DOI,Citation ID,First author,Year,animal type,exposure age,behavior test: Y/N,intervention1,intervention2 （anesthetics only),genetic chain,content,Question 1,Question 1_original_sentences,Question 2,Question 2_original_sentences,Question 3,Question 3_original_sentences,intervention_1,Question 4intervention_1_original_sentences,intervention_2,Question 4intervention_2_original_sentences,Question 5,Question 5_original_sentences,Question 6,Question 6_original_sentences,Question 7,Question 7_original_sentences,Question 8,Question 8_original_sentences,Question 9,Question 9_original_sentences,Question 10,Question 10_original_sentences,correct_1,correct_2,correct_3,correct_4,correct_5,correct_6,fn 10.1007/s12640-009-9063-8,365.0,Bercker,2009,rats,postnatal day 6,Y,propofol,sevoflurane,wistar,"Neurotox Res (2009) 16:140–147 DOI 10.1007/s12640-009-9063-8 Neurodegeneration in Newborn Rats Following Propofol and Sevoflurane Anesthesia Sven Bercker Æ Bettina Bert Æ Petra Bittigau Æ Ursula Felderhoff-Mu¨ ser Æ Christoph Bu¨ hrer Æ Chrysanthy Ikonomidou Æ Mirjam Weise Æ Udo X. Kaisers Æ Thoralf Kerner Received: 13 June 2008 / Revised: 21 April 2009 / Accepted: 12 May 2009 / Published online: 27 May 2009 (cid:1) Springer Science+Business Media, LLC 2009 Abstract Propofol and sevoflurane are commonly used drugs in pediatric anesthesia. Exposure of newborn rats to a variety of anesthetics has been shown to induce apoptotic neurodegeneration in the developing brain. Newborn Wistar rats were treated with repeated intraperitoneal injections of propofol or sevoflurane inhalation and compared to controls. Brains were examined histopathologically using S. Bercker and B. Bert contributed equally to this article. S. Bercker (&) (cid:1) U. X. Kaisers Department of Anesthesiology and Intensive Care Medicine, University Hospital Leipzig, Leipzig, Germany e-mail: sven.bercker@medizin.uni-leipzig.de B. Bert Institute of Pharmacology and Toxicology, School of Veterinary Medicine, Freie Universitaet Berlin, Berlin, Germany the De Olmos cupric silver staining. Additionally, a sum- mation score of the density of apoptotic cells was calculated for every brain. Spatial memory learning was assessed by the Morris Water Maze (MWM) test and the hole board test, performed in 7 weeks old animals who underwent the same anesthetic procedure. Brains of propofol-treated animals showed a significant higher neurodegenerative summation score (24,345) when compared to controls (15,872) and to sevoflurane-treated animals (18,870). Treated animals also demonstrated persistent learning deficits in the hole board test, whereas the MWM test revealed no differences between both groups. Among other substances acting via GABAA agonism and/or NMDA antagonism propofol induced neurodegeneration in newborn rat brains whereas a sevoflurane based anesthesia did not. The significance of these results for clinical anesthesia has not been completely elucidated. Future studies have to focus on the detection of safe anesthetic strategies for the developing brain. P. Bittigau Children’s Hospital, Campus Virchow-Klinikum, Charite´- Universitaetsmedizin Berlin, Berlin, Germany Keywords Neurotoxicity (cid:1) Propofol (cid:1) Sevoflurane (cid:1) Newborn (cid:1) Anesthesia (cid:1) Behavior (cid:1) Histology (cid:1) Rodents U. Felderhoff-Mu¨ser Department of Neonatology, University Hospital of Essen, Essen, Germany Introduction C. Bu¨hrer Department of Neonatology, Children’s Hospital, Campus Virchow-Klinikum, Charite´-Universitaetsmedizin Berlin, Berlin, Germany C. Ikonomidou Department of Neurology, University of Wisconsin, Madison, WI, USA M. Weise (cid:1) T. Kerner Department of Anesthesiology and Intensive Care Medicine, Asklepios Klinikum Hamburg, Hamburg, Germany Propofol (6,2 Diisopropylphenol) has been introduced as a in 1977 (Kay and Rolly sedative and anesthetic agent 1977). In pediatric anesthesia it is widely used if intra- venous induction is needed, as a sedative for short interventions, in day case surgery, and in total intravenous anesthesia. Furthermore, propofol is popular due to its short context-sensitive half-life combined with rapid clear-headed reawakening and its antiemetic properties. After the report of 5 children dying from myocardial 123 Neurotox Res (2009) 16:140–147 failure after long-term propofol infusion (Parke et al. 1992) its use in pediatric critical care has been restricted; however, short-term application in children is considered safe. In 1999 the U.S. Federal Drug Administration decreased the approved age for maintenance of anesthesia with propofol to 2 months, whereas in Germany the use of propofol 1% for induction of anesthesia and mainte- nance is approved for children older than 1 month (Motsch and Roggenbach 2004). Despite these restrictions off-label use is common for anesthesia even in preterm infants and neonates. Due to its favorable properties for inhalational induction of anesthesia, its sweet odor and its rapid onset and offset the fluorinated hydrocarbon sevoflurane (2,2,2-trifluoro-1- [trifluoromethyl]ethyl fluoromethyl ether) is also widely used in current pediatric anesthesia. Similar to most anes- thetics, sevoflurane acts via GABA agonism (Hapfelmeier et al. 2001). Recently, it was shown that the combined application of GABA-enhancing and NMDA-blocking agents (midazo- lame, nitrous oxide and isoflurane) induced widespread neurodegeneration in the brains of newborn rats (Jevtovic- Todorovic et al. 2003). In addition, this was demonstrated for a variety of other agents with the same mechanisms of action, e.g. barbiturates, benzodiazepines, alcohol and ketamine (Ikonomidou et al. 2001; Bittigau et al. 2002). These findings have been followed by a lively discussion regarding their clinical relevance (Anand and Soriano 2004; Olney et al. 2004). The presented study was conducted to evaluate the neurotoxic effects of sevoflurane and propofol in newborn rats by analyzing the immediate histological damage and behavioral changes in the adult animals. Materials and Methods The experiments were performed according to the guide- lines of the German Animal Protection Law and were approved by the Berlin State authorities. Wistar rat pups were purchased from the Bundesinstitut fu¨r gesundheitlichen Verbraucherschutz und Veterina¨r- medizin BgVV, Berlin, Germany. Experimental Protocol Six-day-old Wistar rats received either intraperitoneal (i.p.) injections of propofol or underwent inhalational anesthesia with sevoflurane and were separated from their mother during the experimental phase. In every litter animals were randomized either for anesthesia or controls. 141 For propofol anesthesia doses of 30 mg/kg body weight were given every 90 min up to a cumulative dose of 90 mg/kg. For gas administration rats were placed into an incubation chamber (Billups Rothenberg Inc., Del Mar, USA), which was connected to an anesthesia system (F.Stephan GmBH, Gackenbach) for 6 h. Carbon dioxide and sevoflurane concentrations were monitored using a gas monitor (Datex Ohmeda, GE Healthcare, Munich, Ger- many). To avoid rebreathing of carbon dioxide, inspired CO2 concentration was continuously monitored and kept below 1 vol% by adjusting the fresh gas flow. Pilot studies established that sevoflurane concentrations between 3 and 5% maintained sufficient depth of anesthesia, as deter- mined by lack of reaction to a painful stimulus. However, it was also observed that skin color changed and respiratory diminished in some animals, suggesting respiratory insuf- ficiency. Accordingly, animals were closely monitored during the experiment and sevoflurane concentration adjusted between 3 and 5 vol% to maintain normal skin color and adequate respiratory efforts. The animals were observed for another 90 min until they were awake and active to be returned to their mother after the last injection and 6 h of gas application respec- tively. To maintain body temperature and prevent hypo- thermia, animals were placed on a heating device. During anesthesia respiratory frequency and skin color were observed to detect apnea and hypoxia. If bradypnoe occurred, rats received a pain stimulus, if breathing did not restart or resuscitation efforts were necessary rats were excluded from further processing and analysis. Verum and control animals received injections of PA¨ D II cristalloid/ glucose (50 g/l) solution (Fresenius-Kabi, Bad Homburg, Germany) to prevent hypoglycemia and hypovolemia. Control animals were separated from the mother for the same period as the anesthetized animals and received injections of the crystalloid/glucose solution as well. In order to reduce the amount of laboratory animals, the control animals of the propofol group were pooled with control animals from the sevoflurane group. Therefore, sham injections have not been performed. However, all experiments were performed using the same experimental settings and laboratories during the same time. For perfusion fixation animals were killed with an injection of an overdose of chloral hydrate 24 h after starting anesthesia. A solution of PBS (phosphate buffered saline) mixed with heparine (Thrombophob 25,000, Hep- arin-Natrium; Nordmark Arzneimittel GmbH, Uetersen, Germany) was injected slowly into the heart and ascending aorta in order to wash out the blood from the vessels. Afterwards, rats were perfused with a solution containing paraformaldehyde 4% (Merck, Darmstadt, Germany) with cacodylate buffer for 10 min (De Olmos cupric silver staining). (Sigma, Deisenhofen, Germany) 123 142 Histology To visualize degenerating cells, coronal sections (70 lm) of the whole brain were cut on a vibratome and stained with silver nitrate and cupric nitrate (De Olmos and Ingram 1971). This technique stains degenerating cells dying via an apoptotic or non-apoptotic mechanism. Degenerating cells were identified by their distinct dark appearance due to silver impregnation. Quantification of Damage Quantification of brain damage was assessed in the frontal, parietal, cingulate, retrosplenial cortex, caudate nucleus (mediodorsal part), thalamus (laterodorsal, mediodorsal, and ventral nuclei), septum, dentate gyrus, hypothalamus, cornu ammonis field CA1, and subiculum in silver stained sections by estimating mean numerical densities (Nv) of degenerating cells (Gundersen et al. 1988). An unbiased counting frame (0.05 mm 9 0.05 mm: dissector height 0.07 mm) and a high aperture objective were used for sampling. The Nv for each brain region was determined with 8–10 dissectors. Regional Nv values from 17 brain regions were summed to give a total score for degenerating neurons for each brain. Figure 1 shows representative sil- ver stained brain regions. Fig. 1 Light microscopic overviews of silver-stained transverse sections picturing neurodegenerative changes in 6-day-old rats. The images of the rat thalamus show examples 24 h after treatment a after propofol treatment, b sevoflurane treatment, and c for controls. Degenerated neurons are pictured as small dark dots 123 Neurotox Res (2009) 16:140–147 Behavioral Task treated, n = 7 testing n = 13 propofol For behavioral sevoflurane treated animals and n = 6 controls were anesthetized as described above. Only male pups were used. At the beginning of behavioral testing, animals were 7 weeks old. Animals were group-housed (4–5 animals per cage) under standard laboratory conditions (22 ± 2(cid:2)C room temperature) with an artificial 12 h light-dark cycle (lights on 6.00–18.00 h). Rats had access to food (Altromin 1326, Lage, Germany) and water ad libitum. They were acclimated to the animal unit for at least 2 weeks before testing. One hour prior to testing rats were transferred to a quiet anteroom. All experiments were performed between 8.00 and 13.00 h and only male animals were tested. In order to avoid possible carry-over effects, a pause of 7 days, during which the animals were left undisturbed in their home cages, was introduced between the hole board and water maze task. Morris Water Maze (MWM) Test The water maze task was conducted by using the same experimental design as described previously (Bert et al. 2002). A blue circular tank (diameter 200 cm, 60 cm deep) was filled up with water (21 ± 1(cid:2)C) to a height of 42 cm. Neurotox Res (2009) 16:140–147 The tank was surrounded by several visual cues and was indirectly illuminated (120 lx at the centre of the pool). For a single adaptation trial (day 0, without platform), the rats were released into the pool for 90 s with no escape platform present. On the following 8 days (day 1–8, place version) a transparent platform (16 9 16 cm) was sub- merged 1.5 cm below the surface in the middle of one of four virtual quadrants which was according to adaptation trial neither preferred nor avoided by the rat. Each day the animals were lowered into the water facing the wall from three different starting points (left, opposite, and right from the platform quadrant). Animals that did not find the escape platform within 90 s were placed onto it by the experi- menter. All rats were allowed to remain on the platform for 30 s for orientation and were afterwards removed to rest for 60 s in a heated cage until the next trial. For each trial the escape latency to reach the platform was measured by a computerized tracking system (TSE VideoMot, Version 1.43, Bad Homburg, Germany). For each animal the three daily trials were averaged. On day 9 the escape platform was removed (spatial probe) and the time spent in each quadrant during a single 90 s trial was registered. On day 10 (cued version) the platform was elevated 1 cm above water level, signaled by a white cylinder (diameter 3 cm and 4 cm high), and moved to the quadrant opposite to the initial quadrant. This test was performed to assess the motivation to escape from the water and sensor-motor integrity. The testing procedure and recorded parameter during the cued version were the same as for the hidden platform version of the task (Morris 1984). Hole Board Test The hole board apparatus consisted of a square box (50 9 50 cm) made of grey Perspex with 16 equally spaced holes (diameter 2.5 cm), and was situated in a sound-attenuated chamber. The behavior of rats was monitored by an overhead installed video camera which was linked to a computerized tracking system (TSE Vid- eoMot2, Bad Homburg, Germany). The test was conducted on two consecutive days. On both days rats were placed in the centre of the apparatus and observed for 10 min. The numbers of nose pokes and rearings as well as the distance traveled were recorded. After each animal the box was cleaned with 2-propanol 30%. Habituation to the apparatus was defined as a significant reduction of nose pokes, rearings and locomotor activity from the 1st to the 2nd day (Voits et al. 1995). Blood Gas Analysis To exclude severe hypoxia, hypercapnia or lactic acidosis, a blood gas analysis was performed for example in one 143 animal of each group by transcutaneous puncture of the left ventricle. The probe was analyzed by a blood gas analyzer (Radiometer ABL series, Radiometer, Copenhagen, Denmark). Statistical Analysis The Kolmogorov Smirnov test was used to test for normal distribution. The results of the sum scores were compared using the Mann–Whitney U test between controls and propofol as well as between controls and sevoflurane. The place version data of the water maze test were analyzed by two-way ANOVAs on repeated measures followed by Holm-Sidak method for post-hoc multiple pair-wise com- parisons. The spatial probe and the cued version data were analyzed by one-way ANOVAs followed by Holm-Sidak post-hoc tests. The data of the hole board test were ana- lyzed by paired t-tests. Differences were considered to be significant if P \ 0.05. Results Anesthetic Procedures All rats subjected to propofol injections or inhalational anesthesia with sevoflurane developed deep anesthesia with no or only minor reaction to pain stimuli. Rats were observed concerning skin color and respiratory frequency. In all but two rats no pathological findings were observed. Of the anesthetized rats, n = 1 in each treatment group had apnea and died during the experiment. Blood gas analyses revealed normal results. Histology For silver nitrate and cupric nitrate staining, 26 animals have been processed after propofol anesthesia and 13 ani- mals after sevoflurane anesthesia whereas 18 controls were separated from their mothers as described above. The results of the sum score, the cell counts of every brain region and the differences in whole body weight as well as the absolute brain weight between anesthetized and control animals are summarized in Table 1. There was a significant higher sum score of degenerated neurons in propofol treated animals compared to the control group (P \ 0.001). Main differences in the amount of degenerated cells could be detected in the mediodorsal and laterodorsal part of the thalamus and in the subiculum. There was no significant difference between controls and sevoflurane treated ani- mals (P = 0.944). 123 144 Neurotox Res (2009) 16:140–147 Table 1 Results for controls, propofol and sevoflurane treated animals concerning brain weight (g), difference of body weight before and 24 h after the experiments, and histological damage as sum score and in the several regions Percentiles Controls Propofol Sevoflurane 25 50 75 25 50 75 25 50 75 Brain weight (g) 0.64 0.69 0.7 0.6 0.64 0.68 0.575 0.6 0.61 Change in body weight (g) 1.35 1.9 2.55 0.4 1.4 1.8 0.6 1.2 1.45 Sum score CFR II 13140 2000 15872 2571 19821 3571 18622.75 2000 24345.5 3714 32677 5571 12765 2571 17410 3000 18537 3928.5 CFR IV 635 952 1270 635 952 1270 635 952 1270 CING II 1143 2143 2571 1429 2571 4143 1785.5 2429 2857 CING IV 1270 1270 1587 1270 1270 1587 1270 1587 1746 caud 228 314 674 200 286 800 328.5 400 700 septum 71 143 286 114 200 371 171 257 314 CPR II 1500 2143 4071 2571 4000 6143 1643 2571 3856.5 CPR IV 793 952 1270 635 635 1270 635 635 1269.5 RSC II 500 1000 1214 571 857 1143 857 1143 2428.5 RSC IV 952 1270 1905 952 952 1587 952 952 1587.5 TH MD 86 171 285 257 343 486 114.5 200 257 TH LD 314 400 643 1057 2371 4171 585.5 771 1814.5 TH V 71 114 328 86 200 314 100 143 228.5 hyth 385 486 743 371 571 1114 285.5 543 700 ca1 dg 286 171 429 229 571 343 286 229 429 286 571 400 214.5 171 286 286 429 485.5 subic 400 686 900 943 1200 1972 486 600 671 CFR frontal cortex, CING cingulated cortex, caud caudate, septum, CPR parietal cortex, RSC retrosplenial cortex, TH thalamus, hyth hypo- thalamus, ca1 ca1 hippocampus, dg dentate gyrus, subic subiculum MWM Test Place Version motor integrity. Also, in the cued version a difference between the propofol or sevoflurane treated animals and controls was not detected. There was a significant effect of factor day during the place version (P \ 0.001) in all groups. Post-hoc analysis revealed that all groups exhibited decreasing time escaping the water on days 2–8 when compared to day 1. Even though it seems that on day 2 and 4 propofol treated rats were seeking the platform for a longer period, a significant group effect was not observed (F(1, 17) = 2.050; P = 0.170). Spatial Probe The good performance during the place version was reflected in the spatial probe. In all three groups, rats preferred the quadrant where the platform was located during the place version to the other three quadrants. Accordingly, the test did not show any difference between controls and anesthetized rats. Hole Board Control animals showed a significant reduction of nose pokes behavior (P = 0.030) and a decrease in locomotor activity from day 1 to day 2 (P = 0.012), referring to a non- spatial habituation learning. However, the numbers of rear- ings were not significantly decreased on day 2. In contrast, propofol-treated animals showed no habituation to the hole board. The number of nose pokes and distance traveled remained unchanged, whereas the number of rearings was even increased on day 2 (P = 0.01). In contrast, a significant reduction of nose pokes behavior from day 1 to day 2 could be shown in sevoflurane-treated animals (P \ 0.05). Discussion Cued Version All animals showed a decrease in the escape latencies during the 2nd and 3rd trial indicating no deficient sensory- In our study a short-term propofol anesthesia of approxi- mately 4.5 h duration induced histological neurodegener- ation in the immature rat brain and led to persistent 123 Neurotox Res (2009) 16:140–147 learning deficits. Anesthesia with a cumulative dose of 90 mg/kg propofol caused significantly higher scores of degenerated neurons compared to controls. Accordingly, animals showed significant learning defi- cits during behavioral testing after 7 weeks. In contrast, a prolonged exposure to sevoflurane did not lead to mor- phological brain damage or to learning deficits when compared to controls. A broad variety of psychoactive and sedative substances such as barbiturates, benzodiazepines, antiepileptic drugs (Bittigau et al. 2002), Ketamine (Fredriksson et al. 2007) and anesthetics with a combination of sedatives (Jevtovic- Todorovic et al. 2003) as well as different doses of pro- pofol (Fredriksson et al. 2007; Cattano et al. 2008) have been shown to induce apoptosis in the central nervous system of animals. Jevtovic-Todorovic et al. demonstrated that anesthesia with a cocktail of midazolam, Isoflurane and nitrous oxide led to similar deficiencies. In most monitored brain regions propofol-treated ani- mals showed an increase in degenerated cells. The maxi- mum difference was detected in the thalamus. Learning deficits have been shown to be associated with circum- scribed hippocampal damage (Morris et al. 1982). How- ever, in our study neuronal damage was distributed diffusely and the hippocampus was also affected. The location of the maximum effects in the thalamus is in accordance with a recent study of Nikizad et al. (2007) who demonstrated the neurotoxic effects of a 6-h anesthesia with Isoflurane, Midazolam and nitrous oxide. In the learning tests there were only minor effects of propofol treatment on spatial navigation, as estimated by the MWM test. Although the learning curve during the place version showed a slight difference toward a learning deficit no group effect for the whole investigation period could be shown. Furthermore, results did not differ on day 8. In contrast, propofol-treated animals showed no habit- uation to the hole board. The number of nose pokes and distance traveled remained unchanged. Thus, propofol anesthesia affected the animals’ capability for explorative learning. It has been criticized that neurotoxic effects of anes- thetics in animal models might be induced by uncontrol- lable the mother, such as deprivation of hypoglycemia or hypoxia (Soriano et al. 2005). In the lit- erature there is evidence for an aggravation of apoptosis by glucose deprivation (Wise-Faberowski al. 2001). Therefore, it might be speculated that isolation from the mother and hypoalimentation alone induced apoptosis of neurons. However, in our experiments there was no sig- nificant difference in the increase of body weight between controls and propofol-treated animals in the 24 h after testing. Additionally, the brain weights did not differ. The effects et 145 blood gas analysis for one propofol-treated animal revealed normal results. The death of one animal possibly caused by depth of propofol anesthesia might be seen as an indication for asphyxia in at least some animals. However, a corre- sponding case was also seen in the sevoflurane group and here no difference in neurotoxic effects or any learning deficits could be demonstrated. A possible limitation might be that sham injections have not been performed in the control and in the sevoflurane group. However, there is no evidence in the literature that intraperitoneal injections alone may lead to a comparable increase in neurodegeneration. Furthermore, it has to be considered that the majority of the studied substances show a dose-dependent toxicity. In our study a distinct dose has been chosen to maintain a predefined depth of anesthesia. Therefore, we cannot exclude that higher doses of sevo- flurane would have had more distinct effects. As discussed earlier, a variety of anesthetics and other substances obviously may induce impaired brain develop- ment and cognitive or behavioral defects. This is well known for alcohol abuse in pregnancy leading to the fetal Impaired neurological development alcohol syndrome. could also be shown in infants after maternal benzodiaze- pine (Laegreid et al. 1992) or antiepileptic medication (Meador et al. 2009) during pregnancy. Furthermore, the application of Phenobarbital in infants suffering from sei- zures was associated with a significant lower intelligence quotient when compared to placebo (Farwell et al. 1990). In experimental studies an induction of apoptotic neuro- degeneration in newborn rats by high-dose GABAA ago- nists such as diazepam and Phenobarbitone has been described by Bittigau et al. (2003). The exact mechanism by which these classes of medicaments induce neuroa- poptosis remains unclear. It has been hypothesized that depression of neuronal activity during synaptogenesis is a common denominator. Recently, it has been shown that isoflurane-induced apoptosis is dependent on cytosolic calcium levels and therefore disruption of intracellular calcium homeostasis is a potential pathway (Wei et al. 2008; Zhang et al. 2008). In the data presented here, we could show that the GABA agonist sevoflurane did not lead to increased cell death even though the animals were deeply anesthetized indicating sufficient depression of neuronal activity. We cannot conclude why sevoflurane in contrast to other tested substances with the same mechanism of action did not lead to neuronal cell damage. However, data concern- ing the influence of inhalational anesthetics on brain development are not consistent. To our knowledge only few recently published studies could show neurotoxic effects of inhalational anesthetics individually and not in combination with other substances (Johnson et al. 2008). Li et al. (2007) demonstrated that exposure to isoflurane 123 146 decreased apoptosis in 21-day-old rats. In the above dis- cussed study of Jevtovic-Todorovic et al. (2003) only a cocktail of three anesthetic substances led to the described effects. We suggest that volatile halogenated hydrocarbons do not have comparable neurotoxic effects as benzodiaze- pines, ketamine, propofol and other substances. It has to be discussed if the prolongation of exposure or an increase of concentrations might lead to more pronounced neurotoxic effects. Additionally, in this study rats were euthanized 24 h after the anesthetic procedure whereas other protocols waited for a shorter period (Jevtovic-Todorovic et al. 2003; Li et al. 2007). We cannot exclude that sevoflurane anes- thesia would have more pronounced effects if this period would have been shorter. The experimental results concerning sedatives and anesthetics raised serious concerns about the safety of common NMDA antagonists and GABA agonists used in pediatric anesthesia. Consecutively, the transferability of such results to human beings has been discussed contro- versially. The main arguments against transferability were that the reported neurodegeneration may be also caused by ischemia, hypoxia, hypoglycemia or hypothermia due to insufficient monitoring (Anand and Soriano 2004). During our experiments animals were deeply sedated and two animals even died during anesthesia. As we could not demonstrate any increase in scores of degenerated cells and accordingly could not observe any learning deficits in sevoflurane animals when compared to controls, we sug- gest that depth of anesthesia did not influence cell death in the described experimental setting. In clinical studies, neurotoxic effects of a propofol- based anesthesia causing learning disorders or develop- mental retardation have not been confirmed yet. Currently, neurological sequelae in children submitted to prolonged propofol infusion have been described in case reports (Lanigan et al. 1992; Trotter and Serpell 1992). After surgery was performed in newborn infants for transposition of the great arteries, prolonged intensive care (and hence prolonged exposure to sedatives) is associated with reduced intelligence quotients at 8 years of age (Newburger et al. 2003). But learning deficits after extensive surgery in the newborn are most likely influenced by a variety of reasons and should not be referred to anesthesia alone. However, the issue of neurotoxicity after administration of GABAA agonists or NMDA antagonists has not been subject to a randomized controlled trial. To date no clinical trial investigated neurological sequelae after application of different anesthetic regimens in the newborn. Concerns have to be raised that the use of propofol in neonates might induce apoptotic neurodegeneration and may lead to specific behavioral deficits. This has been already shown for other frequently used substances (i.e., benzodiazepines, barbiturates, volatile anesthetics). In the 123 Neurotox Res (2009) 16:140–147 presented experiments, inhalational anesthesia did not have such consequences. In clinical pediatric anesthesia, propofol is considered to be a safe intravenous agent. Apart from former clinical practice it has been shown extensively that there is unconditional necessity for anesthesia during surgery in the neonatal period. In contrast, apoptotic neurodegeneration has been demonstrated exclusively in animal experiments. As clinical studies are still lacking, future research has to focus on the detection of safe anesthetic strategies and substances. Acknowledgments This study was funded by institutional resources of the Department of Anesthesiology and Intensive Care Medicine, and of the Children’s Hospital, Campus Virchow Klinikum, Charite´- Universitaetsmedizin in Berlin, Germany. References Anand KJ, Soriano SG (2004) Anesthetic agents and the immature therapeutic? Anesthesiology 101: brain: are these toxic or 527–530 Bert B, Fink H, Huston JP, Voits M (2002) Fischer 344 and Wistar rats differ in anxiety and habituation but not in water maze performance. Neurobiol Learn Mem 78:11–22 Bittigau P, Sifringer M, Genz K, Reith E, Pospischil D, Govindarajalu S, Dzietko M, Pesditschek S, Mai I, Dikranian K, Olney JW, Ikonomidou C (2002) Antiepileptic drugs and apoptotic neuro- degeneration in the developing brain. Proc Natl Acad Sci USA 99:15089–15094 Bittigau P, Sifringer M, Ikonomidou C (2003) Antiepileptic drugs and apoptosis in the developing brain. Ann NY Acad Sci 993: 103–114; discussion 123–104 Cattano D, Young C, Straiko MM, Olney JW (2008) Subanesthetic doses of propofol induce neuroapoptosis in the infant mouse brain. Anesth Analg 106:1712–1714 De Olmos JS, Ingram WR (1971) An improved cupric-silver method for impregnation of axonal and terminal degeneration. Brain Res 33:523–529 Farwell JR, Lee YJ, Hirtz DG, Sulzbacher SI, Ellenberg JH, Nelson KB (1990) Phenobarbital for febrile seizures—effects on intel- ligence and on seizure recurrence. N Engl J Med 322:364–369 Fredriksson A, Ponten E, Gordh T, Eriksson P (2007) Neonatal exposure to a combination of N-methyl-D-aspartate and gamma- aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107:427–436 Gundersen HJ, Bendtsen TF, Korbo L, Marcussen N, Moller A, Nielsen K, Nyengaard JR, Pakkenberg B, Sorensen FB, Vesterby A et al (1988) Some new, simple and efficient stereological methods and their use in pathological research and diagnosis. APMIS 96:379–394 Hapfelmeier G, Schneck H, Kochs E (2001) Sevoflurane potentiates through recombinant and blocks GABA-induced currents alpha1beta2gamma2 GABAA receptors: implications for an enhanced GABAergic transmission. Eur J Anaesthesiol 18: 377–383 Ikonomidou C, Bittigau P, Koch C, Genz K, Hoerster F, Felderhoff- Mueser U, Tenkova T, Dikranian K, Olney JW (2001) Neuro- transmitters and apoptosis in the developing brain. Biochem Pharmacol 62:401–405 Neurotox Res (2009) 16:140–147 Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikr- anian K, Zorumski CF, Olney JW, Wozniak DF (2003) Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 23:876–882 Johnson SA, Young C, Olney JW (2008) Isoflurane-induced neuroa- poptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 20:21–28 Kay B, Rolly G (1977) I.C.I. 35868, a new intravenous induction agent. Acta Anaesthesiol Belg 28:303–316 Laegreid L, Hagberg G, Lundberg A (1992) Neurodevelopment in late infancy after prenatal exposure to benzodiazepines—a prospective study. Neuropediatrics 23:60–67 Lanigan C, Sury M, Bingham R, Howard R, Mackersie A (1992) Neurological sequelae in children after prolonged propofol infusion. Anaesthesia 47:810–811 Li Y, Liang G, Wang S, Meng Q, Wang Q, Wei H (2007) Effects of fetal exposure to isoflurane on postnatal memory and learning in rats. Neuropharmacology 53:942–950 Meador KJ, Baker GA, Browning N, Clayton-Smith J, Combs- Cantrell DT, Cohen M, Kalayjian LA, Kanner A, Liporace JD, Pennell PB, Privitera M, Loring DW (2009) Cognitive function at 3 years of age after fetal exposure to antiepileptic drugs. N Engl J Med 360:1597–1605 Morris R (1984) Developments of a water-maze procedure for studying spatial learning in the rat. J Neurosci Methods 11:47–60 Morris RG, Garrud P, Rawlins JN, O’Keefe J (1982) Place navigation impaired in rats with hippocampal lesions. Nature 297:681–683 infusion syndrome. Motsch J, Roggenbach J (2004) Propofol Anaesthesist 53:1009–1022; quiz 1023–1004 Newburger JW, Wypij D, Bellinger DC, du Plessis AJ, Kuban KC, Rappaport LA, Almirall D, Wessel DL, Jonas RA, Wernovsky G (2003) Length of stay after infant heart surgery is related to cognitive outcome at age 8 years. J Pediatr 143:67–73 147 Nikizad H, Yon JH, Carter LB, Jevtovic-Todorovic V (2007) Early exposure to general anesthesia causes significant neuronal deletion in the developing rat brain. Ann NY Acad Sci 1122: 69–82 Olney JW, Young C, Wozniak DF, Ikonomidou C, Jevtovic-Todorovic V (2004) Anesthesia-induced developmental neuroapoptosis. Does it happen in humans? Anesthesiology 101:273–275 Parke TJ, Stevens JE, Rice AS, Greenaway CL, Bray RJ, Smith PJ, Waldmann CS, Verghese C (1992) Metabolic acidosis and fatal myocardial failure after propofol infusion in children: five case reports. BMJ 305:613–616 Soriano SG, Anand KJ, Rovnaghi CR, Hickey PR (2005) Of mice and men: should we extrapolate rodent experimental data to the care of human neonates? Anesthesiology 102:866–868; author reply 868–869 Trotter C, Serpell MG (1992) Neurological sequelae in children after prolonged propofol infusion. Anaesthesia 47:340–342 Voits M, Fink H, Gerhardt P, Huston JP (1995) Application of ‘nose- poke habituation’ validation with post-trial diazepam- and cholecystokinin-induced hypo- and hypermnesia. J Neurosci Methods 57:101–105 Wei H, Liang G, Yang H, Wang Q, Hawkins B, Madesh M, Wang S, Eckenhoff RG (2008) The common inhalational anesthetic isoflurane induces apoptosis via activation of inositol 1,4,5- trisphosphate receptors. Anesthesiology 108:251–260 Wise-Faberowski L, Raizada MK, Sumners C (2001) Oxygen and glucose deprivation-induced neuronal apoptosis is attenuated by halothane and isoflurane. Anesth Analg 93:1281–1287 Zhang G, Dong Y, Zhang B, Ichinose F, Wu X, Culley DJ, Crosby G, Tanzi RE, Xie Z (2008) Isoflurane-induced caspase-3 activation is dependent on cytosolic calcium and can be attenuated by memantine. J Neurosci 28:4551–4560 123",rats,['Newborn Wistar rats were treated with repeated intraperitoneal injections of propofol or sevoflurane inhalation and compared to controls.'],postnatal day 6,['Six-day-old Wistar rats received either intraperitoneal (i.p.) injections of propofol or underwent inhalational anesthesia with sevoflurane and were separated from their mother during the experimental phase.'],Y,"['Spatial memory learning was assessed by the Morris Water Maze (MWM) test and the hole board test, performed in 7 weeks old animals who underwent the same anesthetic procedure.']",propofol,['Newborn Wistar rats were treated with repeated intraperitoneal injections of propofol or sevoflurane inhalation and compared to controls.'],sevoflurane,['Newborn Wistar rats were treated with repeated intraperitoneal injections of propofol or sevoflurane inhalation and compared to controls.'],wistar,['Newborn Wistar rats were treated with repeated intraperitoneal injections of propofol or sevoflurane inhalation and compared to controls.'],The study evaluates the neurotoxic effects of sevoflurane and propofol in newborn rats by analyzing immediate histological damage and behavioral changes in adult animals.,['The presented study was conducted to evaluate the neurotoxic effects of sevoflurane and propofol in newborn rats by analyzing the immediate histological damage and behavioral changes in the adult animals.'],None,[],"The study suggests that propofol induces neurodegeneration in newborn rat brains, whereas a sevoflurane-based anesthesia did not, highlighting the need for safe anesthetic strategies for the developing brain.",['Among other substances acting via GABAA agonism and/or NMDA antagonism propofol induced neurodegeneration in newborn rat brains whereas a sevoflurane based anesthesia did not. The significance of these results for clinical anesthesia has not been completely elucidated. Future studies have to focus on the detection of safe anesthetic strategies for the developing brain.'],"The study mentions the limitation of not performing sham injections in the control and sevoflurane group, and the potential influence of anesthesia depth on cell death was not explored.",['A possible limitation might be that sham injections have not been performed in the control and in the sevoflurane group. We cannot conclude why sevoflurane in contrast to other tested substances with the same mechanism of action did not lead to neuronal cell damage.'],None,[],True,True,True,True,True,True,10.1007/s12640-009-9063-8 10.1002/cbin.10349,4738.0,Cao,2015,mice,postnatal day 14,Y,ketamine,none,c57bl/6,"Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10349 RESEARCH ARTICLE Role of miR-34c in ketamine-induced neurotoxicity in neonatal mice hippocampus Shu-e Cao*, Jianmin Tian, Shengyang Chen, Xiaoran Zhang and Yongqiang Zhang Department of Anesthesiology, The First Affiliated Hospital of XinXiang Medical College, WeiHui, HeNan Province 453100, China Abstract Ketamine is a commonly used pediatric anesthetic, but it might affect development, or even induce neurotoxicity in the neonatal brain. We have used an in vivo neonatal mouse model to induce ketamine-related neurotoxicity in the hippocampus, and found that miR-34c, a microRNA associated with pathogenesis of Alzheimer’s disease, was significantly upregulated during ketamine-induced hippocampal neurodegeneration. Functional assay of silencing miR-34c demonstrated that downregulation of miR-34c activated PKC-ERK pathway, upregulated anti-apoptotic protein BCL2, and ameliorated ketamine-induced apoptosis in the hippocampus. Cognitive examination with the Morris water maze test showed that ketamine-induced memory impairment was significantly improved by miR-34c downregulation. Thus, miR-34c is important in regulating ketamine-induced neurotoxicity in hippocampus. Keywords: hippocampus; ketamine; miR-34c; neurotoxicity Introduction Ketamine, synthesized in 1962, has been widely used in clinic anesthesia due to its rapid onset and minimal side-effects (Domino, 2010). Pharmacologically, the major mechanism of ketamine working as anesthetic is to inhibit the glutamate neuro-transmission through N-methyl-D-aspartate (NMDA) receptors (Ikonomidou et al., 1999 Olney et al., 1991), and a ketamine overdose could severely affect the development of neonatal brain and induce cortical neurotoxicity in both animals and humans (McGowan and Davis, 2008; Brambrink et al., 2012 Dong and Anand, 2013). In hippocampus, the major component of brain associated with memory and learning, new evidence had revealed through both in vitro and in vivo animal models, that repetitive or high dose adminis- tration of ketamine suppressed neural excitability, induced apoptosis impair learning and memory functions (Huang et al., 2012 Huang et al., 2013). Little is known about the underlying mechanisms or the associated signaling pathways during the process of hippocampal or memory neurodegeneration induced by anesthesia. significantly in hippocampus, thus MicroRNAs are endogenously expressed noncoding short RNAs regulating gene silencing by suppressing the transla- tion or degrading targeted messenger RNAs (Kim, 2005). They are abundantly expressed in various components in the brain, being involved in modulating embryogenesis, neural development, and maturation (Kosik and Krichevsky, 2005; Darnell et al., 2006 Kosik, 2006; Lau and Hudson, 2010). Among them, microRNA 34 c (miR-34c) is a member of miR-34 family, which includes three homologous miRNAs expressed at two different loci of chromosome (miR-34a, miR-34b, and miR-34c), and are involved in various aspects of neural development or degeneration (Agostini et al., 2011; Casci, 2012; Liu et al., 2012). miR-34c is a newly discovered modulator associated with pathogenesis of neurodegenera- tive disease (Zovoilis et al., 2011). Thus, we have determined whether miR-34c may regulate anesthesia-related neurotox- icity in hippocampus. Ketamine was introduced into an in vivo neonatal mouse model to induce anesthesia-related hippocampal neurotoxicity, and the effect of ketamine- induced neurodegeneration on the expression level of miR- 34c in hippocampus was measured. A lentiviral vector was used to downregulate miR-34c to investigate its functional (cid:1)Corresponding author: e-mail: yongqiang.zhang@aol.com 164 Cell Biol Int 39 (2015) 164–168 © 2014 International Federation for Cell Biology Y. Zhang et al. role in modulating anesthesia-induced neurotoxicity in hippocampus in vivo. Materials and methods Animals C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China). The in vivo induction of ketamine-related hippo- campal neurotoxicity was done at 2 weeks. Quantitative real time PCR of miR-34 family was used at 3 weeks, as was hippocampal injection of lentivirual vector of miR-34c. For analyses of TUNEL staining and Western blotting, 2-month old mice were used. All experimental procedures were reviewed and approved by the Animal Care Committee at the first affiliated Hospital of XinXiang Medical College. Induction of ketamine-related hippocampal neurotoxicity The in vivo protocol to induce ketamine-related hippocam- pal neurotoxicity was done as before with slight modifica- tions (Hayashi et al., 2002; Huang et al., 2012, Liu et al., 2012). Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75 mg/kg ketamine per day for six consecutive days (n ¼ 28). Normal saline was injected in the control group of mice (n ¼ 25). RNA isolation and reverse transcription Hippocampal RNA was isolated with Trizol reagent (In Vitrogen, Carlsbad, CA, USA). Briefly, mice were anesthe- tized and decapitated. Hippocampal samples were retrieved and homogenized at 1 mL Trizol/0.1 g tissue. The quantity of RNA was assessed by spectrophotometry followed by 1% agarose gel electrophoresis. Total RNA was treated with 10 U of RNase free DNase I, and reverse transcription (RT) was done in a total volume of 20 mL with random hexamer primers using a High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). cDNA was stored at (cid:3)20(cid:4)C until further use. Quantitative RT-PCR Expression of miR-34a, miR-34b, miR-34c, and house- keeping gene GAPDH were measured by TaqMan micro- RNA RT-PCR on the ABI 7900 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). Expression profiles of each gene were quantified using corresponding standard curves. End-point RT-PCR of miR-34a, miR-34b, miR-34c, and GAPDH used 50 ng of total RNA with a mirVana RT-PCR miRNA Detection Kit (Ambion, Austin, Cell Biol Int 39 (2015) 164–168 © 2014 International Federation for Cell Biology miR-34c in hippocampus Texas, USA). PCR products were separated and visualized on a 4% agarose gel. Each sample was run in triplicate and a mean value of each Ct triplicate was used. Lentivirus production and transduction To downregulate miR-34c, the coding sequence for a 2’-O- methyl oligonucleotide of miR-34c inhibitor was UCCGU- CACAUCAAUCGACUAACG, and the non-specific control antisense sequence was UACUCUUUCUAGGAGGUU- GUUAUU (Yu et al., 2012). These two sequences were amplified and cloned into pCDH-CMV-MCS-EF1-coGFP for in vivo gene transfer, resulting in a miR-34c inhibitor vector (lenti-miR34c-I) and miR-34c non-specific control vector (lenti-miR34c-C) (System Biosciences, Mountain View, CA, USA). The lentivirual expression vectors and pPACK packaging vector were co-transfected into 293T cells, and viral particles were collected and concentrated to high titer. Hippocampal injection One day after the 6-day ketamine treatment, the injections of lent viruses were performed on the right side of the cortex. A tiny hole was drilled above hippocampus and a Hamilton syringe was used to inject 2 mL of lentivirus of miR-34c inhibitor (lenti-miR34c-I, 20 mM, n ¼ 17) or non- specific control (lenti-miR34c-C, 20 mM, n ¼ 14) at the coordinates assessed from bregma and skull surface: lateral þ1.5 mm, and vertical anteroposterior (cid:3)2.0 mm, (cid:3)1.5 mm. After injection, the incision was quickly sealed with dental cement. Western blotting Western blotting analysis was conducted at 2 months. Four mice with Lenti-miR34c-I injection and four mice with Lenti-miR34c-C injection were included in this analysis. Forty micrograms of hippocampal protein were collected and separated on an 8% NuPage Gel with MES buffer (Invitrogen, Carlsbad, CA, USA) and transferred to a polyvinylidene difluoride membrane. Primary antibody dilutions included 1:500 BCL2 (Santa Cruz, USA), 1:100 phosphorylated-PKC (p-PKC) (Sant Cruz Biotechnologies, Santa Cruz, CA, USA), 1:100 phosphorylated-ERK (p-ERK) (Sant Cruz Biotechnologies, Santa Cruz, CA, USA), and 1:1,000 b-actin (Cell Signaling, Danvers, MA, USA). Membranes were then incubated in primary antibody in Odyssey Blocking Buffer at 4(cid:4)C for 24 h, followed by three washes in 0.1% PBS-T and 1 h incubation at RT with 1:1,000 secondary antibodies. The films were visualized and quantified on the Odyssey Infrared Imaging Center (Li-Cor, Lincoln, NE, USA). 165 miR-34c in hippocampus TUNEL staining for hippocampal apoptosis Hippocampal slices (350 mm) were prepared for terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) staining to detect the apoptosis, using an In Situ Cell Death Detection Kit according to manufacturer’s protocol (Roche, Branchburg, NJ, USA). Five mice with Lenti-miR34c-I injection and 5 mice with Lenti- miR34c-C injection were included in the analysis. Hippo- campal CA1 region was examined under a fluorescent scope. The apoptotic CA1 neurons were identified based on their size, location and immuno-reaction to TUNEL staining. The average number of the apoptotic neurons per 0.01 mm2 was measured and compared between control hippocampi and hippocampi treated with miR-34c inhibitor. Morris water maze (MWM) testing The MWM testing was carried out 1 month after hippocampal transfection of miR-34c knockdown. Eight mice with Lenti-miR34c-I injection and 5 mice with Lenti- miR34c-C injection were included in this analysis. In a large circular tank with a transparent platform (10 cm (cid:5) 10 cm), warm water at 26(cid:4)C was added to submerge the platform 1 cm below the surface. Visual cues of color paints were used to aid mice in locating the platform. The mice were given training sessions four times per day for one week before final testing. In each training session, the mice were put in the maze to locate the platform in 2 min followed by resting on the platform for 30 s. If mice did not locate the platform in 2 min, they were aided with flashing lights to the platform with 30 s of rest on top of the platform. On the final day of examination, the average swimming time and swimming distance were compared between control mice and the mice with miR-34c knockdown. Statistical analysis Statistic analysis was conducted with SPSS software (version 11.0). The measured data were presented as mean (cid:6) stan- dard deviations. The statistical differences were measured with a Student’s t-test, and the significance set at P < 0.05. Results miR-34c is upregulated in hippocampus by excessive ketamine administration We examined whether the expression profiles of the miRNAs in the mirR-34 family would be modulated by excessive ketamine application that induces neurodegener- (Hayashi et al., 2002, Huang ation in hippocampus et al., 2012; Liu et al., 2012). After injecting C57BL/6 mice at 2 weeks with 75 mg/kg ketamine for 6 days, they were 166 Y. Zhang et al. killed on the 7th day. Hippocampal mRNAs of miR-34 family, including miR-34a, miR-34b, and miR-34c, were measured by quantitative real-time PCR (qPCR). miR-34c was particularly upregulated, whereas miR-34a or miR-34b was relatively unchanged (Figure 1). Knocking down miR-34c ameliorates ketamine-induced hippocampal neurotoxicity To see if miR-34c has a role in modulating the neurotoxicity in hippocampus induced by excessive administration of keta- mine, we gave repeated daily administration of ketamine through systemic injection in young mice (P14) for six consecutive days. In hippocampus, the neurons in CA1 regions underwent significant apoptotic neurodegeneration, as previously reported (Hayashi et al., 2002, Huang et al., 2012; Liu et al., 2012). However, after injection of lentivirus containing miR-34c inhibitor (lenti-miR34-I) into mouse hippocampus on P21, TUNEL staining on 2-month old mouse hippocampal CA1 region showed that the number of apoptotic neurons was significantly reduced (Figure 2A), being about half of the number of apoptotic neurons in mice injected with control lentivirus (lenti-miR34c-C) (P < 0.05). Thus, inhibition of miR-34c helps ameliorate anesthesia- induced neurotoxicity in the hippocampus. Knocking down miR-34c upregulates anti-apoptotic pathways during ketamine-induced hippocampal neurotoxicity After systemic ketamine administration and hippocampal miR-34c lentivirus injection, Western blotting analysis was used on the 2-month old mice (Figure 2B). Anti-apoptotic protein Bcl2 was significantly upregulated by knocking n o s s e r p x e A N R m 4 3 - R m i i 450% 400% 350% 300% 250% 200% 150% 100% 50% Contrl Ketamine 0% miR-34a miR-34b miR-34c Figure 1 Hippocampal miR-34c expression is upregulated by ketamine. Mice were treated with repetitive IP administration of ketamine, or normal saline (control) for 6 days. Expression of miR34a/b/c mRNAs (normalized to GAPDH) in hippocampus were examined by q-PCR. (*, P < 0.05, n ¼ 5). Cell Biol Int 39 (2015) 164–168 © 2014 International Federation for Cell Biology Y. Zhang et al. A lenti-miR34c-C lenti-miR34c-I B lenti-miR 34c-C lenti-miR 34c-I p-PKC p-ERK Bcl2 β-action Figure 2 Knocking down miR-34c reduces apoptosis, upregulated Bcl2 and PKC-ERK signaling pathway after ketamine-induced hippocampal neurotoxicity. (A) TUNEL staining of hippocampal CA1 region in 2-month-old mice induced with ketamine-related neurotoxicity. Hippocampal injection of control vector (lenti-miR34c-C), or vector of miR-34c inhibitor (lenti-miR34c-I) was performed on P21. (B) Western blotting was also used to compare Bcl2 protein, phosphorylated PKC (p- PKC), and phosphorylated ERK (p-ERK), between miR-34c inhibitor treated mice and control mice after ketamine-induced hippocampal neurotoxicity. (Scale bar: 50 mM). down miR-34c in the hippocampus. It was previously demonstrated that ketamine downregulated PKC pathway in the hippocampus to induce neuronal apoptosis (Huang et al., 2012; Liu et al., 2012). Here, we demonstrate that PKC pathway is indeed activated or strengthened, as more phosphorylated PKC and phosphorylated ERK were induced by genetically knocking down miR-34c after ketamine treatment. Knocking down miR-34c increases memory performance after ketamine-induced hippocampal neurotoxicity The question remained as to whether knocking down miR- 34c could rescue the memory loss after ketamine-induced neurotoxicity in hippocampus. Two-month-old mice were examined by the MWM test. For the control mice, lentivirus containing the non-specific control vector was injected in the hippocampus. Mice with hippocampal downregulation of miR-34c following ketamine-induced memory im- pairment, the averaged swimming time and swimming distance were both markedly reduced compared to the mice without hippocampal miR-34c downregulation (Figure 3). Thus, our result suggests that downregulation of miR-34c could increase memory. Cell Biol Int 39 (2015) 164–168 © 2014 International Federation for Cell Biology miR-34c in hippocampus A 80 ) c e s ( e m 60 i t g n m m w S i i 40 20 0 lenti-miR34c-C lenti-miR34c-I B ) m c ( e c n a t s d i 1300 1000 g n m m w S i i 500 lenti-miR34c-C lenti-miR34c-I Figure 3 Knocking down miR-34c increases memory performance after ketamine-induced hippocampal neurotoxicity. Mice were initially induced with hippocampal neurotoxicity by repeated administra- tion of ketamine, and then followed by hippocampal injection of control vector (lenti-miR34c-C, left), or miR-34c inhibitor (lenti-miR34c-I, right). Morris water maze was used at 2 months to compare memory performance. Both swimming time (A) and swimming distance (B) were shortened in the mice receiving miR-34c inhibitor after ketamine- induced memory dysfunction in hippocampus. *, P < 0.05 (n ¼ 5). Discussion Ketamine is commonly used in pediatric anesthesia, but evidence suggests that excessive or repetitive usage of ketamine hinders or even damages the normal development of neonatal brain in both animal and human. We need to understand the underlying molecular mechanisms of this cortical neurotoxic event, as well as identify therapeutic targets to reduce or inhibit anesthesia-induced neuro- degeneration in the brain. miR-34c had an important role in anesthesia-induced hippocampal neurodegeneration. Though all three members of the miR-34 family, miR-34a, miR-34b, and miR-34c, are expressed in hippocampus, little is known about their exact roles in modulating hippocampal maturation or develop- ment (Juhila et al., 2011). miR-34c is upregulated in neurodegenerative diseases or under stress condition, and targeted inhibition of miR-34c markedly improved learning capability in mice (Haramati et al., 2011; Zovoilis et al., 2011). After introducing hippocampal neurodegen- in vivo eration in mouse through ketamine induction, 167 miR-34c in hippocampus inhibition of miR-34c in hippocampus significantly im- proved MWM performance, with shortened swimming time and distance to locate platforms. Thus, along with previous findings, the results point to a critical role of miR-34c in regulating memory function through hippocampus in the brain. It is noteworthy that anti-apoptotic protein Bcl2 was upregulated by miR-34c being knocked down after keta- mine-induced neurotoxicity in hippocampus. The expres- sion, or induced overexpression of Bcl2 protein by tumor necrosis factor (Tamatani et al., 1999) or estrogen receptors (Zhao et al., 2004), proved protective against neuronal apoptosis in the hippocampus. And miR-34a is inversely associated with Bcl2 expression in cortex in Alzheimer’s disease (Wang et al., 2009), but there has been no report identifying any of the miR-34 family in the regulation of Bcl2 expression in hippocampus. Thus, our finding showing that knocking down miR-34c upregulated Bcl2 expression level in hippocampus after ketamine-induced neurotoxicity is novel, and also indicates that miR-34 family microRNA might be directly involved in the regulation of neuronal apoptosis in the hippocampus. Thus, our data could further our understanding on identifying the underlying mecha- nisms of anesthesia-induce neurotoxicity, as well as developing targeted clinic therapies to treat anesthesia- induced neurotoxicity in neonatal brains. Acknowledgements and funding References Agostini M, Tucci P, Killick R, Candi E, Sayan BS, di val Cervoval PR, et al. (2011) Neuronal differentiation by TAp73 is mediated by microRNA-34a regulation of synaptic protein targets. Proc Natl Acad Sci 108: 21093–8. Brambrink AM, Orfanakis A, Kirsch JR (2012) Anesthetic neurotoxicity. Anesthesiol Clin 30: 207–28. Casci T, (2012) Ageing: MicroRNA tunes ageing pathway in flies. Nat Rev Genet 13: 222–3. Darnell DK, Kaur S, Stanislaw S, Konieczka JH, Yatskievych TA, Antin PB (2006) MicroRNA expression during chick embryo development. Dev Dyn 235: 3156–65. Domino EF (2010) Taming the ketamine tiger. 1965. Anesthesi- ology 113: 678–84. Dong C, Anand K (2013) Developmental neurotoxicity of ketamine in pediatric clinical use. Toxicol Lett. Haramati S, Navon I, Issler O, Ezra-Nevo G, Gil S, Zwang R, et al. (2011) MicroRNA as repressors of stress-induced anxiety: the case of amygdalar miR-34. J Neurosci 31: 14191–203. Hayashi H, Dikkes P, Soriano SG (2002) Repeated administration of ketamine may lead to neuronal degeneration in the developing rat brain. Paediatr Anaesth 12: 770–4. 168 Y. Zhang et al. Huang L, Liu Y, Jin W, Ji X, Dong Z (2012) Ketamine potentiates hippocampal neurodegeneration and persistent learning and memory impairment through the PKCgamma-ERK signaling pathway in the developing brain. Brain Res 1476: 164–71. Huang L, Liu Y, Zhang P, Kang R, Li X, Bo L, et al. (2013) In vitro dose-dependent inhibition of the intracellular spontaneous calcium oscillations in developing hippocampal neurons by ketamine. PLoS One 8: e59804. Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K, et al. (1999) Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 283: 70–4. Juhila J, Sipila T, Icay K, Nicorici D, Ellonen P, Kallio A, et al. (2011) MicroRNA expression profiling reveals miRNA families regulating specific biological pathways in mouse frontal cortex and hippocampus. PLoS One 6: e21495. Kim VN (2005) Small RNAs: classification biogenesis, and function. Mol Cells 19: 1–15. Kosik KS (2006) The neuronal microRNA system. Nat Rev Neurosci 7: 911–20. Kosik KS, Krichevsky AM (2005) The elegance of the MicroRNAs: a neuronal perspective. Neuron 47: 779–82. Lau P, Hudson LD (2010) MicroRNAs in neural cell differentia- tion. Brain Res 1338: 14–9. Liu N, Landreh M, Cao K, Abe M, Hendriks G-J, Kennerdell JR, et al. (2012) The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. Nature 482: 519–23. McGowan FX, Jr., Davis PJ (2008) Anesthetic-related neurotox- icity in the developing infant: of mice, rats, monkeys and, possibly, humans. Anesth Analg 106: 1599–602. Olney J, Labruyere J, Wang G, Wozniak D, Price M, Sesma M (1991) NMDA antagonist neurotoxicity: mechanism and prevention. Science (Washington) 254: 1515–8. Tamatani M, Che YH, Matsuzaki H, Ogawa S, Okado H, Miyake S-i , et al. (1999) Tumor necrosis factor induces Bcl-2 and Bcl-x expression through NFŒ B activation in primary hippo- campal neurons. J Biol Chem 274: 8531–8. R Wang X, Liu P, Zhu H, Xu Y, Ma C, Dai X, et al. (2009) MiR-34a, a microRNA up-regulated in a double transgenic mouse model of Alzheimer’s disease, inhibits bcl2 translation. Brain Res Bull 80: 268–73. Yu F, Jiao Y, Zhu Y, Wang Y, Zhu J, Cui X, et al. (2012) MicroRNA 34c gene down-regulation via DNA methylation promotes self- transition in breast renewal and epithelial-mesenchymal tumor-initiating cells. J Biol Chem 287: 465–73. Zhao L, Wu T-w, Brinton RD (2004) Estrogen receptor subtypes alpha and beta contribute to neuroprotection and increased Bcl-2 expression in primary hippocampal neurons. Brain Res 1010: 22–34. Zovoilis A, Agbemenyah HY, Agis-Balboa RC, Stilling RM, Edbauer D, Rao P, et al. (2011) MicroRNA-34c is a novel target to treat dementias. Embo J 30: 4299–308. Received 25 February 2014; accepted 5 June 2014. Final version published online January 2015. Cell Biol Int 39 (2015) 164–168 © 2014 International Federation for Cell Biology",mice,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']",postnatal day 14,"['Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75 mg/kg ketamine per day for six consecutive days (n ¼ 28).']",Y,['Cognitive examination with the Morris water maze test showed that ketamine-induced memory impairment was significantly improved by miR-34c downregulation.'],ketamine,"['Ketamine is a commonly used pediatric anesthetic, but it might affect development, or even induce neurotoxicity in the neonatal brain.']",none,[],c57bl/6,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']","The study addresses the role of miR-34c in ketamine-induced neurotoxicity in the neonatal mouse hippocampus, which is a novel aspect not previously resolved.","['We have used an in vivo neonatal mouse model to induce ketamine-related neurotoxicity in the hippocampus, and found that miR-34c, a microRNA associated with pathogenesis of Alzheimer’s disease, was significantly upregulated during ketamine-induced hippocampal neurodegeneration.']",The use of a lentiviral vector to downregulate miR-34c and investigate its role in modulating anesthesia-induced neurotoxicity in vivo.,['A lentiviral vector was used to downregulate miR-34c to investigate its functional role in modulating anesthesia-induced neurotoxicity in hippocampus in vivo.'],"The findings suggest that miR-34c plays a crucial role in regulating ketamine-induced neurotoxicity, which could lead to new therapeutic targets for preventing anesthesia-induced neurodegeneration in neonatal brains.","['Thus, miR-34c is important in regulating ketamine-induced neurotoxicity in hippocampus.']",None,[],Potential applications include developing targeted therapies to treat or prevent anesthesia-induced neurotoxicity in neonatal brains by modulating miR-34c.,"['Thus, miR-34c is important in regulating ketamine-induced neurotoxicity in hippocampus.']",True,True,True,True,True,True,10.1002/cbin.10349 10.1213/ANE.0000000000000030,903.0,Cheng,2014,mice,postnatal day 7,N,isoflurane,none,cd-1,"N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t NIH Public Access Author Manuscript Anesth Analg. Author manuscript; available in PMC 2014 June 01. Published in final edited form as: Anesth Analg. 2014 June ; 118(6): 1284–1292. doi:10.1213/ANE.0000000000000030. Subclinical Carbon Monoxide Limits Apoptosis in the Developing Brain After Isoflurane Exposure Ying Cheng and Richard J. Levy, MD Division of Anesthesiology and Pain Medicine, Children’s National Medical Center, The George Washington University School of Medicine and Health Sciences, Washington, DC. Abstract BACKGROUND—Volatile anesthetics cause widespread apoptosis in the developing brain. Carbon monoxide (CO) has antiapoptotic properties, and exhaled endogenous CO is commonly rebreathed during low-flow anesthesia in infants and children, resulting in subclinical CO exposure. Thus, we aimed to determine whether CO could limit isoflurane-induced apoptosis in the developing brain. METHODS—Seven-day-old male CD-1 mouse pups underwent 1-hour exposure to 0 (air), 5, or 100 ppm CO in air with or without isoflurane (2%). We assessed carboxyhemoglobin levels, cytochrome c peroxidase activity, and cytochrome c release from forebrain mitochondria after exposure and quantified the number of activated caspase-3 positive cells and TUNEL positive nuclei in neocortex, hippocampus, and hypothalamus/thalamus. RESULTS—Carboxyhemoglobin levels approximated those expected in humans after a similar time-weighted CO exposure. Isoflurane significantly increased cytochrome c peroxidase activity, cytochrome c release, the number of activated caspase-3 cells, and TUNEL positive nuclei in the forebrain of air-exposed mice. CO, however, abrogated isoflurane-induced cytochrome c peroxidase activation and cytochrome c release from forebrain mitochondria and decreased the number of activated caspase-3 positive cells and TUNEL positive nuclei after simultaneous exposure with isoflurane. CONCLUSIONS—Taken together, the data indicate that CO can limit apoptosis after isoflurane exposure via inhibition of cytochrome c peroxidase depending on concentration. Although it is unknown whether CO directly inhibited isoflurane-induced apoptosis, it is possible that low-flow Copyright © 2014 International Anesthesia Research Society Address correspondence to Richard J. Levy, MD, Division of Anesthesiology and Pain Medicine, Children’s National Medical Center, 111 Michigan Ave., NW, Washington, DC 20010. rlevy@cnmc.org.. DISCLOSURES Name: Ying Cheng Contribution: This author helped collect data, analyzed the data, and contributed in study design. Attestation: Ms. Cheng attests to the integrity of the data and the analysis and approves the final manuscript. She is the archival author. Name: Richard J. Levy, MD. Contribution: This author designed the study, analyzed the data, and prepared the manuscript. Attestation: Dr. Levy attests to the integrity of the data and the analysis and approves the final manuscript. This manuscript was handled by: Gregory J. Crosby, MD. The authors declare no conflicts of interest. Reprints will not be available from the authors. N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy anesthesia designed to target rebreathing of specific concentrations of CO may be a desired strategy to develop in the future in an effort to prevent anesthesia-induced neurotoxicity in infants and children. Anumber of commonly used anesthetic drugs cause widespread neuronal apoptosis in the developing mammalian brain.1–5 Vulnerability coincides with the period of synaptogenesis, and anesthesia-induced neurotoxicity has been shown to result in significant neuron loss, behavioral impairments, and cognitive deficits in a variety of newborn animal models.6,7 Although a causal relationship in humans has yet to be demonstrated, evidence indicating an association between anesthesia exposure and cognitive and behavioral disorders in young children continues to emerge.8–10 Thus, there is a need to develop protective strategies to prevent potential anesthesia-induced neurodegeneration in infants and children. The exact upstream mechanisms that initiate anesthesia-induced neurotoxicity are not completely understood; however, downstream, the process is mediated by the mitochondrial pathway of apoptosis.6,11 After anesthetic exposure, Bax translocates to the outer mitochondrial membrane, resulting in mitochondrial permeabilization, release of cytochrome c, widespread caspase-3 activation, and DNA fragmentation.6 Upstream of this phenomenon, cytochrome c is bound to cardiolipin on the inner mitochondrial membrane via electrostatic and hydrophobic interactions.12 Cytochrome c has peroxidase activity and, in the presence of hydrogen peroxide, oxidizes cardiolipin to hydroperoxycardiolipin.12 This mobilizes cytochrome c from the inner membrane and permits it to be released after permeabilization of the outer mitochondrial membrane. Carbon monoxide (CO) is a colorless and odorless gas that has antiapoptotic properties.13–18 CO prevents apoptosis by binding to the cytochrome c-cardiolipin complex and inhibiting cytochrome c peroxidase activity.12,19 This prevents oxidation of cardiolipin, mobilization and release of cytochrome c, and subsequent caspase activation. It has been demonstrated that brief exposure to low concentrations of CO inhibits developmental programmed cell death in vivo in the forebrain of newborn mice.19 It is important to note that infants and children are routinely exposed to CO during low-flow anesthesia when rebreathing is permitted.20,21 The source of CO in this setting is likely exhaled endogenous CO generated via heme catabolism.21 Because exhaled CO is not scavenged or removed from the anesthesia breathing circuit, during low-flow anesthesia, patients rebreathe exhaled CO and experience a subclinical CO exposure.21,22 In this work, we aimed to determine whether the antiapoptotic effects of subclinical concentrations of inspired CO could limit anesthesia- induced neuronal apoptosis. We demonstrated that CO exposure limits apoptosis in a variety of brain regions in newborn mice exposed to isoflurane by inhibiting cytochrome c peroxidase activity and subsequent cytochrome c release. These findings are clinically relevant and could have implications for the development of low-flow anesthesia as a standard paradigm to target low CO concentration exposures in infants and children to prevent anesthesia-induced neurotoxicity. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 2 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy METHODS Animal Exposures The care of the animals in this study was in accordance with National Institutes of Health and Institutional Animal Care and Use Committee guidelines. Study approval was granted by the Children’s National Medical Center. Sixto 8-week-old CD-1 pregnant female mice (20–30 grams) were acquired (Charles River, Wilmington, MA) to yield newborn pups. CD-1 mice were chosen because pups have been shown to reliably demonstrate neuronal changes consistent with human neonatal injury in specific experimental models.23 On postnatal day 7 (P7), we exposed male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO in air, or 100 ppm CO in air with and without isoflurane (2%) for 1 hour in a 7-L Plexiglas chamber (25 × 20 × 14 cm). The 3 experimental CO cohorts represented: negative control (0 ppm CO), low concentration subclinical CO (5 ppm), and high concentration subclinical CO (100 ppm). The chamber had a port for fresh gas inlet and a port for gas outlet that was directed to a fume hood exhaust using standard suction tubing. Specific concentrations of CO in air (premixed gas H-cylinders, Air Products, Camden, NJ) were verified using an electrochemical sensing CO detector (Monoxor III, Bacharach, Anderson, CA). Designated CO mixtures were delivered through the variable bypass isoflurane vaporizer and exposure chamber at a flow rate of 8 to 12 L/min. Mice were kept warm with an infrared heating lamp (Cole-Parmer, Court Vernon Hills, IL). P7 was chosen because synaptogenesis peaks at day 7 in rodents and is completed by the second or third week of life.24,25 One hour exposure to 2% isoflurane has been shown to activate brain capsase-3 in 7-day-old mice and is a brief anesthetic exposure.26 After exposure, pups were placed with their respective dams. Eighty- four newborn mice were evaluated. Carboxyhemoglobin (COHb) Levels COHb levels were measured immediately after 1-hour exposure. At the time of euthanasia, after pentobarbital injection (150 mg/kg, intraperitoneal), 200 μL blood was sampled from the left ventricle and COHb measured via 6 wavelength co-oximetry (Radiometer Osm3 Hemoximeter, Copenhagen, Denmark, range 0–100 ± 0.2%). Five animals per cohort were evaluated. Activated Caspase-3 Immunohistochemistry Five hours after exposure, following euthanasia with pentobarbital injection (150 mg/kg, ip), the brain was perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) via left ventricle injection for 30 minutes and then postfixed in additional fixative solution for 24 hours at 4°C. Serial sections were cut at a thickness of 6 μm in the coronal plane through the cerebral hemispheres beginning at −1.7 mm from bregma and 2.1 mm from interaural, and individual sections were slide mounted. Immunohistochemistry was performed on 3 to 4 nonserial nonadjacent sections using polyclonal antirabbit activated caspase-3 (Cell Signaling Technology, Beverly, MA), biotinylated secondary antibody (goat antirabbit, Cell Signaling Technology), and developed with diaminobenzidine. Nuclei were counterstained with hematoxylin. The number of activated caspase-3 positive cells per square millimeter was quantified at ×10 magnification in neocortex (primary and secondary somatosensory and auditory neocortices), hippocampus (dentate gyrus, CA1, CA2, and CA3 regions), and Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 3 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy hypothalamic/thalamic region (laterodorsal, mediodorsal, ventromedial, ventrolateral, ventroposteromedial, ventroposterolateral thalamic nuclei, ventromedial hypothalamic nucleus, peduncular part of the lateral hypothalamus, and the central anterior hypothalamic area) of both hemispheres in 3 to 4 animals per group. Brain regions were defined in accordance with Mouse Brain Atlas.27,28 Terminal Deoxynucleotidyl Transferase-Mediated UTP Nick End-Labeling Staining Five hours after exposure, following euthanasia, the brain was perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) via left ventricle injection for 30 minutes and then postfixed in additional fixative solution for 24 hours at 4°C. Paraffin- embedded brain sections were cut into 6-μm sections in the coronal plane through the cerebral hemispheres beginning at −1.7 mm from bregma, 2.1 mm from interaural, slide mounted, and stained for terminal deoxynucleotidyl transferase-mediated UTP nick end- labeling (TUNEL). Sections were incubated in 0.5% Triton at room temperature, followed by proteinase K at 37°C, then immersed in terminal deoxynucleotidyl transferase (TdT) buffer (30 mmol/L Tris-HCl buffer, pH 7.2, 140 mmol/L sodium cacodylate, and 1 mmol/L cobalt chloride) at room temperature. This was followed by incubation with TdT and biotin-16-dUTP for 60 minutes at 37°C. The reaction was terminated with TB buffer (300 mmol/L sodium chloride with 30 mmol/L sodium citrate) at room temperature, followed by immersion in 3% hydrogen peroxide and 2% fetal bovine serum at room temperature. The sections were then covered with an Avidin Biotin Complex (1:200 dilution) for 30 minutes at room temperature, incubated with FITCAvidin D for detection, and counterstained with DAPI. The numbers of TUNEL positive nuclei in neocortex, hippocampus, and hypothalamic/thalamic region (identical regions as for activated caspase-3) were quantified at ×10 magnification in 3 to 4 nonserial sections per mouse, and 3 to 4 mice per cohort were evaluated. Brain regions were defined in accordance with Mouse Brain Atlas.27,28 Cytochrome C Peroxidase Activity Immediately after 1-hour exposure, cytochrome c was extracted from fresh mitochondria as previously described.29 Isolated forebrain mitochondria (20 mg/mL) were suspended in a hypotonic 0.015 M KCl solution for 10 minutes on ice and then centrifuged at 105,000g for 15 minutes at 4°C. The pellet was resuspended in 0.15 M KCl solution for 10 minutes on ice and then centrifuged again at 105,000g for 15 minutes at 4°C. The supernatant was collected and cytochrome c content quantified with spectrophotometry. The peroxidase activity of 0.5 to 1 μM cytochrome c was determined by measuring the rate of oxidation of 50 μM 2,2 azinobis-(2-ethylbenzthiazoline-6-sulfonate) (ABTS) in 10 mM potassium phosphate buffer (pH 7.4) at 415 nm (ε415 = 3.6 × 104 M−1 cm−1) after the addition of hydrogen peroxide.30 Five animals per cohort were evaluated. Heme C Determination Immediately after 1-hour exposure, forebrain mitochondria and cytosol were isolated by differential centrifugation.31 As previously described, forebrain was harvested and homogenized in ice-cold H medium (70 mM sucrose, 220 mM mannitol, 2.5 mM Hepes, pH 7.4 and 2 mM EDTA).31 The homogenate was spun at 1500g for 10 minutes at 4°C. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 4 ′- N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Supernatant was removed and centrifuged at 10,000g for 10 minutes at 4°C. Cytosolic supernatant was collected, and pellet was resuspended in H medium and centrifuged again at 10,000g for 10 minutes at 4°C. Pellet was again resuspended in H medium, and mitochondrial and cytosolic protein concentrations subsequently determined using the method of Lowry.31 Mitochondrial and cytosolic heme c content were calculated from the difference in spectra (dithionate/ascorbate reduced minus air-oxidized) of mitochondria or cytosolic protein (0.5– 1 mg) solubilized in 10% lauryl maltoside using an absorption coefficient of 20.5 mM−1 cm−1 at 550 to 535 nm.32,33 Five animals per cohort were evaluated. Statistical Analysis Sample sizes for each end point were chosen based on previous work.19 Our previous study used 8 animals per cohort for COHb and heme c determination, 3 to 4 animals per cohort for activated caspase-3 and TUNEL assessment, and 5 animals per cohort for measurement of cytochrome c peroxidase activity, and data followed normal probability distribution.19 For this work, sample sizes were based on the number of animals needed to detect a 30% difference from air-exposed control values with a power of 80 based on an α of 0.01. Data are presented as mean ± SE. To assess statistical significance, we performed pairwise comparisons in an analysis of variance design using Tukey test. RESULTS Brief Subclinical CO Exposure With and Without Isoflurane in Newborn Mouse Pups To investigate the effects of subclinical CO on isoflurane-induced neuronal apoptosis, we exposed 7-day-old male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO (low concentration subclinical exposure), or 100 ppm CO (upper limit of subclinical exposure) for 1 hour with and without isoflurane (2%). P7 was chosen because synaptogenesis peaks on day 7 in rodents and is completed by the second or third week of life.24,25 The exposure time was chosen because inspiring isoflurane for 1 hour has been shown to activate brain capsase-3 in 7-day-old mice and is a clinically relevant anesthetic duration in infants and children.26 COHb levels increased significantly in the cohort exposed to 100 ppm CO without isoflurane with a trend toward significance in animals exposed to 100 ppm with isoflurane (Fig. 1). There was no significant difference in COHb levels in cohorts exposed to 5 ppm CO compared with air-exposed control values (Fig. 1). Isoflurane exposure had no independent effect on COHb levels (P = 0.34 [95% CI, 1.45 ± 0.05]) (Fig. 1). It is important to note that the resultant COHb levels measured after CO exposure in all groups approximated levels expected in humans after a similar time-weighted exposure (e.g., mean COHb of 3.27% in humans after 1-hour exposure to 100 ppm CO, 95% CI ± 0.12) (Fig. 1).34–36 Furthermore, these levels were well below values known to result in tissue hypoxia (70% COHb) and were markedly less than levels known to elicit signs and symptoms in humans (10% COHb).13,37 Thus, 1-hour exposure to 5 or 100 ppm CO in 7-day-old mouse pups was a subclinical CO exposure. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 5 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Brief Subclinical CO Exposure Inhibits Neuronal Apoptosis in Isoflurane-Exposed Mice Commonly used anesthetics cause widespread apoptosis in the developing mammalian brain.1–5 Thus, we determined the effect of CO on isoflurane-induced neuronal apoptosis in the neocortex, hippocampus, and hypothalamic and thalamic regions by assessing for activated caspase-3 with immunohistochemistry and TdT-mediated TUNEL staining on slide-mounted brain sections. Pups were evaluated 5 hours after simultaneous exposure to either 0 ppm CO (air), 5 ppm CO, or 100 ppm CO with or without isoflurane on P7. Consistent with previous work, 1-hour exposure to isoflurane in air significantly increased the number of activated caspase-3 positive cells and TUNEL positive nuclei in all brain regions examined compared with nonisoflurane air-exposed animals (Figs. 2 and 3).26 CO significantly decreased the number of activated caspase-3 positive cells and TUNEL positive nuclei in virtually every brain region of both cohorts exposed to CO with isoflurane compared with mice exposed to isoflurane in air (Figs. 2 and 3). It is important to note that activated caspase-3 and the number of TUNEL positive nuclei were at or below air-exposed levels in all brain regions evaluated after 100 ppm CO and isoflurane exposure. In addition, there appeared to be a concentration-dependent CO effect on the number of activated caspase-3 positive cells in the hypothalamus/thalamus and TUNEL positive nuclei in the neocortex and hippocampus of isoflurane-exposed mice. Exposure to CO without isoflurane had variable effects on activated caspase-3 and the number of TUNEL positive nuclei compared with air-exposed controls (Figs. 2 and 3). Differences trended toward significance between CO-exposed cohorts without isoflurane in the number of TUNEL positive nuclei in the hippocampus and hypothalamus/thalamus of 100 ppm CO exposed mice vs animals exposed to 5 ppm CO (Fig. 3). CO Inhibits Forebrain Cytochrome C Peroxidase Activity and Isoflurane-Induced Cytochrome C Release from Mitochondria Peroxidation of cardiolipin is an upstream event that is important for cytochrome c release and initiation of the mitochondrial apoptosis pathway.12 CO can bind to the cytochrome c- cardiolipin complex and inhibit cytochrome c peroxidase activity, thereby preventing oxidation of cardiolipin and mobilization and release of cytochrome c.12,19 Thus, we extracted cytochrome c from forebrain mitochondria immediately after 1-hour exposure to either 0 ppm CO (air), 5 ppm CO, or 100 ppm CO with or without isoflurane on P7 and measured peroxidase activity of cytochrome c using spectrophotometry. To assess for cytochrome c release, we measured the amount of heme c (the heme moiety of cytochrome c) in forebrain mitochondrial and cytosolic fractions immediately after exposure. Isoflurane either significantly increased or trended toward a significant increase in forebrain cytochrome c peroxidase activity after 1-hour exposure in air compared with all nonisoflurane-exposed cohorts (Fig. 4). All isoflurane-exposed cohorts demonstrated significantly higher or a trend toward significantly higher cytochrome c peroxidase activity compared with nonisoflurane CO matched cohorts (Fig. 4). CO exposure significantly decreased forebrain cytochrome c peroxidase activity in isoflurane and nonisoflurane- exposed cohorts in a concentration-dependent manner (Fig. 4). CO-mediated inhibition of Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 6 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy cytochrome c peroxidase resulted in enzyme activities that were below that of air-exposed control values in all CO-exposed cohorts (Fig. 4). After isoflurane exposure for 1 hour in air, heme c levels decreased significantly in the mitochondrial fraction and increased significantly in the cytosolic fraction compared with nonisoflurane air-exposed controls, suggesting increased cytochrome c release in the forebrain after exposure (Fig. 5). CO exposure without isoflurane trended toward a significant increase in the amount of heme c in forebrain mitochondria in 5 ppm exposed animals compared with air-exposed controls (Fig. 5A). Cytosolic heme c content in forebrain decreased significantly in both cohorts exposed to CO without isoflurane compared with air-exposed controls, indicating inhibition of cytochrome c release (Fig. 5B). Exposure to CO with isoflurane resulted in significantly increased heme c levels within forebrain mitochondria of 100 ppm exposed mice and significantly decreased heme c in cytosol of both CO-exposed cohorts compared with animals exposed to isoflurane alone (Fig. 5). Decreases in cytosolic heme c after CO exposure with isoflurane were dose- dependent, and levels were at or below air-exposed control values (Fig. 5B). Mitochondrial heme c levels in animals exposed to isoflurane with 100 ppm CO were equivalent to levels seen in forebrain mitochondria of controls exposed to air alone (Fig. 5A). Taken together, the data suggest that CO inhibits forebrain cytochrome c peroxidase and, depending on concentration, can decrease isoflurane-induced cytochrome c release. DISCUSSION Our findings are consistent with previous work and support the concept that isoflurane causes neurotoxicity in the developing mammalian brain via activation of the intrinsic apoptosis pathway.6,11 In addition, we demonstrate for the first time that, upstream from cytochrome c release, isoflurane increases forebrain cytochrome c peroxidase activity. It is important to note that subclinical concentrations of CO inhibited isoflurane-induced cytochrome c peroxidase activation in a dose-dependent manner and decreased the release of cytochrome c, limiting apoptosis in the developing brain after exposure to isoflurane. Because hydrogen peroxide is required for induction of cytochrome c peroxidase, increased peroxidase activity likely resulted from isoflurane-induced oxidative stress.38,39 Although we did not measure free radicals as part of this study, isoflurane and other anesthetic drugs generate reactive oxygen, nitrogen species, and hydrogen peroxide in developing neurons, hippocampus, subiculum, and thalamus.40–42 In addition, cytochrome c peroxidase activity has been shown to increase in the forebrain of mice during oxidative stress, and cytochrome c has been developed as a biosensor for hydrogen peroxide detection.43,44 Thus, isoflurane exposure likely increased hydrogen peroxide production that, in turn, enhanced the peroxidase activity of cytochrome c.38 Finding increased cytochrome c peroxidase activity after isoflurane exposure is significant because it uncovers a potential target for therapeutic intervention. Peroxidase activation is necessary and critical for mobilization and release of cytochrome c from mitochondria during apoptosis.12 Release of cytochrome c is often considered the “point of no return” in the pathway.45 Thus, targeting the peroxidase activity of cytochrome c is logical and Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 7 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy inhibiting cytochrome c peroxidase could prevent cytochrome c release during proapoptotic stimuli such as with anesthetic exposure. In support of this concept, low concentrations of inhaled CO (50–500 ppm) have been shown to prevent apoptosis in endothelium, vascular smooth muscle, liver, lung tissue during hyperoxia, sepsis, and ischemia-reperfusion.14–18 In previous work, we demonstrated that brief exposure to low CO concentrations can inhibit cytochrome c peroxidase in vivo and impair programmed cell death in the developing forebrain of newborn mice.19 Here we demonstrate that CO, inspired at subclinical concentrations, inhibits activation of cytochrome c peroxidase during isoflurane exposure and impairs release of cytochrome c. CO prevents apoptosis by binding to the cytochrome c-cardiolipin complex and inhibiting cytochrome c peroxidase activity.12 This prevents oxidation of cardiolipin and subsequent release of cytochrome c.12 Although it is possible that CO may exert its prosurvival response via a variety of other mechanisms, our data suggest that abrogation of isoflurane- induced apoptosis may be due to CO-mediated inhibition of cytochrome c peroxidase activation. This is supported by finding concentration-dependent responses to subclinical CO exposure within different aspects of the intrinsic apoptosis pathway that we assayed (cytochrome c peroxidase, cytochrome c release, activation of caspase-3, and DNA breakage [TUNEL]). Although the data indicate that low concentrations of CO can inhibit apoptosis in the developing brain, we have not conclusively shown that CO directly prevents isoflurane- induced neuronal apoptosis. This is important because the CO effect could simply be a generalized, nonspecific phenomenon. Thus, it is possible that CO-mediated inhibition of apoptosis and anesthetic-induced apoptosis are 2 distinct processes that occur simultaneously and independently within the developing brain but not necessarily in the same cells. If these 2 processes are mutually exclusive, then certain cell populations would undergo apoptosis after exposure to isoflurane while totally different cell populations, destined to die via developmental programmed cell death, would survive due to CO- mediated inhibition of the intrinsic apoptosis pathway. Although the total number of neurons undergoing apoptosis in this scenario would be relatively decreased compared with isoflurane exposure alone, the impact on neurodevelopment could be devastating. This is because we have previously demonstrated that exposure to low concentrations of CO in the absence of an anesthetic prevents natural programmed cell death in the neocortex and hippocampus of 10-day-old mice and impairs neurocognitive development.19 Thus, although CO has antiapoptotic properties, its unchecked effects in the developing brain could be equally as deleterious as the effects of anesthetics alone. Furthermore, brief, low concentration CO exposures can also cause oxidative stress.46 Such undesired effects could enhance apoptosis during development and could explain our findings regarding activated caspase-3 and TUNEL in the cohorts exposed to CO for 1 hour without isoflurane. So it is possible that CO has the potential to exert proapoptotic effects that could act synergistically with isoflurane. Thus, before implementing subclinical CO exposure in everyday clinical practice, its safety and efficacy must be established given the fact that its pro- and antiapoptotic effects could have adverse consequences in the developing brain. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 8 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy The only way to prove that CO directly prevents the proapoptotic effect of isoflurane is to evaluate neurocognitive function and behavior after exposure. The fact that we have not included such an assessment in this work is a major limitation of the study. However, this will be the focus of future work. Thus, until we determine neurodevelopmental outcome after combined exposure to CO with isoflurane, we cannot draw definitive conclusions about the benefit of CO during an anesthetic. Regarding clinical toxicity, elevated COHb levels are formed after exposure to high concentrations of CO and can interfere with tissue oxygen delivery by impairing oxygen binding to and dissociation from hemoglobin.37 Overt clinical toxicity manifests from tissue hypoxia when COHb levels are higher than 70%, and signs and symptoms first appear when COHb levels are higher than 10%.13,37 Acute exposure to CO concentrations larger than 800 ppm can rapidly cause brain injury, cerebral edema, coma, and death, while brief exposure to 220 ppm results in headache, dizziness, and impaired judgment.34 Exposure to concentrations <120 ppm does not elicit any appreciable clinical symptoms.34 Thus, short- term exposure to 5 or 100 ppm CO is a non–life-threatening subclinical exposure, and the resultant COHb levels are well below values that cause tissue hypoxia and clinical signs and symptoms. CO is endogenously produced, and infants and children routinely inspire subclinical concentrations of CO when rebreathing is permitted during low-flow general anesthesia.20,21,47 In previous work, we found that children inspire an average of 2 to 3 ppm CO and as much as 18 ppm CO during low-flow anesthesia.20,21 This resulted in an increase in COHb by an average of 0.2% up to 0.5% from baseline after 1 hour of low-flow anesthesia.20 In the current work, we found a similar increase in COHb after 1-hour exposure to 5 ppm CO and a 3% to 4% increase after exposure to 100 ppm CO. Thus, exposing newborn mice to 5 ppm CO with isoflurane mimics a subclinical CO exposure during lowflow anesthesia at a time point in late infancy. Here we found that 5 ppm CO limited apoptosis after isoflurane exposure while 100 ppm CO maintained levels of apoptosis at or below control values. These findings suggest that higher concentrations of subclinical CO may be necessary to completely offset the proapoptotic response to isoflurane. Thus, it is possible that levels of CO encountered with rebreathing during routine lowflow anesthesia may limit isoflurane-induced neurotoxicity but may not be adequate to completely prevent it. However, more investigation is necessary before such conclusions can be made. Targeting cytochrome c peroxidase to offset the oxidative stress of an anesthetic exposure is a novel and intriguing concept. Given that CO is commonly rebreathed during lowflow anesthesia and readily diffuses across the blood-brain barrier to gain access to the mitochondrial inner membrane, it has the potential to be developed as an antiapoptotic agent to prevent anesthesia-induced neurotoxicity.48 However, before routine application of CO as such a therapeutic agent, neurodegeneration needs to be definitively shown to occur in children after anesthetic exposure, CO must be shown to directly inhibit isoflurane-induced apoptosis, and the safety of subclinical CO exposure during development needs to be established. With further work, however, it is possible that low-flow anesthesia, intended to Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 9 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy result in low concentration CO exposure, may be established as a standard paradigm designed to protect the developing brain of the infants and children we care for. Acknowledgments Funding: None. REFERENCES 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early exposure to common anesthetic agents causes widespread neurode-generation in the developing rat brain and persistent learning deficits. J Neurosci. 2003; 23:876–82. [PubMed: 12574416] 2. Stefovska VG, Uckermann O, Czuczwar M, Smitka M, Czuczwar P, Kis J, Kaindl AM, Turski L, Turski WA, Ikonomidou C. Sedative and anticonvulsant drugs suppress postnatal neurogenesis. Ann Neurol. 2008; 64:434–45. [PubMed: 18991352] 3. Istaphanous GK, Loepke AW. General anesthetics and the developing brain. Curr Opin Anaesthesiol. 2009; 22:368–73. [PubMed: 19434780] 4. Brambrink AM, Evers AS, Avidan MS, Farber NB, Smith DJ, Zhang X, Dissen GA, Creeley CE, Olney JW. Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology. 2010; 112:834–41. [PubMed: 20234312] 5. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, McAuliffe JJ, Danzer SC, Loepke AW. Comparison of the neuroapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology. 2011; 114:578–87. [PubMed: 21293251] 6. Olney JW, Young C, Wozniak DF, Ikonomidou C, Jevtovic-Todorovic V. Anesthesia-induced developmental neuroapoptosis. Does it happen in humans? Anesthesiology. 2004; 101:273–5. [PubMed: 15277906] 7. Rizzi S, Ori C, Jevtovic-Todorovic V. Timing versus duration: determinants of anesthesia-induced developmental apoptosis in the young mammalian brain. Ann N Y Acad Sci. 2010; 1199:43–51. [PubMed: 20633108] 8. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, Gleich SJ, Schroeder DR, Weaver AL, Warner DO. Early exposure to anesthesia and learning disabilities in a population- based birth cohort. Anesthesiology. 2009; 110:796–804. [PubMed: 19293700] 9. DiMaggio C, Sun LS, Kakavouli A, Byrne MW, Li G. A retrospective cohort study of the association of anesthesia and hernia repair surgery with behavioral and developmental disorders in young children. J Neurosurg Anesthesiol. 2009; 21:286–91. [PubMed: 19955889] 10. Flick RP, Katusic SK, Colligan RC, Wilder RT, Voigt RG, Olson MD, Sprung J, Weaver AL, Schroeder DR, Warner DO. Cognitive and behavioral outcomes after early exposure to anesthesia and surgery. Pediatrics. 2011; 128:e1053–61. [PubMed: 21969289] 11. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V. Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience. 2005; 135:815–27. [PubMed: 16154281] 12. Kapetanaki SM, Silkstone G, Husu I, Liebl U, Wilson MT, Vos MH. Interaction of carbon monoxide with the apoptosis-inducing cytochrome c-cardiolipin complex. Biochemistry. 2009; 48:1613–9. [PubMed: 19183042] 13. Kao LW, Nañagas KA. Carbon monoxide poisoning. Emerg Med Clin North Am. 2004; 22:985– 1018. [PubMed: 15474779] 14. Zhou H, Liu J, Pan P, Jin D, Ding W, Li W. Carbon monoxide inhalation decreased lung injury via anti-inflammatory and anti-apoptotic effects in brain death rats. Exp Biol Med (Maywood). 2010; 235:1236–43. [PubMed: 20810760] 15. Song R, Kubo M, Morse D, Zhou Z, Zhang X, Dauber JH, Fabisiak J, Alber SM, Watkins SC, Zuckerbraun BS, Otterbein LE, Ning W, Oury TD, Lee PJ, McCurry KR, Choi AM. Carbon Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 10 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy monoxide induces cytoprotection in rat orthotopic lung transplantation via anti-inflammatory and anti-apoptotic effects. Am J Pathol. 2003; 163:231–42. [PubMed: 12819027] 16. Bernardini C, Zannoni A, Bacci ML, Forni M. Protective effect of carbon monoxide pre- conditioning on LPS-induced endothelial cell stress. Cell Stress Chaperones. 2010; 15:219–24. [PubMed: 19693705] 17. Sarady JK, Zuckerbraun BS, Bilban M, Wagner O, Usheva A, Liu F, Ifedigbo E, Zamora R, Choi AM, Otterbein LE. Carbon monoxide protection against endotoxic shock involves reciprocal effects on iNOS in the lung and liver. FASEB J. 2004; 18:854–6. [PubMed: 15001560] 18. Wang X, Wang Y, Kim HP, Nakahira K, Ryter SW, Choi AM. Carbon monoxide protects against hyperoxia-induced endothelial cell apoptosis by inhibiting reactive oxygen species formation. J Biol Chem. 2007; 282:1718–26. [PubMed: 17135272] 19. Cheng Y, Thomas A, Mardini F, Bianchi SL, Tang JX, Peng J, Wei H, Eckenhoff MF, Eckenhoff RG, Levy RJ. Neurodevelopmental consequences of sub-clinical carbon monoxide exposure in newborn mice. PLoS One. 2012; 7:e32029. [PubMed: 22348142] 20. Levy RJ, Nasr VG, Rivera O, Roberts R, Slack M, Kanter JP, Ratnayaka K, Kaplan RF, McGowan FX Jr. Detection of carbon monoxide during routine anesthetics in infants and children. Anesth Analg. 2010; 110:747–53. [PubMed: 20185653] 21. Nasr V, Emmanuel J, Deutsch N, Slack M, Kanter J, Ratnayaka K, Levy R. Carbon monoxide re- breathing during low-flow anaesthesia in infants and children. Br J Anaesth. 2010; 105:836–41. [PubMed: 20947594] 22. Woehlck HJ. Carbon monoxide rebreathing during low flow anesthesia. Anesth Analg. 2001; 93:516–7. [PubMed: 11473890] 23. Farahani R, Kanaan A, Gavrialov O, Brunnert S, Douglas RM, Morcillo P, Haddad GG. Differential effects of chronic intermittent and chronic constant hypoxia on postnatal growth and development. Pediatr Pulmonol. 2008; 43:20–8. [PubMed: 18041750] 24. Rice D, Barone S Jr. Critical periods of vulnerability for the developing nervous system: evidence from humans and animal models. Environ Health Perspect. 2000; 108(Suppl 3):511–33. [PubMed: 10852851] 25. Sanno H, Shen X, Kuru N, Bormuth I, Bobsin K, Gardner HA, Komljenovic D, Tarabykin V, Erzurumlu RS, Tucker KL. Control of postnatal apoptosis in the neocortex by RhoA-subfamily GTPases determines neuronal density. J Neurosci. 2010; 30:4221–31. [PubMed: 20335457] 26. Johnson SA, Young C, Olney JW. Isoflurane-induced neuroapoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol. 2008; 20:21–8. [PubMed: 18157021] 27. Franklin, KBJ.; Paxinos, G. The Mouse Brain in Stereotaxic Coordinates. Academic Press; San Diego, CA: 1997. 28. Paxinos, G.; Watson, C. Atlas of the Developing Mouse Brain: At E17.5, PO, and P6. Academic Press; San Diego, CA: 2007. 29. Jacobs EE, Sanadi DR. The reversible removal of cytochrome c from mitochondria. J Biol Chem. 1960; 235:531–4. [PubMed: 14406362] 30. Kim NH, Jeong MS, Choi SY, Kang JH. Peroxidase activity of cytochrome c. bull. Korean Chem Soc. 2004; 25:1889–92. 