DOI,Citation ID,First author,Year,animal type,exposure age,behavior test: Y/N,intervention1,intervention2 （anesthetics only),genetic chain,content,Question 1,Question 1_original_sentences,Question 2,Question 2_original_sentences,Question 3,Question 3_original_sentences,intervention_1,Question 4intervention_1_original_sentences,intervention_2,Question 4intervention_2_original_sentences,Question 5,Question 5_original_sentences,Question 6,Question 6_original_sentences,Question 7,Question 7_original_sentences,Question 8,Question 8_original_sentences,Question 9,Question 9_original_sentences,Question 10,Question 10_original_sentences,correct_1,correct_2,correct_3,correct_4,correct_5,correct_6,fn 10.1097/ALN.0b013e318289bc9b,905.0,Boscolo,2013,rats,postnatal day 7,N,nitrous oxide,isoflurane,sprague dawley,"N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t NIH Public Access Author Manuscript Anesthesiology. Author manuscript; available in PMC 2014 January 03. Published in final edited form as: Anesthesiology. 2013 May ; 118(5): . doi:10.1097/ALN.0b013e318289bc9b. Early Exposure to General Anesthesia Disturbs Mitochondrial Fission and Fusion in the Developing Rat Brain Annalisa Boscolo, M.D.*, Desanka Milanovic, Ph.D.†, John A. Starr, B.S.‡, Victoria Sanchez, B.S.§, Azra Oklopcic, B.S.||, Laurie Moy#, C Carlo Ori, M.D.**, Alev Erisir, M.D., Ph.D.††, and Vesna Jevtovic-Todorovic, M.D., Ph.D.‡‡ *Research Associate, Department of Anesthesiology, University of Virginia Heath System, Charlottesville, Virginia, and Department of Anesthesiology and Pharmacology, University of Padua, Padua, Italy †Research Associate, Department of Anesthesiology, University of Virginia Heath System, and The Institute for Biological Research “Sinisa Stankovic,” University of Belgrade, Belgrade, Serbia ‡Medical Student, Department of Anesthesiology, University of Virginia Heath System §Graduate Student, Department of Anesthesiology, University of Virginia Heath System, and Neuroscience Graduate Program, University of Virginia, Charlottesville, Virginia ||Technician, Department of Anesthesiology, University of Virginia Heath System #Undergraduate Student, Department of Anesthesiology, University of Virginia Heath System **Professor, Department of Anesthesiology and Pharmacology, University of Padua ††Associate Professor, Neuroscience Graduate Program, University of Virginia, and Department of Psychology, University of Virginia ‡‡Professor, Department of Anesthesiology, University of Virginia Heath System, and Department of Psychology, University of Virginia Abstract Background—General anesthetics induce apoptotic neurodegeneration in the developing mammalian brain. General anesthesia (GA) also causes significant disturbances in mitochondrial morphogenesis during intense synaptogenesis. Mitochondria are dynamic organelles that undergo remodeling via fusion and fission. The fine balance between these two opposing processes determines mitochondrial morphometric properties, allowing for their regeneration and enabling normal functioning. As mitochondria are exquisitely sensitive to anesthesia-induced damage, we examined how GA affects mitochondrial fusion/fission. Methods—Seven-day-old rat pups received anesthesia containing a sedative dose of midazolam followed by a combined nitrous oxide and isoflurane anesthesia for 6 h. Results—GA causes 30% upregulation of reactive oxygen species (n = 3–5 pups/group), accompanied by a 2-fold downregulation of an important scavenging enzyme, superoxide dismutase (n = 6 pups/group). Reactive oxygen species upregulation is associated with impaired mitochondrial fission/fusion balance, leading to excessive mitochondrial fission. The imbalance Copyright © 2013, the American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins. Address correspondence to: Dr. Jevtovic-Todorovic: Department of Anesthesiology, University of Virginia Health System, PO Box 800710, Charlottesville, Virginia 22908. vj3w@virginia.edu. Information on purchasing reprints may be found at www.anesthesiology.org or on the masthead page at the beginning of this issue. Anesthesiology’s articles are made freely accessible to all readers, for personal use only, 6 months from the cover date of the issue. N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. between fission and fusion is due to acute sequestration of the main fission protein, dynamin- related protein 1, from the cytoplasm to mitochondria, and its oligomerization on the outer mitochondrial membrane. These are necessary steps in the formation of the ring-like structures that are required for mitochondrial fission. The fission is further promoted by GA-induced 40% downregulation of cytosolic mitofusin-2, a protein necessary for maintaining the opposing process, mitochondrial fusion (n = 6 pups/group). Conclusions—Early exposure to GA causes acute reactive oxygen species upregulation and disturbs the fine balance between mitochondrial fission and fusion, leading to excessive fission and disturbed mitochondrial morphogenesis. These effects may play a causal role in GA-induced developmental neuroapoptosis. Recent animal and emerging human data suggest that general anesthetics commonly used in pediatric medicine could be damaging to the developing nervous system. The neurotoxic effects are described as apoptotic in nature1–4 and are accompanied by severe and long- lasting disturbances in synaptogenesis.5–8 It appears that the impairment of synaptic development involves not only deletion of the existing synapses, but also a disturbance in the formation of novel synapses.9 Proper morphogenesis, function, and regional distribution of mitochondria are crucially important in the development and function of immature synapses and, consequently, for the formation of functional brain circuitries. Our recent studies indicate that general anesthesia (GA) causes statistically significant decrease in synapses, and disturbances in mitochondrial morphogenesis in the vicinity of synaptic connections, thus pointing at mitochondria as organelles likely to be responsible for anesthesia-induced impairment of neuronal development and synaptic function.10 Furthermore, we previously reported that the general anesthetic isoflurane, when combined with midazolam and nitrous oxide, causes apoptotic neurodegeneration that is, in part, mitochondria dependant.4 These findings collectively suggest that mitochondria could be an important and early target for GA-induced impairment of neuronal development and synaptogenesis. Mitochondria are highly dynamic. Their ability to provide adequate support to the developing neurons relies on constant remodeling via fusion and fission.11 A fine dynamic balance between these two opposing processes depends on the physiological and metabolic requirements of a neuron. Overactive fission leads to mitochondrial fragmentation, whereas overactive fusion leads to undue mitochondrial enlargement. Both phenomena may cause impaired mitochondrial function. Fusion and fission in mammalian neurons are controlled by many proteins. A protein of particular interest in the control of fission is an important member of the dynamin superfamily of proteins, dynamin-related protein 1 (Drp-1), which mediates the remodeling of the inner and outer mitochondrial membranes.12,13 Drp-1 translocates to the mitochondrial outer membrane and polymerizes to form a ring-like structure that enables mitochondrial division. A protein of particular interest in the control of fusion is mitofusin-2 (Mfn-2), a member of the Mfn family of proteins.11 Mfn-2 stabilizes the interaction between two adjacent mitochondria. 14 Interestingly, Mfn-2 also controls mitochondrial oxidative metabolism and the redox state of a neuron,15 a function that was of interest in view of our recently published findings, suggesting that GA causes upregulation of reactive oxygen species (ROS).16 We examined the acute in vivo effects of GA on the dynamic balance between mitochondrial fission and fusion, two key processes in mitochondrial proliferation, regeneration, and function. We administered a routine anesthesia cocktail containing isoflurane, nitrous oxide, and midazolam to rats during the intense stage of their brain development (at postnatal day Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 2 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. [P] 7). We confirmed that acute anesthesia exposure results in an imbalance of ROS homeostasis, caused, in part, by modulation of the function of scavenging enzymes. We also discovered that GA causes downregulation of the fusion protein Mfn-2 and translocation of a fission protein, Drp-1, from cytoplasm to mitochondria, followed by the enhancement of Drp-1 oligomerization, ultimately leading to excessive mitochondrial fission. Materials and Methods Animals Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments. This postnatal day is when rat pups are most vulnerable to anesthesia-induced neuronal damage.4 Our routine anesthesia protocol was used as previously described.10 Briefly, experimental rat pups were exposed to 6 h of anesthesia and controls were exposed to 6 h of mock anesthesia (vehicle + air). After the administration of anesthesia, rats were randomly divided into three groups: one group for ultrastructural analysis of the subiculum using electron microscopy, one group for assessing expression of several proteins using the Western blotting technique, and one group for functional studies of superoxide dismutase (SOD) and catalase activity using ELISA. Rat pups assigned for histological studies were reunited with their mothers and killed 24 h postanesthesia (at P8). Rat pups assigned for Western blot and ELISA studies were killed immediately postanesthesia (at P7). The experiments were approved by the Animal Use and Care Committee of the University of Virginia Health System, Charlottesville, Virginia, and were performed in accordance with the Public Health Service’s Policy on Human Care and Use of Laboratory Animals. Efforts were made to minimize the number of animals used. Anesthesia We used our routine anesthesia protocol as previously described.10,16 Briefly, nitrous oxide and oxygen were delivered using a calibrated flowmeter. Isoflurane was administered using an agent-specific vaporizer that delivers a set percentage of anesthetic into the anesthesia chamber. Midazolam (Sigma–Aldrich Chemical, St. Louis, MO) was dissolved in 0.1% dimethyl sulfoxide just before administration. For control animals, 0.1% dimethyl sulfoxide was used alone. To administer a specific concentration of nitrous oxide/oxygen and isoflurane in a highly controlled environment, an anesthesia chamber was used. Rats were kept normothermic and normoxic while glucose homeostasis was maintained within normal limits throughout the experiment, as previously described.17,18 For control experiments, air was substituted for the gas mixture. After initial equilibration of the nitrous oxide/oxygen/ isoflurane or air atmosphere inside the chamber, the composition of the chamber gas was analyzed by infrared analyzer (Datex Ohmeda, Madison, WI) to establish the concentrations of nitrous oxide, isoflurane, carbon dioxide, and oxygen. P7 rat pups received a single injection of midazolam (9 mg/kg, intraperitoneally) followed by 6 h of nitrous oxide (75%), isoflurane (0.75%), and oxygen (approximately 24%). Thus, the measured fraction of inspired oxygen in both control and experimental conditions was 0.21–0.24. Several studies have shown that this protocol causes significant developmental neuroapoptosis.1,4,10,16,19 Histopathologic Studies On P8, each pup was deeply anesthetized with phenobarbital (65 mg/kg, intraperitoneally) (University of Virginia Pharmacy, Charlottesville, Virginia). Perfusion and fixation of brain tissue were performed as previously described.10,16 Briefly, the left ventricle was cannulated, the descending aorta was clamped, and an initial flush was carried out with Tyrodes solution (30–40 ml) (Sigma–Aldrich Chemical). For morphometric analyses of pyramidal neurons, we perfused with paraformaldehyde (2%) and glutaraldehyde (2%). Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 3 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. After the perfusion, we removed the rats’ brains and stored them in the same fixative overnight. Both control and experimental pups were perfused by an experienced experimenter on the same day, using the same solution to assure uniform tissue fixation. Any brain considered to have been inadequately perfused was not processed for electron microscopy analysis. Our routine electron microscopy protocol has been described elsewhere.6,10 Briefly, fixed brains were coronally sectioned (50–75 μm thick) with a DTK-1000 microslicer (Ted Pella, Tools for Science and Industry, Redding, CA). The subiculum was localized as described in anatomical maps,20 fixed in 2% osmium tetroxide (Electron Microscopy Sciences, Hatfield, PA), stained with 4% uranyl acetate (Electron Microscopy Sciences), and embedded in aclar sheets using epon–araldite resins. The subiculum was then dissected from the aclar sheets and embedded in BEEM capsules (Electron Microscopy Sciences). To prepare capsules for microtome cutting (Sorvall MT-2 microtome, Ivan Sorvall, Norwalk, CT), the tips were manually trimmed so that ultrathin slices (silver interference color, 600–900 Å) could be cut using a diamond knife (Diatome, Hatfield, PA). Ultrathin sections were placed on grids and examined using a 1230 TEM electron microscope (Carl Zeiss, Oberkochen, Germany). Morphometric Analyses Our protocol for morphometric analyses of mitochondria was previously described.10 Briefly, as the cytoplasmic soma of pyramidal neurons cannot be captured in their entirety with a single photo frame at such high magnification (×6,000–×12,000), we took multiple sequential pictures using a 16-megapixel digital camera (SIA-12C digital cameras, Scientific Instruments and Applications, Duluth, GA), then tiled them seamlessly together to make a mosaic of one whole cell body. We analyzed 5 neurons from each animal (n = 4 pups/group) for a total of 20 neurons in the control group and anesthesia-treated group each. For statistical analysis, we used n = 4 pups/group after we obtained the average from five neurons in each pup. From these mosaic pictures, the cytoplasmic and mitochondrial areas were measured using Image-Pro Plus 6.1 computer software (MediaCybernetics, Bethesda, MD). The number of animals necessary for these complex and time-consuming ultrastructural histological studies was determined based on our previously published studies (n = 4 pups in each group from four different litters. Equal numbers of male and female pups were used for each experimental condition. Control and experimental pups were equally represented from each litter).6,10 The investigator analyzing electron micrographs was blinded to the experimental conditions. Catalase and SOD Activity Assays Control and experimental groups of rats were killed immediately postanesthesia, and the subicular and thalamic brain tissues were removed quickly. The tissues were homogenized in 20 mm HEPES buffer at pH 7.2, containing 1 mm EDTA, mannitol, and sucrose per gram of brain tissue (for SOD) or cold phosphate-buffered saline (for catalase) with 1mm EDTA. Upon centrifugation at 1,500g, followed by centrifugation at 10,000g at 4°C, the supernatants were collected and the assays were carried out at 25°C. SOD activity was assayed using a commercially available kit (Superoxide Dismutase Assay kit, Cayman Chemical, Ann Arbor, MI) that can detect the activity of all three forms of SOD—Cu/Zn-, Mn-, and Fe-SOD—as absorbance at 440–460 nm. Catalase activity was assayed using a commercially available kit (OxiSelect Catalase Activity Assay kit, Cell Biolabs Inc., San Diego, CA) with absorbance detected at 520 nm. The assays were performed following the manufacturer’s instructions using a microplate reader (VersaMax, Molecular Devices, Chicago, IL). Total protein was measured for each sample on the day of the assay using a commercially available protein determination kit (Bradford method) (Cayman Chemical, Ann Arbor, MI). The activities of SOD and catalase were expressed in arbitrary units per Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 4 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. milligram protein. The group sizes for each experimental condition are indicated in the figure legends. Subcellular Fractionation Mainly subicular tissues (with some thalamic contamination) were collected immediately postanesthesia. Briefly, the tissues were cut in small pieces and gently homogenized in ice- chilled Dounce homogenizers (20 strokes) using isotonic extraction buffer A from a Mitochondrial Isolation Kit (Sigma-Aldrich Co.) with protease inhibitor cocktail (Roche, Indianapollis, IN). The homogenates were centrifuged at 1,000g for 5 min to remove unbroken cells and nuclei. Supernatants were transferred into new tubes and centrifuged at low speed (3,500g for 10 min) to yield mitochondria-enriched fractions without lysosome and peroxisome contamination. Supernatants were removed and centrifuged at 70,000g to obtain pure cytosol fractions, and the mitochondria-enriched pellets were carefully resuspended and washed again in 1× extraction buffer A. The mitochondrial fractions then were re-pelleted by centrifugation at 1,000 and 3,500g for 5 and 10 min, respectively. Proteins from the mitochondria-enriched pellets were extracted by vortexing for 1 min in lysis buffer containing 20 mm Tris-HCl at pH 8.0, 137 mm NaCl, 10% glycerol, 1% nonidet P-40, and 2 mm EDTA. Following centrifugation at 13,000g, the supernatants were removed and protein concentration in the pellets was determined using the bicinchoninic acid micro- protein assay (Micro BCA protein assay kit, Pierce Inc., Rockford, IL). Subcelullar fractionation was performed at 4°C. The pellets are considered to contain the “heavy” mitochondrial fraction—enriched with mitochondria with substantially diminished presence of lysosomes and peroxisomes, which are common contaminants of this fraction. Western Blotting The protein concentration of the lysates was determined with the Total Protein kit (Sigma– Aldrich Chemical Co.). For separation of Mfn-2 and Drp-1 monomers, protein samples (30 μg per lane) were heat-denaturized in 2× Laemmli sample buffer, electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel, and transferred to a nitrocellulose membrane (Hybond ECL, Amersham International, Buckinghamshire, United Kingdom). To investigate Drp-1 oligomerization, the boiling step was omitted and 60 μg of samples were subjected to nonreducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (without β-merkaptoethanol or dithlothreltol in 2× loading buffer) on 8% acrylamide gel21 and transferred to a polyvinylidene difluoride membrane (Millipore, Danvers, MA). The membranes subsequently were incubated and probed with the anti-Drp-1 primary antibody or anti-Mfn 2 antibody at a dilution of 1:1000 each (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in Tris-buffered saline–Tween overnight, followed by the incubation with the appropriate secondary antibodies conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Inc.). Immunoreactive bands were visualized using enhanced chemiluminescence (Pierce, Inc.). β-ACTIN (1:10,000, Sigma-Aldrich) and porin (1:2500, Invitrogen, Eugene, OR) were used as loading controls for cytosolic and mitochondrial fraction, respectively. The molecular size of the proteins of interest was determined by comparison to pre-stained protein markers (BioRad, Hercules, CA). All gels were densitometrically analyzed in GBOX-chemi (Syngene, Frederick, MD) using the computerized image analysis program ImageQuant 5.0 (GE Heathcare, Life Sciences, Piscataway, NJ). Data were analyzed first as a ratio between the protein of interest and β- actin (or porin) and expressed as a percent change from a control density. The group sizes for each experimental condition are indicated in the figure Legends. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 5 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Spectrophotometric Detection of ROS Control and experimental groups of rats were killed immediately postanesthesia, and the subicular and thalamic brain tissues were quickly removed. ROS were measured as hydrogen peroxide using the horseradish peroxidase-linked spectrophotometric assay kit according to the manufacturer’s instructions (Amplex Red, Invitrogen). Briefly, extracted brain mitochondria samples (120 μg) were added to a 96-well plate containing 100 μl of reaction buffer consisting of 0.1 U/ml of the horseradish peroxidase, 50 μm Amplex UltraRed, and 1 μl of dimethyl sulfoxide. Reactions were incubated at room temperature for 30 min and protected from light. Resorufin absorptions were followed at 560 nm using a VersaMax tunable microplate reader (Molecular Devices, Chicago, IL). Hydrogen peroxide levels are expressed in arbitrary units (per milligram protein). The group sizes for each experimental condition are indicated in the figure legends. Statistical Analysis Single comparisons among groups were made using an unpaired two-tailed t test. When ANOVA with repeated measures was needed, the Bonferroni correction was used to help maintain prescribed alpha levels (e.g., 0.05). Histograms in cumulative frequency analysis were compared with chi-square-test. Using the standard version of GraphPad Prism 5.01 software (Media Cybernetics, Inc., Bethesda, MD), we considered P < 0.05 to be statistically significant. All the data are presented as mean + SEM. No experimental data were missing or lost to statistical analysis. Results GA Induces Excessive Mitochondrial Fission in Developing Neurons Our ultrastructural analysis of mitochondrial morphology in subicular pyramidal neurons revealed that anesthesia-treated animals contain numerous small round mitochondria displaying globular morphology 24 h postanesthesia exposure (on P8). Compared to controls (fig. 1A), it appeared that anesthesia-treated subicular neurons contained significantly more mitochondria (fig. 1B). The mitochondrial matrix was pale and showed signs of swelling. Although the inner and outer membranes appeared somewhat intact, the cristae seemed distorted and difficult to discern (fig. 1C), suggesting ultrastructural damage to mitochondria undergoing excessive fission. To quantify the observed effect, which suggested that GA may increase mitochondrial density, we performed detailed morphometric analysis of each mitochondrion and determined mitochondrial density in the soma of pyramidal subicular neurons. We calculated mitochondrial density by counting the number of mitochondrial profiles per unit area (μm2) of cytoplasmic soma in each pyramidal neuron. We found that there were approximately 30% more mitochondrial profiles in experimental neurons compared to controls (* P = 0.0179) (fig. 2A). However, when the sum of mitochondrial areas was presented as a percent of the cytoplasmic area of pyramidal neurons, we found that mitochondria in the control and experimental neurons occupied approximately the same percent of the cytoplasmic soma (P = 0.8067) (fig. 2B), suggesting that the higher density of mitochondrial profiles could be due to enhanced fission, resulting in a shift of mitochondrial pool from a larger to a smaller category (n = 4 control and four experimental pups). To examine this notion, we performed frequency distribution analysis by grouping mitochondria by their area and counting the number of mitochondria in each bin as shown in figure 2C. We found that there were significantly more mitochondria smaller than 0.16 μm2 in experimental animals when compared to controls (P < 0.001, horizontal bar), suggesting a leftward shift in mitochondrial size due to GA treatment. Indeed, when we performed cumulative frequency analysis (in percentage), designed to take into account the differences Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 6 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. in overall mitochondrial number in control versus experimental neurons, we found a leftward shift toward the smaller category (fig. 2D). For example, although mitochondria smaller than 0.012 μm2 were detected in GA-treated pyramidal neurons, none that small could be detected in control neurons. In addition, more than 50% of mitochondria in GA- treated neurons were smaller than 0.1 μm2, whereas about 30% were found in that size category in control animals. This finding suggests that GA may enhance mitochondrial fission. GA Causes Excessive Accumulation of ROS To begin to understand the mechanism(s) by which anesthesia may cause excessive mitochondrial fission, we examined whether anesthesia exposure causes undue accumulation of ROS. This idea stems from the fact that oxidative stress, implicated in promoting fission and inhibiting fusion,21 may disturb the fine balance between these two processes crucial for proper mitochondrial remodeling.11 We measured ROS with a kit that detects hydrogen peroxide in fresh brain homogenate obtained from P7 rats immediately after 6 h of anesthesia. As shown in figure 3, the level of ROS in experimental animals was significantly increased (about 30%) compared to that in sham controls (*P = 0.0357) (n = 3 rat pups in the control group; n = 5 rat pups in the experimental group), suggesting that anesthesia promotes significant ROS accumulation. GA Acutely Impairs SOD but not Catalase Activity As excessive ROS accumulation could be the result of ineffective scavenging machinery (responsible for maintaining ROS levels within normal limits), we set out to examine whether anesthesia has an acute effect on two important scavenging enzymes, SOD and catalase. We measured their activities in fresh brain homogenate obtained from P7 rat pups immediately after 6 h of anesthesia or sham treatment. The activity of SOD and catalase was expressed in units per milligram of protein. As shown in figure 4, there was a significant, 2- fold decrease in SOD activity immediately after anesthesia treatment compared to that in sham controls (fig. 4A) (**P = 0.0011; n = 6 pups in control group; n = 6 pups in experimental group). When we measured the activity of catalase, we found no change in the experimental groups compared to that in the sham controls (fig. 4B) (P = 0.6631; n = 6 pups in control group; n = 6 pups in experimental group). GA Modulates Expressions of Mfn-2 and Drp-1 Proteins, Two Important Regulators of Mitochondrial Fusion and Fission, Respectively In view of our findings that anesthesia may cause excessive mitochondrial fission and inappropriate ROS accumulation, and the fact that oxidative stress can lead to disturbances of fine balance between mitochondrial fusion and fission, we assessed whether anesthesia modulates the expression of two key proteins responsible for maintaining mitochondrial dynamics, Mfn-2 and Drp-1. As Mfn-2 and Drp-1 proteins are involved in active remodeling of the outer and inner mitochondrial membranes, and could be localized in cytoplasm or be sequestered in the mitochondrial membrane, we measured their expression in both cytosolic and mitochondrial compartments. As shown in figure 5, there was about a 40% decrease in cytosolic Mfn-2 protein in GA-treated animals compared to that in sham controls (*P = 0.026; n = 6 pups in control group; n = 6 pups in experimental group) (fig. 5A). However, we found a slight but nonsignificant difference (P = 0.075) between Mfn-2 expression in the mitochondrial fractions of GA-treated versus sham controls (fig. 5B) (n = 9 pups in the control group; n = 9 pups in the experimental group). As shown in figure 6, we detected a significant decrease (about 40%) (***P < 0.0001) in Drp-1 protein expression in cytosol from GA-treated versus sham-treated animals (fig. 6A) (n = 11 pups in the control group; n = 11 pups in the experimental group), and a significant Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 7 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Discussion increase (about 50%) (***P = 0.0002) in Drp-1 protein expression in the mitochondrial fraction of GA-treated versus sham-treated animals (fig. 6B), suggesting substantial translocation of Drp-1 to the mitochondrial membranes (n = 10 pups in the control group; n = 10 pups in the experimental group). Once Drp-1 is translocated from the cytoplasm to mitochondrial membranes, the Drp-1 monomer undergoes self-assembly (i.e., oligomerization) on the mitochondrial outer membrane, a step that allows the formation of the ring-like structure necessary for mitochondrial fission.12,13 As our findings suggest that anesthesia causes oxidative stress and may promote Drp-1 translocation to mitochondria, and in view of the fact that the oxidative stress can cause Drp-1 oligomerization, we set out to examine whether anesthesia promotes excessive formation of Drp-1 oligomers, which could, in part, explain enhanced mitochondrial fission. Indeed, we found that anesthesia increases the amount of the oligomerized form of Drp-1 protein by about 45% compared to that in controls (fig. 7; **P = 0.0037; n = 7 pups in the control group; n = 7 pups in the experimental group). Early exposure to GA causes acute upregulation of ROS that is, in part, due to downregulation of SOD activity and lack of compensatory modulation of catalase activity. ROS upregulation is associated with impaired mitochondrial fission and fusion. This could be due to differential modulation of mitochondrial fission/fusion proteins. On the one hand, GA causes a decrease in Drp-1 protein in the cytoplasm due to an apparent translocation to mitochondria, with subsequent Drp-1 oligomerization on the outer mitochondrial membrane, a necessary step in the formation of the ring-like structures and fission. On the other hand, a lack of compensatory modulation of Mfn-2, a protein necessary for mitochondrial fusion, tips the fine equilibrium toward excessive mitochondrial fission (fig. 8). Based on previous reports suggesting that the GA causes massive developmental neuroapoptosis,1,4,18,19 and on others suggesting that excessive mitochondrial fission is associated with apoptotic cell death,21–23 we propose that excessive mitochondrial fission may be important for GA- induced developmental neurotoxicity. Here we confirm that GA causes acute ROS upregulation.16 Moreover, we propose that a GA-induced disturbance in the neuronal redox state is likely caused by an imbalance between ROS production and ROS scavenging. Because mitochondria exposed to GA undergo excessive fission, and because unbalanced fission may lead to mitochondrial dysfunction11,21 resulting in excessive ROS generation, it is possible that overproduction of ROS is the likely cause of ROS upregulation as dysfunctional mitochondria could be the greatest intracellular source of ROS. Indeed, Barsoum et al.24 have shown that persistent mitochondrial fission leads to mitochondrial dysfunction and excessive production of ROS, one of the earliest signs of disturbed homeostasis leading to neuronal cell death. Nevertheless, a fully functional scavenging system is also very important. For example, in order to manage a substantial increase in production of superoxide ions (normally generated with a rate constant that is already 3–8 times that of superoxide decomposition by SOD), the activity of SOD has to increase substantially.25 However, we show that GA induces statistically significant decrease in SOD activity, thus placing ROS homeostasis in double jeopardy: impaired scavenging in the setting of enhanced ROS production. The GA effect on scavenging enzymes seems to be selective. Despite a decrease in SOD activity, the activity of catalase is spared. Although the reason for this selective effect remains unclear, the lack of a compensatory increase in catalase activity in the setting of upregulated levels of its substrate, hydrogen peroxide, may worsen the acute oxidative stress in developing neurons. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 8 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Although GA induces differential effects on the activity of these scavenging enzymes, it remains to be determined whether GA has an effect on their protein content. It remains unclear whether GA-induced mitochondrial fission is the main cause of acute oxidative stress (especially as impaired mitochondria could be a powerful source of ROS) or its outcome, as mitochondria are also an important target of ROS. Disturbed redox state of the neuron regulates the translocation of Drp-1 from the cytosol to mitochondria and its oligomerization in vitro, thus directing mitochondrial dynamics toward excessive fission.21 Here we show that in vivo upregulation of ROS is associated with similar changes in Drp-1. Although the mechanism of Drp-1 oligomerization in vivo remains unsettled, previous in vitro studies have suggested that oxidative stress promotes the formation of thiol cross-links from cysteine residues in Drp-1, which could, in turn, promote the formation of Drp-1 oligomers.26 In some neurodegenerative diseases27 and some forms of acute brain injury,28 there is a shift toward excessive mitochondrial fission, leading to neuronal death. Consequently, Drp-1 inhibitors such as the Mdivi family of compounds were shown to prevent mitochondrial fission, loss of mitochondrial membrane potential, and neuronal death both in vitro and in vivo.28 In fact, Drp1 translocation to mitochondrial membrane and subsequent mitochondrial fission were the key features that preceded neuronal death. Although the safety profile of presently available Drp-1 antagonists in very young animals remains to be established, it is possible that these agents may offer some benefit in protecting against GA-induced disturbance in mitochondrial fission as Drp-1 may be an important cellular target of GA- induced developmental neurotoxicity. Although the focus of this study was not on following the neuronal fate during excessive mitochondrial fission, we and other researchers previously have reported that early exposure to GA enhances developmental neuroapoptosis by massive activation of caspase-3.1,3,4,9,18,19 As excessive fission is considered to be an early occurrence during apoptosis, 22,23 the question remains whether apoptosis is caused by fission or whether fission is its consequence. Based on our previously published findings, one would suggest the former conclusion. We know that our GA protocol causes early cytochrome c leak, resulting in caspase-3 and -9 activation and apoptotic neurodegeneration that is considered to be intrinsic (mitochondria)-dependent.4 Although the exact timing of these processes vis- à-vis mitochondrial fission remains to be deciphered, we suggest that GA-induced mitochondrial fission promotes acute cytochrome c leak, leading to caspase activation. Some earlier reports support this view. For example, dominant negative mutants of Drp-1, which antagonize mitochondrial fission, have been shown to block cytochrome c release, apoptotic activation, and cell death.22,24,29,30 In addition, overexpression of the Mfn family of proteins (that promote mitochondrial fusion) has been known to curtail cytochrome c release and inhibit apoptosis. 31 However, other reports suggest that mitochondrial fission is an epiphenomenon that accompanies apoptosis. For instance, overexpression of the anti- apoptotic protein Bcl-xL (known to protect mitochondrial membrane) was demonstrated to block cytochrome c release in vitro, but did not block mitochondrial fission. This suggests that mitochondrial fission may not be the causal event in apoptosis-associated cytochrome c release.32 Regardless of what view is accepted, GA-induced ROS upregulation disturbs fusion/fission balance and promotes excessive mitochondrial fission, as we have shown here, while promoting excessive cytochrome c release and caspases 9 and -3 activation, as we have shown previously.4 We know that the long-term effects of early exposure to GA are manifested as mitochondrial enlargement.10 Here we report that the acute effects of GA are manifested as a decrease, not an increase, in mitochondrial size. Although it remains to be examined whether GA has Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 9 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. long-term effects on fission/fusion machinery, possibly causing excessive fusion long after the initial exposure occurs, it is more likely that the mitochondria undergoing undue fission become vulnerable to fragmentation of cristae and inner mitochondrial membranes. This could, in turn, cause significant impairment of mitochondrial membrane integrity, leading to “leakiness” and swelling. Supporting this notion is our earlier report describing that mitochondrial swelling in addition to derangement and fragmentation of cristae indeed occurs when mitochondria are examined two weeks postanesthesia.10 In addition, a report by Barsoum et al.24 showed that excessive fission can impair the integrity of mitochondrial cristae often referred to as “cristae remodeling.”30,33 Although our study was not designed for live imaging of mitochondrial dynamics in terms of mitochondrial localization, antero versus retrograde transport along the neuronal axon, or speed of movement, it is possible that the disturbed fission and fusion could cause impaired mitochondrial agility and dynamics. Well-designed in vitro studies in which neurons can be examined during anesthesia exposure using time lapse confocal imaging will be needed to confirm this notion. The concern regarding the maintenance of physiological homeostasis during anesthesia brings into focus the potential role of hypoxia in anesthesia-induced ROS upregulation. Indeed hypoxia may cause a significant rise in ROS in ischemic neurons, which could in turn initiate mitochondrial injury and neuronal death.34 As our earlier studies using the same GA protocol have ruled out the occurrence of hypoxia,1,4,18 it is unlikely that the GA- induced ROS upregulation we report herein is due to inadequate oxygenation. The role of Mfn-2 protein extends beyond controlling fusion. Mfn-2 modulates metabolism via electron transport chain complexes I, IV, and V35,36 and controls oxygen consumption and electrochemical potential.15 Hence, Mfn-2 plays an important role in controlling the redox and metabolic state of the cell. Due to its role in curtailing oxidative stress and cytochrome c release, while interacting with anti-apoptotic bcl family of proteins,37 Mfn-2 may be crucial for maintaining mitochondrial integrity. Consequently, Mfn-2 is regarded as an important therapeutic target for the treatment of diseases caused by disturbed mitochondrial homeostasis and morphogenesis.38 Indeed some studies have shown that compensatory upregulation of Mfn-2 is the key to blocking the upregulation of ROS and mitochondrial fragmentation. 39,40 Because of the vital role of Mfn-2 in mitochondrial and neuronal function and its apparent downregulation by GA, we suggest that Mfn-2 could be an important target for preventive strategies aimed at curtailing GA-induced developmental neuroapoptosis. Although our anesthesia protocol is a reliable model for studying developmental neurodegeneration, it is based on the use of anesthetics in combination. Therefore, despite the fact that clinical anesthesia commonly relies on the use of more than one anesthetic to achieve the desired effect, we were unable to examine the relative contribution of each agent. Further studies with individual anesthetics could decipher their relative importance. In conclusion, early exposure to GA impairs mitochondrial morphogenesis and disturbs fission/fusion. This is accompanied by the disturbance of neuronal scavenging machinery and excessive ROS accumulation. Acknowledgments This study was supported by the National Institute of Health/The Eunice Kennedy Shriver National Institute of Child and Human Development 44517 (to Vesna Jevtovic-Todorovic) and 44517-S (to Vesna Jevtovic-Todorovic), Bethesda, Maryland; Harold Carron endowment (to Vesna Jevtovic-Todorovic), University of Virginia, Charlottesville, Virginia; John E. Fogarty Award 007423-128322 (to Vesna Jevtovic-Todorovic), National Institute Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 10 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. References of Health, Bethesda, Maryland; and March of Dimes National Award (to Vesna Jevtovic-Todorovic). Vesna Jevtovic-Todorovic was an Established Investigator of the American Heart Association (Dallas, Texas), National Award. The authors thank Jan Redick, B.S., Laboratory Director of the Advanced Microscopy Facility at the University of Virginia Health System, Charlottesville, Virginia, for technical assistance with electron microscopy and data analyses. The authors thank Shawn D. Feinstein, B.S. (Medical Student, Virginia Commonwealth University School of Medicine, Richmond, Virginia), and Kirsten Rose, Ph.D. (Research Associate, Department of Anesthesiology, University of Virginia Health System), for technical assistance with mitochondrial analysis and Western blot studies, respectively. 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci. 2003; 23:876–82. [PubMed: 12574416] 2. Rizzi S, Carter LB, Ori C, Jevtovic-Todorovic V. Clinical anesthesia causes permanent damage to the fetal guinea pig brain. Brain Pathol. 2008; 18:198–210. [PubMed: 18241241] 3. Slikker W Jr, Zou X, Hotchkiss CE, Divine RL, Sadovova N, Twaddle NC, Doerge DR, Scallet AC, Patterson TA, Hanig JP, Paule MG, Wang C. Ketamine-induced neuronal cell death in the perinatal rhesus monkey. Toxicol Sci. 2007; 98:145–58. [PubMed: 17426105] 4. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V. Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience. 2005; 135:815–27. [PubMed: 16154281] 5. Head BP, Patel HH, Niesman IR, Drummond JC, Roth DM, Patel PM. Inhibition of p75 neurotrophin receptor attenuates isoflurane-mediated neuronal apoptosis in the neonatal central nervous system. Anesthesiology. 2009; 110:813–25. [PubMed: 19293698] 6. Lunardi N, Ori C, Erisir A, Jevtovic-Todorovic V. General anesthesia causes long-lasting disturbances in the ultrastructural properties of developing synapses in young rats. Neurotox Res. 2010; 17:179–88. [PubMed: 19626389] 7. Briner A, De Roo M, Dayer A, Muller D, Habre W, Vutskits L. Volatile anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiology. 2010; 112:546–56. [PubMed: 20124985] 8. Briner A, Nikonenko I, De Roo M, Dayer A, Muller D, Vutskits L. Developmental stage-dependent persistent impact of propofol anesthesia on dendritic spines in the rat medial prefrontal cortex. Anesthesiology. 2011; 115:282–93. [PubMed: 21701379] 9. Lemkuil BP, Head BP, Pearn ML, Patel HH, Drummond JC, Patel PM. Isoflurane neurotoxicity is mediated by p75NTR-RhoA activation and actin depolymerization. Anesthesiology. 2011; 114:49– 57. [PubMed: 21169791] 10. Sanchez V, Feinstein SD, Lunardi N, Joksovic PM, Boscolo A, Todorovic SM, Jevtovic-Todorovic V. General anesthesia causes long-term impairment of mitochondrial morphogenesis and synaptic transmission in developing rat brain. Anesthesiology. 2011; 115:992–1002. [PubMed: 21909020] 11. Chan DC. Mitochondrial fusion and fission in mammals. Annu Rev Cell Dev Biol. 2006; 22:79– 99. [PubMed: 16704336] 12. Yoon Y, Pitts KR, McNiven MA. Mammalian dynamin-like protein DLP1 tubulates membranes. Mol Biol Cell. 2001; 12:2894–905. [PubMed: 11553726] 13. Smirnova E, Griparic L, Shurland DL, van der Bliek AM. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell. 2001; 12:2245–56. [PubMed: 11514614] 14. Koshiba T, Detmer SA, Kaiser JT, Chen H, McCaffery JM, Chan DC. Structural basis of mitochondrial tethering by mitofusin complexes. Science. 2004; 305:858–62. [PubMed: 15297672] 15. Chen H, Chomyn A, Chan DC. Disruption of fusion results in mitochondrial heterogeneity and dysfunction. J Biol Chem. 2005; 280:26185–92. [PubMed: 15899901] Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 11 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. 16. Boscolo A, Starr JA, Sanchez V, Lunardi N, DiGruccio MR, Ori C, Erisir A, Trimmer P, Bennett J, Jevtovic-Todorovic V. The abolishment of anesthesia-induced cognitive impairment by timely protection of mitochondria in the developing rat brain: The importance of free oxygen radicals and mitochondrial integrity. Neurobiol Dis. 2012; 45:1031–41. [PubMed: 22198380] 17. Jevtovic-Todorovic V, Benshoff N, Olney JW. Ketamine potentiates cerebrocortical damage induced by the common anaesthetic agent nitrous oxide in adult rats. Br J Pharmacol. 2000; 130:1692–8. [PubMed: 10928976] 18. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V. General anesthesia activates BDNF-dependent neuroapoptosis in the developing rat brain. Apoptosis. 2006; 11:1603–15. [PubMed: 16738805] 19. Yon JH, Carter LB, Reiter RJ, Jevtovic-Todorovic V. Melatonin reduces the severity of anesthesia- induced apoptotic neurodegeneration in the developing rat brain. Neurobiol Dis. 2006; 21:522–30. [PubMed: 16289675] 20. Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates. Australia: Academic Press; 1944. 21. Tian C, Murrin LC, Zheng JC. Mitochondrial fragmentation is involved in methamphetamine- induced cell death in rat hippocampal neural progenitor cells. PLoS ONE. 2009; 4:e5546. [PubMed: 19436752] 22. Frank S, Gaume B, Bergmann-Leitner ES, Leitner WW, Robert EG, Catez F, Smith CL, Youle RJ. The role of dynamin-related protein 1, a mediator of mitochondrial fission, in apoptosis. Dev Cell. 2001; 1:515–25. [PubMed: 11703942] 23. Youle RJ, Karbowski M. Mitochondrial fission in apoptosis. Nat Rev Mol Cell Biol. 2005; 6:657– 63. [PubMed: 16025099] 24. Barsoum MJ, Yuan H, Gerencser AA, Liot G, Kushnareva Y, Gräber S, Kovacs I, Lee WD, Waggoner J, Cui J, White AD, Bossy B, Martinou JC, Youle RJ, Lipton SA, Ellisman MH, Perkins GA, Bossy-Wetzel E. Nitric oxide-induced mitochondrial fission is regulated by dynamin- related GTPases in neurons. EMBO J. 2006; 25:3900–11. [PubMed: 16874299] 25. Crichton, RR.; Ward, RJ. Oxidative Stress and Redox Active Metal Ions. In: Crichton, RR.; Ward, RJ., editors. Metal-based Neurodegeneration: From Molecular Mechanisms to Therapeutic Strategies. Vol. Chapter 2. John Wiley & Sons; 2006. p. 21-51. 26. Costantini P, Belzacq AS, Vieira HL, Larochette N, de Pablo MA, Zamzami N, Susin SA, Brenner C, Kroemer G. Oxidation of a critical thiol residue of the adenine nucleotide translocator enforces Bcl-2-independent permeability transition pore opening and apoptosis. Oncogene. 2000; 19:307– 14. [PubMed: 10645010] 27. Reddy PH, Reddy TP, Manczak M, Calkins MJ, Shirendeb U, Mao P. Dynamin-related protein 1 and mitochondrial fragmentation in neurodegenerative diseases. Brain Res Rev. 2011; 67:103–18. [PubMed: 21145355] 28. Grohm J, Kim SW, Mamrak U, Tobaben S, Cassidy-Stone A, Nunnari J, Plesnila N, Culmsee C. Inhibition of Drp1 provides neuroprotection in vitro and in vivo. Cell Death Differ. 2012; 19:1446–58. [PubMed: 22388349] 29. Breckenridge DG, Stojanovic M, Marcellus RC, Shore GC. Caspase cleavage product of BAP31 induces mitochondrial fission through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J Cell Biol. 2003; 160:1115–27. [PubMed: 12668660] 30. Germain M, Mathai JP, McBride HM, Shore GC. Endoplasmic reticulum BIK initiates DRP1- regulated remodelling of mitochondrial cristae during apoptosis. EMBO J. 2005; 24:1546–56. [PubMed: 15791210] 31. Wu S, Zhou F, Zhang Z, Xing D. Mitochondrial oxidative stress causes mitochondrial fragmentation via differential modulation of mitochondrial fission-fusion proteins. FEBS J. 2011; 278:941–54. [PubMed: 21232014] 32. Sheridan C, Delivani P, Cullen SP, Martin SJ. Bax- or Bak-induced mitochondrial fission can be uncoupled from cytochrome C release. Mol Cell. 2008; 31:570–85. [PubMed: 18722181] 33. Scorrano L. Opening the doors to cytochrome c: Changes in mitochondrial shape and apoptosis. Int J Biochem Cell Biol. 2009; 41:1875–83. [PubMed: 19393761] Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 12 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. 34. Abramov AY, Scorziello A, Duchen MR. Three distinct mechanisms generate oxygen free radicals in neurons and contribute to cell death during anoxia and reoxygenation. J Neurosci. 2007; 27:1129–38. [PubMed: 17267568] 35. Bach D, Pich S, Soriano FX, Vega N, Baumgartner B, Oriola J, Daugaard JR, Lloberas J, Camps M, Zierath JR, Rabasa-Lhoret R, Wallberg-Henriksson H, Laville M, Palacín M, Vidal H, Rivera F, Brand M, Zorzano A. Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity. J Biol Chem. 2003; 278:17190–7. [PubMed: 12598526] 36. Pich S, Bach D, Briones P, Liesa M, Camps M, Testar X, Palacín M, Zorzano A. The Charcot- Marie-Tooth type 2A gene product, Mfn2, up-regulates fuel oxidation through expression of OXPHOS system. Hum Mol Genet. 2005; 14:1405–15. [PubMed: 15829499] 37. Delivani P, Adrain C, Taylor RC, Duriez PJ, Martin SJ. Role for CED-9 and Egl-1 as regulators of mitochondrial fission and fusion dynamics. Mol Cell. 2006; 21:761–73. [PubMed: 16543146] 38. Jahani-Asl A, Cheung EC, Neuspiel M, MacLaurin JG, Fortin A, Park DS, McBride HM, Slack RS. Mitofusin 2 protects cerebellar granule neurons against injury-induced cell death. J Biol Chem. 2007; 282:23788–98. [PubMed: 17537722] 39. Yu T, Robotham JL, Yoon Y. Increased production of reactive oxygen species in hyperglycemic conditions requires dynamic change of mitochondrial morphology. Proc Natl Acad Sci USA. 2006; 103:2653–8. [PubMed: 16477035] 40. Li J, Liu X, Wang H, Zhang W, Chan DC, Shi Y. Lysocardiolipin acyltransferase 1 (ALCAT1) controls mitochondrial DNA fidelity and biogenesis through modulation of MFN2 expression. Proc Natl Acad Sci USA. 2012; 109:6975–80. [PubMed: 22509026] Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 13 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. What We Already Know about This Topic Common general anesthetics induce apoptotic neurodegeneration in the developing mammalian brain and disturb mitochondrial morphogenesis during synaptogenesis and fission What This Article Tells Us That Is New Early exposure to general anesthetics causes acute reactive oxygen species upregulation and disturbs the fine balance between mitochondrial fission and fusion, implicating yet another causal role for general anesthetics-induced developmental neuroapoptosis Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 14 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 1. Anesthesia causes acute ultrastructural changes in mitochondria of pyramidal subicular neurons of 8-day-old rats. (A) Mitochondria in the cytoplasm of subicular pyramidal neurons from sham control animals resemble long tubules with intact inner and outer membranes and numerous cristae tightly packed inside healthy looking matrix. (B) Mitochondria in the cytoplasm of subicular pyramidal neurons from anesthesia- treated animals are numerous. The mitochondria are round, small, and display globular morphology 24 h postanesthesia exposure (on P8). Their matrix is pale and shows the signs of swelling. Although the inner and outer membranes appear somewhat intact, the cristae seem distorted and difficult to discern (C). N = nucleus. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 15 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 2. Anesthesia induces excessive fission of mitochondria in the soma of pyramidal subicular neurons of 8-day-old rats. (A) Mitochondrial density was assessed by counting the number of mitochondrial profiles per unit area (μm2) of cytoplasmic soma in each pyramidal neuron. There are approximately 30% more mitochondrial profiles in anesthesia-treated neurons compared with controls (*P = 0.0179). (B) The summation of mitochondrial areas, presented as a percent of the cytoplasmic area of pyramidal neurons, reveals that mitochondria in the control and experimental neurons occupy approximately the same area of the cytoplasmic soma (P = 0.8067). (C) Frequency distribution analysis by grouping of mitochondrial area indicates that there are significantly more mitochondria smaller than 0.16 μm2 (indicated with horizontal bar) in experimental animals compared with controls (P < 0.001). (D) Cumulative frequency analysis (in percentage), designed to take into account the differences in overall mitochondrial number in control vs. experimental neurons, indicates a leftward shift toward smaller mitochondria after anesthesia treatment, with over 50% of mitochondria in the category of lesser than 0.1 μm2. In addition, mitochondria smaller than 0.012 μm2 were detected in the anesthesia-treated pyramidal neurons, whereas none that small could be detected in the control neurons (n = 4 control and four experimental pups, five neurons from each pup). Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 16 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 3. Anesthesia causes acute reactive oxygen species upregulation. Reactive oxygen species were measured in fresh homogenates of subicular and thalamic tissues obtained from P7 rats immediately after 6 h of anesthesia or sham treatment using a kit that detects hydrogen peroxide as described in Methods. We found that the level of reactive oxygen species in anesthesia-treated animals was increased significantly (about 30%) compared to that in sham controls (*P < 0.0357) (n = 3 rat pups in control group; n = 5 rat pups in the experimental group). P7 = postnatal day 7. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 17 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 4. Anesthesia acutely impairs superoxide dismutase (SOD) but not catalase activity. The activities of SOD and catalase were measured in fresh homogenates of subicular and thalamic tissues obtained from P7 rat pups immediately after 6 h of anesthesia or sham treatment and are expressed in units per milligram of protein. (A) We found a significant 2- fold decrease in SOD activity immediately after anesthesia treatment compared to that in sham controls (**P = 0.0011) (n = 6 pups in the control group; n = 6 pups in experimental group). (B) There was no difference in catalase activity between the sham control and experimental groups (P = 0.6631) (n = 6 pups in the control group; n = 6 pups in the experimental group). P7 = postnatal day 7. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 18 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 5. Anesthesia decreases expression of mitofusin-2 (Mfn-2) in the cytosolic fraction. The expression of Mfn-2 protein was estimated from Western blotting in fresh cytosolic and mitochondrial fractions of subicular and thalamic tissues obtained from P7 rats immediately postanesthesia or sham treatment. The protein levels are estimated from Western blotting as percent change from sham controls after normalization to β-actin (cytosolic fraction) or porin (mitochondrial fraction). (A) In the anesthesia- treated group (Treat), Mfn-2 protein expression in the cytosolic fraction was decreased by about 40% compared to that in the sham controls (Cont) (*P = 0.026) (n = 6 pups in the control group; n = 6 pups in the experimental group). (B) In the anesthesia-treated group (Treat), Mfn-2 protein expression in the mitochondrial fraction was approximately the same as that in the experimental group compared to that in the sham controls (Cont) (P = 0.0745) (n = 9 pups in control group; n = 9 pups in experimental group). The molecular mass standards (in kDa) are shown at the right of the representative Western blots (C: cytosolic Mfn-2; D: mitochondrial Mfn-2). (*) Indicates a nonspecific band detected by anti-Mfn2 antibody. P7 = postnatal day 7. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 19 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 6. Anesthesia decreases expression of Drp-1 in the cytosolic fraction and increases Drp-1 in the mitochondrial fraction. The expression of Drp-1 protein was estimated by Western blotting in fresh cytosolic and mitochondrial fractions of subicular and thalamic tissues obtained from P7 rat pups immediately postanesthesia or sham treatment. The protein levels were expressed as percent change from sham controls after normalization to β-actin (cytosolic fraction) or porin (mitochondrial fraction). (A) In the anesthesia-treated group (Treat), Drp-1 protein expression in the cytosolic fraction was significantly decreased compared to sham controls (Cont) (***P < 0.0001) (n = 11 pups in control group; n = 11 pups in experimental group). (B) In the anesthesia-treated group (Treat), Drp-1 protein expression in the mitochondrial fraction was significantly increased compared to that in sham controls (Cont) (***P = 0.0002) (n = 10 pups in the control group; n = 10 pups in the experimental group). The molecular mass standards (in kDa) are shown at the right of the representative Western blots (C = cytosolic Drp-1; D = mitochondrial Drp-1). (*) Indicates alternate splice variant typically recognized by antibody against Drp-1. Drp-1 = dynamin-related protein 1; P7 = postnatal day 7. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 20 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 7. Anesthesia enhances Drp-1 oligomerization in the mitochondria. The samples for Drp-1 oligomer analysis were subjected to a nonreducing gel sodium dodecyl sulfate- polyacrylamide gel electrophoresis. Anesthesia (Treat) increases the protein content of the oligomerized form of Drp-1 in the mitochondrial fraction by about 45% compared to sham controls (Cont) (**P = 0.0037; n = 7 pups in the control group; n = 7 pups in the experimental group). The molecular mass standards (in kDa) are shown at the right of the representative Western blots. Drp-1 = dynamin-related protein 1. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 21 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Boscolo et al. Fig. 8. Proposed pathways that may be responsible for the excessive mitochondrial fission caused by an early exposure to anesthesia. Anesthesia causes downregulation of superoxide dismutase activity accompanied by a lack of compensatory modulation of catalase activity, and these effects are associated with reactive oxygen species upregulation. Elevated reactive oxygen species differentially modulate mitochondrial fission and fusion. They are suggested to induce acute downregulation of Drp-1 protein in the cytoplasm due to its translocation to mitochondria, followed by its oligomerization on the outer mitochondrial membrane, a necessary step in the formation of the ring-like structures required for mitochondrial fission. General anesthesia also causes acute downregulation of mitofusin-2 (Mfn-2), a protein necessary for mitochondrial fusion, thus tipping the fine equilibrium between fission and fusion toward excessive mitochondrial fission. Mitochondria that undergo excessive fission are less functional and more likely to generate excessive amounts of reactive oxygen species, thus further promoting reactive oxygen species upregulation in the setting of downregulated superoxide dismutase activity. In addition, down-regulation of Mfn-2 in the cytoplasm disturbs the redox balance in the neuron, leading to additional reactive oxygen species accumulation. Drp-1 = dynamin-related protein 1. Anesthesiology. Author manuscript; available in PMC 2014 January 03. Page 22",rats,['Seven-day-old rat pups received anesthesia containing a sedative dose of midazolam followed by a combined nitrous oxide and isoflurane anesthesia for 6 h.'],postnatal day 7,['Seven-day-old rat pups received anesthesia containing a sedative dose of midazolam followed by a combined nitrous oxide and isoflurane anesthesia for 6 h.'],N,[],midazolam,['Seven-day-old rat pups received anesthesia containing a sedative dose of midazolam followed by a combined nitrous oxide and isoflurane anesthesia for 6 h.'],isoflurane,['Seven-day-old rat pups received anesthesia containing a sedative dose of midazolam followed by a combined nitrous oxide and isoflurane anesthesia for 6 h.'],sprague dawley,"['Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments.']",None,[],None,[],None,[],None,[],None,[],True,True,True,False,True,True,10.1097/ALN.0b013e318289bc9b 10.1016/S1995-7645(14)60066-3,408.0,Cao,2014,rats,postnatal day 7,Y,ketamine,propofol,sprague dawley,"Asian Pacific Journal of Tropical Medicine (2014)407-411 Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Medicine journal homepage:www.elsevier.com/locate/apjtm Document heading doi: 10.1016/S1995-7645(14)60066-3 Effect of propofol and ketamine anesthesia on cognitive function and immune function in young rats Yan-Li Cao, Wei Zhang*, Yan-Qun Ai, Wen-Xia Zhang, Yi Li Department of Anesthesiology, First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan, China A R T I C L E I N F O A B S T R A C T Article history: Received 10 November 2013 Received in revised form 15 December 2013 Accepted 15 February 2014 Available online 20 May 2014 Keywords: Propofol Ketamine Cognitive function Immune function Objective: To investigate the effects of propofol and ketamine on the cognitive function and A total of 80 young rats were randomly divided into immune function in young rats. four groups: Control group, ketamine group (experimental group A), propofol group (experimental group B), ketamine and propofol group (experimental group C). All rats had continuous injection for three times, serum IL-2, IL-4 and IL-10 and whole brain IL-1毬 level, hippocampal neuronal apoptosis level were measured. The cognitive ability in rats was tested by water maze. Results: Water maze test showed on the 1st d, the maze test latency of the control group, the experimental group B and the experimental group C water were decreased gradually; Compared with the control group after 3 days, the latency of the experimental group A, experimental group B and experimental group C were all decreased, the crossing circle times were also reduced. Hippocampal neuron apoptosis were (2.3依1.7)%, (14.7依6.9)%, (4.2依3.3)%, (10.2依4.8)% in control group, experimental group A, experimental group B and experimental group C, respectively. The neurons apoptosis of experimental group A was significantly increased. The serum IL-4 and IL- 10 of the experimental group A, experimental group B and experimental group C after anesthesia were significantly higher than the control group. The whole brain IL-1毬 of the experimental group A, experimental group B and experimental group C were significantly lower than the control Propofol can reduce anesthesia effect of ketamine on the cognitive function group. and immune function in the young rats. Method: Conclusions: 1. Introduction Intravenous general anesthetics not only has good analgesic effect, but also has no significant side effects on inhibiting respiration, which is widely used in clinical surgical treatment[1]. The clinical application showed that the use of general anesthesia can cause recent cognitive impairment and mental ill effect and other adverse reactions. Neonatal ’ and infant s central nervous system and immune system are still in the developmental stage and particularly sensitive to the external environment. The mechanisms of anesthesia effects on the central nervous system and immune system are still not very clear[2]. Therefore, this experiment aims to provide the basis for clinical by the application of ketamine and the composite application of propofol and ketamine on the cognitive function and immune function in young rats. 2. Materials and methods 2.1. Animals Corresponding author: Wei Zhang, Chief Physician, Department of Anesthesiology, First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan, China. Tel: 15038068026 E-mail: caoyanli530@163.com Foundation project: It is supported by Youth Innovation Fund of The First Affiliated Hospital of Zhengzhou University (2012-2015) and National Natural Science Foundation(81200909). A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected. All animals were provided by XX University Experimental Animal Center, and were kept in a constant temperature 25 , constant humidity 40% -50% environment, and had freely drank autoclaved water. ℃ 407 Yan-Li Cao et al./Asian Pacific Journal of Tropical Medicine (2014)407-411 408 2.2. Main reagents and instruments Optical microscope was purchased from Japanese Nikon company,German Leica Microtome was purchased from Dalian Dajian Medical Devices Co., Ltd., Micro pipette and homogenizer were purchased from the German Eppendorf Company, -80 refrigerator were purchased from China Haier Company. TUNEL assay kit was purchased from Roche Company, IL-4, IL-1毬 and IgE radioimmunoassay kit were purchased from Wuhan Boster Biological Engineering Co., Ltd., Ketamine (100 mg/10 mL) were purchased from Jiangsu Hengrui Limited Company, propofol injection (200 mg/20 mL) were purchased from Sichuan Shule Pharmaceutical Corporation. Experimental animal cages, precision electronic balance, 0.9% saline solution, hematoxylin, eosin staining solution were provided by the laboratory. ℃ 2.3. Experimental methods 2.3.1. Experimental animal model and grouping methods A total of 80 young rats were randomly divided into four groups (the control group, experimental group A, =20). All experimental group B, experimental group C) ( young rats received the adaptive breeding for 1 week in animal room. The animals in the control group received 0.9% saline l mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group A received 80 mg/kg ketamine l mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group B received 80 mg/kg propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group C received 80 mg/kg ketamine and propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times. The injection volume was 1 mL, and if it was less than l mL it was supplemented by saline. Half of rats in each group were randomly sacrificed after 15 min of anesthesia, the other half underwent Morris water maze test 3 weeks later. All died or abandoned animals in midway were supplemented by modeling again. n selected. The heart was exposed by thoracotomy, the perfusion needle was inserted to the ascending aorta from the left ventricle, and fixed. The right auricle was cut. It was washed at 4 saline by perfusion needle until the effluent of the right atrium was clear. Then it was fixed by 4% paraformaldehyde phosphate buffer. Hippocampal was isolated from the brain tissue when the body tissues and organs were hard, they were paraffin-embedded and cut. Neuronal apoptosis detection was performed by terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) method. TUNEL-positive cells showed brown particles in the nucleus. Six horizons were randomly selected and average optical density was measured. Positive intensity and the apoptotic index were calculated. × The formula was as follow: apoptotic index (AI) = MOD Area% 100, MOD represents the average gray level; area% represents the percentage of the total positive nucleus area in the total nucleus area. The other half young rats cerebral was obtained quickly by sterile opening cranium, and brain tissue was mixed with ice normal saline by homogenizer. 10% brain homogenate was prepared at 4 , and centrifuged at 3 000 r/min for 15 min. The supernatant was stored at -80 for test. Whole brain IL-1毬 levels were detected by ELISA. ℃ × ℃ ℃ 2.3.4. Morris water maze test Behavior of rats was observed by Morris water maze[3]. Round tank has four quadrants. A black platform was fixed at the fourth quadrant, located 1 cm underwater. The rats were put into the water of a randomly select quadrant, swim tracks of the rats were recorded with a camera. How long rats find the platform is the latency. After this test, the platform was removed and the rats were put into water from the same water-entering point, the times of crossing the former platform were measured. 2.4. Statistical analysis 2.3.2. Immune parameters detection Using heparinization disposable 5 mL sterile syringe, 2 mL blood was obtained by percutaneous puncture at the point of maximal impulse and then it was injected into sterile EP , it was centrifuged at 3 000 r/min at tube. After 30 min at 4 low temperature for 10 min. Serum was separated and stored at -80 for the test. Serum IL-2, IL-4 and IL-10 levels were detected by ELISA. ℃ ℃ Data were expressed as mean依SD values and analyzed with SPSS 13.0 software. After the variance test, the difference between two groups was compared with single factor analysis <0.05 was considered as statistical significant of variance. difference. P 3. Results 2.3.3. Brain tissue specimen collection, preparation and indicators test 3.1. Serum IL-2, IL-4 and IL-10 and whole brain IL-1毬 level After blood collection, half of the young rats were randomly The serum IL-2 in each groups showed no significant Yan-Li Cao et al./Asian Pacific Journal of Tropical Medicine (2014)407-411 P >0.05). The serum IL-4 and IL-10 of the difference ( experimental group A, experimental group B and experimental group C were significantly higher than <0.05). There was significant the normal control group ( difference in the serum IL-4 and IL-10 levels between experimental group C and experimental group A ( <0.05). The whole brain IL-1毬 level of the experimental group A, experimental group B and experimental group C were significantly lower than the normal control group ( <0.05). There was significant difference in whole brain IL-1毬 level P between experimental group C and experimental group A ( <0.05) (Table 1). P P P in the experimental group A, experimental group B and experimental group C, which was statistically significant different from that of the control group ( <0.05). Compared with the experimental group A, the latency on the 3rd day was significant different from that of the experimental group B and experimental group C ( <0.05). Compared with the control group, there was significant difference in the crossing circle times from experimental group A, experimental group B and experimental group C ( <0.05). Compared with the experimental group A, the crossing circle times of the there was significant difference in the crossing circle times from experimental group B and experimental group C ( <0.05) (Table 3). P P P P 3.2. Hippocampal neurons apoptosis Hippocampal neurons apoptosis of the experimental group A was (14.7依6.9)%, which was significantly increased than <0.05); The apoptosis that of the control group [(2.3依1.7)%] ( rate of the experimental group B was (4.2依3.3)%, which >0.05), but had no significant difference from NS group ( significantly lower than that of experimental group A ( <0.05); The apoptosis rate of the experimental group C was (10.2依 4.8)%, which was significantly increased compared with the control group ( <0.05), but significantly decreased compared with the experimental group A ( P P P P P <0.05). 3.3. Rat behavior observation With the changes of time, the latency of control group, experimental group B and experimental group C were decreased gradually, there was significant difference between that on 1st d and 3rd d ( <0.05). The latency of experimental group A was not changed significantly P >0.05); The latency after 3 days gradually decreased ( P 4. Discussion Postoperative cognitive dysfunction attracts increasing attention. Numerous studies have shown the use of narcotic drugs is closely related the understanding dysfunction. Hippocampal neuron is considered to be major neurons which involved in long-term memory. Damage in the neurons synapse structure can significantly affect the ability of learning and memory in rats. Postsynaptic membrane receptor also involved in cognitive function of rats as an important information carrier, and that the pathogenesis of Alzheimer s patients is related with the decreased expression of receptor [4-11]. The immune changes under ’ attention. anesthetized stress of rats also attract researchers Anesthetic ketamine and propofol were involved in the regulation of the central nervous system by inhibiting postsynaptic membrane receptors, but the changes of the cognitive function and immune function and the mechanism is still not clear. Thus we anesthetized the young rats in this ’ Table 1 Serum IL-2, IL-4 and IL-10 and whole brain IL-1毬 level of rats. Indexes IL-2 (ng/mL) IL-4 (ng/mL) IL-10 (ng/mL) IL-1毬 (ngL) Note: * Compared with the control group, Control group 0.5依0.1 0.4依0.1 0.7依0.2 115.4依15.3 P Experimental group A 0.4依0.1 * 1.5依0.5 * 3.1依0.8 * 93.1依10.2 △ <0.05, Compared with experimental group A, eExperimental group B 0.4依0.1 * 1.3依0.5 * 2.6依0.6 * 97.1依18.6 P <0.05. Experimental group C 0.4依0.1 △ * 1.0依0.3 △ * 1.8依0.5 △ * 112.8依18.4 Table 2 Water maze test results. Indexes Control group Experimental group A Experimental group B Experimental group C Note: * Compared with the control group, 1 d 112.7依24.4 115.0依24.5 114.2依26.2 109.9依25.3 P <0.05, △ Latency(s) 2 d 89.5依15.4 105.9依20.6 92.6依16.8 90.3依20.4 Compared with experimental group A, P 3 d * 53.2依12.1 △ 104.3依17.3 △ * 65.0依13.1 △ * 72.4依11.6 <0.05. Crossing circle times 6.2依2.3 1.2依0.6 3.5依2.1 3.2依2.2 △ △ △ 409 Yan-Li Cao et al./Asian Pacific Journal of Tropical Medicine (2014)407-411 410 study and then explore the effect of ketamine and propofol on the cerebral development and the immune system. As a classical neurological behavior methods, morris water maze has become the standard mode to study the memory mechanism[12]. Therefore, this experiment also chose this classic mode to explore the effect of anesthetics on the cognitive function in rats. This study showed that the latency at three days is not significantly shorter after the use of anesthetics ketamine, and the times of cross the flat is far less than the normal control group, which suggested the ketamine anesthesia can reduce the spatial learning and memory ability in young rats .The latency at three days is significantly shorter than 1 day of young rats after the use of anesthetics propofol, but the exploration time was significantly longer than the normal control group. The times of cross the flat is significantly increased than the normal control group, which suggested the ketamine anesthesia can reduce the spatial learning and memory ability in young rats, but the degree is significantly less than the ketamine group. Studies have found that ketamine abusers have a long damaged memory, and its mechanism is related to damaged hippocampal neurons, which prompt some neuronal apoptosis of rats. Once propofol does not have an impact on cognitive function in rats , but the use of many drugs can cause propofol nerve degeneration and affect the brain development[13-18]. The spatial learning and memory ability in young rats of ketamine & propofol group is similar to the propofol group, the latency is significantly shorter than the ketamine group, and the times of cross the flat is also significantly increased, which suggested that the ketamine & propofol anesthesia can reduce the effect ketamine on cognitive function. The apoptosis rate of ketamine & propofol group is significantly lower than the ketamine group by the study of hippocampal neuronal apoptosis, which is accordance with the change of spatial learning and memory ability in young rats. That showed propofol can reduce ketamine-induced apoptosis in hippocampal neurons. These results indicate that the mechanism that propofol can ’ cognitive reduce the effect of ketamine anesthesia on rats lies in hippocampal neuronal apoptosis. With the increase in hippocampal neuronal apoptosis, the long-term learning and memory dysfunction are more obvious[19-23]. Numerous studies also believes that the use of propofol in humans and animals have the cerebral protective effect. Its protective mechanism may be related with reducing cerebral metabolic rate of oxygen and intracranial pressure and reducing excitatory amino acid glutamate neurotransmitter release, blocking glutamate pathways, reducing neurotoxicity induced pathological damage, the lipid peroxidation effect, preventing protein denaturation and release of inflammatory mediators and preventing secondary damage neuronal cells; reducing the formation of free radicals[24-26]. Immunity is one of the main effects of the stress response. Immune function in young rats still in the developmental stage, which is sensitive the stimulation of external factors. Generally it is believed that the impact of stress on the immune system is mainly suppression and regulation. T lymphocytes are the most important component which constitute the immune system. Good immune function of the body needs to maintain a moderate level of response and homeostasis. Th1 cells and Th2 cells is critical in maintaining the balance of immune function. Once there is Th cell subsets imbalance, that is Thl/Th2 ratio and functional imbalance, will lead to immune dysfunction[27,28], which usually expressed as the abnormal secretion of the activation factor of various inflammatory cell. This study suggests that the anesthetic of each group has little effect on IL-2 secretion, but the serum IL-4 and IL-10 were significantly increased, while the whole brain IL-1毬 were significantly decreased. Studies suggest that stress response of the adult rats is different from that in the young rats. Adult rats have a strong adaptability,while the young rats have long-lasting effects to the stress response and have a continuing influence. IL-1毬 is a cytokines produced by a variety of cells in a infection and inflammation state, which have a wide range of physiological effects. It often called the central stress-mediated factors.When there is systemic stress responses, central IL-1毬 may showed high expression[29,30]. In summary, ketamine can inhibit the cognitive function in young rats and has toxic effects on hippocampal neurons. In combination with propofol, it can reduce neurotoxicity and protect the brain tissue. Ketamine can inhibit the immune function in young rats, while propofol can reduce ’ s inhibition to the immune function .However, the ketamine there are still some gaps between the animal studies and human clinical trials. If it is consistent with human trials still need further research. Conflict of interest statement We declare that we have no conflict of interest. References [1] Chen S. Clinical comparative study of propofol and isoflurane Strait on elderly patientscognitive function after surgery. Pharmaceutical J 24 2012; (6): 127-128. [2] Gan RH, Xu LL, Xie AQ, Tian S, Yang ZY. Influence of isoflurane Yan-Li Cao et al./Asian Pacific Journal of Tropical Medicine (2014)407-411 411 and propofol on cognitive of aged patients. 23 (6): 1104-1106. Western Med 2011; once or repeatedly on the brain against global cerebral ischemia- Chin J Anesthesiol 26 reperfusion injury in rats. 2006; (8): 720- [3] Sun HJ, Liang SJ, Zhang LW. Effects of propofol and isoflurane J anesthesia on elderly patients cognitive function after surgery. Knotty 9 2010; (10): 773-774. [4] Marsden KC, Shemesh A, Bayer KU, Carroll RC. Selective 2+ translocation of Ca 栻alpha) to inhibitory synapses. 107 /calmodulin protein kinase IIalpha (CaMK Proc Natl Acad Sci USA 2010; 723. [19] Zhao DM, Li QC, Diao HL, Liu HF, Wang LM, Huang F. Effects of propofol pretreatment on learning and memory ability and J ’ hippocampus injury of Alzheimer Binzhou Med School s disease-like model rats. 30 2007; (6): 407-411. [20] Erasso DM, Camporesi EM, Mangar D, Saporta S. Effects of (47): 20559-20564. [5] Gustin RM, Shonesy BC, Robinson SL, Rentz TJ, Baucum AJ, isoflurane or propofol on postnatal hippocampal eurogenesis in Brain Res 1530 young and aged rats. 2013; : 1-12. Jalan-Sakrikar N, et al. Loss of Thr286 phosphorylation disrupts synaptic CaMK栻 毩 targeting, NMDAR activity and behavior in pre-adolescent mice. Mol Cell Neurosci 47 2011; (4): 286-292. [6] Chen NM, Ding L. Propofol to the elderly colon cancer S100毬 Chin Rural expression and cognitive function after radical surgery. Med 19 2012; (8): 13-14. [21] Mirski MA, Lewin JJ, Ledroux S, Thompson C, Murakami P, Zink EK, et al. Cognitive improvement during continuous sedation in critically ill, awake and responsive patients: the Acute Intensive Care Med Neurological ICU Sedation Trial (ANIST). 36 2010; (9): 1505-1513. [22] Erasso DM, Chaparro RE, Quiroga Del Rio CE, Karlnoski R, [7] Xu XD, Zhang LC. Experimental research of propofol on learning Chin Pract Med 8 (12): 7-9. 2013; and memory function. [8] Wu D. The influence of Sevoflurane and propofol general Camporesi EM, Saporta S. Quantitative assessment of new cell proliferation in the dentate gyrus and learning after isoflurane 2 ; Brain Res orpropofol anesthesia in young and aged rats. 2012; anesthesia on elderly patients after anesthesia emergence time and Chin Pharmaceutical 22 cognitive function. 2013; (5): 95-96. ë te S, Leydet J, Echenne B, Rivier F, et al. [9] Meyer P, Langlois C, So Unexpected neurological sequelae following propofol anesthesia in Brain Dev 32 infants: Three case reports. 2010; (10): 872-878. 1441: 38-46. [23] Schoen J, Husemann L, Tiemeyer C, Lueloh A, Sedemund- Adib B, Berger KU, et al. Cognitive function after sevoflurane- vs . propofol-based anaesthesia for on-pump cardiac surgery: a Br J Anaesth 106 randomized controlled trial. 2011; (6): 840-850. [10] Xiao J,Zheng LM, Wang ML, et al. Effects of disoprofol and [24] Soukup J, Selle A, Wienke A, Steighardt J, Wagner NM, Kellner isoflurane on postoperative cognitive dysfunction in the elderly. Chin Modern Doctor 48 2010; (11): 80-81. P. Efficiency and safety of inhalative sedation with sevoflurane in comparison to an intravenous sedation concept with propofol in [11] Sharma S, Rakoczy S, Brown-Borg H. Assessment of spatial Life Sci 23 memory in mice. 2010; (17-18): 521-536. intensive care patients: study protocol for a randomized controlled Trials 10 trial. 2012; (13): 135. [12] Jiang Y, Zhou ZJ, Chen P, Huang F, Xian YS, Wang YL, et [25] Lewis LD, Weiner VS, Mukamel EA, Donoghue JA, Eskandar EN, al.Effects of multiple doses of propofol on cognitive function in Chin J Anesthesiol 28 neonatal rats. 2008; (11): 1007-1009. [13] Jiang Y, Gao J, Chen P, Li QY. Effects of propofol on pyramidal J Chongqing neuron apoptosis in hippocampus of neonatal rats. Med Univ 34 2009; (3): 304-307. [14] Xiao B, Han F, Shi YX. Expression changes of CaMKII 毩 and 2009; Progr Anatomical Sci pCaMKII in the PTSD rat amygdala. 15 (4): 396-399. [15] Chen YF. The effect of propofol on cell apoptosis after freezing Xianning Coll J 21 injury rats. 2007; (6): 474-475. Madsen JR, et al. Rapid fragmentation of neuronal networks at the Proc Natl Acad Sci onset of propofol-induced unconsciousness. USA 109 2012; (49): E3377-E3386. [26] Ye X, Lian Q, Eckenhoff MF, Eckenhoff RG, Pan JZ. Differential PLoS general anesthetic effects on microglial cytokine expression. One 8 (1): e52887. 2013; [27] Erdogan MA, Demirbilek S, Erdil F, Aydogan MS, Ozturk E, Togal T, et al. The effects of cognitive impairment on anaesthetic Eur J Anaesthesiol 29 requirement in the elderly. 2012; (7): 326- 331. [16] Kuai JK, Han LC, Chai W. The long-term changes and [28] Luo J, Min S, Wei K, Li P, Dong J, Liu YF. Propofol protects mechanism of cognitive function after ketamine anesthesia in Chin Med Sci 16 neonatal rats. 2007; (9): 789-791. [17] Song SL, Wang JM. Experimental research about the effect of against impairment of learning-memory and imbalance of hippocampal Glu/GABA induced by electroconvulsive shock in J Anesth 25 depressed rats. 2011; (5): 657-665. monosodium gutamate on the ability of learning and memory and Guangzhou Med the behaviour in open field in rats. 2008; 39 (1): [29] Rezaei F, Nasseri K, Esfandiari GR, Sadeghi SM, Fathie M, Gharibi F. Remifentanil added to propofol for induction of 1-3. [18] Li YC, Li Y, Wang YS, Li JQ, Li ZX, Li EY, et al. Protective anesthesia can reduce reorientation time after electroconvulsive J ECT 28 therapy in patients with severe mania. 2012; (2): 124- effects of preconditioning with different doses of propofol given 127.",rats,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",postnatal day 7,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",Y,['Behavior of rats was observed by Morris water maze.'],ketamine,"['The animals in experiment group A received 80 mg/kg ketamine l mL by intraperitoneal injection every 2 h, continuous for 3 times.']",propofol,"['The animals in experiment group B received 80 mg/kg propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times.']",sprague dawley,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",This experiment aims to provide the basis for clinical by the application of ketamine and the composite application of propofol and ketamine on the cognitive function and immune function in young rats.,"['Therefore, this experiment aims to provide the basis for clinical by the application of ketamine and the composite application of propofol and ketamine on the cognitive function and immune function in young rats.']",None,[],Propofol can reduce anesthesia effect of ketamine on the cognitive function and immune function in the young rats.,['Propofol can reduce anesthesia effect of ketamine on the cognitive function and immune function in the young rats.'],"However, the degree is significantly less than the ketamine group. Studies have found that ketamine abusers have a long damaged memory, and its mechanism is related to damaged hippocampal neurons, which prompt some neuronal apoptosis of rats.","['However, the degree is significantly less than the ketamine group. Studies have found that ketamine abusers have a long damaged memory, and its mechanism is related to damaged hippocampal neurons, which prompt some neuronal apoptosis of rats.']",None,[],True,True,True,True,True,True,10.1016/S1995-7645(14)60066-3 10.1016/j.bbrc.2021.03.063,234.0,Chen,2021,mice,gestational day 14,Y,sevoflurane,none,c57bl/6,"Biochemical and Biophysical Research Communications 553 (2021) 65e71 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / y b b r c Maternal anesthesia with sevoflurane during the mid-gestation induces social interaction deficits in offspring C57BL/6 mice Qingcai Chen a, 1, Wei Chu b, 1, Rui Sheng b, Shaoyong Song a, Jianping Yang a, Fuhai Ji a, ** Xin Jin a, * a Department of Anesthesiology, First Affiliated Hospital of Soochow University, Suzhou, 215006, China b Department of Pharmacology, Soochow University School of Pharmaceutical Science, Suzhou, 215123, China , a r t i c l e i n f o a b s t r a c t Article history: Received 17 January 2021 Accepted 11 March 2021 Available online 20 March 2021 Keywords: Anesthesia Sevoflurane Neurotoxicity Sociability Preference for social novelty Three-chambered social paradigm Sevoflurane anesthesia in pregnant mice could induce neurotoxicity in the developing brain and disturb learning and memory in the offspring mice. Whether it could impair social behaviors in the offspring mice is uncertain. Therefore, we assessed the neurobehavioral effect of in-utero exposure to sevoflurane on social interaction behaviors in C57BL/6 mice. The pregnant mice were anesthetized with 2.5% sevo- flurane in 100% oxygen for 2 h, and their offspring mice were tested in three-chambered social paradigm, which includes three 10-min sessions of habituation, sociability, and preference for social novelty. At the juvenile age, the offspring mice showed abnormal sociability, as proved by not taking more time sniffing at the stranger 1 mouse compared with the empty enclosure (108.5 ± 25.4 vs. 108.2 ± 44.0 s, P ¼ 0.9876). Meanwhile, these mice showed impaired preference for social novelty, as evidenced by not taking more time sniffing at the stranger 2 compared with the stranger 1 mouse (92.1 ± 52.2 vs. 126.7 ± 50.8 s, P ¼ 0.1502). At the early adulthood, the offspring mice retrieved the normal sociability (145.6 ± 33.2 vs. 76.0 ± 31.8 s, P ¼ 0.0001), but remained the impaired preference for social novelty (100.6 ± 29.3 vs. 118.0 ± 47.9 s, P ¼ 0.3269). Collectively, these results suggested maternal anesthesia with sevoflurane could induce social interaction deficits in their offspring mice. Although the disturbance of sociability could be recoverable, the impairment of preference for social novelty could be long-lasting. © 2021 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 1. Introduction Preclinical studies suggested that anesthetic agents could induce the neurotoxicity in developing brain and cause neurobehavioral changes in adulthood [1e4]. Anesthetic-induced developmental neurotoxicity could be attributed to multiple factors, including anesthetic agents, anesthesia regimen (i.e., concentration and dura- tion), and brain vulnerability [2,5]. Sevoflurane is commonly used in parturient undergoing non-obstetric surgery, which incurs many concerns on neurodevelopmental consequences. environmental toxicants including anesthetic agents should play an important role [8,9]. It was reported that in-utero exposure to isoflurane could impair the spatial working memory of the rat [5]. Therefore, we hypothesized that in-utero exposure to sevoflurane could induce social interaction deficit in offspring C57BL/6 mice. To verify this possibility, we performed maternal anesthesia with sev- oflurane in pregnant mice on gestational day 14. Next, we conducted social interaction test in their offspring mice at one- and two-month- old. The main objective was to determine whether in-utero exposure to sevoflurane was induce social interaction deficit in offspring mice. In recent years, children with autistic spectrum disorders are increasing. The core symptom of autism is social interaction deficit [6,7], but the neuropathological mechanism remains uncertain. The combined effect of genetic predisposition and early exposure to 2. Methods and materials 2.1. Animals Corresponding author. ** Corresponding author. E-mail addresses: jifuhai@hotmail.com (F. Ji), jinxin@suda.edu.cn (X. Jin). 1 These authors contributed equally to this work (Q.C.C. and W.C.). This study was approved by the Institutional Animal Care and Use Committee of Soochow University. Adult C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Suzhou, China). One male and four female mice were housed per https://doi.org/10.1016/j.bbrc.2021.03.063 0006-291X/© 2021 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Q. Chen, W. Chu, R. Sheng et al. cage for breeding the offspring mice. Six pregnant mice on gesta- tional day 14 were randomly assigned to receive either 2.5% sevo- flurane in 100% oxygen or just 100% oxygen as the control. Their offspring mice were correspondingly assigned as the testing mice. Several pregnant mice without any treatment were chosen to produce the offspring mice as the stranger mice. The pups were fostered by their own dams till weaning on postnatal day 21. All mice were raised in a controlled condition (21e22 (cid:2)C, 12 h light/ dark cycle, light on at 7 a.m.), with access to standard mouse chow and water ad libitum. 2.2. Maternal anesthesia A clinically-retired anesthesia machine was used to supply one- way gas flow. A transparent plastic box (20 L (cid:3) 20 W (cid:3) 6 H cm) was used as the anesthetizing chamber, with three holes for gas inflow, gas outflow, and gas monitoring. A heating-pad was placed un- derneath the anesthetizing chamber to keep mice warm during anesthesia. Sevoflurane anesthesia on pregnant mice in this study was strictly performed by the protocols of previous study [10], in which arterial blood pressure and blood gas analysis were demonstrated within normal limits. The pregnant mice retained spontaneous respiration during inhalational anesthesia. Sevo- flurane was washed out with pure oxygen for 15 min, and the pregnant mice with right reflex were put back to home cages. 2.3. Social apparatus The three-chambered social box (40L (cid:3) 60W (cid:3) 22H cm) with two enclosures (7D (cid:3) 15H cm) was used for social interaction test (Fig. 1AeC). An improved video-tracking system programed by ANY-maze (Stoelting Co., USA) was used to capture the movement of mouse. Given the testing mouse initiates social approaching to the stranger mouse by nose-to-nose or nose-to-tail sniffing (Fig. 1D), the animal’s head was tracked by the video-tracking system. Four behavioral parameters was automatically measured by ANY-maze program, including the time sniffing at the enclosure and number of sniffs at the enclosure, the time exploring in the side-chamber and number of entries into side chamber. Specifically, “at the enclosure” is defined as the mouse head entering an area of 3 cm around the enclosure. 2.4. Social interaction test The offspring mice (N ¼ 17 Control, 9 males and 8 females; N ¼ 14 Sevoflurane, 9 males and 5 females) were tested at one- and two-month-old (i.e., the juvenile and early-adult age). In advance, the testing mouse was housed single for 1-h isolation in the behavioral room. The stranger mice were the identical background, same gender and similar age as the testing mouse, and they had exactly no contact before. Social interaction test is composed of three 10-min sessions of habituation, sociability, and preference for social novelty. Firstly, the testing mouse was allowed to freely explore in social box with two doorways opening. Next, an unfa- miliar conspecific (Stranger 1) was introduced into one enclosure, and the testing mouse was allowed to sniff the stranger 1 or explore the empty enclosure (Fig. 1E, G). After that, another unfamiliar conspecific (Stranger 2) was introduced into the other enclosure, and the testing mouse was allowed to sniff the stranger 1 and stranger 2 (Fig. 1F, H). Placement of the stranger 1 on the left or right side was systematically altered between trials, and social apparatus was cleaned after each trial to minimize olfactory disturbance. 66 Biochemical and Biophysical Research Communications 553 (2021) 65e71 2.5. Statistical analysis Data were shown as Mean ± SD. Graphpad Prism 5.0 software (San Diego, USA) was used for statistical analyses. Social data ob- tained from the left and right side were mutually exclusive in each 10-min session and they were normally distributed by Kolmogorov-Smirnov tests. Therefore, two-tailed paired t-test was used to compare the side preferences (stranger 1 vs. the opposite). Two-way repeated measures (RM) ANOVAs were used to analyze the interaction effects of treatment (control or sevoflurane) (cid:3) side (stranger 1 or the opposite). Based on the preliminary study, a sample size of more than 5 (sociability) and 13 (preference for so- cial novelty) could lead to a 90% power to detect a difference in side preference with 5% type I error. P values less than 0.05 (*), 0.01 (**) and 0.001 (***) were considered statistically significant. 3. Results 3.1. Maternal anesthesia with sevoflurane induced abnormal sociability in the offspring mice at one-month-old The offspring mice in the control showed normal sociability, as proved by taking more time sniffing (Fig. 2A left, 167.7 ± 55.4 vs. 102.5 ± 35.4 s, P ¼ 0.001) and sniffing more frequently (Fig. 2B left, 42.9 ± 16.2 vs. 27.9 ± 9.1, P ¼ 0.0078) at the enclosure containing the stranger 1, as compared to the empty enclosure. Meanwhile, these testing mice spent more time exploring in the chamber with stranger 1 than in the empty chamber (Fig. 2C left, 298.5 ± 60.7 vs. 215.0 ± 45.8 s, P ¼ 0.0034). However, the offspring mice undergoing in-utero exposure to sevoflurane showed no side preference be- tween the stranger 1 and empty side, in terms of the time sniffing (Fig. 2A right, 108.5 ± 25.4 vs. 108.2 ± 44.0 s, P ¼ 0.9876) or the number of sniffs (Fig. 2B right, 43.2 ± 11.7 vs. 44.4 ± 12.9, P ¼ 0.8089) at the enclosure, or the time exploring in the chamber (Fig. 2C right, 240.2 ± 42.5 vs. 237.5 ± 50.7 s, P ¼ 0.9122). In addition, two-way ANOVAs showed the significant interaction effects of treatment (control or sevoflurane) (cid:3) side (the stranger 1 or empty side), in terms of the time taken sniffing (Fig. 2A, F ¼ 7.7070, P ¼ 0.0095), the number of sniffs (Fig. 2B, F ¼ 5.3030, P ¼ 0.0287) and the time spent exploring (Fig. 2C, F ¼ 5.4560, P ¼ 0.0266). As for the number of entries into the chamber, the offspring mice in either group displayed no significant differences between two sides (Fig. 3D), which indicated the similar probabilities of exploration in the left and right chamber. Together, these data suggested that maternal anesthesia with 2.5% sevoflurane could induce the socia- bility deficit in their offspring mice at juvenile age. 3.2. Maternal anesthesia with sevoflurane induced abnormal preference for social novelty in the offspring mice at one-month-old The offspring mice in the control showed normal preference for social novelty, as evidenced by taking more time sniffing (Fig. 2E left, 92.9 ± 33.5 vs. 193.6 ± 61.1 s, P < 0.0001) and sniffing more frequently (Fig. 2F left, 26.7 ± 6.8 vs. 45.6 ± 20.7, P ¼ 0.0013) at the enclosure containing stranger 2, as compared to the stranger 1. Meanwhile, these testing mice spent more time exploring in the chamber with stranger 2 than in the chamber with stranger 1 (Fig. 2G left, 194.5 ± 33.4 vs. 323.8 ± 54.5 s, P < 0.0001). However, the offspring mice undergoing in-utero exposure to sevoflurane showed no side preference between the stranger 2 and stranger 1 mouse, in terms of the time sniffing (Fig. 2E right, 92.1 ± 52.2 vs. 126.7 ± 50.8 s, P ¼ 0.1502) or the number of sniffs (Fig. 2F right, 29.1 ± 12.5 vs. 35.0 ± 11.2, P ¼ 0.2354) at the enclosure, or the time exploring in the chamber (Fig. 2G right, 204.8 ± 77.5 vs. 286.0 ± 88.6 s, P ¼ 0.0785). Q. Chen, W. Chu, R. Sheng et al. Biochemical and Biophysical Research Communications 553 (2021) 65e71 Fig. 1. Social interaction test in the three-chambered social box. (A) Schematic view of the three-chambered social box with two video-cameras hung right above two enclosures. (B) Schematic view of two enclosures in the left and right chambers. (C) One testing mouse is exploring in the social box with two doorways opening. (D) One testing mouse is sniffing the stranger mouse in the manner of nose-to-nose or nose-to-tail. (E) One testing mouse shows normal sociability as proved by preferring the stranger 1 mouse to the empty enclosure. (F) The testing mouse shows normal preference for social novelty as evidenced by preferring the stranger 2 to stranger 1 mouse. (G) One testing mouse shows impaired sociability as proved by no side preference between the stranger 1 mouse and the empty enclosure. (H) The testing mouse shows impaired preference for social novelty as evidenced by no side preference between the stranger 2 and stranger 1 mouse. Unit of dimension: millimeters. E ¼ the empty enclosure, S1 ¼ Stranger 1, S2 ¼ Stranger 2. Additionally, two-way ANOVAs showed the significant interac- tion effect of treatment (control or sevoflurane) (cid:3) side (stranger 2 or stranger 1) in terms of time taken sniffing at the enclosure (Fig. 2E and F ¼ 5.248, P ¼ 0.0294). As for the number of entries into the chamber, the offspring mice in either group displayed no sig- nificant differences between two sides (Fig. 2H), which reflected the equal opportunities of exploration in the left and right chamber. Together, these data suggested that maternal anesthesia with 2.5% sevoflurane could impair the preference for social novelty in their offspring mice at juvenile age. showed normal sociability, as evidenced by taking more time sniffing the stranger 1 over the empty enclosure (Fig. 3A right, 145.6 ± 33.2 vs. 76.0 ± 31.8 s, P ¼ 0.0001). This recovery of sociability was sup- ported by the number of sniffs at the enclosure (Fig. 3B right, 57.0 ± 16.9 vs. 35.7 ± 6.2, P ¼ 0.0009) and the time spent exploring in the chamber (Fig. 3C right, 305.0 ± 43.2 vs. 185.1 ± 35.7 s, P < 0.0001). In addition, two-way ANOVAs detected no interaction effect of treatment (cid:3) side in either parameter (Fig. 3AeC), which supported the recovery of sociability in a certain extent. Collectively, these data suggested that the offspring mice exposed to sevoflurane in-utero could retrieve normal sociability at early-adulthood. 3.3. The offspring mice exposed to sevoflurane in-utero retrieved normal sociability at two-month-old The offspring mice undergoing fetal exposure to sevoflurane 67 Q. Chen, W. Chu, R. Sheng et al. Biochemical and Biophysical Research Communications 553 (2021) 65e71 Fig. 2. The offspring mice undergoing in-utero exposure to sevoflurane show abnormal sociability and impaired preference for social novelty at one-month-old. The offspring mice exposed to sevoflurane in-utero show no side preference between the stranger 1 mouse and the empty side, in terms of time sniffing at the enclosure (A, right), number of sniffs (B, right), and time exploring in the chamber (C, right). Additionally, these offspring mice show no side preference between the stranger 2 and stranger 1 mouse, in terms of time sniffing at the enclosure (E, right), number of sniffs (F, right), and time exploring in the chamber (G, right). As for the number of entries into chamber, there are not significant differences between two sides in the session of either sociability (D) or preference for social novelty (H). Data are expressed as Mean ± SD. N ¼ 17 Control and 14 Sevoflurane. **P < 0.01, ***P < 0.001. 3.4. The offspring mice exposed to sevoflurane in-utero remained abnormal preference for social novelty at two-month-old The offspring mice undergoing fetal exposure to sevoflurane showed again no side preference between the stranger 2 and stranger 1 mouse, in terms of the time sniffing (Fig. 3E right, 100.6 ± 29.3 vs. 118.0 ± 47.9 s, P ¼ 0.3269) or the number of sniffs (Fig. 3F right, 42.9 ± 15.6 vs. 52.2 ± 14.1, P ¼ 0.1074) at the enclosure, 68 Q. Chen, W. Chu, R. Sheng et al. Biochemical and Biophysical Research Communications 553 (2021) 65e71 Fig. 3. The offspring mice undergoing in-utero exposure to sevoflurane retrieve normal sociability, but remained abnormal preference for social novelty at two-month-old. The offspring mice exposed to sevoflurane in-utero take more time sniffing (A, right) and sniff more frequently (B, right) at the enclosure containing stranger 1, and they spend more time exploring in the chamber with stranger 1 (C, right), as compared to the empty side. However, these offspring mice show no side preference between the stranger 2 and stranger 1 mouse, in terms of time sniffing at the enclosure (E, right), number of sniffs (F, right), and time exploring in the chamber (G, right). As for the number of entries into chamber, there are not significant differences between two sides in the session of either sociability (D) or preference for social novelty (H). Data are expressed as Mean ± SD. N ¼ 17 Control and 14 Sevoflurane. *P < 0.05, ***P < 0.001. or the time exploring in the chamber (Fig. 3G right, 248.7 ± 64.6 vs. 250.7 ± 67.3 s, P ¼ 0.9558). Collectively, these data suggested that the offspring mice exposed to sevoflurane in-utero could not re- covery the normal preference for social novelty at early-adulthood, indicating that maternal anesthesia with 2.5% sevoflurane might cause the long-term impairment of social memory in offspring mice. 69 Q. Chen, W. Chu, R. Sheng et al. 4. Discussions Clinical anesthesia facilitates a variety of surgical procedures by bringing patients into an unconscious and painless state, which is usually regarded as a safe and reversible process [11]. However, it may not be the truth in two extremes of life, including the pediatric and geriatric patients [12,13]. A great number of pregnant women are receiving non-obstetric surgeries and fetal intervention pro- cedures under general anesthesia [1]. As many anesthetic agents are lipophilic, they can easily cross placenta and cause fetal expo- sure to anesthetics. Several studies have suggested anesthetic- induced developmental neurotoxicity, ranging from human em- bryonic stem cells in vitro to rodents and non-human primates in vivo [14e18]. It was reported that sevoflurane anesthesia in pregnant mice on gestation day 14 induced the learning and memory impairment in offspring mice [10]. Therefore, we anes- thetized the pregnant mice on gestational day 14, and tested social interaction behaviors of the offspring mice at one- and two-month- old. As a result, we found that maternal anesthesia with 2.5% sev- oflurane for 2 h was able to induce social deficits in offspring mice. In recent decades, children with autism spectrum disorders are largely increasing [7,8,19]. Autism is clincally diagnosed by social interaction deficit, communicative impairment, and repetitive stereotyped behaviors [20e22]. As a core symptom of autism, many preclinical studies were conducted to determine the mechanism of social interaction deficit [23,24]. A three-chambered social para- digm is well-designed to test social behaviors in mouse model [25,26]. Two video-cameras were hung right above two enclosures, which could montage two video-images and capture the moment of testing mice in ANY-maze program. In this study, we examined two biological profiles of testing mice, including sociability and preference for social novelty. In detail, sociability, reflecting social affiliation, is primarily judged by the testing mouse taking more time sniffing the stranger 1 over the empty enclosure. Similarly, preference for social novelty, reflecting social recognition memory, is largely judged by the testing mouse taking more time sniffing the stranger 2 over the stranger 1. In early studies, side preferences were mainly determined by the time spent exploring in the left or right chamber [25,27]. The testing mice might spend much time wandering in side chambers, instead of directly interacting with the stranger mouse. Then, the time sniffing the stranger mouse was used to reflect side preference in social studies [22,24,28e30]. Meanwhile, the number of sniffs acted as an auxiliary parameter, like the entries into open arms in elevated plus maze [5,31,32]. In this study, we found that the offspring mice undergoing in- utero exposure to sevoflurane showed abnormal sociability at ju- venile age, whereas these offspring mice retrieved normal socia- bility at early-adulthood. The disturbance of sociability in offspring mice displayed in a time-dependent manner, and the retrieving of sociability might be explained by an environmental stimuli. It was reported ameliorate sevoflurane-induced neurotoxicity and reverse learning and memory impairment in mice [10,33]. that environmental enrichment can In contrast, the offspring mice exposed to sevoflurane in-utero showed abnormal preference for social novelty at juvenile age, and these mice remained this abnormality at early-adulthood. This long-term impairment of social recognition memory was in line with sevoflurane-induced impairment in learning and memory, as indicated by water-maze task or fear-conditioning test [10,33,34]. Notably, sevoflurane anesthesia in this study was conducted by the protocols of previous studies, in which blood gas analysis denied any hypoxemia in anesthetized mice [10,35]. Admittedly, this study has several limitations. Firstly, we did not investigate social inter- action behaviors of the offspring mice at more time points. Given 70 Biochemical and Biophysical Research Communications 553 (2021) 65e71 the recovery of sociability at two-month-old, it was possible that the testing mice undergoing in-utero exposure to sevoflurane could regain normal preference for social novelty in later life or amelio- rated by environmental stimuli [10]. However, our findings have detected the detrimental effects of in-utero exposure to sevo- flurane on social behaviors of offspring mice. Secondly, it should be cautious to extrapolate our findings in mice to human being. Given that the gestational period is 21 days in mice, the anesthesia duration of 2 h in mice (nearly 27 h in humans) is much longer than the average time of sevoflurane anesthesia in humans. In addition, the sequence and timing of neurodevelopmental processes are different between species. For instance, the neurogenesis and neural migration is predominant in the 2nd trimester for humans, but in the 3rd trimester for rodents [1]. Thirdly, we had no idea of whether the anesthetized dams might have difficulties in fostering pups. To rule out this confounding factor, we will arrange cross- nursing between the anesthetized and control dams in future study. Finally, we did not investigate the underlying mechanisms of social like the altered expression of special receptor proteins in developing brain. How- ever, we will explore the detailed mechanism of social deficits in offspring mice based on the current observations, and determine specific brain regions including the anesthetic-related GABA metabolism and social memory-related NMDA expression [5]. interaction deficits in offspring mice, In conclusion, maternal anesthesia with sevoflurane during the interaction deficits in the mid-gestation could induce social offspring mice. In particular, the sociability of the offspring mice could be abnormal at juvenile age, and it could return normally at early-adulthood. However, the preference for social novelty of these mice could be impaired for much longer time. Declaration of competing interest The authors declare no conflict of interest. Acknowledgements This study was supported by grants from Natural Science Foundation of China (81471835). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2021.03.063. References [1] A. Palanisamy, Maternal anesthesia and fetal neurodevelopment, Int. J. Obstet. Anesth. 21 (2012) 152e162. [2] X. Shen, Y. Dong, Z. Xu, H. Wang, C. Miao, S.G. Soriano, D. Sun, M.G. Baxter, Y. Zhang, Z. Xie, Selective anesthesia-induced neuroinflammation in devel- oping mouse brain and cognitive impairment, Anesthesiology 118 (2013) 502e515. [3] Y. Takaenoki, Y. Satoh, Y. Araki, M. Kodama, R. Yonamine, S. Yufune, T. Kazama, Neonatal exposure to sevoflurane in mice causes deficits in maternal behavior later in adulthood, Anesthesiology 120 (2014) 403e415. [4] M. Satomoto, Y. Satoh, K. Terui, H. Miyao, K. Takishima, M. Ito, J. Imaki, Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice, Anesthesiology 110 (2009) 628e637. [5] A. Palanisamy, M.G. Baxter, P.K. Keel, Z. Xie, G. Crosby, D.J. Culley, Rats exposed to isoflurane in utero during early gestation are behaviorally abnormal as adults, Anesthesiology 114 (2011) 521e528. [6] J.N. Crawley, Designing mouse behavioral tasks relevant to autistic-like be- haviors, Ment. Retard. Dev. Disabil. Res. Rev. 10 (2004) 248e258. [7] S.S. Moy, J.J. Nadler, Advances in behavioral genetics: mouse models of autism, Mol. Psychiatr. 13 (2008) 4e26. [8] J.J. Schwartzer, C.M. Koenig, R.F. Berman, Using mouse models of autism spectrum disorders to study the neurotoxicology of gene-environment in- teractions, Neurotoxicol. Teratol. 36 (2013) 17e35. [9] P.L. Oliver, K.E. Davies, Interaction between environmental and genetic factors Q. Chen, W. Chu, R. Sheng et al. modulates schizophrenic endophenotypes in the Snap-25 mouse mutant blind-drunk, Hum. Mol. Genet. 18 (2009) 4576e4589. [10] H. Zheng, Y. Dong, Z. Xu, G. Crosby, D.J. Culley, Y. Zhang, Z. Xie, Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice, Anesthesiology 118 (2013) 516e526. [11] H.M. Holtby, Neurological injury and anesthetic neurotoxicity following neonatal cardiac surgery: does the head rule the heart or the heart rule the head, Future Cardiol. 8 (2012) 179e188. [12] G.K. Istaphanous, J. Howard, X. Nan, E.A. Hughes, J.C. McCann, J.J. McAuliffe, S.C. Danzer, A.W. Loepke, Comparison of the neuroapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice, Anesthesiology 114 (2011) 578e587. [13] J. Jiang, H. Jiang, Effect of the inhaled anesthetics isoflurane, sevoflurane and desflurane on the neuropathogenesis of Alzheimer’s disease (review), Mol. Med. Rep. 12 (2015) 3e12. [14] X. Lei, Q. Guo, J. Zhang, Mechanistic insights into neurotoxicity induced by anesthetics in the developing brain, Int. J. Mol. Sci. 13 (2012) 6772e6799. [15] C. Wang, Advanced pre-clinical research approaches and models to studying pediatric anesthetic neurotoxicity, Front. Neurol. 3 (2012) 142. [16] X. Bai, D. Twaroski, Z.J. Bosnjak, Modeling anesthetic developmental neuro- toxicity using human stem cells, Semin. CardioThorac. Vasc. Anesth. 17 (2013) 276e287. [17] D. Twaroski, Z.J. Bosnjak, X. Bai, MicroRNAs: new players in anesthetic- induced developmental neurotoxicity, Pharm. Anal. Acta 6 (2015) 357. [18] Z.J. Bosnjak, Y. Yana, S. Canfield, M.Y. Muravyevaa, C. Kikuchia, C. Wellsc, J. Corbettd, X. Baia, Ketamine induces toxicity in human neurons differenti- ated from embryonic stem cells via mitochondrial apoptosis pathway, Curr. Drug Saf. 7 (2012) 106e119. [19] F.I. Roullet, J.K. Lai, J.A. Foster, In utero exposure to valproic acid and autism–a current review of clinical and animal studies, Neurotoxicol. Teratol. 36 (2013) 47e56. [20] C.B. Boylan, M.E. Blue, C.F. Hohmann, Modeling early cortical serotonergic deficits in autism, Behav. Brain Res. 176 (2007) 94e108. [21] B.L. Pearson, J.K. Bettis, K.Z. Meyza, L.Y. Yamamoto, D.C. Blanchard, R.J. Blanchard, Absence of social conditioned place preference in BTBR Tþtf/J mice: relevance for social motivation testing in rodent models of autism, Behav. Brain Res. 233 (2012) 99e104. [22] K.K. Chadman, Fluoxetine but not risperidone increases sociability in the BTBR mouse model of autism, Pharmacol. Biochem. Behav. 97 (2011) 586e594. [23] A.C. Felix-Ortiz, K.M. Tye, Amygdala inputs to the ventral hippocampus bidi- rectionally modulate social behavior, J. Neurosci. 34 (2014) 586e595. [24] S.S. Moy, J.J. Nadler, N.B. Young, R.J. Nonneman, A.W. Grossman, D.L. Murphy, A.J. D’Ercole, J.N. Crawley, T.R. Magnuson, J.M. Lauder, Social approach in 71 Biochemical and Biophysical Research Communications 553 (2021) 65e71 genetically engineered mouse lines relevant to autism, Gene Brain Behav. 8 (2009) 129e142. [25] S.S. Moy, J.J. Nadler, A. Perez, R.P. Barbaro, J.M. Johns, T.R. Magnuson, J. Piven, J.N. Crawley, Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice, Gene Brain Behav. 3 (2004) 287e302. [26] J.N. Crawley, T. Chen, A. Puri, R. Washburn, T.L. Sullivan, J.M. Hill, N.B. Young, J.J. Nadler, S.S. Moy, L.J. Young, H.K. Caldwell, W.S. Young, Social approach behaviors in oxytocin knockout mice: comparison of two independent lines tested in different laboratory environments, Neuropeptides 41 (2007) 145e163. [27] J.J. Nadler, S.S. Moy, G. Dold, D. Trang, N. Simmons, A. Perez, N.B. Young, R.P. Barbaro, J. Piven, T.R. Magnuson, J.N. Crawley, Automated apparatus for quantitation of social approach behaviors in mice, Gene Brain Behav. 3 (2004) 303e314. [28] S.S. Moy, V.D. Nikolova, N.V. Riddick, L.K. Baker, B.H. Koller, Preweaning sensorimotor deficits and adolescent hypersociability inGrin1Knockdown mice, Dev. Neurosci. 34 (2012) 159e173. [29] S.S. Moy, R.J. Nonneman, N.B. Young, G.P. Demyanenko, P.F. Maness, Impaired sociability and cognitive function in Nrcam-null mice, Behav. Brain Res. 205 (2009) 123e131. [30] S.S. Moy, R.J. Nonneman, G.O. Shafer, V.D. Nikolova, N.V. Riddick, K.L. Agster, L.K. Baker, D.J. Knapp, Disruption of social approach by MK-801, amphet- amine, and fluoxetine in adolescent C57BL/6J mice, Neurotoxicol. Teratol. 36 (2013) 36e46. [31] S.S. Moy, J.J. Nadler, N.B. Young, A. Perez, L.P. Holloway, R.P. Barbaro, J.R. Barbaro, L.M. Wilson, D.W. Threadgill, J.M. Lauder, T.R. Magnuson, J.N. Crawley, Mouse behavioral tasks relevant to autism: phenotypes of 10 inbred strains, Behav. Brain Res. 176 (2007) 4e20. [32] K. Kent, V. Arientyl, M.M. Khachatryan, R.I. Wood, Oxytocin induces a condi- J. Neuroendocrinol. 25 (2013) tioned social preference in female mice, 803e810. [33] Y. Zhao, K. Chen, X. Shen, Environmental enrichment attenuated sevoflurane- induced neurotoxicity through the PPAR-gamma signaling pathway, BioMed Res. Int. 2015 (2015) 107e149. [34] W. Chung, S. Park, J. Hong, S. Park, S. Lee, J. Heo, D. Kim, Y. Ko, Sevoflurane exposure during the neonatal period induces long-term memory impairment but not autism-like behaviors, Paediatr. Anaesth. 25 (2015) 1033e1045. [35] Y. Dong, G. Zhang, B. Zhang, R.D. Moir, W. Xia, E.R. Marcantonio, D.J. Culley, G. Crosby, R.E. Tanzi, Z. Xie, The common inhalational anesthetic sevoflurane induces apoptosis and increases beta-amyloid protein levels, Arch. Neurol. 66 (2009) 620e631.",mice,['Maternal anesthesia with sevoflurane during the mid-gestation induces social interaction deficits in offspring C57BL/6 mice'],gestational day 14,"['Therefore, we anesthetized the pregnant mice on gestational day 14, and tested social interaction behaviors of the offspring mice at one- and two-month- old.']",Y,"['The pregnant mice were anesthetized with 2.5% sevoflurane in 100% oxygen for 2 h, and their offspring mice were tested in three-chambered social paradigm, which includes three 10-min sessions of habituation, sociability, and preference for social novelty.']",sevoflurane,['The pregnant mice were anesthetized with 2.5% sevoflurane in 100% oxygen for 2 h'],none,[],c57bl/6,['Maternal anesthesia with sevoflurane during the mid-gestation induces social interaction deficits in offspring C57BL/6 mice'],This study addresses the uncertainty of whether in-utero exposure to sevoflurane could impair social behaviors in offspring mice.,['Sevoflurane anesthesia in pregnant mice could induce neurotoxicity in the developing brain and disturb learning and memory in the offspring mice. Whether it could impair social behaviors in the offspring mice is uncertain.'],The study presents innovations in methodology by using a three-chambered social paradigm to assess social interaction behaviors in mice.,"['The pregnant mice were anesthetized with 2.5% sevoflurane in 100% oxygen for 2 h, and their offspring mice were tested in three-chambered social paradigm, which includes three 10-min sessions of habituation, sociability, and preference for social novelty.']",The article argues the impact of findings by suggesting that maternal anesthesia with sevoflurane could induce long-lasting social interaction deficits in offspring mice.,"['Collectively, these results suggested maternal anesthesia with sevoflurane could induce social interaction deficits in their offspring mice. Although the disturbance of sociability could be recoverable, the impairment of preference for social novelty could be long-lasting.']",The study's limitations include not investigating social interaction behaviors at more time points and the potential differences in neurodevelopmental processes between species.,"['Admittedly, this study has several limitations. Firstly, we did not investigate social interaction behaviors of the offspring mice at more time points.', 'Secondly, it should be cautious to extrapolate our findings in mice to human being.']",Potential applications include further understanding of the neurodevelopmental impact of anesthetic exposure during pregnancy and its long-term effects on offspring.,"['In conclusion, maternal anesthesia with sevoflurane during the mid-gestation could induce social interaction deficits in the offspring mice.']",True,True,True,True,True,True,10.1016/j.bbrc.2021.03.063 10.1002/brb3.2556,878.0,Chen,2022,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"Received: 30 October 2021 Revised: 20 January 2022 Accepted: 27 February 2022 DOI: 10.1002/brb3.2556 O R I G I N A L A R T I C L E miRNA-384-3p alleviates sevoflurane-induced nerve injury by inhibiting Aak1 kinase in neonatal rats Yuanyuan Chen1 Xuan Gao2 Hao Pei3 1Department of Anesthesiology, Yancheng Maternity and Child Health Care Hospital, Yancheng, Jiangsu, China Abstract Objective: Sevoflurane is a common anesthetic and is widely used in pediatric clinical 2Department of Anesthesiology, Shanghai Blue Cross Brain Hospital, Shanghai, China surgery to induce and maintain anesthesia through inhalation. Increasing studies 3Department of Anesthesiology, Children’s Hospital of Fudan University, Shanghai, China have revealed that sevoflurane has neurotoxic effects on neurons, apoptosis, and memory impairment. miR-384 is involved in the process of neurological diseases. Correspondence Hao Pei, Department of Anesthesiology, Children’s Hospital of Fudan University, No. 399, Wanyuan Road, Minhang District, Shanghai City 201102, China. Email: lebajie_pei@hotmail.com However, the role of miRNA-384-3p in sevoflurane-induced nerve injury is not clear. This study focused on exploring the roles and mechanisms of miRNA-384-3p in sevoflurane-induced nerve injury. Methods: Seven-day-old rats were exposed to 2.3% sevoflurane to induce nerve injury. The morphological changes in neurons in the hippocampal CA1 region were detected Yuanyuan Chen and Xuan Gao contributed equally to this work. by HE staining and Nissl staining. Neuronal apoptosis was detected by TUNEL and Western blot assays. Spatial memory and learning ability were detected by the Morris water maze assay. The target gene of miRNA-384-3p was verified through a luciferase reporter assay. A rescue experiment was used to confirm the miRNA-384-3p pathway in sevoflurane-induced nerve injury. Results: Sevoflurane reduced miRNA-384-3p expression in the rat hippocampus. miRNA-384-3p alleviated sevoflurane-induced morphological changes in hippocampal neurons and apoptosis of neurons in the hippocampal CA1 region. Meanwhile, miRNA- 384-3p attenuated the decline in spatial memory and learning ability induced by sevoflurane. miRNA-384-3p alleviated sevoflurane-induced nerve injury by inhibiting the expression of adaptor-associated kinase 1 (Aak1). Conclusion: Our findings revealed the role and mechanism of miRNA-384-3p in sevoflurane-induced nerve injury, suggesting that miRNA-384-3p could be a novel and promising strategy for reducing sevoflurane-induced neurotoxicity. K E Y W O R D S Aak1, miRNA-384-3p, nerve injury, sevoflurane This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2022 The Authors. Brain and Behavior published by Wiley Periodicals LLC. Brain Behav. 2022;12:e2556. https://doi.org/10.1002/brb3.2556 wileyonlinelibrary.com/journal/brb3 1 of 11 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2 of 11 CHEN ET AL. were kept on a 12-h light–dark cycle in individually ventilated cages at 21 ± 1◦C with free access to food and water. All animal experi- ments were approved by the Institutional Animal Care and Use Com- 1 INTRODUCTION Sevoflurane, an inhalation anesthetic, is widely used in clinical surgical mittees and performed according to the institution’s guidelines and operations (Egan, 2015; Yi et al., 2015). However, recent studies have animal research principles. shown that sevoflurane has neurotoxic effects, increases neuronal The rats were randomly divided into three groups: control, sevoflu- apoptosis, and reduces learning and memory ability (H. He et al., 2018; rane, and miRNA-384-3p agomir injection. Each group consisted of 12 Perez-Zoghbi et al., 2017). The mechanism of sevoflurane-induced neu- rats. Sevoflurane was used to anesthetize rats as previously described rotoxicity remains mostly unknown. Hence, it is necessary to explore (Zhou et al., 2017). Briefly, rats were exposed to 2.3% sevoflurane the underlying molecular mechanism of sevoflurane-induced neuro- for 2 h every day for 3 continuous days. The gas flow was 2 L/min, toxicity to reduce sevoflurane-induced nerve injury. and the concentration of sevoflurane was measured by a gas monitor MicroRNAs (miRNAs) are noncoding RNAs, and their expres- (Detex Ohmeda, CO, USA). The NPS-A3 heating device (Midea Group, Beijiao, China) was used to heat the chamber up to 38◦C. Rats in the sevoflurane group were injected with 2 nmol agomir NC (volume is 2 μl) into the hippocampus on the left lateral cerebral ventricles sion is involved in various physiological and pathological processes (Gjorgjieva et al., 2019; Sun et al., 2018). Some studies have con- firmed that miRNAs play a vital role in sevoflurane-induced neurotox- icity. For example, Zhao et al. (2018) found that sevoflurane upregu- after the first day of exposure to sevoflurane. The miRNA-384-3p lates miR-34a expression in the hippocampus. miR-34a also promoted agomir was purchased from RiboBio (Guangzhou, China) and diluted neuronal apoptosis and memory impairment induced by sevoflurane through the wnt1/β-catenin pathway (Zhao et al., 2018). In neonatal with Entranster transfection reagent (Engreen Biosystem Co., Beijing, China). Then, bilateral intrahippocampal administration was per- formed by injection with 2 nmol miRNA-384-3p agomir (volume is 2 μl) rats, the level of miR-96 is positively correlated with the concentra- tion of exposed sevoflurane. The increased expression of miR-96 aggra- into the hippocampus using a stereotaxic apparatus (RWD Life Science, vates sevoflurane-induced hippocampal neuron apoptosis and cogni- Shenzhen, China) and a 33-gauge beveled NanoFil needle. On the first tive function injury (C. Xu et al., 2019). X. He et al. (2007) found that day of exposure to sevoflurane, the cells were exposed to sevoflurane miR-384 expression was higher in the hippocampus than in other tis- for 2 days. Control group rats were exposed to air for 2 h/day and over sues. In addition, miR-384-5p expression was more than 10 times 3 consecutive days. After being exposed to sevoflurane for 3 days, the higher than that of miRNA-384-3p in the rat hippocampus (X. He rats were euthanized, and the hippocampus was collected for further et al., 2007). Liu et al. found that chronic cerebral ischemia increased experiments. miR-384 expression in the hippocampus and hippocampal neurons. Knockdown of miR-384 inhibits the apoptosis of hippocampal neurons induced by chronic cerebral ischemia (Liu et al., 2019). Similarly, miR- 2.2 Cell isolation and culture 384-5p promotes neurotoxicity and attenuates learning and memory in rats (Jiang et al., 2016; Q. Xu et al., 2019). However, whether the The hippocampus was dissected from neonatal rats (7 days old), roles of miRNA-384-3p are consistent with those of miR-384-5p in triturated, and dissociated through trypsin. The dissociated cells were neurotoxicity remains obscure. Therefore, we focused on exploring the filtered and centrifuged and then resuspended in Dulbecco’s Modified effects of miRNA-384-3p on sevoflurane-induced neurotoxicity. Eagle Medium/F12 medium (DMEM/F12, Thermo-Scientific, MA, Aak1, adaptor-associated kinase 1, has been reported to be associ- USA). Then, the cells were seeded onto dishes coated with poly-D- ated with nervous-related diseases and nerve injury (Shi et al., 2014). lysine and cultured with DMEM/F12 supplemented with 10% fetal For instance, Aak1 regulates clathrin-mediated endocytosis, thereby bovine serum (FBS, Thermo Scientific, MA, USA), 1% glutamine, 4.5 g/L affecting the cognitive ability of AD mice (Fu et al., 2018). However, the B27 plus glucose, and 1% penicillin–streptomycin (Sigma–Aldrich, MI, USA). After culturing for 3 days, 5 μg/ml cytosine arabinoside C role of Aak1 in anesthesia-induced neurotoxicity remains unclear. The role and mechanism of miRNA-384-3p in sevoflurane-induced (Sigma–Aldrich, MI, USA) was added to the medium and cultured for 24 h. The neurons were cultured in a humidified incubator at 37◦C and 5% CO2 for 14 days. neurotoxicity were investigated in this study, and the results confirmed that miRNA-384-3p attenuated sevoflurane-induced neuronal apop- tosis and memory disorder by inhibiting the expression of Aak1. Our findings suggest that miRNA-384-3p may be a promising strategy for resolving sevoflurane-induced nerve injury during clinical surgery. 2.3 Cell treatment and transfection 2 MATERIALS AND METHODS Neurons were cultured in a humidified incubator chamber with a gas mixture of 1% sevoflurane, 94% air and 5% CO2 for 6 h. Sevoflurane was delivered to the chamber at a rate of 10 L/min Animals and treatment 2.1 through a vaporizer (Datex-Ohmeda, Helsinki, Finland). Control Seven-day-old Sprague–Dawley rats were used in this study. They were neurons were cultured in a humidified incubator with 95% air and 5% obtained from the GemPharmatech Company (Nanjing, China). All rats CO2. 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 3 of 11 2.6 Hematoxylin and eosin staining Hippocampal neurons, including control and sevoflurane-exposed neurons, were seeded into 24-well plates at 104 cells/well. When the confluence of the cells reached 60%, Lipofectamine 3000 (Thermo Sci- Rats were euthanized under the anesthesia of pentobarbital sodium entific, MA, USA) was used for transfection. miRNA-384-3p mimics, (80 mg/kg), and then the hippocampal tissues were removed. Tissues NC mimics, pcDNA-Aak1 vector (pc-Aak1), and pcDNA control vec- were fixed with 4% paraformaldehyde for 24 h and paraffin embed- ded. Sections of 4 μM were cut, and staining was carried out according tor (pc-NC) were obtained from GeneChem (Shanghai, China). miRNA- 384-3p mimics and NC mimics were transfected into control neu- to the hematoxylin and eosin (HE) protocol. Neural injury scoring was rons. NC mimics and pc-NC were transfected into control neurons performed according to the following standard: no nerve cell death, 0 simultaneously. NC mimics and pc-NC, miRNA-384-3p mimics and pc- points; scattered single nerve cell death, 1 point; slight nerve cell death, NC, and miRNA-384-3p mimics and pc-Aak1 were transfected into 2 points; mass nerve cell death, 3 points; and almost complete nerve sevoflurane-exposed neurons simultaneously. The transfection con- cell death, 4 points. centration was 10 nM. After transfection for 48 h, the cells were col- lected for further experiments. 2.7 Nissl staining Real-time quantitative polymerase chain 2.4 reaction Paraffin sections of hippocampal tissues were deparaffinized and stained with cresyl violet solution for 45 min at 37◦C. Next, sections were washed with distilled water and differentiated with gradient con- Total RNA was isolated from hippocampal tissue or transfected neu- centration ethanol. The differentiation was stopped when the tissue rons by using TRIzol reagent (Thermo-Scientific, MA, USA). RNA was was clear by transferring the sections to distilled water. Then, the sec- reverse transcribed into cDNA by using the PrimeScript RT reagent kit tions were dehydrated through a gradient concentration of ethanol and (Takara, Japan). A SYBR green PCR kit (Vazyme, Nanjing, China) was covered with neutral resin. Optical microscopy (Nikon, Tokyo, Japan) used to perform real-time quantitative polymerase chain reaction (RT– was used to observe the neurons in the hippocampal CA1 regions. The qPCR). U6 and GAPDH were used to normalize the relative expres- number of Nissl bodies was analyzed in a double-blinded manner with sion of miRNA-384-3p and Aak1. The miRNA-384-3p forward primer sequence (5′−3′) was AATTCCTAGAAATTGTT, and the reverse primer sequence (5′−3′) was AGTGCAGGGTCCGAGGTATT. The U6 forward primer sequence (5′−3′) was CTCGCTTCGGCAGCACATATACT, and the reverse primer sequence (5′−3′) was ACGCTTCACGAATTTGCGT- GTC. The Aak1 forward primer sequence (5′−3′) was CGGGTCACTTC- CGGGTTTA, and the reverse primer sequence (5′−3′) was TTCTTCTC- CGGTTTCAGCCC. The GAPDH forward primer sequence (5′−3′) was GAACGGGAAGCTCACTGG, and the reverse primer sequence (5′−3′) Image-Pro Plus 6.0. 2.8 Cell apoptosis The cell apoptosis ratio was measured in transfected neurons and hip- pocampal tissues by using the In Situ Cell Death Detection kit (Roche, Basel, Switzerland). After staining, the positive neurons were ran- domly observed by a fluorescence microscope (Nikon, Tokyo, Japan) was GCCTGCTTCACCACCTTCT. in five fields. The apoptosis ratio was measured by TUNEL-positive neurons/DAPI-positive neurons. 2.5 Subcellular fractionation 2.9 Western blot analysis After hippocampal microdissection, tissues were immediately treated with freshly prepared ice-cold homogenization buffer (20 mM HEPES, Protein was extracted from hippocampal tissue or transfected neurons 2 mM EGTA, 0.3 mg/ml dithioerythritol, 0.16 mg/ml phenylmethyl- using RIPA lysis buffer containing a protease inhibitor (Promega sulfonyl fluoride, and 0.020 mg/ml aprotinin) and homogenized. The homogenate was centrifuged at 17,000 × g for 5 min to obtain the Corporation, WI, USA). The protein samples were fractionated by SDS–PAGE and transferred to a polyvinylidene difluoride membrane cytoplasmic fraction. The pellet was washed with buffer B (150 mM NaCl; 10 mM HEPES; 1 mM EDTA), centrifuged at 17,000 × g for 1 min at 4 ◦C, resuspended in buffer C (25% v/v glycerol; 20 mM HEPES; 400 mM NaCl; 1.2 mM MgCl2; 0.2 mM EDTA), vortexed for 30 s and incubated on ice for 10 min (five times) to finally centrifuge at 17,000 × (PVDF, Millipore, MA, USA). Afterwards, the membranes were incu- bated with 5% nonfat milk for 2 h at room temperature. Then, the membranes were incubated with the primary antibody overnight at 4◦C. Then, the membranes were incubated for 2 h with the secondary antibody at room temperature and visualized with a chemilumines- g for 20 min to obtain the nuclear fraction (Caviedes et al., 2021). RNA cence kit (Vazyme, Nanjing, China). ImageJ software was used to expression of GAPDH, U6, miRNA-384-3p, and Aak1 in the nuclear analyze the protein expression. In this study, antibodies against Bax, and cytoplasmic fractions was detected by RT–qPCR as mentioned Bcl-2, cleaved caspase-3, PCNA, and Aak1 were diluted to 1:1000 for above. use, cleaved caspase-9 was diluted to 1:200, and Ki-67 was diluted to 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 4 of 11 CHEN ET AL. 1:100. β-actin was used as the internal control, and the antibody was ANOVA were used to test the mean difference between groups. Statis- diluted to 1:5000. The goat anti-rabbit HRP antibody was used as a tical analysis was carried out using GraphPad Prism 7 (GraphPad Inc., San Diego, CA, USA). A p-value < .05 was considered statistically sig- secondary antibody and diluted to 1:5000 for use. All antibodies were nificant. purchased from Abcam (London, England). 2.10 Morris water maze test 3 RESULTS The Morris water maze (MWM) test was used to evaluate the learning 3.1 miRNA-384-3p in the rat hippocampus Sevoflurane reduces the expression of and memory abilities of rats at the age of 2 months. The MWM con- sisted of a pool (100 cm × 100 cm × 60 cm) and a platform (1 cm × 1 cm). The pool was filled with warm water (25◦C) to 1 cm. Rats were ran- domly placed in the pool and allowed to swim to the platform. The time To detect the effect of sevoflurane on miRNA-384-3p expression, we collected hippocampal tissues from control and sevoflurane-exposed that the rats spent swimming to a hidden platform was measured at 90 neonatal rats and detected the expression of miRNA-384-3p through s, and the rats were allowed to rest on the platform for 20 s. The time RT–qPCR. The results showed that miRNA-384-3p expression was was recorded as 90 s if the rats did not find the platform within 90 s, and decreased in the hippocampal tissues of sevoflurane-exposed rats the rats were also placed on the platform for 20 s to rest. In the acqui- compared with control rats (Figure 1a). miRNA-384-3p was primarily sition phase, five training sessions were conducted every day for 5 con- located in the cytoplasm in hippocampal tissues (Figure 1b). The results tinuous days. After the training, probe trials were performed. The time suggested that miRNA-384-3p was downregulated by sevoflurane in of plateau quadrant residence and the number of traversing platforms the rat hippocampus. were recorded by computerized tracking/analyzing video systems to suggest the spatial memory and learning ability of the rats. miRNA-384-3p restores sevoflurane-induced 3.2 morphological changes in neurons in the hippocampal CA1 region Dual-luciferase reporter assay 2.11 Aak1 wild type (Aak1 WT) containing the miRNA-384-3p binding sites in the 3′UTR of Aak1 was inserted into the firefly luciferase vector. Sevoflurane-induced neurotoxicity has been reported previously (Perez-Zoghbi et al., 2017). To confirm the role of miRNA-384-3p To confirm specific binding, an Aak1 mutant (Aak1 Mut) containing the mutated binding sites of miRNA-384-3p in the Aak1 3′UTR was in sevoflurane-induced neurotoxicity, miRNA-384-3p agomir was injected into the rat hippocampus after the first day of sevoflurane constructed. For the luciferase reporter assay, hippocampal neurons exposure. We detected morphological changes in neurons through HE were cultured and plated in 24-well plates. Each well was transfected with 1 μg Aak1 WT vector or Aak1 Mut vector, 1 μg Renilla luciferase and Nissl staining. The HE results showed that sevoflurane induced neuronal injury and decreased the number of neurons in the hippocam- plasmid, and 100 pM miRNA-384-3p mimics or NC mimics by using pal CA1 regions, and the decreased injury and number of neurons were Lipofectamine 3000 (Invitrogen, CA, USA). After 48 h of transfection, attenuated by the miRNA-384-3p agomir (Figure 2a). The Nissl the dual-luciferase reporter assay system (Promega Corporation, WI, results showed that Nissl bodies and neurons were decreased in the USA) was used to measure the firefly and Renilla luciferase activities. hippocampal CA1 regions of sevoflurane-exposed rats compared with control rats. The sevoflurane-induced decrease in Nissl bodies was attenuated by the miRNA-384-3p agomir (Figure 2b). These 2.12 Cell viability assay results demonstrated that miRNA-384-3p restored the sevoflurane- induced morphological changes in neurons in the hippocampal CA1 Cell viability was detected by the cell counting kit-8 (CCK8) assay. regions. Transfected hippocampal neurons were seeded onto 96-well plates at approximately 103 cells/well (100 μl/well). Then, the neurons were cul- tured for 1 h and mixed with 10 μl CCK8 reagent (Dojindo, Kumamoto, miRNA-384-3p inhibits sevoflurane-induced 3.3 neuronal apoptosis in the hippocampal CA1 region Japan) for 2 h. Next, the optical density was measured at 450 nm by uti- lizing a Bio-EL340 automatic microplate reader (Tek Instruments, Hop- kinton, USA). We detected the function of miRNA-384-3p in sevoflurane-induced neuronal apoptosis through the TUNEL assay and Western blot 2.13 Statistical analysis assay. The TUNEL assay results demonstrated that the apoptosis ratio of neurons was increased in the hippocampal CA1 region of All data are presented as the mean ± standard deviation (SD) of sevoflurane-treated rats compared with control rats. Overexpression three independent experiments. Unpaired Student’s t test and one-way of miRNA-384-3p inhibited the apoptosis induced by sevoflurane 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 5 of 11 F I G U R E 1 Sevoflurane reduces the expression of miRNA-384-3p in the rat hippocampus. (a) The expression of miRNA-384-3p was detected by RT–qPCR in the hippocampus of sevoflurane-exposed rats and control rats. (b) Nuclear and cytoplasmic expression of miRNA-384-3p in the hippocampus from control rats was assessed by RT–qPCR. **p < .01, the difference was compared to control rats. The error bars represent the mean ± SD in three independent repetitions F I G U R E 2 miRNA-384-3p restores sevoflurane-induced morphological changes in neurons in the hippocampal CA1 region. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal neonatal rats were used as a negative control. (a) HE staining detected morphological changes in neurons in the hippocampal CA1 region. (b) Nissl staining detected Nissl bodies and neurons in the hippocampal CA1 region. The scale bar is 50 μM. Every experiment had three independent repetitions. ***p < .001, **p < .01 vs. the control group, ##p < .01, #p < .05 vs. the sevoflurane group. The error bars represent the mean ± SD in three independent repetitions 3.4 and learning ability of sevoflurane-treated rats miRNA-384-3p improves the spatial memory (Figure 3a). Similar to the TUNEL assay results, Western blot results showed that the expression of Bax, cleaved-caspase-3, and cleaved- caspase-9 was increased. Meanwhile, Bcl-2 expression was decreased in the hippocampal CA1 region of sevoflurane-treated rats compared Next, we tested the function of miRNA-384-3p in sevoflurane-induced with control rats. Overexpression of miRNA-384-3p attenuated changes in spatial memory and learning ability through the MWM sevoflurane-induced expression changes in these apoptosis-related test. The results showed that the time of plateau quadrant residence genes (Figure 3b). These results suggested that miRNA-384-3p inhib- and the number of traversing platforms were reduced in sevoflurane- ited sevoflurane-induced neuronal apoptosis in the hippocampal CA1 treated rats compared with control rats, suggesting that sevoflurane region. impaired the spatial memory and learning ability of rats (Figure 4a,b). 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 6 of 11 F I G U R E 3 miRNA-384-3p inhibits sevoflurane-induced neuronal apoptosis in the hippocampal CA1 region. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal neonatal rats were used as a negative control. (a) Cell apoptosis was detected by a TUNEL assay in the hippocampal CA1 region. (b) Western blot analysis of the expression of apoptosis-related genes. **p < .01. The difference was compared to control rats. ##p < .01, #p < .05, the difference was compared to sevoflurane-treated rats. The error bars represent the mean ± SD in three independent repetitions Meanwhile, overexpression of miRNA-384-3p increased the plateau and miRDB databases to predict the target genes of miRNA-384-3p. quadrant residence time and the number of traversing platforms in The predicted results showed that Aak1 was the only target gene of sevoflurane-treated rats, suggesting that miRNA-384-3p attenuated miRNA-384-3p in the three databases (Figure 5a). The predicted bind- sevoflurane-induced injury to spatial memory and learning ability ing sequence of Aak1 and miRNA-384-3p is shown in Figure 5b. The (Figure 4a,b). These results demonstrated that miRNA-384-3p had a luciferase assay was used to confirm the binding site, and the results showed that the luciferase activity was decreased in Aak1 3′UTR protective effect on spatial memory and learning ability in rats. WT and miRNA-384-3p mimic cotransfected neurons compared with Aak1 3′UTR WT and NC mimic cotransfected neurons. However, the luciferase activity was not significantly changed in Aak1 3′UTR 3.5 Aak1 is a target gene of miRNA-384-3p MUT-transfected neurons (Figure 5c). To confirm that miRNA-384-3p To explore the underlying mechanism of miRNA-384-3p in regulates Aak1 expression, Western blotting was performed on neu- sevoflurane-induced nerve injury, we used the TargetScan, miRWalk, rons transfected with NC mimics or miRNA-384-3p mimics. The results 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 7 of 11 F I G U R E 4 miRNA-384-3p improves the spatial memory and learning ability of sevoflurane-treated rats. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal rats were used as a negative control. When rats were at the age of 2 months, plateau quadrant residence (a) and the number of traversing platforms (b) were detected by the MWM test. *p < .05 vs. the control group, #p < .05 vs. the sevoflurane group. The error bars represent the mean ± SD. Every experiment had three independent repetitions F I G U R E 5 Aak1 is a target gene of miRNA-384-3p. (a) Prediction of target genes of miRNA-384-3p through the miRDB, miRWalk, and TargetScan databases. (b) The putative target sequence of miRNA-384-3p in the 3′UTR of Aak1 and the mutated sequence. (c) Luciferase assays in neurons transfected with Aak1 WT or Aak1 Mut and NC mimics or miR-384 mimics. (d) Western blot analysis of Aak1 expression in neurons transfected with miRNA-384-3p mimics or NC mimics. (e) RT-qPCR detected Aak1 expression in the hippocampus of sevoflurane-treated rats and control rats. (f) Nuclear and cytoplasmic expression of Aak1 in the hippocampus from normal rats was assessed by RT-qPCR. **p < .01. The difference was compared to control rats or transfected NC mimic neurons. The error bars represent the mean ± SD in three independent repetitions 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 8 of 11 CHEN ET AL. showed that the expression of Aak1 was decreased in miRNA-384-3p neurodevelopmental defects (Warner et al., 2018; Zhang et al., 2016). For instance, ropivacaine exposure induces significant sciatic nerve mimic-transfected neurons compared with NC mimic-transfected injury in diabetic rats (Yu et al., 2019). Ketamine, midazolam, or a neurons (Figure 5d). Additionally, RT-qPCR results showed that Aak1 combination of the two drugs induce apoptotic neurodegeneration in was upregulated in the hippocampus of sevoflurane-treated rats the developing mouse brain (Young et al., 2005). Therefore, exploring compared with control rats (Figure 5e). Moreover, Aak1 was primarily the methods of reducing the injury induced by anesthesia is impor- located in the cytoplasmic fraction in the hippocampus of control rats tant and necessary. Sevoflurane is an anesthetic and contributes to (Figure 5f). These results demonstrated that Aak1 was a target gene neurological disorders and neurodegeneration in the development of of miRNA-384-3p and that its expression was negatively regulated by miRNA-384-3p. the brain and affects memory and cognition (O’Farrell et al., 2018; Zhang et al., 2016). Sevoflurane at subanesthetic concentrations trig- gers neuronal apoptosis in 7-day-old mouse brains (Zhang et al., 2008). 