shift +r uby +s le +s na +s rs +s cov +s udoku +t D +t ut +t var +t ors +t last +t ank +t ga +t weak +t Water +t uesday +t amanho +t CaloStage +u I +u K +u S +u T +v ark +v card +w Z +w ig +w ings +w af +w ish +w pa +x R +x ss +x si +x account +x Vals +x BA +x refs +x WK +x ilinx +y C +y K +y Q +y md +y Test +y Length +y ara +z or +z are +z Type +z stack +z inc +| {}\ +} }'. +} `, +} ^{ +} >") +« ìŀIJ +¯ ä¸Ģ +¯ 件 +à Ĭ +É £ +à ¨ +í İ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č čĊĠĠ +Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ оÑĢ +Ġ åıĤæķ° +Ġ ப +Ġ ERC +Ġ âķļâķIJâķĿ +Ġ è¿ĻéĩĮ +Ġ çĶ¨äºİ +Ġ ultra +Ġ ��ıĸåĩº +ij å®ļ +ĺ 리 +Ŀ ì²´ +ĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +in items +in creasing +in anet +or ize +or qa +on oi +at um +at alog +at órios +re ce +re im +re auth +re define +re minder +re zervaci +se lective +se ismic +st b +st bl +st ica +st owaway +en ode +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ +Ġt S +Ġt as +Ġt am +Ġt if +Ġt mb +Ġt ec +Ġt ron +Ġt SS +Ġt body +Ġt weak +ar ai +ar oo +ar aoh +al m +de leting +le f +an mar +an vil +Ġi C +Ġi q +Ġi val +Ġi dd +Ġi graph +Ġi Reg +Ġi Scale +Ġi cmp +-- ") +me lt +me spath +Ġ' == +Ġ' }' +Ġ' (', +Ġ' ()': +ro data +ti q +mp g +Ġc ord +Ġc obj +Ġc txt +Ġc Info +Ġc fr +Ġc rack +Ġc oba +Ġc limate +Ġp li +Ġp ra +Ġp load +Ġp ings +Ġp doc +Ġp tf +Ġp dist +Ġp vol +Ġp isa +Ġp izza +Ġp urification +Ġf ct +Ġf size +Ġf ron +Ġf sql +Ġf pad +Ġf ashion +Ġf ocused +Ġ" ]] +Ġ" && +he e +it t +it ate +it are +it ools +lo pt +00 96 +00 65 +ge les +ort a +', '')) +Ġn ar +Ġn ist +Ġn samples +Ġn asc +Ġn timesteps +Ġs list +Ġs xc +Ġs ounds +Ġs xy +Ġs ized +Ġs mote +ss s +ss v +Ġin x +Ġin out +Ġin cl +Ġin cr +Ġin volves +Ġre tail +Ġre late +Ġre distributions +Ġre parandum +Ġo e +Ġo da +Ġo dk +Ġd Q +Ġd ti +Ġd jang +Ġd lat +Ġd ork +li ber +ct ate +un iv +un ify +un filtered +un specified +un verified +Ġm st +Ġm op +Ġm nt +Ġm os +Ġm box +Ġm á +Ġm jd +ra cket +Ġe ab +Ġe list +Ġe vs +Ġe sses +Ġe miss +Ġe clipse +la dy +la cion +la unched +() < +() """ +() [:, +() [:- +ent rada +ent halpy +ad rado +", ", +co le +co pper +co variates +ri an +ri me +ri as +Ġthe oretical +Ġb ld +Ġb pad +Ġb aud +Ġb lighted +Ġ1 100 +Ġ# ', +ed b +11 16 +11 25 +11 94 +11 78 +um o +int Type +Ġ( > +Ġ( ',', +Ġw w +Ġw et +Ġw sg +Ġw oman +Ġw atches +Ġw ood +ch s +ch al +ch ia +ch arging +te tra +te fact +di vided +ata re +Ġself mon +Ġself drive +== ") +], ( +], ) +from Buffer +Ġfor mer +Ġfor got +': "< +es a +es pan +ĊĊ ĊĊĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĊĠĠĠ +ode sic +is inf +is Active +val ign +name cols +get ype +get List +get uid +get Column +get Block +get Page +get Cluster +get pw +(' ) +(' () +)) ? +set Name +set locale +set Angle +Ġto e +Ġto mb +ĠT al +ĠT AD +ĠT ank +ĠT ILES +ĠT itan +il legal +th rown +us ps +str f +Ġ2 83 +Ġ2 78 +Ġ2 030 +ers can +(" %( +(" {}". +(" )", +(" '% +pp p +pp t +as f +as se +as ion +as ant +as nn +as px +ĉĉ Ċĉ +[' @ +op tic +op cional +Ġis Used +Ġ7 60 +ĠS HE +ĠS ORT +ĠS ROM +ĠS CS +ĠS inger +ĠS entiment +ĠS UPER +ĠC r +ĠC DS +ĠC losing +ig raph +ig uous +ig rams +") [' +Ġdef initely +Ġg cc +Ġg ross +Ġg cloud +for wards +Ġr er +Ġr cs +Ġr ush +Ġr sqrt +Ġr ational +Ġr sem +Ġl main +Ġl ps +Ġl sq +Ġl rtc +": "" +end oc +end ere +data model +data ft +data Type +ĠA K +ĠA W +ĠA er +ĠA FF +ĠA valiações +ĠA iiDA +sp ack +sp fx +01 27 +01 55 +01 33 +01 85 +Ġcon trib +Ġcon ference +ic ation +ic lu +ic ide +to log +to high +to dense +99 212 +Ġ: [' +path nodes +type defs +ĠF rank +ĠF OV +ĠF ALSE +od ou +sc lient +qu irer +log like +om ni +Ġh v +Ġh il +Ġh all +Ġh ire +Ġh ive +Ġh ough +po ches +ta pp +ĠP t +ĠP ast +ĠP ron +ĠP BE +ĠP icture +ĠP USH +ĠI so +ĠI van +ĠI deal +file menu +ĠL t +ĠL on +ĠL PAR +ĠL aser +res izable +Ġth rottle +=' "', +Ġde b +Ġde ar +pro ces +pro vin +ex a +ex cluding +im en +im ized +im mobili +Ġex ercises +Ġ3 11 +Ġ3 34 +Ġ3 44 +Ġ3 28 +Ġ3 71 +10 25 +10 34 +10 49 +ow ed +ĠD ri +ĠD ub +ĠD ST +ĠD ONE +ĠD eno +ĠD raft +ac ad +ac fg +ac les +Re action +Re present +Re curring +sh ang +sh iny +Ġdata IO +ĠM om +ĠM ine +ĠM RI +ĠM atter +ĠM use +ĠM NE +ĠM iddle +ĠM irror +ĠM Pa +ĠM Ãī +time frame +time Stamp +if u +key ed +Ġv ms +Ġv are +Ġv df +Ġv umi +Ġv aries +Ġv switch +Ġv Inc +02 02 +02 16 +02 03 +ĠO db +ds lx +Ġ* ) +Ġ* ', +Ġx offset +Ġx hat +Ġx DP +Ġse ps +Ġse lective +ack et +test a +test util +add Transform +add Weighted +Ċĉĉ ĠĠĠĠĠĠĠ +Ċĉĉ ĊĊ +[" < +[" @ +ER Pp +IN UOUS +Ġstr ands +.. # +xb an +load Tests +ore tic +Ġ% ]', +Ġme mbro +---------------- ----- +---------------- --------- +Ġpro cedures +py mol +art ments +xc be +pre ference +pre cedence +07 07 +07 907 +xd ump +xd gm +Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠB G +ĠB or +ĠB ou +ĠB box +ĠB ear +ĠB GP +ĠB illing +ĠB azel +12 25 +12 22 +12 79 +ĠE MA +ĠE scape +ĠE quival +ĠE stab +ĠE MBED +Ġj ulian +ci phers +text Info +AT IC +Ġ) * +low tohigh +com and +ĠN H +ĠN Z +ĠN r +ĠN s +ĠN uc +ĠN TP +ĠN atural +}, {" +len lp +num FidsInList +################ ### +Ġres istivity +Ġ4 29 +Ġ4 69 +Ġget User +lu is +92 75 +92 000 +92 67 +In ds +In flow +In duce +In crease +In Scene +In Place +In Force +In cluding +ĠR s +ĠR io +ĠR ice +ĠR DM +ĠR HS +ĠR asa +ĠR abbit +mo ore +Ġun c +Ġun like +Ġun normalized +Ġun electrified +fo ster +fo lios +ule ur +ule tte +read mill +32 19 +32 21 +per clip +oc a +oc co +son ic +ĠG U +ĠG a +ĠG od +ĠG reg +ĠG rupo +Ġco li +EN DO +ĠW M +ĠW a +ĠW ing +ho ppingSite +url join +Ġout l +bu zz +bu ddy +AR P +Ġ5 15 +Ġ5 05 +Ġ5 46 +Ġ5 91 +Ġhe al +ape x +Ġan a +Ġan ten +Ġan ova +Ġen calc +Ġen coders +che ster +999 6 +18 09 +18 24 +18 81 +16 12 +16 15 +16 86 +16 56 +16 98 +line Citation +sa mplerate +cur ie +cur Contrast +da e +Ġk id +Ġk Wh +Ġk endall +Ġcol lects +25 01 +25 05 +25 91 +Ġro uted +St ations +Ġpy mc +Ġpy win +Ġpy brain +Ġpy quil +Ġpy pandoc +Ġpy fos +Ġ6 16 +Ġ6 24 +Ġset Create +ag ues +ts d +Ġmodel VertexAttribEnum +13 10 +13 45 +lib elle +Ġwh ites +Ġwh iten +ll ar +15 24 +SE E +SE M +SE MI +ST AG +ec tious +max Force +05 05 +05 57 +Ġthis dir +Ġthis Glyph +03 16 +03 15 +Ġint code +cs i +cs dk +we ave +Ġop Dict +train Idx +Ġch am +Ġch dir +ax ins +17 73 +17 900 +dd u +14 25 +14 88 +14 56 +Ġpre vs +Ġpre cursor +Ġresult ed +Ġat tribution +info mapWrapper +LE C +LE AG +Type def +RE PRO +IC IT +08 01 +08 03 +AN O +22 81 +Ġ\ :[ +ĠH G +ĠH P +ĠH TT +ĠH MM +ĠH unter +ĠH PAI +ĠRe vision +sub plt +sub Path +Ġ{} ] +input dir +np u +np bf +eri mp +][ %( +mat s +Ġdi als +df n +db m +db ag +88 15 +lin has +lin tian +comp liant +comp ensation +ID ata +Ġsc ored +Ġsc rolled +34 88 +34 41 +pos able +84 64 +84 36 +84 98 +ĠIn vest +ĠIn creasing +write bytes +Ġkey space +inter lace +inter national +by z +Ġle fto +24 87 +24 56 +24 800 +Pro v +Ġoutput Col +Ġpo li +Ġsub plt +Ġsub nodes +96 13 +96 09 +Ġac comp +Ġcomp ounds +ĠCon versation +Ġnew list +94 97 +Ġcur ated +Ġcur Slide +Ġ} . +33 38 +DE FL +Ġapp let +Ġapp liance +json string +Ġno mes +87 99 +87 64 +87 96 +87 74 +no Noise +Ġla sa +Ġla gs +85 16 +97 07 +97 88 +97 37 +97 94 +97 65 +mi cha +mi xtures +net ometer +36 05 +36 88 +36 33 +36 39 +36 62 +=[ {" +Ġopen ff +ĠK V +ĠK u +ĠK ol +ĠK ills +ĠK evin +95 05 +95 75 +lat Lng +Ġit alic +86 18 +stra va +26 10 +26 02 +Ġmax split +Ġdo ctype +Ġz info +Ġz lb +################################ ######## +process Receipt +AG TC +AG UU +57 33 +57 66 +57 82 +Ġ! _ +Ġ[' __ +... ")) +Ġ8 05 +Ġext Right +create Data +ED B +IS US +IS ODES +reg plot +do metry +parse AndOutput +group Id +"," / +Ġcreate Matrix +current Index +color scale +color maps +color imetry +man ufacture +version ed +66 04 +23 00 +AC S +=( ? +Ġcheck rain +44 94 +44 91 +44 81 +44 54 +44 59 +44 53 +frame bit +IM U +Ġdis cussion +Ġdis nake +ulti es +Ġ** {" +ENT RIES +OT O +Ġnode list +']) * +raw source +var Ch +so ul +56 97 +go ma +go es +98 00 +98 99 +98 07 +Ġsp iral +local ftp +Ġmin v +ĠUn fortunately +Po kemon +Se en +uc d +Ac id +Ac Fan +be ck +Ġcan onicalize +ĠQ c +ĠQ Settings +ĠQ Painter +ĠQ GridLayout +Ġcolor Hex +PT w +PT unable +35 35 +ud l +Col lections +ref dict +ern ando +Ġwor ry +File Upload +AD CP +Ar ticles +cre ments +Ġim csdk +doc no +',' *. +',' _') +ĠSe parate +Ġad mit +norm Off +45 00 +45 26 +ng uin +attr name +ide code +token izers +ĠY T +ĠY aml +ĠY EAR +Ġinter sections +Ġrandom Line +ĠX LS +ĠX MPP +`` .""" +Ġbase Type +Ġbase URL +CH ASE +call args +47 99 +47 34 +47 87 +47 57 +47 48 +47 42 +101 2 +101 4 +[:, [ +[:, :- +Set Name +Set Avatar +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +pl ates +IL T +Ġreg ress +Ġreg rid +Test ed +Test Size +Test Loader +')) [ +HO VER +Ch ristian +led ges +du pes +Ġlin et +gen B +gen bank +gen otick +sg f +order By +Ġar ctan +46 19 +46 83 +PE C +ĠJ et +ĠJ PEG +ĠJ AVA +ĠJ ordan +ĠJ UMP +ĠJ ulian +89 01 +89 86 +source File +DI tem +yp ass +Field Options +Ġcal ories +[- ( +)] < +ld nn +Ġmodule Context +pk cs +Ġq ty +Ġq gis +TH UMB +TR T +sys Log +air play +To Smiles +ĠPy Pep +Ġ''' `` +DO S +De k +De pression +De bian +Config Stack +US C +]* ', +dim ms +block devs +Ġtable au +Ġdoc body +off s +gn mi +graph ml +67 96 +43 16 +Ġitem sets +ĠCON TRI +ĠPro cesses +CL ANG +vid Time +Ġ100 01 +vo icing +Ġnet list +SI F +Ġmatch up +cu los +context lib +48 06 +48 64 +)* \ +Ġqu orum +Ġqu arantine +Ġimg name +EX TR +red ner +No se +No va +total FlourGrams +Ġarray ScaleT +ãģ ° +ĠAr n +42 94 +TT Y +Ġtemp sum +msg pack +task path +debug level +ca e +board list +Ġfig title +Ġuti lize +ĠÐ IJ +"> ', +cli entid +Ġtotal SendText +"]) [ +Get Data +Get Cell +Get Driver +UM F +Node Map +ĠPar agraph +rect angular +xy xy +39 64 +Ġsum it +Ġsave Name +rand Int +initialize Range +Ġele c +Ġele man +Ġass ertions +--- ") +Ġnorm alizing +mer kle +54 84 +Column DataSource +Ġauth lib +itle ts +cv ae +exit Code +fn match +Ġimp acts +Ġ... : +Ġ... ). +Ġnext line +Object InScene +Bo dies +ĠTO P +dev table +over time +over loaded +Input Layout +Ġab sence +58 03 +58 64 +58 34 +State Notification +State Disabled +access ors +pr s +pr sa +gr anted +gr inder +dist Char +dist Peak +dist ortion +learn ed +Out come +и к +и Ñħ +ãĤ ĥ +ĠNo Return +ĠNo tifications +Ġbin ds +Ġbin ario +change speed +59 06 +59 8424 +ĠDe position +ĠDe bian +ĠDe livery +sw aps +CA path +Ġexec vp +Ġform ulas +itor io +ĠRes net +ĠGener alized +ãĥ ĭ +Ġpage d +Th rottle +çļĦ 人 +çļĦ æĸ¹æ³ķ +At End +PL C +inser tions +Up Time +Ġhere in +Ġabs or +Int roduction +IP V +disp ersion +:] ], +RES ENT +radi cal +ĠPath ToTest +DB OT +BU GS ++' /' +EM MEN +tic ity +sim u +Ġorig ins +Ġoptim izing +ĠWe ak +stream Data +Ġ15 2215 +Inter p +Inter cept +Ġgl ance +}") . +na o +na Letalis +åĪ ¥ +extra spath +CK B +med Var +Ġmy rank +41 32 +Ġtri mming +mc Ntw +Ġconst ellation +"); ' +Qu er +Qu arantine +By Class +ĠFor bidden +################################################################ ############################################################ +window ed +mod flow +dt m +admin istr +full chip +full argspec +has oc +body Index +uff ing +uff ling +inst it +inst ein +resource UUID +az im +az oo +az ioni +wise Conv +Ġcsv reader +Ġvis dom +meta var +des var +Sp aces +sm ar +sm ith +tax i +/{ {{ +FL UID +sin i +active background +active Jobs +ĠDE MO +ee g +VE LOCITY +Ġge w +GR L +GR P +web links +cast ing +math text +Sub urb +Ġ$ ' +sql c +SER IES +dat adog +gor illa +NO FF +ĠBase Handler +Ġì µľëĮĢ +rs age +rs lt +Ġnoti fied +61 92 +Ġtwo chars +GB A +GB Y +Ġcell Value +Ġcluster ings +Ġzip s +hex str +]+ | +]+ ') +NE F +Ġposition ed +Ġposition Gain +Ġ'% ') +draw n +Ġ13 1072 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +cut ting +her m +rot ors +'} ]} +Mode lo +è¯ ij +Or q +Or gs +Ġsw da +Ġsw apping +Ġsw apper +GET BLOCK +Pe ssoas +Event Base +ĠLe g +Ġspecified Date +Ġmer lin +NA XIS +cap np +cap ped +arm Controller +thread Name +CI SE +oo vs +Mat plotlib +Start s +jnxMbgSgw DelBr +jnxMbgSgw ModBr +.... ") +multi sample +multi dim +long cmd +ĠPRO FILE +ĠPRO DU +sec PerLine +ĠTime InForce +ĠOr d +mk l +Ġsuccess ive +profile PicUrl +chain ed +chain code +cd rom +Pri v +Pri medVar +ĠCom ma +Ġ"% " +å® ĥ +=\ ' +term Summary +Ġconn ectiv +custom izations +ACT TT +ĠUnit Model +ĠUnit Command +parti ally +10011 00 +rb ac +ĠHttp Status +CRE DS +ĠName Count +neg dis +Ġ"_ "). +Map a +GL U +GL Y +Be ans +ठī +GG TC +Ġpad rão +vol umen +fetch Status +Ġrot ors +validate Name +End Date +á» ³ +á» µ +á» ¹ +Ġgr d +SH L +convert ing +tile Name +Valid ating +ĠAt l +respon ds +Ġdon nées +hes ity +ish able +ish ness +Ġve g +Ġve cs +depend ents +mac rolanguage +Ip Ranges +ĠAl len +ĠAl bert +Ġdat an +Ġselected Features +Service Linker +Ġcap size +ĠOb servations +fl m +fr ng +screen ing +ĠPre Trained +ĠPre paring +ĠSh ot +Ġdelta Peak +pa ul +Ġstack ing +Search Space +ĠPer imeter +æĪ ª +Ġct u +Ġattribute Type +Ġattribute Name +([" % +POINT OPTIONS +å° º +ĠAd Hoc +reference Unit +MB I +STAT EDATA +VENT ION +Ġfailed VoteLogTrx +ĠSer um +ĠAn chor +OB RACE +1111111111111111 1111111111111111 +Range Start +Range End +black out +period LE +period ogram +ĠLO CATION +ĠLO GGING +Ġdiff ers +UU EMNN +CONT ACT +Ġæ ³ +Ġæ ¸ +Ġda q +ĠSub Command +SL ASH +Ġhand y +čĊĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ +ĠLoc ator +GO EEXF +ĠOpen ID +ĠOn line +Ġinser tions +parameter ized +Ġpatch ing +ĠIP Address +SQL ITE +Classifier VlanMap +ĠHttpResponse Error +ĠHttpResponse Forbidden +Ġcontrol Mode +available classes +Ġpr ó +fun site +ç» ijå®ļ +mis ses +Ġside bar +Default Value +Ġsubject ed +Const Context +Ġcop ula +Ġzero es +åį İ +Ġcre at +Property Meta +Light Link +Back bone +192 1 +Ver micul +gl Get +Go To +Go Lab +ا ÙĨ +relation Map +speci fications +ĠHTTP BasicAuth +Ass ist +к Ñĸ +owner node +Ġ"< ", +NS amples +Noti fier +(? :\ +ĠGo ing +kw i +Edit ing +dc ad +ĠMy Graph +Ġtile db +çĶ¨ æĿ¥ +è® ¸ +Grid Size +Component Name +COMP ANY +TRI UMF +}} $', +ĠExt end +Ag ain +ĠMo ves +dense Layer +Ġcent res +01011 10 +Ġcharacter istics +Ġcharacter creator +dummy path +byte order +disc arded +disc losure +ĠText Field +ĠIter ations +ĠIter ative +Pass words +media Type +CV C +scan dir +Ġri se +Ġri ce +Sk u +cn trs +ato shi +ä¸į ä¼ļ +ä¸į å¤Ł +ah y +ascii art +zen ith +ĠSE AM +Exp ire +exist ant +UND AY +Dec or +sol ns +Ġep hemeral +Ġrep lied +switch ing +204 0 +204 4 +Ġhome work +Plot ing +star let +Ġway point +Ġsen ti +ĠRead FemResp +Sw itches +break er +Interface Number +Account Name +Account Que +Account Selection +ĠDB US +IV UTIL +Ġtw ilio +Ġcross ings +('. '. +ĠSQL ITE +ĠAD G +Args BaseIndex +Random ForestRegressor +ĠIndex ed +BACK BONE +under standing +Fixed Width +ĠTra vis +pie zo +Profile Args +wall time +ĠProcess PoolExecutor +deploy er +MD g +Ġè · +Ġè ĩ +differ ential +differ entiable +Ġpol ys +Ġpol ler +ĠMon ths +ðŁĩ © +ðŁĩ « +ðŁĩ Ń +Work load +Work book +çİ © +negative Rate +contin ent +BA ZEL +234 3 +æŀ Ĺ +sl di +Ġequ ip +Ġequ ally +ĠCode d +ĠDet alhes +Ġvo ce +Attribute Dict +ji ang +01000000 3820 +915 7 +RC ardTable +RC ardEntry +ĠMulti Mode +ĠMulti variate +ĠMulti DiGraph +BI ANA +emp erature +Ġexpand ing +Ġtab ular +¡ółģ Ńółģ¿ +163 16 +Ġcdbp RealmKnownPeers +Ġlate xtools +Tri gonometric +Ġbig ip +Ġinner datapath +ä¸Ń å¿ĥ +208 7 +ae iou +shuffle Logic +ĠDO ES +Ġcla ve +ĠPh ys +Ġmd sspath +301 5 +åĨ ³ +Last Edit +tot s +Ġsol v +Ġsol um +Ġem ulate +Ġem mental +Space Token +Bot tle +Gen ome +Ġfe conf +Ġfe lix +905 5 +Ġsur prise +hw p +ĠMin ute +Feature Extraction +Part Number +Ġground SH +separ able +specific Tissue +Ġthree bot +(". "): +Ab normOff +ä¸Ĭ çļĦ +ä¸Ĭ ä¸Ģ个 +203 4 +jnxMbgSgwPP DelBr +jnxMbgSgwPP ModBr +met atable +jnxMbgSgwIf DelBr +jnxMbgSgwIf ModBr +299 2 +Ġ\" {}\" +315 7 +315 8 +315 9 +Storage Class +Ġ"[ % +cum ul +857 143 +Lim iter +Lim itation +GPU s +PK CS +ĠNetwork ing +åħ¥ åĬĽ +ĠAttribute Type +ĠPerson s +updated At +Ġfh ir +Translation Notification +Translation Sync +Translation Urls +Translation Subscriptions +ENTRY POINTOPTIONS +Ġvisu als +ANS WER +Ġgeo coder +456 3 +456 9 +hyper path +EP ISODES +éģ ¿ +Ġnone xistent +Dete ctions +Ġnd arrays +308 3 +304 5 +Pr incip +pur chases +Display Utils +sto ppo +sto ichiometry +Ġmet atiling +("{} |{}|{}|{} +ĠOp Test +Ġvelocity Gain +Ġden oted +ðŁı´ółģŃółģ ¡ +ðŁı´ółģŃółģ ¹ +vor i +say hi +Ġ---------------- ----- +Ġ---------------- ---------- +Ġnor dic +pdb flex +VK h +dark net +Lin AlgError +OFF ER +Expression Context +ki lo +-> % +ĠQuery Uniprot +ĠØ · +Ġí ĸ +Ġí ĴĢë§ģ +Auto Scaling +å· ³ +Ġavoid ing +284 3 +284 9 +427 7 +427 9 +Ġsignature x +292 6 +Ġflo ors +Ġdiag on +Ġdic ion +spread flag +spread sheets +ç§ ģ +REF PROP +OD g +Med lineCitation +rend ers +394 2 +sz yst +Ġblue tooth +436 6 +ĠCLI P +å¸ ¥ +ific acion +Ġadj Pvalue +388 2 +388 3 +Ġ'[ ': +Ġ'[ {" +大 éĥ +237 7 +Ġfront GroundGHI +Ġlab s +Vo tes +Ġur ban +Ġelect ro +pix set +pix format +Ġcu isine +293 5 +293 9 +303 5 +303 8 +ĠLib re +Accept ed +Ġrepe atable +qV QK +à± Ĥ +tm ux +collect d +HH HH +æµ · +Ġhold ings +396 8 +457 4 +Ġlegend size +337 2 +337 8 +387 6 +387 7 +ем Ñĥ +437 6 +437 7 +Vol unteer +Report ed +ĠOver lay +ĠFilter Call +åIJį åįķ +Vlan Id +Ġhex str +Flag ged +cook er +386 9 +ĠDocument s +455 5 +El Left +ĠMap CellType +è½ ¯ä»¶ +tun gs +ĠSci ences +sound cloud +332 2 +Sm allest +Ġai y +urb ine +Ġcam Data +bm ds +Ġ----- ") +ë¡ ¤ +ç± ³ +Func Animation +aco ustic +ĠShow s +[:,:, : +ĠпÑĢ ог +405 6 +è· Ł +Inv ite +/# / +Car lo +Ø§Ø ¦ +Ġpast ed +ĠTry Lock +çķ ° +Ġroll ES +Ġpacket Handler +RESPONSE V +364 3 +Ġurls afe +online judge +ĠCall ing +Syn onym +ĠGenerator Type +309 4 +Ġarc name +Ġ============================================================================= == +ĠSupp ress +ä½ľ åĵģ +Ġpyg mo +285 8 +Ġ################ ####### +Ġ################ ############## +ĠSw agger +Ġд о +onto logies +Ġvirtual HostUtilities +="# " +Ġalt ura +GY RO +Ġlb ls +Ġcorre lación +toc Str +Ġheat maps +cutoff s +Equ ation +Serial Query +Serial StateNotification +ipy ard +ĠApi Error +}$ ' +Camera Setup +Inser tion +)[' \"] +áĦ Ģ +áĦ ĥ +Diff Convs +ĠAWS Region +Ġaffili ation +("../ ") +ðŁı´ółģ¢ółģ ·ółģ +Stock Model +taint ed +Ġarm or +Ġarm our +Bool Type +oct olytics +åıĤæķ° åIJį称 +Ep Number +Band it +Ġfragment ation +ARB ALL +åIJİ ç¼Ģ +Ġ#-------------------------------- -------- +Ġmanifest data +ê³ µ +ĠNEG ATIVE +Spect roscopic +morph W +ĠAv ailability +´ółĢ µółģ¿ +Mag ick +Mag nitude +Ġprom in +Remote Server +Dump ing +spo iler +Hw Histos +LAY OUT +CLO SING +èª į +èª ŀ +VI ER +Ġparticular ly +Ġta H +UAL IZ +TW LIGHT +(".") [- +Keyboard Interrupt +>` __ +>` _. +ĠStream s +ê¸ Ģ +Texture Filename +pal indrome +ĠLogin Error +Http Error +Ġdd trace +Ġrecogn ised +Mar shall +ston ed +exact ly +ãģ§ ãģĻ +street view +ĠChar les +ĠPosition al +ĠImp licit +Boolean Field +autom ated +Ġ'.. ') +="{ & +ðŁı´ółģ°ółģ ³ółģ +ðŁı´ółģ°ółģ ¬ółģ +hal frng +ĠDummy Operator +ô t +memo ize +åıª å¾Ĺ +åıª èĥ½ +ĊĉĊĉ ĊĉĊ +448 55 +algo Params +ĠLi u +contrast ive +Ġtor ow +Pol ynomial +åģ ĩ +Ġ+' /' +Cer tain +Elect rical +vcf call +Ġvoltage s +åĨħ éĥ¨ +acp ypes +Ri ver +Ġfunctional ities +fruit Purees +äºĮ åįģ +Ġ"\\ " +ĠDIR S +Feed back +Ġima gined +Ġoct avia +vic tim +Ġmorph ology +Ms gs +Ġens uring +ĠEdge DB +Ġrecur Searcher +chem ical +Actor CreationTaskSpec +Shift Arr +Es colha +Ġ'& ' +ĠChannel s +({}) ". +655 36 +Ġ× ¢ +Ġ'| ',' +éĥ½ æĺ¯ +Ġtoggle Button +Require Debug +ä¹ĭ åīį +vex Hull +FULL SCREEN +اÙĦ Ûģ +nut tx +Ïĥ η +Ġosg Terrain +аÑģ Ñĭл +May be +deleg ations +LOY EE +åĮħ æĭ¬ +Tw it +ак ÑĤи +ĠCRE DIT +LogLevel Response +LogLevel Request +Updated Notif +ðIJ ij +Ġig ual +Cy thon +Ġvk Value +Learning Rate +ĠMET ADATA +([^ '\ +ĠInstall ing +Ġroutine Timer +Health y +LER ANCE +flt Spec +Ġfocus able +ï¼ģ ") +ï¼ģ ï¼ģ +ĠCould n +,* /*; +Ġlm db +空 æł¼ +Ġìŀ Īëĭ¤ +åºĶ 该 +JA EGER +åħ¨ éĥ¨ +ĠSkip Test +ridd ing +Ġ147 0 +Ġíķ Ļ +website Url +Ġcad nano +ãģ¾ ãģĽ +Rank ing +Ġstrand Over +æıIJ åıĸ +craw ling +who is +Ġæī Ģ +Hand ling +Rad ianInverter +highest High +668 36 +è¦ĭ äºĨ +GM CC +evalu ators +ółĢ²ółĢ µółģ¿ +ółĢ²ółĢ ¶ółģ¿ +CHANGE LOG +eigen vector +************************************************************************ *** +inel las +Ġgi ant +COPY RIGHT +blend Shape +çĪ ± +Ġfan Art +Ġmens aje +xgb c +Ġisol ation +âĪ ļ +Mol ToSmiles +enci ar +enci amento +Tech nical +ν δ +ĠFE ES +PIX IVUTIL +REL ATED +ĠìĹ ¬ +ĠDistribution NotFound +000001100101 0101111 +getsize of +agree ing +ðŁı´ółģ¤ółģ ¥ółģ +erc ic +Veri fier +cY mh +easy Core +domin ant +Ġrelat ively +ад аÑĩ +OAuth Users +aver aging +æ· ± +ê² ° +Asc ending +ANALY ZE +Attach ments +å¼łæĺ¯ åı°æ¹¾ +Æ°á» Ł +èĻ « +ĠColour s +Ġcoco tb +Ġanim ated +æīĵ å¼Ģ +Trust ed +ëł ¤ +Ġpare ns +KD Tree +pup pet +ĠfltStmt Ip +cand y +skeleton s +த வ +âĺ ħ +Ġtan h +ĠDisable Able +MONITOR ING +âĸĪâĸĪâķĶ âķĿ +Ġ***** ") +Ġhom ogeneous +Ġ!!! !") +ĠMyCustom NewsPopularity +ĠBits Type +Attack er +Ġcraw l +åĽ½ å¾½ +BED ROOM +represent ed +Ġtreat ments +Sun day +atten uation +ole ans +consu med +vul n +('../../ ') +ĠSep tember +ĠKo di +Ġabbre viations +ĠÄ ° +meme ber +Ġbirth day +CCC GE +Dynamic StockModel +ĠPl anning +COVER AGE +ClassifierIp Source +ClassifierIp Destination +hil um +marg inal +Ġsma pe +åıĬ æııè¿° +ĠÑģÑĤ ÑĢок +íĺ ¸ +rein force +Ñħод а +Augment ation +dR QQw +Ġpul ses +ĠArg Source +ế u +XB MLANGPATH +kine tic +Ġack nowled +Ġvac ancy +cpwVcPerf Current +SAN CAI +ĠSimp lify +ĠCri tical +Reflector s +Keep er +Optimization Status +Ġл и +ि à¤Ĥ +JU MP +ĠHist orical +frameN Stop +CONSTANT S +cif s +ë° ĺ +planet ary +informat ics +reveal ed +Ġdeno tes +çݯ å¢ĥ +settle ment +Ġgri pper +Ġpyqt Signal +Ġperfect ly +cPPPoES AbnormOff +TENSOR FLOW +Ġmort gage +ĠOrg Extended +Ġê³ Ħ층 +ĠPeak Table +POLY GON +receiv ing +robo tics +ĠFollow ing +Ġbear er +8765 432 +Compound Object +UPDAT ES +Ġ################################################################################################################ #### +Lon gest +Prote cted +Ġhg ail +_- _ +STUD Y +Õ¡Õ ¬ +({} )) +Hour ly +Mirror ed +Ġtur bin +CLASSI FIERS +onboard ing +observ atory +Ub untu +ClassifierEthernet Source +tektronix MDO +ĠIncrement al +ĠctspIf L +DEN Y +Way ne +Ġcros ses +Ġnos y +Ġtektronix MDO +jaco bi +ĠMonth ly +Ġ################################################################################################ ####### +ĠcpwVcPerf Total +ç¿ » +Ġiot bx +ĠINTER VAL +Ġmsrest azure +Ġshel ls +Ġexhaust ed +Combat LogData +ãĤ· ãĥ§ãĥ³ +Ġtabu ada +pedigree Cells +ק ×Ļש +Ġsty ling +HEALTH CHECK +whit enoise +ĠImpact o +èĦļ æľ¬ +SHO OT +ĠAstr onaut +æĬ¥ éĶĻ +Lasso Lars +ĠSmooth ing +ĠUsd Geom +Ġdivid end +Wrapped Tokens +Bri ef +Ġrefine ment +ÃŃn imo +stockidx name +åįĸ åĩº +xia omi +0062 99212 +ĠLeaf Indices +STOCK S +Dry Run +Kine matics +Smooth ing +stun ned +Ġhab en +ĠEst imation +EXCLU IR +Packed Reflectors +Ġguide lines +Cancelled Error +","" ). +nthes ise +ĠVir ginia +Ġverific ar +Ġrespon ding +CALC ULATED +Solve Result +íĮ Į +Ġtet ra +Ġconsum ers +ĠPulse Error +ĠJon athan +ObjectRef Info +ĠNavigation Toolbar +ĠFRAME WORK +getTransaction Receipt +ĠRM utils +cvcConf Controller +身份 è¯ģ人åĥıéĿ¢ +Focal Point +evi ctions +('(' ) +ĠWEB HOOK +Lease AccessConditions +ल त +Ġ================================================================================= = +âķļâķIJâķIJâķIJâķIJ âķIJâķIJâķĿ +ê·¸ ìĿ¸ +AUGMENT ATIONS +Ġpadd lenlp +lich tungs +UCgU CoVC +è¯ģ件 éĻĦ件 +å±ħæ°ijå±ħä½ı è¯ģ +å±ħæ°ijå±ħä½ı è¯ģ人åĥıéĿ¢ +ĠFritz Status +å¨ ģ +åĶ ¯ä¸Ģ +rela xed +Ġequival ence +ĠTensorTrain Batch +ĠCOUN TER +Ġsymp ify +ç¯ Ģ +mich igan +DIVID ER +âĶģ âĶģ +mcast ControlList +ĠMik rotik +DropNetflowMonitor Group +SecurityGroup Tag +Annih ilationRate +hay stack +Ġwaf lib +ĠHY PER +ĠProceed ings +GRAN DEUR +Ġvibrato Pos +кл ÑİÑĩ +ĠTagged Item +Exe mplo +yam ls +Ġppc ls +0074 8417 +BoxMesh Component +SourceCode Pro +ĠAdministr ators +Insights Constants +ĠMIDDLE WARE +ĠUnp ack +linu xbridge +akk ında +CONFL ICT +Causal InsightsConstants +ĠrwMotorTorque Config +é¥ ° +Ġnitro gen +Ġreti red +ĠDry Run +Infin ium +ĠConan File +ClassifierInner VlanMap +benchmarking ProcessId +殿 帥 +UnorderedAccess View +ĠMort gage +Ġè½ ¬ +Ġdiccion ario +Ġë¶Ħ ìĦĿ +Iss uer +Ġpgs rc +GetX axis +QUOT ES +ĠPROB LEM +basicPreset Test +ĠHEO SEvent +APPRO VED +Ġaba ixo +éĺ² æŃ¢ +Xform Op +Ġndc g +Ġbent oml +ltt ng +haarc ascade +Alig ner +MONSTER BEHAVIOR +ĠæĮĩ å®ļ +Vrf Name +ĠAVA IL +ĠMult inomial +ĠErd AcFan +Constr List +ðŁĺģ ðŁĺģ +ĠCrossEntropy Loss +½Ķ ëĵľ +ÕŃ Õ¡Õ¬ +01306 398 +Ġosx photos +Ġ![]( ../../ +ucch ini +conduct ance +Manufacture Date +áĥļ áĥĺáĥ +homoph ones +zná mk +Ġeyetrack str +ĠMRBrain S +BFR ange +mvs net +getmax yx +ĠFib onacci +04857 958 +ĠBaseNon Aggregate +Ġè¦ ģ +é¢ľ èī² +éĺŁ åĪĹ +somename space +Ġcrawll Twit +BCEWithLogits Loss +AndGreed Indicator ++.*)') ), +;:{ & +mard at +getpw uid +Ġrsem gr +xdgm ime +17900 058 +DEFL ATED +micha el +parseAndOutput Csv +SetAvatar Response +ĠPathToTest File +naLetalis ca +GOEEXF PTunable +GoLab OAuthUsers +TranslationNotification Recipients +TranslationSync Logs +stoppo int +("{}|{}|{}|{} |{}\ +ãģ¾ãģĽ ãĤĵ +தவ à®± +ĠDisableAble CommandHandler +ĠMyCustomNewsPopularity DataLoader +åĽ½å¾½ éĿ¢ +006299212 598424 +UCgUCoVC cYmh +ĠErdAcFan Setting +" (.* +# | +' ': +' ([ +' ". +' {} +' ({ +( | +( ('{ +) (* +) }. +) %\ +) $", +* ?\ ++ )') ++ ="\ +- , +. """) +/ .* +2 00000 +3 923 +3 925 +3 136 +3 194 +3 325 +3 935 +3 998 +3 179 +3 995 +4 164 +4 194 +4 122 +4 181 +4 239 +4 238 +8 20 +8 946 +9 025 +9 137 +9 135 +9 327 +: _ +: "] +; ;\ += `\ +> '], +? ! +A ri +A tiv +A IG +A bri +A OI +B ent +B ian +B ANK +B ecause +B ayesian +C rc +C MSG +C ERN +C usto +C oulomb +D er +D AS +D ich +D FF +D ynam +D MY +D odge +E a +E inf +E CS +E AX +E vidence +E GRESS +E psilon +E mitter +F im +F ly +F resh +F uel +F wu +F etches +G UN +G uest +G nu +G eral +H ang +H eld +H AM +H ING +H MM +H ora +I AM +I dade +I ERx +J F +J r +K ern +K CS +K VS +K VA +K HZ +L int +L TT +L umi +L ITE +L icence +L obby +M ur +M us +M os +M ich +M UL +M ais +M UV +M sun +M jI +M appable +N iter +N EST +N DY +O wn +O thers +O puDevice +P set +P res +P norm +P ai +P AGES +P ckt +P esquisar +Q Table +R am +R AC +R CL +R AIN +R oman +S SE +S ou +S ID +S AA +S lc +S ieve +S IDER +S ENSORS +T ir +T AN +T Ex +T ai +T ank +T ries +T APE +T Compute +U v +U VC +V IC +V gs +V IL +V ik +V So +V PC +V PD +V QA +V endors +W rl +X GEo +Y V +Y olo +Z f +Z ap +Z ENK +[ ], +[ ^\ +] }', +] >= +^ * +_ ]) +_ ). +_ ([ +_ [- +b ub +b low +b ia +b ene +b DY +b DZ +b lood +b umentations +c log +c ateg +c item +c las +c vars +c ortex +c plusplus +d ram +d cd +d pkg +d ana +d ropoff +e te +e ha +e bi +e thernet +e charts +e quilibrium +f pp +f elt +f etched +f lickr +g J +g L +g ct +g pp +g ize +g low +g nn +g static +g ador +g auc +g lides +g acha +h dd +h map +h cal +h ams +h aw +h mc +h aven +i I +i ar +i are +i ÃŁ +j K +j Z +j el +j ellyfish +k G +k V +k op +k ou +k ernal +k fold +k Hz +k illed +k itchen +l C +l gn +l fe +l cores +l wr +m gs +m oto +m alt +m RM +m Erro +n ub +n ary +n True +n net +n vis +n Time +n steps +n frames +n asm +n Rows +n abla +o K +o ch +o ha +p L +p M +p W +p ult +p lu +p values +p Value +p thread +p convert +p logical +p Priority +p ulls +q I +q Z +q it +q VC +r C +r I +r val +r ray +r pi +r fs +r sqrt +r wx +s B +s ir +s mpl +s aml +s lan +s quee +s outheast +t info +t old +t Description +t bi +t ros +t Device +t returns +t qp +t Ctrl +u ite +u wi +v arg +v map +v ld +v double +v mlin +w age +w ash +w OB +w Go +w mg +x T +x ue +x co +x id +x right +x left +x Max +x EA +y ı +z C +z X +z ab +z max +| "' +} '), +} _\ +} ">{ +´ ółĢ°ółģ¿ +µ ółĢ±ółģ¿ +¹ éĩı + ± +É Ĥ +Ñ Ķ +× Ĵ +Ø £ +á ĩ +â ° +å Ħ +ç ĩ +é ¤ +é Ĩ +ê ľ +ë ĮĢ +ï ¿½ +ĉ ĊĊ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĠĠĠĠĠĠĠĠĠĠĠ +Ġ uld +Ġ 000000 +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ÃŃ +Ġ 002 +Ġ âŀ +Ġ è¿Ļ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ############# +Ġ ðŁĺ +Ġ ÑĨи +Ġ éħįç½® +Ġ lobby +Ġ æĺ¾ç¤º +Ġ å¾ĹåĪ° +Ġ ç´¢å¼ķ +ĥ £ +Į ìĬ¤íĬ¸ +ĺ 못 +ļ Į +ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠĠ čĊĠĠĠ +in ps +in cor +in variant +in psd +er de +or ne +or bits +on off +at in +at traction +re tt +re buf +se con +se ps +st ico +en ie +Ġt doc +Ġt win +Ġt urt +Ġt utorials +ar my +ar si +de la +de ed +de compose +le p +le igh +an ity +an ie +Ġi z +Ġi ct +Ġi id +Ġi max +Ġi cons +Ġi IndexReg +me ts +me dic +Ġ' ;\ +Ġ' $\ +ro ok +ro former +ti ma +ti ms +ti ger +mp q +mp ls +mp ileup +Ġc Y +Ġc is +Ġc ance +Ġc ens +Ġc lif +Ġc ass +Ġc ele +Ġc ents +Ġc flags +Ġc dp +Ġc Profile +Ġc ffi +Ġc kt +Ġc xC +Ġp H +Ġp he +Ġp ers +Ġp ound +Ġp md +Ġp ies +Ġp ounds +Ġf ab +Ġf num +Ġf ba +Ġf rees +Ġf rq +Ġf ederation +Ġf ifty +Ġ" ': +Ġ" ') +Ġ" ?? +Ġ" \\\\ +Ġ" =": +he te +he ly +he ating +it k +Ġa er +Ġa res +Ġa ob +Ġa min +Ġa ead +Ġa fixed +lo docus +00 76 +00 10011 +ge orge +ge ese +ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġn ics +Ġn fft +Ġn inja +Ġn reps +Ġs op +Ġs path +Ġs if +Ġs ids +Ġs sm +Ġs fc +Ġs freq +Ġs mass +Ġs cout +Ġs lides +Ġs ür +ss pec +Ġin for +Ġre k +Ġre ff +Ġre frame +Ġre curs +Ġre ceptor +sel ength +sel ayer +Ġo ov +Ġo dl +Ġd al +Ġd ss +Ġd ub +Ġd ert +Ġd cm +Ġd ÃŃ +Ġd ni +Ġd adi +Ġd rac +Ġd ollars +li zer +li zz +pe w +un er +un map +un mask +un visit +un typed +un ichr +Ġm ys +Ġm cts +Ġm tx +Ġm alt +Ġm ssql +Ġm ÃŃnimo +ra iser +Ġe di +Ġe og +Ġe mitted +ate e +ate l +() ]: +fi e +fi ds +fi du +ad mit +ad ress +ad monition +co c +ri or +ri son +Ġb ill +Ġb ounce +Ġb ayesian +Ġb illion +Ġb dotControlConfig +Ġ1 997 +11 32 +11 33 +11 38 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ +int f +int ree +id list +Ġ( {" +Ġ( "") +Ġw o +Ġw ild +Ġw ally +Ġw ie +Ġw eno +Ġw deployment +Ġw urde +ch od +ch ans +te et +di um +di ary +di xel +di hedral +def lection +ata pult +Ġ[ / +ma int +ma gy +ul k +== [' +Ġif f +ot om +ol on +el H +es sentials +ode s +is al +is num +is Checked +is Flagged +get default +get status +get Set +get Config +get String +get Dir +get addr +get Struct +get Speed +one Turn +one cker +)) ') +set value +set Finish +set ContactInfo +Ġto m +Ġto pos +Ġto wers +ĠT ol +ĠT TF +ĠT iamat +th ir +th ose +import ing +str t +con fidential +Ġ2 92 +Ġ2 79 +(" ([ +(" (? +pp ings +as v +as sembler +arg Name +arg names +op c +Ġ{ {} +Ġ7 34 +ĠS age +ĠS ak +ĠS AP +ĠS xx +ĠS hel +ĠS SO +ĠS ITE +ĠS ector +ĠS EG +ĠS ticker +ĠS pring +ĠS IDER +ĠS NOwGLoBES +ab h +ab l +ĠC P +ĠC W +ĠC as +ĠC oun +ĠC IS +ĠC fg +ĠC GS +ĠC ategor +ĠC IE +ĠC TF +ĠC EA +ĠC lusters +ĠC lears +ĠC APS +ĠC ROSS +ĠC ORMBase +ig py +ig json +up c +up ied +up sampled +rint er +Ġg ab +Ġg pt +Ġg hosts +Ġg unzip +Ġg lavniMenu +for security +ter razas +Ġr j +Ġr peaks +Ġr uby +Ġl z +Ġl tr +Ġl ui +Ġl mer +Ġl sb +Ġl ucky +data size +data In +data Base +ĠA io +ĠA tiv +ĠA ward +ĠA ws +ĠA CM +ĠA xon +sp anning +ver ters +'] " +'] ' +'] .__ +'] ]] +'] )). +01 08 +01 58 +Ġcon flow +Ġcon vection +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ke xt +am bo +to bytes +to ctree +to TheOrdinal +99 04 +99 14 +ith ens +ist itle +ĠF G +ĠF s +ĠF ac +ĠF EM +ĠF inger +ĠF ocal +ĠF avorite +od s +log Dir +om d +value A +Ġh pr +Ġh alt +Ġh anded +Ġh kl +Ġh orizontally +ĠP B +ĠP unk +ĠP ATCH +ĠP lainText +Ġas in +der ef +ĠI var +ĠI RC +ĠI MF +file d +ĠL am +ĠL CL +ĠL atex +ĠL INK +ub o +ub ution +tr ump +tr atio +Ġth ank +Ġth under +=' .') +Ġst upid +Ġde ver +Ġde coders +Ġde duplicate +Ġde duced +Ġde precation +Ġde sea +pro gs +pro cedure +pro ficiency +0000 10000 +ex on +im b +im array +Ġex clus +Ġex clusion +Ġ3 94 +10 85 +10 23 +10 47 +10 40 +ase m +ect l +ect ure +out dated +ow il +ĠD P +ĠD ust +ĠD CT +ĠD EM +ĠD aily +ĠD etailed +ac z +Ġu cp +Ġu selength +]) | +Re actions +Re cover +app i +app run +app store +sh aw +sh allow +ĠM R +ĠM ULT +ĠM ink +ĠM ocker +ĠM ov +ĠM outh +ĠM apper +ĠM KL +time path +čĊ čĊĉĉĉ +=" ^ +Ġv d +Ġv z +Ġv arnam +02 67 +Ġ_ ): +Ġy str +Ġy scale +Ġy cmd +Ġy gg +Ġy af +Ġy pad +Ġy rng +Ġy lims +Ġnp y +ĠO ffer +ĠO CC +Ġ* " +Ġpar te +Ġpar ties +Ġx res +Ġx pos +Ġx pad +os ds +Ġma ko +que ens +test word +Ġor phan +ER I +IN A +.. ',' +xb u +xb mc +ore hole +ore aders +Ġ% }')) +tra kt +Ġfile Prefix +our Excel +Ġpro tot +Ġpro mpted +py ro +py ver +py file +py md +art en +art lan +xc or +xc at +pre l +pre vent +pre lim +pre sto +ap m +ap erture +07 96 +07 95 +xd ays +ense n +Ġbe ats +Ġbe lief +Ġbe lieve +Ġbe haves +Ċĉ ĊĊ +ĠB urn +ĠB ST +ĠB cc +ĠB uff +ĠB rad +ĠB ah +12 32 +12 86 +12 83 +12 29 +12 72 +Ġname Chunks +ys on +ĠE ar +ĠE den +ĠE yes +ĠE AI +ĠE quivalent +ĠE ITHER +Ġj accard +Ġj ulia +AT GA +model path +ĠN t +ĠN IL +ĠN ose +date format +bo le +Ġ4 32 +Ġ4 13 +Ġ4 96 +Ġ4 97 +Ġ4 26 +Ġ4 23 +Ġ4 46 +Ġ4 53 +Ġ4 49 +92 04 +col laborator +In dx +In complete +In structions +In consistent +In sufficient +In HCBytes +In HCPackets +ind en +ĠR ub +ĠR ST +ĠR ail +ĠR OUT +ĠR OW +ĠR ENAME +mo ons +mo sphere +mo odle +ep ide +Ġun filtered +Ġun compressed +Ġun stable +OR L +OR IZED +fo vs +Ġtest data +Ġtest bed +lic ence +Ġlog dirs +oc eny +son ar +// : +ĠG E +ĠG il +Ġco gs +Ġco ordination +Ġco lossalai +EN SA +ĠW av +ĠW ords +ĠW GS +tri buted +Ġout box +Con ns +Con gratulations +ĠV C +ĠV ery +ĠV alley +ĠU W +ĠU ri +ĠU NA +Ġ5 11 +Ġ5 00000 +Ġ5 600 +mb a +ib al +ard ens +ard uino +min ar +min io +min eral +min iglm +18 27 +18 38 +18 21 +18 59 +18 49 +16 11 +16 99 +16 55 +16 63 +Ġlist ar +cur vature +da i +Ġk ls +Ġk ids +Ġk pc +Ġk si +Ġk fp +Ġk ws +Ġk rb +Ġk bd +Ġk ahy +25 83 +Ġpy z +Ġpy doc +Ġpy chron +Ġpy omo +Ġpy gears +Ġpy loco +Ġpy redner +Ġ6 20 +lt ot +lt nw +ag i +ag artlan +ump rod +http components +http Target +04 66 +04 29 +13 32 +13 18 +13 74 +13 58 +13 53 +lib dir +06 87 +06 52 +ll ll +class ical +class wise +15 95 +15 56 +15 43 +15 54 +15 58 +ST ABLE +ec cen +max y +Ġthis Invocation +03 44 +jo se +Ġop end +ute ur +train loader +Ġch allenges +ax l +17 96 +17 94 +17 63 +Ġal ip +dd fa +93 02 +93 33 +93 77 +93 43 +93 52 +ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +14 06 +14 08 +14 87 +14 83 +14 76 +ne ato +Ġ/ ( +Ġat tic +Ġat tractor +64 08 +index Type +error handler +Ġra ke +Ġra cket +([ . +([ {" +gra ce +gra duate +ence Error +:// ') +RE CLASS +RE LAY +RE CONSTRUCT +IC MP +08 99 +08 55 +08 67 +pi a +Ġ. * +ĠH IT +ĠH ong +ĠH alf +ĠH IST +ĠH ills +ĠH ierarchy +ĠH XL +ĠH ilbert +ĠH abilidade +ĠRe levant +ĠRe seller +sub titles +input DNAs +eri e +Ġdi richlet +sk f +sk ri +db ToPutIn +88 05 +88 14 +88 52 +ded uplicate +ast ers +lin n +lin s +comp yle +ID AY +ID GET +ID ATH +ID evice +Ġsc Object +Ġ` - +34 25 +34 21 +start tls +Ġwe alth +Ġwe apons +09 11 +09 17 +09 54 +09 73 +09 62 +84 00 +84 26 +84 35 +84 77 +ĠIn ky +write str +ere k +nd x +ant lr +gs util +by tree +bin info +lock er +Ġle aders +Ġle venshtein +ave gador +24 00 +37 11 +37 23 +37 82 +37 81 +37 61 +ak u +Pro of +Pro vision +point net +Ġoutput ting +Ġpo x +Ġcom ent +Ġsub window +Ġsub problems +Ġso le +rep rise +96 75 +Ġcomp et +Ġcomp iling +Ġinput DNAs +55 64 +55 56 +94 07 +Ġcur ried +Ġ} }} +33 32 +DE CK +Ġapp Cfg +Ġapp reci +node list +row id +87 44 +87 45 +87 77 +87 78 +no ck +AL B +AL READY +Ġclass if +exp losion +Data source +AS ig +AS IBLE +iv ens +Ġla place +Ġla unches +85 32 +85 08 +85 66 +85 72 +". ' +". \ +97 74 +back ports +net app +================ =========== +36 17 +36 96 +36 66 +36 73 +36 61 +36 00000 +=[ . +011 4 +011 6 +011 7 +011 01 +011 0000 +Ġopen id +ĠK T +ĠK an +ĠK ing +ĠK DE +ĠK raus +95 02 +95 77 +95 73 +lat tr +Ġimage Layer +86 94 +Ġtorch audio +mon s +Ġz mp +Ġz id +Ġjson file +rit to +rit ories +57 16 +57 17 +57 42 +Ġ[' * +Ġ| '.\ +create Database +reg istro +Res ized +Ġbo ols +message Panel +spe lls +Ġfil ls +List Context +current Path +color ize +color ama +Ġunder water +port ed +ach uset +version eer +Ġlo ose +api Version +status bar +23 89 +request Id +AC VM +Ġcheck boxes +Ġcheck ov +Ġte achers +44 92 +44 93 +44 08 +44 36 +44 38 +44 29 +IM ES +80 99 +AP PR +75 65 +new list +new Path +new Cur +stri king +Ġnode id +ef e +']) ( +En abling +Co VA +ET x +var args +cal T +cal z +cal ing +56 59 +go ti +98 32 +98 08 +my keyspace +Ġmin x +Ġmin val +Ġmin pix +Se ym +uc r +Ac meAccount +be ing +be ad +be ch +be ho +be ach +be ads +UR B +UR DAY +ĠQ Object +ĠQ Font +Ġcolor es +uple s +of code +target ing +35 01 +35 13 +35 87 +35 83 +AB IL +vis c +ref ined +Value Validator +Ġmo te +Ġmo jo +ain s +AD I +AD AGUC +save mat +cre am +Ġad visor +45 08 +45 22 +45 34 +45 28 +Ġvalid ar +ng amma +fil mo +ich olas +cent ury +item Class +ey J +ĠY e +ĠY ANG +Ġinter view +Ġinter leave +ĠX y +ĠX ia +ĠX DR +Ġtrans mitted +47 97 +47 67 +]] - +action List +command State +Ġpos file +Ġ9 03 +find ById +cy t +Set Output +Ġreg ulator +mean ing +83 06 +Ġmain loop +Ġag nostic +Ġag enda +Ġver is +led Collection +du it +Ġlin scale +random ized +UN AVAILABLE +UN DAI +gen rule +gen omic +order by +Ġcommand Size +46 01 +46 99 +46 25 +46 14 +46 86 +46 58 +ĠJ eff +Log Handler +bg tools +bg porter +Num MsgRx +Num MsgTx +yle vels +89 05 +89 85 +source d +lect ance +DI A +DI AN +Ġ] * +":" ", +ld r +40 99 +Ġread fromBuffer +ANT RA +Un zip +Un Sup +Un Supported +Ġversion ed +TH OR +TH AN +TR UTH +TR ULE +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ister ed +air port +air case +To xCast +CON TR +De limiter +Config urations +dim red +Ġval Summaries +Time Span +âĢ ¢ +Ġtable fmt +MP U +cat tle +43 55 +use package +ĠCON V +Ġup graded +ĠPro fits +Ġplot util +uid ColName +:: { +000000 5 +Ġnet messages +ug gle +Ġmatch Tissue +cu df +page d +std npf +PI ECE +48 04 +48 15 +48 22 +48 94 +48 26 +Ġqu otient +Ġqu artz +EX ACT +91 99 +ĠData Validation +err state +red in +Ġfirst name +No isy +\\ - +content Type +42 32 +42 18 +TT emp +Ġtemp s +MA KE +EL LE +EL ASTIC +Model Tag +Model Serializer +EST E +)/ $', +iss pmatrix +DAT ORY +ten ancy +metri ces +mt u +"> " +wo uld +rol ls +parent Constraint +Get Bin +Node Available +ĠWAR N +76 87 +Ġsum m +Ġsum ming +pc r +Ġsave fig +Ġsave Image +Ġover writing +Ġ", "") +Ġtensor force +bl ame +Ġass ist +Ġass im +uni MIB +play back +cho co +Number Exception +aw an +aw ner +tensor rt +--- \ +Ġchar Set +tmp Pat +ik FootControl +Key File +74 04 +74 21 +epoch len +mem map +mem cpy +enter prises +Ġfind all +Ġimp artial +String Plug +String VectorData +Object Index +Object Store +Comp ressed +Comp ressor +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ +Form Invalid +ker beros +Le gal +Input Definition +edge size +Ġab und +58 17 +58 09 +58 95 +dist ubution +Out HCBytes +Out HCPackets +ĠTest case +и и +Ġlocal es +Ġdest pattern +"\ ( +pol ler +Ġbin size +Ġman ages +Ġman agers +uper ação +Ġport able +ĠDe viation +CA AU +si aml +Ġ200 01 +height map +Ġextra polation +Ġbu ys +network management +Trans formed +ORT E +ãĥ į +connect ing +xff z +ym ce +Th ermal +Th irty +pb f +Index In +Index Handler +Index Endpoint +ĠPython Spec +fs leyes +52 64 +cell Y +ĠUser Docker +Of ficial +Of SecondFixedSurface +Up Stream +ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +ĊĠĠ ĊĠĠĠĠĠĠĠ +); ') +Sh i +Ġ255 06 +GH id +Ġcase name +Ġcase less +Ġexist ent +Image Name +Image Reader +Int Code +ĠSo up +disp ose +49 04 +49 08 +ÑĢ еÑģ +DB NAME +Ġmask grad +part ners +SC Q +PRO TON +stream Id +Ġ15 17 +Ġgl Color +Ġgl Uniform +serv ant +ĠGet MainURLFromList +cluster Path +:\ /\ +domain name +åĪ Ģ +Not Ready +CK PT +Base Url +Ġtri gonometric +Ġtri ângulo +git repo +font type +Al loy +Al rm +Al phabet +gg h +keep dims +keep alive +fp fh +ground truth +69 55 +"{ _ +Ġsome how +full Name +Rx Packets +Ġgover n +ĠCh ristian +sleep time +ĠImage Ops +Py Node +inst al +Ġraw output +For Account +hash able +hash map +äº Ĵ +track Validator +ĠSim Array +ĠSim CLR +div mod +é d +Ġmock env +Ġmon otonic +Ġnon posy +Ġhost ing +Ġloc alized +Ġref used +æķ Ĺ +ĠLo ve +ays ia +bit rage +bit finex +ĠDef initions +Group Type +xed o +drop let +drop Database +VE Y +arr ing +Ġge ometric +Ġge ocat +Pre process +PU Z +GR AP +web page +web novel +Sub classes +Sub tract +Sub Resource +Sub menu +Sub Account +sig fac +af c +af eta +ĠZ AP +,' % +NO ISY +ĠBase HTTPRequestHandler +Ġì °¨ +fin ais +ã i +Ġzip line +ĠSO I +Dis c +]+ "\ +NE IGH +Ġcho se +ha ha +ha hm +sen ate +ĊĊĉĉ Ċĉ +ĠAdd Entities +gt g +supp lement +any Of +Ġ14 19 +áĥ ĵ +Point Pattern +ĠCheck er +ĠCheck point +Lib virt +rot ator +ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +ĠApp State +Ġcustom s +Ġcustom ers +Or Empty +0011 10 +." } +cm divor +Ġinstall Status +Item Index +ĠConfig Type +ĠConfig ures +ĠConfig YesNo +âĸĪâĸĪ âĸij +ĠComp ress +ĠComp liance +xab V +imp acted +We ibull +hand verts +Ġbefore hand +"} )) +åIJ ¬ +Code Block +Date AndTime +prob ab +prob ably +ĠCol lision +ĠCol lege +Ġpe ace +'{ _ +Start Date +Ġweb ob +ASS URANCE +BL K +multi select +multi lingual +Ġmc mc +Ġsuper class +NN C +Ġ[- ]') +!! ' +EXT ENTS +requ is +ĠPo kemon +commit tee +ling ton +())) )) +ĠCom bat +STR ICT +All Users +All Args +ret to +way point +cer pt +lon ass +On T +On z +On es +Command o +Ġtrack lets +ĠModel Form +ĠEX PI +Ġinitial value +Ġinitial isation +Ġmulti variate +SV I +Ġ---------------------------------------------------------------- --------------- +Resource Properties +xF AC +xF CE +xF DB +used forsecurity +Is Not +DR mt +128 33 +ĠIt alian +End Event +Ġdisable s +short code +Ġdraw down +Ġgr ating +ĠTo xCast +unique s +ĠAt tribution +Ġview ing +Ġview port +SO M +Ġskip na +AV ATAR +An imals +pus hed +mu Sensor +:- ^ +:- :< +Query Executor +à® Ļ +ĠAl arm +fici e +final wgt +EE B +fr ance +screen shots +Ġvari ations +Ġannot s +Ġstack trace +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠPer mutation +bi co +ä¸Ģ è¦ +ä¸Ģ æł· +vv max +Ġtk n +[\ " +hs b +Ġround house +Down Stream +bb c +bb re +Ġip addr +vas z +vas ion +ĠRE AL +ĠRE PL +ĠRE MOVE +Ġë ¦¬ +Ġë IJĺ +)- ( +car park +Ġ25 000 +menu T +Ġcl ct +Ġmod eration +925 92 +Ġarch install +Ġtick marks +New Optimizer +Ġvideo item +Ġour selves +Ġauto data +Ġauto CH +gu er +gu ys +pla idml +Update Task +Update Progress +PRE FERENCE +atic ity +Ġio ctl +ĠLO W +UU G +Ġæ ² +Ġseed ing +ĠDis p +Ġhand shake +čĊĠĠĠĠ čĊĠĠĠĠĠĠĠ +čĊĠĠĠĠ čĊč +JE CTION +Red dit +404 4 +sn iff +MT k +super type +GT PPort +IF ACE +tw elve +conn exion +500 7 +Ġbit wise +Ġpr ze +Ġsepar able +Ġsepar ating +reward ing +}: [ +}: ){ +ĠTensor Constant +ĠTensor Product +PER FORMANCE +Const ellation +Ġcre ar +EC N +ĠTH ESE +Ġapply info +Ver Rx +Ver ErrRx +Ġmp lt +------------------------------------------------ - +Go als +selected Layers +Ġdev il +éĩ įç½® +PH Y +PH j +asis LinearRegression +ka hy +Ġinv ocations +Ġpayload s +Ġ"< !-- +ĠCO DEC +]} } +]} }, +Noti fs +BR Y +Ġpa ÃŃs +Ġmemory view +Ġgamma s +audio FileMetadata +And rew +ao e +çĶ¨ çļĦ +Component Status +BB BP +DA w +Batch Data +Ạ± +poly val +fold ing +ĠBUT TON +Ġeps g +ĠColumn DT +Ġms ds +alan obis +HTTP Client +Seri alizable +proc Man +æį ī +free desktop +CHECK SUM +ĠDi gest +Instance Identifier +Ġnormal isation +Ġ(_ ): +UC s +ĠNode Type +}{ % +}/{ : +LIST EN +.) [- +asc ading +>. > +mol l +FE ASIBLE +Spe aker +åĢ Ł +401 5 +rd Config +rup os +Ġmarker styles +Ġmarker edgewidth +204 5 +att Hero +Ġ'< ': +ama s +}] $', +sess or +ĠDec isionTree +Panel s +Sw itchover +ĠPO LL +ĠPO INTS +bf gs +roy al +ĠDB s +Ġtw enty +writ eto +loud ness +Ġctsp Notif +Uti lization +ĠEvent Type +rome try +BACK OFF +BACK WARD +čĊčĊčĊčĊ čĊ +gi ra +éĻ ° +917 7 +iso strf +yl or +193 8 +ĠLabel ledCollection +ĠDate Value +Multi Array +square up +ðŁĩ ¿ +wave Mobile +My Class +My Sql +negative NumberException +den ied +den omin +RA ID +WR ONG +ĠCode c +ĠCode Template +ĠDet ach +Ġtermin ations +cir klo +'" % +ĠSequence Matcher +COMM ISSION +emp h +emp loyees +Ġflat s +218 5 +uck les +264 7 +Post Num +Scalar Mappable +Ġcer tainty +Can ada +¡ółģ ¢ółģ¿ +Url IndexHandler +Ġcdbp AppAdvFromPeer +WORK FLOW +see ing +Ġbig dl +137 2549 +CN T +Ġmis cellaneous +(); ") +ов Ñĭй +Ġcla imed +gri b +Ġforward ing +YY SgAq +132 5 +Ġpur ple +weep rint +Gen re +Ġfe j +Ġfe ather +emb data +pin ning +stit utions +ĠMin imal +Bytes Type +AK hQK +ĠÑģ к +ĠÑģ озд +Schema s +Schema Error +syn ced +:::: ::: +zo pe +Sequence Type +operator name +Stack ed +ĠInvalid Argument +ris is +indent ed +('[ *] +sci entific +har vard +207 1 +203 1 +Ġresid ent +rou pe +GRO OVE +Ùħ ÙĦ +Initi alizes +904 5 +nu isance +Ġ"[ +] +Ġ"[ *] +ĠItem Attr +CAP ITAL +OC orrect +ен ÑĮ +Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Reference FormID +ARG ES +Mask s +ä¼ ° +Ġba selayer +ê u +updated Egg +ĠBe ach +Container Deployed +Ġut ter +908 4 +456 2 +SUB NET +SUB PIXEL +Interval Start +Rest Client +Use ful +Ġnd vi +Ġgeneral Dict +tcp Sock +Import ed +Ġlock file +Rot Mat +Display Name +424 3 +424 4 +Ġmet atable +Ġsym m +еÑĢ ез +operation Handle +Ġ"' ", +Buffer Size +selector s +ĠNorm ally +ĠNorm alizer +ĠCustom JS +nz p +ðŁı´ółģŃółģ ² +ðŁı´ółģŃółģ Ń +ĠSpe ll +éĹ ¨ +Ġlst sub +ĠDynamic ally +Ġnor ms +VK J +Ġĉ čĊĉĉĉ +Ġpipe Dst +MR Brain +HD h +ĠQuery Root +Active Users +Ġinvok ing +Auto scaler +Ġregular izer +307 9 +427 3 +Ġâ ģ +Tool Button +DEL IMITER +ĠResource NotFoundError +406 5 +Ġfbx AttributeType +è¾ ¨ +scra bble +'% (' +nf ld +Ġ------------------------------------------------ -------------- +ĠtypeOf SecondFixedSurface +ĠCONTRIBUT IONS +Len ErrRx +д е +#---------------------------------------------------------------- -------------------------------- +Draw s +Identity Pool +334 2 +334 3 +å± Ģ +008 04 +325 46 +MI LL +LB Z +dos ya +ĠCLI ArgumentType +Ġhalf width +PONSE QUERY +Driver Manager +Next Action +æĭ ħ +æĭ Ł +ĊĊĊĊĊĊĊĊ ĊĊ +ĊĊĊĊĊĊĊĊ ĊĊĊĊ +QK B +Ġ109 5 +426 6 +VALUE ENTRY +åŃĹ æ¯į +ĠLib s +BS XGEo +Font Size +Ġrepe tition +ermin ator +omin ate +ĠWork ing +395 9 +corre ctor +ĠDIS CO +ан о +RUN E +ðŁı´ółģ´ółģ ´ółģ +FD ACVM +396 1 +396 2 +457 1 +457 5 +387 4 +ÙĨ ا +ĠVer tices +vr net +Ġsubmit ting +Ġinf erior +Ġinf ected +Ġinf oln +Ġannotation Dict +visu alizer +how dy +Ġwatch list +ĠOver view +ĠLocal Settings +Ġva ex +è§ Ī +Ġtot ally +Ġhapp ening +ðŁı´ółģ¬ółģ ²ółģ +fm ri +fm wk +ภĦภ+ĠPort ex +ĠMeasure TFactor +386 2 +386 5 +425 2 +425 8 +Word Sent +455 9 +ĠFeature ProcessError +Cons ider +Send Fail +das d +Ġexpl orer +/* / +/* ") +ĠSci entist +ĠCar bon +bro oke +HY UNDAI +ĠLin coln +Err Frames +Err IndTx +Err IndRx +ĠCloud Formation +Show ing +æ¬ ł +ĠJson UrlIndexHandler +qq ında +ĠPass ing +Ġcum ul +ĠRet ri +408 9 +vn ic +Ġlearn able +opp onents +hu flow +sky lib +407 2 +é¢ ¨ +Ġbus io +&& & +pw r +Ġbon ded +364 8 +Ġwater ston +åĬł å¯Ĩ +Syn set +adow run +ĠDown loads +Distri butions +èĩª å®ļä¹ī +Ġpod er +Ġarc sec +Ġquat Rot +PM Context +Ġrl RmonControl +но Ñģ +Authentication Error +Ġmen os +ìŀ ¬ +ìŀ Ī +ĠUN DER +nv link +éĤ Ĭ +ORDER ER +Cost ing +ðŁı´ółģ£ółģ µ +ðŁı´ółģ£ółģ ¬ółģ +Ġpersist ing +ĊĊĠĠĠĠ ĊĊĠĠĠ +SIG MA +Ġparticip ating +ince ton +ĠGaussian Process +':[ (' +Registry Test +vk Type +ĠCer tificates +ĠApi Key +çŃ ĸ +dry run +Ġdigit ou +Security Token +FFER ENCE +MULT IC +"% (( +ĠReport er +poll uted +Sur vival +WF hY +ĠGit Lab +acion al +MAC HINE +Ġ#-------------------------------- ---- +CEL SIUS +åįķ ä½į +ĠBasic ally +Ġmut agen +VV V +´ółĢ ·ółģ¿ +liz ard +818 93 +FB eta +Ġhy bridi +Ġhy steresis +FRAME BUFFER +Pop ulate +Sort ExprContext +Ġsal ário +limin ary +Ġpen alties +Book Main +×ķ× Ĺ +×ķ× Ļ +éł ħ +Ġtech nically +GAM ES +Ġinterest s +Angle At +Angle HAt +èª ¿ +ĠVe locity +THE ME +Ġsun ny +Ġsho oting +428 1 +428 3 +428 9 +fem ur +398 2 +Proto ErrRx +434 2 +LAT ENCY +pan ic +bN m +ĠRef lection +>( .*? +san itized +ê¸ Ī +Ġask openfilename +ĠUP LOAD +fac ade +Http Request +Ġ"@ " +ĠÑĤ ак +âĢĿ , +CSV Name +nes prá +Activity Task +Clear ing +Clear ance +ĠMa intenance +éĩį åĬĽ +æµĭ éĩı +FIN ISHED +åºı æİĴåĪĹ +SCAL ES +Ġregression s +Allow s +åľ° æĸ¹ +Fit Ins +ç¼ º +ç¼ ĵ +JOB S +Ġ'.. ' +xclu de +ĠDummy Resource +Trade Limitation +éĺ ħ +Ġht s +Fra ctional +elt wise +ĠLi quid +Ġposs ui +Ġcas a +Ġnlp cc +Ġeigen value +Ġbp fmt +DCC SIG +Green e +Saving Time +Tab ular +Turn ing +enn ial +AGG TT +Ġvisual isation +代 çIJĨ +Ġsubscription s +Ġpsy chopy +amer ican +Feed Num +guest s +division s +Ġ205 0 +receive Data +Perf ect +áĥIJáĥ ¡áĥ +slide set +recent ly +Ġrecur se +Ġconver ters +GU ARD +Ġemo tion +Ġgg plot +éĽĨ 群 +Ġstandardi zation +Ġenvi ar +ĠRelease Type +TestModel DiffConvs +ä¿Ŀ æĮģ +解 åİĭ +Cri tic +Cri mes +Cri anças +stre amp +1166 138 +ĠDeep Mind +Ġ× Ĺ +Ġ################################################ ######### +ок аз +JS Complier +ĠÃ Ĺ +Ġcorrespond ence +night ly +Ġusd Skel +âĸĪâĸĪâķij âĸijâĸij +Dimension ality +mil itary +milli second +(":") [- +Ġwind ing +ĠAL G +Ġ({}) '. +ĠHyper parameters +("* ") +Ġ$$ | +ĠAdam W +PAGE BREAK +enh anced +Trigger ed +gpc r +ĠFra ctional +LER E +Ġ&= & +Apply ToKeys +æīĭ æľº +ĠMember Configuration +Ġrepos itorio +Il mi +Ġprec isa +ĠGra ham +Ġê° ģ +ICsInv PrTx +ICsInv PrRx +ICsInv LenTx +ICsInv LenRx +]+)/ $", +ο ÏĤ +ç¦ ® +filesystem encoding +ĠHo pe +Blend State +ĠUS AGE +Manifest File +Manifest Row +Termin ate +Termin ation +Termin als +ĠCONT INUE +Packet Alloc +Packet SendFail +Hand lers +Sal ary +invest ed +Ġ================================================= ===== +FACT URE +Im mediate +snow flake +2222 2222 +AGENT A +ółĢ²ółĢ ·ółģ¿ +IET x +ĠMig ration +è¿ŀ ç»Ń +ĠHar vester +Ġextreme ly +Push ing +Push Probe +ÑĢÑĥ г +withdraw al +Good s +Good bye +0123456789 0123456789 +GRE Y +Sparse Segment +ĠHost name +NumberOf Swaps +Ġcalib rate +PRODU IT +Uniform Location +UF xiK +ĠFE ATURE +ĠENV IRON +CUSTOM ER +XT ENSA +resol v +Behavior Group +ÐĴ Ñĭ +ici ar +shrink age +News letter +oz w +Eff ector +aba qus +respond ence +Emp loyees +lte Config +Ġoid c +Anim ations +Ġsecure aws +Ġdut y +BOO ST +RMS prop +RMS Prop +stretch ing +Ġdont cares +Ġvcf call +DlData NotifTx +DlData NotifRx +DlData AckTx +DlData AckRx +10001111101000010000 110 +ĠVLAN s +Resume NotifTx +Resume NotifRx +Resume AckTx +Resume AckRx +çİ° åľ¨ +ĠJohn son +Bert PreTrainedModel +ож ал +hpnicf proxycheck +Ġbtn Click +Ġ655 36 +OPER ATORS +æĹł æ³ķ +å½¢ å¼ı +Ġmom s +harvester zerg +ĠBi opython +Mail box +Ġ'? ': +Ġvers us +ĠBro ken +bear type +Chat Event +SUP ERSC +ĠÙħ ÙĨ +ĠAlex ander +FJ YYSgAq +Oi J +Ġmit mproxy +ĠCollect ing +Mini Mill +Ġdeco uple +FIRM WARE +íĻ ķ +Ġnic er +ĠEpoch s +åѦ ç¿Ĵ +âĸĪâĸĪâķĶ âķIJâķIJâķIJâķIJ +gro bid +Ġbib tex +manip ulate +Evaluate Ins +unge ons +ĠDele ting +Requires ContextResult +èµ· ä¾Ĩ +Glyph s +Ġdyn spec +mak etrans +ĠSD SS +ĠSn mpAdminString +proportion al +mip map +ĠHam ming +Ġè¾ ¹ +Ġwik idata +YYYY MM +parate ur +PriceReminder Item +usel ahs +Ġmob ility +ĠTick er +ĠSocket IO +Ġbea con +vacc ination +wagtail core +ĠÑģÑĤ аÑĤ +Truth Value +gdb init +Ġdise ntanglement +\\/ \\\\\\ +ÐĿ ай +rein amento +Ġvacc ine +Pull Probe +ĠAg enda +Ġ327 67 +LEG AL +explor atory +Ġadverti sed +FQq FQK +Susp NotifTx +Susp NotifRx +Susp AckTx +Susp AckRx +East ern +ĠLow est +ä¸Ķ 說 +BBBB BBBB +Forecast Day +Mobile Net +Unkn MsgRx +Unkn VerRx +ãģ£ ãģŁ +CreateSess ReqTx +CreateSess ReqRx +CreateSess RspTx +CreateSess RspRx +ICsPT NotSuppTx +ICsPT NotSuppRx +BrRes FlrIndTx +BrRes FlrIndRx +BrRes CmdTx +BrRes CmdRx +ĠæĹ ¶ +DelSess ReqTx +DelSess ReqRx +DelSess RspTx +DelSess RspRx +DelIndTun ReqTx +DelIndTun ReqRx +DelIndTun RespTx +DelIndTun RespRx +DelConnSet ReqTx +DelConnSet ReqRx +DelConnSet RspTx +DelConnSet RspRx +CrIndTun ReqTx +CrIndTun ReqRx +CrIndTun RespTx +CrIndTun RespRx +UpdBr ReqTx +UpdBr ReqRx +UpdBr RspTx +UpdBr RspRx +UpdConnSet ReqTx +UpdConnSet ReqRx +UpdConnSet RspTx +UpdConnSet RspRx +SUPER USER +CrtBr ReqTx +CrtBr ReqRx +CrtBr RspTx +CrtBr RspRx +RelAcsBr ReqTx +RelAcsBr ReqRx +RelAcsBr RespTx +RelAcsBr RespRx +ĠTor onto +Ġru cio +ĠPod man +Ped igree +Ġdeno ised +čĊčĊĠĠĠĠ čĊĠĠĠ +Transl ated +Ġ()) ", +Ġspy der +ĠArm ored +instanti ation +æ¡Ĩ çļĦ +Ber lin +Ġdevelop ing +Ġabstra ction +Phot on +'â Ĩ +Ill umina +Ġcnx n +Ġprivileges list +Chem ical +Ġfund ing +ĠACT IVE +ĠInv ite +ĠInser tion +SCR IM +MUT ATE +Ġоб Ñī +Ġton ight +ĠæŃ ¤ +ĠctspVlan Config +gv util +ĠÑĦ Ñĥнк +ĠPed ro +ARES PONSEQUERY +Ġë¹ Ħ +GTP UnknVerRx +Ġì§ Ħ +]? [ +oni eważ +ĠUT IL +Sha ft +DISCONNECT ED +urnit ures +Ġthrust er +Ġstrong ly +ĠYes No +Shot Gun +à°¤ à°ª +Xtest Pos +๠Ī +ĠÑį ÑĤ +ĠArrow Draw +Ġgenotype s +CDOT ARESPONSEQUERY +AIR PORT +æŁ IJ +DUPL ICATE +ctspVlan Config +DEN IED +puls ar +Ġfram ing +ĠAppro x +ĠAppro ach +á»ģ u +HubPort Speed +BlockHeadersWithChainLock sRequest +JW TRULE +æħ ¢ +otp Data +ĠCts SecurityGroupTag +Dhcp Relay +Ù¾ ر +amen ity +Ġhim self +Ġuniq List +è¯Ħ 论 +electric ity +erode d +ĠKa HyPar +<<<<<<<< <<<<<<<< +Raster izer +Ġfam ous +Ġeine m +ĠAstr onom +ĠRAD IO +å·¥ ä½ľ +Ġacme AccountSelection +Ġautoc ast +HTTPS Connection +åħ³éĶ® åŃĹ +ĠìŀĪ ëĬĶ +War ren +oli go +èĮ ¶ +èĮ ĥåĽ´ +orche stration +Ġresol ving +EVER Y +FIND ERS +\"] ([^'\ +ĠMAN IFEST +Ġelv UP +Ġalta z +Ġalgor itm +cyber Panel +ĠCoin Gecko +Ġforth coming +ĠPat rick +Ġtear off +Ġdimm List +Adaptive AvgPool +IFIC ATIONS +Ġescol h +ĠCommunic ations +čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊčĊ��ĊčĊ +DiscoMode BridgeLamp +seal ed +INHER IT +ĠQGraphics View +BRACK ET +ConnectivityTest Request +ĠDagster Instance +ĠSym bolic +ĠCLO SE +Ġstrat ify +ĠHex rdConfig +DISPATCH ER +Ġpearson r +Ġnod ename +tou ched +ĠLD AP +Recur so +NumBytes Tx +NumBytes Rx +Ġprincip le +Ġíģ¬ 기 +usbDeviceCdc Descriptor +BOR OUGH +Dou glas +NAN O +ĠGui ded +Sens itivity +Ġfight er +viol ations +Ġarity Sum +Synchron ization +discreti ze +Ġborrow ed +mline file +Ġapart ments +Ġode int +ĠSTO CK +ĠBla ze +OutOf Range +ĠëĤ ĺ +PeerConnection UpNotif +PeerConnection DownNotif +PeerAddr Type +ĠåĩĢ é¢Ŀ +ĠåĩĢ åįł +togg l +Ġhcal digi +Ġprece ding +ICsVer NotSuppTx +ICsVer NotSuppRx +ICsUnknown Tx +ICsUnknown Rx +ICsSyn ErTADTx +ICsSyn ErTADRx +ICsSys FailTx +ICsSys FailRx +ICsSem ErTADTx +ICsSem ErTADRx +ICsReloc FailTx +ICsReloc FailRx +ICsInReFRe PrTx +ICsInReFRe PrRx +ICsColNW ReqTx +ICsColNW ReqRx +à¤Ĺ लत +EndMarker Tx +EndMarker Rx +VerNotSup Tx +VerNotSup Rx +StopPaging IndTx +StopPaging IndRx +ciscoDiaBaseProt Enable +ICsInvTot LenTx +ICsInvTot LenRx +ICsInvMsgFmt Tx +ICsInvMsgFmt Rx +ICsUnexpRpt IERx +ICsUnexpRpt IETx +ICsUnPgUESus Tx +ICsUnPgUESus Rx +DlDataNoti FlrIndTx +DlDataNoti FlrIndRx +ICsCmpDet Tx +ICsCmpDet Rx +ICsPTMSISigMM Tx +ICsPTMSISigMM Rx +ICsNoRes Tx +ICsNoRes Rx +ICsNoMem Tx +ICsNoMem Rx +ICsReqAccept Tx +ICsReqAccept Rx +ICsReqRej Tx +ICsReqRej Rx +ICsTFTSys ErrRx +ICsTFTSys ErrTx +ICsTFTSMANT ErTx +ICsTFTSMANT ErRx +ICsServDenied Tx +ICsServDenied Rx +ICsNewPTNPref Tx +ICsNewPTNPref Rx +ĠíĻķ ë¥ł +ICsUERefuses Tx +ICsUERefuses Rx +ICsNOTFTUECTX Tx +ICsNOTFTUECTX Rx +ICsRMValRcv Tx +ICsRMValRcv Rx +ICsAcceptPart Tx +ICsAcceptPart Rx +ICsMisUnknAPN Tx +ICsMisUnknAPN Rx +ICsProtoNtSup Tx +ICsProtoNtSup Rx +ICsIMSINotKn Tx +ICsIMSINotKn Rx +ICsRATChg Tx +ICsRATChg Rx +ICsDtForNtSup Tx +ICsDtForNtSup Rx +ICsGREKeyNtFd Tx +ICsGREKeyNtFd Rx +ICsAPNResTInc Tx +ICsAPNResTInc Rx +ICsLclDet Tx +ICsLclDet Rx +ICsISRDeact Tx +ICsISRDeact Rx +ICsRPrNt RspTx +ICsRPrNt RspRx +ICsUENot RespTx +ICsUENot RespRx +ICsCondIEMs Tx +ICsCondIEMs Rx +ICsAPNAcsDen Tx +ICsAPNAcsDen Rx +ICsUserAUTHFl Tx +ICsUserAUTHFl Rx +ICsUnabPageU ERx +ICsUnabPageU ETx +ICsCtxNotFnd Tx +ICsCtxNotFnd Rx +ICsManIEMiss Tx +ICsManIEMiss Rx +ICsEIFRNCEn Tx +ICsEIFRNCEn Rx +INFORMATION AL +延 å®ī +VARIANT S +bast ian +ught er + # +ĠIma ging +Ġmechan isms +PRIM ARIES +订 åįķ +BeamSpot Rcd +Ġdamp ing +ĠGM TTemp +Ġëĵ ¤ +FORWAR DED +sire ne +Transient FailureNotif +ĠìĪ «ìŀIJ +wireless Config +nrb Parser +âĤ ĵ +Ġsce ener +queri er +ĠgetIndicator Value +Mechanical Object +ĠForti Gate +Permanent FailureNotif +ĠTraffic Light +NpuNumberForDrop Stats +eSource Pivot +pob servations +reson ance +pyn cho +Ġesti magic +Mlp Policy +ê¹ Į +heli al +Ġindivid ually +Ġinsur ance +boxc ap +ĠROB OT +Ġlaz ily +ĠYa hoo +Configura ções +OrMore Args +ProtocolError Notif +çķª åı· +Gaffer UI +Tac Toe +Vac uum +cnx n +envi roment +Ġpue de +preparate urs +STRI PE +Ġendere ço +Qry ContigID +ltp FR +starg ates +11001 00000000 +AllBut One +EnumType Wrapper +BIS HOP +ĠFear AndGreedIndicator +tamp on +ĠConda Env +Throws Exception +ĠEvalu ates +Binar izer +MolFrom Smiles +Ġafet ada +BUND LE +fuj ita +getSymbol Value +ibili dade +ĠKeyed Vectors +IpMask Bits +ĠCarousel Item +ĠtexCoord Set +HNF s +csa il +sener gize +ĠBBB P +AGo UCgUCoVCcYmh +Ġtrk Coll +Ġèĭ ¥ +Epist asisLinearRegression +oFAr FJYYSgAq +Ġبار ÛĴ +MML ab +alou pe +assault Rifle +POSS IBLE +ĠsendTo AllButOne +FromLocal Action +æĹĭ转 åľĨä¸ĭæłĩbuff +GradientDescent Optimizer +hUKh UFxiK +993700787401 576 +BKB CoVA +Ġoda huflow +éģ¿ åħį +lichtungs beho +Pckt LenErrRx +ZENK AKU +isFlagged List +Ġyaf owil +Ġkahy par +eccen ca +achuset ts +APPR ENT +Seym ourExcel +UnSup MsgRx +UnSupported MsgRx +ĠUserDocker Exception +IntCode Program +ĠglUniform Matrix +RxPackets Dropped +ĠAddEntities Callback +cmdivor cx +GTPPort ErrRx +kahy par +1372549 01 +AKhQK hUKhUFxiK +updatedEgg ROI +MRBrain S +BSXGEo AKhQKhUKhUFxiK +PacketAlloc Fail +SUPERSC RIPT +âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJ âķĿ +FQqFQK BSXGEoAKhQKhUKhUFxiK +CDOTARESPONSEQUERY SERIALIZED +ĠåĩĢåįł æ¯Ķ +BeamSpotRcd Printer +ĠGMTTemp File +oFArFJYYSgAq FQqFQKBSXGEoAKhQKhUKhUFxiK +BKBCoVA oFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiK +BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiK AGoUCgUCoVCcYmh +! } +# ---- +' = +' "] +' >< += -- += }") +> () +> ): +> |\ +? >> +Ġ' ()' +ro v +ro it +ro medriver +ti st +ti ed +mp u +Ġc ual +Ġc td +Ġc job +Ġc rl +Ġc tkn +Ġp st +Ġp lo +Ġp min +Ġp ace +Ġp ou +Ġp ain +Ġp range +Ġp rt +Ġp board +Ġp spec +Ġp long +Ġp wave +Ġp erio +Ġf ic +Ġf list +Ġf open +Ġf lm +Ġf uck +Ġf ledge +Ġf ollower +Ġf ranchise +it ar +it ype +it as +Ġa j +Ġa ma +Ġa qu +Ġa pro +Ġa ward +Ġa Dict +lo m +00 86 +00 78 +00 012 +00 2672 +ge vent +ge so +', ], +Ġn es +Ġn ec +Ġn comp +Ġn types +Ġn words +Ġn side +Ġn spath +Ġn Bits +Ġn rof +Ġn ipype +Ġs sa +Ġs late +Ġs CB +Ġs lugs +Ġs liders +ut p +ut zer +ut ura +ur ize +ur fer +ur adio +ss ibly +Ġin strs +Ġre ts +Ġre new +Ġre mark +Ġre compute +Ġre minder +ing Group +Ġo fi +Ġo der +Ġd Z +Ġd op +Ġd end +Ġd out +Ġd time +Ġd ob +Ġd ace +Ġd field +Ġd Ed +li ving +pe ssoas +un ra +un balance +un sch +un translated +un iversal +un advertised +Ġm name +Ġm og +Ġm ant +Ġm tag +Ġm angle +Ġm ux +Ġm sd +Ġm arc +Ġm tv +Ġm kt +Ġm jx +Ġm srp +ra st +ra ven +Ġe S +Ġe T +Ġe Node +Ġe tl +Ġe phys +Ġe hf +la ge +la res +ion ette +() ')[ +co te +co op +co bra +co hol +co astal +ri id +ri gh +ri bbon +Ġb om +Ġb row +Ġb bs +Ġb pm +Ġb uried +Ġb ouwens +Ġb acpypes +Ġ1 156 +Ġ1 151 +Ġ# < +Ġ# ================================================================ +Ġ# === +ed env +11 93 +11 19 +11 49 +int ersphinx +Ġw vs +Ġw avel +Ġw kt +ch u +ch re +ch icago +te ising +di graph +di jkstra +and feel +Ġ[ , +Ġ[ !] +ma sh +ma preduce +ul ename +== [ +== >", +], )) +"" "). +ol di +ol us +Ġ+ ------ +is z +is pec +val pha +get P +get time +get EstimatedTransactionFee +get SfpCmd +get filesystemencoding +(' ================================ +)) " +)) [' +)) }) +)) +" +set Data +set Results +set MinMax +set Driven +Ġ- ' +Ġto x +Ġto file +Ġto days +ĠT K +ĠT c +ĠT an +ĠT ac +ĠT ob +ĠT own +ĠT AP +ĠT une +ĠT TS +ĠT iden +il p +th ous +con ge +con strain +con secutive +con ductor +(" = +(" ### +(" .* +(" };\ +as ar +[' -', +iz ar +et nam +arg c +arg List +op ense +Ġ{ [ +Ġis nan +Ġis Valid +Ġ7 70 +ĠS v +ĠS ar +ĠS mo +ĠS END +ĠS LA +ĠS MF +ĠS HOP +ab use +ĠC le +ĠC lu +ĠC ay +ĠC ai +ĠC CD +ĠC IR +ĠC Metric +ĠC EOS +ĠC rawler +ĠC rowdsource +up iter +up vote +Ġg od +Ġg low +Ġg params +Ġg cp +Ġg pr +Ġg Term +Ġg endoc +for notify +for got +for earm +ter a +Ġr str +Ġr type +Ġr dd +Ġr dfs +Ġl file +Ġl xc +Ġl cs +Ġl cp +Ġl ÃŃ +Ġl bd +": """ +end date +end ings +data array +data io +data Line +ĠA lib +ĠA BS +'] "). +01 86 +01 29 +01 48 +Ġcon he +Ġcon ductor +Ġcon ductivity +ic als +ic ensing +ke zi +am ic +to a +to ut +Ġ: ]* +Ġ: ])) +ĠF ab +ĠF UZZ +sc im +qu ay +log x +log ilab +list file +list of +value typed +vi vi +vi be +ser de +Ġh c +Ġh an +Ġh map +Ġh mass +Ġh sl +Ġh abilidade +** . +all ergens +po cs +po lice +ta ylor +ĠP P +ĠP g +ĠP ind +ĠP ear +ĠP ivot +ĠP angolin +ĠI LI +ĠI HC +ĠI PUZ +ĠL M +ĠL W +ĠL EX +ĠL RU +ĠL dap +ĠL obby +ĠL isp +ub mit +Ġth reat +Ġth rash +Ġth umbnails +=' '> +=' |') +=' ?') +Ġst ems +Ġst ereo +Ġde con +Ġde lt +Ġde db +Ġde be +Ġde bian +Ġde epest +ine a +est ro +Ġ""" " +Ġnot as +im izer +im fs +Ġex ib +Ġex clusions +Ġ3 17 +Ġ3 88 +Ġ3 95 +Ġ3 46 +Ġ3 42 +Ġ3 58 +10 66 +10 29 +10 58 +10 62 +Ġprint Msg +out p +out Dir +ĠD ID +ĠD uring +ĠD emisto +ac qu +Re ce +Re ceiv +Re ached +Re maining +Re achabilityServiceClient +app spot +sh ore +sh uf +sh aders +Ġdata path +Ġdata interface +Ġdata Arrays +ĠM ell +ĠM argin +ĠM UV +ĠM Bus +ĠM ATER +ĠM exico +nt rain +time span +time Step +time Slice +oun der +if l +if r +key chain +Ġv u +Ġv xc +Ġv utils +Ġv tmp +Ġv Imp +02 34 +02 37 +02 66 +02 44 +02 48 +ext er +Ġy n +Ġy res +Ġy out +Ġy train +Ġy Test +Ġy Min +Ġy arl +ĠO O +ĠO mni +Ġpar ametric +Ġx j +Ġx mean +Ġx amb +Ġx clim +alse nse +Ġse mp +Ġse us +Ġse ir +Ġma Uuid +Ġma hotas +test dir +test Path +add uct +add Point +add Event +add Child +[" % +ER ARCH +IN FOR +IN SIGHT +Ġstr atified +load Collector +ore a +Ġme c +Ġme h +Ġme son +---------------- --------------- +tra y +ens o +ens ics +py bullet +xc pp +pre cs +dex com +ap ing +07 13 +07 75 +ang ry +ang let +xd o +ES P +ES OL +"] [:] +ĠB ath +ĠB ern +ĠB é +ĠB ounded +12 11 +12 88 +12 45 +12 67 +12 91 +12 59 +ĠE P +ĠE V +ĠE tc +ĠE ste +ĠE Ap +ĠE xact +Ġj ane +""" ### +wor l +wor lds +text pos +AT M +AT CA +AT GTT +Ġ) / +model file +ans ys +ĠN D +ĠN an +date string +ir us +num Comp +Ġres izing +user List +user names +user Input +bo c +bo dia +Ġ4 92 +Ġ4 17 +Ġ4 19 +Ġ4 33 +Ġ4 45 +Ġ4 77 +Ġ4 21 +ger many +Ġget args +Ġget Status +Ġget Color +92 01 +92 33 +92 36 +col lisions +In tr +In ject +In fra +In gest +In Game +In ertia +In iciado +======== ") +lot ter +ĠR j +ĠR ose +ĠR otor +ĠR AI +mo ov +Ġun related +Ġun conditional +Ġun hexlify +Ġun compyle +read List +Ġtest set +Ġtest dir +Ġtest loader +Ġtest infra +Ġlog id +Ġlog ins +32 71 +oc ms +oc chi +ĠG an +ĠG RE +ĠG AM +Ġco ordin +Ġco efici +Ġon Event +EN N +ĠW AN +ĠW arn +ĠW atched +ĠW ulff +tri ed +Ġout ra +Ġout break +Ġout Tmp +AR IUM +AR esponse +ĠV AC +ĠV pc +ĠV ia +ĠV ocab +ĠV oo +ĠV oucher +ĠV apor +ĠV IVO +ĠV BINSTST +ĠU F +ĠU m +ĠU ber +dict Config +print Func +param type +Ġ5 16 +Ġ5 94 +Ġ5 33 +Ġ5 85 +Ġ5 81 +Ġ5 400 +Ġhe ated +Ġhe aps +mb ins +). ". +ape l +Ġan te +Ġen map +Ġen emies +ise ase +ire f +ire ctory +che byshev +min ion +min Max +min iconda +999 0 +Error Exception +18 14 +18 29 +16 94 +16 73 +16 69 +array Key +array SearchT +sa mpl +sa uri +Ġk IR +Ġcol span +25 76 +Ġro ger +St ory +Ġpy o +Ġpy pk +Ġpy rfc +Ġpy dub +config File +Ġ6 06 +Ġ6 80 +Ġ6 54 +Ġ6 59 +ag ator +ag ara +ag fusion +04 76 +13 82 +13 72 +og n +lib vul +06 03 +06 94 +06 95 +06 86 +15 87 +15 47 +15 69 +SE xception +ec r +100 8 +max X +max i +max time +05 83 +Ġthis Annotation +03 86 +03 98 +03 82 +cs f +we ig +Ġch ats +Ġch Names +Ġch ina +Ġch urch +17 18 +17 93 +17 22 +17 45 +Ġal phanumeric +Ġal bumentations +93 99 +93 03 +93 95 +93 57 +93 83 +93 39 +93 53 +93 68 +14 55 +14 95 +14 66 +stance s +Ġpre con +Ġpre lim +Ġresult ant +ord ons +Ġat titude +Ġat least +64 66 +64 56 +right x +right key +error Detail +ings Serializer +gra bbed +076 8 +076 9 +plot array +LE AVE +Type Ref +Type Symbol +RE FI +RE WARD +RE VERSE +Ġtra il +08 28 +ðŁ ħ +ðŁ Ī +pi ano +22 60 +ĠH op +ĠH all +ĠH alo +ĠH IV +ĠRe cover +ĠRe maining +ĠRe paintResult +sub length +sub way +sub sections +sub scribed +Ġ{} ", +Ġ{} '). +Ġ{} )[ +input Col +Ġdi ssip +sk o +sk ater +db d +LL ist +UT A +88 02 +88 36 +88 95 +88 82 +Ġargs map +19 59 +image io +image space +image builder +comp lier +ID A +34 01 +34 29 +pos i +09 01 +09 68 +84 13 +84 75 +84 43 +ĠIn dian +own x +Ġkey press +nd Box +inter change +inter rupted +ant asy +bin val +bin path +Ġle f +Ġle aky +result filename +ann s +24 89 +24 63 +ak p +state xclude +Ġoutput String +Ġ@ { +Ġsub dict +Ġsub packages +Ġsub sections +Ġsub packet +als i +als Response +AM I +96 14 +96 36 +96 74 +96 198 +ĠCon d +Ġnew Size +Ġnew spaper +ress o +ress ources +Ġall data +55 94 +94 83 +94 62 +clu ÃŃdo +Ġcur x +33 00 +33 85 +33 91 +DE LT +RO WN +Ġapp imagebuilder +()) [: +Name Context +node Value +Ġno op +Ġline Type +AL RM +AL TERN +AL NIC +fic ulty +(), \ +'. """ +Ġsys config +85 99 +97 19 +97 26 +mi os +rans form +================ ==== +36 87 +36 97 +36 56 +36 38 +36 91 +011 5 +011 00 +011 0011 +query string +Ġid r +ĠK r +ĠK az +ĠK VM +ĠK night +ĠK amaelia +95 11 +95 24 +95 97 +view able +run test +run state +86 88 +Ġmax i +Ġmax s +sum marizer +Ġz k +Ġz ap +Ġz ll +Ġz edenv +################################ ########## +################################ ########### +process String +Ġjson path +Ġjson pickle +Ġhas Next +Ġindex Range +default filters +default FileName +AG R +AG GG +57 99 +57 13 +57 34 +his hek +Ġ[' \"]([^'\ +create DataFrame +Ġtf records +Res ol +Ġbo at +au er +au lo +Text Info +List File +List Group +CO V +CO bj +Ġunder Skeleton +api Class +trans Figure +request Headers +AC COUN +Ġstart X +Ġte ach +Ġli sa +44 00 +44 32 +44 43 +44 71 +frame type +cont ro +cont orno +IM MO +IM IZE +Ġdis cu +Ġdis like +Ġdis abling +AP ACHE +Des ired +new sessionid +OT SU +yst one +yst reets +En c +En vs +En hanced +Co Y +Co vid +auth data +auth entic +Ġend X +Ex pires +Ex perience +ET A +ET RM +ET CB +Ġ-- ' +cal vin +56 99 +56 17 +56 64 +56 85 +56 54 +56 72 +56 021 +98 97 +Ġsp anner +FI O +my File +Ġ(' < +Ġ(' [ +box ix +Ġ(" [ +Se arches +be k +be ast +ĠQ T +ĠQ max +ĠQ LF +ĠQ ahat +Ġcolor space +Ġcolor ful +35 22 +35 66 +35 28 +35 21 +AB AND +vis dom +ref eicao +Value Ar +Value Entry +straint s +Ċĉĉĉĉ Ċĉ +Buil tin +File Loader +AD G +ran co +Ġtarget Layer +cre ature +Ġim Patho +))) [ +))) ]) +))) /( +Ġcurrent QSize +45 12 +45 88 +45 81 +ĠAN U +ĠAN SI +77 88 +amp ering +the sauri +Ġerror bars +ĠY ES +ĠY olo +Ġinter im +Ġinter leaved +Ġrandom ized +ĠX C +ĠX lib +ĠX GBoost +Ġtrans verse +Ġarg min +Ġarg String +cc ds +47 02 +47 18 +47 05 +47 17 +47 37 +47 55 +47 33 +47 35 +47 29 +initi ate +]] [" +face bank +column configure +ĠEx am +ĠEx pects +tf p +Ġ9 0000 +cy tomine +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +pl M +pl Pitch +Ġsk l +Test Base +Ġser vicer +Ġpd k +Ġevent o +Ġevent HubMessage +Ġver bs +Ch er +Ch rom +Ch anging +UN PUBLISH +ĠIN TERNAL +ors ma +order ID +46 32 +46 03 +46 77 +46 72 +PE AK +ĠJ s +ĠJ am +ĠJ ason +Ġcv t +Ġcolumn Merge +DI GEST +ĠSt ored +Field ID +70 32 +)] \ +ail and +Un link +Un structuredGrid +The y +mask partial +Ġq hat +TH TH +tag statexclude +TR ESPONSE +sys ctl +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ +To Json +To Many +To Unzip +Ġ''' . +CON Z +De S +De Conv +De uteronomium +ost an +field Name +sign ers +29 000 +US IGN +Ġ`` { +Ġ`` __ +Time And +block size +'][' # +usr data +Ġdb cur +MP R +MP a +67 02 +43 32 +43 05 +show er +ĠCON TEXT +Ġup scale +Ġplot utils +search path +search Indicators +Ġ100 2 +:: " +:: ] +000000 2 +Ġpoint Size +Ġpoint pattern +Ġpoint Distance +down grade +48 14 +48 27 +ðŁı´ółģ ·ółģ +ie vv +Ġqu ot +Parser Error +Ġimg ur +EX PR +EX TRAP +EX ISTS +fe lix +red raw +red ucing +No N +No OptionError +total Count +ze bra +Ġ'. /' +42 13 +42 33 +ify ing +])) / +Ġquery Cells +last Error +left x +project Id +EL S +Ġpri sm +Model Base +link List +debug Mode +ï¼ Ĺ +ĠIS LANDS +ĠÐ ¢ +"> {}( +ĠSub tract +sr ch +expression file +expression Header +liter atura +MET ANS +404 2 +404 3 +404 7 +404 9 +Ġ"{ }, +Ġshort hand +ĠOpen MMLab +ĠIP SEC +SU C +SU GGEST +Ġ? ) +Ġ? )", +Ġ? ???? +ĠWh y +agg Reports +Ġbit map +MAP PED +glob F +glob e +Ġpr f +Ġpr z +Ġpr ng +fast api +ĠInter est +ĠInter pre +ĠInter faces +ĠInter ceptor +ç» ĺ +ç» Ŀ +}: {: +With Selection +With Overrides +Stats SkippedGroup +962775 924 +ı k +uring Element +joint Index +ĠEN TER +ĠEN VAR +åľ ĸ +Mem cache +å¼ Ł +Ġarea T +wb em +SET S +simple jwt +Ver bosity +cogn ite +PH RD +uch sia +Open CL +Open Shift +011100 100 +Ass istance +Ass ayed +cid o +mid as +merge sort +к е +/> ", +ĠCO OK +As ynchronous +Local Logging +DD M +dy libs +ĠMy InputTransform +ĠMy BalancerExchange +Top level +Top ics +Ġpower ed +look andfeel +400 3 +400 6 +Ġtile Name +rr set +ĠST AR +è® ¯ +BB C +big rams +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ +dimension ality +Page View +Ạ³ +Ạµ +Ạ· +}} [( +ĠObject Manager +System Length +System Exit +Ġcent ro +################################################ ##### +Ġexpression Builder +sy l +HTTP Connection +Seri alizers +eps ilons +ä¿ º +Ġclear ing +edit page +Pass ing +Ne u +Network ing +Network Options +Ġri vers +Ġri scv +ĠNode Map +Ġtool z +Ġtool tips +dp f +}{ { +ĠPoint less +semb ling +čĊĠĠĠĠĠĠĠĠ ĉ +zen odo +power ed +Ġcombin es +Ġcombin atorial +Ġque ens +sol ving +401 6 +IE s +rd types +sal ine +Ġsite map +pickle File +Ġedit ors +progress Bar +Ho spital +}] ') +Ġterm os +çĽ ¤ +çĽ ĥ +9248 0215 +Enter prise +ino es +SimType Function +alias ing +Unit Config +ĠPO I +å¯ « +('. /' +ĠMake MetadataLine +Mod N +ĠSp am +tu h +ĠAD AGUC +nc dm +Ġctsp SgaclIpv +contact able +ĠEvent Context +ĠEvent Types +oring a +Rel ativ +serial ise +submit ter +program ming +PN F +Ġsq la +Rate InSeconds +Ġpermit s +в еÑģÑĤ +tel net +Ġnumer al +Exec utes +wi pe +ê° ľë +ĠMon key +Sign up +Ġxy wh +yl ated +gp v +æľī çļĦ +003 137254901 +ðŁĩ ´ +ðŁĩ » +Change log +ctsp SgtCaching +ctsp AuthorizationSgaclFail +ctsp SgaclIpv +My Node +DER IVED +ĠEnd Point +ĠAnd erson +VS MOW +WR ITER +æŀ ¶ +Ġworking area +Ġequ alized +Ġvo or +annotation Dict +BF S +ĠMat ern +phi h +{}/ '. +'" %( +Ġstatic files +circ a +915 5 +LV a +Admin istration +uck le +flush Input +Ġ"$ " +resid ents +åĮ Ĺ +Ġanaly sed +Fin alize +Tri e +Ġadjust ments +ned in +uk as +117 64 +Sec rets +Sec DebugLogLevel +DT D +ĠDO I +Arg Type +Ġhref s +dn coarse +Ġregex s +ĠPrint ing +165 42 +Extra Info +Ġsy scall +Ġem ulation +combin ase +Ġfe cha +Ġfe asibility +INTER VENTION +ierarch ies +Ġmu ut +Ġtransaction al +sur gery +Ġsur veys +}_{ \ +ĠMin utes +ĠMin Hash +disable s +Ġcondition als +Host Key +Feature Collection +Ġfid ucial +Ġ{: } +accept s +hd ul +ĠPri me +Ġ================================================================= ===== +met als +follow ings +Video Node +Ġmac rolanguage +retri eved +ĠCan onical +Ġ"[ %( +machine Name +RED DIT +Uni Prot +DK Z +CAP AC +ен но +Reference Information +eg as +Ġpositions PerPrimitiveUnitCell +Validation Folder +212 08 +Password Reset +Ġsquare form +ENTRY TYPE +Ġhyper opt +Ġhyper visor +Ġhyper bolic +Ġmass Threshold +908 7 +Ġgeo code +SUB URB +expect ing +ðŁı´ółģ³ółģ ®ółģ +ðŁı´ółģ³ółģ ¶ółģ +ðŁı´ółģ³ółģ ¹ółģ +Ġwhite lists +{}_ {}". +Email Message +Ġnone mpty +å®ļ ä½į +Ġet na +304 4 +Pr erequis +coin base +Standard Scaler +Ġmet ros +Sgt RowStatus +Body Type +Ret rieving +IGN ORED +Ġrefer ência +BATCH ES +EMAIL S +Ġsv gd +ĠEd ges +################################################################################ ########## +403 5 +ĠStd Function +ÑģÑĤ а +Meta Names +Remove ImageOptions +Ġĉ ĠĠĠĠĠĠĠĠĠĠĠ +HD L +Ġbg api +ĠØ Ń +Segment edColormap +Ġí Ķ +ÛĮ ر +ÛĮ س +Build ImageOptions +Build ImageMessage +284 8 +427 1 +ili a +ili co +236 9 +recv ing +DEL IM +Ġpin yin +Ġfbx Skin +Dialog Frame +ĠSc anner +ĠSearch ing +browser stack +Card inality +pay ments +Ġmultip licity +ĠEnum ValueSet +288 1 +288 5 +oauth s +oauth lib +quad ric +Ġdiag s +Comple tion +334 4 +334 6 +422 1 +422 6 +Ġsync er +ĠFirst File +ĠThread Pool +ìĿ´ ë +ìĿ´ ëĭ¤ +436 2 +ific ator +ÙĪ Úº +{: ^ +ĠTR ACE +AU X +AU CTION +ĠBack up +237 9 +æĭ ¼ +æĭ ¾ +lam orous +Param Type +Ġmar ried +Ġmar riage +Ġhit ting +ĠRout ing +Ġdetection results +426 3 +attack s +ĠFree Solv +Site TypeSymbol +sfp Compliance +sfp Voltage +sfp Temperature +sfp Connector +sfp Wavelength +sfp TransCode +sfp BrSpeed +sfp SmLength +sfp MmLength +sfp CopperLength +385 0 +Ġfour ier +("# "): +395 2 +Pack ing +м ож +м ин +ĠBar code +ĠConstruct s +396 7 +457 8 +launch ers +FOR K +ĠOver rides +Ġatt ending +cart opy +åIJį åīį +ภ¢ +ภ± +ĠPort erStemmer +386 3 +Ġ'@ ': +ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠ +455 6 +Ġeth ereum +Send TransactionRequest +Ġmail to +Ġmail bot +dhcp Relay +/* ') +ĠCar negie +332 3 +MON O +065 36 +Ġsha ft +crypto graphy +ö yle +Ġai ogram +ĠOper ación +Ġweek days +Route Table +æĸ¹ 便 +zM zM +Ġcam fi +947 2301 +Qos Option +Ġtele phone +NODE LIST +cookie jar +VA o +Ve hicles +408 4 +408 8 +Kp UK +æĸ° çļĦ +opp s +patient Sep +Ġ-------------------------------- --------- +687 5 +ÑĨ Ñĭ +åıĤ çħ§ +Car ree +Car roll +Ent rada +Bad dies +ĠdocsLoadBal Channel +Ang les +MF PP +eros ion +ĠTF Record +æĬ Ģ +ADD ONS +ĠProperty Registry +tos is +QUE UED +subscribe ToBlockHeadersWithChainLocks +wik is +ĠDown loader +augment ations +ãĥ³ ãĤ¹ +Pod Autoscaler +Ġquat AM +Ow ned +Notification Target +Qq FA +bian chi +ung ry +åŃĺ åĤ¨ +gas us +hard en +ĠAT I +fbx Material +jj z +dra ke +dra sil +)? (\ +еÑĤ од +particle Flow +ðŁı´ółģ£ółģ º +ðŁı´ółģ£ółģ ©ółģ +ĠIM U +ĠDep ending +409 8 +ĊĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ +ĠTri ck +ÙĬ ر +Ġhar ness +Ġhar vest +ç« Ļ +Ġnav bar +ualiz ação +è o +Ġrs lt +Interrupt Exception +čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ +Ġdeep er +Ġdeep lodocus +Center Crop +Ġpv lib +Ġplan ets +Processor Max +Processor Current +Copy Message +ĠPR P +466 1 +Pa ssage +ï¼ī ', +áĦ ī +áĦ į +KI LO +'); ") +trunc ation +Byte Array +composition al +Threshold Rule +Ġslow sql +dag ster +ĠVis itor +WF W +sem ver +Sets Dict +Clock Boost +¯ółģ Ńółģ +Ġeff ector +æłĩ è¯Ĩ +ĠPoly gons +ĠPoly tope +Ġprime ira +PROCESS ORS +STREAM ING +CAL IB +Ġopp ortunity +ðŁı´ółģ³ółģ© ółĢ² +WK x +Annot ator +Annot ated +Ġpiece wise +Ġsock etio +Install ation +ĠIdenti fication +Ġ'\\ ': +ĠìĿ ½ +sch en +Ġdc Pitch +Ġ================= =") +Ġ================= ====== +Inf lation +æĻ ¯ +forecast ed +daemon ize +398 9 +Clean ed +ulo mb +dead ended +Align RNA +438 2 +ĠNUM BERS +tro uble +393 1 +393 3 +434 9 +gf H +Hook s +bN my +ROP IC +模 æĿ¿ +Free Solv +pal av +Ġcare t +è¨ Ĭ +Ġsay ing +Ġste ep +cas a +umin um +Ġwarn ed +mention ed +How ever +Home s +don nees +Stmt Renum +van ag +ORD ERS +MANAG ERS ++) '). +OID C +utt X +Blue King +Ġcrypto currency +ĠSeq Record +Fit ness +Ġperm ite +Ġinstanti ating +Catalog s +Catalog Manager +"^ (\ +Ġbed s +ðŁı´ółģ°ółģ · +ĠcpwVc IdMapping +ĠcpwVc PeerMapping +Person s +hal ation +abo lic +Fold ers +ĠPAR SE +Ġht t +ĠPack ard +mini map +ĊĉĊĉ ĊĉĊĉ +æĺ¯åIJ¦ åŃĺåľ¨ +Ġcommunic ating +cdbpPeerStats DW +pitch fork +snmp v +mh oltz +alter Add +alter Drop +Ġм ож +Ġм акÑģим +sex o +Ġspo tipy +Ġeigen vector +ĠASC ENDING +667 556 +Ġhum ans +Ġcrit erio +ĠSec RuleEngine +ĠSec AuditEngine +ç© ¿ +ĠSuccess ful +ĠClean Resp +emoji Panel +rms d +bol tz +zW Y +äºĮ åıī +pseudo code +pseudo count +ĠBit Torrent +Fbx Anim +Feed Forward +Hot Water +Parent s +tre asury +ĠES OL +ðŁı´ółģ®ółģ ² +ðŁı´ółģ®ółģ ¡ółģ +Sql MySql +Ġmorph ological +Ġ#------------------------------------------------ ------- +samp lename +Ġib is +ilton ians +Ġ-------------------------------------------------------------------------------- ----- +vit ational +capit als +áĥIJáĥ ķ +chk pt +ĠPos itions +DOC USIGN +ĠPur ple +GU EST +æ¡ £ +Ġconcurrent ly +ĠVideo Stream +ĠVideo FileClip +solid ation +cropped VideoDir +477 2 +Ûģ ا +ĠJOIN ED +sprite collide +ĠPlay list +Diag nostic +nT p +does n +Ġ× ij +Ġ################################################ ########## +Ġtv db +Ġinc lination +graphics View +dap lab +س ت +Ġnt path +Ġhighlight ing +Gra vity +Sn ake +Gw Index +Ê· Äĥ +Ê· ɤ +ĠProp agation +OPEN ED +Curve Node +GENER IC +oh lc +ĠCap ability +Ġhack er +ðŁı´ółģµółģ ºółģ +Ġig py +shuff lenet +CTT CT +(''' \ +ĠFUN C +Ġvk String +inherit ance +===== # +ĠInstall ation +Ġspeak ing +ë§ Ī +ĠFra gment +د ر +ĠOAuth Handler +ãĢĢãĢĢ ĠĠĠ +Dat os +ç² ® +Ġconj ugate +psu A +psu B +ĠAnnot ations +ĠActive Unit +ĠMetric Summary +Ġê° ľ +ĠSpark Conf +Ġimprove ments +Ġë° ° +Ġë° Ķ +Ġë° ľ +ĠCy tomine +ĠGR ID +ĠGR ACE +olin ite +ĠLat ent +Est ado +KN IGHT +ARE AS +ĠHo ok +intersect ing +ĠSte el +ĠEstim ated +Adj acent +³ółĢ ´ółģ¿ +Snapshot Identifier +ĠVol atility +â y +11000011 000101111000000 +æ¯Ķ äºļ +(.* \ +å¡ ŀ +resample s +ĠEnt ropy +AGA AG +失 æķĹ +COPY OPTIONS +çŃī 级 +DITION AL +Ġnest erov +Ġelf file +trackOfThingsProducer D +ìľ¼ ë©´ +ç³» æķ° +áħ µ +FIT INS +gebra ic +EXEC UTE +Ġflood system +Ġcrash ing +Design Id +Animation Time +ĠSupport s +Ġpivot ed +Ġsale or +facebook research +çĻ» éĻĨ +ĠBuffer ed +dol fin +wid owed +REL ATION +corp ora +μ ε +μ ÎŃ +Rename All +Ġprox imity +ĠHigh er +ĠìĹ IJ +áĥĺáĥ ļ +CATEG ORICAL +ĠConcat en +Ġmed itation +Ġcomput ers +ÅĽ ci +4444 4444 +Ġcry st +dyn TaskName +Ġrelat ing +Ġrelat ório +thumb print +Ġhb TradeQue +ил аннÑı +Ġdemon stration +說 éģĵ +Aff inity +Horizontal PodAutoscaler +Ġida es +adverti sement +ĠPER IOD +Ġxg j +ĠExecution Style +Based Vlan +Ġblur ring +ĠPrivate Key +ĠSuper visor +Shuffle NetUnit +South ern +Ġtem os +\\. [ +completion Function +Æ°á» ¡ +ssim val +quer da +ĠPOS Indices +Shelf Request +Ġresearch ers +odock VS +ĠVari ational +Static Text +pyg mo +repair ID +#------------------------------------------------ -------------- +Ġpare de +Like lihood +DEST INATION +HAT Colour +Stri de +Ġaw esome +Ġhw sim +æµĭè¯ķ éĽĨ ++---------------- ---+ +Ġrelax ation +ĠDa mage +ĠÎ ² +Ġxt riage +Pas cal +Ġsand y +Inher it +Resid ues +Prim var +Dst Port +Mig rate +Spo tify +µółĢ ³ółģ¿ +ĠPas sed +ĠEpoch Array +åĽĺ æĽ¸ +CAM INFO +CAM ERA +Ġbib items +PRODUCT S +Ġ"(" : +ĠTW O +("' {}' +ĠìĪĺ ìłķ +ĠCR UD +ĠMC SCRIPT +ĠContin ue +Ġcle ans +Requires Context +ðŁı´ółģªółģ Ń +Ġfavor ites +Ġmv pa +Ġ#---------------- --------------- +ĠSn ake +ĠRMS prop +ĠÐĴ озвÑĢаÑī +åı¥ åŃIJ +Prun e +Ġmas ses +Ġpup ilometry +Ġrobust ness +Ġatten tions +Photo Image +Ġ"../../ ../ +Ġnuc mer +ĠHEAD ERS +wat ers +Ġglyph s +ĠGi ang +Gray scale +Altern ate +ĠEvery thing +Identi fiers +ãĤ¸ ãĤ§ +Scra pe +KILL CAMINFO +ç¡® ä¿Ŀ +enrich ments +Ġimap lib +usuario Iniciado +Ġvac ation +SAN ITIZE +cate l +ë² Ħ +Ġkh mer +Notify Global +Amplitude Score +Ġcru ise +idu cial +çĬ¶æĢģ çłģ +ä»Ĭ æĹ¥ +spher ic +IMPLE MENT +Equipment Class +Spectral Distributions +BET A +settle d +Appro x +å°ij èı¯ +BEHAVIOR GROUP +BEHAVIOR ITEM +CANCEL LED +ĠWire Guard +AAAAAAAA AAAAAAAA +Ġê³ ĦìĤ° +ĠFl Electrode +ifft shift +weapons ound +ün ü +ola f +Ġbear type +Ġattri buted +GRAD IENT +ĠScra per +Rich mond +Wiki pedia +elimin ate +Ġgn uradio +Ġhal os +################################################################################################ #### +��Adv ance +ĠctspVlan SgtMapping +æĶ¯ ä»ĺ +ç¢ º +Ġ########## ", +Ġtre ats +dez vous +Ġ'! =' +ASC ENDING +POMERIUMSERVICE ACCOUN +Exc itation +ĠER Pp +Ġbre ath +classif zOR +Bea con +اب ع +Ġdil ate +ĠMobile NetV +Ġrecommend ations +ĠProgramming Error +ĠCog n +ĠFar be +guy en +leader boards +ĠPull Request +shap ing +Ġtrait stone +Ġterra script +ä½Ĩ æĺ¯ +Ġpurchase d +Ġelectrum sv +ĠÑĢаР¹Ð¾Ð½ +Ġremo tes +Idle State +HAS HED +('-------------------------------- ---') +Recomm ended +REJECT ED +ĠIDXGI Factory +BlockHeadersWithChainLock sResponse +ĠCAS CADE +âĸĦ âĸĦ +Ġinde ks +Ġdanger ous +2352 94 +è¯Ħ ä»· +Ġfuncion ário +Ġsayı sı +è¶ħ è¿ĩ +TRE ATMENT +פ ר +atur as +("================ == +ĠEasy Dict +Ġkn ack +á»ħ u +Ġreci procal +Serve Graph +("-------------------------------- ------") +ROS InterruptException +VCV T +ĠSel enium +ĠCached PropertyRegistry +PUBLISH ENTRY +wake up +ĠSig moid +ĠSho pping +ĠExpl orer +xytext M +ãĥĹ ãĥŃ +ctspIf L +ĠPhoto Image +FUZZ ER +(... ), +relat ivistic +Ġbrown ie +Ġtoward Centre +DEG REE +LOOP BACK +SecAuditLog Parts +Aligned BoundingBox +COORDIN ATOR +mens a +Ġspars ify +ellip ses +ĠUr ne +BUDGET AMOUNT +ĠGRAPH SLAM +Ġmistr an +ĠIll uminant +Ġprocur ar +ĠStand ardi +Lap lacian +jer sey +Ġfort une +disa ster +Ġgar age +immediate ly +ĠJe an +District Nodes +BIC UBIC +Mip Slice +nlog lik +setRevisions Descriptions +ĠTiny Tag +0142 857143 +ĠRecur sively +Ġhttpd Config +TELE GRAM +divor ced +Ġíģ¬ 롤 +DepthStencil State +Lip ophilicity +çĮ ® +ĠPIC MI +Ġassemb lies +shar pen +LOOK UP +4768 26 +Ġautof lush +ĠëĦ £ +paren tes +SAMPL ING +Ġëĭ¤ ìĿĮ +Approval ForAll +TRO OP +jane la +Ġü ber +kep ler +Ġpref ect +accessible fornotify +Ġdatlim z +å½± åĵį +Ġmultiplic ative +RUNTIME PARAMS +pegas os +ĠбÑĭ ÑĤÑĮ +Ġxlsx writer +cac ert +sar sa +thal py +ĠDEFIN ES +Ġhospit als +Ordered ByPk +SUBMIT TED +Replica Set +Fund amental +SPAR K +myst ery +uten berg +opi lot +Reci eved +Recovery Token +Instanti ate +REMOV ED +PREV IOUS +ĠíĻķ ìĿ¸ +Bibli ografia +LON GLINK +Ġsme aring +oltz mann +Ġrail rl +11011111111 001000000 +ĠdayOf Week +ĠdayOf Months +employ er +00001000000 11111 +Coun tries +Plate Carree +ĠPier re +Ġintention ally +actionBar Default +ResourceDescription Paged +LSConn State +ĠAbility Id +jes ica +Ġcen ário +whites ide +ĠwordTreeMap List +âĢįðŁļ Ĵ +å®Ŀ åħ· +%%.. %%.. +ãĤĴä½ľ ãĤĭ +ProcessingJob Summaries +DeployStatus Message +Communic ation +('=== > +ĠCop ied +Ġgib berish +ĠOPER ATOR +ĠRIP RouteEntry +hospit alized +GetBlock Request +ĠIDXG IDevice +Realloc Resource +æĸĩåŃĹ åĪĹ +Ġcython ize +Ġsatur ate +BLOCKHEADERSWITHCHAINLOCK SRESPONSE +80000 0858 +TAR IFF +Ġance stral +atab ility +ĠSPE ED +ĠSTY LE +Ġharm less +ĠLip ophilicity +Replay Buffer +ĠRDK it +ĠVas prun +ĠVlan Index +DIG ITS +concaten ation +Ġespa ço +MonsterBehavior WithOverrides +Cant aloupe +LRS cheduler +𤠼µ +ĠALI GN +Ġthermo stat +ĠBan co +ĠTimeslot Collection +Trackbar Pos +RANCH ER +Ġæµĭ éĩı +#************************************************ ****** +Hen ry +Ġpend ulum +ĠFly ter +Ġdatadict s +GraphQL Error +ĠØ® ارج +ĠAPIT estCase +æıĴ åħ¥ +áĥ£áĥļ áĥĺ +CCL M +Efficient Net +Hemi Rect +pck l +ĠSqu ared +triang ula +ĠVID EO +ĠUl tra +vmV mps +Ġæ°´æŀª éĢŁåº¦ +TERR ARIUM +Ч ÑĤо +Ġinfe ction +SONG INFO +ĠDisplacement AmplitudeScore +StatsTotal Packets +åį· 积 +åģı 移 +UNIVERS AL +FREQU ENCY +SPR ITES +itzer land +getServer Stat +ĠCRY STAL +Ġexplan ations +ĠMcD onald +ĠEff ective +ĠNSF G +rylov Newton +ogre tim +ück en +Ġdolfin x +ĠfswRWVoltage Config +ROIPhysical Property +Dasy A +oere blex +getVertex OrNew +ĠWrest ling +manus cript +Deli Line +ĠRECE IVED +ĠDeserialize Exception +VIOL ATIONS +ĠSensorEntity Description +ãĥªãĥ³ ãĤ¯ +åŃ¦ä¹ł çİĩ +SCENED ESCRIPTION +Ġomn isci +Ġetique ta +ĠSher brooke +Seek bar +TTk Button +Ġ',( @' +Ġsincron ização +combinator ics +lemmat ize +DomainName Server +Ġlbry net +Ġìłij ê·¼ +梯 度 +EVALUATE INS +Ġnile arn +DECOR ATOR +HEART BEAT +ĠUndirected Graph +ĠExplainer Dashboard +TEAC HER +ĠEXER CISE +MINI KILLCAMINFO +Ġ\"{}\ "". +ĠÑĢез ÑĥлÑĮÑĤаÑĤ +约æĿŁ åıĬæııè¿° +аÑĢамеÑĤ ÑĢÑĭ +AIC PA +CMsg Vector +Ragged Tensor +sna pobservations +Ġ"&& ", +asion ally +iclu mp +immobili zer +ĠDeno tes +loadTests From +ĠNuc lino +erimp osed +ĠAdHoc Command +ĠSubCommand Failure +dcad ol +Ġrice cooker +Ġèĩ ª +(('{ % +AIG PT +Bian chi +CMSG VECTOR +Ġpies cope +otom ous +getStruct uringElement +ĠCTF d +ĠMocker Fixture +ĠUNA UTHORIZED +Ġalip ay +ngamma fesc +trackValidator TrackingOnly +Commando Baddies +ä¸Ģè¦ § +ECN CLD +ascading DictItem +çŃĸ çķ¥ +éłħ 缮 +ç¼ĵ åŃĺ +Ġì§Ħ íĸī +ĠYesNo Type +延å®ī åºľ +Ġsceener Regex +ĠCondaEnv Exception +Vmom i +wows dir +Ġperio di +002672 9472301 +ĠdEd desc +Ġ+------ + +setResults Name +setDriven Keyframe +ĠMATER IAL +adduct s +ERARCH Y +INSIGHT S +AResponse QuerySerialized +printFunc Test +REFI ID +IMMO BIL +ETCB CH +ABAND ON +ValueAr rs +ToUnzip To +TimeAnd Size +PROPOS AL +ĠmyMin Hasher +ClientProperties Message +ĠpixelMatches Color +92480215 476826 +patientSep erated +ãĤ¸ãĤ§ ãĤ¯ãĥĪ +å°ijèı¯ å±± +ĠFlElectrode Extension +POMERIUMSERVICEACCOUN TRESPONSE +OrderedByPk Field +0026729472301 667556 +! """ +# $ +# ''' +$ - +% - +' ? +( (), +) ']) +) +'/ +* < +* )', +, :: +, )* +- ) +- / +- ])[ +. '] +. )*( +/ ` +/ ). +/ ". +3 127 +3 198 +3 934 +3 195 +3 169 +3 173 +4 001 +4 128 +4 137 +4 114 +4 147 +4 327 +4 188 +4 026 +4 346 +4 159 +4 291 +5 109 +5 278 +5 000000000 +5 323 +7 81 +7 00000 +7 002 +7 020 +8 996 +9 011 +9 024 +9 117 +9 136 +9 116 +9 015 +: @ +: `` +< =\ += ([ += ]\ += ()), +> @ +> {} +> ({ +> .*? +@ )\ +A ra +A ero +B d +B n +B iz +B low +B AG +B ING +B ey +B ear +B IP +B DS +B etter +B illing +B ayes +B lood +C ss +C ari +C IM +C AB +C EST +C NO +C lon +C ros +C asing +C ubes +C anny +D ex +D ew +D net +D AB +D CD +D DR +D Tree +D PC +E ql +E wm +E mergency +F ON +F RE +F ran +F iducial +G AG +G OL +G gw +G umb +G oblet +H ong +H ai +H TR +H rs +H ACK +H ighest +H AMS +I PO +I bis +J V +J ACK +J itter +J apan +K on +K ay +L ly +L OR +L AP +L CA +L argest +L lz +M ate +M ary +M ute +M ud +M osaic +M ódulo +N ue +N ES +N ice +N SS +N Ro +N ICK +N jI +N Streams +N evada +N LTK +O OP +O uest +P UN +P LI +P ink +P crit +P unct +P lain +P acific +Q Frame +Q RS +R an +R ut +R ose +R PL +R BF +R PA +R ESSION +R idge +R USSIAN +S lit +S IL +S UL +S AGE +S OS +S PRITE +S tiff +S cott +T ak +T AP +T ell +T ze +T SV +T iny +T jc +T ARBALL +U f +U pt +U CC +U CTOR +U PTIME +V b +V FP +V MS +V TEC +W f +W is +W AT +W av +W FS +W wW +W armup +X O +X ic +X DR +X Sa +X gc +Y train +Y TE +Y ork +Y LABEL +Y rV +Y kJ +[ âĪļ +\ | +\ "); +_ ": +_ ~\ +` ', +a User +b ce +b pe +b oun +b size +b date +b df +b ron +b ible +b Db +b kc +b arium +b lighted +b ryant +c data +c ator +c arn +c node +c AG +c not +c fe +c ensoring +d ge +d log +d cor +d ough +d ır +d ungeon +d jske +e vid +e vv +e quival +e urope +f list +f als +f ear +f stream +f ond +f lies +f strings +f ranchise +g luster +g tt +g fx +g fm +g ência +g mdp +g arden +g AccSfp +g ordons +h O +h un +h im +h app +h ud +h ba +h All +h rf +h rp +h undreds +h ertz +i G +i up +i elle +i ère +j G +j S +j th +j om +j db +j ams +j ogo +k L +k il +k points +k elp +l H +l L +l P +l T +l ance +l bo +l fo +l max +l cs +l df +l md +l cd +l bc +m D +m grid +m ics +m mt +m spath +m rp +n en +n all +n gs +n ict +n vs +n Total +n channels +n days +n secs +o N +o val +o as +o ise +p ml +p ant +p map +p va +p ango +p ileup +q L +q S +q set +q node +q Pos +q pid +q icon +q sl +q vd +q Neg +q cow +r O +r data +r list +r tes +r alized +r src +r é +r gt +r ó +r svp +s E +s P +s ra +s ate +s rom +s data +s min +s api +s ud +s gen +s alo +s freq +s lm +t K +t Q +t at +t str +t ension +t stop +t Pumpkin +t Tomato +t Beans +t Cantaloupe +u en +u ve +u ition +u handle +v C +v ro +v ra +v os +v len +v rh +v zt +v tec +w P +w ts +w ars +x se +x len +x SP +x EC +x proj +x NT +x FFFFFF +y J +y R +y S +y str +y age +y ect +y ard +y tes +y ong +y oung +z F +z H +z I +z K +z in +z ne +z io +z elle +z ynq +{ / +| $ +| - +| { +} "], +} >" +¡ áĥIJáĥ +¢ è¿İ +¤ å®ļ +¦ Ħ +¬ ´ +¬ áĥĿ +® åĬ© +± Ħë +´ Ģ +µ ółĢ²ółģ¿ +· ółĢ±ółģ¿ +à Ľ +Ä ĵ +Î ķ +Ö Ĥ +× Ĺ +é Ł +ê ļ +ì ° +ð ¡ +ĉ ĊĉĊ +Ġ ange +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +Ġ æľī +Ġ âĸijâĸij +Ġ ä¸Ģ个 +Ġ Ø§Ø +Ġ åIJİ +Ġ arial +Ġ ãģ¨ +Ġ å¤ĦçIJĨ +Ġ åŃĹ符串 +Ġ åħ³éĹŃ +Ġ ********** +Ħ IJ +ī ´ +ij '), +ĸ ï¸ı +ļ « +ł íģ +ĠĠĠĠ č +ĠĠĠĠ ĊĠĠĠĠ +ĠĠĠ čĊĠĠĠĠĠĠĠ +in are +in son +in var +in dic +in car +in manta +er en +er vices +or p +or ian +at ta +at ian +at tribution +re j +re dir +re format +re alized +re match +re loaded +re mapping +re servations +re cycle +re serve +re bate +se de +se min +Ġ= =============== +st f +st t +st alk +en zyme +Ġt T +Ġt j +Ġt ck +Ġt ule +Ġt ib +Ġt iled +Ġt rs +Ġt SSS +Ġt amanho +Ġt ibble +Ġt asty +Ġt riton +ar que +ar rive +ar Xiv +al bers +al phanumeric +de li +de comp +de crement +de mie +le in +le ve +an ion +an my +Ġi type +Ġi Row +Ġi gu +Ġi Dy +Ġi BaseReg +me o +me ment +me chan +me chanic +Ġ' >= +Ġ' >', +Ġ' !': +Ġ' ------------------------------------------------------------------------------------------ +ro ta +ro ger +ro ves +ti ds +ti os +ti dy +Ġc pt +Ġc var +Ġc item +Ġc block +Ġc ensoring +Ġc imgt +Ġc risis +Ġp it +Ġp is +Ġp tp +Ġp max +Ġp ax +Ġp his +Ġp fn +Ġp cov +Ġp allet +Ġp wn +Ġp wc +Ġp illow +Ġp esto +Ġp onieważ +Ġf ur +Ġf ax +Ġf rm +Ġf uzzer +Ġ" ## +Ġ" }" +Ġ" >" +Ġ" :") +Ġ" ..." +he igth +it p +it self +it fs +Ġa os +Ġa ep +Ġa jax +Ġa cesso +Ġa perture +lo f +lo os +lo ose +00 19 +00 45 +00 79 +ort n +ort s +ce edge +Ġn q +Ġn arg +Ġn tr +Ġn tp +Ġn feat +Ġn sen +Ġn jit +Ġn enhum +Ġn aked +Ġs mp +Ġs ss +Ġs sg +Ġs bd +Ġs paring +Ġs gains +ut ta +ur ança +Ġin g +Ġin et +Ġin data +Ġin range +Ġin struct +Ġin div +Ġin eligible +Ġre w +Ġre du +Ġre make +Ġre vised +Ġre aching +Ġre mind +ing a +Ġo xygen +Ġd A +Ġd V +Ġd val +Ġd sc +Ġd dd +Ġd ere +Ġd mon +Ġd rain +li se +li ds +un f +un ar +un ov +un ivers +Ġm set +Ġm lab +Ġm ib +Ġm repo +Ġm svc +ra el +Ġe li +Ġe ch +Ġe TH +Ġe je +Ġe uclid +Ġe mergency +() { +() ]), +() `, +() ``. +() }:{ +fi a +fi s +fi res +fi red +ue las +ent in +ent rance +ad h +ad u +co at +co ms +co bj +co alesce +ri r +ri ger +Ġthe Ax +Ġb cc +Ġb less +Ġb ake +Ġb tc +Ġb sha +Ġb ounded +Ġ1 157 +Ġ1 250 +Ġ# ================================================================================ +11 92 +11 96 +11 40 +11 68 +um ulative +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +id un +id ate +id ump +id Name +id ia +Ġ( (* +Ġw el +Ġw tr +Ġw cb +Ġw ife +Ġw olfram +Ġw szyst +ch t +ch ure +te la +di gram +def ect +def ining +): # +and ar +ata k +ata form +Ġ[ # +ma ine +ul ars +Ġimport able +], ), +ck d +el lo +el der +el ite +el ens +el bo +': '. +es peci +es ults +ĊĊ ĊĠĠĠĠ +ĊĊ Ċĉĉĉ +is c +is u +is se +is ch +is new +is Connected +is crowd +is Staged +is disjoint +val ds +val ide +val ences +__ == +__ )[ +get ti +get line +get float +get Index +get Context +get Conf +get Nodes +get Edge +get TrackbarPos +one st +(' $\ +(' [\ +(' ----- +)) % +)) [:, +)) [- +set C +set diff +set Standard +set Expression +ĠT D +ĠT y +ĠT LD +ĠT rend +ĠT ICK +ĠT angent +il ent +con an +con ce +con ju +Ġ2 000000 +(" ************************ +') # +') [: +') }" +as cent +as gi +as yl +iz a +op las +op ixel +op otential +Ġ{ # +Ġ{ - +Ġ{ :, +Ġis First +Ġis Match +Ġ7 99 +Ġ7 36 +ĠS s +ĠS x +ĠS or +ĠS up +ĠS ine +ĠS eat +ĠS cor +ĠS EX +ĠS tick +ĠS MC +ĠS CR +ĠS CM +ĠS cores +ĠS MAC +ĠS NI +ĠS ensing +ĠS KU +ab ba +ab olo +ĠC onse +ĠC AM +ĠC ron +ĠC IM +ĠC ream +ĠC VE +ĠC ros +ĠC hole +ĠC odon +ĠC lyde +ĠC rawl +ig ue +ht od +up dat +Ġg def +Ġg lib +Ġg att +Ġg NMI +for a +for count +ter ra +ter ate +ter ritory +Ġr ct +Ġr ue +Ġr name +Ġr data +Ġr list +Ġr pt +Ġr ans +Ġr max +Ġr start +Ġr cc +Ġr pn +Ġr ural +Ġr mg +Ġr lb +Ġl ucid +end urance +data Access +data science +ĠA th +ĠA ust +ĠA lig +ĠA OI +sp ices +'] ]= +01 87 +01 57 +01 66 +01 47 +01 79 +01 0000000000 +Ġcon solidation +am at +am yg +to i +to w +99 73 +par as +par ity +path To +ist ente +ĠF AN +ĠF ee +ĠF ederated +ĠF resnel +sc n +sc apy +qu als +qu ater +qu anto +qu arters +log ue +log print +om ing +om ena +Ġh atch +Ġh av +Ġh undreds +all on +po a +ĠP ump +ĠP reset +ĠP CRE +ĠP illow +ĠP Ann +ĠP uzzle +ĠP urification +Ġas df +ĠI z +ĠI CU +file size +file Type +file paths +ĠL ake +ĠL LR +ĠL ENGTH +ĠL ikes +res ion +res izing +tr j +Ġst un +Ġst iffness +Ġde ss +Ġde ls +Ġde si +Ġde sig +Ġde cryption +Ġde xp +Ġde dication +Ġde vido +pro ceed +est ine +est ablished +Ġ""" ), +pt f +fig height +fig Size +Ġ3 98 +10 27 +10 48 +10 54 +10 51 +out Name +out spec +ĠD L +ĠD ell +ĠD FT +ĠD emon +ĠD HT +ĠD RV +ac loud +ac ronym +Ġu st +Ġu cd +Ġu dr +]) # +]) [: +]) """, +]) != +Re ar +Re load +Re ach +Re jected +Re cursion +Re tire +Re packer +sh x +sh ine +sh irt +sh chyna +sh ipyard +Ġdata Name +Ġdata hub +Ġdata cube +ĠM r +ĠM s +ĠM art +ĠM AR +ĠM ight +ĠM ont +ĠM pr +ĠM oment +ĠM ike +ĠM inecraft +ĠM CTS +nt arget +time scale +if s +key len +key map +key pad +key typed +xf sm +=" ï +=" ]) +=" '+ +=" *") +Ġv f +Ġv h +Ġv es +Ġv ig +Ġv inf +Ġv ÃŃ +Ġv stations +02 84 +ew c +ext langs +Ġy int +Ġy ang +Ġy Data +Ġy range +Ġy lb +Ġy oke +Ġy grafico +ĠO doo +ds a +ds on +Ġx key +Ġx ys +Ġx api +Ġx lb +Ġx ena +Ġx rng +os at +Ġse gy +Ġse titem +Ġma ptbx +que en +test results +test steps +Ġor ion +Ġor dem +add Node +add Location +add Tests +add Both +ject ure +ER GY +IN COME +IN VOICE +Ġel s +Ġel la +xb ch +xb bo +ure n +1111 011 +Ġme ow +Ġme ets +Ġme todo +Ġme tod +---------------- ------ +Ġfile Severity +Ġpro pos +Ġpro state +ens ate +py datetime +py pa +py mysql +py annote +pre e +pre st +pre print +pre Tasks +ls on +ap aper +07 08 +07 88 +07 85 +07 45 +ang ler +ES TR +Ġbe ep +ĠB s +ĠB ir +ĠB ass +ĠB lood +ĠB asket +Ġos geo +12 17 +12 24 +12 89 +12 933 +ĠE G +ĠE ver +ĠE ta +ĠE OL +ĠE CS +ĠE MG +Ġj v +ime o +ob an +text pad +AT GCT +Ġ) ;\ +low pass +ĠN I +ĠN X +ĠN EXT +ĠN MF +ĠN okia +}, {: +ir ks +ir atio +len X +len Y +bo ify +Ġ4 07 +Ġ4 66 +Ġ4 47 +Ġ4 83 +Ġ4 59 +Ġ4 095 +ff n +ff s +ff nn +lu ent +92 16 +92 88 +92 95 +92 66 +92 50 +92 62 +In cid +In formações +In coherence +ind f +append only +ĠR yan +mo ver +mo od +mo gor +mo eda +ep hemeral +Ġun loaded +Ġun modified +Ġun pickle +Ġun deploy +Ġun mute +Ġun ivariate +Ġun iversity +Ġun ichr +Ġtest plan +lic as +ĠG lass +��G ust +ĠG IM +ĠG lonass +Ġco q +Ġco vs +Ġon mt +EN EF +EN ZA +EN GLISH +ĠW elcome +ĠW WZ +ho les +ho ugh +Ġout data +Con former +Con vective +bu tils +ĠV H +ĠV N +ĠV V +ĠV iz +ĠV ic +ĠV pn +ĠV ali +ĠV ella +ĠU R +ĠU RDF +ry an +Ġnum ls +Ġ5 25 +Ġ5 56 +Ġ5 30 +). ' +ib an +ib mq +Ġan vil +Ġ__ _/ +Ġen ame +Ġen couragements +che mic +ator ia +Ġtime spec +Ġtime Var +Ġ> / +18 19 +16 13 +16 22 +16 53 +line count +sa f +sa k +sa ac +Ġk z +Ġk ub +Ġk ir +Ġk ale +Ġk ong +Ġcol names +Ġro p +Ġro ads +St or +St ored +St uck +St ories +Ġpy com +Ġpy cuda +Ġpy fftw +config Path +config uring +config urable +Ġ6 32 +Ġ6 25 +Ġ6 04 +ag as +ag ios +ts q +04 09 +Ġmodel grid +13 13 +13 83 +13 39 +13 78 +13 51 +lib psd +lib rosa +06 02 +06 07 +06 15 +06 72 +Ġwh is +ll hr +class ifications +15 78 +15 59 +15 908 +ST ONE +100 7 +100 103 +max length +max Total +max heap +05 12 +05 67 +Ġthis item +03 17 +03 84 +03 53 +03 462 +Ġint end +Ġint uitive +we bui +uti ae +ip fs +Ġch ilds +Ġch romedriver +17 00 +17 11 +17 02 +17 14 +17 98 +17 42 +17 39 +17 72 +Ġal ib +Ġal umn +Ġal oha +93 86 +93 56 +93 82 +14 32 +14 33 +14 82 +14 58 +ari ma +Ġpre co +Ġpre fs +Ġpre serving +Ġpre pended +ne opo +Ġ/ $$ +ok i +Ġby e +64 17 +64 55 +64 86 +right word +Ġob spy +enti sts +Ġra iz +Ġ[] }, +Ġ[] }) +([ __ +:// ", +iti e +RE PE +RE POS +RE LOAD +RE VISION +Ġtra pezoid +IC F +IC ATED +08 32 +08 16 +08 08 +08 65 +08 62 +main file +main frame +main menu +ty t +ty per +Ġ\ __ +ĠH PO +ĠH yp +ĠH DU +ĠRe v +ĠRe base +tain ment +sub systems +sub portal +Ġ{} - +Ġ{} ...'. +ml Scene +lob e +eri alized +mat t +mat ron +Ġsh ops +Ġsh arded +Ġdi ss +Ġdi bu +Ġdi xel +sk ie +df b +df List +work shop +88 32 +88 42 +19 80 +output Directory +comp iling +comp acted +Ġsc m +Ġsc rolling +Ġsc raping +34 61 +Ġ[" __ +Ġ[" {}/ +uil la +Ġwe ave +09 04 +09 64 +ĠIn s +ĠIn compatible +ĠIn dustry +ask ed +by Area +Ġle an +Ġle xe +result N +24 81 +24 51 +37 72 +Pro vince +em scripten +point ing +point list +point Format +ark ed +Ġsub model +Ġsub total +Ġsub project +Ġsub modules +yn ew +rep ancy +rep laces +AM F +96 92 +96 37 +96 94 +96 66 +Ġac q +Ġac cordance +Ġcomp ressor +Ġcomp arator +Ġcomp romisso +aliz a +aliz ada +ĠCon n +55 87 +55 75 +55 35 +94 03 +94 77 +94 65 +94 48 +Ġ} },{ +DE PRECATED +RO LES +node id +node Id +Ġlabel dict +row wise +av ro +av ity +av ily +Ġno server +87 48 +87 54 +no o +Ġclass room +exp m +exp lained +CT TC +Data Value +Data Module +Data Layer +Data Store +Data bricks +Data Importer +AS R +Ġla cks +85 00 +85 07 +97 22 +97 73 +rid x +back Auth +{} ; +{} @ +net box +================ ======== +36 24 +36 77 +36 82 +36 58 +36 59 +36 69 +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +but ing +ron i +ron o +ron Emails +Ġopen pose +Ġopen shift +ĠK d +ĠK CS +ĠK aggle +95 16 +95 09 +95 96 +95 78 +word le +view Offset +Ġcont aminated +run ing +run dir +86 2745 +Ġmax X +Ġmax Overlap +mon omials +Ġdate parser +Ġz cond +Ġz idColName +################################ ############ +process Events +default skin +57 84 +57 67 +57 74 +Ġhelp Text +Ġ! \ +Ġ[' " +Ġ[' \ +Par as +Par cel +Ġext ents +Ġext ending +Ġext erior +Ġ| -- +Ġ| _) +create Child +create TextNode +"), ( +IS P +IS OT +reg ret +Ġtf ssa +ix in +ix ar +Ġbo ids +Ġbo ston +do h +do ing +do xy +parse String +au kee +spe ckle +Ġne i +ele metry +Text Line +Ġfil ing +Ġfil eno +env var +List ening +current Time +CO IN +tle ment +color space +color Test +color ado +color Space +upp y +man hattan +ach y +Ġlo h +Ġlo o +trans fo +trans mat +AC ON +AC GT +Ġcheck first +Ġstart Y +Ġli d +Ġli es +Ġli ber +44 13 +44 35 +44 83 +44 41 +44 61 +Ċĉĉĉ ĠĠĠĠ +utf low +Ġdis cart +Ġdis appear +AP IT +75 66 +new Value +Ġtext type +Ġrun as +Ġrun py +ef fic +']) / +En ables +Co sts +Co oldown +Ġend loop +Ex am +Ex press +Ex ercise +raw File +so x +cal ifornia +56 92 +go vt +98 25 +98 26 +Ġsp ring +Ġsp lash +38 91 +my app +Ġmin X +Ġmin DF +pop in +ĠUn like +ĠUn iswap +Po ses +Po ols +Ġ(' *', +Ġ(" {} +uc ion +Ac ronym +be b +be it +ĠQ Action +ĠQ Calendar +img type +target Cells +35 99 +35 07 +35 25 +35 88 +35 09 +35 26 +35 47 +35 46 +ref purpose +Ġus a +File Names +File Texture +bs olar +AD P +AD RESSE +Ar rows +Ar mor +Ar ffRow +save Image +save As +Ġtarget Attr +))) # +ĠSe ason +Ġad opt +Ġad mitted +45 99 +45 18 +45 93 +45 94 +45 49 +77 10 +77 66 +77 72 +PO W +PO DO +PO GOProtos +attr getter +ql U +the th +ide os +Ġerror ed +Ġerror Message +Ġdistri b +ĠY an +ĠY ang +Ġinter sects +ä¸ ĸ +Ġspeci ally +ĠX code +CH IP +47 22 +47 96 +initi es +]] } +csv path +101 8 +action Entity +ĠEx erc +tf m +Ġload module +Ġload CSVName +ash i +Set point +Set List +Set Size +Set FileName +pl anned +cord inate +Ġreg ards +Ġreg istrar +Ġreg ião +50 32 +Test Config +')) ): +')) )) +HO I +HO O +Ġser o +83 86 +Ġevent Type +Ġevent Id +Ch ance +Ch apters +Ch inese +wh ale +UN ION +UN USED +UN CHANGED +gen i +gen code +ĠIN I +sg n +rt na +rt tm +82 02 +82 12 +82 94 +host names +order Type +Ġar q +iter text +46 05 +46 95 +46 38 +46 81 +ĠJ C +ĠJ uniper +loadText ure +Log Event +Num Str +Num erical +tiv ni +lect ual +DI ALOG +Ġ] [' +cp df +open ai +open citations +Ġread Lines +Ġq rels +temp LE +tag per +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ +UL ATE +air craft +To y +To Markdown +CON FI +De al +De former +De cember +exec uting +sign bank +076923076 9 +Time line +Time span +Time zone +Time Profiler +âĢ ĭ +cul ant +65 85 +Ġdb con +43 08 +Ġup time +Ġup coming +Ġcor porate +ĠPro x +ĠPro of +ĠPro metheus +Ġcontin ent +ins urance +vo v +vo le +Ġpoint net +Ġmatch Dict +page size +down sampled +''' \ +48 11 +48 18 +48 93 +48 09 +48 96 +Ġqu ota +Ġqu iver +Ġimg Url +err ar +pass port +iven ess +Ġfirst Screen +Ġfirst CharMatchInd +No Int +total Quantity +mode st +ãģ ¡ +rate Limit +ĠAr go +ĠAr mor +42 09 +TT N +Ġgroup docs +EL INE +Model Request +е ÑĦ +ï¼ ij +mt c +Ġwork spaces +ĠÐ ij +ĠÐ Ĺ +Frame buffer +Ġinst itution +Ġinst anci +post ag +Ġback ed +Ġback bones +ous ly +Get Key +Get NodeOptions +game board +Node Type +ĠPar is +ĠPar ametric +match Tissue +tx ns +tx yz +ny u +Message ID +address ing +Ġsave Data +Ġover la +Ġover writes +bl una +play Id +play ground +================================ ========== +Ġmake file +build out +Descriptor Metadata +aw transaction +Ġchar ged +TO W +ik Handle +duct ance +mer ging +mer gência +54 00 +54 07 +she ep +Ġoff spring +cv x +const itu +74 18 +cmd class +MO L +MO VIE +Ġtop level +Ġ'__ ** +ĠCo hort +01111 01 +73 88 +dis GB +dis LA +dis GA +dis LB +dis MEI +Ġ... ". +String Type +Object Id +Object Group +Com ic +FT A +Comp iling +Ġorder by +Bo ards +send file +ush i +Ġuni ver +next Execution +Form er +Form Field +Response Result +Response Body +over stock +Class Accessor +Input Data +Input File +Input DNA +edge list +Ġsupp lement +State Data +wer k +dist plot +req d +case fold +ãĤ ¦ +ãĤ ¬ +Ġbot orch +User ID +User Manager +Ġman ifold +lim odou +âĢį ðŁĮ +Ġhead lines +queue dJ +ĠDe coding +ĠDe compose +ĠDe compiled +pen nylane +sw im +CA QC +si am +Ġform ulation +sor u +sor ugrup +Exception Check +abs ch +ãĥ Ģ +ãĥ ľ +Access Error +Access Token +Th row +Th umbs +author ship +çļĦ æŶéĹ´ +At ual +unit cell +52 06 +52 05 +52 88 +ĠUser Form +ĠUser Facing +Of Password +QU AN +62 99 +WAR DS +ĊĠĠĠĠĠĠ ĊĠ +ĊĠĠ ĊĠĠĊĠ +Sh aring +ba o +Image Orientation +oken poster +IP SL +:] ))) +Ġtmp Site +URL Error +Ġgraph ite +Ġ". |* +Loc alization +Ġter mios +decode VTEC +SC AR +ĠSet ter +ĠSet Plot +PRO FILES +202 11 +}\ /\ +63 03 +63 87 +Ġoptim izations +CC CA +Inter rupts +72 25 +na pts +åĪ · +åĪ Ĵ +extra cts +Ġtask path +Create LinearProjectile +Ġmy funds +Tx Gap +Ġsim core +Ġph s +Ġsent encias +âĶĢ âķ° +By Request +Client Async +69 05 +mod SecInstalled +App Data +App lying +н ов +diff priv +Fa zer +patch name +Ġmark ov +aa qi +ĠImage Share +Ñģ ли +Ñģ каз +Py Seq +az u +az tec +Ġcsv writer +For Intent +pg id +meta file +Ġmon ty +Ġloc ust +COL ON +tran sect +PR P +PR NGKey +Group By +_{ *} +active state +ĠDE EP +Pre processing +Ġdatabase New +GR AT +web root +++ +\ +Sub type +Sub graphTypes +Sub Equil +ĠAPI Request +af ford +dat var +LOG OPTIONS +NO STORE +Ġparent Is +ĠEn coded +Ġthread List +UP LE +UP AC +Ġì Ĭ +Ġì ĽIJ +('/ ' +GB D +GB K +GB R +Ġcell time +Ġcell ranger +Ġcell setpath +Ġcluster Module +ĠMan ually +training Set +Dis ks +nb t +zip File +Tensor Flow +Ġdir list +Run Config +real Width +Check Info +embed der +Return Code +Token Authentication +Token Lookup +Rule Spec +åħ ĴåŃIJ +price Type +áĥ ¡áĥ +Function Call +sd ss +ĠCheck out +Ġgame ston +display Warning +Ġpick up +GS PC +Ġyield ing +'} ): +'} ]}, +Per fil +Per ceptual +Per ceptron +Or th +.