31. Piel DA, Gruber PJ, Weinheimer CJ, Courtois MR, Robertson CM, Coopersmith CM, Deutschman CS, Levy RJ. Mitochondrial resuscitation with exogenous cytochrome c in the septic heart. Crit Care Med. 2007; 35:2120–7. [PubMed: 17855825] 32. Ozawa T, Tanaka M, Shimomura Y. Crystallization of the middle part of the mitochondrial electron transfer chain: cyto-chrome bc1-cytochrome c complex. Proc Natl Acad Sci U S A. 1980; 77:5084–6. [PubMed: 6254056] 33. Tanaka M, Ogawa N, Ihara K, Sugiyama Y, Mukohata Y. Cytochrome aa(3) in Haloferax volcanii. J Bacteriol. 2002; 184:840–5. [PubMed: 11790755] 34. Winter PM, Miller JN. Carbon monoxide poisoning. JAMA. 1976; 236:1502. [PubMed: 989121] 35. Peterson JE, Stewart RD. Absorption and elimination of carbon monoxide by inactive young men. Arch Environ Health. 1970; 21:165–71. [PubMed: 5430002] Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 11 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy 36. Stewart RD, Peterson JE, Baretta ED, Bachand RT, Hosko MJ, Herrmann AA. Experimental human exposure to carbon mon-oxide. Arch Environ Health. 1970; 21:154–64. [PubMed: 5430001] 37. Gorman D, Drewry A, Huang YL, Sames C. The clinical toxicology of carbon monoxide. Toxicology. 2003; 187:25–38. [PubMed: 12679050] 38. Puchkov MN, Vassarais RA, Korepanova EA, Osipov AN. Cytochrome c produces pores in cardiolipin-containing planar bilayer lipid membranes in the presence of hydrogen peroxide. Biochim Biophys Acta. 2013; 1828:208–12. [PubMed: 23085196] 39. Kim H, Oh E, Im H, Mun J, Yang M, Khim JY, Lee E, Lim SH, Kong MH, Lee M, Sul D. Oxidative damages in the DNA, lipids, and proteins of rats exposed to isofluranes and alcohols. Toxicology. 2006; 220:169–78. [PubMed: 16442689] 40. Bai X, Yan Y, Canfield S, Muravyeva MY, Kikuchi C, Zaja I, Corbett JA, Bosnjak ZJ. Ketamine enhances human neural stem cell proliferation and induces neuronal apoptosis via reactive oxygen species-mediated mitochondrial pathway. Anesth Analg. 2013; 116:869–80. [PubMed: 23460563] 41. Matsuoka H, Watanabe Y, Isshiki A, Quock RM. Increased production of nitric oxide metabolites in the hippocampus under isoflurane anaesthesia in rats. Eur J Anaesthesiol. 1999; 16:216–24. [PubMed: 10234490] 42. Boscolo A, Milanovic D, Starr JA, Sanchez V, Oklopcic A, Moy L, Ori CC, Erisir A, Jevtovic- Todorovic V. Early exposure to general anesthesia disturbs mitochondrial fission and fusion in the developing rat brain. Anesthesiology. 2013; 118:1086–97. [PubMed: 23411726] 43. Cheng Y, Corbin JG, Levy RJ. Programmed Cell Death is Impaired in Fmr1mutant mice. Dev Neuroscience. 2013; 35:347–58. 44. De Wael K, Bashir Q, Van Vlierberghe S, Dubruel P, Heering HA, Adriaens A. Electrochemical determination of hydrogen peroxide with cytochrome c peroxidase and horse heart cytochrome c entrapped in a gelatin hydrogel. Bioelectrochemistry. 2012; 83:15–8. [PubMed: 21889423] 45. Ferraro E, Pulicati A, Cencioni MT, Cozzolino M, Navoni F, di Martino S, Nardacci R, Carrì MT, Cecconi F. Apoptosomedeficient cells lose cytochrome c through proteasomal degradation but survive by autophagy-dependent glycolysis. Mol Biol Cell. 2008; 19:3576–88. [PubMed: 18550800] 46. Thom SR, Ischiropoulos H. Mechanism of oxidative stress from low levels of carbon monoxide. Res Rep Health Eff Inst. 1997; 80:1–19. [PubMed: 9476263] 47. Hayashi M, Takahashi T, Morimatsu H, Fujii H, Taga N, Mizobuchi S, Matsumi M, Katayama H, Yokoyama M, Taniguchi M, Morita K. Increased carbon monoxide concentration in exhaled air after surgery and anesthesia. Anesth Analg. 2004; 99:444–8. [PubMed: 15271722] 48. Sutherland BA, Harrison JC, Nair SM, Sammut IA. Inhalation gases or gaseous mediators as neuroprotectants for cerebral ischaemia. Curr Drug Targets. 2013; 14:56–73. [PubMed: 23170797] Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 12 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Figure 1. Carboxyhemoglobin (COHb) levels after carbon monoxide (CO) exposure with and without isoflurane. COHb levels were measured immediately after CO exposure with (+) and without (−) isoflurane. Values are expressed as percentage (%) COHb means plus standard error. N = 5 animals per cohort. *P < 0.05 vs air and 5 ppm CO cohorts. †P < 0.01 vs air and 5 ppm CO cohorts. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 13 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Figure 2. Activated caspase-3 after carbon monoxide (CO) exposure with and without isoflurane. Immunohistochemistry for activated caspase-3 was performed on coronal sections 5 hours after exposure. (A) Representative sections imaged at ×10 from somatosensory neocortex (NC), hippocampus (HC), and hypothalamic/thalamic region (H/T) obtained after 1-hour exposure to air (0 ppm CO), 5 ppm CO, or 100 ppm CO with (+) and without (−) isoflurane are depicted. Arrowheads indicate activated caspase-3 stained cells. Activated caspase-3 positive cells undergoing degeneration within the boxed area in each section are magnified in the inset. CA1, CA2, dentate gyrus (DG) regions of HC are labeled. Scale bars, 100 μm. Quantification of activated caspase-3 stained cells in (B) neocortex (C) hippocampus and (D) hypothalamic/thalamic region are demonstrated. Values are expressed as means plus standard error. N = 3–4 animals per cohort. *P < 0.05 vs 0 ppm CO − isoflurane. †P < 0.01 vs 0 ppm CO − isoflurane. ^P < 0.001 vs 0 ppm CO − isoflurane. @ P < 0.05 vs 0 ppm CO + isoflurane. ‡P < 0.01 vs 0 ppm CO + isoflurane. #P < 0.001 vs 0 ppm CO + isoflurane. $P < 0.05 vs 5 ppm CO + isoflurane. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 14 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Figure 3. Apoptosis after carbon monoxide (CO) exposure with and without isoflurane. TUNEL assays were performed on coronal sections 5 hours after exposure. (A) Representative sections imaged at ×10 from somatosensory neocortex (NC), hippocampus (HC), and hypothalamic/thalamic region (H/T) obtained after 1-hour exposure to air (0 ppm CO), 5 ppm CO, or 100 ppm CO with (+) and without (−) isoflurane are depicted. Green TUNEL positive nuclei are visible. CA1, CA2, dentate gyrus (DG) regions of HC are labeled. Scale bars, 100 μm. Quantification of total TUNEL positive nuclei from NC, HC, and H/T in 3–4 nonserial coronal sections are demonstrated in (B) neocortex (C) hippocampus and (D) hypothalamic/thalamic region. Values are expressed as means plus standard error. N = 3–4 animals per cohort. *P < 0.05 vs 0 ppm CO − isoflurane. †P < 0.01 vs 0 ppm CO − isoflurane. ^P < 0.001 vs 0 ppm CO − isoflurane. @ P < 0.05 vs 0 ppm CO + isoflurane. ‡P < 0.01 vs 0 ppm CO + isoflurane. % P < 0.05 vs 5 ppm CO − isoflurane. &P < 0.01 vs 5 ppm CO − isoflurane. $P < 0.05 vs 5 ppm CO + isoflurane.?P < 0.05 vs 100 ppm CO − isoflurane. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 15 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Figure 4. Cytochrome c peroxidase activity after carbon monoxide (CO) exposure with and without isoflurane. Steady-state cytochrome c peroxidase activity immediately after 1-hour exposure is shown. Values are expressed as means plus standard error. N = 5 animals per cohort. *P < 0.05 vs 0 ppm CO − isoflurane, P < 0.001 vs 5 ppm CO − isoflurane, vs 100 ppm CO − isoflurane. †P < 0.01 vs 0 ppm CO − isoflurane. ‡P < 0.001 vs 0 ppm CO − isoflurane. ^P < 0.05 vs 5 ppm CO − isoflurane. @P < 0.01 vs 5 ppm CO − isoflurane. #P < 0.05 vs 100 ppm CO − isoflurane.?P < 0.01 vs 0 ppm CO + isoflurane. $P < 0.01 vs 5 ppm CO + isoflurane. %P < 0.001 vs 0 ppm CO + isoflurane. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 16 N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t N H P A A u t h o r I M a n u s c r i p t Cheng and Levy Figure 5. Cytochrome c release after carbon monoxide (CO) exposure with and without isoflurane. Heme c content within (A) mitochondria and (B) cytosol is demonstrated. Values are expressed as means plus standard error. N = 5 animals per cohort. *P < 0.05 vs 0 ppm CO − isoflurane. †P < 0.01 vs 0 ppm CO − isoflurane. #P < 0.05 vs 5 ppm CO + isoflurane. ‡P < 0.001 vs 0 ppm CO − isoflurane. ^P < 0.01 vs 0 ppm CO and 5 ppm + isoflurane. @P < 0.01 vs 5 ppm CO − isoflurane. Anesth Analg. Author manuscript; available in PMC 2014 June 01. Page 17",mice,"['Seven-day-old male CD-1 mouse pups underwent 1-hour exposure to 0 (air), 5, or 100 ppm CO in air with or without isoflurane (2%).']",postnatal day 7,"['Seven-day-old male CD-1 mouse pups underwent 1-hour exposure to 0 (air), 5, or 100 ppm CO in air with or without isoflurane (2%).']",N,[],isoflurane,"['Seven-day-old male CD-1 mouse pups underwent 1-hour exposure to 0 (air), 5, or 100 ppm CO in air with or without isoflurane (2%).']",none,[],cd-1,"['Seven-day-old male CD-1 mouse pups underwent 1-hour exposure to 0 (air), 5, or 100 ppm CO in air with or without isoflurane (2%).']",The study aimed to determine whether CO could limit isoflurane-induced apoptosis in the developing brain.,"['Thus, we aimed to determine whether CO could limit isoflurane-induced apoptosis in the developing brain.']",None,[],The findings suggest that CO can limit apoptosis after isoflurane exposure via inhibition of cytochrome c peroxidase depending on concentration.,"['Taken together, the data indicate that CO can limit apoptosis after isoflurane exposure via inhibition of cytochrome c peroxidase depending on concentration.']",None,[],The development of low-flow anesthesia as a standard paradigm to target low CO concentration exposures in infants and children to prevent anesthesia-induced neurotoxicity.,['anesthesia designed to target rebreathing of specific concentrations of CO may be a desired strategy to develop in the future in an effort to prevent anesthesia-induced neurotoxicity in infants and children.'],True,True,True,True,True,True,10.1213/ANE.0000000000000030 10.1007/s12640-018-9877-3,437.0,Chen,2018,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"Neurotoxicity Research (2018) 34:188–197 https://doi.org/10.1007/s12640-018-9877-3 ORIGINAL ARTICLE Neonatal Exposure to Low-Dose (1.2%) Sevoflurane Increases Rats’ Hippocampal Neurogenesis and Synaptic Plasticity in Later Life Xi Chen 1 & Xue Zhou 1 & Lu Yang 1 & Xu Miao 1 & Di-Han Lu 1 & Xiao-Yu Yang 1 & Zhi-Bin Zhou 1 & Wen-Bin Kang 1 & Ke-Yu Chen 1 & Li-Hua Zhou 2 & Xia Feng 1 Received: 26 October 2017 / Revised: 7 January 2018 / Accepted: 26 January 2018 / Published online: 9 February 2018 # Springer Science+Business Media, LLC, part of Springer Nature 2018 Abstract The increasing usage of general anesthetics on young children and infants has drawn extensive attention to the effects of these drugs on cognitive function later in life. Recent animal studies have revealed improvement in hippocampus-dependent perfor- mance after lower concentrations of sevoflurane exposure. However, the long-term effects of low-dose sevoflurane on the developing brain remain elusive. On postnatal day (P) 7, rats were treated with 1.2% sevoflurane (1.2% sevo group), 2.4% sevoflurane (2.4% sevo group), and air control (C group) for 6 h. On P35–40, rats’ hippocampus-dependent learning and memory was tested using the Morris water maze. Cognition-related and synapse-related proteins in the hippocampus were measured using Western blotting on P35. On the same day, neurogenesis and synapse ultrastructure were evaluated using immunofluorescence and transmission electron microscopy (TEM). On P35, the rats neonatally exposed to 1.2% sevoflurane showed better behavioral results than control rats, but not in the 2.4% sevo group. Exposure to 1.2% sevoflurane increased the number of 5′-bromo-2- deoxyuridine (BrdU)-positive cells in the dentate gyrus and improved both synaptic number and ultrastructure in the hippocam- pus. The expression levels of BDNF, TrkB, postsynaptic density (PSD)-95, and synaptophysin in the hippocampus were also increased in the 1.2% sevo group. In contrast, no significant changes in neurogenesis or synaptic plasticity were observed between the C group and the 2.4% sevo group on P35. These results showed that exposure of the developing brain to a low concentration of sevoflurane for 6 h could promote spatial learning and memory function, along with increased hippocampal neurogenesis and synaptic plasticity, in later life. Keywords Sevoflurane . Hippocampus . Cognitive function . Neurogenesis . Synaptic plasticity Introduction The developing brain is vulnerable to environmental influ- ences including general anesthetics (Loepke and Soriano 2008; Mellon et al. 2007). The widespread and prevalent use Xi Chen and Xue Zhou contributed equally to this work. Li-Hua Zhou zhoulih@mail.sysu.edu.cn Xia Feng fengxiar@sina.com 1 Department of Anaesthesiology, The First Affiliated Hospital of Sun Yat-Sen University, No. 58 Zhongshan Road 2, Guangzhou 510080, Guangdong, People’s Republic of China 2 Department of Anatomy, Zhongshan School of Medicine, Sun of anesthesia in children makes its safety a major health issue of interest. Sevoflurane is a volatile anesthetic that is common- ly used, particularly in clinical pediatric anesthesia, because it is better tolerated than many other anesthetics and has excel- lent results (Goa et al. 1999). Accumulating evidence suggests that neonatal rodent exposure to higher concentrations of sevoflurane could induce developmental neurotoxicity, in- cluding long-term learning disabilities, degeneration of neu- rons, and impairment of synaptic plasticity (Feng et al. 2012; Ishizeki et al. 2008; Tao et al. 2016). However, recent studies have shown that lower concentrations of sevoflurane have neuroprotective effects (Chen et al. 2015; Payne et al. 2005). These complicated results suggest that different parameters such as concentration, timing, and exposure duration of sevoflurane are critical to the final outcomes and reflect the complexity of the effects on the central nervous system. However, the effect of low-concentration sevoflurane during the neonatal period on learning and memory ability in later life Yat-Sen University, No. 74 Zhongshan Road 2, Guangzhou 510080, Guangdong, People’s Republic of China Neurotox Res (2018) 34:188–197 has been unclear. The present work aimed to fill a current gap in the literature by investigating whether exposure to a low concentration (1.2%) of sevoflurane during early postnatal life impacts learning and memory ability later in life. Here, we exposed rats at postnatal day (P) 7 to air or to 1.2 or 2.4% sevoflurane for 6 h. During the juvenile stage, we compared the effects of lower and higher concentrations of sevoflurane on anesthetic-induced hippocampus-dependent learning and memory ability, neurogenesis, and synaptic plas- ticity in the hippocampal area. Methods Ethical Approval The use of rats in this study was approved by the Institutional Animal Care and Use Committee at Sun Yat-sen University (Guangzhou, China). All experiments were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. Sprague-Dawley multiparous dams (n = 31) with litters con- taining male pups (n = 135) were purchased from Experimental Animal Center of Sun Yat-sen University, China. We only used male offspring to exclude the influence of estrogen on the biochemical data and neurocognitive func- tions. The pups from postnatal day 0 (P0) to P20 were housed with the dams in a 12-h:12-h light:dark cycle (light from 07:00 to 19:00), and room temperature (RT) was maintained at 21 ± 1 °C. On P21, the pups were weaned and housed 4–6 per cage in a standard environment. Anesthesia SD rats at P7 (weight 14–16 g) were randomly divided into the air-treated control (C group), the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group). Rats in the 1.2% sevo group and the 2.4% sevo group were placed in a plastic container and exposed to 1.2 or 2.4% sevoflurane continuously for 6 h, using air as a carrier, with a total gas flow of 2 L min−1. A nasopharyngeal airway tube was put in their mouth to prevent apnea and hypoxia when the rats stopped moving in the container. During expo- sure, the temperature inside the container was maintained at 30 °C using an external heating device (NPS-A3 heating de- vice, Midea Co., Guangdong, China) and a hot water bag on the bottom of the container with a constant temperature main- tained between 30 and 35 °C. The concentrations of sevoflurane, oxygen, and carbon dioxide in the chamber were monitored by a gas monitor (Detex-Ohmeda, Louisville, CO, USA). During exposure, an investigator monitored the rats’ spontaneous respiratory frequency and skin color every 5 min to detect any apnea or hypoxia. The rats were immediately exposed to air and excluded from the experiment if these symptoms were detected. Sevoflurane administration was ter- minated 6 h later, and the rats were exposed only to air. When the rats were moving freely again, they were placed back into their maternal cages. Rats in the C group were exposed to the same container as the rats in the 1.2% sevo and 2.4% sevo group but were exposed to air alone for 6 h. Arterial Blood Gas Analysis We performed arterial blood analysis in order to exclude the influence of respiratory or metabolic disorder. The arterial blood samples from the C, 1.2% sevo, and 2.4% sevo groups were obtained from the left cardiac ventricle immediately after removal from the maternal cage (n = 5 in each group) at the end of anesthesia. They were analyzed immediately after col- lection using a blood gas analyzer (Gem Premier 3000, US). We analyzed the pH, arterial carbon dioxide tension (PaCO2), arterial oxygen tension (PaO2), and blood glucose levels of the arterial blood samples. Morris Water Maze Test On P35, the rats were tested for spatial learning and memory ability using the Morris water maze (MWM). Three groups of rats (n = 10 in each group, weight 90–100 g) were tested on the MWM, which consists of two different tests including hidden platform acquisition and a probe trial test, at P35– P40 using the Water Maze Tracking System (MT-200; Chengdu, China). A white platform (12 cm diameter) was submerged in a circular pool (160 cm in diameter, 50 cm in height) that was filled with warm water (23 ± 2 °C). The pool, located in a room with no windows, was virtually divided into four quadrants. A video camera connected to the computer running the tracking software was suspended above the pool and captured the rats’ movements for analysis. At P35, before the test, a single habituation trial was performed without the platform; in this trial, the rats were placed in the water for 120 s. In the hidden platform acquisition test, performed at P36–P39, each rat was placed, facing the wall of the pool, in one of the four quadrants and allowed to swim freely in search of the escape platform for a maximum of 120 s. The experi- ment was repeated with four trials per day for four consecutive days. The average escape latency time (latency to reach the platform) was measured to evaluate spatial learning ability. At P40, a probe trial test was performed by removing the plat- form and releasing the rats into the water for 120 s. We calcu- lated the time spent in the quadrant that previously contained the target and the frequency of crossing the former location of the platform. The rats were dried and placed back into a heated cage after completing each test. 189 190 Western Blot Analysis On P10 and 28, rats (n = 5 in each group at each sacrifice time point) were sacrificed by rapid decapitation, and the bilateral hippocampus areas were harvested and stored at − 80 °C until use. Protein was extracted using RIPA lysis buffer (Keygen Biotech, Nanjing, China). The amount of protein in each hip- pocampal tissues was measured using a protein assay kit (BCA, Pierce, Thermo, USA). Polyacrylamide-SDS gels with an equal amount of 50-μg load in each lane were electropho- resed, and the proteins transferred onto PVDF membranes (Millipore, Carrigtwohill, Ireland). The blots were blocked with 5% skim milk in Tris-buffered saline (150 mM NaCl, 0.1% TWEEN 20, 20 mM Tris, pH 7.4) for 1 h and then incubated overnight at 4 °C with anti-BDNF (1:1000, Novusbio, USA), anti-TrkB (1:800, Millipore, Ireland), anti- postsynaptic density (PSD-95) (1:2000, Abcam, England), and anti-synaptophysin (1:20,000, Abcam, England) primary antibodies. After rinsing, membranes were probed with corre- sponding secondary antibodies at RT for 2 h. Immunoreactive bands were detected with an enhanced chemiluminescence detection system (Bio-Rad, USA). A β-actin antibody (1:1000, ABclonal, China) was used to normalize for sample loading and transfer. The intensities of the bands were densitometrically quantified using ImageJ. BrdU Injections and Immunofluorescence For the 5′-bromo-2-deoxyuridine (BrdU) injections, we followed the methods as previously described (Chen et al. 2015; Tozuka et al. 2005). BrdU has been described as a marker of neurogenesis and can incorporate into DNA only during the S-phase of the mitotic process (Kee et al. 2002). BrdU (Sigma, America) was dissolved in normal saline (10 mg mL−1) and injected at a dosage of 300 mg/kg. To investigate the effects of 1.2% sevoflurane on cellular prolif- eration, we performed a single injection of BrdU i.p. 24 h after sevoflurane exposure. Three days later, the rats were perfused, and their brains were processed for immunofluorescence. To investigate the effects of 1.2% sevoflurane on the survival of newborn cells, we performed a single injection of BrdU i.p. 24 h before sevoflurane exposure. Four weeks (28 days) after the BrdU injection, the rats were perfused, and their brains were processed for immunofluorescence. For morphological examination, rats were deeply anesthe- tized with chloral hydrate at P10 and P35 (n = 5 in each group at each sacrifice time point, 80–100 g) and then transcardially perfused with 0.9% normal saline at RT followed by a fixative solution of 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) in 0.1 M PBS (pH 7.4) at 4 °C. The brains were harvested, postfixed in 4% paraformaldehyde for 8 h, and subsequently soaked in 30% sucrose until they sank. Consecutive frozen coronal sections of the hippocampus were Neurotox Res (2018) 34:188–197 cut at a thickness of 30 μm. Every fifth section of the consec- utive sections was processed by BrdU staining. DNA was first denatured by incubation with 2 N HCl for 30 min at 37 °C followed by a 15-min wash in 0.1 M boric acid (pH 8.5), with three 10-min washes in 0.01 M PBS before each step. The sections were blocked in 3% BSA and 0.4% Triton X-100 for 2 h at RT before being incubated with primary antibody (rat anti-BrdU, 1:200, ab6326, Abcam, UK) in 1% BSA over- night at 4 °C. Then, the sections were incubated with second- ary antibody (Cy3 goat anti-rat IgG, 1:200, KGAB018, Keygentee, China) for 2 h at RT. Fluorescence was detected with a fully automatic fluorescence microscope (Olympus BX63, Japan). An observer who was blinded to group assign- ment was responsible for counting the number of BrdU- positive cells at × 200 magnification. Total cell counts were divided by the total number of sections for analysis. Transmission Electron Microscopy TEM was used to assess synaptic plasticity in the hippo- campus after exposure to treatment (n = 5 in each group) at P35. Twenty-eight days after exposure to treatment, the rats were perfused transcardially with 50 mL of 0.9% normal saline, followed by 50 mL of a mixture of 2% paraformaldehyde and 2.5% glutaraldehyde (Sigma- Aldrich, G6257, USA) in 0.1 M PBS. Approximately 1 mm3 of tissue per rat was dissected from the hippocam- pus and fixed in 2% glutaraldehyde for 2 h at 4 °C. The tissues were rinsed in 0.1 M cacodylate buffer and postfixed with 1% osmium tetroxide for 2 h. Then, the tissue was rinsed with distilled water before undergoing dehydration in a graded ethanol series. Subsequently, the tissue was infiltrated overnight at 4 °C using a mixture of half acetone and half resin. The tissue was embedded in resin 24 h later and then cured fully as follows: 37 °C overnight, 45 °C for 12 h, and 60 °C for 24 h. After that, 70-nm sections were cut and stained with 3% uranyl ace- tate for 20 min and 0.5% lead citrate for 5 min. Ultrastructural changes in synapses in the hippocampus were observed under TEM. Five pictures of each subre- gion per ultrathin section (five rats in total per group) were taken at each of two magnifications: × 13,500 and × 37,000. All pictures taken at × 13,500 magnification were used to observe the number of synapses, and all pictures taken at × 37,000 magnification were used to measure the thickness of the postsynaptic density and the width of the synaptic cleft. The number of synapses was expressed as the average number of synapses in each picture taken at × 13,500. The thickness of the postsynap- tic density and the width of the synaptic were expressed as the average values for all synapses in all pictures taken at × 37,000, as described. We measured the distances using the image analysis software ImageJ. Neurotox Res (2018) 34:188–197 191 Statistical Analysis The results were expressed as the mean ± standard deviation (SD) for each group. The statistical tests were conducted using the computerized statistical package SPSS 19.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism Software version 5.0 (GraphPad Software, Inc., San Diego, CA, USA). The arterial blood data were analyzed using Student’s t test. One-way ANOVA was used to evaluate differences in the quantities of hippocampal proteins, numbers of BrdU-positive cells and synapses, and ultrastructure parameters of synapses among groups. Unpaired t tests and two-way ANOVA were used to analyze the results of the MWM. Each experiment was per- formed at least three times. A value of P < 0.05 was consid- ered statistically significant. which indicated that the rats were learning from practice every day. However, from the third training day, the la- tency to locate the hidden platform in the 1.2% sevo group was significantly shorter than that in the C group and of the 2.4% sevo group (all P < 0.001 vs. C group; Fig. 1a). In the probe trial, the time spent in the target quadrant in the 1.2% sevo group (5.22 ± 2.30) was longer than that in the C (4.08 ± 2.50) group and in the 2.4% sevo group (4.19 ± 2.21; P < 0.01, Fig. 1b). Moreover, the frequency of passing through the target quadrant was significantly higher in the 1.2% sevo group (4.50 ± 2.396) than that in the C group (3.17 ± 1.76) and the 2.4% sevo group (2.92 ± 1.53, Fig. 1c). There were no significant differences in the rats’ swimming speeds (C, 23.44 ± 0.99 cm s−1; 1.2% sevo, 24.01 ± 0.81 cm s−1; 2.4% sevo, 24.43 ± 1.02 cm s−1, according to one-way ANOVA, P = 0.63) among the three groups. Results Sevoflurane Does Not Cause Respiratory or Metabolic Disorder 1.2% Sevoflurane Increased the Number of BrdU-Positive Cells in DG During sevoflurane exposure period, none of the rats appeared with apnea or hypoxia. Arterial blood analysis was used to exclude the influence of respiratory or metabolic disorder. No rats died during the exposure period. Compared with the control group, there were no significant changes in the pH, PaCO2, PaO2, or arterial blood glucose levels before or after exposure in the 1.2% sevo group or the 2.4% sevo group (Table 1). 1.2% Sevoflurane Increased Spatial Learning and Memory Development Later in Life Four weeks after sevoflurane exposure, the spatial learn- ing and memory was measured by the MWM test de- scribed in the BMethods.^ The results (Fig. 1) showed that the latency to find the hidden platform decreased gradu- ally day by day as training progressed in the three groups, To test the level of neurogenesis in the DG, we used BrdU to label proliferative cells as an indicator of neurogenesis. The im- munofluorescence images showed that BrdU-labeled cells were present in all three groups on both P10 and P35, which means that hippocampal neurogenesis was active in the young rats. In addition, the neurogenesis level was higher on P10 (Fig. 2a–c) than that on P35 (Fig. 2d–f) in all the groups. The data from immunofluorescence staining demonstrated that 1.2% sevoflurane significantly increased the number of BrdU- positive cells on both P10 and P35. Statistical testing showed that the number of BrdU-positive cells was significantly larger in the 1.2% sevo group than that in the C group and the 2.4% sevo group on P10 (C, 254 ± 37.92; 1.2% sevo, 408 ± 35.85; 2.4% sevo, 245 ± 34.24; P < 0.0001, Fig. 2g) and P35 (C, 30.83 ± 2.85; 1.2% sevo, 35.83 ± 2.14; 2.4% sevo, 28.50 ± 2.35; P = 0.0004, Fig. 2h). No significant difference was found between the C group and the 2.4% sevo group. Table 1 Arterial blood analysis (N = 5 in each group) Groups C 1.2% sevo 2.4% sevo P value pH PaCO2 (kPa) PaO2 (kPa) Glucose (mmol L−1) 7.40 ± 0.05 3.57 ± 0.38 13.38 ± 0.55 5.6 ± 0.8 7.39 ± 0.08 3.56 ± 0.52 13.42 ± 0.51 5.3 ± 0.7 7.37 ± 0.09 3.58 ± 0.45 13.35 ± 0.60 5.5 ± 0.5 0.70 0.82 0.92 0.69 Neonatal exposure to a low or high concentration of sevoflurane does not lead to significant cardiorespiratory dysfunction. Arterial blood gas analysis revealed no significant difference in any of the measured parameters among the three groups (t test, all P values > 0.05) PaCO2 arterial carbon dioxide tension, PaO2 arterial oxygen tension, Glucose blood glucose levels, C control, 1.2% sevo 1.2% sevoflurane-exposed group, 2.4% sevo 2.4% sevoflurane-exposed group 192 Fig. 1 Exposure to 1.2%, but not 2.4%, sevoflurane in neonatal rats on P7 induces spatial learning and memory changes in the juvenile stage. a In the MWM, the 1.2% sevo group had a significantly shorter latency than the C group to reach the platform. b The numbers of rats that reached the target quadrant within 120 s were significantly increased in the 1.2% sevo group compared with those in the C group. c The frequency of crossing the former location of the target platform within 120 s was significantly increased in the 1.2% sevo group compared with that in the C group. Data are presented as the mean ± SD (n = 10 in each group). *P < 0.05 versus C group; **P < 0.01 versus C group; ***P < 0.001 versus C group. C, control; 1.2% sevo, 1.2% sevoflurane-exposed group; 2.4% sevo, 2.4% sevoflurane-exposed group Hippocampal Synaptic Changes in Hippocampus Expression of Synapse-Associated Proteins in the Hippocampus Two typical synaptic proteins in the hippocampus were visualized by SDS-PAGE and immunoblotting with corresponding antibod- ies for PSD-95 and synaptophysin (SYN). The optical density ratios of the band intensities of the studied proteins normalized to β-actin were expressed as fold changes in the three groups. Compared with the level of PSD-95 in the hippocampus of the C group, the PSD-95 protein in the hippocampus of the 1.2% sevo group was significantly increased on P35 (158.6% of control, P = 0.0066), but there was no significant change in the 2.4% sevo group (128.5% of control, P = 0.73). Moreover, as with the higher level of PSD-95 observed in the 1.2% sevo group, the SYN protein level in the hippocampus of the 1.2% sevo group at P35 was also increased (231.6% of control, P = 0.0082) compared with that of the C group (Fig. 3). However, the SYN protein levels showed no significant change in the 2.4% sevo group compared with those in the C group (197.6% of control, P = 0.50). Ultrastructural Changes in Hippocampal Synapses The number of synapses and the synaptic ultrastructure of the hippocampus were examined using TEM 4 weeks after Neurotox Res (2018) 34:188–197 sevoflurane exposure. Compared with the C and 2.4% sevo groups, the 1.2% sevo group showed an increase in the num- ber of synapses in the hippocampus (C, 13.0 ± 2.74; 1.2% sevo, 17.4 ± 2.80; 2.4% sevo, 10.80 ± 1.92; P = 0.0042 of control, Fig. 4a–c, g). The statistical analysis showed a signif- icant difference in ultrastructure changes: we found a notice- ably narrower synaptic cleft width and greater PSD thickness in the 1.2% sevo group than in either of the other groups (Table 2). No differences were found between the C and 2.4% sevo groups in the number of synapses, synaptic cleft width, or PSD thickness. 1.2% Sevoflurane Increased the Levels of BDNF and TrkB in the Hippocampus To assess the neuroprotective effects of low-dose sevoflurane on the developing brain, the levels of the neurogenesis- and synaptic plasticity-related proteins BDNF and TrkB (Lu et al. 2013; Sairanen et al. 2005) (Hariri et al. 2003) were examined by Western blotting at P35. The optical density ratios of the band intensities of the studied proteins normalized to β-actin were expressed as fold changes for the three groups. At P35, the expression levels of BDNF and TrkB protein in the hip- pocampus of the 1.2% sevo group were significantly in- creased compared with those of the C group (BDNF 63.5% of control, P = 0.0063; TrkB 49.8% of control, P = 0.0002) and the 2.4% sevo group (BDNF 54.2% of control, P = 0.90; Neurotox Res (2018) 34:188–197 Fig. 2 Neonatal exposure to 1.2% sevoflurane increased neuronal neurogenesis in the hippocampal DG on P10 and P35. a–c BrdU- positive cells on P10 in sevoflurane-treated and untreated rats. d–e BrdU-positive cells on P35 in sevoflurane-treated and untreated rats. g, TrkB 29.8% of control, P = 0.64; Fig. 3a–c). There was no significant difference between the C group and the 2.4% sevo group in these proteins. Discussion Sevoflurane is one of the most commonly used anesthetics in neonatal and pediatric anesthesia practice. The safety of the clinical application of sevoflurane in young children is still unclear. The present work aimed to find out whether exposure to a lower concentration (1.2%) of sevoflurane during early postnatal life impacts learning and memory ability later in life. In the current study, we selected 1.2% sevoflurane as the lower dose because this is the lowest sub-anesthetic dose that can prevent rats’ movement in response to a slight stimulus in neonatal rats and did not inhibit respiration. But beyond that, 1.2% sevoflurane is comparable to be used in the clinical setting. Using the MWM, we found that exposure of neonatal rats to 1.2% sevoflurane for 6 h improved their hippocampus- dependent learning and memory ability. In addition, changes were found in the number of BrdU-positive cells in the DG and the number of synapses, synaptic cleft width, and h Summary data for the experiment at P10 and P35. Scale bar represents 50 μm. ***P < 0.001 versus C group; ****P < 0.0001 versus C group. C, control; 1.2% sevo, 1.2% sevoflurane-exposed group; 2.4% sevo, 2.4% sevoflurane-exposed group postsynaptic density thickness in the hippocampus of the low-dose group. Our observations indicated that increased neurogenesis and synaptic plasticity in the hippocampus caused by low-dose sevoflurane might induce changes in neu- robehavioral function later in life. The MWM test in the current study demonstrated that neo- natal exposure to 1.2% sevoflurane for 6 h could facilitate the spatial learning and memory ability of rats later in life. Our result was consistent with previous studies showing that neo- natal exposure to sevoflurane in rodents has no potential to harm their neurobehavioral function in adulthood (Callaway et al. 2012; Liang et al. 2010). More remarkably, Chen et al. found that a subclinical dose of sevoflurane could promote hippocampal neurogenesis in neonatal rats and facilitate den- tate gyrus-dependent learning (Chen et al. 2015). Furthermore, in vitro studies confirmed that a lower dose of sevoflurane could promote the self-renewal capacity and dif- ferentiation of cultured neural cells (Nie et al. 2013; Yang et al. 2017). Our results showed that a higher concentration of sevoflurane had no deleterious effects on learning and mem- ory. However, some studies have found apparently contradic- tory results, indicating that neonatal exposure to a high dose of sevoflurane in rodents and nonhuman primates produces 193 194 Fig. 3 Exposure to 1.2% sevoflurane increased BDNF, TrkB, PSD-95, and SYN levels in the hippocampus. a Representative immunoblots for the expression levels of BDNF and TrkB in the hippocampus 4 weeks after sevoflurane exposure. b, c Quantification of BDNF and TrkB normalized to β-actin (n = 5 per group). d Representative immunoblots for the expression levels of PSD-95 and SYN in the hippocampus 4 weeks after sevoflurane exposure. e, f Quantification of PSD-95 and neurobehavioral defects persisting into adulthood (Haseneder et al. 2009; Jevtovic-Todorovic et al. 2003). We assume that this discrepancy is due to the use of different animal models and behavioral tests. Recent studies have confirmed that a subclinical concen- tration of sevoflurane can enhance the proliferation of cultured neural stem cells (NSCs) (Nie et al. 2013). Our immunofluo- rescence histochemistry results also showed that 1.2% sevoflurane exposure increased the number of BrdU-positive cells at both P10 and P35, indicating a positive effect on neurogenesis. This finding is consistent with a previous study, which demonstrated that a sub-anesthetic dose of sevoflurane led to a significant increase in neurogenesis in neonatal rats (Chen et al. 2015). Furthermore, high concentrations and mul- tiple exposures to sevoflurane anesthesia during the neonatal period are considered to be associated with a reduction in neurogenesis (Fang et al. 2017; Lee et al. 2017). These results suggest that sevoflurane exerts dual effects on cognitive func- tion and neurogenesis depending on the dose and duration. In addition, a previous study showed that BDNF plays an impor- tant role in regulating the basal level of neurogenesis in the dentate gyrus (Lee et al. 2002), and those newly generated cells can mature into functional neurons in the mammalian brain (van Praag et al. 2002). In our study, compared with Neurotox Res (2018) 34:188–197 SYN normalized to β-actin (n = 5 per group). Data are expressed as the mean ± SD. One-way ANOVA: BDNF F = 7.24, P = 0.0063; TrkB F = 17.92, P = 0.0002; PSD-95 F= 7.84, P = 0.0066; SYN F = 7.357, P = 0.0082; *P < 0.05 versus C group, **P < 0.01 versus C group, ***P < 0.001 versus C group, #P < 0.05 versus 2.4% sevo group, and ##P < 0.05 versus 2.4% sevo group. C, control; 1.2% sevo, 1.2% sevoflurane-exposed group; 2.4% sevo, 2.4% sevoflurane-exposed group expression in the C group and the 2.4% sevo group, hippo- campal BDNF and TrkB protein expression in the 1.2% sevo group was prominently increased after exposure to sevoflurane for 28 days. These results suggest a critical role of BDNF signaling and neurogenesis in hippocampus- dependent learning and memory. In support of this possibility, BDNF signaling has been shown to improve cognitive func- tion (Hariri et al. 2003), and the process of neurogenesis may be a substrate for learning and memory (van Praag et al. 2002). We showed here that the improvement in learning and mem- ory after exposure to low-dose sevoflurane might be linked to neurogenesis via increases in the expression of BDNF and TrkB. In addition, we observed that 6 h of low-dose sevoflurane exposure could augment the number of synapses and improve the synaptic ultrastructure in the hippocampus. Previous in- vestigations have reported that changes in the number and function of synapses can cause changes in synaptic plasticity and thereby affect learning and memory (Martin et al. 2000). Using TEM to analyze the number and the ultrastructure of synapses in the hippocampus, we found ultrastructural chang- es in hippocampal synapses after low-dose sevoflurane expo- sure. Furthermore, we analyzed the synaptic plasticity by mea- suring two synaptic marker proteins: synaptophysin (a Neurotox Res (2018) 34:188–197 195 Fig. 4 Effects of sevoflurane on the synaptic ultrastructure of the hippocampus on P35 as visualized by TEM. a–c Representative images show the difference in the number of synapses per unit volume across the three groups (red arrows count the number of synapse). Scale bars = 1 μm. d–f Representative images show the differences in the synaptic interfaces across the three groups. Scale bars = 200 nm. Magnification is × 13,500 (a–c) and × 37,000 (d–f). Summary data for the experiment are presented in g. **P < 0.001 versus C group; ##P < 0.01 versus 2.4% sevo group. C, control; 1.2% sevo, 1.2% sevoflurane-exposed group; 2.4% sevo, 2.4% sevoflurane-exposed group presynaptic marker) and PSD-95 (a postsynaptic marker) (Head et al. 2009). The expression levels of synaptophysin and PSD-95 were significantly higher in the 1.2% sevo group than those in the other two groups. Recent studies have dem- onstrated that early exposure to high-dose of sevoflurane can induce neurotoxicity by decreasing the expression of synaptophysin and PSD-95 in the hippocampus (Wang et al. 2013; Zheng et al. 2013) and lead to greater synaptic loss and ultrastructural damage (Amrock et al. 2015). However, these studies noted that high-dose sevoflurane produced neurotoxic effects related to synaptic plasticity damage. Whether the neuroprotective effect of low-dose sevoflurane is connected to synaptic changes remains unknown. The current study gives us an indication that low-dose sevoflurane exposure exerts a neuroprotective effect on the developing brain and that effect may relate to the improvement in synaptic plasticity. BDNF is an important, well-studied neurotrophin that carries out a variety of neurotrophic and neuroprotective func- tions in the developing brain (Gray et al. 2013). A consider- able body of research indicates that the role of BDNF signal- ing in hippocampus-dependent learning and memory is Table 2 Structural parameters of the synaptic interface in the hippocampus (N = 10 synapses) Groups C 1.2% sevo 2.4% sevo P value PSD thickness (nm) Synaptic cleft width (nm) 32.38 ± 4.69 20.00 ± 1.60 41.39 ± 4.32**** 13.31 ± 1.11**** 31.76 ± 3.36 18.64 ± 1.714 P < 0.0001 P < 0.0001 Data are presented as the mean ± SEM N the number of synapses, PSD postsynaptic density ****P < 0.0001 vs. C (one-way ANOVA) 196 important both in humans and in experimental animals (Hariri et al. 2003; Lee et al. 2004; Tyler et al. 2002). Moreover, growing evidence suggests a more nuanced role for BDNF signaling in learning and memory, in which it acts primarily as a facilitator of synaptic plasticity and neuronal survival (Gray et al. 2013). This study showed that BDNF and TrkB protein expression in the hippocampus prominently increased after long-term exposure to low-dose sevoflurane compared with high-dose sevoflurane exposure or no exposure. It is plausible that increased hippocampal expression of BDNF and TrkB may play a mechanistic role in the behavioral per- formance improvement induced by low-dose sevoflurane. Therefore, we hypothesize that the observed improvement in neurogenesis and synaptic plasticity may be connected with BDNF expression and TrkB signaling. Our study has some limitations. First, our experiment just observed a phenomenon and tendency that the improvement both in cognitive function and in neurogenesis/synaptic plas- ticity followed by 1.2% sevoflurane exposure; we did not demonstrate a definite connection between them. This limita- tion may weaken our evidence regarding the causal link be- tween cognitive function and hippocampal neurogenesis/ synaptic plasticity. This is the first step that we have observed the tendency, but the exact mechanism needs more investiga- tions, which will be also reported by related articles in future. Second, we did not investigate the effects of low-dose sevoflurane on other domains of cognitive function; we fo- cused only on learning and memory function because it is the major domain of cognitive function. However, the data from the current study suggest that low-dose sevoflurane exposure could facilitate learning and memory; this possibility merits further studies to undercover the underlying mechanisms. In conclusion, our findings demonstrate that neonatal ex- posure to low-dose sevoflurane improves hippocampus- dependent learning and memory later in life. This effect may be connected to improved hippocampal neurogenesis and syn- aptic plasticity. If exposure of young patients to lower doses of sevoflurane can promote learning and memory, the selection of this anesthetic and dose range can serve as a new strategy to improve outcomes for children who must undergo anesthesia. However, further clinical studies will need to confirm this possibility. Funding Information This work was supported by the grants from the National Natural Science Foundation of China (No. 81571032 to Xia Feng and No. 81701047 to Xue Zhou). Compliance with Ethical Standards The use of rats in this study was approved by the Institutional Animal Care and Use Committee at Sun Yat-sen University (Guangzhou, China). All experiments were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. Neurotox Res (2018) 34:188–197 Conflict of Interest The authors declare that they have no conflict of interest. References Amrock LG, Starner ML, Murphy KL, Baxter MG (2015) Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure. Anesthesiology 122(1):87–95. https:// doi.org/10.1097/ALN.0000000000000477 Callaway JK, Jones NC, Royse AG, Royse CF (2012) Sevoflurane anes- thesia does not impair acquisition learning or memory in the Morris water maze in young adult and aged rats. Anesthesiology 117(5): 1091–1101. https://doi.org/10.1097/ALN.0b013e31826cb228 Chen C, Shen FY, Zhao X, Zhou T, Xu DJ, Wang ZR, Wang YW (2015) Low-dose sevoflurane promotes hippocampal neurogenesis and fa- cilitates the development of dentate gyrus-dependent learning in neonatal rats. ASN neuro 7(2):175909141557584. https://doi.org/ 10.1177/1759091415575845 Fang F, Song R, Ling X, Peng M, Xue Z, Cang J (2017) Multiple sevoflurane anesthesia in pregnant mice inhibits neurogenesis of fetal hippocampus via repressing transcription factor Pax6. Life Sci 175:16–22. https://doi.org/10.1016/j.lfs.2017.03.003 Feng X, Liu JJ, Zhou X, Song FH, Yang XY, Chen XS, Huang WQ, Zhou LH, Ye JH (2012) Single sevoflurane exposure decreases neuronal nitric oxide synthase levels in the hippocampus of developing rats. Br J Anaesth 109(2):225–233. https://doi.org/10.1093/bja/aes121 Goa KL, Noble S, Spencer CM (1999) Sevoflurane in paediatric anaes- thesia: a review. Paediatr Drugs 1:127–153 Gray JD, Milner TA, McEwen BS (2013) Dynamic plasticity: the role of glucocorticoids, brain-derived neurotrophic factor and other trophic factors. Neuroscience 239:214–227. https://doi.org/10.1016/j. neuroscience.2012.08.034 Hariri A, Goldberg T, Mattay V, Kolachana B, Callicott J, Egan M, Weinberger D (2003) Brain-derived neurotrophic factor val(66)met polymorphism affects human memory-related hippocampal activity and predicts memory performance. J Neurosci 23:6690–6694 Haseneder R, Kratzer S, von Meyer L, Eder M, Kochs E, Rammes G (2009) Isoflurane and sevoflurane dose-dependently impair hippo- campal long-term potentiation. Eur J Pharmacol 623(1-3):47–51. https://doi.org/10.1016/j.ejphar.2009.09.022 Head E, Corrada MM, Kahle-Wrobleski K, Kim RC, Sarsoza F, Goodus M, Kawas CH (2009) Synaptic proteins, neuropathology and cog- nitive status in the oldest-old. Neurobiol Aging 30(7):1125–1134. https://doi.org/10.1016/j.neurobiolaging.2007.10.001 Ishizeki J, Nishikawa K, Kubo K, Saito S, Goto F (2008) Amnestic concentrations of sevoflurane inhibit synaptic plasticity of hippo- campal CA1 neurons through gamma-aminobutyric acid-mediated mechanisms. Anesthesiology 108:447–456 Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF (2003) Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci : Off J Soc Neurosci 23(3):876–882 Kee N, Sivalingam S, Boonstra R, Wojtowicz JM (2002) The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis. J Neurosci Methods 115(1):97–105. https://doi.org/10.1016/S0165- 0270(02)00007-9 Lee J, Duan W, Mattson MP (2002) Evidence that brain-derived neuro- trophic factor is required for basal neurogenesis and mediates, in part, the enhancement of neurogenesis by dietary restriction in the hippocampus of adult mice. J Neurochem 82:1367–1375 Neurotox Res (2018) 34:188–197 Lee JL, Everitt BJ, Thomas KL (2004) Independent cellular processes for hippocampal memory consolidation and reconsolidation. Science (New York, NY) 304:839–843 Lee S, Chung W, Park H, Park H, Yoon S, Park S, Park J, Heo JY, Ju X, Yoon SH, Kim YH, Ko Y (2017) Single and multiple sevoflurane exposures during pregnancy and offspring behavior in mice. Paediatr Anaesth 27(7):742–751. https://doi.org/10.1111/pan.13139 Liang G, Ward C, Peng J, Zhao Y, Huang B, Wei H (2010) Isoflurane causes greater neurodegeneration than an equivalent exposure of sevoflurane in the developing brain of neonatal mice. Anesthesiology 112(6):1325–1334. https://doi.org/10.1097/ALN. 0b013e3181d94da5 Loepke AW, Soriano SG (2008) An assessment of the effects of general anesthetics on developing brain structure and neurocognitive func- tion. Anesth Analg 106(6):1681–1707. https://doi.org/10.1213/ane. 0b013e318167ad77 Lu B, Nagappan G, Guan X, Nathan PJ, Wren P (2013) BDNF-based synaptic repair as a disease-modifying strategy for neurodegenera- tive diseases. Nat Rev Neurosci 14(6):401–416. https://doi.org/10. 1038/nrn3505 Martin SJ, Grimwood PD, Morris RG (2000) Synaptic plasticity and memory: an evaluation of the hypothesis. Annu Rev Neurosci 23(1):649–711. https://doi.org/10.1146/annurev.neuro.23.1.649 Mellon RD, Simone AF, Rappaport BA (2007) Use of anesthetic agents in neonates and young children. Anesth Analg 104(3):509–520. https://doi.org/10.1213/01.ane.0000255729.96438.b0 Nie H, Peng Z, Lao N, Dong H, Xiong L (2013) Effects of sevoflurane on self-renewal capacity and differentiation of cultured neural stem cells. Neurochem Res 38:1758–1767 Payne RS, Akca O, Roewer N, Schurr A, Kehl F (2005) Sevoflurane- induced preconditioning protects against cerebral ischemic neuronal damage in rats. Brain Res Sairanen M, Lucas G, Ernfors P, Castren M, Castren E (2005) Brain- derived neurotrophic factor and antidepressant drugs have different but coordinated effects on neuronal turnover, proliferation, and sur- vival in the adult dentate gyrus. J Neurosci : Off J Soc Neurosci 25: 1089–1094 Tao G, Luo Y, Xue Q, Li G, Tan Y, Xiao J, Yu B (2016) Docosahexaenoic acid rescues synaptogenesis impairment and long-term memory def- icits caused by postnatal multiple sevoflurane exposures. Biomed Res Int 2016:4062579 Tozuka Y, Fukuda S, Namba T, Seki T, Hisatsune T (2005) GABAergic excitation promotes neuronal differentiation in adult hippocampal progenitor cells. Neuron 47:803–815 Tyler WJ, Alonso M, Bramham CR, Pozzo-Miller LD (2002) From ac- quisition to consolidation: on the role of brain-derived neurotrophic factor signaling in hippocampal-dependent learning. Learning Mem (Cold Spring Harbor, NY) 9:224–237 van Praag H, Schinder AF, Christie BR, Toni N, Palmer TD, Gage FH (2002) Functional neurogenesis in the adult hippocampus. Nature 415(6875):1030–1034. https://doi.org/10.1038/4151030a Wang SQ, Fang F, Xue ZG, Cang J, Zhang XG (2013) Neonatal sevoflurane anesthesia induces long-term memory impairment and decreases hippocampal PSD-95 expression without neuronal loss. Eur Rev Med Pharmacol Sci 17:941–950 Yang Z, Lv J, Li X, Meng Q, Yang Q, Ma W, Li Y, Ke ZJ (2017) Sevoflurane decreases self-renewal capacity and causes c-Jun N- terminal kinase-mediated damage of rat fetal neural stem cells. Sci Rep 7:46304. https://doi.org/10.1038/srep46304 Zheng H, Dong Y, Xu Z, Crosby G, Culley DJ, Zhang Y, Xie Z (2013) Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice. Anesthesiology 118(3):516–526. https:// doi.org/10.1097/ALN.0b013e3182834d5d 197",rats,"['SD rats at P7 (weight 14–16 g) were randomly divided into the air-treated control (C group), the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",postnatal day 7,"['SD rats at P7 (weight 14–16 g) were randomly divided into the air-treated control (C group), the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",Y,"['On P35, the rats were tested for spatial learning and memory ability using the Morris water maze (MWM).']",sevoflurane,['Neonatal Exposure to Low-Dose (1.2%) Sevoflurane Increases Rats’ Hippocampal Neurogenesis and Synaptic Plasticity in Later Life'],none,[],sprague dawley,"['Sprague-Dawley multiparous dams (n = 31) with litters containing male pups (n = 135) were purchased from Experimental Animal Center of Sun Yat-sen University, China.']",The study aimed to fill a current gap in the literature by investigating whether exposure to a low concentration (1.2%) of sevoflurane during early postnatal life impacts learning and memory ability later in life.,['The present work aimed to fill a current gap in the literature by investigating whether exposure to a low concentration (1.2%) of sevoflurane during early postnatal life impacts learning and memory ability later in life.'],None,[],"The findings suggest that exposure of the developing brain to a low concentration of sevoflurane for 6 h could promote spatial learning and memory function, along with increased hippocampal neurogenesis and synaptic plasticity, in later life.","['These results showed that exposure of the developing brain to a low concentration of sevoflurane for 6 h could promote spatial learning and memory function, along with increased hippocampal neurogenesis and synaptic plasticity, in later life.']","The study did not demonstrate a definite connection between cognitive function and hippocampal neurogenesis/synaptic plasticity, and did not investigate the effects of low-dose sevoflurane on other domains of cognitive function.","['First, our experiment just observed a phenomenon and tendency that the improvement both in cognitive function and in neurogenesis/synaptic plasticity followed by 1.2% sevoflurane exposure; we did not demonstrate a definite connection between them. Second, we did not investigate the effects of low-dose sevoflurane on other domains of cognitive function; we focused only on learning and memory function because it is the major domain of cognitive function.']","If exposure of young patients to lower doses of sevoflurane can promote learning and memory, the selection of this anesthetic and dose range can serve as a new strategy to improve outcomes for children who must undergo anesthesia.","['If exposure of young patients to lower doses of sevoflurane can promote learning and memory, the selection of this anesthetic and dose range can serve as a new strategy to improve outcomes for children who must undergo anesthesia.']",True,True,True,True,True,True,10.1007/s12640-018-9877-3 10.1021/acschemneuro.0c00106,3879.0,Chen,2020,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"Downloaded via JOHNS HOPKINS UNIV on November 20, 2023 at 16:49:37 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles. Research Article pubs.acs.org/chemneuro PDE‑7 Inhibitor BRL-50481 Reduces Neurodegeneration and Long- Term Memory Deficits in Mice Following Sevoflurane Exposure Yingle Chen, Shunyuan Li,* Xianmei Zhong, Zhenming Kang, and Rulei Chen Cite This: ACS Chem. Neurosci. 2020, 11, 1353−1358 Read Online ACCESS Article Recommendations Metrics & More ABSTRACT: Sevoflurane, one of the most commonly used anesthetic agents, has been demonstrated to induce widespread neurodegeneration in the developing brain. We aimed to evaluate the protective effects of a PDE-7 inhibitor (BRL-50481) against the neurotoxic effects of sevoflurane on the developing nervous system. Spatial learning and memory in sevoflurane-treated mice were examined using the Morris water maze test, and neuroprotective effects of PDE-7 inhibitor (BRL-50481) against sevoflurane- induced impairments were evaluated. Our results showed that sevoflurane treatment markedly induced neurodegeneration and impaired long-term memory in neonatal mice. Notably, BRL-50481 coadministration could significantly attenuate sevoflurane- induced learning and memory defects, prevent deterioration of recognition memory, and protect against neuron apoptosis. Mechanistically, BRL-50481 administration suppressed sevoflurane-induced neurodegenerative disorders through restoring cAMP and activating cAMP/CREB signaling in the hippocampus. PDE7 inhibitor may be a potential therapeutic agent for sevoflurane- induced neurodegeneration and long-term memory deficits. KEYWORDS: Sevoflurane, neurodegeneration, long-term memory deficits, PDE-7 inhibitor, cAMP/CREB signaling ■ INTRODUCTION rats exhibited significantly dose- and duration-dependent neurodegeneration with various doses and durations of sevoflurane treatments.12 Amrock et al. evaluated the neuro- degenerative effects of single or multiple doses of 2.5% sevoflurane administration using neonatal rats and found that 2 h exposure resulted in severe synaptic loss and dramatic apoptotic cell death in many brain regions.11 Pregnant women, newborns, and infants are often exposed to anesthetic agents during childbirth or for surgical procedures. It has been demonstrated that the administration of anesthetic reagents is toxic to the developing brain and causes widespread neurodegeneration and long-term deficits in learning and behavior.1−5 Hence, it is of crucial importance to study the effects of anesthetics on the developing nervous system and discover effective therapeutic treatments. Sevoflurane, also called fluoromethyl, The cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB) has been extensively implicated in neurogenesis, survival, proliferation, and differ- entiation.13−16 As a transcriptional factor, CREB is activated by is one of the most commonly used volatile anesthetic agents for the induction and maintenance of general anesthesia.6 It is useful for infants and children due to its rapid induction, fast recovery, and less irritation to the airway.6,7 However, numerous studies have reported that neonatal administration of sevoflurane induced widespread neurological disorders, including neurodegenera- tion, deficits learning tasks, and long-term potentiation inhibition.8−12 Zheng et al. found that neonatal Received: February 25, 2020 Accepted: March 25, 2020 Published: April 9, 2020 in spatial © 2020 American Chemical Society 1353 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358 ACS Chemical Neuroscience pubs.acs.org/chemneuro Research Article Figure 1. Sevoflurane does not affect learning and memory of neonatal mouse at early stages. Two weeks after sevoflurane exposure, spatial learning and memory were examined by Morris water maze test on Day1 (P21), Day 2 (P22), and Day 3 (P23). (A) Delay time to reach the platform of indicated groups. (B) Swimming path length before reaching the platform of indicated groups. (C) Percent of time spent in the target quadrant in a probe test of indicated groups. n = 8 for each time point. Data represent mean ± SD. Figure 2. BRL-50481 attenuates sevoflurane induced learning and memory defects. Eight weeks after sevoflurane exposure, spatial learning and memory were examined by Morris water maze test on Day 1 (P63), Day 2 (P64), and Day 3 (P65). (A) Delay time to reach the platform of indicated groups. (B) Swimming path length before reaching the platform of indicated groups. (C) Percent of time spent in the target quadrant in a probe test of indicated groups. n = 8 for each time point. Data represent mean ± SD, *P < 0.05, #P < 0.001 compared with sham group. cAMP-dependent phosphorylation on Ser 133, which triggers the transcription of downstream targets including BDNF, TrkB, and c-Fos, and eventually regulates neurogenesis.16−18 Recently, Xiong et al. reported that sevoflurane-nitrous oxide learning and memory deficiencies anesthesia-induced spatial were associated with the cAMP/CREB signaling inhibition in rats.10 The phosphodiesterase 7 (PDE-7) is a cAMP-specific metallophosphohydrolase enzyme, which suppresses the cAMP/CREB signaling pathway though catalyzing cAMP to the inactive form 5′AMP.4,19,20 Accumulating evidence have showed that PDE-7 inhibitors emerge as promising candidates for promoting neuron survival, improving cognitive symptoms, and treating memory deficits.21−24 BRL-50481 is a PDE-7 specific inhibitor, which can decrease animals’ anxiety levels, promote oligodendrocyte precursor differentiation, inhibit neuroinflammation, and protect against spinal cord in- jury.21,22,24,25 However, the roles of BRL-50481 on sevoflur- ane-induced neurodegenerative disorders remain unknown. In the present study, we demonstrated the neuroprotective effects of PDE7 inhibitor, BRL-50481, against sevoflurane-induced neurodegeneration and long-term memory deficits. Noticeably, BRL-50481 attenuated sevoflurane-induced learning and memory defects, prevented deterioration of recognition memory, and protected against neuron apoptosis through activating the cAMP/CREB signaling, suggesting a potential therapeutic role of PDE7 inhibitors in the treatment of sevoflurane-induced neurodegenerative disorders. ■ RESULTS AND DISCUSSION Sevoflurane is a commonly used volatile anesthetic agent due to it exhibiting rapid induction, fast recovery, and less irritation to the airway.6,7 However, accumulative research and clinical data have demonstrated that neonatal administration of sevoflurane may cause widespread neurological disor- ders.8−12,16 Recently, PDE-7 inhibitors have emerged as promising candidates for promoting neuron survival, improv- ing cognitive symptoms, and treating memory deficits.4,19−27 However, little is known about whether PDE-7 inhibitors can attenuate sevoflurane-induced neurodegenerative disorders. Here, we utilized a PDE-7 specific inhibitor, BRL-50481, to demonstrate the preventive effect of PDE-7 inhibitors on sevoflurane-induced neurodegeneration and long-term memo- ry deficits. Neither Sevoflurane nor the BRL-50481 Affects the Spatial Learning and Memory Ability of Neonatal Mice at Early Stage. P7 neonatal pups undergo extensive neurogenesis to develop episodic memory and establish hippocampal learning. Therefore, they are very sensitive to neurotoxic influences at this stage.8,11,12,16 Based on this, we used P7 mouse pups to perform anesthesia administration to evaluate the neurotoxic effects of sevoflurane exposure. We first 1354 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358 ACS Chemical Neuroscience investigated the spatial learning and memory ability in P7 pups after 4 h sevoflurane exposure and then evaluated the neuroprotective effects of PDE-7 inhibitor (BRL-50481) through coadministration with sevoflurane (Figure 1). As shown in Figure 1A, the time of delay to find the platform was measured on postnatal days 21, 22, and 23 (Day 1, Day 2, and Day 3) after 4 h sevoflurane exposure on P7 pups, which was comparable to that of the sham group. Moreover, the low or high dose PDE-7 inhibitor (BRL-50481) injected groups showed the same pattern compared to sham and control group. Similarly, there was no difference in the swimming path length and percentage of time stay in the target quadrant (Figure 1B and C). These data suggested that neither sevoflurane nor the PDE-7 inhibitor affected the spatial learning and memory ability of mice at the early developmental stage. BRL-50481 Attenuates Sevoflurane-Induced Learn- ing and Memory Defects in Neonatal Mouse. We next monitored the spatial learning and memory ability of 9 week postnatal mice (P63−P65) using the Morris water maze test. As shown in Figure 2, 4 h sevoflurane exposure (B0 group) induced marked neurocognitive deficiency compared to the sham and control groups. The delay time to find the platform and swimming path length were significantly prolonged for th B0 group (Figure 2A and B). The sevoflurane-induced memory retention defect was observed using the probe test, where the B0 group spent the least amount of time in the target quadrant (Figure 2C). Although the PDE-7 inhibitor BRL-50481 alone (control group) did not exhibit enhanced neurocognition and memory retention compared to sham the sevoflurane-induced learning and (control vs sham), memory defects were significantly attenuated by a high-dose (5 mg/kg) BRL-50481 injection (B5 vs B0), which was not rescued by the low-dose (1 mg/kg) BRL-50481 administration (B1 vs B0). We observed improved escape latency (Figure 2A and C) and shorter swimming length (Figure 2B) in the control and B5 groups, which indicted that a higher dose of PDE-7 inhibitor could significantly attenuate sevoflurane- induced learning and memory defects. Interestingly, we found that the spatial learning and memory ability of the pups receiving 4 h sevoflurane exposure was similar to that of the sham group at an early stage (P21−P23). However, 8 weeks after sevoflurane exposure, these mice exhibited significant neurodegenerative disorders compared to the sham group (P63−P65). We speculated that this phenotypic trait might be caused by progressive neuro- degeneration. There was no or less deficit observed at the early stage (2 weeks), but the deficits were evident at 8 weeks after sevoflurane exposure. In line with our findings, other groups observed similar results. Keith et al. demonstrated that cell-death-induced hippocampal DG deficit was improved over 6 weeks.28 Fang et al. treated the 7 day old rats with sevoflurane exposure and found altered neurodegeneration, neurocognitive function, and neurogenesis at 6 weeks instead of 2 weeks after exposure.9 Further studies need to be performed to address the cause of this delay in the onset of cognitive deficit. BRL-50481 Prevents Sevoflurane-Induced Deteriora- tion of Recognition Memory in Neonatal Mouse. To further investigate the recognition memory defects induced by sevoflurane, we performed the novel object recognition test, which utilizes the natural tendency of rodents to spend more time to explore a novel object than a familiar one. The results the sevoflurane-treated group (B0) and showed that pubs.acs.org/chemneuro Research Article sevoflurane plus low-dose BRL-50481 injected group (B1) indeed exhibited a malfunction in the memory of the mice, they barely remembered the object that they were supposed to be familiar (Figure 3). In contrast, the high-dose BRL-50481 Figure 3. BRL-50481 prevents sevoflurane induced deterioration of recognition memory. (A) Exploration time of indicated group spent with an old object and new object. (B) Discrimination index of recognizing the new vs old object of an indicated group. n = 8 for each group. Data represent mean ± SD, *P < 0.05 compared with sham. injected group (B5) prevented this malfunction and displayed the recognition ability similar to that of the sham and control groups (Figure 3). The above results suggested that a higher dose of PDE-7 inhibitor prevented sevoflurane-induced deterioration of recognition memory. BRL-50481 Protects against Sevoflurane-Induced Apoptosis in Hippocampus. To further evaluate the neurocognitive deficits after 4 h of sevoflurane exposure, we performed caspase-3 (CA3) IHC staining in the hippocampal CA1 and dentate gyrus (DG) regions. The degenerated neurons were labeled by CV3 and are shown in Figure 4A. Figure 4. BRL-50481 protects against sevoflurane induced apoptosis in hippocampus. (A) Representative images of cleaved caspase-3 immunohistochemical staining in the hippocampal CA1 region. Arrows indicate the cleaved caspase-3 positive cells. (B, C) Auantitative statistic of degenerated neurons of indicated groups in hippocampal CA1 (B) and (C) DG regions. n = 8 for each group. Data represent mean ± SD, *P < 0.05, #P < 0.001 compared with Sham. Apoptotic cell density (AC-3 cells mm−2) increased about 10- fold in CA1 and DG regions in the sevoflurane-treated group (B0) compared to the sham group (Figure 4B and C). Notably, coadministration of high-dose BRL-50481 with sevoflurane (B5) strikingly reduced sevoflurane-induced apoptosis (Figure 4B and C). 1355 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358 ACS Chemical Neuroscience BRL-50481 Suppresses Sevoflurane-Induced Neuro- degeneration through Restoring Hippocampal cAMP/ CREB Signaling. We next measured the pCREB and total CREB protein levels in each group. Although there was no significant difference in total CREB protein levels after sevoflurane exposure (Figure 5A and B), pCREB protein Figure 5. BRL-50481 administration rescues sevoflurane induced pCREB downregulation. (A) Immunoblots of lysates from indicated hippocampus to show the protein levels of total CREB, pCREB, and β-actin. (B, C) Relative protein levels of total (B) CREB and (C) pCREB normalized by β-actin. n = 8 for each group. Data represent mean ± SD, *P < 0.05 compared with sham. expression in the B0 group was significantly decreased (Figure 5A and C). Accordingly, coadministration of high-dose PDE-7 inhibitor BRL-50481 with sevoflurane (B5) could restore pCREB to the sham group’s level. These results indicated that sevoflurane impaired the cycle of pCREB and decreased the pCREB level and the PDE-7 inhibitor might be involved in this cycle to block the inhibitory effect of sevoflurane. CREB phosphorylation can be triggered by cAMP accumulation. We observed decreased pCREB expression after sevoflurane exposure in the above results; next, we asked whether cAMP was involved in the sevoflurane-induced neurodegeneration and long-term memory deficits. The ELISA the cAMP levels were significantly results showed that the sevoflurane-treated decreased in the hippocampus of group (B0 in Figure 6). Accordingly, coadministration of high-dose PDE-7 inhibitor BRL-50481 with sevoflurane (B5) could restore cAMP to the sham group’s level. Thus, the results suggested that sevoflurane exposure suppressed the Figure 6. BRL-50481 administration facilitates cAMP accumulation after sevoflurane exposure. The hippocampal cAMP levels of indicated groups were determined by using a mouse cAMP ELISA kit. Data represent mean ± SD, *P < 0.05 compared with sham. pubs.acs.org/chemneuro Research Article cAMP accumulation and in turn inhibited the cAMP/CREB signaling, whereas BRL-50481 prevented this inhibitory effect and restored cAMP/CREB signaling in the hippocampus. Increasing the intracellular cAMP levels appears to favor the survival and differentiation of neurons, such as oligodendroglial and Schwann cells.13−15,18,25,29,30 PDE-7 catalyzes cAMP to the inactive form and then suppresses the cAMP/CREB signaling pathway. study, we demonstrated the neuroprotective effects of PDE7 inhibitor against sevoflurane- induced neurotoxicity through activating the cAMP/CREB signaling pathway. Notably, the rescued neurodegenerative disorders were observed in the high-dose BRL-50481-treated improve- including prevention of neurodegeneration, group, ment in learning and memory, reduction of apoptosis in the hippocampus, restoration of cAMP, and activation of the cAMP/CREB signaling pathway. In agreement with the neuroprotective function of PDE7 inhibitors, Valdes-Moreno et al. found that PDE7 inhibitors improved feeding and anxiety behaviors of rats through increasing the accumbal and hypothalamic thyrotropin-releasing hormone expression.24 Medina-Rodriguez et al. revealed that PDE7 inhibitor treatment could accelerate human oligodendrocyte precursor differentiation and survival.25 Paterniti et al. demonstrated that PDE7 inhibitor administration could significantly reduce the degree of spinal cord inflammation, tissue injury, and levels of TNF-α, IL-6, COX-2, and iNOS.21 Collectively, these results strongly suggested that PDE7 inhibitors could promote neurogenesis and improve neurodegenerative disorders. Specifically, the PDE7 inhibitor BRL-50481 is a potential drug candidate to be further studied for the treatment of sevoflurane-induced neurodegeneration. In this This study demonstrated the neuroprotective effects of PDE7 inhibitor, BRL-50481, on sevoflurane-induced neuro- degeneration. Mechanistically, BRL-50481 administration significantly attenuated sevoflurane-induced learning and memory defects, deterioration of recognition memory, and neuron apoptosis through activating the cAMP/CREB signal- ing in the hippocampus. These findings suggested that PDE7 inhibitor BRL-50481 is a potential drug candidate for the treatment of sevoflurane-induced neurodegenerative disorders. ■ MATERIALS AND METHODS Animals and Treatments. Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study. The mice were bred and maintained in the animal care facility following the standard rearing conditions of 12 h light and 12 h dark. All mouse studies were performed following the guidelines established by the Institutional Animal Care and Use Committee in Quanzhou First Hospital Affiliated to Fujian Medical University (QFH2017jb43i). BRL-50481 (Tocris Bioscience, Bristol, United Kingdom) was dissolved in 2.5% dimethyl sulfoxide (Sigma, St. Louis, MO) with 0.9% NaCl and injected intraperitoneally into pups before subjecting them to sevoflurane, with a vehicle injection as control. Thirty minutes later, the injected pups were put into a semiclosed chamber and exposed to 3% sevoflurane for 4 h. After exposure, pups were returned to the parents’ cages and monitored for health status until the following tests. The pups were randomly divided into five groups as follows: Sham: vehicle intraperitoneal injection; Control: 5 mg/kg BRL-50481 intraperitoneal injection; B0: Sevoflurane anesthesia, vehicle intraperitoneal injection; B1: Sevoflurane anesthesia, 1 mg/kg BRL-50481 intra- peritoneal injection; 1356 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358 ACS Chemical Neuroscience B5: Sevoflurane anesthesia, 5 mg/kg BRL-50481 intra- peritoneal injection. Each group contained 10 pups. Morris Water Maze Test and Analysis. The spatial memory ability of control and treated mice was determined using the Morris water maze test developed by Richard Morris.31 In brief, a 160 cm diameter and 60 cm high circular tank was filled with water at 30 cm high. The water temperature was maintained at 22 °C. A 12 cm diameter circular platform was submerged 1 cm below the water surface in the center of one of the four virtual quadrants.32 The control and treated mice were trained four times per day for 6 days. The mouse was released into the water, and it navigated to reach the platform. The maximum swimming time of the tested mouse was 80 s. If the mouse could escape to the refuge within 60 s, the delay to find the platform time was recorded as 60 s. Mice were allowed to stay on the platform for 15 s, and then they were sent to their cages under a heat lamp to maintain their core temperature. The escape latency was recorded by a tracking system, and data were analyzed using ViewPoint video tracking system (ViewPoint Behavior Technology, Civrieux, France). Three daily trials were averaged for each animal.32 Immunohistochemistry (IHC) Analyses. Mice were euthanized and perfused with cold phosphate-buffered saline and 4% paraformaldehyde immediately. The brains were fixed with 4% paraformaldehyde overnight and then cryoprotected by immersion in 30% sucrose at 4 °C for 48 h. Coronal sections (25 μm) were cut using a manual rotary microtome (Leica, Wetzlar, Germany). The caspase-3 IHC staining was performed as previously described.33 The cleaved caspase-3 antibody (ab13847) was purchased from Abcam (Cambridge, MA). Immunoblotting Analyses. Frozen hippocampus homogenates were lysed using radioimmunoprecipitation buffer (Bioequip, Shanghai, China). The samples were subjected to immunoblotting analysis as described previously.33 The pCREB (Ser133, #9198, 1:1000 dilution) and CREB (#9197, 1:2000 dilution) primary antibodies were ordered from Cell Signaling Technology (Danvers, MA), and the internal control β-actin antibody was ordered from Abcam (ab8226, 1:2000 dilution). cAMP Concentration Assay. cAMP levels were measured using the mouse cAMP ELISA kit (ab133051, Biocompare, South San Francisco, CA) following the manufacturer’s instructions. Statistical Analysis. Statistical analyses were carried out by using the SPSS 11.0 package. Differences between groups were analyzed using analysis of variance (ANOVA) or two-sample t test with Bonferroni correction. All data represent mean ± standard deviation (SD). Statistical significance thresholds were set at *P < 0.05. ■ AUTHOR INFORMATION Corresponding Author Shunyuan Li − Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou 362000, Fujian, China; Email: cylfj@126.com orcid.org/0000-0003-1778-8386; Authors Yingle Chen − Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou 362000, Fujian, China Xianmei Zhong − Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou 362000, Fujian, China Zhenming Kang − Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou 362000, Fujian, China Rulei Chen − Department of Anesthesiology, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou 362000, Fujian, China Complete contact information is available at: pubs.acs.org/chemneuro Research Article https://pubs.acs.org/10.1021/acschemneuro.0c00106 Author Contributions Did the experiments and analyzed the data: Y.C., S.L., X.Z., Z.K., R.C. Designed the study and wrote the manuscript: S.L. All authors approved the final submission. Funding This work was supported by the Natural Science Foundation Project of Fujian Province (#2018J01200). Notes The authors declare no competing financial interest. ■ REFERENCES (1) Warner, D. O., Zaccariello, M. J., Katusic, S. K., Schroeder, D. R., Hanson, A. C., Schulte, P. J., Buenvenida, S. L., Gleich, S. J., Wilder, R. T., Sprung, J., Hu, D., Voigt, R. G., Paule, M. G., Chelonis, J. J., and Flick, R. P. (2018) Neuropsychological and Behavioral Outcomes after Exposure of Young Children to Procedures Requiring General Anesthesia: The Mayo Anesthesia Safety in Kids (MASK) Study. Anesthesiology 129, 89−105. (2) Andropoulos, D. B. (2018) Effect of Anesthesia on the Developing Brain: Infant and Fetus. Fetal Diagn Ther 43, 1−11. (3) Glatz, P., Sandin, R. H., Pedersen, N. L., Bonamy, A. K., Eriksson, L. I., and Granath, F. (2017) Association of Anesthesia and Surgery During Childhood With Long-term Academic Performance. JAMA Pediatr 171, e163470. (4) Bollen, E., and Prickaerts, J. (2012) Phosphodiesterases in neurodegenerative disorders. IUBMB Life 64, 965−970. (5) Ing, C., Wall, M. M., DiMaggio, C. J., Whitehouse, A. J. O., Hegarty, M. K., Sun, M., von Ungern-Sternberg, B. S., Li, G., and Sun, L. S. (2017) Latent Class Analysis of Neurodevelopmental Deficit After Exposure to Anesthesia in Early Childhood. J. Neurosurg Anesthesiol 29, 264−273. (6) De Hert, S., and Moerman, A. (2015) Sevoflurane. F1000Research 4, 626. (7) Goa, K. L., Noble, S., and Spencer, C. M. (1999) Sevoflurane in paediatric anaesthesia: a review. Paediatr Drugs 1, 127−153. (8) Satomoto, M., Satoh, Y., Terui, K., Miyao, H., Takishima, K., Ito, M., and Imaki, J. (2009) Neonatal Exposure to Sevoflurane Induces Abnormal Social Behaviors and Deficits in Fear Conditioning in Mice. Anesthesiology 110, 628−637. (9) Fang, F., Xue, Z., and Cang, J. (2012) Sevoflurane exposure in 7- day-old rats affects neurogenesis, neurodegeneration and neuro- cognitive function. Neurosci. Bull. 28, 499−508. (10) Xiong, W.-X., Zhou, G.-X., Wang, B., Xue, Z.-G., Wang, L., Sun, H.-C., and Ge, S.-J. (2013) Impaired spatial learning and memory after sevoflurane-nitrous oxide anesthesia in aged rats is associated with down-regulated cAMP/CREB signaling. PLoS One 8, e79408− e79408. (11) Amrock, L. G., Starner, M. L., Murphy, K. L., and Baxter, M. G. (2015) Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure. Anesthesiology 122, 87− 95. (12) Zheng, S. Q., An, L. X., Cheng, X., and Wang, Y. J. (2013) Sevoflurane causes neuronal apoptosis and adaptability changes of neonatal rats. Acta Anaesthesiol. Scand. 57, 1167−1174. (13) Nakagawa, S., Kim, J. E., Lee, R., Chen, J., Fujioka, T., Malberg, J., Tsuji, S., and Duman, R. S. (2002) Localization of phosphorylated cAMP response element-binding protein in immature neurons of adult hippocampus. J. Neurosci. 22, 9868−9876. (14) Fujioka, T., Fujioka, A., and Duman, R. S. (2004) Activation of cAMP signaling facilitates the morphological maturation of newborn neurons in adult hippocampus. J. Neurosci. 24, 319−328. (15) Ao, H., Ko, S. W., and Zhuo, M. (2006) CREB activity maintains the survival of cingulate cortical pyramidal neurons in the adult mouse brain. Mol. Pain 2, 15. 1357 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358 ACS Chemical Neuroscience (16) Ding, M.-l., Ma, H., Man, Y.-g., and Lv, H.-y. (2017) Protective effects of a green tea polyphenol, epigallocatechin-3-gallate, against sevoflurane-induced neuronal apoptosis involve regulation of CREB/ BDNF/TrkB and PI3K/Akt/mTOR signalling pathways in neonatal mice. Can. J. Physiol. Pharmacol. 95, 1396−1405. (17) Chrivia, J. C., Kwok, R. P., Lamb, N., Hagiwara, M., Montminy, M. R., and Goodman, R. H. (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365, 855−859. (18) Kida, S., and Serita, T. (2014) Functional roles of CREB as a positive regulator in the formation and enhancement of memory. Brain Res. Bull. 105, 17−24. (19) Chevalier, E., Lagente, V., Dupont, M., Fargeau, H., Palazzi, X., Richard, V., Dassaud, M., Fric, M., Coupe, M., Carre, C., Leduc, S., Bernardelli, P., Vergne, F., Berna, P., and Bertrand, C. P. (2012) Lack of involvement of type 7 phosphodiesterase in an experimental model of asthma. Eur. Respir. J. 39, 582−588. (20) Morales-Garcia, J. A., Echeverry-Alzate, V., Alonso-Gil, S., Sanz- SanCristobal, M., Lopez-Moreno, J. A., Gil, C., Martinez, A., Santos, A., and Perez-Castillo, A. (2017) Phosphodiesterase7 Inhibition Activates Adult Neurogenesis in Hippocampus and Subventricular Zone In Vitro and In Vivo. Stem Cells 35, 458−472. (21) Paterniti, I., Mazzon, E., Gil, C., Impellizzeri, D., Palomo, V., Redondo, M., Perez, D. I., Esposito, E., Martinez, A., and Cuzzocrea, S. (2011) PDE 7 inhibitors: new potential drugs for the therapy of spinal cord injury. PLoS One 6, e15937. (22) Redondo, M., Zarruk, J. G., Ceballos, P., Pérez, D. I., Pérez, C., Perez-Castillo, A., Moro, M. A., Brea, J., Val, C., Cadavid, M. I., Loza, M. I., Campillo, N. E., Martínez, A., and Gil, C. (2012) Neuroprotective efficacy of quinazoline type phosphodiesterase 7 inhibitors in cellular cultures and experimental stroke model. Eur. J. Med. Chem. 47, 175−185. (23) Morales-Garcia, J. A., Alonso-Gil, S., Gil, C., Martinez, A., Santos, A., and Perez-Castillo, A. (2015) Phosphodiesterase 7 inhibition induces dopaminergic neurogenesis in hemiparkinsonian rats. Stem Cells Transl. Med. 4, 564−575. (24) Valdes-Moreno, M. I., Alcantara-Alonso, V., Estrada-Camarena, E., Mengod, G., Amaya, M. I., Matamoros-Trejo, G., and de Gortari, P. (2017) Phosphodiesterase-7 inhibition affects accumbal and hypothalamic thyrotropin-releasing hormone expression, feeding and anxiety behavior of rats. Behav. Brain Res. 319, 165−173. (25) Medina-Rodriguez, E. M., Arenzana, F. J., Pastor, J., Redondo, M., Palomo, V., Garcia de Sola, R., Gil, C., Martinez, A., Bribian, A., and de Castro, F. (2013) Inhibition of endogenous phosphodiesterase 7 promotes oligodendrocyte precursor differentiation and survival. Cell. Mol. Life Sci. 70, 3449−3462. (26) Pekkinen, M., Ahlstrom, M. E. B., Riehle, U., Huttunen, M. M., and Lamberg-Allardt, C. J. E. (2008) Effects of phosphodiesterase 7 inhibition by RNA interference on the gene expression and differentiation of human mesenchymal stem cell-derived osteoblasts. Bone 43, 84−91. (27) Safavi, M., Baeeri, M., and Abdollahi, M. (2013) New methods for the discovery and synthesis of PDE7 inhibitors as new drugs for neurological and inflammatory disorders. Expert Opin. Drug Discovery 8, 733−751. (28) Keith, J. R., Wu, Y., Epp, J. R., and Sutherland, R. J. (2007) Fluoxetine and the dentate gyrus: memory, recovery of function, and electrophysiology. Behav. Pharmacol. 18, 521−531. (29) Li, Q. Q., Shi, G. X., Yang, J. W., Li, Z. X., Zhang, Z. H., He, T., Wang, J., Liu, L. Y., and Liu, C. Z. (2015) Hippocampal cAMP/PKA/ CREB is required for neuroprotective effect of acupuncture. Physiol. Behav. 139, 482−490. (30) Wang, H., Xu, J., Lazarovici, P., Quirion, R., and Zheng, W. (2018) cAMP Response Element-Binding Protein (CREB): A Possible Signaling Molecule Link in the Pathophysiology of Schizophrenia. Front. Mol. Neurosci. 11, 255. (31) Morris, R. (1984) Developments of a water-maze procedure for studying spatial learning in the rat. J. Neurosci. Methods 11, 47−60. pubs.acs.org/chemneuro Research Article (32) Vorhees, C. V., and Williams, M. T. (2006) Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848−858. (33) Guo, L., Zhang, P., Chen, Z., Xia, H., Li, S., Zhang, Y., Kobberup, S., Zou, W., and Lin, J. D. (2017) Hepatic neuregulin 4 signaling defines an endocrine checkpoint for steatosis-to-NASH progression. J. Clin. Invest. 127, 4449−4461. 1358 https://dx.doi.org/10.1021/acschemneuro.0c00106 ACS Chem. Neurosci. 2020, 11, 1353−1358",mice,['Spatial learning and memory in sevoflurane-treated mice were examined using the Morris water maze test'],postnatal day 7,['We first investigated the spatial learning and memory ability in P7 pups after 4 h sevoflurane exposure'],Y,"['Spatial learning and memory in sevoflurane-treated mice were examined using the Morris water maze test', 'We next monitored the spatial learning and memory ability of 9 week postnatal mice (P63−P65) using the Morris water maze test', 'To further investigate the recognition memory defects induced by sevoflurane, we performed the novel object recognition test']",sevoflurane,['Spatial learning and memory in sevoflurane-treated mice were examined using the Morris water maze test'],none,[],c57bl/6,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",This study demonstrates the neuroprotective effects of PDE7 inhibitor against sevoflurane-induced neurotoxicity through activating the cAMP/CREB signaling pathway.,"['However, little is known about whether PDE-7 inhibitors can attenuate sevoflurane-induced neurodegenerative disorders.']",None,[],The findings suggest that PDE7 inhibitor BRL-50481 is a potential drug candidate for the treatment of sevoflurane-induced neurodegenerative disorders.,['These findings suggested that PDE7 inhibitor BRL-50481 is a potential drug candidate for the treatment of sevoflurane-induced neurodegenerative disorders.'],None,[],PDE7 inhibitors may be potential therapeutic agents for sevoflurane-induced neurodegeneration and long-term memory deficits.,['PDE7 inhibitor may be a potential therapeutic agent for sevoflurane- induced neurodegeneration and long-term memory deficits.'],True,True,True,True,True,True,10.1021/acschemneuro.0c00106 10.1016/j.ijdevneu.2019.04.002,248.0,Goyagi,2019,rats,postnatal day 7,Y,sevoflurane,none,wistar,"International Journal of Developmental Neuroscience 75 (2019) 19–26 Contents lists available at ScienceDirect International Journal of Developmental Neuroscience journal homepage: www.elsevier.com/locate/ijdevneu Dexmedetomidine reduced sevoflurane-induced neurodegeneration and long-term memory deficits in neonatal rats T Toru Goyagi Department of Anesthesia and Intensive Care Medicine, Akita University Graduate School of Medicine, 1-1-1 Hondo, Akita, Akita 010-8543, Japan A R T I C L E I N F O A B S T R A C T Keywords: Sevoflurane Anesthesia Dexmedetomidine Cognitive function Neonate Neural toxicity Exposure to sevoflurane and other inhalational anesthetics can induce neurodegeneration in the developing brain. Although dexmedetomidine (DEX) has provided neuroprotection against hypoxic ischemic injury, rela- tively little is known about whether it has the neuroprotective effects against anesthetic-induced neurodegen- eration. This study examined whether DEX improves the long-term cognitive dysfunction observed after ex- posure of neonatal rats to 3% sevoflurane. Seven-day-old rats received intraperitoneal saline (DEX 0) or DEX (6.6, 12.5, 25 μg/kg) 30 min before exposure to 3% sevoflurane with 21% oxygen for 4 h (n = 10 per group). The pups in the control group received only DEX 25 μg/kg without anesthesia. The escape latency in the Morris water maze was significantly increased in the DEX 0 group compared with the sham and control group, and the escape latency, but not the swimming path length, was significantly shorter at post-natal day 47 in the DEX 25 than in the DEX 0 group. The percent time spent in the quadrant was significantly decreased in the DEX 0 group compared with the sham and control group, and the percent time spent in the quadrant was significantly in- creased in the DEX 25 group compared with the DEX 0 groups. The freezing times of the DEX 0 and 6.6 groups were significantly decreased compared with those in the sham, control and DEX 25 groups. The number of NeuN- positive cells in the CA1 region was significantly decreased in the DEX 0 and 6.6 groups compared with the sham, control and DEX 25 groups. These findings indicate pre-treatment with DEX may improve long-term cognitive function and ameliorate the neuronal degeneration induced by sevoflurane exposure in neonatal rats. 1. Introduction Exposure of the immature brain to general anesthetics causes structural and functional alterations, subsequently resulting in the neurodegenerations (Disma et al., 2016; Stratmann, 2011; Walters and Paule, 2017). Sevoflurane, an inhalational anesthetic, is widely used in pediatric anesthesia. Many experimental studies have shown exposure of the developing brain to sevoflurane causes neurological impairment in later adulthood (Amrock et al., 2015; Fang et al., 2012; Zheng et al., 2013). Furthermore, clinical reports have shown long-term behavioral impairments and memory dysfunction in infants and children after anesthesia exposure (Davidson et al., 2016; Sun et al., 2016; Warner et al., 2018). There is concern that infants and children could be af- fected if they receive general anesthesia for a prolonged period and multiple times during the neonatal and infant term (Andropoulos and Greene, 2017). As general anesthesia is necessary for surgery, the in- vestigation of method to ameliorate anesthesia-induced neurotoxicity is urgently needed. adjuvant of anesthesia to provide analgesia and sedation in the pre- operative and postoperative periods (Kamibayashi, 2000). These effects are useful for the prevention of postoperative delirium (Duan et al., 2018). Moreover, DEX protects organs in various injury models in- cluding ischemia (Dahmani et al., 2005; Engelhard et al., 2002; Eser et al., 2008; Goyagi et al., 2009; Zhu et al., 2013), inflammation (Vincent Degos et al., 2013), and traumatic injury (Schoeler et al., 2012), owing to its anti-apoptotic effects (Engelhard et al., 2002), its ability to decrease caspase-3 elevation (Dahmani et al., 2005; Eser et al., 2008), its effects on the phosphoinositide 3-kinase (PI3K)/Akt and extracellular signal-regulated kinase 1/2 (ERK1/2) pathways (Zhu et al., 2013) via the α2A and imidazole 1 receptors (Ma et al., 2004). Pharmacological preventive strategies against neurodegeneration induced by general anesthesia have been introduced (Disma et al., 2016; Walters and Paule, 2017). DEX is likely to be a protective com- pound that could be used to prevent or ameliorate anesthesia-induced neurodegeneration (Walters and Paule, 2017). Based on previous stu- dies, DEX can ameliorated the neuroapoptosis and cognitive dysfunc- tion induced by exposure of the developing brain to ketamine (Duan et al., 2014), isoflurane (Li et al., 2014; Sanders et al., 2010, 2009), Dexmedetomidine (DEX) is an α2-adrenoceptor agonist that has sedative and analgesic effects, and has been widely used clinically as an E-mail address: tgoyagi@doc.med.akita-u.ac.jp. https://doi.org/10.1016/j.ijdevneu.2019.04.002 Received 31 January 2019; Received in revised form 28 March 2019; Accepted 3 April 2019 Available online 05 April 2019 0736-5748/ © 2019 ISDN. Published by Elsevier Ltd. All rights reserved. T. Goyagi sevoflurane (Perez-Zoghbi et al., 2017) and propofol (Lv et al., 2017; Wang et al., 2016; Xiao et al., 2018). Moreover, DEX has neuropro- tective effects in the hypoxic-ischemic neonatal brain (Ren et al., 2016; Zhou et al., 2018) and in an acute hyperoxic neonatal rat model (Endesfelder et al., 2017; Sifringer et al., 2015). In contrast, DEX does not ameliorate the injury induced by sevoflurane, and induces neural apoptosis in neonatal rats (Lee et al., 2017). Although many reports have shown that DEX is protective against anesthesia-induced neuro- degeneration, few reports have shown high mortality rates under high- dose DEX with sevoflurane anesthesia in neonatal rats (Lee et al., 2017; Perez-Zoghbi et al., 2017). Thus, the efficiency of DEX against sevo- flurane-induced neurodegeneration is not fully understood. We hypothesized that DEX administration could ameliorate the neurodegeneration triggered by sevoflurane in the developing rat brain and improve cognitive function in the long-term. This study examined the effects of DEX on rat brain histological changes, of through the assessment of persistent normal cells, and cognitive function in later life following perinatal sevoflurane exposure. 2. Material and methods All animal protocols were approved by the animal research com- mittee of Akita University, Japan (Approval number: a-1-2625). Seven- day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15 g) were used in this study. Animals were housed under standard conditions (12 h light/12 h dark cycle at 22 °C) in the Animal Research Laboratory at Akita University. All efforts to reduce the number of animals and their suffering were made. The animals were randomly divided into 6 groups (n = 10 per group) as follows: no anesthesia and no injection (sham), no anesthesia and intraperitoneal 25 μg/kg DEX (control), intraperitoneal saline (DEX 0), intraperitoneal 6.6 μg/kg DEX intraperitoneal 12.5 μg/kg DEX (DEX 12.5), and in- (DEX 6.6), traperitoneal 25 μg/kg DEX (DEX 25). After 30 min intraperitoneal injection on P7, the pups were put into a plastic chamber, exposed to 3% sevoflurane with 2 L/min of 21% oxygen for 4 h, and returned to their mother’s cage. The oxygen and sevoflurane concentration were measured using a gas analysis system (GE Healthcare BioSciences, Pittsburgh, PA). The chamber was main- tained at 30 ± 1 °C using an infrared heat lamp during the exposure. 2.1. Cognitive tests 2.1.1. Morris water maze Spatial memory retention was examined using the Morris water maze by blinded observer as described previously (Goyagi, 2018). At P27 – P29, acquisition trials were executed 4 times per day for 3 suc- cessive days. The latency and the swimming path length to reach the hidden platform were measured using a video image motion analyzer (DVTrack DVT-11; Muromachi Kikai Co. Ltd, Tokyo, Japan). If the rat could not reach the hidden platform within 90 s, it was placed on the platform for 30 s during an acquisition trial. At P47 – P49, retention trials were executed 4 times per day. If the rats failed to find the platform within 90 s, the latency was regarded as 90 s. In this study, a probe trial was not done during the acquisition trials. 2.1.2. Fear conditioning test Fear conditioning was performed to evaluate contextual memory retention using the fear conditioning system (MK-450RSQ; Muromachi Kikai Co., Ltd, Tokyo, Japan) as described previously (Goyagi, 2018). The apparatus consisted of a clear rectangular Plexiglas box with a floor of for the delivery of electric currents. At P42, the rats were placed on the cleaned parallel metallic rods to be accustomed to new environment for 1 min, before they were presented with a 70-dB white noise for 30 s A mild foot shock (0.4-mA) was administered through the metallic rods during the last 1 s of the tone presentation. The tone-shock pairing was repeated once per minute for the next 2 min. The rats were left in 20 International Journal of Developmental Neuroscience 75 (2019) 19–26 Fig. 1. Morris water maze results 3 weeks after sevoflurane exposure. (A) Escape latency to reach the platform, (B) swimming path length to the platform, and (C) swimming speed were measured. Days 1, 2, and 3 of the acquisition trials were P27, P28, and P29, respectively. Although the escape latency on day 3 significantly decreased in all groups compared with the latency on day 1, no significant differences were found among the groups on days 1–3, whereas the swimming path length in the sham group was significantly shorter than that in the other groups. The data are expressed as means ± SDs (n = 10). DEX, dexmedetomidine. the cage for an additional 60 s before returned to their cage. At P49, cued fear memory was tested by placing rats into an unrelated en- vironment for 90 s without any tone and presenting the auditory cue for a further 60 s used for conditioning. Freezing time was measured by the percent of time during the tone presentation using a video image mo- tion analyzer (DVTrack DVT-11; Muromachi Kikai Co. Ltd, Tokyo, Japan). 2.2. Histological analyses 2.2.1. Neuronal nuclei staining After finished the water maze task and fear conditioning test at P49, the rats’ brains were removed and embedded in paraffin following the perfusion of heparinized saline then 150 mL of 4% paraformaldehyde in phosphate buffer (pH 7.4) to use further neuronal nuclei (NeuN) stain, as described previously (Goyagi, 2018). In brief, 3-μm-thick serial transverse sections were incubated with a mouse monoclonal antibody to NeuN antigen (NeuN; 1:100 diluted in blocking solution; Millipore Corporation, Temecula, CA) for 10 min at 37 °C. Immunodetection was performed using avidin-horse radish peroxidase complexes with T. Goyagi Fig. 3. Fear conditioning test results. The freezing time in response to the conditioned stimulus tone on P49 was significantly longer in the DEX 25 groups compared with the DEX 0 and 6.6 groups. The freezing time was significantly decreased in the DEX 0 group compared with the sham and the control group. * P < 0.05 vs sham, † P < 0.05 vs control, and ‡ P < 0.05 vs DEX 25. The data are expressed as means ± SD (n = 10). DEX, dexmedetomidine. biotinylated antibodies to rabbit and mouse IgG (MILLIPORE IHC Se- lectR Immunoperoxidase Secondary Detection System; Millipore Cor- poration), with diaminobenzidine. Then we counterstained those with hematoxylin. The NeuN-positive cells express as mature typical neurons after growth. We counted the number of NeuN-positive cells in bilateral 500 μm × 300 μm areas in the CA1 hippocampus, amygdala, and cer- ebral cortical layer 3, as described previously (Goyagi, 2018). 2.2.2. Positive cell density map (PCDM) The PCDM was made as described previously (Goyagi, 2018; Wada et al., 2006). In brief, the composite image was FFT- bandpass-filtered using the Image J program (National Institute of Health, Bethesda, MD) to eliminate low-frequency drifts (> 20 pixels [50 μm]) and high-fre- quency noises (< 1 pixel [2.5 μm]). The PDCM was made with a 21 International Journal of Developmental Neuroscience 75 (2019) 19–26 Fig. 2. Morris water maze results 6 weeks after sevoflurane exposure. (A) Escape latency to reach the platform, (B) swimming path length, (C) swimming speed, and (D) percent time to reach the quadrant were measured on day 1 (P47). The escape latency was significantly longer in the DEX 0 group than in the sham and the control group, and significantly shorter in the DEX 25 group than in the DEX 0 group. No significant differences were observed in swim- ming path length among the groups. The swimming speed in the DEX 0 and 12.5 groups was significantly decreased compared with that in the sham group. The percent time spent in the quadrant was significantly decreased in the DEX 0 group compared with the sham and the control group. However, it was significantly increased in the DEX 25 group compared with the DEX 0 group. * P < 0.05 vs sham, † P < 0.05 vs control, and ‡ P < 0.05 vs DEX 25. The data are expressed as means ± SD (n = 10). DEX, dexmedetomidine. custom-made program using MATLAB (MathWorks INC., Natick, MA) (Wada et al., 2006), then adjusted for each section automatically and enumeration of NeuN-positive cells in each 100 μm × 100 μm square section. Finally, the normalized PCDMs were seen as averaged for each group (Fig. 6 A). As mentioned our previous study (Goyagi, 2018), the PCDMs were analyzed whether the DEX-treated groups showed in- creased NeuN cell density compared with the DEX 0 group. The areas were mapped as colored to indicate significantly increased normal neurons in blocks where the P value was less than 0.05 (Fig. 6B). 