3.6 neuronal apoptosis and nerve injury through Aak1 miRNA-384-3p alleviates sevoflurane-induced Sevoflurane exposure repeatedly induces cognition-related biochem- ical changes in the hippocampus and impairs learning and memory ability (Guo et al., 2018). Therefore, we established a sevoflurane To confirm whether miRNA-384-3p plays a role in sevoflurane-induced neurotoxicity model in neonatal rats through repeated exposure to nerve injury through Aak1, we transfected miRNA-384-3p mimics and sevoflurane. the Aak1 vector into hippocampal neurons simultaneously, and the Previous studies have reported that neurotoxicity induced by anes- neurons were cultured with sevoflurane. The RT-qPCR results showed thesia is regulated by miRNA (Bahmad et al., 2020). For example, that miRNA-384-3p expression was decreased in sevoflurane-treated miR-34a expression is upregulated in propofol-treated neurons and neurons compared to control neurons, and miRNA-384-3p mimics rats. Meanwhile, inhibition of miR-34a improves propofol-induced restored the expression of miRNA-384-3p. Meanwhile, the expres- cognitive dysfunction by suppressing cell apoptosis and recovering sion of Aak1 was increased in sevoflurane-treated neurons compared the expression of MAPK/ERK pathway genes (Xin, 2018). miR-124 with control neurons. miRNA-384-3p mimics decreased the expres- increases ketamine-induced apoptosis in the hippocampal CA1 region sion of Aak1 in sevoflurane-treated neurons, and the miRNA-384-3p- and improves the memory performance of mice (H. Xu et al., 2015). induced decrease in Aak1 was partially restored by transfection with miR-384 is also involved in the progression of brain development, cog- the Aak1 vector (Figure 6a). To detect whether Aak1 participated in nition, and pathophysiology of neurological disorders (Gu et al., 2015). the regulation of miRNA-384-3p on sevoflurane-induced cell viability, However, the roles of miRNA-384-3p in anesthesia-induced neurotox- a CCK8 assay was used. The results showed that miRNA-384-3p atten- icity remain unclear. Here, we detected the expression of miRNA-384- uated the inhibitory effect of sevoflurane on cell viability, while the 3p in sevoflurane-exposed rat hippocampi and found that sevoflurane miRNA-384-3p effect was remarkably undermined after the overex- decreased the expression of miRNA-384-3p. A miRNA-384-3p agomir pression of Aak1 (Figure 6b). Western blotting was used to measure was injected into neonatal rats to overexpress miRNA-384-3p. We fur- proliferation-related gene expression at the protein level. The results ther confirmed that miRNA-384-3p improved neuronal morphology, showed that sevoflurane inhibited the expression of PCNA and Ki- neuronal apoptosis, and learning and memory ability in sevoflurane- 67, which was partially restored by miRNA-384-3p. Meanwhile, over- treated rats. expression of Aak1 attenuated miRNA-384-3p-mediated expression miRNAs mainly regulate the mRNA degradation or posttranscrip- changes in PCNA and Ki-67 in sevoflurane-treated neurons (Figure 6c). tional repression of the targeted gene (Saliminejad et al., 2019). To The TUNEL assay was used to detect whether Aak1 participated in explore the mechanism of miRNA-384-3p in sevoflurane-induced the regulation of miRNA-384-3p on sevoflurane-induced cell apop- nerve injury, we predicted and confirmed that Aak1 is a target tosis, and the results showed that overexpression of miRNA-384-3p gene of miRNA-384-3p. Aak1 plays vital roles in neuropathic pain, reduced the apoptosis of hippocampal neurons induced by sevoflu- schizophrenia, Parkinson’s disease and other neuropathic disorders rane, while the miRNA-384-3p effect was inhibited by increasing the (Abdel-Magid, 2017). For example, Fu et al. found that Aak1 expression is highest on day 14 and is reduced on day 30 in the Aβ1-42-induced AD model. The expression of Aak1 is negatively correlated with cognitive expression of Aak1 (Figure 6d). Similar to the results, the Western blot results demonstrated that sevoflurane-induced changes in apoptosis- related genes were attenuated by miRNA-384-3p. Meanwhile, Aak1 ability by regulating the process of clathrin-mediated endocytosis (Fu overexpression restored the miRNA-384-3p-mediated changes in the et al., 2018). Kostich, Walter et al. discovered that Aak1 knockout mice expression of these genes in sevoflurane-treated hippocampal neurons have an antinociceptive phenotype, which may be a novel therapeutic (Figure 6e). These results demonstrated that miRNA-384-3p allevi- approach for neuropathic pain by inhibiting Aak1 kinase (Kostich et al., ated sevoflurane-induced neuronal apoptosis and nerve injury through 2016). Leger, Helene et al. found that Ndr kinases inhibit the prolifer- Aak1. ation of terminally differentiated cells and modulate the function of interneuron synapses through Aak1 (Leger et al., 2018). However, the DISCUSSION 4 role of Aak1 in anesthesia-mediated nerve injury remains unknown. Here, we confirmed that Aak1 expression was negatively regulated Anesthesia is widely used in modern medicine; however, a multitude by miRNA-384-3p in hippocampal neurons. Meanwhile, we demon- of evidence has demonstrated that anesthesia increases the risk of strated that miRNA-384-3p alleviated sevoflurane-induced neuronal 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 9 of 11 F I G U R E 6 miRNA-384-3p alleviates sevoflurane-induced neuronal apoptosis and nerve injury through Aak1. Hippocampal neurons were divided into four groups, including NC mimic- and pc-NC-transfected neurons cultured under control conditions, NC mimic- and pc-NC-transfected neurons cultured with 1% sevoflurane, miRNA-384-3p mimic- and pc-NC-transfected neurons cultured with sevoflurane, miRNA-384-3p mimic-, and pc-Aak1-transfected neurons cultured with sevoflurane. (a) RT-qPCR detected miRNA-384-3p and Aak1 levels. (b) CCK8 assay detected cell viability. (c) Western blot analysis of the expression of proliferation-related genes. (d) TUNEL assay detected cell apoptosis. (e) Western blot analysis of apoptosis-related gene levels. **p < .01 vs. the NC mimics + pc-NC group. ###p < .001, ##p < .01 vs. the sevoflurane group. &&&p < .001, &&p < .01, &p < .05 vs. the miR-384-3p mimic + pc-NC + sevoflurane group. The error bars represent the mean ± SD in three independent repetitions apoptosis and nerve injury by inhibiting the expression of Aak1 via CONFLICT OF INTEREST rescue experiments. The authors declare that they have no conflict of interest. AUTHOR CONTRIBUTIONS CONCLUSION 5 Xuan Gao and Hao Pei conceived and designed the study. Xuan Gao and Yuanyuan Chen performed the literature search and data extraction. Hao Pei drafted the manuscript. All authors read and approved the final In neonatal rats, we confirmed the roles and mechanisms of version of the manuscript. miRNA-384-3p in sevoflurane-induced nerve injury, including hip- pocampal neuron apoptosis and memory impairment. The findings of our study suggest that miRNA-384-3p could be a promising DATA AVAILABILITY STATEMENT strategy for reducing sevoflurane-induced nerve injury in clinical All data generated or analyzed during this study are included in the surgery. article. 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 10 of 11 CHEN ET AL. PEER REVIEW Leger, H., Santana, E., Leu, N. A., Smith, E. T., Beltran, W. A., Aguirre, G. D., & Luca, F. C. (2018). Ndr kinases regulate retinal interneuron prolifera- tion and homeostasis. Science Reports, 8, 12544. https://doi.org/10.1038/ s41598-018-30492-9 The peer review history for this article is available at https://publons. com/publon/10.1002/brb3.2556 Liu, J., An, P., Xue, Y., Che, D., Liu, X., Zheng, J., Liu, Y., Yang, C., Li, Z., & Yu, B. (2019). Mechanism of Snhg8/miR-384/Hoxa13/FAM3A axis regulating neuronal apoptosis in ischemic mice model. Cell Death & Disease, 10, 441. https://doi.org/10.1038/s41419-019-1631-0 ORCID Hao Pei https://orcid.org/0000-0002-6777-5463 O’Farrell, R. A., Foley, A. G., Buggy, D. J., & Gallagher, H. C. (2018). Neurotox- icity of inhalation anesthetics in the neonatal rat brain: Effects on behav- ior and neurodegeneration in the piriform cortex. Anesthesiology Research and Practice, 2018, 6376090. REFERENCES Abdel-Magid, A. F. (2017). Inhibitors of adaptor-associated kinase 1 (AAK1) may treat neuropathic pain, schizophrenia, Parkinson’s disease, and other disorders. ACS Medicinal Chemistry Letters, 8, 595–597. https://doi. org/10.1021/acsmedchemlett.7b00208 Perez-Zoghbi, J. F., Zhu, W., Grafe, M. R., & Brambrink, A. M. (2017). against sevoflurane-induced neurotoxicity extends to several brain regions in neonatal rats. British Journal of Anaesthesia, 119, 506–516. https://doi.org/10.1093/bja/aex222 Dexmedetomidine-mediated neuroprotection Bahmad, H. F., Darwish, B., Dargham, K. B., Machmouchi, R., Dargham, B. B., Osman, M., Khechen, Z. A., El Housheimi, N., Abou-Kheir, W., & Chamaa, F. (2020). Role of microRNAs in anesthesia-induced neurotoxicity in animal models and neuronal cultures: A systematic review. Neurotoxic- ity Research, 37, 479–490. https://doi.org/10.1007/s12640-019-00135- 6 Saliminejad, K., Khorram Khorshid, H. R., Soleymani Fard, S., & Ghaffari, S. H. (2019). An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. Journal of Cellular Physiology, 234, 5451–5465. https: //doi.org/10.1002/jcp.27486 Shi, B., Conner, S. D., & Liu, J. (2014). Dysfunction of endocytic kinase AAK1 in ALS. International Journal of Molecular Sciences, 15, 22918–22932. https://doi.org/10.3390/ijms151222918 Caviedes, A., Maturana, B., Corvalán, K., Engler, A., Gordillo, F., Varas-Godoy, M., Smalla, K. H., Batiz, L. F., Lafourcade, C., Kaehne, T., & Wyneken, U. (2021). eNOS-dependent S-nitrosylation of the NF-κB subunit p65 has neuroprotective effects. Cell Death & Disease, 12, 4. https://doi.org/10. 1038/s41419-020-03338-4 Sun, Z., Shi, K., Yang, S., Liu, J., Zhou, Q., Wang, G., Song, J., Li, Z., Zhang, Z., & Yuan, W. (2018). Effect of exosomal miRNA on cancer biology and clinical applications. Molecular Cancer, 17, 147. https://doi.org/10.1186/ s12943-018-0897-7 Egan, T. D. (2015). Total intravenous anesthesia versus inhalation anesthe- sia: A drug delivery perspective. Journal of Cardiothoracic and Vascular Anesthesia, 29 Suppl (1), S3–S6. https://doi.org/10.1053/j.jvca.2015.01. 024 Warner, D. O., Zaccariello, M. J., Katusic, S. K., Schroeder, D. R., Hanson, A. C., Schulte, P. J., Buenvenida, S. L., Gleich, S. J., Wilder, R. T., Sprung, J., Hu, D., Voigt, R. G., Paule, M. G., Chelonis, J. J., & Flick, R. P. (2018). Neuropsychological and behavioral outcomes after exposure of young children to procedures requiring general anesthesia: The Mayo Anes- thesia Safety in Kids (MASK) Study. Anesthesiology, 129, 89–105. https: //doi.org/10.1097/ALN.0000000000002232 Fu, X., Ke, M., Yu, W., Wang, X., Xiao, Q., Gu, M., & Lu, Y. (2018). Periodic vari- ation of AAK1 in an Abeta1-42-induced mouse model of Alzheimer’s dis- ease. Journal of Molecular Neuroscience, 65, 179–189. https://doi.org/10. 1007/s12031-018-1085-3 Gjorgjieva, M., Sobolewski, C., Dolicka, D., Correia de Sousa, M., & Foti, M. (2019). miRNAs and NAFLD: From pathophysiology to therapy. Gut, 68, 2065–2079. https://doi.org/10.1136/gutjnl-2018-318146 Xin, P., Kuang, H. X., Li, X. L., Wang, Y., Zhang, B. M., Bu, H., Wang, Z. B., Meng, Y. H., Wang, Y. H., & Wang, Q. H. (2018). Proteomics and its application to determine mechanism of action of traditional Chinese medicine. Zhong- guo Zhong Yao Za Zhi = Zhongguo Zhongyao Zazhi = China Journal of Chi- nese Materia Medica, 43, 904–912. Gu, Q. H., Yu, D., Hu, Z., Liu, X., Yang, Y., Luo, Y., Zhu, J., & Li, Z. (2015). miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Nature Communication, 6, 6789. https://doi.org/10.1038/ ncomms7789 Xu, C., Niu, J. J., Zhou, J. F., & Wei, Y. S. (2019). MicroRNA-96 is respon- sible for sevoflurane-induced cognitive dysfunction in neonatal rats via inhibiting IGF1R. Brain Research Bulletin, 144, 140–148. https://doi.org/ 10.1016/j.brainresbull.2018.09.001 Guo, S., Liu, L., Wang, C., Jiang, Q., Dong, Y., & Tian, Y. (2018). Repeated expo- sure to sevoflurane impairs the learning and memory of older male rats. Life Sciences, 192, 75–83. https://doi.org/10.1016/j.lfs.2017.11.025 He, H., Liu, W., Zhou, Y., Liu, Y., Weng, P., Li, Y., & Fu, H. (2018). Sevoflurane post-conditioning attenuates traumatic brain injury-induced neuronal apoptosis by promoting autophagy via the PI3K/AKT signaling pathway. Drug Design, Development and Therapy, 12, 629–638. https://doi.org/10. 2147/DDDT.S158313 Xu, H., Zhang, J., Zhou, W., Feng, Y., Teng, S., & Song, X. (2015). The role of miR-124 in modulating hippocampal neurotoxicity induced by ketamine anesthesia. International Journal of Neuroscience, 125, 213–220. https:// doi.org/10.3109/00207454.2014.919915 Xu, Q., Ou, J., Zhang, Q., Tang, R., Wang, J., Hong, Q., Guo, X., Tong, M., Yang, L., & Chi, X., (2019). Effects of aberrant miR-384-5p expression on learn- ing and memory in a rat model of attention deficit hyperactivity disor- der. Frontiers in Neurology, 10, 1414. https://doi.org/10.3389/fneur.2019. 01414 He, X., Zhang, Q., Liu, Y., & Pan, X. (2007). Cloning and identification of novel microRNAs from rat hippocampus. Acta Biochimica et Biophys- ica Sinica (Shanghai), 39, 708–714. https://doi.org/10.1111/j.1745-7270. 2007.00324.x Yi, W., Zhang, Y., Guo, Y., Li, D., & Li, X. (2015). Elevation of Sestrin-2 expres- sion attenuates sevoflurane induced neurotoxicity. Metabolic Brain Dis- ease, 30, 1161–1166. https://doi.org/10.1007/s11011-015-9673-1 Young, C., Jevtovic-Todorovic, V., Qin, Y. Q., Tenkova, T., Wang, H., Labruyere, J., & Olney, J. W. (2005). Potential of ketamine and midazolam, individ- ually or in combination, to induce apoptotic neurodegeneration in the infant mouse brain. British Journal of Pharmacology, 146, 189–197. https: //doi.org/10.1038/sj.bjp.0706301 Jiang, M., Yun, Q., Shi, F., Niu, G., Gao, Y., Xie, S., & Yu, S. (2016). Down- regulation of miR-384-5p attenuates rotenone-induced neurotoxicity in dopaminergic SH-SY5Y cells through inhibiting endoplasmic reticulum stress. American Journal of Physiology. Cell Physiology, 310, C755–C763. https://doi.org/10.1152/ajpcell.00226.2015 Kostich, W., Hamman, B. D., Li, Y. W., Naidu, S., Dandapani, K., Feng, J., Easton, A., Bourin, C., Baker, K., Allen, J., Savelieva, K., Louis, J. V., Dokania, M., Elavazhagan, S., Vattikundala, P., Sharma, V., Das, M. L., Shankar, G., Kumar, A., . . . Albright, C. F. (2016). Inhibition of AAK1 kinase as a novel therapeutic approach to treat neuropathic pain. Journal of Pharmacology and Experimental Therapeutics, 358, 371–386. https://doi. org/10.1124/jpet.116.235333 Yu, Z. Y., Geng, J., Li, Z. Q., Sun, Y. B., Wang, S. L., Masters, J., Wang, D. X., Guo, X. Y., Li, M., & Ma, D. (2019). Dexmedetomidine enhances ropivacaine- induced sciatic nerve injury in diabetic rats. British Journal of Anaesthesia, 122, 141–149. https://doi.org/10.1016/j.bja.2018.08.022 21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License CHEN ET AL. 11 of 11 Zhang, X., Xue, Z., & Sun, A. (2008). Subclinical concentration of sevoflu- rane potentiates neuronal apoptosis in the developing C57BL/6 mouse brain. Neuroscience Letters, 447, 109–114. https://doi.org/10.1016/j. neulet.2008.09.083 sevoflurane-induced apoptosis in the developing rat brain potentially via the mitochondrial pathway. Molecular Medicine Reports, 15, 2204–2212. https://doi.org/10.3892/mmr.2017.6268 Zhang, X., Zhou, Y., Xu, M., & Chen, G. (2016). Autophagy is involved in the sevoflurane anesthesia-induced cognitive dysfunction of aged rats. Plos One, 11, e0153505. https://doi.org/10.1371/journal.pone.0153505 Zhao, X., Sun, Y., Ding, Y., Zhang, J., & Li, K. (2018). miR-34a inhibitor may effectively protect against sevoflurane-induced hippocampal apopto- sis through the Wnt/beta-catenin pathway by targeting Wnt1. Yonsei Medical Journal, 59, 1205–1213. https://doi.org/10.3349/ymj.2018.59. 10.1205 How to cite this article: Chen, Y., Gao, X., & Pei, H. (2022). miRNA-384-3p alleviates sevoflurane-induced nerve injury by inhibiting Aak1 kinase in neonatal rats. Brain and Behavior, 12, e2556. https://doi.org/10.1002/brb3.2556 Zhou, X., Xian, D., Xia, J., Tang, Y., Li, W., Chen, X., Zhou, Z., Lu, D., & Feng, X. (2017). MicroRNA-34c is regulated by p53 and is involved in",rats,['Seven-day-old rats were exposed to 2.3% sevoflurane to induce nerve injury.'],postnatal day 7,['Seven-day-old rats were exposed to 2.3% sevoflurane to induce nerve injury.'],Y,['Spatial memory and learning ability were detected by the Morris water maze assay.'],sevoflurane,['Seven-day-old rats were exposed to 2.3% sevoflurane to induce nerve injury.'],none,[],sprague dawley,['Seven-day-old Sprague–Dawley rats were used in this study.'],The role of miRNA-384-3p in sevoflurane-induced nerve injury is not clear.,"['However, the role of miRNA-384-3p in sevoflurane-induced nerve injury is not clear.']",None,[],miRNA-384-3p could be a novel and promising strategy for reducing sevoflurane-induced neurotoxicity.,"['Our findings revealed the role and mechanism of miRNA-384-3p in sevoflurane-induced nerve injury, suggesting that miRNA-384-3p could be a novel and promising strategy for reducing sevoflurane-induced neurotoxicity.']",None,[],miRNA-384-3p as a strategy for reducing sevoflurane-induced neurotoxicity.,"['Our findings revealed the role and mechanism of miRNA-384-3p in sevoflurane-induced nerve injury, suggesting that miRNA-384-3p could be a novel and promising strategy for reducing sevoflurane-induced neurotoxicity.']",True,True,True,True,True,True,10.1002/brb3.2556 10.31083/j.jin2003065,1043.0,Gao,2021,rats,gestational day 14.5,N,sevoflurane,none,sprague dawley,"e c n e i c s o r u e N e v i t a r g e t n I f o l a n r u o J Original Research Prenatal sevoflurane exposure causes abnormal development of the entorhinal cortex in rat offspring Ying Gao1, Tianyun Zhao1, Yanxin Chen2, Zhixiang Sun3, Junming Lu2, Ziwen Shi1, Xingrong Song1,* 1Department of Anesthesiology, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, 510623 Guangzhou, Guangdong, China 2Department of Anesthesiology, Guangdong Hospital of Traditional Chinese Medicine (The Second Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine), 510120 Guangzhou, Guangdong, China 3Department of Anesthesiology, Shanghai University of Medicine & Health Sciences Affiliated Zhoupu Hospital, 201318 Shanghai, China Correspondence: songxingrong@gwcmc.org (Xingrong Song) DOI:10.31083/j.jin2003065 This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/). Submitted: 14 March 2021 Revised: 26 March 2021 Accepted: 12 May 2021 Published: 30 September 2021 As a gamma-aminobutyric acid type A receptor agonist sevoflurane is a common general anesthetic used in anesthesia and affects the neural development in offspring. We hypothesized that sevoflurane could regulate interneurons via the neuregulin-1-epidermal growth factor receptor-4 (NRG1–ErbB4) pathway in the entorhinal cortex (ECT) of the middle pregnancy. Six female rats in middle pregnancy (14.5 days of pregnancy) were randomly and equally divided into sevoflurane (SeV) and control groups. The rats in the SeV group were exposed to 4% sevoflurane for 3 hours. The expression levels of NRG1 and ErbB4, parvalbumin (PV) and glutamic acid decarboxylase (GAD67), and N-methyl-D-aspartate receptor subunit 2A (NR2A) and subunit 2B (NR2B) in offspring were examined through immunohis- tochemistry. The pyramidal neurons in the ECT were examined via Golgi staining. The levels of NRG1 and ErbB4 were significantly de- creased (P < 0.01) and the levels of PV and GAD67 (interneurons) were found to be decreased in the SeV group (P < 0.01). The level of NR2B was found to be increased while the level of NR2A being decreased in the SeV group (P < 0.01). The development of pyra- midal neurons was abnormal in the SeV group (P < 0.05). Conclu- sively, prenatal sevoflurane exposure could lead to the disturbance of the interneurons by activating the NRG1–ErbB4 pathway and sub- sequently result in abnormal development of pyramidal neurons in middle pregnancy. Prenatal sevoflurane exposure in middle preg- nancy could be potentially harmful to the neural development of rat offspring. This study may reveal a novel pathway in the influence mechanism of sevoflurane on rat offspring. middle pregnancy is a “busy period of neural development” in which neurons proliferate, migrate, and differentiate [2]. Anesthetics commonly used in clinical practice have been found to mainly affect two major neurotransmitter recep- tors, N -methyl-D-aspartate (NMDA) receptors and gamma- aminobutyric acid (GABA) receptors, during the develop- ment of the central nervous system (CNS). Exposure to gen- eral anesthetics before and after birth could affect brain devel- opment. A warning against prolonged and repeated exposure to general anesthetics during pregnancy was proposed by the American Food and Drug Administration. Sevoflurane, as a GABA type A (GABAA) receptor agonist/enhancer [3] is a common general anesthetic used in anesthesia for pregnant women. Hence, prenatal sevoflurane exposure during middle pregnancy could affect the neural development of offspring. As an excitatory transmitter in the early stage of neural development, GABA is a key neurotransmitter in the devel- opment of the brain that plays an important role in the pro- liferation and migration of neurons [4, 5]. When neurons migrate to the target cortex, the process of neuronal migra- tion is terminated by contact of GABA receptor. With the development of the brain, the GABAA receptor changes from excitability to inhibition and depolarization to hyperpolariza- tion [4, 5]. As a GABAA receptor agonist, sevoflurane could play an important role in the proliferation and migration of neurons. Keywords Sevoflurane; Interneurons; Middle pregnancy; NRG1–ErbB4; Entorhinal cortex 1. Introduction About 0.75–2% of pregnant women need non-obstetric surgery every year [1]. Middle pregnancy (namely, second trimester) is considered to be a safe period for surgical anes- thesia. With the development of fetal surgery and laparo- scopic technology, an increasing number of pregnant women undergo surgery under general anesthesia during middle pregnancy [1]. However, recently, studies have shown that The “vulnerability window” of neurotoxicity of general anesthetics is mainly at the peak of brain nerve cell prolif- eration, migration, or synaptic development (i.e., during the middle or late stage of pregnancy) [2]. In middle pregnancy, the fetus’ brain is extremely sensitive to changes in the en- vironment. Middle pregnancy is a critical period for brain nerve development (neuron proliferation, migration, and the formation of neural connections), and most of these events occur in middle pregnancy [6]. In addition to unavoidable emergency operations in middle pregnancy, selective oper- ations are also mostly carried out in this period. Prena- J. Integr. Neurosci. 2021 vol. 20(3), 613-622 ©2021 The Author(s). Published by IMR Press. tal sevoflurane exposure in middle pregnancy may affect fe- tal neural development and cause neural dysfunction in off- spring. Interneurons, located with GABAA receptors, can control and regulate the pyramidal neurons in the entorhinal cortex (ECT). The layers II and III (LII and LIII) pyramidal neu- rons of the ECT send out perforating fibers to transmit in- formation to the hippocampus, and the hippocampus forms memories by editing and storing information [7]. The hip- pocampus is the key center of brain association, learning, and memory. Thus, interference with interneurons may lead to learning and memory dysfunction. However, previous re- lated studies have been mainly focused on ultrastructural and functional impairments of pyramidal neurons after sevoflu- rane exposure [8–11]. Relatively little attention has been paid to interneurons. Neuregulin-1 (NRG1), a member of the epidermal growth factor family, plays an important role in promoting the phos- phorylation of epidermal growth factor receptor-4 (ErbB4) [12, 13]. ErbB4 receptors have a variety of isomers, includ- ing ErbB (1–4). ErbB4 is highly expressed in the brain and has a strong affinity for NRG1. Most ErbB4 receptors are ex- pressed on parvalbumin (PV) interneurons, which account for 40% of interneurons [12–14]. The NRG1–ErbB4 path- way can regulate and interact with the secretion function of GABAA receptors [15]. The NRG1–ErbB4 pathway plays a great role in the occurrence, migration, and synaptic plas- ticity of neurons [16–18] by regulating the composition of interneurons’ subunit and the activity of receptor [19–21]. Furthermore, alterations of the NRG1–ErbB4 pathway could regulate key receptors connected to learning and memory ability, such as NMDA receptors [22, 23]. Moreover, ex- posure to general anesthetics can interfere with the key pro- cesses of dendritic growth and the development of pyramidal neurons [24]. Li et al. [25] found that disruption of NRG1– ErbB4 signaling in the PV-positive interneurons caused cog- nitive impairment in rats after exposure to isoflurane. Hence, it is possible that sevoflurane can induce neural dysfunction in offspring by regulating GABAA receptors in the PV in- terneurons of the ECT through the NRG1–ErbB4 pathway. Consequently, the influenced NRG1–ErbB4 pathway could further regulate interneurons and pyramidal neurons and af- fect the information transmission function of the ECT. Herein, we hypothesize that sevoflurane could regulate in- terneurons via the NRG1–ErbB4 pathway in the ECT of off- spring during the middle pregnancy. Gestational day 14.5 in pregnant rats is similar to middle pregnancy in humans [26]. In this study, pregnant mice were exposed to sevoflurane in middle pregnancy. The status of the NRG1–ErbB4 pathway, interneurons, NMDA receptors, and the dendrite morphol- ogy of pyramidal neurons were examined to test the hypothe- sis. Discovering the mechanism of sevoflurane-induced neu- rotoxicity is of great significance for guiding the standardized clinical use of general anesthetics and research into toxicity prevention and treatment. 614 2. Methods 2.1 Animals Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days. Then the female SD rats were mated with male SD rats with sexual experience at 7:00 PM after adaptive feeding. Vaginal smears were performed the next morning and pregnancy day 0, G0, was defined by sperm detection. The pregnant rats were randomly divided into two groups: a control group (control, n = 3) and a sevoflurane group (SeV, n = 3). The six female SD rats were raised to G14.5 (middle pregnancy). 2.2 Anesthesia On pregnancy day 14.5, the rats allocated to sevoflurane exposure were put inside a 30 cm × 20 cm × 120 cm box. A mixture of oxygen and sevoflurane (2 L/min with 4% sevoflu- rane) was delivered through an inlet port connected to a va- porizer, while a gas analyzer installed on a second port al- lowed monitoring of anesthetic gas concentration. Pregnant rats are more sensitive to sevoflurane and a minimum alve- olar concentration (MAC) of 2.4% in healthy adult rats [27], so the concentration of sevoflurane (3%) is equivalent to 1.3 MAC to maintain a surgical level of anesthesia. The rats in the control group inhaled oxygen (2 L/min). However, lim- ited to anesthesia machine conditions that it is not completely airtight, the inhalation concentration of sevoflurane should be 4% in order to reach 1.8 MAC to maintain a surgical level of anesthesia in the SeV group. The inhalation time is 3 hours in the SeV group. During the procedure, the skin color of the rats’ mouths, noses, limbs, and respiratory amplitudes and frequencies were observed to avoid hypoxia respiratory de- pression. After anesthesia, the rats were sent back to their cages after the righting reflex was recovered. After sevoflu- rane anesthetization, an arterial blood gas analysis was per- formed to assess gas exchange and glycemic status in female rats. The site of blood sampling was left heart artery. If there was a significant derangement, e.g., severe hypoxemia, these female rats were no longer involved in the follow-up experi- ments. No female rats were excluded in the study. Then the rat offspring were reared and delivered naturally. 2.3 Tissue section preparation Three offspring were randomly selected from each group with one offspring/dam. The ex vivo brain samples of the off- spring rats were harvested at the day 30 of postpartum (P30) for histology, immunostaining and Golgi staining. Rats in both the control and SeV groups were executed and perfused through the left ventricle with precooling saline followed by 4% paraformaldehyde in 0.01 M phosphate buffered saline (PBS) pH 7.35. The brain tissue of the rats was taken and post-fixed for 24 hours for paraffin and frozen sections. To analyze the status of the NRG1–ErbB4 pathway in the interneurons, the expression levels of NRG1 and ErbB4 in LII and III of the ECT were examined via immunohisto- chemistry. The NRG1–ErbB4 pathway plays an important Volume 20, Number 3, 2021 role in the genesis, migration, differentiation, maturation, and neurotransmitter synthesis of GABAergic interneurons. We assumed that the number of GABAergic interneurons the LII/LIII ECT of offspring in could be affected by alter- ations of the NRG1–ErbB4 pathway. Therefore, we label GABAergic interneurons with PV to represent PV interneu- rons. We also used glutamic acid decarboxylase 67 (GAD67) to label GABAergic interneuron (the key enzyme of GABA neurotransmitter synthesis) positive cells to represent the to- tal GABAergic interneurons in the LII/LIII ECT. The expres- sion levels of PV and GAD67 in LII and LIII of the ECT were examined via immunohistochemistry. That is, Interneurons were identified by immunoreactivity to PV and GAD67. To investigate whether NRG1–ErbB4 pathway changes in off- spring after prenatal sevoflurane exposure affect the forma- tion of subunits during maturation, we detected NMDA re- ceptor subunit 2A (NR2A) and NMDA receptor subunit 2B (NR2B) by immunofluorescence. The expression levels of NR2A and NR2B in LII and LIII of the ECT were examined via immunohistochemistry to analyze the status of NMDA receptors in the ECT. There is a fixed pattern of neurite growth in the developing brain. We assumed that prenatal sevoflurane exposure could affect the inherent growth pat- tern of dendrites and dendritic spines in pyramidal neurons through NRG1–ErbB4 alterations. Therefore, we used Golgi silver staining to investigate the length of dendrites and the number of branches and dendritic spines. Golgi staining was performed to analyze the total dendrite length, number of dendritic branches, spatial distribution of dendrites, and den- sity of dendritic spines in the pyramidal neurons in the ECT. 2.4 Histology and immunohistochemistry The coronal sections of the brain were deparaffinized, re- hydrated, and immersed in 3% H2O2 at room temperature for 30 min. Antigens were retrieved in a 0.01 mol/L citric buffer (pH 6.0) at 97 C for 15 min. The coronal sections were cooled down for 1 h before being blocked by 10% bovine serum albumin (BSA) solution. Staining with diluted primary antibodies was conducted at 4 C overnight (for at least 18 h). The primary antibodies included rabbit anti rat NRG-1 (1:1000, Cat. No Ab191139, Abcam, Cambridge, UK), rab- bit anti rat ErbB4 (1:250, Cat. No Sc-283, Santa Cruz, Dal- las, Texas, USA), rabbit anti rat NR2A (1:1000, Cat. No cell signaling technology, Massachusetts, USA), rabbit anti rat NR2B (1:1000, Cat. No 06-600, Millipore, Massachusetts, USA), mice anti rat PV (1:1000, Cat. No #2886709, Milli- pore), and rat anti rat GAD67 (1:2500, Cat. No. MAB5406, Millipore, Massachusetts, USA). After being washed by 0.1% PBST for three times (5 min), the sections were stained with diluted second antibodies at room temperature for 2 h and kept in a dark place. After washed by 0.1% PBST for three times (5 min), the sections were counterstained with hema- toxylin, dehydrated with ethanol and mounted with cov- erslips. Then the expression levels of NRG1, ErbB4, PV, GAD67, NR2, A and NR2B were examined using a fluores- cence microscope (Leica DM6000B, Germany). The results Volume 20, Number 3, 2021 were shown as positive cells/sections. In each rat, we ran- domly select 5–6 coronal sections to count the cells to avoid error resulting from the section status. The brain area sec- tions (ECT) we selected for immunohistochemical section is fixed. There is an inward concave angle under the area of the ECT, which is used to locate the central cortex and reduce the error. The size of the ECT in this part of the rat brain is rela- tively fixed, so the randomly selected sections can be regarded as roughly the same size which is comparable. 2.5 Golgi stain 150 µm-thick frozen brain sections were obtained from control and SeV rats. Golgi–Cox staining was performed using the FD Rapid Golgi stain kit (Cat. NO. PK401, FD NeuroTechnologies, Inc. Columbia, USA) according to the manufacturer’s protocols. Ten well-individualized pyrami- dal neurons in LII and LIII of the ECT were randomly se- lected from each rat. Sequential optical sections of 1392 × 1040 pixels were taken at 1.5 µm intervals along the z-axis (Leica, DMi8 + DFC7000J, Germany). The Imaris software (BitPlane AG, Zurich, Switzerland) was used for tridimen- sional reconstruction. The total dendrite length, number of dendritic branches, and spatial distribution of dendrites in the pyramidal neurons of the ECT were estimated using Sholl analysis [28]. To measure the density of dendritic spines, a straight dendrite was scanned on the z-axis using a 100 × objective microscope. A 40-µm long dendrite was randomly intercepted with image J 1.46r (National institute of health, Bethesda, Maryland, USA). The number of synaptic spines was counted and the density of synaptic spines (spines/10 µm) was calculated. At least 10 terminal dendrites were se- lected for each sample. 2.6 Statistical analysis All the data was expressed as mean ± standard deviation. JMP software version 16.0 (SAS Institute, Cary, NC, USA) was used for statistical processing. All parameters were tested for normal distribution using the Kolmogorov-Smirnov test. Two independent-sample t tests were conducted used to compare the parameters differences between the control and sevoflurane groups, including NRG1, ErbB4, PV, GAD67, NR2B and NR2A. Dendrites were analyzed with Kruskal- Wallis test (Sholl analysis) and Steel Dwass post hoc test using JMP software version 16.0 (SAS Institute, Cary, NC, USA) [28]. It was considered that a difference was statistically sig- nificant when P < 0.05. GraphPad Prism 5.0 (GraphPad Soft- ware, San Diego, CA, USA) software was used to make draw- ings. 3. Results 3.1 Prenatal sevoflurane exposure down regulates the level of NRG1–ErbB4 in LII/LIII of the ECT in offspring The results showed that the expression of NRG1 in the SeV group was significantly lower than that in the control group (control group: 9.94 ± 4.26, SeV group: 3.72 ± 2.08, P < 0.01) (Fig. 1). The ErbB4 level in SeV group was also 615 Fig. 1. Exposure of sevoflurane to maternal rats impaired the NRG1–ErbB4 signaling pathway in the LII/LIII entorhinal cortex of offspring. Inverted fluorescence microscopy showed that the NRG1 and ErbB4 positive cells were stained with green fluorescence. The top picture shows the field of vision under the 100 × light microscope of the inverted fluorescence microscope. We used the inverted fluorescence microscope to scan the whole picture of immunofluorescence staining of 100 × rat brain slices. In the whole picture, the area in the white box is pyramidal neurons in the LII/LIII entorhinal cortex. In the control (A and C) and sevoflurane (B and D) groups, A and B show the NRG1 positive cells in the LII/LIII entorhinal cortex of the P30 progeny. C and D show the ErbB4 positive cells. The numbers were significantly decreased in the sevoflurane group compared to the control group (E and F). Note: The symbol ‘**’ represented there was significant difference between groups under the significant level of 0.01. significantly lower than that in the control group (control group: 20.11 ± 12.67, SeV: 6.47 ± 3.41, P < 0.01) (Fig. 1). 3.3 Prenatal exposure to sevoflurane leads to the abnormal expressions of NMDA receptor subunits in LII/LIII of the ECT of offspring 3.2 Prenatal sevoflurane exposure reduces the number of interneurons in the LII/LIII ECT of offspring The results showed that the number of PV positive cells in the SeV group was significantly lower than that in control group (control group: 23.41 ± 1.01, SeV group: 7.41 ± 0.82, P < 0.01) (Fig. 2). The number of GAD67 positive cells in the SeV group decreased significantly (control group: 17.44 ± 4.63, SeV group: 10.05 ± 3.17, P < 0.01) (Fig. 2). The results were as follows (Fig. 3): compared to the control group, the number of NR2A positive cells in the SeV group was decreased (control group: 24.00 ± 10.83, SeV group: 11.40 ± 10.10, P < 0.05) while the number of NR2B positive cells was significantly increased (control group: 15.61 ± 5.14, SeV group: 38.21 ± 8.50, P < 0.01). 616 Volume 20, Number 3, 2021 Fig. 2. The GABAergic interneurons of offspring in the LII/LIII entorhinal cortex were significantly reduced. PV and GAD67 positive cells were stained with red fluorescence, so in the inverted fluorescence microscope at 20X magnification, these cells are indicated by red fluorescence. (A) The PV positive cells in the LII/LIII entorhinal cortex of the P30 offspring in the control group. (B) PV immunofluorescence (red) on a P30 offspring rat in the sevoflurane group. (C) GAD67 immunofluorescence (red) on a P30 offspring rat in the control group. (D) GAD67 immunofluorescence (red) on a P30 offspring rat in the sevoflurane group. (E) The numbers of PV cells were significantly decreased in the sevoflurane compared to the control group. (F) The numbers of GAD67 cells were significantly decreased in the sevoflurane group compared to the control group. Note: The symbol ‘**’ represented there was significant difference between groups under the significant level of 0.01. 3.4 Prenatal sevoflurane exposure results in the abnormal development of the dendrites of pyramidal neurons The results showed that compared to that in the control group, the number of dendritic spines of the pyramidal neu- rons in LII/LIII of the ECT in the SeV group was significantly increased (control group: 8.88 ± 1.83, SeV group: 11.86 ± 1.27, P < 0.01), the total length of dendrites in the SeV group was significantly lower than that in the control group (con- trol group: 3819.32 ± 614.99, SeV: 2978.45 ± 577.31, P < 0.01), and the number of dendrite branches in the SeV group was significantly lower than that in control group (control group: 38.24 ± 4.66, SeV group: 32.22 ± 6.88, P < 0.01) (see Fig. 4). Sholl analysis showed that the spatial distribution of dendrites was abnormal (P < 0.05, Fig. 4). 4. Discussion We previously speculated that prenatal sevoflurane, as an exogenous GABAA receptor agonist, down regulated the NRG1–ErbB4 signaling pathway and that this change could lead to the disturbance of interneurons and the abnormal de- velopment of the dendrites of pyramidal neurons. The re- sults of this study basically confirmed our hypothesis. This could be helpful for the standardization of the clinical use of sevoflurane and its toxicity prevention and treatment. With the development of surgical technology and fetal surgery, an increasing number of pregnant women need to be exposed to general anesthetics. Sevoflurane mainly acts as GABAA receptor agonist/enhancer and has sedative, anal- gesic, and muscle relaxant effects. Bartolini et al. [29] found that the inhalation of sevoflurane in 2MAC can inhibit uter- ine muscle contraction in a dose-dependent manner. Thus, based on its inhibition of uterine contraction, which can pre- vent premature delivery, sevoflurane is the most widely used inhalation anesthetic during pregnancy. Sevoflurane easily impacts fetuses though the placenta [30]. Zheng et al. [9] found that with the inhalation of 2.5% sevoflurane for 2 hours and 4.1% sevoflurane for 6 hours, the offspring of pregnant rat showed decreased learning and memory ability, accompa- nied by the release of inflammatory agents in the hippocam- pus and abnormal synaptic development. In recent years, a large number of studies have shown that sevoflurane it neurotoxic to the developing brain, which can lead to in- creased neuronal apoptosis, the inhibition of proliferation, neuronal development disorders, and long-term neurobe- havioral abnormalities [31, 32]. However, most of the au- thors of these studies were focus on the hippocampus, which is related to learning and memory, and mainly studies the ul- trastructural and functional impairment of projection neu- rons. Little attention has been paid to LII/LIII of the ECT, which is the key area of hippocampal information input. In LII/LIII of the ECT, interneurons, characterized as GABAer- gic neurons, could be regulated by sevoflurane. Impacts on the NRG1–ErbB4 pathway in interneurons may further reg- ulate interneurons themselves and pyramidal neurons and af- fect the information transmission functions of the ECT. Volume 20, Number 3, 2021 617 Fig. 3. Maternal exposure of sevoflurane leads to impaired maturation of NMDA receptors in offspring. NR2A and NR2B positive cells are indicated by green fluorescence. (A) The NR2A positive cells in the LII/LIII entorhinal cortex of the P30 offspring in the control group. (B) NR2A immunofluorescence (green) on a P30 offspring rat in the sevoflurane group. (C) NR2B immunofluorescence (green) on a P30 offspring rat in the control group. (D) NR2B immunofluorescence (green) on a P30 offspring rat in the sevoflurane group. (E) The numbers of NR2A cells were significantly decreased in the sevoflurane compared to the control group. (F) The numbers of NR2B cells were significantly increased in the sevoflurane compared to the control group. Note: The symbol ‘**’ represented there was significant difference between groups under the significant level of 0.01. In this study, we simulated clinical practice. The preg- nant rats were anesthetized with 4% sevoflurane for 3 hours at 14.5 days of gestation to reach a MAC of 1.8 (lower than normal rats, considering that pregnant rats are more sensitive to sevoflurane), which was equivalent to that of most surgical operations for pregnant females. We found that sevoflurane, as an exogenous GABAA receptor agonist, could down reg- ulate the NRG1–ErbB4 signaling pathway (Fig. 2). NRG1 is highly expressed in mammalian embryos and decreases with age. It involves many aspects of neural development, includ- ing neuronal migration, survival, axon projection, myelin sheath development, synaptic formation and the regulation of neurotransmitter receptor expression [13, 16, 33–37]. Pre- vious studies have revealed that the NRG1–ErbB4 pathway is necessary for the generation and migration of intermedi- ate neurons originating from the medial ganglionic eminence (MGE) region [16, 38–40]. The impairment of the NRG1– ErbB4 pathway can affect the migration of PV interneurons from the MGE region. PV interneurons account for 40% of interneurons, and there was a decrease of 30–50% of in- terneurons in ErbB4 gene knockout rats. We administered sevoflurane anesthesia during middle pregnancy, which is the critical period of the development of the generation and mi- gration of the embryonic interneurons. In this period, the MGE area produces PV interneurons, which migrate to the edge of the cortex and subventricular area and then radially to the target cortex [29]. Our results also showed that the NRG1–ErbB4 pathway was down regulated along with a de- crease in the number of interneurons. Therefore, the de- crease in the number of interneurons in LII/LIII of the ECT in the SeV group could have been due to the inhibition of the formation of interneurons by the decreased NRG1–ErbB4 level. At the same time, the decreased NRG1–ErbB4 blocked interneurons’ migration to LII/LIII of the ECT. The NMDA receptor (NMDAR) is mainly composed of two NR1 and two NR2 subunits. The distribution of NM- DAR subunits (NR1, NR2, NR3) also changes with the pro- cess of neurodevelopment. NR1 begins to increase after birth until puberty and reaches a peak level in the third week af- ter birth. NR2B and NR2D are the main subunits of NR2 in 618 Volume 20, Number 3, 2021 Fig. 4. Sevoflurane exposure disturbs the maturation of pyramidal neurons in the LII/LIII entorhinal cortex of offspring. Six P30 brains in each group were processed for Golgi–Cox impregnation, and pyramidal neurons in the LII/LIII entorhinal cortex were studied in the control (examples in A) and sevoflurane (examples in C) groups. The left panels (A and C) show two examples of Golgi-impregnated neurons. The total branch number and dendritic length were significantly decreased in the sevoflurane group compared to the control group (E and F) (n = 24 neurons in each group). In addition, higher spine density was observed in the sevoflurane group had than the control group (see B, D, and H) (n = 24 dendrites in each group). Sholl analysis showed that the complexity of dendritic trees was lower in the sevoflurane group than the control group (G). Note: The symbol ‘*’ represented there was significant difference between groups under the significant level of 0.05. The symbol ‘**’ represented there was significant difference between groups under the significant level of 0.01. the embryonic stage. The expression of NR2 changes signif- icantly in the two weeks after birth. NR2A begins to par- tially replace NR2B until the brain matures. The develop- ment of NMDAR subunits marks the transition from im- mature to mature neurons and is closely related to the de- velopment of learning and memory ability. In our experi- ment, exposure to sevoflurane was found to decrease the ex- pression of NR2A and increase the expression of NR2B in offspring, which is consistent with the findings of previous studies [31, 32]. NRG1–ErbB4 changes could increase the phosphorylation of NR2B by Fyn and, thus, reduce the in- ternalization of NR2B and delay the transition from NR2B to NR2A. NRG1–ErbB4 can regulate not only the release and activity of GABAergic neurotransmitters but also the exci- tatory synapses on inhibitory neurons (interneurons). The intracellular segment of the ErbB4 protein contains post- synaptic postsynaptic dens 95 (PSD-95)/DiscsLarge/zonula occludens protein-1 (ZO1) (PDZ) domains, which are an- chored to the postsynaptic membrane by interacting with other proteins (such as PSD-95) that also contain PDZ [41– 43]. Thus, ErbB4 regulates the function of the NMDAR by the connection of PDZ [41–43]. The NRG1–ErbB4 pathway phosphorylates the phosphorylation site of NR2B through a member of the Src family of Fyn (SRC/Fyn), which blocks the internalization of NR2B by protein AP-2 [44, 45]. In this way, the NRG1–ErbB4 pathway increases the expression of Volume 20, Number 3, 2021 619 NR2B on the postsynaptic membrane [44, 45]. Thus, the de- creased NRG1–ErbB4 level results in increased NR2B and de- creased NR2A levels (Fig. 3). This alteration may lead to the abnormal development of learning and memory ability. Pyramidal neurons are responsible for information trans- mission, and their function is very important. Therefore, it has always been a research hotspot in the topic of the neu- rotoxicity of general anesthetics during development. In- terneurons play an important role in regulating pyramidal neurons. We found that prenatal sevoflurane exposure in middle pregnancy resulted in a significant increase in the number of dendritic spines, a significant decrease in the to- tal length of dendrites, and an abnormal spatial distribution of dendrites in offspring (Fig. 4). There could be three pos- sible mechanism behind the increased number of dendritic spines. One explanation is that the decrease in the number of interneurons leads to the weakening of their regulation of pyramidal neurons, resulting in abnormal numbers of den- dritic spines. The second explanation is that the change of the NRG1–ErbB4 pathway could regulate the dendritic spines of pyramidal neurons. Barros et al. [35] found that the num- ber of pyramidal dendritic spines decreased after ErbB4 and ErbB2 knockout in the nervous system. However, the num- ber of pyramidal dendritic spines did not decrease in the ex- periment of ErbB4 knockout by pyramidal cells [44, 46]. It is suggested that ErbB2 may play a role of functional com- pensation, and there is an over-compensation in the num- ber of pyramidal dendritic spines [37, 47]. The third ex- planation is that the NR2B subunit of NMDAR combines with PSD-95 and calmodulin-dependent kinase II (CaMKII), which activates a series of downstream signaling pathways and leads to an increase in the number of dendritic spines [48]. The NR2B/PSD95/kalirin-7 pathway is very impor- tant in the development of neuronal dendritic spines. Re- cent studies have shown that PSD-95, kalirin-7, and NR2B form a complex with a postsynaptic membrane through the PDZ domain. NR2B can activate kalirin-7, and then activate Rac1, a downstream RhoGTPase family member [49]. In this way, NR2B could dynamically regulate actin cytoskeleton re- arrangement, promote the growth of dendritic spines, induce the formation of spinous structures in neuronal bodies, and cause the excessive formation of dendritic spines in pyramidal neurons and interneurons [49]. The decrease of total length and branches of dendrites in offspring may be explained by the change of the NRG1–ErbB4 signaling pathway and NR2B subunit, which mainly involve the growth and pruning of dendrites [36, 37]. Further, the plasticity of dendritic spines affects learning and memory function, especially the forma- tion of long-term memory [50, 51]. The initial experimental hypothesis has been verified in this study. However, to test the hypothesis, this study focused on the study of the ECT with a concentration on the memory transfer station. Thus, this study did not involve an investi- gation of the dentate gyrus area of the hippocampus, which was directly projected by pyramidal neurons in the ECT. The 620 time (3 h) for sevoflurane exposure may be too long in ac- tual clinical situation. However, despite the hard exploratory work we’ve done, there is a few results we assumed except for that sevoflurane exposed to fetal brain for at least 3 hours or neonatal brains for more than 6 hours were neurotoxic. These results suggested that the safe concentration and ex- posure time in most clinical practice is safe. 5. Conclusions Prenatal sevoflurane exposure in middle pregnancy could lead to the disorder of the interneurons by activating the GABAA receptor and its NRG1–ErbB4 pathway. In this way, prenatal sevoflurane leads to the abnormal dendrite devel- opment of the pyramidal neurons in the ECT of offspring rats and, thus, may interfere with the process of information transmission from the ECT to the hippocampus. This study indicated a possible novel neurotoxic pathway in the influ- ence of sevoflurane on ECT of rat offspring. In clinical prac- tice, the concentration of sevoflurane is much lower than the concentration in this study because of the addition of other auxiliary drugs such as opioid sedatives. Secondly, because of the advancement of surgical procedures, most non-obstetric procedures during pregnancy do not require 3 hours. There- fore, the current clinical use of sevoflurane is safe. How- ever, prolonged exposure to high concentrations of sevoflu- rane still needs to be alert to neurotoxicity. Abbreviations gamma- aminobutyric acid; CNS, central nervous system; GABAA, GABA type A; LII and LIII, layers II and III; NRG1, Neuregulin-1; ErbB4, epidermal growth factor receptor-4; PV, parvalbumin; SD, Sprague–Dawley; SeV, sevoflu- rane; MAC, minimum alveolar concentration; P30, the day 30 of postpartum; PBS, phosphate buffered saline; GAD67, glutamic acid decarboxylase 67; NR2A, NMDA receptor subunit 2A; NR2B, NMDA receptor subunit 2B; BSA, bovine serum albumin; MGE, medial ganglionic eminence region; NMDAR, NMDA receptor; PDZ, PSD- 95/DiscsLarge/ZO1; PSD-95, postsynaptic dens 95; ZO1, onula occludens protein-1; SRC/Fyn, Src family of Fyn; CaMKII, calmodulin-dependent kinase II. NMDA, N -methyl-D-aspartate; GABA, Author contributions XS, YG and TZ designed research; YG, TZ, YC, ZS, ZS and JL performed experiments; YC analyzed data; YG wrote the paper; TZ and XS critically revised the paper. Ethics approval and consent to participate This experiment was approved by the Animal Ethics Committee of Guangzhou Medical University, and the re- searchers strictly followed the relevant provisions of the “Guidelines for the Care and Use of Laboratory Animals” is- sued by the National Institutes of Health in 1996 (ethic code: 2016-029). Volume 20, Number 3, 2021 Acknowledgment We thank Xiaolong Zeng for assistance in manuscript re- vision preparation. Funding This work was granted by the National Natural Science Foundation of China (Granted no. 81870823). Conflict of interest The authors declare no conflict of interest. References [1] Okeagu CN, Anandi P, Gennuso S, Hyatali F, Stark CW, Prab- hakar A, et al. Clinical management of the pregnant patient under- going non-obstetric surgery: Review of guidelines. Best Practice & Research Clinical Anaesthesiology. 2020; 34: 269–281. [2] Jevtovic-Todorovic V, Absalom AR, Blomgren K, Brambrink A, Crosby G, Culley DJ, et al. Anaesthetic neurotoxicity and neuro- plasticity: an expert group report and statement based on the BJA Salzburg Seminar. British Journal of Anaesthesia. 2013; 111: 143– 151. [3] Grasshoff C, Antkowiak B. Propofol and Sevoflurane Depress Spinal Neurons in Vitro via Different Molecular Targets. Anes- thesiology. 2004; 101: 1167–1176. [4] Ben-Ari Y. Excitatory actions of gaba during development: the na- ture of the nurture. Nature Reviews Neuroscience. 2002; 3: 728– 739. [5] Wang DD, Kriegstein AR. Defining the role of GABA in cortical development. Journal of Physiology. 2009; 587: 1873–1879. [6] Palanisamy A. Maternal anesthesia and fetal neurodevelopment. International Journal of Obstetric Anesthesia. 2012; 21: 152–162. [7] Bjarnadottir M, Misner DL, Haverfield-Gross S, Bruun S, Hel- gason VG, Stefansson H, et al. Neuregulin1 (NRG1) Signaling through Fyn Modulates NMDA Receptor Phosphorylation: Dif- ferential Synaptic Function in NRG1+/- Knock-Outs Compared with Wild-Type Mice. Journal of Neuroscience. 2007; 27: 4519– 4529. [8] Istaphanous GK, Ward CG, Nan X, Hughes EA, McCann JC, McAuliffe JJ, et al. Characterization and quantification of isoflurane-induced developmental apoptotic cell death in mouse cerebral cortex. Anesthesia and Analgesia. 2013; 116: 845–854. [9] Zheng H, Dong Y, Xu Z, Crosby G, Culley D, Zhang Y, et al. Sevoflurane Anesthesia in Pregnant Mice Induces Neurotoxicity in Fetal and Offspring Mice. Anesthesiology. 2013; 118: 516–526. [10] Briner A, De Roo M, Dayer A, Muller D, Habre W, Vutskits L. Volatile anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiol- ogy. 2010; 112: 546–556. [11] Zhao T, Li Y, Wei W, Savage S, Zhou L, Ma D. Ketamine admin- istered to pregnant rats in the second trimester causes long-lasting behavioral disorders in offspring. Neurobiology of Disease. 2014; 68: 145–155. [12] Corfas G, Roy K, Buxbaum JD. Neuregulin 1-erbB signaling and the molecular/cellular basis of schizophrenia. Nature Neuro- science. 2004; 7: 575–580. [13] Mei L, Xiong W. Neuregulin 1 in neural development, synaptic plasticity and schizophrenia. Nature Reviews. Neuroscience. 2008; 9: 437–452. [14] Liang D, Fan F, Ding W, Fang Y, Hu L, Lei B, et al. Increased Seizure Susceptibility for Rats Subject to Early Life Hypoxia might be Associated with Brain Dysfunction of NRG1-ErbB4 Signaling in Parvalbumin Interneurons. Molecular Neurobiology. 2020; 57: 5276–5285. [15] Harrison PJ, Weinberger DR. Schizophrenia genes, gene expres- sion, and neuropathology: on the matter of their convergence. Molecular Psychiatry. 2005; 10: 40–68. Volume 20, Number 3, 2021 [16] Anton ES, Ghashghaei HT, Weber JL, McCann C, Fischer TM, Cheung ID, et al. Receptor tyrosine kinase ErbB4 modulates neu- roblast migration and placement in the adult forebrain. Nature Neuroscience. 2004; 7: 1319–1328. [17] Ozaki M, Tohyama K, Kishida H, Buonanno A, Yano R, Hashikawa T. Roles of neuregulin in synaptogenesis between mossy fibers and cerebellar granule cells. Journal of Neuroscience Research. 2000; 59: 612–623. [18] Zhao JJ, Lemke G. Selective disruption of neuregulin-1 function in vertebrate embryos using ribozyme-tRNA transgenes. Devel- opment. 1998; 125: 1899–1907. [19] Gu Z, Jiang Q, Fu AKY, Ip NY, Yan Z. Regulation of NMDA re- ceptors by neuregulin signaling in prefrontal cortex. Journal of Neuroscience. 2005; 25: 4974–4984. [20] Ozaki M, Sasner M, Yano R, Lu HS, Buonanno A. Neuregulin-beta induces expression of an NMDA-receptor subunit. Nature. 1997; 390: 691–694. [21] Konradi C, Heckers S. Molecular aspects of glutamate dysregula- tion: implications for schizophrenia and its treatment. Pharma- cology & Therapeutics. 2003; 97: 153–179. [22] Gabrieli D, Schumm SN, Vigilante NF, Meaney DF. NMDA Receptor Alterations after Mild Traumatic Brain Injury Induce Deficits in Memory Acquisition and Recall. Neural Computation. 2021; 33: 67–95. [23] Howe T, Blockeel AJ, Taylor H, Jones MW, Bazhenov M, Malerba P. NMDA receptors promote hippocampal sharp-wave ripples and the associated coactivity of CA1 pyramidal cells. Hippocam- pus. 2020; 30: 1356–1370. [24] Bartolini G, Ciceri G, Marín O. Integration of GABAergic in- terneurons into cortical cell assemblies: lessons from embryos and adults. Neuron. 2013; 79: 849–864. [25] Li X, Su F, Ji M, Zhang G, Qiu L, Jia M, et al. Disruption of hippocampal neuregulin 1-ErbB4 signaling contributes to the hippocampus-dependent cognitive impairment induced by isoflu- rane in aged mice. Anesthesiology. 2014; 121: 79–88. [26] Clancy B, Darlington RB, Finlay BL. Translating developmental time across mammalian species. Neuroscience. 2001; 105: 7–17. [27] Ihmsen H, Schywalsky M, Plettke R, Priller M, Walz F, Schwilden H. Concentration-effect relations, prediction probabilities (Pk), and signal-to-noise ratios of different electroencephalographic parameters during administration of desflurane, isoflurane, and sevoflurane in rats. Anesthesiology. 2008; 108: 276–285. [28] Sholl DA. Dendritic organization in the neurons of the visual and motor cortices of the cat. Journal of Anatomy. 1953; 87: 387–406. [29] Bartolini G, Ciceri G, Marín O. Integration of GABAergic in- terneurons into cortical cell assemblies: lessons from embryos and adults. Neuron. 2013; 79: 849–864. [30] Chai D, Cheng Y, Jiang H. Fundamentals of fetal toxicity relevant to sevoflurane exposures during pregnancy. International Journal of Developmental Neuroscience. 2019; 72: 31–35. [31] Wang W, Jia L, Luo Y, Zhang H, Cai F, Mao H, et al. Location- and Subunit-Specific NMDA Receptors Determine the Developmen- tal Sevoflurane Neurotoxicity through ERK1/2 Signaling. Molec- ular Neurobiology. 2016; 53: 216–230. [32] Zhang X, Shen F, Xu D, Zhao X. A lasting effect of postnatal sevoflurane anesthesia on the composition of NMDA receptor subunits in rat prefrontal cortex. International Journal of Devel- opmental Neuroscience. 2016; 54: 62–69. [33] Falls DL. Neuregulins: functions, forms, and signaling strategies. Experimental Cell Research. 2003; 284: 14–30. [34] Buonanno A, Fischbach GD. Neuregulin and ErbB receptor sig- naling pathways in the nervous system. Current Opinion in Neu- robiology. 2001; 11: 287–296. [35] Barros CS, Calabrese B, Chamero P, Roberts AJ, Korzus E, Lloyd K, et al. Impaired maturation of dendritic spines without disor- ganization of cortical cell layers in mice lacking NRG1/ErbB sig- naling in the central nervous system. Proceedings of the National Academy of Sciences. 2009; 106: 4507–4512. [36] Fazzari P, Paternain AV, Valiente M, Pla R, Luján R, Lloyd K, et 621 al. Control of cortical GABA circuitry development by Nrg1 and ErbB4 signalling. Nature. 2010; 464: 1376–1380. [37] Cooper MA, Koleske AJ. ErbB4 localization to interneurons: clearer insights into schizophrenia pathology. Biological Psychi- atry. 2011; 70: 602–603. [38] Buonanno A. The neuregulin signaling pathway and schizophre- nia: from genes to synapses and neural circuits. Brain Research Bulletin. 2010; 83: 122–131. [39] Fisahn A, Neddens J, Yan L, Buonanno A. Neuregulin-1 modulates hippocampal gamma oscillations: implications for schizophrenia. Cerebral Cortex. 2009; 19: 612–618. [40] Flames N, Long JE, Garratt AN, Fischer TM, Gassmann M, Birchmeier C, et al. Short- and long-range attraction of corti- cal GABAergic interneurons by neuregulin-1. Neuron. 2004; 44: 251–261. [41] Garcia RA, Vasudevan K, Buonanno A. The neuregulin recep- tor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proceedings of the National Academy of Sciences. 2000; 97: 3596–3601. [42] Krivosheya D, Tapia L, Levinson JN, Huang K, Kang Y, Hines R, et al. ErbB4-neuregulin signaling modulates synapse development and dendritic arborization through distinct mechanisms. Journal of Biological Chemistry. 2008; 283: 32944–32956. [43] Huang YZ, Won S, Ali DW, Wang Q, Tanowitz M, Du QS, et al. Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 2000; 26: 443–455. [44] Wang JQ, Guo M, Jin D, Xue B, Fibuch EE, Mao L. Roles of sub- unit phosphorylation in regulating glutamate receptor function. European Journal of Pharmacology. 2014; 728: 183–187. 622 [45] Nakazawa T, Komai S, Tezuka T, Hisatsune C, Umemori H, Semba K, et al. Characterization of Fyn-mediated tyrosine phos- phorylation sites on GluR epsilon 2 (NR2B) subunit of the N - methyl-D-aspartate receptor. Journal of Biological Chemistry. 2001; 276: 693–699. [46] Alkire MT, Gruver R, Miller J, McReynolds JR, Hahn EL, Cahill L. Neuroimaging analysis of an anesthetic gas that blocks human emotional memory. Proceedings of the National Academy of Sci- ences. 2008; 105: 17221727. [47] Yin D, Sun X, Bean JC, Lin TW, Sathyamurthy A, Xiong W, et al. Regulation of spine formation by ErbB4 in PV-positive interneu- rons. Journal of Neuroscience. 2013; 33: 19295–19303. [48] Tolias KF, Bikoff JB, Burette A, Paradis S, Harrar D, Tavazoie S, et al. The Rac1-GEF Tiam1 couples the NMDA receptor to the activity-dependent development of dendritic arbors and spines. Neuron. 2005; 45: 525–538. [49] Penzes P, Jones KA. Dendritic spine dynamics–a key role for kalirin-7. Trends in Neurosciences. 2008; 31: 419–427. [50] Xu T, Yu X, Perlik AJ, Tobin WF, Zweig JA, Tennant K, et al. Rapid formation and selective stabilization of synapses for endur- ing motor memories. Nature. 2009; 462: 915–919. [51] Tschida K, Mooney R. Deafening Drives Cell-Type-Specific Changes to Dendritic Spines in a Sensorimotor Nucleus Impor- tant to Learned Vocalizations. Neuron. 2012; 73: 1028–1039. Volume 20, Number 3, 2021",rats,"['Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days.']",gestational day 14.5,['The six female SD rats were raised to G14.5 (middle pregnancy).'],N,[],sevoflurane,['Prenatal sevoflurane exposure causes abnormal development of the entorhinal cortex in rat offspring'],none,[],sprague dawley,"['Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days.']",This study may reveal a novel pathway in the influence mechanism of sevoflurane on rat offspring.,['This study may reveal a novel pathway in the influence mechanism of sevoflurane on rat offspring.'],None,[],Prenatal sevoflurane exposure in middle pregnancy could be potentially harmful to the neural development of rat offspring.,['Prenatal sevoflurane exposure in middle pregnancy could be potentially harmful to the neural development of rat offspring.'],None,[],None,[],True,True,True,True,True,True,10.31083/j.jin2003065 10.3892/mmr.2019.10397,1134.0,Guan,2019,rats,postnatal day 7,N,propofol,none,sprague dawley,"Molecular Medicine rePorTS 20: 1837-1845, 2019 Potential role of the cAMP/PKA/CREB signalling pathway in hypoxic preconditioning and effect on propofol‑induced neurotoxicity in the hippocampus of neonatal rats ruiconG Guan, JinG lV, Fei Xiao, YouBinG Tu, YuBo Xie and li li Department of Anaesthesiology, The First Affiliated Hospital of Guangxi Medical University, nanning, Guangxi Zhuang autonomous region 530021, P.r. china received august 23, 2018; accepted May 29, 2019 doi: 10.3892/mmr.2019.10397 Abstract. Hypoxic preconditioning (HPc) is neuroprotective against ischaemic brain injury; however, the roles of potential anti-apoptotic signals in this process have not been assessed. To elucidate the molecular mechanisms involved in HPc-induced neuroprotection, the effects of HPc on the cyclic adenosine monophosphate (caMP)/protein kinase a (PKa)/caMP response element-binding protein (creB) signalling pathway and apoptosis in Sprague-dawley pups (postnatal day 7) treated with propofol were investigated. Western blot and histological analyses demonstrated that HPc exerts multiple effects on the hippocampus, including the upregulation of caMP and phos- phorylation of creB. These effects were partially blocked by intracerebroventricular injection of the protein kinase antago- nist H89 (5 µmol/5 µl). notably, the level of cleaved caspase-3 was significantly downregulated by treatment with the cAMP agonist Sp-caMP (20 nmol/5 µl). The results indicate that propofol increased the level of cleaved caspase-3 and Bax by suppressing the activity of caMP-dependent proteins and Bcl-2; thus, HPc prevents propofol from triggering apoptosis via the caMP/PKa/creB signalling pathway. what other irreversible effects it exerts on the central nervous system (4-6). exposure to a subanaesthetic dose of propofol was demonstrated to alter long non‑coding RNA profiles in the immature mouse hippocampus (7) and cause disorders in hippocampal circuits resulting in several diseases, including alzheimer's disease and Parkinson's disease (8), while expo- sure to a high propofol dose inhibited long-term potentiation in the ca1 area of the adult hippocampus. a 100 mg/kg dose of propofol induces the expression of apoptotic proteins, including B-cell lymphoma 2-associated X and caspase-3, in Sprague-dawley pups (postnatal day 7), followed by adverse effects, such as learning and memory impairment (9-12). Therefore, it is hypothesized that neonatal rats have increased sensitivity and are more vulnerable to a 100 mg/kg dose of propofol than adult rats. Hypoxic preconditioning (HPc) is the exposure of an organ to a moderate hypoxic stimulus prior to injury (13). calcium overload (14) and overproduction of reactive oxygen species (15) have been identified by the detection of elec- trical simulation and neuronal depolarization during cellular processes in the rat hippocampus. Introduction in the last several years, the importance of propofol as a short-acting anaesthetic agent has begun to be recognized in animal models (1,2). Propofol affects GaBaa transmission and decreases glutamate transmission (3). These findings have raised questions about how extensively propofol is used and Correspondence to: Professor Yubo Xie or dr li li, department of anaesthesiology, The First affiliated Hospital of Guangxi Medical university, 6 Shyanghyong road, nanning, Guangxi Zhuang autonomous region 530021, P.r. china e-mail: xybdoctor@163.com e-mail: 3196274@qq.com HPc has long been recognized to induce neuroprotection and neuroplasticity in bone marrow stromal cells (16,17); however, the anti-apoptotic signals that mediate these processes remain unclear. To address this issue, immature male Sprague-dawley rats were exposed to HPc and propofol, either alone or in the relevant combinations. it was hypothesized that HPc increases the concentration of cyclic adenosine monophosphate (caMP) via direct phosphorylation of effector proteins and regulation of transcriptional activators or the corresponding gene tran- scription. caMP response element-binding protein (creB) is required for neuronal growth within hippocampal tissues. The role of the caMP/creB signalling pathway in intrinsic apoptosis is illustrated in Fig. 1. Materials and methods Key words: hypoxic preconditioning, propofol, hippocampus, apoptosis Rat HPC model. all animal procedures were conducted with the approval of the animal care and use committee of Guangxi Medical university (nanning, china). Seven-day-old (P7) male Sprague-dawley pups (average body weight, 10-15 g, n=70) were identified and numbered using picric acid, which 1838 Guan et al: THe caMP/PKa/creB SiGnallinG PaTHWaY decreaSeS ProPoFol-induced neuroToXiciTY Figure 1. role of the caMP/creB pathway in intrinsic apoptosis. caMP, cyclic adenosine monophosphate; creB, caMP response element-binding protein. Figure 2. Experimental workflow. were revealed to the investigator only after the completion of experiments and analyses. all pups were housed in a tempera- ture‑controlled room (22±1˚C) with a 12‑h light/dark schedule. H89 (Selleck chemicals) and Sp-caMP (Sigma-aldrich; Merck KGaa) were prepared in 5 µl double-distilled water. The experimental set-up is illustrated in Fig. 2 (n=10) and the following experimental groupings were used: i) normal saline group (nS group) received intraperitoneal injections of an equal volume of normal saline; ii) propofol group (P group) received intraperitoneal injections of 100 mg/kg propofol; iii) following the propofol treatment as in the P group, the propofol + Sp-caMP group (P+Sp-caMP group) received intracerebroventricular injections of 20 nmol/5 µl Sp-caMP (a caMP-dependent protein kinase agonist); iv) HPc+P group rats were placed in a chamber containing 8% oxygen and 92% nitrogen for 10 min, and the pups were subsequently exposed to room air for a further 10 min, and following five HPC cycles, the rats received an intraperitoneal injection of 100 mg/kg propofol; v) HPc+P +H89 group was exposed to 5 µmol/5 µl H89 [a protein kinase a (PKa) inhibitor] by intracerebroven- tricular injections, followed by the same protocol as in the HPc+P group; vi) the remaining pups in the two blank test Molecular Medicine rePorTS 20: 1837-1845, 2019 groups received intracerebroventricular injections of dimethyl sulfoxide (d-icV group) or normal saline (nS-icV group). all pups were sacrificed according to standard protocols (100 mg/kg intraperitoneal sodium pentobarbital). Brain tissue slices were prepared for immunohistochemistry and the levels of PKa, creB, phosopho (p)-creB, B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax) and caspase-3 were evaluated by western blotting. Morphological and structural changes were evaluated by haematoxylin and eosin (H&e) staining and transmission electron microscopy. Intraventricular injections. as aforementioned, rats were anesthetized with sodium pentobarbital and centralized coor- dinates of anterior fontanel (x=0, y=0, z=0) using stereotaxic apparatus (ryward life Technology co., ltd.), the sterile cannula was implanted at aP-2 mm (front and posterior), Mlr-1.5 mm (left and right of the midline), and H-2 mm (depth from the left ventricle, x=-1.0 mm, y=2 mm, z=0). after positioning, the skull was drilled, and then Sp-caMP (5 µl) or H89 (5 µl) was slowly injected at rate of 0.1 µl/min. The blank groups following the same protocol with an equal volume of dMSo or normal saline. ELISA. The intracellular concentrations of adenylyl cyclase in the pups was determined by eliSa according to the instruc- tions of the assay manufacturer (cat. no. S0026; Beyotime institute of Biotechnology). sections were dewaxed in xylene for 15 min and rehydrated using graded ethanol. The sections were immersed in haema- toxylin for 30 sec and then subjected to antigen retrieval using 0.01 mol/l sodium citrate and incubated with 10% normal goat serum at room temperature for 30 min to block nonspecific binding, followed by incubation with the primary antibodies against PKa c and p -creB (cat. nos. 5842S and 9198S, 1:1,000; Cell Signaling Technology, Inc.) at 4˚C overnight. The sections were incubated with streptavidin-horseradish peroxidase at room temperature for 30 min and then stained with 0.05% 3,3-diaminobenzidine substrate, followed by counterstaining with 1% haematoxylin at 37˚C for 30 sec. The sections were observed using a microscope (olympus BX53; Olympus Corporation) and four fields of the hippocampus were randomly selected in every section which represented the areas of interest and the positive cells were counted using image-Pro Plus version 6.0 software (Media cybernetics inc.). Electron microscopy. The ultrastructures of neurocytes were observed by transmission electron microscopy (HiTacHi H‑7650; Hitachi, Ltd.). Briefly, 2.5% glutaraldehyde solution was perfused into the rats, and the tissues were fixed in 1% oso4 at 4˚C for 1 h, dehydrated in increasing concentrations of ethanol and embedded in epon. Then, the samples were sectioned into semi-thin slices (1 µm) and stained with 1% uranyl acetate and 5% uranyl acetate at 37˚C for 20 min. The ultrastructures of the entire mitochondria were measured by manually measuring length using image Pro Plus (version 6.0.0.260, Media cybernetics, inc.). Western blot analysis. All pups were sacrificed to harvest the brain tissue. The protein was extracted by riPa lysis Buffer (Beijing Solarbio Science & Technology co., ltd.) and protein concentration measured using a bicinchoninic acid protein assay (Biotype Biotech co.). The mass of protein loaded per lane was 20 µl. equal amounts of proteins were loaded onto 12% SdS-polyacrylamide gels. electrophoresed proteins were transferred to polyvinylidene difluoride membranes (0.22‑µm pore size; eMd Millipore). The membranes were blocked using 5% bovine serum albumin (blocking buffer) for 2 h at room temperature and incubated with the following primary antibodies overnight at 4˚C: β-tubulin (1:2,000; cat. no. 48885), caspase-3 (1:1,000; cat. no. 48658) and cleaved caspase-3 (1:1,000; cat. no. 29034; all from Signalway antibody) Bcl-2 (1:1,000; cat no. ab196495; abcam), Bax (cat. no. 27727) PKa (cat. no. 5842S), creB (cat. no. 9197S) and p-creB (cat. no. 9198S) (all 1:1,000; from cell Signaling Technology, inc.), and GaPdH (1:10,000; cat. no. 10494-1-aP; Proteintech, inc.). The membranes were washed three times with Tris-buffered saline 1% Tween-20 (TBST; pH 7.4) and then incubated in horseradish peroxidase-conjugated secondary antibody (1:10,000; cat. no. 134658; li-cor Biosciences) for 2 h at room temperature (23‑25˚C) and washed three times with TBST. The bands were developed using an odyssey infrared imaging system (li-cor Biosciences) and evaluated using densitometric analysis (imageJ 1.52 h, national institutes of Health). H&E and immunohistochemical staining. Morphological and structural changes were observed by H&e staining. Tissues were fixed in 4% ice‑cold paraformaldehyde at 4˚C for 2 h and paraffin‑embedded sections were obtained. The paraffin Statistical analysis. data are presented as the mean ± standard error, and were analysed using SPSS version 17.0 (SPSS, inc.) and GraphPad Prism 5 software (GraphPad Software inc.). Multiple comparisons were performed using one-way analysis of variance (anoVa), followed by dunnett's post hoc test, as appropriate. P<0.05 was considered to indicate a statistically significant difference. Results HPC induces CREB phosphorylation and attenuates propofol‑induced neurotoxicity in neonatal rats. H&e staining revealed areas of brain cells affected by propofol, which exhibited less shrunken cell bodies and pyknotic nuclei (Fig. 3). compared with the P group, electron microscopy demonstrated that neurons were rich in mitochondria and the width of mitochondrion was decreased in the HPc+P group (F=54.44, P<0.05; Fig. 4). Treatment with H89, a PKa inhibitor, revealed expansion of the width of mitochondrion similar to the P group. HPC increases the level of cAMP and PKA, and p‑CREB‑posi‑ tive cells. The level of cAMP was significantly upregulated in the HPc + P group compared with the P group (Fig. 5). additionally, western blot analysis revealed a significant difference in PKa levels between the P group and the nS group. The expression of Bcl‑2 was significantly decreased in the pups treated with propofol; whereas, the expression of Bax and cleaved caspase‑3 was significantly increased (Fig. 6A‑D). Western blot analysis demonstrated that the level of p-creB 1839 1840 Guan et al: THe caMP/PKa/creB SiGnallinG PaTHWaY decreaSeS ProPoFol-induced neuroToXiciTY Figure 3. Haematoxylin and eosin staining of brain lesions. examination by light microscopy following a high dose injection of propofol. Histological analysis revealed normal cells in the three blank test groups (nS, nS-icV, and d-icV) and disordered cells in the P group, which exhibited different degrees of degen- eration. Furthermore, cellular degeneration in the HPC+P and P+Sp‑cAMP groups was mild. Magnification, x200. Black arrow indicates the CA1 area of the Hippocampus. nS, normal saline; icV, intracerebroventricular; d, dimethyl sulfoxide; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist. was significantly increased in the HPC+P group compared with the P group (1.050±0.083 vs. 1.400±0.111, respectively, F=15.83; P<0.05; Fig. 6e and F). The results of immuno - histochemical staining indicated that HPc and treatment with Sp-caMP (a caMP-dependent protein kinase agonist) increased the levels of PKa (F= 17.26; P<0.05; Fig. 7) and p-creB (F= 14.81; P<0.05; Fig. 8), whereas H89 abolished these effects. Propofol reduces the number of p‑CREB‑positive cells in the hippocampal CA1 region. The expression of p-creB was negatively associated with the expression of cleaved-caspase-3, and there was no significant difference in the expression of creB between the nS and nS-diV groups (Fig. 8). was consistent with the Sp-caMP treatment. Furthermore, H89 decreased the activation of p-creB following HPc compared with the HPc+P group (Fig. 8). Discussion The present findings are an extension of previous studies (18,19) to investigate the caMP/PKa/creB signalling pathway and propofol-induced apoptosis. The results of the present study revealed that p-creB promotes cell survival and long-term synaptic change. Propofol-induced intrinsic apoptosis in neonatal rats was previously reported to be mediated by Bax (20) and release of caspase-3, which are important hall- marks of apoptosis (21). Bax disrupts mitochondrial membrane potential by affecting the permeability transition pores and facilitating the release of cytochrome c (22). HPC suppresses propofol‑induced neurotoxicity via activa‑ tion of cAMP‑dependent proteins. compared with the nS group, the activities of cleaved caspase-3 were upregulated with a 2-fold change in the P group, and the levels of Bax were examined to investigate neurotoxicity following treat- ment with 100 mg/kg propofol. i n the HPc+P group, the Bcl-2 (Fig. 6) and p-creB (Fig. 8) levels in brain tissue were significantly increased compared with the P group, which PKa expression was reduced in the P group and this reduction was prevented by HPc, but not when H89 was applied. Furthermore, caMP levels were markedly increased in the HPc+P group. These data confirmed that HPc attenuates propofol-induced neuroapoptosis by altering the content of caMP in the hippocampus of rats via activation of caMP/PKa/creB signalling, a reduced Bax/Bcl-2 ratio and Molecular Medicine rePorTS 20: 1837-1845, 2019 Figure 4. Examination of the hippocampal CA1 region by transmission electron microscopy (Magnification, x15,000) following propofol‑induced apoptosis. (a) dendritic spine lesions, endoplasmic reticulum degranulated and mitochondrial swelling were observed. (B) Width of mitochondrion were measured by image Pro Plus (version 6.0.0.260), F=54.44; *P<0.05 vs. the nS group; #P<0.05 vs. the P group; &P<0.05 vs. the HPc+P group. nS, normal saline; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist; icV, intracerebroventricular; d, dimethyl sulfoxide. downregulation of caspase-driven apoptosis downstream. The relative expression of these proteins determines cell survival. caspase-3 is one of the key executors of apoptosis and a widely studied member of the caspase family. Mitochondrial outer membrane permeabilization is involved in the neuroprotective effects of HPc against propofol-induced neurotoxicity in rats. The study by Xu et al (23) revealed that HPc promotes the survival and viability of trophoblast cells. Transmission electron microscopy demonstrated that the mitochondrial outer membrane and matrix were enhanced by HPc with less degenerating vacuoles and apoptotic bodies observed. The findings indicated that pretreament with HPC reduced mitochondrial apoptosis. Figure 5. eliSa analysis of caMP content in the hippocampus of rats. F=50.58, *P<0.05 vs. the nS group; #P<0.05 vs. the P group; &P<0.05 vs. the HPc+P group. caMP, cyclic adenosine monophosphate; nS, normal saline; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist; icV, intracerebroventricular; d, dimethyl sulfoxide. neuronal cell apoptosis is associated with minor behavioural changes and cognitive dysfunction in adoles- cent rats (24). When an apoptosis signal appears, cleaved caspase-3 causes degradation of the neuron cell membrane and prevents the repair of damaged dna. HPc induces robust 1841 1842 Guan et al: THe caMP/PKa/creB SiGnallinG PaTHWaY decreaSeS ProPoFol-induced neuroToXiciTY Figure 6. activation of caMP/PKa/creB by HPc or caMP agonists reduces neuroapotosis in the developing brains of Sprague-dawley rats (n=10 per group). (a-d) representative western blots using 12% SdS-PaGe and densitometry analysis of the ratio of of Bax to β-tubulin (F=12.81), Bcl-2 (F=9.990), cleaved caspase-3 (F=7.409), PKac (F=8.366), to GaPdH. compared with the nS group, the expression of cleaved caspase-3 was increased to a 2-fold change in the P group; neonatal exposure to HPc attenuated the effect of propofol-induced apoptosis with downregulation of cleaved caspase-3. (e and F) representative western blots using 12% SdS-PaGe and densitometry analysis of the ratio of p-creB to creB (F=15.83). The results are expressed as the mean ± standard deviation. *P<0.05 vs. the nS group; #P<0.05 vs. the P group; &P<0.05 vs. the HPc+P group. nS, normal saline; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist; icV, intracerebroventricular; d, dimethyl sulfoxide; caMP, cyclic adenosine monophosphate; PKac, protein kinase a catalytic subunit; creB, caMP response element-binding protein; Bcl-2, B-cell lymphoma-2; Bax, Bcl-2-associated X protein. Molecular Medicine rePorTS 20: 1837-1845, 2019 Figure 7. Effect of propofol on PKA expression following HPC. (A) Immunohistochemical staining of PKA in the seven groups (Magnification, x100). (B) Quantification of PKA staining expressed as the mean ± standard deviation; F=17.26, *P<0.05 vs. the nS group; #P<0.05 vs. the P group; &P<0.05 vs. the HPc+P group. Black arrow indicateS PKa-positive cells. PKa, protein kinase a; nS, normal saline; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist; icV, intracerebroventricular; d, dimethyl sulfoxide. Figure 8. effect of propofol on creB following HPc. (a) immunohistochemical staining of p-creB in the seven groups (Magnification, x100). (B) Quantification of p‑CREB staining expressed as the mean ± standard deviation; F=14.81, *P<0.05 vs. the nS group; #P<0.05 vs. the P group; &P<0.05 vs. the HPc+P group. Black arrow indicateS p-creB positive cells. p, phospho; creB, caMP response element-binding protein; nS, normal saline; P, propofol; HPc, hypoxic preconditioning; Sp-caMP, cyclic adenosine monophosphate agonist; icV, intracerebroventricular; d, dimethyl sulfoxide. 1843 1844 Guan et al: THe caMP/PKa/creB SiGnallinG PaTHWaY decreaSeS ProPoFol-induced neuroToXiciTY neuroprotection in models of neonatal hypoxia (25). HPc was demonstrated to increase Bcl-2 expression and reverse the propofol-induced reduction in neuronal caMP levels. additionally, as a potent and selective PKa inhibitor for evalu- ation of PKa function in many organs, such as the brain, muscle and heart, pretreatment with H89 (26), abolished the beneficial effects of HPc, whereas pretreatment with Sp-caMP (27,28), a PKa agonist, increased the protective effects of HPc on propofol-induced hippocampal apoptosis. Whether Sp-caMP exhibits a neuronal protective effect on the hippocampus requires investigation in future experiments, since our results do not include H89 or Sp-caMP alone. notably, cellular life and death are mitigated by Bcl-2 (29), which may be correlated with the caMP/PKa/creB pathway balancing the neuronal proliferation and apoptosis, as the phosphorylation of creB promotes synaptic and neural plasticity, and Bcl-2 mediates mitochondria-induced cellular toxicity (30). The mechanism underlying the neuroprotective effect of HPC is associated with the cAMP content. The findings of the present study revealed that the apoptosis rate was significantly decreased in the HPc+P and P+Sp-caMP groups compared with the P group. Thus, HPc ameliorates propofol-induced neuroapoptosis via an increase in caMP levels and phosphory- lation of creB, which prevents caspase-3 from inducing the apoptosis of hippocampal neurons. Patient consent for publication not applicable. Competing interests The authors declare that they have no competing interests. References 1. Miner Jr and Burton JH: clinical practice advisory: emergency department procedural sedation with propofol. ann emerg Med 50: 182-187, 187.e1, 2007. 2. Vasileiou i, Xanthos T, Koudouna e, Perrea d , Klonaris c, Katsargyris a and Papadimitriou l: Propofol: a review of its non-anaesthetic effects. eur J Pharmacol 605: 1-8, 2009. 3. Wang J, c ottrell J e and Kass iS: effects of desflurane and propofol on electrophysiological parameters during and recovery after hypoxia in rat hippocampal slice ca1 pyramidal cells. neuroscience 160: 140-148, 2009. 4. creeley c, dikranian K, d issen G, Martin l , olney J and Brambrink a: Propofol-induced apoptosis of neurones and oligodendrocytes in fetal and neonatal rhesus macaque brain. Br J anaesth 110 (Suppl 1): i29-i38, 2013. 5. Ko HM, Kim SY, Joo SH, cheong JH, Yang Si, Shin cY and Koo Bn: Synergistic activation of lipopolysaccharide-stimulated glial cells by propofol. Biochem Biophys res commun 438: 420-426, 2013. 6. Sun Wc and Pei l: rno-mir-665 targets Bcl2l1 (Bcl-xl) and increases vulnerability to propofol in developing astrocytes. J neurochem 138: 233-242, 2016. Acknowledgements not applicable. 7. logan S, Jiang c , Yan Y, i nagaki Y, a rzua T and Bai X: Propofol alters long non‑coding RNA profiles in the neonatal mouse hippocampus: implication of novel mechanisms in anesthetic-induced developmental neurotoxicity. cell Physiol Biochem 49: 2496-2510, 2018. Funding The present study was supported by the national natural Science Foundation of china (grant nos. 81373498 and 81060277), the Guangxi Key research and development Program (grant no. aB18221031), the Science Study and Technology d evelopment Program of Guangxi (grant no. 1355005-4-2), and the Science and Technology research Project of Guangxi university (grant no. 2013Zd014). 8. Heckman Pra, Blokland a, Bollen ePP and Prickaerts J: Phosphodiesterase inhibition and modulation of corticostriatal and hippocampal circuits: clinical overview and translational considerations. neurosci Biobehav rev 87: 233-254, 2018. 9. Zhang S, liang Z, Sun W and Pei l: repeated propofol anesthesia induced downregulation of hippocampal mir-132 and learning and memory impairment of rats. Brain res 1670: 156-164, 2017. 10. Kajimoto M, atkinson dB, ledee dr, Kayser eB, Morgan PG, Sedensky MM, isern nG, des rosiers c and Portman Ma: Propofol compared with isoflurane inhibits mitochondrial metabolism in immature swine cerebral cortex. J cereb Blood Flow Metab 34: 514-521, 2014. Availability of data and materials The datasets used during the present study are available from the corresponding author upon reasonable request. 11. cui Y, l ing-Shan G, Yi l, Xing-Qi W, Xue -Mei Z and Xiao-Xing Y: repeated administration of propofol upregulated the expression of c-Fos and cleaved-caspase-3 proteins in the developing mouse brain. indian J Pharmacol 43: 648-651, 2011. 12. lv J, liang Y, Tu Y, chen J and Xie Y: Hypoxic preconditioning reduces propofol-induced neuroapoptosis via regulation of Bcl-2 and Bax and downregulation of activated caspase-3 in the hippo- campus of neonatal rats. neurol res 40: 767-773, 2018. Authors' contributions YX was responsible for the conception and design of the study. YX, rG, Jl, YT and FX conducted the experiments. ll analysed the data, rG drafted the work and revised it critically for impor- tant intellectual content. all authors have read and approved the final manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved. 13. Baillieul S, chacaroun S, doutreleau S, detante o, Pépin Jl and Verges S: Hypoxic conditioning and the central nervous system: a new therapeutic opportunity for brain and spinal cord injuries? exp Biol Med (Maywood) 242: 1198-1206, 2017. 14. okuda S, Sufu- Shimizu Y, Kato T, Fukuda M, n ishimura S, oda T, Kobayashi S, Yamamoto T, Morimoto S and Yano M: caMKii-mediated phosphorylation of ryr2 plays a crucial role in aberrant ca2+ release as an arrhythmogenic substrate in cardiac troponin T-related familial hypertrophic cardiomy- opathy. Biochem Biophys res commun 496: 1250-1256, 2018. 15. liang c , d u F, c ang J and Xue Z: Pink1 attenuates propofol-induced apoptosis and oxidative stress in developing neurons. J anesth 32: 62-69, 2018. Ethics approval and consent to participate all animal procedures were conducted with the approval of the animal care and use committee of Guangxi Medical university (nanning, china). 16. Wei ZZ, Zhu YB, Zhang JY, Mccrary Mr, Wang S, Zhang YB, Yu SP and Wei l: Priming of the cells: Hypoxic preconditioning for stem cell therapy. chin Med J (engl) 130: 2361-2374, 2017. 17. Tsui YP, Mung aK, chan YS, Shum dK and Shea GK: Hypoxic preconditioning of marrow-derived progenitor cells as a source for the generation of mature schwann cells. J Vis exp: Jun 14, 2017. doi: 10.3791/55794. Molecular Medicine rePorTS 20: 1837-1845, 2019 18. lv J, Wei Y, chen Y, Zhang X, Gong Z, Jiang Y, Gong Q, Zhou l, Wang H and Xie Y: dexmedetomidine attenuates propofol-induce neuroapoptosis partly via the activation of the Pi3k/akt/GSK3β pathway in the hippocampus of neonatal rats. environ Toxicol Pharmacol 52: 121-128, 2017. 19. Zhong Y, liang Y, chen J, li l, Qin Y, Guan e, He d, Wei Y, Xie Y and Xiao Q: Propofol inhibits proliferation and induces neuroapoptosis of hippocampal neurons in vitro via downregula- tion of nF-κB p65 and Bcl-2 and upregulation of caspase-3. cell Biochem Funct 32: 720-729, 2014. 20. Galluzzi l and Vanpouille-Box c: BaX and BaK at the gates of innate immunity. Trends cell Biol 28: 343-345, 2018. 21. rahmani M, n kwocha J, Hawkins e , Pei X, Parker re , Kmieciak M, leverson Jd, Sampath d, Ferreira-Gonzalez a and Grant S: cotargeting Bcl-2 and Pi3K induces BaX-dependent mitochondrial apoptosis in a Ml cells. c ancer res 78: 3075-3086, 2018. 22. Ma ZW and l iu dX: Humanin decreases mitochondrial membrane permeability by inhibiting the membrane association and oligomerization of Bax and Bid proteins. acta Pharmacol Sin 39: 1012-1021, 2018. 25. Stetler ra, leak rK, Gan Y, li P, Zhang F, Hu X, Jing Z, chen J, Zigmond MJ and Gao Y: Preconditioning provides neuro- protection in models of cnS disease: Paradigms and clinical significance. Prog neurobiol 114: 58-83, 2014. 26. Bao d, Zhao W, dai c, Wan H and cao Y: H89 dihydrochloride hydrate and calphostin c lower the body temperature through TrPV1. Mol Med rep 17: 1599-1608, 2018. 27. Yoo SB, l ee S, l ee JY, Kim BT, l ee JH and Jahng JW : caMP/PKa agonist restores the fasting-induced down-regula- tion of nnoS expression in the paraventricular nucleus. Korean J Physiol Pharmacol 16: 333-337, 2012. 28. laycock JF, Hubbard Ji, Schwartz JH, Stanton Ba and Valtin H: The caMP agonist Sp-caMPS stimulates osmotic water trans- port across rat inner medullary collecting duct cells. ann n Y acad Sci 689: 606-608, 1993. 29. Singh r, letai a and Sarosiek K: regulation of apoptosis in health and disease: The balancing act of Bcl-2 family proteins. nat rev Mol cell Biol 20: 175-193, 2019. 30. lonze Be and Ginty dd: Function and regulation of creB family transcription factors in the nervous system. neuron 35: 605-623, 2002. 23. Xu c, li X, Guo P and Wang J: Hypoxia -induced activation of JaK/STaT3 signaling pathway promotes trophoblast cell viability and angiogenesis in preeclampsia. Med Sci Monit 23: 4909-4917, 2017. 24. Karen T, Schlager GW, Bendix i, Sifringer M, Herrmann r, Pantazis c, enot d, Keller M, Kerner T and Felderhoff-Mueser u: effect of propofol in the immature rat brain on short- and long-term neurodevelopmental outcome. PloS one 8: e64480, 2013. This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) License. 1845",rats,['the effects of HPc on the cyclic adenosine monophosphate (caMP)/protein kinase a (PKa)/caMP response element-binding protein (creB) signalling pathway and apoptosis in Sprague-dawley pups (postnatal day 7) treated with propofol were investigated.'],postnatal day 7,['the effects of HPc on the cyclic adenosine monophosphate (caMP)/protein kinase a (PKa)/caMP response element-binding protein (creB) signalling pathway and apoptosis in Sprague-dawley pups (postnatal day 7) treated with propofol were investigated.'],N,[],propofol,['the effects of HPc on the cyclic adenosine monophosphate (caMP)/protein kinase a (PKa)/caMP response element-binding protein (creB) signalling pathway and apoptosis in Sprague-dawley pups (postnatal day 7) treated with propofol were investigated.'],none,[],sprague dawley,['the effects of HPc on the cyclic adenosine monophosphate (caMP)/protein kinase a (PKa)/caMP response element-binding protein (creB) signalling pathway and apoptosis in Sprague-dawley pups (postnatal day 7) treated with propofol were investigated.'],"The study addresses the role of the cAMP/PKA/CREB signalling pathway in hypoxic preconditioning and its effect on propofol-induced neurotoxicity in neonatal rats, which has not been fully assessed before.","['Hypoxic preconditioning (HPc) is neuroprotective against ischaemic brain injury; however, the roles of potential anti-apoptotic signals in this process have not been assessed.']",None,[],"The findings suggest that hypoxic preconditioning prevents propofol-induced apoptosis via the cAMP/PKA/CREB signalling pathway, indicating a potential neuroprotective strategy against propofol-induced neurotoxicity.","['The results indicate that propofol increased the level of cleaved caspase-3 and Bax by suppressing the activity of caMP-dependent proteins and Bcl-2; thus, HPc prevents propofol from triggering apoptosis via the caMP/PKa/creB signalling pathway.']",None,[],"The research findings could lead to the development of strategies for neuroprotection against propofol-induced neurotoxicity in neonatal rats, potentially applicable in clinical settings to safeguard the developing brain.","['The results indicate that propofol increased the level of cleaved caspase-3 and Bax by suppressing the activity of caMP-dependent proteins and Bcl-2; thus, HPc prevents propofol from triggering apoptosis via the caMP/PKa/creB signalling pathway.']",True,True,True,True,True,True,10.3892/mmr.2019.10397 10.3892/mmr.2014.2751,623.0,Han,2015,mice,postnatal day 7,N,sevoflurane,none,c57bl/6,"226 MOLECULAR MEDICINE REPORTS 11: 226-230, 2015 Single sevoflurane exposure increases methyl‑CpG island binding protein 2 phosphorylation in the hippocampus of developing mice XIAO‑DAN HAN, MIN LI, XIAO‑GUANG ZHANG, ZHANG‑GANG XUE and JING CANG Department of Anesthesia, Zhongshan Hospital, Fudan University, Shanghai 200032, P.R. China Received December 16, 2013; Accepted June 9, 2014 DOI: 10.3892/mmr.2014.2751 Abstract. Sevoflurane is an inhaled anesthetic that is widely used in clinical practice, particularly for pediatric anesthesia. Previous studies have suggested that sevoflurane may induce neurotoxicity in the brains of neonatal mice. In the present study, the possible mechanism of neurodegeneration induced by sevoflurane in the developing brain, and the possibility that memantine treatment is able to reverse this phenomenon, were investigated. On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine. Methyl‑CpG island binding protein 2 (MeCP2), cAMP response element‑binding protein (CREB) and brain‑derived neurotrophic factor (BDNF) expression in the hippocampus was measured by western blotting. Exposure to 1.5% sevoflurane resulted in increased MeCP2 phosphorylation in the hippocampus, which was reversed by memantine injection. However, neither CREB phosphorylation nor BDNF expression were significantly altered by sevoflurane treatment. The current study indicated that sevoflurane causes neurotoxicity in the developing brain, and that this may be attributed to increased MeCP2 phosphor- ylation in the hippocampus. It was also demonstrated that this neurotoxicity can be prevented by the N‑methyl‑D‑aspartate glutamate receptor inhibitor memantine. Introduction persistent learning deficits (1,2). Loepke et al (3) observed that isoflurane led to apoptotic neurodegeneration, and Head et al (4) elucidated the relevant signaling pathways. Satomoto et al (5) demonstrated that exposing neonatal mice to sevoflurane results in learning deficits, in addition to autism‑like abnormal social behavior. These studies together demonstrate that sevoflurane is harmful to the developing brain. Methyl‑CpG island binding protein 2 (MeCP2) is a transcriptional repressor and is important in neuron matura- tion and normal brain function (6). Studies have suggested that MeCP2 is closely associated with NMDA receptors in the brain (7,8). MeCP2 is a nuclear protein that selectively binds methylated DNA, then recruits other proteins to form an inhibition complex, thereby inhibiting the expression of various genes (9,10). MeCP2 gene mutations can cause the neurodevelopmental disorder Rett syndrome (11), which can lead to cognitive impairment, motor disability and repetitive stereotyped hand movements. Up to 80% of those affected with Rett syndrome experience seizures. A number of studies have hypothesized that these symptoms may be due to defects in experience‑dependent synapse maturation (12,13), where normal synapse connections fail to establish in the critical period. These studies have demonstrated that MeCP2 is critical in the maturation of the nervous system and the normal functioning of nerve cells. Sevoflurane is widely used in the clinic, particularly in pediatric anesthesia. However, infants brains are at a stage at which important changes are occurring, including synapse formation and axon and dendrite growth; this renders them strongly susceptible to environmental influences, such as general anesthetics. A number of studies have demonstrated that early exposure to a variety of anesthetics can cause widespread neurodegeneration in the developing brain and cAMP response element‑binding protein (CREB) is a nuclear regulatory factor that may regulate gene transcrip- tion following phosphorylation of serine 133, thus enhancing the expression of multiple target genes. One study indicated that CREB is the major transcription regulatory factor of brain‑derived neurotrophic factor (BDNF), and thus increases BDNF expression. This is a crucial process in the survival and differentiation of neurons (14). Another study demonstrated that isoflurane anesthesia induces neuronal apoptosis by affecting the formation of neuronal synapses in the develop- mental stages, potentially via the BDNF‑p75‑RhoA signaling pathway (4). Correspondence to: Dr Jing Cang, Department of Anesthesia, Building 10, Zhongshan Hospital, Fudan University, 180 Fenglin Road, Shanghai 200032, P.R. China E‑mail: cangj_jcang@163.com Key words: sevoflurane, neurotoxicity, P7 mice, MeCP2, memantine, hippocampus Memantine is a derivative of amantadine, and acts on the glutamatergic system by inhibiting NMDA receptors. It is involved in neuroprotection and acts to preserve normal synaptic function. It is approved for use in moderate‑to‑severe Alzheimer's disease, by the FDA and the European Medicines Agency, and has been demonstrated to produce positive effects on cognition, mood and behavior (15,16). HAN et al: SINGLE SEVOFLURANE EXPOSURE INCREASES MECP2 PHOSPHORYLATION To investigate the molecular mechanism of neurodegen- eration induced by sevoflurane, neonatal mice were exposed to sevoflurane and the protein expression levels of CREB and BDNF were assessed in the developing hippocampus. Protein expression levels of MeCP2 and the effect of pre‑injected memantine were also examined, in order to determine whether memantine is able to reverse the neurodegeneration. Materials and methods Animals and sevoflurane exposure. All animal experiments were performed using protocols approved by the institutional animal use and care committee of the Zhongshan Hospital, Fudan University (Shanghai, China). At postnatal day 7 (P7), male C57BL/6 mice (weight, 3‑5 g; Shanghai Laboratory Animal Center, Shanghai, China) were randomly divided into a sevoflurane‑treated group (n=6) and an air‑treated control group (n=6) for analysis of the effects of sevoflurane on CREB phosphorylation, BDNF expression and MeCP2 phosphorylation levels. Mice were placed in a plastic container and continuously exposed to 1.5% sevoflurane (Maruishi Pharmaceutical Co., Osaka, Japan) in air, or to air alone for 2 h, with a gas flow of 2 l/min. For further experiments, male C57BL/6 mice at postnatal day 7 (P7) were randomly divided into four groups: The sevoflurane‑saline group (sevo group, n=7); the air‑saline group (control group, n=6); the sevoflurane‑memantine group (sevo+mem group, n=7); and the air‑memantine group (mem group, n=6). Mice received 1 mg/kg saline or memantine intraperitoneally prior to sevo- flurane or air treatment. The mice were then placed in a plastic container and continuously exposed to 1.5% sevoflurane in air or to air alone for 2 h, with a gas flow of 2 l/min. During expo- sure to sevoflurane or air, the container was heated to 37˚C with a heating pad. The concentrations of sevoflurane, oxygen and carbon dioxide in the container were monitored with a gas monitor (Datex Cardiocap Ⅱ, Datex‑Ohmeda, Madison, WI, USA). Following exposure to sevoflurane or air, the mice were returned to their cages. The mice were housed six per cage and maintained on a 12 h light/dark cycle with access to food and water ad libitum. Two hours post‑exposure the mice were sacrificed by decapitation, and their hippocampi were removed. Sodium dodecyl sulphate (SDS) was added to the samples prior to boiling for 10 min at 100˚C. Equal quantities of protein (15 µg) were used to detect the expression of the proteins of interest. Samples were electrophoresed on 10 or 15% SDS polyacrylamide gel, blotted onto polyvinylidine fluoride membranes (Bio‑Rad Laboratories, Hercules, CA, USA) and then incubated with the following antibodies overnight at 4˚C: Anti‑phospho‑CREB (ser133), (cat no. 06‑519, EMD Millipore, Billerica, MA, USA) 1:4,000 dilution in 5% non‑fat milk; anti‑CREB (cat no. MAB5432, Millipore) 1:5,000 dilution in 5% non‑fat milk; anti‑BDNF (cat no. AB1779SP, Millipore) 1:1,000 dilution in 5% non‑fat milk; anti‑MeCP2 (cat no. 3456P, Cell Signaling Technology, Danvers, MA, USA) 1:4,000 dilution in 5% non‑fat milk; anti‑phospho‑MeCP2‑S421 (cat no. AP3693a, Abgent Biotech, Suzhou, China) 1:2,000 dilution in 5% non‑fat milk); and anti‑actin (cat no. A5441, Sigma‑Aldrich, St. Louis, MO, USA) 1:10,000 dilution in 5% non‑fat milk. The following day, the blots were incubated for 1 h at room temperature with horseradish peroxidase‑conjugated secondary goat anti‑rabbit or goat anti‑mouse immunoglob- ulin G (Kangchen, Shanghai, China), 1:5,000 dilution in 5% non‑fat milk. Immunoreactive bands were visualized using Amersham ECL Prime Western Blotting Detection kit (cat NO.RPN2232; GE Healthcare, Chalfont St. Giles, UK). The protein signals were quantified using Quantity One software and a GS‑800 Calibrated Imaging Densitometer (Bio‑Rad Laboratories) and normalized to a corresponding internal reference: CREB for the exression of p‑CREB‑S133, MeCP2 for P‑MeCP2‑S421 and actin for BDNF. Statistical analysis. All data are presented as the mean ± stan- dard error. Data were analyzed using the unpaired Student's t‑test in Origin software, version 7.5 (OriginLab, Northampton, MA, USA). P<0.05 was considered to represent a statistically significant difference. Results Arterial blood gas analyses. Arterial blood samples were obtained from the left cardiac ventricle of the mice immedi- ately after exposure to sevoflurane, and were transferred to heparinized glass capillary tubes. Blood pH, partial pressure of carbon dioxide in mmHg (PaCO2), partial pressure of oxygen in mmHg (PaO2), lactate (Lac), and bicarbonate (HCO3) were analyzed immediately after blood collection using a GEM Premier 3000 analyzer (Instrumentation Laboratory, Lexington, MA, USA). Protein extraction and western blot analysis. Resected hippocampi were placed into 1.5‑ml centrifuge tubes and preserved in liquid nitrogen. All methods were conducted on ice. An NE‑PER Nuclear and Cytoplasmic Extraction kit (cat no.78835; Thermo Fisher Scientific, Waltham, MA, USA) was used to extract protein samples. All steps were conducted according to the manufacturer's instructions. Sevoflurane does not induce metabolic or respiratory dete- rioration. Blood gas analyses indicated that there was no deterioration in respiration or metabolism in the animals following a 2‑h sevoflurane exposure. All parameters were tested, including PH, PaCO2, PaO2, oxygen saturation, Lac and HCO3. No significant differences in any of the parameters were detected between the sevoflurane and the control group (P>0.05; Table I). Sevoflurane does not cause changes in CREB phosphoryla- tion and BDNF expression in the hippocampus. Western blot analyses of hippocampal CREB phosphorylation and BDNF expression levels were performed 2 h following exposure to sevoflurane or air. The results indicated that there were no significant differences in levels of CREB phosphorylation (Fig. 1) and BDNF (Fig. 2) expression between the sevoflu- rane‑treated (n=6) and air‑treated (n=6) groups. Sevoflurane treatment increases MeCP2 phosphorylation at the serine 421 loci in the hippocampus. Western blot analyses of hippocampal MeCP2 phosphorylation in the 227 228 MOLECULAR MEDICINE REPORTS 11: 226-230, 2015 Table I. Arterial blood gas analysis. Arterial blood gas Control (n=6) Sevoflurane (n=6) pH PaCO2 (mmHg) PaO2 (mmHg) SaO2 (%) Lac (mmol/l) HCO3 (mmol/l) 7.4±0.05 28.4±3.0 91.0±6.8 93.6±2.6 1.1±0.5 23.8±1.6 7.38±0.04 30.1±4.0 88.8±5.6 92.7±2.5 1.2±0.4 24.1±1.5 Exposure to sevoflurane did not induce significant metabolic or respiratory impairment. Analysis of arterial blood gas revealed no significant differences in any of the measured parameters between the sevoflurane group and the control one (t‑test, P>0.05). Pa, partial pressure; Sa, saturation. Figure 3. Sevofl urane treatment leads to a signifi cant increase in hippo‑ 3. Sevoflurane treatment leads to a significant increase in hippo- campal P‑MeCP2‑S421 expression levels. *P<0.05, sevoflurane‑treated group vs. control group at P7. MeCP2, methyl‑CpG island binding protein 2. Figure 1. Sevoflurane treatment did not cause significant changes in hip- pocampal CREB phosphorylation in mouse hippocampi at postnatal day 7. P>0.05, sevoflurane group (n=6) vs. the control group (n=6). CREB, cAMP response element‑binding protein. Figure 4. Memantine treatment results in normalized P‑MeCP2‑S421 expres- sion levels following sevoflurane treatment. Sevoflurane‑treated (n=7) mice exhibited a significant increase in hippocampal P‑MeCP2‑S421 expression levels (*P<0.05 vs. control group, n=6). The sevo + mem group (n=7) exhib- ited a significant decrease in hippocampal P‑MeCP2‑S421 expression levels (*P<0.05 vs. sevo group). Significantly different levels of P‑MeCP2‑S421 expression were not identified in the mem group (n=6) when compared with the control group (n=6) (P>0.05). MeCP2, methyl‑CpG island binding protein 2. Figure 2. Sevoflurane treatment did not cause significant changes in hip- pocampal BDNF expression levels in mouse hippocampi at postnatal day 7. P>0.05, sevoflurane group (n=6) vs. control group (n=6). BDNF, brain‑derived neurotrophic factor. sevoflurane‑treated and control groups were performed 2 h following exposure to sevoflurane or air. The results indi- cated that sevoflurane‑treated mice exhibited an increase in hippocampal MeCP2 phosphorylation at serine 421 loci (P‑MeCP2‑S421), compared with phosphorylation in the hippocampi of the control mice. There expression level of P‑MeCP2‑S421 was increased in the sevoflurane‑treated group (n=6) compared with the control group(n=6) (P<0.05; Fig. 3). Sevoflurane increases the MeCP2 phosphorylation at the serine 421 loci in the hippocampus, and pre‑injection of memantine reverses this phenomenon. Western blot analyses of hippocampal MeCP2 phosphorylation were performed 2 h following exposure to sevoflurane or air. Compared with the control group (air and saline, n=6), the sevo group (sevoflurane HAN et al: SINGLE SEVOFLURANE EXPOSURE INCREASES MECP2 PHOSPHORYLATION and saline, n=7) exhibited a significant increase in hippo- campal P‑MeCP2‑S421 expression levels (P<0.05; Fig. 4). Compared with the sevo group, the sevo+mem group exhib- ited a significant decrease in hippocampal P‑MeCP2‑S421 levels (P<0.05; Fig. 4). No significant difference was detected between the mem group (memantine and saline, n=6) and the control group (n=6). for synaptic NMDA receptors than extrasynaptic NMDA receptors. Thus, it exhibits an important role in neuroprotec- tion, while preserving normal synaptic function (26). In the present study, memantine was able to reverse the increase in MeCP2 phosphorylation in the hippocampus following sevoflurane exposure. This demonstrates that memantine may have a protective effect against neurodegeneration induced by sevoflurane exposure. Discussion In the present study, it was demonstrated that P‑MeCP2‑S421 expression levels in hippocampi resected at P7 increased in mice exposed to 1.5% sevoflurane for 2 h, and that meman- tine pre‑injection was able to reverse this increase. However, sevoflurane did not cause significant changes in CREB phos- phorylation and BDNF expression levels in the hippocampus. A dose of 1.5% sevoflurane, which did not inhibit respira- tion and circulation in mouse pups, was selected for the current study. Arterial blood analyses confirmed that none of the mice experienced hypoxemia or hypercapnia during the 2‑h sevoflurane exposure; there were no significant differences in any of the tested parameters between the sevoflurane group and the control group. These results exclude the possibility of hypoxemia and hypercapnia affecting the outcome of the following experiments. In conclusion, the results of the present study demonstrated that P‑MeCP2‑S421 expression levels in the hippocampus increased in P7 mice exposed to 1.5% sevoflurane for 2 h, and pre‑injected memantine reversed this increase. Sevoflurane did not cause changes in CREB phosphorylation or BDNF expression levels in the hippocampus. Future investigation of MeCP2 and NMDA receptors is required in order to further investigate their effects on the central nervous system during its development. Acknowledgements The current study was supported by grants from the National Natural Science Foundation of China (grant no. 81100796). References A previous study demonstrated that early exposure to sevoflurane causes widespread neurodegeneration in the developing brain (17). However, the exact mechanism of action underlying the effect of sevoflurane remains unknown. The results of the present study may provide a possible explana- tion for sevoflurane‑mediated neurodegeneration, as they suggested that MeCP2 may be important in neuronal degen- eration following neonatal sevoflurane exposure. The γ‑a m inobutyr ic acid type A (GA BA) and N‑methyl‑D‑aspartate glutamate (NMDA) receptors are essential for the development of an ordered neural map (18,19), and are important in the alteration of synaptic transmis- sion. Neurotransmitters or compounds that act on them may contribute to the impairment of brain development and synaptogenesis (20,21). MeCP2 links closely with NMDA receptors in the brain, and NMDA receptors (particularly NR2A) are essential for visual cortical function in the absence of MeCP2 (22). The activity‑dependent expression of another NMDA subunit (NR2B) is mediated by MeCP2‑dependent epigenetic regulation (23). Thus, as indicated in the present study, MeCP2 may regulate NMDA receptors, leading to various effects on brain function in mice. MeCP2 phos- phorylation at serine 421 loci is a key signal, which may cause downstream changes in the signaling pathway and influence the central nervous system. Previous studies indicated that CDKL5 is a target of MeCP2 in the brain, and is regulated by DNA methylation (24). MeCP2 can also interact with some microRNAs to regulate brain function (25). Further study of these aspects is required in order to figure out whether and how microRNAs are involved in the regulation of neuroplas- ticity in the brain. 1. Jevtovic‑Todorovic V, Hartman RE, Izumi Y, et al: Early exposure to common anesthetic agents causes widespread neurodegen- eration in the developing rat brain and persistent learning deficits. J Neurosci 23: 876‑882, 2003. 2. Liang G, Ward C, Peng J, Zhao Y, Huang B and Wei H: Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 112: 1325‑1334, 2010. 3. Loepke AW, Istaphanous GK, McAuliffe JR, et al: The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and memory. Anesth Analg 108: 90‑104, 2009. 4. Head BP, Patel HH, Niesman IR, Drummond JC, Roth DM and Patel PM: Inhibition of p75 neurotrophin receptor attenuates isoflurane‑mediated neuronal apoptosis in the neonatal central nervous system. Anesthesiology 110: 813‑825, 2009. 5. Satomoto M, Satoh Y, Terui K, et al: Neonatal exposure to sevo- flurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 110: 628‑637, 2009. 6. Kishi N and Macklis JD: MECP2 is progressively expressed in post‑migratory neurons and is involved in neuronal maturation rather than cell fate decisions. Mol Cell Neurosci 27: 306‑321, 2004. 7. Nguyen MV, Du F, Felice CA, et al: MeCP2 is critical for main- taining mature neuronal networks and global brain anatomy during late stages of postnatal brain development and in the mature adult brain. J Neurosci 32: 10021‑10034, 2012. 8. Kron M, Howell CJ, Adams IT, et al: Brain activity mapping in Mecp2 mutant mice reveals functional deficits in forebrain circuits, including key nodes in the default mode network, that are reversed with ketamine treatment. J Neurosci 32: 13860‑13872, 2012. 9. Cohen S, Gabel HW, Hemberg M, et al: Genome‑wide activity‑dependent MeCP2 phosphorylation regulates nervous system development and function. Neuron 72: 72‑85, 2011. 10. Fuks F, Hurd PJ, Wolf D, Nan X, Bird AP and Kouzarides T: The methyl‑CpG‑binding protein MeCP2 links DNA methylation to histone methylation. J Biol Chem 278: 4035‑4040, 2003. 11. Bienvenu T and Chelly J: Molecular genetics of Rett syndrome: when DNA methylation goes unrecognized. Nat Rev Genet 7: 415‑426, 2006. Memantine is an amantadine derivative and NMDA receptor inhibitor. It has been used to treat Alzheimer's disease and is accepted to be safer than other NMDA receptor inhibi- tors, as a therapeutic dose of memantine has a greater affinity 12. Zhou Z, Hong EJ, Cohen S, et al: Brain‑specific phosphorylation of MeCP2 regulates activity‑dependent Bdnf transcription, dendritic growth, and spine maturation. Neuron 52: 255‑269, 2006. 13. Li H, Zhong X, Chau KF, Williams EC and Chang Q: Loss of activity‑induced phosphorylation of MeCP2 enhances synapto- genesis, LTP and spatial memory. Nat Neurosci 14: 1001‑1008, 2011. 229 230 MOLECULAR MEDICINE REPORTS 11: 226-230, 2015 14. Tao X, Finkbeiner S, Arnold DB, Shaywitz AJ and Greenberg ME: Ca2+ influx regulates BDNF transcription by a CREB family transcription factor‑dependent mechanism. Neuron 20: 709‑726, 1998. 21. Yon JH, Daniel‑Johnson J, Carter LB and Jevtovic‑Todorovic V: Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience 135: 815‑827, 2005. 15. Areosa Sastre ASF and McShane R: Memantine for dementia. The Cochrane Library. 2006. 16. Mount C and Downton C: Alzheimer disease: progress or profit? Nat Med 12: 780‑784, 2006. 17. Zhang X, Xue Z and Sun A: Subclinical concentration of sevo- flurane potentiates neuronal apoptosis in the developing C57BL/6 mouse brain. Neurosci Lett 447: 109‑114, 2008. 22. Durand S, Patrizi A, Quast KB, et al: NMDA receptor regulation prevents regression of visual cortical function in the absence of Mecp2. Neuron 76: 1078‑1090, 2012. 23. Lee S, Kim W, Ham BJ, Chen W, Bear MF and Yoon BJ: Activity‑dependent N R2B expression is mediated by MeCP2‑dependent epigenetic regulation. Biochem Biophys Res Commun 377: 930‑934, 2008. 18. Simon DK, Prusky GT, O'Leary DD and Constantine‑Paton M: N‑methyl‑D‑aspartate receptor antagonists disrupt the formation of a mammalian neural map. Proc Natl Acad Sci USA 89: 10593‑10597, 1992. 19. Hardingham GE, Fukunaga Y and Bading H: Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut‑off and cell death pathways. Nat Neurosci 5: 405‑414, 2002. 20. Johnson SA, Young C and Olney JW: Isoflurane‑induced neuro- apoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 20: 21‑28, 2008. 24. Carouge D, Host L, Aunis D, Zwiller J and Anglard P: CDKL5 is a brain MeCP2 target gene regulated by DNA methylation. Neurobiol Dis 38: 414‑424, 2010. 25. Im HI, Hollander JA, Bali P and Kenny PJ: MeCP2 controls BDNF expression and cocaine intake through homeostatic inter- actions with microRNA‑212. Nat Neurosci 13: 1120‑1127, 2010. 26. Xia P, Chen HS, Zhang D and Lipton SA: Memantine prefer- entially blocks extrasynaptic over synaptic NMDA receptor currents in hippocampal autapses. J Neurosci 30: 11246‑11250, 2010.",mice,['On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine.'],postnatal day 7,['On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine.'],N,[],sevoflurane,['On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine.'],memantine,['On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine.'],c57bl/6,['On postnatal day 7 (P7) C57BL/6 mice were continuously exposed to 1.5% sevoflurane for 2 h following pre‑injection of saline or memantine.'],The study investigates the mechanism of neurodegeneration induced by sevoflurane in the developing brain and explores memantine's potential to reverse this phenomenon.,"['In the present study, the possible mechanism of neurodegeneration induced by sevoflurane in the developing brain, and the possibility that memantine treatment is able to reverse this phenomenon, were investigated.']",None,[],"The study demonstrates the neurotoxic effects of sevoflurane on the developing brain, attributed to increased MeCP2 phosphorylation, and suggests memantine as a preventive treatment.","['The current study indicated that sevoflurane causes neurotoxicity in the developing brain, and that this may be attributed to increased MeCP2 phosphor- ylation in the hippocampus. It was also demonstrated that this neurotoxicity can be prevented by the N‑methyl‑D‑aspartate glutamate receptor inhibitor memantine.']",None,[],Memantine may have a protective effect against neurodegeneration induced by sevoflurane exposure in the developing brain.,['This demonstrates that memantine may have a protective effect against neurodegeneration induced by sevoflurane exposure.'],True,True,True,True,False,True,10.3892/mmr.2014.2751 10.1016/j.ntt.2020.106890,520.0,Burks,2020,rats,postnatal day 7,N,sevoflurane,none,sprague dawley,"Neurotoxicology and Teratology 80 (2020) 106890 Contents lists available at ScienceDirect Neurotoxicology and Teratology journal homepage: www.elsevier.com/locate/neutera Regions of the basal ganglia and primary olfactory system are most sensitive to neurodegeneration after extended sevoflurane anesthesia in the perinatal rat ☆ T Susan M. Burks, John F. Bowyer, Jennifer L. Walters, John C. Talpos ⁎ National Center for Toxicological Research, 3900 NCTR Rd, Jefferson, AR 72079, United States of America A R T I C L E I N F O A B S T R A C T Keywords: Neurotoxicity Development Fluoro-Jade Hypoxia Indusium griseum Extended general anesthesia early in life is neurotoxic in multiple species. However, little is known about the temporal progression of neurodegeneration after general anesthesia. It is also unknown if a reduction in natural cell death, or an increase in cell creation, occurs as a form of compensation after perinatal anesthesia exposure. The goal of this study was to evaluate markers of neurodegeneration and cellular division at 2, 24, or 72 h after sevoflurane (Sevo) exposure (6 h) in fully oxygenated postnatal day (PND) 7 rats. Neurodegeneration was ob- served in areas throughout the forebrain, while the largest changes (fold increase above vehicle) were observed in areas associated with either the primary olfactory learning pathways or the basal ganglia. These regions included the indusium griseum (IG, 25-fold), the posterior dorso medial hippocampal CA1 (17-fold), bed nucleus of the stria terminalis (Bed Nuclei STM, 5-fold), the shell of the nucleus accumbens (Acb, 5-fold), caudate/ putamen (CPu, 5-fold), globus pallidus (GP, 9-fold) and associated thalamic (11-fold) and cortical regions (5- fold). Sevo neurodegeneration was minimal or undetectable in the ventral tegmentum, substantia nigra, and most of the hypothalamus and frontal cortex. In most brain regions where neurodegeneration was increased 2 h post Sevo exposure, the levels returned to < 4-fold above control levels by 24 h. However, in the IG, CA1, GP, anterior thalamus, medial preoptic nucleus of the hypothalamus (MPO), anterior hypothalamic area (AHP), and the amygdaloid nuclei, neurodegeneration at 24 h was double or more than that at 2 h post exposure. Anesthesia exposure causes either a prolonged period of neurodegeneration in certain brain regions, or a distinct secondary degenerative event occurs after the initial insult. Moreover, regions most sensitive to Sevo neurodegeneration did not necessarily coincide with areas of new cell birth, and new cell birth was not consistently affected by Sevo. The profile of anesthesia related neurotoxicity changes with time, and multiple mechanisms of toxicity may exist in a time-dependent fashion. 1. Introduction Early in life, the brain of mammalian species undergoes a period of rapid growth known as the brain growth spurt (BGS) (Dobbing and Sands, 1979; Workman et al., 2013). During this time, the brain is thought to be more vulnerable to toxic insults such as general an- esthesia exposure (Eriksson, 1997; Ikonomidou, 2009; Rice and Barone, 2000). Anesthesia related neurotoxicity in animal models of human neonatal brain development was first established by Olney and collea- gues after ketamine or nitrous oxide exposure in the rat (Jevtovic- Todorovic et al., 2001). Since then, markers of neurotoxicity have been anesthetic. This reported with every FDA approved general phenomenon has been observed in multiple species including rats (Jevtovic-Todorovic et al., 2000; Scallet et al., 2004), mice (Istaphanous et al., 2011; Zheng et al., 2013b), nonhuman primates (Brambrink et al., 2010; Paule et al., 2011; Slikker Jr. et al., 2007; Talpos et al., 2019), nematodes (Gentry et al., 2013; Na et al., 2017), and zebrafish (Guo et al., 2015; Kanungo et al., 2013). The clinical relevance of these findings has been debated (Vutskits and Culley, 2019). However, sev- eral large scale retrospective studies have shown that multiple ex- posures to anesthesia within the first two years of life is associated with an increased incidence of learning disabilities and attention-deficit hyperactivity disorder (Flick et al., 2011; Sprung et al., 2012; Wilder et al., 2009), as well as an increased use of psychotropic drugs to treat a ☆ The information in these materials is not a formal dissemination of information by the Food and Drug Administration (FDA) and does not represent agency position or policy. ⁎ Corresponding author. E-mail address: John.Talpos@fda.hhs.gov (J.C. Talpos). https://doi.org/10.1016/j.ntt.2020.106890 Received 13 December 2019; Received in revised form 10 April 2020; Accepted 29 April 2020 Available online 12 May 2020 0892-0362/ Published by Elsevier Inc. S.M. Burks, et al. variety of conditions (Ing et al., 2020). It seems that early life exposure to general anesthesia increases the likelihood of individuals having cognitive differences during development (Ing and Brambrink, 2019). Perinatal anesthesia related neurotoxicity is well established in animal models of human use (Brambrink et al., 2012; Brambrink et al., 2010; Ikonomidou, 2009; Jevtovic-Todorovic et al., 2001; Paule et al., 2011; Slikker Jr. et al., 2007; Talpos et al., 2019; Walters and Paule, 2017). However, the temporal progression of this neurotoxicity has not been described. For example, the pattern of neurodegeneration (post- exposure) that develops over time and across brain regions has not been determined. Also, the temporal aspects of any “compensatory” effects that involve increased birth of new cells in the days after insult are unknown. Addressing these knowledge gaps will help in understanding the mechanisms behind anesthesia related neurotoxicity and in de- termining the clinical relevance of animal models to human perinatal anesthesia exposure. More than 100 laboratory animal studies have described the effects of prolonged anesthetic exposure to neonates in various species. While several studies evaluate toxicity in multiple brain structures (Deng et al., 2014; Lee et al., 2017; Perez-Zoghbi et al., 2017; Rizzi et al., 2008), most focus on one or two areas of interest. This makes it difficult to determine which areas of the brain are most vulnerable to anesthesia related neurotoxicity and to resolve discrepancies within the literature (Brambrink et al., 2012; Brambrink et al., 2010; Zhang et al., 2016; Zou et al., 2009). Moreover, by focusing on specific brain regions, we cannot determine if neurotoxicity is caused by anesthetic drugs acting on in- dividual cells or is the result of disrupted activity at a network level. Another obstacle in understanding the nature of anesthesia-related neurotoxicity is the focus on a single time point to assess neurodegen- eration. Most studies quantify neurodegeneration several hours after the ending of exposure. In some ways, this approach is logical as many markers of neurotoxicity, such as Fluoro-jade C (FJC) or caspase-based stains, are ephemeral in nature. However, assessing markers of toxicity at a single timepoint assumes neurodegeneration happens at the same pace and via a single mechanism throughout the brain. A lack of ap- propriate neuronal stimulation can increase apoptosis (Kilb et al., 2011; Lewin and Barde, 1996). Accordingly, a “second wave” of neurode- generation in brain regions heavily innervated by areas effected in the initial insult might be expected at later time points. Conversely, internal mechanisms to ameliorate early increases in neurodegeneration within a region may only be observable at later time points. For example, a decrease in baseline apoptosis or neurogenesis may be observed in animals exposed to anesthesia to compensate for earlier damage (Jiang et al., 2016). There may be a decrease in the number of newborn cells (neuronal or glial) in regions with high levels of neurodegeneration due to loss of neurotrophic factor(s) that would have been released by dying neurons (Lewin and Barde, 1996). It is unlikely that moments where the highest level of neurodegeneration are observed are optimal to detect endogenous compensation. Sevo is currently the most frequently used general anesthetic in humans, and its neurotoxic potential has been well described (Amrock et al., 2015; Brioni et al., 2017; Delgado-Herrera et al., 2001; Fang et al., 2012; Lerman and Johr, 2009; Pellegrini et al., 2014; Walters and Paule, 2017; Zheng et al., 2013a). Accordingly, the primary goal of this study was to determine regional and temporal patterns of acute neu- rodegeneration that occurs in the rat forebrain following perinatal an- esthesia exposure in fully oxygenated animals. To do this, PND 7 rats were exposed to Sevo (2.5% in 75% oxygen/25% nitrogen carrier gas for 6 h). Animals were sacrificed at 2, 24, or 72 h after cessation of Sevo. This enabled the determination of how markers of neurodegen- eration (FJC) differed by region and changed with time. Throughout this study our primary endpoint was on the incidence of FJC positive cells. We selected FJC because it is one of the most commonly used methods to study degenerating neurons, making it an excellent mark of neurotoxic insult. It is effective at highlighting areas of the brain that have been impacted by general anesthesia and serves to effectively 2 Neurotoxicology and Teratology 80 (2020) 106890 demonstrate areas of potential interest. However, an increased in- cidence in neurodegeneration is only one of the many changes that have been observed in the brains of animals exposed to general anesthesia early in life. Early life exposure has been shown to decrease dendritic spine densities (Briner et al., 2011), alter development of GABAeric networks (Osterop et al., 2015), influence neurogenesis (Stratmann et al., 2010), alter neurotransmitter receptor densities (Zurek et al., 2014), and induce neuroinflammation (Zheng et al., 2013a). Any one of these changes may cause the observed changes in cognition and beha- vior that have been reported. 2. Methods 2.1. Animals Pregnant Sprague-Dawley rats (Charles Rivers, USA) arrived on gestational day 5. Litters were culled to four males and four females on PND 4. A within-litter treatment design was used to evaluate the effect of Sevo. Four animals, 2 males and 2 females, were selected from each litter. One animal of each sex was randomly assigned to the Sevo group with the other being assigned to the vehicle condition. Three animals per sex were assigned to each treatment / timepoint combination (N = 72). Multiple stains were used on tissue from the same animal. Two animals were removed from the 72 h Sevo group. One animal was removed for failing to meet inclusion criteria for oxygenation (no hy- poxic animals were included in the study), and a second animal died between exposure and sacrifice. Rats were housed in a light (12 h/12 h light/dark cycle) and temperature (22 ± 2 °C) controlled vivarium and given free access to food and water (NIH41 laboratory animal diet, Envigo, Madison, WI). All animal procedures were carried out in ac- cordance with the Guide for the Care and Use of Laboratory Animals. Animal use and procedures were approved by the NCTR Institutional Animal Care and Use Committee (IACUC), which has full NIH-OLAW accreditation. Animals were housed in the NCTR facility in isolator top boxes with wooden chip bedding and ad libitum food and water. 2.2. Study design On PND 7, rats were exposed to vehicle gas alone (75% oxygen/25% nitrogen) or 2.5% Sevo (in vehicle gas) for 6 h. During anesthesia ex- posure, each pup was placed in an individual airtight acrylic chamber and the selected gas mixture was delivered at a flow rate of 0.75–1 L/ min (Walters et al., 2020). The concentration of Sevo was set using a commercial gas analyzer (Riken, USA). Surface body temperature was collected prior to and every 2 h following the start of Sevo exposure using an infrared thermometer (Micro-Epsilon, Ortenburg, Germany). Heating plates located beneath each chamber were used to maintain body temperatures at baseline levels. In addition, arterial oxygen sa- turation (SpO2), breath rate, heart rate, and pulse distention were monitored in each pup continuously using a pulse oximeter (Starr Life Sciences Corp, USA). The average SPO2 value was calculated every 30 min (Supplemental Table 1); if an individual rat's SPO2 fell below 85% during any of the 30 min intervals, it was excluded from the study. Upon recovery, the pups were removed from the chambers, rubbed with bedding material from their home cage, and returned to their dams. Control animals were treated the same as the experimental group ex- cept they were not exposed to anesthesia and there SPO2 was not monitored. Pups were sacrificed 2 h (PND 7), 24 h (PND 8), and 72 h (PND 10) after the cessation of Sevo or vehicle gas exposure. Briefly, the rats were deeply anesthetized with pentobarbital and transcardially perfused with 0.9% heparinized saline followed by 10% neutral buffered for- malin. Brains were removed and post-fixed in 10% neutral buffered formalin for 24 h, cryoprotected in 20% sucrose until they sank, and subsequently frozen on dry ice and stored at −80 °C. Tissue was cut into 30 μm thick coronal sections using a cryostat, stored in 0.08% S.M. Burks, et al. sodium azide in PBS for up to two weeks and then transferred to freezing solution (0.02 M phosphate buffer (pH 7.4) containing 25% (v/ v) glycerol and 30% (v/v) ethylene glycol) until processed for im- munohistochemistry or histology. 2.3. FJC immunolabeling For FJC labeling, a modified method (Bowyer et al., 2018b; Schmued et al., 2005) was used. Briefly, sections of interest were re- moved from freezing solution and rinsed three times in 0.1 M phosphate buffer (PB, pH 7.4) for 1 min. Sections were then mounted on gelatin coated slides in 0.005 M PB (pH 7.4) and dried at 50 °C for 2 h. Sub- sequently, slides were immersed for: 3 min in basic alcohol, 2 min in 70% ETOH, 2 min in Millipore water, 11 min in 0.06% potassium permanganate, 2 min in Millipore water, 10 min in FJC (0.00001% in 0.1% glacial acetic acid), and three 2 min washes in Millipore water. Slides were then dried at 50 °C for 5–10 min, cleared with xylene for 1 min, and cover-slipped with DPX mounting media. 2.4. Mki67 immunolabeling A buffer of 0.1 M PB (pH 7.4) containing 0.4% Triton X-100 was used in all the steps involving free floating sections agitated on an or- bital shaker. Sections containing regions of interest were initially wa- shed in buffer three times (15 min each) to remove excess freezing solution. After a 30 min pre-incubation in 4% normal goat serum, the sections were incubated in 4% serum and chicken polyclonal antibody to Mki67 (1:2000, EnCor Biotechnology, USA) for 1 to 2 h at room temperature followed by 18 to 24 h at 5 °C. Sections were then washed three times for 15 min and incubated in a biotinylated goat anti-chicken antibody (1:350, Invitrogen, USA) for 1 h at room temperature. The sections were then washed three times (15 min per wash) and incubated in Streptavidin TRITC (1:200, Jackson ImmunoResearch, USA) for 1 h. The sections were then washed three times (15 min per wash) and mounted on Superfrost Plus slides (Thermo Fisher Scientific, USA) and dried at room temperature for ≥12 h in the dark. Finally, the slides were cleared in xylene and cover-slipped with DPX mounting medium. 2.5. NeuN immunolabeling Sections containing the four regions (IG, anterior CPu (CPua), anterior thalamus, and CA1) with the highest per mm2 levels of FJC labeled cells were immunolabeled with an antibody to NeuN in con- junction with DAB visualization. Sections were washed in 0.1 M PB (pH 7.4) for 15 min and then incubated in 0.1 M PB containing 0.05% H2O2 for 10 min to suppress the endogenous peroxidases. From this point on, except for the last step of 3,3′-diaminobenzidine (DAB) pro- cessing, incubation and washing solutions consisted of 0.1 M PB con- taining 0.25% Triton X-100. Sections were then washed three times for 5 min. Following a 20 min pre-incubation in 5% normal goat serum, the sections were incubated in rabbit anti-NeuN (1:1000, Abcam, USA) antibody for 18 to 24 h at room temperature. Sections were then wa- shed three times for 5 min and incubated in a biotinylated goat anti- rabbit antibody (1:300, Thermo Fisher Scientific, USA) for 2 h. The signal was then amplified using the avidin and biotinylated horseradish peroxidase macromolecular complex (Vector Laboratories, USA) and visualized with 0.5 mg/mL of DAB in Tris-HCl buffer. Sections were washed twice for 5 min in Tris-HCl, mounted, and dried on a slide warmer for ≥12 h. Finally, the slides were cleared in xylene and cover- slipped with DPX mounting medium. 2.6. Thionine staining Thionine staining was performed to verify brain regions. Sections from regions where the highest levels of FJC staining were observed from PND 7, 8 and 10 were mounted from 0.1 M PB (pH 7.4) on 3 Neurotoxicology and Teratology 80 (2020) 106890 Superfrost Plus slides (Thermo Fisher Scientific, USA) and dried at 55 °C for 15 min. They were then immersed in double distilled water for 4 min. Subsequently, the sections were immersed in a solution of 0.1% thionine acetate (Sigma-Aldrich, USA) in double distilled water for 8 min. The sections were then transferred through two washes of water (2 min each) followed by 70% ethanol in water (2 min), 95% ethanol (2 min) and 100% ethanol (2 min). The sections were then transferred to xylene for ≥2 min and cover-slipped as described above. 2.7. Image capturing and analysis Imaging of brain tissue was conducted using a Nikon Eclipse Ni microscope equipped with digital cameras (Photometrics, USA; Nikon, USA). FJC, Mki67, NeuN, and thionine labeling were quantified in the somatosensory cortex, motor cortex, CPu, thalamus, CA1 region of the hippocampus, septum and amygdala at 10× magnification using NIS Elements AR automated software (Nikon, USA). Brain regions were defined in accordance with brain atlases for adult and neonatal rats (Paxinos and Watson, 2014; Ramachandra and Subramanian, 2011). 2.8. Stereological analysis The brain regions in which the highest levels of FJC positive neu- rons were identified with the aid of adult and neonatal atlases as guides. Given the absence of a complete neonatal atlas, these locations were verified using thionine stained sections from the same regions that the FJC sections were taken to determine neurodegeneration from the pups sacrificed at PND 7, 8 and 10 [see Fig. 1]. Subsequent to identifying these regions, unbiased stereological estimates of positively im- munolabeled cells/structures were performed from images that were captured with Photometrics (fluorescent) or Nikon (brightfield) digital cameras using NIS elements AR software for analysis. Unless otherwise stated, six animals were used for each treatment condition; however, only 4 animals reached inclusion criteria under the 72 h Sevo condition. For each animal included, one instance of each region was utilized. When more than one instance of a region was available for an animal, the average count for that region, in that an- imal, was utilized for statistics. Therefore, N is reflective of the number of animals included in each treatment group. All FJC, NeuN and Mki67 cell counts represented are calculated from both hemispheres, and thus represent the region as a whole. Data were normalized by the total area of the counted region of interest and expressed as number of label positive cells per mm2. All animals were given a unique ID that was not indicative of treatment prior to analysis. The investigator who took images and conducted immunohistochemical analysis was unaware of treatment conditions and post-exposure intervals at the time of analysis. FJC images were taken at 10× using a FITC filter and Photometrics camera. FJC positive cells were counted in NIS Elements AR by re- stricting the area to ≥4μm2 and ≤ 75 μm2, MinFret ≥1.93 μm, and SumIntensity ≥102 and ≤ 2,876,455. Threshold settings were as fol- lows: Smooth 5×, Clean 2×, Fill holes ON, Separate 1×. Binning was set at 8. Mki67 images were taken at 20× using TRITC filter, ND4 filter, and Photometrics camera. Mki67 positive cells were counted in NIS Elements AR by restricting Area ≥ 24 μm2 and ≤ 300 μm2, Width ≥ 2.29 μm, and MeanIntensity ≥229 and ≤ 65,535. Threshold settings were as follows: Smooth OFF, Clean OFF, Fill holes OFF, Separate 4×. Binning was set at 8. NeuN images were taken at 10× using brightfield imaging and a Nikon camera. Images of NeuN positive cells in the CPua and anterior thalamus were first processed by a medium equalization accuracy strength of 30, followed by Fourier transform noise reduction at 0.880 and detail enhancement at 0.045 with average intensity maintained. NeuN positive cells were then counted in NIS Elements AR by restricting area ≥ 0.42 μm2 and ≤ 2276.45μm2, threshold set to intensity with the following set- tings: Smooth OFF, Clean 1×, Fill holes OFF, Separate 4×. Binning was set at 8. For the densely populated regions of CA1 and IG, to get S.M. Burks, et al. 4 Neurotoxicology and Teratology 80 (2020) 106890 (caption on next page) S.M. Burks, et al. Neurotoxicology and Teratology 80 (2020) 106890 Fig. 1. Coronal brain sections showing regions with highest levels of increased neurodegeneration after Sevo anesthesia. The left most column (A1, +2.76 from bregma through G1, −4.80 from bregma) shows coronal sections in adult rats (Paxinos and Watson, 2014) that correspond to coronal sections in the PND 7 (A2 to G2), PND 8 (A3 to G3) and PND 10 (A4 to G4). The gold color highlights superimposed on the adult sections correspond to the regions in the neonates where neurodegeneration was highest. The regions in neonates do not correspond perfectly with the adults, as seen in the septal, posterior cortical and midbrain regions. The lateral septum is not highlighted in gold because it occurs rostral to C1, at 0.24 mm from bregma, while the retromammillary decussation and ventral tegmental area (rostral), and substantia nigra, reticular part and dorsal tier are not shown because they are caudal of bregma −4.80 mm. Image G1 is a composite of images from the adult diencephalon (bregma −3.96 mm) and cortex / hippocampus (bregma −4.80). This was necessary to provide an adequate representation of the more caudal aspects of the PND 7–10 rat brain. Abbreviations for the gold highlighted brain regions of interest in A1 through G1 are: A29c-1 = more anterior region of the retrosplenial cortex A29c-2 = more posterior region of the retrosplenial cortex Acb = accumbens shell AHP = anterior hypothalamic area, posterior part AIV & LO = agranular insular cortex ventral + lateral orbital cortex Anterior Thalamus = VA, VL and intralaminar nuclei of the thalamus BMA & MeA = basomedial amygdaloid nucleus + medial amygdaloid nuclei ST = Bed Nuclei STM; lateral + medial division of bed nucleus of the stria terminalis CA1 = field CA1 of hippocampus CG Ctx = cingulate cortex CPua = caudate/putamen, ~ 2.16 mm bregma CPub = caudate/putamen, ~ −0.12 to −0.24 mm bregma DLG = dorsal lateral geniculate nucleus GP = lateral globus pallidus IG = indusium griseum, hippocampal rudiment M1 & M2 = primary + secondary motor cortex, layer I & II M2 = secondary motor cortex, layer I & II MPO = medial preoptic nucleus of the hypothalamus PMCo = posteromedial cortical amygdaloid nucleus VTA = retromammillary decussation + ventral tegmental area, rostral S1BF = primary somatosensory cortex, barrel field SNR & SNCD = substantia nigra, reticular part + dorsal tier. Fig. 2. Regions with the highest levels of FJC labeling at 2 h after Sevo. The average ± SEM of FJC positive cells after 2 h Sevo, normalized to 1 mm2 area, are displayed in de- creasing order. N = 6, however for the Bed Nuclei STM, AHP, and SNR & SNCD regions, N = 5 due to proces- sing/regional complications. As the sections used were 30 μm thick, the total number of degenerating neurons per 1 mm3 would be 40× that shown for each region. Abbreviations present in Fig. 2 are the same as used in Fig. 1. The blue background indicates that the region is associated with the primary olfactory learning system while the tan background indicates that the region is part of the basal ganglia and motor movement system. The arrow points to the values related to the SNR and SNCD. **P ≤ 0.002, ***P ≤ 0.0002, ****P ≤ 0.00002. accurate cellular discrimination of NeuN, images were first processed by Fourier transform noise reduction at 0.543 and detail enhancement at 0.034 with average intensity maintained. Subsequently, a green component contrast was applied with the following settings: Low = 0, High = 177, Gamma =5. Then the positive cells were counted using the same settings as for CPua and anterior thalamus. 