* . +.* / +GET USER +á veis +á fico +Ġinstall Syn +Ġlink ing +Ġstri pe +Ġsend Text +direct notify +imp ath +imp utation +Line Col +Line Color +Ġmer ceedge +"} ]', +Date Formatter +Load Block +cf l +arm our +Ref used +Ġparam ters +'{ :< +Mat lab +Ġ") ": +Ġest udantes +MC MC +SD A +fc st +counter ed +Count ing +vers ible +vers atile +ĠRelation al +mk p +Ġ[- ]") +!! ". +EXT ENDED +cd r +cd na +ling Error +ĠTe mple +ret code +Box Size +So il +ming w +vari ous +vari ety +Mo jo +Mo vies +lon don +å® ¿ +~~~~~~~~ ~~~~ +seg wit +auto encoder +Output Module +rm ul +Ġdisplay Name +Level Behavior +Ġinitial ised +prop name +prop ensities +AIN S +this dir +Ġ---------------------------------------------------------------- -------- +Ġ---------------------------------------------------------------- ---------------------------------- +Met ering +GL enum +Ele ID +Resource Data +PS P +PS NR +GG GC +xF CD +Ġmove chance +ĠURL S +Ġoutputs GT +issue d +issue comment +ĠAc tiv +DR ULE +Ġaut umn +("- "* +128 34 +Ġrot ating +short s +Ġdraw style +cr ude +cr kc +Ġcore props +tile extent +("% - +bn db +Ġprefix exp +Ġdon or +IR q +âĶĮ âĸĪâĸĪâĸĪ +Ġnotice d +Min er +Min Size +Ġregister ing +ĠUp on +xs x +allow een +Struct ures +ratio TL +aut umn +aut of +à® ļ +Task Arg +à° « +hist oric +Ġprevious Utt +volume Type +Ġdat ar +Ġrate map +member Id +Ġcap np +Address Type +fr mt +Cur rX +Cur rY +ĠPre dictions +ĠPre processor +*\ (\ +pa ssage +Ġfast path +Ġfast ai +Search List +ĠPer ceptual +bi jector +ä¸Ģ å¼ł +}'. \ +payload s +Ġfree zer +bind x +ĠAd ult +land m +pd c +ÃŃ stica +ĠRE MAIN +Ġpas sengers +CR C +CR U +'^ [ +force field +ĠAn ki +Ġpop ulação +Ġnamespace d +ĠInput String +bed path +Ñĥ Ñī +Stream Name +enum bers +enum eration +Op in +Invalid Configuration +Over head +stock Mar +Ġcons iders +oto ol +NUM BERS +Ġmultiple tau +Ġauto array +Ġauto encoder +PRE DICTION +л ем +л Ñĸ +ja cob +Ġconv Config +("/ * +("/ ")) +Ġactual mente +Ġæ Ģ +Ġprop het +ĠSub st +ĠSub lime +ĠDis creti +PY PY +Ġlang name +čĊĠĠĠĠ čĊ +čĊĠĠĠĠ čĊčĊĠĠĠ +GO PTIONS +sn appy +ĠOpen MOC +super cell +ĠIP s +SQL ite +Read Write +Classifier Log +ĠHttpResponse NotFound +ĠInter p +ĠInter pret +}: " +Ġside walk +With Fbx +install Status +cb or +Ġbegin ing +ı rak +æĹ § +åį ½ +ĠEN ERGY +Ġestim ating +ĠTH IR +ĠTH IRD +ĠAR CH +Ġgra us +Ġgra ding +Ġgra fana +gl ar +cred def +cred itor +Ġmp ileup +Element List +alt ura +cogn ito +Layer Elements +ĠHTTP CacheManager +EO M +Open ing +Ġcat Jump +Ñı з +Ñı ÑĤÑĮ +Ġinv ite +aff le +Register IncentiveProposal +]} ", +BR ACE +Ġimplement er +dy graph +Python FunctionDescriptor +ĠMy Sum +ĠMy Private +Ġpower api +WE BS +And Compile +Grid View +BB T +DA O +916 5 +916 7 +DIS CARD +dig ite +TA KE +TA KER +Ġsegment ations +COMP ILER +COMP RESSED +permission Name +permission Id +flux err +Batch Received +Batch TransferFrom +poly dets +ĠJSON Response +cert file +NOT FOUND +NOT IFICATIONS +dense net +Transform ations +ĠDes k +sy nthesize +HTTP BadRequest +SN D +SN P +Ġvm f +Ġdrop na +ssl Cert +edit ing +edit ors +Ġп ок +Instance Type +Ne urons +ĠNode List +mg bl +mg xs +ĠSH ORT +ĠSH ARED +}{ :< +Ġperiod LE +ĠNe ver +ĠNew Optimizer +LIST CONTAINERS +exist ed +ĠBy e +Ġcombin er +Ġque en +Ġep ics +rd k +rd class +Rout es +sal a +sal ah +pto mino +tol int +Ġedit able +Ho le +UST ED +ĠDec or +activity Id +FIX ME +VC g +Order Traversal +Interface Type +Ġspect ro +Ġretri ever +ĠDB Name +384 615 +ati co +ĠSp line +ĠSp onsor +Ġhidden Layer +Ġorigin ating +Ġctsp SgaclMonitor +Ġctsp OperSgaclMapping +FC lose +ĠAss istant +Ġpoly fit +king Status +BC F +Iter ative +Track Pt +ĠIndex er +Mark ers +Mark ups +fri day +program mer +episode Separator +Rate Coeff +lis sement +uit ar +Ġnumer ically +Ġprogress Bar +éĻ ħ +Ġxy xy +æľī æѤ +ĠMessage Handler +Multi cast +ĠRandom URI +ðŁĩ ¼ +hy ps +EA U +EA p +archive path +enc ils +Mapping Error +mn fld +ali ased +condition ing +tan ame +Ġvo ids +Attribute Name +ĠState I +ĠMat thew +Ġnoise s +Ġstatic ally +Ġpt b +emp ties +PA ID +adjust able +Files Formatter +ĠId Token +Ġps ds +ĠGL X +Pl anner +1234 567 +ATT CT +ATT ENTION +\' ') +ç½ · +Ġ'" % +ĠAs ynchronous +Begin ning +arc Length +00101 0000 +dz eta +Script Path +Ġbranch ing +XXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXX +(); ' +ĠMax wellCC +501 5 +gri dding +det to +Dep endent +ĠGraph Algos +Ġappend ManifestFile +ĠGoogle Home +ĠModule Type +åĩº ãģĹãģŁ +Ġsy ft +Gen res +Record ing +Ġns lices +Job Status +¬ółģ ¡ółģ¿ +ensemb l +multip lic +IMAGE MESSAGE +IMAGE OPTIONS +æĸĩ æ¡£ +cdbp RealmKnownPeers +cdbp AppAdvFromPeer +sur veys +ĠService Account +Ġexternal Failure +æĪIJ çļĦ +flip ped +Host Ip +Ġfl x +ĠParameter Grid +Feature Vector +news letter +("[ ") +ĠInvalid Operation +fb ps +ĠSimple HTTPServer +ĠPri m +ĠPri vileges +207 2 +203 9 +met atype +Env Var +Ġcast s +315 1 +perm al +Ġrec uperação +ĠFI EL +Ùħ ÙĬ +Ùħ Ø´ +ĠMock Response +LP Z +nu ke +Ġ"[ __ +Ġroute map +........ .. +Power ed +eg onet +Ġdetect ing +ä¼ ģ +225 4 +bt m +asset Name +dw f +Ġfs x +Ġ99 5 +LR K +Ġpot ato +ĠBea con +908 5 +456 8 +hyper opt +ðŁı´ółģ³ółģ ¡ +:{ : +LT L +ste pper +Ġmid as +mas senergize +neighbor distances +tcp x +Ġair lines +Ġpk unit +ĠInt roduction +424 6 +424 7 +ĠOp ti +Ret val +Ġsym metri +Ġrelation Name +åĪĨ éħį +åĪĨ 辨 +Windows Path +00001111 0000 +ĠMet al +Channel Id +Optim ized +Ġaz m +igen omic +reply error +Ġam use +ĠPost s +ĠPost Serializer +Api Server +dark grid +Ġв оз +Remove ContainerMessage +ĠBlock ing +OFF ICE +ĠMark s +907 5 +HI ERARCHY +Ġphase d +[] "},{" +[] "}]," +Ġec g +Poly DP +decoder awtransaction +Active Workspace +å¹ ¿ +å¹ ħ +Build Element +å· ŀ +Dense Layer +Ġâ Ħ +Ġasc ent +PREFIX ES +Ġorgan iser +Tool tip +GC LOUD +808 1 +è¾ ¼ +è¾ ŀ +xl wings +Ġ------------------------------------------------ ---- +Ġ------------------------------------------------ --------- +Li q +æĢ Ĵ +--------- ") +Comple ter +ĠExtra Trees +Modi fiers +п од +п оÑģ +ĠSER IAL +Ġinher iting +webs ites +436 1 +nor r +å¸ ®åĬ© +rich ard +æŶ éķ¿ +Ġн ом +Ġer oded +regular ize +大 éĻĨ +Ġcloud pickle +ĠFree BSD +303 4 +Tun ed +ĠResult Set +aps ule +aux iliar +Simple HTR +quis itions +mysql db +à± ĩ +cg ranges +lig ent +Ġml func +deriv s +deriv ation +redis DB +)+' ;' +395 8 +MIS MATCH +IFI ED +ij ax +§ółģ ¡ółģ¿ +м и +392 8 +impl ant +ðŁı´ółģ´ółģ ¬ółģ +Ġpid file +{}) ". +solve NQueens +Ġboot style +337 6 +aggreg ations +aggreg ators +437 8 +Ġsubmit ter +identi fies +ĠAuto Config +SW T +è§ ģ +']} ), +Ġhex lify +rotate Z +(': : +ภ¡ +Ġ88 2 +ĠMicro Python +425 4 +425 7 +coverage s +anchor Field +das hes +'> { +ĠCar Bay +ĠStorage Helper +ä¿¡ åı· +Ġxs lt +332 1 +332 9 +Transport s +Conn ective +Ġphi Arr +Err back +ö r +ĠOper ators +ĠCloud Error +Qos Statistics +ln k +ĊĉĠĠĠ ĉĉ +Screen ers +408 1 +Acc Dup +SCHE DULE +Basic Preset +ĠAction Result +ĠShow ing +mr k +mr mlScene +ĠDire ctedGraph +Kp V +autog enerated +ĠпÑĢ и +'[ ?] +stand out +405 2 +emo f +emo tions +hu ang +ĠCSV Logger +Inv Cmd +smart s +smart license +å¿ « +Car tesian +sky blue +fv ha +approx PolyDP +ĠContext Manager +Ġbus ca +ADD NODEOPTIONS +364 2 +364 9 +Ġmi pt +("_ ")) +ĠProperty Mock +ĠProperty ParamRegistry +314 2524 +ple cos +æľ¬ 次 +æľ¬ åľ° +Limit Participant +dg ds +Ġsi xth +Full Name +UA AC +ãĥ³ ãĤ° +kn uckles +Prefix Length +çº ¢ +Ġwebs ites +Transformer WrapperDF +Qq F +ç´ ħ +ĠTech nical +LEN BAL +Ġrho i +ìŀ ĺ못 +design s +XL l +Ġaugment ations +çĻ º +REPL ICA +Qy G +due ling +Ġincorrect amente +ĠAT UALIZ +Scene DescriptorMetadata +ORDER ED +çĤ¹ çļĦ +SF PT +bag ging +hc X +Ġuid ColName +Domain s +WC wW +ĠEval uating +Cost Center +Inte grand +ä¾Ĩ åĪ° +sf u +ĠSelect KB +wa ze +Ġbenchmark ing +ĠStop Order +)? ' +Ġtex te +еÑĤ ÑĮ +Pixel Spacing +rn aseq +ðŁı´ółģ£ółģ ¡ółģ +éĹ´ éļĶ +899 05 +Ġlig ne +Raw Data +SIG KILL +Ġhar vesters +ĠGaussian NB +ĠGaussian Broad +osa Casing +ffili ation +Ste el +缮 åīį +ACCOUNT S +ĠCount ing +ĠFa ça +Login View +466 6 +432 4 +OVER FLOW +}$ ") +Ġmk time +ï¼ī ãĢĤ +wu Ew +áĦ ģ +Ġgeom Proj +æ¨ Ļ +Ġ104 2 +Ans wers +mapp able +99999 88 +Security tube +Ġmouse Jump +ìł Ģ +Ġwon der +æ° Ķ +rev oc +ðŁı´ółģ¢ółģ ¦ +ĠAut odockVS +mZ kZ +Note field +Ġrecent Points +ĠFin ancial +ÑĢаР· +STRUCT IONS +zoom s +Ġrecomm enders +Ġrecomm endation +than ol +æłĩ åĩĨ +Ġdesign ated +ĠPart ying +Annot ate +Ġce iling +bla zeface +ê³ Ħ +morph s +osp fL +Ġ{}: {}". +Statement Type +´ółĢ ¹ółģ¿ +Ġfore grad +Ġgap hor +Ġhy ps +Remote Control +docsLoadBal RestrictCm +CENT RATION +Ġbeam Line +ед н +additional Fields +Book marks +Cl ark +éł Ī +Ġsuc cesses +ĠìĿ ¼ +435 1 +435 2 +bow tie +Ġ================= ===== +Ġsun less +dead ends +Ġmul heres +Ġsto ichiometry +AGC AG +#================================================================ =========== +438 1 +LAT ITUDE +ĠCat álogo +physical Value +mw eri +ìĭ ¤ +ìĭ ľë +Ġठ¤ +Ġ µ +Calcul ations +Free ze +dro ps +pal m +tele fone +ĠSto pping +ĠSto cks +Ġste ak +Http Uri +checkbox test +399 3 +MZ ML +cas ses +Schedule d +Schedule Block +pep tide +âĢĿ . +TI FF +van ia ++) $", +Ġintegr ations +Ġintegr ating +ĠLim its +×Ļ ×Ļ×Ŀ +Ġfee Cost +ĠChar Field +Boolean Expression +"^ [ +"^ __ +ìļ ¸ +MARK ET +ÅĤ o +ÅĤ ÄĻ +Arch ived +âĢįðŁĴ » +æĪij çļĦ +Fe bruary +ĠCent ers +Fun Cmd +Bus car +Oct o +)# , +)# . +æ¸ ¸ +cros copy +Ġtor rent +Ġspo of +ĠBO A +éĩĮ éĿ¢ +æŃ£ éĿ¢ +Blob Url +éļ ¾ +éļ Ĥ +Ġ134 2 +ĠCS Nodes +об Ñĭ +bracket ed +Initial ise +visual isation +}` " +ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXX +Creation Time +Ġincoming LaneNo +Ok ay +draft docs +xD AD +Ġ#------------------------------------------------ ---------- +Ġ(? : +Ġreplic ated +Hist orical +ema iled +por c +ĠQuest ions +dH V +uá» Ł +vir us +VP Set +Actor TaskSpec +ĠRequires Context +æĮĩ éĴĪ +æ¡ ¶ +éķ ľ +Ġmemo ized +ĠRot atingFileHandler +лÑı ÑĢ +Ġmilli ons +Eg k +Ġ'| ', +Ġveh res +Ġnan ome +ENC ER +101011 0100 +Oj g +dN dz +Ġtl ds +ĠAda BoostClassifier +ãģĮ ãģĤãĤĭ +Gra de +ban ker +mach inery +Ê· i +Ê· iÉĻ +Ê· iu +ĠSat urday +novel s +ADAP T +GENER ATE +çľĭ äºĨ +orator ies +riz ard +Ġham iltonian +inherit Expression +Ġpreserve AspectRatio +Boost Regressor +Uq kU +cool ing +cool warm +SEG MENTS +د Ùĩ +0005 87 +Ġbas arim +ĠMember Id +ç² ĺ +Ġconj untos +464 3 +Cycle s +ativ os +åıĺ åĮĸ +Jp N +_{}_ {}_{}_ +prom ote +PAY ROLL +ç¦ ģ +Ġty po +Workflow Action +Ġ'^ ', +Ġinject or +ĠCy ber +occup ation +Ġíķ ´ +strand Middle +sma pe +ĠÑĩ ÑĤ +ĠÑĩ еÑĢез +Ġins ights +ĠQU ERY +ãģ¾ ãģĹãģŁ +Fri ction +Opts Cmd +eos pecs +交 æį¢ +ĠMetadata Catalog +tas min +tas max +Ġ204 0 +ĠCollection Remove +Ds Map +Hand shake +³ółĢ ³ółģ¿ +³ółĢ µółģ¿ +ĠStatic Objects +ðŁı´ółģ§ółģ ²ółģ +RAT ING +Forward ing +ółĢ²ółĢ ��ółģ¿ +æ¯Ķ è¾ĥ +687896 85 +Ġsubstit uto +ĠExport er +MOV ES +MOV ING +}| [ +ĠEnt rada +NON BLOCK +Ġnib ble +Push AllArgs +ĠÑĥ каз +Ġtup la +ĠSpect roscopic +ĠscaleFactor OfSecondFixedSurface +IDXGI Resource +Act uator +danger ous +Ġul ca +usd Stage +Ġconsu mes +osg Terrain +Ġcamp any +amplitude s +æīĢæľī çļĦ +Kn uckle +Ġ197 0 +ĠBin walk +five thirty +Ġstrength s +proof reader +ĠDig raph +ðŁı´ółģ¥ółģ ¥ółĢ +lv ls +zoo keeper +ĠAir byte +Ġexam ined +ëĵ ł +srcs ys +Equals Foo +ĠSS ASig +Ġtrick y +æŁ¥è¯¢ ç»ĵæŀľ +Sci py +incid in +attri buted +ĠcdbpLocal IpAddr +Ġcomput ador +åĮº åĪĨ +åĮº åŁŁ +Eff Op +ìĥ Ŀ +detailed description +detailed Description +Emp loy +varn am +èĤ ¯ +èĤ » +Manage mement +Future Warning +ona uti +ĠAssert Error +ĠMi ssion +Synth Cmd +ĠCORS Middleware +åł Ĩ +ĠLong Tensor +Ġko ji +Matching Styles +camel case +è© ŀ +Ġtier dict +ĠPER CENT +Ġjog o +Ġblur red +Asc endants +2656 9498 +åĽł æѤ +Radius Arcmin +Ġо ÑĪиб +Break ing +vac ation +ðŁį ³ +Proposal Id +repair s +#------------------------------------------------ ------------- +Sep tember +cdbpLocal Vendor +cdbpLocal Appl +Au stralia +ALI ASES +bic ycle +Ġoffer ed +law rence +Ġ206 0 +ĠSTE PS +ðŁij¨ âĢįðŁij© +Ġsand wich +routine Timer +Dst Addr +Lang FileLines +spar v +plug ret +tB anana +ĠClick House +ĠÚ© ÛĴ +ROT ATE +manip ulator +diffic ulties +ĠCR IT +trait stones +---------------------------------- \ +Ġboost ed +Disp on +haust ive +satis fied +SCO PES +infe ctions +ĠAG ENT +æѦ åĻ¨ +cdbpPeer Vendor +è®Ńç»ĥ éĽĨ +tiny db +atten ded +ĠDirect NotifyGlobal +Ġdatum Leta +Ġfeel ing +Cb Cr +rub bish +Ġ"| " +Ġ"| ". +ĠRMS F +Ġroad bed +CLI QUE +ĠìĦ ł +Ġhess ian +ãģĵ ãģ¨ +!@ !@ +cau ses +Finding Tracklet +Ġmob il +aqu a +hil bert +mort gage +ί α +èŃ ° +Ġfair ly +0025 57 +ĠBR IDGE +ĠBer lin +doub ly +Buy backAuth +æĶ¶ æĭ¾ +ص ÙĦ +orb ance +coll ator +Ġoutgoing LaneNo +Locations Reserved +Ġfoot note +ãĥķãĤ © +ÐĹ Ð°Ð´Ð°Ñĩ +ĠполÑĮзоваÑĤел ей +bomb LocationsReserved +æĴ ŀ +ĠSL URM +ĠBU CKET +ĠStar lette +ĠXXXXXXXXXXXXXXXX XX +,:,:, :], +Ġnex us +Logic Cmd +Ġqc flag +ĠSimulator Event +VSI F +VSI FClose +ĠClo udflare +ĠLu ke +"]* )['\"] +~~~~~~~~~~~~~~ ~ +Ġstackconvert STR +MOT OR +tF ot +íĥ Ģ +Ġdeno ise +Ġdeno ising +ĠPA IE +ĠGPL v +HOOK S +ãĥĩ ãĤ£ +ĠDetect ron +ĠscaledValueOf SecondFixedSurface +twin y +ãĥ¡ ãĥ³ãĥĪ +Ham ilton +candle s +æº ĸ +Ġdomin ance +Ġparalle lism +sketch ycoco +ãĤ³ ãĥŀ +ĠìĿ´ë ¦Ħ +Ġperiodic ity +fib sem +Ġfund amental +Propose AddTaskAdmin +Propose AddTaskOwner +Propose RemoveTaskAdmin +Propose RemoveTaskOwner +8765 4321 +ĠAttr Dict +Ġckan ext +HDF S +MUT ATION +elimin ar +ĠSY MB +Ġserv os +çĻ½ åIJįåįķ +Ġambig uities +æ¼ Ķ +ĠÑĦ ай +Ġdup lication +ĠTrust ed +Ġhypot enuse +ĠPed ido +ĠHtml Formatter +ĠStratisCli EngineError +ĠStratisCli Incoherence +PIC IOUS +getText Size +ĠEPS ILON +ĠnumberOf Months +OPTIM IZER +({} ), +hin iratio +plat ypus +atmo sphere +Ġ'~ ' +ĠSpider ApiException +refentry title +sira ble +Ġphysics ClientId +åĢį æķ° +Miss ile +mU wG +Ġelection date +ĠFar mer +Ġthrust ers +ĠOrient DB +pyx ll +ugue se +)+"\ " +ç»´ 度 +Ġbur st +CDOT AResponseQuerySerialized +Ġне обÑħодим +Ġnucleoti de +hrep rl +Ġ"> ": +Ġben ches +Ġben efit +MLP Policy +SYN TAX +ĠÑĩиÑģл а +ĠOk ta +ALIGN ED +Listen Port +Ġglm fit +Weak Method +ĠSTATIC FILES +Twitter Service +éŁ³ é¢ij +ĠCts Acl +ĠRegistration Form +AndWait ForIntent +ìĺ¤ ê¸° +tZ ucchini +reconstruct ed +still ma +Ġdrag Data +ĠLif ecycle +ĠIC MP +Ġvul ner +Ġvul nerability +Ġneuro lib +Ġìľ ł +Ġoccure nce +SEGMENT IO +YUV Pixel +ipe lago +èį ī +ĠPseudo DojoFamily +Ġasynchronous ly +ĠRAD IUS +ä¼ĺ åħĪ +Categorical Dist +Ġsau ce +abstra ction +Ġenh anced +Ġopent elemetry +Moving Average +IDXGIS urface +Tro uble +orche strator +ĠCached PropertyParamRegistry +ĠUC SC +Ġatri but +larch dir +Ġawk ward +Enhance ment +åİĨ åı² +اد ر +Utter AndWaitForIntent +è£ħ 饰 +RABBIT MQ +ÈĻ i +Ġ"~ / +Ġmé dia +Ġthumb print +ĠBr ute +emoj is +POMERIUMSERVICEACCOUNT REQUEST +Dns Server +00010011 000000000000000 +templ ated +ĠCam ada +igmp Count +nthes izer +ĠInvert ed +'])+' ",' +greet ings ++\. ?\ +consider ed +æ¸ħ çIJĨ +[\\/ ]. +basket ball +è¸ ª +arri ved +Ġconsum ing +Ġshar py +Ġconfigura ções +Interactive Session +Mutable Mapping +Sho ck +Ġath lete +ĠLos ses +Ġ______ _ +áĥIJáĥł áĥIJáĥ¡áĥ +Ġplex api +quar tile +ĠEVAL UATE +ãĤŃ ãĥ¥ +à°¬ à°¡ +Ġovlp s +OCT AVES +Wal ker +dop out +chicken pox +travers als +ANNOT ATION +Ġtempl ated +APIS chema +MULTIP LIER +Ùĩا ÛĮ +Appear ance +èĹ ı +Ġcyl indrical +opend ap +Ġ--------------------------------------------------- # +è§Ħ æł¼ +Notebook Difference +FbxNode Attribute +Ġë³Ģ íĻĺ +Ġiop rinter +Ġnue va +ĠMPC ORB +ENCODE D +课 ç¨ĭ +ê°Ĵ ìĿĦ +æ°£ 毬 +CWD MC +ĠWINDO W +comic Name +ecal ho +Ġapple seed +Ġneck lace +CREDIT S +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +debt or +ĠFurther more +ĠVs Ss +ðĿħ ¥ +SUS PICIOUS +gir ar +ĠESS C +Ġaval ible +Ġquar tile +guar dian +Ġelectrode Positions +Ġдан нÑĭÑħ +lensfun py +Wik idata +ĠCe CILL +Produced Value +âĢįðŁļ Ģ +AccessKey Id +ĠDEP LOY +ServerInfo Response +Ġadminist rador +ĠOverflow Error +å¥Ĺ åĪ© +Ġ'$']],[[' $', +gkl ss +imme e +ĠMEN U +pydev d +Insecure RequestWarning +Anneal ing +Ġë© Ķ +Ġæ£Ģ æŁ¥ +/>` _ +èªŃ ãģ¿ +HealthCheck Options +Hflow UMan +NLL Loss +ð¨ ļ« +istra ils +ĠDerived Level +Ġobvious ly +Ġsubscri bing +Ġspa Cy +ĠDescriptor s +еÑĢаÑĤ ÑĥÑĢа +Highlight MenuItem +ĠìķĬ ìĿĢ +æ´» åĬ¨ +rasp berry +endOf LoadBlock +ĠMID I +ĠMich igan +ĠNinja BuildElement +Ġtrabal ho +wordtag counter +Activ ations +Uploaded File +ÑģÑĭл ки +StreamEncryption Property +THRESHOL DRULE +ĠзапиÑģ ей +çª Ĺ +ĠBright side +Ġpret tify +solicit acao +MAINT AINER +ĠQuat To +ÙħÙĨ ابع +çĪ¬ èĻ« +GRI F +tM oringa +listPieces White +ĠMic hel +ĠVOL UME +omestic HotWater +WEAP ON +ĠMocked Boto +ĠíĨ łíģ +Ġâľ ĵ +ĠReferenced InheritingObject +Ġpalav ra +ĠDISTRIBUT ION +Ġíĺķ íĥľ +ĠVoiceActivity Version +Cidr Ip +Vapor Pressures +gals pec +vts Display +alco holic +Ġpes os +ĠTic TacToe +ĠTiles Converter +ál culo +ĠAPIS erver +Ġsteem rewarding +anonym ized +ĠNBPKG INFO +Ġtiff file +('= ')[ +ĠNico las +FALL BACK +ĠfilterStatement Entry +decodeBinary Int +Ġпол ной +originalEgg RotBBox +ØŃÙĪ اÙĦÛģ +ĠíķĦ íĦ° +chau dh +ĠCUT Status +erez Comp +COOR DS +Universal Diff +ToRet ain +TransactionEvent Info +GMTCLib Error +rawData Repacker +DATAT YPE +огÑĢаÑĦ иÑı +Ġpedigree Cells +Ġtti immee +Ġmountain s +9218108178 557 +ĠSEQU ENCE +109100 129 +Landmark Locations +Ġconex ão +ĠдÑĢÑĥзÑĮÑı Ñħ +tWater melon +ĠPron oun +ĠEstab lish +Ġpywin auto +ddu Consumption +LEAG UES +interlace d +ĠConversation Handler +longcmd string +ĠUnitModel Costing +ĠPreTrained Tokenizer +SearchSpace Name +Ġæ³ ¨ +Ġæ¸ ħ +Vermicul ite +ĠMultivariate Gaussian +Ġsolv ated +Princip alsResponse +ĠпÑĢог ÑĢамм +Ġ×¢ ׾ +ĠíķĻ ìĬµ +0000011001010101111 11101 +ĠAVAIL ABLE +AOI cor +Gnu Indicators +Kern ingGroup +kou fu +qit argspec +isal num +Ġtopos ort +Ġ{{} }'. +Ġconflow gen +Ġygg drasil +PROTON ATED +ĠEXPI RED +royal blue +ContainerDeployed Options +Ġutter ances +IdentityPool Provider +MULTIC AST +streamp lot +оказ аÑĤÑĮ +LERE QUEST +ĠCoinGecko API +lichtungsbeho erde +BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiKAGoUCgUCoVCcYmh BKBCoVAoFArFJYYSgAqFQqFQKBSXGEoAKhQKhUKhUFxiKAGoUCgUCoVCcYmh +Hinds ight +buna ÅĤ +å³ ° +unra isable +ĠAlib aba +INFOR ESPONSE +ĠGAM MA +ĠVoucher Type +libvul pes +Ġdissip ation +ALTERN ATIVE +orsma al +PRAG MA +áp ida +UniProt KB +boltz mann +Ġmistran scribe +parentes co +Fundamental Types +11011111111001000000 011 +Ġperiodi cally +djske letor +gordons Model +vtec Mode +±Ħë ĦIJ +Ġ'------------------------------------------------------------------------------------------ ' +setStandard Buttons +ĠChole sky +Ġrmg py +Ġrlb ench +mogor ov +chemic als +ĠQCalendar Widget +PODO PTIONS +actionEntity Set +tivni Gumb +NoInt en +queuedJ obs +ĠUserFacing GraphQLError +ImageOrientation Patient +aaqi hh +ĠparentIs Class +Ġgameston k +ĠinstallSyn Apps +ĠpreviousUtt Same +ĠREMAIN S +stockMar ke +ırak ı +ĠMyPrivate Cloud +LISTCONTAINERS OPTIONS +metatype s +ĠSelectKB est +ĠGaussianBroad ening +ospfL sdb +fivethirty eight +Managemement Zones +26569498 055 +VSIFClose L +ãĤ³ãĥŀ ãĥ³ãĥī +ĠStratisCliIncoherence Error +áĥIJáĥłáĥIJáĥ¡áĥ ¬áĥĿ +ĠíĨłíģ ° +ĠUnitModelCosting Block +! / +! ')) +! \\ +" ([ +" /{ +" ;\ +# ================================================ +$ $\ +$ ^{- +% ;"> +' __ +' '), +' + +> ? +> } +> ": +> ... +> %( +@ ! +@ ", +@ (\ +A way +A FIO +B end +B RI +B IB +B ell +B ASIS +B ench +B NET +B GP +B attery +C ot +C name +C as +C able +C ls +C iv +C ron +C ele +C raw +C PC +C BA +C lar +C ASH +C ensus +C linton +D un +D il +D as +D mass +D NB +D une +D WR +D hw +D molar +E mit +E AB +E PP +E lite +E bookInfo +F ul +F List +F orth +F VC +F yu +F izz +F ashion +G AL +G BU +G OB +G angSTRCall +H ad +H ill +H AB +H mac +H ints +H oney +H STS +H askell +H ISEQ +H WND +I df +J c +J m +J ak +J ones +J pn +K nn +K now +K iki +K IA +K aggle +K itchen +K elurahan +L ar +L prob +L SH +L emon +M RI +M Vi +M over +M ORE +M NR +M WT +M fj +M aria +M CObj +N am +N ub +N ob +N ak +N QU +N TER +N ao +N MR +N itr +O ak +O WS +O Ag +O utflow +P our +P HE +P las +P PI +P atches +P MT +P MAN +P WA +Q SO +R à +R us +R data +R ace +R nn +R ACK +R ICS +R ussian +S on +S sh +S tp +S GT +S queeze +S aves +S FIXED +T on +T ig +T pro +T rent +T ou +T input +T output +T ies +T MPL +T reatment +T BD +T UMan +T aylor +U net +U CI +U ENCE +U ETYPE +V AT +V ATION +V oucher +W ED +W SS +W qV +W atched +W illiams +W DItem +X d +X Interface +X ilinx +Y an +Y et +Y OU +Y nJ +Z score +Z STD +Z ENO +[ ]) +[ [\ +[ ()] +[ ÃĹ +\ , +\ '] +\ '. +\ "} +\ ")\ +] -- +] ({ +_ ))) +_ [:, +a ix +a parser +b time +b ff +b dd +b att +b proposal +b JZ +b fnc +b reathe +b redde +c ld +c arr +c sts +d ce +d od +d ds +d cs +d lat +d pr +d sets +d ynam +d FR +d aniel +e ing +e bug +e bb +e uclid +f de +f eld +f rc +f lour +f dip +f etches +g A +g H +g N +g P +g S +g Z +g ation +g il +g mk +g ages +g umb +g modern +h T +h ame +h ly +h ne +h ak +h ps +h box +h umi +h ues +h vr +i X +i list +i est +i Reg +j ing +j ada +j UY +j amin +k C +k P +k om +k pt +k und +k nx +k yper +k dc +k Wh +k ras +k eto +k atz +k raken +k endall +k obieta +l O +l Q +l R +l X +l name +l ators +l orem +m K +m O +m me +m file +m ang +m ull +m fr +m angled +m anga +n li +n ion +n xb +n step +n sen +n ão +n wb +n ogram +n hood +n Samples +n ubar +o Z +o ab +o vo +o Bu +p T +p un +p max +p unc +p FI +p af +p vals +p wn +p loidy +p NumClassInstances +q M +q ls +q config +q FQ +q dD +r Z +r ush +r svps +r ftc +r lowtohigh +s L +s Y +s xc +s url +s lit +s dt +s Di +s bc +s ÉĻ +s Container +s Äħd +t ms +t ref +t Property +t Connector +t Tenant +t SetPoint +u J +u P +u able +u dim +u á +u Ãł +u XL +u acao +v A +v ne +v Down +v tu +v archar +w ol +w sp +w ks +w rf +w Val +w heat +x ent +x lf +x mpp +x Mid +x Pae +y P +y la +y ue +y man +y esterday +z B +z O +z S +z an +z os +z by +z hat +{ %. +} + +} "\ +} >' +} ° +¡ æľī +« ółĢ +« æıı +¬ ¼ +¶ ółĢ±ółģ¿ +· '), +½ ÕŃÕ¡Õ¬ +¾ çħ§ + ª +à IJ +Ä § +Õ ¬ +× ĸ +Ø ¢ +à ½ +è ij +í Ĥ +ð ¯ +č ĠĠĠ +Ġ ĊĊĊĠĠĠ +Ġ vide +Ġ ĊĊĊ +Ġ âĸĪâĸĪ +Ġ 840 +Ġ ]). +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ è¡Į +Ġ âĸĪâĸĪâĸĪâĸĪ +Ġ ï¼Ī +Ġ è¿Ľ +Ġ åı¯ä»¥ +Ġ ä¸ŃçļĦ +Ġ æĪĸèĢħ +Ġ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +Ġ 示ä¾ĭ +Ġ ÚĨ +Ġ åİ»éĻ¤ +Ĥ '), +Ħ Īë +Ī ï¸ı +Ĭ éĻ¤ +ij IJ +ķ '), +ķ ï¼ +ķ ï¸ı +Ĺ ç¤º +ľ Īï¸ı +ĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠ ĊĊĠĠĠ +ĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠ +in sp +in order +in divid +in verter +in dication +in lined +er d +or u +or else +on ne +on HighlightMenuItem +at ro +at ie +at tk +at onic +re i +re ta +re label +re loc +re class +re ns +re fid +re bind +re tire +ĠĠĠĠĠĠĠ ĊĠĠĠ +ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +se cur +st ing +st da +st pg +st illa +st sci +st airs +en ny +en ia +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +Ġt in +Ġt pe +Ġt name +Ġt us +Ġt type +Ġt ray +Ġt dict +Ġt lim +Ġt dl +Ġt acker +Ġt ambi +ar py +ar ff +ar dian +ar cade +ar ques +ar sten +al axy +al saaudio +de u +de er +de es +de gs +de bs +de project +de ets +de generate +de precate +le cular +le akage +le aders +an se +an image +Ġi ch +Ġi os +Ġi stem +Ġi StopIso +Ġi StartGrd +me c +me ha +me TRN +Ġ' "\ +Ġ' {\ +Ġ' ```' +ro st +ro Mapping +ro ism +ti te +ti pos +ti cc +ti led +ti emp +mp e +Ġc D +Ġc arg +Ġc min +Ġc ere +Ġc ave +Ġc cl +Ġc xx +Ġc opt +Ġc dr +Ġc atches +Ġc dk +Ġc bc +Ġc wr +Ġc ancellation +Ġp ig +Ġp sp +Ġp size +Ġp lu +Ġp ll +Ġp ik +Ġp fs +Ġp bf +Ġp expect +Ġp ony +Ġp aga +Ġf al +Ġf he +Ġf def +Ġf oc +Ġf format +Ġf wave +Ġf wr +Ġf ichi +Ġ" --- +Ġ" != +Ġ" ..") +he p +## \ +it ert +it ario +it unes +it helial +Ġa str +Ġa book +Ġa hat +Ġa ffix +Ġa sci +Ġa meric +Ġa dicionar +Ġa voids +Ġa dequ +lo ci +lo ps +00 32 +00 17 +00 27 +00 82 +00 190 +ge ck +ge eks +ge psg +ort o +Ġn po +Ġn states +Ġn ano +Ġn grams +Ġn tok +Ġn odo +Ġn Samples +Ġn ginx +Ġn ulls +Ġs rom +Ġs as +Ġs ó +Ġs ugar +ut om +ur r +ur are +ur ora +ur wid +ss um +ss cores +Ġin Pos +Ġin verter +Ġin variant +Ġin tial +Ġin efficient +Ġin feasible +Ġin sufficient +Ġre j +Ġre tr +Ġre version +Ġre starts +Ġre scaled +Ġre mapped +ing Event +ing hua +ame hame +Ġo hem +Ġd L +Ġd ht +Ġd all +Ġd art +Ġd size +Ġd ff +Ġd ass +Ġd bg +Ġd dt +Ġd sets +Ġd ram +Ġd hi +Ġd lite +Ġd uf +Ġd odge +li as +li ff +li atu +ct xt +pe i +un def +un read +un pickle +un supervised +un restricted +un projected +un igrams +Ġm all +Ġm md +Ġm uc +Ġm si +Ġm mr +ra ces +ra sa +ra dd +ra mi +ra sing +ra shed +Ġe ml +Ġe els +Ġe vecs +la f +la ware +la uc +la ining +() }]', +() <> +ue la +ue ling +ad t +ad mission +co add +ri v +Ġb ol +Ġb ang +Ġb ass +Ġb ak +Ġb dist +Ġb lan +Ġb ryant +Ġb bndb +Ġb ırakı +Ġ1 011 +Ġ1 026 +Ġ1 883 +ed alize +11 27 +11 24 +11 29 +11 81 +11 62 +um os +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +id algo +id KickOffset +Ġ0 105 +Ġw u +Ġw age +ch ants +ch ances +ch atterbot +te ls +te vent +te osat +di er +di ers +di ment +di os +di cc +di gal +di visible +di cities +): : +): ]) +and l +Ġ[ ])] +ma cd +ma stad +ma hotas +ma ptree +ul aries +== =\ +], :] +Ġif s +Ġif name +Ġif Table +ot r +ot yp +Ġfor bid +"" ": +"" """ +el en +es cap +turn on +ode te +ode sk +is play +is Empty +is posable +val ent +val ve +val grind +__ =" +__ }') +get able +get Var +get Instance +get LevelName +(' #### +(' '), +(' ([ +(' ')) +(' ------------------------------------------------ +(' (', +(' ---------- +)) == +)) }}[( +set Window +set Min +set genes +set Slider +set Edge +set Horizontal +set Taxon +Ġ- ") +Ġto s +Ġto oth +ĠT G +ĠT a +ĠT it +ĠT ur +ĠT am +ĠT ray +ĠT ape +ĠT eff +ĠT RY +ĠT RA +ĠT Schema +ĠT iming +ĠT TL +ĠT aking +ĠT ABS +ĠT Docs +il de +il Bert +il lino +th a +th us +us u +us dt +us band +us dc +str in +str ange +con tag +con served +con forms +con serve +Ġ2 080 +(" == +(" ---------------------------------------------------------------- +(" ----- +(" ]") +pp oc +pp Samplers +pp ClassInstances +pp ShaderResource +pp ConstantBuffers +as ys +as ia +as Params +arg ate +op al +Ġ{ __ +Ġis Infected +Ġis Highway +Ġis omorphic +Ġis hift +Ġ7 80 +Ġ7 000 +Ġ7 35 +Ġ7 40 +ĠS en +ĠS ter +ĠS ex +ĠS ant +ĠS ock +ĠS rc +ĠS AA +ĠS PR +ĠS LC +ĠS cr +ĠS IR +ĠS pa +ĠS CAL +ĠS keleton +ĠS YN +ĠS till +ĠS IGH +ĠS afety +ab ar +ab ies +ab uri +ĠC ame +ĠC one +ĠC ome +ĠC CI +ĠC PC +ĠC WT +ĠC rown +ĠC ifar +ĠC amel +ĠC ivis +ĠC umulative +ig lob +up re +up ut +") [- +Ġ== \ +Ġdef x +Ġdef ini +Ġg op +Ġg flags +Ġg wb +Ġg unicorn +for c +for ks +Ġr py +Ġr br +Ġr dg +Ġr alph +Ġr svps +Ġl ud +Ġl pm +Ġl orentz +end l +end rec +end ocal +data plot +data Name +ĠA DB +ĠA ged +ĠA ki +sp d +sp at +sp rint +sp out +sp lines +sp ik +sp aring +sp licing +ver key +'] ]]): +01 64 +01 38 +01 39 +01 78 +01 53 +01 52 +01 055 +01 00000000000000 +01 0800 +Ġcon centrations +ic are +ic ano +am or +am us +am end +am ts +to List +to World +to ilet +99 32 +99 05 +99 64 +99 86 +99 28 +99 82 +99 74 +par err +path Checkpoint +ist ure +type check +ĠF d +ĠF sa +ĠF allback +ĠF usion +ĠF aster +ĠF alcon +ĠF ingers +ĠF ederal +od x +od ing +sc ater +sc ente +qu ity +qu iry +log sum +log gamma +log uniform +log Action +vi k +vi ti +vi ate +Ġh po +Ġh item +Ġh ail +Ġh anging +Ġh azards +Ġh uggingface +Ġh abilidades +ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ta i +ta y +ĠP x +ĠP ig +ĠP res +ĠP IN +ĠP cs +ĠP OT +ĠP UR +ĠP rest +ĠP VC +ĠP RESET +ĠP Hop +ĠP acific +Ġas data +Ġas ign +ĠI FF +ĠI MAP +ĠI TS +ĠI muSensor +ĠI UPAC +file List +file Output +ĠL V +ĠL ime +ĠL TR +ĠL ater +ĠL BR +ĠL AMP +ĠL ARGE +ĠL ondon +ĠL ittle +res im +tr k +ize Path +Ġth ru +=' ): +=' {{ +Ġst t +Ġst ix +Ġst udio +Ġst reets +Ġst eady +Ġde pression +Ġde dg +Ġde duplicated +Ġde ficit +Ġde protonated +Ġde cription +pro verb +pro px +pro mpted +pro ulette +Ġ""" # +pt p +pt rain +form Data +form Wd +ex cess +ex its +im on +im list +Ġex poses +Ġex cellent +able Object +Ġ3 37 +Ġ3 61 +Ġ3 800 +args list +ption s +10 99 +10 33 +10 83 +10 82 +10 31 +10 53 +ase c +out filename +out ward +ĠD Y +ĠD ed +ĠD ou +ĠD ave +ĠD OS +ĠD IV +ac io +ac quired +ac ca +Ġu x +Ġu funcs +]) " +]) `. +]) +'\ +ert mgmt +Re ps +Re build +Re member +Re pas +Re construction +Re placing +Re mainder +ite ch +app np +app les +sh as +sh annon +Ġdata Type +Ġdata files +ĠM W +ĠM as +ĠM ec +ĠM ari +ĠM ai +ĠM VE +ĠM á +ĠM PY +ĠM ango +ĠM vir +ĠM ASTER +time ter +time codes +if null +key format +xf du +=" ...") +=" -") +Ġv int +Ġv file +Ġv center +Ġv cpu +Ġv ital +Ġv zf +02 33 +02 97 +02 26 +02 35 +02 76 +02 58 +ext m +Ġ_ ` +Ġy z +Ġy size +Ġy ref +Ġy dl +Ġy yy +Ġy finance +Ġy oung +Ġnp hot +ĠO H +ĠO ST +ĠO dometry +Ġpar q +Ġpar ola +Ġx code +Ġx off +Ġx dot +Ġx avier +Ġse am +Ġma h +ĊĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +test Set +Ġor a +Ġor b +add E +add To +add Attr +add Parameters +add LevelName +add Errback +IN BOUND +Ġstr len +Ġel lapsed +xb au +ange xpr +ore ography +ms on +Ġme w +ON LINE +ON ICAL +tra ctions +Ġfile Type +Ġfile ID +Ġfile Handler +Ġpro tolint +py path +py nq +pre build +pre Components +pre Clock +cess or +cess ion +ls as +ap rf +ap ril +07 27 +07 97 +xd ate +xd ma +xd omain +label map +label Size +label Range +label Format +Ġbe gan +are to +Ċĉ Ċĉĉ +"] '). +ĠB OLD +ĠB attle +ĠB IDS +ĠB ollinger +12 03 +12 20 +12 46 +12 65 +12 42 +12 73 +12 62 +12 49 +12 69 +12 71 +ys z +ĠE z +ĠE MP +ĠE ffect +ĠE FS +ĠE rn +ĠE vidence +ĠE moji +Ġj c +Ġj k +Ġj ed +Ġj ud +Ġj uniV +Ġj ordan +Ġj fscoer +Ġj mespath +ci vis +ob W +ob last +Ġ< {}> +AT GAT +AT BW +Ġ) ] +xa ec +xa ai +čĊĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +ĠN de +ĠN ul +ĠN am +ĠN est +ĠN ER +ĠN ik +ĠN SS +ĠN aming +ir fft +num values +num enc +bo i +bo iler +Ġ4 12 +Ġ4 88 +Ġ4 37 +Ġ4 38 +Ġ4 39 +Ġ4 31 +Ġ4 500 +ger ber +ff a +Ġget Name +Ġget Register +Ġget Args +92 05 +92 27 +92 94 +92 86 +92 47 +92 46 +92 52 +col Dec +In spection +In compatible +In dustry +In stitution +append f +append h +ĠR D +ĠR d +ĠR val +ĠR om +ĠR vec +ĠR PAR +ĠR TF +ĠR CNN +ĠR ising +ep idx +ep hole +ray a +Ġun ip +Ġun parsed +Ġun matched +Ġun observed +OR ARY +fo ck +read Path +read Net +read buffer +lic able +Ġlog lambda +32 27 +per ation +ph os +son y +ĠG em +ĠG Lib +ĠG uess +ĠG enes +ĠG BP +EN CODER +ĠW D +ĠW u +ĠW y +ĠW andb +ĠW illow +ĠW arehouse +ĠW ishing +ĠW illiam +ĠW IDGET +loc ally +Ġout def +Ġout Format +Ġout Heading +Con su +ĠV u +ĠV x +ĠV ert +ĠV RF +ĠV VV +ĠU B +ĠU CS +ĠU ndo +ry p +ry ptor +Ġ5 97 +Ġ5 95 +Ġ5 77 +Ġ5 73 +mb ert +ib atches +ape st +Ġan ts +Ġan uga +Ġan terior +ard b +ard our +min v +min cbar +min kowski +999 3 +ator io +IT A +IT H +Ġtime Distance +Error Config +Error Dialog +18 43 +18 39 +16 95 +16 77 +16 74 +16 49 +16 61 +16 384 +Ġlist as +sa id +cur ium +Ġk at +Ġk pi +Ġk ilo +Ġcol con +Ġcol labor +25 0000 +25 60 +St s +St derr +Ġpy d +Ġpy cs +Ġpy query +Ġpy git +Ġpy click +Ġpy proj +Ġpy MOR +Ġpy perclip +Ġpy echarts +Ġ6 85 +Ġ6 66 +ag h +ag no +04 24 +Ġmodel led +13 14 +13 09 +13 87 +13 77 +13 47 +06 93 +06 75 +06 67 +ll er +class room +15 84 +15 91 +15 74 +SE PT +ST AsIn +ST AsOut +ec ord +ec vl +ec tives +100 9 +max split +05 25 +05 55 +05 95 +05 79 +05 050 +05 7833 +03 68 +03 333334 +jo e +uti ve +ip sg +Ġop c +Ġch urn +Ġch ron +17 25 +17 24 +17 79 +17 59 +17 53 +17 62 +17 61 +17 368 +Ġal d +Ġal gun +dd ap +93 74 +93 78 +14 07 +14 18 +14 35 +14 65 +14 53 +14 52 +14 49 +14 63 +Ġpre T +Ġpre print +Ġresult set +Ġresult Line +ne ff +Ġ/ _/ +ok io +64 06 +64 34 +64 84 +64 36 +right y +right Hand +Ġrange d +'' \ +Ġra x +Ġdefault ArgsBaseIndex +base Aliases +ou los +([ ]). +gra der +gra ding +gra ined +iti zers +RE CL +RE MAIN +RE PLAY +08 11 +08 02 +08 18 +08 66 +main Window +AN IM +AN NOUN +Ġ\ __, +Ġ. " +Ġ. ", +Ġ. ") +ĠH F +ĠH AR +ĠH ay +ĠH ai +ĠH orse +ĠH ORIZ +ĠH CCJC +ĠH wVal +ĠRe c +ĠRe ion +ĠRe load +ĠRe build +ĠRe active +ĠRe actions +ĠRe cti +ay o +sub g +sub directory +sub category +sub protocol +sub elem +Ġ{} / +ml md +lob bies +np s +np lt +][ { +Ġsh it +Ġsh ls +sk it +sk inning +df j +db config +db lock +db Name +mit re +LL ITE +88 34 +88 84 +88 66 +88 76 +ast rec +output Folder +lin ode +image A +image List +ID UMP +ID leta +(( (' +(( .*)\ +Ġsc rap +Ġsc rypt +start X +ree ce +09 08 +09 84 +09 89 +84 32 +84 05 +84 84 +84 37 +84 76 +84 666 +ĠIn tr +ĠIn format +ĠIn Memory +ĠIn dicate +ĠIn secure +ĠIn dust +ION IQ +own Posts +Ġkey gen +ant enna +gs Eg +bin i +bin ario +lock B +lock Unlock +Ġle AG +Ġle aks +ĠThe ir +result ante +Ġax sh +Ġax array +Ġpath To +Ġpath lines +Ġpo f +Ġcom ic +Ġsub elem +Ġsub strates +yn o +96 11 +96 02 +96 32 +96 83 +96 54 +96 68 +96 62 +Ġac cu +Ġac companies +Ġac yclic +Ġcomp ly +Ġcomp laint +ses sed +ĠCon ference +ĠCon nections +ĠCon tractor +Ġall Lines +55 99 +55 07 +94 32 +94 15 +94 66 +94 76 +94 79 +94 68 +Ġcur ation +Ġcur ry +Ġ} " +DE BIAN +json Conf +Name Count +node Count +87 06 +87 62 +no ff +no access +no logies +Ġline color +Ġline Amt +AL M +exp at +exp Info +exp loit +CT EST +CT AList +Data Error +Data List +Data Model +Data center +Data Resource +Data Mdt +AS IA +AS AsIn +AS AsOut +'. * +97 17 +97 36 +97 44 +97 98 +97 58 +97 53 +rid ership +back cast +back testing +back Components +back Clock +net rc +net conf +================ ========== +36 25 +36 04 +36 15 +36 27 +36 23 +36 72 +Ġspe ckle +ron es +=[ [" +=[ {}, +Ġopen mm +Ġid v +ĠK en +ĠK as +ĠK ir +ĠK wargs +ĠK napsack +ĠK elvin +ĠK DTree +95 85 +95 66 +95 83 +95 106 +word wrap +lat t +Ġit k +Ġ'- '. +Ġdist ant +Ġimage process +Ġimage Urls +run pytest +run Interaction +86 64 +86 75 +86 52 +stra uss +Ġmax Y +Ġmax Series +Ġmax numvalues +Ġdate str +fa e +################################ ###### +process able +Ġjson able +Ġjson Data +rit o +AG ER +AG AG +.__ .__ +57 18 +57 25 +57 97 +57 56 +57 35 +57 77 +57 47 +57 39 +57 58 +57 72 +his wap +Ġ[' { +Ġ[' *. +Par is +Ġext ention +Ġext entions +create Test +IS CV +IS BN +Ġtf l +Res Names +ix Y +Ġper ceived +Ġne opixel +Text Utility +List edColormap +current Color +CO ÃĽ +man o +man ila +md n +md ss +Ġlo ot +Ġlo uvain +66 93 +AC ED +AC CR +AC AsIn +AC AsOut +Ġstart Point +Ġmat urity +44 99 +und ra +ENT O +ENT UATION +AP T +AP UREMENT +Ġadd Dir +Des igned +Des erialize +75 45 +new p +new key +new bin +new addr +cor related +io ctl +ait on +]: ] +]: ', +Ġurl quote +clo ak +ef ul +En dere +En ronEmails +auth time +11111111 11 +28 395 +Ġend facet +Ex cept +ET rade +so i +cal liope +ther m +ther lands +56 04 +56 03 +56 14 +56 88 +56 35 +56 89 +98 18 +98 03 +Ġpass code +Ġsp ur +Ġsp ine +client es +FI t +FI PS +FI RING +local StringPath +38 144 +my o +my dir +my font +obj eto +Ġmin l +LO ST +LO LW +box lib +Ġ(" _ +Ġ(" <<< +uc c +Ac cident +be v +be es +be haviour +ĠOR ANGE +ĠQ C +ĠQ obj +ĠQ Timer +ĠQ CheckBox +ĠQ CoreApplication +img path +img file +PT M +35 12 +35 18 +35 27 +ick ing +ref pipe +ref parsers +Value M +ern ions +Ġus ando +space ship +File Util +File LineCol +AD OR +ont rol +Ar k +save Name +Ġtarget Delete +tim g +cre ases +doc utils +',' '), +stat ustext +flow ims +ĠSe a +ĠSe arches +nn f +45 09 +45 83 +77 84 +77 79 +PO I +the tas +Ġerror message +ĠY I +ĠY s +Ġmay an +ĠX r +ĠX FP +`` `` +`` `\ +Ġrow id +Ġarg nums +Ġbase uri +Ġbase Url +Ġbase Interval +cc ertmgmt +47 15 +47 03 +47 08 +47 45 +47 21 +47 62 +csv s +event Name +core ml +101 0101 +weight ings +Str ong +Ġgo v +tf l +tf js +Ġpos Xf +Ġload steps +ash ape +cy clo +cy cling +Set Shader +Set Speed +Set ModuleLogLevel +Set Reslice +Ġmethod name +Ġreg ulation +Ġreg ret +Test Files +Ġser a +83 14 +83 08 +83 55 +Ġpd m +Ġmain frame +Ġag rees +Ġag regar +Ġver ifier +Ch ol +Ch ristmas +>> ', +Ġlin Dim +UN LOCK +UN umber +UN STABLE +qual name +ĠIN V +ĠIN SUR +ĠIN FORMATION +ĠIN COME +82 99 +82 18 +82 93 +Ġar v +Ġar ri +Ġar ousal +46 24 +46 28 +46 35 +46 79 +ĠJ O +ĠJ u +ĠJ PG +ĠJ accard +ĠJ IRA +Log it +Num Py +Num ero +Num Resources +Lo RaWAN +89 02 +Ġ] ): +ĠSt udio +ĠSt ages +":" ' +ld as +open qa +open pose +assert That +Ġread VariableOp +ANT I +ANT S +Un ity +pk mn +The ory +mask m +Ġq config +Ġq arr +temp files +tag id +tag text +sys Mgmt +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ +To Re +To ok +To Pod +To UserName +To ServiceLinker +To Newsletter +To HorizontalPodAutoscaler +ĠOption Menu +ĠPy th +ĠPy test +CON J +CON VERSION +CON VERT +DO ES +Ob ser +Ob stacle +gener ative +De form +De liver +ost ree +Config Source +Config Args +29 00 +Ġval Row +о е +ell ations +Ġdb ot +Ġdb user +43 56 +Ġ{" __ +Ġsource pattern +cl kpnt +use less +ĠPro t +ĠPro be +ĠPro files +FF ATBW +uid l +ĠList ing +INT O +dep ot +dep ending +000000 01000000 +Ġnet cdf +Ġnet vtx +SI FY +ug ly +Ġsample sheet +cu X +page Info +page Size +down sampling +48 07 +Ġimg RGB +Ġimg aug +EX CEEDED +ĠData s +ĠData Parallel +ĠData Transformation +err s +60 92 +Ġ'. [ +\\ ") +Ġarray Y +Ġarray SearchT +rate map +ĠAr bitrary +ĠAr duino +42 98 +Ġtemp im +])) ; +msg box +last Date +Path Name +left y +project Path +EL IMIT +EL ANTRA +Ġpri imek +Model Driver +е е +")) [ +iss uper +ï¼ Ĵ +ï¼ ķï¼ +server List +Ġinst ancia +kin o +Get Member +Get Shader +Get ModuleLogLevel +Get TransactionResponse +Get TransactionRequest +Get UniformLocation +Get Conformer +Node Set +Node Attributes +tx prepare +ĊĊĊ ĠĠ +Ġclient ReferenceInformation +ble s +Ġbreak point +Message LogData +Add Actor +Add PodOptions +Ġsave Checkpoint +rand seed +initialize Slider +bar ra +bl stm +Ġass ure +Ġass oc +folder Path +matrix file +uni h +build Dir +Ġ& # +Number Interrupt +Number Formatting +aw sc +--- > +Ġlast N +Ġlast Node +Ġchar m +TO WER +TO LERANCE +Ġword Dict +Ġword POSMap +ik vision +conv en +conv entions +ĊĊĉ ĠĠĠ +mer chants +Tra iling +Column Name +Ġframe works +79 02 +Key points +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ +74 64 +74 550 +tick width +epoch time +MO DER +Ġ', ') +mem cached +ĠCo variance +less on +73 56 +Ġimp utation +Ġimp rimir +datetime s +LI FT +Ġnext s +String Field +String Exp +ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Com b +Comp eti +Bo y +Bo ss +ush are +0101 001 +Ġshape d +Ġshape lets +ker ns +][' # +over head +tree pars +Ġiniti alizations +58 11 +58 01 +58 08 +State Enabled +pr qA +pr qR +Ser viço +OP US +Out SamplerTransformer +ĠTest ed +ĠTest Interpolator +Reg ist +и Ñī +ãĤ ħ +Ġ.. ................................ +ĠNo tion +Ġbin ance +âĢį ðŁį³ +SS W +ĠDe precated +pen et +sw f +sw gith +Ġproject Id +CA UC +spec tive +68 95 +ĠRes ampling +ĠRes istor +Ġextra pol +Ġextra Fields +network D +static Counter +ãĥ ¯ +ãĥ Ħ +ãĥ Ł +connect To +Access Authorization +Th ick +pb txt +Index ing +Index Next +ia a +çļĦ åij¨æľŁ +çļĦ ç»ĵæŀľ +çļĦ æķ°éĩı +çļĦ æIJľç´¢ +çļĦ åıĸåĢ¼ +Ġneed ing +At trition +Ġblock map +52 02 +52 25 +cell Value +ĠUser Info +ĠUser Register +Of Trending +ATE LLITE +)[ \ +); ", +Sh ar +Sh Me +Sh ane +Sh ipping +Ġcase xml +Image Net +fra ud +IP Resolution +ĠSo lo +lip tic +Ġtmp Ele +49 17 +RES OL +RES PON +radi usr +ÑĢ о +ĠPath Manager +DB Name +Def in +Info Type +internal Values ++' +)', +Ġter mo +SC V +su curi +ĠVersion Info +ĠVersion Conflict +abel ing +Context Cache +sim ulations +sim CaloStage +sim iliarity +Ġ"" ; +Ġorig Id +63 85 +Ġoptim um +CC GE +Inter ceptor +Ġgl Gen +Ġgl GetUniformLocation +IO Settings +na iv +ĠID isposable +Not Available +Not InListResponse +Ġtask Json +setup s +Create APIView +Create FieldDef +Ġmy str +Ġtri map +Ġsim u +Ġph id +Ġph araoh +Ġsa zm +Ġgrid data +font name +Al liance +execute TestCase +gg gg +Qu iz +By e +By Epoch +################################################################ # +Client Fan +mod Sec +App lied +App Directories +:` < +н ÑĥÑİ +admin istration +Ġoper acao +Ġsu cesso +Ġsu curi +ĠCh assis +ĠCh aitanya +optim izations +scal ers +Ad vice +Ad Kraus +ven n +ven ues +inst a +ĠAny thing +resource Payload +lack s +ĠTh rift +ĠTh umbs +':' -', +Ġraw source +For warded +For warder +track id +ĠType Ref +xbc x +clean ers +clean Description +é c +é lé +des kew +Sp onsor +Sp awner +cel and +Ġmon ai +.\ .\ +.\ ,\ +Ġedge db +win Choice +help Text +best move +sin a +sin us +vm Membership +PR EST +ĠMe chanic +ĠMe ssaging +ĠMe teosat +xed v +ĠDE VELO +Ġact Id +Ġge z +Ġge ot +Ġge odesic +Pre cedence +Ġpost processing +web api +ç ao +VER Y +VER SED +Ġfin alized +Sub st +Sub resource +xcf c +xbe g +Ġ$ ${ +xce y +sig term +dm f +LOG OUT +ĠZ hu +ram ı +NO M +ĠBase map +ĠEn force +ĠEn velope +UP A +non uniform +non pulsars +Ġì ° +Ġì ¢ħ +xdb v +æľ Ĺ +æľ Ŀ +WS FP +fin ale +fin alized +GB B +GB E +Ġinit ramfs +global StringPath +ã y +Dis aster +Dis cussion +can on +ons ors +Tensor Group +Tensor Dataset +Ġdir Sep +Run off +Port Idx +fill Poly +He uristic +Token Error +Token Mapper +Ġpack Name +RL Bot +Rule Block +Rule Violation +åħ ī +any diag +record Time +loy d +draw coastlines +ending Line +Ġ14 29 +)\ . +ĠRel u +account Name +áĥ ¨ +sd card +ĠCheck ed +rel and +ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +xcb c +'} ' +ĠApp lying +Ġcustom ise +Or bits +("-- > +xad Z +Ġsw elling +dx s +Ġvi able +Pe aks +Event Args +Event Send +Event Dur +rad ores +Item Found +GI VEN +ĠLe vit +ĠConfig Error +dest inations +Ġstri ps +Ġsend Message +imp o +imp rimir +Line ages +Ġmer gers +Ġmer cury +MS D +MS K +MS W +MS UB +MS RP +"} }) +Code Type +Date Range +ixel s +cap able +thread Id +thread pool +thread Mode +Ref lected +prob num +CI HP +cos at +ĠCol ored +oo ooo +OUT P +OUT BOUND +Mat t +Ġ") ", +Ġlong itudinal +Start Server +MC U +jnxMbgSgw S +multi tenancy +none x +Ġmc HW +Ġmc AccXFP +counter factualInterfaceSlider +Ġhandle textpad +Ġsuper user +Count down +Count Equal +single s +vers i +ĠNot FittedError +ĠTime Distributed +Ġgen otick +ĠImport ed +cla ws +!! \ +chain net +cd hit +Pri ces +STR sIn +STR sOut +normal LaImages +CD N +All TestFiles +Ġsm ith +ming a +Mo tif +pub s +On Fail +auto start +Sc raping +Ġconn len +Ġconn width +distri b +ĠEX PORT +Ġconf ined +Ġbl ending +Ġtx To +Ġmulti modal +OK BLUE +Be er +Do xyfile +ठĸ +eras ing +Resource Policy +Oper SgaclMonitor +Oper IpTrafficType +Ġresource Payload +PS O +GG M +GG TG +xF CA +xF CC +xF DA +xF CF +Ġunique Id +Ġaut odoc +Ġaut htoken +Ġaut onomous +month day +Ġcard ano +Ext erior +Ġrot ational +End Token +Dir Name +FR AIS +FR UNumber +short cmd +ĠNum erical +SH UFF +Ġreport Gen +gre se +convert or +expected result +ĠAt tempts +HER O +bn ac +Ġhigh level +>< !-- +linear Gradient +SO FT +Min Group +Min ima +Min MaxScaler +Ġconnect To +rest ored +ĠUp loader +USER PROFILE +mu da +noti f +:- < +semantic web +alo cean +Loader Photo +aut obot +aut okernel +Ġfun ny +Ġfun ções +9999 994 +fid Node +Ġperson a +EE A +EE EE +GN G +Ġfra ccion +Service APIClient +Ġacc XFP +screen cap +istic ally +ĠPre trained +ĠSh ader +ĠSh ipping +'+ _ +Ġcir ca +Ġcir culo +125 000 +Ġcomponent Name +ĠPer ceptron +bi quad +Policy Enabled +)]) / +)} ( +Ġfree form +Var Nuc +Ġaverage Current +Ġaverage Power +ĠAd obe +LA I +LA X +Ġip Address +Version ing +vas prun +ĠRE JECT +ĠRE VEN +ĠRE PUBLIC +SP DX +SP READ +Ġspace d +GEN CY +sync Overlay +expand er +Ġassoci ations +Ġcl ues +TC MB +TC APS +Doc Warning +Params InMsgName +Op Type +ads abs +Ġseq Names +002 37 +Ġday time +Ġsignal ing +stock name +Ġarch ivos +white grid +}/ ", +New ErrorType +Ġauto mpl +gu ity +gu ava +From Path +From Getting +From UserName +PRE LOAD +sym m +sym table +bus inesses +л иж +UU UU +Control Group +Control XInterface +ï¸ı âĥ£ +Ġæ ĭ +]- ( +]- . +]- [ +SL T +Ġprev Indirection +ĠDis plays +PY PI +ĠQu iz +ĠQu eries +Ġthreshold ing +Red istribution +123 123 +123 145 +Ġclose Friendly +ĠOpen Therm +ea e +gal era +mar rend +mar athon +IF REQ +Ġ? ' +Read L +ulator y +Ġbit movin +most Recent +Ġpr one +Ġmonth TotalAmount +Ġmonth UsedAmount +Ġmonth AvailableAmount +Ġmonth FrozenAmount +Ġface ts +CM W +CM SSW +fun ct +âĢįâ ľĪï¸ı +Ġlow ers +With Constants +pn as +EG A +Const s +tasks json +ĠDo Nothing +joint Positions +ĠEN DS +ĠEN DC +åľ Ł +Mem Dict +ĠAR RAY +ĠField Role +Ġgra fica +Ġgra vitational +Ġmp s +Ġactive Width +ا Ùĩ +container Name +Layer Element +speci als +Ġnb Depth +uch i +Open CV +Ġcat kin +Ġcalcul ar +kit benchmark +Ġwould n +mid t +ensure data +ĠUpdate Operand +:]) ] +Ñĭ е +Ġchain code +Ġchain params +Ġchain Menu +learning Rate +Ġ"{} _{}". +Ġ'{} {: +³ółģ µółģ¿ +³ółģ ¯ółģ¿ +ĠCO ST +ĠCO VID +One time +One ToOne +One EqualsFoo +As sembler +Mon o +Local ity +DD PG +DD TCAPS +Ġap scheduler +Ġpower line +look s +look ForAccount +400 9 +Pi Graph +Bar ang +ĠST UD +hi j +rf v +rec N +rec setTaxon +hot fix +DA a +DIS CLAIM +DIS PATCHED +ÑĮ ого +dig itizers +Ġsegment or +Page Size +Page Template +Batch KMeans +}} }) +}} $", +ĠJSON Field +Ġdes conto +ORE QUEST +600 06 +Ag EA +private key +)' > +)' %( +']] ]: +Seri alization +01011 000011 +Ġ]) ), +ĠClass ic +ĠClass Group +edit ar +Ġп ап +ĠSystem Label +ĠSystem Folder +ĠSystem Mask +gene tic +CV S +Ne uro +Ne utral +Wh it +Ġvol atile +æł Ī +ãĢĤ ', +Sk etch +ä¸į éľĢè¦ģ +ä¸į çŁ¥ +ah med +Ġseg uint +Ġcontract Duration +aj Äħ +zen desk +Exp loit +ĠFL ASK +FE rrs +------ ') +Ġengine ering +cov timedist +Connection Index +Dec lare +decor ate +401 3 +icon bitmap +rd chem +Ġroom Exist +sal mon +Ġedit ar +Ġbar u +wav s +çĽ ĸ +dk n +Ġplay book +Ġplay ground +Ġplay lists +ĠClient AuthenticationError +Order ing +Sw armController +answer ordinal +break points +Interface MIB +ana fi +Unit Cache +ĠHe avy +Account Add +Ġretri ed +ĠPO UR +ĠDB API +Ġtw os +align er +ĠAS SIGN +Ġcross origin +ati lities +VALID ATE +Ġreset ting +Ġctsp OperSgacl +Project ed +Project parameters +bad guys +Match Error +Ġnull context +103 07907 +Ġpoly line +vp ip +Engine Hybrid +Random Crop +Random WindowTitle +Random HorizontalFlip +}_ ${ +Location Query +Piece wise +under water +Ġdot net +AX ON +pie Chart +ï¼ļ ", +Ġ00 8 +History Operation +wall s +Ġfo x +PRESS URE +Delete View +wi Äħ +translate Y +Sample d +00100 1111 +Bl ending +Bl ender +tl ds +Ġè ¨ +Ġè ¶ +TS LA +Area Field +æŃ » +Ġpol ls +Ġpol ynom +analy zed +Multi class +ĠRandom ize +ðŁĩ ¾ +Vc Index +Work ed +vl un +ctsp OperSgacl +Ġ{}) [' +My Service +ĠLine width +ĠLine String +Ġ27 001 +contin uity +previous Batch +WR F +sl n +CP B +CP US +Mapping Mode +-------------- ") +tan mu +ĠState R +ados Ocp +{}/ {} +ASK S +Role Admin +Ġdump ing +Ġcos a +amb ia +amb assador +walk To +915 6 +RC J +Ġsn ip +BI GGER +uck er +PA STY +Ġscan py +Ġscan code +Ġ"$ $", +è¦ Ĩ +Post code +lec un +ATT GTT +ATT ENTUATION +¡ółģ ³ółģ¿ +Ġ'" ': +Fin ally +[[ _ +Transaction Type +PARAM SET +Tri ps +00101 0 +Current Time +pet sc +åľ¨ æѤ +dz ie +CN V +Sec RuleEngine +Sec AuditEngine +Real ESRGAN +Arg Parser +gri df +Ġ[{ }, +Dep ends +Menu Bar +push integer +push nil +Ġmd traj +Scale X +OEO Objects +OEO WorkMode +OEO CardObjects +Stop Server +Ġless er +Ġpur ity +Ġpur ify +906 6 +032 7 +combin er +deg C +lf ns +pin code +905 6 +sur prise +sur rounding +ĠService Perimeter +Ġcondition ed +CAR GO +VM ICRO +Sequence Model +ãģ® ãģ§ +Stack s +Stack er +('< ', +Ġground truth +ĠInvalid RequestError +ú b +ú l +ú de +Cache Entry +Cache ImageOptions +Cache ImageMessage +hd g +('[ ', +ĠFind CC +ü ç +Ġ================================================================= ======== +Ġ35 000 +Prop ortion +Prop agator +ĠCan cer +Ùħ ر +ĠMock Ibis +Initi ating +DK ernel +ä l +calculate State +calculate Trigonometric +market operations +bt cvae +Ġba ÄŁ +Unknown Types +Flow s +OUTPUT S +ĠDataFrame s +Password Form +Container Tools +Ġhyper geometric +Ġswitch erLoc +Ġband its +ANS FORMATION +qs f +hyper pars +âĶĮâĶĮâĶĮâĶĮ âĶĮâĶĮâĶĮ +Cap ac +Cap ability +lar ı +å®ļ ä¸Ģ个 +dialog Text +Rest oring +DC G +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +small print +WIT HOVER +ĠSV O +("{ :-^ +nick Name +Ġmet res +Sgt StorageType +Sgt GenId +397 2 +Debug ger +Debug ModeEnabled +Ġfiltered MapDict +WA w +FQ oF +Sgacl Index +LIN ETO +unpack dir +unpack PNF +æ³ ¢ +Ġsv ds +################################################################################ ## +403 6 +403 9 +Api Error +Api Key +287 7 +Ġdetermin ation +Remove ImageMessage +Ġĉ ĠĠĠĠĠĠĠ +Ġpipe graph +ki poi +MR ML +ador a +Resp ond +ĠØ µ +Ġí ĥ +FUN CTYPE +å¹ ² +Processing Pipeline +ĠResource ExistsError +CB ERS +Ġfbx Manager +Ġscra mble +Ġscra mbled +Opt Table +#---------------------------------------------------------------- ---------- +pay out +Ġmultip oly +п л +п ол +п п +å± ı +422 7 +ĠPi CN +osm os +Player Type +Vec s +Ġeq tk +MI STRY +ĠCHE MISTRY +ĠThread ing +Ġent halpy +unknown Rate +vd loc +Member Forces +ÙĪ ا +VIS IBILITY +VIS UAL +Ġadj Enemy +Ġ'[ +] +chrom a +æĭ ¥ +Ġlab ware +HB HE +Lines Corpus +Ġgive back +virtual Write +virtual HostUtilities +Ġlex ical +Ġlex ico +Ġlex icons +Ġur is +åī ĬéĻ¤ +Ġmar ine +rh ino +Ġbra intree +Ġ96 00 +Accept ance +ĠChange log +destroy ed +åĢ¼ 为 +Ġcy t +CLIENT S +895 2584 +Ġindi cies +aux ili +Font Properties +ĠWork ed +Ġten nis +Kind BackupInfo +HH H +Pack ard +ij ing +392 7 +æµ ª +ĠCH ANGES +ĠDelete View +boost ed +337 3 +337 4 +ÙĨ Ùĩ +launch Job +Seq Record +ZZ Z +Vertex Shader +Summary Writer +UV s +('# % +ĠOver all +Product Fields +Ġrefresh ing +Ġcri se +Ġcri ado +Ġcri spy +Ġtransfer no +Ġtransfer ring +PLAY FIELD +SW IFT +High er +High charts +ðŁı´ółģ¬ółģ µółģ +ภĻ +spatial Corr +feedback s +425 1 +455 1 +fish List +Send TransactionResponse +955 7 +è½ ´ +Ġfrag One +dhcp Server +tun a +peer power +${ :. +ĠCar Park +bro chure +Ġhard en +Ġtrigger ing +COR DS +ĠDisplay Name +suc atalog +Ġ; ) +peg Price +Ġgs util +ĠGrid Size +以 å¤ĸ +æ¬ ¢è¿İ +âĢįâĿ¤ï¸ı âĢįðŁij© +âĢįâĿ¤ï¸ı âĢįðŁij¨ +uf z +ĠJson LinesCorpus +Lock ed +ĠDictionary ToInclude +çĶŁ åij½ +Ve lo +PROC ID +repe al +Acc Retrans +оÑĢ од +ĠRES ET +Filename NodeMap +CUR DIR +ĠTemp oral +mr kr +Ġattack ers +Ġsubnet s +Ġcallable s +patient Id +Ġ-------------------------------- -- +mel bourne +405 1 +405 3 +LIMIT S +Inv itation +MED IATE +Ġrepro duction +percentage m +Timeout Exception +Ġzo ho +continue Routine +inline formset +æĬ ½ +Ġgpu db +'''' '' +Weight ing +364 6 +ĠConnection Line +ãģ« ãģĻãĤĭ +ãģ« ãģ¤ +tor valds +QUE EN +Ġtail le +æľ¬ 软件 +åĬł åħ¥ ++'. '+ +Ġflu ctuation +STRE T +augment er +Ġquat A +Prefix es +Prefix Operator +Find ings +Qq EQ +Ġ95 0 +ä½ľ æĪIJ +ìŀ ij +Ġproj etos +Ġunknown s +Ġpyg sti +Tools Dialog +pull MessageLogData +Region MAPE +Pub med +Ġmix up +Ġrg kmax +\"> \ +Cost ByEpoch +SCRIPT CONTEXT +Make Dirs +Ġsky walking +âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢ +Pixel Shader +Ġи г +LINK ED +cisco TrustSecPolicyMIB +请 æĮī +yu an +SEQU ENCER +ĠMethod PropertyMeta +Ġhar v +å¥ ĩ +ì§ ¸ +Ġnav rep +osa Wellbore +ĠExp onential +ĠExp iring +Ste llar +è res +Ġrs old +RR G +Ġdeep chem +ĠHome s +SPE CT +craft Text +tEXt Comment +ĠExec Comp +ĠExec uting +Login Window +ĠCre ar +ĠJob Application +оÑĤ ели +466 8 +Sq Arr +Measure Duration +AW G +}$ '. +ë¡ľ ê·¸ìĿ¸ +Does ThrowsException +DESC R +gaussian Blur +guild ID +éĶ Ģ +éĶ ģ +aG h +MULT IS +çľ ģ +Ġfew shot +composition path +ðŁı´ółģ¢ółģ ªółģ +Stock UF +sser vice +chip C +ĠKEY S +Den ver +Ġcd lib +Ġarm ory +WF h +ĠLE DEmote +Cir c +ĠAccount Info +Ġ################################ ### +Ġ################################ ############# +ĠSymbol Table +Ġз аг +第 ä¸ī +,, , +Band Num +Ġcf lib +Ġcf gs +ĠSingle Mode +BM ES +Ti ers +emit ters +warp Affine +live streams +058 000002 +SUM O +åįķ è¯į +gov uk +ðŁı´ółģ¡ółģ ¬ +Ġmut ations +´ółĢ ¸ółģ¿ +001011 000101 +Ġslope s +Ġsock eye +Ġprom otion +ĠTechno logist +Ġhope fully +Ġsal ario +Ġ################################################################ # +Ġstuff s +Ġjump scale +GRAM MAR +Ġmount ing +Rec Base +spo on +sch d +ãģĹ ãģªãģĦ +èª ¤ +ĠVe il +wallet balancer +Ġ================= == +ĠFormat ting +8888 88 +åħ³ 注 +398 1 +ĠåĪ łéĻ¤ +ĠMer ged +Ġmicro phone +COM ING +mic ron +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +Ġdecrease d +Ġchrom aticity +Ġquad rant +Hook Options +}; ") +Ġठ² +ĠAB IDE +Ġ » +tele scope +tele phone +ĠCL DR +rw ParamsInMsgName +475 1 +ĠFire fighter +399 1 +399 2 +Ġappear ing +Export ar +ал ��¸Ð· +/{}/ '. +don eness +ĠCallback s +ĠCallback Query +VIE WER +ju lian +jet o +Ñĸ д +Gaussian Noise +kU ql +lw ir +nw iz +Ġtax i +Ġcr str +Ġcr é +iden Service +ĠConnect ing +ĠConnect Handler +Analy ser +Ġswap ped +Bul lets +lexer Alt +å®ŀ éªĮ +reion ize +ĠInstance ToInclude +zc ash +Ġbed leak +å¼Ģ åIJ¯ +NI RO +brand Name +Arch ives +âĢįðŁĴ ¼ +}% '. +ĠPAR A +TRANS POSE +AAA AG +Machine Learning +Star Context +rV Z +BIT TAG +Nv me +Ġgzip ped +Ġм еÑĤод +ĠcdbpPeerStats DW +liver esults +Ġbroadcast Severity +ĠAM QP +Activation Function +åı· çłģ +Ġazure ml +Pol ling +Mass Hierarchy +vtk MRML +ä¸ī ä¸ĩ +åĨħ åľ° +':{' $ +ĠPlugin Error +Ġactiv ator +计 æķ° +visual ise +ĠSur ge +bor row +secrets manager +polygon Index +TEXTURE CUBE ++". "+ +Hot Key +guest agent +nos y +Ġoct ave +Sql ite +Ġib api +Reset Error +ãĤ¤ ãĥ³ãĥ +datal abeling +qi u +ATTT TT +activ ator +Google ContainerTools +brief Doc +âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij© +âĢįâĿ¤ï¸ıâĢįðŁĴĭ âĢįðŁij¨ +determin ant +ocp ra +ج Ùħ +":{ }," +316 24 +ERN pH +Ġdoctest s +ĠTool box +ĠLast File +TestModel s +TestModel ShuffleNetUnit +ðŁı´ółģ«ółģ ²ółĢ +解 åĨ³ +PERSON NE +nT iles +Ġmilli second +1166 14 +Ġthink ing +does nt +winner Code +Ġtv showtitle +Ġhouse holds +bazel build +pct g +Oz k +ĠSan tos +(?: (?: +Qual values +TMP DIR +dN dmag +ж еÑĢ +Ġtl v +è¿ĩ 滤 +好 æ¼¢ +åĥı ç´ł +ìĸ ¸ +altern atives +OPEN ING +pron o +alarm net +ĠCRE ATED +Ġig vm +Ġig ibson +ĠCli pper +Ġneuron spath +arith m +Ġcatch up +ĠMET A +ĠMET RICS +([^ / +RK NR +pat ents +Course Title +Literal Context +ç³ ĸ +Ġbas ins +æīĭ åĬ¨ +Ùģ ÛĮ +ç² Ĵ +Ġsit uations +ĠFeed Forward +Phase RadianInverter +SAME ORIGIN +incorrect ly +die sel +Ġstra va +skin ned +uẠ¡ +uẠ£ +Replace ContainerMessage +ĠGra fana +ĠPerform ing +Sy nthetic +YM id +Ġ207 0 +ĠLab oratories +ĠCost s +åıij å¸ĥ +BLEND MODE +FACE BOOK +ĠPlace ment +fed ora +fed SDN +Ġcad ast +ĠAPP LICATION +Az imuth +OFFSET S +Localized DateAndTime +Ġtrip let +³ółĢ ·ółģ¿ +³ółĢ ¶ółģ¿ +Ġwhitespace Count +Ġperf kitbenchmark +ÑĨи Ñİ +Ao û +Ġtell ing +Ġamb ient +ðŁı´ółģ§ółģ ¥ółģ +æĮģ ä»ĵ +FW D +RAT ELIMIT +Under Sampler +Under lineNav +Tele phone +Ġpriv key +èĬ Ļ +注 éĩĬ +çİĭéĢ² æĽ° +áĨ « +ĠÑĥ дал +thinningThingProducer A +ÑĢÑĥ пп +Ġenemy Y +GRE ATER +Ġcamp y +Ġnest a +Ġelf tools +office Document +Ġcaption s +Ġisol ates +Ġunexpected ly +Ġcalib rations +天 ä¸ĭ +Verify ing +æ¶ ¦ +cq lengine +Tech nique +Tech nology +mscModVcs X +mscModVcs Wins +album artist +Ġcour t +Ġbrand s +Ġ(* , +('.. ')) +ĠInit Harvester +Ġlem mas +ìĸ´ ìŀĪ +stral ian +REPORT S +Ġsatis fies +áĥĶáĥij áĥIJ +tir ar +Ġutiliz ando +ĠìĹ ´ +áĥĺáĥ ¡ +AO V +ÐŁ оказаÑĤÑĮ +shrink ed +energ ylevels +ĊĠĠĠĠĉ ĠĠĠ +ĠInternal Error +ĠPlan ets +Ġexpk p +ĠMA KE +uploaded JarLocation +ĠExit Status +ĠctspDef ConfigIpv +Ġcropped Vid +("__ ") +ĠMi B +ĠMi light +LLLLLLLLLLLLLLLL L +Ġcdf vals +Ġrelat órios +ĠFLO OD +Ġautos klearn +OAuth Handler +birth day +Ġko libri +åĪ© 润 +åŁº æľ¬ +Orient ed +sus picious +sus pended +Ġpert Size +ĠPr in +Ġvy f +ĠParam Info +ĠCOMP ON +ç½ij 页 +Ġdatatype s +ctspDef ConfigIpv +QI u +SUR FACE +Ġhid ing +='< -', +COOK IES +ĠQuantum Black +å¼łæĺ¯ æ¸¯æ¾³ +ĠDif ficulty +distro less +Notifications Group +Ġxf p +dee prec +town halls +ISS AGE +Ka olinite +éĵ ¶ +('~ '), +ĠVari ation +Ġscroll bar +abcdef g +Firewall Policy +001011110111101011 000 +Ġ199 0 +593 10 +recur rence +Attention Transformer +è¯Ń è¨Ģ +#------------------------------------------------------------------------------ # +Ik Cube +Land marks +indi cies +ĠCrypto dome +Too Long +ĠMemo History +ĠAlign ed +cep tive +ĠDa uphin +Ġextern ally +ðŁij¨ âĢįðŁij¨ +Mini Blocks +Ġxt ype +Ġ"** /*. +Ġeast us +ander er +Ġstraight forward +Ada ptor +WG US +ĠPas o +ĠPas cal +perio dicities +Ġsubtract ing +Ġaccurate ly +ðŁij© âĢįðŁij© +ðŁij© âĢįðŁij¨ +ðŁij¨ðŁı» âĢįðŁij¨ðŁı» +ðŁij¨ðŁı» âĢįðŁij©ðŁı» +ðŁij¨ðŁı¼ âĢįðŁij¨ðŁı¼ +ðŁij¨ðŁı¼ âĢįðŁij©ðŁı¼ +ðŁij¨ðŁı½ âĢįðŁij¨ðŁı½ +ðŁij¨ðŁı½ âĢįðŁij©ðŁı½ +ðŁij¨ðŁı¾ âĢįðŁij¨ðŁı¾ +ðŁij¨ðŁı¾ âĢįðŁij©ðŁı¾ +ðŁij¨ðŁı¿ âĢįðŁij¨ðŁı¿ +ðŁij¨ðŁı¿ âĢįðŁij©ðŁı¿ +ðŁij©ðŁı» âĢįðŁij¨ðŁı» +ðŁij©ðŁı» âĢįðŁij©ðŁı» +ðŁij©ðŁı¼ âĢįðŁij¨ðŁı¼ +ðŁij©ðŁı¼ âĢįðŁij©ðŁı¼ +ðŁij©ðŁı½ âĢįðŁij¨ðŁı½ +ðŁij©ðŁı½ âĢįðŁij©ðŁı½ +ðŁij©ðŁı¾ âĢįðŁij¨ðŁı¾ +ðŁij©ðŁı¾ âĢįðŁij©ðŁı¾ +ðŁij©ðŁı¿ âĢįðŁij¨ðŁı¿ +ðŁij©ðŁı¿ âĢįðŁij��ðŁı¿ ++)\ . +Native Tokens +Ġ***** "); +Ġmole cool +Three Finger +ĠWORK LOAD +ĠÚ© ر +Ġcontra cted +ĠIgn ored +PLAN E +CROSS ORIGIN +ĠSta y +Ġnucle i +satis fy +Multip lier +ĠÑĢ еж +ðŁķ ´ +ĠAuthentication Error +ĠAssoci ation +ĠSn ippet +svn NetIf +å°ĩ 士 +Modules TestStruct +ĠPrimary Threshold +eig s +mip lib +won ing +Ġ)( ...) +ĠRMS D +assertRoleAssignment NotInListResponse +extrapol ating +Organ ized +Weather ForecastManager +lE ol +Ġmas ke +ãģĵ ãĤĮ +ðŁı´ółģ¡ółģºółģ ³ółģ +离 å¢Ļ +ĠMQTT SN +Java FunctionDescriptor +¶ółĢ ³ółģ¿ +¶ółĢ µółģ¿ +¶ółĢ ·ółģ¿ +Ġads refpipe +Look ing +INITIAL IZE +Follow ers +rk arsten +Pipe Error +KM CO +æ» ij +Ġpan optes +Ġpres igned +Ġntw XFP +Ġburn in +travel times +Cart Pole +ĠHealth Check +OEOHW WorkMode +æ¯į åŃIJ +,,,, , +Ġetsys NacApplianceMIB +PLATFORM S +ĠACC ESSE +ĠMu ShMe +Ġsynchron ized +RAR sIn +RAR sOut +ĠAg ents +ĠOPT S +INF OREQUEST +Ġ'$'],[' $', +fli plr +Ġà° ļ +Ġrece ber +Ġrece bido +Ġmov Avg +Logical ResourceId +Operational SgaclName +Operational SgaclGenId +Ġ************************************************************************ ****** +ĠSIG TERM +è¿IJ æļ +Ġgrow ing +ĠAtom ic +Reject AddTaskAdmin +Reject AddTaskOwner +Reject RemoveTaskAdmin +Reject RemoveTaskOwner +ĠMini BatchKMeans +Ġл ай +Integration Client +ospf Nbr +Ġingredients Json +gens im +mols ysmt +Ġnex B +Expect ations +Tester Ontology +âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı » +âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¼ +âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ½ +âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¾ +âĢįâĿ¤ï¸ıâĢįðŁij¨ðŁı ¿ +âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı » +âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¼ +âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ½ +âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¾ +âĢįâĿ¤ï¸ıâĢįðŁij©ðŁı ¿ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı » +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¼ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ½ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¾ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij¨ðŁı ¿ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı » +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¼ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ½ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¾ +âĢįâĿ¤ï¸ıâĢįðŁĴĭâĢįðŁij©ðŁı ¿ +gat ron +Ġ******************************** **************** +ĠfuniIf Tx +ĠfuniIf Rx +ĠTor rent +ĠPod cast +ĠLu is +ĠOB SERV +ĠEt L +Ġtrap Host +Updates Rule +ĠciscoDiameterBasePMIB Local +mE wm +ç¶ ĵ +informat ique +Ġbaz el +ĠDat en +Ġextr uct +Ign ored +RH WSFP +jam bs +Ġgri lle +Ġven ues +Cool ers +оп ÑĢоÑģ +123456789 012 +MapperStatus LO +Ġ"""< ? +Ġparalle lize +DECL AR +ĠÐŁ олÑĥÑĩ +arpInspect Filter +åķĨ ä¸ļ +depart ure +ĠSy mantic +paralle ls +POLY AXON +ĠarrayT MAPE +ĠarrayT MAPEStd +ì¹ ´ +Ġcra zy +ĠMul timedia +Parsing TesterOntology +ĠRegular ization +èµĦ 产 +Ġchromosome s +太åħ¬ éģĵ +Ġton as +Memo Activity +('-') [- +å®ĺ æĸ¹ +ĠæŃ ¥ +ĠAssignment Stmt +ĠRestri ct +EXECUT OR +yG Qy +ĠME AN +ĠUsu ario +Shadow socksr +Ġviol ation +mobilenet v +ĠWeighted Point +1118 80 +ĠCla us +SUPP LY +ĠâĪ Ĵ +122817 1851 +Ima ginary +ece f +Ġ'~ /. +Ġdil ated +Ġhang s +ĠWik ibase +2693 59 +monte carlo +refentry info +Alloc Empty +Referenced ROINumber +dub lin +é© ¾çħ§ +Ġpag ina +ĠMAT LAB +ĠOrient ed +hospital Name +Ġ'-') }") +á»ĩ u +Cf gs +rob js +Ġdiscri min +CDOT AS +\\\\\\\\ \\\\\\\\ +ĠOPEN ING +ðŁı´ółģ¤ółģº ółĢ +Ej ercic +sequ encia +Ġble ach +acceler ator +Ġsucceed s +Ġا ÙĪ +ĠPdf Pages +á»ĥ u +ĠcpwVcPerf Current +ĠSNMP v +Impl ant +jun os +decess ors +ĠuE vt +="[ %( +ĠRequire ments +Ġsplice d +Ġservi co +Ġservi ços +å¤ĩ éĢī +師 çĪ¶ +è§Ĩ åĽ¾ +ש ×Ŀ +Ġblo cos +IpSw PermitPkts +IpSw DropPkts +IpSw MonitorPkts +IpHw PermitPkts +IpHw DropPkts +IpHw MonitorPkts +BTagMIST AGT +mrstp Port +mrstp Bridge +ĠLex icon +ĠinputFile Map +CHARACT ERS +Gar age +SQU ARE +bble s +crl f +Ġclon ing +Ġovers ample +Ġstim uli +grav atar +Serve Pref +åħ· ä½ĵ +Cop ied +kal di +Ġplas ma +Ġæī§è¡Į æĢ» +TAL K +ĠCAP TCHA +ĠFreq Dist +ĠDan cing +Electric ity +âĸĪâĸĪâķĶâķIJâķIJ âķĿ +TensorflowModelPerformance Example +HORIZ ON +æĤ £ +Ġ**************************************************************** ********************************************** +Ġyap f +Confidence Builder +Ġalgor and +9366 8952584 +ĠExpl oration +ĠJaco b +uniq TypeList +Registered Item +ĠSTD IN +ĠCHAR ACT +standardi ze +standardi zed +PAG INATION +Ġmé todo +oln mpc +toon base +Ġhab its +Ġleia Texto +ĠSeg AOIcor +SecAuditLog Type +SecAuditLog RelevantStatus +TrustSecPolicy MIBCompliance +CUT OFF +Ġaim Trigger +binar ize +binar izer +ĠQGraphics Item +Ġrespon ded +electrode Width +Ġlldb suite +funcsynopsis info +èIJ ½ +Ġave GroundGHI +geop andas +Street Map +maximal Expression +ISSU ER +âĢįðŁİ ¤ +âĢįðŁİ ¨ +âĢįðŁİ ĵ +Reqsts Out +ĠSearchQuery Set +FirewallRule Invalid +Lap lace +Stick y +fol k +remo ver +ĠfuniVcl Tx +ĠfuniVcl Rx +fif th +Ġhexa decimal +Ġkern ing +achability Service +Ġcvx py +financial Data +ह र +ĠMODI FY +nucle us +Was Cancelled +jen ga +',[ ]) +xter ity +ĠSus pend +Ġgrand parent +="{} "/> +pyqt graph +ĠRecur so +Ġquas ars +ggi are +Ġlocaliz ado +åºĦ 客 +ĠSpan ish +ç®Ģ åįķ +ìĭĿ ìľ¼ë¡ľ +ĠSecAuditLog Type +ĠSecAuditLog RelevantStatus +Verification Plugin +身份 è¯ģ +Hal os +RAA sIn +RAA sOut +sul ci +ç· ļ +çĸ ij +ĠåŁº åºķ +Ġfle xbe +adio Button +ĠTrunc ate +ĠSil va +Ġencaps ulate +ANNOT ATIONS +Ġzh mcclient +Ġtempl ating +Spam Emails +Ġtaint ed +Ġcocoa Popup +cPPPoEServer Auth +'ãĢ Ķ +Bon us +FREE IPA +Unp ack +hus band +Ġespecific ar +advent ofcode +='[ %( +ĠMICRO PY +ĠVan illa +ĠNewCell Bend +Ġapproxim ates +thrott ling +BTagMISTAG J +BTagMISTAG JB +<_|<_| <_|<_| +PAC B +overs ampling +Ġ../../ _ +Ġincor por +Ġincor retamente +Ġmeg ux +Ġapparent ly +Ġboiler plate +coroutine function +checklists id +ĠDecre ase +ĠDecre ment +Ġê· ¸ +ĠìĹ° ìĤ° +DETECT ORS +Scor ing +Sweep Input +Ġdum mies +Ġhabit at +Ġkar ak +Ġpyth ia +orden ar +REMOV ETASK +ĠPerp Market +COMPAT IBLE +Ġdatalake Source +=-=-=-=-=-=-=-=- =-=- +Ġbibli oteca +ĠqsfpAcc TxPower +ĠqsfpAcc RxPower +ĠqsfpNtw TxPower +ĠqsfpNtw RxPower +ĠèĵĿ鲸 æĻº +hann es +nur sery +éº ½ +Ġà® ĩண +getResult Details +Ġlun gs +ĠPOL Y +ĠOCL Array +ATR ANSFORMATION +Ġpredecess ors +âĶģ âĶ +Filmografi a +Ġ----------------------------------------------------------- # +ĠTRAN SL +ĠTRAN SACTION +ĠклаÑģÑģ иÑĦ +ĠвÑģе Ñħ +dSpace Get +hatch styles +zhang xinx +ĠÑħ оÑĤели +assemb led +ĠSNP s +zervaci ja +订 éĺħ +对é½IJ å®ŀä½ĵ +Annih il +kub eflow +kub ectl +loser Code +ĠSlow Query +1095 93668952584 +movi elens +ĠWs Context +ĠHAND LERS +Ġweigh s +Ġneutr alized +ĠDEP END +FORWAR DER +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X +Autom ated +Ġdynamical time +gkl sh +logResource Method +ĠMEN LO +ĠElev ator +phfqit K +phfqit OK +Ġcompos it +ListComponentDef sRequest +)*| .", +)*| ...", +GetBlock Response +QueryUsers Request +QueryGroups Request +Realloc Options +RenderTarget View +Ġsatur ated +BLOCKHEADERSWITHCHAINLOCK SREQUEST +ListIssueTemplates Request +Hflow CMB +Stra ight +xtra ctor +âĢįðŁı « +âĢįðŁı Ń +宽 度 +Ġmultiflow m +еÑĢаÑĤ оÑĢ +ÏĦε Ïģ +ĠзапÑĢоÑģ а +--·--· --·--· +lographic Orbits +ï½ŀï½ŀ ï½ŀï½ŀ +Pend ReqstsOut +ĠSpy der +Ġglu u +ĠPink y +ASRs In +ASRs Out +ACRs In +ACRs Out +calcular Pos +Sgacls Monitor +TRUNC ATE +GetEstimatedTransactionFee Response +GetEstimatedTransactionFee Request +âĢįðŁĶ § +âĢįðŁĶ ¬ +binaryObject FileName +binaryObject FileTypeCode +Ġì² ĺ리 +âĢįâļ ĸï¸ı +âĢįâļ ķï¸ı +frontal face +ĠâĤ¬ { +deeplab v +ĠDiagnostics State +å±ħæ°ijæĿ¥å¾Ģ 大éĻĨ +å±ħæ°ijæĿ¥å¾Ģ åĨħåľ° +Ġrabbit mq +Demon strate +PAND ORA +apart ments +èĨ Ĭ +ï©Ĥ çĦ¶ +Ġwvl ns +Ġhai ku +ĠBIN ARY +Compet ency +Minimap Event +å¾® ä¿¡ +ModSec Rules +recommend ations +krbcred info +entropi es +Ġome gas +Ġbsc Mtd +ĠSPL IT +Ġgol ang +ĠFlu id +ĠFSM Context +ĠmcNtw XFP ++"' !") +ĠNearest Neighbors +Ġsimpli fies +ĠGeomCombination Set +ĠÑĨ ен +devi ance +ĠTet ris +ĠAnonymous User +00001011 0000100000011111 +RECO GN +ĠParti cipant +ĠBoiler plate +Corp oration +IMPÃĶ T +Deri ve +Pype It +atri bu +Ġtropo sphere +rystal lographicOrbits +ĠAcceler ator +Funcion DoesThrowsException +Ġidempot ency +ĠWEIGHT S +åijĬèѦ ä¿¡æģ¯ +'// *[@ +*[\ '"] +Domin ant +gad gets +kot lin +wagta iladmin +ïª ĵ +utput file +ĠTaxon omy +pathItem StringPath +Ġhik ari +ĠPrune Source +Ġspearman r +Ġfiltr ation +OLT IPS +QUER IES +*(.*? )| +DRA WN +Phen ols +Ġâĺ Ĩ +PROCED URE +AbstractItem View +RfcSdk BlobUrl +áĥłáĥIJáĥ ĵ +ä¾Ŀèµĸ 项 +MetaInfoClass Member +CNB TC +Cru ise +GLOW BL +nac imiento +æ© Ł +getSegment HostName +typeOf Level +Ġstro kes +ĠMime Type +ĠQText Edit +ĠQUE UE +decry pter +FRU Name +BRUSH STYLE +ĠèĢ ĥ +hbW Ui +Ġ×Ĵ ש×Ŀ +cloudd rive +WRRRRRW WRRRRRW +Onnx Model +bite opt +zob rist +åµ Į +ĠLIC ENCE +ifur c +ĠWatson Response +举 ä¾ĭ +Decompose AttentionTransformer +Ġìļ Ķ +MultivariateNormal Diag +дел аÑĤÑĮ +EMO JI +Mfg ID +gai error +muti yama +Ġodk azy +ĠEMBED DED +Ġana conda +curContrast CH +Ġwhites paces +Ġlefto ver +administr ative +GETBLOCK REQUEST +ĠOrd inal +å°º 寸 +16316 32546 +Ġdiagon als +Ġpromin ence +TENSORFLOW MODEL +MONSTERBEHAVIOR WITHOVER +Dich roism +Pai ement +RAC MO +slan ey +xue qiu +ĠÑĨи ÑĦ +ĠcxC d +getstatus output +ĠTTF ont +ĠCfg Node +xbu fs +ĠKT BW +Ġ['* '] +Ġæ² ¡æľī +ĠĉčĊĉĉĉ ĠĠĠĠĠ +Ġâģ ł +slideset Cover +RMSProp Optimizer +Ġè¾¹ çķĮ +ShotGun Vis +Rasterizer State +Ġescolh ida +APPRENT ISSAGE +=-- =-=-=-=-=-=-=-=- +rekt anglet +selecion ar +Ġ#< == +teising ai +ĠMell on +Ġroger that +Ġpypk gen +Ġ['\"]([^'\ "]*)['\"] +ListGroup Item +apiClass Overrides +ToMany Field +LIUB ert +Ġexecu ção +symbo lize +Relativ izePath +ðŁı´ółģ£ółģº ółĢ +vanag ari +Ġë°Ķ ê +μÎŃ Î½Î± +Ġíģ¬ë¡¤ ë§ģ +IMMOBIL IZER +5323 1750 +Ġtasty pie +especi ally +setC ascadingDictItem +abolo id +pree mpt +ĠGIM PW +03462 10307907 +ĠConn ectivity +862745 098 +werk zeug +âĢįðŁĮ ¾ +Overhead Event +ĠSubst For +WEBS ITE +ĠFIEL DS +Ġत र +ÐĹадаÑĩ а +VSIF ReadL +[\\/]. *', +áĥIJáĥłáĥIJáĥ¡áĥ¬áĥĿ áĥłáĥIJáĥĵ +MCObj ective +ZENO DO +sÉĻ hv +sContainer Context +xMid YMid +Ĺ示 æķ° +stilla vailable +tipos refeicao +tiemp o +Ġfichi ers +00190 92480215476826 +geck odriver +amehame ha +Ġmmd nn +Ġ0105 10 +illino is +ppShaderResource Views +ĠSIGH ASH +ĠMec ab +ĠMá quina +Ġnphot ons +labelRange Minimum +Ġunip ipeline +REMAIN ING +ANNOUN CE +ĠHwVal Label +lockUnlock Display +createTest Step +LOLW AT +Accident Marker +ToPod Linker +ToHorizontalPodAutoscaler Linker +issuper set +ï¼ķï¼ ĸ +ĠTestInterpolator Load +staticCounter factualInterfaceSlider +AccessAuthorization Rule +ClientFan Coolers +AppDirectories Finder +EventDur List +ĠLevit ating +FromGetting UserInfo +ĠMockIbis Client +çĶŁåij½ åij¨æľŁ +LocalizedDateAndTime Data +Ġperfkitbenchmark er +Aoû t +ĠÑĢеж им +离å¢Ļ è·Ŀ离 +è¿IJæļ Ĺ示æķ° +ĠåŁºåºķ æĹ¥ä»ĺ +ĠèĵĿ鲸æĻº äºij +ĠклаÑģÑģиÑĦ икаÑĨии +zhangxinx in +ĠbscMtd Core +1631632546 3142524 +MONSTERBEHAVIORWITHOVER RIDES +0346210307907 3131 +! ")," +# ...# +$ ". +% '}), +' /{ +' "\( +( :, +) "): +* % +* "): +* .* +* ,\ +* )( +* /* ++ // ++ /\ ++ )' +, & +, ": +, ). +, (( +, [- +, ...] +- "* +. # +. ']) +. ]] +. >> +. "): +/ ')) +/ "> +2 111 +3 126 +3 123 +3 175 +3 186 +3 184 +3 188 +3 937 +3 994 +4 999 +4 076 +4 111 +4 108 +4 115 +4 131 +4 158 +4 776 +4 231 +5 646 +5 967 +5 050 +6 125 +6 005 +8 936 +8 997 +8 055 +8 555 +9 115 +9 00000 +9 125 +9 123 +9 888 +9 105 +9 104 +9 197 +9 187 +: ! +: ; +: | +: "). +: .* +: [] += : += ":" += ('-- +> ), +> "), +> "): +> """. +> ()' +> ()', +? ". +@ " +A le +A rap +A For +A void +A dicion +A waitable +B le +B row +B cc +B TO +B AY +B ah +B earing +B loom +B ndBox +C ST +C ust +C old +C nn +C IL +C ART +C If +C DS +C ities +C uda +C aught +C abin +C andidat +C ROWN +D ra +D os +D Type +D PP +D GL +D rag +D VS +E data +E OR +F ol +F ine +F est +F ew +F cs +F ord +F ID +F ive +F ED +F lying +F reqs +F isher +F ayette +F AMILY +G ib +G ust +G ating +G ram +G rn +G love +G pio +H un +H IN +H art +H num +H olds +H LS +H JZ +H uo +H alloween +J N +J er +J it +J ose +J upyter +J uan +J apanese +K ings +K lU +K nowledge +K ratos +L pe +L id +L af +L ava +L JJ +L isa +L xW +L edger +M int +M use +M SS +M VA +M artin +M RIO +N PP +N bins +N zM +N pv +N XV +N ÃŃvel +N nut +N ITUDE +O id +O il +O go +O MP +O ME +O STRE +O lU +O regon +P OR +P IT +P ics +P NO +P br +P MENT +P rd +P wr +P aused +P illow +P lainText +P inellas +Q ar +Q CK +Q Widget +Q Font +Q MARK +Q MainWindow +R az +R TF +S ph +S ANT +S NE +S ticker +S ockets +S pherical +S ATELLITE +T ue +T em +T SI +T bl +T MB +T WE +T une +T weets +T bulk +T fidf +T URES +T weak +T rotter +U in +U name +U UM +U CK +U DS +U Box +V enti +V AB +V CL +V TP +V DR +V CS +V pn +V Qq +V ROT +V ASP +W ise +W arn +W ear +W EL +W MT +W BC +W LF +W arehouse +X SS +Y test +Y outube +Z TA +[ ? +[ (( +\ ") +\ "}, +] =" +] '), +] >> +] ;\ +^ ~ +_ ][ +_ .__ +_ (- +` _ +a ul +a set +a ind +a ide +a exit +a uri +a Hh +b ax +b ai +b fe +b rows +b bx +b orn +b FY +b aud +c sp +c ure +c ci +c ft +c lib +c be +c Reg +c job +c ida +c andid +c IF +c akes +c assandra +c lasse +c UMan +c umprod +d un +d end +d uplic +d cb +d wi +d comb +d HB +d lopen +d ani +d arts +e fi +e ep +e oc +e jo +e vs +e hr +e ligibility +e bnfSuffix +f log +f ang +f dir +f ug +f cmd +f inesse +g D +g son +g ated +g ns +g xy +g é +g ML +g mock +g maps +g roupe +h G +h set +h ans +h mi +h au +h ns +h UL +h bar +h vd +h KJ +h kM +h lts +h gnc +i V +i Sib +j L +j at +j ure +j ee +j ason +k O +k ata +k to +k ang +k ings +k xy +k ik +k ana +k ivy +k ullan +k Pkt +l N +l S +l bx +l Ä±ÅŁ +l baas +m ms +m bo +m format +m enti +m df +m fa +m ud +m core +m é +m rs +m dates +m iles +m Uy +m unicipality +m alleus +m ÄĻżczyzna +n de +n ue +n xt +n ind +n print +n sa +n class +n count +n nd +n mi +n feat +n Test +n ca +n words +n asc +n ino +n spot +n anny +n lopt +o Q +o R +o Y +o spath +o Mod +p S +p len +p Name +p Data +p Shader +p cie +p angolin +p ssm +q B +q H +q ing +q tree +q codes +q rels +r path +r ango +r arily +r hyth +r xfsm +s S +s li +s set +s xt +s pp +s ke +s box +s Table +s bx +t A +t U +t X +t ss +t pp +t list +t ance +t user +t mb +t sa +t ars +t ink +t ready +t Total +t bb +t Destination +t asmota +t rotter +u ir +u fo +u ay +u eno +u yu +u wsgi +u RJ +v I +v md +v idx +v box +v é +v á +v dc +v cn +v Xr +w B +w I +w L +w V +w X +w ow +w right +w edge +w ia +w Op +w unsch +w aukee +x I +x ON +x model +x unit +x vals +x AE +x iao +y I +y dim +y true +y pred +y ork +y dk +y pher +y Axis +y asg +z R +z id +z limit +z lim +z ava +z illow +| [^ +} = +} ''' +} %( +¢ áĥĶáĥijáĥĺ +§ ä½ +© åħĭ +² å®Ĺ +Ä « +Î ® +Ï Ī +Ð ¤ +Õ ´ +Õ ¶ +â Ĵ +æ ¿ +è ° +è ĵĿ +í Ĩ +í ĭ +í ŀ +ð § +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ue +Ġ )). +Ġ čĊĠ +Ġ ()): +Ġ ãĢĤ +Ġ ï¼ļ +Ġ utcnow +Ġ åīį +Ġ 请 +Ġ ε +Ġ å½ĵåīį +Ġ 表示 +Ġ âĸĪâĸĪâķĹ +Ġ æľĢ大 +Ġ é¦ĸ +Ġ ultimate +Ġ ÙĩاÛĮ +ģ '), +į ìĬ¤íĬ¸ +ı è§Ī +ĠĠ ĉ +ĠĠĠ č +ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠ Ċ +ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +in cl +in vol +in band +in jected +in aci +in Audio +in vivo +er ddap +or ce +or os +or ario +or ama +or lose +on l +on de +on sets +on tap +at he +re x +re tr +re ff +re ive +re weight +re ticle +re straints +se v +se vir +se ña +Ġ= - +st x +st ew +st ks +st ren +st ools +st xo +en ca +Ġt ss +Ġt ed +Ġt date +Ġt ft +Ġt gs +Ġt map +Ġt utils +Ġt run +Ġt sec +Ġt ads +Ġt orsion +Ġt endency +Ġt ÃŃtulo +ar bitrary +al as +al ib +al liance +de ci +de als +de limit +de pression +de tached +de multiplex +le ek +le vs +an id +an tom +an cing +Ġi ap +Ġi cat +Ġi gb +Ġi ota +Ġi Zt +-- # +me lo +Ġ' = +Ġ' :: +Ġ' (? +ro filer +ti la +ti fi +ti alize +ti des +ti sm +mp d +mp h +mp v +mp ar +mp tion +Ġc us +Ġc ve +Ġc file +Ġc ts +Ġc group +Ġc bs +Ġc height +Ġc af +Ġc sd +Ġc rv +Ġc rab +Ġc ivis +Ġc atapult +Ġp save +Ġp ian +Ġp tu +Ġp unto +Ġp rtc +Ġp resident +Ġp ushes +Ġp antalla +Ġf ity +Ġf df +Ġf ref +Ġf lower +Ġf build +Ġf paths +Ġf ridge +Ġf lour +Ġf ides +Ġf usel +Ġf arthest +Ġf sspec +Ġ" {' +Ġ" ------ +Ġ" =", +Ġ" ``` +he lical +he xbin +## : +Ġa an +Ġa ad +Ġa po +Ġa bl +Ġa ges +Ġa udience +Ġa ims +Ġa coustic +lo te +lo mer +00 77 +00 49 +ge fahr +Ġn ss +Ġn ad +Ġn bs +Ġn features +Ġn gl +Ġn blocks +Ġn runs +Ġn lls +Ġs li +Ġs ad +Ġs data +Ġs ld +Ġs level +Ġs ake +Ġs gt +Ġs quee +Ġs AX +Ġs helter +Ġs TmpReg +ut ers +Ġin ew +Ġin flux +Ġin cons +Ġin consistency +Ġin Worksheet +Ġre buf +Ġre dash +Ġre started +self lessness +self ishness +ing ency +Ġo j +Ġo th +Ġo ob +Ġo tf +Ġo gg +Ġo cm +Ġo zone +Ġd F +Ġd path +Ġd year +Ġd dec +Ġd any +Ġd theta +Ġd ali +Ġd asem +ct d +ct eur +pe a +pe are +pe lican +un ed +un os +un ich +un struct +un equal +un wrap +un flatten +un related +un pause +Ġm ing +Ġm sm +Ġm cf +Ġm colors +Ġm lm +Ġm vir +Ġm ibr +Ġm nfld +ra ction +ra ds +ra isim +Ġe ul +Ġe str +Ġe do +Ġe mul +Ġe eg +Ġe poll +Ġe cvl +Ġe mso +---- | +---- ') +---- -\ +() ": +() }. +() [::- +fi ction +ue d +ent D +ent ina +ent reprise +ad di +ad vice +ad ay +ad opt +ad joint +ad mitted +ad icion +", )) +co ci +co assembly +co digo +co ulomb +ri en +ri sh +ri sing +Ġthe matic +Ġb ub +Ġb idx +Ġb ern +Ġb ail +Ġb ets +Ġb mk +Ġb kc +Ġ1 111 +Ġ# \ +Ġ# --- +ed own +11 30 +11 58 +11 69 +um ie +um bers +int ensive +id v +id an +id loc +id ai +Ġ( ", +Ġ( .) +Ġw g +Ġw and +Ġw pi +Ġw gt +Ġw ired +Ġw iring +ch im +ch train +ch own +ch ancel +ch uck +ch urch +ch aitanya +di me +di ch +di ode +di ente +di mento +): - +): ]. +Ġ[ ` +Ġ[ :, +ul n +ul wich +from Time +Ġif config +ot te +Ġfor ks +Ġfor ked +Ġfor nec +ol int +el er +el ink +': ([ +': '\ +es r +es ource +es cript +turn ed +Ġ+ ----------------- +is he +is ius +is coroutinefunction +val is +val obj +__ % +__ _\ +name text +name servers +get source +get parent +get Key +get Function +get attribute +get Default +get children +get fits +get Contours +get ctime +one amente +('  +(' == +(' [' +(' }\ +)) > +set list +set Type +set err +set pts +set trace +set Fill +set DefaultValue +Ġ- \ +Ġto u +Ġto w +Ġto me +Ġto urn +Ġto ko +Ġto uca +ĠT d +ĠT ro +ĠT ot +ĠT ou +ĠT RE +ĠT SS +ĠT ier +ĠT URN +ĠT SF +ĠT reatment +ĠT BD +ĠT utorial +xt d +il an +th ai +th ank +th rash +str m +con us +con ci +con servation +Ġ2 72 +Ġ2 160 +(" ---- +(" ########## +(" '") +(" ******************************************************** +pp c +as x +as mx +as aurus +iz i +et as +arg str +op f +op in +op ent +Ġ{ {\ +Ġ{ :,} +Ġ7 10 +Ġ7 18 +Ġ7 89 +ĠS ti +ĠS AR +ĠS SE +ĠS pl +ĠS IL +ĠS AME +ĠS ymb +ĠS izes +ĠS SIM +ĠS CAN +ĠS IX +ĠS liding +ĠS UNDAY +ab un +ab orted +ab sence +ab hishek +Ġof s +ĠC ape +ĠC lang +ĠC TA +ĠC NOT +ĠC VS +ĠC lar +ĠC hess +ĠC TU +ĠC ensus +ĠC ascade +ig UC +ht ar +up age +") ") +Ġdef ender +Ġg or +Ġg log +Ġg object +Ġg ait +Ġg rain +Ġg rown +Ġg yr +Ġg ismo +for es +for seti +ter ial +Ġr cond +Ġr tn +Ġr anging +Ġr hea +Ġr undra +Ġl ar +Ġl la +Ġl anel +Ġl unch +": % +data Path +ĠA pe +ĠA ri +ĠA sc +ĠA PT +ĠA rt +ĠA ven +ĠA sm +ĠA BI +ĠA PK +ĠA stro +ĠA frica +ĠA thena +sp inner +ult on +'] < +'] [:- +'] ]]]: +01 28 +01 21 +Ġcon son +Ġcon fs +Ġcon serv +ic at +am bul +to cs +to ward +to ordinal +99 88 +99 76 +99 54 +99 59 +par r +ist ion +ist ors +ĠF n +ĠF on +ĠF an +ĠF ired +ĠF OTA +ĠF ah +ĠF SW +ĠF rappe +ĠF uzz +ĠF OUR +ĠF ides +ĠF etches +ĠF abric +ĠF ugue +od oo +od hodnoLetalisce +sc rit +sc rolled +log Verbose +list Nodes +om ol +om nib +value B +value X +Ġh ol +Ġh ops +Ġh acer +** \ +all Songs +po ser +po cket +ta ker +ĠP Z +ĠP layers +ĠP late +ĠP itch +ĠP IE +ĠP Cre +ĠP MF +ĠP vt +ĠP LEASE +ĠP anda +ĠP uts +ĠP eriodic +ĠP rade +ĠP acote +Ġas g +Ġas pects +ĠI de +ĠI an +ĠI mplemented +ĠI TER +ĠI ContentType +file Label +file services +ĠL G +ĠL p +ĠL IN +ĠL ift +ĠL EA +ĠL INES +ub u +ub in +res u +tr TC +Ġth er +Ġth or +=' /') +Ġst c +Ġst ance +Ġst ft +Ġst raw +Ġst udi +Ġde queue +Ġde quantizer +Ġde activated +Ġde limiters +pro fits +0000 06 +0000 066 +Ġ""" { +form ated +ex position +ex pyfun +ex pertise +im resize +Ġex pos +Ġex cut +Ġex pyfun +able Doc +fig i +fig width +Ġ3 29 +Ġ3 62 +10 32 +10 89 +Ġprint out +Ġprint outs +out patient +out Audio +ĠD N +ĠD ar +ĠD un +ĠD om +ĠD AS +ĠD OT +ĠD SM +ĠD IG +ĠD RC +ĠD avis +ac b +ac fd +ac tively +Ġu ob +Ġu dim +Ġu cm +]) ([ +]) }") +]) +( +Re ss +Re master +Re constructor +Re lax +Re moval +app path +app admin +sh ir +sh ark +sh dfs +sh ields +Ġdata In +Ġdata array +Ġdata Base +ĠM U +ĠM p +ĠM ens +ĠM AD +ĠM SS +ĠM CC +ĠM att +ĠM xN +time gm +lab ama +xf fy +=" {}_ +Ġv qa +Ġv apor +Ġv álida +02 17 +02 38 +02 39 +02 49 +ew are +Ġ_ ), +Ġy am +Ġy title +Ġy off +Ġy offset +Ġy outs +Ġy yyy +Ġy esterday +ĠO x +ĠO pu +ĠO SC +ĠO VS +ĠO OI +ds v +ds db +Ġpar ame +Ġpar ul +Ġx out +Ġx sum +Ġx List +Ġx new +Ġx title +Ġx scale +Ġx tick +Ġx account +Ġx agents +Ġx ác +os as +os able +Ġse cts +Ġse mantics +Ġma v +Ġma sters +Ġma xcbar +que z +test network +test loader +test opts +test Parameterised +add Pair +add Items +add Switch +add Sphere +Ċĉĉ ĊĊĉ +ER VER +Ġstr SN +xe bu +xb at +xb ee +ure g +load file +ore p +ore gressive +ms m +ms r +ms marco +Ġ% \ +Ġ% }{{ +Ġme ls +Ġme mb +Ġme adowrun +our i +Ġpro tor +Ġpro kka +py o +py utils +py xel +py parsing +py Sat +py tesseract +py nguin +py scrabble +pre built +pre cise +pre mium +ls of +ap iv +ap unov +07 56 +07 46 +07 59 +xd fo +label List +ber ries +ber ita +ber noulli +are t +are lation +"] ]: +"] != +"] }), +ĠB read +ĠB ars +ĠB ME +ĠB mag +ĠB ench +ĠB ird +ĠB rightness +ĠB PF +ĠB ASIC +12 27 +12 53 +Ġname Space +ys a +ys la +ĠE A +ĠE F +ĠE u +ĠE pi +ĠE mit +ĠE fficiency +ĠE quipe +ĠE clipse +ĠE lizabeth +Ġj ira +Ġj avi +Ġj apan +Ġj asht +ci v +ob lin +ob bs +ob ama +ly rics +text file +text tt +size L +com ando +ĠN it +ĠN AT +ĠN ord +ĠN atom +ĠN itro +date Modified +date picker +ir radiance +num Units +Ġres olutions +user Info +Ġ4 84 +Ġ4 27 +Ġ4 57 +Ġ4 44 +Ġ4 98 +Ġ4 73 +Ġ4 58 +Ġ4 78 +ger r +ff d +Ġget Time +Ġget Offset +Ġget Topology +92 99 +92 64 +92 82 +92 76 +92 68 +tp s +tp air +col lege +In k +In de +In Text +In creasing +In Progress +In grese +ind re +ĠR J +ĠR uth +ĠR az +ĠR ocket +ĠR ANK +ĠR uby +ĠR enders +Ġun weighted +Ġun even +Ġun fortunately +Ġun documented +Ġun obtainium +Ġun idecode +Ġun touched +read Unit +read FList +Ġtest step +Ġlog book +Ġlog likelihood +32 016 +per name +oc l +oc n +oc chio +ph ony +son ian +// \ +ĠG d +ĠG y +ĠG CS +ĠG IST +ĠG LY +ĠG rouped +ĠG PDF +ĠG RPC +ĠG allery +ĠG ardens +Ġco loc +Ġco gent +EN ANCE +ĠW it +ĠW as +ĠW all +ĠW AS +ĠW ould +ĠW FS +ĠW hole +ĠW rapping +ĠW illiams +ho f +ho se +ho ge +ho yde +loc alized +loc idad +Ġout df +Ġout group +Con crete +Con solid +bu z +AR SE +AR PHRD +ĠV or +ĠV out +ĠV oid +ĠU PG +code book +Ġnum b +Ġnum Blocks +Ġnum aras +print v +print ers +param Map +Ġ5 88 +Ġ5 27 +Ġ5 90 +Ġ5 23 +Ġ5 45 +Ġ5 78 +Ġ5 68 +Ġhe brew +Ġhe uristics +mb is +). ''' +Ġan nu +Ġ__ _| +Ġen closed +Ġen rolled +che strator +min l +min ify +min heap +min Phi +Ġtime Series +Ġ> ") +18 23 +16 02 +16 32 +16 37 +16 000 +16 45 +16 29 +16 43 +16 52 +16 72 +line Elts +Ġk im +Ġk ann +Ġk pts +Ġk vs +Ġk ornia +Ġcol Number +Ġcol liding +Ġcol lateral +Ġro yalty +St ops +St uff +Ġpy G +Ġpy unit +Ġpy bind +Ġpy yaml +Ġpy ansys +Ġ6 10 +Ġ6 84 +Ġset points +ag han +ts lam +ts inghua +http bin +04 13 +04 15 +04 22 +04 95 +04 47 +04 48 +04 69 +Ġmodel Name +13 86 +13 48 +13 79 +og k +og den +lib png +06 01 +06 99 +06 85 +06 56 +06 39 +06 54 +06 1728 +ign er +ign ement +15 32 +15 13 +15 94 +15 86 +15 23 +15 28 +15 61 +15 926535 +SE CRE +ST RO +ST AFF +100 109100129 +max Y +ass word +ass calar +05 99 +05 08 +05 37 +05 77 +05 65 +Ġthis Layer +03 85 +03 63 +cs ystem +cs graph +we icloud +Ġop ti +Ġop func +Ġop ções +Ġch ol +Ġch own +Ġch ann +ax le +17 34 +17 23 +17 49 +93 11 +93 15 +93 44 +93 58 +lit erate +lit erature +14 14 +14 22 +14 85 +14 38 +14 45 +14 42 +14 81 +14 39 +Ġpre ench +Ġpre compute +Ġpre ço +Ġpre tend +Ġpre senter +uth or +ord on +Ġat s +Ġat ts +Ġat temps +Ġat uais +Ġby z +64 16 +64 64 +64 38 +error Code +base string +([ * +info max +LE Error +LE AF +LE MENTED +Type ViewSet +RE DU +Ġtra itlets +IC ER +IC AT +08 13 +08 22 +pi xbufs +Ġ\ { +Ġ\ _\ +ĠH B +ĠH S +ĠH ang +ĠH cs +ĠH AN +ĠH err +ĠH appy +ĠRe bounds +ĠRe moved +ĠRe covery +ĠRe gressor +ay ush +tain er +sub a +sub data +sub part +sub geometry +sub cool +sub reddits +Ġ{} .\ +Ġ{} ;\ +Ġ{} /{}'. +input Data +np m +mat ure +mat ive +Ġdi ary +Ġdi ou +Ġdi amond +df d +db ody +mit er +88 00 +88 99 +88 31 +eat o +comp ared +comp ilers +comp teur +comp laint +comp rimento +comp artments +Ġ` !! +34 19 +34 37 +34 42 +34 31 +34 71 +start file +Ġwe ig +ated SVD +09 12 +09 32 +09 05 +09 44 +09 77 +09 48 +09 74 +09 58 +84 14 +84 45 +ĠIn d +write Object +write Only +ere f +Ġkey value +Ġkey phrase +nd ash +nd Array +inter rog +gs cond +shape ly +lock ing +ak an +state less +Ġoutput dir +Ġoutput Bands +Ġpo z +Ġpo vez +Ġpo isoned +Ġsub types +Ġsub way +Ġsub commands +Ġsub problem +Ġsub division +Ġso cks +vel la +vel ation +yn ch +ception s +AM QP +AM atrix +96 18 +96 95 +96 26 +96 35 +96 76 +96 53 +Ġac ronym +Ġcomp atability +ĠCon tour +Ġnew l +Ġnew file +Ġnew relic +Ġall er +Ġall ure +Ġall Atoms +Ġall Games +55 54 +94 05 +94 09 +94 24 +94 85 +94 44 +94 52 +Ġcur y +Ġcur dir +Ġ} ;\ +Ġ} }{% +ĊĠĠĠĠ ĊĊĊ +Ġapp run +json b +()) }") +()) +"\ +node js +row Item +av V +av lov +Ġno Of +Ġno updated +87 16 +87 66 +no pe +no el +no server +AL A +AL AR +fic ado +fic ada +Data Entry +iv s +Ġla do +'. /{{{ +85 17 +85 37 +85 97 +85 75 +97 11 +97 25 +97 04 +97 24 +97 75 +97 68 +rid en +mi k +36 01 +36 22 +36 26 +36 98 +36 89 +36 21 +36 31 +Ġspe cular +=[ (- +Ġopen peerpower +Ġid c +Ġid ct +ĠK n +ĠK s +ĠK line +ĠK ay +ĠK PI +ĠK ingdom +ĠK EK +ĠK entucky +Ġuser PrincipalsResponse +95 18 +95 46 +95 79 +word Id +word cloud +lat ure +lat lng +view shed +run as +run env +86 96 +Ġtorch blocks +mon to +Ġdo ors +Ġdo colour +fa iss +fa ilo +Ġz b +Ġz igpy +################################ ####### +rit ter +Ġtrain set +Ġtrain Array +AG AIN +57 11 +57 12 +57 15 +57 76 +57 68 +57 296 +... > +... """ +Ġ8 09 +Ġext ens +Ġ| __/ +create File +create Curve +"), ], +ED Analyzer +reg rid +Res caling +ix map +Ġbo ots +Ġbo ÅŁ +Ġper pendicular +layer branch +Ġne on +env New +"," < +List Nodes +List AccessBindingsRequest +List NetworkOptions +current q +current Start +CO D +Ġunder line +man uel +md ump +Ġlo ses +66 97 +66 82 +AC M +AC CAA +AC QUIRE +Ġte ss +Ġte eth +Ġli ved +44 86 +44 98 +44 82 +44 51 +Ċĉĉĉ ĠĠĠ +cont ador +ns st +und ler +IM GS +Ġdis appeared +Ġ** -- +ENT ITIES +ler k +Ġadd ons +Des cul +Des erialization +75 00 +75 67 +new value +new Size +new sol +Ġtext size +Ġtext Output +cor ed +mail ings +Ġrun ghc +OT P +Ġnode DataArray +Ġnode pathString +ef ault +']) + +En ergies +En lla +En ggNumber +auth key +auth enticator +Ex oSM +ET RE +ET AB +ET EMPL +Id Info +var bin +var Name +fix ups +56 00 +56 05 +56 94 +56 313 +98 23 +Ġsp index +client JSON +move it +my key +my profile +my cloud +Ġmin Y +Ġmin es +Ġmin lon +Ġmin Length +Ġmin cbar +Ġmin dsdb +pop item +ĠUn lock +ĠUn bound +ĠUn structuredGrid +Po or +Po vez +box ed +box nind +Ġ(" __ +Me eting +uc f +Ac celer +method name +ĠOR ACLE +ĠQ L +ĠQ Point +ĠQ Sql +img url +Ġcolor ing +35 02 +35 92 +35 32 +35 14 +35 64 +35 84 +35 95 +35 23 +35 38 +35 39 +Descri bing +ud ad +ref meta +Value For +File Map +pri ma +AD irectory +save as +tim izer +Ġim array +Ġim mutability +Ġdf n +))) ), +',' %( +stat ÃŃstica +ĠSe maphore +Ġad vent +Ġad ler +Ġad vection +nn Buy +nn Sell +45 03 +45 39 +ĠAN AL +77 778 +zer oline +cent rics +item configure +the on +the ir +the oretic +ĠY Leaf +act ually +Ġrandom isation +Ġrandom Timer +ĠX ST +ĠX PATH +`` ): +Ġrow Type +Ġrow Id +Ġrow span +Ġarg Name +Ġarg vs +Ġbase url +CH AP +CH ALL +cc b +47 01 +47 93 +47 85 +47 91 +47 49 +47 41 +]] âĸĪâĸĪ +]] âĸĴ +Ġcode base +csv DataParser +event ually +101 3 +Str atified +ĠEx cept +las ificacion +Ġpos x +top ographic +Ġ<= > +cy pher +poch s +Status Dict +Status Response +Status Page +Set Up +Set Range +Set Mapper +Ġpython com +Ġpython osc +pl umber +pl ataform +IL SV +cord ion +Ġsk opt +Ġreg ridding +Test Client +Test Gen +Ġevent related +IB AI +Ġver os +Ch I +Ch ris +du ff +random ly +random ness +rop ical +UN ITY +gen proto +82 04 +82 86 +}) ? +}) [ +}) ]) +order edDict +Ġar ith +Ġar abic +46 18 +46 84 +46 33 +46 31 +46 78 +46 52 +ĠJ as +ĠJ ian +ĠJ Tol +107 3 +107 4 +107 9 +Log an +Log File +Log ged +Log Events +Lo Py +raph s +89 096 +options Count +options Must +DI ES +Ġ] '%( +70 93 +ld da +ld ots +open bins +assert CountEqual +Ġread thedocs +Un register +Ġq h +Ġq mid +Ġq radial +temp ertureSensor +tag idx +tag ym +TR X +TR ACES +sys admin +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ +UL ATIONS +To Port +ĠOption List +ĠPy game +ĠPy Mongo +ĠPy duino +ĠPy Unused +ĠPy Protected +Ġ''' # +DO G +DO CTEST +De formation +De coding +De bit +De vanagari +Ġval e +Ġval ign +Time Range +о Ñı +={ { +65 02 +65 06 +65 05 +65 44 +Ġdb l +Ġdb conf +Ġdb motif +Ġdb PrivateKey +MP CAPS +67 07 +cat alyst +43 11 +Ġsource code +cl fs +Ġup dat +Ġup loads +Ġup wards +Ġcor ed +ĠPro d +ĠPro duce +ĠPro ducer +ĠPro cedure +ĠPro tein +Ġplot y +uid a +ĠList ener +ins z +ins ns +ins ilico +:: % +:: ** +Ġnet app +Ġnet ns +Ġnet miko +SI P +SI b +ug ation +cu encia +''' (? +context pred +48 16 +48 25 +48 19 +48 34 +48 000 +ðŁı´ółģ ¯ółģŃółģ +sv l +)* (- +Parser States +Ġimg List +EX OD +FA DE +err ing +red hat +red undant +Ġfirst Iteration +No vember +total Cells +ze go +\\ , +mode lo +mode la +ãģ ¸ +ãģ Ķ +Ġtemp TileTab +])) ( +])) * +])) ): +msg List +last nm +last TreeMap +last rowid +project euler +Ġpri hodnoLetalisce +Model Grid +Ġprocess String +Ġcontinue d +")) ; +")) ). +ï¼ İ +ï¼ ĺ +ï¼ Ļ +axis width +ĠIS C +server Port +ĠÐ ķ +post ure +cli pper +Ġback ing +Ġback testing +Ġback propagation +Ġtag name +Get Index +Get Property +Get PodOptions +Node T +Node File +76 07 +xy yy +81 99 +Ġbreak points +Ġsum marizer +001 0000 +Add PomeriumServiceAccountResponse +Ġfa hrenheit +bar a +bar h +Ġele s +Ġed uc +Ġlast Date +erate ly +Ġchar ms +tmp LFN +Ġtoken list +TO C +TO O +TO UR +TO COL +ren w +ik k +Tra der +Tra verse +1011 011 +Key Version +Ġauth z +Vi a +Ġoff ence +cv ss +74 86 +within Seq +Ġobj nuv +MO DS +Ġtop most +less ons +01111 10000 +]), [ +73 84 +dis miss +fit nesses +datetime format +String Value +Object FileName +Object FileTypeCode +Comp te +Comp ly +Bo hr +ush en +ful ness +adj list +first nm +Le o +Le ague +Le gis +Class Type +Ġiniti ation +edge pred +edge wall +Ġsupp ose +58 13 +58 05 +58 27 +fore ach +fore points +fore stry +State Key +State Effector +pr sco +pr erun +Ser ving +gr lex +dist ilbert +ĠTest Base +Reg istrar +и ÑĢ +Ġ16 384 +pol lo +Ġbin val +Ġbin om +Ġbot x +change list +User List +User Login +59 55 +seq map +seq vae +pen n +sw elling +Ġproject Modules +CA a +CA aD +spec gram +53 32 +Trans ceiver +static derived +qui la +ãĥ ĵ +Ġav sc +Access Preview +Ġpage size +Th readed +Th rashed +pb xproj +Ġsession no +Ġsession Id +ia world +çļĦ æīĢæľī +çļĦ 缮å½ķ +çļĦ æĿĥéĻIJ +ĠPython CI +PL Y +PL ACEMENT +pack a +Ġblock fs +fs l +unit proba +ĠUser Input +Of File +Of Line +Of ManagementZone +QU IET +62 87 +Up loads +ank i +WAR RANT +)[ ^ +ÑĤ а +ÑĤ еÑĢ +Sh allow +Sh arp +Image Type +Int ens +lip ped +lip ines +disp on +ÑĢ ÑĬ +Ġmap box +ĠPath Type +ĠPath ControlXInterface +header hash +Def ensive +Ġ". /" +Loc ate ++' & ++' "' +Ġter cei +SC M +su ff +Ġsorted list +Context Manager +sim bert +202 00 +202 102 +Ġfi la +stream handler +CC VS +Ġgl Vertex +Ġgl Enable +IO Loop +na Test +ĠID urnika +Ġtask Id +med it +Create TableRequest +Ġmy server +prot olint +Ġtri age +Tx Byte +Ġph iloc +Ġsa mplers +fla re +API Error +execute Hive +Qu otient +keep dim +ĠFor ma +Ġheight map +fp ae +dec sec +Client Builder +Client Power +mod ulo +ink ing +medi awiki +('\ '{ +Ġoper ação +full monte +Rx Byte +has ATA +has Next +diff exp +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +era de +ĠCh rist +ĠNOT FOUND +ĠMed ic +Ġshow Progress +Ġshow Animate +Ġmark ovi +tex as +ĠImage List +ĠImage Result +ĠImage Stream +ven us +Py C +Py th +Py torch +inst ar +inst apaper +Ġmean var +resource Type +az ir +ĠTh resh +ĠTh ermal +For Day +Ġvis py +äº ¦ +pg y +ĠDict Config +ĠDict Mixin +é du +Sp inner +Sp acer +Sp irit +cel lid +directory ToUnzipTo +Ġnon lin +pair ing +Ġinfo str +Ġinfo max +Ġclo ses +Ġclo sely +Ġedge Splitter +æķ ij +les ion +FL UX +bit rarily +PR ICES +PR EROUTING +ĠMe aly +Group Index +Ġret Str +Ġret SiteMap +Ġret inanet +active Interval +ĠDE LETED +____ _| +ee info +Ġact ualizado +DS R +Ġpost proc +web console +++ " +++ \ +Ġfin ance +Sub system +Sub scribe +side bars +sql session +af r +ĠZ hone +Ġparent dir +ĠEn hanced +Ġì ½Ķëĵľ +Ġcfg v +Ġcfg file +django apps +light on +light year +fin Pitch +gb its +GB Q +GB T +GB Regressor +Ġans w +stats d +stats models +hex sha +Ġbest move +Dis covered +nb d +nb its +nb atches +]+ )') +NE CTOR +zip s +Tensor Like +tt c +Ġcho colate +ha el +ha proxy +xde y +ĠFile Status +ĠFile StatusType +Port List +grad x +He ads +ĠAdd New +Return ing +supp l +åħ µ +Ġ'% ', +Ġkernel pkg +price High +price Low +draw s +Ġcomple ter +Ġ13 37 +Ġ14 30 +summary Stats +Te ff +mount point +áĥ ª +Function Component +sd n +sd conv +Ġlayer Values +Ġlayer branch +ĠCheck Box +Ġpick er +Per c +Per Pr +Or Update +xad o +eff c +Ġsw ing +Ġsw ener +xcc L +xcc f +zero es +." }) +Ġspec grams +cm st +á g +á rias +xcd F +ĠLe ader +ek f +ek t +ĠConfig Loader +ĠComp ressed +xab H +imp ression +Ġmer id +Ġmer kle +hand yman +"} : +Date Form +Date Picker +Load ers +Load Library +NA IL +Array Slice +sequence d +æķ° ãĤĴ +CI X +ĠRun off +storage services +Ċĉĉĉĉĉ ĠĠ +Ġerr code +Ġerr Str +Mat rices +Ġweb pack +Ġest amos +ASS OCI +BL IND +BL ENDO +ote ls +multi process +multi lined +Ġmc d +Ġmc python +Ġmc Fan +Ġsuper vision +Ġsuper pmi +Process CreateTime +Process UserTime +POST ROUTING +long long +ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +vers ary +ĠPRO TOCOL +sec comp +ĠTime line +Ġgen res +ĠPo le +xdc r +STR INGS ++" ', +All Folder +All UpdatesRule +Box Width +nan median +Ġempty buttons +Ġ"% { +Ġsm ile +cer tain +dr f +Ġkeep alive +framework configuration +Mo h +Mo strar +pub hits +On un +å® « +seg mask +Ġdisplay io +custom user +custom DataType +Ro I +Ro yalty +ĠModel Config +inf ob +rb frame +ĠHttp Error +tk list +Ġconf used +Ġconf luent +Ġservice List +Ġinitial ising +TP DT +Ġwait Release +]], [ +INFO S +fail safe +GL X +GL double +ठª +ठµ +ठľ +Resource Requirements +Ġresource Type +GG CT +GG TTT +vol atilities +Ġfolder Dict +xF AD +xF CB +Is Local +Is Authenticated +OS PF +tool sets +Core Error +Ext er +Ext reme +End Point +FR Block +short hand +ĠNum ba +Ġdraw Animate +ĠAuth Token +Ph rases +gh env +Ġcore clr +GE E +Valid ators +Total Surface +pdf Path +tab lissement +Ġdon ation +SO A +SO ME +Min ute +Min imo +Min imizer +čĊĠ čĊ +Ġtr usec +Server Proxy +xs lt +Char acters +Di GS +Ġve locidade +Query Result +Ip E +Ip VK +Ġfun coes +ĠAl phabet +ĠAl though +ĠAl catel +9999 99999 +Ġsin h +fici encies +hour ss +hist Img +Source Args +volume High +volume Low +Ġfra ctal +member configuration +Ġcap a +Ġcap fd +component Name +Graph Name +Graph JSON +ĠPre c +ĠPre sent +ĠPre ference +ĠSh utdown +pa res +Ġfast mvsnet +Search Strategy +ĠPer m +bi jectors +ä¸Ģ ä¸ĭ +ä¸Ģ äºĽ +ä¸Ģ èĪ¬ +download ing +exc ited +exc iton +ĠPlot ter +)} ] +)} }, +=% - +Ġthese Keys +Down Button +Row Panel +bb d +ĠFunction Transformer +LA W +atom y +initial State +Ġip f +clear Events +MB h +Ġclean ly +MIN IMAP +ÃŃ san +ĠRE Q +ĠRE PEAT +ĠRE POSITORY +Cal houn +Ġpas cal +Ġë ² +AND ROID +Device Id +Device Info +Device Label +VENT ORY +car toon +CR F +support al +ĠSer vi +START PTS +Ġpop n +IZ ERS +Stream Reader +Stream Proc +OB SERV +Ġmod ular +Ġmod ulation +Ġ"+ ": +Ġradi an +Op V +moved im +)') ; +after noon +stock Code +}/ ') +Ġtick font +New Type +Ġvideo Name +Ġauto complete +ĠTrans fo +gu in +gu arded +From Port +Update Form +desc s +sym CoinGame +Ġ'# ', +bus queda +Binary Op +ĠLO CK +Ġdiff opts +UU GG +CONT INUOUS +Control ContainerMessage +just e +Ġæ Ļ +004 18 +Ġrel ates +ĠSub Resource +ĠSub graphTypes +boot style +liter ation +Ġ19 80 +åº « +sn akes +MT F +ĠOpen PN +ĠOpen AIGPT +parameter Name +gal actic +mar ine +ĠRed uced +tw ine +tw alk +Ġforce CTAList +Ġum ap +Classifier Name +agg type +500 03 +Ġbit string +abi en +mass ist +akes peare +ĠInter section +fun nel +pkg config +With DeliLine +NB q +Bu ck +ĠTensor RT +dash boards +DU INO +Default Router +Ġpossible Comment +ó dico +ı ÄŁ +ĠDo ppler +åį Ĺ +ĠEN SO +Mem Setup +miss iles +wb c +Back ward +Sa o +ĠField List +ĠField DataType +ĠField RowPanel +orn os +SET AVATAR +simple Type +Ver key +gl ut +gl Bind +gl fw +Ġmp math +------------------------------------------------ -------- +Ġdev type +Ġdev ito +éĩ İ +ĠRequest Error +ĠRequest State +PH C +PH I +PH OT +wrap ERC +ĠIMP LEMENTED +Ġcat enets +个 好 +cid as +Ġho liday +Ġ"{} \ +Ġ'{} : +³ółģ ¤ółģ¿ +MAN Y +MAN DATORY +]} ] +NS W +eve tech +BR ID +BR AND +BR ICK +============ ') +safe TransferFrom +OPT IMAL +DD DD +world map +Ġap ós +charge Region +Top o +look ahead +Ġexc itations +Ġaccept orPos +ĠST L +ĠST AND +ĠST ORE +ĠST ORED +rec tilinear +è® ® +Grid History +Grid MixIn +LS R +inv itro +same As +flo p +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +COMP ILE +Page Number +TRI G +TRI ANGLE +}} { +ĠJSON Parser +Ġdes ispec +hello world +FORMAT TER +ada delta +################################################ ####### +)' ", +PC F +Ġflow m +sy nt +HTTP Status +HTTP Provider +First ArraySlice +ĠLight GBM +Ġclear ance +ĠClass room +ĠText Blob +ĠDi jkstra +Ġп ожал +erm ite +itter gefahr +010000 1111 +Instance Error +Ġvol untário +ĠCallable Registry +ĠCallable ParamRegistry +Ġ(_ | +UC F +UC i +ãĢĤ \ +ä¸į åı¯ +ah sin +ĠSH APE +\" % +ĠNe il +esc uelas +ĠSE PARATOR +power set +Series Type +mol leweide +Ġque m +wiki quote +Ġenter prises +æī ¿ +æī ¹éĩı +Ġep hem +Ġbbox A +icon Size +Author ized +Ġdig s +switch erLoc +ĠRo y +bul ges +sal ario +Parameter Key +att end +sentence piece +Vis cL +Vis cUMan +star map +star red +ĠDec rypt +Ġsen list +Ġterm generator +Sele cione +ĠBE ER +ĠBE FORE +Ġsaved ir +ĠRead Resp +Ġdepend ant +ino tify +rum b +REG ULAR +break ing +Unit test +TOKEN MAPPING +Ġtw ill +Ġgt mcore +ĠAS R +Ġcross ref +ĠValid ates +ĠSQL Context +ĠSQL STATE +ati ally +ĠMake file +VAR ARG +Ġhidden W +tu u +ĠAD MM +nc ml +Ńółģ ¯ółģ¿ +equ ity +Ġpoly a +ĠDark net +ĠNet App +serial Number +Ġturn on +Ġdot dict +PN P +Ġsq r +Ġsq norm +ĠTra cer +ĠTra versal +ï¼ļ { +tel le +ĠDevice Exception +Mock AccessPreview +clusters pec +Ġprogress ive +Ġnx os +wi ener +gi co +MD k +Val uation +为 å¿ħ +Ġpol Phi +Sign ificant +iso dic +yl vania +Multi LineString +square XPos +square YPos +Work ers +ctsp OperSgaclMapping +My Admin +ĠOf ficial +BA KE +RA STER +bc g +archive Dir +condition er +Ġvo x +Ġfreq ghz +Ġinsert width +orph ans +~~~~~~~~~~~~~~~~ ~~~~~~~~ +ĠToken ize +Ġsn model +Ġsn ail +Ġsn appy +ĠMulti cast +organ ize +emp loyment +Admin Status +PA nn +PA LETT +Ġna pts +Producer KF +Ġmatching Symbols +è¦ ĸ +Ġtab tran +Ġtab ela +Ġpkg Name +Ġpla ser +Scalar Type +Ġanaly tic +MIT TED +Ġcomplex es +¡ółģ £ółģ¿ +Url Format +Float Opt +Float Slider +hub System +ĠAs semble +PARAM ETRE +Tri ggers +variance s +Ġpp in +Current Status +pet name +åľ¨ 家 +Script Compositions +uk i +solution Path +Ġcompare path +partition ed +ĠMax NLocator +Ġmag enta +ëĭ ī +Ġsyn aptic +Nodes Data +132 2 +Stop Iteration +Ġusage s +Ġregex es +Ġless ons +Ġgrad cam +Ġlight bus +geo coders +execution Time +åĩº ä¾Ĩ +Ġsol vable +032 3 +Ġsy loga +Bot Chat +Ġfe ers +INTER IOR +Ġred mapper +lf w +Header File +ĠService Error +squ ar +squ idpy +æĪIJ 交 +ĠMin uit +Ġir regular +AK ER +ĠParameter Error +ĠParameter Key +micro python +ĠMO VED +bre ath +("[ % +ú s +ú y +specific Matrix +('[ % +Ġprior ities +fb ank +sci av +har ry +Ab undance +ĠCur ses +NET S +Ġ================================================================= ================================================ +Ġmac OS +retri able +Ùħ ت +ç¬ ij +Ġtemperature float +Ġ"[ ", +Ġ"[ ": +proj Tr +Reference Args +primary field +GPU db +PK L +flu ids +gc D +ä¼ ´ +dw Flags +Style JSON +ĠBe i +LR P +comb obox +Print Msg +Ġbad guy +£ółģ ¡ółģ¿ +special attack +SUB TRACT +pot ted +Ġpretrained models +ĠBl ank +NT PT +NT ASKS +Ġwhite point +Ġaddr R +('.') [: +Cor re +Cor relations +Cor porate +xFF B +ĠSP M +Import ant +Pr D +Pr ince +Ġnu clear +ĠTimestamp s +ĠInt ro +Debug Point +half prod +half Span +еÑĢ ж +Ġrelation al +ĠTEST ED +WA VE +Ġ"* /*", +Ġden omin +åĪĨ ä»ĺ +ftp server +ĠCustom s +ĠMet ropolis +APP END +Ġquestion naire +ðŁı´ółģŃółģ ºółģ +Ġaz im +Ġaz lmb +éĹ ľ +964 4 +Ġ---------------- ------------- +ĠPost ing +ĠPost Form +################################################################################ # +################################################################################ #### +################################################################################ ######### +Metadata Value +ÑģÑĤ в +Ġann data +Ġв ид +Ġв ÑĢемÑı +Remove NodeOptions +Remove ContainerOptions +ĠBlock s +MR i +[] ' +Ġocc asionally +hold out +Ġí ijľ +Ġí ı¬ +å¹ ¾ +Build Context +Ġregular ized +Ġregular izers +375 08 +ĠEntity Type +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +Ġorgan isms +ĠSU FFIX +ĠConv olve +406 2 +406 7 +Dialog ue +Pair wise +nf log +Ġ------------------------------------------------ ------ +Card Type +Card Num +Ġmultip lies +SK VS +SK ILL +Ġproto s +Embed ded +Ġdiag nosis +Modi fying +п олÑĥÑĩ +Ġwave forms +Player Info +REF INE +OD Y +Ġspecial String +Hello Req +Hello Resp +åij Ī +ìĿ´ ì§Ģ +Ġent ers +Ġserial ise +Ġbi quad +Ġaddition ally +å¸ Ŀ +ÙĪ ÙĦ +ÙĪ Ù¹ +903 7 +Constant ModN +AU DI +Ġ'[ { +ĊĊĊĊĊĊĊĊ ĊĊĊ +ĠSign Up +Split s +notify Global +PD w +ĠQue ens +cher ry +Ġcy linder +Ġcy clic +cnn lstm +qV Qq +ĠWork shop +395 3 +Empty PairLocList +mal formed +ан а +RUN S +RUN PATH +м ен +æµ ıè§Ī +Ġdr zave +897 5 +Amount In +Amount Out +ÙĨ Ú© +ĠVer bosity +aggreg ates +vr w +ĠRO Is +ĠValidation Exception +LF y +对 äºİ +ĠHO ME +('# ', +Ġatt ns +å¦ ¨ +Ġ*** " +ãĥ¼ ãĤ¯ +Vlan Mode +ìĦ ¤ +ðŁı´ółģ¬ółģ © +ĠPort folios +386 7 +prog Bar +Ġ65 27 +LOCAL ID +MK B +MK TG +Word Sn +Cons ult +Cons istency +El se +Send Message +ĠMap ped +Cla ims +war ranty +ĠSci Py +apis erver +CONTRO LS +arrow Width +COR RECTION +suc cesses +Ġstar fish +]; [ +以 ä¸ĭ +Wait For +æ¬ ² +Ġoccur ing +sun light +LIB S +Ġ85 0 +Ġsoft fab +weather map +PROC ESSED +408 2 +DJ Z +Func Expr +fire Claim +fire Zap +aud Rate +pv Controller +wire map +ĠAction Type +ĠShow PlatformHardware +ĠDire ctories +Ġbind Transform +ĠпÑĢ а +ĠпÑĢ оÑģÑĤ +Ġ-------------------------------- ------- +405 8 +hu iming +ÑĨ а +CG TT +MED V +Metric Summary +Metric StatusDict +Ġ[{' $ +355 5 +355 7 +Ġang ry +Ġfire bird +Ġanchor Origin +MF n +Timeout Expired +approx imate +407 3 +ĠContext ual +Ġcs graph +ADD ON +("_ "): +Library Version +ĠCall Back +customer care +perf tests +lem matizer +Prefix Digit +Ġamp el +æİ¥ æĶ¶ +Adam W +357 4 +ìŀ Ħ +ĠLOG IN +ĠSELECT ED +Ġaugment er +Ġ################ ### +REPL ICATE +ĠSchema Parser +Ġд оÑģÑĤ +fbx Skin +coco a +('{ { ++') ' +Cent ro +ìĹ ° +WC x +Ġ([ ], +regression s +ĠAddress A +ĠLinear SegmentedColormap +ĠSUB MISSION +Inte grate +æ³ķ 人 +/? $", +ĠSelect Field +)? ( +ĠCY AN +Ġcorre lacion +toc sc +077 20 +ðŁı´ółģ£ółģ § +LINK FLAGS +Ġ"," [ +请 éĩįæĸ° +409 1 +ĠMac Address +åĽŀ è°ĥ +alloc ators +Ġgd spy +Colour space +éĽ £ +éĽ Ħ +ĠEmail s +ĠInst agram +Equ ity +Equ iv +Ste ep +è n +Big Bang +RR P +ita ire +('" % +ĠHome page +cached property +SPE CS +craft ed +must Comply +ĠExec utable +Move ment +ongs ide +ĠCre ative +466 9 +432 3 +áĦ ħ +Ġsens ible +ograph s +Ans atz +Diff use +LM DB +Security System +AUT OM +ел ÑĮ +ел еж +ìł Ī +ìł IJ +938 27 +ĠProduct Type +æ° ı +ðŁı´ółģ¢ółģ ¢ +ĠAut onomous +Threshold Length +ĠAns wers +ĠFin der +Geometry Shader +oct ave +quat Mad +ĠLE ARN +NP p +ĠTarget s +ÑĢаР±Ð¾ÑĤ +æľĢ æĸ° +æľĢ åIJİ +æľĢ ç»Ī +Ġ################################ ########### +Ġз наÑĩ +Bit te +jump er +jump scale +¯ółģ ²ółģ¿ +ĠLevel s +wr k +ĠGaffer Image +heap ify +Ġdesign ate +warp ing +¨ółģ ¡ółģ¿ +Ġsudo ers +ĠPool ing +058 16 +uclide Result +Details Response +ت ا +ĠBasic Auth +ðŁı´ółģ¡ółģ Ńółģ +GAT TT +Ġmut ex +Na Cl +ĠAccess Control +FB rowser +sco ping +Ġprom oted +mJ i +Ġrcl Factors +Remote Jw +hm ann +Ġsal aris +ед ел +additional Properties +ctr ine +curl ine +Ġpeak Value +íķĺ ê³ł +aro on +Ġ================= ========= +Ġsun set +ĠFormat ted +Ġ#---------------------------------------------------------------- ---------- +dead be +ĠSa ver +æŁ¥ æī¾ +434 3 +Ġpb k +Ġquad mesh +Ġquad radiusr +Hook Name +Hook Ex +Ġsuppress ing +CAN NOT +Ġ « +ĠNon linear +ĠGeneric FormSet +Ġsay i +475 4 +QR adioButton +ĠCONFIG UR +likelihood s +Master Metadata +bas al +ĠÑĤ ÑĢ +bal sa +Section Error +ал и +care home +pC ryptor +Ġbug gy +ĠHand shake +CW DM +How ard +Ġ115 200 +Ñĸ Ñı +Ġ[% ] +door way +ĠBox Layout +capture bat +KER N +ĠHE OS ++) $', +ãģ§ ãģ¯ +Ġke el +refer ent +$$$$ $$ +zc z +ometri cal +hal ted +Speci alized +Zero DivisionError +Ġpay er +ô me +}% , +ĠCent OS +ĠFast a +éĺ ¶ +PATCH ES +AAA AT +artifact Id +Bus ca +Oct ober +åĵ ²å®Ĺ +Ġau ctions +Ġcommunic ator +dD r +Ġol du +elt UMan +scroll bar +ĠPower Output +='# ') +设 å¤ĩ +VARI ANCE +åŁ · +Ġcid rs +Ġbroadcast ing +flex ible +('* ' +======= ") +Endpoint Address +Dummy RecBase +Green let +Mass Flux +ä¸ī åĢĭ +ä¸ī åĽĽ +ä¸ī ç®ĩ +Async Client +Ġttk bootstrap +Ġsup ress +Ġaccounts Trx +paper ai +White Mode +ĠFramework Version +ĠFramework Configuration +Ġlot tery +Ġiss uing +ĠEqu ity +Ġ74 97 +Pur due +fP n +Ġsem ver +Ġsem Rows +Ġsem Cols +fan Art +Fbx LayerElement +Qa D +Qa hat +Qa DT +Ġgp flow +Short Name +Parent heses +Ġima gename +ĠWait er +Quanti dade +xD y +г о +Ġil k +quick start +ĠMIN IMUM +datal ab +Ġ-------------------------------------------------------------------------------- - +QCA QC +Ġalter ing +éĻIJ å®ļ +áĥIJáĥ Ļ +Ġix network +âĸĴ [[ +Ġnc bi +Ġnc ands +Ġconver tion +Ġlibs alt +ĠOptim al +Echo Cancel +Ġspread sheets +ĠCopy ing +ĠMatch er +Es se +omb ie +ìľ ¨ +Ġtok val +ĠRot ary +ĠRelease Level +Ġ`{ { +ðŁı´ółģ«ółģ ° +ä¿Ŀ è¯ģ +æĿ¥ èĩª +Cri me +Gas Meter +Ġmilli meters +Ġfood item +bib tex +bib lio +vil no +Ġ× IJ +æ¯ı ä¸Ģ个 +Ġ}} ')) +356 9 +Ġmoment o +ĠOct ets +ĠOct ober +Qual ified +Ġusd Geom +ĠSTAT S +Gra sp +Ġheart beep +ĠComplex Type +Gw Name +Ġèİ·åıĸ å½ĵåīį +Cancel ResponseWrapper +Nav Object +Payload Record +Primary Vertices +åįģ ä¸ĩ +Plan o +Rq N +Ġfault y +LogLevel s +/_ / +ÏĦ ικ +("* " +ĠRange s +Shared Cooldown +ĠAC COUNT +Cookie Jar +Geo coder +Sequential DoublyRobust +sta inger +Ġatualiz adas +Ùģ ت +Ġsit ename +Ġappe ared +ĠFri end +Confirm AddTaskAdmin +Confirm AddTaskOwner +Confirm RemoveTaskAdmin +Confirm RemoveTaskOwner +еÑģ Ñı +åºĶ çĶ¨ +Fx link +award ing +uáº Ń +Dev Tiers +foot ball +Har vest +Har vard +ο ι +ridd le +Ġnecess idades +Ġ'^ ': +ĠGR N +strand Over +ValueType Context +Est ablish +ĠLiteral Parser +ĠQU OT +FM eltUMan +Ġ02 111 +ĠMask ing +DST ENCIL +ĠSte phen +Clip To +Dif fs +Mal tego +ĠNV DA +000000001 000000001 +Performance WP +Performance PayloadRecord +YEAR S +xAB A +Ġamb assador +ĠVol unteer +ĠVol untário +ĠVol unteers +Under stand +stellar mass +Ġautom ation +ółĢ²ółĢ ¹ółģ¿ +âķļ âĸĪâĸĪâĸĪâĸĪ +ðŁı´ółģ¬ółģ¶ ółĢ± +ìĬ¤ íģ¬ +}| {:^ +ĠSGACL s +Gre aterThan +Ġvl ss +ĠBound aries +ãĤ¿ ãĤ° +sit uation +éħįç½® ä¿¡æģ¯ +çŃī äºİ +492 1 +osg GA +Ġspectral Index +KK K +Ġtdk lib +Rn R +Ġbla de +Fast a +ĠOrigin ally +ĠGPS O +Room s +sear chels +Design ated +ðŁı´ółģ¥ółģ ´ółģ +Em ulate +Em ulator +Ġdri ll +adaptive Threshold +Ġlem mat +åħ¶ ä¸Ń +ĠENV IRONMENT +smb client +è³ Ĭ +umber land +Expand ing +Expand WordSn +ĠNormal ised +Ġsb plt +Ġosc illation +ĠTurn s +ĠKernel Density +BOUND ING +Ġdas hed +Ġ((( _ +":{" $ +Ġprox mox +ĠBay ramı +Behavior Item +mop ool +attri butions +Ġbm ds +LOGG ED +north western +WI K +ĠMag Meter +Ġstartup info +1011011011 0000000000000 +å¼ķ çĶ¨ +ç¾ Ĭ +Ġdn stwister +forge eks +4444 44 +Ġft sel +Ġsus ceptible +lift sim +lift Over +("__ "): +ĠMi xture +на Ñı +Anim ated +Ġannual Demand +GCELL HO +dyn spec +fault y +chro tron +ĠAct uating +Ġmeth ylation +auction Period +BTC USDT +ë³ Ħ +åĪ© çĶ¨ +ĠDoes n +Matching Parameter +Matching Engine +RMS D +fre ertos +Ġkingdom s +Chrome Options +ç½ij æł¼ +catch ing +Ïģ α +Ø´ Ùħ +('| ')[ +ĠFactor s +LOSS ES +SUR G +zu lip +Ġmaintain s +ĠRight HoppableLocList +OPS IS +jU a +èĻ İ +ĠDif ference +ĠInstrument s +ĠOrgan ism +EAR LY +Ġ1234 567 +Hero Positions +Ġbor is +ĠSSH Client +Ġgeop otential +绣 ä¸Ģ +allo ff +Ġpal indrome +Ġpal pite +Ġpix loc +Ġegg RotBBox +Ġwest PartCoords +Ġrw Factory +FileSystem Finder +Ġelimin ating +izz es +audi obook +ĠLeft HoppableLocList +Tot als +è°ĥ è¯ķ +Ġsom ar +ĠFo ot +tsk id +Chat Id +Vehicle API +С ÑĤаÑĤ +ĠÙħ ا +Ġaw spfx +ĠAlex Net +LEAR N +GetStatus Request +636 17368 +Wire less +Ġbk user +Gr anted +Ġeast PartCoords +broad com +Resid uals +UNIC ORN +ä¹Ł å°±æĺ¯ +µółĢ µółģ¿ +µółĢ ·ółģ¿ +µółĢ ¹ółģ¿ +ìĺ ģ +ĠScan Code +spar ser +ĠPas co +Ġmach inery +gro k +ĠBri an +copyfile obj +]+) $', +ajax Flag +ĠWORK ING +ĠDynOv Exp +ACCA AA +è¯į æ±ĩ +Imm utable +Ġcone ct +ĠAnn Data +ĠDist roMapping +ĠDist ilBert +Ġtriple ts +Ġnucle us +COLOUR S +Frozen Set +Sales APIClient +blo cos +Ġincre ments +ĠAG ENTS +ĠDele tes +ĠMal formed +æĺİ æĹ¥ +SOCIAL ACCOUNT +BadRequest Exception +Ġ#---------------- - +appear ances +ĠVeri fied +Ops Key +eig val +ĠоÑĤ веÑĤ +Ġsfp TransCode +Ġskeleton Obj +consu mes +ĠìĦ ± +Organ isation +Maps Dir +Maps DictList +åľĨ å½¢ +å¼¹ æĢ§ +alex a +meme temps +INV ITE +Ġknee angle +ĠHandler Type +CIP HER +ĠSyn chron +ĠdeÄŁ iÅŁkenin +EXPI RES +EXPI RY +ам и +replicate Dict +("," ))) +Xa vier +wat son +wat che +etsys NacApplianceMIB +ĠSelf Describing +Sleep ing +Ġslide Index +ĠBer keley +ICON DA +ĠObtain s +ĠShort cut +Unique Constraint +mist une +ÑĬ нÑĪ +Ġfoot print +ãĥķãĤ £ +Ir regular +voting policy +adult s +poss um +ĠRecipe Maintainer +Identi fy +Share holdings +овеÑĢ Ñıем +CLOUD WATCH +ç¡® å®ļ +ì² ľ +Ġsam cli +Ġvac uum +Excel File +ãģı ãģł +Launch er +ZH ONE +xcode proj +×Ķ ×¢ +getNode Config +Ġadverti se +these Keys +容 éĩı +çķ¶ æĻĤ +æĴ Ń +varx ravel +pkt log +quantization Step +Budget Amount +Ġot ter +ĠæĹ ł +å±± 寨 +ĠìĿ´ ìļ© +æ°´æŀª ä½įç½® +Ġcrystal lographic +ë° ¥ +ĠâĸĴ âĸij +Ġmg mt +Ġru amel +scar let +æī¾ ä¸įåĪ° +cis intern +Ġpear ll +Ġsor u +ĠRay theon +ĠGP US +7483 648 +Mes senger +Ġfed learner +Cool er +ãĥ¡ ãĥĥ +instanti ated +Ber noulli +Jwt Header +Ġdomin ant +Ġbq skit +Ġrsi ValueArrs +Ġconvex ity +Managed Objects +busy box +è¾¹ çļĦ +Ġhamming Distance +ĠLABEL S +Tf Idf +xform Op +Ġcrow ding +("=") + +paralle lize +LETT ERS +BAN Q +PDB s +Ġion izing +Ġcra shed +ĠInser ter +SCR ATCH +Dri ving +Rich ard +sie ge +ĠdJ db +ĠdJ dW +ĠGrad Cam +Then Average +ĠLinked In +ĠTrust Sec +ASC RIPT +详 ç»Ĩ +Ġëį°ìĿ´íĦ° 를 +ĠWeighted SequentialDoublyRobust +Clay more +YC LE +ĠLand sat +ĠChunk Matcher +OPTIM A +ĠвÑĭ вод +Heading WithDeliLine +Rock s +Vin List +reco il +hemer is +ĠCamp o +ĠAu fgabe +ĠAu stralian +Ġdeleg ated +comput ers +çĶµ æ±ł +请æ±Ĥ çļĦ +gpio zero +Ïī ÏĦεÏģ +ì¤ Ģ +Contrast ive +Ġpyle us +1415 926535 +å¤ī æıĽ +MONTH S +kel vin +ĠÑį лем +titan ic +ĠPatch Collection +ĠrlHistoryControl Entry +rang ler +ĠÑĢаР±Ð¾ÑĤ +sequ encing +Ġremo vido +Ġbil inear +etun ed +Ġhou ston +ĠGre mlin +иÑģÑĤ и +åıį éĩįåĬĽ +Spatial Reference +ðŁı´ółģ«ółģ¥ ółĢ +,?,? ,?,? +ðŁı´ółģªółģ° ółĢ +#-------------------------------- ------------- +Hop Site +Ġclu mp +Ġcros sed +ALIGN MENT +ĠIDXGI Output +HubPort Device +éŁ³ ä¹IJ +Ġber noulli +Ġlim ite +ĠAlert s +ĠíĮ ¨ +��ĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪ âķij +++++++++++++++++++++++++++++++++ ++++++++++++++++++++++++++++++++ +pon zi +Ġproble ma +Combat HeroPositions +ủ a +ủ y +Ġplays ound +ĠEquation Extractor +Nor ESM +ĠLike lihood +lugg able +ĠWidget s +Ġkn ob +Ġoccure nt +移 åĬ¨ +Cpp FunctionDescriptor +Tel net +\- ]* +Ġreci eved +ĠAstr onomy +Ġstim ulus +presen ter +ĠVul can +Ġdiver gent +regress ors +ĠExist enceError +çĶ± äºİ +PERCENT ILE +ĠPostgreSQL Storage +Ven ue +Ġpunct uations +ĠMEM BERS +Ġrollo uts +Ġdivid ends +pops Tol +åħ³éĶ® çĤ¹ +ãģķãĤĮ ãģ¦ +ãģķãĤĮ ãģŁ +Ġcandle stick +Ġstretch ing +ENO ENT +ĠADMIN S +SYMB OLS +ĠPriority Queue +Ġimbalance d +Emb arked +jud ger +jud ged +Ðĺ з +ĠTran script +ĠFC ST +Ġvt reat +0312 100 +Compat ible +Ġcircum stances +æŃĮ æĽ² +ctspIf SgtMapping +REGISTER ED +(... ): +Ġر Ûģ +ĠNF LOG +Ġtransmit ting +EMD py +åħ± æľī +Ġviv otools +ĠQuaternion Class +Exponential MovingAverage +ãĥķãĤ¡ãĤ¤ãĥ« ãĤĴ +Suc ceeded +mens aje +Ġlif elines +ĠSPAR SIFY +igmp Filtering +ĠLen T +ĠLAT ENCY +KeyValue Entry +Ġsufficient ly +govern ance +ĠPypeIt Error +ĠPypeIt MetaData +'[\ '"\( +geop lot +("** {}** +tox ic +ĠIll inois +ĠLuc as +Ġstrat um +ISSU ETEMPL +denorm alize +ĠdocsLoadBalBasicRule Dis +Ġprojek ti +Ġprojek ty +BCE Loss +æļ Ĥ +diss olve +assayed file +ĠHu go +ĠRep lica +Ġgrace ful +Signing Key +åijĮ èİĬ客 +Mount Point +Transp arent +bish op +Ġari adne +ĠÛģ ÛĴ +ĠCp G +ĠCp wVc +ĠDIM M +Ġenumer ations +Ġterrain Tile +ĠLearn er +TFRecord Writer +رÙĪ ابط +Retri ever +Retri eved +Ġdenorm alize +Ġsteel py +Ger many +ð¦ ŀ +Ġmil lis +ĠCE FBrowser +emer gency +ListPomeriumSession sResponse +offers B +Determin es +BILL ING +ип иÑģ +ĠBuilt In +Declaration Node +Cel sius +CAD ENZA +CUD NN +jian renw +sif ter +èĹ Ŀ +Ġslo upce +Ġreconnect ing +advent ure +Ġstitch ing +outflow ed +ĠMidi Out +ĠsegmentText Split +Spell ing +Ġ구 íĺĦ +CURR ENCY +discreti zation +Restricted Transfer +DUP LEX +Hier arquia +Shel ve +harm less +Ġnue vo +raid Disk +ĠENABLE D +metter e +gss api +Ïĩ ε +ì°¨ ìĽIJ +ĠRis cv +ĠVoting Policy +ĠHL SSignalingData +COMPAT IBILITY +Ambient Volume +ĠдÑĢÑĥз ей +Ipt c +ĠCandidate Info +ĠBre ast +ĠGar age +ĠGar cia +nego ti +routerVrrp Status +Fblas Order +Coun ters +Easy SNMP +Kan po +èħ ° +stitch er +chol B +Ġanc illary +COOL ERS +Evalu ates +Ġдан нÑĭе +Ġзаказ а +Gran ularity +aus pex +Ġtort oise +Ġpileup read +Ġpileup column +igs list +ĠPla intext +emiss ive +ĠglBind Texture +Ġadminist radores +Ġ"'{}' ". +DeployStatus Options +ĠAugment ation +ĠDiagnostic Status +éĬĢ åŃIJ +Ġktó rzy +Ijo i +Mpk M +blu zelle +Õ¥ ÖĢ +Ġapy hgnc +ĠAff ine +Ġcondense d +produ cible +Ġyan it +ĠElev ation +indust ries +wwww wwww +ListComponentDef sResponse +ĠcvcConf Controller +ĠProte ct +ĠIDXG IS +ĠìĪ ľ +QueryUsers Response +QueryGroups Response +Ġæ£Ģ æµĭ +Ġíħ ĮìĬ¤íĬ¸ +Payments Percentage +ListIssueTemplates Response +mstpXst Port +gig abytes +gSfp Table +gSfp Entry +rch line +zion ale +ξ ÏīÏĦεÏģ +Ġance stry +ĠIsol ation +ĠEfficient Net +ĠGD AL +ĠConf lict +ListProjects Response +ListProjects Request +calo Stage +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +GetUserInfo Request +ImageFile Names +RunAndWait Message +RunAndWait Options +gtgt gtgt +spectro graphs +concaten ated +ĠShip ments +åĩł 个 +Digital InOut +HYPER LEDGER +SceneDescription Array +mush room +ìħ ĺ +Ġ'> =' +ĠPoker RuleViolation +Ġdesp ite +Ġraz ão +Ġexter ne +ĠProc Man +Ġbinar ize +пÑĢав ÑĸлÑĮ +THRESHOL DS +"[\ .\,\ +frees ound +frees urfer +nand uri +anymal C +Ġppt x +Ġnob ody +Ġconcern ed +obah n +featur izer +Leet Code +Minimap DebugPoint +Structured Grid +Ġsurvi ve +ĠSerialize Or +ĠeggBB Ang +dvid env +treen umbers +alphab etical +proven ance +ĠGran de +ãĤ½ ãĥ¼ãĤ¹ +ĠSimulated OpuDevice +QosCW min +QosCW max +Incremental CompileOperation +MIME Text +wux iaworld +Ġnume xpr +Ġecon omic +ĠTok ens +ĠTransp arent +ĠSPECI FIC +ĠCID R +scre ens +ĠBED T +EXPRESS ION +ãģ«å¤ī æĽ´ +severe Cases +Jon athan +Rap idity +Sit uation +nfe v +vend ored +çij ŀ +geon ames +ĠCMS Plugin +colpm Dec +ĠRecogn izer +RESTRICT ED +Spin Box +010000111 00000000000 +Ġcaract ere +ноÑģÑĤ ÑĮ +å§ĵ åIJį +mstp Gen +BulkUpdate Failed +Law rence +æ¦ Ĥ +Ġnur sery +romag netic +victory orlose +Ġthous ands +Ġdew point +ĠBento Service +tmpArray T +Discreti zation +Ġrespons ibility +åIJĥ äºĨ +imaget agger +ĠDeclar ation +Booked Serializer +ĠSecondary Threshold +ĠACTIV ITY +è³ĩæĸĻ 庫 +BENCH MARK +canti le +ìĪ ľ +isub scriptions +Ġhun ts +Ġstret ches +Ġdeepp avlov +Ġjds ub +ĠNAS A +priet ary +OPA QUE +ĠMotif Finder +Ġvolt tron +hybridi zation +��waterimg Res +REPLACEMENT S +#================================================================================ ============ +Hou ston +TFL ITE +Õ¸ ÖĤ +Ġodhod noLetalisce +Ġester ni +chao xing +ĠSMT BFRange +ĠPROM PT +ĠBOO LEAN +Ġkits une +ĠHEM ATO +Ġservic enow +ĠgroupSync Read +ESTIM ATED +ContextSupport Object +StreamBank P +PERSIST ENT +PHYS ICAL +ĠctspAuthorizationSgaclFail Notif +lcq mc +ĠMathemat ica +EPG Refresh +ĠOperate Code +بÛĮ رÙĪ +ãĤ¿ãĤ¤ ãĥł +ĠfltStmtArb Value +PFPupp iJ +WAG TAIL +wish list +Ġretail Price +Ġdjang ocms +unfiltered MapsDictList +Ġwsg iref +ĠAer onauti +ĠHTT Mock +Ġlasa gna +ĠKol mogorov +Ġgew ittergefahr +Workload IdentityPoolProvider +ĠíĴĢë§ģ ê³Ħ층 +Ġfragmentation Dictionary +Ġacknowled gment +Mirrored Strategy +ĠMultinomial NB +Ativ idades +Mich igan +QTable WidgetItem +UVC et +clas sed +vmlin uz +Ġfrees lots +lizz ard +getaddr info +ĠShel ly +']]] ]): +ĠMKL Matrix +pymd ownx +Weibull LT +Ġ리 ìĬ¤íĬ¸ +ĠDisp ersion +ĠDecisionTree Regressor +gira ffe +Shaft Element +AEG IS +JNI Env +Melt MassFlux +fdi pest +vut br +èij£ å°ĩ士 +encry pter +opense arch +ĠkIR G +ðŁı´ółģ·ółģ ³ółģ +ProcessKernel Time +TaskExecution Spec +ĠëģĿ ëĤĺ +SUC CEEDED +ç»ĺ åĪ¶ +åľĸ çīĩ +ĠCOOK IE +Ġmuut tu +particleFlow Cluster +äºĮåıī æłij +æĶ¯ä»ĺ å®Ŀ +ReallocResource Message +printFuncTest HeadingWithDeliLine +DPC MPCAPS +PUN CT +idun nam +oplas my +ĠisFirst Pass +Ġrue da +ĠAlig ner +CONFI GS +FormField Invalid +éļĤ 縣 +ADAPT IVE +ĠCRIT ICAL +è£ħ饰 åĻ¨ +ĠMultivariateGaussian Distribution +Craw ford +oBu ono +stda uthor +itert uples +geeks forgeeks +ppoc amp +ĠCame mbert +ĠDY NAM +ĠNul lify +Competi tie +Ġphid ias +ãģ«ãģ¤ ãģĦãģ¦ +MULTIS AMPLE +vtkMRML Markups +ç²Ĵ 度 +*[\'"] ('+_ +ĠèĢĥ åı¤ +ĠOrdinal Encoder +Arap aho +Muse Alg +OSTRE E +Pwr Down +kPkt log +§ä½ ©åħĭ +stren ght +Ġigb hvr +Ġfides ops +Ġfusel age +Ġsquee zed +chancel or +Ġ+----------------- +-------------------+ +Ġrundra matiq +Ġlanel ines +ĠFah renheit +ĠFides OpsKey +logVerbose File +omnib us +ĠPrade sh +Remaster Procedure +Ġprotor pc +Ġjavi fy +Ġjasht me +createFile Symbol +envNew Acronym +ListNodes Options +Descul pe +ValueFor Factors +ADirectory Error +ILSV RC +optionsMust Understand +Ġqradial gradient +ĠPyUnused Local +ĠPyProtected Member +EXOD US +withinSeq Val +ĠPythonCI LEError +executeHive Query +Ġmarkovi fy +PerPr Alrm +ĠOpenPN M +SETAVATAR RESPONSE +ViscL Man +MockAccessPreview Finding +Ġazlmb r +полÑĥÑĩ аем +RemoteJw ks +DSTENCIL CAPS +PerformanceWP Record +ExpandWordSn ippets +ĠSelfDescribing Json +Shareholdings Of +ãģıãģł ãģķãģĦ +×Ķ×¢ ר +ĠWeightedSequentialDoublyRobust Estimator +ĠÑįлем енÑĤ +ξÏīÏĦεÏģ ικ +ĠPokerRuleViolation Exception +"[\.\,\ ?\ +ĠAeronauti cs +" & +" _{ +" âĿĮ +# ( +# ': +$ ) +$ '. +% ']") +' >>> +' ྠ+( ..., +) [:: +* { ++ )) ++ """ ++ ].[ +, ], +, '), +, '. +, }', +- & +- [ +- {} +- '): +- .', +- ]+)/ +- ].[ +. ? +. | +. )\ +. )** +. "]/ +/ ": +/ "), +/ \\ +0 997 +0 935 +3 174 +3 145 +3 647 +3 997 +3 189 +3 938 +4 033 +4 025 +4 022 +4 117 +4 116 +4 857 +4 144 +4 185 +4 121 +4 184 +4 335 +4 924 +4 865 +4 777 +4 648 +5 867 +5 878 +6 127 +6 015 +7 147 +7 077 +8 004 +8 266 +9 014 +9 018 +: + +: {}/{}". +< { += ',' += (". +> ]) +> ). +> ',' +> (\ +> '). +? ")) +@ $\ +A ver +A IME +A wards +A unt +A gency +A ffiliation +B un +B AC +B ash +B lower +B SS +B ee +B MAP +B anned +B aba +B oston +B raz +C ate +C ow +C ord +C row +C ors +C xx +C raft +C rawler +C RLF +D om +D UR +D iss +D uty +D uplex +E ar +E om +E mo +E ok +E cc +E tc +E Is +E CHE +E gamma +E rase +E Wrapper +E uro +E jected +E ulerian +E psg +E ligibility +E ESG +F am +F lower +F CE +F fs +F é +F rank +F Loop +F UK +F gw +F rac +F XC +F ederation +F urniture +F LIP +F LossAlarm +G on +G row +G reg +G ps +G PI +G ren +G RANT +G cm +G HOST +G hg +G rowth +H se +H ge +H is +H end +H od +H all +H OR +H AY +H mass +H CV +H abit +H molar +H ierarchical +I EC +I RECT +I ENCY +J IS +J ane +J IRA +J INJA +K ur +K om +K im +K IN +K DF +K CSS +L SE +L ING +L INT +L PORT +L VAR +L orentz +M it +M ens +M art +M ys +M é +M tu +M ysql +M ARCH +M ounts +M HD +M UTE +M cD +M IPS +M ountain +M LIR +N ation +N types +N EX +N DS +N GS +N MT +N rec +N Rate +N cases +N bW +N VIDIANetV +O utils +O Dict +O GI +P id +P ul +P list +P ho +P List +P ng +P ins +P mt +P END +P CD +P rf +P sy +P unctuation +P PIP +P erturbation +Q fp +Q qV +Q ComboBox +R ol +R os +R ip +R Co +R ide +R CA +R dr +R PM +R ATES +R ides +R entalData +S la +S ul +S IC +S eat +S iv +S RGB +S FD +S phinx +S cheduling +T ang +T min +T pos +T AM +T ld +T SS +T abs +T EM +T Loop +T ftp +T NR +T DY +T APS +T UNE +T ILES +T ruck +T LossAlarm +T UPLE +U int +U CA +U GG +U gk +V OR +V Sg +V IZ +V PN +V BA +V RS +V qs +V ADD +V éri +W ard +W ERS +W HETHER +W hole +W raps +W Vl +W EDGE +X tr +X EN +X code +X OT +X scale +X AY +X mas +Y h +Y TC +Y uk +Y HB +Y ields +Y oung +Y CbCr +Z AP +Z illa +Z MQ +Z nZ +[ ${ +\ % +] """ +] "), +] ']) +] ``. +] ")[ +^ % +_ + +_ )): +_ `. +` """ +` .') +a ist +a oc +a string +a List +a verb +a ee +a CP +a ð +a Genes +a esthetics +b de +b res +b dir +b ts +b ass +b mm +b TA +b els +b rowsers +c ine +c app +c np +c box +c uc +c python +c uid +c PH +c OH +c ancellation +c linical +d re +d list +d ly +d é +d alpha +d Check +d cf +e map +e eprom +f al +f mp +f ce +f ct +f ot +f cs +f row +f parser +f pc +f On +f spath +f ridge +f prop +f bf +f ü +f Fx +g up +g ow +g ac +g tp +g max +g ium +g lr +g nome +h F +h S +h get +h ab +h ag +h rt +h mt +h je +h ork +h inds +h ru +h hi +h del +h MJ +h urst +i Col +i oth +i hash +i js +i ques +j D +j F +j um +j ub +j ans +j step +j ars +j kl +j hh +j NZ +j apanese +j azz +j andro +k D +k R +k ent +k args +k ib +k ong +k oth +k aw +k Hx +l A +l ame +l line +l pi +l eri +l vol +l UC +l probs +l argo +l ır +l bfgs +m co +m ta +m out +m cu +n te +n lay +n In +n File +n No +n coder +n proc +n Connection +n rotation +n arrow +n Bits +n Creating +n ZW +n Actions +n partitions +n qubit +n aked +n Exiting +n ifti +n hwc +n ominate +o P +o on +o es +o dict +o attr +p score +p String +p fs +p vs +p Device +p lastic +p ssh +p awn +p aie +p ifu +q C +q at +r L +r value +r start +r ale +r FI +r limit +r dtype +r br +r relu +r pipe +r uta +r ulers +s A +s J +s di +s dir +s ump +s ou +s ures +s var +s ids +s LC +s mac +s bi +s stable +t file +t valid +t df +t ANT +t non +t bd +t Wr +t umor +u C +u ac +u alized +u dic +u dia +u ada +u los +u ý +v Q +v ort +v od +v tr +v ine +v ann +v bar +v bd +w text +w mo +w ok +w sg +w lan +w addr +w ired +w rd +w rn +w Pg +x er +x res +x out +x ks +x mask +x Label +x sec +x forms +x ima +x BC +x anim +x OJ +y D +y U +y q +y me +y um +y res +y ap +y ll +y fix +y title +y Max +z D +z ar +z set +z ale +z ahl +{ [ +{ {\ +{ ((- +| ( +| < +| > +} ',' +} =\ +} !") +} $$ +} ),( +} """) +} `) +} ://{ +¤ íĬ¸ +¦ ×ķ× +¦ éĻ¤ +ª Ķ +ª åķı +® áĥĶáĥij +³ å®ļ +· ółĢ²ółģ¿ +¸ ĥ +¼ êµ +à ļ +Å º +Å ij +Æ Ĩ +Æ IJ +Î ł +Õ ½ÕŃÕ¡Õ¬ +× Ľ +ã ij +ã ¸ĥ +è Ĵ +è ĸ +è ĺ +ë ħ +ë ¯¸ +ì ´ +ì Ľ +ï ¹ +ĉ Ċĉĉĉ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ã +Ġ ******** +Ġ era +Ġ čĊčĊĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ÛĮ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ čĊĉĉĉĉĉĉ +Ġ ед +Ġ uber +Ġ Äį +Ġ æĸ¹æ³ķ +Ġ 999999 +Ġ è¿Ļ个 +Ġ ç±»åŀĭ +Ġ ÅĽ +Ġ ÑĢав +Ġ é»ĺ认 +Ġ åIJĦ +Ġ íķĺëĬĶ +Ġ ä¹° +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ãĦ +Ġ âĸĪâĸĪâĸĴ +Ġ é¼łæłĩ +Ġ åįĩ +Ġ 建ç«ĭ +Ġ åĶ¯ä¸Ģ +Ġ پر +Ġ ðŁħ +Ħ ìłĦ +į ± +Ļ çī¹ +Ľ éĢī +ľ ´ +ľ áĥĺáĥ +ĠĠ ĊĠĠĠĠĠ +ĠĠ čĊčĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +in in +in data +in os +in vent +in cy +in spec +in dia +in ferences +in Channel +in finite +in scribed +er q +or c +or est +or cid +on ta +on io +on ormal +at ra +at os +at test +at titude +at tachement +re on +re se +re inf +re tracted +re oriented +re cruit +se in +se pt +se gn +se lections +se eded +se ja +Ġ= [' +st g +st iti +st ial +st udi +st upid +st encils +en ome +en rico +en codable +ĊĠĠĠĠĠĠĠĠ ĊĊ +Ġt val +Ġt all +Ġt form +Ġt xf +Ġt ern +Ġt ict +Ġt ik +Ġt dm +Ġt uh +Ġt enth +Ġt inta +ar ro +ar it +ar der +ar akoon +al ick +al ah +al veo +al berto +al uminum +de se +de ut +de sp +de com +de ll +de init +de quantize +de limiters +le on +le en +le aving +an ager +an nee +Ġi j +Ġi di +Ġi path +Ġi ho +Ġi sto +me st +me ll +me kk +me teor +me taname +Ġ' ... +Ġ' ']) +Ġ' ----- +Ġ' ]') +Ġ' ]") +Ġ' >') +Ġ' }': +Ġ' « +ro tt +ro cum +ti ent +mp j +mp layer +mp ika +Ġc T +Ġc X +Ġc se +Ġc def +Ġc str +Ġc args +Ġc read +Ġc max +Ġc als +Ġc AG +Ġc ix +Ġc err +Ġc plt +Ġc dm +Ġc hex +Ġc groups +Ġc menu +Ġc iso +Ġc raft +Ġc idade +Ġc ortex +Ġc Nos +Ġp ype +Ġp test +Ġp ls +Ġp ty +Ġp act +Ġp pl +Ġp mem +Ġp noise +Ġp star +Ġp nr +Ġp onto +Ġp endant +Ġp prp +Ġp ÅĻ +Ġf ro +Ġf action +Ġf ear +Ġf handler +Ġf pattern +Ġf beta +Ġf lying +Ġf mix +Ġf qn +Ġf elt +Ġf lights +Ġf isher +Ġf lickr +Ġf lashed +Ġ" }, +Ġ" ([ +Ġ" ...") +Ġ" }": +Ġ" }$" +he w +he ar +he us +he im +he lio +it us +it ore +it mo +Ġa ow +Ġa ap +Ġa post +Ġa ero +Ġa kg +Ġa uch +Ġa wx +Ġa eros +Ġa valiações +Ġa diabatic +Ġa valiable +lo ys +00 23 +00 28 +00 81 +00 025 +00 186 +00 1110000 +ge p +ge te +ge xe +ge com +ge mini +ge matria +ge orep +ce la +ce loss +ce des +', {" +Ġn T +Ġn op +Ġn part +Ġn é +Ġn steps +Ġn groups +Ġn bx +Ġn ya +Ġn omin +Ġn uclide +Ġn lats +Ġn uscenes +Ġn avegador +Ġn ysa +Ġs ind +Ġs dev +Ġs é +Ġs bp +Ġs ftp +Ġs ido +Ġs amba +Ġs olução +ut on +ur rent +ss lo +Ġin j +Ġin its +Ġin case +Ġin duce +Ġin visible +Ġin sira +Ġin dependence +Ġin verso +Ġin voicing +Ġin valpha +Ġre type +Ġre var +Ġre assign +Ġre servations +Ġre agents +Ġre wind +Ġre starting +Ġre indexer +Ġre jections +Ġre naming +Ġre ionization +Ġre presenta +ing en +ing Center +Ġo st +Ġo mt +Ġd S +Ġd k +Ġd name +Ġd iz +Ġd file +Ġd len +Ġd lu +Ġd index +Ġd row +Ġd ern +Ġd gen +Ġd long +Ġd dr +Ġd lon +Ġd vr +Ġd obi +Ġd unes +Ġd ropoff +li ens +li sa +li ations +li gn +ct ext +ct tt +pe pper +un an +un dir +un ho +un ref +un mark +un follow +un masked +un limited +un managed +un rotated +un infected +un hexlify +un spent +un distort +un reid +un explored +Ġm A +Ġm ce +Ġm line +Ġm ann +Ġm mi +Ġm ash +Ġm use +Ġm ie +Ġm ush +Ġm va +Ġm uted +Ġm uit +Ġm ticker +Ġm orse +Ġm amba +Ġm rcnn +Ġm undo +Ġm ariadb +ra pp +ra ine +ra ctor +ra zer +ra mento +Ġe V +Ġe bs +Ġe tf +Ġe mg +Ġe uro +Ġe asing +Ġe mice +ate ur +ate pc +ate sts +() ==' +() ``, +fi at +fi la +fi ssion +fi ki +ent size +ent rant +ad bb +ad visory +", [ +", ") +", )), +co x +co ul +co ment +co word +co led +co xon +co ffee +ri j +ri vers +ri eb +ri etta +Ġthe sis +Ġb pe +Ġb end +Ġb ite +Ġb size +Ġb plot +Ġb abel +Ġb cd +Ġb ills +Ġb outs +Ġb dists +Ġb reathe +Ġb rought +Ġb ÅĤÄĻ +Ġ1 170 +Ġ1 030 +Ġ1 291 +Ġ1 993 +Ġ1 371 +Ġ# (" +ed al +ed ro +11 22 +11 20 +11 90 +11 000 +11 82 +11 46 +11 91 +11 72 +11 51 +rom o +rom os +um m +um er +um blr +int ype +int ake +int ended +id xb +id ref +Ġw pe +Ġw ash +Ġw ied +Ġw tiles +Ġw aste +Ġw olf +Ġw ishes +ch p +ch ow +ch amp +ch anger +ch alice +di as +di ve +di fier +di std +def pm +): ( +and partner +Ġ[ (( +ma son +ul ario +Ġimport utils +], )); +ot arget +ot su +ot Eo +Ġfor ne +Ġfor ecaster +ol U +el mo +el ength +el lipsoid +el ancer +), '. +es z +es ara +es sential +ĊĊ ĊĠĠĠĠĠĠĠĠ +Ġ+ '\ +is not +is Match +is Enabled +is Eulerian +val l +val ley +__ "], +__ }. +__ }: +name se +name id +name tag +get ID +get Path +get Class +get Options +get Min +get Ip +get Filter +get Next +get BBox +get Fbx +get Servo +get fullargspec +(' "" +(' >>> +(' +', +(' >') +(' ==> +set size +set Column +set Output +set Source +set ools +set warnings +set Param +set Disabled +set Focus +set Stretch +set Pixmap +set RTS +set ModelData +set FixedWidth +Ġto ps +Ġto ctree +Ġto NFD +Ġto NFKD +Ġto NFC +Ġto NFKC +ĠT LO +ĠT ai +ĠT ik +ĠT XT +ĠT SSS +ĠT INY +xt y +xt end +xt reme +il let +il ateral +th xl +th umbs +th ursday +str test +Ġreturn t +Ġreturn List +con i +con te +con stra +con ference +ers ine +(" .. +(" **** +(" >> +(" ]", +(" ===== +(" ====== +(" -----") +') }") +') }", +as freq +as ynchronous +ĉĉ ĊĊĉ +iz ip +iz io +et ti +et code +et work +et namese +arg y +arg dict +op a +op ic +op lan +op aque +op tapy +Ġ{ {' +Ġis im +Ġis Flow +Ġis crowd +Ġis obaric +Ġ7 07 +Ġ7 04 +Ġ7 83 +ĠS F +ĠS ab +ĠS ens +ĠS oc +ĠS ph +ĠS ix +ĠS ymbols +ĠS CV +ĠS yl +ĠS inh +ĠS QS +ĠS YS +ĠS BP +ĠS tein +ĠS crud +ĠS olar +ĠS obel +ĠS moke +ĠS lixmpp +ab en +ab lo +ab lue +ĠC ate +ĠC ls +ĠC ele +ĠC OT +ĠC andle +ĠC ake +ĠC ards +ĠC apt +ĠC FR +ĠC RED +ĠC aching +ĠC SSS +ĠC assandra +ĠC limate +ĠC MPS +ĠC RLF +ĠC linTox +ĠC apsule +ig U +ig ating +ht f +up lot +up wind +") # +Ġdef enders +Ġg ad +Ġg nn +Ġg ks +Ġg ater +Ġg rl +Ġg hi +Ġg Best +for bid +for ecaster +Ġr B +Ġr ut +Ġr value +Ġr ta +Ġr stop +Ġr vec +Ġr bv +Ġl q +Ġl te +Ġl ite +Ġl pi +Ġl inter +Ġl gs +Ġl its +Ġl rc +Ġl so +Ġl vm +Ġl ung +Ġl Units +end code +data Value +data files +data pipeline +data hub +ĠA O +ĠA sh +ĠA AT +ĠA mt +ĠA LA +ĠA wards +ĠA bra +ĠA gency +ĠA APL +sp x +sp hx +sp inn +ult ural +age RnR +'] }' +01 99 +01 98 +01 51 +put y +Ġcon tribute +Ġcon verti +Ġcon vective +ic ur +ic ata +ic io +ke let +am ind +am omHistory +to self +to grid +to gether +to ppings +99 07 +99 55 +99 62 +Ġ: ' +par ray +par ry +par aboloid +ist y +type of +ĠF Q +ĠF ine +ĠF AR +ĠF eat +ĠF ED +ĠF FA +ĠF light +ĠF arm +ĠF rees +ĠF ancy +ĠF aked +ĠF acts +ĠF ees +ĠF ollower +ĠF urniture +od k +od or +od lib +sc en +sc am +sc ure +sc reener +sc enic +qu im +qu idity +log f +log os +log ram +log pdf +log OnFail +list box +om ber +om bre +vi b +vi vado +vi brato +vi meo +Ġh ask +Ġh nn +Ġh ists +Ġh ose +Ġh rm +Ġh dl +Ġh artree +Ġh ilbert +ĠĠĠĠĠ Ċ +all Data +po or +po di +po známk +ta per +ta king +ĠP n +ĠP ra +ĠP ic +ĠP ap +ĠP ING +ĠP AP +ĠP ref +ĠP si +ĠP CI +ĠP SD +ĠP TP +ĠP SP +ĠP TS +ĠP HI +ĠP acman +ĠP iggyback +ĠP HOT +ĠP GOPTIONS +ĠP luggable +ĠI B +ĠI ron +ĠI OB +ĠI CSS +ĠI Vs +ĠI CRS +file Config +file handler +file Prefix +file MinSize +file ToRetain +ĠL es +ĠL em +ĠL DI +ĠL ars +ĠL TE +ĠL CD +res o +Ġth re +Ġth irty +=' > +=' ### +=' (', +Ġst or +Ġst ays +Ġst dio +Ġde duct +Ġde compile +Ġde generate +Ġde dicate +Ġde serializer +Ġde lattr +pro py +pro duced +est user +est ados +0000 023 +pt m +pt x +pt y +form ulation +ex o +ex cl +ex LB +ex posed +im l +im is +im os +im enti +im utils +im ization +im decode +im ads +im oto +Ġex cp +Ġex UB +Ġex changed +Ġ3 54 +Ġ3 49 +Ġ3 41 +10 28 +10 38 +10 400 +Ġprint c +out text +out num +out prefix +ĠD er +ĠD ur +ĠD os +ĠD ream +ĠD MP +ĠD SS +ĠD inner +ĠD OM +ĠD AQ +ĠD ropping +ĠD ollars +ĠD QM +ĠD utch +ĠD uty +ac ro +ac ia +Ġu df +Ġu struct +Ġu Total +Ġu Prim +]) <= +Re k +Re pos +Re qui +Re payment +Re corded +Re bates +ite am +app log +app context +app oint +sh ut +sh lex +sh arded +sh ingles +Ġdata iku +ĠM int +ĠM ob +ĠM eld +ĠM UT +ĠM OT +ĠM VA +ĠM ade +ĠM Ws +ĠM JD +ĠM achines +time Filter +time Created +time Now +time Secs +if print +key list +key ids +key chains +lab x +lab la +lab ility +=" // +=" ([^ +=" ;") +Ġv w +Ġv dc +Ġv flip +Ġv quad +Ġv oted +02 12 +02 93 +02 52 +02 63 +ext ending +ext ensive +Ġy d +Ġy vals +Ġy uv +ĠO D +ĠO l +ĠO u +ĠO dd +ĠO ps +ĠO dim +ĠO LD +ĠO liver +ds P +ds b +ds m +Ġ* ") +Ġpar quet +Ġpar atext +Ġx w +Ġx ci +Ġx size +Ġx block +Ġx dg +os kin +os aur +Ġse al +Ġse ach +Ġma st +Ġma xt +Ġma proulette +ack ed +test name +test client +test tube +Ġor y +add V +add param +add headers +add Scale +add Lane +Ċĉĉ ĊĉĉĊĉ +ER P +IN FIX +IN COMING +Ġstr in +Ġstr on +Ġstr tobool +xe en +xe ew +xe fy +.. """ +Ġel ms +Ġel lipsoid +xb cp +xb aa +xb az +ure ka +ms ource +Ġme smo +Ġme trn +Ġme mbros +ON AL +---------------- -------- +---------------- --- +---------------- ------------- +Ġfile ds +Ġfile exists +Ġfile Dir +Ġpro yect +py i +py m +py r +py brain +py uic +xc u +xc v +pre ci +ls StreamProc +ap ns +ap lan +07 99 +07 14 +07 22 +07 24 +07 52 +ang r +ang strom +xd u +xd cs +xd au +xd cy +label Id +Ġbe i +Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +"] )). +ĠB ing +ĠB mi +ĠB run +ĠB IL +ĠB ounds +ĠB ible +ĠB az +ĠB star +ĠB asin +ĠB ibli +ĠB ONUS +ĠB RANCH +12 90 +12 66 +12 78 +12 63 +Ġname ko +ys ing +ys ers +ys nmp +ĠE I +ĠE TR +ĠE Tag +ĠE numer +ĠE MD +ĠE EP +ĠE PG +ĠE quilibrium +ĠE ESG +ĠE statÃŃstica +Ġj an +Ġj self +Ġj no +Ġj unc +Ġj ie +Ġj amf +._ . +ime ters +ci bo +ci ja +ci Adres +ob u +ob ble +ob stime +ob niz +""" ( +Ġ< --- +ly tics +text variable +text Range +text fsm +AT TEST +AT AAAA +AT ERE +low s +com er +com ics +model led +ĠN er +ĠN ath +ĠN ine +ĠN ear +ĠN ie +ĠN xN +ĠN athan +ĠN exus +date str +}, {' +ir regular +ir onic +ir rigation +len EnggNumber +num col +num diff +Ġres ort +Ġres name +Ġres izes +Ġres Len +bo a +Ġ4 99 +Ġ4 75 +Ġ4 67 +Ġ4 62 +Ġ4 72 +ger rit +Ġget Random +Ġget Six +lu til +lu tils +dir Name +92 12 +92 25 +92 06 +92 44 +92 2337203685 +tp age +col laboration +In format +In Tree +In coherent +In gredient +quest s +ĠR ap +ĠR ates +ĠR ide +ĠR ATE +ĠR DS +ĠR OM +ĠR PM +ĠR eroute +mo o +mo z +mo zart +ep l +Ġun s +Ġun ame +Ġun if +Ġun cut +Ġun wrap +Ġun flatten +Ġun idade +Ġun locked +Ġun freeze +Ġun authenticated +Ġun assigned +Ġun projected +Ġun stacked +Ġun answered +OR F +fo ol +read Object +read Bool +Ġtest Pass +Ġtest Folder +lic ate +lic ulas +Ġlog Level +32 91 +32 06536 +per ks +oc ross +ph in +ĠG or +ĠG ab +ĠG ear +ĠG host +ĠG CL +ĠG ren +ĠG TK +ĠG aia +ĠG umbel +ĠG olly +ĠG rupos +Ġco pper +Ġon delete +Ġon wards +Ġon going +format o +EN CI +EN GE +EN DIAN +ĠW C +ĠW N +ĠW ins +ĠW ars +ĠW ML +ĠW PS +ĠW avelength +ĠW SG +ho pe +ho tels +loc mem +Ġout filename +Ġout ward +Ġout lines +Ġout fp +Ġout Obj +Con ts +Con vergence +Con ventions +bu la +AR ING +AR DUINO +ĠV est +ĠV IP +ĠV ERT +ĠV ocê +ĠV iterbi +ĠV axman +ĠV ectors +ĠU mb +ĠU nd +ĠU CHAR +ĠU tah +ry ption +dict Key +print Usage +Ġ5 06 +Ġ5 17 +Ġ5 64 +Ġ5 22 +Ġ5 19 +Ġ5 37 +Ġ5 86 +Ġ5 83 +Ġ5 21 +Ġ5 74 +Ġ5 51 +Ġ5 987 +Ġ5 0612 +Ġhe mi +ight er +ib urg +Ġan h +Ġan ch +Ġ__ , +Ġen var +Ġen gg +Ġen cour +Ġen large +ise khon +ard vark +che ll +min al +999 4 +ator Player +Ġtime scale +Ġtime Step +Error Detail +Ġ> " +18 754 +16 85 +16 35 +16 42 +16 374 +Ġlist Workflow +line item +line To +line String +coun cil +ft en +sa ga +cur ry +cur Obj +da a +Ġk ow +Ġk ms +Ġk config +Ġcol widths +(): ] +Ġro ver +Ġro of +Ġro dap +St ale +St ars +St ages +St arter +Ġpy re +Ġpy te +Ġpy gs +Ġpy tools +Ġpy dev +Ġpy learn +Ġpy pm +Ġpy lons +Ġpy mdb +Ġpy kern +Ġpy iem +Ġpy roslib +Ġpy hmmer +config HASS +Ġ6 15 +Ġ6 33 +Ġ6 45 +Ġ6 53 +Ġset t +Ġset Vertex +ag ra +ag ri +ag rant +ts ig +ts config +http core +04 11 +04 07 +04 06 +04 34 +04 94 +04 97 +04 45 +04 59 +04 900 +13 93 +13 89 +13 73 +13 68 +13 69 +og i +lib p +lib ili +06 18 +06 34 +06 77 +06 76 +ign als +ign oring +15 25 +15 06 +15 17 +15 08 +15 27 +15 36 +15 000 +15 77 +15 83 +15 82 +15 29 +15 51 +lif ford +cept ors +100 0101 +100 111111111111111111111 +max xx +max Length +max Events +max imo +max NumberOf +ass r +ass ian +05 11 +05 02 +05 58 +05 53 +05 72 +Ġthis ODict +03 93 +03 87 +03 57 +03 56 +03 58 +03 62 +]. \ +we athers +Ġop ad +Ġop ml +train s +train eree +Ġch ans +Ġch alice +Ġch aos +Ġch ampion +17 38 +17 89 +17 68 +Ġal u +Ġal mac +onse nse +93 04 +93 332 +14 27 +14 37 +14 23 +14 28 +14 50 +14 73 +14 61 +Ġpre par +Ġpre face +Ġpre exec +Ġpre cio +Ġpre sti +Ġpre mium +Ġpre pares +Ġresult Func +ne q +ne ulink +Ġ/ | +Ġat ype +ok eras +ok oban +vent ana +64 37 +64 23 +64 98 +64 67 +64 76 +64 54 +64 73 +64 52 +64 1975 +right Panel +right Arm +Ġob t +Ġob lik +enti ated +Ġra ma +Ġra io +([ (( +gra ine +076 2 +076 5 +076 6 +076 7 +:// "+ +plot x +plot y +iti se +iti an +iti va +iti zation +Type Exception +Ġtra ditional +Ġtra kt +IC M +IC SS +IC TCP +08 92 +08 84 +08 24 +08 87 +08 97 +08 86 +08 83 +08 48 +08 74 +main dir +ty name +ðŁ Ĩ +pi k +pi et +ust a +Ġ. % +Ġ. ') +ĠH U +ĠH our +ĠH aw +ĠH CC +ĠH aving +ĠH orizon +ĠH azards +ĠH acker +ĠH anoi +ĠH lsStreamProc +ĠRe write +ĠRe sets +ĠRe ais +ĠRe ached +sub query +sub total +sub network +sub clip +sub packet +Ġ{} !'. +ml er +input Widget +input Args +mat show +mat ically +mat thews +Ġsh iny +Ġsh aders +Ġsh ingles +Ġdi vs +sk aters +db key +work shops +88 12 +88 27 +88 96 +88 85 +88 54 +88 73 +88 61 +lp aW +ded upe +ast s +ast ed +image set +image File +image Pull +comp os +(( ?: +Ġsc or +Ġ` ! +Ġ` @ +34 946 +start work +pos mask +pos itivo +Ġ[" * +Ġwe ar +Ġwe iÃŁ +09 03 +09 66 +09 45 +09 52 +09 69 +09 103 +84 86 +84 44 +84 65 +84 67 +84 62 +84 63 +ĠIn k +ĠIn ject +ĠIn coming +ĠIn finite +ĠIn jector +write able +write Bool +ere lease +ere ira +27 00 +27 932 +Ġkey values +nd cg +ant z +gs Vel +by token +bin om +bin centers +shape Rdr +lock time +Ġle verage +Ġle iden +result ing +arch er +arch ipelago +Ġconfig ures +37 176 +Ġpath join +Pro fit +Pro cedures +em v +em is +ark a +Ġoutput F +Ġoutput filename +Ġ@ \ +Ġpo a +Ġpo lib +Ġpo cket +Ġpo les +Ġpo sso +Ġcom and +Ġcom types +Ġcom bat +Ġcom merce +Ġsub st +Ġsub tra +Ġsub samples +Ġsub tags +Ġsub dag +Ġsub ckt +yn ode +Ġ{' __ +rep rs +AM aire +96 01 +96 06 +96 134 +96 306 +96 158 +96 087 +Ġac ampamento +Ġac ordo +Ġac quisitions +ache lor +ĠCon j +ĠCon vergence +ĠCon centration +ĠCon vexHull +Ġnew value +Ġnew Map +Ġnew states +Ġnew Matrix +ress ive +Ġall tweets +Ġinput ted +55 18 +55 05 +55 34 +55 66 +55 45 +55 74 +[: ]= +94 34 +94 86 +94 54 +Ġcur P +Ġcur ie +arn s +DE CRYPT +DE LET +DE VELO +RO L +RO PE +RO bjects +Ġapp oint +json net +split By +Ġlabel pad +row ave +av x +Ġno on +Ġno Outgoing +Ġno Incoming +87 00 +87 04 +87 85 +87 29 +no Of +Ġline ages +AL IVE +fic ador +exp val +exp ids +(), " +-------------------------------- -------------- +-------------------------------- ----------- +ensor ed +AS I +iv f +85 45 +85 73 +85 78 +97 13 +97 86 +97 67 +back door +mi er +mi ke +{} \' +net f +net dev +================ == +36 02 +36 32 +36 95 +36 000 +36 28 +36 81 +ron os +=[ { +=[ [[ +011 0000000000000000 +Ġopen unreid +Ġid l +ĠK ur +ĠK ine +ĠK max +ĠK ie +ĠK SS +ĠK CSS +ĠK MOD +ĠK NX +ĠK SSS +ĠK amehameha +95 01 +95 99 +95 14 +95 86 +95 26 +95 43 +95 39 +word nets +lat ter +lat long +Ġit m +Ġdist ros +Ġimage code +Ġimage Path +run cmd +instance d +86 95 +86 26 +86 66 +86 77 +stra ddr +Ġmax imize +Ġmax Coin +sum ma +mon otone +Ġdo ses +fa w +Ġz a +Ġz um +Ġz ep +Ġz mc +Ġz hat +Ġjson field +Ġjson Conf +Ġjson rq +HE LL +string ify +string Path +default Test +default Graph +AG ING +57 00 +57 88 +57 86 +57 26 +57 57 +57 44 +57 48 +57 78 +57 52 +57 014 +Ġ! !") +Ġ! @! +Ġ[' -', +Ġext ender +Ġext Top +ww tANT +Ġ| ") +create Integer +create Trackbar +ED UC +ED GED +IS C +IS K +IS HER +reg a +reg en +reg ime +Ġtf lib +number of +Ġbo ys +Ġbo oleans +do cteur +Ġper mu +Ġper cepts +Ġper ennial +message Id +au f +au gs +group er +group docs +spe ar +Ġne k +Ġne ur +Ġne ces +Ġne urosynth +ele ven +Text ual +Text area +env opts +List Equal +CO G +CO SE +CO IL +CO EFF +CO ALESCE +Ġfunction Name +man ded +man vol +ach ieve +Ġlo la +Ġlo ved +Ġlo sing +Ġlo oo +66 07 +66 77 +23 839 +AC FL +AC ENTER +Ġte h +Ġte aching +Ġmat hemat +ps v +Ġli q +Ġli gate +44 96 +44 33 +44 31 +Ċĉĉĉ Ċĉĉĉ +frame Y +und os +und led +IM IZER +Ġdis hes +Ġ** __): +80 32 +AP D +AP s +AP AN +AP IB +Ġadd class +Ġadd nodes +Des k +75 05 +new dir +new order +new Graph +Ġtext blob +cor rel +cor rente +cor responds +cor respondence +io ff +ait ai +Ġrun command +Ġrun nings +OT HERS +Ġnode sel +Ġnode info +Ġnode Label +ef v +ef etch +En codes +En gines +28 367 +Ġend Y +Ġend y +Ġend rec +Ex r +Ex cess +Ex erc +Ex haust +ET a +ET CBC +Ġ-- ') +Ġ-- >" +so ciety +cal cs +ther as +56 95 +go at +go To +98 22 +98 37 +98 904 +Ġsp m +Ġsp ins +Ġsp itz +Ġsp orsmaal +local db +my path +Ġdict Zigbee +Ġmin ut +Ġmin utiae +Ġmin ThresholdLength +LO V +box style +Ġ(" ../ +check able +check style +check boxes +check PositiveNumber +batch norms +Se guro +uc l +Ġcan tid +UR ACY +ĠQ ry +ĠQ Tree +ĠQ Pixmap +img w +img dir +img msg +Ġcolor izer +Ġcolor scale +Ġcolor Header +target DB +35 11 +35 16 +35 96 +35 94 +35 9375 +Descri ção +ud pa +Col lected +Col umbia +Ġus ado +dataset Id +dataset Version +space one +Ġmo od +File ID +AD Q +AD AM +AD JECT +ual ated +ran ties +cre atable +Ġim u +Ġim lib +Ġim resize +Ġdf obj +',' _ +stat ics +stat istical +flow cells +ĠSe ven +Ġad c +Ġad alah +45 05 +77 26 +ng uess +PO LE +PO bject +PO SCAR +the il +the os +the sis +token Weight +token Balance +bug fix +Ġdistri butor +noun s +ĠY un +ĠY et +ĠY oung +Ġinter medi +Ġinter Bands +ä¸ ĵ +ĠX I +ĠX S +ĠX e +Ġtrans versal +Ġarg c +Ġarg dict +Ġarg Parser +Ġarg complete +Ġarg Format +Ġbase y +CH G +CH W +CH ANCE +CH ILD +cc rs +47 27 +47 98 +47 47 +47 83 +47 82 +47 43 +47 81 +47 466 +47 758 +]] ))) +]] ]] +]] âĸĵ +csv name +csv reader +csv FilePath +event ID +core f +ĠEx press +ĠEx hale +[:, _ +tf x +tf learn +Ġ9 09 +top K +top lot +top ological +Ġload txt +find bugs +Set ter +Set Num +Set Current +Set AccessBindingsRequest +Ġpython Code +dire ita +dire cao +Ġreg r +Ġreg ime +Test Plan +Ġser en +Ġser if +83 84 +IB O +Ġmain title +Ġver ifies +Ch orus +Ch oreography +wh ms +nder e +>> " +Ġlin ode +mark ings +ai ss +ai ka +ĠIN S +ĠIN CLUDE +sg r +sg fpath +82 96 +}) '), +Ġar rs +Ġar bre +iter ated +46 37 +46 94 +46 85 +46 82 +46 21 +46 73 +46 51 +ĠJ i +ĠJ r +ĠJ es +ĠJ os +txt Box +Ġcv s +107 8 +Log Entry +Log Mat +Log Moneyness +Lo ose +Lo Or +89 11 +source Folder +DI terate +Ġ] } +loss y +yp ad +":" $ +cp x +cp tr +labels Entry +)] '. +ld h +nx api +Ġmodule Name +open mc +fg mask +Ġread File +Ġread pv +Un set +Un cle +Un meth +Un healthy +pk ts +mask points +Ġq chem +Ġversion eer +TH ING +UL F +UL P +UL Y +UL FOR +air things +To A +To Node +To Dict +To Binary +To Remove +To Math +To Caller +CON STR +CON DA +Ob serv +De laware +De seja +ost op +Config Dir +sign ificance +29 101 +US s +US ym +Ġ`` @ +Time List +Time Period +Time Distributed +Time Elapsed +block height +block Job +Ġdb session +67 38 +cat kin +43 03 +43 19 +show Amount +show aia +bot m +bot toms +cl rs +cl oned +ĠCON FL +ĠCON NECT +ĠCON CENTRATION +Ġup vote +Ġcor tical +ĠPro v +ĠPro ble +ĠPro vided +ĠPro pose +Table Table +Table Target +CL s +vid a +ĠList a +Ġcontin uity +INT ERRU +fir ming +fir mative +vo o +vo ided +:: [ +:: %( +000000 111 +Ġnet G +SI mage +Ġmatch string +std v +std int +48 17 +sv r +ie ee +Ġqu ais +Ġqu tip +Ġqu odlib +EX FL +EX PTIME +ĠData Update +FA A +ingle ss +Ġany ways +fe ctions +red ds +Ġfirst day +No Args +total Size +total Supply +\\ % +\\ "} +session Id +ãģ ¹ +ãģ ļ +ĠAr ffRow +TT F +Ġtemp Line +])) + +Ġgroup name +last Updated +pha idai +MA KER +MA COS +Model Config +Model Metrics +Model Checkpoint +EST ABL +Ġcontext Name +task map +е ÑĨ +ca des +DAT ED +DAT ATRANSFORMATION +DAT ACENTER +âĸ ł +Ġfig let +ten cent +ĠIS R +ĠIS SS +mt cnn +Ġwork place +ĠÐ ¤ +"> & +"> '+"\ +Max Global +post gis +Ġback stack +Ġback cast +Ġback warp +Ġback tracking +Ġback GTI +"]) ], +"]) [" +Ġexp rs +Get Frame +Get Count +Get Current +Get Cluster +Get Modified +Get Cert +Get ComponentDefRequest +Get PomeriumServiceAccountResponse +Get ManagedObjects +game stage +Node Error +Node Lis +Node Conts +match up +Ġ'/ '). +Ġbut t +(- . +39 18 +ny ch +ny zo +Ġsum mar +Message Dialog +Add Renderer +Ġover flows +bar Number +Ġtensor network +Ġass m +Ġass ault +folder path +matrix Spot +uni Valid +uni vals +char dev +char offset +conf ound +conf licts +build type +Ġ& \ +cho o +Number Bits +aw ake +Ġlast Time +tmp path +tmp fs +tmp Site +TO K +TO UCH +ren ded +Ġfound CTAs +conv s +ui py +ui ente +čĊčĊ ĠĠĠĠĠĠ +scale Mult +PAT TER +54 75 +png quant +Tra j +Tra its +Column Type +Ġframe Color +79 64 +Key Name +Key Id +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Vi ri +cv c +cv v +const recharge +74 075 +tick locs +MIB Module +Ġobj c +exit Symbol +MO X +mem stats +enter Symbol +ĠCo ord +ĠCo upling +Ġpytest er +73 99 +73 14 +73 37 +73 96 +Ġfind Value +dis allow +fit x +Ġimp uted +Ġ... ]] +LI Z +Ġnext ype +String Index +ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ +Com mitted +Com mercial +Comp act +Comp Aux +common mark +common columns +Ġorder Id +send ers +Ġuni con +adj Pvalue +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ +pred id +pred pixels +Ġfilter Type +Ġspecific Dict +ĠTO OL +ĠTO PIC +first weekday +][' @ +Class ic +Class Info +Ġiniti ator +edge count +edge colors +Ġab r +Ġab br +Ġsupp l +58 12 +State Change +State Metadata +access log +pr x +pr inceton +gr d +dist ill +78 26 +OP F +ĠTest Config +case id +("\ " +pol lution +ĠNo OptionError +Ġbin str +job Script +User Create +User Factory +User Credentials +Ġman ubot +59 01 +59 02 +seq id +seq Names +Ġport a +ĠDe ut +ĠDe que +ĠDe veloped +ĠDe launay +sw in +sw ish +Ġproject roles +53 08 +View Up +Ġform al +Ġlength Of +Ġfollow ings +Exception Handler +68 6400 +ĠRes er +ĠRes pon +Ġbu ck +Trans itions +ãĥ İ +ãĥ Ŀ +connect Nodes +çļ ĩ +ym m +Th ermo +Index Buffer +acc db +xx Sph +çļĦ åĩ½æķ° +çļĦ åĽ¾çīĩ +çļĦ æľĢ大 +çļĦ 大å°ı +PL ACES +pack file +Ġblock txt +inser ter +fs f +unit TestSupport +(_ [ +Ġchange point +Ġchange State +Ġ"/ . +cell Stats +cell Rows +ĠUser Name +If String +If Mtu +62 04 +ank d +Sh utting +Sh uffling +opt parser +ba ys +prefix Operator +fra gs +ĊĊĊĊ ĊĠ +IP SE +IP VerErrRx +IP ProtoErrRx +ĠSo fa +disp er +disp ers +Ġtmp Name +Ġtmp Threshold +49 18 +49 13 +49 06 +radi ation +Ġmap Cells +DB T +DB Type +DB Common +DB OX +Def s +Ġmask rcnn +Ġmask RCNN +012 95106 +Ġgraph cut +xaf I +BU FF +ards on +EM Y +EM INDER +SC a +SC RE +SC RI +su ave +sim id +sim ul +Ġfi epi +63 07 +Request Type +Ġoptim isation +stream consumer +stream IDs +Ġ15 35 +Ġserver details +CC F +ĠGet Field +ĠGet Page +72 13 +72 03 +cluster Status +IO I +IO mica +na ea +na pari +wd th +åĪ º +åĪ » +Not Defined +Create ComponentDefRequest +Create ColumnFamilyRequest +Ġmy frame +Ġmy screen +resp ons +resp rocessing +Base Generator +Ġtri o +Ġtri stimulus +Tx Rx +Tx CurWorkMode +Ġph en +Ġph rases +Ġph igaro +Ġapi Class +Ġsa o +mc Fan +Ġgrid color +xfe U +Al length +Al DynAdOcc +"); ') +Ġ'' ))) +Qu arter +By Value +Option Overrides +69 18 +pect rogram +Ġwrite ToFile +App lies +н ев +dt ml +TE LL +Ġoper ates +Ġ'\ ' +Ġsu its +Ġdown to +Ġdown sampling +has popup +diff serv +era SAS +Fa de +Fa ça +ĠCh ang +ĠCh alice +ĠCh icago +uff in +uff man +scal able +Ad r +ĠImage Folder +ĠImage Grab +Py YAML +inst level +resource index +resource tags +az w +az ar +az ul +az ines +az zo +lan ta +Ġ[[ [[ +ĠTh row +':' # +Ġcsv File +Ġcsv FilePath +Ġraw FileName +Ġraw dbs +hash er +hash val +xef K +pg a +div Val +ĠDict Reader +ero ot +Sp ots +setMax imum +Ġmock ing +pair T +sm enu +KEY UP +KEY FILE +KEY PAIR +Ġclo set +select inload +Ġref Id +Ġref lects +FL G +FL AT +FL ink +PR ICER +ĠMe asures +Ġret DQ +_{ ( +active Pitch +FO X +FO pt +ee b +ä» į +Ġexpress ão +Net Mask +Net NLTK +Pre parateur +report Type +Ġpost ure +Ġpost code +GR ASS +web test +web browser +++ ", +Sub array +Sub process +Sub title +Sub struct +Ġrand n +Ġrand y +xdf G +xdf j +Result Set +ML A +ML Model +sql mat +Auth nContext +af d +af l +dat at +ĠZ S +,' +',' +NO ON +NO ULL +Ġjob id +Ġjob Id +ĠBase Resource +ĠBase Service +ĠBase Api +ĠBase Plugin +Ġì º +Ġì ¸µ +xdb n +xdb w +WS q +ICs Denied +ICs Srv +ICs AlDynAdOcc +upper bound +light blue +light curve +fin ds +gb p +gb if +Ġtwo Squares +GB C +GB H +GB O +Ġcell Top +Ġcell Rows +Ġsplit ratio +global DhcpRelay +Ġans i +Ġvar Name +ĠMan ages +ĠMan uel +ĠMan ila +leg ato +Ġzip codes +-% . +hex string +hex Value +]+ )* +rain er +Tensor sTo +rank data +ha Problem +sen te +sen ta +sen vol +sen tie +ĊĊĉĉ Ċ +xde q +imple ments +ĠFile Field +ĠFile Handler +UD GE +grad y +cfg mgr +Ġpack er +åħ ħ +Ġjo y +Ġkernel spec +any ons +any way +insert width +draw Bot +Ġcomple to +Ġ14 25 +)\ (\"\ +10000 11100 +Ġstat function +Ġstat ics +br ance +br Limit +sd am +sd sc +.', )) +Lib raries +xcb W +her otarget +Ġpick ing +GS QL +rot li +rot Mat +Ġauthor izer +Ġcustom AttrData +Per ry +Per Class +Per PeerStats +Per Chunk +Per haps +Color Space +Or Array +eff ector +0011 000000 +0011 011101 +Ġsw irl +Ġvi rus +á ver +á tica +Item Field +Item Alert +ĠLe arned +ĠConfig s +ĠConfig Map +ĠConfig Tree +Label List +Label Dataset +Label Encoder +Ġresp FromGettingUserInfo +Ġlink List +ĠComp osition +Ġsend ers +imp edance +," % +Line Text +We bui +Ġmer cantile +xdd w +ategor i +Load Balance +mm detection +arm hf +thread safe +Ref lectance +Ġfeature DictObject +Ġrest o +Ġrest au +CI Ig +Sim Hits +Ġpe ut +Fil m +Ċĉĉĉĉĉ Ċĉĉĉ +OUT CAR +ãĢ ķ'), +Ġweb struct +xda o +BL AS +108 19 +.... \ +.... ..") +rl on +rl RmonControl +multi set +multi array +multi tenant +multi shard +Ġmc Pm +Ġsuper op +Count ed +button List +button Canvas +Ġemail er +long name +ĠRelation Type +avg rate +mk temp +modi fications +ĠPo licies +commit Timestamps +())) ] +STR ENGTH +STR ATEG ++" '" ++" '") +xac X +Ġpub li +Ġstream er +ĠLog Message +ĠLog Norm +ĠLog Util +So licit +Ċĉĉĉĉĉĉ Ġ +lon gs +Command er +buffer Position +Ġtrack ers +Output Base +Output As +buil ts +term Represents +Norm Disp +Ro berta +Ro yal +ĠEX IST +ĠEX TRA +ĠEX CEPTION +timeout ed +10011 10001111 +ĠHttp Client +æĸ ½ +Ġchild Context +tuple tree +ĠName Expr +ĠName Mapper +Ġconnection Array +prop val +Map Line +this Node +Do ctor +à¤ Ń +Tag Set +Resource List +Resource MapEntry +([' / +vol ta +Ġfolder Name +Ġmove ments +bucket name +flat land +Is Remote +Is HubPortDevice +OS F +OS X +OS fp +DR V +("- + +Ext ender +Ext Mib +vs Attr +inner most +Ġrot ten +FR B +Ġdraw ings +Ġdraw downs +ĠAuth nContext +Method NotAllowed +(** _ +(** {" +(** {' +cr d +cr nr +ĠTo y +zy y +SH AP +tile db +ĠAt ten +ĠAt tempting +ĠAt trition +115 200 +Total Count +Total Execution +Total Charges +Total Octets +buf r +Window Extractor +Ġskip CTAs +Button With +AV R +TER Y +rest itution +Server Name +An se +An chors +An uncio +VID EOS +Di ctionaries +Di hedral +Ġow ning +allow list +noti ces +Ġve ze +ĠBo keh +Ġ### ') +depend ant +aut ob +Ip Filter +ĠAl g +ĠAl locate +question group +kernel spec +fici ent +à° ¹ +Ġast ar +Ġast ype +hist o +Ġdat o +Ġdat at +Ġdat alo +obs N +Service user +Service Perimeter +ii if +Ġsort By +ĠOb served +Ġfit stbl +fl ank +Address B +_, )) +fr inge +CHE M +Ġreq Type +ĠSh i +Length TransferFunction +*\ *\ +Ġstack level +termin ating +æĪ ¸ +æĪ ı +([" -- +ĠString Indexer +hs r +)]) ), +Ġ'{ :,} +Ġ'{ :,. +Ġfree ëIJĺ +Conv Nets +Module Selector +tech niques +Var Intens +ĠAd Kraus +ĠFunction ality +Ġip sum +clear ing +MB q +MB qN +MB gM +Version String +MIN ER +pd params +ÃŃ ci +ÃŃ das +ÃŃ nh +ĠRE CORD +Ġamount OfBytes +)- [: +SP IDER +CR N +CR ONT +support ing +/\ )\(\"\ +Ġ25 92000 +ĠSer viço +ĠAn ti +ĠAn ime +ĠAn geles +GEN DIR +ĠInput Layer +Ġreal time +Ġlat Lng +IZ r +IZ ATIONS +Has Field +Ġcl kpnt +OB w +Ġmod è +axes pad +Op Mode +Ġsel marker +Ġdec lination +Block er +oto pe +ĠMIT RE +high score +}/ . +Ġtick Log +New EnvType +Ġauto load +Ġauto commit +Que ueno +attribute update +From Unicode +Update Event +Update AccessBindingsRequest +PRE FS +ev Max +Br ute +Filter Attr +ja h +eq Pops +rea is +Control Set +Control HistoryControl +Control ContainerOptions +9218 107 +004 77 +Peer Gw +]- = +ĠSub process +ĠSub Element +sr gan +Ġprev lin +Ġprev token +ĠDis c +ĠDis connect +ĠDis ney +PY TORCH +ĠQu arter +CLUD ES +åº Ń +404 6 +Ġ"{ ", +Ġshort cuts +ĠOpen SSL +ĠOn coming +Ġinser ir +digit alocean +ĠRed shift +GT CA +Ġforce Invoke +Ġtimestamp ed +agg info +Ġcontrol Types +Ġpr in +Ġpr zy +Ġlow Crv +Ġside chainnet +With Opts +With LayerElements +install ing +NB p +Bu oy +DU s +EG ROUND +Default Info +Default Measures +PER M +PER ATION +ĠLoad Data +ĠLoad Average +ı lar +Ġinte grand +ĠDo ing +ĠDo ctor +å¼ · +Ġcre ative +Ġds out +Sa ImagePatientNum +ĠAR FF +ĠAR TI +SET FL +Ġcut ter +Ġgra bs +gl xinfo +Ġmp c +Ġactive Job +Element Field +Element Selector +Ġjoin Prune +Go Archive +Ġdev uelve +PH F +Ġnb Points +ĠHTTP Adapter +cells X +Open ID +ov y +011100 111111 +Ass ume +Ass uming +kit ty +ĠUpdate Failed +:]) ), +Ñĭ в +Ġho omd +================================================================ ============== +Ġ"{} -{}". +Ġ"# "+ +Register ServiceDescriptor +/> ', +³ółģ ¥ółģ¿ +Ġ"< % +Ġ"< @{}> +ĠCO ORD +ĠCO ALESCE +]} { +]} /{ +]} -{ +(? ! +BR K +ĠGo Pro +Local Config +Ġap itools +ĠMy Screener +Ġ'') ] +Top K +look ml +Pi ke +ĠST ILL +And Start +rec ver +Ġflags Surrounding +BB BS +DIS P +DIS CO +Ġcost eA +subject Name +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +COMP ARE +poly mer +Ġdes se +Action Token +600 7 +System Status +NOT SET +ĠMo ore +ĠMo lecular +private Key +>, . +Real istic +ов аÑĤÑĮ +Ġbn ds +AI RE +Ġ[{ : +BER NOULL +Menu Command +LOCK ED +YY aaqihh +ĠGraph ite +Ġworks heets +132 7 +quot ation +dn Z +aur a +ĠPrint Usage +165 114 +ĠGoogle Cloud +Ġpur chases +Ġgrad var +Ġlight ning +Ġlight gbm +geo server +geo coder +lookup field +,)) [ +Space Create +Bot tleneck +Gen esis +share X +æķ°æį® çļĦ +Ġred undancy +905 03 +æĸĩ ç«ł +cam ids +PIPE LINES +hw px +ĠMin us +ĠMin idump +Ġir radiances +ĠÑģ об +ĠÑģ делаÑĤÑĮ +CAR RY +VM ware +micro seconds +ãģ® è¨Ńå®ļ +HW Spd +Stack Trace +Ġground Truth +accept ance +Ġautomatic amente +ĠWeb Error +äºĨ åı²éĢ² +ĠSimple State +ĠSimple HTTPRequestHandler +ĠSimple Grasp +ĠPri mer +ĠPri vilege +contract Duration +Ġresid ence +Ġresid ents +NET MASK +met re +thresh olded +Ùħ ØŃ +904 9 +Storage ClientAsync +machine group +Uni verse +cum bent +ĠItem Response +OC ardTable +OC ardEntry +illi ard +ен ÑĤи +={} : +={} \ +Lim b +Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +sell M +linux dist +Offset Str +ĠNetwork Packets +ä¼ ¯ +ĠWindow Generator +visit Symbol +ĠTemplate NotFound +ĠTemplate SyntaxError +ko loj +ê m +Validation Result +FS R +Ġvisu alized +Ġvisu alizing +Print String +Ġut xo +ĠTask Type +Ġswitch er +Ġband pass +prior itized +SERVER STATUS +hyper v +ĠTable Definition +Ġuseful ness +ðŁı´ółģ³ółģ ³ółģ +ðŁı´ółģ³ółģ ¢ółģ +ðŁı´ółģ³ółģ ²ółģ +{}_ {}'. +Interval List +Interval Secs +EP IC +bon h +prote ome +xFF A +xFF E +Ġnd min +Ġgit lab +sup ers +Import From +Ġown cloud +Ġnu isance +coin cid +Display Entry +æĮ ij +Global Exception +Global Tag +Ġpk dlog +Ġmet py +Ġ36 00000 +filtered MapDict +ĠSum med +Title s +еÑĢ ем +sens u +WA KE +operation Queue +Sto chastic +åĪ° çļĦ +åĪĨ æķ° +åĪĨ ä½į +Windows Server +Ġsv hn +APP ID +Ġquestion no +Template Name +gw ick +表 çļĦ +-{ : +spark Context +ĠPost al +ĠPost fix +################################################################################ ##### +403 1 +Api Config +dark file +nl ons +cod rive +Ġann ually +Remove PodOptions +ĠBlock DevTiers +ĠMark Sheet +[] ',' +Ġstock ing +CY THON +Select ing +ĠØ º +Ġguess ing +Plugin Descriptor +Plugin Control +Plugin Specification +ÛĮ ÙĪÙĨ +Ali en +Cho i +Cho ices +ili u +Ġâ Ĩ +ky fil +ĠSU ITE +Inst ead +406 1 +æĽ ¾ +808 8 +Entity Id +ĠStruct Type +Opt Entry +è¾ ij +umb ai +chi are +scra mble +Ġ------------------------------------------------ ---------- +Ġ------------------------------------------------ ------------- +rist ol +Operation Failed +URI Ref +д Ñĥ +#---------------------------------------------------------------- ----------- +Card Number +Card Desc +ĠJo e +ĠJo hannes +SK fT +SK IPPING +æĢ ª +Ġproto bufs +ĠVi olation +quad rature +Ġ'$ ': +Ġwave function +647 0588 +Player ClientPropertiesMessage +REF GUID +142 857 +åij ³ +Ġreading old +Points T +Ġent ren +Database s +Ġblue bottle +Ġbi en +Ġbi ke +nor et +nor dic +ĠCLI Abstraction +connected Exception +Member V +ific a +ÙĪ ب +ÙĪ ج +VIS ITED +Ġhalf Site +Ġн его +Constant R +Ġer ow +Ġer ased +Ġer pnext +chrom s +大 çİĭ +大 åįķåĩĢæµģåħ¥ +Ġfront Reflected +Driver Attr +Next LogEvents +guess Types +Write File +Ġpdf s +Param Name +Param Constants +Ġur wid +Split ting +rx pk +åī © +åī ª +Ġcloud inary +TX PCAPS +sfp util +ĠSource FileLoader +10111111 10111111 +Convert Feature +Ġк аÑĢ ++/ - +Ġcy clo +å°ı æŶ +("# % +("# ", +sat urday +tm st +tm nx +)+' _'+ +Ġten Flow +('/') [:- +ĠStep LR +existing FilenameNodeMap +ан дÑĭ +м еÑĢ +392 2 +impl ants +Ġboot loader +Ġboot Code +Ġsmooth ness +337 1 +Ġtar dis +ĠVer tica +Seq Num +Seq IO +437 1 +bat im +voltage Sensor +Vertex Array +Summary Provider +ĠHO G +Ġwatch ers +cart Cords +Ġescape s +Ġgreen budget +Ġasset Name +åIJį åŃĹ +Ġgu assian +Ġhex U +Ġhapp iness +ðŁı´ółģ¬ółģ £ +ðŁı´ółģ¬ółģ ´ółģ +Ma ine +Ma NodeName +cook ing +Ġwarning Cache +988 4 +ĠConfiguration Space +MK A +ĠDocument Array +fish ers +fish eries +Required Placement +Required ResourcesEntry +ĠSession Authentication +El lipsis +El vDown +bid os +ĠColor ado +ĠDatabase Error +dhcp v +formula field +Su cess +ĠDistri butor +ACCESS ION +ĠLin ha +Ġweek end +918 66 +è¿Ļ äºĽ +Analysis Directory +Fo x +zM w +Qos Support +Show Modal +Show ErrorDialog +elf eld +sun day +ĠTop Level +mf F +mse val +qq q +ĠPass w +Ġcum m +çĶŁ æķĪ +Imp roper +Pipeline State +Ġspi ces +verti cally +Ġlearn ers +SCHE MAS +aud tool +ĠDire ctor +892 44 +autog rid +ĠпÑĢ ипиÑģ +405 9 +hu BaseGenerator +ÑĨ ий +è· ª +è· Į +Ġci bo +Non current +Ġmol leweide +Metric Meta +ĠSTR UCT +355 1 +Bad ges +Ġfire store +ATH ON +sky water +Used ResourcesEntry +approx im +407 8 +Ġ86 01 +ĠTF NNC +ĠView er +ĠView port +«ółģ ¡ółģ¿ +ãģ« ãģĤãĤĭ +Ġsr hand +Ġmonitor Info +æģ © +Ġtruth TrackPt +åĬł ä¸Ĭ +adow s +UA UC +egg roll +libs mb +Ġquat ES +Ġwar ranties +Bound aries +ç´ ° +357 1 +357 7 +357 9 +Cfg Link +Ġsat test +design ation +design ations +285 9 +uu u +getTyped Value +hard code +Ġ################ ########### +Runtime Warning +Ġincorrect ament +ĠSchema Migration +fbx Anim +Cent roid +ìĹ ĪìĬµëĭĪëĭ¤ +Ġhighest Coverage +aref as +Pick ler +Pick led +ä¾Ĩ åı²éĢ² +take off +wa its +pf D +pf ns +еÑĤ а +еÑĤ и +Definition Arn +ĠTraining DataImporter +ufact uring +ðŁı´ółģ£ółģ Ńółģ +GP IB +Hash Key +请 éĢīæĭ© +yu da +ĠTri e +ĠTri g +ĠTri p +ĠBinary SearchTree +ĠBinary LabelDataset +calcul ates +SIG MORPH +SIG USR +ÙĬ Ø© +ĠGaussian Mixture +illing ness +Uns orted +éĽ » +osa icking +ĠExp lo +'$ |\ +hl cv +prun able +Ġdeep ly +åĽ¾ ä¸Ń +èĢ Ĺ +Ġbounding Rect +Copy From +Copy Paths +ND SE +ND Qu +ND VI +Snap s +ĠJob Input +IJ FI +ĠCer tificado +aaaa a +ĠLoop ing +432 2 +Ġlaunch Job +566 7 +çŃ ĽéĢī +SIGN ING +áĦ Ħ +áĦ ĩ +áĦ Ĭ +áĦ İ +Ġouter most +Bin Num +Ġbel t +ĠUUID Type +ĠUUID NAME +Ġsd File +='\ '\ +Ġbehavior Node +ograph ical +99999 73 +086 3206536 +čĊčĊĉ č +kE gk +--------------- \ +Ġgc j +Ġaltern ating +Ġaltern atives +uj Template +ĠFloat ing +ĠRegister Form +ĠRegister View +ĠAut ogenerated +ĠKEY SIZE +ĠKEY WORDS +vstack ed +Ġslow queryhistory +Bool Parameter +Geometry Id +ĠTarget Finder +ĠDense Net +Term Context +ĠGit CommandError +BLOCK ED +Ep Cut +__} ({ +jump s +Ġsch metterling +иÑĤ аÑĤ +activate Position +Lat in +Lat tice +Ġheap ify +Ġopp ortunities +ĠPart s +ARB ON +Ġ#-------------------------------- -------------- +Ġ#-------------------------------- ------------- +Ġdem os +INIT IONS +Deploy er +Ġeas ysnmp +ĠCOL ON +SUM MAR +åįķ åħĥ +bla ke +ت ÛĴ +ĠBasic Conv +Spect atorPlayer +Ġ{}: ". +friend id +Sta ys +Ġ87 2 +liz ing +ques ne +FB X +]}, " +gather ing +sco laire +Ġprom ise +ĠEntry Point +CONTAIN S +Ġhealth check +docsLoadBal Channel +Install Params +Sort ing +]][ [ +Ġ################################################################ ####### +Ġ'\\ ', +Ġstuff toplot +Ġpen alize +Bucket Client +NZ F +arity Sum +×ķ× ¤ +×ķ× ĺ +;"> ' +{}\ ''. +435 9 +sch metterling +sch lichtungsbehoerde +"/ >< +ade Anuncio +kM vl +èª ° +Tick ers +Ġ================= ============ +Ġcisco TrustSecPolicyMIB +Ġsun py +Ġsun rise +Ġny quist +Ġ#---------------------------------------------------------------- -------------------------- +åħ³ äºİ +åİ» æİī +ulo us +dead lock +NULL ABLE +deployment Name +ĠMer maid +NL G +Ġeasy dict +Ġìł IJ +Ġìł Ħì +mic he +pan optes +pan asonic +ç¨ ³å®ļ +Ġquad rants +pnic fpae +dater ange +Ġठ¦ +Ġठ¹ +ĠRole Requirement +ĠGeneric Strings +Ġfriend Name +áĥĶáĥ ¡ +áĥĶáĥ ł +Ġcare ers +Ġcare fully +fac ial +Ġssh Port +475 2 +475 3 +Ġdu pes +ĠPV OL +Init Resources +Namespace Roles +simp li +Ġappear ance +ĠHand lers +é«ĺ 度 +é«ĺ 太å°ī +don ut +xFA A +ĠContact Form +Ġneutron client +ju lia +Ġpic models +Ġflt Global +ĠMa intainer +ì§Ģ ë§ +mom s +shutdown Notification +Ġphot Filter +Analy tics +Analy zing +Gamma k +Ġke ithley +authentication Mechanism +æīĢ åľ¨ +ĠPOST ROUTING +Ġexpanded Frags +Private Data +Fit Res +Ġeg de +Ġperm iti +Boolean Value +Kh QK +ðŁı´ółģ°ółģ ¹ +Person aId +lbl Info +tang os +éĢļ ä¿¡ +éĢļ 讯 +ĠOUTPUT S +Speci fics +wG g +wG lyph +ÅĤ u +Experiment UrlFormat ++- ]?[ +Gradient Tape +Ġgas ConstantR +æĪij åĢij +Constants Package +Fe el +}% ") +ĠCent os +TRANS FORMATION +TRANS FORMS +Fun ny +\. [ +Ġht ype +ĠSent ences +Ġau ssi +rV idName +æ¸ © +odo Installed +scroll command +ĠChrome DriverManager +algo Strategy +ĠLi ang +alter ed +DIST RIBUT +Ġм Ñĭ +Ġм ен +Ġм он +Ġм ин +Ġtor r +Ġspo ken +ĠBO UND +ĠMove ment +ĠMove It +('* '* +bur ger +Ġ134 1 +Ġsup erimposed +ĠSec ure +ĠSec DebugLogLevel +hover item +ли енÑĤ +Ġtenant adm +Cut s +Cut ting +Tab Bar +Cr é +pres igned +åIJĪ æ³ķ +Ġfaster RCNN +OBJ COPY +fan SpeedSensor +Ġpsy neulink +Ġkill ers +Ġfeatur ize +ĠAnaly se +Fbx Vector +LONG ITUDE +ĠTrack ed +Depth wiseConv +cw l +ĠES Xi +Ġuploaded JarLocation +Quanti ze +ELL IPSE +Ġmorph s +Ġ#------------------------------------------------ ----- +samp width +094 12 +ĠBook ing +bes kyfil +Ġrd Mol +Ġbackup Count +ĠNamed ItemList +ب Ùĩ +World Line +nft Id +ľë ıĦ +dH Z +uá» ³ +uá» µ +uá» · +uá» ¹ +Ġemb ryo +drug design +ĠSTART S +áĥIJáĥ Ľ +slide MenuItem +ĠPos ixPath +Atom Names +Ġcipher Type +xW J +Ġemo tions +VIEW DATA +ج ÙĬ +æ¡ Ĥ +ĠVideo Capture +477 4 +ĠPub med +Ġ`{ \\" +Cli Sock +Hazard List +uer to +Diag nosis +æĿ¥ æºIJ +Publish ing +Play back +nT PerPrAlrm +Ġfood s ++"\ " +kZ G +kZ ER +Ġ################################################ ########### +covid gr +Received Xmas +Ġprim ers +æ¯ı æĹ¥ +éĥ½ ä¼ļ +Ġcert bot +Ġtcp CliSock +ĠStack Overflow +ĠOct o +GTT T +Scope Info +hass py +AIS Alarm +Ïĥ ει +ĠGen otype +MenuItem Selected +Audit Provider +milli meters +ìĸ ij +deleg ates +shif ter +shif ty +shif ting +Prediction Class +Cancel IncentiveProposal +ĠMAC D +ĠMAC M +ìĦľ ìļ¸ +Ġ'; ': +Ġsl di +Ġsl hand +ĠPlatform s +ĠHyper visor +åįģ äºĮ +uris ch +ĠCap ac +ãģ¨ ãģĹãģ¦ +cj l +Ġban anas +Ġopened x +Signature Messages +×Ļ× Ķ +×Ļ× ¦×ķ× +Ñī ие +Ġhierarchy View +Sequential Handler +ä¿® æŃ£ +ben efit +erce Type +cool rack +ĠAcc um +ĠAcc ident +Ġweak ly +Health Status +INSTALL ER +gzip ped +ĠPop ulated +Axis System +Ġturtle s +ĠTer ritories +Ġly apunov +ĠFeed back +Cycle Time +ĠAnnot ator +åıĺ æĪIJ +SgaclMapping Table +SgaclMapping Entry +cad ena +ĠGra fo +Prot otype +Adv ance +ĠOrganization Member +æŶéĹ´ ä¸įå¤Ł +åĪĹ表 ä¸ŃçļĦ +Ġê° Ŀì²´ +ĠCred its +foot notes +Voice Interface +Ġty f +("~ ") +("~ /. +Ġnecess ários +EXAMPLE xxxxx +Abs W +Abs On +Abs Jnt +Abs orbance +ĠCy Get +ĠGR AY +Tmp Info +_* }}$', +rig ged +#. ## +xm lobject +ĠÑĩ аÑģ +Ġmedi as +ĠHo le +ĠQU EST +Topology WithOpts +Relation Type +Wrap Mode +eos pec +Rep licas +Ġstrand Middle +collected Items +Ġskin name +Manifest Column +ĠComment ed +Termin ated +hom o +rhs Node +who ami +Ġinvert Map +ĠSte ve +ĠArticle Serializer +blur red +ĠGraphQL Error +GMT InvalidInput +Mal ware +Rad ar +Convolution al +BIND INGS +xAB B +Ġ================================================= ============== +Ġ================================================= ====== +ACA ACAA +ĠStatic Files +ðŁı´ółģ§ółģ ¨ółģ +FACT ORS +éĶ® åĢ¼ +åĸ ® +ìķ Ħì +consum ing +CERT IFIC +there fore +Ġjitter x +Ġjitter y +Sprite List +Ġ$( @ +Secret AccessKey +alis ca +ĠEnt sche +IMPORT ANT +IMPORT ANCE +ĠDebug ger +Changed Meta +Ġâĸij [[ +Ġâĸij âĸĴ +seding EventQuery +ess ay +thinningThingProducer D +thinningThingProducer J +thinningThingProducer M +ĠLIB RARY +ĠWOR LD +ек ÑĤи +GCC C +Uri Method +kd tree +Ġcamp us +Ġcamp os +Ġcampaign s +ĠIBM Q +ĠLook s +ع ÙĦ +áħ ¡ +áħ ¥ +Ġbc ds +Ġhyp nogram +Inputs Entry +天 åŃIJ +Wr F +Ġmirror s +Ġsubclass ing +TRA IT +iko la +ĠIdentity Task +NIST AMO +ĠProb abilistic +Aggreg ation +was AssociatedWith +Ġsmo ke +Ġdri ven +ĠAir flow +ĠFE ED +æľº åĻ¨ +SYS CONFIG +Ġ144 0 +ĠTele phone +ĠPa int +ĠRi ot +phs bx +Ġpreferred Epsg +Ġê² Ģ +Station ID +Rename TableRequest +Sci Py +Sci ssors +Super vised +Ġspot rac +ĠGood s +ç¡ ¬ +èĦ « +èĦ ± +Ġrp ns +Ġrp csystem +ĠVER IS +ù y +åĮº åĪ« +Chooser Window +ĠRED IRECT +ĠUtil Funcs +ðŁı´ółģ¤ółģ ¯ +ðŁı´ółģ¤ółģ Ń +Validate ResourcePolicy +cron s +Ġdn aml +express ing +lineage Cells +overall rate +模åŀĭ 认为 +ELE MENTS +NK wwtANT +YAML Error +Ġamong st +scraped title +dyn Vel +ĠFIL ING +Ġhb mqtt +ðŁı´ółģ¨ółģ ´ółģ +Ġautos ize +æķ°æį®åºĵ ä¸Ń +Week ly +DV TXPCAPS +Pure WindowsPath +ĠSu ffix +ĠExecution Context +Ġjog ou +ĠParam Exception +Variant Selection +0101000010110011 0101001 +Ø´ ÙĥÙĦ +èģ ļ +Ġhpnicf proxycheck +Bert Policy +aser ow +ĠStri pe +Ġguest s +Serv let +ож д +Ġìķ Ħ +Ġìķ Īë +ĠQuantum Tape +484 3 +496 2 +Che f +ë¶ ģ +Ġuncer tain +WSMan Plugin +ĠCharacter ized +Ġ1234 56789 +éĢĻ åİ® +ĠAdjust ed +ãĥ¼ãĥ ł +797 9 +orbit als +Archive Path +REST ful +skew ness +#------------------------------------------------ ------------ +ëł Ī +ĠRET URNING +arrayT MAPEStd +cdbpLocal IpAddr +Ġwy ckoff +Ġvers atile +tsk set +Ġminim izing +Chat Wheel +Compiler Error +ай ÑĤе +íķ´ ìķ¼ +SPEC IES +zk client +Ġrelax ing +Ġmist une +ĠSTE VE +Ġextern es +legacy Modifier +hydro gen +ĠfltStmt Index +Purchase d +ÙĤ ÙĦ +é£ ® +ĠÎ » +Ġaf ford +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠGENER IC +ĠGENER ATE +Ada grad +Pas ses +Pas senger +ç¥ ĸ +ĠMail box +ĠRUN NING +Resid ue +ä¹Ł æĺ¯ +µółĢ ´ółģ¿ +µółĢ ¶ółģ¿ +ĠÅ ½ +âĸĪâĸĪâķĹ âĸij +\": {\" +Ġwa ist +ĠPiece wise +mov able +Trial Inputs +bob ux +diameter Vendor +ĠDynOv Exponents +OPort Pri +OPort HWPri +ĠPARAM S +è¿ŀæİ¥ æĸ¹å¼ı +684 1 +Ġrear GroundSH +---------------------------------- ") +ĠDesign ation +thanks in +ĠPC BA +ðŁı´ółģªółģ ¯ółģ +SCAN LINE +senti ments +Modules Directory +ĠQuanti ze +Where Filter +Days OffsetStr +çĶ» åĥı +ĠTrace Runner +TRANSACTION EVENT +vul kan +çµ ± +Ġill umin +Ġwik itext +ãģĵ ãģĵ +Ġabbre v +åľĨ çļĦ +ĠDiag onal +Ġب Ùĩ +¶ółĢ ´ółģ¿ +Ġpup a +ĠFe lix +Ġknee Friction +ĠCombin ing +ÏĨ α +æ´ ª +é¦ Ļ +Ġfresh man +('^ [ +ĠSocket Server +Ġlan es +ĠdeÄŁ eri +Pipe lines +Supported Version +Electron Identification +hil ums +mort ality +Ġgir ar +Ġgir ls +ĠFi xtures +Truth Status +Cart By +Ġema cs +æ¯į 親 +Flux es +ÐĶ лÑı +ÑĬ ÑĢ +ĠMu joco +ATG AA +ORmtPort HWPri +RAR ITY +ì nh +poss ibilities +Ġxgb c +Ġdisc repancy +ãĤ¸ ãĥ¥ +ĠUniform Prior +ĠUniform FloatHyperparameter +WifiBridge Lamp +Fr ance +ÐĹ Ð°Ð¿ +ĠâĶ ľ +Ġà° ķ +Ġà° Ĺ +Ġpet scii +Ġsam tools +Ġimpact o +ÑĤо Ñĩ +Ġë³ ´ +SgaclMonitor Mode +级 åĪ« +)& ( +Bond At +Bond HAt +Four ier +ĠCri me +ĠBen utzer +2424 2424 +ĠExchange Error +Observer Subscriber +Relates To +Ġìłķ ìĥģìłģ +Paging Response +Paging Request +bomb Percent +qb di +æĴ ¤ +æĴ ¥ +ĠSL ACK +ĠFIN N +ĠBU FFER +FIRE BASE +Comparison Expression +ĠXXXXXXXXXXXXXXXX X +'# ') +BRIGHT NESS +ICsMan IEIncorr +வ à®° +ĠMarkdown Document +ĠìĿ´ ê±° +ĠSmart Link +ĠClo ses +ĠClo sure +ĠPod s +election date +Stateful Set +AccessBindings Response +Prom otion +bnd box +íĥ Ŀ +Ġrub bish +ĠExclu ÃŃda +Parti cip +Ġloan er +dhcpSnp Bind +Adjust ment +ĠOneHotEncoder Transform +Jwt Authentication +Ġê°Ģ ëĬ¥ +Ġtil tr +Ġparalle ls +ĠGradient BoostingClassifier +Managed Cluster +arpInspect Statistics +Credit CardNumber +Ġê³ µ +hod naLetalisca +kar ate +ø r +depart ures +ĠTIM ETO +Visu alize +éģİ åİ» +Ġbear ings +ĠInv aders +Translate OpIfNotEmpty +GRAD ES +ĠFileSystem Storage +Ġadministr ativa +Ġ################################################################################################################ ######## +glt f +Ġáĥ ¨áĥĶáĥ +ENK ETO +Prote ct +################################################################################################ ## +स à¤ķ +persistent VolumeClaim +Rk dH +ç¢ ¼ +ĠÑĦ оÑĢм +Ġtre ating +Ġhg web +Ġsed grid +Assets Resource +Boosting Regressor +Sym metric +Å© y +Ġfer net +Ġomit Measurements +Ġmir gecom +Ġseper ate +{}" '. +Ġг ÑĢÑĥпп +åĪ¤æĸŃ æĺ¯åIJ¦ +OPTIM IZE +Digit Date +Misc Info +'` { +Pan Tilt +Ġfwhm RMSF +ĠCamp bell +vien as +Ġshrink age +Ġadult s +ICsServ NotSup +ĠFlash VL +ĠAuthorization Response +ĠTRANS FORM +'''''''''''''''' '''''' +ĠAggreg ator +BALL OC +Mk dir +sla ves +ytick format +Subnet InterfaceMIB +ĠStratified ShuffleSplit +passenger Obj +scrapy d +bibli ografia +fur thest +Ïħ ÏĦ +ئ ÛĴ +๠Ģ +๠Ħภ+Ġbur uz +sharp ness +Ġneigh bs +PROMPT S +ér ature +Liquid Sky +Hold ing +Hold time +mL dap +swe eps +ĠScal ed +ĠGauss ians +2739 87 +иÑģÑĤ ика +éĩĩ éĽĨ +ctspVlan SgtMapping +SYN OPSIS +(.*? ) +×ŀ ר +sty lit +Ġclu st +ĠDES EN +Strength s +ĠInvent ories +Formula Dict +ụ y +åĭķ çĶ» +Mor itz +Tt Form +ĠAp skri +ASY MM +ĠSocial Account +PAIR S +è§Ĩ é¢ij +ĠCircuit Python +æľ±æѦ æ¥Ĭæĺ¥ +,... ], +=$ '+ +PEN AL +categor ial +ÃŁ e +Ġinde ed +ĠBlender bot +Ġsayı yı +WEEK DAY +wet test +('{: > +("================ ==== +worm hole +ĠREM OTE +ãģĿ ãĤĮ +TERMIN ATE +ãĢĢãĢĢãĢĢãĢĢ ãĢĢãĢĢĠĠĠ +Walk ing +pfx file +ĠHer oku +DIAG NO +Serve Prefs +ĠChallenge Host +Ġshorten ed +åĩĨ å¤ĩ +å°ıäºİ éĺĪåĢ¼ +fltStmt Arb +MODIFI ERS +Cop ies +Cop ula +nuc l +éĮ ² +atu ur +Ġpunct uator +ĠPACK ET +ĠElastic Search +ĠRIGHT S +ĠGri ffin +Ġcouple d +Ġvernier Chip +Ġautoc lass +MaterialExpression Reroute +åħ³éĶ® è¯į +ĠAnalytical ElementSelector +ãģķãĤĮ ãĤĭ +Bri an +TUN NEL +TUN NISTAMO +uF wu +éİ Ń +Ġcow s +Ġ"+" -"* +held out +ĠSys root +ĠBinder MethodNotAllowed +soli dated +foreign key +Ġ모 ëĵł +Ġconsult a +Ġtooltip ped +âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ +âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ +èı¯ éļĤ縣 +ICsNewPT SIAdbr ++(\ .\ +Ben efit +PAS CAL +iment os +ĠMix in +5746 165114 +unders cores +ĠExpl ore +perturb ations +BUY BACK +QosIf Statistics +ĠSpecific ally +Kine matic +Ġر Ú©Ú¾ +isam Appliance +announce ment +ĠctspIpSgt Mapping +Persistent Volume +Persistent VolumeClaim +Fort ran +Suc cesses +("------------------------------------------------ ------------") +Ġvic tims +dbtool sservice +3427 89244 +Coll ator +overla ped +Locale Middleware +Neighbor Sampler +},{},{ },{},{ +ĠCONTRO L +ĠBoundary Side +Ġmim ic +ĠCLO UD +ĠLuc id +obb ies +ASSET S +INTE GRATION +ImageFolder Structure +áĥķ áĥľ +Ġhighway Sources +Ġhighway Sinks +Segmentation Class +ĠAutoML Search +Squared Error +Tim ings +Vir us +jnt Root +remo tes +deliver ed +diss olved +disa greement +ĠFuture Warning +Ġ`( ..., +Ġpoor ly +dome stic +Ġctl Name +nucle i +VertexAttrib Array +&&&&&&&& &&&&&&&& +Pruning TestModelEltwise +Mip Levels +jav atests +ĠÛģ ÙĪ +ĠSpi keTrainArray +Ġcomplement ary +Stroke Cap +ĠREQUI RE +ĠctspPeerPolicy UpdatedNotif +ATTACK ER +Retri eval +ĠPROCESS ING +éĺ¿ å°Ķ +usbDeviceCdc Fun +ĠSecAuditLog Parts +Focal Loss +æij © +ĠÅŁ ey +Ġmil k +exhale Doxygen +shar pe +ĠVIS UAL +USi V +offers A +EMBED DING +Quant as +multicast Status +MULTIP LE +âķļâķIJâķIJâķIJâķIJ âķIJâķĿ +wed nesday +chkpnt Cluster +Ġgpio zero +Ġstitch er +ĠDest roy +Ġchkpnt Cluster +Ġshut ting +akh stan +IMAG ENET +âĶĢâĶĢâķ° âĶ¤ +ĠNewCell Length +Explicit Hs +lcg ce +Ġillu strates +Ġê°Ĵ ìĿĦ +ĠCHANNEL S +WAL K +WAL LET +fare t +íĶ Ħ +violin plot +Ġpyn put +Ġpyn wb +cyc lic +ĠResp ond +ĠDEFIN ITION +Ċĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉ +Ġ------------------------------------------------------------------------------------------------ ------------- +ĠOrdered Set +ffffffff ffff +Differ entiable +ĠìĹ° ìĨį +èģĶ ç³» +ĠNORMAL IZED +Scor er +å¨ ĺ +Ġtent ar +Ġcab ecalho +ĠRis ch +Ġcooper ative +yste matic +Ġminer als +CHN ICAL +ĠExpect ation +ICsOpt IEIncorr +ĠChemical ConstantsPackage +ICsPkFltMan ErTx +ICsPkFltMan ErRx +ICsPkFltSyn ErTx +ICsPkFltSyn ErRx +DynAd Oc +JAN UARY +Sing apore +êµ IJ +0046 0863206536 +Ġrefactor ing +ĠClay ton +ĠFACT ORS +Stress Regs +MPS State +ðŁı´ółģºółģ Ń +ðŁı´ółģºółģ ·ółģ +Quota Bucket +ĠUpgrade Id +zzare lla +ĠклаÑģÑģ а +ĠVARI ABLES +EFFECT IVE +åij½ä»¤ è¡Į +Bla de +Han cock +mva EleID +çı Ń +èĥ Į +ĠCF FI +ĠLasso Lars +loadmodule status +ĠResolve Info +AccessBinding Delta +Ġ202101 09 +guar ante +ATTACH MENT +AccSfp Exist +MODUL ENAME +nnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnn +Hover Info +Lazy Tensor +Nim bus +ྠ·'), +çĭ ¬ +Ġtort uga +Ġgro bid +ĠNFT Collection +Ġdifer entes +ĠAPIKey Header +ServerInfo Request +channelsresource bytoken +å°¼ æĹ¥ +ĠOperating System +Ġì§Ģ ìłķ +Õ¥ Õ¬ +æĩ ī +Ġaci ma +Ġew ma +ĠSay ı +ĠAff inity +ĠBat telle +Ġonmouse out +Ġkube config +Ġfaz endo +6284 74075 +Ġvarargs Index +ım ız +PNL Path +Ġíħ įìĬ¤íĬ¸ +LANDS AT +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXX +%%%%%%%% %%%%%%%% +$$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$ +Ġkullanı cı +ĠæıIJ 交 +Cour ier +Capt cha +HTT PU +Vap orizations +zel and +0055 686400 +ĠSQ RT +queri e +apri ka +ĠgetIndicator Components +Accum ulator +GetUserInfo Response +xxxxx EXAMPLExxxxx +ĠDOC UMENT +codename s +Supports SetSpeed +ĠAutom ation +éĤ£ä¹Ī è¿Ļ个 +Ġespa ços +NpuNumberForDrop Stat +Follower Num +Pae MIBModule +Smo othed +mfc cs +narr ation +rut ina +Ġnj emu +Ġbombs Surrounding +setCurrent Index +Ġelite ch +Ġjew e +sov token +ConfigValue String +lmn ID +ØŃÙĬ ØŃ +qweqwe qwe +Ġæµĭ è¯ķ +Opaque Pointer +Gather ing +XLS X +Ġdock ing +ĠFully Connected +ĠMiddleware Mixin +Protein Dict +arna at +tokenAmount In +tokenAmount Out +GetPomeriumSession Response +GetPomeriumSession Request +Leet code +Structured Text +SPOT IFY +Geometric Transform +ĠScipy Matrix +ClickHouse TableTarget +ĠLearningRate Scheduler +ÏĦα ι +ĠоÑĩ ков +Adapt ed +Ġæīĵåį° æĹ¥å¿Ĺ +ListPomeriumServiceAccounts Response +ListPomeriumServiceAccounts Request +DLL s +Voo vv +loo ped +Ġpripis uje +01001011 0101110 +datan um +Impersonate Request +Survi ved +octop rint +è¨ĺ äºĭ +Ġê°Ļ ìĿĢ +ĠDeterministic Variable +Cpk Info +Cpk ScopeInfo +pent ine +rug ged +0056 00460863206536 +urri cane +Ġbes ides +mast ery +ĠArab ic +Ġbehavi ors +arrayPeak Index +Ġdies er +DEMO GRAPHICS +ï¼IJ ï¼IJ +Adverti sement +ĠSTRE AM +ãģ«å¤ī æıĽ +(.+ ?) +ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ +phosph ate +AUR US +Ded icated +Fram ing +padd lex +pgs ql +å² Ľ +Ġpiv ots +Ġsyl labus +ĠdU Arr +Ġdream s +ctls Entry +Ġbasket ball +ĠNak hon +ĠGIAI FilterValue +Ġlear ndash +Ġacad admin +ĠProper ies +Traces Entry +Ġsuas ive +ICsAll DynAdOcc +ICsAll DynAdOc +ICsPage Tx +ICsPage Rx +áĥĴ áĥIJáĥł +ĠcloseEnemy Targets +Ġ��´ Ł +εÏĥ μ +ãĤ¹ãĤ¿ ãĥ³ãĥĹ +ä¹ĭéĹ´ çļĦ +Ġëĭ¨ ìĸ´ +,,,,,,,, ,,,,, +ICsManIEIncor Tx +ICsManIEIncor Rx +'''''''''''''''''''''''''''''''' '''''''''''''''''''''' +ICsOptIEIncor Tx +ICsOptIEIncor Rx +ĠìĦ¤ìłķ íķľëĭ¤ +daatAnd Skip +ICsDenINRat Tx +ICsDenINRat Rx +ICsNPTSIAdbr Tx +ICsNPTSIAdbr Rx ++]( = +Gym Env +Lik ely +Marg ins +drunk datanum +Ïį νδ +ĠÕ § +Ġpon tos +Ġsib lings +Ġoss dbtoolsservice +Ġdorm er +ĠLAY ER +Ġuży wa +Ġjav adoc +Ġunresolved Dict +Proble ma +Thumb print +QueryClass ifications +ĠPreview Manager +)}} [( +æł¡ éªĮ +ĠPOOL ING +ĠìķĪ íķĺë©´ +BUILT INS +âĸĪâĸĪâķĶâķIJâķIJâĸĪâĸĪâķĹ âĸĪâĸĪâķij +GNBStatusIndication IEs +ĠPREDICT IVE +#$% ^& +Hum ans +Jaco bi +ntr ls +ëĦ Ī +Ġdod ges +ĠHal os +ĠHum mingbot +fermis urface +THES AURUS +crn rlon +Ñĥй ÑģÑĤа +Penalty Goals +honor ific +Dock Widget +Louis iana +ĠCBE Data +Ġhon or +Invent ario +ĠtestParse Book +ĠGir ls +Ġattribut y +ĠConfusion Matrix +ĠJer sey +ï¼Ķ ï¼ķï¼ĸ +ĠGenerative Model +Ġabsol utely +radky X +Roi Strategy +Ġæ± Ĥ +Withdraw al +BarChart Trace +Medical Example +ĠнÑĥж но +PWC Net +èŀį åIJĪ +Ġìĺ¤ë¥ĺ ëĤ¨ +INCENTIVE PROPOSAL +Gad get +Oam Frames +eon ato +mcall info +ymd hms +Ġப à®± +Ġnar val +Ġnasc imento +Ġanten na +IData set +Prov Info +soul forge +THUMB NAIL +EXTR AS +Ġabsor ption +Ġveg segment +Ġdatan orm +ĠSerum Market +UUEMNN dRQQw +ĠØ· ÙĪر +Ġrepeatable Instance +RequireDebug False +аÑģÑĭл кÑĸ +ק×Ļש ×ķר×Ļ×Ŀ +"(.* ) +Dynam oDB +DMY hms +fidu cial +chod zi +getString FromUnicode +ĠCIS CO +ĠPunk te +ĠHIST ORY +Ġleaders hip +Ġcoment ario +Ġappreci ate +ĠXia omi +ĠJeff rey +ELASTIC SEARCH +instal lable +ĠGaussianProcess Regressor +×ķ×Ĺ ×ķת +Ġ×Ĺ ×Ļצ×ķ× +ĠTicker Id +ĠSymbolic Constant +OutOfRange Error +Ġëĵ¤ ìĸ´ +>): '. +ĠDecrement Level +ĠdatalakeSource Exists +phfqitK etsBarSpace +phfqitOK etsBarSpace +ANNOUNCE MENT +16316325463142524 56313 +Awaitable Get +Halloween Drops +Jit StressRegs +Laf ayette +VDR UN +groupe dby +lomer ative +Ġwpi lib +dich otomous +etas eries +ĠPIE CE +ĠGIST EMP +ICAT WhereFilter +ĠHAN LP +Ġaller gen +ĠnoOf Errs +failo ver +ETAB LEREQUEST +ãģĶ ãģ¨ +ĠÐķ Ñģли +WARRANT IES +ÑĢÑĬ з +202102 12 +cmst phsbx +BLENDO PERATION +PHI LOC +squar ings +ĠBei Dou +PrD nTPerPrAlrm +Ġвид е +ĠSUFFIX ES +05816 200 +ĠRotary Specifics +MatchingEngine IndexEndpoint +СÑĤаÑĤ иÑģÑĤика +иÑģÑĤи кÑĥ +åıįéĩįåĬĽ 液ä½ĵ +Shelve TestCase +пÑĢавÑĸлÑĮ на +ãĤ¿ãĤ¤ãĥł ãĤ¹ãĤ¿ãĥ³ãĥĹ +ĠëģĿëĤĺ ê³ł +Arapaho e +"[\.\,\?\ /\)\(\"\ +ECHE C +GPI Opin +Mys im +Véri fication +XOT ANN +dCheck Fns +gtp ixels +pifu hd +¦éĻ¤ çļĦæIJľç´¢åįĬå¾Ħ +ãij ¹ +inChannel Response +mekk ablue +rocum ulus +Ġaeros ol +gexe m +distd g +andpartner address +setModelData Wrap +ĠScrud APIView +ĠCls Type +kelet al +Requi em +Ġjie ba +ĠgetSix DigitDate +Ġ50612 33 +Ġengg ToMath +Ġrodap é +Ġoblik ujTemplate +Ġcommerce tools +AMaire na +createInteger Symbol +EDUC ATION +EDGED B +manvol num +Seguro ValidationError +Ġcantid ad +ADJECT IVE +SetNum ExplicitHs +LoOr RmtFg +ULFOR GE +Ġquodlib et +ESTABL ISHED +MaxGlobal Buckets +PATTER NS +01295106 5746165114 +Ġfiepi pe +eraSAS IEEE +PRICER EMINDER +,'+',' -'* +ICsDenied INRat +sentie on +Webui DisplayEntry +LoadBalance Mib +STRATEG IES +OutputAs Base +NormDisp Incr +crnr lat +ButtonWith Return +ĠfreeëIJĺ ìĦľ +CRONT AB +ĠforceInvoke GC +ĠARTI FACT +Nevermore Requiem +LISTISSUETEMPL ATES +waveleb gth +BERNOULL I +ĠMinidump MiscInfo +ĠgroundTruth Bounds +åĪĨä½į æķ°åĢ¼ +ĠCLIAbstraction Exception +ĠhalfSite Size +RequiredPlacement ResourcesEntry +SIGMORPH ON +SpectatorPlayer Click +pnicfpae ExtMib +NamespaceRoles Entry +ì§Ģë§ ī +ĠrdMol Transforms +ReceivedXmas Gift +æŶéĹ´ä¸įå¤Ł éķ¿ +ValidateResourcePolicy Finding +NKwwtANT Q +ĠkneeFriction Force +ĠTIMETO OLTIPS +ĠApskri tis +exhaleDoxygen Stdin +channelsresourcebytoken andpartneraddress +0055686400 628474075 +'''''''''''''''''''''''''''''''''''''''''''''''''''''' ''' +Ïįνδ εÏĥμ +Ġ×Ĺ×Ļצ×ķ× ł +! ": +! ). +! "," +! '} +! "} +! :" +" ## +" '), +" ^\ +" ``, +# > +# } +# ": +# === +# ===== +# ************************************************************************ +$ _ +$ )', +% ] +% ")) +& ~\ +' ~ +' (' +' _{ +' >" +' (?: +' ((? +( / +) âĶĢâĶĢâĶĢâĶĢ +* @ ++ =( ++ )- ++ $", +, } +, ') +, }\ +, %( +, ],[ +, )]) +, "") +- ': +- "," +- |\ +- =\ +- [\ +- ]+)/$', +. & +. @ +. )[ +/ , +/ ] +/ '] +/ "]) +/ '). +/ _\ +1 0000000000 +3 326 +3 644 +3 183 +3 191 +4 154 +4 197 +4 112 +4 348 +4 946 +4 344 +4 336 +4 333 +4 994 +5 002 +5 150 +5 037 +5 954 +5 054 +6 133 +6 167 +6 145 +6 997 +6 036 +6 574 +7 90 +7 927 +8 114 +8 934 +8 947 +8 335 +8 00000000000000 +8 072 +9 004 +9 118 +9 198 +9 186 +9 023 +9 145 +: ]* +: /', +: {}\ +: {}" +; = +; '> +< ' += @\ += \\" +> ']) +> }\ +> """) +> :< +\ =\" +] "] +] '): +] (* +] (** +] ('+_ +_ (* +` ] +` )') +a enter +a forms +b num +b son +b loc +b da +b ord +b gra +b lin +b ach +b atter +b width +b ice +b ush +b mc +b fill +b rad +b tw +b dy +b UV +b OH +b dists +b dotControlConfig +b lotter +c st +c ata +c sh +c orm +c db +c err +c bb +c asing +c wa +c jk +c Dg +c Ri +c Pickle +c idades +c imento +c coli +d out +d tf +d ither +d pid +d wb +d roid +d roi +d vc +d strike +d pkt +d pout +d uplex +d vipng +d gtg +d WithFbx +e he +e ol +e ase +e ap +e ci +e ssage +e gs +e ams +e ie +e quence +e ui +e lim +e qui +e By +e arnings +e bd +e bc +e poches +f st +f tr +f ls +f cf +f limb +f coll +f urniture +g mp +g us +g os +g arch +g ait +g ating +g ian +g reed +g uint +g metric +g fc +g dr +g Vals +g ada +g OU +g ì +g odot +g rocery +g lamorous +h L +h ype +h item +h dim +h dx +h Pa +h unt +h apd +h urt +i it +i ert +i lient +i ale +i ef +i ções +i Cp +j co +j ul +j no +j io +j ours +j upiter +k ul +k as +k shape +k ie +k iss +k AND +k lar +k atex +k skk +l len +l ord +l string +l rc +l mt +l Up +l gt +l metric +l MB +l uma +m ls +m error +m idd +m ender +m star +m Auto +m ticker +m Qy +m ansion +m jx +m Por +n ath +n list +n sh +n test +n len +n output +n comp +n ant +n map +n https +n types +n ash +n mt +n Output +n rm +n states +n faces +n Loading +n samp +n States +n usc +n lats +n largest +n Chan +o C +o L +o or +o ir +o ep +o lare +o live +p B +p P +p Q +p ion +p sp +p xd +p min +p ain +p Num +p last +p mt +p keep +p Mode +p Resource +p VK +p ortion +p ils +p untos +p resident +p udl +q D +q ak +q names +q hat +q rd +q rack +r D +r ath +r sc +r min +r lib +r index +r lp +r sg +r dm +r dr +r vv +r dl +r DC +r typer +s O +s Q +s U +s int +s og +s word +s xx +s font +s fd +s noop +s otto +s lashes +s ults +s atchmo +s ushen +t O +t Y +t me +t index +t lp +t bin +t cu +t urb +t Vq +t mtc +u A +u Q +u os +u ance +u are +u ables +u Li +u ô +u Vy +u YW +u Ry +u Æ¡ +v ce +v fi +v xf +v ls +v ml +v ader +v fe +v mc +v ram +v ws +v ni +v ano +v bv +v yt +v codec +v ortex +w and +w xf +w art +w ml +w ield +w ie +w char +w exit +w js +w oman +w kg +w rp +w iring +w OI +w olfram +w esolowski +w anderer +x U +x it +x end +x ds +x ms +x com +x mi +x dev +x CE +x late +x CC +x DF +x Min +x Cell +x CF +x amb +x DP +x hr +x QK +x vb +x inet +y T +y V +y en +y path +y view +y ref +y table +y labels +y td +y day +y grafico +y enne +z at +z is +z path +z ids +z cl +z axis +z gc +z Score +z KZ +z abbix +z GYz +| } +| %( +} [\ +} }/ +} ...') +} >{ +} =%. +¨ ×ķ×Ĺ×ķת +¯ Ģ +¶ ółĢ²ółģ¿ +· ółĢ°ółģ¿ +¸ Į +¸ ëĭ¤ +¸ ółĢ±ółģ¿ +¸ ółĢ²ółģ¿ + £ +à į +à ĵ +Î ĵ +Ð ¥ +Ð ¯ +Ñ ŀ +Ù Ģ +Ù ij'), +Ú Ī +á ´ +á ¿ +â ĵ +â Ĥ¬ +ã ħ +æ Ĩ +é ī +é łģ +ë IJ +ë £Į +ì ¸µ +ì ¢ħ +ð © +ĉ Ġĉ +ĉ ĠĉĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ +č čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ï +Ġ ata +Ġ ense +Ġ lable +Ġ е +Ġ ĊĊĊĊ +Ġ čĊčĊč +Ġ ric +Ġ åĪ° +Ġ ãĢģ +Ġ čĊĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ +Ġ åŃIJ +Ġ åĪĹ +Ġ è +Ġ ż +Ġ åħ¬ +Ġ 并 +Ġ ãĥ© +Ġ à°ª +Ġ è¿ŀæİ¥ +Ġ éĢļè¿ĩ +Ġ ESCAPE +Ġ åĽłä¸º +Ġ åIJ¯åĬ¨ +Ġ éļıæľº +Ġ æľįåĬ¡åĻ¨ +Ġ åºıåĪĹåĮĸ +Ġ ················ +Ġ акÑĤи +Ġ éĺ²æŃ¢ +Ġ éĩįç½® +Ġ ÈĻi +Ġ 离å¢Ļè·Ŀ离 +Ģ '), +Ģ ìĿ´ +Ĥ èĨĬ +Ī 기 +ī ê· +į Ķ +ı ¾ +ı īê· +ķ ìħ +Ĺ áĥ +Ł ° +Ń ółĢ +ĠĠ ĊĠĠĠĠĊĠĠĠ +ĠĠ ĊĊĠ +ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +in at +in spe +in visible +in die +in atura +in forcement +in verters +er ro +er outing +or ciones +on J +on ode +on ay +on opy +on View +on MenuItemSelected +at ari +at ograms +re mi +re var +re factor +re agent +re va +re mes +re aper +re calc +re agents +re xp +re allink +re ptrain +se i +se st +se xt +se il +st c +st est +st ray +st ere +st dio +st ret +st ands +en is +en wiki +en zi +en ça +Ġt sa +Ġt plot +Ġt ache +Ġt var +Ġt tf +Ġt su +Ġt area +Ġt cb +Ġt ips +Ġt aps +Ġt anim +Ġt aste +Ġt aurus +Ġt rends +Ġt ongue +ar q +ar os +ar ys +ar ization +ar bitration +al b +al p +al or +al ch +al ts +al ised +al inux +de tr +de poch +de si +de dicated +de codable +de blended +de structors +le h +le i +le es +le tra +le doit +an os +an ne +an uc +an cp +an omFlag +Ġi at +Ġi me +Ġi lo +Ġi ri +Ġi min +Ġi inter +Ġi step +Ġi cu +Ġi bl +Ġi dist +Ġi cm +Ġi Item +Ġi cd +Ġi lon +Ġi gp +Ġi calendar +me ow +me tod +me erkat +Ġ' ", +Ġ' [[ +Ġ' ]', +Ġ' :/ +Ġ' !' +Ġ' ðŁį +Ġ' =': +ro ph +ro ads +ti ct +ti db +ti ler +ti fication +Ġc ort +Ġc iti +Ġc api +Ġc uid +Ġc dist +Ġc pd +Ġc hest +Ġc heat +Ġc IVs +Ġc lobber +Ġp ens +Ġp cs +Ġp ok +Ġp sk +Ġp AG +Ġp ong +Ġp last +Ġp mt +Ġp pr +Ġp height +Ġp stats +Ġp resses +Ġp nts +Ġp Ã¥ +Ġp illar +Ġf se +Ġf ot +Ġf as +Ġf ms +Ġf error +Ġf event +Ġf ld +Ġf ca +Ġf pc +Ġf dist +Ġf rank +Ġf mm +Ġf area +Ġf square +Ġf lee +Ġf erry +Ġf pga +Ġ" ï +Ġ" ]. +Ġ" ))) +Ġ" :\ +Ġ" {" +Ġ" [\ +Ġ" ')[ +Ġ" (", +Ġ" ()" +Ġ" ::" +Ġ" ');") +he o +he se +it to +Ġa h +Ġa al +Ġa mo +Ġa CT +Ġa cond +Ġa ia +Ġa pid +Ġa ção +Ġa mar +Ġa pare +Ġa hd +Ġa asks +Ġa juda +Ġa voided +lo k +lo ma +lo oper +00 63 +00 022 +ge os +ge lu +ge ben +', ( +', ** +Ġn P +Ġn list +Ġn count +Ġn move +Ġn ca +Ġn tokens +Ġn obs +Ġn ights +Ġn parts +Ġn mr +Ġn tro +Ġn cpus +Ġn spin +Ġn lons +Ġn poi +Ġn ifti +Ġn rrd +Ġn autobot +Ġs st +Ġs int +Ġs pre +Ġs line +Ġs new +Ġs files +Ġs ai +Ġs air +Ġs xx +Ġs fs +Ġs mc +Ġs alle +Ġs fx +Ġs dn +Ġs outheast +Ġs pheres +ut op +ur as +ur alize +ur izer +ur ges +Ġin fix +Ġin liers +Ġin voices +Ġre ss +Ġre li +Ġre di +Ġre label +Ġre weight +Ġre proto +Ġre sets +Ġre training +Ġre normalize +Ġre lying +Ġre built +Ġre deem +Ġre deemed +Ġre allink +Ġre servoir +Ġre shaping +sel s +self register +mport al +ing List +Ġo i +Ġo dict +Ġo uti +Ġo ca +Ġo dom +Ġd line +Ġd max +Ġd ok +Ġd box +Ġd tf +Ġd vm +Ġd inner +Ġd kernel +Ġd slice +Ġd umb +Ġd ltk +Ġd arts +Ġd ungeon +Ġd ungeons +Ġd butils +li ere +li sd +li ka +li vy +ct rs +pe za +un ce +un gen +un block +un ami +un linked +un defines +un iswap +Ġm S +Ġm ur +Ġm ri +Ġm val +Ġm tr +Ġm ms +Ġm sa +Ġm fa +Ġm ld +Ġm true +Ġm ice +Ġm bar +Ġm book +Ġm tz +Ġm ili +Ġm bids +Ġm alleus +ra q +ra vem +Ġe la +Ġe ph +Ġe ther +Ġe vid +Ġe ug +Ġe inst +Ġe cf +Ġe mu +Ġe va +Ġe Idx +la e +la xis +ion et +() ** +() +"/ +fi xb +fi scal +ue ler +ent z +ent as +ad ag +ad List +ad ian +ad af +ad hd +", }, +", {" +co q +co atl +co mports +co deform +ri us +ri ere +ri ssian +Ġb se +Ġb op +Ġb list +Ġb loc +Ġb ust +Ġb ark +Ġb mon +Ġb las +Ġb ones +Ġb Pos +Ġb mesh +Ġb ru +Ġb flux +Ġb Interval +Ġb ayes +Ġb rier +Ġb hv +Ġb ureau +Ġb ingo +Ġb orehole +Ġb abies +Ġb EndpointAddress +Ġ1 00000000 +Ġ1 025 +Ġ1 965 +Ġ1 448 +Ġ# / +Ġ# [' +Ġ# ... +ed ish +ed dy +ed irect +11 98 +11 31 +11 61 +11 0000100 +um ably +um brance +int h +int ere +int cols +int ables +int uition +id name +Ġ( {' +Ġw z +Ġw text +Ġw char +Ġw vm +Ġw ider +Ġw calc +Ġw arc +Ġw anna +Ġw aters +Ġw wz +ch m +ch ir +ch imp +ch ieve +ch uang +te se +te mbre +di cs +di util +di gy +def ns +Ġ[ $ +Ġ[ ": +Ġ[ ([ +Ġ[ +] +ma ka +ma xcbar +Ġself t +ul ui +ul ution +== ( +], '. +], :], +Ġif ft +Ġif Type +ot ta +ck i +ck p +Ġfor tios +"" )) +"" ). +ol it +ol la +ol ph +ol ong +el ts +urn pars +es cal +es querda +turn On +Ġ+ ( +Ġ+ ------------------------------------------------ +ode ep +is ort +is che +is function +is ner +is Statement +is Ui +is calar +is odate +is Watched +val esti +val Summaries +__ '), +name List +get code +get param +get Frame +get Max +get Object +get State +get gamma +get Attr +get Env +get Param +get Tick +get Tokens +get NumberOf +get RoleMember +get Vendors +(' ### +(' ^\ +(' >', +(' ]') +(' +') +(' ()') +(' ....... +)) { +)) | +)) ", +)) [::- +set ti +set state +set Frame +set Image +set Item +set heading +set Zero +set Neg +set Pen +set LoadModule +set WhiteMode +ath rate +Ġ- +", +Ġto f +Ġto i +Ġto float +Ġto Delete +Ġto Ignore +Ġto mato +ĠT U +ĠT our +ĠT rid +ĠT UN +ĠT ian +ĠT EA +ĠT ente +ĠT ony +ĠT ango +ĠT ENSOR +ĠT ILE +ĠT IFF +ĠT URNING +ĠT ibble +xt riage +il h +us id +us ba +us adas +str ations +str atified +str tobool +con ode +con sin +con jecture +Ġ2 200 +(" ==== +(" #! +(" +", +pp lot +pp tx +') ]: +as chema +as inh +[' $ +[' / +et ro +et xt +et ers +et rain +op lin +op ie +op ted +op olog +op oulos +ve ill +ve cts +Ġ{ "" +Ġis am +Ġis class +Ġis Ok +Ġ7 11 +Ġ7 05 +Ġ7 95 +Ġ7 56 +ĠS ul +ĠS sa +ĠS ax +ĠS cri +ĠS CO +ĠS AC +ĠS ud +ĠS ton +ĠS ams +ĠS EL +ĠS OP +ĠS CC +ĠS MB +ĠS car +ĠS ites +ĠS mar +ĠS PH +ĠS anner +ĠS CP +ĠS DP +ĠS olved +ĠS ongs +ĠS emi +ĠS cheme +ĠS ersic +ĠS leek +ab ra +ab is +Ġof ficially +ĠC un +ĠC able +ĠC IT +ĠC ant +ĠC ores +ĠC ATCH +ĠC VM +ĠC DK +ĠC SF +ĠC rash +ĠC CW +ĠC ASES +ĠC ALLED +ĠC JK +ĠC WD +ĠC ambridge +ĠC oulomb +ĠC ruz +ig ment +up a +up ation +") ' +") [: +Ġdef end +Ġdef ec +Ġg to +Ġg ly +Ġg og +Ġg tf +Ġg yp +Ġg é +Ġg ift +Ġg cf +Ġg ae +Ġg bp +Ġg pytorch +Ġg iou +Ġg eral +Ġg sums +Ġg rapheme +Ġg azoo +ter ror +Ġr ls +Ġr limit +Ġr tree +Ġr pg +Ġr arity +Ġr vae +Ġr ndr +Ġr svp +Ġr hasspy +Ġl or +Ġl line +Ġl da +end API +data pack +data cube +ĠA j +ĠA k +ĠA ver +ĠA lta +ĠA ca +ĠA BO +ĠA way +ĠA CS +ĠA UG +ĠA bbre +ĠA esara +sp or +sp ir +sp oc +sp ero +sp ired +sp loit +sp resso +ult ura +ver al +ver de +ver Count +'] ", +'] (' +'] >= +'] ==" +01 91 +01 31 +01 68 +01 69 +01 978 +Ġcon stru +ic md +ke ops +ke vin +am J +am odel +am ination +am ina +to ss +to NFKD +to NFKC +to Checksum +99 13 +99 36 +99 67 +99 298 +Ġ: ##: +ist ing +ist ico +type id +type Name +ĠF al +ĠF IND +ĠF DF +ĠF PN +ĠF OO +ĠF FM +ĠF XS +ĠF requencies +sc ue +sc ored +sc rypt +qu in +qu eried +qu anta +qu izzes +log name +log output +log Message +list p +om g +om be +vi ed +vi able +vi ms +vi per +vi fs +vi king +Ġh q +Ġh size +Ġh len +Ġh dd +Ġh nd +Ġh lm +Ġh ua +Ġh flip +Ġh uber +Ġh inge +Ġh vac +Ġh allo +Ġh dlc +Ġh ousing +Ġh akkında +Ġh usband +all files +all Items +po z +po bj +po strun +ta ut +ta ps +ta ux +ĠP W +ĠP ES +ĠP reg +ĠP las +ĠP az +ĠP DS +ĠP CD +ĠP CM +ĠP sy +ĠP Vector +ĠP rac +ĠP apers +ĠP FX +ĠP atients +ĠP ALE +ĠP aginated +ĠP izza +ĠP cellX +ĠP RUNE +ĠP ereira +Ġas a +Ġas Params +ĠI L +ĠI on +ĠI CA +ĠI CM +ĠI FFT +ĠI hre +file write +file Input +ĠL N +ĠL as +ĠL ES +ĠL EN +ĠL ou +ĠL au +ĠL ets +ĠL vec +ĠL BL +ĠL TL +ĠL igate +ĠL AMBDA +ĠL arger +ub d +ub its +res co +res block +res istor +tr K +tr po +tr unks +Ġth y +Ġth ir +=' ( +=' __ +=' // +=' ')) +=' |', +Ġst an +Ġst ated +Ġde ter +Ġde let +Ġde limit +Ġde cry +Ġde unicode +Ġde cks +Ġde compression +Ġde convolution +Ġde bounce +Ġde dupe +ine w +pro log +pro ds +pro posed +est y +0000 4 +0000 024 +0000 010000 +0000 016 +ex pt +ex pects +im od +im ents +fig Name +fig let +fig datapath +Ġ3 96 +Ġ3 840 +Ġ3 306 +Ġ3 190 +10 20 +10 30 +10 42 +10 61 +10 404 +Ġprint ProgressBar +out files +out unit +ĠD H +ĠD K +ĠD f +ĠD t +ĠD as +ĠD ow +ĠD ia +ĠD SON +ĠD SL +ĠD VM +ĠD Ãī +ĠD isease +ac m +ac co +ac lass +ac ids +Ġu da +Ġu func +Re class +Re map +Re factor +Re liability +Re cursos +Re deemed +Re paintResult +Re zervacija +ite ment +app builder +app Mag +sh c +sh ua +Ġdata List +Ġdata pack +Ġdata sources +Ġdata IdInfo +ĠM H +ĠM id +ĠM ES +ĠM ute +ĠM AG +ĠM ysql +ĠM aur +ĠM IPS +ĠM osaic +time Zone +oun sfield +if fs +key hash +lab e +=" ../../ +=" (.*? +Ġv at +Ġv fi +Ġv ue +Ġv lab +Ġv ols +Ġv itro +Ġv maf +02 24 +02 28 +02 68 +ew n +ext diff +Ġy e +Ġy name +Ġy ara +Ġy centergrid +Ġnp d +ĊĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĠO c +ĠO z +ĠO gg +ĠO PC +ĠO TF +ĠO TL +ĠO GUI +ds lide +Ġ* /\ +Ġpar k +Ġpar list +Ġpar ry +Ġpar cel +Ġx df +Ġx names +Ġx du +Ġx Max +Ġx late +Ġx proj +Ġx CB +os v +Ġse as +Ġse mester +Ġma ket +que l +test lib +test ng +test multi +test Folder +add Action +add Host +add MenuCommand +[" $ +IN VERT +IN STRUCTIONS +Ġstr ptime +xe cy +.. " +.. ' +.. ')) +Ġel lipsis +xb m +xb ft +xb lock +xb ox +1111 1011 +load able +load Data +ore tically +ms an +Ġme al +Ġme chanic +ON IC +Ġfile d +Ġfile Id +Ġfile Desc +Ġfile Pattern +Ġpro ot +Ġpro ces +Ġpro ven +Ġpro prietary +Ġpro spero +py le +py td +py mor +py numenc +xc cp +pre m +pre cursor +pre paring +pre dictive +pre cpd +dex p +ls g +ls it +ap tist +07 37 +07 74 +ang an +xd bo +xd fg +Ġbe z +Ġbe ars +Ġbe half +Ġbe came +are Rfc +Ċĉ ĊĊĉ +"] [: +ĠB A +ĠB ol +ĠB es +ĠB os +ĠB AN +ĠB old +ĠB uri +ĠB TC +ĠB road +ĠB UG +ĠB anks +ĠB irth +ĠB ANK +ĠB ubble +ĠB Rep +ĠB oggle +ĠB loom +ĠB ypass +ĠB ODY +ĠB aserow +Ġos a +12 99 +12 26 +12 56 +12 98 +12 38 +12 200 +12 68 +12 41 +ĠE U +ĠE h +ĠE di +ĠE ER +ĠE ps +ĠE UR +ĠE CC +ĠE NA +ĠE nums +ĠE lapsed +ĠE CB +ĠE uro +ĠE BS +ĠE van +ĠE QUAL +ĠE rik +Ġj n +Ġj w +Ġj er +Ġj am +Ġj ack +Ġj sw +Ġj unit +Ġj asy +Ġj amo +Ġj okes +Ġj uju +Ġj okenposter +ime t +ime des +ci er +""" ## +Ġ< * +ly r +ly des +ly ric +text sc +text line +AT TRI +AT ATTT +xa ab +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +com bi +ans on +ĠN ile +ĠN min +ĠN ach +ĠN FS +ĠN MR +ĠN avy +ĠN NL +ĠN OPEN +ĠN PCs +ĠN eato +ir q +len ül +num ens +num Rows +user Data +user Choice +user Mail +bo uti +bo hr +Ġ4 94 +Ġ4 81 +Ġ4 79 +Ġ4 800 +ff b +ff v +Ġget user +Ġget Text +Ġget Num +Ġget Client +Ġget Target +Ġget Instance +Ġget Constant +Ġget mtime +Ġget tempdir +Ġget sizeof +lu c +dir t +92 11 +92 02 +92 03 +92 34 +92 87 +92 23 +92 56 +92 45 +92 74 +92 73 +tp a +tp layer +col m +col Number +col RA +In di +In box +In let +In Port +In variant +In Ts +ind ing +append entry +ĠR u +ĠR x +ĠR ig +ĠR og +ĠR AND +ĠR NG +ĠR ico +ĠR Lock +ĠR ussian +mo ss +mo file +mo tions +Ġun o +Ġun common +Ġun cached +Ġun initialized +Ġun supervised +Ġun idades +Ġun rar +Ġun distort +Ġun caught +Ġun necess +OR TH +OR ATE +fo ci +Ġtest e +Ġtest it +Ġtest mod +Ġlog x +Ġlog filename +Ġlog loss +Ġlog handler +Ġlog zero +Ġlog Dir +32 128 +ctor ia +per u +per de +per ft +oc d +oc m +ph ar +ĠG on +ĠG mail +ĠG mean +ĠG EM +ĠG IF +ĠG EO +ĠG SM +ĠG HI +ĠG ND +ĠG rover +ĠG lue +ĠG ismo +ĠG uitar +ĠG reece +ces u +Ġco er +Ġco var +Ġco author +Ġco authors +Ġco oldown +Ġco mports +Ġco ffee +Ġon update +EN VS +ĠW B +ĠW t +ĠW x +ĠW act +ĠW ash +ĠW ETH +ĠW agtail +loc alizado +Ġout Size +Ġout Pos +Ġout look +bu da +bu sters +bu ja +AR ON +AR MV +ĠV X +ĠV ent +ĠV BO +ĠV RS +ĠV NF +ĠV gmElectron +ĠV owpal +ĠU D +ĠU Net +ĠU RN +ĠU rban +ary otes +ry ml +Ġnum Left +Ġnum Cols +Ġvalue Batch +print Type +print Label +Ġ5 92 +Ġ5 32 +Ġ5 34 +Ġ5 26 +Ġ5 29 +Ġ5 54 +Ġhe ll +Ġhe ater +Ġhe xdump +ib re +Ġan cho +Ġan iso +Ġan afi +Ġan impath +Ġen cu +Ġen closing +Ġen hancer +ard a +che z +min r +min size +min imo +999 1 +Ġtime func +Ġtime crop +Ġtime Bin +18 50 +18 62 +18 334 +18 3246 +16 18 +16 88 +16 23 +16 38 +16 89 +16 58 +16 206 +line chart +coun ties +array Sample +ft l +sa vg +cur ing +cur CH +cur va +da ho +da wn +da Dc +Ġk li +Ġk ata +Ġk ol +Ġk pt +Ġk ay +Ġk fold +Ġk rases +Ġk üç +Ġcol bar +Ġcol una +Ġcol laboration +(): \ +Ġro lled +St m +St dT +St anford +Ġpy h +Ġpy xb +Ġpy rep +Ġpy card +Ġpy clustering +Ġpy mor +Ġpy nk +Ġpy rin +Ġpy charm +Ġpy mtl +Ġpy tts +Ġpy lsb +Ġpy efd +Ġpy gbif +config path +config dir +Ġ6 01 +Ġ6 14 +Ġ6 86 +Ġ6 75 +Ġ6 60 +Ġ6 78 +Ġ6 371 +lt ers +Ġset Value +ag an +ag ne +ag ua +ag orean +ts pec +04 03 +04 85 +04 26 +04 75 +04 28 +04 62 +04 385 +13 84 +13 43 +13 62 +13 49 +og roup +lib name +06 32 +06 04 +06 05 +06 37 +06 33 +06 46 +06 61 +ll d +ll nl +ll Diff +class num +class property +class Matrix +class Tissues +class ificator +ign or +ign al +ign ite +ign ores +15 11 +15 18 +15 19 +15 37 +15 96 +15 44 +15 98 +15 38 +15 79 +15 62 +15 63 +SE s +SE AM +SE VER +SE PAR +SE CTIONS +ST AGES +ec tivities +100 102 +max r +max v +max Bytes +ass ium +05 22 +05 26 +05 98 +05 74 +05 78 +05 49 +03 917 +03 000000000000 +cs se +cs rc +uti d +uti fy +uti lizer +ip db +Ġop cion +train Model +train Array +Ġch op +Ġch ime +Ġch ords +Ġch allen +Ġch ÃŃnh +17 01 +17 12 +17 29 +17 48 +17 71 +Ġal liance +93 01 +93 06 +93 87 +93 45 +93 67 +93 69 +93 964 +93 955 +valid ations +lit res +sed KlineEdit +14 92 +14 97 +14 86 +14 57 +14 31 +14 883 +Ġpre vi +Ġpre pro +Ġpre valence +Ġpre liminary +Ġresult list +Ġresult Array +ne at +ne teisingai +Ġ/ ** +Ġ/ >> . +du f +qual ifier +gen model +gen ie +gen msg +ĠIN ADDR +sg iving +func ao +ename s +}) / +}) [' +}) '). +Ġeach ClassInfo +host apd +Ġar che +Ġar uco +Ġar thur +Ġar tefact +iter find +iter ating +iter ators +46 11 +46 64 +46 23 +ĠJ in +ĠJ im +ĠJ og +ĠJ ake +ĠJ ia +ĠJ avascript +ĠJ DBC +Log Path +Num er +89 09 +source type +Ġcolumn Number +Field Ids +Ġcal m +Ġcal cula +cp b +cp lts +ks l +)] ( +)] }, +open chain +open shift +open lane +open pyxl +open weathermap +fg as +fg db +assert All +Ġread ers +root Folder +Ġformat ing +Un label +Un matched +Un fortunately +Un iversity +pk M +mask b +Ġq lib +Ġq td +Ġq cut +Ġq codes +Ġq tflux +Ġversion ing +tag ulous +TR gn +sys la +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +air plane +To Track +To Receive +ĠPy dantic +ĠPy Github +Ġ''' < +CON SENT +CON NECTOR +DO B +De e +De ja +De coded +exec line +Ġbatch ing +Config urable +.') ; +US qV +Ġ`` : +Ġ`` < +dim shuffle +Ġval obj +Time Line +Time Slot +ESS AY +ESS MENT +âĢ ² +Ġbuil difier +Ġtable ToMarkdown +Ġdoc book +ell ung +65 43 +Ġdb Name +Ġdb man +grid rad +MP ort +67 86 +67 66 +cat Plot +43 18 +Ġitem set +Ġitem Type +Ġitem List +head lines +Ġsource File +cl c +cl ue +use tex +python path +Ġup to +ĠPro j +ĠPro fessor +results file +CL ES +FF CA +ĠList ric +ĠList APIView +ĠList edColormap +Ġ100 5 +INT ENT +ins ult +vo ie +:: $ +:: `` +000000 3 +000000 05 +Ġpoint less +SI V +SI VE +SI REN +Ġsample Sequence +page content +context ual +48 99 +48 12 +48 36 +48 38 +sv hn +ie ch +)* [ +Ġqu its +)): ] +Ġimg file +Ġimg plot +EX CLUS +ĠData center +ĠData Layout +FA H +FA X +FA q +err List +fe b +fe il +fe icao +red fish +place ID +No CSRF +No Findings +total CH +total LangFileLines +ze g +ze v +ze ch +Ġ'. * +Ġ'. '] +Ġ'. {}. +mode m +Ġarray Sample +ãģ ² +ãģ ³ +ĠAr bitration +ĠAr maz +Ġtemp str +Ġgroup ings +last Index +copy ing +MA LE +Path Type +Path Effects +Ġright y +project a +Ġpri son +Ġpri mal +Ġpri vileged +Model Exception +EST ER +EST ORE +link ing +task id +task num +ca f +Ġhttp tools +âĶ Ĥ +âĶ ĥ +)), ( +)), \ +board ing +Ġuti lized +ten or +span ish +server IP +Max Height +Max PacketSize +Max EpNumber +post url +post back +post Message +Ġtotal Size +Ġtotal Count +Ġback slash +111 0000000000000000 +rol laxis +"]) ; +"]) } +Ġexp ids +Ġtag Name +dic ale +Get Type +Get At +Get Array +Get All +Get Page +Get Prop +Get Motor +Get Src +Get Bounds +Get TableRequest +Get MemoryInfo +Get PomeriumServiceAccountRequest +Get Geometric +Get ClockBoost +game Over +UM D +Node Id +Node StringList +Node labelsEntry +ĠPar m +match Dict +xy c +xy print +xy minmax +ted ges +Ġclient es +Ġclient Id +Ġsum Overlap +Add PomeriumServiceAccountRequest +pc f +pc m +rand x +rand perm +bl fsm +Ġass istant +Ġiter atively +uni qui +char lie +================================ == +================================ ==== +conf luence +Ġbool Input +cho oser +tmp s +tmp name +tmp Dir +anti cip +TO GG +Ġword check +Ġfound ation +Ġfound ations +conv Stride +čĊčĊ čĊĉ +čĊčĊ čĊčĊčĊĠĠĠ +mer idian +mer maid +54 64 +Tra cing +Key Vault +Ġauth req +74 27 +settings Raw +Ġobj Slc +MO UTH +Ġ', ': +vector ization +ĠCo pper +ĠCo uleur +ĠCo erceType +01111 0 +fn i +73 85 +email er +Ġimp or +Ġimp osed +Ġimp urity +Ġimp erative +Ġ... ", +Ġ... ]. +LI G +LI KE +LI FE +Ġnext Position +blob FromImage +Object Types +Com bine +Comp ares +stack trace +day time +Ġuni str +adj mat +Ġfilter Spec +next Arg +Form Data +Form ulas +dev info +ker btime +Le v +Le on +Le aves +Ġeval el +OL A +OL ATION +over den +over loading +over lays +**************** *** +tree bank +Ġbuild type +Ġab d +58 32 +58 14 +58 22 +58 38 +Ġinstance ID +ðŁij Ĩ +access point +pr vkey +Ser vi +gr q +gr ps +gr ats +Ġ12 25 +78 94 +Out ros +Out lier +ĠTest Data +ĠTest Funcs +Reg Range +Reg ToReceive +req n +и на +Ġlocal ground +Ġsign alling +ãĤ ® +ãĤ º +Ġdest a +Ġ.. [ +Ġ.. ................ +Ġbin centers +Ġweight Arr +Ġbot m +User Error +system ctl +59 00 +seq len +ĠDe ath +ĠDe part +ĠDe liver +ĠDe veloper +ĠDe cide +pen g +sw ener +sw itched +Ġproject q +CA J +CA USE +53 13 +53 57 +53 103 +Ġform ated +Ġlib sovtoken +čĊĉ č +čĊĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +68 12 +ĠRes Conv +ĠRes Nest +TY P +Trans it +static Route +IND ICATION +option List +Ġav x +Access Denied +ym Q +author ised +Ġstd Value +acc ents +acc nn +çļĦ åŃIJ +çļĦ ç²ĴåŃIJ +ĠPython ICATWhereFilter +At ari +At Index +At Pos +At ualizar +PL URAL +Ġlambda utils +unit ed +(_ ( +Man ually +Ġchange CC +52 32 +Ġ"/ % +cell list +Of Week +sq n +If CmtsCmStatus +Up E +Up z +Up Sampling +Up ChannelId +ank idb +Ġmsg id +ĊĠĠ ĉ +Sh rink +Ġcase d +Ġabs nr +Image Collection +Image Provider +Int ention +IP ANT +dot a +ĠSo lid +disp lays +:] \ +Ġtmp Input +ÑĢ Ñı +ÑĢ об +ÑĢ он +DB D +Def Template +012 345 +Info Group +ene ver +Ġ". # +Ġ". /{ ++' "') ++' +\. ++' *)', +EM S +su ds +su ant +su its +su mexp +Ġsorted HazardList +sim ulators +Ġ"\ ' +Ġoffset y +Ġfi res +Ġfi bo +}\ "" +Request er +Ġoptim ise +ĠWe apon +Ġ15 26 +CC CF +Inter pret +Inter national +Ġgl Tex +Ġfont scale +Ġfont Scale +IO V +na ver +ĠID leta +Not AliveException +Not Differentiable +Ġtask DefinitionArn +setup Ui +Create OrUpdate +Ġmy List +resp osta +Base TestCase +Ġtri v +Ġtri bes +Ġdocument os +Ġdocument class +Ġph n +Ġapi ClassName +mc app +Ġgrid ded +xfe M +xfe u +ude s +Ġleft y +font properties +Al m +Al to +Al len +Al cohol +Ġ'' '). +Qu anto +video file +keep s +By b +By ID +By Node +ĠFor k +ĠFor um +ĠFor ms +Ġtraining Set +Ġsearch re +Ġsrc File +Client s +69 17 +69 84 +mod er +mod ular +Ġwrite able +App Metadata +App ointment +ink ler +medi ation +"{ { +Ġ'\ '' +Ġsu ffer +Ġsu ited +Ġdown Payment +has ice +stop times +256 25 +era py +ĠCh ip +uff e +Ġshow er +Ġshow Object +optim ise +scal ings +Ġmatrix Spot +Ad ress +ĠImage m +ĠImage Data +ĠImage File +ĠImage Dataset +ĠImage Reconstructor +Ñģ м +database Old +ven ire +Py File +Py Segment +Py Side +inst on +inst ancia +ĠAny Str +Ġmean Value +az l +az io +ĠTh rough +':' % +':' { +For bes +For MaskedLM +Ġvis iting +ĠType Def +ĠType Alias +meta item +ĠDict Configurator +ero om +ero kee +sort able +ĠSoftware Plan +Sp lice +Ġmon sters +Ġmon asca +Ġnon routing +sm u +### --------------------------------------------------------------------------- +win ograd +select able +Ġref lex +æķ ħ +sin c +sin ogram +ones ian +vm m +gy uan +PR PS +ĠDef in +ĠMe eting +script Dir +Group CA +Ġret weets +FO p +Ġact ualiz +Ġact StrokeCap +Ġexpress ing +Ġge ant +Ġge titem +Ġge onode +Pre ference +Pre proc +Pre condition +Pre scribed +DS K +report es +PU PIL +GR ESSION +GR kZ +web view +web kit +web apps +web trade +web logo +------- ') +VER B +VER TIC +Ġfin Pitch +Ġfin ancial +lr g +Sub Token +Sub Folder +Sub stitutions +ĠAPI Error +Ġmem os +Ġmem ories +Ġmem cached +ML QA +ML QDU +Ġ$ ", +Ġ$ $\ +comple teness +Ġbox plot +xce d +Auth z +Auth enticator +Auth Tld +SER VERS +sig lay +sig quit +af ri +dat o +offset x +ĠZ YX +,' ') +NO FILE +Ġjob Info +Ġthere by +ĠBase Data +ĠBase Client +ĠBase Event +ĠBase Channel +ĠEn c +ĠEn viron +ĠEn thought +Ġì ¹ +rs f +Ġnoti fying +('/ '), +('/ '). +æľ ¨ +fin etuning +fin etuned +GB F +GB G +GB I +GB J +GB L +GB N +GB S +GB V +GB W +GB X +ALL O +Ġcell finder +Ġcell Shade +xeb L +Ġsplit ed +THER MAL +ged it +Ġvar ats +Ġvar Match +ĠMan atee +training Data +Ġzip f +Ġzip code +Ġbest Dist +can ucks +]+ [\ +]+ )' +Tensor s +Tensor Mesh +Ġscript ing +Ġcho co +sen i +ĊĊĉĉ ĉĉĉĉĉ +Check Point +ĠFile Output +ĠFile Names +factor ization +fill ing +He ights +oid al +ĠAdd BeliefEvent +distance path +Token Name +Token Classification +supp lied +Ġjo urney +center On +price magic +record ers +threshold On +Ġparti da +Ġcomple ting +oper ability +Ġ13 84 +Ġalpha Left +Ġalpha Right +mount ing +áĥ ¨áĥĶáĥ +Ġstat array +Point ing +br l +br utto +Function Key +sd r +Ġlayer wise +Ġlayer Idx +Ġgame event +Ġgame over +rel Cont +display Node +display feedback +Ġits dangerous +Ġelement ary +ĠApp licable +Ġauthor ed +Ġauthor itative +Ġdete cts +ROM AN +Per Sg +Per Run +Per Unit +Per Url +Per ManagementZone +Color ado +xad M +xad Y +cols ample +0011 01011 +0011 00001001 +.* " +.* ' +.* ") +GET POMERIUMSESSION +cm ul +cm fs +Item Type +ĠKey Vault +GI F +GI ST +Ġctx s +ĠLe ase +ĠLe gend +ĠConfig ReadError +Ġlink refid +ĠComp at +ĠComp romisso +Ġstri pping +xab T +xab k +imp uter +imp lode +MS DU +Ġcache Round +"} }} +Code State +Code Freqs +Date Of +PUT emperature +cf b +cf d +cf env +cf reqs +lex ists +lex icons +mm u +cap fd +arm v +mag limit +mag azine +Ġrest orer +Ġsecond Screen +Sim ulated +Ġpe u +Ġpe ss +Fil t +Ċĉĉĉĉĉ Ġ +OUT IZER +ãĢ ĭ +Ġlong name +Ġweb hooks +Ġweb dav +Ġest iver +ASS ESSMENT +BL A +BL ESSED +Ġprogram med +Ġ'_ '+ +MC F +MC v +SD Q +fc d +rl view +}') " +player Id +filt filt +filt nu +multi modal +multi threaded +multi woz +multi quadric +compile all +document class +ier en +Ġhandle length +Process Name +Process Stdout +Process KeyEvent +Session Error +Session ID +long i +ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĠPRO XY +ĠTime table +ĠTime delta +ĠTime Function +ĠTime zone +ĠTime outs +ification Exception +seri alizables +ĠOr den +avg time +Ġgen o +Ġsuccess full +ranch er +!! ') +ĠPo lish +STR AVA ++" _"+ +CD LL +CD NA +render Text +Box Sizer +area Name +ws z +BO U +BO V +BO AR +Ġsm is +Ġsm arter +where ami +ĠLog ged +ĠLog Loss +vari ations +------------ ') +On Client +å® Ī +Ġcls dict +~~~~~~~~ ~~ +auto scaled +buffer View +Output Type +Output Path +rm w +Equal ity +Manager Base +rough ly +Level Component +çĶ ² +click up +CRE MENT +IMIT ERS +è¿ ľ +js oc +Ġjs n +)/( $ +this name +Ġglob s +OK TA +OK GREEN +Be g +Be ach +Be haviour +ठħ +Resource Query +PS L +GG CC +Ġpad val +xF DC +Is Valid +UE A +OS A +OS AMPLE +OS Disk +cloud pickle +tool z +ĠAc comp +ĠAc cel +fetch ing +Ġaut hed +Ġlook ahead +Ġcard inal +DF S +vs code +FR ENCH +Ph D +Ġgr áfico +ĠDefault Info +Ġ'../ ../../ +zy k +zy w +SH IPPING +0001 8 +gh h +Ġcore utils +Ġ') ]) +tile map +tile Count +Ġdel c +Valid ates +115 183246 +known Nodes +Ġprefix Out +Ġdon nees +IR S +IR NOFF +ĠTuple s +linear time +SO UNDS +Ġskip If +Min nesota +Button Style +:, :, +AV EL +Ġtr X +Ġtr uly +ish ment +Server TestCase +An no +An ki +Ġshe bang +ĠUp loading +Ġve locidad +aut res +aut otvm +Query Type +Task Status +Task Stage +memory view +ĠAl liance +éĢ © +ĠOb stacle +alk on +Ġprob able +ĠPre cipitation +ĠPre dictive +Ġfail safe +pa W +Ġcir culant +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Search Result +ume spresso +ĠPer manent +Ġdt list +termin ations +bi py +bi adj +bi conode +Ġct as +)+ ', +ĠString Property +atterns Error +ä¸Ģ æĹ¥ +Policy Name +Policy Id +Policy Table +Policy Entry +mut ative +control Client +control Types +],[ ]] +å° ĭ +Ġtk FileDialog +[\ ]\ +}'. ") +)} / +BASE BALL +Module Error +YX R +Widget List +Down Frame +ĠAd vection +clear Flags +pd w +ÃŃ o +kg k +Cal rissian +Ġpas sthrough +Ġë ı +Ġë IJľ +AND WAIT +SP D +Device ID +Device Strategy +Device SerialNumber ++\ )') +car di +CR T +CR IS +CR ITER +Ġfailed tests +'^ __ +ĠSer vo +Train able +ĠAn se +ĠAn ne +Ġpop ulating +ĠInput Example +ĠInput ValidationError +Ġlat i +Ġlat ents +Ġassoci ates +Ġmod erate +TC Entity +TC YT +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +enum combobox +Ġ"+ /- +011011 001101 +925 925 +generator erator +Op acity +Ġsel ler +oriz ing +Ġday light +after gemm +Ġgoogle maps +duc tive +NUM LINES +Ġvideo Writer +<\ / +Ġauto map +ĠTrans formed +ĠTrans Queries +Ġmig en +attribute Set +From Array +From Host +Update AccessBindingsMetadata +Ġfp Dir +ev ens +Obj eto +bus co +Binary Coding +л ав +ĠLO OK +pick lable +pick les +Filter Form +Filter Backend +feed Id +prev lin +Ġæ ĵ +ĠSub commands +sr u +NU GGET +SL V +SL ICES +Ġprev Text +VERS ITY +ĠDis likes +ĠDis pon +Ġappro aches +Dire ctedGraph +åº § +404 8 +sn ail +MT Ex +CS F +super vision +FIL ING +ĠRed dit +ĠIP sec +ĠIP FS +Read Input +Scal es +Ġpr de +Ġpr zed +fast est +CM i +CM SC +čĊĉĉĉ čĊĉ +fun coes +}: ") +Default Cutting +wt ACQA +ó d +ima gen +ima gename +Ġinte iros +ĠDo or +ĠEN TRY +SA W +ROOT DIR +EC AL +EC YCLE +Light ing +Light ning +ĠTH R +Back URL +ĠAR C +Ġcut List +Ġcut Bar +You Tube +Ġgra ma +Ġgra ms +Ġgra df +Ġgra bbed +Ġgra viti +Ver dict +Sum mon +Ġmp f +Ġmp consts +Ġmp irun +divid ends +route maps +------------------------------------------------ --# +Ġjoin path +Go x +PH B +PH G +PH i +Ġnb Factors +ĠOrder Item +ĠOrder Payment +cells Y +Open Stack +Open SSL +ov r +ru ssian +assign s +mid gard +merge Time +ĠUpdate Configurations +Ġchain ed +================================================================ ==== +Ġinv M +Ġinv álida +Register States +Ġ'{} -{}'. +Ġmaximum s +³ółģ ¨ółģ¿ +³ółģ «ółģ¿ +Ġ"< ": +MAN ENT +ĠCO LL +ĠCO UPA +]} ; +]} $", +curr Id +One Turn +One DeviceStrategy +ĠReg ards +Pool V +Pool DB +radius AuthServer +radius AcctServer +SELECT ED +Ge ographic +Ġpara view +ĠGo lomb +kw a +kw m +Local File +Local Settings +Local Stack +DD TX +Ġpa cote +world Map +dy ne +Ġap sum +look at +complete Jobs +Ġexc itation +Bar ato +Bar Equals +audio set +hi Pixel +And or +ao lo +rec Taxon +segment Text +Grid ded +Grid Points +DA ILY +TA I +TA K +DEV IATION +COMP LETION +COMP RESSION +Batch Method +sep al +dl train +}} ; +lier props +Ġdes ire +ĠObject Detector +ĠObject InGame +System Memory +System APIClient +Ġcent ery +Ġcent ury +%% ; +mul her +ada strar +cour sier +HTTP ONLY +Ġvm icro +ä¿ Ĥ +Ġclear able +Ġdrop let +byte ps +free form +some dir +edit Source +edit Tweaks +IA i +Mix er +Ġcar to +Ġcar park +configuration Exception +Ġpor que +Ġpor cent +ato ire +ä¸į 带 +ah u +mg d +mg p +ĠSH T +Ġreward String +Ġlater al +semb les +Ġidenti cally +aris ation +ĠNe cessary +ĠNe ighbour +ĠNe urosynth +LIST PROJECT +LIST POMERIUMSERVICEACCOUNT +aj V +zen et +.) { +>. +? +ĠjnxMbgSgwPP Gtp +Exp ROW +Exp losion +ges ch +ital ian +Connection Pool +qt Widget +ĠArgument DefaultsHelpFormatter +sol andi +SM OTE +ĠRo ger +sal ad +IG ATE +Parameter Exception +att ro +105 31 +Vis it +Vis icom +Ġ'< ', +progress Callback +Ho la +analysis Samples +Ġbar coded +ond ale +eno it +Ġcomplete Text +Enter ed +pm ra +pm dec +VC PU +Order No +Sw ag +chart tooltip +Account Type +Ġexport Server +ĠDB SCAN +ĠTrain Settings +Ġcross Set +Mod s +ĠSp end +ĠSp anning +Ġspeed up +Ġorigin ated +Supp ression +CONF IDENCE +Ńółģ ©ółģ¿ +regex s +Match Q +Match Count +Match OnClient +bra vo +Uti liz +ĠAss ist +ĠAss igned +ICES HIP +Ġpoly tope +Args Entry +frag ility +Iter ProcessStdout +Random Sampler +Random Forest +Random Seed +rome da +Rel W +Rel On +Rel atórios +ĠIndex ing +ĠIndex Handler +Mark ed +under covered +under stood +lc j +Thread LocalStack +press o +ĠGroup Pruning +ACC ACC +HEAD ING +Ġoc cs +Ġsmall int +ĠCor re +MODEL NAME +Ġ00 16 +Mock ValidateResourcePolicyFinding +lis ation +ĠProject Info +uit ka +Exec uted +Delete ComponentDefRequest +Delete PomeriumServiceAccountResponse +ULL NAME +Folder Path +MD Q +Ġè µ +Ġvertex es +æŃ ĩ +Ġpol R +ĠMon ster +ĠMon day +contents Sizer +Ġxy Train +gp ib +ĠLabel Binarizer +ĠMessage Segment +Multi AV +ĠRandom Walk +Change In +hy d +hy dr +ctsp Notif +ctsp SgaclMonitor +Ġbook ids +Web Config +Web Engine +wave Plot +3333 3 +LU x +LU y +rag ments +ĠOf fices +BA U +archive Info +234 23 +ĠAnd reas +104 5719 +VS i +VS q +VS WITCH +enc umbrance +STATUS INDICATION +CP x +ali yun +Ġequ ilateral +tan imoto +BF GS +Ġpublic ly +ĠState Vector +OW L +Ñĩ иÑĤ +vertex Count +Ġcos mos +ENS ITIVE +walk ers +ĠSequence Type +LV L +Ġsn k +ĠMulti part +Ġflat buffers +projects Id +Admin User +resid ency +ourse ment +Ġtab ulated +Ġpkg dict +Ġpla id +ĠGL N +ĠGL enum +Ġinterpol ations +Ġinterpol ating +人 èĦ¸ +ced ural +Url Base +\' % +Execution Error +hub s +Ġcdbp Redundancy +==" [ +ĠNoti fier +Tri ed +Ġbig rams +Ġinner Class +arc tic +arc cosh +Ġpp q +bri o +bri s +pet ros +137 183 +CN R +DQ E +Real time +elem wise +nr g +appro priate +LOAD ING +ов нÑĸ +tb G +Ġcla se +ĠMax imal +Arg List +Arg Max +gri p +ĠPh onopy +Ġmag X +Ġmag Y +Ġmag Z +family Name +301 623 +ĠGraph core +ĠGraph Database +Scale Factor +Last Period +Ġsyn spec +Ġsyn tactic +Ġsyn ergia +Ġsyn ColSum +132 3 +Ġvocab ularies +118 943399 +---------- + +Ġgrad check +Ġlight weaver +åĩº æĿ¥ +åĩº éĶĻ +Ġsol ph +Ġsol nml +032 4 +SY R +Ġns bu +rotation Time +Job type +quote char +Header Error +Header Parser +border ed +905 8 +cdbp Redundancy +167 67 +begin ner +ĠMin er +ĠMin Max +ĠMin ValueValidator +800 8 +CAR ET +Ġfl loat +Ġfl ank +ĠParameter Sampler +micro meter +syn sets +ĠMO USE +ĠMO DER +ãģ® ãģŁãĤģ +bre ast +ĠInvalid Transaction +Left Shift +sb plt +separ ation +accept ing +ĠWeb Success +AE s +hd wf +setdefault timeout +voice hat +Ġaudio FileType +ر ا +ĠSimple TestCase +ĠSimple Pipeline +hn en +ä¸Ĭ éĿ¢ +ä¸Ĭ è¯ģ +203 0 +çī Ľ +Exist ence +jnxMbgSgwPP Gtp +Video Frame +lV ote +GRO W +11100 01011 +Ġwrong ly +ĠMock Transport +ĠMock DefTemplate +904 6 +Ġcapt um +verify ing +Storage Error +ä ch +ä hlen +Parameters Res +DIM S +ен еÑĢаÑĤоÑĢ +={} )". +Reference Descriptor +ARG ING +general Matrix +general Tissues +PK H +PK column +gc H +gc j +chan ics +bt g +Ġgot ta +activation Function +Ġvs id +Configuration Error +Configuration Model +Configuration Values +dw Num +ê tre +ARCH ES +nav reptrain +truth y +ĠBe ing +LR a +Ġpot rze +Password Change +ĠBea utiful +Container ID +Container IDs +Print URL +Ġhyper links +Ġhyper pars +£ółģ ´ółģ¿ +£ółģ ¥ółģ¿ +special defense +prior ities +Ġgeo coding +Ġgeo locator +SUB SET +SUB RESOURCE +pot assium +ĠTable au +parallel cluster +ĠBl ur +ðŁı´ółģ³ółģ Ń +NT Q +ste pping +Interval Tree +Ġmid Point +Ġmid night +Linear Gaussian +å®ļ 義 +Rest arts +Ġproc Var +calendar Id +Cor rupted +Ġgeneral file +308 0 +Ġcrop Str +ĠSP F +sup ra +Ġnu Scenes +Ġnu qql +ĠSV I +ä¸ĭ éĻIJ +sto ol +Ġpk i +adv antage +("{ ", +("{ :. +ĠAUTH ENT +Ġsimp ts +Ġsimp lices +ĠOp tical +Debug File +Ret SiteMap +actual Size +еÑĢ ед +286 23839 +FQ i +Right Shift +inc ub +inc lination +¢ółģ ²ółģ¿ +Ġsv r +ĠCustom Deletion +APP ING +APP DIR +Ġ'* | +ĠEd ward +Ġam ended +Ġnor ma +156 3786 +beam line +ĠNotification Hub +Ġв опÑĢоÑģ +Lin has +Usage Error +Ġpipe Src +907 7 +eye Crv +[] ", +-> { +ĠQuery able +185 185 +Select Multiple +ĠØ £ +Ġí ģ +Auto Tools +Auto Flex +Auto Labeling +nlp d +QP ixmap +Cho sen +TAG IDX +Ġcircuit Nodes +ãĤĴ çĶŁæĪIJ +ãĤĴ æĮĩå®ļ +Ġorgan isations +Ġprocessed Text +Tool box +recv until +Inst al +Inst agram +Ġfbx Property +Ġfbx Cluster +Ġdeploy ing +Opt Group +subnet BasedVlan +ĠSearch er +ĠSearch Engine +Li ber +д лÑı +#---------------------------------------------------------------- -------- +#---------------------------------------------------------------- ------------ +#---------------------------------------------------------------- --------------------------------------------------# +AWS Module +ĠVi T +Ġknown Nodes +Draw ing +®ółģ ©ółģ¿ +quad key +Comple xes +mig rated +character istic +CACHE D +Game Nodes +ĠAb el +ĠPi co +"])) ): +Player List +Vec Env +REF LECT +Med als +²ółģ ©ółģ¿ +Average d +LB a +Ġent ro +Ġbi oreaders +sudo ers +Ãł o +å¸ ģ +å¸ Į +Member Def +NR q +margin als +ĠTR PO +Ġti ế +Ġн еÑĤ +Ġн аз +Ġн ей +Ġн ай +AU A +NG j +Ġer f +Ġer lang +more path +Ġfront GroundSH +guess or +ots os +virtual InterfaceList +WARNING S +Ġmar sh +ĠRout es +ĠGame States +ĠFree ze +ĠOne Time +trigger Price +Alt ura +Ġsche ming +PD N +TX CTL +ĠSample Interval +Ċĉĉĉĉĉĉĉ Ċĉĉĉĉĉĉ +HR UN +zh ong +Convert Command +capt able +Ġк аз +Ġк он +Ġк ак +Ġк лиенÑĤ +åĢ¼ çļĦ +385 663 +Ġcy box +Ġcandidate Mats +aux il +Ġrepe ti +ĠFrame s +ĠFrame buffer +mysql Db +Memory Entry +Ġml xtend +ĠWork around +Ġten ha +Custom DnsServer +0004 5 +ĠDIS K +ан ов +Pack aging +RUN ANDWAIT +ij ack +§ółģ µółģ¿ +Ġpixels X +Ġpixels Y +æµ ® +ĠCH ARGES +ĠHTML Session +FD h +FD CA +Score Lost +Ġdr maa +currency Str +ĠServer Status +ĠVer bose +è¦ģ åѦç¿Ĵ +Vol atility +vr ni +з Ñĭ +ident al +996 862745098 +996 137183 +FOR EGROUND +Ġinf all +Ġinf lection +INDEX ES +nm r +('# ')[ +ĠOver riding +ĠLocal Db +Distance Robot +"' %( +High s +ĠMem orial +ðŁı´ółģ¬ółģ ¶ółģ +Ġ88 888 +backup Count +lg pl +lg mlvq +LOCAL ES +ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠ +Ġeth erscan +Repository Error +ĠSession Local +central widget +dri l +dri est +kl qp +*** ") +dhcp d +peer state +SB H +ĠSci kit +ĠStorage Config +ä¿¡ çĶ¨ +139 13 +bro kers +Ġbro ther +Ġhard share +FIELD DEF +COR PUS +crypto currency +ö ren +Ġai op +urb ance +Ġstar red +æĸ¹ æ¡Ī +Fo urnitures +Ġcam vtk +Ġcam adas +Ġcam bios +ĠCloud Watch +Ġtele vision +ĠParse Exception +Show Label +RT M +cookie j +ĊĉĠĠĠ ĉ +Db Id +LIB SRC +qq K +Ġflex mock +__() =="[ +Assignment Title +Imp ô +ĠRet ention +408 7 +DJ I +Func Formatter +XML Parser +vn ÄĽ +verti ce +åı¯ çĶ¨ +FAIL SAFE +aco sh +season al +Ġmpl rc +946 96158 +Kp RK +deep er +prof anity +autog enerate +Ġ-------------------------------- -------- +405 5 +CG AL +Non Empty +Metric Warning +Car los +Ent re +Ġregist ries +LAN GS +MF g +ĠXML Base +ĠTF IDF +ĠUnivers it +Ġbus inesses +wc FB +rem oted +Ġwater mark +constructor s +ĠConnection Refused +ĠProperty Correlations +ãģ« ãģª +åĬ¨ éĩı +Detail APIView +ADDRESS CAPS +BAL ANCE +Ġ': ': +Ġsr gan +Ġsr HNFs +Ġmedian Value +Ġmarket Class +Ġprote ome +åĬł èĵ +wik ilink +ĠDown sample +Dele tes +Full screen +Ġtm ux +ĠKe el +kn obs +rg kmax +ðŁ¤ Ķ +Ġkw mo +Qq HA +ç´ į +php MyAdmin +éħ ĭ +357 3 +three bot +Ġvtk Image +Ġpyg mt +ĠUN SIGNED +nv cc +éĤ ī +Ġ################ ######## +Ġincorrect o +Ġexplicit OCorrect +Flags Entry +902 8 +coco tools +She ep +jj j +Domain Shader +Dest inaci +SCRIPT OMIC +ĠLinear Interp +Ġsky scrapers +cpwVc Local +cpwVc Remote +cpwVc Inbound +Ġrev ocation +Ġrev oked +ĠSelect ing +ĠDI FFERENCE +tEX ticc +Agg FuncExpr +iam i +traj data +Definition Error +Ġterminal tables +Ġled ges +Ġи д +may ankd +ĠTri mesh +ĠBinary Node +ĠBinary Expression +ÙĬ ع +Ġpeople Total +Ġcatalog ue +blog spot +plate au +Uns upervised +éĽ ¶ +Ġray a +':[ ],' +Shader Node +KB aL +Ġmargin als +887 9230327 +Ġplan il +geom space +Ġinp utid +ê°Ģ ì§Ģ +Copy Entry +gold Rat +ĠPR Data +Ġoverlap ped +466 5 +909 8 +Sq WS +TARGET S +risk Score +Ġthresh olded +Ġstand ards +432 9 +AW AY +OVER ALL +å» Ł +Ġmk ldnn +ĠEND POINT +Camera Status +Ġlaunch pad +566 8 +çŃ µ +SIGN UP +wu h +ĠDEBUG GING +Ġdigit ados +ĠFore caster +ograph ie +Ans i +Diff Entry +Ġland m +Ġland mask +Byte Count +bash rc +kE ql +kE gl +rev oked +ð��ı´ółģ¢ółģ ´ +ðŁı´ółģ¢ółģ ¯ółģ +ðŁı´ółģ¢ółģ ´ółĢ +ĠKEY WORD +mZ m +Ġsqu idpy +Background Tasks +ĠVis dom +Bool Const +Bool Expr +oct ober +quat A +sem seg +ĠTarget Type +Ġquick er +ÑĢаР¶ +åıĤæķ° çļĦ +Ġ################################ ############### +Ġqt binpath +第 ä¸Ģ个 +éģĵ å°ı人 +EI GEN +èµ ´ +Bit map +иÑĤ еÑĢаÑĤÑĥÑĢа +wr angle +Ti pos +ĠSk learn +Ġdesign s +čĊčĊčĊčĊčĊčĊčĊčĊ čĊčĊčĊčĊ +Side Force +Ġopp s +live count +åIJİ éĿ¢ +Selection TimeoutError +Ġ#-------------------------------- - +Ġeas iest +ĠCOL LECTION +Click ed +XC hem +ت ÛĮ +ت ØŃ +ĠDIRECT ORY +kc j +Ġdns utils +Ġ{}: '. +Ġscr ub +Na T +Ġ87 1 +Ġfore head +Compliance s +sco ut +mJ mZ +Ġtd odbc +Ġhy dr +Ġ108 4 +ĠIdenti fiers +ĠERROR S +è¿Ľ åĪ¶ +WITH IN +Ġtran sed +Rec tilinear +ĠDete cts +ĠMatrix Error +spo ilers +MJ D +MJ h +MJ PG +MJ lM +PART MENT +ĠìĿ ¸ë +ĠModi fication +íķĺ ìĦ¸ìļĶ +leaf let +PF X +Ġsho ppers +666 99298 +428 31624 +æĻ ® +forecast ing +dX F +åħ³ èģĶ +AFT s +Ġconstructor s +Ġsto mach +Ġfeedback type +deployment Label +Ba L +ĠMer chant +Ġmicro states +Ġmicro bepy +"; "); +gf tratio +xE F +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +Ġpb kdf +}; " +Ġठª +845 03917 +ĠStream Encryption +CAN ONICAL +ĠNon Empty +ĠNon ParaG +DM UL +Ġcare er +ĠPipeline Context +roc eries +Ġsay ac +Ġsay ının +QUERY USERS +QUERY GROUPS +485 8 +Http ResponseError +Ġdu pe +Init CpuEntry +Master Filler +dup lication +lU q +è´ ¨ +Ġdd pg +Schedule Slot +Export Exception +ç»ĵ å°¾ +care ers +tracking Particles +don ate +don ot +Ġrecogn ise +Ġrecogn izers +Sys Path +Sys ctlsEntry +TIM ELINE +Ġ118 63 +ĠEmbed dings +ĠInitial CameraPosition +Ġgateway forms +TI ER +848 1675 +social wall +ĠCalcul ated +è¿Ķ ãģĻ +éĩį è¯ķ +Ġintegr ates +Ġintegr ators +utt seg +Ġiso format +Ġdecision s +064 88 +Switch ing +Credentials Error +使çĶ¨ è¿Ļ个 +Ġquality Mask +refer ral +åľ° åĽ¾ +TG TT +Compute Shader +ĠChar acters +å®ŀ éĻħ +published At +NETWORK S +Kh QL +Ġmt fixb +="{ { +DateTime Field +)| *. +Ġmn ar +ĠDummy Metric +274 94 +Ġfrac Value +abo ok +CRY STAL +Ġpys nmp +Arch itecture ++- ]+ +åıª è¦ģ +Internal Error +TRANS PARENT +mini po +Graphics Context +RPC Server +Ġtc ax +Ġau stralia +Span ish +Span Sec +Selected Path +scipy biteopt +dD px +sand wich +Ġwheel base +Ġposs ÃŃvel +dnn lib +Ġqual trics +contrast LaImages +Expected Improvement +Ġspo on +Ġeigen vec +Std Src +465 10819 +bur den +åĨħ çijŀ +Async Thread +Ġims izes +Ġdry Run +contra cted +Ġmini po +)+" /"+ +Cut Strategy +об ÑĢаж +Groups Enabled +DNA class +Ġiss parse +Ġiss uer +iser ver +ĠClean ed +ĠPassword Reset +OUR A +éĢī 课 ++] ?[ +Ġdense net +chrome os +0100000000 0000 +äºĮ è¿ĽåĪ¶ +ĠXXXXXXXXXXXXXXXXXXXXXXXX XX +pretty Print +bullet Order +Creation Rate +fan Rpm +Ġnom i +Ġdark file +BAD GR +amer icano +čĊĠĠ č +Force On +Depth s +Depth Combined +ĠAnsible AWSModule +éľĢ æ±Ĥ +tre k +tre x +ĠES O +Ġima gen +ĠmscModVcs RowStatus +Ġgrids ize +æѤ æŶ +æѤ åŃĹ段 +Sync ing +draft s +Ġmorph ing +Ġ#------------------------------------------------ -- +ĠSplit s +Ġrd class +clicked Pos +Ġosp rofiler +ĠPDF s +ãĤ¤ ãĥª +mor ning +por tions +Ġens ured +Ġchord length +dH d +motor bike +uá» ij +uá» ĵ +uá» ķ +uá» Ĺ +Ġpie zo +Ġemb d +Ġ.... : +Abstract EventLoop +!!!!!!!! !!!! +Sent Clock +slide SetSubmenu +='./ ', +prox mox +Priority Queue +XYZ Info +Atom Tree +Atom Sym +ĠOptim ize +HASH SEED +xW I +determin er +Ġemo j +åºĵ çļĦ +VIEW PORT +HG Cal +SOL UTION +477 8 +Ġticket LinkFun +ĠDomain Charge +Cli mb +Cli pping +VX LAN +Ġtopo logies +ĠPlay book +ĠMode m +ðŁı´ółģ«ółģ §ółģ +çĶ¨æĪ· çļĦ +ä¿Ŀ çķĻ +TEX COORD +Ġintro duces +Commit Log +Ġfood Spawn +ĠDistributed Sampler +PRIV KEY +线 æĢ§ +Ġ× ¨×ķ×Ĺ×ķת +Ġ################################################ # +Ġ################################################ ## +routing Status +ðŁĻ ı +ок ен +decision s +433 1 +Ġtoggle Dict +Ġà ® +Ġnan ose +ĠStack er +colored logs +FULL Y +ĠZero Padding +è¿ĩ ç¨ĭ +ĠSTAT ES +Patch y +Sn mpAdminString +Zone Index +Å¡ ÃŃ +é» ŀ +ĠACL s +Ġosg DB +ĠGen Img +аÑģ к +âĸĪâĸĪâķij âĸijâĸijâĸij +Dimension al +ĠGEN E +Separ ate +Predict ing +å°± ä¸į +Cancel Request +ĠAL TFONT +ĠFit ted +Dr zave +Ġ'; '. +ĠPlatform Info +ĠGu ardian +ĠCap acity +ðŁı´ółģµółģ ¡ +ðŁı´ółģµółģ ŃółĢ +ãģ¨ ãģį +choose op +ĠRoom s +ĠCli pping +ĠRange Index +10100 1001101 +×Ļ× ĺ +Annotation Task +lus ive +([^ < +ĠFra is +integr als +Course Locate +abbre viations +ĠCase Study +Deep Learning +clamp ed +(':') [- +ãģĻãĤĭ ãĤĪãģĨ +Ġsit ting +ĠFeed ElementList +464 1 +464 9 +Ġ':' ))) +ĠAnnot ate +Ġprec is +еÑģ ÑĮ +åıĺ æĽ´ +Ġsmart y +Ġsmart ystreets +Ġorders Priority +Jp OJ +cad astro +uẠ¥ +uẠ§ +uẠ© +uẠ« +wy z +wy ckoff +|| | +Ġrpc peer +spl char +spl unk +åħ¨ å±Ģ +ĠAlgorithm Blocks +ĠMetric Type +wl cs +Äį no +Äį eno +ãĤĮ ãĤĭ +ĠmcRmt HW +Ax on +Har rison +JO URNAL +YM H +ο Ïģ +isol ine +Ġnecess idade +Contin uing +:::::::: :::: +ĠWorker Pool +Heat CapacityGas +ĠCy Uart +ĠVal uation +Ġcomputer Choice +North land +cen us +oe uvre +ORIG INS +#. ''', +AQ AB +aW l +bil ateral +æĦ Ľ +ĠAPP RO +STD DEV +Topology Exception +Relation ships +:** ") +eos fit +Ġeye lid +ĠMask RCNN +ĠBus ca +Ġphrase List +ĠShape file +WEB PACK +ĠDateTime Field +Fix It +who se +endant Cell +Ġcoin cid +ĠArticle Part +र ठ+Ġæī ¾ +åĩ½æķ° çļĦ +³ółĢ ¹ółģ¿ +ĠNV Link +objec tids +Seed s +Ġ================================================= = +Ġ================================================= ============= +ĠAsync Mock +ĠAsync Iterable +ACA AC +ĠStatic Kernel +FACT OTUM +Ġpopup s +Gpu DimShuffle +Under lying +snow leopard +ìķ ½ +ìķ Ī +covariance s +(.* )", +QT q +increase d +Ġsubstit uting +Traffic Light +MOV ED +LZ L +Ys W +ë nim +semi logx +Ġpep ulators +htm lt +AGA AGC +IMPORT ED +ĠDebug ging +è¾ĵåħ¥ çļĦ +Ġâĸij âĸĪâĸĪâĸĪ +ĠHar ry +Ġextreme ties +GTerm Context +Nj Ss +sit ting +ĠÑĥ же +Physical ResourceId +Plug Value +ë© Ķ +Ġrdf value +ĠLIB SRC +ек ÑĤоÑĢ +kd xa +Ġdz do +Ġmens al +office document +ĠForeignKey Constraint +Ġincident Details +ĠAudio Clip +ĠPL ACE +æĸŃ è¨Ģ +Double PFPuppiJ +ĠWebDriver Exception +æĢ§ èĥ½ +Ji Y +RAD AR +RAD IO +âĪ « +èĭ ¦ +Ġ---- # +ACTIV ATE +缴 åĪ° +Ġbio shareX +ĠRad ar +ĠRad ial +åħ¶ å®ŀ +çĻ» éĮ² +ìĸ´ ì§Ħ +hY UF +èİ·åıĸ æķ°æį® +ĠRi emann +ĠInstanti ates +SSH Client +Ġê² Į +Pat rick +μ α +Ġosc ill +ĠSS LO +Ġga ze +Ġgold Rat +ĠKernel s +áĥĶáĥij áĥ£áĥļáĥĺ +Super visor +Super sedingEventQuery +slog an +wavelength s +Ġdur ch +Ġdur ante +ĠVolume Liquids +Ann ounce +Īë ¹Ħ +Ġbm Attributes +Fw Version +ìĥ ī +ĠctspDef OperSgaclMapping +æ±Ĥ ãĤģ +cron tab +xv g +ÅĽ li +rosa urus +Ġdn ld +icu uc +ĠPRE V +Conversion Exception +1001111011110101 0001101 +íĬ¸ ëĦĪ +Veri fies +lift ing +ĠCAN CEL +tur bo +ìĪĺ ê°Ģ +Ġrelat ives +ĠAct uator +ĠFIL ENAME +quant umespresso +Ġstub ber +axv span +ил ÑĮ +æĥħ åł± +ë³ µ +('+ ','-'* +ĠInstruction TestGen +ĠStat istic +æķ´ 个 +æĽ° ä½ł +reh ensive +Ġ193 1 +ĠPr ince +extreme ties +083 91 +pivot ed +Ġlease Parameters +ĠCOMP LEX +ç½ij ç«Ļ +ãĥ³ãĥ Ģ +ìĭľ ì§Ģ +ìĭľ ê°Ħ +Ki K +catch ment +('| '. +('| '): +ĠParallel Aggregator +010001 000 +Ġblend Mesh +Ġhier arquia +Ġmaintain ing +motif Strengths +Pages MountPoint +ĠBucket Lock +ĠBucket Permission +frm PlayerInfo +could n +CHUNK S +Ġìĭ ł +Ġìĭ ľëıĦ +ĠRNN Cell +occur red +ĠAdjust ing +ĠExternal Writer +олÑĮзов аÑĤÑĮ +lM tl +orbit al +Ġplate Corners +Ġbor rar +ĠVari ous +Ġanim ations +Static Files +modal ities +ĠcdbpPeer IpAddress +01111110101111011 001001 +Ġbam boo +ĠReduce Mean +#------------------------------------------------ ---------- +Ġever green +Ġgran de +Ġyellow brick +äºĭ åĬ¡ +å®Į åħ¨ +表示 åıĸä¸įåĪ° +Au ction +indi co +Ġtaxon Data +Ġwy kon +ALI EN +Ġspell ing +Targets Entry +bic an +ĠCrypto graphy +æµĭè¯ķ çĶ¨ +Ġmit suba +FAST A +Ġowl nets +quaternion ic +ĠfltStmt Action +809 0 +ÙĤ اÙĦ +è£ ¡ +ĠÎ ´ +Ġxt rain +ĠHDF S +Ġmission s +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X +Wind Gust +Zr MZ +broad ening +ool kit +Ġsouth west +ĠCUR R +Ġviz Engine +Ġcomposition al +Resid ence +és ult +ĠLabelEncoder Transform +organism Tag +vX v +µółĢ ¸ółģ¿ +chop ped +dicom Mode +ĠPas ses +\": \"" +ths Float +Inspect eur +mov Avg +Concat Dataset +belief s +Ġquant as +Regular Polygon +åİŁ ä¾Ĩ +åİŁ å§ĭ +æµģ ä½ĵ +ĠWORK FLOW +493 1 +Gain s +mind waveMobile +ĠÚ© Ûģا +ĠOff sets +PLAN ES +Elev ator +Sky Coord +ĠTrade Info +Evaluate Res +Destroy Particle +è¿ŀæİ¥ å±Ĥ +AJ ADQ +DPT ADDRESSCAPS +ZM n +Ġnv cc +ĠDist inct +ĠMis configurationException +ĠReal ESRGAN +5555 55 +误 å·® +Working Directory +ĠTransformer Mixin +blo q +Ġmeet ings +æѦ èĹĿ +cdbpPeer Index +cdbpPeer IpAddress +ĠNEW LINE +Gy ro +Put nam +Ġdefin icao +Ġconvention al +ĠFunc Animation +ĠDirect Label +Reply Error +ĠVeri fies +ĠQuanti zation +RAS A +Ug mk +cit dl +ĠCIF Article +ĠHam mer +ĠÐĴ аÑĪ +ĠìĦ ¸ +Organ ism +TAX E +Prun eSource +ר ×IJ +ilit Ãł +ĠQual trics +åIJ¯ çĶ¨ +Ġneighborhood s +Ġب Ø´ÙĥÙĦ +çķĮ éĿ¢ +XP ENDING +XP atternsError +ĠÄ IJ +Ġeig s +Ġeig vals +Ġeig vecs +ĠTun able +Ġrh os +ĠCombin es +CIP ES +λ μÎŃνα +æ´ Ĺ +Ġfresh maker +Ġnuc ypher +ĠTick ets +ĠSyn chrotron +ĠdeÄŁ il +Capabilities CA +çĻ»å½ķ 失败 +Vect s +aqu amar +æ» ļ +Ġpres umed +Ġburn er +Ġburn ed +ĠFORM ATION +Ġanti petros +åıĬ åĪ©äºļ +ĠÑģÑĤ ÑĢани +cql types +jb od +èŃ ĺ +doub an +Generation Id +ĠVisu alizer +Tip Info +ÐĿ е +rein forcing +retain ed +Ġ'] ': +Ġpure ly +Ġfre ely +Ġguid ing +ĠACC EL +Ġdeliver oo +Inline Text +Ġalg um +VERT ICES +Dih Num +Rm dir +Ġwal dur +='. '): +Ġdoub let +fli pper +ĠâĶ Ķ +deco Gift +Ġsequ encing +DIFF USE +å®ī åĵ¥ +ĠREG ION +832 92 +ë² ķ +Ġcmake Lines +ĠSimp lified +])+' " +ĠOw ned +Intensity Analyzer +IPP ROTO +Ġ================================= ======= +Ġeb cli +Ġ["" ], +phon ology +Expl orer +refname div +Ġinstal ação +Comparison Result +Downloads Directory +ĠClassifier Explainer +ospf If +,:,:, :]) +ELECT ORATE +Zh one +Ġelastic ache +apid oc +apid ocs +RET URNING +AGAA CT +åĪĽå»º ä¸Ģ个 +ĠæĹ ĭ转 +Mongo DB +ç§į ç±»åŀĭ +ĠSupported DBType +Bang TokenType +SAS Dot +èı ľ +mels pectrogram +Ġcame o +ĠClo udify +Ġrobo corp +Apple TV +ChainLock SignatureMessages +Episode s +bnd l +kir bid +unda ção +oph ily +ĠGP IB +archives Password +Ġsubsequent ly +Ġlamb d +Ġmaxim ally +AGTT A +čĊčĊĠĠĠĠ č +MEAS URE +åºľ ä¸Ń +WebSocket Server +大å°ı åĨĻ +Mes her +ZO OM +ZX h +Ġcubic web +ĠFO Vs +obot ocore +Ġpyqt Slot +ĠArm Pose +Servers Net +gpt g +Instrument s +ĠWire Cut +ãĤ³ ãĥ¼ãĥī +ĠZope TestCase +Phot ometry +ĠTransformation Params +Ñĭл о +}}} }' +åķĨ åºĹ +ĠÑĩиÑģ ел +ĠSy nthetic +ĠSCHE D +Ġlens fun +ĠNu Images +POLY TRACKER +Ġestablish ing +Gl ance +Ġion type +ĠInser ts +ĠEXT ENSION +ĠEXT ENSIONS +ĠDisk Usage +SAL AIRE +cra zy +cra zyflie +sie ving +Ġáĥ ij +Ġáĥ Ľ +Ġips o +ĠPUB L +Ġya hoo +QUANT AXIS +AGGREG ATE +Lj C +Timing Point +Timing Points +±ółģ ¡ółģ +·ółĢ ³ółģ¿ +ĠAtt endance +ĠPed idos +ĠME AS +Inference Session +ĠUsu ário +UpdateParticle Ent +æĭī åħĭ +æ¶Ī è´¹ +æ·»åĬł åĪ° +/** '), +Ġè¿ĶåĽŀ æŁ¥è¯¢ç»ĵæŀľ +algebra ic +ĠCla use +ĠMor an +ĠMor ning +ductor s +Ġг од +ĠWHITE POINT +ĠStrict Redis +ĠStrict HostKeyChecking +Ġdil ithium +ĠTfidf Transformer +ĠEric sson +ĠNR PE +ĠRefer er +comput ations +ãĤĤ ãģ® +ĠHeight map +ĠTRANS FER +Hk df +Ðij ележ +Ġchess board +ĠNET LINK +ĠGer enciar +ĠHard ware +Subnet PacketSize +glue point +???? ???? +ciscoDiameterBasePMIB Local +bibli ography +696 969 +CLOCK BOOST +Rh ode +fav ourite +|* ': +ĠÑį к +dere ference +shap enet +Ġdiscri m +TimeSeries Categor +Ġbottle s +京 師 +ér é +ĠrlHistoryControl Buckets +DIC ALE +Freq GHz +FORE IGN +kick ed +rang t +æŁ ± +ì¶ Ķ +edx app +tektronix DPO +tektronix MSO +ĠGre ater +ĠYOLO X +DUPL ICATED +çŃ¾ åIJį +Ġtorque Rod +(.*? )= +ìŀħ ëł¥ +Ġ################################################################################################ ########### +Ball jump +}({ %( +æħ ĭ +Ġæķ°æį® åĮºéĹ´ +ĠCts SgaclMonitorMode +ĠPhi lipp +Ġkine matics +ipa healthcheck +CLIM BING +Heap Item +0100000001000000 0100000001000000 +åı¯èĥ½ è¿ĶåĽŀ +Ù¾ ÛĮÙĪÙĨ +Ġç ı¾ +Ġocr d +Ġblo om +Ġdeve m +2814 121 +InputTransform Processor +è¯Ħ ä¼° +æĹ¥å¿Ĺ å¹³åı° +Cd tr +PUR CHASE +POP ULATION +4802 34946 +èĩ³ ä»Ĭ +ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ +âķļâķIJâķĿ âĸijâĸij +èĦļ 注 +Cpp check +Cod er +Lan Mode +ipe trash +ìłģ ìĿ¸ +ĠMol Kit +ĠMLP Classifier +ĠConditional Poisson +ĠConditional Logit +Ġopenv switch +ĠQiskit MachineLearning +ãĤĵ ãģ§ +ĠLOAD ING +incremental CompileOperation +enhance ment +Alex Net +Alex ander +Risk Map +chin astock +abstra ctions +ĠDol t +ĠBP synapse +ĠBalance d +ĠElastic Net +Ġvernier Cell +ãĤĪ ãĤĬ +Ġbrute force +MaterialExpression FunctionInput +DEPEND ENT +Ġì¶Ķ ì¶ľ +Blink y +Tax Id +TUN ING +Ġ~~~~~~~~~~~~~~~~ ~~~~~~ +Ġ~~~~~~~~~~~~~~~~ ~~~ +Ķë ī´ +Ķë ĦĪë +arma cy +Ġcow say +Ġbright ening +ĠCAP DU +Ġglo uton +ĠConfirm Dialog +BACKUP INFO +èı¯ éĻ° +BID POSTS +Emb ryo +FIND ING +Ġblink py +ĠSAT URDAY +ĠCG AL +Ġyap ı +Ġcompri sed +Ġcompri sing +ä»ħ ä»ħ +Ġarchives Username +OpenGL Context +ĠдÑĢÑĥ г +TRANSL ATOR +Ġachieve ment +Say Hello +gloss ary +hap loid +pine apple +relat iv +stk var +macos x +Reco Tracks +ĠBRO KER +产 çĶŁ +è¼ ª +è¼ ¸ +Ġlif espan +Ġnas ceu +Ġcongru ent +ĠMARK ER +11110000111100001111 0000 +agc gg +ĠHEL PER +sendto address +ĠпеÑĢ ед +Networks Entry +Party Type +ĠWaiting Analyser +BlendShape Channel +pand da +×¢ ׾ +èIJ ¬ +arri vals +ĠCLO SING +1717 996137183 +Ġshar pe +Unary AggFuncExpr +INTE GR +ImageFolder Dataset +ĠMOD ULES +æ¤ į +Ġ************************ ******* +deliver oo +ĠBlog Post +ĠRen ew +Conformance Classes +Ġhexa gon +Ġrab bits +ĠHu BMAP +ĠRep lication +temper atuur +ĠZe it +ĠZe eman +ĠMajor é +ĠSentence Transformer +ĠÑĤаблиÑĨ Ñĥ +Grand Parent +Spi keTrainArray +aż er +bld r +jav adoc +ìĻ ¸ +olc Database +ĠPrep end +Ġendian ness +Ġaline file +ĠProvision ing +Ġquas ar +8193 37176 +capac itor +capac idade +Social Media +åºĦ ä¸Ĭ +ĠPhysics Tools +ĠUNI VERSITY +ĠGafferScene UI +ĠRefresh Token +éĺ¿ èģĶ +Ġìĭľ ê°Ħ +æij Ħ +ç· ¨ +ĠåŁº äºİ +Ġpom dp +Ġdill file +entr ys +Ġze ep +5724 819337176 +ãģij ãĤĭ +è¿ĺ æĺ¯ +Calib ri +ĠMyResource Pool +BILL BOARD +funiIfConf Sig +funiIfConf Ilmi +Cog n +Perspective Transform +hj ong +ččĊč čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġpron oun +amon ds +Ġxk cd +è§Ħ åĪĻ +èĢģ æ¼¢ +Ġillu strate +Ġlkml dict +Aes Gcm +Shel by +kor ali +íĶ ¼ +Ġiop c +Listing Mutation +Ġquater x +Ġtrig code +Ġìĸ ¼êµ +GNB STATUSINDICATION +ä¸įåIJĮ çļĦ +Differ ent +Clu starData +Fund ing +slo upce +arv ind +Ġez ff +ĠFX O +Ġthl flux +owa Äĩ +ĠVE LOCITY +sax utils +ĠRecomm end +ĠRecomm ended +ĠKuge ln +ãĥī ãĤŃãĥ¥ +servic enow +áĥĽ áĥ£áĥļ +追 踪 +ĠAutoModel ForSequenceClassification +è¿Ľç¨ĭ æ±ł +ĠèĵĿ鲸 åŁºç¡Ģ +ĠèĵĿ鲸 æĹ¥å¿Ĺå¹³åı° +habit at +reti en +Ġreco il +getNum Pages +ĠSIO CGI +ĠPOL ARON +ĠOID C +12578 05 +12578 056 +Ġ<% = +Infer rer +mich al +ĠJAN VIER +ðŁı´ółģºółģ ¡ółģ +ä¸ĭè½½ ä»»åĬ¡ +ĠfbxLayer Materials +ĠбÑĥ к +èѦ åijĬ +ë²Ī íĺ¸ +Viz Params +cairo cffi +Ġ".. ")) +tek st +ĠBal dry +tribu tivity +Conditional Generation +ĠendTime Phrase +7833 8879230327 +]+\. [ +Suppress Mentions +WRIT ABLE +WRIT TEN +åĩºåĬĽ ãģĻãĤĭãĤĪãģĨ +Evalu ated +än ge +对é½IJ çļĦ +è·³ è¿ĩ +Ansible Module +Friendly Locs +Worksheet Index +ĠImmutable Map +Fib count +Fib onacci +fant asy +qG SIb +Ġpai ement +Ġsla ves +ĠCpp check +ĠMur ray +lenn ium +emiss mat +ĠStub ber +CONTRACT S +ÑĢед ел +rapid yaml +displayed Bookmarks +ãĢij ãĢIJ +Ġëĵ ± +associated Typedef +seo ul +(")") [- +spaw ned +poli tics +ĠMutation Type +pyth ia +3245 000 +hospit als +weed ie +ĠHor ns +ĠHor ovod +Ġcompos ites +ãĤ» ãĥ¼ãĤ¸ +Ġphys net +Tagged Item +Ġprerequis ites +Ġazimuth Offsets +ç§ij å¨ģ +ĠAdministr ative +dhcpSnpDbStat Last +Ġ模 åŀĭ +Cour ses +Fac ade +cass ini +greg Name +iag R +Ġpand ac +Ġfem ur +chlor ide +ĠSTY LES +Ġsubscri bes +Envi ar +5606 2425 +CONFL UENCE +ĠForti OS +NNNN NNNN +spectro grams +Trip let +çŃĶ æ¡Ī +Snippet Options +Residual Connection +Ġë§Ī ì§Ģë§ī +Luc ent +Smo kingStatus +çĵ ľ +ĠÏĥ ÏįνδεÏĥμ +defi chain +Ġcif Tags +Ġcob ra +Ġpam ogk +Ġreda ctions +ĠSon os +ĠAmb iguous +ĠASS URANCE +Ġuic md +ĠGf Matrix +ĠGel man +Ġshap enet +merid ional +Approved ForAll +TECH S +à¸ģ ภ+fourier Har +ượ c +PLANET ARY +ĠMONGO DB +âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ âĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶâĢĶ +Bor ough +HMF CA +Panda Modules +Sar ah +Tutorial TipInfo +xtension s +modelPath Bare +Ġroz umie +ASSE MENT +Ġcontro urs +TextIO Wrapper +NoSuch Process +MAINT ENANCE +princip le +Ġmanim lib +propag ators +ĠBarry ExportException +ĠBarry ConversionException +ĠSMOTE ENN +缸åIJĮ çļĦ +ĠElectrical Demand +Ġúlti mas +Elasticsearch Exception +fsw Algorithms +|--- |--- +Ġnarr ative +maked oc +ĠSQU ARE +ĠAux iliar +listPieces Black +ĠDET ECT +ĠBayes Classifier +Ġcogn ito +Tournament Drop +Ġexplo ded +CommandLine Argument +WEAP ONS +Ġdesapare cidas +ĠíĨ µ +ãĤĴåıĸå¾Ĺ ãģĻãĤĭ +Impersonate Response +æ±ĩ æĢ» +Ġë°ĺ íĻĺ +Ġpalav ras +Hide Show +Nod al +Sav ings +aero spike +sobre nome +Ġãģ§ åĩºåĬĽãģĻãĤĭãĤĪãģĨ +Ġ"'' ")) +extr usion +ERV ICE +Ġbehavi ours +Ġconten ant +Ġconten ido +Ġfiber flat +Adverti sing +ĠìĨ į +influx DB +éĢĴ å¢ŀ +Ñĥм енÑĤ +consult ar +vertica py +ĠMaya Cmds +IMPÃĶ TS +tacacs AuthServer +tacacs AcctServer +Fram erate +Pseudo DojoFamily +Suggest ed +aqK lineEdit +forth coming +Ġاس ت +Ġico los +Ġsie ves +elong ation +igable String +Ġdeform ation +ĠIDE A +Ġselecion ado +addObject AtPos +ĠEmb arque +colpm RA +GetNode Attribute +ĠColab oratory +Ġautore load +ĠæĿ ¡ +ĠæĿ ¥ +Neo Pixel +æľīæķĪ åĢ¼ +ä¼Ĭ æľĹ +ä¼Ĭ æĭīåħĭ +ĠØ´ دÙĩ +Robert son +εÏĥ ÏĨα +ì¤ij ì¹ĺ +SMTBF SweepInput +Cra ig +Eco EII +Pag SeguroValidationError +SAR SA +VIMS Error +YQQ Q +blab la +yar ac +Ġnats orted +viv ace +Ġsegu ir +Ġbean count +ĠELE MENTS +ĠETF s +ĠRod rig +Ġalph amind +Proble mas +6901 84503917 +BOS ITY +DeletePomeriumSession Request +å§Ķ æīĺ +å§Ķ åĨħçijŀ +Surf Node +GUESS ES +ĠBertFor MaskedLM +Satis faction +ĠAirport Map +ĠSqlAlchemy BatchData +Menor Valor +UpstreamHealthchecks Active +UpstreamHealthchecks Passive +cirrus vet +BAT TERY +Bars Plot +pist ol +sni per +decide Server +Ġblit z +xtr uth +9958 115183246 +ĠFog gy +Ġhwt Hls +ĠPET Sc +appar ate +Ġorche stration +Ġcouch base +Ġanci ent +ĠsetObject Clean +Ġchamp ions +ĠReplay Buffer +ListTables Response +ListTables Request +filmografi a +ĠqPos AvgLoc +ĠqNeg AvgLoc +6737 3052 +ĠÐĵ енеÑĢаÑĤоÑĢ +Ġautop ct +ĠMoh amed +ĠCorrection Swaps +casesFor ICU +casesFor Venti +GlobalLight Color +GlobalLight Direction +osaCent A +osaCent B +ĠExplicit ly +Ġdemonstr ated +FirewallGroup Port +ĠбÑĥд еÑĤ +ADDTASK ADMIN +ADDTASK OWNER +Jas per +JRI J +wvl ns +Ġrech te +peech MatchOnClient +ĠTod ay +ĠSAV ING +ĠPAS SED +Ġvow el +INSTR UMENT +ĠEPOCH S +epNumberBulk In +Ġheapp ush +ĠProg Bar +Ġphon enumbers ++"/" +" +Ġdecim ator +Ġ"{}/{}/ {}". +çĽij æݧ +INTERPOL ATED +åĵª 个好 +Excl usion +.-- .-- +Distr ito +SMB H +nore ply +Ġåıĸåĩº 该 +ĠdQ Arr +getCluster Id +":"" },{" +ĠAW IPS +Ġhil las +ĠMÃī DICALE +ĠBor uta +ĠRabbit MQ +ĠCONTRI BU +ĠPRODU CT +ĠHttpStatus Error +åįİ ä¸º +大éĥ ŀ +ç©ºæł¼ éĶ® +Ġturbin ia +áĥļáĥĺáĥ Ŀ +Bent on +Mais Barato +eha B +lgn rm +squee zenet +Ġaer on +atel ja +ĠCategor ia +Ġexclus ively +="^ ", +ALB UM +Resized Crop +goti ation +CONTR AST +Transformed Distribution +IndexIn Cycle +:\/\ / +GRAP HY +NEIGH BORS +ĠCombat Data +moll view +Switchover Interval +denomin ators +à¸Ħภ³ +>(.*? )]) > +: |\ +: ,\ +: ?\ +: ")," +; {\ +< {}>'. += âĢĻ += }< +> * +> ; +> /", +> ${ +> }]', +? '. +? "), +? ~\ +@ &\ +@ ~\ +A ER +A lta +A tmp +A fee +A juda +A symCoinGame +A chieve +B is +B price +B mag +B tc +B EE +B bb +B percent +B Ag +B anner +B aby +B QK +B utter +B Kp +B ike +B ounded +B orrow +B isector +B ashOperator +B rizard +B ristol +C en +C ort +C ts +C ws +C AND +C ANCE +C ropping +C assandra +C lasse +C DELT +C umberland +D ing +D ab +D od +D ert +D ob +D AP +D ick +D ear +D MA +D Matrix +D MD +D ados +D NT +D uel +D ARRAY +D ARTS +D exter +D omesticHotWater +E ight +E ps +E du +E ym +E sm +E je +E tw +E uk +E Kh +E HG +E vil +F en +F ds +F LL +F its +F ear +F sw +F ONE +F lick +F MJ +F ENCES +F rontier +F resnel +F alsi +F ulton +G if +G AR +G mail +G AD +G MA +G Bo +G si +G QL +G rat +G CD +G rove +G PG +G bz +G Xy +G JA +G LOSS +G umbel +G ears +G TRX +G UNICORN +H xe +H IVE +H gc +H MI +H CLK +H artree +I a +I st +I AG +I IS +I STR +J ST +J RE +J AL +J ama +J AE +J uniper +J icn +J APAN +K in +K is +K ES +K AR +K ORE +K NR +K hg +K illing +K ubernetes +K NeighborsClassifier +K ᵧ +K evin +K UKA +K rylovNewton +L um +L as +L AG +L PP +L hx +L pd +L BR +L ao +L lc +L BA +L java +L GC +L dv +L iving +L VARS +L ASER +M pe +M ic +M im +M eld +M net +M IM +M AB +M org +M ash +M ins +M mk +M tl +M ails +M aur +M ATH +M zA +M iller +M zMz +M ammal +N ur +N min +N max +N UT +N IS +N ix +N my +N dim +N ERS +N TY +N samples +N LC +N Ip +N FS +N nz +N MF +N bio +N uclideResult +N GridPoints +O ON +O US +O vers +O js +O pus +O dk +O VC +O HH +O hm +O CEAN +P nt +P min +P AM +P ron +P lat +P ension +P IM +P ong +P CK +P states +P GN +P kg +P ula +P eng +P JJ +P INS +P lugs +P eriodic +Q PE +Q ym +Q Policy +Q RA +Q Slider +Q uiet +R ack +R ER +R sa +R cs +R ou +R ust +R TT +R é +R pd +R SP +R SM +R HW +R QK +R RF +R BM +R cL +R acp +R ollo +R ifer +R HEL +R WSpeed +R ISCV +S or +S lo +S name +S ms +S oc +S ight +S db +S old +S AD +S ze +S ymb +S late +S part +S ML +S MC +S BO +S rm +S USE +S mass +S NS +S sl +S dw +S lices +S olved +S aref +S molar +S lides +S HOP +S trap +S ENDS +S tix +S PARSE +S obre +T es +T one +T et +T ic +T our +T ls +T oc +T AS +T run +T Ac +T ong +T PE +T Class +T IF +T ama +T ANG +T eng +T DK +T rends +T angent +U il +U IC +U rb +U dp +U wm +U rn +V St +V db +V AM +V io +V TO +V CE +V tk +V AI +V QR +V DW +V IPER +V axman +W an +W ON +W are +W lt +W rt +W IND +W IP +W SC +W TF +W ASH +W aste +W XK +W inston +X ar +X ST +X EL +X ian +X sd +X FORM +X VID +X mx +X RANGE +X MPP +Y ang +Y np +Y NC +Y CB +Y zW +Y eti +Z EN +Z max +Z ED +Z END +Z HR +Z TI +Z ONES +\ _ +\ )\ +\ +\ +\ ":[ +\ ":"+ +] "], +] |\ +] _, +] _[ +] +'\ +] !=" +^ / +_ \\ +_ )[ +_ }\ +_ {}/ +_ ^_ +` ]( +` ='% +a xb +a ument +a mag +a ired +a NG +a partment +a Quote +a fts +a iplatform +b rom +b ure +b ls +b ly +b names +b mode +b dt +b vec +b ida +b mk +b ii +b Obj +b ills +b qs +b Ra +b wr +b ctest +b cnts +b ureau +b ionic +c args +c mo +c line +c number +c ai +c fs +c dm +c On +c Files +c rab +c Place +c OX +c tives +c racker +c Sib +c rane +c lobber +d de +d te +d us +d all +d file +d lab +d ans +d line +d ok +d reg +d obj +d year +d topic +d uel +d RT +d Kp +d ining +d ala +d Errors +e class +e utils +e Fh +e ÄŁer +f th +f sp +f line +f ak +f api +f bs +f tag +f ca +f spec +f mod +f rank +f NA +f eng +f bc +f prime +f phab +f rench +f uzzer +f arthest +f abien +g ma +g ab +g all +g are +g ob +g code +g da +g ag +g ast +g ant +g run +g ists +g colors +g qa +g pa +g cov +g pickle +g ives +g markers +g opro +g libc +g romacs +g lade +g änge +h P +h ence +h uc +h ists +h ank +h gt +h oly +h ii +h MN +h jj +h ocr +h indi +h anoi +h orizontally +h ldr +h ierarchies +h lmann +i ew +i add +i print +i max +i info +i au +i lities +i vals +i NR +i KR +i InstrTest +i StopIso +j pp +j file +j ak +j pn +j dc +j Ãł +j QI +j uly +j uju +j fscoer +j unior +k ol +k am +k ls +k ap +k lif +k Num +k az +k account +k vs +k orean +l ith +l pt +l vert +l bn +l Mesh +l ZW +m P +m R +m ss +m get +m reg +m object +m AP +m nn +m ug +m DB +m fin +m ips +m scMod +m indx +m lengine +n fig +n args +n out +n param +n action +n dist +n spec +n If +n ature +n vars +n obs +n fl +n Invalid +n Content +n logs +n prec +n phi +n Host +n levels +n Plus +n pix +n Done +n Hash +n Press +n Running +n Your +n udge +n qn +n engo +n ulls +n rrd +o T +o ed +o el +o ED +o ai +o aG +p ce +p ate +p ang +p low +p join +p ale +p lag +p cre +p aw +p Of +p fp +p rag +p iles +p folio +p volumes +p itches +p unte +p Lvl +p NodeConts +q T +q in +q type +q em +q conf +q State +q freq +r P +r gs +r message +r ud +r vert +r gn +r gw +r prof +r Vq +r dataclass +r Rj +s C +s D +s ut +s ult +s format +s map +s run +s batch +s bg +s content +s idd +s late +s chi +s Ri +s Available +s QJ +s nek +s Kaolinite +s OutputBase +t ore +t ense +t num +t atus +t we +t Data +t client +t case +t unit +t Code +t LC +t vv +t chunk +t insertion +t Loss +t means +t Unknown +t pex +t Deleting +t ır +t Qp +u ai +u ffer +u vm +u dims +u uv +u PDF +u KA +v ue +v di +v xt +v ens +v ys +v dict +v og +v ign +v nn +v cpu +v cm +w end +w ere +w ann +w ick +w amp +w MD +w arc +w rote +w esi +w asserstein +x K +x in +x def +x test +x dex +x AC +x title +x AD +x yp +x match +x lang +x MT +x vertices +x DC +x ctype +x BD +x imo +x liff +x FilesFactor +y ch +y len +y ummy +y inc +z al +z he +z ad +z pp +z we +z mat +z BY +z ipping +z mr +z hao +{ ((( +{ ;( +| % +| , +| ") +| }\ +| (? +} '): +} "]) +} ]), +} |\ +} /\ +} >'. +© å±ķ +¬ å¦Ĥ +¶ ółĢ°ółģ¿ +¸ ìĿ´ +» è¾ij +¾ ¸ + § +à ĺ +Ä ¼ +Å £ +Å ĺ +Ê ĥ +Ë ĭ +Ð Ń +× ĵ +â ¬ +â ĭ +ã Ī +é ¬ +é ± +é ĭ +ë ¨ +ë Ī +ë ıĻ +ì ½ +ì Ĥ +ì į +í ľ´ +ĉ čĊĉ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +č ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ,- +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ ãĤĴ +Ġ 854 +Ġ Ċĉĉĉĉĉĉĉ +Ġ · +Ġ ãģ« +Ġ 877 +Ġ éĩį +Ġ å°± +Ġ 9999999 +Ġ è¿Ľè¡Į +Ġ çŃī +Ġ íķľëĭ¤ +Ġ å¾ħ +Ġ ãĥŃ +Ġ å¼Ģå§ĭ +Ġ åĨį +Ġ åıijéĢģ +Ġ ĉĉĉĉĉ +Ġ âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâķĹ +Ġ å¢ŀåĬł +Ġ ERNp +Ġ åħ¥åĬĽ +Ġ arduino +Ġ με +Ġ ç»ĺåĪ¶ +Ģ ëĭī +Ī æĿĥ +Ĭ ¹ +ĺ IJ +Ń IJ +ĠĠ Ċĉĉ +ĠĠ čĊč +ĠĠĠĠ ĊĊ +ĠĠĠĠ ĊĠ +ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠ ĊĊ +ĠĠĠĠĠĠĠĠ č +in W +in en +in ti +in form +in size +in Name +in version +in vention +in ria +er ange +er ste +er ased +or un +or ff +or io +or relation +or pay +or arily +on ion +on key +on do +on tract +on eline +at n +at te +at ms +at dl +re el +re ver +re ll +re mat +re process +re bound +re hand +re writer +re scaling +re zoom +re cog +re servoir +se le +se ems +se texpr +se mester +se diment +st as +st ain +st itle +st aircase +en r +en rol +en vio +en ggNumber +en dix +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠ +ĊĠĠĠĠĠĠĠĠ ĊĊĊĠĠĠ +Ġt sp +Ġt ep +Ġt dd +Ġt dim +Ġt span +Ġt scale +Ġt domain +Ġt inputs +Ġt vars +Ġt cr +Ġt cn +Ġt lf +Ġt ente +Ġt ivar +Ġt ernary +Ġt ampering +Ġt ahsin +ar U +ar V +ar W +ar st +ar te +ar ation +ar ak +ar massist +al n +al umn +al gs +al ie +al ics +al RT +al bedo +de h +de i +de ce +de mi +de mean +de compile +de berta +de quantizer +de cember +de epest +le ments +le gen +le xtype +le thal +an ing +an zi +an alyst +an isotropy +an uncio +Ġi ut +Ġi print +Ġi lat +Ġi ran +Ġi met +Ġi SEG +Ġi TmpReg +me in +me call +me mdump +Ġ' ...') +Ġ' != +Ġ' \\\\ +Ġ' ;', +ro a +ro sen +ro bjects +ro cessor +mp n +mp img +mp ool +mp irun +Ġc data +Ġc path +Ġc ac +Ġc lic +Ġc dict +Ġc base +Ġc ream +Ġc ai +Ġc ors +Ġc No +Ġc mode +Ġc fs +Ġc sin +Ġc cf +Ġc enum +Ġc ea +Ġc rf +Ġc dh +Ġc aster +Ġc fm +Ġc Extension +Ġc insn +Ġc EffOp +Ġc rumb +Ġp ion +Ġp el +Ġp data +Ġp im +Ġp ap +Ġp ele +Ġp sys +Ġp exit +Ġp sm +Ġp ram +Ġp cap +Ġp fc +Ġp coords +Ġp ino +Ġp gp +Ġp nl +Ġp cie +Ġp AUC +Ġf j +Ġf str +Ġf ist +Ġf args +Ġf ang +Ġf ip +Ġf ids +Ġf ysical +Ġf acilities +Ġf ifo +Ġf antasy +Ġ" ][ +Ġ" '. +Ġ" ]: +Ġ" ); +Ġ" ]/ +Ġ" ]') +Ġ" ]", +he in +he ated +he tes +he ater +he aven +he xdomain +## ------------------ +it ron +it oken +it bx +Ġa file +Ġa ms +Ġa mpl +Ġa graph +Ġa ingle +Ġa pts +Ġa mn +Ġa mazon +Ġa sex +Ġa houghton +lo ler +00 80 +00 30 +00 40 +00 73 +00 68 +00 51 +00 033 +00 916 +00 057 +00 058 +00 2657 +00 4802 +ge ster +ge mann +ort emp +ce b +ce m +ce tt +ce mbre +', ): +Ġn ion +Ġn ub +Ġn In +Ġn lat +Ġn ies +Ġn height +Ġn fs +Ġn sq +Ġn images +Ġn cm +Ġn unique +Ġn ada +Ġn regions +Ġn wires +Ġn ominator +Ġn Deg +Ġn ortheast +Ġs pp +Ġs col +Ġs ire +Ġs ag +Ġs port +Ġs parser +Ġs izer +Ġs hed +Ġs ift +Ġs vec +Ġs rm +Ġs bi +Ġs ni +Ġs amb +Ġs runner +Ġs upy +Ġs ö +Ġs izing +Ġs Äħ +Ġs onic +Ġs phs +Ġs IndexReg +Ġs atchmo +ut an +ut are +ut filepath +ur ale +ur den +ss us +ss are +Ġin dir +Ġin File +Ġin files +Ġin Size +Ġin sn +Ġin formed +Ġin duced +Ġin clusion +Ġin gestion +Ġin hib +Ġin volving +Ġin progs +Ġre x +Ġre ma +Ġre com +Ġre no +Ġre number +Ġre do +Ġre location +Ġre project +Ġre active +Ġre parsed +Ġre translate +Ġre defined +Ġre locations +Ġre voke +Ġre versal +Ġre tire +Ġre alsense +Ġre compiling +sel L +sel ib +self text +ing Handler +ing Process +Ġo val +Ġo db +Ġo Parser +Ġo asis +Ġo tu +Ġo phy +Ġo seo +Ġo msdk +Ġd C +Ġd N +Ġd Y +Ġd la +Ġd am +Ġd xd +Ġd col +Ġd np +Ġd sk +Ġd map +Ġd do +Ġd var +Ġd ong +Ġd tt +Ġd sd +Ġd cd +Ġd desc +Ġd gp +Ġd PIm +Ġd scp +Ġd wy +Ġd Phi +Ġd vipng +li v +li ment +li go +li web +li ato +li citi +ct b +ct p +ct ct +ct ags +ct apipe +pe cial +un que +un split +un parsed +un watch +un compressed +un initialized +un yt +un balanced +un mapped +un healthy +un recognized +un ivariate +Ġm E +Ġm V +Ġm str +Ġm ule +Ġm iti +Ġm yn +Ġm AP +Ġm types +Ġm cc +Ġm rs +Ġm tb +Ġm ango +Ġm ichael +Ġm osaic +Ġm Eq +Ġm gear +Ġm ás +Ġm medit +Ġm umbai +Ġm mgp +ra ct +ra ub +ra ising +ra ison +ra ça +Ġe sk +Ġe df +Ġe fa +Ġe las +Ġe ating +Ġe fit +Ġe spec +Ġe pg +Ġe scalar +Ġe ffici +Ġe ox +Ġe quilibrium +Ġe Bay +la dim +la use +---- + +ate Site +ion es +ion ale +() }} +fi k +fi z +fi bo +fi mI +fi ddle +ent hought +tion al +ad p +ad code +ad ia +ad rat +co pts +co vars +co binding +co operative +ri pe +ri ment +ri que +ri em +ri pple +Ġthe Arr +Ġthe orem +Ġb ou +Ġb ere +Ġb float +Ġb graph +Ġb ene +Ġb ii +Ġb ads +Ġb patterns +Ġb Idx +Ġb ÄĻ +Ġb cnts +Ġb ouncing +Ġb runei +Ġb angexpr +Ġb cookiej +Ġ1 300 +Ġ1 1000 +Ġ1 023 +Ġ1 185 +Ġ1 162 +Ġ1 995 +Ġ1 978 +Ġ1 378 +Ġ1 260 +Ġ1 476 +Ġ1 983 +Ġ# }, +ed m +ed Device +ed Throughput +11 34 +11 50 +11 000000 +11 74 +11 643 +rom ole +um on +int oken +id n +id al +id ung +Ġ( ', +Ġ( ([ +Ġ( ${ +Ġ( ((( +Ġ( './ +Ġw if +Ġw mo +Ġw ts +Ġw edge +Ġw lan +Ġw ells +Ġw pas +Ġw zh +Ġw dv +Ġw rangle +Ġw urden +ch n +ch le +ch sel +ch am +ch é +te ach +te za +te strun +di ac +di ou +di amond +di lution +di enst +di atonic +def or +ata base +ata mento +Ġ[ ': +Ġ[ __ +Ġ[ :] +Ġ[ âĢĺ +ma m +ma pe +ma ck +ma xt +ma ml +ma sq +ma mm +ma eters +Ġself droid +ul ário +Ġimport ances +from srcdir +ot as +Ġfor um +Ġfor warder +el and +el son +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +': < +': '' +), (- +urn aghan +es net +turn Off +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ+ ', +ode Angle +is ic +is date +is Local +is Null +is aurus +val le +val avan +get state +get create +get header +get Handler +get Group +get Color +get Bytes +get Camera +get Em +get LineColor +get YUVPixel +(' ==== +(' $', +(' << +(' .' +(' [[ +(' ]', +(' @@ +(' âĻ +)) ])) +)) }" +)) }.{ +set Config +set Path +set points +set Node +set State +set Filter +set Register +set Title +set Flags +set osa +set blocking +set Contents +set Goal +set Velocity +set Brightness +set metatable +ath am +Ġ- (( +Ġ- \\ +Ġ- %] +Ġto il +Ġto string +Ġto JSON +ĠT Z +ĠT m +ĠT RO +ĠT cp +ĠT ee +ĠT ek +ĠT ropo +ĠT alk +ĠT Doc +ĠT agg +ĠT ao +ĠT ama +ĠT Func +ĠT APE +ĠT REE +ĠT Compute +ĠT AKE +ĠT ambi +ĠT ruck +xt on +xt ron +xt rain +il ance +il ly +il ars +il lover +th andler +th ru +us in +us ch +us ible +us sen +us bb +Ġreturn arg +con son +con mon +con cert +con verts +con former +con sequent +con cordance +con duit +Ġ2 345 +ers burg +(" (" +(" ******** +(" :: +(" [\ +(" >" +(" ##### +(" =========== +(" ."+ +(" ----------------------------------\ +pp l +pp SwapChain +') ' +') [:- +') }), +as z +as man +iz dy +iz ki +iz ações +et w +et x +et adata +et racker +et kconfig +arg val +arg group +op name +op last +op era +ve au +Ġ{ ", +Ġis a +Ġis Plot +Ġis Constant +Ġ7 0000 +Ġ7 06 +Ġ7 37 +Ġ7 55 +Ġ7 21 +Ġ7 69 +ĠS X +ĠS q +ĠS ed +ĠS ENT +ĠS US +ĠS entry +ĠS pr +ĠS URE +ĠS LD +ĠS RC +ĠS MI +ĠS DL +ĠS titch +ĠS titching +ĠS qrt +ab sor +ab ier +ab gp +Ġof r +ĠC ow +ĠC iv +ĠC ENT +ĠC types +ĠC fn +ĠC ats +ĠC xx +ĠC BO +ĠC ells +ĠC TC +ĠC rea +ĠC orn +ĠC itation +ĠC ampaign +ĠC NF +ĠC itr +ĠC ENTER +ĠC ropping +ĠC srf +ĠC oughlin +ĠC osmos +ĠC lasificacion +ĠC PUTemperature +ig b +ig gs +ig uchi +ht w +up r +up t +up start +") ]. +") }) +") '). +") }') +") [::- +Ġg ize +Ġg our +Ġg ag +Ġg pb +Ġg tex +Ġg rat +Ġg prev +Ġg uro +Ġg spread +Ġg lims +Ġg wf +Ġg olf +Ġg opro +Ġg uilds +Ġg oblet +Ġg arden +Ġg allon +Ġg pnas +for ensics +for Rnn +ter mo +Ġr code +Ġr count +Ġr unc +Ġr paths +Ġr hot +Ġr bc +Ġr bp +Ġr pyc +Ġr nas +Ġl data +Ġl ld +Ġl umi +Ġl rs +Ġl Count +Ġl pad +Ġl Format +Ġl dg +Ġl umin +Ġl ág +Ġl NumberBits +Ġl usid +end line +end stamp +end Block +data point +data description +data Frame +ĠA h +ĠA w +ĠA la +ĠA ma +ĠA us +ĠA sp +ĠA RI +ĠA DO +ĠA ero +ĠA spect +ĠA EA +ĠA FQ +ĠA rist +ĠA hm +ĠA scii +ĠA sia +ĠA mino +ĠA TOM +ĠA aron +sp lugin +'] ]), +'] }] +01 96 +01 90 +01 30 +01 83 +01 0000000000000000 +01 0001111 +Ġcon ll +Ġcon vol +Ġcon ferences +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ic z +ic do +ic ns +ke stra +am u +am oto +to g +to me +to ys +to ko +to coo +to ppar +to DaysOffsetStr +99 12 +99 06 +99 22 +99 24 +99 26 +99 56 +99 47 +99 65 +99 665 +Ġ: ][ +Ġ: )") +Ġ: !: +par al +path ing +path For +ile m +ist ol +ist as +ist ep +ist ema +type v +ĠF M +ĠF z +ĠF ro +ĠF red +ĠF aw +ĠF ALL +ĠF lap +ĠF RA +ĠF ota +ĠF LEX +ĠF SR +ĠF illing +ĠF avor +ĠF uzzy +ĠF etched +ĠF BX +ĠF ighter +ĠF uniValid +od ynamics +sc ss +sc li +sc end +sc si +sc rapper +sc rolling +sc alls +qu y +qu an +qu qu +qu ip +qu akes +log M +log on +log filename +log Info +log Msg +log probs +log ica +log ico +log likelihood +list ify +list Bullet +om ix +vi ction +vi are +vi vl +vi rial +Ġh ic +Ġh file +Ġh append +Ġh ast +Ġh ill +Ġh iv +Ġh ud +Ġh ca +Ġh stack +Ġh anoi +** /*. +ĠĠĠĠĠ ĊĊĠĠĠ +all pairs +all neighbordistances +po c +po und +po of +po ws +po ente +ta e +ta k +ta ubar +ta urus +ĠP c +ĠP ul +ĠP ST +ĠP ric +ĠP CR +ĠP aging +ĠP eng +ĠP HY +ĠP BT +ĠP TI +ĠP romise +ĠP RESENT +ĠP aulo +ĠP egas +Ġas h +ĠI K +ĠI U +ĠI CE +ĠI Unknown +ĠI Arr +ĠI ANA +ĠI PIP +ĠI roha +ĠI saac +ĠI hnen +file id +file set +file info +file ID +file string +file Box +file spath +ĠL s +ĠL ed +ĠL ens +ĠL MS +ĠL SL +ĠL HK +ĠL una +ĠL TD +ĠL ukas +res se +res ur +res pective +tr u +tr unch +tr iton +tr usec +ize Pkts +Ġth ailand +=' -- +=' ), +=' {}' +Ġst u +Ġst eve +Ġst ests +Ġde i +Ġde fi +Ġde pt +Ġde ap +Ġde du +Ġde duce +Ġde lr +Ġde cr +Ġde bt +Ġde sirable +Ġde creases +pro cur +pro ble +pro ficiencies +est ream +0000 101 +0000 101111 +Ġ""" ). +pt c +ex yz +ex cep +ex cerpt +ex haustive +ex hau +im H +im W +im ma +im ul +im view +im ba +im inder +Ġex ps +Ġex abgp +able Mixin +Ġ3 00000 +Ġ3 500 +Ġ3 072 +10 69 +10 563 +Ġprint md +out data +out age +out lines +out Path +out Has +out filepath +out links +ow der +ĠD p +ĠD or +ĠD ER +ĠD ob +ĠD ip +ĠD em +ĠD ED +ĠD ont +ĠD UM +ĠD slice +ĠD SA +ĠD RY +ĠD Matrix +ĠD ICT +ĠD sl +ĠD ados +ĠD AI +ĠD ASH +ĠD rops +ĠD XF +ĠD MAR +ĠD ragon +ac r +ac re +ac us +ac cio +ac tives +ac celerated +ac ronyms +ac cordion +Ġu pp +Ġu hat +Ġu Arr +Ġu liweb +]) ') +]) ]] +]) }) +]) [- +]) ")') +ert s +Re setting +Re cipient +Re vit +Re combinase +Re Äįeno +ite p +app ari +app liance +app hire +sh er +sh an +sh ull +sh aff +sh iro +Ġdata model +Ġdata Frame +Ġdata Dictionary +Ġdata Mag +Ġdata qc +Ġdata Omega +ĠM K +ĠM ER +ĠM ind +ĠM ace +ĠM IC +ĠM ASS +ĠM UDA +ĠM Hz +ĠM TL +nt one +nt otal +nt fs +nt ario +time unit +time zones +time taken +time smar +time Mins +if cb +key store +key ring +key vault +lab Cfg +lab undance +lab labla +xf p +xf s +xf v +xf ep +xf by +xf lag +xf ffff +xf lags +=" __ +=" .") +Ġv ard +Ġv ou +Ġv pos +Ġv Max +Ġv router +Ġv dom +Ġv lc +Ġv isto +Ġv enn +Ġv ários +Ġv edo +Ġv modl +Ġv olumetric +02 10 +02 47 +02 69 +02 157 +02 447 +ext ant +Ġy ar +Ġy ul +Ġy keys +Ġy Vals +Ġy appi +Ġy argy +Ġnp er +Ġnp ad +ĠO U +ĠO t +ĠO ER +ĠO CS +ĠO CP +ĠO regon +Ġ* _): +Ġpar sl +Ġpar cels +Ġpar adigm +Ġpar maeters +Ġx G +Ġx mp +Ġx ub +Ġx std +Ġx dis +Ġx ia +Ġx opt +Ġx edges +Ġx Cell +Ġx vb +Ġx cen +Ġx npts +Ġx oro +Ġx centergrid +Ġx Wrt +os X +Ġse v +Ġse ção +Ġse ni +Ġse lec +Ġse award +Ġma j +Ġma xc +Ġma ven +Ġma estro +que ak +que uing +que tzal +test path +test user +test Data +test group +test module +test package +add user +add ral +add Rotate +add Interfaces +add Knob +add PyFile +Ċĉĉ ĊĉĉĊ +[" # +[" ), +ER ING +IN R +IN AL +IN DIRECT +IN FIN +IN VOL +IN CLUDED +IN uttX +IN VENTORY +Ġstr atis +Ġstr OutputPath +.. { +xb di +xb ep +xb cs +xb dd +xb du +xb cu +xb mr +ange l +1111 0 +1111 100 +load Module +load Information +load Balancer +ore gon +ms b +ms ize +Ġ% ] +Ġ% )") +Ġme at +Ġme io +Ġme teo +ON BOAR +tra SAS +tra indf +Ġfile id +Ġfile server +Ġfile hash +Ġfile encoding +Ġpro verbs +Ġpro ducers +ens ures +py h +py p +py w +py pp +py query +py obj +py doc +py github +py side +py bind +py spark +py fits +py dap +py basics +py RRG +xc l +xc er +xc fo +xc fe +xc nc +xc abh +pre di +pre lu +pre fill +pre loop +pre calc +mage s +cess ario +ls ankidb +ap ta +ap man +ap scheduler +ap ivot +ap agar +07 15 +07 84 +07 23 +07 35 +07 89 +07 54 +ang B +ang hai +xd an +label names +ES K +ES ELECT +ber e +ber ger +Ġbe ir +Ġbe ard +Ġbe em +Ċĉ ĊĠĠĠ +Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠ +"] () +"] ))] +"] }], +ĠB F +ĠB j +ĠB iz +ĠB ac +ĠB ER +ĠB ib +ĠB ak +ĠB AC +ĠB CE +ĠB ays +ĠB OM +ĠB eng +ĠB uck +ĠB AZ +ĠB IAS +ĠB olt +ĠB BBBBBBBB +ĠB ình +Ġos utils +12 50 +12 39 +ys log +ys ide +ys ze +ys sey +ĠE sp +ĠE max +ĠE cs +ĠE ager +ĠE du +ĠE bi +ĠE gyp +ĠE sta +ĠE uclid +ĠE instein +Ġj query +Ġj step +Ġj ug +Ġj sd +Ġj Query +Ġj uris +ci ous +ob d +ob vious +ob ench +ob uy +ob fusc +Ġ< << +Ġ< <<< +ly a +text cat +text bf +text vali +AT P +AT CCT +Ġ) ', +Ġ) ", +Ġ) [:, +xa ew +xa ep +xa az +low rank +low high +size X +com mas +com una +com arques +model er +ĠN ur +ĠN ep +ĠN ou +ĠN AN +ĠN net +ĠN ão +ĠN As +ĠN ullable +ĠN AK +ĠN SW +ĠN REM +ĠN amer +ĠN HWC +ĠN ÃĥO +ĠN guyen +date Simulation +ir Image +ir relevant +num code +num Blocks +Ġres on +Ġres lt +Ġres umed +user from +user details +bo effc +bo Gears +Ġ4 87 +Ġ4 85 +Ġ4 86 +Ġ4 28 +Ġ4 89 +Ġ4 71 +ger ed +ff tp +Ġget time +Ġget Node +Ġget Temp +Ġget Current +Ġget Channel +Ġget Next +Ġget Items +lu ca +lu stre +lu igi +lu dge +92 92 +92 32 +92 93 +92 08 +92 19 +92 83 +92 89 +92 81 +tp ad +col at +col ation +col Name +col Num +col lateral +col labor +In Folder +In ky +In spector +In voices +In fluence +lot to +ĠR ust +ĠR parms +ĠR Spec +ĠR ULES +ĠR anch +ĠR ápida +mo vel +mo sso +mo tivo +mo zzarella +Ġun umpy +Ġun clear +Ġun enc +Ġun escape +Ġun closed +Ġun merged +Ġun formatted +Ġun yt +Ġun authorized +Ġun confirmed +Ġun reachable +Ġun infected +Ġun allocated +Ġun reliable +Ġun released +OR I +OR w +OR AT +fo ss +read random +read frames +read Only +Ġtest app +Ġtest group +Ġtest ng +Ġtest Tag +lic hess +Ġlog f +Ġlog Flag +Ġlog Publisher +32 90 +per r +per ceived +per ishable +// " +// ( +ĠG s +ĠG low +ĠG Label +ĠG NN +ĠG Window +ĠG IZ +ĠG uest +ĠG iving +ĠG rey +ĠG iga +ĠG nedin +ĠG ageRnR +ĠG uillaume +Ġco mport +Ġco add +Ġon b +Ġon ap +Ġon error +Ġtype Code +EN EMY +ĠW P +ĠW o +ĠW en +ĠW ant +ĠW AL +ĠW ild +ĠW arm +ĠW ood +ĠW olfram +ĠW armup +ĠW HOLE +ĠW rangler +tri o +tri mesh +ho ff +ho YG +ity a +ity Image +url ToImage +Ġout age +Ġout files +Con ver +Con ds +Con tributors +Con sensus +Con tributions +Con versation +Con grats +bu c +bu ch +bu til +AR IO +AR GB +ĠV A +ĠV R +ĠV ik +ĠV IR +ĠV ERY +ĠV GM +ĠV entilation +ĠU CI +ĠU Arr +ĠU TM +ry max +Ġnum int +Ġnum col +Ġnum eri +Ġnum Iterations +Ġnum FidsInList +print ed +param Id +Ġ5 24 +Ġ5 35 +Ġ5 82 +Ġ5 89 +Ġ5 67 +Ġ5 48 +Ġ5 42 +Ġ5 39 +Ġ5 31 +Ġ5 58 +Ġ5 63 +Ġ5 72 +Ġ5 61 +Ġ5 71 +Ġhe ard +Ġhe sap +mb ling +). * +ib ar +ssion e +Ġen r +che v +che ese +min F +min a +min dist +999 5 +ator ies +Ġtime lines +Ġtime String +Ġtime zones +Ġtime machines +Error Response +Error Handler +Error Notification +scri ptor +scri bus +18 10 +16 25 +16 09 +16 27 +16 21 +16 68 +Ġlist ens +line A +line of +line parsed +line Buffer +array SMAPE +sa ss +sa ction +sa ys +da gs +Ġk il +Ġk ull +Ġk ake +Ġk Hz +Ġk night +Ġk arma +Ġk orre +Ġcol lation +Ġcol pm +Ġcol ums +Ġcol lege +Ġro ta +Ġro sbag +Ġpy po +Ġpy dm +Ġpy bm +Ġpy curl +Ġpy tket +Ġpy berny +Ġpy Vmomi +Ġpy inotify +config Value +Ġ6 97 +Ġ6 95 +Ġ6 65 +Ġ6 39 +Ġ6 74 +Ġ6 63 +Ġ6 72 +Ġset Point +Ġset Color +Ġset Label +ener ator +ag gs +ag rams +ump er +http URL +04 14 +04 63 +13 88 +13 91 +13 42 +13 59 +13 071 +og c +og ad +og onal +lib path +lib gmt +lib tcod +lib retranslate +06 17 +06 09 +06 26 +06 98 +06 42 +06 31 +06 78 +Ġwh ats +ll db +ll bG +class Node +class Counts +ign up +15 14 +15 88 +15 75 +15 35 +15 39 +15 73 +15 68 +15 71 +ST X +ST OB +ec l +100 10000 +100 01000100 +100 1011101 +100 89905 +max int +max val +max min +max Value +max pool +max Len +05 17 +05 09 +05 27 +05 94 +05 87 +05 85 +05 86 +03 34 +03 33 +03 95 +03 47 +03 78 +03 010000003820 +Ġint f +Ġint seqs +cs ip +cs ock +jo or +we v +we th +we ird +we ixin +ip api +ip Status +ip acker +Ġop j +Ġop in +Ġop tapy +train X +Ġch g +Ġch log +Ġch ang +Ġch uck +Ġch aque +17 04 +17 13 +17 37 +17 69 +17 136 +17 996 +Ġal m +Ġal locations +Ġal saaudio +Ġal packa +Ġal ongside +93 12 +93 14 +93 42 +93 62 +93 400 +93 397 +valid token +lit ter +14 12 +14 13 +14 24 +14 96 +14 46 +14 29 +14 21 +14 91 +14 59 +14 72 +14 41 +14 71 +Ġpre dic +Ġpre training +Ġresult file +uth er +ne ur +ne yu +ne urosynth +Ġ/ ) +Ġ/ >\ +Ġby ref +Ġby Area +64 88 +64 87 +64 77 +64 8193 +Ġob Conversion +Ġob fuscate +Ġob tener +index TRgn +error es +error List +'' ( +'' * +Ġra j +Ġra s +Ġra dk +Ġra cks +Ġdefault ed +Ġ[] ') +Ġ[] ']) +Ġ[] {}". +Ġsub q +Ġsub cal +Ġsub files +Ġsub terms +Ġsub tbl +Ġsub linn +Ġso v +Ġso us +vel ho +Ġ{' ': +AM IL +AM AX +96 25 +96 77 +96 29 +96 218 +96 299 +96 6400 +Ġac quires +Ġac tively +Ġcomp osing +Ġcomp ensation +Ġcomp lains +Ġcomp etitive +ĠCon strained +ĠCon gratulations +Ġnew name +Ġnew fig +Ġnew Col +Ġnew item +Ġnew Model +Ġnew Start +Ġnew Files +Ġnew Gen +Ġnew Quote +Ġnew Implant +Ġall files +Ġall configs +Ġall ura +Ġall ManagemementZones +Ġinput String +Ġinput Tensor +Ġinput Line +Ġinput GPU +Ġinput FileName +55 28 +55 83 +55 46 +55 73 +55 62 +55 314 +55 4744 +[: ]: +[: ])]) +94 18 +94 16 +94 06 +94 37 +94 26 +94 29 +94 43 +94 91 +Ġ} "}) +ĊĠĠĠĠ ĊĠĠĠĠĠ +ĊĠĠĠĠ ĊĊĠĠĠĠ +arn Vault +DE BT +DE POSITION +DE LEGATE +RO ZXh +Ġapp engine +Ġapp Engine +json api +()) ( +()) / +()) == +()) [:- +()) +'. +fer ti +fer ential +fer roni +node manager +node Label +Ġlabel color +Ġlabel left +Ġlabel stf +av obj +av ailab +Ġno x +Ġno split +87 33 +87 56 +87 47 +87 42 +87 299 +no zero +no alias +Ġline count +AL AD +Ġclass id +Ġclass Dict +Ġclass property +fic ación +exp liciti +CT CT +CT CCT +-------------------------------- ----- +Data Particle +AS AP +iv r +Ġla o +85 12 +85 18 +85 13 +85 03 +85 84 +85 28 +85 47 +85 46 +85 65 +85 74 +85 62 +85 175 +85 377 +97 03 +97 64 +97 27 +97 28 +97 47 +97 50 +97 42 +rid able +rid wen +back ed +back slash +{} } +net G +net ns +36 03 +36 51 +36 71 +Ġspe ar +=[ ^ +Ġuse RWVoltage +011 200 +011 010011 +Ġid en +Ġid xt +ĠK J +ĠK un +ĠK ra +ĠK ub +ĠK ick +ĠK ML +ĠK ali +ĠK onto +ĠK AFKA +ĠK NOW +ĠK EEP +ĠK roger +ĠK absch +Ġuser info +Ġuser adm +95 22 +95 94 +95 36 +95 23 +95 38 +95 45 +95 48 +95 62 +95 72 +95 69 +95 287 +923 89 +return Argument +word space +lat i +Ġ'- ')) +Ġdist ort +view topic +Ġrequest Str +run opp +run IDs +86 12 +86 24 +86 82 +86 72 +stra ck +stra da +Ġmax time +Ġmax match +Ġmax pool +Ġmax Area +Ġmax zoom +Ġmax imo +sum med +Ġdo odle +Ġdo Overwrite +Ġdate Added +fa f +fa h +fa i +fa z +fa el +fa hrenheit +Ġz n +Ġz un +Ġz sc +Ġz mb +Ġz step +Ġjson data +init T +HE F +rit órios +string Order +Ġtrain solv +default Resolution +default WorksheetIndex +AG N +57 32 +57 27 +57 23 +57 38 +57 81 +57 51 +57 224 +57 026 +57 13913 +Ġ! " +Ġ! !!!! +Ġ[' {} +Ġ[' ../ +... ], +Ġ8 07 +Ġ8 55 +Ġext rem +ster ic +ster ne +ww a +Ġ| --> +Ġ| __| +create Node +create Image +create Dir +"), ' +ED A +IS ION +IS ADE +IS LAND +reg u +reg ulator +reg rets +Ġtf name +Ġtf record +Ġtf snippet +Res ur +do ei +au k +au ro +au la +layer Number +ele s +try bunaÅĤ +rc file +rc ase +rc min +List T +List ed +List Panel +List Store +current Contour +CO C +CO W +CO INS +color Hex +color blind +port Handler +port Security +man ame +Ġlo ans +trans list +trans Data +66 02 +66 88 +66 62 +66 72 +23 123145 +Ġdx kxy +unc ached +unc losed +AC g +AC DA +Ġcheck box +Ġcheck Layout +Ġcheck pointer +ING RESS +Ġstart angle +lag stafi +Ġte a +Ġte ma +Ġte quila +ps N +ps imi +Ġli ability +Ġli eu +44 97 +44 904 +ns bx +ns ylvania +IM T +IM ARIES +Ġdis order +Ġdis position +Ġ** ( +AP IC +AP PNP +ler a +Ġadd Layer +Ġadd asnn +Des erializer +75 02 +75 95 +75 26 +75 44 +75 83 +new er +new data +new file +new url +new class +new Gen +Ġtext file +Ġtext line +Ġtext Rect +Ġtext ToUse +Ġ-*- \ +cor a +cor ona +mail man +io o +io stream +Ġrun id +OT L +OT ONIC +]: , +]: \ +Ġnode js +Ġnode Editor +Ġurl split +Ġurl List +Ġurl unparse +clo sures +ef ef +']) - +En countered +Co upling +Co efficients +RI FT +Ġend date +Ġend task +Ex MT +Ex ports +ET AG +ET RA +Id y +Id Invalid +Ġ-- " +Ġ-- ") +Ġ-- >", +Ġ-- > +ly J +ly wood +ly copersicum +text L +text x +text size +text input +text width +text grid +text ui +text Output +text Over +text Backend +AT AN +AT ERS +AT IO +AT AGC +AT IQ +AT ACAA +AT IVES +Ġ) + +Ġ) { +Ġ) } +Ġ) """ +Ġ) [::- +xa x +xa an +xa fi +xa ed +xa ch +xa es +xa fo +xa ft +xa fa +xa ey +xa fe +xa fy +xa aa +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +low ip +low level +low mid +low Val +low Eyelid +size V +size Parallel +čĊĠĠĠĠĠĠĠ čĊĠĠĠ +com id +com ers +com be +com enda +com unas +com manded +com IpFilter +com modities +com inciare +model v +model Config +model entity +model Location +model members +ans w +ans he +ans ing +ans lar +ĠN M +ĠN Y +ĠN b +ĠN n +ĠN se +ĠN par +ĠN ag +ĠN max +ĠN ant +ĠN io +ĠN types +ĠN UL +ĠN layers +ĠN CL +ĠN PI +ĠN DB +ĠN GO +ĠN half +ĠN PROP +ĠN INET +ĠN Samples +ĠN iko +ĠN REL +ĠN MU +ĠN ulls +ĠN ATIVE +ĠN aT +ĠN WB +ĠN ifti +ĠN MVOC +ĠN SEvent +ĠN uttX +ĠN ombre +ĠN SImage +ĠN bonh +ĠN ttExtractor +ĠN ixon +date Id +date Path +date Dict +}, ') +}, {}'. +ir in +ir ion +ir ho +ir cle +ir ca +ir atory +ir hom +len G +len a +len z +len Dict +num W +num h +num int +num box +num nodes +num Features +num Black +num Pages +num Missed +num subgroup +num PerClass +num FidNodes +num Fingers +Ġres ist +Ġres izer +Ġres red +Ġres olute +Ġres ubmit +Ġres UsedDsMap +user lib +user File +user case +user Color +user Search +user Deleted +user Brightness +bo di +bo og +bo logy +bo hotels +bo gus +Ġ4 600 +Ġ4 2000 +Ġ4 403 +Ġ4 235 +Ġ4 065 +Ġ4 444 +Ġ4 341 +Ġ4 054 +Ġ4 959 +ger i +ff x +ff de +ff unction +ff wd +XX H +Ġget Y +Ġget size +Ġget date +Ġget ID +Ġget current +Ġget status +Ġget files +Ġget Log +Ġget Config +Ġget Max +Ġget Message +Ġget Context +Ġget Request +Ġget fla +Ġget Code +Ġget Min +Ġget Device +Ġget Block +Ġget Objects +Ġget Matrix +Ġget Transaction +Ġget Left +Ġget Soup +Ġget scheduler +Ġget Right +Ġget Meta +Ġget Usage +Ġget Points +Ġget Vertex +Ġget Summary +Ġget XML +Ġget Save +Ġget Shader +Ġget launcher +Ġget Saved +Ġget Pixels +Ġget Weather +Ġget Outputs +Ġget Forecast +Ġget EstimatedTransactionFee +Ġget argspec +Ġget Outgoing +Ġget Incoming +Ġget Facebook +Ġget Resolved +Ġget Oops +Ġget jobID +Ġget Complexity +Ġget fullargspec +Ġget pyver +Ġget Sensitivity +Ġget LSE +Ġget Goto +Ġget CartByGoods +Ġget OurTimeAndSize +Ġget sitepackages +Ġget Akiba +lu o +lu me +lu la +lu ci +lu hn +lu cas +lu dG +lu orescence +dir Out +92 107 +92 91 +92 63 +92 216 +92 327 +92 138 +92 156 +92 808 +92 965 +92 969 +92 0103 +tp h +tp m +tp th +tp ls +tp cc +tp mex +col data +col ator +col Id +col let +col ons +col dest +col Count +col liding +col ortemp +In Q +In et +In comp +In File +In fil +In Image +In Run +In Filter +In With +In dian +In DQ +In Memory +In Stock +In finite +In sensitive +In Anchor +In Hours +In deed +In quiry +In hPa +In surance +In scrição +ind E +ind ab +ind xx +ind ucing +ind ocument +append Constraint +append HTML +quest a +ĠR Y +ĠR an +ĠR ang +ĠR ENT +ĠR IB +ĠR ounds +ĠR CL +ĠR ug +ĠR OP +ĠR CE +ĠR DB +ĠR CV +ĠR ama +ĠR bf +ĠR inger +ĠR ivers +ĠR asm +ĠR osa +ĠR TD +ĠR TEX +ĠR ubble +ĠR IPv +ĠR aman +ĠR ANGE +ĠR IPP +ĠR ABBIT +ĠR svp +ĠR onald +ĠR abin +ĠR behaviour +ĠR icker +mo og +mo stra +mo meta +mo othed +ep ared +ep hemerals +ray on +ray let +ray leigh +Ġun st +Ġun ew +Ġun mark +Ġun struct +Ġun conf +Ġun stack +Ġun patch +Ġun ions +Ġun pad +Ġun async +Ġun tu +Ġun scaled +Ġun initialised +Ġun published +Ġun readable +Ġun desired +Ġun protected +Ġun warped +Ġun satis +Ġun managed +Ġun usable +Ġun biased +Ġun amed +Ġun furl +Ġun declared +Ġun tangle +Ġun igrams +Ġun constrain +Ġun realized +Ġun judged +Ġun desirable +Ġun igram +Ġun serem +OR ALE +fo u +fo ver +fo ai +fo fc +fo xtrot +ule t +ule te +read val +read json +read Count +read ibility +read INI +read DocChart +read SignalStrength +reate Database +Ġtest val +Ġtest list +Ġtest label +Ġtest lib +Ġtest base +Ġtest pos +Ġtest Path +Ġtest Map +Ġtest corpus +Ġtest Convert +Ġtest XML +Ġtest Prefix +Ġtest Cloud +Ġtest leaf +Ġtest Fix +Ġtest Expand +Ġtest scenarios +lic are +lic ato +Ġlog py +Ġlog Name +Ġlog sum +Ġlog group +Ġlog space +Ġlog gin +Ġlog files +Ġlog cat +Ġlog post +Ġlog istics +Ġlog levels +Ġlog FilePath +Ġlog feeder +Ġlog RotateOnStartup +32 70 +32 60 +32 175 +32 194 +32 303 +32 895 +32 376 +32 374 +32 066 +32 878 +32 098 +32 2079 +32 4661 +32 99587 +per lin +per man +per page +per mu +per Page +per plexities +oc q +oc u +oc z +oc lass +oc alize +oc ater +oc cer +oc curs +oc PH +oc rd +ph id +ph araoh +ph obert +ph arynx +// _ +// ---------------------------------# +ĠG la +ĠG ad +ĠG ol +ĠG ub +ĠG ds +ĠG ap +ĠG lif +ĠG LO +ĠG EST +ĠG FT +ĠG si +ĠG ater +ĠG reed +ĠG Line +ĠG dk +ĠG LU +ĠG DT +ĠG love +ĠG pio +ĠG EOF +ĠG ilbert +ĠG oblet +ĠG romacs +ĠG arden +ĠG wen +ĠG haz +ĠG FLOP +ĠG abriel +ĠG ibson +ĠG lacier +ĠG azette +ĠG ivens +ĠG utenberg +ĠG RIB +ĠG uilherme +ĠG upta +ĠG FPGAN +ĠG CLIENTSECRET +ĠG YRO +ces a +ces ful +Ġco al +Ġco vars +Ġco variant +Ġco mplementation +Ġco uplings +Ġco elhos +Ġon ed +Ġon value +Ġon Tree +Ġon rack +Ġon ERC +Ġon Hover +Ġon glides +Ġon rech +Ġon codrive +Ġtype model +Ġtype check +Ġtype of +Ġtype checking +format D +EN EG +EN IX +ĠW n +ĠW ER +ĠW ard +ĠW orm +ĠW right +ĠW ak +ĠW ED +ĠW ANT +ĠW ie +ĠW EL +ĠW MO +ĠW inner +ĠW EE +ĠW ells +ĠW ISE +ĠW FC +ĠW eng +ĠW EA +ĠW PA +ĠW INTER +ĠW rist +ĠW MI +ĠW AU +ĠW adi +ĠW alter +ĠW enn +ĠW onder +ĠW aste +ĠW ISH +ĠW oj +ĠW rench +ĠW rote +ĠW izard +ĠW EEK +ĠW sResource +ĠW DItem +ĠW bGit +ĠW elch +tri co +ho es +ho con +ho med +ho ek +ity labs +loc X +loc Y +loc a +loc alizations +url dir +url Counter +url Summary +Ġout set +Ġout str +Ġout num +Ġout config +Ġout flow +Ġout queue +Ġout unit +Ġout vals +Ġout channels +Ġout door +Con form +Con fidences +Con sortium +Con trary +Ġlen n +Ġlen v +Ġlen AB +Ġlen stronomy +bu x +bu ging +bu je +AR CT +AR TR +AR glass +AR VIND +AR elation +AR PROJECTILE +ĠV I +ĠV j +ĠV k +ĠV r +ĠV v +ĠV ad +ĠV min +ĠV RO +ĠV ader +ĠV ale +ĠV env +ĠV server +ĠV ERS +ĠV MD +ĠV micro +ĠV ä +ĠV servers +ĠV inh +ĠV ista +ĠV IPS +ĠV endors +ĠV QE +ĠV ASP +ĠV iana +ĠV CCS +ĠV esper +ĠV CVS +ĠV RRP +ĠV FFSL +ĠV ISTED +ĠV intage +ĠU ne +ĠU CT +ĠU TR +ĠU NN +ĠU rb +ĠU Graph +ĠU SP +ĠU TA +ĠU ntrack +ĠU tara +code author +code pipeline +code Editor +code chef +code ToHTML +ry Z +ry u +dict Name +dict Var +Ġnum f +Ġnum IB +Ġnum lines +Ġnum IP +Ġnum actions +Ġnum Nodes +Ġnum PK +Ġnum chunks +Ġnum Frames +Ġnum IAC +Ġnum ToBinary +Ġnum uPDF +Ġnum FidNodes +Ġnum ransacs +Ġnum CHRG +Ġnum ForegroundPixels +Ġvalue Dict +print Color +print Schema +print Separator +print Verbose +param dir +Ġ5 800 +Ġ5 121 +Ġ5 050 +Ġ5 080 +Ġ5 4612 +Ġhe m +Ġhe aded +Ġhe igth +Ġhe xdomain +mb e +mb p +mb r +mb v +mb ta +mb asic +mb alance +). """, +). *', +ib l +ib or +ib il +ib ale +ib ia +ib ench +ib bean +ib agh +ib ilitÃł +Ġan i +Ġan at +Ġan cu +Ġan atom +Ġan ima +Ġan ki +Ġan umber +Ġan nih +Ġan them +Ġan atomy +Ġan ynode +Ġan oplura +Ġ__ ________________ +Ġ__ ________________________________________________________________ +Ġfrom at +Ġfrom date +Ġfrom buffer +Ġfrom Interval +Ġfrom Previous +Ġen e +Ġen n +Ġen quire +Ġen cry +Ġen igma +Ġen rico +Ġen zymes +ise e +ise ed +ise ul +ise Labels +ire z +ard arsysla +che ga +che ptomino +min n +min qual +min Node +min ority +min pairs +min Rate +min Coord +min kms +min Enclosing +min SequenceSize +min Revenue +min ResF +999 35 +999 82 +IT B +IT SU +IT DA +IT ORY +IT CODE +Ġtime C +Ġtime type +Ġtime code +Ġtime Point +Ġtime Code +Ġtime Init +Ġtime stops +Ġtime Since +Ġtime OfDay +Ġtime XPos +Ġtime Lable +Error Count +Error Messages +Error Checker +scri bd +Ġ> ( +Ġ> . +18 30 +18 301 +18 298 +18 01802 +16 92 +16 26 +16 201 +16 91 +Ġlist map +Ġlist item +Ġlist Tb +line X +line No +line Number +line cache +line stop +line Array +line Length +line arities +line breaks +coun tratio +array Part +ft count +sa ger +sa uc +sa ik +sa gt +sa hara +cur a +cur batch +cur pk +cur Priority +cur Slide +da al +da api +da gger +da chi +da han +da jte +'), ) +Ġk c +Ġk le +Ġk mp +Ġk un +Ġk os +Ġk per +Ġk ph +Ġk ho +Ġk base +Ġk init +Ġk ld +Ġk red +Ġk ia +Ġk ernal +Ġk NN +Ġk pd +Ġk ı +Ġk dc +Ġk Vals +Ġk rpc +Ġk RS +Ġk Mean +Ġk kt +Ġk arb +Ġk oh +Ġk aka +Ġk ratos +Ġk law +Ġk ilog +Ġk elly +Ġk elp +Ġk jf +Ġk aż +Ġk orna +Ġk lipped +Ġk ludge +Ġk appas +Ġcol data +Ġcol type +Ġcol lab +Ġcol width +Ġcol tran +Ġcol ons +Ġcol sd +Ġcol gate +Ġcol Dec +Ġcol Names +Ġcol lapsing +Ġcol ortemp +25 20 +25 50 +25 70 +25 0000000 +25 211 +25 907 +25 422 +25 085 +25 080 +Ġro data +Ġro ok +Ġro bin +Ġro score +Ġro dar +Ġro ku +Ġro lename +Ġro ppy +Ġro ulete +St ab +St ony +Ġpy R +Ġpy p +Ġpy op +Ġpy text +Ġpy format +Ġpy code +Ġpy ec +Ġpy rite +Ġpy right +Ġpy node +Ġpy net +Ġpy parser +Ġpy of +Ġpy flow +Ġpy az +Ġpy help +Ġpy mesh +Ġpy ja +Ġpy dash +Ġpy wt +Ġpy dl +Ġpy dp +Ġpy robot +Ġpy cycle +Ġpy coin +Ġpy virtual +Ġpy performance +Ġpy latex +Ġpy infra +Ġpy kd +Ġpy radio +Ġpy ocr +Ġpy mort +Ġpy coral +Ġpy bedtools +Ġpy riemann +Ġpy dgm +Ġpy copia +Ġpy kka +Ġpy grape +Ġpy pinyin +Ġpy raf +Ġpy coreir +Ġpy serini +Ġpy nvml +Ġpy hcl +Ġpy scrabble +Ġpy twalk +Ġpy pkgpath +Ġpy stratis +Ġpy rogue +Ġpy monad +Ġpy whatkit +Ġpy hocon +config server +config DescriptorSize +Ġ6 11 +Ġ6 13 +Ġ6 96 +Ġ6 57 +Ġ6 56 +Ġ6 98 +Ġ6 35 +Ġ6 89 +Ġ6 81 +Ġ6 79 +Ġ6 58 +Ġ6 49 +Ġ6 61 +Ġ6 71 +Ġ6 007 +Ġ6 854 +Ġ6 563 +Ġ6 2269 +lt n +lt y +lt on +Ġset ters +Ġset On +Ġset term +Ġset rgb +Ġset Main +Ġset Remote +Ġset uppy +Ġset distrocname +ener o +ener ating +ag ata +ag ment +ag pl +ag aa +ag ada +ag Ax +ag tg +ag Az +ag Ay +ag Vg +ag Xg +ag gingClassifier +ag regar +ag gressor +ag ritrop +ts B +ts i +ts igma +ts unami +ts ikchen +http x +http lib +http Statuses +04 87 +04 20 +04 011 +04 30 +04 42 +04 39 +04 79 +04 73 +04 78 +04 53 +04 52 +04 41 +04 51 +04 007 +04 386 +04 355 +Ġmodel path +Ġmodel list +Ġmodel info +Ġmodel Config +Ġmodel Number +Ġmodel API +Ġmodel Button +Ġmodel Task +Ġmodel Location +13 90 +13 30 +13 111 +13 165 +13 987 +13 054 +13 5802 +og u +og gi +og aster +og awa +og rsf +lib E +lib re +lib py +lib exec +lib xml +lib cz +lib GLES +lib pyqt +lib erty +lib sass +lib daal +06 44 +06 38 +06 83 +06 91 +06 49 +06 51 +06 194 +06 907 +06 172 +06 937 +06 966 +06 311 +06 2742 +06 3850 +Ġwh irl +ll h +ll ä +ll Tr +ll crnrlon +ll crnrlat +class y +class id +class Id +class ref +class parent +class indices +class Folder +ign ature +ign side +ource Pack +15 99 +15 93 +15 923 +15 90 +15 80 +15 81 +15 31 +15 72 +15 916 +15 104 +15 208 +15 387 +lif espan +lif ecyle +SE U +SE p +SE DIM +SE MBL +SE VEN +SE CTOR +SE rrs +ST B +ST H +ST ask +ST DS +ST AK +ST LINK +ST AMP +ST IX +ST ENCI +ec m +ec ce +ec la +ec bf +ec cObs +100 06 +100 05 +100 64 +100 1111111111111111 +100 101111 +100 01000000 +100 0111111 +100 926 +100 756 +100 0100010001000100 +100 18754 +ĠLicense s +max width +max encode +max radius +max jobs +max sol +max well +max Coord +max shield +max Lon +max Tries +max imization +max ImagesPerCategory +max Knee +ass ur +ass are +ass isted +ass orb +05 64 +05 97 +05 45 +05 101 +05 107 +05 42 +05 54 +05 59 +05 300 +05 61 +05 384 +05 305 +05 457 +05 405 +05 899 +05 018 +05 377 +05 865 +05 768 +05 389 +05 2264 +05 1501 +05 3943 +Ġthis url +Ġthis Span +03 37 +03 36 +03 80 +03 35 +03 42 +03 59 +03 49 +03 71 +03 132 +03 114 +03 436 +03 478 +03 3613 +orm at +orm an +orm uBot +Ġint ers +Ġint array +Ġint General +Ġint Corner +Ġint Invoice +]. +-\ +cs ocket +cs dn +cs beam +cs Relative +cs ApiClient +jo K +jo ken +jo hns +jo oneal +we f +we h +we fz +we Dy +we arable +we ewx +we bgl +uti ans +uti lis +uti ques +ip tr +ip lot +ip ip +ip opt +ip fw +ip scraper +Ġop a +Ġop ense +Ġop sys +Ġop ción +Ġop tix +Ġop CodeFreqs +eld rit +ute ch +train A +train B +train Y +train ings +train String +train Longitude +train Latitude +train Stays +Ġch n +Ġch s +Ġch ce +Ġch air +Ġch si +Ġch lor +Ġch aves +Ġch agn +Ġch arger +Ġch Additive +Ġch ameleon +Ġch ickens +ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +17 90 +17 207 +17 296 +17 397 +Ġal oc +Ġal td +Ġal tu +Ġal bert +Ġal ayer +Ġal cun +Ġal cohol +Ġal igment +Ġal coholic +dd k +dd ot +dd dh +93 61 +93 103 +93 167 +93 857 +93 808 +93 918 +93 892 +93 912 +93 902 +93 909 +93 911 +93 474 +93 3732 +93 0906 +valid er +valid ates +valid ChapterNum +ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +lit V +lit ro +lit ros +lit ues +sed thick +14 000 +14 101 +14 89 +14 48 +14 60 +14 175 +14 156 +14 0705 +ari us +ari as +Ġpre st +Ġpre mask +Ġpre buffer +Ġpre emp +Ġpre conditions +Ġpre filer +Ġpre Best +Ġpre serves +Ġpre bang +Ġpre scriptions +Ġpre dix +Ġpre emph +Ġpre conditioner +Ġpre fijo +Ġresult B +Ġresult C +Ġresult Q +Ġresult Number +Ġresult Dict +Ġresult ante +Ġresult Json +ne X +ne h +ne au +ne mpty +ne ider +ne arly +ne uml +ne pochs +Ġ/ " +Ġ/ { +Ġ/ \\ +Ġ/ >', +ord ine +ord pi +Ġat c +Ġat n +Ġat list +Ġat test +Ġat ob +Ġat dict +Ġat temp +Ġat Tree +Ġat Names +Ġat traction +Ġat Sym +ok in +ok it +ok base +Ġby name +Ġby hour +**** """ +umn i +64 99 +64 25 +64 15 +64 22 +64 19 +64 27 +64 96 +64 85 +64 40 +64 74 +64 78 +64 41 +64 180 +64 198 +64 106 +64 375 +64 396 +right most +right arrow +right Brow +Ġob b +Ġob ie +Ġob ten +Ġob servers +Ġob lique +Ġob scure +index Value +index File +index To +index Size +index Words +error message +enti eth +Ġrange breaks +Ġra g +Ġra ug +Ġra stream +Ġra dec +Ġra ider +Ġra mas +Ġra stre +Ġra fiki +Ġra menia +Ġdefault Node +Ġdefault VariantSelection +Ġdefault prjid +base data +base test +base Value +base dirname +base Metric +base objs +base Paths +base SpanSec +Ġ[] ' +ou o +ou z +ou la +ou res +ou venir +([ #\ +gra is +gra ffi +gra ppe +076 92 +076 73 +info list +plot data +plot size +plot Dir +plot Global +plot Experiment +plot Baseline +plot Trades +plot ImageProvider +arget s +count Matrix +iti c +iti ga +iti tl +LE DO +LE MS +LE TS +LE TON +LE EF +Type Context +Type Derived +Type UnaryAggFuncExpr +RE A +RE ATE +RE VE +RE BASE +RE CS +RE LU +RE Cluster +RE ACTIVE +RE MASTER +RE PARAMETER +RE ALLOC +RE WARDS +RE VERSED +RE ALLO +RE ASONS +Ġtra s +Ġtra ing +Ġtra ded +join able +IC J +IC Y +IC ITY +IC ATES +IC urr +IC LASS +IC reateDatabase +08 0000 +08 14 +08 38 +08 46 +08 91 +08 42 +08 39 +08 54 +08 0101 +08 59 +08 71 +08 307 +08 918 +08 875 +08 645 +08 274 +08 33333333 +08 1450 +08 36782 +argument list +main Frame +main chain +main Sizer +main ToolBar +AN Z +AN HO +AN IES +AN NUM +AN SU +AN UNCIO +pi i +pi ped +pi xs +pi overview +pi cosat +pi lihan +22 107 +22 70 +22 202 +22 207 +22 212 +22 267 +22 015 +22 223 +Ġ\ + +Ġ\ \' +ust ays +Ġ. ' +Ġ. { +Ġ. /{ +ĠH c +ĠH n +ĠH ab +ĠH od +ĠH ip +ĠH ari +ĠH base +ĠH cal +ĠH AD +ĠH off +ĠH INT +ĠH EX +ĠH adj +ĠH itch +ĠH ero +ĠH UB +ĠH ier +ĠH oriz +ĠH ough +ĠH ints +ĠH oney +ĠH LT +ĠH EY +ĠH uber +ĠH uan +ĠH TM +ĠH abit +ĠH wang +ĠH ORA +ĠH otel +ĠH abilidades +ĠH askell +ĠH ousing +ĠH ulk +ĠH FTA +ĠH uffman +ĠH iguchi +ĠH asting +ĠH immelblau +ĠH ampshire +ĠH ijacking +ĠH fArgumentParser +ĠH extream +ĠRe ar +ĠRe ed +ĠRe id +ĠRe mo +ĠRe index +ĠRe create +ĠRe order +ĠRe Frame +ĠRe initialize +ĠRe curs +ĠRe setting +ĠRe visit +ĠRe bulk +ĠRe construct +ĠRe cursion +ĠRe production +ĠRe bec +ĠRe messa +ĠRe ionization +ĠRe connecting +ĠRe agan +ĠRe gula +ĠRe deemErc +ĠRe levé +ĠRe movinator +ay e +ay i +ay ing +ay Response +ay ama +sub n +sub form +sub step +sub token +sub channel +sub Class +sub columns +sub window +sub select +sub zip +sub sequence +sub vol +sub figure +sub packages +sub lists +sub tiles +sub categories +sub formula +sub division +sub worksheet +sub rsa +sub locality +sub grupo +sub linn +sub Cort +Ġ{} & +Ġ{} ." +Ġ{} ={} +Ġ{} /{}/ +Ġ{} """. +Ġ{} }}}, +Ġ{} ..'. +Ġ{} ãĢĤãĢĤãĢĤãĢĤ +ml f +ml box +input data +input List +input box +input Value +input files +input Number +input String +input Options +input rpc +input Cols +input Electrode +input MagMeter +np v +np le +np age +eri k +eri er +eri co +eri alizes +][ :]) +mat ric +mat ryoshka +Ġsh r +Ġsh at +Ġsh go +Ġsh andler +Ġsh ake +Ġsh utter +Ġsh ields +Ġsh runk +Ġsh ameless +Ġdi o +Ġdi u +Ġdi pha +Ġdi electric +Ġdi urne +Ġdi aling +Ġdi oxide +sk n +sk p +sk ar +sk il +sk us +sk os +sk else +sk opt +sk irt +sk aya +sk bitmap +sk idl +sk ynet +df ac +df player +df opts +db ef +db dump +db Exception +db Access +db tt +db constants +db room +db Wh +db postgres +db Pil +mit ry +LL V +LL q +LL DP +UT M +UT able +UT IONS +UT OL +UT ERON +UT uning +work path +work let +work sheets +88 11 +88 92 +88 26 +88 98 +88 46 +88 89 +88 29 +88 234 +88 217 +88 906 +88 427 +88 425 +88 955 +88 227 +88 335 +88 393 +88 454 +88 575 +88 477 +88 3399 +88 2831 +lp df +lp wan +ded uplicated +ast art +ast yle +Ġargs cope +19 100 +19 000 +19 50 +19 126 +19 000101 +19 045 +19 159 +19 648 +eat er +output Type +output List +output String +output RGB +output Filename +output factors +output FileType +lin a +lin q +lin scale +lin cRNA +image utils +image quality +comp i +comp action +comp vert +comp Index +comp osto +comp rens +comp laints +comp actify +ID B +ID V +ID INE +ID Ref +ID OS +ID IFIER +ID AES +ID ADE +(( .+)\ +Ġsc ad +Ġsc cs +Ġsc ron +Ġsc rapper +Ġsc VI +Ġsc itype +34 169 +34 237 +34 426 +34 036 +34 975 +34 500735 +start net +start Point +start One +start Page +start Msecs +start IOV +start ReleaseTime +pos se +pos res +pos Xf +pos sessed +Ġ[" ' +Ġ[" { +Ġ[" /", +Ġ[" -", +Ġ[" *"], +Ġwe py +Ġwe iter +Ġwe asy +Ġwe ibull +ree FloatImage +09 67 +09 42 +09 006 +84 92 +84 999 +84 16 +84 39 +84 41 +84 69 +84 61 +84 115 +84 896 +84 397 +84 687 +84 357 +84 067 +84 435 +84 245 +84 727 +84 447 +84 669 +84 1563786 +ĠIn str +ĠIn spe +ĠIn File +ĠIn let +ĠIn gress +ĠIn bound +ĠIn duction +ĠIn dia +ĠIn dicators +ĠIn ici +ĠIn fusion +ĠIn quirer +ĠIn ChI +ĠIn spired +ĠIn jured +write block +write Count +write All +write Val +write Tests +write plots +write SAM +with google +with Day +with mpi +with gft +ere q +ere my +ere ady +27 964 +27 848 +orch id +update State +update ROI +update GUI +update Rho +ask an +ask sper +ask saveasfilename +ask okcancel +Ġkey able +Ġkey Value +Ġkey Vals +Ġkey byte +Ġkey pressed +nd g +nd ar +nd tr +nd point +nd ocs +inter webs +inter connectivity +inter regnum +ant al +ant ro +ant ine +ant art +ant prop +ant arti +ant lir +ant ennas +gs l +gs z +gs rc +gs iftp +by o +by ol +by ear +bin data +bin keys +bin ia +bin Count +bin Samples +shape let +lock path +lock Type +lock Value +lock Max +lock Min +lock Precision +lock Increment +lock Continuous +lock OneTurn +lock ShowLabel +Ġle l +Ġle ather +Ġle ste +Ġle etcode +Ġle itura +ill on +ĠThe il +result set +result count +result Function +ann i +ann uel +ann uum +arch Num +ging Surrogate +Ġax range +24 50 +24 002 +24 211 +24 219 +37 334 +37 387 +37 3061 +37 8968 +Ġpath list +Ġare sta +Ġare Equivalent +ak J +ak N +ak U +ak ci +ak ari +ak ia +Pro ds +Pro vas +Pro pell +state info +state Info +state vars +em li +em var +point pattern +point Types +ark ansas +map line +map List +map mask +map Filters +map Sentence +Ġoutput PK +Ġoutput Full +Ġ@ !@ +Ġpo fs +Ġpo lec +Ġcom ming +Ġcom bind +Ġcom manded +Ġsub G +Ġsub key +Ġsub stance +Ġsub main +Ġsub word +Ġsub keys +Ġsub dep +Ġsub cmd +Ġsub spec +Ġsub components +Ġsub typ +Ġsub parts +Ġsub proc +Ġsub sol +Ġsub elements +Ġsub family +Ġsub Container +Ġsub traj +Ġsub trees +Ġsub lineage +Ġsub subdirs +Ġsub Criteria +Ġsub misson +Ġso ul +Ġso lids +Ġso dipodi +yn i +yn an +yn es +yn olds +yn fev +als am +rep func +rep aired +AM w +AM Service +AM CTRL +AM ERIC +96 19 +96 34 +96 28 +96 98 +96 81 +96 096 +96 217 +96 501 +96 032 +96 904 +96 236 +96 237 +96 355 +96 364 +96 913 +96 877 +96 985 +96 092 +96 963 +96 1755 +96 3481 +96 5984 +Ġac qu +Ġac ert +Ġac loud +Ġac quiring +Ġac nfg +Ġcomp l +Ġcomp on +Ġcomp data +Ġcomp ens +Ġcomp resses +Ġcomp lain +Ġcomp rehend +Ġcomp romise +Ġcomp artments +Ġcomp ete +Ġcomp anion +Ġcomp ensate +Ġcomp romised +ses ame +aliz i +aliz ando +aliz acao +aliz zare +ĠCon stru +ĠCon gress +ĠCon servation +ĠCon texts +ĠCon currency +ĠCon solid +ĠCon fli +ĠCon fluence +ĠCon solidate +Ġnew H +Ġnew f +Ġnew val +Ġnew str +Ġnew text +Ġnew json +Ġnew node +Ġnew List +Ġnew template +Ġnew Dict +Ġnew seed +Ġnew Line +Ġnew topic +Ġnew plan +Ġnew spacing +Ġnew hp +Ġnew pile +Ġnew Intervals +Ġnew EntityId +Ġnew Districts +Ġnew comers +ress l +ress ão +Ġall H +Ġall y +Ġall args +Ġall tags +Ġall docs +Ġall Full +Ġall radii +Ġall Fragments +Ġall EntityTypes +Ġall KernelPaths +Ġinput Data +Ġinput box +Ġinput files +Ġinput dim +Ġinput Dict +Ġinput Array +Ġinput rpc +Ġinput Attr +Ġinput CRS +Ġinput Sd +55 01 +55 0000 +55 12 +55 22 +55 88 +55 19 +55 33 +55 95 +55 000 +55 31 +55 58 +55 78 +55 59 +55 555 +55 283 +55 2454 +55 1116 +[: ][' +94 89 +94 49 +94 41 +94 61 +94 71 +94 384 +94 232 +94 906 +94 935 +94 314 +94 244 +94 866 +94 313 +94 676 +94 3503 +94 44444444 +94 6009 +clu string +clu stal +Ġcur G +Ġcur L +Ġcur ator +Ġcur hp +Ġcur seek +Ġcur ious +Ġ} ') +Ġ} ]] +Ġ} } +... `: +Ġ8 01 +Ġ8 25 +Ġ8 06 +Ġ8 93 +Ġ8 08 +Ġ8 34 +Ġ8 21 +Ġ8 001 +Ġ8 190 +Ġ8 064 +Ġ8 2644 +Ġext gw +Ġext inct +Ġext Corner +ww G +Ġ| ___ +create Text +create Job +create Edge +create Dimension +create Reverse +create TextureCube +create CLAHE +create ClassificationImageFolderStructure +create AutoEncoderImageFolderStructure +create LabelFileFromPathoDict +"), ), +ED S +ED o +ED URE +ED OTA +ED Alias +ED RIVER +IS VS +reg type +reg incid +Ġtf c +Ġtf worker +Ġtf prof +Res n +Res Parser +Res izes +Res uming +Res ampler +number Range +number Directory +number Azimuth +number oframes +number forindex +ix w +ix network +Ġbo logna +Ġbo utiques +do z +do pp +do Not +do Try +Ġper ceive +Ġper Volume +Ġper mutate +Ġper deu +Ġper missões +message id +parse Data +parse Log +parse Int +parse fromstring +ale a +ale jandro +au X +au i +au me +au che +au cs +group list +group opt +spe cul +spe tto +Ġne X +Ġne Y +Ġne ue +Ġne upy +Ġne lem +Ġne vow +Ġne pochs +ele tt +ele land +Text Value +Text Parser +Text API +Text Rank +Text Ctrl +Ġfil ereader +env en +env info +env yconfig +"," @ +"," \\ +"," (.* +"," &# +Ġ10 99 +Ġcreate func +Ġcreate Table +Ġcreate Option +Ġcreate Row +Ġcreate Spoiler +try out +try bun +try Again +List ings +List Property +List Mixin +List Wrapper +List Dialog +List CreateAPIView +current user +current File +current stop +current Module +current Iteration +current Section +current Archive +current Enzyme +current Remap +CO Bh +CO PTIONS +CO bjects +tle d +Ġfunction call +Ġfunction startTime +old Value +old Pos +color izer +color scheme +color cycle +color FromPlugs +upp ing +upp asd +port o +port Auth +port folios +port BasedVlan +man ia +man Filter +man ufacturing +man oeuvre +man hatten +ach orro +md ps +md Status +version List +version Info +version Tag +Ġlogging Flag +Ġlo ci +Ġlo ude +Ġlo vasz +90 924 +api os +api user +api keys +api Node +api Client +api Url +api Handle +api Mirror +trans from +trans code +trans verse +trans coder +trans missions +status Text +status page +status Titles +66 15 +66 03 +66 17 +66 34 +66 37 +66 95 +66 38 +66 76 +66 39 +66 178 +66 509 +66 3503 +23 022 +23 105 +23 918 +23 078 +23 643 +Ġdx data +Ġdx psf +unc a +unc lipped +unc laimed +AC ER +AC ION +AC CL +AC BE +AC BA +AC AGC +AC AGT +AC ACAA +AC UMOS +=( .