2.3. Statistical analysis The escape latency, the swimming speed, the swimming path length, the freezing time, and the number of NeuN-positive cells are expressed as means ± standard deviation (SD). Comparisons of these variables among the groups were performed using a one-way or two- way analysis of variance (ANOVA) for multiple comparisons followed by Bonferroni post hoc tests. Each PCDM using a Gaussian filter of the block size (SD = 100 μm) was analyzed using t-tests for each block. Differences with p-values less than 0.05 were considered statistically significant. We performed all analyses using GraphPad Prism 6 (GraphPad Software, Inc., San Diego, CA). 3. Results 3.1. DEX improves memory retention in the Morris water maze The escape latencies and swimming path lengths to the hidden platform in the acquisition trials during postnatal day 27–29 (P27–29) are shown in Fig. 1. No statistically significant differences among the groups were found for the DEX treated, sham and control groups, in- dicating that all rats acquired the task equally well. As shown in Fig. 2, the escape latency was significantly increased in the DEX 0 group compared with the sham, the control and the DEX 25 group, and the escape latency, but not the swimming path length, was significantly shorter in the DEX 25 group than in the DEX 0 group at P47. In addi- the swimming speed in the DEX 0 and 12.5 groups was tion, T. Goyagi International Journal of Developmental Neuroscience 75 (2019) 19–26 Fig. 4. NeuN staining of brain sections from sevoflurane-exposed rats. Representative NeuN staining at -3 ± 0.2 mm from bregma is shown. NeuN-positive cells in the entire image at lower magnification (A), CA1 hippocampus at higher magnification (B), amygdala at higher magnification (C), and cortex at higher magnification (D) are shown for each group. Squares indicate the measuring field in the CA1, amygdala, and cortex. Scale bar: 3 mm (A) or 100 μm (B, C, and D). DEX, dexmedetomidine. 22 T. Goyagi Fig. 5. Numbers of NeuN-positive cells in the hippocampus, amygdala, and cortex of sevoflurane-exposed rats. The number of NeuN-positive cells in the CA1 region of the hippocampus was decreased in the DEX 0 group compared with the sham, control, DEX 12.5 and 25 groups. The number of NeuN-positive cells was increased in the DEX 12.5 and 25 groups compared with the DEX 0 group (A). The number of NeuN- positive cells in the amygdala was decreased in the DEX 0 group compared with the sham and the control group, and increased in the DEX 12.5 and 25 groups compared with the DEX 0 group (B). The number of NeuN-positive cells in the cortex was decreased in the DEX 0 group compared with the sham and the control group (C). * P < 0.05 vs Sham, † P < 0.05 vs control, ‡ P < 0.05 vs DEX 25, § P < 0.05 vs DEX 12.5. The data are expressed as means ± SD (n = 10). DEX, dexmedetomidine. significantly decreased compared with that in the sham group. The percent time spent in the quadrant was significantly decreased in the DEX 0 group compared with the sham and the control group, and the percent time spent in the quadrant was significantly increased in the DEX 25 group compared with the DEX 0 group. This indicates that the DEX 25 improved the escape latency, the swimming speed, and he percent time spent in the quadrant. 3.2. Fear conditioning test The freezing times in response to the conditioned stimulus tone were significantly decreased in the DEX 0 and 6.6 groups compared with the sham, the control and DEX 25 groups. The data indicate that the DEX 25 group had a freezing time that was similar to that in the sham group. (Fig. 3). 23 International Journal of Developmental Neuroscience 75 (2019) 19–26 3.3. DEX attenuates the reduction in neuronal numbers in anesthesia- exposed brains Fig. 4 shows NeuN staining of brain sections from the 5 groups at -3 mm caudally to bregma. The number of NeuN-positive cells per 0.15 mm2 in the hippocampal CA1 region was significantly decreased in the DEX 0 and 6.6 groups compared with the sham, the control and the DEX 25 groups. In addition, the DEX 12.5 and 25 groups had an increased number of positive cells compared with those in the DEX 0 group (Fig. 5A). The number of NeuN-positive cells per 0.15 mm2 in the amygdala was significantly decreased in the DEX 0 group compared with the sham and the control group, and the number of cells in the DEX 12.5 and 25 groups were significantly increased compared with those in the DEX 0 group, suggesting that DEX 12.5 and 25 increased the number of intact cells in the amygdala (Fig. 5B). The number of NeuN-positive cells per 0.15 mm2 in the cortex was significantly de- creased in the DEX 0 group compared with the sham and the control group (Fig. 5C). 3.4. PCDM and statistical parameter mapping of positive cell density Fig. 6A shows the NeuN PCDM for each group. The positive cell density tended to increase in the cortex. DEX-treated rats showed an increase in the hippocampal and cortical PCDM compared with the DEX 0 group. The differences among the groups are shown in detail in Fig. 6B. DEX-treated rats had significantly increased NeuN-positive cell densities when compared with those in the DEX 0 group. Increased NeuN expression was observed in almost all cortical and hippocampal areas, indicating that the numbers of normal cells in the DEX 12.5 and 25 groups were profoundly higher than those in the DEX 0 group. 4. Discussion Our study shows that the pre-treatment of neonatal rats with DEX before exposure to sevoflurane anesthesia improved cognitive function, and increased the number of intact neurons in the cortex, hippocampus, and amygdala in the adulthood, indicating that DEX attenuates the neural degeneration induced by exposure of the developing rat brain to sevoflurane. Although the doses of DEX used in this study were 6.6, 12.5, and 25 μg/kg, we did not find a dose-response relationship. The rats in the DEX 25 group obtained the maximum effects compared with those in the other groups, as seen in the water maze, fear conditioning test, and histological results. These results were consistent with previous similar studies (Li et al., 2014; Sanders et al., 2010, 2009), though inconsistent with others (Lee et al., 2017; Perez-Zoghbi et al., 2017). In previous studies, DEX ameliorated the neuroapoptosis and cognitive dysfunction induced by exposure of the developing brain to isoflurane (Li et al., 2014; Sanders et al., 2010, 2009), sevoflurane (Perez-Zoghbi et al., 2017), and propofol (Lv et al., 2017; Wang et al., 2016; Xiao et al., 2018). Sanders et. al. showed that DEX 25, 50, and 75 μg/kg prevents cortical apoptosis in vitro and in vivo, whereas higher doses of DEX do not further increase the protection against isoflurane-induced injury in the cortex (Sanders et al., 2010). In contrast, the study from Perez- Zoghbi et al. showed that co-administration of DEX (1 μg/kg) during 2.5% sevoflurane exposure for 6 h provided significant neuroprotection, as measured by a reduction in the number of caspase-3 positive cells in several brain regions, whereas DEX at doses of 10, and 25 μg/kg in combination with sevoflurane increased mortality (Perez-Zoghbi et al., 2017). In contrast to previous studies, the aim of this study was to measure cognitive function, using the fear conditioning test, and the number of intact neurons in the brain during adulthood, as in our previous study (Goyagi, 2018). We only measured the freezing time to tone but did not use contextual stimuli. The amygdala contributes to the acquisition of conditioned fear responses to a cue, whereas the amygdala and the T. Goyagi International Journal of Developmental Neuroscience 75 (2019) 19–26 Fig. 6. Positive cell density map (PCDM) and statistical parameter mapping of positive cell densities in the brains of sevoflurane-exposed rats. (A) The NeuN PCDM for each group is shown. (B) Statistical parametric mapping showing the areas (red) where the DEX-treated groups yielded significantly higher NeuN-positive cell densities than the DEX 0 group, indicating the numbers of normal cells in the DEX-treated group were higher than in the DEX 0 group. DEX, dexmedetomidine. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article). hippocampus contribute to the acquisition of contextual conditioned fear responses (Phillips and LeDoux, 1992; Selden et al., 1991; Stanton, 2000). In this study, we measured the number of NueN-positive cells in both the amygdala and CA1 hippocampus. The cells in both regions increased in the DEX 12.5 and 25 groups, which was consistent with the behavioral results. The behavioral and histological results from this study suggested that administration of 12.5 and 25 μg/kg DEX improved learning and memory following sevoflurane-induced neuro- logical impairment in the developing brain. Neural toxicity induced by exposure to general anesthesia in neo- natal rodents has been shown to lead to neurological impairments in adulthood (Disma et al., 2016; Stratmann, 2011; Walters and Paule, 2017). Numerous animal studies have reported that anesthetic neuro- toxicity occurs via several pathways (Acharya et al., 2015; Jevtovic- 24 T. Goyagi Todorovic, 2018; Shen et al., 2013; Sinner et al., 2014). We have pre- viously reported that the use of oxygen as a carrier gas at concentra- tions higher than 21% ameliorates sevoflurane-induced neurodegen- eration. (Goyagi, 2018). Therefore, we used air as a carrier for sevoflurane anesthesia to minimize the neuroprotective effects of oxygen. According to the results of a previous study, co-administration of high dose DEX (5, 25 and 50 μg/kg) and 2.5% sevoflurane in rat pups causes high mortality rates (Perez-Zoghbi et al., 2017), and DEX pro- duces significant cellular degeneration and apoptosis in primary sen- sory brain regions (Pancaro et al., 2016), though we did not find the degeneration induced by DEX administration alone (control group) in this study. Although we also used 3% sevoflurane in this study, 25 μg/ kg DEX did not cause a high rate of mortality. This difference may be because of the different methodology used and the environment. Fur- ther studies are needed to clarify the neurotoxic effects of DEX in neonatal brain, with or without sevoflurane anesthesia. This study has several limitations. First, the rat pups were main- tained under spontaneous ventilation during sevoflurane anesthesia. Since sevoflurane depresses ventilation in a dose-dependent manner, hypercapnia may be seen during the anesthesia exposure. Although we did not measure the blood gas analysis in this study, there was no significant difference in the rate of hypercapnia among the groups in our previous study (Goyagi, 2018). Therefore, hypercapnia was not examined here. Second, the rat pups received sevoflurane with 21% oxygen in this study. According to our previous study, rat pups that receive sevoflurane with 21% oxygen exhibit a profound increase in neurodegeneration compared with those that receive 30% oxygen (Goyagi, 2018). DEX has neuroprotective effects against hypoxic brain and spinal insult (Dahmani et al., 2005; Engelhard et al., 2002; Eser et al., 2008; Goyagi et al., 2009; Goyagi and Tobe, 2014; Ma et al., 2004; Zhu et al., 2013), and in animal neonatal models, particularly in the hypoxic-ischemic neonatal brain (Ren et al., 2016; Zhou et al., 2018). It is possible that DEX might be protective against the hypoxic effects of 21% oxygen rather than the neurotoxicity induced by sevo- flurane here. Although a carrier gas with 21% oxygen might increase the neurodegeneration induced by sevoflurane anesthesia in the neo- natal brain compared with higher oxygen concentrations, DEX ame- liorated the neurodegeneration induced by sevoflurane exposure with 21% oxygen in this study, as previously described (Perez-Zoghbi et al., 2017). Third, we used the Morris water maze and fear conditioning test to measure neurocognitive memory function in later adulthood in this study. As there are many tests for cognitive function in rats, further studies are warranted to measure the effects on other type of cognitive function. Fourth, the mechanisms underlying the protective effects of DEX were not clear from this study. Based on a previous study, DEX may attenuate the reduction in the expression of anti-apoptotic sig- naling pathways mediated by Bcl-2 and phosphor-ERK1/2 induced by isoflurane anesthesia, in a similar manner to that of neonatal brain injury (Li et al., 2014). Moreover, DEX has anti-apoptotic effects (Engelhard et al., 2002), decreases caspase-3 elevation (Dahmani et al., 2005; Eser et al., 2008) and attenuates the activation of the PI3k/Akt/ glycogen synthase kinase (GSK)3beta pathway in propofol-induced neuroapoptosis (Lv et al., 2017; Wang et al., 2016; Xiao et al., 2018). Further research is warranted in order to ascertain the precise neuro- protective mechanisms of DEX against neural toxicity induced by an- esthesia exposure in the neonatal brain. 5. Conclusion Four-hour administration of sevoflurane anesthesia in neonatal rats caused significant cognitive impairment in adulthood. Administration of a single dose of 25 μg/kg DEX before sevoflurane exposure improved cognitive functions, and maximum effects were observed at this dose compared with the other doses. Also, DEX attenuates the reduction in neuronal numbers in sevoflurane-exposed brains. DEX is likely to be useful as a neuroprotective agent in pediatric anesthesia. 25 International Journal of Developmental Neuroscience 75 (2019) 19–26 Ethics approval The animal experiments were performed according to international ethical standards and approved by the research ethics committee of Akita University (a-1-2625). Funding This study was supported in part by a Grant-in-Aid for Scientific Research (C), JSPS KAKENHI Grant Number JP 24592291. Conflict of interest The authors declare no conflicts of interest. Acknowledgements I would like to thank Mr. Yoshitsugu Tobe and Dr. Yoko Masaki, Ph.D. from the Department of Anesthesia and Intensive Care Medicine, Akita Graduate School of Medicine, for technical assistance. I am also grateful to Dr. Makoto Wada, M.D., Ph.D. from the Department of Rehabilitation for Brain Functions, National Rehabilitation Center for Persons with Disabilities, for technical advice and the use of his soft- ware. References Acharya, N.K., Goldwaser, E.L., Forsberg, M.M., Godsey, G.A., Johnson, C.A., Sarkar, A., DeMarshall, C., Kosciuk, M.C., Dash, J.M., Hale, C.P., Leonard, D.M., Appelt, D.M., Nagele, R.G., 2015. Sevoflurane and Isoflurane induce structural changes in brain vascular endothelial cells and increase blood-brain barrier permeability: possible link to postoperative delirium and cognitive decline. Brain Res. 1620, 29–41. Amrock, L.G., Starner, M.L., Murphy, K.L., Baxter, M.G., 2015. Long-term effects of single or multiple neonatal sevo urane exposures on rat hippocampal ultrastructure. Anesthesiology 122, 87–95. Andropoulos, D.B., Greene, M.F., 2017. Anesthesia and developing brains — implications of the FDA warning. N. Engl. J. Med. 376, 905–907. Dahmani, S., Rouelle, D., Gressens, P., Mantz, J., 2005. Effects of dexmedetomidine on hippocampal focal adhesion kinase tyrosine phosphorylation in physiologic and is- chemic conditions. Anesthesiology 103, 969–977. Davidson, A.J., Disma, N., de Graaff, J.C., Withington, D.E., Dorris, L., Bell, G., Stargatt, R., Bellinger, D.C., Schuster, T., Arnup, S.J., Hardy, P., Hunt, R.W., Takagi, M.J., Giribaldi, G., Hartmann, P.L., Salvo, I., Morton, N.S., von Ungern Sternberg, B.S., Locatelli, B.G., Wilton, N., Lynn, A., Thomas, J.J., Polaner, D., Bagshaw, O., Szmuk, P., Absalom, A.R., Frawley, G., Berde, C., Ormond, G.D., Marmor, J., McCann, M.E., 2016. Neurodevelopmental outcome at 2 years of age after general anaesthesia and awake-regional anaesthesia in infancy (GAS): an international multicentre, rando- mised controlled trial. Lancet 387, 239–250. Degos, Vincent, Le charpentier, Tifenn, Chhor, Vibol, Brissaud, Olivier, Lebon, Sophie, Schwendimann, Leslie, Bednareck, Nathalie, Passemard, Sandrine, Mantz, Jean, Gressens, Pierre, 2013. Neuroprotective effects of dexmedetomidine against gluta- mate agonist-induced neuronal cell death are related to increased astrocyte brain- derived neurotrophic factor expression. Anesthesiology 118, 1123–1132. Disma, N., Mondardini, M.C., Terrando, N., Absalom, A.R., Bilotta, F., 2016. A systematic review of methodology applied during preclinical anesthetic neurotoxicity studies: important issues and lessons relevant to the design of future clinical research. Paediatr. Anaesth. 26, 6–36. Duan, X., Li, Y., Zhou, C., Huang, L., Dong, Z., 2014. Dexmedetomidine provides neu- roprotection: impact on ketamine-induced neuroapoptosis in the developing rat brain. Acta Anaesthesiol. Scand. 58, 1121–1126. Duan, X., Coburn, M., Rossaint, R., Sanders, R.D., Waesberghe, J.V., Kowark, A., 2018. Efficacy of perioperative dexmedetomidine on postoperative delirium: systematic review and meta-analysis with trial sequential analysis of randomised controlled trials. Br. J. Anaesth. 121, 384–397. Endesfelder, S., Makki, H., von Haefen, C., Spies, C.D., Buhrer, C., Sifringer, M., 2017. Neuroprotective effects of dexmedetomidine against hyperoxia-induced injury in the developing rat brain. PLoS One 12, e0171498. Engelhard, K., Werner, C., Kaspar, S., Möllenberg, O., Blobner, M., Bachl, M., Kochs, E., 2002. Effect of the alpha2-agonist dexmedetomidine on cerebral neurotransmitter concentrations during cerebral ischemia in rats. Anesthesiology 96, 450–457. Eser, O., Fidan, H., Sahin, O., Cosar, M., Yaman, M., Mollaoglu, H., Songur, A., Buyukbas, S., 2008. The influence of dexmedetomidine on ischemic rat hippocampus. Brain Res. 1218, 250–256. Fang, F., Xue, Z., Cang, J., 2012. Sevoflurane exposure in 7-day-old rats affects neuro- genesis, neurodegeneration and neurocognitive function. Neurosci. Bull. 28, 499–508. Goyagi, T., 2018. The additional oxygen as a carrier gas during long-duration sevoflurane T. Goyagi exposure ameliorate the neuronal apoptosis and improve the long-term cognitive function in neonatal rats. Brain Res. 1678, 220–230. Goyagi, T., Tobe, Y., 2014. Dexmedetomidine improves the histological and neurological outcomes 48 h after transient spinal ischemia in rats. Brain Res. 1566, 24–30. Goyagi, T., Nishikawa, T., Tobe, Y., Masaki, Y., 2009. The combined neuroprotective effects of lidocaine and dexmedetomidine after transient forebrain ischemia in rats. Acta Anaesthesiol. Scand. 53, 1176–1183. Jevtovic-Todorovic, V., 2018. Exposure of developing brain to general anesthesia: What is the animal evidence? Anesthesiology 128, 832–839. Kamibayashi, T.M.M., 2000. Clinical uses of alpha 2-adrenergic agonists. Anesthesiology 93, 1345–1349. Lee, J.R., Lin, E.P., Hofacer, R.D., Upton, B., Lee, S.Y., Ewing, L., Joseph, B., Loepke, A.W., 2017. Alternative technique or mitigating strategy for sevoflurane-induced neuro- degeneration: a randomized controlled dose-escalation study of dexmedetomidine in neonatal rats. Br. J. Anaesth. 119, 492–505. Li, Y., Zeng, M., Chen, W., Liu, C., Wang, F., Han, X., Zuo, Z., Peng, S., 2014. Dexmedetomidine reduces isoflurane-induced neuroapoptosis partly by preserving PI3K/Akt pathway in the hippocampus of neonatal rats. PLoS One 9, e93639. Lv, J., Wei, Y., Chen, Y., Zhang, X., Gong, Z., Jiang, Y., Gong, Q., Zhou, L., Wang, H., Xie, Y., 2017. Dexmedetomidine attenuates propofol-induce neuroapoptosis partly via the activation of the PI3k/Akt/GSK3beta pathway in the hippocampus of neonatal rats. Environ. Toxicol. Pharmacol. 52, 121–128. Ma, D., Hossain, M., Rajakumaraswamy, N., Arshad, M., Sanders, R.D., Franks, N.P., Maze, M., 2004. Dexmedetomidine produces its neuroprotective effect via the alpha 2A-adrenoceptor subtype. Eur. J. Pharmacol. 502, 87–97. Pancaro, C., Segal, B.S., Sikes, R.W., Almeer, Z., Schumann, R., Azocar, R.J., Marchand, J.E., 2016. Dexmedetomidine and ketamine show distinct patterns of cell degenera- tion and apoptosis in the developing rat neonatal brain. J. Matern. Fetal. Neonatal. Med. 29, 3827–3833. Perez-Zoghbi, J.F., Zhu, W., Grafe, M.R., Brambrink, A.M., 2017. Dexmedetomidine- mediated neuroprotection against sevoflurane-induced neurotoxicity extends to several brain regions in neonatal rats. Br. J. Anaesth. 119, 506–516. Phillips, R.G., LeDoux, J.E., 1992. Differential contribution of amygdala and hippo- campus to cued and contextual fear conditioning. Behav. Neurosci. 106, 274–285. Ren, X., Ma, H., Zuo, Z., 2016. Dexmedetomidine postconditioning reduces brain injury after brain hypoxia-ischemia in neonatal rats. J. Neuroimmune Pharmacol. 11, 238–247. Sanders, R.D., Xu, J., Shu, Y., Januszewski, A., Halder, S., Fidalgo, A., Sun, P., Hossain, M., Ma, D., Maze, M., 2009. Dexmedetomidine attenuates isoflurane-induced neu- rocognitive impairment in neonatal rats. Anesthesiology 110, 1077–1085. Sanders, R.D., Sun, P., Patel, S., Li, M., Maze, M., Ma, D., 2010. Dexmedetomidine pro- vides cortical neuroprotection: impact on anaesthetic-induced neuroapoptosis in the rat developing brain. Acta Anaesthesiol. Scand. 54, 710–716. Schoeler, M., Loetscher, P.D., Rossaint, R., Fahlenkamp, A.V., Eberhardt, G., Rex, S., Weis, J., Coburn, M., 2012. Dexmedetomidine is neuroprotective in an in vitro model for traumatic brain injury. BMC Neurol. 12, 20. Selden, N.R., Everitt, B.J., Jarrard, L.E.R., T W, 1991. Complementary roles for the 26 International Journal of Developmental Neuroscience 75 (2019) 19–26 amygdala and hippocampus in aversive conditioning to explicit and contextual cues. Neuroscience 42, 335–350. Shen, X., Dong, Y., Xu, Z., Wang, H., Miao, C., Soriano, S.G., Sun, D., Baxter, M.G., Zhang, Y., Xie, Z., 2013. Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 118, 502–515. Sifringer, M., von Haefen, C., Krain, M., Paeschke, N., Bendix, I., Buhrer, C., Spies, C.D., Endesfelder, S., 2015. Neuroprotective effect of dexmedetomidine on hyperoxia-in- duced toxicity in the neonatal rat brain. Oxid. Med. Cell. Longev. 2015, 1–10. Sinner, B., Becke, K., Engelhard, K., 2014. General anaesthetics and the developing brain: an overview. Anaesthesia 69, 1009–1022. Stanton, M.E., 2000. Multiple memory systems, development and conditioning. Behav. Brain Res. 110, 25–37. Stratmann, G., 2011. Neurotoxicity of anesthetic drugs in the developing brain. Anesth. Analg. 113, 1170–1179. Sun, L.S., Li, G., Miller, T.L., Salorio, C., Byrne, M.W., Bellinger, D.C., Ing, C., Park, R., Radcliffe, J., Hays, S.R., DiMaggio, C.J., Cooper, T.J., Rauh, V., Maxwell, L.G., Youn, A., McGowan, F.X., 2016. Association between a single general anesthesia exposure before age 36 months and neurocognitive outcomes in later childhood. JAMA 315, 2312–2320. Wada, M., Yoshimi, K., Higo, N., Ren, Y.R., Mochizuki, H., Mizuno, Y., Kitazawa, S., 2006. Statistical parametric mapping of immunopositive cell density. Neurosci. Res. 56, 96–102. Walters, J.L., Paule, M.G., 2017. Review of preclinical studies on pediatric general an- esthesia-induced developmental neurotoxicity. Neurotoxicol. Teratol. 60, 2–23. Wang, Y., Wu, C., Han, B., Xu, F., Mao, M., Guo, X., Wang, J., 2016. Dexmedetomidine attenuates repeated propofol exposure-induced hippocampal apoptosis, PI3K/Akt/ Gsk-3beta signaling disruption, and juvenile cognitive deficits in neonatal rats. Mol. Med. Rep. 14, 769–775. Warner, D.O., Zaccariello, M.J., Katusic, S.K., Schroeder, D.R., Hanson, A.C., Schulte, P.J., Buenvenida, S.L., Gleich, S.J., Wilder, R.T., Sprung, J., Hu, D., Voigt, R.G., Paule, M.G., Chelonis, J.J., Flick, R.P., 2018. Neuropsychological and behavioral outcomes after exposure of young children to procedures requiring general anesthesia: the mayo anesthesia safety in kids (MASK) study. Anesthesiology 129, 89–105. Xiao, Y., Zhou, L., Tu, Y., Li, Y., Liang, Y., Zhang, X., Lv, J., Zhong, Y., Xie, Y., 2018. Dexmedetomidine attenuates the propofol-induced long-term neurotoxicity in the developing brain of rats by enhancing the PI3K/Akt signaling pathway. Neuropsychiatr. Dis. Treat. 14, 2191–2206. Zheng, S.Q., An, L.X., Cheng, X., Wang, Y.J., 2013. Sevoflurane causes neuronal apoptosis and adaptability changes of neonatal rats. Acta Anaesthesiol. Scand. 57, 1167–1174. Zhou, X.M., Liu, J., Wang, Y., Zhang, M.H., 2018. Silencing of long noncoding RNA MEG3 enhances cerebral protection of dexmedetomidine against hypoxic-ischemic brain damage in neonatal mice by binding to miR-129-5p. J. Cell. Biochem. 28, 1–11. Zhu, Y.M., Wang, C.C., Chen, L., Qian, L.B., Ma, L.L., Yu, J., Zhu, M.H., Wen, C.Y., Yu, L.N., Yan, M., 2013. Both PI3K/Akt and ERK1/2 pathways participate in the pro- tection by dexmedetomidine against transient focal cerebral ischemia/reperfusion injury in rats. Brain Res. 1494, 1–8.",rats,"['Seven-day-old rats received intraperitoneal saline (DEX 0) or DEX (6.6, 12.5, 25 \x085g/kg) 30 min before exposure to 3% sevoflurane with 21% oxygen for 4 h (n = 10 per group).']",postnatal day 7,"['Seven-day-old rats received intraperitoneal saline (DEX 0) or DEX (6.6, 12.5, 25 \x085g/kg) 30 min before exposure to 3% sevoflurane with 21% oxygen for 4 h (n = 10 per group).']",Y,"['Spatial memory retention was examined using the Morris water maze by blinded observer as described previously (Goyagi, 2018).', 'Fear conditioning was performed to evaluate contextual memory retention using the fear conditioning system (MK-450RSQ; Muromachi Kikai Co., Ltd, Tokyo, Japan) as described previously (Goyagi, 2018).']",sevoflurane,"['Seven-day-old rats received intraperitoneal saline (DEX 0) or DEX (6.6, 12.5, 25 \x085g/kg) 30 min before exposure to 3% sevoflurane with 21% oxygen for 4 h (n = 10 per group).']",dexmedetomidine,"['Seven-day-old rats received intraperitoneal saline (DEX 0) or DEX (6.6, 12.5, 25 \x085g/kg) 30 min before exposure to 3% sevoflurane with 21% oxygen for 4 h (n = 10 per group).']",wistar,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15 g) were used in this study.']",This study examined whether DEX improves the long-term cognitive dysfunction observed after exposure of neonatal rats to 3% sevoflurane.,['This study examined whether DEX improves the long-term cognitive dysfunction observed after exposure of neonatal rats to 3% sevoflurane.'],None,[],DEX may improve long-term cognitive function and ameliorate the neuronal degeneration induced by sevoflurane exposure in neonatal rats.,['These findings indicate pre-treatment with DEX may improve long-term cognitive function and ameliorate the neuronal degeneration induced by sevoflurane exposure in neonatal rats.'],"The study did not measure blood gas analysis during sevoflurane anesthesia, and the neuroprotective mechanisms of DEX were not clarified.","['Since sevoflurane depresses ventilation in a dose-dependent manner, hypercapnia may be seen during the anesthesia exposure.', 'Further research is warranted in order to ascertain the precise neuroprotective mechanisms of DEX against neural toxicity induced by anesthesia exposure in the neonatal brain.']",DEX as a neuroprotective agent in pediatric anesthesia.,['DEX is likely to be useful as a neuroprotective agent in pediatric anesthesia.'],True,True,True,True,False,True,10.1016/j.ijdevneu.2019.04.002 10.1097/EJA.0b013e328330d453,667.0,Han,2010,rats,postnatal day 7,N,ketamine,none,sprague dawley,"Original article 181 The effect of ketamine on N-methyl-D-aspartate receptor subunit expression in neonatal rats Li-Chun Hana, Li-nong Yaob, Sheng-xi Wuc, Yong-hui Yangb, Li-Xian Xua,M and Wei Chaib,M X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f Background and objective Ketamine has been widely used in paediatric anaesthesia but its influence on development in infants and toddlers still remains unclear. In order to elucidate the influence of ketamine on brain development in neonatal rats, semiquantitative reverse transcriptase PCR, quantitative reverse transcriptase PCR and immunohistochemistry assays were performed to detect the expression of N-methyl-D-aspartate receptor subtypes expression. Methods Seven-day-old rats were divided into two random groups. All of them were injected with ketamine intraperitoneally at postnatal day (PND) 7; one group was sacrificed at PND 7, but the other group was sacrificed at PND 28. Each group was divided into five random subgroups. Results In the semiquantitative reverse transcriptase PCR and quantitative reverse transcriptase PCR experiments, ketamine treatment caused a marked increase in mRNA expression in all subtypes at PND 7 and in NR2A subtypes at PND 28. Immunohistochemistry results indicated that NR2A, 2B and 2C receptor protein increased significantly at PND 7, and NR2A receptor protein increased at PND 28. Conclusions Exposure to ketamine resulted in an increase in N-methyl-D-aspartate receptor subunits at PND 7, and this increase persisted to PND 28 in NR2A. Eur J Anaesthesiol 27:181–186 Q 2010 European Society of Anaesthesiology. European Journal of Anaesthesiology 2010, 27:181–186 Keywords: hippocampus, immunohistochemistry, ketamine, N-methyl-D- aspartate, quantitative reverse transcriptase PCR, semiquantitative reverse transcriptase PCR aDepartment of Anesthesiology, School of Stomatology, bDepartment of Anesthesiology, Tangdu Hospital and cDepartment of Anatomy, Histology and Embryology, K. K. Leung Brain Research Centre, Fourth Military Medical University, Xi’an, PR China Correspondence to Dr Li-Xian Xu, Department of Anesthesiology, School of Stomatology, Fourth Military Medical University, Xi’an 710032, PR China E-mail: kqmzk@fmmu.edu.cn Correspondence to Dr Wei Chai, Department of Anesthesiology, Tangdu Hospital, Fourth Military Medical University, Xi’an, 710038, PR China E-mail: tdmzka@fmmu.edu.cn Received 12 February 2009 Revised 14 July 2009 Accepted 14 July 2009 Introduction Ketamine is used as a general paediatric anaesthetic for surgical procedures in infants and toddlers. It has been reported that it blocks excitatory synaptic transmission by acting as a noncompetitive N-methyl-D-aspartate (NMDA) receptor ion channel blocker [1]. NMDA receptors play important roles in excitatory synap- tic transmission, in brain cell migration, differentiation, survival and activity-dependent synaptic plasticity under- lying learning and memory [2]. Ikonomidou et al. [3] was the first to demonstrate that the NMDA receptor antagonists MK-801 and ketamine induce neuroapoptosis in several encephalic regions in rats at postnatal day (PND) 7 after treatment for 8 h. Since then, groups have verified that NMDA receptor antagonists can provoke neuroapop- tosis in many encephalic regions [4–6]. Many studies have shown that NMDA receptor anta- gonists can change the expression of NMDA receptor subtypes. In the present study, in order to investigate the influence of ketamine on brain development in neonatal rats, we aimed to show that ketamine, administered as a classic general anaesthetic agent for short-term anaesthe- sia caused changes in the expression of NMDA receptor subtypes NR1, NR2A, NR2B and NR2C at the mRNA level using quantitative reverse transcriptase (qRT) PCR and semiquantitative reverse transcriptase (sqRT) PCR techniques and at the protein level using immuno- histochemistry. Materials and methods Animals Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12 : 12 h light/ dark cycle at 22–258C ambient temperature with food and water available ad libitum for the mothers. All of the experimental procedures were approved by the Animal Use and Care Committee for Research and followed the ethical guidelines for investigation of experimental pain in conscious animals [7]. M Dr Li-Xian Xu and Dr Wei Chai contributed equally to the writing of this article. Rats (n ¼ 40) were divided into two random groups. In one group (n ¼ 20) the rats were injected with ketamine 0265-0215 (cid:1) 2010 Copyright European Society of Anaesthesiology DOI:10.1097/EJA.0b013e328330d453 Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited. 182 European Journal of Anaesthesiology 2010, Vol 27 No 2 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f Table 1 Summary of experimental protocol PND 7 C K1 K2 Control group 100 mg kg(cid:1)1 ketamine persistently for 6 h 100 mg kg(cid:1)1 discontinuously for three times for 2 h; the three times were given once every other day K3 K4 50 mg kg(cid:1)1 ketamine persistently for 6 h 50 mg kg(cid:1)1 discontinuously for three times for 2 h; the three times were given once every other day PND 28 C K1 K2 Control group 100 mg kg(cid:1)1 ketamine persistently for 6 h 100 mg kg(cid:1)1 discontinuously for three times for 2 h; the three times were given once every other day K3 K4 50 mg kg(cid:1)1 ketamine persistently for 6 h 50 mg kg(cid:1)1 discontinuously for three times for 2 h; the three times were given once every other day intraperitoneally (i.p.) at PND 7 [8] and sacrificed within 24 h. In the other group (n ¼ 20) the rats were also injected with ketamine at PND 7 and were sacrificed at PND 28. Each group was divided into five random subgroups (n ¼ 4 per subgroup). The control group received 0.9% physio- logical saline. The other four groups received i.p. injec- tions of ketamine (K1–K4) [9] (see Table 1). Semiquantitative reverse-transcriptase PCR and quantitative real-time reverse-transcriptase PCR All animals from the different groups (n ¼ 4) were killed by decapitation under ether anaesthesia. sqRT-PCR was used to qualitatively assess the effect of NMDA subtype receptor expression. qRT-PCR was then applied in order to further quantify the observed effects. Table 2 sum- marizes information about the oligonucleotide primers used in this study. All primer sequences were checked in GenBank (National Center for Biotechnology Infor- mation, Bethesda, Maryland, USA) to avoid inadvertent sequence homologies. b-actin was used as an internal control. Animals were decapitated under ether anaesthe- sia, and the hippocampus was quickly dissected out and frozen at (cid:1)808C until use. Total RNA was isolated using Trizol reagent (Invitrogen, Virginia, USA), according to the manufacturer’s instructions, and then reverse transcribed with Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Invitrogen) and oligo(dT)12–18 primers. For sqRT-PCR, a PCR reaction mixture containing 10 mmol l(cid:1)1 Tris (pH 8.3), 50 mmol l(cid:1)1 KCI, 1.5 mmol l(cid:1)1 MgCI2, 100 ml of deoxyribonucleotide triphosphate (dNTP), 2.5 units of Taq DNA polymerase (Takara, Kyoto, Japan), 0.5 ml of synthesized cDNA and 20 pmol of each sense and antisense primer pair. The PCR reac- tion was performed for 30 cycles using a PTC-100 Pro- grammed Thermal Controller (MJ Research, Watertown, Massachusetts, USA) as follows: 1 min at 938C, 30 s at appropriate annealing temperature (Table 2) and 1 min at 728C, with 1 min of 938C treatment before starting the thermal cycles, and, finally, an 8 min extension at 728C was conducted. PCR was performed simultaneously on control and experimental rat samples, with the internal controls (b-actin) running in parallel with the examined mRNAs. In all reverse transcriptase PCR experiments including negative controls, in which template RNA or reverse transcriptase was omitted, no PCR product was detected. Ten microlitres of each PCR product was electrophoresed on a 3% agarose gel containing ethidium bromide. Resulting gel bands were visualized in an ultraviolet (UV) transilluminator, and images were cap- tured with an eight-bit charge coupled device (CCD) camera (Ultra-Violet Products, Upland, California, USA). Quantitative PCR was set up using SYBR Green- containing premix from Takara. The reverse transcrip- tase reaction product (100 ng) was amplified in a 25 ml reaction with 12.5 SYBR Premix EX Taq (Takara, Shiga, Japan). Samples were heated to 908C for 30 s, and then amplified for 40 cycles consisting of 958C for 15 s and 608C for 15 s. Relative quantification of NMDA subtype receptors was performed by a comparative threshold cycle method. All data are expressed as mean (cid:2) SEM. Experimental groups were compared by analysis of var- iance. P values of less than 0.05 were considered to be statistically significant. Immunohistochemistry Rats in the control group and those in the K1 and K3 subgroups (n ¼ 4), which were sacrificed on PND 7 or PND 28, were perfused transcardially with 100 ml of 0.01 mol l(cid:1)1 PBS (pH 7.4), followed by 100 ml of 4% (w/v) paraformal- dehyde and 75% (v/v) saturated picric acid in 0.1 mol l(cid:1)1 phosphate buffer (pH 7.4). The brains were then removed immediately and placed into the same fresh fixative for an additional 2 h at 48C. Subsequently, the brains were Table 2 Oligonucleotide primers used in the quantitative reverse transcriptase PCR and semiquantitative reverse transcriptase PCR experiments Subunits Subunits primer sequences Expected size (bp) Annealing temperature (8C) R1 NR2A NR2B NR2C b-actin 50-ATGGCATCATCGGACTTCAG-30 50-GGGCTCTTGGTGGATTGTCA-30 50-ATTCATCCCTTCGTTGGTTG-30 50-GCTATGGGCAGGCAGAGAAG-30 50-GTGGGCACTGAGGACTTGTT-30 50-TGTACGACATCAGCGAGGAC-30 50-TCGTATTCCTCCAGCACCTT-30 50-GATCCAGCCACTCACCGTAG-30 50-TGGTGGGTATGGGTCAGAAGGACTC-30 50-CATGGCTGGGGTGTTGAAGGTCTCA-30 431 395 319 300 265 58 56 56.3 55 57.3 Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited. Effect of ketamine on NMDA receptor subunit expression Han et al. 183 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f placed into 30% (w/v) sucrose solution in 0.1 mol l(cid:1)1 phos- phate buffer (pH 7.4) overnight at 48C (the sucrose solution contained 0.02% NaN3), and then cut serially into 30 mm thick coronal sections by the use of a freezing microtome (Kryostat 1720; Leitz, Mannheim, Germany). The sections were placed into five different dishes accord- ing to their numerical order while cutting (e.g. sections 1 and 7 in dish 1; sections 2 and 8 in dish 2; sections 3 and 9 in dish 3; sections 4 and 10 in dish 4; and sections 5 and 11 in dish 5). Each dish usually contained 28–32 sections. All sections were washed carefully with 0.01 mol l(cid:1)1 PBS. The sections in the first three dishes were used for immu- nohistochemistry for NR2A–2C. Briefly, the sections were incubated at 48C sequentially with: a mixture of rabbit anti-NR2A, 2B and 2C serum (1 : 200 dilution; Elek mol- nar) for 24 h; biotinylated goat antirabbit immunoglobulin G (1 : 200 dilution; Vector) for 2 h; and avidin-labelled horseradish peroxidase compound (1 : 100 dilution; Vector) for 1 h. The diluent used for all antibodies was 0.05 mol l(cid:1)1 PBS containing 5% (v/v) normal donkey serum, 0.5% (v/v) Triton X-100, 0.05% (w/v) sodium azide (NaN3) and 0.25% (w/v) carrageenan (pH 7.3). In the fourth dish, normal rabbit serum was used instead of rabbit anti-NR2A, 2B and 2C serum, and the following steps were the same as mentioned above. The fifth dish was used for Nissl stain- ing in order to locate a positive construction. The sections were rinsed at least three times in 0.01 mol l(cid:1)1 PBS (pH 7.4) after each incubation, for at least 10 min. The sections were coloured with diaminobenzidine (DAB) and H2O2, then sections were mounted onto clean glass slides, air dried and cover-slipped with a mixture of 50% (v/v) glycerin and 2.5% (w/v) triethylene diamine (antifading agent) in 0.01 mol l(cid:1)1 PBS. Finally, the sections were studied under a microscope. Fig. 1 ) n i t c a - β / ( s l e v e l A N R m e v i t a l e R 120 100 80 60 40 20 0 120 100 80 60 40 20 0 120 100 80 60 40 20 C C # # # K1 $ K1 K2 NR1 $ K2 NR2A K3 K3 $ 7d 28d K4 $ K4 0 Results Semiquantitative reverse-transcriptase PCR and quantitative real-time reverse-transcriptase PCR Reverse transcriptase PCR revealed mRNA expression of NR1, NR2A, NR2B and NR2C receptor subtypes as well as the b-actin in the rat hippocampus. The size of the bands for each receptor corresponded to the expected cDNA fragment size based on the choice of oligonucleo- tide primers (Table 2). 120 100 80 60 40 C # K1 K2 NR2B K3 K4 20 Ketamine treatment caused a marked increase in NR1, NR2A, NR2B and NR2C mRNA expressions at PND 7 when compared with the control (P < 0.05; Figs 1 and 2). At PND 28, ketamine treatment resulted in a different pattern of NMDA receptor mRNA expression from that at PND 7. Moreover, we also observed that the expres- sion of NR2A mRNA was significantly increased not only at PND 7 but also at PND 28 (P < 0.05; Figs 1 and 2), but no significant change was observed in NR1, NR2B or NR2C mRNA expression at PND 28 when compared with the control group (P > 0.05; Figs 1 and 2). More- over, no change was found among groups K1–K4, so we 0 C K1 K2 K3 K4 NR2C Histogram summary for relative expression levels of NR1, NR2A, NR2B and NR2C mRNA in the hippocampus of PND 7 and PND 28 rats after administration of ketamine (n ¼ 16, mean (cid:2) SE). C, control group; K1– K4, ketamine-treated groups. (cid:3)P < 0.05, compared with control group at PND 7; $P < 0.05, compared with control group at PND 28; and #P < 0.05, control group at PND 7 compared with the control group at PND 28. PND, postnatal day. Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited. 184 European Journal of Anaesthesiology 2010, Vol 27 No 2 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f Fig. 2 Electrophoresis strip of NR1, NR2A, NR2B and NR2C mRNA expression in the hippocampus of PND 7 and PND 28 rats after administration of ketamine. The expression of b-actin mRNA was used as an internal control. C, control group; K1–K4, ketamine-treated groups (see Materials and methods). PND, postnatal day. concluded that the dosage and schedule of exposure might not influence the effects of ketamine. In addition, NR1, NR2A and NR2C subtype receptor mRNA expression at PND 28 exhibited a significant increase when compared with PND 7 in the control group, but NR2B exhibited a reverse trend (P < 0.05; Figs 1 and 2). subgroups was higher than that in the control group: NR2A (control, 1.7 (cid:2) 0.1; K1, 7.2 (cid:2) 3.5; K3, 9.9 (cid:2) 4.3), NR2B (control, 1.2 (cid:2) 0.1; K1, 8.8 (cid:2) 3.4; K3, 9.5 (cid:2) 4.5) and NR2C (control, 3.8 (cid:2) 1.5; K1, 16.2 (cid:2) 6.2; K3, 16.8 (cid:2) 6.8). At PND 28, only the NR2A subtype receptor expression was significantly increased in the K1 and K3 groups com- pared with the control group: NR2A (control, 10.8 (cid:2) 3.2; K1, 28.5 (cid:2) 4.5; K3, 32.2 (cid:2) 5.4). There was no significant difference between the K1 and K3 subgroups. Discussion In the present study, we observed that neonatal rats receiving ketamine, administered for short periods and at moderate doses, could upregulate the NR1, NR2A, 2B and 2C receptor subtype mRNA and NR2A, 2B and 2C receptor subtype protein at PND 7, and the NR2A recep- tor mRNA and protein expression increase persisted to PND 28. It is well accepted that NMDA receptor antagonists can induce an increase in some NMDA recep- tor subtype mRNA expression during critical periods of [10,11]. Chronic treatment of cultured development neurons from neonatal rat brains with amino-phosphono- pentanoate 5 (AP-5), an NMDA receptor antagonist, increased NR2B mRNA expression, as well as NR1 and NR2A/B polypeptides [12]. Also, increased expression of excitatory amino acid receptor subunit mRNA may con- tribute to the enhanced vulnerability to excitotoxic injury that has been observed after MK-801 treatment [13]. Previous studies [14,15] showed that NMDA receptors participated in central nervous system (CNS) regulation and appeared to regulate the excitatory synaptic trans- mission and synaptic plasticity underlying learning and in glutamate transmission, memory. Abnormalities particularly involving overstimulation of NMDA recep- tors, have been implicated in apoptosis, abnormal axonal arborization and aberrant CNS development [16]. In 2002, Olney [17] observed that NMDA receptor anta- gonists interfered with CNS development and caused abnormalities in morphology and function. Neonatal rats receiving AP-5 or MK-801 during the first 2 weeks of life developed abnormal axonal arborizations in the retinal connections to the superior colliculus, interfering with normal visual responses [18]. Neurons with NMDA receptors are exquisitely sensitive to overstimulation, and they are similarly sensitive to understimulation during synaptogenesis. Too much NMDA receptor stimulation triggers excitotoxic neurodegeneration, but too little triggers apoptotic neurodegeneration [17]. Immunohistochemistry of NR2A, 2B and 2C subtype protein Representative photomicrographs of NR2A, 2B and 2C subtype receptor staining and statistical analysis with the Student’s t-test among the groups are presented in Fig. 3. At PND 7, NR2A, 2B and 2C subtype receptor expression was observed mainly in the hippocampus, and the corresponding receptor expression in the K1 and K3 Ketamine treatment may alter glutamatergic synaptic transmission through NMDA receptors and contributes to the upregulation of NMDA receptor mRNA expres- sion, but how increased expression of excitatory amino acid receptor subunit mRNA contributes to excitotoxic injury and neuroapoptosis remains controversial. Some researchers have found that glutamate binding to NMDA Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited. Effect of ketamine on NMDA receptor subunit expression Han et al. 185 Fig. 3 X M 0 h C y w C X 1 A W n Y Q p / I l i D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f Representative photomicrographs of brain sections showing N-methyl-D-aspartate receptor subtype neurons in the CA1 region of the hippocampus in rat brains in the control (a, d, g), K1 (b, e, h) and K3 (c, f, i) groups. (m and n) The statistical analysis of NMDA receptor subtype neurons in different groups on PND 7 and PND 28. Ketamine (K1 and K3) produced much higher expressions of NR2A, 2B and 2C on PND 7, and NR2A on PND 28 than the control groups; scale bar ¼ 100 mm in (l) for (a)–(l). (cid:3)Groups K1 and K3 are statistically significantly different (P < 0.05) from group C in the CA1 region on PND 7 and PND 28. NMDA, N-methyl-D-aspartate; PND, postnatal day. Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited. 186 European Journal of Anaesthesiology 2010, Vol 27 No 2 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C 3 V C 1 y 0 a b g g Q Z X d g G 2 M w Z L e = o n 1 1 2 0 2 0 2 3 r i i l f j l I / / D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / e a n a e s t h e s o o g y j i l b y B h D M 5 e P H K a v 1 z E o u m 1 Q N 4 a + k J L h E Z g b s I H o 4 f t f receptors caused Ca2þ influx that activates second mes- sengers, thus regulating neuronal migration, differen- tiation and synaptic plasticity [19–22]. High concen- trations of glutamate resulted in too much Ca2þ influx, causing excitotoxicity. Here, we showed that ketamine could increase mRNA expression of NMDA receptor subtypes. However, if this block is eliminated, the increased expression of NMDA receptors might result in increased glutamate binding, thus inducing excessive Ca2þ influx. This altered level of Ca2þ influx could lead to neuroapoptosis. Further studies on ketamine-induced changes in apoptosis and Ca2þ-binding proteins are necessary to elucidate this possibility. Glutamate and NMDA receptors mediate a variety of complicated biological processes such as induction, generation, differentiation, apoptosis, migration, synaptic formation and neural network establishment [2,14– 15,17,23]. Synaptic and extrasynaptic NMDA receptors have fundamentally different effects on the fate of neurons. Synaptic NMDA receptors promote survival, whereas extrasynaptic NMDA receptors trigger neuronal degeneration and cell death [24,25]. Therefore, an increase in the expression of some NMDA receptor subunits might result in changes in subunit composition and possibly influence all of these developmental pro- cesses. Although the mechanisms underlying upregula- tion of expression were not clear, Wang et al. [26] suggested that increased NMDA receptor expression might be due to an increased rate of transcription or decreased rate of degradation. Taken together, these studies suggest that neonatal animals receiving chronic NMDA receptor antagonists developed abnormal neuronal structure and altered CNS function. Our present study demonstrated that ketamine, administered for short periods and at clinical application doses, induced changes in NMDA receptor subunit com- position and increased some NMDA receptor subtype expressions in neonatal rats, and this effect persisted to PND 28. The expressions of NMDA receptor subunits showed a period specificity at both the transcriptional and translational levels. Ketamine as a kind of NMDA recep- tor antagonist might change the period-specific expres- sion of some NMDA receptor subunits. 3 Ikonomidou C, Olney JW, Bosch F, et al. Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 1999; 283:70–74. 4 Jevtovic-Todorovic V, Hartman RE, Izumi Y, et al. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 2003; 23:876–882. 5 Luk KC, Kennedy TE, Sadikot AF. Glutamate promotes proliferation of striatal neuronal progenitors by an NMDA receptor-mediated mechanism. J Neurosci 2003; 23:2239–2250. 6 Mellon RD, Simone AF, Rappaport BA. Use of anesthetic agents in neonates and young children. Anesth Analg 2007; 104:509–520. 7 Zimmermann M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983; 16:109–110. 8 Mickly GA, Remmers-Roeber DR, Crouse C. Ketamine blocks a taste- mediated conditioned motor response in perinatal rats. Pharmacol Biochem Behav 2000; 66:547–552. 9 Wolfensohn S, Lloyd M. Handbook of laboratory animal management and welfare. Oxford, UK: Wiley-Blackwell Inc.; 2003; 185–186. 10 Trevisan L, Fitzgerald LW, Brose N, et al. Chronic ingestion of ethanol up- regulates NMDAR1 receptor subunit immunoreactivity in rat hippocampus. J Neurochem 1994; 62:1635–1638. 11 Hinoi E, Fujimori S, Nakamura Y, et al. Constitutive expression of heterologous N-methyl-D-aspartate receptor subunits in rat adrenal medulla. J Neurosci Res 2002; 68:36–45. 12 Follesa P, Ticku MK. NMDA receptor upregulation: molecular studies in cultured mouse cortical neurons after chronic antagonist exposure. Neuroscience 1996; 16:2172–2178. 13 Wilson MA, Kinsman SL, Johnston MV. Expression of NMDA receptor subunit mRNA after MK-801 treatment in neonatal rats. Dev Brain Res 1998; 109:211–220. 14 Kato K, Li ST, Zorumski CF. Modulation of long-term potentiation induction in the hippocampus by NMDA-mediated presynaptic inhibition. Neuroscience 1999; 92:1261–1272. 15 Hudspith MJ. Glutamate: a role in normal brain function, anesthesia, analgesia and CNS injury. Br J Anesth 1997; 78:731–747. 16 Haberny KA, Paule MG, Scallet AC, et al. Ontogeny of the N-methyl-D- aspartate (NMDA) receptor system and susceptibility to neurotoxicity. Toxicol Sci 2002; 68:9–17. 17 Olney JW. New insights and new issues in developmental neurotoxicology. Neurotoxicology 2002; 23:659–668. 18 Simon DK. NMDA receptor antagonists disrupt the formation of a mammalian neural map. Proc Natl Acad Sci U S A 1992; 89:10593– 10597. 19 Akopian A, Witkovsky P. Calcium and retinal function. Mol Neurobiol 2002; 2:113–132. 20 Holt M, Cooke A, Wu MM, et al. Bulk membrane retrieval in the synaptic terminal of retinal bipolar cells. J Neurosci 2003; 23:1329–1339. 21 Weiler R, Janssen BU. Spinule-type neurite outgrowth from horizontal cells during light adaptation in the carp retina: an actin-dependent process. J Neurocytol 1993; 22:129–139. 22 Berridge MJ, Bootman MD, Roderick HL. Calcium signalling: dynamics, homeostasis and remodeling. Nat Rev Mol Cell Biol 2003; 4:517–529. 23 Behar TN, Scott CA, Greene CL, et al. Glutamate acting at NMDA receptors stimulates embryonic cortical neuronal migration. J Neurosci 1999; 19:4449–4461. 24 Wittmann M, Bengtson CP, Bading H. Extrasynaptic NMDA receptors: mediators of excitotoxic cell death. Pharmacol Cereb Ischemia 2004;253–266. 25 Jiang Q, Gu Z, Zhang G, et al. NMDA receptor activation results in regulation of extracellular signal-regulated kinases by protein kinases and phosphatases in glutamate-induced neuronal apoptotic-like death. Brain Res 2000; 887:285–292. 26 Wang C, Sadovova N, Fu X, et al. The role of the N-methyl-D-aspartate Acknowledgement This work was supported by grants from the National Natural Science Foundation of China (nos 30470556 and 30570683). receptor in katemine-induced apoptosis in rat forebrain culture. Neuroscience 2005; 132:967–977. References 1 Yamamura T, Harada K, Okamura A, Kemmotsu O. Is the site of action of ketamine anesthesia the N-methyl-D-aspartate receptor? Anesthesiology 1990; 72:704–710. 2 Komuro H, Rakic P. Modulation of neuronal migration by NMDA receptors. Science 1993; 260:95–97. Copyright © European Society of Anaesthesiology. Unauthorized reproduction of this article is prohibited.",rats,['Seven-day-old rats were divided into two random groups.'],postnatal day 7,['All of them were injected with ketamine intraperitoneally at postnatal day (PND) 7;'],N,[],ketamine,['All of them were injected with ketamine intraperitoneally at postnatal day (PND) 7;'],none,[],sprague dawley,['Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12 : 12 h light/dark cycle at 22–258C ambient temperature with food and water available ad libitum for the mothers.'],The influence of ketamine on brain development in neonatal rats and its effect on N-methyl-D-aspartate receptor subunit expression.,"['Background and objective Ketamine has been widely used in paediatric anaesthesia but its influence on development in infants and toddlers still remains unclear. In order to elucidate the influence of ketamine on brain development in neonatal rats, semiquantitative reverse transcriptase PCR, quantitative reverse transcriptase PCR and immunohistochemistry assays were performed to detect the expression of N-methyl-D-aspartate receptor subtypes expression.']","Use of semiquantitative reverse transcriptase PCR, quantitative reverse transcriptase PCR, and immunohistochemistry assays to detect NMDA receptor subtypes expression.","['In order to elucidate the influence of ketamine on brain development in neonatal rats, semiquantitative reverse transcriptase PCR, quantitative reverse transcriptase PCR and immunohistochemistry assays were performed to detect the expression of N-methyl-D-aspartate receptor subtypes expression.']","Exposure to ketamine results in an increase in N-methyl-D-aspartate receptor subunits, which may influence brain development and synaptic plasticity.","['Conclusions Exposure to ketamine resulted in an increase in N-methyl-D-aspartate receptor subunits at PND 7, and this increase persisted to PND 28 in NR2A.']",None,[],Understanding the effects of ketamine on NMDA receptor expression could inform safer pediatric anesthesia practices.,['Background and objective Ketamine has been widely used in paediatric anaesthesia but its influence on development in infants and toddlers still remains unclear.'],True,True,True,True,True,True,10.1097/EJA.0b013e328330d453 10.1007/s12640-016-9615-7,341.0,Huang,2016,rats,postnatal day 7,Y,ketamine,none,sprague dawley,"Neurotox Res (2016) 30:185–198 DOI 10.1007/s12640-016-9615-7 O R I G I N A L A R T I C L E Ketamine Affects the Neurogenesis of the Hippocampal Dentate Gyrus in 7-Day-Old Rats He Huang1 Dan Wang2 Cun-Ming Liu1 • Yu-Qing Wu2 Jie Sun1 Ting Hao2 Chun-Mei Xu2 Received: 15 December 2015 / Revised: 22 February 2016 / Accepted: 1 March 2016 / Published online: 10 March 2016 (cid:2) Springer Science+Business Media New York 2016 Abstract Ketamine has been reported to cause neonatal neurotoxicity via a neuronal apoptosis mechanism; how- ever, no in vivo research has reported whether ketamine could affect postnatal neurogenesis in the hippocampal dentate gyrus (DG). A growing number of experiments suggest that postnatal hippocampal neurogenesis is the foundation of maintaining normal hippocampus function into adulthood. Therefore, this study investigated the effect of ketamine on hippocampal neurogenesis. Male Sprague– Dawley rats were divided into two groups: the control group (equal volume of normal saline), and the ketamine- anesthesia group (40 mg/kg ketamine in four injections at 1 h intervals). The S-phase marker 5-bromodeoxyuridine (BrdU) was administered after ketamine exposure to postnatal day 7 (PND-7) rats, and the neurogenesis in the hippocampal DG was assessed using single- or double- immunofluorescence staining. The expression of GFAP in the hippocampal DG was measured by western blot anal- ysis. Spatial reference memory was tested by Morris water maze at 2 months after PND-7 rats exposed to ketamine treatment. The present results showed that neonatal keta- mine exposure significantly inhibited neural stem cell (NSC) proliferation, decreased astrocytic differentiation, and markedly enhanced neuronal differentiation. The dis- ruptive effect of ketamine on the proliferation and differ- entiation of NSCs lasted at least 1 week and disappeared the by 2 weeks after ketamine exposure. Moreover, migration of newborn neurons in the granule cell layer and the growth of astrocytes in the hippocampal DG were inhibited by ketamine on PND-37 and PND-44. Finally, ketamine caused a deficit in hippocampal-dependent spatial reference memory tasks at 2 months old. Our results sug- gested that ketamine may interfere with hippocampal neurogenesis and long-term neurocognitive function in PND-7 rats. These findings may provide a new perspective to explain the adult neurocognitive dysfunction induced by neonatal ketamine exposure. Keywords Ketamine (cid:2) Neonatal (cid:2) Neurogenesis (cid:2) Hippocampal dentate gyrus (cid:2) Morris water maze test Ketamine, an N-methyl-D-aspartate (NMDA) receptor antagonist, is widely used in anesthesia, analgesia, and sedation during the neonatal period (Asadi et al. 2013; Guerra et al. 2011). However, ketamine has been reported short-term and long-term neurotoxicities, to induce including neuronal apoptosis and neurocognitive dysfunc- tion in the adult stage (Ikonomidou et al. 1999; Liu et al. 2011; Paule et al. 2011; Zou et al. 2009; Pfenninger et al. 2002; Wilder et al. 2009). As a commonly used anesthetic the safety of during pediatric anesthesia and sedation, ketamine has been the subject of concern for anesthesiol- ogists and the public. & Yu-Qing Wu xymzyqwu@126.com 1 Department of Anesthesiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China 2 Jiangsu Province Key Laboratory of Anesthesiology, Xuzhou Medical College, Xuzhou, China The causal link between neuronal death in the hip- pocampus of the developing brain and neurocognitive dysfunction in the adult stage has not been investigated in detail. Curiously, a previous study showed that 4 h of hypercapnia exposure caused a similar degree of hip- pocampal neuronal death as 4 h of isoflurane in PND-7 rats, but only 4 h of isoflurane caused a long-term neu- rocognitive deficit (Stratmann et al. 2009). This raises 123 186 suspicion regarding whether ketamine-induced hippocam- pal neuronal death in PND-7 rats can fully account for the neurocognitive dysfunction observed in the adult stage. Hence, it is worthwhile to study whether there is any other mechanism to explain the cognitive deficit in the adult stage after neonatal ketamine exposure other than anes- thesia-induced neuronal death. The developing central nervous system (CNS) has a critical period called brain growth spurt (BGS), which lasts from the end of pregnancy to the first 2–3 weeks after birth in rodents; in humans, the corresponding period begins in the last trimester of pregnancy and continues until 2 years after birth (Byrnes et al. 2001). During this period, the brain exhibits a high degree of plasticity, and substantial neuro- genesis occurs rapidly and lays the foundation for the normal structure and function of the brain. The hippocampal dentate gyrus (DG) is one of only two restricted regions other than the subventricular zone (SVZ) where neurogenesis occurs during development and continues, at a slower rate, into adulthood (Lledo et al. 2006; Mongiat and Schinder 2011; Luskin 1993; Vadodaria and Jessberger 2014). The neuro- genesis of the hippocampal DG plays a critical role in the formation of hippocampal-dependent spatial learning and memory function (Dupret et al. 2008; Stone et al. 2011). Neurogenesis is a complicated process that includes neural stem cell (NSC) proliferation, neuronal or astrocytic differ- entiation, and migration of newborn neurons. NSCs, which are located in the hilus/subgranular zone (SGZ) of hippocampal DG, partially begin to differentiate into neurons or astrocytes, while others retain the ability to divide. Some of the newly generated granule neurons can migrate into the granule cell layer (GCL) and functionally incorporate into the hip- pocampal circuit (granule neurons–CA3–CA1 loop) (Vado- daria and Jessberger 2014; van Praag et al. 2002). Postnatal neurogenesis in the DG may be sensitive to outside stimulation, such as hypoxia–ischemia, hyperoxia, and stress (Bartley et al. 2005; Belnoue et al. 2013; Porzionato et al. 2013). In recent years, there has been increasing research into the effect of anesthetics on post- natal neurogenesis in the DG (Fang et al. 2012; Erasso et al. 2013; Nie et al. 2013; Stratmann et al. 2009). How- ever, the effects of ketamine on neonatal hippocampal neurogenesis in vivo have not been reported. The present study aims to explore the effects of ketamine on postnatal neurogenesis in the hippocampal DG in vivo. Materials and Methods Animal Treatment All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Medical 123 Neurotox Res (2016) 30:185–198 University. The timed-pregnant Sprague–Dawley rats were housed in a temperature-controlled (22–23 (cid:3)C) room on a 12 h:12 h light:dark cycle (light on at 8:00 AM) with free access to food and water. The PND-7 male rat pups (11–14 g) were randomly assigned to ketamine-treated and control groups. In the treated group, ketamine was diluted in 0.9 % normal saline, and PND-7 rats were intraperi- toneally administered with 40 mg/kg doses of ketamine in four injections at 1 h intervals (40 mg/kg 9 4 injections). Control rats received an equal volume of normal saline. Temperature probes were used to facilitate control of temperature at 36.5 ± 1 (cid:3)C using computer-controlled heater/cooler plates integrated into the floor of the cham- ber. Between each injection, animals were returned to their chamber to help maintain body temperature and reduce stress. BrdU Injections All animals received an intraperitoneal injection of BrdU (5-bromo-2-deoxyuridine; Sigma) at a dosage of 100 mg/ kg after ketamine anesthesia according to the following experimental schedule. Experiment 1: To evaluate the effect of ketamine on the proliferation and differentiation of NSCs in the DG during the BGS, the PND-7 rats received a single intraperitoneal injection of BrdU on PND-7, 13, and 20 after ketamine treatment. The animals were then anesthetized and fixed by perfusion at 24 h after each BrdU injection. The experi- mental protocol is described in Tables 1a and 2. Experiment 2: To exclude the GFAP/BrdU double- positive cells that were proliferative astrocytes, the PND-7 rats received a single intraperitoneal injection of BrdU on PND-7, 13, and 20 after exposure to treatment. The animals were then perfused at 3 h after each BrdU injection. The experimental protocol is detailed in Tables 1b and 2. Experiment 3: To determine the effect of ketamine on the migration of newborn granule neurons in the DG, the PND-7 rats received three consecutive BrdU injections on PND-7, 8, and 9 after exposure to treatment. At 28 and 35 days after the last BrdU injection, the animals were anesthetized and fixed by perfusion. The experimental protocol is described in Table 1c and 2. Cell Apoptotic Assays Nestin/caspase-3 and GFAP/caspase-3 double-immunoflu- orescence staining was utilized to detect whether ketamine could induce the apoptosis of NSCs or astrocytes. At 12 h after the end of control and ketamine-anesthesia treatment, the neonatal rats were anesthetized and fixed by perfusion (n = 5 per group). Neurotox Res (2016) 30:185–198 187 Table 1 Experimental design Total no. of BrdU injections Postnatal day on which BrdU was administered Survival (day) after the last BrdU injection a. Experiment 1 (n = 5) Effect of ketamine on the proliferation and differentiation 1 7 1 of NSCs in the DG of PND-7 rats 1 13 1 1 20 1 b. Experiment 2 (n = 5) To exclude the GFAP/BrdU double-positive cells that were 1 7 3 proliferative astrocytes 1 1 13 20 3 3 c. Experiment 3 (n = 5) Effect of ketamine on the migration of newborn granule 3 7–9 28 neurons in the DG of PND-7 rats 3 7–9 35 Table 2 Immunolabeling Targeted process NSC proliferation Neuronal differentiation Astrocytic differentiation Astrocytic proliferation IF stain Nestin/BrdU b-tubulin III/BrdU GFAP/BrdU GFAP/BrdU these steps. Blocking of nonspecific epitopes with 10 % donkey serum in PBS with 0.3 % Triton-X for 2 h at room temperature preceded incubation overnight at 4 (cid:3)C with the primary antibodies listed in Table 3 in PBS with 0.3 % Triton-X. On the next day, the sections were incubated with the appropriate secondary fluorescent antibodies (In- vitrogen Carlsbad, CA) for 2 h at room temperature. Migration of newborn granule neurons IF immunofluorescence Tissue Preparation and Immunofluorescence NeuN/BrdU Astrocytic development was detected by using GFAP single-labeled staining. The sections were incubated over- night at 4 (cid:3)C with a fluorescent antibody for the GFAP (Table 3). After three washes in PBS, sections were incu- bated with secondary fluorescent antibody (Invitrogen) for 2 h at room temperature. At the indicated time point, animals were deeply anes- thetized and then transcardially perfused with 0.9 % nor- mal saline followed by 4 % paraformaldehyde. The brains were removed, postfixed overnight in 4 % paraformalde- hyde, and placed in 30 % sucrose until sunk. The coronal sections of brain were cut consecutively at a thickness of 30 lm when the hippocampus was initially exposed. The fifteenth section was taken and stored in PBS. According to the Atlas of the Developing Rat Brain and previous reports (Ashwell and Paxinos 2008; Paxinos and Watson 1986), the positions of hippocampus coronal sections selected in to the our study were about 2.20–2.25 mm posterior bregma at PND-8 rats, about 2.35–2.40 mm posterior to the bregma at PND-14 rats, about 2.50–2.55 mm posterior to the bregma at PND-21 rats, and about 2.75–2.85 mm posterior to the bregma at PND-37 and PND-44 rats, respectively. For Nestin/BrdU, b-tubulin III/BrdU, GFAP/BrdU, and NeuN/BrdU double-immunofluorescence the BrdU antigen was exposed by incubating the sections in 2-normal hydrochloric acid for 30 min at 37 (cid:3)C and then washed three times with PBS for 5 min between each of staining, To characterize the phenotype of cell apoptosis, brain sections were analyzed by double-labeled staining. The sections were incubated overnight at 4 (cid:3)C with the appro- priate primary antibodies listed in Table 3. After three washes with PBS, the sections were incubated with the suitable secondary fluorescent antibodies (Invitrogen) for 2 h at room temperature. A skilled pathologist blinded to the study conditions examined the labeled sections using a laser scanning con- focal microscope (Fluoview 1000, Olympus). The number of single- or double-positive cells in the hippocampal DG was quantified using Image-Pro Plus software. Western Blot Analysis Thirty and thirty-seven days after the control or ketamine- anesthesia treatment, the animals were decapitated, and the hippocampal DG tissue was dissected carefully with ana- tomic microscope (leica EZ4HD). The harvested hip- pocampal tissues were homogenized on ice using lysate buffer plus protease inhibitors. The lysates were cen- trifuged at 14,000 rpm for 15 min at 4 (cid:3)C and were 123 188 Neurotox Res (2016) 30:185–198 Table 3 Primary antibodies Antibody name Specificity Host species Dilution rates Company Nestin b-tubulin III Neural stem cells Newborn neurons Rabbit Rabbit 1:100 1:200 Abcam Abcam GFAP Astrocytes Rabbit 1:200 Millipore NeuN Mature neurons Mouse 1:400 Millipore BrdU Newly generated cells Mouse 1:1000 Sigma BrdU Newly generated cells Rabbit 1:500 Abcam Caspase-3 Cell apoptosis Mouse 1:100 Santa Cruz resolved by 12 % polyacrylamide gel electrophoresis, and the target proteins were transferred to nitrocellulose membranes. The blots were incubated with blocking buffer for 2 h at room temperature and then incubated for 24 h at 4 (cid:3)C with the primary antibodies: rabbit anti-GFAP anti- body (1:1000, Millipore) and GAPDH. The membranes were then incubated with appropriate secondary alkaline antibody donkey phosphatase-conjugated (1:10,000, Abcam) for 1 h. The band intensity was quan- tified using Image J software (n = 5 per group). anti-rabbit Morris Water Maze Test Province Key Laboratory of Anesthesiology, Xuzhou Medical College, Xuzhou, China). Statistical Analysis The statistical analysis was conducted using SPSS 13.0, and the graphs were created using GraphPad Prism 5. The data were analyzed using Mann-Whitney U test. The interaction between time and group factors in a two-way ANOVA was used to analyze the difference of escape latency between rats in the control group and rats treated with ketamine in the MWM. The data are presented as the mean ± SD, and p \ 0.05 was considered statistically significant. The hippocampal-dependent spatial memory abilities were tested by using the Morris water maze (MWM). Different set of rats were tested 2 months after administration of ketamine on PND-7. A circular, black painted pool (180 cm diameter, 50 cm deep) was filled with water to a depth of 30 cm. The water temperature was maintained at 25 ± 1 (cid:3)C. An invisible platform (10 cm diameter) was submerged 1 cm below the water surface and placed in the center of the III quadrant which was determined with four starting locations called I, II, III, and IV at equal distance on the edge of the pool. During five consecutive days, the experiments were conducted in a dark and quiet laboratory, all the rats were trained four times per day, the starting positions were random for each rat. When the rat found the platform, the rat was allowed to stay on it for 30 s. If a rat did not find the platform within 120 s, the rat would be guided gently to the place and allowed to stay on it for 30 s, and the latency time to find the hidden platform was recorded as 120 s. The average time from four trials rep- resented as the daily result for the rat. On the sixth day, the hidden platform was removed, and the rat was placed in the opposite quadrant. Rats were allowed to swim freely for 120 s. The numbers the rat swam to cross the previous platform area, and the times the rat stayed in the target quadrant within 120 s were recorded. Each animal’s path was tracked by a computerizing video system. After every trial, each rat was placed in a heater plates for 1 to 2 min until dry before being returned to its chamber. The data were analyzed using software for the MWM (Jiangsu Results Ketamine Anesthesia in Postnatal Rats Induced Inhibition of NSC Proliferation in the Hippocampal DG As shown in Fig. 1d, e, the percentage (8 ± 1.04 %) and density (11 ± 1.08 lm2) of Nestin?/BrdU? cells in the ketamine-treated group were significantly decreased compared to those in the control group (14 ± 1.30 %; 20 ± 2.22 lm2) 1 day (PND-8) after exposure to keta- mine. This suppressive effect of ketamine on NSC pro- liferation was also found at 7 days (PND-14: 10 ± 0.77 vs. 14 ± 1.45 %; 15 ± 1.29 vs. 19 ± 2.08 lm2) after (PND-21: anesthesia 18 ± vs. 11 ± 1.32 1.75 lm2) after anesthesia. Typical immunofluorescence pictures are shown in Fig. 1a, b, c. In addition, we found that there were no significant differences in NSC prolif- eration at different time points (PND-8, 14, and 21) in either the control groups or the ketamine-treated groups. These data indicated that ketamine could significantly inhibit the proliferation of NSCs in the hippocampal DG of neonatal rats for at least 1 week and that the ability of NSC proliferation could recover after anesthesia. but vs. disappeared 13 ± 1.13 %; at 14 days 17 ± 2.44 at 2 weeks 123 Neurotox Res (2016) 30:185–198 Fig. 1 Effect of ketamine on the proliferation of NSCs in the hippocampal dentate gyrus (DG) of neonatal rats. The NSCs were labeled with primary antibodies against Nestin (green) and BrdU (red). The immunoreactive cells were visualized using a laser scanning confocal microscope (a, b and c; magnification: 9200); the scale bar is 100 lm. The filled arrows point to Ketamine Anesthesia in Postnatal Rats Promoted the Neuronal Differentiation of NSCs in the Hippocampal DG Figure 2d, e show that the percentage (18 ± 2.27 %) and density (23 ± 3.74 lm2) of b-tubulin III?/BrdU? cells were significantly increased in the ketamine-treated group com- pared to those in the control group (12 ± 2.07 %; 189 Nestin/BrdU double-labeled cells. The ratio of Nestin?/BrdU? cells to Nestin? cells was calculated (d). The Y axis ‘‘(lm2)’’ represents the density of Nestin?/BrdU? cells in the DG (e). Data are presented as the mean ± SD (n = 5). **p\0.01 versus control group. GCL granule cell layer; ML molecular layer; PCL polymorphic cell layer (Color figure online) 17 ± 3.25/lm2) 1 day (PND-8) after exposure to ketamine. This stimulating effect of ketamine on neuronal differenti- ation of NSCs was also assessed at 7 days (PND-14: 16 ± 2.24 vs. 11 ± 1.25 %; 21 ± 3.01 vs. 16 ± 2.05 lm2) after anesthesia but was not detected at 14 days (PND-21: 12 ± 1.90 vs. 12 ± 2.34 %; 18 ± 2.28 vs. 17 ± 2.92 lm2) after anesthesia. Typical immunofluorescence pictures are shown in Fig. 2a, b, c. Moreover, we did not observe 123 190 significant differences in the neuronal differentiation of NSCs at different time points (PND-8, 14 and 21) in either the control groups or the ketamine-treated groups. These data indicated that ketamine could significantly promote the neuronal differentiation of NSCs in the hippocampal DG of neonatal rats for at least 1 week, and this stimulating effect finally disappeared by 2 weeks after anesthesia. Fig. 2 Effect of ketamine on the neuronal differentiation of NSCs in the hippocampal dentate gyrus (DG) of neonatal rats. The newborn neurons were labeled with primary antibodies against b-tubulin III (green) and BrdU (red). The immunoreactive cells were visualized using a laser scanning confocal microscope (a, b and c; magnification: 9200); the scale bar is 100 lm. The filled arrows point to b-tubulin 123 Neurotox Res (2016) 30:185–198 Ketamine Anesthesia in Postnatal Rats Attenuated the Astrocytic Differentiation of NSCs in the Hippocampal DG Similar to the effect of ketamine on NSC proliferation, the percentage (11 ± 0.89 %) and density (10 ± 1.46 lm2) of GFAP?/BrdU? cells were significantly decreased in the III/BrdU double-labeled cells. The ratio of b-tubulin III?/BrdU? cells to BrdU? cells was calculated (d). The Y axis ‘‘(lm2)’’ represents the density of b-tubulin III?/BrdU? cells in the DG (e). Data are presented as the mean ± SD (n = 5). *p\0.05, **p\0.01 versus control group. GCL granule cell layer, ML molecular layer, PCL polymorphic cell layer (Color figure online) Neurotox Res (2016) 30:185–198 Fig. 3 Effect of ketamine on the astrocytic differentiation of NSCs in the hippocampal dentate gyrus (DG) of neonatal rats. The newborn astrocytes were labeled with primary antibodies against GFAP (green) and BrdU (red). The immunoreactive cells were visualized using a laser scanning confocal microscope (a, b and c; magnification: 9200); the scale bar is 100 lm. The filled arrows point to GFAP/ BrdU double-labeled cells. The ratio of GFAP?/BrdU? cells to BrdU? cells was calculated (d). The Y axis ‘‘(lm2)’’ represents the density of GFAP?/BrdU? cells in the DG (e). To exclude that GFAP/ ketamine-treated group compared to those in the control group (15 ± 1.30 %; 17 ± 2.07 lm2) 1 day (PND-8) after exposure to ketamine. This inhibitory effect of ketamine on astrocytic differentiation of NSCs was also detected at 191 BrdU double-positive cells were the proliferative astrocytes, another set of animals was perfused and sacrificed at 3 h after BrdU injection on PND-7, 13, and 20. The proliferative astrocytes were also stained with primary antibodies against GFAP and BrdU, and the density of GFAP/BrdU double-labeled cells was calculated (f). Data are presented as the mean ± SD (n = 5). *p\0.05, **p\0.01 vs. control group. GCL granule cell layer, ML molecular layer, PCL polymorphic cell layer (Color figure online) 7 days (PND-14: 13 ± 1.40 vs. 15 ± 0.97 %; 12 ± 2.11 vs. 16 ± 1.88 lm2) after anesthesia but disappeared at 14 days (PND-21: 14 ± 1.57 vs. 14 ± 1.39 %; 13 ± 0.91 vs. 14 ± 0.82 lm2) after anesthesia (Fig. 3d, e). Typical 123 192 immunofluorescence pictures are shown in Fig. 3a, b, c. Moreover, we did not observe significant differences in the astrocytic differentiation of NSCs at different time points (PND-8, 14 and 21) in either the control groups or the ketamine-treated groups. These data suggested that keta- mine could also inhibit the astrocytic differentiation of NSCs in the hippocampal DG of neonatal rats for at least 1 week, and this inhibitory effect finally disappeared by 2 weeks after anesthesia. To exclude the GFAP/BrdU double-positive cells that were proliferative astrocytes, the animals were perfused at 3 h after BrdU injection on PND-7, 13, and 20. We found only a small amount of GFAP/BrdU double-positive cells in both the control and ketamine groups at the three time points, and there were no significant differences in the proliferation of matured astrocytes between the ketamine and control groups (Fig. 3f). The NSCs and Astrocytes in the Hippocampal DG of Neonatal Rats are Resistant to Ketamine-Induced Cell Apoptosis To investigate the effects of ketamine on the apoptosis of NSCs and astrocytes in the hippocampal DG of neonatal rats, we analyzed the nestin/caspase-3 and GFAP/caspase-3 double-positive cells in the hippocampal DG using double- immunofluorescence staining 12 h after the end of keta- mine anesthesia. The results showed that there were no significant changes in the numbers of nestin/caspase-3 or GFAP/caspase-3 double-positive cells in either the control or ketamine groups. These results suggested that the dosage and duration of ketamine used in our experiment could not induce the apoptosis of NSCs and astrocytes in the hip- pocampal DG (Fig. 4a, b). Ketamine Anesthesia in Postnatal Rats Inhibited the Migration of Newborn Neurons in the GCL of the Hippocampal DG According to previous research (Kempermann et al. 2003; Esposito et al. 2005), the hippocampal GCL can be divided into four zones (SGZ, GCL1, GCL2, and GCL3) from the inside to outside of the GCL. The newborn neurons dif- ferentiated from NSCs could migrate from the SGZ to different locations throughout the GCL. The experimental is shown in Fig. 5a. To better visualize the protocol migration of the newly generated neurons in the GCL, we examined the NeuN?/BrdU? cells in the GCL 28 days (PND-37) and 35 days (PND-44) after the last BrdU injection using double-immunofluorescence staining. According to our findings, ketamine could significantly increase the rate of BrdU-positive neurons in the SGZ compared to the total BrdU-positive neurons in the GCL 123 Neurotox Res (2016) 30:185–198 Fig. 4 Effect of ketamine on the apoptosis of NSCs and astrocytes in the hippocampal dentate gyrus of neonatal rats. The PND-7 rats were perfused and sacrificed at 12 h after four injections of 40 mg/kg ketamine at 1-h intervals. The apoptosis of NSCs and astrocytes is shown with nestin/caspase-3 (a) and GFAP/caspase-3 (b) double- staining (magnification: 9400; the scale bar immunofluorescence layer, PCL is 50 lm). GCL granule cell polymorphic cell layer layer, ML molecular PND-44: vs. (PND-37: 74 ± 6.11 vs. 26 ± 10.28 %) (Fig. 5d); the rate of BrdU- positive neurons in GCL1 compared to the total BrdU- positive neurons in the GCL was significantly decreased in the ketamine group compared to that in control group on PND-37 (24 ± 10.61 vs. 46 ± 12.57 %) and PND-44 (21 ± 9.65 vs. 51 ± 4.65 %) (Fig. 5e). The rate of BrdU- positive neurons in GCL2 compared to the total BrdU- positive cells in the GCL was significantly decreased in the ketamine group compared to that in control group on PND- 37 (5 ± 7.36 vs. 16 ± 5.06 %) and PND-44 (5 ± 6.85 vs. 23 ± 7.45 %) (Fig. 5f). The rate of BrdU-positive neurons in GCL3 compared to the total BrdU-positive neurons in the GCL showed no significant difference between the control and ketamine groups on PND-37 and PND-44. Typical immunofluorescence pictures are shown in Fig. 5b, c. Taken together, that neonatal ketamine exposure could inhibit the migration of postna- tally generated neurons in the GCL of the hippocampal DG and restrict them inside the GCL. 70 ± 16.73 36 ± 9.31 %; these results suggest Neurotox Res (2016) 30:185–198 Fig. 5 Effect of ketamine on the migration of newborn neurons in the hippocampal dentate gyrus (DG) of neonatal rats. Experimental protocol (a). Representative photographs from a laser scanning confocal microscope are shown (b, c; magnification: a, e 9200; b– d and f–h 9400); the scale bar is 50 lm (a, b). The NeuN (green)/ BrdU (red) double-positive cells distributed in the GCL. The filled Ketamine Anesthesia in Postnatal Rats Inhibited the Growth of Astrocytes in the Hippocampal DG The normal migration of newborn neurons in the hip- pocampal DG is dependent on the development of 193 arrows point to the double-positive cells. The percentage of BrdU- positive cells expressing NeuN in each cell layers of GCL was calculated (d, e, f). Data are presented as the mean ± SD (n = 5). *p\0.05, **p\0.01 versus control group. SGZ subgranular zone, GCL granule cell layer (Color figure online) astrocytes in this area, which play a supporting role in the migration of newborn neurons. The experimental protocol is presented in Fig. 6a. Our results showed that ketamine could restrain the growth of radial glial cells in the hip- pocampal DG on PND-37 and PND-44, and the density of 123 194 Fig. 6 Effect of ketamine on the development of radial glia in the hippocampal dentate gyrus (DG). Experimental protocol (a). Repre- sentative photographs from a laser scanning confocal microscope are shown (b; magnification: a, c, e and g 9200; b, d, f and h 9400); the scale bars are 100 lm (a) and 50 lm (b). The density of GFAP GFAP-positive cells in the hippocampal DG was signifi- cantly reduced in the ketamine-treated group compared to that in the control group (PND-37: 176 ± 9.96 vs. 230 ± 9.95 lm2; PND-44: 193 ± 12.62 vs. 244 ± 10.97 lm2) 123 Neurotox Res (2016) 30:185–198 positive cells in the DG was calculated (c). The expression level of GFAP in the DG was measured by Western blot analysis at the same time points (d, e). Data are presented as the mean ± SD (n = 5). **p\0.01 versus control group. GCL granule cell layer, ML molecular layer, PCL polymorphic cell layer (Color figure online) (Fig. 6c). Typical immunofluorescence pictures are shown in Fig. 6b. The hippocampus tissues of rats on PND-37 and PND- 44 were used for Western blot analysis. Quantification of Neurotox Res (2016) 30:185–198 the Western blot showed that the ketamine anesthesia induced less visible bands representing GFAP compared with the control group at these two time points (PND-37: 57 ± 4.06 vs. 89 ± 3.44 %; PND-44: 76 ± 6.88 vs. 93 ± 3.41 %; Fig. 6d, e). that neonatal ketamine exposure had a significantly inhibitory effect on the growth of radial glial cells, which may be an important reason for the inhibition of migration of newborn neurons. Together, these data suggest Neonatal Ketamine Exposure Caused Spatial Memory Impairment in the Adult Stage Figure 7a–d showed the memory and learning performance of rats in 2 months old. The latency to find the hidden platform of two groups rats had a reduced tendency as training progressed, which indicated that the animals were learning from practice of everyday. However, during the five training days, the latency to locate the hidden platform in ketamine group was significantly longer than that in control group (p \ 0.05; Fig. 7a), indicating neonatal Fig. 7 Anesthesia with ketamine in neonatal rats at postnatal day 7 (PND-7) induces learning and memory impairment in the adult stage. Ketamine anesthesia significantly increased the latency time of rat swimming in the Morris water maze (MWM) as compared with the control group (a). The times that the rats stayed in the target quadrant within 120 s was significantly reduced in ketamine group than that in 195 ketamine exposure could induce significantly impairment in learning and memory functions during the adult stage. In the memory retrieval tests, the times that the rats stayed in the target quadrant within 120 s was significantly reduced in ketamine group than that in control group (28 ± 9.02 vs. 44 ± 7.80 %; Fig. 7b). Also, the numbers of crossing over the previous platform site within 120 s was significantly in control group reduced in ketamine group than that (2 ± 0.75 vs. 5 ± 1.41; Fig. 7c). The typical track chart were shown in Fig. 7d. These data suggested that exposing ketamine (40 mg/kg 9 4 injections) to PND-7 rats could cause hippocampal-dependent neurocognitive impairment in the adult stage. Discussion Widespread and growing research has reported that keta- mine has neurotoxic effects on the developing animal brain (Ikonomidou et al. 1999; Liu et al. 2011; Paule et al. 2011; Zou et al. 2009), and its safety in pediatric anesthesia has control group (b). The numbers of crossing over the previous platform site within 120 s was significantly reduced in ketamine group than that in control group (c). Typical path chart of space exploration were exhibited (d). Data are presented as mean ± SD (n = 6). *p\0.05, **p\0.01 versus control group (Color figure online) 123 196 been the subject of extensive concern for anesthesiologists and the public, based on the evidence that ketamine may have an association with neurocognitive impairment in children (Pfenninger et al. 2002; Wilder et al. 2009). However, the causal link between neuron death in the developing animal brain induced by anesthetics and long- term hippocampal-dependent neurocognitive deficits has not been elucidated. It is therefore of interest for us to explore the other mechanisms that can explain the hip- pocampal-dependent neurocognitive dysfunction caused by neonatal ketamine exposure. The substantial neurogenesis in the hippocampal DG lasts for life in animals and humans (Abrous et al. 2005). the production of During the process of neurogenesis, granule cells may change dynamically with age. In the rat, the granule cells in the DG are generated from the 14th day of gestation until the adult stage, and approximately 80 % of the granule cells are produced postnatally with a peak around seven days after birth (Altman and Bayer 1990). The accumulated results have demonstrated that the factors interfering with neuron production (e.g., postnatal or adult) may have a significant impact on hippocampus-dependent function (Young et al. 1999; Kempermann and Gage 2002). However, only some newborn neurons can be selected by the DG and allowed to migrate into the normal position of the GCL to meet the functional demand (Dupret et al. 2007; Kee et al. 2007). Hence, neurogenesis in the DG plays a crucial role in the normal of structure and function of the hippocampus. Numerous studies have suggested that NMDA-R plays an important role in regulating the neurogenesis of the hippocampal DG (Joo et al. 2007; Kitayama et al. 2004; Luk et al. 2003). However, the effects of blocking NMDA- R on the neurogenesis of the hippocampal DG are con- troversial (Nacher et al. 2001; Nacher and McEwen 2006; Arvidsson et al. 2001). Ketamine, as an NMDA-R inhi- bitor, was reported to inhibit the proliferation of NSCs isolated from the SVZ in the rat fetal cortex and enhance its neuronal differentiation in a previous in vitro study (Dong et al. 2012); however, its effect on postnatal neurogenesis in the hippocampal DG has not been studied in vivo. Hence, it might provide a new perspective to study the neonatal neurotoxicity of ketamine. BrdU, a classical tool for the detection of cell fate, was used to test neurogenesis. The scheme and dose of BrdU administration in our tests was based on previous experi- ments (Guidi et al. 2005; Zhang et al. 2014). We first observed the change in NSC proliferation and differentia- tion in the DG within two weeks after ketamine anesthesia. Our results showed that ketamine could significantly inhi- bit the proliferation of NSCs with decreased numbers of Nestin/BrdU double-positive cells. It was also found that the astrocytic differentiation of NSCs was markedly 123 Neurotox Res (2016) 30:185–198 attenuated with a decreased number of GFAP/BrdU dou- ble-positive cells, while the neuronal differentiation of NSCs was obviously promoted with an increased number of b-tubulin III/BrdU double-positive cells. Our present results are partially consistent with the reports of Dong et al. (Dong et al. 2012). In addition, these effects of ketamine on the proliferation and differentiation of NSCs could last at least 1 week but disappeared 2 weeks after neonatal ketamine exposure. It is known that mature astrocytes can proliferate after exposure to some types of stimulation, such as stroke (Barreto et al. 2011). To exclude the proliferative mature astrocytes from the newly differentiated astrocytes, GFAP/BrdU double-labeling immunostaining was performed 3 h after the BrdU injec- tion, by which time BrdU had been adequately incorpo- rated newly differentiated astrocytes had not been generated. It was found that only a small number of mature astrocytes were capable of proliferating in the hippocampus of neonatal rats, and ketamine did not significantly promote or suppress the proliferation of mature astrocytes. There was no sig- nificant difference in the number of GFAP/BrdU double- positive cells between the control and ketamine groups. Therefore, it was determined that the GFAP/BrdU double- positive cells detected at 24 h after the BrdU injection could represent the newborn astrocytes differentiated from NSCs. In addition, to observe the effect of ketamine on the apoptosis of NSCs and astrocytes in the DG of neonatal rats, the nestin?/caspase-3? and GFAP?/caspase-3? cells were measured using double-labeled immunofluorescence. The results showed that neither nestin/caspase-3 nor GFAP/caspase-3 double-positive cells were found in the control or ketamine groups. Although neuron apoptosis has been demonstrated to be induced by neonatal exposure to ketamine, the present dosage and duration of ketamine were unable to induce the apoptosis of NSCs and astrocytes in the DG of neonatal rats. Thus, it is suggested that the reduced numbers of nestin/BrdU double-positive cells and GFAP/BrdU double-positive cells were not caused by cell death after ketamine exposure. into the proliferative cells, but the It is necessary for the newly differentiated neurons to migrate into the GCL of hippocampal DG to exert normal function. The abnormal migration of newborn granule neurons in the hippocampal DG is associated with hip- pocampal-specific cognitive deficits (Manning et al. 2012). The present study showed that ketamine could markedly inhibit the migration of newborn neurons with a decreased percentage of NeuN/BrdU double-positive cells in each layer of the GCL in the hippocampal DG both at PND-37 and PND-44. Further study indicated that the number of GFAP- positive cells and the expression of GFAP in hippocampal DG were significantly reduced in the ketamine group com- pared to the control group. Our findings suggest that the Neurotox Res (2016) 30:185–198 reduced expression of GFAP may be caused by suppressing the astrocytic differentiation of NSCs after neonatal keta- mine exposure. The inhibitory effect of ketamine on the growth of astrocytes may result in abnormally positioned newborn neurons within the GCL during neuronal migration because astrocytes play a support role in the migration of newborn neurons (Sibbe et al. 2009). A previous study reported that colchicine injection into the DG caused the impairment in hippocampal-dependent spatial memory, but the lesion was limited to the DG rather than other hippocampal regions (Keith et al. 2007). This result suggested that the DG damage alone could produce a hippocampal-type neurocognitive dysfunction. According to the present study, neonatal ketamine exposure induced a significant alteration of neurogenesis in the hippocampal DG, which may be an important reason leading to abnor- malities in the structure of the hippocampus. It might have a close association with the ketamine-induced neurocog- nitive impairment. The mechanisms by which ketamine induce the inter- ference of neurogenesis in the hippocampal DG remain to be determined. In our previous in vitro study, suppressing Ca2?