2.9. Statistical analysis Results are presented as mean ± SEM. The 2, 24, and 72 h groups were analyzed using separate two-way ANOVAs (region and treatment). Post-hoc analysis was performed using a Sidak's post-hoc test (alpha = 0.02), or unpaired t-tests, (effect of sacrifice interval; alpha = 0.05). All analyses were performed in GraphPad Prism version 6 (GraphPad Software, Inc.; USA). Due to processing/regional compli- cations, in certain circumstances N of 6 was not available. The Bed 5 S.M. Burks, et al. 6 Neurotoxicology and Teratology 80 (2020) 106890 (caption on next page) S.M. Burks, et al. Neurotoxicology and Teratology 80 (2020) 106890 Fig. 3. Visual presentation of FJC labeling in three regions with high levels of FJC labeling at 2 h after Sevo exposure. Representative micrographs of FJC labeling in the control and Sevo animals for the CPua, Acb, and M1 & M2 are shown 2 h after Sevo. Both high and low magnifications are shown; the red arrows point to the same location on the two different magnifications (indicated by the red magnification bars). The larger FJC labeled structures in the three regions ranged from 2 to 8 μm2. Fig. 4. Regions with highest levels of FJC labeling at 24 h after Sevo. The regions with the highest increases in (> 4 and ≤ 75 μm2) FJC structures present at 24 h after Sevo are shown on the x- axis. The average of means along with the SEMs shown on the y-axis are nor- malized to 1 mm2 area for both control and Sevo groups. Abbreviations present are the same as used in Fig. 1. The blue background indicates that the region is associated with the primary olfactory learning system while the tan back- ground indicates that the region is part of the basal ganglia and motor move- ment system. The arrow points to the bars related to the SNR and SNCD. ****P ≤ 0.00002. the numbers of large Nuclei STM, AHP, and SNR & SNCD regions of the 2 h post Sevo ani- mals, N = 5 (Fig. 2). For the 24 h post Sevo animals in the Anterior Thalamus, Bed Nuclei STM, A29c-1, S1BF, BMA & MeA, VTA, MPO, and SNR & SNCD regions, N = 5 (Figs. 4 and 9). For the 24 h post Sevo animals in the GP and AHP, N = 4 (Fig. 4). For NeuN, 24 h post Sevo controls were N = 4 in the IG (Fig. 7). Controls for Mki67 at the anterior thalamus where N = 5 (Fig. 9). In the CPua, 24 h post Sevo and control animals were N = 4 for Mki67 (Fig. 9). 3. Results Preliminary data identified over ten specific brain regions in which the density of FJC labeling within the region was at least three-fold increased over other brain regions. FJC labeling within these regions, as well as some regions which have significant synaptic connections to the identified regions, was then conducted to determine the statistical dif- ferences between regions over the three timepoints (PND 7 at 2 h post Sevo, PND 8 at 24 h post Sevo, and PND 10 at 72 h post Sevo). Regions highlighted in gold are superimposed over coronal sections (+2.76 to-4.8 mm from bregma) of an adult rat brain in Fig. 1, in- dicating increased FJC labeling due to Sevo. Corresponding thionine- stained brain sections from neonatal pups at PND 7, 8 and 10 are shown in the remaining three columns. The anatomy of the brain regions in the adult versus neonate coronal sections approximately correspond. However, more posteriorly, the corpus collosum appears to extend further back with respect to the midbrain. Thus, there is an apparent 1 mm discrepancy caudally at −5.0 mm from bregma on PND 7–10. At this age, the neocortex and the hippocampal morphology agrees with a position at −4.8 to −5.0 mm from the bregma in adults while the midbrain shown corresponds to about −4.0 mm in adults. This dis- crepancy is less pronounced at PND 10. In the sections more rostral, the correspondence seems to be uniform up to +2.78 mm from bregma. Note that the lateral septum is not highlighted in Fig. 1 because it occurs rostral to C1, at 0.24 mm from bregma. As can be seen in Fig. 1, the size of the coronal sections in the neonatal brain increase about 30% from PND 7 to 10. Increased FJC labeling was determined by evaluating the number of FJC-labeled neurons per mm2 in brain regions of the Sevo or control group. Two hours after Sevo, neurodegeneration was most prominent in brain regions associated with the primary olfactory learning system (Fig. 2, blue), as well as the basal ganglia and thalamic and cortical regions related to motor movement (Fig. 2, tan). The regions of the primary olfactory learning system included: the indusium griseum (IG), lateral septum, accumbens shell (Acb), posterior hippocampal CA1 (lighter color indicates looser association), bed nucleus of the stria terminalis (Bed Nuclei STM), posteromedial cortical nuclei of the amygdala (PMCo), and the amygdaloid nucleus (BMa & MeA). In the basal ganglia associated brain regions, layer I and II of the anterior motor cortex (M1 & M2), anterior thalamus, lateral globus pallidus (GP), and caudate/putamen (CPua,b, both anterior medial and more posterior ventral) were affected. The retrosplenial cortex (A29c-1 and A29c-2), barrel fields of cortical primary somatosensory (S1BF), sec- ondary motor cortex (M2), and cingulate cortex (CG Ctx) were the other regions most affected by Sevo. The total number of FJC-labeled neurons per region, irrespective of its total area, are found in Supplemental Fig. 1. (Because the areas of regions analyzed varied greatly, the ab- solute numbers per region are greater in the regions of the anterior thalamus and CPu, which encompass larger total areas. From that standpoint, the regions of the anterior thalamic nuclei (−1.2 to 3.0) and CPub had the greatest number of FJC labeled neurons followed by CA1, PMCo, Bed Nuclei STM, A29c-1, A29c-2, and Acb.) FJC labeling in the substantia nigra (SNR & SNCD) and ventral tegmental area (VTA) was minimal (Fig. 2 and Supplemental Fig. 2). Also, there was very little labeling in the frontal cortex at +4.2 mm from bregma (Supplemental Fig. 1). Representative micrographs show Sevo exposure increases FJC labeling for the CPua, Acb, and M2 (Fig. 3). 7 S.M. Burks, et al. Twenty-four h after Sevo, the FJC labeling was within 3-fold of control in half the brain regions (Fig. 4). There was still a 3 to 6-fold increase in the numbers of FJC labeling in the Bed Nuclei STM, Acb and more anterior medial CPu (CPua) relative to control at 24 h post Sevo. 8 Neurotoxicology and Teratology 80 (2020) 106890 Fig. 5. Visual presentation of FJC labeling in three regions with high levels of neurodegeneration 24 h after Sevo exposure. Representative micrographs for neurodegeneration/FJC labeling in the control and Sevo groups for the IG, Bed Nuclei STM and CA1 are shown at 24 h after Sevo. Both high and low magnifications are shown; the red arrows point to the same location on the two different magnifications as indicated by the red magnification bars. FJC labeling in the CA1 is present in objects approaching 9 μm in diameter with a pronounced layer of FJC labeled puncta above in the region of fibers of passage. FJC-labeled objects of the same size are seen in the IG with a light interspersion of puncta. FJC-labeled objects present in the Bed Nuclei STM are ≤8 μm with very few puncta being present. However, after 24 h, in the IG, posterior CA1, anterior thalamic nuclei, and GP, there was still 25.7, 17, 11.7, and 9.8-fold, respectively, higher levels of FJC labeling compared to control. There was very little effect of Sevo on FJC labeling in most of the hippocampus except for the striking increases in CA1, caudally just before the appearance of the subiculum where the morphology of the cortex and hippocampus cor- respond to the CA1 region present from about −4.5 to −5.0 mm from bregma (Fig. 5). High levels of FJC labeling can be seen in the lateral dorsal (both AD and LDVL) central medial (CM) and ventromedial (VM) nuclei of the thalamus (Fig. 6). The levels of FJC labeling in all brain regions were within 3.8-fold or less at 72 h after Sevo compared to control except for the M1 & M2 motor cortex at −0.6 mm from bregma (Supplemental Fig. 3). Interestingly, high levels of FJC labeled struc- tures of the size of degenerating neurons were seen at 72 h after Sevo in two of the four rats evaluated (Supplemental Fig. 4). These are most likely images of neurons dying within the last 24 h. The total number of surviving neurons per brain region (at PND 7 and 8) with the high increases in FJC labeling were determined by using NeuN immunolabeling, which will detect most but not all neurons (Mullen et al., 1992). Micrographs of these NeuN labeled regions can be found in Supplemental Fig. 5. The number of NeuN labeled cells within a region in one section and the number of FJC cells in an adjacent section for the IG, CPua, anterior thalamus and CA1 (Fig. 5) were de- termined. A single section was not as feasible for use for dual staining due to the fragility of the PND 7 and 8 sections and the densely packed NeuN neurons labeled with DAB obscured the FJC labeled cells. The percentage of FJC labeling relative to NeuN labeled cells within a re- gion after Sevo or vehicle gas at 2 h (Fig. 7) was calculated via the following method [(total FJC positive cells per 1mm2 / total NeuN positive cells per 1mm2)*100]. Unfortunately, enough tissue did not remain at the 24 h condition to determine the total number of NeuN positive cells. However, the number of NeuN positive cells were little changed between the 2 and 72 h conditions (15% difference for the IG). Accordingly, the number of NeuN positive cells at the 2 h condition was also used for the 24 h condition. The newly-born cells within regions were determined at 2 h and 24 h using antibodies to Mki67 to determine if the regions with more intense Sevo-related neurodegeneration (FJC labeling) had any obvious connection with regions of new cell birth. There were appreciable numbers of Mki67 labeled nuclei in the CPua, Acb, S1BF, and LDVL (Fig. 8). The regions of mitotic activity are identified at 10×; enlarged Mki67 nuclei about to separate are also shown at 20× for clarity. The numbers of Mki67 labeling nuclei per mm2 were determined in both control and Sevo groups at 2 and 24 h in the CPua, anterior thalamus, and VM nuclei of the thalamus (Fig. 9). It was expected that if the newborn cells, which would not be neuronal, in these regions were dying, that there would be fewer Mki67 labeled nuclei in the Sevo group at 2 h. At 24 h they might be either: 1) decreased due to con- tinued degeneration or, 2) increased due to compensation for loss at 2 h. However, effects of Sevo were variable between the thalamus and CPua, with no clear evidence that Mki67 labeling was altered by Sevo. Mki67 labeled cells were present in high numbers in all the regions with high FJC labeling. S.M. Burks, et al. 4. Discussion PND 7 rats were exposed to Sevo general anesthesia after which, regions of the forebrain were quantified with FJC, and how the regional pattern of neurodegeneration varied with time was determined. Pathways of the basal ganglia and portions of the olfactory learning system were most affected by Sevo. Remarkably, in some brain regions as many as 10% of the total neurons appeared to be dying 24 h after Sevo exposure (IG; Fig. 7). We also observed significant neurodegen- eration in areas of the brain, such as the IG (Figs. 2 and 4), and in other areas that failed to reach statistical significance, such as the lateral septum and the bed nucleus STM that have been previously overlooked. In contrast to previous studies (Lee et al., 2017; Perez-Zoghbi et al., 2017; Zhou et al., 2016), we observed clear, but spatially restricted, damage to the CA1 region of the hippocampus. By 72 h signs of neu- rodegeneration were greatly reduced. The reduced profile of hippo- campal damage observed here may be caused by the exclusion of ani- mals that did not maintained adequate oxygenation throughout the course of exposure. Transient levels of low oxygen during prolonged Sevo exposure may result in a more pervasive pattern of neurodegen- eration within the hippocampus. 9 Neurotoxicology and Teratology 80 (2020) 106890 Fig. 6. Visual presentation of FJC labeling in four thalamic nuclei with high levels of in- creased FJC labeling at 24 h after Sevo exposure. The large top panel shows the entire thalamus in one hemisphere. The third ventricle and the ventral aspects of the hippocampus are present at the very top of the panel. The panel is a composite of twenty-four micrographs taken at 10× magnification. FJC labeling was prominent in the lateral dorsal thalamic nucleus, ven- trolateral portion (LDVL), anterodorsal portion (AD), ventromedial (VM) and central medial (CM) nuclei of the thalamus as shown in the bottom four panels. Magnification is the same for all four and represented in the far-left panel. White boxes highlight the areas in the lower panels. FJC labeling is present in objects up to ⩰ 9 μm in diameter with a light interspersion of puncta. Several regions of the forebrain showed elevated levels of FJC staining 2 h after Sevo exposure (Fig. 2). The brain regions affected could be roughly split into two groups: those related to the basal ganglia and motor movement (anterior thalamus, CPua,b, GP, M1& M2, GP, M2 and possibly S1BF (Gerfen and Surmeier, 2011; Ikemoto et al., 2015) and regions that have been associated with the primary olfactory learning pathway (IG, CA1, Bed Nuclei STM, Acb, lateral septum, BMa & MeA and PMCo (Shipley and Adamek, 1984)) as well as “spatial cognition” (CA1, (Gilbert et al., 2001; Kesner et al., 2004) (Gallagher and Chiba, 1996), fear learning (BMa & MeA, and PMco (Gallagher and Chiba, 1996)), reward and addiction (Acb (Di Chiara, 2002)), response to stress (Bed Nuclei STM (Choi et al., 2008)) and many other aspects of behavior. Elevated levels of FJC, although not statistically significant, were also detected in other areas known to be important to learning and memory such as A29c-1 and A29c-2 (Nelson et al., 2018; Todd et al., 2019). By 24 h after Sevo (Fig. 4), the same general regional pattern was seen in the basal ganglia pathway and the primary olfactory learning pathways in the top twelve brain regions. Moreover, neuro- degeneration was again detected in A29c-1 and A29c-2 as well as the AHP. Most studies investigating anesthesia related neurotoxicity evaluate S.M. Burks, et al. Fig. 7. Percentage of munoreactive cells at 2 and 24 h after Sevo. The percentage of FJC labeled cellular structures within a region in Sevo and control groups was indirectly calculated by determining the numbered of NeuN labeled cells within a region in one section and the number of FJC cells in an adjacent section for the IG, anterior CPu anterior thalamus and CA1. The per- centage of large (> 4 and ≤ 75 μm2 in area) FJC structures relative to NeuN labeled cells present at 2 and 24 h after Sevo or in control are shown. The mean percentages along with SEMs are displayed. ** indicates P ≤ 0.0001. large FJC structures present relative to NeuN im- animals at a single time point. In contrast, we evaluated Sevo related neurodegeneration at 2, 24, and 72 h after the cessation of exposure. Neurodegeneration was detected subsequent to what is seen at 2 h and regions experiencing prolonged neurodegeneration and/or those un- dergoing a “second wave” of neurodegeneration were identified. Some of the regions associated with the basal ganglia pathway and the pri- mary olfactory learning pathway showed signs of either a prolonged neurodegeneration (CPua) or a second neurodegenerative event (IG, CA1, and thalamus). These regions had multifold increases in FJC staining at 24 h compared to 2 h. In contrast, the M1 & M2, PMCo, CPub, and cingulate more rapidly returned to control, or near control levels. For example, the PMCo and CPub have levels of FJC staining approximately 5-fold higher than control at 2 h, but levels were es- sentially normal at 24 h post exposure. These data indicate there are regional differences in sensitivity to anesthesia related neurotoxicity, and that timing of neurotoxicity differs in a region dependent manner. One explanation for this phenomenon could be delayed scavenging 10 Neurotoxicology and Teratology 80 (2020) 106890 of the dead neurons in brain regions with high neurodegeneration; that is, the brain could be rate-limited in the clearance of dead neurons. Dead neurons in excess of the threshold could be misinterpreted as dying at a later point. However, “Delayed scavenging” was not ob- served in the Acb and CPub. These regions had high levels of neuro- degeneration at 2 h, but 5-fold drops in the number of degenerating neurons labeled with FJC at 24 h. Moreover, delayed scavenging cannot explain the actual increase in degenerating neurons in the IG, anterior thalamus, and CA1 at 24 h compared to 2 h. These data indicate the initial loss of neurons in some regions associated with the basal ganglia and the primary olfactory learning pathway is followed by a “second wave” of cell death. Endogenous neurodegeneration might increase because of the loss of cellular inputs triggered by the “first wave” of neurodegeneration. Alternatively, Sevo exposure may cause a second wave of neurodegeneration at 24 h via a fundamentally different me- chanism and with a different temporal profile from that observed at 2 h. Regardless of the mechanism, the prospect of a distinct second wave of neurodegeneration increases the difficulty in ameliorating anesthesia related neurodegeneration and highlights the importance of con- sidering multiple time points when studying anesthesia related neuro- degeneration. It is unclear why Sevo causes an increase in FJC positive cells in some areas, while leaving others unaffected. It is not as simple as an abundance of newly divided cells. Many areas of the brain where ele- vated numbers of FJC positive cells were observed were past their periods of “peak” neurogenesis. For example, neurogenesis is thought to peak at post-conception day (PCD) 17 in the Acb (Clancy et al., 2009), PCD 16 in the CA1 (Wyss and Sripanidkulchai, 1985) (Workman et al., 2013), and PCD 14 in the CPu (Clancy et al., 2009; Workman et al., 2013). In the CA1 we observed about 5% of all cells being FJC positive (Fig. 7) even though neurogenesis in the region is greatly reduced by PCD 20 (Wyss and Sripanidkulchai, 1985). These data therefore suggest that a cell being recently born is not enough to make it vulnerable to anesthesia related neurotoxicity. Another possible explanation for certain areas being more sensitive to Sevo is the high prevalence of GABAA receptors. While the IG does have high levels of GABAA receptor mRNA (PND 5 rats (Poulter et al., 1992)), so does the dentate gyrus (Poulter et al., 1992) where little to no evidence of neurodegeneration was detected. Some of the neuro- degeneration may be the consequence of a lack of organized stimula- tory input caused by anesthesia exposure. For example, previous work has demonstrated an increase in degenerating cells in the substantia nigra (bilateral) 1–4 days after an excitatory striatal lesion (unilateral) in the PND 7 rat (Macaya et al., 1994). Similarly, stimulatory activity is required for normal cortical development (Kilb et al., 2011; Lewin and Barde, 1996). However, it is unclear if a lack of organized stimulation could so rapidly impact neurodegeneration and cause an increase in FJC staining 2 h post Sevo cessation. If that is indeed the case, it would ultimately translate into lasting behavioral changes when normal sti- mulation has been restored. Clearly, additional studies are required. Another possibility is that some neuron types, more abundant in certain regions, are more vulnerable to insult in adults and neonates. For example, the basal ganglia associated regions of the thalamus, which are shown here to be sensitive to Sevo, are also sensitive to cell death as a result of thiamine deficiency and methamphetamine in adult rodents (Bowyer et al., 2008; Bowyer et al., 2018b). Except for the retrosplenial (A29c) and motor cortex, all brain regions where Sevo resulted in high levels of neurodegeneration in the perinatal rat also display pronounced neurotoxicity in adult rodents exposed to me- thamphetamine. Most of the potential mechanisms behind the hy- perthermic and excitatory neurotoxicity produced by amphetamines and seizures would not be thought to occur during anesthesia. How- ever, blood flow disruption within regions where neurodegeneration occurs has been observed with methamphetamine and amphetamine exposure, and likely triggers the seizures and neurodegeneration pro- duced (Bowyer et al., 2018a). Sevoflurane can induce vasodilation S.M. Burks, et al. Neurotoxicology and Teratology 80 (2020) 106890 Fig. 8. a,b. Mki67 immunolabeling labeling in the CPua, Acb, S1BF and LDVL at 2 h after Sevo anesthesia (8a) or control (8B). Cells undergoing the process of mitosis in the CPua, Acb, S1BF and LDVL at 2 h after Sevo exposure were labeled using Mki67. The white boxes indicate where mitosis has just occurred with two new nuclei appearing in the CPua, Acb, and S1BF (a). In the LDVL, it appears some time has passed since the original nucleus has divided (a). Magnification is the same for all four regions and is shown in the two CPua panels. (Matta et al., 1999; Sakata et al., 2019). It is therefore possible that, in the perinatal rats exposed to Sevo, a deficiency in brain blood-flow occurs in regions with pronounced neurodegeneration. Young animals may lack the physiological robustness needed to overcome periods of abnormal regional blood flow. FJC is the most recent and most selective fluorescent ligand/label developed to detect neurodegeneration, it can label the soma, den- drites, axons and terminals of degenerating neurons in adult animals (Schmued et al., 2005). However, in perinatal animals, the Fluoro Jade (versions b and c) labeling is primarily observed as circular structures ranging from 2 to ≤10 μm in diameter with very little or no labeling of the dendrites and axons as seen in the present study and previously (Scallet et al., 2004). The location, morphology and size of the larger FJC structures seen in perinatal animals after Sevo exposure coincides well with the TUNEL data, which detects apoptotic degeneration by labeling the degraded fragmenting DNA (Scallet et al., 2004; Schmued et al., 2005). The ligand(s) generated during neurodegeneration that covalently bind to FJC is unknown, but it is likely highly positively charged. It is not known why dendrites and soma (other than the nu- cleus) were not labeled with FJC in perinates. In normal perinates, FJC labeling is present among the degrading DNA and histones found in or surrounding the collapsing nucleus during the apoptotic process. From this study and previous research, most of the cells labeled with FJC are likely neurons (Scallet et al., 2004; Schmued et al., 2005). Sevo exposure did not decrease the Mki67 labeling, which indicates that most of the cells observed dividing were not neuronal in nature. However, this assumes that Mki67 antibodies cannot label FJC labeled neurons owing to degradation of the Mki67 protein. In the present study, the FJC labeling in the hippocampal CA1, IG and some thalamic nuclei showed morphological similarities with adult FJC labeling. FJC labeled the entire soma and a few proximal dendrites. In the CA1 region, FJC also labeled fibers of passage residing about the degenerating neurons. It is not clear why this occurred only in these regions, but it could be due to a different type of neurodegen- erative process other than classic apoptosis, or that the neurons affected in this area were further along in their differentiation to the “adult” state. During the BGS, new cells are continually created while others are degenerating via normal apoptotic processes. This dynamic state has led some to question the clinical relevance of anesthesia related death during the BGS. Hypothetically, endogenous amelioration of anesthesia related cell death could occur by either decreasing the rate of apoptosis, or by increasing the creation of new cells. Several areas of the brain did have a transient reduction in FJC levels at either 24 or 72 h post ex- posure, suggesting potential compensation. Yet, it is unlikely that the decline in endogenous neurodegeneration is enough to compensate for 11 S.M. Burks, et al. Fig. 9. Effects of Sevo on Mki67 labeling in the CPu and thalamus. The numbers of Mki67 labeled cells in the CPua, anterior thalamus and VM nuclei of the thalamus are shown in the control and Sevo groups at the 2 h and 24 h time points. No statistical significance was observed. the multiple fold increase in neurodegeneration that occurred due to Sevo exposure. Similarly, Mki67, a non-specific nuclear marker of the birth/mitosis of all cells (Brown and Gatter, 1990; von Bohlen und Halbach, 2011) was used to determine if more cells were born in the areas of greatest neurodegeneration. There was no convincing evidence of an increase in new cell birth (Mki67 labeling) in regions where Sevo exposure increased neurodegeneration the most (anterior thalamus, Figs. 4 and 9). Although not statistically significant, some brain regions trended toward elevated levels of Mki67 binding under the control condition (e.g., CPu and thalamus, Fig. 9), as well as increased neuro- degeneration after Sevo exposure. The brain does not appear to meaningfully increase the supply of viable neurons within the first 72 h 12 Neurotoxicology and Teratology 80 (2020) 106890 of Sevo exposure. In most of these regions, neuronal cell birth is thought to have ended by PND 7–8 (Feliciano and Bordey, 2013). In future re- search, it will be important to consider the developmental fate of cells born in the brain in the hours after Sevo insult. Many of the brain areas where neurodegeneration was observed are crucial for cognition, and prolonged general anesthesia can cause lasting behavioral changes. Surprisingly, with an independent cohort of rats treated under near identical conditions, we saw no significant ef- fects of Sevo exposure when tested during adulthood on a battery of operant tests (Walters et al., 2020). Behavioral effects of these ex- posures were limited to an altered locomotor activity response after an amphetamine challenge. It is possible that we may have detected more robust effects of Sevo if we evaluated Morris Water Maze (MWM) or a radial arm maze (RAM) performance. Many reports have previously shown animals treated with anesthesia early in life to have altered performance on those tasks in adulthood (Walters and Paule, 2017). However, the MWM and RAMs are both dependent upon a functioning hippocampus (Morris et al., 1982; Olton et al., 1978), and we observed less damage to the hippocampus than reported in other studies. We included only those animals that maintained adequate oxygenation throughout the entirety of the exposure, and we observed less extensive neurodegeneration in the hippocampus, potentially because of this. The diffuse nature of the insult, with generally fewer than 1% of neurons dying in any area (notable exceptions) may not have been sufficient to impair performance on operant based tasks of cognition (Walters et al., 2020). While still controversial, an ever-growing body of evidence in- dicates that extended exposure to general anesthesia, including Sevo, early in life has the potential to be neurotoxic. Here, we confirmed that in adequately oxygenated animals, Sevo exposure caused neurodegen- eration but to a lesser extent in some brain regions (e.g., hippocampus) than previously seen. Moreover, our comprehensive assessment of the brain highlights additional regions that may be vulnerable to anesthesia related neuronal degeneration. Most striking was the damage seen in the IG; over 10% of the total cells stained positive for FJC at 24 h post- exposure. By including a time course, we also established that neuro- degeneration does not progress at a uniform pace after Sevo exposure. The temporal pattern of FJC staining also suggests a second wave of degeneration at 24 h, likely driven by a different mechanism than that which caused degeneration at 2 h. The realization that anesthesia re- lated neurodegeneration does not occur at a uniform pace, and that damage may be more spread than initially assumed, is crucial for the future study of mechanisms of and treatments for anesthesia related neurotoxicity. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ntt.2020.106890. Funding This work was funded by NCTR Protocol E07601.01. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influ- ence the work reported in this paper. Acknowledgements The authors would like to thank James Raymick for his assistance with tissue processing. References Amrock, L.G., Starner, M.L., Murphy, K.L., Baxter, M.G., 2015. Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure. S.M. Burks, et al. Anesthesiology 122 (1), 87–95. Bowyer, J.F., Thomas, M.T., Schmued, L.C., Ali, S.F., 2008. Brain region-specific neuro- degenerative profiles showing the relative importance of amphetamine dose, hy- perthermia, seizures and the blood-brain barrier. Ann. N. Y. Acad. Sci. 1139, 127–139. Bowyer, J.F., Tranter, K.M., Robinson, B.L., Hanig, J.P., Faubion, M.G., Sarkar, S., 2018a. The time course of blood brain barrier leakage and its implications on the progression of methamphetamine-induced seizures. Neurotoxicology 69, 130–140. Bowyer, J.F., Tranter, K.M., Sarkar, S., Hanig, J.P., 2018b. Microglial activation and vascular responses that are associated with early thalamic neurodegeneration re- sulting from thiamine deficiency. Neurotoxicology 65, 98–110. Brambrink, A.M., Evers, A.S., Avidan, M.S., Farber, N.B., Smith, D.J., Zhang, X., Dissen, G.A., Creeley, C.E., Olney, J.W., 2010. Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology 112 (4), 834–841. Brambrink, A.M., Evers, A.S., Avidan, M.S., Farber, N.B., Smith, D.J., Martin, L.D., Dissen, G.A., Creeley, C.E., Olney, J.W., 2012. Ketamine-induced neuroapoptosis in the fetal and neonatal rhesus macaque brain. Anesthesiology 116 (2), 372–384. Briner, A., Nikonenko, I., De Roo, M., Dayer, A., Muller, D., Vutskits, L., 2011. Developmental stage-dependent persistent impact of propofol anesthesia on dendritic spines in the rat medial prefrontal cortex. Anesthesiology 115 (2), 282–293. Brioni, J.D., Varughese, S., Ahmed, R., Bein, B., 2017. A clinical review of inhalation anesthesia with sevoflurane: from early research to emerging topics. J. Anesth. 31 (5), 764–778. Brown, D.C., Gatter, K.C., 1990. Monoclonal antibody Ki-67: its use in histopathology. Histopathology 17 (6), 489–503. Choi, D.C., Evanson, N.K., Furay, A.R., Ulrich-Lai, Y.M., Ostrander, M.M., Herman, J.P., 2008. The anteroventral bed nucleus of the stria terminalis differentially regulates hypothalamic-pituitary-adrenocortical axis responses to acute and chronic stress. Endocrinology 149 (2), 818–826. Clancy, B., Teague-Ross, T.J., Nagarajan, R., 2009. Cross-species analyses of the cortical GABAergic and subplate neural populations. Front. Neuroanat. 3, 20. Delgado-Herrera, L., Ostroff, R.D., Rogers, S.A., 2001. Sevoflurance: approaching the ideal inhalational anesthetic. A pharmacologic, pharmacoeconomic, and clinical re- view. CNS Drug Rev 7 (1), 48–120. Deng, M., Hofacer, R.D., Jiang, C., Joseph, B., Hughes, E.A., Jia, B., Danzer, S.C., Loepke, A.W., 2014. Brain regional vulnerability to anaesthesia-induced neuroapoptosis shifts with age at exposure and extends into adulthood for some regions. Br. J. Anaesth. 113 (3), 443–451. Di Chiara, G., 2002. Nucleus accumbens shell and core dopamine: differential role in behavior and addiction. Behav. Brain Res. 137 (1–2), 75–114. Dobbing, J., Sands, J., 1979. Comparative aspects of the brain growth spurt. Early Hum. Dev. 3 (1), 79–83. Eriksson, P., 1997. Developmental neurotoxicity of environmental agents in the neonate. Neurotoxicology 18 (3), 719–726. Fang, F., Xue, Z., Cang, J., 2012. Sevoflurane exposure in 7-day-old rats affects neuro- genesis, neurodegeneration and neurocognitive function. Neurosci. Bull. 28 (5), 499–508. Feliciano, D.M., Bordey, A., 2013. Newborn cortical neurons: only for neonates? Trends Neurosci. 36 (1), 51–61. Flick, R.P., Katusic, S.K., Colligan, R.C., Wilder, R.T., Voigt, R.G., Olson, M.D., Sprung, J., Weaver, A.L., Schroeder, D.R., Warner, D.O., 2011. Cognitive and behavioral out- comes after early exposure to anesthesia and surgery. Pediatrics 128 (5), e1053–e1061. Gallagher, M., Chiba, A.A., 1996. The amygdala and emotion. Curr. Opin. Neurobiol. 6 (2), 221–227. Gentry, K.R., Steele, L.M., Sedensky, M.M., Morgan, P.G., 2013. Early developmental exposure to volatile anesthetics causes behavioral defects in Caenorhabditis elegans. Anesth. Analg. 116 (1), 185–189. Gerfen, C.R., Surmeier, D.J., 2011. Modulation of striatal projection systems by dopa- mine. Annu. Rev. Neurosci. 34, 441–466. Gilbert, P.E., Kesner, R.P., Lee, I., 2001. Dissociating hippocampal subregions: double dissociation between dentate gyrus and CA1. Hippocampus 11 (6), 626–636. Guo, P., Huang, Z., Tao, T., Chen, X., Zhang, W., Zhang, Y., Lin, C., 2015. Zebrafish as a model for studying the developmental neurotoxicity of propofol. J. Appl. Toxicol. 35 (12), 1511–1519. Ikemoto, S., Yang, C., Tan, A., 2015. Basal ganglia circuit loops, dopamine and motiva- tion: a review and enquiry. Behav. Brain Res. 290, 17–31. Ikonomidou, C., 2009. Triggers of apoptosis in the immature brain. Brain and Development 31 (7), 488–492. Ing, C., Brambrink, A.M., 2019. Mayo Anesthesia Safety in Kids continued: two new studies and a potential redirection of the field. Br. J. Anaesth. 122 (6), 716–719. Ing, C., Ma, X., Sun, M., Lu, Y., Wall, M.M., Olfson, M., Li, G., 2020. Exposure to surgery and anesthesia in early childhood and subsequent use of attention deficit hyper- activity disorder medications. Anesth. Analg. https://doi.org/10.1213/ANE. 0000000000004619. 31923004. Istaphanous, G.K., Howard, J., Nan, X., Hughes, E.A., McCann, J.C., McAuliffe, J.J., Danzer, S.C., Loepke, A.W., 2011. Comparison of the neuroapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114 (3), 578–587. Jevtovic-Todorovic, V., Benshoff, N., Olney, J.W., 2000. Ketamine potentiates cere- brocortical damage induced by the common anaesthetic agent nitrous oxide in adult rats. Br. J. Pharmacol. 130 (7), 1692–1698. Jevtovic-Todorovic, V., Wozniak, D.F., Benshoff, N.D., Olney, J.W., 2001. A comparative evaluation of the neurotoxic properties of ketamine and nitrous oxide. Brain Res. 895 (1–2), 264–267. Jiang, Y., Tong, D., Hofacer, R.D., Loepke, A.W., Lian, Q., Danzer, S.C., 2016. Long-term 13 Neurotoxicology and Teratology 80 (2020) 106890 fate mapping to assess the impact of postnatal isoflurane exposure on hippocampal progenitor cell productivity. Anesthesiology 125 (6), 1159–1170. Kanungo, J., Cuevas, E., Ali, S.F., Paule, M.G., 2013. Ketamine induces motor neuron toxicity and alters neurogenic and proneural gene expression in zebrafish. J. Appl. Toxicol. 33 (6), 410–417. Kesner, R.P., Lee, I., Gilbert, P., 2004. A behavioral assessment of hippocampal function based on a subregional analysis. Rev. Neurosci. 15 (5), 333–351. Kilb, W., Kirischuk, S., Luhmann, H.J., 2011. Electrical activity patterns and the func- tional maturation of the neocortex. Eur. J. Neurosci. 34 (10), 1677–1686. Lee, J.R., Lin, E.P., Hofacer, R.D., Upton, B., Lee, S.Y., Ewing, L., Joseph, B., Loepke, A.W., 2017. Alternative technique or mitigating strategy for sevoflurane-induced neuro- degeneration: a randomized controlled dose-escalation study of dexmedetomidine in neonatal rats. Br. J. Anaesth. 119 (3), 492–505. Lerman, J., Johr, M., 2009. Inhalational anesthesia vs total intravenous anesthesia (TIVA) for pediatric anesthesia. Paediatr. Anaesth. 19 (5), 521–534. Lewin, G.R., Barde, Y.A., 1996. Physiology of the neurotrophins. Annu. Rev. Neurosci. 19, 289–317. Macaya, A., Munell, F., Gubits, R.M., Burke, R.E., 1994. Apoptosis in substantia nigra following developmental striatal excitotoxic injury. Proc. Natl. Acad. Sci. U. S. A. 91 (17), 8117–8121. Matta, B.F., Heath, K.J., Tipping, K., Summors, A.C., 1999. Direct cerebral vasodilatory effects of sevoflurane and isoflurane. Anesthesiology 91 (3), 677–680. Morris, R.G., Garrud, P., Rawlins, J.N., O'Keefe, J., 1982. Place navigation impaired in rats with hippocampal lesions. Nature 297 (5868), 681–683. Mullen, R.J., Buck, C.R., Smith, A.M., 1992. NeuN, a neuronal specific nuclear protein in vertebrates. Development 116 (1), 201–211. Na, H.S., Brockway, N.L., Gentry, K.R., Opheim, E., Sedensky, M.M., Morgan, P.G., 2017. The genetics of isoflurane-induced developmental neurotoxicity. Neurotoxicol. Teratol. 60, 40–49. Nelson, A.J.D., Hindley, E.L., Vann, S.D., Aggleton, J.P., 2018. When is the rat retro- splenial cortex required for stimulus integration? Behav. Neurosci. 132 (5), 366–377. Olton, D.S., Walker, J.A., Gage, F.H., 1978. Hippocampal connections and spatial dis- crimination. Brain Res. 139 (2), 295–308. Osterop, S.F., Virtanen, M.A., Loepke, J.R., Joseph, B., Loepke, A.W., Vutskits, L., 2015. Developmental stage-dependent impact of midazolam on calbindin, calretinin and parvalbumin expression in the immature rat medial prefrontal cortex during the brain growth spurt. Int. J. Dev. Neurosci. 45, 19–28. Paule, M.G., Li, M., Allen, R.R., Liu, F., Zou, X., Hotchkiss, C., Hanig, J.P., Patterson, T.A., Slikker Jr., W., Wang, C., 2011. Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys. Neurotoxicol. Teratol. 33 (2), 220–230. Paxinos, G., Watson, C., 2014. The Rat Brain in Stereotaxic Coordinates, 7th ed. Elsevier. Pellegrini, L., Bennis, Y., Velly, L., Grandvuillemin, I., Pisano, P., Bruder, N., Guillet, B., 2014. Erythropoietin protects newborn rat against sevoflurane-induced neurotoxi- city. Paediatr. Anaesth. 24 (7), 749–759. Perez-Zoghbi, J.F., Zhu, W., Grafe, M.R., Brambrink, A.M., 2017. Dexmedetomidine- mediated neuroprotection against sevoflurane-induced neurotoxicity extends to several brain regions in neonatal rats. Br. J. Anaesth. 119 (3), 506–516. Poulter, M.O., Barker, J.L., O’Carroll, A.M., Lolait, S.J., Mahan, L.C., 1992. Differential and transient expression of GABAA receptor alpha-subunit mRNAs in the developing rat CNS. J. Neurosci. 12 (8), 2888–2900. Ramachandra, R., Subramanian, T., 2011. Atlas of the Neonatal Rat Brain. CRC Press. Rice, D., Barone .Jr., S., 2000. Critical periods of vulnerability for the developing nervous system: evidence from humans and animal models. Environ. Health Perspect. 108 (Suppl. 3), 511–533. Rizzi, S., Carter, L.B., Ori, C., Jevtovic-Todorovic, V., 2008. Clinical anesthesia causes permanent damage to the fetal guinea pig brain. Brain Pathol. 18 (2), 198–210. Sakata, K., Kito, K., Fukuoka, N., Nagase, K., Tanabe, K., Iida, H., 2019. Cerebrovascular reactivity to hypercapnia during sevoflurane or desflurane anesthesia in rats. Korean J Anesthesiol 72 (3), 260–264. Scallet, A.C., Schmued, L.C., Slikker Jr., W., Grunberg, N., Faustino, P.J., Davis, H., Lester, D., Pine, P.S., Sistare, F., Hanig, J.P., 2004. Developmental neurotoxicity of ketamine: morphometric confirmation, exposure parameters, and multiple fluorescent labeling of apoptotic neurons. Toxicol. Sci. 81 (2), 364–370. Schmued, L.C., Stowers, C.C., Scallet, A.C., Xu, L., 2005. Fluoro-Jade C results in ultra high resolution and contrast labeling of degenerating neurons. Brain Res. 1035 (1), 24–31. Shipley, M.T., Adamek, G.D., 1984. The connections of the mouse olfactory bulb: a study using orthograde and retrograde transport of wheat germ agglutinin conjugated to horseradish peroxidase. Brain Res. Bull. 12 (6), 669–688. Slikker Jr., W., Zou, X., Hotchkiss, C.E., Divine, R.L., Sadovova, N., Twaddle, N.C., Doerge, D.R., Scallet, A.C., Patterson, T.A., Hanig, J.P., Paule, M.G., Wang, C., 2007. Ketamine-induced neuronal cell death in the perinatal rhesus monkey. Toxicol. Sci. 98 (1), 145–158. Sprung, J., Flick, R.P., Katusic, S.K., Colligan, R.C., Barbaresi, W.J., Bojanic, K., Welch, T.L., Olson, M.D., Hanson, A.C., Schroeder, D.R., Wilder, R.T., Warner, D.O., 2012. Attention-deficit/hyperactivity disorder after early exposure to procedures requiring general anesthesia. Mayo Clin. Proc. 87 (2), 120–129. Stratmann, G., Sall, J.W., May, L.D., Loepke, A.W., Lee, M.T., 2010. Beyond anesthetic properties: the effects of isoflurane on brain cell death, neurogenesis, and long-term neurocognitive function. Anesth. Analg. 110 (2), 431–437. Talpos, J.C., Chelonis, J.J., Li, M., Hanig, J.P., Paule, M.G., 2019. Early life exposure to extended general anesthesia with isoflurane and nitrous oxide reduces responsivity on a cognitive test battery in the nonhuman primate. Neurotoxicology 70, 80–90. Todd, T.P., Fournier, D.I., Bucci, D.J., 2019. Retrosplenial cortex and its role in cue- specific learning and memory. Neurosci. Biobehav. Rev. 107, 713–728. S.M. Burks, et al. von Bohlen und Halbach, O., 2011. Immunohistological markers for proliferative events, gliogenesis, and neurogenesis within the adult hippocampus. Cell Tissue Res. 345 (1), 1–19. Vutskits, L., Culley, D.J., 2019. GAS, PANDA, and MASK: no evidence of clinical anes- thetic neurotoxicity!. Anesthesiology 131 (4), 762–764. Walters, J.L., Paule, M.G., 2017. Review of preclinical studies on pediatric general an- esthesia-induced developmental neurotoxicity. Neurotoxicol. Teratol. 60, 2–23. Walters, J.L., Chelonis, J.J., Fogle, C.M., Ferguson, S.A., Sarkar, S., Paule, M.G., Talpos, J.C., 2020. Acetyl-L-carnitine does not prevent neurodegeneration in a rodent model of prolonged neonatal anesthesia. Neurotoxicol. Teratol. https://www.ncbi.nlm.nih. gov/pubmed/32376384. Wilder, R.T., Flick, R.P., Sprung, J., Katusic, S.K., Barbaresi, W.J., Mickelson, C., Gleich, S.J., Schroeder, D.R., Weaver, A.L., Warner, D.O., 2009. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 110 (4), 796–804. Workman, A.D., Charvet, C.J., Clancy, B., Darlington, R.B., Finlay, B.L., 2013. Modeling transformations of neurodevelopmental sequences across mammalian species. J. Neurosci. 33 (17), 7368–7383. Wyss, J.M., Sripanidkulchai, B., 1985. The development of Ammon’s horn and the fascia dentata in the cat: a [3H]thymidine analysis. Brain Res. 350 (1–2), 185–198. 14 Neurotoxicology and Teratology 80 (2020) 106890 Zhang, X., Shen, F., Xu, D., Zhao, X., 2016. A lasting effect of postnatal sevoflurane an- esthesia on the composition of NMDA receptor subunits in rat prefrontal cortex. Int. J. Dev. Neurosci. 54, 62–69. Zheng, S.Q., An, L.X., Cheng, X., Wang, Y.J., 2013a. Sevoflurane causes neuronal apop- tosis and adaptability changes of neonatal rats. Acta Anaesthesiol. Scand. 57 (9), 1167–1174. Zheng, H., Dong, Y., Xu, Z., Crosby, G., Culley, D.J., Zhang, Y., Xie, Z., 2013b. Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice. Anesthesiology 118 (3), 516–526. Zhou, X., Li, W., Chen, X., Yang, X., Zhou, Z., Lu, D., Feng, X., 2016. Dose-dependent effects of sevoflurane exposure during early lifetime on apoptosis in hippocampus and neurocognitive outcomes in Sprague-Dawley rats. Int J Physiol Pathophysiol Pharmacol 8 (3), 111–119. Zou, X., Patterson, T.A., Divine, R.L., Sadovova, N., Zhang, X., Hanig, J.P., Paule, M.G., Slikker Jr., W., Wang, C., 2009. Prolonged exposure to ketamine increases neuro- degeneration in the developing monkey brain. Int. J. Dev. Neurosci. 27 (7), 727–731. Zurek, A.A., Yu, J., Wang, D.S., Haffey, S.C., Bridgwater, E.M., Penna, A., Lecker, I., Lei, G., Chang, T., Salter, E.W., Orser, B.A., 2014. Sustained increase in alpha5GABAA receptor function impairs memory after anesthesia. J. Clin. Invest. 124 (12), 5437–5441.",rats,"['Extended general anesthesia early in life is neurotoxic in multiple species. However, little is known about the temporal progression of neurodegeneration after general anesthesia. It is also unknown if a reduction in natural cell death, or an increase in cell creation, occurs as a form of compensation after perinatal anesthesia exposure. The goal of this study was to evaluate markers of neurodegeneration and cellular division at 2, 24, or 72 h after sevoflurane (Sevo) exposure (6 h) in fully oxygenated postnatal day (PND) 7 rats.']",postnatal day 7,"['The goal of this study was to evaluate markers of neurodegeneration and cellular division at 2, 24, or 72 h after sevoflurane (Sevo) exposure (6 h) in fully oxygenated postnatal day (PND) 7 rats.']",N,[],sevoflurane,"['The goal of this study was to evaluate markers of neurodegeneration and cellular division at 2, 24, or 72 h after sevoflurane (Sevo) exposure (6 h) in fully oxygenated postnatal day (PND) 7 rats.']",none,[],sprague dawley,"['Pregnant Sprague-Dawley rats (Charles Rivers, USA) arrived on gestational day 5.']","The temporal progression of neurotoxicity has not been described. For example, the pattern of neurodegeneration (post-exposure) that develops over time and across brain regions has not been determined.","['Perinatal anesthesia related neurotoxicity is well established in animal models of human use. However, the temporal progression of this neurotoxicity has not been described. For example, the pattern of neurodegeneration (post-exposure) that develops over time and across brain regions has not been determined.']","This study utilized a time-course evaluation of neurodegeneration at 2, 24, and 72 hours after sevoflurane exposure in rats.",['This enabled the determination of how markers of neurodegeneration (FJC) differed by region and changed with time.'],"The realization that anesthesia related neurodegeneration does not occur at a uniform pace, and that damage may be more spread than initially assumed, is crucial for the future study of mechanisms of and treatments for anesthesia related neurotoxicity.","['The realization that anesthesia related neurodegeneration does not occur at a uniform pace, and that damage may be more spread than initially assumed, is crucial for the future study of mechanisms of and treatments for anesthesia related neurotoxicity.']",None,[],None,[],True,True,True,True,True,True,10.1016/j.ntt.2020.106890 10.1111/pan.12263,801.0,Hu,2013,rats,postnatal day 7,N,sevoflurane,none,wistar,"Pediatric Anesthesia ISSN 1155-5645 O R I G I N A L A R T I C L E Effects of sevoflurane on the expression of tau protein mRNA and Ser396/404 site in the hippocampus of developing rat brain Zhi-yong Hu1, Hai-yan Jin1, Li-li Xu2, Zhi-rui Zhu1, Yi-lei Jiang1 & Robert Seal3 1 Department of Anesthesiology, The Children’s Hospital, School of Medicine, Zhejiang University, Hangzhou, China 2 Department of Anesthesiology, The Second Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, China 3 Department of Anesthesia and Pain Medicine, University of Alberta and Stollery Children’s Hospital, Edmonton, AB, Canada Keywords phosophorulation; tau; sevoflurane; neonatal Summary Correspondence Zhi-yong Hu, Department of Anesthesiology, The Children’s Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China Email: huzhiyong777@126.com Section Editor: Andrew Davidson Accepted 18 August 2013 doi:10.1111/pan.12263 Background: General anesthesia induces a transient hyperphosphorylation of tau protein that is associated with neurotoxicity in neonatal rats, but the mechanism remains unknown. The current study sought to investigate the effects of sevoflurane on the levels of tau phosphorylation at phosphor- Ser396/404 and total tau mRNA in the hippocampus of neonatal rats. Materials and Methods: Thirty-six 7-day-old rats were randomly exposed for 6 h to either 3% sevoflurane (S) or air (NC) as a placebo. They were sacri- ficed at 1, 7 and 14 days after the anesthesia, respectively, and thus assigned to S1d, S7d, S14d, NC1d, NC7d, and NC14d groups (n = 6). Their brain tissues were harvested and then subjected to histopathologic, Western blot and real- time polymerase chain reaction analysis. Results: Microtubule cytoskeletons were arranged in neat parallel rows in rats exposed only to air, whereas the microtubules were arranged in a disor- derly and intermittent (nonparallel) fashion in rats exposed to sevoflurane. The levels of tau mRNA in the S1d and S7d groups were significantly higher than those in the NC1d and NC7d groups. There was no significant differ- ence in the levels of tau mRNA between the S14d and NC14d groups. The levels of tau protein at Ser404 in the S1d, S7d, and S14d groups were signifi- cantly higher than those in NC1d, NC7d, and NC14d groups. The levels of tau protein at Ser396 in the S1d, and S7d groups were significantly higher than those in the NC1d, and NC7d groups, while there was no significant difference in the levels of tau protein at Ser396 between the S14d group and the NC14d group, respectively. Conclusion: In rat hippocampus, sevoflurane was associated with microtubu- lar disarray as well as increased levels of tau mRNA and excessive phosphor- ylation of tau protein at Ser396 and Ser404. This implicates that sevoflurane may induce neurotoxicity. Introduction In humans, anesthetic agents sometimes have to be administered during the brain growth spurt period that occurs between the third trimester and the age of approx- imately 2 years. This time period is equivalent to the first week after birth in mice and rats. Recently, it has been demonstrated in rodents that neonatal administration of anesthetics induced widespread neurodegeneration and severe deficits in spatial learning tasks (1,2). The underly- ing mechanism is not fully understood. To minimize risks, the risk of anesthesia in neonates, it is necessary to undertake further study to assess the effects of anesthet- ics on the developing nervous system. (2,2,2-trifluoro-1-[trifluoromethyl]ethyl fluoromethyl ether) is one of the most frequently used Sevoflurane 1138 © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein volatile anesthetics for the induction and maintenance of general anesthesia during surgery because of its low blood–gas partition coefficient and low pungency. In infants and children, these properties convey the benefit of rapid induction and recovery as well as less irritation to the airway. Sevoflurane has been shown to enhance GABAA receptors (3) and to block NMDA receptors, although more research is necessary to better character- ize its effects on NMDA receptors (4). drawn from the same litters, so that each experimental condition had its own group of littermate controls. All animals were kept in standard animal cages under con- ventional housing conditions (12-h light-dark cycle, 22°C), with ad libitum access to food and water. All experimental procedures were in accordance with the Guidance Suggestions for the Care and Use of Labora- tory Animals, formulated by the Ministry of Science and Technology of China (8). Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared with nonneuronal cells. One of tau’s main functions is to modulate the stability of axonal microtubules. Hyperphosphorylation of the tau protein (tau inclusions, pTau) can result in the self- assembly of tangles of paired helical filaments (PHFs) and straight filaments, which are involved in the patho- genesis of Alzheimer’s disease (AD) and other tauopa- thies. Several other studies (5,6) have shown that sevoflurane may induce apoptosis in the brain tissues of neonatal mice. It has also been associated with increased tau phosphorylation through specific kinase activation and with spatial memory deficits. These data support a correlation between exposures to anesthetic agents and cognitive decline. Tau is hyperphosphorylated in PHFs, and specific phosphorylation sites have been implicated in the loss of tau’s association with the membrane cortex during AD disease state, including Ser 199/202, Thr 231, and Ser 396/404. Over-activation of proline-directed kinases such as cyclin-dependent kinase 5(CDk5) and glycogen synthase kinase 3(GSK3) has been implicated in the aberrant phosphorylation of tau at the proline- directed site (7). The hippocampal formation is essential for the processing of episodic memories for autobio- graphical events that happen in unique spatiotemporal contexts. Distinct regions, layers, and cells of the hippo- campal formation exhibit different profiles of structural and molecular development during early postnatal life. Anesthesia treatment Our research protocol was approved by the institutional animal research review board of Zhejiang University (Zju201301-1-02-021). Thirty-six 7-day-old male rats were allocated by computer-generated random numbers to a 6 h exposure in an anesthesia chamber with either 3% sevoflurane (H20100586; Abbott, Chicago, IL, USA) plus 60% oxygen (group S) or air as a normal control (group NC). Sevoflurane was delivered into the chamber by an agent-specific vaporizer. All anesthetized rats breathed spontaneously and underwent heart rate monitoring. As well, body temperature was monitored with a rectal probe and maintained between 36.0°C and 37.0°C by means of a heating pad. Rats were sacrificed at 1, 7 and 14 days following exposure, respectively, and were thus assigned to sevoflurane group (S1d, S7d, S14d groups, n = 6 in each) and normal control group (NC1d, NC7d, NC14d groups, n = 6 in each). Their brains were removed immediately after death and then frozen in dry ice and stored at (cid:1)70°C until used. Arterial blood gas analysis To determine the adequacy of ventilation, arterial blood was sampled immediately after removal from the mater- nal cage (0 h) or at the end of anesthesia (6 h) by obtain- ing a single sample (100 ll) from the left carotid artery using a 24 gauge SURFLO (Terumo, Tokyo, Japan) catheter. Bicarbonate concentration (millimoles per liter), oxygen saturation (%), pH, paCO2 (mmHg), and paO2 (mmHg) were measured immediately after blood collection, using a Nova Biomedical blood gas apparatus (ABL800; Radiometer, Copenhagen, Denmark). In this investigation, we examined the roles of Cdk5 and GSK3 in tau hyperphosphorylation in neonatal rat hippocampus induced by sevoflurane. We also assessed the effect of sevoflurane on the levels of tau phosphory- lation at phosphor-Ser396/404 and tau mRNA in the hippocampus of neonatal rat. Materials and methods Examination of microtubule structure by electron microscopy Animals The hippocampus was removed and cut into 1 mm3 fragments. These were then fixed in 2.5% glutaraldehyde for 2 hours followed by 1% osmium tetroxide (pH 7.3–7.4) for 1–2 h. After fixation, the samples were rinsed with buffer for 20 min, dehydrated, soaked, and Thirty-six neonatal male Wistar rats aged 7 days were purchased from Zhejiang Academy of Medical Science (Hangzhou, China) (SYXK(zhe)2005-0072). A balanced number of control and experimental animals were © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 1139 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein embedded. An ultra-thin slicer was used to cut slices of 1–10 lm thickness that were then stained and viewed under electron microscopy (model CM10; Philips, Ein- dhoven, captured through a CCD camera (model C4742-95; Hamamatsu, Bridgewater, NJ, USA) and Advantage CCD Camera System software (Advanced Microscopy Techniques Corporation, Danvers, MA, USA). the SYBR Green PCR signal was confirmed by melting curve analysis. Acquired data were analyzed by LIGHTCY- CLE 2000 software 3.5 (Roche). The Ct value of each gene was normalized against that of GAPDH. Tau pri- mer sequences were as follows: tau-sense 5′ACC CCG CCA GGA GTT TGA C-3′, tau-antisense 5′-GAT CTT CGC CCC CGT TTG-3′ 244 bp, GAPDH-sense 5′- CTA CAA TGA GCT GCG TGT GGC-3′, GAPDH- antisense 5′-CAG GTC CAG ACG CAG GAT GGC-3′ 207 bp. the Netherlands). Images were Western blotting analysis for tau pSer396 and pSer404 All data are expressed as mean (cid:3) SD. SPSS 12.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Numerical data including Oxygen saturation, PaO2, PaCO2, pH, and the levels of tau phosphorylation at phosphor-Ser396/404 and tau mRNA between groups were analyzed by the Student’s t-test, and intragroup numerical data were analyzed by repeated measures ANOVA. Statistical significance was accepted as P < 0.05. For the Western blot analysis, samples (80 lg protein) were prepared using neonatal rat hippocampal tissue. These were mixed with sample buffer, separated by 10% SDS-PAGE and electroblotted to a nitro cellulose mem- brane. The membrane was blocked for 1 hour at room temperature with blocking solution (5% nonfat milk in Tris-buffered saline with Tween 20 [TBST]). Blots were then incubated overnight at 4°C with the specific rat monoclonal antibodies anti-pSer396 (sc-101815) and anti-pSer40 (sc-12952) (1 : 200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA) or b-actin anti- body (Santa Cruz Biotechnology). The samples were then washed three times and incubated with a horserad- ish peroxidase-labeled second antibody rabbit anti-rat IgG (1 : 2000 dilution; GE Healthcare, Shanghai, China) for 1 h at room temperature prior to visualiza- tion with a chemiluminescence detection technique (Su- perSignal West Pico Chemiluminescent Substrates; Pierce Biotechnology, Rockford, IL, USA). Densitomet- ric techniques were performed to quantify the protein band absorbance (GEL-PRO ANALYZER software; Bio-Rad Laboratories, Hercules, CA, USA) and expressed as rel- ative densitometric units of the corresponding control. Results The results of arterial blood gas analysis To assess the effects of selected anesthetics on the devel- oping brain, we exposed the rats to sevoflurane for 6 h. There were no signs of metabolic or respiratory distress. Oxygen saturation, PaO2, PaCO2, and pH did not differ significantly comparing with the control animals exposed to air for 6 h (Table 1). The observation of microtubes by electron microscopy The microtubule cytoskeleton was arranged in neat rows and parallel to each other in the NC group, whereas the microtubules were arranged in a disorderly and inter- mittent fashion and were not parallel to each other in group S (Figure 1). Tau assay and quantitative real-time PCR Total RNA was isolated from sevoflurane group and control group. Hippocampus neurons using the RNA- easy mini kit (Takara, Dalian, China) according to the manufacture’s instruction. First-strand cDNA was syn- thesized from 5 lg of total RNA using the Super Script III first-strand synthesis kit (Takara) and random hex- amer system (Roche, Shanghai, China). Quantification of the target genes was performed with Power SYBR Green PCR master mix kit (ABI, Carlsbad, CA, USA) in Bio-Rad MX3000P real-time PCR system according to the manufacturer’s instructions. Triplicate quantita- tive reverse transcription PCRs were carried out for each sample. The PCR amplification cycles were as follows: initial denaturation at 95°C for 15 min, followed by 40 cycles with denaturation at 95°C for 20 s, and annealing-extension at 60°C for 35s. The specificity of The expression of tau mRNA in neonatal rat hippocampus tissues The levels of tau mRNA in the S1d and S 7d groups were significantly higher than those in the NC1d and NC7d groups(P < 0.05). There was no significant difference in the levels of tau mRNA between S14d and NC14d groups (P > 0.05; Figure 2). The expression of tau protein Ser396 site in neonatal rat hippocampus issues The levels of tau protein at Ser396 in S1d, and S7d groups were significantly higher than those in NC1d, and NC7d groups (P < 0.05). There were no significant difference 1140 © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein Table 1 Arterial blood gas analysis. Neonatal exposure to 3% sevoflurane does not induce significant cardiorespiratory dysfunction. Analysis of arterial blood gas revealed no significant differences in any of the measured parameters between rats exposed for 6 h to sevoflurane and control rats exposed to air for 6 h (t-test, all P values > 0.05) Arterial blood gas PaO2, mmHg PaCO2, mmHg pH SaO2 Time, h 98.6 (cid:3) 0.3 99.3 (cid:3) 0.7 98.6 (cid:3) 0.4 98.2 (cid:3) 0.8 98.6 (cid:3) 8.5 99.1 (cid:3) 10.2 98.7 (cid:3) 6.3 98.2 (cid:3) 12.5 39.9 (cid:3) 5.7 40.2 (cid:3) 3.9 41.2 (cid:3) 4.4 42.5 (cid:3) 7.2 7.41 (cid:3) 0.03 7.40 (cid:3) 0.04 7.43 (cid:3) 0.06 7.42 (cid:3) 0.03 Exposed to air for 6 h (n = 18) Exposed to 3% sevoflurane for 6 h (n = 18) 0 6 0 6 PaCO2, arterial carbon dioxide tension; PaO2, arterial oxygen tension; SaO2, arterial oxygen saturation. (b) (a) (c) (d) Figure 1 Electron microscopic examination of hippocampal neurons from 7-day-old rats exposed for 6 h in an anesthesia chamber to either 3% sevoflurane in 60% oxygen or air. Anesthesia caused dis- array of microtubule in rat hippocampus. Neonatal rats (7 day) were exposed to air (a) or 3% sevoflurane plus 60% oxygen (b–d) for 6 h, then the hippocampal tissues were taken and examined by electron microscopy. After exposure to air for 6 h (a), the microtubules were arranged in neat parallel rows. After exposure to 3% sevoflurane plus 60% oxygen for 6 h (b–d), the microtubules were arranged in a disor- derly and intermittent fashion and were not in parallel with each other (b), or became disrupted, indistinct and have lost the normal order of arrangement (c,d). Arrows indicate the microtubule structures. Scale bars: 0.2 lm. (magnification 960 000). and tau mRNA in neonatal rat hippocampus following the administration of 3% sevoflurane for 6 h. We found that sevoflurane induced increased levels of tau mRNA at 1 and 7 days as well as producing excessive phosphor- ylation of tau protein at Ser404 at 1, 7, and 14 days and Ser396 at 1 and 7 days in neonatal rat hippocampus. These results suggest that sevoflurane may induce neuro- toxicity in neonatal rats. This is consistent with recent evidence that different types of anesthetic agents, includ- ing sevoflurane, promote tau phosphorylation (6). Furthermore, in our study on electron microscopy, we observed that hippocampal neuron microtubules were significantly changed and became disorganized follow- ing sevoflurane exposure. in the levels of tau protein at Ser396 between the S14d and the NC14d groups, respectively (P > 0.05; Figure 3). The expression of tau protein Ser404site in neonatal rat hippocampus tissues The levels of tau protein at Ser404 in S1d, S7d, and S14d groups were significantly higher than those in NC1d, NC7d, and NC14d groups. (P < 0.05; Figure 4). Discussion In this study, we investigated the effects of sevoflurane on the levels of tau phosphorylation at phosphor-Ser396/404 © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 1141 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein We chose sevoflurane anesthesia because a recent study by Satomoto et al. (9) indicated that anesthesia with 3% sevoflurane plus 60% oxygen for 6 h does not significantly alter blood gas and brain blood flow. At the same time, we hypothesized that this high concentra- tion of sevoflurane anesthesia would be sufficient to demonstrate changes in tau phosphorylation at phos- phor-Ser396/404 and tau mRNA in the brain tissues of neonatal rats. The tau protein is the taylorism end product of selective montaging from a single gene designated microtubule-associated in humans (10). Its primary function is to regulate the stabilization of axonal microtubules, and it has two means of dominating microtubule stability: isoforms and phosphorylation. Moreover, hyperphosphoryla- tion of the tau protein (tau inclusions, p-tau) can lead to the self-assembly of tangles of paired helical fila- ments and straight filaments involved in the pathogen- esis of Alzheimer’s disease and other tauopathies (11). In other neurodegenerative diseases, the deposition of assemblages substantial in certain tau isoforms has been found. When misfolded, this otherwise extraordi- narily soluble protein can constitute exceedingly insol- uble assemblages resulting in a few neurodegenerative diseases. Recent research (5) suggests that tau protein (MAPT) protein tau Figure 2 The expression of tau mRNA (mean (cid:3) SD). After exposure to 3% sevoflurane in 60% oxygen for 6 h, the levels of tau RNA in the S1d and S7d groups were significantly higher than those in the NC1d and NC7d groups (P < 0.05). There was no significant difference in the levels of tau mRNA between S14d and NC14d groups (P > 0.05). There were 6 rats in each group at each time point. *P < 0.05 compared with the control group. (a) (b) respectively (P > 0.05). *P < 0.05, compared with the control group. (a) The expression of p-tau protein Ser396 site by Western blot analy- sis; S, sevoflurane group; NC, control group. (b) Quantitative expres- sion of p-tau protein Ser396 site. The data are expressed as mean (cid:3) SD (ratio to b-actin). There were six rats from each group at each time point. Figure 3 The expression of p-tau protein Ser396 site in neonatal rat hippocampus tissues. After exposure to 3% sevoflurane in 60% oxygen for 6 h, the levels of tau protein at Ser396 in the S1d and S7d groups were significantly higher than those in the NC1d and NC7d groups (P < 0.05). There were no significant differences in the levels of tau protein at Ser396 between the S14d and the NC14d groups, (a) (b) Figure 4 The expression of p-tau protein pSer404 in neonatal rat hip- pocampus tissues. After exposure to 3% sevoflurane plus 60% oxy- gen for 6 h, the levels of tau protein at Ser404 in S1d, S7d, and S14d groups were significantly higher than those in NC1d, NC7d, and NC14d groups (P < 0.05). *P < 0.05, compared with the control group. (a) The expression of p-tau protein Ser404 site by western blot analysis; S, sevoflurane group; NC, control group. (b) quantitative expression of p-tau protein Ser404 site. The data are expressed as mean (cid:3) SD (ratio to b-actin).There were six rats from each group at each time point. 1142 © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein might be discharged extracellularly by an exosome- based mechanism in Alzheimer’s disease and in anes- thetic neurotoxicity in neonatal animals with similar geriatric neuroapoptosis. Lunardi et al. found that anesthesia caused long-lasting ultrastructural dis- array in the subicular neuropil and mitochondria of 21-day-old rats. Head et al. (13) showed that isoflura- ne significantly decreased the number of synapses in the hippocampus compared with baseline in postnatal day (PND) 5 mice. Our electron microscopic finding in hippocampal neurons of microtubular disorganiza- tion supports the finding of Planel et al. (14). They found that exposure to isoflurane at clinically relevant doses led to increased levels of phospho-tau, increased insoluble aggregated forms of tau and detachment of tau from microtubules. these It microtubular structure changes may destroy the stabil- ity of microtubules, damage axonal transport and eventually led to neuroapoptosis. of nontransgenic mice. Some phosphorylation sites have been linked to specific aspects of tau pathology such as the sequestration of normal tau, the inhibition of tau MT binding, and the promotion of tau aggre- gation. Planel et al. (14) also demonstrated that in JNLP3 mice, a mouse model of tauopathy expressing P301L mutant tau that exposure to 1.3% isoflurane for 4 h increased tau phosphorylation at the AT8, CP13(Ser202), pS262, MC6, and PHF-1 epitopes. Recently, Tan et al. (19) confirmed these results in rats and demonstrated that 1.5% isoflurane for 2 h resulted in tau hyperphosphorylation at the Thr205 and Ser396 epitopes in the hippocampus and attrib- uted this effect to anesthesia-induced hypothermia. Our study showed that tau protein at Ser404 was excessively hyperphosphorylated after and 14 days, and at Ser396 after 1 and 7 days in neonatal rat hippocampus following sevoflurane anesthesia. Therefore, consistent with the findings of Van der Jeugd, sevoflurane may lead to neuronal apoptosis in the developing rodent brain through tau hyperphosph- orylation at the Ser396 and Ser404 sites. (20). (12) 1, is probable that 7, The hippocampus is involved in learning and in con- solidation of explicit memories from short-term memory to cortical memory storage for the long term; its precise role in memory storage remains an active area of research and is beyond the scope of this research. Recent investigations have shown both that activation of a mutant tau gene in mice results in neuronal loss, brain atrophy, and memory impairment; and that inhibition of the mutant tau gene leads to cessation of neuronal loss, decreased atrophy of brain, and improvement in memory (15). Increased tau phosphorylation following anesthesia has also been observed with sodium pento- barbital, ketamine, or urethane (16). Yan et al. (5) examined the effects of sevoflurane on caspase-3 activa- tion and Ablevels in the brain tissues of neonatal mice and concluded sevoflurane may induce neurotoxicity. Our research showed that in the newborn rats sevoflura- ne induced increased levels of tau mRNA at 1 and 7 days followed by a decline by day 14. This suggests that a mechanism of sevoflurane-induced neurotoxicity could occur through activation of mutant tau genes. This study has some limitations. Firstly, a 6-h-long exposure to sevoflurane in a 7-day-old rat pup has potentially small clinical relevance. Secondly, we did not correlate our findings with testing for learning and mem- ory defects. Thirdly, our observations of phosphoryla- tion of tau protein and microtubular disarray are suggestive, but not conclusive about the possible mecha- nisms for sevoflurane neurotoxicity. Finally, compara- bility of our work with those of others is confounded by differences in experimental animal ages, test parameters, and the dose, duration and method of administration of sevoflurane. Future studies will help elucidate these mechanisms. In conclusion, we have shown that sevoflurane, the most commonly used neonatal general anesthetic, can induce an increase in the levels of tau mRNA as well as excessive phosphorylation of tau protein at Ser396 and Ser404 in neonatal rat hippocampus. As well, we observed electron microscopic evidence of microtubular disarray in the hippocampus of sevoflurane-exposed rats. These findings suggest that sevoflurane anesthesia (up to 3%) may be neurotoxic in neonatal rats. These findings should support the need for further studies to determine the potential neurotoxicity of sevoflurane anesthesia in the developing brain of animals and humans. Phosphorylation of tau is adjusted by a host of kin- ases, containing PKN, a serine/threonine kinase, which phosphorylates tau, giving rise to destruction of microtubule organization. Because the hyperphosph- orylated tau was situated at the PHF-1(S396/S404) and threonine (T) T231 positions (17) in the intraneu- the PHF-1(S396/ rofibrillary tangles S404) was chosen to as the marker of sevoflurane- induced neurotoxicity in our study. Planel et al. (18) observed anesthesia induced by chloral hydrate, sodium pentobarbital, or isoflurane resulted in a robust hyperphosphorylation of tau at PHF-1 (Ser396/Ser404) epitopes in the brain stage, (NFT) short-term (30–60 min) that Acknowledgments This work was the Ministry of Education, Zhejiang, China (Y201017446), supported by the project of © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144 1143 14609592, 2013, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pan.12263 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License Z. Hu et al. Effects of sevoflurane on the expression of tau protein the Bureau of (Y201121392) and the project of Chinese Medicine, Zhejiang, China (2011ZA067) and the Project of Medical Technology, Zhejiang, China (2013ZDA011), (2013KYB193). The Authors wish to thank the Key Laboratory for Diagnosis and Therapy of Neonatal Diseases and the Key Laboratory of Reproductive Genetics, Zhejiang University, Ministry of Education, Zhejiang, China, for their support. Conflict of interest No conflicts of interest declared. References 15 Santacruz K, Lewis J, Spires T et al. Tau suppression in a neurodegenerative mouse model improves memory function. Science 2005; 309: 476–481. 7 Shahani N, Brandt R. Functions and mal- functions of the tau proteins. Cell Mol Life Sci 2002; 59: 1168–1680. 1 Jevtovic-Todorovic V, Hartman RE, Izumi Y et al. Early exposure to common anes- thetic agents causes widespread neurodegen- eration in the developing rat brain and persistent learning deficits. J Neurosci 2003; 23: 876–882. 8 The Ministry of Science and Technology of the People s Republic of China. Guidance Suggestions for the Care and Use of Labora- tory Animals. 2006-09-30. 16 Holscher C, van Aalten L, Sutherland C. Anaesthesia generates neuronal insulin resis- tance by inducing hypothermia. BMC Neuro- sci 2008; 9: 100. 2 Fredriksson A, Ponte′n E, Gordh T et al. Neonatal exposure to a combination of N-methyl-D-aspartate and gamma- aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegenera- tion and persistent behavioral deficits. Anesthesiology 2007; 107: 427–436. 9 Satomoto M, Satoh Y, Terui K et al. 17 Augustinack JC, Schneider A, Mandelkow EM et al. Specific tau phosphorylation sites correlate with severity of neuronal cytopa- thology in Alzheimer’s disease. Acta Neuro- pathol 2002; 103: 26–35. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 2009; 110: 628–637. 10 Sultan A, Nesslany F, Violet M et al. Nuclear tau, a key player in neuronal DNA protection. J Biol Chem 2011; 286: 4566–4575. 3 Nishikawa K, Harrison NL. The actions of sevoflurane and desflurane on the gamma- aminobutyric acid receptor type A: effects of TM2 mutations in the alpha and beta subun- its. Anesthesiology 2003; 99: 678–684. 4 Hollmann MW, Liu HT, Hoenemann CW 18 Planel E, Richter KE, Nolan CE et al. Anes- thesia leads to tau hyperphosphorylation through inhibition of phosphatase activity by hypothermia. J Neurosci 2007; 27: 3090–3097. 11 Iqbal K, Liu F, Gong CX et al. Tau in Alzheimer disease and related tauopathies. Curr Alzheimer Res 2010; 7: 656–664. 12 Lunardi N, Ori C, Erisir A et al. General 19 Tan W, Cao X, Wang J et al. Tau hyper- et al. Modulation of NMDA receptor func- tion by ketamine and magnesium, part II: interactions with volatile anesthetics. Anesth Analg 2001; 92: 1182–1191. phosphorylation is associated with memory impairment after exposure to 1.5% isoflurane without temperature maintenance in rats. Eur J Anaesthesiol 2010; 27: 835–841. Anesthesia causes long-lasting disturbances in the ultrastructural properties of develop- ing synapses in young rats. Neurotox Res 2010; 17: 179–188. 5 Lu Y, Wu X, Dong Y et al. Anesthetic sevo- flurane causes neurotoxicity differently in neonatal na€ıve and Alzheimer disease trans- genic mice. Anesthesiology 2010; 112: 1404–1416. 20 Van der Jeugd A, Ahmed T, Burnouf S et al. Hippocampal tauopathy in tau transgenic mice coincides with impaired hippocampus- dependent learning and memory, and attenuated late-phase long-term depression of synaptic transmission. Neurobiol Learn Mem 2011; 95: 296–304. 13 Head BP, Patel HH, Niesman IR et al. Inhi- bition of p75 Neurotrophin receptor attenu- ates Isoflurane-mediated neuronal apoptosis in the neonatal central nervous system. Anes- thesiology 2009; 110: 813–825. 6 Le Freche H, Brouillette J, Fernandez- 14 Planel E, Bretteville A, Liu L et al. Accelera- tion and persistence of neurofibrillary pathol- ogy in a mouse model of tauopathy following anesthesia. FASEB J 2009; 23: 2595–2604. Gomez FJ et al. Tau phosphorylation and sevoflurane anesthesia: an association to postoperative cognitive impairment. Anes- thesiology 2012; 116: 779–787. 1144 © 2013 John Wiley & Sons Ltd Pediatric Anesthesia 23 (2013) 1138–1144",rats,['Thirty-six 7-day-old rats were randomly exposed for 6 h to either 3% sevoflurane (S) or air (NC) as a placebo.'],postnatal day 7,['Thirty-six 7-day-old rats were randomly exposed for 6 h to either 3% sevoflurane (S) or air (NC) as a placebo.'],N,[],sevoflurane,['Thirty-six 7-day-old rats were randomly exposed for 6 h to either 3% sevoflurane (S) or air (NC) as a placebo.'],none,[],wistar,"['Thirty-six neonatal male Wistar rats aged 7 days were purchased from Zhejiang Academy of Medical Science (Hangzhou, China) (SYXK(zhe)2005-0072).']",The study sought to investigate the effects of sevoflurane on the levels of tau phosphorylation and tau mRNA in the hippocampus of neonatal rats.,"['General anesthesia induces a transient hyperphosphorylation of tau protein that is associated with neurotoxicity in neonatal rats, but the mechanism remains unknown. The current study sought to investigate the effects of sevoflurane on the levels of tau phosphorylation at phosphor- Ser396/404 and total tau mRNA in the hippocampus of neonatal rats.']",None,[],"The findings suggest that sevoflurane anesthesia may be neurotoxic in neonatal rats, implicating potential neurotoxicity through increased levels of tau mRNA and excessive phosphorylation of tau protein.","['In rat hippocampus, sevoflurane was associated with microtubular disarray as well as increased levels of tau mRNA and excessive phosphorylation of tau protein at Ser396 and Ser404. This implicates that sevoflurane may induce neurotoxicity.']","The study's limitations include a potentially small clinical relevance due to the 6-hour-long exposure to sevoflurane in 7-day-old rat pups, lack of correlation with learning and memory defects testing, and the observational nature of phosphorylation of tau protein and microtubular disarray.","['This study has some limitations. Firstly, a 6-h-long exposure to sevoflurane in a 7-day-old rat pup has potentially small clinical relevance. Secondly, we did not correlate our findings with testing for learning and memory defects. Thirdly, our observations of phosphorylation of tau protein and microtubular disarray are suggestive, but not conclusive about the possible mechanisms for sevoflurane neurotoxicity.']",None,[],True,True,True,True,True,True,10.1111/pan.12263 10.4196/kjpp.2017.21.6.579,827.0,Jiang,2017,rats,postnatal day 7,Y,isoflurane,none,sprague dawley,"Korean J Physiol Pharmacol 2017;21(6):579-589 https://doi.org/10.4196/kjpp.2017.21.6.579 Original Article Genistein attenuates isoflurane-induced neurotoxicity and improves impaired spatial learning and memory by regulating cAMP/CREB and BDNF-TrkB-PI3K/Akt signaling Tao Jiang1, Xiu-qin Wang1, Chuan Ding1, and Xue-lian Du2,* Departments of 1Anesthesiology, 2Gynecology, Shandong Cancer Hospital, Jinan 250117, Shandong Province, China ARTICLE INFO Received June 6, 2016 Revised August 2, 2016 Accepted August 18, 2016 Correspondence Xue-lian Du E-mail: xueliandu@hotmail.com Key Words BDNF CREB Genistein Isoflurane Neurodegeneration Phosphatidylinositol 3-kinase ABSTRACT Anesthetics are used extensively in surgeries and related procedures to prevent pain. However, there is some concern regarding neuronal degeneration and cognitive deficits arising from regular anesthetic exposure. Recent studies have indicated that brain-derived neurotrophic factor (BDNF) and cyclic AMP response element-binding protein (CREB) are involved in learning and memory processes. Genistein, a plant-derived isoflavone, has been shown to exhibit neuroprotective effects. The present study was performed to examine the protective effect of genistein against isoflurane-induced neurotoxicity in rats. Neonatal rats were exposed to isoflurane (0.75%, 6 hours) on postnatal day 7 (P7). Separate groups of rat pups were orally administered genistein at doses of 20, 40, or 80 mg/kg body weight from P3 to P15 and then exposed to isoflurane anesthesia on P7. Neuronal apoptosis was detected by TUNEL assay and FluoroJade B staining following isoflurane exposure. Genistein significantly reduced apoptosis in the hippocampus, reduced the expression of proapoptotic factors (Bad, Bax, and cleaved caspase-3), and increased the expression of Bcl-2 and Bcl-xL. RT-PCR analysis revealed enhanced BDNF and TrkB mRNA levels. Genistein effectively upregulated cAMP levels and phosphorylation of CREB and TrkB, leading to activation of cAMP/CREB-BDNF-TrkB signaling. PI3K/Akt signaling was also significantly activated. Genistein administration improved general behavior and enhanced learning and memory in the rats. These observations suggest that genistein exerts neuroprotective effects by suppressing isoflurane-induced neuronal apoptosis and by activating cAMP/CREB-BDNF-TrkB-PI3/Akt signaling. INTRODUCTION Inhalation anesthetics, such as isoflurane, are commonly used in clinical practice. However, accumulating experimental evidence suggests that early exposure to volatile anesthetics can cause neurodegeneration in the developing animal brain [1-5]. Furthermore, anesthetic exposure has been reported to show correlations with persistent learning and behavioral deficits [6,7]. Various mechanisms have even been proposed for anesthetic- induced neuroapoptosis and memory deficits [8-10]. A better understanding of the mechanisms would aid the development of strategies that could prevent or reduce anesthetic-induced apoptosis and memory impairments. Cyclic AMP response element-binding protein (CREB) is widely involved in learning and memory [11] and in long-term potentiation (LTP) [12]. CREB plays critical roles in hippocampal neurogenesis, neuronal survival and differentiation, and neuroprotection [13-15]. Inhibition of phosphodiesterase-4 (PDE4) leads to increased cAMP levels, resulting in phospho- rylation of CREB [16,17]. Phosphorylation/activation of CREB This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright © Korean J Physiol Pharmacol, pISSN 1226-4512, eISSN 2093-3827 Author contributions: T.J. and X.-L.D. designed this study. T.J., X.-Q.W., C.D. and X.-L.D. performed the experiments. C.D. and X.-L.D. analyzed the data and prepared the manuscript. www.kjpp.net 579 Korean J Physiol Pharmacol 2017;21(6):579-589 580 (pCREB) was found to be critical for long-term memory consolidation [18,19]. Further studies showed that anesthetic isoflurane and sevoflurane downregulate cAMP/CREB signaling [9,20]. Brain-derived neurotrophic factor (BDNF) is an important neuroprotective factor that plays significant roles in neuronal development, synaptogenesis, learning, and memory [21,22]. BDNF exerts its functions through activation of specific cell surface receptors, TrkB and p75 neurotrophin receptor [23]. Activation of TrkB was shown to be essential for the survival- promoting functions of BDNF [24]. Furthermore, BDNF activates the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) signaling pathway in neurons [25]. The PI3K/Akt pathway is expressed widely in the CNS, and it mediates cell survival, proliferation, and differentiation. It is also involved in learning and memory formation [26,27]. Initiation of the BDNF/TrkB/ PI3-K/Akt signal pathway in the hippocampus is crucial for working memory formation [28]. Impaired BDNF-TrkB signaling has recently been proposed in anesthetic-induced neurotoxicity [29]. Genistein, 5,7-dihydroxy-3-(4-hydroxyphenyl)-4H-1-benzo- pyran-4-one, is an isoflavone widely present in leguminous plants [30]. Genistein was found to exert a wide spectrum of biological activities, including antioxidant [31], anti-inflammatory [32], hepatoprotective [33], neuroprotective [34], and antimetastatic effects [35]. The present study was performed to determine whether genistein can reduce neuronal apoptosis, modulate cAMP/CREB–BDNF/TrkB/PI3K signaling, and improve memory and learning in rats exposed to isoflurane. METHODS Chemicals and reagents Genistein and isoflurane (0.75%) were obtained from Sigma- Aldrich (St. Louis, MO, USA). For expression analysis, antibodies against CREB, p-CREB, cleaved caspase-3, Bcl-2, Bad, Bcl-xL, Bax, β-actin, phosphatase and tensin homolog (PTEN), and mammalian target of rapamycin complex 1 (mTORc1) were purchased from Cell Signaling Technology (Beverly, MA, USA). Akt, p-Akt, GSK-3β, p- GSK-3β, BDNF, TrkB, and p-TrkB were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). PDE4 and Ca2+/calmodulin-dependent kinase IV (CaMKIV) were from Abcam. All other chemicals and reagents used in the present study were purchased from Sigma-Aldrich unless otherwise noted. Animals This study and its experimental design were approved by the animal experimentation ethics committee of the hospital, and Korean J Physiol Pharmacol 2017;21(6):579-589 Jiang T et al all techniques were performed in compliance with the guidelines issued for the care and use of laboratory animals by the NIH and National Animal Welfare Law of China. Pregnant Sprague– Dawley rats were housed in individual sterile plastic cages under standard animal house conditions (12-h day/night cycle, 23oC±2oC) at 55~65% humidity levels. The rats were given free access to standard pellet food and water. Animals were monitored carefully for the birth of pups, and the day on which pups were born was designated as postnatal day 0 (P0). The pups were housed in sterile cages and carefully maintained under the same conditions as described above. Anesthesia exposure Separate groups of rat pups were treated orally with genistein at 20, 40, or 80 mg/kg body weight every day from P3 to P15 along with the standard diet. On P7, the pups were exposed to 0.75% isoflurane (6 h) in 30% oxygen or air [~0.3 minimum alveolar concentration (MAC)] as described by Orliaguet et al.[36] in a temperature-controlled chamber [5]. Rats in the control group were not exposed to isoflurane and were not given genistein. P7 was chosen for anesthetic exposure based on previous studies suggesting that rats are most sensitive to anesthesia-induced neuronal damage during this period [1]. For analysis of neuroapoptosis, cAMP levels, and gene expression, the rat pups were sacrificed 1 h after anesthetic exposure. The animals were perfused transcardially with ice-cold saline and 4% paraformaldehyde in 0.1 M phosphate buffer. Determination of neuroapoptosis by TUNEL assay The influence of genistein on isoflurane-induced neuronal apoptosis was determined by TUNEL assay as described by Li et al. [5]. The brain tissues were cut into sections at a thickness of 5 µm, and apoptosis was assessed using the Dead EndTM fluorometric TUNEL system kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The numbers of TUNEL-positive cells in the hippocampal CA1, CA3, and dentate gyrus sections were determined and analyzed using NIS-Elements BR image processing and analysis software (Nikon Corporation, Tokyo, Japan). The concentration of TUNEL-positive cells in each region is presented as the number of TUNEL-positive cells/mm2. Fluoro-Jade B staining Fluoro-Jade B (FJB) staining was performed to determine neurodegeneration. Hippocampal sections (30 µm thick) were fixed on slides coated with gelatin and dried at room temperature overnight. Slides were rehydrated and then incubated in potassium permanganate (0.06%) for 15 min, rinsed with distilled H2O, and stained with FJB. The sections were further incubated with 0.1% acetic acid for 30 min and observed under a microscope https://doi.org/10.4196/kjpp.2017.21.6.579 Genistein attenuates isoflurane-induced neurotoxicity (DM IRB; Leica, Wetzlar, Germany). Determination of cyclic AMP Cyclic AMP (cAMP) levels in the hippocampal tissues were determined using a cAMP complete ELISA kit in accordance with the manufacturer’s protocol (Enzo Life Sciences, Farmingdale, NY, USA). The cAMP levels were expressed as pmol/mg. RT-PCR analysis RT-PCR was performed to assess the influence of genistein on BDNF and TrkB gene expression in the hippocampal tissues of isof lurane anesthesia-treated rat pups. Total RNA was isolated from the hippocampi using Trizol (Invitrogen, Carls- bad, CA, USA), and the RNA concentration was determined using a Nanodrop spectrophotometer (ND 1000; Bio-Rad, Hercules, CA, USA). First-strand complementary DNA (cDNA) was synthesized using the Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA). PCR was performed according to the manufacturer’s protocol. The primer sequences for BDNF and TrkB were as follows: BDNF, For ward: 5'-CGA AGAGCTGCTGGATGAG-3', Reverse: 5'-ATGGGATTACACTTGGTCTCG-3'. Trk B, Forward: 5'-CCTCCACGGATGTTGCTGA-3', Reverse: 5'-GGCTGTTGGTGATACCGAAGTA-3'. GAPDH expression was assessed as an internal control using the following primer sequences: Forward: 5'-CCGTATCGGACGCCTGGTTA-3', Reverse: 5'-GGCTGTTGGTGATACCGAAGTA-3'. PCR products were separated on agarose gels (1%) and stained with 0.05% ethidium bromide. Band intensities were analyzed using a Bio Gel imagery apparatus (Bio Rad). Immunoblotting The harvested hippocampal tissues were subjected to ex- pression analysis by Western blotting as described previously [37,38]. Briefly, the tissues were homogenized in lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Nonidet P-40) with protease inhibitors (aprotinin, pepstatin A, and leupeptin) at mg/mL concentrations for protein extraction. The cell lysate was centrifuged (12,000 g for 10 min at 4oC), the supernatant was removed, and the total protein concentration was determined using a protein assay kit (Bio-Rad). Equal amounts of sample protein (50 µg) were electrophoresed in NuPAGE Novex Bis-Tris gradient gels (Invitrogen). The separated bands were then blotted onto nitrocellulose membranes and incubated with blocking solution (0.1% TBST and 5% non-fat milk) for 2 h, followed by incubation with primary antibodies overnight at 4oC. The membranes were washed three times in TBST and then incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology) for 60 min. Following five www.kjpp.net to six washes in TBST, immunoreactive bands were visualized using an ECL detection kit (GE Healthcare, Fairfield, CT, USA) and analyzed using Image J software (NIH Image, Bethesda, MD, USA). Protein expression was normalized relative to the expression of β-actin as an internal standard. Behavioral analysis: open field test P35 rats exposed to anesthesia on P7 were subjected to open field tests to evaluate their anxiety behavior and general locomotory activity. The rats were placed in a white plastic chamber (100×100×100 cm) for 5 min, and exploratory behavior in the novel environment was recorded using a video tracking system (XR-XZ301; Shanghai Soft maze Information Technology Co., Ltd., Shanghai, China). Fear conditioning test Hippocampal-dependent and -independent responses were assessed by a fear conditioning test performed as described previously [39,40]. P35 rats were subjected to fear stimuli. Each rat was placed in a test chamber in a dark room. The chamber had grid floors with stainless steel bars attached to a shock delivery system (Coulbourn, Whitehall, PA, USA). The animals were exposed to three tone–foot shock pairings (tone: 2000 Hz, 85 db, 30 s followed by foot shock: 1 mA, 2 s) at 1-min intervals. Animals were removed from the chamber 30 s after conditioning. After 24 h, the same animals were placed in the chamber, one animal at a time for a period of 8 min, in the absence of tone and electric shock. The behavior and freezing response of the animals were recorded. Two hours later, the animals were placed in a test chamber that varied from the first test chamber in context and smell (instead of ethanol, as used in the first chamber, 1% acetic acid was used to wipe the second chamber) in a relatively light room. Freezing responses were documented for 3 min without auditory conditioning stimulus. The auditory stimulus was turned on for 30 s in three cycles with a 60 s inter-cycle interval. The freezing behavior was recorded. Learning and memory analysis: Morris water maze test The Morris water maze test was used to assess learning ability and memory retention. For the Morris water maze test (Shanghai Jiliang Software Technology Co. Ltd., Shanghai, China), a circular pool was filled with warm water (25±1oC) approximately 1.5 cm above a transparent round platform 15 cm in diameter that was placed in any of the four quadrants of the pool. The platform was placed in the same position throughout the training period. P31 rats that were administered genistein and/or exposed to isoflurane on P7 were trained to explore the maze. The rats were trained in two sessions/day for 4 consecutive days. The animals Korean J Physiol Pharmacol 2017;21(6):579-589 581 582 Jiang T et al were permitted to swim freely in the pool until they reached the platform. If the rats were unable to find the submerged platform within 60 s, they were directed to the platform and allowed to remain there for 30 s. The swimming path was observed using an automated video tracking system (ANY-maze video tracking system; Stoelting Co., Wood Dale, IL, USA). The time taken by the rats to reach the platform was recorded as the latency. After 4 days of trial sessions, cued trials were conducted on P35 to evaluate non-cognitive impairments, such as visual impairments and/or any difficulties in swimming. The circular pool was surrounded with a black cloth to hide any visual cues. The rats were subjected to four trials/day. Each rat was positioned in a defined place within the pool during the trials and was allowed to swim and locate the submerged platform, which was attached to a rod fixed ~20 cm above water level. The rod served as the cue. The time taken to locate the cued platform was recorded as mentioned above. For the place trials, the cloth surrounding the pool and the cue rod attached to the platform were removed. Rats were positioned at random points and allowed to locate the platform; the time taken to locate the platform was recorded. RESULTS Genistein inhibited isoflurane-induced neuroapoptosis Several studies have indicated severe neuronal death following exposure to volatile anesthesia [1,41]. Consistent with these previous reports, increased apoptotic cell counts were observed 6 h after isoflurane exposure in this study (Fig. 1A). A significant increase (p<0.05) in the TUNEL-positive cell count was observed in rat pups exposed to isoflurane alone. Staining with FJB, an anionic X fluorescein derivative that specifically stains degenerating neurons, also revealed severe neuronal apoptosis in the hippocampal CA1, CA3, and dentate gyrus regions (Fig. 1B), and increased numbers of FJB-positive neurons were seen in the hippocampi of P7 rat pups that had been exposed to isoflurane. Genistein at 20, 40, or 80 mg significantly (p<0.05) reduced FJB- positive cell counts, indicating decreased neuronal degeneration. Genistein at a dose of 80 mg, compared with lower doses, decreased TUNEL-positive and FJB-positive cell counts more effectively. Probe trials were conducted to assess memory retention. The test was performed 24 h after the place trials. The platform was placed in a different quadrant than where the submerged platform had been during the cued and place trials (target quadrant). The time spent by the rats in the target quadrant searching for the submerged platform was recorded. Statistics The results are presented as means±standard deviation (SD) of six independent experiments. Data were analyzed for statistical significance by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test as a post hoc analysis using SPSS (version 22.0; SPSS, Chicago, IL, USA). In all analyses, p<0.05 was taken to indicate statistical significance. Genistein modulated expression of proteins involved in the apoptotic pathway The greatest susceptibility to anesthetic neurotoxicity is considered to occur at P7, as rapid synaptogenesis and brain development occur at this time [1,42]. Therefore, we examined the effects of genistein on the levels of proteins involved in the apoptotic pathway, including cleaved caspase-3. Western blotting analysis revealed marked increases in cleaved caspase-3 levels, a marker of anesthetic-induced toxicity [1,43], following isoflurane exposure (Fig. 2). Further, significantly (p<0.05) enhanced expression levels of proapoptotic proteins, Bad and Bax, were seen with decreased (p<0.05) levels of the antiapoptotic proteins, Bcl- 2 and Bcl-xL (Fig. 2). These alterations in expression indicated A B Fig. 1. Genistein effectively reduced isoflurane-induced neuroapoptosis. The effect of genistein (20, 40 or 80 mg) on neuronal apoptosis following isoflurane exposure was assessed in the hippocampal regions by (A) TUNEL assay and (B) Fluoro-Jade B staining. Geinstein dose- dependently reduced isoflurane-induced apoptosis. The data are presented as mean±SD, n=6. aStatistically significant differences at p<0.05 vs respective control. b–fSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. Korean J Physiol Pharmacol 2017;21(6):579-589 https://doi.org/10.4196/kjpp.2017.21.6.579 Genistein attenuates isoflurane-induced neurotoxicity increased levels of apoptosis in the hippocampi of P7 rats. The enhanced expression levels of caspase-3, Bad, and Bax proteins were consistent with the changes in TUNEL-positive and FJB- positive cell counts. However, genistein administration to the rat pups prior to isoflurane markedly (p<0.05) inhibited expression of the proapoptotic proteins Bax and Bad, resulting in significant (p<0.05) increases in the expression levels of Bcl-2 and Bcl-xL. At all three doses evaluated, genistein enhanced antiapoptotic protein expression and reduced proapoptotic protein expression; however, the effect was more pronounced at a dose of 80 mg than at 40 mg or 20 mg genistein. The levels of Bad and Bax protein expression were reduced to 102.2% and 102.0% respectively, following treatment with 80 mg genistein. Genistein upregulated CREB activation neuroapoptosis, memory deficits, and cognitive impairments [44-46]. CREB is a significant downstream transcription factor of the cAMP and Ca2+ signal transduction pathways that critically regulates the expression of genes involved in memory consolidation [47,48]. We assessed the influence of genistein on CREB expression and activation. CREB and CaMKIV expression levels were significantly (p<0.05) reduced following isoflurane exposure (Fig. 3). Levels of phosphorylated CREB were also markedly (p<0.05) reduced, while expression of the enzyme PDE4 was upregulated (p<0.05). Nevertheless, genistein inhibited (p<0.05) PDE4 levels and enhanced phosphorylation of CREB in a dose-dependent manner. Genistein at a dose of 80 mg significantly (p<0.05) increased the expression levels of total CREB and CaMKIV to 101.0% and 100.0% respectively. The upregulation of phosphorylated CREB levels could be due to direct upregulation of phosphorylation by genistein or may be due to enhanced expression of CREB by genistein itself. However, Initial exposure to various anesthetic compounds causes A B Fig. 2. Genistein modulated the expression of proteins of the apoptotic cascade. (A) Western blotting analysis revealed that genistein significantly (p<0.05) reduced isoflurane-induced raised expressions of cleaved caspase-3, and pro-apoptotic proteins (Bad, and Bax), while geinstein markedly (p<0.05) up-regulated the expression of anti-apoptotic proteins, Bcl-2 and Bcl-xL. (B) Represents relative expressions of proteins with control expressions set at 100%. The data are presented as mean±SD, n=6. aStatistically significant difference at p<0.05 vs respective control. b–eSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test (Lane 1, Control; Lane 2, Isoflurane; Lane 3, Isoflurane+20 mg Genistein; Lane 4, Isoflurane+40 mg Genistein; Lane 5, Isoflurane +80 mg Genistein). A B Fig. 3. Genistein effectively upregulated CREB signalling. (A) Expression analysis by Western blotting revealed up-regulated CREB signaling in the hippocampal tissues on geinstein supplementation. Genistein significantly (p<0.05) increased isoflurane suppressed CREB phosphorylation and CaMKIV expression. (B) Represents relative expressions of proteins with control expressions set at 100%.The data are presented as mean±SD, n=6. aStatistically significant differences at p<0.05 vs respective control. b–eSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test (Lane 1, Control; Lane 2, Isoflurane; Lane 3, Isoflurane + 20 mg Genistein; Lane 4, Isoflurane + 40 mg Genistein; Lane 5, Isoflurane + 80 mg Genistein). www.kjpp.net Korean J Physiol Pharmacol 2017;21(6):579-589 583 584 Jiang T et al the enhanced phosphorylation of CREB along with upregulation of CaMKIV levels suggested activation of CREB and improved CREB signaling. Influence of genistein on cAMP levels CREB is phosphorylated and activated by the enzymes protein kinase A (PKA) and CaMKIV [47,49,50]. cAMP accumulation activates PKA [51]. We assessed the levels of cAMP following isoflurane exposure. A marked (p<0.05) decrease in cAMP levels after isoflurane exposure (Fig. 4) was observed, indicating that this decrease could have contributed in part to the decrease in CREB phosphorylation. Consistent with increased pCREB levels, we observed marked (p<0.05) increases in cAMP levels after genistein administration. The expression levels of cAMP increased by 0.41%, 0.67%, and 0.81% following treatment with genistein at doses of 20, 40, and 80 mg, respectively. These observations indicate that genistein can increase a part of CREB phosphorylation via the cAMP pathway, thereby upregulating cAMP/CREB signaling. Fig. 4. Genistein increased hippocampal cAMP levels. cAMP levels in the hippocampal tissues following isoflurane exposure was assessed by ELISA. Genistein was found to cause significant (p<0.05) increase in the cAMP levels in a dose-dependent manner. The data are presented as mean±SD, n=6. aStatistically significant difference at p<0.05 vs respective control. b–eSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. A B C D Fig. 5. Genistein up-regulated BDNF –TrkB signaling. The BDNF and TrkB expressions in the hippocampal tissues were assessed both at mRNA and as well protein levels. Genistein dose-dependently increased the expression of BDNF and TrkB at both (A and B) mRNA and (C and D) protein levels. (C and D) Geinstein increased phosphorylation of TrkB. (B and D) Represents relative expressions of proteins with control expressions set at 100%. the data are presented as mean±SD, n=6. aStatistically significant difference at p<0.05 vs respective control. b–fSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test (Lane 1, Control; Lane 2, Isoflurane; Lane 3, Isoflurane+20 mg Genistein; Lane 4, Isoflurane + 40 mg Genistein; Lane 5, Isoflurane+80 mg Genistein). Korean J Physiol Pharmacol 2017;21(6):579-589 https://doi.org/10.4196/kjpp.2017.21.6.579 Genistein attenuates isoflurane-induced neurotoxicity Effects of genistein on BDNF-TrkB expression Growth factor signaling induces the intracellular signaling cascade that leads to phosphorylation and activation of CREB [52]. Isoflurane was found to cause significant (p<0.05) downregulation of BDNF (Fig. 5) and TrkB expression. Activation of TrkB was reduced following exposure to isoflurane. RT-PCR analysis indicated significant (p<0.05) upregulation of BDNF and TrkB mRNA levels in rats administered genistein prior to anesthetic exposure. Further, BDNF and TrkB protein expression levels were upregulated (p<0.05). Genistein improved (p<0.05) TrkB activation in a dose-dependent manner, as indicated by significantly elevated (p<0.05) phosphorylated TrkB levels; phosphorylated TrkB levels increased by 66.7% after treatment with 20 mg genistein, while 80 mg genistein resulted in an increase of 93.2%. Genistein-mediated upregulation in phosphorylated TrkB levels could be due either to the direct inf luence of the drug on increased phosphorylation or to the increase in expression of TrkB itself. Genistein-mediated upregulated BDNF/TrkB signaling may have contributed to the increased levels of phosphorylated CREB expression. Genistein modulated PI3K/Akt signaling BDNF-TrkB-dependent and -independent cascades have been reported to modulate PI3K/Akt signaling, a major cell survival pathway in neurons [53,54]. After finding that genistein upregulates BDNF-TrkB expression, we also examined whether it modulates the PI3K/Akt pathway. We observed significant (p<0.05) reductions in the levels of Akt, GSK-3β, and mTORc1 (Fig. 6). Western blotting analysis revealed significant increases in PTEN levels after isoflurane exposure, indicating downregulation of the pathway. Further, marked upregulation of the phosphorylated forms of Akt and GSK-3β were observed A B Fig. 6. Genistein modulated the expression of PI3K/Akt pathway proteins. (A) Western blot analysis of the PI3K pathway proteins revealed that genistein upregulated the expression of Akt, GSK-3β, phospho-Akt and phospho- GSK-3β and mTORc1 while suppressed PTEN, signifying activation of PI3K/Akt signaling cascade. (B) The data are presented as mean±SD, n=6. aStatistically significant difference at p<0.05 vs respective control. b–fSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test (Lane 1, Control; Lane 2, Isoflurane; Lane 3, Isoflurane+20 mg Genistein; Lane 4, Isoflurane+40 mg Genistein; Lane 5, Isoflurane+80 mg Genistein). A B Fig. 7. Geinstein improved the general behavior of P35 rats following isoflurane exposure at P7. (A) The behavior of the rats in a novel environment was assessed by open-field test. Geinstein treatment improved the movement of the rats in comparison with isoflurane-alone exposed rats. (B) Genistein enhanced the freezing responses of P35 rats in context and cued fear conditioning tests. The data are presented as mean±SD, n=6. aStatistically significant difference at p<0.05 vs respective control. b–fSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. www.kjpp.net Korean J Physiol Pharmacol 2017;21(6):579-589 585 586 Jiang T et al A B Fig. 8. Geinstein effectively improved learning and memory of rats in the Morris water maze tests. (A) The escape latency of the rats during training sessions reveals that geinstein treatment reduced the latency time. (B) Genistein treatment enhanced the performance of the rats in identifying the submerged platform at a shorter latency time demonstrating effectively improved spatial navigation in cued and place trials. In probe trials geinstein-treated rats spent longer time looking out for the platform in the target quadrant in comparison with isoflurane-alone exposed rats, indicating improved memory retention on geinstein treatment. The data are presented as means±SD, n=6. aStatistically significant at p<0.05 vs respective control. b–fSignificant differences (p<0.05) between mean values as determined by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. in genistein-treated animals. The levels of mTORc1 were also significantly increased (p<0.05), while those of PTEN were markedly decreased (p<0.05). PTEN expression was decreased from 176.1% to 114% after treatment with 80 mg genistein. These observations indicated that genistein activated PI3K/Akt signaling and aided neuronal survival. The observed effects of genistein could be either direct and/or mediated by activation of BDNF-TrkB signaling. Genistein improved behavior The general behavior of P35 rats following isoflurane exposure on P7 was examined. In the open field test, minor changes in the behavior of the rats exposed to anesthesia were noticed in comparison with control rats (Fig. 7). The fear conditioning test, a reliable test used to assess learning capacity, was also performed. The fear responses to shock and noise were recorded as freezing responses. The responses to cued and context conditioning of rats exposed to isoflurane alone were significantly impaired (p<0.05) (Fig. 7). The intensities of the fear responses were much higher (p<0.05) in rats treated with genistein compared with those treated with isoflurane alone, suggesting better learning. and 4 between rats treated with genistein versus isoflurane alone; rats treated with genistein showed a latency similar to that of normal controls. The cued and place trials were performed to assess the ability of the rats to identify the submerged platform as a measure of their spatial navigation and memory. Rats exposed only to the anesthetic isoflurane showed longer escape latencies than did those in the other groups. This longer latency reflects the effects of isoflurane on spatial learning and memory. While the rats in the anesthetic control group took a longer time to reach the submerged platform in the pool, genistein-treated rats showed significantly better performance (Fig. 8). The animals took significantly (p<0.05) less time to reach the platform even in the absence of visual cues. Nevertheless, in probed trials, the rats treated with isoflurane alone spent considerably (p<0.05) less time in the target quadrant, suggesting impaired memory capacity. Rats administered genistein spent a longer time in the target quadrant searching for the platform. These observations indicated memory retention in the rats to search for the platform, suggesting that genistein supplementation significantly improved learning and memory in these animals. Genistein improved spatial learning and memory DISCUSSION Learning and memory are the most important features of cognition. We assessed learning and memory in P35 rats using Morris water maze tests. The experimental data revealed negligible changes in the escape latencies of the rats in the different test groups on day 1 of training (Fig. 8). Nevertheless, on day 2, minor changes in the latency were noted between rats exposed to isoflurane alone in comparison with the other groups; however, on days 3 and 4, the escape latencies were considerably longer. Differences were also noted in escape latencies on days 3 Inhalation anesthetics can cause neuroapoptosis in the evolving brain [1,5,55], and in line with earlier reports, the TUNEL assay and FJB staining revealed that exposure to isoflurane for 6 hours caused robust apoptosis in the hippocampal regions. Further, Western blot analysis was performed to assess the levels of cleaved caspase-3, a marker of apoptosis, and apoptotic pathway proteins. Isoflurane exposure caused significant upregulation of cleaved caspase-3 levels along with increased levels of the proapoptotic proteins Bax and Bad. Whereas the levels of Bad and Bax Korean J Physiol Pharmacol 2017;21(6):579-589 https://doi.org/10.4196/kjpp.2017.21.6.579 Genistein attenuates isoflurane-induced neurotoxicity increased, those of Bcl-2 and Bcl-xL were severely suppressed by isoflurane. Bcl-2 and Bcl-xL are antiapoptotic proteins that belong to the Bcl-2 family. They block the translocation of Bax to the mitochondria, maintain mitochondrial integrity and membrane potential, and prevent the discharge of cytochrome C from the mitochondria and the initiation of apoptosis [56]. The increased levels of Bcl-2 and Bcl-xL with decreased levels of Bad and Bax observed after genistein treatment are indicative of apoptosis suppression. Decreased cleaved caspase-3 levels were observed after genistein treatment. This suppression of proapoptotic proteins and cleaved caspase-3 could have contributed to decreased apoptotic cell counts as observed in the TUNEL and FJB staining assays. These observations suggest the potential protective effects of genistein against isoflurane-induced neurotoxicity. The PI3/Akt pathway is a major pathway involved in neuronal cell survival [57]. We observed significantly reduced expression of Akt, phosphorylated Akt, and mTORc1 following isoflurane exposure, indicating downregulated PI3K/Akt signaling. Genistein significantly increased Akt, phosphorylated Akt, and mTORc1 expression, while reducing PTEN levels in a dose-dependent manner, leading to activation of the PI3K/Akt signaling pathway. Activated Akt blocks Bad, which eventually leads to release of the antiapoptotic protein Bcl-xL, thus inhibiting apoptosis [58]. Therefore, activation of the pathway by genistein inhibited apoptosis and improved neuronal survival. CREB plays a major role in long-term memory formation [47,59,60]. Activation of CREB by phosphorylation is necessary for its function [52]. cAMP levels regulate activation of the enzyme PKA, which phosphorylates CREB [51,61]. BDNF is a key target of CREB signaling [62,63] and is important in the development and survival of neurons as well as in maturation of the developing brain and regulation of synaptic transmission in the hippocampus [22,64]. BDNF/TrkB signaling is a major pathway in neuronal signaling in synaptic plasticity and memory [10]. Reduced levels of cAMP following isoflurane exposure suggest reduced activation of PKA, subsequently leading to decreased phosphorylated CREB levels and thus inhibition of cAMP/CREB signaling. Further, phosphorylated CREB levels suppressed by isoflurane exposure could also be due to decreased CaMKIV expression. Interestingly, significantly increased cAMP and CaMKIV levels along with decreased PDE4 observed after genistein administration indicate activated cAMP/CREB signaling. The increases in expression of BDNF and TrkB at both the gene and protein levels could be due to either direct action of genistein or indirect activation of CREB signaling. Further, BDNF has been reported to stimulate PI3K/Akt signaling, and thus activation of PI3K/Akt signaling also could have been due to increased BDNF expression, as observed with genistein treatment. Thus, genistein-mediated upregulation of PI3K/ Akt signaling may have contributed partially to the decrease in www.kjpp.net neuronal apoptosis. Isof lurane-induced cognitive dysfunction and memory impairments have been reported [1,3]. Genistein was shown to improve the general behavior as well as fear responses of the rats in a novel environment. Fear conditioning tests the spatial memory of rats. Improved responses suggest that genistein enhanced memory in the rats. Further, the behavior of rats exposed to isoflurane was also assessed using the Morris water maze test, which is considered the gold standard for assessing both learning ability and memory retention in behavioral neuroscience [65]. Spatial attainment of learning in the Morris water maze, represented as escape latency, was significantly improved by genistein. In addition, memory retention was higher in genistein-treated rats, suggesting the ability of genistein to improve the learning and memory of isoflurane-exposed rats effectively. Increased CREB-BDNF-TrkB signaling and decreased hippocampal neuroapoptosis observed after genistein treatment could have contributed to improved learning and memory. CONCLUSION The results of the present study suggested that genistein effectively activates cAMP/CREB-BDNF-TrkB–PI3K/Akt signaling, suppresses neuroapoptosis, and enhances learning and memory in rats following exposure to isoflurane. Further studies exploring the potential of genistein to reduce anesthetic-induced neurotoxicity are warranted. CONFLICTS OF INTEREST The authors declare no conflicts of interest. REFERENCES 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dik- ranian K, Zorumski CF, Olney JW, Wozniak DF. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neu rosci. 2003;23:876-882. 2. Brambrink AM, Evers AS, Avidan MS, Farber NB, Smith DJ, Zhang X, Dissen GA, Creeley CE, Olney JW. Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthe- siology. 2010;112:834-841. 3. Kong F, Xu L, He D, Zhang X, Lu H. Effects of gestational isoflurane exposure on postnatal memory and learning in rats. Eur J Pharma- col. 2011;670:168-174. 4. Li Y, Liu C, Zhao Y, Hu K, Zhang J, Zeng M, Luo T, Jiang W, Wang H. Sevoflurane induces short-term changes in proteins in the cerebral cortices of developing rats. Acta Anaesthesiol Scand. 2013;57:380- 390. Korean J Physiol Pharmacol 2017;21(6):579-589 587 588 5. Li Y, Wang F, Liu C, Zeng M, Han X, Luo T, Jiang W, Xu J, Wang H. JNK pathway may be involved in isoflurane-induced apoptosis in the hippocampi of neonatal rats. Neurosci Lett. 2013;545:17-22. 6. Flick RP, Katusic SK, Colligan RC, Wilder RT, Voigt RG, Olson MD, Sprung J, Weaver AL, Schroeder DR, Warner DO. Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics. 2011;128:e1053-1061. 7. Gentry KR, Steele LM, Sedensky MM, Morgan PG. Early develop- mental exposure to volatile anesthetics causes behavioral defects in Caenorhabditis elegans. Anesth Analg. 2013;116:185-189. 8. Head BP, Patel HH, Niesman IR, Drummond JC, Roth DM, Patel PM. Inhibition of p75 neurotrophin receptor attenuates isoflurane- mediated neuronal apoptosis in the neonatal central nervous sys- tem. Anesthesiology. 2009;110:813-825. 9. Xiong WX, Zhou GX, Wang B, Xue ZG, Wang L, Sun HC, Ge SJ. Impaired spatial learning and memory after sevoflurane-nitrous oxide anesthesia in aged rats is associated with down-regulated cAMP/CREB signaling. PLoS One. 2013;8:e79408. 10. Wu J, Zhang M, Li H, Sun X, Hao S, Ji M, Yang J, Li K. BDNF pathway is involved in the protective effects of SS-31 on isoflurane- induced cognitive deficits in aging mice. Behav Brain Res. 2016;305: 115-121. 11. Bourtchuladze R, Frenguelli B, Blendy J, Cioffi D, Schutz G, Silva AJ. Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive element-binding protein. Cell. 1994;79:59-68. 12. Impey S, Mark M, Villacres EC, Poser S, Chavkin C, Storm DR. Induction of CRE-mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the hippocampus. Neuron. 1996;16:973-982. 13. Nakagawa S, Kim JE, Lee R, Chen J, Fujioka T, Malberg J, Tsuji S, Duman RS. Localization of phosphorylated cAMP response element-binding protein in immature neurons of adult hippocam- pus. J Neurosci. 2002;22:9868-9876. 14. Fujioka T, Fujioka A, Duman RS. Activation of cAMP signaling facilitates the morphological maturation of newborn neurons in adult hippocampus. J Neurosci. 2004;24:319-328. 15. Ao H, Ko SW, Zhuo M. CREB activity maintains the survival of cingulate cortical pyramidal neurons in the adult mouse brain. Mol Pain. 2006;2:15. 16. Schneider HH. Brain cAMP response to phosphodiesterase inhibitors in rats killed by microwave irradiation or decapitation. Biochem Pharmacol. 1984;33:1690-1693. 17. Li YF, Huang Y, Amsdell SL, Xiao L, O'Donnell JM, Zhang HT. Antidepressant- and anxiolytic-like effects of the phosphodies- terase-4 inhibitor rolipram on behavior depend on cyclic AMP response element binding protein-mediated neurogenesis in the hip pocampus. Neuropsychopharmacology. 2009;34:2404-2419. 18. Brightwell JJ, Smith CA, Neve RL, Colombo PJ. Long-term memory for place learning is facilitated by expression of cAMP response element-binding protein in the dorsal hippocampus. Learn Mem. 2007;14:195-199. 19. Rosenegger D, Parvez K, Lukowiak K. Enhancing memory formation by altering protein phosphorylation balance. Neurobiol Learn Mem. 2008;90:544-552. 20. Zhang F, Zhu ZQ, Liu DX, Zhang C, Gong QH, Zhu YH. Emulsified isoflurane anesthesia decreases brain-derived neurotrophic factor expression and induces cognitive dysfunction in adult rats. Exp Jiang T et al Ther Med. 2014;8:471-477. 21. Minichiello L. TrkB signalling pathways in LTP and learning. Nat Rev Neurosci. 2009;10:850-860. 22. Park H, Poo MM. Neurotrophin regulation of neural circuit development and function. Nat Rev Neurosci. 2013;14:7-23. 23. Huang EJ, Reichardt LF. Trk receptors: roles in neuronal signal transduction. Annu Rev Biochem. 2003;72:609-642. 24. Reichardt LF. Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci. 2006;361:1545-1564. 25. Takei N, Kawamura M, Hara K, Yonezawa K, Nawa H. Brain- derived neurotrophic factor enhances neuronal translation by activating multiple initiation processes: comparison with the effects of insulin. J Biol Chem. 2001;276:42818-42825. 26. Horwood JM1, Dufour F, Laroche S, Davis S. Signalling mechanisms mediated by the phosphoinositide 3-kinase/Akt cascade in synaptic plasticity and memory in the rat. Eur J Neurosci. 2006;23:3375-3384. 27. Chiang HC, Wang L, Xie Z, Yau A, Zhong Y. PI3 kinase signaling is involved in Abeta-induced memory loss in Drosophila. Proc Natl Acad Sci U S A. 2010;107:7060-7065. 28. Mizuno M, Yamada K, Takei N, Tran MH, He J, Nakajima A, Nawa H, Nabeshima T. Phosphatidylinositol 3-kinase: a molecule mediating BDNF-dependent spatial memory formation. Mol Psy- chiatry. 2003;8:217-224. 29. Pontén E1, Fredriksson A, Gordh T, Eriksson P, Viberg H. Neonatal exposure to propofol affects BDNF but not CaMKII, GAP-43, synaptophysin and tau in the neonatal brain and causes an altered behavioural response to diazepam in the adult mouse brain. Behav Brain Res. 2011;223:75-80. 30. Gętek M, Czech N, Muc-Wierzgoń M, Grochowska-Niedworok E, Kokot T, Nowakowska-Zajdel E. The active role of leguminous plant components in type 2 diabetes. Evid Based Complement Alternat Med. 2014;2014:293961. 31. Xu SZ, Zhong W, Ghavideldarestani M, Saurabh R, Lindow SW, Atkin SL. Multiple mechanisms of soy isoflavones against oxi- dative stress-induced endothelium injury. Free Radic Biol Med. 2009;47:167-175. 32. Behloul N, Wu G. Genistein: a promising therapeutic agent for obesity and diabetes treatment. Eur J Pharmacol. 2013;698:31-38. 33. Ganai AA, Khan AA, Malik ZA, Farooqi H. Genistein modulates the expression of NF-κB and MAPK (p-38 and ERK1/2), thereby attenuating d-Galactosamine induced fulminant hepatic failure in Wistar rats. Toxicol Appl Pharmacol. 2015;283:139-146. 34. Su P, Zhang J, Wang S, Aschner M, Cao Z, Zhao F, Wang D, Chen J, Luo W. Genistein alleviates lead-induced neurotoxicity in vitro and in vivo: Involvement of multiple signaling pathways. Neurotoxicology. 2016;53:153-164. 35. Spoerlein C, Mahal K, Schmidt H, Schobert R. Effects of chrysin, apigenin, genistein and their homoleptic copper(II) complexes on the growth and metastatic potential of cancer cells. J Inorg Biochem. 2013;127:107-115. 36. Orliaguet G, Vivien B, Langeron O, Bouhemad B, Coriat P, Riou B. Minimum alveolar concentration of volatile anesthetics in rats during postnatal maturation. Anesthesiology. 2001;95:734-739. 37. Wu J, Dong L, Zhang M, Jia M, Zhang G, Qiu L, Ji M, Yang J. Class I histone deacetylase inhibitor valproic acid reverses cognitive deficits in a mouse model of septic encephalopathy. Neurochem Res. 2013; 38:2440-2449. https://doi.org/10.4196/kjpp.2017.21.6.579 36. Orliaguet G, Vivien B, Langeron O, Bouhemad B, Coriat P, Riou B. Minimum alveolar concentration of volatile anesthetics in rats during postnatal maturation. Anesthesiology. 2001;95:734-739. 37. Wu J, Dong L, Zhang M, Jia M, Zhang G, Qiu L, Ji M, Yang J. Class I histone deacetylase inhibitor valproic acid reverses cognitive deficits in a mouse model of septic encephalopathy. Neurochem Res. 2013; 38:2440-2449. https://doi.org/10.4196/kjpp.2017.21.6.579 Genistein attenuates isoflurane-induced neurotoxicity 38. Ji M, Dong L, Jia M, Liu W, Zhang M, Ju L, Yang J, Xie Z, Yang J. Epigenetic enhancement of brain-derived neurotrophic factor signaling pathway improves cognitive impairments induced by isoflurane exposure in aged rats. Mol Neurobiol. 2014;50:937-944. 39. Kim JJ, Fanselow MS. Modality-specific retrograde amnesia of fear. Science. 1992;256:675-677. 40. Lin D, Zuo Z. Isoflurane induces hippocampal cell injury and cognitive impairments in adult rats. Neuropharmacology. 2011;61: 1354-1359. 41. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, Ito M, Imaki J. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology. 2009;110:628-637. 42. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, McAuliffe JJ, Danzer SC, Loepke AW. Comparison of the neuro- apoptotic properties of equipotent anesthetic concentrations of des- flurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology. 2011;114:578-587. 43. Dong Y, Zhang G, Zhang B, Moir RD, Xia W, Marcantonio ER, Culley DJ, Crosby G, Tanzi RE, Xie Z. The common inhalational anesthetic sevoflurane induces apoptosis and increases beta-amy- loid protein levels. Arch Neurol. 2009;66:620-631. 44. Culley DJ, Baxter MG, Yukhananov R, Crosby G. Long-term impairment of acquisition of a spatial memory task following iso- flurane-nitrous oxide anesthesia in rats. Anesthesiology. 2004; 100:309-314. 45. DiMaggio CJ, Sun L, Kakavouli A, Li G. Exposure to anesthesia and the risk of developmental and behavioral disorders in young children. Anesthesiology. 2008;109:A1415. 46. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, Gleich SJ, Schroeder DR, Weaver AL, Warner DO. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology. 2009;110:796-804. 47. Sakamoto K, Karelina K, Obrietan K. CREB: a multifaceted regulator of neuronal plasticity and protection. J Neurochem. 2011; 116:1-9. 48. Kida S, Serita T. Functional roles of CREB as a positive regulator in the formation and enhancement of memory. Brain Res Bull. 2014;105:17-24. 49. Gonzalez GA, Montminy MR. Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell. 1989;59:675-680. 50. Gonzalez GA, Yamamoto KK, Fischer WH, Karr D, Menzel P, Biggs W 3rd, Vale WW, Montminy MR. A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence. Nature. 1989;337:749-752. 51. Carlezon WA Jr, Duman RS, Nestler EJ. The many faces of CREB. www.kjpp.net Trends Neurosci. 2005;28:436-445. 52. Yamashima T. 'PUFA-GPR40-CREB signaling' hypothesis for the adult primate neurogenesis. Prog Lipid Res. 2012;51:221-231. 53. Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Kaplan DR, Greenberg ME. Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science. 1997; 275:661-665. 54. Brunet A, Datta SR, Greenberg ME. Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr Opin Neurobiol. 2001;11:297-305. 55. Ma D, Williamson P, Januszewski A, Nogaro MC, Hossain M, Ong LP, Shu Y, Franks NP, Maze M. Xenon mitigates isoflurane-induced neuronal apoptosis in the developing rodent brain. Anesthesiology. 2007;106:746-753. 56. Hsu SY, Kaipia A, Zhu L, Hsueh AJ. Interference of BAD (Bcl-xL/ Bcl-2-associated death promoter)-induced apoptosis in mammalian cells by 14-3-3 isoforms and P11. Mol Endocrinol. 1997;11:1858- 1867. 57. Zhu YM, Wang CC, Chen L, Qian LB, Ma LL, Yu J, Zhu MH, Wen CY, Yu LN, Yan M. Both PI3K/Akt and ERK1/2 pathways participate in the protection by dexmedetomidine against transient focal cerebral ischemia/reperfusion injury in rats. Brain Res. 2013; 1494:1-8. 58. Koh PO. Nicotinamide attenuates the ischemic brain injury-induced decrease of Akt activation and Bad phosphorylation. Neurosci Lett. 2011;498:105-9. 59. Amano H, Maruyama IN. Aversive olfactory learning and asso- ciative long-term memory in Caenorhabditis elegans. Learn Mem. 2011;18:654-665. 60. Kandel ER. The molecular biology of memory: cAMP, PKA, CRE, CREB-1, CREB-2, and CPEB. Mol Brain. 2012;5:14. 61. Merz K, Herold S, Lie DC. CREB in adult neurogenesis--master and partner in the development of adult-born neurons? Eur J Neurosci. 2011;33:1078-1086. 62. Sheng M, Thompson MA, Greenberg ME. CREB: a Ca2+-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science. 1991;252:1427-1430. 63. Finkbeiner S, Tavazoie SF, Maloratsky A, Jacobs KM, Harris KM, Greenberg ME. CREB: a major mediator of neuronal neurotrophin responses. Neuron. 1997;19:1031-1047. 64. Henriksson BG, Söderström S, Gower AJ, Ebendal T, Winblad B, Mohammed AH. Hippocampal nerve growth factor levels are related to spatial learning ability in aged rats. Behav Brain Res. 1992;48:15-20. 65. Bromley-Brits K, Deng Y, Song W. Morris water maze test for learning and memory deficits in Alzheimer's disease model mice. J Vis Exp. 2011. doi: 10.3791/2920. Korean J Physiol Pharmacol 2017;21(6):579-589 589",rats,"['Neonatal rats were exposed to isoflurane (0.75%, 6 hours) on postnatal day 7 (P7).']",postnatal day 7,"['Neonatal rats were exposed to isoflurane (0.75%, 6 hours) on postnatal day 7 (P7).']",Y,"['Behavioral analysis: open field test', 'Fear conditioning test', 'Learning and memory analysis: Morris water maze test']",isoflurane,"['Neonatal rats were exposed to isoflurane (0.75%, 6 hours) on postnatal day 7 (P7).']",none,[],sprague dawley,['Pregnant Sprague–Dawley rats were housed in individual sterile plastic cages under standard animal house conditions.'],The study addresses the concern regarding neuronal degeneration and cognitive deficits arising from regular anesthetic exposure by examining the protective effect of genistein against isoflurane-induced neurotoxicity.,"['However, there is some concern regarding neuronal degeneration and cognitive deficits arising from regular anesthetic exposure.']",None,[],The article argues the impact of findings by suggesting that genistein exerts neuroprotective effects by suppressing isoflurane-induced neuronal apoptosis and by activating cAMP/CREB-BDNF-TrkB-PI3/Akt signaling.,['These observations suggest that genistein exerts neuroprotective effects by suppressing isoflurane-induced neuronal apoptosis and by activating cAMP/CREB-BDNF-TrkB-PI3/Akt signaling.'],None,[],Potential applications emerge from the research findings in the development of strategies that could prevent or reduce anesthetic-induced apoptosis and memory impairments.,['A better understanding of the mechanisms would aid the development of strategies that could prevent or reduce anesthetic-induced apoptosis and memory impairments.'],True,True,True,True,True,True,10.4196/kjpp.2017.21.6.579 10.3389/fncel.2020.00004,415.0,Ju,2020,mice,postnatal day 16,N,sevoflurane,none,c57bl/6,"ORIGINAL RESEARCH published: 28 January 2020 doi: 10.3389/fncel.2020.00004 The mTOR Inhibitor Rapamycin Prevents General Anesthesia-Induced Changes in Synaptic Transmission and Mitochondrial Respiration in Late Postnatal Mice Xianshu Ju 1,2,3†, Min Jeong Ryu 1†, Jianchen Cui 1,2,3, Yulim Lee 1,2,3, Sangil Park 4, Boohwi Hong 4,5, Sungho Yoo 4, Won Hyung Lee 4,5, Yong Sup Shin 4,5, Seok-Hwa Yoon 4,5, Gi Ryang Kweon 1,2, Yoon Hee Kim 4,5, Youngkwon Ko 4,5, Jun Young Heo 1,2,3* and Woosuk Chung 2,4,5* Edited by: Julie S. Haas, Lehigh University, United States 1Department of Biochemistry, Chungnam National University School of Medicine, Daejeon, South Korea, 2Department of Medical Science, Chungnam National University School of Medicine, Daejeon, South Korea, 3Infection Control Convergence Research Center, Chungnam National University School of Medicine, Daejeon, South Korea, 4Department of Anesthesia and Pain Medicine, Chungnam National University Hospital, Daejeon, South Korea, 5Department of Anesthesia and Pain Medicine, Chungnam National University School of Medicine, Daejeon, South Korea Reviewed by: Se-Young Choi, Seoul National University, South Korea Seok-Kyu Kwon, Korea Institute of Science and Technology (KIST), South Korea Correspondence: Jun Young Heo junyoung3@gmail.com Woosuk Chung woosuk119@gmail.com †These authors have contributed equally to this work Received: 06 August 2019 Accepted: 09 January 2020 Published: 28 January 2020 Citation: Ju X, Ryu MJ, Cui J, Lee Y, Park S, Hong B, Yoo S, Lee WH, Shin YS, Yoon S-H, Kweon GR, Kim YH, Ko Y, Heo JY and Chung W (2020) The mTOR Inhibitor Rapamycin Prevents General Anesthesia-Induced Changes in Synaptic Transmission and Mitochondrial Respiration in Late Postnatal Mice. Front. Cell. Neurosci. 