* +=( ",", +Ġcheck dir +Ġcheck Piece +Ġcheck summer +Ġstart Index +Ġstart dat +Ġstart prob +Ġstart Block +Ġstart Interval +Ġstart Epoch +Ġstart tls +Ġstart Ep +Ġstart Addresses +Ġstart InterfaceNumber +Ġstart EpCut +Ġstart SessionResponse +lag r +lag ged +lag tigt +lag uerre +Ġte i +Ġte ve +Ġte aspo +Ġmat r +Ġmat s +Ġmat name +Ġmat ure +Ġmat Times +ps G +ps ionic +Ġli ck +Ġli king +Ġli abilities +Ġli ées +44 40 +44 568 +44 444 +44 559 +44 2943 +frame set +frame match +frame Size +frame alpha +frame Rate +cont rei +ns q +ns id +ns bu +ns ink +ns lices +ns ynfev +und y +und en +und ancies +und ocumented +IM M +IM DB +IM PRO +IM HD +IM ixin +Ġdis con +Ġdis lib +Ġdis place +Ġdis pose +Ġdis allow +Ġdis pla +Ġdis closed +Ġdis patches +Ġdis advantages +Ġdis regard +Ġdis fluency +Ġdis poser +Ġdis cretion +Ġdis juncts +Ġ** / +Ġ** \ +Ġ** ` +Ġ** >** +ENT E +ENT ROPY +object Storage +AP M +AP OT +AP POINT +AP PC +AP PLE +AP ATH +AP OST +AP UNLOCK +AP ointer +AP IMixin +ler o +ler in +ler ows +ler mont +Ġadd op +Ġadd end +Ġadd time +Ġadd File +Ġadd Num +Ġadd Link +Ġadd Sample +Ġadd rtype +Ġadd hom +Ġadd FramingCodes +Des al +Des afio +75 10 +75 25 +75 08 +75 09 +75 24 +75 36 +75 86 +75 000 +75 89 +75 48 +75 31 +75 69 +75 355 +75 312 +75 399 +75 068 +75 3764 +75 9671 +new P +new X +new c +new g +new t +new ly +new json +new img +new ids +new head +new password +new font +new Scale +new Feature +new Mesh +new Root +new Scene +new Contents +new Fish +resh ard +resh ared +idx es +Ġtext a +Ġtext obj +Ġtext grid +Ġtext position +Ġtext Size +Ġtext rank +Ġtext Format +Ġtext clf +Ġtext magic +Ġtext SecondScreen +float Path +cor os +cor az +cor ked +cor vette +cor asick +mail from +mail list +mail server +mail Sender +io f +io q +io Type +io vec +io logy +io Calc +io peia +Ġrun e +Ġrun set +Ġrun state +Ġrun Name +Ġrun tests +Ġrun Process +OT IDE +]: # +]: [ +]: ", +Ġnode pool +Ġurl conf +Ġurl Start +clo set +clo ser +clo vebooks +ef P +ef ax +']) ** +']) }, +']) [: +yst ores +yst oolbox +yst aple +En roll +En trust +En hancer +En codable +En cType +En thalpyVaporizations +En cyclopedia +Co W +Co me +Co il +Co fig +Co RA +Co DeS +auth n +auth file +11111111 1101111 +28 204 +28 187 +28 947 +28 2465 +RI SE +RI LL +RI BU +RI VE +RI GER +Ġend l +Ġend pt +Ġend coding +Ġend Block +Ġend Idx +Ġend Msecs +Ex pose +Ex Jpi +ET est +ET IC +ET AS +ET TER +Id P +Id Y +Id Z +Id t +Id ent +Id By +Id Token +raw i +raw io +raw Transaction +raw nie +raw bitrate +var P +var o +var q +var pi +var ID +var types +var names +var mask +var RWModel +fix cols +so o +so us +so loud +so uma +cal er +cal ulate +cal Temp +cal centi +cal Offset +cal ories +cal Slope +cal inski +cal lowip +Ġmessage list +Ġmessage Handler +56 01 +56 02 +56 12 +56 09 +56 26 +56 30 +56 21 +56 53 +56 512 +56 808 +56 396 +56 357 +56 977 +56 576 +56 066 +56 901 +56 758 +go lem +go AAA +go sta +98 36 +98 923 +98 916 +98 164 +98 295 +98 007 +98 1100 +98 2837 +98 2386 +98 3199 +98 3759 +98 3068 +98 2459 +98 3956 +98 9235 +Ġpass worword +Ġsp d +Ġsp num +Ġsp mi +Ġsp ends +Ġsp inn +Ġsp acer +Ġsp rings +Ġsp leen +Ġsp illover +client callbacks +FI ABLE +FI REPLACE +local Path +local Run +local InertiaDiagonal +38 000 +38 133 +38 336 +move Past +my name +my th +my model +my param +my ip +my query +my project +my database +my Session +my writer +my Method +my mesh +my inv +my Series +my Profile +my Files +my Offset +my PDF +my PackedPoint +my elin +obj f +obj p +obj Type +obj copy +obj dump +obj cls +obj fname +obj StockMst +Ġdict a +Ġdict b +Ġdict Name +Ġmin u +Ġmin is +Ġmin UP +Ġmin ority +Ġmin Vector +Ġmin Peak +Ġmin zoom +Ġmin Phi +Ġmin Radius +Ġmin kowski +Ġmin Rapidity +Ġmin SequenceSize +Ġmin inums +pop d +pop stat +pop PR +******** **** +LO L +LO p +LO DE +LO VF +ĠUn subscribe +ĠUn seen +ĠUn identified +ĠUn certainty +ĠUn picklingError +ĠUn balancedDataset +ĠUn normalizes +Po i +Po z +Po ti +Po li +Po lish +Ġ(' ( +Ġ(' =', +box line +box scores +box novel +Ġ(" ([ +Ġ(" *. +Ġ(" '% +check path +check pt +check Version +check Joint +check Ack +check unsigned +check PermissionOwnership +batch import +title ment +Me e +Me ad +Me aly +Me ga +Me ade +Me lodic +module str +module Path +Se an +Se ver +Se agate +Se vere +Se venth +Se znam +Se questro +Se dezev +Se otud +uc an +uc cd +Ac quired +Ac cr +Ac ampamento +method Array +method caller +be z +be ek +be bb +be holder +be lie +be ggars +Ġcan dies +Ġcan ucks +UR T +UR w +UR SDAY +ĠOR CA +ĠOR GAN +tes i +tes la +ĠQ K +ĠQ M +ĠQ g +ĠQ o +ĠQ ED +ĠQ List +ĠQ Time +ĠQ String +ĠQ Item +ĠQ UI +ĠQ LD +ĠQ Thread +ĠQ Url +ĠQ Standard +ĠQ Brush +ĠQ Activation +ĠQ HL +ĠQ ProgressBar +ĠQ idian +ĠQ nabla +ĠQ AbstractItemView +ĠQ TabBar +ĠQ WebEngine +ĠQ InputDialog +ĠQ MetaObject +ĠQ KeySequence +ĠQ CoDeS +200 204 +img A +img id +img test +img sets +img loaded +img filepath +img ByteArr +Ġcolor log +Ġcolor List +Ġcolor xy +PT A +PT Z +PT URN +of D +of y +of day +of contents +of eng +of ei +of Rectangle +of fices +target Path +target Dir +target Layer +target Delete +35 33 +35 000 +35 127 +35 156 +35 1055 +sample Json +AB l +AB LY +AB RID +vis ibile +ud ging +Col laborator +Col umbus +ref l +ref Data +ref seq +ref metric +ref Count +ref itter +ref raction +Value List +Value Key +Value Types +Value Buffer +Ġwor n +org util +org ensen +html filter +html testapp +Ċĉĉĉĉ Ġĉĉ +Ġus fm +Ġus Processor +dataset Name +Ġmo q +Ġmo ss +Ġmo is +Ġmo ver +Ġmo vi +Ġmo file +Ġmo tiv +Ġmo tivation +Ġmo ea +Ġmo eda +Ġmo teur +Ġmo jom +Ġmo isture +Ġmo yenne +File d +File Form +File Response +File Mode +File Match +File Controller +File Only +File Extension +File Converter +File Matcher +File Resolver +File NotFoundException +File Recorder +File Zilla +ain i +bs G +bs v +bs df +bs dm +bs mn +bs wap +bs gda +Ġresponse List +pri a +pri mc +pri zes +Ġcopy text +Ġcopy Textures +201 37155 +AD M +AD ate +AD Core +AD GROUPS +AD Andor +ran m +Ar h +Ar son +Ar AG +Ar gon +Ar AK +Ar cher +Ar thur +Ar lington +Ar chiver +save out +save Data +save kw +save Checkpoint +save Localizations +Ġtarget user +Ġtarget db +Ġtarget layer +Ġtarget room +Ġtarget Cell +Ġtarget Cells +Ġtarget Handle +Ġtarget Contexts +tim eraSASIEEE +cre sc +cre ations +cre alm +Ġim files +Ġim hei +Ġdf c +Ġdf list +Ġdf test +Ġdf List +Ġdf range +Ġdf betas +Ġdf vfs +doc name +doc file +doc Id +doc fx +doc setPath +))) ( +',' # +',' ( +',' { +stat ues +stat Genes +flow lines +flow chart +ĠSe verity +ĠSe paration +Ġad as +Ġad dict +Ġad words +Ġad missions +Ġad ınız +Ġad rese +Ġcurrent start +Ġcurrent Path +Ġcurrent Start +Ġcurrent Enzyme +Ġcurrent ModSecRules +nn g +nn cf +nn rq +norm Config +45 10 +45 395 +45 0576 +77 00 +77 01 +77 99 +77 17 +77 64 +77 55 +77 44 +77 65 +77 69 +77 975 +77 648 +77 433 +77 751 +amp i +amp o +amp ro +amp osm +Ġvalid Snaps +Ġvalid FileOnly +ng c +ng if +ng als +PO X +PO p +PO UND +PO ffset +table DG +table ToMarkdown +zer oth +zer bai +zer orank +zer ototal +zer ocater +attr Data +ich er +ich tb +ich naea +cent ery +cent ralized +item Name +item metadata +item ized +item ById +ql Y +ql wu +ql enth +the file +the irs +the Ax +the Hostname +ide m +ide tail +Ġdatetime format +function Name +function Derivative +Ġerror count +Ġerror Derivative +ey r +ey Jv +ĠY o +ĠY am +ĠY Error +ĠY Type +ĠY ann +ĠY AM +ĠY FI +ĠY aw +ĠY ev +ĠY Filter +ĠY lm +ĠY ubi +ĠY elp +ĠY ARN +ĠY NEG +ĠY ModelError +Ġinter c +Ġinter limb +Ġinter ceptor +Ġinter ruption +Ġinter helical +act list +ä¸ ¡ +ä¸ ¥ +ä¸ ĺ +feat Holder +"], )) +"], [" +Ġspeci fi +Ġspeci alize +Ġrandom izer +Ġrandom String +Ġrandom Card +Builder Factory +ĠX E +ĠX v +ĠX Text +ĠX SD +ĠX Block +ĠX Interface +ĠX Import +ĠX HTML +ĠX OVER +ĠX CMD +ĠX enia +ĠX dbException +sent Error +`` """ +Ġtrans length +Ġtrans location +Ġtrans literate +Ġtrans literation +Ġtrans akci +Ġrow list +Ġrow props +Ġarg u +Ġarg num +Ġarg values +Ġarg Max +Ġarg Names +Ġarg Proc +Ġarg minmax +Ġarg OrArgTuple +Ġbase P +Ġbase flow +Ġbase Dir +Ġbase Coin +CH U +CH AS +CH OO +CH ASTIC +CH INA +CH eader +cc m +cc lcgce +call p +call Id +call TB +call instrs +call Later +47 19 +47 28 +47 46 +47 165 +47 299 +47 325 +47 903 +47 087 +47 1228 +47 880 +47 4542 +ong lides +ong qing +initi ating +]] # +]] + +]] ]. +]] }) +Ġcode List +Ġcode box +Ġcode book +csv r +ict s +Ġenum aration +event o +event hub +event Ticket +event SeqNum +core gen +101 0100 +101 00101 +101 325 +101 344 +101 607 +101 5625 +action str +action url +action logs +face Start +command Name +Str s +column Names +column Combination +ĠEx ps +ĠEx ceeded +ĠEx posure +ĠEx haust +ĠEx pertise +ĠEx PASy +ĠEx plained +ĠEx oGENI +[:, " +Ġgo o +Ġgo st +tf n +tf w +tf ac +tf ms +tf tp +tf devices +files B +files izes +files imul +las jon +names cope +Ġpos dict +pert Size +Ġ9 10 +Ġ9 12 +Ġ9 1000 +Ġ9 00000 +top n +top rint +top num +top down +top Down +top two +top crop +top generated +top Bids +top fifty +top lankton +ream ento +Ġload model +Ġload cols +Ġload funcs +Ġload Ui +Ġload DataSet +Ġload Entries +Ġload HDL +Ġload AndCompileList +find val +find table +find And +find Median +find Entities +find NumBytes +find Homography +ash in +ash er +cy m +cy press +cy rillic +Status Of +Status Result +Status Check +Status Args +Status VO +Status OutputType +Set tle +Set File +Set Option +Set Item +Set Dir +Set Source +Set And +Set Grid +Set Full +Set Pixel +Set Joint +Set Pad +Set RenderWindow +Set EditText +Set WindowsHookEx +ning ton +Ġpython w +Ġpython starter +pl MB +pl unge +.""" . +IL AB +IL DR +IL TS +Ġmethod Id +Ġmethod nums +ĠOF A +ĠOF ORSIGN +dire tto +Ġsk m +Ġsk aio +Ġreg name +Ġreg idx +Ġreg las +Ġreg Obj +Ġreg iões +vert ure +Test Program +Test Password +Test Agent +Test Common +Test Gadget +Test Harness +Test EpRet +Test WebsocketRegisterAgent +Test namePow +')) ]) +mean P +mean var +mean std +mean fesc +Ġgener ically +HO G +HO LY +HO ULD +HO UGH +license plates +83 01 +83 99 +83 92 +83 16 +83 13 +83 17 +83 57 +83 90 +83 916 +83 132 +83 905 +83 875 +83 558 +Ġstring From +range li +range Sampling +range PixelSize +range RandomWeight +Ġevent label +Ġevent Nodes +Ġevent InstanceType +Ġone Turn +Ġone fuzz +IB E +IB g +IB KJ +IB Ij +Ġmain part +Ġmain lane +length scales +length Scales +Ġver ity +Ġver warming +Ch en +Ch ad +Ch urn +Ch op +Ch ave +Ch IP +Ch imp +Ch eng +Ch allen +Ch anger +Ch rg +Ch ances +Ch erry +Ch omsky +wh l +wh dr +response query +response Elements +response Received +Ġsize Policy +led Demo +>> ' +du de +du ke +du fan +du zione +du ytan +Ġlin en +Ġlin ia +Ġlin enum +Ġlin uxbridge +mark one +mark two +mark twor +mark onern +random start +random ised +ai j +ai al +UN A +UN W +UN CTION +UN DEF +UN NER +UN COMPRESSED +UN PAID +qual ification +qual icati +gen ic +gen List +gen ef +gen mask +gen Model +gen elatex +ĠIN IC +ĠIN DU +ĠIN CLUS +ĠIN STRUCTIONS +close fig +close Event +sg ol +sg pa +filter able +filter Date +filter Spec +filter Edit +filter Enabled +rt n +rt List +rt temberg +ĠReturn Stmt +ĠReturn TotalRowCounts +82 13 +82 08 +82 97 +82 000 +82 1010 +}) ', +dim X +dim name +dim gray +Ġseri ously +Ġval min +Ġval max +Ġval ences +Time Text +Time step +Time Code +Time Setting +Time Tagger +ESS OR +ESS ARY +âĢ » +âĢ Į +block name +block time +block types +block fs +block header +block hex +block quote +round Int +Ġtable t +Ġtable sample +65 18 +65 13 +65 17 +65 97 +65 86 +65 38 +65 45 +65 48 +65 81 +65 164 +65 432 +65 465 +off ense +off Max +off ering +gn E +gn U +Ġdb m +Ġdb Id +Ġdb host +graph array +graph ie +grid name +grid der +grid app +grid world +grid Fx +grid Fy +MP AS +67 11 +67 14 +67 19 +67 34 +67 27 +67 94 +67 87 +67 26 +67 80 +67 75 +67 35 +67 43 +67 42 +67 376 +67 3762 +cat Index +43 00 +43 13 +43 040 +show all +show Py +show background +show instr +show Macro +show Logs +show spikes +show userdata +bot te +Ġitem count +head count +head water +Ġ{" *": +Ġsource layer +Ġsource Table +Ġsource language +Ġsource Width +Ġsource Folder +cl ss +cl ark +cl onal +cl athrates +use Multi +use Cp +use Bias +use explorer +use tempo +use ExoSM +use ExplicitDryRunSpec +use Autoc +ĠCON J +ĠCON VER +ĠCON VERSION +ĠCON VERSATIONS +python ize +device set +device Type +Ġup f +Ġup lo +Ġup start +Ġup ward +Ġup down +Ġup vector +Ġup sampler +Ġup firdn +Ġcor po +Ġcor als +Ġcor rep +Ġcor nac +Ġcor outines +ĠPro do +ĠPro ton +ĠPro cedural +ĠPro jeção +level ing +Table Type +Table Name +Table au +Table View +Table Def +Table Values +Table Schema +Table Bootstrap +CL e +CL IN +CL DN +Ġplot data +Ġplot dat +Ġplot All +FF C +FF LAGS +21 934 +search box +search File +search filter +search Time +search tools +search Form +search Keys +search Bean +search CallLater +Ġ:: :: +ĠList ar +ĠList Property +ĠList Serializer +ĠList MetricSummary +ĠList MetricMeta +ĠFlag Region +Ġcontin ua +lines wcs +lines ToRm +Ġ100 4 +Ġ100 9 +Ġ100 14 +Ġ100 24 +INT RO +fir mier +fir ulais +vo i +vo it +:: / +:: ', +:: ], +dep hell +dep latformr +000000 08 +000000 011101 +000000 0101110 +000000 0424 +000000 1001111011111111 +Ġnet rc +Ġnet port +Ġnet box +Ġnet stat +Ġnet Dict +Ġpoint list +Ġpoint Time +Ġpoint Index +Ġpoint clouds +SI GL +SI Wi +SI REPO +ug u +ug ues +ug uin +ug iem +ug uay +Ġmatch dict +Ġmatch Type +Ġmatch Str +Ġmatch tag +Ġmatch IdList +entry ByName +cu H +cu Q +cu as +cu ir +cu je +cu grape +Ġother move +Ġother dbref +page Number +page banner +true skill +down By +down sampler +std arg +Ġaction able +Ġaction Id +Ġaction server +Ġresults gen +PI R +PI ID +PI ENT +PI KE +PI ECES +context Name +context List +context math +48 32 +sv s +sv ilupp +ie me +)* (( +Ġqu in +Ġqu di +Ġqu art +Ġqu anta +Ġqu eremos +Parser Storage +Parser Arguments +Ġoptions Categorized +store AccessToken +Ġimg B +Ġimg W +Ġimg Y +Ġimg Z +Ġimg Name +Ġimg net +Ġimg File +Ġimg Width +Ġimg Height +Ġimg ContainerUrls +EX A +EX AM +EX CL +ĠData source +ĠData Table +ĠData Object +ĠData proc +ĠData ONE +ĠData Wrapper +ĠData Collection +ĠData Import +ĠData Sink +ĠData Collator +ĠData Preparation +ĠData TextParser +only rot +ical y +FA V +FA p +FA AS +FA ql +FA VOR +err file +err level +err Code +err prob +err ortext +pass code +ting roup +ting ham +plt Average +plt ModeSplit +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ +Ġany config +Ġany Set +Ġany cache +Ġany body +Ġany Adjacent +fe u +fe af +fe vals +fe bb +fe Offset +fe ira +red dish +60 93 +Ġfirst Num +Ġfirst Occur +No Encryption +No Pen +No Arrow +No vembre +total Fail +total Weight +total Frames +total gft +total Cases +total SendText +total ThreadCount +ze j +ze se +ze gov +ze mailer +Ġ'. - +Ġ'. ---- +Ġ'. ')) +Ġ'. \\ +Ġ'. /', +Ġ'. {:. +\\ : +\\ ') +\\ '] +\\ ". +\\ "+ +session less +session Affinity +Ġarray X +Ġarray Size +Ġarray SMAPE +Ġarray GroupIndex +ãģ ¥ +ãģ ´ +ãģ ŀ +ãģ Ń +rate c +content moderator +ĠAr r +ĠAr min +ĠAr my +ĠAr med +ĠAr rows +ĠAr bre +ĠAr gent +ĠAr dour +ĠAr vind +42 367 +ify GT +TT ES +Ġtemp F +Ġtemp U +Ġtemp Time +Ġtemp sock +Ġtemp Org +Ġtemp Quat +Ġtemp ertureSensor +Ġtemp ConfigPath +Ġtemp LetLog +])) /( +])) +', +msg Type +msg handler +Ġgroup Id +Ġquery view +Ġquery List +Ġquery parser +Ġquery Func +Ġquery DbFetch +last one +last Data +last Update +last Page +last Cmd +last Login +descriptor Size +copy sign +copy button +MA I +MA ID +Path Data +Path To +Path Patch +Ġright state +ĠException Utils +left value +left KerningGroup +left Brow +project or +project DirPath +project ssites +EL ab +EL BO +EL TA +EL SIF +'): {' +Ġpri vs +Model ler +Model Session +Model Names +Model Parameters +Model Selector +Model GAT +Model GCN +Model APPNP +EST ATIONS +EST ATUS +link text +link Data +link Embedding +Ġcontext Data +Ġcontext ual +Ġcontext Seq +Ġprocess Sample +task name +task data +task mage +task paren +Ġlimit NumberOfFile +ffer ed +debug Count +debug talk +debug EDDN +ca ers +ca path +ca po +ca file +ca ded +ca det +ca Cer +")) \ +Ġhttp header +expr ng +iss mantics +)), ) +)), - +DAT ARE +board d +âĸ Į +axis below +Ġfull Order +Ġfull Sequence +Ġuti lio +Ġuti liza +ten Input +ten Grid +ten emos +ĠIS IC +ĠIS SN +ĠIS OLATION +ĠValue Enum +server URL +server nodes +metri que +mt g +mt ed +ative Power +Ġwork List +Ġwork instartups +ĠÐ § +Frame Or +Frame Codes +Frame Latency +Ġinst ability +Ġinst Pool +Max Range +Max Req +Max Files +Max Vertex +Max Span +Max Age +Max Latency +Max Sessions +Max UserNum +post ion +post ed +post gress +post Process +post loop +post codes +post ests +cli mato +kin n +kin je +Ġtotal size +Ġtotal count +Ġtotal power +Ġtotal Cells +Ġtotal Chunks +Ġtotal LangFileLines +Ġback s +Ġback ers +Ġback logs +Ġback ports +Ġback door +Ġback tester +Ġback ported +Ġback jumping +ous Plus +111 000000000000 +cond tion +wo j +wo ol +ped ro +ped Dataset +ped Body +Ġexp n +Ġexp iring +Ġexp Scores +Ġunit less +Ġunit tests +Ġunit Mgr +parent Index +parent Elements +parent FolderPath +Ġtag outfilepath +Ġcount Dict +Ġcount Coin +Get File +Get attr +Get Log +Get Path +Get Int +Get Device +Get Doc +Get Ver +Get Transform +Get Random +Get Header +Get Display +Get Constant +Get Split +Get Pod +Get Parent +Get Maximum +Get Records +Get Animation +Get Rotation +Get Dst +Get Capabilities +Get Charge +Get TimeSeries +Get ClassName +Get Partner +Get MainURLFromList +Get LookupTable +Get Nbins +Get PrivateData +Get BlendShapeChannel +Get ServiceConnector +Get SecondDouble +Get AttrValue +Get PrivateKeyFileName +game start +game play +game pad +Ġwrit ting +UM o +UM ass +Node To +Node Port +Node Idx +Node Linker +ĠPar ticles +ĠPar aguay +match Template +match zoo +match Expansion +76 99 +76 92 +76 08 +76 19 +76 84 +76 97 +76 95 +76 26 +76 35 +76 29 +76 31 +Ġ'/ '), +Ġ'/ ')) +Ġ'/ '): +Ġ'/ {}'. +Ġ'/ _' +Ġ'/ *') +Ġ'/ {}', +ted With +ted ModelDriver +ĊĊĊ ĊĠĠĠĠĠĠĠĠĠ +39 877 +Ġclient Secret +ny Bot +ny dail +Ġcall ate +Ġcall sm +Ġcall TIIReviewServ +ble stone +čĊĉĉ čĊĉĉ +ice va +ice cream +Ġbreak Condition +td y +Ġsum o +Ġsum sk +Ġsum Range +Ġsum ário +Ġsum ranks +Ġsum atoria +Ġargument e +Ġargument o +Message Text +Message Button +Message Attr +Message Definition +Message ToString +Message Receiver +address To +001 93 +001 000001 +001 000011 +Add Button +Add Sample +Add Cmd +Add Callback +Add Analysis +Add Hs +Add Variations +pc ax +pc ay +Ġsave ext +Ġsave image +Ġsave Model +Ġsave kw +Ġsave Fig +Ġsave Processed +Ġsave Montage +Ġover ide +Ġover den +Ġover density +Ġover ridable +rand index +rand quote +rand Alpha +eta ire +bar r +bar names +bar bican +ĠTHE M +ĠTHE Y +ĠTHE ME +bl cD +Ġass cIncident +uni bo +uni cos +uni codes +char ged +================================ ===== +Ġmake Schedule +Ġmake Slice +conf Mat +build dir +build From +Ġ& , +limit ing +limit éĻIJåĪ¶ +cho se +cho sed +cho osed +cho osing +cho oses +Number Query +aw b +aw et +aw ag +aw ning +aw ips +aw cz +aw amoto +aw sume +(\ "" +(\ )\ +Ġed X +Ġed ad +Ġed getype +Ġlast H +Ġlast Vid +Ġlast AppliedLayer +Ġlast InstallPackageModifiedTime +Ġchar List +Ġchar pters +tmp f +tmp data +tmp img +tmp root +tmp FD +tmp OutputFolder +tmp UDS +tmp icns +Ġtoken Id +Ġtoken prog +dump ing +dump docfile +anti l +anti le +anti cs +anti sense +Ġnorm aliz +Ġnorm atoms +Ġnorm RedirectTarget +TO B +TO F +TO s +TO PK +TO DEVICE +TO MBSTONE +Ġword Vals +Ġword Counts +Ġword Break +ren ta +ESC REATE +Ġfound Sig +Ġfound ACTS +Ġfound ImproperDihedTypes +Ġfound CANS +ik SC +ik Qg +ik Qh +conv out +"][" / +"][" _ +src Path +src Folder +src jar +ĊĊĉ Ġ +future Type +Ġmode ms +Ġmode los +Ġ## " +entity type +entity IdList +scale Factor +scale fctr +mer av +54 03 +54 93 +54 14 +54 08 +54 94 +54 23 +54 82 +54 91 +54 3665 +Tra ded +Column Transformer +Column ClickhouseAnnotation +Ġframe Number +Ġframe buf +79 01 +79 13 +79 84 +79 87 +Key point +Key Up +Key NotFoundException +Ġfla kes +Ġauth file +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Vi u +Vi ctor +Vi vien +Vi enna +Vi ctoria +Ġoff value +Ġoff ensive +Ġoff shoot +cv b +const val +const delta +const tau +74 01 +74 99 +74 92 +74 14 +74 36 +74 66 +74 98 +74 35 +74 82 +74 89 +74 907 +74 0726 +ĠVar in +ĠVar ipacker +ĠVar oquaux +cmd map +cmd tools +cmd loop +roll ups +now s +Ġdim H +Ġdim Z +Ġdim in +tick format +tick lbls +Ġobj id +Ġobj class +Ġobj dump +Ġobj spec +Ġobj loader +Ġobj cls +Ġobj etos +Ġobj StockMst +epoch File +exit Binary +exit Expression +exit Simple +exit Literal +exit Primitive +exit Unary +exit PrefixOperator +MO VIELENS +Ġ', '% +Ġstep f +Ġstep ic +vector c +mem Total +mem consumer +mem Active +mem chr +enter Binary +enter Expression +enter Simple +enter Literal +enter Primitive +enter Unary +enter PrefixOperator +Ġ'__ ']) +ĠCo al +ĠCo di +ĠCo coa +ĠCo operative +ĠCo zmo +less andro +01111 011101 +01111 1011111110111111 +01111 011010011 +01111 001111101111 +fn ext +fn half +Ġexpected Content +Ġexpected Surviving +73 07 +73 08 +73 34 +73 09 +73 98 +Ġfind All +Ġfind New +Ġfind Font +dis i +dis m +dis course +dis asm +dis appear +dis assembler +fit to +fit path +Ġimp ar +Ġdif fract +LI V +LI k +LI UD +LI UTable +Ġnext y +Ġnext Row +Ġnext Val +Ġnext Enzyme +blob storage +ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +Object Error +Object List +Object Class +Object Exception +Object DD +Object Link +Object Meta +Object NotFoundError +Object Permission +Object CommandContext +Object storeSiteMover +Com o +Com ms +Com BAT +FT PS +Comp iles +Comp liant +Comp romisso +Comp arable +Comp InDQ +common Prefix +common wealth +Ġorder cn +Ġorder books +cache Obj +Ġdevice Diff +Bo o +Bo NN +Bo ole +Bo yer +stack ers +stack traces +day ton +day Locator +day cnv +send Data +send Coin +send ThePacket +send VKey +ush a +ush y +ush ar +ush ima +ful filled +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ +0101 387 +unk er +unk own +Ġfilter type +Ġfilter bank +Ġspecific values +Ġspecific Matrix +Ġspecific Tissues +variable FromSymbols +next s +next ype +next loc +next gen +next Token +next Valid +next Enzyme +ĠTO ML +ĠTO LERANCE +Ġshape Type +Ġshape files +Form Boundary +Response Schema +first String +first day +first lineno +dev name +dev str +Le i +Le go +Le aving +Le aky +else if +Ġeval t +Ġeval results +Ġeval ution +ULT ANEOUS +over line +over fit +Class Def +Class ifiers +Class ificação +Ġ>>> ]) +**************** ***** +Input Set +Input Form +Input Handler +Input Label +Input Device +Input Folder +Input Features +Input Receiver +PP A +PP M +PP RO +PP PP +PP lus +PP vss +PP zww +PP bYY +tree bohotels +Ġiniti lize +Ġbuild tool +Ġbuild Feature +Ġbuild Boss +Ġab map +Ġab road +Ġab rig +Ġsupp lier +Ġsupp lément +58 15 +58 076 +58 201 +58 025 +58 147 +58 327 +58 244 +58 088 +State ments +State Info +State Dir +State Ebl +ART Y +Ġinstance DictStr +Ġfield Values +access ory +pr P +pr st +pr ince +Ser des +gr b +gr m +gr ino +gr ubu +Ġ12 84 +Ġ12 96 +Ġ12 95 +Ġ12 645 +dist il +dist ace +dist ancia +dist illation +dist ancing +dist UrlBase +dist pickymodel +78 07 +78 18 +78 15 +78 076 +78 09 +78 37 +78 0064 +OP ENT +OP ERT +OP Hj +Out T +Out ALCARECOTkAlMinBias +ĠTest ers +ĠTest Auth +ĠTest Session +ĠTest Dataset +ĠTest Block +ĠTest Script +ĠTest Common +ĠTest ando +ĠTest Stage +ĠTest DSM +ĠTest CreateFile +ĠTest oot +ĠTest XDRI +Reg ula +Reg Plot +req header +.", ) +case db +case less +Ġlocal config +Ġlocal stack +Ġlocal BBox +., :: +Ġsign ify +Ġsign ifies +ãĤ ¶ +ãĤ į +"\ )> +Ġ16 64 +Ġ16 09 +DIR CEU +Ġ.. , +Ġ.. ...... +("\ "" +("\ "", +pol la +pol ito +pol Phi +ĠNo Op +ĠNo Args +ĠNo DictKey +ĠNo Deps +ĠNo InputNoOutput +ĠNo ReverseMatch +stru zione +stru ktion +Ġbin list +Ġbin ho +Ġbin width +Ġbin arr +Ġbin Width +Ġbin capacity +Ġbot member +job log +job Num +job Title +job Limit +change Type +change Constraint +change Format +change ScaleX +change ScaleY +change AppId +User ge +User bot +User DB +User Code +User With +User Action +User JSON +User Mixin +User Serializer +User Admin +User Encoder +User Controller +User Answer +Ġman oeuvre +etch up +lim g +59 14 +raise num +raise NotDefined +Ġparse args +Ġparse mod +XXXXXXXX XXX +XXXXXXXX XXXXXX +XXXXXXXX XXXXXXX +seq x +seq tax +seq repo +seq logo +Ġport ray +Ġport anto +Ġport foly +Ġallow Env +SS OF +queue DepthCombined +ĠDe fi +ĠDe pression +ĠDe composition +ĠDe senvol +ĠDe enis +ĠDe Soto +sw m +sw at +sw int +sw indow +sw pc +sw imming +sw ifter +Ġproject X +CA w +CA ej +CA IX +CA AGCT +CA STS +CA lign +style N +Ġexec utar +spec D +53 12 +53 03 +53 96 +53 94 +53 97 +53 95 +53 86 +53 56 +si ena +si emContext +View name +View able +View Controller +View Dimension +View Columns +View TestMixin +View SelectedPath +rule z +rule type +rule Protocol +sor ties +itor i +Ġlib ri +Ġlib mc +Ġlib forms +Ġlib louis +Ġlib mkl +Ġlib pthread +Ġdep args +Ġdep lete +Ġdep ósito +čĊĉ čĊĉ +čĊĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +åı « +åı Ļ +åı ¶åıĺæį¢ +68 99 +68 07 +68 06 +68 15 +68 64 +68 24 +68 37 +68 33 +68 98 +68 097 +68 2313 +68 0210 +ĠRes izing +ĠRes moke +ĠRes posta +ĠRes cales +Ġstatus Code +Ġextra Info +Ġextra Arg +Ġextra cellular +Ġextra errList +TY FP +Ġbu fs +Ġbu ddy +network P +network id +network mode +Trans E +Trans fo +Trans lating +ORT ASK +IND RO +CE O +CE IL +CE xtension +qui ri +qui bo +ctx manager +Ġav od +Ġav aial +License Text +Access Log +Access Point +Access Service +Access Flags +xff C +xff J +xff L +xff N +xff P +xff T +xff V +xff m +xff p +ym up +ym do +ym tau +Ġpage able +Ġpage List +Ġpage Num +Ġpage link +Ġpage Size +Ġpage Url +service config +Th r +Th in +Th ur +Th res +Th ieu +Th inningTest +Index Response +Index Entry +Index Val +Index Console +ia h +ia ÅĤ +ia Soft +author izations +acc ine +acc Utils +xx large +Ġserialized ATN +çļĦ data +çļĦ ä¸Ģ +çļĦ åŃĹ +çļĦ åīį +çļĦ ç±» +çļĦ 使çĶ¨ +çļĦ åºĵ +çļĦ ä¿®æĶ¹ +çļĦ 线ç¨ĭ +çļĦ æķ°åŃĹ +çļĦ åıĺéĩı +çļĦ 模åĿĹ +çļĦ æĹ¥æľŁ +çļĦ æłĩçŃ¾ +çļĦ æĸĩ件夹 +çļĦ éªĮè¯ģçłģ +çļĦ å®ŀä¾ĭ +çļĦ 缮çļĦ +çļĦ 个æķ° +çļĦ è³ĩæĸĻ +çļĦ ç©ºæł¼ +çļĦ åŃĹæ¯į +çļĦ åľ°æĸ¹ +çļĦ è§Ħæł¼ +çļĦ è¿ŀæİ¥æĸ¹å¼ı +çļĦ å¤ĩéĢīåij¨æľŁ +Ġneed Clean +ĠPython Qt +At an +At Top +At tribution +At lanta +PL v +PL table +PL IES +PL ITE +PL wp +PL ayer +PL ACED +PL CPB +pack b +pack name +Ġblock Expired +Ġblock Untrusted +inser ting +fs ync +fs lots +fs upplicant +ian te +ordin at +ordin ario +ordin aten +unit ag +(_ . +(_ (? +Man a +Man App +Ġchange ps +52 10 +52 12 +52 13 +52 15 +52 085 +ets RL +Ġ"/ * +Ġ"/ {}". +Ġ"/ "+ +Ġ"/ ../../ +Ġ"/ *") +cell width +cell spath +cell Bot +cell centers +cell dms +cell notation +ĠUser API +ĠUser Query +ĠUser Update +ĠUser Detail +ĠUser Details +ĠUser Errors +ĠUser Keyword +ĠUser Premium +ĠUser Obstacle +ĠUser IdInvalid +ĠUser RateThrottle +ĠUser PoolId +Of ast +Of fic +Of The +Of Class +Of Tx +Of Service +Of Container +Of Beta +Of Share +Of Difference +Of Improvement +Of Motif +position ed +QU A +QU ES +QU ET +QU ARE +sq L +sq li +sq norm +sq lengine +If Files +62 02 +62 98 +62 992 +62 061 +Up x +Up Block +Up sampling +Up Pins +ank le +ank owski +WAR P +WAR ES +ĠCreate Database +ĠCreate Help +ĠCreate APIView +ĠCreate ableAPIResource +Ġfeatures R +Ġfeatures copy +Ġfeatures Names +ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +)[ [" +)[ \' +Ġmsg type +Ġmsg hash +Ġmsg Hdr +ĊĠĠ ĊĊĠĠĠ +ĊĠĠ ĊĊ +ĊĠĠ ĉĉ +ĊĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ÑĤ оÑĤ +ÑĤ ак +ÑĤ ÑĢа +); '. +Sh en +Sh ield +Sh utter +Sh erman +Sh amos +Sh uffled +remove Item +remove Child +opt vis +opt block +opt vars +opt insn +Ġrender Object +xml dir +xml doc +xml Url +Ġcase sensitive +Ġexist ance +Ġtitle case +ba ut +ba ad +ba its +ba ÅŁ +ba ixo +Ġabs Path +Image d +Image Error +Image Num +Image Surface +Image Caption +fra id +ĊĊĊĊ ĠĠ +ĊĊĊĊ ĊĊĠ +Int Array +Int Msg +IP y +IP AC +IP lugin +IP SET +xec C +xec F +xec K +xec U +xec g +xec z +xec ute +dot m +dot dict +ĠSo C +ĠSo licit +ĠSo ciale +lip le +lip ids +lip tical +lip ayResponse +disp os +disp angle +disp osable +:] }") +AGE MENT +Ġtmp ID +Ġtmp src +Ġtmp String +Ġtmp Step +Ġtmp Ret +Ġtmp FD +Ġtmp Std +Ġtmp Tags +Ġtmp OutKey +Ġtmp OutVar +Ġtmp Incomp +Ġtmp MaxFiles +49 88 +49 85 +RES IDENT +pu Key +radi ative +Ġwas AssociatedWith +book end +book sn +book marks +book shelf +ÑĢ оÑĩ +ÑĢ еÑĪно +Ġmap cells +ĠPath Patch +ĠPath Definitions +ĠPath Effects +DB E +DB F +DB I +DB size +DB Exception +DB BACKUP +Ġ300 7 +URL æĺ¯ +URL FORMAT +URL åľ°åĿĢ +Def ense +Def ence +Def lection +Def ender +Def Loader +Ġtuple Data +Ġmask thresh +Ġmask gradient +0100 10111 +0100 100101 +012 878 +012 98288 +012 11039 +Ġgraph it +xaf G +xaf T +Info Objects +Info Serializer +Info Hash +---------------------------------------------------------------- -------- +ene tic +Ġ". \ +Loc ators +Loc alizer +BU MP ++' [' +example SetFiles +EM F +Ġter á +Ġter reno +Ġ202 5 +Ġ202 8 +decode bytes +SC C +SC mat +SC riterion +SC Xy +SC ISS +tic ut +Ġmore Products +su o +su mes +su kunimi +ĠVersion s +Ġsorted List +Ġsorted By +ĠSet Color +ĠSet ModuleLogLevel +ĠSet ClipboardText +ĠSet TheView +PRO G +PRO SE +PRO PS +PRO BA +PRO FACT +PRO MISC +Context Menu +Context Word +sim dir +sim core +sim ulink +Ġ"\ ">" +Ġ"\ "}],\" +tom cat +202 202 +202 00110 +202 10331 +Ġoffset Delta +Ġfi las +}\ : +}\ """" +}\ "". +}\ ">" +Ġorig trees +Ġorig VideoDir +63 17 +63 84 +63 97 +63 86 +63 56 +63 91 +63 858 +63 3709 +Request ID +Ġoptim ally +Ġoptim ised +This Full +stream sx +Ġ15 01 +Ġ15 10 +Ġ15 19 +Ġ15 81 +Ġserver uid +Ġserver tools +Ġserver Port +seed set +binary package +CC R +CC Ac +CC CL +CC GG +CC aller +Inter calib +Inter sects +Inter changeFormat +Ġgl End +Ġgl Read +Ġgl Init +Ġgl Clear +Ġgl TexCoord +Ġgl Lightfv +Ġgl BufferData +Ġgl DrawArrays +Ġgl VertexAttribPointer +Ġfont able +Ġfont Type +Ġfont family +ĠGet Data +ĠGet ters +ĠGet Inter +ĠGet Capabilities +ĠGet Scores +ĠGet EstimatedTransactionFee +ĠGet ModuleLogLevel +ĠGet CmdStatus +ĠGet RoleMember +ĠGet Badges +ĠGet Deployer +ĠGet LongPathName +ĠGet ShortPathName +*( < +*( .+ +*( ?: +*( .*?)\ +72 99 +72 12 +72 32 +72 16 +72 176 +pec w +pec util +pec tives +cluster er +cluster arn +cluster ization +cluster Idx +cluster Credentials +delete user +ĠAll ure +ĠAll Users +ĠAll Categories +ĠAll classscore +AA F +AA AG +AA AD +AA AF +AA ATGG +AA djust +IO p +IO CON +IO HW +nodes Enriched +na f +na h +na z +na val +na if +:\ ([#\ +ĠID CG +(* [_ +wd n +wd t +wd v +wd TU +åĪ ¤ +Not able +Not Set +Not Done +Not Before +__) } +__) }" +Ġtask set +Ġtask mage +med line +med itech +Create Key +Create Event +Create Graph +Create New +Create PDF +Ġmy type +Ġmy col +Ġmy map +Ġmy File +Ġmy table +Ġmy cv +Ġmy mesh +Ġmy SQL +Ġmy rn +Ġmy bash +Ġmy treenumbers +resp ath +prot ID +Ġ"__ " +Base s +Base View +Base Check +Base Item +Base Loader +Base Service +Base Dataset +Base Mixin +Base Transformer +Base SearchCV +Base dD +Base FormView +Base InputHandler +Tx Period +Ġsim batch +Ġsim body +Ġexample SetFiles +Ġph q +Ġph ra +Ġph il +Ġph aset +Ġapi list +Ġapi Client +Logger Provider +Ġsa as +Ġsa pos +Ġsa dece +Ġsa firnotification +Ġlevel q +Ġlevel Order +Ġlevel Drop +git o +API Router +API è°ĥçĶ¨ +torch tb +mc f +mc id +mc nt +mc python +mc Transceiver +mc TxByte +mc RxByte +Ġgrid Input +Ġgrid GT +Ġgrid Pred +xfe C +xfe L +xfe Q +xfe R +xfe b +Ġleft crop +font z +font prop +font goggles +'][ ()] +'][ ()], +ars ide +Al O +Al b +Al ger +Al uno +Al mond +"); \ +Ġsent Pose +Ġsent encia +make File +make DataFrame +make Move +make filePath +execute builtin +gg reg +Qu z +Qu AD +Qu ench +Qu ando +Qu oted +Qu adr +Qu andl +Qu arentined +video Dict +keep ass +By User +By Page +By Day +By Region +By Most +By Patient +By Axis +By Cov +By ConstantModN +By Nation +By LineText +ĠFor ne +ĠFor rest +ĠFor Each +ĠFor seti +Ġidx j +Ġidx sh +Ġidx min +Ġidx max +Ġidx sg +Ġidx sphi +Ġidx ToTag +Ġtraining state +window size +fp names +Ġsearch path +Ġsearch Index +Ġsearch terms +Ġsearch Paths +dec ree +dec Deg +QL ID +Client es +Client Options +Client Util +Client Cert +Client Deployer +'\ [ +'\ (" +'\ `([^\`]+)\ +69 64 +69 112 +69 085 +pect ra +mod o +mod base +mod als +mod logs +Ġwrite up +Ġwrite Output +App ia +App Info +App Auth +App Window +App Service +App Collection +App Flow +App rove +App NRate +App licator +ular isation +:` - +:` [ +:` _ +medi es +medi atype +н ен +н оз +н ей +н ез +н омÑĥ +dt c +dt w +dt cv +dt tt +dt Float +dt orun +"{ __ +ZE C +bool Path +TE A +TE B +TE lement +TE AMS +('\ [ +('\ "', +Ġwhere Str +admin User +admin panel +Ġoper ated +Ġoper ador +Ġ'\ / +Ġsu v +Ġsu ck +Ġsome stream +Ġ"-- >", +Ġdown wards +full res +full model +full title +Rx Buffer +Rx Trace +Rx PWR +has u +has Data +has flux +has GLE +has Defected +has BeenRun +xfb A +xfb D +xfb E +xfb I +xfb Q +xfb p +stop ics +stop Event +stop One +stop Words +stop Btn +256 56 +era e +body len +Ġgover nor +Fa z +ĠCh ad +ĠCh im +ĠCh ase +ĠCh ern +ĠCh aco +ĠCh erry +ĠCh arts +patch notes +ĠNOT ACHAR +Ġapplic ability +uff les +uff enh +register Name +register Command +register New +Ġshow Log +Ġshow case +Ġshow cases +Ġshow Help +Ġshow instr +Ġshow Matches +Ġshow Tables +Ġmark ings +optim um +optim iz +optim izes +optim istic +optim alg +optim istically +other m +other Property +aa fu +tex file +tex info +bytes Beyond +Ġconvert ors +Ġconvert ToOne +Ad c +Ad versarial +Ad Hoc +rap li +ĠImage Token +ĠImage Button +ĠImage Grid +ĠImage Reader +ĠImage Normalize +ĠImage Viewer +ĠImage Attachment +home Space +Ñģ а +Ñģ е +Ñģ и +Ñģ ка +Ñģ ÑģÑĭлки +ven ia +Py Flow +Py roc +Py blo +Py FileWriter +Py Installer +Py EMD +Py qtree +Py IOmica +inst Lumi +ï¼Į ', +ï¼Į âĢľ +ĠAny where +tests dk +Ġmean freq +resource ID +resource manager +Ġheader ed +Ġheader hash +az o +az ia +lan ır +lan elet +hed rals +orig en +Ġ[[ . +Ġ[[ { +Ġ[[ [] +ĠTh an +ĠTh ick +ĠTh reader +ĠTh erm +ĠTh ickness +ĠTh ames +ĠTh rottle +ĠTh ief +':' - +Ġcsv name +Ġcsv files +Ġraw Label +Ġraw ADCP +For am +For ID +For Loop +For Job +For Windows +For Quote +For Updates +For Exact +For BridgeLamp +For nec +For Causal +For TokenClassification +For Hotword +hash Sequence +hash pw +TYPE PRODUIT +TYPE INTERVENTION +Ġvis cm +Ġvis Params +äº ® +äº ² +äº Ĥ +xef C +xef E +xef H +xef I +xef N +xef z +track e +track name +track ml +track let +track Pause +ĠType Engine +ĠSim fast +ĠSim Library +ĠSim ulates +xfc E +xfc J +xfc S +xfc Y +xfc m +xfc r +pg p +pg num +pg again +pg Yeti +Size Converter +div w +div ing +div es +xfa N +xfa W +xfa Z +xbc H +xbc K +xbc L +meta Data +meta store +meta interp +ĠDict Array +ĠDict Serializer +ĠDict Cursor +'}, {' +é mo +é nom +gest or +sort box +des conto +Sp O +Sp ans +Sp lash +Sp iral +cel lo +Ġunittest instance +Ġmock obj +Ġmon omer +Ġnon spatial +Ġnon Direct +Ġnon posx +Ġnon singular +Ġnon parametric +Ġnon memberRefName +Ġoptional Flags +sm X +sm x +sm len +sm gr +sm iley +sm alisca +Ġinfo dict +Ġinfo Node +Ġinfo Object +Ġinfo Element +KEY FRAME +KEY POINTS +KEY SETS +.\ . +.\ +\ +Ġloc ates +Ġloc alizable +Ġclo ak +Ġclo vars +Ġclo udf +Ġedge list +Ġedge pair +### ------------------------------------------- +win rm +Ġpi Tom +DataFrame s +/{ { +help core +help Filename +select Expr +Ġref l +Ġref string +Ġref Task +Ġref reshes +æķ µ +best child +FL D +FL AC +FL SH +FL ANK +FL AKE +FL APUNLOCK +tran scribe +tran scriber +sin es +pool size +pool choice +pool ports +pool Choice +pool Supply +ĠLo vec +ĠLo Ra +ĠLo pez +feature List +feature DictObject +vm f +vm id +vm adm +vm Vlans +bit o +bit code +bit Array +bit coind +gy o +gy ong +istr ative +hel v +PR C +PR ref +PR oute +PR BSE +PR EREQUISITE +ĠMe ga +ĠMe chanism +ĠMe mbro +ĠMe Cab +script name +Group Norm +Group Service +Group Delta +Group MAPE +xed K +xed M +xed S +xed U +xed Y +xed c +xed d +xed f +xed h +xed k +xed u +Ġret as +Ġret angulo +_{ % +_{ ' +_{ - +active Time +active Distance +FO FC +ĠDE LET +Ġinclude First +Ġinclude FrameCodes +drop rate +Ġchannel Box +VE o +ä» ª +arr Client +arr anging +Ġact W +Ġact uelle +Ġact uators +Ġge mini +Ġge odetic +Ġge ometrical +Ġge lenAcilar +Net Model +Net Loop +Net Scaler +Net Icon +Net EncoderPolicy +Pre S +Pre par +Pre vent +Pre Index +Pre scription +Pre serve +Pre Processor +Pre liminary +Pre diccion +Pre InOrder +Pre AuxLogits +DS B +DS unny +DS ACAT +report c +report results +report Counter +Ġpost ive +Ġpost Only +Ġpost routing +PU F +PU I +GR k +GR ATIONS +GR Pct +GR LostBarn +web dataset +web Settings +web spider +Ġbetween ness +sqrt n +ç gen +ç ek +ç amentos +]]) / +]]) ; +++ . +++ ': +++ )', +Ġfin er +Ġfin ais +Ġfin alizada +lr p +lr us +math group +math close +math open +math world +alid as +Ġgenerate Points +Sub dir +Sub command +Sub graph +Sub level +Sub directory +Sub Title +Sub traction +Sub mitted +Sub Sys +Sub Accounts +Sub menuItem +Sub Meshes +ĠAPI Version +ĠAPI Factory +ĠAPI 说æĺİ +xcf C +xcf E +xcf S +xcf d +xcf q +xcf w +Ġrand index +Ġrand samples +Ġrand erso +xdf A +xdf F +xdf J +xdf L +xdf M +xdf Q +xdf k +xdf l +xdf m +Result Type +Result File +Result Size +Result Category +rat t +element Id +ML X +ML Parser +ML CA +ML PB +xbe H +xbe P +xbe X +xbe a +xbe j +xbe v +Ġ$ $$$$$ +ĠArgs Parser +Ġlaw suit +docs LoadBalanceMib +Ġbox s +Ġbox lines +xce B +xce I +xce L +xce P +xce R +xce Z +xce b +xce x +xce XV +google source +google play +google plus +sql Content +Auth n +Auth enticating +Auth AdminStatus +sig M +sig m +sig la +sig args +sig mask +sig req +sig thresh +sig Region +af q +af fil +af firm +dm Z +dat i +dat filepath +LOG ON +LOG NAME +LOG ERROR +LOG FEEDER +offset type +DATA ANSWER +Ġscore List +ĠZ H +ĠZ ur +ĠZ int +ĠZ pp +ĠZ ac +ĠZ table +ĠZ SI +ĠZ ubi +ĠZ achary +ĠZ ymo +,' // +,' +') +ram eny +NO VO +NO DELAY +Ġjob man +Ġjob flow +Ġjob Limit +Gener ators +Gener Topo +Ġthere Exists +ĠBase Config +ĠBase Class +ĠBase Manager +ĠBase Block +ĠBase Layer +ĠBase Component +ĠBase Serializer +ĠBase Schema +ĠBase Player +ĠBase Metric +ĠBase Transformer +ĠBase Processor +ĠBase Exchange +ĠBase OAuth +ĠBase Grant +Ġparent frame +Ġparent Id +Ġparent Tab +Ġparent MatchingStyles +Ġ// //////////////////////////////////////////////////////////////// +ĠEn ds +ĠEn ough +ĠEn caps +ĠEn trée +Ġcli mb +Ġcli mat +Ġthread Id +Ġthread Count +UP pz +non iid +non relativistic +non mnfld +non alch +non domination +non edict +Ġì ħ +Ġì į¼ +Ġì ¦ī +Ġì ī½ +Ġì Ľ¹ +rs l +rs bs +rs OrPr +Ġnoti fi +Ġnoti fic +Ġcfg rib +xdb P +xdb Q +xdb m +xdb r +xdb t +('/ '+ +æľ Ń +WS M +WS z +WS ERS +WS wW +WS PAM +WS GJs +Ġcmd str +Ġcmd list +Ġcmd args +Ġcmd Str +Ġcmd Max +Ġcmd Man +Ġcmd Min +Ġcmd Diff +Ġcmd CommitLog +upper Limit +upper Physical +Ġsql list +Ġsql where +Ġsql vc +Ġsql lineage +dio vas +xbf F +xbf L +xbf P +xbf T +xbf V +xbf u +Pos ix +Pos Er +Pos ição +Pos Handles +light er +light Color +light novel +light curves +light kube +light nings +fin i +fin ire +fin alization +fin fish +gb kconfig +GB EE +GB sb +GB gY +Entry ListResource +Ġcell data +Ġcell width +()). \ +Ġcluster lib +ux heat +section def +section FromNode +Ġremove LF +Ġremove Dirs +Ġremove BBOX +Ġremove Duplicates +xeb A +xeb C +xeb D +xeb G +xeb H +xeb J +xeb R +xeb W +xeb X +xeb d +xeb r +xae D +xae K +xae O +xae R +xae U +xae V +xae X +xae h +xae k +xae v +Ġsplit ing +Ġsplit graph +Ġsplit lines +Ġsplit arr +Ġsplit KeyList +Ġinit Cmds +global token +global temp +global Mass +ã u +Ġans wr +INE A +alpha f +alpha py +Ġvar list +Ġvar ID +Ġvar mask +Ġvar Types +Ġvar Degree +ĠMan hattan +FP C +FP F +FP j +leg ar +leg alize +leg ale +training DataFile +Ġzip Field +Ġzip bObj +Ġpart nership +-% % +}. * +hex val +hex digits +hex archive +Ġbest Buffer +Ġbest substring +Ġbest AvgValue +0000000000000000 0001 +0000000000000000 0000000000 +ĠStr and +ĠStr Arg +ĠStr Lines +ĠStr uts +ĠStr atum +ĠSO FT +ĠSO ME +ĠSO URCES +Dis pose +Dis ables +Dis connected +Dis ambig +Dis abling +Dis ruption +Dis criminant +nb Depth +nb Samples +nb ananas +can ary +can Be +can objverts +can Robo +amera Server +]+ )) +]+ \\ +]+ $", +]+ .*[ +NE i +NE OD +zip Code +zip Directory +zip åIJİç¼Ģ +zip bObj +ons ite +rain fall +Tensor List +Tensor Train +Tensor RT +Ġdir Y +Ġdir Out +Ġscript process +tt amente +Ġcho ke +Run Descriptor +Run Command +Run Method +Run Cmd +Run Queue +Run Checks +Run IIF +rank ers +ha ma +ha State +ha Identifier +ha Lh +ha usdorff +ME O +sen list +sen Rot +real key +real ms +real loc +real istic +real gdp +real Donal +Check Request +Check Item +Check Output +Check Failure +Check GreaterThan +Check LanMode +xde B +xde F +xde M +xde X +xde b +ĠFile path +ĠFile Stream +ĠFile NotFound +ĠFile Link +ĠFile Write +ĠFile Console +ĠFile Allowed +Port land +Port Stat +Port ugal +UD N +UD IM +UD matrix +grad var +grad check +grad norm +grad Fill +factor ize +px OJ +px rpython +fill r +]): # +He mp +He im +He els +He lios +He avily +ĠAdd r +ĠAdd Analysis +ĠAdd JointLimitParticipant +cfg Path +gt P +gt c +gt gf +gt cag +include Overview +distance data +distance Dict +Return Statement +Token Stream +Token Validator +Token Parts +Token Semicolon +supp osed +supp liers +supp lements +xfd B +xfd F +xfd J +xfd K +xfd L +xfd M +xfd S +xfd T +xfd j +xfd x +xfd z +cip ents +Qt ChooserWindow +Qt Qml +Qt WebEngineWidgets +Ġjo urnée +Ġ'% " +Ġ'% ': +any one +any where +center Y +price Id +price Reminder +Ġparti cipi +loy ds +loy alty +loy ola +draw able +draw timing +alog ger +oper on +oper aciones +Ġ"- "] +Ġ"- // +Ġ"- ")) +Ġ"- "). +Ġ"- >", +Ġ"- >". +Ġ13 11 +Ġ13 06 +Ġ13 19 +Ġ13 85 +Ġ13 80 +Ġ13 000 +Ġ14 87 +Ġ14 20 +Ġ14 26 +Ġ14 75 +Ġ14 000 +Ġ14 28 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġsee king +Ġalpha f +Constraint Model +)\ .(\ +account info +Te k +Te mpl +10000 11 +Ġstat ue +Ġstat vfs +UB YTE +Point less +Point Start +Point Flow +br h +br ine +br db +br rp +br vt +Function On +Function Task +Function Generator +Function Expression +Function Factors +sd ls +sd ollars +Ġlayer Outputs +ĠCheck list +ĠCheck sum +ĠCheck pointer +ĠCheck Availability +ĠCheck WarningCount +ĠCheck ErrorCount +Ġexit status +Ġgame object +Ġtests Without +rel Delta +ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ +Lib an +display Information +Ġ[], [],[],[ +Argument Error +Argument Context +xcb H +xcb L +xcb M +xcb V +xcb i +xcb j +xcb m +her ic +Ġpick les +Ġelement SetData +Ġelement SetFull +GS LIST +rot to +rot mat +rot Save +Mode ToUse +ĠApp Run +ĠApp Kit +ĠApp Dashboard +ĠApp rentice +ĠApp Adder +Ġmeta Cols +VAL RNG +VAL UETYPE +Ġnow list +Ġnow date +Ġnow ait +Ġnow here +Ġauthor Genders +Ġcustom id +Ġcustom izer +Ġcustom izations +Ġcustom ises +ROM AGNET +ROM MEO +Per p +Per Cluster +Per Cap +Per centile +Per Meter +Color ed +Color Py +Color Array +Color DataSet +Color Primvar +Color PlugValue +Or che +Or Tuple +Or den +Or Password +Or Json +Or Copy +Or Baseline +Or Emotion +Or chestrator +Or MetricFn +Or NameAlreadyExists +xbd B +xbd F +xbd h +xbd j +xbd v +xbd x +xad D +xad P +xad R +xad S +xad a +xad w +xad y +xad z +xad IE +eff e +eff bot +eff ectif +0011 2233 +Ġsw at +Ġsw ir +Ġsw ell +Ġsw iss +Ġsw edish +Ġsw ngSeed +xcc F +xcc P +xcc W +xcc b +xcc d +xcc r +zero Terminated +Ġspec imen +.* "], +.* ']), +.* $') +Ġvi ver +Ġvi list +Ġvi vi +Ġvi ele +Ġvi ik +GET POMERIUMSERVICEACCOUNTREQUEST +cm x +cm nt +cm ip +cm df +cm divw +á k +á u +á y +á cie +á ticas +á lisis +Ġflask app +Ġflask App +Ġflask cbv +Pe te +Pe pper +Pe ugeot +Pe epholeOptimise +xba S +xba Z +xba h +xcd C +xcd E +xcd K +xcd S +xcd V +xcd c +xcd q +Ġinstall ers +Ġinstall dir +Ġinstall Reactor +Event Name +Event List +Event Log +Event Table +Event Number +Event Entry +Event Run +Event Content +Event Types +Event Provider +Event Store +Event Hub +Event Detail +Event Bus +Event Changes +rad lat +rad ps +Item Id +vec Inferrer +ĠKey Bundle +ĠKey Jar +ĠKey OrNameAlreadyExists +GI R +GI p +GI LL +GI FT +GI GANT +card dav +xea D +xea E +xea N +xea U +xea Z +ĠLe v +ĠLe vi +ĠLe aving +ĠLe ón +ek a +ek sterne +cial is +ĠConfig Engine +ĠConfig Store +ĠConfig Selection +ĠConfig urator +velo ce +Ġverbose Level +Label Path +Label sets +Label Edit +Label Format +Label Scaler +Label Opts +Label Calibration +Label Ranking +Ġsci unit +Ġresp u +Ġresp once +Ġlink i +âĸĪâĸĪ âĸĵ +âĸĪâĸĪ âĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮâĶĮ +âĸĪâĸĪ âĸĢ +dest in +dest DirPath +ĠComp oser +ĠComp oses +ĠComp liant +ĠComp laint +ĠComp etitiveSignal +ĠComp osedForm +Ġstri vial +Ġsend o +Ġsend Data +Ġsend Transaction +Ġsend MQTT +xab B +xab K +xab Q +xab c +xab f +xab i +xab j +xab m +xab o +imp e +imp Data +imp erial +imp oss +," =", +Line list +Line User +Line Width +Line Interval +Line Samples +We ird +We aver +Ġmer curial +Ġ18 000 +MS ID +xdd A +xdd B +xdd R +xdd Z +xdd g +ategor ioj +71 92 +71 32 +Ġcache Dir +Ġcache Block +hand bag +åIJ ¨ +åIJ ¸ +åIJ ¹ +åIJ ı +åIJ Ĺ +Code To +Code View +Code Gen +Code Len +Code Pipeline +Code Mgr +|\ . +|\ .\ +|\ +)?(\ +depth ens +depth Data +Date line +Date Code +Date Let +xbb Y +xbb b +xbb h +xbb j +xbb k +ving stewart +til vÃŃsanir +Ġavailable classes +Ġavailable ForStaticIp +Load Mesh +Load Threads +cf engine +cf proxy +lex info +lex pand +mm g +mm ata +NA Q +cap stone +Ġsingle source +Ġsingle Parameter +arm nn +arm uPDF +Ġopt space +Ġopt vars +Ref lect +Ref Count +Ref GT +Ref Page +Ref Seq +Ref Selector +Ref Aligner +Ref SeqNum +Ġaddress Length +Ġfeature Vec +Ġfeature Transformer +Ġfeature Maker +Ġfunc body +Ġfunc Size +mag ne +mag netometer +mag hAll +æķ° 缮 +æķ° å¼ı +æķ° åįģ +Ġrest ing +Ġrest id +Ġrest shop +prob type +xee B +xee M +xee W +Ġsecond Line +Ġparam list +Ġparam Count +Ġparam descs +CI K +CI PE +CI ATED +CI ELab +Ġstop when +ĠCol lider +ĠCol lapsed +Ġpe ach +Ġpe destrian +Ġpe liculas +Ġpe gtree +ĠRun Go +ĠRun MCMC +storage Path +storage Size +Ġloop infos +Fil tro +oo h +Ċĉĉĉĉĉ Ċĉ +'{ \ +'{ ", +OUT S +ãĢ ĩ +Ġerr msgs +Ġerr oneamente +Ġerr oneous +Mat Print +Mat GAN +Ġ") [- +Ġlong dir +Ġlong Options +Start Point +Start End +Start Main +Start OfContainer +Ġweb test +Ġweb api +Ġweb store +Ġweb settings +Ġweb stack +Ġweb Service +Ġweb interface +Ġweb logo +Ġweb dnn +Ġlocation Data +xda G +xda K +xda L +Ġest ilo +Ġest ekak +ASS IS +BL B +108 07 +Ġprogram Size +MC S +MC GILL +jnxMbgSgw PPIP +SD FG +fc ns +fc GHz +.... >> +.... -', +rl ControlHistoryControl +}') ], +je z +je on +je an +ote book +ote cas +ote iro +player ClientPropertiesMessage +multi var +multi mask +multi graph +multi level +multi tags +multi NC +multi subject +multi byte +multi matic +multi threading +multi maskm +document Element +document Constant +Ġaccess bot +Ġaccess ions +Ġaccess ories +Ġaccess Policies +Ġmc apps +ERROR DETAIL +ier es +ier ry +ier ung +counter a +WOR ST +Ġhandle Rep +Ġsuper types +Ġsuper access +Ġsuper fluous +policy ID +=[], [] +Count State +Count XPos +button Frame +button Any +Process Factory +Process Memory +POST ER +long dir +long table +long names +long Path +long sec +long running +long deg +ĠPRO CES +ĠPRO PAG +ĠNot Html +,\ .: +sec Type +sec lines +sec meters +ĠTime Program +ĠTime Delta +ĠTime Limit +ĠTime Period +ĠTime tracking +NN S +NN p +Ġattr dict +seri alizing +ĠOr ka +ĠOr phan +å¤ ® +avg Interval +avg Len +Ġgen et +Ġgen mk +Ġgen Lim +Ġgen bank +Ġgen shin +ĠImport MatrixVal +cla he +cla mm +cla imer +cla iming +cla mation +mk y +mk z +mk line +mk isofs +Ġold C +Ġold Cur +Ġold EntityId +Ġ[- ( +!! ) +!! ', +!! !' +ender er +EXT REME +chain analysis +chain RIC +requ ote +ĠDT W +anel lo +ĠPo les +Pri ze +Pri mor +xdc L +xdc R +xdc Z +xdc b +xdc j +xdc q +commit ting +ling id +())) ), +())) +". +Ġcontains Object +Ġcontains Point +ĠCom mission +ĠCom Replace +ĠCom Dust +STR AT +Ġdiffer net +ĠTe sseract +ĠTe lom +normal ising ++" & ++" ...") ++" $") ++" ("+ +cost eA +cost OfEquity +CD D +CD M +CD CD +render Mode +render Properties +handle Unknown +Ġinputs A +Ġinputs B +All Target +All Close +All Completed +All Plots +xac E +xac G +xac M +xac T +xac f +xac m +xac w +ret value +ret stat +ret na +Box Predictor +nan rankdata +ws L +ws FI +ws dm +aly an +Ġfinal es +Ġfinal list +Ġfinal Df +Ġfinal Trending +BO Y +BO n +BO UN +BO MB +BO IDS +BO ILER +Ġpub ids +Ġdimension less +Ġ"% % +uter ms +way Network +way veai +Ġsm al +Ġsm id +Ġsm ali +Ġsm irks +loop time +pad w +pad len +cer tify +plugin name +ĠLog File +ĠLog Event +ĠLog normal +ĠLog Statistics +ĠLog Diag +111111 01001001110001111 +So ma +So Far +dr b +dr ar +dr pc +dr inking +}' ")) +}' "}) +Ġkeep going +Ċĉĉĉĉĉĉ ĠĠĠ +Ċĉĉĉĉĉĉ Ċĉĉĉ +vari o +Ġallowed Attrs +Mo tivo +Mo yen +tack er +pub l +pub keys +pub Date +pub chem +pub nub +On j +On to +On Di +On Cluster +On ClickAction +On CompileCompleted +Command State +Command Params +Command NotFound +Command KeyMask +å® ħ +Values Helper +~~~~~~~~ ~ +seg reto +auto log +auto layout +auto augment +auto contrast +auto Ping +auto awsume +Ġtrack name +Ġtrack able +Output LOCAL +Output Rescaling +rm g +rm r +Ġkeys Pressed +Sc rapper +Equal Case +Equal Sign +Ġconn ectivities +ĠLI FT +ĠLI GE +ĠLI WC +xaa I +xaa N +xaa O +/( .+ +site key +site config +ACT ORS +ACT INIA +ACT ATACAA +ACT ORTASK +lux I +ĠUnit ary +ĠUnit Cell +ĠUnit Price +ĠUnit OfWork +qa oq +Ġbinary Vals +Ġbinary ObjectFileName +Ġbinary ObjectFileTypeCode +Ġbinary ToNum +distri cts +parti cul +Manager Dialog +Norm an +Norm alizing +spect r +ĠModel Data +ĠModel Keys +ĠModel Schema +ĠModel GAT +ĠModel GCN +ĠModel APPNP +ĠEX ACT +ĠEX TERN +ĠEX CLUDE +ĠEX TERNAL +ĠEX PRESSED +inf eld +inf ested +inf usion +inf ectious +inf lations +inf lated +Ġind CC +Ġind uctive +Ġind ustries +timeout EDDN +10011 0101 +rb t +rb ps +ĠHttp d +ĠHttp Runner +ĠHttp Endpoint +ĠHttp BadRequestException +ĠHttp Locust +Ġcompute Exp +Ed F +Level Manager +Level Formatter +Ġchild type +Ġchild hood +click models +tuple Id +tk ge +9902 83 +9902 63 +ĠName Contains +Ġconf use +Ġinitial Network +TP B +TP X +Ġconnection Socket +entic ado +Ġwait list +neg ro +prop Neg +prop ulsion +Ġcreated At +js Alert +js bGR +Ġbl bf +Ġbl stm +Ġjs chart +Ġnodes ToAdd +Ġnodes ListPerNodeLabel +Ġ"_ "+ +Map Maker +Map Prefixes +Ġtx groups +this is +this own +this Notes +generate Method +generate Tests +generate CreditCardNumber +Ġmulti path +Ġmulti url +Ġmulti ml +Ġmulti grid +Ġmulti scale +Ġmulti agent +Ġmulti language +Ġmulti world +Ġmulti proc +Ġmulti effects +Ġmulti quadric +SV TYPE +Met as +OK U +OK AY +æĺ Ń +GL ON +GL float +GL ASS +GL USTER +Be Read +Be Assigned +Do Y +Do ub +Do ador +Do Firmware +Do AccountAdd +Do ImportConfig +Do ExportConfig +Do NotToogleChargingException +Do odadESSource +Ele ctsys +Tag Key +Tag Manager +Tag Map +Tag Enabled +Tag BaseEnabled +Ġhtml text +Ġwant ing +Resource Status +Resource Serializer +times lice +Ġalso Occupied +([' {} +([' ../ +([' ________________________ +Oper Mode +Ġresource Group +Ġresource Kind +Spec Py +Spec Func +Spec DataReader +Spec Nest +Spec imen +PS A +PS QL +PS AE +GG AG +GG AA +GG TAG +GG GTT +Ġpad list +Ġpad Start +Ġpad tok +Ġdomain sizeX +fname In +vol ont +vol Shape +xca Q +xca R +xca e +{' ;'. +xF EE +xF BA +xF BD +used Object +ĠSimType Long +flat s +flat Map +Is n +Is Enabled +Is Timeout +Is Unicode +Is olation +Is Collecting +Is rael +Jo N +ICE DataPath +Ġproduct info +agent e +UE Q +ĠURL SSS +ĠURL Resolver +OS UB +OS Runner +OS PIKE +({" $ +cloud run +cloud Manager +cloud Member +cloud monitoring +tool path +tool dict +tool belt +ĠAc cesses +ĠAc meAccount +ĠAc ampamento +ĠAc qState +Ġunique Conv +skip InstallParams +skip OnCluster +DR T +DR ON +DR AM +DR UG +1001 000000001000000 +Ġaut he +Ġaut opilot +Ġaut okeras +Ġaut olens +Ġaut enticado +Ġoriginal Features +Ġoriginal Words +("- ")) +("- "). +("- +- +PORT AL +ĠIt ot +Ġlook at +Ġbytes In +Ġbytes Beyond +Ġneg at +Ġneg ations +Ġneg dis +Ġneg Meth +Core quisite +DF E +DF PT +DF eed +Ext Vec +vs ctl +inner Mask +Ġrot ar +Ġrot label +Ġrot loss +âķ ł +comm om +End Address +End WithSelection +End SpellCast +Found Pattern +FR AM +LC w +LC ache +short ened +ĠNum Group +ĠNum eral +ĠNum éri +ĠNum RegToReceivePerSg +region es +Ġdraw now +Ġdraw Bisector +ĠAuth enticating +Method Name +Method View +Method Info +Enum erable +Ġrule IP +Ġrule Port +Ġrule Names +FORM ULA +Ġgr ün +Ġcorrect Vals +cr V +cr nm +cr nM +cr fsuite +cr WSGJs +ĠDefault ValueDict +Ġ'../ ')) +Ġ'../ ../../../ +figure Dir +ĠTo e +ĠTo Do +ĠTo Update +ĠTo pple +ĠTo PILImage +dete ctive +ĠLanguage s +zy dziewierz +SH istorical +0001 7 +0001 20 +0001 395 +0001 545 +Ġ32 9792 +gh an +gh id +Ġreport e +unique Urls +gre ys +Ġcore ali +ĠQt Qml +convert Back +GE Y +GE OM +GE OC +GE OF +Ġ') [: +tile width +tile height +tile sets +tile Names +expected Element +expected Points +("% ")[ +Ġdel count +Ġdel tag +Ġsig ui +Ġsig req +Ġsig lim +Ġsig proc +Ġsig visa +Ġsig moide +=[" % +=[" { +=[" *. +=[" /", +category Name +category List +hat ri +ĠAt ual +ĠAt ualização +ĠAt lanta +bn ch +bn ath +bn box +bn icate +115 43 +115 226 +Total Length +Total Energy +Total Errors +Total Income +/" +" +PAR MAP +Ġdetails ViewColumns +pdf to +pdf base +pdf crop +pdf latex +pdf æł¼å¼ı +known Publications +Ġpredict Method +Ġview up +Ġview ability +Ġview Location +033 07 +tab name +tab size +tab Name +tab ulary +tab bing +tab lenames +collection field +Ġprefix Operator +Ġhigh freq +IR Q +IR w +IR ER +IR CK +IR cuts +IR FU +IR CJ +Ġ------- > +ĠTuple Instance +Tree map +Tree Size +Tree Widget +Tree Interceptor +Window Handle +linear ize +linear size +linear Es +linear Bs +SO E +SO MA +SO CI +SO ILS +SO METHING +SO SCriterion +ga ma +ga fic +ga act +ga ana +Ġskip Scan +Ġhash Sequence +Ġhash Outputs +Ġhash Poti +Min os +Min LOD +Ġconnect é +validation Examples +socket Keep +čĊĠ čĊĠĠĠĠĠĠĠ +čĊĠ čĊĠĠ +:, [ +AV O +AV P +AV Q +AV X +rest o +rest id +rest orer +Ġtr data +Ġtr sh +Ġtr nd +Ġtr uthtable +ish y +Ġsequence d +Server less +Server Client +Server Manager +Server SelectionTimeoutError +An w +An halt +Ġshe ared +ĠUp stream +ĠUp loads +ĠUp sert +USER DOCKER +xs f +xs TH +xs TE +istri erung +Char set +Char Box +Char lie +Di He +gpu home +Ġow scap +Ġdebug print +Ġdebug ged +Ġdebug Date +mu ÅŁ +mu zzle +Struct Type +Struct Format +amount OfBytes +Ġve p +Ġve ut +Ġve gan +Ġve za +Ġve PTP +semantic Type +ĠBo eing +010 3282 +Ġrunning Configure +Ġrole Dict +Ġcommon ops +aut ok +aut ores +aut odock +aut ounit +mac ion +Query Handler +Query Parameter +Query Schema +Query Sync +Query ValueEx +Query Uids +Ip Permissions +Ip VJ +Task List +Task Set +Task Params +memory BufferSeverity +Ġfun ctor +Ġfun nel +Ġfun ctest +Ġfun ción +ĠAl fa +ĠAl gebra +ĠAl bedo +ĠAl arms +kernel pkg +9999 997 +DX h +{\ }\ +Ġsin a +Ġsin x +fici o +fici ente +fici entes +hour angle +à° Ĩà°® +Program Libs +final ware +final Volume +final Orientation +final island +éĢ ŀ +Ġast rometry +Ġperson alized +Ġprevious StepName +EE UAghhBDCw +Source d +Source IpAddress +Source Skin +Source FileLoader +Source IpPrefixLength +lint ing +Ġdat read +Ġdat List +Ġdat umi +Ġdat enum +Ġdat props +Ġdat Hash +Ġselected Index +Ġselected Layers +Ġrate stats +Service V +Service State +Service Provider +Service Unavailable +ii K +ii y +ii EEEII +Ġacc us +Ġacc nt +Ġacc ents +member def +member ForID +history DB +ìĿ ij +Ġcap teur +Ġcap irca +ĠOb serve +Ġfit vals +Ġfit scatter +Ġfit vmicro +Ġfit vsini +fl gs +fl Un +Address List +Address Code +Address Manager +Address Spec +Address Less +Ġhow ToStoreToken +Graph Surgeon +_, [[ +_, [[( +CHE L +Ġreq info +Ġprob ing +Ġprob num +istic as +Ġvari os +Ġvari abel +dia co +dia Env +Ġassign mentid +ĠPre par +ĠPre fer +ĠPre defined +ĠPre ferred +ĠPre dicate +ĠPre dicts +ĠPre computed +ĠPre vents +ĠSh ut +ĠSh aring +Length NLLLoss +Length Standardi +Ġfail Count +__, )) +legend Kwargs +Ġdelta T +Ġdelta Sx +'+ \ +*\ (.*\ +pa Int +pa WF +pa Continue +Ġcir colari +Ġstack Top +Ġcomponent e +Ġfast Anchor +Ġfast jsonschema +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Search State +Search Scraper +ĠPer u +ĠPer petual +ĠPer imeters +ynamic Plot +Ġfactor ed +Ġfactor Sensi +åĬ ī +Ġdt factory +Ġbody Id +bi om +bi ó +bi harmonic +Ġct b +Ġct n +Ġ17 00 +([" / +)+ ') +)+ (( +)+ ","+ +ĠString ArrayType +ä¸Ģ åIJij +ä¸Ģ è½® +ä¸Ģ çĻº +ä¸Ģ é½Ĭ +download page +download 缮å½ķ +download 缮å½ķä¸ĭ +gan te +gan ache +Policy Response +Policy State +Policy Row +Policy Classifier +Policy Queue +Policy Player +Policy Diff +Policy Priority +Policy Vid +Policy Bandwidth +Policy Outgoing +Policy TOS +Policy DSCP +Policy Metering +Policy Forwarding +Policy EgressPort +mut uelle +mut linfo +Dataset Name +Dataset Config +exc itations +Ġwords Draw +vv f +vv PAC +å° Ī +å° ĸ +Ġtk ge +Ġtk fd +[\ ]] +[\ )\ +[\ [( +hs Vi +}'. " +Ġvalidation Percentage +ĠPlot Type +ĠPlot Data +ĠPlot List +ĠPlot Extension +)]) ]) +}". \ +}". """ +}". """) +mesh clust +ked astic +)} % +)} - +)} ). +)} +Ġ? ;' +Ġ? ''', +Read out +Read Message +Read Timeout +Read Sensor +Read LittleEndian +Read Varint +Read Gals +Read StatusOf +hidden W +hidden Layer +hidden imports +Ġforce fully +Ġforce dtorun +Ġum ask +Ġum ychart +ĠWh ip +ĠWh atever +Classifier Table +Classifier Path +Classifier State +Classifier Entry +Classifier Match +Classifier Weight +Classifier Indicator +Classifier VlanEntry +Classifier VlanTable +Classifier TimeRange +Classifier MatchCount +Classifier CountState +ĠHttpResponse ServerError +Ġcontrol lo +Ġcontrol Axes +Ġbit an +Ġbit code +Ġbit mark +Ġbit tensor +Ġbit depth +Ġbit boards +abi lization +MAP LINE +MAP RED +MAP ENTRY +MAP BOX +glob us +glob io +glob opt +most ly +Ġpr ms +Ġpr ance +Ġpr dt +Ġpr erouting +mass a +mass FL +mass Values +mass achusetts +mass ofpi +Ġsepar ação +fast ly +fast text +fast node +fast Field +fast cat +fast DAQ +fast mvsnet +Ġface ID +ĠInter helical +percent max +percent Done +ç» ¼ +}: ( +}: (( +}: '. +Ġlow Val +Ġlow ess +Ġside car +provider Directory +With Stats +With Action +With Notifications +With Less +With LMHeadModel +With Vehicles +With Redu +With Sle +pn config +pn gs +install Policy +install LogPath +NB D +NB T +Bu gs +Bu enos +Ġlower ing +Ġlower Archives +Ġparsed Name +Ġparsed Params +DU LO +EG g +ĠNumber Range +ĠNumber Format +('% - +Default Config +Default Gateway +PER T +PER MS +PER MIT +PER MANENT +pare cchio +cb unc +cb reak +cb channel +cb mc +cb vd +cb Hx +cb Learner +Const itution +Const ellations +Ġpossible s +Ġadmin Password +Ġadmin nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn +9218108 16 +Ġbegin nt +ó eo +Ġsimple Exception +Ġsimple dialog +Ġcop a +Ġzero space +ĠLoad Library +fd c +fd De +ı l +ı ca +ı yla +Content Protection +æĹ ¦ +æĹ ı +æĹ Ĺ +Ġinte g +ĠDo ubly +åį ı +ĠEN CRYPTION +ĠEN SEMBL +SA K +SA Q +SA UCE +åľ § +åľ Ĵ +targets Enriched +Mem ToNumpyArray +ROOT CERTIFIC +Ġcre c +Ġcre w +Ġcre ep +Ġarea mask +Ġestim ado +((" . +EC F +EC U +EC w +EC DB +Light Type +wb t +Ġds LS +ĠTH AN +ĠTH READ +ĠTH RED +Ġapply QA +Ġapply TextRank +Back ing +Back space +Back propagation +Sa VS +Ġwin len +Ġwin List +Ġwin rm +Ġwin Choice +Ġexisting Clusters +ĠAR T +ĠAR AB +ĠAR MA +ĠAR TIC +192 0962 +ĠField Variable +ĠField Category +ĠField DoesNotExist +Ġdesc lines +orn ings +orn amos +Ġmost Frequent +Ġcut Offset +Ġgra vel +Ġgra fico +Ġgra duate +Ver ses +Ver wandte +gl get +gl Shader +gl Compile +gl Attach +gl Detach +gl Lightfv +([[ [- +Ġvolume Type +Ġvolume High +Ġvolume Low +export ers +export Dir +export Server +export Format +export FileName +Sum ter +Sum Token +Sum Count +Sum marize +Sum atera +Ġmp q +Ġmp r +Ġmp u +Ġmp re +Ġmp id +Ġmp edal +Ġmp rogress +roid Manager +005 473 +005 9823 +005 36918 +Ġactive Offset +Element File +Element Context +Element Base +route dem +------------------------------------------------ ----------+ +Ġjoin list +Go P +selected Level +selected Fault +selected ItemType +selected TargetLocation +Ġdev str +alt ro +alt markets +READ ABLE +ĠRequest Config +ĠRequest Configuration +container header +Layer Data +Layer Norm +PH xc +PH IF +speci alizations +speci fics +Ġnb h +Ġnb ex +Ġnb Lots +ĠOrder Status +ĠOrder Refund +ĠDjango JSONEncoder +ĠDjango FilterBackend +uch s +ĠHTTP Created +199 651 +Variable Name +Variable Dialog +Variable Attributes +ĠIMP URITY +Open Mesh +Open Div +Open SSH +Open Threads +Open MOC +Open StreetMap +Open Paren +ov an +ov ci +ov sk +ov ica +ov Mad +Ġcat Name +Ġmissing DocWarning +个 åħĥç´ł +个 èĬĤçĤ¹ +Ġcounter parts +Ġcounter factual +011100 01101 +cross domain +cross refs +cross woz +Ass oc +Ass Name +ka h +ru ft +Ñı Ñģ +Ñı б +assign Property +assign Variable +cid ente +mid o +mid ine +mid head +mid Target +merge vcf +merge Logs +ensure MoreBytes +Ġscreen ers +Ġscreen board +:]) [ +lst sub +lst Len +Ñĭ м +chat log +2012 12057 +sigma Add +Ġho yde +================================================================ ========= +UI UC +upload File +Ġatom Num +Ġ"{} "\ +Ġinv conv +Ġinv itations +ĠExample Model +Ġcomment ing +Ġcomment Field +ĠNote Object +ĠNote ViewSet +aff ect +aff fffe +к ом +к ам +room cnt +room InDirection +Ġboard Type +Ġboard Cells +speed y +speed plus +Register Name +/> ". +/> ,< +Ġ'{} '" +Ġpayload Builder +³ółģ ³ółģ¿ +³ółģ ·ółģ¿ +³ółģ §ółģ¿ +³ółģ ºółģ¿ +ignore check +topic Ext +topic Partition +Ġ"< : +Ġ"< -- +MAN N +\"\ "\ +release Particles +ĠCO G +band gap +band oned +curr Target +curr tsk +NS F +NS qc +NS REC +eve online +ĠReg Lasso +ĠReg ulatory +ĠReg ardless +Pool er +Pool Token +Pool ProfileArgs +(? =[ +(? =(? +(? ::[ +As T +As semble +As sessor +BR C +BR AM +BR ISK +transpose A +transpose B +FLO PTURN +safe browsing +DEF MAP +DEF BUTTON +Ge G +Ge Qx +Ge otech +Mon omial +Mon aco +Ġimplement a +Ġpara Count +aws Region +aws AccountId +)" < +kw ik +kw alk +kw mg +kw mE +kw rgs +Local Optimizer +Local Strategy +DD ER +Edit Hinge +Edit WordState +dy u +Ġap ers +Ġap itoken +Python Type +Python Command +SFP Connector +SFP Wavelength +SFP Fiber +SFP BaudRate +SFP Vcc +SFP RxPWR +SFP DateCode +ĠMy List +ĠMy server +ĠMy SQ +ĠMy Miner +ĠMy Ips +ĠMy UserWith +Ġmemory Size +Ġmemory Persist +Ġmemory BufferSeverity +Ġ'') ), +clip num +scalar ization +Top ography +complete Type +complete Score +Ġtile set +Pi et +rr nm +Ġexc use +Bar code +Bar rel +Bar ney +Bar WithFocusChart +ĠST IX +ĠST UFF +crypt en +encoding Desc +WE F +hi atus +hi jack +rf j +rf bj +rf loor +Ġneeded negatedword +And Date +And Filter +And Trace +And Replace +And Die +And reas +And Epics +And Maybe +Category ID +Category Form +Category Item +invalid o +rec path +rec Addr +rec Combined +del c +del routes +del phia +Ġflags Size +çĶ¨ éĢĶ +è® Ĭ +ranges lider +Grid Statistics +]= (( +green let +VERSION PATH +LS M +LS Q +LS w +LS AD +LS COLORS +Component Data +Component Factory +BB g +DA y +inv ader +916 26 +916 65 +916 297 +916 6666 +916 0664 +916 0316 +DIS JOINT +DIS PLACEMENT +same site +arti flette +namespace Id +subject Input +Ġpattern ed +big num +big box +big ram +big integer +big bird +flo oded +dig Time +dig End +dig Diff +dig icert +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĊĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +TA gs +TA AC +TA aj +camera Name +camera Group +camera Pos +camera Matrix +Ġsegment os +'])) [ +'])) ] +DEV SQ +DEV OLO +COMP ET +COMP IL +COMP LI +COMP ANIES +Page Memory +Page Blob +Page CleanUp +TRI VI +Ġarr p +Ġarr Size +Ġ90 92 +Batch Runner +Batch Unlock +actor id +actor data +actor key +dl Z +dl ite +poly go +poly dispersity +}} ` +}} +Ġreward StringList +Ġinterval array +ĠPoint Net +\" ') +\" /\ +two factor +Ġseg no +Ġseg wit +Ġseg unda +Ġseg itiga +Ġidenti ficação +Ġidenti ficadores +extract network +extract frames +extract Functions +aris a +Ġperiod ogram +ĠNe on +ĠNe ue +ĠNe vis +ĠNe bula +ĠNe braska +čĊĠĠĠĠĠĠĠĠ čĊčĊĠĠĠĠĠĠĠĠ +ĠNew node +ĠNew Life +ĠNew Rates +ĠNew UserForm +LIST NETWORK +LIST NODES +LIST ACCESSBINDINGS +aj Y +aj c +aj u +aj as +zen i +zen Pen +atio Temporal +asc endant +asc endantCell +constraint CheckBox +ĠSE PAR +ĠSE VENT +power State +Matrix Path +Matrix As +LD P +LD x +LD y +mol er +Exp ands +Exp Variance +ĠFL UX +FE A +Spe ex +lm ks +------ ' +215 0 +Ġengine Displacement +Ġengine Cylinders +ges amt +168 00 +168 06 +168 55 +ital ia +enable Auto +cov type +cov Size +Connection Manager +Connection ResetError +Ġfilters Values +Dec oration +Dec entr +Dec Coins +JSON B +JSON Renderer +JSON Decoder +qt T +qt path +Ġenter prise +ĠArgument Type +ĠArgument Item +sol c +sol ana +sol diers +æī ¹ +Ġep name +401 066 +SM h +SM u +SM ASK +SM ISSION +icon URL +Ġprice Type +Ġprice List +Ġprice High +Ġprice Low +rup ting +Ġrep mat +Author ize +Author izer +Ġsigma X +Ġdig a +Ġdig raph +Ġscores A +Ġscores B +switch ToProximity +dst field +Loss Scale +ĠRo BERTa +Ġtesting Parameters +sal var +sal ome +sal utation +sal inity +Ġsite alt +204 97 +204 21509 +IG V +IG ER +IG REE +prediction Tir +prediction BNET +Parameter ized +Parameter Csv +att name +att ns +MESS AGING +AF S +AF RI +AF UNCTION +kp K +kp lug +Ġhome space +Ġhome PlayerCode +105 93 +105 86 +105 26 +Ġedit ado +Ġedit cap +Vis ited +Vis aD +Ġ'< @ +Ġ'< =', +Ġ'< !@( +Ho pe +Ho loChassis +Plot Mode +UST races +star args +star check +Ġbar w +Ġbar ra +Ġbar plot +wav edata +}] / +}] $') +diag rams +diag noses +Ġsen tim +çĽ ĴåŃIJ +çĽ Īäº +Ġts A +Ġts ikchen +ĠOS F +ĠBE AST +ĠBE PASTY +Ġplay back +()), \ +175 36 +175 45 +Ġalways link +ĠRead me +ĠRead Imaged +elements List +Position AtTop +ino vo +VC P +VC U +VC W +VC MP +VC qF +rum our +Ġdst x +ĠConst itu +ĠConst antes +ĠClient Detail +ĠClient ResponseError +resize Amount +Sw apping +Sw arm +Sw itzerland +answer array +answer counter +čĊĉĉĉĉ čĊ +break after +Interface V +Interface StateTrap +Unit Type +Unit Cost +Unit ConfigEntry +Unit ConfigTable +Unit OnFailure +GA x +GA z +GA yy +GA AGGTT +GA USSIANS +0101111 111001011 +Ġ500 51 +ĠHe aven +Account Table +Account Entry +Account Run +Account Del +Account Authorization +Account Break +Account Watcher +ĠPO JO +ĠPO DEM +roy den +âĶĢâĶĢâĶĢâĶĢ âĶ¤ +ĠDB I +ĠDB Cluster +ĠDB Schema +ĠDB Connector +shared ContextCache +IV no +TF DS +TF reeFloatImage +Ġtw int +Ġtw ext +Ġtw iddle +Ġtw opi +abstract model +Ġgt ff +writ edata +align To +ĠAS YNC +ĠTrain ings +ĠTrain Data +ĠTrain Config +ĠTrain Label +ĠTrain SetGenerator +STOP WORDS +STOP BITS +å¯ » +Ġcross domain +('. ',' +RGB Color +ĠSQL A +ĠSQL Slow +Parse Response +Link Num +Link ConfigEntry +Link ConfigTable +uv ic +uv flow +uv Hist +uv PNO +aging Parents +Mod erate +Mod bus +Mod ulate +Mod Degree +VAR NISH +ĠSp O +ĠSp inner +ĠSp acing +ĠSp iral +ĠSp itzer +ĠSp irit +ĠSp insolve +ĠSp atioTemporal +tu y +tu ion +tu key +00011 000001111 +ĠAD AM +,) ?\ +|' %' +LY P +Ġctsp Sgacl +Ġctsp SgtPolicyGroup +Ġctsp IpSwStatisticsGroup +Ġctsp IpHwStatisticsGroup +Ġctsp GlobalSgaclEnforcementGroup +Ġctsp ConfigSgaclMonitor +Supp Timeout +Project Name +Project Path +Project Manager +Project Journal +Project Member +Ġmember chk +Ńółģ ·ółģ¿ +Ńółģ ¤ółģ¿ +Ńółģ °ółģ¿ +mix graph +BE B +BE ARB +FC B +FC p +bad os +bad code +bad ditional +Match Recursive +Match Predictions +Ġavg Value +Ġavg temp +PLE ASE +Ġ23 64 +Ġstderr List +ĠAss ymetric +Ġhour angle +103 94 +Ġpoly ak +ĠForm er +ĠForm Field +ĠForm Processor +vp Info +BC NR +BC XYZ +bias Y +bias Val +za proxy +ĠEvent Data +ĠEvent Base +ĠEvent Source +ĠEvent Service +ĠEvent Grid +ĠEvent Page +II g +II III +Random Search +Random Flip +Random Shuffle +Random ResizedCrop +}_ \\ +Names Train +Track ball +Track History +Track Meter +Location Constraint +rome ter +prec line +Rel ational +Ġderi ving +Ġderi vs +Vector Field +Vector Val +Vector Numpy +bd ry +bd topo +bd vG +npy name +npy Files +sph harm +Ġpositive Words +submit ting +markdown ify +čĊčĊčĊčĊ čĊčĊčĊ +dh All +lc L +Thread ing +Document o +fri sbee +Ġdot Product +program ing +program Name +ĠGroup Count +ĠGroup Manager +ĠGroup Address +ĠGroup Range +ĠGroup Profile +ĠGroup Results +ĠGroup ìĿ´ +ĠGroup ìĿĺ +ĠGroup Sync +ĠGroup KFold +ĠGroup MaskWidth +ĠGroup MappingMode +ĠGroup DocsRequestSigner +ACC IDENT +ACC ACCA +ACC CAU +Ġadditional type +Ġnegative Words +missing Number +Ġmaster VinTupleList +Ġrepo data +[..., ::- +AX ES +Fixed NodeFile +PN Z +PN AS +PN PT +Ġsq lify +ĠTra it +ĠTra il +ĠStart Server +ï¼ļ ' +ï¼ļ - +Cell Reference +Rmt Inf +ANG ELES +Rate Limiter +ĠCor r +Ġshuffle Ganon +Profile Type +в г +в он +Ġ00 02 +Ġ00 08 +Ġcred ited +Ġcred encial +ĠResponse Type +ĠResponse Data +ä¹ ħ +ä¹ Ļ +tel la +ĠDevice Info +ĠDevice Factory +Mock Server +Mock Parameter +ĠProject ID +wall Count +216 00 +216 07 +216 26 +216 842 +216 64775 +unic ÃŃ +Ġnumer ador +MESSAGE ID +Ġfo liation +Ġfo yer +Ġlinear ity +Ġlinear ization +Ġlinear Es +Ġlinear Bs +Exec Id +Ġ"") [ +Ġ"") ), +Ġnx graph +Ġnx rays +Ġfalse count +Surface Ir +gui args +wi ed +problem ID +problem Name +generic Payload +ĠProcess LookupError +Temp er +Temp File +Temp erture +gi B +gi ver +gi ato +gi udi +gi Cg +gi oso +gi orno +translate All +ĠCommand Parser +ĠCommand NotFound +Sample Desc +Sample Frames +Sample Goat +Sample Discarding +éĻ £ +00100 111 +outh ful +917 1 +917 2 +917 695 +917 1864 +917 6585 +Cmd Write +Folder Files +('_ '): +('_ ','- +Types Treatment +deploy Opt +MD b +Val Transformer +Val uatin +Ġè £ħ +Ġè ĮĥåĽ´ +2017 0525 +Ġvertex List +Ġvertex Normals +Ġtopic id +Ġtopic ID +Ġtopic Ext +Ġtraceback s +TS K +TS UB +Single File +Single Parameter +warn options +differ ente +为 ä¸Ģ +Area Infil +ĠGe ant +ĠGe onames +ĠGe odesy +css hlib +Ġpol lution +Ġpol ystores +Sign In +Sign off +Sign ika +remote path +remote content +analy ser +otype s +Ġxy cen +double it +double word +double Col +double Path +++++ +++ +yl K +yl fm +gp uid +Ġprivate ly +æľī 误 +æľī éĹ®é¢ĺ +æľī ä¸ĢåĢĭ +003 64 +003 934 +003 996 +ĠLabel Int +ĠDate i +ĠMessage Id +ĠMessage SelectMenu +ĠMessage Decryption +Multi part +Multi sets +Multi Task +Multi stage +Multi Category +Multi Step +Multi Metric +Multi FErrs +square PerRow +Ġfix ate +Ġfix ity +Ġfix iert +Ġfix ieren +ĠRandom Vector +ĠRandom Mesh +ĠRandom Active +ĠRandom Apply +vl q +vl w +vl ans +vl vl +çİ » +eng land +eng agement +cons lug +Change View +Change Handler +Change Event +Change Password +Change Finished +hy b +ctsp Sgt +ctsp Notifs +ctsp SgtPolicyGroup +ctsp IpSwStatisticsGroup +ctsp IpHwStatisticsGroup +ctsp GlobalSgaclEnforcementGroup +ctsp OldPeerSgt +Ġbook id +Ġbook end +Ġbook ings +Ġbook alo +Web Request +Web driver +Web Server +Web links +Web Cari +EA oF +Tuple Parameter +My Dataset +My Drive +My Todo +ĠLine ByLineText +Ġverify BundleStructure +Ecriture Let +DER IV +GD L +GD rive +den ver +Ġev ap +Ġev sim +Ġev itar +rag ue +Ġfc A +Ġfc B +Ġfc C +BA J +BA QE +RA H +bc x +bc ub +bc dfghjk +archive End +234 24 +Ġrelease Times +ĠAnd y +ĠAnd res +104 97 +104 36 +104 28 +104 8576 +previous StepName +VS s +VS mF +ied liwo +enc Key +enc enode +Ġ256 0 +sl v +sl kE +Ġeven nia +ĠIs is +ĠIs Owner +ĠIs ADirectoryError +ĠIs MorePlant +ĠIs otropic +Ġworking Profiles +è¡Į æĶ¿åĮº +mn u +ali ke +Ġcp cor +Ġcp modelPath +Ġcp uidle +aper to +Main IP +Main loop +tan ta +æĿ Ĥ +Ġbr ng +ĠCode Type +ĠCode gen +ĠCode State +background Archived +Generator Type +person CareProb +Ġ~ * +Ġvo ir +Ġvo ices +annotation pro +Attribute Group +Attribute SubGroup +scheme Recalculate +Av min +Av max +Av KF +Av Slope +Av ionics +OW ELS +cir cs +Instruction Format +LINE ITEM +Ġfreq TileTab +Ġes idfile +Ġes colas +Ñĩ е +ĠMat hew +phi Max +phi TotalSurface +Ġobs co +Ġobs file +Ġobs map +CF N +CF String +RS R +RS IT +RS qV +ji C +Ġteam Dict +Ġteam Turn +protocol version +protocol IEs +Role Need +Ġcamera Matrix +raft sman +ÉĻ m +ÉĻ n +ÉĻ li +ÉĻ dÉĻ +ano ia +ano va +vertex Id +ĠDEFAULT NAME +Ġdump er +Ġstatic v +It ot +It ESProducer +Ġpt ot +Ġpt clouds +Ġpt AfterCut +amb ari +amb lin +ENS URE +Bal d +Bal timore +01000000 0100000000000000 +ĠBSD Painter +Stat Key +ĠSequence Model +ĠSequence Labeling +(', '). +915 06 +915 23 +915 77 +915 985 +915 5205 +LV V +LV r +ĠToken Identifier +ĠToken Account +ĠToken Generator +ĠToken Metadata +ĠToken Close +ĠToken Verify +COMM UN +87300948 11 +RC N +RC NR +RC URLY +kind le +Ġsn cosmo +Ġsn lds +ĠMulti class +ĠMulti Dict +ĠMulti Point +ĠMulti Label +ĠMulti Array +ĠMulti Process +ĠMulti Box +ĠMulti Action +ĠMulti Che +ĠMulti StepLR +ĠMulti lingual +BI H +emp ID +emp orary +Ġflat lib +Ġflat tens +Admin Mode +Admin Role +Admin Dashboard +ffff ffffff +)") ') +calc Obj +2006 10887 +Fail Count +PA W +PA x +PA IGN +Ġscan Layer +Ġscan plan +WH DB +WH ICH +Attr List +Attr Dict +Attr Item +Attr Tags +Ġ"$ ")) +Ġna virice +Ġremoved Files +udi os +ĠBY ear +è¦ ı +Post ing +Post Rt +Ġtab f +Ġpkg name +Ġpkg basename +lec ito +lec tively +Ġps if +Ġps min +Ġps max +Ġps ifs +pher ic +ĠGL double +ĠGL ushort +Scalar Sigmoid +åĮ ¿ +Ġcer es +Ġcer tool +Ġcer tificado +人 éĢģ +人 æķ¢ +Can ary +Can isius +Can BeRead +Ġremote Port +Ġremote Logging +ATT AG +ATT GGT +ATT ACTTT +Ġtz win +Ġtheta Dt +TEXT URES +¡ółģ ¹ółģ¿ +¡ółģ ©ółģ¿ +¡ółģ ªółģ¿ +Ġ@@ @@@@ +Anal ysing +ced ent +Ġrotation Dir +GER ENCIAR +Url Path +\' ") +\' ". +ç½ ² +Execution Time +Execution Result +Execution Settings +Ġ'" ')) +Ġ'" {}{} +Ġcoords Array +ĠDataset Names +Fin land +hub ot +fixed Buffer +fixed TimeStep +WORK S +WORK ING +[[ ({ +members Online +ĠAs semb +Ġdocs Cable +median Radius +Cre w +Cre ando +Tri mesh +Tri emli +Ġbig String +Ġbig RD +Ġbig qvd +æİ ¢ +æİ Į +Ġinner Node +Ġinner Val +refresh Mode +Ġadjust s +ä¸Ń è¯ģ +ä¸Ń åŃĺåľ¨ +ä¸Ń åĩ» +ä¸Ń 央 +Any one +Ġpp f +Ġpp anmy +00101 01 +00101 0101 +00101 010000 +00101 01001011 +00101 011100111111 +000101 000011 +Loop Type +Loop Data +Loop List +Loop Iteration +Current Role +bri an +bri ties +pet store +137 84 +137 75 +good Features +good wife +good hertz +åľ¨ 线 +åľ¨ è¿ĻéĩĮ +åľ¨ æµĭè¯ķéĽĨ +dz do +Ġgood List +ned y +ĠIO D +ĠIO HW +åıĸ ãĤĬ +217 74 +CN TR +uk ha +sender Id +117 25 +ĠStatus Reason +232 832 +ae b +yg win +yg Wi +ĠON VIF +297 94 +DQ y +DQ wN +DQ NTorch +Ġarti ficially +solution TextWithoutDot +567 66 +XXXXXXXXXXXXXXXX XXXXXXX +:], ( +="" . +DT iles +DT Ms +DT CTRL +Real MemoryTrap +elem Conn +elem nts +km en +km yn +nr ul +Ġmis leading +shuffle Algorithm +ов а +ов оÑĢ +Ġbn lp +ĠMax Feature +Arg Min +Arg ListContext +bert config +gri mm +gri ffin +det thresh +det rended +AI Y +Ġmag ent +Ġmag ick +Ġmag Field +Ġmag ical +Ġmag limit +Ġmag netis +197 11 +197 95 +Dep Time +Dep ending +push d +push er +push string +Ġdisk less +301 552 +301 95287 +301 67337 +YY A +åĨ © +åĨ · +ëĭ µ +ëĭ Ń +ĠGraph Win +Scale form +Scale Draw +$$ ( +$$ ", +Last Offset +Last Examples +Last Focus +Last Related +Last Comma +Last PresentCount +Ġsyn tac +Ġsyn ctogit +Nodes ToLink +Stop Time +Stop Price +Stop Deviation +dn Y +dn ic +dn ld +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ +Ġpercent OfBombs +Queue Runner +aur ora +௠Ģ +Ġregex Content +114 12 +118 17 +---------- ') +ĠPrint Exception +165 15 +Extra DHCP +Ġpur ging +Ġpur ges +Ġpur sue +Ġgrad loss +Ġlight bg +Ġlight bulb +906 3 +906 74 +906 307 +906 7777 +906 2603 +geo data +geo api +geo location +ĠModule Logger +ĠModule Compiler +åĩº ä¸Ģ个 +åĩº ãģĻ +åĩº åİ» +åĩº åıij +Ġsol entware +lookup Transform +032 1 +032 8 +bp name +hang ing +hang man +åİ ĺç±³ +Ġsy metric +Ġsy nthe +Ġsy nthesise +Ġsy nple +Ġem scripten +combin es +combin ers +Space Trap +Space Pressed +Bot s +Bot Api +Gen ex +Gen omic +Gen Vect +Gen TaskParams +SY nJ +Ġfe h +Ġfe il +share y +share dir +share point +share dblock +INTER FRAME +Ġtasks instage +emb re +emb ark +Ġns wer +æķ°æį® åĪ° +æķ°æį® åĴĮ +rotation Type +rotation Id +rotation Pivot +Job Manager +Job Operator +Job Definition +Job ListDO +Header Format +Symbol List +border less +men ción +men fas +pin hole +pin hu +¬ółģ §ółģ¿ +¬ółģ °ółģ¿ +stit o +113 05 +113 85 +ensemb F +146 85 +146 97 +Ġprocessing Time +905 0 +905 1 +multip liers +Ġmanager access +cam id +cdbp Realm +sur a +sur ro +vie ss +167 38 +167 31 +Ġsur prising +ĠWith draw +ĠService Config +ĠService Types +ĠService Registry +ĠService Now +Cluster Builder +Cluster Grid +Cluster CollectionTag +hw a +hw path +hw sku +hw nds +squ irrel +}_{ ( +begin time +æĪIJ æľ¬ +Bind Flags +ĠMin Step +ĠMin LR +ĠMin eral +ĠMin Neutral +registry mixin +6666 67 +6666 666 +Dig s +RM synth +flip Layers +Ġir rigation +Ġdays OfDifference +Ġcondition ally +ĠVAL IGN +Bytes Throughput +Bytes ToCode +AK I +AK i +AK IYQQ +AK TIF +ĠÑģ ов +ĠÑģ ам +ĠÑģ ÑĬ +ĠÑģ иÑģÑĤ +ĠÑģ Ñĥм +ĠÑģ оÑĢÑĤи +ssh fs +ssh Port +ssh PrivateKeyFile +ĠPyQt Visa +CAR edu +Host Address +Host Caching +Host MacAddress +Host Maddr +Schema Exception +Ġfl tr +Ġfl Contents +Ġfl ushes +ĠParameter Expression +Feature Data +Feature NotImplementedError +Feature ListResource +VM s +VM ULL +VM VN +VM CTRL +VM Icrtl +micro service +syn spec +syn scapes +ĠMO File +ĠMO Pool +zo la +136 24 +136 95 +136 3303 +Sequence Generator +Sequence Matcher +ãģ® æķ´æķ° +ãģ® ãĥĹãĥŃãĤ¸ãĤ§ãĤ¯ãĥĪ +course ware +HW zm +Stack Status +Stack Size +Stack Idx +bre ve +Ġ(% ) +Ġ(% )") +('< '): +("[ ]") +ĠInvalid Address +ĠInvalid Usage +ĠInvalid RSE +Ġagg Keys +Left ToPlace +gm res +ios a +ú i +phone metadata +company Name +DIRECT ORIES +svg path +Application ScopedVolume +Ġelem cat +ĠWeb App +ĠWeb portal +ĠWeb Mirror +ĠWeb DAV +specific ally +Ġinspect utils +106 167228 +äºĨ ä»ĸ +äºĨ ä¸Ģ次 +('[ { +('[ {" +('[ ')[ +('[ ')] +('[ $] +ĠFind Family +([]) ; +([]) ): +../../ ') +../../ ../../ +fb j +ü p +ü st +ü nt +Ġaudio list +Ġaudio files +Ġaudio chan +sci are +134 92 +Factor Max +Factor ial +har dest +har vs +har isekhon +ر Ùī +ر ابط +ر ائ +(". ". +ĠSimple Recorder +ĠSimple ReplayBuffer +ĠSimple TestState +hn Id +ĠCur ves +ĠCur ving +ĠCur tin +ĠPri sm +Encoder WithAction +ä¸Ĭ å±± +ä¸Ĭ 端çİĭ +lb W +lb ry +lb oro +contract URI +ĠSave Name +ĠSave User +NET CONF +NET MI +NET SEQ +Ind onesian +DP ARTY +Ġ================================================================= ==== +Ġ================================================================= === +119 648 +ĠFil m +ĠFil led +Env var +Env Config +Ġprovider Node +Ġshift Dict +Ġshift states +Ġshift amount +ĠWITH IN +299 55 +299 67 +Ġ\" $ +Ġ\" ' +Video Path +Video Dataset +student login +Ġrec bole +Ġrec tifier +ĠCan onicalize +ĠFI FTE +HA w +HA wkg +ever note +ever green +Ùħ ز +11100 011 +ĠMock Logger +ĠMock Token +ĠMock Vault +ĠMock AsyncSession +ĠRelationship s +904 373 +LP SC +verify Host +Ġhistory Range +Storage Level +Storage Policy +Storage Helper +Storage Keeper +984 4 +984 156 +984 436 +984 855 +984 8900586 +Ġ"[ { +Ġ"[ ]" +Ġdecode Generator +saved Path +saved Posts +Uni CMSCreateUpdateSerializer +!= ',': +DK K +cum b +cum l +cum m +ä ne +ĠItem Type +ĠItem Desc +proj ec +should n +should run +857 753 +Parameters List +DIM PACT +OC J +ен ем +ен нÑĭÑħ +Ġpredicted Measurement +Ġč ĊĠĠĠĠĠĠĠĠĠ +Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +sell Price +ARG ENT +calculate NN +calculate NumberOfMonths +market er +market price +BY J +BY PASS +BY JB +934 07 +195 2446 +primary Extension +primary InPort +primary OutPort +general Dict +flu ff +Offset Pointer +//////// ///// +cube list +gc ct +gc no +gc Time +gc Di +gc HA +ceil C +00000100 0101 +00000100 0100000000 +ATED OWN +Ġdetect em +ä¼ º +visit Array +visit ValueType +visit Assign +letter ing +letter atura +letter Combinations +letter ToIndex +ko z +ko ji +Ġba map +activation Configure +Ġvs xml +pkl ID +åħ¥ å¢ĥ +åħ¥ å¸Ń +Fla re +Fla ke +ĠConvert ed +Configuration Parser +Configuration Descriptor +Configuration Controller +Flow Name +Render Targets +dw y +dw Cookie +ê me +Ġfs name +serve Pref +serve Prefs +trip comp +trip detail +trip lets +Style Multiline +212 45365 +896 3 +896 6 +Mesh Data +Mesh Topology +nav n +nav itron +ye on +ÙĦ ÙĬ +ÙĦ غ +ĠPerson a +ĠFoundation Plist +Ġ99 3 +Ġ99 6 +ĠBe es +ĠBe ast +ĠBe come +ĠBe zier +ĠDataFrame Row +LR Z +FS j +Ġsquare Sum +Ġsquare YPos +corr num +corr ugation +Print Info +Ġut l +Ġut ts +Ġut ente +Ġut chours +Ġut worzyÄĩ +Ġbad cols +ĠTask List +ĠTask Group +ĠTask Result +ĠTask Spec +ĠTask Identifier +Ġhyper link +Ġhyper edges +Ġhyper wires +Ġhyper helpcore +boolean Expression +Ġswitch point +Ġswitch mng +908 3 +908 75 +£ółģ ²ółģ¿ +£ółģ ©ółģ¿ +Ġband Max +Ġband Mean +Ġband Std +ANS ION +ĠRemove Empty +ĠRemove Weak +347 99 +347 94 +special ties +special Vars +Ġgeo data +Ġgeo spark +Ġgeo spatial +SERVER INFOREQUEST +SUB DIR +SUB VERSION +SUB EV +SUB TAGS +SUB SETS +SUB SAMPLING +pot s +qs V +Ġdue t +Ġdue lee +Ġdue AtSigning +without sep +MY NAME +MY DEVOLO +hyper mesh +hyper wire +hyper threading +hyper cubes +001111 10110 +ĠTable Converter +ĠTable Border +ðŁı´ółģ³ółģ ºółģ +âĶĮâĶĮâĶĮâĶĮ âĸĪâĸĪâĸĪ +:{ { +NT W +NT UB +ste en +ste al +ste ep +ste go +ste ams +327 88 +327 39 +Ġaddr string +IDENT IFICATION +Interval Time +Interval Scheduler +Interval Upper +Interval Lower +Interval InMilliseconds +EP ICS +Email View +Email Server +Email Password +Email Username +Two Numbers +UK F +UK t +UK MO +UK hg +UK IDSS +lar va +éģ µ +éģ ł +Ġnone access +Ġmid points +prote ctor +157 02 +157 75 +157 4428 +0111 000000111 +ĠCompute Device +Linear Mapping +Linear Locator +hit ters +hit ting +hit achi +panel review +dialog Search +")[ [" +Dete cts +Rest Api +Use Type +Use ViewSet +Cor responding +Cor respondence +Cor ridor +Call Next +Call ByClass +slug name +Ġnd ar +mas con +mas cher +neighbor ing +Ġgeneral Match +variant Set +DC B +DC URSOR +DC ameraServer +ĠSP ICE +304 033 +304 6786 +sup erimposed +tcp dump +tcp SerSock +monitor ID +xyz cal +xyz zy +Import ConfigName +Import Suitable +Pr pp +XY WH +144 83 +148 975 +small size +Ġnu ssl +Ġnu fission +Ġdp dx +ĠSV HN +Rot ated +pur ify +pur ges +pur ities +pur due +ä¸ĭ ä¸Ģ个 +ä¸ĭ éĿ¢çļĦ +ä¸ĭ ä¸Ģè¡Į +Display able +Price Response +Price Resource +Price Alert +õ i +õ eo +sto pper +Ġair test +Ġair play +Ġinline Translations +fw f +fw LSConnState +INST IT +INST ANTI +Agent RegistrationRequest +Global LB +Global AutoK +dem ics +("{ },{},{ +ĠInt ense +ĠInt ended +ĠInt Arg +186 25 +Standard Sql +Standard Robot +Standard QueryParameters +424 93103 +Ġmet amodel +'}) [' +'}) ]) +397 0 +stick ied +("{} - +ĠOp A +Debug ging +Body Text +EY A +EY R +EY l +EY ES +EY lE +Ret ail +mx len +filtered content +filtered Torques +537 4 +IGN ORES +Ġsym bo +Ġsym table +ĠSum mar +ĠSum mation +ĠSum OfBeta +actual GroundGHI +>' ; +Title Cat +Title Opts +Ġrefer ance +Ġrefer ential +еÑĢ ов +allowed Exact +sens ores +coeff OrTrig +194 33 +WA U +Connect ors +177 867 +177 66177 +operation Filling +FQ s +Right Hand +Ġcc cs +Ġ"' [ +Ġ"* "}}) +åĪ° ä¾Ĩ +åĪ° æĸĩä»¶å¤¹çĽ®å½ķ +pod aj +Ġden ite +åĪĨ åĢ¼ +åĪĨ 段 +åĪĨ åİĭ +åĪĨ ç»Ļ +Helper Fn +inc arn +inc Op +unpack er +ĠNorm alizes +ftp d +ftp lib +ftp wrapper +¢ółģ ¹ółģ¿ +¢ółģ ®ółģ¿ +¢ółģ ©ółģ¿ +¢ółģ ¢ółģ¿ +¢ółģ £ółģ¿ +¢ółģ ¨ółģ¿ +æ³ ° +æ³ Ľ +ĠCustom ization +ĠCustom Entity +ĠCustom izing +00001111 0000000011110000111100001111 +APP FW +Channel Class +Channel ZS +Channel Subclass +Channel BatchUnlock +Controller Manager +Div ine +Div orce +echo AndDie +nz px +Template View +gw G +gw f +station Number +station Dict +Ġ'* ')) +Ġaz s +Ġ({ : +Ġ({ ','. +maker dao +ĠEd ited +ĠEd itable +Shape file +Shape Function +Shape ShadingEngine +Ġé lect +Ġé té +ĠDynamic Model +DATAB AR +Software SourceCode +964 1 +964 85 +964 74 +964 039 +ĠĊĉĉ Ċ +Ġnor mais +156 37 +156 96 +pdb s +pdb Id +ĠPost ThreadMessage +beam formed +################################################################################ ### +################################################################################ ############### +=', '); +Api Object +Api MethodInfo +VK q +dark style +Ġfri da +cod as +cod ons +ÑģÑĤ ок +287 72 +287 226 +Meta Path +Meta Class +repeat last +007 8915584 +Ġann as +187 99 +187 88 +Ġв о +tweet Trump +tweet Feder +tweet Mercedes +vin ator +Ġdetermin ar +ĠBlock Model +ĠBlock Request +ĠBlock Header +ĠBlock Metadata +ĠBlock Headers +Lin n +Lin ode +Lin ha +OFF SHOOT +Usage Plan +Ġĉ ĠĠ +Ġtxt file +Ġtxt Col +Ġtxt ai +Ġtxt area +Ġtxt Literal +Expression ParserInfo +Ġpipe Flag +907 216 +907 072 +HI y +HI RE +OO D +OO FErrs +SAM ME +ki lobytes +Ġphase Type +MR K +MR iN +MR iO +[] ')) +ĠBuild ings +1001111 01111 +1001111 01001101 +174 0699 +-> ~ +HD G +HD t +HD ly +HD MLX +Ġflux s +Ġflux err +Ġ105 0 +Ġ105 2 +Ġstock Num +Ġstock multiply +023 12 +Ġneighbor Values +ĠQuery Rule +ĠQuery Dataset +Ġdesired Face +Ġbg nd +ĠAnal is +185 05 +185 44 +Select Field +Select All +Ġec codes +parametri zed +Ġshared X +Ġshared ContextCache +Ġshared MemToNumpyArray +Resp ons +Resp iratory +Poly lines +Poly Map +Segment Model +ĠDefaults Flex +Ġletter Match +Plugin Error +Scre ens +Ġí ĭ +Ġí ıīê·ł +()} ): +()} ), +()} ). +()} ," +'> )", +'> £ +/* { +/* /* +Cla udia +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ +via U +Ġprimary field +0000000000000000000000 4 +EVENT NAME +war pbreaks +ĠSci ssors +ĠCar to +ĠCar regamento +ĠCar teira +apis ervers +Ġali ke +ĠStorage Policy +ĠStorage Api +?? ?\ +Callback List +HTML Report +Su ffered +sound Tab +sound Beep +Ġxs min +Ġxs dbserver +097 08 +097 43 +Arr Time +Cat Sim +Cat alyst +Day ton +Day Price +Day Volume +Day Since +MON DAY +Sm iley +bz t +bro j +bro ck +bro chen +bro oks +arrow Border +Ġbro kers +Ġhard ly +065 15 +ĠLin AlgError +346 17 +346 75 +executor Id +ĠDisplay DriverMemoryInfoV +ö ö +Ġai om +Ġai obotocore +Ġai owork +('{} // +ĠTag API +ĠOper ações +ĠOper atableStateMachine +937 43 +918 199 +918 1937 +918 2363 +918 3179 +peg Writer +Ġgs cond +ĠGrid World +ETH NIC +ETH ForExact +æĸ¹ ç¨ĭ +ä¸Ģ个 æĸĩ件 +åĴĮ ãģĮ +åĴĮ åĽ½ +åĴĮ 对åºĶ +åĴĮ 微信 +Estim ating +zM wM +Ġcam d +Ġcam ada +Ġcam OffTimes +ĠCloud watch +ĠCloud Provider +ĠCloud Monitor +ĠCloud Runner +ĠCloud Passage +997 09 +935 47 +935 179 +947 24 +947 97 +947 36 +947 23 +Root chain +Fore ver +Qos TrafficClass +]; ', +review ers +Ġtele fones +ĠParse Result +ĠParse TotalRowCounts +以 æĬ¤çħ§ +以 身份è¯ģ +mous i +Measurement Info +Measurement Process +Measurement QueryBuilder +NODE AVAILABLE +986 7 +986 8 +986 934 +986 895 +986 686 +BIN WALK +RT D +RT ROI +RT qd +elf are +ĠTree Pars +nost i +ĠINT ENT +Ġoccur ance +,:] - +,:] / +,:] [" +932 2 +932 9 +sun os +sun xia +timent o +ĠTop lice +anger ed +Db D +Db apiDescription +Lock Time +LIB SUFFIX +VA O +qq p +qq mixed +ë¡ ł +__() [:- +Ġ\\ . +Ġ\\ """ +ACL ES +ĠDictionary Of +Mer ges +Mer cury +Wi E +Ġ85 218 +Ġcum w +Ġsoft sign +Ġsoft boxen +ĠComple to +Assignment Operator +Assignment TestMixin +ĠQueue Config +Imp ar +Imp recise +Ve h +Ve z +Ve ga +Ve getable +ç± ¤ +Ġê ± +Ġê µ +utter rance +construct s +Ġconcat Interests +ĠVm caCer +weather store +Pipeline Name +408 796 +XML Porter +pace d +repe tir +Ġspi o +fire db +fire brick +fire fighters +asm DataTable +verti do +Acc Mag +оÑĢ оÑģÑĤ +åı¯ éĢī +åı¯ 访éĹ® +AZ Account +AZ DL +AZ ANGLE +Basic LSTMCell +Basic BucketClient +Volume Parser +Volume Trap +Void Message +Äĥ l +Äĥ Çħ +ĠRES OUR +ĠRES TRICT +ĠVM SS +ĠVM Ware +aud acity +CUR RIC +CUR TSIES +aco tes +pv x +¤ółģ ²ółģ¿ +¤ółģ ®ółģ¿ +Ġcity Schema +Ġcity scapes +ctl Name +ctl Set +ĠAction Table +ĠAction Types +collections Enriched +Ġpeer topeer +ĠTemp C +ĠShow Platform +ĠShow Dot +ĠShow ProcessesCpu +mr rank +mr trix +Ġwall Count +ĠDire cted +ĠDire cao +rights List +946 06 +946 08 +[:,:, _], +892 06 +892 242 +Kp W +Kp Z +Kp FG +QA u +dT dx +dT rump +deep learning +Ġbind callargs +prof Activation +æĸ° ç��Ī +autog bt +ĠпÑĢ оÑģ +ĠпÑĢ ил +opp ortunities +Ġcoord file +population Dict +687 9 +687 95 +687 895 +hu ahua +symbols im +ÑĨ ÑĮ +()[' __ +048 35 +048 320 +048 32295 +smart tab +CG emv +CG ACCAGC +CG ACATCAT +MED ICATION +MED ICAL +Non Used +Non Commercial +Non AdiabaticMSWH +Non PenaltyGoalsP +Non UniformResourceIndex +Wq x +å¿ Ļ +Ġada grad +Ġmol list +Car l +Car la +Car regamento +Ent ree +Ent rez +RAN KS +RAN Linelist +gd ala +deleted In +rack hd +Ġones pace +å¾Ĺ ä»ĸ +Ø§Ø µ +Ø§Ø ¬Ø¹ +æĸĩ件 æľĢ大 +Bad ge +Bad Value +Bad Argument +cancel Button +cancel Duration +Ġang strom +Ġtt Lib +Ġfire cracker +ATH ABLE +Ġanchor Fields +sky lake +Ġregist radas +0101011 0101101 +circuit point +circuit location +circuit region +ĠdocsLoadBal SystemGroup +ĠdocsLoadBal ParametersGroup +ĠdocsLoadBal PoliciesGroup +ĠdocsLoadBal BasicCompliance +Ang ular +Ang ulo +Ang Vel +LAN CZ +fv IT +fv KT +ĠTry Class +Ġprojection Location +ĠXML Parser +912 5743 +912 9897 +BN yx +rho i +Ġ86 3 +Ġ86 9 +Ġ86 59 +Ġ86 52 +Ġ86 62 +Ġaux ili +Ġaux illary +Ġemp has +Ġemp iri +Ġemp loys +ĠTF Bert +ĠContext Field +Ġatoms PerUnitCell +Resources AWS +ĠView shed +Features Handler +pw linear +pw ned +æĬ ± +æĬ ĸ +Ġbon ne +Ġbon asu +Ġbon ferroni +998 38 +Ġ56 250 +RESPONSE WRAPPER +Ġgpu Id +ADD PODOPTIONS +«ółģ µółģ¿ +«ółģ ©ółģ¿ +«ółģ Ńółģ¿ +«ółģ ¢ółģ¿ +«ółģ ¨ółģ¿ +Ġmi ke +Ġmi xbox +ĠUsing Redis +ĠConnection Pool +ĠConnection Failure +ĠConnection ResetError +ĠProperty List +swap ped +swap ETHForExact +Ġfraction ally +Ġfraction Expression +ĠRGB Image +Detail Text +Detail Info +Detail API +Detail Serializer +BatchNorm Dropout +Ġsr index +Ġmarket place +DN ASE +DN LD +FROM VER +Pattern Tokenizer +Pattern Django +Pattern MatchingParameter +Ġtail Height +ĠCall er +ĠCall Node +subscribe CallingSearchSpaceName +working Dir +Ġcurve NodeIdx +Exit Stack +од олж +Ġsafe str +customer Encryption +Ġtruth y +åĬł éĢŁåº¦ +åĬł ä¹ĺ +Limit Error +ĠLayer WithObservations +Syn opsis +Syn TagRus +dg msolver +wik ipit +wik icreole +Properties Response +Percent Dir +Help Command +Help Author +Dele t +Dele ter +Full Column +Full Info +Full Batch +Full Verkey +SR D +SR N +Ġtm st +Ġtm os +Ġtm Items +Ġtm Funds +Ġtm FAH +Ġtm IAH +lem ens +Ġflu c +Ġflu ent +035 257 +035 13016 +ĠKe en +ĠGenerator Exit +ãĥ³ ãĤ³ãĥ¼ãĥī +èĩª è¡Į +èĩª ä¾Ĩ +èĩª åĭķ +Pod List +PRI O +kn it +kn BNyx +rg bs +Ġcpu list +Ġcpu info +ĠReference Type +Ġquat T +Ġquat ro +Ġquat MuseAlg +Prefix List +Prefix Pattern +Refresh Dict +Refresh Count +Backend Config +Ow l +Ow en +PM U +PM table +PM wp +PM ANDCloudy +hb Y +hb Que +hb HN +hb TradeQue +hb Gci +çº ª +Ġwar to +ĠSupp ression +Notification Settings +Notification Translation +Notification Hub +Notification Listener +Pitch Tier +Qq E +Qq PR +mime bundle +ç´ Ħ +ç´ Ļ +seek ruid +Ġrl lib +Ġrl bot +SSL v +æİ¥ åŃĹ +æİ¥ çŁ©å½¢ +fj Q +fj z +hg M +hg ta +hg che +hg cal +hg nn +éħ § +Ġ95 9 +Ġ95 134 +Ġmen ubar +ĠPY TH +ĠPY PY +ĠPY TORCH +ĠPY NQ +ĠPY SLAM +Material Analysis +Material GAN +Material Editing +ä½ľ ä¸ļ +ä½ľ ä¼Ļä¼´ +357 2 +Cfg Path +Cfg Resource +zA aj +ìŀ ¡ +los ive +three fold +Ġvtk Renderer +Ġvtk ContourFilter +Ġcolour Def +Ġpyg plates +Ġpyg acal +material Index +Ġcached Pages +Operator Base +Ġll x +Ġll type +Ġll nl +Ġll Tr +trust s +Ġseen Patterns +ĠUN ITED +ĠUN IMO +ĠUN TRUSTED +344 96211 +XL j +XL Net +gain ed +nv vm +nv tabular +ITEM ALERT +åŃĺ åħ¥ +ĠLOG ICAL +Ġaugment or +hard coded +ëĬ ĺ +ĠBu at +ĠBu enos +Ġ57 05 +Ġ57 997 +REPL IC +REPL ACED +Region al +Runtime Message +度 æĬ¥åijĬ +Pub lishes +Qy WT +Qy KR +Qy AQ +due t +guid ing +Ġaio files +fixture name +ĠSw elling +ĠSw itchover +ĠSw eden +ĠSw armController +ĠAT NDeserializer +995 86 +055 48 +compiler Common +Ġд аÑĤ +Ġд аг +Ġд еÑĦ +Ġд иÑĢекÑĤоÑĢ +Ġд окÑĥменÑĤ +Ġevalu acio +Scene View +Flags Trap +Flags ToCheck +902 37 +fbx Time +fbx Manager +fbx Property +fbx Layer +hop shdfs +Ġresize Amount +('{ '): +Ġcoverage Statistics +Ġcoverage eligibilityrequest +çĤ¹ åĽ¾ ++') \ +Cent ers +Cent ralized +SF PU +She bang +hc Lr +jj T +ìĹ ħ +Ġuid l +335 22 +335 87 +iteration Drop +åīį 端 +åīį éĿ¢çļĦ +Handle View +WC Q +WC MA +\"> & +°ółģ ²ółģ¿ +°ółģ ¬ółģ¿ +editor config +Ġhighest High +need les +965 04 +965 46 +965 353 +SCRIPT COMPONENTS +ĠAddress able +ĠAddress Family +numeric ally +numeric Keys +ĠLinear Anneal +ĠLinear SVR +Epoch Based +Pick up +Qi E +Qi qV +Qi LCJ +α Ïĥ +α ÏħÏĦÏĮ +rab il +rab ble +rab bits +ĠSUB MIT +ĠSUB MITTED +ĠPe pper +000011 10 +ĠOSI soft +Ġcomb is +Ġsky tools +cpwVc MIB +使 ãģĨ +ä¾Ĩ ä¸Ģ +ä¾Ĩ æĪij +ä¾Ĩ æĻĤ +ä¾Ĩ æĿİåIJī +ĠWindows Utils +Save User +Save Start +Save Screenshot +gent oo +mult sB +zi Info +Ġrev Anneal +outer Mask +ĠDI FFER +Ġonto logies +037 84 +037 35 +ROI Pooling +ROI coordinatesPath +ĠBoolean Choice +dra ugiem +wa cont +Ġalt type +Ġalt Row +)? ') +)? )? +Agg lomerativeClustering +pf ings +pf ams +pf ClusterBuilder +Ġtex ar +Ġtex id +Ġtex filter +Ġtex coord +Ġdropout s +Ġlb time +traj index +265 24 +265 21 +265 024 +еÑĤ ей +еÑĤ ÑģÑı +Transfer Event +Transfer Setup +ĠTraining state +ĠTraining Events +CPU æł¸ +CPU AccessFlags +Pixel Shuffle +rn vp +Ġmm db +077 86 +Ġled State +Ġи Ñħ +TODO S +éĹ´ çļĦ +899 84 +GP V +GP X +Hash ing +Hash ShelveTestCase +SIM ILAR +SIM ULATIONS +SIM ULTANEOUS +Timer GetElapsed +cisco Experiment +cisco TrustSecPolicyMIBCompliance +anim ating +Ġchem spider +Ġchem icals +646 13 +646 09 +Ġ"," _") +请 ä¸Ģ次 +请 æ£ĢæŁ¥ +请 åıĤè§ģ +Raw Log +Raw Image +Raw Socket +mz Z +mz d +mz cu +mz tab +mz btg +yu Parser +yu Ry +yu Uy +yu Rw +yu anshe +©ółģ ¡ółģ¿ +©ółģ ¬ółģ¿ +©ółģ ¤ółģ¿ +may day +ĠTri ad +ĠTri angular +ĠTri ggers +ĠTri mming +ĠBinary TreeNode +ĠBinary ObjectFileName +ĠBinary ObjectFileTypeCode +ĠBinary Relevance +ĠBinary OperationExpression +SEQU AL +875 64 +977 98 +977 953 +calcul ators +SIG PIPE +ĠMethod Wrapper +ĠMethod Meta +ĠMethod NotAllowed +ÙĬ ÙĨ +ÙĬ ض +Ġ92 0 +Ġ92 1 +Ġ92 6 +Ġgym nast +018 32878 +075 32 +scaling Pivot +ĠApply In +Permission Error +Permission Set +åĽŀ æĸĩ +åĽŀ å¤į +åĽŀ çŃĶ +Ġcatalog List +La AlO +OG F +blog Nb +zs L +zs x +å¥ Ķ +ç« ¥ +ç« Ł +ì§ ķ +alloc a +alloc s +alloc ating +Ġnav igable +Ġnav igating +Ġnav itron +Ġgd cmdtools +ĠLink Error +ĠLink OrCopy +phys ionet +phys iological +ĠGaussian State +ĠGaussian LatentVar +REM OT +957 64 +957 09 +957 94 +957 67 +957 157 +302 22 +045 19 +045 85 +045 42 +plate Charge +plate aus +913 03 +Uns upport +tls v +éĽ ¨ +Ġray Direction +osa Code +ĠEmail Str +ĠInst al +376 35 +376 3259 +ĠExp ansion +ĠExp ensive +Shader Compilers +ç±» æł·æľ¬ +'$ ^ +Ste fan +Ste vens +WIN API +WIN NER +hh BBC +è g +015 1917 +Ġha as +Ġha ha +Ġha uteur +Ġha usdorff +aug avpils +Big ML +Big Wig +KB a +you gest +('" {}" +Ġdeep lab +Ġdeep sv +Ġdeep speech +927 12 +927 75 +ĠHome Matic +Center Of +SPE AKER +vk Value +vk String +vk ontakte +Ġpv Name +Ġpv Controller +Ġcond ensation +Ġcond ensate +Ġprep ped +åĽ¾ å½¢ +tEXt Software +èĢ ¦ +geom data +lista Low +lista Close +Ġ46 08 +Login Manager +Processor Info +Move it +Move Rects +Move ToolRel +Move InWith +ê°Ģ ìł¸ +Copy Util +ND L +ND h +ND AP +ND Array +ND pd +ND HWC +ND Interpolator +Snap Period +ongs ang +repos adocommon +arth ikk +ĠPR NGKey +irt If +776 946 +776 1571 +ĠJob Runner +ĠJob Browser +оÑĤ о +оÑĤ кÑĥда +ĠBlueprint s +909 1 +Cosm os +IJ B +IJ VK +IJ PJ +Sq Y +Sq WC +TARGET ID +Ġpts L +ĠCer tificação +ĠApi Response +ĠApi TypeError +vertical alignment +Ġstand off +Measure Channel +OVER VIEW +SG F +SG amut +SG MLParser +}$ , +}$ . +}$ | +}$ ^\ +}$ )' +}$ -$\ +åŀ ĵ +Camera Display +Inser ter +034 75 +034 35 +034 23918 +034 7761571 +Setup EndEvent +EB J +EB M +EB ITDA +pause Bool +rer oll +rer uns +çŃ ij +çŃ IJç§ijæĬĢ +0002 01 +0002 832 +0002 32788 +Ġsong Name +Ġlost limit +SIGN IN +ï¼ī ", +ï¼ī ï¼ļ +HEADER SIZE +312 77 +312 644 +QC dir +QC AL +QC GEEE +wu Vw +Ġ97 0 +Ġ97 1 +Ġ97 6 +Ġ97 8 +876 55 +Ġgeom s +Ġgeom lib +Does nt +FILTER ED +BT ST +BT STR +Bin der +Bits Type +å§ ¬ +æ¨ Ĥ +Ġsens itivities +ĠUUID Field +================================================ ============ +================================================ ========= +Ġdigit ada +Ġdigit ação +Ġentire ty +bio io +bio containers +persist ing +Ġpull Secret +Ġsd scli +Ġ104 1 +Ġ104 3 +Ġ104 15 +ĠARE A +trunc norm +phot HI +257 05 +257 55 +257 66 +CHAR MM +CHAR SET +**************************************************************** ") +911 0762 +Diff List +aG hp +aG pq +xC c +xC eleb +xC ircle +mapp s +ĠAWS HelperFn +99999 85 +99999 74 +99999 78 +Byte TxRx +AUT OL +AUT OP +AUT ONOM +kE w +--------------- ") +ĠBig World +epic enter +ел овек +"% _ +Bridge Adapter +åĿ ¡ +åĿ ij +ìł ij +Ġsil x +Ġgc graph +Ġgc mt +ĠProduct Data +ĠProduct Doc +ĠProduct Attribute +communic ability +Ra id +Ra fael +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +("../ ..") +ĠFloat Field +ĠFloat SampleRate +ĠFloat OrIter +ĠFail Stress +ĠFail Strain +Ġ67 103 +ĠReport Lab +ðŁı´ółģ¢ółģ ¨ +ðŁı´ółģ¢ółģ ®ółģ +ĠRegister ing +ĠRegister FirstArgument +Stock Code +985 34 +985 916 +985 364 +985 645 +985 954 +985 453 +>| < +QS ortFilter +few shot +sser ocr +chip seq +Ġ72 10 +ĠAut orefMarker +Progress Message +Progress Selected +ĠKEY FORMAT +Threshold Policy +Threshold Percentage +Threshold Comparator +Ġsupervisor ctl +mZ l +mZ mb +Ġsqu irrel +ĠVector ized +ĠVector EncoderFactory +works Algorithm +975 95 +Note Object +ĠKeyboard Entry +guide lines +CSS List +Den nis +Vq v +Vq xY +Ġcd ci +Ġcd base +Ġcd Type +ĠFin alize +ĠVis py +ĠVis ible +ĠVis ibility +ĠVis icom +0001111 110 +Ġarm Ik +ĠTransform ations +ĠTransform Dataset +ĠTransform Runner +ĠControl lable +ĠControl Channel +894 9 +KJ B +KJ BJ +OX D +Sur se +Sur veillance +WF pa +quat ro +quat MUSE +ĠLE s +956 94 +Ġordered dict +Running After +Starting At +Extension Default +Cir klo +9214 22 +056 85 +374 75 +555 04 +Ġquick Swap +æľĢ ä¼ĺ +æľĢ åĪĿ +次 éĥ½ +次 è½® +次 ãģ®ãĥijãĤ¹ +åıĤæķ° éĶĻ误 +åıĤæķ° åı¯èĥ½ +Term StarContext +ĠGit Error +ĠGit Project +ĠGit Fetcher +ĠGit CommitLog +wee de +087 9726 +Ġshif tx +Ġqt pp +Ġqt query +Ġз ад +STRUCT S +STRUCT URES +PYTHON FUNCTIONDESCRIPTOR +第 ä¸ĢæĿ¡ +éģĵ é¢ĺ +BLOCK ING +BLOCK CHAIN +Clock Delta +EI o +EI GH +EI lE +Fire worksAlgorithm +Missing Transform +Year sIn +ej q +ej u +ej erk +èµ ¤ +èµ ¢äºĨ +Ġrecomm ends +__} '} +)); ") +,, ,\ +Bit mask +Bit field +Bit coin +Band Path +Band Cover +¯ółģ µółģ¿ +¯ółģ ®ółģ¿ +Ġcf ar +peak file +people Total +ĠSingle Point +ĠSingle Tree +ĠSingle MeasurementQueryBuilder +æłĩ 注 +Language Code +Language Property +wr V +wr ts +oracle id +Ġlargest Size +924 94 +924 8206 +CAL END +Lat via +Lat Lon +Ti ramisu +pwd Limit +resume SayAll +Ġdesign er +328 06 +328 55 +328 125 +JJ p +MAC s +Side Sets +emit tance +¨ółģ µółģ¿ +¨ółģ ²ółģ¿ +¨ółģ ¨ółģ¿ +Ġ94 4 +Ġ94 87 +Ġ94 1293 +live stock +live clientdata +Ġcook ed +ARB OR +dfs df +genet IC +Development Config +ĠComponent Spec +åIJİ éĿ¢çļĦ +ĠPool Membership +Selection List +Selection Point +(. +)\ +BD M +hint ed +æ® ĭ +Ġhad le +Ġdem angle +Ġdem angled +INIT IATE +Ġ68 25 +Ġ68 106 +ĠSequential Memory +.*? )(,\ +Deploy Config +Annot ToCoord +OH c +OH v +OH w +OH AA +OH Tu +kb qa +kb ipscraper +Ġ98 9 +058 37 +058 26 +Ġmaybe Deferred +RESOURCE ID +RESOURCE MESSAGE +RESOURCE MAPENTRY +Kit ti +kv adrat +qn ec +uy o +uy or +uy ler +uy ã +uy á +uy ú +uy Ãł +uy ù +uy ạ +uy Å© +uy ả +uy ụ +uy ủ +Ġtemporary Credentials +Edge Size +åįķ æĿ¡ +åįķ çĭ¬ +Details Form +Details Handler +Details Resource +:[ ^ +ت Ùĩ +ت Ø® +ĠBasic LSTMCell +ĠBasic PyFileWriter +ĠRest arts +967 994 +ĠDIRECT LY +GAT GTC +KZ DI +KZ VK +kc jk +kc jl +osp fV +osp heric +Ġ"( .*)" +ĠAv ro +ĠAv atar +ami lo +SETT LE +compress String +compress ibility +compress Scripts +friend name +Cloud Watch +DZ b +DZ DO +Sta y +fz f +fz x +fz mc +qr q +001011 1000101 +Ġslim ta +Ġwav enumber +Ġfore gradient +Ġfore ignKeyFields +Ġsock type +Compliance Type +ĠPROC EDURE +ĠAccess or +ĠAccess Policy +ĠAccess Denied +Ġpotential VarNames +Close Div +DL X +DL halos +DL CHeader +FB DD +FB DDTX +Mag netometer +]}, ' +Ġnr wp +ĠSeries GroupBy +Ġys min +ðŁ§ ł +medium Temperature +Ġ'{}' ...". +Rob bin +Rob inson +]== \'% +mJ ib +mJ iY +Ġhy undai +Ġhy drate +ARR CCCGE +Ġhealth monitor +Particle Vector +Particle RefSelector +Install MessageHandler +Install Attempt +Dump Index +Pop over +Ġfrozen dict +Ġsal v +Ġsal en +Ġsal ts +Ġsal inity +Ġsal iva +994 829 +ango lare +ĠGOO D +starting Range +ĠApplication ScopedVolume +ĠApplication OptInTxn +ĠIdenti fies +Wave form +Wave let +]][ :,[ +Ġ################################################################ ######## +Ġ################################################################ ##### +Ġ################################################################ ############################################################## +Proxy Handler +Proxy Service +367 022 +è¿Ľ åħ¥ +è¿Ľ æĿ¥ +Mapper Resource +Mapper ConfigEntry +Mapper ConfigTrap +broadcast Severity +hide SlideName +ż szy +Ġtran scribe +animation Filename +Ġpen state +Ġpen ny +Ġpen diente +ĠTw itch +aci ja +244 17 +976 05 +976 647 +Metrics BaseCheck +ĠMatrix Space +ĠMatrix Symbol +ĠLinux ONE +ĠLinux ARM +ĠLinux MIPS +Ġreproduce d +Hyper params +NZ SEE +Writ able +spo oky +Contact Wizard +Contact usForm +978 142 +Generate PodName +,[ ], +;"> { +PART SUPP +TASK ARG +TASK EXECUTIONS +éł ij +éł Ĺ +ctr ls +10011111111 1111 +10011111111 1110011 +435 3 +CLO UDS +jY yM +sch olarly +sch midt +sch issmantics +your self +Ġdc im +038 27 +ãģĹ ãģı +matching Type +Ġpeak zilla +Angle Space +Win Socket +ade sh +ade gu +bj db +candidates file +Axes Actor +THE TA +Tick Formatter +eu X +Ġ================= ============= +Ġsun pos +Ġsun day +Ġsun beam +Ġsho vel +Inf ectious +ĠGlobal MaxPooling +ĠGlobal AutoK +Ġcookie Msg +Ġcookie jar +047 37 +886 15 +577 8413 +Ġtwisted caldav +428 391 +}-{ :. +Ġbri ghtest +Ġbri ghtics +forecast Out +ĠREAD Y +CONTROL CONTAINERMESSAGE +CONTROL CONTAINEROPTIONS +YA xis +Ġny zo +Ġ#---------------------------------------------------------------- - +Ġ#---------------------------------------------------------------- ---------------------------------- +Ġ(` -') +phen otypic +556 32 +ãĥĪ ãĥĶãĥĥãĤ¯ +OBJECT REFINFO +ĠHeart Rate +ĠHeart Beat +åİ» çľĭ +BOT S +BOT TLE +qc generator +qc HDMLX +ÑĦ Ñĥнк +ÑĦ ÑĸлÑĮм +éĸ ī +ĠåĪ ©çĶ¨ +Ġmul it +Ġmul sum +ĠCache s +ĠCache Exception +Ġconversion Factor +Ġsto q +AGC AGG +AGC AGA +ãģĦ ãģĨ +ãģĦ ãĤĮãģ° +binding path +binding Root +NULL IFZERO +deployment List +#================================================================ ============ +Ba ja +Ba idu +Face File +Face Dataset +RENT AL +TW IKI +ÄĻ g +chord length +(".") [: +ĠSa úde +ĠMer ci +ĠMer lin +ĠMer ging +ĠMer ges +ĠMar co +ĠMar ine +ĠMar ca +ĠEl ves +ĠEl liptic +Meter Uploader +NL umi +YS QCFEEIIIR +æŁ¥ æŃĮ +Ġmicro bial +COM POSITIONAL +"; ") +393 54 +Tr F +Tr inomial +mic romagnetic +viz dir +viz ual +ÄŁ ru +Ġpb data +Ġpb ex +Ġpb parser +Ġpb reports +Ġhp Conv +ĠLa Tex +Ġchrom osom +DEP ENDS +Ġquad prog +Ġquad ruped +Messages Start +pnic fsupplicant +>` __, +Dot StringsEntry +bN k +bN n +bN u +bet ai +ez d +ez io +ez alor +}; '. +¶ółģ ¡ółģ¿ +¶ółģ ©ółģ¿ +¶ółģ ¤ółģ¿ +Ġठ¶ +ĠठĨ +Ġà¤ Ń +Ġwinner Code +Ġwinner Mu +Ġwinner OgMu +ĠAB ORT +ĠAB ACAD +Ġparticle Production +movie list +ĠRef ers +845 80 +845 35 +845 241 +correlation Method +ĠStream link +ĠStream BlockValidationError +Board Processor +Ġsuppress Rom +893 88 +CAN ame +EV x +RW Array +san ction +san itise +Ġ ¬ +Ġ ± +Ġ ¯\_( +redd o +redd y +chkpntTrap MibModule +about code +ĠCho se +ĠCho sen +ĠCategory Serializer +ĠNon Linear +ĠNon AuthTld +ĠNon AdiabaticMSWH +Ġunpack er +Texture FilterCaps +ĠGeneric WebHook +Ġadapt ing +模 æĭŁ +)}) ' +DM ULL +FG M +Free R +Free Time +Free RTOS +Kernel Exception +Kernel PCA +dro hne +ĠCL AMP +ĠBot AI +ĠBot Inventory +648 28 +648 328 +Ġdispatch able +ĠLogin Page +('_') [:- +ĠAbstract File +ĠAbstract Model +ĠAbstract Dissimilarity +ĠPipeline Response +ĠPipeline Base +ĠPipeline Selector +fac lambda +fac enet +rw CZ +è¨ » +Ġste go +Ġste alth +066 38 +discard ing +ĠMaximum WaitTime +Http s +Http Header +hid api +Ġ"@ ": +Ġ"@ /./ +ĠFire Exit +ĠPV reflected +928 13 +Init words +Init Date +ä¿¡æģ¯ 表 +IX OTH +IX USR +IX GRP +KL TFreeFloatImage +MZ v +MZ XML +MZ jN +Master Horizontal +Master AmbientVolume +bw tools +bw Parcel +bas gra +bas ins +cas u +cas ings +cas ualties +dup lif +lU s +lU gl +lU qF +è´ £ +è´ ´ +ĠÑĤ к +ĠÑĤ олÑĮко +ĠÑĤ еÑħ +Ġmomentum opt +umin ium +Ġassembly line +photo shop +378 36 +378 35 +366 36 +ĠTransl ates +Gu an +Gu arante +NORM ED +Si Py +Si ena +Si PM +Si xth +ira re +well formed +well orts +Ġfact Text +pep tides +pep tidecutter +upgrade InstanceContainer +Export ConfigName +Section Category +prim ers +prim atelja +âĢĿ \ +âĢĿ ). +ал Ñĭ +åĬŁ çİĩ +ç»ĵ çĤ¹ +CSV Importer +Ġbug zilla +tracking Material +Download ViewSet +Ġlowest chi +Ġmagic ian +DoesNotExist Error +727 9 +727 90000 +727 12350 +Home Assistant +PARTICLE INDEX +cro o +cro ci +cro ped +cro chet +don ation +don key +don orPos +nes is +111011 00011111111 +028 35 +ĠContact Info +Activity ProducedBy +Activity ConsumedBy +ãĤ¹ çĻ¾äºĮåįģä¸īä¸ĩåĽĽåįĥäºĶçĻ¾åħŃåįģä¸ĥ +particip ation +Slot EqualsCondition +ju lio +jet je +Ġsever ities +critical ity +454 96 +Ġdisplayed image +HK n +Mar ist +Mar ble +PJ hK +Sys Framework +TIM ON +TIM ED +TIM ING +TIM INGS +TIM ESTEP +nop ad +nop onzi +Ñĸ з +Ñĸ б +Ġfx Name +Ġoptimal TAD +ĠBox scores +ĠInitial ising +ĠInitial ises +Clear Log +Clear Statistics +Figure Canvas +van he +van jske +van couver +Ġmajor Type +856 56 +CHAIN CODE +éĩį è¦ģ +éĩį åIJĪ +éĩį åIJ¯ +ĠPOSS IBLE +Signal Error ++) "> ++) $") +901 64 +901 235 +919 4399 +Gaussian Process +kU j +kU in +kU gw +lw lrap +nw is +snap base +Ġtax ed +Ġtax Means +Ġcr ude +apple script +Ġadapter kind +filing Fees +Ġintegr als +jit tor +utt all +"""" "" +Ġdecision sToDFA +Intel ligent +ĠConnect ors +ĠConnect Timeout +ãģ§ ãĤĤ +ãģ§ ãģĤãĤĭ +ãģ§ æĽ²ãģĮãĤĭ +Switch board +Analy se +Binding Level +Voltage Trap +使çĶ¨ èĢħ +Ġke vingstewart +refer ers +untu ck +Ġconfirm ations +ĠInte gers +878 32 +Allow Any +Ġswap RB +æīĢ éľĢè¦ģ +ĠFIX TURES +Bul garia +KR B +Lab Templates +Math Calc +dll Dir +078 125 +Compute ElementLpDistance +ĠChar lie +Private Networks +å®ŀ åIJį认è¯ģ +Extractor Op +Worker Store +Worker MirroredStrategy +318 1200 +318 93004 +318 37288 +ZW V +ç¼ ĺ +reion ization +heart s +heart beep +ĠPosition wise +ĠImp ute +ĠImp roved +ĠImp ossible +ĠInstance s +ĠInstance Type +ĠInstance Change +ĠInstance Arn +ãģ¦ ãģ® +Boolean Not +Boolean Or +Boolean And +Boolean Encoder +åı² 太åħ¬ +autom ate +surf board +Catalog Worker +"^ ([ +"^ [\ +"^ (? +JOB STORE +Kh QJ +Kh QI +instruction reporter +Ġ'.. '))) +Ġmt urk +Ġbed line +Ġbed utils +Ġbed rag +Ġbag it +isin in +Ġeng age +557 94 +557 45 +DateTime Index +DateTime Original +Elements X +Elements Y +Decimal Type +Decimal Digs +ĠcpwVc Up +ĠcpwVc Outbound +Person a +Person Action +Person Speed +Person InImage +hal config +lbl Health +lbl Attack +ĠDummy File +ĠDummy Discrete +Ġfrac ción +ĠOUTPUT FILE +COMMAND CONDITION +MAT CHED +fout Name +fout Path +wG Qy +abo la +447 04 +After Reboot +After EqualSign +LES HOULD +LES SEQUAL +Sig uiente +ÅĤ ad +ÅĤ ni +meas urable +Ġpys dn +Ġpys atl +Ġpys nark +Ġpay ing +Ġpay ed +Ġpay ins +Ġpay day +ĠUsage Page +Arch onView +xxx åIJİç¼Ģ +Upload API +ĠAdmin Config ++- ]?