-PKCa-ERK1/2 signaling pathway may be involved in this inhibitory effect of ketamine on hippocampal NSCs proliferation (Yu-Qing et al. 2014). Thus, our future studies will include exploring whether ketamine exposure affects the hippocampal neurogenesis process through interfering with the calcium signaling pathway in vivo study. In summary, neonatal ketamine exposure could interfere the hippocampal DG, with postnatal neurogenesis of including the inhibition of NSC proliferation and astrocytic differentiation, the promotion of neuronal differentiation, the inhibition of astrocytic growth, and neuronal migration in the GCL. These findings may account for the adult hippocampal-dependent dysfunction induced by neonatal ketamine exposure. neurocognitive Acknowledgments This work was supported by the National Nat- ural Science Foundation of China (81171013), the Key Subject of Colleges and Universities Natural Science Foundation of Jiangsu Province (10KJA320052). Compliance with Ethical Standards Conflict of interest The authors have declared that no competing interests exist. References Abrous DN, Koehl M, Le Moal M (2005) Adult neurogenesis: from precursors to network and physiology. Physiol Rev 85:523–569 Altman J, Bayer SA (1990) Migration and distribution of two populations of hippocampal granule cell precursors during the perinatal and postnatal periods. J Comp Neurol 301:365–381 197 Arvidsson A, Kokaia Z, Lindvall O (2001) N-methyl-D-aspartate receptor-mediated increase of neurogenesis in adult rat dentate gyrus following stroke. Eur J Neurosci 14:10–18 Asadi P, Ghafouri HB, Yasinzadeh M, Kasnavieh SM, Modirian E (2013) Ketamine and atropine for pediatric sedation: a prospec- tive double-blind randomized controlled trial. Pediatr Emerg Care 29:136–139 Ashwell KWS, Paxinos G (2008) Atlas of the developing rat nervous system. Elsevier, San Diego Barreto GE, Sun X, Xu L, Giffard RG (2011) Astrocyte proliferation following stroke in the mouse depends on distance from the infarct. PLoS ONE 6:e27881 Bartley J, Soltau T, Wimborne H, Kim S, Martin-Studdard A et al (2005) BrdU-positive cells in the neonatal mouse hippocampus following hypoxic-ischemic brain injury. BMC Neurosci 6:15 Belnoue L, Grosjean N, Ladeveze E, Abrous DN, Koehl M (2013) Prenatal stress inhibits hippocampal neurogenesis but spares olfactory bulb neurogenesis. PLoS ONE 8:e72972 Byrnes ML, Reynolds JN, Brien JF (2001) Effect of prenatal ethanol exposure during the brain growth spurt of the guinea pig. Neurotoxicol Teratol 23:355–364 Dong C, Rovnaghi CR, Anand KJ (2012) Ketamine alters the neurogenesis of rat cortical neural stem progenit or cells. Crit Care Med 40:2407–2416 Dupret D, Fabre A, Dobrossy MD, Panatier A, Rodriguez JJ et al learning depends on both the addition and (2007) Spatial removal of new hippocampal neurons. PLoS Biol 5:e214 Dupret D, Revest JM, Koehl M, Ichas F, De Giorgi F et al (2008) Spatial relational memory requires hippocampal adult neuroge- nesis. PLoS ONE 3:e1959 Erasso DM, Camporesi EM, Mangar D, Saporta S (2013) Effects of isoflurane or propofol on postnatal hippocampal neurogenesis in young and aged rats. Brain Res 1530:1–12 Esposito MS, Piatti VC, Laplagne DA, Morgenstern NA, Ferrari CC et al (2005) Neuronal differentiation in the adult hippocampus recapitulates 25: 10074–10086 embryonic development. J Neurosci Fang F, Xue Z, Cang J (2012) Sevoflurane exposure in 7-day-old rats affects neurogenesis, neurodegeneration and neurocognitive function. Neurosci Bull 28:499–508 Guerra GG, Robertson CM, Alton GY, Joffe AR, Cave DA et al (2011) Neurodevelopmental outcome following exposure to sedative and analgesic drugs for complex cardiac surgery in infancy. Paediatr Anaesth 21:932–941 Guidi S, Ciani E, Severi S, Contestabile A, Bartesaghi R (2005) Postnatal neurogenesis in the dentate gyrus of the guinea pig. Hippocampus 15:285–301 Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J et al (1999) Blockade of NMDA receptors and apoptotic neurodegeneration in the developing brain. Science 283:70–74 Joo JY, Kim BW, Lee JS, Park JY, Kim S et al (2007) Activation of NMDA receptors increases proliferation and differentiation of hippocampal neural progenitor cells. J Cell Sci 120:1358–1370 Kee N, Teixeira CM, Wang AH, Frankland PW (2007) Preferential incorporation of adult-generated granule cells into spatial memory networks in the dentate gyrus. Nat Neurosci 10: 355–362 Keith JR, Wu Y, Epp JR, Sutherland RJ (2007) Fluoxetine and the dentate gyrus: memory, recovery of function, and electrophys- iology. Behav Pharmacol 18:521–531 Kempermann G, Gage FH (2002) Genetic influence on phenotypic differentiation in adult hippocampal neurogenesis. Brain Res Dev Brain Res 134:1–12 Kempermann G, Gast D, Kronenberg G, Yamaguchi M, Gage FH (2003) Early determination and long-term persistence of adult- 123 198 generated new neurons in the hippocampus of mice. Develop- ment 130:391–399 Kitayama T, Yoneyama M, Tamaki K, Yoneda Y (2004) Regulation of neuronal differentiation by N-methyl-D-aspartate receptors expressed in neural progenitor cells isolated from adult mouse hippocampus. J Neurosci Res 76:599–612 Liu F, Paule MG, Ali S, Wang C (2011) Ketamine-induced neurotoxicity and changes in gene expression in the developing rat brain. Curr Neuropharmacol 9:256–261 Lledo PM, Alonso M, Grubb MS (2006) Adult neurogenesis and functional plasticity in neuronal circuits. Nat Rev Neurosci 7:179–193 Luk KC, Kennedy TE, Sadikot AF (2003) Glutamate promotes proliferation of striatal neuronal progenitors by an NMDA receptor-mediated mechanism. J Neurosci 23:2239–2250 Luskin MB (1993) Restricted proliferation and migration of postna- tally generated neurons derived from the forebrain subventricular zone. Neuron 11:173–189 Manning EE, Ransome MI, Burrows EL, Hannan AJ (2012) Increased adult hippocampal neurogenesis and abnormal migration of adult-born granule neurons is associated with hippocampal- specific cognitive deficits in phospholipase C-beta1 knockout mice. Hippocampus 22:309–319 Mongiat LA, Schinder AF (2011) Adult neurogenesis and the plasticity of the dentate gyrus network. Eur J Neurosci 33:1055–1061 Nacher J, McEwen BS (2006) The role of N-methyl-D-asparate receptors in neurogenesis. Hippocampus 16:267–270 Nacher J, Rosell DR, Alonso-Llosa G, McEwen BS (2001) NMDA receptor antagonist treatment induces a long-lasting increase in the number of proliferating cells, PSA-NCAM-immunoreactive granule neurons and radial glia in the adult rat dentate gyrus. Eur J Neurosci 13:512–520 Nie H, Peng Z, Lao N, Dong H, Xiong L (2013) Effects of sevoflurane on self-renewal capacity and differentiation of cultured neural stem cells. Neurochem Res 38:1758–1767 Paule MG, Li M, Allen RR, Liu F, Zou X et al (2011) Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys. Neurotoxicol Teratol 33:220–230 Paxinos G, Watson C (1986) The rat brain in stereotaxic coordinates, vol 2. Academic Press, Sydney Pfenninger EG, Durieux ME, Himmelseher S (2002) Cognitive impairment after small-dose ketamine isomers in comparison to equianalgesic racemic ketamine in human volunteers. Anesthe- siology 96:357–366 123 Neurotox Res (2016) 30:185–198 Porzionato A, Macchi V, Zaramella P, Sarasin G, Grisafi D et al (2013) Effects of postnatal hyperoxia exposure on the rat dentate Funct gyrus 220(1):229–247 and subventricular zone. Brain Struct Sibbe M, Forster E, Basak O, Taylor V, Frotscher M (2009) Reelin and Notch1 cooperate in the development of the dentate gyrus. J Neurosci 29:8578–8585 Stone SS, Teixeira CM, Zaslavsky K, Wheeler AL, Martinez-Canabal A et al (2011) Functional convergence of developmentally and adult-generated granule cells in dentate gyrus circuits supporting hippocampus-dependent memory. Hippocampus 21:1348–1362 Stratmann G, May LD, Sall JW, Alvi RS, Bell JS et al (2009a) Effect of hypercarbia and isoflurane on brain cell death and neurocog- nitive rats. Anesthesiology 110:849–861 dysfunction in 7-day-old Stratmann G, Sall JW, May LD, Bell JS, Magnusson KR et al (2009b) Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology 110:834–848 Vadodaria KC, Jessberger S (2014) Functional neurogenesis in the adult hippocampus: then and now. Front Neurosci 8:55 van Praag H, Schinder AF, Christie BR, Toni N, Palmer TD et al (2002) Functional neurogenesis in the adult hippocampus. Nature 415:1030–1034 Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, Gleich SJ, Schroeder DR, Weaver AL, Warner DO (2009) Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 110:796–804 Young D, Lawlor PA, Leone P, Dragunow M, During MJ (1999) Environmental enrichment inhibits spontaneous apoptosis, pre- vents seizures and is neuroprotective. Nat Med 5:448–453 Yu-Qing Wu, Liang Tuo, Huang He et al (2014) Ketamine inhibits proliferation of neural stem cell from neonatal rat hippocampus in vitro. Cell Physiol Biochem 34:1792–1801 Zhang K, Zhao T, Huang X, Wu LY, Wu K et al (2014) Notch1 mediates postnatal neurogenesis in hippocampus enhanced by intermittent hypoxia. Neurobiol Dis 64:66–78 Zou X, Patterson TA, Divine RL, Sadovova N, Zhang X et al (2009a) Prolonged exposure to ketamine increases neurodegeneration in the developing monkey brain. Int J Dev Neurosci 27:727–731 Zou X, Patterson TA, Sadovova N, Twaddle NC, Doerge DR et al (2009b) Potential neurotoxicity of ketamine in the developing rat brain. Toxicol Sci 108:149–158",rats,"['Male Sprague–Dawley rats were divided into two groups: the control group (equal volume of normal saline), and the ketamine-anesthesia group (40 mg/kg ketamine in four injections at 1 h intervals).']",postnatal day 7,"['The S-phase marker 5-bromodeoxyuridine (BrdU) was administered after ketamine exposure to postnatal day 7 (PND-7) rats,']",Y,['Spatial reference memory was tested by Morris water maze at 2 months after PND-7 rats exposed to ketamine treatment.'],ketamine,"['Male Sprague–Dawley rats were divided into two groups: the control group (equal volume of normal saline), and the ketamine-anesthesia group (40 mg/kg ketamine in four injections at 1 h intervals).']",none,[],sprague dawley,"['Male Sprague–Dawley rats were divided into two groups: the control group (equal volume of normal saline), and the ketamine-anesthesia group (40 mg/kg ketamine in four injections at 1 h intervals).']","This study investigated the effect of ketamine on hippocampal neurogenesis in vivo, which had not been reported before.","['however, no in vivo research has reported whether ketamine could affect postnatal neurogenesis in the hippocampal dentate gyrus (DG).']",None,[],The findings suggest that ketamine may interfere with hippocampal neurogenesis and long-term neurocognitive function in PND-7 rats.,['Our results suggested that ketamine may interfere with hippocampal neurogenesis and long-term neurocognitive function in PND-7 rats.'],None,[],None,[],True,True,True,True,True,True,10.1007/s12640-016-9615-7 10.1186/s12871-018-0471-2,1187.0,Huang,2018,rats,gestational day 21,Y,isoflurane,none,sprague dawley,"Huang et al. BMC Anesthesiology (2018) 18:5 DOI 10.1186/s12871-018-0471-2 R E S E A R C H A R T I C L E Open Access Influence of isoflurane exposure in pregnant rats on the learning and memory of offsprings Wei Huang, Yunxia Dong, Guangyi Zhao, Yuan Wang, Jingjing Jiang and Ping Zhao* Abstract Background: About 2% of pregnant women receive non-obstetric surgery under general anesthesia each year. During pregnancy, general anesthetics may affect brain development of the fetus. This study aimed to investigate safe dosage range of isoflurane. Methods: Forty-eight SpragueDawley (SD) pregnant rats were randomly divided into 3 groups and inhaled 1.3% isoflurane (the Iso1 group), 2.0% isoflurane (the Iso2 group) and 50% O2 alone (the control group) for 3 h, respectively. Their offsprings were subjected to Morris water maze at day 28 and day 90 after birth to evaluate learning and memory. The expression of cAMP-response element binding protein (CREB) and phosphorylated cAMP-response element binding protein (p-CREB) was detected in the hippocampus dentate gyrus. Results: Less offsprings of Iso2 group were able to cross the platform than that of the control group (P < 0.05). Accordingly, the Iso2 offsprings expressed p-CREB mainly in the subgranular zone in contrast to the whole granular cell layer of hippocampus dentate gyrus as detected in the Iso1 and control offsprings; the expression level of pCREB was also lower in the Iso2 than Iso1 or control offsprings (P < 0.05). Conclusion: Inhalation of isoflurane at 1.3% during pregnancy has no significant influence on learning and memory of the offspring; exposure to isoflurane at 2.0% causes damage to spatial memory associated with inhibition of CREB phosphorylation in the granular cell layer of hippocampus dentate gyrus. Keywords: Isoflurane, CREB, Pregnancy, Memory, Offsprings Background Approximately, more than 2% of pregnant women receive non-obstetric surgery under general anesthesia [1, 2]. In humans, brain development mainly occurs in the fetal period when the proliferation, differentiation and migra- tion of neurons and the formation and modification of synapses as well as myelin are very active. Thus, during that time, the fetal development of central nervous system is extremely vulnerable to both internal and external en- vironmental changes and neurons without formation of synapses will become apoptotic [3, 4]. General anesthesia during pregnancy may affect brain development of the fetus and their learning abilities. However, there is no guideline for isoflurane usage during pregnancy due to lack of clinical studies [5]. In 1985, Uemura et al. first found that the fetus exposed to halothane affected synaptic development in the neonatal brains [6], which have confirmed by increasing evidence [7, 8]. It was proposed that anesthetics used in general anesthesia increase the apoptosis of immature neurons, causing damage to the nervous system in fetus [9]. To date, a variety of studies have shown that high concen- tration of anesthetics in general anesthesia cause dam- ages to nervous system, but these anesthetics at a clinical or subclinical concentration on fetal brain development is unclear. the influence of Correspondence: mzekcd@sj-hospital.org Department of Anesthesiology, Shengjing Hospital of China Medical University, No. 36 SanHao Street, HePing District, ShenYang, Liaoning Province, People’s Republic of China Therefore, it is important to investigate the influence of general anesthesia on brain development of offspring in order to guide anesthesia in pregnant women receiving non-obstetric surgery. In the present study, pregnant rats © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Huang et al. BMC Anesthesiology (2018) 18:5 were exposed to isoflurane at different concentrations and subjected their offsprings to the behavior study, aiming to investigate the influence of isoflurane exposure during pregnancy on the memory and learning abilities of the offspring as well as to explore the range of safe doses, which may provide evidence for the clinical use and inves- tigations of anesthetics. We hypothesize that isoflurane inhalation during pregnancy compromises the offspring’s learning abilities and memory in a concentration- dependent manner. Methods This study was approved by the Ethics Committee of Affiliated Shengjing Hospital of China Medical University, and specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University. Animals were housed at 22–24 °C, 40–60% hu- midity with a 12-h light /dark cycle and had free access to food and water. Rats at the gestational age of 21 days (E21) were used in subsequent experiments. According to the isoflurane dose, rats were divided into 3 groups: the Iso1 group (1.3% isoflurane), the Iso2 group (2.0% isoflur- ane) and the control group (0% isoflurane; O2). In the absence of anesthesia, intratracheal intubation was difficult in the control group. Thus, all the rats retained spontaneous breathing and did not receive intra- tracheal intubation. Inhalation of isoflurane at a high con- centration may inhibit respiration and cause hypoxia. Thus, in our pilot study, pregnant rats at the gestational age of 20 days (E20) were anesthetized intraperitoneally with pentobarbital sodium and catheter indwelling was done in the right carotid artery; rats were then allowed to recover at room temperature. At E21, rats were placed in a box filled with prefilled gas according to the following groups: 50% O2 was administered in the control group; 1.3% isoflurane was administered in the Iso1 group (50% oxygen, balanced with nitrogen); 2.0% isoflurane was ad- ministered in the Iso2 group (50% oxygen, balanced with nitrogen). All rats were retained spontaneous breathing and exposed in the box for 3 h (the concentrations of iso- flurane and oxygen were monitored). The mean arterial blood pressure was continuously monitored via a catheter in the carotid artery, and arterial gas analysis was performed hourly. The results showed that inhalation of isoflurane at 1.3% or 2.0% had no influence on the arterial gas and mean arterial blood pressure. Rats used in pilot study will not be used for formal study. In this study, a total of 48 rats at E21 were randomly assigned into 3 groups and exposed to isoflurane at the pre- designed concentration for 3 h. Animals were allowed to re- cover at room temperature and housed until they delivered. The number of fetuses was recorded, and healthy male neo- natal rats were used in the experiments. At day 28 after birth Page 2 of 7 (P28), the male offsprings were randomly assigned into two groups: one for Morris water maze (MWM) test to evaluate memory and learning and the other one were housed until day 90 after birth (P90) to receive the same MWM test. MWM test used a round swimming pool sized 150 cm in diameter and 60 cm in height with a platform sized 10 cm in diameter in the maze. The removable platform was 1.5 cm lower than the water surface. The visual cues (a variety of figures) on the maze’s inner wall remained un- changed during the study. Training and examination were performed in the water at 20 °C. After each examination, rats were dried under a lamp and returned to the cages. Place navigation test was performed for consecutive 5 days. In brief, platform were placed in a quadrant (the 4th quadrant in this study). At predesigned time point, rats were placed in a random quadrant (once for each quadrant). If the rat found the platform within 90s, it was allowed to stay on the platform for 15 s and then placed out of the pool. The spatial navigation test was performed on the 6th day to evaluate memory. In brief, the platform was removed, rats were placed in a random quadrant and the swimming trajectory was recorded within 90s. In the test, the proportion of swimming distance in the platform quadrant to the total swimming distance and the times of crossing the platform were calculated. The swimming dis- tance in the platform quadrant reflects spatial localization and the times of crossing the platform reflects the accur- acy of spatial memory. Before training, the platform was visible above the water surface, which may exclude rats with visual defects that were unable to find the platform. In addition, rats with poor performance in the test, such as those could not find the hidden platform and swam along the wall, were also excluded from this study. Two hours after the spatial navigation test, rats were intraperitoneally anesthetized with pentobarbital sodium. Half of each group of the rats were used to collect brain and followed by the separation of hippocampus. The hippocampus was weighed and lysed for total protein extraction. Samples were then stored at −80 °C for later use. Western blotting was performed to detect the protein expression of CREB and p-CREB in the hippocampus. The half of the rats were transcardially perfused with 4% paraformaldehyde and the brain was collected and fixed in 4% paraformaldehyde. Immunohistochemistry was per- formed to detect CREB and p-CREB expression. (Fig. 1). The neonatal rats were randomly assigned into different groups to reduce variation. We normalized CREB and p- CREB protein expression in control group as 1. CREB and p-CREB expression in the Iso1 and Iso2 group was com- pared with the controls. All data are expressed as mean ± standard deviation. Statistical analyses were performed by using SPSS software (version 21.0; IBM, Corp., Armonk, NY, USA). One-Way ANOVA was used to compare the means between groups. A value of P < 0.05 indicated significance. Huang et al. BMC Anesthesiology (2018) 18:5 Page 3 of 7 Fig. 1 Study protocol. The E21 pregnant rats were randomized to inhalation with isoflurane 1.3%, 2.0% or O2. After the pregnant rats gave birth, the male offspring rats were randomized to day 28 after birth (P28) and day 90 after birth (P90), followed by MWM (place navigation 5 days and spatial navigation on the 6th day). At 2 h after the spatial navigation of MWM, detect the protein expression of CREB and p-CREB in the hippocampus Results A total of 48 pregnant rats were used in this study, and eventually 316 male neonatal rats were used in the subse- quent experiments. There were 52, 51 and 54 rats at day 28 after birth in the control, Iso1 and Iso2 group, respect- ively; there were 54, 51 and 54 rats at day 90 after birth in the control, Iso1 and Iso2 group, respectively (Table 1). There was no significant difference in the percentage of swimming distance in platform quadrant (IV quadrant) among three groups (P > 0.05). The times of crossing the platform in the Iso2 group was significantly lower than in the control group (P < 0.05) (Figs. 2 and 3). CREB expression in the granule cell layer of the hippo- campus dentate gyrus was comparable among the three groups (P > 0.05). p-CREB expression was mainly found in the whole granule cell layer of the hippocampus dentate gyrus in the control and Iso1 group, but mainly found in subgranular zone (SGZ) in the Iso2 group. In addition, p- CREB expression in the Iso2 group was significantly lower than in the Iso1 and control group (Fig. 4). CREB expression was similar among the three groups (P > 0.05). In addition, there was no marked difference in Table 1 The male offsprings in each group p-CREB expression between the Iso1 and control group (P > 0.05), however, p-CREB expression in the Iso2 group was significantly lower than in the control group (P < 0.05) (Fig. 5). Discussion The growth and development of central nervous system are very complex in mammals. A substantial proportion of neurons undergo apoptosis during normal develop- ment. In synaptic plasticity phase, the nervous system is extremely sensitive to the internal and external environ- ments and neurons that don’t form synapses will undergo apoptosis [3, 4]. Human brain development occurs mainly in fetus and mature slowly after birth [10], which is differ- ent from other species. For example, the nervous system of small rodents is largely immature at birth and rapidly developed after birth. Thus, in an animal study, brain development should be temporally equivalent to that in humans. It has been shown that brain development of rats at E21 is equivalent to that of human fetus at the gesta- tional age of 12–16 weeks the second trimester [10, 11]. In this study, pregnant SD rats at E21 were exposed to iso- flurane to mimic anesthesia on pregnant woman in the second trimester; isoflurane at 1.3% and 2.0% is equivalent to 1 and 1.5 MAC, respectively [12, 13]. P28 Control 53-1a Iso1 51 P90 Total 54 107-1a 51 102 a1 rat in the control group was excluded due to poor performance in MWM test Iso2 54 54 108 The behavior MWM test is often employed as an ef- fective tool to evaluate spatial learning and memory of rodents [14, 15]. In the spatial navigation test, the ratio of swimming distance in the platform quadrant to the total swimming distance reflects the capability of spatial Huang et al. BMC Anesthesiology (2018) 18:5 Fig. 2 The track of MWM space exploration experiment at P28 of offsprings. a: The green circle in the diagram is the platform, the red line is the trajectories of rats. b: The times of crossing the platform. c: The percentage of platform quadrant. *: P < 0.05 vs. Control Fig. 3 The track of MWM space exploration experiment at P90 of offsprings. a: The green circle in the diagram is the platform, the red line is the trajectories of rats. b: The times of crossing the platform. c: The percentage of platform quadrant. *: P < 0.05 vs. Control Page 4 of 7 Huang et al. BMC Anesthesiology (2018) 18:5 Page 5 of 7 Fig. 4 CREB and p-CREB expression in the granule cell layer of the hippocampus dentate gyrus of offspring rats. a: Arrow points positive cells. b: The P28 offspring rats. c: The P90 offspring rats. *: P < 0.05 vs. Control location, and the times of crossing the platform reflects the accuracy of spatial memory. Our results showed that the ratio of swimming distance was comparable in the young (28 days) and adult (90 days) rats among the three groups, but the times of crossing the platform in the Iso2 group was significantly less than in the other two groups, indicating that isoflurane at a high concentration compromises the accuracy of spatial memory in rats but has little influence on their spatial localization. The hippocampus is crucial to learning and memory [16–18]. The dentate gyrus in hippocampus is responsible for cognition and location navigation and transduces signals from the inner olfactory cortex to other regions of the hippocampus [19–21]. CREB is an important nuclear pro- tein expressed widely in the cortex and hippocampus of adult rats. The dentate gyrus has the highest expression of CREB in the hippocampus [22]. CREB plays important roles in neurogenesis, synaptic formation, learning and memory [23, 24]; it regulates the transcription of a large number of genes, such as brain derived neurotrophic factor, c-fos, synaptic I and Ca/calmodulin-dependent protein kinases kinases or CaM kinases [25, 26], to form new synapses and gain long-term memory. Increased CREB expression and/or activity promotes memory formation [27, 28], and reduces CREB expression and/or activity in- hibits memory formation [29–31]. Phosphorylated CREB was detected in cortical neurons with plasticity formation and hippocampal neurons after long-term potentiation stimulation and neurobehavioral training [32]. In addition, injection of CREB at dorsal hippocampus in mice was found to improve spatial memory in water maze test, but injection of the CREB variant that was unable to be Huang et al. BMC Anesthesiology (2018) 18:5 Page 6 of 7 Fig. 5 Western blotting of CREB and p-CREB expression in the hippocampus dentate gyrus of offspring rats. a and c: The P28 offspring rats. b and d: The P90 offspring rats. *: P < 0.05 vs. Control phosphorylated at ser133 deteriorated spatial memory of these mice [33]. Increased p-CREB enhanced memory and cognitive abilities in mice [34]. Therefore, CREB phosphor- ylation contributes to the formation of memory. In this study, our results showed that p-CREB expression in the Iso2 group was significantly lower than in the control group and Iso1 group, which is consistent with the findings from MWM test. These findings confirm the crucial role of CREB phosphorylation in the formation of memory [33]. The cortex at the hippocampus dentate gyrus can be di- layer and vided into the molecular layer, granular cell polymorphic cell layer. Immunohistochemistry showed that CREB was expressed mainly in the granule cell layer of the dentate gyrus in offspring rats. In the control group and Iso1 group, p-CREB was expressed in the whole gran- ule cell layer of the dentate gyrus, but its expression was only detectable in the subgranular zone (SGZ) in the Iso2 group. In 1998, Eriksson et al. confirmed neurogenesis in the dentate gyrus of humans for the first time [35]. Since then, increasing evidence has indicated a neural stem cell region in mammalian brain that is localized between the granular cell layer and hilus region with a size of 50– 100 μm [36]. The region is also known as the subgranular zone. Neurons in the SGZ may differentiate into mature granular cells, some intermediate neurons, and glial cells, which are finally integrated into the granular cell layer [37–39]. These cells then form synapses, playing import- ant roles in learning and memory. In the present study, the results showed that p-CREB was mainly expressed in SGZ of the dentate gyrus in the Iso2 group. Our results indicates that inhalation of isoflurane at a high concentra- tion affects CREB phosphorylation in fetal brain without altering the CREB expression, which leads to compro- mised learning and memory. The new neural stem cells in SGZ in adulthood are not affected by the anesthetic and may further differentiate into granular cells and join the granular cell layer. Thus, the expression of CREB and p- CREB in SGZ remained unchanged. However, we could not exclude that isoflurane inhalation during pregnancy has little influence on neural stem cells in SGZ. In the present study, pregnant rats were exposed to iso- flurane for 3 h, which is equivalent to 48 h general anesthesia in humans. Other harmful stimulation was not employed aiming to reduce other confounding factors. it is rare that pregnant However, women received anesthesia without surgery or surgery is performed under anesthesia for several weeks. Thus, al- though our results indicate that isoflurane has influence on neural development, we usually will not expect the equivalent conditions in general clinical practice. in clinical practice, Conclusion Inhalation of isoflurane at 1.3% during pregnancy has no sig- nificant influence on learning and memory of the offspring in rats; exposure to isoflurane at 2.0% during pregnancy af- fects the accuracy of spatial memory of the offspring, but has little influence on spatial localization, which is associated to inhibition of CREB phosphorylation in the granular cell layer of the dentate gyrus in the hippocampus of fetal rats. Abbreviations CREB: CAMP-response element binding protein; E21: Gestational age of 21 days; MWM: Morris water maze; P28: Day 28 after birth; P90: Day 90 after birth; p-CREB: Phosphorylated cAMP-response element binding protein; SD pregnant rats: SpragueDawley pregnant rats; SGZ: Subgranular zone Acknowledgements Not Applicable. Funding The study was funded by Natural Science Foundation of China (81671311) and Natural science fund of Liaoning province (2015020467). Huang et al. BMC Anesthesiology (2018) 18:5 Availability of data and materials The datasets generated and analysed during the current study are available from the corresponding author on reasonable request. Authors’ contributions YD and YW carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. GY and JJ participated in the design of the study, carried out immunoassays and performed the statistical analysis. WH and PZ conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript. Ethics approval and consent to participate This study was approved by the Ethics Committee of Affiliated Shengjing Hospital of China Medical University. Reference number for the ethics approval is 2017PS335K. Consent for publication Not Applicable. Competing interests The authors declare that they have no competing interests. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Received: 14 August 2017 Accepted: 4 January 2018 References 1. Reitman E, Flood P. Anaesthetic considerations for non-obstetric surgery during pregnancy. Br J Anaesth. 2011;107:i72–8. Cheek TG, Baird E. Anesthesia for nonobstetric surgery: maternal and fetal considerations. Clin Obstet Gynecol. 2012;52:535–45. Kong FJ, Ma LL, WW H, Wang WN, HS L, Chen SP. Fetal exposure to high isoflurane concentration induces postnatal memory and learning deficits in rats. Biochem Pharmacol. 2012;84:558–63. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci. 2003;23:876–82. Cunningham F, Leveno K, Bloom S, Hauth J, Rouse D, Spong C. Williams obstetrics [M]. New York: McGraw-Hill Professional; 2009. Uemura E, Levin ED, Bowman RE. Effects of halothane on synaptogenesis and learning behavior in rats. Exp Neurol. 1985;89:520–9. 2. 3. 4. 5. 6. 7. Wang Y, Li Y, Xing Q, Han XG, Dong X, Lu Y, Zhou M. Sevoflurane anesthesia in pregnant rats negatively affects nerve function in offspring potentially via inhibition of the Wnt/β-catenin pathway. Mol Med Rep. 2017;15:2753–9. Fang F, Song R, Ling X, Peng M, Xue Z, Cang J. Multiple sevoflurane anesthesia in pregnant mice inhibits neurogenesis of fetal hippocampus via repressing transcription factor Pax6. Life Sci. 2017;175:16–22. 9. Wang Y, Cheng Y, Liu G, Tian X, Tu X, Wang J. Chronic exposure of gestation rat to sevoflurane impairs offspring brain development. Neurol Sci. 2012;33:535–44. 8. 10. Palanisamy A. Maternal anesthesia and fetal neurodevelopment. Int J Obstet Anesth. 2012;21:152–62. 11. Clancy B, Darlington RB, Finlay BL. Translating developmental time across mammalian species. Neuroscience. 2001;105:7–17. 12. Yoo KY, Lee JC, Yoon MH, Shin MH, Kim SJ, Kim YH, Song TB, Lee J. The effects of volatile anesthetics on spontaneous contractility of isolated human pregnant uterine muscle: a comparison among sevoflurane, desflurane, isoflurane, and halothane. Anesth Analg. 2006;103:443–7. 13. Zhai WH, Zhao J, Huo SP, Chen XG, Li YD, Zhang ZL, LL Y, Song S, Wang QJ. Mechanisms of cytotoxicity induced by the anesthetic isoflurane: the role of inositol 1, 4, 5-trisphosphate receptors. Genet Mol Res. 2015;14:6929–42. 14. Callaway JK, Jones NC, Royse AG, Royse CF. Memory impairment in rats after desflurane anesthesia is age and dose dependent. J Alzheimers Dis. 2015;44:995–1005. 15. Barrientos RM, Kitt MM, D'Angelo HM, Watkins LR, Rudy JW, Maier SF. Stable, long-term, spatial memory in young and aged rats achieved with a one day Morris water maze training protocol. Learn Mem. 2016;23:699–702. Page 7 of 7 16. Rosi S, Andres-Mach M, Fishman KM, Levy W, Ferquson RA, Fike JR. Cranial irradiation alters the behaviorally induced immediate-early gene arc ( activity- regulated cytoskeleton-associated protein). Cancer Res. 2008;68:9763–70. 17. Mack ML, Preston AR. Decisions about the past are guided by reinstatement of specific memories in the hippocampus and perirhinal cortex. NeuroImage. 2016; 127:144–57. Slee EA, Adrain C, Martin SJ. Executioner caspase-3,-6,and-7 perform distinct,non-redundant roles during the demolition phase of apoptosis. J Biol Chem. 2001;276:7320–6. 18. 19. Gonçalves JT, Schafer ST, Gage FH. Adult neurogenesis in the hippocampus: from stem cells to behavior. Cell. 2016;167:897–914. 20. Mazumder S, Plesca D, Almasan A. Caspase-3 activation is a critical determinant of genotoxic stress-induced apoptosis. Methods Mol Biol. 2008;414:13–21. 21. de Vasconcellos AP, Zugno AI, Dos Santos AH, Nietto FB, Crema LM, Goncalves M, Franzon R, de Souza Wyse AT, da Rocha ER, Dalmaz C. Na+, K+ -ATPase activity is reduced in hippocampus of rats submitted to an experimental model of depression: effect of chronic lithium treatment and possible involvement in learning deficits. Neurobiol Learn Mem. 2005;84:102–10. 22. Yu W, Zhang L, Han TZ, Jiang ML. Distribution of p-CREB in hippocampal formation of adult rats. J Fourth Mil Med Univ. 2004;25:874–6. 23. Han JH, Kushner SA, Yiu AP, Cole CJ, Matynia A, Brown RA, Neve RL, Guzowski JF, Silva AJ, Josselyn SA. Neuronal competition and selection during memory formation. Science. 2007;316:457–60. 24. Mizuno M, Yamada K, Maekawa N, Saito K, Seishima M, Nabeshima TCREB. Phosphorylation as a molecular marker of memory processing in the hippocampus for spatial learning. Behav Brain Res. 2002;133:135–41. 25. Deisseroth K, Bito H, Tsien RW. Signaling from synapse to nucleus: postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic plasticity. Neuron. 1996;16:89–101. 26. Zhu DY, Lau L, Liu SH, Wei JS, Activation LYM. Of cAMP-response-element- bingding protein (CREB) after focal cerebral ischemia stimulates neurogenesis in the adult dentate gyrus. Proc Natl Acad Sci U S A. 2004;101:9453–7. 27. Pittenger C, Huang YY, Paletzki RF, Bourtchouladze R, Scanlin H, Vronskaya S, Kandel ER. Reversible inhibition of CREB/ ATF transcription factors in region CA1 of the dorsal hippocampus disrupts hippocampus-dependent spatial memory. Neuron. 2002;34:447–62. 28. Hinoi E, Balcar VJ, Kuramoto N, Nakamichi N, Yoneda Y. Nuclear transcription factors in the hippocampus. Prog Neurobiol. 2002;68:145–65. 29. Putignano E, Lonetti G, Cancedda L, Ratto G, Costa M, Maffei L, Pizzorusso T. 30. 31. 32. 33. 34. 35. Developmental downregulation of histone posttranslational modifications regulates visual cortical plasticity. Neuron. 2007;53:747–59. Kida S, Josselyn SA, Peña de Ortiz S, Kogan JH, Chevere I, Masushige S, Silva AJCREB. Required for the stability of new and reactivated fear memories. Nat Neurosci. 2002;5:348–55. Todorovski Z, Asrar S, Liu J, Saw NM, Joshi K, Cortez MA, Snead OC 3rd, Xie W, Jia Z. LIMK1 regulates long-term memory and synaptic plasticity via the transcriptional factorCREB. Mol Cell Biol. 2015;35:1316–28. Taubenfeld SM, Wiig KA, Monti B, Dolan B, Pollonini G, Alberini CM. Fornix- dependent induction of hippocampal CCAAT enhancer-binding protein [beta] and [delta] co-localizes with phosphorylated cAMP response element-binding protein and accompanies long-term memory consolidation. J Neurosci. 2001;21:84–91. Sekeres MJ, Neve RL, Frankland PW, Josselyn SA. Dorsal hippocampal CREB is both necessary and sufficient for spatial memory. Learn Mem. 2010;17:280–3. Lee Y, Kim J, Jang S, Administration OS. Of Phytoceramide enhances memory and upregulates the expression of pCREB and BDNF in hippocampus of mice. Biomol Ther (Seoul). 2013;21:229–33. Eriksson PS, Perfilieva E, Björk-Eriksson T, Alborn AM, Nordborg C, Peterson DA, Gage FH. Neurogenesis in the adult human hippocampus. Nat Med. 1998;4:1313–7. Traiffort E, Ferent J. Neural stem cells and notch signaling. Med Sci (Paris). 2015;31:1115–25. 36. 37. Garcia AD, Doan NB, Imura T, Bush TG, Sofroniew MV. GFAP-expressing progenitors are the principal source of constitutive neurogenesis in adult mouse forebrain. Nat Neurosci. 2004;7:1233–41. Lepousez G, Nissant A, Lledo PM. Adult neurogenesis and the future of the rejuvenating brain circuits. Neuron. 2015;86:387–401. Kee N, Teixeira CM, Wang AH, Frankland PW. Preferential incorporation of adult-generated granule cells into spatial memory networks in the dentate gyrus. Nat Neurosci. 2007;10:355–62. 37. Garcia AD, Doan NB, Imura T, Bush TG, Sofroniew MV. GFAP-expressing progenitors are the principal source of constitutive neurogenesis in adult mouse forebrain. Nat Neurosci. 2004;7:1233–41. Lepousez G, Nissant A, Lledo PM. Adult neurogenesis and the future of the rejuvenating brain circuits. Neuron. 2015;86:387–401. Kee N, Teixeira CM, Wang AH, Frankland PW. Preferential incorporation of adult-generated granule cells into spatial memory networks in the dentate gyrus. Nat Neurosci. 2007;10:355–62. 38.",rats,"['Forty-eight SpragueDawley (SD) pregnant rats were randomly divided into 3 groups and inhaled 1.3% isoflurane (the Iso1 group), 2.0% isoflurane (the Iso2 group) and 50% O2 alone (the control group) for 3 h, respectively.']",gestational day 21,['Rats at the gestational age of 21 days (E21) were used in subsequent experiments.'],Y,['Their offsprings were subjected to Morris water maze at day 28 and day 90 after birth to evaluate learning and memory.'],isoflurane,"['Forty-eight SpragueDawley (SD) pregnant rats were randomly divided into 3 groups and inhaled 1.3% isoflurane (the Iso1 group), 2.0% isoflurane (the Iso2 group) and 50% O2 alone (the control group) for 3 h, respectively.']",none,[],sprague dawley,"['Forty-eight SpragueDawley (SD) pregnant rats were randomly divided into 3 groups and inhaled 1.3% isoflurane (the Iso1 group), 2.0% isoflurane (the Iso2 group) and 50% O2 alone (the control group) for 3 h, respectively.']","This study aimed to investigate safe dosage range of isoflurane during pregnancy and its effects on the learning and memory of offsprings, addressing the lack of guidelines for isoflurane usage during pregnancy due to insufficient clinical studies.","['This study aimed to investigate safe dosage range of isoflurane.', 'However, there is no guideline for isoflurane usage during pregnancy due to lack of clinical studies.']",None,[],"The findings suggest that inhalation of isoflurane at 1.3% during pregnancy has no significant influence on learning and memory of the offspring, while exposure to isoflurane at 2.0% causes damage to spatial memory, potentially impacting guidelines for anesthesia in pregnant women.",['Inhalation of isoflurane at 1.3% during pregnancy has no significant influence on learning and memory of the offspring; exposure to isoflurane at 2.0% causes damage to spatial memory associated with inhibition of CREB phosphorylation in the granular cell layer of hippocampus dentate gyrus.'],"The study's limitations include the use of high concentrations of isoflurane equivalent to 48 h of general anesthesia in humans, which is rare in clinical practice, and the lack of other harmful stimulations to reduce confounding factors.","['In the present study, pregnant rats were exposed to isoflurane for 3 h, which is equivalent to 48 h general anesthesia in humans.', 'Other harmful stimulation was not employed aiming to reduce other confounding factors.']",None,[],True,True,True,True,True,True,10.1186/s12871-018-0471-2 10.1213/ANE.0b013e318281e988,407.0,Istaphanous,2013,mice,postnatal day 7,N,isoflurane,none,none,"H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Pediatric Neuroscience Section Editors: Peter J. Davis/Gregory J. Crosby Characterization and Quantification of Isoflurane- Induced Developmental Apoptotic Cell Death in Mouse Cerebral Cortex George K. Istaphanous, MD,*† Christopher G. Ward, MD,*† Xinyu Nan, BS,* Elizabeth A. Hughes, BS,* John C. McCann, BS,* John J. McAuliffe, MD, MBA,*† Steve C. Danzer, PhD,*† and Andreas W. Loepke, MD, PhD*† BACKGROUND: Accumulating evidence indicates that isoflurane and other, similarly acting anes- thetics exert neurotoxic effects in neonatal animals. However, neither the identity of dying corti- cal cells nor the extent of cortical cell loss has been sufficiently characterized. We conducted the present study to immunohistochemically identify the dying cells and to quantify the fraction of cells undergoing apoptotic death in neonatal mouse cortex, a substantially affected brain region. METHODS: Seven-day-old littermates (n = 36) were randomly assigned to a 6-hour exposure to either 1.5% isoflurane or fasting in room air. Animals were euthanized immediately after exposure and brain sections were double-stained for activated caspase 3 and one of the following cellular markers: Neuronal Nuclei (NeuN) for neurons, glutamic acid decarboxylase (GAD)65 and GAD67 for GABAergic cells, as well as GFAP (glial fibrillary acidic protein) and S100β for astrocytes. RESULTS: In 7-day-old mice, isoflurane exposure led to widespread increases in apoptotic cell death relative to controls, as measured by activated caspase 3 immunolabeling. Confocal analy- ses of caspase 3–labeled cells in cortical layers II and III revealed that the overwhelming majority of cells were postmitotic neurons, but some were astrocytes. We then quantified isoflurane- induced neuronal apoptosis in visual cortex, an area of substantial injury. In unanesthetized control animals, 0.08% ± 0.001% of NeuN-positive layer II/III cortical neurons were immuno- reactive for caspase 3. By contrast, the rate of apoptotic NeuN-positive neurons increased at least 11-fold (lower end of the 95% confidence interval [CI]) to 2.0% ± 0.004% of neurons imme- diately after isoflurane exposure (P = 0.0017 isoflurane versus control). In isoflurane-treated animals, 2.9% ± 0.02% of all caspase 3–positive neurons in superficial cortex also coexpressed GAD67, indicating that inhibitory neurons may also be affected. Analysis of GABAergic neurons, however, proved unexpectedly complex. In addition to inducing apoptosis among some GAD67- immunoreactive neurons, anesthesia also coincided with a dramatic decrease in both GAD67 (0.98 vs 1.84 ng/mg protein, P < 0.00001, anesthesia versus control) and GAD65 (2.25 ± 0.74 vs 23.03 ± 8.47 ng/mg protein, P = 0.0008, anesthesia versus control) protein levels. CONCLUSIONS: Prolonged exposure to isoflurane increased neuronal apoptotic cell death in 7-day-old mice, eliminating approximately 2% of cortical neurons, of which some were identified as GABAergic interneurons. Moreover, isoflurane exposure interfered with the inhibitory nervous system by downregulating the central enzymes GAD65 and GAD67. Conversely, at this age, only a minority of degenerating cells were identified as astrocytes. The clinical relevance of these findings in animals remains to be determined. (Anesth Analg 2013;116:845–54) From the Departments of *Anesthesia and †Pediatrics, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio. Accepted for publication November 27, 2012. Supported in part by 2 mentored research grants from the Foundation for Anesthesia Education and Research (FAER) to G. K. I. and to C. G. W., men- tor A. W. L. General anesthetics, such as isoflurane, are used in millions of children around the world.1 However, preclinical studies demonstrating increased brain cell death after anesthetic exposure in developing animals have raised serious concerns about their safe use in the very young.2–8 This report was previously presented, in part, at the 2010 International Anes- thesia Research Society meeting. George K. Istaphanous, MD, is currently affiliated with the Department of Anesthesiology, Children’s Hospital Los Angeles, Los Angeles, CA. Christopher G. Ward, MD, is currently affiliated with the Department of Anesthesiology and Critical Care, Children’s Hospital of Philadelphia, Philadelphia, PA. The authors declare no conflicts of interest. Reprints will not be available from the authors. Address correspondence to Andreas Loepke, MD, PhD, Department of Anes- thesia, Cincinnati Children’s Hospital Medical Center, ML2001, 3333 Burnet Ave., Cincinnati, OH 45229. Address e-mail to pedsanesthesia@gmail.com. Copyright © 2013 International Anesthesia Research Society. DOI: 10.1213/ANE.0b013e318281e988 Anesthesia-induced brain cell death is widespread and at least some of the dying cells are neurons. However, whether and to what extent neurons versus non-neuronal cells are affected by isoflurane exposure is unclear. Although previous studies have convincingly demonstrated the presence of increased brain cell death in neonatal animals using a variety of cell death markers, such as caspase 3, Fluoro Jade B, TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling), and cupric silver stains, these markers were not specific to a particular brain cell type and have not been routinely combined with phenotypic markers for April 2013 • Volume 116 • Number 4 www.anesthesia-analgesia.org 845 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f specific cell types.2,3,5,9 Accordingly, previous studies have relied on cell morphology alone to identify cells vulnerable to anesthesia-induced degeneration such as neurons. Most of these studies have localized cell death to cortical and subcortical gray matter, where the predominant cell types are neurons and glia. Determining the relative extent to which these 2 cell types are affected by anesthesia exposure will be particularly important for predicting the functional consequences of anesthesia-induced cell loss because the different cell types possess vastly different regenerative capacities. Whereas glial cell proliferation can occur throughout adulthood, neuronal proliferation becomes increasingly restricted as the brain matures.10 In the case of neuronal cell loss, it is also unclear which neuronal subtypes are most vulnerable. Answering this question is of particular importance for understanding anesthesia-induced cell death because of the phenomenon’s particular pattern of distribution. In contrast to other types of brain injury, such as ischemia in which a majority of cells in an affected region are destroyed, anesthetics induce widespread, scattered cell loss. Dying cortical brain cells are found immediately adjacent to apparently unaffected cells, suggesting that intrinsic differences among brain cells con- fer distinct vulnerabilities; however, the nature of these dif- ferences is not known. Accordingly, the present study quantitatively and quali- tatively characterized the cellular phenotype of susceptible brain cells in the superficial layers of neocortex, a brain region substantially affected by isoflurane-induced apop- totic cell death in neonatal mice. This was accomplished by using specific immunohistochemical markers for neurons, inhibitory interneurons, and astrocytes, and by comparing these findings with naturally occurring apoptosis in fasted, unanesthetized littermates, in order to provide insights into the selectivity, potential mechanisms, and consequences of anesthesia-induced cell death. METHODS All procedures were approved by the Institutional Animal Care and Use Committee and conformed to the guidelines for ethical treatment of animals. Efforts were made to mini- mize the number of animals used. Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12- hour light-dark cycle at 22°C with free access to food and water. This hybrid was selected because they exhibit robust anesthesia-induced apoptosis with acceptable survival.3 For protein analyses, a separate set of animals (n = 22) was treated and euthanized as described above. The left hemispheres were cut into 4 coronal sections, frozen in liquid nitrogen, and stored at −80°C until use. At a later date, sections of neocortex around bregma −3 mm were separated with a razor blade on dry ice and then homog- enized twice in cell lysis buffer solution for approximately 10 seconds each time at 4°C. The homogenate was then centrifuged at 13,000 rpm using a refrigerated microcen- trifuge (Fresco centrifuge, Sorvall, Buckinghamshire, UK). The supernatant was removed and used for testing for the specific proteins. Immunohistochemistry Slide-mounted brain sections were blocked for 1 hour in nor- mal goat serum, followed by incubation in rabbit antiactivated caspase 3 polyclonal antibodies (1:100, 9661L; Cell Signaling, Danvers, MA) for 18 hours at −4°C, combined with one of the following antibodies: (1) mouse anti– Neuronal Nuclei (NeuN) monoclonal antibodies (NeuN, 1:500, Chemicon, MAB377; Millipore, Billerica, MA), (2) mouse antiglutamate decarboxylase isoform 67 (antiglutamic acid decarboxylase [GAD]67, 1:2000, MAB5406; Chemicon), (3) mouse anti- S100β (1:500, CB1040; Millipore), or (4) chicken antiglial fibrillary acidic protein (GFAP) (1:500, AB5541; Chemicon). Sections were then rinsed in blocker and incubated in Alexa Fluor 488 goat antirabbit secondary antibodies (1:200, A11034, Molecular Probes Inc.; Invitrogen, Carlsbad, CA) for 4 hours at 20°C, combined with either Alexa Fluor 594 goat antimouse (1:250, A11032, Molecular Probes) or Alexa Fluor 594 goat antichicken (1:250, A11042, Molecular Probes) sec- ondary antibodies, as appropriate for the primary antibody species. After immunostaining, sections were dehydrated in an ascending ethanol series, cleared in xylenes, and mounted with Krystalon (EMD, Gibbstown, NJ). Identification of Cellular Phenotype To determine the phenotype of degenerating cells, brain sections from anesthesia-treated and control animals, cor- responding to Bregma −2.46 to −2.70 (figures 51–53 in the mouse brain atlas by Paxinos and Franklin11) and double- immunostained for caspase 3 and NeuN or triple stained for caspase 3, S100β, and GFAP, were examined by an observer unaware of group assignment. NeuN and S100β stains can- not be combined in the same section, because both second- ary antibodies are raised in the same species. Isoflurane Treatment For caspase 3 immunohistochemistry, 7-day-old CD1 and C57BL/6 hybrid littermates (n = 14) were randomly assigned to a 6-hour exposure to 1.5% isoflurane (approxi- mately 0.6 minimum alveolar concentration in these mice) in 30% oxygen (anesthesia, n = 8) or to 6 hours in room air (control, n = 6). Immediately after treatment, animals were euthanized with an overdose of ketamine, acepromazine, and xylazine. Brains were immersion-fixed in 4% parafor- maldehyde in phosphate-buffered saline (pH 7.4), postfixed overnight at 4°C, and cryopreserved in 25% sucrose. Brains were snap frozen and 40-μm coronal sections were cut on a cryostat (Thermo Electronics, Kalamazoo, MI). Sections were mounted to charged slides and stored at −80°C until use. Caspase 3 immunostaining was excited using the 488-nm laser line, and emission wavelengths between 510 and 540 nm were collected to identify caspase-positive cells in layers II/III from retrosplenial cortex to piriform cortex using an SP5 confocal microscope set up on a DMI6000 stand (Leica Microsystems, Wetzlar, Germany) equipped with a 63× objective (NA 1.4). This region was selected because it has repeatedly demonstrated increased numbers of apoptotic cells in immature rodents.2,3 Immunostaining for NeuN, S100β, or GFAP was excited using the 543-nm laser line, and emission wavelengths between 600 and 650 nm were collected. Confocal optical sections were collected through the midpoint of the caspase 3–positive cell (pinhole = 1 Airy unit). Data are expressed as the percentage of caspase 3–immunoreactive cells that were also NeuN- or GFAP-positive, respectively. 846 www.anesthesia-analgesia.org ANesthesiA & ANAlgesiA H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Quantification of Apoptotic Cells Using the Optical Dissector Method Further quantification of the effects of isoflurane exposure on cortical neurons and on GABAergic interneurons was performed as previously described.3,8 Briefly, confocal image stacks of caspase 3/GAD67 double labeling were collected at 1-µm increments through the entire Z-depth of the tissue (40 μm) using 1× optical zoom. Six image stacks were collected from layers II/III of visual cortex, corresponding to figures 51 to 53 in the mouse brain atlas by Paxinos and Franklin,11 from each animal, as follows: for each hemisphere, 3 adja- cent confocal image stack frames were collected beginning 750 μm from the midline and moving laterally (Leica SP5, 63× 1.4 NA objective, 1-μm steps). Image stacks, which were 120 × 120 µm in dimension for NeuN and 240 × 240 µm for GAD67, because of the significantly lower cellular density for the latter stain compared with NeuN, were transferred to Neurolucida software (v7.50.4; MBF Bioscience, Williston, VT) for analysis. Using the optical dissector method, an observer unaware of group assignment quantified the respective numbers of NeuN-positive or GAD67-positive cells, the corresponding number of caspase 3–positive cells, and the number of caspase 3/GAD67 or caspase 3/NeuN double-positive cells in each field.12,13 Cells were considered positive if their fluorescence intensity was 2 times or greater than the background intensity. Counts from all 6 respective image stacks were averaged for each animal. Quantification of GAD67 and GAD65 Expression Using Competitive Enzyme-Linked Immunosorbent Assay We used a competitive enzyme-linked immunosorbent assay to quantify the expression of the two γ-aminobutyric acid A (GABAA) synthesizing enzymes, GAD67 and GAD65. Rat antiglutamate decarboxylase isoform 67 (Anti GAD67, 1:5000, 671-C; Alpha Diagnostics Inc., San Antonio, TX) and goat antiglutamate decarboxylase isoform 65 (Anti GAD65, 1:32,000, Ab67725; Abcam, Cambridge, MA) antibodies were incubated overnight with the homogenized cortical tissue samples. These bound antibody/antigen complexes were then added to a GAD67 or GAD65 antigen-coated well blocked with 5% bovine serum albumin. Rabbit antirat and rabbit antigoat secondary antibodies were added to GAD67 and GAD65 complexes, respectively. The secondary anti- bodies were covalently bound to horseradish peroxidase, an enzyme that cleaves the peroxide in the chromophore 3,3′,5,5′-tetramethylbenzidine. This enzyme activation turned on the chromophore and emitted a blue signal, which when treated with 2 M sulfuric acid turned to a yellow color, which was measured at 450 nm using a spectrophotometer (Jenway Genova Life Science Spectrophotometer; Bibby Scientific Limited, Staffordshire, UK). Absorbancy was then compared with a standard curve allowing for the determi- nation of the isoforms’ concentrations. Statistical Analysis All sample sizes for group assignment were made a priori. For each animal, the total NeuN-positive cells were counted over the 6 fields. The number of caspase 3/NeuN dou- ble-positive cells was defined as an event. The data were April 2013 • Volume 116 • Number 4 normalized to events (caspase 3/NeuN double-positive cells) per 400 NeuN-positive cells counted, the lower end of cells encountered in each animal, to avoid extrapolation. Gross inspection of the raw data revealed that caspase 3 activation in NeuN-positive cells was a rare event with a mean incidence of 2.4% and a maximal incidence of 3.6% in the anesthesia-treated animals. This event rate met the criteria for analysis using the Poisson distribution. The Poisson mean event rate, λ, and its 95% CI were deter- mined using the MATLAB® function [lambdahat,lambdaci] = poissfit(data,alpha). The vector “data” represented the number of events per 400 counted NeuN cells for each ani- mal in the group of interest and α = (1 − CI). The mean event rates, λ, derived from the MATLAB function, were used to construct probability distribution function curves for the 2 groups (see Appendix). The raw event counts were used to compute the ratio of events in the anesthesia-treated group to the control group using equations 6 and 7 in Graham et al.14 This method was used as an independent means to assess the mean event ratio and to determine the 95% CI for the event ratio. All other data are presented as means ± SEM. Group comparisons were made using the Mann-Whitney U test. Statistical calculations were analyzed using Stata/IC 10.1 for Mac OS X (Stata Corp., College Station, TX). Statistical significance was accepted at P < 0.05. RESULTS Neonatal Isoflurane Exposure Increases Apoptosis Throughout the Developing Mouse Brain In 7-day-old mice, isoflurane exposure led to widespread qualitative increases in apoptotic cell death relative to controls, as measured by caspase 3 immunolabeling. Although cellu- lar degeneration was observed in many brain regions, such as thalamus, striatum, and hippocampus, superficial cortical cell layers II and III comprised the highest density of apoptotic cells (Fig. 1), consistent with previous findings.3,8 Accordingly, quantitative analyses focused on this region in an effort to char- acterize the cellular phenotype and to quantify apoptotic cell death after isoflurane exposure in an area of “maximal” injury. Neurons Are Preferentially Lost After Isoflurane Exposure To reveal the cellular specificity of isoflurane-induced apoptosis, caspase 3 labeling was combined with either NeuN immunohistochemistry, which labels postmitotic neurons, or S100β and GFAP immunohistochemistry, which primarily label glial cells, the 2 predominant cell classes in the neocortex. Confocal analyses in cortical layers II and III revealed that 98% ± 0.6% of all caspase 3–labeled cells colocalized with NeuN in isoflurane-treated mice (Figs. 2 and 3). In contrast, 0.3% ± 0.26% and 6.6% ± 1% of degenerating cells were GFAP- and S100β-positive, respectively (Figs. 3 and 4), suggesting that isoflurane overwhelmingly affects cortical, postmitotic neurons immediately after exposure. Although far fewer cells were caspase 3 immunoreac- tive in control animals, similar relative percentages of the dying cells expressed NeuN (98% ± 2% [95% CI 92.4, 103.5] or 98% ± 0.6% [95% CI 96.9, 99.8] for control or anesthesia, www.anesthesia-analgesia.org 847 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f respectively) or GFAP (0% [95% CI 0, 0] or 0.3% ± 0.26% [95% CI −0.3, 0.8], for control or anesthesia, respectively). These percentages followed the rare event rate, as outlined below and were indistinguishable from anesthesia-treated animals in terms of neuronal versus astrocytic cells (P = 0.18 or P ≈ 1 for NeuN or GFAP colocalization, respectively, comparing anesthesia with control). This suggests that, although cell loss was substantially higher after anesthesia exposure, the cell type being lost, predominantly neurons, was similar to naturally occurring cell death, as observed in control animals. Figure 1. Isoflurane exposure induces signifi- cant apoptotic brain cell death in neocortex of neonatal mice. Representative photomicrograph obtained with laser confocal microscopy demon- strating activation of caspase 3 (green dots, a marker of apoptosis) in superficial layers II/III of neocortex (arrowheads) and layer IV/V (arrows) in (A) unanesthetized, fasted control animals, or (B) after a 6-hour exposure to 1.5% isoflurane on day 7 of life. Scale bar = 200 µm. Isoflurane Exposure Increases Apoptosis at Least 11-Fold in Superficial Cortical Neurons Because the majority of dying cells in superficial cortical layers were identified as neurons, based on colocalization with NeuN, we further quantified isoflurane-induced neuronal apoptosis among cells in the visual cortex, using the optical dissector method. In unanesthetized, fasted animals, 0.08% ± 0.001% of NeuN-positive layer II/III cortical neurons were immunoreactive for caspase 3, undergoing natural apoptosis. By contrast, the rate of apoptotic NeuN-positive neurons increased to 2.0% ± 0.004% of all postmitotic neurons immediately after isoflurane exposure (P = 0.0017 isoflurane versus control; Fig. 3). The average number of cells counted on a group basis was 590 ± 47 for the control group and 582 ± 39 for the anesthesia group; these values were not significantly different. Two caspase 3/NeuN double-positive cells were observed in the control group for an event rate of 0.23 per 400 NeuN-positive cells. A total of 95 double-positive cells were observed in the anesthesia-treated animals, yielding an event rate of 8.77 per 400 NeuN-positive cells. The mean (95% CI) for the ratio of events was 38.8 (10.5, 143). Using the Poisson statistics, the 95% CIs for λ ranged from 0.015 to 1.05 (mean = 0.23) caspase 3/NeuN double-positive cells per 400 NeuN-positive cells for the control animals, and from 6.64 to 10.83 (mean = 8.55) in the anesthesia-treated animals. The predicted ratio of events, comparing anesthesia-treated animals with controls, on the basis of mean λ was 37.2. Conversely, the probability of observing no events per 400 NeuN-positive cells in the control group was P = 0.79, whereas the probability of observing 1 event was P = 0.18. For the anesthesia-treated group, 8 events has the maximal probability of being observed (P = 0.137) (see Appendix). The central 50% of the probability mass for the event ratio lies between 24 and 62; thus, 50% of the time the observed ratio of caspase 3/NeuN double-positive cells per X (an arbitrary large number) NeuN-positive cells in anesthesia- treated to control animals will be between 24 and 62. The limits were narrower than, but close to, the limits that would be computed using the Wald large number approximation.15 Figure 2. Postmitotic neurons are affected by apoptotic cell death after isoflurane exposure in neonatal mice. Representative photo- micrograph demonstrating neocortical cells stained for the apop- totic marker–activated caspase 3 (green, top), the neuronal marker Neuronal Nuclear antigen (NeuN) (red, middle), and a merged image of the 2 stains (bottom) in a mouse brain after a 6-hour exposure to 1.5% isoflurane on day 7 of life. Cells labeled for activated caspase 3 and NeuN (yellow, arrows) are identified as postmitotic neurons undergoing apoptosis, compared with cells only expressing caspase 3 (arrowheads). The left column represents a 90-degree rotation on the y-axis confirming colocalization of both markers in a single neuron (yellow). Scale bar = 10 µm. Isoflurane Exposure Increases Apoptosis in GABAergic Cortical Neurons Although many caspase 3/NeuN double-positive neurons in anesthesia-treated animals appeared to be principal cells based on morphological criteria (pyramidal structure 848 www.anesthesia-analgesia.org ANesthesiA & ANAlgesiA H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Figure 3. Anesthesia-induced and physiological apoptosis over- whelmingly affect postmitotic neurons in neonatal mice. Graphical quantification of the differential effects of isoflurane-induced apop- tosis (left pie chart, Anesthesia) or natural apoptosis (right, No Anesthesia) on neurons (Neuronal Nuclear antigen, NeuN) and astro- cytes (glial fibrillary acidic protein, GFAP) in superficial neocortex in 7-day-old mice after a 6-hour exposure to 1.5% isoflurane or 6 hours of fasting. Isoflurane induces apoptotic cell death in 2% of brain cells in layer II/III of neocortex, compared with only 0.08% succumb- ing to physiological apoptosis in 7-day-old mice. Both after anes- thesia and in unanesthetized animals, the overwhelming majority of affected cells are postmitotic neurons (98% NeuN+), whereas astro- cytes are substantially less affected (0.3% GFAP+ or 6.6% S100β+; data not shown). *P < 0.01 compared with no anesthesia. with radially oriented apical and basal dendrites; Figs. 1 and 2), caspase 3–immunoreactive cells with bipolar or stellate morphologies were occasionally observed, sug- gesting that interneurons are also affected during isoflu- rane exposure. To determine whether this was indeed the case, caspase 3 immunolabeling was combined with immu- nohistochemistry for the GABAergic interneuron marker GAD67. In isoflurane-treated animals, 2.9% ± 0.02% of all caspase 3–positive neurons in superficial cortex also coexpressed GAD67 (Fig. 5). Expressed as the percent- age of GABAergic interneurons that were affected by the anesthetic exposure, almost 28% of all GAD67-positive cells were also immunoreactive for caspase 3, imply- ing that a significant percentage of the GAD67 popu- lation underwent apoptosis after isoflurane exposure. Further analysis, however, led us to interpret these Figure 4. Anesthesia-induced apoptosis does not substantially affect astrocytes. Representative photomicrograph after a 6-hour exposure to 1.5% isoflurane in a 7-day-old mouse and demonstrating the astroglial cell markers glial fibrillary acidic protein (GFAP) (red, top left), S100β (blue, top right), the apoptotic marker–activated caspase 3 (green, bottom left), and the 3 channels merged (bot- tom right). A very small minority of caspase 3–expressing, apoptotic cells colocalized GFAP and S100β (GFAP+/S100β+, double arrows), unequivocally identifying them as astrocytes. The great majority of GFAP+/S100β+ cells (asterisk) and GFAP−/S100β+ cells (double arrowheads) did not contribute to the pool of apoptotic cells. Some apoptotic, caspase 3–positive cells expressing S100β, but lacking GFAP (single arrow), exhibited a nonastrocytic morphology raising the possibility that they were not astrocytes. The great majority of apoptotic cells were identified as neurons, coexpressing Neuronal Nuclear antigen (not shown) but lacking GFAP as well as S100β (single arrowhead). Scale bar = 20 µm. April 2013 • Volume 116 • Number 4 numbers cautiously. Specifically, an estimation of the number of GAD67-immunoreactive somatic profiles revealed a significant reduction in the density of neurons with labeled soma in anesthesia-treated animals relative to controls. Accordingly, the reduced denominator in anes- thesia-treated animals would bias the observed percen- tile toward overestimating the effect on the total neuronal population, but underestimating the effect on GABAergic neurons. Isoflurane Exposure Reduces GAD67 and GAD65 Expression in GABAergic Interneurons in Superficial Cortex To confirm the observation of reduced GAD67 labeling, con- focal image stacks were collected from visual cortex, and the optical dissector method was used to quantify the number www.anesthesia-analgesia.org 849 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f of GAD67-positive cells, caspase 3–positive cells, and dou- ble-positive cells. After isoflurane exposure, the density of GAD67-immunoreactive cell bodies was reduced in anesthe- sia-treated animals by a factor of 3, relative to unanesthetized, fasted littermates (1.2 ± 0.4 · 103 vs 3.9 ± 0.7 · 103 cells/mm3, P = 0.011). However, in accordance with our other results, the density of all caspase 3–positive cells (both GAD67-positive and -negative) was increased 17-fold in these sections, com- paring anesthesia animals with control (11.2 ± 2.1 · 103 vs 0.66 ± 0.03 · 103 cells/mm3, P = 0.01) (Fig. 6). Enzyme-linked immunosorbent assay results mirrored the immunohistochemical findings. Isoflurane exposure caused a decrease in GAD67 expression compared with control (29.17 ± 11.10 vs 119.21 ± 11.23 ng/mg protein, P < 0.00001). The other isoform of the GABA-synthesizing enzyme, GAD65, was also decreased after anesthesia expo- sure compared with the control group (2.25 ± 0.74 vs 23.03 ± 8.47 ng/mg protein, P = 0.0008), whereas β-actin, a ubiq- uitous isoform of actin, was found to be 24.60 ± 4.60 ng/mg protein (CI 14.0, 35.2) in control animals versus 27.99 ± 3.63 ng/mg protein (CI 19.1, 36.9) in anesthetized animals (P = 0.8432 anesthesia versus control). DISCUSSION Prolonged exposure to the inhaled anesthetic isoflurane has been shown to trigger widespread brain cell death in several in vivo and in vitro neonatal animal models2–9,16–20 and to lead to subsequent long-term neurocognitive impairment,2,4,21 raising serious concerns regarding the safe use of isoflurane and similarly acting drugs in neonates.22–24 Several animal studies have localized cell death to cortical and subcortical gray matter, where the predominant cell types are neurons and glia, and have observed a predilection for the superficial cortical layers, peaking in 7-day-old rodents.2–4 However, the cellular phenotype of susceptible cells has not been immunohistochemically identified and the absolute extent of cell death has not been quantified; instead, previous studies have solely relied on morphological criteria for identification and have described apoptotic cell death as a percentage increase of physiological apoptosis. In this regard, the present study in 7-day-old mice intro- duces 4 key findings. First, the great majority of cortical brain cells, 98%, eliminated immediately after a neonatal exposure to isoflurane were postmitotic neurons, as identified by NeuN expression. Second, isoflurane led to the demise of 2% of all cortical NeuN-positive neurons in layer II/III, a region con- sistently exhibiting substantial apoptosis, which represented an at least 11-fold increase over physiological apoptosis observed in unanesthetized, fasted littermates. Third, despite the disparate rates of apoptosis observed in anesthetized and unanesthetized animals, postmitotic neurons, and not astrocytes, were the predominant affected cell type in both groups. This observation suggests that anesthetic neurotoxic- ity may target the same cell population vulnerable to normal, developmentally regulated cell death. Finally, isoflurane led to neuroapoptosis in a segment of GABAergic interneurons and was associated with a decrease in the expression of the main GABA-synthesizing enzymes, suggesting that isoflu- rane may, at least transiently, interfere with proper inhibitory function in the developing brain. Figure 5. GABAergic interneurons undergo apoptotic cell death after isoflurane exposure in neonatal mice. Representative photomicro- graph illustrating labeling of neocortical cells in layers II/III with the apoptotic marker–activated caspase 3 (green, top), interneuronal marker glutamic acid decarboxylase (GAD)67 (red, middle), and the 2 channels merged (bottom) in a 7-day-old mouse after a 6-hour exposure to 1.5% isoflurane. Colocalization of activated caspase 3 and GAD67 signifies a GABAergic interneuron undergoing apop- totic cell death (arrow), whereas adjacent GAD67-positive cells are seemingly unaffected (arrowheads). The left column represents a 90-degree rotation on the y-axis confirming colocalization of both markers in a single neuron (yellow). Scale bar = 10 µm. Isoflurane Substantially Increases Apoptosis Among Postmitotic Neurons, but Not Astrocytes NeuN is a neuron-specific protein that is found in the nuclei of neuronal cell types of the central nervous system, signify- ing postmigratory status and is absent from glial cells.25 In the murine neocortex, NeuN is first expressed in subplate neu- rons, the first cortical neurons to develop, starting at embry- onic day 17.5 and does not reach adult levels until 16 days postnatally.25,26 Demonstrating that 98% of cells expressing the apoptotic marker caspase 3 also coexpressed the neuro- nal marker NeuN, the present study unequivocally identified the cortical cells primarily affected by cellular death imme- diately after an isoflurane exposure as postmitotic neurons. This finding is somewhat surprising, given the fact that sus- ceptibility to anesthesia-induced, cortical cytotoxicity has historically been found to be limited to very young animals, peaking at postnatal day 7, and dramatically subsiding after 10 days of age in small rodents.27 However, our results extend observations in neonatal rats, demonstrating that isoflurane does not seem to induce cellular death in neuronal progeni- tor cells.28 Nevertheless, given that many susceptible cells were found in the superficial cortical layer II and that mam- malian cortex forms in an inside-out pattern, whereby newly 850 www.anesthesia-analgesia.org ANesthesiA & ANAlgesiA H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f Figure 6. Isoflurane exposure leads to apoptotic cell death in a sig- nificant fraction of GABAergic interneurons as well as to a decrease in the GABAergic neuronal density in neocortex of neonatal mice. Graphical quantification of the differential effects of isoflurane- induced apoptosis (left pie chart, Anesthesia) or natural apoptosis (right, No Anesthesia) on GABAergic, glutamic acid decarboxylase (GAD)67-positive neurons in superficial neocortex of 7-day-old mice after a 6-hour exposure to 1.5% isoflurane or 6 hours of fasting, respectively. Isoflurane induces apoptotic cell death in 28% of GAD67-positive brain cells in layer II/III of neocortex, compared with physiological apoptosis in 2.4% of cells in fasted 7-day-old control mice. However, isoflurane exposure also significantly reduced the density of GAD67-positive neurons, which may lead to an underesti- mation of the affected percentage of GABAergic neurons. *P < 0.01 and †P < 0.02 compared with no anesthesia. generated neurons migrate past the earlier generated cells to form more superficial layers,29 the present findings sug- gest that susceptibility for anesthesia-induced cell death is increased in relatively young, postmitotic neurons. Another startling observation of the present study in post- natal day 7 mice was the dramatically lower rate of cell death, less than 0.5% and 7% of apoptotic cells expressed GFAP and S100β, respectively, observed among astrocytes, which are part of the glial family of brain cells and represent the other large portion of cortical cells. Astrocytes serve to protect, nurture, and support neurons by producing trophic factors, regulate neurotransmitters and ion concentrations, remove toxins and debris, mediate synaptogenesis, and contribute to synapse elimination as well as structural neuronal plastic- ity.30,31 This finding does not exclude that these cells are not involved in neuronal degeneration via proapoptotic signals, such as observed during brain ischemia.32 It is also conceiv- able that astrocytes may undergo more pronounced apoptotic cell death at a later time point compared with neurons, similar to experimental models of brain ischemia.33 Although GFAP is a widely accepted marker for astrocytes, it has also been found to be expressed in some neuronal progenitors.34 S100β is most frequently found in astrocytes, but has also been found in some neurons and oligodendrocytes.33,35 Moreover, some of the S100β-positive cells in our study may have exhibited neu- ronal morphology (Fig. 4); therefore, we cannot exclude that some of these cells may not have been astroglia, which may help explain the apparent overlap in the cell counts. Previous studies in neonatal rats have demonstrated an up to 68-fold increase in apoptotic brain cell death after an isoflurane-based anesthetic exposure.2 However, the absolute percentage of cells affected by this phenomenon remained unknown. Apoptotic cell death is an integral part of normal brain maturation, eliminating 50% to 70% of neurons and progenitor cells during the extent of central nervous system development, which spans over several weeks in small rodents.36,37 Accordingly, at any given time point, only a small fraction of cells undergo physiological apoptotic cell death. In 5-day-old mice, apoptotic cell death has been found to occur in 0.07% of cortical neurons.38 Similarly, the present study observed caspase 3 labeling, a marker for apoptotic cell death, in <0.08% of fasted 7-day-old control mice. Conversely, immediately after a 6-hour exposure to isoflurane, the percentage of neurons undergoing apoptotic cell death increased at least 11-fold to approximately 2% of April 2013 • Volume 116 • Number 4 all neurons in the superficial layers of visual cortex. This region was selected for quantification because anesthesia- induced cell loss has repeatedly exhibited a substantial predilection for cells in superficial neocortex. Other less- susceptible brain regions not examined here would likely demonstrate a lower percentage of apoptotic cells. The long-term effects of the elimination of up to 2% of neurons in neocortex and other brain regions on subsequent brain structure and function remain speculative. The tem- porary increase in neuroapoptosis observed here could pos- sibly be offset by increased subsequent neurogenesis, similar to observations after postnatal hypoxia,39 or by subsequent decreases in naturally occurring apoptosis. The number of neocortical neurons peaks in 16-day-old mice and decreases by 30% thereafter,26 suggesting that the developing mouse brain may have sufficient reserve capacity to absorb a 2% neuronal loss. Consistent with this interpretation, a previous study by our group did not detect a significant decrease in adult corti- cal neuronal density after a similar neonatal isoflurane expo- sure,3 although a 2% reduction would be difficult to detect even with the most robust cell-counting techniques. Neurocognitive abnormalities were also absent in these animals, again suggest- ing that any deficits, if present, are subtle.3 However, the small quantity of the eliminated brain cells does not exclude the pos- sibility of long-term network disruptions, because loss of even a small number of neurons with important function or during critical periods for brain development may have a significant impact on the subsequent development of neural networks. Isoflurane Exposure Leads to Apoptotic Cell Death in GABAergic Interneurons and to Decreased Expression of GAD65 and GAD67 GABA, the main inhibitory neurotransmitter in the central nervous system, is synthesized by 2 isoforms of the enzyme GAD, which are located on 2 different genes and demonstrate dissimilar location and function.40 GAD67, the predominant isoform responsible for >90% of GABA production, is located in the cytosol, and thought to function as a trophic factor,41 whereas GAD65 is located at the nerve terminals, specifically responding to short-term demands for GABA, such as during neurotransmission.42 GAD67 immunohistochemistry revealed a 12-fold increase in the number of caspase 3/GAD67 double- positive cells in anesthesia-exposed animals. This finding sug- gests that isoflurane leads to the demise of a significant amount of GABAergic neurons immediately after exposure, as also www.anesthesia-analgesia.org 851 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f recently observed in newborn rats.43 Similarly, exposure to other GABA agonists, muscimol and propofol have also been previ- ously found to induce GABAergic neuronal death in immature rat telencephalon cultures.44 More mature cells treated with these GABA agonists, however, were less vulnerable to long- term effects, suggesting that susceptibility is age-dependent.44 In the present study, prolonged exposure to isoflurane led to a significant decrease in both isoforms of the GABA- synthesizing enzyme. These reductions in GAD expres- sion could be explained by either isoflurane-induced neuronal cell death of GAD-containing (i.e., GABAergic) neurons or by a drug-induced downregulation or cleav- age of the enzyme. Although the present study found a 12-fold increase in the number of apoptotic GABAergic neurons after isoflurane exposure, potentially explaining the observed reduction in GAD expression, the disparate reductions in the 2 GAD isoforms, by 50% for GAD67 and by >90% for GAD65, suggest that exposure to anesthesia might have additional functional effects, beyond cell death, on GABAergic interneurons. Previous findings of decreased GAD enzyme activity after treatment with the GABAA agonists vigabatrin, propofol, and muscimol support this hypothesis.44,45 This downregulation could be explained by an isoflurane-induced, excitotoxic cleavage of GAD65 and GAD67, as previously reported in cultured hippocampal GABAergic neurons.46 Regardless of the mechanism, given the fact that interneurons comprise 12% to 15% of all corti- cal neurons in adult rodents,47 the permanent loss of even a small number of GABAergic interneurons or prolonged interference with their function could potentially have pro- found effects on the normal balance of excitation and inhibi- tion in the developing brain. Given the anesthesia-induced alterations in GAD expression, however, the absolute frac- tion of GABAergic neurons eliminated during isoflurane exposure is difficult to assess, because both the numera- tor, the number of surviving GABAergic neurons, and the denominator in this equation, GAD67 expression, changed. Because astrocytes are also a source for GABA and con- tain GAD67,48 we cannot exclude that glia may have had a role in the observed changes in GAD expression. However, converging lines of evidence lead us to believe that the anes- thesia-induced reduction in GAD expression observed in our experiments was predominantly mediated by neurons, rather than astrocytes. First, we found that both GAD67 and GAD65 expressions were decreased after anesthetic exposure; the combination of GAD65 and GAD67 is only expressed in neurons, whereas astrocytes have only been shown to express GAD67.48 Second, although some GAD67–positively stained cells could have been astrocytes, it is more likely that they were GABAergic neurons, because cellular apoptosis over- whelmingly affected cells expressing the neuronal marker NeuN, and to a much lesser degree the astroglial markers GFAP or S100β, suggesting that alterations in GAD expression may have also predominantly occurred in neurons. Human applicability of the present findings in animals remains unresolved. Although histopathological studies cannot be performed in healthy children after exposure to general anesthetics, several epidemiological studies have returned conflicting results. Some have detected an association between exposure to anesthesia and surgery early in life and subsequent behavioral or learning abnormalities,49,50 whereas others have not observed any deleterious effects in children exposed to anesthetics and sedatives during vulnerable periods in their brain development.51–53 The present study used clinically relevant doses of isoflurane, approximating 0.6 minimum alveolar concentration,8 for a relatively long exposure period, which may be outside of the normal clinical practice, to create a measurable effect, because the injury is exposure time– dependent and dose-dependent.9 The maturational stage of the human brain equivalent to the mice used in the present study remains controversial; older data suggest that postnatal day 7 mice are comparable to human infants,54 whereas more contemporary studies indicate mouse brain development at this stage to be closer to human fetuses at midgestation.55 In conclusion, a 6-hour exposure to clinical doses of iso- flurane increased neuronal apoptotic cell death in 7-day- old mice, killing approximately 2% of cortical neurons, of which some were identified as GABAergic interneurons. Conversely, astrocytes were substantially less affected by iso- flurane exposure at this age. Moreover, isoflurane exposure dramatically decreased expression of both isoforms of the GABA-synthesizing enzyme GAD, which indicates that the anesthetic drug may interfere with proper inhibitory function in the developing brain. The permanence of these findings, however, remains unknown. Additional studies will need to identify the phenomenon’s selectivity and molecular mecha- nisms to determine its applicability to pediatric anesthesia. E APPENDIX Supplemental Figure 1. Significantly higher rate of neuronal apop- tosis observed in isoflurane-exposed animals compared with unanesthetized littermates. Cumulative probability curves using the Poisson distribution of rare events and depicting the number of apoptotic neurons (NeuN+/caspase 3+ cells) per 400 neurons (NeuN+ cells) for 7-day-old mice exposed to 1.5% isoflurane for 6 hours (filled circles) or fasted in room air (filled squares). The event rate λ was normalized to 400 NeuN+ cells, the lower end of the num- ber of cells counted in each animal, to avoid extrapolation. Graphs were calculated using the MATLAB® (MathWorks, Natick, MA) func- tion [lambdahat,lambdaci] = poissfit(data,alpha) in an iterative man- ner. The vector ‘data’ represented the number of events per 400 counted NeuN+ cells for each animal in the group of interest and alpha was the confidence interval. The output was used to construct a cumulative probability curve for the Poisson mean event rate for both treatment groups. 852 www.anesthesia-analgesia.org ANesthesiA & ANAlgesiA H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f DISCLOSURES Name: George K. Istaphanous, MD. Contribution: This author helped design the study, conduct the study, analyze the data, and write the manuscript. Attestation: George K. Istaphanous has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: Christopher G. Ward, MD. Contribution: This author helped conduct the study. Attestation: Christopher G. Ward has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: Xinyu Nan, BS. Contribution: This author helped conduct the study. Attestation: Xinyu Nan has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: Elizabeth A. Hughes, BS. Contribution: This author helped conduct the study. Attestation: Elizabeth A. Hughes has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: John C. McCann, BS. Contribution: This author helped conduct the study. Attestation: John C. McCann has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: John J. McAuliffe, MD, MBA. Contribution: This author helped analyze the data and write the manuscript. Attestation: John J. McAuliffe has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: Steve C. Danzer, PhD. Contribution: This author helped design the study and write the manuscript. Attestation: Steve C. Danzer has seen the original study data, reviewed the analysis of the data, and approved the final manuscript. Name: Andreas W. Loepke, MD, PhD. Contribution: This author helped design the study, conduct the study, analyze the data, and write the manuscript. Attestation: Andreas W. Loepke has seen the original study data, reviewed the analysis of the data, approved the final manuscript, and is the author responsible for archiving the study files. This manuscript was handled by: Gregory J. Crosby, MD. REFERENCES 1. DeFrances CJ, Cullen KA, Kozak LJ. National Hospital Discharge Survey: 2005 annual summary with detailed diagno- sis and procedure data. Vital Health Stat 2007;13:1–209 2. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Early expo- sure to common anesthetic agents causes widespread neurode- generation in the developing rat brain and persistent learning deficits. J Neurosci 2003;23:876–82 3. Loepke AW, Istaphanous GK, McAuliffe JJ III, Miles L, Hughes EA, McCann JC, Harlow KE, Kurth CD, Williams MT, Vorhees CV, Danzer SC. The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and mem- ory. Anesth Analg 2009;108:90–104 April 2013 • Volume 116 • Number 4 4. Stratmann G, May LD, Sall JW, Alvi RS, Bell JS, Ormerod BK, Rau V, Hilton JF, Dai R, Lee MT, Visrodia KH, Ku B, J, Firouzian A. Effect of Zusmer EJ, Guggenheim hypercarbia and isoflurane on brain cell death and neurocog- nitive dysfunction in 7-day-old rats. Anesthesiology 2009;110: 849–61 5. Brambrink AM, Evers AS, Avidan MS, Farber NB, Smith DJ, Zhang X, Dissen GA, Creeley CE, Olney JW. Isoflurane- induced neuroapoptosis in the neonatal rhesus macaque brain. Anesthesiology 2010;112:834–41 6. Rizzi S, Ori C, Jevtovic-Todorovic V. Timing versus dura- tion: determinants of anesthesia-induced developmental apoptosis in the young mammalian brain. Ann NY Acad Sci 2010;1199:43–51 7. Lemkuil BP, Head BP, Pearn ML, Patel HH, Drummond JC, Patel PM. Isoflurane neurotoxicity is mediated by p75NTR- RhoA activation and actin depolymerization. Anesthesiology 2011;114:49–57 8. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, McAuliffe JJ, Danzer SC, Loepke AW. Comparison of the neu- roapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 2011;114:578–87 9. Johnson SA, Young C, Olney JW. Isoflurane-induced neuro- apoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 2008;20:21–8 10. Henschel O, Gipson KE, Bordey A. GABAA receptors, anes- thetics and anticonvulsants in brain development. CNS Neurol Disord Drug Targets 2008;7:211–24 11. Paxinos G, Franklin KB. The Mouse Brain in Stereotaxic Coordinates. 2nd ed. San Diego: Academic Press, 2001 12. West MJ, Slomianka L, Gundersen HJ. Unbiased stereological estimation of the total number of neurons in the subdivisions of the rat hippocampus using the optical fractionator. Anat Rec 1991;231:482–97 13. West MJ. Stereological methods for estimating the total number of neurons and synapses: issues of precision and bias. Trends Neurosci 1999;22:51–61 14. Graham PL, Mengersen K, Morton AP. Confidence limits for the ratio of two rates based on likelihood scores: non-iterative method. Stat Med 2003;22:2071–83 15. Rothman KJ, Greenland S. Modern Epidemiology. 2nd ed. Philadelphia: Lippincott-Raven, 1998 16. Wei H, Kang B, Wei W, Liang G, Meng QC, Li Y, Eckenhoff RG. Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently. Brain Res 2005;1037:139–47 17. Wise-Faberowski L, Zhang H, Ing R, Pearlstein RD, Warner DS. Isoflurane-induced neuronal degeneration: an evalua- tion in organotypic hippocampal slice cultures. Anesth Analg 2005;101:651–7 18. Wei H, Liang G, Yang H. Isoflurane preconditioning inhib- ited isoflurane-induced neurotoxicity. Neurosci Lett 2007;425: 59–62 19. Ma D, Williamson P, Januszewski A, Nogaro MC, Hossain M, Ong LP, Shu Y, Franks NP, Maze M. Xenon mitigates isoflurane- induced neuronal apoptosis in the developing rodent brain. Anesthesiology 2007;106:746–53 20. Head BP, Patel HH, Niesman IR, Drummond JC, Roth DM, Patel PM. Inhibition of p75 neurotrophin receptor attenuates isoflurane-mediated neuronal apoptosis in the neonatal central nervous system. Anesthesiology 2009;110:813–25 21. Stratmann G, Sall JW, May LD, Bell JS, Magnusson KR, Rau V, Visrodia KH, Alvi RS, Ku B, Lee MT, Dai R. Isoflurane dif- ferentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology 2009;110:834–48 22. Jevtovic-Todorovic V, Olney JW. PRO: anesthesia-induced developmental neuroapoptosis—status of the evidence. Anesth Analg 2008;106:1659–63 23. Loepke AW, McGowan FX Jr, Soriano SG. CON: the toxic effects of anesthetics in the developing brain: the clinical perspective. Anesth Analg 2008;106:1664–9 www.anesthesia-analgesia.org 853 24. Loepke AW. Developmental neurotoxicity of sedatives and anesthetics: a concern for neonatal and pediatric critical care medicine? Pediatr Crit Care Med 2010;11:217–26 42. Erlander MG, Tobin AJ. The structural and functional heteroge- neity of glutamic acid decarboxylase: a review. Neurochem Res 1991;16:215–26 H o 4 X M 0 h C y w C X 1 A W n Y Q p / I l i Q H D 3 3 D 0 O d R y 7 T v S F 4 C f 3 V C 4 / O A V p D D a 8 K K G K V 0 Y m y + 7 8 = o n r i i l 1 1 / 2 0 / 2 0 2 3 D o w n o a d e d l f r o m h t t p : / / j o u r n a s . l l w w . c o m / a n e s t h e s a - a n a g e s a i l b y B h D M f 5 e P H K a v 1 z E o u m 1 t Q N 4 a + k J L h E Z g b s I f 25. Mullen RJ, Buck CR, Smith AM. NeuN, a neuronal specific nuclear protein in vertebrates. Development 1992;116:201–11 26. Lyck L, Krøigård T, Finsen B. Unbiased cell quantification reveals a continued increase in the number of neocortical neurones during early post-natal development in mice. Eur J Neurosci 2007;26:1749–64 27. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V. Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience 2005;135:815–27 28. Sall JW, Stratmann G, Leong J, McKleroy W, Mason D, Shenoy S, Pleasure SJ, Bickler PE. Isoflurane inhibits growth but does not cause cell death in hippocampal neural precursor cells grown in culture. Anesthesiology 2009;110:826–33 29. Rakic P. Mode of cell migration to the superficial layers of fetal monkey neocortex. J Comp Neurol 1972;145:61–83 30. Aschner M, Sonnewald U, Tan KH. Astrocyte modulation of neurotoxic injury. Brain Pathol 2002;12:475–81 31. Stevens B. Neuron-astrocyte signaling in the development and plasticity of neural circuits. Neurosignals 2008;16:278–88 32. Anderson MF, Blomstrand F, Blomstrand C, Eriksson PS, Nilsson M. Astrocytes and stroke: networking for survival? Neurochem Res 2003;28:293–305 33. Yu AC, Wong HK, Yung HW, Lau LT. Ischemia-induced apop- tosis in primary cultures of astrocytes. Glia 2001;35:121–30 34. Yang Q, Hamberger A, Khatibi N, Stigbrand T, Haglid KG. Presence of S-100 beta in cholinergic neurones of the rat hind- brain. Neuroreport 1996;7:3093–9 35. Vives V, Alonso G, Solal AC, Joubert D, Legraverend C. Visualization of S100B-positive neurons and glia in the cen- tral nervous system of EGFP transgenic mice. J Comp Neurol 2003;457:404–19 36. Oppenheim RW. Cell death during development of the nervous system. Annu Rev Neurosci 1991;14:453–501 37. Rakic S, Zecevic N. Programmed cell death in the developing human telencephalon. Eur J Neurosci 2000;12:2721–34 38. Hodge RD, D’Ercole AJ, O’Kusky JR. Insulin-like growth fac- tor-I (IGF-I) inhibits neuronal apoptosis in the developing cere- bral cortex in vivo. Int J Dev Neurosci 2007;25:233–41 39. Fagel DM, Ganat Y, Silbereis J, Ebbitt T, Stewart W, Zhang H, Ment LR, Vaccarino FM. Cortical neurogenesis enhanced by chronic perinatal hypoxia. Exp Neurol 2006;199:77–91 40. Buddhala C, Hsu CC, Wu JY. A novel mechanism for GABA synthesis and packaging into synaptic vesicles. Neurochem Int 2009;55:9–12 41. Kanaani J, Kolibachuk J, Martinez H, Baekkeskov S. Two dis- tinct mechanisms target GAD67 to vesicular pathways and pre- synaptic clusters. J Cell Biol 2010;190:911–25 43. Zhou ZW, Shu Y, Li M, Guo X, Pac-Soo C, Maze M, Ma D. The glutaminergic, GABAergic, dopaminergic but not cholinergic neurons are susceptible to anaesthesia-induced cell death in the rat developing brain. Neuroscience 2011;174:64–70 44. Honegger P, Pardo B, Monnet-Tschudi F. Muscimol-induced death of GABAergic neurons in rat brain aggregating cell cul- tures. Brain Res Dev Brain Res 1998;105:219–25 45. Honegger P, Matthieu JM. Selective toxicity of the general anes- thetic propofol for GABAergic neurons in rat brain cell cultures. J Neurosci Res 1996;45:631–6 46. Baptista MS, Melo CV, Armelão M, Herrmann D, Pimentel DO, Leal G, Caldeira MV, Bahr BA, Bengtson M, Almeida RD, Duarte CB. Role of the proteasome in excitotoxicity-induced cleavage of glutamic acid decarboxylase in cultured hippocam- pal neurons. PLoS One 2010;5:e10139 47. Beaulieu C. Numerical data on neocortical neurons in adult rat, with special reference to the GABA population. Brain Res 1993;609:284–92 48. Lee M, Schwab C, McGeer PL. Astrocytes are GABAergic cells that modulate microglial activity. Glia 2011;59:152–65 49. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, Gleich SJ, Schroeder DR, Weaver AL, Warner DO. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 2009;110: 796–804 50. DiMaggio C, Sun LS, Li G. Early childhood exposure to anes- thesia and risk of developmental and behavioral disorders in a sibling birth cohort. Anesth Analg 2011;113:1143–51 51. Rozé JC, Denizot S, Carbajal R, Ancel PY, Kaminski M, Arnaud C, Truffert P, Marret S, Matis J, Thiriez G, Cambonie G, André M, Larroque B, Bréart G. Prolonged sedation and/or analge- sia and 5-year neurodevelopment outcome in very preterm infants: results from the EPIPAGE cohort. Arch Pediatr Adolesc Med 2008;162:728–33 52. Bartels M, Althoff RR, Boomsma DI. Anesthesia and cognitive performance in children: no evidence for a causal relationship. Twin Res Hum Genet 2009;12:246–53 53. Guerra GG, Robertson CM, Alton GY, Joffe AR, Cave DA, Dinu IA, Creighton DE, Ross DB, Rebeyka IM; Western Canadian Complex Pediatric Therapies Follow-up Group. Neurodevelopmental outcome following exposure to sedative and analgesic drugs for complex cardiac surgery in infancy. Paediatr Anaesth 2011;21:932–41 54. Dobbing J, Sands J. Quantitative growth and development of human brain. Arch Dis Child 1973;48:757–67 55. Clancy B, Darlington RB, Finlay BL. Translating developmental time across mammalian species. Neuroscience 2001;105:7–17 854 www.anesthesia-analgesia.org ANesthesiA & ANAlgesiA",mice,['METHODS: Seven-day-old littermates (n = 36) were randomly assigned to a 6-hour exposure to either 1.5% isoflurane or fasting in room air.'],postnatal day 7,['METHODS: Seven-day-old littermates (n = 36) were randomly assigned to a 6-hour exposure to either 1.5% isoflurane or fasting in room air.'],N,[],isoflurane,['METHODS: Seven-day-old littermates (n = 36) were randomly assigned to a 6-hour exposure to either 1.5% isoflurane or fasting in room air.'],none,[],c57bl/6,['Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12- hour light-dark cycle at 22°C with free access to food and water.'],The study addresses the characterization and quantification of isoflurane-induced developmental apoptotic cell death in neonatal mouse cerebral cortex.,"['However, neither the identity of dying cortical cells nor the extent of cortical cell loss has been sufficiently characterized.']",The study uses immunohistochemical identification and quantification of apoptotic death in neonatal mouse cortex.,['We conducted the present study to immunohistochemically identify the dying cells and to quantify the fraction of cells undergoing apoptotic death in neonatal mouse cortex.'],The article argues the impact of findings in terms of the potential neurotoxic effects of isoflurane on neonatal animals and the implications for pediatric anesthesia.,['The clinical relevance of these findings in animals remains to be determined.'],None,[],None,[],True,True,True,True,True,False,10.1213/ANE.0b013e318281e988 10.1016/j.bja.2018.04.034,740.0,Ju,2018,rats,postnatal day 5,Y,sevoflurane,none,sprague dawley,"British Journal of Anaesthesia, 121 (2): 406e416 (2018) doi: 10.1016/j.bja.2018.04.034 Advance Access Publication Date: 5 June 2018 Neuroscience and Neuroanaesthesia Role of epigenetic mechanisms in transmitting the effects of neonatal sevoflurane exposure to the next generation of male, but not female, rats L.-S. Ju1, J.-J. Yang1, T. E. Morey1, N. Gravenstein1,2, C. N. Seubert1, J. L. Resnick3, J.-Q. Zhang4 and A. E. Martynyuk1,2,* 1Department of Anesthesiology, University of Florida College of Medicine, Gainesville, FL, USA, 2The McKnight Brain Institute, University of Florida College of Medicine, Gainesville, FL, USA, 3Department of Molecular Genetics and Microbiology, University of Florida College of Medicine, Gainesville, FL, USA and 4Department of Anesthesiology, Zhengzhou University, Zhengzhou, China Corresponding author. E-mail: amartynyuk@anest.ufl.edu This article is accompanied by an editorial: A poisoned chalice: the heritage of parental anaesthesia exposure by Vutskits et al., Br J Anesth 2018:121:337e339, doi: 10.1016/j.bja.2018.05.013. Abstract Background: Clinical studies report learning disabilities and attention-deficit/hyperactivity disorders in those exposed to general anaesthesia early in life. Rats, primarily males, exposed to GABAergic anaesthetics as neonates exhibit behav- ioural abnormalities, exacerbated responses to stress, and reduced expression of hypothalamic K (Kcc2). The latter is implicated in development of psychiatric disorders, including male predominant autism spectrum disorders. We tested whether parental early life exposure to sevoflurane, the most frequently used anaesthetic in pae- diatrics, affects the next generation of unexposed rats. Methods: Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations. Results: Male, but not female, progeny of sevoflurane-exposed parents exhibited abnormalities in behavioural testing and Kcc2 expression. Male F1 rats of both exposed parents exhibited impaired spatial memory and expression of hip- pocampal and hypothalamic Kcc2. Offspring of only exposed sires had abnormalities in elevated plus maze and prepulse inhibition of startle, but normal spatial memory and impaired expression of hypothalamic, but not hippocampal, Kcc2. In contrast to exposed F0, their progeny exhibited normal corticosterone responses to stress. Bisulphite sequencing revealed increased CpG site methylation in the Kcc2 promoter in F0 sperm and F1 male hippocampus and hypothalamus that was in concordance with the changes in Kcc2 expression in specific F1 groups. Conclusions: Neonatal exposure to sevoflurane can affect the next generation of males through epigenetic modification of Kcc2 expression, while F1 females are at diminished risk. þ (cid:2) (cid:2) 2Cl Cl Keyword: anesthesia; DNA methylation; heredity; neurodevelopmental disorders; pediatrics Editorial decision: 2 May 2018; Accepted: 2 May 2018 © 2018 British Journal of Anaesthesia. Published by Elsevier Ltd. All rights reserved. For Permissions, please email: permissions@elsevier.com exporter 406 Editor’s key points (cid:5) Early exposure to general anaesthetics can result in persistent cognitive dysfunction in adult animals, but effects on their offspring are unknown. (cid:5) Offspring of rats exposed to sevoflurane as neonates were investigated for behavioural abnormalities, changes in brain gene expression and deoxyribonucleic acid methylation in the genes’ promoters. (cid:5) Adult male, but not female, progeny of rats neonatally exposed to sevoflurane exhibited abnormalities in epigenetic regulation, gene expression and behaviour. Most retrospective epidemiological studies of neurocognitive function in older children who had general anaesthesia early in life have found significant deficiencies.1 Considering the compelling animal data, the US Food and Drug Administration recommended avoiding, when possible, anaesthesia in chil- dren <3 yr old, and emphasised the pressing need for further research.2 The full range of neonatal anaesthesia-induced abnormalities, the mechanisms involved, and the role of sex remain poorly understood even in exposed animals.3 We have found that rats exposed as neonates to sevoflurane, propofol, or etomidate, anaesthetics with clinically important effects on GABA type A receptors (GABAAR), exhibit behavioural deficiencies and exacerbated hypothalamic-pituitary adrenal (HPA) axis responses to stress.4e8 These anaesthetic-induced abnormalities are greater in male rats and reminiscent of those induced by excessive postnatal stress.9e11 Anaesthetic- enhanced GABAAR signalling, which is depolarising/stimula- tory during early life because of a high Na (NKCC1)/ co-transporter ratio,12e14 could play an K important role in initiating and mediating these abnormalities. Thus, NKCC1 inhibition before anaesthesia was protective, whereas anaesthetised neonatal rats had hypothalamic upre- gulated Nkcc1 and downregulated Kcc2 messenger ribonucleic acid (mRNA) concentrations even in adulthood.7,8 þ þ (cid:2) K 2Cl þ (cid:2) (cid:2) 2Cl (KCC2) Cl During the second postnatal week, GABAAR-mediated neuronal signalling undergoes a fundamental transition from predominantly depolarising/stimulatory to inhibitory caused by concomitant developmental downregulation of NKCC1 and, most importantly, upregulation of neuron-specific KCC2. This shift is brain region- and sex-dependent, occurring earlier in females.12e14 Anaesthetic-induced delay in the developmental NKCC1/KCC2 ratio maturation could have serious conse- quences for brain functioning as delay/impairment in NKCC1/ KCC2 ratio maturation has been linked to neuropsychiatric disorders, including autism spectrum disorders (ASD) and schizophrenia, which predominate in males.15e17 A growing number of studies point to co-occurrence of ASD and attention-deficit/hyperactivity disorder (ADHD). Thus, 50e70% of those with ASD exhibit ADHD symptoms, whereas 15e25% of children with ADHD have symptoms of ASD.18 Importantly, clinical studies report significant increases in ADHD in those who had medical procedures early in life that required expo- sure to general anaesthesia, with repeated exposures being a prognostic factor for more severe outcome.2 Recent studies in rodents demonstrate that the develop- mental effects of excessive stress early in life can be carried to the next generation or beyond, presumably by epigenetic mechanisms such as non-coding RNAs and deoxyribonucleic Multigenerational developmental effects of sevoflurane - 407 acid (DNA) methylation.19e21 We have found that rats exposed as neonates to sevoflurane exhibited increased expression of hippocampal DNA methyltransferases, in addition to abnor- malities at the synaptic and behavioural levels.22 These en- zymes catalyse DNA methylation at the 5 position of cytosine residues adjacent to guanines (CpG sites), typically leading to long-term transcriptional repression. To investigate whether neonatal exposure to sevoflurane affects exposed parents and their unexposed progeny, neonatal male and female rats were exposed to 6 h of anaesthesia with sevoflurane, and their progeny were tested for inherited behavioural and molecular alterations. 