14:4. doi: 10.3389/fncel.2020.00004 Preclinical animal studies have continuously reported the possibility of long-lasting neurotoxic effects after general anesthesia in young animals. Such studies also show that the neurological changes induced by anesthesia in young animals differ by their neurodevelopmental stage. Exposure to anesthetic agents increase dendritic spines and induce sex-dependent changes of excitatory/inhibitory synaptic transmission in late postnatal mice, a critical synaptogenic period. However, the mechanisms underlying these changes remain unclear. Abnormal activation of the mammalian target of rapamycin (mTOR) signaling pathway, an important regulator of neurodevelopment, has also been shown to induce similar changes during neurodevelopment. Interestingly, previous studies show that exposure to general anesthetics during neurodevelopment can activate the mTOR signaling pathway. This study, therefore, evaluated the role of mTOR signaling after exposing postnatal day (PND) 16/17 mice to sevoflurane, a widely used inhalation agent in pediatric patients. We first confirmed that a 2-h exposure of 2.5% sevoflurane could induce widespread mTOR phosphorylation in both male and female mice. Pretreatment with the mTOR inhibitor rapamycin not only prevented anesthesia-induced mTOR phosphorylation, but also the increase in mitochondrial respiration and male-dependent enhancement of excitatory synaptic transmission. However, the changes in inhibitory synaptic transmission that appear after anesthesia in female mice were not affected by rapamycin pretreatment. Our results suggest that mTOR inhibitors may act as potential therapeutic agents for anesthesia-induced changes in the developing brain. Keywords: general anesthesia, mTOR, neurodevelopment, neurotoxicity, synaptic transmission Frontiers in Cellular Neuroscience | www.frontiersin.org 1 January 2020 | Volume 14 | Article 4 Ju et al. INTRODUCTION Preclinical report possible neurotoxic effects from anesthesia in young rodents, sheep, and non-human primates (Olutoye et al., 2016; Jevtovic-Todorovic, 2018). The United States Food and Drug Administration (U.S. FDA) has therefore published warnings regarding the repeated or prolonged use of anesthesia in children under age 3 years. Fortunately, recent clinical studies strongly suggest that a single, short exposure to anesthetic does not affect neurodevelopment (O’Leary and Warner, 2017; Warner et al., 2018; McCann et al., 2019). However, there are still concerns regarding multiple anesthetic exposures (Warner et al., 2018; Zaccariello et al., 2019). animal studies continuously anesthesia-induced neurotoxicity depends on their neurodevelopmental stage. While anesthesia induces neuronal cell death in neonatal mice, the same anesthetics induces excitatory/inhibitory imbalance in late postnatal mice (Briner et al., 2010; Chung et al., 2017a; Ju et al., 2019). Importantly, excitatory/inhibitory imbalance has been linked to diverse neurodevelopmental disorders (Meredith, 2015; Lee et al., 2017). Because most procedures requiring anesthesia in humans are performed during the postnatal period, these anesthesia-induced changes in late postnatal mice may be of great importance, as the neurodevelopment of mice during this stage may be equivalent to the neurodevelopment of human infants (Workman et al., 2013). However, the mechanisms underlying anesthesia-induced changes in late postnatal mice are still not completely understood. of Previous studies also show that a serine/threonine functions controls including protein synthesis, energy metabolism, cell survival, autophagy and mitochondria biogenesis in peripheral tissues. In the nervous system, mTOR pathway regulates axonal sprouting, axonal regeneration and myelination, ion channel and receptor expression, and dendritic spine growth (Bockaert and Marin, 2015; Huber et al., 2015). Previous studies also show that activation of mTOR enhances synaptic activity by promoting AMPA receptor synthesis and expression at the cell surface (Wang et al., 2006; Ran et al., 2013). In addition, mTOR regulates dendritic spine development and formation (Tavazoie et al., 2005; Lee et al., 2011), and excitatory synaptic transmission (Tang et al., 2002; Cammalleri et al., 2003). As exposure to anesthetics increase synaptic proteins, dendritic imbalance spinogenesis, (Briner et al., 2010; Chung et al., 2017a; Ju et al., 2019), it is highly possible that mTOR signaling is involved with these anesthesia-induced changes. Indeed, previous studies show that anesthetics increase mTOR signaling in various ages (Li et al., 2010, 2017; Zhang et al., 2014; Kang et al., 2017). For example, injection of ketamine in adult mice was found to induce mTOR activation, accompanied by increased spinogenesis and excitatory synaptic transmission (Li et al., 2010). Isoflurane induction of anesthesia in postnatal day (PND) 15 mice was found to induce long-lasting mTOR pathway activation in the dentate gyrus, leading to changes in dendritic arbors, dendritic spines numbers, and impaired learning and memory (Kang The mammalian target rapamycin (mTOR), kinase, intra-cellular and induce excitatory/inhibitory Frontiers in Cellular Neuroscience | www.frontiersin.org 2 Rapamycin Prevents Neurological Changes et al., 2017). These changes were prevented by the mTOR pathway inhibitor rapamycin. However, the exact role of mTOR after general anesthesia in late postnatal mice has not been sufficiently evaluated. To evaluate the role of mTOR signaling following anesthesia in late postnatal mice, PND 16/17 mice were exposed to 2.5% sevoflurane (the most widely used inhalation agent in pediatric patients) for 2 h. Administration of sevoflurane to PND 16/17 mice has been shown to increase dendritic spine formation, to alter mitochondrial function, and to induce sex-dependent changes in excitatory/inhibitory synaptic transmission (Chung et al., 2017a; Ju et al., 2019). Based on previous findings, this study hypothesized that sevoflurane-induced changes in late postnatal mice could be prevented by inhibiting the mTOR pathway with rapamycin. MATERIALS AND METHODS Animals All experiments were approved by the relevant Committees of Chungnam National University, Daejeon, South Korea (CNU-01135). C57BL/6J mice were maintained in a specific pathogen-free (SPF) room maintained at 22◦C, with a 12 h light/dark cycle, and fed ad libitum. Animals received anesthesia during the light cycle. This research adheres to the ARRIVE (Animal Research: Reporting in vivo Experiments) guidelines. Anesthesia PND 16/17 mice were randomly divided into three groups: control, sevoflurane, and sevoflurane plus rapamycin groups. Mice in the sevoflurane and sevoflurane plus rapamycin groups were placed in a 1-l plastic chamber and exposed to a constant flow of fresh gas [fraction of inspired oxygen (FiO2) 0.4, 4 L/min] containing 2.5% sevoflurane for 2 h. Full recovery was confirmed 30 min after discontinuing sevoflurane. Control mice were treated identically but without sevoflurane. The anesthesia chamber was placed in a 36◦C water bath to maintain a constant temperature. Carbon dioxide and sevoflurane were monitored using an S/5 compact anesthetic monitor and a mCAiO gas analyzer module (Datex-Ohmeda, Helsinki, Finland). Rapamycin Treatment Rapamycin (LC Laboratories, Woburn, MA, USA) was reconstituted in ethanol at a concentration 10 µg/µl and then diluted in 5% Tween-80 (Sigma–Aldrich, St. Louis, MO, USA) and 5% PEG-400 (Sigma–Aldrich, St. Louis, MO, USA), as described (Chen et al., 2009). Mice in the sevoflurane plus rapamycin group were each administered three intraperitoneal injections of rapamycin (5 mg/kg) at 24 h intervals prior to sevoflurane exposure, whereas mice in the control and sevoflurane groups were injected with an identical volume of vehicle. Western blotting Whole-brain samples were obtained from the mice 24 h after sevoflurane exposure. Mice were exposed to carbon January 2020 | Volume 14 | Article 4 Ju et al. dioxide before brain extraction, and each whole brain was homogenized with a tissue grinder in RIPA lysis buffer [ELPIS-BIOTECH, Daejeon, South Korea, 100 mM Tris–hydrochloride (pH 8.5), 200 mM NaCl, 5 mM EDTA, and 0.2% sodium dodecyl sulfate], containing phosphatase and protease (Sigma–Aldrich). After cocktails centrifuging the homogenized samples at 12,000× g for 15 min at 4◦C, the supernatants were decanted and their protein concentrations were measured using the Bradford assay (Bio-Rad, Hercules, CA, USA). Samples (20 µg) were electrophoresed on SDS PAGE gels, and transferred to (pore size, 0.2 µm; Amersham nitrocellulose membranes Protran(cid:114), GE Healthcare, at Buckinghamshire, UK) 200 mA for 2 h. The membranes were blocked for 1 h with Tris-buffered saline-Tween 20 [10 mM Tris–hydrochloride (pH 7.6), 150 mM NaCl, and 0.1% Tween 20], containing followed by incubation 3% bovine serum albumin (BSA), with primary antibodies and the appropriate secondary Specific antibodies antibody-labeled proteins were detected using the enhanced chemiluminescence iNtRON BioTechnology, Seongnam, South Korea). Primary antibodies included antibodies to phospho-mTOR(S2448), mTOR (Cell Signaling Technology, Danvers, MA, USA), postsynaptic density 90 (PSD95; Neuromab, Davis, CA, USA), GAD65 (Abcam, Cambridge, UK), NDUFB8 (a mitochondrial complex I subunit; Santa Cruz Biotechnology, Santa Cruz, TX, USA), COX4 (a mitochondrial complex IV subunit; Novus Biologicals, Centennial, CO, USA) and actin (Santa Cruz Biotechnology, Santa Cruz, TX, USA). Antibodies against GluA1 (1193) and GluA2 (1195) have been described previously (Kim et al., 2009). inhibitor coupled to horseradish peroxidase. system (WEST-ZOL plus; Oxygen Consumption Rate Mitochondria were isolated from brain tissues 24 h after sevoflurane exposure, as previously described (Chung et al., 2017a). Each brain was homogenized in a mitochondrial isolation buffer [70 mM sucrose, 210 mM mannitol, 5 mM HEPES, 1 mM EGTA, and 0.5% (w/v) fatty acid–free BSA (pH 7.2)] with a Teflon-glass homogenizer (Thomas Fisher Scientific, Swedesboro, NJ, USA). After centrifugation at 600× g for 10 min at 4◦C and at 17,000× g for 10 min at 4◦C, the mitochondrial fraction was resuspended in a mitochondrial isolation buffer. Protein concentration was measured by the Bradford assay (Bio-Rad), and 20 µg aliquots of protein were diluted with 50 µl mitochondrial assay solution [70 mM sucrose, 220 mM mannitol, 10 mM KH2PO4, 5 mM MgCl2, 2 mM HEPES, 1 mM EGTA, 0.2% (w/v) fatty acid–free BSA, 10 mM succinate, and 2 µM rotenone (pH 7.2)] and seeded in an XF-24 plate (Seahorse Bioscience, North Billerica, MA, USA). The plates were centrifuged at 2,000× g for 20 min at 4◦C using a swinging bucket microplate adaptor (Eppendorf, Hamburg, Germany); 450 µl mitochondrial assay buffer was added to each plate, and the plates were maintained at 37◦C for 8–10 min. Each plate was transferred to a Seahorse XF-24 extracellular flux analyzer (Seahorse Bioscience) and the oxygen consumption rate (OCR) was measured at five stages: stage I (basal level); Frontiers in Cellular Neuroscience | www.frontiersin.org 3 Rapamycin Prevents Neurological Changes following the addition of adenosine diphosphate stage II, (ADP); stage III, following the addition of oligomycin, a mitochondrial oxidative phosphorylation (OXPHOS) complex 5 inhibitor; stage IV, following the addition of carbonyl cyanide m-chlorophenyl hydrazine (CCCP), a mitochondrial OXPHOS complex 4 inhibitor; and stage V, following the addition of antimycin A, a mitochondrial OXPHOS complex 3 inhibitor. OCR was automatically calculated and recorded using Seahorse XF-24 software (Seahorse Bioscience). Electrophysiology Whole-cell voltage-clamp recordings of pyramidal neurons in the CA1 region of the hippocampus were obtained as described (Chung et al., 2015a). Twenty-four hours after exposure to sevoflurane or fresh gas, sagittal slices of the hippocampus (300 µm) were prepared in ice-cold dissection buffer (212 mM sucrose, 25 mM NaHCO3, 5 mM KCl, 1.25 mM NaH2PO4, 10 mM d-glucose, 2 mM sodium pyruvate, 1.2 mM sodium ascorbate, 3.5 mM MgCl2, and 0.5 mM CaCl2) aerated with 95% O2/5% CO2, using a VT1200S vibratome (Leica, Arrau, Switzerland). Slices were transferred immediately to a 32◦C chamber containing artificial cerebrospinal fluid (aCSF: 125 mM NaCl, 25 mM NaHCO3, 2.5 mM KCl, 1.25 mM NaH2PO4, 10 mM d-glucose, 1.3 mM MgCl2, and 2.5 mM CaCl2, continuously aerated with 95% O2/5% CO2) and incubated for 30 min. Glass capillaries were filled with two kinds of internal solutions. For miniature excitatory postsynaptic current (mEPSC) recordings, the glass capillaries were filled with an internal solution containing 117 mM CsMeSO4, 10 mM tetraethylammonium chloride, 8 mM NaCl, 10 mM HEPES, 5 mM QX-314-Cl, 4 mM Mg-adenosine triphosphate (ATP), 0.3 mM Na-guanosine triphosphate, and 10 mM EGTA; for miniature inhibitory postsynaptic current (mIPSC) recordings, the glass capillaries were filled with an internal solution containing 115 mM CsCl, 10 mM tetraethylammonium chloride, 8 mM NaCl, 10 mM HEPES, 5 mM QX-314-Cl, 4 mM Mg-ATP, 0.3 mM Na-guanosine triphosphate, and 10 mM EGTA. Whole-cell recordings were performed under visual control (BX50WI; Olympus, Tokyo, Japan) with a multi clamp 700A amplifier (Molecular Devices, San Jose, CA, USA). Data were acquired with Clampex 9.2 (Molecular Devices, San Jose, CA, USA) and analyzed using Clampfit 9 software (Molecular Devices, San Jose, CA, USA). Statistical Analysis The sample size was determined based on previous experience or as previously described (Chung et al., 2015b, 2017b). All statistical analyses were performed using R statistical software (3.1.2: R Core Team, Austria). All continuous variables were tested to determine whether they met conditions of normality and homogeneity of variance. One-way ANOVA with post hoc Tukey HSD test was performed when both conditions were met, Welch’s ANOVA with post hoc Tukey HSD test was performed when homogeneity of variance was unmet, and the Kruskal–Wallis test with post hoc Dunn’s test was performed if normality was unmet. P < 0.05 was considered January 2020 | Volume 14 | Article 4 Ju et al. Rapamycin Prevents Neurological Changes FIGURE 1 | Rapamycin prevents sevoflurane-induced activation of mammalian target of rapamycin (mTOR) signaling in male and female postnatal day (PND) 16/17 mice. (A) Time schedule for experiments. PND 14/15 mice were intraperitoneally injected with vehicle or rapamycin once daily for 3 days. On day 3 (PND 16/17), the mice were exposed to 2.5% sevoflurane anesthesia for 2 h. On day 4, mice were sacrificed and their whole brains were extracted. (B–E) Western blot of whole-brain samples obtained 24 h after sevoflurane exposure. (B,D) Western blotting with antibodies specific for phosphorylated and total mTOR and actin (loading control) in male and female mice. (C,E) Quantification of mean ± SD protein band intensity in panels (B,D; n = 4 or 5 per group; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001). statistically significant. Statistical Supplementary Statistics. results are presented as RESULTS Sevoflurane Exposure in PND 16/17 Mice Induces Widespread Activation of the mTOR Signaling Pathway sevoflurane induces widespread activation To assess level of mTOR of in phosphorylation was measured by western blotting whole brain samples obtained 24 h after sevoflurane exposure. We also evaluated whether three daily injections of rapamycin prior to sevoflurane exposure could prevent mTOR phosphorylation (Figure 1A). Because we had found that sevoflurane changes were sex-dependent, mTOR phosphorylation was separately measured in male and female mice. Sevoflurane exposure enhanced phosphorylation of mTOR in both male and female mice, and such phosphorylation was injection sexes (Figures 1B–E). that the mTOR signaling pathway, the blocked in both by rapamycin Rapamycin Treatment Prevents a Sevoflurane-Induced Increase of Mitochondrial Function in PND 16/17 Mice We previously respiration continuously increases for up to 9 h after sevoflurane exposure in PND 16/17 mice (Chung et al., 2017a). Mitochondrial respiration, which is conducted by assembled mitochondrial and nuclear-originated proteins, produces ATP by consuming oxygen. To determine the association between mTOR signaling and sevoflurane-induced changes in mitochondrial respiration, the amounts of the OXPHOS complex subunit proteins NADH: reported that mitochondrial Ubiquinone Oxidoreductase Subunit B8 (NDUFB8; subunit of OXPHOS complex I) and cytochrome c oxidase subunit 4 (COX4; subunit of OXPHOS complex IV) were measured 24 h after sevoflurane exposure. Sevoflurane increased the level of NDUFB8, but not of COX4, only in female mice. The increase was inhibited by preinjection with rapamycin (Figures 2A–D). To assess mitochondrial respiration 24 h after sevoflurane exposure, we also measured the OCR in mitochondria isolated from whole brains (Figures 2E–H). Sevoflurane exposure increased basal OCR (stage I) only in female mice, but increased ADP-induced OCR (stage II), oligomycin induced ATP production (stage III), and maximal OCR (stage IV) in both male and female mice. These changes were prevented by rapamycin pretreatment in both male and female mice (Figures 2F,H). Taken together, sevoflurane- induced changes in mitochondrial function in an mTOR dependent manner. these results showed that Rapamycin Treatment Prevents a Sevoflurane-Induced Increase of AMPA Receptor Subunit GluA2 in PND 16/17 Male Mice We previously reported that a single exposure of PND 16/17 mice to sevoflurane affects the level of expression of synaptic molecules 6 h later (Chung et al., 2017a; Ju et al., 2019). To confirm longer-lasting changes in expression and to determine the role of mTOR signaling, western blotting was performed 24 h after sevoflurane exposure. The expression of GluA2 was significantly increased only in male mice, while there were no significant changes in female mice (Figure 3). The increase in GluA2 expression was inhibited by rapamycin pretreatment, suggesting that the mTOR pathway is also associated with changes in protein expression after exposure to sevoflurane in male mice. Frontiers in Cellular Neuroscience | www.frontiersin.org 4 January 2020 | Volume 14 | Article 4 Ju et al. Rapamycin Prevents Neurological Changes FIGURE 2 | Rapamycin prevents sevoflurane-induced increases in mitochondrial function and oxidative phosphorylation (OXPHOS) complexes in PND 16/17 mice. (A–D) Whole-brain samples obtained 24 h after sevoflurane exposure. (A,C) Western blotting with antibodies specific for the OXPHOS complex subunits NDUFB8 (OXPHOS complex I) and COX4 (OXPHOS complex IV) and actin (loading control) in male and female mice. (B,D) Quantification of mean ± SD protein band intensity in panels (A,C; n = 4 or 5 per group; n.s., not significant, ∗p < 0.05, ∗∗∗p < 0.01). (E–H) Oxygen consumption rate (OCR) of mitochondria isolated from the whole brain 24 h after sevoflurane exposure. The substrate was used by adding succinate to the mitochondrial assay buffer. Adenosine diphosphate (ADP) was used to stimulate adenosine triphosphate (ATP) turnover and ATP generation was measured with oligomycin (Oligo). Maximal OCR was assessed using carbonyl cyanide m-chlorophenyl hydrazone (CCCP) and non-mitochondrial OCR was measured using antimycin A (AA; n = 4 or 5 per group; n.s., not significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001). Values are presented as mean ± SD. Rapamycin Treatment Prevents Sevoflurane-Induced Changes of Excitatory Synaptic Transmission in Male Mice But Does Not Prevent Changes of Inhibitory Synaptic Transmission in Female Mice Exposure of PND 16/17 mice to sevoflurane was shown to induce acute, sex-dependent changes in various brain regions Ju et al., 2019). To extend these (Chung et al., 2017a; findings, we assessed changes of excitatory/inhibitory synaptic transmission in CA1 pyramidal neurons in the hippocampus 24 h after sevoflurane exposure. Sevoflurane increased mEPSC frequency only in male mice (Figure 4), an increase blocked by preinjection of rapamycin (Figures 4A,B). In contrast, sevoflurane affected mIPSC frequency only in female mice (Figure 5), but these changes were unaffected by preinjection of rapamycin (Figures 5C,D). These results suggest that only the Frontiers in Cellular Neuroscience | www.frontiersin.org 5 January 2020 | Volume 14 | Article 4 Ju et al. Rapamycin Prevents Neurological Changes FIGURE 3 | Rapamycin prevents the sevoflurane-induced increase in the expression of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor subunit GluA2 in PND 16/17 male mice. (A–D) Western blotting of whole-brain samples obtained 24 h after sevoflurane exposure for expression of excitatory {postsynaptic density 95 [PSD95], GluA1, GluA2} and inhibitory (GAD65) synaptic proteins. Actin was used as the loading control. (B,D) Mean ± SD protein band intensity in panels (A,C; n = 4 or 5 per group; n.s., not significant, ∗∗p < 0.01). sex-dependent changes in excitatory synaptic transmission are mTOR dependent. DISCUSSION Few studies to date have analyzed the mechanisms underlying changes in synaptic transmission after exposure to anesthesia in late postnatal mice. To gain further insight and to identify a possible molecular target for preventing such anesthesia-induced changes, we focused on the mTOR pathway due to the fact that mTOR signaling regulates mitochondrial function (Ramanathan and Schreiber, 2009; Morita et al., 2015, 2017), dendritic spine formation, AMPA receptor synthesis, and excitatory synaptic transmission (Bockaert and Marin, 2015). Our results indicate that the mTOR pathway is associated with the changes that occur after anesthetic exposure in late postnatal male mice. function has been shown to be involved with dendritic spine formation and synaptic transmission (Li et al., 2004; Guo et al., 2017; Rossi and Pekkurnaz, increases spinogenesis and induces change in synaptic transmission, we previously suggested the compensatory increase of mitochondria Neuronal mitochondrial 2019). Since anesthetic exposure function as a possible mechanism (Chung et al., 2017a). However, we were unable to provide a mechanism by which sevoflurane increased mitochondrial function. Previous studies have suggested that the mTOR complex stimulates the synthesis of mitochondrial components by regulating translation (Morita et al., 2013). In our present study, we also suggest that mTOR regulates in mitochondrial function by showing that rapamycin pretreatment efficiently blocks the sevoflurane-induced increases in mitochondrial OCR in both male and female mice. While our results suggest that mTOR may regulate the sevoflurane-induced neurological changes through mitochondrial activation, many studies also show that mTOR signaling itself is an important regulator of dendritic spine formation, AMPA receptor synthesis, and excitatory synaptic transmission (Bockaert and Marin, 2015). Thus, the anesthesia-induced changes in a mitochondrial-independent fashion as well. However, considering previous evidence function with regarding the significance of mitochondrial neurological changes, it is highly possible that mTOR regulates the sevoflurane-induced changes through both mitochondrial- dependent and independent pathways. sevoflurane-induced changes inhibition of the mTOR pathway can prevent Frontiers in Cellular Neuroscience | www.frontiersin.org 6 January 2020 | Volume 14 | Article 4 Ju et al. Rapamycin Prevents Neurological Changes FIGURE 4 | Rapamycin prevents the increase in excitatory synaptic transmission in PND 16/17 male mice 24 h after sevoflurane exposure. (A,B) Frequency and amplitude of miniature excitatory postsynaptic currents (mEPSCs) in male mice 24 h after sevoflurane exposure with/without rapamycin pretreatment (control: 20 cells from three mice; sevoflurane: 16 cells from three mice; rapamycin: 19 cells from three mice; n.s., not significant, ∗∗p < 0.01). (C,D) Frequency and amplitude of mEPSC in female mice 24 h after sevoflurane exposure with/without rapamycin pretreatment (control: 20 cells from three mice; sevoflurane: 18 cells from three mice; rapamycin: 19 cells from three mice; n.s., not significant). Values are presented as mean ± SD. variable a in neuroscience (Shansky and Woolley, 2016; Bale and Epperson, 2017; Torres-Rojas and Jones, 2018), and has been shown to affect anesthesia-induced neurotoxicity during neurodevelopment in young animals (Boscolo et al., 2013; Ju et al., 2019). Unfortunately, the majority of clinical studies have been performed with male patients (Lin et al., 2017), and the clinical significance of sex is still in need of further evaluation. Several sex-dependent changes were also discovered in our present study. First, while sevoflurane activates mTOR in both sexes, mTOR-dependent increases in AMPA receptor subunit expression and excitatory synaptic transmission only occurred in male mice. This may be due to sex-dependent differences in the downstream signaling of mTOR. A previous study has shown different downstream activities between male and female mice in non-neural tissues. For instance, when compared to female mice, male mice showed decreased basal mTORC1 activity in the liver and heart tissue, while the basal mTORC2 activity was increased in muscle tissue (Baar et al., 2016). Sevoflurane-induced mTOR activation may result in male-dependent changes due to differences in mTOR downstream signaling in male and female mice. Second, sevoflurane exposure induced different mitochondrial changes Sex is recognized as valuable biological between sexes. When measured 24 h after sevoflurane exposure, male mice displayed increases of ADP induced OCR, maximal OCR and ATP production without changes in basal OCR and OXPHOS subunit protein levels. However, all stages of the mitochondrial OCR and OXPHOS subunit protein levels were still increased in female mice. Such discrepancies between male and female mice may be due to the differences in mitochondrial respiratory function, morphology, and reactive oxygen species (ROS) homeostasis (Khalifa et al., 2017). Previous studies also show sex-dependent differences in mitochondrial biogenesis after oxygen-glucose deprivation and reoxygenation (Sharma et al., 2014). Another interesting fact is that sevoflurane-induced activation of the mTOR pathway can sex-dependently affect the expression of a specific set of proteins, as female mice show more significant changes for a mitochondrial protein, but male mice display more difference in an excitatory synaptic protein. While this may be due to distinct downstream mTOR signaling between male and female mice as mentioned above, distinct gene expression (sexually dimorphic genes) and epigenetic sex differences may also be involved (Yang et al., 2006; McCarthy and Nugent, 2015). An important factor in our study was the duration of rapamycin treatment. Initially, the experiments involved a single Frontiers in Cellular Neuroscience | www.frontiersin.org 7 January 2020 | Volume 14 | Article 4 Ju et al. Rapamycin Prevents Neurological Changes FIGURE 5 | Rapamycin does not prevent the decrease in inhibitory synaptic transmission in PND 16/17 female mice 24 h after sevoflurane exposure. (A,B) Frequency and amplitude of miniature inhibitory postsynaptic currents (mIPSCs) in male mice 24 h after sevoflurane exposure with/without rapamycin pretreatment (control: 20 cells from four mice; sevoflurane: 22 cells from four mice; rapamycin: 22 cells from four mice; n.s., not significant). (C,D) Frequency and amplitude of mIPSC in female mice 24 h after sevoflurane exposure with/without rapamycin pretreatment (control: 23 cells from four mice; sevoflurane: 21 cells from four mice; rapamycin: 21 cells from four mice; n.s., not significant, ∗p < 0.05, ∗∗p < 0.01). injection of rapamycin (Supplementary Figure S1). Although this single injection restored the phosphorylation level of mTOR, it did not prevent the sevoflurane-induced increase in mEPSC frequency in male mice. We next used a daily injection of rapamycin (5 mg/kg/day) for three consecutive days based on previous studies (Zeng et al., 2009; Huang et al., 2010; Hartman et al., 2012). Unlike a single injection, multiple rapamycin injections were capable of preventing the sevoflurane- induced increase in excitatory synaptic transmission. mTOR acts by forming two distinct protein complexes, mTOR Complex 1 (mTORC1) and mTOR Complex 2 (mTORC2). Despite rapamycin being an mTOR inhibitor, prolonged rapamycin treatment is required to block mTORC2. One possible explanation is that blockade of mTORC2 by multiple rapamycin injections is required to block changes in excitatory synaptic transmission. the female-dependent changes in inhibitory synaptic transmission after sevoflurane exposure seems to be irrelevant of mTOR signaling, as rapamycin pretreatment did not affect inhibitory synaptic transmission in both male and female mice. Also, the changes of inhibitory synaptic transmission observed 24 h Another interesting finding of our study is that than the changes after sevoflurane exposure was different observed shortly after anesthesia induction (Chung et al., 2017a; Ju et al., 2019). Whereas mIPSC frequency increased in female mice 6 h after sevoflurane exposure (Ju et al., 2019), mIPSC frequency decreased 24 h after exposure. Genetic mouse models of neurodevelopmental disorders have also shown reversed changes in synaptic transmission during development (Chung et al., 2019). Although these reversed changes may be due to compensation mechanisms, more studies focusing on the mechanism behind time-dependent changes in inhibitory synaptic transmission in female mice are required. limitations. Although the oxygen concentration during anesthesia was relatively low (FiO2 0.4), thereby avoiding oxygen toxicity, we are unable to rule out the effects of slight changes in arterial carbon dioxide (PaCO2) and blood pH after exposure to sevoflurane for 2 h (Chung et al., 2017a). Another the inconsistency of brain regions among experiments. Western blot and mitochondrial experiments were performed using to confirm widespread whole-brain samples, enabling us changes function. in mTOR signaling and mitochondrial However, electrophysiology experiments were performed using This study has several limitation was Frontiers in Cellular Neuroscience | www.frontiersin.org 8 January 2020 | Volume 14 | Article 4 Ju et al. only hippocampal neurons. We have previously reported that sevoflurane exposure induces similar, but slightly different, changes in different brain regions (Chung et al., 2017a; Ju et al., 2019). Since the importance of sex regarding sevoflurane- induced changes were more thoroughly addressed in the hippocampus, we evaluated the possible sex-dependent effects of rapamycin in the hippocampus (CA1 region). In conclusion, exposure of PND 16/17 mice to sevoflurane enhanced induces mTOR phosphorylation, excitatory function mitochondrial synaptic transmission. Although further regarding the mechanism behind inhibitory synaptic changes in female mice are necessary, our results suggest that mTOR inhibitors may be potential therapeutic agents for anesthesia-induced changes during neurodevelopment. to and male-dependent studies leading DATA AVAILABILITY STATEMENT All datasets generated for this study are included in the article/Supplementary Material. ETHICS STATEMENT The animal study was reviewed and approved by Committees of Chungnam National University, Daejeon, South Korea (CNU-01135). Written informed consent was obtained REFERENCES Baar, E. L., Carbajal, K. A., Ong, I. M., and Lamming, D. W. (2016). Sex- and tissue- specific changes in mTOR signaling with age in C57BL/6J mice. Aging Cell 15, 155–166. doi: 10.1111/acel.12425 Bale, T. L., and Epperson, C. N. (2017). Sex as a biological variable: who, what, when, why and how. Neuropsychopharmacology 42, 386–396. doi: 10.1038/npp. 2016.215 Bockaert, J., and Marin, P. (2015). mTOR in brain physiology and pathologies. Physiol. Rev. 95, 1157–1187. doi: 10.1152/physrev.00038.2014 Boscolo, A., Ori, C., Bennett, J., Wiltgen, B., and Jevtovic-Todorovic, V. (2013). Mitochondrial protectant pramipexole prevents sex-specific long-term cognitive impairment from early anaesthesia exposure in rats. Br. J. Anaesth. 110, i47–52. doi: 10.1093/bja/aet073 Briner, A., De Roo, M., Dayer, A., Muller, D., Habre, W., and Vutskits, L. (2010). Volatile anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiology 112, 546–556. doi: 10.1097/aln.0b013e3181cd7942 Cammalleri, M., Lutjens, R., Berton, F., King, A. R., Simpson, C., Francesconi, W., et al. (2003). Time-restricted role for dendritic activation of the mTOR-p70S6K pathway in the induction of late-phase long-term potentiation in the CA1. Proc. Natl. Acad. Sci. U S A 100, 14368–14373. doi: 10.1073/pnas. 2336098100 Chen, C., Liu, Y., Liu, Y., and Zheng, P. (2009). mTOR regulation and therapeutic rejuvenation of aging hematopoietic stem cells. Sci. Signal. 2:ra75. doi: 10.1126/scisignal.2000559 Chung, C., Ha, S., Kang, H., Lee, J., Um, S. M., Yan, H., et al. (2019). Early correction of N-Methyl-D-Aspartate receptor function improves autistic-like social behaviors in adult Shank2−/− mice. Biol. Psychiatry 85, 534–543. doi: 10.1016/j.biopsych.2018.09.025 Chung, W., Choi, S. Y., Lee, E., Park, H., Kang, J., Park, H., et al. (2015a). Social deficits in IRSp53 mutant mice improved by NMDAR and mGluR5 suppression. Nat. Neurosci. 18, 435–443. doi: 10.1038/nn.3927 Frontiers in Cellular Neuroscience | www.frontiersin.org 9 Rapamycin Prevents Neurological Changes from the owners for the participation of their animals in this study. AUTHOR CONTRIBUTIONS XJ and MR: helped design, development, execution of experiments and preparation of manuscript. SP and BH: helped perform the statistics. JC, YL and SY: helped execution of experiments. WL, YS, S-HY, GK, YHK and YK: helped design and development of experiments, oversight. WC and JH: helped design, development and execution of experiments, oversight, preparation of manuscript. FUNDING This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean Government (MSIT) (NRF-2018R1C1B6003139, NRF-2017R1A5A2015385, NRF-2019M3E5D1A02068575) and by the research fund of Chungnam national university hospital (2019-1569-01). SUPPLEMENTARY MATERIAL The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fncel.2020.000 04/full#supplementary-material. Chung, W., Park, S., Hong, J., Park, S., Lee, S., Heo, J., et al. (2015b). Sevoflurane exposure during the neonatal period induces long-term memory impairment but not autism-like behaviors. Paediatr. Anaesth. 25, 1033–1045. doi: 10.1111/pan.12694 Chung, W., Ryu, M. J. Y., Lee, S., Yoon, S., Park, H., et al. (2017a). Sevoflurane exposure during the critical period affects synaptic transmission and mitochondrial respiration but not long-term behavior in mice. Anesthesiology 126, 288–299. doi: 10.1097/aln.00000000000 01470 J., Heo, Chung, W., Yoon, S., and Shin, Y. S. (2017b). Multiple exposures of sevoflurane during pregnancy induces memory impairment in young female offspring mice. Korean J. Anesthesiol. 70, 642–647. doi: 10.4097/kjae.2017. 70.6.642 Guo, L., Tian, J., and Du, H. (2017). Mitochondrial dysfunction and synaptic transmission failure in Alzheimer’s disease. J. Alzheimers Dis. 57, 1071–1086. doi: 10.3233/jad-160702 Hartman, A. L., Santos, P., Dolce, A., and Hardwick, J. M. (2012). The mTOR inhibitor rapamycin has limited acute anticonvulsant effects in mice. PLoS One 7:e45156. doi: 10.1371/journal.pone.0045156 Huang, X., Zhang, H., Yang, J., Wu, J., Mcmahon, J., Lin, Y., et al. (2010). Pharmacological inhibition of the mammalian target of rapamycin pathway suppresses acquired epilepsy. Neurobiol. Dis. 40, 193–199. doi: 10.1016/j.nbd. 2010.05.024 Huber, K. M., Klann, E., Costa-Mattioli, M., and Zukin, R. S. (2015). Dysregulation of mammalian target of rapamycin signaling in mouse models of autism. J. Neurosci. 35, 13836–13842. doi: 10.1523/jneurosci.2656-15.2015 Jevtovic-Todorovic, V. (2018). Exposure of developing brain to general anesthesia: what is the animal evidence? Anesthesiology 128, 832–839. doi: 10.1097/aln. 0000000000002047 Ju, X., Jang, Y., Heo, J. Y., Park, J., Yun, S., Park, S., et al. (2019). Anesthesia affects excitatory/inhibitory synapses during the critical synaptogenic period in the hippocampus of young mice: importance of sex as a biological variable. Neurotoxicology 70, 146–153. doi: 10.1016/j.neuro.2018.11.014 January 2020 | Volume 14 | Article 4 Ju et al. Kang, E., Jiang, D., Ryu, Y. K., Lim, S., Kwak, M., Gray, C. D., et al. (2017). Early postnatal exposure to isoflurane causes cognitive deficits and disrupts development of newborn hippocampal neurons via activation of the mTOR pathway. PLoS Biol. 15:e2001246. doi: 10.1371/journal.pbio.2001246 Khalifa, A. R., Abdel-Rahman, E. A., Mahmoud, A. M., Ali, M. H., Noureldin, M., Saber, S. H., et al. (2017). Sex-specific differences in mitochondria biogenesis, morphology, respiratory function and ROS homeostasis in young mouse heart and brain. Physiol. Rep. 5:e13125. doi: 10.14814/phy2.13125 Kim, M. H., Choi, J. H., Paik, S. K., et al. (2009). Enhanced NMDA receptor-mediated synaptic transmission, enhanced long-term potentiation and impaired learning and memory in mice lacking IRSp53. J. Neurosci. 29, 1586–1595. doi: 10.1523/jneurosci.4306- 08.2009 J., Yang, J., Chung, W., Kim, Lee, C. C., Huang, C. C., and Hsu, K. S. (2011). Insulin promotes dendritic spine and synapse formation by the PI3K/Akt/mTOR and Rac1 signaling pathways. Neuropharmacology 61, 867–879. doi: 10.1016/j.neuropharm.2011.06.003 Lee, E., Lee, (2017). Excitation/inhibition imbalance in animal models of autism spectrum disorders. Biol. Psychiatry 81, 838–847. doi: 10.1016/j.biopsych.2016.05.011 J., and Kim, E. Li, N., Lee, B., Liu, R. J., Banasr, M., Dwyer, J. M., Iwata, M., et al. (2010). mTOR-dependent synapse formation underlies the rapid antidepressant effects of NMDA antagonists. Science 329, 959–964. doi: 10.1126/science.1190287 Li, X., Wu, Z., Zhang, Y., Xu, Y., Han, G., and Zhao, P. (2017). Activation of autophagy contributes to sevoflurane-induced neurotoxicity in fetal rats. Front. Mol. Neurosci. 10:432. doi: 10.3389/fnmol.2017.00432 Li, Z., Okamoto, K., Hayashi, Y., and Sheng, M. (2004). The importance of dendritic mitochondria in the morphogenesis and plasticity of spines and synapses. Cell 119, 873–887. doi: 10.1016/j.cell.2004.11.003 Lin, E. P., Lee, J. R., Lee, C. S., Deng, M., and Loepke, A. W. (2017). Do anesthetics harm the developing human brain? An integrative analysis of animal and human studies. Neurotoxicol. Teratol. 60, 117–128. doi: 10.1016/j.ntt.2016. 10.008 McCann, M. E., De Graaff, J. C., Dorris, L., Disma, N., Withington, D., Bell, G., et al. (2019). Neurodevelopmental outcome at 5 years of age after general anaesthesia or awake-regional anaesthesia in infancy (GAS): an international, multicentre, randomised, controlled equivalence trial. Lancet 393, 664–677. doi: 10.1016/S0140-6736(18)32485-1 McCarthy, M. M., and Nugent, B. M. (2015). At the frontier of epigenetics of brain sex differences. Front. Behav. Neurosci. 9:221. doi: 10.3389/fnbeh.2015. 00221 Meredith, R. M. (2015). Sensitive and critical periods during neurotypical and aberrant neurodevelopment: a framework for neurodevelopmental disorders. Neurosci. Biobehav. Rev. 50, 180–188. doi: 10.1016/j.neubiorev.2014.12.001 Morita, M., Gravel, S. P., Chenard, V., Sikstrom, K., Zheng, L., Alain, T., et al. (2013). mTORC1 controls mitochondrial activity and biogenesis through 4E- BP-dependent translational regulation. Cell Metab. 18, 698–711. doi: 10.1016/j. cmet.2013.10.001 Morita, M., Gravel, S. P., Hulea, L., Larsson, O., Pollak, M., St-Pierre, J., et al. (2015). mTOR coordinates protein synthesis, mitochondrial activity and proliferation. Cell Cycle 14, 473–480. doi: 10.4161/15384101.2014.991572 Morita, M., Prudent, J., Basu, K., Goyon, V., Katsumura, S., Hulea, L., et al. (2017). mTOR controls mitochondrial dynamics and cell survival via MTFP1. Mol. Cell 67, 922.e925–935.e925. doi: 10.1016/j.molcel.2017.08.013 O’Leary, J. D., and Warner, D. O. (2017). What do recent human studies the association between anaesthesia in young children 458–464. tell us about and neurodevelopmental outcomes? Br. doi: 10.1093/bja/aex141 J. Anaesth. 119, Olutoye, O. A., Sheikh, F., Zamora, I. J., Yu, L., Akinkuotu, A. C., Adesina, A. M., et al. (2016). Repeated isoflurane exposure and neuroapoptosis in the midgestation fetal sheep brain. Am. J. Obstet. Gynecol. 214, 542.e541–542.e548. doi: 10.1016/j.ajog.2015.10.927 Ramanathan, A., and Schreiber, S. L. (2009). Direct control of mitochondrial function by mTOR. Proc. Natl. Acad. Sci. U S A 106, 22229–22232. doi: 10.1073/pnas.0912074106 Frontiers in Cellular Neuroscience | www.frontiersin.org 10 Rapamycin Prevents Neurological Changes Ran, I., Gkogkas, C. G., Vasuta, C., Tartas, M., Khoutorsky, A., Laplante, I., et al. (2013). Selective regulation of GluA subunit synthesis and AMPA receptor-mediated synaptic function and plasticity by the translation repressor 4E-BP2 in hippocampal pyramidal cells. J. Neurosci. 33, 1872–1886. doi: 10.1523/jneurosci.3264-12.2013 Rossi, M. J., and Pekkurnaz, G. (2019). Powerhouse of the mind: mitochondrial plasticity at the synapse. Curr. Opin. Neurobiol. 57, 149–155. doi: 10.1016/j. conb.2019.02.001 Shansky, R. M., and Woolley, C. S. (2016). Considering sex as a biological variable will be valuable for neuroscience research. J. Neurosci. 36, 11817–11822. doi: 10.1523/jneurosci.1390-16.2016 Sharma, J., Johnston, M. V., and Hossain, M. A. (2014). Sex differences in mitochondrial biogenesis determine neuronal death and survival in response to oxygen glucose deprivation and reoxygenation. BMC Neurosci. 15:9. doi: 10.1186/1471-2202-15-9 Tang, S. J., Reis, G., Kang, H., Gingras, A. C., Sonenberg, N., and Schuman, E. M. (2002). A rapamycin-sensitive signaling pathway contributes to long-term synaptic plasticity in the hippocampus. Proc. Natl. Acad. Sci. U S A 99, 467–472. doi: 10.1073/pnas.012605299 Tavazoie, S. F., Alvarez, V. A., Ridenour, D. A., Kwiatkowski, D. J., and Sabatini, B. L. (2005). Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2. Nat. Neurosci. 8, 1727–1734. doi: 10.1038/nn1566 Torres-Rojas, C., and Jones, B. C. (2018). Sex differences in neurotoxicogenetics. Front. Genet. 9:196. doi: 10.3389/fgene.2018.00196 Wang, Y., Barbaro, M. F., and Baraban, S. C. (2006). A role for the mTOR pathway in surface expression of AMPA receptors. Neurosci. Lett. 401, 35–39. doi: 10.1016/j.neulet.2006.03.011 Warner, D. O., Zaccariello, M. J., Katusic, S. K., Schroeder, D. R., Hanson, A. C., Schulte, P. J., et al. (2018). Neuropsychological and behavioral outcomes after exposure of young children to procedures requiring general anesthesia: the mayo anesthesia safety in kids (MASK) study. Anesthesiology 129, 89–105. doi: 10.1097/ALN.0000000000002232 Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., and Finlay, B. L. (2013). Modeling transformations of neurodevelopmental sequences across mammalian species. J. Neurosci. 33, 7368–7383. doi: 10.1523/JNEUROSCI. 5746-12.2013 Yang, X., Schadt, E. E., Wang, S., Wang, H., Arnold, A. P., Ingram-Drake, L., et al. (2006). Tissue-specific expression and regulation of sexually dimorphic genes in mice. Genome Res. 16, 995–1004. doi: 10.1101/gr.5217506 Zaccariello, M. J., Frank, R. D., Lee, M., Kirsch, A. C., Schroeder, D. R., Hanson, A. C., et al. (2019). Patterns of neuropsychological changes after the mayo general anaesthesia in young children: secondary analysis of anesthesia safety in kids study. Br. J. Anaesth. 122, 671–681. doi: 10.1016/j.bja. 2019.01.022 Zeng, L. H., Rensing, N. R., and Wong, M. (2009). The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy. J. Neurosci. 29, 6964–6972. doi: 10.1523/jneurosci.0066-09.2009 J., Wang, C., Yu, S., Luo, Z., Chen, Y., Liu, Q., et al. (2014). Sevoflurane postconditioning protects rat hearts against ischemia-reperfusion injury via the activation of PI3K/AKT/mTOR signaling. Sci. Rep. 4:7317. doi: 10.1038/srep07317 Zhang, Conflict of Interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Copyright © 2020 Ju, Ryu, Cui, Lee, Park, Hong, Yoo, Lee, Shin, Yoon, Kweon, Kim, Ko, Heo and Chung. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. January 2020 | Volume 14 | Article 4",mice,['Preclinical animal studies have continuously reported the possibility of long-lasting neurotoxic effects after general anesthesia in young animals.'],postnatal day 16/17,"['This study, therefore, evaluated the role of mTOR signaling after exposing postnatal day (PND) 16/17 mice to sevoflurane, a widely used inhalation agent in pediatric patients.']",N,[],sevoflurane,"['This study, therefore, evaluated the role of mTOR signaling after exposing postnatal day (PND) 16/17 mice to sevoflurane, a widely used inhalation agent in pediatric patients.']",rapamycin,"['Pretreatment with the mTOR inhibitor rapamycin not only prevented anesthesia-induced mTOR phosphorylation, but also the increase in mitochondrial respiration and male-dependent enhancement of excitatory synaptic transmission.']",c57bl/6,"['C57BL/6J mice were maintained in a specific pathogen-free (SPF) room maintained at 22◦C, with a 12 h light/dark cycle, and fed ad libitum.']",The study addresses the role of mTOR signaling in anesthesia-induced changes in synaptic transmission and mitochondrial respiration in late postnatal mice.,"['This study, therefore, evaluated the role of mTOR signaling after exposing postnatal day (PND) 16/17 mice to sevoflurane, a widely used inhalation agent in pediatric patients.']",None,[],The article argues that mTOR inhibitors may act as potential therapeutic agents for anesthesia-induced changes in the developing brain.,['Our results suggest that mTOR inhibitors may act as potential therapeutic agents for anesthesia-induced changes in the developing brain.'],The study has limitations regarding the effects of slight changes in arterial carbon dioxide (PaCO2) and blood pH after exposure to sevoflurane for 2 h.,"['This study has several limitations. Although the oxygen concentration during anesthesia was relatively low (FiO2 0.4), thereby avoiding oxygen toxicity, we are unable to rule out the effects of slight changes in arterial carbon dioxide (PaCO2) and blood pH after exposure to sevoflurane for 2 h.']",None,[],True,False,True,True,False,True,10.3389/fncel.2020.00004 10.1213/ANE.0b013e3182a8c709,815.0,Kato,2013,rats,postnatal day 7,N,sevoflurane,none,wistar/st,"H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Neonatal Exposure to Sevoflurane Causes Significant Suppression of Hippocampal Long-Term Potentiation in Postgrowth Rats Rui Kato, MD, PhD,* Kaori Tachibana, MD, PhD,* Naoki Nishimoto, PhD,† Toshikazu Hashimoto, MD, PhD,* Yosuke Uchida, MD,* Ryoko Ito, MD,* Kenkichi Tsuruga, MD,* Koichi Takita, MD, PhD,* and Yuji Morimoto, MD, PhD* BACKGROUND: The inhaled anesthetic sevoflurane is commonly used for neonates in the clinical setting. Recent studies have indicated that exposure of neonatal rodents to sevoflu- rane causes acute widespread neurodegeneration and long-lasting neurocognitive dysfunction. Although acute toxic effects of sevoflurane on cellular viability in the hippocampus have been reported in some studies, little is known about the effects of neonatal sevoflurane exposure on long-term hippocampal synaptic plasticity, which has been implicated in the processes of learn- ing and memory formation. Our study is the first to examine the long-term electrophysiological impact of neonatal exposure to a clinically relevant concentration of sevoflurane. METHODS: On postnatal day 7, rats were exposed to sevoflurane (1% or 2% for 2 hours) with oxygen. To eliminate the influence of blood gas abnormalities caused by sevoflurane-induced respiratory suppression, a group of rats were exposed to a high concentration of carbon dioxide (8% for 2 hours) to duplicate respiratory disturbances caused by 2% sevoflurane exposure. RESULTS: Exposure of neonatal rats to 2% sevoflurane for 2 hours caused significant suppres- sion of long-term potentiation (LTP) induction in the postgrowth period. There was no significant difference between the control group and the CO2-exposed group in LTP induction, indicating that sevoflurane-induced LTP suppression was not caused by blood gas abnormalities. CONCLUSION: Our present findings indicate that neonatal exposure to sevoflurane at a higher concentration can cause alterations in the hippocampal synaptic plasticity that persists into adulthood. (Anesth Analg 2013;117:1429–35) Neonatal exposure to anesthetics has been shown to induce acute neuronal cell death and long-lasting behavioral abnormalities in animal models includ- ing primates.1–6 Jevtovic-Todorovic et al.1 reported that isoflurane, individually or in combination with other anes- thetics, caused neurodegeneration, deficits of hippocampal electrophysiological function, and persistent memory and learning impairments in rats. Fredriksson et al.2 reported that neonatal exposure to a combination of thiopental or propofol and ketamine caused a synergistic neurotoxic effect in mice. According to those reports, anesthetics that activate γ-aminobutyric acid-A (GABA) receptors and block N-methyl-d-aspartate (NMDA)-type glutamate receptors have neurotoxic effects in developing animals.6,7 Sevoflurane is one of the most commonly used inhaled anesthetics for neonates in the clinical setting. It activates GABA receptors (GABAR) and blocks NMDA receptors,8,9 From the *Department of Anesthesiology and Critical Care Medicine and †Di- vision of Clinical Trial Management, Center for Translational Research, Hok- kaido University Graduate School of Medicine, Sapporo, Japan. and several lines of study have shown that it causes neu- rodegeneration in the central nervous system in neona- tal rodents and long-lasting neurocognitive dysfunction, including learning disabilities.3,10–13 The effect of acute anes- thetic toxicity on cellular viability has been well studied; however, the mechanism of long-lasting learning disabili- ties is still uncertain. Hippocampal synaptic plasticity has been implicated in many learning and memory processes.14–18 Therefore, 1 possible mechanism that underlies the learning disability found after neonatal exposure to sevoflurane is assumed to be impairments in hippocampal synaptic plasticity. In this study, we aimed to characterize the electrophysiologi- cal alterations caused by neonatal sevoflurane exposure by investigating in vivo long-term potentiation (LTP) induc- tion in the hippocampal CA1 region. We also evaluated the effects of hypercapnia and acidosis using a carbon dioxide (CO2) exposure model because respiratory disturbances caused by anesthesia are unavoidable in small animals. The present study is the first to examine the long-term electro- physiological impact of exposing neonatal rats to clinically relevant concentrations of sevoflurane. Accepted for publication August 2, 2013. Funding: This work was supported by the Ministry of Education, Science, Sports, and Culture of Japan Society for the Promotion of Science. (Grants-in- Aid for Scientific Research 22591699, 20791060) The authors declare no conflicts of interest. Reprints will not be available from the authors. Address correspondence to Rui Kato, MD, PhD, Department of Anesthesiol- ogy and Critical Care Medicine, Hokkaido University Graduate School of Medicine, Kita-15, Nishi-7, Kita-Ku, Sapporo 060-8638, Japan. Address e-mail to katorui@med.hokudai.ac.jp. Copyright © 2013 International Anesthesia Research Society DOI: 10.1213/ANE.0b013e3182a8c709 METHODS Animals The experiments were approved by the Committee for Animal Research of the Hokkaido University Graduate School of Medicine. Pregnant Wistar/ST rats were obtained from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). The animals were housed in a room maintained at 22°C to 25°C with a 12-hour light-dark cycle (light from December 2013 • Volume 117 • Number 6 www.anesthesia-analgesia.org 1429 ReseaRch RepoRt H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Neonatal Sevoflurane Exposure Impairs Long-Term Potentiation Induction 06:00 to 18:00) and were given free access to food and water. Rats were handled in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Hokkaido University Graduate School of Medicine. Gas Exposure At postnatal day 7, male pups were divided into 4 treat- ment groups as follows: animals exposed to (1) 1% sevo- flurane with oxygen (O2), (2) 2% sevoflurane with O2, (3) 8% CO2 with O2 to mimic hypercapnia and acidosis caused by 2% sevoflurane exposure, or (4) 100% O2 as a control. Rat pups were placed in an acrylic chamber and exposed to warmed, humidified gas for 2 hours. The total gas flow was 3 L/min to maintain a stable gas concentration. The concentrations of sevoflurane, CO2, and O2 in the chamber were continuously monitored using an anesthetic gas moni- tor (5250RGM, Datex-Ohmeda GE Healthcare, Chalfont St. Giles, United Kingdom). The gas temperature in the cham- ber was maintained at 27.5°C to 28.6°C, measured using a TR-200 (F.S.T., Foster City, CA), and the rats’ body tempera- tures were maintained at 35.1°C to 36.5°C, measured using a Thermofocus® (Tecnimed, Tokyo, Japan). To avoid litter variability, equal numbers of rat pups from each litter were randomly assigned to the 4 treatment groups. After gas exposure, rat pups were brought up in an austere environ- ment in standardized cages to avoid the influence of envi- ronmental enrichment on later neurocognitive functions.13 Arterial Blood Gas Assessment To assess respiratory disturbances caused by sevoflurane exposure, arterial blood gas assessment was performed as described previously.19,20 At postnatal day 7, rats underwent arterial blood sampling from the left ventricle via transtho- racic puncture under local subcutaneous anesthesia (0.05 mL of 1% lidocaine) at 30, 60, 90, or 120 minutes during 2 hour treatments. Since taking even a single sample of blood could be fatal for the rats, blood sampling was conducted only once for each rat. A small amount of blood (<100 μL) was collected and analyzed immediately using a blood gas analyzer (ABL510, Radiometer Medical, Brønshøj, Denmark) that measured pH, partial pressure of CO2, and O2 (Paco2 and Pao2 in mm Hg, respectively). In all cases, the procedure was completed within 1 minute in the chamber. Electrophysiological Study Between postnatal days 63 and 70, an electrophysiologi- cal study was performed following our reported method.21 Rats were anesthetized with 1% halothane in a mixture of 21% O2 and 79% nitrogen through a tracheal catheter, and their lungs mechanically ventilated (SN-480–7, Shinano, Tokyo, Japan). They were placed in a stereotaxic apparatus with the bregma and lambda in the same horizontal plane, and their body temperatures were maintained at 37°C ± 0.5°C with a heating pad throughout the recording period. The concentration of halothane and expired CO2 tension was continuously monitored through a tracheal catheter using an anesthetic gas monitor (5250RGM, Datex-Ohmeda GE Healthcare), and the expired CO2 tension was main- tained between 35 and 45 mm Hg. A monopolar recording electrode was inserted into the pyramidal cell body layer 1430 www.anesthesia-analgesia.org of the hippocampal CA1 region (5.0 mm posterior and 3.0 mm lateral to the bregma and approximately 2.2 mm ven- tral to the dura), to record extracellular population spike amplitude (PSA) (Fig. 1A). A bipolar stimulating electrode was inserted into the ipsilateral Schaffer collaterals (3.0 mm posterior and 1.5 mm lateral to the bregma, and 2.8 mm ventral to the dura) to deliver cathodal stimulus (fre- quency 0.1 Hz, pulse duration 250 μs) (Fig. 1A). A single electrical stimulus evoked action potentials in the Schaffer collaterals, resulting in activation of pyramidal cells of the CA1 region, and extracellular PSA was recorded (MacLab, ADInstruments, Sydney, Australia). We measured the PSA following our previous method.21 Briefly, the PSA was defined as the absolute voltage of a vertical line running from the population spike minimum to its intersection with a line tangential to the population spike onset and popula- tion spike offset. To adjust the test stimulus, changes in PSA caused by varied stimulus intensity were recorded, and the intensity of the test stimulus was then fixed to produce a half-maximal response for each rat. After establishing a sta- ble baseline for 30 minutes, LTP was induced by applying high-frequency stimulation (HFS; 10 trains at 1 Hz each, composed of 8 pulses at 400 Hz), at the same intensity as the test stimulation. Then relative ratios of PSAs before and after the HFS were then plotted every 5 minutes for 60 minutes after HFS. On completion of the experiment, small lesions were made using a direct electric current (5 µA for 30 seconds) at the tips of the recording and stimulating electrodes. The positions of the electrodes were examined histologically (Fig. 1) according to methods in similar pre- vious reports.22,23 Histological confirmation of the locations of the electrodes showed misplacement of the electrodes in 2 rats in each group, so the data obtained from those elec- trodes were excluded from the following assessment. All Figure 1. Positions of stimulating and recording electrodes (A). The triangle shows the position of the tip of the stimulating electrode, which was located 3 mm posterior and 1.5 mm lateral to the bregma and 2.8 mm under the dura. The circle shows the position of the tip of the recording electrode, which was located 5 mm posterior and 3 mm lateral to the bregma and 2.2 mm under the dura. The locations of the electrodes were examined using a post hoc histological test (B, C). The arrow shows the tip of the stimulating electrode located at the Schaffer collateral (B), and the arrowhead shows the recording electrode located in the pyramidal cell layer of the CA1 region (C). aNesthesia & aNalgesia H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f data were collected by investigators who were blinded to treatment assignment. Statistical Methods All statistical analyses were performed using GraphPad Prism version 5.04 (GraphPad Software, Inc., San Diego, CA). First, we confirmed normal distribution of the obtained data by the Shapiro-Wilk test and a normal-probability plot. Data obtained in arterial blood gas analysis were analyzed using 1-way analysis of variance (ANOVA) followed by Bonferroni multiple comparison test for each time point. In the comparisons of LTP data, we used 2-way repeated-mea- sures ANOVA with treatment and time as factors to assess the interaction, and we used 1-way ANOVA followed by Bonferroni multiple comparison test to evaluate differences among the groups at each time point. All averaged data are presented as mean ± SEM. Probability values (P) of <5% were considered significant. RESULTS Anesthetic Effect of Neonatal Sevoflurane Exposure Neonatal 2% sevoflurane exposure caused immediate loss of spontaneous movement and righting reflex but pre- served the response to tail pinch. Neonatal 2% sevoflurane also reduced respiratory rate throughout treatment. In the group exposed to 1% sevoflurane, spontaneous movement decreased, but the righting reflex, tail pinch response and frequency of breath were not disturbed. CO2 exposure caused no remarkable change. After treatment, all rats recovered completely. Arterial Blood Gas Analysis The results from blood gas analysis are summarized in Table 1. In the CO2 and 2% sevoflurane groups, there were significant respiratory disturbances from hypercapnia and respiratory acidosis throughout treatment compared with the control and 1% sevoflurane groups, whereas 1% sevo- flurane exposure caused no significant changes compared with no exposure in the control group. We could not find significant differences in Pao2, Paco2, or pH between the CO2 and 2% sevoflurane-exposed groups, that is, the hyper- capnia and acidosis observed in the 2% sevoflurane group were the same in the CO2 group. Hypoxia was not observed during treatment in any group. Neonatal Exposure to 2% Sevoflurane Caused Significant Suppression of Hippocampal LTP Induction After the establishment of stable baseline PSAs, the groups (N = 8 for each) were subjected to HFS. PSAs were signifi- cantly augmented in the control and CO2 groups, and LTP was induced as shown in Figure 2A. The maximal responses were 214.1% ± 29.8%, 218.6% ± 25.4%, 170.7% ± 20.1%, and 130.9% ± 10.5% in the control, CO2, 1% sevoflurane, and 2% sevoflurane groups, respectively. Two-way repeated-mea- sures ANOVA revealed significant differences among the treatments (F = 3.90; P = 0.019) but not among time courses (F = 1.86; P = 0.058). There was no interaction among the groups (F = 0.70; P = 0.825). The LTP data between 15 and December 2013 • Volume 117 • Number 6 60 minutes after HFS were used for this analysis because LTP responses were unstable for 10 minutes after HFS. LTP induction in the 2% sevoflurane group was significantly suppressed compared with the control and CO2 groups at 5, 10, 15, 20, 25, 30, 35, and 40 minutes (Fig. 2B). There were no significant differences among the other groups. However, the statistical power of the analysis between the control and 1% sevoflurane groups might have been insuf- ficient from our sample size. As shown in Table 2, the width of Bonferroni adjusted 95% confidence interval for the mean difference between these groups was greater com- pared with the mean difference at each time point. Further research may be necessary to detect the difference caused by 1% sevoflurane exposure. These results indicated that neonatal 2% sevoflurane exposure caused significant long- lasting suppression of hippocampal LTP induction, but neo- natal 8% CO2 exposure with O2 did not cause any significant electrophysiological changes. DISCUSSION In this study, we showed that neonatal exposure to 2% sevoflurane caused significant suppression of LTP induc- tion in an in vivo electrophysiological study of adult rats. Hypercapnia and acidosis, which mimicked the sevoflu- rane-induced respiratory disturbances, had no influence on LTP induction. In the present study, we used 1% halothane to anesthe- tize rats during hippocampal LTP measurement. In vivo electrophysiological study under halothane anesthesia is a well-established procedure in adult rodents.24,25 Halothane anesthesia provides a more stabilized anesthetic depth during experiments compared with the intermittent IV or intraperitoneal injection of anesthetics. Although halothane has been shown to depress CA1 population spikes and LTP induction when applied to hippocampal slices,26 exposure to halothane in vivo does not block the induction of hip- pocampal LTP.27 The discrepancy between these findings in vitro and in vivo could reflect differences in the balance between excitatory and inhibitory circuitry. Thus, halothane has been used successfully for in vivo studies of hippocam- pal synaptic plasticity in rodents, including our previous studies.21,24,25,28,29 To avoid the possible modulation of hippo- campal synaptic activity by halothane-induced physiologi- cal changes (e.g., hypoxia and ischemia), we used intensive respiratory management in our in vivo electrophysiological studies.21,28,29 Respiratory management by tracheal intuba- tion, mechanical ventilation, and monitoring of end-tidal CO2 enabled us to control halothane-induced respiratory depression. Halothane also suppresses circulation; how- ever, our preliminary study showed that 1% halothane had relatively little influence on femoral arterial pressure in adult rats (data not shown). Thus, we assume that halo- thane anesthesia in this in vivo study had minimal electro- physiological and physiological influence on hippocampal synaptic activity. learn- ing impairments after neonatal exposure to anesthetics remain poorly understood. Although acute widespread cell death has been observed,1,30,31 several studies have shown increased neurogenesis and apparent anatomical recovery The critical mechanisms that contribute to www.anesthesia-analgesia.org 1431 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Neonatal Sevoflurane Exposure Impairs Long-Term Potentiation Induction Table 1. Arterial Blood Gas Analysis Group Control Time (min) 30 60 90 120 30 60 90 120 30 60 90 120 30 60 90 120 CO2 1% Sevoflurane 2% Sevoflurane N 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 pH 7.43 ± 0.04 7.36 ± 0.03 7.37 ± 0.02 7.38 ± 0.02 7.18 ± 0.03a 7.16 ± 0.03a 7.14 ± 0.02a 7.20 ± 0.02a 7.41 ± 0.02b 7.40 ± 0.04b 7.36 ± 0.01b 7.34 ± 0.05b 7.18 ± 0.03ac 7.23 ± 0.0ac 7.17 ± 0.03ac 7.18 ± 0.03ac Paco2 (mm Hg) 37.9 ± 5.4 47.2 ± 7.3 44.0 ± 3.0 46.5 ± 2.6 76.3 ± 4.9a 88.7 ± 5.8a 81.5 ± 5.0a 79.7 ± 6.2a 39.1 ± 2.8b 38.7 ± 3.3b 41.6 ± 1.0b 53.9 ± 5.6b 77.5 ± 5.7ac 79.1 ± 3.8ac 81.7 ± 2.8ac 89.9 ± 5.1ac Pao2 (mm Hg) 414.0 ± 51.6 414.2 ± 30.5 369.2 ± 53.7 350.6 ± 51.8 296.8 ± 70.9 200.1 ± 24.7 215.2 ± 45.8 237.5 ± 51.2 405.1 ± 77.0 358.4 ± 94.6 360.2 ± 64.4 366.9 ± 66.1 337.6 ± 28.4 226.9 ± 52.8 200.2 ± 28.9 235.4 ± 40.5 Data from arterial blood gas analysis. All groups were composed of 5 rats. Blood samples were collected from the left ventricle every 30 minutes during gas exposure. Statistical analysis revealed that neonatal 2% sevoflurane anesthesia and 8% CO2 exposure caused significant hypercapnia and acidosis in rats. There were no significant differences between the control group and 1% sevoflurane group or the CO2 group and 2% sevoflurane group for pH and Paco2. Hypoxia was not observed in any group. The acidosis and hypercapnia observed in the 2% sevoflurane group were well mimicked by the CO2 group. Data are presented as mean ± SEM. aVersus control group. bVersus CO2 group. cVersus 1% sevoflurane group. P < 0.05. Figure 2. Neonatal 2% sevoflurane anesthesia suppressed long-term potentiation (LTP) induction in the postgrowth period. Specimen record- ings (A) and time course responses of population spike amplitude (PSA) to 60 minutes after high-frequency stimulation (HFS) (B). Two-way repeated-measures ANOVA revealed that there was no interaction between treatments and time course changes, whereas there were signifi- cant differences between treatments during the period from 15 to 60 minutes after HFS. Statistical analysis revealed that there were signifi- cant differences between the 2% sevoflurane group and the control and CO2 groups at 5, 10, 15, 20, 25, 30, 35, and 40 minutes after HFS. All groups were composed of 8 rats. Data are shown as mean ± SEM. *Versus control group, †Versus CO2 group. after acute histopathological damage induced by neonatal anesthesia.5,20 In those studies, rat pups that were exposed to anesthesia showed minimal to no histopathological damage as adults. This suggests that the developing brain may have a high capacity for self-repair of morphological changes. This evidence led us to hypothesize that there might be additional, or even alternative, mechanisms that could mediate anesthetic-induced long-term learning defi- cits and other cognitive dysfunctions besides the immediate morphological changes in the hippocampus. 1432 www.anesthesia-analgesia.org aNesthesia & aNalgesia H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Table 2. Bonferroni Adjusted 95% Confidence Intervals for the Mean Difference Between Treatments in Figure 2B Control versus CO2 Time points (min) 15 20 25 30 35 40 45 50 55 60 Lower CL (%) −65.09 −61.71 −79.29 −72.26 −69.94 −70.10 −91.01 −86.49 −70.41 −83.53 Control versus 1% sevoflurane Difference (%) 12.97 11.84 −2.97 9.2 3.92 8.29 −8.37 −2.1 13.92 2.72 Upper CL (%) 91.04 85.4 73.36 90.65 77.78 86.69 74.28 82.29 98.24 88.98 Time points (min) 15 20 25 30 35 40 45 50 55 60 Lower CL (%) −124.87 −122.88 −123.25 −125.13 −115.66 −119.30 −135.91 −131.13 −116.65 −130.26 Control versus 2% sevoflurane Difference (%) −46.81 −49.33 −46.93 −43.67 −41.81 −40.9 −53.27 −46.74 −32.33 −44.01 Upper CL (%) 31.26 24.22 29.4 37.78 32.05 37.49 29.38 37.66 52 42.24 Time points (min) 15 20 25 30 35 40 45 50 55 60 Difference (%) −90.49 −89.36 −91.08 −90.68 −87.1 −83.76 −89.11 −84.98 −72.2 −88.02 Lower CL (%) −168.55 −162.91 −167.41 −172.13 −160.96 −162.16 −171.76 −169.37 −156.52 −174.27 Upper CL (%) −12.43 −15.80 −14.76 −9.23 −13.24 −5.37 −6.46 −0.59 12.13 −1.76 Bonferroni adjusted 95% confidence interval (95% CI) for the mean difference by the treatment combination between groups in Figure 2B. Mean difference (Difference), lower confidence limits (lower CL), and upper CL between groups at each time point was listed. 95% CI for the mean difference showed that there was a statistical difference in the control group versus 2% Sevoflurane group, and there was no statistical significance difference in the control group versus CO2 group and in the control group versus 1% Sevoflurane group at each time point. However, in the control group versus CO2 group and in the control group versus 1% Sevoflurane group, the statistical power might be insufficient from our sample size, because the width of 95% CI was greater compared with the mean difference between groups. Further, research is required to detect the difference. One possible reason for anesthetic-induced neurotoxicity is the potential effect of anesthetics on synaptic morphology and function. Previously, we reported that the GABAergic anesthetic pentobarbital, administered at P7, induced long- lasting suppression of hippocampal synaptic plasticity as well as learning disturbances.21 Commonly used anesthet- ics with GABAergic or antiglutamatergic properties such as midazolam, isoflurane, and nitrous oxide, when combined, also suppress hippocampal LTP in adulthood after admin- istration at P7.1 Thus, hippocampal LTP might be associated with the pathophysiology of neonatal anesthetic-related learning deficits remaining in adulthood. During synaptogenesis, signals via NMDA and/or GABA receptors mediate neuronal survival, migration, and synaptic formation.32,33 It has been reported that abnormal December 2013 • Volume 117 • Number 6 or excess signals of those receptors may have a long- lasting negative influence over synaptic maturation.34,35 Because sevoflurane has GABAergic and/or antiglutama- tergic properties,8,9 neonatal sevoflurane anesthesia pas- sively modulates those synaptic developmental processes and induces abnormal synaptic formation or ectopic neu- ronal cell distribution that leads to impairment of syn- aptic plasticity such as induction of hippocampal LTP in the CA1 region. We have reported that administration of dexmedetomidine, an α2A adrenergic agonist, causes no impairment in hippocampal synaptic plasticity28 and has no adverse effect on cognitive functions in adulthood.36 The absence of neurotoxicity in rodents treated neonatally with dexmedetomidine, which has no GABAergic or glu- tamatergic properties, may suggest that pharmacological intervention via GABAergic and/or glutamatergic neuro- transmission might play a crucial role in the impairment of hippocampal neural functions, including hippocampal synaptic plasticity. However, further study is needed to clarify the mechanisms underlying sevoflurane-induced LTP impairment shown in this study. Despite several conflicting reports,1,3,31 it has been well documented that neonatal rodents develop respiratory suppression and subsequent blood gas abnormalities dur- ing anesthetic exposure.21,37,38 Loepke et al.20 pointed out the possible involvement of such blood gas abnormalities in anesthetic-induced neurotoxicity observed in neonatal rodents. Yet the role of blood gas abnormalities in neurode- velopment has remained uncertain. Recently, we attempted to evaluate the influence of blood gas abnormalities in P7 rat pups on their later hippocampal function.29 In that study, P7 rat pups exposed to 13% CO2 under 21% O2 showed blood gas abnormalities along with hypoxia, hypercapnia, and metabolic acidosis, which inhibited hippocampal LTP induction in the postgrowth period.29 Importantly, com- pared with acidosis only, prolonged metabolic acidosis with hypoxia has been thought to carry a higher risk for neuro- nal deficits.39 Furthermore, studies performed in clinical set- tings have demonstrated a correlation between the degree of metabolic acidosis and neonatal neurological outcome.40 This evidence led us to suspect that neither hypercapnia nor low pH, but the coexistence of hypoxia and progres- sive metabolic acidosis during CO2 exposure, could have profound effects on hippocampal synaptic plasticity in later life. In light of this evidence, we used 100% O2 as a carrier gas in the current study. We needed 8% CO2 with 100% O2 to mimic respiratory disturbance and subsequent blood gas abnormalities caused by 2% sevoflurane exposure; this CO2 exposure protocol caused no impairment in later LTP induc- tion, suggesting that respiratory disturbances caused by neonatal exposure to 2% sevoflurane had negligible influ- ence on hippocampal synaptic plasticity in later life. This finding also led us to speculate that hypercapnia and low pH during development, without hypoxia and possible metabolic acidosis, had less effect on hippocampal synaptic plasticity in later life. In conclusion, our present findings indicate that expo- sure to 2% sevoflurane causes persistent suppression of LTP induction. This persistent change in synaptic plastic- ity after neonatal sevoflurane exposure may be one of the www.anesthesia-analgesia.org 1433 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Neonatal Sevoflurane Exposure Impairs Long-Term Potentiation Induction mechanisms underlying sevoflurane-induced neurocogni- tive dysfunction. E DISCLOSURES Name: Rui Kato, MD, PhD. Contribution: This author designed the study, conducted almost all experiments with some other authors, and wrote the manuscript. Attestation: Rui Kato attests to the integrity of the original data and the analysis reported in this manuscript. Yuji Morimoto is the archival author. Name: Kaori Tachibana, MD, PhD. Contribution: This author helped in designing the study and conducting experiments. Name: Naoki Nishimoto, PhD. Contribution: This author helped in statistical analysis. Name: Toshikazu Hashimoto, MD, PhD. Contribution: This author helped in designing the study and preparing the manuscript. Name: Yosuke Uchida, MD. Contribution: This author helped in preparing the manuscript. Name: Ryoko Ito, MD. Contribution: This author helped in electrophysiological tests. Name: Kenkichi Tsuruga, MD Contribution: This author helped in preparing the manuscript. Name: Koichi Takita, MD, PhD. Contribution: This author helped in electrophysiological tests and preparing the manuscript. Name: Yuji Morimoto, MD, PhD. Contribution: This author helped in designing the study and preparing the manuscript. Attestation: Yuji Morimoto is the archival author of this manuscript. This manuscript was handled by: Gregory J. Crosby, MD. REFERENCES 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early expo- sure to common anesthetic agents causes widespread neurode- generation in the developing rat brain and persistent learning deficits. J Neurosci 2003;23:876–82 2. Fredriksson A, Pontén E, Gordh T, Eriksson P. Neonatal expo- sure to a combination of N-methyl-D-aspartate and gamma- aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 2007;107:427–36 3. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, Ito M, Imaki J. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 2009;110:628–37 4. Slikker W Jr, Zou X, Hotchkiss CE, Divine RL, Sadovova N, Twaddle NC, Doerge DR, Scallet AC, Patterson TA, Hanig JP, Paule MG, Wang C. Ketamine-induced neuro- nal cell death in the perinatal rhesus monkey. Toxicol Sci 2007;98:145–58 5. Stratmann G, May LD, Sall JW, Alvi RS, Bell JS, Ormerod BK, Rau V, Hilton JF, Dai R, Lee MT, Visrodia KH, Ku B, Zusmer EJ, Guggenheim J, Firouzian A. Effect of hyper- carbia and isoflurane on brain cell death and neurocogni- tive dysfunction in 7-day-old rats. Anesthesiology 2009;110: 849–61 6. Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vöckler J, Dikranian K, Tenkova TI, Stefovska V, Turski L, Olney JW. Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 1999;283:70–4 7. Olney JW, Young C, Wozniak DF, Jevtovic-Todorovic V, Ikonomidou C. Do pediatric drugs cause developing neurons to commit suicide? Trends Pharmacol Sci 2004;25:135–9 1434 www.anesthesia-analgesia.org 8. Hollmann MW, Liu HT, Hoenemann CW, Liu WH, Durieux ME. Modulation of NMDA receptor function by ketamine and magnesium. Part II: interactions with volatile anesthetics. Anesth Analg 2001;92:1182–91 9. Nishikawa K, Harrison NL. The actions of sevoflurane and desflurane on the gamma-aminobutyric acid receptor type A: effects of TM2 mutations in the alpha and beta subunits. Anesthesiology 2003;99:678–84 10. Bercker S, Bert B, Bittigau P, Felderhoff-Müser U, Bührer C, Ikonomidou C, Weise M, Kaisers UX, Kerner T. Neurodegeneration in newborn rats following propofol and sevoflurane anesthesia. Neurotox Res 2009;16:140–7 11. Edwards DA, Shah HP, Cao W, Gravenstein N, Seubert CN, Martynyuk AE. Bumetanide alleviates epileptogenic and neurotoxic effects of sevoflurane in neonatal rat brain. Anesthesiology 2010;112:567–75 12. Kodama M, Satoh Y, Otsubo Y, Araki Y, Yonamine R, Masui K, Kazama T. Neonatal desflurane exposure induces more robust neuroapoptosis than do isoflurane and sevoflurane and impairs working memory. Anesthesiology 2011;115:979–91 13. Shih J, May LD, Gonzalez HE, Lee EW, Alvi RS, Sall JW, Rau V, Bickler PE, Lalchandani GR, Yusupova M, Woodward E, Kang H, Wilk AJ, Carlston CM, Mendoza MV, Guggenheim JN, Schaefer M, Rowe AM, Stratmann G. Delayed environmental enrichment reverses sevoflurane-induced memory impairment in rats. Anesthesiology 2012;116:586–602 14. Morris RG, Garrud P, Rawlins JN, O’Keefe J. Place naviga- tion impaired in rats with hippocampal lesions. Nature 1982;297:681–3 15. Burgess N, Maguire EA, O’Keefe J. The human hippocampus and spatial and episodic memory. Neuron 2002;35:625–41 16. Bliss TV, Collingridge GL. A synaptic model of memory: long- term potentiation in the hippocampus. Nature 1993;361:31–9 17. Gruart A, Muñoz MD, Delgado-García JM. Involvement of the CA3-CA1 synapse in the acquisition of associative learning in behaving mice. J Neurosci 2006;26:1077–87 18. Whitlock JR, Heynen AJ, Shuler MG, Bear MF. Learning induces long-term potentiation in the hippocampus. Science 2006;313:1093–7 19. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V. General anes- thesia activates BDNF-dependent neuroapoptosis in the devel- oping rat brain. Apoptosis 2006;11:1603–15 20. Loepke AW, Istaphanous GK, McAuliffe JJ 3rd, Miles L, Hughes EA, McCann JC, Harlow KE, Kurth CD, Williams MT, Vorhees CV, Danzer SC. The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and mem- ory. Anesth Analg 2009;108:90–104 21. Tachibana K, Hashimoto T, Kato R, Tsuruga K, Ito R, Morimoto Y. Long-lasting effects of neonatal pentobarbital administration on spatial learning and hippocampal synaptic plasticity. Brain Res 2011;1388:69–76 22. Ohashi S, Matsumoto M, Otani H, Mori K, Togashi H, Ueno K, Kaku A, Yoshioka M. Changes in synaptic plastic- ity in the rat hippocampo-medial prefrontal cortex pathway induced by repeated treatments with fluvoxamine. Brain Res 2002;949:131–8 23. Tachibana K, Kato R, Tsuruga K, Takita K, Hashimoto T, Morimoto Y. Altered synaptic transmission in rat anterior cingulate cortex following peripheral nerve injury. Brain Res 2008;1238:53–8 24. Thiels E, Xie X, Yeckel MF, Barrionuevo G, Berger TW. NMDA receptor-dependent LTD in different subfields of hippocampus in vivo and in vitro. Hippocampus 1996;6:43–51 25. Yeckel MF, Berger TW. Spatial distribution of potentiated syn- apses in hippocampus: dependence on cellular mechanisms and network properties. J Neurosci 1998;18:438–50 26. MacIver MB, Tauck DL, Kendig JJ. General anaesthetic modi- fication of synaptic facilitation and long-term potentiation in hippocampus. Br J Anaesth 1989;62:301–10 27. Pearce RA, Stringer JL, Lothman EW. Effect of volatile anes- thetics on synaptic transmission in the rat hippocampus. Anesthesiology 1989;71:591–8 28. Tachibana K, Hashimoto T, Kato R, Uchida Y, Ito R, Takita K, Morimoto Y. Neonatal administration with dexmedetomidine aNesthesia & aNalgesia H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f does not impair the rat hippocampal synaptic plasticity later in adulthood. Paediatr Anaesth 2012;22:713–9 29. Tachibana K, Hashimoto T, Takita K, Ito R, Kato R, Morimoto Y. Neonatal exposure to high concentration of carbon dioxide produces persistent learning deficits with impaired hippocampal synaptic plasticity. Brain Res 2013; 1507:83–90 30. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, McAuliffe JJ, Danzer SC, Loepke AW. Comparison of the neu- roapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 2011;114:578–87 31. Liang G, Ward C, Peng J, Zhao Y, Huang B, Wei H. Isoflurane causes greater neurodegeneration than an equivalent expo- sure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 2010;112:1325–34 32. Komuro H, Rakic P. Modulation of neuronal migration by NMDA receptors. Science 1993;260:95–7 33. Behar TN, Smith SV, Kennedy RT, McKenzie JM, Maric I, Barker JL. GABA(B) receptors mediate motility signals for migrating embryonic cortical cells. Cereb Cortex 2001;11:744–53 34. De Roo M, Klauser P, Briner A, Nikonenko I, Mendez P, Dayer A, Kiss JZ, Muller D, Vutskits L. Anesthetics rapidly promote December 2013 • Volume 117 • Number 6 synaptogenesis during a critical period of brain development. PLoS One 2009;4:e7043 35. Koyama R, Tao K, Sasaki T, Ichikawa J, Miyamoto D, Muramatsu R, Matsuki N, Ikegaya Y. GABAergic excitation after febrile sei- zures induces ectopic granule cells and adult epilepsy. Nat Med 2012;18:1271–8 36. Sanders RD, Sun P, Patel S, Li M, Maze M, Ma D. Dexmedetomidine provides cortical neuroprotection: impact on anaesthetic-induced neuroapoptosis in the rat developing brain. Acta Anaesthesiol Scand 2010;54:710–6 37. Danneman PJ, Mandrell TD. Evaluation of five agents/meth- ods for anesthesia of neonatal rats. Lab Anim Sci 1997;47:386–95 38. Loepke AW, McCann JC, Kurth CD, McAuliffe JJ. The physi- ologic effects of isoflurane anesthesia in neonatal mice. Anesth Analg 2006;102:75–80 39. Low JA, Galbraith RS, Muir DW, Killen HL, Pater EA, Karchmar EJ. Factors associated with motor and cognitive deficits in chil- dren after intrapartum fetal hypoxia. Am J Obstet Gynecol 1984;148:533–9 40. Hanrahan JD, Cox IJ, Edwards AD, Cowan FM, Sargentoni J, Bell JD, Bryant DJ, Rutherford MA, Azzopardi D. Persistent increases in cerebral lactate concentration after birth asphyxia. Pediatr Res 1998;44:304–11 www.anesthesia-analgesia.org 1435",rats,"['On postnatal day 7, rats were exposed to sevoflurane (1% or 2% for 2 hours) with oxygen.']",postnatal day 7,"['On postnatal day 7, rats were exposed to sevoflurane (1% or 2% for 2 hours) with oxygen.']",N,[],sevoflurane,"['On postnatal day 7, rats were exposed to sevoflurane (1% or 2% for 2 hours) with oxygen.']",none,[],wistar/st,"['Pregnant Wistar/ST rats were obtained from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).']",Our study is the first to examine the long-term electrophysiological impact of neonatal exposure to a clinically relevant concentration of sevoflurane.,['Our study is the first to examine the long-term electrophysiological impact of neonatal exposure to a clinically relevant concentration of sevoflurane.'],None,[],Our present findings indicate that neonatal exposure to sevoflurane at a higher concentration can cause alterations in the hippocampal synaptic plasticity that persists into adulthood.,['Our present findings indicate that neonatal exposure to sevoflurane at a higher concentration can cause alterations in the hippocampal synaptic plasticity that persists into adulthood.'],None,[],None,[],True,True,True,True,True,True,10.1213/ANE.0b013e3182a8c709 10.1016/j.ejphar.2011.08.050,307.0,Kong,2011,rats,gestational day 14,Y,isoflurane,none,none,"European Journal of Pharmacology 670 (2011) 168–174 Contents lists available at SciVerse ScienceDirect European Journal of Pharmacology j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / e j p h a r Behavioural Pharmacology Effects of gestational isoflurane exposure on postnatal memory and learning in rats Feijuan Kong a, 1, Linhao Xu b, 2, Daqiang He b, 2, Xiaoming Zhang b, 2, Huishun Lu a,⁎ a Department of Anesthesiology, Women's Hospital, School of Medicine, Zhejiang University, China b Institute of Anatomy and Cell Biology, School of Medicine, Zhejiang University, China a r t i c l e i n f o a b s t r a c t Article history: Received 16 July 2011 Received in revised form 15 August 2011 Accepted 27 August 2011 Available online 14 September 2011 Keywords: Isoflurane Memory and learning impairment Hippocampus C/EBP homologous protein Caspase-12 Neuron apoptosis A maternal fetal rat model was developed to study the effects of gestational isoflurane exposure on postnatal memory and learning and investigate the potential mechanisms. Pregnant rats at gestational day 14 were ex- posed to 1.3% isoflurane for 4 h. Spatial learning and memory of the offspring were examined using the Mor- ris Water Maze. The expression levels of C/EBP homologous transcription factor protein (CHOP) and caspase- 12 in the hippocampus of the pups were determined by immunohistochemistry and western blot analysis. Simultaneously, the ultrastructure changes of synapse in the hippocampal CA1 and dentate gyrus region were also observed by transmission electron microscopy (TEM). Prenatal exposure to isoflurane impaired postnatal spatial memory and learning in the offspring rats as shown by the longer escape latency and the fewer times of original platform crossing in the Morris Water Maze test. The number of CHOP and caspase- 12 positive neurons significantly increased by 138% and 147% respectively in the hippocampus of isoflur- ane-exposed pups, as well as the levels of CHOP and caspase-12 protein. Furthermore, TEM studies showed changes of synaptic ultrastructure in isoflurane-exposed hippocampus characterized by the decreased synap- se number, the widened synaptic cleft and the thinned postsynaptic densities. These results demonstrate that gestational exposure to a clinically relevant concentration of isoflurane could cause neuron apoptosis, changes of synaptic structure, and postnatal spatial memory and learning impairments in offspring. Our study further showed that the up-regulation of CHOP and caspase-12 may contribute to isoflurane-induced neuron apoptosis. © 2011 Elsevier B.V. All rights reserved. 1. Introduction Many pregnant women, fetuses, and infants are exposed to a variety of anesthetic agents for surgical or diagnostic procedures each year. Pregnant women sometimes undergo general anesthesia during their pregnancy for surgeries unrelated to the delivery, such as fetal and non-obstetric surgeries, especially during midgestation (Goodman, 2002; Tran, 2010). Since most general anesthetic agents are lipophilic and cross the placenta easily (Dwyer et al., 1995), the developing fetal brains will be exposed to anesthetics as well. Inhalation anesthetics such as isoflurane have been widely used in recent years in clinical and research practices. Preclinical studies demonstrate that early exposure to anesthetic agents causes neuroapoptosis and long-term cognitive im- pairments (Culley et al., 2004; Jevtovic-Todorovic et al., 2003; Ma et al., 2007), and recent clinical studies support the possibility (DiMaggio et al., 2008; Kalkman et al., 2009; Wilder et al., 2009). These observations ⁎ Corresponding author at: Department of Anesthesiology, Women's Hospital, School of Medicine, Zhejiang University, Hangzhou, Bachelor Road 1, 310006, PR China. Tel.: + 86 571 87061501 2410; fax: + 86 571 87061878. E-mail address: lig08010915@163.com (H. Lu). 1 Postal address: Department of Anesthesiology, Women's Hospital, School of Medi- cine, Zhejiang University, Hangzhou, Bachelor Road 1, 310006, PR China. raise concerns about the potentially deleterious effects of general anes- thesia in the human fetus, neonate, and infant. Nevertheless, the major- ity of prior neurodevelopmental studies focused on postnatal subjects rather than on the fetuses. In this study, we hypothesized that gestation- al exposure to isoflurane during maternal anesthesia may have deleteri- ous effects on the fetal brain that leads to postnatal spatial memory and learning impairments in the offspring rats. The cellular and molecular mechanisms of anesthetics-mediated neurotoxicity remain unclear. Previous studies indicate that endo- plasmic reticulum (ER) stress is associated with a range of diseases, including ischemia/reperfusion injury, neurodegeneration, and dia- betes (Oyadomari and Mori, 2004), making ER stress a probable in- stigator of pathological cell death and dysfunction. At least three pathways contribute to ER stress-mediated cell death: transcription activation of the C/EBP homologous transcription factor (CHOP) (Oyadomari and Mori, 2004), activation of the IRE1-tumor necrosis factor receptor-associated factor (TRAF2) pathway (Matsukawa et al., 2004) and activation of ER-resident caspase-12 (Nakagawa and Yuan, 2000; Nakagawa et al., 2000). CHOP, a member of the C/ EBP transcription factor family, is induced by ER stress and thus causes apoptosis. Caspase-12, an ER-specific caspase, participates in apoptosis under ER stress. In the current study, we hypothesized that CHOP and caspase-12 play a role in the mechanisms of isoflur- ane-induced neuron apoptosis. 2 Postal address: Institute of Anatomy and Cell Biology, School of Medicine, Zhejiang University, Hangzhou, Yuhangtang Road 388, 310058, PR China. 0014-2999/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2011.08.050 F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 169 In the present study, using a maternal fetal rat model, we tested the capacity for learning and memory in pups of fetal exposure to iso- flurane with the Morris Water Maze. Then we used transmission elec- tron microscopy (TEM) to investigate synaptic ultrastructure changes in the hippocampal area. We also measured the levels of CHOP and caspase-12 protein in the hippocampal area, and analyzed their rela- tionship with isoflurane-induced neuron apoptosis. 2. Materials and methods 2.1. Animals All of the animals were treated according to the guidelines of the Guide for the Care and Use of Laboratory Animals (China Ministry of Health). The Laboratory Animal Care Committee of Zhejiang Universi- ty approved all experimental procedures and protocols. All efforts were made to minimize the number of animals used and their suffer- ing. The dams were housed in polypropylene cages, and the room temperature was maintained at 22 °C, with a 12-hour light–dark cycle. The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to midgestation in humans (Clancy et al., 2001, 2007), the period when most nonobste- tric surgeries and fetal interventions are performed (Goodman, 2002; Tran, 2010). 2.2. Anesthesia exposure Ten dams were randomly divided into a control and an isoflurane group (n = 5). The dams were placed in plastic containers resting in water baths with a constant temperature of 38 °C. In these boxes, the dams were either exposed to 1.3% isoflurane (Lot 826005U, AB- BOTT, USA) in a humidified 30% oxygen carrier gas or simply humid- ified 30% oxygen without any inhalational anesthetic for 4 h. We chose 1.3% as the anesthetic concentration because it represents 1 minimum alveolar concentration (MAC) in the pregnant rats (Mazze et al., 1985). The determination of anesthetic duration based on our preliminary study which indicated that maternal physiological states remained stable throughout a 4-hour isoflurane exposure. The isoflurane concentration in the box was monitored with an agent gas monitor (Vamos, Drager Medical AG & Co. KgaA). Otherwise, control and experimental animals were under the same treatment and envi- ronment. During isoflurane anesthesia, arterial blood gases and blood glucose were measured at the end of the 4-hour anesthetic exposure. The rectal temperature was maintained at 37 ± 0.5 °C. After exposure, the dams were returned to their cages and allowed to deliver natural- ly. The postnatal body weights of the rat pups were monitored. 2.3. Memory and learning studies Four rat pups (2 females and 2 males) from each dam were select- ed to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications (Jevtovic-Todorovic et al., 2003). A round pool (diameter, 150 cm; depth, 50 cm) was filled with Fig. 1. Effects of rats exposed to isoflurane on postnatal memory and learning ability. (A) Place trial demonstrating the latency for offspring rats to reach platform measuring spatial information acquisition. (B) Probe trial demonstrating the number of original platform crossing measuring memory retention capabilities. *P b 0.05 compared with control. warm (24 °C) opaque water to a height of 1.5 cm above the top of the movable clear 15-cm-diameter platform in the third quadrant. A video tracking system recorded the swimming motions of animals, and the data were analyzed using motion-detection software for the Morris Water Maze (Actimetrics Software, Evanston, IL, USA). After every trial, each rat was wiped before returning to its regular cage, keeping warm and free diet. 2.3.1. Place trials The place trials were performed at postnatal day 29 for 4 days to determine the rats' ability to obtain spatial information. At postnatal day 28, the rats were made to know the existence of the platform through a 30-second swimming training. A dark black curtain sur- rounded the pool to prevent confounding visual cues. All rats received 4 trials per day in each of the four quadrants of the swimming pool. On each trial, rats were placed in a fixed position into the swimming pool facing the wall. They were allotted 120 s to find the platform upon which they sat for 20 s before being removed from the pool. If a rat did not find the platform within 120 s, the rat was gently guided to the platform and allowed to remain there for 20 s. For all training trials, swim speed and the time to reach the platform (escape latency) were recorded. The less time it took a rat to reach the platform, the Table 1 Maternal physiological parameters during isoflurane anesthesia. 0 h 4 h Control 1.3% isoflurane Control 1.3% isoflurane pH PaCO2 (mm Hg) PaO2 (mm Hg) SaO2 (%) Glucose (mg/dl) 7.43 ± 0.02 35.8 ± 2.47 169.5 ± 4.32 95.4 ± 1.1 113 ± 21 7.43 ± 0.01 36.7 ± 1.34 168.2 ± 6.19 94.2 ± 1.2 115 ± 16 7.41 ± 0.02 36.6 ± 2.39 166.2 ± 6.41 95.1 ± 0.9 116 ± 22 7.39 ± 0.01 37.9 ± 3.25 165.3 ± 5.32 94.6 ± 1.1 115 ± 12 1.3% isoflurane did not affect arterial blood gas values and blood glucose levels significantly. PaCO2 = arterial carbon dioxide tension; PaO2 = arterial oxygen tension; SaO2 = arterial oxygen saturation. 170 F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 better the learning ability. We took the average of four trials as the es- cape latency each day. 2.3.2. Probe trials Probe trials were conducted immediately after the four-day period to evaluate memory retention capabilities. The probe trials involved removing the submerged platform from the pool and allowing the rats to swim for 120 s in any of the four quadrants of the swimming pool. Time spent in the third quadrant and the number of original platform crossing in the third quadrant was recorded. immediately. Immersion fixation was completed on tissues about 1 mm3 from the hippocampus. Samples were rinsed in cold phosphate-buffered saline (PBS) and placed in 2.5% glutaraldehyde at 4 °C for 4 h. The tissue was rinsed in buffer and post-fixed with 1% osmium tetroxide for 1 h. Then, the tissue was rinsed with distilled water before undergoing a grad- ed ethanol dehydration series and was infiltrated using a mixture of half propylene oxide and half resin overnight. Twenty-four hours later, the tis- sue was embedded in resin. 120 nm sections were cut and stained with 4% uranyl acetate for 20 min and 0.5% lead citrate for 5 min. Ultrastruc- ture changes of synapse in the hippocampus were observed under a transmission electron microscope (Phliphs Tecnai 10, Holland). 2.4. Transmission electron microscopy 2.5. Tissue section preparation After the Morris Water Maze test, three pups per group were anesthe- tized with a lethal dose of Nembutal. The thoracic cavities were opened and perfused intracardially with 100 mL of normal saline. Then the hippo- campus, including CA1 and dentate gyrus area, of each rat was taken out After the Morris Water Maze test, two pups from each dam were anesthetized by intraperitoneal injection of a lethal dose of Nembutal. The aorta was cannulated and the animal was firstly perfused with Fig. 2. The expression of CHOP and caspase-12 increased significantly in the hippocampus of isoflurane-exposed pups showed by immuno-reaction. (Aa) CHOP immunohistochem- ical staining in control pups × 400. (Ab) CHOP immunohistochemical staining in isoflurane-exposed pups × 400. (Ac) Caspase-12 immunohistochemical staining in control pups × 400. (Ad) Caspase-12 immunohistochemical staining in isoflurane-exposed pups × 400. The number and optical density of the CHOP (B) and caspase-12 (C) positive neurons were compared between the control and 1.3% isoflurane treatment groups. **P b 0.01 compared to control. Scale bar = 50 μm. F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 200 mL of normal saline, then with 250 mL of 4% formaldehyde (freshly made from paraformaldehyde) for 20–30 min. The fixed brain was then removed from the cranial cavity and post-fixed over- night in the same fixative at 4 °C. The tissues were embedded in par- affin, and transverse paraffin sections containing the hippocampal area (5 mm thick) were mounted on silanecoated slides. Sections were deparaffinaged and rehydrated. Then the sections were treated for antigen retrieval with 10.2 mmol/L sodium citrate buffer, pH 6.1, for 20 min at 95 °C for immunohistochemistry. 2.6. Immunohistochemistry analysis The sections mentioned above were washed in 0.01 M PBS con- taining 0.3% Triton X-100 (pH 7.4, PBS-T), followed by blocking in 5% normal goat serum in 0.01 M PBS. The sections were then incubat- ed in the primary antibodies rabbit polyclonal against anti-CHOP or caspase-12 (1:100, Santa Cruz Biotechnology, USA) overnight at 4 °C. After a thorough wash in PBS, sections were incubated with bio- tinylated goat anti-rabbit IgG antibody (1:200, Boster, China) for 2 h at room temperature, followed by avidin–biotin–peroxidase complex solution (ABC, 1:100, Boster) for 2 h at room temperature. Immunola- beling was visualized with 0.05% diaminobenzdine (DAB) plus 0.3% H2O2 in PBS and the reaction was stopped by rinsing the slides with 0.2 M Tris–HCl. Sections were mounted onto 0.02% poly-L-lysine- coated slides and allowed to dry at room temperature. Then the sec- tions were dehydrated through a graded series of alcohols, cleared in xylene and finally coverslipped. Rat Immunoglobulin IgG (1:200, Biomeda Corporation, USA) was used instead of primary antibody as a negative control. Three sections from each animal were selected at random and images were photographed under 400× magnification in 3 visual fields/per section, the CHOP and caspase-12 positive neu- rons were counted in the same area. The optical densities of CHOP and caspase-12 positive neurons were measured quantitatively using NIH image software (ImageJ, National Institutes of Health, Be- thesda, MD). and graphs were performed or generated, respectively, using Graph- Pad Prism Version 4.0 (GraphPad Prism Software, Inc. CA, USA). 3. Results 3.1. Physiologic parameters As shown in Table 1, ABG values and blood glucose levels were within the normal physiologic range. There were no significant differ- ences in ABG values and blood glucose levels before and after expo- sure in both the control group and the 1.3% isoflurane treatment group. All pups were viable and there were no significant differences in growth rate of the rat pups between the two groups (data not shown). 3.2. Morris Water Maze test As shown in Fig. 1A, pups in both groups showed a rapid decrease in latency, while the pups of the isoflurane group spent more time to find the platform than those of control group in the place trial (P b 0.05). Swimming speeds were also analyzed during place trials, and no differences were observed between the two groups (data not shown). In the probe test, the number of crossing over the former platform location in isoflurane-treated pups was fewer than the cor- responding control animals (Fig. 1B, P b 0.05), but the time spent in the third quadrant where the platform located has no difference (data not shown). 2.7. Western blot analysis After Morris Water Maze test, two pups from each pregnant moth- er were anesthetized with a lethal dose of Nembutal. Then their tho- racic cavities were opened and perfused intracardially with 100 mL of normal saline. Hippocampus, including CA1 and dentate gyrus field, of each rat was taken out immediately to obtain fresh tissue speci- mens. Protein concentration was determined by the BCA method using bovine serum albumin as the standard. Protein samples (50 μg) were separated by 12% sodium dodecyl sulfate polyacryl- amide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellu- lose membrane. The membranes were blocked by nonfat dry milk buffer for 2 h and then incubated overnight at 4 °C with primary an- tibody against CHOP or caspase-12 (1:500, Santa Cruz Biotechnology, USA). The membranes were subsequently incubated with horseradish peroxidase-conjugated secondary antibodies and developed with ECL kit. The optical densities of bands were quantitatively analyzed using Bio-Rad Quantity One 4.6.2 (Bio-Rad Laboratories, USA). The results were expressed as a relative density. Equal protein loading in each lane was confirmed by hybridization with a 1:2000 dilution of β- actin antibody (Santa Cruz Biotechnology, USA). 2.8. Statistical analysis All data were presented as mean ± S.E.M. Results of weight of postnatal rat pups and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Other data were an- alyzed using Student's t-test for comparison of two groups. A P value of b0.05 was considered statistically significant. All statistical tests Fig. 3. The levels of CHOP and caspase-12 protein remarkably increased in the hippo- campus of isoflurane-exposed pups. (A) Representative changes of CHOP and cas- pase-12 by western blot analysis. (B, C) The quantified CHOP (B) and caspase-12 (C) bands were normalized to the loading control β-actin. **P b 0.01, ***P b 0.001 com- pared to control. 171 172 F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 3.3. Immunoreactivity assay In the isoflurane-exposed pups, the expression of CHOP in the hip- pocampal CA1 and dentate gyrus area increased compared with the control (Fig. 2A a and b). The caspase-12 expression displayed the same tendency of increase in the hippocampal area in the isoflur- ane-treated pups (Fig. 2Ac and d). Quantitative analysis of the num- ber and optical densities of CHOP and caspase-12 positive neurons for the whole hippocampal CA1 and dentate gyrus area showed that their immunoreactivity was increased compared with the control (Fig. 2B and C, P b 0.01). 3.4. CHOP and caspase-12 protein levels Consistent with the findings of immunohistochemistry studies, western blot analysis showed that the levels of CHOP and caspase- 12 protein markedly increased in the hippocampal region of isoflur- ane-exposed pups when compared with the control (Fig. 3, P b 0.01). 3.5. Ultrastructure changes in synapse of hippocampus Synapses with postsynaptic densities, an inerratic synaptic cleft and a presynaptic vas were clearly visible in the control pups (Fig. 4A and C). In contrast, in the isoflurane-treated pups, the num- ber of synapses decreased in the dentate gyrus and CA1 area, while a widened synaptic cleft, thinned postsynaptic densities and loss of a presynaptic vas were observed (Fig. 4). 4. Discussion demonstrate that gestational exposure to a clinically relevant concen- tration of isoflurane causes postnatal spatial memory and learning impairments in the offspring rats. Moreover, neuron apoptosis and changes of synaptic structure were also observed at the hippocampal level in pups subject to isoflurane. Our present work confirmed that the levels of CHOP and caspase- 12 increased at hippocampal level in isoflurane-exposed rats, as indi- cated by the significant increase in the amount and densities of CHOP and caspase-12-positive cells, as well as the levels of CHOP and cas- pase-12 protein. Neuronal cell death after general anesthesia has re- cently been documented in several immature animal models. Some studies proposed that inhalational anesthetics, such as isoflurane, in- duced cell death processes through activation of γ-aminobutyric acid and inhibition of N-methyl-D-aspartate receptors (Ikonomidou et al., 1999; Olney et al., 2004). However, the mechanisms of the effect are not clear or fully understood. Recent advances indicate that ER re- sponses play a pivotal role in cellular apoptosis after exposure to var- ious stresses, such as hypoxia, calcium dysregulation and oxidative stress (Larner et al., 2005; Schroder and Kaufman, 2005). C/EBP ho- mologous protein (CHOP), also known as GADD153 (growth arrest- and DNA damage-inducible gene 153), is a member of the C/EBP fam- ily of bZIP transcription factors, and its low expression under normal conditions is induced to high levels by ER stress. The role of CHOP in ER stress-induced apoptosis has been illustrated in Chop−/− mice (Oyadomari et al., 2001; Zinszner et al., 1998). Caspase-12 has been proposed as a key mediator of ER stress-induced apoptosis (Szegezdi et al., 2003). CHOP activation occurs concomitantly with the activa- tion of caspase-12, and activated caspase-12 in turn produces activa- tion of the caspase cascade (Rao et al., 2002). Caspase-12 activation is mediated mainly by calpain, which is released from the ER membrane by tumor necrosis factor receptor-associated factor. Subsequently, caspase-12 interacts with caspase-9, which forms part of the ‘intrinsic’ apoptotic pathway, leading to activation of the executer caspase-3. In the present study, we employed a new model, a maternal fetal rat model, to study the behavioral and neurotoxic effects of exposure to anesthetics and investigate the potential mechanisms. Our results Fig. 4. Ultrastructural changes of synapse in the CA1 and dentate gyrus area of hippocampus under TEM. (A, C) control pups, (B, D) isoflurane-exposed pups. F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 Therefore, CHOP and caspase-12-mediated ER stress-induced cell death appear to be the major mediators of anesthesia-mediated apoptotic cellu- lar death. Learning and memory are important aspects of cognitive func- tion. Our results showed that prenatal exposure to isoflurane dis- played deficits and memory capabilities in pups as manifested by the longer escape latency and the fewer times of original platform crossing in the Morris Water Maze test. The lack of differences in swimming speeds be- tween the two groups suggested that the learning and memory def- icits observed in our study were not due to sensorimotor disturbances. Consistent with previous studies in maternal fetal rat models, these findings indicate that rats exposed to anesthetics in utero during fetal neurodevelopment is capable of causing be- havioral abnormalities in adolescent animals (Chalon et al., 1981; Palanisamy et al., 2011). However, the effects of anesthesia used during the development of fetal brains on postnatal memory and learning ability are controversial, with transient improvement (Li et al., 2007), no effects (McClaine et al., 2005) and permanent im- pairment (Chalon et al., 1981; Palanisamy et al., 2011) all being reported. These discrepancies could be due to methodological dif- ferences, species differences (rats vs. mice), pharmacological differ- ences in anesthetic concentrations (0.5–2 MAC), or differences in anesthetic durations (1–6 h). Last but not the least is the time of isoflurane exposure. Since different neurodevelopmental events are performed in their timing relative to gestational age, it is expected that the vulnerabil- ity of the brain to the adverse effects of the anesthetic agents would be different depending on the time of exposure. Correspond- ingly, behavioral outcome varies as a function of the neurodevelop- mental events occurring at the time of exposure. The time of isoflurane exposure in the current study corresponds approximately to midgestation in human, and studies in several animal species suggest that susceptibility is limited to a brain developmental state corresponding to the human second trimester of pregnancy. in postnatal spatial learning (isoflurane vs. sevoflurane), differences Acknowledgments We thank Shu Han, M.D., Ph.D. (Associate Professor, Institute of Anatomy and Cell Biology, School of Medicine, Zhejiang University, China) for the technical support and thought-provoking discus- sions. Our work was supported by the Medical and Health Re- search Fund of Health Department of Zhejiang Provincial, China (no. 2010KYA129). References Chalon, J., Tang, C.K., Ramanathan, S., Eisner, M., Katz, R., Turndorf, H., 1981. Exposure to halothane and enflurane affects learning function of murine progeny. Anesth. Analg. 60, 794–797. Clancy, B., Darlington, R.B., Finlay, B.L., 2001. Translating developmental time across mammalian species. Neuroscience 105, 7–17. Clancy, B., Kersh, B., Hyde, J., Darlington, R.B., Anand, K.J., Finlay, B.L., 2007. Web-based method for translating neurodevelopment from laboratory species to humans. Neuroinformatics 5, 79–94. Culley, D.J., Baxter, M.G., Yukhananov, R., Crosby, G., 2004. Long-term impairment of acquisition of a spatial memory task following isoflurane-nitrous oxide anesthesia in rats. Anesthesiology 100, 309–314. DiMaggio, C.J., Sun, L., Kakavouli, A., Li, G., 2008. Exposure to anesthesia and the risk of developmental and behavioral disorders in young children. Anesthesiology 109, A1415. Dwyer, R., Fee, J.P., Moore, J.M., 1995. Uptake of halothane and isoflurane by mother and baby during caesarean section. Br. J. Anaesth. 74, 379–383. Goodman, S., 2002. Anesthesia for nonobstetric surgery in the pregnant patient. Semin. Perinatol. 26, 136–145. Gruart, A., Munoz, M.D., Delgado-Garcia, J.M., 2006. Involvement of the CA3–CA1 syn- apse in the acquisition of associative learning in behaving mice. J. Neurosci. 26, 1077–1087. Ikonomidou, C., Bosch, F., Miksa, M., Bittigau, P., Vockler, J., Dikranian, K., Tenkova, T.I., Stefovska, V., Turski, L., Olney, J.W., 1999. Blockade of NMDA receptors and apopto- tic neurodegeneration in the developing brain. Science 283, 70–74. Jevtovic-Todorovic, V., Hartman, R.E., Izumi, Y., Benshoff, N.D., Dikranian, K., Zorumski, C.F., Olney, J.W., Wozniak, D.F., 2003. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J. Neurosci. 23, 876–882. In the present study, our results demonstrated that the number of synapses decreased significantly in the dentate gyrus and CA1 area with widened synaptic clefts, thinned postsynaptic densities and a loss of the presynaptic vas in the isoflurane-exposed rats. It is widely recognized that there is a relationship between hippocampal synaptic plasticity and memory (Gruart et al., 2006; Sametsky et al., 2010; Thompson et al., 2008). The synaptic cleft is a region of information transmission among neurons and plays an important role in the dy- namics of synaptic activity. The thickness of postsynaptic densities and the ability of learning and memory training and memory reten- tion go hand in hand. These changes impaired synapse normal struc- ture and resulted in interruption of synaptic connections. Our results suggest that the interruption of synaptic connections may be a mech- anism which further leads to changes of synaptic plasticity and conse- quent memory and learning impairments. Kalkman, C.J., Peelen, L., Moons, K.G., Veenhuizen, M., Bruens, M., Sinnema, G., de Jong, T.P., 2009. Behavior and development in children and age at the time of first anes- thetic exposure. Anesthesiology 110, 805–812. Larner, S.F., Hayes, R.L., Wang, K.K., 2005. Unfolded protein response after neuro- trauma. J. Neurotrauma 23, 807–829. Li, Y., Liang, G., Wang, S., Meng, Q., Wang, Q., Wei, H., 2007. Effects of fetal exposure to isoflurane on postnatal memory and learning in rats. Neuropharmacology 53, 942–950. Ma, D., Williamson, P., Januszewski, A., Nogaro, M.C., Hossain, M., Ong, L.P., Shu, Y., Franks, N.P., Maze, M., 2007. Xenon mitigates isoflurane-induced neuronal apoptosis in the developing rodent brain. Anesthesiology 106, 746–753. Matsukawa, J., Matsuzawa, A., Takeda, K., Ichijo, H., 2004. The ASK1-MAP kinase cas- cades in mammalian stress response. J. Biochem. 136, 261–265. Mazze, R.I., Rice, S.A., Baden, J.M., 1985. Halothane, isoflurane, and enflurane MAC in pregnant and nonpregnant female and male mice and rats. Anesthesiology 62, 339–341. McClaine, R.J., Uemura, K., de la Fuente, S.G., Manson, R.J., Booth, J.V., White, W.D., Campbell, K.A., McClaine, D.J., Benni, P.B., Eubanks, W.S., Reynolds, J.D., 2005. General anesthesia improves fetal cerebral oxygenation without evidence of subse- quent neuronal injury. J. Cereb. Blood Flow Metab. 25, 1060–1069. Nakagawa, T., Yuan, J., 2000. Cross-talk between two cysteine protease families: activa- tion of caspase-12 by calpain in apoptosis. J. Cell Biol. 150, 887–894. In summary, the current findings demonstrate that prenatal expo- sure to anesthetic drugs during a critical period of neural develop- ment causes neuron apoptosis, changes of synaptic structure, and postnatal spatial memory and learning impairments in the offspring rats. We speculate that the up-regulation of CHOP and caspase-12 may contribute to neural cell apoptosis, leading to damage in synapse number and function and consequent impairments in synaptic plas- ticity, all of which would contribute to the long-term neurocognitive decline. With the gradual rise in the occurrence of fetal and non-ob- stetric surgery during pregnancy under general anesthesia, it is im- perative that further animal studies into the mechanism as well as clinical studies defining human susceptibility are both urgently need- ed. A better understanding of the inhalational anesthetics mecha- nisms will help us to guide clinical trials aiming to define the scope of the problem in humans and may lead to preventive and therapeu- tic strategies. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B.A., Yuan, J., 2000. Caspase- 12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amy- loidbeta. Nature 403, 98–103. Olney, J.W., Young, C., Wozniak, D.F., Jevtovic-Todorovic, V., Ikonomidou, C., 2004. Do pediatric drugs cause developing neurons to commit suicide? Trends Pharmacol. Sci. 25, 135–139. Oyadomari, S., Mori, M., 2004. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 11, 381–389. Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I., Akira, S., Araki, E., Mori, M., 2001. Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc. Natl. Acad. Sci. U. S. A. 98, 10845–10850. Palanisamy, A., Baxter, M.G., Keel, P.K., Xie, Z., Crosby, G., Culley, D.J., 2011. Rats ex- posed to isoflurane in utero during early gestation are behaviorally abnormal as adults. Anesthesiology 114, 521–528. Rao, R.V., Castro-Obregon, S., Frankowski, H., Schuler, M., Stoka, V., del Rio, G., Bredesen, D.E., Ellerby, H.M., 2002. Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1-independent intrinsic pathway. J. Biol. Chem. 277, 21836–21842. Sametsky, E.A., Disterhoft, J.F., Geinisman, Y., Nicholson, D.A., 2010. Synaptic strength and postsynaptically silent synapses through advanced aging in rat hippocampal CA1 pyramidal neurons. Neurobiol. Aging 31, 813–825. 173 174 F. Kong et al. / European Journal of Pharmacology 670 (2011) 168–174 Schroder, M., Kaufman, R.J., 2005. The mammalian unfolded protein response. Annu. Rev. Biochem. 74, 739–789. Szegezdi, E., Fitzgerald, U., Samali, A., 2003. Caspase-12 and ER-stress-mediated apoptosis: the story so far. Ann. N. Y. Acad. Sci. 1010, 186–194. Wilder, R.T., Flick, R.P., Sprung, J., Katusic, S.K., Barbaresi, W.J., Mickelson, C., Gleich, S.J., Schroeder, D.R., Weaver, A.L., Warner, D.O., 2009. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 110, 796–804. Thompson, J.V., Sullivan, R.M., Wilson, D.A., 2008. Developmental emergence of fear learning corresponds with changes in amygdala synaptic plasticity. Brain Res. 1200, 58–65. Zinszner, H., Kuroda, M., Wang, X., Batchvarova, N., Lightfoot, R.T., Remotti, H., Stevens, J.L., Ron, D., 1998. CHOP is implicated in programmed cell death in response to im- paired function of the endoplasmic reticulum. Genes Dev. 12, 982–995. Tran, K.M., 2010. Anesthesia for fetal surgery. Semin. Fetal Neonatal Med. 15, 40–45.",rats,['A maternal fetal rat model was developed to study the effects of gestational isoflurane exposure on postnatal memory and learning and investigate the potential mechanisms.'],gestational day 14,['Pregnant rats at gestational day 14 were ex- posed to 1.3% isoflurane for 4 h.'],Y,['Spatial learning and memory of the offspring were examined using the Mor- ris Water Maze.'],isoflurane,['Pregnant rats at gestational day 14 were ex- posed to 1.3% isoflurane for 4 h.'],none,[],none,[],"The study addresses the potential deleterious effects of general anesthesia on the human fetus, neonate, and infant, which have not been fully explored in prior neurodevelopmental studies.","['These observations raise concerns about the potentially deleterious effects of general anes- thesia in the human fetus, neonate, and infant. Nevertheless, the major- ity of prior neurodevelopmental studies focused on postnatal subjects rather than on the fetuses.']",The study presents a maternal fetal rat model to investigate the effects of gestational isoflurane exposure on postnatal memory and learning.,['A maternal fetal rat model was developed to study the effects of gestational isoflurane exposure on postnatal memory and learning and investigate the potential mechanisms.'],"The article argues that gestational exposure to isoflurane could cause neuron apoptosis, changes of synaptic structure, and postnatal spatial memory and learning impairments in offspring, highlighting the need for further studies and clinical trials.","['These results demonstrate that gestational exposure to a clinically relevant concentration of isoflurane could cause neuron apoptosis, changes of synaptic structure, and postnatal spatial memory and learning impairments in offspring.']",None,[],"The findings suggest the need for further animal and clinical studies to define human susceptibility to anesthetic agents during fetal development, potentially leading to preventive and therapeutic strategies.","['With the gradual rise in the occurrence of fetal and non-ob- stetric surgery during pregnancy under general anesthesia, it is im- perative that further animal studies into the mechanism as well as clinical studies defining human susceptibility are both urgently need- ed.']",True,True,True,True,True,True,10.1016/j.ejphar.2011.08.050 10.1371/journal.pone.0105340,269.0,Lee,2014,rats,postnatal day 7,Y,isoflurane,desflurane,sprague dawley,"Early Exposure to Volatile Anesthetics Impairs Long-Term Associative Learning and Recognition Memory Bradley H. Lee1, John Thomas Chan1, Obhi Hazarika1, Laszlo Vutskits2, Jeffrey W. Sall1* 1 Department of Anesthesia and Perioperative Care, University of California San Francisco, San Francisco, California, Unites States of America, 2 Department of Anesthesiology, Pharmacology and Intensive Care, University Hospital of Geneva, Geneva, Switzerland Abstract Background: Anesthetic exposure early in life affects neural development and long-term cognitive function, but our understanding of the types of memory that are altered is incomplete. Specific cognitive tests in rodents that isolate different memory processes provide a useful approach for gaining insight into this issue. Methods:Postnatal day 7 (P7) rats were exposed to either desflurane or isoflurane at 1 Minimum Alveolar Concentration for 4 h. Acute neuronal death was assessed 12 h later in the thalamus, CA1-3 regions of hippocampus, and dentate gyrus. In separate behavioral experiments, beginning at P48, subjects were evaluated in a series of object recognition tests relying on associative learning, as well as social recognition. Results: Exposure to either anesthetic led to a significant increase in neuroapoptosis in each brain region. The extent of neuronal death did not differ between groups. Subjects were unaffected in simple tasks of novel object and object-location recognition. However, anesthetized animals from both groups were impaired in allocentric object-location memory and a more complex task requiring subjects to associate an object with its location and contextual setting. Isoflurane exposure led to additional impairment in object-context association and social memory. Conclusion:Isoflurane and desflurane exposure during development result in deficits in tasks relying on associative learning and recognition memory. Isoflurane may potentially cause worse impairment than desflurane. Citation: Lee BH, Chan JT, Hazarika O, Vutskits L, Sall JW (2014) Early Exposure to Volatile Anesthetics Impairs Long-Term Associative Learning and Recognition Memory. PLoS ONE 9(8): e105340. doi:10.1371/journal.pone.0105340 Editor: Yael Abreu-Villac¸a, Universidade do Estado do Rio de Janeiro, Brazil Received April 30, 2014; Accepted July 18, 2014; Published August 28, 2014 Copyright: (cid:1) 2014 Lee et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All data are within the paper and supporting files. Funding: Funding for the study was provided through National Institutes of Health Grant GM086511 to JWS, the University of California San Francisco Department of Anesthesia and Perioperative Care Hamilton Award to JWS, and by Swiss National Science Foundation Grant 31003A_130625 to LV. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. Email: sallj@anesthesia.ucsf.edu Introduction Every day, anesthetics are used around the world in newborns and infants who undergo medical procedures. There is growing concern that anesthetics can significantly alter the developing brain, and animal models have shown that exposure to anesthetics at an early age lead to neuronal death and long-term cognitive dysfunction [1–3]. Epidemiologic studies suggest that humans are also susceptible to long-term cognitive effects after anesthesia [4,5]. Our knowledge of cognitive effects in humans has been, until recently [6], limited to retrospective studies that typically assess global tests of learning and behavior [4,5,7,8]. For instance, most of identify cognitive or learning disabilities by evaluating databases for individuals with diagnostic codes for unspecified delays, behavioral disorders, language or speech problems [7,8], or through IQ and achievement tests [4,5]. Because these studies examine generalized learning problems, they contribute minimally to our understanding of the memory processes that underlie the cognitive impairment. these epidemiologic studies An important challenge in the study of anesthetic neurotoxicity is developing a model by which cognitive effects in animals can be translated to humans. Memory processing is highly conserved across rodent and human species [9]. In particular, hippocampal memory functions are very similar between rats and humans [9], and the hippocampus is crucial in spatial encoding, associative learning, and recognition memory in both rats and humans [9– 12]. Rodent models therefore provide valuable insight into the types of memory that may be affected in humans. However, behavioral studies are prone to using overlapping models for evaluating learning and memory. Many studies use similar tests, such as the Morris water maze [2,13–15], because they have consistently identified a cognitive deficit. Identifying impairment in specific memory processes, such as recognition and associative memory, in animal models will provide insight into effects in humans and may help guide future assessments of learning and memory in children, as has recently been reported [6]. Recognition memory, which is a subtype of declarative in humans for recalling different events, memory, is crucial PLOS ONE | www.plosone.org 1 August 2014 | Volume 9 | Issue 8 | e105340 objects, and people [16,17]. It has been shown that animals also have episodic-like memory that can be demonstrated through tests involving memory for ‘‘what,’’ ‘‘where,’’ and ‘‘when’’ details of an event. This was first described in birds [18] and more recently in rodents [12,19–22], and models have since been developed to examine recognition memory in various ways [20,23–25]. recognition memory Furthermore, many studies processes rely on the hippocampus and thalamus [19,26], which are areas of neuronal degeneration following anesthesia [2,14]. find that The present study was designed to evaluate the effects of two commonly used volatile anesthetics – isoflurane and desflurane – on specific learning and memory processes following neonatal exposure. After delivering 1 Minimum Alveolar Concentration [27] of either anesthetic for 4 hours at postnatal day 7 (P7), subjects were evaluated in a set of recognition tasks involving associative memory, as well as social memory, that have been shown to be sensitive to lesions in hippocampal and thalamic circuits [19,28,29]. Methods Subjects from the Institutional Animal Care and Use Committee at the University of California, San Francisco. Five Sprague-Dawley dams with litters of postnatal day 6 (P6) pups from were obtained from Charles River Laboratories (Gilroy, CA). Each litter contained only males and was culled to ten pups. In total, the males were taken from at least ten different litters. On P7, animals from each litter were randomly assigned to control and treatment groups. They were weaned at P23 and housed three per cage under standard lab housing with 12 h light/dark cycle. Animals were food restricted (access to food only during light cycle) for tasks involving object recognition to increase activity and object exploration. All experiments were conducted with approval Anesthesia Anesthesia was delivered as described previously [14,30,31]. Briefly, animals in the treatment groups received either isoflurane or desflurane as a single agent in air and oxygen (FiO250%) at 1 Minimum Alveolar Concentration [27] for four hours. MAC was determined by tail clamping every 15 minutes, and anesthetic concentration was adjusted accordingly, so that on average 50% of animals would move in response to clamping (Fig. 1). 12 out of 18 animals anesthetized with isoflurane survived to undergo behav- ioral testing, and 13 out of 18 animals anesthetized with desflurane survived and underwent behavioral testing. Control animals were concurrently placed in an anesthesia glove box of the same material and conditions without being exposed to anesthesia or tail clamping. Animals were kept on a warming blanket, and temperatures were measured using an infrared laser thermometer and maintained with a goal of 35uC. Histology Brains from the two anesthetized groups and the control group (n = 10 per group) were assessed for acute neuronal death. Twelve hours after anesthesia, animals were transcardially perfused with cold 4% paraformaldehyde in phosphate-buffered saline and brains were removed, postfixed, and sunk in sucrose solution. They were then sliced into 60 micron-thick slices and every other slice was mounted and stained with FluoroJade C, a marker specific for neurodegeneration [32,33] (FJC, 0.001%, Millipore, Billerica, MA). FJ-positive cells were counted using Nikon Eclipse 80i microscope under 20X magnification in each slice containing PLOS ONE | www.plosone.org 2 Anesthetic Effects on Memory Figure 1. MAC of isoflurane and desflurane. Anesthetics were separately delivered to P7 rats in air and oxygen (FiO2 50%) as previously described6, 9. Tail-clamping occurred every 15 minutes, and anesthetic concentration was adjusted to 1 MAC. As before6, 9, MAC decreases with increasing duration of anesthesia for both agents. doi:10.1371/journal.pone.0105340.g001 the structure of interest. Structures included in analysis were the anterodorsal (LD), and anteromedial (AM) thalamic nuclei, as well as CA1-3 regions of the hippocampus and the dentate gyrus. (AD), anteroventral (AV), laterodorsal Object Recognition Tasks Object recognition was assessed using similar arrangements as others [19,28]. Behavior testing occurred during the light phase of the circadian cycle between 0800 and 1700 hrs in two separate arenas, hereafter referred to as contexts, of identical size (61 cm square base, walls 50 cm high). Context 1 had yellow walls with a base covered in wood-effect vinyl lining, and context 2 had black walls with a black plastic base. Different visual cues were placed on the walls of each context. A video camera (SONY HDR-CX190) was mounted 2 meters above the testing area for recording and observing subjects. For each task, except the allocentric object- location task, subjects were placed into contexts in the same (away from the objects). location and facing the south wall Beginning at P42, subjects were habituated to the two contexts prior to testing by being placed individually into the context for 5 min per day for 4 consecutive days. All animals underwent all behavioral tasks. Subjects were tested on the same day for any given task and in the same sequence of tasks. All tasks were performed in the order presented in subsequent weeks, except for the first two (novel object and object-place) which were performed in the same week. The order of testing during the day was counterbalanced among groups. Investigation of an object was defined as sniffing or placing the nose within 1 cm of and oriented toward the object. Subjects were recorded, and observers blinded to group assignment were used to determine investigation times. Object investigation times during the initial exposure for each task were compared to assess for possible confounding effects of varying investigation times on the ability to recognize objects. All objects and testing arenas were wiped with 70% ethanol between testing. Novel Object Recognition. Testing began at P48 with novel object recognition. A single trial was performed for each animal consisting of ‘‘exposure’’ and ‘‘test’’ phases separated by a two- minute delay (Fig. 2A). During the exposure, subjects were placed into the context and allowed to explore two identical objects for four minutes. After the delay, they were placed into the same context for three minutes with one of the objects replaced with a August 2014 | Volume 9 | Issue 8 | e105340 Anesthetic Effects on Memory Figure 2. Object recognition. For each task, except allocentric object-place recognition, subjects are introduced at and facing the wall away from the objects. (A) Novel object recognition. Two identical objects are presented in the exposure, and one (right) is replaced with a novel object in the test phase. (B) Object-place recognition. Two different objects are presented, followed by two identical objects. In the test phase, the right object appears in a novel location within the context. (C) In the allocentric version of object-place recognition, subjects are again introduced at and facing the south wall (S) in the exposure. However, for the test phase, subjects are placed at and facing either the east (E) or west (W) wall. (D) Object-context recognition. Two different pairs of objects are presented in two different contexts, so each object is associated with a particular context. In the test phase, one object (right object, top row; left object, bottom row) appears within a context in which it has not been explored. (E) Object-place-context recognition. Two different objects are first presented in a context. The object locations are then reversed and presented in a different context. Thus, after two exposures, each object is seen in both contexts and both locations (left and right). In the test phase, two objects are presented in either context, so one (right object, top row; left object, bottom row) appears in a novel configuration of place and context. doi:10.1371/journal.pone.0105340.g002 novel object. Half of the subjects were tested in each context with the location (left or right) of the novel object counterbalanced among subjects. Object-Place Recognition. Subjects were tested in their ability to recognize an object and its location. Two trials were performed, and investigation times were totaled for the two trials. In the exposure, two different objects were presented in a context for four minutes. After a two-minute delay, two identical copies of one of the previous objects were presented in the same context for three minutes (Fig. 2B). Both objects were equally familiar, but one now occupied a different location within the context. two different objects were (Fig. 2E). presented within a context. Next, subjects were placed in the opposite context with the same two objects and their locations reversed. Thus, after two exposures, each object was observed in both contexts and locations (left and right). In the test phase, two identical copies of either of the previous objects were presented in a context. The location and context associated with one object were familiar, while the other ‘‘displaced’’ object appeared in a location and context in which it had not been observed. Two trials were conducted with the test phase occurring in opposite contexts for each trial (Fig. 2E). In the first exposure, Allocentric Object-Place Recognition. For the previous task, subjects were always introduced into the context facing the wall (south wall) opposite the two objects (Fig. 2C). In the allocentric version of the task, for the initial exposure, subjects were again placed into the context facing the south wall. In the test phase, however, the entry point was varied and half of the subjects were introduced facing either the east or west wall (Fig. 2C). Two trials were performed and the entry point was randomized among subjects. Object-Context Recognition. Subjects were assessed in their ability to recognize an object with a particular context. The task required two separate exposures, each lasting four minutes and separated by a two-minute delay (Fig. 2D). In the first exposure, a pair of identical objects was presented in a context. Next, subjects were placed in a different context with a different pair of objects. In the test phase, lasting three minutes, subjects were placed into a context with one of each previously encountered object. Thus, one object was presented in the same context as before, while the other object appeared within a context in which it had not been explored. Two trials were conducted, and the test phase occurred in opposite contexts for each trial (Fig. 2D). Social Behavior and Social Recognition Following object recognition, animals were given unrestricted access to food. Social interaction and recognition were assessed using a discrimination paradigm one week after completing object recognition testing at P80. In the exposure, the subject was presented with a caged stimulus animal and a novel object for five minutes. This arrangement evaluates social behavior by deter- spend more time investigating the mining whether subjects stimulus animal or object7. After a sixty-minute delay, subjects were presented simultaneously with the same ‘‘familiar’’ animal and a novel animal the previously encountered animal was demonstrated by decreased investigation of the familiar target relative to the novel one. for three minutes. Recognition of Same-sex juvenile conspecifics were used as stimulus animals. Male pups five weeks of age were housed individually one week prior to testing. Investigation of the stimulus animal was defined as sniffing or direct contact with the subject’s nose or paws. Investigation of the novel object was defined as sniffing or placing the nose within 1 cm of and oriented toward object. Object-Place-Context Recognition. Subjects were tested in their ability to recognize an object with its location and context PLOS ONE | www.plosone.org 3 August 2014 | Volume 9 | Issue 8 | e105340 Anesthetic Effects on Memory Figure 3. Neuronal death by group. A to F) Exposure to either anesthetic – desflurane or isoflurane – led to significantly increased neuronal death in each brain region. The degree of neurodegeneration was similar in desflurane and isoflurane-treated subjects. Sample images from brains at 20X magnification are shown alongside graphs comparing total cell death for each structure. G) The average increases in neuronal death relative to controls are shown. *P,0.05. doi:10.1371/journal.pone.0105340.g003 Statistical Analysis Data were analyzed using Prism 6 Software for Mac OSX (GraphPad Software Inc., San Diego, CA). Data were assessed for normal distribution using the D’Agostino and Pearson test. Parametric tests were used for normally distributed data; otherwise, nonparametric tests were used for analysis. All comparisons used a two-tail test and a P value less than 0.05 was considered statistically significant. Total FluoroJade-positive cells for each brain region were compared among the groups – control, desflurane, isoflurane – using one-way ANOVA for parametric data or the Kruskal-Wallis test for nonparametric data. Bonferroni’s post-test with multiple comparisons was used following one-way ANOVA, and Dunn’s post-test was used with the Kruskal-Wallis test. The fold-increase in neuronal death was determined for each structure by dividing the total FJ-positive cells for all anesthetized animals (n = 20) by the average number of FJ-positive cells per structure for control animals (n = 10). the groups using either one-way ANOVA with Bonferroni’s post- test or the Kruskal-Wallis test with Dunn’s post-test. In addition, a ‘‘discrimination index’’ (DI) was calculated and (eg. represents the relative time spent exploring each target Familiar versus Novel). To calculate DI, the time spent investigating the familiar target was subtracted from the time spent on the novel target, and this was divided by the total time investigating the two (eg. DI = (Novel-Familiar)/(Total spent Time)). This value was compared to a theoretical value of zero using one sample t-test to assess whether a preference was shown for one of the objects, and a positive DI indicates preference for the novel aspect of the task. For each task, DI of control animals was compared against DI of all anesthetized animals. Also, within the group of anesthetized animals, the DI of desflurane-treated subjects was compared with that of isoflurane-treated subjects. These comparisons were made using either unpaired t-test for parametric data or the Mann Whitney test for nonparametric data. Recognition tasks were first assessed by comparing the investigation times of each target using paired tests for each group. Paired t-test was used for normally distributed data, and nonparametric data were analyzed with the Wilcoxon matched- pairs rank test. Also, to identify possible confounding effects of varying investigation times on subsequent object/animal recogni- tion, the times during the exposure phase were compared between Results Increased neuronal death occurs similarly in desflurane and isoflurane-treated animals There was increased neuronal death in each brain region in animals exposed to either desflurane or isoflurane relative to the control animals (Fig. 3). No difference in the extent of cell death PLOS ONE | www.plosone.org 4 August 2014 | Volume 9 | Issue 8 | e105340 Anesthetic Effects on Memory was identified between the two anesthetized groups. Anesthetic exposure resulted in significantly increased cell death in the (P = 0.0001, one-way ANOVA; control vs. des hippocampus P = 0.0002, control vs. iso P = 0.99, Bonferroni), dentate gyrus (P = 0.0003, one-way ANOVA; control vs. des P = 0.0002, control vs. iso P = 0.03, des vs. iso P = 0.16, Bonferroni), anterodorsal thalamus (P,0.0001, one-way ANOVA; control vs. des P,0.0001, control vs. iso P = 0.0007, des vs. iso P = 0.98, Bonferroni), anteromedial thalamus (P,0.0001, one-way ANOVA; control vs. des P,0.0001, control vs. iso P,0.0001, des vs. iso P = 0.99, Bonferroni), anteroventral thalamus (P,0.0001, iso Kruskal-Walli P = 0.001, des vs. iso P = 0.99, Dunn’s), and laterodorsal thalamus (P,0.0001, one-way ANOVA; control vs. des P,0.0001, control vs. iso P,0.0001, des vs. iso P = 0.99, Bonferroni). The relative fold-increase in cell death for each brain region is shown in Figure 3G. iso P = 0.0015, des vs. test; control vs. des P,0.0001, control vs. Novel Object and Object-Place Recognition are Unaffected subjects (novel object P = 0.9, unpaired t-test; object-place P = 0.3, Mann Whitney test) or between desflurane and isoflurane subjects (novel object P = 0.83, unpaired t-test; object-place P = 0.64, Mann Whitney test). Isoflurane but not desflurane treated animals are impaired in object-context and social recognition Only the isoflurane group was impaired in the ability to associate an object with its context and spent similar amounts of time with each object in this task (control P = 0.001, Wilcoxon test familiar vs. novel context; desflurane P = 0.006, isoflurane P = 0.2, paired t-test, Fig. 5A). DIs of control and desflurane subjects were greater than zero but not in isoflurane-treated subjects (control P = 0.004, desflurane P = 0.04, isoflurane P = 0.95, one sample t- test, Fig. 5B). Comparison of DI between control and anesthetized subjects did not reveal a difference (P = 0.094, unpaired t-test, Fig. 5B). Within the anesthetized group, DI did not differ significantly between desflurane and isoflurane-treated subjects (P = 0.32, unpaired t-test). Exploration times in the exposure phases of the object-context task were similar for the three groups (P = 0.6, one-way ANOVA). Subjects from each group were able to distinguish familiar and novel objects, revealed by increased investigation times of the novel object (control P = 0.006, desflurane P = 0.01, isoflurane P = 0.0003; paired t-test familiar vs. novel, Fig. 4A). Object-place recognition was also intact in each group, and animals spent more location (control P = 0.006, time with the object desflurane P = 0.001, isoflurane P = 0.0008, paired t-test familiar vs. novel location, Fig. 4C). There was no difference in object exploration times among groups during the exposure for either task (novel object P = 0.5, one-way ANOVA, object-place P = 0.2, Kruskal-Wallis). in a novel Discrimination Indexes [3] for all subjects were greater than recognition (control P = 0.007, zero for both novel object desflurane P = 0.002, isoflurane P = 0.002, one sample t-test, Fig. 4B) and object-place recognition (control P = 0.01, desflurane P = 0.001, isoflurane P = 0.001, one sample t-test, Fig. 4D). No differences in DI were identified between control and anesthetized Isoflurane animals also had impaired social memory while desflurane animals were unaffected when comparing social target (control P = 0.0009, desflurane P = 0.002, investigation times isoflurane P = 0.08; paired t-test familiar vs. novel animal, Fig. 5C). DIs of control and desflurane subjects were greater than zero (control P = 0.0009, desflurane P = 0.002, one sample t-test, Fig. 5D), although isoflurane DI did not differ significantly from zero (P = 0.064, one sample t-test, Fig. 5D). No difference between DI was identified in control vs. anesthetized groups (P = 0.84, unpaired t-test). the isoflurane DI was lower than desflurane DI although it did not reach statistical significance (P = 0.17, unpaired t-test). In the exposure of the social recognition task, animals from all groups displayed normal social behavior and spent significantly greater time investigating the social target relative to the object (all P, 0.0001, paired t-test object vs. social target). In the subset of anesthetized subjects, Figure 4. Novel object and object-place recognition. A) Subjects all demonstrated successful object recognition and preferentially explored the novel object. B) Each group’s DI was significantly greater than zero, and there was no difference in DIs. C) Subjects were also able to identify an object in a novel location, demonstrated by a relative increase in investigation of that object. D) Again, DIs for all subjects were greater than zero with no differences identified. *P,0.05, **P,0.01, ***P,0.001, CON = control, DES = desflurane, ISO = isoflurane. doi:10.1371/journal.pone.0105340.g004 PLOS ONE | www.plosone.org 5 August 2014 | Volume 9 | Issue 8 | e105340 Anesthetic Effects on Memory Figure 5. Object-context and social recognition. A) Isoflurane-treated animals were impaired in associating an object with a particular context. Animals exposed to desflurane, on the other hand, recognized when an object appeared in a different context and spent more time with that object. B) The DI for anesthetized subjects in this task did not differ from zero, and, within this group, only the desflurane DI significantly exceeded zero. C) Desflurane-treated subjects also had no change in social recognition ability, spending more time with the novel animal, while isoflurane-treated animals had deficient social memory. D) DI for both control and anesthetized animals exceeded zero, although DI for the subset of isoflurane-treated subjects did not. *P,0.05, **P,0.01, ***P,0.001, n.s. = not significant. doi:10.1371/journal.pone.0105340.g005 Anesthetized subjects are impaired in allocentric object- place and object-place-context recognition Animals from both isoflurane and desflurane groups were impaired in object recognition when the entry site was varied in the allocentric version of the object-place task (control P = 0.001, desflurane P = 0.08, paired t-test familiar vs. novel; isoflurane P = 0.2, Wilcoxon test, Fig. 6A). The control DI was greater than zero (P = 0.0004, one sample t-test, Fig. 6B), while neither desflurane nor isoflurane DI differed from zero (desflurane P = 0.094, isoflurane P = 0.31, one sample t-test, Fig. 6B). DI of control animals was also significantly greater than that of anesthetized subjects (P = 0.024, unpaired t-test), although no difference was detected in the subset of desflurane and isoflurane- treated animals (P = 0.95, unpaired t-test). Anesthetized subjects from both groups were also unable to distinguish objects task (control P = 0.04, desflurane P = 0.5, paired t-test familiar vs. displaced; isoflurane P = 0.8, Wilcoxon test, Fig. 6C). Only the control DI exceeded zero in this task (control P = 0.021, desflurane P = 0.71, isoflurane P = 0.7, one sample t-test, Fig. 6D). Control DI was again significantly greater than DI for anesthetized subjects (P = 0.04, unpaired t-test), and no difference was found between desflurane and isoflurane DIs (P = 0.59, unpaired t-test). Investi- gation times during the exposures were similar between groups for each task (allocentric object-place P = 0.1, object-place-context P = 0.7, one-way ANOVA). The summary of all behavioral testing is presented in Table 1, where each group is evaluated whether they demonstrate a preference for the novel portion of the task by recognizing a familiar set of stimuli. in the object-place-context Discussion The main finding of this study is that exposure to the volatile anesthetics isoflurane and desflurane causes impairment in tasks relying on specific cognitive processes of associative learning and recognition memory. After exposure to 1 MAC of either anesthetic for 4 hours during the early postnatal period, adult subjects could identify a novel object and recognize changes in an location. However, anesthetized animals were object’s spatial unable to recognize an object’s location when they entered the testing arena from a different vantage point or perform a complex task requiring the integration of object, place, and context details. In addition, isoflurane-treated subjects were impaired in context- specific object recognition and exhibited deficient social memory. The behaviors assessed in this study provide valuable insight into the types of learning affected by neonatal anesthesia exposure. The object recognition tasks performed here rely on spatial memory, but they also require associative processing to encode the relationships among distinct elements encountered during a given exposure [28,34,35]. Both control and treatment animals easily recognize a novel object, but animals that were anesthetized on P7 begin to show impairment when presented with objects that were previously in a different location or context, suggesting problems with associative learning. The impairment in the allocentric object-place task may also be related to spatial memory, because the animals are able to identify objects when relying on egocentric cues but struggle when forced to rely on allocentric cues. Episodic memory is associative in nature, and memory formation relies in large part on our ability to link new experiences and items with closely related ideas, facts, and the environment or context in which we learn them [36]. Clearly, a problem forming associations and relationships would affect memory encoding over time. Furthermore, within the broad domain of episodic memory, recognition memory is a specific type of memory that, according to the dual process model, is comprised of recollection and familiarity [26,36]. It is likely that impairment in the object recognition and in associative memory tasks could also result recollection, a process underlying recognition memory [19,28]. We recently reported deficits in recollection in both rodents and children after anesthesia at an early age [6]. Persistent problems with associative and recognition memory in children would have important consequences for learning and development throughout from a deficit PLOS ONE | www.plosone.org 6 August 2014 | Volume 9 | Issue 8 | e105340 Anesthetic Effects on Memory Figure 6. Allocentric object-place and object-place-context recognition. A) Exposure to isoflurane or desflurane led to impairment in identifying an object’s location when the site of entry into the context was changed. The varied entry points forced subjects to rely on allocentric cues to identify the object’s location. B) DI of control animals was significantly greater than that of anesthetized subjects. Neither desflurane nor isoflurane DI significantly exceeded zero. C) Isoflurane and desflurane-treated subjects were also impaired in recognition of an object that required association of its place and context. D) Again, control DI was greater than anesthetized DI. Neither subset of anesthetized subjects – desflurane or isoflurane – had DI greater than zero. *P,0.05, **P,0.01, n.s. = not significant. doi:10.1371/journal.pone.0105340.g006 adolescence. The precise cognitive domains that may be impaired in children and how these effects manifest later in life is still unclear, and these are important areas of future investigation. Isoflurane has been used in numerous studies to investigate the effects of anesthesia and many labs have reported cell death and behavioral changes after isoflurane exposure [1–3,14,30]. The effects associated with desflurane, though, are less well described. Similar to other volatile anesthetics, desflurane in neonates has been shown to induce cell death [37,38]. However, few studies of behavior have been performed, and only one of these has demonstrated cognitive impairment [38]. Kodama and colleagues found that mice exposed to desflurane later developed problems with short-term and long-term memory [38]. In our present study, we demonstrate impairment in desflurane-treated animals using two separate tasks that involve associative learning. Together, these behavioral results show that desflurane, like isoflurane [2,14,30] and sevoflurane [13,30,39], alters long-term cognitive behavior. Isoflurane-treated animals were impaired in two additional behavioral suggesting a distinct outcome from those anesthetized with desflurane. Others have also identified distinct outcomes using different anesthetic agents [37,38,40,41], although the reason underlying these behavioral findings is unclear. The types of memory involved in this series of behavioral testing are processed in the medial including temporal hippocampus and dentate gyrus, as well as the anterior thalamus and prefrontal cortex [26],[42], and we identified increased neurodegeneration in each of these brain regions. However, the observation of distinct behavioral outcomes occurred in the setting of a similar extent of neuronal injury. The discrepancy between histologic and behavioral findings suggest that, although neuronal death may play a role in determining behavioral phenotype, other effects on neural development likely contribute, as well. In fact, there is evidence that volatile anesthetics can alter synaptogenesis and dendritic spine density even in the absence of cell death [43]. In addition, anesthetics have been shown to result in significant tasks, lobe [19,28], Table 1. Summary of behavioral testing. Discrimination Index for task greater than zero? Control DES ISO Novel Object Recognition Yes Yes Yes Object-Place Recognition Yes Yes Yes Object-Context Recognition Yes Yes No Social Recognition Yes Yes No Allocentric Object-Place Recognition Yes No No Object-Place-Context Recognition Yes No No For each test, recognition of a familiar set of stimuli results in preferential exploration of the novel aspect of the task. Discrimination Index (DI) represents the time spent with the novel object or animal relative to the familiar one, and DI significantly greater than zero demonstrates successful recognition in the task. doi:10.1371/journal.pone.0105340.t001 PLOS ONE | www.plosone.org 7 August 2014 | Volume 9 | Issue 8 | e105340 neuroinflammation [41], changes in cell signaling [44], and stem cell proliferation [45,46]. It is likely that anesthetic effects on these processes of brain development contribute to the ultimate cognitive outcome. Isoflurane-treated animals also had difficulty with social recognition which is more likely related to long-term memory processes than their capacity for social interaction. Unlike previous reports [39], we found all animals behaved similarly during the exposure portion of the test, spending much more time with a novel animal than an object. In fact, throughout these experiments the treatment groups demonstrated a difference in none of suggests exploration time during the exposure phase. This anesthetic exposure does not alter investigatory or social behavior, motivation, or attention. Limitations The purpose of this study is to evaluate two separate anesthetics using outcomes of cell death and behavior. We cannot make conclusive remarks regarding mechanisms underlying cognitive impairment, and separate studies are needed to better understand these processes. Also, a comprehensive analysis of neuronal death was not undertaken, and it is possible that other brain regions show a difference. The hippocampus and thalamus were chosen, however, because of their underlying role in the investigated behavior. Social recognition is based on olfaction in rodents [47] and we did not perform a separate experiment to exclude impaired olfaction as the basis for deficient social recognition in our subjects. However, we have previously determined that anesthetic exposure does not impair olfaction [6]. Isoflurane-treated subjects displayed typical social behavior in each part of the test, suggesting impaired recognition was due to effects on memory rather than interest, References 1. Gentry KR, Steele LM, Sedensky MM, Morgan PG (2013) Early developmental exposure to volatile anesthetics causes behavioral defects in Caenorhabditis elegans. Anesth Analg 116: 185–189. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, et al. (2003) Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 23: 876–882. 2. 3. Brambrink AM, Evers AS, Avidan MS, Farber NB, Smith DJ, et al. (2010) Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology 112: 834–841. 4. Flick RP, Katusic SK, Colligan RC, Wilder RT, Voigt RG, et al. (2011) Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics 128: e1053–1061. 5. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, et al. (2009) Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 110: 796–804. 6. Stratmann G, Lee J, Sall JW, Lee B, Alvi BS, et al. (2014) Effect of general anesthesia in infancy on long-term recognition memory in humans and rats. Neuropsychopharmacology 39. EPub ahead of print. 7. DiMaggio C, Sun LS, Kakavouli A, Byrne MW, Li G (2009) A retrospective cohort study of the association of anesthesia and hernia repair surgery with behavioral and developmental disorders in young children. J Neurosurg Anesthesiol 21: 286–291. 8. DiMaggio C, Sun LS, Li G (2011) Early childhood exposure to anesthesia and risk of developmental and behavioral disorders in a sibling birth cohort. Anesth Analg 113: 1143–1151. 9. Bunsey M, Eichenbaum H (1996) Conservation of hippocampal memory function in rats and humans. Nature 379: 255–257. 10. Eichenbaum H, Yonelinas AP, Ranganath C (2007) The medial temporal lobe and recognition memory. Annu Rev Neurosci 30: 123–152. 11. Burgess N, Maguire EA, O’Keefe J (2002) The human hippocampus and spatial and episodic memory. Neuron 35: 625–641. 12. Fortin NJ, Wright SP, Eichenbaum H (2004) Recollection-like memory retrieval in rats is dependent on the hippocampus. Nature 431: 188–191. 13. Shih J, May LD, Gonzalez HE, Lee EW, Alvi RS, et al. (2012) Delayed environmental enrichment reverses sevoflurane-induced memory impairment in rats. Anesthesiology 116: 586–602. PLOS ONE | www.plosone.org 8 Anesthetic Effects on Memory motivation, or olfaction. Also, although the rats were tested serially, they did not show any signs of decreasing interest with the objects as we used objects that appeared novel to the subjects in each trial. In fact, the exploration times remained very similar across the tests from first to last. There are numerous studies documenting effects of gestational and early life stress on long-term behavior [48,49]. Because the animals were shipped, rather than bred in the housing facility, it is possible that they were exposed to early life stress that may affect aspects of behavior. Although effects of stress are likely evenly distributed amongst behavior groups, these considerations should be taken into account when interpreting behavioral results. Finally, the cognitive outcomes from the two anesthetics appear to be different; however, it is possible that the two anesthetics were not entirely equal in depth in spite of being adjusted to 1 MAC. This must be taken into consideration when attempting to make direct comparisons between the two volatile anesthetics. Conclusion Neonatal exposure to isoflurane and desflurane led to impair- ment in object recognition tasks relying on spatial and associative memory. These findings provide evidence that anesthetics can affect distinct cognitive processes that are fundamental to learning and memory in rodents, as well as humans. Author Contributions Conceived and designed the experiments: BHL JTC OH LV JWS. Performed the experiments: BHL JTC OH LV JWS. Analyzed the data: BHL JTC OH LV JWS. Contributed reagents/materials/analysis tools: BHL JTC OH LV JWS. Contributed to the writing of the manuscript: BHL JTC OH LV JWS. 14. Stratmann G, May LD, Sall JW, Alvi RS, Bell JS, et al. (2009) Effect of hypercarbia and isoflurane on brain cell death and neurocognitive dysfunction in 7-day-old rats. Anesthesiology 110: 849–861. 15. Boscolo A, Ori C, Bennett J, Wiltgen B, Jevtovic-Todorovic V (2013) Mitochondrial protectant pramipexole prevents sex-specific long-term cognitive impairment from early anaesthesia exposure in rats. Br J Anaesth. 16. Yonelinas AP (2001) Components of episodic memory: the contribution of recollection and familiarity. Philos Trans R Soc Lond B Biol Sci 356: 1363– 1374. 