\ +]| (?: +ô i +ô á»ĵ +ô á»ij +ô á»Ļ +ô á»ķ +ô á»Ĺ +memo tifs +ortho graphy +()- _ +Ġgas ses +ĠBad ge +ĠBad Argument +ĠBad guy +ĠBad Vrrp +278 12 +Trade off +Trade Info +Trade Run +Trade Timestamp +Trade Executor +Trace Implementation +åıª éĢīæĭ© +Internal LoopbackTest +Algorithm ic +æĪij ä¸į +æĪij èĭ¥ +CONTAINER ID +CONTAINER IDS +CONTAINER DEPLOYED +Balance Resource +Fe ather +XR D +fort e +fort y +}% ' +})) [' +})) |(? +anon imo +anon imous +Ġcart Cords +Ġimported Component +ĠCent ro +ĠFast q +logic node +ĠPAR AGR +TRANS CODING +TRANS FORMATIONS +============== ') +============== =\ +sales force +Fun ded +\. (\ +cite able +duplicate L +éĺ ³ +Ġht ls +Ġht df +conj unta +ĠPack ing +ĠPack GroupsEnabled +ATTRIBUT ESTATUS +mini val +dbs np +847 18 +Comment List +principal Service +å½ĵ 天 +å½ĵ identify +slow query +']]) * +ĠDocker Interpolation +ĊĉĊĉ Ċĉ +ĠNE UR +ĠNE WS +ĠNE AREST +974 13 +974 15 +974 33 +99999999 999999 +æĺ¯åIJ¦ å·² +æĺ¯åIJ¦ æĺ¾ç¤º +æĺ¯åIJ¦ åıįéĩįåĬĽæ¶²ä½ĵ +Selected Layers +Ġcommunic ates +)# ( +Cross ing +Cross Bundle +MV P +bk r +sand storm +sand blaze +Ġol un +Ġder adical +scroll IntoView +scroll tofixed +ĠPower Converter +='# ', +353 91 +overwrite Output +ĠMean BP +ĠMean EventDurList +Finished AndStart +cdbpPeerStats ProtocolErrors +cdbpPeerStats TransientFailures +cdbpPeerStats PermanentFailures +cdbpPeerStats RedirectEvents +cdbpPeerStats AccDupRequests +cdbpPeerStats EToEDupMessages +604 1 +604 56 +dust intran +dna Length +han lp +han ler +pitch fx +('// ') +Ġtodo ist +ĠLi hui +Ġposs ivel +Ġdisp ers +Ġdisp atched +Ġtransition ing +ĠSummary Res +BIT MEX +yan lÄ±ÅŁ +alter æµĭè¯ķ +alter ä¸įæĬ¥éĶĻ +Expected Hash +Ġм еÑģÑı +Ġм оменÑĤ +иÑģ п +æł¼ 鼷ç¼ĸçłģ +ĠcdbpPeerStats ProtocolErrors +ĠcdbpPeerStats TransientFailures +ĠcdbpPeerStats PermanentFailures +ĠUnicode EncodeError +Ġadjac ente +GW G +sam j +sam an +Ġtor datahub +Ġcas cades +Ġcas ualties +Ġcas caded +Ġnlp d +Ġspo ilers +Ġbroadcast s +ĠASC IIC +Std call +Std dev +Ġlive count +TRAP S +éĩĮ äºij +è¿ĶåĽŀ æķ°æį® +è¿ĶåĽŀ ä¸Ģ个 +è¿ĶåĽŀ çļĦæķ°æį® +BP v +cL vd +flex ibility +Ġdl logging +Ġrt entry +Ġrt ticket +Ġrt midi +667 45 +CHO SE +CHO OLS +465 020577 +partner key +Endpoint Mixin +Cer tificates +Cer berus +Dummy Classifier +Dummy ObjectId +Elect ra +bur buja +vf ve +vf args +vcf dir +vtk PolyData +vtk LookupTable +Ú© ا +Ġhum id +priv ates +ä¸ī äºĶ +ä¸ī è§Ĵ +Ġcleanup Materials +åĨħ ç½® +Async Path +BRO WN +BRO KERS +BRO WSERS +Oh Q +Ġlife loopweb +Ġcrit dist +Ġcrit LineSamples +Ġsup orted +Ġsup rimentos +contra ctions +contra ctid +ĠSec ant +ĠPlugin Base +hover cards +Ġactiv idades +Ġactiv ité +ли Ñĩ +计 åĪĴ +Owner Mode +)+" % +)+" - +Cut off +Other Class +Other Count +WER Metric +Ġfrequ entist +ĠSuccess Counter +ĠSuccess MessageMixin +Ġdie sel +Ġdie sen +Trained Tree +ä»ĸ å¦Ĥä½ķ +Disk Dataset +Disk SpaceTrap +ä½ł è¾ĵåħ¥çļĦ +ä½ł æĹ¶ä½łåľ¨ +White Box +Ġmisc group +Cr ud +DNA WS +Ri NR +Ri yadh +Try Except +Vy G +dv bi +pres ale +pres umably +ĠCluster Grid +ĠEqu atoria +ĠEDIT OR +ĠRender EngineHybrid +Ġraster ing +Ġraster izer +TK Status +zZ o +enn en +ĠSM OT +ĠBio Image +ĠBio medical +ĠBio informatics +REGI ST +AGG CC +AGG AAAA +445 31 +visual Genes +нÑĭ ми +åIJĪ ä½ľä¼Ļä¼´ +910 94 +910 646 +Pur ge +fP m +fP s +fP w +fP ns +fP sz +ndi vide +åķ ¥ +reload weapon +demand Level +mess ytable +chrome cast +ĠSur vival +ĠSur veys +0100000000 000 +Ġcov FH +IMG DIR +Testing Queue +ĠEnter tainment +OBJ C +OBJ DOMO +OBJ SUFFIX +("/") [:- +ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXX +ĠXXXXXXXXXXXXXXXXXXXXXXXX XXX +ĠXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXX +Creation Error +Creation Date +Creation Parameters +Answer ed +HAL TED +Uuid Gen +bor r +fan ci +grouped Factors +pseudo time +Ġpsy cho +Ġnom s +Ġkill mail +ĠAnaly ser +PLUGIN CONTROL +PLUGIN SPECIFICATION +785 398 +Gi I +Gi ver +Hg Y +Qa DS +Src T +Ġ"../ ") +through out +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +ĠUI Wo +844 99 +Short ening +Short Cable +Ġphoto ionization +缸 åħ¬ +缸 å·® +缸 éĤ» +缸 çħ© +LOCATION PING +ĠTrack Trigger +ĠSignal Dataset +ĠSignal Choice +^^^^^^^^ ^^^^^^ +ĠAnsible F +Feed s +Feed Version +Feed stock +Mi w +Ok abe +Parent List +cw WF +guest tools +nos lug +tre zor +tre asurer +xB ias +ĠES M +ĠES un +Ġoct es +Ġoct oprint +Ġmor an +Ġmor alize +Ġmor ango +Ġmor occo +ĠSchedule Key +Ġdefer reds +ĠAgent Type +Ġunion find +ĠWait For +Ġcorrelation Method +blank waters +Ġheading M +Quanti zer +Quanti zing +æѤ æĸ¹æ³ķ +Sql Query +Sync Interval +eh All +vic le +will power +zm ann +Ġmorph ometrics +Ġ(? ): +Ġ(? =\ +Ġ(? )", +Ġ(? ,?,?,?,? +Ġ205 3 +Ġ205 9 +094 77 +Ġmanagement ZoneIndex +QUEST IONS +gredi ents +ĠBook Main +ĠSplit ter +ĠSplit Mode +ĠSplit PatternTokenizer +Actions Resource +Ca AQQ +Issue NotDefined +bes selj +yi Xy +г Ñĥ +quick check +quick ref +quick sort +quick helper +ĠMIN OR +ĠMIN US +ĠMIN LP +ĠNv Error +Ġcombination Sum +Ġcombination Probability +ĠNormalize Integrand +Nx M +cus o +ب Ùħ +ب ÙĪ +isa Äĩ +ĠPDF Parser +Ġleaf let +ãģŁ ãģĻ +ãĤ¤ ãĥ³ãĥĪ +Team Form +åIJĮ æŃ¥ +Ġpolygon Idx +World Transform +'+' \ +'+' -'* +kh mer +mor let +mor eland +por tia +eral a +Ġdos n +Ġdos age +Ġshader ObjectTypes +Perf omer +Ġ-------------------------------------------------------------------------------- --- +Ġ-------------------------------------------------------------------------------- -------------- +Ġ-------------------------------------------------------------------------------- --------------- +qi ang +uá» Ľ +vit b +æĥ ± +æĥ ¹ +Ġcancel frame +Ġpie Chart +Ġ"^ [ +Ġ"^ (? +Ġrestore Count +Ġemb data +ATTT GATT +ĠNor wegian +Ġalter Add +Ġ.... ') +Ġ.... ... +capit ol +serialized ATN +drug target +Ġlongest Palindrome +åĨĻ çļĦ +им ен +им еÑĢ +Abstract Application +ĠEdge Lines +ĠDirectory Names +ĠFailed Predicate +ĠFailed SystemCall +Best Models +vlan Trunk +recent Points +Ġmal colm +ĠCore Config +ĠCore NLP +ĠPos ix +ĠPos ição +='./ '): +prox ito +ĠML KNN +chem ist +chem graph +âĸĴ âĸĪâĸĪâĸĪâĸĪ +ĠTransaction Normalized +>{ }, +Atom MappingDict +VP USH +Ġcau chy +Ġnc file +Ġnc client +Ġnc pl +tell ing +Ġconver ta +ĠPur ge +Ġtexture Offset +Logging Context +ப à®± +Google Net +Neg Mask +Ġcipher TextFile +Black ListedQuestions +GU AR +GU CC +HASH ES +HASH KEY +HASH DIFF +RB w +RB AR +VOL ATILE +cz P +cz d +dO x +eti co +xW LB +determin es +Ġff std +setype s +2457 84357 +Ġnotify Control +æĮĩ æķĻ +Ground Withdrawal +Ground Phos +SOL TY +cD CS +cD gd +ج Ú¾ +Ġ------ " +inn amor +Ġgg DNAs +Ġdeclar acion +reading Type +Callable Registry +Callable ParamRegistry +Ġvoice box +INTERVAL S +ìĹIJ ê²Į +ĠIECore Maya +Git Habit +MASK ING +Words With +pq Sk +Ûģ ÛĮ +ìľ ¡ +Ġtok endito +Ġmemo list +Ġenvi ados +100101 010110110000 +aste lo +ĠJOIN ING +ãģª ãģ© +Combin es +Tags List +ĠTool InputFile +ĠTool OuputFile +squares GroupedByInds +NORMAL ISED +Cli que +cnbtc Que +cnbtc TradeQue +Ġ'& . +ĠPlay books +ĠMode Baseline +Problem Adapter +Problem StateTrap +TestModel Select +TestModel Alter +çĶ¨æĪ· è¿ŀæİ¥ +æĿ¥ æŀĦéĢł +解 çłģ +解 æ³ķ +AUTO UNIT +Cri ança +Play Sound +Play Pause +PERSON NEM +San itizer +nT t +nT ank +ªółģ ©ółģ¿ +arb our +Ġslack bot +Ġ:- ) +Ġthink plot +0257 064 +ISH IRING +Commit ed +ĠDeep lab +ĠDeep Learning +Ġfood Pos +({}) ^ ++"\ ");") +bib code +bib number +¦ółģ ¡ółģ¿ +¦ółģ ¬ółģ¿ +Æ° i +Ġ× ł +Ġ× ¡×ķפת +Ġdecla res +Ġmel bourne +ĠREST Client +Ġcoef ficents +associ ator +ĠInformation al +Ġcompressed Data +Ġcompressed Code +858 04 +Ġcorr fp +playlist Items +ок о +decision sToDFA +decision ToState +GRAPH JSON +Structure View +Ġveh Desc +equipment class +æ¯ı ä¸Ģè¡Į +æ¯ı ä¸Ģå¼ł +SHE BANQ +gender izer +vgg net +}- {}". +éĥ½ åĪ° +ĠSG AINS +Ġ}} """ +Ġ}} "> +ä¹ĭ ä¸Ĭ +Ġpoll ID +WebKit FormBoundary +页 æķ° +页 çłģ +xr ff +Ġà ¾ +Ġà ĺ +Ġà ľ +Ġnan op +ĠSan to +ĠStack Trace +ĠRob ocorp +ENC ESCREATE +Coord System +101011 0010101 +Beam Search +æĶ¹ 为 +'; '), +FULL DIR +GTT C +GTT AG +GTT GCT +GTT TTTT +Ha W +Ha q +TMP NAME +dN ative +hass io +س Ùħ +س ØŃ +س Ø® +å¢ » +æ£ ® +æ² ¿ +Ġdom ish +Ġdom blk +Ġdom ÃŃnio +ĠScript Item +ĠAda max +ĠHas htag +ĠHas ColE +Ġcompress ive +Ġusd Material +Ġб оÑĤ +Ġб ал +Ġб аз +اÙĦ Ùĩ +اÙĦ Ùģ +好 äºĨ +好 äºĭ +585 1589 +586 857 +Gra pe +Gra des +Gra sped +HS IC +NY T +NY PL +Zone Names +ban co +mI tr +Å¡ Äįe +Ïĥ ᵧ +Ïĥ ÏĢά +Ïĥ μαÏĦα +é» İ +Ġspark ml +Ġspark tk +Ġhi per +ansible testvcn +ĠGen ie +ĠGen Task +Noise less +ĠParser ATN +он а +Subject s +Subject Type +Subject Map +Subject Confirmation +Subject Locality +该 æłĩè¯Ĩ +该 çĶ¨æĪ·çļĦ +该 URLåľ°åĿĢ +ĠGeo coder +ĠGeo spatial +ĠGeo jsonPointItem +MenuItem Id +Capacity Units +âĸĪâĸĪâķij âĸĪâĸĪâķijâĸijâĸij +FX Inverter +Gw MA +fps Single +gis mo +milli sec +Ġpat ID +Ġpat rol +Ġdrive se +Ġmult s +Ġmult ado +weak ly +expiration Date +{}: {}'. +POOL DEV +LIGHT ING +åĪ« åIJį +Prediction Outcome +å°± åı¯ä»¥ +å°± æ·»åĬłæķ°æį® +Ġèİ·åıĸ SQL +Ġèİ·åıĸ æľĢæĸ° +Ġèİ·åıĸ çĶ¨æĪ·ä¿¡æģ¯ +Bro j +altern ates +altern ating +Ġdm utils +Ġdm ubar +Ġwind LE +ĠAL SO +ĠFit bit +ĠLang Type +shard Count +Ġorient Controller +OPEN CL +ratic ule +Nav bar +Tw ident +Tw ython +Vs ersion +fT z +gif ts +Ġrom Var +Ġsl urp +Ġod abir +Ġom ist +ĠPlatform Package +ĠGu o +ĠHyper band +ĠHyper Parameter +ĠHyper geometric +ĠHyper Leda +novel full +novel spread +ABC DE +Primary Key +Primary DefList +åįģ èIJ¬ +677 08 +Fg E +Kx SL +Plan et +Plan Args +Rq MR +VB IC +oh ui +tst X +uls ory +setIndex Func +ĠCRE ATION +ĠCRE DS +ĠCRE ATING +Ġ\' {" +Ġ\' {}\ +Ġ\' {}\''. +011101 0011100 +674 9600 +ãģ¨ ãģĹãģŁ +ãģ¨ ãģªãĤĭ +ав иÑĤ +ав ки +Ġaligned Points +ĠRoom Image +ĠRoom KeyRequest +ĠRoom StreamToken +538 2 +Ren amer +Solution Loop +ÏĦ Ïİ +Ġig xml +("* : +ĠCli ques +CTT CA +CTT GA +CTT AACTTC +Ġopened File +TRAN SI +Shared Key +Shared Library +Shared Secret +Shared AccessAuthorizationRule +Shared SystemMemory +Signature Serializer +kr kbipscraper +Ġepi demi +ĠAC ER +ĠAC CL +para fita +Ġham m +Ġham iltonians +Geo code +Geo Country +Detection Point +inherit file +Ġbroken axes +èĩªåĬ¨ å®ļä½į +èĩªåĬ¨ éĩįæĸ°çĻ»å½ķ +Annotation Config +599 2 +MATCH ONCLIENT +fu ori +Ñī о +Ġcatch er +Ġcatch ment +adm ica +000002 00 +ĠMET S +ĠMET RIC +([^ , +UNIT ER +Ġphy cas +ĠForward Kinematics +Disable RFC +Distribution Wrapper +.+ ?) +RK PR +hor st +ĠRaw Data +ĠRaw Message +ĠRaw Result +ĠRaw Deletion +ĠRaw DescriptionHelpFormatter +ĠRaw StorageMode +Ġspeak later +strict ly +Chunk ing +specified DateStr +Trigger Results +éľĢè¦ģ ä¸Ĭä¼ł +éľĢè¦ģ å¡«åĨĻ +402 22 +YT Qa +Za WF +ben nojoy +fL s +gle ason +pat role +rus sell +suggest s +ë§ IJ +ë§ Īëĭ¤ +Ġ":" + +ĠFra ser +INS IDE +SEG MENTED +axi om +Ġatualiz acao +tagged Validators +UPLOAD LIMITS +Health care +integr ators +Ġscrapy d +å¦Ĥæŀľ æĺ¯ +Img ur +flt Global +qK y +0005 9896 +0005 18528 +ĠTE HTÃĦVÃĦ +ĠSite Stat +ĠCase Accessors +ĠCase Folding +servo Ear +ĠPop over +Ġclassify Model +Deep Key +Deep ImageWriter +IOS cheduler +æīĭ ä¸Ń +thresholds ByDetector +(':') + +ãģĻãĤĭ ãģŁãĤģ +设置 æĪIJ +Amp R +Need ToReconfigure +VL DR +nat urale +Ùģ ÙĦÙħ +Ùģ ÙĪÙ¹ +Ġsit n +Ġsit atlar +Ġwiki quote +divide s +ĊĊĠĠĠĠĠĠ ĊĠĠĠ +Ġly ing +Ġconj uncts +ĠFeed Group +01000100 010001111 +01000100 1100001001 +CRAFT ASSIST +空 åĢ¼ +空 çĻ½ +Hy P +Hy steresis +Mj g +uan ia +uan za +ativ ado +unix Time +ĠSeri alized +ĠSeri alizers +ĠFri ction +Confirm Total +Confirm ationType +Ġprec autions +oku Wiki +Ġsolid ity +Ġgoes Through +еÑģ Ñĭ +åıĺ æµģä½ĵ +Ġìŀ ĺ +Ġìŀ ijìĦ± +001100 010001000 +太 大 +Ġsmart noise +00010000 1111110011011101 +åºĶ 为 +Asset Loaders +Django Translations +Django FilterBackend +Fx k +Fx n +Jp Op +Mg R +NER Tagger +UX HEAT +cad air +cad ene +prom o +prom ising +uẠ¯ +uẠ± +uẠ³ +uẠµ +uẠ· +wy er +wy chow +wy ższy +|| _ +|| ** +stan bul +ĠCamera Intrinsics +Ġrpc api +ĠMissing Required +ĠMissing Extension +ĠGra dec +ĠGra bbing +468 22 +TRACK ML +ĠTesting Config +packed Point +Adv EMDpy +åħ¨ éĸĭ +External Tool +External LoopbackTest +External NonContainerDatabase +Unicode String +Unicode Hex +æŶéĹ´ è¦ģ +ĠMemory File +Age Care +EZ PROXY +Sy SQ +Sy nthesise +]** (- +cO HE +Ġê° ķ +atile Image +0003 8992 +Ġintent os +ĠHash ing +ĠHash Permutation +ĠHash Permutations +Ġmanip ulator +ĠVerify ing +Family Id +Hard t +Hard Disk +Hard Sigmoid +Hard LinkNum +PAY PAL +osc ap +Ġty pos +("~ "* +dirty FDF +Ġintersect ing +Ġë° ķìĬ¤ +ç»Ħ æĪIJ +Ġestimated NoiseMap +wrapped UuidGen +Ġdiagonal Difference +ĠExecute Preprocessor +Bg MM +Ter razas +iy or +ila pi +Ġ(\ *|([ +Ġwerk nemer +els Ã¥ +ĠSele ctiveKeyRestoreOperation +ĠCy Set +ĠCy Jtag +fork server +Ġdead lock +Ġxp Array +ĠRate Limited +ĠGR ASP +ĠVal entyn +speak TextInfo +cats List +ĠValues View +0100101 0010010101 +ço is +Ġcleaned Sentence +supports Interface +contours Filter +Ġcorrection path +North ampton +oF os +tup la +youtube VOS +čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +Ġodd ly +strand Orient +ĠLat ency +ĠProtocol Error +ĠProtocol Specification +Shell ys +Shell Command +Original FollowerNum +ĠQuestion group +Est afeta +ZI PL +aW QiOi +rss feed +sma shing +æĦ ¿ +ĠÑĩ еловек +research gate +Ġcad ences +Ġcad CAD +Ġcad áver +Ġmedi ans +ĠWatch dog +ĠHo ch +ĠHo oks +ĠQU AT +ĠExperiment Point +ãģ¾ ãģŁ +ãģ¾ ãĤĬ +Topology Component +Topology Changed +Blend Operation +Blend Func +HIGH BROW +IQ J +Rank ed +Rank Map +YW l +vw ap +Ġdeci bels +Rep ai +ĠRect angulo +ITOR IES +neutron client +portal Login +Ġskin list +Ġskin ny +Manifest Error +Ġpacked Point +ĠDateTime Parser +ĠDateTime Picker +çīĩ 段 +ĠMetadata Mixin +æĸ¹æ³ķ éªĮè¯ģ +æĸ¹æ³ķ 模æĿ¿ +æıIJ é«ĺ +DST PATH +DST OPTS +who Can +Ġsob ie +Ġ185 2 +Ġ204 9 +ĠSte em +ĠSte wart +Ġcoin base +Ġcoin cident +Article Title +ĠArticle Info +Ġprimitive Info +Adj ective +Precision Quantization +Precision DecimalType +General Category +Ġjournal ière +ĠNumPy Net +Ġæī ¹éĩı +ĠGraphQL String +ĠGraphQL View +ĠGraphQL Float +ĠGraphQL Boolean +ä¼ļ æľī +ä¼ļ åľ¨ +ä¼ļ èĩªåĬ¨ +ä¼ļ 导èĩ´ +Packet Format +Packet Rate +Ġguar ded +Clip Sampler +Mal ta +Micro scope +Ny M +OZ z +Rad raster +Vl Z +dB aggingClassifier +Ġ214 7483648 +Ġgy ral +Ġgy roscopic +Ġgy psy +amin ont +Regex p +ĠNV Me +ĠNV API +replay ed +Building Block +Learn python +33333333 3333 +33333333 334 +33333333 333 +audit Info +BIND TODEVICE +GM DS +GM CObjects +Sal em +Sal do +Sal ário +Square Idx +invest or +Ġ================================================= ==== +Ġmr na +esp I +esp lice +esp tool +ĠAsync IOScheduler +focus LastFocus +0111011 011 +ĠStatic Maze +ðŁı´ółģ§ółģ ¬ółģ +ðŁı´ółģ§ółģ ¢ółģ +ðŁı´ółģ§ółģ ·ółģ +Dispatch Prefix +Ġpopup Menu +ĠTopic Node +ĠTopic Arn +RAT IC +Under line +snow LE +snow board +â nd +åĸ Ĭ +ìķ ¡ +Ġbt list +Ġbt ns +consum o +States AndTrace +Ġrad util +Forward Delay +Forward Kinematics +Forward Declarations +ä½į åĢ¼ +Blocks Response +Market Supply +ĠEdit ra +ĠEdit Areas +并 æıIJ交 +æ¯Ķ å¦Ĥ +scratch dir +QT qc +Vm HostIp +xFFFFFFFF FFFF +increase Energy +00111 00000100 +isk ater +Ġexe time +Ġalgo Analysis +ROW ID +BLUE PRINT +ĠAlpha Go +Ġcentre ID +Visual Alert +ĠHeader Size +ĠHeader FieldTypeError +Secret ResourceProperties +Secret ToPodLinker +"$ ( +495 9 +495 0117696 +Os Type +eigen val +iq VC +jh j +}| } +}| /( +}| (?:[ +regs istered +semi ology +semi covariance +Ġtissue Testing +lik ad +Ġbet abin +ĠSC ENAR +ĠMod ul +ĠEnt re +ĠEnt ropia +AGA ACAACT +ĠArch onView +9999999 3 +Central Dir +Central Moments +Ġsquares GroupedByInds +è¿Ľè¡Į çĶ»åĽ¾ +Ġgrammar FileName +GCT AAC +GCT ATACT +Ġnib p +Ġbx common +("@ ")[ +ĠMc Gu +Ġvl cp +Ġvote LogTrx +054 88 +054 98 +ĠProgress Log +Contents OfFile +ãĤ¿ ãĥĸ +quiet er +客 æĪ¿ +Embedding Inferrer +转 为 +转 åıij +转 è½½ +Ġrgba Data +)[:, : +417 27 +706 86572 +Sem imajor +bW Jlci +sit n +sit uations +whole File +zn O +ĠÑĥ д +ĠÑĥ Ñħод +ĠÑĥ знаÑĤÑĮ +inode s +lov acco +roment Vars +thinningThingProducer E +thinningThingProducer F +Ġgi riÅŁ +ĠAmazon as +Ġhor Headers +Ġhor rible +ĠLock ed +ĠLock time +Ġroc ch +080 933732 +COPY MESSAGE +COPY PATHS +ACH AT +ĠJava Field +Physical Point +ĠRoot Bank +ĠRoot ServersNet +åı¯ä»¥ çľĭåĪ° +çŃī ä»· +'< [ +'< .*? +092 1 +492 54 +Plug board +Scan Order +TB ang +TB Meters +æĵ ¡ +æĵ º +æĵ Ħ +æĵ Ķ +æĵ ļ +ë© Ķëī´ +Ġul ps +Ġfr max +Ġfan tastico +Ġindx m +Ġindx p +usd prize +ĠFull Connected +ĠWOR KS +Means Denoising +Ġusr pass +家 åºŃ +ĠActivity Log +ĠActivity Context +ĠActivity Member +LAST PERIOD +ä¼ł è¾ĵ +BAR CODE +Dy lan +KK KK +Sparse Driver +Sparse CategoricalCrossentropy +kd Tree +vZ V +voc base +voc bases +reci ation +reci ver +reci procitylabs +Ġdz data +Ġdz psf +Ġhot key +Ġhot word +Ġhot fix +former PreTrainedModel +ĠHost s +ĠWeight ing +ratios pectra +Phi los +Evaluation Results +Macro Name +ç³» çµ± +596 1503 +KG goAAA +}[ +] +}[ *] +áħ ¢ +pex pect +Ġbc deter +ĠClear ing +ĠClear Active +ĠElect rodes +ĠElect ronic +ĠRa fael +Ġcalib re +天 èī² +天 æ°Ķ +Ġsmallest Size +Double EG +Double Buffer +æį¢ 为 +æĢ§ åĪ« +picture Enhancer +ä¿®æĶ¹ 并æıIJ交 +310 48 +Fast Speech +Fast GFile +Ji Q +Ji ang +Kn ife +RAD II +SQ SC +UF dX +dZ dU +ÏĢ Ïī +ÏĢ ÏĮ +âĪ ¨ +Ġ---- > +Ġche mistry +Ġ197 1 +Ġ197 2 +Ġ197 9 +thr sh +Quantum Package +Quantum Black +Quantum Calibration +å¹³ ä¹IJ +å¹³ ç±³ +597 1 +Js Parser +Mc On +Mol Sys +èĪ ī +èĪ į +Ħì Ľ +Ħì ¹ĺ +stroke Color +enci ais +Ġtweepy s +Ġcrash reports +Ġstroke Weight +Ġvid list +Ġvid mode +Ġvid cap +Construct ing +Construct ListOf +Ġkv pair +Encryption Type +Encryption Settings +PECT IVE +ĠProb Rules +ĠProb Lexicon +Ġsupply Temperature +Alpha Centauri +Tech no +Tech nologies +Docker Image +Em ulation +bos on +jitter x +jitter y +lv q +mscModVcs Add +mscModVcs Call +mscModVcs Acc +mscModVcs IntOpt +mscModVcs NetworkId +wal dur +was Sourced +Ġcour sier +Ġcour tesy +Ġdog pile +Ġbio info +Ġbio informatics +Ġbio imageio +Ġbio diesel +ĠAir lines +ĠAir plane +Ġher ramienta +Ġdele ter +Ġexam ines +ĠRad iaSoft +PIX SCALE +PRINT ING +æľº è¿IJè¡Į +999999 79 +ĠSTATE MENT +管 å¾ħ +è¿Ļ个 å¼Ģåħ³ +è¿Ļ个 URLæĺ¯ +Ġmkdir p +dol or +dol ar +hY WF +pure es +pure storage +è³ ¢ +è³ « +è³ ľ +íĬ ¼ +====== ") +ĠPa ints +ĠPa ÃŃs +Ġxb bo +REL DIR +REL ATIONS +overview Text +ĠThird Level +ĠBool Expr +Tracker TFP +Tracker MaterialAnalysis +ĠNormal isation +Ġoccup ies +Ġoccup ancies +Media Swapped +Ġbinding path +598 9 +598 0702 +Pat Algos +dent ro +Ġcnbtc Que +Ġshelf Idx +uns ized +Ġbir ini +ĠScore Ref +ĠSSL Error +ĠSSL Context +Ġga intable +Ġstamp ed +Ġyaw DMP +collapse Summary +collapse Trigger +Indicator Comment +ĠGRO UND +Ġencrypted var +Station ary +Station ZO +000000000000 11100 +1010100011 000000 +ãĥ© ãĥª +ãĥ© ãĥĻãĥ« +ãĥ© ãĥ³ãĥĢãĥł +Ġtrick ier +Soft wares +ĠâĢĺ [âĢĻ +ĠâĢĺ ]âĢĻ +æŁ¥è¯¢ è¯Ńåı¥ +áĥĶáĥij áĥĶáĥijáĥĺ +FU o +FU signal +JR AL +JR QK +Lh MD +lls g +Ġlic z +teacher count +":{" _ +ĠPick ing +ĠPick les +ĠPick lingError +Ġprox imal +Ġprox ied +ĠVolume Liquid +Ġlisting local +ĠHigh Level +Ġdigest mod +ĠInventory Entry +Ġspot seeker +CLUSTER ED +CLUSTER BACKEND +Ġutiliz ing +ãĤī ãģ£ +ĠìĹ Ń +00000000000000000000000000000000 000000000000 +00000000000000000000000000000000 00000000000000000000000000000000 +ĠTimeout Expired +Behavior alRTLIR +Swap Strategy +Swap MemoryTrap +éłŃ åı£ +áĥĺáĥ ij +èİĬ éĻ¢ +Ann ouncement +DG MG +Flt Clock +Flt Filt +PRES ERVE +Saved Width +Saved Height +Saved ModelBuilder +iw nlp +iw WC +jw Y +ÐĴ аÑĪ +ÐŁ еÑĢ +ÐŁ олÑĥÑĩ +ÐŁ аÑĢамеÑĤÑĢÑĭ +èĦ ij +Ġpode mos +Ġauc list +Ġesp tool +ĠVER BOSITY +Ġtraits ui +subj list +DataSet ModelSerializer +à¤Ĥ ", +Backup Day +Ġgrade Actions +ĠMySQL Client +ĠcdbpLocal IpAddress +592 997 +595 769 +625 035 +625 2900 +Drive NetIcon +Maker Notes +SEND FILE +north west +ù a +ù i +('\\ '): +('\\ ','') +('\\ ')[- +ĠAmeric as +ĠPlan ck +ĠDim orphite +Ġmed als +Ġmed ida +Ġmed filt +played card +Ġidxs bx +101111000101 001001 +Ġbullet X +æ°´ æ» +0001010101010011100 101011 +/- / +Cp wVc +GLOBAL NAME +jt alk +åĭ ¤ +åĭ ¾ +åĭ ĩ +éĴ © +ĠCOR BA +shadow Link +dfa ust +DET ACHED +ĠExit Point +MALL OC +1011011011 0000000101110 +ĠLogging Exception +å¼ķ ä½Ļ +Serialize ToDoList +ĠctspDef SwStatisticsGroup +ĠctspDef HwStatisticsGroup +100010000111111 001000 +62670934 87 +Cam adas +Emp loyment +Ptr Errs +jac r +udf ul +èĤ ¥ +sea file +lad visor +Ġhint List +ĠPRE PROCESSING +express ao +Ġjet zt +Inventory AccountWatcher +aked on +Ġacl content +Seg Evaluator +displace d +ĠComm unities +ĠComm Care +Examples Directory +ĠAsset Type +æİĴ éĻ¤ +0010101110011111111 11101 +模åŀĭ è®Ńç»ĥ +100011111010000 10001110 +10111011010001110000 0100100 +486 1 +ELE M +ELE VATION +Veri log +Veri fique +Veri ficar +[^ * +easy ops +easy Science +mgr state +soc re +vR p +Ġcry spy +Ġft nt +lift ed +("__ ")[ +ERE QUEST +ĠRt DB +TTT CT +Organization Group +snippet compiler +Associ ates +Matcher Data +Ġannual InterestRate +Ġannual CostsReduction +rgba f +Ġdispatcher Instances +Ġemoji count +Ġemoji Mention +GCELL IDLE +JWT HEADER +JWT AUTHENTICATION +cT id +cT uT +fault Type +fly e +Ġtls v +Ġtip i +Ġcdf Beta +intro duce +intro spect +('> ......'), +ĠCC X +ĠFLO P +ĠFLO Ps +quant Dict +Ġhb ldh +Ġmeth ionine +latin um +latin English +auction Parameters +989 857 +ил ÑĮно +Generic JSON +Generic Phase +ад ÑĢеÑģ +Ġfasta parser +Ġsecure ly +Ġsecure crt +Scaling Model +缮å½ķ çļĦè·¯å¾Ħ +缮å½ķ åĴĮ对åºĶ +0011100010111110000 010 +ĠContainer Properties +ECT L +ECT S +Ethernet Cards +Week Data +ë³ ´ë +Ġcg pa +Ġfft convolve +Ġreact ome +92154 1801802 +Ġko lay +Ġko ef +Ġko ÅĦ +ĠInfo Declar +ĠInstruction List +AGT ATAG +AGT GCGC +778 64 +ĠStat ify +Unexpected ly +bottle prefixes +bottle brominations +åĪ© çİĩ +æķ´ åºĵæĿĥéĻIJ +åħĥ ãĤ¿ãĤ¤ãĥłãĤ¹ãĤ¿ãĥ³ãĥĹ +Ġproportion ally +01011111110000 100011 +ĠPhone Repository +Destination IpAddress +Destination IpPrefixLength +Ġideal point +00111111100011 0001111 +)< " +412 23126 +Ew mg +FZ r +Pure Path +Pure Notefield +PID ER +PID Status +Va ata +Virtual ID +Virtual File +Virtual Device +Virtual Link +dJ db +fre ar +fre quencey +Ġrid ing +Ġida des +Ġdont break +adverti se +chore ography +ĠSu curi +ĠPr inceton +ĠPER MISSION +ĠPER MITTED +Ġexif data +Ġexif tool +ĠRF SException +Ġtrajectories SortedBy +ĠParam Desc +Based Cache +Ġblur ry +Ġautog rid +Ġautog alaxy +ĠCOMP UT +ĠCOMP RESS +Ġplaylist id +ç½ij åħ³ +FUNC FLAG +å·² åŃĺåľ¨ +Ġspike metrics +11101101110011 101111 +499 1 +584 2 +838 26257 +Bank Stab +Cg Q +bis ch +bis que +catch er +catch ments +Ïģ ί +Ø´ ÙĨ +Ø´ Ùĩ +Ø´ ØŃ +Ø´ ج +Ø´ Ø® +çĬ ¬ +Ġcn ti +Ġwish list +('| ')) +('| ')] +ĠSuper Expr +ĠFactor Max +ĠFactor ielle +ĠFactor ioCalc +Refer ències +Ġallocation Table +Ġ|\ _ +Resume Move +blk size +Shuffle NetV +010001 011011 +010001 0000000000 +Intersection Index +Subscription Type +ĠLogisticRegression CV +ctspDef SwStatisticsGroup +ctspDef HwStatisticsGroup +ĠWorkflow Factory +åĬŁèĥ½ APIè°ĥçĶ¨ +å½ĵåīį çĶ¨æĪ· +688 1 +CPP M +CPP FUNCTIONDESCRIPTOR +Np vl +Ten nessee +Vg MB +mus cle +mus culus +Ġhd us +Ġhier achy +Ġmaintain ability +\\. \\ +Serv os +Serv Action +ож ие +gestion soci +Ġìķ ŀ +à®± ப +ĠQuantum Instance +ĠQuantum Computer +Estimate Key +ĠBucket s +å¼łæĺ¯ èº«ä»½è¯ģ人åĥıéĿ¢ +å¼łæĺ¯ èº«ä»½è¯ģ +å¼łæĺ¯ ä¸ªäººæīĭæĮģ身份è¯ģ人åĥıéĿ¢ +å¼łæĺ¯ ä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ +484 1 +Che ese +Che byshev +Che yenne +JB KR +NX OS +ZG QE +frm ts +hero es +hero Sprite +hpnicf VoiceInterface +wide vine +Ġdol ore +abb age +ĠAF FILI +Ġvin Field +Ġvin Tuple +Ġproof read +ĠInstrument Identifiers +Company APIClient +WSMan Close +ĠOrgan izations +å¤ĸ 驾çħ§ +å¤ĸ æİ¥çŁ©å½¢ +longest Ones +è¿Ļæĺ¯ ä¸Ģ个 +#============================================================================== # +ĠCharacter istics +ĠCharacter LevelCnnModel +GATEWAY S +10010111111101011100 110 +093 75 +504 3 +603 3684 +Ty Z +jq d +nE U +olog ists +olog ia +ĠEST Ãģ +Ġ../ % +orB asis +dee ppink +Ġson o +Ġson Lib +ĠPOS form +ĠDrop shot +ĠBa sel +ĠBa um +ĠBa iley +RELEASE PARTICLEINDEX +ĠRemote Project +Ġsubscribe Camera +direc iton +åı° éĺ¶ +ĠForce field +ĠForce Run +WORLD LINE +éĢĻ æĺ¯åĢĭ +ĠExternal Type +Ġxytext A +Voxel GPU +Voxel Library +ãĥ¼ãĥ į +pronoun s +497 9 +797 69 +834 142 +Hero StatGrowth +MIDDLE WARES +SPL ASH +Ġart s +orbit number +anz as +Ġplate Charge +Ġ"& ", +Ġbor da +('~ ') +ĠSSH Runtime +Reminder Request +Ġresample s +ĠVari ants +Ġanim StackIdx +Proposal DurationInHours +ĠcdbpPeer StorageType +ĠcdbpPeer PortListen +0010101001 0000000000011 +Archive Info +ä¿ĿåŃĺ æķ°æį® +ä¿ĿåŃĺ åľ°åĿĢ +'(? :\ +Amazon as +PAN ASONIC +pom mern +allo ther +Ġpal at +Ġpal abras +Ġpix data +Ġpix ette +Ġbam files +Ġwest HemiRect +Ġgreat ly +Ġrw OutName +Ġrw randomstart +Ġsex ual +pyg df +ĠBi LSTM +ENUM S +ĠHead s +astro pedia +optimal count +Ġstatistic ally +WORKER TYPE +Ġartist ft +é«ĺä¿ħ åľ¨ +é«ĺä¿ħ åģļ +å¯Ĩçłģ ä¸įèĥ½ +Ctrl Sum +Mail Address +Sep Conv +VQ D +VQ SHL +VQ DMULH +VQ DMULL +ëł ¨ +izz are +ĠSi amese +Ġgender Dict +exam score +Ġ312 55 +ĠMIS C +oso vo +ĠRET RY +0800 08 +Ġshot Submission +Ġdialect s +audi odb +9627736 29908 +ĠSubject Confirmation +ĠSubject Locality +åĽĽ çĻ¾ +cdbpLocal ConfigReset +cdbpLocal ResetTime +cdbpLocal StatsTotalUpTime +Ġsvg dirpath +ðŁı´ółģ²ółģµółģ Ńółģ +ðŁı´ółģ²ółģµółģ ¡ółģ +ðŁı´ółģ²ółģµółģ °ółģ +ðŁı´ółģ²ółģµółģ ¶ółģ +å¢ŀ 大 +Foo Car +Ik F +Ik Handle +QB EE +QB FEII +Stri pe +Tot ally +Tot ErrSecs +TLS v +hyp sklearn +è°ĥ èĬĤ +Ġá reas +Ġtaxon Id +Ġsoc faker +Ġwy kop +Ġwy ÅĽwi +made Flag +Ġprot ID +ĠBro oks +ĠGpu Tri +ĠGpu ArrayConstant +Consumer Name +AREA IMOL +popen Executioner +ĠJS Complier +ĠProxy Router +ĠProxy Fix +Management Error +Management System +Edges Between +Character istic +Character DesignId +ĠObj ectives +íķ´ ëĭ¹ +íķ´ ìĻ¸ +Retry Rate +Retry IntervalInMilliseconds +ĠMerge Digests +Ġadjacent Diff +685 667 +PX WW +cds xmatch +С ÑģÑĭлка +ĠÙħ ر +Ġaw ful +Ġaw ake +Ġaw scam +("$ " +("$ "+ +Ġprovision al +ĠEast side +ATER ESPONSE +neural network +Ġallen act +主 é¢ĺ +主 åºĵçļĦ +Too Large +GetStatus Approach +ãĤĬ ãģ¾ãģĻ +ĠMemo ization +ĠDEV ICES +ĠDEV NULL +ĠWhite Noise +Ġclause cat +å®ļä¹ī çļĦ +ĠTwitter User +æµĭè¯ķ æĸ¹æ³ķ模æĿ¿ +657 029 +Flatten BatchNormDropout +Known Value +Music Track +Music Url +Music Player +Oi hh +Vt Mapping +pup ut +pup ils +sap m +zG c +Ġfm client +Ġschool Data +Ġmit xgraders +Ġmist akes +Ġmist aken +asp loit +ĠSTE ADY +ĠFake Context +ĠFront ExtractorOp +ĠDa vide +ĠDa Vinci +Repr Def +ĠBridge s +ĠBridge Agent +ĠBridge Optimizer +substit utes +filler K +Ġowl ready +Ġradial axis +Assign Sub +hydro graphy +cdbpRealmMessageRoute Index +ĠKeep Alive +MULTI PLY +ĠfltStmt IpProtocol +Purchase PlanArgs +没æľī 以 +Arc Color +ĠÎ º +ĠÎ ĵ +Ġcss Constellation +Ġ"** / +Ġ"** ", +Ġ"** ") +Ġ"** /* +Ġaf firm +Ġey ed +Ġey etracker +Ġeast HemiRect +0102 144769 +Ġ*( () +Indices WithLayerElements +MASTER METADATA +Services Response +Services Credentials +ин е +ин Ñģкий +åı³ 侧 +Ġdirty FDF +à°Ĥ ', +Ġlegacy Modifier +Restore User +Restore Default +Ġzope Password +ĠCentral ity +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXX +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXX +ĠDimension Error +Air craft +Ada ir +Pas sengers +SMS Server +SMS Password +SMS Username +WG KV +Wind ing +Wind Farm +skeleton ize +skeleton ByNode +Ġcron job +ury at +Ġbob spassword +Ġwide ly +ĠCUR SOR +ĠCUR TSIES +":[" $ +":[" . +Ġdeco func +Ġdeco upage +Ġdeco defunc +ĠDiv a +ĠMail ing +ĠMail Sender +Inc Rate +Ġencrypt ing +Join Chars +à°ª à°¦ +Ġcaps ul +credit card +æŀĦ æĪIJ +organism IGV +æĢ» åħ± +æĢ» 容éĩı +PRESENT ED +BK GND +BUS CO +Don ation +Dst T +IY Rw +Lang s +Lang Types +Mig rated +burn t +nsp r +nsp ats +vX t +Ġ(): (' +Ġsched ulers +Ġ(# ) +setColor BridgeLamp +ĠTr inomial +ĠScan Bunch +Ġliteral Names +ĠPas sengers +ĠPas sthrough +Ġsocial network +аб оÑĤ +Before Store +åѦ ç§ij +åĽĺ æĿ±äº¬ +ạ o +ạ u +Relative Ranks +Ġbuffers z +)^ ( +/{} " +686 2 +CAM ER +CAM PAIGN +CAS s +Focus In +Sl ur +gar min +gar cia +gro ovy +plug ged +tB enchmark +trend ings +Ġets pecutil +Ġhom ography +poster ity +ĠPiece Color +ĠMesh Clust +Ġwithdraw n +ĠBri ll +Inspect Done +Concat Att +Contract UriMethod +089 02707208 +Proj ek +Proj IdentitySpace +returned Time +fade Dark +Ġ!!! ") +Ġquant arhei +аем ÑĭÑħ +PROB LEMS +]+) (\ +spectral Index +ajax uploader +Ġvotes Final +åİŁ åĽ¾ +ĠWORK SPACE +.- ]+ +.- .', +699 67 +JPEG InterchangeFormat +Pen nsylvania +Sz r +Sz olnok +Same Name +Same TypeUnaryAggFuncExpr +\". \ +dum mys +hon ba +qml file +ê· Ģ +Ġ"(" + +("' "): +Ġran ch +ĠOff ers +ĠVo vov +ĠVo xCeleb +REMOVE IMAGEMESSAGE +REMOVE IMAGEOPTIONS +REMOVE PODOPTIONS +REMOVE CONTAINEROPTIONS +ĠReply KeyboardMarkup +ĠReply KeyboardRemove +MOUSE INPUT +PLAN ETS +ĠìĪĺ íĸī +æľª çŁ¥ +æľª æŃ£ç¡®éħįç½® +è¯į åħ¸ +Ġaccident al +Related Field +Related Tracks +Related UserStory +Related AWSResources +Evaluate Local +,:,:] + +#---------------- # +#---------------- ------------- +20000 28 +Csv Path +CROSS REF +Vel ho +Xl Z +YL fb +din ero +din osaur +nD ear +Ø· ر +Ġcraw led +Ġnv db +dip not +dip loma +('{}/ {}_ +("^ (\ +ĠSta inger +ĠFixed String +ĠDist utils +ĠDist ances +ĠDist illation +ĠMC SCF +ĠMis classified +trait stone +ĠReal m +ĠReal time +Ġboost Hi +THIS DIR +ĠParams Of +令 éĥŀ +influ xd +ĠDesign er +ĠctspDownloaded SgaclMappingGroup +ĠTransformer Encoder +Ġsobre nome +*' -') +PCT N +SCO PER +SCO PING +dock area +jE aj +jE Qi +qh All +rsi DF +xAuth Method +xAuth ConfigEntry +xAuth Quiet +xAuth ReAuth +xAuth ServerTimeout +xAuth MaxReq +xAuth TxPeriod +xAuth SuppTimeout +represent atives +Ġcle o +Ġcle and +Ġcle andoc +ĠTermin ated +ĠTermin ating +Ġrb ac +ĠFoo Identifier +ĠPC s +ĠDele gates +ĠNav igableString +fov Input +ĠWater fall +ĠWater Pumping +Ġìĺ Ī문 +WSGI Application +WSGI RequestHandler +Scroll bar +ĠAuthentication Exception +highlight er +Neighbors Regressor +ĠAssoci ate +ĠAssoci ações +cdbpPeer IpAddr +èµ· åĭķ +èµ· æ¢ĨåŃIJ +friendly Name +ĠDetection Metrics +508 397 +613 19159 +GF Command +Gh ob +Half Fix +Put ting +XM curr +cH j +Ùĥ Ùħ +Ġsales Tax +Ġinfra ctions +Ġdyn asty +Ġdyn atrace +Ġmv mat +Ġ#---------------- ----- +Ġ#---------------- -------------- +mak etx +opro to +ĠSD GraphObject +Ġdefin tions +excluded ServerNumber +ĠDir NotFoundError +ĠDirect Object +ĠWE ATHER +ĠVeri ficar +ĠIndi cies +senti re +ĠRuntime Determined +BOOK STORE +ĠBootstrap DeployConfig +Ġdatum Dic +å°ĩ è®Ģåıĸ +ĠQuanti ties +ĠQuanti zed +CFG FILE +CFG Fast +常 éĩı +Ġcritical Switch +ä»»åĬ¡ 管éģĵ +RAS R +]==' /': +cit ati +cit tad +eX Bl +eig sh +eig sigS +jz zy +mip maps +ĠоÑĤ обÑĢаж +ĠоÑĤ ноÑĪ +Ġ"| ") +distr oname +ĠTT LCache +ĠPM ID +ĠPM Context +Ġbeat en +ĠNext Marker +Ġkick back +Ġroad runner +ĠHam iltonians +Ġdivided Fxn +populate Indicators +Ġcorp oration +CLI KEYS +swift stack +radial Gradient +Organ izer +Organ iser +çĶ» åĩº +Ġëĭ ´ +TAX ES +Posts ByPage +combination Probability +Principal Panel +Ġsymbolic Names +ĠASCII ReplyDecoder +488 9 +ñ ol +Ġortho gon +Ġtit re +Ġill umina +Ġ"=" * +Ġ"... / +0006 22708 +Ġmas con +Ġmas quer +Ġmas querade +Ġwik idated +Ġwik ilanguage +('../../ ../ +veh ConfigInMsgName +spit z +ĠBLOCK CHAIN +ĠNull Market +Ġchrome os +ĠKo opman +ĠQual ys +ĠQual ification +Ġrespond ents +pubmed id +åľĨ åįĬå¾Ħ +ĠNews letter +ĠNews Article +Ġب اÙĦ +ĠdocsLoadBalChgOver MacAddress +ĠdocsLoadBalChgOver InitTech +ðŁı´ółģ¡ółģºółģ ¢ółģ +ðŁı´ółģ¡ółģºółģ §ółģ +!@ }') +!@ #$%^&* +787 0366 +Bs ouvenir +VR AMP +WP ACT +crow din +dan ja +mad rileno +nice ly +uV x +alex ander +Ġprac tices +Ġeig val +ĠFe et +Ġatten dees +compact Descr +ĠExpression AttributeValues +EXTENSIONS MENU +)+'. '+ +çī© 车 +applicant dashboard +INITIAL IZED +ingredients Priority +483 9 +795 374 +But te +Bias Metrics +Dynamic Effector +Ignore Count +Jack Descriptor +Us F +Us Iml +λ ÎŃ +æ´ Ľ +Ġremember ing +Ġog Message +Ġmob ili +elp igraph +('^ ([ +ĠSyn set +ĠSocket Client +ĠSocket Executer +ĠSnapshot File +Ġlan mode +ĠAbs orb +ĠPl XTask +ĠPl äne +ĠdeÄŁ iÅŁken +Ġunic lass +Ġunic orn +Ġanno ations +compound def +Coordinate Transformation +Ġquarter TotalAmount +Ġquarter UsedAmount +Ġquarter AvailableAmount +Ġquarter FrozenAmount +PROX IES +PROX MOX +Ġsearching For +ам а +ам Ñĭл +Ġshortest Distance +ClassifierIp Table +ClassifierIp Entry +ClassifierIp Protocol +ClassifierIp DSCP +ClassifierIp Precedence +ClassifierIp EstablishOnly +ClassifierIp ToS +"""""""" ) +ĠDelta Zk +çĻ»å½ķ 页éĿ¢ +ĠAUTO COLUMN +,: ]), +,: ][' +,:], ' +Cw SD +KM f +KM IA +Life Noise +dS dU +fB mV +hil berthuang +vacc inations +wat ts +wat contacts +wagtail katex +ί δ +recursion Level +eni em +alta re +Ġ'` -- +Ġcot b +Ġcot c +Ġcot angent +Ġpan oramic +Ġpil box +Ġpres umably +urk on +urk ana +ĠSelf Handling +Ġlg block +Ġlg win +Ġlg mlvq +ĠNL Q +ĠGreen e +ĠoutFile Plot +Ġanti aliased +0625 000 +rcl Rebate +ABS ENT +ABS FILEPATH +ĠMedia File +webapp service +ctspDownloaded SgaclMappingGroup +LOADBALANC ER +ĠÑģÑĤ ен +firewall Status +firewall Utilities +golden set +golden Path +Measured Error +Measured Process +æĮĩå®ļ è·¯å¾Ħ +Probability Weighting +Probability HasChanged +é»ĺ认 容éĩı +ZipFile Manager +ĠTEMP ORARY +1666666666 6 +1666666666 7 +ìĥģ ìĿĢ +#- # +796 52085 +Aux Q +Aux iliary +Aux iliaire +Btn Div +Cart Cords +Gene Reviews +KY H +Lam ar +Qk q +Sleep Action +gol and +ò i +ò eo +ĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġå¦Ĥæŀľ 没æľī +Ġå¦Ĥæŀľ ä½ľèĢħ +Ġfair ness +cevap lar +Ġslide Group +Ġmip maps +cob alt +cob blestone +Ġ166 0 +Ġ159 1142400000 +ĠCard inality +Ġglyph Name +Ġlu as +Ġlu xtronik +ĠBR USH +ĠRAT IO +ĠRich Text +ĠRich String +ĠRich Handler +ĠGi ampaolo +ĠGi useppe +hou go +RECE IV +RECE IVER +ICON SIZE +doub led +Already Exist +Already Running +Already ExistsError +ĠRedis Client +ĠHealth care +из а +æĶ¶ çķĻ +æĶ¶ çĽĬ +æł¼å¼ı æĺ¯ +æł¼å¼ı 为 +712 150 +757 467 +Balancer PoolToken +Ix WL +Iy A +Iz vori +Iz jave +Iz danja +Ju gs +Occ lusion +Rat ings +mist ake +wtf s +ž ev +ÐĶ жеÑĢела +ص ÙĬ +rein amentos +Ġimag Part +Ġcats List +ĠACC URACY +Ġhalo struct +Ġ386 2259 +Ġmess y +ATG ACAAGTT +Inline KeyboardButton +Ġoutgoing Hom +ogra fÃŃa +Ġalg od +REAL TIME +polar ization +polar scan +drawing ml +Controlled Type +ìŀ¥ ë©´ +éĸĭ å°ģ +éĸĭ ãģķãĤĮãģ¦ãģĦãĤĭ +Augment ed +association proxy +814 40 +BIO MD +Ir rigation +MICRO S +MICRO SLEEP +Pull Requests +QH BoxLayout +dual tor +ì a +ì u +馬 åıªè¦ĭ +Ġpul p +Ġpul sed +Ġpul zar +fiber bitmask +ĠAg ilent +ĠDLL ist +ĠOPT IMA +"]}) ' +okc Que +okc TradeQue +ĠRecipe s +Ġdoub t +Identi dade +Ġinterpre te +Ġinterpre ters +ĠArg Cb +Registration Inline +ãĤ¸ ãĥĥãĥĪ +Share BuybackAuth +PUB KEY +datum Dic +Ġdifferenti ated +ĠPrediction ContextCache +ĠPercent ages +ĠPercent StyleMultiline +PARAMETER LIST +KILL S +Alignment SummaryMetrics +^^^^^^^^^^^^^^^^ ^^^^") +807 374 +Ww Wq +XB t +wgt q +ÐĹ Ð° +ÐĹ Ð½ÐµÑĪнÑĸÑı +ÐĹ Ð²ÑıзанÑĭ +åĤ į +åĤ ħéĩĮ +ì² ĺëŁ +ĉĊĉ ĊĉĊ +ĠâĶ « +ĠâĶ ı +ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊ +Ġsdk Driver +Ġsrv file +Ġrece bidas +peed s +("---------------- -----") +("---------------- -------") +("'", "") +("'", ""). +ĠSch midt +ĠSch uffenh +ĠPark way +Ġjp ype +Ġjupyter ed +ĠWrap Erc +{}' ". +Ġ['_ '. +ĠQgs Wkb +Logical Not +ãģı ãĤĭ +ãģı ãģĻ +Appliance s +å®ī åħ¨ +ĠREG ULAR +ĠREG ENTS +Ġë³ µ +Ġë³ ¸ +Ġexperimental OCorrect +brew ery +Ġsvn NetIf +Letalis c +ĠAllowed Range +è´¥ äºĨ +Affine Scalar +-]+ @[ +607 00 +Bh ww +Four CC +Four Sdk +Jx WK +Jx WL +MAR CO +Ns lits +ZH SK +qid ian +uE f +×Ķ ×ŀ +íĸ ĪìĬµëĭĪëĭ¤ +Ġtu flow +Ġpour riez +Ġaudit ors +Ġsap Instances +Ġsap RfcSdkBlobUrl +Ġsans Type +Ġinvent or +Ġinvent ree +Ġrent Payment +getNode TargetNodeStringList +ĠCri cket +ĠCri mes +ĠCri mson +bugs nag +AGCT TTTT +Ġfilt filt +Ġspam writer +Ġspam reader +7777 77778 +Ġloadbalancer v +è¿IJ åĬ¨ +ĠAttach ments +Ġcreator Type +Ġcreator Name +Keep ing +çķ¶ å¤ľ +Ġìłķ ìĿĺ +Ġìłķ ëĭµ +*: .* +SENT ENCES +TOR ONTO +kJ wuje +Ġ================================= = +Ġ================================= == +Ġ================================= ") +Ġic ustays +Ġeb last +Ġeb Split +coher ency +dil ithium +Ġgw q +Ġgw fname +Ġgw ots +ĠActor Critic +ĠLow Rank +ĠMini BatchSize +Ġproton s +ĠBU CK +ĠBU ILT +ĠBand it +ĠBand Path +Ġjit Chol +dateTime Path +phon o +phon edit +phon ique +intern ally +Ġnewtype list +ĠKratos Mapping +ĠKratos Unittest +FIRE FOX +postal address +Transition MovingPlatform +ĠForest s +ни ка +æķ¸ åŃĹ +æķ¸ çĽĥ +ĠPerformance s +ır ı +EOF Error +Ġè§ Ĩ +Forecast er +ospf VirtualLink +ãģĹãģ¦ ãģĬãģı +KeyboardButton Url +alternate Identifiers +Ġingredients Priority +éĻĦ件 åį³åı¯ +'# { +ELECT RIC +ELECT RICAL +ELECT ROMAGNET +Mobile Phone +Ta xa +wO By +Ġtiny DB +Ġelastic ity +Ġelastic beanstalk +lamb data +lamb ert +Ġblow fish +ĠCM IP +ĠCM DS +ĠMagic Parser +pycuda decon +ĠBoston VolumeParser +Ġje dem +Ġchip type +Ġchip Width +Ġchip Dims +ANN DIR +ĠHist GradientBoostingClassifier +AGAA UU +AGAA UC +AGAA AGTA +AGAA CTTG +EDIT ABLE +CONSUM ED +åĪĽå»º æķ°æį®åºĵ +ĠSimulator Interface +å¤į æĿĤ +publication Year +Currency Code +ĠSubmit s +ĠSubmit Config +åįĬ å¹´ +åįĬ å¤ľ +个人 éĵ¶è¡Į +个人 æī« +GeV optimized +Foot Scale +ĠìĿ´ ìĥģ +ĠSmart y +ĠCatalog ue +çī¹å¾ģ çĤ¹ +éĶĻ误 å½ĴåĽł +SUPER ADMIN +533 18 +Bang Bang +Mouse Pos +Mouse Button +Mouse Stuff +Rw anda +SAS peci +VG J +Yb FY +Yb DZ +Yb Va +gat k +rF ar +ë° © +Ġ******************************** *** +Ġ******************************** ****** +Ġ******************************** ******* +ĠâĸĴ [[ +ĠâĸĴ âĸĪâĸĪâĸĴ +Ġik ke +Ġik HandJoint +ĠfuniIf Established +Ġmg lat +Ġmg mol +()}) ; +ĠTor Request +ĠPayment Status +ĠPayment Method +ĠPayment Txn +ĠLu xtronik +ĠMS Result +ĠMS Results +ATCT CAT +9265 12 +coln all +Ġrobo cop +STL ING +ĠEnv Spec +ĠAnalog In +ĠciscoDiameterBasePMIB Compliance +ĠciscoDiameterBasePMIB NotificationsGroup +ĠciscoDiameterBasePMIB TrapCfgGroup +Softmax Layer +ðŁı´ółģ´ółģ¨ółĢ ¸ółĢ +ðŁı´ółģ´ółģ¨ółĢ ¹ółĢ +Human Readable +Ped ra +RN ASeq +kir by +qrst vwxyz +symb iflow +༠ĭ +ç¶ » +antes FormView +Ġist edi +Ġist agged +ramp ic +ramp Object +oph ie +ĠPA INT +Ġvc cs +ĠBang Seq +ĠBang Glob +ĠExclu ded +ĠRay Process +ĠRay mond +ibi ção +Ġroster id +Ġshadow List +949 096 +874 567 +Ġmaxim ise +AGTT TC +2337 58036 +HOOK OPTIONS +čĊčĊĠĠĠĠ čĊčĊĠĠĠ +ãĥĩ ãĥIJ +ĠChild ren +jnxMbgSgwGtp If +jnxMbgSgwGtp Mib +jnxMbgSgwGtp PeerGw +jnxMbgSgwGtp PrDnTPerPrAlrm +jnxMbgSgwGtp AlarmStatCounter +à°° à°¸ +WebSocket App +WebSocket SubscriptionManager +Conflict ing +ĠFilename NodeMap +Distributed Object +Permissions Error +Permissions AccessControl +aaaaaaaa aa +缩 è¿Ľ +缩 æĶ¾ +ĠSuite Split +ĠMyCustomAmazonReview NIPS +589 00 +827 25656 +Hn vs +JY THON +Mr Worldwide +Offer ing +OEE Objects +OEE CardObjects +Trend Strategy +Xp Y +jam o +jam alogger +kle ene +react ants +renamed ToFilename +renamed FromFilename +Ġfed SecAg +Ġaus ge +Ġaus reich +Ġadb ID +Ġspy ne +Ġspy ware +unzip ped +Ġearth quake +Ġ({} ), +Ġ({} )\ +ĠSparse Matrix +ĠShell CommandOutput +ĠCl ark +ĠFO GLAMP +ĠBreak s +ĠNested RenameAll +ddd ppp +lateral Tile +Ġdisambig uator +Ġdisambig uated +Ġminus Minutes +ĠChain Map +à®Ł à®° +ĠNeg ation +tello Flip +tello Move +MapperStatus Table +MapperStatus State +MapperStatus Entry +MapperStatus Resource +MapperStatus CmdStatus +MapperStatus AISE +MapperStatus RxTrace +MapperStatus MultiFErrs +MapperStatus OOFErrs +MapperStatus TotErrSecs +CANCEL INCENTIVEPROPOSAL +CANCEL RESPONSEWRAPPER +ĠATTRIBUT ES +ĠATTRIBUT ION +722 43 +Ber bice +BTS RX +QW Table +]+' ",' +candle stick +junit xml +æº Ģ +Ġê°Ģ ìŀ¥ +rod Displacement +Ġcategor ie +Ġdomin ion +Ġdomin os +Ġbatched TransactionConfig +('; '): +ĠPixel EncoderFactory +Instrument Values +9600 6409 +DECL TYPES +Coverage Algorithm +ãĤ³ ãĥ³ãĥ +ãĤ³ ãĥ¡ãĥ³ãĥĪ +Managed CustomImage +Managed PrefixList +Phot ons +Phot ography +Ġbandwidth s +Ġsymmetry Tolerance +Fixture ItemField +ĠWorkspace Service +Bandwidth PortNumber +ĠìĿ´ë £¨ +ĠìĿ´ë Ł° +ĠìĿ´ë ²¤íĬ¸ +1234567812345678 12345678 +ĠRectangle Mesh +Microsoft AMD +人åĥıéĿ¢ çħ§çīĩ +Gal axies +GAME OVER +Ill umination +Ill uminance +Por que +Ux M +VT PR +hib it +zf dir +zf index +ç¸ Ľ +è« ¸ +ìĤ¬ ëŀĮ +Ġni vel +Ġmarg en +ĠSy nthesise +ĠSCHE ME +ĠPush Button +Reward Embed +="` ! +ĠEarth quake +Ġchk pt +Ġchk stab +1976 34169 +ĠCondition ally +ĠarrayT Index +ãģį ãĤĭ +PROGRAM ER +PROGRAM FILES +Charge Controller +Downloading Resource +lidar msg +ün ün +ä¸Ĭä¼ł App +ãģĹãģŁ ãĤī +ð¥ļĥ ä¾Ĩ +Gl ue +Mid land +Mid town +Padding FIFOQueue +Tal ha +]._ . +glo ver +tS NE +è» Ĭ +Ġion ospheric +robo corp +robo grammatic +Ġcra zyflie +Ġcra ssus +Ġinvest igations +Ġdra stically +Ġbid ding +Ġwl name +':[' _. +ĠFN DC +ĠDNS KEY +ĠMul her +ĠMsg Prefix +0200 1909 +ĠyPos Loc +ĠEigen value +ĠEigen values +ĠEigen vectors +ĠRPC Response +3209 0 +ĠHuman Name +inputfile Etot +Ġshuff les +ĠInser ting +ðŁı´ółģ¦ółģ Ńółģ +Compound AssignmentBody +Spider Py +ĠFileSystem EventHandler +ĠCombine Operand +ĠAttr Formatter +ĠAlready AliveException +Overview Text +Ġadministr atively +ĠRegular ized +ĠRegular GridInterpolator +Limits Helper +å·® 人 +spreadsheet ml +æĸ¹å¼ı ä¸ĭ +太åħ¬ åķı +缴æİ¥ ä¸Ĭéĩĩæł· +Bio SQL +Bio Nano +Dri ll +Dri bbles +Earth Feature +Earth Interior +GJ T +Male Setup +Ping Test +Rich ardson +TPU Strategy +Vote Trx +Wallet Balancer +Yellow Cards +cra shed +dC dz +rar åIJİç¼Ģ +rnd o +yM JoBB +è² ¨ +è² ª +è² ¬ +è² » +Ġáĥ ĵ +ĠÙĦ ا +ĠÙĦ ÙĨÚ© +Ġоб ÑĬ +Ġоб ÑĢабоÑĤ +itz ky +0007 01682 +0007 57657 +('$ \\ +('$ '+ +quil file +Ġhal ves +Ġhal acha +Ġhal fnhalf +Ġya par +ĠGrad Scaler +ĠWR ONG +Prote ctor +DataGenerator Cfg +Ġserv ant +âĢ¦ ' +Ġtemper ed +Prior itized +á»į i +á»į eo +ĠæŃ ¦åĻ¨ +ĠctspVlan ConfigGroup +ĠctspVlan SgtRowStatus +={}) '. +SUBJECT S +ĠUnsupported Format +åıijéĢģ æ¶Īæģ¯ +EXECUT ED +764 46202 +816 57 +Assert s +Mont ana +Natural EarthFeature +Pal au +Timing Foot +WAN Pil +±ółģ ¡ółģ¿ +غ ÛĮر +ç¢ ij +Ŀ¼ ë©´ +oro ot +Ġtre ys +Ġtens ordot +Ġ"] ;\ +lomb scargle +Ġdup lified +ctu dir +ĠSal ary +Ġger çek +amd secs +ĠPed antic +ĠPed alboard +='{ {" +ĠDot ty +ĠDot Map +ĠDot StringsEntry +ĠGC J +ĠUpper case +anno optimize +later ale +shortest Distance +ĠPlots Producer +Assets PriceResource +ĠByte Util +Rotate XYZ +ĠJoint State +ĠJoint Commands +ĠCHECK POINT +ĠCHECK POINTS +Ġangular axis +åĿIJ ä¸ĭ +測 a試 +COMPONENT NAME +æ·»åĬł ä¸Ģ个 +#, ## +Far mer +LN nz +Nb Wh +Nb OfTx +Ox nP +Van illa +Zj NZ +aJ Q +nC z +Å© a +Å© i +ĠER A +ĠER F +ĠER ASED +Ġè¿ĶåĽŀ ä¸Ģ个 +Ġè¿ĶåĽŀ æĢ»è¡Įæķ° +meg set +meg ux +meg adriver +Ġfer enda +Ġnorth ern +Ġdh client +ĠTorch Trainer +ĠTorch Predictor +ĠTorch Categorical +ĠTorch Scorer +ĠTorch DistributionWrapper +ĠMor av +ĠGal ileo +2727 2727 +Ġkeystone auth +ĠnumberOf Nodes +ĠnumberOf Frames +ĠnumberOf Steps +ĠnumberOf Interfaces +Ġdisco Mode +Ġsponsor ship +Ġг оÑĤов +Ġelev ations +Ġlibt bb +Than h +ĠSoft Butter +ĠChunk Registry +Submit Cone +ĠCompare Methods +Overall LSConnState +ĠSubscription Adjustment +Ġwinning BetThreshold +OPTIM IZATIONS +æŃ¥ æķ° +Digit One +ĠâĪ Ī +ĠâĪ ŀ) +786 9 +Dyn Class +Dyn Interface +IU PUI +Mirror Mode +Rock y +]? $', +bir atnag +bir atchowk +hin av +nation Idx +wine hq +Ġtur bulence +Ġtur icreate +Ġ'~ ': +("================================================ ==============") +("================================================ =======") +ĠSpider Monkey +ĠLive Lobby +Ġdese mp +Ġdese ased +Ġxpath helper +ĠEL MO +Ġresistance List +Ġtyped py +Ġshrink A +AGCA UG +AGCA ACG +ãģ¿ åIJĪãĤıãģĽ +ãĤ« ãĥ¬ +ãĤ« ãĥ¼ãĥĸ +fract al +ĠìĤ¬ ëŀĮ +ĠìĤ¬ ìĿ´ì¦Ī +áĥĿ áĥĴáĥłáĥIJáĥ¤áĥĺáĥIJ +Road Runner +çĶµ è§Ĩ +ĠFlash textBackend +Decl Ref +Ġbring ing +ĠAuthorization CodeGrant +Ġrolling cs +fabric ation +ĠSecret Value +ĠOptimization Task +ĠAggreg ating +æľįåĬ¡ 端 +735 991 +BALL OON +Miss oula +Pep ulators +Syntax Path +SENSOR PROPERTY +bel indab +Ïī Ïĥη +Ðij Ñĭ +Ðij аÑģкеÑĤ +Ðij ибли +Ġpag ure +Ġpag ify +lai Product +ĠCV PR +ĠLan caster +ĠLan çamento +ĠLan diaEnv +Recogn ize +observ ability +ĠGer ando +1415 9265 +ĠHard coded +Ġscreener result +Ġ'-') })", +Ġ'-') }/" +Ġdistro dict +ãĥ¬ ãĥ¼ãĥ +sqr thann +не Ñĩ +Subnet Group +Materials Manager +Prime Max +Prime Transactions +Prime Award +Prime UTR +Flash Test +Flash Size +ĠPeer Read +ĠPeer IdInvalid +bibli ographic +çĦ¡ æ³ķ +ĠWSGI Adapter +BRE ATHABLE +CLOCK S +Hierarchy Tree +Middle sex +Minecraft Forge +Plane Stats +Plane Position +Rand Idx +Yy Mj +hdl c +ئ Ùħ +ئ ÛĮ +๠ī +Ġç ok +animal Info +titan ium +Ġperi ódico +Ġperi helion +Ġmus i +Ġmus ical +Ġbur ger +Ġbur sts +ĠSlack ApiError +Ġgan bon +Ġgan joor +toy rnn +ĠFIR MWARE +='- ')) +ĠOcc upation +ĊĉĉĊĉĉ ĊĉĉĊĉ +Ġmeld en +appe xec +appe ars +Ġja xboard +ĠGO ES +ĠWidth s +Ġanon link +Ġcolon na +AGU AA +cython ize +Ġarrange ment +ĠStats Bomb +TimeSeries Panel +Ġoffers A +ĠTyped ListType +Ġnonlinear ity +ClassifierEthernet Type +ClassifierEthernet Table +ClassifierEthernet Entry +ClassifierEthernet Inner +ClassifierEthernet PacketFormat +ả o +ả u +ả y +UCg W +Ġnaive bayes +pearson r +Liquid ator +#----------------------------------------------------------------------------- # +MNOP QRS +ĠrlHistoryControl Index +Ġlandscape s +Combination Algorithm +vvvvvvvvvvvvvvvv vvvv +ĠOPEN STACK +弹簧 éķ¿åº¦ +AIR TABLE +Bz r +Ej er +Ej ecutar +FORE CAST +Lk S +Qj UZ +dsp ilt +kern ing +mL vl +Ðļ ом +Ðļ он +æŁ » +ì¶ © +ì¶ ľëł¥ +Ġ################################################################################ ##### +incenti ve +anth os +0008 8729 +Ġremo vida +Ġremo vidos +Ġremo vinator +Ġble ak +Ġbil ly +Ġbil hetes +tektronix OA +etun imi +ĠScal er +ĠScal es +ĠFed Avg +ĠFed Learner +ĠIV no +ester no +9612 8803 +COS MOS +Idle Time +Idle Code +Idle Worker +åıį 转 +Ġ"\" [' +autoc lass +autoc reate +autoc apture +à®° ண +à®° à®Ļ +Ġtraced Stories +Ġinvocation Dictionary +ĠctspIf SgtRowStatus +ctspVlan ConfigGroup +Ġclamp ing +ĠPostgres Operator +Ġد ÙĪس +Ġprotect able +Ticket APIMixin +Aggregate Error +#-------------------------------- # +#-------------------------------- ------------ +Pandas DataFrame +Sil va +Sil houette +Sam uel +VD UP +gE AgEA +×ŀ ×ķ×Ĵרפ×Ļ��Ķ +æ¥ µ +Ġا ÙĬ +Ġا Ù¾ +Ġú ltimos +sty led +Ġclu mps +Ġfram enet +Ġinform ar +Ġinform ado +Ġdip de +('-------------------------------- --------') +ĠTLS v +Ġling id +'][: ][ +ĠPeriod s +ĠDES IGN +ĠDES AFIO +Ġvoting policy +precip itations +Cond or +ogen ize +ogen ised +0518 51994 +Ġident Pos +Ġtektronix OA +ï¼Ł ', +ĠIDXGI Resource +Ġmonkey Patch +Subset or +Subset TransformerWrapperDF +PortStatus Table +PortStatus Number +PortStatus Entry +PortStatus Link +PortStatus Media +PortStatus PortState +PortStatus SpdDpx +PortStatus FlwCtrl +PortStatus AutoNego +ĠAppro pri +ụ a +ụ i +Ġhydro gens +åĭķ è©ŀ +ĠCURRENT S +æIJľç´¢ åĪĹ表 +'& '], +Skeleton s +Wake up +[/ ] +[/ ]?$', +aB c +aE WM +jun tar +nF calls +udata ptr +æħ Į +æħ ķ +ç¿ ł +Ġæķ°æį® éĽĨ +decess or +Ġpsu A +Ġpsu B +Ġnh au +Ġnh Æ° +Ġsist emin +urg ia +cohort e +dise ases +otp base +ĠTel ler +ĠTel ink +ĠFer mi +ĠBroadcast ing +ĠNC CL +ĠGtk DocComment +Ġkine tics +Ġkine matic +ecs ke +ĠchkpntTrap OID +neuro image +neuro svn +pointcloud npz +Ġloser Code +Ġloser Mu +Ġloser OgMu +2813 1239818 +ADJ USTED +âĸĦ âĸĪ +Ġìĥ Īë¡ľ +Ġsmiles Dict +ĠLogLevel Response +ĠLogLevel Request +á»ı i +á»ı eo +Calibration Assertions +Override Provider +ĠRegistration Response +ĠíĮ ¬ìħĺ +æĭ¿ åĪ° +SIGNATURE MESSAGES +Monthly Income +åĮħåIJ« 桶 +åĮħåIJ« download缮å½ķä¸ĭ +Migration Required +ìĺ¤ ë©´ +,... ]. +=$ (_ +Dhcp Options +Dhcp Setting +Deriv atives +Firmware FileName +Jl MB +PEN DED +QD ab +hE Ug +sds rc +Ä° K +Ù¾ ا +é² ľ +Ġç £¨çļ® +Ġç łĶ究 +0094 1961 +0094 07024 +Ġdynam ixel +Ġdraft s +Ġtoml kit +threaded Response +ĠSlot MPolar +ĠLB aaS +Ġdepart ures +Ġproble mas +ĠBenchmark s +ansi string +Ġant lir +2263 37 +ĠConversion Error +ĠConversion FailedError +2633 52 +Ġperimeter x +Tox icity +Ġdocx file +mtl novel +Ñģп ÑĢав +Ñģп аÑģÑĭлкÑĸ +äºĶ æł¼ +äºĶ ä¸ĥ +Pretty TimeDelta +è¯Ħ åĪĨ +Ġfuncion a +Ġfuncion alidades +ủ i +Ġdescendants Collector +ĠкоÑĤоÑĢ аÑı +BasicAuth ConfigArgs +页éĿ¢ æıIJ交 +åıĺéĩı PATH +æĪĸèĢħ ç¦ģçĶ¨ ++-+-+-+- +-+-+-+ +>- ?\ +Ek sterne +Nk Y +Nor way +PUR GED +PUR BBANK +Pref light +eF its +glass face +oke x +pink y +¸ë ¯¸ +פ ×Ļ׾ +anneal er +spr inger +Ġvul gatus +ĊĠĊĠ ĊĠĊĠ +ĠEm scripten +pho enix +ĠGPT J +ĠWind ing +0614 1411 +2777 78 +fair field +fair play +Ġzf ec +HEALTH STATUS +whit en +ĠGeneration Utils +Manual Cleanup +Manual TimeSetting +áĥ£áĥ ¨áĥĶáĥ +TERMIN ATED +yyyy yyyy +metas chema +æľĢå°ı çļĦ +ĠколиÑĩеÑģÑĤв а +ĠколиÑĩеÑģÑĤв ам +<_| > +<_| ;^{;^{;^{;^{ +Cod on +Front end +IPT C +Lan tern +SLA AC +Tar Info +Tel ink +Xml Attributes +Æ¡ i +θ εί +θ αÏĥ +Ðŀ ÑĤ +Ðŀ б +Ðŀ ÑĪиб +èį ¯ +Ġcash Flow +Ġfq file +Ġfq dn +Ġsnd Bonus +Ġmad lib +ĠSam melr +ĠCut off +ĠCut Strategy +ĠImplement ations +ĠMD Traj +ĠMol erTest +presen te +presen tive +Ġbeg gining +ĠEmp loyment +ĠGMT CLib +Ġ508 62 +Ġrace car +grav ite +grav Bodies +ĠHer zegov +Ġweird ness +ĠInflux Db +Ġnewton s +ĠPara StorageKeeper +################################################################################################################ ########### +Spline Map +sdc list +Anti derivative +Anti Horaria +Ġdescendant Cells +BRANCH ES +ää rin +ĠLayerNorm GRUCell +]|[ !*\(\), +ë§Į íģ¼ +fltStmt Action +fltStmt SrcPort +fltStmt DstPort +BoundingBox es +éĤ®ä»¶ åĪĹ表 +éĤ®ä»¶ éħįç½® +Exploration RightsModel +>.* )/ +>.* )$', +Broad band +Rfc Enable +Sch utter +Sch norr +Sch uyler +Tho usand +nim base +β ιβλιογÏģαÏĨ +Ġåľ¨ æīĢæľī +tik novel +Ġplas mas +Ġplas TeX +0015 1885 +chin ch +("-------------------------------- ---") +opti track +ĠSide Bar +ĠSky borg +Ġlk is +ĠAUC Metric +ĠDy lan +ĠDol ores +ĠMut uelle +ĠBalance Of +ĠBalance Sheet +ĠUsd Shade +Ġenh ances +1817 633709 +Ġrob odk +Ġopent racing +ĠRepresents Float +POL LED +ToFirst Name +ĠDataType Util +ĠDataType Converter +Ġfade Color +Ġfade Params +GGG mqooYY +éĢ£ çµIJ +ĠVertical Flip +SCHED ULES +ĠìŀĪ ìĿĦ +ĠSpectrum Library +loidy PlotDir +ãģķãĤĮ ãģ¾ãģĻ +698 029 +Basis Features +Frag Color +IAS et +Ld Js +Margin Phase +SOR ENTO +Sdk InstallAttempt +Tro ves +TAL colors +grow ing +mux ings +mosaic Dir +oli vier +sold List +æ¾ ĹèĻİ +èĮ ĥ +ëIJĺ ìĸ´ +Ġ~~~~~~~~~~~~~~~~ ~~~~~~~~~~ +rear range +rear ranged +anh ulle +Ġcó lera +lil lirier +ĠSys BP +ĠCached SchemaRegistry +Ġld da +Ġld Distances +spa vent +ĠFran çois +ĠLot terie +ĠDan ach +ĠDialog Message +ĠBinder NotFound +ĠNA ICS +readI List +ENO DEV +chess bot +1834 985 +Ġrack ed +replication Params +ĠConfirm ation +4585 24 +Boot Version +Least Squares +ãĥĨ ãĤ¹ãĥĪ +åħ¸ åŀĭ +ĠCalc Attrs +menuitem radio +åįĸ ä¸Ģ +Linked In +LoopDetected Table +LoopDetected Number +LoopDetected Entry +LoopDetected Action +LoopDetected CurrentStatus +LoopDetected Resumed +LoopDetected StateEbl +è§Ĵ 度 +ĠPortfolio Lab +ĠdocsLoadBalGrp IsRestricted +å¦Ĥä½ķ æľ±æѦ +Deployment ToHorizontalPodAutoscalerLinker +Electric ité +ĠEquipment Holder +YesNo Type +æīĭæĮģ æĬ¤çħ§ä¸ªäººèµĦæĸĻ页 +客æĪ· ID +æĬ¤çħ§ åħ¥å¢ĥ +BID BASKET +Stem Pooling +Wed strijden +Would BeAssigned +YD CI +bubble s +cfn Properties +iB log +iE Qi +kia de +qo es +uD FFF +wake Reason +wake UpPins +é¾ Ļ +ï½ Ķ +Ġ**************************************************************** *************************** +Ġrebate Expiration +Ġbat H +ĠTran scribe +ĠSho vel +ĠSho oting +ĠCG emv +ĠFC Repo +ĠMAN DATORY +ĠMAN UFACTURER +ĠMAN UALLY +ĠMAN AGEMENT +ĠMix ing +ĠMix ins +ĠBill Importer +ĠBank note +ĠWi ener +ĠWi Fi +Confidence Bound +Ġopens lides +Ġaltitude s +9366 31 +Ġram da +Ġram disk +1906 21 +((? <=\ +explode Obj +CONV SEG +xytext B +uniq If +ĠCoin base +Computer System +Ġsaf exl +Forbidden Exception +ĠLeaf DataList +ĠPoisson ElasticNet +Ġæł ¼ +Ġæł ĩ +ĠSTD DEV +Ġcaracter isticas +Iterations PerEpoch +2167 82 +ĠMonte Carlo +SYNC DB +Masked Bijector +ç§Ĵ åĨħ +standardi zation +ĠUniversal Automatic +torque Rod +Mismatch Error +TABLES PACE +Utter State +(... )) +Elastic ity +Elastic Search +Kine ctA +bab ies +bab boon +cQ TT +gloss is +hV qu +mother board +ÈĻ at +Т ек +Ġر د +stk off +Ġ"! "])) +Ġ"~ ", +Ġnul lptr +getApp Config +getApp Metadata +Ġhab itable +Ġdetach ing +Ġpars able +ĠBon jour +ĠBon jours +ĠNIC OS +3273 148975 +Ġano atual +ĠHy dr +ĠHy steresis +ĠHy SDS +announce ments +Ġlap se +5708 04 +4467 97913 +ĠSeg ments +4609 66 +Observation Date +Observation Expression +ãģł ãģĹ +stacks Pairwise +grat itude +Ġbots Online +Transactions Response +ĠCharge ment +Adaptive Mode +产 åĵģ +åħ± 享 +Ġviv intpy +"}} }' +Ġastro ML +ĠctspIpSgt AddressType +Ġescol he +å®ŀçİ° äºĨ +Persistent DictClient +Radio Button +Grey Scaled +ëĤĺ ëĬĶ +ĠTunnel Endpoint +TrustSecPolicy MIBCompliances +Dns Name +Dns Setting +Fort nite +Mand reel +Mand arin +NAS Net +Tweet Output +bys ource +fwhm RMSF +gio vann +Ä© a +Ä© u +è¼ ķ +Ġaver ager +0009 57045 +0009 32505 +00010011 0000000011 +("------------------------------------------------ ") +("------------------------------------------------ --") +ĠSHO GUN +ĠSPAR K +ĠCam adas +ĠCategorical Field +Ġhá stafi +ĠPoll ForActivityTask +ĠLen nyBot +ĠLAT EST +ĠMiss ouri +ĠMultip lic +ĠMultip lication +ĠMultip lies +ĠEE PROM +fog lio +ĠUr sula +Ġanalog ue +Ġanalog ous +Ġenroll Id +Ġprefetch ing +87427 7 +9757 84 +Ġspaw ning +bean count +bean ContextSupportObject +airmass format +KeyValue Array +Ġjoystick s +án tico +Neighbor hood +Expired ObjectDeleteMarker +bulge Found +consider ando +Ġsynth text +Ġsynth tool +Ġê¸ Ģ +Years SinceLast +funcsynopsis div +ĠWaiting ForHotword +suggestion Id +Absolute Max +Absolute Min +ĠGRAPH IC +ĠCONTRO LS +åIJ¯åĬ¨ 线ç¨ĭ +BandwidthConf Table +BandwidthConf Entry +'[\ (\ +."] ' +Nl MeansDenoising +Pending Panel +Rolling Micro +Rolling Macro +Sed Net +Sed AFactor +Sed AAdjust +cin que +fon ti +fon do +smax P +×¢ ×ij +èIJ ¨ +stor ia +Ġtet ris +arri ving +Ġih rem +Ġner ve +addition als +Ġwget Results +("... ")) +asg op +ĠSpo oq +ĠCAL IFORNIA +ĠCmd Line +ĠAbri mos +']+' #'+ +Ġconc ave +ĠPal m +ĠPal indrome +ĠIll umination +obb dets +ATO MS +ATO GRAPHY +Street Client +maximal file +piv ots +Ġnotion al +ISSU ANCE +Reser ve +Reser voir +]*\ )\( +SIZ ED +ĠCover ed +ĠorderInformation LineItems +taxon omic +NEWS LETTER +NEWS PIDER +PortConf Table +PortConf Number +PortConf Description +PortConf Entry +PortConf PortState +PortConf SpdDpx +PortConf FlwCtrl +ĠCalib Calorimetry +аг ÑĢамм +CREAT ING +CREAT ELINE +CREAT ETABLEREQUEST +ĠNotebook ManagementError +Neighbour IdStringList +denorm alized +uesta Resource +ĠMOD PATH +UPDATEPARTICLE LATENCY +ĠпÑĢовеÑĢ ка +ĠdocsLoadBalBasicRule Table +ĠdocsLoadBalBasicRule Group +ĠdocsLoadBalBasicRule Entry +Ġprojek tit +ĠTrigger SleepAction +åIJİçļĦ å¯Ĩçłģ +xAuthConfigExt Table +xAuthConfigExt Entry +ãģ£ãģ¦ ãģĦãĤĭ +Af firmative +Bob Cat +Kal imantan +Tim ers +jer zydziewierz +sos petto +zq mixed +aters hed +dele ter +ĠfuniVcl Fa +Ġnsp ins +Ġsiz y +("{}/ {}". +("{}/ {}_ +ĠSorted Set +ĠAst roidManager +sper seg +0192 0385 +0192 197634169 +ĠPAY MENT +ĠPersist ence +Recursive Func +foil Import +Ġhexa gons +Ġ______ __ +1851 99146 +9354 24 +ĠHex adecimal +Ġcodepoint N +cyl inders +ãģĪ ãĤĭ +ĠChrom osomal +PRINCIP ALS +ĠEncryption Type +ừ i +ừ u +Ġctl Grp +ä¹° ä¸Ģ +Trig Status +ĠMODI FIER +пÑĢ им +пÑĢ оÑģÑĤ +ASTER OID +ĠDependency File +Guard Band +ĠFigureCanvas Agg +ĠFILTER ING +BIC DOS +Du quesne +Poll ForActivityTask +Spi ke +Spi Dev +iN ed +ovs db +ðŀ ¥ +relax ing +Ġpgm Name +Ġpgm var +Ġnat cap +Ġnod os +olc Sp +__'] .__ +getTransaction Count +ĠSpi ke +ĠCT As +ĠCp ds +tou pels +Ġandroid AccMag +ĠFrench Customer +quar tet +truck s +ĠDie IfFiles +="{} ">{}[- \ +>[- &\ +Adiabatic MSW +CIT ON +EMO JIS +Hcal Plugins +JAV AFUNCTION +Lacp StateDisabled +Lacp StateEnabled +Mik hail +Pier re +Vwu F +Vwu h +clp OrganisationId +flashed Fly +hift KeyMask +kow itz +lph All +lph Obs +sle pt +íİ ĺ +íİ ĺìĿ´ìĬ¤ +ččĊĠĠ ččĊĠĠ +ĠоÑĢ деÑĢ +lef texpr +Ġcrack ing +Ġptf adapter +Ġfocused Cells +Ġ"]] ", +hee zy +Ġodk az +Ġmop idy +Ġmá quina +Ġemiss ary +Ġblighted Pixels +Ġwet test +charging tariffs +(') ','') +setAngle AndDistance +asf array +ĠisUsed Shadow +ĠSHE LL +ĠSHE ET +ĠCr tomo +Ġhil um +ĠPt Max +ĠPBE s +ĠIso SpecPy +ĠIdeal Gas +ĠLon go +Ġdeb fullname +ĠDub lin +acad admin +Represent ing +Represent ativePower +0216 38144 +Ġxhat minus +..# .", +..# ..# +ĠEquival ences +},{" _ +ĠGa ifax +ĠGreg ory +Ġcoli coords +Ġheal py +curContrast SaImagePatientNum +Ġkid ney +1345 96128803 +ĠHTT POk +ĠHMM ERModel +ĠInvest ig +ĠInvest igation +Ġlefto vers +Ġaccomp lish +Ġaccomp anied +Ġnewlist t +AGUU UU +goma cc +9807 73 +ĠYaml ConfigurationParser +ĠbaseURL SSL +Ġregress ing +sgf rlf +sourceFile Values +sourceFile Keys +ĠArn old +ĠÐIJ д +GetDriver ByName +5834 349 +prsa Obs +learned mgrstate +5906 02001909 +ĠGeneralized Binomial +ĠGeneralized Trinomial +ãĥĭ ãĥ¥ +PLC JS +Interp Dat +Ġglance client +åĪ¥ è¨ĺäºĭ +uffing ton +ĠìµľëĮĢ íĴĢë§ģ +rslt name +GETBLOCK RESPONSE +ĠPRODU CTION +GGTC GCTATACT +ĠPerimeter ator +æĪª åĽ¾ +ĠOpenID Schema +Ġpró ximo +LightLink ConnectionIndex +ä¸įä¼ļ 被 +zenith distance +Expire Date +Decor ators +ĠTravis CI +æŀĹ åŃIJ +ĠCoded OutputStream +ĠcdbpRealmKnownPeers Index +aeiou y +StorageClass Linker +cumul ants +Ġ--------------------- # +kilo meter +Ġíĸ ĪìĬµëĭĪëĭ¤ +Ġelectro Pyy +Accepted PacketRate +collectd mon +æµ· å¤ĸ驾çħ§ +ElLeft Reflector +ElLeft ReflectorDist +ElLeft HyperbolicReflector +ElLeft HyperbolicReflectorDist +ç±³ çŃIJç§ijæĬĢ +Bandit Learner +åıªèĥ½ æĺ¯ +äºĮåįģ ä¸ĩ +Ïĥη ÏĤ +fltSpec Index +fltSpec Version +GMCC ardObjects +blendShape ByNode +çĪ± 丽 +æ·± è¯ģ +Attachments View +å¼łæĺ¯åı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ +å¼łæĺ¯åı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢ +Æ°á»Ł i +Æ°á»Ł u +candy cane +âĸĪâĸĪâķĶâķĿ âĸĪâĸĪâķij +CCCGE g +ClassifierIpSource IpAddress +ClassifierIpSource IpMaskBits +ClassifierIpSource SocketRangeStart +ClassifierIpSource SocketRangeEnd +ClassifierIpDestination IpAddress +ClassifierIpDestination IpMaskBits +ClassifierIpDestination SocketRangeStart +ClassifierIpDestination SocketRangeEnd +cPPPoESAbnormOff PerThreshold +cPPPoESAbnormOff PerAlarm +Ġê³Ħ층 ìĿĦ +8765432 0988 +({})) ". +Mirrored Ports +ClassifierEthernetSource Ports +ClassifierEthernetSource MacAddress +ClassifierEthernetSource MACMask +ClassifierEthernetSource Trunks +HEALTHCHECK OPTIONS +DryRun Operation +身份è¯ģ人åĥıéĿ¢ æĸĩ件åIJį称æĺ¯abc +è¯ģ件éĻĦ件 缮åīį +âĶģâĶģ âĶģâĶģ +ĠTaggedItem FormSet +Ġ转 åĮĸ为 +åĽ½å¾½éĿ¢ æĺ¯def +Abri r +Bent ley +Evidence Type +Geral do +Lobby Populate +Own GroupId +Own UserId +Ram Size +TAN ButtonText +Yolo sec +^* _{ +bene ath +ete cho +glow pick +iar ou +nvis ii +squee zed +varg en +çĩ Ĵ +ëĮĢ ë¹Ħ +ĠÃŃ cone +Ġâŀ Ł +Ġâŀ ¡ï¸ı +onoff glides +secon dext +Ġtwin x +dela xes +Ġiz nos +medic ine +Ġcance ls +Ġcele stial +Ġ"?? ?" +Ġrek ja +Ġrek ordbox +Ġrecurs iva +ĠdÃŃ as +Ġbounce time +maint ype +getSet Brightness +getSet DiscoMode +Ġtom ada +ĠTol erance +thir ds +thir teen +ĠSak ai +ĠCROSS OVER +ĠAtiv idade +ĠAward SearchView +ĠAxon DeepSeg +ambo anga +9904 55 +ĠFac ulty +ĠFavorite Place +ĠLam bdas +ĠLam SlotMag +ĠLINK ASLI +Recover Time +ĠMULT IP +ĠMink Loc +ĠMink owski +Ġprotot ypical +pymd mix +xcor r +aperture c +ĠBuff Id +ĠBah r +Insufficient PrivilegeError +ĠRail Env +ĠROUT ERS +epide mies +1827 296 +dai lies +0466 1834985 +llll ll +Ġopend ap +grace fully +ĠHIT RANLinelist +Ġcompet ências +ĠKan ban +filmo graphy +filmo graf +ĠYANG Bool +ĠYANG ListType +ĠYANG DynClass +DIA LECT +Noisy Dataset +Compressor Finder +Ġgovern ance +äºĴ è´¨ +Preprocess Response +NEIGH BOR +supplement al +áĥĵ áĥĶáĥijáĥIJ +OrEmpty Docstring +Ones Complement +IsNot My +ĠAlarm Setting +Ġannots Graph +ĠPermutation Group +[\" | +Ġ리 íĦ´ +ĠëIJĺ ìĸ´ìŀĪëĬĶê°Ģ +procMan ForJob +åĢŁ ç²® +RAID VolumeTrap +grib file +ĠInvalidArgument Exception +ÙħÙĦ ØŃÙĪظ +9084 887 +RotMat NP +ĠSpell Checker +#------------------------------------------------------------------------------------------------ ------------ +MILL ION +dosya Ismi +åŃĹæ¯į çļĦ +ĠWorking Directory +corrector Status +ðŁı´ółģ´ółģ´ółģ ³ółģ +ðŁı´ółģ´ółģ´ółģ °ółģ +fmri prep +åĬłå¯Ĩ åIJİçļĦå¯Ĩçłģ +ĠApiKey Model +åįķä½į åIJijéĩı +81893 004 +Ġhybridi zations +>(.*? )< +ê¸Ī ìķ¡ +ĠLiquid atable +ä¿ĿæĮģ ä¸Ģèĩ´ +解åİĭ åįķ个 +解åİĭ æķ´ä¸ªçĽ®å½ķä¸ĭ +ĠALG ORITHM +Triggered Spectrum +æīĭæľº åı·çłģ +Immediate Context +SparseSegment Sum +Ġbibtex parser +Ġbeacon ing +ĠLowest Period +Photon Luminosity +Ġprivilegeslist Count +ĠобÑī иÑħ +ĠÑĦÑĥнк ÑĨиÑı +æŁIJ 个 +æŁIJ äºĽ +æħ¢ æĹ¥å¿Ĺ +<<<<<<<<<<<<<<<< <<<<<<<<<<<<<<<< +èĮĥåĽ´ åĨħ +ĠDagsterInstance MigrationRequired +ĠBlaze CashBuybackAuth +ĠëĤĺ íĥĢ +ĠTrafficLight Error +1100100000000 11111111110 +âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ +Anon ym +CORM UUID +Dual MediaSwapped +Emotion BasedD +Fed ora +Fully Connected +Liter atur +PDE Problem +PERS P +PERS PECTIVE +Sop ron +Tre asure +VINT AGE +Warp Image +fet al +oé t +tti var +ĠåĬłè½½ æķ°æį®éĽĨ +relig ions +Ġtessel ation +decompressed File +Ġcrl fs +Ġpst ary +Ġpain el +Ġapro pri +Ġapro vado +Ġnes nel +Ġnes mdb +Ġdop hon +Ġmog rify +Ġmant ém +Ġmangle Function +Ġ#================================================================ =========== +ĠTob ago +ĠTune in +ĠSmo kingStatus +ĠCIR RO +ĠCrowdsource Form +forgot ten +ĠFab ian +listof data +Ġhan alearn +ĠPg net +ĠLM Logger +ĠLdap Usage +Ġdelt ree +ĠDID Type +ĠOmni Error +ĠBern ard +ĠBounded Tensor +ĠEP ICS +worl de +ATGTT AGCGT +9233 18636 +ĠGan esan +Ġcoordin ators +Ġcoefici ent +ĠVapor Pressure +weig tedAverage +Ġleaky ReLu +01100 10111111 +01100 010001001100001001 +ĠKr onecker +9597 888711769 +AGGG CG +Ġdiscu ssing +Desired Capabilities +Ġ('< ', +bek istan +ĠcurrentQSize Read +ĠXGBoost Node +Cher bourg +THTH THTH +DeConv Clean +Ġimgur python +Travel Time +QUICK NAV +WARM STEP +Ġ"\", \" +Ġ"\", \"" +ĠWei bo +Adres se +FOUR CC +NNTP Base +Solo mon +Ġconfusing ly +EndOf Container +Phys Rev +GEEE I +éĢĤ åºĶ +ĠSham al +ĠSham aliyah +ĠAdverti sing +Ġmoder ns +ĠLOWER CASE +Ġ"{}, {}". +SUGGEST IONS +Memcache Set +Memcache Increment +LocalLogging State +syl labus +ê°ľë ³Ģ +ctspAuthorizationSgaclFail Info +ctspAuthorizationSgaclFail Reason +åĮĹ äº¬ +surgery tf +ĠPrime iro +ÛĮس ÛĴ +AUX HEAT +ย าวà¹Ħม +ĠdocsLoadBalChannel Entry +ĠdocsLoadBalChannel IfIndex +Ġharvest ed +CALIB RATED +è¨Ĭ æģ¯ +Ġsteep ness +Fitness Max +Catalogs List +Ġhtt mock +cdbpPeerStatsDW CurrentStatus +cdbpPeerStatsDW ReqTimer +FbxAnim Layer +FbxAnim CurveNode +SqlMySql T +ĠMetricSummary Response +ĠMetricSummary Proto +Adjacent Edges +trackOfThingsProducerD Plus +ĠBuffered S +RenameAll Serialize +ĠConcaten ation +Ġcryst als +ưỡ i +ưỡ u +Pascal VOC +ĠCRUD dy +Alternate KeyMask +çĬ¶æĢģçłģ æĸŃè¨Ģ +EquipmentClass Form +Approx imation +AAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA +âĸĦâĸĦ âĸĦ +thalpy Vaporization +ReplicaSet ToHorizontalPodAutoscalerLinker +ReplicaSet ToDeployment +actionBarDefault SubmenuItem +Ġgibberish Output +800000858 00000000000000000000004 +𤼵 è·¡ +ĠFlyter Sender +Ġخارج ÙĬØ© +åį·ç§¯ æł¸ +UNIVERSAL DIFF +Ġìłijê·¼ ìĿĦ +ĠÑĢезÑĥлÑĮÑĤаÑĤ Ñĭ +immobilizer Release +immobilizer Lock +loadTestsFrom TestCase +Vmomi Support +ĠMATERIAL IZED +Ara koon +Billing Record +CNO SPFC +Dew Maple +DAB ING +FRE ETEXT +GAG GCGAAAAAAA +Kay naklar +Mud OPDensity +Mud IPDensity +Nue vo +NES DAY +Punct Tokenizer +Slit Separation +WAT CHED +boun cer +blighted Pixels +blighted HSV +gluster fs +hun ting +hrp an +kil pasarja +kelp Props +lance lot +ngs im +qPos AvgLoc +qNeg AvgLoc +vzt mpl +Îķ ί +Îķ ξÏīÏĦεÏģικ +éŁ ĵ +ì° Įê°ľ +ervices Id +Ġtj list +Ġigu anas +Ġpit op +Ġpis ze +unf olded +unar date +univers ities +Ġech oscope +ĠeTH ls +Ġbtc Valuatin +1168 93 +Ġwolfram alpha +Ġwszyst kich +Ġ[# ] +isnew tskset +isnew checktask +ĠTangent Space +ĠSup orte +ĠSMAC CV +ĠSNI PE +ĠConse quent +ĠCron Job +ĠCodon Lprob +updat eneighbour +ĠFee Code +quater x +Ġdess iner +Ġdels um +Ġdels uper +ĠDemon strate +ĠDemon stration +ĠvÃŃ tma +ĠvÃŃ timas +Ġordem Servi +prest ig +prest odb +ĠEta Max +ATGCT GGTCGCTATACT +ĠNI RO +ĠVic tim +Ġkir bi +Stored InfoType +15908 29943 +Ġalumn o +resultN Var +resultN FilePath +ĠKaggle Word +Ġexterior Color +ISOT ROPIC +TextLine Dataset +ĠYan dex +ĠXcode Project +ĠExerc iser +ĠExerc ÃŃcio +gencode vm +Deal er +ĠProx imity +insurance claim +GetKey Code +ĠParametric DB +Ġoverla id +Ġoverla ppath +ĠCohort e +bao chen +20211 016 +Interrupts Trap +TxGap Ind +ĠImageShare Form +Ñģказ аÑĤÑĮ +COLON IZABLE +ĠìĽIJ ëŀĺ +RuleSpec Context +Orth ogonal +ĠsendText Total +Counting Thread +Soil IncRate +GGGC AGATGATGTC +ĠActiv ations +ä¸Ģå¼ł 个人æī« +ĠAnki JsonExporter +PREDICTION CLASS +("/")) - +ClassifierLog State +ClassifierLog Notification +BatchReceived Method +BatchTransferFrom Method +ĠctspOperSgaclMapping Group +RateCoeff Estimator +multiplic ar +ĠInvalidOperation Error +Ġpotato es +广 åijĬ +поÑģ иланнÑı +ä¿¡åı· åIJį称 +SFPT emperature +SFPT xPWR +SFPT xBias +еÑĤÑĮ ей +éĹ´éļĶ æŶéĹ´ +æ¨Ļ æºĸ +æ¨Ļ 籤 +æłĩåĩĨ çłģ +Octo Print +游 æłĩ +Ġspoof ed +æŃ£éĿ¢ çħ§çīĩ +ĠincomingLaneNo G +Historical Record +ç²ĺ è¿ŀ +ç¦ģ è»įæķĻéłŃ +Ġíķ´ ìķ¼ +ĠcdbpLocalIpAddr Type +èĤ¯ æĶ¾ +ĠClickHouse Cluster +ĠoutgoingLaneNo G +ãĥķãĤ© ãĥ«ãĥĢ +æºĸ åĤĻ +ĠìĿ´ë¦Ħ ìĿĦ +ĠSYMB OLS +ĠTrusted UserJSON +ĠnumberOfMonths Changed +Missile Design +ĠOkta Collection +ĠLifecycle HookName +ĠLifecycle ActionToken +èįī åłĤ +æ¸ħçIJĨ æĪIJåĬŁ +Shock ConsumerType +ðĿħ¥ '), +ĠDEPLOY ED +dduConsumption PerManagementZone +ĠPreTrainedTokenizer Fast +å³° 度 +Cele bA +EAB WriteAlternate +Ful fillment +Fashion MNIST +Nob ody +PMAN DRainning +PMAN DFoggy +PMAN DSunny +Rus sell +Stp StateDisabled +Stp StateEnabled +Stp TopologyChanged +Treatment MachineName +Williams burg +Yan lÄ±ÅŁ +YnJ zE +\'] ') +carr era +kom bu +kWh r +nxb entrust +slit len +slit wid +uá i +uá y +uÃł i +uÃł y +wol fv +Ġvide ostream +ĠâĸĪâĸĪâĸĪâĸĪ âĸĪâĸĪ +Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~ +Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~ +ĠÚĨ اÛģ +Ġ"--- " +Ġ"!= ", +Ġ"!= ") +Ġaffix es +0032 200610887 +Ġretr uns +unread Counter +unread MessagesStart +Ġbang cont +odete ct +isplay Control +valgrind Args +getVar ByName +('------------------------------------------------ -') +setEdge Property +Ġtooth pick +ĠTray Menu +ĠTeff st +strin ged +conforms To +ĠSter ling +ĠSant é +ĠScr udful +ĠCome t +spik etrain +9905 15 +ĠFd File +oding ViolationErrs +scater data +Ġhitem list +ĠPig tail +ĠPres ley +ĠPrest on +ĠPVC s +ĠLV DS +trk let +Ġstudio library +excess ive +ĠMari ana +ĠMai or +ĠMango AccountFlags +keyformat versions +0226 323 +0235 842 +Ġmah alanobis +addTo Parset +ĠBollinger Bands +ATGAT ATTACTTT +xaai q +boi ardo +ĠWandb Logger +ĠVert rees +ĠUB Int +Stderr Handler +ĠHay en +ĠHORIZ ON +ĠRec SysFramework +linode ID +ĠInformat ics +ĠInformat ik +ĠIndicate MissingTransform +lockB Max +lockB Min +lockB Increment +========================== =" +ĠKas sel +9566 75 +ĠimageUrls HD +Deserialize ToDoList +ĠtargetDelete DB +ĠYI ELD +Ġargnums l +cyclo matic +Chol era +Ġarri ved +Ġarri vals +ToRe veal +Deliver able +clkpnt s +ĠarraySearchT MAPE +ĠArbitrary Timestamp +kino Directory +GetMember Count +bles Spectrum +connectTo SwarmController +ĠUserRegister Form +Defin ite +ĠglGen Buffers +ĠglGen VertexArrays +Alliance Name +scalers RawToDigi +Advice Type +AdKraus Ops +éc édent +ĠDEVELO PER +ĠDEVELO PMENT +Ġì° ¾ +Heuristic NoAng +EventSend Email +EventSend Trap +EventSend SMS +ĠColored LevelFormatter +nonex istant +nonex isting +UUUU UC +learningRate Conv +Mono space +recN Prsa +recsetTaxon Parent +recsetTaxon Synonym +ĠClassic FSM +Whit ney +Whit taker +ä¸įéľĢè¦ģ åĮħåIJ«æ¡¶ +çĽĸ ç«łé¡µ +AccountAdd Name +AccountAdd Password +Ġè¨ Īç®Ĺ +Multiclass Pipeline +SequenceModel ing +SequenceModel InputToHidden +Stacker Classifier +Stacker Regressor +dialogText Blue +dialogText Gray +Ġíĥ Ģ +пл аÑĤ +HBHE Darkening +Ġlexico gafic +pegPrice Max +pegPrice Min +pegPrice Deviation +欢è¿İ ä¿¡åĬŁèĥ½ +Velo cities +æĬ½ å¥ĸ +Pubmed Document +Ġиг ÑĢÑĭ +LINKED DATA +å¥ĩ æĢª +ë¡ľê·¸ìĿ¸ ìłķë³´ìĿĦ +001011000101 01011000011 +schd uler +telephone Number +ĠCallbackQuery Handler +AAAAG GC +ãĤ¤ãĥ³ãĥ ĩãĥĥãĤ¯ãĤ¹ +åĥıç´ł åĢ¼ +PhaseRadianInverter RealTimeModel +uạ i +uạ y +uả i +uả y +ĠGrafana Error +Ġcadast ra +Ġcadast radas +áĨ« áĨ· +ĠÑĥдал Ñıем +ĠcroppedVid Final +Oriented Reviews +ç½ij页 ä¸Ĭ +å¼łæĺ¯æ¸¯æ¾³ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢ +svnNetIf Name +svnNetIf Address +Organized Submission +ĠetsysNacApplianceMIB Group +Ġreceber á +Ġлай ки +Ġлай ков +Ġлай каÑħ +ĠciscoDiameterBasePMIBLocal CfgGroup +ĠciscoDiameterBasePMIBLocal CfgSkippedGroup +ĠciscoDiameterBasePMIBLocal StatsSkippedGroup +MapperStatusLO FErrs +MapperStatusLO SErrs +MapperStatusLO PtrErrs +ĠæŃ¥ in +ĠWeightedPoint Bisector +Ġdiscrimin ate +CDOTAS PEECH +\\\\\\\\\\\\\\\\ \\\\ +BTagMISTAGT CH +BTagMISTAGT CHEM +BTagMISTAGT CHEL +mrstpPort Designated +mrstpBridge Index +Ġæī§è¡ĮæĢ» æŶéķ¿ +ĠfuniVclTx Clp +ĠfuniVclRx Clp +cPPPoEServerAuth Requests +cPPPoEServerAuth Failures +cPPPoEServerAuth Successes +ĠNewCellBend Upper +ĠNewCellBend Lower +ĠNewCellBend Overall +<_|<_|<_|<_| <_|<_|<_|<_| +Ġincorpor ated +Ġincorpor ates +ĠìĹ°ìĤ° ìŀIJ +订éĺħ éĵ¾æİ¥ +Annihil ating +ĠDEPEND ENCY +宽度 ä¿®æĶ¹ä¸º +å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģ人åĥıéĿ¢ +å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģ人åĥıéĿ¢ +RECOGN ITION +Derive Response +atribu ido +ĠPruneSource Count +ĠPruneSource Address +ĠPruneSource MaskWidth +举ä¾ĭ å¦Ĥä¸ĭ +ĠìļĶ 리 +Ġè¾¹çķĮ åİĭåĬĽ +LIUBert State +LIUBert Duration +LIUBert ErrSecs +Ġë°Ķê ¿ +IMMOBILIZER LOCK +IMMOBILIZER RELEASE +ĠTestInterpolatorLoad Normal +ĠTestInterpolatorLoad Big +ĠTestInterpolatorLoad Small +,": ", +8555 24 +Ble edFill +CIf D +Cabin Cat +DGL Graph +Jupyter LabTemplates +Kings Raid +Kratos ProcessFactory +Lpe L +Lid hje +Raz ão +SANT A +TWE ETS +VAB D +Wise FeedForwardNetwork +Youtube DL +_][ \ +csp attern +cure k +candid tates +jee z +kang aroo +mms im +mUy G +tink off +vmd k +Õ¶ Õ¥ÖĢ +è° · +èĵĿ èī² +íĨ ł +Ġ请 åľ¨ +ĠæľĢ大 åĢ¼ +Ġultimate ly +Ġted istgrp +Ġ':: ' +Ġ'(? :' +mpv Args +mption Granularity +Ġcaf eteria +Ġpunto Cercano +Ġpunto Minimo +Ġsgt bx +rish abh +Ġwand bs +chim era +otte sa +ishe ye +getsource file +Ġtow ns +ĠTot EventDurList +ĠTier ra +opin ion +opent db +opent herm +ĠClar a +ĠClar iteia +ĠCensus Query +ĠAven ger +scrit os +scrolled text +ĠMens agem +Ġyam ls +Ġmemb ase +ĠEmit s +32016 080101 +hose Data +Ġnumaras ını +0413 758 +0656 156 +1528 0102 +100109100129 101 +Ġopti mbench +REDU CE +complaint Period +ĠInd onesia +5715 388 +57296 36 +6697 1817633709 +ĠUnbound Context +Acceler ation +ĠQSql Query +StatusPage Client +ĠJian fa +ĠProd uto +Via Appia +cvss V +0111110000 110 +Compte Lib +foreach RDD +Serving InputReceiver +penn ies +Ġtercei ra +ĠglEnable VertexAttribArray +ĠtaskId Str +ĠImageStream Image +PyC QA +ĠMealy State +Ġfinance database +ĠZhone RowStatus +Ġì½Ķëĵľ 를 +ttc gt +ĠAddNew Line +áĥª áĥľáĥĿáĥijáĥĶáĥijáĥĺ +ĠCompressed Image +excited Numerical +DeviceInfo List +ĠvideoName Split +ĠæĻ Ĥ +ĠæĻ ®éĢļ +ĠReduced DensityMatrix +Buck nell +-------------------------------------------------------- -\ +DDDD DD +PageNumber Pagination +0100001111 10110 +Ġquem ado +Ġsenlist order +ctspOperSgaclMapping Group +RASTER IZER +PALETT E +INTERIOR TOW +Ġ================================================================================================================= ===== +Ġíijľ ìĭľ +REFINE FINAL +Consult ar +ĠCallBack s +ĠдоÑģÑĤ авки +fbxSkin ToSkin +ðŁı´ółģ£ółģ§ ółĢ +请éĩįæĸ° ä¿®æĶ¹å¹¶æıIJ交 +éĽ£ å¾Ĺ +áĦħ áħ¡ +GATTT ATATTT +ĠrclFactors Expiration +ĠCONFIGUR ATIONS +ĠÑĤÑĢ еб +ĠÑĤÑĢ еÑĤÑĮей +Specialized SemanticVariant +éĺ¶ èĬĤçĤ¹ +AAAAT AGAACAACT +åĵ²å®Ĺ çļĩå¸Ŀ +ĠWaiter Error +ĠFriend ship +uáºŃ y +Maltego Message +Maltego Transform +GreaterThan OrEqual +绣ä¸Ģ çļĦ +è°ĥè¯ķ 使çĶ¨è¿Ļ个PID +ìĺģ ìĥģ +ĠVerified BootVersion +ĠSynchron ize +ĠSynchron ization +ĠShortcut Column +ĠìĿ´ìļ© íķ´ +ĠвÑĭвод им +Contrastive Loss +ĠGremlin ServerError +Ġclump Info +Venue Info +ãģķãĤĮãģ¦ ãģĦãģ¾ãģĻ +ĠCpwVc IndexType +ĠCpwVc IDType +RestrictedTransfer Method +ĠCandidateInfo NotFound +mstpXstPort Designated +ĠfltStmtArbValue High +ĠfltStmtArbValue Low +WorkloadIdentityPoolProvider Oidc +WorkloadIdentityPoolProvider AwsArgs +MeltMassFlux Man +Ġmuuttu ja +Ġmuuttu jan +æĶ¯ä»ĺå®Ŀ åĴĮ微信 +ĠCamembert ForSequenceClassification +ãģ«ãģ¤ãģĦãģ¦ è¨Ģ +logVerboseFile Parsed +×Ķער ×ķת +>',' _', +>',' **', +Aver aging +Aunt Of +Bun stable +Cord oba +Crow dAnki +Emo jis +Flower Service +Greg or +Greg ory +Habit at +IEC ORE +Mé todo +Nrec Prsa +Pmt Inf +Psy chiat +Rip ley +Sul fate +TUNE DEMBED +VOR R +VRS QR +Yuk on +Yuk ki +gup ta +hab its +ijs sel +jum bo +plastic ity +uý u +wsg iserver +yum iceva +yap en +zar vary +Ġã İ +ĠčĊĉĉĉĉĉĉ ĉĉĉ +Ġuber mag +ĠÄį arou +ĠÄį iarou +ĠåIJĦ ç§į +Ġåįĩ åºıæİĴåĪĹå¾ĹåĪ°çļĦ +inspec z +recruit ing +recruit ment +Ġtict actoe +arit me +Ġ'« ', +Ġcread a +Ġcplt s +Ġcdm Corpus +Ġcraft ed +Ġpype flow +Ġpstar x +Ġponto on +ĠpÅĻ i +Ġfelt type +Ġ"}, ") +Ġsé curité +Ġdern ier +Ġdobi Seznam +uninfected Area +Ġmline file +Ġmash umaro +rapp resent +ĠbÅĤÄĻ d +ĠbÅĤÄĻ dy +romo lecule +Ġwash er +chp NeedToReconfigure +isEulerian Walk +getFilter Width +getFilter Bias +getFbx BlenShape +('"" \ +constra ins +(".. ")) +ĠSoc cer +ĠSph ero +ĠSinh Integral +ĠCandle stick +ĠCapt uring +ĠClimate Entity +Ġrut ina +Ġrut inas +Ġlte Config +9907 31 +ĠFED ER +vibrato Pos +poznámk y +ĠPic amera +ĠPap irus +Ġstor ms +ĠDuty Failure +ĠMUT UELLE +apns Token +ĠBIL STM +ĠBibli oteca +ĠEEP s +ĠEPG Refresh +ĠEquilibrium DB +ATTEST ATIONS +ATAAAA AGATTCTTG +ATERE MOVE +ATERE QUEST +ĠNer vanaGPU +Ġuns ichtb +ĠGor ica +ĠGren oble +ĠWC IC +ĠVest Device +Ġanch ored +1508 33 +Ġpresti ges +Ġrama Parrafo +ĠHour ly +0969 32 +ĠInfinite Iterator +ĠInjector File +noOf Tweet +ĠKine tics +ĠKie ffer +faw nofija +Ġneur ite +Ġneces ario +correl ator +efv hh +Exhaust ed +goTo Main +98904 3 +Ġintermedi ates +ĠargFormat String +Ġseren dipity +LogMat urity +Uncle Of +GetFrame Statistics +Classic Control +disper se +åĪº éİĹ使æ£Ĵ +Quarter ly +diffserv Map +Fade Gesture +Ġ[[[[ ] +ä»į çĦ¶ +Ġìº Ķ +Ġ층 ìĿĺ +0011000000 100111101001101 +ĠLearned MgrState +ĠfeatureDictObject B +rlRmonControl HistoryControl +Solicit ado +æĸ½ 禮 +ĠToy ota +Ġastar Solver +Ġdatat ree +obsN Prsa +ServicePerimeter SpecArgs +ServicePerimeter StatusArgs +CHEM ICAL +ÃŃci us +Distro less +Whats ItESProducer +Decre ase +000110000001100000011 000 +ĠmasterOperation Thread +ĠcalcDecJan Feb +ĠGoogleCloud Storage +Genesis Block +ĠSimpleGrasp Srv +ĠSimpleGrasp WithSle +ImportFrom EPSG +æĮij äºĨ +表çļĦ æŁ¥è¯¢æĿĥéĻIJ +ĠâĨ ij +#--------------------------------------------------------------------------- # +ĠкаÑĢ ÑĤ +ĠкаÑĢ ÑĤе ++/- /_ +Ġcyclo stats +tmnx Dot +ĠVertica Py +Ġspices Num +Noncurrent Days +approxim ant +ĠViewport EngineHybrid +CfgLink Name +ĠTrig Simplify +鼻 æµģ +鼻 åľ§ +5667 326 +BinNum Expr +ĠìłĦì ²´ +ĠìłĦì Ĩ¡ +miche le +miche lson +é«ĺ度 ä¿®æĶ¹ä¸º +Ġpermiti r +DISTRIBUT ED +Ġмен Ñİ +Ġмон еÑĤ +Ġмин им +Cré er +uỳ u +uỵ u +uá»· u +uỹ u +ĠPubmed DumpIndex +ĠOcto Bot +ĠOcto Pod +ĠProbabilistic Model +Ġê²Ģ ìĥī +èĦ± æķı +èĦ± æľºè¿IJè¡Į +ĠSuffix Trie +Ġwyckoff Sum +ĠfltStmtIndex New +Adagrad Optimizer +diameterVendor Ietf +æ´ª ä¿¡ +Ġìłķìĥģìłģ ìĿ¸ +Ġìłķìĥģìłģ ìĿ´ì§Ģ +æĴ¤ éĶĢ +ĠSmartLink Condition +StatefulSet ToHorizontalPodAutoscalerLinker +碼 表 +ĠÑĦоÑĢм аÑĤе +à¹Ģ à¸ģ +å°ıäºİéĺĪåĢ¼ çļĦå¤ĩéĢīåij¨æľŁ +ĠctspIpSgtMapping Group +PersistentVolumeClaim Linker +PersistentVolumeClaim ToPodLinker +ĠCONTROL LED +ĠExpectation Claim +èĥĮ æĻ¯ +ĠLassoLars IC +guarante ed +guarante es +ĠNFTCollection Validator +ĠXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX X +%%%%%%%%%%%%%%%% %%%%%%%%%%%%%%%% +ĠæıIJ交 ä¸Ńåĩ» +ĠDOCUMENT ATION +rutina Ejercicios +ãģ«å¤īæıĽ ãģĻãĤĭ +ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ +Dedicated SystemMemory +Dedicated VideoMemory +DockWidget Area +ĠtestParseBook ChVs +"[\.\,\?\/\)\(\"\ !]", +GPIOpin OUT +Ġ5061233 105 +PRICEREMINDER ITEM +)âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâķŃ +8335 34 +Bmp ImageFile +CAME O +DAN Co +Flor ian +Greet ings +IIB yMJoBB +Jim my +Kamp ong +Nth Co +NDR H +Pit ts +Pup Menu +Pfx FileName +Rex xar +RSV P +SCH UL +Snipe Checkin +Snipe CheckoutForm +Vest ur +Vacc ine +VSH LL +VICT IM +VICT ORIA +batter ystaple +equi lib +hitem name +midd lename +pNum Modes +plast id +uô i +wie sen +xit Coordinator +xlate To +xCell x +ytd l +ãħ ¤ +ëIJ ¨ +Ġric ga +Ġż ar +Ġãĥ© ãĤ¤ãĥ³æ¤ľåĩº +ĠåIJ¯åĬ¨ æĸ¹å¼ı +ĠæľįåĬ¡åĻ¨ 端åıĤæķ° +ĢìĿ´ ìĬ¤ +indie hackers +rexp and +sext o +alb ano +tict oc +Ġpens insula +Ġ"ï ĭ +Ġaia map +Ġamar a +Ġspre ading +Ġsfs idb +Ġress oures +Ġeph id +Ġwaters hed +],'. ', +],'. ') +Ġfortios api +turnOn WifiBridgeLamp +getRoleMember Count +setFrame Shape +setFrame Shadow +setWhiteMode BridgeLamp +ĠSsa Instr +ĠSax ony +ĠSCO PE +ĠSCC Search +ĠSMB us +ĠSCP Client +Ġdefec ation +Ġgog api +ĠAj out +ĠAlta ir +spir alarm +ĠFFM pegWriter +ĠPCD Alignment +ĠPsy cho +ĠPrac tical +ĠPrac tices +ĠPALE TTES +Ġdeter rent +Ġdelet ar +Ġdecry ptor +ĠMES H +ĠMIPS InstructionFormat +ĠOGUI LE +ĠBroad band +ĠBloom berg +Ġjer sey +ATTRI B +bouti ques +ĠgetConstant Weight +luc inda +ĠGEM SA +ĠGlue Dataset +ĠWash list +Ġancho Min +Ġpyh pecw +Ġpycard dav +Ġpylsb out +ignor etarget +Ġlemp ivari +Ġacer tou +noops ym +36885 39 +ĠimageName Dict +AGAC AU +parseC Struct +6605 2536 +IMPERSON ATERESPONSE +IMPERSON ATEREQUEST +Encaps ulateItWithGlobalException +Ġspr inger +ĠUnregister HotKey +Acer tou +举 西 +CHRO ME +SetNumberOf TableValues +IBAIB AKB +Ġagate charts +ĠArmaz ém +1110000000000000000 011110 +Ġimpor per +Leon ardo +çļĦåŃIJ 缮å½ķåĴĮ对åºĶ +Shrink age +moder ato +ĠChip Type +ĠshowObject Scale +Ġreflex ive +afri ca +ĠEnc Dec +Pointing HandCursor +GETPOMERIUMSESSION REQUEST +Filt red +Ġcardinal ities +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ +WidgetList ChangeEvent +ĠAdvection RK +ĠServo Kit +TCEntity Array +ĠDispon ibilidade +OpenStack VirtualMachine +Geographic Location +ä¿Ĥ ãĤĬ +editSource KeyPress +editTweaks KeyPress +IAi CI +mgd logs +LISTPROJECT SREQUEST +LISTPOMERIUMSERVICEACCOUNT SREQUEST +Visicom ReverseGeocoder +Utiliz ado +Marked Location +Ġèµ · +ĠRandomWalk Robot +ĠRandomWalk EqOracle +ChangeIn X +ChangeIn Y +hydr us +archiveInfo Format +OWL NETS +ĠMultipart Encoder +----------+ -----------+ +åĩºæĿ¥ çļĦ +16767 400 +ãģ®ãģŁãĤģ ãģ« +dwNum Entries +navreptrain rnn +Ġpotrze buje +LinearGaussian WithKnown +Corrupted Error +stool box +ĠQueryable Property +ĠQueryable Properties +ĠØ£ ÙĬض +AutoLabeling Config +subnetBasedVlan Src +ĠknownNodes Lock +Ġназ наÑĩен +Ġmarsh alled +Ġrepeti tive +RUNANDWAIT MESSAGE +æµ® 浪 +AssignmentTitle c +ĠRetention Policy +ĠUniversit at +ĠUniversit ät +ĠKeel Attribute +Ġplanil ha +9098 075 +å»Ł ð¥ļĥ +èµ´ å¸Ń +XChem Utils +ĠMerchant OrderNo +ĠNonParaG auss +QUERYUSERS REQUEST +QUERYGROUPS REQUEST +ç»ĵå��¾ 没æľī以 +ĠqualityMask EPIC ++-]+ @[ +åıªè¦ģ åĮħåIJ«download缮å½ķä¸ĭ +Ġimagen um +uá»ij i +uá»ĵ i +uá»ķ i +uá»Ĺ i +!!!!!!!!!!!! !! +è¿ĩç¨ĭ ä¸Ń +âĸĪâĸĪâķijâĸijâĸijâĸij âĸĪâĸĪâķij +ãģ¨ãģį ãģ¯ +DeepLearning Examples +Ġprecis amos +åıĺæĽ´ ç±»åŀĭ +uấ y +uầ y +uẩ y +uẫ y +ĠMetricType Proto +ĠCyUart Set +bilateral Filter +ë©Ķ ìĭľì§Ģ +Ġìĭł ê²½ë§Ŀ +å®Įåħ¨ æĪIJ交 +Ġwykon aj +ĠfltStmtAction Arg +ĠRealESRGAN v +ĠCIFArticle Form +ĠÑģÑĤÑĢани ÑĨÑĭ +ĠâĶĶ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ +AGTTA ATACT +AGTTA AGTGCGC +ãĤĤãģ® ãĤĴ +ĠrlHistoryControlBuckets Granted +ä»ħä»ħ éľĢè¦ģä¸Ĭä¼ł +ä»ħä»ħ æĶ¯æĮģjpg +輸 åĩº +111100001111000011110000 1111111111111111 +ĠReplication Remote +GrandParent Of +ç·¨ 碼表 +Cogn acy +Ġpronoun s +Different Humps +sloupce Y +fantasy Points +MAINTENANCE COMPUTER +ĠíĨµ íķ´ +ĠRodrig uez +pistol Modes +9958115183246 07 +apparate cfg +ĠsetObjectClean TransformShadingEngine +ĠsetObjectClean ShapeShadingEngine +casesForICU ByRequest +åįİ为 åĪĨéħį +åįİ为 åĪĨç»Ļ +daylightSavingTime EndDate +daylightSavingTime StartDate +ĠSYMBOL s +ĠbaÄŁlant ı +createCurveFrom OrderedEdges +ĠSignUpForm Serializer +INTERRUPT ED +ĠReseqTrack DB +casesForVentilators ByRequest +!* '. +"\\ ])* +,?) """, +5856 881 +6935 072 +8164 97 +8235 471228 +AER OSPIKE +Bprice To +Bprice From +Bpercent To +Bpercent From +Bounded FloatText +Cen ário +CAND Y +Flick Rate +Flick ering +GBo C +HMI JS +IAG et +JAE UQgghh +LBA AS +NUT TX +NuclideResult List +Overs izePkts +QRA E +Ré férences +SMC ALFLOW +Stix Path +Tes oura +TANG ENT +Urb BankStab +VQR DMULH +Wan delroutes +ZEN ANGLE +ZTI b +\+\ )\( +aument ar +cOn WK +frank furt +jak obs +lbn m +oel int +paw lytics +punte ggi +punte ggio +pLvl Grid +twe en +tData Input +vog s +wend en +wann ier +Ëĭ ËĬ +ÐŃ ÑĤо +ìį ¨ +stas hes +mpool TransactionResponse +Ġpexit grp +Ġnub armuPDF +Ġnies koÅĦ +Ġsport sipy +Ġsrm v +Ġsö ylen +Ġingestion Time +Ġrecom end +Ġdam n +Ġesk apade +Ġeffici eny +riem LogR +Ġbere its +ĠbÄĻ dzie +edm testThings +idal oc +cham fer +maxt asksper +':'' } +turnOff WifiBridgeLamp +('==== > +setBrightness BridgeLamp +ĠTagg ableManager +ĠTama Tou +ĠSed iments +ĠSUS PECT +ĠStitch SrcVolume +absor ing +absor ption +ĠCtypes Type +ĠCorn ell +ĠCitr ine +Ġlld butil +ĠAero space +ĠFro benius +ĠFALL BACK +ĠFlap Interval +ĠFlap Enabled +ĠFLEX netDC +ĠFuniValid Vci +ĠFuniValid Vpi +Ġhic cup +proble matic +ĠDER IV +ĠDip loid +ĠdataMag Body +ĠdataMag LVLH +ĠdataOmega RW +xfffff fffffff +Ġvou loir +Ġseni or +Ġseni ors +Ġstratis d +0754 163 +ĠBak ery +ĠBCE Loss +ĠBays Booked +ĠBeng io +ĠBBBBBBBBB B +ĠEgyp tian +ĠEgyp tians +movel ate +readrandom writerandom +ĠGrey Scale +ĠWAL LET +ĠWarmup Cosine +ĠVik idia +ErrorNotification Interval +ErrorNotification Enabled +dags ar +lldb test +Ġchang enum +1713 94622 +Ġradk y +Ġradk yX +ĠReplacing MergeTree +ĠReachabilityService Transport +availab ilities +85377 94244 +ĠKun quat +ĠdateAdded Local +ĠdateAdded UTC +7773 13 +Ġgoog lenet +SetScalar ModeToUse +Testimon ials +Ġverstr line +sgp ceilC +Ġcalcu ate +ToBe Added +ConfigMap ToPodLinker +Traditional Variant +Traditional OpenSSL +cvm fs +LIUC mdStatus +LIUC odingViolationErrs +ObjectField Selector +dayof week +nextPage Key +UserStory Factory +ĠResilient Component +Threat Response +ĠGetProjection Plane +Algor it +ĠrawListOf Trending +ĠSimCC Stdcall +ĠSimCC MicrosoftAMD +Ġnonuniform resourceindex +Ġpiirt ä +Ġpiirt ää +Ġgeol ucidate +ĠìĤ Ńìłľ +ĠcmdLine Parse +uxi ème +alphaS value +alphaS order +ĠCheckbox WithLegend +PerMode Small +Ġviral Advertising +GETSTATUS REQUEST +GETSTATUS RESPONSE +GETTRANSACTION REQUEST +GETTRANSACTION RESPONSE +CIAi C +....# ...... +ĠPROX IES +ĠPROX MOX +lingu istics +Scrolled Window +ĠEXPL ICIT +DRMSystem List +ĠbytesTo Send +ĠbytesTo Short +CaseStudy Version +à°ĩ à°¦ +ĠPrescription Form +/\__ /\__ +TrainTest WithGen +OBST ACLES +ĠTransitions Table +symmetri ze +ĠLOST Geometries +Ġdiffpriv lib +PYTH ONTESTR +ĠOnBegin Round +ĠOnBegin SpellCast +ĠIPC Channel +SQLè¯Ńåı¥ ç»ĵ尾没æľī以 +ClassifierLogging State +ClassifierLogging Interval +WithLoss Cell +åľº æĻ¯ +speedUp DiscoMode +speedUp DiscoModeBridgeLamp +invaders peeds +ĠMoved IssueNotDefined +Decord Init +Decord Decode +ĠepNumberBulk In +ĠepNumberBulk Out +Visualiz ing +IIYQQ wsFI +ê°ķ ìĽIJ +MyBalancerExchange Add +MyBalancerExchange Remove +Ġvoxe lized +ĠStateAttribute LimitsHelper +Ġcommenti ds +Ġcommenti zer +ĠMultiAgent Env +FilesWin Cast +Triple ts +FeatureSupport DataSize +("[{} ][{}] +ĠFIRE FOX +ĠTaskPlugin Upload +fwLocalLogging Stat +fwLocalLogging Desc +ĠвÑħод ов +ĠíļĮ ìĽIJ +Ġâļ ł +ĠJourney TravelTime +lorenz ian +triggerOrder Type +Ġcyc ler +FDwf AnalogIO +Ġdetal les +DELETEPOMERIUMSESSION REQUEST +DELETEPOMERIUMSESSION RESPONSE +Ġinfectious ness +ElApply PackedReflectors +ElApply PackedReflectorsDist +ElExpand PackedReflectors +ElExpand PackedReflectorsDist +ä¿¡åĬŁèĥ½ éĻIJåĪ¶ +Fouls Suffered +Fouls Commited +SERVICEACTIVATION CONFIGURE +ĠcsMoney Limits +ĠvtkRenderWindow Interactor +EnvironmentVariable Args +ExecuteInitialize SolutionStep +ExecuteFinalize SolutionStep +αν θαÏĥ +ĠDIAG RAM +hhBB COBh +ĠJobInfo Factory +оÑĤÑĢ иÑĤе +ĠstandStill End +ĠstandStill Ends +BTSC ERT +ĠTransformers SeqPairDataset +ĠCausal Factor +Magnet Type +ĠnrOf C +ĠnrOf I +ProxyModel Model +schueler A +ĠciscoTrustSecPolicyMIBCompliance Rev +Ġìłľë ª© +ĠCatmull RomBlend +ĠStreamBank Eros +è´Ń çī©è½¦ +ĠÑĤек ÑģÑĤ +ĠÑĤек ÑĥÑī +Marital Status +slowDown DiscoMode +slowDown DiscoModeBridgeLamp +ĠLiquity Staking +ĠLiquity Troves +pressureValve Outlet +pressureValve Inlet +çĽ¸å¯¹ URL +çĽ¸å¯¹ ä½įç½® +uá»Ļ i +æĥº æĥº +VOLUM ES +ìľĦ íķ´ +Ġintrospect ing +Ġק ש×ķר×Ļ×Ŀ +ĠPolyn esia +ĠFitness Plot +åįģæķ° ä¸ĩ +stratis d +taggedIn Posts +taggedIn Comments +PrimitiveItem Context +uẹ o +uẻ o +uẽ o +Ġê°ľë ħIJ +ĠValis pace +áĨ² áĨ´ +DEPLOYSTATUS MESSAGE +DEPLOYSTATUS OPTIONS +ÐŁÐ¾Ñģ иланнÑı +ĠMySQLTotalExecution Counts +ĠMySQLTotalExecution Times +SENDTRANSACTION REQUEST +SENDTRANSACTION RESPONSE +mstMap Vlans +1001001110110101 0111111111 +ĠPOSITION AL +cdbpLocalStatsTotalPackets In +cdbpLocalStatsTotalPackets Out +ĠfltStmtSrcPort High +ĠfltStmtSrcPort Low +ĠfltStmtDstPort High +ĠfltStmtDstPort Low +Skinned Mesh +Ġdjf appendf +Ġdjf appendh +Ġtanmu OpenDiv +Ġtanmu CloseDiv +ãģķãģĽ ãģŁãģĦ +Ġ#---------------------- # +çµĦ ãģ¿åIJĪãĤıãģĽ +ClassifierIpPacketLen RangeStart +ClassifierIpPacketLen RangeEnd +èѬå¦Ĥ æĬ¤çħ§ä¸ªäººèµĦæĸĻ页æĸĩ件åIJį称æĺ¯abc +èѬå¦Ĥ 身份è¯ģ人åĥıéĿ¢æĸĩ件åIJį称æĺ¯abc +Ġrecebe u +77777777 78 +Ġ**************************************** ***** +ĠikFootControl Grp +ĠciscoDiameterBasePMIBPeer CfgGroup +ĠciscoDiameterBasePMIBPeer CfgSkippedGroup +ĠciscoDiameterBasePMIBPeerStats Group +ĠciscoDiameterBasePMIBPeerStats SkippedGroup +ĠciscoDiameterBasePMIBRealm CfgSkippedGroup +ĠciscoDiameterBasePMIBRealm StatsSkippedGroup +網 åĿĢ +綳 èĮ¶ +AGTTGTT CTATTTTA +cPPPoESNormOff PerThreshold +cPPPoESNormOff PerAlarm +Omni Wheel +ĠWRIT TEN +ç¢Ĺ éħĴ +ĠFunny QueryClass +ĠFunny QueryType +CDOTAM sg +CDOTAM SG +ClassifierEthernetDestination MacAddress +ClassifierEthernetDestination MACMask +fltStmtIp SrcAddr +fltStmtIp DstAddr +Gvrp StateDisabled +Gvrp StateEnabled +BandwidthConfStorm State +BandwidthConfStorm BW +BandwidthConfIngress State +BandwidthConfIngress BW +BandwidthConfEgress State +BandwidthConfEgress BW +ĠÑģлов о +ctspIpSgtMapping Group +parente mail +ĠNewCellWidth Mean +BTagMISTAGSS VH +BTagMISTAGSS VHEM +港澳å±ħæ°ijå±ħä½ıè¯ģ åĽ½å¾½éĿ¢ +Ġ------------------------------------------------------------------------------------------------------ % +Bibliografi ja +8888888888888888 88888888 +ĠcdcEndpoints SAM +ĠcdcEndpoints Pic +å¼łæĺ¯æīĭæĮģåı°æ¹¾ å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢çħ§çīĩ +å¼łæĺ¯æīĭæĮģåı°æ¹¾ å±ħæ°ijæĿ¥å¾Ģ大éĻĨéĢļè¡Įè¯ģ人åĥıéĿ¢ +å¼łæĺ¯æīĭæĮģ港澳 å±ħæ°ijå±ħä½ıè¯ģ人åĥıéĿ¢çħ§çīĩ +å¼łæĺ¯æīĭæĮģ港澳 å±ħæ°ijæĿ¥å¾ĢåĨħåľ°éĢļè¡Įè¯ģ人åĥıéĿ¢ +åĪĩãĤĬ æĽ¿ãģĪ +ĠæİĴ éĻ¤ +ĠdocsLoadBalChnPairsIfIndex Depart +ĠdocsLoadBalChnPairsIfIndex Arrive +该åŃĹ段填åĨĻ test +该åŃĹ段填åĨĻ abc +Investment Cost +åĪĿæľŁ åĮĸ +ãģĿãģ®ä»ĸ ãģ®ãĥĹãĥŃãĤ¸ãĤ§ãĤ¯ãĥĪ +DESTROYPARTICLE INVOLVING +ĠMakerdao Vault +ĠMakerdao DSR +ĠclavController Grp +1590788 458524 +ĠctspSgtCachingVlans Second +Ġê·¸ë¦ °ëĭ¤ +LacpPort Added +LacpPort TrunkFailure +prsaRec Combined +ĠìĹ¬ê¸° ìĦľ +å¼łæĺ¯åı°æ¹¾å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģæŃ£éĿ¢ +å¼łæĺ¯åı°æ¹¾å±ħæ°ijæĿ¥å¾Ģ大éĻĨ éĢļè¡Įè¯ģåıįéĿ¢ +ĠfltStmtIpSrcAddr High +ĠfltStmtIpSrcAddr Low +ĠfltStmtIpDstAddr High +ĠfltStmtIpDstAddr Low +cPPPoESAbnormOffs Threshold +cPPPoESAbnormOffs Alarm +Ġsürü mlerinden +ĠYearnVault s +ĠYearnVault sV +ĠLiquidation Event +ĠLiquidation Processor +çł´ 綻 +ĠíĶĦ ë¡ľ +Approximate ly +saveImageFor Classification +saveImageFor AutoEncoder +åĪ©æ¶¦ç©ºéĹ´ å°ıäºİ +åĪ©æ¶¦ç©ºéĹ´ 大äºİ +å¼łæĺ¯æ¸¯æ¾³å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģæŃ£éĿ¢ +å¼łæĺ¯æ¸¯æ¾³å±ħæ°ijæĿ¥å¾ĢåĨħåľ° éĢļè¡Įè¯ģåıįéĿ¢ +Ġæī§è¡ĮæĢ»æ¬¡æķ° åĢĴåºıæİĴåĪĹ +TENSORFLOWMODELPERFORMANCE EXAMPLE +ĠTrouble Maker +RoyaltyBps Method +NTPTime Sync +NTPTime Zone +PersistentVolumeTo StorageClassLinker +PersistentVolumeTo PersistentVolumeClaimLinker +6465423123145 6460312100645 +Ġåıĸåĩºè¯¥éĽĨ群 çļĦè¿ŀæİ¥æĸ¹å¼ı +GETESTIMATEDTRANSACTIONFE ERESPONSE +GETESTIMATEDTRANSACTIONFE EREQUEST +PolicyOutOfProfile Action +PolicyOutOfProfile DSCP +TCEnhancedEntity Array +OpenCVEgg ROICurr +个人æīĭæĮģ身份è¯ģ人åĥıéĿ¢ æĺ¯gh +个人è¯ģ件认è¯ģ æŶè¯ģ件éĻĦ件 +å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ +#---------------------------------- # +*[: =]\ ++), (\ +5276 75 +8000000 080008 +=([^ ]]*)\ +Carg amos +CURLY NAME +Equival ência +Gle ason +Goth ic +NTP Server +Nobs Prsa +Nspawn Setup +Ota vio +Pree mptionGranularity +PASSI VE +Rib bon +Sic ilia +Und ersizePkts +Vig ilance +Vsn Ss +VOX EL +Winds orize +ajs noia +cador ias +dnx STS +dHash Space +evoke Persist +hsc ic +miti gation +pato is +rne bot +rmy knife +sJob Config +wes ley +zyst a +çŀ ŀ +íı¬ 구 +ĠÉĻ laq +Ġáĥĺáĥ ®áĥĺáĥļáĥĶáĥĹ +ĠовеÑĢ ÑģÑĤок +Ġå¤īæıĽ åħĥãĤ¿ãĤ¤ãĥłãĤ¹ãĤ¿ãĥ³ãĥĹ +insh uo +recurs ice +Ġtreen o +Ġimit ation +mpto te +Ġcach eready +Ġcake chat +Ġpuzz les +Ġpzm test +Ġsfr d +Ġrestr ito +Ġrequ red +Ġregra s +rave py +rament a +Ġesg enerator +covert ree +rifer imenti +Ġ[~ ]> +Ġ[:: ]: +Ġ[#' ../../ +isApp Exist +getNumber AfterEqualSign +getSample Power +setContext Property +ĠTru ss +ilj atelja +conserv ancy +veget ables +vegg iedag +Ġ{... }, +Ġisom eric +ĠSPC ert +ĠSUC ESSO +ĠSlov ens +ĠCHO ICES +ĠCLIC KHOUSE +ĠCpw OperStatus +ĠCHOL MOD +Ġgmw fbps +Ġlsh f +ĠAFor Root +icer igi +99011 37 +99537 037 +ĠFAT AL +ĠFUND AMENTAL +listFile LumiArray +ĠPbot Y +ĠLav ender +ĠLEG END +ubber Band +Ġthal iana +Ġstark net +propell ant +exclu deref +10866 170 +ĠDra vi +ĠDias BP +ĠDanger ous +ĠDMG State +Ġuia utomator +ĠMAS QUERADE +ĠMOB ILE +02158 245784357 +ĠOZ PACBCRS +Ġparrain é +oreg istry +pyt nyu +apic ls +ATCAA ATGTTAGCGT +ĠNAV IGATION +ĠNNC F +ĠNSA p +ĠgetArray BaseName +ĠRp Address +ĠGross o +ĠGrapheme BreakProperty +ĠWT Forms +ĠUMN Sub +Ġlistof data +Ġkik net +Ġkalan ını +Ġpyfasta q +agio tis +03426 3046786 +ĠHeter odyne +imageData GeometryFilter +ĠIncor porated +emm our +Ġlagr angian +netd Service +8627 451 +summar ization +57476 17 +Ġcheckstyle Name +Coer cing +docbook file +ĠSeis CL +CHOS x +Christop her +Ġdiret amente +Ġcorn flow +Ġcorresp oing +Ġcontinu ua +cuff links +svgs lides +Ġquan itze +NoData Plugin +Ġutilis é +ĠtotalFC alls +Ġbacklog todo +GetMethod Config +AddN chw +Ġabge brochen +CAE eaA +çļĦçī¹å¾ģ åĽ¾ +çļĦåħ·ä½ĵ åĢ¼çĶ± +ImageIntermediate Writer +AAl phabet +AAo hhBBCOBh +Ġphssum csv +mcg ill +'\[( .*)\ +Ġmodifi ee +Ġretard ance +çı yı +ĠZü rich +ĠEnketo Error +Ġì¼ ĢìĿ´ìĬ¤ +GBw cx +NEO PIXEL +Teardown EndEvent +PerS RECluster +ĠmcTransceiver Dist +PointerShape BufferSize +dru gs +()[] {}" +âķĶ âķĿ +Phili pp +TreeItems FromItem +GraphNode Proto +ĠPreserve LoggingContext +CRAI GSLIST +ÑĥлÑıÑĢ но +BinaryClassification Evaluator +ĠSubscri bes +bootstra pper +PYv Hk +åįĺ èªŀ +Ġ'{}.{}. {}. +BRD ADDR +VERSIONING ANNOTATION +ĠcarPos x +LISTTABLES RESPONSE +lmnp qrstvwxyz +čĊĉĉĉĉĠĠĠĠĠĠĠĠĠ č +AccountBalance s +BCrypt SHA +91776 56 +ĠèĻ ļæĭŁ +Ġgenepool detail +backgroundTasks Lock +ĠStateful Function +ĠMatth ieu +Ġcalcual ted +FilesIn Dir +åĩºäºİ ä»»ä½ķ +Rendered PageBreak +sensing Start +40375 6749600 +éĿł è¿ij +paypal http +Ġentr ée +humid ifier +è·ij åĩº +ĠBinarySensor Entity +ÙĩÙħ ÚĨÙĨÛĮÙĨ +1010000101000000 1010000101000000 +ĠÑĤел еÑĦ +ĠBadges ByCategory +GiRaFFE food +çĽ¸ä¼¼ 度 +ĠmscModVcsAdd OptTable +ĠmscModVcsAcc OptTable +ĠmscModVcsIntOpt Table +isaac muse +имоÑģÑĤ ÑĮ +012345678 90 +GREET INGS +ãĥ©ãĤ¤ ãĥĸãĥ©ãĥª +detailedH Path +ĠblendColors Node +Chegada Fila +ĠAssumeRole PolicyDocument +åı³éĶ® éĶ® +æµģéĩı åĢ¼ +èīº æľ¯ +ĠStaging Area +blox route +ĠFuncion ário +éĸĭå§ĭ æĹ¥ +pirates base +Xplat Enabled +ĠBreakout Graphics +è²´ èİĬ +ãĤ°ãĥ© ãĥł +9217975 031371 +Ġглав ное +Õ¡Õ¶ Õ¡Õ +��ħÏĢο Ïĥημ +SLAVER EQ +DIAGRAM S +BootcampRun Enrollment +ĠSolaris x +ĠHydro Weno +çģ° 度 +ĠпеÑĢв ой +Ġmatem ática +ĠCalibrated LabelRanking +OtpBlobNo Urls +OtpBlobEmpty Urls +ninety five +ĠSSDP Response +wedstri jd +ĠhpnicfVoiceIfCfgEchoCancel Switch +Rollback Error +TeacherExtra Form +Ġìĭ¤ìłľ ë¡ľ +Captured Text +ê¹Ģ ë°¥ +ä¹Ŀç´ĭé¾į åı²éĢ² +ĠìĻĦìłĦ ìĹ°ê²° +対象 ãĥģãĥ£ãĥ³ãĥįãĥ« +æIJŃ éħį +ĠÚ¯Ùģت Ùĩ +windowBackgroundWhiteBlue Text +ĠFAULT Y +decodeProtocolSigned HundredthsFloat +iadEnable Symbol +икипед ии +Shipper Response +800000858000000000000001000000 01 +("****************************** ") +68789685924 92 +Ġseamless ly +ĠзагÑĢÑĥ ж +ĠShowPlatformHardwareQfp Bqs +NGSIM Env +Ġphenom enological +ĠNachrich ten +Ġencuent ra +ĠMOUSEBUTTON DOWN +Ġíģ´ë ¦Ń +ĠìĨįìĦ± ëĵ¤ +ĠæĿ¡ä»¶ åĪ¤æĸŃ +ĠespecÃŃ ficos +EcalLaserAPDPNRatios Rcd +McafeeEsm Get +Ġ\'\'\ ' +ĠMockPowerOutput Driver +%| ''' +*([ +- +200000000000000000000000000000000 0000 +4873 1097 +5147 88 +6068 27 +7097 88 +9195 2705 +=.*? &", +>\\ +=;,? +¼ê°ģ íĺķ +Úĵ Ùĩ +Ġåıĸ å¼ķä½Ļ +ĠðŁļ ¨ +Ġè¯Ń ä¹ī +Ġåİĭ缩 å¯Ĩçłģ +Ġæĸĩæľ¬ éķ¿åº¦ +Ġçİ°åľ¨ æĺ¯ä¸ŃåĽ½ +ĠéŃĶ æ³ķ +Ġä¿¡çĶ¨ åį¡ +senn a +Ġtama ño +alon so +allag h +anam nesis +Ġ'#! '+ +Ġccm lib +Ġppi Complex +Ġfoll wing +Ġ"------------------------------- " +00107 395201212057 +00176 968 +geire m +ĠnÄĽ m +Ġswee ep +Ġrequis itos +ĠdÅĤu go +Ġmont age +Ġmidd lename +Ġmgl ng +Ġecos ante +()+". ") +11327 923318636 +defaul ter +getMeta Settings +('================================================================ ================================ +setApp Name +setShareholder MaxShares +ĠTIO CM +("^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^") +ppError Msgs +['* :% +Ġ{âĢĺ ,âĢĻ +ĠSiste mas +Ġrde lts +Ġrug ged +ĠAtribut o +01347 9252695 +01057 32 +01556 99 +ĠFwd Fx +ĠFUJ ITSU +vibr ant +ĠION IQ +ĠLPW STR +ĠLiech ti +Ġstabili zed +Ġdesm os +imbar azz +ĠDIC OM +ĠDDR Tree +ĠDENS IDAD +ĠMos cow +ĠMTC NN +ĠMENTION ED +Ġvarn m +02224 93 +Ġparâ metros +test測試 test +111110 11111111111111110 +xcent ers +ĠBIND ABLE +ĠButter worth +ĠEIP CR +ĠEspeci ally +Ġjuli amirror +ĠNog iBlog +boj one +ĠgetUrl Params +ĠgetHint Group +InV MT +Inno DB +ĠRAPID YAML +hoyo lab +ĠVirt utech +ĠUcs Handle +Ġhesit ate +Ġanteri ores +Ġenjo ying +minis creen +linePlus BarWithFocusChart +TrueSkill Dictionary +saven py +Ġkne ejerk +Ġkolo m +Ġpyrom ancy +Ġpydot Graph +ecim ila +03474 831399 +ipzig js +ĠpreActivate Values +neigb ors +entitle ments +08116 82 +ĠReconnect WebSocket +][-\ +]?[ +ĠInve ce +ĠInclu ÃŃda +Progra my +DELI VERY +ĠnoIn Conns +Ġlash able +ĠKash mir +ĠKLI FS +wordprocessing ml +0000000000101 000 +Ġdopp lershif +processRaw File +initWith ContentsOfFile +ĠindexTo Direct +Ġ8388 608 +23903 880 +contaminated Area +Ġdiscus sed +corrisp ond +Enga jado +Coapplicant Income +28384 648328 +56964 59 +Ġpassow rd +Ġspé ci +myDS MWB +ĠQi ita +35964 7736 +Ġworl dbody +ADDIT IVE +ĠSev cik +ĠXD MF +IBR ION +Chir ality +ĠINSTANT IATE +DIFFER ENTIAL +assertSame Entity +ĠPyMissing OrEmptyDocstring +ConfigJob CreationError +reduc ers +buildand deploy +ĠCoordinator Entity +Complain ant +prerequis ites +çļĦå¹³åı° æłĩè¯Ĩ +GHJ KL +puzz les +01218 646 +ContextChild Peer +ĠglDisable VertexAttribArray +ĠChib rary +Ġshowf liers +homeLocation Window +Ñģег да +SizeOf Info +gyhaz a +vespa interactive +Preprint View +DSAT AB +Ġ$@ ". +datar obot +datalo ad +ĠinitInv F +ĠAddW Map +åħĦ å¼Ł +áĥ¬áĥ§áĥIJáĥłáĥĿ áĥĶáĥijáĥĺ +PointOr Unit +LoadImage FromFile +SimState LoopData +costum ers +Mov Valid +ĠAcumos Session +ĠbytesPer Record +LCQ MC +Philli ps +GEMP ad +Ġtrang ain +auton otebook +à®Ĩ த +ĠëĺIJ ëĬĶ +92592592 59 +00297 00000000000004 +correcthorse batterystaple +ĠQuin tile +ĠOpenGeneral Licence +00527 447 +ĠUpdateOne Pass +Ġapag ado +ĠDesp legar +Neutrino Decay +Ġbarrage BtnDiv +Selecion ar +BEH IND +RAWSIM output +ĠGLubyte Array +11864 21774 +GenParticle Validation +risult ato +democ ratico +Ġamic able +Ġannivers ary +ĠвÑĤоÑĢ ой +ĠBlockfs Stack +Ġoccas ions +ĠâĤ ½' +ãĤĴåIJ«ãĤĢ æĸĩç¯Ģ +0082495 42493103 +connectedComponents WithStats +帰 å±ŀ +æĭĴ ç»Ŀ +åĢ¼æĺ¯åIJ¦ åľ¨ +ĠCHAP TER +ĠROCK STAR +åIJįåĴĮ download缮å½ķ +VlanPort BaseEnabled +æĹ¥æľ¬ èªŀ +WordIn DifferentHumps +Carto grapher +ãģ«æĪ» ãģĻ +NotificationConfig StreamingConfigArgs +ĠиÑģÑĤоÑĢ иÑİ +ĠSingleOutput LinearGaussianWithKnown +Ġtranscend ental +schiz ont +ĠSmtp Messenger +ãĥĪãĥ¼ãĤ¯ ãĥ³ +ĠUnsupervised Trainer +ãĥ«ãĥ¼ãĥ Ĺ +ĠDATAS OURCE +TDatum Type +ĠменÑĮ ÑĪе +ĠRecordManager WithNotifications +ĠAnalyzed Series +åIJĮåIJį 书ç±į +PerfTest CodeGen +slideCover SubTitle +GroundTruth Simulator +ĠDownloadProgress Spinner +Ġèİ·åıĸèµĦ产 æķ°æį® +ĠWHIT ELISTED +ĠLibraryCharge Handler +Datadog AWSIntegration +cadast rados +ĠGrass hopper +Ġæī«æıı æĢ»è¡Įæķ° +ÑĢаÑĪ иваем +апиÑĪ иÑĤе +ĠRunningMean Std +âķļâķIJâķIJ âĸĪâĸĪâķĶâķIJâķIJâķĿ +AGAATCT TTTTATT +DwarseMarkering Verschu +ÏĢί ÏĥηÏĤ +èİ·åıĸæĸ¹æ³ķ 请åıĤè§ģ +RoundTrip Loader +ĠMagma Protocol +ATATAA ATCACGCTAAC +ATATCAT GCGTCA +ĠPREPAR E +01011101011100000111111 10 +flytekit plugins +YuXM n +æ·® å·ŀ +1001001110110101011 0111111 +CgY EA +å¯Ĩçłģæĺ¯ ç»Łä¸ĢçļĦ +ürk çe +ÑįÑĤ омÑĥ +ThreeEquals Four +ĠIgnorable Exception +Ġnvml Device +ĠÑĢек омен +ĠоÑĤг ад +ĠâĶĹ âĶģâĶ +ATCGT ATGTGA +rosterId Row +ãĤ³ãĥ³ ãĤ½ +ĠInvitation Id +貫 è³ŀéĮ¢ +ηγ ÎŃÏĤ +Mirroring Port +ĠCognite Client +×ŀש ×IJ×ij×Ļ×Ŀ +é¦ĸ次 å®ŀåIJį认è¯ģ +æľ±æѦçŃī ä¸ī人 +åĽłä¸ºæĺ¯ æī¹éĩı +]|[$-_@.&+ ]|[!*\(\), +éĮ¦ è¥ĸ +Ķ모 리 +orchestral WinButton +Usuarios FormView +ĠPeptide Seq +Shoot Gallery +asdfgh jkl +ĠSuspicious Operation +>[^:] +?)\ +æijĺ è¦ģ +"(?? +ĠCTAEqual Risk +ÙħتعÙĦÙĤ Ûģ +Ġnécess ite +="([^"] +)"> +ĠìķĪëIJĺ ìĸ´ìŀĪëĬĶê°Ģ +Ġklij enta +CHROMO SOME +plagiar ised +ĠgetCurrentLine Region +åįģåħ«èĪ¬ æѦèĹĿ +ã¨į éĸij +Ġ"âĶĶ âĶĢ +Ġmoused own +("\"\"\ ,") +LINESTY LES +ĠнаиболÑĮÑĪ им +Ġrhinoscripts yntax +Ġ00216316305403 042524 +åŀĥåľ¾ è¯įæ±ĩ +()*+,- ./ +ĠÑĥÑģлов иÑı +ConsoleAuthTokens Controller +1526020019150506 0405180910390 +ÏħνδÎŃ ÏĥειÏĤ +meccan ico +ĠNNTPP ermanentError +createBackgroundSubtractor MOG +áĥ¤áĥĺáĥļáĥĽ áĥĿáĥĴáĥłáĥIJáĥ¤áĥĺáĥIJ +={'_':_ }, +Ġпози ÑĨии +åĩºä¸īåįĥ 貫è³ŀéĮ¢ +аÑĤегоÑĢ ии +SAIohBBCCOFg JAEUQgghh +èĢģç§įç¶ĵçķ§ 缸åħ¬ +)_/ ¯ +*([- , +*"- ") +10000000000000000 0000011 +70657 269 +81166 9 +;<>? =< +Axi om +Ayr ıca +Bstat trak +BTree ShelveTestCase +BAX T +Bbv CI +BLOO DIMPACT +Cann ondale +Crest s +Crypton ian +Casca ded +Dpr Bert +Dram Test +EAT EN +EQUIT IES +Fdf Parser +Ftrl Optimizer +FNOM IA +GULL Y +Gilli land +HISE QX +Hazel nut +IUDE xists +JUM POUT +JUD D +JfT pJk +KVlan List +MACK RL +Mdns Scanner +Mental OrEmotion +NORE PEAT +Nccl AllReduce +Rfl Ld +Raph Algorithm +Suff olk +Sú visi +TIL DA +Tenth Degree +Ult mt +Vnf Instance +Waf Error +Wü rttemberg +Wcet ResParser +ZABBI X +Zusam menfas +[). +(?=\])) +blid h +bhattach an +cFunction Prefix +dGu PNPT +dinn ertable +dSigma Add +egon n +flib ble +fles ch +gme ep +hbp apps +harging tariffs +iVB ORw +jero fi +jdon ÃŃthat +kii roo +kloud trader +lbra gstad +lOX F +madd pg +nsted API +ncoh ers +oZI hvc +pith y +pures nmp +pnx enopoulos +pConcern edDevice +rxc allback +rgy b +tPED IGREE +tEduc atedGuess +tmotiv ated +uORB Topics +vass Result +yif an +¯âĢįâ Ĺ +Õį ÕŃÕ¡Õ¬ +Ġuto ol +ĠãĢĢãĢĢãĢĢãĢĢ ãĢĢãĢĢãĢĢãĢĢãĢĢãĢĢĠĠĠ +ĠáĥĶáĥł áĥĹ +ĠæĸŃè¨Ģ çĬ¶æĢģçłģ +Ķë¡ľ ìĽĮ +ķáĥł áĥĶáĥijáĥĺ +intill ation +oron ix +reprodu cibility +stpz crnm +enni als +Ġtare hart +Ġtream ent +Ġtian shou +Ġtula jdonÃŃthat +Ġtäh än +Ġioth read +Ġitemp rop +Ġikin ci +Ġirem os +memp tr +meis anggou +Ġ'???? ?' +rostatics Handler +Ġcil antro +Ġcux filter +Ġcling o +ĠcOne Runtime +Ġcnl unardate +ĠcKnn Runtime +Ġpale omix +Ġpogle dajte +Ġpbx proj +Ġpunte ggi +Ġplugg y +Ġfulls ky +Ġ"ï¼ī ") +Ġ"========================== =\ +helip ad +##________________________________________________________________ __|| +Ġaix ò +Ġawc Bongo +Ġaforem entioned +00256 1574428 +00178 19648 +001813 47 +009999999 77648 +001986 31 +002727 58 +002668 96963 +002466 75 +008874 85 +003299 71 +geerling guy +ĠnFF THalf +ĠnInner Quantum +Ġnazy wa +Ġsapi ens +Ġsnee ze +urlab ari +ssly ze +ssrc ss +Ġrestring ir +Ġogre tim +Ġoanda pyV +Ġduy gu +Ġdjit ellopy +ĠdNr Pops +liush ilive +unpop ped +Ġmmsg hdrs +Ġmsmar co +Ġebee Split +Ġeteen päin +cocost uff +codefor ces +Ġbessel j +ĠbJack Type +romanti clovebooks +umont real +idÅĤ owo +idalph ar +Ġ(+/ -%. +Ġ(âī Ī +chalog in +chridd yp +teok set +definic ao +andaGri pper +odesch ini +isLo oped +iscu ous +isTarget Grasped +isocal endar +isWeak Ref +isRfc Installed +isNVDAObject InApplication +isDefensive PI +namedt upe +getOpen FileName +getCV s +getExecution Service +getouter frames +getMiddle Point +getPanda Logger +getRaised Exception +getRxPacket Error +('...... >'), +setAccess Mode +setnc attr +setMag Filter +setEndOf LifeNoise +setKeyable Attributes +ĠTBU tility +ĠTga Format +ĠTwi lio +ĠTWR P +ĠTAE YONG +ĠTrist an +strTensor Tuple +("================================================================ =======") +("################################################################### ") +ppDis assembly +pprm Hdr +ppRenderTarget Views +Ġishash ad +ĠisSingle Quote +ĠisDouble Quote +ĠSenti ments +ĠStem mer +ĠSMSG ateway +ĠStac PropertyView +ĠSán chez +ĠSMITH SONIAN +abez ado +ĠCrit eria +ĠCMW DB +ĠCSSH at +ĠCUMP LE +ĠCédu las +igital Errs +htfL GeQx +Ġgim memotifs +Ġglot tal +Ġgriz li +Ġrhop late +Ġrápid o +ĠlEvent Num +Ġldl decom +endof text +ĠAlon so +ĠAmr hein +ĠACES tream +ĠAdiabatic MSW +019347 04661834985 +Ġconsoli dates +toGPUS hape +ithasht u +pathRemoved Styles +ĠFonse ca +ĠFmt Str +ĠFergus on +odmlt ables +logMb aryon +ĠPyn guin +ĠPESS OA +ĠPsql D +ĠPrpc rypt +ĠPYY AML +ĠPLAST K +Ġasfg it +ĠIeo mapSentence +fileRec N +fileObs N +ĠLTLE ncoder +ĠLuminoso Client +Ġthril led +Ġstea mapi +Ġstixc ore +progra mas +00002899 65 +exect ute +exfxc xdxbxegedabagacad +Ġ3956 071 +104675 16072 +Ġprinthelp line +outOf Band +ĠDeps Modifier +ĠDiox ide +acier tos +accou feat +Ġugan il +Revelation Model +ĠMpO uthApi +ntImp ares +timeStorageClass Updated +ifNotExists Flag +keyåŃĹ段 æŶ +Ġvinc paths +Ġvæ re +ĠvShi elded +021383 5778413 +ĠOPe NDAP +ĠObn iz +ĠOgc Api +ĠOdys sey +Ġxld lib +Ġxigtx ml +oscedastic ity +Ġmahal Dist +Ġmaxter ms +addGL GetConstant +addJoint FromPos +addStiff Wire +INNO DB +INVS RC +INCOMPRESS IBLE +ĠstrLog Name +Ġelpig raph +Ġmelh or +Ġpropri edade +pyec ore +pyAS A +pyaw abi +pyrami de +artTo CatSim +aplic acion +ĠBouw meester +1210078 0307 +ĠnameAnd Aov +ĠEdd ystone +ĠEting of +Ġjndi Str +worfk low +textOver flows +ATAN ButtonText +ĠNPROP HET +irho mass +irhom olar +numBlack Pieces +Ġresizer atio +Ġgetfla pi +ĠgetUsage Embed +ĠgetForecast SummaryFromTemp +ĠgetResolved Options +ĠgetOops Embed +ĠgetGoto Code +ĠgetAkiba TimeAndSize +InAnchor Names +Inquiry Request +ĠRCV ALL +ĠRTEX ITCODE +ĠRIPP acket +Ġuntu k +foai wej +ĠtestCloud Passage +ĠGLO BUS +ĠGLU COSE +ĠGEOF RED +Ġonrech te +ĠWEA VER +ĠWsResource NotFoundError +ĠWDItem Engine +ĠVintage ousPlus +Ġ54612 33125 +ibagh eri +Ġannih ilation +ĠfromPrevious Step +chega mais +minEnclosing Circle +dachi py +ĠkMean Cluster +Ġkjf elt +Ġcolsd one +Ġpyec sca +Ġpymesh fix +Ġpyja mas +Ġpydl m +Ġpyvirtual display +Ġpyinfra box +Ġpyradio config +Ġpymort ests +Ġsetrgb color +ĠsetRemote Sensor +libcz mq +libGLES v +06194 9587 +06311 989 +Ġwhirl pool +SEDIM ENT +STENCI LOP +100926 053943 +maxKnee Force +051501 304 +03478 013479252695 +ĠintGeneral Ledger +csRelative Path +utilis ateur +eldrit ch +Ġchagn ges +Ġrastream ento +Ġramenia app +baseMetric V +grappe lli +plotGlobal Use +REMASTER PROCEDURE +REPARAMETER IZED +REALLOC RESOURCEMESSAGE +REALLO COPTIONS +ANNUM S +ANSU hEUg +ĠRecurs iva +ĠRegula Falsi +subCort Aff +Ġ{}/{}/ {} +Ġ{}ãĢĤãĢĤãĢĤãĢĤ '. +inputMagMeter Name +skelse c +Ġscron sole +34500735 416 +Ġweasy print +writeAll BranchCatalogs +withgft zero +updateGUI Image +updateRho Prd +ĠConfli cts +943503 36 +9444444444 444444 +DETA ILED +DEHUM IDIFIER +DEUTERON OMY +ROTT LE +Ġappinvent ormuBot +NameGender Classifier +avgb pm +ĠnoOut Conns +Ġnovac lient +ALAAAAAA QAB +CTGCCC AGATGCGA +CTGCGCA CTTAACTTC +DataZoom Opts +ivaz is +851475 143 +Ġspecp ad +011165 12332600 +011169 100926053943 +Ġopenarticle gauge +ĠKiven C +ĠKRB CRED +ĠuserExist InRoom +ĠuserWants ToExit +Ġcontfract beta +ĠimageToMap Id +ĠmaxPoint Index +ĠmaxSurvey Dist +Ġzmator der +ĠhasVar args +AGWE ED +createReverse Node +ISVS JfTpJk +numberRange Looks +numberAzimuth Looks +doTry Next +specul ative +trybun at +currentRemap Filename +Ġloude st +ĠcheckPiece MovValid +Ġdispla cy +APPOINT MENT +APOST ROPHE +753764 06311989 +282465 18 +ETTER BEEK +calcenti res +Ġspinn man +movePast EndOfContainer +myPDF path +ĠUnidentified ImageError +Mealy State +ĠQUI ET +ĠQStandard Item +ĠQidian Exception +targetDelete DB +ABRID GED +primc aps +20137155 06 +77975 000005 +zerbai jan +eyJv cmdf +ĠXImport Filter +CHOO SE +cclcgce li +474542 8888 +toptwo hundred +TestnamePow TestRunner +ĠstringFrom Gralog +rangeSampling Rate +Chrg Br +marktwor nn +markonern n +ĠfilesToBe Used +iterNodes ByType +iterReachable TreeItemsFromItem +NumRT Vs +NumCompanies Worked +Loyo la +assertHTMLE qual +ĠreadOne Operation +ĠreadMaster File +TRadi obutton +ULocal OptGroup +ToTra sferList +ToGL Type +ToGP ULocalOptGroup +ToCir culant +ĠPybind Base +ĠPyFE MP +ĠPyShadow ingBuiltins +ĠPyPortfolio Opt +ĠPyCUD ADeviceInfo +ConfigExpected StackSize +65465 24242 +67376 064 +showPy plotGlobalUse +showMacro Window +useMulti GPU +useCp ROI +useAutoc alling +ĠListMetricSummary Response +ĠListMetricMeta Response +000000011101 00111110110 +0000001001111011111111 0 +FAVOR ITE +pltAverage PersonSpeed +ĠanyAdjacent Occupied +ĠfirstOccur List +ifyGT GFCommand +ĠqueryDbFetch All +lastCmd Time +taskparen tidmap +DATARE QUEST +ĠfullOrder Data +FrameOr SearchList +climato logies +GetHeader Value +GetDst Property +nydail ynews +Ġcallsm usic +ĠasscIncident Count +buildFrom PreInOrder +awcz yni +543665 000518528 +ĠfindNew Heights +Ġdiffract ogram +LIUD igitalErrs +ObjectDD L +ObjectLink ConnectionIndex +Ġordercn stit +Boole Set +Ġsupplément aires +ĠTestXDRI OCToD +Regula Falsi +struktion en +Ġportfoly o +682313 03 +CExtension Array +etsRL AngleSpace +celldms x +cellnotation spath +ĠCreateHelp Text +ImageCaption ing +ĠtmpIncomp List +ĠPathDefinitions Weighted +DBBACKUP PATH +01298288 6546524242 +ĠsortedBy RankMap +PROFACT IV +}\"""" ) +ThisFull path +Ġphaset hread +torchtb profiler +ByCov Rate +ClientCert Failure +'\`([^\`]+)\ `', +AppAuth Client +hasGLE xtension +optimalg ft +ĠconvertToOne Hot +Pyroc lastic +Pyblo xy +ĠTherm Bands +ForBridgeLamp Cmd +Fornec er +ForCausal LM +pgYeti Maya +ĠnonDirect Sites +.