0 Methods Animals All experimental procedures were approved by the University of Florida Institutional Animal Care and Use Committee. Sprague-Dawley rats were housed under controlled illumina- tion (12-h light/dark, lights on at 7:00AM) and temperature (23e24 C) with free access to food and water. Within 24 h of delivery, litters were culled to 12 pups. At 21 postnatal days (P21), pups were weaned and housed in sex-matched groups of two for the rest of the study. (cid:3) Treatment groups The P5 male and female rat pups were kept in a temperature- controlled chamber (37ºC) with a continuous supply of 30% (cid:2)1) during anaesthesia with 6 vol% oxygen in air (1.5 L min sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group). Previously, we have shown that blood glucose and gas levels after 2.1% sevo- flurane for 6 h were in the normal range.4 Control F0 animals were subjected to animal facility rearing only (control group). The F0 male and female rats were sequentially evaluated on the elevated plus maze (EPM) starting on P60, for prepulse inhibition (PPI) of the acoustic startle response on P70, and for corticosterone responses to physical restraint for 30 min on (cid:4)P160 followed by isolation of brain and gamete tissue sam- ples for further analyses (Fig. 1). Twenty-four F0 males and 24 females were mated on ~P90 to produce the F1 generation. F0 breeders were randomised into one of the following four groups for mating: 1) control malesþcontrol females (con- M*con-F); 2) exposed malesþcontrol females (sevo-M*con-F); 3) control malesþexposed females (con-M*sevo-F); and 4) exposed malesþexposed females (sevo-M*sevo-F). The female was kept alone throughout the entire gestation and post- partum rearing periods. The F1 rats, 144 in total [n¼18 per sex (two) per group (four)], which were subjected to facility rearing only, were evaluated in the EPM starting on P60, PPI of startle on P70, Morris water maze (MWM) testing starting on P79, and for the corticosterone responses to restraint for 30 min on (cid:4)P90, followed by isolation of brain tissue samples for further analyses. A separate cohort of F1 rats was sacrificed on P5 to collect brain tissue for bisulphite sequencing. Basal and stress-induced activity of the HPA axis Blood samples (~300 mL) were collected at rest and 10, 60, and 120 min after the restraint, as previously described.7 Serum corticosterone was measured using commercial ELISA kits (Cayman Chemical Company, Ann Arbor, MI, USA) following the manufacturer’s instructions.7,8 408 - Ju et al. Fig 1. Study design. EPM, elevated plus maze; PPI, prepulse inhibition; MWM, Morris water maze. Behavioural tests The EPM, acoustic startle response, PPI of startle, and MWM tests were performed as previously described.4e8 Tissue collection vector with the TOPO TA cloning kit for sequencing (Life Technologies, Carlsbad, CA, USA). Miniprep was performed on each positive clone using ZR Plasmid Miniprep kit (Zymo Research). Sanger sequencing was done by Genewiz (South Plainfield, NJ, USA) using M13R primers. The DNA methylation status of all CpG sites was analysed using Benchling Molecular Biology 2.0 Software (Benchling, San Francisco, CA, USA). Adult rats were anaesthetised with sevoflurane and decapi- tated. Whole brains were removed and immediately put in a stainless steel adult rat brain slicer matrix with 0.5 mm coro- nal section slice intervals (Zivic Instruments, Pittsburgh, PA, USA). Hypothalamic paraventricular nucleus (PVN) tissue was punched out with a 1-mm ID glass capillary tube. The hippo- campus was isolated from the respective slices. Tissues were placed in vials filled with RNAlater solution (Invitrogen, Carlsbad, CA, USA) and stored at (cid:2)80 C. Sperm were isolated from the caudal epididymis of adult males and stored at (cid:2)80 C. After separation from the adipose tissues, ovaries were stored at (cid:2)80(cid:3)C. (cid:3) (cid:3) Analyses of mRNA levels for Nkcc1, Kcc2, and glucocorticoid receptors (Gr) The mRNA levels for Nkcc1, Kcc2 in the PVN of the hypothala- mus and hippocampus, and for Gr in the hippocampus were analysed via qRTePCR as previously described.7,8 Bisulphite sequencing Genomic DNA was extracted from the sperm pellet and ovaries of adult F0 rats and from hippocampal and hypotha- lamic tissues of P5 F1 rats using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany). The sodium bisulfite conversion was performed with EZ DNA Methylation kits (Zymo Research, Irvine, CA, USA) following the manufacturer’s instructions. The primers (Nkcc1: forward: GAGAGGAGTTTATAGGGTT; reverse: AACCCTAC(A/G)CTAACCAACCTC; Kcc2: forward: GATTGTAAGTGTTTTTATTATTGAGTTGTATATT; reverse: AATAAACTTTTCCCCTTTTATACCC) were designed for the bisulfite-converted DNA sequences, using previously pub- lished sequences.23,24 PCR amplification was performed with HotStar Taq (Qiagen). Amplicons were cloned into pCR4-TOPO Statistical analysis Values are reported as mean (standard deviation). Statistical analyses were carried out on raw data using SigmaPlot 13.0 software (Systat Software, Inc., San Jose, CA, USA). To assess differences in total corticosterone concentration, EPM behav- iour and gene expression for Nkcc1, Kcc2, and Gr, t-test and one way analysis of variance (ANOVA) were used for F0 and F1 generations, respectively. Two way ANOVA with experimental groups and time as the independent variables was run to analyse changes in serum corticosterone concentrations at rest and at three time points after the restraint. Two way ANOVA was used to analyse the PPI data, with the treatment and prepulse intensity as independent variables, and the MWM latencies to escape data, with experimental groups and days of training as the independent variables. One-way ANOVA was used to analyse time spent in the target quad- rant and numbers of crossings during the MWM probe test. Two way measures ANOVA with treatment as ‘between’- subject factor and CpG site as ‘within’-subject factor was used to analyse the frequency methylation of CpG sites. Multiple pairwise comparisons were done with the Holm-Sidak method. All comparisons were run as two-tailed tests. A P value <0.05 was considered significant. The sample sizes in this study were based on previous experience with the same experimental techniques.6-8 Results Neuroendocrine and behavioural abnormalities in F0 rats Adult F0 rats, exposed to sevoflurane as neonates, had significantly higher total corticosterone responses to restraint Multigenerational developmental effects of sevoflurane - 409 stress compared with F0 controls [males, t(8)¼(cid:2)8.09, P<0.001; and females, t(8)¼(cid:2)3.05, P¼0.015]. These increases in cortico- sterone responses were because of higher concentrations of corticosterone 10 min after restraint (P<0.001, males, Fig. 2a and b; and P<0.001, females, Fig. 2c and d). The F0 male rats, exposed to sevoflurane as neonates, spent a shorter time in open arms [t(20)¼2.67, P¼0.015, Fig. 2e] and travelled shorter distances during the EPM test [t(20)¼2.27, P¼0.034, Fig. 2f]. In F0 females, there was no significant between-subjects effect of neonatal sevoflurane exposure on time spent in open arms and distance travelled during the EPM test (Fig. 2g and h). There were significant effects of neonatal exposure to sevoflurane on PPI of startle in adult F0 rats [F(1,66)¼14.80, P<0.001, males, Fig. 2i; and F(1,66)¼9.13, P¼0.004, females, Fig. 2j]. Startle stimuli by themselves caused similar responses in the control and sevoflurane groups of F0 male and female rats. Hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios in F0 rats The F0 male rats from the sevoflurane group had increased Nkcc1 mRNA levels [t(11)¼(cid:2)3.29, P¼0.007, Fig. 3a] and decreased Kcc2 mRNA levels [t(11)¼2.24, P¼0.047, Fig. 3b] in the PVN of the hypothalamus, resulting in significantly increased Nkcc1/Kcc2 mRNA ratios [t(11)¼(cid:2)6.97, P<0.001, Fig. 3c]. The F0 female rats from the sevoflurane group had increased Nkcc1 mRNA levels [t(10)¼(cid:2)2.91, P¼0.016, Fig. 3d], but not significantly altered Kcc2 mRNA levels (Fig. 3e) in the PVN of the hypothalamus. Still, the resulting Nkcc1/Kcc2 mRNA ratios in sevoflurane exposed F0 females were increased [t(10)¼(cid:2)3.17, P¼0.01, Fig. 3f]. In the hippocampus of F0 male rats from the sevoflurane group, only Kcc2 mRNA levels were reduced [t(10)¼4.17, P¼0.002, Fig. 3h]. Overall, changes in hippocampal Kcc2 mRNA and Nkcc1 mRNA resulted in an increased Nkcc1/Kcc2 mRNA ratio in F0 males [t(10)¼(cid:2)3.27, P¼0.008, Fig. 3i]. In contrast, hippocampal mRNA Fig 2. Adult F0 rats, exposed to sevoflurane on postnatal Day 5, exhibited exacerbated corticosterone responses to physical restraint for 30 min, impaired behaviour in the elevated plus maze (EPM) and reduced prepulse inhibition (PPI) of startle. Shown are the respective concentrations of serum corticosterone across each collection point, and the total corticosterone response in male (a, b) and female (c, d) rats. To assess differences in total corticosterone concentrations, area under the curve in respect to ground (concentrations of cortico- sterone at rest were taken as a ground), was calculated. Data are means [standard deviation (SD)] from five rats per treatment group. (eeh) Shown are time (%) spent in open arms of the EPM and distance travelled by male (e, f) and female (g, h) rats. Data are means (SD) from 11 male and 12 female rats per treatment group. (i, j) Shown are %PPI responses in male (i) and female (j) rats. Data are means (SD) from 12 rats per treatment group. Colour coding in (eeh) is applicable to all figures. *P<0.05 vs control. 410 - Ju et al. þ þ (cid:2) þ (cid:2) (Kcc2) and glucocorticoid receptors (Gr) in the paraventricular nucleus (PVN) of the Fig 3. Gene expression of Na hypothalamus and hippocampus of adult F0 rats, exposed to sevoflurane on postnatal Day 5. Shown are the respective levels of Nkcc1 messenger ribonucleic acid (mRNA), Kcc2 mRNA and the resulting Nkcc1/Kcc2 mRNA ratios in the PVN of the hypothalamus of males (aec) and females (def) and in the hippocampus of males (gei) and females (jel). Data normalised against control are means [standard deviation (SD)] from a minimum of six rats per treatment group (n¼7, male sevoflurane group, hypothalamus). (m, n) Shown are levels of Gr mRNA in the hippocampus of male (m) and female (n) rats. Data normalised against control are means (SD) from six rats per treatment group. Colour coding in m and n is applicable to all figures. *P<0.05 vs control. K 2Cl (Nkcc1), K 2Cl levels for Nkcc1, Kcc2, and Nkcc1/Kcc2 were similar in control and sevoflurane exposed F0 female rats (Fig. 3jel). The hip- pocampal levels of Gr mRNA were similar in control and sev- oflurane exposed F0 male (Fig. 3m) and female rats (Fig. 3n). Behavioural abnormalities and corticosterone responses to stress in F1 rats Serum concentrations of corticosterone in male and female rats from the F1 generation were not different among all experimental groups within the same sex (Fig. 4aed). In F1 males, there was a significant between-subjects effect of parental neonatal exposure to sevoflurane on time spent in open arms [F(3,67)¼3.51, P¼0.02; Fig. 4e], but there was no sig- nificant effect on distance travelled (Fig. 4f) during the EPM test. Only F1 male progeny of exposed males and unexposed females spent shorter time in open arms of the EPM. The time spent in open arms and distance travelled during the EPM test were not different amongst all experimental groups of F1 fe- male rats (Fig. 4g and h). There was a significant effect of parental sevoflurane exposure on PPI of startle responses in F1 male rats [F(3,204)¼9.19, P<0.001; Fig. 4i]. Only male progeny of exposed sires exhibited reduced PPI of startle at PP3 (P¼0.014 vs F1 males of con-M*con-F), and PP6 (P¼0.007 vs F1 males of con- M*con-F). There was no significant treatment effect on PPI of Multigenerational developmental effects of sevoflurane - 411 Fig 4. F1 male, but not female, offspring of sires exposed to sevoflurane on postnatal Day 5, exhibit behavioural abnormalities, while both F1 females and F1 males had normal corticosterone responses to stress. Shown are the respective concentrations of serum corticosterone across each collection point, and the total corticosterone responses in male (a, b) and female (c, d) F1 rats. To assess differences in total corticosterone concentrations, area under the curve in respect to ground (concentrations of corticosterone at rest were taken as a ground), was calculated. Data are means [standard deviation (SD)] from six animals per treatment group. Shown are % of time spent in open arms of the elevated plus maze (EPM) and distance travelled by male (e, f) and female (g, h) F1 rats. Data are means (SD) typically from 18 animals per treatment group (n¼17, male con-M*con-F group). (i, j) Shown are %PPI responses at prepulse intensity (PP) of 3 dB, 6 dB, and 12 dB in male (i) and female (j) F1 rats. Data are means (SD) from 18 rats per treatment group. (k) Plots showing the values of escape latencies during the 5-day training period from P80 to P84 for F1 male rats. (l, m) Histograms showing the time spent in the target quadrant and the number of times the rat crossed the previous location of the escape platform. (nep) Shown are respective data for F1 female rats collected during the Morris water maze (MWM) tests. Data are means (SD) from 18 animals per treatment group. Colour coding in (eeh) is applicable to all figures. *P<0.05 vs F1 males from the con-M*con-F group. 412 - Ju et al. startle in F1 female rats (Fig. 4j). The startle amplitudes were similar among all experimental groups of F1 male and F1 fe- male rats. Hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios and hippocampal Gr mRNA levels in F1 rats In males, the MWM test showed no significant between- subjects effect of parental sevoflurane exposure on the escape latencies across the 5-day training period, but there was a significant within-subjects effect of day of training [F(4,272)¼30.03, P<0.001; Fig. 4k]. There were significant effects of parental sevoflurane exposure on time in the target quad- rant [F(3,68)¼2.75, P¼0.049; Fig. 4l] and times of crossing over the platform [F(3,68)¼3.06, P¼0.034; Fig. 4m]. Only male offspring of both exposed parents spent significantly shorter time in the target quadrant (P¼0.04 vs F1 males of con-M*con-F) and made less crossings over the former platform (P¼0.04 vs F1 males of con-M*con-F). There were no significant group effects in the MWM tests of F1 female rats (Fig. 4nep). In F1 males there was a significant between-subjects effect of sevoflurane exposure on Nkcc1 mRNA levels parental [F(3,22)¼4.55, P¼0.013, Fig. 5a], Kcc2 mRNA levels [F(3,22)¼13.53, P<0.001, Fig. 5b], and the Nkcc1/Kcc2 mRNA ratios [F(3,22)¼5.68, P¼0.005, Fig. 5c] in the PVN of the hypothalamus. In contrast, F1 females showed no such between-subjects effects in the PVN of the hypothalamus (Fig. 5def). In the hippocampus of F1 males, there was no significant between-subject effect of parental neonatal sevoflurane exposure on Nkcc1 mRNA levels (Fig. 5g), but there was a sig- nificant effect on Kcc2 mRNA levels [F(3,20)¼3.55, P¼0.03, Fig. 5h] and thus the Nkcc1/Kcc2 mRNA ratio [F(3,22)¼5.52, P¼0.006, Fig. 5i]. In the hippocampus of F1 females, there were no þ þ (cid:2) þ (cid:2) (Kcc2) and glucocorticoid receptors (Gr) in the paraventricular nucleus (PVN) of the Fig 5. Gene expression for Na hypothalamus and hippocampus of F1 rats. Shown are the respective levels of Nkcc1 messenger ribonucleic acid (mRNA), Kcc2 mRNA, and the resulting Nkcc1/Kcc2 mRNA ratios in the PVN of the hypothalamus of F1 males (aec) and F1 females (def) and in the hippocampus of F1 males (gei) and F1 females (jel). Data normalised against control are means [standard deviation (SD)] from at least six rats per treatment group (n¼7, male con-M*con-F and sevo-M*con-F groups). (m, n) Shown are levels of Gr mRNA in the hippocampus of male (m) and female (n) rats. Data normalised against control are means (SD) from six rats per treatment group. Colour coding in (m) and (n) is applicable to all figures. *P<0.05 vs F1 males from the con-M*con-F group. K 2Cl (Nkcc1), K 2Cl Multigenerational developmental effects of sevoflurane - 413 Fig 6. Methylation in promoter region of Kcc2 gene in sperm and ovary deoxyribonucleic acid (DNA) of F0 rats and in the hypothalamus and hippocampus DNA of F1 rats. (A) Bisulphite sequencing of CpG sites in the Kcc2 gene of nine clones from four individual sperm (A,aec) and ovary (A,def) DNA samples isolated from sevoflurane-exposed and control F0 rats. Heat maps show DNA methylation status of CpG sites in the promoter region of the Kcc2 gene in sperm (A,a) and ovaries (A,d) of F0 rats. Red cells show methylated sites. X axisdCpG sites; Y axisdclones. Histograms showing methylation frequency at each CpG site (A,bdmales; A,ddfemales) and DNA methylation level at all six CpG sites (A,cdmales; A,fdfemales). (B) Shown are the DNA methylation status of CpG sites, methylation frequencies at each CpG site and DNA methylation level at all six CpG sites in the Kcc2 gene of 9e10 clones from the hypothalamus of F1 male rats (B,aec) and F1 female rats (B,def). (C) The results of similar analyses as in (B) for hippocampus of F1 rats. Data are means (standard deviation) from four rats per y P<0.05 vs all treatment group (n¼5, hypothalamus samples isolated from male rats). *P<0.05 vs F1 males from the con-M*con-F group. other treatment groups. Colour coding in A,c is applicable to A,b; in A,f to A,e; in B,c,f to B,b,e; in C,c,f to C,b,e. significant between-subjects effects of parental neonatal sev- oflurane exposure on Cl (cid:2) transporter mRNA (Fig. 5jel). There was significant between-subjects effect of parental neonatal sevoflurane exposure on the hippocampal Gr mRNA levels in F1 males [F(3,20)¼7.44, P¼0.002, Fig. 5m], but not in F1 females (Fig. 5n). ovaries of control and sevoflurane-exposed adult female rats (Fig. 6A,def). Greater methylation changes might be present in oocytes, a minor fraction of the cells in the ovary. There was significant effect of parental treatment on the frequencies of CpG site methylation in the hypothalamus in F1 male [F(3,96)¼32.09, P<0.001, Fig. 6B,aec], but not female prog- eny (Fig. 6B,def). DNA methylation in the Kcc2 gene promoter In sperm of F0 rats there was significant effect of treatment [F(1,36)¼59.06, P<0.001, Fig. 6A,aec] and within-subjects effect of CpG site [F(5,36) ¼ 37.80, P<0.001] on methylation frequency. There was a trend but no significant difference between CpG site methylation frequency in the Kcc2 gene promoter in The CpG site methylation frequency in the hippocampus of F1 male rats was largest if both parents were exposed to sev- oflurane as neonates [F(3,72)¼96.83, P<0.001, Fig. 6C,aec], while F1 females were not significantly affected (Fig. 6C,def). We did not detect significant differences in the frequency of CpG site methylation in the promoter in the Nkcc1 gene in F0 sperm of control and rats exposed to sevoflurane as neonates. 414 - Ju et al. Discussion A single exposure of neonatal rats to sevoflurane, the most frequently used general anaesthetic in paediatrics, led to sig- nificant behavioural abnormalities and changes in DNA methylation not only in exposed rats in adulthood, but also in their adult male offspring that were never exposed to sevo- flurane. These effects of sevoflurane were strongly sex- dependent. The findings that male offspring only, but not female littermates, were affected indicate that it is unlikely that sevoflurane-induced abnormalities are transmitted to the next generation through sevoflurane-altered behaviour of the exposed dams. Furthermore, in the EPM and PPI of startle behavioural tests, male offspring of control females and exposed males were the only experimental group that exhibited significant abnormalities, even though F0 males did not have a direct contact with their progeny. These findings, together with increased hypothalamic and hippocampal Nkcc1/Kcc2 mRNA ratios in exposed parents and their male offspring and similarly increased DNA methylation of the Kcc2 gene promoter in the sperm of F0 exposed sires and hypo- thalamic and hippocampal tissues of their male, but not fe- male progenies, strongly support involvement of epigenetic mechanisms in the effects of parental neonatal exposure to sevoflurane to the next generation. The similarities between the developmental effects of exposure to GABAergic anaesthetics4e8 and perinatal stress9e11 early in life suggests similarities in the underlying mechanisms of both phenomena. Recent studies in rodents also report heritable multigenerational effects of perinatal stress.19e21 Similar to our findings of normal corticosterone responses to physical restraint in progeny of sevoflurane- exposed parents, Morgan and Bale19 found normal cortico- sterone responses in offspring of prenatally stressed males and control females. Similar to our findings that only males were affected by neonatal exposure of their parents to sev- oflurane, developmental effects of paternal prenatal stress were detected in male offspring only.19 Among plausible explanations for normal corticosterone responses in male offspring of the exposed rats could be increased expression of Grs in the hippocampus, PVN, pituitary, or all three consistent with our finding of increased concentrations of Grs mRNA in the hippocampus of F1 male rats where only one parent had been exposed to sevoflurane. The GRs mediate the negative feedback of corticosterone on HPA axis activity.25 Male offspring of exposed male F0/unexposed female F0 exhibited reductions in PPI of acoustic startle and in time spent in open arms of the EPM. These PPI and EPM abnor- malities were accompanied by greater increases in hypotha- lamic PVN Nkcc1/Kcc2 mRNA ratios. Also, male progeny of exposed male F0/unexposed female F0 had significantly higher CpG methylation frequencies in the promoter of the Kcc2 gene in the hypothalamus. In contrast, abnormalities in spatial memory during the MWM test, a standardised and widely used behavioural test that strongly correlates with hippocampal synaptic plasticity,26 were most prominent in male offspring when both parents were exposed. Again, consistent with behavioural findings, the greatest increase in hippocampal Nkcc1/Kcc2 mRNA ratio was found in male offspring of this group. Furthermore, this group had significantly higher CpG methylation in the promoter of the Kcc2 gene in the hippo- campus. Together, these findings support an important role of epigenetic mechanisms in the mediation of heritable developmental effects of early life exposure to sevoflurane. Another novel observation is that a delay or postponement in the developmental maturation in the Nkcc1/Kcc2 ratio in the PVN of the hypothalamus can selectively affect EPM and PPI behaviour with no significant effect on MWM behaviour, while impaired developmental maturation of the Nkcc1/Kcc2 ratio in the hippocampus can have profound consequences for MWM behaviour, with no significant effects on EPM and PPI behav- iour. In future studies it will be important to elucidate how closely the observed changes in gene expression in each spe- cific experimental group translate to changes in respective protein concentrations. Why male offspring of exposed male F0/unexposed female F0 exhibit significant deficiencies in the EPM and PPI of startle tests, especially when compared with offspring of both exposed parents, remains to be elucidated, as does why only male progeny were affected. A greater HPA axis response to stress in exposed F0 males,6 as opposed to greater stress re- sponses in naı¨ve females,27 suggest that anaesthesia alters postnatal brain sex differentiation, at least as it relates to HPA axis function. The primary female sex steroid hormone 17b- oestradiol, synthesised in neonatal brain through aromati- sation of testis-derived testosterone, directs brain sexual differentiation by organisational actions during a critical period.28 Of relevance, 17b-oestradiol is known to down- regulate neuronal Kcc2 expression.13,14 It would be important to explore whether sex-dependent developmental effects of sevoflurane include effects on brain sexual differentiation. Even though an increase in the Nkcc1 mRNA level was detected only in the hypothalamus of one group of second generation male rats, the male progenies of exposed male F0/ unexposed female F0, it remains to be elucidated how such an increase in hypothalamic Nkcc1 mRNA level was passed to the next generation, as we were not able to detect significant changes in the methylation pattern of the Nkcc1 gene pro- moter in sperm of exposed F0 males. In summary, our results demonstrate for the first time that neurobehavioural abnormalities induced by neonatal expo- sure to the general anaesthetic sevoflurane can be transmitted to the next generation in a complex, sex- and brain region- specific mode through epigenetic mechanisms. This basic science study deals with a complex biological phenomenon of intergenerational heritability of the effects of environmental factors, in general, and with a newly uncovered potentially important translational problem (i.e. intergenerational heri- tability of the effects of early in life general anaesthesia exposure). Mechanisms of sevoflurane-induced sex- and brain region-specific effects across two generations are exciting and challenging topics for future studies. To further substantiate translational applicability of this phenomenon, additional animal studies using different neonatal anaesthesia para- digms that more broadly model stages of human postnatal brain development at the time of anaesthesia exposure and duration of anaesthesia exposure in young human patients will be needed. Authors’ contributions Designed research: A.E.M., L.-S.J., T.E.M., N.G., C.N.S., J.L.R., J.-Q.Z. Performed research: L.-S.J., J.-J.Y. Analysed data: L.-S.J., J.-J.Y., A.E.M. Wrote the paper: A.E.M., T.E.M., N.G., C.N.S., J.-Q.Z. Approved the final manuscript: all authors. Acknowledgements The authors thank B. Setlow, J. Li, and X. Yang for helpful advice and technical assistance. Declaration of interest The authors declare that they have no conflicts of interest. Funding National Institutes of Health (R01NS091542, R01NS091542-S to A.E.M.), I. Heermann Anesthesia Foundation, Inc (to J.L-S.), the Jerome H. Modell Endowed Professorship (to N.G.), and the National Natural Science Foundation of China (U1404807, 81771149 to J.Z.). References 1. Ing C, Sun M, Olfson M, et al. Age at exposure to surgery and anesthesia in children and association with mental disorder diagnosis. Anesth Analg 2017; 125: 1988e98 2. U.S. Food and Drug Administration. FDA drug safety communication: FDA review results in new warnings about using general anesthetics and sedation drugs in young children and pregnant women. Available from: https://www.fda.gov/ Drugs/DrugSafety/ucm532356.htm. [Accessed 25 August 2017] 3. Sanders RD, Hassell J, Davidson AJ, Robertson NJ, Ma D. Impact on neuro- development: an update. Br J Anaesth 2013; 110(Suppl 1): i53e72 anaesthetics surgery and of 4. Edwards DA, Shah HP, Cao W, Gravenstein N, Seubert CN, Martynyuk AE. Bumetanide alleviates epileptogenic and neurotoxic effects of sevoflurane in neonatal rat brain. Anesthesiology 2010; 112: 567e75 5. Cao W, Pavlinec C, Gravenstein N, Seubert CN, Martynyuk AE. Roles of aldosterone and oxytocin in ab- normalities caused by sevoflurane anesthesia in neonatal rats. Anesthesiology 2012; 117: 791e800 6. Xu C, Tan S, Zhang J, et al. Anesthesia with sevoflurane in neonatal rats: developmental neuroendocrine abnormal- ities and alleviating effects of the corticosteroid and Cl(-) importer antagonists. Psychoneuroendocrinology 2015; 60: 173e81 7. Ju LS, Yang JJ, Gravenstein N, et al. Role of environmental stressors in determining the developmental outcome of neonatal anesthesia. Psychoneuroendocrinology 2017; 81: 96e104 8. Yang J, Ju L, Jia M, et al. Subsequent maternal separation exacerbates neurobehavioral in rats neonatally exposed to sevoflurane anesthesia. Neurosci Lett 2017; 661: 137e42 abnormalities 9. Furukawa M, Tsukahara T, Tomita K, et al. Neonatal maternal separation delays the GABA excitatory-to- inhibitory functional switch by inhibiting KCC2 expres- sion. Biochem Biophys Res Commun 2017; 493: 1243e9 10. O’Malley D, Dinan TG, Cryan JF. Neonatal maternal sepa- ration in the rat impacts on the stress responsivity of central corticotropin-releasing factor receptors in adult- hood. Psychopharmacology (Berl) 2011; 214: 221e9 Multigenerational developmental effects of sevoflurane - 415 11. Veerawatananan B, Surakul P, Chutabhakdikul N. Maternal restraint stress delays maturation of cation- chloride cotransporters and GABAA receptor subunits in the hippocampus of rat pups at puberty. Neurobiol Stress 2015; 3: 1e7 12. Ben-Ari Y. The GABA excitatory/inhibitory developmental journey. Neuroscience 2014; 279: sequence: a personal 187e219 13. Perrot-Sinal TS, Sinal CJ, Reader JC, Speert DB, McCarthy MM. Sex differences in the chloride cotrans- porters, NKCC1 and KCC2, in the developing hypothala- mus. J Neuroendocrinol 2007; 19: 302e8 14. Nunez JL, McCarthy MM. Resting intracellular calcium concentration, depolarizing GABA and possible role of local estradiol synthesis in the developing male and fe- male hippocampus. Neuroscience 2008; 158: 623e34 15. Tang X, Kim J, Zhou L, et al. KCC2 rescues functional deficits in human neurons derived from patients with Rett syndrome. Proc Natl Acad Sci USA 2016; 113: 751e6 16. Merner ND, Mercado A, Khanna AR, et al. Gain-of-function missense variant in SLC12A2, encoding the bumetanide- sensitive NKCC1 cotransporter, identified in human schizophrenia. J Psychiatr Res 2016; 77: 22e6 17. Lemonnier E, Villeneuve N, Sonie S, et al. Effects of bumetanide on neurobehavioral function in children and adolescents with autism spectrum disorders. Transl Psy- chiatry 2017; 7, e1056 18. Antshel KM, Zhang-James Y, Wagner KE, Ledesma A, Faraone SV. An update on the comorbidity of ADHD and ASD: a focus on clinical management. Expert Rev Neurother 2016; 16: 279e93 19. Morgan CP, Bale TL. Early prenatal stress epigenetically programs dysmasculinization in second-generation offspring via the paternal lineage. J Neurosci 2011; 31: 11748e55 20. Bohacek J, Farinelli M, Mirante O, et al. Pathological brain plasticity and cognition in the offspring of males sub- jected to postnatal traumatic stress. Mol Psychiatry 2015; 20: 621e31 21. Rodgers AB, Morgan CP, Leu NA, Bale TL. Transgenera- tional epigenetic programming via sperm microRNA re- capitulates effects of paternal stress. Proc Natl Acad Sci USA 2015; 112: 13699e704 22. Ju LS, Jia M, Sun J, et al. Hypermethylation of hippocampal synaptic plasticity-related genes is involved in neonatal sevoflurane exposure-induced cognitive impairments in rats. Neurotox Res 2016; 29: 243e55 23. Cho HM, Lee HA, Kim HY, Han HS, Kim IK. Expression of Naþ-Kþ -2Cl- cotransporter 1 is epigenetically regulated during postnatal development of hypertension. Am J Hypertens 2011; 24: 1286e93 24. Yeo M, Berglund K, Hanna M, et al. Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter. Proc Natl Acad Sci USA 2013; 110: 4315e20 25. Sapolsky RM, Krey LC, McEwen BS. The neuroendocri- nology of stress and aging: the glucocorticoid cascade hypothesis. Endocr Rev 1986; 7: 284e301 26. Vorhees CV, Williams MT. Value of water mazes for assessing spatial and egocentric learning and memory in rodent basic research and regulatory studies. Neurotoxicol Teratol 2014; 45: 75e90 416 - Ju et al. 27. Iwasaki-Sekino A, Mano-Otagiri A, Ohata H, Yamauchi N, Shibasaki T. Gender differences in corticotropin and corticosterone secretion and corticotropin-releasing fac- tor mRNA expression in the paraventricular nucleus of the the hypothalamus and the central nucleus of amygdala in response to footshock stress or psychological stress in rats. Psychoneuroendocrinology 2009; 34: 226e37 28. McCarthy MM, Nugent BM, Lenz KM. Neuroimmunology and neuroepigenetics in the establishment of sex differ- ences in the brain. Nat Rev Neurosci 2017; 18: 471e84 Handling editor: H.C. Hemmings Jr",rats,['Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations.'],postnatal day 5,['Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations.'],Y,"['The F0 male and female rats were sequentially evaluated on the elevated plus maze (EPM) starting on P60, for prepulse inhibition (PPI) of the acoustic startle response on P70, and for corticosterone responses to physical restraint for 30 min on P160 followed by isolation of brain and gamete tissue samples for further analyses.', 'The F1 rats, 144 in total [n=18 per sex (two) per group (four)], which were subjected to facility rearing only, were evaluated in the EPM starting on P60, PPI of startle on P70, Morris water maze (MWM) testing starting on P79, and for the corticosterone responses to restraint for 30 min on P90, followed by isolation of brain tissue samples for further analyses.']",sevoflurane,['Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations.'],none,[],sprague dawley,['Offspring (F1) of unexposed or exposed to sevoflurane on postnatal day 5 Sprague-Dawley rats (F0) were subjected to behavioural and brain gene expression evaluations.'],This study addresses the issue of how neonatal exposure to sevoflurane affects the next generation of males through epigenetic modification of Kcc2 expression.,"['Neonatal exposure to sevoflurane can affect the next generation of males through epigenetic modification of Kcc2 expression, while F1 females are at diminished risk.']",None,[],The findings demonstrate that neurobehavioural abnormalities induced by neonatal exposure to sevoflurane can be transmitted to the next generation through epigenetic mechanisms.,"['Our results demonstrate for the first time that neurobehavioural abnormalities induced by neonatal exposure to the general anaesthetic sevoflurane can be transmitted to the next generation in a complex, sex- and brain region-specific mode through epigenetic mechanisms.']",None,[],None,[],True,True,True,True,True,True,10.1016/j.bja.2018.04.034 10.1371/journal.pbio.2001246,384.0,Kang,2017,mice,postnatal day 18,Y,isoflurane,none,c57bl/6,"SHORT REPORTS Early postnatal exposure to isoflurane causes cognitive deficits and disrupts development of newborn hippocampal neurons via activation of the mTOR pathway a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 Eunchai Kang1,2☯, Danye Jiang3☯, Yun Kyoung Ryu3☯, Sanghee Lim3, Minhye Kwak3, Christy D. Gray3, Michael Xu3, Jun H. Choi1¶, Sue Junn1, Jieun Kim1, Jing Xu3, Michele Schaefer3, Roger A. Johns3, Hongjun Song1,2,4, Guo-Li Ming1,2,4, C. David Mintz3* 1 Institute for Cell Engineering, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America, 2 Department of Neurology, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America, 3 Department of Anesthesiology, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America, 4 The Solomon Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America OPEN ACCESS ☯ These authors contributed equally to this work. ¶Author Jun Choi was unavailable at the time of acceptance for publication to confirm his authorship contributions. On his behalf, all other authors have reported his contributions to the best of their knowledge. * cmintz2@jhmi.edu Citation: Kang E, Jiang D, Ryu YK, Lim S, Kwak M, Gray CD, et al. (2017) Early postnatal exposure to isoflurane causes cognitive deficits and disrupts development of newborn hippocampal neurons via activation of the mTOR pathway. PLoS Biol 15(7): e2001246. https://doi.org/10.1371/journal. pbio.2001246 Received: September 30, 2016 Accepted: June 2, 2017 Published: July 6, 2017 Copyright: © 2017 Kang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: Johns Hopkins ACCM Department anesthesiology.hopkinsmedicine.org (grant number StAAR) to CDM. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. NIH- NIGMS www.nih.gov (grant number 1R01GM120519-01 and 1K08GM104329-01) to CDM. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. NIH www.nih.gov Abstract Clinical and preclinical studies indicate that early postnatal exposure to anesthetics can lead to lasting deficits in learning and other cognitive processes. The mechanism underlying this phenomenon has not been clarified and there is no treatment currently available. Recent evidence suggests that anesthetics might cause persistent deficits in cognitive func- tion by disrupting key events in brain development. The hippocampus, a brain region that is critical for learning and memory, contains a large number of neurons that develop in the early postnatal period, which are thus vulnerable to perturbation by anesthetic exposure. Using an in vivo mouse model we demonstrate abnormal development of dendrite arbors and dendritic spines in newly generated dentate gyrus granule cell neurons of the hippo- campus after a clinically relevant isoflurane anesthesia exposure conducted at an early postnatal age. Furthermore, we find that isoflurane causes a sustained increase in activity in the mechanistic target of rapamycin pathway, and that inhibition of this pathway with rapa- mycin not only reverses the observed changes in neuronal development, but also substan- tially improves performance on behavioral tasks of spatial learning and memory that are impaired by isoflurane exposure. We conclude that isoflurane disrupts the development of hippocampal neurons generated in the early postnatal period by activating a well-defined neurodevelopmental disease pathway and that this phenotype can be reversed by pharma- cologic inhibition. PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 1 / 18 Anesthetic toxicity and mTOR (grant number NS048271 and MH105128) to GLM. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. NIH www.nih.gov (grant number NS047344) to HS. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Abbreviations: BDNF, brain-derived neurotrophic factor; DCG, dentate gyrus granule cell; DIV, day in vitro; DISC1, disrupted in schizophrenia 1; GFP, green florescent protein; IP, intraperitoneal; mTOR, mechanistic target of rapamycin; P, postnatal day; PI3K-Akt, phosphoinositide 3 kinase-protein kinase B; pS6, phosphor-S6. Author summary The United States Food and Drug Administration has recently warned that exposure to anesthetic and sedative drugs during the third trimester of prenatal development and dur- ing the first 3 years of life may cause lasting impairments in cognitive function. The mech- anisms by which this undesirable side effect occurs are unknown. In this manuscript, we present evidence in mice that early developmental exposure to isoflurane, a canonical gen- eral anesthetic, disrupts the appropriate development of neurons in the hippocampus, a brain region associated with learning and memory. Isoflurane also causes up-regulation of the mechanistic target of rapamycin (mTOR) pathway, a signaling system that has been associated with other neurodevelopmental cognitive disorders. Treatment with an inhibi- tor of the mTOR pathway after isoflurane exposure normalizes neuronal development and also ameliorates the impairments in learning induced by isoflurane. We conclude that early exposure to isoflurane can cause learning deficits via actions on the mTOR pathway, and that this mechanism represents a potentially druggable target to minimize the side effects of anesthetics on the developing brain. Introduction Several large retrospective analyses link exposure to anesthetics and surgery within the first 3 years of life with subsequent effects on cognitive function, as measured by worsened perfor- mance on school assessments, an increase in billing codes relevant to learning disorders, and deficits in neuropsychological testing [1–3]. It is difficult to separate the effects of surgery, anesthesia, and comorbidity in clinical studies. However, multiple independent investigations conducted in rodent models using different anesthetics and varying exposure paradigms in the absence of surgery indicate that early developmental exposure to general anesthetic agents results in lasting impairment on behavioral measures of neurocognitive function, predomi- nantly in the domain of learning and memory [4–12]. While 2 recent clinical studies give some reassurance that short, single exposures in healthy children may not have dramatic conse- quences [13,14], clear evidence of lasting cognitive deficits was detected recently in a carefully conducted study of a somewhat longer clinically relevant anesthetic exposure in nonhuman primates [15]. Thus, there are serious concerns in the anesthesiology, surgery, and pediatrics literature that anesthetic exposure may result in worsened cognitive outcomes for some unknown fraction of the hundreds of thousands of children under age 4 who undergo surgery each year [16–18]. In response to these findings, the US Food and Drug Administration recently issued a drug safety communication warning that anesthetic exposure may pose risks to brain development and calling for further research on this topic. The molecular and cellular mechanisms underlying this phenomenon have yet to be clearly elucidated, and no prophylac- tic or treatment strategies exist. Much of the literature on the effects of anesthetic exposure on brain function focuses on the potential for anesthetics to activate apoptotic cell death pathways in neurons [6,19], but more recent work has led to the novel hypothesis that anesthetics cause lasting effects on cognitive function via sublethal effects on critical processes in neuronal development [20]. In humans, the neural circuitry underlying higher brain functions, such as learning, is primarily estab- lished between the second trimester and early childhood [21], a period that includes the win- dow of putative vulnerability to anesthetics identified in epidemiologic studies [18]. During this time, critical ongoing developmental events are occurring in many neurons of the hippo- campus, including growth of dendritic arbors and generation of dendritic spines, which are PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 2 / 18 Anesthetic toxicity and mTOR the postsynaptic elements of excitatory synapses [22]. There are substantial differences in developmental timelines in the different species in which the effects of early postnatal anesthe- sia exposure on cognitive function have been studied, but one notable common feature is the generation and development of a large percentage of the dentate gyrus granule cell (DGC) neurons in the hippocampus [23], a structure that is critical to cognitive functions, including learning and memory. Thus, in this study we investigated the effects of anesthesia exposure on dendritic arbor and spine development in early postnatally generated DGCs, which may be an important target population and may also serve as a model for postnatal neuron development in other brain regions. We employed a retrovirus-mediated labeling method in intact mice to examine the devel- opment of dendrite arbors and dendritic spines in DGCs in vivo after exposure to a clinically relevant dose of isoflurane. This approach allows morphological analyses of a uniform and well-studied population of neurons, the DGCs, at a single cell level in vivo [24]. We find that early postnatal exposure to isoflurane results in a substantial and lasting disruption of dendritic arborization and spine development. Isoflurane was found to over-activate the mechanistic target of rapamycin (mTOR) pathway, a signaling system critical for normal development, which has been implicated in neurodevelopmental disorders in which cognitive function is affected, including autism and fragile X mental retardation [25,26]. Strikingly, the adverse effects of isoflurane on both dendrite morphology and behavioral tests of learning can be reversed with rapamycin, an mTOR inhibitor. Our findings reveal a novel mechanism by which anesthetics disrupt brain development that has been implicated in other neurodevelop- mental disorders and that is potentially reversible via drug therapy. Results and discussion In order to investigate the effects of anesthetics on dentate gyrus neuron development in vivo, we employed stereotaxic injection to deliver a retrovirus expressing green florescent protein (GFP) to label newly generated dentate gyrus neurons [24]. Injections were conducted at post- natal day (P) 15; on P18, the animals were exposed to isoflurane, a canonical halogenated ether vapor anesthetic. The dose of isoflurane exposure (1.5%) falls well within clinically relevant parameters, as the minimum alveolar concentrations of isoflurane ranges between 1.6% and 1.8% in children between ages 0 and 4 [27]. A 4 hour-exposure duration was selected based on clinical data, which showed that significant learning deficits in children are associated with more than 2 hours of anesthetic exposure [3]. All exposed mice survived and recovered readily, and results of physiologic monitoring of sentinel animals are shown in S1 Table. Tissue was collected for morphological studies at P30. A flow diagram of these experiments is shown in Fig 1A. We sought to determine whether exposure to anesthetics during development alters neuro- nal structure in newborn DGCs lasting fashion. Previous investigations have been potentially confounded by an inability to determine the developmental stage at which any given neuron under analysis was affected by anesthetics, given the nonhomogenous timeline of neuronal development that occurs even within discrete brain regions. In our model, the labeled DGCs, which have fully definable structure due to GFP expression that allows for easy analysis of morphology (Fig 1B), represent a cohort of cells with a uniform birthdate, all of which were exposed to anesthetics at the same point in their developmental timeline. Examination of den- dritic structure revealed a striking finding: compared to neurons in unexposed littermate con- trols, labeled neurons in isoflurane-exposed animals exhibit an 83% increase in total dendritic arbor length at P30 (p < 0.005; Fig 1C–1E). To further elucidate this phenomenon, we con- ducted a Sholl analysis, which revealed a significant increase in dendrite arbor complexity with PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 3 / 18 Anesthetic toxicity and mTOR Fig 1. Isoflurane exposure results in overgrowth of dendritic arbors. (A) A schematic diagram of isoflurane exposure procedure for morphology examination. (B) Sample confocal image of dentate gyrus granule cell (DGCs) infected with retrovirus expressing green florescent protein (GFP) (scale bar: 100 μm). Representative confocal images (C) and tracings (D) of individual control and isoflurane-exposed GFP+ neurons at postnatal day (P) 30 exhibiting overgrowth in the isoflurane group relative to control conditions (scale bar: 10 μm for both C and D). Summaries of total dendritic length (E) and Sholl analysis of dendritic complexity (F) of GFP+ neurons show marked overgrowth of dendritic arbors. Numbers associated with bar graph indicate the number of neurons examined from at least 5 animals per group. The same groups of neurons were examined in (E) and (F). Values represent mean ± SEM (**p < 0.01; Student t test for E and *p < 0.0001 ANOVA for F). Underlying data in S1 Data under Fig 1F tab. https://doi.org/10.1371/journal.pbio.2001246.g001 PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 4 / 18 Anesthetic toxicity and mTOR isoflurane exposure (p < 0.0001; Fig 1F). This finding seems to represent an acceleration of dendrite growth, because dendritic length and complexity in the isoflurane group no longer differs from controls at P60 (S1A–S1D Fig). Branch number is unaffected at either time point (S1E Fig). Cell positioning within the dentate gyrus is unaffected (S1F Fig), suggesting no defi- cits in migration, but soma size is significantly increased with isoflurane exposure at P30, but not P60 (S1G Fig), further suggesting an abnormal acceleration in DGC growth. The change in timing of dendritic development resulting from anesthetic exposure repre- sents a novel and surprising effect of anesthetics on the developing brain. In vitro studies of axon growth suggest that volatile anesthetics such as isoflurane may slow the growth of axons and prepolarized neurites [28,29], but axons and dendrites have substantial differences in their developmental properties [30]. A cell culture study that specifically examined dendrites found that exposure to propofol, but not midazolam, at 1 day in vitro (DIV) caused a lasting suppres- sion of dendritic growth in GABAergic neurons [31]. While the timing of exposure and mea- surement loosely resembles our model, the difference in anesthetic agents and the lack of an in vivo context may explain the disparate findings. Furthermore, the DGCs are primarily gluta- matergic and have properties quite distinct from the GABAergic interneurons population [32]. The only other study to assess the effects of anesthetics on dendrites in vivo found no acute change in the dendritic arbors of prefrontal cortex pyramidal neurons in P16 rats 6 hours after isoflurane exposure, but did not examine longer-term effects [33]. Thus, it is unclear whether the transient dendritic hypertrophy we observed might generalize beyond the DGCs exposed early in their development. Abnormalities in dendritic arbor development may have a profound impact on the function of a neuron via effects on the neuron’s synaptic field and pathologic overgrowth of dendrites has been hypothesized as a component of human neu- rodevelopmental diseases such as autism and schizophrenia [34]. Overgrowth of dendritic arbors has been observed in some animal models of Fragile-X syndrome [35] and autism [36]. However, we cannot determine whether the phenomenon that we observed is a cause of neu- ronal dysfunction or simply an epiphenomenon or adaptive response. We next asked whether isoflurane exposure results in long-term deficits in learning poten- tially attributable to a disruption of the function of the DGCs in which we have detected a morphological abnormality. Animals were exposed to isoflurane 1.5% for 4 hours at P18 and evaluated for deficits in the object-place recognition and the Y-maze tests of spatial learning at P60 (Fig 2A). Both of these tasks are highly sensitive to alterations in the function of even small numbers of dentate gyrus neurons [37]. In the object-place recognition test, control animals spend significantly more time exploring objects in novel positions, but isoflurane- exposed animals exhibit no exploration preference (Fig 2B, S2A and S2C Fig). Similarly, in the Y-maze test, unlike controls, isoflurane-exposed mice do not exhibit a preference for explora- tion of the newly available arm (Fig 2C, S2B and S2D Fig). These data demonstrate that isoflur- ane exposure results in a lasting reduction in performance on the tasks of spatial learning that are dependent on the hippocampus and potentially sensitive to disruption of the development of the dentate gyrus. Next, we asked whether the observed changes in behavior after anesthetic exposure could be attributed to a lasting change in synapses of the DGCs. We used the retrovirus-mediated labeling method to quantify the density of dendritic spine formations at P60, the age at which behavioral testing took place (Fig 2A). Dendritic spines are dynamic, actin-dependent struc- tures that are critical for learning and memory functions [38]. Spines have range of morpholo- gies traditionally classified as stubby, thin, and mushroom shape. We found a small, but significant decrease in the total density of spines (12% decrease, p < 0.05) in anesthesia- exposed groups, and a very striking 39% decrease in the density of mushroom spines (p < 0.001; Fig 2D, S2E and S2F Fig). No significant change was seen in the density of stubby PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 5 / 18 Anesthetic toxicity and mTOR Fig 2. Isoflurane exposure impairs spatial learning and causes a loss of dendritic spines in dentate gyrus neurons. (A) A schematic diagram of isoflurane exposure procedure for behavior tests and spine analysis. Shown in (B and C) are summaries of the object-place recognition test (B) and the Y- maze test (C) (Control n = 12, Isoflurane n = 11; **p < 0.01, Student t test). (D) Representative processed confocal images of dendritic spines of control and isoflurane-exposed green florescent protein positive (GFP) neurons at postnatal day (P) 60 (scale bar: 2 μm). Shown on right are summary plots of total and mushroom class dendritic spine density, revealing a striking loss of mature spines. Numbers associated with the bar graph indicate the number of dendritic segments examined from at least 5 mice from each group, a total of 2,586 spines in the control group and 2,818 spines in the isoflurane group were analyzed (*p < 0.05; ****p < 0.0001, Student t test). Underlying data in S1 Data under Fig 2B-D tab. https://doi.org/10.1371/journal.pbio.2001246.g002 or thin spines (S2G and S2H Fig). Stubby spines are thought to be immature, thin spines are highly plastic and often transient unless converted into mushroom morphology, and mush- room spines typically represent long-lasting, stable synaptic connections [39]. The reduction in mushroom spine number suggests a substantial loss of synapses that could reasonably account for the reduced performance in spatial learning. Our finding of a reduction in spine density in the cohort of labeled DGCs is in keeping with an increasing body of work suggests that relatively immature neurons exposed to anesthetics may suffer a long-lasting loss of synaptic connections. Studies from 2 different groups in rats found that early postnatal exposure to either sevoflurane alone or a combination of isoflurane, midazolam, and nitrous oxide resulted in a long-term reduction in the number of synaptic profiles measured by quantitative electron microscopy in the hippocampal CA1 and subicu- lum areas, respectively [40,41]. The hippocampus is a relatively late developing structure [42], PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 6 / 18 Anesthetic toxicity and mTOR and thus during early postnatal life, it has numerous neurons that are still undergoing active dendrite arborization and spine formation. In support of the hypothesis that developing neu- rons may be vulnerable to anesthesia-induced synapse loss, a long-term study of the effects of single dose propofol exposure in rats found a decrease in spines in the medial prefrontal cortex of rats exposed at P5 and measured at P90 [43]. In striking contrast, exposure at P15 actually caused an increase in spine number [43], suggesting a notable difference in vulnerability that occurs with neuronal maturation. If developmental exposure to anesthetics can cause a lasting or even permanent loss of synaptic connections in key brain regions such as the hippocampus and pre-frontal cortex this event may represent a perturbation of the development of key brain circuitry, which, in turn, could explain an ongoing loss of cognitive function. A common feature shared by several neurodevelopmental disorders with phenotypes remi- niscent of what we have observed in neurons exposed to anesthesia during development is an alteration in signaling in the mTOR pathway [44]. To determine whether activity in the mTOR system is altered by an early exposure to anesthetics we conducted quantitative fluores- cence immunohistochemistry using an antibody against phospho-S6 (pS6), a reliable reporter of activity in this pathway [37]. We exposed mice to isoflurane at 1.5% for 4 hours and mea- sured pS6 immunoreactivity in the DGC layer. We found an increase of greater than 2-fold in pS6 intensity at P30 (p < 0.0005; Fig 3A, S3 Fig), which was still evident at P60 (S4 Fig). This demonstrates a substantial and lasting upregulation of activity in the mTOR pathway in the dentate gyrus during the period in which we have observed morphological alterations. We next asked whether increased activity in the mTOR pathway is required for the isoflur- ane-induced deficits in spatial learning that we observed previously. Mice were exposed to iso- flurane 1.5% for 4 hours on P18, given intraperitoneal (IP) injections either of vehicle control or 20 mg/kg rapamycin, a pharmacologic inhibitor of mTOR, every other day between P21 and P29, and then assayed for spatial learning via behavioral testing (Fig 3B). To confirm that our rapamycin treatment effectively suppressed isoflurane-mediated activity in the mTOR pathway, we tested for pS6 immunoreactivity in the dentate gyrus of animals exposed to iso- flurane and then treated with rapamycin. We found that rapamycin treatment significantly reduced pS6 immunoreactivity compared to isoflurane and that levels were comparable to untreated controls (Fig 3A). Subsequently, we tested whether blocking mTOR activation induced by isoflurane could rescue the morphological disruptions and behavioral deficits observed after isoflurane treat- ment. First, we tested the effects of mTOR inhibition on isoflurane-induced dendrite growth acceleration. We found that rapamycin treatment after isoflurane significantly reduces total dendritic length compared with the control group (p < 0.05) and that dendritic length in the isoflurane plus rapamycin group is not significantly different from controls (Fig 3C). Sholl analysis indicates that rapamycin treatment after isoflurane results in arbor complexity that is more similar to what is measured with control conditions than with isoflurane alone (Fig 3D). Rapamycin treatment alone has no effect on spatial learning (S5A–S5D Fig), but rapamycin treatment after isoflurane exposure restores performance to near control levels in both the object-place recognition and Y-maze tests (Fig 3E and 3F and S5C–S5F Fig). Subsequently, we assayed the numbers of dendritic spines in the retrovirus-labeled DGCs exposed to isoflurane with and without rapamycin treatment. We find no significant difference in the total dendritic spine density between the vehicle and rapamycin groups exposed to isoflurane (Fig 3G and S5G and S5H Fig). However, when only the mushroom spines are considered, we find an increase in spine density in the rapamycin group compared to the vehicle treated group (p < 0.0001) (Fig 3G). There is no significant difference in mushroom spine density between the control group that did not receive isoflurane and the isoflurane plus rapamycin group (Fig 3G). By contrast stubby spine density appears to be reduced by isoflurane and rapamycin PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 7 / 18 Anesthetic toxicity and mTOR Fig 3. Isoflurane exposure leads to aberrant activation of the mechanistic target of rapamycin (mTOR) signaling pathway, and pharmacological inhibition of the mTOR activities rescues deficits in behavioral tests and loss of spines. (A) Representative confocal images of phospho-S6 (pS6) immunofluorescence at postnatal day (P) 30 in the dentate gyrus showing an increase in labeling in the isoflurane plus vehicle (Iso/V) group relative to controls and a return to baseline in the group exposed to isoflurane and subsequently treated with rapamycin, designated Iso/R. The upper panels PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 8 / 18 Anesthetic toxicity and mTOR are original confocal images with DAPI in blue and pS6 labeling in red, and the lower panels are processed for quantification with black pS6 signal on white background (ML, molecular layer; DG, dentate gyrus; HI, hilus, scale bar: 50 μm). Also shown in (A) quantification of normalized pS6 expression in the dentate gyrus granule cell layer (***p < 0.001, ANOVA, numbers in each bar represent n for images analyzed). (B) Schematic diagram of rapamycin treatment for behavior tests and spine analysis. Summaries of total dendritic length (C) and Sholl analysis of dendritic complexity (D) of GFP+ neurons show a rescue of normal dendritic arbor length and complexity with Iso/R. Values represent mean ± SEM (*p < 0.05, **p < 0.01; ANOVA for C; *p < 0.0001 ANOVA for D). Numbers in each bar represent number of cells analyzed per group, minimum of 5 animals per group). Summaries of object-place recognition test (E) and Y-maze test (F) for Iso/V and Iso/R show a recovery to near control performance with Iso/R. (Control n = 10, Iso/V n = 11, Iso/R n = 11; *: p < 0.05; **: p < 0.01, Student t test). (G) Representative confocal images of dendritic spines at P60. Scale bar: 2 μm. Shown on right are summary plots of total and mature dendritic spine density. Numbers associated with bar graph indicate the number of dendritic segments examined, a total of 2,586 spines in the control group, 1,831 spines in the isoflurane plus vehicle group, and 2,999 spines in the isoflurane plus rapamycin group were analyzed (****p < 0.0001; ns: non-significant; ANOVA, numbers in each bar represent n of dendritic segments analyzed per group, minimum of 5 animals per group). Underlying data in S1 Data under Fig 3A-G. https://doi.org/10.1371/journal.pbio.2001246.g003 treatment relative to isoflurane alone, and no significant differences are measured in thin spines (S5I and S5J Fig). Thus, our data suggest that rapamycin, by inhibiting the mTOR path- way, prevents an isoflurane-induced reduction in stable synaptic connections. Taken together, our findings indicate that isoflurane causes a sustained increase in activity in the mTOR pathway that leads to dendrite growth acceleration and either synapse loss or reduced synapse formation in DGCs. Superficially, our results are at odds with a previous study, showing no activation of mTOR in the hippocampus after sevoflurane anesthesia [45], but in the other study, measurements were taken hours after exposure, whereas in the current study we made measurements 1 to 2 weeks later, with a goal of elucidating longer term effects on neuronal development. The mTOR pathway is an intriguing potential mechanism of injury, as it has been implicated both in normal functions in brain development and it is disarrayed in a wide-range of human neurodevelopmental disease [46]. The mTOR pathway is involved in normal development of dendrites and synapses through its actions, integrating signals from the phosphoinositide 3 kinase-protein kinase B (PI3K-Akt) system, which is influenced by both activity and neurotrophic growth factors, such as brain-derived neurotrophic factor (BDNF), that act via tyrosine kinase receptors [47,48]. Downstream mediators of mTOR that influence synaptogenesis include actions on mitochondrial function, lipid synthesis, and trans- lational control via the mTOR1 complex and RhoGTPase actions on the cytoskeleton via the mTOR2 complex [47,48]. Enhanced activity in the mTOR pathway induced by knockdown of disrupted in schizophrenia 1 (DISC1) in newly generated DGCs in adult animals causes accel- erated development of dendrites, similar to what we have seen, but it is accompanied by an increase in spine formation [37,49], which stands in apparent contrast to the spine decrease seen in our model. However, several key differences exist between the models that may explain this discrepancy: (1) our study follows the neurons in question for a much longer period, and thus it is possible that overgrowth leads to spine loss over a sufficient length of time; (2) in the DISC1 study, only the studied cohort of newborn DGCs was affected, whereas in our model isoflurane may exert an effect on the surrounding cells as well as the labeled cells; (3) the influ- ence of the DISC1 knockdown was permanent, whereas in our model isoflurane is given tran- siently and its effects may therefore be manifested differently over time; and (4) we observe overgrowth at P30, which is no longer apparent at P60, and it is possible that early acceleration of growth followed by slowing may induce synaptic loss as a result of a disruption of the nor- mal timing of dendritic arbor growth relative to dendritic spine growth. Additionally, it should be noted that the effects of changes in mTOR signaling may depend on context and on activity in other systems. For instance, Kumar et al. showed that transient inhibition of mTOR, which alone decreases spine formation, could actually increase formation of mushroom spines in a PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 9 / 18 Anesthetic toxicity and mTOR developmental model when it was accompanied by activation of the PI3K-Akt system or treat- ment with BDNF [50]. In this model, an increase in mushroom spines is accompanied by a decrease in filopodial protrusions that the authors interpret as a destabilization or regression of synapses. Isoflurane and other anesthetics act on multiple targets in developing neurons, and thus understanding their actions on spine and synapse formation will require a full inves- tigation of how each component of the signaling systems that underlie this process is affected. Given the complexity of the mTOR pathway, the effects of a lasting change in the activity of this pathway are difficult to predict. A sustained increase in mTOR pathway tone certainly has the potential to powerfully alter neurotransmission in the dentate gyrus, as evidenced by the appearance of epileptiform activity in mice with selective deletions of phosphatase and tensin homolog, an mTOR pathway inhibitor, in DGCs [51]. Thus, we hypothesize that isoflurane- induced changes in mTOR signaling have the potential to disrupt the course of neuronal devel- opment in the dentate gyrus and perhaps in other brain areas in such a way as to disrupt cogni- tive function. Even if our findings do not generalize to other cell types and brain regions, they still have significant implications given that substantial populations of DGCs are generated in rodents [52], nonhuman primates [53], and humans [52] during the hypothesized period of susceptibility to anesthesia-induced cognitive deficits in each of these species and these neu- rons are critical for learning across species. Furthermore, our findings suggest the possibility that harmful effects of mTOR overactivation could be prevented. Complex neurodevelopmen- tal cognitive disorders like autism, in which the pathophysiology may involve changes in mTOR pathway activity that stem from a combination of genetic and environmental factors occurring at unknown times during development, present great challenges in designing an mTOR targeted therapy [54]. By contrast, anesthetic effects on cognitive function result from a brief toxic insult at a known time, and therefore might be more amenable to treatment. Thus, our discovery of a novel, reversible mechanism of injury in developmental anesthetic neuro- toxicity has translational potential that can be explored in future studies. Methods Ethics All study protocols involving mice were approved by the Animal Care and Use Committee at the Johns Hopkins University (protocol MO14M315) and conducted in accordance with the NIH guidelines for care and use of animals. Animals C57BL/6 mice were housed in a temperature- and humidity-controlled room with a 12:12 hour light:dark cycle, and provided with ad libitum access to water and food. Both sexes were equally represented in all experiments. No animals were excluded. Isoflurane treatment and physiologic monitoring of sentinel animals P18 mouse littermates were randomly assigned to 2 groups. In Group 1 (isoflurane), mice were exposed to 1.5% isoflurane carried in 100% oxygen for 4 hours. A calibrated flowmeter was used to deliver oxygen at a flow rate of 5 L/min and an agent-specific vaporizer was used to deliver isoflurane. In Group 2 (control), mice were exposed to room air for 4 hours. Animals were returned to their cages together with their littermates upon regaining righting reflex. Mice were continually monitored and recorded for skin temperature, heart rate, and oxygen saturation during the 4-hour isoflurane treatment (PhysioSuite; Kent Scientific, Torrington, PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 10 / 18 Anesthetic toxicity and mTOR CT). Intracardiac puncture was used to collect left ventricular blood samples from selected sentinel animals, and those confirmed to be arterial are reported. Production and stereotaxic injection of engineered retroviruses Engineered self-inactivating murine retroviruses were used to express GFP under Ubiquitin promotor (pSUbGW vector) specifically in proliferating cells and their progeny [55,56]. High titers of engineered retroviruses (1 x 109 unit/ml) were produced by cotransfection of retroviral vectors and VSVG into HEK293gp cells followed by ultracentrifugation of viral supernatant as previously described [24,49,55–57]. After induction with a single ketamine injection (50mg/ kg), high titers of GFP-expressing retroviruses were stereotaxically injected into the P15 mice dentate gyrus through a 32-gauge microsyringe (Hamilton Robotics, Reno, NV) at 2 sites of the following coordinates relative to the bregma (mm): AP: −2.2, ML: ±2.2, DV: −2.4. The ret- rovirus-containing solution was injected at a rate of 0.025 μl/min for a total of 0.5 μl per site. After infusion, the microsyringe was left in place for an additional 5 minutes to ensure full virus diffusion and to minimize backflow. After surgery, mice were monitored for general health every day until full recovery. In order to test for a possible confound related to the use of ketamine anesthesia, pS6 immunoreactivity in the dentate gyrus was quantified at P30 in naïve control animals and compared to pS6 immunoreactivity in animals doses with ketamine as above. No significant difference is seen in pS6 levels between these groups (S6 Fig). Immunostaining After transcardial perfusion fixation with 4% paraformaldehyde/PBS, brains were sliced trans- versely (50 μm thick) with microtome and processed for immunohistochemistry. Primary antibodies, including goat anti-GFP (Rockland, 1:1000) and chicken anti-GFP (Millipore, 1:1000) were used. Immunofluorescence was performed with a combination of Alexa Fluor 488- or Alexa Fluor 594-labeled anti-goat, anti-chicken, or anti-rabbit secondary antibodies (1:250) and 4´,6´-diaminodino-2-phenylindole (DAPI, 1:5000). For analysis of pS6 levels, pri- mary antibodies against pS6-Ser235/236 (rabbit, 1:1000, Cell Signaling) were used. Effective immunostaining of pS6 required an antigen retrieval protocol as previously described [58]. Briefly, sections were incubated in target retrieval solution (DAKO) in 85˚C for 20 minutes followed by washing with PBS for t3 times before the incubation with primary antibody. Imaging and analyses Images were acquired on a confocal system (Zeiss LSM 710 or Leica SPE) and morphological analyses were carried out as previously described [24,49,55,56,58,59]. Images for dendritic and spine morphology were deconvoluted with Auto Quant X (Media Cybernetics, Rockville, MD) using the blind algorithm, which employs an iteratively refined theoretical PSF. No further processing was performed prior to image analysis. For visualization, brightness, and contrast levels were adjusted using Image J (NIH). For analysis of dendritic development, three-dimen- sional (3D) reconstructions of entire dendritic processes of each GFP+ neuron were obtained from Z-series stacks of confocal images using excitation wavelength of 488 nm at high magnifi- cation (x 40 lens with 0.7x optical zoom). The two-dimensional (2D) projection images were traced with NIH Image J plugin, NeuronJ. All GFP+ DGCs with largely intact, clearly identifi- able dendritic trees were analyzed for total dendritic length. The measurements did not include corrections for inclinations of dendritic process and therefore represented projected lengths. Sholl analysis for dendritic complexity was carried out by counting the number of dendrites that crossed a series of concentric circles at 10 μm intervals from the cell soma using ImageJ (NIH). For complete 3D reconstruction of spines, consecutive stacks of images were PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 11 / 18 Anesthetic toxicity and mTOR acquired using an excitation wavelength of 488 nm at high magnification (x 63 lens with 5x optical zoom) to capture the full depth of dendritic fragments (20–35 μm long, 40~70 dendritic fragments in each condition analyzed) and spines using a confocal microscope (Zeiss, Oberko- chen. Germany). Confocal image stacks were deconvoluted using a blind deconvolution method (Autoquant X; Media Cybernetics, Rockville, MD). The structure of dendritic frag- ments and spines was traced using 3D Imaris software using a “fire” heatmap and a 2D x–y orthoslice plane to aid visualization (Bitplane, Belfast, UK). Dendritic fragments were traced using automatic filament tracer, whereas dendritic spines were traced by means of an autopath method with the semiautomatic filament tracer (diameter; min: 0.1, max: 2.0, contrast: 0.8). For spine classification, a custom MatLab (MathWorks, Natick, MA) script was used based on the algorithm; stubby: length (spine) <1.5 and max width (head)mean width (neck) (cid:3)1.2 and max_width (head) >0.3; if the spine was not classified as mushroom or stubby, it was defined as long-thin. Axonal bouton volume from axonal fragments was measured by using 3D Imaris software and using a magic wand menu (Bitplane, Belfast, UK) after deconvolution. For analysis of pS6 levels, the sections were processed in parallel and images were acquired using the identical settings, (Zeiss LSM 710, 20X lens). Fluorescence intensity was measured within the granular cell layer using Ima- geJ (NIH) and the value was normalized to background signal in the same image. These data were then subsequently normalized to the area of the dentate gyrus granule layer as defined by DAPI staining. All experiments were carried out in a blind fashion to experimental conditions. Behavioral tests Sixty-day-old mice housed in groups (5 mice per cage) were handled for at least 2 minutes per day for 3 days before the start of the behavioral experiments. All behavioral tests were per- formed during the light phase of the cycle between 8:00AM and 6:00PM. Experimenters were blind to the samples when behavioral tests were carried out and quantified. The numbers of mice per condition are indicated in the figure legends. Object-place recognition test. Object-place recognition was performed as previously described [37]. Briefly, the test was assessed in a 27.5 cm × 27.5 cm × 25 cm opaque chamber with a prominent cue on 1 of the walls. Each mouse was habituated to the chamber for 15 min- utes daily for 2 days. During the training phrase, each mouse was allowed to explore 2 identical objects (glass bottle, 2.7 cm diameter, 12 cm height, and colored paper inside) for 10 minutes. The mouse was then returned to its home cage for a retention period of 24 hours. The mouse was reintroduced to the training context and presented with 1 object that stayed in the same position as during training while the other object was moved to a new position. Movement and interaction with the objects was recorded with a video camera that was mounted above the chamber and exploratory behavior was measured by a blinded observer. Exploratory behavior was defined as sniffing, licking, or touching the object while facing the object. Y-maze test. In the Y-maze test, mice were released from the start arm (no visual cue) and allowed to habituate to only 1 out of 2 possible choice arms (overt visual cue) for 15 min- utes. This was followed at 24 hours later by the recognition phrase in which the animal could choose between the 2 choice arms after being released from the start arm. The timed trials (5 minutes) were video recorded as well as graded by an observer blind to condition for total exploration time in each choice arm. Rapamycin treatment P21 mouse littermates were given IP injections of rapamycin (Sigma-Aldrich, St. Louis, MO) prepared from a stock solution (25 mg/ml in 100% ethanol, stored at -20˚C) diluted to a final PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 12 / 18 Anesthetic toxicity and mTOR concentration of 4% (v/v) ethanol in the vehicle. Vehicle consisted of 5% Tween 80 (Sigma- Aldrich, St. Louis, MO) and 10% polyethylene glycol 400 (Sigma-Aldrich, St. Louis, MO) as pre- viously described [58,60,61]. Both rapamycin- and vehicle-treated mice received the same vol- ume for each injection (200 μl). Mice received treatments at 48 hour intervals from P21 to P29. Statistics Results are expressed as mean ± SEM. A one-tailed Student t test or ANOVA with Bonferroni test for intergroup comparisons were used for most statistical comparisons between groups as described in the figure legends using Prism Software (Graphpad Software Inc, La Jolla, CA). For Sholl analysis ANOVA was used at each point to test for differences between distributions. All data examined with parametric tests were determined to be normally distributed, and the criteria for statistical significance was set a priori at p < 0.05. Sample sizes were predicted based on experience from previous similar work [24]. All relevant data are available from the authors. Supporting information S1 Fig. A dense field of isoflurane and control group dendrites is shown for P30 and P60 to illustrate the overgrowth phenonenom (scale bar: 50μm). (A). Neurolucida tracings of P60 neurons suggest that the overgrowth does not persist at P60 (scale bar: 20μm) (B), and quanti- tative analysis by dendrite length measurement (C) Sholl analysis (D) do not show significant differences between control and isoflurane groups at P60. Isoflurane exposure does not sub- stantially alter DGC distribution. The bar graph in E shows positioning of control and isoflur- ane-exposed newborn DGCs in the dentate gyrus at P30 and P60. Layers 1, 2, and 3 refer to the inner, middle, and outer layers of granule cells in the dentate gyrus, respectively; layer 4 refers to the molecular layer. Soma size of DGCs is significantly increased at P30 ((cid:3): p<0.01 Student’s t-test), but not at P60 as show in F. To determine whether isoflurane increases branch number, we counted branch points in each dendritic arbor of the labeled neurons. No significant difference was found at either P30 or P60 (G). For all bar graphs, numbers on each barindicate the number of neurons examined from at least four mice from per group. Underly- ing data in S1 Data under Fig S1C-G. (TIF) S2 Fig. Absolute values for exploration time during the object-place recognition (A) and the Y-maze tests (B) are shown at 24 h after training (Object place-recognition: Control n = 12, Iso n = 11, (cid:3)p < 0.05, Student’s t-test; Y-maze: Control n = 12, Iso n = 11; (cid:3)p < 0.05, Student’s t-test). Individual data points are shown for the object-place recognition (C) and Y-maze tasks (D) The number of spines counted as a function of the length of each dendritic fragment on which they were counted is represented graphically for total spines (E) and mushroom spines (F) for the isoflurane (red) and control (black) groups. Dendritic spine density measurements for stubby and thin spine morphologies in control and isoflurane conditions are shown in (G) and (H), respectively. No significant differences were seen in either of these morphological groups. A reduction in stubby spine density is seen with isoflurane and a further reduction with isoflurane and rapamycin, and no significant difference is measured in thin spine density between any of the conditions ((cid:3)(cid:3) p < 0.01 (cid:3)(cid:3)(cid:3)p < 0.001 ANOVA). (TIF) S3 Fig. A tiled reconstruction of a representative confocal image of an entire dentate gyrus at P40 with immunohiostochemistry for pS6 and counterstaining for DAPI for control and isoflurane-exposed is shown (blue: DAPI; red: pS6). Scale bar: 100 μm. (TIF) PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 13 / 18 Anesthetic toxicity and mTOR S4 Fig. Immunoreactivity for pS6 measured at P60 is significantly increased after isoflur- ane treatment, and is reduced with rapamycin treatment. ((cid:3)(cid:3)(cid:3)p < 0.001, (cid:3)(cid:3)(cid:3)(cid:3)p < 0.0001, ANOVA, numbers in each bar represent n for images analyzed) Scale bar: 50 μm. Underlying data in S1 Data file under Fig S4. (TIF) S5 Fig. As an additional control tests of spatial learning were performed on animals treated with rapamycin only, in the absence of isoflurane to test for possible effects or rapamycin independent of anesthesia-induced deficits. No change in performance relative to control is measured with rapamycin in either object place-recognition (A) or Y-maze test paradigms (B). These results are also presented in the context of the control, isoflurane, and isoflurane plus rapamycin groups (C,object place recognition; D, Y-maze). Individual data points are shown for the object-place recognition (E) and Y-maze tasks (F). The number of spines counted as a function of the length of each dendritic fragment on which they were counted is represented graphically for total spines (G) and mature spines (H) for the isoflurane (red) and control (black) groups. Dendritic spine density measurements for stubby and thin spine morphologies in control and isoflurane conditions are shown in (I) and (J), respectively. Underlying data in S1 Data under Fig S5A-J. (TIF) S6 Fig. All animals used in experiments requiring stereotaxic injection of retrovirus, including both controls and isoflurane exposed groups, were anesthetized with small doses of ketamine to facilitate the surgery. To test for a possible confounding effect of ketamine, levels of pS6 labeling in the dentate gyrus were measured in naïve controls and in animals that received ketamine only. No significant difference pS6 immunoreactivity is seen between the two groups (Student’s t-test). Numbers on each bar indicate the number for images analyzed from at least five mice from per group. Scale bar: 25 μm. Underlying data in S1 Data under Fig S6. (TIF) S1 Table. Data describing the physiologic response to anesthesia from is presented from a cohort of sentinel animals. As in experimental protocols, mouse pups on postnatal day 18 (P18) were induced with Isoflurane 3% in oxygen until loss of righting reflex, and anesthesia was maintained at 1.5% in oxygen for 4h while the animals were spontaneously ventilating. Heart rate, oxyhemoglobin saturation, and skin surface temperature were measured with the Kent Scientific PhysioSuite hourly, and values obtained throughout a given hour were aver- aged (T1A). Data are presented in T1A as the mean ± SEM (n = 4 readings taken in 6 sentinel animals). At the end of the protocol animals were sacrificed, and blood samples were obtained by attempted cannulation of the left ventricle. Due to technical limitations we were not able to obtain an arterial sample for all animals. The value for partial pressure of oxygen for arterial samples is shown as is the blood glucose concentration for all samples (T1B). Underlying data in S1 Data under Fig 3A–3G. Underlying data in S1 Data under Fig S1T. (TIF) S1 Data. Source data. Cited in figure legends in manuscript. (XLSX) Acknowledgments We would like to acknowledge the helpful contributions of Sunu Kim (technical assistance) and Allan Gottschalk (critical commentary). PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 14 / 18 Anesthetic toxicity and mTOR Author Contributions Conceptualization: Yun Kyoung Ryu, Roger A. Johns, Hongjun Song, Guo-Li Ming, C. David Mintz. Funding acquisition: C. David Mintz. Investigation: Eunchai Kang, Danye Jiang, Yun Kyoung Ryu, Sanghee Lim, Minhye Kwak, Christy D. Gray, Michael Xu, Jun H. Choi, Sue Junn, Jieun Kim, C. David Mintz. Methodology: Eunchai Kang, Yun Kyoung Ryu, Hongjun Song, Guo-Li Ming, C. David Mintz. Project administration: C. David Mintz. Resources: Roger A. Johns, Hongjun Song, Guo-Li Ming, C. David Mintz. Supervision: Eunchai Kang, Yun Kyoung Ryu, Roger A. Johns, Hongjun Song, C. David Mintz. Visualization: C. David Mintz. Writing – original draft: Eunchai Kang, Danye Jiang, Christy D. Gray, Michele Schaefer, C. David Mintz. Writing – review & editing: Michael Xu, Jing Xu, Michele Schaefer, Roger A. Johns, Hongjun Song, C. David Mintz. References 1. DiMaggio C, Sun LS, Kakavouli A, Byrne MW, Li G. A retrospective cohort study of the association of anesthesia and hernia repair surgery with behavioral and developmental disorders in young children. J Neurosurg Anesthesiol. 2009; 21(4): 286–291. https://doi.org/10.1097/ANA.0b013e3181a71f11 PMID: 19955889 2. Ing C, Dimaggio C, Whitehouse A, Hegarty MK, Brady J, von Ungern-Sternberg B, et al. Long-term Dif- ferences in Language and Cognitive Function After Childhood Exposure to Anesthesia. Pediatrics. 2012 Aug; peds.2011-3822; https://doi.org/10.1542/peds.2011-3822 PMID: 22908104 3. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, et al. Early exposure to anes- thesia and learning disabilities in a population-based birth cohort. Anesthesiology. 2009; 110(4): 796– 804. https://doi.org/10.1097/01.anes.0000344728.34332.5d PMID: 19293700 4. Erasso DM, Chaparro RE, Quiroga Del Rio CE, Karlnoski R, Camporesi EM, Saporta S. Quantitative assessment of new cell proliferation in the dentate gyrus and learning after isoflurane or propofol anes- thesia in young and aged rats. Brain Res. 2012; 1441: 38–46. https://doi.org/10.1016/j.brainres.2011. 11.025 PMID: 22297171 5. Huang L, Cichon J, Ninan I, Yang G. Post-anesthesia AMPA receptor potentiation prevents anesthesia- induced learning and synaptic deficits. Sci Transl Med. 2016; 8 (344): 344ra385. 6. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, et al. Early expo- sure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci. 2003; 23(3): 876–882. PMID: 12574416 7. Lee BH, Chan JT, Hazarika O, Vutskits L, Sall JW. Early exposure to volatile anesthetics impairs long- term associative learning and recognition memory. PLoS ONE. 2014;9(8): e105340. https://doi.org/10. 1371/journal.pone.0105340 PMID: 25165850 8. Levin ED, Uemura E, Bowman RE. Neurobehavioral toxicology of halothane in rats. Neurotoxicol Tera- tol. 1991; 13(4): 461–470. PMID: 1921926 9. Ramage TM, Chang FL, Shih J, Alvi RS, Quitoriano GR, Rau V, et al. Distinct long-term neurocognitive outcomes after equipotent sevoflurane or isoflurane anaesthesia in immature rats. Br J Anaesth. 2013; 110 Suppl 1: i39–46. 10. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, Ito M, et al. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology. 2009 Mar; 110(3): 628–637. https://doi.org/10.1097/ALN.0b013e3181974fa2 PMID: 19212262 PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 15 / 18 Anesthetic toxicity and mTOR 11. Shih J, May LD, Gonzalez HE, Lee EW, Alvi RS, Sall JW, et al. Delayed environmental enrichment reverses sevoflurane-induced memory impairment in rats. Anesthesiology. 2012 Mar; 116(3): 586– 602. https://doi.org/10.1097/ALN.0b013e318247564d PMID: 22354242 12. Zhu C, Gao J, Karlsson N, Li Q, Zhang Y, Huang Z, et al. Isoflurane anesthesia induced persistent, pro- gressive memory impairment, caused a loss of neural stem cells, and reduced neurogenesis in young, but not adult, rodents. J Cereb Blood Flow Metab. 2010 May; 30(5): 1017–1030. https://doi.org/10. 1038/jcbfm.2009.274 PMID: 20068576 13. Davidson AJ, Disma N, de Graaff JC, Withington DE, Dorris L, Bell G, et al. Neurodevelopmental out- come at 2 years of age after general anaesthesia and awake-regional anaesthesia in infancy (GAS): an international multicentre, randomised controlled trial. Lancet. 2016; 387(10015): 239–250. https://doi. org/10.1016/S0140-6736(15)00608-X PMID: 26507180 14. Sun LS, Li G, Miller TL, Salorio C, Byrne MW, Bellinger DC; et al. Association Between a Single General Anesthesia Exposure Before Age 36 Months and Neurocognitive Outcomes in Later Childhood. JAMA. 2016 Jun; 315(21): 2312–2320. https://doi.org/10.1001/jama.2016.6967 PMID: 27272582 15. Raper J, Alvarado MC, Murphy KL, Baxter MG. Multiple Anesthetic Exposure in Infant Monkeys Alters Emotional Reactivity to an Acute Stressor. Anesthesiology. 2015 Nov; 123(5): 1084–1092. https://doi. org/10.1097/ALN.0000000000000851 PMID: 26313293 16. Hays SR, Deshpande JK. Newly postulated neurodevelopmental risks of pediatric anesthesia: theories that could rock our world. J Urol. 2013 Apr; 189(4): 1222–1228. https://doi.org/10.1016/j.juro.2012.11. 090 PMID: 23178900 17. Kuehn BM. FDA considers data on potential risks of anesthesia use in infants, children. JAMA. 2011 May; 305(17): 1749–1750, 1753. https://doi.org/10.1001/jama.2011.546 PMID: 21540413 18. Rappaport BA, Suresh S, Hertz S, Evers AS, Orser BA. Anesthetic neurotoxicity—clinical implications of animal models. N Engl J Med. 2015 Feb; 372: 796–797. https://doi.org/10.1056/NEJMp1414786 PMID: 25714157 19. Istaphanous GK, Ward CG, Nan X, Hughes EA, McCann JC, McAuliffe JJ, et al. Characterization and quantification of isoflurane-induced developmental apoptotic cell death in mouse cerebral cortex. Anesth Analg. 2013 Apr; 116(4): 845–854. https://doi.org/10.1213/ANE.0b013e318281e988 PMID: 23460572 20. Wagner M, Ryu YK, Smith SC, Mintz CD. Review: effects of anesthetics on brain circuit formation. J Neurosurg Anesthesiol. 2014 Oct; 26(4): 358–362. https://doi.org/10.1097/ANA.0000000000000118 PMID: 25144504 21. Tau GZ, Peterson BS. Normal development of brain circuits. Neuropsychopharmacology. 2010 Jan; 35 (1): 147–168. https://doi.org/10.1038/npp.2009.115 PMID: 19794405 22. Lefebvre JL, Sanes JR, Kay JN. Development of Dendritic Form and Function. Annu Rev Cell Dev Biol. 2015; 31: 741–777. https://doi.org/10.1146/annurev-cellbio-100913-013020 PMID: 26422333 23. Kang E, Berg DA, Furmanski O, Jackson WM, Ryu YK, Gray CD, et al. Neurogenesis and developmen- tal anesthetic neurotoxicity. Neurotoxicol Teratol. 2017 Mar; 60:33–39. https://doi.org/10.1016/j.ntt. 2016.10.001 PMID: 27751818 24. Ge S, Goh EL, Sailor KA, Kitabatake Y, Ming GL, Song H. GABA regulates synaptic integration of newly generated neurons in the adult brain. Nature. 2006 Feb; 439(7076): 589–593. https://doi.org/10. 1038/nature04404 PMID: 16341203 25. Dolen G, Bear MF. Fragile x syndrome and autism: from disease model to therapeutic targets. J Neuro- dev Disord. 2009 Jun; 1(2): 133–140. https://doi.org/10.1007/s11689-009-9015-x PMID: 21547712 26. Takei N, Nawa H. mTOR signaling and its roles in normal and abnormal brain development. Front Mol Neurosci. 2014 Apr; 7: 28. https://doi.org/10.3389/fnmol.2014.00028 PMID: 24795562 27. Cameron CB, Robinson S, Gregory GA. The minimum anesthetic concentration of isoflurane in chil- dren. Anesth Analg. 1984 Apr; 63(4): 418–420. PMID: 6703367 28. Mintz CD, Smith SC, Barrett KM, Benson DL. Anesthetics interfere with the polarization of developing cortical neurons. J Neurosurg Anesthesiol. 2012; 24(4): 368–375. https://doi.org/10.1097/ANA. 0b013e31826a03a6 PMID: 23085784 29. Ryu YK, Khan S, Smith SC, Mintz CD. Isoflurane impairs the capacity of astrocytes to support neuronal development in a mouse dissociated coculture model. J Neurosurg Anesthesiol. 2014 Oct; 26(4): 363– 368. https://doi.org/10.1097/ANA.0000000000000119 PMID: 25191957 30. Jan YN, Jan LY. The control of dendrite development. Neuron. 2003 Oct; 40(2): 229–242. PMID: 14556706 31. Vutskits L, Gascon E, Tassonyi E, Kiss JZ. Clinically relevant concentrations of propofol but not midazo- lam alter in vitro dendritic development of isolated gamma-aminobutyric acid-positive interneurons. Anesthesiology. 2005 May; 102(5): 970–976. PMID: 15851884 PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 16 / 18 Anesthetic toxicity and mTOR 32. Amaral DG, Scharfman HE, Lavenex P. The dentate gyrus: fundamental neuroanatomical organization (dentate gyrus for dummies). Prog Brain Res. 2007; 163: 3–22. https://doi.org/10.1016/S0079-6123 (07)63001-5 PMID: 17765709 33. Briner A, De Roo M, Dayer A, Muller D, Habre W, Vutskits L. Volatile anesthetics rapidly increase den- dritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiology. 2010 Mar; 112(3): 546–556. https://doi.org/10.1097/ALN.0b013e3181cd7942 PMID: 20124985 34. Jan YN, Jan LY. Branching out: mechanisms of dendritic arborization. Nat Rev Neurosci. 2010 May; 11(5): 316–328. https://doi.org/10.1038/nrn2836 PMID: 20404840 35. Galvez R, Smith RL, Greenough WT. Olfactory bulb mitral cell dendritic pruning abnormalities in a mouse model of the Fragile-X mental retardation syndrome: further support for FMRP’s involvement in dendritic development. Brain Res Dev Brain Res. 2005 Jun; 157(2): 214–216. https://doi.org/10.1016/j. devbrainres.2005.03.010 PMID: 15878626 36. Jiang M, Ash RT, Baker SA, Suter B, Ferguson A, Park J, et al. Dendritic arborization and spine dynam- ics are abnormal in the mouse model of MECP2 duplication syndrome. J Neurosci. 2013 Dec; 33(50): 19518–19533. https://doi.org/10.1523/JNEUROSCI.1745-13.2013 PMID: 24336718 37. Zhou M, Li W, Huang S, Song J, Kim JY, Tian X, et al. mTOR Inhibition ameliorates cognitive and affec- tive deficits caused by Disc1 knockdown in adult-born dentate granule neurons. Neuron. 2013 Feb; 77(4): 647–654. https://doi.org/10.1016/j.neuron.2012.12.033 PMID: 23439118 38. Grienberger C, Chen X, Konnerth A. Dendritic function in vivo. Trends Neurosci. 2015 Jan; 38(1): 45– 54. https://doi.org/10.1016/j.tins.2014.11.002 PMID: 25432423 39. Bourne J, Harris KM. Do thin spines learn to be mushroom spines that remember? Curr Opin Neurobiol. 2007 Jun; 17(3): 381–386. https://doi.org/10.1016/j.conb.2007.04.009 PMID: 17498943 40. Amrock LG, Starner ML, Murphy KL, Baxter MG. Long-term effects of single or multiple neonatal sevo- flurane exposures on rat hippocampal ultrastructure. Anesthesiology. 2015 Jan; 122(1): 87–95. https:// doi.org/10.1097/ALN.0000000000000477 PMID: 25289484 Lunardi N, Hucklenbruch C, Latham JR, Scarpa J, Jevtovic-Todorovic V. Isoflurane impairs immature astroglia development in vitro: the role of actin cytoskeleton. J Neuropathol Exp Neurol. 2011 Apr; 70(4): 281–291. https://doi.org/10.1097/NEN.0b013e31821284e9 PMID: 21412172 40. Amrock LG, Starner ML, Murphy KL, Baxter MG. Long-term effects of single or multiple neonatal sevo- flurane exposures on rat hippocampal ultrastructure. Anesthesiology. 2015 Jan; 122(1): 87–95. https:// doi.org/10.1097/ALN.0000000000000477 PMID: 25289484 Lunardi N, Hucklenbruch C, Latham JR, Scarpa J, Jevtovic-Todorovic V. Isoflurane impairs immature astroglia development in vitro: the role of actin cytoskeleton. J Neuropathol Exp Neurol. 2011 Apr; 70(4): 281–291. https://doi.org/10.1097/NEN.0b013e31821284e9 PMID: 21412172 42. Semple BD, Blomgren K, Gimlin K, Ferriero DM, Noble-Haeusslein LJ. Brain development in rodents and humans: Identifying benchmarks of maturation and vulnerability to injury across species. Prog Neu- robiol. 2013; 106–107: 1–16. https://doi.org/10.1016/j.pneurobio.2013.04.001 PMID: 23583307 43. Briner A, Nikonenko I, De Roo M, Dayer A, Muller D, Habre W, et al. Developmental Stage-dependent persistent impact of propofol anesthesia on dendritic spines in the rat medial prefrontal cortex. Anesthe- siology. 2010; 11: 282–293. 44. Costa-Mattioli M, Monteggia LM. mTOR complexes in neurodevelopmental and neuropsychiatric disor- ders. Nat Neurosci. 2013; 16: 1537–1543. https://doi.org/10.1038/nn.3546 PMID: 24165680 45. Tan H, Li CL, Zhang L, Yang ZJ, Zhao X, Wang YW. Sevoflurane inhibits the phosphorylation of ribo- somal protein S6 in neonatal rat brain. Int J Clin Exp Med. 2015; 8(9): 14816–14826. PMID: 26628963 46. Lipton JO, Sahin M. The neurology of mTOR. Neuron. 2014 Oct; 84: 275–291. https://doi.org/10.1016/ j.neuron.2014.09.034 PMID: 25374355 47. Switon K, Kotulska K, Janusz-Kaminska A, Zmorzynska J, Jaworski J. Molecular neurobiology of mTOR. Neuroscience. 2017 Jan; 341: 112–153. https://doi.org/10.1016/j.neuroscience.2016.11.017 PMID: 27889578 48. Swiech L, Perycz M, Malik A, Jaworski J. Role of mTOR in physiology and pathology of the nervous sys- tem. Biochim Biophys Acta. 2008 Jan; 1784(1): 116–132. https://doi.org/10.1016/j.bbapap.2007.08. 015 PMID: 17913600 49. Duan X, Chang JH, Ge S, Faulkner RL, Kim JY, Kitabatake Y, et al. Disrupted-In-Schizophrenia 1 regu- lates integration of newly generated neurons in the adult brain. Cell. 2007 Sept; 130(6): 1146–1158. https://doi.org/10.1016/j.cell.2007.07.010 PMID: 17825401 50. Kumar V, Zhang MX, Swank MW, Kunz J, Wu GY. Regulation of dendritic morphogenesis by Ras- PI3K-Akt-mTOR and Ras-MAPK signaling pathways. J Neurosci. 2005 Dec; 25 (4): 11288–11299. 51. Pun RY, Rolle IJ, Lasarge CL, Hosford BE, Rosen JM, Uhl JD; et al. Excessive activation of mTOR in postnatally generated granule cells is sufficient to cause epilepsy. Neuron. 2012 Sep; 75(6): 1022– 1034. https://doi.org/10.1016/j.neuron.2012.08.002 PMID: 22998871 52. Altman J, Bayer SA. Migration and distribution of two populations of hippocampal granule cell precur- sors during the perinatal and postnatal periods. J Comp Neurol. 1990 Nov; 301(3): 365–381. https:// doi.org/10.1002/cne.903010304 PMID: 2262596 PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 17 / 18 Anesthetic toxicity and mTOR 53. Rakic P, Nowakowski RS. The time of origin of neurons in the hippocampal region of the rhesus mon- key. J Comp Neurol. 