17. Brown MW, Aggleton JP (2001) Recognition memory: what are the roles of the perirhinal cortex and hippocampus? Nat Rev Neurosci 2: 51–61. 18. Clayton NS, Dickinson A (1998) Episodic-like memory during cache recovery by scrub jays. Nature 395: 272–274. 19. Eacott MJ, Norman G (2004) Integrated memory for object, place, and context in rats: a possible model of episodic-like memory? J Neurosci 24: 1948–1953. 20. Eacott MJ, Easton A, Zinkivskay A (2005) Recollection in an episodic-like memory task in the rat. Learn Mem 12: 221–223. 21. Dere E, Huston JP, De Souza Silva MA (2005) Episodic-like memory in mice: simultaneous assessment of object, place and temporal order memory. Brain Res Brain Res Protoc 16: 10–19. 22. Kart-Teke E, De Souza Silva MA, Huston JP, Dere E (2006) Wistar rats show episodic-like memory for unique experiences. Neurobiol Learn Mem 85: 173– 182. 23. Eichenbaum H, Fortin N, Sauvage M, Robitsek RJ, Farovik A (2010) An animal model of amnesia that uses Receiver Operating Characteristics (ROC) analysis to distinguish recollection from familiarity deficits in recognition memory. Neuropsychologia 48: 2281–2289. 24. Easton A, Eacott MJ (2010) Recollection of episodic memory within the medial temporal lobe: behavioural dissociations from other types of memory. Behav Brain Res 215: 310–317. 25. Sauvage MM (2010) ROC in animals: uncovering the neural substrates of recollection and familiarity in episodic recognition memory. Conscious Cogn 19: 816–828. 26. Aggleton JP, Dumont JR, Warburton EC (2011) Unraveling the contributions of the diencephalon to recognition memory: a review. Learn Mem 18: 384–400. 27. Macbeth AH, Edds JS, Young WS 3rd (2009) Housing conditions and stimulus females: a robust social discrimination task for studying male rodent social recognition. Nat Protoc 4: 1574–1581. August 2014 | Volume 9 | Issue 8 | e105340 28. Langston RF, Wood ER (2010) Associative recognition and the hippocampus: differential effects of hippocampal lesions on object-place, object-context and object-place-context memory. Hippocampus 20: 1139–1153. 29. Cross L, Brown MW, Aggleton JP, Warburton EC (2012) The medial dorsal thalamic nucleus and the medial prefrontal cortex of the rat function together to support associative recognition and recency but not item recognition. Learn Mem 20: 41–50. 30. Ramage TM, Chang FL, Shih J, Alvi RS, Quitoriano GR, et al. (2013) Distinct long-term neurocognitive outcomes after equipotent sevoflurane or isoflurane anaesthesia in immature rats. Br J Anaesth. 31. Stratmann G, Sall JW, Eger EI 2nd, Laster MJ, Bell JS, et al. (2009) Increasing the duration of isoflurane anesthesia decreases the minimum alveolar anesthetic concentration in 7-day-old but not in 60-day-old rats. Anesth Analg 109: 801– 806. 32. Schmued LC, Stowers CC, Scallet AC, Xu L (2005) Fluoro-Jade C results in ultra high resolution and contrast labeling of degenerating neurons. Brain Res 1035: 24–31. 33. Wang L, Liu YH, Huang YG, Chen LW (2008) Time-course of neuronal death in the mouse pilocarpine model of chronic epilepsy using Fluoro-Jade C staining. Brain Res 1241: 157–167. 34. Aggleton JP, Sanderson DJ, Pearce JM (2007) Structural hippocampus. Hippocampus 17: 723–734. 34. Aggleton JP, Sanderson DJ, Pearce JM (2007) Structural hippocampus. Hippocampus 17: 723–734. 35. Mumby DG, Gaskin S, Glenn MJ, Schramek TE, Lehmann H (2002) Hippocampal damage and exploratory preferences in rats: memory for objects, places, and contexts. Learn Mem 9: 49–57. 36. Mayes A, Montaldi D, Migo E (2007) Associative memory and the medial temporal lobes. Trends Cogn Sci 11: 126–135. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, et al. (2011) the neuroapoptotic properties of equipotent anesthetic Comparison of concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114: 578–587. 36. Mayes A, Montaldi D, Migo E (2007) Associative memory and the medial temporal lobes. Trends Cogn Sci 11: 126–135. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, et al. (2011) the neuroapoptotic properties of equipotent anesthetic Comparison of concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114: 578–587. 38. Kodama M, Satoh Y, Otsubo Y, Araki Y, Yonamine R, et al. (2011) Neonatal desflurane exposure induces more robust neuroapoptosis than do isoflurane and sevoflurane and impairs working memory. Anesthesiology 115: 979–991. PLOS ONE | www.plosone.org 9 Anesthetic Effects on Memory 39. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, et al. (2009) Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 110: 628–637. 40. Liang G, Ward C, Peng J, Zhao Y, Huang B, et al. (2010) Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 112: 1325–1334. 41. Shen X, Dong Y, Xu Z, Wang H, Miao C, et al. (2013) Selective anesthesia- induced neuroinflammation in developing mouse brain and cognitive impair- ment. Anesthesiology 118: 502–515. 42. Aggleton JP, Hunt PR, Nagle S, Neave N (1996) The effects of selective lesions within the anterior thalamic nuclei on spatial memory in the rat. Behav Brain Res 81: 189–198. 43. Briner A, De Roo M, Dayer A, Muller D, Habre W, et al. (2010) Volatile anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiology 112: 546–556. 44. Masaki E, Kawamura M, Kato F (2004) Attenuation of gap-junction-mediated signaling facilitated anesthetic effect of sevoflurane in the central nervous system of rats. Anesth Analg 98: 647–652, table of contents. 45. Sall JW, Stratmann G, Leong J, McKleroy W, Mason D, et al. (2009) Isoflurane inhibits growth but does not cause cell death in hippocampal neural precursor cells grown in culture. Anesthesiology 110: 826–833. 46. Lin N, Moon TS, Stratmann G, Sall JW (2013) Biphasic change of progenitor proliferation in dentate gyrus after single dose of isoflurane in young adult rats. J Neurosurg Anesthesiol 25: 306–310. 47. Tang AC, Reeb BC, Romeo RD, McEwen BS (2003) Modification of social memory, hypothalamic-pituitary-adrenal axis, and brain asymmetry by neonatal novelty exposure. J Neurosci 23: 8254–8260. 48. Koenig JI, Elmer GI, Shepard PD, Lee PR, Mayo C, et al. (2005) Prenatal exposure to a repeated variable stress paradigm elicits behavioral and neuroendocrinological changes in the adult offspring: potential relevance to schizophrenia. Behav Brain Res 156: 251–261. 49. Weinstock M (2001) Alterations induced by gestational stress in brain morphology and behaviour of the offspring. Prog Neurobiol 65: 427–451. August 2014 | Volume 9 | Issue 8 | e105340",rats,['Postnatal day 7 (P7) rats were exposed to either desflurane or isoflurane at 1 Minimum Alveolar Concentration for 4 h.'],postnatal day 7,['Postnatal day 7 (P7) rats were exposed to either desflurane or isoflurane at 1 Minimum Alveolar Concentration for 4 h.'],Y,"['In separate behavioral experiments, beginning at P48, subjects were evaluated in a series of object recognition tests relying on associative learning, as well as social recognition.']",isoflurane,['Postnatal day 7 (P7) rats were exposed to either desflurane or isoflurane at 1 Minimum Alveolar Concentration for 4 h.'],desflurane,['Postnatal day 7 (P7) rats were exposed to either desflurane or isoflurane at 1 Minimum Alveolar Concentration for 4 h.'],sprague dawley,"['Five Sprague-Dawley dams with litters of postnatal day 6 (P6) pups from were obtained from Charles River Laboratories (Gilroy, CA).']",The study addresses the incomplete understanding of the types of memory altered by early anesthetic exposure.,"['Anesthetic exposure early in life affects neural development and long-term cognitive function, but our understanding of the types of memory that are altered is incomplete.']",None,[],The findings indicate deficits in tasks relying on associative learning and recognition memory due to early exposure to volatile anesthetics.,['Isoflurane and desflurane exposure during development result in deficits in tasks relying on associative learning and recognition memory.'],The study acknowledges the challenge of translating cognitive effects in animals to humans and the need for further assessments in children.,['An important challenge in the study of anesthetic neurotoxicity is developing a model by which cognitive effects in animals can be translated to humans.'],None,[],True,True,True,True,True,True,10.1371/journal.pone.0105340 10.1002/brb3.514,299.0,Lin,2016,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"Early-life single-episode sevoflurane exposure impairs social behavior and cognition later in life Daisy Lin1,2,*, Jinyang Liu1,*, Lea Kramberg1, Andrea Ruggiero1, James Cottrell1 & Ira S. Kass1,2,3 1Anesthesiology Department, SUNY Downstate Medical Center, Box 6, 450 Clarkson Ave, Brooklyn, New York 11203 2Department of Physiology and Pharmacology, SUNY Downstate Medical Center, 450 Clarkson Ave, Brooklyn, New York 11203 3The Robert F. Furchgott Center for Neural and Behavioral Sciences, Brooklyn, New York 11203 Keywords Cognition and social interaction, postnatal day 7, sevoflurane Correspondence Daisy Lin, Anesthesiology Department, SUNY Downstate Medical Center, Box 6, 450 Clarkson Ave, Brooklyn, NY 11203. Tel: 718-270-2048, 718-270-1709; Fax: 718- 270-3928; E-mail: daisy.lin@downstate.edu Funding Information This study was supported by the Anesthesiology Department, Brooklyn Anesthesia Research Division of the University Physicians of Brooklyn, Brooklyn, New York. Received: 3 September 2015; Revised: 12 May 2016; Accepted: 13 May 2016 Brain and Behavior, 2016; 6(9), e00514, doi: 10.1002/brb3.514 These authors contributed equally to the work. Abstract Background: Single-episode anesthetic exposure is the most prevalent surgery- related incidence among young children in the United States. Although numer- ous studies have used animals to model the effects of neonatal anesthetics on behavioral changes later on in life, our understanding of the functional conse- quences to the developing brain in a comprehensive and clinically relevant manner is unclear. Methods: The volatile anesthetic, sevoflurane (sevo) was administered to C57BL6 postnatal day 7 (P7) mice in a 40% oxygen and 60% nitrogen gas mixture. In order to examine the effects of sevo alone on the developing brain in a clinically relevant manner, mice were exposed to an aver- age of 2.38 (cid:1) 0.11% sevo for 2 h. No sevo (control) mice were treated in an identical manner without sevo exposure. Mice were examined for cognition and neuropsychiatric-like behavioral changes at 1–5 months of age. Results: Using the active place avoidance (APA) test and the novel object recognition (NOR) test, we demonstrated that P7 sevo-treated mice showed a deficit in learning and memory both during periadolescence and adulthood. We then employed a battery of neuropsychiatric-like behavioral tests to examine social interaction, communication, and repetitive behavior. Interestingly, compared to the no- sevo–treated group, sevo-treated mice showed significant reductions in the time interacting with a novel mouse (push–crawl and following), time and interac- tion in a chamber with a novel mouse, and time sniffing a novel social odor. Conclusions: Our study established that single-episode, 2-h sevo treatment dur- ing early life impairs cognition later on in life. With this approach, we also observed neuropsychiatric-like behavior changes such as social interaction defi- cits in the sevo-treated mice. This study elucidated the effects of a clinically rel- evant single-episode sevo application, given during the neonatal period, on neurodevelopmental behavioral changes later on in life. Introduction General anesthesia has been used in young children dur- ing surgical procedures dating back as early as the 1800s (Costarino and Downes 2005; Mai and Cote 2012). Cur- rently, an annual estimate of over 1 million children under the age of 4 received medical procedure-related anesthesia in the United States (Rabbitts et al. 2010). However, it is only in the last decade that we started to recognize that general anesthesia has deleterious effects on the developing brain (Jevtovic-Todorovic et al. 2003; Fre- driksson et al. 2007; Mellon et al. 2007; Slikker et al. 2007; Loepke and Soriano 2008; DiMaggio et al. 2009, 2011; Wilder et al. 2009; Brambrink et al. 2010; Sun 2010; Stratmann 2011; Amrock et al. 2015). With arising concerns regarding the safe use of general anesthesia in young children, there is an urgent demand to clearly understand the resulting functional changes in the brain in a comprehensive and clinically relevant manner. This current study investigates the resulting functional changes that have been widely established, such as cogni- tion, as well as those still unknown, such as neuropsychi- atric disorders. Using the mouse as a model system, we examined these functional changes while maintaining a close relevance of our study approach to clinical settings. Our focus is to examine the implications of single-episode ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (1 of 14) This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior anesthetic exposure on early brain development because it is the most prevalent surgery-related incidence among children under the age of 4 (Wilder et al. 2009). et al. 2005; Read and Hammersley 2005; Cath et al. 2008; Champagne and Curley 2009; Roullet et al. 2013; Lee et al. 2015). Exposure to anesthetics during a critical developmental time period is a major environmental insult to the brain. However, the effect of early-life expo- sure to anesthetics on the development of neuropsychi- atric disorders is not clear and therefore is investigated as an area of functional changes in this current study. Numerous human and animal studies had been con- ducted to examine the association between early-life gen- eral anesthetic exposure and behavioral changes later on in life, with a focus on cognitive function (Jevtovic- Todorovic et al. 2003; DiMaggio et al. 2009; Sprung et al. 2009; Wilder et al. 2009; Flick et al. 2011; Murphy and Baxter 2013; Shen et al. 2013a). A majority of the human studies were conducted with a retrospective population cohort approach, by gathering data from a specific sub- population and identifying incidences of general anes- ages of 3–6. However, thetic the variations in these human study approaches such as dif- ferent assessment tools have led to inconsistent conclu- impairment sions; (DiMaggio et al. 2009, 2011; Sprung et al. 2009; Wilder et al. 2009), while others did not (Bartels et al. 2009; Kalkman et al. 2009; Hansen et al. 2011, 2013). Although prospective human studies have started to emerge in recent years, an agreement in outcome has yet to be established. An interim secondary outcome study from one group did not find increased risk of neurodevelop- mental outcome at 2 years of age (Davidson et al. 2016), while another group found cognitive impairment in chil- dren ages 6–11 years (Stratmann et al. 2014). We investigated the role of early-life exposure to sevoflurane on cognition and neuropsychiatric-like behav- ioral changes. Sevo is the most commonly used volatile anesthesia for surgical procedures on both children and adults in the United States (Sakai et al. 2005). By expos- ing postnatal day 7 (P7) mice to a single episode of sevo for 2 h, we established that cognitive ability was impaired later on in life. Interestingly, we also observed with three different behavior paradigms that early-life exposure to sevo resulted in social deficits. This study extends our awareness of the insults that single-episode exposure to sevo has on the developing brain, resulting in long-lasting functional changes that we can observe through behavior later on in life. exposure before some groups reported cognitive Materials and Methods Treatment with sevoflurane C57/BL6 mice were used throughout the study, which was approved by the SUNY Downstate IACUC. A total of nine litters of mice were used to establish the approxi- mate MAC for P7 mice. A separate set of 11 litters of mice were used for treatment without tail clamp and mice from this group were used for behavioral tests later on in life. At P7, all male pups from each litter (ranging from 2 to 6 pups) were randomly assigned to either the sevo or the no sevo (control) group, while the female pups remained with the dam. During a 2-h treatment period, pups from the sevo group were separated from the dam and exposed to sevo in a 40% oxygen (O2) and 60% nitrogen (N2) gas mixture (GTS-WELCO, Newark Distri- bution, Morrisville, PA). These pups were placed on a 37°C heating pad to prevent hypothermia during treat- ment. A pulse oximeter sensor (MSTAT 4 mm, Kent Sci- entific Corporations, Torrington, CN) was placed on one of the hind paws of the pup and measurements for heart rate (HR) and blood oxygen saturation (SpO2) were recorded every 5 min. To establish the approximate MAC of sevo on P7 mice, each treatment of sevo consisted of two mice and tail clamp was done every 10 min. The sevo concentration was adjusted to a higher concentration if both mice moved during tail clamp, adjusted to a lower concentration when neither mouse moved during tail clamp, and no adjustment was made when only one Animal studies, ranging from rodents to nonhuman primates, have persistently showed an association between early-life general anesthetic exposure and deficits in learn- ing and memory-related behavior. However, anesthetics such as isoflurane (iso), sevoflurane (sevo), or ketamine were generally given in the range of 4–8 h in rodents et al. 2008; (Jevtovic-Todorovic Loepke et al. 2009; Satomoto et al. 2009; Stratmann et al. 2009; Liang et al. 2010; Murphy and Baxter 2013; Shen et al. 2013a; Wang et al. 2013; Lee et al. 2014a), to as long as 5–24 h in monkeys (Zou et al. 2009, 2011; Bram- brink et al. 2010; Paule et al. 2011). As a comparison, children undergoing typically exposed to only 1 MAC (minimum alveolar concentra- tion) of iso or sevo for <1 h (Rabbitts et al. 2010). There- the reported behavior changes as a result of fore, anesthetic in animals have not accurately depicted the effects of anesthetics on the developing brains of young children. et al. 2003; Sanders surgeries are routine exposure The developing brain is vulnerable to a variety of envi- ronmental insults, ranging from deprivation of maternal care to toxin and drug exposure, resulting in increased risk of neuropsychiatric disorders, such as autism spec- trum disorder, depression, anxiety, bipolar disorder, schizophrenia, and obsessive compulsive disorder (Pichot 1986; Ansorge et al. 2004; Batten et al. 2004; Phillips Brain and Behavior, doi: 10.1002/brb3.514 (2 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior mouse responded to stimuli. This was our approach to determine that with a given sevo concentration, 50% of mice did not respond to stimuli. The sevo concentration was recorded every 5 min since that was the time interval that we used to record peripheral capillary oxygen satura- tion (SpO2) and HR. The pups from the control group were also separated from the dam and exposed only to 40% O2 and 60% N2. At the end of the 2-h treatment the pups were returned to their home cage and reunited with their dams. All pups were then reared and weaned follow- ing standard institution procedures. explore the open field arena. Locomotion activities such as distance and time in different compartments of the arena were automatically measured using a computerized track- ing apparatus (Versadat, Versamax, Groovy, CA). Learning and memory-like behavior Active place avoidance test The APA test is a hippocampus-dependent spatial mem- ory test. A rotating arena consisting of a circular platform (40 cm diameter) was placed in the center of a dimly lit room. The mouse was trained to avoid a 60° shock zone, which could be defined within a region of the room iden- tified by multiple visual cues (Fenton et al. 1998; Wesier- ska et al. 2005). Two-day trials were performed as described previously (Burghardt et al. 2012). Briefly, the mouse was given 10 min for each trial with at least a 50- min intertrial interval. The locomotion of the mouse was tracked by computer-based software that analyzed images from an overhead camera and delivered shocks appropri- ately (Tracker, Bio-Signal Group Corp., Brooklyn, NY). A brief constant current shock (500 msec, 60 Hz, 0.2 mA) across pairs of rods was delivered to the shock zone upon entrance of the mouse. Track analysis software (Bio-Signal Group Corp.) was used to compute the num- ber of times that the mouse entered the shock zone. Behavior tests The mice that were involved in the behavior tests had undergone a 2-h sevo or no sevo treatment at P7 without tail clamping. They were reared and group housed under standard conditions. The sevo-treated mice were marked to distinguish them from the no-sevo–treated mice within a litter. We examined at most one to two litters of mice at a time for each behavior, with at least 1 week of resting time in between different behavioral tests. The behavior tests were given sequentially for the active place avoidance (APA), reciprocal social interaction, and olfaction habitua- tion/dishabituation. After completion of these tests, we then introduced three-chamber interaction, open field, and novel object recognition (NOR). All behavioral apparatus were assembled and remained in their original locations throughout the entire duration of the project. The APA test was done on mice starting at the age of P27. All other behaviors were conducted on mice within the age range of 1.5–5 months old. The following reasons contributed to variation in the number of mice used for some tests. First, we were not able to examine all treated mice on the APA due to irreparable malfunctioning of the APA apparatus. Therefore, we introduced NOR as a second cognition test on mice that had not been used for the APA. Second, some mice were not included in testing if they were not within the age range at the time of the test, specifically the second group of tests such as three-chamber interaction, open field, and NOR. Besides the APA and the open field, all other tests that required manual scoring were first video- taped and then scored by experimenters who were blind to the treatment status of the mice. foot Novel object recognition test This is a two consecutive day test examining learning and memory-like behavior on adult male mice (3–5 months of age; Leger et al. 2013). The test was conducted in a room with dim lighting. Day 1 is considered the familiarization phase. Mice were individually habituated in a standard open field apparatus for 10 min. They were then taken out of the arena briefly and two identical glass bottles filled with pink silica gel were placed in the center of the arena. The glass bottles were positioned 5 inches from each other such that the mouse can travel freely across the center of the arena without obstruction. The mouse was then put back in the arena and allowed 10 min to become familiar with the two identical objects. Day 2 is the test phase. One of the glass bottles is taken out of the arena and replaced with a yellow laboratory tube rack (H 6.5, W 3.5, D 2 inches) as a novel object. The holes on the sides of the tube rack were taped to prevent the mouse from climbing on them during the experiment. The same mouse was placed in the arena for 10 min in an identical manner as day 1 and allowed 10 min of exploration time. The times spent sniff- ing and interacting with (attempting to climb up or jump on or at) the familiar and the novel objects were scored for each mouse. Locomotion and anxiety-like behavior Open field test An open field apparatus was used to assess the general physical and anxiety-like performance of the mice based on their ambulatory locomotion in the arena (Crawley 1985). In a well-lit novel room, each mouse was given 30 min to ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (3 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior presentation of odor lasted 2 min. The amount of time that the mouse spent sniffing the cotton swab, including nose poking, chewing, sniffing, and close proximity (2 cm) of the nose to cotton swab was scored (Silverman et al. 2010). Social interactions Reciprocal social interaction The subject mouse (P7 sevo treated or no sevo control) was transferred from his home cage to a new cage with fresh bedding and allowed to habituate to the cage for 10 min. At the end of this 10-min session, a novel male target mouse (that had not undergone treatment during P7) of similar age was introduced into the same cage. The subject and the target mice were allowed to interact for 10 min. The amount of time that the subject mouse spent interacting with the target mouse (push–crawl/fol- lowing behavior), self-grooming, and exploring the arena and the total time the mouse was mobile were scored manually (Silverman et al. 2010). Statistical analysis All statistical analysis was done using GraphPad Prism 5.0 (GraphPad, San Diego, CA). Data with one variable such as the open field and the reciprocal social interaction were analyzed by t test. Data with two variables such as the APA, the NOR, the three-chamber interaction, and the olfaction habituation/dishabituation were analyzed by two-way ANOVA, followed by Bonferroni posttests. Results Three-chamber interaction A three-chamber apparatus made of clear plexiglass was used for this study (Nadler et al. 2004). The apparatus is divided into three equally sized compartments (H 9.5, W 8, D 16 inches). First, the subject mouse was habituated for 10 min in the center chamber. Then the doors that give access to the left and right sides of the chamber were opened allowing the subject mouse to freely explore all three chambers for 10 min. During this time, the novel target mouse was habituated under a wire pencil cup on a separate tabletop. After 10 min of three-chamber explo- ration, the doors were closed and the subject mouse was briefly confined in the center chamber. During this time, we set up the three-chamber apparatus such that the novel target mouse was placed on one side of the cham- ber and a novel empty pencil cup on the other side. A weighted plastic cup was placed on the top of each pencil holder to prevent the subject mouse from climbing on the top of it. The doors were then opened to allow the subject mouse to explore the three chambers for 10 min. Establishing a mouse model of neonatal sevoflurane treatment In order to understand the effect that neonatal sevo treat- ment alone has on behavioral changes later on in life, we established two different sevo treatment groups. During a 2-h treatment period, we used tail clamp to first establish that the approximate MAC of sevo for P7 mice averaged 3.58 (cid:1) 0.07% (Fig. 1A). Since tail clamp may result in pain and scaring of the tail similar to the act of clinical surgery, we then treated a separate group of mice in a sim- ilar manner but without tail clamp. This second group of mice was treated with a reduced concentration of sevo, which was sufficient to keep the mice immobilized/uncon- scious and this sevo concentration averaged 2.38 (cid:1) 0.11% (Fig. 1B). These mice were subsequently examined for the effect of neonatal sevo treatment alone on behavioral changes later on in life. Mice were monitored closely for their measurements of peripheral capillary oxygen satura- tion (SpO2) and HR during the treatment. An average SpO2 of 97 (cid:1) 0.11% and HR of 427 (cid:1) 2.02 beats per min suggest the mice were in a physiological healthy state, without any signs of hypoxia (Fig. 1C and D). Communication Olfaction habituation/dishabituation The mouse was transferred to a new cage containing a thin layer of fresh bedding and a hole for inserting a cotton tipped swab. After a 10-min habituation period in the new cage, the mouse was presented with nonsocial and social odors. Each odor was presented for three consecutive times; the order of presentation was water, almond extract (1:100, Spice Supreme), orange extract (1:100, McCor- mick), mouse socials 1 and 2. The mouse social odors were taken by wiping in a zigzag pattern across the bottom sur- face of different cages for odors 1 and 2; each cage housed the same sex and strain. Each unfamiliar mice of Locomotion and anxiety-like behavior Locomotion and movement of the limbs are critical to all mouse behavior. Therefore, the no–sevo- and sevo-treated mice were examined for their locomotion in the open field apparatus as a general physical assessment (Crawley 1985, 2007; Fig. 2). This brightly lit, novel test environ- ment with an unprotected center is also anxiety provok- ing. The two groups of mice were examined for their exploration in the center versus the total arena as a mea- surement of anxiety-like behavior. We observed no Brain and Behavior, doi: 10.1002/brb3.514 (4 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior Figure 1. Two approaches of sevo treatment on postnatal day 7 (P7) mice. (A) The approximate minimum alveolar concentration (MAC) of sevo necessary for P7 mice was established by tail clamping every 10 min during treatment. The approximate MAC of sevo was averaged to be 3.58 (cid:1) 0.07% based on the concentration recorded every 5 min (N = 13). (B) On a separate group of mice, less than one MAC (2.38 (cid:1) 0.11%) of sevo was given without tail clamping. This group of mice was then used in all the subsequent behavior paradigms (N = 17). (C and D) Data shown are measurements taken from the group of mice that were exposed to sevo with tail clamp. SpO2 and heart rate were recorded every 5 min on all mice undergoing sevo treatment. Figure 2. Postnatal day 7 sevo treatment did not have an effect on locomotion and anxiety-like behavior later on in life. No differences were observed between the two groups (no sevo vs. sevo) on different measurements of the open field apparatus such as (A) total distance traveled and the (B) ratio of center/total distance traveled. Unpaired t-test with Welch’s correction was used for statistical calculation (N = 14 for no sevo; N = 13 for sevo). two groups on locomotion differences between the (Fig. 2A) and anxiety-like behavior (Fig. 2B; unpaired t- test with Welch’s correction). Data suggest that locomo- tion and anxiety-like behaviors are not potential con- founds to subsequent behavioral tests. five trials during day 1 and this behavior persisted into day 2. A similar observation was not present in the sevo group. Sevo-treated mice showed significantly more entrances into the shock zone over the 2 days, 10-trial period (two-way ANOVA followed by Bonferroni postt- ests, P < 0.01 for treatment, P < 0.001 for trial, P > 0.05 for interaction between treatment and trial, and P < 0.05 for treatment effect within trials, day 1—trials 4 and 5 and day 2—trial 2). Learning and memory Active place avoidance We observed learning and memory impairment as early as periadolescent age (P27 and P28), based on the hip- pocampus-dependent APA test. The mouse learned to avoid a stationary shock zone in a constant rotating arena using the distal room landmarks as cues (Fig. 3). The no- sevo–treated mice learned to avoid the shock zone over Novel object recognition We examined cognitive function of adult mice (ages 4– 5 months) by the NOR test. The NOR is a widely used learning and memory task, which offers no external stim- uli or reinforcement (Leger et al. 2013). During day 1— ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (5 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior Figure 3. Neonatal sevo treatment impaired learning and memory during periadolescence. (A) Locomotion of a no- sevo- and a sevo-treated mouse are represented by traces on the circular rotating platform. The arrow indicates the direction of platform movement (1 revolution per minute). Entrances into the shock zone (represented by the 60° red zone) are marked as the red dots. (B) At P27 and P28, sevo-treated mice entered the shock zone significantly more compared to the no-sevo–treated group during a total of 10 trials. Two-way ANOVA was used for statistical calculation: F(1, 63) = 1.28, P < 0.01 for treatment; F(9, 63) = 14.6, P < 0.001 for trials; F(9, 63) = 1.8, P > 0.05 for interaction between treatment and trials. Bonferroni posttests showed P < 0.05 for treatment on day 1, trials 4 and 5; day 2, trial 2. Asterisk (*) denotes P < 0.05 for treatment effect within the trials (N = 4 for no sevo, N = 5 for sevo). familiarization (Fig. 4A), both the no-sevo- and sevo-trea- ted groups spent a similar amount of time exploring the two identical objects, with no differential preference for a specific object (Fig. 4B; two-way ANOVA). However, dur- ing day 2—testing (Fig. 4A), the no sevo group spent sig- this nificantly more time exploring the novel object; difference was not found in the sevo-treated group (Fig. 4C; two-way ANOVA, followed by Bonferroni postt- ests, P < 0.01 for time exploring the objects in the no sevo group). Combining the two sets of learning and memory behavioral tests, data demonstrated for the first time, a 2-h, single-episode neonatal exposure to less than one MAC of sevo impairs learning and memory as early as periadolescence and this persists to adulthood. direct insight into how two unfamiliar mice interact in a standard new cage. We scored the four most predominant behaviors of the subject mouse while paired with the target mouse in the novel cage, such as push–crawl/following, arena explo- ration, self-grooming, and time being mobile. Among the four measurements, sevo-treated mice showed a specific deficit compared to no-sevo–treated mice on the amount of time they engage in push–crawling and following the unfamiliar mouse (Fig. 5; unpaired t-test with Welch’s correction, P < 0.05). Data show mice exposed to single- episode sevo treatment on P7 had impaired social interac- tion later on in life. Three-chamber social interaction Social interactions We wanted to further understand whether the two groups of P7-treated mice would differ in a social behavior para- digm that is self-directed, without the physical elicitation from the novel target mouse. To address this question, interaction three-chamber we Reciprocal social interaction Mice are social animals that engage in a variety of social interaction behaviors. The reciprocal social interaction paradigm is designed to provide the most detailed and employed the social Brain and Behavior, doi: 10.1002/brb3.514 (6 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior confined under a wire pencil cup on one of the two sides of the three-chamber apparatus (Fig. 6A). Confining the target novel mouse under the wire pencil cup prevented aggressive interaction between the two unfamiliar mice while providing olfactory, visual, auditory, and tactile contact. In the no sevo group, mice spent significantly more time in the chamber with the confined novel mouse com- pared to the chamber with the novel object (an empty pencil cup; Fig. 6B; two-way ANOVA, followed by Bon- ferroni posttests, P < 0.001). This behavior was not pre- sent in which mice spent similar amount of time in the mouse chamber and the object chamber. Although the subject mouse was always placed in the center chamber at the initiation of the experiment, both no sevo and sevo groups showed the least interest in the center chamber compared to the two side chambers (Fig. 6B; two-way ANOVA, followed by Bonferroni posttests, P < 0.001). While in the specific chambers, we made similar observations on the time that the no sevo versus sevo mouse spent interacting with the novel mouse or the novel object, such as nose poking or sniffing. The mice from the no-sevo–treated group had significantly more interest in interacting with the novel mouse rather than the object, while the sevo-treated two-way group did not show a preference (Fig. 6C; followed by Bonferroni posttests, P < 0.001). ANOVA, Combining data from this experiment and reciprocal social interaction, we demonstrated that early-life sevo treatment impacts social interaction later on in life. for the sevo-treated group, Communication Olfactory Olfactory cues are considered to be important for rodent choice, mother–infant communication such as mate bonding, aggressive interaction, territory recognition, and social bonding (Harrington 1976; Clutton-Brock 1989; Ferguson et al. 2001; Broad et al. 2006; Stowers et al. 2013). Since the effect of early-life general anesthetic exposure on communication is unclear, we examined this behavior by the olfactory habituation/dishabituation para- digm (Crawley et al. 2007). Figure 4. Neonatal sevo-treated mice showed impairment in learning and memory during adulthood. (A) A schematic layout of the novel object recognition task that was used to examine the learning and memory behavior in mice. (B) During day 1—familiarization, both no sevo and sevo groups spent similar amounts of time exploring the two identical objects. No preference for a specific object was detected. A statistical analysis, P > 0.05 for two-way ANOVA was used for treatment, object, and interaction between treatment and object. (C) During day 2—testing, while the no-sevo–treated group spent significantly more time exploring the novel object, the sevo-treated group did not show an increased interest. Two-way ANOVA, followed by Bonferroni posttest were used for statistical analysis, F(1, 36) = 3.6, P > 0.05 for treatment; F(1, 36) = 10.4, P < 0.01 for object; F(1, 36) = 3.6, P > 0.05 for interaction between treatment and object. Asterisk (**) denotes P < 0.01 for exploration time between the two different objects in the no sevo group (N = 11 for no sevo; N = 9 for sevo). Mice were presented with three different nonsocial odors and two different social odors on cotton swabs. Both the sevo- and no-sevo–treated groups were able to habituate to the same odor when it was presented three consecutive times. This indicated by a significant decrease in time spent sniffing the cotton swabs of the same odor from the first to the third presentation (Fig. 7; repeated measure two-way ANOVA, P < 0.0001 for time spent sniffing cotton swabs from the first to the third is paradigm (Nadler et al. 2004; Silverman et al. 2010). In this experimental setup, the subject mouse initiated the social approach, while the target novel mouse was ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (7 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior Figure 5. Neonatal sevo-treated mice had a deficiency in social interaction behaviors as shown by reciprocal social interaction. (A) The sevo-treated mice showed significantly less push–crawl and following toward a novel mouse of the same sex and similar age compared to the no-sevo– treated mice. (B–D) During the 10 min of the reciprocal social interaction paradigm, the two groups of mice did not display a difference in arena exploration, self- grooming, or total time being mobile in the cage. Unpaired t-test with Welch’s correction was used for statistical calculation. Asterisk (*) denotes P < 0.05 (N = 18 for no sevo; N = 17 for sevo). (A) (B) (C) Figure 6. Neonatal sevo-treated mice had a deficiency in social interaction behaviors as shown by three-chamber social interaction. (A) A three- chamber apparatus was used to examine social interaction as shown in the photograph. The apparatus is divided into an object chamber (left), a center chamber (center), and a novel mouse chamber (right). The doors on both the left and the right side of the center chamber are opened to allow the subject mouse to travel freely in between all three chambers. (B) The no sevo group spent significantly more time in the novel target mouse chamber compared to the object chamber, while the sevo group showed no such preference. Both groups of mice showed the least preference for the center chamber in which there was no novel target mouse or object present. Two-way ANOVA, followed by Bonferroni posttest were used for statistical analysis, F(1, 81) = 0, P > 0.05 for treatment; F(2, 81) = 46.3, P < 0.0001 for chamber; F(2, 81) = 2.9, P > 0.05 for interaction between chamber and treatment. Asterisk (***) denotes P < 0.001 for time in mouse versus object chamber for the no sevo group; P < 0.001 for time in mouse versus center and object versus center chamber for both the no sevo and the sevo groups. (C) A similar observation was made for the time the mice spent interacting with the novel target mouse or the novel object (sniffing and nose poking). The no-sevo– treated mice spent significantly more time interacting with the novel target mouse than the novel object. Such an observation was not present in the sevo-treated group. Two-way ANOVA, followed by Bonferroni posttest were used for statistical analysis, F(1, 53) = 1.3, P > 0.05 for treatment; F(1, 53) = 14.6, P < 0.001 for subject/object; F(1, 53) = 1.8, P > 0.05 for interaction between treatment and subject/object. Asterisk (***) denotes P < 0.001 for time spent interacting with subject/object for the no sevo group (N = 16 for no sevo; N = 13 for sevo). Brain and Behavior, doi: 10.1002/brb3.514 (8 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior dishabituation in nonsocial odors, we noticed a difference in their behavior toward the social odors. The sevo-trea- ted mice showed significantly less interest in sniffing com- pared to no-sevo–treated mice when novel mouse 2 odors were presented (repeated measure two-way ANOVA, P = 0.05 for treatment). These data further validate a deficiency in social interaction behavior in P7 sevo-treated mice, an observation that has been recapitulated in two other behavioral paradigms in this current study: recipro- cal social and three-chamber social interaction. Discussion In the United States, children under the age of 4 requir- ing single-episode exposure have the highest prevalence compared to two or more exposures (Wilder et al. 2009). Therefore, the effect of early-life single-episode anesthetic exposure on the long- term functional consequence of brain development is par- ticularly important. Our goal for this study is to capture this effect in our mouse-model system using a clinically relevant anesthetic concentration and duration such that we can apply the results to better understand the risks in children. The major findings in this study are that P7 sevo-exposed mice had impairments in cognition and social interaction behaviors later on in life. surgery-related anesthetic Figure 7. Both neonatal no-sevo- and sevo-treated mice showed no impairment olfactory habituation/dishabituation. Mice were able to habituate to the same scent when presented three consecutive times. This was shown by a significant decrease in the time spent sniffing from the first to the last presentation of the same scent. Repeated measure two-way ANOVA resulted in F(2, 66) = 40, P < 0.0001 for almond; F(2, 66) = 40, P < 0.0001 for orange; and F(2, 66) = 40, P < 0.0001 for social 1 and F(2, 66) = 5, P < 0.01 for social 2. There was no treatment difference on nonsocial and social 1 odor habituation. These mice were also able to dishabituate from old scents when new scents were presented. This was shown by a significant increase in every transition between the last presentation of the old scent to the first presentation of the new scent. A two-way ANOVA resulted in F(1, 66) = 31, P < 0.0001 for transition from water to almond; F(1, 66) = 20, P < 0.0001 for transition from almond to orange; F(1, 66) = 127, P < 0.0001 for transition from orange to social 1; and F(1, 66) = 14, P < 0.001 for transition from social 1 to social 2. There was no treatment difference on odor dishabituation. However, sevo-treated mice were observed to have a social interaction abnormality in this paradigm. There was a treatment difference on in which a repeated measure two-way social 2 odor habituation, ANOVA resulted in F(1, 66) = 4, P = 0.05 for treatment. Asterisk (*) denotes P = 0.05 for treatment effect on social 2 odors: mouse 2-1, 2-2, and 2-3 (N = 18 for no sevo; N = 17 for sevo). in communication behavior based on F(2, 66) = 30, P < 0.0001 for water; It has been more than a decade since the first study in rodents demonstrated anesthetic neurotoxicity in the developing brain, resulting in impairment in cognitive function later on in life (Jevtovic-Todorovic et al. 2003). However, the effects of single-episode neonatal anesthetic exposure still face skepticism due to three major issues. First, animal studies lack a close mimic of anesthetic commonly applied to children treatment parameters among the single-episode exposure group. Second, a more comprehensive understanding of the functional conse- quences of single-episode exposure on different behavioral changes with disease implications has not been estab- lished. Third, it is difficult to dissociate general anesthesia from the underlying disease, coexisting conditions, or sur- gical procedures study focuses on addressing these critical questions and they are discussed in detail in the following sections. presentation of the odors: water, almond, orange, and social 1; repeated measure two-way ANOVA, P < 0.01 for time spent sniffing cotton swabs from the first to the third presentation of the odor, social 2). There was no treatment difference on habituation for nonsocial and social 1 odors. Presentation of new odors elicited increased interest such that both groups of mice were able to dishabituate from the old scent to the new scent. This is indicated by a significant increase in time spent sniffing the cotton swab from the last presentation of the old odor to the first presentation of the new odor (two-way ANOVA, P < 0.01–0.0001 for change of odor: transition from an old to a new odor). While both groups of mice showed similar behavior in olfactory cue habituation/ that require anesthesia. This Single-episode anesthetic treatment in neonates Skepticism toward the effect of neonatal single-episode anesthetic exposure arises mainly due to inconsistency in experimental approaches, which ranges from anesthetic type to treatment duration and concentration. We chose to study only one type of anesthetic, sevoflurane, for sev- eral reasons. Unlike some other animal studies that used ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (9 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior different anesthetic cocktails, treatment with sevo alone in this study provides a clear picture of its specific effects on the developing brain. Anesthetic cocktails that others have used to establish mouse models of neonatal anesthetic effects included nitrous oxide, which is often used as one of the induction agents, or ketamine, which is often used as procedural sedation or premedication in emergency rooms, but not as anesthetic maintenance for pediatric ambulatory surgeries (Alderson and Lerman 1994; Mellon et al. 2007; Lee et al. 2013). However, sevo is used for both anesthetic induction and maintenance, therefore it is often the main anesthetic agent during a pediatric surgical procedure (Goa et al. 1999). The effect of neonatal single-episode anesthetic exposure on different behavioral changes One of the significances of the current study is that we demonstrated impairment in cognitive behavior by adher- ing our study approach closely to clinical scenarios and is based on two cognitive tasks that involve different brain regions. By the APA test, we demonstrated that P7 sevo- treated mice had impairment in the hippocampus-depen- dent spatial memory as early as periadolescent age (P27– P28; Fig. 3). Previous functional inactivation of the dorsal spatial hippocampus blocked both the acquisition of memories and the retrieval of long-term spatial avoidance memories on the APA (Fenton et al. 1998; Cimadevilla et al. 2000; Kubik and Fenton 2005; Wesierska et al. 2005). Lesions in other brain regions such as the fornix or the anterior thalamus have also resulted in deficits in long-term spatial memory (Aggleton et al. 1996); however, region-specific tasks are needed to suggest their vulnerabil- ity to the effects of sevo during neonatal period. Since sevo targets receptors such as GABAA, glycine, and nicotinic acetylcholine that are ubiquitously expressed throughout the central nervous system (CNS) (Campagna et al. 2003; Rudolph and Antkowiak 2004), we wondered what other brain regions might be involved in neonatal sevo-induced cognitive deficits. To approach this question, we examined the mice on a different cognition task, NOR (Fig. 4). This task was chosen specifically because unlike the APA, which is hippocampus-dependent, this task examines recognition memory formation and is associated with the cortex, espe- cially the medial temporal lobe and the thalamus (Brown and Aggleton 2001; Norman and Eacott 2004; Aggleton et al. 2011; Warburton and Brown 2015). We speculate that neonatal sevo-induced cognitive impairment is associ- ated with these brain regions, but would require future work at the anatomical, morphological, and electrophysi- ology level to support this. To translate animal data and apply it to understand the clinical implications of general anesthesia, it is critical to adhere to treatment parameters commonly used among young children. Several of the most frequently performed procedures among children under the age of 4 are tonsil- lectomy, circumcision, hernia repair, and myringotomy with ear tube (Rabbitts et al. 2010). Children undergoing these types of surgeries are typically among the single-epi- sode anesthetic exposure group. The average duration of these types of surgeries is under 1 h and general anesthe- sia is most frequently used. However, among P7 rodent studies, exposure to anesthetics ranged from 4 to 6 h et al. 2008; (Jevtovic-Todorovic Loepke et al. 2009; Satomoto et al. 2009; Stratmann et al. 2009; Liang et al. 2010; Lee et al. 2014a,b). Longer expo- sure times ranging from 5 to 24 h were examined in monkeys (Zou et al. 2009, 2011; Brambrink et al. 2010; Paule et al. 2011). This is a 4- to 24-fold increase in treat- ment duration compared to pediatric ambulatory surg- eries and is not a realistic prediction for children among the single-episode exposure group. et al. 2003; Sanders Our study approach consisted of 2 h of sevo treatment (Fig. 1). We did not reduce exposure to 1 h, but recog- nize that further reducing the duration would be a closer mimic to the common clinical surgeries among young children. Nevertheless, our approach is already the short- est duration currently used in animal studies, as we are unaware of any animal study with <2 h exposure dura- tion. While others have used a range of 1–4% sevo on P7 rodents (Satomoto et al. 2009; Liang et al. 2010; Feng et al. 2012; Kato et al. 2013; Ramage et al. 2013; Shen et al. 2013b; Amrock et al. 2015), we used an average dosage of 2.38% of sevo. This concentration was less than the MAC for P7 mice, but was sufficient to keep the mice immobilized/unconscious throughout the duration of the treatment (Fig. 1). This further illustrates the deleterious effects of early-life sevo, resulting in behavioral changes later on in life. Future works on fine-tuning procedural approaches in order to establish the best rodent model for translational research are still necessary. Another significance of the current study is our investi- gation of the effects of neonatal sevo exposure on the development of neuropsychiatric-like behavioral changes. Perturbation of the developing brain due to environmen- tal insults is associated with numerous neurodevelopmen- tal disorders. The exposure of human fetuses or neonatal rodents is paradoxically linked to changes in emotional behavior or the development of depression/anxiety later on in life (Ansorge et al. 2004; Hanley et al. 2013). Alcohol exposure during gestation is associated with a wide range of neurobehavioral disorders, including mood, cognition, and social interaction changes (Streissguth et al. 2004). Aside from toxins and drugs, early-life abuse and neglect has been demonstrated to increase susceptibility to depression, schizophrenia, and to antidepressants Brain and Behavior, doi: 10.1002/brb3.514 (10 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior accompany surgery-related anesthesia. Many studies used tail clamping of animals to establish the required MAC of anesthetics. Such approaches mimic clinical surgical pro- cedures and are good animal models used to understand surgical-related anesthesia. However, to understand the effect of anesthesia alone, we need to completely dissoci- ate anesthesia from the act of surgery. Previously, two groups conducted learning and memory behavioral tests on neonatal sevo-treated rats without tail clamping (Shih et al. 2012; Stratmann et al. 2014). However, rats in both groups were treated for 4 h with sevo ranging from 2.1% to 5.3%. Long treatment duration indicates potential resulted in physiologically decreased survival rates from 92% to 67% between the 2 and 4 h (Shih et al. 2012). The present study demon- strated for the first time a single-episode, 2-h treatment by sevo alone during the neonatal period impairs both social interaction and cognition. anxiety-related disorders (Batten et al. 2004; Phillips et al. 2005; Read and Hammersley 2005; Champagne and Cur- ley 2009). Anesthetic exposure during neonatal surgical treatment is also an environmental insult to the develop- ing brain. Therefore, we used a comprehensive approach by including social interaction (Figs. 5, 6), communica- tion (Fig. 7), and repetitive behavior (Data S1) to better understand the neurodevelopmental changes of these mice. Among these behaviors, social interaction impair- ment associated with neonatal sevo treatment has been reported previously by another group (Satomoto et al. 2009). Using a caged social target in an open field appa- ratus, the group demonstrated that the no-sevo–treated control group interacted significantly more with the social target compared to the sevo-treated group. The novelty of the current study is, not only did we observed a deficit in social behavior in three different paradigms, reciprocal social interaction, and olfactory habituation/dishabituation (Figs. 5–7); our study approach, compared to Satomoto et al., consisted of a threefold reduced treatment duration (2 hr, Lin et al., vs. 6 hr, Satomoto et al.) and a lower sevo dosage (2.38% sevo, Lin et al., vs. 3% sevo, Satomoto et al.). intolerable toxicity; this interaction, three-chamber social Concluding Remarks We took the top-down approach to study the effects of neonatal exposure to sevo by incorporating a battery of behavior paradigms. Our group showed for the first time that a single-episode, 2-h treatment of 2.3% sevo during the neonatal period impairs both social interaction and cognition later on in life. This study provides insight into the effects that clinically relevant neonatal anesthesia expo- sure have on the long-term functional changes in the brain. With this information, we will then be able investigate the associated changes in electrophysiology, morphology, sig- nal pathways, and molecular mechanisms. We are hopeful that our cumulative understanding will result in future therapeutic targets that may reverse the deleterious effects of early-life anesthetic exposure on the developing brain. Changes in social behavior could arise from an imbal- ance in excitatory/inhibitory neurotransmission, which has been shown in both mouse models of autism (Chao et al. 2010; Auerbach et al. 2011; Peca et al. 2011; Penagarikano et al. 2011; Han et al. 2012) and by optogenetic manipula- tion (Yizhar et al. 2011). It is temping to hypothesize that sevo’s activation of GABAA receptors in the developing brain may contribute to this imbalance. GABA exerts exci- tatory signaling in neurons during early development and then undergoes a switch to inhibition (Ben-Ari et al. 2007). In rodents, the GABA switch extends over the entire second postnatal week and is completed in the third extruder K+/ week. Developmental expression of the Cl cotransporter, KCC2 is pivotal for the change from Cl depolarizing to hyperpolarizing GABAA-mediated action (Ben-Ari et al. 2007). Exposure to sevo at P7 is concurrent with GABA’s excitatory/inhibitory switch and the expres- sion of KCC2. Whether excess activation of the GABAA receptor by sevo during this critical developmental period has an effect on the expression of KCC2, is unknown. Future investigation on sevo’s interference with the nor- mal developmental excitatory/inhibitory switch would provide insight into the mechanisms underlying the observed functional changes of the brain. (cid:3) (cid:3) Acknowledgments We are thankful for the generous funds to carry out this research that were provided by the Anesthesiology Department through the Brooklyn Anesthesia Research Division of the University Physicians of Brooklyn, Brook- lyn, New York. Conflict of Interest None declared. Dissociating general anesthesia from surgery References Aggleton, J. P., P. R. Hunt, S. Nagle, and N. Neave. 1996. The effects of selective lesions within the anterior thalamic nuclei on spatial memory in the rat. Behav. Brain Res. 81:189–198. Animal models provide an ideal system to dissociate the that underlying diseases and coexisting conditions ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (11 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior autism-like stereotypies and Rett syndrome phenotypes. Nature 468:263–269. Aggleton, J. P., J. R. Dumont, and E. C. Warburton. 2011. Unraveling the contributions of the diencephalon to recognition memory: a review. Learn. Mem. 18:384–400. Alderson, P. J., and J. Lerman. 1994. Oral premedication for Cimadevilla, J. M., A. A. Fenton, and J. Bures. 2000. Functional inactivation of dorsal hippocampus impairs active place avoidance in rats. Neurosci. Lett. 285:53–56. Clutton-Brock, T. H. 1989. Mammalian mating systems. Proc. paediatric ambulatory anaesthesia: a comparison of midazolam and ketamine. Can. J. Anaesth. 41:221–226. R. Soc. Lond. B Biol. Sci. 236:339–372. Amrock, L. G., M. L. Starner, K. L. Murphy, and M. G. Baxter. 2015. Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure. Anesthesiology 122:87–95. Costarino, A. T. Jr, and J. J. Downes. 2005. Pediatric anesthesia historical perspective. Anesthesiol. Clin. North America 23:573–595, vii. Ansorge, M. S., M. Zhou, A. Lira, R. Hen, and J. A. Gingrich. 2004. Early-life blockade of the 5-HT transporter alters emotional behavior in adult mice. Science 306:879–881. Crawley, J. N. 1985. Exploratory behavior models of anxiety in mice. Neurosci. Biobehav. Rev. 9:37–44. Crawley, J. N.. 2007. What’s wrong with my mouse?: Auerbach, B. D., E. K. Osterweil, and M. F. Bear. 2011. behavioral phenotyping of transgenic and knockout mice. Wiley-Interscience/John Wiley & Sons, Hoboken, NJ. Crawley, J. N., T. Chen, A. Puri, R. Washburn, T. L. Sullivan, Mutations causing syndromic autism define an axis of synaptic pathophysiology. Nature 480:63–68. Bartels, M., R. R. Althoff, and D. I. Boomsma. 2009. J. M. Hill, et al. 2007. Social approach behaviors in oxytocin knockout mice: comparison of two independent lines tested in different laboratory environments. Neuropeptides 41:145–163. Davidson, A. J., N. Disma, J. C. de Graaff, D. E. Withington, Anesthesia and cognitive performance in children: no evidence for a causal relationship. Twin Res. Hum. Genet. 12:246–253. Batten, S. V., M. Aslan, P. K. Maciejewski, and C. M. Mazure. 2004. Childhood maltreatment as a risk factor for adult cardiovascular disease and depression. J. Clin. Psychiatry 65:249–254. L. Dorris, G. Bell, et al. 2016. Neurodevelopmental outcome at 2 years of age after general anaesthesia and awake- regional anaesthesia in infancy (GAS): an international multicentre, randomised controlled trial. Lancet 387:239– 250. Ben-Ari, Y., J. L. Gaiarsa, R. Tyzio, and R. Khazipov. 2007. DiMaggio, C., L. S. Sun, A. Kakavouli, M. W. Byrne, and GABA: a pioneer transmitter that excites immature neurons and generates primitive oscillations. Physiol. Rev. 87:1215– 1284. G. Li. 2009. A retrospective cohort study of the association of anesthesia and hernia repair surgery with behavioral and developmental disorders in young children. J. Neurosurg. Anesthesiol. 21:286–291. Brambrink, A. M., A. S. Evers, M. S. Avidan, N. B. Farber, D. J. Smith, X. Zhang, et al. 2010. Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology 112:834–841. DiMaggio, C., L. S. Sun, and G. Li. 2011. Early childhood exposure to anesthesia and risk of developmental and behavioral disorders in a sibling birth cohort. Anesth. Analg. 113:1143–1151. Broad, K. D., J. P. Curley, and E. B. Keverne. 2006. Mother- infant bonding and the evolution of mammalian social relationships. Philos. Trans. R. Soc. Lond. B Biol. Sci. 361:2199–2214. Feng, X., J. J. Liu, X. Zhou, F. H. Song, X. Y. Yang, X. S. Chen, et al. 2012. Single sevoflurane exposure decreases neuronal nitric oxide synthase levels in the hippocampus of developing rats. Br. J. Anaesth. 109:225–233. Fenton, A. A., M. Wesierska, Y. Kaminsky, and J. Bures. 1998. Brown, M. W., and J. P. Aggleton. 2001. Recognition memory: what are the roles of the perirhinal cortex and hippocampus? Nat. Rev. Neurosci. 2:51–61. Both here and there: simultaneous expression of autonomous spatial memories in rats. Proc. Natl Acad. Sci. USA 95:11493–11498. Burghardt, N. S., E. H. Park, R. Hen, and A. A. Fenton. 2012. Adult-born hippocampal neurons promote cognitive flexibility in mice. Hippocampus 22:1795–1808. Ferguson, J. N., J. M. Aldag, T. R. Insel, and L. J. Young. Campagna, J. A., K. W. Miller, and S. A. Forman. 2003. 2001. Oxytocin in the medial amygdala is essential for social recognition in the mouse. J. Neurosci. 21:8278–8285. Flick, R. P., S. K. Katusic, R. C. Colligan, R. T. Wilder, R. G. Voigt, M. D. Olson, et al. 2011. Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics 128:e1053–e1061. Fredriksson, A., E. Ponten, T. Gordh, and P. Eriksson. 2007. Neonatal exposure to a combination of N-methyl-D-aspartate and gamma-aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107:427–436. 2001. Oxytocin in the medial amygdala is essential for social recognition in the mouse. J. Neurosci. 21:8278–8285. Flick, R. P., S. K. Katusic, R. C. Colligan, R. T. Wilder, R. G. Voigt, M. D. Olson, et al. 2011. Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics 128:e1053–e1061. Fredriksson, A., E. Ponten, T. Gordh, and P. Eriksson. 2007. Neonatal exposure to a combination of N-methyl-D-aspartate and gamma-aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107:427–436. Mechanisms of actions of inhaled anesthetics. N. Engl. J. Med. 348:2110–2124. 2001. Oxytocin in the medial amygdala is essential for social recognition in the mouse. J. Neurosci. 21:8278–8285. Flick, R. P., S. K. Katusic, R. C. Colligan, R. T. Wilder, R. G. Voigt, M. D. Olson, et al. 2011. Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics 128:e1053–e1061. Fredriksson, A., E. Ponten, T. Gordh, and P. Eriksson. 2007. Neonatal exposure to a combination of N-methyl-D-aspartate and gamma-aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107:427–436. Cath, D. C., D. S. van Grootheest, G. Willemsen, P. van Oppen, and D. I. Boomsma. 2008. Environmental factors in obsessive-compulsive behavior: evidence from discordant and concordant monozygotic twins. Behav. Genet. 38:108–120. Brain and Behavior, doi: 10.1002/brb3.514 (12 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior Goa, K. L., S. Noble, and C. M. Spencer. 1999. Sevoflurane in paediatric anaesthesia: a review. Paediatr. Drugs 1:127–153. Han, S., C. Tai, R. E. Westenbroek, F. H. Yu, C. S. Cheah, G. B. Potter, et al. 2012. Autistic-like behaviour in Scn1a+/- mice and rescue by enhanced GABA-mediated neurotransmission. Nature 489:385–390. with infection during pregnancy and risk of autism spectrum disorders. Brain Behav. Immun. 44:100–105. Leger, M., A. Quiedeville, V. Bouet, B. Haelewyn, M. Boulouard, P. Schumann-Bard, et al. 2013. Object recognition test in mice. Nat. Protoc. 8:2531–2537. Liang, G., C. Ward, J. Peng, Y. Zhao, B. Huang, and H. Wei. 2010. Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 112:1325–1334. Hanley, G. E., U. Brain, and T. F. Oberlander. 2013. Infant developmental outcomes following prenatal exposure to antidepressants, and maternal depressed mood and positive affect. Early Hum. Dev. 89:519–524. Loepke, A. W., and S. G. Soriano. 2008. An assessment of the effects of general anesthetics on developing brain structure and neurocognitive function. Anesth. Analg. 106:1681–1707. Hansen, T. G., J. K. Pedersen, S. W. Henneberg, D. A. Pedersen, J. C. Murray, N. S. Morton, et al. 2011. Academic performance in adolescence after inguinal hernia repair in infancy: a nationwide cohort study. Anesthesiology 114:1076–1085. Loepke, A. W., G. K. Istaphanous, J. J. 3rd McAuliffe, L. Miles, E. A. Hughes, J. C. McCann, et al. 2009. The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and memory. Anesth. Analg. 108:90–104. Hansen, T. G., J. K. Pedersen, S. W. Henneberg, N. S. Morton, and K. Christensen. 2013. Educational outcome in adolescence following pyloric stenosis repair before 3 months of age: a nationwide cohort study. Pediatr. Anaesth. 23:883–890. Mai, C. L., and C. J. Cote. 2012. A history of pediatric anesthesia: a tale of pioneers and equipment. Paediatr Anaesth. 22:511–520. Harrington, J. E. 1976. Recognition fo territorial boundaries by olfactory cues in mice (Mus musculus L.). Z. Tierpsychol. 41:295–306. Mellon, R. D., A. F. Simone, and B. A. Rappaport. 2007. Use of anesthetic agents in neonates and young children. Anesth. Analg. 104:509–520. Murphy, K. L., and M. G. Baxter. 2013. Long-term effects of neonatal single or multiple isoflurane exposures on spatial memory in rats. Front. Neurol. 4:87. Jevtovic-Todorovic, V., R. E. Hartman, Y. Izumi, N. D. Benshoff, K. Dikranian, C. F. Zorumski, et al. 2003. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J. Neurosci. 23:876–882. Nadler, J. J., S. S. Moy, G. Dold, D. Trang, N. Simmons, A. Perez, et al. 2004. Automated apparatus for quantitation of social approach behaviors in mice. Genes Brain Behav. 3:303–314. Kalkman, C. J., L. Peelen, K. G. Moons, M. Veenhuizen, M. Bruens, G. Sinnema, et al. 2009. Behavior and development in children and age at the time of first anesthetic exposure. Anesthesiology 110:805–812. Norman, G., and M. J. Eacott. 2004. Impaired object recognition with increasing levels of feature ambiguity in rats with perirhinal cortex lesions. Behav. Brain Res. 148:79–91. Paule, M. G., M. Li, R. R. Allen, F. Liu, X. Zou, C. Hotchkiss, et al. 2011. Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys. Neurotoxicol. Teratol. 33:220–230. Kato, R., K. Tachibana, N. Nishimoto, T. Hashimoto, Y. Uchida, R. Ito, et al. 2013. Neonatal exposure to sevoflurane causes significant suppression of hippocampal long-term potentiation in postgrowth rats. Anesth. Analg. 117:1429– 1435. Kubik, S., and A. A. Fenton. 2005. Behavioral evidence that Peca, J., C. Feliciano, J. T. Ting, W. Wang, M. F. Wells, T. N. Venkatraman, et al. 2011. Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature 472:437–442. segregation and representation are dissociable hippocampal functions. J. Neurosci. 25:9205–9212. Lee, S. Y., S. L. Cheng, S. B. Ng, and S. L. Lim. 2013. Single- Penagarikano, O., B. S. Abrahams, E. I. Herman, K. D. breath vital capacity high concentration sevoflurane induction in children: with or without nitrous oxide? Br. J. Anaesth. 110:81–86. Winden, A. Gdalyahu, H. Dong, et al. 2011. Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities, and core autism-related deficits. Cell 147:235–246. Lee, B. H., J. T. Chan, O. Hazarika, L. Vutskits, and J. W. Sall. 2014a. Early exposure to volatile anesthetics impairs long- term associative learning and recognition memory. PLoS One 9:e105340. Phillips, N. K., C. L. Hammen, P. A. Brennan, J. M. Najman, and W. Bor. 2005. Early adversity and the prospective prediction of depressive and anxiety disorders in adolescents. J. Abnorm. Child Psychol. 33:13–24. Lee, B. H., J. T. Chan, E. Kraeva, K. Peterson, and J. W. Sall. 2014b. Isoflurane exposure in newborn rats induces long- term cognitive dysfunction in males but not females. Neuropharmacology 83:9–17. Pichot, P. 1986. DSM-III: the 3d edition of the Diagnostic and Statistical Manual of Mental Disorders from the American Psychiatric Association. Rev. Neurol. (Paris) 142:489–499. Lee, B. K., C. Magnusson, R. M. Gardner, A. Blomstrom, C. J. Newschaffer, I. Burstyn, et al. 2015. Maternal hospitalization ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc. Brain and Behavior, doi: 10.1002/brb3.514 (13 of 14) 21579032, 2016, 9, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.514 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License D. Lin et al. Early-Life Sevoflurane Exposure on Behavior Stratmann, G. 2011. Review article: neurotoxicity of anesthetic drugs in the developing brain. Anesth. Analg. 113:1170– 1179. Rabbitts, J. A., C. B. Groenewald, J. P. Moriarty, and R. Flick. 2010. Epidemiology of ambulatory anesthesia for children in the United States: 2006 and 1996. Anesth. Analg. 111:1011–1015. Stratmann, G., J. W. Sall, L. D. May, J. S. Bell, K. R. Ramage, T. M., F. L. Chang, J. Shih, R. S. Alvi, G. R. Quitoriano, V. Rau, et al. 2013. Distinct long-term neurocognitive outcomes after equipotent sevoflurane or isoflurane anaesthesia in immature rats. Br. J. Anaesth. 110 (Suppl 1):i39–i46. Magnusson, V. Rau, et al. 2009. Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology 110:834– 848. Stratmann, G., J. Lee, J. W. Sall, B. H. Lee, R. S. Alvi, J. Shih, et al. 2014. Effect of general anesthesia in infancy on long- term recognition memory in humans and rats. Neuropsychopharmacology 39:2275–2287. Read, J., and P. Hammersley. 2005. Child sexual abuse and schizophrenia. Br. J. Psychiatry 186:76; author reply 76. Roullet, F. I., J. K. Lai, and J. A. Foster. 2013. In utero exposure to valproic acid and autism–a current review of clinical and animal studies. Neurotoxicol. Teratol. 36:47–56. Rudolph, U., and B. Antkowiak. 2004. Molecular and neuronal Streissguth, A. P., F. L. Bookstein, H. M. Barr, P. D. Sampson, K. O’Malley, and J. K. Young. 2004. Risk factors for adverse life outcomes in fetal alcohol syndrome and fetal alcohol effects. J. Dev. Behav. Pediatr. 25:228–238. substrates for general anaesthetics. Nat. Rev. Neurosci. 5:709–720. Sun, L.. 2010. Early childhood general anaesthesia exposure Sakai, E. M., L. A. Connolly, and J. A. Klauck. 2005. and neurocognitive development. Br. J. Anaesth. 105(Suppl 1):i61–i68. Inhalation anesthesiology and volatile liquid anesthetics: focus on isoflurane, desflurane, and sevoflurane. Pharmacotherapy 25:1773–1788. Wang, S. Q., F. Fang, Z. G. Xue, J. Cang, and X. G. Zhang. 2013. Neonatal sevoflurane anesthesia induces long-term memory impairment and decreases hippocampal PSD-95 expression without neuronal loss. Eur. Rev. Med. Pharmacol. Sci. 17:941–950. Sanders, R. D., J. Xu, Y. Shu, A. Fidalgo, D. Ma, and M. Maze. 2008. General anesthetics induce apoptotic neurodegeneration in the neonatal rat spinal cord. Anesth. Analg. 106:1708–1711. Satomoto, M., Y. Satoh, K. Terui, H. Miyao, K. Takishima, M. Ito, et al. 2009. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 110:628–637. Warburton, E. C., and M. W. Brown. 2015. Neural circuitry for rat recognition memory. Behav. Brain Res. 285:131–139. Wesierska, M., C. Dockery, and A. A. Fenton. 2005. Beyond memory, navigation, and inhibition: behavioral evidence for hippocampus-dependent cognitive coordination in the rat. J. Neurosci. 25:2413–2419. Shen, X., Y. Dong, Z. Xu, H. Wang, C. Miao, S. G. Soriano, et al. 2013a. Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 118:502–515. Wilder, R. T., R. P. Flick, J. Sprung, S. K. Katusic, W. J. Barbaresi, C. Mickelson, et al. 2009. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 110:796–804. Shen, X., Y. Liu, S. Xu, Q. Zhao, X. Guo, R. Shen, et al. 2013b. Early life exposure to sevoflurane impairs adulthood spatial memory in the rat. Neurotoxicology 39:45–56. Shih, J., L. D. May, H. E. Gonzalez, E. W. Lee, R. S. Alvi, J. W. Sall, et al. 2012. Delayed environmental enrichment reverses sevoflurane-induced memory impairment in rats. Anesthesiology 116:586–602. Yizhar, O., L. E. Fenno, M. Prigge, F. Schneider, T. J. Davidson, D. J. O’Shea, et al. 2011. Neocortical excitation/ inhibition balance in information processing and social dysfunction. Nature 477:171–178. Zou, X., T. A. Patterson, R. L. Divine, N. Sadovova, X. Zhang, J. P. Hanig, et al. 2009. Prolonged exposure to ketamine increases neurodegeneration in the developing monkey brain. Int. J. Dev. Neurosci. 27:727–731. Silverman, J. L., M. Yang, C. Lord, and J. N. Crawley. 2010. Behavioural phenotyping assays for mouse models of autism. Nat. Rev. Neurosci. 11:490–502. Slikker, W. Jr, X. Zou, C. E. Hotchkiss, R. L. Divine, N. Zou, X., F. Liu, X. Zhang, T. A. Patterson, R. Callicott, S. Liu, et al. 2011. Inhalation anesthetic-induced neuronal damage in the developing rhesus monkey. Neurotoxicol. Teratol. 33:592–597. Sadovova, N. C. Twaddle, et al. 2007. Ketamine-induced neuronal cell death in the perinatal rhesus monkey. Toxicol. Sci. 98:145–158. Sprung, J., R. P. Flick, R. T. Wilder, S. K. Katusic, T. L. Pike, M. Dingli, et al. 2009. Anesthesia for cesarean delivery and learning disabilities in a population-based birth cohort. Anesthesiology 111:302–310. Supporting Information Additional supporting information may be found online in the supporting information tab for this article: Stowers, L., P. Cameron, and J. A. Keller. 2013. Ominous odors: olfactory control of instinctive fear and aggression in mice. Curr. Opin. Neurobiol. 23:339–345. Data S1. Repetitive behavior. Brain and Behavior, doi: 10.1002/brb3.514 (14 of 14) ª 2016 The Authors. Brain and Behavior published by Wiley Periodicals, Inc.",mice,"['The volatile anesthetic, sevoflurane (sevo) was administered to C57BL6 postnatal day 7 (P7) mice in a 40% oxygen and 60% nitrogen gas mixture.']",postnatal day 7,"['The volatile anesthetic, sevoflurane (sevo) was administered to C57BL6 postnatal day 7 (P7) mice in a 40% oxygen and 60% nitrogen gas mixture.']",Y,"['Using the active place avoidance (APA) test and the novel object recognition (NOR) test, we demonstrated that P7 sevo-treated mice showed a deficit in learning and memory both during periadolescence and adulthood.', 'We then employed a battery of neuropsychiatric-like behavioral tests to examine social interaction, communication, and repetitive behavior.']",sevoflurane,"['The volatile anesthetic, sevoflurane (sevo) was administered to C57BL6 postnatal day 7 (P7) mice in a 40% oxygen and 60% nitrogen gas mixture.']",none,[],c57bl/6,"['The volatile anesthetic, sevoflurane (sevo) was administered to C57BL6 postnatal day 7 (P7) mice in a 40% oxygen and 60% nitrogen gas mixture.']",This study addresses the unclear functional consequences of neonatal anesthetic exposure on the developing brain in a comprehensive and clinically relevant manner.,"['Although numerous studies have used animals to model the effects of neonatal anesthetics on behavioral changes later on in life, our understanding of the functional consequences to the developing brain in a comprehensive and clinically relevant manner is unclear.']",The study uses a clinically relevant single-episode sevo application during the neonatal period to elucidate neurodevelopmental behavioral changes.,"['This study elucidated the effects of a clinically relevant single-episode sevo application, given during the neonatal period, on neurodevelopmental behavioral changes later on in life.']","The article argues that early-life single-episode sevoflurane exposure impairs cognition and social behavior later in life, highlighting the importance of understanding anesthetic effects on the developing brain.","['Our study established that single-episode, 2-h sevo treatment during early life impairs cognition later on in life.', 'With this approach, we also observed neuropsychiatric-like behavior changes such as social interaction deficits in the sevo-treated mice.']",None,[],None,[],True,True,True,True,True,True,10.1002/brb3.514 10.1097/ALN.0000000000002904,263.0,Li,2019,mice,postnatal day 7,Y,isoflurane,none,c57bl/6,"A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t HHS Public Access Author manuscript Anesthesiology. Author manuscript; available in PMC 2020 November 01. Published in final edited form as: Anesthesiology. 2019 November ; 131(5): 1077–1091. doi:10.1097/ALN.0000000000002904. Early Postnatal Exposure to Isoflurane Disrupts Oligodendrocyte Development and Myelin Formation in the Mouse Hippocampus. Qun Li, Ph.D., Reilley P. Mathena, B.S., Jing Xu, M.D., O’Rukevwe N. Eregha, B.A., Jieqiong Wen, B.S., Cyrus D. Mintz, M.D., Ph.D. Department of Anesthesiology and Critical Care Medicine, Johns Hopkins School of Medicine, Baltimore, MD. Abstract Background: Early postnatal exposure to general anesthetics may interfere with brain development. We tested the hypothesis that isoflurane causes a lasting disruption in myelin development via actions on the mammalian target of rapamycin (mTOR) pathway. Methods: Mice were exposed to 1.5% isoflurane for 4 hours at postnatal day 7. The mTOR inhibitor, rapamycin, or the pro-myelination drug, clemastine, were administered on days 21-35. Mice underwent Y-maze and novel object position recognition tests (n=12 per group) on days 56-62 or were sacrificed for either immunohistochemistry (n=8 per group), Western blotting (n=8 per group) at day 35 or were sacrificed for electron microscopy at day 63. Results: Isoflurane exposure increased the percentage of pS6+ oligodendrocytes in fimbria of hippocampus from 22±7% to 51±6% (p<0.0001). In Y-maze testing, isoflurane-exposed mice did not discriminate normally between old and novel arms, spending equal time in both (50±5% old: 50±5% novel, p=0.999), indicating impaired spatial learning. Treatment with clemastine restored discrimination, as evidenced by increased time spent in the novel arm (43±6% old:57±6% novel, p<0.001) and rapamycin had a similar effect (44±8% old:56±8% novel; p<0.001). Electron microscopy shows a reduction in myelin thickness as measured by an increase in g-ratio from 0.76±0.06 for controls to 0.79±0.06 for the isoflurane group (p<0.001). Isoflurane exposure followed by rapamycin treatment resulted in a g-ratio (0.75±0.05) that did not differ significantly from the control value (p=0.426). Immunohistochemistry and Western blotting show that isoflurane acts on oligodendrocyte precursor cells to inhibit both proliferation and differentiation. DNA methylation and expression of a DNA methyl transferase 1 is reduced in oligodendrocyte precursor cells after isoflurane treatment. Effects of isoflurane on oligodendrocyte precursor cells were abolished by treatment with rapamycin. Corresponding Author: Cyrus D. Mintz, M.D., Ph.D., Johns Hopkins University School of Medicine Department of Anesthesiology and Critical Care Medicine, 720 Rutland Ave., Ross 370, Baltimore, MD 21205, 917-733-0422, cmintz2@jhmi.edu. Clinical Trial Number and Registry URL: Not applicable. Prior Presentations: Title: Early Postnatal Exposure to General Anesthesia Disrupts Oligodendrocyte Development and Myelin Formation in Hippocampus. Presentation 1: The Sixth Pediatric Anesthesia and NeuroDevelopment Assessment (PANDA) Symposium: Moderated Poster Discussion. Saturday, 2:00-3:00 pm, April 14th, 2018. New York. Presentation 2: The Forty Eighth Society for Neuroscience (SfN) Annual Meeting. Poster Presentation (#204.15). Sunday 1:00-5:00 pm. November 4, 2018. San Diego, CA Conflicts of Interest: The authors declare no competing interests. A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Conclusions: Early postnatal exposure to isoflurane in mice causes lasting disruptions of oligodendrocyte development in the hippocampus via actions on the mTOR pathway. Summary Statement: Early (postnatal day 7) isoflurane exposure in mice disrupts oligodendrocyte development and myelin formation in hippocampal white matter via activation of mTOR and alterations of in DNA methylation levels. Introduction Modern general anesthesia allows the safe performance of several hundred million surgical procedures annually. 1 However, there is growing concern that some vulnerable categories of patients, particularly young children, geriatric patients, and individuals with underlying brain disorders, may be at risk of lasting cognitive dysfunction.2-4 While conclusive evidence of anesthetic neurotoxicity has not been established in human studies, some animal studies have shown that exposure to general anesthetics in early development cause impaired neurocognitive performance5-8 and that the peak period of behavioral and cognitive vulnerability to general anesthetics in rodents occurs in early postnatal life.9-11 Based on these studies, the U.S. Food and Drug Administration issued a warning that lengthy or repeated exposure to general anesthetics and sedative drugs from the third trimester of prenatal development through the first three years of life may cause lasting impairment in the cognitive function.12 The molecular and cellular mechanisms underlying this phenomenon remain poorly understood. Most studies investigating anesthetic neurotoxicity have focused on neuronal development. 7,13 However, brain function is also dependent on the myelin-forming oligodendrocytes, which undergo critical developmental events during the putative window of vulnerability. Myelination involves proliferation of oligodendrocyte progenitor cells, differentiation of oligodendrocyte progenitor cells into mature oligodendrocytes, and ensheathment of axons. Myelin is critical for neurotransmission in the CNS and disruptions of myelin function are associated with neurological and psychiatric disorders.14,15 In this study, we test the hypothesis that early postnatal exposure to isoflurane affects oligodendrocyte development and myelin formation in the hippocampus in an in vivo mouse model. To establish the extent to which isoflurane-induced deficits can be attributed to impaired myelination, we employed clemastine, an antimuscarinic drug approved drug for multiple sclerosis therapy, which promotes oligodendrocyte differentiation and myelination and reverses the phenotype of several murine disease models involving demylelination.16,17 Exposure to general anesthetics has been shown to impact molecular signaling pathways implicated in the dynamic maintenance of cellular homeostasis and development.13 Recently, the mammalian target of rapamycin (mTOR) signaling has emerged as a critical integrator of activity of nerve cells and synaptic inputs that in turn affect many cellular metabolic processes.18 Studies have implicated mTOR signaling in neurodevelopmental and neuropsychiatric disorders.19 We previously showed that isoflurane disrupts development of newborn hippocampal neurons and synaptic formation via activation of the mTOR pathway. 7, 20 In this study, we further investigate the role of mTOR in isoflurane-induced Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 2 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. neurotoxicity in mouse oligodendrocyte development and myelination using mTOR activity markers and rapamycin, an mTOR pathway inhibitor. We explored the effects on axon- oligodendrocyte precursor synapses, which are thought to be critical for turning oligodendrocyte development to match neuronal activity.21-23 Activity in the mTOR pathway mediates DNA methylation in neurons 24 and cancer cells,25 and it has been reported that DNA methylation is a well-recognized epigenetic modification that regulates oligodendrocyte development and is necessary for efficient myelin formation.26-28 Thus, the effect of general anesthetics and mTOR activation on DNA methylation level in oligodendrocytes has also been investigated. Materials and Methods Animal paradigm and experimental timeline. A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study. 84 (44 male and 40 female) of them were randomly selected for the rapamycin experiment and 36 (17 male and 19 female) for the clemastine experiment. Sex was not factored into research design as a biological variable. Both sexes were equally represented in all experiments. All study protocols involving mice were approved by the Animal Care and Use Committee at the Johns Hopkins University and conducted in accordance with the NIH guidelines for care and use of animals. Experimental procedures followed the modified protocols from a previously published journal.7 At postnatal day 7, animals were exposed to isoflurane or room air for 4 hours. From postnatal days 21-35, half of the isoflurane-exposed mice were injected (i.p.) bi-daily with rapamycin (n=28 per group) or fed daily with clemastine through gastric gavage (n=12 per group). The other half were injected with vehicle of rapamycin or fed with vehicle of clemastine. For the rapamycin experiment, a subset of mice from each group were sacrificed at postnatal day 35 for immunohistochemistry (n=8 per group) or Western blotting (n=8 per group). The remaining mice underwent behavioral testing for spatial learning and memory functions between postnatal days 56-62 (n=12 for each group). After behavior tests, two mice from each group were processed for electron microscopy at postnatal day 63. Only behavior tests were conducted for clemastine feeding experiment (n=12 for each group) (Fig. 1A). Isoflurane exposure. At postnatal day 7, two-thirds of the mice were evenly distributed across littermate groups and were randomly selected for isoflurane exposure. The other one-third of the mice stayed in room air as a naïve control. Volatile anesthesia exposure was accomplished using a Supera tabletop portable non-rebreathing anesthesia machine. 3% isoflurane mixed in 100% oxygen was initially delivered in a closed chamber for 3-5 min and after loss of righting reflex, animals were transferred to the specially designed plastic tubes. A heating pad (36.5ºC) was placed underneath the exposure setup. The mice were exposed to 1.5% isoflurane carried in 100% oxygen for 4 hours. A calibrated flowmeter was used to deliver oxygen at a flow rate of 5 L/min and an agent specific vaporizer was used to deliver isoflurane. During isoflurane Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 3 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. exposure, mice were monitored for change in physiological state using the non-invasive MouseOx plus instrument (STARR Life Sciences, Holliston, MA, USA). A collar clip connected to the instrument was placed on the neck and a temperature probe placed on the skin of the abdomen. Ten-minute readings with 1-hour intervals were taken. Data was collected in four time-points and averaged for each case. The skin temperature (34.1±0.8ºC), pulse distention (168.9±36.6 μm), heart rate (376.8±94.1 bpm), breath rate (77.4±35.8 brpm), and oxygen saturation (99.3±0.3%) were recorded. After the isoflurane exposure, mice were returned to their moms together with their littermates upon regaining righting reflex. All animals (100%) survived the isoflurane exposure.7 Rapamycin injection. A total of 84 mice were equally divided into three groups: 1) naïve control; 2) isoflurane exposure plus vehicle; and 3) isoflurane plus rapamycin injection. From postnatal days 21-35, half of the isoflurane-exposed mice (group 3; n=28 per group) were injected intraperitoneally with 0.2% rapamycin dissolved in vehicle solution and the other half with vehicle only (group 2; n=28 per group). Vehicle consisted of 5% Tween 80 (Sigma Aldrich, St. Louis, MO, USA), 10% polyethylene glycol 400 (Sigma-Aldrich, St. Louis, MO, USA), and 8% ethanol in saline. Mice received 100 μl rapamycin or vehicle for each injection at 48 hour intervals from postnatal days 21-35. 7 Clemastine feeding. In this experiment, 36 animals were also equally divided into three groups as above. Clemastine (Tocris Bioscience, Bristol, UK) was dissolved in DMSO (Sigma-Aldrich, St. Louis, MO, USA) at 10 mg/ml followed by further dilution in ddH2O into 1 mg/ml. From postnatal days 21-35, half of the isoflurane exposed mice (n=12 for each group) were fed clemastine (10 mg/kg) daily via gastric gavage using plastic feeding tubes (gauge 22; Instech, Plymouth Meeting, PA, USA), and the other half (n=12 for each group) were fed same volume of 10% DMSO as vehicle.16,17 Behavior tests. The novel object position recognition test and Y-maze test were performed at the last week of the survival period (postnatal days 56-62).7 Experimenters were blinded to condition when behavioral tests were carried out and quantified. 1). Novel object position recognition test: The test was assessed in a 27.5 cm × 27.5 cm × 25 cm opaque chamber. During the pre-test day (day 1), each mouse was habituated to the chamber and allowed to explore 2 identical objects (glass bottles, 2.7 cm diameter, 12 cm height, and colored paper inside) for 15 minutes. The mouse was then returned to its home cage for a retention period of 24 hours. On the test day (day 2), the mouse was reintroduced to the chamber and presented with one object that stayed in the same position (old position) while the other object was moved to a new position (novel position). A five-minute period of movement and interaction with the objects was recorded with a video camera that was mounted above the chamber and exploratory behavior was measured by a blinded observer. Exploratory behavior was defined as touching the object with snouts. The numbers of exploratory contacts with the novel object and with the old Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 4 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. object were respectively recorded, and the ratios over the total exploratory contact numbers were calculated. 2). Y-maze test: In the pre-test phase (day 1), mice explored and habituated in the start arm (no visual cue) and 1 out of 2 possible choice arms with overt visual cue (old arm) for 15 minutes. This was followed by the recognition phase (day 2) 24 hours later, in which the animals could move freely in the three arms and choose between the 2 choice arms (old arm and novel arm) after being released from the start arm. The timed trials (5 minutes) were video recorded as well as graded by an observer blinded to the conditions for exploration time in each choice arm and the percentages over total exploratory time were calculated. Immunohistochemistry. During postnatal days 30-35, 5-bromo-2’-deoxyuridine (Abcam, Cambridge, UK) was injected intraperitoneally at 50mg/kg daily in animals randomly selected from three groups (n=8 for each group). At postnatal day 35, mice were perfused with 40 ml 4% paraformaldehyde in PBS. Brains were removed and post-fixed at 4ºC overnight, followed by 30% sucrose in PBS at 4°C for 48 hours. The brains were coronally sectioned in 40 μm thickness using a freezing microtome. For each brain, 72 sections containing fimbria were collected in a 24-well tissue culture plate and they were divided into twelve wells in a rotating order (6 sections per well). Seven wells of sections were immunostained for: (1) phospho-S6 and adenomatous polyposis coli; (2) 5-bromo-2’-deoxyuridine and neural/glial antigen 2 ; (3) adenomatous polyposis coli and platelet-derived growth factor receptor alpha; (4) vesicular glutamate transporter 1 and neural/glial antigen 2; (5) myelin basic protein; (6) DNA methyltransferase 1 and Olig2 (oligodendrocyte transcription factor marker); (7) 5- methylcytosine (5-mC) and adenomatous polyposis coli. For 5-bromo-2’-deoxyuridine staining, sections were pretreated with 2N HCl to denature DNA (37°C; 45min), and with 2 × 15min borate buffer (pH 8.5) to neutralize the HCl. After 3×10min PBS washing, sections were blocked in 10% normal goat serum and 0.1% triton X-100 for 60min, followed by primary antibody incubation at 4ºC overnight. Primary antibodies used in this study were: rabbit anti-phospho-S6 (1:1,000; Cell Signaling, Boston, MA, USA), mouse anti-5- bromo-2’-deoxyuridine (1:200; Abcam, Cambridge, UK), rabbit anti-neural/glial antigen 2 (1:200; Millipore, Burlington, MA, USA), mouse anti-adenomatous polyposis coli (1:2,000; Millipore, Burlington, MA, USA), mouse anti-myelin basic protein (1:500; Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti- platelet-derived growth factor receptor alpha (1:500; Lifespan Bio, Seattle, WA, USA), mouse anti- vesicular glutamate transporter 1 (1;200; Abcam, Cambridge, UK), mouse anti-DNA methyltransferase 1 (1:100; Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti-Olig2 (1:2,000; Abcam, Cambridge, UK), and rabbit anti-5-methylcytosine (1:2,500; Abcam, Cambridge, UK). After 3×10min washes in PBS, sections were incubated with secondary antibodies for 2 hours: Alexa 488 conjugated goat anti-rabbit IgG (1:300; Invitrogen, Eugene, OR, USA) mixed with Cy3 conjugated goat anti-mouse IgG (1:600; Jackson ImmunoResearch Labs, West Grove, PA, USA), or Alexa 488-goat anti-mouse IgG (1:300; Invitrogen, Eugene, OR, USA) mixed with Cy3 conjugated goat anti-rabbit IgG (1:600; Jackson ImmunoResearch labs, West Grove, PA, USA). After 3×10min PBS washes, sections were mounted onto slides, air-dried, and cover-slipped.21 Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 5 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Cell counting and immuno-fluoresce intensity analysis in fimbria The sections were observed and imaged using a Leica 4000 confocal microscope (Wetzlar, Germany). All single- or double- immunolabeled cells within hippocampal fimbria area were counted using ImageJ with cell counter plugin (NIH, Bethesda, MD, USA). The criteria for counting mTOR active oligodendrocytes required a cell to have both phospho- S6+ (in red channel) and adenomatous polyposis coli+ (in green channel) cytoplasm and merged image of double labeled cells appeared yellow color (Fig. 1B). Proliferating oligodendrocyte progenitor cells and 5-methylcytosine+ oligodendrocytes were counted for cells that have 5-bromo-2’-deoxyuridine+ or 5-methylcytosine + nuclei and neural/glial antigen 2+ or adenomatous polyposis coli+ cytoplasm. However, both DNA methyltransferase 1 and Olig2 reactivity were seen in nuclei. Identification of excitatory axon-oligodendrocyte progenitor cell synapses involved vesicular glutamate transporter 1+ terminal boutons closely apposing on the surface of neural/glial antigen 2+ oligodendrocyte progenitor cells. For adenomatous polyposis coli and platelet-derived growth factor receptor alpha double-stained sections, almost no double-labeled cells were seen, which means these two markers label cells in different oligodendrocyte development stages without overlapping. Images containing fimbria were taken at 20x magnification in red (Cy3), green (Alexa 488), and merged channels. All single- (Cy3+ or Alexa488+) and double-labeled cells in fimbria were counted. Images were opened and initialized in ImageJ. The fimbria area was outlined using the ‘‘Freehand’’ tool. “Plugins”, “Analysis”, and ‘‘Cell Counter’’ tools were selected, and each labeled cell inside was clicked, with which each counted cell was marked preventing the same cell from being counted twice. The numbers of counted cells were automatically recorded. The ratio of a specific marker labeled oligodendrocytes (such as yellow-colored phospho-S6+/ adenomatous polyposis coli+ cells over all green adenomatous polyposis coli+ cells in Fig. 1B) was calculated. For each case, numbers from 12 fimbria images (6 sections, both sides) were averaged. There was almost no double staining for adenomatous polyposis coli and platelet-derived growth factor receptor alpha. We the used ratio of adenomatous polyposis coli+ over platelet-derived growth factor receptor alpha+ cells to evaluate the maturation of oligodendrocyte lineage cells. For axon- oligodendrocyte progenitor cells synapse, five neural/glial antigen 2 positive cells from each image (60 cells for each case) were randomly selected and photos were taken in a higher magnification (40x). Every vesicular glutamate transporter 1+ terminal boutons apposing on each selected cell were counted with imageJ and average numbers were calculated. The fluorescence intensity of myelin basic protein immunoreactivity in fimbria were also quantitatively analyzed using ImageJ. Photos of the fimbria area from immunostained sections were taken at 20x magnification. Identical photo exposure was set for all groups. The image was opened with ImageJ and outline of fimbria was drawn with “Freehand” tool. The “set measurements” was selected from the analyze menu and “integrated density” was activated. A region in lateral ventricle was selected as background. The final myelin basic protein intensity of fimbria area equals measured density minus background. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 6 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Western blotting. Eight animals from each group were quickly perfused with cold saline on day 35. From the medial aspect of the hemisphere, the hippocampus was exposed and separated from brain tissue. Fimbria located in the ventrolateral side of the hippocampus were easily identified by bright white color under dissection microscope, and then removed with fine forceps. Fimbria tissue was lysed in the lysis buffer, homogenized with a bullet bender (Next Advance, Troy, NY, USA), and centrifuged. The supernatant was taken and stored in −80°C. The next day, samples were prepared with 1:1 denaturing sample buffer (Bio-Rad, Hercules, CA, USA), boiled for 5 min, and run on 4-12% Bis-Tris Protein Gels (Invitrogen, Carlsbad, CA, USA) in running buffer (Invitrogen, Carlsbad, CA, USA) with 150 volts for about 1 hour. The proteins were transferred to nitrocellulose blotting membranes (Invitrogen, Carlsbad, CA, USA). Blots were probed with anti-neural/glial antigen 2 (1:200; Millipore, Burlington, MA, USA), anti-NK2 homeobox 2 (1:200; Abcam, Cambridge, UK), anti-myelin basic protein (1:500; Santa Cruz Biotechnology, Dallas, TX, USA), anti-DNA methyltransferase 1 (1:100; Santa Cruz Biotechnology, Dallas, TX, USA) and anti-β-actin antibodies (1:1,000; Cell Signaling Technology, Boston, MA, USA). The membranes with the primary antibodies were stored in 4°C overnight. After incubation in secondary antibodies (1:2,000; Cell Signaling Technology, Boston, MA, USA) for 1 hour, blots were visualized using ECL western blotting substrate kit (Pierce Biotechnology, Waltham, MA, USA). Images were acquired using ChemiDoc imaging system (Bio-Rad, Hercules, CA, USA) and were quantitated with ImageJ (NIH, Bethesda, MD, USA). First, the images were opened using File>Open. The rectangles around all lanes (each lane includes bands for detected marker and β-actin) were drawn by choosing “Rectangular Selection”. Then proceeding to “Analyze>Gels>Plot Lanes”, peaks were generated representing the density of bands, followed by clicking “Straight Line” tool to enclose the peaks and selecting the “Wand” tool to highlight the peaks. After this, Analyze>Gels>Label Peaks was used to get numbers for peak area (band intensity). The ratios of band density of oligodendrocyte lineage markers over β-actin were calculated.21 Electron microscopy. Two animals from each group were perfused with 2% glutaraldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) plus 2% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) in PBS at postnatal day 63 (after behavior tests) and post-fixed at 4°C for 1 week. Brains containing fimbria were dissected into small blocks (2mm × 2mm × 2mm). The blocks were placed into 1% OsO4 (Electron Microscopy Sciences, Hatfield, PA, USA) for 1 hour, stained in 0.5% uranyl acetate (Electron Microscopy Sciences, Hatfield, PA, USA) overnight, and dehydrated in a series of alcohols followed by propylene oxide for 3 hours. After being infiltrated with a 1:1 mixture of propylene oxide and EMBed-812 embedding resin (Electron Microscopy Sciences, Hatfield, PA, USA) for 3 hours, the blocks were embedded with the same resin in the plastic templates at 60ºC overnight.21 Parasagittal semi-thin sections (1 μm) were cut and stained with 1% Toluidine blue for preliminary light microscopy observation. Then, 90 nm ultrathin sections were cut, picked up on Forvar- coated slotted grids, and stained with 0.5% uranyl acetate and 0.5% lead citrate (Electron Microscopy Sciences, Hatfield, PA, USA). Thin sections were observed and imaged with a Hitachi 7600 transmission electron microscope (Chiyoda, Tokyo, Japan). For each case, 10 Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 7 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. photos were randomly photographed at 20,000×. The thickness of myelin was quantitatively measured by determining g-ratio, which was calculated by dividing the diameter of the axon by the diameter of the entire myelinated fiber as previously described. ImageJ (NIH, Bethesda, MD, USA) was used by first opening ultrastructural images. The scale was set according to the scale bar in the images by selecting “Analyze>Set Scale”. The “straight line tool” was selected to measure axonal caliber and diameter of myelinated axons. One hundred axons per group (two animals, fifty from each) were randomly selected and quantitatively analyzed (n=100).16 Statistical analysis. The statistics were performed with GraphPad Prism 6 (La Jolla, CA, USA) program. The sample size was based on our previous experience with this design. No a priori statistical power calculation was conducted. Normal distribution was verified using the D’Agostino Pearson test. Data for immunohistochemistry, Western blotting, and electron microscopy were analyzed using one-way analysis of variance (ANOVA). The factor of variable was comparisons among groups (control vs. isoflurane plus vehicle vs. isoflurane plus rapamycin). The behavior tests were analyzed with two-way ANOVA. For this analysis, the second factor was animal’s choice between old vs. novel positions (or arms) and only the values for this variable in each individual group were compared. The Tukey post hoc test was employed for intergroup comparisons. The two-tailed test was set according to convention. The criteria for significant difference was set a priori at p<0.05. In this study, all results were expressed as mean ± standard deviation (SD). The sample size “n” represents the number of animals for each group. Only exception is g-ratio analysis with electron microscopy in which “n” indicates the number of randomly selected axons from two mice per group (n=100). This analysis way is extensively applied for g-ratio study.16 Because all animals survived tests, there were no missing data in this study. No exclusions for outliers were made in this study. In some experiments, the sample size was increased in response to peer review. Results Effect of early isoflurane exposure on mTOR activity in oligodendrocytes in hippocampal fimbria. All experiments compared the three groups as follows: naïve control, isoflurane exposure plus vehicle, and isoflurane exposure plus treatment (rapamycin or clemastine). We first assayed for activity in the mTOR pathway in oligodendrocytes by double labeling for phospho-S6, a reliable reporter of activity in this pathway,29 and adenomatous polyposis coli, a standard marker for oligodendrocyte. In the control group, 22±7% adenomatous polyposis coli positive oligodendrocytes in fimbria were also immuno-labeled for phospho- S6. There was a profound increase in the percentage of phospho-S6+/ adenomatous polyposis coli+ cells over adenomatous polyposis coli+ cells to 51±6% in isoflurane exposure mice (p<0.0001). However, this increase of phospho-S6+/ adenomatous polyposis coli+ cells over adenomatous polyposis coli+ cells was prevented by treatment with rapamycin (32±12%, p=0.001). These data indicate early exposure of a general anesthetic Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 8 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. agent causing a lasting increase in the activity of the mTOR signaling pathway in the oligodendrocytes of hippocampus white matter, and rapamycin attenuates this increase. Effect of isoflurane exposure on spatial learning. Next, we asked whether isoflurane exposure impairs spatial learning and memory behaviors using the novel objective position recognition test (Fig. 2A) and Y-maze test (Fig. 2B), and whether treatment with rapamycin or clemastine restores these functions in our exposure paradigm. 1). Rapamycin study: In the novel object position recognition test, control animals made 58±8% contacts with the object that had been repositioned as compared to 42±8% contacts with the unchanged object (p<0.0001). The isoflurane-exposed mice made essentially equal contacts at both objects (53±6% vs. 47±6% times; p=0.398). Rapamycin treatment restored the performance to near control levels (55±8% vs. 45±8% times; p=0.016) (Fig. 2C). In the Y-maze test, control animals exhibited a higher percentage of exploration time in novel arm (58±5% exploration time) compared to the old one (42±5% exploration time) (p<0.0001). Isoflurane-exposed animals without rapamycin treatment had equal exploration times in both arms (50±5% vs. 50±5% time duration; p=0.999), and rapamycin treatment restored performance in this task (56±8% vs. 44±8% time duration; p<0.001) (Fig. 2D). 2). Clemastine study: In the novel object recognition test, control animals made more contacts with the object in the novel position (57±8% vs. 43±8% times; p=0.007), but isoflurane exposed animals exhibited no exploration preference (51±10% vs. 49±10% times; p=0.998). Clemastine treatment increased the difference near the control cases (56±7% vs. 44±7% times; p=0.028) (Fig. 2E). Similarly, in the Y-maze test, unlike controls (58±6% vs. 42±6% time duration; p<0.0001), isoflurane exposed mice spent identical time in both old and novel arms (51±7% vs. 49±7% time duration; p=0.999), and this effect of isoflurane was reversed by clemastine treatment (57±6% vs. 43±6% time duration; p<0.001) (Fig. 2F). Effects of isoflurane on oligodendrocyte development. In order to measure the proliferation of oligodendrocyte progenitor cells, the brain tissue was immunolabeled with antibodies against 5-bromo-2’-deoxyuridine and an oligodendrocyte progenitor cells marker, neural/glial antigen 2. We examined proliferating oligodendrocyte progenitor cells by counting 5-bromo-2’-deoxyuridine and neural/glial antigen 2 double- labeled cells in fimbria. We counted 49±14% neural/glial antigen 2 positive oligodendrocyte progenitor cells in control, and 27±9% neural/glial antigen 2 positive cells in isoflurane exposed animals were 5-bromo-2’-deoxyuridine positive (p=0.001). This ratio number increased to 47±7% (p=0.003) in isoflurane plus rapamycin injection group (Fig. 3A). Interestingly, we found that neural/glial antigen 2 expression from Western blot in the isoflurane exposure group (83±20% intensity over β-actin) is slightly lower than the control (87±15%, p=0.882) and rapamycin treatment groups (89±17%, p=0.819), but there is no statistical difference among groups (Fig. 3B). However, expression level of NK2 homeobox 2, a transcription factor that identifies oligodendrocyte differentiation, was downregulated by isoflurane (67±16% vs. 32±10% intensity over β-actin; p=0.001) and rapamycin attenuated Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 9 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. this effect (58±22% % intensity over β-actin; p=0.015) (Fig. 3B). We then performed double-immunolabeling for adenomatous polyposis coli and the oligodendrocyte progenitor cell marker platelet-derived growth factor receptor alpha, and applied oligodendrocyte/ oligodendrocyte progenitor cell ratio as a parameter to evaluate the oligodendrocyte differentiation in fimbria. 30 The ratio of the number of adenomatous polyposis coli positive mature oligodendrocytes over the number of platelet-derived growth factor receptor alpha labeled oligodendrocyte progenitor cells in isoflurane exposed mice (233±43%) revealed lower than in control (347±70% cells; p=0.002), and rapamycin treatment increases this ratio (338±52% cells; p=0.003) (Fig. 3C). To test the effects of isoflurane on axon-oligodendrocyte progenitor cell synapses, we identified excitatory axon-oligodendrocyte progenitor cell synapses in the fimbria as puncta that were immunopositive for vesicular glutamate transporter 1, which were closely apposed on neural/glial antigen 2+ cell bodies. We found that the number of axon-oligodendrocyte progenitor cell synapses on each oligodendrocyte progenitor cell in isoflurane exposure (0.8±0.6 vGlut1+ terminals per OPC) showed a statistically significant reduction compared to control (2.6±1.2 terminals per cell; p=0.001) and rapamycin treatment rescued these synapses (2.2±0.7 per cell; p=0.008) from isoflurane exposure (Fig. 4). Effects of isoflurane exposure on myelination. To test for changes in myelination after anesthesia exposure, we measured fluoresce intensity of immunolabeling for the myelin basic protein in fimbria. We found an immuno- intensity reduction in isoflurane exposure (70±18% intensity over control) compared to control conditions (100±17% control; p=0.006), which were partially restored with rapamycin treatment (92±17% rapamycin treatment; p=0.041) (Fig. 5A). We then conducted Western blot from fimbria tissue to confirm this finding. The band intensity of myelin basic protein over β-actin showed a statistically significant decrease by isoflurane exposure (110±30% vs. 60±19% intensity ratio; p=0.002) and expression of myelin basic protein was restored with rapamycin treatment (100±26% intensity ratio; p=0.013) (Fig. 5B). For further confirmation, we conducted electron microscopy to test for changes in the thickness of myelin wraps after isoflurane exposure. The quantitative analysis revealed a statistically significant increase of g-ratio (thinner myelin sheath) in isoflurane exposed animals than control (0.76±0.06 vs. 0.79±0.06 g-ratio; p<0.001) and rapamycin treatment reversed this difference (0.75±0.05 g-ratio; p<0.0001) (Fig. 5C). Effects of isoflurane exposure on DNA methylation in oligodendrocytes. We asked if early exposure to isoflurane has a lasting effect on DNA methylation levels in oligodendrocytes. We observed that 60±15% of Olig2+ cells (a transcription factor marker for oligodendrocyte lineage cells) in control conditions were double-labeled with DNA methyltransferase 1 in fimbria as compared to only 42±12% Olig2+ cells (p=0.027) in the isoflurane exposure group. Rapamycin treatment following isoflurane exposure increased the ratio of DNA methyltransferase 1+/Olig2+ over Olig2+ cells (62±11% ratio; p=0.01) (Fig. 6A). Western blots were conducted which confirmed that DNA methyltransferase 1 expression is reduced with isoflurane treatment (25±8% intensity ratio over β-actin) compared to control (58±21% intensity ratio over β-actin; p<0.001) and a partial recovery Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 10 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Discussion results from rapamycin treatment (49±9% ratio; p=0.006) (Fig. 6B). In order to determine whether changes in DNA methyltransferase 1 levels have functional significance, we assayed levels of 5-methylcytosine, which is a product of DNA methyltransferase 1 mediated DNA methylation, in oligodendrocytes. Isoflurane exposure decreased the ratio of 5-methylcytosine positive nuclei over adenomatous polyposis coli labeled oligodendrocytes (33±13% ratio) relative to control (52±13% ratio; p=0.006), and rapamycin treatment reversed this decrease (48±7% ratio; p=0.031) (Fig. 6C). In this study, we report that early postnatal exposure to isoflurane in mice causes a substantial disruption of oligodendrocyte development and myelination in fimbria of the hippocampus, which is the predominant bundle of efferent axonal fibers from the hippocampus. Proliferation and differentiation of oligodendrocyte progenitor cells are chronically impaired by early isoflurane exposure, as is the formation of synaptic connections between oligodendrocyte progenitor cells and axons. This results in a measurable loss of myelin in the fimbria. Proper connections and communications between hippocampus and the neocortex are critical for performing the cognitive and psychological functions.14, 31, 32 Myelination is essential in establishing connectivity in the growing brain by facilitating rapid and synchronized information transfer across the nervous system. Once thought of as solely a passive insulator, myelin is now understood to be actively involved in the function and development of the CNS.33 Abnormal myelination of axons disrupts the communications between brain regions, and it has been reported that myelin deficits in the hippocampus cause cognitive and psychological disorders.34-36 Previous studies have shown an acute increase in apoptosis of oligodendrocytes, the myelin forming glial cells, with early exposure to isoflurane,37, 38 but our findings demonstrate a lasting effect of anesthesia on oligodendrocyte proliferation and differentiation that results in a decrease in myelination in the hippocampal fimbria. The process of oligodendrocyte development occurs based on an intrinsic program that is modulated by neurotransmitters and electrical activity in CNS.39-41 Axonal terminals release glutamate as a transmitter at not only axonal terminals but also at discrete sites along axons in white matter.42 By acting on AMPA or NMDA receptors expressed on oligodendrocyte progenitor cells, glutamate increases the downstream phosphorylation of the cAMP response element binding protein and release of calcium from intracellular stores,43 thereby promoting oligodendrocyte progenitor cell proliferation and differentiation. As an agonist of GABA-A and glycine receptors,44 as well as a potential NMDA inhibitor,45 isoflurane suppresses excitatory neurotransmission.46 It raises the possibility that a profound direct action on oligodendrocyte progenitor cells, which express both GABA and NMDA receptors, is caused by isoflurane during a critical period in development and that this may alter the developmental program, thus resulting in deficits in myelination. An alternative or complementary explanation may be an indirect effect mediated by the electrochemical synapses that occur between axonal terminals and oligodendrocyte progenitor cells (axon- oligodendrocyte progenitor cell synapses). Formation of glutamatergic axon- oligodendrocyte progenitor cell synapses plays an important role in promoting activity- dependent oligodendrocyte development and maintenance.21-23 The chronic, lasting effects Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 11 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. of isoflurane on neuronal synapses that we have previously shown may translate into reduced activity at axon- oligodendrocyte progenitor cell synapses, thus leading to suppression of oligodendrocyte progenitor cell development. A previous study showed that plasticity of axon-oligodendrocyte progenitor cell synapses is highly dependent on electrical activity.21 The data in this study further confirms that exposure of isoflurane reduces the number of excitatory (vesicular glutamate transporter 1 positive) axon-oligodendrocyte progenitor cell synapses in hippocampus, which is likely a key mechanism of general anesthetic-induced hypomyelination. Our previous work has indicated that exposure to isoflurane disrupts the development of hippocampal neurons generated in the early postnatal period by inappropriately increasing activity in the mTOR pathway and we found that both behavioral and histological changes could be reversed by pharmacologic mTOR inhibition.7 In the present study, as in neurons, we observe a lasting alteration in the tone of mTOR signaling in oligodendrocytes in the hippocampal fimbria for a protracted period after isoflurane exposure which appears to be integral to the developmental disruption. We found a substantial improvement in phenotype with rapamycin treatment in this study as well. The mTOR pathway is an intracellular signaling pathway that regulates cellular activities including proliferation, differentiation, apoptosis, metabolism, transmitter release, and other biological processes.18 In the past decade, many studies have implicated mTOR signaling in CNS developmental and neuropsychiatric disorders.19 Two structurally and functionally distinct mTOR-containing complexes have been identified in oligodendrocytes. The first, mTOR complex 1 (mTORC1), contains the adaptor protein Raptor, which influences myelin basic protein expression via an alternative mechanism and is sensitive to the drug rapamycin. The second complex, mTORC2, contains Ritor, and it is thought to control myelin gene expression at mRNA level and is relatively rapamycin insensitive.47 The mTOR pathway itself plays a complex role in myelination; mTOR activity can either enhance or suppress oligodendrocyte development depending on the context. A study using a mouse line with oligodendrocyte-specific knockdown of mTOR in CNS has provided evidence that mTOR is essential for oligodendrocyte development and myelination.48 Inhibition of mTOR via rapamycin in cultured adult oligodendrocyte progenitor cells or in a mouse model starting at 6 weeks of age results in oligodendrocyte differentiation deficits along with reduced expression of major myelin proteins and mRNAs.49-51 In contrast, activation of mTOR induced by tuberous sclerosis complex −1 or 2 gene mutations in early oligodendrocyte progenitor cells caused white matter abnormalities, including myelin deficits in CNS.52-54 A bidirectional action of the PI3K-Akt-mTOR axis in myelination has also been reported in studies of the PNS. If tuberous sclerosis complex −1 deletion occurs in early developmental stages in Schwann cells, mTOR hyperactivity arrests the process by which Schwann cells ensheathe axons. If mTOR activity is increased in Schwann cells after they have begun wrapping around axons, there is actually in increase in myelination.55 Thus, oligodendrocyte development and myelination may be dependent on precise balance and timing in mTOR signaling. Either increasing or decreasing levels of mTORC1 activity interferes with oligodendrocyte differentiation and causes potentially causes hypomyelination.56 Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 12 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. While we do not yet have a clear picture of how changes in mTOR activity act on oligodendrocytes, our data indicate changes in DNA methylation as a promising direction. Recent work shows developmental anesthetic toxicity may involve epigenetic modulation 57 and that DNA methylation plays an important role in regulating oligodendrocyte progenitor cell proliferation and differentiation.26-28 Intriguingly, mTOR signaling has been shown to negatively regulate DNA methylation via an action on DNA methyltransferase 1,24, 25 suggesting a possible connection between mTOR signaling and oligodendrocyte development. This finding is consistent with our data showing that isoflurane exposure and concomitant increases in mTOR signaling lead to a decrease in DNA methyltransferase 1 expression and DNA methylation in developing oligodendrocytes, and that both of these changes are reversible with rapamycin treatment. We propose that oligodendrocytes should be further studied both as a potential target in anesthetic neurotoxicity and as a model system in which to further explore the interplay of anesthetics, mTOR signaling, and DNA methylation. Our work is limited by the rodent model, which has well-known confounds related to anesthetic administration in very young, small mice in which physiologic monitoring and control of respiratory function is challenging. In particular, we have chosen to use 100% oxygen as a carrier for isoflurane, which has the beneficial effect of preventing hypoxia in our model system, but which raises the possibility of a combined effect of isoflurane and hyperoxia damage that cannot be fully controlled for in our experimental model. While it is indeed the case that supplemental oxygen is frequently used in pediatric anesthesia practice it would be ideal to avoid confounds presented by hyperoxia and other physiologic issues via studies in large animal models and in cell culture models and we hope further work in this area will be undertaken in these systems. Acknowledgments: This work was funded by the US National Institutes of Health, Bethesda, MD (5R01GM120519 to C.D.M.) and by the Johns Hopkins Department of Anesthesiology and Critical Care (StAAR award to C.D.M.) Funding Statement: This work was funded by the US National Institutes of Health, Bethesda, MD. (5R01GM120519 to C.D.M). References 1. Weiser TG, Regenbogen SE, Thompson KD, Haynes AB, Lipsitz SR, Berry WR, & Gawande AA (2008). An estimation of the global volume of surgery: a modelling strategy based on available data. Lancet (London, England), 372(9633), 139–144. 2. Eckenhoff JE (1953). Relationship of anesthesia to postoperative personality changes in children. AMA Am J Dis Child, 86(5), 587–591. [PubMed: 13103772] 3. Davidson AJ, Disma N, de Graaff JC, Withington DE, Dorris L, Bell G, Stargatt R, Bellinger DC, Schuster T, Arnup SJ, Hardy P, Hunt RW, Takagi MJ, Giribaldi G, Hartmann PL, Salvo I, Morton NS, von Ungern Sternberg BS, Locatelli BG, Wilton N, Lynn A, Thomas JJ, Polaner D, Bagshaw O, Szmuk P, Absalom AR, Frawley G, Berde C, Ormond GD, Marmor J, McCann ME, GAS consortium. (2016). Neurodevelopmental outcome at 2 years of age after general anaesthesia and awake-regional anaesthesia in infancy (GAS): an international multicentre, randomised controlled trial. Lancet (London, England), 387(10015), 239–250. 4. Sun LS, Li G, Miller TL, Salorio C, Byrne MW, Bellinger DC, Ing C, Park R, Radcliffe J, Hays SR, DiMaggio CJ, Cooper TJ, Rauh V, Maxwell LG, Youn A, McGowan FX (2016). Association Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 13 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Between a Single General Anesthesia Exposure Before Age 36 Months and Neurocognitive Outcomes in Later Childhood. JAMA, 315(21), 2312–2320. [PubMed: 27272582] 5. Coleman K, Robertson ND, Dissen GA, Neuringer MD, Martin LD, Cuzon Carlson VC, Kroenke C, Fair D, Brambrink AM (2017). Isoflurane Anesthesia Has Long-term Consequences on Motor and Behavioral Development in Infant Rhesus Macaques. Anesthesiology, 126(1), 74–84. [PubMed: 27749311] 6. Alvarado MC, Murphy KL, & Baxter MG (2017). Visual recognition memory is impaired in rhesus monkeys repeatedly exposed to sevoflurane in infancy. Br J Anaesth, 119(3), 517–523. [PubMed: 28575197] 7. Kang E, Jiang D, Ryu YK, Lim S, Kwak M, Gray CD, Xu M, Choi JH, Junn S, Kim J, Xu J, Schaefer M, Johns RA, Song H, Ming GL, Mintz CD (2017). Early postnatal exposure to isoflurane causes cognitive deficits and disrupts development of newborn hippocampal neurons via activation of the mTOR pathway. PLoS Biol, 15(7), e2001246. [PubMed: 28683067] 8. Shen X, Liu Y, Xu S, Zhao Q, Guo X, Shen R, & Wang F (2013). Early life exposure to sevoflurane impairs adulthood spatial memory in the rat. Neurotoxicology, 39, 45–56. [PubMed: 23994303] 9. Stratmann G, Sall JW, May LDV, Bell JS, Magnusson KR, Rau V, Visrodia KH, Alvi RS, Ku B, Lee MT, Dai R (2009). Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology, 110(4), 834–848. [PubMed: 19293705] 10. Pontén E, Fredriksson A, Gordh T, Eriksson P, & Viberg H (2011). Neonatal exposure to propofol affects BDNF but not CaMKII, GAP-43, synaptophysin and tau in the neonatal brain and causes an altered behavioural response to diazepam in the adult mouse brain. Behav Brain Res, 223(1), 75–80. [PubMed: 21540061] 11. Zhu C, Gao J, Karlsson N, Li Q, Zhang Y, Huang Z, Li H, Kuhn HG, Blomgren K (2010). Isoflurane anesthesia induced persistent, progressive memory impairment, caused a loss of neural stem cells, and reduced neurogenesis in young, but not adult, rodents. J Cereb Blood Flow Metab: Official Journal of the International Society of Cerebral Blood Flow and Metabolism, 30(5), 1017– 1030. 12. Center for Drug Evaluation and Research. “Drug Safety and Availability – FDA Drug Safety Communication: FDA Review Results in New Warnings about Using General Anesthetics and Sedation Drugs in Young Children and Pregnant Women.” US Food and Drug Administration Home Page. https://www.fda.gov/Drugs/DrugSafety/ucm532356.htm 13. Vutskits L, & Xie Z (2016). Lasting impact of general anaesthesia on the brain: mechanisms and relevance. Nat Rev Neurosci, 17(11), 705–717. [PubMed: 27752068] 14. Nickel M, & Gu C (2018). Regulation of Central Nervous System Myelination in Higher Brain Functions. Neural Plast, 2018, 1–12. 15. Chiaravalloti ND, DeLuca J. Cognitive impairment in multiple sclerosis. Lancet Neurol. 2008;7(12):1139–1151. [PubMed: 19007738] 16. Liu J, Dupree JL, Gacias M, Frawley R, Sikder T, Naik P, & Casaccia P (2016). Clemastine Enhances Myelination in the Prefrontal Cortex and Rescues Behavioral Changes in Socially Isolated Mice. J Neurosci, 36(3), 957–962. [PubMed: 26791223] 17. Li Z, He Y, Fan S, & Sun B (2015). Clemastine rescues behavioral changes and enhances remyelination in the cuprizone mouse model of demyelination. Neurosci Bull, 31(5), 617–625. [PubMed: 26253956] 18. Laplante M, & Sabatini DM (2012). mTOR signaling in growth control and disease. Cell, 149(2), 274–293. [PubMed: 22500797] 19. Costa-Mattioli M, & Monteggia LM (2013). mTOR complexes in neurodevelopmental and neuropsychiatric disorders. Nat Neurosci, 16(11), 1537–1543. [PubMed: 24165680] 20. Xu J, Mathena RP, Xu M, Wang Y, Chang C, Fang Y, Zhang P, Mintz CD (2018). Early Developmental Exposure to General Anesthetic Agents in Primary Neuron Culture Disrupts Synapse Formation via Actions on the mTOR Pathway. Int J Mol Sci, 19(8), 2183. 21. Li Q, Houdayer T, Liu S, & Belegu V (2017). Induced Neural Activity Promotes an Oligodendroglia Regenerative Response in the Injured Spinal Cord and Improves Motor Function after Spinal Cord Injury. J Neurotrauma, 34(24), 3351–3361. [PubMed: 28474539] Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 14 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. 22. Bergles DE, & Richardson WD (2015). Oligodendrocyte Development and Plasticity. Cold Spring Harb Perspect Biol, 8(2), a020453. [PubMed: 26492571] 23. Gautier HO, Evans KA, Volbracht K, James R, Sitnikov S, Lundgaard I, James F, Lao-Peregrin C, Reynolds R, Franklin RJ, Káradóttir RT (2015). Neuronal activity regulates remyelination via glutamate signalling to oligodendrocyte progenitors. Nat Commun, 6(1), 8518. [PubMed: 26439639] 24. Zhang X, He X, Li Q, Kong X, Ou Z, Zhang L, Gong Z, Long D, Li J, Zhang M, Ji W, Zhang W, Xu L, Xuan A (2017). PI3K/AKT/mTOR Signaling Mediates Valproic Acid-Induced Neuronal Differentiation of Neural Stem Cells through Epigenetic Modifications. Stem Cell Reports, 8(5), 1256–1269. [PubMed: 28494938] 25. Wang C, Wang X, Su Z, Fei H, Liu X, & Pan Q (2015). The novel mTOR inhibitor Torin-2 induces autophagy and downregulates the expression of UHRF1 to suppress hepatocarcinoma cell growth. Oncol Rep, 34(4), 1708–1716. [PubMed: 26239364] 26. Moyon S, Huynh JL, Dutta D, Zhang F, Ma D, Yoo S, Lawrence R, Wegner M, John GR, Emery B, Lubetzki C, Franklin R, Fan G, Zhu J, Dupree JL, Casaccia P (2016). Functional Characterization of DNA Methylation in the Oligodendrocyte Lineage. Cell Reports, 15(4), 748–760. [PubMed: 27149841] 27. Moyon S, Ma D, Huynh JL, Coutts DJC, Zhao C, Casaccia P, & Franklin RJM (2017). Efficient Remyelination Requires DNA Methylation. eNeuro, 4(2), ENEURO.0336-16.2017. 28. Moyon S, & Casaccia P (2017). DNA methylation in oligodendroglial cells during developmental myelination and in disease. Neurogenesis (Austin, Tex.), 4(1), e1270381. 29. Zhou M, Li W, Huang S, Song J, Kim JY, Tian X, Kang E, Sano Y, Liu C, Balaji J, Wu S, Zhou Y, Zhou Y, Parivash SN, Ehninger D, He L, Song H, Ming GL, Silva AJ (2013). mTOR Inhibition ameliorates cognitive and affective deficits caused by Disc1 knockdown in adult-born dentate granule neurons. Neuron, 77(4), 647–654. [PubMed: 23439118] 30. Assinck P, Duncan GJ, Plemel JR, Lee MJ, Stratton JA, Manesh SB, Liu J, Ramer LM, Kang SH, Bergles DE, Biernaskie J, Tetzlaff W (2017). Myelinogenic Plasticity of Oligodendrocyte Precursor Cells following Spinal Cord Contusion Injury. J Neurosci, 37(36), 8635–8654. [PubMed: 28760862] 31. Preston AR, & Eichenbaum H (2013). Interplay of hippocampus and prefrontal cortex in memory. Curr Biol, 23(17), R764–73. [PubMed: 24028960] 32. Frankland PW, & Bontempi B (2005). The organization of recent and remote memories. Nat Rev Neurosci, 6(2), 119–130. [PubMed: 15685217] 33. Fields RD (2014). Neuroscience. Myelin--more than insulation. Science (New York, N.Y.), 344(6181), 264–266. 34. Sacco R, Bisecco A, Corbo D, Della Corte M, d’Ambrosio A, Docimo R, Gallo A, Esposito F, Esposito S, Cirillo M, Lavorgna L, Tedeschi G, Bonavita S (2015). Cognitive impairment and memory disorders in relapsing–remitting multiple sclerosis: the role of white matter, gray matter and hippocampus. J Neurol, 262(7), 1691–1697. [PubMed: 25957638] 35. Damjanovic D, Valsasina P, Rocca MA, Stromillo ML, Gallo A, Enzinger C, Hulst HE, Rovira A, Muhler N, De Stefano N, Bisecco A, Fazekas F, Arevalo MJ, Yousry TA, Filippi M (2017). Hippocampal and Deep Gray Matter Nuclei Atrophy Is Relevant for Explaining Cognitive Impairment in MS: A Multicenter Study. AJNR Am J Neuroradiol, 38(1), 18–24. [PubMed: 27686487] 36. Chen BH, Park JH, Lee T-K, Song M, Kim H, Lee JC, Kim YM, Lee CH, Hwang IK, Kang IJ, Yan BC, Won MH, Ahn JH (2018). Melatonin attenuates scopolamine-induced cognitive impairment via protecting against demyelination through BDNF-TrkB signaling in the mouse dentate gyrus. Chem Biol Interact, 285, 8–13. [PubMed: 29476728] 37. Brambrink AM, Back SA, Riddle A, Gong X, Moravec MD, Dissen GA, Creeley CE, Dikranian KT, Olney JW (2012). Isoflurane-induced apoptosis of oligodendrocytes in the neonatal primate brain. Ann Neurol, 72(4), 525–535. [PubMed: 23109147] 38. Jiang D, Lim S, Kwak M, Ryu YK, & Mintz CD (2015). The changes of oligodendrocytes induced by anesthesia during brain development. Neural Regen Res, 10(9), 1386–1387. [PubMed: 26604888] Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 15 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. 39. Stevens B, Porta S, Haak LL, Gallo V, & Fields RD (2002). Adenosine: a neuron-glial transmitter promoting myelination in the CNS in response to action potentials. Neuron, 36(5), 855–868. [PubMed: 12467589] 40. Barres BA, & Raff MC (1993). Proliferation of oligodendrocyte precursor cells depends on electrical activity in axons. Nature, 361(6409), 258–260. [PubMed: 8093806] 41. Gibson EM, Purger D, Mount CW, Goldstein AK, Lin GL, Wood LS, Inema I, Miller SE, Bieri G, Zuchero JB, Barres BA, Woo PJ, Vogel H, Monje M (2014). Neuronal activity promotes oligodendrogenesis and adaptive myelination in the mammalian brain. Science (New York, N.Y.), 344(6183), 1252304. 42. Kukley M, Capetillo-Zarate E, & Dietrich D (2007). Vesicular glutamate release from axons in white matter. Nat Neurosci, 10(3), 311–320. [PubMed: 17293860] 43. Redondo C, López-Toledano MA, Lobo MVT, Gonzalo-Gobernado R, Reimers D, Herranz AS, Paino CL, Bazán E (2007). Kainic acid triggers oligodendrocyte precursor cell proliferation and neuronal differentiation from striatal neural stem cells. J Neurosci Res, 85(6), 1170–1182. [PubMed: 17342781] 44. Grasshoff C, & Antkowiak B (2006). Effects of isoflurane and enflurane on GABAA and glycine receptors contribute equally to depressant actions on spinal ventral horn neurones in rats. Br J Anaesth, 97(5), 687–694. [PubMed: 16973644] 45. Petrenko AB, Yamakura T, Sakimura K, & Baba H (2014). Defining the role of NMDA receptors in anesthesia: are we there yet? Eur J Pharmacol, 723, 29–37. [PubMed: 24333550] 46. Baumgart JP, Zhou Z-Y, Hara M, Cook DC, Hoppa MB, Ryan TA, & Hemmings HC (2015). Isoflurane inhibits synaptic vesicle exocytosis through reduced Ca2+ influx, not Ca2+-exocytosis coupling. Proc Natl Acad Sci U S A, 112(38), 11959–11964. [PubMed: 26351670] 47. Jacinto E, Loewith R, Schmidt A, Lin S, Rüegg MA, Hall A, & Hall MN (2004). Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Bio, 6(11), 1122– 1128. [PubMed: 15467718] 48. Wahl SE, McLane LE, Bercury KK, Macklin WB, & Wood TL (2014). Mammalian target of rapamycin promotes oligodendrocyte differentiation, initiation and extent of CNS myelination. J Neurosci, 34(13), 4453–4465. [PubMed: 24671992] 49. Guardiola-Diaz HM, Ishii A, & Bansal R (2012). Erk1/2 MAPK and mTOR signaling sequentially regulates progression through distinct stages of oligodendrocyte differentiation. Glia, 60(3), 476– 486. [PubMed: 22144101] 50. Tyler WA, Gangoli N, Gokina P, Kim HA, Covey M, Levison SW, & Wood TL (2009). Activation of the Mammalian Target of Rapamycin (mTOR) Is Essential for Oligodendrocyte Differentiation. J Neurosci, 29(19), 6367–6378. [PubMed: 19439614] 51. Narayanan SP, Flores AI, Wang F, & Macklin WB (2009). Akt signals through the mammalian target of rapamycin pathway to regulate CNS myelination. J Neurosci, 29(21), 6860–6870. [PubMed: 19474313] 52. Jiang M, Liu L, He X, Wang H, Lin W, Wang H, Yoon SO, Wood TL, Lu QR (2016). Regulation of PERK–eIF2α signalling by tuberous sclerosis complex-1 controls homoeostasis and survival of myelinating oligodendrocytes. Nat Commun, 7(1), 12185. [PubMed: 27416896] 53. Scholl T, Mühlebner A, Ricken G, Gruber V, Fabing A, Samueli S, Gröppel G, Dorfer C, Czech T, Hainfellner JA, Prabowo AS, Reinten RJ, Hoogendijk L, Anink JJ, Aronica E, Feucht M (2017). Impaired oligodendroglial turnover is associated with myelin pathology in focal cortical dysplasia and tuberous sclerosis complex. Brain Pathol, 27(6), 770–780. [PubMed: 27750396] 54. Carson RP, Kelm ND, West KL, Does MD, Fu C, Weaver G, McBrier E, Parker B, Grier MD, Ess KC (2015). Hypomyelination following deletion of Tsc2 in oligodendrocyte precursors. Ann Clin Transl Neurol, 2(12), 1041–1054. [PubMed: 26734657] 55. Figlia G, Norrmén C, Pereira JA, Gerber D, & Suter U (2017). Dual function of the PI3K-Akt- mTORC1 axis in myelination of the peripheral nervous system. ELife, 6. 56. Lebrun-Julien F, Bachmann L, Norrmén C, Trötzmüller M, Köfeler H, Rüegg MA, Hall MN, Suter U (2014). Balanced mTORC1 activity in oligodendrocytes is required for accurate CNS myelination. J Neurosci, 34(25), 8432–8448. [PubMed: 24948799] Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 16 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. 57. Dalla Massara L, Osuru HP, Oklopcic A, Milanovic D, Joksimovic SM, Caputo V, DiGruccio MR, Ori C, Wang G, Todorovic SM, Jevtovic-Todorovic V (2016). General Anesthesia Causes Epigenetic Histone Modulation of c-Fos and Brain-derived Neurotrophic Factor, Target Genes Important for Neuronal Development in the Immature Rat Hippocampus. Anesthesiology, 124(6), 1311–1327. [PubMed: 27028464] Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 17 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 1. (A) Experimental timeline. A total of 120 mice (84 for rapamycin injection and 36 for clemastine feeding experiments) were used in this study. At postnatal day 7, two-thirds of the mice were exposed to isoflurane carried for 4 hours and the other one-third of the animals remained in room air as naïve control. From postnatal days 21-35, isoflurane- exposed mice were injected (i.p.) with rapamycin or vehicle at 48 hour intervals; or daily fed with clemastine or vehicle. Mice were sacrificed at postnatal day 35 for immunohistochemistry and Western blotting, or at postnatal day 63 for electron microscopy. The novel objective position recognition test and Y-maze test were performed during postnatal days 57-62. (B). Effect of early isoflurane exposure on mTOR pathway activity in oligodendrocytes of hippocampus fimbria. Coronal brain sections from control, isoflurane exposure, and isoflurane plus rapamycin groups were immunostained with adenomatous polyposis coli (APC; green) and phosphor-S6 (pS6; red) antibodies. Arrows indicate phospho-S6+ and adenomatous polyposis coli+ double-labeled cells (yellow) in merged images. Scale bar=10 μm. The histogram shows quantitative results. In isoflurane-exposed mice, the ratio of phospho-S6+/ adenomatous polyposis coli+ over adenomatous polyposis coli+ cells is dramatically increased compared to control and this increase is reversed with rapamycin treatment. (n=8 for each group; One-way ANOVA; **: p<0.01; ****: p<0.0001). Iso: isoflurane. Error bars represent SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 18 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 2. Isoflurane impairs cognitive functions via mTOR activity. (A). Novel object recognition test. On day 1, mice were allowed to explore two identical objects in an opaque chamber. On day 2, one object was moved to a novel position. Exploratory behavior was defined as the number of object-contacting with snouts. (B). Y-maze test. On day 1, mice habituated in the start arm and one choice arm. On day 2, the animal could choose between two arms. Exploration time in both arms was respectively recorded. (C). Novel object recognition test for rapamycin study. Control animals made more contact with the object in the novel position than that in the old position. Isoflurane-exposed mice have identical contacts for both positions. Rapamycin treatment restores performance to near control levels. (D). Y- maze study. Control animals stayed in the novel arm for longer time than in the old arm. Isoflurane-exposed animals stayed in both arms for same time. Rapamycin treatment reversed this ratio to near control. (E). Novel object recognition test for clemastine study. Control animals spent more time exploring the object in the novel position, but isoflurane- exposed animals exhibited no exploration preference. Clemastine treatment increased difference near the level of control animals. (F). Y-maze test. Similarly, isoflurane mice spent identical time for both arms, but this effect of isoflurane was reversed by feeding clemastine. The statistics was Two-way ANOVA (n=12 for each group; *: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001; ns: no significance). Error bars: SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 19 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 3. The effect of isoflurane exposure and rapamycin treatment on oligodendrocyte development in fimbria. (A). Oligodendrocyte progenitor cell proliferation was detected with 5-bromo-2’- deoxyuridine and neural/glial antigen 2 double-immunolabeling. A reduction in 5-bromo-2’- deoxyuridine +/ neural/glial antigen 2+ cells in isoflurane-exposed animals was observed compared to the control. This number was increased in isoflurane plus rapamycin injection group. Scale bar=20μm. (B). Western blot data indicated that the neural/glial antigen 2 level was not altered by isoflurane exposure and rapamycin administration. Expression of NK2 homeobox 2, a transcript factor for oligodendrocyte differentiation, was downregulated by isoflurane and rapamycin treatment attenuated this effect. (C). Oligodendrocyte differentiation was analyzed with lineage tracing using immunohistochemistry. The ratio of adenomatous polyposis coli+ mature oligodendrocyte number over platelet-derived growth factor receptor alpha+ oligodendrocyte progenitor cells in isoflurane-exposed mice revealed reduction compared to control, and rapamycin treatment increases the ratio. Scale bar=20μm. (n=8 for each group; One-way ANOVA; *: p<0.05; **: p<0.01; ns: no significance). Iso: isoflurane. Error bars indicate SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 20 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 4. The effect of isoflurane exposure and rapamycin treatment on the numbers of excitatory axon-oligodendrocyte progenitor cell synapses in fimbria. The vesicular glutamate transporter 1+ axon-oligodendrocyte progenitor cell synapses were identified with terminals apposing on neural/glial antigen 2+ oligodendrocyte progenitor cells (arrows indicate these synapses). The number in isoflurane exposure mice was lower than control and rapamycin treatment rescued these axon- oligodendrocyte progenitor cell synapses. Scale bar=5μm. (A). Control. (B). Isoflurane exposure plus vehicle group (C). Isoflurane exposure with rapamycin treatment. (D). Graph showing quantitative data (n=8 for each group; One-way ANOVA; **: p<0.01). Iso: isoflurane. Error bars equal SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 21 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 5. The effect of isoflurane exposure and rapamycin treatment on myelination in fimbria. (A). Myelination was quantitatively analyzed with myelin basic protein immunostaining. The myelin basic protein intensity in isoflurane-exposed mice was reduced compared to control conditions and is increased with rapamycin treatment. For this analysis, the same exact photo setting was performed for all groups. * in photos: CA3 of hippocampus; fi: fimbria of hippocampus; LV: lateral ventricle. Scale bar=200μm. (B). Western blot data indicated expression of myelin basic protein was decreased by isoflurane exposure and then elevated by rapamycin treatment. (C). Electron microscopy analysis was performed in fimbria parasagittal ultrathin sections. The ratio of axonal caliber over diameter of myelinated fiber (g-ratio) was increased in isoflurane-exposed animals (it means decreased myelin thickness) compared to control, and rapamycin treatment reversed this change. Scale bar=0.5μm. n=8 for each group in (A), (B), and n=100 for each group in (C). One-way ANOVA; *: p<0.05; **: p<0.01. Iso: isoflurane. Error bars indicate SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 22 A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t A u t h o r M a n u s c r i p t Li et al. Fig. 6. The effect of isoflurane exposure and rapamycin treatment on DNA methylation level in oligodendrocytes. (A). DNA methylation level examined with DNA methyltransferase 1 and Olig2 double immunolabeling. The percentage of DNA methyltransferase 1+/Olig2+ over Olig2+ nuclei in isoflurane-exposed mice was lower than control and rapamycin increased this ratio. Scale bar=25 μm. (B). Western blot data revealed isoflurane dramatically decreased the DNA methyltransferase 1 level and rapamycin increased DNA methyltransferase 1. (C). 