\+\ ):\ +Ġcloudf erry +ĠpiTom ation +ĠLovec ruft +FOFC WT +SubSys Id +SubAccounts Serializer +MLPB aseline +Ġ$$$$$$ /| +sigRegion ChangeFinished +ĠZubi eta +GenerTopo Edges +rsOrPr nAmt +hexarchive file +Discriminant Analysis +canBe Wrapped +NEOD yS +RunIIF all +realDonal dTrump +ĠFileConsole Logger +PortStat uDescription +pxrpython subst +ĠAddJointLimitParticipant Step +priceReminder List +Ġparticipi al +ĠelementSetFull PathData +PerCap ita +ColorPlugValue Dialogue +OrPassword Error +zeroTerminated Floats +EventChanges Tracker +GIGANT UM +LabelCalibration Settings +æķ°å¼ı ãģ¨ãģĹãģ¦ +ĠRunGo ToTest +documentConstant Identifier +ĠPROCES SED +ĠPROPAG ATING +ĠNotHtml Exception +,\.: ;\ +ĠoldCur Slide +ĠTelom ere +handleUnknown Assignment +ĠfinalTrending List +BOILER PLATE +ĠLogStatistics Agent +EqualCase Ignore +ĠLIGE LE +ACTORTASK SPEC +DoFirmware Upgrade +(['________________________ ', +ĠuniqueConv os +1001000000001000000 111 +SHistorical Record +0001545 48 +ĠQtQml Viewport +socketKeep Alive +Ġowscap able +QuerySync Params +LengthStandardi zer +Ġcircolari List +ĠstackTop List +PolicyRow status +PolicyQueue Action +PolicyDiff ServAction +PolicyPriority Action +PolicyOutgoing Action +PolicyMetering State +PolicyForwarding Action +Ġë¸Ķ ë¡Ŀ +ĠflagBits Size +ANDrQC soYYaaqihhhpq +CRCAlign Errors +sortedJun cs +computeDistance ToSubspace +StreamFlow VolAdj +TCATTTGT ATAGTTTTTTT +0110110111111 011011 +InvalidMnemonic OrPasswordError +0028877 3763259 +0029275 1363303 +002991155 233758036 +NewEvents Result +Ġautoscalings im +Queenst own +UpdateProperty Cache +nihl atak +PRECONDST ARTR +("""""""""""""""""" """""""") +readexact ly +ĠSubaward View +ĠSubroutine Node +ĠSubthesauri LabelCalibrationSettings +ĠQuTi P +ĠOpenMDA O +ĠOnSpell Effect +ClassifierMatch Order +WithVehicles InTree +WithRedu ctions +ĠTHRED DS +ĠapplyQA OA +ĠARTIC LE +ĠmostFrequent Alternative +glShader Source +glCompile Shader +glAttach Shader +glDetach Shader +005473 17766177 +0059823 10467516072 +specifics name +VariableAttributes Error +ensureMoreBytes CanBeRead +currtsk name +SFPConnector Type +SFPFiber Type +ĠMyUserWith SameName +rfloor div +AndReplace InAnchorNames +recAddr Stream +TRIVI ALLY +ĠJSONWeb TokenAuthentication +ActionMulti Panel +ActionSelect IdleWorker +ActionSpatialUnit SelectionPoint +TransformBroadcast er +TransformIndexTo PhysicalPoint +externalController Output +ĠColumnShift TableBootstrap +ĠTextMel ID +ĠnormalizeTwitter WordsWith +ahrsp os +ĠNewLife Utils +LISTNETWORK OPTIONS +LISTNODES OPTIONS +LISTACCESSBINDINGS RESPONSE +zenPen xil +Decentr alized +VisaD ynamicPlot +çĽĪäº ı +AccountBreak downBy +uvHist Block +agingParents MoveInWith +ĠSpatioTemporal Dataset +ĠAssymetric Node +RandomShuffle Queue +TrackHistory Length +21664775 94350336 +SurfaceIr radiances +Temperture Trap +SampleDiscarding Kernel +003934 64 +003996 98 +ĠRandomMesh Composer +ĠLineByLineText Dataset +bcdfghjk lmnpqrstvwxyz +iedliwo ÅĽÄĩ +ĠTokenVerify View +ĠMultiChe b +emporary Error +ĠremoteLogging Config +Ġ'"{}{} "'. +00101011100111111 0111101 +åľ¨çº¿ è°ĥè¯ķ使çĶ¨è¿Ļ个PID +232832 34 +ĠONVIF Camera +Ġmagnetis ation +30195287 69064523 +30167337 74 +ExtraDHCP Validation +906307 7870366 +GenVect Lin +ĠMinNeutral Pt +CARedu ceCuda +HWzm RR +ĠInvalidRSE Expression +NETMI KO +9848900586 3667 +ATEDOWN LOAD +servePref Set +IntervalUpper Key +IntervalLower Key +CallNext HookEx +DCURSOR CAPS +INSTANTI ATED +ĠSumOfBeta Ece +allowedExact Paths +ĠEditable Filter +0078915584 89063755 +tweetFeder er +ĠBlockHeaders WithChainLock +ĠdesiredFace Width +ĠDefaultsFlex ibility +AutoUploadLog State +४ॠ« +ãĤĴæ¤ľ åĩºãģĹãģŁ +置信 度 +GCATCT GGGCAGATGATGTC +017378 134596128803 +ĠExtractive QAPipeline +пÑĸ Ñģ +UPDATEPARTIC LESHOULD +42261826 1740699 +0082734 080933732 +0089297 12100780307 +0089257 34500735416 +szkol anka +ĠнелÑĮ зÑı +ConstantPyIOmica ExamplesDirectory +âĸĪâĸĪâĸĪâĸĪâĸĪâĸĪâķ ¦âķĿ +triggerOriginal Price +triggerTrailing StopDeviation +updatesMerged Block +ĠChangeActivePlots Var +å°ıå®ĺ 人 +)+'|| '+ +CustomMetric LookupError +0004947 33 +ijnv anhulle +ScoreDiffs PerSRECluster +wmLHE GS +ReleaseParticle Index +ĠmediaTrabal hos +4379383 01211039 +ĠOverdamped Brownian +ãĥ¼ãĤ± ãĥ³ãĤ¹ +VlanDouble TagEnabled +VlanMetro ModeEnabled +LOCALISATION PRODUIT +fishpig cow +ĠFeatureTracker Types +arrowBorder width +Ġaiowork ers +ĠCloudPassage Handler +以æĬ¤çħ§ 举ä¾ĭ +以身份è¯ģ 举ä¾ĭ +RTROI ObservationsSequence +sunxia ofei +ĠVmcaCer tool +ĠRESOUR CES +CURRIC ULUM +Ġpeertopeer utils +CGACCAGC ATTCACATACG +LANCZ OS +Ġempiri cally +swapETHForExact Tokens +035257 446797913 +03513016 359647736 +MaterialEditing Library +ĠUNIMO Model +ĠLinearAnneal edPolicy +EpochBased Runner +ĠDIFFER ENT +请ä¸Ģ次 åıªéĢīæĭ© +Ġgymnast ics +01832878 1006857753 +blogNb PostsByPage +arthikk annan +ĠJobBrowser BFF +03423918 1186421774 +0347761571 9248206 +QCGEEE IIByMJoBB +AUTONOM IE +QSortFilter ProxyModel +次éĥ½ å°ıäºİéĺĪåĢ¼ +次轮 è®Ń +åıĤæķ°åı¯èĥ½ 为空 +ĠGitCommitLog Node +YearsIn CurrentRole +resumeSayAll Mode +ospfV irtIf +0010111000101 000001001 +ARRCCCGE cDCS +TASKEXECUTIONS PEC +100111111111110011 001101 +pnicfsupplicant proxycheck +rwCZ dGuPNPT +ĠMaximumWaitTime Exceeded +Ġ"@/./ +/-/_ +ĠPVreflected Irr +11101100011111111 111111 +Ñĸб лÑĸ +ĠDummyDiscrete Env +CONTAINERDEPLOYED OPTIONS +ĠPARAGR APH +å½ĵidentify Type +ĠLihui yuParser +ĠASCIIC mdEncoder +åIJĪä½ľä¼Ļä¼´ çļĦå¹³åı°æłĩè¯Ĩ +ĠUIWo YD +ATTTGATT AAAATAGAACAACT +ĠFailedPredicate Exception +PERSONNEM ORALE +WebKitFormBoundary F +Ġdomblk error +ĠParserATN Simulator +该æłĩè¯Ĩ çļĦåħ·ä½ĵåĢ¼çĶ± +该URLåľ°åĿĢ å¿ħé¡»æĮīçħ§é¡ºåºı +âĸĪâĸĪâķijâĸĪâĸĪâķijâĸijâĸij âĸĪâĸĪâķĹ +wychow awczyni +åħ¨éĸĭ ãģ§æĽ²ãģĮãĤĭ +AgeCare Scaling +ĠHashPermutation Mapper +PAYPAL ISHIRING +Estafeta Label +æĸ¹æ³ķéªĮè¯ģ çļĦdata +PrecisionQuantization Config +Ġæī¹éĩı 解åİĭ +focusLastFocus ableObject +ĠStaticMaze Navigation +4950117696 081450 +Ġbetabin om +ĠSCENAR IO +è¿Ľè¡ĮçĶ»åĽ¾ æĵįä½ľ +ĠÑĥÑħод ов +LASTPERIOD AMOUNT +KGgoAAA ANSUhEUg +ConstructListOf Processes +è¿Ļ个URLæĺ¯ çĽ¸å¯¹URL +101111000101001001 000000 +æ°´æ» ¸ +AGTATAG CGACCAGCATTCACATACG +ĠtrajectoriesSortedBy StartEnd +83826257 32775 +ĠFactorioCalc Base +gestionsoci etaire +å¼łæĺ¯èº«ä»½è¯ģ åĽ½å¾½éĿ¢ +å¼łæĺ¯ä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ æŃ£éĿ¢çħ§çīĩ +ĠAFFILI ATES +éĢĻæĺ¯åĢĭ å¾Īéķ·çļĦåŃĹ +00101010010000000000011 00 +QBFEII IYRw +GetStatusApproach Position +FlattenBatchNormDropout Extractor +0102144769 15280102 +ĠMeshClust Enabled +xAuthQuiet Period +xAuthReAuth Period +ĠWaterPumping StationZO +ĠRuntimeDetermined EnviromentVars +å°ĩè®Ģåıĸ Excel +Ġwikilanguage s +UsIml zX +амÑĭл ков +79652085 14613565 +ATGACAAGTT CTTGAAAACA +ĠoutgoingHom enet +éĸĭå°ģ åºľ +åĤħéĩĮ åı¶åıĺæį¢ +ì²ĺëŁ ¼ +ĠSchuffenh auer +ĠQgsWkb Types +ĠexperimentalOCorrect List +kJwuje htfLGeQx +ELECTROMAGNET IC +AGAAAGTA ATATCATGCGTCA +个人éĵ¶è¡Į åį¡è®¤è¯ģ +SASpeci alizedOSDisk +PermissionsAccessControl Args +ĠMyCustomAmazonReviewNIPS DataLoader +Ġausreich end +MapperStatusAISE rrs +MapperStatusRxTrace Errs +96006409 3299587 +ĠìĿ´ë£¨ ìĸ´ì§Ħ +Ġgerçek leÅŁ +NbOfTx s +ĠSoftButter fly +biratnag ar +Ðijибли огÑĢаÑĦиÑı +ĠLancaster Stemmer +PrimeAward Summaries +ரண à®® +051851994 185199146 +ĠGtkDocComment Block +009407024 106167228 +页éĿ¢æıIJ交 åıĤæķ°åı¯èĥ½ä¸ºç©º +æĪĸèĢħç¦ģçĶ¨ åĽ¾åĥıä¼łè¾ĵ +פ×Ļ׾ ×ŀ×ķ×Ĵרפ×Ļ×Ķ +áĥ£áĥ¨áĥĶáĥ ķáĥłáĥĶáĥijáĥĺ +<_|;^{;^{;^{;^{ ;^{;^{;^{: +ÐŀÑĪиб ка +ĠSammelr öhrchen +ĠHerzegov ina +SdkInstallAttempt Time +ĠCachedSchemaRegistry Client +æīĭæĮģæĬ¤çħ§ä¸ªäººèµĦæĸĻ页 æĺ¯def +æĬ¤çħ§åħ¥å¢ĥ çĽĸç«łé¡µ +ĠUniversalAutomatic Answer +3273148975 0759 +giovann icuriel +000100110000000011 00000 +YearsSinceLast Promotion +×¢×ij ×ķ×ĵ×ķת +CREATELINE ARPROJECTILE +Affirmative Id +01920385 3016733774 +0192197634169 13338 +ĠDieIfFiles Mismatch +usbDeviceCdcBuf Pool +åįĬå¾ĦçļĦç²ĴåŃIJ æĿ¥è¯´ +æij½åħİ æĿİåIJī +Ġpomodor r +11129900 1912 +cPPPoEServerCurr Sessions +à°Ĺà°® à°¨ +åIJ¦åĪĻ忽çķ¥ 该åŃĹ段çļĦåıĸåĢ¼ +åIJ¦åĪĻå¿ħå®ļ æĬ¥éĶĻ +ĠSoundCloudLiked Tracks +EcalIntercalib Constants +KjelsÃ¥ s +VersorAt Time +003528131239818 3218 +004765164 8537794244 +ChanBrizard EOM +LIUAnalog Errs +LIUExcess Zeros +LIUPRBSE rrs +æĶ¯æĮģåĪĨåİĭ åį· +Ġ+-------------+---------+ ----------------------------------------------------------+ +374769085 3614695 +Thanksgiving WeekData +ĠspiceTls Port +å¼łæĺ¯æīĭæĮģä¸ŃåĽ½ä»¥å¤ĸ驾çħ§ 人åĥıéĿ¢çħ§çīĩ +xpaeportHandshake Status +xpaeportUserNum Now +xpaeportMcast TrigStatus +åħ«åįģèIJ¬ ç¦ģè»įæķĻéłŃ +æīĢ以å¿ħé¡» å¯Ĩçłģæĺ¯ç»Łä¸ĢçļĦ +005489088 061949587 +áĥľáĥIJáĥĽ áĥ£áĥ¨áĥĶáĥķáĥłáĥĶáĥijáĥĺ +çİīé¾į çŃĨæŀ¶ +Ġíݸ미 ë¶Ħ +IDXGIDecode SwapChain +åįķ个æĸĩ件æľĢ大 ä¸įè¶ħè¿ĩ +ÏĦελεÏħ ÏĦα +ĠPersistentDictClient Exception +ĠAdaptiveParamNoise Spec +'{"-": > +Ġ解åİĭæĸĩ件çļĦ 缮çļĦåľ° +Ġ解åİĭåİĭ缩æĸĩ件 åĪ°æĸĩä»¶å¤¹çĽ®å½ķ +MarcSkovMad sen +03665756 2013715506 +ÏĢοÏĥÏĢά ÏĥμαÏĦα +Ġãģ§ãĤīãģ£ ãģıãģĻ +ĠBWAPIT ool +ЦиÑĦ ÑĢа +ĠRpcAmqp Client +REMOVENODE OPTIONS +OptimizeFunctionOn NextCall +ĠкоÑĢнев ой +PodToReplicaSet Linker +PodToStatefulSet Linker +PodToDaemonSet Linker +èĦ¸çļĦåĽ¾çīĩ éĻĦ件åį³åı¯ +FruitPuree Percent +ACTORCREATION TASKSPEC +ĠBertForQAS imple +못ê°Ģìł¸ ìĺ¤ë©´ +BareBones FireworksAlgorithm +SonyElectronics Corporation +tortuguin ha +ذرائ ع +ATTGACGC ATGATATTACTTT +MinimalPhsBandCover ing +ĠAbstractBaseTestFor HDP +JAVAFUNCTION DESCRIPTOR +021638144 24420707 +åĪ¥è¨ĺäºĭ æķ°ãģ® +çĪ±ä¸½ ä¸Ŀ +å¼łæĺ¯åı°æ¹¾å±ħæ°ijå±ħä½ıè¯ģ åĽ½å¾½éĿ¢ +è¯ģ件éĻĦ件缮åīį ä»ħä»ħæĶ¯æĮģjpg +secondext inctiongame +解åİĭæķ´ä¸ªçĽ®å½ķä¸ĭ å¤ļ个 +PhotonLuminosity Density +EmotionBasedD ic +çĬ¶æĢģçłģæĸŃè¨Ģ 失败 +ReplicaSetToDeployment Linker +CNOSPFC lBr +GAGGCGAAAAAAA ATATAAATCACGCTAAC +ĠordemServi co +1590829943 940 +ä¸Ģå¼łä¸ªäººæī« èĦ¸çļĦåĽ¾çīĩéĻĦ件åį³åı¯ +ĠTrustedUserJSON Presenter +0032200610887 23078 +ä¸įéľĢè¦ģåĮħåIJ«æ¡¶ åIJįåĴĮdownload缮å½ķ +å¥ĩæĢª çļĦåıĤæķ° +CDOTASPEECH MATCHONCLIENT +<_|<_|<_|<_|<_|<_|<_|<_| <_|;^{;^{;^{;^{;^{;^{;^{: +Ġè¾¹çķĮåİĭåĬĽ æĿĥéĩį +32016080101 91 +66971817633709 65 +GATTTATATTT TTTTTCGCCTCGACATCAT +WorkloadIdentityPoolProviderOidc Args +TUNEDEMBED DING +ATAAAAAGATTCTTG TTTTCAAGAACTTG +fawnofija wef +ĠSimpleGraspWithSle w +èĦ±æľºè¿IJè¡Į æĪĸèĢħç¦ģçĶ¨åĽ¾åĥıä¼łè¾ĵ +ĠæıIJ交ä¸Ńåĩ» è´¥äºĨ +SnipeCheckin Form +ĠæľįåĬ¡åĻ¨ç«¯åıĤæķ° éªĮè¯ģ +çļĦåŃIJ缮å½ķåĴĮ对åºĶ æĸĩ件åIJį称åį³åı¯ +ĠØ£ÙĬض ا +åıªè¦ģåĮħåIJ«download缮å½ķä¸ĭ çļĦåŃIJ缮å½ķåĴĮ对åºĶæĸĩ件åIJį称åį³åı¯ +AGTTAAGTGCGC AGAAAGTAATATCATGCGTCA +ä»ħä»ħéľĢè¦ģä¸Ĭä¼ł ä¸Ģå¼łä¸ªäººæī«èĦ¸çļĦåĽ¾çīĩéĻĦ件åį³åı¯ +åįİ为åĪĨç»Ļ åIJĪä½ľä¼Ļä¼´çļĦå¹³åı°æłĩè¯Ĩ +8235471228 38406 +\+\)\( .\+\):\ +ËĭËĬ éĢĻæĺ¯åĢĭå¾Īéķ·çļĦåŃĹ +ĠnieskoÅĦ c +maxtasksper child +ĠCheckboxWithLegend Group +PYTHONTESTR UNNER +ãģķãģĽãģŁãģĦ ãĥģãĥ£ãĥ³ãĥįãĥ« +OpenCVEggROICurr Embryo +个人è¯ģ件认è¯ģæŶè¯ģ件éĻĦ件 çļĦæĸĩ件URL +=([^]]*)\ ]/ +ajsnoia jerofi +02158245784357 8595 +ATCAAATGTTAGCGT GATTTATATTTTTTTTCGCCTCGACATCAT +034263046786 69112 +AAohhBBCOBh JAIUQQgghHIwkgEIIIYQQ +403756749600 872 +0018734496211 436635 +getSumOfMotif ScoreDiffsPerSRECluster +ResonanceDecay Filter +ãģ®ãĥķãĤ©ãĥ¼ãĥŀ ãĥĥãĥĪ +à¸Ľà¸£à¸Ķ à¸ģรà¸Ń +ACAATATAAAAAAACTATACAA ATGACAAGTTCTTGAAAACA +ScrapedFinishedAndStart Analysis +kanepokh ari +|<>+=;,? *@ +Ġåıĸå¼ķä½Ļ åĬĽ +Ġçİ°åľ¨æĺ¯ä¸ŃåĽ½ AèĤ¡ +00107395201212057 15 +03474831399 216782 +Ġdopplershif ted +008249542493103 945 +WordInDifferentHumps Mode +AGAATCTTTTTATT GTC +DwarseMarkeringVerschu ind +èİ·åıĸæĸ¹æ³ķ请åıĤè§ģ å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼å¦Ĥä½ķèİ·åıĸxaccountTypeçļĦåıĸåĢ¼ +ATCGTATGTGA ATGCTGGTCGCTATACT +"(?> +" ={ +" ''' +" +\ +" /\ +" !') +" ${ +" /(? +" {}\ +" `) +" ...\ +" ðŁĵ +" ``) +" ([\ +" |" +" ¬ +" |{ +" /*": +# ^ +# =\ +# ^\ +# ?\ +# *\ +# [\ +# @\ +# <\ +# -\ +# [] +$ ` +$ '), +$ ({ +$ :\ +$ '\ +$ "). +$ >\ +$ ,\ +$ $', +$ ]\ +$ !\ +$ @\ +$ #\ +$ )' +$ _( +$ (". +$ ^{ +$ ]") +$ ;', +% [ +% { +% ), +% }, +% '), +% \\ +% '). +% ï¼Į +% '}, +% |\ +% ,\ +% $\ +% *\ +% ~\ +% -\ +% ')[ +% >& +& : +& = +& ^ +& =\ +& !\ +& +\ +& /\ +& %. +& =+ +' == +' >> +' #! +' '). +' }\ +' ï¼Į +' "). +' "} +' !\ +' """, +' ~\ +' -\ +' `, +' #\ +' ")[ +' -{ +' ?", +' -', +' âĢĶ +' /? +' {}\ +' ..\ +' ðŁ¤Ķ +' âĢ²âĢ² +' ðŁ¤£ +' ཱ +' {}'". +( ^ +( ('-- +( }\ +( ./ +( ,\ +( ?\ +( `\ +( ]\ +( #\ +( %% +( {}. +( /[ +) .. +) =( +) ":" +) (- +) '][ +) $\ +) =\ +) !\ +) =% +) &\ +) ...") +) [:] +) ?", +) ``` +) ([^ +) ']* +) "}], +) âĶĢâĶĢâķ°âĶ¤ +) [:,:,[ +* ; +* ` +* ), +* __ +* =" +* '. +* ". +* " +- '% +- *', +- *' +- *", +- >"+ +- {}/'. +. $ +. "\ +. '\ +. =\ +. ^\ +. )]) +. )', +. @\ +. ~\ +. (? +. )" +. '])) +. ]', +. ']} +. ``` +. ]}, +. âĢĿ +. +) +. ''') +. $% +. ]+)\ +. ?(\ +. ]+)", +. =]\ +. +-]+ +. )(?: +/ ! +/ & +/ ), +/ "] +/ =( +/ .\ +/ |\ +/ `\ +/ @\ +/ ')[ +/ ")), +/ ")[ +/ ]') +/ ..." +/ )? +/ )| +/ @@ +/ ...' +/ .*', +0 925 +0 937 +0 927 +0 924 +0 994 +0 928 +0 939 +0 9990 +1 00000011 +1 000000000000000 +1 000000000000 +1 000000001000000001 +2 000000 +2 110 +2 1001 +2 180 +2 1002 +3 370 +3 150 +4 100 +4 200 +4 925 +4 160 +4 848 +4 958 +4 993 +4 992 +4 939 +4 981 +4 982 +5 255 +5 9627 +5 126 +5 022 +5 024 +5 948 +5 175 +5 133 +5 146 +5 136 +5 176 +5 196 +5 138 +5 178 +5 277 +5 139 +5 935 +5 946 +5 021 +5 179 +5 057 +5 336 +5 141 +5 086 +5 222 +5 966 +5 975 +5 087 +5 328 +5 978 +5 038 +5 886 +5 085 +5 066 +5 274 +5 243 +5 448 +5 465 +5 273 +5 046 +5 253 +5 084 +5 449 +5 289 +5 351 +5 8793 +5 462 +5 089 +5 481 +5 053 +5 471 +6 201 +6 001 +6 0001 +6 115 +6 024 +6 168 +6 175 +6 103 +6 224 +6 117 +6 197 +6 327 +6 156 +6 023 +6 375 +6 325 +6 235 +6 065 +6 048 +6 267 +6 055 +6 229 +6 037 +6 867 +6 257 +6 645 +6 956 +6 555 +6 576 +6 320 +6 085 +6 845 +6 066 +6 378 +6 578 +6 064 +6 557 +6 263 +6 228 +6 098 +6 884 +6 291 +6 758 +6 868 +6 371 +6 999999 +6 381 +6 963 +6 979 +6 960 +6 09414 +7 100 +7 076 +7 107 +7 10000 +7 255 +7 925 +7 127 +7 024 +7 005 +7 006 +7 168 +7 105 +7 102 +7 163 +7 137 +7 197 +7 114 +7 165 +7 106 +7 176 +7 347 +7 327 +7 345 +7 148 +7 156 +7 996 +7 267 +7 998 +7 179 +7 227 +7 965 +7 037 +7 265 +7 189 +7 191 +7 257 +7 086 +7 056 +7 924 +7 248 +7 576 +7 978 +7 038 +7 085 +7 066 +7 366 +7 028 +7 945 +7 878 +7 078 +7 323 +7 465 +7 445 +7 575 +7 253 +7 068 +7 467 +7 084 +7 474 +7 291 +7 554 +7 329 +7 031 +7 282 +7 039 +7 669 +7 663 +7 831 +8 076 +8 012 +8 010 +8 925 +8 123 +8 006 +8 154 +8 096 +8 117 +8 197 +8 133 +8 106 +8 109 +8 144 +8 156 +8 155 +8 027 +8 276 +8 143 +8 644 +8 336 +8 037 +8 075 +8 152 +8 222 +8 182 +8 377 +8 374 +8 248 +8 058 +8 067 +8 556 +8 030 +8 648 +8 064 +8 078 +8 242 +8 270 +8 068 +8 363 +8 283 +8 043 +8 042 +8 1955 +9 022 +9 180 +9 1234 +9 124 +9 196 +9 109 +9 013 +9 122 +9 184 +9 139 +: ) +: ^ +: } +: ('\ +: ### +: $', +: âĢĻ +: "]/ +: (?: +: ][: +: *' +: *", +: ~/ +; > +; ] +; "] +; "), +; "): +; (\ +; }\ +; '\ +; >\ +; |\ +; ,\ +; &\ +; #\ +; ::\ +; {};{}; +< @ +< =' +< }\ +< =- +< {\ +< &\ +< -\ += () += :\ += }') += +\ += ('% += {}. += /") += @@ += ?' += ?" += ~' += $$( +> ^ +> __ +> .. +> ([ +> (( +> )\ +> /' +> .... +> ]\ +> {\ +> *\ +> +\ +> """, +> )' +> [{ +> "]). +> ...] +> ''') +> ','') +> )]; +> ([^<]* +? # +? + +? _ +? ": +? ). +? "," +? '\ +? ;\ +? $', +? _\ +? {}". +? >") +? )? +? (?:[ +? :\/\ +@ & +@ = +@ ? +@ ` +@ ') +@ ([ +@ "\ +@ >\ +@ ]\ +@ {}". +@ {}. +A ur +A rom +A ma +A to +A ta +A ls +A AT +A oc +A ces +A ire +A lib +A lp +A do +A CO +A IM +A ql +A nder +A bg +A not +A US +A lambda +A qui +A EM +A ven +A sin +A ves +A ha +A br +A eq +A sn +A ATA +A IF +A EC +A IA +A bra +A vp +A bd +A yy +A EA +A erials +A ffi +A QK +A hu +A ito +A IDE +A mong +A HK +A Hg +A kh +A HG +A ACA +A stro +A ATG +A inda +A gua +A iiDA +A ATCA +A dota +A chromLens +A dbTool +A VERAGE +A WithOutput +A kinator +A iiEEEII +A irthings +B ing +B ers +B tr +B ac +B our +B lu +B ass +B ust +B ast +B ak +B av +B FI +B PT +B act +B las +B pl +B UN +B ally +B last +B ible +B ART +B PL +B light +B rl +B IR +B SL +B GT +B READ +B NS +B BR +B aker +B VC +B FC +B tl +B gp +B VS +B HW +B ä +B inc +B nl +B HI +B Day +B ARK +B Wq +B atched +B ranches +B ARR +B pz +B ounce +B ento +B KW +B ARE +B IDS +B xN +B bL +B nF +B illion +B azel +B URS +B ingham +B OLT +B anners +B BRY +B oltzmann +B POW +B undler +B achelor +B gcH +B PDN +B acteria +B issau +B rierScore +B NGrad +C ce +C es +C age +C ta +C py +C ob +C oc +C ape +C jo +C ay +C mat +C av +C Data +C uration +C cy +C bg +C UM +C ui +C Class +C case +C AGE +C Not +C dt +C aa +C ASS +C SH +C GN +C PY +C orn +C COMP +C ADDR +C kt +C lare +C Release +C WT +C utter +C Wq +C UA +C ATOR +C abe +C inder +C pq +C AMA +C annon +C MOS +C rops +C airo +C uV +C dE +C runch +C lou +C ADR +C rane +C reek +C txs +C ulture +C iclo +C rawl +C DBS +C amas +C BRACKET +C errar +C lerk +C obble +C atherine +C aleb +C uvette +C POX +C yprus +C lemens +D ge +D ame +D all +D xe +D ap +D ime +D ID +D ak +D ive +D ps +D AD +D nn +D DI +D US +D ell +D Model +D Get +D Node +D lambda +D CE +D Create +D vm +D rs +D ME +D px +D á +D TTP +D AGS +D inner +D Loader +D beta +D tw +D MAP +D DU +D orn +D ru +D VERSION +D ah +D rum +D CF +D LV +D java +D ofs +D LR +D gw +D umb +D Head +D rv +D NR +D HR +D zh +D awn +D auc +D gain +D hc +D WC +D AMP +D wu +D ani +D qn +D Ãī +D well +D rV +D cj +D rew +D Wrap +D omic +D maven +D uo +D Compile +D qN +D ONES +D ahl +D iversity +D emisto +D usk +D enoise +D rought +D cmDir +D PortObjects +D Åģ +D jibouti +D mitry +D okuWiki +E on +E con +E min +E ll +E ax +E pi +E bin +E ww +E AC +E FA +E CA +E cies +E gy +E FO +E fc +E va +E zen +E tu +E xecu +E BE +E BA +E BF +E lf +E spaces +E ARCH +E DEL +E sz +E HH +E HC +E VA +E hg +E IDs +E VI +E san +E van +E ston +E oh +E rie +E oF +E mpi +E LECTION +E ACH +E CRIT +E cds +E Hq +E kle +E Jz +E arl +E agle +E liza +E ELS +E mergência +E QqF +E AGAIN +E PrintURL +E gypt +E CalSD +E lastiCache +E clair +E iffel +E QUIVALENT +F le +F ss +F as +F ase +F ow +F tp +F ron +F ps +F AP +F org +F Sg +F oth +F ld +F Un +F td +F CA +F DB +F QL +F ret +F POINT +F ó +F ru +F SN +F cn +F UND +F ives +F ied +F CODE +F uk +F TestCase +F Style +F NT +F ancy +F xyz +F uz +F HB +F UA +F hg +F mz +F BT +F avor +F uj +F MAC +F kb +F WL +F NULL +F rw +F uzz +F pz +F zW +F uer +F UZ +F Comm +F ARE +F hY +F alls +F alcon +F Hq +F ifth +F tZ +F olk +F ORTE +F antasy +F hcX +F enske +F MMT +F rustum +G ue +G id +G ol +G is +G ow +G ly +G low +G len +G ag +G cs +G lock +G ale +G FI +G Ac +G DI +G root +G pk +G UM +G MO +G OP +G ross +G TE +G Rx +G bit +G eff +G alle +G GI +G mag +G UE +G OS +G ros +G rr +G ao +G Wh +G POS +G ACC +G ini +G COUNT +G gp +G probs +G VK +G UES +G hp +G QA +G Wq +G hq +G uy +G XC +G hz +G Ãī +G lU +G pC +G REE +G iving +G pq +G APS +G zG +G jR +G overnment +G aia +G ilbert +G urg +G GLES +G AGGT +G Approved +G eeks +G rapheme +G CTTCT +G utenberg +G uitar +G reece +G oblin +G ordon +G FLOPs +G CFS +G uatemala +G iovanni +H ss +H ig +H xc +H ep +H da +H ari +H sk +H ick +H cc +H US +H ny +H ART +H DB +H CC +H ee +H RL +H br +H á +H mag +H oo +H SD +H aut +H SL +H alt +H UI +H LD +H FE +H LY +H yy +H nz +H isto +H uron +H HR +H kk +H tm +H hg +H ND +H XC +H fD +H MZ +H ô +H XR +H unt +H pz +H xW +H xz +H fu +H uan +H xg +H ADER +H PIX +H LLL +H dY +H nJ +H pV +H jy +H HOOK +H JY +H zzz +H ilbert +H abilidade +H QQw +H abilidades +H ernando +H MPR +H usband +H otels +H uffman +H ALLO +H jjj +H ampshire +H ernandez +H UNG +H CalSD +H ybird +H ARGINGTARIFFS +I th +I label +I dd +I gra +I the +I ik +I mk +I cer +I AND +I Stream +I ka +I faces +I UG +I lV +I sso +I HR +I bz +I mJ +I mh +I zZ +I HM +I HZ +I ALLY +I PIP +I HEP +I muSensor +I plM +I xWI +J in +J ur +J ol +J ve +J sp +J xc +J ag +J CT +J En +J UR +J IL +J IB +J pc +J aw +J Of +J resp +J UP +J ason +J ACT +J OK +J ga +J PY +J IF +J SU +J OM +J Sw +J AX +J BI +J DQ +J YY +J DC +J ki +J TAG +J ky +J Kp +J Sq +J AW +J uj +J AIL +J jY +J MX +J Ov +J zZ +J ndi +J nP +J Um +J vN +J DBC +J ulian +J okes +J FLEX +J UDGE +J BaL +K id +K and +K ul +K ot +K el +K value +K os +K xa +K ho +K min +K array +K IC +K em +K au +K ET +K IL +K ost +K ui +K OP +K SS +K Base +K ZE +K PR +K WS +K eff +K oo +K BL +K So +K UE +K ane +K Ip +K SP +K zz +K OB +K OTA +K DU +K ao +K fold +K INGS +K loud +K ua +K BA +K RA +K CN +K HW +K BY +K FS +K VK +K HI +K obo +K QK +K PD +K ETH +K CAL +K RX +K xE +K Xy +K Dg +K ras +K xW +K ala +K enh +K DW +K rz +K PCA +K oj +K SSS +K elp +K zE +K entucky +K andidat +K orea +K lein +K atie +K giAI +K ruskal +K enzie +K jsn +K erala +L ut +L xc +L ob +L ator +L ord +L RE +L np +L own +L yn +L iv +L AC +L ain +L SI +L ie +L UM +L ets +L DS +L ACK +L Qt +L CI +L XXX +L IME +L AV +L SL +L SA +L dc +L aj +L eno +L ives +L TS +L ITS +L qs +L Fi +L nz +L ues +L anded +L ips +L FD +L sun +L Wi +L pf +L KB +L ND +L KA +L abe +L ZW +L atex +L ALT +L Qs +L ikes +L SHIFT +L UMIN +L iga +L uego +L unar +L pfD +L ankers +L MERFitGrid +L legada +L ütfen +L aminar +L ustre +L ACTATE +L ittoral +L loyds +M fi +M ata +M ot +M age +M am +M ist +M pi +M ann +M old +M PO +M ong +M DI +M ug +M CA +M CE +M CK +M QL +M istr +M GR +M rs +M WS +M ICE +M DF +M IZ +M TC +M sn +M theta +M WE +M IG +M nc +M Vector +M mn +M ali +M RC +M uk +M INTER +M xyz +M andatory +M ora +M hg +M ARB +M ara +M lx +M bj +M Ui +M solar +M ilit +M ILES +M hUK +M nist +M obi +M Bean +M asters +M ashape +M aroon +M eross +M isiones +M artijn +M ornings +N en +N it +N ss +N un +N ra +N sp +N ine +N test +N xc +N ib +N ft +N ass +N ay +N DE +N back +N net +N IM +N AP +N tem +N AD +N ong +N De +N CL +N FF +N pc +N OL +N ature +N ero +N arr +N INE +N Te +N vars +N apt +N BO +N DF +N final +N fl +N YX +N LA +N MENT +N GEN +N IZ +N ev +N SU +N RU +N found +N PC +N WORD +N LD +N TF +N hood +N DER +N ied +N ina +N tb +N DK +N pth +N uz +N CHAN +N inja +N yb +N arrow +N ICS +N vt +N atal +N LM +N mM +N YA +N PATCH +N cL +N Xq +N yi +N kZ +N early +N QT +N dZ +N hk +N ginx +N parm +N cX +N gx +N elly +N orb +N wO +N olan +N athan +N stars +N icht +N iger +N Prsa +N exus +N enets +N OPA +N DCG +N ombre +N apsController +N sga +N urkana +O re +O sc +O py +O EN +O io +O Se +O stat +O DI +O SI +O EL +O ny +O PP +O DIR +O ven +O FL +O uri +O zone +O MM +O MB +O Op +O CS +O mar +O gl +O uch +O dom +O AF +O kp +O hy +O AI +O har +O HA +O DIM +O GC +O ij +O wm +O HY +O IJ +O mitted +O mh +O xW +O gle +O cq +O xw +O yk +O POSITIONS +O dhod +O dometry +O ntarget +O SImage +O olong +O lympus +P ue +P pp +P est +P Re +P ens +P fo +P og +P ip +P dd +P ok +P start +P state +P no +P reg +P ont +P orted +P top +P IB +P rt +P PE +P De +P err +P ca +P ogle +P xy +P reen +P ny +P xx +P CC +P By +P é +P DS +P ME +P SIZE +P SD +P ane +P tile +P va +P fr +P pd +P BR +P dl +P FE +P GA +P FC +P BA +P ano +P uk +P Collection +P DK +P BY +P nl +P avel +P STATE +P BS +P awn +P gain +P mz +P ASET +P QC +P ledge +P RESET +P jx +P atience +P ulls +P CLK +P eso +P ETS +P resident +P zzz +P izza +P lateau +P laces +P ÃĶ +P ágina +P igs +P DDD +P ulp +P cellX +P GOPTIONS +P zyy +P istol +P irImage +P izdyukLogger +P uppi +P HOSPHATE +P rague +Q in +Q ab +Q om +Q sh +Q ms +Q xd +Q max +Q ax +Q AM +Q of +Q ey +Q Config +Q TT +Q sim +Q App +Q az +Q ves +Q PU +Q gh +Q Tree +Q WN +Q SP +Q NB +Q TA +Q RY +Q OM +Q Network +Q Ke +Q AF +Q WH +Q YY +Q DK +Q cx +Q lg +Q RF +Q QA +Q DAY +Q HP +Q Star +Q zW +Q Ok +Q Dn +Q jq +Q MH +Q XP +Q iao +Q SCR +Q ProgressBar +Q VBoxLayout +Q SQLITE +Q StatusBar +Q afT +Q ToolBox +Q EARBE +R ub +R min +R CT +R iv +R IS +R ps +R ick +R rt +R ug +R UM +R Client +R NE +R ado +R oo +R BL +R MM +R va +R CS +R NB +R Pi +R ah +R qt +R ough +R ama +R Sw +R AX +R tl +R CP +R ivers +R DAY +R bio +R mZ +R het +R UUID +R cw +R nut +R NW +R enders +R GCN +R TOL +R hod +R aspberry +R ogue +R ÃĬ +R acket +R CKB +R SDA +R DRV +R UNTIMES +R èg +R AGWEED +S ti +S as +S ds +S ap +S ang +S fo +S print +S ise +S iti +S df +S ant +S word +S his +S io +S OT +S Ac +S PT +S of +S inal +S ally +S ug +S entry +S ched +S PP +S pr +S OP +S pu +S ven +S Py +S INE +S ons +S RL +S ão +S cm +S alle +S mk +S URE +S MIN +S ni +S FLAGS +S WE +S QP +S quad +S iou +S trainer +S xp +S ICK +S XR +S rV +S dZ +S dJ +S jU +S assandra +S amut +S ugar +S eward +S ersic +S FTP +S leepy +S porter +S ABIL +S ystematic +S ENSITIVE +S istema +S ptSwitchoverInterval +S pencer +S PORTAGE +S alidas +S ottesa +T ce +T ed +T ata +T is +T ub +T ib +T SE +T ST +T error +T ay +T own +T ron +T ale +T CO +T ern +T pl +T Test +T HO +T CON +T sv +T MA +T Frame +T td +T ik +T MO +T ia +T AA +T CK +T sing +T CD +T Spec +T DF +T GE +T SO +T Button +T axes +T ads +T ru +T rf +T DA +T FE +T HEAD +T weep +T LP +T ony +T vor +T MR +T Li +T qV +T VA +T aco +T pw +T anim +T BT +T WF +T uy +T ornado +T atlas +T UAL +T qc +T UY +T odd +T aste +T yc +T IPS +T BODY +T SSS +T mV +T urk +T aL +T INK +T ako +T ambi +T ears +T reas +T DOS +T ahsin +T ColumnType +T urkish +T oggles +T ideGauge +T ASMOTA +T éléphone +U at +U ol +U pp +U ta +U ER +U py +U ls +U ph +U UT +U rc +U so +U LO +U Se +U names +U top +U ym +U EM +U Ad +U mm +U tc +U FR +U zy +U cb +U OM +U ah +U mn +U sb +U OD +U qV +U hg +U jY +U AGC +U qp +U yi +U psilon +U IMe +U ntrack +U AgEAg +U trecht +V on +V at +V ut +V ad +V di +V im +V ys +V oc +V IT +V ast +V AS +V AG +V ale +V List +V Me +V ern +V off +V ous +V ice +V FT +V ym +V mc +V TE +V era +V é +V ML +V NO +V gt +V We +V rl +V On +V tc +V Is +V mu +V NC +V SA +V Sa +V DD +V cn +V Sw +V VS +V RC +V ae +V sb +V hd +V QK +V TX +V dj +V Fo +V inh +V yu +V JJ +V BG +V WW +V RW +V kZ +V nic +V UZ +V HOSTS +V gk +V RZ +V jE +V CCS +V arnam +V dXV +V egas +V istrails +V erts +V FFSL +V RADH +V agrantfile +W fi +W ad +W ch +W ol +W es +W et +W ab +W age +W XX +W ec +W start +W his +W Ac +W tf +W US +W err +W MA +W OL +W enu +W lr +W bx +W IR +W AV +W TC +W RU +W orth +W att +W GA +W uv +W LY +W vp +W PARAM +W AE +W LR +W MR +W LB +W UV +W vn +W QS +W erk +W lU +W Mass +W enn +W zW +W xW +W onder +W ILL +W fT +W Bg +W XS +W Ji +W BQ +W xv +W ulff +W nE +W YG +W IDGET +W unsch +W anderer +W igner +W inkler +W AVEL +W ALIKI +X in +X val +X list +X xe +X ls +X LO +X ql +X cy +X DI +X TR +X off +X CL +X vo +X Key +X fy +X PL +X fc +X Is +X vs +X FR +X An +X IZ +X Sw +X MODEL +X CP +X BI +X ye +X nz +X AU +X LF +X UV +X HC +X gd +X fv +X Dim +X zs +X OVER +X Vq +X NZ +X Angle +X bj +X rw +X lU +X Kh +X Dg +X Canvas +X xxxxxxxx +X Pz +X Bx +X ANIM +X dmf +X SLT +X Beach +X ChaCha +X CHACHA +Y ar +Y um +Y ul +Y val +Y name +Y as +Y ap +Y AR +Y ag +Y LE +Y ay +Y ml +Y ale +Y SI +Y LI +Y AY +Y FP +Y MS +Y FR +Y DD +Y lm +Y bf +Y LU +Y DQ +Y LP +Y DC +Y Dim +Y OG +Y NF +Y DL +Y jY +Y Angle +Y Tab +Y Ui +Y Canvas +Y vF +Y NW +Y uan +Y iy +Y UF +Y jU +Y jq +Y Hh +Y bD +Y Ig +Y Rr +Y esterday +Y LBZ +Y ELP +Y mZl +Z ar +Z al +Z de +Z ad +Z id +Z el +Z is +Z pp +Z ob +Z AN +Z ION +Z av +Z ING +Z ef +Z so +Z FI +Z mean +Z MP +Z FT +Z af +Z oo +Z SV +Z GL +Z hi +Z DQ +Z YY +Z hang +Z SK +Z tm +Z Kp +Z WF +Z KZ +Z RX +Z erg +Z TG +Z Fe +Z MG +Z Canvas +Z TU +Z Hh +Z Mm +Z Hx +Z Xl +Z Fq +Z qv +Z mdn +Z unan +Z anzibar +Z hitang +Z amboanga +[ %( +[ {" +[ >\ +[ ,\ +[ @\ +[ %\ +[ .*\ +\ & +\ * +\ + +\ .. +\ ']) +\ ;\ +\ /\ +\ -= +\ '.' +\ ;", +\ /(\ +\ *.* +\ ')' +] ([ +] *- +] (\ +] (_ +] ^\ +] `\ +] @\ +] &\ +] }/ +] <\ +] ~\ +] '])) +] >" +] =[] +] ^{ +] **( +] ``, +] $') +] ','[ +^ ! +^ ? +^ ') +^ (* +^ )\ +^ ,\ +^ $\ +^ +\ +^ ~\ +^ *) +^ *, +^ *: +^ *_ +^ +, +_ ! +_ "] +_ (): +_ }) +_ )] +_ ={ +_ :\ +_ $\ +_ [\ +_ )- +_ )( +_ #\ +_ }} +_ ]+) +_ [:]) +_ \\/\\\\\\ +_ ^[\\ +` ? +` (\ +` >\ +` |\ +` ,\ +` ^\ +` ?\ +` !\ +` @\ +` -------' +a ing +a un +a up +a am +a ob +a xa +a ib +a Name +a word +a idx +a amp +a Sg +a Config +a TT +a folder +a dev +a PR +a DS +a Values +a TC +a VS +a RS +a LV +a det +a Space +a OO +a ZZ +a QQ +a Timer +a Sq +a Vq +a XR +a KH +a ubar +a PrivateKey +a TQ +a proxies +a ereo +a DQa +a SWO +a stratto +a Impar +a parafita +b li +b ion +b type +b ER +b ap +b ci +b ray +b EN +b ho +b sa +b ull +b do +b rc +b ait +b ich +b ql +b ong +b cy +b igh +b ors +b graph +b total +b logger +b ik +b height +b clean +b script +b VE +b dm +b zip +b hx +b ws +b GG +b pa +b WN +b tech +b Br +b fd +b Sk +b cn +b ellow +b ced +b EY +b Fi +b Helper +b ki +b WF +b FB +b 好 +b Rq +b hk +b asso +b elle +b elli +b elly +b ivariate +b Yi +b imento +b iao +b linn +b ranco +b ryan +b DataStore +b beb +b undler +b enoit +b ameda +b heptomino +b ignside +c put +c ic +c ist +c file +c ang +c num +c ape +c min +c ute +c ations +c ated +c string +c env +c Co +c go +c norm +c PO +c csv +c length +c gen +c filter +c graph +c use +c mode +c send +c PL +c rap +c ML +c UD +c CI +c Norm +c rb +c Do +c bn +c mesh +c ites +c repr +c LD +c za +c ini +c anner +c illa +c UG +c DQ +c partition +c asset +c FQ +c ando +c QK +c plane +c anning +c wg +c wG +c Nv +c ils +c uno +c QT +c appy +c és +c gbf +c ctbx +c avo +c IVs +c ules +c enso +c errar +c utive +c dmf +c reprs +c frags +c approps +c itações +c actus +c riteo +c invfft +d data +d ith +d args +d mo +d ph +d ho +d print +d ne +d enti +d base +d np +d ress +d split +d word +d his +d md +d PT +d ql +d yp +d cp +d tx +d rand +d tick +d dev +d Le +d lim +d ank +d pu +d words +d mc +d DS +d Or +d uler +d Is +d addr +d oman +d gamma +d ı +d typ +d PC +d Target +d OM +d ino +d Sw +d gi +d ina +d PA +d ú +d met +d ora +d interp +d Flag +d mel +d Wq +d Qq +d ito +d KB +d KJ +d ż +d Cl +d JS +d Rq +d Lp +d amd +d rought +d PTw +d ritto +d BFS +d parray +d Remap +d enames +d orsal +d ionysus +d loge +d PPYba +e me +e get +e up +e par +e od +e list +e value +e ine +e if +e ew +e ys +e com +e ft +e ST +e ust +e ix +e color +e values +e PT +e ties +e PE +e use +e PI +e ze +e TO +e verse +e Th +e lish +e gor +e ux +e ida +e loop +e Min +e Server +e abc +e ula +e PY +e bins +e LU +e lider +e PA +e Mesh +e ante +e LF +e VA +e hh +e Hg +e ssid +e TM +e Pn +e Dx +e Xr +e XA +e labor +e lizabeth +e Kq +e vasion +e stratto +e quirect +e DRq +f ti +f ss +f ing +f ata +f up +f args +f ob +f xa +f model +f In +f ity +f ry +f start +f lock +f ave +f Po +f uc +f be +f ud +f stat +f nn +f ey +f pl +f kwargs +f bg +f cp +f cat +f nal +f PI +f TT +f reen +f Out +f queue +f service +f prefix +f DB +f header +f handler +f any +f br +f vec +f cos +f Ro +f writer +f PS +f addr +f abc +f Op +f oto +f PY +f shift +f band +f Pi +f LS +f asci +f uv +f ellow +f BY +f MY +f methods +f Debug +f GP +f mpy +f Ti +f Na +f Hw +f ledge +f eder +f owl +f also +f YN +f omit +f ountain +f Bw +f ugue +f ATI +f bbb +f uels +f hog +f alli +f erie +f ritto +f LIZ +f lierprops +f svh +f änger +f linch +g he +g ut +g ion +g one +g ub +g ms +g user +g oc +g ax +g ave +g av +g ale +g api +g ng +g table +g ks +g fg +g MP +g ical +g rect +g td +g bl +g conf +g ater +g EM +g alle +g mag +g pd +g iler +g fd +g wb +g Network +g Panel +g vp +g II +g lider +g Header +g ivers +g HA +g lio +g Cells +g spread +g LEVEL +g ica +g irl +g ö +g chr +g Wi +g utter +g rown +g QA +g QQ +g kn +g La +g qn +g kc +g RPC +g acs +g qi +g Best +g QB +g ð +g iga +g imento +g Yw +g ulp +g lavniMenu +g utenberg +g ðu +g azetteer +g ERER +g SpecificObjects +g debi +g itee +g untas +h ro +h ers +h ase +h ds +h ange +h text +h ho +h ight +h ll +h lin +h nd +h arch +h ark +h man +h api +h IM +h io +h ild +h ran +h not +h ca +h ik +h ake +h sw +h ia +h AA +h aml +h uff +h ão +h ado +h cap +h SV +h UE +h ratio +h ja +h bins +h UI +h cn +h arp +h amb +h refs +h NV +h anning +h mong +h kU +h enn +h MQ +h adas +h YW +h captcha +h Cam +h Oc +h unter +h BBC +h anief +h metis +h YXm +i ator +i output +i pos +i color +i filter +i US +i FA +i wo +i era +i ero +i arr +i bution +i hex +i ha +i BO +i GE +i GT +i apps +i CV +i GA +i robot +i Cell +i Scale +i Factor +i HA +i ya +i HH +i qn +i Cloud +i Hw +i Username +i auli +i pes +i Mj +i Music +i Eo +i endo +i Sz +i UQ +i RN +i Hf +i yyyy +i Yk +i otools +i Shares +i USC +i RMn +i TestType +i GRS +i DRAC +i StockCode +i GEEEI +i CIAiC +j he +j self +j la +j us +j sc +j der +j bo +j cs +j iv +j List +j ef +j uc +j gen +j sg +j raph +j ake +j sw +j Of +j cm +j Query +j GN +j MB +j kw +j orth +j FE +j eno +j pm +j bd +j lc +j yy +j HA +j BY +j EY +j ki +j umb +j vr +j ena +j bm +j QA +j hu +j kn +j bud +j erk +j JZ +j qi +j Rs +j Zs +j Aw +j edi +j Fq +j ø +j Vr +j DH +j esse +j chap +j ÅĽÄĩ +j uniper +j Fov +j weD +j smith +j ensen +j Å¡ÃŃ +j fkmerfile +j ixiang +j icha +j foaiwej +k mp +k ver +k ke +k ta +k lt +k point +k ses +k no +k ww +k rc +k RI +k mean +k mask +k link +k fy +k Object +k pts +k rat +k vars +k á +k NN +k Mo +k An +k va +k Conv +k pd +k boot +k SN +k mol +k yl +k Any +k rp +k ko +k Fi +k hr +k Api +k ham +k Product +k Handle +k rn +k BT +k Bridge +k ido +k Skip +k mini +k uberne +k Ts +k Ik +k elly +k RH +k cvl +k azoo +k nock +k ostan +k sher +k ludge +k annada +k tral +k alturi +k ARRCCCGEcDCS +l ur +l pe +l ata +l to +l ub +l key +l lu +l bu +l ard +l dd +l index +l ere +l update +l AC +l AB +l space +l nn +l cc +l core +l width +l du +l xy +l unk +l Count +l On +l LC +l convert +l cb +l Go +l release +l CV +l bbox +l Conf +l ceil +l MY +l methods +l QK +l lare +l Wq +l wx +l wp +l è +l EI +l umin +l ala +l ento +l ZG +l Gal +l ø +l TransferFunction +l ithium +l uminance +l LengthTransferFunction +l gili +l nrho +l legada +l urkers +l ähteet +l cnN +m ti +m str +m xd +m ans +m len +m ll +m jo +m do +m old +m ates +m table +m types +m tag +m cat +m ca +m ful +m ness +m seg +m TP +m hs +m Version +m jpg +m rf +m LD +m delay +m unic +m ä +m rv +m EV +m Vy +m XV +m Sy +m KC +m Fs +m Ew +m rcnn +m others +m trs +m jb +m COUNTER +m ctf +m grav +m arian +m allows +m Rl +m lsl +m flx +m umps +m macosx +m Ã¥l +m mcif +n un +n ad +n int +n ol +n get +n ve +n ab +n for +n vi +n pro +n ack +n num +n right +n base +n ay +n input +n np +n db +n fa +n try +n List +n object +n io +n auth +n Po +n Se +n img +n ud +n ref +n rt +n oth +n field +n results +n wo +n mem +n String +n ores +n User +n ian +n header +n example +n API +n By +n body +n Py +n cel +n vm +n lr +n Token +n cm +n We +n Load +n filt +n sec +n js +n Jo +n Min +n Graph +n MT +n CM +n SET +n cells +n 个 +n rec +n Grid +n hello +n found +n ada +n Iter +n digits +n Delete +n mn +n Real +n Nodes +n Sequence +n har +n ä +n tau +n failed +n Usage +n Segment +n Build +n MI +n iters +n lam +n chunks +n cha +n vn +n Epoch +n ita +n Sq +n phot +n todo +n Si +n Second +n expires +n Testing +n Answer +n Username +n uts +n Writing +n Updated +n PROCESSING +n Jy +n sta +n Layers +n YW +n Obs +n Good +n Evaluation +n KV +n Song +n nose +n Foo +n Ix +n Bond +n Qz +n å¼Ģå§ĭ +n Inference +n Valor +n photons +n Would +n Correct +n Actual +n opython +n Neighbour +n iffer +n senter +n Performing +n PRECAUTIONARY +n æĤ¨ +n iente +n byz +n acional +n Goodbye +n Reps +n kUql +n inth +n pythonpath +n CDCInstances +n mea +n uplan +n 请填åĨĻ +n Rounding +n jev +n ä¹ĭåIJİä¼ļ +o fi +o ad +o co +o os +o LL +o shape +o yn +o io +o vis +o filename +o files +o ost +o Model +o Exception +o Create +o scal +o ven +o ged +o uble +o lid +o aur +o lio +o xes +o AAAA +o VA +o ito +o Vq +o virt +o Hg +o aW +o Yb +o authtoken +o InstrTest +o NBo +o Mapa +o hlcv +o Encoders +p I +p he +p ss +p ms +p ll +p ax +p mat +p rit +p ns +p ler +p ols +p olu +p ran +p ont +p amp +p annel +p names +p vert +p keys +p fg +p mode +p lim +p static +p é +p counts +p stats +p All +p dr +p vol +p testing +p ork +p coords +p BR +p ssl +p acing +p UC +p aging +p Job +p tau +p FQ +p ips +p ora +p once +p FileName +p Wq +p fj +p Flags +p IJ +p Rec +p MZ +p Allow +p Async +p Ly +p Obs +p latency +p Predicate +p ZN +p DataSize +p agen +p Entrypoint +p illage +p apa +p ër +p uml +p DepthStencilView +p awsc +p ablo +p DirtyRects +p SourceName +p rairie +p aijb +p aginas +p npoly +q ar +q al +q lo +q un +q val +q sp +q file +q out +q tp +q max +q string +q ww +q amp +q ng +q types +q pl +q mark +q tag +q eta +q conv +q cv +q ian +q dot +q steps +q VE +q ha +q bx +q dr +q tn +q bins +q dk +q dq +q eth +q DT +q variant +q MR +q rnn +q NV +q hp +q dg +q hl +q fD +q Xy +q BH +q OJ +q vF +q NY +q closure +q Em +q FU +q DV +q dJ +q Zo +q Ty +q clust +q chrm +q NVq +q akp +q IIY +q Coupling +q CIAi +q bertlayer +q aijb +r me +r ce +r ata +r ma +r der +r ine +r time +r test +r size +r mb +r its +r List +r Id +r ref +r space +r function +r gen +r vo +r std +r Get +r xy +r xx +r ero +r sm +r bit +r nb +r paths +r profile +r USER +r zz +r NB +r bins +r DD +r AK +r HA +r ceil +r HI +r Processing +r nf +r wm +r getattr +r pow +r Percent +r nv +r dfs +r NZ +r Hw +r aro +r IX +r CW +r setattr +r EPOCH +r Fg +r RNA +r inge +r mpc +r LZ +r freqs +r NX +r protect +r Episode +r Rp +r Slow +r chrm +r tril +r mats +r neff +s ri +s ata +s ation +s ve +s vi +s ls +s ber +s ly +s len +s bo +s ger +s ind +s ft +s info +s no +s do +s md +s new +s mail +s my +s models +s ref +s nn +s fg +s bl +s send +s unk +s mc +s year +s urls +s les +s ram +s vec +s long +s lon +s bits +s ider +s fun +s bbox +s amb +s Url +s Space +s lam +s TX +s Fo +s Filename +s mel +s DEVICE +s rem +s ami +s naps +s odo +s lee +s Lookup +s Username +s Fs +s Vg +s ott +s Nh +s Mp +s ì +s mdl +s lits +s fog +s GHz +s ÉĻr +s OutputFile +s modelfile +s istema +s ichkar +s orgente +s alida +s ueldo +s ustain +t li +t la +t ata +t val +t ation +t form +t nt +t text +t model +t cur +t da +t join +t net +t ww +t ols +t File +t rop +t nx +t ins +t Model +t game +t Node +t conv +t reshold +t Of +t GH +t Int +t reed +t timestamp +t MC +t Count +t cd +t Min +t CS +t Go +t chat +t RU +t AI +t Expression +t Topic +t VALUE +t Score +t Seq +t GP +t IJ +t Ra +t Missing +t Your +t Accuracy +t inder +t Username +t XV +t gender +t TV +t RNA +t Xr +t closure +t Lp +t Am +t enth +t Ws +t Wind +t GEO +t Ii +t LX +t XH +t IOError +t Rebate +t cfl +t Institution +t enames +t ussen +t versky +t KlS +t YXRwbG +t AGw +t tacker +u ut +u ers +u ow +u ap +u ob +u lic +u che +u ft +u ari +u db +u json +u io +u OT +u var +u Ar +u kwargs +u char +u Th +u By +u ves +u alization +u oo +u ws +u fr +u Msg +u ka +u ao +u flux +u Sign +u fb +u ffici +u Wq +u Flags +u Sensor +u wa +u Wave +u Eg +u Kx +u Lu +u Rn +u Ew +u Dh +u Ii +u Dp +u Rz +u oms +u Tl +u csf +u RSqU +u Porta +v re +v ct +v pp +v om +v ase +v py +v info +v count +v ast +v ak +v rep +v ron +v List +v LO +v table +v files +v pk +v cu +v red +v Max +v Vi +v Up +v rat +v zero +v NA +v inf +v End +v fr +v oto +v dl +v OM +v JSON +v oring +v amb +v dn +v hosts +v inc +v ables +v uz +v guess +v ica +v kk +v Hz +v ZZ +v CPU +v GP +v ita +v VV +v Sn +v Pn +v Dw +v Ul +v Nh +v KU +v Wk +v Yx +v ÄĹ +v nnn +v poser +v helio +v rij +v illä +w us +w ab +w am +w path +w ex +w ob +w size +w AR +w class +w ari +w pi +w np +w ast +w Ac +w cu +w pc +w fn +w OP +w oken +w ily +w br +w card +w mm +w tc +w Version +w ells +w gu +w kp +w uv +w AX +w yy +w LU +w mq +w WA +w avel +w ky +w vr +w fm +w lg +w tracker +w fv +w WK +w WW +w asn +w pars +w Vy +w QCA +w RB +w ounded +w zu +w ott +w omen +w Fq +w ahl +w RAA +w isp +w GAw +w ibble +w WAw +w obble +w assr +w inkler +w YMH +w ombat +w elfare +x li +x int +x us +x pt +x args +x xd +x ys +x text +x map +x sum +x mail +x space +x labels +x De +x vid +x dep +x copy +x Dict +x pb +x acc +x ian +x pu +x admin +x has +x headers +x section +x Start +x ways +x coords +x Block +x rd +x gi +x tics +x sect +x uz +x nor +x vd +x Mean +x lam +x spacing +x mr +x ito +x WF +x gettext +x wheel +x titles +x samp +x ctypes +x HZ +x Uniform +x Pz +x Lt +x Inc +x stype +x others +x KF +x jH +x OQ +x Conformance +x KIT +x Objs +x gfH +x cham +x imagesize +x iong +x NPIntervalli +x ButtonScroller +x ixi +y ge +y fi +y ad +y ol +y turn +y ath +y ab +y tr +y lab +y ds +y OR +y array +y og +y ay +y ann +y Data +y do +y List +y box +y Value +y space +y ash +y The +y cl +y bounds +y umi +y fp +y gt +y Start +y ane +y As +y ao +y WR +y iff +y tau +y Offset +y ko +y MY +y spacing +y anchor +y centers +y Edge +y MJ +y YS +y titles +y scroll +y wW +y xz +y IDAT +y ums +y hU +y Zy +y KIT +y odl +y Ofz +y timg +y ZMn +y chel +y acht +y ButtonScroller +y ushu +z lo +z un +z as +z up +z end +z am +z sh +z ls +z ho +z ax +z ou +z shape +z yn +z net +z title +z range +z ai +z cat +z ten +z bar +z xx +z cf +z zy +z MT +z Go +z ah +z nc +z BE +z ini +z EY +z WA +z sz +z PM +z GY +z JZ +z Rq +z KW +z Pz +z dZ +z wal +z Nm +z beg +z Jk +z uma +z Lg +z Lj +z burg +z igbee +z ambi +z aki +z droje +z otero +z ám +{ $ +{ , +{ ; +{ < +{ | +{ __ +{ (\ +{ $\ +{ =\ +{ ^\ +{ /\ +{ @\ +{ -\ +{ âĢĻ +{ @{} +{ :-< +| ; +| ? +| -------------------------------- +| (\ +| ?\ +| _\ +| *\ +| {}'. +| >" +| ------ +| +| +| ----| +| ::.. +} ([ +} =[ +} ]] +} (- +} "): +} {" +} >\ +} '{ +} }') +} :", +} $\ +} <\ +} }: +} #\ +} ï¼ļ +} !') +} ``. +} âĢĻ +} +". +} """. +} ]+" +} ):\ +} ::{ +} (_[ +} âĶĥ +} *.{ +~ % +~ ( +~ ) +~ + +~ - +~ ^ +~ _ +~ | +~ ") +~ .\ +~ >\ +~ =\ +~ ^\ +~ [\ +~ +\ +~ :::::::: +¡ åĪ° +¢ áĥ£áĥł +¤ ľ +¥ ï¼ +¥ íĽĦ +¦ १ +¦ °íĬ¸ +¨ èĥ +¨ ३ +© æ¯Ķäºļ +« æŃ£ +« ร +« âĪ« +¬ ॠ+® ॠ+® ت +® âĪ +¯ '), +¯ 示 +¯ æĴ +¯ ska +¯ çĭ +¯ æ´¾ +° ãĤĬ +° åĩı +± åĬ¨ +± éłħ缮 +² Ħ +² æŁĵ +³ IJ +³ è²» +´ ' +´ ij +´ å±ķ +´ æ¢ģ +´ ì¹´ìĺ¤ +µ ľ +¶ ´ +¶ Į +¶ çĽĺ +· ¨ +· è´Ŀ +¸ ä¾ +¸ íĬ¸ +º ¼ +º IJ +» æĢ» +½ ľ +½ æľī +½ åħ¥ +½ çĦ¶ +¾ 讯 +¾ 伯 +¿ Ħ +¿ '), + �� +à ¿ +à Ĩ +Ä ¾ +Ä ĭ +Å ³ +É ¡ +É Ĵ +Ê » +Ê Į +Ì ģ +Î ¤ +Î ¥ +Î Ĩ +Î Ĵ +Î Ľ +Î ľ +Ï µ +Ð © +Ð ® +Õ ³ +Õ ¿ +Ö ¸ +Ö ¹ +Ö ¼ +Ö ģ +Ö ¿'), +Ø ¡ +Ú ij +Û ĩ +â ½ +â İ +ã Ĵ +ä ³ +ä ķ +ä ĺ +å © +å ª +å ¬ +å ¶ +æ ª +ç £ +è Ķ +è ķ +è Ŀ +è ¤ĩ +é µ +é · +é ¹ +é ī´ +é ¬¼ +é ¶´ +ê ¶Į +ë ĸ +ë ĨĴ +ë ¬¼ +ë ¸Į +ë ŃIJ +ë ¯Ģë¡ľ +ë Ŀ½ +ë ¹Į +ì ģ +í ĮĢ +ĉ ĊĠĠĠĠĠĠĠĠĠĠĠ +ĉ ĊĊĠĠĠ +ĉ čĊč +ĉ čĊĉĉ +ĉ čĊĉĉĉĉĉĉĉ +ĉ ĠčĊĉĉĉ +ĉ ĊĊĊĉĉ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ċ ³³ +č ĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +č čĊĠč +Ġ Í +Ġ 923 +Ġ âĸĪ +Ġ ĊĊĉĉ +Ġ mpt +Ġ âĶĮâĶĮ +Ġ ~\ +Ġ 948 +Ġ 0000000 +Ġ ĊĉĊ +Ġ čĊĠĠĠĠčĊĠĠĠ +Ġ ura +Ġ äºĨ +Ġ ç½® +Ġ 大 +Ġ ĊĊĊĊĊĊĊĊ +Ġ čĊčĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ è¯ģ +Ġ ðŁ¤ +Ġ çĤ¹ +Ġ ел +Ġ Ùĩ +Ġ ĊĊĊĉ +Ġ ä¿¡æģ¯ +Ġ ãĤ¹ +Ġ è¿Ķ +Ġ åľ° +Ġ åIJĪ +Ġ čĊĉĉčĊĉ +Ġ éĥ½ +Ġ åĮħ +Ġ ак +Ġ åĩ½æķ° +Ġ ãĤ¿ +Ġ ÑĢÑĥ +Ġ æĪĸ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ å¾Į +Ġ 缴 +Ġ åħ¶ +Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ Ïģ +Ġ ç»ĵæŀľ +Ġ Ċĉĉĉĉĉĉĉĉ +Ġ å½¢ +Ġ ä¸İ +Ġ ~~~~~~ +Ġ åı³ +Ġ த +Ġ 对象 +Ġ åĽ½ +Ġ åĽ¾çīĩ +Ġ 对åºĶ +Ġ 代çłģ +Ġ 失败 +Ġ åĪĨç±» +Ġ ç²ĴåŃIJ +Ġ ĊĊĉĉĉĉĉ +Ġ ç³»ç»Ł +Ġ æķ°åŃĹ +Ġ åıĸå¾Ĺ +Ġ éĿŀ +Ġ å®ĮæĪIJ +Ġ çīĪæľ¬ +Ġ éŁ³ +Ġ ĊĠĠĊĠĠĠ +Ġ à®® +Ġ çĶ± +Ġ éĤ®ä»¶ +Ġ ÃŃn +Ġ ä¸Ģ次 +Ġ 000000000000000000000000 +Ġ è¿IJè¡Į +Ġ ãĥij +Ġ å°±æĺ¯ +Ġ ä½ľèĢħ +Ġ éĩįå¤į +Ġ 缮æłĩ +Ġ ä¼łåħ¥ +Ġ 磩éĺµ +Ġ åĮ¹éħį +Ġ åŃĹåħ¸ +Ġ ä½ľä¸º +Ġ 代表 +Ġ ä½İ +Ġ čĊĉĉĉĉĠĠ +Ġ âĸijâĸijâĸijâĸijâĸij +Ġ æĺł +Ġ ############################################################## +Ġ 9999999999999999 +Ġ å®Łè¡Į +Ġ åĩ¦çIJĨ +Ġ 表åįķ +Ġ É£ +Ġ âĸĪâĸĪâķĶâķIJâķIJâķIJâķIJâķĿ +Ġ ãĢĮ +Ġ çŃĸçķ¥ +Ġ 帮åĬ© +Ġ ~~~~~~~~~~~~~~~ +Ġ åīĬéĻ¤ +Ġ åħ³æ³¨ +Ġ å®ĺæĸ¹ +Ġ ä¿Ŀè¯ģ +Ġ 绣ä¸Ģ +Ġ 大åįķåĩĢæµģåħ¥ +Ġ åİ»æİī +Ġ ãģĿãĤĮ +Ġ âķļâķIJâķIJâķIJâķIJâķIJâķĿ +Ġ ÚĪ +Ġ être +Ġ ðŁ¤Ķ +Ġ åħ³èģĶ +Ġ çĻ»å½ķ失败 +Ġ ä¼ĬæľĹ +Ġ ä¼Ĭæĭīåħĭ +Ġ éĺ¿å°ĶåıĬåĪ©äºļ +Ġ å°¼æĹ¥åĪ©äºļ +Ġ åĬłèĵ¬ +Ġ å®īåĵ¥æĭī +Ġ éĺ¿èģĶéħĭ +Ġ ãĥīãĤŃãĥ¥ãĥ¡ãĥ³ãĥĪ +Ġ ç§ijå¨ģçī¹ +Ġ å§ĶåĨħçijŀæĭī +Ġ å°½ +Ġ änder +Ġ ç¬ĶçĶ» +Ġ å¤īæķ° +Ġ 继æī¿ +Ġ åģĩ设 +Ġ å¯Ĩ度 +Ġ çĽijåIJ¬ +Ġ éĶģå®ļ +Ġ ãĤ¤ãĥ³ãĤ¹ãĤ¿ãĥ³ãĤ¹ +Ġ çĬ¶æħĭ +Ġ åİĦçĵľå¤ļå°Ķ +Ġ ç»ĵåIJĪ +Ġ æĪªå±ı +Ġ éłģéĿ¢ +Ġ uterms +Ġ 饱åĴĮ +Ġ å°ıäºİéĺĪåĢ¼çļĦå¤ĩéĢīåij¨æľŁ +Ġ ä¿ĤãĤĬ +Ģ ìĿĺ +Ģ íĭ° +ģ å¹³ +Ĥ ´ +Ĥ ĺ +Ĥ 缴 +Ĥ åĸ® +Ĥ à¸Ľà¸£à¸Ķà¸ģรà¸Ń +ĥ Ħ +ĥ è¿ŀæİ¥ +Ħ · +Ħ ", +Ħ ìĦ± +Ħ 产 +Ħ íĮħ +Ħ íĬ¼ +ħ ", +ħ '), +Ĩ ι +ĩ Ħ +ĩ ëĭ¤ +ĩ æ¥Ĭæĺ¥ +ĩ æ¢Ŀ +Ī ¬ +ī æĺİ +ĭ ä¸ĭ +Į '), +Į ìĪĺê°Ģ +į '), +į ëĭĪëĭ¤ +į åĭ +į 夫 +İ '), +ı ķ +ı '), +ı çļĦ +ı è¦ +ı èĭ +IJ ', +IJ è¨Ń +ij ', +Ĵ '), +Ĵ த +Ĵ åħī +ĵ ´ +ĵ æ±Ł +ĵ ìĿ´ëĬĶ +ĵ DÅģ +ĸ åĪ©çİĩ +Ĺ ', +ĺ ', +ĺ ìĿĮ +ĺ íĶĮ +Ļ ãĥ³ +Ļ áĥĺáĥ +ļ Ĥ +ļ æĦı +Ľ ׾ +Ľ èĮ¶ +ľ ¨ +ľ » +ľ çİĩ +ľ 구 +ľ ãģijãĤĭ +Ŀ æľŁ +Ŀ ìĭ¤ +Ŀ æĴŀ +Ł Ń +ł ¨ +ł 人 +ł åĮĸ +ł ãĤĮ +ł ×ĺ +Ń à¥ +Ń Ïģγα +ĠĠ ĉĉ +ĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠ čĊĠĠĠĠčĊĠĠĠ +ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠ čĊ +ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ +ĠĠĠ�� čĊčĊĠĠĠ +ĠĠĠĠ ĊĊĊ +ĠĠĠ ĊĠĠĠĠĠ +ĠĠĠ Ċĉ +ĠĠĠ Ċĉĉĉ +ĠĠĠ ĊĠĠĠĠĊĠĠĠ +ĠĠĠ ĊĠĠ +ĠĠĠ čĊĠĠĠĠčĊĠĠĠ +ĠĠĠĠĠĠĠĠ ĊĊ +ĠĠĠĠĠĠĠĠ ĠĊĠĠĠ +ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠč +in B +in K +in q +in u +in name +in ver +in pt +in col +in process +in ale +in act +in core +in vid +in dep +in fs +in Size +in til +in je +in validation +in ish +in ascii +in activity +in structor +in Folder +in separ +in corre +in tid +in Progress +in forma +in paint +in forme +in nov +in organic +in quirer +in creases +in straddr +in cumbent +in quin +in cluso +in utile +in VoiceSeekbar +in stersect +in connu +in cumb +er er +er or +er re +er ter +er ec +er ast +er lock +er ai +er ating +er flag +er den +er Shape +er itud +or q +or r +or ra +or ad +or el +or am +or ment +or ans +or url +or sed +or ock +or create +or so +or ized +or je +or ales +or mous +or angered +on h +on k +on n +on ge +on ate +on is +on als +on ze +on linear +on Action +on Req +on Expand +on lined +on shire +on Collapse +on iyon +on juist +on ScreenCoordinates +at A +at Q +at ct +at ata +at up +at our +at py +at che +at tain +at ong +at yp +at EX +at ik +at ization +at rs +at tc +at ools +at ov +at rust +at tia +at travers +at ului +at mlst +at mfFuniMIB +at erede +re ur +re def +re par +re ser +re com +re config +re pi +re bot +re cl +re vid +re ten +re queue +re ASE +re med +re verb +re sets +re cision +re chunk +re orth +re cov +re Match +re built +re definition +re mediate +re launch +re distribute +re ordered +re started +re indexed +re birth +re CAPTCHA +re seller +re pyd +re searches +re alsense +re infections +re cycling +re venus +re presenter +re producible +re entrant +re linquishment +ĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +se j +se k +se es +se if +se ep +se ag +se net +se man +se pol +se Info +se tex +se gy +se eed +se mel +se lects +se mana +se pia +se gbits +se znam +se ppia +ĊĠĠĠ ĊĠ +ĊĠĠĠ ĊĠĠĠĠĠ +Ġ= ) +Ġ= ') +Ġ= ======== +Ġ= {" +Ġ= +" +Ġ= >', +Ġ= [[ +Ġ= (""" +Ġ= "/ +Ġ= /= +Ġ= -, +st de +st ion +st ow +st ang +st are +st do +st cp +st wo +st words +st adir +st aking +st devs +st Management +st abili +st infection +st agn +st retto +st infections +st terror +st libpath +en X +en Z +en b +en one +en ab +en ex +en dex +en ber +en ho +en ron +en stra +en Value +en ning +en gg +en ko +en han +en contra +en abling +en rolled +en usa +en countered +ĊĠĠĠĠĠĠĠĠ ĉĉ +ĊĠĠĠĠĠĠĠĠ ĊĠ +ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊ +Ġt D +Ġt fi +Ġt ad +Ġt int +Ġt ch +Ġt res +Ġt ect +Ġt key +Ġt ore +Ġt py +Ġt ense +Ġt ire +Ġt error +Ġt base +Ġt ive +Ġt fa +Ġt box +Ġt batch +Ġt arent +Ġt table +Ġt types +Ġt ai +Ġt results +Ġt angle +Ġt expr +Ġt ym +Ġt ends +Ġt cls +Ġt ummy +Ġt vs +Ġt ii +Ġt shift +Ġt aker +Ġt enable +Ġt otor +Ġt uv +Ġt bd +Ġt deps +Ġt ali +Ġt aper +Ġt ÉĻ +Ġt pot +Ġt axs +Ġt ulo +Ġt allest +Ġt onic +Ġt â +Ġt colname +Ġt ddft +Ġt rello +Ġt utar +Ġt Graphs +Ġt filli +Ġt mtc +Ġt urkish +Ġt weeprints +Ġt versky +Ġt attoo +Ġt Admix +Ġt ürkçe +ar F +ar Z +ar at +ar ct +ar un +ar ite +ar test +ar son +ar be +ar ants +ar bit +ar ı +ar ZZ +ar YZ +ar ametric +ar inda +ar mato +ar lington +ar Rol +ar agua +al Q +al S +al en +al ar +al ed +al ot +al us +al im +al are +al ay +al lower +al ba +al URL +al rm +al istic +al trim +al emi +al phan +al aya +al Systems +al armed +al quanto +al ongside +al legato +al chemist +al mighty +de F +de q +de on +de en +de it +de pp +de put +de ser +de len +de lu +de cs +de db +de cal +de las +de lection +de ks +de ld +de delta +de term +de signed +de mid +de buff +de compression +de allocate +de veloped +de lou +de zza +de posite +de protonated +de oU +de launay +de lps +de CONZ +de serialise +de odor +de linqu +de lpfp +de activeUser +de biasing +le u +le mp +le to +le ys +le aut +le HA +le ido +le wis +le isen +le dby +le maitre +le karz +an ot +an es +an vi +an bo +an tp +an arch +an Ac +an ca +an ao +an scription +an adu +an ynode +an opie +an agrams +an ynan +an ÈĻat +Ġi def +Ġi get +Ġi arg +Ġi value +Ġi ob +Ġi base +Ġi db +Ġi pos +Ġi md +Ġi Time +Ġi plt +Ġi lex +Ġi colors +Ġi month +Ġi glob +Ġi digits +Ġi problem +Ġi phone +Ġi lb +Ġi runner +Ġi hr +Ġi Tun +Ġi chr +Ġi gd +Ġi tos +Ġi vt +Ġi beat +Ġi lh +Ġi zp +Ġi Look +Ġi ostream +Ġi qrt +Ġi raf +Ġi rast +Ġi grlex +-- % +-- ' +-- >< +me V +me ad +me ber +me stri +me so +me tag +me tics +me hr +me sso +me iro +me fox +me chanical +me sini +me gatron +me mpool +me monger +me iduo +Ġ' × +Ġ' (" +Ġ' ==== +Ġ' ]) +Ġ' ---------------- +Ġ' (( +Ġ' "," +Ġ' *- +Ġ' âĢ +Ġ' ); +Ġ' _{ +Ġ' |\ +Ġ' :::: +Ġ' ###### +Ġ' ``` +Ġ' ...', +Ġ' âĢľ +Ġ' ='. +Ġ' âĢĵ +Ġ' ].') +Ġ' âı +Ġ' âĺĨ +Ġ' --------------------- +Ġ' >>', +Ġ' ãĢĤ', +Ġ' -------------------------------------------------------- +Ġ' ðŁijĨ +Ġ' ":') +ro K +ro pe +ro el +ro cs +ro do +ro xy +ro duct +ro ving +ro mes +ro cesses +ro thead +ro blox +ro bbie +ro tondo +ti u +ti z +ti ro +ti ert +ti che +ti da +ti max +ti pi +ti tems +ti zen +ti sser +ti chen +ti amen +mp k +mp m +mp el +mp as +mp cs +mp net +mp tive +mp io +mp ca +mp mt +mp help +mp rot +mp litude +mp lare +mp qY +mp oline +mp lutil +Ġc E +Ġc ex +Ġc ci +Ġc ly +Ġc lot +Ġc fo +Ġc ape +Ġc ft +Ġc ag +Ġc ated +Ġc ak +Ġc split +Ġc do +Ġc ler +Ġc go +Ġc doc +Ġc ng +Ġc open +Ġc python +Ġc ui +Ġc src +Ġc objects +Ġc dt +Ġc é +Ġc ero +Ġc bit +Ġc uuid +Ġc paths +Ġc á +Ġc mm +Ġc pid +Ġc ited +Ġc ÃŃ +Ġc ima +Ġc wrap +Ġc uv +Ġc nc +Ġc bp +Ġc transfer +Ġc Title +Ġc levels +Ġc ais +Ġc defs +Ġc ota +Ġc rg +Ġc IDs +Ġc jp +Ġc finder +Ġc ElementTree +Ġc idades +Ġc zf +Ġc sharp +Ġc Restricted +Ġc ulture +Ġc NoN +Ġc avity +Ġc álculo +Ġc uppa +Ġc Nei +Ġp C +Ġp E +Ġp one +Ġp to +Ġp ta +Ġp out +Ġp line +Ġp sa +Ġp ant +Ġp ak +Ġp Name +Ġp Data +Ġp rit +Ġp group +Ġp List +Ġp lag +Ġp idx +Ġp ols +Ġp ict +Ġp gen +Ġp labels +Ġp post +Ġp tx +Ġp lambda +Ġp conv +Ġp unk +Ġp pts +Ġp lim +Ġp center +Ġp loads +Ġp gamma +Ġp mass +Ġp rag +Ġp ints +Ġp serve +Ġp Pr +Ġp nm +Ġp bid +Ġp anning +Ġp ango +Ġp fio +Ġp agers +Ġp rcp +Ġp zscore +Ġp Gm +Ġp encils +Ġp aprika +Ġp residency +Ġp JML +Ġf di +Ġf ma +Ġf us +Ġf log +Ġf om +Ġf ext +Ġf ap +Ġf xa +Ġf user +Ġf ff +Ġf config +Ġf cs +Ġf ou +Ġf by +Ġf ak +Ġf als +Ġf man +Ġf api +Ġf of +Ġf ream +Ġf ug +Ġf Path +Ġf debug +Ġf lan +Ġf ling +Ġf cr +Ġf va +Ġf rf +Ġf lies +Ġf ati +Ġf sl +Ġf flush +Ġf allen +Ġf lf +Ġf Env +Ġf udge +Ġf fq +Ġf Tmp +Ġf Dx +Ġf aked +Ġf ought +Ġf izz +Ġf curves +Ġf uction +Ġf alta +Ġf printf +Ġf glm +Ġf ldr +Ġf uniMIB +Ġf MRI +Ġf uther +Ġf fai +Ġf usions +Ġf bgn +Ġf paramlims +Ġf uniMIBCompliance +Ġf isheye +Ġ" -------- +Ġ" ]) +Ġ" ={ +Ġ" ({ +Ġ" )): +Ġ" )), +Ġ" (- +Ġ" '\ +Ġ" )\ +Ġ" '{ +Ġ" ==" +Ġ" ([^ +Ġ" };\ +Ġ" ],\ +Ġ" âĻ +Ġ" âļ +Ġ" âĢ¢ +Ġ" ------------------- +Ġ" ï¼Į" +Ġ" });\ +Ġ" ===============\ +he Z +he c +he de +he ur +he ath +he ff +he mo +he lin +he av +he ters +he cho +he ker +he ats +he pb +he xample +he aring +he zza +he sian +he Know +he lae +he licopter +## - +## ": +## ==== +## === +it ent +it ap +it ory +it no +it utils +it ão +it ja +it és +it eness +it oba +it arian +it amar +it ranslations +it Kenar +Ġa co +Ġa if +Ġa mple +Ġa ec +Ġa cted +Ġa idx +Ġa var +Ġa my +Ġa pri +Ġa ql +Ġa column +Ġa pert +Ġa fir +Ġa fe +Ġa ics +Ġa pc +Ġa char +Ġa day +Ġa ctx +Ġa present +Ġa year +Ġa ged +Ġa je +Ġa sec +Ġa month +Ġa PY +Ġa irs +Ġa Dist +Ġa sph +Ġa det +Ġa Space +Ġa ios +Ġa phrase +Ġa quisition +Ġa OI +Ġa stral +Ġa cea +Ġa ð +Ġa proxies +Ġa cessing +Ġa merica +Ġa éri +Ġa jay +Ġa mais +Ġa voir +Ġa urora +Ġa Hnum +Ġa amodel +Ġa parente +Ġa buse +Ġa divinhar +Ġa fraid +lo T +lo ut +lo path +lo af +lo ons +lo va +lo uv +lo far +lo ski +lo eck +lo ž +lo osh +00 076 +00 29 +00 67 +00 39 +00 300 +00 61 +00 123 +00 104 +00 164 +00 800 +00 896 +00 375 +00 808 +00 900 +00 026 +00 158 +00 097 +00 065 +00 995 +00 034 +00 087 +00 968 +00 240 +00 085 +00 095 +00 111111111111111111111 +00 074 +00 769 +00 1800 +00 3239 +00 010001000 +00 3900 +ge u +ge me +ge li +ge lab +ge low +ge oc +ge min +ge og +ge we +ge ps +ge ld +ge cko +ge ography +ge obox +ge lato +ge odesic +ge otool +ge ysers +ge ographical +ge bco +ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ort ing +ce o +ce ew +ce ses +ce lis +ce NG +ce PG +ce lain +ce ola +', % +', , +', - +', __ +', '), +', '' +', :], +Ġn A +Ġn F +Ġn W +Ġn Y +Ġn ing +Ġn and +Ġn val +Ġn ig +Ġn ls +Ġn text +Ġn xa +Ġn dir +Ġn lt +Ġn ok +Ġn ast +Ġn pos +Ġn exp +Ġn mi +Ġn ale +Ġn color +Ġn new +Ġn ref +Ġn tim +Ġn files +Ġn open +Ġn vid +Ġn msg +Ġn board +Ġn mt +Ġn Max +Ġn match +Ġn dist +Ġn ude +Ġn mod +Ġn af +Ġn rs +Ġn mm +Ġn rl +Ġn All +Ġn vals +Ġn control +Ġn Doc +Ġn ula +Ġn sr +Ġn days +Ġn wb +Ġn theta +Ġn hi +Ġn itter +Ġn exist +Ġn lis +Ġn ylim +Ġn Space +Ġn Cells +Ġn aux +Ġn ico +Ġn ivo +Ġn ales +Ġn apis +Ġn ö +Ġn Outer +Ġn rack +Ġn rg +Ġn particles +Ġn udge +Ġn shots +Ġn trees +Ġn zc +Ġn uber +Ġn Things +Ġn ãģĮ +Ġn Possible +Ġn Obs +Ġn Levels +Ġn largest +Ġn orte +Ġn repeats +Ġn lake +Ġn acelle +Ġn Endpoints +Ġn ifty +Ġn comms +Ġn halos +Ġn hwc +Ġn neighs +Ġn ominate +Ġn locktime +Ġn lyric +Ġn annan +Ġn uitka +Ġn Depths +Ġn Slides +Ġn vpicpr +Ġn imare +Ġn CompletedIter +Ġn EdgesOnCell +Ġn loe +Ġn awet +Ġs S +Ġs re +Ġs val +Ġs value +Ġs vi +Ġs ore +Ġs ang +Ġs ise +Ġs lt +Ġs ump +Ġs ings +Ġs ark +Ġs word +Ġs params +Ġs List +Ġs be +Ġs models +Ġs inal +Ġs led +Ġs du +Ġs uid +Ġs ia +Ġs font +Ġs win +Ġs pool +Ġs scores +Ġs ga +Ġs DX +Ġs sn +Ġs ru +Ġs rf +Ġs cov +Ġs omatic +Ġs vp +Ġs anner +Ġs bc +Ġs ano +Ġs perm +Ġs iting +Ġs celer +Ġs gain +Ġs ung +Ġs ÅĤ +Ġs cool +Ġs ppr +Ġs intel +Ġs resids +Ġs ieved +Ġs agas +Ġs lipped +Ġs oluções +Ġs alida +Ġs ueldo +Ġs mlb +Ġs pparser +Ġs ushy +Ġs CMOS +ut el +ut inal +ut ong +ut ants +ut ado +ut ino +ut zt +ut tivo +ur ers +ur age +ur bo +ur ag +ur ip +ur ated +ur ak +ur bs +ur du +ur ie +ss b +ss as +ss op +ss ic +ss vi +ss ub +ss ize +ss os +ss ign +ss uto +ss ier +ss olver +ss hs +ss dp +ss imo +ss peed +ss sZ +ss ysla +ss ische +ss erae +Ġin ame +Ġin path +Ġin ns +Ġin gor +Ġin equal +Ġin Port +Ġin gre +Ġin ev +Ġin TS +Ġin good +Ġin canvas +Ġin gres +Ġin dem +Ġin bm +Ġin Place +Ġin sects +Ġin spa +Ġin ÃŃcio +Ġin manta +Ġin iciado +Ġin Workbook +Ġin moov +Ġin actives +Ġin lining +Ġre us +Ġre to +Ġre pt +Ġre param +Ġre join +Ġre lin +Ġre bin +Ġre mi +Ġre color +Ġre auth +Ġre cal +Ġre open +Ġre ponse +Ġre ik +Ġre qui +Ġre fp +Ġre loader +Ġre ç +Ġre tract +Ġre connection +Ġre bind +Ġre created +Ġre scan +Ġre press +Ġre frac +Ġre distribution +Ġre xp +Ġre lia +Ġre formatted +Ġre mappings +Ġre indexed +Ġre plays +Ġre playing +Ġre marked +Ġre located +Ġre visited +Ġre configured +Ġre writes +Ġre cep +Ġre compiled +Ġre creating +Ġre builds +Ġre initialization +Ġre formatting +Ġre disa +Ġre locatable +Ġre vise +Ġre publishing +Ġre lación +Ġre numbered +Ġre straints +Ġre configuring +Ġre zervacija +Ġre Emulate +Ġre entrant +Ġre scue +Ġre infective +Ġre cherche +Ġre parameterization +Ġre linquishment +Ġre ltol +Ġre jonowy +Ġre cipents +sel in +sel FnDir +self v +self type +self boost +ing l +ing In +ing ui +ing yu +ing dong +ing entésimo +ing ParentList +ame y +ame zon +Ġo F +Ġo L +Ġo q +Ġo se +Ġo self +Ġo path +Ġo om +Ġo os +Ġo df +Ġo iv +Ġo do +Ġo ks +Ġo cat +Ġo debug +Ġo String +Ġo ven +Ġo cf +Ġo oo +Ġo writer +Ġo Options +Ġo cn +Ġo vl +Ġo dn +Ġo lar +Ġo ficial +Ġo ike +Ġo virt +Ġo grey +Ġo hms +Ġo meg +Ġo mtk +Ġo stap +Ġo dios +Ġo topi +Ġo strich +Ġo golem +Ġd D +Ġd log +Ġd odel +Ġd ci +Ġd ax +Ġd base +Ġd info +Ġd df +Ġd ave +Ġd ress +Ġd uct +Ġd my +Ġd tes +Ġd nx +Ġd fir +Ġd ync +Ġd ics +Ġd td +Ġd dev +Ġd acc +Ġd depth +Ġd cr +Ġd sr +Ġd cb +Ġd dy +Ġd typ +Ġd ilon +Ġd vp +Ġd Vector +Ġd wi +Ġd wave +Ġd pot +Ġd Delta +Ġd vn +Ġd ances +Ġd Timer +Ġd rew +Ġd Xs +Ġd udp +Ġd Radius +Ġd arwin +Ġd Lambda +Ġd scraper +Ġd ÃŃa +Ġd anh +Ġd ibase +Ġd akota +Ġd dxi +Ġd FDF +Ġd deta +Ġd uca +Ġd MAE +Ġd gtg +Ġd kepler +Ġd sgn +Ġd dzeta +Ġd orsal +Ġd abei +Ġd andan +Ġd tracers +Ġd airy +Ġd chpNeedToReconfigure +li J +li pe +li dir +li ctor +li ssage +li vo +li si +li vious +li cos +li ev +li eg +li ante +li via +li wc +li dade +li ott +li oso +li oproj +li dades +li yah +li lien +li mpar +ct h +ct z +ct aw +ct hing +ct Offers +ct RNS +ct tttt +pe th +pe sc +pe que +pe ap +pe per +pe ste +pe lem +pe wa +pe ito +pe fac +pe lle +pe sca +pe ckle +pe lato +pe asant +pe destrians +un r +un de +un ck +un ist +un ime +un group +un sign +un conf +un ged +un eff +un vec +un gh +un ga +un trained +un obs +un gu +un conn +un tar +un configure +un cia +un listed +un blocked +un idata +un needed +un configured +un till +un rolled +un protect +un opened +un solved +un watched +un validated +un happy +un tested +un targeted +un referenced +un hashable +un pushed +un settled +un rigged +un itless +un potable +un disturbedMediumFlow +un laden +un stucking +Ġm L +Ġm M +Ġm ge +Ġm sc +Ġm mo +Ġm dict +Ġm valid +Ġm ari +Ġm ill +Ġm ses +Ġm default +Ġm lag +Ġm client +Ġm top +Ġm length +Ġm cat +Ġm cl +Ġm dep +Ġm scale +Ġm ful +Ġm req +Ġm Entry +Ġm fname +Ġm ni +Ġm sigma +Ġm rec +Ġm otype +Ġm rio +Ġm ij +Ġm vr +Ġm gd +Ġm alloc +Ġm tls +Ġm qc +Ġm RNA +Ġm TLS +Ġm stype +Ġm unge +Ġm others +Ġm Ã¥ +Ġm COUNTER +Ġm ccore +Ġm angling +Ġm toa +Ġm minion +Ġm scn +Ġm uffin +Ġm osaicking +Ġm unkres +Ġm ême +ra N +ra ma +ra pt +ra sed +ra pi +ra gen +ra ins +ra ined +ra cial +ra spi +ra ffin +ra Destinacije +Ġe er +Ġe ol +Ġe ac +Ġe sa +Ġe da +Ġe ip +Ġe clu +Ġe img +Ġe call +Ġe Max +Ġe pc +Ġe struct +Ġe ui +Ġe scope +Ġe sim +Ġe vm +Ġe cm +Ġe chain +Ġe loop +Ġe tw +Ġe gl +Ġe eps +Ġe vp +Ġe voke +Ġe wm +Ġe Er +Ġe lision +Ġe yr +Ġe volved +Ġe bay +Ġe distr +Ġe kle +Ġe laboration +Ġe commerce +Ġe vasion +Ġe arns +Ġe ttä +Ġe lapsingTime +Ġe ternal +Ġe tiche +la j +la it +la us +la sa +la cs +la ip +la vo +la uto +la pack +la rea +la dos +la wn +la mente +la wl +la zione +la mports +la skie +---- \ +---- +-------------------+ +---- .----- +ate Impact +ion o +ion are +ion ado +ion ato +() ? +() '), +() '. +() ". +() ï¼Į +() }_ +() `) +() +'\ +fi N +fi de +fi um +fi is +fi lat +fi bs +fi lip +fi é +fi ves +fi Dataset +fi xdate +fi loso +ue le +ue me +ue ce +ue ix +ue do +ue ee +ent on +ent re +ent rep +ent ino +ent ário +ent herm +ent omino +ad it +ad ms +ad ise +ad mi +ad ition +ad ain +ad ies +ad ams +ad block +ad ics +ad words +ad mm +ad hi +ad rive +ad bd +ad ente +ad amente +ad anet +ad nego +ad detto +ad resu +ad ownet +ad ptv +ad aboost +ad skil +", ( +", - +", . +", _ +", ]: +", )}, +co on +co str +co con +co sa +co work +co try +co pri +co cc +co loss +co vo +co initialize +co oper +co uter +co gh +co processor +co mplementation +co locate +co erc +co operate +co ewm +co ppin +co upler +ri D +ri u +ri re +ri di +ri pp +ri gs +ri be +ri buted +ri era +ri card +ri cer +ri router +ri ama +ri pet +ri cks +ri cally +ri zzo +ri zzare +ri conosc +ri unito +ri spet +ri inng +Ġthe o +Ġthe il +Ġthe data +Ġthe ft +Ġthe Time +Ġthe saurus +Ġthe audiodb +Ġb F +Ġb time +Ġb ew +Ġb ure +Ġb label +Ġb num +Ġb lu +Ġb ard +Ġb start +Ġb pos +Ġb av +Ġb rid +Ġb word +Ġb sum +Ġb group +Ġb tle +Ġb atter +Ġb fe +Ġb ics +Ġb pc +Ġb ats +Ġb ends +Ġb dot +Ġb decode +Ġb gg +Ġb mod +Ġb dat +Ġb rs +Ġb Function +Ġb sd +Ġb zero +Ġb vec +Ġb Map +Ġb ored +Ġb pd +Ġb band +Ġb aker +Ġb lists +Ġb rio +Ġb ili +Ġb ora +Ġb tm +Ġb phrase +Ġb jd +Ġb ento +Ġb uns +Ġb atz +Ġb ounty +Ġb vg +Ġb vh +Ġb eso +Ġb unches +Ġb mtk +Ġb oltzmann +Ġb Hnum +Ġb imod +Ġb ishop +Ġb ifurcations +Ġb alsam +Ġ1 107 +Ġ1 0101 +Ġ1 0000000000000000 +Ġ1 128 +Ġ1 123 +Ġ1 948 +Ġ1 104 +Ġ1 224 +Ġ1 137 +Ġ1 146 +Ġ1 177 +Ġ1 145 +Ġ1 140 +Ġ1 130 +Ġ1 946 +Ġ1 344 +Ġ1 360 +Ġ1 037 +Ġ1 075 +Ġ1 034 +Ġ1 975 +Ġ1 149 +Ġ1 968 +Ġ1 577 +Ġ1 246 +Ġ1 366 +Ġ1 454 +Ġ1 578 +Ġ1 324 +Ġ1 958 +Ġ1 242 +Ġ1 467 +Ġ1 439 +Ġ1 678 +Ġ1 973 +Ġ1 382 +Ġ1 462 +Ġ1 673 +Ġ1 891 +Ġ# $ +Ġ# ~ +Ġ# ---- +Ġ# (' +Ġ# '/ +Ġ# !/ +ed k +ed ig +ed do +ed ium +ed Image +ed des +ed Dataset +ed bf +ed Iter +ed Identity +ed gar +ed mak +ed izione +ed ikt +ed wardyehuang +11 999 +11 41 +11 011011 +11 00101 +11 146 +11 299 +11 158 +11 143 +11 977 +11 376 +11 226 +11 086 +11 248 +11 085 +11 323 +11 358 +11 440 +11 92813 +rom DialogFrame +um u +um ise +um ag +um ax +um ay +um ere +um und +um ail +um isi +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ +int p +int v +int on +int an +int as +int ance +int reg +int ele +int rain +int Query +int rp +int Between +id B +id G +id in +id us +id ic +id log +id col +id io +id ding +id let +id cache +id uous +id Len +id uals +id alab +id Sud +id CheckItem +Ġ( , +Ġ( ": +Ġ( =" +Ġ( '' +Ġ( ''' +Ġ( ____ +Ġ( .* +Ġ( ?? +Ġ( ___ +Ġ( => +Ġ( --> +Ġ( ')', +Ġ0 16 +Ġ0 17 +Ġ0 77 +Ġ0 39 +Ġ0 110 +Ġw q +Ġw ri +Ġw sc +Ġw im +Ġw ore +Ġw ib +Ġw ings +Ġw nn +Ġw amp +Ġw tf +Ġw ks +Ġw aw +Ġw dt +Ġw mac +Ġw ii +Ġw rd +Ġw ots +Ġw adi +Ġw irtual +Ġw elt +Ġw vf +Ġw StringIO +Ġw mos +Ġw oe +Ġw ashing +Ġw Cam +Ġw oke +Ġw rds +Ġw assr +Ġw asteful +Ġw lauto +ch d +ch pp +ch ic +ch time +ch if +ch ise +ch ou +ch iti +ch ave +ch arn +ch ler +ch oth +ch anel +ch rift +ch ka +ch asm +ch kM +ch uan +ch berg +ch ott +ch olar +ch itz +ch ristop +ch arger +ch ameleon +ch isquare +ch ungszentrum +ch idSud +te F +te Y +te ma +te str +te sp +te ase +te spy +te Lpe +te indre +di gs +di ale +di ler +di var +di pha +di hed +di mag +di gamma +di ções +di atomic +di lemma +di xY +di visão +di hedTypes +di ÄŁer +di arization +di pendente +di ÄŁiniz +di ametro +di chroic +di haml +def f +def ra +def set +def ence +def ba +def lections +def Exist +def macro +def Grp +def Opts +def unto +def rost +def FilterAttr +def DriverAttr +): = +): ** +): ]: +and j +and u +and are +and amount +and ria +and aran +ata y +ata class +ata sets +ata mente +Ġ[ ! +Ġ[ : +Ġ[ ? +Ġ[ (), +Ġ[ {\ +Ġ[ _, +Ġ[ _. +Ġ[ ("_ +Ġ[ ']', +ma an +ma ce +ma sc +ma res +ma py +ma ging +ma bra +ma cher +ma wa +ma Tokenizer +ma ara +ma zione +ma jÄħ +ma ptbx +ma estro +ma uve +ma hjong +Ġself v +Ġself Closing +ul q +ul an +ul lo +ul te +ul let +ul ki +ul atable +ul mts +ul ées +ul mano +Ġimport mail +Ġimport ando +Ġimport ante +== "" +== ''' +], "\ +], ..., +], ...] +], :,:], +from iter +from samples +from tuple +from Enum +from Matrix +from arrays +from Place +from Year +from Mag +from sizing +from MFP +Ġif c +Ġif rag +Ġif ttt +ot E +ot F +ot n +ot y +ot ho +ot ak +ot fr +ot ros +ot hello +ot gw +ot Fo +ot timo +ot helial +ot helio +ot ranslations +ck en +ck out +ck nn +ck ks +Ġfor c +Ġfor ums +Ġfor 문 +Ġfor eman +"" ], +ol w +ol ate +ol cs +ol table +ol lection +ol sen +ol kit +ol ano +ol tre +ol hos +el L +el n +el name +el ke +el sa +el ves +el gp +el lapsed +el lie +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +': , +': '), +': {} +': {}, +), _ +), )); +urn o +urn ar +es k +es me +es ame +es im +es col +es ign +es Type +es ses +es rc +es ources +es rf +es cores +es gd +es xi +es gf +es imo +es erc +es ional +es sentially +es pecial +es cluso +es kenar +es iduals +turn o +turn ing +turn ip +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĊ ĊĠĠĠĠĠĠĠĠĊ +Ġ+ / +Ġ+ ') +Ġ+ ---------------- +Ġ+ ". +Ġ+ "]/ +Ġ+ -", +Ġ+ ")") +Ġ+ ------------+-------------------------------- +ode code +ode gree +is A +is d +is ct +is ma +is ow +is que +is ure +is ard +is ive +is number +is method +is PO +is ning +is match +is ia +is Py +is On +is crit +is Interface +is abstract +is strings +is done +is cam +is cher +is Wi +is Enable +is Ri +is cus +is outlier +is Music +is Same +is Working +is Visible +is Absolute +is nil +is Summer +is printable +is Playing +is csi +is lington +is NodeType +is Subtype +is PrescribedForceOn +is lava +is miniz +is TrustedForwarder +is urvey +is unchecked +is piel +is AfterSelection +is phx +is MyView +is NotDone +val ore +val ib +val do +val core +val range +val Input +val loader +val Loss +val bard +val uable +val uables +val utare +val dienst +val proate +__ ? +__ """ +__ ]. +__ '. +__ ( +)) +"\ +)) #. +)) -( +)) +'\ +set or +set ters +set Id +set raw +set The +set Table +set uid +set pass +set ores +set Pos +set Server +set Graph +set Content +set Transform +set zen +set Width +set Scale +set Left +set Right +set Plugin +set Database +set Root +set Filename +set Progress +set Background +set funcs +set Master +set Home +set Locator +set DateTime +set Tags +set logfile +set Family +set Interaction +set Popup +set Maya +set LoginStatus +set Resolved +set PlaceholderText +set Speaker +set ValidData +set EndPoint +set RestrictedTransfer +set readermode +set RoyaltyBps +set InitialState +set BoardState +set TlogCompression +set hreads +ath i +ath ar +ath lete +ath ani +ath leen +Ġ- # +Ġ- | +Ġ- `` +Ġ- ### +Ġ- ]", +Ġ- __| +Ġto a +Ġto g +Ġto en +Ġto ut +Ġto ck +Ġto us +Ġto str +Ġto ile +Ġto bs +Ġto Str +Ġto Get +Ġto Node +Ġto pping +Ġto bytes +Ġto ee +Ġto Task +Ġto sses +Ġto Ret +Ġto Write +Ġto Skip +Ġto Feed +Ġto Currency +Ġto Continue +Ġto urney +Ġto StateList +ĠT q +ĠT iz +ĠT art +ĠT ls +ĠT ir +ĠT oc +ĠT AR +ĠT og +ĠT em +ĠT ache +ĠT av +ĠT UR +ĠT of +ĠT ies +ĠT ash +ĠT ld +ĠT gn +ĠT ie +ĠT Path +ĠT send +ĠT ram +ĠT NO +ĠT ERR +ĠT Ref +ĠT SD +ĠT HER +ĠT fl +ĠT SA +ĠT UI +ĠT VM +ĠT Collection +ĠT udo +ĠT recv +ĠT iling +ĠT VA +ĠT ung +ĠT Canvas +ĠT weak +ĠT MAPE +ĠT amba +ĠT AMS +ĠT pch +ĠT asmota +ĠT REC +ĠT MAPEStd +ĠT ears +ĠT ARBALL +ĠT IPO +ĠT UPLE +ĠT ilde +ĠT arefas +ĠT FOD +ĠT ASMOTA +ĠT éléphone +ĠT DataStd +ĠT odeschini +ĠT seep +xt or +xt ol +xt ree +xt rans +xt ream +xt ured +xt FileReader +xt rak +il k +il al +il ter +il son +il da +il cm +il sym +il ja +il mente +il Uh +il rys +th age +th ou +th ug +th ats +th MB +th unks +th rew +th ogonal +us an +us qu +us ho +us bu +us api +us ual +us ins +us ão +us ato +us unu +us Imaging +us abl +us Cari +import r +import able +import Conditions +str g +str r +str str +str list +str File +str Log +str ative +str nc +str ando +str utt +str PID +str utto +str INI +str Peptide +str prose +str ategic +Ġreturn names +Ġreturn Image +Ġreturn Array +Ġreturn Values +Ġreturn Vec +Ġreturn Vect +con z +con ch +con ject +con check +con tex +con joint +con sens +con vey +con wc +con currently +con cet +con corrente +con firming +con dicional +con tribs +con tempor +con seguente +Ġ2 854 +Ġ2 097 +Ġ2 344 +Ġ2 057 +Ġ2 181 +Ġ2 977 +Ġ2 333 +Ġ2 368 +Ġ2 067 +Ġ2 928 +Ġ2 338 +Ġ2 856 +Ġ2 078 +Ġ2 343 +Ġ2 329 +Ġ2 339 +Ġ2 371 +Ġ2 363 +Ġ2 852 +ers cript +ers Registry +ers pectral +(" ''' +(" }\ +(" .\ +(" ------- +(" !! +(" +" +(" !") +(" [[ +(" _" +(" (% +(" && +(" ``` +(" :[ +(" ============== +(" <<<< +(" || +(" ~~~~~~ +(" !!! +(" <<<<<<<< +(" ==> +(" ==") +(" ```\ +(" ]")[ +(" ]"): +(" ðŁĶĦ +pp x +pp py +pp Start +pp End +pp Factory +pp Adapter +pp Texture +pp icture +pp DepthStencilView +pp GeometryShader +pp SignatureBlob +pp ImmediateContext +') - +') ]. +') ". +') `. +') "%( +') })) +as K +as name +as par +as ds +as ir +as col +as pi +as ound +as iv +as object +as ie +as matrix +as wiki +as gd +as Regs +as dfa +as witch +as dasd +as jno +as urv +ĉĉ ĊĊ +iz h +iz q +iz y +iz an +iz sa +iz zy +iz bi +iz zo +iz Zw +iz pis +iz dihaml +-------- ", +et b +et k +et u +et ur +et us +et up +et tings +et fs +et Code +et ernal +et obs +et ric +et tu +et Backend +et Round +et ów +arg en +arg num +arg ins +arg ui +arg reed +arg flag +arg comment +arg oment +arg Format +op K +op j +op k +op m +op ad +op set +op str +op am +op ac +op lot +op Dict +op anel +op ulate +op hic +op amine +op orto +op omba +ve de +ve la +ve ig +ve ze +ve enk +ve stito +Ġ{ (' +Ġ{ """ +Ġ{ :% +Ġ{ [] +Ġis up +Ġis ic +Ġis list +Ġis nt +Ġis valid +Ġis float +Ġis stream +Ġis pec +Ġis Client +Ġis Output +Ġis inf +Ġis pkg +Ġis null +Ġis void +Ġis Local +Ġis Scale +Ġis Last +Ġis Collection +Ġis Translation +Ġis Shader +Ġis Texture +Ġis Primitive +Ġis Holiday +Ġis Possible +Ġis pagination +Ġis Week +Ġis Rotation +Ġis Loaded +Ġis Major +Ġis Negative +Ġis Numeric +Ġis larch +Ġis Squared +Ġis Mutable +Ġis CGI +Ġis Hashable +Ġis odate +Ġis DataFile +Ġis herm +Ġis Legal +Ġis dcf +Ġis Excluded +Ġis loggedin +Ġis AfterSelection +Ġis Cryptography +Ġis Witness +Ġis AllCompleted +Ġis AveCost +Ġ7 01 +Ġ7 22 +Ġ7 85 +Ġ7 97 +Ġ7 90 +Ġ7 000000 +Ġ7 81 +Ġ7 31 +Ġ7 58 +Ġ7 63 +Ġ7 41 +Ġ7 61 +Ġ7 71 +Ġ7 800 +Ġ7 373 +Ġ7 463 +Ġ7 50003 +ĠS lo +ĠS li +ĠS ang +ĠS ob +ĠS che +ĠS IT +ĠS ass +ĠS ip +ĠS lit +ĠS tain +ĠS au +ĠS box +ĠS table +ĠS cy +ĠS air +ĠS ESS +ĠS ounds +ĠS ous +ĠS aw +ĠS dist +ĠS ank +ĠS aml +ĠS hash +ĠS ays +ĠS WS +ĠS ized +ĠS ão +ĠS cf +ĠS BL +ĠS rl +ĠS pub +ĠS hist +ĠS SP +ĠS ices +ĠS dk +ĠS ana +ĠS AX +ĠS css +ĠS VS +ĠS wers +ĠS LR +ĠS QP +ĠS FD +ĠS MON +ĠS ln +ĠS vn +ĠS DN +ĠS ung +ĠS iam +ĠS AMP +ĠS CAT +ĠS CU +ĠS RAM +ĠS PECT +ĠS aba +ĠS amba +ĠS andra +ĠS amut +ĠS tix +ĠS licing +ĠS WITCH +ĠS CHOOL +ĠS irr +ĠS PORTS +ĠS zor +ĠS ushi +ĠS oluções +ĠS unglasses +ĠS loppy +ĠS lurm +ĠS doMessage +ĠS NLDS +ĠS tpmex +ĠS ROMPy +ĠS itja +ab w +ab an +ab ot +ab ay +ab ef +ab func +ab lon +ab ato +ab uck +ab bag +ab uy +ab rams +ab bond +ab Instr +ab onne +None Value +None Statement +Ġof t +Ġof proto +ĠC n +ĠC t +ĠC in +ĠC ul +ĠC name +ĠC us +ĠC et +ĠC up +ĠC sp +ĠC od +ĠC ub +ĠC im +ĠC ance +ĠC url +ĠC SE +ĠC ec +ĠC ari +ĠC row +ĠC ents +ĠC ern +ĠC ies +ĠC MA +ĠC tx +ĠC TO +ĠC Class +ĠC IP +ĠC arr +ĠC rs +ĠC WS +ĠC ERR +ĠC RL +ĠC BL +ĠC ordinates +ĠC PS +ĠC Loader +ĠC MB +ĠC MAX +ĠC OB +ĠC aj +ĠC arp +ĠC ities +ĠC reat +ĠC RA +ĠC NAMES +ĠC Tk +ĠC rist +ĠC TX +ĠC BS +ĠC atar +ĠC MN +ĠC LF +ĠC Setting +ĠC PM +ĠC idade +ĠC nv +ĠC atal +ĠC GP +ĠC La +ĠC acher +ĠC yr +ĠC Term +ĠC rating +ĠC itations +ĠC GTT +ĠC ROW +ĠC KK +ĠC Fs +ĠC REST +ĠC UBE +ĠC KAN +ĠC locks +ĠC idr +ĠC anny +ĠC abin +ĠC usto +ĠC orners +ĠC UED +ĠC ubs +ĠC SafeLoader +ĠC BRACE +ĠC ARBON +ĠC atherine +ĠC leveland +ĠC uckoo +ĠC rying +ĠC amilo +ĠC astelo +ig le +ig ame +ig as +ig als +ig ates +ig ao +ig matic +ig uity +ig ibson +ht g +ht me +ht ra +ht op +ht bl +ht docs +ht bc +ht bW +ht heory +up V +up in +up il +up map +up rt +up link +up ped +up side +up sampler +up buff +up scaling +up voted +") ]: +") ]] +") }" +") }. +") }' +") }} +") ])]) +") ]]/ +Ġ== [ +Ġ== ": +Ġ== ". +rint s +Ġdef val +Ġdef file +Ġdef Mode +Ġdef vars +Ġdef ensive +Ġdef uns +Ġdef aul +Ġdef erring +Ġdef eats +Ġg list +Ġg ta +Ġg ase +Ġg py +Ġg fo +Ġg mb +Ġg ml +Ġg uil +Ġg als +Ġg mi +Ġg ids +Ġg wh +Ġg ists +Ġg lim +Ġg fs +Ġg luster +Ġg logging +Ġg enu +Ġg az +Ġg dat +Ġg ha +Ġg apt +Ġg qa +Ġg tc +Ġg dirs +Ġg ssl +Ġg dp +Ġg ino +Ġg bf +Ġg gp +Ġg Cells +Ġg pointer +Ġg ROI +Ġg wu +Ġg bench +Ġg prox +Ġg erce +Ġg psd +Ġg lad +Ġg mst +Ġg enders +Ġg Qg +Ġg ì +Ġg usto +Ġg athers +Ġg streamer +Ġg unif +Ġg mlvq +Ġg éo +Ġg ulp +Ġg ridding +Ġg erek +Ġg üç +Ġg roceries +Ġg idgethub +Ġg iraffe +Ġg ShootGallery +for f +for n +for age +for ex +for aging +for syn +for 循çݯ +for zare +for tios +for xmail +ter e +ter es +ter ry +ter rit +ter font +ter gom +Ġr N +Ġr Q +Ġr W +Ġr Y +Ġr k +Ġr on +Ġr me +Ġr ation +Ġr set +Ġr par +Ġr test +Ġr lt +Ġr ust +Ġr lp +Ġr string +Ġr List +Ġr File +Ġr ong +Ġr filter +Ġr sign +Ġr xy +Ġr header +Ġr dat +Ġr bucket +Ġr cloud +Ġr flux +Ġr dp +Ġr Idx +Ġr pm +Ġr tl +Ġr hy +Ġr sb +Ġr gw +Ġr ffi +Ġr anger +Ġr pw +Ġr mv +Ġr freqs +Ġr umor +Ġr chrm +Ġr ussian +Ġr tfm +Ġr ápida +Ġr neff +Ġr Äĥzboi +Ġr GoldenGate +Ġl Y +Ġl li +Ġl ul +Ġl sc +Ġl value +Ġl num +Ġl tp +Ġl ts +Ġl index +Ġl shape +Ġl box +Ġl sg +Ġl sign +Ġl strip +Ġl mem +Ġl si +Ġl ctx +Ġl fs +Ġl Base +Ġl hash +Ġl lr +Ġl ending +Ġl bx +Ġl freq +Ġl shift +Ġl ó +Ġl mid +Ġl pairs +Ġl dst +Ġl tl +Ġl Ãł +Ġl ora +Ġl yt +Ġl spl +Ġl delim +Ġl fns +Ġl Ix +Ġl coh +Ġl shas +Ġl nbits +Ġl orenzian +Ġl urkers +Ġl gtm +Ġl AllTarget +": \ +": ^ +": {} +": '+ +": ''. +end m +end re +end id +end ale +end idx +end less +end Index +end ario +end Module +end uses +end Screen +end HOLD +end globals +end anz +end EpCut +end ToEnd +end ReleaseTime +end othelial +data S +data Y +data stat +data Set +data block +data folder +data Handler +data storage +data Pointer +data Map +data cursor +data generator +data repo +data fast +data Location +data Types +data Points +data Release +data Filename +data Prefix +data stores +data Written +data Uploader +data wT +data Sine +data SetList +data sinks +ĠA e +ĠA o +ĠA de +ĠA par +ĠA pt +ĠA lp +ĠA ask +ĠA no +ĠA stra +ĠA ster +ĠA AB +ĠA ud +ĠA AD +ĠA PO +ĠA sg +ĠA ld +ĠA TR +ĠA cl +ĠA ble +ĠA MO +ĠA si +ĠA lan +ĠA PR +ĠA prob +ĠA POST +ĠA long +ĠA STR +ĠA CD +ĠA TP +ĠA GG +ĠA SH +ĠA bb +ĠA MB +ĠA utor +ĠA SL +ĠA mar +ĠA fri +ĠA Bl +ĠA OC +ĠA vin +ĠA MR +ĠA MIS +ĠA FD +ĠA uf +ĠA eros +ĠA xi +ĠA yr +ĠA KA +ĠA EI +ĠA Ãī +ĠA mor +ĠA KS +ĠA IPS +ĠA VB +ĠA WARD +ĠA ZI +ĠA xo +ĠA Zs +ĠA aga +ĠA symmetric +ĠA gar +ĠA gro +ĠA ATG +ĠA éri +ĠA tribu +ĠA lyt +ĠA ffiliation +ĠA pollo +ĠA symCoinGame +ĠA ffected +ĠA fghan +ĠA dbTool +ĠA cerca +ĠA WithOutput +ĠA lamos +ĠA meba +ĠA acAudio +ĠA bandoned +ĠA ivazis +sp b +sp g +sp re +sp mp +sp id +sp ire +sp og +sp yn +sp ress +sp mi +sp old +sp ies +sp ide +sp ost +sp ie +sp ian +sp dx +sp arm +sp ru +sp uman +sp inning +sp iking +sp rime +sp orsmaal +sp orgente +sp msyntax +ult ad +ult ry +ver i +ver me +ver ge +ver ed +ver di +ver ke +ver Info +ver aging +ver ific +ver Importer +ver lauf +age l +age o +age Of +age bins +age ingList +'] ') +'] '] +'] :] +'] += +'] }{ +'] +( +'] }." +'] ][( +01 80 +01 00000 +01 025 +01 2019 +01 917 +01 915 +01 045 +01 367 +01 928 +01 358 +01 00000000000000000000 +01 661 +01 4407 +01 3400 +put data +put line +put env +put request +put Number +Ġcon ter +Ġcon ts +Ġcon List +Ġcon cord +Ġcon sect +Ġcon wc +Ġcon cluded +Ġcon former +Ġcon sequ +Ġcon veys +Ġcon cordance +Ġcon duit +Ġcon jecture +Ġcon gé +Ġcon solidated +Ġcon ductive +Ġcon teúdo +Ġcon inue +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ic j +ic y +ic li +ic ue +ic nt +ic ds +ic lass +ic ache +ic lique +ke v +ke te +ke es +ke by +ke xec +ke liminar +am c +am x +am om +am bu +am ock +am ie +am ura +am ico +am idade +am aro +am mor +to str +to ine +to test +to date +to dd +to lower +to Get +to Index +to samples +to integer +to JSON +to Parse +to aster +to Bytes +to sessions +to lare +to Send +to Delta +to Screen +to Bits +to Place +to Year +to pprint +to Append +to vag +to analyses +to ctext +to bii +to kyo +to mpkins +to tigmmass +99 18 +99 27 +99 35 +99 77 +99 50 +99 46 +99 63 +99 400 +99 600 +99 218 +99 264 +99 124 +99 895 +99 405 +99 048 +99 335 +99 045 +99 376 +99 316 +99 478 +Ġ: < +Ġ: ]] +Ġ: ]+ +Ġ: {}". +Ġ: )" +Ġ: ${ +Ġ: {}, +Ġ: '_ +Ġ: +: +ith a +ith r +par d +par are +par vo +par ting +par ado +par cov +par lament +par anoia +path array +path view +path Set +path Model +path spec +path ops +path Args +path Cap +path Seq +path Root +path lens +path Aug +path ãģ¯ +path Posts +path ogen +Ġand er +Ġand erson +Ġand romeda +ile a +ile x +ile an +ist ence +ist ere +ist ress +ist omock +type error +type attr +type Model +type Dict +type cast +type inf +type åĢ¼ä¸º +ĠF V +ĠF p +ĠF are +ĠF max +ĠF eld +ĠF ou +ĠF AL +ĠF AC +ĠF NAME +ĠF fs +ĠF ian +ĠF DB +ĠF reed +ĠF requ +ĠF vv +ĠF SP +ĠF MT +ĠF SA +ĠF aces +ĠF RU +ĠF ellow +ĠF FS +ĠF rac +ĠF wr +ĠF utures +ĠF irm +ĠF TD +ĠF arb +ĠF onts +ĠF ZI +ĠF Manifest +ĠF ountain +ĠF orte +ĠF ederation +ĠF anta +ĠF atture +ĠF GLM +ĠF alli +ĠF antasy +ĠF ulton +ĠF AMILIES +ĠF inkel +ĠF loppy +ĠF aucher +ĠF GSD +ĠF wVersion +ĠF ischer +od u +od at +od un +od as +od les +od rome +od HR +sc b +sc u +sc ion +sc vi +sc iv +sc rt +sc ared +sc aff +sc uro +sc imo +sc endent +sc ritto +sc ilpy +sc ielo +qu F +qu x +qu z +qu en +qu ared +qu vv +qu ando +qu into +qu antes +qu arant +qu inas +qu artz +qu imb +qu andl +qu stion +log E +log an +log time +log config +log Data +log view +log group +log ler +log loss +log ists +log post +log Formatter +log ically +log FilePath +log thumb +log stash +log eny +log enetic +list c +list comp +list layers +list Info +list All +list Search +list panel +list formats +list Groups +list Zigbee +list Observ +list alinux +list fromusers +om ation +om ers +om ens +om bra +om ogene +om ische +om kull +om munic +value type +value format +value List +value Node +vi ch +vi bo +vi ral +vi ii +vi ited +vi ä +vi Äĩ +vi athan +vi ère +vi kid +vi lian +vi jayesh +vi vente +vi ssuto +ser rat +ser aph +Ġh L +Ġh ut +Ġh ype +Ġh one +Ġh fig +Ġh dir +Ġh ight +Ġh min +Ġh ump +Ġh ace +Ġh ust +Ġh of +Ġh ong +Ġh rt +Ġh keys +Ġh plt +Ġh lr +Ġh dx +Ġh auto +Ġh inds +Ġh orizont +Ġh ana +Ġh uck +Ġh rp +Ġh pix +Ġh ij +Ġh dg +Ġh dry +Ġh ô +Ġh bboxes +Ġh ø +Ġh dbg +Ġh inz +Ġh ertz +Ġh ende +Ġh olon +Ġh erring +Ġh uffman +Ġh ijack +Ġh iguchi +Ġh ermitian +Ġh igiene +Ġh indered +Ġh endrix +Ġh ylfm +** ' +** /* +** {}** +ĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ +ĠĠĠĠĠ čĊčĊĠĠĠ +ĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +all E +all ine +all gen +all nan +all thing +all Temp +all configs +all Cells +all Err +all centers +all Tags +all vecs +all bars +all Anchor +all Dates +all Tiles +all Solutions +all Tally +all DMD +all EntityTypes +all GMD +all gemein +all popstat +all NPrsa +po f +po lo +po ise +po let +po pper +po ker +po lis +po lished +po ppy +po ppler +po jen +po obah +po wied +po olid +ta G +ta j +ta ve +ta ine +ta xf +ta go +ta act +ta pas +ta uk +ta zione +ta vg +ta ceto +ĠP X +ĠP q +ĠP ue +ĠP ys +ĠP ir +ĠP lu +ĠP ard +ĠP eri +ĠP db +ĠP ree +ĠP au +ĠP ain +ĠP ey +ĠP ict +ĠP Lo +ĠP DO +ĠP CL +ĠP lambda +ĠP ats +ĠP Image +ĠP URE +ĠP ane +ĠP MT +ĠP GA +ĠP RA +ĠP AE +ĠP eg +ĠP ony +ĠP avel +ĠP REF +ĠP ampa +ĠP SB +ĠP aged +ĠP AST +ĠP rab +ĠP ENSION +ĠP HS +ĠP unctuation +ĠP SSH +ĠP lugs +ĠP andoc +ĠP erspective +ĠP ulls +ĠP eso +ĠP etr +ĠP Basis +ĠP lateau +ĠP irates +ĠP laces +ĠP apa +ĠP INTS +ĠP arente +ĠP esto +ĠP eller +ĠP erez +ĠP itt +ĠP apel +ĠP DUs +ĠP istol +ĠP ushover +ĠP runed +ĠP wnState +ĠP esquisas +ĠP exBinary +ĠP ensei +ĠP impData +ĠP loidyPlotDir +ĠP NASNet +ĠP andaGripper +ĠP livo +Ġas str +Ġas ic +Ġas Array +Ġas hes +Ġas gi +Ġas Pickle +Ġas sessed +der d +der p +der ain +ĠI pt +ĠI ms +ĠI low +ĠI oc +ĠI AC +ĠI PT +ĠI face +ĠI python +ĠI MO +ĠI KE +ĠI dx +ĠI mag +ĠI BR +ĠI EA +ĠI GD +ĠI RS +ĠI FS +ĠI ZZ +ĠI Copy +ĠI BP +ĠI RON +ĠI Browser +ĠI dea +ĠI Enumerator +ĠI daho +ĠI PRoute +file N +file c +file time +file key +file count +file input +file group +file tmp +file Result +file storage +file counter +file Read +file Link +file share +file Sep +file TimeSpan +ĠL U +ĠL or +ĠL de +ĠL ion +ĠL ack +ĠL ange +ĠL ance +ĠL ind +ĠL OR +ĠL ID +ĠL ies +ĠL iter +ĠL ESS +ĠL ie +ĠL iss +ĠL Max +ĠL OL +ĠL CA +ĠL é +ĠL PUT +ĠL NA +ĠL inf +ĠL STAT +ĠL MT +ĠL ima +ĠL HOST +ĠL PC +ĠL itter +ĠL ond +ĠL ives +ĠL CF +ĠL ae +ĠL ya +ĠL IDs +ĠL PF +ĠL omb +ĠL xm +ĠL argo +ĠL PAREN +ĠL SHIFT +ĠL enz +ĠL MDB +ĠL bands +ĠL APL +ĠL ucky +ĠL uminosity +ĠL loyd +ĠL ütfen +ĠL aminar +ĠL udwig +ĠL aird +ĠL nurl +ĠL UNA +ub B +ub w +ub en +ub ut +ub ject +ub ator +ub scription +ub traction +ub hav +res as +res list +res dir +res ave +res Seq +res umed +res pects +res ampling +res istente +res RetSiteMap +tr Z +tr c +tr f +tr z +tr ing +tr data +tr ys +tr ates +tr ny +tr dp +tr uls +Ġth xl +Ġth inningThingProducer +Ġth ë +Ġth rought +Ġth redds +Ġth rsl +=' [" +=' '), +=' ?' +=' [% +=' "- +=' */ +Ġst m +Ġst al +Ġst ing +Ġst ime +Ġst event +Ġst reak +Ġst ake +Ġst xo +Ġst aking +Ġst airs +Ġst anje +Ġst arring +Ġst adium +Ġst romal +Ġst avke +Ġst robogrammatic +Ġde ed +Ġde vi +Ġde line +Ġde cs +Ġde ty +Ġde vel +Ġde fic +Ġde cri +Ġde init +Ġde spe +Ġde mail +Ġde pri +Ġde poch +Ġde tx +Ġde ux +Ġde vided +Ġde sses +Ġde press +Ġde central +Ġde sert +Ġde ben +Ġde mek +Ġde struc +Ġde dik +Ġde ctate +Ġde klar +Ġde quip +Ġde activating +Ġde partement +Ġde activates +Ġde buging +Ġde serializing +Ġde uxième +Ġde chif +ine z +ine co +ine vit +ine gar +pro w +pro ot +pro pos +pro so +pro fil +pro position +pro dot +pro site +pro va +pro duc +pro ced +pro ofs +pro vj +pro vado +pro guard +pro prio +pro fess +pro logue +pro digal +pro digy +pro gess +est ad +est able +est ark +est ores +est Curve +est atico +0000 5 +0000 8 +0000 13 +0000 15 +0000 14 +0000 20 +0000 42 +0000 51 +0000 01110000 +0000 017 +0000 1010000 +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +Ġ""" % +Ġ""" + +Ġ""" @ +Ġ""" ## +Ġ""" ** +Ġ""" \" +Ġ""" ++++++++++++++++++++++++++++++++ +pt u +pt tion +pt ed +pt us +pt alk +pt Loss +pt race +pt onext +form Id +form style +form Grid +form ulario +form ismatch +ex X +ex b +ex d +ex f +ex w +ex db +ex now +ex groups +ex ceeded +ex haust +ex pel +ex cused +ex mods +ex ractor +ex ceeding +ex aminer +ex conly +Ġnot ably +im f +im ge +im ms +im ir +im ute +im odule +im sg +im Input +im medi +im Array +im atic +im ini +im Import +im Xy +im Paths +im balanced +im former +im sharp +im bab +Ġex a +Ġex ot +Ġex val +Ġex per +Ġex json +Ġex pop +Ġex amp +Ġex abel +Ġex ov +Ġex onic +Ġex erc +Ġex cepthook +Ġex changer +Ġex ascale +Ġex ercice +Ġex ibição +able By +able Tool +able Callback +able Iterator +able PPO +fig file +fig text +fig num +fig arch +Ġ3 999 +Ġ3 076 +Ġ3 011 +Ġ3 200 +Ġ3 000000 +Ġ3 1000 +Ġ3 256 +Ġ3 126 +Ġ3 0000000 +Ġ3 400 +Ġ3 193 +Ġ3 016 +Ġ3 456 +Ġ3 017 +Ġ3 013 +Ġ3 143 +Ġ3 250 +Ġ3 077 +Ġ3 034 +Ġ3 275 +Ġ3 151 +Ġ3 926 +Ġ3 240 +Ġ3 320 +Ġ3 078 +Ġ3 974 +Ġ3 329 +Ġ3 676 +Ġ3 019 +Ġ3 241 +Ġ3 473 +Ġ3 451 +Ġ3 090 +Ġ3 941 +Ġ3 1883 +args InText +10 300 +10 600 +10 401 +10 904 +10 857 +10 878 +10 223 +10 451 +10 754 +Ġprint ers +Ġprint String +Ġprint alert +Ġprint ables +Ġprint After +ase Config +ase cross +ect yper +ect ady +out T +out b +out c +out l +out form +out fig +out out +out row +out var +out of +out dim +out scale +out tree +out Color +out Cache +out Cols +out Globals +out Instant +out liar +out VoiceSeekbar +ow w +ow ard +ow ell +ow itz +ĠD X +ĠD n +ĠD re +ĠD type +ĠD ance +ĠD orm +ĠD ere +ĠD ock +ĠD PT +ĠD ies +ĠD ear +ĠD ome +ĠD DO +ĠD PI +ĠD EX +ĠD IP +ĠD PR +ĠD rain +ĠD ha +ĠD SO +ĠD ja +ĠD IF +ĠD CM +ĠD DD +ĠD RU +ĠD ah +ĠD ana +ĠD bd +ĠD PN +ĠD eng +ĠD DT +ĠD hw +ĠD DK +ĠD HI +ĠD GC +ĠD ONT +ĠD ETER +ĠD MF +ĠD PM +ĠD uy +ĠD FB +ĠD FG +ĠD rink +ĠD UMP +ĠD uels +ĠD emos +ĠD ulwich +ac u +ac at +ac ce +ac sc +ac ore +ac ces +ac dd +ac lient +ac map +ac cc +ac ular +ac gt +ac ão +ac orn +ac relation +ac dc +ac cesses +ac Current +ac ios +ac chi +ac cade +ac Voltage +ac quisitions +ac ımız +ac acag +ac MaxPower +Ġu P +Ġu h +Ġu data +Ġu file +Ġu ds +Ġu lic +Ġu Type +Ġu ids +Ġu dev +Ġu role +Ġu fp +Ġu clean +Ġu cf +Ġu Sensor +Ġu vic +Ġu Bel +Ġu IdxRegVal +Ġu Ctxs +Ġu sethreads +]) % +]) ` +]) ][ +]) \\ +]) (\ +]) ][" +]) }') +]) }' +]) [:- +]) ]} +]) [..., +]) +'. +]) }-{ +]) [:: +ert xt +ert rain +Re m +Re in +Re id +Re create +Re act +Re Comp +Re send +Re coder +Re marks +Re calibration +Re lief +Re confirm +Re mess +Re yk +Re conc +Re versing +Re constructed +Re lacion +Re cruit +Re ceptive +Re venus +Re inforcement +Re mediation +Re wF +Re finery +Re combining +ite ments +ite press +ite mprop +ite mpro +ite mia +ite erd +ite eritud +app t +app df +app db +app files +app Context +app Version +app hook +app lier +app lies +app arente +app rentice +app alachian +app reciation +sh am +sh ub +sh ms +sh atter +sh andler +sh bot +sh andle +sh na +sh Domain +sh kM +sh ih +sh IH +sh ëm +sh outout +ment Status +ment ação +ment Migration +ment aal +Ġdata F +Ġdata I +Ġdata description +Ġdata gram +Ġdata folder +Ġdata joint +Ġdata hot +Ġdata Batch +Ġdata sizes +Ġdata grams +Ġdata iterator +Ġdata gateway +Ġdata Center +Ġdata zoom +Ġdata Csv +Ġdata XZ +Ġdata sketch +Ġdata bse +Ġdata pssm +ĠM j +ĠM un +ĠM am +ĠM ile +ĠM are +ĠM ans +ĠM uth +ĠM np +ĠM ann +ĠM old +ĠM IM +ĠM yst +ĠM ong +ĠM DO +ĠM next +ĠM IP +ĠM ined +ĠM GR +ĠM ICs +ĠM SON +ĠM BL +ĠM ender +ĠM cd +ĠM MM +ĠM Ph +ĠM SO +ĠM AV +ĠM SP +ĠM SL +ĠM OM +ĠM dp +ĠM LD +ĠM allet +ĠM AI +ĠM ais +ĠM LF +ĠM bid +ĠM PG +ĠM RT +ĠM EB +ĠM ansion +ĠM LM +ĠM PJ +ĠM NI +ĠM cL +ĠM iser +ĠM ELL +ĠM iy +ĠM els +ĠM FM +ĠM MU +ĠM inta +ĠM SCO +ĠM ilit +ĠM obi +ĠM IPT +ĠM fcc +ĠM ASSE +ĠM APPING +ĠM eyer +ĠM tcnn +ĠM orphometrics +ĠM unkres +ĠM ORTALITY +ĠM oteur +nt ree +nt bus +nt ables +nt ılar +time me +time file +time parse +time Frame +time Index +time Point +time Cells +time Limit +time ctrl +time Execute +time Deleted +time OfDay +time stepping +time tric +time ofday +ĠNone x +oun i +oun ced +if c +if p +if lo +if ex +if are +if Type +if act +if names +if Table +if true +if ren +if cmd +if ae +if ctl +if fie +key val +key name +key string +key version +key values +key File +key String +key Resource +key Down +key frames +key NodeData +lab a +lab dir +lab script +lab oratory +xf en +xf de +xf ct +xf co +xf ck +xf es +xf ds +xf ff +xf ak +xf av +xf fa +xf be +xf bs +xf act +xf fg +xf cl +xf bl +xf chl +ror i +čĊĠĠĠ č +=" & +=" | +=" ): +=" ** +=" ([ +=" (\ +=" .* +=" $\ +=" +" +=" ..." +=" (.+?) +=" {}:{}". +=" ðŁ§ł +Ġv H +Ġv le +Ġv type +Ġv list +Ġv len +Ġv print +Ġv ign +Ġv index +Ġv space +Ġv ain +Ġv ld +Ġv If +Ġv dot +Ġv med +Ġv mod +Ġv sm +Ġv Item +Ġv cd +Ġv yper +Ġv Min +Ġv ao +Ġv wave +Ġv amb +Ġv ê +Ġv gw +Ġv cx +Ġv rho +Ġv gain +Ġv Switch +Ġv lad +Ġv asp +Ġv indo +Ġv lil +Ġv ál +Ġv árias +Ġv rij +Ġv agrant +02 13 +02 100 +02 64 +02 88 +02 21 +02 000000 +02 42 +02 31 +02 79 +02 0101 +02 51 +02 192 +02 199 +02 600 +02 168 +02 175 +02 135 +02 896 +02 187 +02 178 +02 988 +02 276 +02 918 +02 368 +02 377 +02 865 +02 846 +02 085 +02 0300 +02 7777777778 +ew a +ew s +ew ed +ew idth +ew ell +ew ater +ew ka +ext ype +ext ure +ext ree +ext math +ext Top +ext Temp +ext Setup +ext Corner +ext PluginDescriptor +ext remes +ext ruder +ext ratrees +ext rems +ext RunDescriptor +Ġ_ \ +Ġ_ /| +Ġy B +Ġy D +Ġy g +Ġy pp +Ġy value +Ġy lab +Ġy ms +Ġy ard +Ġy ok +Ġy block +Ġy ell +Ġy std +Ġy bounds +Ġy bar +Ġy dm +Ġy sd +Ġy ummy +Ġy mu +Ġy Train +Ġy scatter +Ġy amb +Ġy Fail +Ġy Eval +Ġy ubi +Ġy Mean +Ġy Vertex +Ġy mw +Ġy acs +Ġy cbar +Ġy tilt +Ġy atim +Ġy Zn +Ġy versor +Ġy Intervalli +Ġy scrollcommand +Ġy wyz +Ġy adda +Ġy LocBomb +Ġnp m +Ġnp ol +Ġnp time +Ġnp utils +Ġnp adding +Ġnp lus +Ġnp runed +ĊĠ ĊĊ +ĊĠ ĊĊĠ +ĊĠ ĊĠĠ +ĊĠ ĉĉĉĉĉĉ +ĠO M +ĠO Q +ĠO m +ĠO o +ĠO st +ĠO de +ĠO sh +ĠO rc +ĠO go +ĠO TH +ĠO pc +ĠO system +ĠO ba +ĠO bit +ĠO PR +ĠO DS +ĠO GR +ĠO cr +ĠO ja +ĠO mar +ĠO uest +ĠO OC +ĠO aks +ĠO sf +ĠO BT +ĠO Tr +ĠO smo +ĠO omi +ĠO DEN +ĠO Correction +ĠO lof +ĠO BRACE +ĠO ued +ĠO SPF +ĠO SEO +ĠO LTP +ds x +ds um +ds file +ds out +ds max +ds LS +ds ourcing +ds witch +Ġ* & +Ġ* ; +Ġ* "+ +Ġ* âĢĺ +Ġ* /*', +Ġ* -* +Ġpar al +Ġpar tion +Ġpar is +Ġpar ler +Ġpar ries +Ġpar ked +Ġpar king +Ġpar alla +Ġpar alist +Ġpar fait +Ġpar cellation +Ġpar celas +Ġx Q +Ġx in +Ġx sel +Ġx ue +Ġx ent +Ġx te +Ġx val +Ġx str +Ġx end +Ġx right +Ġx Data +Ġx rc +Ġx iter +Ġx yp +Ġx cp +Ġx Table +Ġx left +Ġx delta +Ġx body +Ġx ero +Ġx encode +Ġx dm +Ġx vars +Ġx Label +Ġx units +Ġx LC +Ġx pdf +Ġx vals +Ġx Length +Ġx ways +Ġx SP +Ġx Train +Ġx Range +Ġx slice +Ġx scatter +Ġx align +Ġx prec +Ġx gp +Ġx Offset +Ġx Cells +Ġx Draw +Ġx Vertex +Ġx mr +Ġx Center +Ġx pan +Ġx mh +Ġx tilt +Ġx Lg +Ġx DNN +Ġx ephem +Ġx versor +Ġx Crypt +Ġx hats +Ġx Punct +Ġx liff +Ġx itorch +Ġx inshuo +os l +os ge +os mo +os sed +os ml +os ible +os urface +os mu +os iton +os isoft +os kedastic +Ġse ma +Ġse bu +Ġse net +Ġse be +Ġse ams +Ġse pc +Ġse si +Ġse bi +Ġse pare +Ġse ura +Ġse maphore +Ġse venth +Ġse aport +Ġse qlenth +Ġma f +Ġma gs +Ġma ix +Ġma pb +Ġma Txt +Ġma gna +Ġma xtruth +Ġma anged +Ġma elstrom +Ġma ingui +ĊĠĠĠĠĠ ĊĠĠĠĠĠĠ +que v +que ta +que io +que lon +que das +ack a +ack up +lass ian +test A +test B +test y +test id +test val +test object +test img +test dataset +test mode +test struct +test String +test Ref +test Map +test Matrix +test helper +test Collection +test Acc +test Runner +test Labels +test harness +test Digits +test aid +test Tpro +test Tpos +test ResourceMap +Ġor ds +Ġor ang +Ġor json +Ġor ignal +Ġwith args +Ġwith Header +Ġwith Display +Ġwith Geom +Ġwith Ens +add end +add ock +add Text +add angle +add Class +add rule +add ends +add nodes +add Button +add Var +add Row +add Filter +add Plot +add Cell +add Loop +add Div +add Database +add Parent +add Curve +add Arguments +add Anchor +add Changes +add Buttons +add Legend +add Roles +add Jnt +add endum +add tobin +add BytesToCode +add orment +Ċĉĉ ĊĠĠĠĠĠĠĠ +Ċĉĉ Ċĉĉĉ +Ċĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +[" ../ +ER OW +ER NR +ER EQ +ER EZ +ER ZEL +ER CKB +ER ASED +IN B +IN P +IN DE +IN ATE +IN OUT +IN CR +IN SN +IN CAR +IN FK +IN FRA +IN COMPATIBLE +IN DEPENDENT +IN CLUSION +IN VOKE +Ġstr util +Ġstr Port +Ġstr End +Ġstr anger +Ġstr LogPath +Ġstr ategic +xe F +xe J +xe i +xe at +xe le +xe an +xe as +xe ab +xe am +xe ex +xe bo +xe fo +xe ay +xe ak +xe be +xe cp +xe ca +xe aw +xe ba +xe az +xe af +xe Bw +xe Jx +.. , +.. ]) +.. ._ +.. ...", +Ġel ts +Ġel pi +Ġel yra +xb p +xb ot +xb el +xb bu +xb ec +xb ay +xb db +xb output +xb bs +xb ai +xb af +xb tw +ange lo +ange li +ange ls +ure up +ure Count +ure qs +ure nce +1111 12 +1111 101 +1111 65 +1111 101111 +1111 1011101 +mple ted +load Dir +load DLL +load balancing +load SubSection +ore ms +ore Äĩ +ore feicao +ore alistic +ms me +ms key +ms ys +ms ft +ms ou +ms result +ms coco +ms xm +ms pecies +Ġ% }] +Ġ% },{ +Ġme q +Ġme lo +Ġme ll +Ġme tab +Ġme dn +Ġme hr +Ġme taname +ON N +ON CO +ON DIS +ON LOAD +---------------- -") +---------------- ------------") +tra di +tra sp +tra versed +tra itlets +tra intype +tra jectroy +tra itements +ance And +Ġfile data +Ġfile lib +Ġfile start +Ġfile state +Ġfile io +Ġfile manager +Ġfile imp +Ġfile Map +Ġfile pattern +Ġfile Found +Ġfile Location +Ġfile Exists +Ġfile Servers +Ġfile LastModified +Ġfile ToRetain +Ġfile togenerate +Ġfile VList +our land +Ġpro iz +Ġpro log +Ġpro pi +Ġpro uct +Ġpro ud +Ġpro fil +Ġpro ving +Ġpro dy +Ġpro ced +Ġpro fits +Ġpro vj +Ġpro ceso +Ġpro medio +Ġpro spective +Ġpro ficiencies +Ġpro geny +Ġpro iek +Ġpro iect +ens g +ens al +ens ore +ens ord +py q +py u +py ss +py val +py str +py sc +py dir +py bin +py fa +py File +py cell +py dot +py clean +py gpu +py gamma +py reader +py cred +py dy +py dig +py dense +py excel +py arrow +py probe +py guide +py demic +py scaffold +py zmq +py duino +py cbc +py rcc +py eem +py flakes +py ensembl +py instapaper +py exo +py docteur +py qbdi +py cocotools +py Mez +py cpdflib +py medphys +py elftools +py armnn +py zbar +art plug +xc an +xc ce +xc ad +xc co +xc di +xc ab +xc ci +xc bo +xc ft +xc ag +xc dd +xc do +xc bg +xc cl +xc lim +xc ba +xc dt +xc TE +xc aa +xc zu +xc lusive +pre q +pre te +pre sponse +pre ader +pre feat +pre pl +pre mask +pre loaded +pre ench +pre Sum +pre jection +pre Register +pre conditions +pre ste +pre attention +pre fers +pre serves +pre calculated +pre gunta +pre alm +pre mier +pre RegistrationInline +pre decessor +ls bu +ls bs +ls ru +ls NContent +ls Ijo +ap w +ap en +ap ses +ap stra +ap ilar +ap rg +ap itools +ap tepc +ap opto +ap imatic +07 34 +07 38 +07 175 +07 301 +07 315 +07 176 +07 908 +07 964 +07 236 +07 288 +07 436 +07 987 +07 303 +07 364 +07 902 +07 875 +07 956 +07 577 +07 213 +07 474 +07 279 +ang ar +ang ere +ang ulation +ang rot +ang olo +ang won +xd m +xd ct +xd di +xd ap +xd ay +xd fa +xd ai +xd cp +xd cl +xd fe +xd ca +xd cd +xd zs +xd fff +label ss +label Name +label color +label ler +label Col +label Mat +label Font +atch ing +ES g +ES un +ES kM +ES erver +ES ERVICES +ber i +ber ra +ber ang +Ġbe ad +Ġbe ch +Ġbe cu +Ġbe press +Ġbe lie +are x +are z +are ach +are ns +are mba +Ċĉ ĠĠĠĠĠĠĠĠĠĠ +"] - +"] '. +"] ])) +"] }" +"] ]], +"] [:- +"] }} +"] += +"] '))) +"] },{ +ĠB Z +ĠB n +ĠB un +ĠB id +ĠB ic +ĠB am +ĠB om +ĠB oun +ĠB ray +ĠB ok +ĠB ast +ĠB ark +ĠB row +ĠB ron +ĠB ale +ĠB ING +ĠB LO +ĠB UR +ĠB org +ĠB ash +ĠB MP +ĠB EL +ĠB SS +ĠB AY +ĠB ALL +ĠB oid +ĠB ender +ĠB tn +ĠB orn +ĠB hi +ĠB aker +ĠB lec +ĠB ATT +ĠB Bot +ĠB ever +ĠB asset +ĠB orders +ĠB inja +ĠB hard +ĠB abe +ĠB OID +ĠB ASES +ĠB erry +ĠB tst +ĠB rew +ĠB INS +ĠB undles +ĠB eni +ĠB urk +ĠB ICON +ĠB ivariate +ĠB anc +ĠB dil +ĠB orrow +ĠB rake +ĠB ENCH +ĠB oris +ĠB URS +ĠB IAC +ĠB lotter +ĠB ndBox +ĠB ranco +ĠB ryan +ĠB achelor +ĠB PDN +ĠB hattach +ĠB ishop +ĠB rierScore +ĠB ắc +ĠB airro +ĠB entley +ĠB csApiClient +ĠB ofeng +ĠB uryat +ĠB etRound +Ġos u +Ġos pe +Ġos bot +Ġos gb +Ġos vol +Ġos container +12 923 +12 43 +12 81 +12 202 +12 211 +12 218 +12 295 +12 129 +12 360 +12 576 +12 289 +12 9999999 +12 054 +12 443 +12 2736 +Ġname size +Ġname ID +Ġname of +Ġname Output +Ġname parts +Ġname Match +Ġname servers +Ġname chars +ys W +ys X +ys j +ys pec +ys imple +ys lam +ĠE O +ĠE k +ĠE at +ĠE co +ĠE ch +ĠE ph +ĠE scri +ĠE da +ĠE ip +ĠE sk +ĠE map +ĠE mpl +ĠE AB +ĠE nn +ĠE MO +ĠE qui +ĠE VER +ĠE gor +ĠE lex +ĠE vals +ĠE fr +ĠE GO +ĠE merge +ĠE UI +ĠE rf +ĠE mul +ĠE IGHT +ĠE UG +ĠE lite +ĠE quality +ĠE OC +ĠE special +ĠE YE +ĠE jected +ĠE OG +ĠE LM +ĠE priv +ĠE BAD +ĠE KS +ĠE WM +ĠE Ps +ĠE ACH +ĠE OA +ĠE rin +ĠE mir +ĠE PUB +ĠE KF +ĠE labor +ĠE EMD +ĠE fet +ĠE VERY +ĠE AGAIN +ĠE motions +ĠE CDH +ĠE rosion +ĠE tiqueta +Ġj lo +Ġj un +Ġj ul +Ġj pp +Ġj as +Ġj up +Ġj type +Ġj sk +Ġj stat +Ġj ids +Ġj uni +Ġj ones +Ġj ó +Ġj ä +Ġj ij +Ġj ade +Ġj dbc +Ġj tup +Ġj unto +Ġj orgs +Ġj ailer +Ġj oka +Ġj eden +Ġj Exam +Ġj alap +Ġj fieldID +Ġj iosa +Ġj usqu +Ġj shbot +._ -]+\.[ +ime i +ime ssage +ime tro +ime dean +ci O +ci P +ci ma +ci ag +ci ence +ci ante +ci lia +ci vil +ci liation +ci lieg +ci vilian +ob c +ob la +ob io +ob bi +ob spy +ob ras +ob serving +ob rig +ob lox +ob raine +ob soletes +""" ' +""" @ +""" [ +""" ` +""" .. +""" `` +""" **************************************************************** +wor n +wor de +Ġ< ! +Ġ< " +Ġ< [ +Ġ< ==== +Ġ< <<<< +ly q +ly x +ly z +ly an +ly Error +text C +text color +text ual +text files +text Content +text ura +text classification +text Score +text dlg +text Orig +text SecondScreen +text dbPil +AT Z +AT ON +AT ree +AT PT +AT TY +AT ABLE +AT IV +AT ACCA +AT CAAC +AT CHED +Ġ) (" +Ġ) ** +Ġ) .', +Ġ) ][" +Ġ) [:- +Ġ) &\ +Ġ) #. +Ġ) ?