1981 Feb; 196(1): 99–128. https://doi.org/10.1002/cne.901960109 PMID: 7204668 54. Sato A. mTOR, a Potential Target to Treat Autism Spectrum Disorder. CNS Neurol Disord Drug Tar- gets. 2016; 15(5): 533–543. https://doi.org/10.2174/1871527315666160413120638 PMID: 27071790 55. Kang E, Burdick KE, Kim JY, Duan X, Guo JU, Sailor KA, et al. Interaction between FEZ1 and DISC1 in regulation of neuronal development and risk for schizophrenia. Neuron. 2011 Nov; 72(4): 559–571. https://doi.org/10.1016/j.neuron.2011.09.032 PMID: 22099459 56. Zhang H, Kang E, Wang Y, Yang C, Yu H, Wang Q, et al. Brain-specific Crmp2 deletion leads to neuro- nal development deficits and behavioural impairments in mice. Nat Commun. 2016; 7: https://doi.org/ 10.1038/ncomms11773 PMID: 27249678 57. Song J, Sun J, Moss J, Wen Z, Sun GJ, Hsu D, et al. Parvalbumin interneurons mediate neuronal cir- cuitry-neurogenesis coupling in the adult hippocampus. Nat Neurosci. 2013 Dec; 16(12): 1728–1730. https://doi.org/10.1038/nn.3572 PMID: 24212671 58. Kim JY, Duan X, Liu CY, Jang MH, Guo JU, Pow-anpongkul N, et al. DISC1 regulates new neuron development in the adult brain via modulation of AKT-mTOR signaling through KIAA1212. Neuron. 2009 Sep; 63(6): 761–773. https://doi.org/10.1016/j.neuron.2009.08.008 PMID: 19778506 59. Jang MH, Bonaguidi MA, Kitabatake Y, Sun J, Song J, Kang E, et al. Secreted frizzled-related protein 3 regulates activity-dependent adult hippocampal neurogenesis. Cell Stem Cell. 2013 Feb; 12(2): 215– 223. https://doi.org/10.1016/j.stem.2012.11.021 PMID: 23395446 60. Kim JY, Liu CY, Zhang F, Duan X, Wen Z, Song J, et al. Interplay between DISC1 and GABA signaling regulates neurogenesis in mice and risk for schizophrenia. Cell. 2012 Mar; 148(5): 1051–1064. https:// doi.org/10.1016/j.cell.2011.12.037 PMID: 22385968 61. Mao Y, Ge X, Frank CL, Madison JM, Koehler AN, Doud MK, et al. Disrupted in schizophrenia 1 regulates neuronal progenitor proliferation via modulation of GSK3beta/beta-catenin signaling. Cell. 2009 Mar; 136(6): 1017–1031. https://doi.org/10.1016/j.cell.2008.12.044 PMID: 19303846 PLOS Biology | https://doi.org/10.1371/journal.pbio.2001246 July 6, 2017 18 / 18",mice,['Using an in vivo mouse model we demonstrate abnormal development of dendrite arbors and dendritic spines in newly generated dentate gyrus granule cell neurons of the hippocampus after a clinically relevant isoflurane anesthesia exposure conducted at an early postnatal age.'],postnatal day 18,"['Injections were conducted at postnatal day (P) 15; on P18, the animals were exposed to isoflurane, a canonical halogenated ether vapor anesthetic.']",Y,"['In the object-place recognition test, control animals spend significantly more time exploring objects in novel positions, but isoflurane- exposed animals exhibit no exploration preference.', 'Similarly, in the Y-maze test, unlike controls, isoflurane-exposed mice do not exhibit a preference for exploration of the newly available arm.']",isoflurane,"['Injections were conducted at postnatal day (P) 15; on P18, the animals were exposed to isoflurane, a canonical halogenated ether vapor anesthetic.']",none,[],c57bl/6,"['C57BL/6 mice were housed in a temperature- and humidity-controlled room with a 12:12 hour light:dark cycle, and provided with ad libitum access to water and food.']",Isoflurane disrupts the development of hippocampal neurons generated in the early postnatal period by activating a well-defined neurodevelopmental disease pathway and that this phenotype can be reversed by pharmacologic inhibition.,['We conclude that isoflurane disrupts the development of hippocampal neurons generated in the early postnatal period by activating a well-defined neurodevelopmental disease pathway and that this phenotype can be reversed by pharmacologic inhibition.'],Use of a retrovirus-mediated labeling method in intact mice to examine the development of dendrite arbors and dendritic spines in DGCs in vivo after exposure to isoflurane.,['We employed a retrovirus-mediated labeling method in intact mice to examine the development of dendrite arbors and dendritic spines in DGCs in vivo after exposure to a clinically relevant dose of isoflurane.'],The findings reveal a novel mechanism by which anesthetics disrupt brain development that has been implicated in other neurodevelopmental disorders and that is potentially reversible via drug therapy.,['Our findings reveal a novel mechanism by which anesthetics disrupt brain development that has been implicated in other neurodevelopmental disorders and that is potentially reversible via drug therapy.'],None,[],The discovery of a reversible mechanism of injury in developmental anesthetic neurotoxicity has translational potential that can be explored in future studies.,"['Thus, our discovery of a novel, reversible mechanism of injury in developmental anesthetic neurotoxicity has translational potential that can be explored in future studies.']",True,True,True,True,True,True,10.1371/journal.pbio.2001246 10.1016/j.bcp.2012.06.001,470.0,Kong,2012,rats,gestational day 14,Y,isoflurane,none,none,"Biochemical Pharmacology 84 (2012) 558–563 Contents lists available at SciVerse ScienceDirect Biochemical Pharmacology j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b i o c h e m p h a r m Fetal exposure to high isoflurane concentration induces postnatal memory and learning deficits in rats Fei-Juan Kong a, Lei-Lei Ma b, Wen-Wen Hu c, Wen-Na Wang b, Hui-Shun Lu c,*, Shu-Ping Chen a,** a Department of Anesthesiology, First People’s Hospital of Hangzhou, PR China b Department of Anesthesiology, Second Affiliated Hospital, School of Medicine, Zhejiang University, PR China c Department of Anesthesiology, Women’s Hospital, School of Medicine, Zhejiang University, PR China A R T I C L E I N F O A B S T R A C T Article history: Received 9 May 2012 Accepted 1 June 2012 Available online 15 June 2012 Keywords: Isoflurane Fetal rats Memory and learning deficits Neuron apoptosis Synaptic plasticity We developed a maternal fetal rat model to study the effects of isoflurane-induced neurotoxicity on the fetuses of pregnant rats exposed in utero. Pregnant rats at gestational day 14 were exposed to 1.3 or 3% isoflurane for 1 h. At postnatal day 28, spatial learning and memory of the offspring were examined using the Morris Water Maze. The apoptosis was evaluated by caspase-3 immunohistochemistry in the hippocampal CA1 region. Simultaneously, the ultrastructure changes of synapse in the hippocampal CA1 and dentate gyrus region were observed by transmission electron microscopy (TEM). The 3% isoflurane treatment group showed significantly longer escape latency, less time spent in the third quadrant and fewer original platform crossings in the Morris Water Maze test, significantly increased number and optical densities of caspase-3 neurons. This treatment also produced remarkable changes in synaptic ultrastructure compared with the control and the 1.3% isoflurane groups. There were no differences in the Morris Water Maze test, densities of caspase-3 positive cells, or synaptic ultrastructure between the control and 1.3% isoflurane groups. High isoflurane concentration (3%) exposure during pregnancy caused spatial memory and learning impairments and more neurodegeneration in the offspring rats compared with control or lower isoflurane concentrations. (cid:2) 2012 Elsevier Inc. All rights reserved. 1. Introduction prior neurodevelopmental studies focused on postnatal subjects rather than on the fetuses. Inhalation anesthetics such as isoflurane have been widely used in recent years in clinical and research practices. A growing body of evidence both in animals [1–3], and humans [4–6] supports the view that exposure to anesthetics early in life causes neurohis- topathologic changes and long-term cognitive impairments. Our recent study also demonstrated gestational exposure to a clinically relevant concentration of isoflurane could cause neuron apoptosis, changes of synaptic structure, and postnatal spatial memory and learning impairments in the offspring rats [7,8]. Anesthesia given to immature rodents causes cognitive dysfunction, raising the possibility that the same might be true for millions of human fetuses, neonates and infants undergoing surgical procedures under general anesthesia each year. Nevertheless, the majority of Corresponding author at: Department of Anesthesiology, Women’s Hospital, School of Medicine, Zhejiang University, No. 1 Bachelor Road, Hangzhou 310006, PR China. Tel.: +86 571 87065701x2410; fax: +86 571 87061878. ** Corresponding author at: Department of Anesthesiology, First People’s Hospital of Hangzhou, No. 261 Huansha Road, Hangzhou, 310006, PR China. Tel.: +86 571 87065701x10448; fax: +86 571 87914773. E-mail address: kongfeijuan@163.com (S.-P. Chen). 0006-2952/$ – see front matter (cid:2) 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.bcp.2012.06.001 Many pregnant women, fetuses, and infants are exposed to a variety of anesthetic agents for surgical or diagnostic procedures each year. Pregnant women sometimes undergo general anesthe- sia during their pregnancy for surgeries unrelated to the delivery, such as fetal and non-obstetric surgeries, especially during mid- gestation [9,10]. It is estimated that some 1–2% of pregnant women in developed countries undergo anesthesia during their pregnancy for surgery unrelated to the delivery [11]. Since most general anesthetic agents are lipophilic and cross the placenta easily [12], the developing fetal brains will be exposed to anesthetics as well. We have previously shown that 1.3% isoflurane administered during pregnancy produced detectable effects to the rat pups [7,8]. Furthermore, in some cases, such as fetal surgery to correct various congenital malformations during mid-gestation, the fetal brain can be exposed to 2–3 times (2.5–3 Minimal Alveolar Concentration (MAC)) higher than clinically relevant concentrations of inhalation anesthetics to relax uterine smooth muscle and provide adequate anesthesia [10,13]. Fetal surgery is relatively new and rare, however, it is a rapidly growing and evolving area, and may become standard therapy for most disabling malformations that are currently treated in young infants [13,14]. Given the dose-dependent neurodegenerative properties F.-J. Kong et al. / Biochemical Pharmacology 84 (2012) 558–563 of anesthetics, we hypothesized that high isoflurane concentra- tions normally used during fetal surgery causes spatial memory and in offspring. learning impairments and more neurodegeneration Here, we studied the potential effects of different isoflurane concentrations on neuroapoptosis and cognitive function on the offspring of pregnant rats exposed to anesthesia at gestational day 14. the changes of synaptic ultrastructure in the hippocampal area used transmission electron microscopy (TEM). In addition, we investigated 2. Materials and methods 2.1. Animals 2.3.1. Place trials The place trials were performed at postnatal day 29 for 4 days to determine the rats’ ability to obtain spatial information. At postnatal day 28, rats were tested for their ability to swim to a visible platform through a 30-s swimming training. A dark black curtain surrounded the pool to prevent confounding visual cues. All rats received 4 trials per day in each of the four quadrants of the swimming pool. On each trial, rats were placed in a fixed position into the swimming pool facing the wall. They were allotted 120 s to find the platform upon which they sat for 20 s before being removed from the pool. If a rat did not find the platform within 120 s, the rat was gently guided to the platform and allowed to remain there for 20 s. For all training trials, swim speed and the time to reach the platform (escape latency) were recorded. The less time it took a rat to reach the platform, the better the learning ability. We took the average of four trials as the escape latency each day. All of the animals were treated according to the guidelines of the Guide for the Care and Use of Laboratory Animals (China Ministry of Health). The Laboratory Animal Care Committee of Zhejiang University approved all experimental procedures and protocols. All efforts were made to minimize the number of animals used and their suffering. The dams were housed in polypropylene cages, and the room temperature was maintained at 22 8C, with a 12-h light–dark cycle. The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to mid-gestation in humans [15,16], the period when most non-obstetric surgeries and fetal interventions are performed [9,10]. 2.3.2. Probe trials Probe trials were conducted immediately after the four-day period to evaluate memory retention capabilities. The probe trials involved the submerged platform of the third quadrant from the pool and allowing the rats to swim for 120 s in any of the four quadrants of the swimming pool. Time spent in the third quadrant and the number of original platform crossing in the third quadrant was recorded. 2.4. Transmission electron microscopy 2.2. Anesthesia exposure The dams were randomly divided into three groups: control, low concentration of isoflurane (1.3%), and high concentration of isoflurane (3%) treatment groups (n = 8). The dams were placed in plastic containers resting in water baths with a constant tempera- ture of 38 8C. In these boxes, pregnant rats in isoflurane treatment groups were exposed to 1.3 or 3% isoflurane (Lot 826005U, Abbott Laboratories Limited, USA) in a humidified 30% oxygen carrier gas for 1 h; the control group was exposed to simply humidified 30% oxygen without any inhalational anesthetic for 1 h. We chose 1.3% because it represents 1 MAC in the pregnant rats [17], and 3% is equal to (cid:2)2 MAC. The determination of anesthetic duration based on our preliminary study which indicated that maternal physiological states remained stable throughout a 1-h isoflurane exposure. The isoflurane concentration, oxygen and carbon dioxide levels in the box were monitored with an agent gas monitor (Vamos, Drager Medical AG & Co. KgaA, Germany). Otherwise, control and experimental animals were under treatment and environment. Arterial blood gases (ABG) and blood glucose were measured at the end of the 1-h anesthetic exposure. The rectal temperature was maintained at 37 (cid:3) 0.5 8C. After exposure, all the dams were returned to their cages and allowed to deliver naturally. The postnatal body weights of the rat pups were monitored. the same 2.3. Memory and learning studies Four rat pups (2 females and 2 males) from each dam were selected to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications [1]. A round pool (diameter, 150 cm; depth, 50 cm) was filled with warm (24 8C) opaque water to a height of 1.5 cm above the top of the movable clear 15-cm-diameter platform in the third quadrant. A video tracking system recorded the swimming motions of animals, and the data were analyzed using motion-detection software for the Morris Water Maze (Actimetrics Software, Evanston, IL, USA). After every trial, each rat was wiped before returning to its regular cage, kept warm and allowed free access to food. After the Morris Water Maze test, six pups per group were anesthetized with a lethal dose of Nembutal. The thoracic cavities were opened and perfused intracardially with 100 mL of normal saline. Then the hippocampus, including CA1 and dentate gyrus area, of each rat was taken out immediately. Immersion fixation was completed on tissues about 1 mm3 from the hippocampus. Samples were rinsed in cold phosphate-buffered saline (PBS) and placed in 2.5% glutaraldehyde at 4 8C for 4 h. The tissue was rinsed in buffer and post-fixed with 1% osmium tetroxide for 1 h. Then, the tissue was rinsed with distilled water before undergoing a graded ethanol dehydration series and was infiltrated using a mixture of half propylene oxide and half resin overnight. Twenty- four hours later, the tissue was embedded in resin. 120 nm sections were cut and stained with 4% uranyl acetate for 20 min and 0.5% lead citrate for 5 min. Ultrastructure changes of synapse in the hippocampus were observed under a transmission electron microscope (Philips Tecnai 10, Holland). 2.5. Tissue section preparation After the Morris Water Maze test, two pups from each dam were anesthetized by intraperitoneal injection of a lethal dose of Nembutal. The aorta was cannulated and the animal was firstly perfused with 200 mL of normal saline, then with 250 mL of 4% formaldehyde (freshly made from paraformaldehyde) for 20– 30 min. The fixed brain was then removed from the cranial cavity and post-fixed overnight in the same fixative at 4 8C. The tissues were embedded in paraffin, and transverse paraffin sections containing the hippocampal area were mounted on silanecoated slides. Sections were deparaffinaged and rehydrated. Then the sections were treated for antigen retrieval with 10.2 mmol/L sodium citrate buffer, pH 6.1, for 20 min at 95 8C for immunohis- tochemistry. 2.6. Immunohistochemistry for caspase-3 Caspase-3 positive cells were measured in the hippocampal immunohistochemical methods described CA1 region, using 559 560 F.-J. Kong et al. / Biochemical Pharmacology 84 (2012) 558–563 previously [7,8]. The brain region was chosen because is particularly vulnerable to anesthesia-induced neurodegeneration [1] and is important to memory and learning. Briefly, the sections mentioned above were washed in 0.01 M PBS containing 0.3% Triton X-100 (pH 7.4, PBS-T), followed by blocking in 5% normal goat serum in 0.01 M PBS. The sections were then incubated in the primary antibodies rabbit polyclonal against anti-caspase-3 (1:200, Santa Cruz Biotechnology, USA) overnight at 4 8C. After a thorough wash in PBS, sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200, Wuhan Boster Biological Technology, Ltd., China) for 2 h at room temperature, followed by avidin–biotin–peroxidase complex solution (ABC, 1:100, Wuhan Boster Biological Technology, Ltd., China) for 2 h at room temperature. Immunolabeling was visualized with 0.05% diami- nobenzdine (DAB, Wuhan Boster Biological Technology, Ltd., China) plus 0.3% H2O2 in PBS and the reaction was stopped by rinsing the slides with 0.2 M Tris–HCl. Sections were mounted onto 0.02% poly-L-lysinecoated slides and allowed to dry at room temperature. Then the sections were dehydrated through a graded series of alcohols, cleared in xylene and finally coverslipped. Rat Immunoglobulin IgG (1:200, Biomeda Corporation, USA) was used instead of primary antibody as a negative control. Other chemicals used in this study were provided by Cell Signaling Technology (Beverly, MA). Three sections from hippocampal CA1 region of each animal were randomly selected and images were photographed under 400(cid:4) magnification in 3 visual fields/per section, the caspase-3 positive neurons were counted in the same area. The optical densities of caspase-3 positive neurons were measured quantitatively using Image-Pro Plus version 6.0 (Media Cybernet- ics, Inc., Silver Spring, USA). The optical density of caspase-3 positive cells in a particular brain region was calculated by dividing the integrated optical density of caspase-3 positive cells by the area of that brain region. it treatment groups on any measured variables for ABG values and blood glucose levels. Taking these measures reduces the possibility that isoflurane-induced neurodegeneration in the fetal brains was caused by physiologic side effects (e.g. hypoglycemia, hypoxia and hypercapnia). All pups were viable and there were no significant differences in growth rate of the rat pups among the three groups (P0, 7.23 (cid:3) 0.55, 7.24 (cid:3) 0.49 and 7.18 (cid:3) 0.67 g; P28, 102.26 (cid:3) 3.45, 103.19 (cid:3) 4.15 and 101.78 (cid:3) 4.15 g, in control, 1.3% and 3% isoflurane- exposed pups, respectively). 2.7. Statistical analysis All data were presented as mean (cid:3) S.E.M. Results of weight of postnatal rat pups and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Other data were analyzed using one-way ANOVA, followed by Tukey post hoc multiple comparison tests. A P value of <0.05 was considered statistically significant. All statistical tests and graphs were performed or generated, respectively, using Graph-Pad Prism Version 4.0 (Graph- Pad Prism Software, Inc., CA, USA). 3. Results 3.1. Physiologic parameters As shown in Table 1, ABG values and blood glucose levels were within the normal physiologic range. There were no significant differences between the low and high concentrations of isoflurane Table 1 Maternal physiological parameters during isoflurane exposure. 0 h 1 h 1.3% Iso 3% Iso 1.3% Iso 3% Iso pH PaCO2 (mmHg) PaO2 (mmHg) SaO2 (%) Glucose (mg/dl) 7.45 (cid:3) 0.02 40.8 (cid:3) 2.01 159 (cid:3) 5.46 96.7 (cid:3) 1.3 114 (cid:3) 18 7.41 (cid:3) 0.02 40.6 (cid:3) 1.64 162 (cid:3) 4.25 95.3 (cid:3) 1.1 116 (cid:3) 20 Values are mean (cid:3) S.E.M. n = 8 for each group. Iso = isoflurane; PaCO2 = arterial carbon dioxide tension; SaO2 = arterial oxygen saturation. 7.44 (cid:3) 0.02 43.6 (cid:3) 2.65 163 (cid:3) 6.98 96.1 (cid:3) 0.9 115 (cid:3) 21 7.36 (cid:3) 0.01 43.9 (cid:3) 3.17 166 (cid:3) 5.45 95.4 (cid:3) 1.2 114 (cid:3) 16 tension; PaO2 = arterial oxygen Fig. 1. Rats exposed to isoflurane in utero at high concentration (3%) impaired postnatal memory and learning ability in the Morris Water Maze test. (A) Place trial demonstrating the latency for offspring rats to reach platform measuring spatial information acquisition. (B and C) Probe trial demonstrating the number of original platform crossing (B) and the time spent in the third quadrant (C) measuring memory retention capabilities. Iso, isoflurane. Data represent mean (cid:3) S.E.M. of 32 postnatal rats from 8 pregnant mothers (n = 8) in each group. *P < 0.05 compared with both control and 1.3% Iso. F.-J. Kong et al. / Biochemical Pharmacology 84 (2012) 558–563 3.2. Morris Water Maze test Pups whose mother anesthetized with 3% isoflurane showed a significantly worse performance in the water maze. As shown in Fig. 1A, pups in all groups showed a rapid decrease in latency. While the pups of the 3% isoflurane group spent more time to find the platform than those of 1.3% isoflurane group and control group in the place trial (F(2,63.969) = 4.715, P < 0.05). Swimming speeds were also analyzed during place trials, and no differences were observed among three groups. In the probe test, the number of crossing over the former platform location in 3% isoflurane-treated pups was fewer than the others (F(2,29) = 5.265, P < 0.05; Fig. 1B), as well as the time spent in the third quadrant where the platform (F(2,29) = 4.417, P < 0.05; Fig. 1C). There were no located significantly differences either in the place trial or in the probe test between the control and 1.3% isoflurane groups. Fig. 2. Rats exposed to isoflurane in utero at high concentration (3%) increased apoptosis in the hippocampus CA1 region. (Aa) Caspase-3 immunohistochemical staining in control pups (cid:4)400. (Ab) Caspase-3 immunohistochemical staining in 1.3% isoflurane-exposed pups (cid:4)400. (Ac) Caspase-3 immunohistochemical staining in 3% isoflurane- exposed pups (cid:4)400. (B) The number (Ba) and optical density (Bb) of caspase-3 positive neurons in each group. Iso, isoflurane. Data represent mean (cid:3) S.E.M. of 48 sections of 16 postnatal rats from 8 pregnant mothers (n = 8) in each group. **P < 0.01 compared to control, ***P < 0.001 compared with both control and 1.3% Iso, ### P < 0.001 compared to 1.3% Iso. Scale bar = 50 mm. Fig. 3. Ultrastructural changes of synapse in the CA1 and dentate gyrus area of hippocampus under TEM. (A) TEM showed that 3% isoflurane (c) significantly decreased the number of synapses in pups compared to control (a) and 1.3% isoflurane (b) group (magnification, (cid:4)6200). Scale bar = 2 mm. (B) Higher magnification image (magnification, (cid:4)24,000) showed widened synaptic cleft and disintegration of postsynaptic densities in utero. Arrows = synaptic cleft; arrowheads = postsynaptic densities. Scale bar = 0.5 mm. in pups after 3% isoflurane exposure 561 562 F.-J. Kong et al. / Biochemical Pharmacology 84 (2012) 558–563 3.3. Immunoreactivity assay Table 2 The hippocampal synaptic structural parameters among groups. The 1.3% isoflurane for 1 h did not significantly affect the number and optical densities of caspase-3 positive neurons in the hippocampal CA1 region of the pups when compared with the control (Fig. 2Aa and b). However, 3% isoflurane for 1 h significantly increased caspase-3 number (222% increase over the control, F(2,27) = 13.55, P < 0.001; Fig. 2Ac and Ba) and optical densities in the CA1 region of the hippocampus (129% increase over the control, F(2,27) = 8.353, P < 0.01; Fig. 2Ac and Bb). Control 1.3% isoflurane 3% isoflurane Numerical density (N/mm3) Width of synaptic cleft (nm) Postsynaptic density (nm) 2.45 (cid:3) 0.18 24.91 (cid:3) 2.01 76.59 (cid:3) 7.41 2.41 (cid:3) 0.20 24.09 (cid:3) 2.16 75.52 (cid:3) 6.25 1.44 (cid:3) 0.17* 33.26 (cid:3) 2.65* 50.25 (cid:3) 6.98* Data represent mean (cid:3) S.E.M. of 6 postnatal rats from 8 pregnant mothers (n = 8) in each group. P < 0.05 compared with both control and 1.3% isoflurane. 3.4. Ultrastructure changes in synapse of hippocampus Synapses with postsynaptic densities, an inerratic synaptic cleft and a presynaptic vas were clearly visible in the control pups (Fig. 3Aa and Ba). The structure of synapse in the hippocampal CA1 and dentate gyrus region of pups whose mothers received 1.3% isoflurane treatment impaired (Fig. 3Ab and Bb). However, in the 3% isoflurane-treated pups, the number of synapses decreased in the dentate gyrus and CA1 area, while a widened synaptic cleft, thinned postsynaptic densities and loss of a presynaptic vas were observed (F(2,26) = 5.406, P < 0.05; Fig. 3Ac and Bc, Table 2). for 1 h was not significantly 4. Discussion In the present study, we employed a new model, a maternal fetal rat model, to study the behavioral and neurotoxic effects of exposure to different isoflurane concentrations. The outcome of our study shows that 1 h of isoflurane anesthesia at a high concentration (3%) in pregnant rats impaired postnatal spatial memory and learning in the offspring rats, whereas pups that received low (1.3%) concentrations behaved similarly to control pups. Moreover, there was a tendency of increased apoptosis observed at the hippocampal in pups subject to high concentration of isoflurane anesthesia, as well as remarkable impairments of synaptic ultrastructure in the hippocampal CA1 and dentate gyrus region. level neurodegeneration, even cognitive deficits of their offspring. However, the effects of anesthesia used during the development of fetal brains on postnatal memory and learning ability are controversial, with transient improvement [21], no effects [22] and permanent impairment [1,7,8] all being reported. These discre- pancies could be due to methodological differences, species differences (rats vs. mice), pharmacological differences (isoflurane vs. sevoflurane), differences in anesthetic concentrations (0.5–2 MAC), or differences in anesthetic durations (1–6 h). Last but not the isoflurane exposure. Since different neurodevelopmental events are performed in their timing relative to gestational age, it is expected that the vulnerability of the brain to the adverse effects of the anesthetic agents would be different depending on the time of exposure. Correspondingly, behavioral outcome varies as a function of the neurodevelopmental events occurring at the time of exposure. Altered neurodevelopmental programming in utero, cognitive deficits, psychiatric disturbances, and other diseases may occur [23–25]. The time of isoflurane exposure in the current study corresponds approximately to mid- gestation in human, and studies in several animal species suggest that susceptibility limited to a brain developmental state corresponding to the human second trimester of pregnancy. Together with our previous study [7,8], these results suggest that whether isoflurane induces neurodegeneration in the fetal rat brain or subsequent cognitive impairments depending on the time of isoflurane exposure (mid-gestation), higher concentrations (3% or around 2 MAC for 1 h), and longer anesthetic durations (1.3% for 6 h). These results are consistent with the dose- and time- dependent toxic effects of isoflurane in tissue cultures [26,27] and newborn animals [1]. least is the time of is important aspects of cognitive function. The Water Maze protocol evaluates long-term/reference memory that involves a sequence of specific molecular processes in the CA1 area of the hippocampus [18]. The place trials were performed to obtain spatial information and the probe trials were conducted to evaluate memory retention capabilities. Our results showed that prenatal exposure to isoflurane at a high concentration (3%) displayed deficits in postnatal spatial learning and memory capabilities in pups as manifested by the longer escape latency to reach the platform, the fewer times of original platform crossing and the less time spent in the target quadrant in the Morris Water Maze test. The lack of differences in swimming speeds of all groups excluded the possibility that sensorimotor disturbances in any of the groups could have influenced the learning and memory deficits observed in our study. These behavioral changes are unlikely to be associated with an indirect deleterious effect of isoflurane on pregnancy because maternal physiological parameters during isoflurane anesthesia were normal, and there were no differences in non-cognitive variables, such as litter size, viability, and weight among the three groups, further suggesting that the fetal rat brain was impaired by maternally administered 3% isoflurane. Learning and memory are to determine the rats’ ability The observation of impaired performance in a spatial learning and memory test after high concentration anesthesia in agreement with previous studies focusing on the developing neonatal brains of rodents [1,19] and the fetal brains of guinea pigs [20]. Taken together, these findings clearly reinforce the idea that high concentrations of isoflurane anesthesia are capable of causing is The tendency of increased apoptosis in the hippocampal CA1 region in pups exposed to 3% isoflurane is in agreement with the impaired performance of these rats in the water maze test. The hippocampus plays a major role in spatial learning and memory [28], and its synaptic plasticity is altered by the majority of agents used in general anesthesia [1,7,8]. It is widely recognized that there is a relationship between hippocampal synaptic plasticity and learning and memory [29–31]. In our study, 1.3% isoflurane treatment did not significantly affect normal structure of synapses. However, 3% induced sharp changes of synaptic ultrastructure in the dentate gyrus and CA1 area characterized by the decreased synapse number, the widened synaptic cleft and the thinned postsynaptic densities. The synaptic cleft is a region of information transmission among neurons and plays an important role in the dynamics of synaptic activity. The postsynaptic density is the material basis of synaptic efficacy. The thickness of postsynaptic densities and the ability of learning and memory training and memory retention go hand in hand [30,32]. A decreased number of synapses, a widened synaptic cleft and thinned postsynaptic densities changed synaptic activity. Taken together, we speculate that 3% isoflurane for 1 h significantly increased apoptosis in the CA1 area of hippocampus, leading to impairments in synapse structure and function and consequent damage in synaptic plasticity, and finally to spatial learning and memory deficits. isoflurane F.-J. Kong et al. / Biochemical Pharmacology 84 (2012) 558–563 The mechanisms of inhalation anesthetic-mediated neurode- generation in the developing brain are still not clear. There is a hypothesis that inhalational anesthetics, such as isoflurane, might induce cell death processes through activation of g-aminobutyric acid type A receptors and/or inhibition of N-methyl-D-aspartate (NMDA) receptors in the developing brain [1,33,34], although this view has not been established definitively. Our recent studies suggest that CHOP and caspase-12-mediated ER stress-induced cell death appear to be the major mediators of anesthesia- mediated apoptotic cellular death [7]. In addition, we also demonstrate that inhalational anesthetics induce spatial memory and learning impairments through the down-regulation of GAP-43 and NPY in the hippocampus [8], the up-regulation of C/EBP homologous transcription factor protein (CHOP) and caspase-12 [7], and consequent impairments in synaptic plasticity [7,8]. Given the rapid development of fetal surgery [13,14] and the recent concerns over the possible harmful implications of the various anesthetic drugs at various stages of neurodevelopment, it is in urgent need of a better understanding of how maternal general anesthesia affects the developing fetal brain. A better understand- ing of the mechanisms of clinically relevant anesthetic neurotox- icity will help us to define the scope of the problem in humans and develop strategies that will minimize the possible harmful effects of general anesthesia to patients. [7] Kong FJ, Xu LH, He DQ, Zhang XM, Lu HS. Effects of gestational isoflurane exposure on postnatal memory and learning in rats. Eur J Pharmacol 2011; 670:168–74. [8] Kong FJ, Tang YW, Lou AF, Chen H, Xu LH, Zhang XM, et al. Effects of isoflurane exposure during pregnancy on postnatal memory and learning in offspring rats. Mol Biol Rep 2012;39:4849–55. [9] Goodman S. Anesthesia for nonobstetric surgery in the pregnant patient. Semin Perinatol 2002;26:136–45. [10] Tran KM. Anesthesia for fetal surgery. Semin Fetal Neonatal Med 2010;15:40–5. [11] Crowhurst JA. Anaesthesia for non obstetric surgery during pregnancy. Acta Anaesthesiol Belg 2002;53:295–7. [12] Dwyer R, Fee JP, Moore J. Uptake of halothane and isoflurane by mother and baby during caesarean section. Br J Anaesth 1995;74:379–83. [13] Myers LB, Cohen D, Galinkin J, Gaiser R, Kurth CD. Anesthesia for fetal surgery. Paediatr Anaesth 2002;12:569–78. [14] Goldsmith MF, Straus SE, Kupfer C, Lenfant C, Collins F, Hodes RJ, et al. 2020 vision: NIH heads foresee the future. JAMA 1999;282:2287–90. [15] Clancy B, Darlington RB, Finlay BL. Translating developmental time across mammalian species. Neuroscience 2001;105:7–17. [16] Clancy B, Kersh B, Hyde J, Darlington RB, Anand KJ, Finlay BL. Web-based method for translating neurodevelopment from laboratory species to humans. Neuroinformatics 2007;57:9–94. [17] Mazze RI, Rice SA, Baden JM. Halothane, isoflurane, and enflurane MAC in pregnant and nonpregnant female and male mice and rats. Anesthesiology 1985;62:339–41. [18] Izquierdo I, Medina JH, Vianna MR, Izquierdo LA, Barros DM. Separate mecha- nisms for short- and long-term memory. Behav Brain Res 1999;103:1–11. [19] Ma D, Williamson P, Januszewski A, Nogaro MC, Hossain M, Ong LP, et al. Xenon mitigates isoflurane-induced neuronal apoptosis in the developing rodent brain. Anesthesiology 2007;106:746–53. Acknowledgments [20] Rizzi S, Carter LB, Ori C, Jevtovic-Todorovic V. Clinical anesthesia causes perma- nent damage to the fetal guinea pig brain. Brain Pathol 2008;18:198–210. [21] Li Y, Liang G, Wang S, Meng Q, Wang Q, Wei H. Effects of fetal exposure to isoflurane on postnatal memory and learning in rats. Neuropharmacology 2007;53:942–50. We thank Xiao-Ming Zhang, M.D., Ph.D. (Associate Professor, Institute of Anatomy and Cell Biology, School of Medicine, Zhejiang University, China) for technical support and Shu Han, M.D., Ph.D. (Associate Professor, Institute of Anatomy and Cell Biology, School of Medicine, Zhejiang University, China) for his statistical assistance and thought-provoking discussions. Our work was supported by Medical and Health Research Fund of Health Department of Zhejiang Provincial, China (No. 2010KYA129). [22] McClaine RJ, Uemura K, de la Fuente SG, Manson RJ, Booth JV, White WD, et al. General anesthesia improves fetal cerebral oxygenation without evidence of subsequent neuronal injury. J Cereb Blood Flow Metab 2005;25:1060–9. [23] Gluckman PD, Hanson MA, Bateson P, Beedle AS, Law CM, Bhutta ZA, et al. Towards a new developmental synthesis: adaptive developmental plasticity and human disease. Lancet 2009;373:1654–7. [24] Gluckman PD, Hanson MA, Cooper C, Thornburg KL. Effect of in utero and early- life conditions on adult health and disease. N Engl J Med 2008;359:61–73. [25] Le Pen G, Gourevitch R, Hazane F, Hoareau C, Jay TM, Krebs MO. Peri-pubertal maturation after developmental disturbance: a model for psychosis onset in the rat. Neuroscience 2006;143:395–405. [26] Wei H, Liang G, Yang H, Wang Q, Hawkins B, Madesh M, et al. The common inhalational anesthetic isoflurane induces apoptosis via activation of inositol 1,4,5-trisphosphate receptors. Anesthesiology 2005;108:251–60. References [1] Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zor- umski CF, et al. Early exposure to common anesthetic agents causes wide- spread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 2003;23:876–82. [2] Culley DJ, Baxter M, Yukhananov R, Crosby G. The memory effects of general anesthesia persist for weeks in young and aged rats. Anesth Analg 2003; 96:1004–9. [3] Culley DJ, Baxter MG, Yukhananov R, Crosby G. Longterm impairment of acquisition of a spatial memory task following isoflurane-nitrous oxide anes- thesia in rats. Anesthesiology 2004;100:309–14. [4] Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, et al. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology 2009;110:796–804. [5] Kalkman CJ, Peelen L, Moons KG, Veenhuizen M, Bruens M, Sinnema G, et al. Behavior and development in children and age at the time of first anesthetic exposure. Anesthesiology 2009;110:805–12. [27] Yang H, Liang G, Hawkins BJ, Madesh M, Pierwola A, Wei HF. Inhalational anesthetics induce cell damage by disruption of intracellular calcium homeo- stasis with different potencies. Anesthesiology 2008;109:243–50. [28] Broadbent NJ, Squire LR, Clark RE. Spatial memory, recognition memory, and the hippocampus. Proc Natl Acad Sci U S A 2004;101:14515–20. [29] Sametsky EA, Disterhoft JF, Geinisman Y, Nicholson DA. Synaptic strength and postsynaptically silent synapses through advanced aging in rat hippocampal CA1 pyramidal neurons. Neurobiol Aging 2010;31:813–25. [30] Thompson JV, Sullivan RM, Wilson DA. Developmental emergence of fear learning corresponds with changes in amygdale synaptic plasticity. Brain Res 2008;1200:58–65. [31] Gruart A, Munoz MD, Delgado-Garcia JM. Involvement of the CA3–CA1 syn- apse in the acquisition of associative learning in behaving mice. J Neurosci 2006;26:1077–87. [32] Ziff EB. Enlightening the postsynaptic density. Neuron 1997;19:1163–74. [33] Olney JW, Young C, Wozniak DF, Jevtovic-Todorovic V, Ikonomidou C. Do pediatric drugs cause developing neurons to commit suicide? Trends Phar- macol Sci 2004;25:135–9. [6] Monk TG, Weldon BC, Garvan CW, Dede DE, van der Aa MT, Heilman KM, et al. Predictors of cognitive dysfunction after major noncardiac surgery. Anesthe- siology 2008;108:18–30. [34] Ikonomidou C, Bosch F, Miksa M, Bittigau P, Vockler J, Dikranian K, et al. Blockade of NMDA receptors and apoptotic neurodegeneration in the devel- oping brain. Science 1999;283:70–4. 563",rats,['We developed a maternal fetal rat model to study the effects of isoflurane-induced neurotoxicity on the fetuses of pregnant rats exposed in utero.'],gestational day 14,['Pregnant rats at gestational day 14 were exposed to 1.3 or 3% isoflurane for 1 h.'],Y,"['At postnatal day 28, spatial learning and memory of the offspring were examined using the Morris Water Maze.']",isoflurane,['Pregnant rats at gestational day 14 were exposed to 1.3 or 3% isoflurane for 1 h.'],none,[],none,[],"The study addresses the issue of how fetal exposure to high concentrations of isoflurane affects postnatal memory and learning in rats, which has not been fully explored in prior neurodevelopmental studies.","['Nevertheless, the majority of prior neurodevelopmental studies focused on postnatal subjects rather than on the fetuses.']",The study presents a maternal fetal rat model to investigate the effects of isoflurane-induced neurotoxicity on fetuses exposed in utero.,['We developed a maternal fetal rat model to study the effects of isoflurane-induced neurotoxicity on the fetuses of pregnant rats exposed in utero.'],"The article argues that high isoflurane concentration exposure during pregnancy causes spatial memory and learning impairments and more neurodegeneration in the offspring rats, highlighting the potential risks of using high concentrations of anesthetics during pregnancy.",['High isoflurane concentration (3%) exposure during pregnancy caused spatial memory and learning impairments and more neurodegeneration in the offspring rats compared with control or lower isoflurane concentrations.'],None,[],"The findings could have implications for anesthetic practices during pregnancy, suggesting a need for caution with the use of high concentrations of anesthetics.",['High isoflurane concentration (3%) exposure during pregnancy caused spatial memory and learning impairments and more neurodegeneration in the offspring rats compared with control or lower isoflurane concentrations.'],True,True,True,True,True,True,10.1016/j.bcp.2012.06.001 10.1016/j.brainres.2015.10.050,1730.0,Lai,2016,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Available online at www.sciencedirect.com www.elsevier.com/locate/brainres Research Report Sevoflurane postconditioning improves long-term learning and memory of neonatal hypoxia-ischemia brain damage rats via the PI3K/Akt-mPTP pathway Zhongmeng Laia, Liangcheng Zhanga,n Qingxiu Xua , Jiansheng Sua, Dongmiao Caib, aDeparment of Anesthesiology, Fujian Medical University Union Hospital, 29 Xin-Quan Road, Fuzhou 350001, PR China bDeparment of Anesthesiology, The First Affiliated Hospital of Xiamen University, 55 Zhen-Hai Road, Xiamen 3610003, PR China a r t i c l e i n f o a b s t r a c t Article history: Accepted 16 October 2015 Available online 2 November 2015 Background: Volatile anesthetic postconditioning has been documented to provide neuro- protection in adult animals. Our aim was to investigate whether sevoflurane postcondi- tioning improves long-term learning and memory of neonatal hypoxia-ischemia brain Keywords: Sevoflurane postconditioning Neonatal rat Hypoxic-ischemic brain damage Long-term learning and memory PI3K/Akt pathway Mitochondrial permeability transition pore damage (HIBD) rats, and whether the PI3K/Akt pathway and mitochondrial permeability transition pore (mPTP) opening participate in the effect. Methods: Seven-day-old Sprague-Dawley rats were subjected to brain HI and randomly allocated to 10 groups (n ¼24 each group) and treated as follows: (1) Sham, without hypoxia-ischemia; (2) HI/Control, received cerebral hypoxia-ischemia; (3) HIþAtractylo- side (Atr), (4) HIþCyclosporin A (CsA), (5) HIþsevoflurane (Sev), (6) HIþSevþ LY294002 (9) HIþSevþAtr, and (LY), (10) HIþSevþCsA. Twelve rats in each group underwent behavioral testing and their brains were harvested for hippocampus neuron count and morphology study. (7) HIþSevþ L-NAME (L-N), (8) HIþSevþ SB216763 (SB), Brains of the other 12 animals were harvested 24 h after intervention to examine the expression of Akt, p-Akt, eNOS, p-eNOS, GSK-3β, p-GSK-3β by Western bolting and mPTP opening. Results: Sevoflurane postconditioning significantly improved the long-term cognitive performance of the rats, increased the number of surviving neurons in CA1 and CA3 hippocampal regions, and protected the histomorphology of the left hippocampus. These effects were abolished by inhibitors of PI3K/eNOS/GSK-3β. Although blocking mPTP opening simulated sevoflurane postconditioning-induced neuroprotection, it failed to enhance it. Abbreviations: HIBD, hypoxia-ischemia brain damage; mPTP, mitochondrial permeability transition pore; eNOS, endothelial nitric oxide synthase; mPTP, mitochondrial permeability transition pore; Atr, Atractyloside; CsA, Cyclosporin A; TTC, triphenyltertrazolium chloride; Sev, sevoflurane; EL, Escape latency; HE, hematoxylin–eosin; BSA, ovine serum albumin; least significant difference; PCA, principal components analysis. SD, n Corresponding author. Fax: þ86 59183346181. E-mail addresses: guodh1981@163.com (Z. Lai), zhanglc6@163.com (L. Zhang), sjs2028@163.com (J. Su), standard deviation; LSD, caidongmiao@hotmail.com (D. Cai), 18201019@qq.com (Q. Xu). http://dx.doi.org/10.1016/j.brainres.2015.10.050 0006-8993/& 2015 Elsevier B.V. All rights reserved. 26 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Conclusions: Sevoflurane postconditioning exerts a neuroprotective effect against HIBD in neonatal rats via PI3K/Akt/eNOS and PI3K/Akt/GSK-3β pathways, and blockage of mPTP opening may be involved in attenuation of histomorphological injury. & 2015 Elsevier B.V. All rights reserved. 1. Introduction As a key part in learning and memory adjustment, the hippocampus, including the CA1, CA3, and DG regions, participates in integrating transferred outside information into the nerve center (Chan et al., 2010; Morris et al., 2012). The CA1 region in particular, is highly sensitive to hypoxia- ischemia brain damage (HIBD) (Hopkins and Haaland, 2004). In neonates HIBD may result from perinatal asphyxia, birth injury, and neonatal cardiac surgery, and is a common cause of neonatal death and neurobehavioral impairments (Fan et al., 2005). HIBD may cause apoptosis or necrosis of hippocampal neurons by a cascade of damaging reactions, thus impairing learning and memory (Zhang et al., 2002; Vannucci RC1 and Vannucci, 2001). Therefore, protection of hippocampal neurons is of great significance in prevention and treatment of HIBD. of cerebral impairment, Akt activation after cerebral ischemia is part of the endogenous protection process and the PI3K/Akt pathway participates in sevoflurane protection against cere- bral ischemia-reperfusion injury, (Zitta et al., 2010; Ye et al., 2012) while neuronal mitochondria undergo permeability transition (Nieminen et al., 1996). Emerging evidence has demonstrated that sevoflurane postconditioning reduces cer- ebral HI-induced brain tissue loss via mitochondrial KATP channels, (Ren et al., 2014) and improves short-term learning and memory after focal cerebral ischemia-reperfusion injury in adult rats via inhibition of neuronal apoptosis through the PI3K/Akt pathway (Wang et al., 2010). However, studies have not examined the long-term learning and memory of neona- tal HIBD rats that received sevoflurane postconditioning, the role of PI3K/Akt-mPTP pathway in the process, and related signal-regulating downstream Akt kinases. A method to provide this protective effective is ischemic or pharmacological postconditioning, which has been docu- mented to protect tissues and organs by making cells more tolerant of oxygen deficit (Peng et al., 2012; Danielisová et al., 2008; Hu et al., 2013). In cardiac studies, this postconditioning reduces calcium overload, the oxidative stress response, and ATP consumption in cells and mitochondria, thus protecting the cardiac muscle (Tsang et al., 2004; Lim et al., 2007; Lemoine et al., 2010; Fang et al., 2010). The mechanism involves activation of the Phosphatidylinositol-3 kinase (PI3K)/protein kinase B (Akt) pathway, possible activation of kinases including the downstream proteins of Akt, such as glycogen synthase kinase 3 (GSK-3β), P70S6 kinase (P70S6K), and endothelial nitric oxide synthase (eNOS), suppression of mitochondrial permeability transition pore (mPTP) opening, and opening potassium channels (Tsang et al., 2004; Lim et al., 2007; Lemoine et al., 2010; Fang et al., 2010). In studies Therefore, the purposes of current study were to examine the potential protective effect of sevoflurane postcondition- ing on long-term cognitive performance in neonatal HIBD rats, the related underlying mechanism, and the role of mPTP opening in this process. 2. Results Sevoflurane postconditioning improves non-spatial 2.1. and spatial learning and memory Compared with the HI/Control group, sevoflurane postcondi- tioning increased the DIs of the postconditioning groups (Po0.01), which were reduced by the LY294002 (a PI3K inhibitor), L-NAME (an eNOS inhibitor), and SB216763 (a GSK-3β inhibitor) (Po0.05). Atr did not worsening the DIs of the HI/Control group (P40.05), but it decreased the DIs of Fig. 1 – Experimental protocol and animal grouping. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L- NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. P indicates postnatal age in days. b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 27 Fig. 2 – Results of the novel object recognition test. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. Comparisons between groups were using one-way ANOVA with Fisher's LSD as post-hoc procedure. The detailed sample size, mean7SD are listed in Supplementary table S1. Table 1 – Results of the place navigation study. Day 1 Day 2 Day 3 Day 4 Day 5 Strategy (%) Sham HI/Control HIþSev HIþSevþLY HIþSevþL-N HIþSevþSB HIþAtr HIþSevþAtr HIþCsA HIþSevþCsA 46.0078.04 74.1578.72 55.5277.45 70.2078.26 67.8377.40 67.9079.67 74.5079.24 74.17710.28 ▲ 55.9178.71 54.8778.64 ▲n n ▲ n n n n n 35.0976.20 68.3879.01 42.3877.11 66.66710.72 n 64.7878.02 63.02710.15 n 69.3079.56 68.7979.69 39.5675.57 39.8874.93 ▲n n ▲ n n n ▲ 27.3875.60 56.3376.69 34.1075.69 53.7176.48 49.3876.61 49.2777.29 58.5679.34 56.5278.29 33.9276.83 32.7676.97 ▲n n ▲ n ▲n ▲n n n ▲ 16.7873.86 47.3475.87 19.5473.22 45.4675.50 39.5875.33 38.5475.49 49.7475.05 48.5074.94 18.6673.18 18.6073.91 ▲ n ▲ n ▲n ▲n n n ▲ 14.3872.22 38.2273.93 16.2672.90 37.2573.43 32.3572.30 36.8673.59 39.2573.52 39.3173.35 15.8172.56 15.3772.52 ▲ n ▲ n ▲n n n n ▲ 223(92.92) 164(74.55) 208(86.67) 175(79.55) 187(77.92) 171(77.73) 159(72.27) 162(73.64) 214(89.17) 217(90.42) ▲n n ▲ n n n n n ▲ ▲ ▲ ▲ ▲ ▲ ▲ Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. Data are presented as mean7standard deviation. ▲ Po0.05 when compared with HI/Control group. n Po0.05 when compared with HIþSev group. HIþSev group (Po0.01). Cyclosporine A itself improved the DIs of HI/Control group (Po0.01), but produced no significant improvement in the HIþSev group (P40.05) (Fig. 2). Results of the Morris water maze test are shown in Table 1 and Fig. 3. When compared with that of the HI/Control group and of the groups receiving inhibitors (LY294002, L-NAME, groups, while marginal strategy and random strategy were dominant in the HI/Control, HIþSevþLY/L-N/SB, HIþAtr, and In space exploration, no significant HIþSevþAtr groups. difference in swimming speed was found between the groups (Fig. 3B; F ¼ 0.504, P ¼0.869). Principal component analysis, including cross number (X1), probe time (X2), and probe SB216763), the EL of the groups receiving Sev or CsA or both was significantly shortened (Po0.05). Atr eliminated the protective effect of Sev (Po0.05), although it did not worsen HI injury itself (P40.05). CsA alone shortened the EL, but did not enhance the protective effect of Sev (P40.05). Straight strategy and tendency strategy were the primary movement strategies in the Sham, HIþSev, HIþCsA, and HIþSevþCsA length (X3) on the original platform quadrant, showed that the initial eigenvalues λ 1 was 2.469, and cumulative percent ¼ so the first principal was 82.296%, þ0.376X3 can be extracted to represent the 0.360X1 comprehensive index of rat's spatial memory (Fig. 3A). The result showed that sevoflurane postconditioning significantly improved the score of HI/Control group (Po0.01), which was component Z1 þ0.367X2 28 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Fig. 3 – Results of the space exploration test. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. Comparisons between groups were using one-way ANOVA with Fisher’s LSD as post-hoc procedure. The detailed sample size, mean7SD are listed in Supplementary table S2. respectively decreased by LY294002, L-NAME, and SB216763 (Po0.01). Atr did not reduce the score of HI/Control group (P ¼0.870), but decreased that of HIþSev group (Po0.01). The combined treatment (HIþSevþCsA) did not increase the score of HIþSev group (P¼ 0.414), but CsA alone increased the score of HI/Control group (Po0.01). Sevoflurane postconditioning alleviates neuronal 2.2. damage and loss 2.4. Ca2þ induces mPTP opening A decreasing tendency in optical density at 540 nm (OD540) was seen in the CaCl2-induced mPTP opening time in all groups. mPTP opening was expressed as a reduction in OD540 during a 5 min period (△OD540/min). In the HIþSev, HIþCsA, and HIþSevþCsA groups the decreases were lower than in the HI/Control, HIþAtr, and HIþSevþAtr groups, respectively (Po0.01). In the HIþSevþLY, HIþSevþL-N, and HIþSevþSB groups, the decreases were higher than in HIþSev group (Po0.05) (Fig. 8). In the Sham group, neuronal degeneration and neuronal In the HI/Control, apoptosis were occasionally observed. HIþAtr, and HIþSevþAtr groups obvious pyramidal layer thinning (only 1–2 layers), cell body shrinkage and deformity, disordered cell arrangement, gliocyte proliferation, capillary edema, disconnected neighboring neurons, obvious neuronal apoptosis and loss, and low density were observed. In the HIþSev, HIþCsA, and HIþSevþCsA groups a denser pyramidal layer distribution (3–4 aligned layers), hyperchromatic cyto- plasm, regular cell arrangement, clear structure, only mini- mal few discrete neuronal loss, and remarkably reduced cell apoptosis and cellular atrophy were observed. In the groups given the inhibitors (LY294002, L-NAME, and SB216763), 2–3 layer derangement, cell body shrinkage and deformity, glial cell proliferation, cell connection loss, and obvious neuron apoptosis and neuron absence were seen (Figs. 4 and 5). The surviving neuron density of the CA1 and CA3 regions are shown in Fig. 6. Sevoflurane postconditioning increases the expression 2.3. of p-Akt, p-eNOS, and p-GSK-3β in the left hippocampus No significant difference in t-Akt/eNOS/GSK-3β expression was found in all groups (Fig. 7). The expressions of p-Akt/ eNOS/GSK-3β were higher in the HIþSev than in the HI/ Control group (Po0.05), and significantly decreased in the groups receiving inhibitors when compared with the HIþSev group (Po0.05). 3. Discussion The results of this study using the classical Rice–Vannucci sevoflurane postconditioning model improves long-term learning and memory in neonatal HIBD rats by reducing hippocampal neurons loss; (2) activation of the PI3K/Akt/eNOS and PI3K/Akt/GSK-3β pathways is involved in the neuroprotection provided by sevoflurane postcondi- tioning; and (3) blocking mPTP opening plays an important role in this effect. showed that: (1) Morphological changes of brain tissues are direct indexes to measure HI-induced brain damage. The key brain devel- opment periods of rats are from 1 to 2 days before birth to 2 weeks after birth (Schousboe et al., 2004). Therefore, we intervened on postnatal day 7 and observed structural changes on day 42. The result showed that neuronal degen- eration and neuronal apoptosis were occasionally observed in CA1 and CA3 region in the Sham group, while HI/Control group experienced obvious damage. This finding is consistent with that of other study, (Kumral et al., 2004) and indicates that neonatal HIBD may cause ongoing damage to the hippocampus of rats, which lasts to puberty (postnatal day 35). The CA1 and CA3 regions protected by sevoflurane postconditioning showed denser pyramidal layer distribu- tion, hyperchromatic cytoplasm, regular cell arrangement, clear structure, only minimal neuronal loss, and remarkably reduced cell apoptosis and cellular atrophy, indicating that b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Fig. 4 – Hematoxylin and eosin staining of left hippocampal CA1 region neurons in 42 day old rats (magnification, 200 (cid:2) , 400 (cid:2) ; scale bars¼10 lm). Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. 29 30 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Fig. 5 – Hematoxylin and eosin staining of left hippocampal CA3 region neurons in 42 day old rats (magnification, 200 (cid:2) ,400 (cid:2) ; scale bars¼10 lm). Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Fig. 6 – Number of surviving neurons in the left hippocampal CA1 and CA3 regions. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. Comparisons between groups were using one-way ANOVA with Fisher’s LSD as post-hoc procedure. The detailed sample size, mean7SD are listed in Supplementary table S3. sevoflurane postconditioning is capable of protecting the hippocampus from HIBD. is a hippocampus-dependent cognition (Ennaceur and Delacour, 1988). The novel object recognition test reflects non-spatial learning and memory ability, and can test instant, short- term, and long-term memory retention ability. Rats in the HI/ Control group showed much lower new object recognition than rats in the Sham group at all time points. Presumably, the instant, short-term, and long-term non-spatial memory abilities of HIBD rats were damaged. Sevoflurane postcondi- tioning, however, improved their non-spatial memory ability but the indexes did not reach the levels of the Sham group indicating that sevoflurane postconditioning alone is incap- able of completely eliminating damage to non-spatial mem- ory ability caused by cerebral HI damage. In rats, the habit of exploring new things opening, of mPTPs are key factors that determine whether injury is reversible or irreversible. Mitochondrial permeability transition is a common pathway shared by death and apoptosis of (Kroemer and Reed, 2000; Juhaszova et al., 2009). Sevoflurane and isoflurane postcondi- tioning against cerebral ischemia-reperfusion injury involve inhibition of mPTP opening (Feng et al., 2005; Pagel et al., 2006). Interestingly, neuronal mitochondria undergo perme- ability transition as well, (Nieminen et al., 1996) and inhibi- tion of mPTP activity has become a novel neuroprotection strategy (Kristal et al., 2004). Crucial factors for mPTP opening are mitochondrial calcium overload, ATP depletion, and oxidative stress, and these are exactly what occur in the brains of neonatal HIBD rats during hypoxia-reoxygenation. Thus, sevoflurane postconditioning-conferred neuroprotec- tion against HIBD may also act on mPTP opening. injured cells The Morris water maze is a classic method testing hippocampus-related spatial learning and memory ability (Rodríguez et al., 2003). The Morris water maze test showed that sevoflurane postconditioning improved learning effi- ciency, learning strategy, and long-term spatial memory as compared to the HI/Control group. However, sevoflurane postconditioning did not improve these measures to the level of the Sham group. Research has proven that ischemic injury is a dynamic process, and that rodents continue to loose neurons weeks after cerebral ischemia (Li et al., 1995; Du et al., 1996). This loss is especially characterized by brain damage during the growth period (Hu et al., 2000). Our research showed that compared with the Sham group, rats in the HI/Control group had obvious hippocampal neuron loss and more serious apoptosis, which is consistent with the findings of the aforementioned studies. Neurons almost completely depend on mitochondria-supplied ATP to maintain their function, so the state of mitochondria is an important factor that deter- mines whether injured neurons survive (Kann et al., 2005; Mancuso et al., 2007). mPTPs are highly conductive nonspe- cific channels across the outer mitochondrial and inner mitochondrial membrane. Opening, and the degree of In the current study, the HIþSev group showed signifi- cantly lower mPTP activity, reduced long-term hippocampal pathological injuries, and improved behaviors as compared with the HI/Control group. Atr, a mPTP-specific opener, did not worsen hippocampal neuron damage or harm long-term learning and memory by itself, but appeared to reverse the neuroprotection of sevoflurane postconditioning. Although CsA, a mPTP-specific blocker, mimicked the neuroprotection provided by sevoflurane postconditioning, failed to enhance the effect of sevoflurane postconditioning. These results suggest that sevoflurane postconditioning possibly protects the brain by blocking the mitochondrial permeability transition and reducing metabolic energy disorder and neu- ron damage in the hippocampus and other tissues of HIBD rats. it Endothelial nitric oxide synthase (eNOS), a downstream kinase of Akt, can activate the release of eNO and inhibit platelet aggregation and generation of superoxides in vessels so as to protect endothelial function and promote heman- giectasis and neovascularization, (Rikitake et al., 2002) effi- ciently preventing secondary lower perfusion and the damage to vascular endothelial cells caused by oxygen- derived free radicals during reperfusion period after HIBD. 31 32 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Fig. 7 – Western blot analysis. Protein expression of p-Akt/p-eNOS/p-GSK-3β and t-Akt/t-eNOS/ t-GSK-3β (A) in the left hippocampus in the Sham, HI/Control, HIþSev, and HIþSevþLY groups were determined 24 hours after the intervention. (B and C) Relative density of p-Akt and t-Akt, respectively. β-Actin served as the internal control. Error bars represent standard error of the mean. Statistical comparisons were performed with the Student's t-test. #Po0.05 compared with HI/Control. *Po0.05 compared with HIþSev group. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. The latter 2 are key processes in the occurrence and devel- opment of HIBD. Some researchers believe that NO is involved in mediating the preconditioning and postcondi- tioning effects of volatile anesthetics like sevoflurane and isoflurane, and it remarkably reduces myocardial infarction size in ischemia/reperfusion models (Tessier-Vetzel et al., 2006; Lamberts et al., 2009). Rastaldo et al. (2007) have shown that endogenous NO may activate PKG via cGMP, and ulti- mately affect the human body by inhibiting mPTP opening. The NO/cGMP pathway is one of the important molecular mechanisms by which volatile anesthetics like sevoflurane exert their effects (Johns, 1996). Other studies have shown that GSK-3β takes part in the transduction of several intra- cellular signaling pathways, genetic transcription and trans- lation, embryogenesis, and neuronal death and apoptosis Jope and Johnson, 2004; Chong (Balaraman et al., 2006; et al., 2007). Furthermore, the PI3K/Akt/GSK-3β pathway provides negative feedback and promotes cell survival by phosphorylating ser9 of GSK-3β, and mediating GSK-3β activ- ity inhibition (Pap and Cooper, 1998; Duarte et al., 2008). Ischemic/pharmacological preconditioning and postcondi- tioning produce cardioprotective effects through inhibiting mPTP activity and reducing apoptosis via the PI3K/Akt/GSK- 3β signaling pathway (Juhaszova et al., 2009; Feng et al., 2005; Gomez et al., 2008; Zhu et al., 2010). The concentration of GSK-3β in the central nervous system is extremely high, especially in the hippocampus (Hidenori et al., 2006). The expression level of GSK-3β reaches a peak during late preg- nancy and early after birth, and is closely related to develop- ment and reconstruction of neurons (Takahashi et al., 1994; Leroy and Brion, 1999). We found that the P13K pathway was activated to induce more phosphorylation of Akt, eNOS, and b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 of p90rsk2 under SB216763 treatment is necessary to further elucidate the mechanism in the future. Fig. 8 – Alterations of mitochondrial permeability transition pore opening. Atr, atractyloside; CsA, Cyclosporin A; HI, hypoxia-ischemia; L-N, L-NAME; LY, LY294002; SB, SB216763; Sev, sevoflurane. Comparisons between groups were using one-way ANOVA with Fisher's LSD as post-hoc procedure. The detailed sample size, mean7SD are listed in Supplementary table S4. GSK-3β in the HIþSev group than in the HI/Control, specific inhibitors LY294002, L-NAME, and SB216763 blocked sevoflur- ane postconditioning-induced expression of p-Akt, p-eNOS, and p-GSK-3β, respectively, and mPTP activity was greatly increased in the corresponding groups, neutralizing the effect of sevoflurane postconditioning on HIBD. These findings indicate that sevoflurane postconditioning may confer neu- roprotection against HIBD by inhibiting mitochondrial per- meability transition via the PI3K/Akt/eNOS and PI3K/Akt/ GSK-3β pathways. Although sevoflurane-induced activation of PI3K/Akt has been confirmed to provide heart and cerebral protections in several studies (Ye et al., 2012; Zhang et al., 2014), however, the underlying mechanism of sevoflurane- induced activation of PI3K/Akt is still unknown. It will be interesting to indentify the upstream components of the signaling pathway(s) that exert sevoflurane-induced activa- tion of PI3K/Akt. Previous studies have suggested that PI3K/ AKT/eNOS and PI3K/Akt/GSK-3β pathways may regulate mPTP through PKC-epsilon, reactive oxygen species, Ca2þ and mitochondrial ATP-dependent Kþ channels (Ren et al., 2014; Juhaszova et al., 2004; Pravdic et al., 2009). But the detailed mechanism is still not fully understood and is worthy of further investigation. There are some limitations to this study. Arterial blood gas analysis was not performed during cerebral HI. Some researchers believe that cerebral HI itself, to a certain degree, can promote proliferation of cortical neurons and hippocam- pal neural precursor cells in neonatal rats, (Bartley et al., 2005) while sevoflurane lowers the cerebral metabolic rate, so both play a role in the recovery of neurological function. The result that Art neutralized the neuroprotective effect of sevoflurane postconditioning may partially be due to its effect of inhibiting energy generation rather than blocking mPTP. CsA may be incapable of blocking mPTP opening when mitochondria are seriously injured, and its neuroprotective effect may be dose-dependent. Whether combining different concentrations of sevoflurane and different doses of CsA can protect against HIBD to different degrees requires future study. We did not perform 2,3,5-triphenyltertrazolium chlor- ide (TTC) staining to determine brain infarct volume. Lastly, other pathways such as PI3K/Akt/mTOR or ERK1/2 were not studied. In conclusion, sevoflurane postconditioning may improve long-term learning and memory of neonatal HIBD rats pos- sibly by blocking mPTP opening and reducing neuron death and apoptosis in the hippocampus via PI3K/Akt/eNOS and PI3K/Akt/GSK-3β pathways. 4. Experimental procedures 4.1. Animals A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Labora- tory Animal Co., Ltd., China) were used in this study. They were housed and treated in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 80-23, revised in 2011). All rats were maintained under standard laboratory temperature and humidity and a 12 day/night cycle (8 am/8 pm), and were allowed free access to food and water. The study was approved by the Experimental Animal Care Committee of the Fujian Medical University Union Hospital, and efforts were made to minimize the number of animals used and their suffering. 4.2. Experimental protocol It is noteworthy that sevoflurane postconditionin caused phosphorylation of GSK-3β at Ser9 and its inhibition, while SB216763 blocked sevoflurane-induced phosphorylation of GSK-3β and neuroprotection in our study. These two results seem conflicted since both Sev postconditioning and SB216763 treatment inhibits GSK-3β. However, previous stu- dies have consistently reported that SB216763 reduced the phosphorylation levels of GSK-3β Ser9 (possibly via inhibition of p90rsk2 (Zhang et al., 2003; Lochhead et al., 2001; Liang and Chuang, 2007), a kinase of GSK-3β Ser9), indicating the inhibition effect of SB216763 on GSK-3β has a complicated mechanism which eventually blocked the sevoflurane- induced protection in this study. Examining kinase activity The animals were randomly allocated into 10 groups (n¼ 24 per group; Fig. 1): (1) Sham, without hypoxia-ischemia; (2) HI/ Control, received cerebral hypoxia-ischemia; (3) HIþAtractylo- side (Atr), (4) HIþCyclosporin A (CsA), treated like the control and respectively injected with Atr (10 mg/kg) and CsA (5 mg/ kg); (5) HIþsevoflurane (Sev), treated like the control and (6) HIþSevþLY, received sevoflurane postconditioning; (7) HIþSevþL-N, (10) HIþSevþCsA, treated like the HIþSev group and respectively injected with LY294002 (0.3 mg/kg), L-NAME (10 mg/kg), SB216763 (0.2 mg/kg), Atr (10 mg/kg), and CsA (5 mg/kg). LY294002, L-NAME, and SB216763 are specific blockers of (8) HIþSevþSB, (9) HIþSevþAtr, 33 34 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Akt, eNOS, and GSK-3β, respectively. Atr and CsA open and close, respectively, mPTPs. In each group, the brains of the rats that received behavioral testing (from 32-days-old to 42- days-old; n¼ 12 per group) were harvested for determination of hippocampal neuron count and morphology study, and the brains of the other 12 rats were harvested 24 h after the intervention for Western blot analysis, and study of mito- chondrial permeability transition pore opening. 4.3. Cerebral HI model and sevoflurane postconditioning The cerebral HI model was adapted from a procedure described previously (Ren et al., 2014). Briefly, the rats were anesthetized with pentobarbital sodium (0.5–1%, 40–50 mg/ kg, intraperitoneal), and their left common carotid arteries were permanently ligated with a double 7–0 surgical silk; the arteries in the Sham group, however, were not ligated. A dose of 5 mL of 0.1% DMSO or drug (LY294002, L-NAME, SB216763, Atr, CsA) with 0.1% DMSO was injected into the left lateral ventricle immediately after the surgery as previously described (Satoh and Onoue, 2005). After waking, the rats were returned to their cages with the mothers for 1.5–2.5 h, – and then placed in a chamber containing humidified 8% O2 92% N2 for 2 h. The air temperature in the chamber was maintained at 36.571 1C. The chamber was then exposed to room air for 15–20 min. For sevoflurane postconditioning, the animals were placed in a chamber containing 2.5% sevoflur- –70% N2 for 30 min after cerebral HI injury. After ane in 30% O2 waking, the neonates were cleaned with 75% alcohol and returned to their mothers. 4.4. Novel object recognition test The rats were evaluated with a nonspatial object recognition memory task 25 days after the intervention as described by Ennaceur and Delacour (1988) and Bruel-Jungerman et al. (2005). Briefly, for the first 3 days, after being comforted and stroked, each animal was put into an open chamber made of black plexiglas (80 (cid:2) 80 (cid:2) 60 cm3) for a 5 min acclimation and the test was conducted on the fourth day. Before the test, the animals received a 5 min training in the chamber containing 2 different objects (a white cube and a red cylinder) fixed at adjacent angles with a spacing of 10 cm from the field wall. Rats were put into the chamber with their backs turned towards the objects and allowed to explore the chamber freely for 5 minutes. Exploratory behavior can be identified when rats touch the objects with their noses or put their noses at places within 2 cm of the objects. To test memory storage, the white cube was kept in the chamber and the red cylinder was replaced by a blue semisphere. Exploratory time of new (T2) and old (T1) objects within 5 min was recorded and memorization ability of the rats was assessed by discrimina- þT2). The blue semisphere was replaced tion index: DI¼ T2/(T1 by a green prism 3 h after training, and the green prism was replaced by a yellow irregular shape 24 h after the training. The time each rat used to explore new and old objects was recorded for calculating DI. The DIs at 5 min, 3 h, and 24 h after the training (DI0 h, DI3 h, DI24 h) represent the instant, short-term, and long-term memory, respectively. Data with total exploration time less than 20 s were excluded from statistic analysis. The field was always provided with even light, and the objects and fields were cleaned with 75% ethanol after each testing. 4.5. Morris water maze test After the novel object recognition test, the Morris water maze was used to test spatial learning and memory (Peng et al., 2012; Jiang et al., 2004). Briefly, a black circular pool (120 cm in diameter, 50 cm in height) was filled with water (2571 1C) to a depth of 25 cm and located in a quiet room. Chinese ink was added to make the water opaque. The water maze was conceptually divided into 4 quadrants, and a hyaline platform (10 cm in diameter) was submerged 1 cm below the surface of the water at the midpoint of the third quadrant. In the place navigation trial, each rat underwent 4 successive trials a day for 5 days for memory acquisition training, with a 15 min interval between trials for the rat to recover physically. The sequence of water-entry points differed each day, but the location of the platform was constant. Escape latency (EL) to find the platform was measured up to a maximum of 120 s. On locating the platform, the rat was left there for 15 s before the next trial. If the rats failed to locate the platform within 120 s, it was guided to the platform and allowed to stay there for 15 s. Latency and the search strategies, including straight strategy, tendency strategy, marginal strategy, and random strategy, were recorded for each trial. Twenty-four hours after the last training session, a space exploration trial was performed. The platform was removed from the pool and rats were allowed to swim freely for 60 s. Four indexes were calculated: (1) the time spent by the rats in the third quadrant in which the platform was hidden during acquisition trials; (2) the number of rats crossing exactly over the original position of the platform; (3) the search path in the target quadrant; (4) the total movement distance. Search speed was calculated by total movement distance divided by 120 cm/s. All trials were videotaped by a camera located 2 m above the water surface and computer analyzed. 4.6. Histology of left hippocampal neurons After the behavioral studies, rats were anesthetized with pentobarbital, transcardialy perfused with 200 mL of 4 1C heparin saline solution and then with 300 mL of 4% paraf- ormaldehyde. Left hippocampus was made into a wax block according to Paxinos–Waston methods. Continual coronal sections (4 mm in thickness) at approximately 3.3 mm caudal to bregma were obtained, and subjected to hematoxylin– eosin (HE) staining. The sections were examined by an observer blinded to the rat group assignment. Neurons microscopically showed a clear boundary, a round or an oval shape, a smooth cell membrane, basophilic cytoplasm (Nissl body), a large and round nucleus, a clear nuclear membrane and a large and round nucleolus will be defined as surviving neurons. Apoptotic neurons will not be regarded as surviving ones. Surviving neurons in pyramidal cell layer of the CA1 and CA3 regions were counted (n/mm) by two investigators blind to experimental conditions, and a count was deter- mined by averaging the total of 5 sections. b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 4.7. Western blot analysis Acknowledgments Proteins were separated on a 12% SDS-PAGE gel, and then transferred to a nitrocellulose membrane (Bio-Rad, Hercules, USA). The membrane was blocked using 5% nonfat milk and incubated with a mouse anti-p-Akt, t-Akt, p-eNOS, t-eNOS, p-GSK-3β, and t-GSK-3β monoclonal antibody (mAb) (Cell Signaling Technology, Beverly, MA, USA) or a mouse anti-β- actin mAb (Sigma, USA). The proteins were visualized and quantified using ECL reagents (Pierce, IL, USA). This work was supported by grants from Department of Edu- cation, Fujian Province (type A) (Grant number: JA12159) in part, and the Science Foundation of the Fujian Province, China (Grant No. 2015J01465). Appendix A. Supplementary material 4.8. mPTP opening assay Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.brainres. 2015.10.050 Preparation of mitochondria was adapted from a procedure described previously (Wu et al., 2006). All procedures were carried out in the cold (0–4 1C). Hippocampal pieces were placed in isolation buffer (250 mmol/L sucrose, 210 mmol/L mannitol, 1 mmol/L K-EDTA, 10 mmol/L Tris–HCl, pH 7.4) and homogenized (10 mL buffer/g). The homogenate was imme- diately centrifuged at 2000g for 3 min. The supernatant was centrifuged again at 2000g for 3 min, the second supernatant was decanted and centrifuged at 12,000g for 8 min, and the resulting supernatant was decanted and resuspended in isolation buffer without K-EDTA. The suspension was cen- trifuged at 12,000g for 10 min and the resulting mitochondrial pellet was resuspended in the same buffer. Mitochondrial protein concentration was quantified according to the Brad- ford's method using 1 g/mL bovine serum albumin (BSA) as standard. Purity and integrity of isolated mitochondria were confirmed by neutral red-Janus green B staining (Sigma, USA). Isolated mitochondria from the hippocampus (0.5 mg protein) was resuspended in swelling buffer (71 mmol/L sucrose, 215 mmol/L mannitol, and 10 mmol/L sodium succinate in 5 mmol/L HEPES, pH 7.4) to a final volume of 2 mL, and incubated at 25 1C for 2 min. mPTP-induced mitochondrial swelling was confirmed by 5 min incubation with the strong mPTP inhibitor CsA before addition of CaCl2, and was mea- sured with a spectrophotometer (Beckman DU800, USA) as a reduction in optical density at 540 nm (OD540) (Kristal and Brown, 1999; Baines et al., 2003). 4.9. Statistical analysis r e f e r e n c e s Chan, R.H., Song, D., Goonawardena, A.V., Bough, S., Sesay, J., Hampson, R.E., et al., 2010. Changes of hippocampal CA3–CA1 population nonlinear dynamics across different training ses- sions in rats performing a memory-dependent task. Conf. Proc. IEEE Eng. Med. Biol. Soc. 2010, 5464–5467. Morris, A.M., Churchwell, J.C., Kesner, R.P., Gilbert, P.E., 2012. Selective lesions of the dentate gyrus produce disruptions in place learning for adjacent spatial locations. Neurobiol. Learn. Mem. 97, 326–331. Hopkins, R.O., Haaland, K.Y., 2004. Neuropsychological and neu- ropathological effects of anoxic or ischemic induced brain injury. J. Int. Neuropsychol. Soc. 10, 957–961. Fan, L.W., Lin, S., Pang, Y., Lei, M., Zhang, F., Rhodes, P.G., et al., 2005. Hypoxia-ischemia induced neurological dysfunction and brain injury in the neonatal rat. Behav. Brain Res. 165, 80–90. Zhang, C., Shen, W., Zhang, G., 2002. N-methyl-D-aspartate receptor and L-type voltage-gated Ca2þ suppress the release of cytochrome and the expression of proeaspase-3 in rat hippocampus after global brain ischemia. Neurosci. Lett. 328, 265–268. channel antagonists Vannucci RC1, Brucklacher R.M., Vannucci, S.J., 2001. Intracellular calcium accumulation during the evolution of hypoxic- ischemic brain damage in the immature rat. Brain 126, l17–l20. Peng, B., Guo, Q.L., He, Z.J., Ye, Z., Yuan, Y.J., Wang, N., et al., 2012. Remote ischemic postconditioning protects the brain from global cerebral ischemia/reperfusion injury by up-regulating endothelial nitric oxide synthase through the PI3K/Akt path- way. Brain Res. 1445, 92–102. All data were presented as mean7standard deviation (SD). For comparison between multiple groups, data were analyzed by one-way ANOVA. When a statistical difference was deter- mined by ANOVA, the least significant difference (LSD) procedure was applied. The percentage of search strategies were examined by the Mann–Whitney method, and repetitive measure ANOVA was used to measure mean EL at different time points. Spatial probe trial data were analyzed by one- way ANOVA and principal components analysis (PCA). All analyses were performed with SPSS 13.0 for Windows, and a value of Po0.05 was considered significant. Danielisova´ , V., Gottlieb, M., Ne´ methova´ , M., Burda, J., 2008. Effects of bradykinin postconditioning on endogenous anti- oxidant enzyme activity after transient forebrain ischemia in rat. Neurochem. Res. 33, 1057–1064. Hu, X., Xie, C., He, S., Zhang, Y., Li, Y., Jiang, L., 2013. Remifentanil postconditioning improves global cerebral ischemia induced spatial learning and memory deficit in rats via inhibition of neuronal apoptosis through the PI3K signaling pathway. Neurol. Sci. 34, 1955–1962. Tsang, A., Hausenloy, D.J., Mocanu, M.M., Yellon, D.M., 2004. Postconditioning: a form of “modified reperfusion” protects the myocardium by activating the phosphatidylinositol 3- kinase-Akt pathway. Circ. Res. 95, 230–232. Lim, S.Y., Davidson, S.M., Hausenloy, D.J., Yellon, D.M., 2007. Competing interests Preconditioning and postconditioning: the essential role of the mitochondrial permeability transition pore. Cardiovasc. Res. 75, 530–535. Lemoine, S., Zhu, L., Beauchef, G., Lepage, O., Babatasi, G., The authors report no conflict of interest. Ivascau, C., et al., 2010. Role of 70-kDa ribosomal protein S6 35 36 b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 kinase, nitric oxide synthase, glycogen synthase kinase-3 beta, and mitochondrial permeability transition pore in desflurane-induced postconditioning in isolated human right atria. Anesthesiology. 112, 1355–1363. Fang, N.X., Yao, Y.T., Shi, C.X., Li, L.H., 2010. Attenuation of Feng, J., Lucchinetti, E., Ahuja, P., Pasch, T., Perriard, J.C., Zaugg, M., 2005. Isoflurane postconditioning prevents opening of the mitochondrial permeability transition pore through inhibition of glycogen synthase kinase 3beta. Anesthesiology 103, 987–995. ischemia reperfusion injury by sevoflurane postconditioning involves protein kinase B and glycogen synthase kinase 3 beta activation in isolated rat hearts. Mol. Biol. Rep. 37, 3763–3769. Zitta, K., Meybotun, P., Bein, B., Ohnesorge, H., Steinfath, M., Scholz, J., et al., 2010. Cytoprotective effects of the volatile anesthetic sevoflurane is highly dependent on timing and duration of Sevoflurane conditioning: fimings from a human, in-vitro hypoxia model. Eur. J. Pharmacol. 22, 475–480. Ye, Z., Guo, Q., Xia, P., Wang, N., Wang, E., Yuan, Y., 2012. Pagel, P.S., Krolikowski, J.G., Neff, D.A., Weihrauch, D., Bienen- graeber, M., Kersten, J.R., et al., 2006. Inhibition of glycogen synthase kinase enhances isoflurane-induced protection against myocardial infarction during early reperfusion in vivo. Anesth. Analg. 102, 1348–1354. Kristal, B.S., Stavrovskaya, I.G., Narayanan, M.V., Krasnikov, B.F., Brown, A.M., Beal, M.F., et al., 2004. The mitochondrial per- meability transition as a target for neuroprotection. J. Bioe- nergy Biomembr. 36, 309–312. Sevoflurane postconditioning involves an up-regulation of HIF-1alpha and HO-1 expression via PI3K/Akt pathway in a rat model of focal cerebral ischemia. Brain Res. 1463, 63–74. Nieminen, A.L., Petrie, T.G., Lemasters, J.J., Selman, W.R., 1996. Rikitake, Y., Hirata, K., Kawashima, S., Ozaki, M., Takahashi, T., Ogawa, W., et al., 2002. Involvement of endothelial nitric oxide in sphingosine-1-phosphate-induced angiogenesis. Arterios- cler. Thromb. Vasc. Biol. 22, 108–114. Cyclosporin A delays mitochondrial depolarization induced by N-methyl-D-aspanate in cortical neurons: evidence of the mitochondrial permeability transition. Neuroscience 75, 993–997. Ren, X., Wang, Z., Ma, H., Zuo, Z., 2014. Sevoflurane postcondi- tioning provides neuroprotection against brain hypoxia- ischemia in neonatal rats. Neurol. Sci. 35, 1401–1404. Wang, J.K., Yu, L.N., Zhang, F.J., Yang, M.J., Yu, J., Yan, M., et al., 2010. Postconditioning with sevoflurane protects against focal cerebral ischemia and reperfusion injury via PI3K/Akt path- way. Brain Res. 1357, 142–151. Tessier-Vetzel, D., Tissier, R., Waintraub, X., Ghaleh, B., Berdeaux, A., 2006. Isoflurane inhaled at the onset of reperfusion potentiates the cardioprotective effect of ischemic postcon- ditioning through a NO-dependent mechanism. J. Cardiovasc. Pharmacol. 47, 487–492. Lamberts, R.R., Onderwater, G., Hamdani, N., Vreden, M.J., Steenhuisen, J., Eringa, E.C., et al., 2009. Reactive oxygen species-induced stimulation of 5 AMP-activated protein kinase mediates sevoflurane-induced cardioprotection. Cir- culation 120, 10–15. Rastaldo, R., Pagliaro, P., Cappello, S., Penna, C., Mancardi, D., Schousboe, A., Sarup, A., Bak, L.K., Waagepetersen, H.S., Larsson, O.M., 2004. Role of astrocytic transport processes in glutama- tergic and GABAergic neurotransmission. Neurochem. Int. 45, 521–527. Kumral, A., Uysal, N., Tugyan, K., Sonmez, A., Yilmaz, O., Gok- men, N., et al., 2004. Erythropoietin improves long-term spatial memory deficits and brain injury following neonatal hypoxia-ischemia in rats. Behav. Brain Res. 153, 77–86. Ennaceur, A., Delacour, J., 1988. A new one-trial test for neuro- biological studies of memory in rats. Behav. Brain Res. 31, 47–59. Rodrı´guez, V.M., Carrizales, L., Mendoza, M.S., Fajardo, O.R., Giordano, M., 2003. Effects of sodium arsenite exposure on development and behavior in the rat. Neurotoxicol. Teratol. 24, 743–750. Li, Y., Chopp, M., Jiang, N., Yao, F., Zaloga, C., 1995. Temporal profile of in situ DNA fragmentation after transient middle cerebral artery occlusion in the rat. J. Cereb. Blood Flow Metab. 15, 389–397. Du, C., Hu, R., Csernansky, C.A., Hsu, C.Y., Choi, D., 1996. Very delayed infarction after mild focal cerebral ischemia: a role for apoptosis. J. Cereb. Blood Flow Metab. 16, 195–201. Westerhof, N., et al., 2007. Nitric oxide and cardiac function. Life Sci. 81, 779–793. Johns, R.A., 1996. Nitric oxide, cyclic guanosine momophosphate, and the anesthetic state. Anesthesiology 85, 457–459. Balaraman, Y., Limaye, A.R., Levey, A.I., Srinivasan, S., 2006. Glycogen synthase kinase-3beta and Alzheimer’s disease: pathophysiological and therapeutic significance. Cell Mol. Life Sci. 63, 1226–1235. Jope, R.S., Johnson, G.V., 2004. The glamour and gloom of glyco- gen synthase kinase-3. Trends Biochem. Sci. 29, 95–102. Chong, Z.Z., Li, F., Maiese, K., 2007. The pro-survival pathways of mTOR and protein kinase B target glycogen synthase kinase- 3beta and nuclear factor-kappa B to foster endogenous microglial cell protection. J. Mol. Med. 19, 263–272. Pap, M., Cooper, G.M., 1998. Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-kinase/Akt cell survival pathway. J. Biol. Chem. 273, 19929–19932. Duarte, A.I., Santos, P., Oliveira, C.R., Santos, M.S., Rego, A.C., 2008. Insulin neuroprotection against oxidative stress is mediated by Akt and GSK-3beta signaling pathways and changes in protein expression. Biochim. Biophys. Acta 1783, 994–1002. Hu, B.R., Liu, C.L., Ouyang, Y., Blomgren, K., Siesjo¨ , B.K., 2000. Involvement of caspase-3 in cell death after hypoxia-ischemia declines during brain maturation. Cereb. Blood Flow Metab. 20, 1294–1300. Kann, O., Kovacs, R., Njunting, M., Behrens, C.J., Ota´ hal, J., Lehmann, T.N., et al., 2005. Metabolic dysfunction during neuronal activation in the ex vivo hippocampus from chronic epileptic rats and humans. Brain 128, 2396–2407. Gomez, L., Paillard, M., Thibault, H., Derumeaux, G., Ovize, M., 2008. Inhibition of GSK3beta by postconditioning is required to prevent opening of the mitochondrial permeability transi- tion pore during reperfusion. Circulation 117, 2761–2768. Zhu, J., Rebecchi, M.J., Tan, M., Glass, P.S., Brink, P.R., Liu, L., 2010. Age-associated differences in activation of Akt/GSK-3beta signaling pathways and inhibition of mitochondrial perme- ability transition pore opening in the rat heart. J. Gerontol. A Biol. 65, 611–619. Mancuso, C., Scapagini, G., Curro` , D., Giuffrida Stella, A.M., De Marco, C., Butterfield, D.A., et al., 2007. Mitochondrial dys- function free radical generation and cellular stress response in neurodegenerative disorders. Front. Biosci. 12, 1107–1123. Kroemer, G., Reed, J.C., 2000. Mitochondrial control of cell death. Hidenori, E., Chikako, N., Hiroshi, K., 2006. Activation of the Akt/ GSK-3β signaling pathway mediates survival of vulnerable hippocampal neurons after transient global cerebral ischemia in rat. J. Cereb. Blood Flow Metabol. 26, 1479–1489. Nat. Med. 6, 513–519. Juhaszova, M., Zorov, D.B., Yaniv, Y., Nuss, H.B., Wang, S., Sollott, S.J., 2009. Role of glycogen synthase kinase-3beta in cardio- protection. Circ. Res. 104, 1240–1252. Takahashi, M., Tomizawa, K., Kato, R., Sato, K., Uchida, T., Fujita, S.C., et al., 1994. Localization and developmental changes of tau protein kinase I/glycogen synthase kinase-3 beta in rat brain. J. Neurochem. 63, 245–255. b r a i n r e s e a r c h 1 6 3 0 ( 2 0 1 6 ) 2 5 – 3 7 Leroy, K., Brion, J.P., 1999. Developmental expression and locali- zation of glycogen synthase kinase-3beta in rat brain. J. Chem. Neuroanat. 16, 279–293. Zhang, J., Wang, C., Yu, S., Luo, Z., Chen, Y., Liu, Q., et al., 2014. Sevoflurane postconditioning protects rat hearts against ischemia-reperfusion injury via the activation of PI3K/AKT/ mTOR signaling. Sci. Rep. 4, 7317. Bartley, J., Soltau, T., Wimborne, H., Kim, S., Martin-Studdard, A., Hess, D., et al., 2005. Brd U-positive cells in the neonatal mouse hippocampus following hypoxic-ischemic brain injury. BMC Neurosci. 6, 15. Satoh, J., Onoue, H., 2005. Nogo-A and nogo receptor expression in demyelinating lesions of multiple sclerosis. J. Neuropathol. Exp. Neurol. 64, 129–138. Juhaszova, M., Zorov, D.B., Kim, S.H., Pepe, S., Fu, Q., Fishbein, K. W., et al., 2004. Glycogen synthase kinase-3beta mediates convergence of protection signaling to inhibit the mitochon- drial permeability transition pore. J. Clin. Invest. 113, 1535–1549. Bruel-Jungerman, E., Laroche, S., Rampon, C., 2005. New neurons in the dentate gyrus are involved in the expression of enhanced long-term memory following environmental enrichment. Eur. J. Neurosci. 21, 513–521. Jiang, M.L., Han, T.Z., Pang, W., Li, L., 2004. Gender-and age- Pravdic, D., Sedlic, F., Mio, Y., Vladic, N., Bienengraeber, M., Bosnjak, Z.J., 2009. Anesthetic-induced preconditioning delays opening of mitochondrial permeability transition pore via protein Kinase C-epsilon-mediated pathway. Anesthesiology 111, 267–274. Zhang, F., Phiel, C.J., Spece, L., Gurvich, N., Klein, P.S., 2003. Inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3) in response to lithium. Evidence for autoregulation of GSK-3. J. Biol. Chem. 278, 33067–33077. specific impairment of rat performance in the Morris water maze following prenatal exposure to an MRI magnetic field. Brain Res. 995, 140–144. Wu, L., Shen, F., Lin, L., Zhang, X., Bruce, I.C., Xia, Q., 2006. The neuroprotection conferred by activating the mitochondrial ATP sensitive Kþ channel is mediated by inhibiting the mitochondrial permeability transition pore. Neurosci. Lett. 402, 184–189. Kristal, B.S., Brown, A.M., 1999. Apoptogenic ganglioside GD3 Lochhead, P.A., Coghlan, M., Rice, S.Q., Sutherland, C., 2001. Inhibition of GSK-3 selectively reduces glucose-6-phosphatase and phosphatase and phosphoenolypyruvate carboxykinase gene expression. Diabetes 50, 937–946. Liang, M.H., Chuang, D.M., 2007. Regulation and function of glycogen synthase kinase-3 isoforms in neuronal survival. J. Biol. Chem. 282, 3904–3917. directly induces the mitochondrial permeability transition. Biol. Chem. 274, 23169–23175. Baines, C.P., Song, C.X., Zheng, Y.T., Wang, G.W., Zhang, J., Wang, O.L., et al., 2003. Protein kinase C-epsilon interacts with and inhibits the permeability transition pore in cardiac mito- chondria. Circ. Res. 92, 873–880. 37",rats,['Seven-day-old Sprague-Dawley rats were subjected to brain HI'],postnatal day 7,['Seven-day-old Sprague-Dawley rats were subjected to brain HI'],Y,"['Twelve rats in each group underwent behavioral testing and their brains were harvested for hippocampus neuron count and morphology study.', 'Results of the Morris water maze test are shown in Table 1', 'Results of the space exploration test.']",sevoflurane,['Research Report Sevoflurane postconditioning improves long-term learning and memory of neonatal hypoxia-ischemia brain damage rats via the PI3K/Akt-mPTP pathway'],none,[],sprague dawley,['Seven-day-old Sprague-Dawley rats were subjected to brain HI'],"However, studies have not examined the long-term learning and memory of neonatal HIBD rats that received sevoflurane postconditioning, the role of PI3K/Akt-mPTP pathway in the process, and related signal-regulating downstream Akt kinases.","['However, studies have not examined the long-term learning and memory of neonatal HIBD rats that received sevoflurane postconditioning, the role of PI3K/Akt-mPTP pathway in the process, and related signal-regulating downstream Akt kinases.']",None,[],"Sevoflurane postconditioning exerts a neuroprotective effect against HIBD in neonatal rats via PI3K/Akt/eNOS and PI3K/Akt/GSK-3β pathways, and blockage of mPTP opening may be involved in attenuation of histomorphological injury.","['Conclusions: Sevoflurane postconditioning exerts a neuroprotective effect against HIBD in neonatal rats via PI3K/Akt/eNOS and PI3K/Akt/GSK-3β pathways, and blockage of mPTP opening may be involved in attenuation of histomorphological injury.']","There are some limitations to this study. Arterial blood gas analysis was not performed during cerebral HI. Some researchers believe that cerebral HI itself, to a certain degree, can promote proliferation of cortical neurons and hippocampal neural precursor cells in neonatal rats, while sevoflurane lowers the cerebral metabolic rate, so both play a role in the recovery of neurological function. The result that Art neutralized the neuroprotective effect of sevoflurane postconditioning may partially be due to its effect of inhibiting energy generation rather than blocking mPTP. CsA may be incapable of blocking mPTP opening when mitochondria are seriously injured, and its neuroprotective effect may be dose-dependent. Whether combining different concentrations of sevoflurane and different doses of CsA can protect against HIBD to different degrees requires future study. We did not perform 2,3,5-triphenyltertrazolium chloride (TTC) staining to determine brain infarct volume. Lastly, other pathways such as PI3K/Akt/mTOR or ERK1/2 were not studied.","['There are some limitations to this study. Arterial blood gas analysis was not performed during cerebral HI. Some researchers believe that cerebral HI itself, to a certain degree, can promote proliferation of cortical neurons and hippocampal neural precursor cells in neonatal rats, while sevoflurane lowers the cerebral metabolic rate, so both play a role in the recovery of neurological function. The result that Art neutralized the neuroprotective effect of sevoflurane postconditioning may partially be due to its effect of inhibiting energy generation rather than blocking mPTP. CsA may be incapable of blocking mPTP opening when mitochondria are seriously injured, and its neuroprotective effect may be dose-dependent. Whether combining different concentrations of sevoflurane and different doses of CsA can protect against HIBD to different degrees requires future study. We did not perform 2,3,5-triphenyltertrazolium chloride (TTC) staining to determine brain infarct volume. Lastly, other pathways such as PI3K/Akt/mTOR or ERK1/2 were not studied.']",None,[],True,True,True,True,True,True,10.1016/j.brainres.2015.10.050 10.1371/journal.pone.0070645,564.0,Lei,2013,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"Perinatal Supplementation with Omega-3 Polyunsaturated Fatty Acids Improves Sevoflurane- Induced Neurodegeneration and Memory Impairment in Neonatal Rats Xi Lei1, Wenting Zhang2, Tengyuan Liu3, Hongyan Xiao1, Weimin Liang1, Weiliang Xia3*, Jun Zhang1* 1 Department of Anesthesiology, Huashan Hospital, Fudan University, Shanghai, P. R. China, 2 National Key Laboratory of Medical neurobiology, Fudan University, Shanghai, P. R. China, 3 School of Biomedical Engineering and Med-X Research Institute, Shanghai Jiaotong University, Shanghai, P. R. China Abstract Objectives: To investigate if perinatal Omega-3 polyunsaturated fatty acids (n-3 PUFAs) supplementation can improve sevoflurane-induced neurotoxicity and cognitive impairment in neonatal rats. Methods:Female Sprague-Dawley rats (n = 3 each group) were treated with or without an n-3 PUFAs (fish oil) enriched diet from the second day of pregnancy to 14 days after parturition. The offspring rats (P7) were treated with six hours sevoflurane administration (one group without sevoflurane/prenatal n-3 PUFAs supplement as control). The 5- bromodeoxyuridine (Brdu) was injected intraperitoneally during and after sevoflurane anesthesia to assess dentate gyrus (DG) progenitor proliferation. Brain tissues were harvested and subjected to Western blot and immunohistochemistry respectively. Morris water maze spatial reference memory, fear conditioning, and Morris water maze memory consolidation were tested at P35, P63 and P70 (n = 9), respectively. Results:Six hours 3% sevoflurane administration increased the cleaved caspase-3 in the thalamus, parietal cortex but not hippocampus of neonatal rat brain. Sevoflurane anesthesia also decreased the neuronal precursor proliferation of DG in rat hippocampus. However, perinatal n-3 PUFAs supplement could decrease the cleaved caspase-3 in the cerebral cortex of neonatal rats, and mitigate the decrease in neuronal proliferation in their hippocampus. In neurobehavioral studies, compared with control and n-3 PUFAs supplement groups, we did not find significant spatial cognitive deficit and early long-term memory impairment in sevoflurane anesthetized neonatal rats at their adulthood. However, sevoflurane could impair the immediate fear response and working memory and short-term memory. And n-3 PUFAs could improve neurocognitive function in later life after neonatal sevoflurane exposure. Conclusion: Our study demonstrated that neonatal exposure to prolonged sevoflurane could impair the immediate fear response, working memory and short-term memory of rats at their adulthood, which may through inducing neuronal apoptosis and decreasing neurogenesis. However, these sevoflurane-induced unfavorable neuronal effects can be mitigated by perinatal n-3 PUFAs supplementation. Citation: Lei X, Zhang W, Liu T, Xiao H, Liang W, et al. (2013) Perinatal Supplementation with Omega-3 Polyunsaturated Fatty Acids Improves Sevoflurane- Induced Neurodegeneration and Memory Impairment in Neonatal Rats. PLoS ONE 8(8): e70645. doi:10.1371/journal.pone.0070645 Editor: Georges Chapouthier, Universite´ Pierre et Marie Curie, France Received April 25, 2013; Accepted June 20, 2013; Published August 13, 2013 Copyright: (cid:2) 2013 Lei et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by Natural Science Foundation of China (to Jun Zhang, Grant No. 81171020). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. E-mail: weiliangxia@gmail.com (WX); snapzhang@yahoo.com.cn (JZ) Introduction Sevoflurane is one of the most frequently used volatile general anesthetic agents used during surgical procedures. It is especially useful for pediatric anesthesia because sevoflurane allows rapid induction and recovery and is less irritating to the airway than other inhaled anesthetics [1]. Recent evidence demonstrates that volatile anesthetics can induce neuronal apoptosis [2,3], affect in vitro and in vivo [4], and disturb long-term neurogenesis neurocognitive function in 7-day-old rats [5]. Although several studies report sevoflurane is less cytotoxic than isoflurane and desflurane, sevoflurane exposure in neonates reportedly increases risk for neurodevelopmental impairments in animal models [6–9]. Given its clinical relevance and potential for unfavorable outcomes in pediatric anesthesia, we sought to substantiate sevoflurane’s putative neurotoxic effects, and develop a strategy to prevent sevoflurane-induced neurodevelopmental impairment in neonatal rats. Omega-3 polyunsaturated fatty acids (n-3 PUFAs) are essential dietary nutrients that play critical roles in brain development and function. Their contributions to learning and memory are well documented with maternal n-3 PUFA supplementation during gestation [10]. Prenatal n-3 PUFAs supplementation confers long- term neuroprotection against neonatal hypoxia-ischemic injury via PLOS ONE | www.plosone.org 1 August 2013 | Volume 8 | Issue 8 | e70645 N-3 PUFAs Improve Neurotoxicity of Sevoflurane anti-inflammatory actions [11], and attenuates hyperoxia-induced neuronal apoptosis in the developing brain [12]. Conversely, n-3 PUFAs deficiency altered neurogenesis in embryonic [13] and adult [14] rat brains. They also may exert effects in human neurodegenerative conditions. In a randomized double-blind trial, n-3 PUFAs administration demonstrated positive effects in a small group of Alzheimer’s patients [15]. The effect of n-3 PUFAs on postnatal anesthetic-induced neurotoxicity in the developing brain, however, has never been studied. We hypothesized that n-3 PUFAs supplementation during pregnancy and lactation could protect against neurotoxicity in neonatal rats exposed to sevo- flurane anesthesia. Materials and Methods Animal/Anesthesia treatment The rats used in the present study were obtained from the Animal Care Center of Fudan University. The study protocol was reviewed and approved by the Institutional Animal Care and Use Committee, Fudan University. One-day pregnant female Sprague Dawley rats (weight 220–250 g) were randomly assigned to one of the three groups: control, sevoflurane, or sevoflurane with n-3 PUFAs (n = 3 per group). Fish oil, the main source of n-3 PUFAs (Eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA)), was extracted from the capsule (1000 mg/capsule that containing 180 mg EPA and 120 mg DHA, Puritan’s Pride, Bohemia, NY, USA) and added to food. Pregnant dams in the sevoflurane and control groups were fed a regular laboratory rodent diet with a low n-3 PUFAs concentration (0.5% of total fatty acid), whereas the sevoflurane with n-3 PUFAs group were fed the same diet, but supplemented with n-3 PUFAs (15 mg fish oil/g regular diet) from day 2 of pregnancy to 14 days after parturition. Dams were given free access to food and water, and dams for all groups were kept under identical housing conditions with a 12-h light cycle. On postnatal day 7 (P7), in the sevoflurane and the rat pups sevoflurane with n-3 PUFAs groups received sevoflurane anesthe- sia. P7 rats were placed in a sealed box ventilated with 3% sevoflurane in 60% oxygen and treated for 6 h. The temperature in the sealed box was maintained at 33–35uC. The total survival percentage of P7 rats after 6-h anesthesia was 88.4%; the likely cause of death was respiration depression. After anesthesia, the pups were returned to the dams. Control rat pups were placed in the same box without sevoflurane exposure and under identical experimental conditions. The flow chart for the experimental protocol is summarized in Figure 1. Blood gas analysis gases. Blood was percutaneously aspirated from the left cardiac ventricle after 0, 2, 4, and 6 h of anesthesia (n = 3 per time point). From these samples, we measured partial pressures of carbon dioxide and oxygen, pH, and blood lactate and glucose levels with a Radiometer ABL 800 blood gas analyzer (Radiometer, Copenhagen, Denmark). BrdU injection sevoflurane affects progenitor cell proliferation in the S-phase of the cell cycle, bromodeoxyuridine ((+)-59-bromo-29-deoxyuridine [BrdU]; 97%; Sigma-Aldrich, St. in 0.9% sterile saline solution was injected Louis, MO, USA) intraperitoneally using the procedure described by Wojtowicz [16]. The first dose (150 mg/kg) was administered immediately before sevoflurane treatment, and the three subsequent injections (50 mg/kg BrdU) were given at 24-h intervals following sevo- flurane anesthesia. To determine whether Tissue preparation and immunohistochemistry Animals were deeply anesthetized with chloral hydrate and then transcardially perfused with 0.9% saline followed by 4% parafor- maldehyde in 0.1 M phosphate buffered saline (PBS), pH 7.4. The brains were removed, postfixed overnight in 4% paraformalde- hyde/PBS, and placed in 30% sucrose until they sank in the solution. Coronal sections (30 mm) were cut on a microtome (Leica CM1900 UV, Wetzlar, Germany) and every sixth section was stored in 30% sucrose containing 30% ethylene glycol to stain BrdU or cleaved caspase-3. For immunocytochemical detection of BrdU-labeled nuclei, DNA was denatured to expose the antigen for incubation with 2 N hydrochloric acid for 30 min at 37uC, followed by neutralization with two 10-min incubation periods in 0.5 M boric acid (pH 8.5) at room temperature (RT). Sections were subjected to three 10- min washes in PBS with 0.3% Triton-X with 10 min between each wash. Nonspecific epitopes were blocked with 1% serum for 30 min at RT, and were incubated overnight at 4uC with either BrdU (1:100; BD Pharmingen, Franklin Lakes, NJ, USA) or cleaved caspase-3 (1:1,000; Cell Signaling, Danvers, MA, USA) antibody in PBS and 1% serum. On day 2, the sections were incubated with the appropriate secondary fluorescent antibodies (Alexa Fluor 488, 1:200; Invitrogen, Carlsbad, CA, USA) for 2 h at RT, in PBS. Nuclear counterstaining was performed with 49,6-diamidino-2-phenylin- dole (1:500; Beyotime Institute of Biotechnology, Haimen, China), which was followed by mounting and coverslipping with an aqueous mounting medium. Images were acquired with a microscope (Leica DM2500). BrdU- or cleaved caspase-3-positive cells were counted in a blinded manner at 620 magnification [17]. Questionable structures were excluded from the count if their identification remained uncertain under 640 magnification. followed by three 5-min washes Twelve naı¨ve P7 rats that that did not participate in other experiments were used to assess the effect of sevoflurane on blood Figure 1. Schematic timeline of the experimental procedure. Omega-3 polyunsaturated fatty acids (n-3 PUFAs) supplementation began in dams from pregnancy day 2 to 14 days after parturition or until the day when the brains of their offspring were harvested. The neonatal rats were exposed to 3% sevoflurane (Sevo) for 6 h at their seventh day (P7). The behavioral tests including Morris water maze spatial reference memory, fear conditioning, and Morris water maze memory consolidation on P35–38, P63–64, and P70–79, respectively. P = postnatal day. doi:10.1371/journal.pone.0070645.g001 PLOS ONE | www.plosone.org 2 August 2013 | Volume 8 | Issue 8 | e70645 Western blot analysis The cerebral cortex, thalamus, and hippocampus were harvest- ed 18 h after sevoflurane treatment. The brain tissues were homogenized in RIPA buffer (Millipore, Temecula, CA, USA) containing complete protease inhibitor cocktail and 2 mM phenylmethylsulfonyl fluoride. The lysates were collected and centrifuged at 12,000 rpm for 30 min at 4uC. After the protein samples were quantified using a BCA Protein Assay Kit (Pierce Biotechnology, Rockford, IL, USA), 60 mg of each sample was electrophoresed through a 14% sodium dodecyl sulfate-polyacryl- amide gel and wet electrotransferred to 0.45-mm nitrocellulose membranes (Millipore). The blots were incubated overnight at 4uC with a polyclonal anti-cleaved caspase-3 antibody, and then incubated with a rabbit anti-mouse polyclonal horseradish peroxidase-conjugated secondary antibody (1:5,000; Epitomics, Hangzhou, Zhejiang Province, China) at RT for 1 h. Protein signals were detected using an enhanced chemiluminescence detection system (Pierce Biotechnology). A b-actin antibody (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA, USA) was used to normalize sample loading and transfer. Band intensities were densitometrically quantified using Gel-Pro Analyzer (Media Cybernetics, Bethesda, MD, USA). Neurobehavioral tests in the neurobehavioral tests to exclude estrogen influences on neurocog- nitive evaluations. The water maze setup in spatial reference We used only male offspring (n = 9 per group) Figure 2. Morris water maze setup. Numbers: platform location; Letters: drop location. In the spatial reference memory task, the platform location is in the middle of one of four virtual quadrants (2). In the probe training session, the rat are released from four pseudor- andomly assigned points (D,E,H and G) which provide two short and two medium swims to the platform location per session. In the probe test session, the drop location (F) is at the opposite of original platform. In the memory consolidation task, the platform location are quarter-way between the center of the maze and the wall of the tank on the border of two quadrants (1) or within a quadrant (4), or in the center of the maze (3) or in the middle of one of four virtual quadrants (2). The drop location was pseudorandomly varied to incorporate one short, one medium, and one long swim to platform. doi:10.1371/journal.pone.0070645.g002 PLOS ONE | www.plosone.org 3 N-3 PUFAs Improve Neurotoxicity of Sevoflurane memory task and memory consolidation task was shown in Figure 2. Morris water maze spatial reference memory. Probe training: Rats trained for 4 consecutive days (postnatal days 35– 38, P35–38) in the Morris water maze following treatment with a vehicle or 3% sevoflurane for 6 h. A platform (10.3-cm diameter) was submerged in a circular pool (180-cm diameter, 50-cm depth) filled with warm (23–25uC) opaque water. Rats performed two training sessions each day. In each session, rats performed four trials in which they were released from one of four pseudor- andomly assigned release points while facing the tank wall. This provided two short and two medium swims per session. Animals were allowed 60 s to locate the hidden platform, and if they failed to find the hidden platform in the allotted time, the investigator guided the animal to the platform. In either case, the rats were removed from the platform after 15 s. Training sessions were conducted until the rats could locate the hidden platform in less than 15 s in at least five sessions (average time per session). All trials were videotaped, and rat swim paths were recorded with ANY-maze video tracking system (Stoelting Co., Wood Dale, IL, USA), which allowed us to measure the time taken (latency) to find the platform(s), as well as other behavioral information obtained during the spatial reference memory test. The animals were dried and placed beneath a heating lamp after completing each test. test: A probe trial was performed with the platform removed from the tank to assess memory retention for the hidden platform location. Probe trials were administered 1 day after the last training session (P38). During the 60-s probe trial, we determined the number of entries into the platform quadrant zone, the swimming speed (cm/s), the total distance (cm), and the in the target quadrant relative versus the other time spent quadrants. Probe Fear conditioning test. Rats underwent fear conditioning tests on postnatal days 63–64 (P63–64). Every time four rats randomly chosen from three groups were trained in each session. Rats were placed in plastic chambers with a grid floor constructed from 19 stainless steel bars (4-mm diameter, spaced every 16 mm). The floors were connected to a shock delivery system (Coulbourn, Whitehall, PA, USA), and electrical shocks were delivered through illuminated with the stainless overhead fluorescent bulbs, and a ventilation fan provided background noise (65 db). The training context was considered the appearance, odor, and texture of the environment (chamber and room) in which the rats were trained. After a 3-min baseline exploratory period, rats were presented with three auditory tones (2,000 Hz, 90 db) that were followed 1 min later by an electric shock (1 mA, 2 s). We quantified the rats’ fear response with freezing, which is an innate defensive fear response in rodents and a reliable measure of learned fear. Freezing was defined as the lack of movement, except for respiration. We examined rats in the fear condition test the day after they first received the electrical shock to determine whether they showed fear to the training context or the auditory tone. For the context test, rats were placed in the chamber where they were trained on the previous day. The rats remained in the chamber for 8 min, without an auditory tone or shock. For the tone test, rats were transported in groups to a context chamber with black boards covering the walls. Rats were allowed a 3-min exploratory period before three 30-s tones were played (2,000 Hz, 90 db, separated by 60 s). Rats were removed from the chamber 30 s after the tone presentation. The order of the context and tone tests was counterbalanced so that half of each treatment group first was tested for context and then for tone, whereas the other half of the treatment group was tested in the reverse order. FreezeView software (Coulbourn) was used to score steel bars. The chamber was August 2013 | Volume 8 | Issue 8 | e70645 each animal’s freezing behavior separately for the training period and the context and tone tests, which were expressed as a percentage. Morris water maze memory consolidation. Working mem- ory (WM): On postnatal day 70 (P70), the testing room was rearranged by repositioning the water tank and adding new spatial cues. The platform was submerged 1.5 cm below the water surface in one of four designated platform positions. From P70 onward, one session was conducted per day. Each session began with a 60-s free swim (performance not scored) in which rats explored the maze, and was followed by a 1-min rest interval and three subsequent scored trials. Rats that found the platform during the free swim were allowed to rest on the platform for 15 s. Rats that failed to find the platform during the free swim were guided to the platform and remained there for 15 s. After the free swim, three trials were administered in which the rat was released from one of six pseudorandomly chosen locations that faced the tank wall. The platform location was identical for all animals in a session, but the drop location was pseudorandomly varied to incorporate one short, one medium, and one long swim. Training sessions were administered until the session average for finding the hidden platform was less than 15 s. The latency for reaching the platform was recorded by the ANY-maze video tracking system. Short-term memory (STM) and early long-term memory (ELTM): When the WM latencies of rats in task were plateaued on postnatal day 77 (P77), we increased the delay between the free swim and the subsequent trials. The delay was extended from 1 min on P77 to 1 h on postnatal day 78 (P78) to test STM, and then to 4 h on P79 to test ELTM. Performances on the last trial after the free swim on P77 (1-min delay), P78 (1-h delay), and P79 (4-h delay) were used as measures of WM, STM, and ELTM, respectively. Statistical methods All data are presented as mean 6 standard deviation. We performed two-tailed t to determine differences in cleaved caspase-3 immunohistochemistry and blood gas parameters between the control and sevoflurane groups. We used a one-way analysis of variance followed by Newman-Keuls post hoc tests to determine differences among groups for interactions between n-3 PUFAs or sevoflurane and cleaved caspase-3 activation, BrdU quantification, or neurobe- havioral tests. For all tests, p,0.05 was considered statistically significant. tests (assuming equal variances) Results Blood gas analysis We assessed blood gas and biochemical changes in P7 rats treated with continuous 3% sevoflurane in 60% oxygen for 0, 2, 4, or 6 h. The partial pressures of carbon dioxide and oxygen, pH, and blood glucose and lactate levels at each time point are shown in Figure 3. We observed that prolonged sevoflurane anesthesia caused hypercarbia, but not hypoxemia, which could be due to respiration depression. Neuronal apoptosis Caspase-3 is a ubiquitously distributed caspase, and its activation strongly suggests cellular apoptosis [18]. Eighteen hours showed after sevoflurane anesthesia induction, neonatal rats greater amounts of cleaved caspase-3 immunoreactivity in the (Figure 4K–M) parietal cortex (Figure 4A–E) and thalamus compared to controls. Our results sevoflurane dramatically increased the incidence of apoptosis in thalamic (median 46-fold increase compared with control). neurons indicate that PLOS ONE | www.plosone.org 4 N-3 PUFAs Improve Neurotoxicity of Sevoflurane Although sevoflurane treatment slightly increased apoptosis in cornu ammonis (CA) 1 and 3 hippocampal regions (Figure 4F–J), these changes were not significant. n-3 PUFAs attenuate sevoflurane-induced neuronal apoptosis We examined cortical extracts with western blots to verify activated caspase-3 immunofluorescence represented apoptosis, and to quantify the apoptotic response. Cleaved caspase-3 immunoblotting confirmed that 3% sevoflurane treatment for 6 h increased caspase-3 activity in the parietal cortex of neonatal supplementation significantly rat pups. Perinatal n-3 PUFAs ameliorated cleaved caspase-3 expression in the parietal cortex (Figure 5) of offspring rats that underwent sevoflurane anesthesia. n-3 PUFAs reverse sevoflurane-induced inhibition of hippocampal neuronal proliferation Newly generated BrdU-labeled cells were observed in the dentate gyrus (DG) subgranular zone following immunofluores- cence labeling. Sevoflurane decreased the number and fluores- cence intensity of BrdU-labeled cells in the DG compared with controls, but these changes were attenuated by perinatal n-3 PUFAs supplementation (Figure 6). These findings suggest that perinatal n-3 PUFAs supplementation can reverse sevoflurane- induced neuronal proliferation inhibition in neonatal rat hippo- campus. n-3 PUFAs improve neonatal sevoflurane-induced neurobehavioral deficits in adulthood Sevoflurane anesthesia and n-3 PUFAs supplementation did not affect escape latencies during the six probe training sessions in the Morris water maze (Figure 7A). Similarly, sevoflurane anesthesia did not affect the frequency required to cross the platform region (Figure 7B) or the swimming distance (Figure 7C) during the probe the trial. Finally, n-3 PUFAs supplementation did not affect sevoflurane-induced reduction in swimming speed (Figure 7D). In the fear conditioning training session, the postshock freezing response in rats with neonatal exposure to sevoflurane was significantly decreased compared with controls for shocks 1 and 2. Maternal n-3 PUFAs significantly increased postshock freezing in the offspring. Postshock freezing was similar across all groups for the third tone/shock pairing (Figure 7E). To assess the influence of neonatal exposure to sevoflurane on ELTM, rats underwent contextual/cued fear conditioning tests. In this paradigm, we failed to find any differences after one training day (Figure 7F–G). These results indicate that sevoflurane has no effect, and n-3 PUFAs did not further improve ELTM in the fear conditioning test. supplementation, however, Memory consolidation describes the transition from unstable memories to stable memories. At least four different stages of memory consolidation are distinguished, three of which are assessed here: WM (minutes), STM (minutes to hours), and ELTM (greater than 3 h). We did not assess remote long-term memory because this process requires delays between memory formation and recall that span weeks to months. In the 1-min delay training session, sevoflurane increased escape latencies in the sixth and eighth sessions, whereas supplementation decreased the escape latencies in sevoflurane-treated animals in the fourth, sixth, and eighth sessions (Figure 7H–I). In the 1-h delay session (session 9), sevoflurane-treated rats had significantly longer escape latencies than controls, and sevoflurane-treated rats pre-treated with fish oil had significantly lower escape latencies than sevoflurane-treated rats (Figure 7J). Sevoflurane anesthesia fish oil August 2013 | Volume 8 | Issue 8 | e70645 N-3 PUFAs Improve Neurotoxicity of Sevoflurane Figure 3. Arterial blood gas and biochemical analysis. A: pH; B: PaCO2; C: PaO2; D: Blood lactate concentration; E: Blood glucose concentration. FiO2: fraction of inspired oxygen; PaCO2: partial pressure of carbon dioxide; PaO2: partial pressure of oxygen. Sevo treatment could decrease pH (A) due to hypercarbia (B) and increase the blood glucose concentration; n = 3 at each time. doi:10.1371/journal.pone.0070645.g003 impaired performance in a spatial recognition memory task when 1-min and 1-h delays were introduced between memory encoding and memory retrieval, and perinatal n-3 PUFAs supplementation alleviated this deficit. These results indicate that sevoflurane can impair WM and STM, but n-3 PUFAs can alleviate these impairments. Interestingly, there was no significant difference among groups in escape latency at the 4-h delay session (session 10, Figure 7K), indicating that sevoflurane may not affect ELTM. Discussion Main findings The major findings in this study were as follows: (1) sevoflurane exposure induced neuronal apoptosis in rat pups, (2) sevoflurane exposure decreased hippocampal neuron proliferation in neonates, (3) sevoflurane exposure in neonates impaired STM two months later, and (4) perinatal n-3 PUFA supplementation protects neurons against all three of these sevoflurane-induced changes. neuronal apoptosis. Compared with littermate controls, rat pups ex- posed to 3% sevoflurane for 6 h on P7 (third trimester-equivalent in humans) showed increased apoptotic neurodegeneration in Effects of sevoflurane anesthesia on PLOS ONE | www.plosone.org 5 August 2013 | Volume 8 | Issue 8 | e70645 PLOS ONE | www.plosone.org 6 N-3 PUFAs Improve Neurotoxicity of Sevoflurane August 2013 | Volume 8 | Issue 8 | e70645 N-3 PUFAs Improve Neurotoxicity of Sevoflurane Figure 4. The effects of neonatal sevoflurane exposure on caspase-3 expression. Immunofluorescence revealed the effects of the 6-h 3% sevoflurane exposure on cleaved caspase-3 expression in neonatal rat brains at P7 (n = 3 in each group). The photomicrographs (56) of cleaved caspase-3 in the parietal cortex in control group (A) and in the Sevo group (B); C: The photomicrographs (56with 206inset) of cleaved caspase-3 in the parietal cortex in control group (C) and in the Sevo group (D); Quantification of cleaved caspase-3 in parietal cortex (control vs. Sevo, p = 0.0389) (E); The photomicrographs (106) of cleaved caspase-3 in the CA1 (F), CA3 (H) of controls and CA1 (G), CA3 (I) in Sevo group; Quantification of cleaved caspase-3 in hippocampus region (control vs. Sevo, NS) (J); Photomicrographs (106) of cleaved caspase-3 in the thalamus in control group (K) and in Sevo group (L); Quantification of cleaved caspase-3 in the thalamus region (control vs. Sevo, p = 0.0002) (M). doi:10.1371/journal.pone.0070645.g004 major brain regions that are important for learning and memory. Neuronal apoptosis was partly attributed to hypercarbia caused by sevoflurane-induced respiratory depression, although a previous indicated that hypercarbia does not cause significant report neurocognitive impairment [19]. Some studies indicate sevoflur- ane can induce neuronal apoptosis in neonatal rodents, but most of these studies examined apoptosis only in neocortical [20,21] or hippocampal [22] tissue. We found that neonatal sevoflurane exposure induced caspase-3 activation in the cortex and thalamus, but not the hippocampus. Similarly, Zhu et al. [4] reported that isoflurane had no obvious effect on hippocampal cell death in P14 rats. Anesthetic treatment therefore may have differential effects on neurons at various developmental stages. on sevoflurane neurogenesis. Neonatal neurogenesis begins when cells prolif- erate and ends when cells migrate and integrate into a neuronal circuit as a functional neuron. is widely believed that neurogenesis enables hippocampal plasticity and new memories [23]. In addition to neuronal apoptosis, several recent studies correlate alterations in neurogenesis with cognitive performance [24,25]. Hippocampal neurogenesis initiated after volatile anesthesia in P7 rats [26–28], and the mechanisms underlying this phenomenon have been reviewed [29]. The effect of general anesthesia on neurogenesis, however, is controversial. Whether anesthesia stimulates or depresses neurogenesis appears to depend on the duration, concentration [30], and type of anesthetic administrated [31,32], as well as the animal model used [27] and the experimental conditions [33]. We found that 3% sevoflurane treatment for 6 h significantly decreased the number of BrdU+ cells in the hippocampus DG in P7 rats. Because this inhibition of proliferation can persist the neural in DG can be greatly reduced and affect progenitor pool subsequent neurogenesis [4]. Why sevoflurane anesthesia influ- ences proliferation without causing neuronal apoptosis in the developing hippocampus is unknown. Nevertheless, the sensitivity of the neonatal central nervous system to sevoflurane may affect Effects of anesthesia It is for more than 4 weeks, brain areas differently, depending on the survival, proliferation, differentiation, and migration patterns of neurons for each region. Effects of sevoflurane anesthesia on learning and memory Both juvenile and adult rodents exposed to volatile anesthetics during gestational or neonatal development can show learning and memory impairments [6,34]. We employed a series of neurobe- havioral tests and also found that sevoflurane exposure in neonates resulted in long-term neurocognitive sequelae. Interestingly, we did not observe significant effects on traditional ‘‘hippocampus- dependent’’ ELTM 8 weeks after sevoflurane anesthesia, but sevoflurane did significantly reduce the immediate fear response to the tone/shock pairings in the fear conditioning test. In addition, sevoflurane impaired spatial memory in the Morris water maze memory consolidation test when the delay between memory acquisition and retrieval was extended from 1 min to 1 h, but not to 4 h. This suggests that sevoflurane impaired WM and STM, rather than ELTM. Collectively, tests suggest that sevoflurane has negative effects on WM and STM, but not ELTM. Conversely, Kodama et al. [8] demonstrated that sevoflurane treatment did not impair WM in neonates. The brain regions that were most affected by neuronal apoptosis, changes in memory-related signaling [35], and protein production [36] with sevoflurane exposure are important for learning and memory, which may explain this discrepancy between the results from Kodama et al and ours [37]. Although we examined three brain regions that play major roles in the early stages of learning [38] and the three types of memory [39], other regions also participate in these cognitive functions. Shih et al [7] attributed neurocog- nitive dysfunction to acute sevoflurane-induced neuron death, especially in the thalamus, which was the most severely affected region. In that study, however, the authors did not examine the effect of anesthesia on neurogenesis in the neonatal brain. Consistent with the findings in previous studies, we found that sevoflurane decreased neuronal proliferation in the developing these neurobehavioral Figure 5. Perinatal n-3 PUFAs supplementation attenuates 6-h 3% sevoflurane-induced neuronal apoptosis. Cortical cleaved caspase-3 expression in neonatal brain was examined with Western blot (A); Quantification of cleaved caspase-3 (one-way ANOVA, Newman-Keul post hoc test, F = 6.286, p = 0.0274), *p,0.05 control (n = 3) vs. Sevo (n = 3); #p,0.05 Sevo vs. Sevo+n-3 PUFAs (n = 4) (B). doi:10.1371/journal.pone.0070645.g005 PLOS ONE | www.plosone.org 7 August 2013 | Volume 8 | Issue 8 | e70645 N-3 PUFAs Improve Neurotoxicity of Sevoflurane Figure 6. Perinatal n-3 PUFAs supplementation increases the attenuation of neuronal cells proliferation caused by neonatal exposure to 3% sevoflurane for 6-h in dentate gyrus (DG) region of neonatal hippocampus. BrdU was examined at the DG region by immunofluorescence (A); Quantification of BrdU at the DG region of neonatal hippocampus (one-way ANOVA, Newman-Keul post hoc test, F = 26.07, p = 0.0011), *p,0.05 control vs. Sevo; ###p,0.05 Sevo vs. Sevo+n-3 PUFAs; &&p,0.01 control vs. Sevo+n-3 PUFAs (B). n = 3 in each group. doi:10.1371/journal.pone.0070645.g006 hippocampus. Similarly, a previous study reported that inhibition interfered with memory function [40]. We of neurogenesis speculate that sevoflurane-induced neuron death and failed proliferation in the developing central nervous system reduce brain volume and the number of synaptic connections, and disrupts brain plasticity, which is similar to the effects of alcohol on brain [41]. Neurons lost to apoptosis can be compensated via neurogenesis, as has been reported in stroke cases [42]. However, these newly generated neurons can it integrate into an existing brain network and function in learning and memory. is more essential that commonly have been used as a daily supplement for pregnant and lactating women as it benefits neurodevelopmental outcomes [44]. Therefore, we decided to test whether n-3 PUFAs could improve sevoflurane-induced brain dysfunction. Our data revealed that n-3 PUFA dietary supplementation to dams led to significant and prolonged neuroprotection in offspring rats that received neonatal sevoflurane exposure. This is the first report of n-3 PUFAs exerting protective effects against sevoflurane-induced cognitive impair- ment in rats, specifically by attenuating apoptosis and improving neuronal proliferation. sevoflurane-induced neurotoxicity and behavioral deficits. Considering volatile anesthetics can impair brain function in rodents, finding interven- tions that improve or prevent sevoflurane-induced memory deficits in the developing brain might provide insight into the neurotoxic mechanisms of volatile anesthetics. Although some drugs can protect against anesthesia-induced neurotoxicity [43], n-3 PUFAs n-3 PUFAs protect against Furthermore, there were significantly more BrdU+ immunore- active cells in the hippocampus DG when n-3 PUFA supplemen- tation was combined with sevoflurane anesthesia, than with sevoflurane anesthesia alone. Compared with the control group, the robust effect of n-3 PUFAs on neurogenesis does not appear to promote performance improvements in the neurobehavioral tests. One possible explanation for the proliferative cells do not survive [45], differentiate into mature this observation is that PLOS ONE | www.plosone.org 8 August 2013 | Volume 8 | Issue 8 | e70645 PLOS ONE | www.plosone.org 9 N-3 PUFAs Improve Neurotoxicity of Sevoflurane August 2013 | Volume 8 | Issue 8 | e70645 N-3 PUFAs Improve Neurotoxicity of Sevoflurane Figure 7. Perinatal n-3 PUFAs supplementation improves neonatal sevoflurane exposure induced neurobehavioral impairment at adulthood (n = 9 each group). A–D Morris water maze spatial reference memory. Latency to platform in learning phase (A); Frequency to across the platform region (B); Swimming distance during the probe trial (C); Swimming speed during the probe trial (D); **p = 0.0019 control vs. Sevo. Fear conditioning (E–G). Post shock freezing (E): post shock 1 (F = 29.437, p = 0.0041, one-way ANOVA, Newman-Keul post hoc test, *p,0.05 control vs. Sevo; #p,0.05 Sevo vs. Sevo+n-3 PUFAs); post shock 2 (F = 10.3, p = 0.0033, one-way ANOVA, Newman-Keul post hoc test, *p,0.05 control vs. Sevo group; #p,0.05 Sevo vs. Sevo+n-3 PUFAs). Tone freezing (F); Context freezing (G); Morris water maze memory consolidation (H–K): Latency to platform in learning phase (H); Escape latency at 1-min delay (I) F = 10.25, p = 0.0031, one-way ANOVA, Newman-Keul post hoc test,**p,0.01 control vs. Sevo, ##p,0.01 Sevo vs. Sevo+n-3 PUFAs; Escape latency at 1-h delay (J); F = 13.70, p = 0.0014, one-way ANOVA, Newman-Keul post hoc test, **p,0.01 control vs. Sevo ##p,0.01 Sevo vs. Sevo+n-3 PUFAs; Escape latency at 4-h delay (K). doi:10.1371/journal.pone.0070645.g007 neurons, or effectively integrate into circuits for learning and memory. A longer observational period is needed to assess these possibilities. Although we show that n-3 PUFAs have anti-apoptotic effects and neurogenesis-promoting properties, the molecular signaling involved in these mechanisms are unclear. Zhang and coworkers showed that n-3 PUFAs could confer long-term neuroprotection against hypoxic-ischemic brain injury by suppressing the inflam- matory response [11], and proinflammatory factors are believed to be one of the pro-apoptosis factors that contributes to volatile anesthetic-induced neurotoxicity [46]. In addition, maternal feeding of DHA significantly prevented stress-induced oxidative damage, apoptosis, and mitochondrial metabolism dysfunction in the hippocampus of offspring [47]. Wu et al [48] found that dietary n-3 PUFAs could normalize brain-derived neurotrophic factor (BDNF) levels in a rat model of traumatic brain injury, which is important for neuronal survival, differentiation, and function. It is possible that maternal n-3 PUFA supplementation during pregnancy could protect against postnatal reduction of brain neurotrophins in offspring [49]. Thus, n-3 PUFAs could alleviate neuronal apoptosis via regulating the inflammatory response, restoring BDNF imbalance [50], and/or decreasing reactive oxygen species levels [51] induced by sevoflurane in developing neurons. On the other hand, neurogenesis impairment might be caused by an anesthetic-induced decrease in trophic support (e.g., reduced BDNF levels), and maternal n-3 PUFA supplementation during pregnancy can protect against postnatal reduction of brain neurotrophins (BDNF and nerve growth factor) in offspring [52], which may promote neurogenesis in the developing brain. Collectively, these data support the hypothesis important contributions to the that n-3 PUFAs make several developing nervous system that help to prevent learning and memory impairments [11,48,53]. n-3 PUFAs themselves. Secondly, we did not measure the fatty acid contents in brain and plasma of the rats at several stages (e.g., P0, P14, P38, P64, P79). In a previous study, we have found perinatal n-3 PUFAs supplementation increased functional poly- unsaturated fatty acid composition in brain cortical tissue in neonatal rats at postnatal 14 day with the same dietary feeding protocol used in this study [11]. The results from that study suggest increased n-3PUFAs levels in the brain at P14 are important for neuroprotection in the perinatal period, and later in life. Finally, we did not investigate whether the number of immature neurons was affected by postnatal sevoflurane exposure in P7–10 male rats. Even so, 80–90% of proliferating cells in the hippocampus DG differentiated into mature neurons; therefore, a decrease in BrdU+ cell numbers suggest neonatal sevoflurane exposure influences hippocampal neurogenesis in postnatal rats at P7–10. A recent study showed that exposure to general anesthetics during development appears to influence the percentage of neurons in a new cell population [54]. Therefore, future work should examine which cell types are affected by sevoflurane anesthesia by immunolabeling with specific neuronal cell markers. Conclusion Sevoflurane exposure in neonates results in neuronal apoptosis and impaired proliferation, both of which can cause neurocogni- tive disabilities later in life. In addition, our results provide evidence that perinatal n-3 PUFA supplementation can improve neurocognitive deficits, possibly by reducing neuronal apoptosis and neurogenesis impairment in the developing brain. Neverthe- less, it is critical to recognize that rodent brain development is fundamentally different from that of humans, and the present results might not be directly translated into clinical practice. Hence, further investigations are warranted to fully understand the effects of n-3 PUFAs on general anesthetic-induced neurotoxicity. Limitations There were some limitations to the present study. Firstly, we did not include an experimental group that received n-3 PUFAs during the perinatal period, without sevoflurane exposure. Nevertheless, our primary aim was to determine whether n-3 PUFAs mitigated sevoflurane-induced neurotoxicity and subse- quent cognitive impairment, rather than determine the effects of Author Contributions Conceived and designed the experiments: JZ WX. Performed the experiments: XL WZ HX TL. Analyzed the data: XL. Contributed reagents/materials/analysis tools: XL WZ JZ WX. Wrote the paper: XL JZ WL. Approved final manuscript: JZ. References 1. Patel SS, Goa K (1996) Sevoflurane: a review of its pharmacodynamic and pharmacokinetic properties and its clinical use in general anaesthesia. Drugs 51: 658–700. Johnson SA, Young C, Olney JW (2008) Isoflurane-induced neuroapoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 20: 21– 28. 2. 5. Stratmann G, Sall JW, May LDV, Bell JS, Magnusson KR, et al. (2009) Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. Anesthesiology 110: 834–848. 6. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, et al. (2009) Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 110: 628–637. 3. Xie Z, Dong Y, Maeda U, Alfille P, Culley DJ, et al. (2006) The common inhalation anesthetic isoflurane induces apoptosis and increases amyloid b protein levels. Anesthesiology 104: 988–994. 7. Shih J, May LDV, Gonzalez HE, Lee EW, Alvi RS, et al. (2012) Delayed environmental enrichment reverses sevoflurane-induced memory impairment in rats. Anesthesiology 116: 586–602. 4. Zhu C, Gao J, Karlsson N, Li Q, Zhang Y, et al. (2010) Isoflurane anesthesia induced persistent, progressive memory impairment, caused a loss of neural stem cells, and reduced neurogenesis in young, but not adult, rodents. J Cereb Blood Flow Metab 30: 1017–1030. 8. Kodama M, Satoh Y, Otsubo Y, Araki Y, Yonamine R, et al. (2011) Neonatal desflurane exposure induces more robust neuroapoptosis than do isoflurane and sevoflurane and impairs working memory. Anesthesiology 115: 979–991. PLOS ONE | www.plosone.org 10 August 2013 | Volume 8 | Issue 8 | e70645 9. Wei H, Kang B, Wei W, Liang G, Meng QC, et al. (2005) Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently. Brain Res 1037: 139–147. 10. Olsen SF, Secher NJ, Tabor A, Weber T, Walker JJ, et al. (2005) Randomised clinical trials of fish oil supplementation in high risk pregnancies. BJOG 107: 382–395. 11. Zhang W, Hu X, Yang W, Gao Y, Chen J (2010) Omega-3 polyunsaturated fatty acid supplementation confers long-term neuroprotection against neonatal hypoxic–ischemic brain injury through anti-inflammatory actions. Stroke 41: 2341–2347. 12. Tuzun F, Kumral A, Ozbal S, Dilek M, Tugyan K, et al. (2012) Maternal prenatal omega-3 fatty acid supplementation attenuates hyperoxia-induced apoptosis in the developing rat brain. Int J Dev Neurosci 30: 315–323. 13. Bertrand PC, O’Kusky JR, Innis SM (2006) Maternal dietary (n-3) fatty acid deficiency alters neurogenesis in the embryonic rat brain. J Nutr 136: 1570– 1575. 14. Beltz BS, Tlusty MF, Benton JL, Sandeman DC (2007) Omega-3 fatty acids upregulate adult neurogenesis. Neurosci Lett 415: 154–158. 15. Freund-Levi Y, Eriksdotter-Jonhagen M, Cederholm T, Basun H, Faxen-Irving G, et al. (2006) omega-3 Fatty acid treatment in 174 patients with mild to moderate Alzheimer disease: OmegAD Study: a randomized double-blind trial. Arch Neurol 63: 1402–1408. 16. Wojtowicz JM, Kee N (2006) BrdU assay for neurogenesis in rodents. Nat Protoc 1: 1399–1405. 17. He FQ, Qiu BY, Zhang XH, Li TK, Xie Q, et al. (2011) Tetrandrine attenuates spatial memory impairment and hippocampal neuroinflammation via inhibiting NF-kB activation in a rat model of Alzheimer’s disease induced by amyloid-b (1– 42). Brain Res 1384: 89–96. 18. Gown AM, Willingham MC (2002) Improved detection of apoptotic cells in archival paraffin sections: immunohistochemistry using antibodies to cleaved caspase 3. J Histochem Cytochem 50: 449–454. 19. Stratmann G, May LDV, Sall JW, Alvi RS, Bell JS, et al. (2009) Effect of hypercarbia and isoflurane on brain cell death and neurocognitive dysfunction in 7-day-old rats. Anesthesiology 110: 849–861. Istaphanous GK, Howard J, Nan X, Hughes EA, McCann JC, et al. (2011) the neuroapoptotic properties of equipotent anesthetic Comparison of concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114: 578–587. 20. 21. Lu Y, Wu X, Dong Y, Xu Z, Zhang Y, et al. (2010) Anesthetic sevoflurane causes neurotoxicity differently in neonatal naı¨ve and Alzheimer’s disease transgenic mice. Anesthesiology 112: 1404–1416. 22. Zhou H, Li S, Niu X, Wang P, Wang J, et al. (2013) Protective effect of FTY720 against sevoflurane-induced developmental neurotoxicity in rats. Cell Biochem Biophys 1–8: Epub ahead of print. 23. Denis-Donini S, Dellarole A, Crociara P, Francese MT, Bortolotto V, et al. (2008) Impaired adult neurogenesis associated with short-term memory defects in NF-kappaB p50-deficient mice. J Neurosci 28:3911–3919. 24. Bianchi P, Ciani E, Guidi S, Trazzi S, Felice D, et al. (2010) Early pharmacotherapy restores neurogenesis and cognitive performance in the Ts65Dn mouse model for Down syndrome. J Neurosci 30:8769–8779. 25. Zhao C, Deng W, Gage FH (2008) Mechanisms and functional implications of adult neurogenesis. Cell 132: 645–660. 26. Fang F, Xue Z, Cang J (2012) Sevoflurane exposure in 7-day-old rats affects neurogenesis, neurodegeneration and neurocognitive function. Neuroscience Bulletin: Epub ahead of print. 27. Stratmann G, Sall JW, May LD, Bell JS, Magnusson KR, et al. (2009) Isoflurane differentially affects neurogenesis and long-term neurocognitive function in 60- day-old and 7-day-old rats. Anesthesiology 110: 834–848. 28. Stratmann G, Sall JW, May LD, Loepke AW, Lee MT (2010) Beyond anesthetic properties: the effects of isoflurane on brain cell death, neurogenesis, and long- term neurocognitive function. Anesth Analg 110: 431–437. 29. Lei X, Guo Q, Zhang J (2012) Mechanistic Insights into Neurotoxicity Induced by Anesthetics in the Developing Brain. Int J Mol Sci 13: 6772–6799. 30. Zhao X, Yang Z, Liang G, Wu Z, Peng Y, et al. (2013) Dual effects of isoflurane on proliferation, differentiation, and survival in human neuroprogenitor cells. Anesthesiology 118: 537–549. 31. Dallasen RM, Bowman JD, Xu Y, Hashimoto M, Katakura M, et al. (2011) Isoflurane does not cause neuroapoptosis but reduces astroglial processes in young adult mice. Med Gas Res 1: 27. 32. Tung A, Herrera S, Fornal CA, Jacobs BL (2008) The effect of prolonged anesthesia with isoflurane, propofol, dexmedetomidine, or ketamine on neural cell proliferation in the adult rat. Anesth Analg 106: 1772–1777. PLOS ONE | www.plosone.org 11 N-3 PUFAs Improve Neurotoxicity of Sevoflurane 33. Engelhard K, Winkelheide U, Werner C, Kluge J, Eberspa¨ cher E, et al. (2007) Sevoflurane affects neurogenesis after forebrain ischemia in rats. Anesth Analg 104: 898–903. 34. Loepke AW, Istaphanous GK, McAuliffe JJ 3rd, Miles L, Hughes EA, et al. (2009) The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and memory. Anesth Analg 108: 90–104. 35. Liu XS, Xue QS, Zeng QW, Li Q, Liu J, et al. (2010) Sevoflurane impairs memory consolidation in rats, possibly through inhibiting phosphorylation of glycogen synthase kinase-3b in the hippocampus. Neurobiol Learn Mem 94: 461–467. 36. Alkire MT, Guzowski JF (2008) Hypothesis: Suppression of memory protein formation underlies anesthetic-induced amnesia. Anesthesiology 109: 768–770. 37. Aggleton JP, O’Mara SM, Vann SD, Wright NF, Tsanov M, et al. (2010) Hippocampal–anterior thalamic pathways for memory: uncovering a network of direct and indirect actions. Eur J Neurosci 31: 2292–2307. 38. Winocur G (1985) The hippocampus and thalamus: their roles in short-and long-term memory and the effects of interference. Behav Brain Res 16: 135–152. Izquierdo I, Medina JH, Vianna MRM, Izquierdo LA, Barros DM (1999) Separate mechanisms for short-and long-term memory. Behav Brain Res 103: 1–11. 39. 40. Winocur G, Wojtowicz JM, Sekeres M, Snyder JS, Wang S (2006) Inhibition of neurogenesis interferes with hippocampus-dependent memory function. Hippo- campus 16: 296–304. 41. Richardson HN, Chan SH, Crawford EF, Lee YK, Funk CK, et al.(2009) Permanent impairment of birth and survival of cortical and hippocampal proliferating cells following excessive drinking during alcohol dependence. Neurobiol Dis 36:1–10. Jin K, Wang X, Xie L, Mao XO, Zhu W, et al. (2006) Evidence for stroke- induced neurogenesis in the human brain. Proc Natl Acad Sci U S A 103: 13198–13202. 42. 43. Yon JH, Carter LB, Reiter RJ, Jevtovic-Todorovic V (2006) Melatonin reduces the severity of anesthesia-induced apoptotic neurodegeneration in the develop- ing rat brain. Neurobiol Dis 21: 522–530. Innis SM (2007) Dietary (n-3) fatty acids and brain development. J Nutr 137: 855–859. 44. 45. Takasawa KI, Kitagawa K, Yagita Y, Sasaki T, Tanaka S, et al. (2002) Increased proliferation of neural progenitor cells but reduced survival of newborn cells in the contralateral hippocampus after focal cerebral ischemia in rats. J Cereb Blood Flow Metab 22: 299–307. 46. Wu X, Lu Y, Dong Y, Zhang G, Zhang Y, et al. (2012) The inhalation anesthetic isoflurane increases levels of proinflammatory TNF-a, IL-6, and IL- 1b. Neurobiol Aging 33: 1364–1378. 47. Feng Z, Zou X, Jia H, Li X, Zhu Z, et al. (2012) Maternal docosahexaenoic acid feeding protects against impairment of learning and memory and oxidative stress in prenatally stressed rats: possible role of neuronal mitochondria metabolism. Antioxid Redox Signal 16: 275–289. 48. Wu A, Ying Z, Gomez-Pinilla F (2004) Dietary omega-3 fatty acids normalize BDNF levels, reduce oxidative damage, and counteract learning disability after traumatic brain injury in rats. J Neurotrauma 21: 1457–1467. 49. Sable PS, Dangat KD, Joshi AA, Joshi SR (2012) Maternal omega 3 fatty acid supplementation during pregnancy to a micronutrient imbalanced diet protects postnatal reduction of brain neurotrophins in the rat offspring. Neuroscience 217: 46–55. 50. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V (2006) General anesthesia in the developing rat brain. activates BDNF-dependent neuroapoptosis Apoptosis 11: 1603–1615. 51. Zhang J, Dong Y, Xu Z, Zhang Y, Pan C, et al. (2011) 2-Deoxy-D-glucose attenuates isoflurane-induced cytotoxicity in an in vitro cell culture model of H4 human neuroglioma cells. Anesth Analg 113: 1468–1475. 52. Sable PS, Dangat DK, Joshi AA, Joshi SR (2012) Maternal omega 3 fatty acid supplementation during pregnancy to a micronutrient-imbalanced diet protects postnatal reduction of brain neurotrophins in the rat offspring. Neuroscience 217: 46–55. 53. McNamara RK, Carlson SE (2006) Role of omega-3 fatty acids in brain development and function: potential implications for the pathogenesis and prevention of psychopathology. Prostaglandins Leukot Essent Fatty Acids 75: 329–349. 54. Dong CRC, Anand KJ (2012) Ketamine alters the neurogenesis of rat cortical neural stem progenitor cells. Crit Care Med 40: 2407–2416. August 2013 | Volume 8 | Issue 8 | e70645",rats,['Female Sprague-Dawley rats (n = 3 each group) were treated with or without an n-3 PUFAs (fish oil) enriched diet from the second day of pregnancy to 14 days after parturition.'],postnatal day 7,['The offspring rats (P7) were treated with six hours sevoflurane administration (one group without sevoflurane/prenatal n-3 PUFAs supplement as control).'],Y,"['Morris water maze spatial reference memory, fear conditioning, and Morris water maze memory consolidation were tested at P35, P63 and P70 (n = 9), respectively.']",sevoflurane,['The offspring rats (P7) were treated with six hours sevoflurane administration (one group without sevoflurane/prenatal n-3 PUFAs supplement as control).'],none,[],sprague dawley,['Female Sprague-Dawley rats (n = 3 each group) were treated with or without an n-3 PUFAs (fish oil) enriched diet from the second day of pregnancy to 14 days after parturition.'],This study addresses the challenge of sevoflurane-induced neurotoxicity and cognitive impairment in neonatal rats and investigates the protective effects of perinatal n-3 PUFAs supplementation.,['Objectives: To investigate if perinatal Omega-3 polyunsaturated fatty acids (n-3 PUFAs) supplementation can improve sevoflurane-induced neurotoxicity and cognitive impairment in neonatal rats.'],None,[],The article argues that perinatal n-3 PUFAs supplementation can mitigate sevoflurane-induced unfavorable neuronal effects and improve neurocognitive function in later life after neonatal sevoflurane exposure.,"['Conclusion: Our study demonstrated that neonatal exposure to prolonged sevoflurane could impair the immediate fear response, working memory and short-term memory of rats at their adulthood, which may through inducing neuronal apoptosis and decreasing neurogenesis. However, these sevoflurane-induced unfavorable neuronal effects can be mitigated by perinatal n-3 PUFAs supplementation.']","The study did not include an experimental group that received n-3 PUFAs during the perinatal period, without sevoflurane exposure.","['Firstly, we did not include an experimental group that received n-3 PUFAs during the perinatal period, without sevoflurane exposure.']",Potential applications include using perinatal n-3 PUFAs supplementation to protect against neurotoxicity and cognitive impairments induced by neonatal exposure to anesthetics.,"['Sevoflurane exposure in neonates results in neuronal apoptosis and impaired proliferation, both of which can cause neurocognitive disabilities later in life. In addition, our results provide evidence that perinatal n-3 PUFA supplementation can improve neurocognitive deficits, possibly by reducing neuronal apoptosis and neurogenesis impairment in the developing brain.']",True,True,True,True,True,True,10.1371/journal.pone.0070645 10.1111/jcmm.13524,1256.0,Lin,2018,rats,e7,Y,propofol,none,sprague dawley,"Received: 22 September 2017 | Accepted: 12 December 2017 DOI: 10.1111/jcmm.13524 O R I G I N A L A R T I C L E Propofol exposure during early gestation impairs learning and memory in rat offspring by inhibiting the acetylation of histone Jiamei Lin1,2 | Shengqiang Wang1 | Yunlin Feng1 | Weihong Zhao1 | Weilu Zhao1 | Foquan Luo1 | Namin Feng1 1Department of Anesthesiology, the First Affiliated Hospital, Nanchang University, Nanchang, China Abstract Propofol is widely used in clinical practice, including non-obstetric surgery in preg- 2Department of Anesthesiology, the Eastern Hospital of the First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China nant women. Previously, we found that propofol anaesthesia in maternal rats during the third trimester (E18) caused learning and memory impairment to the offspring Correspondence Foquan Luo Email: lfqjxmc@outlook.com rats, but how about the exposure during early pregnancy and the underlying mecha- nisms? Histone acetylation plays an important role in synaptic plasticity. study, propofol was administered to the pregnant rats in the early pregnancy (E7). In this Funding information Natural Science Foundation of Jiangxi Province, Grant/Award Number: 20132BAB205022, 20171ACB20030; National Natural Science Foundation of China, Grant/Award Number: 81060093, 81460175 The learning and memory function of the offspring were tested by Morris water maze (MWM) test on post-natal day 30. Two hours before each MWM trial, histone deacetylase 2 (HDAC2) inhibitor, suberoylanilide hydroxamic acid (SAHA), Senegenin (SEN, traditional Chinese medicine), hippyragranin (HGN) antisense oligonucleotide (HGNA) or vehicle were given to the offspring. The protein levels of HDAC2, acety- lated histone 3 (H3) and 4 (H4), cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB), N-methyl-D-aspartate receptor (NMDAR) 2 subunit B (NR2B), HGN and synaptophysin in offspring’s hippocampus were determined by Western blot or immunofluorescence test. It was discovered that infusion with propofol in maternal rats on E7 leads to impairment of learning and memory in off- spring, increased the protein levels of HDAC2 and HGN, decreased the levels of acetylated H3 and H4 and phosphorylated CREB, NR2B and synaptophysin. HDAC2 inhibitor SAHA, Senegenin or HGN antisense oligonucleotide reversed all the changes. Thus, present results indicate exposure to propofol during the early gesta- tion impairs offspring’s learning and memory via inhibiting histone acetylation. SAHA, Senegenin and HGN antisense oligonucleotide might have therapeutic value for the adverse effect of propofol. K E Y W O R D S histone deacetylase, learning and memory, pregnancy, propofol Jiamei Lin and Shengqiang Wang contributed equally to this work (co-first author). - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine. 2600 | wileyonlinelibrary.com/journal/jcmm J Cell Mol Med. 2018;22:2600–2611. 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2601 LIN ET AL. 1 | I N T R O D U C T I O N mainly targeting HDAC2, probably has therapeutic potentialities for the learning impairment caused by neurodegenerative diseases.22-24 Histone deacetylase inhibitors facilitated synaptic plasticity and Accumulating evidence indicates general anaesthetics exposure dur- memory by promoting the combination of CREB with CREB-binding ing pregnancy may cause neurotoxic effects and induce persistent cognitive dysfunction of offspring rats.1-3 Propofol is commonly used in pregnancy for non-obstetric surgery. Xiong et al4 showed that protein (CBP) domain, which subsequently activate CREB-mediated transcription.25-27 Our early researches showed that anaesthesia dur- ing early gestation damaged the neurons and reduced the expression anaesthesia with propofol on gestational day 18 (E18) associated of NR2B in hippocampus, thus leading to learning and memory impairments in offspring rats.11,12 In this study, we aim to investigate with the up-regulation of caspase-3 and the loss of neurons, as well as associated with the down-regulation synaptophysin expression in offspring rats’ hippocampus and caused persistent spatial whether histone acetylation involves in the cognitive function learning impairment induced by propofol anaesthesia during early pregnancy. impairment in offspring. Our previous study showed that propofol anaesthesia in the second trimester inhibits the cognitive function of the offspring that is related to down-regulation of the protein levels 2 | M A T E R I A L S A N D M E T H O D S of brain-derived neurotrophic factor (BDNF) and synaptophysin in offspring hippocampus.5 Exposure to propofol for 5 hour caused 2.1 | Drugs death of neurons and oligodendrocytes in foetal and neonatal NHP brain.6 However, little attention was paid to the early stage of gesta- tion, which is equivalent to the early pregnancy of human.7 It is All drugs were prepared just before use: propofol (Diprivan; AstraZe- Italy: jc393, 20 mL: 200 mg); 20% intralipid neca UK limited, (2B6061; Baxter, Deerfield, IL, USA); SAHA (Selleck Chemicals LLC, reported that 0.75% to 2% gestational women have to experience non-obstetric surgery due to various medical problems.8 This number Houston, TX, USA). HGN antisense was synthesized by Sangon Bio- tech (Shanghai, China) Co., Ltd. Senegenin (purity ≥ 98%) was pur- is increasing with the development of laparoscopic technique, and chased from Nanjing SenBeiJia Biological Technology Co., Ltd. the most common surgical procedure performed in the early preg- nancy is laparoscopy.9 It is reported that about 28% of the non- obstetric surgeries occurred in the first trimester.10 Our earlier stud- (Jiangsu province, China). Anti-b-actin and anti-rabbit IgG secondary antibody were obtained from Cell Signaling Technology (Cell Signaling Tech, MA, ies demonstrated that propofol, ketamine, enflurane, isoflurane or USA). Anti-CREB (Phospho S133), anti-NMDAR2B, anti-HDAC2, sevoflurane anaesthesia in the early pregnancy inhibits the cognitive antisynaptophysin, anti-Ac-H4K12 and anti-Ac-H3K14 antibodies function, damages hippocampal neurons, reduces NR2B mRNA and increased HGN mRNA levels in offspring rats’ hippocampus,11-14 but were purchased from Abcam (Abcam, Cambridge, MA, USA). Anti- HGN antibody was synthesized by Kitgen Bio-tech Co., Ltd.(Zhejiang the underlying pathogenesis needs to be clarified. province, China). is considered the cellular mecha- nism of memory formation and plays a role in synaptic plasticity.15 Long-term potentiation (LTP) NR2B is an important positive regulator of learning and memory by promoting synaptic plasticity and LTP.16,17 The balance between 2.2 | Animals The protocol in this study was approved by the institutional review positive and negative learning and memory-regulating genes and pro- board of the First Affiliated Hospital of Nanchang University on the teins is key to the formation, maintenance, as well as retrieval of Use of Animals in Research and Teaching. All the methods in this memory. HGN is a negative regulating protein that highly expresses study were performed in co-ordination with relevant guidelines and in hippocampus, acting suppression/clearance function in memory regulating.18 Inhibiting HGN by antisense oligonucleotide induces an regulations. Sprague Dawley (SD) rats were purchased from the ani- mal science research department of the Jiangxi Traditional Chinese increase in performance of Morris water maze and LTP. This indi- Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China). cates that HGN negatively regulates synaptic plasticity and LTP and The learning and memory functions of the parental rats were plays negative regulating role in the formation and maintenance of assessed using the Morris water maze (MWM) system before mating, memory. so that to minimize the hereditary difference. Animals were housed Persistent changes in synapses, which based on appropriate gene separately under standard laboratory conditions with 12:12 light/ dark cycle, 24 (cid:1) 1°C and had free access to tap water. Two female transcription and subsequent protein synthesis, are the structural basis of learning and memory processes.19 Both compact chromatin rats in cages with one male rat per cage for mating. Pregnancy was structure and the accessibility of DNA to target genes can be modu- diagnosed by the sign of vaginal plug. lated by chromatin remodelling, in particular, histone tail acetylation, thus to regulate their expression.20,21 Histone acetylation regulates by acetyltransferases (HATs) and histone deacetylases (HDACs). 2.3 | Drug treatment HATs serve as transcriptional activators, whereas HDACs serve as rats received intravenous infusion of propo- (n = 10 dams) with the rate of 20 mg kg(cid:3)1 h(cid:3)1 for 4 hours, On E7, pregnant transcriptional repressors. Increased HDAC activity had been linked fol to neurodegeneration. Growing evidence indicated that SAHA, which 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2602 | LIN ET AL. equal volume of saline (n = 10 dams) or intralipid (n = 5 dams), previously described,18,29 once daily for seven consecutive days before MWM trial. respectively. Electrocardiograms, saturation of pulse oximetry (SpO2) and tail non-invasive blood pressure were continuously monitored during 2.4 | Morris water maze test maternal propofol exposure. Using heating lamp and temperature the rectal to monitor Spatial learning and memory were assessed by the MWM test from post-natal day 30 (P30) to P36 according to previously described5,30 temperature and keep it at controller 37 (cid:1) 0.5°C. Arterial blood sampling from lateral caudal artery for with SLY-WMS Morris water maze test system (Beijing Sunny Instru- ments Co. Ltd., Beijing, China). Briefly, the trials start at 9 o’clock in blood gas analysis at the end of propofol anaesthesia. If the total time of SpO2 <95% and/or the systolic blood pressure <80% of the the morning in the MWM system with the pool was filled with baseline in excess of 5 minutes, the pregnant rat was got rid of the study, and other pregnant rats were chosen to supply the sample water to a height of 1.0 cm above the top of a 15-cm-diameter plat- size, so as to exclude the interfering effect of maternal hypotension form, in the second quadrant (target quadrant), and the water main- tained at 24 (cid:1) 1°C. The training trial was performed once a day for or hypoxia on cognitive function in the pup rats. six consecutive days. In each training trial, offspring rats were placed After delivery, the offspring rats born to the same pregnant rat were randomly subdivided into the SAHA, SEN, HGNA group and in the water facing the wall of the pool in the third quadrant, the their relative control groups (DMSO, NS(1) and NS(2) group, respec- farthest one from the target quadrant. The animals were allowed to tively; Figure 1). It has been proved that the acetylation level of his- search for the hidden platform or for 120 seconds. They were after increased 2 hour the tone in hippocampus obviously administration of HDAC inhibitor.27 Therefore, 90 mg kg(cid:3)1 SAHA (HDAC inhibitor), at a concentration of 0.6 lmol L(cid:3)1 dissolved into dimethyl sulphoxide (DMSO) was injected to the offspring in SAHA allowed to remain on the platform for 30 seconds when they found the platform and the time for the animal to find the platform was recorded as escape latency (indicating learning ability). For those who did not find the platform within 120 seconds, the animals were group by the intraperitoneal route at 2 hours before each MWM gently guided to the platform and allowed to stay there for 30 sec- onds, and their escape latency was recorded as 120 seconds. At the trial. The same volume of DMSO was given to the DMSO group. Senegenin, a kind of Chinese medicine, was proved to up-regulate end of the reference training (P37), the platform was removed. The offspring rats were allowed to perform spatial probe test (memory the expression of NR2B mRNA and protein, thus to mitigate cogni- tive dysfunction.28 So, 15 mg kg(cid:3)1 Senegenin and equal volume of saline were given intraperitoneally at 2 hours before each MWM function test) for 120 seconds. Times across the platform (platform crossing times, indicate memory function), the swimming trail and speed were automatically recorded by the system. The mean value trial to SEN or NS(1) groups, respectively. HGN antisense oligonu- cleotide (0.25 nmol lL(cid:3)1, 1.5 lL) or normal saline (1.5 lL) was injected to offspring’s hippocampus in HGNA or NS(2) group as of the platform crossing times, escape latency and speed of the off- spring born to the same pregnant rats was taken as the final results. F I G U R E 1 Experimental design. Pregnant dams were exposed to Propofol, 20% Intralipid or normal saline on E7, and the offspring were treated with SAHA, Senegenin, HGNA or vehicles two hours before behavioural testing. The number in parentheses represents the number of animals: F, female; M, male; SAHA, suberoylanilide hydroxamic acid, also known as vorinostat; DMSO, dimethyl sulphoxide; SEN, Senegenin; NS(1), Normal saline intraperitoneal injection; NS(2), Normal saline intrahippocampus injection; HGNA, HGN antisense oligonucleotide 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2603 LIN ET AL. green light, while the DAPI was performed by UV blue light. All images were recorded at 10 9 209 (Exp Acq-700mmm, Offset Acq- 2.5 | Brain hippocampus harvest 1, Gain Acq-1, Gamma Acq-300). The density of HDCA2 and p- The day after the MWM test, rats were anaesthetized with isoflu- rane and killed by cervical dislocation. Hippocampus tissues were CREB staining was conducted on the images using Image-Pro Plus harvested and stored in Eppendorf tubes that had been treated with 1% DEPC and were stored at (cid:3)80°C (for Western blot analyses) or 6.0 (Media Cybernetics Inc., USA). The images were converted it into black and white pictures. After intensity calibration, hippocampal CA1 area was chosen to analyse and the integrated optical density immersed in 4% paraformaldehyde (for immunofluorescence assay). (IOD) was measured. IOD/Area was calculated as the protein expres- sion level. 2.6 | Western blot analysis The hippocampus (n = 6, with three male and three female offspring 2.8 | Statistical analysis rats from each group) were homogenized on ice in lysis buffer con- All analyses were performed with SPSS 17.0 software (SPSS, Inc., taining a protease inhibitors cocktail. Protein concentration was Chicago, IL, USA). Data from escape latency in the MWM test were determined by the bicinchoninic acid protein assay kit. Protein sam- ples (20 lg) were separated by sodium dodecyl sulphate polyacry- subjected to a repeated measures two-way analysis of variance (RM lamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF two-way ANOVA) and were followed by least significant difference t membrane. The membranes were blocked by non-fat dry milk buffer for 1.5 h and then incubated overnight at 4°C with antihistone H3 (LSD-t) analysis when a significant overall between-subject factor was found (P < 0.05). Data from Western blot and immunofluores- cence staining results were subjected to one-way ANOVA analysis. (acetyl K14) (1:10000), anti- (1:2000), antihistone H4 (acetyl K12) NMDAR2B antisynaptophysin (1:10000) and anti-b-actin (1:2000), respectively. Thereafter, the All data well provided for any of the variables. The LSD t test was anti-HGN (1:1000), (1:1000), used to determine the difference between groups. Statistical signifi- cance was declared at P < .05. membranes were washed three times with TBS-T buffer for 15 min- utes and incubated with the horseradish peroxidase (HRP)-conju- gated secondary antibody for 2 hours at room temperature. The 3 | R E S U L T S immune complexes were washed three times with TBS-T buffer and detected using the ECL system (Millipore Corporation, MA, USA). 3.1 | Physiological parameters of maternal propofol anaesthesia The images of Western blot products were collected and analysed (Wayne Rasband, National Institutes of Health, by ImageJ 1.50i During propofol infusion, the maternal body temperature, respiratory USA). The density of observed protein band was normalized to that of b-actin in the same sample. The results of offspring from all the rate, arterial oxygen saturation, heart rate and non-invasive blood other group were then normalized to the average values of normal saline control offspring (control+NS group) in the same Western blot. pressure were continuously monitored and recorded every five min- utes. No significant change in these physiological parameters had The mean expression level of all of the offspring born to the same been seen during propofol exposure (4 hours). Tail artery blood was collected from pregnant rats for blood gas analysis after propofol perfusion, and no significant difference (P > .05) was observed mother rat in the same group was calculated as the final expression level of the observed proteins. (Table 1). These results suggested that propofol has no side effect indicating the on the physiological parameters in pregnant rats, 2.7 | Immunofluorescence staining Immunofluorescence staining was used to assess HDAC2 and phos- pho-CREB in the hippocampus of offspring rats after the MWM test. Hippocampus from offspring rats (n = 6, with three male and three T A B L E 1 Maternal arterial blood gas at the end of propofol exposure or normal saline (n = 10, mean (cid:1) SD) female offspring rats from each group) were fixated in paraformalde- hyde. Five-lm frozen sections of the hippocampus were used for Normal Saline exposure pregnant rats Propofol exposure pregnant rats Indexes the immunofluorescence staining. The sections were incubated with 7.39 (cid:1) 0.04 7.38 (cid:1) 0.05 pH anti-HDAC2 (1:300) and anti-CREB (1:100) dissolved in 1% bovine serum albumin in phosphate-buffered saline at 4°C overnight. Then, 94.00 (cid:1) 3.52 97.17 (cid:1) 3.49 PO2 (mm Hg) 45.33 (cid:1) 2.88 the sections were incubated with fluorescent-conjugated anti-rabbit 44.83 (cid:1) 5.78 PCO2 (mm Hg) HCO(cid:3) K+ (mmol L(cid:3)1) Na+ (mmol L(cid:3)1) Ca2+ (mmol L(cid:3)1) 3 (mmol L(cid:3)1) secondary antibody (1:300) for 1 hour in the dark at room tempera- 27.95 (cid:1) 3.21 26.68 (cid:1) 2.32 ture. Negative control sections were incubated with PBS as a substi- 3.48 (cid:1) 0.29 3.47 (cid:1) 0.39 tute for primary antibody. Finally, the sections were wet mounted 141.67 (cid:1) 1.03 140.83 (cid:1) 1.47 and viewed immediately using a inverted fluorescence microscope (2009) 1.38 (cid:1) 0.05 1.34 (cid:1) 0.03 (Olympus, Japan). The target protein was red, and nuclei 9.18 (cid:1) 0.99 9.57 (cid:1) 0.55 Glu were blue. The proteins of HDAC2 and p-CREB were excited by the 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2604 | LIN ET AL. results of offspring rats in this study are likely caused directly by the data of offspring from normal saline and intralipid infusion group into one control group in the following data analysis. Propofol expo- propofol rather than secondary effects of maternal propofol infusion. sure increased escape latency, while decreased platform crossing times in offspring compared to the saline control condition (Fig- ure 3C,D, P < .05), 3.2 | Physical features of the offspring indicating propofol anaesthesia on E7 impairs spatial learning and memory in offspring. The birth rate (total number of neonates born to each mother rat), sur- vival rate (survived more than 30 days), gender ratio (the ratio of SAHA, Senegenin and HGN antisense oligonucleotide have been shown to improve learning and memory by facilitating histone acety- females to males) and the average weight of the offspring on day P30 lation, increasing NR2B expression and inhibiting HGN expression, respectively.18,27,28 Therefore, we assessed whether they can amelio- in propofol exposure group were not significantly different from nor- mal saline control group (Figure 2). Dyskinesia was not observed in either of the two groups. These results indicate that maternal propofol rate the learning and memory impairment caused by propofol expo- anaesthesia at the early pregnant stage (E7) has no significant effects sure during pregnancy. Based on the previous discovery on the pharmacodynamics,18,27,28 SAHA or Senegenin was intraperitoneally on physical development of offspring rats, indicating the differences in injected into the offspring 2 hours before each MWM test, while learning and memory observed in this study are caused by propofol HGN antisense oligonucleotide was injected into hippocampus exposure during pregnancy rather than physical differences. 2 hours before each MWM test. The results showed that SAHA, Senegenin or HGN antisense oligonucleotide treatment ameliorated 3.3 | and the ameliorating effect of SAHA, Senegenin and HGN antisense oligonucleotide Impaired learning and memory in offspring the cognitive function deficit caused by propofol exposure during pregnancy (Figure 4A-F, P < .05). SAHA, Senegenin or HGN anti- sense oligonucleotide had no obvious effect on the learning and There was no obvious difference in offspring between normal saline memory in offspring that had not exposed to propofol during preg- and intralipid infusion group (Figure 3C,D). Therefore, we merged nancy (Figure 4A-F). F I G U R E 2 Maternal propofol exposure had no effect on the physical features of the offspring rats. The physical features of the offspring rats between propofol exposure and normal saline control group had no significant difference (P > .05). A, The birth rate (average litter size, total number of neonates born to each mother rat). B, Survival rate of offspring (survived more than 30 days). C, Gender ratio (the ratio of females to males, gender composition). D, The average weight of the offspring on day P30 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2605 LIN ET AL. F I G U R E 3 Maternal Propofol exposure impaired learning and memory in offspring. Post-natal thirty days (P30), the learning and memory were assessed using the Morris water maze (mean (cid:1) SD). A, Escape latency (indicating learning ability) among control groups. B, Platform crossing times (indicating memory ability) among control groups. C, Propofol exposure increased escape latency in offspring compared to the saline control condition (*P < .05). No statistically significant difference was observed between the saline control and intralipid group. D, Propofol exposure decreased platform crossing times in offspring compared to the saline control condition (*P < .05). No significant difference was observed between the saline control and intralipid group F I G U R E 4 SAHA, SEN and HGNA treatment mitigated the learning and memory impairment (mean (cid:1) SD). A, Propofol exposure increased the escape latency in offspring compared to the control condition (*P < .05), and SAHA treatment significantly reversed the effect (#P < .05). B, SEN treatment significantly reversed the effect (#P < .05). C, HGNA treatment significantly reversed the effect (#P < .05). D, Propofol exposure decreased the platform crossing times in offspring compared with the control condition (*P<.05), and SAHA treatment reversed the effect (#P < .05). E, SEN treatment reversed the effect caused by propofol exposure (#P < .05). F, HGNA treatment reversed the effect caused by propofol exposure (#P < .05), and SAHA, SEN and HGNA treatment had no significant effect on learning and memory in offspring that were not exposed to propofol during pregnancy. Error bar = SD (HDACs) and histone acetyltransferases (HATs).33,34 HATs acetylate 3.4 | Reduced histone acetylation levels and the mitigating effect of SAHA,Senegenin and HGN antisense oligonucleotide multiple lysine residues on histones, and different acetylated sites result in different downstream biological effects. H3K14 and H4K12 acetylation have been shown to play a crucial part in learning, mem- ory and synaptic plasticity.35 The results showed that propofol expo- Histone deacetylation was implicated in memory impairments.31,32 The acetylation of histone is regulated by histone deacetylases sure during pregnancy up-regulated HDAC2 protein expression in 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2606 | LIN ET AL. offspring rat’s hippocampus (Figure 6, P < .05), whereas decreased and maintenance.37 NR2B is critical positive regulating factor,38 while HGN is considered as an important recognized as the acetylation levels of H3K14 and H4K12 significantly (Figure 5, P < .05). SAHA, Senegenin and HGN antisense oligonucleotide alle- viated these changes (Figures 5 and 6, P < .05). These results indi- factor.18 The negative results in this study showed that propofol anaesthesia during pregnancy resulted in decrease in NR2B protein (Figure 8A, P < .05), while increased the level of HGN protein (Figure 8B, P < .05), resulted in decreased ratio of NR2B/HGN in offspring rats’ hippocampus (Figure 8C, P < 0.05). cate that propofol anaesthesia during pregnancy inhibits histone acetylation in offspring rats’ hippocampus, which could be alleviated by SAHA, Senegenin or HGN antisense oligonucleotide. The ratio of NR2B/HGN was reversed significantly by SAHA, or HGN antisense oligonucleotide Senegenin P < .05). (Figure 8A-C, 3.5 | Decreased phosphorylated CREB levels in hippocampus and the mitigating effect of SAHA, Senegenin and HGN antisense oligonucleotide 3.7 | Down-regulated expression of synaptophysin in the hippocampus of offspring rats and the improving effect of SAHA, Senegenin and HGN antisense oligonucleotide Phosphorylation of CREB is recognized as a molecular marker of mem- ory processing in the hippocampus for spatial learning.36 Therefore, we investigated the phosphorylation of CREB in this study. The results showed that propofol anaesthesia during pregnancy resulted in decrease in phospho-CREB protein in offspring rats’ hippocampus. Synaptophysin plays an important role in the exocytosis of SAHA, Senegenin or HGN antisense oligonucleotide treatment allevi- ated the effects (Figure 7, P < .05). These results suggest that propofol synaptic vesicles and acknowledged as a marker of synaptic density.39 Synapse loss is closely associated with cognitive dys- function and learning impairment.40,41 The results showed that the anaesthesia during pregnancy on E7 can down-regulate the phosphory- lation of CREB in hippocampus of the offspring, whereas SAHA, Sene- protein level of synaptophysin in maternal propofol exposure lower than control condition (Figure 9), group was indicating genin or HGN antisense oligonucleotide ameliorates this effect. maternal propofol exposure on E7 impairs the synaptic plasticity in offspring rats’ hippocampus, whereas the level of synaptophysin 3.6 | Decreased the ratio of NR2B/HGN in offspring rat’s hippocampus and the reversing effect of SAHA, Senegenin or HGN antisense oligonucleotide in SAHA, Senegenin or HGN antisense oligonucleotide-treated group was higher than propofol exposure group (Figure 9), sug- gesting that SAHA, Senegenin and HGN antisense oligonucleotide The balance between positive and negative regulating factors can reverse the down-regulated expression of synaptophysin of learning and memory plays a key role in the memory obtain caused by propofol. F I G U R E 5 Maternal propofol exposure reduced the level of histone acetylation and the reversed effect of SAHA, SEN and HGNA treatment. Acetylation level of H3K14 and H4K12 was detected by Western blot (mean (cid:1) SD). Maternal exposure to propofol decreased the acetylation level of H3K14 and H4K12 in offspring compared to the control condition (P < .001), and SAHA treatment significantly increased acetylated H3K14 (P = .016) and H4K12 (P = .003) levels; SEN treatment significantly increased acetylated H3K14 (P = .012) and H4K12 (P = .002) levels; HGNA treatment significantly increased acetylated H3K14 (P = .042) and H4K12 (P = .029) levels. The protein levels of acetylated H3K14 and H4K12 in propofol + SAHA, propofol + SEN or propofol + HGNA group were not significantly different from those in control + NS group (P > .05) 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2607 LIN ET AL. F I G U R E 6 Maternal propofol exposure increased the level of HDAC2 and the reversed effect of SAHA, SEN and HGNA treatment. HDAC2 protein level was determined by immunofluorescence (mean (cid:1) SD). Maternal exposure to propofol up-regulated the expression of HDAC2 protein in offspring compared to the control condition (P = .001). SAHA treatment significantly inhibited the expression of HDAC2 protein (P = .029); SEN treatment significantly decreased HDAC2 protein level (P = .032); HGNA treatment significantly decreased HDAC2 protein level (P = .006). The protein levels of acetylated HDAC2 in propofol+SAHA, propofol + SEN or propofol + HGNA group were not significantly different from those in control + NS group (P > .05) F I G U R E 7 Maternal propofol exposure decreased the level of phospho-CREB and the reversed effect of SAHA, SEN and HGNA treatment. Phospho-CREB protein level was determined by immunofluorescence (mean (cid:1) SD). Maternal exposure to propofol decreased the expression of phospho-CREB protein in offspring compared to the control condition (P < .001). SAHA, SEN and HGNA treatment significantly increased phospho-CREB protein level (P = .006, P = .006, P = .016, respectively). The protein levels of phospho-CREB in propofol + SAHA, propofol + SEN or propofol + HGNA group were not significantly different from those in control + NS group (P > .05) 4 | D I S C U S S I O N H3K14 and H4K12 and the phosphorylation of CREB, down-regu- lates the expression of NR2B, up-regulates the expression of HGN The current study findings suggest that pregnant rats propofol and decreases the ration of NR2B/HGN and the expression of anaesthesia on E7 impairs the learning and memory in offspring rats, synaptophysin. SAHA, Senegenin and HGN antisense oligonucleotide increases the expression of HDAC2, inhibits the acetylation of ameliorate all these changes. 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2608 | LIN ET AL. F I G U R E 8 Maternal propofol exposure broken the balance between NR2B and HGN and the mitigating effect of SAHA, SEN and HGNA treatment. Expression of NR2B and HGN protein was detected by Western blot (mean (cid:1) SD). A, Maternal exposure to propofol decreased the NR2B protein level (P < .001). B, Maternal exposure to propofol increased the HGN protein level (P < .001). C, The ratio of NR2B/HGN was significantly reduced in offspring compared with the control condition (P < .001). SAHA, SEN and HGNA treatment significantly increased NR2B protein level and decreased HGN protein level and reversed the ratio of NR2B/HGN (P < .05). The protein levels of NR2B and HGN and the ratio of NR2B/ HGN in propofol + SAHA, propofol + SEN or propofol + HGNA group were not significantly different from those in control + NS group (P > .05) Maternal body temperature, respiratory rate, saturation of pulse the 2nd trimester of pregnancy) may cause learning deficits in the rat offspring.42 Our previous study showed that ketamine, propofol oximetry, heart rate and non-invasive blood pressure were continu- ously monitored during propofol exposure, and no obvious abnor- and enflurane anaesthesia during early gestation (on gestation day 7) induced learning and memory impairment in offspring rats,11-14 asso- mality was observed. Furthermore, maternal artery blood gases were analysed after the 4 hours propofol infusion and showed no signifi- ciated with hippocampal neuron injury, NR2B receptor subunit cant change (Table 1). Moreover, there was no significant difference reduction and increased level of HGN mRNA. in birth rate, offspring survival rate, the ratio of sex or basic physical How does propofol anaesthesia during pregnancy impair the development of offspring between propofol and saline group. These results suggested that the impaired learning and memory of the rats’ learning and memory in offspring? The consolidation and mainte- nance of memory require specific genes expression, and histone acetylation promotes the expression of these genes, while histone deacetylation represses their expression.21,43 Histone deacetylases offspring may be not caused by pathological disorders but caused by the pregnant rats propofol anaesthesia in the current study. Several animal studies showed that anaesthetics exposure during gestation induced apoptosis in foetal brain.1,2,40 Xiong et al and our (HDACs) inhibit the expression of these genes, while histone acetyl- transferases (HATs) promote their expression.44 Among the HDACs, HDAC2 was implicated in learning and memory, it negatively regu- previous study showed that prenatal propofol exposure resulted in learning and memory deficit in offspring.4,5 While these studies lates synaptic plasticity and memory process by suppressing memory specific genes’ expression, and loss function of HDAC2 facilitates synaptic plasticity and learning and memory.32 Graff et al showed mainly focused on the second and third trimester, there is little information in relation to the effect of propofol anaesthesia during early pregnancy on the cognitive function in offspring. Because some that HDAC2 overexpression reduced the histone acetylation of his- tone and inhibited the expression of memory specific genes. HDAC2 of non-obstetric surgeries during pregnancy occurred in the first tri- mester,10 our current study mainly focus on gestation day 7, which distinct with the exposure time-point in previous studies,4-6 the dif- is significantly enriched near the histones of genes shown to play a key role in learning, memory and synaptic plasticity, such as H2B lysine (K) 5, H3K14, H4K5, and H4K12. Reversing the build- up of ferent exposure time-point may alter the vulnerability to general anaesthetics for the developing brain. Halothane and enflurane HDAC2 by short-hairpin-RNA -mediated knockdown activated these exposure on gestation day 6 and 10 (amount to the early and early genes, reinstated structural and synaptic plasticity and abolished the 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2609 LIN ET AL. synaptic plasticity and long-term potential (LTP). Not only the activa- tion of positive regulatory mechanisms that favour memory storage but also the removal of inhibitory constraints that prevent memory storage are required for long-lasting of synaptic plasticity.37 Negative regulators play an important role in the formation and maintenance of memory. Hippyragranin (HGN) is a protein which expresses in rat hippocampus and involves in negative memory regulation.18 Down- regulation of HGN by antisense oligonucleotide in the hippocampal CA1 region caused enhanced learning and memory as well as ele- vated LTP. Therefore, we hypothesize that the balance between the positive regulator NR2B and negative regulator HGN plays a pivotal role in the learning and memory process. Present study showed that Senegenin treatment reversed the protein levels of NR2B, HGN and the ratio of NR2B/HGN, as well as enhanced learning and memory, which in accordance with the previous research that Senegenin attenuates cognitive impairment by up-regulating expression of hip- pocampal NR2B expression in rats.28 While treatment with HGN antisense oligonucleotide inhibited the expression of HGN protein, reversed the ratio of NR2B/HGN and the learning and memory impairment as previous report.18 Transcription factor CREB (cAMP response element-binding pro- tein) shows an important role in synaptic plasticity underlying learn- ing memory.48,49 CREB is a critical mediator of cAMP- and calcium- F I G U R E 9 Maternal propofol exposure decreased the expression of synaptophysin and the reversed effect of SAHA, SEN and HGNA treatment. Synaptophysin level was determined by Western blot (mean (cid:1) SD). Maternal exposure to propofol decreased the expression of synaptophysin in offspring compared to the control condition (P = .002). SAHA, SEN and HGNA treatment significantly increased synaptophysin protein level (P = .026, P = .007, P = .027, respectively). The protein levels of synaptophysin in propofol + SAHA, propofol + SEN or propofol + HGNA group were not significantly different from those in control + NS group (P > .05) inducible transcription, whereas the phosphorylation of serine 133 is its main in its kinase-inducible domain (KID) (phospho-Ser133) transactivating form. Phospho-Ser133 plays a role in CREB to bind the KIX domain of the coactivators CBP and p300 (CBP/p300).50 Vecsey et al25 demonstrated that enhancement of hippocampus- dependent memory and synaptic plasticity by HDAC inhibitors was relied on the binding of CREB and CREB-binding protein (CBP), which induced robust activation of gene transcription afterwards. The activity of CREB is essential to the gene transcription of NR2B, neurodegeneration-associated memory impairments. Abolished the memory impairments in connection with neurodegeneration.35 Our and expression of NR2B relies on the binding of p-CREB to its bind- ing site at the promoter of the NR2B gene.51 Fujita et al27 have demonstrated that HDAC inhibitor up-regulated the expression of isoflurane anaesthesia during earlier study suggested that maternal acetylated histones and NR2B mRNA in the hippocampus, and up- third trimester impairs the spatial learning and memory of the off- spring rats, and its mechanism in connection with the up-regulation regulated expression of acetylated histones was accompanied by enhanced binding of p-CREB to its binding site at the promoter of the NR2B gene.27 These findings indicated that HDAC inhibitor pro- of HDAC2 mRNA and subsequent inhibits the expression of CREB mRNA and NR2B, while HDAC2 inhibition reversed these changes.30 motes learning and memory by increasing the acetylation of histone Consistent to our previous study, our results suggest that maternal propofol anaesthesia on E7 impairs learning and memory in offspring and the phosphorylation of CREB, and subsequent increase of NR2B rats, causes the overexpression of HDAC2 and inhibits the acetyla- expression. Our previous study has demonstrated that isoflurane tion of H3K14 and H4K12, and these effects were reversed by anaesthesia during the third trimester impaired learning and memory in offspring rats via “HDAC2-CREB-NR2B” pathway.30 SAHA. Senegenin and HGN antisense oligonucleotide treatment also showed similar effects. Synaptophysin is a synaptic protein marker and provides a struc- tural basis for synaptic plasticity.52 Decrease in synaptophysin is implicated in learning and memory impairment.1,4,5 Graff et al35 NMDA receptors play a crucial role in neuronal development and circuit formation. Subunit NR2B is critical to learning and memory.45 It is reported that the enhancement of pre-frontal cortical long-term demonstrated that HDAC2 overexpression reduced synaptophysin potentiation (LTP) and working memory via the up-regulate expres- sion of NR2B specifically in the forebrain region.46 While decreased protein level and caused memory impairments, HDAC2 inhibition reversed the effects. As synaptophysin is one of the CREB target genes,53 we detected the expression of synaptophysin in the present expression of NR2B subunit suppressed NMDA-dependent long- learning.47 Therefore, term potentiation (LTP) and impaired spatial study. The results showed that propofol anaesthesia during preg- nancy reduced the protein level of synaptophysin in offspring’s NR2B acts as a positive regulator in memory process by promoting 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License 2610 | LIN ET AL. C O N F L I C T O F I N T E R E S T S hippocampus, whereas SAHA, Senegenin and HGN antisense oligonucleotide mitigated the reduced synaptophysin levels; mean- The authors declare that they have no conflict of interest. while, the increased expression of synaptophysin was companied with decreased HDAC2 protein level, increased histone acetylation A U T H O R C O N T R I B U T I O N S and CREB phosphorylation level. The BDNF-TrkB signalling pathway is one of the downstream regulating targets of histone acetylation, F.Q.L. and J.M.L. conceived and designed the experiments. J.M.L., so BDNF-TrkB signalling pathway may be one of the underlying Y.L.F. and S.Q.W. performed the experiments. J.M.L and F.Q.L. anal- downstream mechanisms of learning and memory deficits induced by ysed the data. J.M.L. contributed reagents/materials/analysis tools. propofol exposure during early gestation. It is confirmed that J.M.L and F.Q.L. wrote the article. All the authors read and approved HDAC2 up-regulation will impair BDNF-TrkB signalling pathway and results in cognitive impairments induced by isoflurane.54 Our previ- the final manuscript. ous study also verified the role of BDNF-TrkB signalling pathway in O R C I D the cognitive deficits induced by propofol during late pregnant stage.5 Whether BDNF-TrkB signalling pathway involves in the Foquan Luo http://orcid.org/0000-0003-0106-0710 learning and memory impairments induced by maternal propofol anaesthesia needs to be explored in future study. Present study has several limitations. First, we had not accessed R E F E R E N C E S the pathological changes of neurons in the foetal brains immediately 1. Zheng H, Dong Y, Xu Z, et al. Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice. Anesthesiol- ogy. 2013;118:516-526. after maternal propofol exposure and during various period of brain in the present development (e.g., post-natal day 1 to 10). Second, study, we only used MWM to evaluate learning and memory. 2. Zhao T, Li Y, Wei W, et al. Ketamine administered to pregnant rats in the second trimester causes long-lasting behavioral disorders in offspring. Neurobiol Dis. 2014;68:145-155. Although MWM is recognized as an appropriate way to evaluate the spatial learning and memory in rodents, to provide a more compre- 3. Palanisamy A, Baxter MG, Keel PK, et al. Rats exposed to isoflurane in utero during early gestation are behaviorally abnormal as adults. Anesthesiology. 2011;114:521-528. hensive assessment of learning and memory in rat offspring, multiple behavioural test such as open field test, step-through test and the fear conditioning test should be used in future study. Third, we have 4. Xiong M, Li J, Alhashem HM, et al. Propofol exposure in pregnant rats induces neurotoxicity and persistent learning deficit in the off- spring. Brain Sci. 2014;4:356-375. explored the underlying mechanisms only from hippocampus. Mater- nal propofol exposure may also affect other brain regions, such as cortex, thalamus and hypothalamus regions. Li et al55 found that 5. Liang Z, Luo F, Zhao W, et al. Propofol exposure during late stages of pregnancy impairs learning and memory in rat offspring via J Cell Mol Med. 2016;20:1920-1931. the BDNF-TrkB signalling pathway. propofol anaesthesia in pregnant rats induced caspase-3 activation and microglial response in foetal rats. They found that the activated 6. Creeley C, Dikranian K, Dissen G, et al. Propofol-induced apoptosis of neurones and oligodendrocytes in fetal and neonatal rhesus maca- que brain. Br J Anaesth. 2013;110:i29-i38. caspase-3-positive cells were abundant and heavily concentrated in the cortex, thalamus and hypothalamus regions.55 Whether maternal propofol anaesthesia will affect the histone acetylation in other brain 7. Clancy B, Darlington RB, Finlay BL. Translating developmental time regions should be studied. We had only evaluated the short-term across mammalian species. Neuroscience. 2001;105:7-17. 8. Goodman S. Anesthesia for nonobstetric surgery in the pregnant therapeutic effects of SAHA, Senegenin and HGNA on behaviour patient. Semin perinatal. 2002;26:136-145. performance and proteins. The long-term or long-lasting therapeutic 9. F€orster S, Reimer T, Rimbach S, et al. CAMIC recommendations for laparoscopy in non-obstetric indications during pregnancy. surgical Zentralbl Chir. 2016;141:538-544. effects of these drugs on learning and memory deficits and protein expression changes caused by propofol exposure on E7 should be 10. Fardiazar Z, Derakhshan I, Torab R, et al. Maternal-neonatal out- come in pregnancies with non-obstetric laparotomy during preg- nancy. Pak J Biol Sci. 2014;17:260-265. evaluated in future study. Taken together, the results of the present study suggest that propofol anaesthesia during first trimester causes learning and mem- 11. Qin Z, Foquan L, Weilu Z, et al. Effect of prolonged anesthesia with propofol during early pregnancy on cognitive function of offspring rats. Chin J Anesthesiol. 2014;34:1051-1053. ory deficit in offspring rats by inhibiting histone acetylation. SAHA, Senegenin and HGN antisense oligonucleotide can ameliorate these 12. Fo-quan L, Jun-wu L, Shu-xin T, et al. Effect of inhalation of enflu- rane in early pregnancy on the expression of NR2B in the hip- pocampus of offspring of rats. Chin J Anesthesiol. 2011;31:1076- 1078. impairments. A C K N O W L E D G E M E N T S 13. Li Gang Z, Wei-lu L. Fo-quan. Effect of ketamine anesthesia in early pregnancy on the c-fos mRNA and c-jun mRNA expression in off- spring of rats. Chin J Anesthesiol. 2010;30:1333-1335. We thank other members of the laboratory for valuable discussion and technical help. This research was supported by National Natural 14. Bing-da L, Fuo-quan L, Wei-lu Z, et al. Effect of ketamine anesthesia in early pregnancy on expression of hippyragranin mRNA in hip- pocampus in offspring of rats. Chin J Anesthesiol. 2012;32:1334- 1336. Science Foundation of China (NO. 81460175, 81060093) and Natu- Jiangxi Province of China ral Science Foundation of (NO. 20171ACB20030, 20132BAB205022). 15824934, 2018, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/jcmm.13524 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License | 2611 LIN ET AL. 36. Mizuno M, Yamada K, Maekawa N, Saito K. CREB phosphorylation as a molecular marker of memory processing in the hippocampus for spatial learning. Behav Brain Res. 2002;133:135-141. 15. Barria A, Malinow R. NMDA receptor subunit composition controls synaptic plasticity by regulating binding to CaMKII. Neuron. 2005;48:289-301. 16. Williams JM, Gu(cid:2)evremont D, Kennard JT, et al. Long-term regulation of n-methyl-d-aspartate receptor subunits and associated synaptic proteins following hippocampal synaptic plasticity. Neuroscience. 2003;118:1003-1013. 37. Abel T, Martin KC, Bartsch D, Kandel ER. Memory suppressor genes: inhibitory constraints on the storage of long-term memory. Science. 1998;279:338-341. 38. Bliss TV. Young receptors make smart mice. Nature. 1999;401:25- 17. Miwa H, Fukaya M, Watabe AM, et al. Functional contributions of synaptically localized NR2B subunits of the NMDA receptor to synaptic transmission and long-term potentiation in the adult mouse CNS. J Physiol. 2008;586:2539-2550. 27. 39. Voigt T, De Lima A, Beckmann M. Synaptophysin immunohistochem- istry reveals inside-out pattern of early synaptogenesis in ferret cerebral cortex. J Comp Neurol. 1993;330:48-64. 40. Kong F, Xu L, He D, et al. Effects of gestational isoflurane exposure J Pharmacol. on postnatal memory and learning in rats. Eur 2011;670:168-174. 18. Zhang XH, Zhang H, Tu Y, et al. Identification of a novel protein for memory regulation in the hippocampus. Biochem Biophys Res Com- mun. 2005;334:418-424. 41. Terry RD, Masliah E, Salmon DP, et al. Physical basis of cognitive alterations in Alzheimer’s disease: synapse loss is the major correlate of cognitive impairment. Ann Neurol. 1991;30:572-580. 19. Sutton MA, Schuman EM. Dendritic protein synthesis, synaptic plas- ticity, and memory. Cell. 2006;127:49-58. 20. Goldberg AD, Allis CD, Bernstein E. Epigenetics: a landscape takes shape. Cell. 2007;128:635-638. 42. Chalon J, Tang CK, Ramanathan S, et al. Exposure to halothane and enflurane affects learning function of murine progeny. Anesth Analg. 1981;60:794-797. 21. Penney J, Tsai LH. Histone deacetylases in memory and cognition. Sci Signal. 2014;7:re12. 22. Singh P, Thakur MK. Reduced recognition memory is correlated with decrease in DNA methyltransferase1 and increase in histone deacetylase2 protein expression in old male mice. Biogerontology. 2014;15:339-346. 43. Kandel ER. The molecular biology of memory storage: a dialogue between genes and synapses. Science. 2001;294:1030-1038. 44. Graff J, Tsai LH. Histone acetylation: molecular mnemonics on the chromatin. Nat Rev Neurosci. 2013;14:97-111. 23. Agudelo M, Gandhi N, Saiyed Z, et al. Effects of alcohol on histone deacetylase 2 (HDAC2) and the neuroprotective role of trichostatin A (TSA). Alcohol Clin Exp Res. 2011;35:1550-1556. 45. Sepulveda FJ, Bustos FJ, Inostroza E, et al. Montecino M, van Zun- dert B. Differential roles of NMDA Receptor Subtypes NR2A and NR2B in dendritic branch development and requirement of RasGRF1. J Neurophysiol. 2010;103:1758-1770. 24. Wagner FF, Zhang YL, Fass DM, et al. Kinetically Selective Inhibitors of Histone Deacetylase 2 (HDAC2) as Cognition Enhancers. Chem Sci. 2015;6:804-815. 