5-methylcytosine, the product of DNA methylation catalyzed by DNA methyltransferase 1, was detected in nuclei of adenomatous polyposis coli+ oligodendrocytes. The ratio of 5-methylcytosine +/ adenomatous polyposis coli + over adenomatous polyposis coli+ cells showed a statistically significant decrease with isoflurane exposure and rapamycin injection reversed this decrease. Scale bar=25μm. (n=8 for each group; One-way ANOVA; *: p<0.05; **: p<0.01; ***: p<0.001). Iso: isoflurane. Error bars represent SD. Anesthesiology. Author manuscript; available in PMC 2020 November 01. Page 23",mice,['A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study.'],postnatal day 7,['Mice were exposed to 1.5% isoflurane for 4 hours at postnatal day 7.'],Y,['Mice underwent Y-maze and novel object position recognition tests (n=12 per group) on days 56-62.'],isoflurane,['Mice were exposed to 1.5% isoflurane for 4 hours at postnatal day 7.'],none,[],c57bl/6,['A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study.'],Early postnatal exposure to general anesthetics may interfere with brain development.,['Background: Early postnatal exposure to general anesthetics may interfere with brain development.'],Use of rapamycin and clemastine to investigate the effects on myelin development and cognitive function.,"['The mTOR inhibitor, rapamycin, or the pro-myelination drug, clemastine, were administered on days 21-35.']","Early postnatal exposure to isoflurane disrupts oligodendrocyte development and myelin formation, impacting cognitive functions.",['Conclusions: Early postnatal exposure to isoflurane in mice causes lasting disruptions of oligodendrocyte development in the hippocampus via actions on the mTOR pathway.'],"The study is limited by the rodent model, which may not fully represent human physiology and development.","['Our work is limited by the rodent model, which has well-known confounds related to anesthetic administration in very young, small mice in which physiologic monitoring and control of respiratory function is challenging.']",Potential applications in understanding and mitigating the risks of anesthesia exposure in young children.,"['Our work is limited by the rodent model, which has well-known confounds related to anesthetic administration in very young, small mice in which physiologic monitoring and control of respiratory function is challenging.']",True,True,True,True,True,True,10.1097/ALN.0000000000002904 10.3892/etm.2017.5651,1395.0,Liu,2018,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"2066 EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 2066-2073, 2018 Influence of sevoflurane exposure on mitogen‑activated protein kinases and Akt/GSK‑3β/CRMP‑2 signaling pathways in the developing rat brain YAFANG LIU1*, CHUILIANG LIU2*, MINTING ZENG3, XUE HAN1, KUN ZHANG1, YANNI FU1, JUE LI1 and YUJUAN LI1 1Department of Anesthesiology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, Guangdong 510120; 2Department of Anesthesiology, Chancheng Center Hospital, Guangdong Medical College, Foshan, Guangdong 528030; 3Department of Anesthesiology, Guangzhou Women and Children's Medical Centre of Guangzhou Medical University, Guangzhou, Guangdong 510523, P.R. China Received October 19, 2016; Accepted October 20, 2017 DOI: 10.3892/etm.2017.5651 Abstract. Prolonged exposure to volatile anesthetics causes neurodegeneration in developing animal brains. However, their underlying mechanisms of action remain unclear. The current study investigated the expression of proteins associated with the mitogen-activated protein kinases (MAPK) and protein kinase B (Akt)/glycogen synthase kinase-3β (GSK-3β)/collapsin response mediator protein 2 (CRMP-2) signaling pathways in the cortices of neonatal mice following exposure to sevoflurane. Seven-day-old (P7) neonatal C57BL/6 mice were randomly divided into 2 groups and either exposed to 2.6% sevoflurane or air for 6 h. Terminal deoxyribonucleotide transferase medi- ated dUTP nick end labeling (TUNEL) staining, as well as the expression of activated caspase-3 and α-fodrin, was used to detect neuronal apoptosis in the cortices of mice. MAPK signaling pathways were investigated by detecting the expres- sion of phosphorylated (p-) extracellular signal-regulated kinase 1/2 (ERK1/2), p-cyclic adenosine monophosphate response element-binding protein (CREB), p-p38, p-nuclear factor (NF-κB) and p-c-Jun N-terminal kinase (p-JNK). Akt/GSK-3β/CRMP-2 signaling pathways were assessed by detecting the expression of p-Akt, p-GSK-3β and p-CRMP-2 in the cortices of P7 mice 2 h following exposure to sevoflu- rane. The results demonstrated that sevoflurane significantly increased the apoptosis of cells in the retrosplenial cortex (RS), frontal cortex (FC) and parietal association cortex (PtA), increased the expression of cleaved caspase-3 expression and promoted the formation of 145 kDa and 120 kDa fragments from α‑fodrin. Sevoflurane inhibited the phosphorylation of ERK1/2 and CREB, stimulated the phosphorylation of p38 and NF-κB, but did not significantly affect the phosphorylation of JNK. Furthermore, sevoflurane inhibited the phosphorylation of Akt, decreased the phosphorylation of GSK-3β at ser9 and increased the phosphorylation of CRMP2 at Thr514. These results suggest that multiple signaling pathways, including ERK1/2, P38 and Akt/GSK-3β/CRMP-2 may be involved in sevoflurane‑induced neuroapoptosis in the developing brain. Introduction Exposure to general anesthetics during brain development may induce widespread apoptotic neurodegeneration in various mammalian species (1-4). Sevoflurane is an inhaled anesthetic commonly used in the clinic, particularly in pediatric medicine, due to its minimal airway reactivity and low blood/gas partition coefficient (5). Previous studies have indicated that sevoflurane causes biochemical changes, including apoptosis, amyloid-β accumulation and neuroinflammation in the hippocampus or cortex, and induces hippocampus-dependent and -independent cognitive dysfunction in developing mice (4,6,7). However, its underlying mechanisms of action remain unknown. Correspondence to: Professor Yujuan Li or Dr Jue Li, Department of Anesthesiology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, 107 Yanjiang West Road, Guangzhou, Guangdong 510120, P.R. China E-mail: yujuan_04@hotmail.com E-mail: leejue@foxmail.com Contributed equally Key words: apoptosis, sevoflurane, mitogen-activated protein kinase, protein kinase B, developing brain Mitogen-activated protein kinases (MAPKs) are a family of serine-threonine protein kinases that consist of three major members: Extracellular signal-regulated kinase 1/2 (ERK1/2), p38 MAPK and c-Jun N-terminal kinases (JNK) (8). MAPK signaling cascades serve crucial cellular roles under normal and pathological conditions, including nervous system develop- ment and neurodegeneration (9,10). Activation of the JNK and p38 pathways may contribute to apoptosis whereas the activa- tion of ERK1/2 induces cell survival following central nervous system injury (11). ERK1/2-dependent phosphorylation of the cyclic adenosine monophosphate response element-binding protein (CREB) may lead to the transcriptional upregulation LIU et al: INFLUENCE OF SEVOFLURANE ON MAPK AND Akt/GSK-3β/CRMP-2 SIGNALING PATHWAYS of the anti-apoptotic proteins Bcl-2 and brain-derived neuro- trophic factor, which promote the survival and differentiation of neurons (12,13). It has been demonstrated that the transient suppression of ERK phosphorylation in neonatal mice causes marked apoptosis of brain cells and has profound long-term effects on brain function, including a reduction in long-term potentiation and memory impairments, and exhibiting no pref- erence for interacting with animate vs. inanimate objects (14). Previous studies demonstrated that the inhaled anesthetic isoflurane suppresses ERK phosphorylation and increases the phosphorylation of p38, MAPK and JNK in the hippo- campus of neonatal rats. Additionally, isoflurane increases neuronal apoptosis by activating the JNK and p38 MAPK pathways (15,16). However, it remains unclear exactly how sevoflurane affects the MAPK pathway. Glycogen synthase kinase-3β (GSK-3β) functions in a wide range of cellular processes, including cell proliferation, differentiation, motility and apoptosis (17-19). It is one of the most important downstream targets of the protein kinase B (Akt) signaling pathway. Akt phosphorylating serine at posi- tion 9 in GSK-3β inhibits GSK-3β activity (20). In neurons, GSK-3β is involved in neuronal microtubule dynamics and determines axon/dendrite polarity by phosphorylating the downstream targets of GSK-3β, such as collapsin response mediator protein 2 (CRMP-2) (17,21,22). CRMP2 is involved in neuronal differentiation and axon growth via the binding of CRMP-2 and tubulin, which promotes microtubule assembly (23). In cultured neurons, CRMP2 has been demon- strated to be critical in axon specification, elongation and branching, thereby establishing and maintaining neuronal polarity (23). CRMP-2 has also been proved to co-localize with Numb and regulate Numb-mediated endocytosis, which is associated with axon growth (24). The binding of CRMP-2 to tubulin is inhibited following the phosphorylation of CRMP-2 by GSK-3β (21). Furthermore, it has been demon- strated that the Akt/GSK-3β/CRMP-2 signaling pathway serves important roles in the establishment of axonal-dendritic polarity in vitro (21) and in mediating axonal injury in the neonatal rat brain following hypoxia-ischemia in vivo (22). The inhibition of Akt signaling serves a critical role in isoflurane-induced neuroapoptosis in developing rats (25). Tao et al (26) also demonstrated that sevoflurane anesthesia stimulates Tau phosphorylation and activates GSK-3β in the hippocampus of young mice, causing cognitive impairment. However, it remains unknown how sevoflurane affects the Akt/GSK-3β/CRMP-2 pathway. To determine the molecular mechanisms of neurotoxicity induced by anesthesia with sevoflurane, the current study investigated changes in the expression of proteins in the MAPK and Akt/GSK-3β/CRMP-2 signaling pathways in the cortices of 7-day-old neonatal mice. Materials and methods Animals. The current study was approved by the Animal Care Committee at Sun Yat-sen University (Guangzhou, China) and performed in accordance with the National Institutes of Health Guide for the Use of Laboratory Animals (27). A total of 24 C57BL/6 male mouse pups, aged 7 days (P7) and weighing 3.5-4.5 g were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China; permission no. SCXK2011-0029). The pups were housed in the same cage as their mothers and were kept under temperature-controlled environmental conditions (26˚C) on a 14:10 constant light‑dark cycle until P7. The mother mice had free access to food and water. The mouse pups at P7 were exposed to 2.6% sevo- flurane (Jiangsu Hengrui Medicine Co., Ltd., Lianyungang, China) for 6 h [~1.0 minimal alveolar concentration (MAC) in P7 mice] in 50% oxygen in a temperature-controlled chamber, following a previously described protocol (n=12) (17). The control mice were exposed to normal air for 6 h under the same condition (n=12). The concentrations of anesthetic gas, oxygen and carbon dioxide in the chamber were measured using a gas analyzer (Datex-Ohmeda; GE Healthcare, Chicago, IL, USA). All animals were sacrificed 2 h following termination of sevoflurane/oxygen exposure and their cortices were used for western blotting (sevoflurane group, n=6; control group, n=6) or TdT-mediated dUTP nick end labeling (TUNEL) with fluorescent dye (sevoflurane group, n=6; control group, n=6). Tissue preparation. Half of the mice in each group were used for western blotting and half of the mice for TUNEL studies. For western blotting, mouse pups were anaesthetized by inhaling 3% of sevoflurane until loss of the righting reflex (LORR), which indicated the mice had lost consciousness. Then the mice were sacrificed by decapitation. Cortices were isolated immediately on ice and then stored at ‑80˚C until use. For TUNEL studies, mouse pups were sacrificed by inhaling 3% of sevoflurane until LORR and perfused transcardially with ice-cold normal saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer for 10 min at 4˚C. Their brains were post‑fixed in the same fixative for 48 h at 4˚C, and then paraffin embedded and sectioned into 6‑µm‑thick sections. As described in previous studies (15,16,25), at least three sections in the same plane of the hippocampus for each animal were selected to detect cells that exhibited positive TUNEL staining; all sections used in TUNEL were 100 µm apart and the sections were according to Figures 129-131 in the Atlas of the Developing Mouse Brain (28). Western blotting. Western blotting was performed as previ- ously described (15,16,25). Briefly, the protein concentration in each sample was determined using a BCA protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Sample proteins (40 µg/lane) were separated on 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. Membranes were blocked with 5% bovine serum albumin (Beyotime Institute of Biotechnology, Shanghai, China) in Tris-buffered saline with Tween-20 (TBST) at room tempera- ture for 1 h. Membranes were subsequently incubated at 4˚C overnight with the following primary antibodies: Anti-cleaved caspase-3 (cat no. 9664) at 1:2,000 dilution, anti-α-fodrin (which contain SBDP145 and SBDP120 fragments; cat no. 2122) at 1:2,000 dilution, anti-phosphorylated-(p)-JNK (cat no. 4668) at 1:2,000 dilution, anti-JNK (cat no. 9252) at 1:2,000 dilution, anti-p-ERK1/2 (cat no. 4376) at 1:1,000 dilu- tion, anti-ERK1/2 (cat no. 4695) at 1:1,000 dilution, anti-p-P38 (cat no. 4631) at 1:1,000 dilution, anti-P38 (cat no. 9212) at 1:1,000 dilution, anti-p-CREB (cat no. 9198) at 1:1,000 dilu- tion, anti-p-nuclear factor-κB (NF-κB) (cat no. 3033) at 1:1,000 2067 2068 EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 2066-2073, 2018 Figure 1. Sevoflurane increased the number of TUNEL positive cells in the cortices of P7 mice. Representative images of TUNEL staining in the (A) RS and FC regions of the cortices. Green staining indicated TUNEL‑positive cells, blue staining indicated nuclear staining (magnification, x100). The white arrows indicate the TUNEL‑positive cells. (B) Quantification of TUNEL positive cells in the RS, FC and PtA regions of the cortices. All results are presented as the mean ± standard deviation of the mean (n=6). ***P<0.001 vs. CON. TUNEL, Terminal deoxyribonucleotide transferase mediated dUTP nick end labeling; Con, control group; Sevo, sevoflurane group; RS, retrosplenial cortex; FC, frontal cortex; PtA, parietal association cortex; P7, 7‑day‑old neonatal mice. dilution, anti-p-Akt (Ser 473) (cat no. 4060) at 1:2,000 dilu- tion, anti-Akt (cat no. 4685) at 1:5,000 dilution, anti-p-GSK-3β (Ser 9) (cat no. 5558) at 1:2,000 dilution, anti-GSK-3β (cat no. 9315) at 1:2,000 dilution, anti-p-CRMP-2 (Thr 514) (cat no. 9397) at 1:2,000 dilution, anti-CRMP-2 (cat no. 9393) at 1:2,000 dilution and anti-β-actin (cat no. 3700) at 1:2,000 dilution (all Cell Signaling Technology, Inc., Danvers, MA, USA) and anti-p-GSK-3β (Ty 216) (cat no. ab75745; Abcam, Cambridge, USA) at 1:2,000 dilution. The membranes were washed with TBST three times and incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies (goat anti-mouse IgG, cat no. A0216; goat anti-rabbit IgG, cat no. A0208; 1:2,000; Beyotime Institute of Biotechnology) at room temperature for 1 h. The membranes were washed with TBST three times and visualized using an enhanced chemiluminescence detection system (cat no. 34580; Thermo Fisher Scientific, Inc.). Images were scanned using an Image Master II scanner (GE Healthcare) and were analyzed using Image Quant TL software (v2003.03, GE Healthcare). The band signals of p-ERK1/2, p-JNK, p-p38, p-Akt, p-GSK-3 and p-CRMP-2 were normalized to the bands of total ERK1/2, JNK, p38, Akt, GSK-3β and CRMP-2 from the same samples. The band signals of the other proteins were normalized to those of β-actin and the results in each group were normalized to that of the corresponding control group. solution and mounted on glass coverslips with clear nail polish sealing the edges. Slides were protected from direct light during the experiment. The images of TUNEL positive cells in the retrosplenial cortex (RS), frontal cortex (FC) and parietal association cortex (PtA) areas were acquired by Ti-S inverted fluorescence microscope (Nikon Corporation, Tokyo, Japan) and analyzed using NIS-Elements Basic Research imaging processing and analysis software (version 3.0; Nikon Corporation). The density of TUNEL positive cells in the three cortical regions was calculated by dividing the number of TUNEL positive cells by the area of that brain region. Statistical analysis. Sample size was calculated using PASS 11 software (NCSS, LLC, Kaysville, UT, USA) to achieve 80% power at a significance level of P<0.05. All data were determined to be normally distributed using the Shapiro‑Wilk test and had no significant heterogeneity of variance as detected by Levene's test. GraphPad Prism 6.0 software (GraphPad Software Inc., La Jolla, CA, USA) was used to conduct all statistical analyses. Data were presented as mean ± standard deviation and were analyzed by Student's t‑test. P<0.05 was considered to indicate a statistically significant difference. Results TUNEL assay. TUNEL was performed following a previ- ously described protocol (15,16). A Dead End™ fluorometric TUNEL system (Promega Corporation, Madison, WI, USA) was used and staining following the manufacturer's protocol. Briefly, TUNEL labeling was conducted with a mix of 45 µl equilibration buffer, 5 µl nucleotide mix and 1 µl recombi- nant terminal deoxynucleotidyl transferase (rTdT) enzyme in a humidified, lucifugal chamber for 1 h at 37˚C, and then Hoechst 33258 (H-33258; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was used to stain nuclei for 10 min at room temperature. The sections were protected by anti-Fade Sevoflurane induces neuroapoptosis by activating caspase‑3 and calpain in the cortices of developing mice. The results of preliminary experiments for arterial blood gas monitoring in the current study demonstrated that neonatal mice exhibited no hypoglycemia and acidosis during sevoflurane exposure. Neuronal apoptosis in the cortical RS, FC and PtA regions of P7 mice were detected by TUNEL (Fig. 1). Sevoflurane increased the number of apoptotic cells by 338.37% in RS, 409.78% in FC and 360.94% in PtA compared with controls (all P<0.001). In addition, changes in the expres- sion of cleaved caspase-3 and α-fodrin (α-II-Spectrin) in the LIU et al: INFLUENCE OF SEVOFLURANE ON MAPK AND Akt/GSK-3β/CRMP-2 SIGNALING PATHWAYS Figure 2. Sevoflurane increased the expression of cleaved caspase‑3, SBDP145 and SBDP120 fragments of α-fodrin in the cortices of P7 mice. Representative western blots of (A) cleaved caspase-3 and (B) α-fodrin. Quantitative analysis of (C) cleaved caspase-3, (D) SBDP145 and (E) SBDP120 expression. All results are presented as the mean ± standard deviation of the mean (n=6). **P<0.01 and ***P<0.001, vs. Con. CON, control group; Sevo, sevoflurane group; P7, 7‑day‑old neonatal mice. Figure 3. Sevoflurane inhibited the phosphorylation of ERK1/2 and CREB, increased the phosphorylation of p38 and NF‑κB, and did not alter JNK activa- tion in the cortex of P7 mice. Representative Western blots of (A) ERK1/2, p-ERK1/2 and p-CREB, (D) p-p38, P-38 and p-NF-κB and (G) JNK and p-JNK. Quantitative analysis of (B) p-ERK1/2 (44 and 42 kDa), (C) p-CREB, (E) p-p38, (F) p-NF-κB (F) and (H) p-JNK. The results are presented as the mean ± stan- dard deviation of the mean (n=6). *P<0.05, **P<0.01, ***P<0.001 vs. CON. CON, control; SEVO, sevoflurane; NF‑κB, nuclear factor κB; p-, phosphorylated; CREB, cyclic adenosine monophosphate response element-binding protein; JNK, c-Jun N-terminal kinase; ERK1/2, extracellular signal-regulated kinase 1/2. cortices of mice were assessed by western blotting (Fig. 2). Sevoflurane anesthesia significantly increased the expression of cleaved caspase‑3 protein expression by 11.66‑fold. (P<0.01; Fig. 2A and C). To examine whether sevoflurane anesthesia influences calpain activity, the expression of α-fodrin in the cortex was measured. Cleavage of the 320 kDa full-length 2069 2070 EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 2066-2073, 2018 Figure 4. Sevoflurane inhibited the activity of the Akt/GSK‑3β/CRMP2 pathway. Sevoflurane reduced the phosphorylation of Akt and GSK‑3β (Ser 9) and increased phosphorylation of GSK-3β (Ty216) and CRMP2 (Thr 514) in the cortex of P7 mice. (A) Representative western blots of p-Akt, p-GSK-3β (Ser 9), p-GSK-3β (Ty216) and p-CRMP2 (Thr 514); Quantitative analysis of (B) p-Akt, (C) p-GSK-3β (Ser 9), (D) p-GSK-3β (Ty216) and (E) p-CRMP2 (Thr 514). Results are presented as the mean ± standard deviation of the mean (n=6). **P<0.01 vs. Con. P7, 7‑day‑old neonatal mice; Con, control group; Sevo, sevoflurane group; p-, phosphorylated; GSK-3β, glycogen synthase kinase-3β; Akt, protein kinase B; CRMP2, collapsin response mediator protein 2. α-fodrin by calpain leads to the formation of the 145 kDa frag- ment (known as Spectrin breakdown product 145; SBPD145), which served as a relative measure of calpain activity, whereas the appearance of an additional 120 kDa fragment (also known as Spectrin breakdown product 120; SBPD120) served as an indicator of caspase-3 activity (29). The amount of the 145 kDa and 120 kDa protein fragment significantly increased by 140.1% (P<0.01; Fig. 2B and D) and 324.3% (P<0.001; Fig. 2B and E), respectively, immediately following termina- tion of sevoflurane anesthesia. cortex following anesthesia with sevoflurane. By contrast, sevoflurane significantly increased the expression of p‑p38 by 204.5% (P<0.001; Fig. 3D and E) and its downstream substrate p-NF-κB by 58.9% (P<0.01; Fig. 3D and F). The expression of p-JNK remained unchanged in the cortices following exposure to sevoflurane (P=0.0665; Fig. 3G and H). Furthermore, the expression of ERK1/2, JNK and p38 exhibited no significant differences between sevoflurane and control rats (data not shown). The effect of sevoflurane on MAPK signaling pathways. Sevoflurane significantly decreased the expression of p-ERK1/2 at 44 kD by 73.9% and p-ERK1/2 at 42 kD by 47.0% (P<0.001; Fig. 3A and B). To further analyze ERK1/2 activity, the phosphorylation of CREB, one of the substrates of ERK1/2, was examined. A 22.6% decrease (P<0.05; Fig. 3A and C) in p-CREB expression was observed in the The effects of sevoflurane on the Akt/GSK‑3β/CRMP‑2 pathway. To determine whether the Akt/GSK-3β/CRMP-2 signaling pathway is involved in sevoflurane‑induced neuroap- otosis, the expression of Akt, GSK-3β and CRMP-2, and their phosphorylation were assessed in the cortex following anes- thesia with sevoflurane. Western blot analysis demonstrated that sevoflurane inhibits Akt activity as, following sevoflurane treatment; the expression of p‑Akt was significantly reduced LIU et al: INFLUENCE OF SEVOFLURANE ON MAPK AND Akt/GSK-3β/CRMP-2 SIGNALING PATHWAYS by 58.9% compared with the control (P<0.01; Fig. 4A and B). Sevoflurane activated GSK-3β by significantly reducing the expression of p-GSK-3β at Ser 9 by 21.45% (P<0.01; Fig. 4A and C) and significantly increasing the expression of p-GSK-3β at Ty216 by 28.02% (P<0.01; Fig. 4A and D). Furthermore, the expression of p-CRMP2 at Thr 514, which reflects GSK-3β activity, was significantly increased by 198.42% following sevoflurane anesthesia compared with the control (P<0.01; Fig. 4A and E). The expression of Akt, GSK-3β and CRMP‑2 did not differ significantly between rats in the sevoflurane and control groups (data not shown). Discussion is responsible for the late phase of depolarization-stimulated CREB phosphorylation and the CaMK cascade regulates the early transient phase (38). The results of the current study demonstrate that sevoflurane decreases ERK phosphorylation and the phosphorylation of downstream CREB, indicating that sevoflurane may inhibit CREB activation by decreasing the phosphorylation of ERK. It has been demonstrated that the suppression of ERK phosphorylation is critically involved in the mechanism underlying sevoflurane‑induced toxicity in the developing brain and that lithium or N-stearoyl-L-tyrosine attenuates anesthetic-induced neuroapoptosis by upregulating the ERK pathway. The results of the present study indicate that the ERK-CREB pathway may be involved in sevoflu- rane-induced neurotoxicity and cognitive dysfunctions. In the current study, it was demonstrated that 6 h exposure to 2.6% sevoflurane significantly increases neuronal apoptosis in the cortices of P7 mice. The activation of calpain and caspase-3 contributed to this neuronal apoptosis. Sevoflurane suppressed the phosphorylation of ERK1/2 and CREB, and promoted the phosphorylation of p38 and NF-κB, but did not influence JNK phosphorylation following 6-h exposure. Furthermore, sevoflurane inhibited the activity of the Akt/GSK‑3β/CRMP-2 pathway by reducing the phosphorylation of Akt and GSK-3β, and increasing the phosphorylation of CRMP-2. It has been demonstrated that sevoflurane induces neuro- apoptosis, which is dependent on the depth of the anesthesia and is time- and brain region-specific (7,30,31). Previous studies have indicated that isoflurane induces more neurotox- icity than equivalent doses of sevoflurane (25,32). Exposure of P7 rats to 1% sevoflurane for 2 h did not result in severe neuroapoptosis, whereas increased concentrations of sevoflu- rane caused neuroapoptosis or cognitive dysfunction in the developing brain (31,33). In the current study, it was demon- strated that exposure of P7 rats to 2.6% sevoflurane (~1 MAC) activates capsase-3 dependent apoptosis, as indicated by the increase in cleaved 19/17-kDa caspase-3 subunits and genera- tion of the α-fodrin 120 kDa fragments (31,33). Furthermore, the relative activity of calpain, manifested as changes in the level of proteolytic fragment in the 145 kDa of α-fodrin, was also increased following sevoflurane exposure in the cortices of P7 rats. Calpains are a family of cysteine proteases activated by calcium and autolytic processing. It has been demonstrated that the pathological activation of calpain leads to cytoskeletal protein breakdown, the loss of structural integrity, dysfunctions of axonal transport and eventually, neuronal cell death (34). Activated calpain may also bind to the apoptosis induced factor (AIF) and thus mediate the caspase-independent apop- totic pathway (35). Indeed, our previous study determined that sevoflurane increases the expression of AIF in the cortex of P7 rats (36). Therefore, it is possible that sevoflurane induces neuroapoptosis by activating the caspase-dependent and -inde- pendent pathways. Sevoflurane induces abnormal social behaviors and cogni- tive dysfunctions in developing animals. CREB activation by phosphorylation is essential in the process of memory forma- tion and maintenance by inducing the expression of genes that are essential for learning (13). Hardingham et al (37) demon- strated that depolarization-stimulated CREB phosphorylation is dependent on activation of the ERK and calcium-dependent protein kinase (CaMK) signaling pathways. The ERK pathway Neuroinf lammation contributes to volatile anes- thetic‑induced cognitive deficits and it has been demonstrated that isoflurane induces learning impairment by activating the NF-κB pathway and upregulating the expression of hippo- campal interleukin-1β in rodents (39,40). Sevoflurane also increases levels of the pro‑inflammatory cytokine interleukin‑6 and tumor necrosis factor-α in the developing mouse brain (7). Anti‑inflammatory therapy significantly attenuated the cogni- tive impairments induced by sevoflurane in young and aged rats (7,41). Our previous study demonstrated that isoflurane induces neuroapoptosis by activating the p38-NF-κB signaling pathway in the brain of developing rats (16). In the present study, it was demonstrated that sevoflurane activates the p38 pathway, as demonstrated by the increase in the phosphoryla- tion of p38 and its downstream substrate NF-κB. However, further studies are required to identify whether the p38-NF-κB pathway is involved sevoflurane‑induced neuroapoptosis and neuroinflammation. Unlike isoflurane, sevoflurane does not promote the phosphorylation of JNK, which is consistent with the results of a study by Wang et al (42) demonstrating that inhibition of JNK does not attenuate sevoflurane-induced neuroapoptosis. Furthermore, sevoflurane induces astrocytic dysfunction by inactivating the JAK/STAT pathway in the hippocampus of neonatal rats (43). These results suggest that the inhibition of the JNK pathway may contribute to neurotox- icity of sevoflurane. The use of general anesthesia may increase the risk of Alzheimer's disease (AD). Isoflurane or sevoflurane promotes AD neuropathogenesis by inducing caspase activation, accumulation of β-amyloid (Aβ) and overt tau hyperphosphory- lation (5,44,45). GSK-3 activation is a critical step in the cascade of detrimental events that occur during the development in AD, preceding the neurofibrillary tangles and neuronal death path- ways (19). It has been demonstrated that sevoflurane induces Tau phosphorylation and GSK-3β activation in the hippocampus of developing mice (26). GSK-3β catalytic kinase activity is regu- lated by the differential phosphorylation of serine/threonine residues, including Ser 21 and Ser 9, which have an inhibitory effect, and tyrosine residues such as Tyr 279 and Tyr 216, which have an activating effect. CRMP-2, a phospho-protein involved in axonal outgrowth and microtubule dynamics, is aberrantly phosphorylated at Thr514 by GSK-3β in the brain of patients with AD (46). In the current study, sevoflurane decreased the phosphorylation of Akt and its downstream protein GSK-3β at Ser9 and also enhanced the phosphorylation of GSK-3β at Ty216, suggesting that sevoflurane activates GSK-3β. This 2071 2072 EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 2066-2073, 2018 effect was confirmed by the effect of sevoflurane on CRMP2 phosphorylation at Thr514, which is one of the downstream sites of GSK-3β. Wang et al (47) suggested that the suppression of CRMP-2 hyperphosphorylation ameliorates β-amyloid-induced cognitive dysfunction and hippocampal axon degeneration. However, it remains unknown whether the suppression of CRMP-2 hyperphosphorylation ameliorates neurotoxicity of sevoflurane in the developing brain. 7. Shen X, Dong Y, Xu Z, Wang H, Miao C, Soriano SG, Sun D, Baxter MG, Zhang Y and Xie Z: Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 118: 502-515, 2013. 8. Ravingerová T, Barancík M and Strnisková M: Mitogen-activated protein kinases: A new therapeutic target in cardiac pathology. Mol Cell Biochem 247: 127-138, 2003. 9. Roux PP and Blenis J: ERK and p38 MAPK-activated protein kinases: A family of protein kinases with diverse biological func- tions. Microbiol Mol Biol Rev 68: 320-344, 2004. The current study had several limitations. Firstly, the changes in the expression of proteins were only evaluated 2 h following sevoflurane exposure and were not observed over a longer duration, which may improve understanding regarding the changes in the expression of these proteins. Additionally, specific inhibitors of p38 or GSK‑3β were not used. These may be useful in determining the exact mechanism of some signaling pathways following exposure to sevoflurane. Additionally, synaptic morphology and the behavior of animals following exposure to sevoflurane was not assessed in the current study. These evaluations may contribute to clarifying the effects of these pathways on sevoflurane‑induced long‑time cognitive impairment. In conclusion, the results of the current study demonstrated that sevoflurane induces changes in the expression of proteins that serve an important role in the brain development of neonatal animals. The proteins identified suggest that sevo- flurane may disturb neuronal migration, differentiation and energy metabolism in the brains of neonatal rats, which may contribute to its neurodegenerative effects. Acknowledgements 10. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K and Cobb MH: Mitogen -activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr Rev 22: 153-183, 2001. 11. Liu AL, Wang XW, Liu AH, Su XW, Jiang WJ, Qiu PX and Yan GM: JNK and p38 were involved in hypoxia and reoxy- genation-induced apoptosis of cultured rat cerebellar granule neurons. Exp Toxicol Pathol 61: 137-143, 2009. 12. Riccio A, Ahn S, Davenport CM, Blendy JA and Ginty DD: Mediation by a CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science 286: 2358-2361, 1999. 13. Lonze BE and Ginty DD: Function and regulation of CREB family transcription factors in the nervous system. Neuron 35: 605-623, 2002. 14. Yufune S, Satoh Y, Takamatsu I, Ohta H, Kobayashi Y, Takaenoki Y, Pagès G, Pouysségur J, Endo S and Kazama T: Transient Blockade of ERK Phosphorylation in the critical period causes autistic phenotypes as an adult in mice. Sci Rep 5: 10252, 2015. 15. Li Y, Wang F, Liu C, Zeng M, Han X, Luo T, Jiang W, Xu J and Wang H: JNK pathway may be involved in isoflurane‑induced apoptosis in the hippocampi of neonatal rats. Neurosci Lett 545: 17-22, 2013. 16. Liao Z, Cao D, Han X, Liu C, Peng J, Zuo Z, Wang F and Li Y: Both JNK and P38 MAPK pathways participate in the protection by dexmedetomidine against isoflurane‑induced neuroapoptosis in the hippocampus of neonatal rats. Brain Res Bull 107: 69-78, 2014. 17. Yoshimura T, Kawano Y, Arimura N, Kawabata S, Kikuchi A and Kaibuchi K: GSK-3beta regulates phosphorylation of CRMP-2 and neuronal polarity. Cell 120: 137-149, 2005. The present study was supported by National Natural Science Foundation of China (grant no. 81371259), the Natural Science Foundation of Guangdong Province (grant no. 2016A030313251), the Science and Technology Program of Gagungdong Province (grant nos. 2014A020212147 and A2013206), the Science and Technology Planning Project of Guangzhou, China (grant no. 201605122118121) and the Medical Science and Technology Program of Foshan (grant no. 20130841). 18. Martin M, Rehani K, Jope RS and Michalek SM: Toll -like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat Immunol 6: 777-784, 2005. 19. Takashima A: GSK-3 is essential in the pathogenesis of Alzheimer's disease. J Alzheimers Dis 9 (3 Suppl): S309-S317, 2006. 20. Cross DA, Alessi DR, Cohen P, Andjelkovich M and Hemmings BA: Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378: 785-789, 1995. 21. Yoshimura T, Arimura N, Kawano Y, Kawabata S, Wang S and Kaibuchi K: Ras regulates neuronal polarity via the PI3-kinase/Akt/GSK-3beta/CRMP-2 pathway. Biochem Biophys Res Commun 340: 62-68, 2006. References 22. Xiong T, Tang J, Zhao J, Chen H, Zhao F, Li J, Qu Y, Ferriero D and Mu D: Involvement of the Akt/GSK-3β/CRMP-2 pathway in axonal injury after hypoxic-ischemic brain damage in neonatal rat. Neuroscience 216: 123-132, 2012. 1. Brambr in k A M, Evers AS, Avidan MS, Fa rber N B, Smith DJ, Zhang X, Dissen GA, Creeley CE and Olney JW: Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology 112: 834-841, 2010. 2. Zheng H, Dong Y, Xu Z, Crosby G, Culley DJ, Zhang Y and Xie Z: Sevoflurane anesthesia in pregnant mice induces neuro- toxicity in fetal and offspring mice Anesthesiology 118: 516-526, 2013. 3. Paule MG, Li M, Allen RR, Liu F, Zou X, Hotchkiss C, Hanig JP, Patterson TA, Slikker W Jr and Wang C: Ketamine anesthesia during the first week of life can cause long‑lasting cognitive deficits in rhesus monkeys. Neurotoxicol Teratol 33: 220-230, 2011. 4. Zhang X, Xue Z and Sun A: Subclinical concentration of sevoflu- rane potentiates neuronal apoptosis in the developing C57BL/6 mouse brain. Neurosci Lett 447: 109-114, 2008. 5. Goa KL, Noble S and Spencer CM: Sevoflurane in paediatric anaesthesia: A review. Paediatr Drugs 1: 127-153, 1999. 6. Dong Y, Zhang G, Zhang B, Moir RD, Xia W, Marcantonio ER, Culley DJ, Crosby G, Tanzi RE and Xie Z: The common inha- lational anesthetic sevoflurane induces apoptosis and increases beta-amyloid protein levels. Arch Neurol 66: 620-631, 2009. 23. Inagaki N, Chihara K, Arimura N, Menager C, Kawano Y, Matsuo N, Nishimura T, Amano M and Kaibuchi K: CRMP-2 induces axons in cultured hippocampal neurons. Nat Neurosci 4: 781-782, 2001. 24. Nishimura T, Fukata Y, Kato K, Yamaguchi T, Matsuura Y, Kamiguchi H and Kaibuchi K: CRMP-2 regulates polarized Numb-mediated endocytosis for axon growth. Nat Cell Biol 5: 819-826, 2003. 25. Li Y, Zeng M, Chen W, Liu C, Wang F, Han X, Zuo Z and Peng S: Dexmedetomidine reduces isoflurane‑induced neuroapoptosis partly by preserving PI3K/Akt pathway in the hippocampus of neonatal rats. PLoS One 9: e93639, 2014. 26. Tao G, Zhang J, Zhang L, Dong Y, Yu B, Crosby G, Culley DJ, Zhang Y and Xie Z: Sevoflurane induces tau phosphorylation and glycogen synthase kinase 3β activation in young mice. Anesthesiology 121: 510-527, 2014. 27. National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals: Guide for the Care and Use of Laboratory Animals. 8th edition. National Academies Press, Washington, DC, 2011. 28. Paxinos G, Halliday G, Watson C, Koutcherov Y and Wang H: Atlas of the developing mouse brain at E17.5, P0 and P6. Academic Press, New York, NY, 2006. LIU et al: INFLUENCE OF SEVOFLURANE ON MAPK AND Akt/GSK-3β/CRMP-2 SIGNALING PATHWAYS 29. Vanags DM, Pörn-Ares MI, Coppola S, Burgess DH and Orrenius S: Protease involvement in fodrin cleavage and phosphatidylserine exposure in apoptosis. J Biol Chem 271: 31075-31085, 1996. 30. Zheng SQ, An LX, Cheng X and Wang YJ: Sevoflurane causes neuronal apoptosis and adaptability changes of neonatal rats. Acta Anaesthesiol Scand 57: 1167-1174, 2013. 31. Xiao H, Liu B, Chen Y and Zhang J: Learning, memory and synaptic plasticity in hippocampus in rats exposed to sevoflurane. Int J Dev Neurosci 48: 38-49, 2016. 32. Liang G, Ward C, Peng J, Zhao Y, Huang B and Wei H: Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 112: 1325-1334, 2010. 33. Wang SQ, Fang F, Xue ZG, Cang J and Zhang XG: Neonatal sevoflurane anesthesia induces long-term memory impairment and decreases hippocampal PSD-95 expression without neuronal loss. Eur Rev Med Pharmacol Sci 17: 941-950, 2013. 34. Vosler PS, Brennan CS and Chen J: Calpain-mediated signaling mechanisms in neuronal injury and neurodegeneration. Mol Neurobiol 38: 78-101, 2008. 40. Li ZQ, Rong XY, Liu YJ, Ni C, Tian XS, Mo N, Chui DH and Guo XY: Activation of the canonical nuclear factor-κB pathway is involved in isoflurane‑induced hippocampal interleukin‑1β elevation and the resultant cognitive deficits in aged rats. Biochem Biophys Res Commun 438: 628-634, 2013. 41. Gong M, Chen G, Zhang XM, Xu LH, Wang HM and Yan M: Parecoxib mitigates spatial memory impairment induced by sevoflurane anesthesia in aged rats. Acta Anaesthesiol Scand 56: 601-607, 2012. 42. Wang WY, Wang H, Luo Y, Jia LJ, Zhao JN, Zhang HH, Ma ZW, Xue QS and Yu BW: The effects of metabotropic glutamate receptor 7 allosteric agonist N, N'-dibenzhydrylethane-1, 2-diamine dihydrochloride on developmental sevoflurane neurotoxicity: Role of extracellular signal-regulated kinase 1 and 2 mitogen-activated protein kinase signaling pathway. Neuroscience 205: 167-177, 2012. 43. Wang W, Lu R, Feng DY and Zhang H: Sevoflurane Inhibits Glutamate-Aspartate Transporter and Glial Fibrillary acidic protein expression in hippocampal astrocytes of neonatal rats through the Janus Kinase/Signal Transducer and activator of transcription (JAK/STAT) pathway. Anesth Analg 123: 93-102, 2016. 35. Lu JR, Lu WW, Lai JZ, Tsai FL, Wu SH, Lin CW and Kung SH: Calcium flux and calpain‑mediated activation of the apoptosis-inducing factor contribute to enterovirus 71-induced apoptosis. J Gen Virol 94: 1477-1485, 2013. 36. Li Y, Liu C, Zhao Y, Hu K, Zhang J, Zeng M, Luo T, Jiang W and Wang H: Sevoflurane induces short‑term changes in proteins in the cerebral cortices of developing rats. Acta Anaesthesiol Scand 57: 380-390, 2013. 44. Liu XS, Xue QS, Zeng QW, Li Q, Liu J, Feng XM and Yu BW: Sevoflurane impairs memory consolidation in rats, possibly through inhibiting phosphorylation of glycogen synthase kinase-3β in the hippocampus. Neurobiol Learn Mem 94: 461-467, 2010. 45. Dong Y, Wu X, Xu Z, Zhang Y and Xie Z: Anesthetic isoflurane increases phosphorylated tau levels mediated by caspase activa- tion and Aβ generation. PLoS One 7: e39386, 2012. 37. Hardingham GE, Arnold FJ and Bading H: Nuclear calcium signaling controls CREB-mediated gene expression triggered by synaptic activity. Nat Neurosci 4: 261-267, 2001. 38. Wu GY, Deisseroth K and Tsien RW: Activity-dependent CREB phosphorylation: Convergence of a fast, sensitive calmodulin kinase pathway and a slow, less sensitive mitogen-activated protein kinase pathway. Proc Natl Acad Sci USA 98: 2808-2813, 2001. 39. Cao L, Li L, Lin D and Zuo Z: Isoflurane induces learning impairment that is mediated by interleukin 1β in rodents. PLoS One 7: e51431, 2012. 46. Ni MH, Wu CC, Chan WH, Chien KY and Yu JS: GSK-3 medi- ates the okadaic acid‑induced modification of collapsin response mediator protein-2 in human SK-N-SH neuroblastoma cells. J Cell Biochem 103: 1833-1848, 2008. 47. Wang Y, Yin H, Li J, Zhang Y, Han B, Zeng Z, Qiao N, Cui X, Lou J and Li J: Amelioration of β-amyloid-induced cognitive dysfunction and hippocampal axon degeneration by curcumin is associated with suppression of CRMP-2 hyperphosphorylation. Neurosci Lett 557: 112-117, 2013. 2073",mice,['Seven-day-old (P7) neonatal C57BL/6 mice were randomly divided into 2 groups and either exposed to 2.6% sevoflurane or air for 6 h.'],postnatal day 7,['Seven-day-old (P7) neonatal C57BL/6 mice were randomly divided into 2 groups and either exposed to 2.6% sevoflurane or air for 6 h.'],N,[],sevoflurane,['Seven-day-old (P7) neonatal C57BL/6 mice were randomly divided into 2 groups and either exposed to 2.6% sevoflurane or air for 6 h.'],none,[],c57bl/6,['Seven-day-old (P7) neonatal C57BL/6 mice were randomly divided into 2 groups and either exposed to 2.6% sevoflurane or air for 6 h.'],"The study investigates the influence of sevoflurane on MAPK and Akt/GSK-3β/CRMP-2 signaling pathways in the developing brain, addressing the unclear mechanisms of action behind sevoflurane-induced neurodegeneration.","['Prolonged exposure to volatile anesthetics causes neurodegeneration in developing animal brains. However, their underlying mechanisms of action remain unclear.']",None,[],"The study suggests that multiple signaling pathways, including ERK1/2, P38, and Akt/GSK-3β/CRMP-2, may be involved in sevoflurane-induced neuroapoptosis in the developing brain.","['These results suggest that multiple signaling pathways, including ERK1/2, P38 and Akt/GSK-3β/CRMP-2 may be involved in sevoflurane-induced neuroapoptosis in the developing brain.']","The study's limitations include the evaluation of protein expression changes only 2 hours after sevoflurane exposure and not over a longer duration, and the lack of specific inhibitors of p38 or GSK-3β to determine the exact mechanism of some signaling pathways following exposure to sevoflurane.","['The current study had several limitations. Firstly, the changes in the expression of proteins were only evaluated 2 h following sevoflurane exposure and were not observed over a longer duration, which may improve understanding regarding the changes in the expression of these proteins. Additionally, specific inhibitors of p38 or GSK‑3β were not used.']",None,[],True,True,False,True,True,True,10.3892/etm.2017.5651 10.3389/fncel.2019.00251,435.0,Li,2019,rats,postnatal day 7,N,ketamine,none,sprague dawley,"fncel-13-00251 June 12, 2019 Time: 17:26 # 1 ORIGINAL RESEARCH published: 13 June 2019 doi: 10.3389/fncel.2019.00251 17β-Estradiol Treatment Attenuates Neurogenesis Damage and Improves Behavior Performance After Ketamine Exposure in Neonatal Rats Weisong Li1, Huixian Li1, Haidong Wei1, Yang Lu1, Shan Lei1, Juan Zheng1, Haixia Lu2, Xinlin Chen2, Yong Liu2 and Pengbo Zhang1* 1 Department of Anesthesiology, The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China, 2 Institute of Neurobiology, National Key Academic Subject, Physiology of Xi’an Jiaotong University, Xi’an, China Ketamine exposure disturbed normal neurogenesis in the developing brain and resulted in subsequent neurocognitive deficits. 17β-estradiol provides robust neuroprotection in a variety of brain injury models in animals of both sexes and attenuates neurodegeneration induced by anesthesia agents. In the present study, we aimed to investigate whether 17β-estradiol could attenuate neonatal ketamine exposure- disturbed neurogenesis and behavioral performance. We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively. At PND 14, the rats were decapitated to detect neurogenesis in the subventricular zone (SVZ) and subgranular zone (SGZ) of the hippocampus by immunofluorescence staining. The proliferation, neuronal differentiation, and apoptosis of NSCs were assessed by immunohistochemistry method and TUNEL assay, respectively. The protein levels of cleaved caspase-3 in vivo in addition to GSK-3β and p-GSK-3β in vitro were examined by western blotting. Spatial learning and memory abilities were assessed by Morris water maze (MWM) test at PND 42–47. Ketamine exposure decreased cell proliferation in the SVZ and SGZ, inhibited NSC proliferation and neuronal differentiation, promoted NSC apoptosis and led to adult cognitive deficits. Furthermore, ketamine increased cleaved caspase-3 in vivo and decreased the expression of p-GSK-3β in vitro. Treatment with 17β-estradiol could attenuate ketamine-induced changes both in vivo and in vitro. For the first time we showed that 17β-estradiol alleviated ketamine-induced neurogenesis inhibition and cognitive dysfunction in the developing rat brain. Moreover, the protection of 17β-estradiol was associated with GSK-3β. Edited by: Hung-Ming Chang, Taipei Medical University, Taiwan Reviewed by: Yuriko Iwakura, Niigata University, Japan Hari Prasad Osuru, University of Virginia, United States Correspondence: Pengbo Zhang zhpbo@xjtu.edu.cn Specialty section: This article was submitted to Cellular Neurophysiology, a section of the journal Frontiers in Cellular Neuroscience Received: 25 December 2018 Accepted: 20 May 2019 Published: 13 June 2019 Citation: Li W, Li H, Wei H, Lu Y, Lei S, Zheng J, Lu H, Chen X, Liu Y and Zhang P (2019) 17β-Estradiol Treatment Attenuates Neurogenesis Damage and Improves Behavior Performance After Ketamine Exposure in Neonatal Rats. Front. Cell. Neurosci. 13:251. doi: 10.3389/fncel.2019.00251 Keywords: neural stem cells, ketamine, neurotoxicity, 17β-estradiol, p-GSK-3β INTRODUCTION Brain growth spurt (BGS) is critical for the normal development of the central nervous system. Substantial neurogenesis occurs in this period, which is characterized by abundant neural stem cell (NSC) changes including cell proliferation, differentiation, migration, and connection of neural cells (Muramatsu et al., 2007). In rodents, this period lasts from birth to the first 2 weeks of life Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 1 fncel-13-00251 June 12, 2019 Time: 17:26 # 2 17β-Estradiol and Neuroprotection Li et al. MATERIALS AND METHODS (Ponten et al., 2012). Since the developing brain is vulnerable to exogenous substrates during BGS, toxic insults may induce impairment in learning and memory abilities in functional adulthood (Eriksson, 1997; Eriksson et al., 2000). It was speculated that neurogenesis damage at an early age would cause cognitive impairment (Kang et al., 2017). Animal Protocols We performed all the experimental protocols according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80–23). The animal procedures were approved by the Animal Care and Use Committee of Xi’an Jiaotong University and designed to minimize the number and suffering of rats used. PND 7 and embryonic day 18–19 Sprague-Dawley rats were obtained from Laboratory Animal Centre of Xi’an Jiaotong University. Ketamine is a non-competitive blocker of N-methyl-D- aspartate (NMDA) receptor and is commonly used in pediatric anesthesia. Recent studies have shown that ketamine inhibits NSC proliferation and disturbs normal neurogenesis (Scallet et al., 2004; Lu et al., 2017), causes neuroapoptosis and neurodegeneration in the developing brain, which may ultimately lead to long-term neurocognitive and memory dysfunctions (Paule et al., 2011; Sabbagh et al., 2012). Although some underlying molecular signals such as the PKC/ERK1/2 pathway, reactive oxygen species-mediated mitochondria dysfunction, and glycogen synthase kinase 3β were speculated to be involved in pathophysiological abnormality induced by ketamine exposure (Huang et al., 2012; Bai et al., 2013; Liu et al., 2013), specific adjunctive therapy aiming to mitigate these negative effect of ketamine is still lacking. Morris Water Maze The spatial learning and memory function of rats after ketamine exposure were tested by MWM experiments as described in a previous study (Shen et al., 2013). Specifically, PND 42–47 rats (n = 10 per group) were trained for place trials and spatial probe tests in a large tank (diameter: 150 cm, depth: 60 cm), which was filled to a depth of 32 cm of warm water (maintained around 25 ± 1◦C) and divided into four quadrants. A platform (diameter: 12 cm, height: 30 cm) was placed in the center of the third quadrant (the target) and submerged approximately 2 cm beneath the water surface. We poured milk powder into the water to make the water opaque. We conducted the place trials at PND 42–46 with 4 trials daily at the same time point and performed the probe trials on PND 47 after 5 days’ training. The swimming of rats during the tests was recorded by a video tracking system installed above the tank. In place trials, rats were placed into four quadrants (spaced 20 min apart) to swim freely for a maximum of 120 s. If the rats could not find the platform within 120 s, they were allowed to stay on the platform for 20 s to observe the environment by guiding. The time for rats to reach the platform and swimming speed were recorded. In probes trials, the platform was removed and the rats were put into the first quadrant and allowed to swim for 120 s. The times of rats crossing the original platform were recorded. 17β-estradiol is a principal female hormone, which provides in robust neuroprotection in many brain injury models both sexes and attenuates neurodegeneration induced by anesthesia agents (McCullough and Hurn, 2003; Li et al., 2014). 17β-estradiol also plays a role as a potent modulator for physiological neurogenesis. NSCs derived from embryos and adults both express estrogen receptor a (ERa) and estrogen receptor b (ERb) (Brännvall et al., 2002). 17β-estradiol not only promotes the proliferation and neuronal differentiation of embryonic NSCs (Brännvall et al., 2002; Isgor and Watson, 2005; Kishi et al., 2005), but also regulates the migration of embryonic neuroblasts via ERb (Wang et al., 2003). 17β-estradiol synaptic transmission, and post-stroke neurogenesis (Garcia-Segura et al., 2001; Zheng et al., 2012). However, whether 17β-estradiol administration protects the developing brain from ketamine- caused neurogenesis cognitive dysfunction remains unclear. also enhances axonal sprouting, impairment and improves Anesthetic Exposure in vivo and Tissue Preparation The PND 7 rats, weighing 13–18 g, were housed with their mother and maintained at a temperature of 24◦C in a 12 h/12 h light/dark cycle with free access to food and water. We assigned the rats randomly into three groups (28 rats from 7 nests in each group, 4 pups per nest): (i) the rats in control group received equal volume of normal saline by intraperitoneal injection as ketamine solution at corresponding time points; (ii) the rats in ketamine group received 40 mg/kg ketamine, diluted in normal saline and administrated by intraperitoneal injection (ketamine, Sigma–Aldrich Inc. St. Louis, MO, United States), the initial injection was considered to be the loading dose, 30% of it was injected at approximately 40 min intervals to maintain the anesthesia for 4 h (Lu et al., 2017); (iii) the rats in the 17β-estradiol group received 17β-estradiol (17β-estradiol, Tocris, Minneapolis, MN, United States; DMSO, Sigma–Aldrich, St Louis, MO, United States) dissolved in dimethylsulfoxide (DMSO) at a concentration of 100 ug/ml, 100 ug/kg 17β-estradiol As a serine/threonine kinase, glycogen synthase kinase (GSK) 3β plays an important role in multiple fundamental functions of cell in the developing brain, including neurogenesis, apoptosis, cell cycle, cytoskeletal integrity, and axon growth (Hur and Zhou, 2010; Kandimalla et al., 2016). Exposure to ketamine decreased GSK-3β phosphorylation and induced neurotoxicity both in the NSCs and neurons of the neonatal rat brains (Bai et al., 2013; Liu et al., 2013; Huang et al., 2015; Lu et al., 2017). Increasing GSK-3β phosphorylation attenuated ketamine-induced neurogenesis disorder and neural cell injury (Lu et al., 2017, 2018). Interestingly, GSK-3β is also a downstream target of estradiol signaling (Shi et al., 2013; Wu et al., 2014). In the present study, we aimed to figure out whether 17β-estradiol could attenuate neurogenesis damage and cognitive dysfunction induced by ketamine exposure. We also investigated whether the GKS-3β signaling pathway participated in the protective effects of 17β-estradiol on ketamine-induced injury in neurogenesis. Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 2 fncel-13-00251 June 12, 2019 Time: 17:26 # 3 17β-Estradiol and Neuroprotection Li et al. solution (without Mg2+ and Ca2+, Gibco, Carlsbad, CA, United States). The tissues were then dissociated and triturated mechanically by a fire-polished Pasteur pipette softly. After centrifugation, the isolated cells were collected and re-suspended in free-serum DMEM/F12 medium (Gibco, Carlsbad, CA, United States) which was supplemented with 2% B27 (Gibco, Carlsbad, CA, United States), 20 ng/ml EGF (Gibco, Carlsbad, CA, United States), 20 ng/ml bFGF (Gibco, Carlsbad, CA, United States), and 100 U/ml penicillin and phytomycin. Cells were cultured for 7 days to form enough neurospheres and then passaged at a density of 2 × 105 cells/ml followed by collection and dissociation as previously described by Reynolds and Weiss (Reynolds et al., 1992). Half of the medium was changed every 3 days. After the second passage, the cells were ready for future experiments. For identification assessment, the cells after passage were seeded onto 100 µg/mL poly-L-lysine-coated coverslips and cultured in differentiating medium that contained 100× N2 supplement, 100× B27 supplement, and 1% fetal bovine serum (FBS, Gibco, Carlsbad, CA, United States) in DMEM/F12 (without b-FGF) for 7 days. administered intraperitoneally 8 h, 1 h prior to and 3 h after ketamine’s initial injection (Liu et al., 2007). During anesthesia, all pups were kept on an electric blanket with the temperature set at 36.5 ± 1◦C to maintain body temperature and reduce stress. We observed the respiratory rate, skin color, and body movement of rats carefully and tested the voluntary movement by clamping the pup tails. Pulse oxygen saturation (SpO2) was detected by attaching the infant pulse oximetry probes to the rat abdomen. After the anesthesia, the pups received BrdU (50 mg/kg, intraperitoneal injection) every 24 h for 7 consecutive days. On PND 14, the rats were decapitated and the brain tissues of SVZ and SGZ were harvested to detect neurogenesis. At 12 h after anesthesia, rat pups (n = 6 per group, captured randomly) were sacrificed by decapitation. Both the brain tissue from SVZ and SGZ were isolated immediately on ice and the stored at −80◦C until use for western blotting. The rats (n = 6 per group, captured randomly) were sacrificed and perfused transcardially with 0.9% saline 7 days after anesthesia, followed by cold 4% paraformaldehyde in PBS. Then the harvested brains were postfixed in 4% paraformaldehyde overnight at 4◦C and dehydrated in 30% sucrose solution for 3–4 days, as we described previously (Lu et al., 2017). The brain tissue from bregma +0.2 mm to bregma −6.0 mm was the region of interest, which were cut into 16 µm coronary tissue slices by freezing microtome (SLEE, Germany). These brain slices were collected and used for future immunohistochemistry staining. The rest of the rat pups (n = 10 per group) were bred for behavior study at adulthood. Drug Exposure and Neurogenesis Analysis in vitro The cells were assigned to the following groups: control group, ketamine group, and 17β-estradiol group. No drug treatment was added to the control group. NSCs in the ketamine group were exposed to 100 µM ketamine for 24 h. NSCs in the 17β-estradiol group were pretreated with 17β-estradiol (100 nM) for 30 min and then 100 µM of ketamine was added to the culture medium for 24 h. For proliferative analysis, NSCs were seeded on cover slips which were pre-coated with 100 µg/mL poly-L-lysine and incubated with BrdU for the last 4 h. Following being fixed with 4% paraformaldehyde, the cells were stained with BrdU antibody (1:200, Abcam, United Kingdom) and DAPI. As for neuronal differentiation analysis, after being exposed to ketamine with or without 17β-estradiol for 24 h, the cells were seeded on cover slips which were pre-coated with 100 µg/mL poly-L-lysine and incubated with differentiating medium for 7 days, then the cells were harvested for immunohistochemical staining. The cells were labeled with β-tubulin III antibody (1:500; Sigma-Aldrich Inc. St. Louis, MO, United States). Briefly, 5–7 randomly selected fields were captured in each coverslip, and the numbers of β-tubulin III-positive cells were counted (at least 200 cells per test case). Data were collected from three independent experiments. Immunohistochemistry Immunohistochemistry was used to evaluate NSC proliferation in SVZ and SGZ by BrdU staining. Firstly, the brain slices were incubated with 2 N HCl for 30 min to denaturate the DNA at 37◦C. After being incubated with 0.1 mol L−1 boric acid (pH 8.5) for 10 min at room temperature followed by three times washing with 0.1 M PBS, the slices were blocked by 2% goat serum and 0.3% Triton X-100 for 2 h at room temperature, then incubated with the mouse monoclonal anti-BrdU antibody (1:200, Abcam, United Kingdom) at 4◦C overnight. The next day, after three washings with 0.1 M PBS, the slices were incubated with tetramethyl rhodamine isothiocyanate (TRITC)-conjugated secondary antibodies for 2 h at room temperature. BrdU-positive cells were counted within defined regions of interest in the SVZ and SGZ. In total, the mean numbers of BrdU-positive cells of six brain slices for each rat, spaced approximately 200 µm apart, were examined by the observer blindly. For each slice, five regions were captured by fluorescence microscopy (BX51, Olympus, Tokyo, Japan), and the planar area enclosed by each region was 50 × 50 µm. The edges of the captured regions were defined according to structural details to ensure the fields did not overlap (Zhang et al., 2009). The density of positive cells was presented as the total number of BrdU-positive cells in the SVZ and SGZ. Cell Apoptosis Test (TUNEL) We used terminal dUTP nick-end Labeling assay after passage, the dissociated cells were exposed to ketamine with or without 17β-estradiol for 24 h. After the treatments, cells were fixed with 4% paraformaldehyde for 15 min. The TUNEL assay was performed according to the instruction (Roche Inc. Roche, of Mannheim, Germany). Data were collected from three independent experiments. to detect cell apoptosis. Briefly, NSC Culture Primary cultured NSCs were obtained from the cortex of rat at embryonic day 18–19 under sterile conditions. Briefly, the forebrain portion was isolated and placed in ice-cold Hank’s in situ Cell Death Detection Kit Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 3 fncel-13-00251 June 12, 2019 Time: 17:26 # 4 17β-Estradiol and Neuroprotection Li et al. Western Blot Analysis Brain tissues from the SVZ and SGZ of rats (n = 6 per group) at 12 h after anesthesia and cell cultures at 24 h following drug exposure were subjected to Western blot analyses as described in our previous studies (Lu et al., 2017). Briefly, the tissues were lysed by RIPA lysis buffer with protease and phosphatase inhibitors. The lysates were homogenized with an electric homogenizer and maintained on ice for 15 min. After being centrifuged for 15 min at 14000 rpm at 4◦C, the supernatant was aspirated and the resulting lysates were placed in a new tube. We used the BCA protein assay kit to examine the protein concentrations. Bovine serum albumin (BSA) was used as a standard. An equal amount of the resulting lysate was resolved by sodium dodecyl sulfate-polyacrylamide gel and the separated proteins were transferred to polyvinylidene fluoride membranes. After being blocked for 1 h at room temperature, the membranes were then incubated with appropriate dilutions of primary antibodies at 4◦C overnight. The used antibodies included anti- caspase-3 (cleaved, 17 KDa, 1:1000, Cell Signal Technology Inc. Beverly, MA, United States), anti-phosophorylated GSK-3β (p-GSK-3β, 1:1000, Cell Signal Technology Inc. Beverly, MA, United States), anti-GSK-3β (1:1000, Cell Signal Technology Inc. Beverly, MA, United States), and anti-β-actin (1:1000, Cell Signal Technology Inc., Beverly, MA, United States). The following day, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit or anti-mouse) for 2 h at room temperature. After being enhanced by chemiluminescence (ECL), the signals were then exposed to X-ray films. Each band in the Western blot represented an independent experiment and at least three independent experiments were conducted. Data were expressed as the ratio to optical density (OD) values of the corresponding controls. The Western blots were quantified as described in our previous study. to the ketamine group, the escape latency was decreased in the 17β-estradiol group on both trial days 3 and 4 [Figure 1C; F(2,48) = 62.35; p < 0.05]. The times to pass over the target platform and time spent in target area are shown in Figures 1D,E. Compared with the control group, rats in the ketamine group had less time to pass over the target platform and spent less time in the target area [F(2,72) = 89.64; p < 0.05]. In contrast, compared with the ketamine group, rats in the 17β-estradiol group passed over the target platform more frequently and spent more time in the target quadrant [F(2,60) = 70.35; p < 0.05]. Collectively, these results showed that ketamine exposure in neonatal rats would induce cognitive impairment in adulthood and that pretreatment with 17β-estradiol could attenuate this defect. 17β-Estradiol Enhanced Proliferation and Reduced Apoptosis of Cells in the SVZ and SGZ Following Ketamine Exposure BrdU incorporation was used to assess cell proliferation. As shown in Figure 2, BrdU-positive cells were distributed in the SVZ and SGZ among all groups. Less BrdU-positive cells were found in the SVZ and SGZ of the ketamine group. Increased BrdU-positive cells were detected in both regions of the control and 17β-estradiol groups. Quantitative analysis showed that the number of BrdU-positive cells in SVZ and in SGZ of ketamine group declined significantly when compared to the control group [F(2,36) = 31.97; p < 0.01, in SVZ and F(2,60) = 6.031; p < 0.01 in SGZ]. The number of BrdU-positive cells in the 17β-estradiol group was significantly higher than that of the ketamine group both in SVZ and in SGZ [F(2,36) = 31.97; p < 0.05 in SVZ and F(2,60) = 6.031; p < 0.05 in SGZ], respectively. However, it was less than that of the control group in SVZ [F(2,36) = 31.97; p < 0.05], but not in SGZ [F(2,60) = 6.031; p > 0.05] (Figure 2G). Considering the important role of cleaved caspase-3 in cell apoptosis (Moosavi et al., 2012), the protein levels of cleaved caspase-3 in the SVZ and SGZ 12 h after ketamine exposure were examined by Western blotting. When compared to the control group, where the levels of cleaved caspase-3 were relatively low, ketamine exposure increased the cleaved caspase- 3 expressions in both regions [F(2,6) = 8.627; p < 0.05, in SVZ and F(2,6) = 9.742; p < 0.05 in SGZ]. However, pretreatment with 17β-estradiol decreased protein expressions of cleaved caspase-3 in the SVZ and SGZ of neonatal rats after ketamine exposure[F(2,6) = 8.627; p < 0.05, in SVZ and F(2,6) = 9.742; p < 0.05 in SGZ] (Figure 2H). Statistical Analysis Data obtained from the study were presented as mean ± SEM. Every data point represented a mean for each animal in a single case. SigmaPlot 12.0 was used for all statistical analysis. Data were tested and then confirmed with normality and equal variance criteria. A one-way analysis of variance (ANOVA) following the post hoc Holm-Sidak method was used to analyze the differences among different groups. A two-tailed probability value P < 0.05 was considered statistically significant. RESULTS 17β-Estradiol Rescued Proliferation and Apoptosis of NSCs Following Ketamine Exposure While It Reversed the Decrease of Neuron Production Induced by Ketamine To identify the characteristics of cultured cells, we first stained the cells with NSC marker nestin 3 days after seeding. The results showed that both in suspension and adherent culture most of the cells were nestin-positive. The percentages of nestin-positive cells were 96.0 ± 2.1 and 17β-Estradiol Improved Ketamine-Induced Decline of Learning and Memory The MWM test results are shown in Figure 1. There was no significant difference in the swimming speed among the control, ketamine, and 17β-estradiol groups [Figure 1B; F(2,36) = 8.956; p > 0.05]. When compared to the control group, the escape latency was increased in the ketamine group on trial day 3 [Figure 1C; F(2,48) = 50.65; p < 0.05]. However, when compared Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 4 fncel-13-00251 June 12, 2019 Time: 17:26 # 5 17β-Estradiol and Neuroprotection Li et al. FIGURE 1 | Diagram of the study and results of Morris water maze trials. (A) The diagram of the timeline of the study. (B) Swimming speed comparison between three groups during the training. There was no difference among three groups. (C) Comparison of the latency to reach the hidden platform. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. (D) Comparison of the numbers to pass over the target platform. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. (E) Comparison of the time spent in target quadrant. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. Data are present as the means ± SEM. n = 6 in each group. 95.0 ± 2.0%, respectively (Figures 3A,B). After incubation the cultured cells with differentiating medium for 7 days, expressed neuronal marker β-tubulin III (22.3 ± 1.9%, Figures 3C,D) and astrocytes marker glial fibrillary acidic (59.8 ± 3.2%, Figures 3C,D). Taken protein (GFAP) together, the cells used in this study were NSCs. cells following ketamine exposure. There was no significant difference between the 17β-estradiol group and the control group [F(2,42) = 148.6; p > 0.05] (Figure 3H). These findings indicated that 17β-estradiol rescued the proliferation of NSCs exposed to ketamine. by differentiation of NSCs was immunofluorescence staining of β-tubulin III (Figures 3I–K). Ketamine exposure for 24h decreased the percentage of β-tubulin III-positive inhibited neuronal indicating ketamine production from NSCs. However, co-administration with 17β-estradiol reversed the effects of ketamine on neuronal production [F(2,42) = 60.36; p < 0.05] (Figure 3L, p < 0.05). There was no significant difference between the 17β-estradiol Neuronal assessed these data suggested that To examine the proliferation of NSCs in vitro, BrdU incorporation method was used (Figures 3E–G). It was shown that the number of BrdU-positive cells was decreased after exposure to ketamine for 24 h when compared to the control group [F(2,42) = 148.6; p < 0.05]. However, pretreatment with 17β-estradiol increased the number of BrdU-positive cells, Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 5 fncel-13-00251 June 12, 2019 Time: 17:26 # 6 17β-Estradiol and Neuroprotection Li et al. FIGURE 2 | The proliferative changes in the SVZ and SGZ. (A–F) Representative images of BrdU immunoreactive cells (red) in the SVZ and SGZ 7 days after anesthesia. Scale bar = 100 µm. (G) Quantification of BrdU-positive cells following different treatment. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. (H) The expression and quantification of caspase-3 by western blotting in the SVZ and SGZ 12 h after anesthesia. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. Data are presented as the means ± SEM. n = 6 in each group. group and the control group [F(2,42) = 60.36; p > 0.05]. These findings indicated that 17β-estradiol rescued the decrease of neuronal production from NSCs exposed to ketamine. control condition. However, pretreatment with 17β-estradiol significantly reduced NSC apoptosis induced by ketamine exposure [F(2,42) = 27.81; p < 0.05] (Figure 3P). We used western blotting to determine related molecules involved in ketamine-induced damage and 17β-estradiol- elicited neuroprotection (Figures 4A,B). The results showed that ketamine exposure for 24h increased cleaved caspase- 3 expression [F(2,24) = 76.59; p < 0.05] and decreased Next, we used TUNEL staining to assess the apoptosis of NSCs, aiming to investigate whether 17β-estradiol could reduce NSC apoptosis induced by ketamine exposure (Figures 3M–O). After ketamine exposure, the number of TUNEL positive cells was obviously increased when compared with the Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 6 fncel-13-00251 June 12, 2019 Time: 17:26 # 7 17β-Estradiol and Neuroprotection Li et al. FIGURE 3 | Identification of cultured cells and the proliferation, differentiation as well as apoptosis of NSCs following different treatment. (A) Images of nestin (red) immunoreactive neurosphere. (B) Images of nestin (red) immunoreactive NSCs. (C) Images of NSCs differentiating into neurons (red) and astrocyte (green). Scale bar = 100 µm. (D) Rate of specific cellular phenotype to total cells (DAPI, blue). (E–G) Representative images of BrdU immunoreactive cells (red) in control, ketamine, and 17β-estradiol group, respectively. Scale bar = 100 µm. (H) Quantification of BrdU-positive cells following different treatment. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. (I–K) Representative images of β-tubulinimmunoreactive cells (red) in control, ketamine, and 17β-estradiol group, respectively. Scale bar = 50 µm. (L) Quantification of β-tubulin III -positive cells following different treatment. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. (M–O) Representative images of TUNEL immunoreactive cells (green) in control, ketamine, and 17β-estradiol groups, respectively. Scale bar = 50 µm. (P) Quantification of TUNEL-positive cells following different treatment. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. Data were collected from three independent experiments and are presented as the means ± SEM. that GSK-3β and caspase-3 were These findings involved in ketamine-induced apoptosis and 17β-estradiol elicited protection. p-GSK-3β expression [F(2,42) = 43.28; p < 0.05] in NSCs compared to the control. Pretreatment with 17β-estradiol decreased the levels of cleaved caspase-3 [F(2,24) = 76.59; p < 0.05] and prevented the deregulation of p-GSK-3β expressions [F(2,42) = 43.28; p < 0.05] in NSCs exposed to ketamine for 24 h. However, there were no differences in the protein expressions of p-GSK-3β [F(2,42) = 43.28; p > 0.05] and cleaved caspase-3 [F(2,24) = 76.59; p > 0.05] between the control group and 17β-estradiol group (Figures 4C,D). suggest DISCUSSION In the present study, our data showed that treatment with 17β-estradiol improved neonatal ketamine exposure-induced Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 7 fncel-13-00251 June 12, 2019 Time: 17:26 # 8 17β-Estradiol and Neuroprotection Li et al. FIGURE 4 | Detection of cleaved caspase-3 and pGSK-3β by western blotting. (A,B) Representative images of western blotting analysis of the cleaved caspase-3 and pGSK-3β in NSCs 24 h following drug exposure. (C,D) Quantification of cleaved caspase-3 and pGSK-3β expression normalized to β-actin following different treatment. ∗p < 0.05 compared with control group, #p < 0.05 compared with ketamine group. Data were collected from three independent experiments and are expressed as the ratio to optical density (OD) values of the corresponding controls. maze at an older age than that used in this study (Li et al., 2014). These findings indicate a potential strategy for prevention of ketamine-induced neurocognitive deficits. cognitive deficits and mitigated ketamine-caused changes in cellular proliferation and apoptosis in the SVZ and SGZ. Treatment with 17β-estradiol rescued neurogenesis and reduced apoptosis of NSCs exposed to ketamine in vitro, in which GSK-3β might play a role in 17β-estradiol-elicited protection. Many studies showed that ketamine caused neuroapoptosis and neurodegeneration in the developing brain, which may finally induce learning and memory disabilities in adults (Fredriksson et al., 2007; Paule et al., 2011; Huang et al., 2012; Moosavi et al., 2012; Sabbagh et al., 2012). However, few studies reported the effect of ketamine on neurogenesis and its long-term outcome in vivo. In mammals, new neurons are generated continuously to certain brain areas throughout life. These neurons are differentiated from NSCs located primarily in the SVZ and SGZ. Proliferation and/or survival of NSCs are the basic events in neurogenesis. Considering the significance of neurogenesis during the BGS period, we evaluated the NSC proliferation and survival using BrdU labeling and apoptosis analysis. It was shown that ketamine inhibited the cell proliferation in the neurogenesis regions of neonatal rats, indicating that neonatal ketamine exposure might impair neurogenesis. This is consistent with previous studies (Huang et al., 2015, 2016; Dong et al., 2016). Interestingly, we observed that 17β-estradiol alleviates cellular proliferating changes induced by ketamine in neurogenesis regions of neonatal rats, indicating that 17β-estradiol enhanced NSC proliferation following ketamine exposure during brain development, which is a benefit in vitro The toxicity of general anesthesia on the developing brain has raised concern in recent years. It is a consensus that repeated exposure to general anesthetic before 3 years of age is harmful to the developing brain (Hu et al., 2017). Ketamine is a commonly used anesthetic in pediatric clinics. It has been proven that ketamine can lead to long-lasting cognitive impairments in rodent and primate models (Fredriksson et al., 2007; Paule et al., 2011; Huang et al., 2012; Moosavi et al., 2012; Zhao et al., 2014). Unfortunately, there has been no safe and effective measure to prevent this deficit until now. To evaluate whether 17β-estradiol could improve the learning and memory ability of adult rats that were subjected to ketamine exposure during the neonatal stage, the Morris water maze was used in this study. The rats in the 17β-estradiol group passed over the target platform more frequently and spent more time in the target area compared with the ketamine group, suggesting that 17β-estradiol ameliorates long-lasting cognitive dysfunction in rodents who received ketamine in the early stage of life. Consistently, Li et al. also reported that 17β-estradiol attenuated long-term cognitive impairments in developing rats though they used higher doses of ketamine and 17β-estradiol and performed the Morris water for neurogenesis. Furthermore, our Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 8 fncel-13-00251 June 12, 2019 Time: 17:26 # 9 17β-Estradiol and Neuroprotection Li et al. study demonstrated that 17β-estradiol rescued proliferation and neuronal production of NSCs exposed to ketamine. Whether anesthetic-induced neurogenesis inhibition contributes to any disabilities in learning and memory functions remains unknown. Our recent work showed that restoration of neurogenesis in SVZ and SGZ in neonatal rats could improve the neonatal ketamine exposure-induced adult spatial learning and memory deficits (Lu et al., 2017). In this study, treatment with 17β-estradiol mitigated ketamine-induced changes in neurogenesis and cognitive deficits. Li et al. reported that ketamine induced neuroapoptosis in the prefrontal cortex of the developing brain and caused long- term cognitive dysfunction in adulthood, and treatment with 17β-estradiol attenuated ketamine-induced damages (Li et al., 2014). Our previous work showed that ketamine exposure did not increase the rate of TUNEL-positive cells in the frontal cortex (Lu et al., 2017). The discrepancy might be due to dose of drugs, regions of interest and endpoints of observation. Collectively, our findings supported a causal link between neurogenesis damage and cognitive dysfunction in neurodevelopmental toxicity of anesthetics. of NSCs was investigated in the study. Later studies should select more indexes to detect differentiation of NSCs in vitro. Thirdly, GSK-3β is the target of numerous molecules, but we did not investigate the upstream and downstream signal of GSK-3β caused by ketamine or 17β-estradiol, and further studies are needed. CONCLUSION In conclusion, using a model of neurotoxicity following ketamine exposure to neonatal rats, we found that ketamine exposure increased apoptosis and decreased proliferation of cells in the SVZ and SGZ, leading to a decline in spatial learning and memory abilities in adulthood. Administration of 17β-estradiol enhanced neurogenesis by decreasing apoptosis and increasing proliferation of NSCs. Furthermore, GSK-3β might be an important molecule that is involved in this process. The present findings provide an experimental basis for the use of 17β-estradiol as a therapeutic drug against the development neurotoxicity of ketamine. Clinically, the results suggest 17β-estradiol may help to prevent ketamine- induced developmental neurotoxicity and GSK-3β may become a molecular target for its treatment. Nevertheless, a much work still needs to be done before clinical use, because a more specific treatment target should be developed and translated to humans. Apoptosis is a critical procedure during the development of the neural system, which occurs at various developmental stages from neurogenesis to adulthood (Hara et al., 2018). However, exogenous insult-induced apoptosis had a lasting impact on neurogenesis in the developing brain (Sokolowski et al., 2013). Maintenance of the homeostasis of neurogenesis provides basis for normal brain structure and function. As an antagonist of non-competitive NMDA receptor, ketamine induced NSC apoptosis by activation of GSK-3β (Lu et al., 2018). It was reported that ketamine induced neuroapoptosis in the prefrontal cortex accompanied by the downregulation of 17β-estradiol, BDNF, and p-Akt in neonatal rats, and treatment with 17β-estradiol attenuated ketamine-induced injuries (Li et al., 2014). We found that treatment with 17β-estradiol decreased NSC apoptosis and increased p-GSK-3β levels, indicating that 17β-estradiol decreased NSC apoptosis by inactivation of GSK- 3β. Further study needs to be done to elucidate how ketamine or 17β-estradiol affect GSK-3β phosphorylation in the NSCs. NSCs express ERa and ERb (Brännvall et al., 2002). 17β-estradiol promotes NSC proliferation and differentiation into neurons (Brännvall et al., 2002; Isgor and Watson, 2005; Kishi et al., 2005). In the present study, whether the protection of 17β-estradiol on ketamine-induced neurogenesis damage is merely due to the increase in NSC proliferation and neuronal differentiation or the decrease in NSC apoptosis needs to be further studied. ETHICS STATEMENT This in accordance with the recommendations of the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80–23). The protocol was approved by the Animal Care and Use Committee of Xi’an Jiaotong University. study was carried out AUTHOR CONTRIBUTIONS PZ, WL, and HuL conceived and designed the experiments. WL, HuL, YaL, SL, and JZ performed the experiments. HW, SL, and XC analyzed the data. HaL and YoL contributed with the Materials and Methods, and critically revised the manuscript. All authors wrote the manuscript. FUNDING Although some important discoveries were revealed by these studies, it is worth emphasizing that several limitations exist. Firstly, NSC differentiation, neuronal apoptosis, or migration in the developing brain were not detected because our main aim for this study was to observe whether anesthesia doses of ketamine could inhibit NSC proliferation, induce NSC apoptosis in neonatal rats, and cause cognitive deficits in adults as well as whether treatment with 17β-estradiol could attenuate these changes. Further study should be done to reveal NSC differentiation, neuronal apoptosis, or migration in the developing brain exposed to ketamine with or without 17β-estradiol. Secondly, only in vitro neuronal differentiation This work was supported by the National Natural Science Foundation of China (81071071 and 81171247), Key Scientific Innovation Team of Shaanxi Province and Technological (2014KCT-22), and Science and Technology Development Project of Shaanxi Province (2013KTCL03-09). ACKNOWLEDGMENTS The thank authors reading the manuscript. Prof. Malgorzata Garstka for Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 9 fncel-13-00251 June 12, 2019 Time: 17:26 # 10 17β-Estradiol and Neuroprotection Li et al. REFERENCES Liu, J. R., Baek, C., Han, X. H., Shoureshi, P., and Soriano, S. G. (2013). Role of glycogen synthase kinase-3beta in ketamine-induced developmental neuroapoptosis in rats. Br. J. Anaesth. 110(Suppl. 1), i3–i9. doi: 10.1093/bja/ aet057 Bai, X., Yan, Y., Canfield, S., Muravyeva, M. Y., Kikuchi, C., Zaja, I., et al. (2013). Ketamine enhances human neural stem cell proliferation and induces neuronal apoptosis via reactive oxygen species-mediated mitochondrial pathway. Anesth. Analg. 116, 869–880. doi:10.1213/ANE.0b013e31828 60fc9 Liu, R., Wang, X., Liu, Q., Yang, S. H., and Simpkins, J. W. (2007). Dose dependence and therapeutic window for the neuroprotective effects of 17beta-estradiolwhen doi: administered after cerebral 10.1016/j.neulet.2007.01.074 ischemia. Neurosci. Lett. 415, 237–241. Brännvall, K., Korhonen, L., and Lindholm, D. (2002). Estrogen- stem cell proliferation and doi:10.1006/mcne.2002. receptor-dependent differentiation. Mol. Cell Neurosci. 21, 512–520. 1194 regulation of neural Lu, P., Lei, S., Li, W., Lu, Y., Zheng, J., Wang, N., et al. (2018). Dexmedetomidine protects neural stem cells from ketamine-induced injury. Cell Physiol. Biochem. 47, 1377–1388. doi: 10.1159/000490823 Dong, C., Rovnaghi, C. R., and Anand, K. J. (2016). Ketamine exposure during embryogenesis inhibits cellular proliferation in rat fetal cortical neurogenic regions. Acta Anaesthesiol. Scand. 60, 579–587. doi: 10.1111/aas.12689 Lu, Y., Giri, P. K., Lei, S., Zheng, J., Li, W., Wang, N., et al. (2017). Pretreatment with minocycline restores neurogenesis in the subventricular zone and subgranular zone of the hippocampus after ketamine exposure in neonatal rats. Neuroscience 352, 144–154. doi: 10.1016/j.neuroscience.2017.03.057 Eriksson, P. (1997). Developmental neurotoxicity of environmental agents in the neonate. Neurotoxicology 18, 719–726. McCullough, L. D., and Hurn, P. D. (2003). Estrogen and ischemic neuroprotection: an integrated view. Trends Endocrinol. Metab. 14, 228–235. doi: 10.1016/s1043-2760(03)00076-6 Eriksson, P., Ankarberg, E., and Fredriksson, A. (2000). Exposure to nicotine during a defined period in neonatal life induces permanent changes in brain nicotinic receptors and in behaviour of adult mice. Brain Res. 853, 41–48. doi: 10.1016/s0006-8993(99)02231-3 Moosavi, M., Yadollahi Khales, G., Rastegar, K., and Zarifkar, A. (2012). The effect of sub-anesthetic and anesthetic ketamine on water maze memory acquisition, consolidation and retrieval. Eur. J. Pharmacol. 677, 107–110. doi: 10.1016/j. ejphar.2011.12.021 Fredriksson, A., Ponten, E., Gordh, T., and Eriksson, P. (2007). Neonatal exposure to a combination of N-methyl-D-aspartate and gamma-aminobutyric acid type a receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107, 427–436. doi: 10.1097/01. anes.0000278892.62305.9c Muramatsu, R., Ikegaya, Y., Matsuki, N., and Koyama, R. (2007). Neonatally born granule cells numerically dominate adult mice dentate gyrus. Neuroscience 148, 593–598. doi: 10.1016/j.neuroscience.2007.06.040 Garcia-Segura, L. M., Azcoitia, I., and DonCarlos, L. L. (2001). Neuroprotection by estradiol. Prog. Neurobiol. 63, 29–60. doi: 10.1016/s0301-0082(00)00025-3 Hara, Y., Sudo, T., Togane, Y., Akagawa, H., and Tsujimura, H. (2018). Cell death in neural precursor cells and neurons before neurite formation prevents the emergence of abnormal neural structures in the Drosophila optic lobe. Dev. Biol. 436, 28–41. doi: 10.1016/j.ydbio.2018.02.004 Paule, M. G., Li, M., Allen, R. R., Liu, F., Zou, X., and Hotchkiss, C. H. (2011). Ketamine anesthesia during the first week of life can cause long- lasting cognitive deficits in rhesus monkeys. Neurotoxicol. Teratol. 33, 220–230. doi: 10.1016/j.ntt.2011.01.001 Ponten, E., Viberg, H., Gordh, T., Eriksson, P., and Fredriksson, A. (2012). Clonidine abolishes the adverse effects on apoptosis and behaviour after neonatal ketamine exposure in mice. Acta Anaesth. Scand. 56, 1058–1065. doi: 10.1111/j.1399-6576.2012.02722.x Hu, D., Flick, R. P., Zaccariello, M. J., Colligan, R. C., Katusic, S. K., Schroeder, D. R., et al. (2017). Association between exposure of young children to procedures requiring general anesthesia and learning and behavioral outcomes in a population-based birth cohort. Anesthesiology 127, 227–240. doi: 10.1097/ ALN.0000000000001735 Reynolds, B. A., Tetzlaff, W., and Weiss, S. (1992). A multipotent EGF- responsive cell produces neurons and astrocytes. J. Neurosci. 12, 4565–4574. doi: 10.1523/jneurosci.12-11-04565. 1992 striatal embryonic progenitor Huang, H., Liu, C. M., Sun, J., Hao, T., Xu, C. M., Wang, D., et al. (2016). Ketamine affects the neurogenesis of the hippocampal dentate gyrus in 7- day-old Rats. Neurotox. Res. 30, 185–198. doi: 10.1007/s12640-016-9615- 9617 Sabbagh, J. J., Heaney, C. F., Bolton, M. M., Murtishaw, A. S., and Kinney, J. W. (2012). Examination of ketamine-induced deficits in sensorimotor gating and spatial learning. Physiol. Behav. 107, 355–363. doi: 10.1016/j.physbeh.2012.0 8.007 Huang, H., Liu, L., Li, B., Zhao, P. P., Xu, C. M., Zhu, Y. Z., et al. (2015). Ketamine interferes with the proliferation and differentiation of neural stem cells in the subventricular zone of neonatal rats. Cell Physiol. Biochem. 35, 315–325. doi: 10.1159/000369698 Scallet, A. C., Schmued, L. C., Slikker, W., Grunberg, N., Faustino, P. J., Davis, H., et al. (2004). Developmental neurotoxicity of ketamine: morphometric labeling of confirmation, exposure parameters, and multiple fluorescent apoptotic neurons. Toxicol. Sci. 81, 364–370. doi: 10.1093/toxsci/kfh224 Huang, L., Liu, Y., Jin, W., Ji, X., and Dong, Z. (2012). Ketamine potentiates hippocampal neurodegeneration and persistent learning and memory impairment through the PKC gamma-ERK signaling pathway in the developing brain. Brain Res. 1476, 164–171. doi: 10.1016/j.brainres.2012.07.059 Shen, X., Dong, Y., Xu, Z., Wang, H., Miao, C., Soriano, S. G., et al. (2013). Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 118, 502–515. doi: 10.1097/ALN. 0b013e3182834d77 Hur, E. M., and Zhou, F. Q. (2010). GSK3 signalling in neural development. Nat. Rev. Neurosci. 11, 539–551. doi: 10.1038/nrn2870 Shi, C., Wu, F., Zhu, X. C., and Xu, J. (2013). Incorporation of beta-sitosterol into the membrane increases resistance to oxidative stress and lipid peroxidation via estrogen receptor-mediated PI3K/GSK3beta signaling. Biochim. Biophys. Acta 1830, 2538–2544. doi: 10.1016/j.bbagen.2012.12.012 Isgor, C., and Watson, S. J. (2005). Estrogen receptor alpha and beta mRNA expressions by proliferating and differentiating cells in the adult rat dentate gyrus and subventricular zone. Neuroscience 134, 847–856. doi: 10.1016/j. neuroscience.2005.05.008 Sokolowski, K., Obiorah, M., Robinson, K., McCandlish, E., Buckley, B., and DiCicco-Bloom, E. (2013). Neural stem cell apoptosis after low-methylmercury exposures loss and in postnatal hippocampus produce persistent cell adolescent memory deficits. Dev. Neurobiol. 73, 936–949. doi: 10.1002/dneu.2 2119 Kandimalla, R., Thirumala, V., and Reddy, P. H. (2016). Is Alzheimer’s disease a type 3 diabetes? a critical appraisal. Biochim. Biophys. Acta 1863, 1078–1089. doi: 10.1016/j.bbadis.2016.08.018 Kang, E., Berg, D. A., Furmanski, O., Jackson, W. M., Ryu, Y. K., Gray, C. D., et al. (2017). Neurogenesis and developmental anesthetic neurotoxicity. Neurotoxicol. Teratol. 60, 33–39. doi: 10.1016/j.ntt.2016.10.001 Wang, L., Andersson, S., Warner, M., and Gustafsson, J. A. (2003). Estrogen receptor (ER)beta knockout mice reveal a role for ERbeta in migration of cortical neurons in the developing brain. Proc. Natl. Acad. Sci. U.S.A. 100, 703–708. doi: 10.1073/pnas.242735799 Kishi, Y., Takahashi, J., Koyanagi, M., Morizane, A., Okamoto, Y., and Horiguchi, S. (2005). Estrogen promotes differentiation and survival of dopaminergic neurons derived from human neural stem cells. J. Neurosci. Res. 79, 279–286. doi: 10.1002/jnr.20362 Wu, J., Williams, D., Walter, G. A., Thompson, W. E., and Sidell, N. (2014). Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells. Exp. Cell Res. 328, 351–360. doi: 10.1016/j.yexcr. 2014.08.030 Zhang, P., Li, Li, J., Wang, B., Wu, H., Yu, Y., Xue, G., and Hou, Y. (2014). 17beta-estradiol attenuates ketamine-induced neuroapoptosis and persistent cognitive deficits in the developing brain. Brain Res. 1593, 30–39. doi: 10.1016/j.brainres.2014.0 9.013 J., Liu, Y., Chen, X., Kang, Q., Zhao, J., et al. (2009). and Human neural stem cell transplantation attenuates apoptosis Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 10 fncel-13-00251 June 12, 2019 Time: 17:26 # 11 17β-Estradiol and Neuroprotection Li et al. Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. improves neurological Anaesthesiol. 024.x functions after cerebral 1184–1191. doi: 53, ischemia in rats. Acta 10.1111/j.1399-6576.2009.02 Scand. Zhao, T., Li, Y., Wei, W., Savage, S., Zhou, L., and Ma, D. (2014). Ketamine administered to pregnant rats in the second trimester causes long-lasting behavioral disorders in offspring. Neurobiol. Dis. 68, 145–155. doi: 10.1016/j. nbd.2014.02.009 Copyright © 2019 Li, Li, Wei, Lu, Lei, Zheng, Lu, Chen, Liu and Zhang. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Zheng, J., Zhang, P., Li, X., Lei, S., Li, W., He, X., et al. (2012). Post-stroke estradiol treatment enhances neurogenesis in the subventricular zone of rats after permanent focal cerebral ischemia. Neuroscience 231, 82–90. doi: 10.1016/ j.neuroscience.2012.11.042 Frontiers in Cellular Neuroscience | www.frontiersin.org June 2019 | Volume 13 | Article 251 11",rats,"['We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively.']",postnatal day 7,"['We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively.']",Y,['Spatial learning and memory abilities were assessed by Morris water maze (MWM) test at PND 42–47.'],ketamine,"['We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively.']",17β-estradiol,"['We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively.']",sprague dawley,"['We treated 7-day-old (Postnatal day 7, PND 7) Sprague-Dawley rats and neural stem cells (NSCs) with either normal saline, ketamine, or 17β-estradiol before/after ketamine exposure, respectively.']",The study aimed to investigate whether 17β-estradiol could attenuate neonatal ketamine exposure-disturbed neurogenesis and behavioral performance.,"['In the present study, we aimed to investigate whether 17β-estradiol could attenuate neonatal ketamine exposure- disturbed neurogenesis and behavioral performance.']",None,[],The study argues that 17β-estradiol alleviated ketamine-induced neurogenesis inhibition and cognitive dysfunction in the developing rat brain.,['For the first time we showed that 17β-estradiol alleviated ketamine-induced neurogenesis inhibition and cognitive dysfunction in the developing rat brain.'],None,[],The potential application of 17β-estradiol as a therapeutic drug against developmental neurotoxicity of ketamine.,['The present findings provide an experimental basis for the use of 17β-estradiol as a therapeutic drug against the development neurotoxicity of ketamine.'],True,True,False,True,False,True,10.3389/fncel.2019.00251 10.1016/j.neuropharm.2007.09.005,531.0,Li,2007,rats,gestational day 21,Y,isoflurane,none,sprague dawley,"Available online at www.sciencedirect.com Neuropharmacology 53 (2007) 942e950 www.elsevier.com/locate/neuropharm Effects of fetal exposure to isoflurane on postnatal memory and learning in rats Yujuan Li a,b, Ge Liang a, Shouping Wang a,b, Qingcheng Meng a, Qiujun Wang a,c, Huafeng Wei a,* a Department of Anesthesiology and Critical Care, University of Pennsylvania, 305 John Morgan Building, 3620 Hamilton Walk, Philadelphia, PA 19104, USA b Department of Anesthesia, Second Affiliated Hospital of Sun Yat-Sen University, Guangzhou 510120, China c Department of Anesthesiology, The Third Clinical Hospital, Hebei Medical University, Shijiazhuang 050051, China Received 9 March 2007; received in revised form 9 August 2007; accepted 10 September 2007 Abstract In a maternal fetal rat model, we investigated the behavioral and neurotoxic effects of fetal exposure to isoflurane. Pregnant rats at gestational day 21 were anesthetized with 1.3% isoflurane for 6 h. Apoptosis was quantified in the hippocampus and cortex at 2 and 18 h after exposure in the fetal brain and in the postnatal day 5 (P5) pup brain. Spatial memory and learning of the fetal exposed pups were examined with the Morris Water Maze at juvenile and adult ages. Rat fetal exposure to isoflurane at pregnancy day 21 through maternal anesthesia significantly decreased spontaneous apoptosis in the hippocampal CA1 region and in the retrosplenial cortex at 2 h after exposure, but not at 18 h or at P5. Fetal ex- posure to isoflurane did not impair subsequent juvenile or adult postnatal spatial reference memory and learning and, in fact, improved spatial memory in the juvenile rat. These results show that isoflurane exposure during late pregnancy is not neurotoxic to the fetal brain and does not impair memory and learning in the juvenile or adult rat. (cid:2) 2007 Elsevier Ltd. All rights reserved. Keywords: Anesthetics; Fetus; Developing brain; Apoptosis; Memory; Learning 1. Introduction Anesthetics cause neurotoxicity in a concentration and time dependent manner in in vitro neuronal models (Chang and Chou, 2001; Eckenhoff et al., 2004; Kim et al., 2006; Kvolik et al., 2005; Loop et al., 2005; Matsuoka et al., 2001; Wei et al., 2005; Wise-Faberowski et al., 2005; Xie et al., 2006, 2007). Relatively fewer studies have investigated the neuro- toxic effects of anesthetics in in vivo models. Isoflurane expo- sure at a clinically relevant concentration (0.75%) for 6 h during postnatal development in rats caused persistent memory and learning deficits, which was associated with widespread neuronal apoptosis (Jevtovic-Todorovic et al., 2003; Yon Corresponding author. Tel.: þ1 215 662 3193; fax: þ1 215 349 5078. E-mail address: weih@uphs.upenn.edu (H. Wei). et al., 2005). Neurons in the developing brain are specifically vulnerable to isoflurane neurotoxicity (Jevtovic-Todorovic et al., 2003). However, the mechanisms for isoflurane neuro- toxicity are unknown. Since anesthetics easily cross the placenta, the developing fetal brain will be exposed to inhaled anesthetics, such as iso- flurane, when pregnant women require surgery. In some cases, such as fetal surgery to correct various congenital malforma- tions during mid-gestation (18e25 weeks) (Myers et al., 2002), the fetal brain can be exposed to 2e3 times (2.5e3 minimal alveolar concentration (MAC)) higher than normal concentrations of inhaled anesthetics, in order to relax uterine smooth muscle and provide adequate anesthesia (Cauldwell, 2002; Myers et al., 2002). Although fetal surgery is relatively new, it is a rapidly growing and evolving area, and may be- come standard therapy for most disabling malformations that 0028-3908/$ - see front matter (cid:2) 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2007.09.005 Y. Li et al. / Neuropharmacology 53 (2007) 942e950 are currently treated in young infants (Goldsmith et al., 1999; Myers et al., 2002). Because most fetal surgeries in humans are performed during mid-gestation, it is important and urgent to know if the anesthetics used cause damage to the develop- ing brain and subsequent postnatal memory problems and learning disabilities. The aim of the current study was to determine whether exposure to clinically relevant concentrations of isoflurane during prenatal development causes neuronal apoptosis and postnatal learning and memory deficits. 2. Materials and methods 2.1. Animals Institute of Animal Care and Use Committee (IACUC) at the University of Pennsylvania approved all experimental procedures and protocols used in this study. All efforts were made to minimize the number of animals used and their suffering. SpragueeDawley pregnant rats (Charles River Laboratories, Inc Wilmington, MA) were housed in polypropylene cages and the room temper- ature was maintained at 22 (cid:2)C, with a 12 h lightedark cycle. Pregnant rats at gestation day 21 (E21) were used for all experiments because it approximately corresponds to mid-gestation in human beings according to the theory of brain growth spurt (Dobbing and Sands, 1979; Jevtovic-Todorovic et al., 2003), and is a common time for most fetal surgeries (18e25 weeks) (Myers et al., 2002). We have designed the following three related studies: (1) pilot study; (2) neurodegeneration study; (3) finally a behavioral study. A pilot study was first conducted to find the highest concentration of isoflurane not accompanied by significant arterial blood gas (ABG) and mean arterial blood pressure (MABP) changes in the mothers. A neurodegeneration study was used to determine the appearance of apoptosis by detection of caspase-3 and TUNEL (terminal de- oxynucleotidyl transferase biotin-dUTP nick end labeling) positive cells in the fetal brain (2 and 18 h post-exposure) or neonatal brain at postnatal day 5 (P5). We have chosen the above time points to detect apoptosis in fetal or newborn brains, based on previously published work (Jevtovic-Todorovic et al., 2003). The behavioral study was performed to investigate the effects of fetal exposure to isoflurane on postnatal memory and learning. The pregnant rats used in each study were not reused in the other two studies. Within each study described above, animals were randomly divided into either isoflurane treatment or sham control groups. Pregnant rats in the isoflurane treatment groups inhaled isoflurane for 6 h, while those in the sham control group only inhaled a carrier gas (30% oxygen, balanced with nitrogen) for 6 h under the same experimental conditions. The distribution of pregnant rats and pups in all three groups is illustrated in Fig. 1. 2.2. Anesthetic exposure Isoflurane is used clinically at a wide range of concentrations (about 0.2e 3%), depending on the presence of other kinds of anesthetics or narcotics and the type and duration of surgery. As isoflurane neurotoxicity is concentration- dependent (Jevtovic-Todorovic et al., 2003; Wei et al., 2005), a primary goal of this study was to investigate if the highest isoflurane concentration used clin- ically is harmful to the fetal brain. Due to our concern that the physiological side effects of these drugs would contaminate the interpretation, we conducted a pilot study to determine the highest anesthetic concentration we could use without invasive support (tracheal intubation and ventilation) that would not significantly affect arterial blood gas (ABG) and mean arterial blood pressure (MABP) in the mothers, and then used this concentration in the subsequent formal study. We wanted to avoid tracheal intubation, as it could possibly af- fect the hemodynamics of pregnant rats and the apoptosis in the fetal brains. In addition, this makes it more difficult to set up the sham control groups without anesthesia. In the pilot study, five pregnant rats were initially anesthetized with 2% isoflurane in 30% oxygen via a snout cone for approximately 1 h and the right femoral artery was catheterized for blood sample collection and measure- ment of MABP by a pressure transducer/amplifier (AD Instruments Inc., Colorado Springs, CO, USA). The rats were recovered for 2 h and then ex- posed to isoflurane, starting at 1.5% in a humidified carrier gas of 30% oxygen, balance nitrogen for 6 h in a monitored chamber in hood. The pregnant rats breathed spontaneously without intubation or other support while being warmed using a deltaphase isothermal pad (Braintree Scientific Inc, Braintree, MA, USA). The rectal temperature was maintained (Fisher Scientific, Pitts- burgh, PA, USA) at 37 (cid:3) 0.5 (cid:2)C. We monitored isoflurane concentration in the chamber using IR absorbance (Ohmeda 5330, Detex-Ohmeda, Louisville, CO, USA). Arterial blood (0.1 ml) from previously placed femoral arterial catheter was collected and ABG determined every 2 h for up to 6 h by an ABG analyzer (Nova Biomedical, Waltham, MA, USA). Blood glucose was simultaneously measured with a glucometer (ACCU-CHECK Advantage, Roche Diagnostics Corporations, Indianapolis, IN, USA). Control rats were exposed only to humidified 30% O2 balanced by N2 (carrier gas for isoflurane in the treatment group) for 6 h in the same chamber under the same experi- mental conditions as in the treatment group. Because one pregnant rat treated with 1.5% isoflurane showed obvious acidemia (which reversed after termina- tion of anesthesia), we decreased the isoflurane concentration to 1.3%, and subsequently found no significant changes in the ABG or MABP between the treatment group and the sham control group (Table 1). Therefore, 1.3% iso- flurane was used in the ensuing neurodegeneration and behavioral studies. Total Pregnant Rats (44) Pilot Study (8) Neurodegeneration Study (21) Behavioral Study (15) Control (4) 1.3% Isoflurane (4) Control (10) 1.3% Isoflurane (11) Control (7) 1.3% Isoflurane (8) 2 Hr (Mother 5) (Fetus 12) 18 Hr (Mother 5) (Fetus 14) 2 Hr (Mother 5) (Fetus 13) 18 Hr (Mother 6) (Fetus 13) Behavioral study Pups (26) Neurodeg- eneration study P5 (7) Behavioral study Pups (31) Neurodeg- eneration study P5 (8) Fig. 1. Nomogram illustrating distribution of pregnant mother and their fetus or postnatal rats among different studies. 943 944 Y. Li et al. / Neuropharmacology 53 (2007) 942e950 In the behavioral study, pregnant rats were treated with 1.3% isoflurane (n ¼ 8) or carrier gas (sham controls, n ¼ 7) for 6 h. The monitoring was the same as that in the pilot study except that femoral artery catheters were not placed. After the exposures, the animals were returned to their cages and the rat pups were delivered naturally. Four rat pups from each pregnant mother were raised to P28 (Juvenile) and P118 (adult), and then used to deter- mine memory and learning ability with a Morris Water Maze (MWM). Two rat pups from the control group and one from the isoflurane group died unexpect- edly, leaving a total of 26 and 31 rat pups in the control and isoflurane treat- ment groups respectively (Fig. 1). corresponding to figure 96 of the rat fetal brain atlas (Paxinos et al., 1990) were chosen for detection of apoptosis by caspase-3 immunohistochemistry and TUNEL staining. In the initial examination of brains sections from the neurodegeneration study, we noticed that apoptosis was most apparent in the hippocampus CA1 region and the retrosplenial cortex, and thus we chose these two brain regions to quantify apoptosis. 2.5. Immunohistochemistry for caspase-3 In the fetal brain apoptosis study, pregnant rats were treated with either 1.3% isoflurane or carrier gas for 6 h. At 2 and 18 h after exposure, the rat pups were delivered by C-section under sodium pentobarbital (100 mg/kg, i.p.) anesthesia. The fetal brains were removed and snap frozen for immuno- histochemical analysis. Two fetal brains from each pregnant rat were studied. In addition, newborn brains from the rat pups born to the pregnant rats in the behavioral study group (one pup from each pregnant rat, treatment n ¼ 8, con- trol n ¼ 7) were also obtained at postnatal day 5 and prepared for the apoptosis study at P5 (Fig. 1). 2.3. Measurement of isoflurane concentration in the brain tissues To confirm that the isoflurane concentration in the fetal brain correlated with the inhaled concentration and brain concentration in the pregnant mothers, we measured the brain isoflurane concentrations in the fetus and the mother simultaneously in one rat. Briefly, after the pregnant rat was ex- posed to 1.3% isoflurane for 6 h, the brains of both mother and fetuses were removed and the brain tissue was immediately placed into 4 ml of 0.02 M phosphate buffer (with 1 mM halothane as internal standard) and homogenized in a glass homogenizer. The homogenate was centrifuged (30,000 (cid:4) g at 4 (cid:2)C for 30 min), the supernatant collected and then loaded onto C18 cartridge that had been conditioned with 2 ml methanol and washed with water, for solid phase extraction. The final sample was eluted with 0.5 ml solution of methanol and 2-propanol (vol:vol 2:1) with 0.1% trifluoroacetic acid. All procedures were performed in the cool room (4 (cid:2)C). A 250 ml aliquot of each final elute was injected into a high performance liquid chromatography (HPLC) system, equipped with a refractive index monitor, for quantitation. Caspase-3 positive cells were detected using immunohistochemical methods described previously (Gown and Willingham, 2002). Briefly, brain incubated in 3% hydrogen peroxide in methanol for sections were first 20 min to quench endogenous peroxidase activity. Sections were then incu- bated with blocking solution containing 10% normal goat serum in 0.1% phos- phate buffered saline with 0.1% Tween 20 (PBST) for 1 h at room temperature after washing with 0.1% PBST. The anti-activated caspase-3 primary antibody (1/200, Cell Signaling Technology, Inc Danvers, MA, USA) was then applied in blocking solution and incubated at 4 (cid:2)C overnight. Tissue sections were bio- tinylated with goat anti-rabbit antibody (1/200, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) in 0.1% PBST for 40 min, followed by incubation with the avidinebiotinylated peroxidase complex (Vectostain ABC-Kit, Vector Lab, Burlingame, CA, USA) for 40 min. Tissue sections were colorized with diaminobenzidine (DAB, Vector Laboratories, Burlingame, CA, USA) for 8 min and counterstained with modified hematoxylin. Negative control sec- tions were incubated in blocking solution that did not contain primary anti- body. Images were acquired and assessed at 200(cid:4) using IP lab 7.0 software linked to an Olympus IX70 microscope (Olympus Corporation, Japan) equip- ped with a Cooke SensiCam camera (Cooke Corporation, Romulus, MI, USA). Three brain tissue sections at 10 mm corresponding to the Atlas of the Devel- oping Rat Brain, Figure 96 (Paxinos et al., 1990) were chosen from each an- imal and analyzed for caspase-3 positive cells in the two brain regions. Two persons blinded to the treatments counted the total number of caspase-3 pos- itive cells in the hippocampal CA1 region and retrosplenial cortex. The areas of entire hippocampal CA1 region and retrosplenial cortex were defined ac- cording to the Atlas of the Developing Rat Brain, Figure 96 (Paxinos et al., 1990) and the area measured using IPLab Suite v3.7 imaging processing and analysis software (Biovision Technologies, Exton, PA, http://www.Bio- Vis.com). The density of caspase-3 positive cells in a particular brain region was calculated by dividing the number of caspase-3 positive cells by the area of that brain region. 2.4. Tissue preparation After treatment with isoflurane or carrier gas alone (control), pregnant rats were anesthetized with sodium pentobarbital intraperitoneally (i.p. 100 mg/kg) at either 2 or 18 h after the end of isoflurane exposure, and the fetuses removed by cesarean section. Likewise, postnatal pups at day 5 (P5) were given the same dose of sodium pentobarbital. All fetuses and pups were then perfused transcardially with ice-cold normal saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The brains were then removed and post-fixed overnight in the same fixative at 4 (cid:2)C, and cryoprotected in 30% (wt/vol) sucrose in 0.1 M phosphate buffer (pH 7.4) at 4 (cid:2)C for 24 h. Thereaf- ter, the brains were frozen in isopentane at (cid:5)20 (cid:2)C and stored at (cid:5)80 (cid:2)C until use. Serial coronal sections (10 mm) were cut in a cryostat (DolbeyeJamison Optical Company, Inc., Pottstown, PA, USA), mounted on gelatin-coated slides and stored at (cid:5)80 (cid:2)C. Coronal brain sections from the same brain 2.6. TUNEL for DNA fragmentation Three brain sections (10 mm) adjacent to the sections used for caspase-3 detection were used for TUNEL staining using the DeadEnd(cid:3) Colorimetric TUNEL System Kit (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocol (Gavrieli et al., 1992). Briefly, sections were permeabilized by proteinase K solution (20 mg/ml) for 8 min, incubated in equilibration buffer for 10 min and the terminal deoxynucleotidyl transferase (TdT) and biotinylated nucleotide were added to the section and incubated in a humidified chamber at 37 (cid:2)C for 1 h. The reaction was then stopped, fol- lowed by incubation with horseradish peroxidase-labeled streptavidin, colori- zation with DAB/ H2O2 and counterstained with modified hematoxylin. For treated with DNase I positive-controls, the tissue sections were first Table 1 Isoflurane (1.3%) did not affect arterial blood pressure and blood gas significantly Baseline 2 h 4 h 6 h Control 1.3% Iso Control 1.3% Iso Control 1.3% Iso Control 1.3% Iso pH PaCO2 PaO2 (cid:5) HCO3 MABP 7.46 (cid:3) 0.02 36.7 (cid:3) 2.80 158 (cid:3) 6.98 25.6 (cid:3) 2.38 117 (cid:3) 7.42 7.46 (cid:3) 0.03 32.8 (cid:3) 0.64 162 (cid:3) 4.67 23.3 (cid:3) 1.57 119 (cid:3) 0.56 7.47 (cid:3) 0.01 33.4 (cid:3) 1.39 149 (cid:3) 9.08 24.4 (cid:3) 1.15 106 (cid:3) 9.61 7.44 (cid:3) 0.02 37.2 (cid:3) 4.33 159 (cid:3) 2.12 25.5 (cid:3) 2.02 90 (cid:3) 6.67 7.45 (cid:3) 0.01 35.8 (cid:3) 3.43 166 (cid:3) 5.45 25.2 (cid:3) 2.84 102 (cid:3) 4.06 7.39 (cid:3) 0.01 39.9 (cid:3) 4.95 156 (cid:3) 8.67 24.2 (cid:3) 2.53 89 (cid:3) 6.68 7.49 (cid:3) 0.00 37.5 (cid:3) 0.90 163 (cid:3) 5.45 28.3 (cid:3) 2.70 106 (cid:3) 4.81 7.39 (cid:3) 0.02 36.6 (cid:3) 2.20 154 (cid:3) 9.43 23 (cid:3) 2.50 89 (cid:3) 7.33 Values are mean (cid:3) SD. n ¼ 4 for each group. Iso, isoflurane; MABP, mean arterial blood pressure. Y. Li et al. / Neuropharmacology 53 (2007) 942e950 (1000 U/ml, pH 7.6) for 10 min at room temperature to initiate breakdown of DNA. Incubation of sections in reaction buffer without TdT provided negative controls. Images were acquired, and TUNEL quantitation performed as de- scribed above for caspase-3. rats (P115) received only one block of trials each day for 5 days using a new plat- form location in an effort to increase task difficulty and improve test sensitivity. 2.7.4. Probe trials 2.7. Spatial reference memory and learning performance 2.7.1. Morris Water Maze (MWM) Pregnant rats were allowed to deliver after the isoflurane treatment and 4 pups per litter (2 females and 2 males) were raised. The body weights of the rat pups were recorded at P0, P3, P5, P11, P17 and P28 to determine growth rate. We determined spatial reference memory and learning with the MWM as reported previously with some modification (Jevtovic-Todorovic et al., 2003). A schematic of the experimental paradigm is shown in Fig. 2. A round, fiberglass pool, 150 cm in diameter and 60 cm in height, was filled with water to a height of 1.5 cm above the top of the movable clear 15 cm diameter platform. The pool was located in a room with numerous visual cues (including com- puters, posters and desks) that remained constant during the studies. Water was kept at 20 (cid:2)C and opacified with titanium dioxide throughout all training and testing. A video tracking system recorded the swimming motions of animals and the data were analyzed using motion-detection software for the MWM (Ac- timetrics Software, Evanston, IL, USA). After every trial, each rat was placed in a holding cage, under an infrared heat lamp, before returning to its regular cage. 2.7.2. Cued trials Probe trials were conducted after the last place trials for the juveniles (P36) and adults (P119) to evaluate memory retention capabilities. After all rats com- pleted the last place trial on the fifth day, the platform was removed from the water maze and rat was started to swim in the quadrant opposite to one the plat- form was placed before. The rats were allowed to swim for 60 s during each probe trial and the time the rats spent in each quadrant was recorded. The per- centage of the swimming time spent in the target (probe) quadrant where the platform was placed before was calculated. The time spent in the target quadrant compared to other quadrants was an indication of memory retention. 2.7.5. Learning to reach criterion test After the last probe test for the adult rats, the animals performed the learn- ing to reach criterion test during the next 9 days as described previously (Chen et al., 2000). The experimental procedure was similar to the place trial except that the platform location was changed. For each rat, the platform was moved between nine different locations set up by the computer. Each rat received up to eight trials per day. In order to advance to the next platform location, each rat had to reach the criterion of three successive trials with escape latency of 20 s or less. If a rat reached a criterion in 8 or less trials, a new platform lo- cation would be selected the following day. The numbers of learned platforms and the number of trials used to reach the criteria were recorded and com- pared. The number of platforms learned and the number of trials to reach a cri- terion indicated the learning ability of the rats. The cued trials were performed only for postnatal rats at P28 and P29 (28 rats in control group and 31 rats in treatment group) to determine whether any non- cognitive performance impairments (e.g. visual impairments and/or swimming difficulties) were present, which might affect performance on the place or probe trials. A white curtain surrounded the pool to prevent confounding visual cues. All rats received 4 trials per day. On each trial, rats were placed in a fixed position in the swimming pool facing the wall and were allowed to swim to a platform with a rod (cue) 20 cm above water level randomly placed in any of the 4 quad- rants of the swimming pool. They were allotted 60 s to find the platform upon which they sat for 30 s before being removed from the pool. If a rat did not find the platform within 60 s, the rat was gently guided to the platform and al- lowed to remain there for 30 s. The time for each rat to reach the cued platform and the swim speed was recorded and the data at P28/29 were analyzed. 2.8. Statistical analysis To reduce variance from different size litters, we averaged the data from all fetal or postnatal rats from the same mother and considered them as a single sample. Results of weight gain of postnatal rat pups, ABG and MABP of preg- nant rats and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Data for immunohistochemistry, TUNEL and other behavioral studies were analyzed using Student’s t-test for comparison of two groups or by ANOVA followed by Fisher’s post hoc multiple compar- ison tests for those with more than two groups. In all experiments, difference were considered statistically significant at P < 0.05. 2.7.3. Place trials 3. Results After completion of cued trials, we used the same rats to perform the place trials to determine the rat’s ability to learn the spatial relationship between distant cues and the escape platform (submerged, no cue rod), which remained in the same location for all place trials. The starting points were random for each rat. The time to reach the platform was recorded for each trial. The less time it took a rat to reach the platform, the better the learning ability. The juvenile rats (P32) received two blocks of trials (two trials per block, 30 s apart, 60 s max- imum for each trial and 2 h rest between blocks) each day for 5 days. The adult 3.1. Comparison of basic physiological variables and brain isoflurane concentrations between 1.3% isoflurane treatment and sham control groups In the pilot study, the pregnant rats at E21, initially exposed to 1.5% isoflurane for 3 h, developed respiratory acidosis E21 P0 P28 P29 P32 P36 P115 P119 P120 P128 Delivery Rat pups Cued Trials 4 trials per day Place Trials 2 blocks per day 2 trials per block Place Trials 1 block per day 2 trials perblock Learning to Reach Criterion Test Anesthetic Exposures Pregnant rats at gestation day 21 Probe trial after last Place Trial Probe trial after last Place Trial Fig. 2. Schematic time-line of Morris Water Maze tests paradigm. E21, pregnant rats at gestational day 21; P0, postnatal day 0. 945 946 Y. Li et al. / Neuropharmacology 53 (2007) 942e950 (PaCO2 increased from 32 to 55 mmHg) and hypoxia (PaO2 decreased from 179 to 82 mmHg). When the isoflurane con- centration was reduced to 1.3%, for up to 6 h (2, 4 and 6 h), there were no significant changes in any of the ABG variables as compared to the controls (Table 1). MABP decreased slightly beginning at 2 h compared to the same animal’s base- line, but was not significantly different from the control group. Therefore, 1.3% isoflurane for 6 h was used in the subsequent formal study. In addition, there were no significant differences in the blood glucose levels before and after exposure in both the control group (113 (cid:3) 28 mg/dl vs. 116 (cid:3) 29 mg/dl; n ¼ 4; P > 0.05) and the 1.3% isoflurane treatment group (117 (cid:3) 17 mg/dl vs. 118 (cid:3) 14 mg/dl; n ¼ 8; P > 0.05). In the behavioral study, there were no significant differences between the two groups on growth rate measured by weight gain in rats from postnatal day 0 (P0) to P28 (data not shown). The concentration of isoflurane in the brain of a pregnant rat was 0.42 mmol/g after exposure to 1.3% isoflurane for 6 h, which was indistinguishable from that of the fetal brain (0.40 mmol/g) measured at the same time. 3.2. Isoflurane inhibited spontaneous neuronal apoptosis in fetus brains We determined the degree of apoptosis by counting caspase- 3 positive and TUNEL-positive cells in different brain regions at 2 h and 18 h after isoflurane treatment and then at postnatal day 5. There was spontaneous apoptosis represented by caspase-3 positive or TUNEL positive cells in the developing fetal brain (Figs. 3 and 4). The caspase-3 positive cells were concentrated in the dorsal midline of the fetal brain along its rostralecaudal axis. There were no significant differences bet- ween control and treatment groups in the areas of hippocampus CA1 region and the retrosplenial cortex (data not shown) deter- mined at 2, 18 h and P5. Compared to the sham control group, 1.3% isoflurane treatment significantly decreased spontaneous apoptosis determined by the density of apoptotic cells in both the hippocampus CA1 region and in retrosplenial cortex at 2 h after treatment, but no differences were seen at 18 h after treatment or at P5 (Fig. 3B,C and 4B,C). Isoflurane treatment significantly decreased the density of caspase-3 and TUNEL positive cells by 80% (P < 0.001) and 81% (P < 0.001) respec- tively in the hippocampal CA1 region (Fig. 3B,C) and by 82% (P < 0.001) and 87% (P < 0.01) respectively in retrosplenial cortex (Fig. 4B,C) at 2 h after isoflurane treatment. reference learning ability in the same animals using the place tri- als, the escape latency to platform was analyzed with two-factor ANOVAwith treatment as a between subjects factor and block as a repeated measure. This analysis yields a main difference in block (P < 0.0001 at P32e36 and P115e119). However, nei- ther the main effect of treatment nor the interaction between treatment and block were significant at P32e36 or at P115e 119 (Fig. 5A,B). The results indicated that the performance dur- ing the place trials improved as training progressed but the there was no significant difference between the two groups at juvenile (P32e36) or at adult (P115e119) ages. We further tested the learning ability in the same adult rats using a more rigorous pro- tocoldthe learning to reach criterion test. They all performed equally well in learning as shown in the numbers of platform reached (Fig. 5C) and took the same number of trials to reach a criterion at each platform (Fig. 5D), suggesting a similar learn- ing ability between the two groups. After the place test, the same postnatal rats were used in a probe test to determine memory re- tention. The juvenile postnatal rats born to the mothers treated with 1.3% isoflurane for 6 h had significantly improved reten- tion of memory (P < 0.05) by spending a greater percentage of time swimming in the probe quadrant as compared with the corresponding control animals (Fig. 6). The swim speed in both groups was not different (data not shown), further indicat- ing the improvement of retention memory was not caused by the rats’ swimming ability as showed in cued trials. However, when the probe test was repeated in adult rats (P119), there was no sig- nificant difference in the percentage of time spent in the probe quadrant between the two groups (Fig. 6). These data suggest that any improvement in memory during juvenile age did not last into the adult age. 4. Discussion Our initial hypothesis was that isoflurane exposure during pregnancy would cause apoptosis in the fetal brain and subse- quent postnatal memory and learning disabilities. This hypoth- esis was based on recent work which showed isoflurane exposure during early postnatal development resulted in an in- crease in apoptosis and subsequent behavioral impairment (Jevtovic-Todorovic et al., 2003). In contrast, we found that isoflurane exposure during late pregnancy transiently inhibited spontaneous apoptosis in the fetal brain and does not impair memory and learning in the juvenile or adult rat. 3.3. Effect of fetal exposure to isoflurane on memory and learning Using the MWM, we examined the effect of prenatal isoflur- ane exposure on the memory and learning ability in postnatal rats at different ages. In the cued trials, there was no significant difference in the latency of swimming to a visible platform be- tween the control group of 26 postnatal rats from 7 pregnant mothers (n ¼ 7) and the isoflurane treatment group of 31 postna- tal rats from eight pregnant mothers (n ¼ 8) (18.5 (cid:3) 1.86 s vs. 18 (cid:3) 2.22 s; P > 0.05). When we compared the spatial The fact that isoflurane did not induce apoptosis in the pre- natal rat brain is consistent with a recent study (McClaine et al., 2005), showing no evidence for a neurotoxic effect of the com- bination of isoflurane/midazolam/sodium thiopental exposure to fetal sheep. Spontaneous apoptosis in the fetal developing brains may be a normal process that shapes the brains as it ma- tures. It seemed that spontaneous apoptosis significantly de- creased as the brain matured especially at postnatal day 5 (Figs. 3 and 4), which was consistent with another report (White and Barone, 2001). The inhibition of spontaneous apoptosis in the fetus developing brains by isoflurane determined 2 h after treatment was not expected. Although the significance of the transient inhibition of spontaneous apoptosis by isoflurane is Y. Li et al. / Neuropharmacology 53 (2007) 942e950 A (a) Control, Caspase-3 (b) 1.3% Isoflurane, Caspase-3 (c) Control, TUNEL (d) 1.3% Isoflurane, TUNEL B 2 m m s / l l 250 200 *** Control 1.3% Iso C 2 m m s / 250 200 *** Control 1.3% Iso e C e v i t i 150 l l e C e v 150 s o P 3 - e s a p s a C 100 50 i t i s o P L E N U T 100 50 0 0 2h 18h Hippocampus CA1 P5 2h 18h Hippocampus CA1 P5 Fig. 3. In utero isoflurane inhibited spontaneous apoptosis in the hippocampus CA1 determined 2 h after treatment. (A) Arrows indicate caspase-3 positive cells and TUNEL-labeled cells in the hippocampus CA1 region of normal control fetal brains (Aa and Ac) or 2 h after isoflurane treatment (Ab and Ad) at E21. (B and C). The comparison between the density of caspase-3 positive cells (B) and TUNEL-positive cells (C) in the hippocampus CA1 region at different times after iso- flurane treatment. Data represent mean (cid:3) SE of 12e14 fetus rat brains from 5e6 pregnant mothers in either the control group or the isoflurane treatment group at 2 and 18 h after isoflurane treatment (see Fig. 1 for the detailed distribution of rats). Seven postnatal rats from 7 pregnant mothers (n ¼ 7) and 8 postnatal rats from 8 pregnant mothers (n ¼ 8) from the behavioral study were used for the neurodegeneration study at P5 (see Fig. 1). Data represent mean (cid:3) SE. ***P < 0.001 versus control. Iso, isoflurane. Scale bar 50 mm. unknown from this study, we speculate this will not affect brain development significantly. Our observation of postnatal rats in the behavioral study did not note obvious physical or behavioral differences between control and isoflurane treatment groups, except the transient memory improvement in the isoflurane treated rats. Nevertheless, the results from this study suggest that isoflurane exposure to pregnant rats does not induce apo- ptosis in the developing fetal brain and does not impair the memory and learning of their offspring. Our results would appear to be at odds with those observed by Jevtovic-Todorovic et al. (2003). However, in that study, ne- onates and not fetuses were exposed to isoflurane, and the 947 948 Y. Li et al. / Neuropharmacology 53 (2007) 942e950 A (a) Control, Caspase-3 (b) 1.3% Isoflurane, Caspase-3 (c) Control, TUNEL (d) 1.3% Isoflurane, TUNEL B 35 Control C 35 Control 2 m m / s l l e C e v i t i 30 25 20 *** 1.3% Iso 2 m m / s l l e C e v i t i 30 25 20 ** 1.3% Iso s o P 3 - e s a p s a C 15 10 5 s o P L E N U T 15 10 5 0 0 2h 18h Retrosplenial Cortex P5 2h 18h Retrosplenial Cortex P5 Fig. 4. Isoflurane inhibited spontaneous apoptosis in the retrosplenial cortex of fetal brains 2 h after treatment. (A) Arrows indicate caspase-3 positive cells and TUNEL-labeled cells in the retrosplenial cortex of normal control fetal brains (Aa and Ac) or 2 h after isoflurane treatment (Ab and Ad) at E21. The density of caspase-3 positive cells (B) and TUNEL-positive cells (C) in the retrosplenial cortex area at different times after isoflurane treatment were compared between the control and 1.3% isoflurane treatment groups. Data represent mean (cid:3) SE of 12e14 postnatal rats from 5e6 pregnant mothers in either control group or the iso- flurane treatment group at 2 and 18 h after isoflurane treatment (see Fig. 1 for the detailed distribution of rats). Seven postnatal rats from 7 pregnant mothers (n ¼ 7) and 8 postnatal rats from 8 pregnant mothers (n ¼ 8) from the behavioral study were used for the neurodegeneration study at P5 (see Fig. 1). Data represent mean (cid:3) SE. ***P < 0.001, **P < 0.01, compared to control. Iso, isoflurane. Scale bar 50 mm. Y. Li et al. / Neuropharmacology 53 (2007) 942e950 A 50 Control 40B Control ) s d n o c e S ( y c n e t a L 40 30 20 10 1.3% Iso ) s d n o c e S ( y c n e t a L 30 20 10 1.3% Iso 0 0 0 1 4 Day of Test (P32-36) 2 3 5 0 1 4 Day of Test (P115-119) 2 3 5 10C m r o f t a P d e n r a e L f o r e b m u N 8 l 6 4 2 D a i r e t i r C h c a e R o t s l a i r T 10 8 6 4 2 Control 1.3% Iso 0 control 1.3% Iso 0 0 1 2 3 platform location 4 5 6 7 8 9 Fig. 5. Isoflurane in utero did not affect postnatal learning ability in juvenile or adult rats. Spatial learning and memory performance were determined using the Morris Water Maze place test paradigm in postnatal juvenile (A) and adult (B) rats and using the learning to reach criteria test in the P120e128 adult (C and D). Data represent mean (cid:3) SE of 26 postnatal rats from 7 pregnant mothers (n ¼ 7) in the control group or 31 postnatal rats from 8 pregnant mothers (n ¼ 8) in the isoflurane treatment group. Iso, isoflurane. interpretation was that the vulnerability of isoflurane-induced apoptosis in the developing brains is correlated to the period of synaptogenesis (Jevtovic-Todorovic et al., 2003; Yon et al., 2005). If true, then the fetal rat is not expected to be as vulner- able as the neonatal rat, which is consistent with the results of 50 Control t n a r d a u q e b o r p n 40 30 20 1.3% Iso i e m i t % 10 0 P36 P119 Day of Test Fig. 6. Isoflurane significantly increased spatial retention memory in postnatal juvenile but not adult rats. Probe test was performed at postnatal day 36 (P36) and 119 (P119) after the last place trial. Data represent mean (cid:3) SE of 26 post- natal rats born from 7 pregnant mothers (n ¼ 7) in the control group or 31 postnatal rats born from 8 pregnant mothers (n ¼ 8) in the isoflurane treatment group. *P < 0.05 compared to control. Iso, isoflurane. our study. However, it should be noted that although vulnerabil- ity to isoflurane-induced apoptosis seems to coincide with the period of synaptogenesis (Hansen et al., 2004; Ikonomidou et al., 2001; Jevtovic-Todorovic et al., 2003), there exists no di- rect evidence showing that synaptogenesis is itself altered, or is causally linked to the subsequent cognitive changes. Toxic ef- fects of isoflurane have also been found in the adult and aged brains (Culley et al., 2003, 2004), when of course little in the way of synaptogenesis is occurring. Isoflurane has long been considered to be cytoprotective against ischemia in the heart and brain (Sakai et al., 2007; Warner, 2000). In previous studies, we and others (Kudo et al., 2001; Wei et al., 2005) have shown that the concentration and time required for isoflurane to induce apoptosis in cultured neurons was greater than that used clinically in patients. It is possible that sub-apoptotic exposure to isoflurane induces pro- tection, analogous to that induced by hypoxia. Accordingly, our preliminary unpublished data have shown that preconditioning of rat primary cortical neurons with 2 MAC isoflurane for 1 h abolished the neurotoxicity induced by a subsequent exposure to 2 MAC isoflurane for 24 h. Thus, it is possible that our use of isoflurane at low ‘‘clinical’’ concentration in the pregnant rat may precondition the fetal brain against spontaneous apo- ptosis in the current study. Therefore, it remains possible that the higher anesthetic concentrations used in fetal surgery (w3% isoflurane) may produce neurotoxicity in the fetal brain. 949 950 Y. Li et al. / Neuropharmacology 53 (2007) 942e950 Other limitations of this study are that we did not expose the mother/fetus to isoflurane at other time points during the pregnancy, so it is possible that we missed the time point when the fetus might be more vulnerable to isoflurane neuro- toxicity. Further, we avoided tracheal intubation in this study in an attempt to minimize confounding variables. This pre- vented us from testing the effects of isoflurane at concentra- tions up to 3% often used during fetal surgery in humans (Cauldwell, 2002; Myers et al., 2002). cleaved caspase 3. Journal of Histochemistry and Cytochemistry 50, 449e454. Hansen, H.H., Briem, T., Dzietko, M., Sifringer, M., Voss, A., Rzeski, W., Zdzisinska, B., Thor, F., Heumann, R., Stepulak, A., Bittigau, P., Ikonomidou, C., 2004. Mechanisms leading to disseminated apoptosis fol- lowing NMDA receptor blockade in the developing rat brain. Neurobiol- ogy of Disease 16, 440e453. Ikonomidou, C., Bittigau, P., Koch, C., Genz, K., Hoerster, F., Felderhoff- Mueser, U., Tenkova, T., Dikranian, K., Olney, J.W., 2001. Neurotransmit- ters and apoptosis in the developing brain. Biochemical Pharmacology 62, 401e405. In summary, prenatal exposure to isoflurane at a concentra- tion commonly used for the maintenance of general anesthesia during late pregnancy in rats does not appear to be neurotoxic to the fetal brain and does not impair memory and learning in the postnatal juvenile or adult rat. Acknowledgments Jevtovic-Todorovic, V., Hartman, R.E., Izumi, Y., Benshoff, N.D., Dikranian, K., Zorumski, C.F., Olney, J.W., Wozniak, D.F., 2003. Early ex- posure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. Journal of Neu- roscience 23, 876e882. Kim, H., Oh, E., Im, H., Mun, J., Yang, M., Khim, J.Y., Lee, E., Lim, S.H., Kong, M.H., Lee, M., Sul, D., 2006. Oxidative damages in the DNA, lipids, and proteins of rats exposed to isofluranes and alcohols. Toxicology 220, 169e178. We acknowledge discussions with Drs Roderic Eckenhoff, Randall Pittman and Maryellen Eckenhoff and the technical support of Dr Min Li, University of Pennsylvania. We thank Dr Alex Loeb for editorial assistance. This study was supported by March of Dimes Birth Defects Foundation Research Grant (12-FY05-62, PI: Huafeng Wei), and partially Institute of General Medical supported by the National Science (NIGMS) K08 grant (1-K08-GM-073224-01, PI: Huafeng Wei), and the Research Fund at the Department of Anesthesiology and Critical Care, University of Pennsylvania (PI: Huafeng Wei). Kudo, M., Aono, M., Lee, Y., Massey, G., Pearlstein, R.D., Warner, D.S., 2001. Effects of volatile anesthetics on N-methyl-D-aspartate excitotoxicity in primary rat neuronaleglial cultures. Anesthesiology 95, 756e765. Kvolik, S., Glavas-Obrovac, L., Bares, V., Karner, I., 2005. Effects of inhala- tion anesthetics halothane, sevoflurane, and isoflurane on human cell lines. Life Sciences 77, 2369e2383. Loop, T., Dovi-Akue, D., Frick, M., Roesslein, M., Egger, L., Humar, M., Hoetzel, A., Schmidt, R., Borner, C., Pahl, H.L., Geiger, K.K., Pannen, B.H., 2005. Volatile anesthetics induce caspase-dependent, mito- chondria-mediated apoptosis in human T lymphocytes in vitro. Anesthesi- ology 102, 1147e1157. Matsuoka, H., Kurosawa, S., Horinouchi, T., Kato, M., Hashimoto, Y., 2001. Inhalation anesthetics induce apoptosis in normal peripheral lymphocytes in vitro. Anesthesiology 95, 1467e1472. References Cauldwell, C.B., 2002. Anesthesia for fetal surgery. Anesthesiology Clinics of McClaine, R.J., Uemura, K., de la Fuente, S.G., Manson, R.J., Booth, J.V., White, W.D., Campbell, K.A., McClaine, D.J., Benni, P.B., Eubanks, W.S., Reynolds, J.D., 2005. General anesthesia improves fetal cerebral oxygenation without evidence of subsequent neuronal injury. Journal of Cerebral Blood Flow and Metabolism 25, 1060e1069. North America 20, 211e226. Myers, L.B., Cohen, D., Galinkin, J., Gaiser, R., Kurth, C.D., 2002. Anaesthe- Chang, Y.C., Chou, M.Y., 2001. Cytotoxicity of halothane on human gingival sia for fetal surgery. Paediatric Anaesthesia 12, 569e578. fibroblast cultures in vitro. Journal of Endodontics 27, 82e84. Paxinos, G., Tork, I., Teccot, L.H., Valentino, K., 1990. Atlas of the Develop- Chen, G., Chen, K.S., Knox, J., Inglis, J., Bernard, A., Martin, S.J., Justice, A., McConlogue, L., Games, D., Freedman, S.B., Morris, R.G., 2000. A learn- ing deficit related to age and beta-amyloid plaques in a mouse model of Alzheimer’s disease. Nature 408, 975e979. ing Rat Brain. Academic Press. Sakai, H., Sheng, H., Yates, R.B., Ishida, K., Pearlstein, R.D., Warner, D.S., 2007. Isoflurane provides long-term protection against focal cerebral ische- mia in the rat. Anesthesiology 106, 92e99. Culley, D.J., Baxter, M., Yukhananov, R., Crosby, G., 2003. The memory ef- fects of general anesthesia persist for weeks in young and aged rats. Anes- thesia and Analgesia 96, 1004e1009. Culley, D.J., Baxter, M.G., Yukhananov, R., Crosby, G., 2004. Long-term impairment of acquisition of a spatial memory task following isoflurane- nitrous oxide anesthesia in rats. Anesthesiology 100, 309e314. Dobbing, J., Sands, J., 1979. Comparative aspects of the brain growth spurt. Early Human Development 3, 79e83. Warner, D.S., 2000. Isoflurane neuroprotection e a passing fantasy, again? An- esthesiology 92, 1226e1228. Wei, H., Kang, B., Wei, W., Liang, G., Meng, Q.C., Li, Y., Eckenhoff, R.G., 2005. Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently. Brain Research 1037, 139e147. White, L.D., Barone, S., 2001. Qualitative and quantitative estimates of apo- ptosis from birth to senescence in the rat brain. Cell Death and Differen- tiation 8, 345e356. Eckenhoff, R.G., Johansson, J.S., Wei, H., Carnini, A., Kang, B., Wei, W., Pidikiti, R., Keller, J.M., Eckenhoff, M.F., 2004. Inhaled anesthetic en- hancement of amyloid-beta oligomerization and cytotoxicity. Anesthesiol- ogy 101, 703e709. Wise-Faberowski, L., Zhang, H., Ing, R., Pearlstein, R.D., Warner, D.S., 2005. Isoflurane-induced neuronal degeneration: an evaluation in orga- notypic hippocampal slice cultures. Anesthesia and Analgesia 101, 651e657. Gavrieli, Y., Sherman, Y., Bensasson, S.A., 1992. Identification of pro- grammed cell-death in situ via specific labeling of nuclear-DNA fragmen- tation. Journal of Cell Biology 119, 493e501. Goldsmith, M.F., Straus, S.E., Kupfer, C., Lenfant, C., Collins, F., Hodes, R.J., Gordis, E., Fauci, A.S., Alexander, D., Battey, J.F., Slavkin, H.C., Leshner, A.I., Olden, K., Hyman, S.E., Fischbach, G.D., 1999. 2020 vi- sion: NIH heads foresee the future. Journal of the American Medical As- sociation 282, 2287e2290. Gown, A.M., Willingham, M.C., 2002. Improved detection of apoptotic cells in archival paraffin sections: immunohistochemistry using antibodies to Xie, Z., Dong, Y., Maeda, U., Alfille, P., Culley, D.J., Crosby, G., Tanzi, R.E., 2006. The common inhalation anesthetic isoflurane induces apoptosis and increases amyloid beta protein levels. Anesthesiology 104, 988e994. Xie, Z., Dong, Y., Maeda, U., Moir, R.D., Xia, W., Culley, D.J., Crosby, G., Tanzi, R.E., 2007. The inhalation anesthetic isoflurane induces a vicious cycle of apoptosis and amyloid beta-protein accumulation. Journal of Neu- roscience 27, 1247e1254. Yon, J.H., Daniel-Johnson, J., Carter, L.B., Jevtovic-Todorovic, V., 2005. An- esthesia induces neuronal cell death in the developing rat brain via the in- trinsic and extrinsic apoptotic pathways. Neuroscience 135, 815e827.",rats,"['In a maternal fetal rat model, we investigated the behavioral and neurotoxic effects of fetal exposure to isoflurane.']",gestational day 21,['Pregnant rats at gestational day 21 were anesthetized with 1.3% isoflurane for 6 h.'],Y,['Spatial memory and learning of the fetal exposed pups were examined with the Morris Water Maze at juvenile and adult ages.'],isoflurane,['Pregnant rats at gestational day 21 were anesthetized with 1.3% isoflurane for 6 h.'],none,[],sprague dawley,"['SpragueeDawley pregnant rats (Charles River Laboratories, Inc Wilmington, MA) were housed in polypropylene cages and the room temper- ature was maintained at 22 (cid:2)C, with a 12 h lightedark cycle.']",The study aimed to determine whether exposure to clinically relevant concentrations of isoflurane during prenatal development causes neuronal apoptosis and postnatal learning and memory deficits.,['The aim of the current study was to determine whether exposure to clinically relevant concentrations of isoflurane during prenatal development causes neuronal apoptosis and postnatal learning and memory deficits.'],None,[],Isoflurane exposure during late pregnancy is not neurotoxic to the fetal brain and does not impair memory and learning in the juvenile or adult rat.,['These results show that isoflurane exposure during late pregnancy is not neurotoxic to the fetal brain and does not impair memory and learning in the juvenile or adult rat.'],"The study did not expose the mother/fetus to isoflurane at other time points during the pregnancy, and it avoided tracheal intubation to minimize confounding variables.","['Other limitations of this study are that we did not expose the mother/fetus to isoflurane at other time points during the pregnancy, so it is possible that we missed the time point when the fetus might be more vulnerable to isoflurane neurotoxicity.']",None,[],True,True,True,True,True,True,10.1016/j.neuropharm.2007.09.005 10.1371/journal.pone.0160826,935.0,Luo,2016,rats,gestational day 18,N,isoflurane,none,sprague dawley,"RESEARCH ARTICLE Maternal Exposure of Rats to Isoflurane during Late Pregnancy Impairs Spatial Learning and Memory in the Offspring by Up-Regulating the Expression of Histone Deacetylase 2 a11111 Foquan Luo1‡*, Yan Hu1,2‡, Weilu Zhao1, Zhiyi Zuo3, Qi Yu1, Zhiyi Liu1, Jiamei Lin1, Yunlin Feng1, Binda Li4, Liuqin Wu4, Lin Xu1 1 Department of Anesthesiology, the First Affiliated Hospital, Nanchang University, Nanchang 33006, China, 2 Department of Anesthesiology, Jiangxi Province Traditional Chinese Medicine Hospital, Nanchang 33006, China, 3 Department of Anesthesiology, University of Virginia, Charlottesville, VA, 22908, United States of America, 4 Department of Anesthesiology, Jiangxi Province Tumor Hospital, Nanchang 330006, China ‡ These authors are co-first authors on this work. * lfqjxmc@outlook.com OPEN ACCESS Citation: Luo F, Hu Y, Zhao W, Zuo Z, Yu Q, Liu Z, et al. (2016) Maternal Exposure of Rats to Isoflurane during Late Pregnancy Impairs Spatial Learning and Memory in the Offspring by Up-Regulating the Expression of Histone Deacetylase 2. PLoS ONE 11 (8): e0160826. doi:10.1371/journal.pone.0160826 Editor: Huafeng Wei, University of Pennsylvania, UNITED STATES Received: September 22, 2015 Accepted: June 6, 2016 Published: August 18, 2016 Copyright: This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication. Data Availability Statement: All relevant data are within the paper. Funding: FL received the funding from the national natural science foundation of China (NO.81460175, NO.81060093), http://www.nsfc.gov.cn/; from the natural science foundation of Jiangxi province of China (NO.20122BAB205012, NO. 20132BAB205022), http://www.jxstc.gov.cn/. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Abstract Increasing evidence indicates that most general anesthetics can harm developing neurons and induce cognitive dysfunction in a dose- and time-dependent manner. Histone deacety- lase 2 (HDAC2) has been implicated in synaptic plasticity and learning and memory. Our previous results showed that maternal exposure to general anesthetics during late preg- nancy impaired the offspring’s learning and memory, but the role of HDAC2 in it is not known yet. In the present study, pregnant rats were exposed to 1.5% isoflurane in 100% oxygen for 2, 4 or 8 hours or to 100% oxygen only for 8 hours on gestation day 18 (E18). The offspring born to each rat were randomly subdivided into 2 subgroups. Thirty days after birth, the Morris water maze (MWM) was used to assess learning and memory in the off- spring. Two hours before each MWM trial, an HDAC inhibitor (SAHA) was given to the off- spring in one subgroup, whereas a control solvent was given to those in the other subgroup. The results showed that maternal exposure to isoflurane impaired learning and memory of the offspring, impaired the structure of the hippocampus, increased HDAC2 mRNA and downregulated cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) mRNA, N-methyl-D-aspartate receptor 2 subunit B (NR2B) mRNA and NR2B pro- tein in the hippocampus. These changes were proportional to the duration of the maternal exposure to isoflurane and were reversed by SAHA. These results suggest that exposure to isoflurane during late pregnancy can damage the learning and memory of the offspring rats via the HDAC2-CREB -NR2B pathway. This effect can be reversed by HDAC2 inhibition. PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 1 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Competing Interests: The authors have declared that no competing interests exist. Introduction Increasing evidence indicates that most general anesthetics are harmful to developing neurons and cause cognitive deficits in a dose- and time- dependent manner. Previous study [1] reported that exposure of pregnant rats to low concentrations of isoflurane (1.3%) for 6 hours did not cause neurodegeneration in the fetal brain or affect learning and memory in the off- spring. However, in a similar animal model, exposure to high concentrations of isoflurane (3%) for only 1 hour caused significant neurodegeneration in fetal brain [2], suggesting a dose- dependent effect of isoflurane neurotoxicity. The majority of general anesthetics are lipophilic and can easily cross the placental barrier. About 0.5% to 2% of pregnant women will suffer non-obstetric surgery [3–5], and most of these procedures (up to 73%) must be completed under general anesthesia [6]. More than 75,000 pregnant women in the United States and 5,700 to 7,600 pregnant women in the European Union undergo non-obstetric surgery each year [7]. However, little is known regarding the effects of maternal exposure to general anes- thetics during late pregnancy on the offspring’s subsequent learning and memory. Data from Sweden showed that among 5,405 patients who had non-obstetric surgery during pregnancy, 23% had procedures during the third trimester [4]. Most of the published studies about isoflur- ane showed a protective effect on the brain, however our previous studies showed that maternal exposure to propofol, ketamine, enflurane, isoflurane or sevoflurane during early gestation could cause learning and memory deficits and showed time-dependent effects [8]. A recent ani- mal study indicated that rats exposed to isoflurane in utero at a time that corresponds to the second trimester in humans exhibited impaired spatial memory [9]. However, rats exposed to isoflurane on gestational day 21(E21) showed no neurotoxicity to the fetal brain, and no learn- ing and memory impairments in the juvenile or adult rats [1]. Synaptic plasticity is critical to memory formation and storage [10]. Histone acetylation has been implicated in synaptic plasticity and learning and memory [11–13]. Histone deacetylase (HDAC) inhibitors can reinstate learning and promote the retrieval of long-term memory in animals with massive nerve degeneration [14]. These findings suggested that HDAC inhibition may provide a therapeutic avenue for memory impairment caused by neurodegenerative dis- eases. Among HDAC family members, HDAC2 functions in modulating synaptic plasticity and producing long-lasting changes to neural circuits, which in turn negatively regulate learn- ing and memory [15]. The hyperphosphorylation of HDAC2 decreases the phosphorylation of cAMP response-element binding (CREB) protein, leading to a decrease in the CREB protein levels [16]. The administration of SAHA increased the levels of acetylated histones, accompa- nied by enhanced binding of phospho-CREB (p-CREB) to its binding site in the promoter of the NR2B gene, a subunit of N-methyl-D-aspartic (NMDA) receptors. This effect led to increased NR2B protein levels in the rat hippocampus, thus facilitating fear extinction [17]. Thus, HDAC2 modulates learning and memory by inhibiting CREB expression and down-reg- ulating the expression of NR2B. Isoflurane can induce repression of contextual fear memory in 3-month-old mice by reducing histone acetylation in the hippocampus, an effect that can be rescued by the HDAC inhibitor sodium butyrate [18]. Neonatal mice repeatedly exposed to isoflurane also showed repression of contextual fear memory [19]. Many pregnancies include non-obstetric surgery during the late pregnancy due to diverse medical conditions, such as acute appendicitis, symptomatic cholelithiasis, and trauma [20– 22]. Increasing reports suggested that any trimester of pregnancy should not be considered as a contraindication to surgery, and many non-obstetric surgeries can be safely performed in the third trimester [20–27]. Prospective clinical studies showed that approximately 27.6% of appendectomies performed during pregnancy were done in the third trimester, and none of the children exhibited any developmental delay during a 47.2-month (range from 13 to 117 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 2 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 months) follow-up time after delivery [28], however learning and memory was not evaluated in these children. The effect of maternal exposure to isoflurane on learning and memory and its mechanism is not well understood. Therefore, the present study was designed to explore the effects of maternal exposure of rats to isoflurane during late pregnancy (corresponding to the human third trimester) on learning and memory in the offspring. Further, we hypothesized that the detrimental effects of isoflurance on learning and memory are mediated through changes in the HDAC2-CREB-NR2B pathway, which we explored by administration of an SAHA. Experimental Procedures Subjects This protocol was approved by the institutional review board of the First Affiliated Hospital of Nanchang University on the Use of Animals in Research and Teaching. Seventy-day-old female Sprague-Dawley (SD) rats (maternal rats) were supplied by the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011–0030). The learning and memory functions of the parental rats were assessed with the MWM before mat- ing. Female rats were then housed with a male rat (2 female: 1 male rat per cage) for mating. Pregnant rats were identified and divided into the isoflurane exposure 2h (I2), 4h (I4), 8h (I8) and control (C) groups (n = 10 per group) based on the MWM test results to minimize the effects of maternal differences in learning and memory. Anesthesia On E18, gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane (Abbott labo- ratories Ltd, Worcester, MA, USA) in 100% oxygen for 2, 4 and 8 hours, respectively, while those in the control group received 100% oxygen only. Electrocardiogram, saturation of pulse oximetry, and the respiratory rate of the rats as well as the inhaled concentration of iso- flurane were monitored continuously with a Datex-Ohmeda ULT-I analyzer. The tail inva- sive blood pressure was monitored intermittently. The rectal temperature was maintained at 37 ± 0.5°C with heating pads. The exposure time began from the loss of the righting reflex. The depth and rate of breath was monitored. The exposure durations were selected because different lengths of surgeries are performed [29], and neuronal damage or apoptosis reaches a maximum when general anesthetic exposure time reaches 6 to 8 hours [30]. Our prelimi- nary study showed that maternal exposure to 1.5% isoflurane for 8 hours did not significantly change blood pressure, blood glucose or venous blood gases. The concentration of isoflurane was selected because 1.5% isoflurane in 100% oxygen equals approximately 1 MAC (mini- mum alveolar concentration) in gestating rats and caused righting reflex loss in our prelimi- nary studies. At the end of the exposure time, all of the rats were exposed to 100% oxygen for 30 min for anesthesia recovery in an anesthesia chamber (40 × 40 × 25 cm). If the cumulative <95% and/or the systolic blood pressure (SBP) decreased by more than 20% of time of SpO2 baseline more than 5 minutes, the dam would be excluded from the study, and another dam was selected to supplement the sample size, thereby excluding the harmful effect of maternal ischemia or hypoxia on offspring rats. Furthermore, to clarify whether exposure to isoflurane caused a significant effect on the internal environment of maternal rats, 10 additional rats at gestational day 18 were selected. Five were exposed to 1.5% isoflurane in 100% oxygen for 8 hours, and the other five were exposed to 100% oxygen for 8 hours. Femoral vein blood was harvested for blood gas analysis. PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 3 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Morris Water Maze (MWM) Test The age of P30 in rat corresponds to preschool age in human [31]. Therefore, we evaluated the spatial learning and memory of the offspring begining on P30 with MWM according previous report [32]. All of the offspring were acclimated to the experimental environment for 30 min before testing. The Morris water maze is a black circular steel pool with a diameter of 150 cm and a height of 60 cm, filled with 24 ± 1°C water to a depth of 20 cm. A circular escape platform of 10 cm in diameter was submerged 1 cm below the water surface in the second quadrant. The swimming trail and speed of the rats was automatically recorded by the SLY-WMS Morris water maze test system (Beijing Sunny Instruments Co. Ltd., Beijing, China). The escape latency (time needed to find the platform), platform crossing times (number of times the rat swam across the submerged platform), and the target quadrant traveling time (time spent in the platform-hidden quadrant) were recorded automatically by the test system. The tests were begun at 9:00 am, one time per day for seven consecutive days. Each offspring rat was put into the pool to search for the platform one time per day for six days (training trial). The starting point was in the third quadrant, the farthest quadrant from the platform-hidden quadrant (the second quadrant in the present study, named the target quadrant). The rats were placed in the water facing the wall of the pool. The same starting point was used for each rat (with a colour marker on the pool wall). The animals were allowed to stay on the platform for 30 seconds when they found the platform. If an animal could not find the platform within 120 s, the escape latency was recorded as 120 s for that trial. The animal was then guided to the platform and allowed to stay on it for 30 s. On the seventh day, the platform was removed. Rats were allowed to swim for 120s to test their memory (platform-crossing times and target quadrant traveling time). The mean of the latencies, platform-crossing times and target quadrant traveling time of the offspring rats born by the same mother rat were calculated as the final results. The offspring born to the same dam in each group were subdivided into the SAHA sub- group (I2S, I4S, I8S and CS subgroup) and the non-SAHA subgroup (I2N, I4N, I8N and CN subgroup) (Fig 1). Two hours before each MWM test, 90 mg/kg SAHA (Selleck Chemicals, Houston, TX, USA), at a concentration of 0.6 μM in dimethyl sulfoxide (DMSO) was given intraperitoneally to the offspring in the SAHA subgroups. An equal volume of DMSO was given to the rats in the non-SAHA subgroups. We selected 2 h before each MWM trial as the administration time point for SAHA based on the fact that 2 h after SAHA administration, the expression of NR2B increased in the hippocampus of Sprague-Dawley rats by enhancing his- tone acetylation, thus facilitating fear extinction [17]. Transmission Electron Microscopy The offspring were anesthetized with isoflurane at 24 h after the MWM test and then eutha- nized by cervical dislocation. Left hippocampus tissues were harvested quickly (in 1 minute) on ice and cut into small pieces of 1 mm3. The hippocampal pieces were immersed in 2.5% glu- taraldehyde in 0.1 mol/l phosphate buffer (pH 7.4) at 4°C for 3 hours, rinsed three times in 0.1 M PBS (phosphate buffered saline), fixed in 1% osmium tetroxide at 4°C for 2 h, dehydrated, embedded, cut into ultrathin sections of 50–70 nm, stained by saturated uranium acetate and lead citrate and observed by transmission electron microscopy. Real Time Polymerase Chain Reaction (RT- PCR) Total RNA of the hippocampus was extracted with Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The mRNA concentration was measured (OD 260 nm) with a spec- trophotometer (Nanophotometer P, MPLEN Co., Germany). Reverse transcription was per- formed with 1 μg total RNA using a Prime ScriptTM RT reagent Kit with gDNA Eraser (Perfect PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 4 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 1. Experimental design. Pregnant dams were exposed to 1.5% isoflurane in 100% oxygen or to 100% oxygen alone for the times indicated on E18 and the offspring were treated with 90 mg/kg SAHA (ip) or vehicle (DMSO) 2 hours before behavioral testing. The number in parentheses represents the number of animals: F = female, M = male; DMSO = dimethyl sulfoxide; SAHA = suberanilohydroxamic acid, also known as vorinostat; TEM = transmission electron microscopy. doi:10.1371/journal.pone.0160826.g001 Real Time; RR047A, TaKaRa BIO Inc., Japan). The cDNA sample was amplified by a real time PCR instrument (ABI7500), with SYBR Premix Ex TaqTM (Tli RNaseH Plus; Code: RR820A, TaKaRa Co., Japan). β-actin was chosen as a reference gene. The length of both the HDAC2 product and the CREB product is 94 bp, whereas the length of the NR2B product is 103 bp, and the length of the β-actin product is 150 bp. PCR amplification was performed with the fol- lowing cycling parameters: one cycle of 95°C for 30 s followed by 40 cycles of 95°C for 5 s, 60°C for 34 s, 95°C for 15 s, 60°C for 1 min and 95°C for 15 s. The ABI7500 instrument automatically analyzed the fluorescence signal and converted it to the Ct value, using β-actin as a housekeeping gene and the Ct value of group C as the compara- tive object. Single-product amplification was confirmed by melting curve and gel electrophore- sis analysis. The expression levels of HDAC2, CREB and NR2B mRNA were normalized to β- actin mRNA and the values of the control group. The mean mRNA expression level of all of the offspring born to the same mother rat was calculated as the final expression level of mRNA. Western Blot Total protein was extracted by lysing the hippocampus (one offspring from each dam) in lysis buffer (Thermo Scientific, Rockford, IL, USA) containing a protease inhibitors cocktail (Sigma-Aldrich). Total protein (50 μg/ lane) was separated on a polyacrylamide gel and then transferred onto PVDF membranes. The membranes were blocked with Protein-Free T20 Blocking Buffer (Thermo Scientific) for 1 h at room temperature and incubated with rabbit polyclonal anti-NR2B antibody (Cell signaling Technology, 1:500) or rabbit polyclonal anti-β actin antibody (Cell Signaling Technology, 1:500) overnight at 4°C. After incubation with goat anti-rabbit HRP-conjugated IgG, the protein complex was revealed with enhanced chemilumi- nescence reagents (Pierce, IL, USA) and quantified by Genesnap version 7.08. The density of PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 5 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 NR2B protein band was normalized to that of β-actin in the same sample. The results from iso- flurane exposed offspring were then normalized to the average values of control offpring in the same western blot. The mean expression level of all of the offspring born to the same mother rat was calculated as the final expression level of NR2B protein. Statistical Analysis All values shown represent the mean ± SEM. The escape latency was subjected to a two-way repeated measures ANOVA (RM ANOVA) with prenatal treatment as a between-litters inde- pendent factor and day as a repeated factor. When an initial ANOVA showed main effects of the factors as well as significant interactions among the factors, post hoc comparisons were conducted by the least significant difference (LSD) t test. The mRNA and protein data, plat- form crossing times, and target quadrant traveling time were analyzed by one-way ANOVA, and followed by LSD t test when a significant difference was found in groups (p < 0.05). Results are considered statistically significant at p < 0.05. Results Isoflurane Exposure Does Not Alter Maternal Blood Gases To clarify whether exposure to 1.5% isoflurane for 8 hours causes significant changes to the internal environment during late pregnancy, 10 gravid rats on E18 were used. We continuously monitored the saturation of pulse oximetry during anesthesia. As a matter of convenience, femoral vein blood gas analysis was used to evaluate whether isoflurane exposure would cause changes in acid-base balance or serum electrolytes in maternal rats. All of the indices of venous blood gases showed no significant changes after an 8-hour exposure to 1.5% isoflurane com- pared with rats exposed to oxygen only (Table 1). These results indicate that exposure to 1.5% isoflurane for 8 hours on E18 does not cause significant metabolic changes to pregnant rats. Impaired Learning and Memory in Rat Offspring and the Ameliorating Effect of SAHA The results of MWM showed that the offspring in isoflurane exposure group had to spend more time finding the platform than the control group. At the third MWM trial, the escape latency in the I2N, I4N or I8N groups was longer than the control group (p < 0.05). The escape latency increased with the increase of isoflurane exposure time. The escape latency in Table 1. The effect of isoflurane exposure on femoral venous blood gas and electrolytes in maternal rats. Indexes pH PO2 (mmHg) PCO2 (mmHg) - (mmol/L) HCO3 BE(B) (mmol/L) Ca2+ (mmol/L) K+ (mmol/L) Na+ (mmol/L) 100% oxygen 7.39±0.03 46.33±6.15 51.5±3.62 31.13±0.45 3.75±1.33 1.24±0.20 4.51±0.64 135.50±1.22 1.5% isoflurane+100% oxygen 7.39±0.23 49.50±4.93 50.50±12.79 27.85±4.78 3.20±0.80 1.41±0.06 4.8±0.50 134.25±0.96 Rats were exposed to oxygen or isoflurane + oxygen for 8 hour and monitored continuously. Final values were recorded at the end of the 8 hour period. n = 5. doi:10.1371/journal.pone.0160826.t001 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 6 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 5 p < 0.05). At the 6th I8N group was longer than control group at 3rd, 4th, 5th and 6th trial ( training trial, the escape latency in the I8N group was significantly longer than the I2N or I4N group (# p < 0.05) (Fig 2A). The offspring in isoflurane exposure group spent less time traveling in the platform hidden quadrant. The target quadrant traveling time in I8N group was less than CN group ((cid:2) p < 0.05), I2N and I4N group (# p < 0.05). The offspring in iso- flurane exposure group swam across the location where the platform hidden less than control group, especially those in I8N group. The platform-crossing times in I8N group was less than CN group ((cid:2) p < 0.05), I2N and I4N group (# p < 0.05, Fig 2B and 2C). These results indicate Fig 2. Maternal isoflurane exposure impaired learning and memory in offspring: Offspring of rats exposed to isoflurane on gestation day 18 (E18) for 2h (I2N), 4h (I4N) and 8h (I8N) respectively. Thirty days postneaonatal (P30), the learning and memory was assessed using the Morris water maze: (a) Escape latency (time to find the hidden platform). At the third trial, the escape latency in the I2N, I4N or I8N group was significant longer than the control group (* p < 0.05); The escape latency increased with the increase of isoflurane exposure time. The escape latency in I8N group was significant longer than control group at 3rd, 4th, 5th and 6th trial (5 p < 0.05). At the 6th training trial, the escape latency in the I8N group was significantly longer than the I2N or I4N group (# p < 0.05); (b) Target quadrant traveling time. The offspring in isoflurane exposure group spent less time traveling in the platform hidden quadrant (target quadrant). The target quadrant traveling time in I8N group was significant less than CN group (* p < 0.05), I2N and I4N group (# p < 0.05); (c) Platform crossing times. The offspring in isoflurane exposure group swam across the location where the platform hidden (platform-crossing times) less than control group, especially those in I8N group. The platform-crossing times in I8N group was significant less than CN group (* p < 0.05), I2N and I4N group (# p < 0.05). CN = control group. doi:10.1371/journal.pone.0160826.g002 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 7 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 3. HDAC2 inhibition alleviated the impaired learning caused by maternal isoflurane exposure. SAHA potentiates the learning ability of normal rats, the escape latencey in SAHA treated normal offspring was shorter than normal control offspring at 2nd, 4th and 5th trial (* p < 0.05, Fig 3a); The escape latency in I2S, I4S and I8S group were shorter than their relative control groups (I2N, I4N and I8N group respectivly), but had no statistical differences (p > 0.05, Fig 3b, c and d). The escape latency in I8S group was longer than normal control group (CN group) at 3rd, 4th and 5th trial (p < 0.05, Fig 3e). S = SAHA treated subgroup; N = non—SAHA treated subgroup. doi:10.1371/journal.pone.0160826.g003 that maternal exposure to isoflurane of approximately 1 MAC (1 MAC of isoflurane for rats on gestational day 14–16 is 1.4%) [33, 34] can impair learning and memory in the offspring. To study whether the learning and memory impairment caused by maternal isoflurane exposure could be reversed by HDAC inhibitor, SAHA was given to the offspring before each MWM trial. The escape latencey in SAHA treated normal offspring was shorter than control group at 2nd, 4th and 5th trial ((cid:2) p < 0.05, Fig 3A). The escape latency in I2S, I4S and I8S group were shorter than their relative control groups (I2N, I4N and I8N group respectivly), but had no statistical differences (p > 0.05, Fig 3B, 3C and 3D). The escape latency in I8S group was longer than normal control group (CN group) at 3rd, 4th and 5th trial (p < 0.05, Fig 3E). The target quadrant traveling time in SAHA treated sugroup was more than relative non-SAHA subgroup (p < 0.05, Fig 4A). The traveling time in I2S, I4S and I8S group was not significantly different from that in CN group (Fig 4A). The platform-crossing times in SAHA treated sugroups increased compared with their relative non-SAHA subgroups (Fig 4B). But the plat- form-crossing times in I8S subgroup was still less than CN group (p < 0.05, Fig 4B). These PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 8 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 4. HDAC2 inhibition reversed the memory impairment caused by maternal isoflurane exposure. (a) Target quadrant traveling time. The target quadrant traveling time in SAHA treated sugroup was significant more than relative non-SAHA subgroups (* p < 0.05); The traveling time in I2S, I4S and I8S group was not significantly different from that in CN group. (b) Platform crossing times. The platform-crossing times in SAHA treated sugroups increased compared with their relative non-SAHA subgroups, but had no statistical differences. The platform-crossing times in I8S subgroup was still less than CN group (* p < 0.05). doi:10.1371/journal.pone.0160826.g004 results indicate that SAHA can alleviate the learning and memory impairment caused by iso- flurane exposure, but cannot completely reverse the impairment when the exposure time was 8 hours. Maternal Isoflurane Exposure Disrupted Ultrastructural Features of Hippocampal Neurons in Offspring Ultrastructural changes in hippocampal neurons were evaluated by electron microscopy. Maternal isoflurane exposure impaired the structure of the hippocampus when the exposure time was more than 4 hours. The ultrastructure in group I2N showed no obvious differences compared to group CN. When the exposure time was lengthened to 4 hours, neuron number decreased, nuclei became irregular, cytoplasmic area decreased, mitochondrial number decreased, and we observed evidence of disordered mitochondrial cristae. The quantity of rough endoplasmic reticulum, ribosome and Golgi apparatus decreased, and the ribosomes exhibited degranulation. When the isoflurane exposure time was prolonged to 8 hours, all of these changes became more prominent. We observed fewer neurons with dilated intercellular space. Dissolved mitochondrial cristae and swollen Golgi apparatus could be observed in group I8. HDAC inhibition alleviated all the hippocampal impairments caused by isoflurane expo- sure, but the neurons number had no obvious change (Fig 5). Increased HDAC2 mRNA Expression Caused By Isoflurane and the Reversed Effect of SAHA Maternal isoflurnae exposure increased the expression levels of HDAC2 mRNA in the hippo- campus of the offspring rats (p < 0.05; Fig 6A). SAHA reversed the expression of HDAC2 mRNA in the hippocampus. The expression levels of HDAC2 mRNA in the CS, I2S, I4S and I8S groups were lower than those in the CN, I2N, I4N and I8N groups respectively (p < 0.05; PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 9 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 5. HDAC2 inhibition alleviated the hippocampal ultrastructure impairment caused by maternal isoflurane exposure (transmission electron microscopy, ×6000). The hippocampal ultrastructure showed apparent abnormality with the increase of isoflurane exposure time. The ultrastructure showed no differences compared to the control group when isoflurane exposure time was 2h (I2N). When isoflurane exposure time lengthen to 4h, the neuron number decreased, the nuclei became irregular, cytoplasmic area decreased, mitochondrial number decreased, and we observed evidence of disordered mitochondrial cristae. The quantity of rough endoplasmic reticulum, ribosome and Golgi apparatus decreased, and the ribosomes exhibited degranulation (I4N). When the exposure time prolonged to 8h, all of these changes became more prominent, there were fewer neurons with dilated intercellular space. Dissolved mitochondrial cristae and swollen Golgi apparatus could be observed (I8N). HDAC inhibition alleviated the impairments, but did not increase the neuronal number (I4S and I8S group). doi:10.1371/journal.pone.0160826.g005 Fig 6B). These results indicate that HDAC2 inhibition can reverse the overexpression of HDAC2 mRNA in offspring caused by maternal isoflurane exposure during late pregnancy. Downregulated CREB mRNA Expression and the Reversed Effect of SAHA The expression levels of CREB mRNA in the hippocampus of the offspring in the I2N, I4N and I8N groups were significantly lower than those in the CN group (p < 0.05; Fig 7A). These results indicate that maternal isoflurane exposure during late pregnancy can inhibit the expres- sion of CREB mRNA in offspring. The CREB mRNA levels in the I8N group were significantly lower than in the I2N group and I4N group (p < 0.05; Fig 7A), suggesting that prolonged expo- sure to isoflurane during late pregnancy has a more profound effect on inhibiting CREB mRNA expression. The expression levels of CREB mRNA in the CS group were higher than those in the CN group (p < 0.05; Fig 7B). This finding indicates that SAHA can potentiate the expression of CREB mRNA in the hippocampus of the offspring rats. The expression levels of CREB mRNA in the I2S, I4S and I8S groups were significantly higher than those in the I2N, I4N and I8N groups respectively (p < 0.05; Fig 7B). These results indicate that SAHA can reverse the inhibiting effect of maternal isoflurane exposure on CREB mRNA expression off- spring rats. However, the expression level of CREB mRNA in the I8S group was still lower than CN group (p < 0.05, Fig 7B). This means that SAHA cannot completely reverse the inhibiting effect of maternal isoflurane exposure on the expression of CREB mRNA when the exposure time is 8 hours. PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 10 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 6. HDAC2 inhibition reversed the overexpression of HDAC2 mRNA caused by maternal isoflurane exposure. The expression levels of HDAC2 mRNA in offspring hippocampus were detected by real time PCR (RT—PCR). The levels of mRNA were normalized to that of β-actin in the same sample and then normalized to the average values of control offspring in the same RT-PCR. The mean value of the mRNA expression level of all of the offspring born to the same mother rat was calculated as the final expression level of mRNA. (a) maternal isoflurane exposure potentiated the expression of HDAC2 mRNA. The HDAC2 mRNA levels in the offpsring hippocampus in I2N, I4N and I8N group were higher than normal control group (CN group, * p < 0.05). (b) SAHA reversed the overexpression of HDAC2 mRNA. The HDAC2 mRNA levels in SAHA treated subgroup were higher than non-SAHA subgroups (* p < 0.05). doi:10.1371/journal.pone.0160826.g006 Downregulated Expression of NR2B and the Reversed Effect of SAHA The expression levels of NR2B mRNA in the hippocampus of the offspring in the I2N, I4N and I8N groups were lower than those in the CN group (p < 0.05; Fig 8A3). The expression levels of NR2B mRNA in the I4N and I8N groups were lower than those in the I2N group (p <0.05; Fig 8A3). The changes of NR2B protein expression levels were similar to NR2B mRNA levels (Fig 8B3). These results indicate that maternal isoflurane exposure during late pregnancy Fig 7. HDAC2 inhibition reversed the downregulated expression of CREB mRNA caused by maternal isoflurane exposure: (a) Isoflurane exposure downregulated CREB mRNA expression. The CREB mRNA levels in the offspring hippocampus in isoflurane exposed group were lower than control group (* p < 0.05). With the increase of isoflurane exposure time, the downregulated effect became more obvious. The CREB mRNA levels in I8N group were higher than I2N group (# p < 0.05). (b) SAHA reversed the down-regulation of CREB mRNA expression. Compared with relative non-SAHA subgroup, the levels of CREB mRNA in SAHA treated sugroup increased (* p < 0.05). But the CREB mRNA levels in I8S subgroup were still lower than normal control group (# p < 0.05). This indicates that SAHA cannot completely reverse the downregulated effect caused by isoflurane when the exposure time prolonged to 8 hours. doi:10.1371/journal.pone.0160826.g007 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 11 / 18 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 12 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Fig 8. HDAC2 inhibition reversed the downregulated expression of NR2B caused by maternal isoflurane exposure. (A1) Amplification plot of NR2B and β-actin mRNA; (A2) Agarose gel electrophoresis images of NR2B and β-actin mRNA; (A3) Maternal isoflurane exposure downregulated the expression of NR2B mRNA (mean ± SE): The levels of NR2B mRNA in isoflurane exposure group (I2N, I4N, I8N) were lower than CN group (* p < 0.05). The NR2B mRNA levels in I4N and I8N group were lower than I2N group (# p < 0.05); (A4) SAHA reversed the downregulated expression of NR2B mRNA (mean ± SE): The levels of NR2B mRNA in I2S, I4S and I8S subgroup were higher than I2N, I4N and I8N subgroup respectively (* p < 0.05). The NR2B mRNA levels in I8S subgroup were lower than CN group (# p < 0.05). (B1) NR2B protein western blot images; (B2) Maternal isoflurane exposure downregulated the expression of NR2B protein (mean ± SD): The protein levels of NR2B protein were lower than CN group (# compared with I2N group, p<0.05b); (B3) HDAC2 inhibition reversed the downregulated expression of NR2B protein: The protein levels of NR2B in I2S, I4S and I8S subgroups were higher than I2N, I4N and I8N sugroups respectively. The levels of NR2B protein in I8S subgroup were lower than CN group (# p < 0.001). This indicates that SAHA cannot completely reverse the downregulated effect caused by isoflurane when the exposure time prolonged to 8 hours. doi:10.1371/journal.pone.0160826.g008 inhibits the expression of NR2B in the hippocampus of the offspring rats and that prolonged isoflurane exposure can exacerbate these changes. The expression levels of NR2B protein and mRNA in the CS, I2S, I4S and I8S groups were higher than those in the CN, I2N, I4N and I8N groups respectively (Fig 8A4 and 8B3). These results indicate that SAHA can reverse the inhib- iting effect of maternal isoflurane exposure on NR2B expression in the hippocampus of the off- spring. However, the mRNA and protein levels of NR2B in the I8S group were still lower than those in the CN group (Fig 8A4 and 8B3). Thus, HDAC2 inhibition cannot completely reverse the inhibiting effects of maternal isoflurane exposure on the expression of NR2B when the exposure time is 8 hours. Discussion The present study provides preclinical evidence that maternal rat exposure to isoflurane during late pregnancy impairs the spatial learning and memory in their offspring. The behavioural abnormality was associated with hippocampal neuronal damage, overexpression of HDAC2 mRNA and the subsequent downregulation of CREB mRNA and NR2B in hippocampus. This finding is similar to the results described in a previous report, which showed that maternal exposure to 1.4% isoflurane for 4 hours on gestational day 14 impairs the offspring rats’ spatial memory acquisition [9]. The results of the present study are different from another report showing that isoflurane exposure during late pregnancy was not neurotoxic to the fetal brain and did not impair learning and memory in juvenile or adult offspring [1]. Isoflurane neurotoxicity is concentration-dependent [35]. General anesthetics can be neuroprotective and neurotoxic, depending on the levels, timing and mode of exposure. Isoflurane exerts multiple effects on neuronal stem cell survival, proliferation and differentiation. Short exposures to low isoflurane concentrations promote proliferation and differentiation of ReNcell CX cells, whereas prolonged exposure to high isoflurane concentrations induced significant cell damage [36]. This may be one of the critical reasons that our result is different from the report by Li et al. [1]. Our study involved 1.5% isoflurane, approximately 1 MAC, which is higher than the concentration used in the previous study (1.3%) [1]. The different exposure timing may be another reason for the differences between two experiments. The exposure time point in our experiment was E18 day, whereas that in previous study was E21 [1]. Therefore, the develop- mental maturity of the neurons was different between two experiments, which may result in different vulnerability to isoflurane [37]. In the present study, the dams were divided into dif- ferent groups based on their learning and memory results tested before pregnancy. This was meant to exclude the effects of genetic factors on the learning and memory of the offspring and may have facilitated the significant differences in learning and memory obtained between the control and isoflurane exposure groups. There was no obvious dyskinesia in offspring. There was no difference in swimming speed (automatically record by MWM system) of the offspring among groups. We had not evaluated the anxiety of offspring rats in present study. But previous study had revealed that rats exposed PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 13 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 to isoflurane in utero on E14 have reduced anxiety compared with controls [9]. Thus the differ- ences in learning and memory results were not caused by abnormal motor function or anxiety in offspring. The femoral vein blood gas analysis showed that exposure to this concentration of isoflurane for 8 hours had no significant effect on the blood gases and electrolytes of the dams (Table 1). Normal maternal body temperature was maintained during the isoflurane exposure process. Dams were removed from the study if they exhibited a cumulative time of more than 5 minutes with SpO2 damaging effect on learning and memory was not induced by physiological disturbances caused by isoflurane. <95% or >20% decrease in systolic blood pressure (SBP). Therefore, the How does isoflurane exposure damage the spatial learning and memory function in off- spring? Transmission electron microscopy results showed that neuron number and ultrastruc- ture in offspring hippocampus had been impaired (Fig 5). HDAC inhibitors could alleviate the impairments, thus improving learning and memory. These data suggest that maternal exposure to isoflurane during late pregnancy harms hippocampal neurons, thus impairing learning and memory in the offspring. Previous results showed that prenatal exposure to 1.3% isoflurane for 4 hours on gestational day 14 led to impaired synaptic ultrastructure in the hippocampus of the offspring and thus causing poor learning and memory [38]. Recently, histone acetylation, which is regulated by histone deacetylases (HDAC), has been implicated in memory formation [39–43]. Increasing histone-tail acetylation can facilitate learning and memory [12, 13]. Further studies showed that HDAC2, but not HDAC1, decreases dendritic spine density, synapse number, synaptic plasticity and memory formation [15]. HDAC2 regulates learning and memory via the transcription factor CREB and the recruitment of the transcriptional coactivator and histone acetyltransferase CREB-binding pro- tein (CBP) via the CREB-binding domain of CBP [44]. The inhibition of HDAC can modulate hippocampal-dependent long-term memory in a CBP-dependent manner [45]. Inhibiting HDAC increases the levels of acetylated histones and phospho-CREB (p-CREB), which enhances the binding of p-CREB to its binding site at the promoter of the NR2B gene, thus increasing the expression of NR2B in the hippocampus [17]. Thus, HDAC2 impairs learning and memory through a pathway involving HDAC2-CREB-NR2B. NR2B is critical to the for- mation and maintenance of learning and memory [46–48]. It is undetermined whether mater- nal isoflurane exposure during late pregnancy damage the spatial learning and memory in offspring via this pathway. The hippocampus is a critical structure for learning and memory. Thus, the expression levels of HDAC2, CREB, and NR2B mRNA and NR2B protein in the hip- pocampus of the offspring were analyzed in the present study. The results showed that mater- nal isoflurane exposure during late pregnancy increased the expression of HDAC2 mRNA, decreased CREB mRNA and NR2B mRNA and protein in the hippocampus of the offspring. This is similar to a previous report that maternal anesthesia with ketamine on G14 downregu- lated the expression of NR2B in the hippocampus of offspring [49]. These results indicate that maternal isoflurane exposure during late pregnancy causes the over-expression of HDAC2, thereby inhibiting the expression of CREB mRNA, resulting in downregulation of NR2B in the hippocampus of the offspring rats. These effects lead to impaired learning and memory in the offspring. NMDA receptor blockade acts critical role in determining whether neurons are reversibly injured or are driven to cell death by isoflurane [50]. Thus, these results indicate that maternal isoflurane exposure during late pregnancy can damage the learning and memory of the offspring rats via the HDAC2-CREB -NR2B pathway. Further supporting the role of HDAC2, CREB and NR2B in the learning and memory dys- function of the offspring, we showed that SAHA (an HDAC inhibitor that mainly inhibits HDAC2) treatment 2 hours before each Morris water maze trial reversed the impaired learning and memory and the alterations in expression of HDAC2, CREB and NR2B mRNA and PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 14 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 protein in the hippocampus. Many lines of evidence showed that HDAC inhibitors that mainly inhibit HDAC2 potentiate learning and memory. The class I HDAC inhibitor RGFP963 can enhance the consolidation of cued fear extinction [51]. Kinetically selective HDAC2 inhibitors rescued the memory deficits in mice with neurodegenerative disease by increasing H4K12 and H3K9 histone acetylation in hippocampal neurons [52]. SAHA facilitated fear extinction of rats by enhancing the expression of hippocampal NR2B-containing NMDA receptors. The lev- els of acetylated histones in the hippocampus increased significantly 2 hours after SAHA administration and were accompanied by enhanced binding of p-CREB to its binding site at the promoter of the NR2B gene [17], resulted in the increase of of NR2B mRNA levels, but not NR1 or NR2A mRNA. Therefore, we administered SAHA to the offspring 2 hours before every water maze trial. It is impossible to know whether the learning and memory improvements caused by SAHA in animals exposed to isoflurane are due to its general compensatory effects or a specific reversal of the effects of isoflurane. However, the effects of SAHA on animals exposed to isoflurane, along with the effects of isoflurane on HDAC, suggest that isoflurane may act on HDAC to affect learning and memory. The results of the present study provided the first demonstration that an HDAC inhibitor reverses the learning and memory impair- ments caused by maternal isoflurane exposure during late pregnancy. β-amyloid protein accu- mulation, caspase activation [53, 54], inositol 1,4,5-trisphosphate (IP3) receptor activation [36, 55] and calcium dysregulation [56] are critical pathological mechanisms in the neurotoxicity caused by isoflurane. It remains to be clarified whether these mechanisms are involved in the learning and memory impairment caused by maternal isoflurane exposure. The maintenance of normal cognition is known to require precise excitatory–inhibitory (E/ I) balance [57]. Disrupted NMDA-receptor signaling may be a molecular substrate common to a number of neurodevelopmental, neuropsychiatric disorders [58]. NR2B is an excitatory receptor and plays a critical role in the maintenance and formation of normal learning and memory. NR2B signaling can be maintained at a normal range to keep the brain in E/I balance. The rats in the CS group in the current study were normal offspring that had not exposed to isoflurane during pregnancy and had normal levels of inhibitory receptors. It is possible that they could maintain normal NR2B function by autoregulation or other pathways. NR2B pro- tein expression in the I2, I4 and I8 groups had been inhibited by maternal isoflurane exposure. Therefore, the expression levels of NR2B protein in these rats could be increased by SAHA via the HDAC2-CREB-NR2B pathway [16, 17] to maintain the E/I balance. Protein levels are dependant on numerous factors, including gene transcription, translation and the number and functional state of cells that produce the protein. Maybe there are some unknow factors affect- ing the mRNA translating to protein, thus result in the increasing degree of NR2B protein was different from that of NR2B mRNA in the groups of I2S, I4S and I8S. Future studies are needed to determine if there are other factors affecting the translation of mRNA to protein in this pathway. The present study only assessed the ultrastructural and molecular changes in the offspring brains after the behaviour test. The acute changes in the fetal brains immediately or several hours after isoflurane exposure had not been evaluated. Whether pretreatment with SAHA prior to isoflurane exposure will block all the harmful effects caused by isoflurane in offspring is not know yet. These questions require further clarification. Taken together, the results in the present study suggested that maternal exposure of rats to isoflurane during late pregnancy impairs the spatial learning and memory of the offspring. This effect was associated with damage to hippocampal neurons, the overexpression of HDAC2 mRNA and the subsequent downregulation of CREB mRNA and NR2B. HDAC2 inhibition improved the impaired learning and memory of the offspring induced by maternal exposure to isoflurane. PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 15 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 Author Contributions Conceived and designed the experiments: FL WZ. Performed the experiments: YH QY BL LW ZL LX YF JL. Analyzed the data: FL ZZ. Contributed reagents/materials/analysis tools: ZL LX. Wrote the paper: FL ZZ YF. References 1. Li Y, Liang G, Wang S, Meng Q, Wang Q, Wei H. Effects of fetal exposure to isoflurane on postnatal memory and learning in rats. Neuropharmacology. 2007; 53(8):942–50. PMID: 17959201 2. Wang S, Peretich K, Zhao Y, Liang G, Meng Q, Wei H. Anesthesia-induced neurodegeneration in fetal rat brains. Pediatr Res. 2009; 66(4):435–40. PMID: 20016413 doi: 10.1203/PDR.0b013e3181b3381b 3. Kort B, Katz VL, Watson WJ. The effect of nonobstetric operation during pregnancy. Surg Gynecol Obstet. 1993; 177(4):371–6. PMID: 8211581 4. Mazze RI, Källén B. Reproductive outcome after anesthesia and operation during pregnancy: a registry study of 5405 cases. Am J Obstet Gynecol. 1989; 161(5):1178–85. PMID: 2589435 5. Brodsky JB, Cohen EN, Brown BW Jr, Wu ML, Whitcher C. Surgery during pregnancy and fetal out- come. Am J Obstet Gynecol. 1980; 138(8):1165–7. PMID: 7446625 6. Baldwin EA, Borowski KS, Brost BC, Rose CH. Antepartum nonobstetrical surgery at (cid:3)23 weeks’ ges- tation and risk for preterm delivery. Am J Obstet Gynecol. 2015; 212(2):232.e1–5. PMID: 25218955 7. Van De Velde M, De Buck F. Anesthesia for non-obstetric surgery in the pregnant patient. Minerva Anestesiol. 2007; 73(4):235–40. PMID: 17473818 8. Zhang Qin,Luo Foquan,Zhao Weilu,Li Bingda,Tang Yang,Hu Yan.Effect of prolonged anesthesia with propofol during early pregnancy on cognitive function of offspring rats. Chin J Anesthesiol, 2014; 34(9): 1051–1053. doi: 10.3760/cma.j.issn.0254-1416.2014.09.005 9. Palanisamy A, Baxter MG, Keel PK, Xie Z, Crosby G, Culley DJ. Rats exposed to isoflurane in utero during early gestation are behaviorally abnormal as adults. Anesthesiology. 2011; 114(3):521–8. PMID: 21307768 doi: 10.1097/ALN.0b013e318209aa71 10. Guan Z, Giustetto M, Lomvardas S, Kim JH, Miniaci MC, Schwartz JH, et al. Integration of long-term- memory-related synaptic plasticity involves bidirectional regulation of gene expression and chromatin structure. Cell. 2002; 111(4):483–93. PMID: 12437922 11. Korzus E, Rosenfeld MG, Mayford M. CBP histone acetyltransferase activity is a critical component of memory consolidation. Neuron. 2004; 42(6):961–72. PMID: 15207240 12. Levenson JM, O'Riordan KJ, Brown KD, Trinh MA, Molfese DL, Sweatt JD. Regulation of histone acety- lation during memory formation in the hippocampus. J Biol Chem. 2004; 279(39):40545–59. PMID: 15273246 13. Vecsey CG, Hawk JD, Lattal KM, Stein JM, Fabian SA, Attner MA, et al. Histone deacetylase inhibitors enhance memory and synaptic plasticity via CREB:CBP-dependent transcriptional activation. J Neu- rosci. 2007; 27(23):6128–40. PMID: 17553985 14. Fischer A, Sananbenesi F, Wang X, Dobbin M, Tsai LH. Recovery of learning and memory is associ- ated with chromatin remodelling. Nature. 2007; 447(7141):178–82. PMID: 17468743 15. Guan JS, Haggarty SJ, Giacometti E, Dannenberg JH, Joseph N, Gao J, et al. HDAC2 negatively regu- lates memory formation and synaptic plasticity. Nature. 2009; 459(7243):55–60. PMID: 19424149 doi: 10.1038/nature07925 16. Almeida S, Cunha-Oliveira T, Laço M, Oliveira CR, Rego AC. Dysregulation of CREB activation and histone acetylation in 3-nitropropionic acid-treated cortical neurons: prevention by BDNF and NGF. Neurotox Res. 2010; 17(4):399–405. PMID: 19779956 doi: 10.1007/s12640-009-9116-z 17. Fujita Y, Morinobu S, Takei S, Fuchikami M, Matsumoto T, Yamamoto S, et al. SAHA, a histone deace- tylase inhibitor, facilitates fear extinction and enhances expression of the hippocampal NR2B-contain- ing NMDA receptor gene. J Psychiatr Res. 2012; 46(5):635–43. PMID: 22364833 doi: 10.1016/j. jpsychires.2012.01.026 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 16 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 18. Zhong T, Qing QJ, Yang Y, Zou WY, Ye Z, Yan JQ, et al. Repression of contexual fear memory induced by isoflurane is accompanied by reduction in histone acetylation and rescued by sodium butyrate. Br J Anaesth. 2014; 113(4):634–43. PMID: 24838805 doi: 10.1093/bja/aeu184 19. Zhong T, Guo Q, Zou W, Zhu X, Song Z, Sun B, et al. Neonatal isoflurane exposure induces neurocog- nitive impairment and abnormal hippocampal histone acetylation in mice. PLoS One. 2015; 10(4): e0125815. PMID: 25928815 doi: 10.1371/journal.pone.0125815 20. Barraco RD, Chiu WC, Clancy TV, Como JJ, Ebert JB, Hess LW, et al. EAST Practice Management Guidelines Work Group.Practice management guidelines for the diagnosis and management of injury in the pregnant patient: the EAST Practice Management Guidelines Work Group. J Trauma. 2010; 69 (1):211–4. PMID: 20622592 doi: 10.1097/TA.0b013e3181dbe1ea 21. Machado NO, Machado LS. Laparoscopic cholecystectomy in the third trimester of pregnancy: report of 3 cases. Surg Laparosc Endosc Percutan Tech. 2009; 19(6):439–41. PMID: 20027085 doi: 10. 1097/SLE.0b013e3181c30fed 22. Upadhyay A, Stanten S, Kazantsev G, Horoupian R, Stanten A. Laparoscopic management of a nonob- stetric emergency in the third trimester of pregnancy. Surg Endosc. 2007; 21(8):1344–8. PMID: 17285387 23. Buser KB. Laparoscopic surgery in the pregnant patient:results and recommendations. JSLS. 2009; 13(1):32–5. PMID: 19366538 24. Qaiser R, Black P. Neurosurgery in pregnancy. Semin Neurol. 2007; 27(5):476–81. PMID: 17940927 25. Holthausen UH, Mettler L, Troidl H. Pregnancy: A contraindication? World J Surg.1999; 23(8):856–62. PMID: 10415212 26. Affleck DG, Handrahan DL, Egger MJ, Price RR. The laparoscopic management of appendicitis and cholelithiasis during pregnancy. Am J Surg.1999; 178(6):523–9. PMID: 10670865 27. Meshikhes AN. Successful laparoscopic cholecystectomy in the third trimester of pregnancy. Saudi Med J. 2008; 29(2):291–2. PMID: 18246244 28. Choi JJ, Mustafa R, Lynn ET, Divino CM. Appendectomy during pregnancy: follow-up of progeny. J Am Coll Surg. 2011; 213(5):627–32. PMID: 21856183 doi: 10.1016/j.jamcollsurg.2011.07.016 29. Rohan D, Buggy DJ, Crowley S, Ling FK, Gallagher H, Regan C, et al. Increased incidence of postoper- ative cognitive dysfunction 24 hr after minor surgery in the elderly. Can J Anaesth. 2005; 52(2):137–42. PMID: 15684252 30. Wang C, Anastasio N, Popov V, Leday A, Johnson KM. Blockade of N-methyl-D-aspartate receptors by phencyclidine causes the loss of corticostriatal neurons. Neuroscience. 2004; 125(2):473–83. PMID: 15062989 31. Rodier PM. Chronology of neuron development: animal studies and their clinical implications. Dev Med Child Neurol. 1980; 22(4): 525–45. PMID: 7409345 32. Bing-da LI,Fuo—quan LUO,Wei—lu ZHAO,Yang TANG,Qin ZHANG,Yan HU.Effect of ketamine anes- thesia in early pregnancy on expression of hippyragranin mRNA in hippocampus in offsprings of rats. Chin J Anesthesiol, 2012, 32(11): 1334–1336. doi: 10.3760/cma.j.issn.0254-1416.2012.11.013 33. Mazze RI, Fujinaga M, Rice SA, Harris SB, Baden JM. Reproductive and teratogenic effects of nitrous oxide, halothane, isoflurane and enflurane in Sprague-Dawley rats. Anesthesiology. 1986; 64(3):339– 44. PMID: 3954129 34. Mazze RI, Rice SA, Baden JM. Halothane, isoflurane and enflurane MAC in pregnant and nonpregnant female and male mice and rats. Anesthesiology. 1985; 62(3):339–41. PMID: 3977116 35. Wei H, Kang B, Wei W, Liang G, Meng QC, Li Y, et al. Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently. Brain Res. 2005; 1037(1–2):139–47. PMID: 15777762 36. Zhao X, Yang Z, Liang G, Wu Z, Peng Y, Joseph DJ, et al. Dual effects of isoflurane on proliferation, dif- ferentiation, and survival in human neuroprogenitor cells. Anesthesiology. 2013; 118(3):537–49. PMID: 23314167 doi: 10.1097/ALN.0b013e3182833fae 37. Hofacer RD, Deng M, Ward CG, Joseph B, Hughes EA, Jiang C, et al. Cell age-specific vulnerability of neurons to anesthetic toxicity. Ann Neurol. 2013; 73(6):695–704. PMID: 23526697 doi: 10.1002/ana. 23892 38. Kong F, Xu L, He D, Zhang X, Lu H. Effects of gestational isoflurane exposure on postnatal memory and learning in rats. Eur J Pharmacol. 2011; 670(1):168–74. PMID: 21930122 doi: 10.1016/j.ejphar. 2011.08.050 39. Morris MJ, Mahgoub M, Na ES, Pranav H, Monteggia LM. Loss of histone deacetylase 2 improves working memory and accelerates extinction learning. J Neurosci. 2013; 33(15):6401–11. PMID: 23575838 doi: 10.1523/JNEUROSCI.1001-12.2013 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 17 / 18 Maternal Exposure to Isoflurane Impairs Memory in Offspring by HDAC2 40. Mahgoub M, Monteggia LM. A role for histone deacetylases in the cellular and behavioral mechanisms underlying learning and memory. Learn Mem. 2014; 21(10):564–8. PMID: 25227251 doi: 10.1101/lm. 036012.114 41. Penney J, Tsai LH. Histone deacetylases in memory and cognition. Sci Signal. 2014; 7(355):re12. PMID: 25492968 doi: 10.1126/scisignal.aaa0069 42. Fass DM, Reis SA, Ghosh B, Hennig KM, Joseph NF, Zhao WN, et al. Crebinostat: a novel cognitive enhancer that inhibits histone deacetylase activity and modulates chromatin-mediated neuroplasticity. Neuropharmacology. 2013; 64:81–96. PMID: 22771460 doi: 10.1016/j.neuropharm.2012.06.043 43. Maddox SA, Schafe GE. Epigenetic alterations in the lateral amygdala are required for reconsolidation of a Pavlovian fear memory. Learn Mem. 2011; 18(9):579–93. PMID: 21868438 doi: 10.1101/lm. 2243411 44. Bambah-Mukku D, Travaglia A, Chen DY, Pollonini G, Alberini CM. A positive autoregulatory BDNF feedback loop via C/EBPβ mediates hippocampal memory consolidation. J Neurosci. 2014; 34 (37):12547–59. PMID: 25209292 doi: 10.1523/JNEUROSCI.0324-14.2014 45. Haettig J, Stefanko DP, Multani ML, Figueroa DX, McQuown SC, Wood MA. HDAC inhibition modu- lates hippocampus-dependent long-term memory for object location in a CBP-dependent manner. Learn Mem. 2011; 18(2):71–9. PMID: 21224411 doi: 10.1101/lm.1986911 46. Bliss TV. Young receptors make smart mice. Nature. 1999; 401(6748):25–7. PMID: 10485698 47. Tang YP, Shimizu E, Dube GR, Rampon C, Kerchner GA, Zhuo M, et al. Genetic enhancement of learn- ing and memory in mice. Nature. 1999; 401(6748):63–9. PMID: 10485705 48. Plattner F, Hernández A, Kistler TM, Pozo K, Zhong P, Yuen EY, et al. Memory enhancement by target- ing Cdk5 regulation of NR2B. Neuron. 2014; 81(5):1070–83. PMID: 24607229 doi: 10.1016/j.neuron. 2014.01.022 49. Zhao T, Li Y, Wei W, Savage S, Zhou L, Ma D. Ketamine administered to pregnant rats in the second tri- mester causes long-lasting behavioral disorders in offspring. Neurobiol Dis. 2014; 68:145–55. PMID: 24780497 doi: 10.1016/j.nbd.2014.02.009 50. Jevtovic-Todorovic V, Beals J, Benshoff N, Olney JW. Prolonged exposure to inhalational anesthetic nitrous oxide kills neurons in adult rat brain. Neuroscience. 2003; 122(3):609–16. PMID: 14622904 51. Bowers ME, Xia B, Carreiro S, Ressler KJ. The Class I HDAC inhibitor RGFP963 enhances consolida- tion of cued fear extinction. Learn Mem. 2015; 22(4):225–31. PMID: 25776040 doi: 10.1101/lm. 036699.114 52. Wagner FF, Zhang YL, Fass DM, Joseph N, Gale JP, Weïwer M, et al. Kinetically Selective Inhibitors of Histone Deacetylase 2 (HDAC2) as Cognition Enhancers. Chem Sci. 2015; 6(1):804–15. PMID: 25642316 53. Pan C, Xu Z, Dong Y, Zhang Y, Zhang J, McAuliffe S, et al. The potential dual effects of anesthetic iso- flurane on hypoxia-induced caspase-3 activation and increases in β-site amyloid precursor protein- cleaving enzyme levels. Anesth Analg. 2011; 113(1):145–52. PMID: 21519046 doi: 10.1213/ANE. 0b013e3182185fee 54. Sun Y, Zhang Y, Cheng B, Dong Y, Pan C, Li T, et al. Glucose may attenuate isoflurane-induced cas- pase-3 activation in H4 human neuroglioma cells. Anesth Analg. 2014; 119(6):1373–80. PMID: 25068691 doi: 10.1213/ANE.0000000000000383 55. Wei H, Liang G, Yang H, Wang Q, Hawkins B, Madesh M, et al. The common inhalational anesthetic isoflurane induces apoptosis via activation of inositol 1,4,5-trisphosphate receptors. Anesthesiology. 2008; 108(2):251–60. PMID: 18212570 doi: 10.1097/01.anes.0000299435.59242.0e 56. Wei H. The role of calcium dysregulation in anesthetic-mediated neurotoxicity. Anesth Analg. 2011; 113(5):972–4. PMID: 22021793 doi: 10.1213/ANE.0b013e3182323261 57. Sohal VS, Zhang F, Yizhar O, Deisseroth K. Parvalbumin neurons and gamma rhythms enhance corti- cal circuit performance. Nature. 2009; 459(7247): 698–702. PMID: 19396159 doi: 10.1038/ nature07991 58. Gandal MJ, Sisti J, Klook K, Ortinski PI, Leitman V, Liang Y, Thieu T, Anderson R, Pierce RC, Jonak G, Gur RE, Carlson G, Siegel SJ. GABAB-mediated rescue of altered excitatory-inhibitory balance, gamma synchrony and behavioral deficits following constitutive NMDAR-hypofunction. Transl Psychia- try. 2012; 2:e142. PMID: 22806213 doi: 10.1038/tp.2012.69 PLOS ONE | DOI:10.1371/journal.pone.0160826 August 18, 2016 18 / 18",rats,"['Foquan Luo1‡*, Yan Hu1,2‡, Weilu Zhao1, Zhiyi Zuo3, Qi Yu1, Zhiyi Liu1, Jiamei Lin1, Yunlin Feng1, Binda Li4, Liuqin Wu4, Lin Xu1']",gestational day 18,"['On E18, gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane (Abbott labo- ratories Ltd, Worcester, MA, USA) in 100% oxygen for 2, 4 and 8 hours, respectively, while those in the control group received 100% oxygen only.']",Y,"['Thirty days after birth, the Morris water maze (MWM) was used to assess learning and memory in the off- spring.']",isoflurane,"['On E18, gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane (Abbott labo- ratories Ltd, Worcester, MA, USA) in 100% oxygen for 2, 4 and 8 hours, respectively, while those in the control group received 100% oxygen only.']",none,[],sprague dawley,['Seventy-day-old female Sprague-Dawley (SD) rats (maternal rats) were supplied by the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011–0030).'],"The study addresses the effect of maternal exposure to isoflurane during late pregnancy on offspring's learning and memory, which was not fully understood.","['However, little is known regarding the effects of maternal exposure to general anes- thetics during late pregnancy on the offspring’s subsequent learning and memory.']",None,[],The article argues the impact of findings in terms of demonstrating the potential damage to offspring learning and memory due to maternal isoflurane exposure.,['These results suggest that exposure to isoflurane during late pregnancy can damage the learning and memory of the offspring rats via the HDAC2-CREB -NR2B pathway.'],None,[],Potential applications include the use of HDAC2 inhibition to alleviate learning and memory impairment caused by maternal isoflurane exposure.,"['These results indicate that SAHA can alleviate the learning and memory impairment caused by iso- flurane exposure, but cannot completely reverse the impairment when the exposure time was 8 hours.']",True,True,False,True,True,True,10.1371/journal.pone.0160826 10.3892/etm.2018.5950,1455.0,Lu,2018,mice,postnatal day 7,Y,sevoflurane,isoflurane,c57bl/6,"EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 4097-4104, 2018 Sevoflurane-induced memory impairment in the postnatal developing mouse brain ZHIJUN LU1, JIHUI SUN1, YICHUN XIN1, KEN CHEN1, WEN DING1 and YUJIA WANG2 1Department of Anesthesia, Rui Jin Hospital Luwan Branch, Shanghai Jiao Tong University School of Medicine, Shanghai 200020; 2Intensive Care Unit, Shanghai Jing'an District Shibei Hospital, Shanghai 200443, P.R. China Received March 31, 2016; Accepted March 6, 2017 DOI: 10.3892/etm.2018.5950 Abstract. The aim of the present study was to confirm that sevoflurane induces memory impairment in the postnatal developing mouse brain and determine its mechanism of action. C57BL/6 mice 7 days old were randomly assigned into a 2.6% sevoflurane (n=68), a 1.3% sevoflurane (n=68) and a control (n=38) group. Blood gas analysis was performed to evaluate hypoxia and respiratory depression during anes- thesia in 78 mice. Measurements for expression of caspase‑3 by immunohistochemistry, cleavage of poly adenosine diphosphate‑ribose polymerase (PARP) by western blotting, as well as levels of brain‑derived neurotrophic factor (BDNF), tyrosine kinase receptor type 2 (Ntrk2), pro‑BDNF, p75 neuro- trophin receptor (p75NTR) and protein kinase B (PKB/Akt) by enzyme-linked immunosorbent assay were performed in the hippocampus of 12 mice from each group. A total of 60 mice underwent the Morris water maze (MWM) test. Results from the MWM test indicated that the time spent in the northwest quadrant and platform site crossovers by mice in the 2.6 and 1.3% sevoflurane groups was significantly lower than that of the control group. Meanwhile, levels of caspase‑3 and cleaved PARP in the 2.6 and 1.3% sevoflurane groups were significantly higher than that in the control group. Levels of pro‑BDNF and p75NTR were significantly increased and the level of PKB/Akt was significantly decreased following exposure to 2.6% sevoflurane. Finally, the memory of post- natal mice was impaired by sevoflurane, this was determined using a MWM test. Therefore, the results of the current study suggest that caspase‑3 induced cleavage of PARP, as well as pro‑BDNF, p75NTR and PKB/Akt may be important in sevoflurane-induced memory impairment in the postnatal developing mouse brain. Correspondence to: Dr Yujia Wang, Intensive Care Unit, Shanghai Jing'an District Shibei Hospital, 4500 Gonghexin Road, Shanghai 200443, P.R. China E-mail: yujiawangwww@hotmail.com Introduction Sevoflurane is a widely used inhalational anesthetic agent that is commonly used in cesarean sections (1) and in operations on infants and young children (2,3). However, the neurotoxic effect of sevoflurane can damage the developing brain and thereby influence long‑term learning and memory in animals (4‑6). Thus, the use of sevoflurane in cesarean delivery or opera- tion for infants and young children may be detrimental to the brain development of infants and children, and influence the memory and cognitive function during childhood. Currently, sevoflurane-induced memory impairment is a method of evaluating sevoflurane-induced damage in the developing brain (5,6). However, the mechanism of sevoflurane‑induced memory impairment remains unclear. Previous studies have demonstrated that 6 h sevoflu- rane exposure may significantly increase the expression of caspase‑3, which is a marker of neural apoptosis (7), in the hippocampi of postnatal rats (8) and neonatal mice (9). Furthermore, it has been determined that neural apoptosis in the hippocampus is associated with impaired memory and cognitive function (10,11). However, to the best of our knowledge, there have been no studies identifying the role of caspase‑3 in sevoflurane‑induced memory impairment in the developing brain. Poly adenosine diphosphate-ribose polymerase (PARP), a substrate of caspase‑3, is associated with long‑term memory (12‑14). Thus, it was suggested that PARP may be cleaved by overexpressed caspase‑3 in the sevoflurane-treated developing brain. In addition, brain‑derived neurotrophic factor (BDNF), cleaved from a precursor of BDNF (pro‑BDNF) and tyrosine kinase receptor type 2 (Ntrk2, also known as TrkB), both important in the survival and growth of neurons (15,16), are also corre- lated with learning and memory (17). Furthermore, it has been reported that the p75 neurotrophin receptor (p75NTR) has marked effects on hippocampal function: Knockout of p75NTR enhanced spatial memory in adult mice (18). Thus, p75NTR may also be involved in sevoflurane‑induced memory impairment in the developing brain. Furthermore, protein kinase B (PKB/Akt, a serine/threonine kinase) has been found to serve a role in numerous pathways that are associated with memory (19,20). Key words: sevoflurane, memory impairment, postnatal mouse, hippocampus Emergency cesarean sections are performed on pregnant women in their third trimester gestation when required and 4098 LU et al: SEVOFLURANE EXPOSURE IN POSTNATAL MICE sevoflurane is often used as an anesthetic during this proce- dure. However, the use of sevoflurane during a cesarean section may affect brain development and cause memory impairment in postnatal infants. Thus, 7-day-old mice, equivalent to a human third trimester gestation (21), were used in the current study to investigate the effect of sevoflu- rane on the memory of postnatal infants. In the present study, levels of caspase‑3, cleaved PARP, BDNF, Ntrk2, pro‑BDNF, p75NTR and PKB/Akt proteins were investigated in the hippocampi of postnatal mice following 6 h sevoflurane exposure to identify the mechanism of sevoflurane‑induced memory impairment in the developing brain. The memory of these postnatal mice was assessed using a Morris water maze (MWM) test at weeks 4 and 12 following sevoflurane exposure to confirm the effect of sevoflurane on memory impairment in postnatal mice. Sevoflurane exposure. As stated in a previous study (25), animals were placed in a temperature‑controlled (37‑38˚C) transparent anesthetic chamber that was connected to an anes- thetic gas monitor (Datex‑Ohmeda S/5, Datex‑Ohmeda; GE Healthcare Bio‑Sciences, Pittsburgh, PA, USA). For mice in the 1.3 and 2.6% sevoflurane groups, mixed gas (5% sevoflurane and 30% O2) was pre‑aerated at a flow rate of 10 l/min until the concentration of sevoflurane reached 5% in the chamber and prior to placing mice in the chamber. Subsequently, these mice were placed into the chamber immediately. Following main- tenance of 5% sevoflurane for 30 sec, mice were exposed to 1.3 or 2.6% sevoflurane for the indicated time periods (1‑6 h), during which 30% O2 was continually gassed into the chamber at a flow rate of 3 l/min. For mice in the control group, 30% O2 alone was aerated into the chamber for 6 h, with a flow rate of 3 l/min. Materials and methods Animal model. All experiments were performed according to the guidelines of the Guide for the Care and Use of Laboratory Animals (22) and were approved by the Institutional Animal Care and Use Committee of Ruijin Hospital Affiliated to Shanghai Jiaotong University (Shanghai, China). A total of 174 C57BL/6 mice (sex ratio, 1:1), were provided by the Model Animal Research Center of Nanjing University (Nanjing, China). They were housed in polypropylene cages (5 or 6 animals per cage) and kept at a 12 h light‑dark cycle at room temperature (21‑24˚C) in 55% humidity for 7 days prior to testing. All animals had free access to food and water. Experimental protocols. There were two experimental protocols used based on the sevoflurane concentration used in previous studies (23,24) and 1.3 and 2.6% sevoflurane was used in the present study. For protocol one, 36 mice were randomly assigned into 3 groups with 12 mice in each group: The 2.6 and 1.3% sevoflurane groups and the control group (exposed to 30% O2). Following exposure to sevoflurane or O2 for 6 h, the mice from all 3 groups were sacrificed by intraperitoneal injection of 1.5% pentobarbital sodium (375 mg/kg) (Dalian Idery Biotechnology Co., Ltd., Dalian, China). Hippocampal tissue samples from these mice were collected to measure the expression of caspase‑3 using immunohistochemistry, the cleavage of PARP by western blotting, and levels of BDNF, Ntrk2, pro‑BDNF, p75NTR and PKB/Akt by ELISA. To evaluate whether hypoxia and respi- ratory depression occurred in mice during anesthesia, blood gas analysis was performed in another 78 mice, which were randomly assigned into 3 groups: 2.6% sevoflurane (n=36), 1.3% sevoflurane (n=36) and control (n=6) groups. The mice in the 1.3 and 2.6% sevoflurane groups were divided into subgroups based on the length of time they were exposed to sevoflurane (1, 2, 3, 4, 5 and 6 h), with 6 mice in each subgroup. For protocol two, a total of 60 mice were randomly assigned into 3 groups with 20 mice in each group: 2.6, 1.3% sevoflu- rane and control groups. Following exposure to sevoflurane for 4 weeks, the MWM test was performed in half of the mice in each group. The MWM test was conducted on the remaining mice at week 12. Blood gas analysis. The mice were anesthetized by intraperi- toneal injection of 1.5% sodium pentobarbital (50 mg/kg). Then blood samples (0.2 ml) were obtained from the left ventricle by cardiac puncture, after which the mice were sacrificed by intraperitoneal injection of 1.5% sodium pentobarbital (375 mg/kg). The partial pressure of oxygen (PaO2), partial pressure of carbon dioxide (PaCO2) and arte- rial oxygen saturation (SaO2) were detected using a portable blood gas analyzer (OPTI Medical Systems Inc., Roswell, GA, USA). Tissue sample collection. Following sevoflurane exposure, all the mice were sacrificed by intraperitoneal injection of 1.5% pentobarbital sodium (375 mg/kg). The brain was then rapidly removed and the complete hippocampus was dissected. Hippocampal tissue samples were stored at ‑80˚C prior to use in laboratory experiments. Immunohistochemistry. The hippocampal tissues were fixed overnight in 4% paraformaldehyde at 4˚C. The hippo- campal slices (5‑µm‑thick) were subsequently prepared using a vibrating tissue slicer (Campden Instruments, Ltd., Loughborough, UK). Immunohistochemical staining was performed as previously described (26,27). Briefly, slices were incubated with hydrogen peroxide in methanol to block endogenous peroxidase activity and 10% normal goat serum (cat. no. C0265; Beyotime Institute of Biotechnology, Haimen, China) to reduce non‑specific antibody binding prior to immunohistochemical staining. Slices were then incubated with a rabbit anti‑caspase‑3 antibody (1:200; cat. no. AC033; Beyotime Institute of Biotechnology) at 4˚C for 12 h, followed by three washes with PBS. Subsequently, these slices were incubated with secondary antibody (1:4,000; cat. no. A0562; biotinylated goat anti-rabbit antibody; Beyotime Institute of Biotechnology) for 30 min at 37˚C. Following washing with PBS, immunoreactivity was visualized using the streptav- idin‑peroxidase complex and 3,3'‑diaminobenzidine (both from Beyotime Institute of Biotechnology). A DM5000B light microscope (Leica Microsystems GmBH, Wetzlar, Germany) was used to observe and collect images. The image analysis software Image Pro Plus version 4.0 (Media Cybernetics, Inc., Rockville, MD, USA) was used to count the number of caspase‑3 positive cells. EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 4097-4104, 2018 Western blotting. The preparation of hippocampus protein extraction was performed as previously described (28,29). Total proteins were extracted with radioimmunoprecipitation assay buffer [1% Triton X‑100, 50 mM Tris, (pH 7.4), 150 mM NaCl, M, 0.1% sodium dodecyl sulfate (SDS), 1 mM EDTA and 1% sodium deoxycholate]. Following 13,000 x g centrifu- gation at 4˚C for 20 min, the supernatant was used for western blotting (30,31). The BCA method was used to assay protein concentrations. In brief, hippocampal tissue proteins were separated by 10% SDS polyacrylamide gel electrophoresis and then electrotransferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat powdered milk for 1 h at 25˚C. The proteins were probed with rabbit anti‑PARP antibodies (1:200, cat. no. AP102) or rat anti‑GAPDH anti- bodies (1:5,000, cat. no. AG019) overnight at 4˚C. Then, goat anti‑rabbit (1:4,000; cat. no. A0208) or goat anti‑rat (1:4,000; cat. no. A0192) horseradish peroxidase‑conjugated secondary antibodies were used for 2 h incubation at room temperature (all from Beyotime Institute of Biotechnology). Proteins were visualized by an enhanced chemiluminescence method and analyzed with the Dolphin‑Doc Plus Gel Documentation system (version 1141002; Wealtec Corp., Sparks, NV, USA). This procedure was repeated twice for all 3 groups. The rela- tive level of PARP was presented as the band intensity and normalized to the corresponding band intensities of GAPDH. end was recorded as the time of escape latency. The swim rate during training was also recorded. On day 7, the probe test was performed by allowing the mice to swim for 60 sec in the absence of the platform. During 60 sec swimming, the time spent in the northwest quadrant and platform site crossovers was recorded and analyzed using the MWM JLBehv‑FCS video analysis system (DigBehv‑MG; Shanghai Jiliang Software Technology Co., Ltd., Shanghai, China). Statistical analysis. All data are presented as the mean ± stan- dard error of the mean. A repeated measures analysis of variance (ANOVA) was used to measure the differences within groups over time. Meanwhile, one-way ANOVA was applied for comparison among groups (2.6, 1.3% sevoflurane and control groups), followed by Student Newman‑Keuls post hoc test. The correlation between the swim rate and time of escape latency was identified using the Pearson Correlation coefficient. For all the analysis, P<0.05 was used to indicate a statistically significant difference. Additionally, SPSS 11.5 (SPSS, Inc., Chicago, IL, USA) was used for the analysis of the present study. Results ELISA. The method of hippocampus protein extraction mentioned above was also used for ELISA. The levels of BDNF, Ntrk2, pro‑BDNF, p75NTR and PKB/Akt were measured using an ELISA kit (cat. no. EK0312; Wuhan Boster Bio‑Engineering Co., Ltd., Wuhan, China) according to the manufacturer's instructions. Briefly, protein samples were added to the enzyme label plate and incubated for 1.5 h at 37˚C. Next, the biotin‑labeled antibodies were added for 1 h incubation at 37˚C. Following washing, 30 min incubation with avidin peroxidase complex was conducted at 37˚C. Color was developed using 3,3',5,5'‑tetramethylbenzidine following 20 min incubation at 37˚C. Following reaction termination with a ‘stop’ solution, the products were measured at 450 nm using a microplate spectrophotometer (Spectramax 190; Molecular Devices LLC, Sunnyvale, CA, USA). All samples were assayed in duplicate and the readings were normalized to the amount of standard protein. Behavioral studies. Prior to the MWM test, mice received 2 min of touch for 5 days to avoid the fear to touch during the test. The MWM test was performed as previously described (32,33), with minor modifications. The round pool (diameter, 122 cm) was filled with warm water, made opaque by the addition of titanium dioxide and an escape platform was placed in the northwest quadrant and hidden 0.5 cm below the surface of the water. The MWM test was performed on 7 consecutive days (6 days for training and 1 day for the probe test). Briefly, mice received 4 training sessions daily for 6 consecutive days. Each trial began from a different point and ended when the mice found the platform. The time from beginning to end was considered to be the time of escape latency. If mice could not find the platform within 90 sec, the time of escape latency was recorded as 90 sec. If mice found the platform within 90 sec, the real time from beginning to Results of blood gas analysis. The PaO2, PaCO2 and SaO2 values remained stable in the 2.6 and 1.3% sevoflurane and control groups following treatment. There were no significant differences identified among groups and the PaO2, PaCO2 and SaO2 values did not notably change with increasing time periods of sevoflurane exposure (Table I). Sevoflurane increases caspase‑3 expression. Significantly more caspase‑3 positive cells were found in the 2.6 and 1.3% sevoflurane groups compared with the control group (P<0.05). Meanwhile, the number of positive cells in the 2.6% sevo- flurane group was significantly higher than that of the 1.3% sevoflurane group (P<0.05; Fig. 1). Sevoflurane promotes the cleavage of PARP. Relative levels of cleaved PARP in the 2.6% (1.552±0.178) and 1.3% (1.376±0.157) sevoflurane groups were significantly increased following sevoflurane exposure compared with the control group (0.729±0.106; P<0.001). However, there was no signifi- cant difference in the level of cleaved PARP (P>0.05) detected in the 2.6 and 1.3% sevoflurane groups (P>0.05; Fig. 2). Effect of sevoflurane on BDNF, Pro‑BDNF, TrkB, Akt/PKB and p75NTR. According to ELISA, 2.6% sevoflurane signifi- cantly increased the expression of Pro‑BDNF compared with the control group (2.6% sevoflurane group, 3,146.32±47.96 vs. control group, 2,817.17±47.96; P<0.05). Furthermore, the level of Akt/PKB was significantly decreased following 6 h exposure to 2.6% sevoflurane, compared with the control group (2.6% sevoflurane group, 1,263.50±27.08 vs. control group, 1,557.35±59.87; P<0.05). In addition, levels of p75NTR in the 2.6% (119.40±2.58) and 1.3% (119.04±1.45) sevoflurane groups were significantly higher than those in the control group (108.34±3.77; P<0.05). However, there were no signifi- cant differences in the levels of BDNF and TrkB (P>0.05) among groups (Table II). 4099 4100 LU et al: SEVOFLURANE EXPOSURE IN POSTNATAL MICE Table I. Results of blood gas analysis during sevoflurane exposure. Time and concentration of sevoflurane exposure PaO2 (mmHg) PaCO2 (mmHg) SaO2 Before exposure (control group) 1 h of 2.6% 2 h of 2.6% 3 h of 2.6% 4 h of 2.6% 5 h of 2.6% 6 h of 2.6% 1 h of 1.3% 2 h of 1.3% 3 h of 1.3% 4 h of 1.3% 5 h of 1.3% 6 h of 1.3% 105±2 103±2 98±4 100±2 99±2 103±3 100±2 103±2 99±1 99±2 102±3 100±3 99±2 21.8±0.8 23.6±0.7 23.0±0.9 23.6±1.2 22.5±0.9 22.0±0.9 23.0±1.0 23.9±0.7 23.3±0.9 24.1±1.5 23.6±0.9 23.6±0.9 23.0±1.1 99.0±0.3 98.3±0.4 97.4±0.6 98.0±0.5 97.4±0.9 98.2±0.4 99.0±0.5 98.1±0.4 97.2±0.6 97.9±0.5 98.6±0.5 97.6±0.4 98.1±0.5 A repeated measures ANOVA was used to assess the differences of data at different time points. The one-way ANOVA method was applied for comparison among groups. No significant differences were observed among the data at different time points and among the three groups. Data are presented as the mean ± standard error of the mean. n=6. PaO2, partial pressure of oxygen; PaCO2, partial pressure of carbon dioxide; SaO2, arterial oxygen saturation. ANOVA, analysis of variance. Figure 1. Expression of caspase‑3 in hippocampus cells. (A‑F) Images of immunohistochemical staining. (A and B) Control; (C and D) 1.3% sevoflurane and (E and F) 2.6% sevoflurane groups. A, C and E, magnification, x4, scale bar, 50 µm; B, D and F: magnification, x20, scale bar, 100 µm. The boxes in A, C and E indicate the area of caspase‑3 positive cells, and parts B, D and F are these boxes at a higher magnification. The arrows in B, D and F indicate caspase‑3 positive cells. (G) The numbers of caspase‑3 positive cells in the hippocampal CA1 region in each group; *P<0.05, compared with the control group; #P<0.05, compared with the 1.3% sevoflurane group. Effect of sevoflurane on mouse memory. As presented in Table III, the time of escape latency significantly decreased as duration time increased in each group during 6 days training at weeks 4 and 12 following sevoflurane exposure (P<0.05). Moreover, the time of escape latency on days 4, 5 and 6 in the 2.6 and 1.3% sevoflurane groups were all significantly higher than that of the control group 4 weeks following sevoflurane exposure (P<0.05). Meanwhile, no significant difference in time of escape latency on days 1, 2 and 3 was observed between the 2.6 and 1.3% sevoflurane groups 4 weeks following sevo- flurane exposure. However, only the time of escape latency on day 6 of training in the 2.6% sevoflurane group was signifi- cantly higher than that of the control group 12 weeks following sevoflurane exposure (P<0.05). Furthermore, no significant difference among groups was revealed in the other times of escape latency (P>0.05) and there was no significant correla- tion between the time of escape latency and swim rate (r>0; P>0.05) observed in the present study. EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 4097-4104, 2018 4101 Table II. Levels of BDNF, Pro‑BDNF, TrkB, Akt/PKB and p75NTR in the hippocampal tissues in each group. Group BDNF (pg/ml) Pro‑BDNF (pg/ml) TrkB (pg/ml) Akt/PKB (pg/ml) p75NTR (pg/ml) 2.6% sevoflurane 1.3% sevoflurane Control P-valueb 1,198.69±31.12 1,188.00±18.02 1,129.50±34.15 0.128 3,146.32±47.96a 2,938.97±113.63 2,817.17±47.96 0.039 711.39±20.37 759.39±13.78 717.60±18.89 0.139 1,263.50±27.08a 1,459.45±23.00 1,557.35±59.87 <0.001 119.40±2.58a 119.04±1.45a 108.34±3.77 0.013 aP<0.05 vs. the control using Student Newman‑Keuls post hoc test. bP‑value was calculated from 2.6%, 1.3% sevoflurane and control groups by the one‑way analysis of variance method. Data are presented as the mean ± standard error of the mean. n=12. BDNF, brain‑derived neuro- trophic factor; TrkB, tyrosine kinase receptor type 2; Akt/PKB, protein kinase B; pro‑BDNF, a precursor of BDNF; p75NTR, p75 neurotrophin receptor; PKB/Akt, protein kinase B. Discussion In the present study, the results of the MWM test determined that the memory of mice in the 2.6 and 1.3% sevoflurane groups were significantly weakened compared with that in the control group. These results provide evidence for sevoflurane‑induced memory impairment in the developing brain of postnatal mice, suggesting that the use of sevoflurane during cesarean section may damage the brain development of postnatal infants. However, the time spent in the northwest quadrant and platform site crossovers was not significantly decreased by 2.6% sevoflurane exposure compared with that in the 1.3% sevoflurane group, apart from the platform site crossovers at the 12th week after sevoflurane exposure. Thus, there may not be a dose‑dependent effect in sevoflurane‑induced memory impairment for postnatal mice. Figure 2. Levels of cleaved PARP in the hippocampus tissue in each group. (A) Images of western blotting; (B) Relative levels of cleaved PARP in each group. *P<0.05, compared with the control group. PARP, poly adenosine diphosphate-ribose polymerase. The results of the probe test revealed that the time spent in the northwest quadrant (week 4: 2.6% sevoflurane group, 0.04±0.03 sec; 1.3% sevoflurane group, 0.19±0.09 sec; control group, 0.88±0.21 sec; and week 12: 2.6% sevoflurane group, 0.23±0.11 sec; 1.3% sevoflurane group, 1.00±0.27 sec and control group, 15.32±3.62 sec) and number of platform site crossovers (week 4: 2.6% sevoflurane group, 0.25±0.16; 1.3% sevoflurane group, 0.63±0.32; control group, 2.38±0.65; and week 12: 2.6% sevoflurane group, 0.67±0.33; 1.3% sevo- flurane group, 2.63±0.71; control group, 4.67±1.18) in the 2.6 and 1.3% sevoflurane groups were significantly lower compared with the control group (P<0.05) at weeks 4 and 12 after sevoflurane exposure. Moreover, platform site cross- overs were significantly decreased following 6 h exposure to 2.6% sevoflurane compared with the 1.3% sevoflurane group 12 weeks after sevoflurane exposure (P<0.05; Table IV). Consistent with previous studies (8,9), caspase‑3 expression was significantly increased by sevoflurane in the present study. Furthermore, the results of the present study provided evidence for an association between caspase‑3 and sevoflurane‑induced memory impairment in postnatal mice. Meanwhile, levels of cleaved PARP in the 2.6 and 1.3% sevoflurane groups were significantly higher than that in the control group. It has been reported that the spatial memory of rats with twice-repeated cerebral ischemia could be significantly improved by decreasing levels of PARP and caspase‑3 (34). Furthermore, increased expression of caspase‑3 and cleavage of PARP are associated with neuronal apoptosis in hippocampal tissue (35,36), which is a major mechanism of memory impairment. Therefore, this evidence indicates that caspase‑3 induced cleavage of PARP may result in neuronal apoptosis in the hippocampus and lead to memory impairment in postnatal mice. The expression of Akt/PKB and pro‑BDNF in the hippocampal tissue was also significantly altered by 2.6% sevoflurane. It was reported that the cleavage of pro‑BDNF is important in the formation of memories (37). The present study indicated that cleavage of pro‑BDNF may be repressed by sevoflurane, leading to accumulation of pro‑BDNF in the hippocampal tissue. Overall, pro‑BDNF is cleaved and changed into BDNF, which is mediated by the activation of phosphatidylinositol 3‑kinase (PI3K), in BDNF‑dependent spatial memory formation (38). PI3K can then phosphorylate Akt/PKB. Inhibition of Akt phosphorylation exacerbates memory deficits in a rat model of Alzheimer's disease (39). 4102 LU et al: SEVOFLURANE EXPOSURE IN POSTNATAL MICE Table III. Results of 6 days training in Morris water maze test. A, Changes of time of escape latency at 4th week (sec) Day 2.6% sevoflurane group 1.3% sevoflurane group Control group P‑valuec 1 2 3 4 5 6 P-valued 84.56±3.02 85.66±2.70 81.96±6.13 76.48±4.85a 85.50±2.52a,b 69.17±5.56a,b 0.009 73.94±4.98 74.98±4.85 71.88±6.45 65.99±5.34a 67.22±4.89a 63.27±6.14a <0.001 82.58±4.15 78.61±4.03 70.99±5.96 50.19±5.72 45.55±4.87 35.97±4.49 <0.001 0.396 0.269 0.233 0.003 <0.001 <0.001 B, Changes of time of escape latency at 12th week (sec) Day 2.6% sevoflurane group 1.3% sevoflurane group Control group P‑valuec 1 2 3 4 5 6 P-valued 81.68±3.58 71.96±4.98 54.40±5.19 55.23±5.48 53.23±5.84 52.42±5.46a,b <0.001 77.27±4.88 71.36±5.63 53.39±4.92 44.25±5.53 36.68±4.49 27.34±4.14 <0.001 72.61±5.29 69.71±6.12 67.75±5.16 60.81±5.59 42.09±5.42 32.73±5.12 <0.001 0.265 0.532 0.351 0.123 0.075 0.001 aP<0.05 vs. the control using Student Newman‑Keuls post hoc test, bP<0.05 vs. the 1.3% sevoflurane group using Student Newman‑Keuls post hoc test. cP‑value was calculated from 2.6%, 1.3% sevoflurane and control groups by the one‑way analysis of variance method. dP-value was calculated from time of escape latency (days 1, 2, 3, 4, 5, 6) by a repeated measures analysis of variance. Data are presented as the mean ± standard error of the mean. n=10. Table IV. Time spent in the northwest quadrant and platform site crossovers in each group. A, Results of the 4th week Results of probe test 2.6% sevoflurane group 1.3% sevoflurane group Control group P‑valuec Time spent in the northwest quadrant (sec) Platform site crossovers (times) 0.04±0.03a 0.25±0.16a 0.19±0.09a 0.63±0.32a 0.88±0.21 2.38±0.65 0.001 0.003 B, Results of the 12th week Results of probe test 2.6% sevoflurane group 1.3% sevoflurane group Control group P‑valuec Time spent in the northwest quadrant (sec) Platform site crossovers (times) 0.23±0.11a 0.67±0.33a,b 1.00±0.27a 2.63±0.71a 15.32±3.62 4.67±1.18 <0.001 0.006 aP<0.05 vs. the control using a Student Newman‑Keuls post hoc test. bP<0.05 vs. the 1.3% sevoflurane group using Student Newman‑Keuls post hoc test. cP‑value was calculated from 2.6%, 1.3% sevoflurane and control groups by the one‑way analysis of variance method. Results are presented as the mean ± standard error of the mean. n=10. Thus, activation of PI3K may be inhibited by sevoflurane and thereby decrease levels of phosphorylated Akt, as well as inhibit cleavage of pro‑BDNF. Akt phosphorylation and activation of PI3K was not assessed in the present study, which is a limitation. However, it was speculated that the decrease in Akt levels observed in the present study was caused by the EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 4097-4104, 2018 feedback inhibition of phosphorylated Akt. Further studies are required to consider the phosphorylation of Akt and the activa- tion of PI3K in this potential mechanism. In addition, the results also demonstrated that p75NTR was upregulated following sevoflurane exposure in postnatal mice. It has been reported that the pro-form of nerve growth factor (proNGF)‑induced neuronal apoptosis is dependent on p75NTR in Alzheimer's disease (40). The balance of TrkA/p75NTR signaling is associated with (‑)‑epigallocatechin‑3‑gallate ameliorated learning and memory deficits in APP/PS1 trans- genic mice (41). Furthermore, the balance of TrkA/p75NTR may be regulated by proNGF in the hippocampus (42). Thus, the balance of TrkA/p75NTR in the present study may be broken by sevoflurane, thereby impairing the ability of post- natal mice to form memories. ProNGF may serve a role in the sevoflurane‑induced increase of p75NTR, promoting neuronal apoptosis and memory impairment. However, the effect of sevoflurane expression on TrkA and proNGF in postnatal mice is unknown. Further studies are required to investigate this effect systematically. 4. Liu F, Rainosek SW, Frisch‑Daiello JL, Patterson TA, Paule MG, Slikker W Jr, Wang C and Han X: Potential adverse effects of prolonged sevoflurane exposure on developing monkey brain: From abnormal lipid metabolism to neuronal damage. Toxicol Sci 147: 562-572, 2015. 5. Tagawa T, Sakuraba S, Kimura K and Mizoguchi A: Sevoflurane in combination with propofol, not thiopental, induces a more robust neuroapoptosis than sevoflurane alone in the neonatal mouse brain. J Anesth 28: 815-820, 2014. 6. Zheng S, Chen X, Wang Y and An L: Effects of sevoflurane on brain neuroapoptosis and ability of long-term learning and memory in newborn rats. Beijing Da Xue Xue Bao 47: 674-678, 2015 (In Chinese). 7. Baydas G, Reiter R, Akbulut M, Tuzcu M and Tamer S: Melatonin inhibits neural apoptosis induced by homocysteine in hippo- campus of rats via inhibition of cytochrome c translocation and caspase‑3 activation and by regulating pro‑and anti‑apoptotic protein levels. Neuroscience 135: 879‑886, 2005. 8. Zhou X, Song FH, He W, Yang XY, Zhou ZB, Feng X and Zhou LH: Neonatal exposure to sevoflurane causes apoptosis and reduces nNOS protein expression in rat hippocampus. Mol Med Rep 6: 543‑546, 2012. 9. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, McAuliffe JJ, Danzer SC and Loepke AW: Comparison of the neuroapoptotic properties of equipotent anesthetic concentra- tions of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114: 578-587, 2011. Additionally, it has been demonstrated that cleavage of pro‑BDNF is essential for long‑term hippocampal plasticity (38). Thus, the inhibition of pro‑BDNF cleavage in mice exposed to sevoflurane may affect hippocampal plasticity in postnatal mice. Meanwhile, the increased expression of caspase‑3 may induce neuronal apoptosis in the hippocampal tissue of postnatal mice in the present study. Thus, sevoflurane may discourage the plas- ticity of the hippocampus and promote neuronal apoptosis in a developing brain by inhibiting the cleavage of pro‑BDNF and upregulating caspase‑3 in postnatal mice. In the present study, hypoxia and respiratory depression were also evaluated in postnatal mice during sevoflurane exposure. The results identified that there were no significant differences among groups. However, in a previous study by Schlünzen et al (43), the mean PaCO2 and total CBF decreased, which may be induced by sevoflurane anesthesia and may cause hyperventilation. A limitation of the present study was the inability to confirm whether the sevoflurane anesthesia lead to hyperventilation. Further studies are required to inves- tigate the hyperventilation caused by sevoflurane anesthesia. In conclusion, the present study demonstrated that sevo- flurane‑induced memory impairment may be associated with neuronal apoptosis by inhibiting the cleavage of pro‑BDNF, as well as increasing caspase‑3 and p75NTR levels in the postnatal developing mouse brain. Acknowledgements The present study was supported by the Natural Science Foundation of Shanghai (grant no. 11ZR1423200) References 10. Albasser MM, Amin E, Lin TC, Iordanova MD and Aggleton JP: Evidence that the rat hippocampus has contrasting roles in object recognition memory and object recency memory. Behav Neurosci 126: 659-669, 2012. 11. Chambers RA, Potenza MN, Hoffman RE and Miranker W: Simulated apoptosis/neurogenesis regulates lea r ning and memory capabilities of adaptive neural networks. Neuropsychopharmacology 29: 747-758, 2004. 12. Sung YJ and Ambron RT: PolyADP -ribose polymerase-1 (PARP‑1) and the evolution of learning and memory. Bioessays 26: 1268-1271, 2004. 13. Cohen‑Armon M, Visochek L, Katzoff A, Levitan D, Susswein AJ, Klein R, Valbrun M and Schwartz JH: Long‑term memor y requires polyADP‑ribosylation. Science 304: 1820-1822, 2004. 14. Goldberg S, Visochek L, Giladi E, Gozes I and Cohen‑Armon M: PolyADP-ribosylation is required for long-term memory formation in mammals. J Neurochem 111: 72-79, 2009. 15. Zhou B, Cai Q, Xie Y and Sheng ZH: Snapin recruits dynein to BDNF‑TrkB signaling endosomes for retrograde axonal trans- port and is essential for dendrite growth of cortical neurons. Cell Rep 2: 42-51, 2012. 16. Stansfield KH, Pilsner JR, Lu Q, Wright RO and Guilarte TR: Dysregulation of BDNF‑TrkB signaling in developing hippo- campal neurons by Pb(2+): Implications for an environmental basis of neurodevelopmental disorders. Toxicol Sci 127: 277-295, 2012. 17. Lai H, Zhao H, Zeng L and Lv Y: BDNF and TrkB mRNA expression in aged hippocampus neurons and their relationship with learning and memory. Prog Anatomical Sci 10: 353‑356, 2004 (In Chinese). 18. Barrett GL, Reid CA, Tsafoulis C, Zhu W, Williams DA, Paolini AG, Trieu J and Murphy M: Enhanced spatial memory and hippocampal long-term potentiation in p75 neurotrophin receptor knockout mice. Hippocampus 20: 145-152, 2010. 19. Yao D, He X, Wang J and Zhao Z: Effects of PI3K/Akt signaling pathway on learning and memory abilities in neonatal rats with hypoxic‑ischemic brain damage. Zhongguo Dang Dai Er Ke Za Zhi 13: 424‑427, 2011 (In Chinese). 20. Zhang JF, Zhou W and Wang T: Effects of propofol on studying and memory dysfunction and cortex trkb/akt pathway in focal cerebral ischemia/reperfusion injury of rats. Herald Med 2: 008, 2012 (In Chinese). 1. Erden V, Erkalp K, Yangin Z, Delatioglu H, Kiroglu S, Ortaküz S and Ozdemir B: The effect of labor on sevoflurane requirements during cesarean delivery. Int J Obstet Anesth 20: 17-21, 2011. 2. Vora KS, Shah VR, Patel D, Modi MP and Parikh GP: Sevoflurane versus propofol in the induction and maintenance of anaesthesia in children with laryngeal mask airway. Sri Lanka J Child Health 43: 77‑83, 2014. 21. Sadrian B, Subbanna S, Wilson DA, Basavarajappa B and Saito M: Lithium prevents long-term neural and behavioral pathology induced by early alcohol exposure. Neuroscience 206: 122‑135, 2012. 22. National Research Council: Guide for the Care and Use of Laboratory Animals. National Academies Press, Washington, DC, pp1072‑1073, 2011. 3. Lerman J, Sikich N, Kleinman S and Yentis S: The pharma- cology of sevoflurane in infants and children. Anesthesiology 80: 814-824, 1994. 23. Wiklund A, Granon S, Faure P, Sundman E, Changeux JP and Eriksson LI: Object memory in young and aged mice after sevo- flurane anaesthesia. Neuroreport 20: 1419‑1423, 2009. 4103 4104 LU et al: SEVOFLURANE EXPOSURE IN POSTNATAL MICE 24. Yue T, Shanbin G, Ling M, Yuan W, Ying X and Ping Z: Sevoflurane aggregates cognitive dysfunction and hippocampal oxidative stress induced by β‑amyloid in rats. Life Sci 143: 194-201, 2015. 25. Zhang F, Feng X, Zeng Q, Wang B, Wilhelmsen K, Li Q, Cao X and Yu B: Sevoflurane induced amnesia inhibits hippocampal Arc expression partially through 5-hydroxytryptamine-7 recep- tors in the bilateral basolateral amygdala in rats. Neurosci Lett 562: 13‑18, 2014. 26. Zhong T, Guo Q, Zou W, Zhu X, Song Z, Sun B, He X and Yang Y: Neonatal isoflurane exposure induces neurocognitive impairment and abnormal hippocampal histone acetylation in mice. Plos One 10: e0125815, 2015. 27. Musumeci G, Castrogiovanni P, Loreto C, Castorina S, Pichler K and Weinberg AM: Post‑traumatic caspase‑3 expression in the adjacent areas of growth plate injury site: A morphological study. Int J Mol Sci 14: 15767‑15784, 2013. 28. Ge HW, Hu WW, Ma LL and Kong FJ: Endoplasmic reticulum stress pathway mediates isoflurane‑induced neuroapoptosis and cognitive impairments in aged rats. Physiol Behav 151: 16‑23, 2015. 29. Lin D and Zuo Z: Isoflurane induces hippocampal cell injury and cognitive impairments in adult rats. Neuropharmacology 61: 1354‑1359, 2011. 30. Cao J, Wang Z, Mi W and Zuo Z: Isoflurane unveils a critical role of glutamate transporter type 3 in regulating hippocampal GluR1 trafficking and context‑related learning and memory in mice. Neuroscience 272: 58-64, 2014. 31. Li XM, Su F, Ji MH, Zhang GF, Qiu LL, Jia M, Gao J, Xie Z and Yang JJ: Disruption of hippocampal neuregulin 1-ErbB4 signaling contributes to the hippocampus-dependent cognitive impairment induced by isoflurane in aged mice. Anesthesiology 121: 79‑88, 2014. 35. Comim CM, Barichello T, Grandgirard D, Dal‑Pizzol F, Quevedo J and Leib SL: Caspase‑3 mediates in part hippocampal apoptosis in sepsis. Mol Neurobiol 47: 394‑398, 2013. 36. Gerace E, Masi A, Resta F, Felici R, Landucci E, Mello T, Pellegrini‑Giampietro DE, Mannaioni G and Moroni F: PARP‑1 activation causes neuronal death in the hippocampal CA1 region by increasing the expression of Ca(2+)‑permeable AMPA recep- tors. Neurobiol Dis 70: 43‑52, 2014. 37. Barnes P and Thomas KL: Proteolysis of proBDNF is a key regulator in the formation of memory. PLoS One 3: e3248, 2008. 38. Mizuno M, Yamada K, Takei N, Tran MH, He J, Nakajima A, Nawa H and Nabeshima T: Phosphatidylinositol 3‑kinase: A molecule mediating BDNF‑dependent spatial memory forma- tion. Mol Psychiatry 8: 217‑224, 2003. 39. Shaerzadeh F, Motamedi F and Khodagholi F: Inhibition of akt phosphorylation diminishes mitochondrial biogenesis regulators, tricarboxylic acid cycle activity and exacerbates recognition memory deficit in rat model of Alzheimer's disease. Cell Mol Neurobiol 34: 1223‑1233, 2014. 40. Pedraza CE, Podlesniy P, Vidal N, Arévalo JC, Lee R, Hempstead B, Ferrer I, Iglesias M and Espinet C: Pro‑NGF isolated from the human brain affected by Alzheimer's disease induces neuronal apoptosis mediated by p75NTR. Am J Pathol 166: 533‑543, 2005. 41. Liu M, Chen F, Sha L, Wang S, Tao L, Yao L, He M, Yao Z, Liu H, Zhu Z, et al: (‑)‑Epigallocatechin‑3‑gallate ameliorates learning and memory deficits by adjusting the balance of TrkA/p75NTR signaling in APP/PS1 transgenic mice. Mol Neurobiol 49: 1350‑1363, 2014. 42. Fortress AM, Buhusi M, Helke KL and Granholm AC: Cholinergic degeneration and alterations in the TrkA and p75NTR balance as a result of pro‑NGF injection into aged rats. J Aging Res 2011: 460543, 2011. 32. Cao Y, Ni C, Li Z, Li L, Liu Y, Wang C, Zhong Y, Cui D and Guo X: Isoflurane anesthesia results in reversible ultrastructure and occludin tight junction protein expression changes in hippocampal blood-brain barrier in aged rats. Neurosci Lett 587: 51-56, 2015. 33. Li Z, Cao Y, Li L, Liang Y, Tian X, Mo N, Liu Y, Li M, Chui D and Guo X: Prophylactic angiotensin type 1 receptor antagonism confers neuroprotection in an aged rat model of postoperative cognitive dysfunction. Biochem Biophys Res Commun 449: 74-80, 2014. 43. Schlünzen L, Vafaee M, Juul N and Cold G: Regional cerebral blood flow responses to hyperventilation during sevoflurane anaesthesia studied with PET. Acta Anaesthesiol Scand 54: 610-615, 2010. This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) License. 34. Hatip‑Al‑Khatib I, Iwasaki K, Chung EH, Egashira N, Mishima K and Fujiwara M: Inhibition of poly (ADP‑ribose) polymerase and caspase‑3, but not caspase‑1, prevents apoptosis and improves spatial memory of rats with twice-repeated cerebral ischemia. Life Sci 75: 1967-1978, 2004.",mice,"['C57BL/6 mice 7 days old were randomly assigned into a 2.6% sevoflurane (n=68), a 1.3% sevoflurane (n=68) and a control (n=38) group.']",postnatal day 7,"['C57BL/6 mice 7 days old were randomly assigned into a 2.6% sevoflurane (n=68), a 1.3% sevoflurane (n=68) and a control (n=38) group.']",Y,['A total of 60 mice underwent the Morris water maze (MWM) test.'],sevoflurane,"['C57BL/6 mice 7 days old were randomly assigned into a 2.6% sevoflurane (n=68), a 1.3% sevoflurane (n=68) and a control (n=38) group.']",none,[],c57bl/6,"['C57BL/6 mice 7 days old were randomly assigned into a 2.6% sevoflurane (n=68), a 1.3% sevoflurane (n=68) and a control (n=38) group.']",The study aimed to confirm sevoflurane-induced memory impairment in the postnatal developing mouse brain and determine its mechanism of action.,['The aim of the present study was to confirm that sevoflurane induces memory impairment in the postnatal developing mouse brain and determine its mechanism of action.'],None,[],"The study suggests that caspase-3 induced cleavage of PARP, as well as pro-BDNF, p75NTR, and PKB/Akt may be important in sevoflurane-induced memory impairment in the postnatal developing mouse brain.","['Therefore, the results of the current study suggest that caspase-3 induced cleavage of PARP, as well as pro-BDNF, p75NTR and PKB/Akt may be important in sevoflurane-induced memory impairment in the postnatal developing mouse brain.']",None,[],None,[],True,True,True,True,False,True,10.3892/etm.2018.5950 10.4149/BLL_2017_017,282.0,Ozer,2017,rats,postnatal day 7,N,sevoflurane,none,wistar-albino,"DOI: 10.4149/BLL_2017_017 Bratisl Med J 2017; 118 (2) 80 – 84 EXPERIMENTAL STUDY Effects of sevofl urane on apoptosis, BDNF and cognitive functions in neonatal rats Ozer AB1, Ceribasi S2, Ceribasi AO2, Demirel I1, Bayar MK3, Ustundag B4, Ileri A1, Erhan OL1 Department of Anesthesiology and Reanimation, Firat University, Faculty of Medicine, Elazig, Turkey. abelinozer@gmail.com ABSTRACT OBJECTIVE: To evaluate the early and late effects of sevofl urane on the neonatal brain. BACKGROUND: Sevofl urane is the most used anaesthetics in neonatal subjects. METHODS: The study included 7-day-old male Wistar-Albino rats (n = 30), which were divided into the two groups according to the anaesthetic received: sevofl urane (S) and control group (C). Half of each group was sacrifi ced six hours after anaesthesia (early, E) while the remaining subjects were sacrifi ced six weeks later (late, L). The serum brain-derived-neurotrophic factor (BDNF), brain BDNF and caspase-3 were evaluated. In addition, elevated plus arm test and Morris water test were performed in the late group. RESULTS: BDNF levels were higher in the late groups than in the early ones (p < 0.05). BDNF levels in cere- bral cortex were higher in the Group CE than in the Group CL and SL (p < 0.05). There was a signifi cant nega- tive correlation between serum BDNF and cortex BDNF levels (p = 0.003, r = –0.425). Cortex caspase 3 levels were signifi cantly higher in the Groups SE and SL than in the Group CE and CL (p < 0.05). There was no sig- nifi cant difference between the groups in the terms of open arm index, locomotor activity and Morris water test. CONCLUSIONS: Although sevofl urane induced apoptosis, it didn’t affect BDNF levels and showed no long- term negative effects on learning and anxiety in neonatal rats (Tab. 1, Fig. 3, Ref. 26). Text in PDF www.elis.sk. KEY WORDS: anesthesia, neonatal, apoptosis, BDNF. Introduction neurotransmission, while in mature brains it occurs by a decrease in GABAergic neurotransmission (6, 7). Brain-derived neurotrophic factor (BDNF) has important im- plications in the survival, growth and differentiation of existing neurons in the central and peripheral nervous system (1, 2). At the same time, BDNF was shown to be active in the hippocam- pus, cerebral cortex, cerebellum and basal forebrain, which are the areas that carry out vital functions such as learning, memory and thinking (3). BDNF shows its effect by the production of neurotransmitters, ion channel expression and by inducing long- term changes in synaptic composition (4, 5). In addition, BDNF enhances excitatory neurotransmission via its presynaptic and postsynaptic effects. Furthermore, it modulates excitatory and inhibitory synaptic transmission by gamma amino butyric acid (GABA)-A receptor-mediated inhibition of postsynaptic current. In immature brains, this effect occurs by an increase in GABAergic Although general anaesthesia is considered safe, experimental studies have shown that it might have harmful effects on the de- veloping mammalian brain (8, 9). It was also shown that exposure to anaesthetics that antagonise N-methyl-D-aspartate (NMDA) receptors or stimulate GABA-A receptors during synaptogenesis in the developing brain may trigger common apoptotic neurode- generation (10). The current study was planned to detect an acute phase brain damage that occurs due to the anaesthetics commonly used in pe- diatric patient population, to investigate the effects of anaesthesia on long-term behaviour, anxiety and impact on learning as well as to determine whether there is a correlation between these effects and serum BDNF, brain BDNF, amino acid levels and apoptosis. Materials and methods 1Department of Anesthesiology and Reanimation, Firat University, Faculty of Medicine, Elazig, Turkey, 2Department of Pathology, Firat University Faculty of Veterinary Medicine, Elazig, Turkey, 3Department of Anesthesi- ology and Reanimation, Ankara University, Faculty of Medicine, Ankara, Turkey, and 4Department of Biochemistry and Clinic Biochemistry, Firat University Faculty of Medicine, Elazig, Turkey Address for correspondence: A.B. Ozer, Department of Anesthesiology and Reanimation, Firat University Medical School, Department of Anes- thesiology and Reanimation, 23119, Elazig, Turkey. Phone/Fax: +90.533.4478924 The preclinical animal study was conducted at the Firat Uni- versity Experimental Research Centre in December 2012. After receiving approval from the institutional Animal Experimentation Ethics Committee, seven-day-old male Wistar-Albino rats were obtained from the Experimental Research Centre. The Helsinki Universal Declaration of Animal Rights was followed at every stage of the study. The rats were kept in the rooms with ambient temperature of 22–24 °C and with 12/12 hour day/night cycle. Except for the time it took for the experimental tests, the subjects Funding: Firat University Scientifi c Research Projects Unit. Indexed and abstracted in Science Citation Index Expanded and in Journal Citation Reports/Science Edition Ozer AB et al.Effects of sevofl urane on apoptosis, BDNF and cognitive functions in neonatal rats The study’s primary outcomes were serum BDNF levels, cortex and hippocampal BDNF levels and neurocognitive status. Secondary outcomes were cortex and hippocampal caspase 3 lev- els. Blood samples were taken at decapitation phase into serum separator tube to evaluate serum BDNF. Blood samples were cen- trifuged at 1000 x g for 15 minute and stored at –20 °C. Serum BDNF levels were measured by the enzyme-linked immunosor- bent assay (ELISA) method (EK0308, Boster Biological Technol- ogy, Ltd.). Brain tissue samples were kept for 24 hours in 10 % formaldehyde prepared with phosphate buffer saline. Brain tissue samples were taken for routine tissue processing for immuno- histochemical (IHC) examination procedure following the sagittal reduction process. Brain tissue was divided at the midline on the sagittal plane. The BDNF levels (Abcam, ab108319, Cambridge, UK) and caspase 3 levels (Abcam, ab13847, Cambridge, UK) were assessed with IHC in brain hemispheres (0 – no staining, 1 – mild, 2 – moderate, 3 – severe). Fig. 1. Serum brain-derived-neurotrophic factor (BDNF) levels of groups. were kept in the same cage with their mothers until postnatal day 21 (PN21). After the 21st day, the rats were put in separate cages and fed with standard rat chow and tap water. Using permuted block randomisation methods, the subjects were divided into the two groups: Group C acted as the control and did not receive any anaesthesia, and in Group S, anaesthesia was achieved with 2.3 % sevofl urane in 50 % oxygen (O2)-air mixture. The concentration of sevofl urane was adjusted according to the tail test. The tail test was applied every 15 minutes. The middle 1/3 of the tail was clamped, and if there was response, sevofl u- rane concentration was increased 15 %. All subjects were put in a plastic, transparent anaesthesia chamber that was connected to the anaesthesia device and was ventilated with 4 L/min fl ow and 50 % O2-air mixture. Immediately after the six-hour administra- tion of anaesthesia, oxygen arterial blood gases were evaluated in 3 subjects from each group. At the end of the application period, half of the subjects were sacrifi ced to determine the early effects of sevofl urane (Group SE and Group CE), while the rest of the subjects were sacrifi ced 6 weeks after the application to determine the late effects of sevofl urane (Group SL and Group CL). In addi- tion, the levels of serum BDNF, brain tissue BDNF and caspase 3 were evaluated for all subjects. The anaesthesia chamber was heated from the outside during the entire experiment to prevent hypothermia. Glucose and saline were administered intradermally to prevent hypoglycaemia and hypovolaemia. Subjects that ex- perienced discolouration of the skin (cyanosis) or a decrease in respiratory rate that did not improve with stimuli, were excluded from the study. The behaviour, anxiety states and spatial learning abilities of the subjects during the long-term period (6 weeks later) were evaluated by using the plus arm test and the Morris water test, respectively. Open arm avoidance index was calculated accord- ing to the formula 100 – ((% of the time spent in the open arms + % of the entrance to the open arms)/2), while the total locomotor activity was calculated based on line crossings + rearing. Swim- ming tests were done 4 times a day for a period of 4 days. The test was repeated 2 days after training and the time it took to reach the platform (latency) and the time spent in the platform quadrant after the platform was removed were recorded. The subjects that com- pleted the swimming test were put back into their heated cages. Those conducting the experiment knew, which group of sub- jects they were dealing with, but those evaluating biochemical, IHC and neurocognitive tests did not know, which samples and subjects belonged to which group. SPSS 15 was used for a statistical evaluation. Nonparametric methods were used for all variables because the sample size was small. Kruskal–Wallis test was used for one-way analysis of vari- ance (ANOVA) of nonparametric data, therefore median values were calculated instead of mean. When it was determined not to the equal of medians with Kruskal–Wallis test, Mann–Whitney U test was used for post-hoc multiple comparisons. The escape latency within the group was evaluated by Wilcoxon test. The correlation between parameters was assessed by Spearman correlation test and p < 0.05 was considered signifi cant. Results Tab. 1. Brain-derived-neurotrophic factor (BDNF) and caspase 3 levels in cortex and hippocampus (median [min-max]). Group CE Group SE Group CL Group SL BDNF cortex 1.5 (1–3) 1.5 (0–2) 1 (0–1) 0.5 (0–1) BDNF hippocampus 1.5 (0–3) 1.5 (1–2) 1 (0–2) 1 (0–2) Caspase 3 cortex 0.5 (0–1) 2 (1–2) 0 (0–1) 1 (1–2) Caspase 3 hippocampus 0.5 (0–1) 1 (0–1) 0.5 (0–1) 1 (0–2) The 30 rats in the study were divided into groups C and S of 15 (50 %) each that were further divided into the early and late subgroups. BDNF levels in the late period groups were higher than in the early period groups (p < 0.05) (Fig. 1). While there was no signifi cant difference in the BDNF levels in the cerebral hippo- campus, the BDNF levels in cerebral cortex were higher in the Group CE than the Group CL and the Group SL (p < 0.05) (Tab. 1). In cerebral cortex of all rats, most signifi cant release of BDNF was present in large neurons in the outer granular layer and the xx 81 Bratisl Med J 2017; 118 (2) 80 – 84 A B E F C D G H Fig. 2. Brain-derived-neurotrophic factor (BDNF) immunohistochemistry staining in the cortex (200 μm) (A – Group CE, B – Group SE, E – Group CL, F – Group SL); in the hippocampus (C – Group CE, D – Group SE, G – Group CL, H – Group SL). outer pyramidal layer. Release of BDNF was detected in all layers of neocortex. Between all groups, the release of BDNF in multi- formed layer was prominent in the Group CE (Fig. 2). There was a signifi cant negative correlation between serum BDNF levels and the cortex BDNF levels (p = 0.003; r = –0.425). Cortex caspase 3 levels were signifi cantly higher in the Groups SE and SL than in the Group CE and the Group CL, especially outer granulary, outer pyramidal layer and pyramidal layer (p < 0.05) (Fig. 3). There was no signifi cant difference between the groups in terms of open arm index and locomotor activity (p > 0.05). Four- day and last-day Morris water test showed no signifi cant difference between groups in terms of time to reach the platform (p > 0.05). There was a negative correlation between serum BDNF and time to reach the platform (p = 0.022, r = –0.509). It was observed that in all groups the time to reach the platform became shorter with time (p < 0.05). When the platform was removed, the time spent in the quadrant with the platform was not signifi cantly different between the groups (p > 0.05). Discussion Sevofl urane is the most commonly used inhalational anaesthet- ic for pediatric surgical cases due to its minimal airway reactivity and low blood/gas partition coeffi cient. Therefore, we evaluated sevofl urane’s effect on the brain of neonatal rat in our study. We have found that serum levels of BDNF increased and brain levels decreased over time. There could be two explanations. Firstly, se- rum BDNF levels are known to increase with age (11). Secondly, it has been reported that hypoxia increases BDNF levels and that continuous positive airway pressure (CPAP) treatment decreases BDNF levels (12–14). In our study, seven-day-old rats were ex- posed to oxygen for 6 hours. Therefore, BDNF levels may also be measured so low in the early stages. While low doses of ketamine did not result in changes in hippocampal BDNF levels, higher doses were shown to increase them (15). Nine hours of 20 mg/kg ketamine treatment was re- ported to increase total BDNF protein levels in the brain (16). In 10-day-old mice 24 hours after propofol administration, BDNF protein levels were reported to decrease in the parietal cortex, but increased in the frontal cortex and hippocampus (17). The BDNF levels in the hippocampus were increased by ketamine, but remained unchanged when treated with propofol alone or in combination with ketamine (18). Yu et al evaluated BDNF lev- els in hippocampal cornus ammonis 3 (CA3) area of seven-day- old that were exposed to 3.6 % sevofl urane during six hours at postnatal 21 days (19). It demonstrated no signifi cant differences 82 Ozer AB et al.Effects of sevofl urane on apoptosis, BDNF and cognitive functions in neonatal rats A B E F C D G H Fig. 3. Caspase 3 immunohistochemistry staining in the cortex (200 μm) (A – Group CE, B – Group SE, E – Group CL, F – Group SL); in the hippocampus (C – Group CE, D – Group SE, G – Group CL, H – Group SL). between sevofl urane group and control group, when BDNF lev- els were evaluated with IHC. However, BDNF messenger ribo- nucleic acid (mRNA) expression, evaluated by reverse transcrip- tion polymerase chain reaction (RT-PCR) and BDNF protein level was evaluated by Western Blot, decreased in sevofl urane group (19). In our study, we found that BDNF levels were not differ- ent between the groups. The study evaluated effects of sequen- tial exposures to sevofl urane on hippocampal BDNF levels of neonatal rats (postnatal six, seven and eight days). On postnatal 21 day, the subjects were divided into the two groups according to different environments. While BDNF levels decreased in the only remaining subjects in the cage, they did not change in pair subjects in the cage (20). In our study, BDNF levels did not de- crease because the subjects were not left alone in a cage except for the experimental protocol. In our study, the cerebral cortex BDNF levels were higher in the Group CE than in the Group CL and the Group SL. In studies with seven-day-old rats where loss of pyramidal neurons was induced, levels of caspase 3 were increased in the hippocampus upon administration of sevofl urane, propofol and ketamine (17, 21–24). In our study, cortex caspase 3 levels were found to be signifi cantly higher in the sevofl urane group compared to the control group. In our study, there was no signifi cant difference between the groups in terms of open-arm avoidance index and locomo- tor activity. In the study, where sevofl urane was applied for six hours to seven-day-old rats, the battery fox test did not cause any signifi cant changes (25). In our study, there was no signifi cant difference between the groups in terms of time to reach the plat- form in the Morris water maze (MWM) test. When the platform was removed, the time subjects spent in the platform quadrant was not signifi cantly different in Group SL compared to Group CL. There was no signifi cant difference in the MWM test of the seven-day-old rats treated with sevofl urane for six hours (25). Moreover, the administration of a high concentration of isofl u- rane during the intrauterine period resulted in a decrease in the time spent to reach the platform in MWM test in neonatal rats, but this time was not signifi cantly different when isofl urane was administered at low concentrations (26). In the study where sevo- fl urane was applied for six hours to seven-day-old rats, latency duration of MWM test increased (19). Differences of this study from our study are the applied sevofl urane dose (3.6 % to 2.3 %) and timing of MWM test (PN21 to PN49–53). Zhang et al demonstrated no differences in terms of neuro-behavioural tests in the subjects that were provided the same conditions as in our study (20). xx 83 Bratisl Med J 2017; 118 (2) 80 – 84 The major limitation of our study was the small number of subjects. For the statement “sevofl urane might be a reliable an- aesthetic in a pediatric patient”, more detailed studies are needed. Serum BDNF levels increased over time, but the opposite was found to be correlated with brain BDNF levels. Sevofl urane did not cause signifi cant changes in the serum, cerebral cortex and hippocampus BDNF levels, but signifi cantly more in the cortex. Sevofl urane caused more apoptosis. Sevofl urane did not cause a reduction in spatial learning and anxiety. And, although sevofl u- rane induced apoptosis, it did not affect the levels of BDNF and showed no long-term negative effects on learning and anxiety in neonatal rats. Learning point Anaesthesia is applied to millions of children for surgery, im- aging and other invasive procedures, the issue is very serious and concerns. Sevofl urane, is the most used inhalation anaesthetic, which does not affect spatial learning and anxiety, even if it in- creases neuro-apoptosis. References 1. Acheson A, Conover JC, Fandl JP et al. A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 1995; 374: 450–453 2. Huang EJ, Reichardt LF. Neurotrophins: roles in neuronal develop- ment and function. Annu Rev Neurosci 2001; 24: 677–736. 3. Yamada K, Nabeshima T. Brain-derived neurotrophic factor/TrkB sig- naling in memory processes. J Pharmacol Sci 2003; 91: 267–270. 4. Baldelli P, Novara M, Carabelli V, Hernandez-Guijo JM, Carbone E. BDNF up-regulates evoked GABAergic transmission in developing hippocampus by potentiating presynaptic N- and P/Q-type Ca2+ channels signalling. Eur J Neurosci 2002; 16: 2297–2310. 5. Sherwood NT, Lo DC. Long-term enhancement of central synaptic transmission by chronic brain-derived neurotrophic factor treatment. J Neurosci 1999; 19: 7025–7036. 6. Kojima M, Klein RL, Hatanaka H. Pre- and post-synaptic modifi ca- tion by neurotrophins. Neurosci Res 2002; 43: 193–199 7. Tanaka T, Saito H, Matsuki N. Inhibition of GABAA synaptic re- sponses by brain-derived neurotrophic factor (BDNF) in rat hippocampus. J Neurosci 1997; 17: 2959–2966. 8. Cote CJ. Pediatric Anesthesia. In: Miller RD, ed. Miller’s Anesthesia, Philadelphia: Elsevier Churchill Livingstone, 2005; 2367–408. 9. Hayashi H, Dikkes P, Soriano SG. Repeated administration of ketamine may lead to neuronal degeneration in the developing rat brain. Paediatr Anaesth 2002; 12: 770–774. 10. Ikonomidou C, Bittgau P, Koch C et al. Neurotransmitters and apop- tosis in the developing brain. Biochem Pharmacol 2001; 62: 401–405. 11. Imam SS, Gad GI, Atef SH, Shawky MA. Cord blood brain de- rived neu-rotrophic factor: diagnostic and prognostic marker in fullterm newborns with perinatal asphyxia. Pak J Biol Sci 2009; 12: 1498–1504. 84 12. Scheepens A, Wassink G, Blanco CE. The effect of a global birth asphyxia on the ontogeny of BDNF and NGF protein expression in the juvenile brain. Brain Res Dev Brain Res 2003; 140: 215–221. 13. Fleiss B, Coleman HA, Castillo-Melendez M, Ireland Z, Walker DW, Parkington HC. Effects of birth asphyxia on neonatal hippocam- pal structure and function in the spiny mouse. Int J Dev Neurosci 2011; 29: 757–766. 14. Korhonen L, Riikonen R, Nawa H, Lindholm D. Brain derived neu- rotrophic factor is increased in cerebrospinal fl uid of children suffering from asphyxia. Neurosci Lett 1998; 240: 151–154. 15. Garcia LS, Comim CM, Valvassori SS et al. Acute administration of ketamine induces antidepressant-like effects in the forced swimming test and increases BDNF levels in the rat hippocampus. Prog Neuropsy- chopharmacol Biol Psychiatry 2008; 32: 140–144. 16. Ibla JC, Hayashi H, Bajic D, Soriano SG. Prolonged exposure to ketamine increases brain derived neurotrophic factor levels in developing rat brains. Curr Drug Saf. 2009; 4: 11–16. 17. Kong FJ, Ma LL, Hu WW, Wang WN, Lu HS, Chen SP. Fetal ex- posure to high isofl urane concentration induces postnatal memory and learning defi cits in rats. Biochem Pharmacol 2012; 84: 558–563. 18. Kohara K, Kitamura A, Adachi N et al. Inhibitory but not excitatory cortical neurons require presynaptic brain-derived neurotrophic factor for dendritic development, as revealed by chimera cell culture. J Neurosci 2003; 23: 6123–6131. 19. Yu Z, You S, Xu M, Lin H, Di MQ, Lian QQ. Effect of acute expo- sure to sevofl urane and isofl urane on learning, memory and brain derived neurotrophic factor expression in hippocampus of juvenile SD rats. Chin J Pharmacol Toxicol 2013; 27: 132–137. 20. Zhang MQ, Ji MH, Zhao QS et al. Neurobehavioural abnormali- ties induced by repeated exposure of neonatal rats to sevofl urane can be aggravated by social isolation and enrichment deprivation initiated after exposure to the anaesthetic. Br J Anaesth 2015; 115: 752–760. 21. Soriano SG, Liu Q, Li J et al. Ketamine activates cell cycle signal- ing and apoptosis in the neonatal rat brain. Anesthesiology 2010; 112: 1155–1163. 22. Yu D, Jiang Y, Gao J, Liu B, Chen P. Repeated exposure to propofol potentiates neuroapoptosis and long-term behavioral defi cits in neonatal rats. Neurosci Lett 2013; 534: 41–46. 23. Liu F, Paule MG, Ali S, Wang C. Ketamine-induced neurotoxicity and changes in gene expression in the developing rat brain. Curr Neuro- pharmacol 2011; 9: 256–261. 24. Zou X, Patterson TA, Sadovova N et al. Potential neurotoxicity of ketamine in the developing rat brain. Toxicol Sci 2009; 108: 149–158. 25. Feng X, Liu JJ, Zhou X et al. Single sevofl urane exposure decreases neuronal nitric oxide synthase levels in the hippocampus of developing rats. Br J Anaesth 2012; 109: 225–233 26. Wang JH, Fu Y, Wilson FA, Ma YY. Ketamine affects memory con- solidation: differential effects in T-maze and passive avoidance paradigms in mice. Neurosci 2006; 140: 993–1002. Received October 2, 2016. Accepted November 18, 2016.",rats,"['The study included 7-day-old male Wistar-Albino rats (n = 30), which were divided into the two groups according to the anaesthetic received: sevofl urane (S) and control group (C).']",postnatal day 7,"['The study included 7-day-old male Wistar-Albino rats (n = 30), which were divided into the two groups according to the anaesthetic received: sevofl urane (S) and control group (C).']",Y,"['In addition, elevated plus arm test and Morris water test were performed in the late group.']",sevoflurane,"['The study included 7-day-old male Wistar-Albino rats (n = 30), which were divided into the two groups according to the anaesthetic received: sevofl urane (S) and control group (C).']",none,[],wistar-albino,"['The study included 7-day-old male Wistar-Albino rats (n = 30), which were divided into the two groups according to the anaesthetic received: sevofl urane (S) and control group (C).']","The study aimed to evaluate the early and late effects of sevoflurane on the neonatal brain, addressing the gap in understanding its impact on apoptosis, BDNF levels, and cognitive functions in neonatal rats.",['ABSTRACT OBJECTIVE: To evaluate the early and late effects of sevofl urane on the neonatal brain.'],None,[],"The findings argue that sevoflurane induces apoptosis but does not affect BDNF levels or have long-term negative effects on learning and anxiety in neonatal rats, suggesting its safety for pediatric anesthesia.","['CONCLUSIONS: Although sevofl urane induced apoptosis, it didn’t affect BDNF levels and showed no long- term negative effects on learning and anxiety in neonatal rats.']",The major limitation of the study was the small number of subjects.,['The major limitation of our study was the small number of subjects.'],"Sevoflurane might be a reliable anesthetic in pediatric patients without long-term negative effects on learning and anxiety, even if it increases neuro-apoptosis.","['Learning point: Anaesthesia is applied to millions of children for surgery, imaging and other invasive procedures, the issue is very serious and concerns. Sevofl urane, is the most used inhalation anaesthetic, which does not affect spatial learning and anxiety, even if it in- creases neuro-apoptosis.']",True,True,False,True,True,True,10.4149/BLL_2017_017 10.1097/ALN.0b013e3181974fa2,722.0,Satomoto,2009,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"Anesthesiology 2009; 110:628 –37 Copyright © 2009, the American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins, Inc. Neonatal Exposure to Sevoflurane Induces Abnormal Social Behaviors and Deficits in Fear Conditioning in Mice Maiko Satomoto, M.D.,* Yasushi Satoh, Ph.D.,† Katsuo Terui, M.D., Ph.D.,‡ Hideki Miyao, M.D., Ph.D.,§ Kunio Takishima, Ph.D.,(cid:1) Masataka Ito, M.D., Ph.D.,# Junko Imaki, M.D., Ph.D.** Background: Neonatal exposure to anesthetics that block N- methyl-D-aspartate receptors and/or hyperactivate (cid:1)-aminobu- tyric acid type A receptor has been shown to cause neuronal degeneration in the developing brain, leading to functional deficits later in adulthood. The authors investigated whether exposure of neonatal mice to inhaled sevoflurane causes defi- cits in social behavior as well as learning disabilities. Methods: Six-day-old C57BL/6 mice were exposed to 3% sevoflurane for 6 h. Activated cleaved caspase-3 immunohisto- chemical staining was used for detection of apoptosis. Cognitive functions were tested by pavlovian conditioned fear test. Social behavior was tested by social recognition and interaction tests. Results: Neonatal exposure to sevoflurane significantly in- creased the number of apoptotic cells in the brain immediately after anesthesia. It caused persistent learning deficits later in adulthood as evidenced by decreased freezing response in both contextual and cued fear conditioning. The social recognition test demonstrated that mice with neonatal exposure to sevoflu- rane did not develop social memory. Furthermore, these mice showed decreased interactions with a social target compared with controls in the social interaction test, indicating a social interaction deficit. The authors did not attribute these abnor- malities in social behavior to impairments of general interest in novelty or olfactory sensation, because they did not detect sig- nificant differences in the test for novel inanimate object inter- action or for olfaction. Conclusions: This study shows that exposure of neonatal mice to inhaled sevoflurane could cause not only learning def- icits but also abnormal social behaviors resembling autism spectrum disorder. MANY pregnant women, newborns, and infants are ex- posed to a variety of anesthetic agents to prevent pain during childbirth or for surgical procedures. Anesthetic agents sometimes have to be administered during an important period of brain growth, the brain growth spurt period, which occurs from the last 3 months of pregnancy until approximately 2 yr after birth (in hu- mans) or during the first 2 weeks after birth (in mice and rats).1– 4 To minimize risks to the fetus or neonates, it is necessary to study the effect of anesthetics not only in terms of teratogenicity, but also on the developing ner- vous system. Recently, it has been demonstrated that neonatal ad- ministration of anesthetics induced widespread neuro- degeneration and severe deficits in spatial learning tasks in rodents.5,6 Jevtovic-Todorovic et al.5 reported that neonatal exposure to a cocktail of anesthetics that are commonly used in pediatric surgery induced brain cell death 15 times more frequently than in control rat brains, and that these animals developed learning prob- lems later in adulthood. Fredriksson et al.6 reported that coadministration of an N-methyl-D-aspartate (NMDA) receptor antagonist with (cid:1)-aminobutyric acid type A (GABAA) receptor agonists synergistically potentiated neonatal brain cell death and resulted in functional def- icits in adult mice, although the underlying mechanism is not fully understood. The most thoroughly investi- gated drug that has NMDA antagonist and GABAA agonist property is ethanol, which induces fetal alcohol syn- drome if the fetus is exposed during the brain growth spurt.3,7 Although detrimental effects of anesthetics on cognitive function have been reported, to our knowl- edge, few studies have investigated the effects of anes- thetics on social behavior. Therefore, we designed the current study to investigate the potential risks of neona- tal exposure to anesthetics to cause social abnormalities. Sevoflurane (2,2,2-trifluoro-1-[trifluoromethyl]ethyl flu- oromethyl ether) is one of the most frequently used volatile anesthetics for induction and maintenance of general anesthesia during surgery and cesarean delivery because of its low blood gas partition coefficient and low pungency. It is especially useful for infants and children because of its properties of rapid induction and recovery together with less irritation to the airway.8 Sevoflurane has been shown to enhance GABAA receptors9 and block NMDA receptors, although more research is necessary to better characterize its effects on NMDA receptors.10 In this investigation, we studied the potential risks of neo- natal exposure to sevoflurane to cause social abnormal- ities and cognitive deficits in mice. Postgraduate Student, # Associate Professor, ** Professor, Department of Developmental Anatomy and Regenerative Biology, † Assistant Professor, (cid:1) Pro- fessor, Department of Biochemistry, National Defense Medical College. ‡ Asso- ciate Professor, Department of Obstetric Anesthesia, § Professor and Chairman, Department of Anesthesiology, Saitama Medical Center, Saitama Medical Univer- sity, Kawagoe, Saitama, Japan. Received from the Department of Developmental Anatomy and Regenerative Biology, National Defense Medical College, Tokorozawa, Saitama, Japan. Submit- ted for publication May 24, 2008. Accepted for publication November 10, 2008. Supported in part by the Ministry of Defense of Japan, Tokyo, Japan (Drs. Satoh and Imaki). There are no financial relationships between any of the authors and any commercial organization with a vested interest in the outcome of the study. Address correspondence to Dr. Satoh: Department of Biochemistry, National Defense Medical College, 3-2 Namiki, Tokorozawa 359-8513, Japan. ys@ ndmc.ac.jp. Information on purchasing reprints may be found at www.anesthesiology. org or on the masthead page at the beginning of this issue. ANESTHESIOLOGY’s articles are made freely accessible to all readers, for personal use only, 6 months from the cover date of the issue. Materials and Methods The experiments were approved by the Committee for Animal Research at National Defense Medical College (Tokorozawa, Saitama, Japan). Pregnant C57BL/6 mice were purchased from SLC (SLC Japan Inc., Shizuoka, Japan). The animals were illuminated with a 12-h light– dark cycle (light from 07:00 to 19:00), and room tem- Anesthesiology, V 110, No 3, Mar 2009 628 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 SEVOFLURANE NEUROTOXICITY IN THE DEVELOPING BRAIN perature was maintained at 21° (cid:1) 1°C. At the age of 3 weeks, the mice were weaned and housed in groups of 4 animals in a room. Mice had ad libitum access to water and food. Previous studies reported that there is litter variability in the rate of apoptosis that occurs spontaneously in neonate mice.11 Therefore, a balanced number of con- trol and experimental animals were drawn from the same litters, so that each experimental condition had its own group of littermate controls. Only the male off- spring were used in this study. A total of 51 litters, 101 control and 103 treated pups, were used in this study. Anesthesia Treatment Postnatal day 6 (P6) male mice were placed in an acrylic box and exposed to 3% sevoflurane or no anes- thetics for 6 h. The total gas flow was 2 l/min, using air as a carrier. During anesthetic exposure, the mice were kept warm on a plate heated to 38°C. Control and ex- perimental animals were under the same treatment and environment except that the control animals were ex- posed only to air. Arterial Blood Gas Analysis Arterial blood analysis was performed essentially as described previously.5,12 Briefly, the pups underwent a quick arterial blood sampling from the left cardiac ven- tricle, and the samples were transferred into heparinized glass capillary tubes. A single sample (55 (cid:2)l) was ana- lyzed immediately after blood collection by blood gas analyzer (ABL800; Radiometer, Copenhagen, Denmark). Samples were obtained immediately after removal from the maternal cage (0 h) or at the end of anesthesia (6 h). At the time of blood sampling, the experiments were terminated by decapitation. Histopathologic Studies Animals from both treatment and control groups were perfused transcardially with 0.1 M phosphate buffer con- taining 4% paraformaldehyde immediately after 6 h of sevoflurane anesthesia, and then the brains were ex- posed to immersion fixation for 24 h at 4°C. The brains were histologically analyzed using paraffin-embedded sections (5 (cid:2)m thick). For immunohistochemistry, anti– active caspase-3 antiserum (D175; Cell Signaling Tech- nology, Beverly, MA) was used at dilutions of 1:400 in antibody diluent (Dako, Glostrup, Denmark). Before to use, sections were dewaxed in xylene and hydrated using a graded series of ethanol. Antigenic retrieval was performed by immersing mounted tissue sections in 0.01 mM sodium citrate (pH 6.0) and heating in an autoclave (121°C) for 5 min. Deparaffinized sections were blocked for endogenous peroxidase activity as described previ- ously,13 followed by blocking with a nonspecific staining blocking reagent (Dako) for 1 h to reduce background staining. The sections were then incubated overnight in a humidified chamber at 4°C. Subsequently, peroxidase- conjugated secondary antibody (DAKO En Vision (cid:2) sys- tem; Dako) and 3,3-diaminobenzine-tetrachloride (DAB; Vector Laboratories, Burlingame, CA) were used accord- ing to the manufacturer’s instructions. Finally, the sec- tions were counterstained with Nissl. Activated caspase- 3–positive cells were counted by the investigator who was blinded to the treatment conditions. transferase–mediated de- oxyuridine 5-triphosphate– biotin nick end labeling stain- ing was performed using an in situ apoptosis detection kit (ApopTag fluorescein; CHEMICON, Temecula, CA) accord- ing to the manufacturer’s protocol. Sections were counter- stained with 4=,6-diamidino-2-phenylindole (DAPI). Fluores- cein was histochemically examined with a fluorescent microscope (TE-2000E; Nikon, Tokyo, Japan) equipped with interlined charge-coupled device camera (DS-U1; Nikon). Terminal deoxynucleotidyl Laser Color Doppler Cerebral blood flow (CBF) was measured by a laser- Doppler blood perfusion imager (Peri Scan PIM II; Per- imed, Stockholm, Sweden). Mice were taken out of the chamber before and every hour during anesthetic treat- ment and were placed face down on the floor while being continuously exposed to sevoflurane via a tube with its opening positioned at the nose of the animals. Their head skins were peeled for scanning CBF, and data were captured using appropriate software (LDPIwin ver- sion 2.6; Lisca, Linko¨ping, Sweden). The perfusion re- sponse is presented in arbitrary perfusion units. Because the arbitrary perfusion units values are not absolute blood flow, the magnitude of the difference in perfusion was calculated as the ratio between the area of maxi- mum peak perfusion and areas of baseline perfusion. Arbitrary perfusion unit values were compared between anesthetized animals and those with mock anesthesia at baseline and at 1-h intervals for 6 h. Preparation of Protein Extracts Mice forebrain was quickly removed and were homog- enized in four volumes of 20 mM Tris-HCl, pH 7.4, 2 mM EDTA, protease inhibitor cocktail (Complete, Roche Di- agnostics, Penzberg, Germany), and phosphatase inhib- itors (20 mM glycerophosphate, 1 mM Na3VO4, 2 mM NaF). After homogenization, a portion of each sample was immediately frozen at (cid:3)80°C. The rest of the ho- mogenate was centrifuged at 15,000g for 30 min at 4°C. The supernatant solutions were separated and stored at (cid:3)80°C until use. The amount of protein in each sample was measured using a protein assay kit (BCA; Pierce, Rockford, IL). Western Blot Analysis The homogenate proteins were subjected to sodium do- decyl sulfate polyacrylamide gel electrophoresis. The pro- Anesthesiology, V 110, No 3, Mar 2009 629 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 630 teins were transferred onto polyvinylidene fluoride mem- branes (Immobilon-P; Millipore, Bedford, MA). The blots were immunoreacted with anti– cleaved poly(adenosine diphosphate–ribose) polymerase (PARP; 1:1,000, rabbit polyclonal, Asp214; Cell Signaling) or anti–(cid:3)-actin (1:5,000, mouse monoclonal, AC-15; Sigma, St. Louis, MO) antibod- ies, and the protein bands were visualized by chemilumi- nescence detection system (SuperSignal West Pico; Pierce). Behavioral Studies As described previously for CBF and histopathologic stud- ies, some sets of mice for behavioral studies were exposed to 3% or 0% sevoflurane for 6 h at P6. They were allowed to mature, and at the appropriate ages, sevoflurane and control mice underwent behavioral tests, namely, open- field, elevated plus-maze, Y-maze, fear conditioning, social recognition, social interaction, olfactory, and novelty tests. The movement of each mouse was monitored and analyzed using a computer-operated video tracking system (SMART, Barcelona, Spain). In the tasks using apparatus with arms, arm entry was counted when all four legs of the animal entered each arm. The apparatus was cleaned after each trial. All apparatus used in this study were made by O’Hara & Co., Ltd. (Tokyo, Japan). Open-field Test. Emotional responses to a novel en- vironment were measured by an open-field test using 8-week-old mice, by a previously described method.14 Activity was measured as the total distance traveled (meters) in 10 min. Elevated Plus-maze Test. The elevated plus-maze test was performed as previously described.14 The elevated plus maze consisted of two open arms (25 (cid:4) 5 cm) and two enclosed arms being elevated to a height of 50 cm above the floor. Normally, mice prefer a closed environ- ment to an open area. Mouse behavior was recorded during a 10-min test period. The percentage of time spent in the open arms was used as an index of anxiety- like behavior. Mice used for the test were aged 8 weeks. Spontaneous Alternation in the Y-maze Test. This study was performed as previously described.14 This study allowed us to assess spatial working memory. The symmetrical Y maze made of acrylic consists of three arms (25 (cid:4) 5 cm) separated by 120° with 15-cm-high transparent walls. Each mouse was placed in the center of the Y maze, and the mouse was allowed to freely explore the maze for 8 min. The sequence and the total number of arms entered were recorded. The percentage of alternation is the number of triads containing entries into all three arms divided by the maximum possible number of alternations (total number of arm entries minus 2) (cid:4) 100. Mice used for the test were aged 11 weeks. The motion of the animals was manually recorded. Fear Conditioning Test. This is a simple and sensi- tive test of hippocampal-dependent and hippocampal- independent learning as previously described.14 Briefly, Anesthesiology, V 110, No 3, Mar 2009 SATOMOTO ET AL. the conditioning trial for contextual and cued fear con- ditioning consisted of a 5-min exploration period fol- lowed by three conditioned stimulus– unconditioned stimulus pairings separated by 1 min each: uncondi- tioned stimulus, 1 mA foot shock intensity, 1 s duration; conditioned stimulus, 80 db white noise, 20 s duration; unconditioned stimulus was delivered during the last seconds of conditioned stimulus presentation. A contex- tual test was performed in the conditioning chamber for 5 min in the absence of white noise at 24 h after condi- tioning. A cued test (for the same set of mice) was performed by presentation of a cue (80 db white noise, 3 min duration) in alternative context with distinct visual and tactile cues. The rate of freezing response (absence of movement in any parts of the body during 1 s) was scored automatically and used to measure fear memory. The test was performed on mice of two different age groups: 8 weeks or between 14 and 17 weeks. Social Recognition Test. Social recognition test was conducted as described previously.15 We transferred 18- week-old mice from group to individual housing for 7 days before testing to permit establishment of a home cage territory. Testing began when a stimulus female mouse was introduced into the home cage of each male mouse for 1-min confrontation. At the end of the 1-min trial, the stimulus animal was removed and returned to an individual cage. This sequence was repeated for four trials with 10-min intertrial intervals, and each stimulus was introduced to the same male resident in all four trials. In a fifth trial, another stimulus mouse was intro- duced to a resident male mouse. Social Interaction Test. Caged social interaction for social versus inanimate targets was performed in an open field using two cylinder cages allowing olfactory and minimal tactile interaction as described previo- usly.16 The cylinder cages were 10 cm in height, with a bottom diameter of 9 cm and bars spaced 7 mm apart. Olfactory Test. Fifteen-week-old mice were habitu- ated to the flavor of a novel food (blueberry cheese) for 3 days before testing. On the fourth day, after 24 h of food deprivation, a piece of blueberry cheese was buried under 2 cm of bedding in a clean cage. The mice were placed in the cage, and the time required to find the food was measured manually. Novelty Test. Activity was measured as the total du- ration of interaction with an inanimate novel object (red tube) in 10 min. The same set of mice underwent social recognition (at 19 weeks of age), social interaction (at 14 weeks of age), olfactory (at 15 weeks of age), and novelty (at 15 weeks of age) tests. In other analyses, each test was conducted with a new set of animals. Statistical Analysis Statistical analysis was performed using Statview soft- ware (SAS, Cary, NC). Comparisons of the means of two D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 SEVOFLURANE NEUROTOXICITY IN THE DEVELOPING BRAIN 631 Table 1. Arterial Blood Gas Analysis Arterial Blood Gas Time, h n pH PacO2, mmHg PaO2, mmHg SaO2, % Sham operation 3% Sevoflurane 0 6 0 6 8 8 8 8 7.40 (cid:1) 0.09 7.38 (cid:1) 0.04 7.32 (cid:1) 0.08 7.46 (cid:1) 0.06 26.0 (cid:1) 4.6 29.4 (cid:1) 6.2 26.9 (cid:1) 4.6 27.5 (cid:1) 6.9 100.2 (cid:1) 5.7 95.6 (cid:1) 10.0 98.5 (cid:1) 6.9 80.9 (cid:1) 4.8 95.8 (cid:1) 1.1 96.1 (cid:1) 1.0 95.4 (cid:1) 1.1 95.4 (cid:1) 0.8 Neonatal exposure to sevoflurane does not induce significant cardiorespiratory dysfunction. Analysis of arterial blood gas revealed no significant differences in any of the measured parameters between mice exposed for 6 h to sevoflurane and control (sham operation) exposed to air for 6 h (t test, all P values (cid:5) 0.05). PaCO2 (cid:6) arterial carbon dioxide tension; PaO2 (cid:6) arterial oxygen tension; SaO2 (cid:6) arterial oxygen saturation. groups were performed using the Student t test. In the Y-maze task, comparisons of group performance relative to random levels were performed using the one-sample t test. Data of the social recognition task were analyzed by repeated-measures two-way analysis of variance. Values are presented as mean (cid:1) SEM. Results Neonatal Exposure to Sevoflurane Did Not Induce Significant Disturbance in Ventilation, Oxygenation, or CBF To examine the effect of neonatal exposure to sevoflu- rane, we exposed P6 mice to 3% sevoflurane for 6 h. Hypoxia is a known cause of neuronal cell death.17 To assess the adequacy of ventilation and oxygenation, we examined the blood gas data in mice during the anesthe- sia. Control samples were obtained from pups exposed to air during the same period. We found that pH, arterial carbon dioxide tension, arterial oxygen tension, and arterial oxygen saturation did not differ significantly from sham control (table 1). These results, together with the fact that pups looked pink throughout the 6 h of gas exposure, led us to conclude that it was unlikely that apoptosis in this protocol was caused by hypoxia/ hypoventilation. Further, to assess the adequacy of cerebral perfu- sion, we measured CBF during anesthesia using a laser-Doppler blood perfusion imager. Control mice were exposed to air for corresponding period of the sevoflurane treated mice. Anesthesia treatment with sevoflurane did not affect CBF compared with control mice at any point during the 6 h of anesthesia (figs. 1A and B). Neonatal Exposure to Sevoflurane Induced Extensive Apoptotic Neurodegeneration Sevoflurane anesthesia significantly increased cleaved caspase-3 apoptosis in the mice immediately after expo- sure (table 2 and figs. 2– 4). Figures 2B and D showed that the increased apoptosis was most robust in the caudate/putamen, retrosplenial cortex, dorsal hip- pocampal commissure, and neocortex in the brains of pups with sevoflurane exposure. In other sections, thal- A Fig. 1. Neonatal exposure to sevoflurane (Sevo) did not induce hypoperfusion of the brain. (A) Representative images of laser color Doppler for cerebral blood flow in a control mouse (upper panel) and in a sevoflurane exposed mouse (lower panel). The degree of perfusion is shown by the color code, with red repre- senting high perfusion and blue repre- senting lower perfusion. No different pat- terns of cerebral blood flow were observed between control and anesthe- tized mice throughout the 6-h exposure period. (B) Time course of cerebral blood flow measured by laser color Doppler during 6 h of 3% sevoflurane administra- tion. The degree of perfusion is pre- sented in arbitrary perfusion units. There was no difference between sevoflurane and control groups during the 6-h period (control, n (cid:2) 3; 3% sevoflurane, n (cid:2) 4). Scale bar: 5 mm. B Anesthesiology, V 110, No 3, Mar 2009 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 632 Table 2. Brain Regions in Which Sevoflurane-induced Neurodegeneration Was Heavily Concentrated Brain Region Severity, Fold Increase CA1 (hippocampus) CA3 (hippocampus) Dentate gyrus Dorsal hippocampal commissure Frontal cortex Temporal cortex Amygdala Caudate/putamen Mammillary complex Retrosplenial cortex Subiculum Pontine nuclei Inferior colliculus Thalamus 4.8 29.7 32.5 65.2 66.7 148.0 51.0 47.7 21.1 166.5 121.5 38.8 32.1 376.7 Severity of damage is expressed as the fold increase (i.e., how many times greater) in the density of degenerating neurons labeled by activated cleaved caspase-3 immunohistochemical staining in the sevoflurane-treated brain (n (cid:6) 6 mice) compared with the rate of degeneration in the same region of control brain (n (cid:6) 6 mice). amus, subiculum, inferior colliculus, and pontine nuclei were also shown to be damaged severely (figs. 3B and C). Figure 4B indicated that severe neuronal damage occurred in the extrahippocampal circuit, which is be- lieved to be important for mediating learning and mem- ory functions,18 including dorsal hippocampal commis- sure as well as thalamus and retrosplenial cortex. Apoptosis were also observed in amygdala (fig. 4D), hippocampus (fig. 4F), frontal cortex (fig. 4H), and mam- millary complex (fig. 4J). These data indicated that the apoptotic response to sevoflurane was robust and fol- lowed a pattern that was characteristic of the pattern reported for other anesthetic drugs or ethanol.18 It was reported that caspase-3 cleavage may occur under a condition that is a nonapoptotic event,19 raising questions about the reliability of cleaved caspase-3 im- munostaining for detecting cell death. Therefore, to ver- ify that the cleaved caspase-3 immunoreactivity repre- sent authentic apoptosis, we also performed terminal deoxynucleotidyl transferase–mediated deoxyuridine 5-triphosphate– biotin nick end labeling as another inde- pendent measure of apoptotic cell death. We found the same pattern of staining as observed by cleaved caspase-3 staining (figs. 4L, N, P, and R). Further, to verify that the previously described immu- nohistochemically detectable reactivity represented au- thentic apoptosis and to quantify the apoptosis re- sponse, we examined cortex extracts from control and sevoflurane-treated pups by Western blot analysis using antibody specific for cleaved PARP. PARP is one of the main cleavage targets of caspase-3 in vivo, and the cleav- age is readily detected in many apoptosis model.20 West- ern immunoblotting with anticleaved PARP antibody de- tected immunoreactivity in sevoflurane-exposed pup Anesthesiology, V 110, No 3, Mar 2009 SATOMOTO ET AL. Fig. 2. The apoptotic response to sevoflurane (Sevo) was robust in pup brain. Light microscopic views of the mouse brain after exposure to room air for 6 h (A and C) and to 3% sevoflurane for 6 h (B and D). Sections were immunochemically stained to reveal caspase-3 activation (A–D). Black dots represent caspase- 3–positive cells, which indicate apoptosis. A substantially higher density of cleaved caspase-3–positive profile is present in sevoflurane-treated brain. cp (cid:2) caudate/putamen; dhc (cid:2) dorsal hippocampal commissure; rs (cid:2) retrosplenial cortex. Scale bars: 1 mm. extracts, whereas the band was under detection level in control pub brain extracts (fig. 4S). General Behavior Was Normal in Mice with Neonatal Exposure to Sevoflurane To examine responses to a novel environment, mice with neonatal exposure to sevoflurane were assayed in an open-field test. These mice did not differ from control animals in their exploratory behavior (fig. 5A; t test, t (cid:6) 1.24, P (cid:5) 0.05). To study whether anxiety-related behav- ior of mice with neonatal exposure to sevoflurane was affected, mice underwent an elevated plus-maze test. Anxiety-related behavior was assessed by the percentage of time spent in the open arms of the test equipment. Anesthetized mice did not differ significantly in the per- centage of time spent in the open arms (fig. 5B; t test, t (cid:6) 0.76, P (cid:5) 0.05). These results indicate that the emotional state of mice with neonatal exposure to sevoflurane did not differ grossly from controls under the conditions of this study. Further, to examine whether exposure of the develop- ing brain to sevoflurane was associated with changes in D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 SEVOFLURANE NEUROTOXICITY IN THE DEVELOPING BRAIN being no difference compared with control (fig. 5C; t test, t (cid:6) 1.20, P (cid:5) 0.05). This result suggests that spatial working memory was not affected by exposure of the developing brain to sevoflurane. Neonatal Exposure to Sevoflurane Induced Deficits in Contextual and Cued Fear Conditioning To assess the influence of neonatal exposure to sevoflurane on long-term memory, mice underwent con- textual/cued fear conditioning. In this paradigm, mice learn to associate previous neutral auditory cues and the apparatus (context) with electric foot shock in a single training session, such that robust long-term memory was established for an experimental context (hippocampus dependent) and an auditory cue (hippocampus indepen- dent).21,22 Long-term memory was assessed based on the freezing reaction of the mice in response to the context or the conditioned cue. The freezing response to the same context in mice with neonatal exposure to sevoflu- rane was reduced significantly compared with controls after a 24-h retention delay at 8 weeks of age (fig. 6A; t test, t (cid:6) 3.10, P (cid:7) 0.01). The response of mice with sevoflurane to the cued fear conditioning was also re- duced significantly after a 48-h retention delay compared with control mice (fig. 6B; t test, t (cid:6) 3.16, P (cid:7) 0.01). It was reported that exposure of infant mice to ethanol induced neuroapoptosis and subsequent memory im- pairments that were very severe at P30 and less severe at P75.18 This result provided evidence favoring the inter- pretation that recovery of some type of learning func- tions might occur in later adulthood in ethanol-treated mice. Therefore, further to examine whether the neona- tal exposure to sevoflurane causes permanent neurocog- nitive deficits in mice and how it evolves over time, we undertook an assessment of hippocampal function at later time point using another set of mice. Fig. 3. Thalamus and other regions were also severely damaged after neonatal exposure to sevoflurane (Sevo). Sagittal (A and B) and coronal (C) views of the mouse brain after exposure to room air for 6 h (A) and to 3% sevoflurane for 6 h (B and C) as described in figure 2. A substantially higher density of cleaved caspase-3–positive profile is present in thalamus (th) as well as subiculum (s), inferior colliculus (ic), and pontine nuclei (pn). rs (cid:2) retrosplenial cortex. Scale bars: 1 mm. spatial working memory, mice underwent a Y-maze spontaneous alternation task. Working memory refers to a cognitive function that provides concurrent temporary storage and manipulation of the information necessary for complex cognitive tasks. This test examines whether mice remember the position of the arm selected in the preceding choice. Mice with and without sevoflurane exposure performed this task with 64.3 (cid:1) 7.3% and 60.0 (cid:1) 8.3% correct choices, respectively, which were well above the expected results of random choices (ran- dom choice (cid:6) 50%; one-sample t test, P (cid:7) 0.05), there We found that neonatal exposure to sevoflurane caused deficits in the fear conditioning test at 14 –17 weeks of age similar to the results at 8 weeks. The freezing response of mice with sevoflurane was reduced significantly in contextual tests compared with that of controls after a 24-h retention delay (fig. 6C; t test, t (cid:6) 3.48, P (cid:7) 0.01). The freezing response of sevoflurane- exposed mice to cued fear was also reduced significantly compared with that of controls after a 48-h retention delay at 14 –17 weeks of age (fig. 6D; t test, t (cid:6) 2.11, P (cid:7) 0.05). These results strongly suggested that exposure of P6 mice to sevoflurane caused hippocampal-depen- dent and -independent neurocognitive deficits that per- sisted for relatively long time periods (at least from 8 to 14 –17 weeks of age) of the mice’s lifespan. Neonatal Exposure to Sevoflurane Induced Abnormal Social Interaction Mice are a social species and exhibit social interaction behavior.23 Therefore, we investigated whether mice Anesthesiology, V 110, No 3, Mar 2009 633 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 634 with neonatal exposure to sevoflurane display abnormal social behaviors. First, we investigated social memory, which depends predominantly on olfactory cues. This ability is needed for social familiarity and can be identi- fied as a consistent decrease in olfactory investigation during repeated encounters with a female in the social recognition test. Control mice showed a significant de- cline in the time spent in investigating a female with subsequent presentation of the same female in trials 3 and 4, as compared with trial 1 (fig. 7A). This decrease was not due to a general decline in olfactory investiga- A B C Anesthesiology, V 110, No 3, Mar 2009 SATOMOTO ET AL. Fig. 4. Inhaled sevoflurane increased ap- optosis in several regions of the brain. Light microscopic views of the mouse brain after exposure to room air for 6 h (A, C, E, G, and I) and to 3% sevoflurane (Sevo) for 6 h (B, D, F, H, and J). Higher density of cleaved caspase-3–positive profile was present in extrahippocampal circuit (A and B), amygdala (C and D), hippocampus (E and F), frontal cortex (G and H), and mammillary complex (I and J). Scale bars: 1 mm in A and B, 50 (cid:3)m in C–J, and 100 (cid:3)m in I and J. (K–R) Termi- nal deoxynucleotidyl transferase–medi- ated deoxyuridine 5-triphosphate– biotin nick end labeling (TUNEL; L, N, P, and R) showed similar pattern of neuroapopto- sis to cleaved caspase-3 staining. Sections stained with 4=,6-dia- were midino-2-phenylindole (DAPI; K, M, O, and Q). Representative images of cortex (K, L, O, and P) and caudate (M, N, Q, and R) are shown. Scale bars: 500 (cid:3)m. (S) Poly(adenosine diphosphate–ribose) poly- merase (PARP) was cleaved after neonatal exposure to sevoflurane. Protein extracts of control (exposure to room air for 6 h) and sevoflurane-exposed cortex were prepared and analyzed for cleaved PARP immunoreac- tivity on Western blot. Representative blot from three independent results (from three pairs of pups) was shown. (cid:4)-Actin reactivity was used as a protein loading control. dhc (cid:2) dorsal hippocampal commissure; rs (cid:2) retro- splenial cortex; th (cid:2) thalamus. counter tion, because presentation of a novel female during trial 5 resulted in a similar amount of investigation as trial 1 with the original female. In contrast, mice with neonatal exposure to sevoflurane showed high levels of sustained investigation at each encounter with the same female and the same level of investigation when presented with a new female at trial 5, significantly different from the response of controls (analysis of variance, F (cid:6) 14.51, P (cid:7) 0.001 [between control and sevoflurane administra- tion]; F (cid:6) 28.34, P (cid:7) 0.0001 [between trials]; F (cid:6) 16.64, P (cid:7) 0.0001 [interaction between trials and sevoflurane Fig. 5. Behavioral effects of neonatal sevoflu- rane exposure were assessed by the open- field test (total distance traveled in 10 min; control, n (cid:2) 10; sevoflurane, n (cid:2) 11; A), ele- vated plus-maze test (percentage of time spent in open arms; control, n (cid:2) 18; sevoflu- rane, n (cid:2) 20; B), and Y-maze test (percentage of correct alternation response; control, n (cid:2) 10; sevoflurane, n (cid:2) 9; C). No significant dif- ferences were observed between mice with neonatal sevoflurane exposure and controls in these tests. D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 SEVOFLURANE NEUROTOXICITY IN THE DEVELOPING BRAIN A B A B C D C D Fig. 6. Neonatal exposure of mice to sevoflurane (Sevo) induced impaired memory performance in both contextual and cued tests. (A and B) Contextual and cued tests at 8 weeks of age. (A) Freezing response was measured in the context before shock (basal freezing) and in the conditioning chamber (contextual fear response) 24 h after conditioning (control, n (cid:2) 8; sevoflurane, n (cid:2) 8). (B) Freezing response (for the same set of mice as in A) was measured in an alternative context without auditory cue (basal freezing after conditioning) or with cue 2 days after conditioning. (C and D) Contextual and cued tests for another set of mice at a different age (14 –17 weeks of age) as in A and B (control, n (cid:2) 9; sevoflurane, n (cid:2) 9). For all figures, asterisks represent statistical difference (* P < 0.05, ** P < 0.01). administration]; fig. 7A). These data suggest that mice with neonatal exposure to sevoflurane do not develop social memory. In a test for social versus inanimate preference, control mice spent significantly more time interacting with the social target than with the inanimate target (fig. 7B; t test, t (cid:6) 7.30, P (cid:7) 0.0001). In contrast, mice with neonatal exposure to sevoflurane spent a similar amount of time interacting with both targets (fig. 7B; t test, t (cid:6) 1.77, P (cid:5) 0.05). Furthermore, mice with neonatal exposure to sevoflurane exhibited decreased interaction with a social target compared with controls (fig. 7B; t test, t (cid:6) 2.38, P (cid:7) 0.05), indicating a social interaction deficit. We did not attribute the abnormalities in social recognition and inter- action to impairment in general interest in novelty or olfac- tory sensation, because we did not detect significant differ- ences between groups in tests for novel inanimate object interaction (fig. 7C; t test, t (cid:6) 0.21, P (cid:5) 0.05) or for olfaction (fig. 7D; t test, t (cid:6) 0.12, P (cid:5) 0.05). Therefore, it can be concluded that mice with neonatal exposure to sevoflurane demonstrated deficits in social behavior. Discussion This study showed that single administration of sevoflurane to neonatal mice caused a significant in- Fig. 7. Neonatal exposure to sevoflurane (Sevo) induced abnor- mal social behavior in adulthood. (A) Olfactory investigations in mice with neonatal exposure to sevoflurane were used for social recognition test. Social memory by male mice was mea- sured as the difference in anogenital investigation. Data depict the amount of time allocated to investigating the same female during each of four successive 1-min trials. A fifth trial depicts the response to a new female. Asterisks represent statistical differences (*** P < 0.001) between each trial compared with the first trial (control, n (cid:2) 17; sevoflurane, n (cid:2) 18). (B) When exposed to caged social and inanimate targets (social interac- tion test) in an open field, control mice showed a normal preference for the social target over an inanimate target, whereas the difference of interaction time between both targets was not significant in mice with neonatal exposure to sevoflu- rane. Furthermore, mice with neonatal exposure to sevoflurane spent significantly less time interacting with the social target compared with controls (control, n (cid:2) 17; sevoflurane, n (cid:2) 18). Asterisks represent statistical differences (* P < 0.05, *** P < 0.001). (C) Time spent interacting with a novel inanimate object was not significantly affected by neonatal exposure to sevoflu- rane (control, n (cid:2) 17; sevoflurane, n (cid:2) 18). (D) Mice with neonatal exposure to sevoflurane did not show significant dif- ferences from controls in latency to find a buried treat after overnight food deprivation (control, n (cid:2) 17; sevoflurane, n (cid:2) 18). crease in neuroapoptosis in the brain compared with littermate controls exposed only to air. Consistent with other recent evidence that apoptotic neurodegeneration can be induced by exposure during the brain growth spurt to drugs that block NMDA receptors and/or hyper- activate GABAA receptors,5,6,18 neonatal exposure to sevoflurane was shown to induce widespread apoptosis in several major brain regions, leading to impaired learn- ing later in adulthood. This finding for sevoflurane is consistent with recent finding by Johnson et al.,24 who found that a neonatal exposure to isoflurane triggers a significant neuroapoptosis response in the mouse brain. Our results of fear conditioning strongly suggested that exposure of P6 mice to sevoflurane caused learning deficits, although we could not rule out the possibility of the effects of sevoflurane on sensitization despite true conditioning to the auditory cue. Furthermore, this Anesthesiology, V 110, No 3, Mar 2009 635 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 636 study also showed that exposure of neonatal mice to inhaled sevoflurane caused deficits in social behavior. To our knowledge, this is the first study to show that single administration of sevoflurane, which is a commonly used anesthetic in pediatric surgery throughout the world, causes a robust neuroapoptosis response in infant mouse brain and behavioral deficits in both cognitive and social spheres. The minimum alveolar anesthetic concentra- tion that prevents purposeful movement in response to supramaximal noxious stimulation in 50% of animals (minimum alveolar concentration) of sevoflurane in hu- man neonates is 3.3 (cid:1) 0.2%.8 Therefore, the concentra- tion of sevoflurane (3%) used in this mice study would be comparable to clinically used ranges. Most anesthetics act via NMDA and/or GABAA recep- tors. It was demonstrated that neonatal coadministration of an NMDA antagonist and a GABAA agonist was much more detrimental than either of these used alone.5,6 Although the precise mechanism for this is yet to be understood, this evidence suggested that more severe neurodegeneration was induced when both NMDA and GABAA receptors were simultaneously altered in the developing brain. Therefore, an anesthetic that has NMDA antagonist and GABAA agonist properties would be of concern when administered to the developing brain. Autism spectrum disorders (ASDs) are a group of com- mon neuropsychiatric disorders characterized primarily by impairments in social, communicative, and behavioral functioning,25 of unknown mechanism. Epidemiologic studies have shown that the prevalence of ASDs is 3– 6 per 1,000 children. If neonatal exposure to anesthetics induces deficits in social behavior, a causal link between ASDs and neonatal exposure to anesthetics could be suggested, because deficits in social behaviors are a core feature of ASDs. Our findings revealed that neonatal exposure to sevoflurane induced deficits in social mem- interaction in mice. These tests were ory and social thought to be core paradigms to test autistic behavior in mice and have been used to measure autistic behavior in other ASD models as well.16,17,26,27 This study is the first to indicate the potential risk of general anesthetics to induce disturbances in social behaviors that resembles those seen in ASDs. However, there is a caveat that the relevance of these mouse findings to the human situation is unknown and requires clarification. It is too early to say whether anes- thetics have the same effect in humans. There may be species differences in the detrimental effects of anes- thetic agents on the developing brain. Physicians could reduce any potential risks by limiting the duration of anesthetic administration in neonates. In any case, the current results suggest the potential hazards of neonatal sevoflurane exposure in causing so- cial behavioral alterations. We would like to insist on the need for further research to determine whether a corre- Anesthesiology, V 110, No 3, Mar 2009 SATOMOTO ET AL. lation exists between anesthesia exposure during devel- opment and ASDs in human populations. What would be the potential association between the sevoflurane-in- duced apoptosis and sevoflurane-induced changes in so- cial behaviors? Several authors have proposed that glu- tamate and GABAergic system disturbance in cortical network in ASDs may be characterized by an imbalance between excitation and inhibition in neuronal net- works.28,29 Such a change may lead to hyperexcitability or unstable neuronal networks, which may alter oscilla- tory rhythms in brain.30,31 The excitatory/inhibitory bal- ance in cortical networks may be controlled by the relative numbers and activities of glutamatergic and GABAergic neurons.29 Indeed, reduced GABAergic inhi- bition by mutations of genes encoding subunits of the GABAA receptors is associated with ASDs.28,29,32 Neural loss by a drug that may violate NMDA and GABAA recep- tors in the critical period, seen in the current study, might interfere with the developmental mechanisms pat- terning the balance between excitation and inhibition system and cause ASD-like behaviors. Our results showed that neuronal degeneration was particularly severe in several of the specific brain regions that comprise the extrahippocampal circuit, which is believed to be important for mediating learning and memory functions. This pattern was similar to the pat- tern for neonatal exposure to ethanol, which has NMDA antagonist and GABAA agonist properties.18 These pat- tern of brain damage and subsequent learning deficits are described in ethanol-treated mice.18 In this regard, it is noteworthy that there is evidence that prenatal expo- sure to ethanol may be a factor in social difficulties in humans.33 Further including electrophysi- ologic study, will be needed to address the molecular mechanisms that explain the relevance between neona- tal exposure to sevoflurane and deficits in social behav- ior. It would also be necessary to study whether other drugs that cause neuroapoptosis in the critical period would induce deficits in social behavior. research, The authors thank Kyoko Takeuchi, Ph.D. (Assistant Professor), Kenji Miura, Ph.D. (Lecturer), Kazuyo Kuroki (Technician, all from the Department of Devel- opmental Anatomy and Regenerative Biology, National Defense Medical College, Tokorozawa, Saitama, Japan), Kunihito Takahashi, Ph.D., (Senior Researcher, Hakuju Institute for Health Science Co. Ltd., Tokyo, Japan), and Tatsuyo Hara- sawa (Technician, Central Research Laboratory, National Defense Medical Col- lege) for the participation in this study; and Kouichi Fukuda, Ph.D. (Associate Professor, Center for Laboratory Animal Science, National Defense Medical Col- lege), for the assistance in animal administration. References 1. Bayer SA, Altman J, Russo RJ, Zhang X: Timetables of neurogenesis in the human brain based on experimentally determined patterns in the rat. Neurotoxi- cology 1993; 14:83–144 2. Rice D, Barone S Jr: Critical periods of vulnerability for the developing nervous system: Evidence from humans and animal models. Environ Health Perspect 2000; 108:511–33 3. Olney JW, Tenkova T, Dikranian K, Qin YQ, Labruyere J, Ikonomidou C: Ethanol-induced apoptotic neurodegeneration in the developing C57BL/6 mouse brain. Brain Res Dev Brain Res 2002; 133:115–26 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1 SEVOFLURANE NEUROTOXICITY IN THE DEVELOPING BRAIN 637 4. Dobbing J, Sands J: Comparative aspects of the brain growth spurt. Early Hum Dev 1979; 3:79–83 5. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF: Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 2003; 23:876–82 6. Fredriksson A, Ponte´n E, Gordh T, Eriksson P: Neonatal exposure to a combination of N-methyl-D-aspartate and (cid:1)-aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behav- ioral deficits. ANESTHESIOLOGY 2007; 107:427–36 7. Ikonomidou C, Bittigau P, Ishimaru MJ, Wozniak DF, Koch C, Genz K, Price MT, Stefovska V, Ho¨rster F, Tenkova T, Dikranian K, Olney JW: Ethanol-induced apoptotic neurodegeneration and fetal alcohol syndrome. Science 2000; 287: 1056–60 M, Lang D, Speer A, Olney JW, Ikonomidou C: Apoptotic neurodegeneration following trauma is markedly enhanced in the immature brain. Ann Neurol 1999; 45:724–35 18. Wozniak DF, Hartman RE, Boyle MP, Vogt SK, Brooks AR, Tenkova T, Young C, Olney JW, Muglia LJ: Apoptotic neurodegeneration induced by ethanol in neonatal mice is associated with profound learning/memory deficits in juve- niles followed by progressive functional recovery in adults. Neurobiol Dis 2004; 17:403–14 19. Rosado JA, Lopez JJ, Gomez-Arteta E, Redondo PC, Salido GM, Pariente JA: Early caspase-3 activation independent of apoptosis is required for cellular func- tion. J Cell Physiol 2006; 209:142–52 20. Lazebnik YA, Kaufmann SH, Desnoyers S, Poirier GG, Earnshaw WC: Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 1994; 371:346–7 8. Lerman J, Sikich N, Kleinman S, Yentis S: The pharmacology of sevoflurane 21. Kim JJ, Fanselow MS: Modality-specific retrograde amnesia of fear. Science in infants and children. ANESTHESIOLOGY 1994; 80:814–24 1992; 256:675–7 9. Nishikawa K, Harrison NL: The actions of sevoflurane and desflurane on the gamma-aminobutyric acid receptor type A: Effects of TM2 mutations in the alpha and beta subunits. ANESTHESIOLOGY 2003; 99:678–84 22. Phillips RG, LeDoux JE: Differential contribution of amygdala and hip- pocampus to cued and contextual fear conditioning. Behav Neurosci 1992; 106:274–85 10. Hollmann MW, Liu HT, Hoenemann CW, Liu WH, Durieux ME: Modulation of NMDA receptor function by ketamine and magnesium, part II: interactions with volatile anesthetics. Anesth Analg 2001; 92:1182–91 11. Young C, Jevtovic-Todorovic V, Qin YQ, Tenkova T, Wang H, Labruyere J, Olney JW: Potential of ketamine and midazolam, individually or in combination, to induce apoptotic neurodegeneration in the infant mouse brain. Br J Pharmacol 2005; 146:189–97 12. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V: General anesthesia acti- vates BDNF-dependent neuroapoptosis in the developing rat brain. Apoptosis 2006; 11:1603–15 13. Ito M, Nakashima M, Tsuchida N, Imaki J, Yoshioka M: Histogenesis of the intravitreal membrane and secondary vitreous in the mouse. Invest Ophthalmol Vis Sci 2007; 48:1923–30 14. Satoh Y, Endo S, Ikeda T, Yamada K, Ito M, Kuroki M, Hiramoto T, Imamura O, Kobayashi Y, Watanabe Y, Itohara S, Takishima K: Extracellular signal-regulated kinase 2 (ERK2) knockdown mice show deficits in long-term memory; Erk2 has a specific function in learning and memory. J Neurosci 2007; 27:10765–76 23. Murcia CL, Gulden F, Herrup K: A question of balance: A proposal for new mouse models of autism. Int J Dev Neurosci 2005; 23:265–75 24. Johnson SA, Young C, Olney JW: Isoflurane-induced neuroapoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 2008; 20:21–8 25. American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders, 4th ed. Washington, DC, American Psychiatric Association, 2000 26. Moretti P, Bouwknecht JA, Teague R, Paylor R, Zoghbi HY: Abnormalities of social interactions and home-cage behavior in a mouse model of Rett syn- drome. Hum Mol Genet 2005; 14:205–20 27. Lijam N, Paylor R, McDonald MP, Crawley JN, Deng CX, Herrup K, Stevens KE, Maccaferri G, McBain CJ, Sussman DJ, Wynshaw-Boris A: Social interaction and sensorimotor gating abnormalities in mice lacking Dvl1. Cell 1997; 90:895– 905 28. Polleux F, Lauder JM: Toward a developmental neurobiology of autism. Ment Retard Dev Disabil Res Rev 2004; 10:303–17 29. Rubenstein JL, Merzenich MM: Model of autism: Increased ratio of excita- 15. Jin D, Liu HX, Hirai H, Torashima T, Nagai T, Lopatina O, Shnayder NA, Yamada K, Noda M, Seike T, Fujita K, Takasawa S, Yokoyama S, Koizumi K, Shiraishi Y, Tanaka S, Hashii M, Yoshihara T, Higashida K, Islam MS, Yamada N, Hayashi K, Noguchi N, Kato I, Okamoto H, Matsushima A, Salmina A, Munesue T, Shimizu N, Mochida S, Asano M, Higashida H: CD38 is critical for social behavior by regulating oxytocin secretion. Nature 2007; 446:41–5 tion/inhibition in key neural systems. Genes Brain Behav 2003; 5:255–67 30. Uhlhaas PJ, Singer W: Neural synchrony in brain disorders: Relevance for cognitive dysfunctions and pathophysiology. Neuron 2006; 52:155–68 31. Buzsa´ki G, Draguhn A: Neuronal oscillations in cortical networks. Science 2004; 304:1926–9 32. Hussman JP: Suppressed GABAergic inhibition as a common factor in 16. Kwon CH, Luikart BW, Powell CM, Zhou J, Matheny SA, Zhang W, Li Y, Baker SJ, Parada LF: Pten regulates neuronal arborization and social interaction in mice. Neuron 2006; 50:377–88 17. Bittigau P, Sifringer M, Pohl D, Stadthaus D, Ishimaru M, Shimizu H, Ikeda suspected etiologies of autism. Autism Dev Disord 2001; 2:247–8 33. Bishop S, Gahagan S, Lord C: Re-examining the core features of autism: A comparison of autism spectrum disorder and fetal alcohol spectrum disorder. J Child Psychol Psychiatry 2007; 48:1111–21 / 33. Bishop S, Gahagan S, Lord C: Re-examining the core features of autism: A comparison of autism spectrum disorder and fetal alcohol spectrum disorder. J Child Psychol Psychiatry 2007; 48:1111–21 / Anesthesiology, V 110, No 3, Mar 2009 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 1 0 3 6 2 8 3 6 8 3 7 1 0 0 0 0 5 4 2 - 2 0 0 9 0 3 0 0 0 - 0 0 0 3 1 p d / / f b y g u e s t o n 3 0 M a r c h 2 0 2 1",mice,['Six-day-old C57BL/6 mice were exposed to 3% sevoflurane for 6 h.'],postnatal day 6,['Six-day-old C57BL/6 mice were exposed to 3% sevoflurane for 6 h.'],Y,"['Cognitive functions were tested by pavlovian conditioned fear test.', 'Social behavior was tested by social recognition and interaction tests.']",sevoflurane,['Neonatal Exposure to Sevoflurane Induces Abnormal Social Behaviors and Deficits in Fear Conditioning in Mice'],none,[],c57bl/6,['Six-day-old C57BL/6 mice were exposed to 3% sevoflurane for 6 h.'],This study investigates the effects of anesthetics on social behavior and learning disabilities.,['The authors investigated whether exposure of neonatal mice to inhaled sevoflurane causes defi- cits in social behavior as well as learning disabilities.'],None,[],The study shows that exposure of neonatal mice to inhaled sevoflurane could cause learning deficits and abnormal social behaviors resembling autism spectrum disorder.,['This study shows that exposure of neonatal mice to inhaled sevoflurane could cause not only learning def- icits but also abnormal social behaviors resembling autism spectrum disorder.'],The relevance of these mouse findings to the human situation is unknown and requires clarification.,"['However, there is a caveat that the relevance of these mouse findings to the human situation is unknown and requires clarification.']",None,[],True,True,True,True,True,True,10.1097/ALN.0b013e3181974fa2 10.3389/fncel.2017.00373,243.0,Xiao,2017,mice,postnatal day 7,N,propofol,none,c57bl/6,"ORIGINAL RESEARCH published: 22 November 2017 doi: 10.3389/fncel.2017.00373 Propofol Exposure in Early Life Induced Developmental Impairments in the Mouse Cerebellum Rui Xiao 1,2, Dan Yu 1,2, Xin Li 2, Jing Huang 1, Sheng Jing 1, Xiaohang Bao 1, Tiande Yang 1* and Xiaotang Fan 2* 1Department of Anesthesiology, Xinqiao Hospital, Third Military Medical University, Chongqing, China, 2Department of Developmental Neuropsychology, Third Military Medical University, Chongqing, China Edited by: Tycho Hoogland, Erasmus Medical Center, Netherlands Reviewed by: Hiroshi Nishiyama, University of Texas at Austin, United States Karen M. Smith, University of Louisiana at Lafayette, United States Propofol is a widely used anesthetic in the clinic while several studies have demonstrated that propofol exposure may cause neurotoxicity in the developing brain. However, the effects of early propofol exposure on cerebellar development are not well understood. Propofol (30 or 60 mg/kg) was administered to mice on postnatal day (P)7; Purkinje cell dendritogenesis and Bergmann glial cell development were evaluated on P8, and granule neuron migration was analyzed on P10. The results indicated that exposure to propofol on P7 resulted in a significant reduction in calbindin-labeled Purkinje cells and their dendrite length. Furthermore, propofol induced impairments in Bergmann glia development, which might be involved in the delay of granule neuron migration from the external granular layer (EGL) to the internal granular layer (IGL) during P8 to P10 at the 60 mg/kg dosage, but not at the 30 mg/kg dosage. Several reports have suggested that the Notch signaling pathway plays instructive roles in the morphogenesis of Bergmann glia. Here, it was revealed that propofol treatment decreased Jagged1 and Notch1 protein levels in the cerebellum on P8. Taken together, exposure to propofol during the neonatal period impairs Bergmann glia development and may therefore lead to cerebellum development defects. Our results may aid in the understanding of the neurotoxic effects of propofol when administrated to infants. Keywords: propofol, cerebellum, development, neurotoxicity, mouse Correspondence: Tiande Yang 31011@sina.com Xiaotang Fan fanxiaotang2005@163.com Received: 08 September 2017 Accepted: 09 November 2017 Published: 22 November 2017 Citation: Xiao R, Yu D, Li X, Huang J, Jing S, Bao X, Yang T and Fan X (2017) Propofol Exposure in Early Life Induced Developmental Impairments in the Mouse Cerebellum. Front. Cell. Neurosci. 11:373. doi: 10.3389/fncel.2017.00373 INTRODUCTION The cerebellum is characterized by laminated structures, and its abnormal morphogenesis may lead to deficits related to disorders such as Dandy-Walker Malformations, Joubert Syndrome and other congenital spinocerebellar ataxias (Millen and Gleeson, 2008). An increasing number of recent studies have suggested that anesthesia may be neurotoxic to the brain and lead to various long-term behavioral disorders, especially in the infants (Olney et al., 2002; Stargatt et al., 2006; Patel and Sun, 2009; DiMaggio et al., 2011; Reddy, 2012; Sinner et al., 2014). Abbreviations: BLBP, Brain lipid binding protein; BrdU, 5-Bromo-2(cid:48)-deoxyuridine; BSA, Bovine serum albumin; CB, Calbindin; DAPI, 4(cid:48),6-diamidino-2-phenylindole; EGL, External granular layer; GFAP, Glial fibrillary acidic protein; HE, Hematoxylin-eosin; IGL, Internal granular layer; IOD, Integrated optical density; i.p., intraperitoneally; ML, Molecular layer; NC, Nitrocellulose; NeuN, Neuronal nuclei; PBS, Phosphate-buffered saline; PCL, Purkinje cell layer; ROD, Relative optical density; RT, Room temperature. Frontiers in Cellular Neuroscience | www.frontiersin.org 1 November 2017 | Volume 11 | Article 373 Xiao et al. function depends on well-organized neuronal connections and the integration of afferent and efferent fibers into the cerebellar circuitry. The mouse cerebellar cortex has a well-defined architecture consisting of the following three major layers: (1) the molecular layer (ML); (2) the Purkinje cell layer (PCL); and (3) the granule layer (Voogd and Glickstein, 1998). To establish proper lamination and circuitry, important events such as neuronal differentiation, morphogenesis, and migration need to be precisely regulated during cerebellar development (Altman and Winfree, 1977; Buffo and Rossi, 2013). Mouse cerebellar development continues until 3 weeks after birth. During this postnatal period, cerebellar cells undergo sequential development steps in spatially well-defined regions. Purkinje cells are the principal neurons, and are transformed from a stellate morphology into their essential dendritic structures between the first and second weeks (Eccles, 1970; Sotelo and Rossi, 2013). At the early postnatal stage, granule cell precursors are the most abundant in the external granular layer (EGL), followed by an inward radial migration along the Bergmann glial radial fibers to their destination, the internal granule layer (IGL; Komuro et al., 2001; Buffo and Rossi, 2013). By the end of the third postnatal week, the EGL disappeared and three well-defined neuronal layers have formed (Qiu et al., 2010). Proper cerebellar Propofol (6,2 diisopropylphenol) is an anesthetic that works through the activation of gamma amino butyric acid A (GABAA) (NMDA) and block of N-methyl-D-aspartate receptors glutamate receptors (Franks and Lieb, 1994; Irifune et al., 2003). It is widely used in the clinic for induction and maintenance of general anesthesia and conscious sedation, especially in neurosurgery, for its unique benefit on cerebral physiology including reduction in cerebral blood flow, intracranial pressure and cerebral metabolism (Diaz and Kaye, 2017). The increasing utilization of propofol as a drug of abuse is of high concern, and a public health threat, especially for developing fetuses. Studies in rodents have confirmed that propofol exposure caused toxic effects in the developing brain. Consistent with other reports, we previously found that propofol administration during early postnatal life suppressed hippocampal neurogenesis (Huang et al., 2016). Additionally, propofol has been implicated in causing movement disorders since 30 years ago, which strongly suggests that propofol may damage the cerebellum (Dingwall, 1987; Zabani and Vaghadia, 1996; Bendiksen and Larsen, 1998; Brooks, 2008). Recent studies have also indicated that propofol depressed Purkinje cell activity and affected the cerebellum circuitry (Jin R. et al., 2015; Jin W. Z. et al., 2015; Lee K. Y. et al., 2015). However, little is known regarding the impact of propofol exposure on the development of the cerebellar neuronal population. In this study, newborn mice at P7 were administered a single injection of 30 or 60 mg/kg of propofol or vehicle of equal volume to explore the effects of propofol on Purkinje cell dendritogenesis and Bergmann glia development. The migration of newborn granule cells in the EGL was evaluated with a 5-bromodeoxyuridine (BrdU) labeling protocol. As the Notch signaling pathway has been indicated to play crucial roles in the regulation of development of Bergmann Frontiers in Cellular Neuroscience | www.frontiersin.org 2 Propofol and Cerebellar Development its involvement in the underlying mechanism on the glia, neurotoxic effects by propofol during the early stage were also explored. MATERIALS AND METHODS Animals Male and female C57/BL6 mice were provided by the Third Military Medical University and housed under a 12 h light/dark cycle in a temperature-controlled room with free access to food and water. All the experimental procedures were performed in accordance with the guidelines for laboratory animal care and use and were approved by Third Military Medical University. Each litter was kept together with its mother throughout the experiment, except for the brief intervals of separation required for the daily injections. At least five mice in each group were analyzed for immunofluorescence staining and three mice for western blot. Drug Treatment The day of birth was designated postnatal day 0 (P0). On P7, pups injection intraperitoneally (i.p.) at a subanesthetic dose of 30 or 60 mg/kg (Cattano et al., 2008; Yang B. et al., 2014), according to our previous study (Huang et al., 2016). The same volume of intralipid was administered i.p. as a vehicle the neonatal mice were grouped control randomly with a random number table base for similar body weight. received a vehicle or propofol for propofol. All To explore the morphological changes in the Purkinje cells, Bergmann glia and granule neuron, pups were sacrificed 24 h (P8) after drug treatment. To evaluate whether propofol affected the radial migration of the granule neurons, a single-dose BrdU injection (50 mg/kg i.p., dissolved in saline) was administered to the pups at P8, which was 1 day after injection with propofol or vehicle. Pups were sacrificed 2 days after the BrdU injection (P10). To maintain a mouse body temperature of 37◦C, the pups were primitively anesthetized in their home cage and then transferred to a Thermocare(cid:114) ICS therapy warmer unit (Thermocare, Incline Village, NV, USA) after being sedated to keep warm in all the experiments. Meanwhile, mouse normal skin color and respiration were observed. Immunofluorescence The dissected cerebella were soaked in 4% paraformaldehyde for 24 h. For cryosections, the tissues (P8) were embedded and sectioned in the sagittal plane at 30 µm. The remaining tissues (P8) and tissues collected on P10 were embedded in paraffin and sagittal sections (5 µm thickness) were collected. Cryosections were used for all the immunofluorescence staining for P8 and paraffin sections were used for Hematoxylin-eosin (HE) staining and BrdU immunofluorescence staining. The sections were pretreated with 3% bovine serum albumin (BSA) (37◦C, 1 h) to block non-specific binding and 0.3% Triton X-100 (37◦C, 30 min) to increase permeability. Then, the sections were incubated with the following primary antibodies in 1% BSA (4◦C, November 2017 | Volume 11 | Article 373 Xiao et al. 18 h): (1) mouse anti-calbindin D-28K (CB) (1:1000, Swant, Bellinzona, Switzerland); (2) rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (1:200, Merck Millipore, Darmstadt, Germany); (3) rabbit polyclonal anti-brain lipid binding protein (BLBP) (1:400, Merck Millipore, Darmstadt, Germany); and (4) mouse anti-neuronal nuclei (NeuN) (1:200, Merck Millipore, Darmstadt, Germany). One percent BSA served as the negative control. After three washing steps with phosphate-buffered saline (PBS, pH 7.4), the sections were incubated with the following secondary antibodies in PBS (room temperature (RT), 3 h): (1) Alexa Fluor 488-conjugated anti-mouse IgG (1:400, Jackson ImmunoResearch, West Grove, PA, USA) for CB and NeuN staining; and (2) cy3-conjugated anti-rabbit IgG (1:400, Jackson ImmunoResearch, West Grove, PA, USA) for BLBP and GFAP staining. All the sections were counterstained with 4(cid:48),6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St. Louis, MO, USA) and then mounted in Vectashield (Vector Laboratories, Burlingame, CA, USA). For BrdU staining, the paraffin sections were deparaffinized in xylene, rehydrated in graded alcohol and processed for antigen retrieval by boiling in citrate buffer (pH 6.0) for 5 min. After incubation in 2 M HCl (37◦C, 30 min) and 0.3% Triton X-100 (37◦C, the sections were exposed to mouse anti-BrdU 30 min), IgG (37◦C for 2 h and then RT for 22 h) (1:600, BD PharmingenTM, Palo Alto, CA, USA) in 1% BSA, followed by the cy3-conjugated anti-mouse IgG secondary antibody (RT, 3 h) (1:400, Jackson ImmunoResearch, West Grove, PA, USA) and DAPI counterstaining. Fluorescence micrographs of the whole parasagittal cerebellar slices were acquired under a Zeiss (Oberkochen, Germany) Axiovert microscope equipped with a Zeiss AxioCam digital color camera connected to the Zeiss Axiovision 3.0 system. The pictures of the Purkinje dendrite and Bergmann fiber contact points were taken with a TCS-SP8 (Leica, Germany) laser scanning confocal microscope connected to a LAS AF Lite system. A z-stack of images, consisting of 6 image planes taken at 1 µm interval was obtained (for a total stack depth of 5 µm). The 5 µm z-stack was taken from the middle of the section to minimize the potential artificial bias. Western Blot Cerebella were harvested on P8 and then isolated and homogenized in ice-cold RIPA Lysis buffer (Beyotime, Shanghai, China). After centrifuging the lysates (15,000× g, 5 min at 4◦C), the protein concentration was calculated using the Bicinchoninic Acid Kit (Beyotime, Shanghai, China). Then, 50 µg of protein from each sample was separated by 10% SDS-polyacrylamide electrophoresis (120 min 80 V) and then transferred to a nitrocellulose (NC) membrane (90 min at 210 mA). The membranes were incubated in 5% fat-free milk in Tris-buffered saline containing 0.1% Tween 20 (3 h at RT). Membranes were then incubated with the following primary antibodies (4◦C, overnight): (1) hamster monoclonal anti-Notch1 (1:500, Santa Cruz Biotechnology, Santa Cruz, CA, USA); (2) rabbit polyclonal anti-Jagged1 (1:500, Santa Cruz Biotechnology, USA); (3) mouse anti- β-actin (1:1000, Cell Cwbio, Beijing, China); and (4) rabbit Frontiers in Cellular Neuroscience | www.frontiersin.org 3 Propofol and Cerebellar Development followed by anti-GAPDH (1:1000, Cell Cwbio, China), the following peroxidase-conjugated secondary antibodies (RT, 2 h): (1) goat anti-mouse IgG (1:1000, Santa Cruz Biotechnology, USA); IgG (1:1000, Santa Cruz Biotechnology, USA); and (3) goat anti-Syrian hamster IgG (1:1000, Santa Cruz Biotechnology, USA). All the bands were exposed to X-ray films (Kodak, Rochester, NY, USA), detected using an enhanced chemiluminescence detection kit IL, USA), and analyzed (Quantity One 4.0; Bio-Rad with the Gel-Pro analyzer Laboratories, Hercules, CA, USA). Quantification of Jagged1 and Notch1 were normalized to the internal reference protein β-actin or GAPDH, and then normalized to the control values. (2) goat anti-rabbit (Pierce, Rockford, Quantification The quantification was obtained from regional analysis of lobe IX. All the sections were taken from similar medial- lateral position within the cerebellum, and each count area was chosen from the same field by the middle of the lobe IX. Calbindin-positive cells were analyzed along the long axis for 500 µm in the middle, and the dendrite length of Purkinje cells was evaluated by measuring the primary dendrite from the soma up to the surface of the ML (three Purkinje dendrites were measured per picture). Number of the NeuN-positive granule neurons were analyzed in the center the IGL in lobe IX along the long axis (unit region of area 2000 µm2). The number of BLBP- and GFAP-positive Bergmann fibers was counted from a 100-µm length in the middle area of lobe IX according to our previous methods (Yamada et al., 2000; Eiraku et al., 2005; Yang Y. et al., 2014). To analyze the astrocytes in the deep white matter, we compared the intensity of the GFAP-positive cells and fibers. Both the background integrated optical density (IOD) and surveyed area (same center area of the white matter from each group) were acquired, and the relative optical density (ROD) was calculated by subtracting the background from the IOD of the positive staining (Bao et al., 2017). Contact points between the calbindin-positive Purkinje cells and GFAP-positive Bergmann fibers were defined as where the tips of growing Purkinje cell dendrites were aligned parallel and attached directly to the rod-like domain of Bergmann fibers, entering the base of the overlying EGL, as previously reported (Yamada et al., 2000; Yamada and Watanabe, 2002; Lordkipanidze and Dunaevsky, 2005). Points were counted per image (212.5-µm length) at the interface between the EGL and ML. Only the yellow dots at the end of the dendrites in the direction of the Bergmann fiber were included, while the crossed ones were excluded in case of false positive. For quantifying granule neuron migration, BrdU-labeled cells were counted in a rectangular box (200 µm width and about 100 cells were counted) extending from the pial surface to the end of the IGL; this value was expressed as a percentage of the total number of BrdU-labeled cells. At least five sections were analyzed in each mouse and five mice from each group. All the quantitative statistics were performed blind to the experimental treatment. November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 1 | Propofol treatment did not alter the formation of the cerebellum at P8. (A–C) The folia structure of the cerebellum at P8 is revealed by Hematoxylin-eosin (HE) staining. (D–F) Magnifications of panels (A–C) show the structure of lobe IX. (G–I) Magnified of the area identified by the black boxes in panels (E–H) show the external granular layer (EGL), molecular layer (ML) and internal granule layer (IGL) of lobe lobe IX. (J) Propofol treatment did not alter the morphologies or cerebellar areas at P8 between the groups. (K) Comparison of relatively identical areas from lobe IX show no obvious differences in the thickness of the EGL at P8 between the groups. Data are presented as the mean ± SD (n = 4). Scale bar: (A–C): 500 µm; (D–F): 100 µm; and (G–I): 25 µm. Statistical Analysis All the data were presented as the mean ± standard deviation and analyzed using one-way analysis of variance (ANOVA) followed by Fisher’s protected least- significant difference post hoc test or a least-significant difference multiple-comparison. The differences were statistically significant when the P value was less than 0.05. Statistical analysis was performed using the SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). RESULTS Propofol Treatment Does Not Alter Cerebellum Formation Folia structure revealed by the HE staining on the sagittal vermal sections from the cerebellum was similar in all groups at P8 (Figures 1A–I). There were no significant alterations in the areas (Vehicle 1.94 ± 0.10 mm2, Pro 30 mg/kg or Frontiers in Cellular Neuroscience | www.frontiersin.org 4 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 2 | Propofol treatment decreased the number of Purkinje cells and depressed the dendrite length at P8. (A–C) Calbindin-stained cerebellar Purkinje cells from the (A) Vehicle, (B) Propofol (30 mg/kg) and (C) Propofol (60 mg/kg) groups. (D–F) Magnified images of Panels (A–C) show the calbindin-positive cells and their dendrites in lobe IX. (G) Quantification of the number of calbindin-positive cells in the purkinje cell layer (PCL). (H) Quantification of the primary Purkinje dendrite length. Data are presented as the mean ± SD (n = 5). Scale bar: (A–C): 200 µm and (D–F): 50 µm. ∗P < 0.05. 60 mg/kg 1.98 ± 0.24 mm2 or 2.00 ± 0.21 mm2, respectively, P > 0.05; n = 4; Figure 1J). In the same area of lobe IX (Figures 1D–F), EGL thickness was not altered by propofol treatment (Vehicle 31.39 ± 2.46 µm; Pro 30 mg/kg or 60 mg/kg 31.48 ± 2.08 µm or 33.75 ± 1.69 µm, respectively, P > 0.05; n = 4; Figure 1K). 30 mg/kg propofol and pups treated with vehicle. However, pups treated with 60 mg/kg propofol had decreased calbindin- positive cells compared to the pups treated with vehicle (Vehicle 22.04 ± 1.69 and Pro 60 mg/kg 19.20 ± 1.00, P < 0.05; n = 5; Figure 2G). The Purkinje dendrite length was also shortened by 60 mg/kg propofol treatment (Vehicle 74.33 ± 18.77 µm and Pro 60 mg/kg 50.85 ± 8.12 µm, P < 0.05; n = 5; Figure 2H). Propofol Treatment Decreases the Number of and Dendrite Outgrowth from Purkinje Cells in a Dose-Dependent Manner Purkinje cells were revealed by their specific marker calbindin. In comparably identical middle areas from lobe IX in the cerebellum (Figures 2A–F), there was no significant difference in the number of calbindin-positive cells (Figure 2G) and the Purkinje dendrite length (Figure 2H) between the pups treated with Propofol Treatment Does Not Alter NeuN-Positive Granule Neurons in the IGL NeuN is a specific marker for granule neurons located in the IGL of the cerebellum. In comparably center areas of the IGL from lobe IX in the cerebellum (Figures 3A–F), propofol treatment at both doses of 30 mg/kg and 60 mg/kg did not alter the number Frontiers in Cellular Neuroscience | www.frontiersin.org 5 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 3 | Propofol treatment did not affect the NeuN-positive cells in the IGL at P8. (A–C) NeuN-stained cerebellar granule neurons from the (A) Vehicle, (B) Propofol (30 mg/kg) and (C) Propofol (60 mg/kg) groups. (D–F) Magnified images of panels (A–C) show the NeuN-positive cells in lobe IX. (G) Quantification of the NeuN positive cells in the IGL. Data are presented as the mean ± SD (n = 5). Scale bar: (A–C): 200 µm and (D–F): 50 µm. of NeuN-positive cells in the IGL when compared to vehicle treatment (Vehicle 20.08 ± 1.25, Pro 30 mg/kg or 60 mg/kg 20.96 ± 1.45 or 19.56 ± 1.44, respectively, P > 0.05; n = 5; Figure 3G). Propofol Treatment Suppresses Bergmann Glial Cell Filiform Processes and Affects the Astrocyte Phenotype Bergmann glia was a specialized form of astrocyte, derived from radial glial cells (Xu et al., 2013). During the first week of postnatal development, Bergmann glia were located among Purkinje cells and extended fibers into the ML directing the distal growth of the Purkinje cell dendritic tree (Voogd and Glickstein, 1998; Yamada and Watanabe, 2002). To determine whether propofol treatment affected Bergmann glial shafts, we observed Bergmann glial organizational structure in lobe IX of the cerebellum through immunostaining assays with specific antibodies for BLBP and GFAP. The radial from the BLBP-positive Bergmann fibers were processes found to extend to the surface of the cerebellum, and BLBP-positive Bergmann soma aligned roughly in a single layer next to Purkinje cells (Figures 4A–C). The BLBP-stained treatment radial fibers were decreased following propofol Frontiers in Cellular Neuroscience | www.frontiersin.org 6 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 4 | Propofol treatment suppressed Bergmann glial cell filiform processes at P8. (A–C) Brain lipid binding protein (BLBP)-stained Bergmann glia fibers in lobe IX from the (A) Vehicle, (B) Propofol (30 mg/kg) and (C) Propofol (60 mg/kg) groups. (D–F) Glial fibrillary acidic protein (GFAP)-stained Bergmann glia fibers in lobe IX from the (D) Vehicle, (E) Propofol (30 mg/kg) and (F) Propofol (60 mg/kg) groups. (G) Quantification of the number of BLBP-positive fibers in the ML. (H) Quantification of the number of GFAP-positive fibers in the ML. (I) Quantification of the optical density of GFAP-positive staining in the white matter. Data are presented as the mean ± SD (n = 5). Scale bar: (A–F): 50 µm. ∗P < 0.05 and ∗∗P < 0.01. (30 or 60 mg/kg) compared with the vehicle-treated group (Figure 4G). Bergmann glial morphology was further assessed by immunostaining histological sections of the cerebella with antibodies directed at GFAP (Figures 4D–F). There were no significant differences in the GFAP-labeled Bergmann glial processes between the propofol (30 mg/kg)-treated and vehicle-treated groups, whereas the number of radial shafts was significantly decreased after propofol administration at the 60 mg/kg dose; and the images displayed hyperplastic astrocytes in the deep white matter (Figures 4H,I). The results showed that propofol promoted a great disturbance in radial glia phenotypic differentiation and Bergmann glia filiform processes that influenced the formation of the radial scaffold. defined as dendritic tips in parallel and closely stuck to the Bergmann glia fibers at the interface between the ML and EGL (Figures 5J–L). Immunolabeling for calbindin-positive dendrites and GFAP-positive fibers revealed that the number of contact points was significantly decreased due to the high propofol treatment at 60 mg/kg compared with the vehicle- treated group (Vehicle 19.50 ± 1.40 and Pro 60 mg/kg 16.58 ± 0.90, P < 0.01; n = 5; Figures 5J–M). The number of contact points was not affected after administration of 30 mg/kg propofol to the mice. Arrows showed the tips of calbindin-immunopositive dendrites are intimately attached to the rod-like shaft of Bergmann fiber contacting domains. These data indicated that the attachments of the Purkinje cells on Bergmann fibers were disrupted after propofol injection, which subsequently resulted in Purkinje cell dendritogenesis disorder. Propofol Treatment Disrupts the Contacts between Purkinje Cells and Bergmann Glial Cells Purkinje cells make contacts with Bergmann glia through the connections between Purkinje cell dendrites and Bergmann glia fibers in the ML (Figures 5A–I). Connections were Propofol Treatment Delays the Migration of Granule Neurons from the EGL to IGL HE staining on sagittal vermal sections from the cerebellum was used to analyze the folia structure of the cerebellum at Frontiers in Cellular Neuroscience | www.frontiersin.org 7 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 5 | Propofol treatment disrupted the contacts between Purkinje cells and Bergmann glial cells at P8. (A–L) Immunolabeling for calbindin (green), GFAP (red), 4(cid:48),6-diamidino-2-phenylindole (DAPI) (blue), their merged images and respective high-resolution images of the merges in the cerebellar lobe IX. (A–C) Calbindin-stained Purkinje cells from the (A) Vehicle, (B) Propofol (30 mg/kg) and (C) Propofol (60 mg/kg) groups. (D–F) GFAP-stained Bergmann glial cell fibers from the (D) Vehicle, (E) Propofol (30 mg/kg) and (F) Propofol (60 mg/kg) groups. (G–I) The merged images showing the calbindin staining, GFAP staining and DAPI in the PCL. (J–L) Magnified images of panels (G–I) show the relationship between the calbindin-positive cells and GFAP-positive cells. The arrows indicate that the tips of calbindin-immunopositive dendrites are intimately attached to the rod-like shaft of Bergmann fiber contacting domains (M) Quantification of the numbers of contact points between the GFAP-positive fibers and calbindin-positive cells around the border between the ML and EGL in the identical lobe of the cerebellum. Data are presented as the mean ± SD (n = 5). Scale bar: (A–I): 50 µm and (J–L): 25 µm. ∗∗P < 0.01. Frontiers in Cellular Neuroscience | www.frontiersin.org 8 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 6 | Propofol treatment increased the thickness of the EGL at P10. (A–C) The folia structure of the cerebellum is revealed by HE staining from the (A) Vehicle, (B) Propofol (30 mg/kg) and (C) Propofol (60 mg/kg) groups. (D–F) Magnified images of panels (A–C) show the structure of lobe IX. (G–I) Magnified areas identified by the black boxes in panels (D–F) show the EGL, ML and IGL, respectively, from lobe IX. (J) Propofol treatment did not alter the morphology or cerebellar area at P10 between the groups. (K) Comparison of relatively identical areas from lobe IX show that propofol treatment increases the thickness of the EGL at P10 compared with the vehicle-treated mice. Data are presented as the mean ± SD (n = 5). Scale bar: (A–C): 500 µm, (D–F): 100 µm, and (G–I): 25 µm. ∗∗P < 0.01. P10 in all the groups (Figures 6A–I). Propofol treatment did not alter the area size at P10 (Vehicle 2.84 ± 0.35 mm2; Pro 30 or 60 mg/kg 2.91 ± 0.33 mm2 or 2.89 ± 0.14 mm2, respectively, P > 0.05; n = 5; Figure 6J). In identical areas of lobe IX (Figures 6D–F), propofol treatment at both 30 and 60 mg/kg increased the thickness of the EGL compared with Frontiers in Cellular Neuroscience | www.frontiersin.org 9 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 7 | Propofol treatment suppressed the radial migration of the granule neurons from the EGL to IGL. Granule neurons were labeled with BrdU in vivo at P8 and the cerebella were harvested at P10 (A–C). Sections were counterstained with DAPI (blue). (D) Quantification of the percentage of BrdU-positive cells in EGL, ML, or IGL to the total BrdU-positive cells at P10. (E) Quantification of the total number of BrdU-positive cells in EGL, ML and IGL at P10. Data are presented as the mean ± SD (n = 5). Scale bar: (A–C): 50 µm. ∗P < 0.05 and ∗∗P < 0.01. the vehicle-treated group (Vehicle 30.66 ± 0.96 µm; Pro 30 or 60 mg/kg 34.06 ± 1.27 µm or 34.73 ± 0.43 µm, respectively, P < 0.01; n = 5; Figures 6G–I,K). the post-mitotic cells in the EGL migrate to their destination in the IGL. The correct positioning of these cells is essential for the final cytoarchitecture and in particular for the three well-defined laminations. It has been suggested that Bergmann glial provided the scaffold for granule neuron migration (Buffo and Rossi, 2013; Xu et al., 2013). BrdU birthdating was used to evaluate the effect of propofol on further granule neuron migration. At P10, the total number of BrdU positive cells was not changed by Propofol treatment (Vehicle 99.05 ± 14.77; Pro 30 or 60 mg/kg 107.40 ± 12.05 or 94.03 ± 16.26, respectively, P > 0.05; n = 5; Figure 7E) and there was no significant difference in the percent of BrdU-positive cells in the ML in the propofol-treated mice compared to the vehicle-treated mice (Figures 7A–C). While the statistical analysis revealed that propofol treatment (30 or 60 mg/kg) increased the percent of BrdU-positive cells in the EGL by 3% or 7.3%, respectively, compared to the vehicle-treated group (Figure 7D). Meanwhile, the percentage of BrdU-positive cells in the IGL was also decreased significantly by propofol treatment (60 mg/kg) compared with the vehicle- treated mice; in contrast, there were no changes due to propofol administration at the 30 mg/kg dosage (Figure 7D). These results indicate that propofol treatment did not suppress the proliferation, but the migration of granule neurons from the EGL to IGL. During postnatal development of the cerebellum, Propofol Treatment Down-Regulates the Jagged1/Notch Pathway in the Cerebellum It has been reported that BLBP protein is a direct target of Notch signaling (Anthony et al., 2005) and active Notch1 signaling is involved in radial fiber formation of Bergmann glia (Xu et al., 2013). The loss of Jagged1, a ligand for Notch signaling, induced a reduction in the number of Bergmann glia cells and affected their morphology (Tanaka and Marunouchi, 2003; Weller et al., 2006). We found that Jagged1 and Notch1 levels were considerably decreased in the the cerebella at P8 following exposure to propofol at 30 mg/kg dose compared to vehicle treatment; a further reduction was detected after treatment with the 60 mg/kg dose (Figure 8A). Quantitative analysis showed that propofol treatment (30 or 60 mg/kg) decreased Jagged1 expression by 20% or 32%, respectively, compared with the vehicle-treated group (Figure 8B); Notch1 protein levels were decreased by 22% and 45%, respectively (Figure 8C). These results suggested that propofol impaired the morphogenesis and phenotypic differentiation of Bergmann glia, potentially via Jagged1/Notch1 signaling. DISCUSSION In this study, we studied the effects of propofol exposure on cerebellar development during early life. Our results demonstrated that a single injection of propofol at a dosage Frontiers in Cellular Neuroscience | www.frontiersin.org 10 November 2017 | Volume 11 | Article 373 Xiao et al. Propofol and Cerebellar Development FIGURE 8 | Propofol treatment induced down-regulation of the Jagged1/Notch pathway in the cerebellum at P8. (A) Representative western blotting for the Jagged1 and Notch1 proteins from the cerebella in each group. (B) Densitometric quantification of Jagged1. Jagged1 protein levels in the Propofol (30 mg/kg)- and Propofol (60 mg/kg)-treated groups were significantly lower than in the vehicle-treated group. (C) Densitometric quantification of Notch. Notch1 protein levels in the Propofol (30 mg/kg)- and Propofol (60 mg/kg)-treated groups were significantly lower than in the vehicle-treated group. ∗P < 0.05 and ∗∗P < 0.01. of 60 mg/kg led to reduced Purkinje cell dendritogenesis, cells migration, and suppressed radial retarded granule glia phenotypic differentiation to Bergmann glia cells. The unbalanced transformational process demonstrated by decreased glial fibers in the ML and increased GFAP-positive astrocytes in the white matter may be due to inhibition of Notch signaling. Propofol at a lower dose of 30 mg/kg resulted in a less pronounced interruption in cerebellar development, with no significant influences on Purkinje cell morphogenesis. Purkinje neurons are GABAergic neurons and considered the sole output neuron in the to grow postnatally. As circuit, Purkinje neurons are also the major cerebellar cell group that integrate motor coordination and learning (Van Der Giessen et al., 2008; Lee R. X. et al., 2015). In rodents, Purkinje neurons exhibit cytoarchitectural changes characterized by highly branched dendritic trees during first 2 weeks after birth (Tanaka, 2009). Our previous studies together with other reports have demonstrated that Purkinje neurons are extremely vulnerable to the neurotoxic effects of EtOH exposure during the early postnatal period (Yang Y. et al., 2014). Emerging evidence has found that propofol administration to neonatal animals caused significant loss in the hippocampus (Han et al., 2015; Huang cell et al., 2016), a typical laminated structure development investigation, we demonstrated that postnatally. propofol exposure significantly decreased Purkinje neurons as assessed by calbindin in the cerebellum at P8 in a dose-dependent manner. We further confirmed that propofol reduced administration into neonatal mice the length of cerebellar Purkinje neuron dendrites in a dose-dependent manner. Taken together, these results indicated that propofol treatment impaired dendritic growth in Purkinje neurons. In this significantly Bergmann glia, which are normally located in the PCL, extend radial fibers stretching from the cell body towards the pial surface. The radial glial cells originate from the ventricular neuroepithelium (VN), migrate and differentiate to Frontiers in Cellular Neuroscience | www.frontiersin.org 11 November 2017 | Volume 11 | Article 373 Xiao et al. all cerebellar glia, including the Bergmann glia, a specialized subtype of the astrocyte (Buffo and Rossi, 2013). It has been indicated that Bergmann glial cells are arranged around the cell bodies of Purkinje neurons at P8 (Xu et al., 2013). Both BLBP and GFAP are specific markers for Bergmann glia, and immunofluorescence staining showed that the number of Bergmann glial fibers in mice exposed to propofol was significantly decreased and that the radial fibers could not extend to the pial surface. Moreover, GFAP-positive, star-shaped astrocytes were increased in the IGL and deep white matter of the cerebella after propofol treatment at the 60 mg/kg dose. These data implied that propofol might accelerate the transformation of radial glial cells into astrocytic phenotype, with star-shaped bushy processes, rather than Bergmann glia with filiform processes. Indeed, Bergmann glia extend long radial fibers in synchrony with the growth of Purkinje cell dendrites during postnatal development. Thus, Bergmann glial fibers may specifically contribute to Purkinje cell dendrite development (Bellamy, 2006). Recent studies indicated that Bergmann fibers enwrapped the synapses in parallel and climbing fibers interact with Purkinje cells affecting Purkinje cell dendrite arborization (Yamada et al., 2000; Lordkipanidze and Dunaevsky, 2005). Consistent with previous reports, we noticed that suppressed Bergmann glial cell filiform processes and their alignment from propofol exposure led to decreased attachments between Purkinje cell dendritic tips and glial fibers loss fibers. Hence, might contribute to propofol-induced suppressed Purkinje cell dendritogenesis. it inferred that Bergmann glial laminated postnatal cerebellar cortex structures is achieved through the directional migration of committed granule neurons along the Bergmann glial radial fibers from the EGL to their destination in the IGL (Sillitoe and Joyner, 2007; Qiu et al., 2010). The intimate structural associations between granule neurons and Bergmann glial fibers are crucial for granule neuron migration. Moreover, several abnormalities in the Bergmann glial fiber radial scaffold structure have been shown to cause granule cell migration alterations (Shetty et al., 1994; Qu and Smith, 2005; Yue et al., 2005; Lin et al., 2009; Nguyen et al., 2013). Propofol induced a thicker EGL and increased number of granule cells remaining in the EGL, which suggested that granule cell migration was retarded. We found that granule cell migration from the EGL to IGL was markedly suppressed by using BrdU birthdating. The lower efficiency of migration could be due to physical impediments to the Bergmann fibers. It is also possible that some granule neurons migrate normally along adequate fibers; hence, only a subpopulation is dramatically retarded in their migration. The creation of several transcription factors and nuclear receptors (Xu et al., 2013). It has been reported that the Notch signaling pathway was an important factor involved in Bergmann glial differentiation and maturation (Lutolf et al., 2002; Tanaka and Marunouchi, 2003). Additionally, the Notch signaling pathway regulates early events in radial formation through direct cell-cell contacts and is necessary for neuronal-induced radial glia formation (Weinmaster, 1997; Gaiano et al., 2000). An in vitro study has Bergmann glia development is regulated by Frontiers in Cellular Neuroscience | www.frontiersin.org 12 Propofol and Cerebellar Development confirmed that Notch pathway activation induced cerebellar astroglia to adopt radial glia morphologies (Patten et al., 2003). Many studies have demonstrated that Notch or Jagged ablation in mice promoted a reduced number of Bergmann glia and abnormal Bergmann processes, which led to further deceleration of granule cell migration and impaired Purkinje cell development (Lutolf et al., 2002; Weller et al., 2006; Komine et al., 2007). In this study, we found that both Notch1 and Jagged1 levels were decreased by propofol treatment, even at the low dose, indicating that the Notch signaling pathway was active early in the inhibition of Bergmann glia development induced by propofol exposure. It has been raised that mechanism of propofol toxicity in immature neurons was GABAergic via the GABAA receptor (Kahraman et al., 2008). GABAA receptor is widely distributing in the cerebellum, including granule cells, Bergmann cells, Purkinje cells, stellate/basket cells and so on (Laurie et al., 1992). What’s more, the GABAA receptors in Bergmann glia express more in the early development period and then decrease in the adulthood (Müller et al., 1994). It highly matches the enhanced activity of Bergmann glia in granule cell migration and synapse formation or remodeling in the early time. Riquelme et al. (2002) found 50% of the Purkinje dendritic spines with the neuronal GABAA receptors were wrapped by Bergmann glia fibers contained GABAA receptors. Ango et al. (2008) further confirmed the dendritic-targeting GABAergic stellate axons are guided to Purkinje dendrites by the Bergmann fibers scaffold and crucial in the physiological control of synaptic integration in postsynaptic neurons. GABAA receptor indeed plays an important role in Bergmann glia function. Therefore, the influence of propofol on Bergmann glia or the whole cerebellum via GABAA receptor deserved more consideration, and the relationship between GABAA receptor and Notch pathway needed to be further explored. In conclusion, our data indicate that propofol treatment during the early postnatal time significantly impaired Bergmann glial cell development and filiform processes, and led to and granule inhibition of Purkinje cells migration afterwards. This the that cerebellum is sensitive to neurotoxicity induced by high doses of propofol. These findings suggest that propofol used in neonates or young children should be monitored more carefully. cell morphogenesis study indicates AUTHOR CONTRIBUTIONS RX and DY conducted the experiments, collected and analyzed the data and drafted the manuscript; XL, JH, SJ and XB contributed to acquisition and analysis of data; TY and XF designed the experiments, supervised the project and revised the manuscript. ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (No. 81371197). November 2017 | Volume 11 | Article 373 Xiao et al. REFERENCES Altman, J., and Winfree, A. T. (1977). Postnatal development of the cerebellar cortex in the rat. V. Spatial organization of purkinje cell perikarya. J. Comp. Neurol. 171, 1–16. doi: 10.1002/cne.901710102 Ango, F., Wu, C., Van der Want, J., Wu, P., Schachner, M., and J. Huang, Z. J. (2008). Bergmann glia and the recognition molecule CHL1 organize GABAergic axons and direct innervation of Purkinje cell dendrites. PLoS Biol. 6:e103. doi: 10.1371/journal.pbio.0060103 Anthony, T. E., Mason, H. A., Gridley, T., Fishell, G., and Heintz, N. (2005). Brain lipid-binding protein is a direct target of Notch signaling in radial glial cells. Genes Dev. 19, 1028–1033. doi: 10.1101/gad.1302105 Bao, X., Cai, Y., Wang, Y., Zhao, J., He, X., Yu, D., et al. (2017). Liver X receptor β is involved in formalin-induced spontaneous pain. Mol. Neurobiol. 54, 1467–1481. doi: 10.1007/s12035-016-9737-1 Bellamy, T. C. (2006). Interactions between Purkinje neurones and Bergmann glia. Cerebellum 5, 116–126. doi: 10.1080/14734220600724569 Bendiksen, A., and Larsen, L. M. (1998). Convulsions, ataxia and hallucinations following propofol. Acta Anaesthesiol. Scand. 42, 739–741. doi: 10.1111/j.1399- 6576.1998.tb05312.x Brooks, D. E. (2008). Propofol-induced movement disorders. Ann. Emerg. Med. 51, 111–112. doi: 10.1016/j.annemergmed.2007.08.023 Buffo, A., and Rossi, F. (2013). Origin, lineage and function of cerebellar glia. Prog. Neurobiol. 109, 42–63. doi: 10.1016/j.pneurobio.2013.08.001 Cattano, D., Young, C., Straiko, M. M., and Olney, J. W. (2008). Subanesthetic doses of propofol induce neuroapoptosis in the infant mouse brain. Anesth. Analg. 106, 1712–1714. doi: 10.1213/ane.0b013e318172ba0a Diaz, J. H., and Kaye, A. D. (2017). Death by propofol. J. La. State Med. Soc. 169, 28–32. DiMaggio, C., Sun, L. S., and Li, G. (2011). Early childhood exposure to anesthesia and risk of developmental and behavioral disorders in a sibling birth cohort. Anesth. Analg. 113, 1143–1151. doi: 10.1213/ANE.0b013e3182147f42 Dingwall, A. E. (1987). Oculogyric crisis after day case anaesthesia. Anaesthesia 42:565. doi: 10.1111/j.1365-2044.1987.tb04081.x Eccles, J. C. (1970). Neurogenesis and morphogenesis in the cerebellar cortex. Proc. Natl. Acad. Sci. U S A 66, 294–301. doi: 10.1073/pnas.66.2.294 Eiraku, M., Tohgo, A., Ono, K., Kaneko, M., Fujishima, K., Hirano, T., et al. (2005). DNER acts as a neuron-specific Notch ligand during Bergmann glial development. Nat. Neurosci. 8, 873–880. doi: 10.1038/nn1492 Franks, N. P., and Lieb, W. R. (1994). Molecular and cellular mechanisms of general anaesthesia. Nature 367, 607–614. doi: 10.1038/367607a0 (2000). Radial glial Gaiano, N., Nye, identity is promoted by Notch1 signaling in the murine forebrain. Neuron 26, 395–404. doi: 10.1016/s0896-6273(00)81172-1 J. S., and Fishell, G. Han, D., Jin, J., Fang, H., and Xu, G. (2015). Long-term action of propofol on cognitive function and hippocampal neuroapoptosis in neonatal rats. Int. J. Clin. Exp. Med. 8, 10696–10704. Huang, Jing, S., Chen, X., Bao, X., Du, Z., Li, H., et al. (2016). Propofol administration during early postnatal life suppresses hippocampal neurogenesis. Mol. Neurobiol. 53, 1031–1044. doi: 10.1007/s12035-014-9052-7 Irifune, M., Takarada, T., Shimizu, Y., Endo, C., Katayama, S., Dohi, T., et al. (2003). Propofol-induced anesthesia in mice is mediated by γ-aminobutyric acid-A and excitatory amino acid receptors. Anesth. Analg. 97, 424–429. doi: 10.1213/01.ane.0000059742.62646.40 J., Jin, R., Liu, H., Jin, W. Z., Shi, J. D., Jin, Q. H., Chu, C. P., et al. (2015). Propofol depresses cerebellar Purkinje cell activity via activation of GABAA and glycine receptors in vivo in mice. Eur. J. Pharmacol. 764, 87–93. doi: 10.1016/j.ejphar. 2015.06.052 Jin, W. Z., Shi, J. D., Liu, H., Lan, Y., Chu, C. P., and Qiu, D. L. (2015). Effects of propofol on the dynamic properties of sensory information processing in the mouse cerebellar cortical molecular layer in vivo. Pharmacology 96, 271–277. doi: 10.1159/000441006 Kahraman, S., Zup, S. L., McCarthy, M. M., and Fiskum, G. (2008). GABAergic mechanism of propofol toxicity in immature neurons. J. Neurosurg. Anesthesiol. 20, 233–240. doi: 10.1097/ANA.0b013e31817ec34d Komine, O., Nagaoka, M., Watase, K., Gutmann, D. H., Tanigaki, K., Honjo, T., et al. (2007). The monolayer formation of Bergmann glial cells is regulated Frontiers in Cellular Neuroscience | www.frontiersin.org 13 Propofol and Cerebellar Development by Notch/RBP-J signaling. Dev. Biol. 311, 238–250. doi: 10.1016/j.ydbio.2007. 08.042 Komuro, H., Yacubova, E., Yacubova, E., and Rakic, P. (2001). Mode and tempo of tangential cell migration in the cerebellar external granular layer. J. Neurosci. 21, 527–540. Laurie, D. J., Seeburg, P. H., and Wisden, W. (1992). The distribution of 13 GABAA receptor subunit mRNAs in the rat brain. II. Olfactory bulb and cerebellum. J. Neurosci. 12, 1063–1076. Lee, R. X., Huang, J. J., Huang, C., Tsai, M. L., and Yen, C. T. (2015). Plasticity of cerebellar Purkinje cells in behavioral training of body balance control. Front. Syst. Neurosci. 9:113. doi: 10.3389/fnsys.2015.00113 Lee, K. Y., Kim, Y. I., Kim, S. H., Park, H. S., Park, Y. J., Ha, M. S., et al. (2015). Propofol effects on cerebellar long-term depression. Neurosci. Lett. 609, 18–22. doi: 10.1016/j.neulet.2015.09.037 Lin, Y., Chen, L., Lin, C., Luo, Y., Tsai, R. Y., and Wang, F. (2009). Neuron- derived FGF9 is essential for scaffold formation of Bergmann radial fibers and migration of granule neurons in the cerebellum. Dev. Biol. 329, 44–54. doi: 10.1016/j.ydbio.2009.02.011 Lordkipanidze, T., and Dunaevsky, A. (2005). Purkinje cell dendrites grow in alignment with Bergmann glia. Glia 51, 229–234. doi: 10.1002/glia.20200 Lutolf, S., Radtke, F., Aguet, M., Suter, U., and Taylor, V. (2002). Notch1 is required for neuronal and glial differentiation in the cerebellum. Development 129, 373–385. Millen, K. J., and Gleeson, J. G. (2008). Cerebellar development and disease. Curr. Opin. Neurobiol. 18, 12–19. doi: 10.1016/j.conb.2008.05.010 J. M., Grosche, Müller, T., Fritschy, J., Pratt, G. D., Möhler, H., and Kettenmann, H. (1994). Developmental regulation of voltage-gated K+ channel and GABAA receptor expression in Bergmann glial cells. J. Neurosci. 14, 2503–2514. Nguyen, H., Ostendorf, A. P., Satz, J. S., Westra, S., Ross-Barta, S. E., Campbell, K. P., et al. (2013). Glial scaffold required for cerebellar granule cell migration is dependent on dystroglycan function as a receptor for basement membrane proteins. Acta Neuropathol. Commun. 1:58. doi: 10.1186/2051- 5960-1-58 Olney, J. W., Wozniak, D. F., Jevtovic-Todorovic, V., Farber, N. B., Bittigau, P., and Ikonomidou, C. (2002). Drug-induced apoptotic neurodegeneration in the developing brain. Brain Pathol. 12, 488–498. doi: 10.1111/j.1750-3639.2002. tb00467.x Patel, P., and Sun, L. (2009). Update on neonatal anesthetic neurotoxicity: insight into molecular mechanisms and relevance to humans. Anesthesiology 110, 703–708. doi: 10.1097/ALN.0b013e31819c42a4 Patten, B. A., Peyrin, (2003). Sequential signaling through Notch1 and erbB receptors mediates radial glia differentiation. J. Neurosci. 23, 6132–6140. J. M., Weinmaster, G., and Corfas, G. Qiu, Z., Cang, Y., and Goff, S. P. (2010). Abl family tyrosine kinases are essential for basement membrane integrity and cortical lamination in the cerebellum. J. Neurosci. 30, 14430–14439. doi: 10.1523/JNEUROSCI.2861 -10.2010 Qu, Q., and Smith, F. I. (2005). Neuronal migration defects in cerebellum of the Largemyd mouse are associated with disruptions in Bergmann glia organization and delayed migration of granule neurons. Cerebellum 4, 261–270. doi: 10.1080/14734220500358351 Reddy, S. V. (2012). Effect of general anesthetics on the developing brain. J. Anaesthesiol. Clin. Pharmacol. 28, 6–10. doi: 10.4103/0970-9185.92426 Riquelme, R., Miralles, C. P., and De Blas, A. L. (2002). Bergmann glia GABAA receptors concentrate on the glial processes that wrap inhibitory synapses. J. Neurosci. 22, 10720–10730. Shetty, A. K., Burrows, R. C., Wall, K. A., and Phillips, D. E. (1994). Combined pre- and postnatal ethanol exposure alters the development of Bergmann glia in rat cerebellum. Int. J. Dev. Neurosci. 12, 641–649. doi: 10.1016/0736- 5748(94)90016-7 Sillitoe, R. V., and Joyner, A. L. (2007). Morphology, molecular codes and circuitry produce the three-dimensional complexity of the cerebellum. Annu. Rev. Cell Dev. Biol. 23, 549–577. doi: 10.1146/annurev.cellbio.23.090506.123237 Sinner, B., Becke, K., and Engelhard, K. (2014). General anaesthetics and the developing brain: an overview. Anaesthesia 69, 1009–1022. doi: 10.1111/anae. 12637 November 2017 | Volume 11 | Article 373 Xiao et al. Sotelo, C., and Rossi, F. (2013). ‘‘Purkinje cell migration and differentiation,’’ in Handbook of the Cerebellum and Cerebellar Disorders, eds M. Manto, J. D. Schmahmann, F. Rossi, D. L. Gruol and N. Koibuchi (Dordrecht: Springer Netherlands), 147–178. Stargatt, R., Davidson, A. J., Huang, G. H., Czarnecki, C., Gibson, M. A., Stewart, S. A., et al. (2006). A cohort study of the incidence and risk factors for negative behavior changes in children after general anesthesia. Paediatr. Anaesth. 16, 846–859. doi: 10.1111/j.1460-9592.2006.01869.x Tanaka, M. (2009). Dendrite formation of cerebellar Purkinje cells. Neurochem. Res. 34, 2078–2088. doi: 10.1007/s11064-009-0073-y Tanaka, M., and Marunouchi, T. (2003). Immunohistochemical localization of Notch receptors and their ligands in the postnatally developing rat cerebellum. Neurosci. Lett. 353, 87–90. doi: 10.1016/s0304-3940(03)01068-1 Van Der Giessen, R. S., Koekkoek, S. K., van Dorp, S., De Gruijl, J. R., Cupido, A., Khosrovani, S., et al. (2008). Role of olivary electrical coupling in cerebellar motor learning. Neuron 58, 599–612. doi: 10.1016/j.neuron.2008.03.016 Voogd, J., and Glickstein, M. (1998). The anatomy of the cerebellum. Trends Neurosci. 21, 370–375. doi: 10.1016/S0166-2236(98)01318-6 Weinmaster, G. (1997). The ins and outs of notch signaling. Mol. Cell. Neurosci. 9, 91–102. doi: 10.1006/mcne.1997.0612 Weller, M., Krautler, N., Mantei, N., Suter, U., and Taylor, V. (2006). Jagged1 ablation results in cerebellar granule cell migration defects and depletion of Bergmann glia. Dev. Neurosci. 28, 70–80. doi: 10.1159/000090754 Xu, H., Yang, Y., Tang, X., Zhao, M., Liang, F., Xu, P., et al. (2013). Bergmann glia function in granule cell migration during cerebellum development. Mol. Neurobiol. 47, 833–844. doi: 10.1007/s12035-013-8405-y Yamada, K., Fukaya, M., Shibata, T., Kurihara, H., Tanaka, K., Inoue, Y., et al. (2000). Dynamic transformation of Bergmann glial fibers proceeds in correlation with dendritic outgrowth and synapse formation of cerebellar Purkinje cells. J. Comp. Neurol. 418, 106–120. doi: 10.1002/(sici)1096- 9861(20000228)418:1<106::aid-cne8>3.0.co;2-n Frontiers in Cellular Neuroscience | www.frontiersin.org 14 Propofol and Cerebellar Development Yamada, K., and Watanabe, M. (2002). Cytodifferentiation of Bergmann glia and its relationship with Purkinje cells. Anat. Sci. Int. 77, 94–108. doi: 10.1046/j. 0022-7722.2002.00021.x Yang, B., Liang, G., Khojasteh, S., Wu, Z., Yang, W., Joseph, D., et al. (2014). Comparison of neurodegeneration and cognitive impairment in neonatal mice exposed to propofol or isoflurane. PLoS One 9:e99171. doi: 10.1371/journal. pone.0099171 Yang, Y., Tang, Y., Xing, Y., Zhao, M., Bao, X., Sun, D., et al. (2014). Activation of is protective against ethanol-induced developmental impairment of Bergmann glia and Purkinje neurons in the mouse cerebellum. Mol. Neurobiol. 49, 176–186. doi: 10.1007/s12035-013 -8510-y liver X receptor Yue, Q., Groszer, M., Gil, J. S., Berk, A. J., Messing, A., Wu, H., et al. (2005). PTEN deletion in Bergmann glia leads to premature differentiation and affects laminar organization. Development 132, 3281–3291. doi: 10.1242/dev. 01891 Zabani, I., and Vaghadia, H. (1996). Refractory dystonia during propofol anaesthesia in a patient with torticollis-dystonia disorder. Can. J. Anaesth. 43, 1062–1064. doi: 10.1007/bf03011910 Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Copyright © 2017 Xiao, Yu, Li, Huang, Jing, Bao, Yang and Fan. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. November 2017 | Volume 11 | Article 373",mice,['Propofol (30 or 60 mg/kg) was administered to mice on postnatal day (P)7;'],postnatal day 7,['Propofol (30 or 60 mg/kg) was administered to mice on postnatal day (P)7;'],N,[],propofol,['Propofol (30 or 60 mg/kg) was administered to mice on postnatal day (P)7;'],none,[],c57bl/6,['Animals Male and female C57/BL6 mice were provided by the Third Military Medical University and housed under a 12 h light/dark cycle in a temperature-controlled room with free access to food and water.'],"This study addresses the effects of early propofol exposure on cerebellar development, which is not well understood.","['However, the effects of early propofol exposure on cerebellar development are not well understood.']",None,[],The findings may aid in understanding the neurotoxic effects of propofol when administered to infants.,['Our results may aid in the understanding of the neurotoxic effects of propofol when administrated to infants.'],None,[],None,[],True,True,True,True,True,True,10.3389/fncel.2017.00373 10.1097/ALN.0b013e3182834d5d,268.0,Zheng,2013,mice,gestational day 14,Y,sevoflurane,none,c57bl/6,"N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t NIH Public Access Author Manuscript Anesthesiology. Author manuscript; available in PMC 2014 March 01. Published in final edited form as: Anesthesiology. 2013 March ; 118(3): 516–526. doi:10.1097/ALN.0b013e3182834d5d. Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice Hui Zheng, M.D., Ph.D.1,# [Research fellow], Yuanlin Dong, M.D., M.S.2,# [Senior Research Technologist], Zhipeng Xu, M.D., Ph.D.3 [Research fellow], Gregory Crosby, M.D.4 [Associate Professor], Deborah J. Culley, M.D.5 [Associate Professor], Yiying Zhang, M.D., M.S.6 [Research fellow], and Zhongcong Xie, M.D., Ph.D.7,* [Associate Professor] 1Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine; Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129-2060; Associate Professor, Department of Anesthesiology, Beijing Chest Hospital, Capital Medical University, Beijing, P. R. China 2Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine; Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 3Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 4Department of Anesthesia, Brigham & Women’s Hospital and Harvard Medical School, Boston, Massachusetts 5Department of Anesthesia, Brigham & Women’s Hospital and Harvard Medical School Boston, MA 02115 6Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine; Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 7Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine; Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts Abstract Background—Each year over 75,000 pregnant women in the United States undergo anesthesia care. We set out to assess the effects of anesthetic sevoflurane in pregnant mice on neurotoxicity and learning and memory in fetal and offspring mice. Methods—Pregnant mice (gestation stage day 14) and mouse primary neurons were treated with 2.5% sevoflurane for 2 h and 4.1% sevoflurane for 6 h, respectively. Brain tissues of both fetal and offspring mice (postnatal day 31), and the primary neurons were harvested and subjected to Corresponding author. Zhongcong Xie, M.D., Ph.D., Associate Professor of Anesthesia, Geriatric Anesthesia Research Unit, Department of Anesthesia, Critical Care and Pain Medicine; Massachusetts General Hospital and Harvard Medical School; 149 13th St., Room 4310; Charlestown, MA 02129-2060, (T) 617-724-9308; (F) 617-643-9277; zxie@partners.org. #Hui Zheng and Yuanlin Dong contributed equally to the work. Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Summary Statement: Sevoflurane anesthesia in pregnant mice induced increases in interleukin-6 levels, reductions in synaptic marker postsynaptic density-95 and synaptophysin levels, caspase-3 activation, and learning and memory impairment in fetal and offspring mice. Work attributed to: the Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts General Hospital and Harvard Medical School. N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Western blot and immunhistochemistry to assess interleukin-6, synaptic markers postsynaptic density-95 and synaptophysin, and caspase-3 levels. Separately, learning and memory function in the offspring mice was determined in the Morris Water Maze. Results—Sevoflurane anesthesia in pregnant mice induced caspase-3 activation, increased interleukin-6 levels [256% ± 50.98 (mean ± SD) vs. 100% ± 54.12, P = 0.026], and reduced postsynaptic density-95 (61% ± 13.53 vs. 100% ± 10.08, P = 0.036) and synaptophysin levels in fetal and offspring mice. The sevoflurane anesthesia impaired learning and memory in offspring mice at postnatal day 31. Moreover, interleukin-6 antibody mitigated the sevoflurane-induced reduction in postsynaptic density-95 levels in the neurons. Finally, environmental enrichment attenuated the sevoflurane-induced increases in interleukin-6 levels, reductions of synapse markers, and learning and memory impairment. Conclusion—These results suggest that sevoflurane may induce detrimental effects in fetal and offspring mice, which can be mitigated by environmental enrichment. These findings should promote more studies to determine the neurotoxicity of anesthesia in the developing brain. Introduction Anesthesia neurotoxicity in the developing brain has been investigated in animals and in humans, and has become a major health issue of interest to both the medical community1 and the public2. Anesthesia and surgery may induce neurodevelopment impairment and cognitive dysfunction in children [reviewed in3]. In preclinical studies, anesthesia has been shown to induce neurotoxicity and learning and memory impairment in young animals [4, reviewed in5]. Each year over 75,000 pregnant women in the United States have non-obstetric surgery and fetal intervention procedures under anesthesia6. Anesthesia neurotoxicity in the developing brain could happen in the fetus because: (1) brain development starts as early as the second trimester of pregnancy; (2) anesthesia can induce neurotoxicity in both adult and young mice, and most general anesthetics are lipophilic and thus cross placenta easily; (3) moreover, uterine exposure to ethanol, valproic acid, and anesthetic isoflurane have been shown to induce behavioral abnormalities in adulthood [7, reviewed in8]. It remains largely to be determined, however, whether anesthesia in pregnant mice can induce neurotoxicity in fetal mice (the developing brain), and neurotoxicity and learning and memory impairment in offspring mice after birth. Sevoflurane is currently the most commonly used inhalation anesthetic. Previous studies have shown that anesthesia with 2.5% sevoflurane for 2 h can induce neurotoxicity in the brain tissues of adult (5-month-old) mice without statistically significant alteration in the values of blood pressure and blood gas9. We therefore determined whether the same sevoflurane anesthesia in pregnant mice could induce neurotoxicity and learning and memory impairment in fetal and offspring mice. Finally, we investigated whether environmental enrichment (EE), a complex living milieu that has been shown to improve learning and memory10–12, could ameliorate the sevoflurane anesthesia-induced detrimental effects. Materials and Methods Mice anesthesia The protocol was approved by the Massachusetts General Hospital Standing Committee (Boston, Massachusetts) on the Use of Animals in Research and Teaching. Three month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice. The pregnant mice were identified and then housed individually. The offspring mice Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 2 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. were weaned 21 days after birth. Animals were kept in a temperature-controlled (22 – 23 °C) room under a 12-h light/dark period (light on at 7:00 AM); standard mouse chow and water were available ad libitum. At gestation stage day 14 (G14), the pregnant mice were randomly assigned to an anesthesia or control group. Mice randomized to the anesthesia group received 2.5% sevoflurane in 100% oxygen for 2 h in an anesthetizing chamber. The control group received 100% oxygen at an identical flow rate for 2 h in an identical chamber as described in our previous studies9. The mice breathed spontaneously, and concentrations of anesthetic and oxygen were measured continuously (Ohmeda, Tewksbury, MA). Temperature of the anesthetizing chamber was controlled to maintain rectal temperature of the animals at 37 ± 0.5 °C. Mean arterial blood pressure was not measured in these mice because the same sevoflurane anesthesia was shown not to alter the values of blood pressure and blood gas in our previous studies9. Anesthesia was terminated by discontinuing sevoflurane and placing the animals in a chamber containing 100% oxygen until 20 min after return of the righting reflex. The anesthesia with 2.5% sevoflurane (about 1.1 minimum alveolar concentration) for two hours in mice was employed to demonstrate whether clinically relevant sevoflurane anesthesia in pregnant mice, which had been shown to induce neurotoxicity in adult mice9, could also induce neurotoxicity in fetal mice and then neurobehavioral deficits in offspring mice. Twenty pregnant mice were included in the experiments, which generated a sufficient number of fetal mice for the biochemistry studies (n = 6 per arm), and offspring mice for the biochemistry (n = 6 per arm) and behavioral studies (n = 15 per arm). Our pilot studies showed a mean difference of 1.5 (3 vs. 1.5) in platform crossing times, an standard deviation (SD) of 1.8 in the control group and 1.3 in the anesthesia group. From the pilot study, we also estimated a mean difference of 150% (250% vs. 100%) in IL-6 levels in brain tissues, an SD of 51 in the control group and 54 in the anesthesia group. Assuming this study would have similar effect sizes, a sample size of 6 per arm for the biochemistry studies and a sample size of 15 per arm for the behavioral studies would lead to 90% or larger power to detect the differences using two-sample t-test with 5% type 1 error. Mouse primary neurons The protocol was approved by the Massachusetts General Hospital Standing Committee (Boston, Massachusetts) on the Use of Animals in Research and Teaching. The harvest of neurons was performed as described in our previous studies13,14. Seven to 10 days after harvesting, the neurons were treated with 4.1% sevoflurane for 6 h as described in our previous studies9. The treatment with 4.1% sevoflurane for 6 h was used to determine whether the sevoflurane anesthesia, which can induce cytotoxicity9, could also reduce levels of postsynaptic density-95 (PSD-95), the marker for synapse. The interleukin (IL)-6 antibody (10 µg/ml) was administrated to the neurons one hour before the sevoflurane treatment. The neurons were harvested at the end of the anesthesia and were subjected to Western blot analysis. Brain tissue harvest and protein level quantification Immediately following the sevoflurane anesthesia, we performed a cesarean section to extract the fetal mice and harvested their brain tissues. We also used decapitation to kill postnatal day (P) 31 offspring mice and harvested their brain tissues. Separate groups of mice were used for the Western blot analysis and the immunohistochemistry studies, respectively. For the Western blot analysis, the harvested brain tissues were homogenized on ice using immunoprecipitation buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM ethylenediaminetetraacetic acid, 0.5% Nonidet P-40) plus protease inhibitors (1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A) as described in our previous studies15. The lysates were collected, centrifuged at 12,000 rapid per minute for 15 min, and quantified for total proteins with bicinchoninic acid protein assay kit (Pierce, Iselin, NJ)15. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 3 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Western blot analysis Western blot analysis was performed using the methods described in our previous studies15. Whole cerebral hemispheres were used for Western blot analysis because there would be an insufficient amount of hippocampus tissues from the fetal mice for Western blot analysis. IL-6 antibody (1:1,000 dilution, Abcam, Cambridge, MA) was used to recognize IL-6 (24 kDa). PSD-95 antibody (1:1,000, Cell Signaling, Danvers, MA) was used to detect PSD-95 (95 kDa). A caspase-3 antibody (1:1000 dilution; Cell Signaling Technology) was used to recognize full-length caspase-3 (35 – 40 kDa) and caspase-3 fragment (17–20 kDa) resulting from cleavage at aspartate position 175. Antibody anti-β-Actin (1:10,000, Sigma, St. Louis, MO) was used to detect β-Actin (42 kDa). Western blot quantification was performed as described by Xie et al.16. Briefly, signal intensity was analyzed using a Bio-Rad (Hercules, CA) image program (Quantity One). We quantified the Western blots in two steps, first using β-Actin levels to normalize (e.g., determining the ratio of IL-6 to β-Actin amount) protein levels and control for loading differences in the total protein amount. Second, we presented changes in protein levels in mice or neurons undergoing sevoflurane anesthesia as a percentage of those in the control group. 100% of protein level changes refer to control levels for the purpose of comparison to experimental conditions. The quantification of Western blot was based not only on the images presented in figures, but also the images not presented in the figures in order to have adequate effect size (e.g., n = 6 in biochemistry studies)15. Immunohistochemistry Immunohistochemistry was performed using the methods described in our previous studies17. P31 offspring mice were anesthetized with sevoflurane briefly (2.5% sevoflurane for 4 min) and perfused transcardially with heparinized saline followed by 4% paraformaldehyde in 0.1M phosphate buffer at pH 7.4. The anesthesia with 2.5% sevoflurane for 4 min in mice provided adequate anesthesia for the perfusion procedure without causing statistically significant changes in blood pressure and blood gas according to our previous studies9. Mouse brain tissues were removed and kept at 4 °C in paraformaldehyde. Five µm frozen sections from the mouse brain hemispheres were used for the immunohistochemistry staining17. The sections were incubated with the primary antibody synaptophysin (Sigma, 1:500) dissolved in 1% bovine serum albumin in phosphate buffered saline at 4 °C overnight. The next day, the sections were exposed to secondary antibody [Alexa Fluor 594 goat anti-rabbit IgG (H+L), Invitrogen, Grand Island, NY). Finally, the sections were wet mounted and viewed immediately using a fluorescence microscope (60 X). We used the mouse hippocampus in the studies of immunohistochemistry density quantification to determine whether sevoflurane anesthesia can induce neurotoxicity in the hippocampus. The photos were taken and an investigator who was blind to the experimental design counted the density of synaptophysin using Image J Version 1.38 (National Institutes of Health, Bethesda, MD)17. Morris Water Maze (MWM) A round steel pool, 150 cm in diameter and 60 cm in height, was filled with water to a height of 1.0 cm above the top of a 15-centimeter diameter platform. The pool was covered with a black curtain and was located in an isolated room with four visual cues on the wall of pool. Water was kept at 20 °C and opacified with titanium dioxide. The P31 offspring mice were tested in the MWM four trials per day for 7 days. Each of the mice was put in the pool to search for the platform and the starting points were random for each mouse. When the mouse found the platform, the mouse was allowed to stay on it for 15 s. If a mouse did not find the platform within a 90-s period, the mouse was gently guided to the platform and allowed to stay on it for 15 s. A video tracking system recorded the swimming motions of Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 4 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. the animals, and the data were analyzed using motion-detection software for the MWM (Institute of Materia Medica, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, P.R. China). At the end of the reference training (P37), the platform was removed from the pool and the mouse was placed in the opposite quadrant. Mice were allowed to swim for 90 s and the times the mouse swam to cross the platform area was recorded (platform cross times). Mouse body temperature was maintained by active heating as described by Bianchi et al.18. Specifically, after every trial, each mouse was placed in a holding cage under a heat lamp for 1 to 2 min until dry before returning to its regular cage. Environmental enrichment The EE in the current experiment was created in a large cage (70 × 70 × 46 centimeter) that included 5 – 6 toys (e.g., wheels, ladders, and small mazes) as described in previous studies with modification10,11. The pregnant mice were put in the EE everyday for two hours before delivery. The pregnant mice delivered offspring mice at G21. Then, the mother and the babies were put in the EE again everyday for two hours from P4 to P30. The objects were changed two to three times a week to provide newness and challenge. Statistics The nature of the hypothesis testing was two-tailed. Data were expressed as mean ± SD. The data for platform crossing time were not normally distributed, thus were expressed as median and interquartile range (IQR). The number of samples varied from 6 to 15, and the samples were normally distributed except platform crossing time (tested by normality test, data not shown). Two-way ANOVA was used to determine the interaction of IL-6 antibody and sevoflurane treatment, and interaction of EE and sevoflurane anesthesia. Interaction between time and group factors in a two way ANOVA with repeated measurements was used to analyze the difference of learning curves (based on escape latency) between mice in the control group and mice treated with anesthesia in the MWM. Multiple comparisons in escape latency of MWM were adjusted using Bonferroni method (with 7 tests, and threshold of 0.05/7 = 0.0071) (*). There were no missing data for the variables of MWM (escape latency and platform crossing time) during the data analysis. Student two-sample t-test was used to determine the difference between the sevoflurane and control conditions on levels of IL-6, PSD-95, and synaptophysin. Finally, the Mann-Whitney test was used to determine the difference between the sevoflurane and control conditions on platform crossing times. P values less than 0.05 (*, # and ^) and 0.01 (**, ## and ^^) were considered statistically significant. SAS software version 9.2 (Cary, NC) was used to analyze the data. Results Sevoflurane anesthesia in pregnant mice induced learning and memory impairment in offspring mice The pregnant mice were either treated with 2.5% sevoflurane anesthesia for 2 h or under the control condition at gestation stage day 14 (G14). The mice delivered offspring mice at G21, and the offspring mice were tested in the MWM from P31 to P37. Comparison of the time that each mouse took to reach a platform during reference training (escape latency) showed that there was a statistically significant interaction between time and group based on escape latency in the MWM between mice following the control condition and mice that were given sevoflurane anesthesia (fig. 1A, ^ P = 0.012, two-way ANOVA with repeated measurement). Comparison of the number of times that each mouse crossed the location of an absent platform at the end of reference training (platform crossing times) indicated that there was a non-significant difference in the platform crossing times between the control condition and the sevoflurane anesthesia (fig. 1B, P = 0.051, Mann-Whitney test, Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 5 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. sevoflurane: median = 1 and IQR = 1 to 3 versus control: median = 2 and IQR = 2 to 4.5). There was no statistically significant difference in mouse swimming speed between the sevoflurane anesthesia and the control group (data not shown). Taken together, these data suggest that sevoflurane anesthesia in pregnant mice may induce learning and memory impairment in offspring mice. Sevoflurane anesthesia in pregnant mice induced neurotoxicity in fetal mice Given that the sevoflurane anesthesia in pregnant mice can induce learning and memory impairment in offspring mice, we assessed the effects of sevoflurane anesthesia on the levels of proinflammatory cytokine IL-6, PSD-95, and caspase-3 activation, the neurotoxicity of which may represent underlying mechanisms of learning and memory impairment19–28. The pregnant mice received anesthesia with 2.5% sevoflurane for 2 h or the control condition at G14. We harvested the brain tissues of the fetal mice at the end of the experiment, and these tissues were subjected to Western blot analysis. Immunoblotting of IL-6 showed that the sevoflurane anesthesia induced more visible bands representing IL-6 as compared to the control condition (fig. 2A). There was no statistically significant difference in β-Actin levels between the control condition and the sevoflurane anesthesia. Quantification of the Western blot showed that the sevoflurane anesthesia increased IL-6 levels in the brain tissues of fetal mice as compared to the control condition: 256% ± 50.98 versus 100% ± 54.12, * P = 0.026 (fig. 2B). Next, we investigated the effects of the sevoflurane anesthesia in pregnant mice on levels of PSD-95, the marker of synapse, in the brain tissues of the fetal mice. Immunoblotting of PSD-95 showed that the sevoflurane anesthesia in pregnant mice produced less visible bands representing PSD-95 in the Western blot as compared to the control condition (fig. 2C). Quantification of the Western blot showed that the sevoflurane anesthesia in pregnant mice reduced PSD-95 levels in the brain tissues of fetal mice as compared to the control condition: 61% ± 13.53 versus 100% ± 10.08, * P = 0.036 (fig. 2D). Finally, we assessed effects of the sevoflurane anesthesia in pregnant mice on caspase-3 activation in the brain tissues of fetal mice. Caspase-3 immunoblotting showed that the sevoflurane anesthesia in pregnant mice increased levels of caspase-3 fragment without statistically significant changes in the levels of FL caspase-3 in the brain tissues of fetal mice (fig. 2E). The quantification of the Western blot, based on the ratio of caspase-3 fragment to FL-caspase-3, revealed that the sevoflurane anesthesia in pregnant mice induced caspase-3 activation as compared to control condition (fig. 2F): ** P = 0.0075, 198% ± 35 versus 100% ± 21. Taken together, these results suggest that anesthesia with 2.5% sevoflurane for 2 h in pregnant mice may induce neurotoxicity, including increases in proinflammatory cytokine levels, a reduction in synapse marker numbers, and caspase-3 activation in fetal mice, which may then lead to learning and memory impairment. Sevoflurane anesthesia in pregnant mice reduced synaptophysin levels in the hippocampus of offspring mice Given that sevoflurane anesthesia may cause acute neurotoxicity in fetal mice and learning and memory impairment in offspring mice at a later time, e.g., P31, we assessed the effects of the sevoflurane anesthesia on levels of IL-6 and synapse markers in the hippocampus of P31 mice. Immunohistochemistry analysis showed that the sevoflurane anesthesia reduced levels of synaptophysin, the synapse marker29, in the hippocampus of P31 mice (fig. 3A). Quantification of the immunohistochemistry image showed that the sevoflurane anesthesia decreased levels of synaptophysin: 77% ± 14.00 versus 100% ± 16.73, ** P = 0.0003 (fig. 3B). These results suggest that the sevoflurane anesthesia in pregnant mice may induce synaptic loss at a later time, e.g., P31, leading to learning and memory impairment. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 6 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. The sevoflurane-induced reduction in PSD-95 level was dependent on the sevoflurane- induced increases in IL-6 level Given that the sevoflurane anesthesia increased IL-6 levels and decreased PSD-95 levels in brain tissues of fetal mice at G14, we then determined their potential association in mouse primary neurons. Treatment with 4.1% sevoflurane for 6 h reduced PSD-95 levels in mouse primary neurons as compared to the control condition (fig. 4A). The treatment with sevoflurane reduced PSD-95 levels as compared to the control condition, but IL-6 antibody mitigated the sevoflurane-induced reduction in PSD-95 levels, evidenced by more visible bands representing PSD-95 following the treatment of sevoflurane plus IL-6 antibody than following the treatment of sevoflurane plus saline (fig. 4A). Quantification of the Western blot showed that the sevoflurane treatment reduced PSD-95 levels (20% ± 4.58 vs. 100% ± 19, ** P = 0.001) and IL-6 antibody mitigated the sevoflurane anesthesia-induced reduction in PSD-95 levels: 36% ± 8.33 versus 20% ± 4.58, * P = 0.035 (fig. 4B). Two-way ANOVA indicated that there was an interaction between IL-6 antibody and sevoflurane, and that IL-6 antibody mitigated the sevoflurane-induced reduction in PSD-95 levels: ^^ P = 0.003 (fig. 4B). These results suggest that the sevoflurane-induced reduction in PSD-95 level may be dependent on the sevoflurane-induced increases in IL-6 level. Interestingly, IL-6 antibody also reduced PSD-95 levels in the primary neurons (fig. 4A and 4B). EE attenuated the sevoflurane anesthesia-induced learning and memory impairment in offspring mice EE has been shown to improve learning and memory30,31, and we therefore assessed whether EE can ameliorate the sevoflurane anesthesia-induced learning and memory impairment. Two-way ANOVA with repeated measurement analysis showed that there was a statistically significant interaction between time and group based on escape latency between mice following sevoflurane anesthesia plus standard environment (SE) and sevoflurane anesthesia plus EE, and EE mitigated the sevoflurane anesthesia-induced increases in escape latency of mice swimming in the MWM (^^ P = 0.0004, fig. 5A). Sevoflurane anesthesia plus EE also increased the platform crossing times of mice in the MWM as compared to sevoflurane anesthesia plus SE (** P = 0.003, Mann-Whitney test, fig. 5B, sevoflurane plus EE: median = 4 and IQR = 3.75 to 4.25 versus sevoflurane plus SE: median = 1 and IQR = 1 to 3). EE alone did not alter escape latency nor platform crossing times of mice swimming in the MWM (fig. 5C and 5D). Two-way ANOVA with repeated measurement analysis showed that there was no statistically significant interaction between time and group based on escape latency between mice following the control condition plus standard environment (SE) and control condition plus EE in the MWM (P = 0.345, fig. 5C), although there was a statistically significant group main effect based on escape latency between mice following the control condition plus SE and control condition plus EE (P = 0.009), figure 5C. Finally, the mice swimming speed in the MWM among all of these conditions were not different (data not shown). Taken together, these data suggest that EE may ameliorate the learning and memory impairment in the offspring mice that is caused by the sevoflurane anesthesia in the pregnant mice. These results are consistent with the findings that EE ameliorates cognitive deficits10,11. EE mitigated the sevoflurane-induced increase in IL-6 levels and reduction in levels of PSD-95 and synaptophysin in the brain tissues of offspring mice Given EE can ameliorate the sevoflurane anesthesia-induced learning and memory impairment, and synapse loss is the pathological finding closely associated with cognitive dysfunction and dementia24, we determined the effects of EE on the sevoflurane anesthesia- induced alterations of IL-6 and synapse marker PSD-95 and synaptophysin levels in the Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 7 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Discussion brain tissues of offspring mice. IL-6 immunoblotting showed that sevoflurane anesthesia in pregnant mice increased IL-6 levels in the brain tissues of P31 offspring mice, and EE mitigated the effects (fig. 6A). The quantification of the Western blot illustrated that the sevoflurane anesthesia increased IL-6 levels: 250% ± 77 versus 100% ± 25, * P = 0.0032. EE mitigated the sevoflurane-induced increase in IL-6 levels: 89% ± 17 versus 250% ± 77, # P = 0.016 (fig. 6B). There was no statistically significant difference in IL-6 levels between the control condition plus SE and control condition plus EE (fig. 6C). Immunoblotting of PSD-95 showed that sevoflurane anesthesia in pregnant mice decreased PSD-95 levels in the brain tissues of P31 offspring mice, and EE mitigated the sevoflurane anesthesia-induced reduction in PSD-95 levels in the brain tissues of offspring mice examined at P31 (fig. 6D and 6E, ## P = 0.0046): 102 ± 3.23 (sevoflurane plus EE) versus 38% ± 19.39 (sevoflurane plus SE) versus 100% ± 20.6 (control plus SE). There was a higher level of PSD-95 in the control plus EE as compared to the control plus SE (fig. 6F). Immunohistochemistry staining showed that sevoflurane anesthesia in pregnant mice decreased synaptophysin levels in the brain tissues of P31 offspring mice as compared to the control condition (fig. 6G and 6H, ** P = 0.00003): 77% ± 17 versus 100% ± 21, EE mitigated the sevoflurane anesthesia-induced reduction in synaptophysin levels in the brain tissues of offspring mice at P31 (fig. 6G and 6H, ## P = 0.000001): 77% ± 17 (sevoflurane plus SE) versus 141% ± 36.44 (Sevoflurane plus EE). Collectively, these results suggest that EE may rescue the sevoflurane anesthesia- induced neuroinflammation and synaptic loss, leading to amelioration of the sevoflurane anesthesia-induced learning and memory impairment. The widespread and growing use of anesthesia in the developing brain makes its safety a major health issue of interest [1, reviewed in3]. This has become a matter of even greater concern with the evidence that anesthesia and surgery may induce neurodevelopment impairment in children, and that anesthetics are neurotoxic in young animals [reviewed in3]. Many pregnant women in the United States have nonobstetric surgery and fetal intervention procedures under anesthesia each year6,32. We therefore determined whether anesthesia with sevoflurane in pregnant mice could induce detrimental effects in fetal mice and offspring mice. We chose sevoflurane in the studies because sevoflurane is currently the most commonly used inhalation anesthetic, although sevoflurane might be less toxic than isoflurane33. Moreover, the effects of isoflurane in pregnant mice on behavioral changes in offspring mice have been determined7. Sevoflurane anesthesia in pregnant mice induced learning and memory impairment in offspring mice at P31 (fig. 1). The same sevoflurane anesthesia induced acute neurotoxicity as evidenced by the increased levels of proinflammatory cytokine IL-6, reduced levels of synapse marker PSD-95, and caspase-3 activation in the brain tissues of fetal mice (fig. 2). The sevoflurane anesthesia in pregnant mice also increased IL-6 levels, and decreased levels of PSD-95 and synaptophysin in the brain tissues of P31 offspring mice (fig. 6). Proinflammatory cytokine IL-6 can be released by the microglia cells during their activation, fueling neuroinflammation and leading to cognitive dysfunction34–36 and mild cognitive impairment (MCI)37 in medical and surgical patients38. PSD-95 is a postsynaptic marker39,40. The reduction of PSD-95 has been shown to be associated with decreases in synapse number or synaptic loss, a part of the mechanisms underlying AD-associated dementia and impairment of learning and memory [23,24, reviewed in25]. In the in vitro studies, IL-6 antibody attenuated the sevoflurane-induced reduction in PSD-95 levels, which suggests that the sevoflurane-induced increase in IL-6 levels may lead to reduction in PSD-95 levels. Taken together, these data suggest that sevoflurane may increase neuroinflammation, e.g., increase in IL-6 levels, which causes a reduction in synapse number, leading to learning and memory impairment. Future studies, including Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 8 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. determination of whether antiinflammation medicine(s) can rescue the sevoflurane anesthesia-induced synaptic loss and impairment of learning and memory, are warranted to further test this hypothesis. IL-6 antibody itself reduced PSD-95 levels in the primary neurons (fig. 4A and 4B). This could be due to IL-6 antibody only mitigating the effects associated with IL-6 accumulation, e.g., mitigating a reduction in PSD-95 levels. In the absence of IL-6 accumulation, however, the IL-6 antibody may have nonspecific effects. The exact mechanisms of these effects remain to be determined. The sevoflurane anesthesia induced caspase-3 activation, increases in IL-6 levels, and a reduction in PSD-95 levels 2 h after the anesthesia in the brain tissues of fetal mice, which occurred more rapidly than in the brain tissues of adult mice (6 h)9. These data suggest that fetal mice might be more vulnerable to neurotoxicity than adult mice. The mechanisms by which anesthetics induce neuroinflammation remain to be determined. Anesthetics have been shown to increase cytosolic calcium levels41–44. The elevation of cytosolic calcium is associated with increased levels of proinflammatory cytokines45, potentially through activation of nuclear factor-κB signaling pathway46–49. Activated nuclear factor-κB translocates to the nucleus where it binds to the promoter region of multiple genes, including cytokine genes46–50. Thus, the future studies will include determining whether anesthetics can increase calcium levels in neurons and microglia cells to trigger generation of proinflammatory cytokine, e.g., IL-6, through nuclear factor-κB signaling pathway. EE, consisting of social interaction and novel stimulation, may result in various neuroplastic changes, including increased hippocampal neurons51, improved spatial abilities and enhanced dendritic growth52, increased neurogenesis53, and increased nerve growth factor54 after brain injury. EE has also been shown to improve learning and memory function10–12. We found that EE ameliorated the sevoflurane anesthesia-induced learning and memory impairment, and mitigated the sevoflurane anesthesia-induced increase in IL-6 levels and reduction in synaptic markers (fig. 5 and 6). These results suggest that EE may rescue the sevoflurane anesthesia-induced neuroinflammation and synaptic loss, leading to improvement of the sevoflurane anesthesia-induced impairment of learning and memory. The studies have several limitations. First, we did not determine the long-term (e.g., 3 to 6 months) effects of sevoflurane anesthesia on learning and memory function, however, the current findings were able to illustrate the effects of sevoflurane anesthesia on behavioral changes (e.g., spatial learning and memory impairment) and the potential underlying cellular mechanisms (e.g., caspase activation, increases in IL-6 levels and synaptic loss). Second, we only focused on one proinflammatory cytokine, IL-6, in the experiments because IL-6 has been shown to contribute to learning and memory impairment. Sevoflurane anesthesia in pregnant mice may also induce other changes (e.g., microglia activation) in the brain tissues of fetal mice consistent with neuroinflammation, which need to be investigated in future studies. It is unknown whether the anesthesia itself contributes to the clinically observed cognitive impairment, or the need for anesthesia/surgery is a marker for other unidentified factors that contribute. In order to either rule in or rule out the contribution of anesthesia, we will determine whether anesthesia alone can induce neuroinflammation and learning and memory in young mice. Our established preclinical mouse model will be used to determine whether anesthetic alone can induce detrimental effects (e.g., learning and memory impairment, and neuroinflammation) in young animals (developing brain), to reveal the underlying mechanisms, and to explore targeted interventions. Moreover, nociceptive Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 9 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. stimuli such as surgical incision and pain with formalin have been shown to potentiate the anesthetic-induced neurotoxicity and neurobehavioral deficits55. The future studies may also include assessing whether other perioperative factors, e.g., hypothermia and hypotension, can potentiate anesthesia-induced neurotoxicity and neurobehavioral deficits. In conclusion, clinically relevant sevoflurane anesthesia in pregnant mice can induce acute neurotoxicity, including increases in IL-6 levels, reductions in synapse marker PSD-95 and caspase-3 activation, in the brain tissues of fetal mice. The same sevoflurane anesthesia in pregnant mice also induced long-term detrimental effects, including reductions in synapse marker PSD-95 and synaptophysin, and impairment of learning and memory in offspring mice at 31 days after the birth. These results suggest that sevoflurane anesthesia in pregnant mice may induce neuroinflammation, caspase activation and synaptic loss, leading to learning and memory impairment. Finally, EE may be able to rescue the sevoflurane anesthesia-induced learning and memory impairment by mitigating the sevoflurane anesthesia-induced synaptic loss and neuroinflammation. These findings will promote more research in anesthesia neurotoxicity in the developing brain, especially mechanistic studies. Acknowledgments Funding: This research was supported by R21AG029856, R21AG038994 and R01 GM088801 from National Institutes of Health, Bethesda, Maryland, and from Cure Alzheimer’s Fund, Wellesley, Massachusetts to Zhongcong Xie. The cost of anesthetic sevoflurane was generously provided by the Department of Anesthesia, Critical Care and Pain Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts. The authors thank Hui Zheng, Ph.D. (Assistant Professor of Medicine, Biostatistics Center, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts) for the advice and help in the data analysis of the studies. Reference 1. Rappaport B, Mellon RD, Simone A, Woodcock J. Defining safe use of anesthesia in children. N Engl J Med. 2011; 364:1387–1390. [PubMed: 21388302] 2. Belluck P. F.D.A to Study Whether Anesthesia Poses Cognitive Risks in Young Children. The New Yorker Time. 2011 Mar 9. Science. 3. Sun L. Early childhood general anaesthesia exposure and neurocognitive development. Br J Anaesth. 2010; 105(Suppl 1):i61–i68. [PubMed: 21148656] 4. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci. 2003; 23:876–882. [PubMed: 12574416] 5. Creeley CE, Olney JW. The young: Neuroapoptosis induced by anesthetics and what to do about it. Anesth Analg. 2010; 110:442–448. [PubMed: 19955510] 6. Kuczkowski KM. Nonobstetric surgery during pregnancy: What are the risks of anesthesia? Obstet Gynecol Surv. 2004; 59:52–56. [PubMed: 14707749] 7. Palanisamy A, Baxter MG, Keel PK, Xie Z, Crosby G, Culley DJ. Rats exposed to isoflurane in utero during early gestation are behaviorally abnormal as adults. Anesthesiology. 2011; 114:521– 528. [PubMed: 21307768] 8. Reitman E, Flood P. Anaesthetic considerations for non-obstetric surgery during pregnancy. Br J Anaesth. 2011; 107(Suppl 1):i72–i78. [PubMed: 22156272] 9. Dong Y, Zhang G, Zhang B, Moir RD, Xia W, Marcantonio ER, Culley DJ, Crosby G, Tanzi RE, Xie Z. The common inhalational anesthetic sevoflurane induces apoptosis and increases beta- amyloid protein levels. Arch Neurol. 2009; 66:620–631. [PubMed: 19433662] 10. Hoffman AN, Malena RR, Westergom BP, Luthra P, Cheng JP, Aslam HA, Zafonte RD, Kline AE. Environmental enrichment-mediated functional improvement after experimental traumatic Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 10 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. brain injury is contingent on task-specific neurobehavioral experience. Neurosci Lett. 2008; 431:226–230. [PubMed: 18162321] 11. Kline AE, Wagner AK, Westergom BP, Malena RR, Zafonte RD, Olsen AS, Sozda CN, Luthra P, Panda M, Cheng JP, Aslam HA. Acute treatment with the 5-HT(1A) receptor agonist 8-OH-DPAT and chronic environmental enrichment confer neurobehavioral benefit after experimental brain trauma. Behav Brain Res. 2007; 177:186–194. [PubMed: 17166603] 12. Sozda CN, Hoffman AN, Olsen AS, Cheng JP, Zafonte RD, Kline AE. Empirical comparison of typical and atypical environmental enrichment paradigms on functional and histological outcome after experimental traumatic brain injury. J Neurotrauma. 2010; 27:1047–1057. [PubMed: 20334496] 13. Zhen Y, Dong Y, Wu X, Xu Z, Lu Y, Zhang Y, Norton D, Tian M, Li S, Xie Z. Nitrous oxide plus isoflurane induces apoptosis and increases beta-amyloid protein levels. Anesthesiology. 2009; 111:741–752. [PubMed: 19741497] 14. Zhang Y, Dong Y, Wu X, Lu Y, Xu Z, Knapp A, Yue Y, Xu T, Xie Z. The mitochondrial pathway of anesthetic isoflurane-induced apoptosis. J Biol Chem. 2010; 285:4025–4037. [PubMed: 20007710] 15. Zhang Y, Xu Z, Wang H, Dong Y, Shi HN, Culley DJ, Crosby G, Marcantonio ER, Tanzi RE, Xie Z. Anesthetics isoflurane and desflurane differently affect mitochondrial function, learning, and memory. Ann Neurol. 2012; 71:687–698. [PubMed: 22368036] 16. Xie Z, Culley DJ, Dong Y, Zhang G, Zhang B, Moir RD, Frosch MP, Crosby G, Tanzi RE. The common inhalation anesthetic isoflurane induces caspase activation and increases amyloid beta- protein level in vivo. Ann Neurol. 2008; 64:618–627. [PubMed: 19006075] 17. Wu X, Lu Y, Dong Y, Zhang G, Zhang Y, Xu Z, Culley DJ, Crosby G, Marcantonio ER, Tanzi RE, Xie Z. The inhalation anesthetic isoflurane increases levels of proinflammatory TNF-alpha, IL-6, and IL-1beta. Neurobiol Aging. 2012; 33:1364–1378. [PubMed: 21190757] 18. Bianchi SL, Tran T, Liu C, Lin S, Li Y, Keller JM, Eckenhoff RG, Eckenhoff MF. Brain and behavior changes in 12-month-old Tg2576 and nontransgenic mice exposed to anesthetics. Neurobiol Aging. 2008; 29:1002–1010. [PubMed: 17346857] 19. Wan Y, Xu J, Ma D, Zeng Y, Cibelli M, Maze M. Postoperative impairment of cognitive function in rats: A possible role for cytokine-mediated inflammation in the hippocampus. Anesthesiology. 2007; 106:436–443. [PubMed: 17325501] 20. Reichenberg A, Yirmiya R, Schuld A, Kraus T, Haack M, Morag A, Pollmacher T. Cytokine- associated emotional and cognitive disturbances in humans. Arch Gen Psychiatry. 2001; 58:445– 452. [PubMed: 11343523] 21. Sparkman NL, Buchanan JB, Heyen JR, Chen J, Beverly JL, Johnson RW. Interleukin-6 facilitates lipopolysaccharide-induced disruption in working memory and expression of other proinflammatory cytokines in hippocampal neuronal cell layers. J Neurosci. 2006; 26:10709– 10716. [PubMed: 17050710] 22. Weaver JD, Huang MH, Albert M, Harris T, Rowe JW, Seeman TE. Interleukin-6 and risk of cognitive decline: MacArthur studies of successful aging. Neurology. 2002; 59:371–378. [PubMed: 12177370] 23. Hongpaisan J, Sun MK, Alkon DL. PKC ε activation prevents synaptic loss, Aβ elevation, and cognitive deficits in alzheimer's disease transgenic mice. J Neurosci. 2011; 31:630–643. [PubMed: 21228172] 24. Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, Hill R, Hansen LA, Katzman R. Physical basis of cognitive alterations in Alzheimer's disease: Synapse loss is the major correlate of cognitive impairment. Ann Neurol. 1991; 30:572–580. [PubMed: 1789684] 25. Querfurth HW, LaFerla FM. Alzheimer's disease. N Engl J Med. 2010; 362:329–344. [PubMed: 20107219] 26. Burguillos MA, Deierborg T, Kavanagh E, Persson A, Hajji N, Garcia-Quintanilla A, Cano J, Brundin P, Englund E, Venero JL, Joseph B. Caspase signalling controls microglia activation and neurotoxicity. Nature. 2011; 472:319–324. [PubMed: 21389984] 27. Wan Y, Xu J, Meng F, Bao Y, Ge Y, Lobo N, Vizcaychipi MP, Zhang D, Gentleman SM, Maze M, Ma D. Cognitive decline following major surgery is associated with gliosis, β-amyloid Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 11 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. accumulation, and tau phosphorylation in old mice. Crit Care Med. 2010; 38:2190–2198. [PubMed: 20711073] 28. Terrando N, Monaco C, Ma D, Foxwell BM, Feldmann M, Maze M. Tumor necrosis factor-α triggers a cytokine cascade yielding postoperative cognitive decline. Proc Natl Acad Sci U S A. 2010; 107:20518–20522. [PubMed: 21041647] 29. Calhoun ME, Jucker M, Martin LJ, Thinakaran G, Price DL, Mouton PR. Comparative evaluation of synaptophysin-based methods for quantification of synapses. J Neurocytol. 1996; 25:821–828. [PubMed: 9023727] 30. Bouet V, Freret T, Dutar P, Billard JM, Boulouard M. Continuous enriched environment improves learning and memory in adult NMRI mice through theta burst-related-LTP independent mechanisms but is not efficient in advanced aged animals. Mech Ageing Dev. 2011; 132:240–248. [PubMed: 21530571] 31. Veena J, Srikumar BN, Mahati K, Bhagya V, Raju TR, Shankaranarayana Rao BS. Enriched environment restores hippocampal cell proliferation and ameliorates cognitive deficits in chronically stressed rats. J Neurosci Res. 2009; 87:831–843. [PubMed: 19006089] 32. Van De Velde M, De Buck F. Anesthesia for non-obstetric surgery in the pregnant patient. Minerva Anestesiol. 2007; 73:235–240. [PubMed: 17473818] 33. Liang G, Ward C, Peng J, Zhao Y, Huang B, Wei H. Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology. 2010; 112:1325–1334. [PubMed: 20460994] 34. Teeling JL, Perry VH. Systemic infection and inflammation in acute CNS injury and chronic neurodegeneration: Underlying mechanisms. Neuroscience. 2009; 158:1062–1073. [PubMed: 18706982] 35. van Gool WA, van de Beek D, Eikelenboom P. Systemic infection and delirium: When cytokines and acetylcholine collide. Lancet. 2010; 375:773–775. [PubMed: 20189029] 36. Willard LB, Hauss-Wegrzyniak B, Wenk GL. Pathological and biochemical consequences of acute and chronic neuroinflammation within the basal forebrain cholinergic system of rats. Neuroscience. 1999; 88:193–200. [PubMed: 10051200] 37. Schuitemaker A, Dik MG, Veerhuis R, Scheltens P, Schoonenboom NS, Hack CE, Blankenstein MA, Jonker C. Inflammatory markers in AD and MCI patients with different biomarker profiles. Neurobiol Aging. 2009; 30:1885–1889. [PubMed: 18378357] 38. Hudetz JA, Gandhi SD, Iqbal Z, Patterson KM, Pagel PS. Elevated postoperative inflammatory biomarkers are associated with short- and medium-term cognitive dysfunction after coronary artery surgery. J Anesth. 2011; 25:1–9. [PubMed: 21061037] 39. Takeuchi M, Hata Y, Hirao K, Toyoda A, Irie M, Takai Y. SAPAPs. A family of PSD-95/SAP90- associated proteins localized at postsynaptic density. J Biol Chem. 1997; 272:11943–11951. [PubMed: 9115257] 40. Liu Q, Trotter J, Zhang J, Peters MM, Cheng H, Bao J, Han X, Weeber EJ, Bu G. Neuronal LRP1 knockout in adult mice leads to impaired brain lipid metabolism and progressive, age-dependent synapse loss and neurodegeneration. J Neurosci. 2010; 30:17068–17078. [PubMed: 21159977] 41. Zhang G, Dong Y, Zhang B, Ichinose F, Wu X, Culley DJ, Crosby G, Tanzi RE, Xie Z. Isoflurane- induced caspase-3 activation is dependent on cytosolic calcium and can be attenuated by memantine. J Neurosci. 2008; 28:4551–4560. [PubMed: 18434534] 42. Zhang J, Dong Y, Xu Z, Zhang Y, Pan C, McAuliffe S, Ichinose F, Yue Y, Liang W, Xie Z. 2- deoxy-D-glucose attenuates isoflurane-induced cytotoxicity in an in vitro cell culture model of H4 human neuroglioma cells. Anesth Analg. 2011; 113:1468–1475. [PubMed: 21965367] 43. Wei H, Liang G, Yang H, Wang Q, Hawkins B, Madesh M, Wang S, Eckenhoff RG. The common inhalational anesthetic isoflurane induces apoptosis via activation of inositol 1,4,5-trisphosphate receptors. Anesthesiology. 2008; 108:251–260. [PubMed: 18212570] 44. Yang H, Liang G, Hawkins BJ, Madesh M, Pierwola A, Wei H. Inhalational anesthetics induce cell damage by disruption of intracellular calcium homeostasis with different potencies. Anesthesiology. 2008; 109:243–250. [PubMed: 18648233] Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 12 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. 45. Kim D, Cho SH, Kim JS, Jo SH, Lee SJ, Kim KT, Choi SY. Human astrocytic bradykinin B(2) receptor modulates zymosan-induced cytokine expression in 1321N1 cells. Peptides. 2010; 31:101–107. [PubMed: 19854233] 46. Meffert MK, Chang JM, Wiltgen BJ, Fanselow MS, Baltimore D. NF-κB functions in synaptic signaling and behavior. Nat Neurosci. 2003; 6:1072–1078. [PubMed: 12947408] 47. Vexler ZS, Yenari MA. Does inflammation after stroke affect the developing brain differently than adult brain? Dev Neurosci. 2009; 31:378–393. [PubMed: 19672067] 48. Baeuerle PA, Henkel T. Function and activation of NF-κB in the immune system. Annu Rev Immunol. 1994; 12:141–179. [PubMed: 8011280] 49. Schneider A, Martin-Villalba A, Weih F, Vogel J, Wirth T, Schwaninger M. NF-κB is activated and promotes cell death in focal cerebral ischemia. Nat Med. 1999; 5:554–559. [PubMed: 10229233] 50. Neumann M, Naumann M. Beyond IkappaBs: Alternative regulation of NF-κB activity. FASEB J. 2007; 21:2642–2654. [PubMed: 17431096] 51. Kempermann G, Kuhn HG, Gage FH. More hippocampal neurons in adult mice living in an enriched environment. Nature. 1997; 386:493–495. [PubMed: 9087407] 52. Leggio MG, Mandolesi L, Federico F, Spirito F, Ricci B, Gelfo F, Petrosini L. Environmental enrichment promotes improved spatial abilities and enhanced dendritic growth in the rat. Behav Brain Res. 2005; 163:78–90. [PubMed: 15913801] 53. Olson AK, Eadie BD, Ernst C, Christie BR. Environmental enrichment and voluntary exercise massively increase neurogenesis in the adult hippocampus via dissociable pathways. Hippocampus. 2006; 16:250–260. [PubMed: 16411242] 54. Torasdotter M, Metsis M, Henriksson BG, Winblad B, Mohammed AH. Environmental enrichment results in higher levels of nerve growth factor mRNA in the rat visual cortex and hippocampus. Behav Brain Res. 1998; 93:83–90. [PubMed: 9659990] 55. Shu Y, Zhou Z, Wan Y, Sanders RD, Li M, Pac-Soo CK, Maze M, Ma D. Nociceptive stimuli enhance anesthetic-induced neuroapoptosis in the rat developing brain. Neurobiol Dis. 2012; 45:743–750. [PubMed: 22075165] Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 13 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Final Boxed Summary Statement What we know about this topic The effects of maternal exposure to sevoflurane to fetal neurotoxicity and neurobehavioral outcome are controversial What new information this study provides Sevoflurane may induce detrimental effects in fetal and offspring mice, which can be mitigated by environmental enrichment. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 14 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 1. Anesthesia with 2.5% sevoflurane for two hours in pregnant mice at gestation stage day 14 (G14) induces learning and memory impairment in offspring mice tested at postnatal day (P)31 A. Sevoflurane anesthesia increases escape latency time of mice swimming in the Morris Water Maze (MWM) as compared to the control condition. Two way ANOVA with repeated measurement analysis shows that there is statistically significant interaction between time and group based on escape latency between mice following the control condition and mice following the sevoflurane anesthesia in the MWM (^ P = 0.012). * indicates that there is a statistically significant difference in the escape latency between the control group and the sevoflurane group. B. Sevoflurane anesthesia reduces the platform Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 15 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. crossing times of mice swimming in the MWM as compared to the control condition (P = 0.051, Mann-Whitney test, median = 1 and IQR = 1 to 3 versus control: median = 2 and IQR = 2 to 4.5). G, gestation stage day; P, postnatal day; MWM, Morris Water Maze; ANOVA, analysis of variance; IQR, interquartile range. n = 15. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 16 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 2. Anesthesia with 2.5% sevoflurane for two hours in pregnant mice at G14 increases IL-6 levels, decreases PSD-95 levels and induce caspase-3 activation in the brain tissues of fetal mice A. Sevoflurane anesthesia increases IL-6 levels in the brain tissues of fetal mice as compared to the control condition in Western blot analysis. There is no statistically significant difference in the amounts of β-Actin in the mouse brain tissues following the sevoflurane anesthesia or control condition. B. Quantification of the Western blot shows that sevoflurane anesthesia increases IL-6 levels in the mouse brain tissues as compared to the control condition (* P = 0.026). C. The sevoflurane anesthesia reduces PSD-95 levels in the brain tissues of fetal mice as compared to the control condition in Western blot analysis. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 17 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. There is no statistically significant difference in the amounts of β-Actin in the mouse brain tissues following the sevoflurane anesthesia or control condition. D. Quantification of the Western blot shows that sevoflurane anesthesia reduces PSD-95 levels in the mouse brain tissues as compared to the control condition (* P = 0.036). E. The sevoflurane anesthesia induces caspase-3 activation in the brain tissues of fetal mice as compared to the control condition in Western blot analysis. There is no statistically significant difference in the amounts of β-Actin in the mouse brain tissues following the sevoflurane anesthesia or control condition. F. Quantification of the Western blot shows that sevoflurane anesthesia induces caspase-3 activation in the mouse brain tissues as compared to the control condition (** P = 0.0075). G, gestation stage day; IL-6, interleukin-6; PSD, postsynaptic density-95; FL, full length. n = 6. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 18 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 3. Anesthesia with 2.5% sevoflurane for two hours in pregnant mice at G14 decreases synaptophysin levels in the hippocampus of offspring mice examined at P31 A. Sevoflurane anesthesia decreases synaptophysin levels in the brain tissues of offspring mice as compared to the control condition in immunohistochemistry analysis. B. Quantification of the immunohistochemistry image shows that sevoflurane anesthesia decreases synaptophysin levels in the mouse brain tissues as compared to the control condition (** P = 0.0003). G, gestation stage day; P, postnatal day. n = 6. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 19 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 4. IL-6 antibody mitigates the sevoflurane-induced reduction in PSD-95 levels in mouse primary neurons A. Treatment with 4.1% sevoflurane for six hours (lanes 7 to 9) reduces PSD-95 levels as compared to the control condition (lanes 1 to 3). The treatment of IL-6 antibody (lanes 10 – 12) mitigates the sevoflurane-induced reduction in PSD-95 levels. There is no statistically significant difference in the amounts of β-Actin in the mouse primary neurons following the treatments of sevoflurane, IL-6 antibody or control condition. B. Quantification of the Western blot shows that sevoflurane treatment decreases PSD-95 levels as compared to the control condition (** P = 0.001). Treatment with sevoflurane plus IL-6 antibody leads to a lesser degree of reduction in PSD-95 levels as compared to treatment with sevoflurane plus Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 20 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. saline (# P = 0.035). Two-way ANOVA shows that there is an interaction of IL-6 antibody and sevoflurane, and that IL-6 antibody mitigates the sevoflurane-induced reduction in PSD-95 levels (^^ P = 0.003). IL-6, interleukin-6; PSD-95, postsynaptic density-95; ANOVA, analysis of variance. n = 6. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 21 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 5. Environmental enrichment (EE) attenuates the sevoflurane-induced learning and memory impairment in offspring mice A. Two way ANOVA with repeated measurement analysis shows that there is a statistically significant interaction between time and group based on escape latency between mice following sevoflurane anesthesia plus SE and sevoflurane anesthesia plus EE (^^ P = 0.0004). * indicates that there is a statistically significant difference in the escape latency between the sevoflurane plus SE group and the sevoflurane plus EE group. B. Mann- Whitney test shows that the platform crossing time of mice swimming in the MWM following the sevoflurane anesthesia plus EE is longer than that of mice following the sevoflurane anesthesia plus SE (** P = 0.003, sevoflurane plus EE: median = 4 and IQR = 3.75 to 4.25 versus sevoflurane plus SE: median = 1 and IQR = 1 to 3). C. ANOVA shows that there is no statistically significant interaction between time and group based on escape latency of mice swimming in the MWM between the control condition plus SE and the control condition plus EE (P = 0.345, N.S.). D. Mann-Whitney test shows that there is no statistically significant difference in platform crossing time of mice swimming in the MWM between the control condition plus SE and the control condition plus EE (P = 0.499, N.S., control condition plus EE: median = 3 and IQR = 2 to 4 versus control condition plus SE: median = 2 and IQR = 2 to 4.25). MWM, Morris Water Maze; ANOVA, analysis of variance; IQR, interquartile range; SE, standard environment; EE, environmental enrichment. n = 15. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 22 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. Figure 6. EE mitigates the sevoflurane-induced increase in IL-6 levels, and reduction in levels of PSD-95 and synaptophysin in mouse brain tissues A. Sevoflurane anesthesia plus SE increases IL-6 levels as compared to the control condition plus SE. Sevoflurane anesthesia plus EE leads to lower levels of IL-6 as compared to the sevoflurane anesthesia plus SE. There is no statistically significant difference in β-Actin levels among the above treatments B. Quantification of the Western blot shows that the sevoflurane anesthesia plus SE increases IL-6 levels as compared to the control condition (* P = 0.032), and EE mitigates the sevoflurane anesthesia-induced increase in IL-6 levels (## P = 0.016). C. There is no statistically significant difference in IL-6 levels between control plus EE and control plus SE. D. Sevoflurane anesthesia plus SE reduces PSD-95 levels as compared to the control condition plus SE. Sevoflurane anesthesia plus EE leads to higher levels of PSD-95 as compared to the sevoflurane anesthesia plus SE. There is no statistically significant difference in β-Actin levels among the above treatments E. Quantification of the Western blot shows that the sevoflurane anesthesia plus SE reduces PSD-95 levels as compared to the control condition (* P = 0.019), and EE mitigates the sevoflurane anesthesia-induced reduction in PSD-95 levels (## P = 0.0046). F. The PSD-95 level increases following control plus EE as compared to control plus SE. G. Sevoflurane anesthesia plus SE leads to a reduction in synaptophysin levels in the brain tissues of offspring mice as compared to the control condition in the immunohistochemistry analysis. EE mitigates the sevoflurane anesthesia-induced reduction in synaptophysin levels. The Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 23 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Zheng et al. synaptophysin level increases following control plus EE as compared to control plus SE. H. Quantification of the immunohistochemistry image shows that sevoflurane anesthesia plus SE leads to a reduction in synaptophysin levels in the brain tissues of offspring mice as compared to the control condition plus SE (black bar, **P = 0.00003). Both EE plus control condition (net bar, ** P = 0.0013) or sevoflurane (gray bar, ** P = 0.000001) cause higher synaptophysin levels in the brain tissues of offspring mice as compared to the control condition (white bar). Finally, there is an interaction between EE and sevoflurane anesthesia that EE mitigates the sevoflurane anesthesia-induced reduction in synaptophysin levels in the hippocampus of offspring mice (^^ P = 0.00005). PSD-95, postsynaptic density-95; IL-6, interleukin-6; SE, standard environment; EE, environmental enrichment. n = 6. Anesthesiology. Author manuscript; available in PMC 2014 March 01. Page 24",mice,"['Three month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice.']",gestational day 14,"['At gestation stage day 14 (G14), the pregnant mice were randomly assigned to an anesthesia or control group.']",Y,"['Separately, learning and memory function in the offspring mice was determined in the Morris Water Maze.']",sevoflurane,"['Sevoflurane anesthesia in pregnant mice induced caspase-3 activation, increased interleukin-6 levels [256% \n\nMice anesthesia\n\nThe protocol was approved by the Massachusetts General Hospital Standing Committee (Boston, Massachusetts) on the Use of Animals in Research and Teaching. Three month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice. The pregnant mice were identified and then housed individually. The offspring mice\n\nwere weaned 21 days after birth. Animals were kept in a temperature-controlled (22 \n\n23 \n\nC) room under a 12-h light/dark period (light on at 7:00 AM); standard mouse chow and water were available ad libitum. At gestation stage day 14 (G14), the pregnant mice were randomly assigned to an anesthesia or control group. Mice randomized to the anesthesia group received 2.5% sevoflurane in 100% oxygen for 2 h in an anesthetizing chamber.']",none,[],c57bl/6,"['Three month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice.']",None,[],None,[],These findings should promote more studies to determine the neurotoxicity of anesthesia in the developing brain.,"['These results suggest that sevoflurane may induce detrimental effects in fetal and offspring mice, which can be mitigated by environmental enrichment. These findings should promote more studies to determine the neurotoxicity of anesthesia in the developing brain.']","The studies have several limitations. First, we did not determine the long-term (e.g., 3 to 6 months) effects of sevoflurane anesthesia on learning and memory function, however, the current findings were able to illustrate the effects of sevoflurane anesthesia on behavioral changes (e.g., spatial learning and memory impairment) and the potential underlying cellular mechanisms (e.g., caspase activation, increases in IL-6 levels and synaptic loss). Second, we only focused on one proinflammatory cytokine, IL-6, in the experiments because IL-6 has been shown to contribute to learning and memory impairment. Sevoflurane anesthesia in pregnant mice may also induce other changes (e.g., microglia activation) in the brain tissues of fetal mice consistent with neuroinflammation, which need to be investigated in future studies.","['The studies have several limitations. First, we did not determine the long-term (e.g., 3 to 6 months) effects of sevoflurane anesthesia on learning and memory function, however, the current findings were able to illustrate the effects of sevoflurane anesthesia on behavioral changes (e.g., spatial learning and memory impairment) and the potential underlying cellular mechanisms (e.g., caspase activation, increases in IL-6 levels and synaptic loss). Second, we only focused on one proinflammatory cytokine, IL-6, in the experiments because IL-6 has been shown to contribute to learning and memory impairment. Sevoflurane anesthesia in pregnant mice may also induce other changes (e.g., microglia activation) in the brain tissues of fetal mice consistent with neuroinflammation, which need to be investigated in future studies.']",None,[],True,True,True,True,True,True,10.1097/ALN.0b013e3182834d5d