(? +xa al +xa co +xa ff +xa io +xa udio +xa Lh +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +low n +low ers +low freq +low Depth +low Controls +low aÄĩ +size pixel +size Opt +size Sequential +čĊĠĠĠĠĠĠĠ čĊčĊĠĠĠĠĠĠĠ +com une +com ico +com addon +com andi +com Pers +com bustion +model c +model net +model grid +model Description +model fields +model Json +model ctrl +ans sen +ans JP +ĠN f +ĠN h +ĠN m +ĠN p +ĠN ic +ĠN ist +ĠN res +ĠN os +ĠN ob +ĠN AR +ĠN ations +ĠN CT +ĠN ich +ĠN ong +ĠN lim +ĠN PU +ĠN INE +ĠN ME +ĠN vars +ĠN BO +ĠN OK +ĠN obs +ĠN OB +ĠN hi +ĠN rf +ĠN DA +ĠN aj +ĠN ina +ĠN HD +ĠN MI +ĠN CHAN +ĠN omin +ĠN ATURE +ĠN BT +ĠN adam +ĠN FW +ĠN SQ +ĠN leaves +ĠN GIN +ĠN yd +ĠN vidia +ĠN amen +ĠN ADC +ĠN vim +ĠN ATS +ĠN Phases +ĠN acional +ĠN NTPT +ĠN uclideResult +date Type +date parse +date parser +date To +date page +date tuple +date From +date AndTime +}, } +}, ". +}, {}". +ir f +ir k +ir reg +ir tt +ir sym +ir nov +len P +len e +len q +len ce +len um +len ded +len pass +len tities +num u +num list +num files +num Variable +num VS +num Left +num cores +num Vertex +num loops +num ubar +num Cpu +num Trees +num ComboBox +num Stem +num Recurrent +num ITEMS +num Timeouts +num Pts +num Splits +num ransacs +num erix +num doclint +Ġres n +Ġres num +Ġres Start +Ġres End +Ġres umption +Ġres peci +Ġres umo +Ġres peaker +user ns +user command +user bar +user tool +user Account +user bw +user RoleMethod +user HoldMohAudioSourceId +bo ch +bo ck +bo us +bo ses +bo obs +bo vl +bo oli +bo oru +Ġ4 001 +Ġ4 404 +Ġ4 127 +Ġ4 102 +Ġ4 567 +Ġ4 456 +Ġ4 027 +Ġ4 936 +Ġ4 687 +Ġ4 360 +Ġ4 086 +Ġ4 244 +Ġ4 320 +Ġ4 072 +Ġ4 979 +Ġ4 571 +ger ar +ger al +ger ino +ff u +ff ast +ff ler +ff tf +Ġassert py +Ġassert Equality +Ġget Q +Ġget X +Ġget val +Ġget data +Ġget frame +Ġget score +Ġget Frame +Ġget Exception +Ġget URL +Ġget Group +Ġget Auth +Ġget Token +Ġget Process +Ġget Module +Ġget Row +Ġget gamma +Ġget signal +Ġget Red +Ġget Property +Ġget Top +Ġget dirs +Ġget submit +Ġget Cmd +Ġget Conf +Ġget members +Ġget Real +Ġget Record +Ġget Header +Ġget failed +Ġget Global +Ġget Active +Ġget Tool +Ġget Hub +Ġget Report +Ġget Root +Ġget Used +Ġget Support +Ġget Labels +Ġget Camera +Ġget Tick +Ġget Messages +Ġget Figure +Ġget Finished +Ġget Accuracy +Ġget Answer +Ġget Fbx +Ġget Best +Ġget Filters +Ġget Oj +Ġget Final +Ġget Ts +Ġget ConfigEntry +Ġget Tip +Ġget Visible +Ġget Comments +Ġget Materials +Ġget Vir +Ġget Predictions +Ġget TapeSites +Ġget Ends +Ġget WCS +Ġget SfpCmd +Ġget Perceptual +Ġget Annealing +Ġget pwnam +Ġget Accel +Ġget JobDocument +Ġget ClusterInfo +Ġget Faq +Ġget AccSfpCmd +Ġget AccQSfpCmd +Ġget NimbusConf +Ġget NtwQSfpCmd +Ġget errortext +Ġget doubleword +lu v +lu ce +lu cent +lu cente +dir n +dir ver +dir log +dir list +dir tree +92 10 +92 100 +92 21 +92 54 +92 41 +92 51 +92 033 +92 206 +92 232 +92 132 +92 147 +92 207 +92 908 +92 964 +92 287 +92 903 +92 897 +92 646 +92 565 +92 867 +92 818 +92 858 +92 2577 +92 0194 +tp at +tp ot +tp ip +tp anel +col w +col in +col lo +col um +col type +col no +col gate +col lar +col ums +col mA +col unas +col lins +col lage +In J +In l +In dic +In Or +In Map +In Project +In sts +In stitute +In Given +In Scope +In duces +In die +In lined +In Pending +In capac +In Shutdown +In equality +In ês +In scre +In quirer +In stitutions +In ProcessKernel +In esistente +In Stones +In fection +In gredients +In scritos +======== ') +ind ro +ind Id +ind onesian +ind uctive +append s +append ing +append able +append To +lot l +lot y +lot ti +lot lib +lot win +ĠR ss +ĠR um +ĠR ho +ĠR ise +ĠR ip +ĠR ings +ĠR IC +ĠR ave +ĠR ive +ĠR ong +ĠR ai +ĠR ost +ĠR idd +ĠR ays +ĠR iddle +ĠR PUT +ĠR ado +ĠR CI +ĠR oo +ĠR uler +ĠR pipeline +ĠR ough +ĠR isco +ĠR tl +ĠR TS +ĠR anks +ĠR ica +ĠR MON +ĠR Adam +ĠR yu +ĠR ND +ĠR Bucket +ĠR arity +ĠR BV +ĠR PAREN +ĠR SHIFT +ĠR CX +ĠR alph +ĠR ifle +ĠR iding +ĠR ISCV +ĠR UCK +ĠR ibre +ĠR oland +ĠR oughly +ĠR ANSAC +ĠR UNTIMES +ĠR Äĥzboi +ĠR ussia +ĠR apptz +ĠR ÃŃos +mo i +mo q +mo or +mo lo +mo am +mo ser +mo ses +mo ids +mo ose +mo vs +mo uel +mo ya +mo cha +mo jom +ep ot +ep ab +ep num +ep ass +ep File +ep By +ep iso +ep ney +ep isodic +ray ids +ray tracing +Ġun list +Ġun doc +Ġun match +Ġun clean +Ġun vec +Ġun bind +Ġun sync +Ġun cover +Ġun squeeze +Ġun shared +Ġun processed +Ġun serialize +Ġun met +Ġun ivers +Ġun reason +Ġun filled +Ġun rolling +Ġun colored +Ġun rated +Ġun mapped +Ġun expanded +Ġun encrypted +Ġun typed +Ġun restricted +Ġun important +Ġun till +Ġun bookmark +Ġun muted +Ġun feasible +Ġun sharp +Ġun standardi +Ġun shifted +Ġun identified +Ġun tested +Ġun marshal +Ġun successfully +Ġun pickled +Ġun lucky +Ġun tapp +Ġun versioned +Ġun subscribed +Ġun settled +Ġun intended +Ġun methylated +Ġun subscribing +Ġun escaper +Ġun ikal +Ġun usual +OR ADO +OR AIRES +OR DIAL +fo i +fo gb +ule y +ule gaard +read x +read from +read os +read len +read wise +read Line +read Bytes +read Buffer +read Word +read YAML +read ahead +read Excel +read NodeFile +read ConfigurationFile +Ġtest a +Ġtest o +Ġtest es +Ġtest user +Ġtest net +Ġtest fn +Ġtest samples +Ġtest Client +Ġtest Mode +Ġtest Code +Ġtest Ref +Ġtest opts +Ġtest Range +Ġtest dirs +Ġtest arguments +Ġtest Collection +Ġtest Timeout +Ġtest Execute +Ġtest Pairs +Ġtest Pred +Ġtest oot +ument s +lic ize +lic ited +Ġlog M +Ġlog T +Ġlog list +Ġlog step +Ġlog err +Ġlog tools +Ġlog Info +Ġlog returns +Ġlog Offset +Ġlog ica +Ġlog FileName +Ġlog StreamName +Ġlog fgas +Ġlog sumexp +Ġlog MoneynessTensor +32 20 +32 214 +32 164 +32 232 +32 296 +32 334 +32 422 +32 903 +32 396 +32 924 +32 052 +per it +per to +per ry +per cept +per sed +per ish +per mut +per fm +per Monkey +per ché +per corso +per messo +oc x +oc ated +oc hem +oc ente +oc cipital +ph D +ph at +ph is +ph op +ph am +ph ne +ph ps +ph ash +ph ins +ph inf +ph ages +ph onto +ph MJ +ph ishing +ph ssum +ph oronix +son er +son line +son uc +son Printer +son printer +// @ +// :. +// {}. +ĠG b +ĠG lo +ĠG ert +ĠG tp +ĠG ated +ĠG nd +ĠG ates +ĠG loss +ĠG cp +ĠG ia +ĠG oo +ĠG ros +ĠG CR +ĠG TC +ĠG orn +ĠG FLO +ĠG LS +ĠG att +ĠG ua +ĠG ems +ĠG MAIL +ĠG PA +ĠG arc +ĠG ye +ĠG OFF +ĠG reet +ĠG NG +ĠG OVER +ĠG AIL +ĠG uy +ĠG eral +ĠG bps +ĠG esti +ĠG FZ +ĠG LOSS +ĠG aga +ĠG OV +ĠG GGG +ĠG oric +ĠG lenn +ĠG aza +ĠG oren +ĠG UNICORN +ĠG eyer +ĠG TFS +ĠG lorot +ĠG esam +ces k +ces ar +ces ary +ces itKenar +Ġco h +Ġco at +Ġco le +Ġco te +Ġco ck +Ġco sh +Ġco lab +Ġco hes +Ġco expression +Ġco variate +Ġco RNN +Ġco ulomb +Ġco CardType +Ġco CardNum +Ġco CardDesc +Ġco arsen +Ġco uleurs +Ġco isas +Ġon load +Ġon End +Ġon Site +Ġon Bit +Ġon critical +Ġon Payment +Ġon vif +Ġon offglides +Ġtype v +Ġtype checker +Ġtype hints +Ġtype guard +format Seconds +EN ROLL +EN ANE +ĠW A +ĠW m +ĠW on +ĠW an +ĠW ort +ĠW and +ĠW ir +ĠW ag +ĠW ide +ĠW ong +ĠW HO +ĠW EST +ĠW mag +ĠW MC +ĠW ish +ĠW MODE +ĠW pa +ĠW ired +ĠW ond +ĠW arc +ĠW IFI +ĠW raps +ĠW LAN +ĠW sgi +ĠW ELL +ĠW BOX +ĠW KHTML +ĠW ildcard +ĠW AVE +ĠW ANN +ĠW QX +ĠW anna +ĠW arden +ĠW AKE +ĠW RMSE +ĠW urst +ĠW itt +ĠW inkler +ĠW inkel +ĠW ALIKI +ĠW LNS +ĠW YSI +ĠW ATCHED +tri os +tri ax +tri med +ho ot +ho ve +ho isted +ho ffset +ho ehner +ity ta +ity Element +loc version +loc culation +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +url split +url match +url vir +url åľ°åĿĢ +url unsplit +url brevity +Ġout F +Ġout L +Ġout h +Ġout val +Ġout ers +Ġout row +Ġout Log +Ġout dim +Ġout folder +Ġout Class +Ġout edges +Ġout wards +Ġout fd +Ġout links +Ġout Files +Ġout FileName +Ġout Cols +Ġout anns +Ġout FMatch +Con ti +Con ce +Con test +Con ll +Con so +Con duct +Con fid +Con ferences +Con fidential +Con centrations +Con tributed +Con teúdo +Con dição +Ġlen p +Ġlen buf +Ġlen Pattern +Ġlen gend +bu dg +bu cks +bu ono +bu Ä¡ +AR CO +AR ET +AR OB +AR CS +AR IA +AR MED +AR Cfg +AR PEN +AR IMA +ĠV it +ĠV low +ĠV ener +ĠV cs +ĠV UT +ĠV api +ĠV DI +ĠV SI +ĠV ie +ĠV ous +ĠV PR +ĠV Group +ĠV END +ĠV SD +ĠV DF +ĠV LC +ĠV NC +ĠV shared +ĠV illa +ĠV õ +ĠV otes +ĠV OX +ĠV Ps +ĠV AO +ĠV scf +ĠV egas +ĠV allon +ĠV ét +ĠV OUCH +ĠV liet +ĠV MTK +ĠV lillirier +ĠV bscript +ĠU G +ĠU L +ĠU d +ĠU h +ĠU k +ĠU pp +ĠU graph +ĠU MA +ĠU Values +ĠU OS +ĠU bi +ĠU SM +ĠU DT +ĠU hr +ĠU funcs +ĠU RP +ĠU lti +ĠU Tuning +ĠU PTIME +ĠU ValueList +code pro +code Names +code Points +code mirror +code gens +ry a +ry w +ry hof +dict attr +dict Of +dict Service +dict Words +dict Chars +Ġnum ang +Ġnum len +Ġnum Comp +Ġnum lim +Ġnum bits +Ġnum Ver +Ġnum CN +Ġnum tables +Ġnum Bytes +Ġnum Parameters +Ġnum Active +Ġnum Features +Ġnum TK +Ġnum RK +Ġnum Hs +Ġnum Layers +Ġnum Complete +Ġnum brid +Ġnum bnd +Ġnum Processes +Ġnum éri +Ġnum ITEMS +Ġnum Quotes +Ġnum Profiles +Ġnum Queued +Ġnum Reps +Ġnum Bags +Ġnum Decs +Ġvalue Arr +Ġvalue BTC +print info +print State +param file +param class +param string +param dim +param Panel +param touch +Ġ5 025 +Ġ5 006 +Ġ5 195 +Ġ5 896 +Ġ5 284 +Ġ5 228 +Ġ5 640 +Ġ5 262 +Ġ5 1301 +Ġ5 1300 +Ġ5 1006 +Ġhe y +Ġhe cho +Ġhe bb +Ġhe aves +Ġhe lix +Ġhe IPP +Ġhe sab +Ġhe xbin +Ġhe xbytes +Ġhe aviside +Ġhe ksher +Ġhe xtream +mb s +mb z +mb ad +mb ab +mb art +mb io +mb box +mb ia +mb rl +mb tiles +mb logthumb +). '%( +ib en +ib ert +ib bert +ib Scale +ib eB +ib orne +ib auer +ib ullet +ape uti +Ġan um +Ġan ex +Ġan ty +Ġan ton +Ġan non +Ġan ivers +Ġan alizar +Ġan isotropic +Ġan omalous +Ġan álisis +Ġan tpat +Ġ__ _\ +Ġ__ ___| +Ġfrom to +Ġfrom key +Ġfrom Node +Ġfrom Task +Ġfrom JSON +Ġen de +Ġen is +Ġen orm +Ġen ery +Ġen vo +Ġen ities +Ġen closure +Ġen kon +Ġen laces +Ġen contr +Ġen closures +ise uil +ise mail +ire view +ard ab +ard are +ard ummy +che y +che mis +che mpy +che wing +che zza +che aron +min es +min ers +min len +min Time +min Point +min cost +min month +min Width +min Vector +min uit +min pix +min ante +min Limit +min Cost +min payment +min inode +min ole +min elv +min imizer +min utiae +999 86 +999 47 +999 800 +999 892 +ator es +ator ie +IT U +IT ATION +IT MS +IT TER +IT VAE +Ġtime file +Ġtime point +Ġtime List +Ġtime eval +Ġtime diff +Ġtime sec +Ġtime DT +Ġtime tracking +Ġtime Slice +Ġtime stepper +Ġtime vortex +Ġtime stepping +Ġtime traSAS +Ġtime ToFloat +Error To +Error Model +Error String +Error Event +Error Factory +Error Mixin +Error Counter +Error Information +Error Reset +Error Wrap +scri m +scri bble +scri vere +Ġ> ] +Ġ> ", +Ġ> ___ +18 076 +18 90 +18 80 +18 012 +18 915 +18 208 +18 232 +18 964 +18 287 +18 932 +18 876 +18 454 +18 2278 +16 07 +16 076 +16 41 +16 033 +16 004 +16 400 +16 205 +16 232 +16 174 +16 023 +16 284 +16 288 +16 088 +16 354 +16 383 +16 071 +16 5500 +16 2902 +16 1104 +Ġlist A +Ġlist B +Ġlist i +Ġlist file +Ġlist key +Ġlist Array +Ġlist All +Ġlist SN +Ġlist Val +Ġlist Files +Ġlist members +Ġlist setpass +line Y +line a +line up +line with +line Name +line color +line ins +line Color +line ares +line plus +line Ct +line Ordering +line loadings +True Color +True QStar +coun ta +array gen +array Factor +ft d +ft se +ft conditions +sa I +sa o +sa ggio +sa kai +sa idas +sa hedron +sa voie +sa wyer +cur f +cur file +cur Dir +cur pairs +cur tis +cur SaImagePatientNum +da V +da u +da ct +da um +da ab +da os +da ha +da vin +da mak +da maging +'), \ +Ġk J +Ġk T +Ġk in +Ġk to +Ġk lu +Ġk result +Ġk cal +Ġk ont +Ġk off +Ġk iss +Ġk tx +Ġk med +Ġk bit +Ġk tk +Ġk ares +Ġk ali +Ġk vectors +Ġk yu +Ġk urt +Ġk agit +Ġk ää +Ġk amaelia +Ġk atalog +Ġk sclient +Ġk azoo +Ġk uvv +Ġk amus +Ġk aitai +Ġk pobjs +Ġk undu +Ġk ết +Ġk ripp +Ġcol w +Ġcol val +Ġcol num +Ġcol map +Ġcol Num +Ġcol dest +Ġcol Count +Ġcol lie +Ġcol lins +Ġcol lided +25 199 +25 400 +25 234 +25 203 +25 277 +25 986 +25 877 +25 428 +25 443 +(): ") +Ġro pe +Ġro jo +Ġro dz +St V +St k +St ark +St ability +St ategy +St amen +St mts +St argate +St abilize +Ġpy q +Ġpy ver +Ġpy path +Ġpy ta +Ġpy df +Ġpy db +Ġpy md +Ġpy ns +Ġpy norm +Ġpy cord +Ġpy Test +Ġpy td +Ġpy mer +Ġpy ats +Ġpy seed +Ġpy inst +Ġpy cf +Ġpy js +Ġpy compat +Ġpy pa +Ġpy cred +Ġpy route +Ġpy ina +Ġpy micro +Ġpy lb +Ġpy NT +Ġpy ftp +Ġpy Tool +Ġpy obo +Ġpy ech +Ġpy bat +Ġpy ln +Ġpy SPACE +Ġpy contacts +Ġpy bam +Ġpy pcd +Ġpy spi +Ġpy quaternion +Ġpy rsa +Ġpy wifi +Ġpy tmx +Ġpy httpd +Ġpy ingest +Ġpy amf +Ġpy CMB +Ġpy cbf +Ġpy cairo +Ġpy caret +Ġpy jokes +Ġpy gmsh +Ġpy SIR +Ġpy corrector +Ġpy fora +Ġpy tai +Ġpy montecarlo +Ġpy exo +Ġpy keops +Ġpy trek +Ġpy medphys +Ġpy jsparser +Ġpy covjson +Ġpy embroidery +Ġpy frechet +Ġpy iom +Ġpy teamup +Ġpy BigWig +Ġpy chpp +Ġpy logview +config db +config ID +config Name +config Info +config Button +config FilePath +Ġ6 07 +Ġ6 22 +Ġ6 27 +Ġ6 200 +Ġ6 83 +Ġ6 67 +Ġ6 68 +Ġ6 144 +Ġ6 373 +Ġ6 2995 +Ġ6 396288 +lt l +lt en +Ġset size +Ġset default +Ġset Text +Ġset Id +Ġset types +Ġset Status +Ġset host +Ġset Level +Ġset New +Ġset Red +Ġset Property +Ġset attrs +Ġset Args +Ġset Left +Ġset Right +Ġset Weight +Ġset Angle +Ġset LogLevel +Ġset Reward +Ġset Brightness +Ġset Scenario +Ġset recursionlimit +Ġset Teams +Ġset distroname +ener ge +ag p +ag os +ag ire +ag ence +ag ulation +ag rees +ag uer +ag ono +ag ésimo +ag osto +ag gggg +ag ayan +ump ur +ump Exception +ts H +ts f +ts ib +ts utils +ts io +ts Num +ts ks +ts ync +ts lice +ts fdye +http c +http version +http auth +04 100 +04 96 +04 36 +04 56 +04 98 +04 400 +04 216 +04 234 +04 301 +04 132 +04 897 +04 364 +04 181 +04 409 +04 248 +04 219 +04 866 +04 928 +04 228 +04 356 +04 3478 +04 2800 +04 2160 +04 5600 +04 93827 +Ġmodel Dir +Ġmodel cov +Ġmodel KeysSet +13 0000 +13 100 +13 80 +13 101 +13 70 +13 033 +13 404 +13 132 +13 134 +13 145 +13 017 +13 647 +13 845 +13 856 +13 088 +13 674 +13 569 +13 1045 +13 1217 +og s +og x +og an +og ui +og lion +og litazone +og loski +og osml +lib net +lib Config +lib Path +lib cache +lib mc +lib ars +lib pg +lib jpeg +lib usb +lib mkl +lib apprun +lib resolv +lib gdk +lib pulseaudio +lib zyre +lib ressl +06 0000 +06 16 +06 88 +06 27 +06 96 +06 923 +06 28 +06 101 +06 89 +06 62 +06 300 +06 41 +06 69 +06 205 +06 175 +06 384 +06 193 +06 208 +06 905 +06 203 +06 196 +06 007 +06 427 +06 209 +06 946 +06 407 +06 393 +06 434 +06 342 +06 3846 +06 2616 +06 2200 +06 25755 +Ġwh ist +ll f +class ind +class group +class var +class fied +class Total +class Extractor +ign itions +ign atures +15 0000 +15 70 +15 40 +15 123 +15 224 +15 096 +15 334 +15 178 +15 237 +15 326 +15 988 +15 644 +15 309 +15 357 +15 965 +15 646 +15 977 +15 877 +15 978 +15 866 +15 246 +15 445 +15 442 +15 060 +lif u +lif ter +lif lower +SE K +SE Y +SE AT +SE MA +SE IR +SE LEX +SE Linux +SE ncoder +ST i +ST OL +ST SR +ST rial +ST ILL +ST XT +ST VQ +ST ALE +ST INGER +ST emplate +ST exture +ĠTrue RNG +ec p +ec let +ec sv +ec isionTree +ec centric +ec ticut +cept js +ace work +ace Stats +100 14 +100 27 +100 97 +100 50 +100 1000 +100 011011 +100 024 +100 011111 +100 1110000 +100 0100000000 +100 100101 +100 010100110 +max R +max T +max l +max abs +max Int +max diff +max Point +max rot +max month +max Sum +max Dist +max Iter +max It +max xyz +max XY +max Limit +max Speed +max slope +max Contour +max Rank +max Coin +max Radius +max Allowed +max readers +max Retries +max elv +max Assayed +max Attempts +max CpuCount +max ResultSize +max CodeLen +ass m +ass ol +ass able +ass ass +ass ai +ass ists +ass ia +ass istent +ass umption +ass itance +ass ibauer +05 03 +05 19 +05 23 +05 80 +05 000 +05 28 +05 201 +05 48 +05 73 +05 41 +05 51 +05 127 +05 205 +05 214 +05 906 +05 422 +05 987 +05 385 +05 386 +05 355 +05 466 +05 877 +05 985 +05 219 +05 665 +05 399 +05 772 +05 2699 +05 2246 +Ġthis num +Ġthis Type +Ġthis comp +Ġthis step +Ġthis File +Ġthis Path +Ġthis Comp +Ġthis Sim +Ġthis Exp +Ġthis Tf +03 30 +03 48 +03 91 +03 025 +03 401 +03 104 +03 136 +03 403 +03 406 +03 422 +03 955 +03 687 +03 055 +03 555 +03 928 +03 044 +03 972 +orm ensal +Ġint u +Ġint Total +Ġint Const +Ġint tol +Ġint entions +Ġint repyd +False Positive +]. ' +cs n +cs y +cs go +cs olve +cs wrapper +cs money +cs strans +jo v +jo an +jo ao +jo hanna +we Q +we W +we Z +we g +we is +we ise +we Dg +we Dx +we Dz +uti en +uti co +uti fier +uti ves +uti liz +ip f +ip an +ip data +ip age +ip type +ip mi +ip ron +ip File +ip Version +ip kg +Ġop Level +Ġop tics +Ġop beat +Ġop tig +Ġop tima +Ġop acus +eld g +eld aten +train label +train Set +train stop +train Dataset +train Folder +train solv +Ġch w +Ġch al +Ġch List +Ġch ao +Ġch ama +Ġch asing +Ġch anger +Ġch rg +Ġch uang +Ġch ữ +Ġch adcode +Ġch isquare +Ġch arect +ax x +ax num +ax info +ax ml +ax Iterations +ax elrod +ĠĠĠĠĠĠ ĊĊ +ĠĠĠĠĠĠ čĊĠĠĠ +ĠĠĠĠĠĠ ĉĠĠĠĠĠ +17 32 +17 16 +17 101 +17 21 +17 31 +17 202 +17 404 +17 211 +17 150 +17 117 +17 299 +17 184 +17 188 +17 385 +17 565 +17 018 +17 648 +17 454 +17 671 +17 1875 +17 2475 +17 1394 +17 2596 +17 0906 +17 5855 +Ġal im +Ġal og +Ġal ters +Ġal dis +Ġal gorith +Ġal way +Ġal pn +Ġal tar +Ġal locator +Ġal bow +Ġal eph +Ġal phan +Ġal ır +Ġal inux +Ġal phanum +Ġal uminum +Ġal unos +Ġal imentos +dd H +dd c +dd ts +dd ress +dd do +dd raw +dd Th +dd dp +dd mList +93 19 +93 91 +93 73 +93 59 +93 115 +93 192 +93 384 +93 915 +93 305 +93 896 +93 016 +93 392 +93 309 +93 055 +93 302 +93 985 +93 576 +93 994 +93 665 +93 458 +93 1545 +valid Num +valid adeAnuncio +valid DataOperator +ĊĠĠĠĠĠĠĠĠĠ ĉĉ +lit re +lit ches +lit térature +14 19 +14 80 +14 69 +14 400 +14 384 +14 102 +14 537 +14 964 +14 445 +14 369 +14 562 +14 4675 +14 4808 +roup ier +ari ens +ari py +ari vo +ari amente +ari yla +Ġpre y +Ġpre cs +Ġpre check +Ġpre filter +Ġpre gn +Ġpre build +Ġpre position +Ġpre loop +Ġpre formed +Ġpre corpus +Ġpre ceed +Ġpre processors +Ġpre existing +Ġpre vention +Ġpre tal +Ġpre compiled +Ġpre ddf +Ġpre emphasis +Ġpre TestResult +Ġpre frontal +Ġpre mature +Ġpre mier +Ġpre scriptors +Ġresult Args +Ġresult ColumnName +uth era +ne W +ne ments +ne bag +ne berg +ne utrino +ne vents +ne ssione +ne arside +ne threitz +Ġ/ [ +Ġ/ ` +Ġ/ __/ +Ġ/ ___/\ +ord ado +Ġat ti +Ġat List +Ġat yp +Ġat rs +Ġat tract +Ġat ypical +Ġat mos +Ġat oi +Ġat mpro +Ġat oma +Ġat mlst +Ġat oolbox +Ġat taches +Ġat mfFuniMIB +ok lahoma +ok ogawa +Ġby r +Ġby Atom +Ġby passes +**** / +**** ") +vent y +64 14 +64 44 +64 45 +64 43 +64 21 +64 68 +64 69 +64 61 +64 0657 +64 567 +64 964 +64 426 +64 555 +64 067 +64 047 +64 653 +64 0394 +64 8834 +64 15926535 +right Port +right Count +right SM +right buff +right KerningGroup +Ġob p +Ġob sc +Ġob ses +index Name +index Search +error ed +error id +error list +error width +error Status +error Count +error codes +error Messages +enti er +enti el +enti ers +enti as +enti ane +enti tlement +Ġrange Type +Ġrange selector +Ġra f +Ġra k +Ġra ds +Ġra ces +Ġra mse +Ġra cog +Ġra isim +Ġra hav +Ġra cine +Ġra dicale +Ġra paz +Ġdefault username +Ġdefault Version +Ġdefault Lemmatizer +base Name +base store +base objects +base service +base Interval +base Points +base validators +Ġ[] ))) +ou fla +ou gou +([ % +([ (- +([ _( +([ -. +([ \' +([ "". +([ ],[],[ +gra p +gra il +gra us +gra cc +gra mbling +gra afia +gra veyard +076 19 +076 37 +076 54 +:// [ +:// {} +:// "), +:// `` +:// {}'. +:// [[ +:// *: +info Element +plot num +plot Key +plot Option +plot Array +plot Filename +plot Figure +plot Normalized +count values +count Lines +count CNot +iti zing +iti vos +LE A +LE V +LE AD +LE TH +LE Ge +LE AST +LE mitter +Type Def +Type As +Type Left +Type Validator +RE Z +RE PUT +RE VERS +RE VERSION +RE LS +RE PASS +RE CAP +RE BIN +RE QS +RE CALL +RE TEN +RE LIABILITY +RE PAIR +RE PRESENTATION +RE IRA +RE LAX +RE TRAIT +RE PAINT +RE HEN +RE UNICA +RE INFORCE +Ġtra x +Ġtra der +Ġtra sh +Ġtra iter +Ġtra ppy +join all +join style +IC B +IC P +IC AN +IC obj +IC ASS +08 93 +08 33 +08 36 +08 923 +08 23 +08 82 +08 81 +08 63 +08 41 +08 69 +08 297 +08 207 +08 299 +08 185 +08 426 +08 457 +08 235 +08 348 +08 998 +08 893 +08 674 +08 758 +08 481 +08 952 +08 8877 +08 1478 +08 20676 +argument type +main page +main Info +main hand +AN g +AN ION +AN INE +AN NE +AN CI +AN CHO +AN LLL +AN DBack +ty u +ty List +pi en +pi al +pi ate +pi xes +pi Ym +pi ombo +pi heptomino +pi oglitazone +22 90 +22 200 +22 30 +22 234 +22 032 +22 905 +22 225 +22 145 +22 932 +22 946 +22 312 +22 047 +22 476 +22 883 +Ġ\ ([ +Ġ\ '" +Ġ\ """" +Ġ\ _| +Ġ\ __/ +Ġ\ __| +Ġ\ -----------> +ust an +mand er +mand ato +Ġ. + +Ġ. , +Ġ. [ +Ġ. :: +Ġ. -. +Ġ. %%........%%....%%..%%.. +Ġ. ----.----- +ĠH Q +ĠH V +ĠH Z +ĠH un +ĠH il +ĠH iz +ĠH end +ĠH ER +ĠH ap +ĠH ob +ĠH AT +ĠH Type +ĠH AM +ĠH av +ĠH ED +ĠH PI +ĠH edge +ĠH DB +ĠH SC +ĠH su +ĠH FP +ĠH ASS +ĠH auto +ĠH oly +ĠH UE +ĠH AV +ĠH dl +ĠH dp +ĠH Loss +ĠH TS +ĠH RS +ĠH HA +ĠH Ãł +ĠH RF +ĠH RT +ĠH ARK +ĠH wp +ĠH SG +ĠH MAC +ĠH DL +ĠH enn +ĠH ubble +ĠH inge +ĠH aven +ĠH vac +ĠH indi +ĠH RP +ĠH Ignore +ĠH JD +ĠH utch +ĠH inch +ĠH HHH +ĠH ALF +ĠH imesis +ĠH ughes +ĠH ockey +ĠH ARBOR +ĠH arbour +ĠRe q +ĠRe ss +ĠRe fi +ĠRe count +ĠRe cre +ĠRe gress +ĠRe cr +ĠRe compute +ĠRe wards +ĠRe jection +ĠRe balance +ĠRe pas +ĠRe versed +ĠRe placement +ĠRe covered +ĠRe aching +ĠRe formatted +ĠRe corder +ĠRe paint +ĠRe mind +ĠRe vise +ĠRe arrange +ĠRe cession +ĠRe produced +ĠRe connaissance +ĠRe vient +ĠRe ynolds +ĠRe ktangel +ay ak +ay Scale +ay xyx +tain ed +sub d +sub res +sub code +sub dict +sub point +sub Text +sub box +sub models +sub space +sub item +sub event +sub files +sub block +sub package +sub unit +sub words +sub steps +sub actions +sub ways +sub actor +sub strings +sub daily +sub networks +sub loops +sub tabs +sub divide +sub sequent +sub pout +sub divisions +sub classed +Ġ{} $ +Ġ{} ( +Ġ{} > +Ġ{} ? +Ġ{} :: +Ġ{} )), +Ġ{} "). +Ġ{} ]\ +Ġ{} )} +Ġ{} )" +Ġ{} %\ +Ġ{} )], +Ġ{} !". +Ġ{} {}{} +Ġ{} ({} +Ġ{} >'. +Ġ{} ]'. +Ġ{} ({})". +odule s +ml h +ml log +ml process +ml ctx +ml blocks +ml perf +ml Uq +ml BCE +ml Dao +ml compass +input X +input type +input class +input node +input ters +input stream +input Folder +input enc +input Attr +input Shape +input Dictionary +input Choice +input datadir +lob ar +np d +np w +np ri +np sql +np blocks +eri DNXSts +][ * +][ / +][ ^ +][ :: +][ ^\ +mat A +mat al +mat plot +mat io +mat ik +mat gan +mat free +mat ica +mat eria +mat ika +mat tone +mat hew +mat heus +Ġsh m +Ġsh or +Ġsh en +Ġsh am +Ġsh ft +Ġsh atter +Ġsh du +Ġsh irt +Ġsh ënim +Ġsh udder +Ġsh erlock +Ġsh preader +Ġdi is +Ġdi jo +Ġdi ves +Ġdi agin +Ġdi ário +Ġdi ssim +Ġdi poles +Ġdi coms +Ġdi amonds +Ġdi yoruz +Ġdi mples +Ġdi hedrals +Ġdi lidir +sk g +sk r +sk is +sk om +sk time +sk jer +sk uidlist +df B +df p +df dU +db V +db b +db lp +db Data +db host +db ins +db service +db dt +db admin +db pool +db rs +db Query +db ea +db Args +db eb +db Wx +db arra +db latt +mit m +mit z +mit te +LL ERS +LL CG +LL TL +LL MHeadModel +LL TGE +UT Q +UT ILITY +UT TER +UT RAN +work phone +88 10 +88 23 +88 80 +88 71 +88 925 +88 224 +88 301 +88 905 +88 225 +88 305 +88 304 +88 987 +88 426 +88 385 +88 065 +88 997 +88 986 +88 565 +88 018 +88 015 +88 967 +88 067 +88 246 +88 945 +88 901 +88 658 +88 1115 +88 4393 +88 5709 +88 07907 +88 6466 +88 235294 +lp V +lp r +lp ush +lp bins +ded Slice +ded uction +ast ate +ast ec +19 40 +19 033 +19 125 +19 002 +19 567 +19 116 +19 325 +19 184 +19 865 +19 847 +19 756 +19 868 +output path +output files +output fn +output cache +output State +output factor +output buffer +output Stream +output Format +output Paths +output Commands +output Constellation +lin f +lin de +lin ers +lin ename +lin enum +lin elen +image x +image Name +image files +image Get +image Size +image Login +image Paths +image Digest +comp o +comp ly +comp check +comp ability +comp Vec +comp licated +comp enses +comp arable +comp romise +comp actividad +ID C +ID N +ID T +ID ES +ID AS +ID ING +ID Set +ID From +ID DIST +ID colName +ID potnika +ID PERT +(( { +(( (( +(( ((_ +Ġsc d +Ġsc at +Ġsc ion +Ġsc reed +Ġsc aper +Ġsc Tools +Ġsc qubits +Ġsc rews +Ġsc intillation +Ġ` ** +Ġ` {" +Ġ` .* +Ġ` -------' +34 076 +34 90 +34 199 +34 204 +34 217 +34 364 +34 956 +34 343 +start Z +start ers +start pos +start Ch +start Key +start At +start dat +start indices +start Line +start prob +start Session +start Button +start Volume +start Quest +start Btn +start WallClock +start Verses +pos Y +pos b +pos ion +pos dict +pos itor +pos itivity +pos iljatelja +Ġ[" $ +Ġ[" {} +Ġ[" $% +Ġ[" #", +uil t +Ġwe ars +Ġwe chat +Ġwe aker +Ġwe ewx +Ġwe ibo +Ġwe pppy +ated ListPageFactory +09 076 +09 75 +09 101 +09 59 +09 49 +09 41 +09 033 +09 126 +09 401 +09 895 +09 887 +09 877 +09 476 +09 439 +09 5668 +84 19 +84 27 +84 33 +84 66 +84 82 +84 89 +84 70 +84 21 +84 58 +84 78 +84 125 +84 925 +84 199 +84 401 +84 193 +84 132 +84 299 +84 908 +84 537 +84 286 +84 986 +84 946 +ĠIn de +ĠIn to +ĠIn version +ĠIn cl +ĠIn dic +ĠIn Out +ĠIn fra +ĠIn active +ĠIn validate +ĠIn spection +ĠIn cluding +ĠIn fine +ĠIn dividuals +ĠIn fos +ĠIn ertia +ĠIn iciar +ĠIn tialize +ĠIn icio +ĠIn surance +ĠIn vasive +write Log +write mem +write Info +write bits +write Pixels +write Xml +write ToFile +write STDERR +ery Keys +with space +with python +ere a +ere m +ere se +ere al +ere ce +ere gin +ere very +ION E +ION IZATION +27 916 +27 294 +27 2000 +27 915 +27 296 +27 286 +27 394 +27 997 +27 018 +27 445 +27 3645 +own load +update lib +update Log +update At +update Report +update Geometry +update Cofig +update ManagerDialog +ask rá +ask atche +Ġkey ing +Ġkey up +Ġkey state +Ġkey man +Ġkey Str +Ġkey down +Ġkey chains +Ġkey binding +Ġkey loggers +Ġkey bindings +Ġkey stroke +nd en +nd an +nd ots +nd hwc +inter m +inter ed +inter ception +inter ns +inter cnt +inter stellar +inter ventions +inter RoleMethod +ant as +ant onio +gs F +gs d +gs i +gs o +gs u +gs v +gs Vi +gs fit +gs fc +gs LC +gs Fg +gs orte +gs Vh +gs heets +gs peech +by l +by os +by Time +by Size +by stage +by passed +by strom +by chev +by testate +bin Str +bin width +bin dist +bin del +shape Blending +lock out +lock names +lock paths +Ġle lo +Ġle sen +Ġle ech +Ġle aking +Ġle aked +Ġle itos +Ġle verCount +Ġle ipzigjs +Ġle aguer +ill ers +ill ness +ĠThe sis +ĠThe oretical +result file +result Paths +result NContent +ann data +ann are +ann eld +arch spec +arch ae +ave fcns +Ġax img +Ġax ju +Ġax elrod +Ġconfig y +Ġconfig Value +24 80 +24 200 +24 60 +24 127 +24 888 +24 384 +24 218 +24 424 +24 987 +24 895 +24 160 +24 377 +24 99999999 +ound ary +37 10 +37 40 +37 60 +37 164 +37 232 +37 456 +37 907 +37 987 +37 303 +37 037 +37 938 +37 247 +37 367 +37 318 +37 358 +Ġpath ing +Ġpath Mapping +Ġare al +ak l +ak t +ak ro +ak um +ak ir +ak ov +ak ita +ak tas +ak iba +ak umar +ak elts +ak meister +ak chott +Pro si +Pro ba +Pro spect +Pro vin +Pro grams +Pro jet +Pro ceeded +Pro Dy +Pro fession +Pro metheus +Pro fessor +Pro yect +Pro cedural +Pro jeção +Pro mpter +state point +state matrix +state machine +em en +em ma +em yst +point B +point plot +point ee +point OutMsgName +map client +map match +map serv +map Point +map Nx +map Renderer +map Ny +Ġoutput q +Ġoutput size +Ġoutput node +Ġoutput files +Ġoutput fn +Ġoutput Filename +Ġoutput Fs +Ġoutput Cols +Ġoutput DNAs +Ġoutput Connections +Ġ@ ' +Ġ@ , +Ġ@ !! +Ġpo zw +Ġpo zyx +Ġpo istion +Ġpo lolu +Ġpo sedge +Ġpo incare +Ġcom er +Ġcom me +Ġcom un +Ġcom Data +Ġcom order +Ġcom unic +Ġcom fort +Ġ-> ") +Ġsub l +Ġsub m +Ġsub fig +Ġsub label +Ġsub index +Ġsub lin +Ġsub token +Ġsub function +Ġsub event +Ġsub location +Ġsub msg +Ġsub struct +Ġsub argv +Ġsub network +Ġsub fields +Ġsub ways +Ġsub stage +Ġsub lists +Ġsub setting +Ġsub categories +Ġsub lista +Ġsub systems +Ġsub grp +Ġsub Centre +Ġsub locality +Ġsub pout +Ġsub grupo +Ġsub routines +Ġsub thesauri +Ġsub subbasepath +Ġsub termRepresentsLessSignificant +Ġsub rayado +Ġsub thesaurus +Ġso ch +Ġso version +Ġso okie +Ġso chi +Ġso ciety +Ġso ciale +Ġso umise +lace d +lace ment +vel en +vel lo +vel diff +vel vet +vel æ +yn chron +yn etwork +yn chemis +Ġ{' % +Ġ{' { +Ġ{' +': +rep id +rep Num +rep lan +rep lying +rep vgg +rep avgs +rep ubb +AM J +AM U +AM HD +AM Bg +AM INA +AM ETABLEREQUEST +AM essage +AM lJo +96 23 +96 38 +96 79 +96 125 +96 126 +96 192 +96 0000000 +96 915 +96 208 +96 137 +96 297 +96 165 +96 908 +96 148 +96 235 +96 5000 +96 045 +96 956 +96 038 +96 393 +96 310 +96 1500 +96 663 +96 2092 +96 9896 +96 5225 +Ġac g +Ġac n +Ġac y +Ġac re +Ġac se +Ġac li +Ġac res +Ġac ces +Ġac cord +Ġac tives +Ġac uer +Ġac ctypes +Ġac ertos +Ġac redit +ache co +Ġcomp ss +Ġcomp te +Ġcomp ren +Ġcomp eti +Ġcomp licate +Ġcomp liment +Ġcomp Numb +aliz enu +aliz ador +aliz ações +ĠCon str +ĠCon clu +ĠCon sum +ĠCon fd +ĠCon roy +ĠCon versions +ĠCon formance +ĠCon firmed +ĠCon tracted +ĠCon fidential +ĠCon formal +ĠCon duit +ĠCon dicional +ĠCon fluent +ĠCon sumes +Ġnew R +Ġnew Y +Ġnew c +Ġnew id +Ġnew data +Ġnew path +Ġnew args +Ġnew code +Ġnew array +Ġnew result +Ġnew query +Ġnew values +Ġnew File +Ġnew link +Ġnew Index +Ġnew Image +Ġnew feature +Ġnew Item +Ġnew metric +Ġnew term +Ġnew trace +Ġnew Ip +Ġnew pm +Ġnew Val +Ġnew Sequence +Ġnew Meta +Ġnew Head +Ġnew regions +Ġnew iters +Ġnew Word +Ġnew Filename +Ġnew Pixel +Ġnew Events +Ġnew Socket +Ġnew blk +Ġnew jsonData +Ġnew Coordinates +Ġnew Processes +Ġnew Poll +Ġnew Getter +Ġnew Signer +Ġnew tds +Ġnew ElementType +Ġnew Dek +Ġnew Bone +Ġnew comer +Ġnew AnchorName +Ġnew regionaltoken +Ġnew dimname +Ġnew globaltoken +Ġnew SnapPeriod +Ġnew MasterAmbientVolume +Ġall seed +Ġall year +Ġall caps +Ġall Templates +Ġall movies +Ġall Skipped +Ġall DNAs +Ġall DictList +Ġall Stars +Ġall TimeList +Ġall Prods +Ġall MeasurementInfo +Ġall FilesInDir +Ġinput str +Ġinput data +Ġinput type +Ġinput filename +Ġinput Parser +Ġinput Path +Ġinput Inter +Ġinput Size +Ġinput Fs +Ġinput Amplitude +55 02 +55 06 +55 17 +55 93 +55 27 +55 85 +55 98 +55 38 +55 200 +55 77 +55 82 +55 29 +55 65 +55 21 +55 39 +55 264 +55 198 +55 119 +55 857 +55 196 +55 166 +55 293 +55 455 +55 956 +55 328 +55 454 +55 068 +55 843 +55 1615 +94 00 +94 10 +94 04 +94 55 +94 50 +94 39 +94 214 +94 915 +94 117 +94 114 +94 147 +94 198 +94 295 +94 296 +94 347 +94 903 +94 932 +94 227 +94 886 +94 666 +94 568 +94 311 +94 12892 +clu mp +Ġcur i +Ġcur se +Ġcur id +Ġcur time +Ġcur ly +Ġcur len +Ġcur Str +Ġcur Volume +Ġcur Indirection +Ġcur idloc +Ġcur blockindex +Ġ} / +Ġ} ): +Ġ} }/ +Ġ} }] +Ġ} ................ +33 10 +33 109 +33 148 +33 647 +33 309 +33 995 +33 189 +ĊĠĠĠĠ ĊĊĠĠĠĠĠĠĠ +ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠ ĊĊĠ +ĊĠĠĠĠ ĊĠĠ +ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ +ĊĠĠĠĠ ĊĊĠĠĠĠĊĠĠĠ +DE K +DE f +DE w +DE DE +DE BUT +DE PART +DE POSIT +DE DICTION +DE PREC +DE ADC +DE DUCTION +RO O +RO IS +RO IO +RO TE +RO PS +RO TS +RO BIN +RO CONTROL +RO rig +Ġapp config +Ġapp Config +Ġapp struct +Ġapp attack +Ġapp daemon +Ġapp oints +Ġapp veyor +Ġapp ctxt +json lines +json OK +json gameevent +json Fpath +()) " +()) > +()) [" +()) ._ +()) [- +()) ''' +()) +' +()) +". +()) ;', +()) +"'" +split Quadratic +fer c +fer n +fer ry +fer rit +fer dian +fer ito +fer imeter +Name ID +Name Of +Name Mapping +Name Prefix +Name ConflictError +node user +node bug +node labels +node Time +node Manager +node Names +node Features +node sktop +node mgr +Ġlabel ss +Ġlabel list +Ġlabel font +Ġlabel codes +Ġlabel Style +Ġlabel Propagation +row er +row ed +row Map +row land +ample bottles +av U +av X +av c +av p +av u +av ion +av gn +av ille +jang a +Ġno f +Ġno di +Ġno error +Ġno mask +Ġno fit +Ġno Rs +Ġno EGStitching +Ġno heaven +Ġno Punc +87 14 +87 19 +87 09 +87 57 +87 107 +87 21 +87 81 +87 58 +87 59 +87 202 +87 255 +87 005 +87 401 +87 234 +87 295 +87 896 +87 287 +87 293 +87 385 +87 392 +87 988 +87 5000 +87 875 +87 298 +87 266 +87 554 +87 839 +87 1709 +mpl ane +no S +no et +no out +no sed +no index +no output +no ai +no static +no echo +no xl +no Seq +no cks +no vertical +no sem +no Creation +no oz +no coerce +no splash +no stdlib +no ocsp +no yar +no ExoSM +no Outlier +no DeleteAtEnd +no Rotates +Ġline a +Ġline end +Ġline Num +Ġline bot +Ġline strip +Ġline Array +Ġline break +Ġline Len +Ġline ctr +Ġline Thickness +Ġline itempro +AL P +AL j +AL AM +AL SO +AL MENT +AL IA +AL BERT +AL PAG +AL LEMENT +Ġclass x +Ġclass ind +Ġclass map +Ġclass group +Ġclass Count +Ġclass refs +Ġclass ific +Ġclass Acc +Ġclass Hits +Ġclass Tallies +fic ent +fic amos +fic titious +exp list +exp times +exp tool +exp asy +exp Points +exp unge +exp Scores +CT E +CT ime +CT ED +CT GG +CT ATT +CT GC +CT CG +CT GAT +CT TTT +CT AAC +CT RIA +-------------------------------- ------- +-------------------------------- ------------- +Data point +Data Message +Data Access +Data App +Data Point +Data Pointer +Data Length +Data Page +Data Iter +Data Types +Data AI +Data Header +Data Buffer +Data Len +Data Mapper +Data Free +Data Cube +Data Spectral +Data Arrays +Data ReadList +Data gramProtocol +AS D +AS V +AS an +AS PP +AS CI +AS FLAGS +AS hw +AS GC +AS erver +AS RQ +AS ession +AS AKi +iv z +iv ist +iv ly +iv no +iv tk +iv shchyna +Ġla va +Ġla dy +Ġla dos +Ġla kew +Ġla ctate +'. { +'. '), +'. *\ +Ġsys Name +Ġsys Location +Ġsys Contact +Ġsys UpTime +85 10 +85 02 +85 88 +85 98 +85 000000 +85 41 +85 61 +85 916 +85 168 +85 154 +85 216 +85 218 +85 164 +85 295 +85 857 +85 327 +85 177 +85 907 +85 174 +85 233 +85 292 +85 394 +85 987 +85 326 +85 900 +85 997 +85 314 +85 344 +85 965 +85 153 +85 312 +85 244 +85 968 +85 398 +85 313 +85 678 +85 939 +ive au +". +? +97 01 +97 100 +97 83 +97 41 +97 294 +97 193 +97 567 +97 327 +97 196 +97 424 +97 397 +97 286 +97 174 +97 284 +97 236 +97 422 +97 955 +97 065 +97 227 +97 077 +97 466 +97 818 +97 435 +97 245 +97 777 +97 393 +97 485 +97 046 +97 910 +97 3736 +rid t +rid y +rid otto +back pack +back projection +back tracking +back office +mi N +mi i +mi et +mi are +mi era +mi xF +mi ura +mi chi +mi RNA +mi stral +mi eni +mi lion +mi amidade +{} & +{} ], +{} __ +{} ]+ +{} }} +{} *** +{} \\\\ +{} """. +ken o +ken berg +ken nethreitz +net o +net sh +net ware +net cat +net proto +net common +net stats +net addr +net speed +net atmo +net blow +rans action +36 500 +36 203 +36 647 +36 026 +36 995 +36 909 +36 317 +36 2597 +Ġspe cre +Ġspe corder +Ġspe ktral +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +čĊč ĊĠĠĠĠĠĠĠĠĠĠ +čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +but es +but ane +ron d +ron izer +ron dis +ron land +ron soft +ron esia +ron ingen +ull veig +=[ ': +=[ ": +=[ ])), +=[ #{ +Ġuse f +Ġuse able +Ġuse default +Ġuse keys +Ġuse match +Ġuse Cython +Ġuse ExoSM +011 87 +011 28 +011 83 +011 0100 +011 101111 +011 001111 +011 912 +011 316 +011 01010100 +Ġopen file +Ġopen box +Ġopen File +Ġopen flow +Ġopen CV +Ġopen Main +Ġopen Price +Ġopen vz +Ġopen ToNewsletter +Ġopen nem +Ġopen ravepy +query Status +query Element +Ġid t +Ġid Des +Ġid Max +Ġid Sub +Ġid Window +ĠK G +ĠK H +ĠK p +ĠK t +ĠK v +ĠK w +ĠK in +ĠK ate +ĠK id +ĠK il +ĠK om +ĠK value +ĠK ore +ĠK lu +ĠK IT +ĠK ok +ĠK ings +ĠK ak +ĠK em +ĠK api +ĠK ies +ĠK not +ĠK amera +ĠK ube +ĠK NET +ĠK LT +ĠK SK +ĠK uz +ĠK NP +ĠK ori +ĠK ras +ĠK oh +ĠK asa +ĠK uh +ĠK illed +ĠK YC +ĠK amen +ĠK nox +ĠK lue +ĠK iK +ĠK vad +ĠK arna +ĠK elv +ĠK ubo +ĠK acz +ĠK archer +ĠK irsch +ĠK insh +ĠK ruskal +ĠK NearestNeighbor +ĠK arelia +ĠK NeighborsRegressor +ĠK Qkq +ĠK loeck +ĠK laip +utils TestSupport +Ġuser tools +Ġuser resp +Ġuser account +Ġuser Menu +Ġuser Agent +Ġuser Assignment +Ġuser Temperature +Ġuser Saturation +Ġuser TestList +95 100 +95 84 +95 923 +95 000 +95 49 +95 025 +95 925 +95 404 +95 215 +95 204 +95 216 +95 294 +95 003 +95 264 +95 905 +95 203 +95 225 +95 308 +95 286 +95 187 +95 808 +95 145 +95 422 +95 277 +95 337 +95 346 +95 408 +95 015 +95 909 +95 856 +95 944 +95 756 +95 099 +95 8844 +95 8692 +95 1156 +95 9605 +95 13788 +ader ente +923 55 +923 57 +923 54 +Ġnumber At +Ġnumber Lost +word file +word seg +word piece +word vecs +word pieces +lat ore +lat tices +lat ino +lat ina +lat ColName +lat Deg +lat MinStr +lat decsec +lat tante +Ġit max +Ġit no +Ġit terate +Ġit iné +Ġ'- % +Ġ'- ']) +Ġdist n +Ġdist la +Ġdist min +Ġdist Type +Ġdist ants +Ġdist Record +Ġdist iller +Ġdist urbance +view name +view models +view Set +view cvs +Ġcont enu +Ġcont enders +Ġcont ornos +Ġcont atos +Ġcont orl +Ġimage folder +Ġimage Object +Ġimage Out +Ġimage Int +Ġimage Counter +Ġimage Amp +Ġrequest info +Ġrequest Obj +run Name +run call +run Test +run scope +run tests +run Target +run Job +run Cancel +run Simulation +run Ima +run estone +Ġtry job +cri min +00000000 03 +00000000 005 +00000000 10001111 +instance type +instance Id +instance Tot +86 04 +86 22 +86 33 +86 87 +86 23 +86 28 +86 200 +86 69 +86 384 +86 2000 +86 207 +86 387 +86 235 +86 988 +86 276 +86 355 +86 247 +86 266 +86 047 +86 557 +86 289 +86 092 +stra ce +stra der +stra ights +stra das +stra sse +26 384 +26 984 +26 286 +26 907 +26 293 +26 364 +26 875 +26 161 +26 238 +26 246 +26 2345679 +Ġmax C +Ġmax k +Ġmax ri +Ġmax ed +Ġmax pro +Ġmax shape +Ġmax mon +Ġmax score +Ġmax Key +Ġmax Reg +Ġmax seq +Ġmax cost +Ġmax radius +Ġmax Power +Ġmax iters +Ġmax Distance +Ġmax Delta +Ġmax Contour +Ġmax Depth +Ġmax attempts +Ġmax Chunk +Ġmax Steps +Ġmax Pixels +Ġmax visits +Ġmax Retention +Ġmax Asks +Ġmax Rapidity +Ġmax Perturbation +Ġmax sofar +Ġmax CpuCount +Ġmax endinghere +ension e +sum ade +Ġtorch data +Ġtorch ify +mon ds +mon lam +mon ograph +mon tare +mon ahan +mon omer +Ġdo h +Ġdo x +Ġdo yle +Ġdo ze +Ġdo Get +Ġdo fit +Ġdo seq +Ġdo ador +Ġdo ssier +Ġdo ilea +Ġdate list +Ġdate line +Ġdate diff +Ġdate Rule +Ġdate Line +Ġdate finder +Ġdate Generation +Ġdate InStock +descri zione +descri ptive +fa A +fa ith +fa zer +fa eda +fa ileds +Ġz T +Ġz d +Ġz w +Ġz in +Ġz mi +Ġz ach +Ġz ain +Ġz err +Ġz div +Ġz cls +Ġz Array +Ġz beta +Ġz scatter +Ġz cnt +Ġz Cell +Ġz hang +Ġz fh +Ġz Vertex +Ġz elle +Ġz tilt +Ġz uten +Ġz versor +Ġz awi +Ġz azu +Ġz aseden +process er +process date +process Frame +process All +process Mesh +process Csv +process VideoStream +Ġjson b +Ġjson str +Ġjson Str +Ġjson logger +Ġjson Object +Ġjson Array +Ġjson ified +Ġjson Mas +Ġjson Fpath +init file +init State +init Persistent +HE H +HE I +HE U +HE ET +HE MA +HE LI +HE ADE +HE BAG +HE DarkeningEP +rit rary +rit rat +Ġparser fromhell +Ġhas mat +Ġhas mark +Ġhas pr +Ġhas neg +Ġhas Big +Ġhas PDF +Ġhas Diff +Ġhas Defected +Ġhas PathSum +string val +string ere +string isoformat +string Repl +Ġindex able +Ġindex File +Ġindex Of +Ġtrain ings +Ġtrain List +Ġtrain Method +default root +default Key +default Item +default auto +default Source +default boot +default Target +default Marker +default Capacity +default Radius +default TestLoader +AG B +AG GA +AG GAT +AG TTTT +AG Ns +AG PLL +AG ACTTT +AG Wstart +57 923 +57 30 +57 101 +57 70 +57 69 +57 025 +57 005 +57 105 +57 214 +57 218 +57 132 +57 203 +57 857 +57 347 +57 345 +57 148 +57 907 +57 375 +57 236 +57 325 +57 394 +57 303 +57 895 +57 235 +57 386 +57 425 +57 936 +57 097 +57 986 +57 932 +57 364 +57 057 +57 913 +57 226 +57 377 +57 509 +57 818 +57 666 +57 777 +57 434 +57 893 +57 074 +57 467 +57 093 +57 2503 +57 7687 +57 28906 +57 09604 +57 01129 +57 21626 +Ġ! . +Ġ! > +Ġ! !' +his o +cle os +cle vis +cle ars +cle ansing +Ġ[' $ +Ġ[' ~ +Ġ[' ']: +Ġ[' $\ +Ġ[' $', +Ġ[' (', +Ġ[' *', +Ġ[' -' +Ġ[' [', +Par agon +... ( +... { +... } +... '), +... `` +... ')) +... '%( +... `") +... >>. +Ġ8 10 +Ġ8 92 +Ġ8 16 +Ġ8 15 +Ġ8 03 +Ġ8 14 +Ġ8 22 +Ġ8 27 +Ġ8 24 +Ġ8 95 +Ġ8 35 +Ġ8 30 +Ġ8 91 +Ġ8 39 +Ġ8 31 +Ġ8 123 +Ġ8 195 +Ġ8 086 +Ġ8 061 +Ġ8 9569 +Ġext en +Ġext ype +Ġext List +Ġext names +Ġext colors +Ġext inguish +ster n +ww J +ww n +ww Go +ww pdb +Ġ| ) +Ġ| , +Ġ| { +Ġ| __) +Ġ| _. +Ġ| "+ +Ġ| ::.. +Ġ| ^)([ +create Config +create Function +create Market +create Tasks +create Vault +create Incident +create ExpectationsPath +create PointsEmbed +"), (" +"), ]), +ED I +ED k +ED CE +ED ITION +ED LM +ED LIT +ED iphone +IS i +IS ES +IS CO +IS DIR +IS SS +IS ORT +IS UP +IS UB +IS CR +IS BI +IS ATIONS +IS PATCHED +IS CSI +IS OPREN +IS ÃīS +IS FIABLE +IS ATTY +reg as +reg ulation +reg istr +reg ados +reg Raw +reg arded +reg ulars +reg olare +Ġtf low +Ġtf board +Ġtf example +Res izing +Res cue +Res olução +Ġnumpy ro +number One +number Steps +ix xxx +ix Yt +ix yyy +ix xyy +Ġbo xy +Ġbo ven +Ġbo hm +Ġbo yer +Ġbo effc +do te +do om +do jo +do times +do va +do zen +do Individual +do ssi +do xyfile +do gey +do ReadInput +Ġper o +Ġper me +Ġper from +Ġper ig +Ġper man +Ġper forma +Ġper missive +Ġper imeters +Ġper colation +Ġper dida +message Text +message Link +parse date +parse addr +parse DOM +parse LTE +parse Zigbee +ale vel +ale Net +au fn +au quier +group id +group Name +group settings +group Te +group shared +group retry +group Sync +spe tt +layer list +layer Count +layer ValueM +Ġne e +Ġne u +Ġne ve +Ġne go +Ġne ko +Ġne Adv +ele x +ele ktron +Text View +Text Stream +Text Block +Text Rules +Text DataObject +Text ãĥģãĥ£ãĥ³ãĥįãĥ« +Ġfil me +Ġfil ms +Ġfil texpr +Ġfil navn +env ar +env Var +env Variables +env isning +"," & +"," ( +"," ^ +"," _ +"," \' +"," (", +"," ("). +Ġcreate string +Ġcreate Parser +Ġcreate Order +Ġcreate Player +Ġcreate Ground +Ġcreate Compose +Ġcreate Voxel +Ġcreate Sphere +Ġcreate UserForm +Ġcreate XSCRIPTCONTEXT +Ġcreate SffCdataStruct +rc z +rc lasses +rc Param +rc ulo +List as +List Str +List Config +List Path +List Model +List Comp +List Index +List Request +List API +List By +List Size +List Opt +List VO +List Prompt +List Pods +List Shards +ware Definition +current Config +current Node +current Count +current Version +current Link +current Document +current Directory +current Points +current DateTime +current FilePath +current ProfileName +__( _ +CO O +CO c +CO PE +CO OP +CO GS +CO MAN +CO MF +CO UPL +CO HERENCE +Ġfunction ally +Ġfunction Signature +old way +old TS +color dict +color Value +color sys +color Index +color ante +color Chooser +color Trait +color Doing +color ShaderNodeName +upp s +upp ers +Ġunder take +port no +port tab +port raits +port ugues +man ti +man parser +man land +man uals +man uale +man ubot +man abar +man ifolds +ach in +ach at +ach al +ach ute +md g +md t +md utils +md ca +md runner +md nJ +version id +version Major +Ġlo i +Ġlo k +Ġlo on +Ġlo pt +Ġlo os +Ġlo hi +Ġlo fti +90 324 +api Group +api ajax +api explorer +trans Image +trans ducer +trans ceiver +trans istion +trans loadings +status up +status Dict +66 01 +66 09 +66 75 +66 28 +66 83 +66 81 +66 54 +66 59 +66 71 +66 808 +66 238 +66 8675 +23 10 +23 128 +23 132 +23 114 +23 119 +23 176 +23 008 +request url +request class +request Obj +unc entered +AC F +AC U +AC h +AC No +AC ATION +AC GAT +AC ATTT +AC GCC +AC QUI +AC AGTT +AC LOUD +AC omp +AC NNNNN +=( * +Ġcheck up +Ġcheck path +Ġcheck file +Ġcheck pt +Ġcheck File +Ġcheck Input +Ġcheck button +Ġcheck Sum +Ġcheck invalid +Ġcheck Delete +Ġcheck Body +Ġcheck Marker +Ġcheck Inverse +Ġcheck CartByGoods +Ġcheck FullVerkey +Ġcheck PhsConsistency +Ġcheck ScrapedFinishedAndStartAnalysis +Ġcheck formismatch +ING EST +ING EF +Ġstart V +Ġstart Z +Ġstart x +Ġstart Ch +Ġstart Process +Ġstart numbers +Ġstart Draw +Ġstart Mid +Ġstart CircN +lag om +Ġte str +Ġte go +Ġte ilt +Ġte krar +Ġmat ype +Ġmat plot +Ġmat utils +Ġmat Score +Ġmat gend +Ġmat erialized +ps b +ps gs +ps ico +Ġli ens +Ġli ken +Ġli sd +Ġli dh +Ġli fts +Ġli pids +Ġli gnes +uld ron +uld uk +44 000 +44 117 +44 287 +44 927 +44 967 +44 088 +44 068 +44 4249 +Ċĉĉĉ ĊĊ +Ċĉĉĉ ĊĊĉ +Ċĉĉĉ ĊĉĉĉĊĉ +ðŁı º +frame d +frame Num +frame times +cont or +cont Num +cont ante +cont orl +ns l +ns name +ns us +ns object +ns nap +ns opts +ns dc +ns Credentials +ns lots +und raw +und ling +und Control +und aria +und ária +IM L +IM ITY +IM OS +IM PAR +IM AX +IM IZATION +IM MUT +IM etadata +Ġdis Y +Ġdis ab +Ġdis put +Ġdis pl +Ġdis pen +Ġdis curs +Ġdis orders +Ġdis cern +Ġdis continuous +Ġdis proportion +Ġdis appearance +Ġdis appoint +Ġdis regarded +ulti mo +ulti Dict +*- * +*- { +Ġ** = +ENT ATION +ENT SOE +object model +object Type +object Set +object Class +object Annotation +AP C +AP O +AP h +AP ON +AP ED +AP EX +AP latform +AP IO +AP NS +AP OD +AP SED +AP YQ +AP RÃĪ +ler ine +Ġadd f +Ġadd text +Ġadd angle +Ġadd Edge +Ġadd Indices +Ġadd Rand +Ġadd Monitoring +Ġadd Delimiter +Ġadd tional +Ġadd TrainingData +Ġadd endum +Ġadd NodesToLink +Ġadd TwoNumbers +Des peckle +75 11 +75 03 +75 93 +75 14 +75 82 +75 29 +75 63 +75 41 +75 217 +75 286 +75 057 +75 2886 +new W +new Y +new path +new time +new Type +new state +new query +new mask +new block +new context +new String +new Comp +new body +new win +new expression +new tasks +new Layer +new Category +new Target +new Width +new Order +new Url +new Word +new Bits +new Sheet +new modal +new Vocab +new Publication +new metatable +new ComponentStatus +new TokenName +new sela +stri x +stri ps +stri ca +Ġtext X +Ġtext files +Ġtext cat +Ġtext book +Ġtext props +Ġtext attack +Ġtext Height +Ġtext grids +Ġtext Fill +Ġtext stripped +Ġ-*- : +float Query +float sit +cor er +cor rf +cor onadash +cor riere +mail name +mail bot +mail Template +mail paper +io a +io v +io lib +io info +io tis +io tio +ait a +Ġrun file +Ġrun if +Ġrun compile +Ġrun Folder +Ġrun Tests +Ġrun pandas +Ġrun Med +OT Z +OT Jk +]: ( +]: < +]: ]) +Ġnode ids +Ġnode Names +Ġnode Sets +Ġnode IpAddr +Ġnode ConnectionData +000 11111 +ild askrá +Ġurl Counter +Ġurl resolvers +Ġurl canon +Ġurl Subj +clo th +ef n +ef sm +ef Ik +']) [- +']) +" +En er +En force +En coded +En closed +En rico +En laces +En cerramento +Co a +Co or +Co op +Co ving +Co ales +Co fee +Co VB +Co Simulation +Co Initialize +Co Robot +Co upon +Co YB +Co û +Co conut +Co voit +,- \ +auth user +auth sets +11111111 00001111000011110000 +11111111 0010011 +28 10 +28 90 +28 000 +28 134 +28 295 +28 212 +28 312 +28 257 +28 911 +28 252 +28 084 +28 3293 +28 2806 +RI p +RI EN +RI BE +RI HY +RI STM +RI VV +RI GID +Ġend Z +Ġend search +Ġend Index +Ġend oscope +Ġend EpCut +Ġend orsed +Ex o +Ex x +Ex Start +Ex End +Ex pn +Ex MY +Ex ocross +Ex PASy +Ex hibit +ET HERE +ET Paths +ET TES +Id Set +Id Field +Id Table +Id Dict +Id Method +Ġ-- ")) +Ġ-- -\ +raw N +raw s +raw input +raw request +raw Features +raw Capture +raw Prediction +raw Deck +raw DataParser +raw midifile +raw idÅĤowo +var Match +var shp +var tis +var ibles +var fdiff +so z +so fs +so lare +so fth +so dipodi +Ġwill SayAll +cal m +cal dir +cal do +Ġmessage IdSet +56 27 +56 923 +56 38 +56 102 +56 567 +56 934 +56 304 +56 854 +56 288 +56 013 +56 986 +56 932 +56 985 +56 818 +56 648 +56 2584 +56 93588 +56 18438 +go on +go us +go vi +go left +go yal +go vori +go comics +go ofy +98 90 +98 300 +98 175 +98 214 +98 218 +98 217 +98 147 +98 135 +98 195 +98 212 +98 286 +98 332 +98 048 +98 965 +98 018 +98 975 +98 087 +98 399 +98 993 +98 262 +98 0232 +98 0113 +Ġpass w +Ġpass er +Ġpass able +Ġpass é +Ġpass band +Ġsp z +Ġsp ill +Ġsp its +Ġsp lines +Ġsp ines +Ġsp atio +Ġsp linalg +Ġsp glib +Ġsp hexa +Ġsp irit +Ġsp orco +Ġsp ørsm +client protocol +client Secret +FI B +FI jk +FI FTH +local stack +local domain +local zone +local isation +local toc +local mtime +local BBox +ding o +38 232 +38 165 +38 315 +38 337 +38 936 +38 065 +38 644 +38 371 +38 040 +move Window +move BookmarkTo +my v +my log +my col +my url +my Name +my Data +my table +my Str +my Object +my words +my cluster +my admin +my bucket +my Doc +my Msg +my repo +my container +my secret +my Page +my POS +my consumer +my Post +my paste +my funcs +my dirpath +my sensors +my expired +my Srv +my anmar +my emph +my configdir +my admintoken +my Wing +my badtoken +my maxencode +my oniyon +obj name +obj str +obj names +obj Func +obj gain +obj CodeMgr +Ġdict ates +Ġdict Char +Ġdict Print +Ġdict Tags +Ġdict Glove +Ġmin T +Ġmin st +Ġmin fi +Ġmin ri +Ġmin ers +Ġmin ver +Ġmin pro +Ġmin mon +Ġmin Num +Ġmin To +Ġmin dim +Ġmin dep +Ġmin Frame +Ġmin conf +Ġmin Number +Ġmin Index +Ġmin cnt +Ġmin ims +Ġmin uts +Ġmin Lon +Ġmin Bids +Ġmin Ascendants +Ġmin Perturbation +Ġmin LUy +Ġmin Pnt +Ġmin Occurs +Ġmin Concav +Ġmin úsculo +pop ul +pop over +pop olare +Ġobject Expr +******** ***** +LO AN +LO PE +LO FF +LO BB +LO YE +LO zs +LO bject +ĠUn load +ĠUn license +ĠUn ify +ĠUn link +ĠUn roll +ĠUn install +ĠUn flatten +ĠUn watch +ĠUn changed +ĠUn ached +ĠUn closed +ĠUn ido +ĠUn resolved +ĠUn restricted +ĠUn idades +ĠUn Supported +ĠUn iva +ĠUn occupied +Po C +Po D +Po o +Po v +Po ster +Ġ(' " +Ġ(' # +Ġ(' @ +Ġ(' ## +Ġ(' >', +Ġ(' (', +Ġ(' ........ +Ġ(' "', +Ġ(' *** +Ġ(' #' +Ġ(' ~/ +box Args +box props +box Condition +Ġ(" # +Ġ(" ( +Ġ(" '" +Ġ(" {: +Ġ(" *" +Ġ(" =================================== +check param +check items +check Path +check board +check If +check Int +check rain +check Item +check On +check Transform +check White +check lstring +check MinimumList +batch s +batch log +parser é¢Ħå¤ĦçIJĨ +title Text +title var +rix inyu +Me als +Me ze +Me SH +Me teo +Me thanol +Me ubles +Me asuring +Me mpoolTransactionResponse +module store +module Header +Se pt +Se ff +Se gs +Se eed +Se ja +Se ems +Se qs +Se aG +Se vier +Se asons +Se idel +Se minar +Se gundo +Se alURL +Se minole +uc ci +uc ination +uc umber +uc davis +Ac ross +Ac cesses +Ac quis +Ac commodator +method ology +method IDs +be ed +be au +be mpty +be gri +be atable +Ġcan List +Ġcan ada +Ġcan Diff +Ġcan Bullet +UR U +UR SE +UR THER +UR FACE +ĠOR A +ĠOR D +ĠOR F +ĠOR CAS +ĠQ E +ĠQ a +ĠQ v +ĠQ Name +ĠQ stat +ĠQ Config +ĠQ pg +ĠQ PU +ĠQ UB +ĠQ Gui +ĠQ RS +ĠQ Menu +ĠQ VM +ĠQ Buffer +ĠQ Dense +ĠQ vd +ĠQ iling +ĠQ UA +ĠQ Shell +ĠQ Media +ĠQ Printer +ĠQ Visa +ĠQ Splitter +ĠQ ScrollBar +ĠQ trac +ĠQ AbstractItem +ĠQ SpinBox +ĠQ DockWidget +ĠQ ProgressDialog +ĠQ FormLayout +ĠQ iniu +ĠQ ALocalize +ĠQ RadioButton +ĠQ VisaDynamicPlot +ĠQ Vistrails +200 01 +200 35 +200 68 +200 600 +200 106 +img B +img list +img List +img feat +img folder +img math +img dup +img Gray +Ġcolor Value +Ġcolor si +Ġcolor scales +Ġcolor jitter +Ġcolor aide +PT E +PT F +PT V +PT o +PT TT +PT ABLE +PT QConfig +uple ft +of n +of inger +of lw +of votes +of legends +of lows +of fidx +target Type +target group +target Table +target cell +target Port +target addr +target Directory +target Url +target wcs +target GroupIds +35 999 +35 232 +35 197 +35 808 +35 377 +35 66587 +sample List +sample table +sample CA +sample Sequence +sample FSS +AB IS +AB AB +AB NO +AB LA +AB USE +AB RT +AB Ln +AB IRER +Descri pcion +vis h +vis nights +ud H +ud ley +ud ctOffers +Ġcontain ig +Col Start +Col End +Col Dir +Col gate +Col liding +Col lective +Col lects +Col lege +ref d +ref r +ref in +ref ra +ref ers +ref node +ref page +ref na +ref pages +ref unds +ref reshed +step max +step ped +step linear +step functions +step funcs +step rms +Value A +Value Field +Value Exception +Value Method +Value Provider +Value ToType +ern ité +Ġwor ries +Ġwor lds +org en +org Id +straint ables +Ċĉĉĉĉ Ċ +Ġus h +Ġus ps +Ġus pec +Ġus ability +Ġus bx +Ġus bb +Ġus ada +Ġus phi +Ġus Pattern +dataset Path +space x +space mail +space images +space clean +space craft +Ġmo e +Ġmo lo +Ġmo sh +Ġmo tions +Ġmo ons +Ġmo vers +Ġmo mapper +File Input +File IO +File Check +File Dir +File Stream +File Buffer +File Lock +File IDs +File Catalog +File Finder +File Manifest +File Fragments +File BasedCache +File CorruptedError +ain an +ain file +ain lp +bs olve +bs witch +bs ExcessLiquid +Ġresponse Val +Ġresponse Bool +pri g +pri mo +pri sed +pri vo +pri rodni +pri stine +201 01 +201 94 +201 36 +201 50 +201 68 +201 00102 +AD URL +AD Net +AD OPT +AD OW +AD KV +AD IFF +AD VERT +AD ORES +AD PCM +AD Leo +ual a +ran obe +ran opie +Ar V +Ar bre +Ar uba +Ar rondis +save params +save folder +save All +save Output +save Stack +save Contour +save Fig +save EXR +save SimulationData +Ġtarget Q +Ġtarget group +Ġtarget ref +Ġtarget File +Ġtarget ted +Ġtarget ctx +Ġtarget language +Ġtarget Letter +Ġtarget Slaves +tim m +tim dett +cre a +cre ep +cre ener +Ġim A +Ġim Folder +Ġim cyl +Ġim treat +mission e +Ġdf nrows +Ġdf ncols +Ġdf Pred +doc val +doc End +doc Const +doc ente +doc Len +doc Props +))) - +))) }}[]< +',' %. +stat i +stat parse +stat Dict +stat metas +flow class +flow meter +ĠSe am +ĠSe go +ĠSe ções +ĠSe vere +ĠSe bastian +ĠSe curities +ĠSe infeld +Ġad t +Ġad or +Ġad ap +Ġad mission +Ġad verse +Ġad groups +Ġad vs +Ġad joint +Ġad missão +Ġad lı +Ġad venture +Ġad versary +Ġad desses +Ġad vemdpy +Ġcurrent Status +Ġcurrent User +Ġcurrent Index +Ġcurrent Dir +Ġcurrent Ip +Ġcurrent Loop +Ġcurrent Month +Ġcurrent FilePath +Ġcurrent Extracts +Ġcurrent VinList +Ġcurrent ModelNames +nn Q +nn cs +nn api +nn Module +nn nu +nn ä +nn Title +nn nm +nn vu +gin al +gin ation +gin ny +norm Err +45 004 +45 905 +45 403 +45 267 +45 366 +45 343 +45 319 +45 859 +45 940 +ĠAN O +ĠAN ET +ĠAN GU +ĠAN ACON +77 02 +77 25 +77 22 +77 19 +77 37 +77 23 +77 28 +77 30 +77 89 +77 76 +77 81 +77 31 +77 68 +77 49 +77 132 +77 900 +77 687 +77 183 +77 557 +77 417 +77 492 +77 0258 +77 25887 +amp m +amp q +amp r +amp er +amp li +amp as +amp Out +amp uz +Ġvalid s +Ġvalid Number +Ġvalid Char +Ġvalid Ans +Ġvalid Extensions +ng a +ng z +ng or +ng round +ng pu +ng cr +ng uy +PO A +PO C +PO M +PO UR +PO LOGY +PO PTS +PO MDO +PO DDER +fil ings +fil ante +fil mato +table a +table t +table data +table Id +table schema +table Widget +table Cols +table linkrowfield +zer inde +attr on +ich ar +ich al +ich é +cent r +cent age +cent res +item def +item set +item list +item count +item Address +item Player +item ToDelete +item SetList +item TagPath +item LoopIteration +ql E +ql V +ql W +ql k +ql ite +ql Wq +ql Yr +ql Qo +the o +the data +the time +the ories +the ora +the things +the bun +ĊĊĠ ĊĠĠĠ +ide Dir +ide abuck +token ed +token State +bug gy +bug bear +ved a +ved o +ved enie +Ġerror File +Ġerror width +Ġerror Count +Ġerror Obj +Ġerror Angle +Ġerror Messages +atter Bot +Ġdistri buting +ey etracker +ĠY P +ĠY R +ĠY tr +ĠY ong +ĠY mean +ĠY ML +ĠY uri +ĠY eo +ĠY ên +ĠY CbCr +ĠY aleNet +Ġinter fer +Ġinter fe +Ġinter comparison +Ġinter activ +Ġinter jections +Ġinter acted +Ġinter quartile +filen m +filen r +act ose +act tca +act caag +ä¸ ¢ +ä¸ ´ +ä¸ ¹ +ä¸ Ī +ä¸ Ł +feat B +feat dir +Ġfloat x +Ġmay avi +Ġspeci fiers +uage m +Ġrandom izes +Ġrandom Integer +Ġrandom Choice +Builder Flag +ĠX g +ĠX en +ĠX tr +ĠX scale +ĠX Key +ĠX opt +ĠX prev +ĠX SL +ĠX CODE +ĠX FAIL +ĠX EB +ĠX uan +ĠX AXIS +ĠX iang +ĠX SLT +ĠX Beach +ĠX TRIM +ĠX BMC +ĠX lsx +ĠX mapEntry +ĠX FStyle +ĠX anadu +sent pair +sent encing +fier Set +`` ; +`` `", +Ġtrans fo +Ġtrans code +Ġtrans Figure +Ġtrans forma +Ġtrans located +Ġtrans boeffc +Ġtrans bfeffc +Ġrow an +Ġrow data +Ġrow Dict +Ġrow major +Ġrow Recipe +Ġarg um +Ġarg sparser +Ġbase x +Ġbase width +Ġbase mask +Ġbase Port +Ġbase Length +Ġbase Delta +Ġbase RefName +CH M +CH X +CH andler +CH EST +CH OL +CH DIR +CH ATE +CH AK +CH ORD +CH ARGINGTARIFFS +CH ILDR +CH ASSIS +cc y +cc ase +cc ca +cc make +cc arini +filename Component +filename fmt +filename Save +inal ado +call Method +47 00 +47 103 +47 132 +47 394 +47 277 +47 408 +47 093 +47 0408 +47 9605 +47 0049 +initi alizations +]] == +]] ])) +]] ]], +]] +\ +]] ))), +]] âĸĦâĸĦâĸĦ +Ġcode block +Ġcode system +csv v +csv out +Ġenum Types +event Type +event names +event let +event expr +event handler +event bus +event Added +event InstanceId +event EventId +event InstanceType +event SetTime +Ġ, -- +Ġ, (' +core ID +core vel +core utils +core api +core meta +core hq +core Tf +101 84 +101 27 +101 97 +101 90 +101 80 +101 98 +101 77 +101 207 +101 700 +101 01001101 +101 001001111 +action Count +action transition +action Pressed +face Aligned +command Id +command StartAddress +weight kg +weight spaceship +Str at +Str PROSE +column ar +column Dict +column Delimiter +ĠEx amine +ĠEx haustive +ĠEx ercice +[:, :], +Ġgo less +Ġgo opylib +tf c +tf Cb +files ToReference +files Processed +las ot +las ers +las ysla +names Classes +Ġpos i +Ġpos ibility +Ġpos sessions +Ġpos itivity +Ġpos icao +Ġpos ibles +Ġpos sessor +Ġpos itiva +Ġpos itively +pert angent +Ġ9 32 +Ġ9 15 +Ġ9 17 +Ġ9 08 +Ġ9 55 +Ġ9 001 +Ġ9 127 +top N +top class +top hat +top Matrix +top lists +top Right +top Lists +ream ble +replace The +replace By +replace With +Ġ<= , +Ġ<= ") +Ġload data +Ġload Json +find path +find file +find point +find number +find Cell +find windows +find Closest +find Nearest +ash ip +cy d +cy box +cy grpc +cy chiti +Status CH +Status Event +Status Widget +Status Serializer +Status Proto +Status DHW +Set X +Set Y +Set Error +Set ters +Set Status +Set Field +Set Key +Set Load +Set Resource +Set Invalid +Set Filter +Set Variable +Set Prop +Set Parameters +Set Channel +Set Points +Set Split +Set Distance +Set Marker +Set Arn +Set Console +Set Separator +Set Indices +Set FileMetadata +Set ToolTip +Set NodeAvailable +Set PasswordForm +Set SecondDouble +Set SettingValue +Set ForwardingPipelineConfig +Set CoolerLevels +Set WindowTextW +Ġpython s +Ġpython Version +Ġpython cile +Ġpython neat +ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĊĠĠĠ +pl U +pl py +pl mn +pl Eu +pl orer +pl Ratio +pl urals +items PerPage +IL A +IL DS +IL ITIES +IL ogger +cord inates +ton al +dire ccion +Ġsk us +Ġsk inning +Ġsk idl +Ġreg al +Ġreg type +Ġreg meta +Ġreg enerating +vert ed +Test Error +Test Comp +Test Image +Test DB +Test Script +Test Corpus +Test FunctionName +')) \ +mean ed +mean cost +mean Corr +mean SquaredError +Ġgener ado +HO U +HO X +HO PS +HO URLY +HO POPTS +Ġser de +83 10 +83 02 +83 12 +83 37 +83 94 +83 567 +83 968 +83 847 +83 0193 +Ġpd g +Ġstring val +Ġstring Length +Ġevent map +Ġevent queue +Ġevent NO +Ġevent InstanceId +Ġone cell +Ġone part +Ġone Student +wait time +wait listed +IB k +IB it +IB ase +IB lock +IB BO +IB MQ +IB qN +IB CCCGE +IB ELS +IB YTE +IB AKBQ +IB DRS +Ġmain fields +Ġmain hand +Ġmain Blocks +Ġag b +Ġag ility +Ġag rega +Ġag rirouter +Ġag ogosml +Ġver de +Ġver ack +Ġver ticle +Ġver dade +Ġver bal +Ġver sement +Ġver ece +Ġver kri +Ġver wenden +Ch u +Ch w +Ch am +Ch ari +Ch ui +Ch ops +Ch imer +Ch amb +Ch ampaign +Ch aco +Ch icken +Ch atham +Ch apman +Ch ongqing +Ch anneld +wh a +wh als +wh YI +wh eres +response Type +response String +nder iv +ner ve +ner gie +led ore +led ang +led gers +>> .. +>> << +du h +du z +du an +du ro +du os +du je +Ġlin o +Ġlin solver +Ġlin tian +Ġlin cRNA +random contact +random Split +random UUID +ai ra +ai om +ai opening +ai jer +ai oregex +ai xdzs +rop olit +UN H +UN L +UN b +UN k +UN s +UN ER +UN ING +UN CE +UN POST +UN SW +UN HAND +UN EXPECTED +UN ENCRYPTED +UN SUBMITTED +UN BLOCKED +UN STRUCTURED +UN SURE +qual itative +qual cuno +gen a +gen ex +gen func +gen conf +gen za +gen ö +gen stein +gen omics +ĠIN P +ĠIN TR +ĠIN CAR +ĠIN TERN +ĠIN STITUTE +ĠIN VOL +ĠIN UTIL +ĠIN VERT +ĠIN DIC +ĠIN VERSE +ĠIN CLUDED +ĠIN SPECT +ĠIN VENTORY +close Context +sg t +sg an +sg bd +sg lite +filter Text +filter queue +filter Obj +filter bank +filter Labels +filter Entities +func ion +func data +func decls +rt g +rt sp +rt tr +rt dir +rt ree +ĠReturn RowCounts +82 10 +82 03 +82 106 +82 908 +82 027 +82 987 +82 997 +82 365 +82 956 +82 111165 +}) $ +}) ` +}) ], +}) ...') +}) ?") +}) $' +}) ;""") +}) ?(\ +Ġeach Para +Ġfiles A +Ġfiles Counters +Ġfiles PassFilter +ams un +ams math +´ółģ µółģ¿ +´ółģ ´ółģ¿ +´ółģ ©ółģ¿ +´ółģ ¢ółģ¿ +´ółģ £ółģ¿ +´ółģ ¨ółģ¿ +Sg p +Sg u +host serv +host Port +host ports +host Release +host elname +order id +Ġar s +Ġar ap +Ġar son +Ġar util +Ġar vo +Ġar rary +Ġar cg +Ġar vet +Ġar maz +Ġar bitrage +Ġar massist +Ġcommand Name +Ġcommand Id +iter et +iter bytes +iter walk +46 20 +46 216 +46 297 +46 305 +46 284 +46 987 +46 303 +46 645 +46 246 +46 356 +PE ERS +PE MS +PE Metric +PE Yj +ĠJ K +ĠJ en +ĠJ al +ĠJ ur +ĠJ ens +ĠJ ax +ĠJ ID +ĠJ ell +ĠJ ets +ĠJ ACK +ĠJ uri +ĠJ ama +ĠJ ij +ĠJ NI +ĠJ FK +ĠJ iao +ĠJ oris +ĠJ urisdiction +ĠJ unior +ĠJ MATS +ĠJ anssen +txt RSYST +lower ing +lower ed +lower Limit +Ġcv utils +Ġcv fd +Ġcv nets +107 37 +107 87 +107 45 +107 60 +107 0047 +107 142857 +Log Y +Log on +Log Text +Log cat +Log Info +Log Group +Log Mem +Log istics +Log Loss +Log Formatter +Log ica +Log Subscription +Log StartTime +Log Dz +Log EndTime +Log TreeSize +bg sub +bg nd +bg Color +bg uess +Num Id +Num File +Num Samples +Num Atoms +Num Respond +Num RegToReceivePerSg +Num IterationsPerEpoch +oth on +oth ic +Lo te +Lo ci +yle ss +yle aves +89 118 +89 167 +89 195 +89 157 +89 035 +89 844 +89 558 +89 1327 +89 87299 +source date +source info +source ware +source description +source author +source language +source Desc +source Glyph +source Vault +source Brand +source codepro +Ġcolumn ar +Ġcolumn es +Ġcolumn Name +Ġcolumn Combination +tiv eness +lect ure +DI E +DI I +DI o +DI mage +DI VISION +Ġ] ], +Ġ] ') +Ġ] ._ +Ġ] """ +Ġ] }, +Ġ] '. +Ġ] ))) +Ġ] |(? +ome t +ome ters +ome than +yp U +yp ants +yp ush +yp Dot +ĠSt an +ĠSt inner +ĠSt arter +Field Set +Field Index +Field Mixin +Field Prefix +Field NotSupported +Field Regrid +Field IdDict +Ġcal or +Ġcal post +Ġcal kow +cp L +cp a +cp v +cp lt +cp raw +cp gz +cp daily +[- _ +[- _. +[- +]?[ +70 926 +ks vm +ks Nv +ks ander +ks jon +)] ", +)] == +)] ') +)] ") +)] ][ +ld c +ld l +ld us +ld api +ld XV +Ġdire cts +Ġdire cotry +ail ure +ail saction +40 934 +40 325 +nx graph +Ġmodule List +Ġmodule Dir +open all +open connect +open orders +open Db +open SSL +open census +open pipes +open pmd +open hackathon +fg Y +fg an +fg color +assert No +assert ResponseError +assert Calibrated +Ġfeat arr +Ġfeat MD +Ġread back +Ġread Input +Ġread ily +Ġread iness +Ġread Filename +Ġread Sensor +Ġread Csv +Ġread Excel +Ġread ucr +Ġread WKT +Ġread McGill +root ed +root Key +root Element +root Zip +root NVDAObject +Ġupdate Config +Ġupdate pc +Ġupdate Entry +Ġupdate CM +Ġupdate Json +ANT AGES +Un V +Un iv +Un comment +Un stage +Un hook +Un Register +Un safe +Un changed +Un seen +Un limited +Un corrected +Un verified +Un necessary +Un idades +Un titled +Un classified +Un reachable +Un stripped +Un zipping +Un scrambled +Un subscribing +pk ok +pk fail +The Example +The Matching +The Faces +mask thresh +mask RCNN +Ġq un +Ġq name +Ġq th +Ġq app +Ġq xf +Ġq ap +Ġq we +Ġq stat +Ġq func +Ġq rt +Ġq dev +Ġq network +Ġq dot +Ġq App +Ġq tt +Ġq rr +Ġq yr +Ġq kv +Ġq anda +Ġq vecs +Ġq Pairs +Ġq cow +Ġq Secondary +Ġq chrm +Ġq gpv +Ġq sortran +Ġq InstallMessageHandler +Ġq ibullet +Ġq ipkg +temp C +temp ate +temp ds +temp Count +temp bucket +temp gui +temp TS +temp Next +temp TweetIDs +Ġversion tuple +Ġversion Major +TH A +TH B +TH M +TH o +TH x +TH ub +TH IN +TH AC +TH andler +TH Tensor +TH IR +TH VC +TH ICK +TH Half +TH oW +TH ROTTLE +tag on +tag value +tag line +tag ne +tag count +tag map +tag git +tag cn +tag lio +tag gio +tag æłĩçŃ¾ +TR J +TR a +TR ING +TR CK +TR ender +TR ADA +TR UCK +TR LDR +TR AVEL +TR ITON +TR AREPRO +description Node +sys info +sys Name +sys rc +sys obj +sys location +sys fs +sys bytes +sys Location +sys Contact +sys descr +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +UL U +UL DB +UL DER +air spaces +air glow +To sh +To Item +To Array +To Var +To Row +To Cell +To Sign +To Space +To Write +To Delta +To Root +To Db +To gether +To Selection +To CSV +To Boolean +To Fun +To Theta +To Define +To Replace +To Rename +To Maker +To Cart +To Keep +To Html +To Portfolio +To TreeNode +To Grab +To urney +To Milliseconds +To Polar +To Gst +To ArgumentList +To TreeItems +To Pym +To Settle +To InputForm +Ġonly once +ĠPy E +ĠPy com +ĠPy ong +ĠPy Node +ĠPy Core +ĠPy lint +ĠPy Open +ĠPy Formatter +ĠPy Engine +ĠPy YAML +ĠPy Bullet +ĠPy EMD +ĠPy Spark +ĠPy copia +ĠPy MISP +ĠPy BBIO +ĠPy ColourChooser +ĠPy MVPA +ĠPy CallByClass +ĠPy JsParser +ĠPy xitCoordinator +ĠPy DME +ĠPy Inquirer +ĠPy Exocross +score Pairs +score atpercentile +let tes +let Transform +let Geo +CON TEST +CON NS +CON VS +CON VERSIONS +CON SIST +CON CENTRATION +CON GÃī +DO L +DO W +DO Z +DO bjects +DO utput +Ob m +Ob n +Ob z +Ob ama +Ob mZ +Ob stacles +Ob tenemos +Ġrequired Name +Ġrequired Keys +Ġrequired DLLs +gener ally +gener acion +De er +De pt +De ap +De ze +De bt +De activate +De compress +De limited +De posits +De blas +De compressor +De voir +De bub +De Pagamento +De cides +De parting +De positor +ost ation +exec l +exec dir +exec Button +exec Cmd +exec lfile +gram fort +field list +field file +field count +field Info +field Net +field Width +field Names +field Precision +Ġbatch i +Ġbatch er +Ġbatch ID +Ġbatch List +Config ID +Config For +Config Failed +Config ValidationException +Config Chess +.') [- +.') ;") +sign a +sign ific +Ġcod alab +29 028 +29 323 +29 852 +29 0400 +not f +not er +not ch +not set +not Äĥ +not finite +not edown +not atka +not choosed +US G +US I +US ub +US Processor +US iU +US Reqs +US FDACVM +Ġ`` - +Ġ`` \\ +Ġ`` "# +]* ' +]* . +]* = +]* ') +]* )", +]* )*( +]* )? +]* ?: +dim Z +dim en +Ġseri vce +Ġval o +Ġval es +Ġval uation +Ġval ptr +Ġval lee +Ġval pct +Ġval Seed +Ġval esti +Ġval ormensal +Time Type +Time To +Time Model +Time DT +Time Feature +Time Interval +Time Condition +Time Steps +Time APIClient +Time SelectedText +Time Spectra +о Ñī +о оÑĢд +âĢ Ĭ +block ers +block model +block wise +block hash +block storage +block TagPath +location panel +location forecast +cul ator +cul ations +cul ating +cul ater +cul enet +round Val +round robin +Ġtable spoons +Ġdoc id +Ġdoc name +Ġdoc ly +Ġdoc filter +Ġdoc qa +Ġdoc umen +Ġdoc plex +Ġdoc BatchSize +Ġdoc nado +65 07 +65 16 +65 04 +65 93 +65 24 +65 87 +65 26 +65 23 +65 35 +65 82 +65 46 +65 91 +65 49 +65 315 +65 396 +65 227 +65 272 +65 939 +65 4321 +65 98904 +off screen +off eso +Ġstate String +gn K +gn al +gn as +gn ize +gn ato +gn occhi +Ġdb F +Ġdb a +Ġdb f +Ġdb w +Ġdb x +Ġdb ss +Ġdb type +Ġdb ml +Ġdb port +Ġdb object +Ġdb manager +Ġdb username +Ġdb Manager +Ġdb factory +Ġdb pedia +Ġdb KeysSet +Ġdb Instancetype +graph scope +graph dy +graph cats +grid L +grid X +grid ce +grid ded +grid scale +grid Inds +MP V +MP h +MP IP +MP CM +MP LS +MP STrial +67 10 +67 13 +67 88 +67 84 +67 33 +67 85 +67 95 +67 83 +67 68 +67 301 +67 207 +67 904 +67 908 +67 394 +67 937 +67 687 +67 213 +67 848 +67 575 +67 0134 +cat on +cat ure +cat Num +cat sand +cat maid +43 10 +43 001 +43 934 +43 964 +43 955 +43 968 +show Info +show Admin +show calls +show Fig +show Plots +show Legend +show stores +show Chorus +show CategoryItem +show Fps +show XCanvas +show YCanvas +show ZCanvas +bot an +bot om +bot states +bot Web +nal t +Ġitem types +head c +head arr +head Jnt +head xsect +Ġ{" ()": +Ġsource IP +cl str +cl enter +cl vm +cl kk +cl vls +use Device +use nc +use Skip +use Abs +use Https +ĠCON N +ĠCON TR +ĠCON DA +ĠCON CEPT +ĠCON CURRENT +ĠCON VERT +python s +python da +python bytes +device info +device Info +device Label +Ġup map +Ġup link +Ġup Pos +Ġup Block +Ġup Target +Ġup take +Ġup mL +Ġup Blink +Ġup Eyelid +Ġup gList +Ġshould Abort +izer Spawner +Ġcor o +Ġcor os +Ġcor so +Ġcor rs +Ġcor rf +Ġcor ona +Ġcor retamente +Ġcor riere +ĠPro MP +ĠPro sim +ĠPro jections +ĠPro ceso +ĠPro digal +ĠPro fesional +Ġdataset te +Ġdataset Name +Ġdataset Dict +results dir +Table Column +Table Input +Table Rows +Table ClickhouseAnnotation +CL Y +CL h +CL BZ +Ġplot Next +Ġplot Legend +Ġplot nine +FF D +FF V +FF CE +FF FC +FF mpeg +vid mode +vid cap +vid jeti +vid goyal +search Model +search pts +search For +search Cat +search Insert +search Friends +Ġ:: ::: +uid o +uid map +uid attr +ĠList as +ĠList ings +ĠList Size +ĠList Dataset +ĠList Instances +ĠFlag Maker +Ġcontin ents +Ġ100 07 +Ġ100 18 +Ġ100 28 +Ġ100 21 +Ġ100 109100 +INT EXT +INT ENSITY +INT HEBAG +ins i +ins om +ins urer +ins Discretizer +fir N +fir ing +fir ingEvent +vo or +vo ce +vo coder +vo lare +:: | +:: ", +:: %. +dep Name +000000 12 +000000 13 +000000 06 +000000 23 +000000 43 +000000 100101010110110000 +Ġnet wor +Ġnet utils +Ġnet cat +Ġnet proto +Ġnet conf +Ġnet weaver +Ġnet uitive +Ġnet filterqueue +Ġpoint A +Ġpoint data +Ġpoint wise +Ġpoint rs +SI H +SI q +ug ent +ug am +ug os +ug are +ug acy +ug ato +ug abo +ug ibi +ug uale +ug askan +Ġmatch able +Ġmatch model +Ġmatch tags +Ġmatch Result +Ġmatch Matrix +Ġmatch maker +Ġmatch Tallies +entry type +entry points +entry Key +({ ( +Ġsample type +Ġsample Id +Ġsample Num +Ġsample Names +Ġsample Mean +Ġsample Success +cu ss +cu ador +cu QI +cu encias +Ġother name +Ġother Utils +Ġother Cost +Ġother Purchase +Ġother Mortgage +page Token +down text +down step +down buff +down going +down Payment +down town +down voting +std call +Ġaction Btn +Ġresults File +PI I +PI K +PI x +PI PS +PI PEN +''' + +48 10 +48 95 +48 28 +48 644 +48 272 +48 2814 +sv V +ie urs +ie zione +)* ' +Ġqu y +Ġqu als +Ġqu reg +Ġqu ake +Ġqu acc +Ġqu arti +Ġqu ê +Ġqu ocsp +Ġqu anity +Ġqu ieres +)): . +Ġimg H +Ġimg i +Ġimg base +Ġimg fmt +Ġimg Filename +Ġimg filenames +Ġimg zmq +EX B +EX O +EX v +EX ION +EX PAT +EX PY +EX ENAME +EX CEL +EX ASY +EX PERIMENTS +EX CITON +91 934 +91 937 +91 927 +ĠData Value +ĠData Test +ĠData Parser +ĠData Key +ĠData pack +ĠData Logger +ĠData Handler +ĠData Element +ĠData Format +ĠData Plot +ĠData Types +ĠData hub +ĠData Sequence +ĠData Flow +ĠData Hub +ĠData Transformer +ĠData Si +ĠData Robot +ĠData InputStream +ĠData Normalizer +ĠData Plotter +ĠData Uploader +ĠData GridView +ĠData KernelException +ĠData LengthStandardizer +ĠData plotOption +#! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! +only include +FA CTION +FA HP +FA IRE +FA IBAIB +FA HRENHEIT +FA gEAgEA +err ata +err log +err info +err ero +err DecShiftArr +err RaShiftArr +err DecShift +err RaShift +pass o +pass in +pass er +pass ation +pass Filter +pass ato +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +Ġany call +fe B +fe K +fe Name +fe ey +fe her +fe els +fe Flood +fe GaussianBlur +fe omorphic +fe itos +fe ilaktig +Ġfilename ids +ating Aggregator +red dest +red die +а е +а ÑĨи +60 996 +60 9975 +Ġfirst ip +Ġfirst Time +Ġfirst Pos +Ġfirst Char +Ġfirst Img +Ġfirst Vid +Ġfirst Coeff +Ġfirst MaxHeight +Ġfirst StrFound +Ġfirst DotIdx +No a +No on +No pe +No ob +No vel +No ised +No Mac +No Selection +No VI +No Editor +No Focus +No Wx +No eF +No DataValue +No MatchError +No JetsBVeto +total count +total Time +total results +total Info +total Results +total hosts +total dos +total Energy +total Colors +total occupancy +total Months +total SaImagePatientNum +total Alerts +total Liquidity +total Earnings +total FruitPureePercent +ze al +ze ip +ze apy +ze jie +ze botWeb +Ġ'. % +Ġ'. -. +\\ ']. +\\ *\" +mode li +Ġarray List +Ġarray Test +Ġarray Valid +Ġarray Factor +Ġarray Expr +Ġarray ByteCount +Ġarray GroupMAPE +Ġarray ToGLType +ãģ IJ +ãģ Ĵ +rate list +rate Fire +content type +content file +content Language +content Encoding +content Disposition +ĠAr ts +ĠAr gon +ĠAr kh +ĠAr rival +ĠAr kestra +42 025 +42 074 +42 088 +42 363 +42 1875 +42 1885 +TT G +TT ING +TT EST +TT ABLE +TT GS +TT LS +TT ae +TT Font +TT IGG +Ġtemp d +Ġtemp n +Ġtemp img +Ġtemp func +Ġtemp Path +Ġtemp Dict +Ġtemp window +Ġtemp TS +Ġtemp Pnts +Ġtemp TweetIDs +])) ' +])) \ +])) } +])) ], +])) +" +msg types +msg hdr +msg RateInSeconds +Ġgroup size +Ġgroup Df +Ġquery String +Ġquery Norm +Ġquery Cell +Ġquery BatchSize +ĠOptional ListStr +last size +last move +last cmd +last hop +last Modified +last Actions +last Changed +last uidl +last PTB +last segid +last messageid +pha setwo +stamp ing +stamp file +stamp ato +copy able +copy Attributes +copy FolderFiles +MA V +MA l +MA AA +MA udio +Path Tra +Path Component +Path Cost +Path Details +Path Finder +Path Strings +Ġright avg +Ġright Square +ĠException Wrapper +ĠException Middleware +ĠException Reporter +left s +left Port +left Count +left SM +left buff +left Margin +project dir +project Config +project Configuration +project Labels +project calico +logger Handler +EL IB +EL APSED +'): ] +Ġpri zes +Ġpri skirt +Ġpri pojen +Model IO +Model API +Model Cache +Model Adapter +Model Permissions +Model Assembler +Model CheckPoint +Model SummaryCsv +EST OR +EST ONES +EST IMATE +link it +link ers +link ings +link state +link Name +link Node +link Object +link uri +link Style +Ġcontext Dir +Ġcontext Word +Ġprocess data +Ġprocess Node +Ġprocess monitor +Ġprocess Standard +Ġprocess Func +)/ " +)/ ', +)/ (\ +)/ <( +task class +task view +task flow +task Token +task master +task Definition +task Conds +е Ñī +ca j +ca ma +ca val +ca using +ca emo +proto buffer +proto byname +mbed ding +")) ( +")) ): +Ġhttp Protocol +expr Search +âĶ Ľ +iss n +iss ar +)), ), +Ġaxis System +Ġaxis below +DAT AROB +board position +âĸ ¶ +ï¼ ĭ +axis Swap +Ġfig s +Ġfig uring +Ġfig ura +Ġfull model +Ġfull title +Ġfull tag +Ġfull negatedword +Ġfull originalword +Ġuti lites +Ġuti litues +ten a +ten able +ten acity +ten stein +ĠIS A +ĠIS IS +ĠIS INs +ĠIS OTROPIC +lete PomeriumSession +span bound +ĠValue Type +ĠValue Change +ĠValue Proxy +ĠValue ToWrite +server name +server Socket +server Uri +mt n +mt ks +mt bl +Ġwork horse +"> [ +"> #' +"> "+"\ +"> / +"]) \ +"]) ]) +"]) ]. +"]) }) +"]) ;\ +Ġexp j +Ġexp map +Ġexp List +Ġexp resses +Ġexp Year +Ġexp Month +Ġexp unge +Ġexp anse +Ġexp CompInDQ +Ġunit b +Ġunit Size +Ġunit PreIndex +parent al +parent MatchingStyles +Ġtag type +Ġtag line +Ġtag Type +Ġtag filter +Ġtag Map +Ġtag strings +Ġcount L +Ġcount Var +Ġcount Groups +Ġcount firmreward +points Blockerized +dic are +dic ante +dic enet +Get Res +Get Text +Get Time +Get Max +Get Response +Get State +Get Base +Get Sub +Get Label +Get Resource +Get Min +Get Op +Get Element +Get Local +Get Python +Get Target +Get JSON +Get Project +Get Directory +Get Step +Get Translation +Get Container +Get Global +Get Tool +Get Points +Get Full +Get Processor +Get Angle +Get Sys +Get Axis +Get PomeriumServiceAccount +Get Inventory +Get Spacing +Get ComponentDef +Get Dynamic +Get PodResource +Get Executable +Get Quaternion +Get Joints +Get RootNode +Get Ram +Get ConnectivityTestRequest +Get FieldID +Get Compositions +Get VFP +Get MappingMode +Get Dihedral +Get Pstates +Get LastError +Get SecretValue +Get Dlg +Get SPName +Get ForegroundWindow +Get CoolerSettings +Get BuildDir +Get ProgressMessage +Get ExternalNonContainerDatabase +Get PfxFileName +Get NumAtoms +game time +game Main +game loading +game Nr +game Started +Ġwrit ed +Ġwrit eto +UM ASK +UM DQ +UM BER +UM ULATION +Node Def +Node Not +Node Query +Node Func +Node Ports +Node Attrs +Node LabelList +ĠPar rot +ĠPar alle +ĠPar adox +ĠPar abéns +match back +match rank +match toks +tx p +tx info +tx To +tx Start +tx xxx +tx ctls +76 11 +76 16 +76 04 +76 06 +76 14 +76 34 +76 09 +76 36 +76 57 +76 75 +76 28 +76 98 +76 214 +76 906 +76 306 +76 185 +xy C +xy scale +xy PosHandles +Ġ'/ '+ +Ġ'/ **/*. +81 998 +lambda F +lambda G +lambda S +ERS ERVICE +39 177 +39 854 +39 075 +39 088 +ymb Bar +eval Date +eval Files +Ġclient config +ny Z +Ġcall from +Ġcall Args +Ġcall Later +ice k +ice ye +Ġbreak ed +Ġbreak Strings +td q +td w +td z +Ġsum Fit +Ġsum Square +Message Add +Message Event +Message Factory +Message Popup +Message Lite +Message ToDict +Message ListenerCallback +address List +address book +Add To +Add Method +Add Unit +Add Imm +Add Translate +Add Relu +Add Accessed +Add Fiducial +Add BookmarkCallback +Add LineageRequest +Add RuntimeMessage +Add Channeld +pc L +pc g +pc nt +pc ds +pc ms +pc dn +pc LxW +Ġsave able +Ġsave filename +Ġsave Dict +Ġsave hist +Ġsave Category +Ġsave Img +Ġsave ModSec +Ġover ly +Ġover views +Ġover come +Ġover writ +Ġover buy +Ġover due +Ġfa ust +Ġfa ça +Ġfa ileds +rand s +rand var +rand ao +Ġ", # +Ġ", "\ +Ġ", "). +Ġ", \\") +Ġ", "")) +bar Width +bar sizes +bar PA +bar Height +bar horizontal +bar ometer +bar shi +bar ney +bar riers +bar polu +Ġtensor shape +Ġtensor pack +Ġtensor bay +Ġtensor hive +Ġtensor FromSentence +Ġele ctions +bl m +bl num +bl ending +bl ksz +Ġass ists +Ġass inatura +Ġass igment +Ġass inalado +Ġiter at +Ġiter count +Ġiter Items +Ġiter fzf +matrix js +uni str +uni ver +uni fication +uni kal +uni queness +uni MIBCompliances +Ġtyp name +play Other +play grounds +char le +char ter +char count +char map +char List +char les +char mcraft +================================ ============= +Ġmake tests +Ġmake Color +Ġmake Json +Ġmake Eight +Ġmake DLP +struct ed +struct log +struct Type +struct Base +conf name +conf str +conf Directory +build args +build project +build Number +build settings +build tool +build Scopes +Ġbool Deep +Ġbool Bias +Ġ& &&&&&&&&&&&&&&&& +limit ation +limit ée +cho y +cho colate +Number Sum +Number Images +Number edList +aw ss +aw spk +aw arded +(\ ( +(\ '' +(\ +|- +tensor network +--- * +--- .__ +Ġed g +Ġed l +Ġed m +Ġed en +Ġed pt +Ġed getpu +Ġed wardyehuang +Ġlast h +Ġlast file +Ġlast ip +Ġlast row +Ġlast Data +Ġlast Num +Ġlast block +Ġlast URL +Ġlast Pos +Ġlast Entry +Ġlast Item +Ġlast Version +Ġlast seen +Ġlast Face +Ġlast Img +Ġlast TradeTimestamp +Ġlast linelen +Ġchar ma +Ġchar data +Ġchar Str +Ġchar IDs +Ġchar lie +tmp c +tmp File +tmp filename +tmp dirname +tmp profile +Ġtoken f +Ġtoken files +Ġtoken Create +Ġtoken izing +Ġtoken TimeStamp +dump search +dump xml +dump vars +dump button +dump STR +dump Shebang +anti alias +anti clockwise +Ġnorm i +Ġnorm alizations +Ġnorm alizar +TO BJ +TO URS +Ġword t +Ġword files +Ġword And +Ġword Vectors +Ġword relationships +Ġword toix +ren as +ren tes +ren dez +ren cias +ĠSee ingClearly +ESC HEMA +Ġfound row +Ġfound End +Ġfound Existing +Ġfound Mails +Ġfound Mets +Ġfound FirstBreak +Ġfound Treemap +ik Q +ik W +ik Y +ik r +ik iz +ik model +ik UA +ik Qi +ik usi +ik ostan +ik HandJoint +duct code +conv in +conv seg +conv bert +conv Ret +conv large +conv Missing +conv gru +conv Layers +conv Inputs +ui y +ui jn +čĊčĊ ĠĠĠĠĠ +čĊčĊ čĊĉĉ +čĊčĊ čĊĠĠĠĠčĊĠĠĠ +čĊčĊ Ġč +src Paths +src Img +src TestFilePath +ĊĊĉ ĊĊ +ĊĊĉ ĊĉĊĉĊ +Ġmode ci +Ġ## ') +Ġ## ::::::::: +entity Type +entity TypeIndex +scale IK +PAT R +PAT ENT +PAT ERN +mer o +mer ry +mer cen +54 11 +54 17 +54 27 +54 55 +54 36 +54 932 +54 555 +54 321 +54 15926535 +channel Id +she ffc +Tra sh +Tra vis +Tra duction +Tra ils +Tra ctatus +ial lo +1011 01011 +1011 001111 +1011 1001111 +Ġframe time +Ġframe match +Ġframe bit +79 00 +79 14 +79 558 +79 0510 +Key code +Key String +Key Response +Key Point +Key Spec +Key Provider +Key Pair +Key Chain +Key InUse +Key ReferenceArgs +Ġfla ming +Ġfla voring +Ġinto x +Ġinto gen +template file +template dir +Ġauth s +Ġauth name +Ġauth key +Ġauth enticator +Vi et +Vi Tt +Ġoff s +Ġoff load +Ġoff shore +itle y +cv d +cv f +cv Hi +const it +74 12 +74 17 +74 93 +74 96 +74 87 +74 23 +74 77 +74 144 +74 876 +74 901 +74 9615 +74 0907 +74 15926535 +ĠVar Def +ĠVar Pool +ĠVar Bind +ĠVar DeclarationNode +ose q +Dict Flatten +cmd queue +cmd Arg +roll ES +Ġdim X +Ġdim mention +tick r +tick list +tick Log +tick interval +MIB Objects +Ġobj f +Ġobj et +Ġobj attr +Ġobj etivo +epoch num +epoch Save +exit Status +MO US +MO LLERS +Ġ', " +Ġ', '] +Ġ', '). +Ġ', '\ +Ġ', ''))) +Ġstep E +Ġstep Num +vector List +ĠTone Set +ĠTone Analyzer +Ġtop score +Ġtop left +Ġtop Level +mem or +mem set +mem UtilTask +enter box +enter tainment +Ġ'__ / +ĠCo M +ĠCo co +ĠCo ach +ĠCo oper +ĠCo arse +ĠCo alesce +ĠCo NLL +ĠCo lossal +ĠCo qState +ĠCo vJSON +less er +less ubscribe +01111 1101 +01111 10110 +01111 1011111111111111101 +fn r +fn fe +fn Dict +Ġexpected Values +Ġexpected Parent +Ġexpected Indexes +Ġexpected Thinned +73 00 +73 02 +73 12 +73 347 +73 1965 +email Data +Ġfind Max +Ġfind Sub +Ġfind Tag +Ġfind And +Ġfind Children +Ġfind Pole +Ġfind Substring +Ġfind MinimalPhsBandCovering +dis X +dis ce +dis array +dis own +dis inf +dis cout +dis GOL +dis rupter +dis chtime +fit r +fit ters +fit Status +fit datastat +Ġimp ut +Ġimp ath +Ġimp rint +Ġimp ls +Ġimp lic +Ġimp Model +Ġimp uting +Ġimp ulse +Ġimp rima +Ġimp ulso +Ġimp recision +property Node +Ġ... }, +Ġ... '): +Ġ... "}, +Ġ... ]): +Ġ... )') +Ġ... ]]: +LI b +LI QU +LI WC +LI PID +Ġnext B +Ġnext f +Ġnext List +Ġnext char +Ġnext Ts +String Reader +String Handle +ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠ +Object Set +Object Factory +Object Container +Object Ids +Object Detector +Object ExprContext +Object PathComponent +Com Arg +Com oe +Com anche +Com Pes +FT M +FT EST +FT oken +FT IR +FT PARA +Comp lt +Comp uted +Comp rome +Comp lian +Comp etitiveSignal +Comp arer +Comp utational +common ly +common prefix +common js +common Device +common libs +common Phone +common datastorage +Ġorder book +cache able +cache Control +cache Ver +cache Blocks +cache hierarchies +Bo om +Bo ule +Bo VB +stack triax +day Key +day Of +day diffs +send term +send Next +send mmsg +ush ing +Ġuni forms +Ġuni forme +ful TestCase +adj s +adj close +adj agecy +ĠĠĠĠĠĠĠĠĠĠĠĠ Ċ +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ +ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ +0101 7 +0101 0000011 +0101 011100001111 +Ġtyping ctx +pred st +pred step +pred File +objects JSON +unk i +unk n +Ġfilter Global +Ġfilter banks +Ġfilter Entities +Ġfilter StatsEntry +Ġspecific Match +variable Count +variable Conditioner +next Node +next Key +next Entry +next card +next Char +next Job +next Func +next Ts +next SlideControl +ĠTO O +ĠTO MOR +ĠTO POLOGY +Ġshape Shading +Response Results +Response Processor +Response MPCM +ium a +first frame +first RetryIntervalInMilliseconds +views CSV +dev ic +dev nodes +dev Price +Le vi +Le ia +Le ather +Le aderboard +Le Decoder +Le uco +Le banon +Ġeval d +Ġeval Gamma +ats u +OL TZ +over use +over pass +over rider +over powered +over lord +over ridable +Class Factory +Class Mixin +Class Miss +Class Cached +role Dict +role Credentials +**************** ******* +Input Values +Input Default +Input Element +Input Connection +Input ValidationError +Input Sentence +Input Cmds +PP G +PP n +PP POE +PP XUU +PP vkk +tree ToDict +Ġbuild Tree +Ġbuild Graph +edge List +Ġab it +Ġab ert +Ġab ide +Ġab tools +Ġab aq +Ġab ritrary +Ġsupp resses +Ġmath jax +58 1024 +58 224 +58 197 +58 013 +58 996 +58 937 +58 947 +58 966 +58 247 +58 067 +58 945 +58 343 +58 354 +58 1559 +ores ize +State Set +State Method +State Changed +State TableError +Ġinstance List +Ġinstance ToTrasferList +Ġfield ing +Ġfield list +Ġfield file +Ġfield Name +Ġfield Ptr +wer o +access Service +access contextmanager +access subg +access KeyId +pr q +pr r +pr u +pr v +pr er +pr atic +pr zed +pr pCryptor +pr ntframe +Ser de +Ser um +Ser vic +Ser gio +Ser vidor +Ser pent +Ser pentine +Ser pJob +gr áfico +Ġ12 12 +Ġ12 06 +Ġ12 03 +Ġ12 17 +Ġ12 14 +Ġ12 37 +Ġ12 97 +Ġ12 36 +Ġ12 86 +dist in +dist id +dist max +dist map +dist files +dist ante +dist into +dist eso +dist urbance +Cont amination +learn able +learn fair +78 01 +78 10 +78 92 +78 32 +78 25 +78 19 +78 27 +78 9218 +78 196 +78 9577 +OP L +OP V +OP p +OP PI +OP SA +OP POSITE +OP ASDF +Out File +Out Back +Out liers +Out Given +Out standing +Ġsettings Dict +ĠTest e +ĠTest ON +ĠTest Path +ĠTest Comp +ĠTest Result +ĠTest Server +ĠTest Loader +ĠTest Search +ĠTest With +ĠTest Vector +ĠTest Multi +ĠTest Utils +ĠTest Player +ĠTest Simple +ĠTest Images +ĠTest Runtime +ĠTest bench +ĠTest Persist +ĠTest Scheduler +ĠTest DataDirectory +ĠTest Goal +ĠTest Impl +ĠTest HET +ĠTest SetGenerator +ĠTest Tensorboard +ĠTest AdminMixin +ĠTest Gyp +ĠTest CallRate +ĠTest CormEnum +Reg CM +Reg Density +req from +req val +req Account +req Ids +case block +case No +и ÑĢÑĥем +и анÑĤ +Ġlocal list +Ġlocal dict +Ġlocal File +Ġlocal User +Ġlocal cidr +., ;: +Ġsign o +Ġsign bank +ãĤ © +Ġdest Path +Ġdest Group +Ġdest iny +"\ . +"\ /\ +"\ "# +Ġ16 18 +Ġ16 25 +Ġ16 85 +Ġ16 90 +Ġ16 77 +Ġloss fn +Ġloss Function +DIR TY +Ġ.. - +("\ "") +("\ ""+ +pol R +pol name +pol ated +pol Angle +pol lination +pol ynode +ĠNo i +ĠNo Item +ĠNo Engine +ĠNo Cache +ĠNo PluginError +stru ÃŃdo +Ġbin I +Ġbin ner +Ġbin keys +Ġbin edges +Ġbin ja +Ġbin Samples +Ġbot pie +Ġbot ões +job app +job search +job trace +change it +change time +change point +change Number +change sets +change Reason +change Fsync +User Def +User Size +User Resource +User Detail +User Details +User Messages +User Slice +User Dashboard +User CreationForm +Ġman que +Ġman ki +Ġman uscript +features L +system Name +system Url +system Settings +system Host +lim ine +59 18 +59 16 +59 55504 +Ġparse Input +Ġparse Int +Ġparse addr +Ġparse opts +Ġparse lem +Ġparse Drug +Ġroot Name +Ġroot Dir +XXXXXXXX X +uper pixel +seq B +seq db +seq Dict +seq tk +seq fullname +seq CWT +Ġport list +Ġport hole +Ġallow ance +SS Q +SS a +SS LC +Ġhead water +queue delay +ĠDe ve +ĠDe als +ĠDe velop +ĠDe bt +ĠDe convolution +ĠDe composer +ĠDe couple +ĠDe hydr +ĠDe coy +pen L +pen insula +sw ss +sw ob +sw av +sw allow +sw orth +sw ana +sw aran +sw aty +sw rangler +Ġproject es +Ġproject Dir +Ġproject Title +CA F +CA k +CA s +CA z +CA CT +CA SET +CA xis +CA USED +CA AAA +CA UX +CA ATCT +CA FFE +CA AGGT +CA STLING +Ġsetup aws +Ġexec time +Ġexec ure +Ġexec uter +spec name +spec unit +spec mod +spec Dir +spec Epoch +53 92 +53 34 +53 025 +53 159 +si q +si ot +si xd +si ATI +si Strip +View point +View let +View URL +View Filter +View Mixin +View Func +rule set +rule IP +Ġform ing +Ġform ulated +Ġform FieldPrefix +sor ce +sor tid +delta Intervallo +github rest +Ġlength y +Ġlength Scales +Ġlib E +Ġlib ro +Ġlib mp +Ġlib path +Ġlib act +Ġlib ell +Ġlib ros +Ġlib dirs +Ġlib city +Ġlib fb +Ġlib ensemble +Ġlib crypto +Ġlib atlas +Ġlib jax +Ġlib vips +Ġlib gexf +Ġlib nacl +Ġlib ecc +Ġlib Ensemble +Ġlib cellml +čĊĉ čĊĉčĊ +Exception Message +åı © +68 00 +68 32 +68 14 +68 96 +68 94 +68 97 +68 28 +68 113 +68 094 +68 943 +68 2815 +68 92494 +ĠRes olved +ĠRes istance +ĠRes Grp +ĠRes cue +ĠRes umo +setStatus Bar +Ġstatus code +Ġstatus Params +Ġextra ce +Ġextra dep +TY E +TY H +TY b +TY f +TY ER +TY UI +TY PING +network zone +network Dir +network Location +network Epoch +network Uuid +network Zones +network HoldMohAudioSourceId +Trans X +Trans f +Trans Value +static ally +abs list +abs diff +ĠGener alize +ĠGener alization +ĠGener ador +IND UCTOR +option chainanalysis +CE B +CE F +CE KHI +qui co +ãĥ ¨ +ãĥ ² +ãĥ Į +Ġglobal Scope +numpy doc +Ġav ant +Ġav conv +Access ing +Access Type +Access ory +Access URL +Access Logger +Ġdirectory ToUnzipTo +xff A +xff B +xff D +xff E +xff I +xff Q +xff R +xff Y +xff b +xff q +ym U +ym q +ym ine +ym ind +ym enu +ym metric +ym shIH +package Name +service connector +service Agreement +Th w +Th z +Th us +Th under +Th ilo +Th ailand +pb I +pb Data +pb ank +pb alls +pb rasil +Index Length +Index Word +Index Pipeline +Index Slice +ia is +ia ith +ia Bot +ia oct +ia XN +author ing +Ġstd q +Ġstd r +Ġstd channel +Ġstd meta +acc are +acc group +acc gg +acc ès +xx ht +xx xyyy +xx Pvz +Ġ'-- '), +çļĦ shape +çļĦ 为 +çļĦ æĪIJ +çļĦ ä¸Ģ个 +çļĦ åĪĹ +çļĦ ãģ« +çļĦ åħ¨ +çļĦ éĶ® +çļĦ éħįç½® +çļĦ åŁº +çļĦ å¯Ĩçłģ +çļĦ 主 +çļĦ å®ļä¹ī +çļĦ 对象 +çļĦ è¾ĵåĩº +çļĦ ä»»åĬ¡ +çļĦ åľĨ +çļĦ 代çłģ +çļĦ æĵįä½ľ +çļĦ æķ°ç»Ħ +çļĦ ç³»ç»Ł +çļĦ éĿŀ +çļĦ æķ´æķ° +çļĦ åĿIJæłĩ +çļĦ 缮æłĩ +çļĦ æł·æľ¬ +çļĦ éĢī项 +çļĦ å½¢å¼ı +çļĦ åģı移 +çļĦ 维度 +çļĦ çĪ¬èĻ« +çļĦ åŁºæľ¬ +çļĦ ç½ijæł¼ +çļĦ åĮºåĪ« +çļĦ ä½ľçĶ¨ +çļĦ è¡Ģéĩı +çļĦ æķ°çĽ® +çļĦ protobuffer +ĠPython s +ĠPython Module +ĠPython LaunchDescription +At test +At Start +At Step +At Least +At tribu +At LastLine +PL A +PL X +PL Z +PL ly +PL ING +PL IB +PL ANS +PL ICATION +PL MN +PL KK +pack two +pack Manifest +Ġblock ers +Ġblock list +Ġblock Name +Ġblock header +Ġblock diag +Ġblock Names +Ġblock Types +Ġblock Sizes +Ġparameter ised +late xtool +fs n +fs Path +fs mt +fs decode +fs anitize +ordin ating +ordin ators +unit b +unit dist +unit Ãł +(_ ). +Man aging +Man teiner +Ġchange set +Ġchange list +Ġchange Angle +ency clo +52 99 +52 19 +52 96 +52 97 +52 90 +52 98 +Ġ"/ ? +Ġ"/ ^ +Ġ"/ _ +Ġ"/ *" +cell Out +cell wise +cell any +cell Values +cell aris +cell props +cell Expression +cell Reserved +schema Ref +schema Location +schema validator +ĠUser Account +ĠUser Schema +ĠUser Credentials +ĠUser Course +ĠUser WebSocket +ĠUser Defined +ĠUser Follower +ĠUser Preferences +ĠUser UpdateForm +ĠUser OpenID +Of F +Of lines +Of Link +Of Two +Of Expr +Of Fields +Of Interest +Of fices +position Exists +position AtLastLine +QU g +QU FB +QU Cg +QU ENCH +sq ls +sq lex +sq euclidean +sq ladvisor +If Name +If pert +If Box +If Cap +If Needed +If VlanId +If Necessary +62 12 +62 03 +62 88 +62 19 +62 96 +62 85 +62 86 +62 347 +62 865 +Up Lo +Up URL +Up keep +Up Down +ank u +ank y +ĠCreate Object +ĠCreate Button +ĠCreate From +ĠCreate Proposal +ĠCreate Digest +Ġfeatures L +Ġfeatures Version +ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ +nap aka +nap akk +)[ [' +)[ ()] +)[ ...] +Ġmsg First +ĊĠĠ ĊĠĠĊĠĠĊĠ +ÑĤ ом +ÑĤ олÑĮко +Ġhere under +Sh in +Sh all +Sh ark +Sh ah +Sh annon +Sh akespeare +remove stamp +remove Class +remove Bookmark +remove NonAscii +Ġ255 2 +Ġ255 3 +Ġ255 6 +opt flow +opt Estimator +ublic ate +GH w +xml filename +xml String +xml Ser +xml schema +xml gameevent +Ġexist en +Ġexist ant +Ġtitle bar +ba H +ba af +ba atar +ba Wavefunction +Image Handler +Image Button +Image Stream +Image NotFound +Image Container +Image Font +Image ROI +Image DataGenerator +Image HDU +Image SpriteId +Image Png +Image InstanceCollection +pping Rate +oken izer +oken Parameter +ĊĊĊĊ ĊĠĠĠĠĠ +ĊĊĊĊ Ċĉĉ +ĊĊĊĊ ĊĊĊĠ +ĊĊĊĊ ĉĉĊ +Int f +Int ra +Int set +Int Action +Int ConstContext +Int ArgType +IP R +IP Sec +IP SUM +xec D +xec H +xec I +xec L +xec P +xec Q +xec X +xec Z +xec b +xec d +xec f +xec j +xec m +xec r +dot o +dot log +dot count +ĠSo lem +ĠSo Ca +disp name +disp lot +disp uted +disp osed +disp osing +:] } +:] ', +:] == +:] }" +:] `. +:] }/{ +��tmp f +Ġtmp File +Ġtmp dirname +Ġtmp fname +Ġtmp New +Ġtmp First +Ġtmp Json +Ġtmp Filename +Ġtmp Each +Ġtmp Tmp +Ġtmp Layers +Ġtmp Fig +Ġtmp LFN +Ġtmp Exr +Ġtmp FilesList +Ġtmp PeakOrder +49 84 +49 646 +49 086 +RES ELECT +RES PAWN +RES UMED +RES ISTOR +pu ff +pu db +radi obutton +book ed +book title +book lets +book worm +ÑĢ ог +ÑĢ иб +ÑĢ еÑĦ +Ġpackage dir +Ġpackage Name +Ġpackage LastModifiedTime +Ġmap set +Ġmap size +Ġmap utils +Ġmap entity +Ġmap Wbem +Ġmap Survol +ĠPath List +ĠPath Wrapper +ĠPath Validator +ĠPath finding +DB Y +DB z +DB us +DB Reader +DB Unknown +DB Snapshot +DB DRIVER +DB lue +DB IAC +DB tAI +URL Base +header ed +header path +header col +header metadata +header Cache +Def end +Def ending +Ġtuple Id +Ġtuple tuple +Ġmask i +Ġmask w +Ġmask able +Ġmask Gray +0100 10 +0100 55 +0100 10011 +0100 1100 +0100 10110 +0100 0101100000111 +0100 1010110010101 +012 852 +Ġgraph args +Ġgraph array +Ġgraph net +Ġgraph ie +Ġgraph dot +Ġgraph sage +Ġgraph ivz +xaf D +xaf Q +xaf X +xaf Z +xaf c +xaf d +xaf l +xaf q +xaf r +xaf w +Info Ex +Info Method +Info Factory +Info Wrapper +Info Title +Info Actor +---------------------------------------------------------------- --- +---------------------------------------------------------------- ------- +---------------------------------------------------------------- ------------ +ene g +ene i +ene er +ene gal +ene Pipeline +ene gro +Ġ". "): +Ġ". "}, +Ġ". "))) +Ġ". *") +Loc File +internal Id +internal Are +BU FG ++' -% ++' }' ++' %- ++' ">'+ +part B +part ly +part config +part probe +part nership +example Plot +example SetDir +EM ail +EM LB +EM KB +Ġter adata +Ġter med +Ġter cio +Ġter restre +Ġter itori +Ġ202 7 +Ġ202 00 +decode Htm +SC K +SC N +SC IM +SC RC +SC rypto +SC VI +SC UDE +SC gU +SC IPY +SC ORER +tic ional +tic stoolbox +Ġmore Changes +su a +su er +su us +su ic +su da +ĠVersion Meta +ĠVersion Upgrade +Ġsorted Array +Ġsorted Champs +ĠSet or +ĠSet Name +ĠSet ters +ĠSet Property +ĠSet Motor +ĠSet Slice +ĠSet Cart +ĠSet MemberForces +ĠSet RestrictedTransferMethod +PRO CM +PRO PN +PRO CFS +abel le +Context o +Context Error +Context Var +Context Types +Context Flags +Context Creator +sim Ecal +sim Sbe +Ġ"" ))) +Ġ"" }) +Ġ"" }], +Ġ"\ '" +Ġ"\ '% +202 01 +202 534 +Ġoffset box +Ġoffset Start +Ġfi er +Ġfi ssion +}\ ', +}\ ", +}\ ") +}\ )? +}\ "") +}\ '') +}\ .){ +}\ ..{ +}\ [\]] +Ġorig count +Ġorig ial +Ġorig ination +Ġorig intrain +63 16 +63 04 +63 15 +63 34 +63 80 +63 033 +Request Get +Request State +Request View +Request URL +Request Wrapper +Request Body +Request Apdu +Request ForQuote +Ġoptim izes +This Batch +ĠWe ber +ĠWe ird +ĠWe eks +ĠWe apons +ĠWe ibull +ĠWe hrmann +stream sets +stream Arn +stream Encryption +stream Stopped +Ġ15 99 +Ġ15 0000 +Ġ15 18 +Ġ15 04 +Ġ15 03 +Ġ15 08 +Ġ15 37 +Ġ15 94 +Ġ15 20 +Ġ15 86 +Ġ15 90 +Ġ15 28 +Ġ15 29 +Ġ15 21 +password MsgFinished +Ġserver less +Ġserver IP +Ġserver Count +Ġserver Settings +binary Path +CC B +CC P +CC z +CC or +CC IO +CC DF +CC CS +CC ACHE +CC ACA +CC GCT +CC Pic +CC BRK +Inter leave +Inter peter +Inter nationalization +Inter faz +Inter DayOnline +Inter operabilityTag +Ġgl and +Ġgl Ortho +Ġgl Framebuffer +Ġfont bakery +ĠGet Builder +ĠGet Info +ĠGet Token +ĠGet Color +ĠGet Output +ĠGet Local +ĠGet Dist +ĠGet Project +ĠGet Location +ĠGet Note +ĠGet Called +ĠGet Vm +ĠGet Lambda +ĠGet Sky +ĠGet Dynamic +ĠGet Cert +ĠGet Followers +ĠGet EndPoints +ĠGet ClipboardText +ĠGet NumSamples +72 11 +72 92 +72 18 +72 04 +72 19 +72 86 +72 98 +72 3303 +72 0603 +cluster Config +cluster Ip +cluster Module +cluster apps +cluster TimeSeriesCategorization +delete hash +delete Property +delete UI +delete ByName +ĠAll Hub +ĠAll detections +ĠAll Imgs +AA V +AA g +AA CT +AA ACT +AA AE +AA UCU +AA ITMS +aded Attention +IO Manager +IO Device +IO Buffer +Ġthen ew +nodes List +na W +na ip +na idm +na virice +ĠID CT +ĠID potnika +(* ), +(* [( +wd w +wd x +domain Name +domain Count +itch er +itch at +ASE TTING +åĪ ¼ +Not Implemented +Not Av +Not Installed +Not Loaded +Not oS +Not Interactive +Not AssociatedWith +Not Yet +Not LinkBlock +Not Consistent +__) +"/ +Ġtask i +Ġtask num +Ġtask flow +Ġtask Index +Ġtask Run +CK bz +med T +med itations +med nH +setup script +Create String +Create Object +Create Service +Create DXGI +Create Container +Create Mapper +Create Texture +Create ByName +Create Solver +Create RG +Create BlendShape +Create ConnectivityTestRequest +Create AuditProvider +Create LogGroup +Ġmy data +Ġmy json +Ġmy utils +Ġmy field +Ġmy Number +Ġmy service +Ġmy diff +Ġmy Map +Ġmy cloud +Ġmy lang +Ġmy region +Ġmy Doc +Ġmy Range +Ġmy consumer +Ġmy Offset +Ġmy Interval +Ġmy Func +Ġmy Round +Ġmy fwd +Ġmy Formula +Ġmy GroupId +Ġmy Qr +Ġmy Sensors +Ġmy NodeName +Ġmy Screeners +Ġmy StickyRange +resp s +resp uesta +Base Q +Base ID +Base Path +Base Object +Base Request +Base Resource +Base Task +Base ball +Base Position +Base Controller +Base fits +Base Repository +Base Sampler +Base Backend +Base Adapter +Base Signal +Base Distribution +Base Migration +Base HDU +Base PerRun +Ġtri l +Ġtri ad +Ġtri gg +Ġtri angulo +Ġtri vially +Ġtri mestri +metadata Format +Ġcontent types +Ġcontent On +Ġdocument ing +Ġsim ule +Ġsim mate +Ġsim iliarity +Ġsim étrica +Ġexample Value +Ġph ne +Ġph antom +Ġph armacy +Logger File +Ġsa fer +Ġsa hara +Ġsa isie +ross o +ross rv +ross zul +Ġlevel two +Handler Class +Handler Manager +Handler Adapter +git Release +git timo +Ġnetwork Handler +Ġnetwork Uuid +fla m +fla x +fla vour +API s +API v +API Url +API ErrorCode +ĠjnxMbgSgw T +ĠjnxMbgSgw ProtocolErrRx +ĠjnxMbgSgw PPT +ĠjnxMbgSgw PacketSendFail +ĠjnxMbgSgw DlDataNotifTx +ĠjnxMbgSgw DlDataNotifRx +ĠjnxMbgSgw DlDataAckTx +ĠjnxMbgSgw DlDataAckRx +ĠjnxMbgSgw ResumeNotifTx +ĠjnxMbgSgw ResumeNotifRx +ĠjnxMbgSgw ResumeAckTx +ĠjnxMbgSgw ResumeAckRx +ĠjnxMbgSgw SuspNotifTx +ĠjnxMbgSgw SuspNotifRx +ĠjnxMbgSgw SuspAckTx +ĠjnxMbgSgw SuspAckRx +ĠjnxMbgSgw UnknMsgRx +ĠjnxMbgSgw CreateSessReqTx +ĠjnxMbgSgw CreateSessReqRx +ĠjnxMbgSgw CreateSessRspTx +ĠjnxMbgSgw CreateSessRspRx +ĠjnxMbgSgw BrResFlrIndTx +ĠjnxMbgSgw BrResFlrIndRx +ĠjnxMbgSgw BrResCmdTx +ĠjnxMbgSgw BrResCmdRx +ĠjnxMbgSgw DelSessReqTx +ĠjnxMbgSgw DelSessReqRx +ĠjnxMbgSgw DelSessRspTx +ĠjnxMbgSgw DelSessRspRx +ĠjnxMbgSgw DelIndTunReqTx +ĠjnxMbgSgw DelIndTunReqRx +ĠjnxMbgSgw DelIndTunRespTx +ĠjnxMbgSgw DelIndTunRespRx +ĠjnxMbgSgw DelConnSetReqTx +ĠjnxMbgSgw DelConnSetReqRx +ĠjnxMbgSgw DelConnSetRspTx +ĠjnxMbgSgw DelConnSetRspRx +ĠjnxMbgSgw CrIndTunReqTx +ĠjnxMbgSgw CrIndTunReqRx +ĠjnxMbgSgw CrIndTunRespTx +ĠjnxMbgSgw CrIndTunRespRx +ĠjnxMbgSgw UpdBrReqTx +ĠjnxMbgSgw UpdBrReqRx +ĠjnxMbgSgw UpdBrRspTx +ĠjnxMbgSgw UpdBrRspRx +ĠjnxMbgSgw UpdConnSetReqTx +ĠjnxMbgSgw UpdConnSetReqRx +ĠjnxMbgSgw UpdConnSetRspTx +ĠjnxMbgSgw UpdConnSetRspRx +ĠjnxMbgSgw CrtBrReqTx +ĠjnxMbgSgw CrtBrReqRx +ĠjnxMbgSgw CrtBrRspTx +ĠjnxMbgSgw CrtBrRspRx +ĠjnxMbgSgw RelAcsBrReqTx +ĠjnxMbgSgw RelAcsBrReqRx +ĠjnxMbgSgw RelAcsBrRespTx +ĠjnxMbgSgw RelAcsBrRespRx +ĠjnxMbgSgw GTPUnknVerRx +ĠjnxMbgSgw StopPagingIndTx +ĠjnxMbgSgw StopPagingIndRx +ĠjnxMbgSgw DlDataNotiFlrIndTx +ĠjnxMbgSgw DlDataNotiFlrIndRx +ĠjnxMbgSgw PcktLenErrRx +ĠjnxMbgSgw UnSupportedMsgRx +ĠjnxMbgSgw RxPacketsDropped +ĠjnxMbgSgw GTPPortErrRx +ĠjnxMbgSgw PacketAllocFail +ĠjnxMbgSgw IPVerErrRx +ĠjnxMbgSgw IPProtoErrRx +mc r +mc as +mc ap +Ġgrid weights +Ġgrid linewidth +Ġgrid Dim +Ġgrid peak +Ġgrid linestyle +AY YB +xfe B +xfe I +xfe e +xfe g +ude ep +Ġconst ela +Ġleft Square +font able +font dir +font color +font File +font Scale +font Height +font Weight +font Properties +font Face +font Roboto +enu wrap +'][ ( +'][ { +ars is +Al f +Al z +Al an +Al te +Al one +Al ong +Al Al +Al arms +Al anine +Al corn +Al ameda +Al monds +Ġsent num +Ġsent Ctr +Ġsent entias +make code +make Response +make install +make Record +make depends +make meme +make Legal +make DimLess +make AttrTags +year Company +Ġ'' " +Ġ'' + +Ġ'' ", +Ġ'' '), +execute Preview +Ġenv py +gg able +gg save +gg cc +gg ara +gg ttcgt +gg actcaag +Qu in +Qu ake +Qu asi +Qu Miw +ause n +ause Method +video archiver +video ListPath +keep ers +=- ' +=- ( +Ġsame Region +Ġsame OriginOnly +By Data +By List +By Path +By String +By Default +By Layer +By Action +By Ag +By Feature +By Cycle +By Alg +By Middles +Option Builder +ĠFor ex +ĠFor ked +ĠFor wards +ĠFor enci +Ġidx Split +################################################################ ############################################################### +Ġtraining data +Ġtraining Mat +window Title +fp g +ground work +ground state +ground Truth +ground truths +Ġsearch Model +Ġsearch Element +Ġsearch Keys +Ġsearch Subdir +Ġtransform lat +Ġtransform List +Ġtransform lng +1000 1111111111111111101 +dec r +dec in +dec il +dec im +dec Mat +dec lares +Ġsrc Path +Ġsrc GT +Ġsrc Content +Ġsrc Paths +QL B +QL V +QL GR +QL BY +QL FY +Client Exception +Client Factory +Client BackURL +Client ConnectorError +'\ { +'\ ${ +Ġscri m +69 03 +mod type +mod index +mod erate +mod ulation +mod Content +mod dynamic +mod Security +Ġwrite OK +Ġwrite Location +Ġwrite Area +Ġwrite Edge +Ġwrite CSV +Ġwrite STL +Ġwrite ModelSummaryCsv +App State +App les +App Auto +App Kit +App rentice +App StateError +App BasicAuthConfigArgs +App EnvironmentVariableArgs +ink i +ink oglion +:` [- +:` **{}** +н еÑĢ +н ед +н аÑĢ +н ак +н еп +н нÑı +н оп +н иÑĤе +н ÑĥÑĤÑĮ +н изÑĥ +Ġpandas SQL +dt or +dt ode +dt val +dt max +dt factory +"{ : +"{ \ +ZE VOL +bool Query +TE ARDOWN +"}, " +('\ " +admin pass +admin Password +Ġoper ative +Ġ'\ [ +Ġ'\ '), +Ġ'\ "' +Ġ'\ '') +Ġsu ave +Ġsu iv +Ġsu kal +Ġsu dachipy +Ġsome string +Ġdown right +Ġdown ward +Ġdown scale +Ġdown scaling +full P +full cell +full hd +full scene +full reload +full cw +full ccw +full StationID +Rx Norm +Rx Escape +has Image +has Label +has Quest +has markup +has LTE +has Zigbee +has Commits +xfb B +xfb L +xfb R +xfb T +xfb Y +xfb c +xfb k +xfb q +xfb w +stop bits +stop iteration +stop oulos +diff args +diff spec +diff Tuple +=[' < +256 04 +256 34 +256 24 +256 39 +era ção +era zione +Ġgover ns +Fa W +ĠCh or +ĠCh ol +ĠCh op +ĠCh ab +ĠCh ave +ĠCh ick +ĠCh ao +ĠCh eng +ĠCh aves +ĠCh ung +ĠCh allenges +ĠCh icken +ĠCh ampion +ĠCh orus +ĠCh itiva +ĠCh ronos +ĠCh EMBL +images out +images ToUse +images DType +ĠNOT SET +ĠNOT ICES +uff t +uff es +uff us +register ing +register ation +register Aug +register Interaction +register Triggered +Ġshow img +Ġshow grid +Ġshow UI +Ġshow Score +Ġshow arrow +Ġshow spikes +Ġshow Moon +scal c +scal endar +Ġmatrix es +other tags +other mal +aa ai +aa KD +aa acgc +aa zebotWeb +tex p +tex ar +bytes Per +bytes rem +Ġconvert Type +Ġconvert File +Ad w +Ad Pauli +Ad rian +Ad opters +rap in +ĠImage Num +ĠImage View +ĠImage Group +ĠImage Change +ĠImage Store +ĠImage Meter +ĠImage Math +ĠImage Cro +ĠImage Magick +ĠImage Preprocessing +ĠImage LinearizationExtractor +home stack +home phone +home brew +home automation +Ñģ ÑĢ +Ñģ ем +Ñģ Ñİ +Ñģ ом +Ñģ ÑĥÑĢÑģ +Ñģ ноÑģка +ven ator +ven ient +ven iam +ven aria +Py test +Py PI +Py Doc +Py SQL +Py Pi +Py yy +Py CF +Py Script +Py craft +Py dicom +Py TypeChecker +Py UnresolvedReferences +Py BBIO +Py PSA +inst s +inst orm +inst ock +inst aId +ï¼Į [[ +ĠAny mail +ĠAny IO +ĠAny way +ĠAny Suggestion +Ġmean a +Ġmean time +Ġmean col +Ġmean count +Ġmean Corr +Ġmean CostByEpoch +resource Name +resource Group +resource UrlBase +Ġheader file +Ġheader text +Ġheader Size +sing apore +sing ularities +az M +az b +az no +az iland +lan i +lan ker +lan caster +hed ges +orig map +orig Filename +ĠTh i +ĠTh in +ĠTh ur +ĠTh under +ĠTh umb +ĠTh rust +ĠTh irty +ĠTh anh +ĠTh rush +ĠTh inking +':' ../ +':' _', +':' #', +Ġcsv Out +Ġraw i +Ġraw db +Ġraw Data +Ġraw groups +Ġraw FilePath +Ġraw Df +Ġraw Sentence +Ġraw spc +Ġraw Foreground +For get +For Text +For CM +For Action +For Repository +For Testing +For Aut +For Voice +For Signing +For Binomial +For LogNormal +For Benchmarks +For AnimationPath +For ProxyModelModel +hash key +hash cat +hash diff +hash Prevouts +hash icorp +TYPE VARS +Ġvis ÃŃveis +xef B +xef J +xef P +xef R +xef S +xef U +xef j +xef m +xef u +track Event +ĠType Input +ĠType Context +ĠType Checker +ulation Level +ĠSim u +ĠSim ics +ĠSim body +ĠSim ulators +ĠSim Muon +ĠSim Calorimetry +xfc D +xfc H +xfc L +xfc M +xfc N +xfc O +xfc R +xfc T +xfc V +xfc W +xfc d +xfc g +xfc w +pg ate +pg host +pg aa +pg schemas +Size In +Size Max +Size Array +Size NC +Size Limit +div Count +xfa D +xfa H +xfa I +xfa O +xfa Q +xfa R +xfa V +xfa q +xfa ctor +']: . +xbc F +xbc W +xbc b +xbc j +xbc m