46. Cui Y, Jin J, Zhang X, et al. Forebrain NR2B overexpression facilitat- ing the prefrontal cortex long-term potentiation and enhancing working memory function in mice. PLoS One. 2011;6:e20312. 25. Vecsey CG, Hawk JD, Lattal KM, et al. Histone deacetylase inhibi- tors enhance memory and synaptic plasticity via CREB: CBP-depen- dent transcriptional activation. J Neurosci. 2007;27:6128-6140. 26. Fass DM, Reis SA, Ghosh B, et al. Crebinostat: a novel cognitive enhan- cer that inhibits histone deacetylase activity and modulates chromatin- mediated neuroplasticity. Neuropharmacology. 2013;64:81-96. 47. Clayton DA, Mesches MH, Alvarez E, et al. A hippocampal NR2B defi- cit can mimic age-related changes in long-term potentiation and spa- tial learning in the Fischer 344 rat. J Neurosci. 2002;22:3628-3637. 48. Sakamoto K, Karelina K, Obrietan K. CREB: a multifaceted regulator of neuronal plasticity and protection. J Neurochem. 2011;116:1-9. 49. Kida S. A functional role for CREB as a positive regulator of memory formation and LTP. Exp Neurobiol. 2012;21:136-140. 27. Fujita Y, Morinobu S, Takei S, et al. Vorinostat, a histone deacetylase inhibitor, facilitates fear extinction and enhances expression of the hippocampal NR2B-containing NMDA receptor gene. J Psychiatr Res. 2012;46:635-643. 50. Xu W, Kasper LH, Lerach S, et al. Individual CREB-target genes dic- tate usage of distinct cAMP-responsive coactivation mechanisms. EMBO J. 2007;26:2890-2903. 28. Xie W, Yang Y, Gu X, et al. Senegenin attenuates hepatic ischemia- reperfusion induced cognitive dysfunction by increasing hippocampal NR2B expression in rats. PLoS One. 2012;7:e45575. 51. Rani CS, Qiang M, Ticku MK. Potential role of cAMP response ele- ment-binding protein in ethanol-induced N-methyl-D-aspartate receptor 2B subunit gene transcription in fetal mouse cortical cells. Mol Pharmacol. 2005;67:2126-2136. 29. Hou Q, Gao X, Zhang X, et al. SNAP-25 in hippocampal CA1 region is involved in memory consolidation. Eur J Neuorsci. 2004;20:1593- 1603. 52. Sheng M, Kim MJ. Postsynaptic signaling and plasticity mechanisms. 30. Luo F, Hu Y, Zhao W, et al. Maternal Exposure of Rats to Isoflurane during Late Pregnancy Impairs Spatial Learning and Memory in the Offspring by Up-Regulating the Expression of Histone Deacetylase 2. PLoS ONE. 2016;11:e0160826. Science. 2002;298:776-780. 53. Lonze BE, Ginty DD. Function and regulation of CREB family tran- scription factors in the nervous system. Neuron. 2002;35:605-623. 54. Ji M1, Dong L, Jia M, et al. Epigenetic enhancement of brain-derived neurotrophic factor signaling pathway improves cognitive impair- ments induced by isoflurane exposure in aged rats. Mol Neurobiol 2014;50:937-944. 31. Peleg S, Sananbenesi F, Zovoilis A, et al. Altered histone acetylation in mice. is associated with age-dependent memory impairment Science. 2010;328:753-756. 32. Guan JS, Haggarty SJ, Giacometti E, et al. HDAC2 negatively regu- plasticity. Nature. formation synaptic and lates memory 2009;459:55-60. 55. Li J, Xiong M, Nadavaluru PR, et al. Dexmedetomidine attenuates neurotoxicity induced by prenatal propofol exposure. J Neurosurg Anesthesiol. 2016;28:51-64. 33. Berndsen CE, Denu JM. Catalysis and substrate selection by his- Struct Biol. acetyltransferases. Curr Opin tone/protein lysine 2008;18:682-689. How to cite this article: Lin J, Wang S, Feng Y, et al. Propofol exposure during early gestation impairs learning and 34. Haberland M, Montgomery RL, Olson EN. The many roles of histone deacetylases in development and physiology: implications for disease and therapy. Nat Rev Genet. 2009;10:32-42. memory in rat offspring by inhibiting the acetylation of histone. J Cell Mol Med. 2018;22:2600–2611. 35. Gr€aff J, Rei D, Guan JS, et al. An epigenetic blockade of cognitive functions in the neurodegenerating brain. Nature. 2012;483:222- 226. https://doi.org/10.1111/jcmm.13524",rats,"['Propofol is widely used in clinical practice, including non-obstetric surgery in pregnant women. Previously, we found that propofol anaesthesia in maternal rats during the third trimester (E18) caused learning and memory impairment to the offspring rats']",gestational day 7,"['In this study, propofol was administered to the pregnant rats in the early pregnancy (E7).']",Y,['The learning and memory function of the offspring were tested by Morris water maze (MWM) test on post-natal day 30.'],propofol,"['In this study, propofol was administered to the pregnant rats in the early pregnancy (E7).']",none,[],sprague dawley,"['Sprague Dawley (SD) rats were purchased from the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China).']","The study addresses the impact of propofol exposure during early gestation on learning and memory in rat offspring, which was not previously explored.","['However, little attention was paid to the early stage of gestation, which is equivalent to the early pregnancy of human.']",None,[],"The article argues that exposure to propofol during early gestation impairs offspring's learning and memory via inhibiting histone acetylation, suggesting therapeutic value for SAHA, Senegenin, and HGN antisense oligonucleotide against propofol's adverse effect.","[""Thus, present results indicate exposure to propofol during the early gestation impairs offspring's learning and memory via inhibiting histone acetylation."", 'SAHA, Senegenin and HGN antisense oligonucleotide might have therapeutic value for the adverse effect of propofol.']","The study has limitations in terms of only using MWM to evaluate learning and memory, not assessing immediate pathological changes in the foetal brains, and not exploring effects on other brain regions or the long-term therapeutic effects of the interventions.","['Second, in the present study, we only used MWM to evaluate learning and memory.', 'First, we had not accessed the pathological changes of neurons in the foetal brains immediately after maternal propofol exposure and during various period of brain development (e.g., post-natal day 1 to 10).', 'Third, we have explored the underlying mechanisms only from hippocampus.']","Potential applications include the therapeutic use of SAHA, Senegenin, and HGN antisense oligonucleotide to mitigate the adverse effects of propofol exposure during pregnancy on offspring's cognitive functions.","['SAHA, Senegenin and HGN antisense oligonucleotide might have therapeutic value for the adverse effect of propofol.']",True,False,True,True,True,True,10.1111/jcmm.13524 10.1016/j.bbrc.2022.01.022,462.0,Liu,2022,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"Biochemical and Biophysical Research Communications 593 (2022) 129e136 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / y b b r c Neonatal exposure to sevoflurane impairs preference for social novelty in C57BL/6 female mice at early-adulthood Huayue Liu a, c, 1, Xiaowen Meng a, c, 1, Yixuan Li b, Shiwen Chen b, Yumeng Ji b, , Xin Jin a, c, * Shaoyong Song a, d, Fuhai Ji a, c, ** a Institute of Anesthesiology, Soochow University, Suzhou, 215006, PR China b Suzhou Medical College of Soochow University, Suzhou, 215123, PR China c Department of Anesthesiology, First Affiliated Hospital of Soochow University, Suzhou, 215006, PR China d Department of Pain Medicine, Dushu Lake Hospital Affiliated to Soochow University, Suzhou, 215124, PR China a r t i c l e i n f o a b s t r a c t Article history: Received 23 December 2021 Accepted 8 January 2022 Available online 12 January 2022 Keywords: Sevoflurane Sociability Preference for social novelty Anesthesia Autism Social interaction deficit is core symptom of children with autism, owing to interaction of genetic pre- disposition and environmental toxins. Sevoflurane could induce neurotoxicity in developing brain in rodent models. This study aims to investigate whether sevoflurane anesthesia in neonatal period could impair social behaviors in male and female mice. Twenty-eight male and thirty-one female mice were randomly assigned to receive 3.0% sevoflurane or 60% oxygen on postnatal day 6. They were tested for social interaction behaviors at one- and two-month-old. In addition, the cortex and hippocampus of neonatal mice undergoing sevoflurane anesthesia were harvested for immunoblotting analysis. As a result, both male and female mice undergoing sevoflurane anesthesia showed strong sociability and weak preference for social novelty at juvenile age. In addition, the male mice developed normal pref- erence for social novelty at early-adulthood; However, the female mice remained weak preference for social novelty. Furthurmore, sevoflurane anesthesia could decrease the levels of PSD95 but not Neuroligin-1 in the hippocampus but not cortex of neonatal mice. In conclusion, sevoflurane anesthesia in neonatal period could disturb development of social memory and impair preference for social novelty in female mice at early-adulthood, with the potential mechanism of decreasing PSD95 expression in the hippocampus of C57BL/6 mice. © 2022 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 1. Introduction Children with autism spectrum disorders are largely increasing and the ratio of boys and girls is nearly 4:1 all over the world [1,2]. The core symptom of autism is social interaction deficit, with the potential mechanism of genetic predisposition and environmental toxicants [3,4]. Meanwhile, some anesthetics are reported to induce neurotoxicity in the developing brain [5,6]. Sevoflurane, an inha- is commonly used in pediatric anesthesia. lational anesthetic, Abbreviations: ASD, autism spectrum disorders; PND, postnatal day; PSD95, postsynaptic density-95. Corresponding author. Department of Anesthesiology, Suzhou, 215006, PR China. ** Corresponding author. Department of Anesthesiology, Suzhou, 215006, PR China. Preclinical studies suggested that neonatal anesthesia with sevo- flurane could impair learning and memory in rodents [7,8]. In particular, neonatal exposure to 3% sevoflurane for 6 h in mice could cause learning deficit in fear conditioning test and social deficit in open field cage [9]. However, it is uncertain whether sevoflurane could impair biological profiles of social affiliation and social memory in mice, and whether the male and female mice would behave differently. Sevoflurane could produce anesthetic effect by stimulating GABA receptors and inducing an imbalance of excitatory and inhibitory neurotransmission [10]. Although anesthetists are taking advantage of sevoflurane for rapid onset time and short duration, pediatric patients are taking risk of sevoflurane-induced develop- mental neurotoxicity and behavioral abnormality. Therefore, we set out to investigate whether neonatal anesthesia with sevoflurane could disturb sociability and preference for social novelty in male and female mice at juvenile age and early-adulthood. E-mail addresses: jifuhai@hotmail.com (F. Ji), jinxin@suda.edu.cn (X. Jin). 1 These authors contributed equally to this work (H. Y. Liu and X.W. Meng). We hypothesized that neonatal exposure to sevoflurane could https://doi.org/10.1016/j.bbrc.2022.01.022 0006-291X/© 2022 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4. 0/). H. Liu, X. Meng, Y. Li et al. induce social interaction deficit in mice. To verify this hypothesis, we firstly anesthetized C57BL/6 mice with 3.0% sevoflurane in 60% oxygen for 2 h on postnatal day 6. Next, we tested social behaviors of the male and female mice at one- and two-month-old. Finally, we examined the levels of Neuroligin-1 and PSD95 in the cortex and hippocampus of sevoflurane-exposed neonatal mice. 2. Methods 2.1. Animals This study was approved by the Institutional Animal Care and Use Committee at Soochow University (Suzhou, Jiangsu, China). Twenty-four female and six male C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Jiangsu, China) for producing next generation of mice. On postnatal day (PND) 21, the offspring mice were separated from dams and housed 4e5 per cage by gender. Four male and four female mice were specifically used as the stranger mice, which were trained to stay calmly in the enclosure before social interaction test. All the mice were raised with free access to food and water in a controlled environment (room temperature 21e22 (cid:1)C, 12/12 h light/dark cycle, and light on at 7 a.m.). 2.2. Anesthesia Inc.) was employed to supply a consistent concentration of anesthetic gas. A sealed plastic box (20 L (cid:3) 20 W (cid:3) 6 H cm) was used as the anes- thetizing chamber, which was drilled with three holes for gas inflow, gas outflow and gas monitoring. An electric heater was placed underneath the anesthetizing chamber to keep neonatal mice warm during anesthesia. A gas analyzer (Datex-Ohmeda, Inc.) was applied to adjust gas concentrations. On postnatal day 6, the neonatal mice were randomly assigned into two groups. Twenty- eight mice (17 males and 11 female) received 3.0% sevoflurane in 60% oxygen for 2 h (Sevo), and thirty-one mice (11 males and 20 female) inhaled merely 60% oxygen for 2 h (Oxyg). Sex of each mouse and amount of each group were not identified until weaning on PND 21. These subject mice were tested for social interaction behavior at one- and two-month-old. A retired anesthesia machine (Datex-Ohmeda, Another battery of neonatal mice were treated with the air condition (control) or 60% oxygen (oxyg) or 3.0% sevoflurane in 60% oxygen (sevo) for 2 h on PND 6, and then killed for harvesting brain tissues 24 h after treatment. Sevoflurane anesthesia was strictly performed by the protocols of previous studies [11,12], in which all neonatal mice could spontaneously breath during general anes- thesia, and their arterial blood pressure and blood gas analysis showed within normal limits. The vapor for releasing sevoflurane was turned off at the end of anesthesia, and the residual anesthetic was washed out with 60% oxygen for 15 min. Finally, these pups were smeared with own bedding and sent back to their dams. 2.3. Social interaction paradigm Social interaction test is performed with the three-chambered social box, with three chambers (40 L (cid:3) 20 W (cid:3) 22 H cm) and two enclosures (7 ID (cid:3) 15 H cm). The floor is painted grey to pro- vide a high contrast with the testing mice. Grid bars of the enclo- sure allow direct contacting between the subject and stranger mice. A novel video-tracking system was developed by hanging two video-cameras right above two enclosures. Thereby, two video- images were integrated into one with the montage effect in ANY- maze program (Stoelting Co., USA). The subject mouse initiates social interaction with the stranger mouse by nose-to-nose or nose- 130 Biochemical and Biophysical Research Communications 593 (2022) 129e136 to-tail sniffing, thus the animal's head is tracked by the ANY-maze program. 2.4. Social interaction test First of all, the stranger mice were transferred into behavioral room and hidden 2 m away from social apparatus. Each subject mouse was taken into behavioral room about 45 min before social interaction test. In the first session (Habituation, 10-min), the sub- ject mouse was gently placed into the middle chamber, and allowed to freely explore in three chambers. In the second session (Socia- bility, 10-min), the subject mouse was guided into the middle chamber and transiently confined there. An unfamiliar conspecific (Stranger 1) was introduced into one enclosure, the subject mouse was allowed to explore in three chambers and sniff at two enclo- sures containing Stranger 1 or not. In the third session (Preference for social novelty 10-min), the subject mouse was again confined into the middle chamber. Another unfamiliar conspecific (Stranger 2) was introduced into the other enclosure, and the subject mouse was allowed to explore in three chambers and sniff at two enclo- sures containing Stranger 2 or Stranger 1. Placement of Stranger 1 on left and right side were balanced between trials, and two stranger mice were the same gender as the subject mice. Sociability is characteristic of the mouse taking more time sniffing its conspecific mouse compared with an inanimate object. Preference for social novelty is characteristic of the mouse taking more time sniffing an unfamiliar mouse compared with a familiar one. Four parameters were measured for judging social choice, including 1) time sniffing at the enclosure, 2) number of sniffs, 3) time exploring in the chamber, and 4) number of entries. Sniffing time at the enclosure was primary outcome, number of sniffs at the enclosure and time exploring in the chamber were secondary outcomes. In social interaction test, “at the enclosure” is defined as the head of mouse entering an area about 3 cm around the enclo- sure, as described in similar social study [13]. And “in the chamber” is defined as the head of mouse entering into the chamber. 2.5. Immunoblotting analysis The brain tissues of neonatal mice were harvested on dry ice at 24 h after treatment. Next, the cortex and hippocampus were ho- mogenized on ice using the immunoprecipitation buffer plus pro- tease inhibitor. And then, the lysates were centrifuged at 15,000 rpm for 30 min at 4 (cid:1)C. After that, the lysates were quan- tified for total protein by the bicinchoninic acid (BCA) protein assay kit (MultiSciences Biotech Co., Ltd. Cat: PQ0012, Lot: A91041). Finally, western blot was performed by the protocols to analyze protein levels in cortex and hippocampus. Neuroligin-1 antibody (1:1000; Santa Cruz Biotechnology, Inc.) was used to detect neuroligin-1 (101 kDa). PSD-95 antibody (1:1000; Cell Signaling Technology, Inc.) was used to detect PSD-95 (95 kDa). Antieb-actin (1:5000; Sigma) was used to detect b-actin (42 kDa). 2.6. Statistical analysis Data were expressed as Mean ± SD. Statistical analyses were performed by using GraphPad Prism 5.0 (San Diego, USA). Data representing social behavior of testing mice were normally distributed by Kolmogorov-Smirnov test. Data of each mouse from the left or right side were mutually exclusive, and two-tailed paired t-test was used to determine side preference, which was supported by other social studies [14,15]. Student's t-test was used to assess differences in the levels of Neuroligin-1 and PSD95 expression in cortex and hippocampus of mice. P values less than 0.05 (*), 0.01 (**) and 0.001 (***) were considered statistically significant. H. Liu, X. Meng, Y. Li et al. 3. Results 3.1. Both male and female subject mice show strong sociability and weak preference for social novelty at one-month-old, and sevoflurane anesthesia on postnatal day 6 could not influence the biologic profiles of social affiliation and social memory in the juvenile mice The subject mice undergoing anesthesia with 3.0% sevoflurane in 60% oxygen on postnatal day 6, both males and females, showed strong sociability at one-month-old, as proved by taking more time (Fig. 1A, 183.3 ± 51.6 vs 73.6 ± 32.6 s, P < 0.0001 Male; 250.7 ± 72.7 vs 71.1 ± 33.3 s, P ¼ 0.0002 Female) approaching the stranger 1 mouse, sniffing more frequently (Fig. 1B, 53.6 ± 21.1 vs 22.9 ± 10.6 , P < 0.0001 Male; 49.0 ± 15.9 vs 21.8 ± 9.4, P ¼ 0.0024 Female) at the enclosure containing stranger 1, and spending more time exploring (Fig. 1C, 348.3 ± 56.7 vs 170.6 ± 47.4 s, P < 0.0001 Male; 377.5 ± 71.4 vs 161.5 ± 58.8 s, P ¼ 0.0002 Female) in the chamber with stranger 1, as compared with the empty side. Collectively, the male and fe- male mice, exposed to sevoflurane in the neonatal period, showed the well-developed social affiliation at the juvenile age. However, the subject mice undergoing anesthesia with 3.0% sevoflurane in 60% oxygen on postnatal day 6, either males or fe- males, showed weak preference for social novelty at one-month- old, as evidenced by taking no more time (Fig. 1E, 105.2 ± 50.7 vs 151.8 ± 72.3 s, P ¼ 0.068 Male; 139.6 ± 55.8 vs 171.5 ± 68.1 s, P ¼ 0.3189 Female) approaching the stranger 2 mouse, sniffing no more frequently (Fig. 1F, 31.0 ± 13.0 vs 37.2 ± 14.4, P ¼ 0.3085 Male; 33.1 ± 11.8 vs 36.2 ± 7.0, P ¼ 0.4993 Female) at the enclosure containing stranger 2, or spending no more time exploring (Fig. 1G, 229.8 ± 90.3 vs 271.9 ± 80.2 s, P ¼ 0.3126 Male; 246.2 ± 54.3 vs 282.8 ± 63.1 s, P ¼ 0.3063 Female) in the chamber with stranger 2, as compared with the stranger 1 side. Together, the male and female mice, exposed to sevoflurane in neonatal period, showed the undevel- oped social memory at the juvenile age. 3.2. The male subject mice, but not the female, showed normal preference for social novelty at two-month-old, and sevoflurane anesthesia on postnatal day 6 could impair the development of social memory of female mice at the early-adulthood The subject mice undergoing anesthesia with 3.0% sevoflurane in 60% oxygen on postnatal day 6, both males and females, showed strong sociability at two-month-old, as proved by taking more time (Fig. 2A, 196.2 ± 50.8 vs. 59.3 ± 24.3 s, P < 0.0001 Male; 189.9 ± 60.4 vs. 58.4 ± 23.8 s, P ¼ 0.0028 Female) approaching the stranger 1 mouse, sniffing more frequently (Fig. 2B, 66.5 ± 17.3 vs. 28.4 ± 10.8, P < 0.0001 Male; 58.3 ± 13.6 vs. 30.4 ± 6.9, P ¼ 0.0051 Female) at the enclosure containing stranger 1, and spending more time exploring (Fig. 2C, 347.4 ± 55.6 vs. 160.0 ± 43.1 s, P < 0.0001 Male; 324.6 ± 65.2 vs. 175.8 ± 43.8 s, P ¼ 0.008 Female) in the chamber with stranger 1, as compared with the empty side. Collectively, the male and female mice, exposed to sevoflurane in the neonatal period, showed the sustained social affiliation at the early- adulthood. Meanwhile, the male subject mice, but not the females, under- going anesthesia with 3.0% sevoflurane in 60% oxygen on postnatal day 6 showed normal preference for social novelty at two-month- old, as evidenced by taking more time (Fig. 2E, 102.0 ± 42.0 vs. 146.6 ± 59.3 s, P ¼ 0.0463 Male; 101.5 ± 34.7 vs. 138.0 ± 49.9 s, P ¼ 0.2462 Female) approaching the stranger 2 mouse, sniffing more frequently (Fig. 2F, 37.1 ± 12.2 vs. 53.1 ± 15.0, P ¼ 0.0102 Male; 40.3 ± 10.3 vs. 53.1 ± 26.0, P ¼ 0.3074 Female) at the enclosure con- taining stranger 2, or spending more time exploring (Fig. 2G, 211.2 ± 58.3 vs. 284.3 ± 59.9 s, P ¼ 0.0254 Male; 228.9 ± 65.3 vs. 269.8 ± 131 Biochemical and Biophysical Research Communications 593 (2022) 129e136 64.3 s, P ¼ 0.4307 Female) in the chamber with stranger 2, as compared with the stranger 1 side. Together, the male mice exposed to sevoflurane in the neonatal period showed the already- developed social memory at the early-adulthood, but the female mice remained undeveloped social memory at the early-adulthood. 3.3. Neonatal exposure to 3.0% sevoflurane in 60% oxygen, as well as inhalation of 60% oxygen, decreased PSD95 levels in the hippocampus, but not the cortex, of neonatal mice In the cortex (Fig. 3A) and the hippocampus (Fig. 3B) of neonatal mice, the immunoblotting displayed that anesthesia with 3.0% sevoflurane (lanes 9-12) and inhalation of 60% oxygen (lanes 5-8) did not change the levels of bands representing Neuroligin-1 expression, as compared with the control (lanes 1-4), Quantifica- tion of Western blot, based on the ratio of Neuroligin-1 levels to b- Actin levels, did not show that neonatal exposure to sevoflurane change the levels of Neuroligin-1 in the cortex (Fig. 3C, 100.0±33.1 vs. 92.7±14.0, P¼0.6975 grey) or the hippocampus (Fig. 3D, 100.0±19.3 vs. 84.8±20.0, P¼0.3155 grey) of the neonatal mice, as compared with the control (white) . The immunoblotting displayed that anesthesia with 3.0% sevo- flurane (lanes 9-12) and inhalation of 60% oxygen (lanes 5-8) did not change the levels of bands representing PSD95 expression in the cortex (Fig. 3E) of neonatal mice, as compared with the control (lanes 1-4). Quantification of Western blot did not show that neonatal exposure to sevoflurane change the levels of PSD95 in the cortex (Fig. 3G, 100.0±23.4 vs. 120.1±27.9, P¼0.3113 grey), as compared with the control (white). However, the immunoblotting displayed that anesthesia with 3.0% sevoflurane (lanes 9-12) and inhalation of 60% oxygen (lanes 5-8) decreased the levels of bands representing PSD95 expression in the hippocampus (Fig. 3F) of neonatal mice, as compared with the control (lanes 1-4). Quanti- fication of Western blot decreased that neonatal exposure to sev- oflurane change the levels of PSD95 in the cortex (Fig. 3H, 100.0±35.9 vs. 49.2±10.8, P¼0.035 grey), as compared with the control (white). 4. Discussions This study was to explore whether neonatal anesthesia with sevoflurane could induce social interaction deficit in C57BL/6 mice, and we performed the experiment with several important con- siderations and preparations. Firstly, we conducted inhalational anesthesia with 3.0% sevoflurane in 60% oxygen for 2 h as in similar studies [16e18], and this regimen of anesthesia in neonatal mice was designed to mimic clinical anesthesia in pediatric patients. Secondly, we employed the three-chambered social paradigm to assess social behaviors of the subject mice [19e21] which could reflect two biological profiles of sociability and preference for social novelty [22]. Thirdly, the subject mice were arranged for social interaction tests at one- and two-month-old, as the juvenile age and early-adulthood were considered to be two critical periods of brain development in human [13,23]. Finally, we tested social interaction behaviors of male and female mice respectively, in or- der to investigate interaction effects of anesthesia and sex on social behaviors of the mice. Thereby, these results were adequate to determine whether neonatal exposure to sevoflurane could induce social interaction deficit in C57BL/6 mice. Our data suggested that both male and female mice, in the three-chambered social test, showed strong sociability and weak preference for social novelty at one-month-old, indicating the robust social affiliation with the conspecific and underdevelopment of social memory at the juvenile age. However, the male mice un- dergoing either sevoflurane anesthesia or oxygen control displayed H. Liu, X. Meng, Y. Li et al. Biochemical and Biophysical Research Communications 593 (2022) 129e136 Fig. 1. The juvenile mice anesthetized with 3.0% sevoflurane in 60% oxygen on PND 6, either male or female, show strong sociability but weak preference for social novelty at one-month-old. In the sociability test, the subject mice in either group, take more time sniffing the stranger 1 mouse (A), sniff more frequently at the enclosure containing stranger 1 (B), and spend more time exploring in the chamber with stranger 1 (C), as compared to the empty side. In the test of social novelty preference, the subject mice in either group, take no more time sniffing the stranger 2 mouse (E), sniff no more frequently at the enclosure containing stranger 2 (F), or spend no more time exploring in the chamber with stranger 2 (G), as compared to the stranger 1 side. (D, H) There are not significant differences between two sides in the number of entries into the chamber. Data are expressed as Mean ± SD. N ¼ 11 Oxygen and 17 Sevoflurane for males, 20 Oxygen and 11 Sevoflurane for females. Paired t-test, two-side. *P < 0.05, **P < 0.01, ***P < 0.001. 132 H. Liu, X. Meng, Y. Li et al. Biochemical and Biophysical Research Communications 593 (2022) 129e136 Fig. 2. The early-adult female mice, anesthetized with 3.0% sevoflurane in 60% oxygen on PND 6, show strong sociability but weak preference for social novelty at two- month-old. In the sociability test, the subject mice in either group, take more time sniffing the stranger 1 mouse (A), sniff more frequently at the enclosure containing stranger 1 (B), and spend more time exploring in the chamber with stranger 1 (C), as compared to the empty side. In the test of social novelty preference, the male mice take more time sniffing the stranger 2 mouse (E), sniff more frequently at the enclosure containing stranger 2 (F), and spend more time exploring in the chamber with stranger 2 (G), as compared to the stranger 1 side. However, the female mice undergoing neonatal anesthesia with sevoflurane show no significant difference (E, F and G, right) between the stranger 2 and stranger 1 side. (D, H) There are not significant differences between two sides in the number of entries into the chamber. Data are expressed as Mean ± SD. N ¼ 11 Oxygen and 15 Sevoflurane for males, 12 Oxygen and 7 Sevoflurane for females. Paired t-test. *P < 0.05, **P < 0.01, ***P < 0.001. 133 H. Liu, X. Meng, Y. Li et al. Biochemical and Biophysical Research Communications 593 (2022) 129e136 Fig. 3. Neonatal exposure to 3.0% sevoflurane in 60% oxygen or only 60% oxygen decrease the level of PSD95 in hippocampus, but not cortex, of the female mice. Western blot analysis displays that neither oxygen (lanes 5e8) nor sevoflurane (lanes 9e12) decreases the level of Neuroligin-1 in either cortex (A) or hippocampus (B) of the female mice, as compared to the control condition (lanes 1e4). Quantification of Western blot shows that neither oxygen (black bar) nor sevoflurane (grey bar) decreases the level of Neuroligin-1 in either cortex (C) or hippocampus (D), as compared to the control condition (white bar). Meanwhile, western blot analysis displays that both oxygen (lanes 5e8) and sevoflurane (lanes 9e12) decreases the level of PSD95 in hippocampus (F) but not cortex (E) of the female mice, as compared to the control condition (lanes 1e4). Quantification of Western blot shows that either oxygen (black bar) or sevoflurane (grey bar) decreases the level of PSD95 in hippocampus (H) but not cortex (G), as compared to the control condition (white bar). N ¼ 4 in each, Student's t-test. *P < 0.05. 134 H. Liu, X. Meng, Y. Li et al. normal preference for social novelty at two-month-old, indicating the well-development of social memory at the early-adulthood. Meanwhile, the female mice undergoing neonatal exposure to sevoflurane remained very weak preference for social novelty, indicating the developmental retardation of social memory at the early-adulthood. Taken together, these results demonstrated that sevoflurane anesthesia in neonatal period could impair preference for social novelty of the female mice at the early-adulthood. In addition, the developmental neurotoxicity of sevoflurane anes- thesia could be partial to female but not male, and neurobehavioral abnormality could be partial to social memory but not social affiliation. Three-chambered social paradigm was widely used for social interaction test in mouse model, which could examine sociability and preference for social novelty [15,24]. Sociability was defined as the propensity of testing mice to spend more time exploring in the chamber containing Stranger 1 than in the empty chamber [14,23]. Preference for social novelty was defined as the propensity of testing mice to spend more time exploring in the chamber con- taining Stranger 2 than in the chamber containing Stranger 1 [24,25]. Because the testing mouse might take too much time wandering and self-grooming, the time exploring in the chamber could not totally represent its real choice [26]. Therefore, we measured time sniffing at the enclosure, as the primary outcome, for accessing social choice of mice. Meanwhile, time exploring in the chamber and number of sniffs at the enclosure were used as the secondary outcomes. Besides, number of entries to side chamber was considered to be an internal control of general activities. In the sociability tests, both male and female mice, either the control or the sevoflurane-exposed, took much more time sniffing Stranger 1 compared with the empty enclosure at one- and two- month-old. These results suggested that 1) social affiliation with conspecific could be a stable and basic instinct of mice, and 2) neonatal exposure to sevoflurane could not impair the sociability of male and female mice. In the social novelty preference tests, both male and female mice, either the control or the sevoflurane- exposed, did not take more time sniffing Stranger 2 compared with Stranger 1 at one-month-old, and the male but not female mice preferred Stanger 2 to Stranger 1 at two-month-old. These results suggested that 1) social memory of the mice could be un- stable and superior neurocognitive function of mice [22,24,25], and 2) neonatal exposure to sevoflurane could selectively impair pref- erence for social novelty of female, but not male, mice at the early- adulthood. In this study, the male mice showed normal preference for novel conspecific at the early-adulthood, rather than at the juvenile age and this phenomenon suggested that social recognition memory was age-dependent in subject mice [26e28]. Meanwhile, the fe- male mice undergoing sevoflurane anesthesia, but not the control, showed weak preference for novel conspecific at the early- adulthood, and this abnormality suggested that sevoflurane- induced neurotoxicity could disturb neurodevelopmental process of social memory in female mice. In clinical phenotypes, children diagnosed as autism spectrum disorders are gender-biased, with more boys outweighing girls. We had no idea of the sexual discrepancy between social deficit in human being and social memory impairment in mouse model, and the potential explana- tion should be based on the development of body and brain. In terms of biological dimorphism, the boys could lag behind the girls in mental and physical development in adolescence, while the fe- male mice should weigh less than male mice in juvenile and early- adulthood. It was reported that sevoflurane anesthesia could impair learning and memory by inducing neuronal apoptosis and inhib- iting synapse plasticity [11,29,30], which were in accordance with 135 Biochemical and Biophysical Research Communications 593 (2022) 129e136 disturbance of social memory in female mice undergoing sevo- flurane anesthesia in our study. Next, we performed immunoblot- ing analysis to determine whether sevoflurane anesthesia in neonatal mice could affect the expression of Neuroligin-1 and PSD95 in the brain tissues. As a result, immunobloting analysis suggested that sevoflurane could not change the levels of Neuroligin-1 in the cortex and hippocampus of neonatal mice. However, we found that sevoflurane could decrease the levels of PSD95 in the hippocampus of neonatal mice. This result suggested the sevoflurane-induced neurotoxicity in developing brain of neonatal mice, although the detailed signaling pathways and neuropathologic mechanisms were unclear at this moment. Chung et al. reported that neonatal exposure to sevoflurane could cause the long-term memory impairment in C57BL/6J mice but not autism-like features [7], indicating the complication of social behavior and recognition memory in mice. In future study, we will explore the neuropathologic mechanisms of social memory impairment, and assess the inconformity of normal preference for social novlety in the oxygen-controlled mice with decreased levels of PSD95 in the hippocampus of neonatal mice. limitations. Firstly, we found the impairment of social memory in female mice undergoing sevo- flurane anesthesia, and then performed immunobloting analysis in brain tissue of sex-mixed mice, because it was difficult to distin- guish male and female mice in neonatal period. Secondly, we had only anesthetized neonatal mice with 3% sevoflurane for 2 h, and this regimen mimicking clinical anesthesia could be close to lower- limit. In future, we will anesthetize neonatal mice with 3% sevo- flurane for 6 h or 2 h for three times, to explore the accumulative impact of sevoflurane-induced neurotoxicity on social behaviors in mice. Thirdly, we performed 3.0% sevoflurane anesthesia in 60% oxygen in neonatal mice in animal study, but we had no idea of whether 60% oxygen itself could produce negative effects in developing brain. In future, we will determine the effect of 60% oxygen on social interaction behaviors of mice. This study has several In conclusion, C57BL/6 mice have two biological profiles of so- ciability and preference for social novelty, which were dominated by robust social affiliation and gradually-developed social memory. Neonatal exposure to sevoflurane could not impair sociability and preference for social novelty in male mice; however it could disturb preference for social novelty in female mice, with the potential mechanism of decreasing PSD95 levels in the hippocampus. Declaration of competing interest The authors declare no competing financial interests. Acknowledgements This work was supported by the National Natural Science Foundation of China (82001126 to S.Y.S, 82072130 and 81873925 to F.H.J), Natural Science Foundation of Jiangsu Province (BK20191171 to F.H.J). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2022.01.022. References [1] B.L. Pearson, J.K. Bettis, K.Z. Meyza, L.Y. Yamamoto, D.C. Blanchard, R.J. Blanchard, Absence of social conditioned place preference in BTBR Tþtf/J mice: relevance for social motivation testing in rodent models of autism, Behav. Brain Res. 233 (1) (2012) 99e104. Jul 15. [2] K.K. Chadman, Fluoxetine but not risperidone increases sociability in the BTBR H. Liu, X. Meng, Y. Li et al. mouse model of autism, Pharmacol. Biochem. Behav. 97 (3) (2011) 586e594. Jan. [3] J.J. Schwartzer, C.M. Koenig, R.F. Berman, Using mouse models of autism spectrum disorders to study the neurotoxicology of gene-environment in- teractions, Neurotoxicol. Teratol. 36 (2013) 17e35. Mar-Apr. [4] N. Kratsman, D. Getselter, E. Elliott, Sodium butyrate attenuates social behavior deficits and modifies the transcription of inhibitory/excitatory genes in the frontal cortex of an autism model, Neuropharmacology 102 (2016) 136e145. Mar. [5] M.E. McCann, S.G. Soriano, General anesthetics in pediatric anesthesia: in- fluences on the developing brain, Curr. Drug Targets 13 (7) (2012) 944e951. injury and anesthetic neurotoxicity following neonatal cardiac surgery: does the head rule the heart or the heart rule the head, Future Cardiol. 8 (2) (2012) 179e188. [6] H.M. Holtby, Neurological [7] W. Chung, S. Park, J. Hong, et al., Sevoflurane exposure during the neonatal period induces long-term memory impairment but not autism-like behaviors, Paediatr. Anaesth. 25 (10) (2015) 1033e1045. Oct. [8] J. Liu, X. Zhang, W. Zhang, G. Gu, P. Wang, Effects of sevoflurane on young male adult C57BL/6 mice spatial cognition, PLoS One 10 (8) (2015), e0134217. [9] M. Satomoto, Y. Satoh, K. Terui, et al., Neonatal exposure to sevoflurane in- duces abnormal social behaviors and deficits in fear conditioning in mice, Anesthesiology 110 (2009) 628e637. [10] J. Jiang, H. Jiang, Effect of the inhaled anesthetics isoflurane, sevoflurane and desflurane on the neuropathogenesis of Alzheimer's disease (review), Mol. Med. Rep. 12 (1) (2015) 3e12. Jul. [11] Y. Lu, X. Wu, Y. Dong, Z. Xu, Y. Zhang, Z. Xie, Anesthetic sevoflurane causes neurotoxicity differently in neonatal naïve and alzheimer disease transgenic mice, Anesthesiology 112 (6) (2010) 1404e1416. [12] Y. Takaenoki, Y. Satoh, Y. Araki, et al., Neonatal exposure to sevoflurane in mice causes deficits in maternal behavior later in adulthood, Anesthesiology 120 (2) (2014) 403e415. [13] B.D. Semple, S.A. Canchola, L.J. Noble-Haeusslein, Deficits in social behavior emerge during development after pediatric traumatic brain injury in mice, J. Neurotrauma 29 (17) (2012) 2672e2683. Nov 20. [14] G. Riedel, S.H. Kang, D.Y. Choi, B. Platt, Scopolamine-induced deficits in social memory in mice: reversal by donepezil, Behav. Brain Res. 204 (1) (2009) 217e225. Dec 1. [15] J.N. Crawley, T. Chen, A. Puri, et al., Social approach behaviors in oxytocin knockout mice: comparison of two independent lines tested in different laboratory environments, Neuropeptides 41 (3) (2007) 145e163. Jun. [16] Y. Zhao, K. Chen, X. Shen, Environmental enrichment attenuated sevoflurane- induced neurotoxicity through the PPAR-gamma signaling pathway, BioMed 136 Biochemical and Biophysical Research Communications 593 (2022) 129e136 Res. Int. 2015 (2015) 107e149. [17] M.H. Ji, L.L. Qiu, J.J. Yang, et al., Pre-administration of curcumin prevents neonatal sevoflurane exposure-induced neurobehavioral abnormalities in mice, Neurotoxicology 46 (2015) 155e164. Jan. [18] Y. Dong, G. Zhang, B. Zhang, et al., The common inhalational anesthetic sev- oflurane induces apoptosis and increases beta-amyloid protein levels, Arch. Neurol. 66 (5) (2009) 620e631. May. [19] S.S. Moy, H.T. Ghashghaei, R.J. Nonneman, et al., Deficient NRG1-ERBB signaling alters social approach: relevance to genetic mouse models of schizophrenia, J. Neurodev. Disord. 1 (4) (2009) 302e312. Dec. [20] S.S. Moy, R.J. Nonneman, N.B. Young, G.P. Demyanenko, P.F. Maness, Impaired sociability and cognitive function in Nrcam-null mice, Behav. Brain Res. 205 (1) (2009) 123e131. Dec 14. [21] S.S. Moy, J.J. Nadler, N.B. Young, et al., Social approach in genetically engi- neered mouse lines relevant to autism, Gene Brain Behav. 8 (2) (2009) 129e142. Mar. [22] J.N. Crawley, Designing mouse behavioral tasks relevant to autistic-like be- haviors, Ment. Retard. Dev. Disabil. Res. Rev. 10 (4) (2004) 248e258. [23] S.S. Moy, R.J. Nonneman, G.O. Shafer, et al., Disruption of social approach by MK-801, amphetamine, and fluoxetine in adolescent C57BL/6J mice, Neuro- toxicol. Teratol. 36 (2013) 36e46. Mar-Apr. [24] S.S. Moy, J.J. Nadler, A. Perez, et al., Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice, Gene Brain Behav. 3 (5) (2004) 287e302. [25] B.L. Pearson, E.B. Defensor, D.C. Blanchard, R.J. Blanchard, C57BL/6J mice fail to exhibit preference for social novelty in the three-chamber apparatus, Behav. Brain Res. 213 (2) (2010) 189e194. Dec 1. [26] J.J. Nadler, S.S. Moy, G. Dold, et al., Automated apparatus for quantitation of social approach behaviors in mice, Gene Brain Behav. 3 (5) (2004) 303e314. Oct. [27] O. Kaidanovich-Beilin, T. Lipina, I. Vukobradovic, J. Roder, J.R. Woodgett, Assessment of social interaction behaviors, JoVE : JoVE 25 (48) (2011). Feb. [28] K. Kent, V. Arientyl, M.M. Khachatryan, R.I. Wood, Oxytocin induces a condi- tioned social preference in female mice, J. Neuroendocrinol. 25 (9) (2013) 803e810. Sep. [29] T. Tagawa, S. Sakuraba, K. Kimura, A. Mizoguchi, Sevoflurane in combination with propofol, not thiopental, induces a more robust neuroapoptosis than sevoflurane alone in the neonatal mouse brain, J. Anesth. 28 (6) (2014) 815e820. Dec. [30] X.D. Han, M. Li, X.G. Zhang, Z.G. Xue, J. Cang, Single sevoflurane exposure increases methyl-CpG island binding protein 2 phosphorylation in the hip- pocampus of developing mice, Mol. Med. Rep. 11 (1) (2015) 226e230. Jan.",mice,['Neonatal exposure to sevoflurane impairs preference for social novelty in C57BL/6 female mice at early-adulthood'],postnatal day 6,['Twenty-eight male and thirty-one female mice were randomly assigned to receive 3.0% sevoflurane or 60% oxygen on postnatal day 6.'],Y,['They were tested for social interaction behaviors at one- and two-month-old.'],sevoflurane,['Twenty-eight male and thirty-one female mice were randomly assigned to receive 3.0% sevoflurane or 60% oxygen on postnatal day 6.'],none,[],c57bl/6,['Neonatal exposure to sevoflurane impairs preference for social novelty in C57BL/6 female mice at early-adulthood'],This study aims to investigate whether sevoflurane anesthesia in neonatal period could impair social behaviors in male and female mice.,['This study aims to investigate whether sevoflurane anesthesia in neonatal period could impair social behaviors in male and female mice.'],None,[],"In conclusion, sevoflurane anesthesia in neonatal period could disturb development of social memory and impair preference for social novelty in female mice at early-adulthood.","['In conclusion, sevoflurane anesthesia in neonatal period could disturb development of social memory and impair preference for social novelty in female mice at early-adulthood.']","The study has several limitations. Firstly, we found the impairment of social memory in female mice undergoing sevoflurane anesthesia, and then performed immunobloting analysis in brain tissue of sex-mixed mice, because it was difficult to distinguish male and female mice in neonatal period.","['This study has several limitations. Firstly, we found the impairment of social memory in female mice undergoing sevoflurane anesthesia, and then performed immunobloting analysis in brain tissue of sex-mixed mice, because it was difficult to distinguish male and female mice in neonatal period.']",None,[],True,True,True,True,True,True,10.1016/j.bbrc.2022.01.022 10.1097/ALN.0b013e31819daedd,5173.0,Liu,2012,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"Anesthesiology 2009; 110:1077– 85 Copyright © 2009, the American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins, Inc. Dexmedetomidine Attenuates Isoflurane-induced Neurocognitive Impairment in Neonatal Rats Robert D. Sanders, B.Sc., M.B.B.S., F.R.C.A.,* Jing Xu, M.D.,† Yi Shu, B.Sc.,‡ Adam Januszewski, B.Sc., M.B.B.S.,§ Sunil Halder, B.Sc., M.B.B.S.,(cid:1) Antonio Fidalgo, M.Sc.,‡ Pamela Sun, B.Sc.,# Mahmuda Hossain, Ph.D.,** Daqing Ma, M.D., Ph.D.,†† Mervyn Maze, M.B., Ch.B., F.R.C.P., F.R.C.A., F.Med.Sci.‡‡ Background: Neuroapoptosis is induced by the administra- tion of anesthetic agents to the young. As (cid:1)2 adrenoceptor signaling plays a trophic role during development and is neu- roprotective in several settings of neuronal injury, the authors investigated whether dexmedetomidine could provide func- tional protection against isoflurane-induced injury. Methods: Isoflurane-induced injury was provoked in organo- typic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine. In vivo, the (cid:1)2 adrenoceptor antagonist ati- pamezole was used to identify if dexmedetomidine neuropro- tection involved (cid:1)2 adrenoceptor activation. The (cid:2)-amino-bu- tyric-acid type A antagonist, gabazine, was also added to the organotypic hippocampal slice cultures in the presence of isoflurane. Apoptosis was assessed using cleaved caspase-3 im- munohistochemistry. Cognitive function was assessed in vivo on postnatal day 40 using fear conditioning. Results: In vivo dexmedetomidine dose-dependently pre- vented isoflurane-induced injury in the hippocampus, thala- mus, and cortex; this neuroprotection was attenuated by treat- ment with atipamezole. Although anesthetic treatment did not affect the acquisition of short-term memory, isoflurane did induce long-term memory impairment. This neurocognitive deficit was prevented by administration of dexmedetomidine, which also inhibited isoflurane-induced caspase-3 expression in organotypic hippocampal slice cultures in vitro; however, gabazine did not modify this neuroapoptosis. Conclusion: Dexmedetomidine attenuates isoflurane-induced injury in the developing brain, providing neurocognitive pro- tection. Isoflurane-induced injury in vitro appears to be inde- pendent of activation of the (cid:2)-amino-butyric-acid type A recep- tor. If isoflurane-induced neuroapoptosis proves to be a clinical problem, administration of dexmedetomidine may be an im- portant adjunct to prevent isoflurane-induced neurotoxicity. ANESTHESIA has recently been associated with wide- spread apoptotic neurodegeneration in the neonatal rat brain with persistent functional neurocognitive impair- ment, exemplified by impaired memory formation.1– 4 This discovery has led to concern about the possible detrimental effects of anesthesia and sedation in the pediatric population. The observed apoptotic neurode- generation mimics the neuronal injury of fetal alcohol syndrome5 and is thought to be secondary to impaired neurotransmission during a critical period of synapto- genesis that triggers so-called neuronal suicide. Indeed, there is significant evidence that preventing synaptic neurotransmission causes deleterious long-term central nervous system changes,6 with synaptic neurotransmis- sion critical to avoid synaptic pruning and apoptosis of activity-deprived neurons.7,8 Generically, anesthetic agents are thought to inhibit synaptic neurotransmission by potentiating (cid:1)-amino- butyric-acid type A (GABAA) receptors, inhibiting gluta- mate N-methyl-D-aspartate (NMDA) channels or activat- ing two-pore potassium channels.9 The net result leads to cellular hyperpolarization and a reduction in neuronal activity. However, during development, this artificial silenc- ing of synapses is thought to induce an apoptotic cascade via disruption of the action of trophic factors, notably brain-derived neurotrophic factor,2,3 phosphorylated ex- tracellular signal-regulated protein kinase 1 and 2 (pERK),2 and phosphorylated-cyclic-adenosine monophosphate (AMP) response element binding protein with subse- quent stimulation of the intrinsic apoptotic cascade.4,10 The intrinsic cascade results in cytochrome C release and Bax signaling to activate the caspase enzymes that provoke cell death by apoptosis.4,10,11 Subsequently, ex- trinsic apoptotic signaling may also be activated.10 These toxic effects have now been established after as little as 60 min of below 1 minimum alveolar concentration of isoflurane in the 7-day-old rat12; thus, a relationship be- tween anesthesia, neuroapoptosis and cognitive dys- function has been established. Academic Clinical Fellow, ‡ Doctoral Student, § House Officer, # Medical Student, ** Research Technician, †† Senior Lecturer, ‡‡ Sir Ivan Magill Professor of Anaesthesia, Department of Anaesthetics, Pain Medicine and Intensive Care, Imperial College London, United Kingdom; (cid:1) Honorary Research Fellow, Imperial College London, and Specialty Trainee, Department of Anaesthetics, Reading General Hospital, Reading, United Kingdom; † Attending Physician, Department of Anesthesiology, Gongli Hospital, Pudong, Shanghai, China. Professor Maze has been a consultant for Abbott Laboratories, Abbott Park, Illinois, to facilitate registration of dexmedetomidine in the United States. Received from the Department of Anaesthetics, Pain Medicine and Intensive Care, Imperial College London, United Kingdom. Submitted for publication January 23, 2008. Accepted December 2, 2008. Supported by Chelsea and Westminster Healthcare NHS Trust, London, United Kingdom, and the Westmin- ster Medical School Research Trust, London, United Kingdom. Address correspondence to Professor Maze: Magill Department of Anaesthet- ics, Intensive Care and Pain Medicine, Imperial College London, Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH. m.maze@ imperial.ac.uk. Information on purchasing reprints may be found at www. anesthesiology.org or on the masthead page at the beginning of this issue. ANESTHESIOLOGY’s articles are made freely accessible to all readers, for personal use only, 6 months from the cover date of the issue. The NMDA antagonist ketamine (20 mg kg(cid:1)1 and above) and the GABAergic agonist midazolam (9 mg kg(cid:1)1) both induce apoptotic neurodegeneration in in- fant mice13 despite having different mechanisms of an- esthetic action. This has significant implications for pedi- atric anesthesia as these drugs are used for premedication, sedation or analgesia in several clinical settings. Further- more, as these agents have differing mechanisms of anes- thetic action, yet induce this neuroapoptosis, it has been argued that it is the anesthetic state that produces the injury.11 To date, only one exception to this rule has been identified, the noble anesthetic gas xenon, which prevented isoflurane-induced toxicity.4 However, xenon Anesthesiology, V 110, No 5, May 2009 1077 1078 is currently not widely available; therefore, we have been seeking to identify alternative methods to amelio- rate this toxicity. Early in life, (cid:2)2 adrenoceptors are thought to play a trophic role in central nervous system signaling,14,15 with endogenous norepinephrine activating cellular survival mechanisms such as the Ras-Raf-pERK pathway.16,17 Acti- vation of this Ras-Raf-pERK pathway has been associated with neuroprotection against the apoptosis induced by NMDA antagonists in the young.2 Dexmedetomidine also increases the expression of the antiapoptotic proteins mdm2 and bcl-2 in a model of adult ischemic cerebral injury18; in vitro, it has been shown to upregulate brain- derived neurotrophic factor, phosphorylated-cyclic-AMP response element binding protein, and pERK signal- ing.16,19,20 However, it is not known whether modifica- tion of these proteins represents a true antiapoptotic effect of dexmedetomidine or whether these findings were merely a correlate of increased cellular survival. Herein, we show that dexmedetomidine protects against anesthetic-induced apoptosis in vivo and in vitro, indi- cating that it does possess antiapoptotic qualities. Im- portantly, we again establish that isoflurane injury provokes a long-term neurocognitive deficit and then demonstrate that this functional deficit can be atten- uated by dexmedetomidine. Materials and Methods The study protocol was approved by the Home Office (London, United Kingdom) and conforms to the United Kingdom Animals (Scientific Procedures) Act of 1986. In Vitro Experiments Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups (Harlan Labora- tories, Huntingdon, United Kingdom) and cultured by the interface method21,22 with some modifications. In brief, the brain was quickly dissected and placed in ice-cooled (4°C) dissection solution. All stages of slice preparation were performed under sterile and ice-cooled conditions. Excess tissue (including the cerebellum, ol- factory bulbs, and meninges) was removed, and the brain was cut into 400-(cid:3)m sagittal slices using a McIl- lwain Tissue Chopper (Mickle Laboratory, Cambridge, United Kingdom). Under a dissecting microscope and avoiding contact with the hippocampus, the slices were separated using fine forceps. Slices containing the intact hippocampus were selected and positioned onto 30-mm- diameter semiporous cell culture inserts (five slices per insert) (Falcon; Becton Dickinson Labware, Millipore, Bedford, MA) and placed in a six-well tissue culture tray (Multiwell; Falcon, Becton Dickinson Labware). Eagle minimum essential medium enhanced with heat-inacti- vated horse serum (1.5 ml) was then transferred to each well. Anesthesiology, V 110, No 5, May 2009 SANDERS ET AL. The slices were incubated for 24 h in humidified air at 37°C, enriched with 5% carbon dioxide. The culture medium was replaced the next day with fresh, temper- ature-equilibrated medium before exposure to gas treat- ments. The groups of slices (n (cid:2) 15 per group) were assigned to control (air (cid:3) 5% carbon dioxide), dexme- detomidine 1 (cid:3)M, gabazine 50 (cid:3)M, 0.75% isoflurane, 0.75% isoflurane (cid:3) dexmedetomidine 1 (cid:3)M, and 0.75% isoflurane (cid:3) gabazine 50 (cid:3)M. All subsequent gas exposure occurred in a specially con- structed exposure chamber as previously described.23 The gases, warmed by a water bath, were delivered in the headspace above the slices by a standard anesthetic machine at 2–3 l/min, and concentrations were moni- tored with an S/5 spirometry module (Datex-Ohmeda, Bradford, United Kingdom). After 3– 4 min of gas flow, the chambers were sealed and placed in a 37°C incuba- tor for 6 h (Galaxy R Carbon Dioxide Chamber; Wolf Laboratories, Pocklington, York, United Kingdom). After exposure, the slices were returned to the incubator for a further 12 h of culture to allow for suitable caspase-3 expression and then fixed overnight in 4% paraformal- dehyde and subsequently immersed in 30% sucrose for a further 24 h at 4°C before slicing with a cryostat. In Vivo Experiments Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber (n (cid:2) 6 per group). Three doses of saline or dexmedetomidine (1, 10, or 25 (cid:3)g/kg) were administered by intraperitoneal injection over the 6-h exposure (at 0, 2, and 4 h). One group received 0.75% isoflurane, 25 (cid:3)g/kg dexmedetomidine, and 500 (cid:3)g/kg nonselective (cid:2)2 adrenoceptor antagonist atipamezole in 3 doses over the 6-h exposure (n (cid:2) 4 per group). An additional three doses of 75 (cid:3)g/kg dexme- detomidine in air were given to establish at extreme doses of dexmedetomidine whether apoptosis could be induced (n (cid:2) 6 per group). The animals were sacrificed (with 100 mg/kg sodium pentobarbital by intraperitoneal injection) at the end of gas exposure and perfused transcardially with heparin- ized saline followed by 4% paraformaldehyde in 0.1 M buffer. After removal of the brain and storage overnight at 4°C in paraformaldehyde, it was transferred to 30% sucrose solution with phosphate buffer and 1% sodium azide and kept at 4°C until the brains were sectioned and stained immunohistochemically for caspase-3. Immunohistochemistry For the in vitro experiments, the slices were sectioned at 25-(cid:3)m intervals using a cryostat, and the inner sec- tions were mounted onto Super Plus-coated glass slides (VWR International, Lutterworth, United Kingdom). The sections were allowed to dry at 37°C for 24 h and then immunostained while adherent to the slides. Concerning DEXMEDETOMIDINE INHIBITS ISOFLURANE-INDUCED INJURY the in vivo experiments, the brain was sliced at 30-(cid:3)m intervals beginning at (cid:1)3.6 mm from the bregma, the sections were then transferred to a six-well plate con- taining phosphate-buffered saline. Sections were dried at 37°C for 24 h and then immunostained while adherent to the slides, before preincubation with hydrogen 0.3% peroxidase in methanol for 30 min and then rinsed in phosphate-buffered saline. The sections were then incu- bated overnight at 4°C with rabbit anti-cleaved caspase-3 (1:2,500; New England Biolab, Hitchin, United King- dom) and then washed three times in phosphate-buff- ered saline with 3% Triton at room temperature. Biotin- ylated secondary antibodies (1:200; Sigma, St. Louis, MO) and the avidin-biotin-peroxidase complex (Vector Laboratories, Orton Southgate, Peterborough, United Kingdom) were applied. The sections were again washed in phosphate-buffered saline before incubating with 0.02% 3,3=-diaminobenzidine with nickel ammo- nium sulfate in 0.003% hydrogen peroxide (DAB kit, Vector Laboratories). The sections were dehydrated through a gradient of ethanol solutions (70 –100%) and then mounted (floating section) and covered with a cover slip. Neurocognitive Evaluation Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber (n (cid:2) 6 per group). Three doses of saline or 25 (cid:3)g/kg dexmedetomidine were administered by intraperitoneal injection over the 6-h exposure (at 0, 2, and 4 h). The animals were al- lowed to mature until postnatal day 40 and then tested for hippocampal-dependent memory and learning func- tion in a previously reported contextual fear-condition- ing behavioral paradigm24 in which the rats were taken from the vivarium in the behavioral room on the first test day and allowed to sit undisturbed in their homecage for 10 min. Once placed in the conditioning chamber, the rats were allowed 198 s of exploration. The conditioning chamber was cubic (30 cm (cid:4) 24 cm (cid:4) 21 cm; Med Associates, Inc., St. Albans, VT) and had a white opaque back wall, aluminum sidewalls, and a clear polycarbonate front door. The conditioning box had a removable grid floor and waste pan. Between each rat, the box was cleaned with an almond-scented solution and dried thoroughly. The grid floor contained 36 stain- less steel rods (diameter, 3 mm) spaced 8 mm center to center. When placed in the chamber, the grid floor made contact with a circuit board through which a scrambled shock was delivered. During training and context test- ing, a standard HEPA filter provided background white noise of 65 db. Afterwards, all animals received 6 cycles of 214 s of trace fear conditioning. The tone was presented for 16 s (2 kHz) followed by a trace interval of 18 s and subse- quent foot shock (2 s, 0.85 mA). The rats were removed from the conditioning chamber 198 s after the last shock and returned to their home cage. The total time of the acquisition phase was 26 min. Acquisition time was defined as the time spent immobile after a shock divided by the intertrial interval. On the next day, trained rats were exposed to the same acquisition environment but received neither tone nor shock for 8 min (context test). The percentage of time an animal froze during the 8-min observation periods was calculated as the number of observations judged to be freezing divided by the total number of observations in 8 min (i.e., 60 observations). Freezing time was assessed using VideoFreeze software (Med Associates Inc., Burlington, VT); therefore, the assessment can be considered objective. The percentage of freezing time (context results) and the area under curve were derived from plots between the percentage freezing time and trial time in the tone test and were used for statistical comparison (mean (cid:5) SD, n (cid:2) 6 per group). Statistical Analyses The number of caspase-3–positive neurons in the cor- tex, thalamus, and hippocampus in each brain slice were counted by an observer blinded to the experimental protocol. Four brain slices were counted per animal. The immunohistochemical and behavioral data are presented as mean (cid:5) SD. Statistical analyses was performed by ANOVA followed by post hoc Newman Keuls testing using the INSTAT (London, United Kingdom) program. P (cid:6) 0.05 was set as significant. Results All animals survived the in vivo experiments. Isoflu- rane induced neuroapoptosis throughout the cortex, thalamus, and hippocampus reflected by the increase in the number of caspase-3–positive cells observed (fig. 1, A–C). Isoflurane (0.75% (cid:3) saline) increased caspase-3 expression relative to air ((cid:3) saline) controls in the cor- tex from 44 (cid:5) 7 to 270 (cid:5) 34 cells (P (cid:6) 0.05; fig. 1D), in the hippocampus from 8 (cid:5) 3 to 80 (cid:5) 11 cells (P (cid:6) 0.05; fig. 1E), and in the thalamus from 4 (cid:5) 2 to 62 (cid:5) 15 cells (P (cid:6) 0.05; fig. 1F). In contrast dexmedetomidine in the presence of air did not increase cellular caspase-3 ex- pression relative to controls (fig. 1, E–F). Dexmedetomidine (1–25 (cid:3)g/kg) provided dose-dependent neuroprotection reducing isoflurane-induced caspase-3 ex- pression in the cortex (186 (cid:5) 23 to 129 (cid:5) 29 cells; P (cid:6) 0.05) relative to isoflurane (270 (cid:5) 34 cells), hippocam- pus (28 (cid:5) 11 to 15 (cid:5) 5 cells; P (cid:6) 0.05) relative to isoflurane (80 (cid:5) 11 cells), and thalamus (21 (cid:5) 6 to 9 (cid:5) 4 cells; P (cid:6) 0.05) relative to isoflurane (62 (cid:5) 15 cells). The addition of 25 (cid:3)g/kg dexmedetomidine provided the most potent protection that was significantly better than 1 or 10 (cid:3)g/kg dexmedetomidine (P (cid:6) 0.05) in each Anesthesiology, V 110, No 5, May 2009 1079 1080 brain area. In the hippocampus and thalamus, but not the cortex, 25 (cid:3)g/kg dexmedetomidine reduced the injury induced by isoflurane to baseline (P (cid:7) 0.05 vs. Air (cid:3) Saline). Reversal of dexmedetomidine neuroprotection by the (cid:2)2 adrenoceptor antagonist, atipamezole, in the hippocampus (P (cid:6) 0.05; fig. 1E), thalamus, and cortex (nonsignificant) indicates that this effect is at least partly mediated by (cid:2)2 adrenoceptors in these regions. Consistent with previous data,4 6 hours of 0.75% isoflu- rane also induced neuroapoptosis in organotypic hip- pocampal slice cultures, increasing caspase-3 expression by 44% (control 18 (cid:5) 6 vs. isoflurane 26 (cid:5) 11 cells; P (cid:6) 0.01; fig. 2, A and B). This effect was reversed by addi- tion of 1 (cid:3)M dexmedetomidine (20 (cid:5) 7 cells; P (cid:6) 0.05, fig. 2C), reducing caspase-3 expression to within 10% of controls. As reported previously,25 gabazine itself was nontoxic (showing caspase-3 expression 92% of air-sa- line treated controls; P (cid:7) 0.05); it did not attenuate isoflurane-induced apoptosis (P (cid:7) 0.05 vs.. isoflurane; fig. 2, D and E). At postnatal day 40, neonatal treatment with isoflu- induced rane-saline, but not air-dexmedetomidine, Anesthesiology, V 110, No 5, May 2009 SANDERS ET AL. Fig. 1. Dexmedetomidine (Dex) inhibits isoflurane-induced neuroapoptosis in vivo. Seven-day-old rats were exposed to air or isoflurane (0.75%) for 6 h with injections of saline or intraperitoneal dexmedetomidine given three times at 0, 2, and 4 h. (A) Photomicrograph of a cor- tical section from an animal exposed to air and three doses of saline over 6 h stained immunohistochemically for caspase-3. (B) A similar photomicrograph of a cortical section from an animal exposed to isoflu- rane and three doses of saline over 6 h. (C) Photomicrograph of a cortical section from an animal exposed to isoflurane and three doses of 1 (cid:3)g/kg dexmedetomi- dine over 6 h stained immunohisto- chemically for caspase-3. (D) Histogram showing the number of caspase-3–posi- tive cortical neurons against interven- tion. (E) Histogram showing the number of caspase-3–positive hippocampal neu- rons against intervention. (F) Histogram showing the number of caspase-3–posi- tive thalamic neurons against interven- tion. The interventions include: Air (cid:4) Sa- line intraperitoneal (Air/Sal), Air (cid:4) Dex 25 (cid:3)g/kg (Air/Dex25), Air (cid:4) Dex 75 (cid:3)g/kg (Iso/Dex75), Isoflurane (cid:4) saline (Iso/Sal), Iso (cid:4) Dex 1 (cid:3)g/kg (Iso/Dex1), Iso (cid:4) Dex 10 (cid:3)g/kg (Iso/Dex10), Iso (cid:4) Dex 25 (cid:3)g/kg (Iso/Dex25), Iso (cid:4) Dex 25 (cid:3)g/kg (cid:4) Atipamezole 500 (cid:3)g/kg (Iso/ Dex25/Atp); n (cid:5) 4 – 6 per group. * (cid:5) P < 0.05 versus Air (cid:4) Sal; ** (cid:5) P < 0.001 versus Air (cid:4) Sal; # (cid:5) P < 0.05 versus Iso (cid:4) Sal; (cid:4) (cid:5) P < 0.01 versus Iso (cid:4) Sal; ˆ (cid:5) P < 0.001 versus Iso (cid:4) Sal; § (cid:5) P < 0.05 versus Iso (cid:4) Dex 25; ˜ (cid:5) P < 0.05 versus Iso (cid:4) Dex1 or Iso (cid:4) Dex10. neurocognitive impairment as assessed by context fear conditioning (a marker of long-term memory); however, none of the groups exhibited any deficit in the acquisition phase (indicating no deficit in short- term memory; fig. 3A). The percentage freezing time in the contextual fear-conditioning experiment was 48 (cid:5) 5% in controls (air-saline), 45 (cid:5) 11% with air- dexmedetomidine–treated animals, and 29 (cid:5) 7% with isoflurane-saline–treated animals (fig. 3B). Dexmedeto- midine ameliorated the neurocognitive impairment in- duced by isoflurane; percentage freezing time 46 (cid:5) 9% with isoflurane-dexmedetomidine–treated animals. Discussion Isoflurane induced widespread cerebral neuroapopto- sis in neonatal rat pups with subsequent long-term neu- rocognitive impairment of the animals. As the injury occurred in the neonatal period and animal training and testing followed this injury, this indicates impairment in learning and memory consistent with a significant hip- DEXMEDETOMIDINE INHIBITS ISOFLURANE-INDUCED INJURY isoflurane treatment. Importantly, in contrast to isoflu- rane (and other agents such as midazolam and ket- amine13), dexmedetomidine itself lacks neurotoxicity even at extremely high doses such as 75 (cid:3)g/kg dexme- detomidine (a dose that is 75 times the ED50 for hypno- sis27). Dexmedetomidine also did not induce neurocog- nitive impairment at the clinically relevant dose of 25 (cid:3)g/kg. Although dexmedetomidine could also attenuate isoflurane-induced neuroapoptosis in organotypic hip- pocampal slice cultures, gabazine did not reverse this effect, suggesting that isoflurane’s neuroapoptotic effect is not mediated by GABAA receptors. Caveats These results indicate that dexmedetomidine can in- hibit neuroapoptosis provoked by isoflurane in vitro and in vivo; however, several caveats need to be raised before further interpretation of our data. Previous re- ports have shown that the apoptosis involved neurons, and the injured cells in our study morphologically ap- pear to be neurons. Therefore we assume the dying cells are neurons; this is supported by our data showing a neurocognitive deficit induced by isoflurane. In addition, our marker of apoptosis and cell death, caspase-3 expres- sion, has been previously validated in this model of anesthetic-injury.1– 4 Although we (and others1) have correlated the apoptosis observed with the neurocogni- tive deficits induced by isoflurane in neonatal rats, we still cannot exclude that other mechanisms (such as effects on neurogenesis or synaptic function) do not contribute to the pathogenesis or the protection af- forded by dexmedetomidine. Fig. 2. Dexmedetomidine (Dex) inhibits isoflurane-induced neuroapoptosis in vitro. C57Bl/6 mice pup organotypic hip- pocampal cultures were exposed to (A) air (cid:4) 5% carbon dioxide (control), (B) isoflurane 0.75% (Iso), (C) isoflurane 0.75% (cid:4) Dex 1 (cid:3)M (Iso (cid:4) Dex), and (D) isoflurane (cid:4) gabazine 50 (cid:3)M (Iso (cid:4) Gab) for 6 h and then stained for caspase-3 using immuno- histochemistry. Quantified data are presented in section E. * (cid:5) P < 0.01 versus Control; ** (cid:5) P < 0.001 versus Control; # (cid:5) P < 0.05 versus Iso and P < 0.01 versus Iso (cid:4) Gab. pocampal lesion.24,26 These data support previous ex- periments showing a significant hippocampal injury af- ter anesthetic treatment.1 Dexmedetomidine provided neuroprotection against isoflurane-induced neuroapop- tosis in a dose-dependent manner, acting via activation of (cid:2)2 adrenoceptors (as atipamezole reversed dexme- detomidine’s neuroprotective effect). Crucially, dexme- detomidine prevented the neurocognitive sequelae of Despite data showing that the hypnotic, analgesic, and neuroprotective effects of dexmedetomidine primarily relate to activation of the (cid:2)2A adrenoceptor,28,29 atipam- ezole significantly inhibited dexmedetomidine’s neuro- protective effect only in the hippocampus. Although there was a trend to a reversal in effect in the thalamus and cortex, atipamezole did not significantly alter dexmedetomidine protection in these regions. This may indicate alternate receptor targets in these regions, such as imidazoline receptors,30 but we suspect a type II error may also account for these findings. Minimal disturbances in arterial blood gases1,3 have been reported in previous studies; however, the poten- tial to induce hypoglycemia in these animals during the anesthetic period is of concern,31 but this has also been shown not to occur.12 Indeed, it is possible that the addition of dexmedetomidine to isoflurane could exac- erbate both the cardiovascular and respiratory depres- sion of the anesthetic state; however, it is also conceiv- able that high doses of dexmedetomidine may have increased either blood pressure (via activation of (cid:2)2B adrenoceptors) or glucose (via (cid:2)2A adrenoceptors). Therefore, we also conducted an in vitro experiment to control for the potential confounding effects of hypoxia, Anesthesiology, V 110, No 5, May 2009 1081 1082 glucose, and temperature dysregulation using the orga- notypic hippocampal slice culture model. We employed the latter experimental paradigm because synapses re- main intact, which is imperative because inhibition of synaptic neurotransmission is hypothesized as critical to the injury. It is known that isoflurane is directly neurotoxic in the organotypic hippocampal slice culture model.4,32 We used a single dose of dexmedetomidine (1 (cid:3)M) in our organotypic hippocampal slice culture studies and did not corroborate the extensive dose response curve that was obtained in vivo because the aim in this experiment was to identify whether dexmedetomidine was acting via a direct or physiologic mechanism. These data suggest that dexmedetomidine can prevent the isoflurane injury by direct action within the central nervous system. It should also be noted that dexmedetomidine, al- though neuroprotective, does not entirely reverse the isoflurane injury in the cortex (despite prominent neu- roprotection of the thalamus and hippocampus being observed). However, our neurocognitive tests did not uncover an isoflurane-associated deficit in memory ac- quisition that typically depends on a functional prefron- tal cortex.33 Therefore, despite significant apoptosis in the cortex, our study suggests the cortex is not function- ally impaired after isoflurane treatment (0.75% for 6 h), Anesthesiology, V 110, No 5, May 2009 SANDERS ET AL. Fig. 3. Cognitive function assessed by trace fear conditioning. Seven-day-old Sprague-Dawley rat pups were exposed with air or 0.75% isoflurane (Iso) in ox- ygen with or without saline or dexme- detomidine (Dex) treatment for 6 h. They were allowed to live up to 40 days and then tested for hippocampal-dependent memory and learning function. (A) The plot of the mean percentage of freezing time of acquisition against six test trials of trace fear conditioning (day 1). (B) The mean of the percentage of freezing time (context results) obtained from trace fear conditioning (day 2). Mean (cid:6) SD (n (cid:5) 6); * (cid:5) P < 0.05 versus other groups. but we do suggest that the effects of other doses of isoflurane still require investigation. In monkeys, ket- amine injury is primarily involved the cortex rather than subcortical structures34; it is possible that, if observed in humans, cortical apoptosis induced by anesthetics may be the predominant injury. Further tests of cortex-based neurocognitive function in rodents and primates should be conducted before this injury is dismissed. A final difficulty plaguing all preclinical studies is the ability to extrapolate across species; in this regard, differ- ential interspecies vulnerability to isoflurane injury may be apparent. Indeed, recent data have suggested that monkey brains may be less vulnerable to ketamine injury than ro- dent brains.34 However, isoflurane may be more potent at inducing apoptosis than ketamine, especially because the injury is apparent after subanesthetic isoflurane concentra- tions lasting only 1 h.12 Whether anesthetic-induced neu- rotoxicity is a clinical problem requires further investiga- tion, including studies involving monkeys and ultimately humans; while we await these answers, we need to strive to obtain a safe anesthetic therapy. Mechanism of Dexmedetomidine Neuroprotection In these studies, we have explored whether dexme- detomidine is antiapoptotic (as suggested, but not di- DEXMEDETOMIDINE INHIBITS ISOFLURANE-INDUCED INJURY rectly investigated by many preclinical studies). We pro- pose that administration of an (cid:2)2 adrenoceptor agonist during the critical phase of synaptogenesis activates the endogenous postsynaptic norepinephrine-mediated tro- phic system, which couples to a pERK-Bcl-2 pathway to produce its antiapoptotic effect.19,20,21 Further studies will probe the involvement of this pathway in vivo. Despite our data showing a role for (cid:2)2 adrenoceptor activation in dexmedetomidine neuroprotection, other potential receptor subtypes, such as the imidazoline re- ceptors, can upregulate pERK and are activated by dexmedetomidine,30 thus providing an alternative mech- anism for dexmedetomidine’s neuroprotective effect. Mechanism of Isoflurane Neurotoxicity Interestingly, gabazine could not reverse the isoflu- rane-induced neurodegeneration despite the hypothesis that, by potentiating GABAA receptor activity, isoflurane inhibits neurotransmission detrimentally during the crit- ical period of synaptogenesis.11 Thus, GABAA receptor activation may not be critical for isoflurane-induced neu- rotoxicity, although it is of interest that GABAA receptor antagonists can attenuate isoflurane’s neuroprotective effect.25,35 While GABAA receptor activation remains an important target for anesthesia, especially for intrave- nous anesthetics such as propofol, its role in haloge- nated volatile anesthesia is less clear.36,37 Therefore, it would appear that activation of the GABAA receptor is important for isoflurane neuroprotection but not neces- sarily critical for toxicity. Whether GABAA receptor antag- onism can attenuate propofol-induced neurotoxicity38 will be of interest because it reverses the propofol anesthetic state.39 However, GABAA receptors are not involved in the neurotoxicity; therefore, it may be possible to design a safe anesthetic agent for use in the young. Interest- ingly, a difference in the ability of sevoflurane and isoflu- rane to induce apoptosis has also been observed previ- ously,40 although preliminary evidence suggests that sevoflurane, similar to isoflurane, also induces neuro- apoptosis in the neonatal rat brain.41 Another receptor target that may be responsible for the isoflurane injury is the NMDA receptor, which plays a critical role in neurodevelopment.8 Each of the neuro- apoptotic-inducing anesthetics, including isoflurane, ket- amine, and MK-801, inhibit the NMDA receptor subtype of the glutamate receptor.1–5,10 –13 An exception to this rule is xenon, another NMDA receptor antagonist, which produces protection against isoflurane-induced injury rather than neuroapoptosis in the neonatal rat brain.4 We consider it likely that xenon exerts an antiapoptotic effect independent of its action at the NMDA receptor. It is of interest that both (cid:2)2 adrenoceptor agonists and xenon can attenuate the injury produced by NMDA an- tagonists in the adult brain42,43; therefore, despite differ- ences in the morphology of the adult and neonatal tox- icity, we cannot discount overlapping mechanisms of injury. In addition, we have not as yet evaluated whether a neuroprotective cocktail of xenon and dexmedetomi- dine can be employed to further reduce isoflurane tox- icity because they provide synergistic protection against neonatal hypoxic-ischemic injury.44 Neurocognitive Effects Our results from our fear conditioning paradigm sup- port the previous reports of neurocognitive impairment in adult rats after neonatal anesthesia.1,45 Fear condition- ing consists of placing a rat or a mouse in a chamber and giving one or more mild electric foot shocks. After a shock, the animal becomes immobile (freezing), a natu- ral response to fear that can be used as an indication of memory formation. Complex neuronal circuitry involv- ing the frontal cortex, hippocampus, periaqueductal gray, and rostral ventral medulla underlie the acquisition and retention of fear conditioning.24 Notably, a damaged hippocampus is unable to process the incoming stimuli producing a memory deficit.26 Interestingly, all groups displayed normal learning as- the animals sessed by the acquisition of memory; showed increasing levels of freezing across the training tones, with freezing levels post-shock on sixth pairing approximately 70%. This indicates a normal short-term memory, a function predominantly involving the pre- frontal cortex.31 In the context assessment, 24 h after acquisition training, animals exposed to isoflurane and saline displayed less freezing when compared to naive controls, indicating a neurocognitive deficit. Thus isoflu- rane-treated animals showed an abnormal response to contextual fear conditioning, indicating a severe hip- pocampal lesion24,26 consistent with previous reports.1 However, our experiments employed a much lower dose of anesthetic than in the previous studies (0.75% isoflurane vs. 0.75% isoflurane plus 75% nitrous oxide and 9 mg/kg midazolam). Even with subanesthetic dos- ing, the potential for functional neurocognitive deficit is apparent. In contrast, dexmedetomidine alone did not induce any memory deficit. Furthermore, the addition of dexmedetomidine to isoflurane reversed the neurocog- nitive compromise induced by isoflurane. This is of crit- ical importance because dexmedetomidine is the first agent to be shown to reverse the neurocognitive dys- function provoked by isoflurane. Dexmedetomidine is widely available and has an ex- panding role in pediatric clinical practice; therefore, if anesthetic-induced neurodegeneration is proven to be a clinical problem, we may already have available a thera- peutic intervention that can be employed in this setting where necessary. In situations where dexmedetomidine is not available, another (cid:2)2 agonist, clonidine, could be a candidate, although further studies are warranted because, although atipamezole significantly reversed dexmedetomi- dine’s neuroprotective effect in the hippocampus, the pro- tection afforded in the thalamus and cortex were not sig- Anesthesiology, V 110, No 5, May 2009 1083 1084 nificantly attenuated; we cannot be sure that all (cid:2)2 adrenoceptor agonists will afford this protection. Clinical Implications Clinically, no information has detailed the extent of anesthetic-induced neonatal neurodegeneration in hu- mans. In terms of neurodevelopment, a 7-day-old rat pup represents the peak of the synaptogenic period, but this period extends from birth to up to 2–3 yr in humans; therefore, the window of vulnerability may be greater in humans.46,47 One cannot advocate withholding anesthe- sia or analgesia during early human life on the basis of these findings because of the harm that this can do.47–50 However, if anesthetic-induced neurodegeneration is re- vealed as a clinical problem for pediatric anesthesia, administration of an (cid:2)2 adrenoceptor agonist during the anesthesia maybe prudent. Thus, this study has uncov- ered a plausible and promising novel application of a widely available class of drugs that may significantly affect the safety of clinical practice. The use of (cid:2)2 adrenoceptor agonists in pediatric prac- tice is expanding as a result of their potent sedative/ hypnotic qualities, analgesic action, potential organ-pro- tective effects, reduction in postoperative nausea and vomiting and delirium, and relative lack of respiratory side effects.51,52 Their use in neonatal practice requires evaluation based on these factors.51 In the future, their organ-protective, including neuroprotective, effects may be of importance to the provision of safe, balanced pediatric anesthesia.47 References 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF: Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 2003; 23:876–82 2. Hansen HH, Briem T, Dzietko M, Sifringer M, Voss A, Rzeski W, Zdzisinska B, Thor F, Heumann R, Stepulak A, Bittigau P, Ikonomidou C: Mechanisms leading to disseminated apoptosis following NMDA receptor blockade in the developing rat brain. Neurobiol Dis 2004; 16:440–53 3. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V: General anesthesia activates BDNF-dependent neuroapoptosis in the developing rat brain. Apoptosis 2006; 11:1603–15 4. Ma D, Williamson P, Januszewski A, Nogaro MC, Hossain M, Ong LP, Shu Y, Franks NP, Maze M: Xenon mitigates isoflurane-induced neuronal apoptosis in the developing rodent brain. ANESTHESIOLOGY 2007; 106:746–53 5. Ikonomidou C, Bittigau P, Ishimaru MJ, Wozniak DF, Koch C, Genz K, Price MT, Stefovska V, Horster F, Tenkova T, Dikranian K, Olney JW: Ethanol-induced apoptotic neurodegeneration and fetal alcohol syndrome. Science 2000; 287: 1056–60 6. Jain N, Florence SL, Qi HX, Kaas JH: Growth of new brainstem connections in adult monkeys with massive sensory loss. Proc Natl Acad Sci U S A. 2000; 97:5546–50 7. Hestrin S: Developmental regulation of NMDA receptor-mediated synaptic currents at a central synapse. Nature 1992; 357:686–9 8. Hardingham GE, Bading H: The Yin and Yang of NMDA receptor signaling. Trends Neurosci 2003; 26:81–9 9. Franks NP, Lieb WR: Molecular and cellular mechanisms of general anaes- thesia. Nature 1994; 367:607–14. 10. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V: Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience 2005; 135:815–27 11. Olney JW, Young C, Wozniak DF, Ikonomidou C, Jevtovic-Todorovic V: Anesthesia-induced developmental neuroapoptosis. Does it happen in humans? ANESTHESIOLOGY 2004; 101:273–5 Anesthesiology, V 110, No 5, May 2009 SANDERS ET AL. 12. Johnson SA, Young C, Olney JW: Isoflurane-induced neuroapoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 2008; 20:21–8 13. Young C, Jevtovic-Todorovic V, Qin YQ, Tenkova T, Wang H, Labruyere J, Olney JW: Potential of ketamine and midazolam, individually or in combination, to induce apoptotic neurodegeneration in the infant mouse brain. Br J Pharmacol 2005; 146:189–97 14. Winzer-Serhan UH, Leslie FM: Expression of alpha2A adrenoceptors during rat neocortical development. J Neurobiol 1999; 38:259–69 15. Song ZM, Abou-Zeid O, Fang YY: Alpha2a adrenoceptors regulate phos- phorylation of microtubule-associated protein-2 in cultured cortical neurons. Neuroscience 2004; 123:405–18 16. Wang Q, Lu R, Zhao J, Limbird LE: Arrestin serves as a molecular switch, linking endogenous alpha2-adrenergic receptor to SRC-dependent, but not SRC- independent, ERK activation. J Biol Chem 2006; 281:25948–55 17. Philipp M, Brede ME, Hadamek K, Gessler M, Lohse MJ, Hein L: Placental alpha(2)-adrenoceptors control vascular development at the interface between mother and embryo. Nat Genet 2002; 31:311–5 18. Engelhard K, Werner C, Eberspa¨cher E, Bachl M, Blobner M, Hildt E, Hutzler P, Kochs E: The effect of the alpha 2-agonist dexmedetomidine and the N-methyl-D-aspartate antagonist S((cid:3))-ketamine on the expression of apoptosis- regulating proteins after incomplete cerebral ischemia and reperfusion in rats. Anesth Analg 2003; 96:524–31 19. Dahmani S, Paris A, Jannier V, Hein L, Rouelle D, Scholz J, Gressens P, Desmonts JM, Mantz J: Dexmedetomidine increases hippocampal phosphory- lated extracellular signal-regulated protein kinase 1 and 2 content by an alpha 2-adrenoceptor-independent mechanism: Evidence for the involvement of imida- zoline I1 receptors. ANESTHESIOLOGY 2008; 108:457–66 20. Dahmani S, Rouelle D, Gressens P, Mantz J: Effect of dexmedetomidine on brain derived neurotrophic factor expression in rat hippocampal slices (ab- stract). ANESTHESIOLOGY 2006; 105:A681 21. Gahwiler BH: Organotypic monolayer cultures of nervous tissue. J Neuro- sci Methods 1981; 4:329–42 22. Stoppini L, Buchs PA, Muller D: A simple method for organotypic cultures of nervous tissue. J Neurosci Methods 1991; 37:173–82 23. Wilhelm S, Ma D, Maze M, Franks NP: Effects of xenon on in vitro and in vivo models of neuronal injury. ANESTHESIOLOGY 2002; 96:1485–91 24. Quinn JJ, Loya F, Ma QD, Fanselow MS: Dorsal hippocampus NMDA receptors differentially mediate trace and contextual fear conditioning. Hip- pocampus 2005; 15:665–74 25. Ma D, Hossain M, Rajakumaraswamy N, Franks NP, Maze M: Combination of xenon and isoflurane produces a synergistic protective effect against oxygen- glucose deprivation injury in a neuronal-glial co-culture model. ANESTHESIOLOGY 2003; 99:748–51 26. Fanselow MS: Contextual fear, gestalt memories, and the hippocampus. Behavioural Brain Res 2000; 110:73–81 27. Sanders RD, Giombini M, Ma D, Ohashi Y, Hossain M, Fujinaga M, Maze M: Dexmedetomidine exerts dose-dependent age-independent antinociception but age-dependent hypnosis in Fischer rats. Anesth Analg 2003; 100:1295–302 28. Lakhlani PP, MacMillan LB, Guo TZ, McCool BA, Lovinger DM, Maze M, Limbird LE: Substitution of a mutant alpha2a-adrenergic receptor via “hit and run” gene targeting reveals the role of this subtype in sedative, analgesic, and anesthetic-sparing responses in vivo. Proc Natl Acad Sci U S A 1997; 94:9950–5 29. Ma D, Hossain M, Rajakumaraswamy N, Arshad M, Sanders RD, Franks NP, Maze M: Dexmedetomidine produces its neuroprotective effect via the (cid:2)2A- adrenoceptor subtype. Eur J Pharmacol 2004; 502:87–97 30. Dahmani S, Paris A, Hein L, Gressens P, Mantz J: Dexmedetomidine activates ERK 1 & 2 via a non-(cid:2)2 adrenoceptors-mediated pathway (abstract). ANESTHESIOLOGY 2007:A12 31. Loepke AW, McCann JC, Kurth CD, McAuliffe JJ: The physiologic effects of isoflurane anesthesia in neonatal mice. Anesth Analg 2006; 102:75–80 32. Wise-Faberowski L, Zhang H, Ing R, Pearlstein RD, Warner DS: Isoflurane- induced neuronal degeneration: An evaluation in organotypic hippocampal slice cultures. Anesth Analg 2005; 101:651–7 33. Blum S, Hebert AE, Dash PK: A role for the prefrontal cortex in recall of recent and remote memories. Neuroreport 2005; 17:341–4 34. Slikker W Jr, Zou X, Hotchkiss CE, Divine RL, Sadovova N, Twaddle NC, Doerge DR, Scallet AC, Patterson TA, Hanig JP, Paule MG, Wang C: Ketamine- induced neuronal cell death in the perinatal rhesus monkey. Toxicol Sci 2007; 98:145–58 35. Elsersy H, Mixco J, Sheng H, Pearlstein RD, Warner DS: Selective gamma- aminobutyric acid type A receptor antagonism reverses isoflurane ischemic neuroprotection. ANESTHESIOLOGY 2006; 105:81–90 36. Jurd R, Arras M, Lambert S, Drexler B, Siegwart R, Crestani F, Zaugg M, Vogt KE, Ledermann B, Antkowiak B, Rudolph U: General anesthetic actions in vivo strongly attenuated by a point mutation in the GABA(A) receptor beta3 subunit. FASEB J 2003; 17:250–2 37. Sonner JM, Zhang Y, Stabernack C, Abaigar W, Xing Y, Laster MJ: GABA(A) receptor blockade antagonizes the immobilizing action of propofol but not ketamine or isoflurane in a dose-related manner. Anesth Analg 2003; 96:706–12 38. Cattano D, Young C, Olney J: Subanesthetic doses of propofol induce neuroapoptosis in the infant mouse brain (abstract). ANESTHESIOLOGY 2007; 106: A1984 DEXMEDETOMIDINE INHIBITS ISOFLURANE-INDUCED INJURY 39. Nelson LE, Lu J, Guo T, Saper CB, Franks NP, Maze M: The sedative component of anesthesia is mediated by GABA(A) receptors in an endogenous sleep pathway. Nat Neurosci 2002; 5:979–84 combination of N-methyl-D-Aspartate and gamma-aminobutyric acid type A re- ceptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioural deficits. ANESTHESIOLOGY 2007; 107:427–36 40. Wei H, Kang B, Wei W, Liang G, Meng QC, Li Y, Eckenhoff RG: Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently. Brain Res 2005; 1037:139–47 41. Satomoto M, Satoh Y, Terui K, Imaki J: Inhaled sevoflurane induces apoptosis in the developing brain and behavioural abnormality in mice (abstract). ANESTHESIOLOGY 2008; 109:A26 42. Marrs W, Kuperman J, Avedian T, Roth RH, Jentsch JD: Alpha-2 adreno- ceptor activation inhibits phencyclidine-induced deficits of spatial working mem- ory in rats. Neuropsychopharmacology 2005; 30:1500–10 46. Dobbing J, Sands J: Comparative aspects of the brain growth spurt. Early Hum Dev 1979; 3:79–83 47. Sanders RD, Ma D, Brooks P, Maze M: Balancing paediatric anaesthesia: Preclinical insights into analgesia, hypnosis, neuroprotection and neurotoxicity. Br J Anaesth 2008; 101:597–609 48. Anand KJS, Hickey PR: Pain and its effects in the human neonate and fetus. N Engl J Med 1987; 317:1321–29 49. Porter FL, Grunau RE, Anand KJ: Long-term effects of pain in infants. J Dev 43. Nagata A, Nakao Si S, Nishizawa N, Masuzawa M, Inada T, Murao K, Miyamoto E, Shingu K: Xenon inhibits but N(2)O enhances ketamine-induced c-Fos expression in the rat posterior cingulate and retrosplenial cortices. Anesth Analg 2001; 92:362–8 44. Rajakumaraswamy N, Ma D, Hossain M, Sanders RD, Franks NP, Maze M: Neuroprotective interaction produced by xenon and dexmedetomidine on in vitro and in vivo neuronal injury models. Neurosci Lett 2006; 409:128–33 45. Fredriksson A, Ponten E, Gordh T, Eriksson P: Neonatal exposure to a Behav Pediatr 1999; 20:253–61 50. Taddio A, Katz J, Ilersich AL, Koren G: Effect of neonatal circumcision on pain response during subsequent routine vaccination. Lancet 1997; 349:599–603 51. Sanders RD, Maze M: Alpha2-adrenoceptor agonists. Curr Opin Investig Drugs 2007; 8:25–33 52. Bergendahl H, Lonnqvist PA, Eksborg S: Clonidine: An alternative to benzodiazepines for premedication in children. Curr Opin Anaesthesiol 2005; 18:608–13 Anesthesiology, V 110, No 5, May 2009 1085",both,"['Isoflurane-induced injury was provoked in organotypic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine.', 'Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups']",postnatal day 7,['Isoflurane-induced injury was provoked in organotypic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine.'],Y,['Cognitive function was assessed in vivo on postnatal day 40 using fear conditioning.'],isoflurane,['Isoflurane-induced injury was provoked in organotypic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine.'],dexmedetomidine,['Isoflurane-induced injury was provoked in organotypic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine.'],sprague dawley,"['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber']",The study investigates whether dexmedetomidine can provide functional protection against isoflurane-induced neurocognitive impairment.,"['As 2 adrenoceptor signaling plays a trophic role during development and is neuroprotective in several settings of neuronal injury, the authors investigated whether dexmedetomidine could provide functional protection against isoflurane-induced injury.']",Use of organotypic hippocampal slice cultures and in vivo models to assess isoflurane-induced injury and the protective effect of dexmedetomidine.,['Isoflurane-induced injury was provoked in organotypic hippocampal slice cultures in vitro or in vivo in postnatal day 7 rats by a 6-h exposure to 0.75% isoflurane with or without dexmedetomidine.'],"Dexmedetomidine attenuates isoflurane-induced injury in the developing brain, providing neurocognitive protection.","['Dexmedetomidine attenuates isoflurane-induced injury in the developing brain, providing neurocognitive protection.']",The study does not fully explore the mechanisms behind dexmedetomidine's protective effects and its potential side effects at high doses.,"['Although dexmedetomidine could also attenuate isoflurane-induced neuroapoptosis in organotypic hippocampal slice cultures, gabazine did not modify this neuroapoptosis.']","If anesthetic-induced neuroapoptosis is a clinical problem, administration of dexmedetomidine may be an important adjunct to prevent isoflurane-induced neurotoxicity.","['If isoflurane-induced neuroapoptosis proves to be a clinical problem, administration of dexmedetomidine may be an important adjunct to prevent isoflurane-induced neurotoxicity.']",False,True,False,True,False,True,10.1097/ALN.0b013e31819daedd 10.18632/oncotarget.15405,1027.0,Li,2017,rats,gestational day 14,Y,ketamine,none,wistar,"Research Paper: Neuroscience Ketamine administered pregnant rats impair learning and memory in offspring via the CREB pathway Xinran Li1, Cen Guo1, Yanan Li1, Lina Li1, Yuxin Wang1, Yiming Zhang1, Yue Li1, Yu Chen1, Wenhan Liu1 and Li Gao1 1 College of Veterinary Medicine, Northeast Agricultural University, Harbin, China Correspondence to: Li Gao, email: gaoli43450@163.com Keywords: CREB pathway, ketamine, learning and memory, pregnant rats, rat offspring, Neuroscience Received: December 21, 2016 Accepted: January 27, 2017 Published: February 16, 2017 Copyright: Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Ketamine has been reported to impair the capacity for learning and memory. This study examined whether these capacities were also altered in the offspring and investigated the role of the CREB signaling pathway in pregnant rats, subjected to ketamine-induced anesthesia. On the 14th day of gestation (P14), female rats were anesthetized for 3 h via intravenous ketamine injection (200 mg/Kg). Morris water maze task, contextual and cued fear conditioning, and olfactory tasks were executed between the 25th to 30th day after birth (B25-30) on rat pups, and rats were sacrificed on B30. Nerve density and dendritic spine density were examined via Nissl’s and Golgi staining. Simultaneously, the contents of Ca2+/Calmodulin-Dependent Protein Kinase II (CaMKII), p-CaMKII, CaMKIV, p-CaMKIV, Extracellular Regulated Protein Kinases (ERK), p-ERK, Protein Kinase A (PKA), p-PKA, cAMP-Response Element Binding Protein (CREB), p-CREB, and Brain Derived Neurotrophic Factor (BDNF) were detected in the hippocampus. We pretreated PC12 cells with both PKA inhibitor (H89) and ERK inhibitor (SCH772984), thus detecting levels of ERK, p-ERK, PKA, p-PKA, p-CREB, and BDNF. The results revealed that ketamine impaired the learning ability and spatial as well as conditioned memory in the offspring, and significantly decreased the protein levels of ERK, p-ERK, PKA, p-PKA, p-CREB, and BDNF. We found that ERK and PKA (but not CaMKII or CaMKIV) have the ability to regulate the CREB-BDNF pathway during ketamine-induced anesthesia in pregnant rats. Furthermore, ERK and PKA are mutually compensatory for the regulation of the CREB-BDNF pathway. INTRODUCTION Ketamine abuse causes more severe problems during pregnancy [1]. In addition, between 0.75% and 2% of pregnant women require surgery either related to the pregnancy or to unrelated medical problems [2]. Furthermore, with the popularity of minimally invasive surgery, surgery during pregnancy has become increasingly widespread [3]. Therefore, the risks of anesthetic administration (such as ketamine) for the fetus have become more important. Unfortunately, only few reports investigated the effects of generally utilized anesthesia on neurodevelopmental consequences for a fetus prior to birth [4-6]. It is well known that the hippocampus plays a central role for learning and memory processes [7], and consequently, this is a known target for drug regulation. Ketamine is a high affinity uncompetitive antagonist of voltage dependent N-Methyl-D-aspartic Acid Receptor (NMDAR) and has been used for decades as a dissociative anesthetic that also appears to be a useful tool in psychiatric research [8]. Ketamine can attenuate learning and memory impairment, particularly for short- term memory [9]. The cAMP-Response Element Binding Protein (CREB) has been reported to be involved in the learning and memory deficits, caused by ketamine [10]. Ketamine can enter the fetus through the placental barrier, where it may exert a stronger impact on the fetus since the fetal brain is still in a stage of development. Even normal use of ketamine may affect the fetus. Therefore, this study examined whether the abilities of learning and memory were altered in the offspring as well as the 32433 ketamine-induced effect on CREB signaling pathways in ketamine-induced pregnant rats on gestational day 14. Morris water maze test RESULTS Nissl’s staining We selected three 104 μm2 areas to conduct a neuron count in both the CA1 (Figure 2c-2d) and CA3 (Figure 2e- 2f) regions of the hippocampus. As shown in Figure 2a-2g, the cell density of K group decreased by 20.5% compared to C group (p < 0.05). Morris water maze test data revealed that rat pups had suffered from a significant main effect on escape latency during spatial training on testing days 2-3 (Figure 4a). In contrast, the escape latency did not reveal any significant differences between the C group and the K group during place navigation trials on day 4-5 (p = 0.223) and spatial probe tests (p = 0.062, Figure 4b). It is worth noting that no significant differences in animals’ swimming speeds were detected (C group: 25.00 ± 1.96 cm/s and K group: 26.00 ± 1.33 cm/s, according to a one- way ANOVA: F = 0.191, p = 0.827) between the C and K group (Figure 4c-4d). Golgi staining Contextual and cued fear conditioning Fully impregnated CA1 pyramidal cells can be detected via Golgi staining, and the spines of the apical dendrites can be analyzed under a light microscope using a 200 × oil immersion objective. We randomly selected 10 μm apical (Figure 3a-3b) and basal (Figure 3c-3d) from the same neurological level to count the number of dendritic spines. Only the density of apical and basal dendrites was determined in our study, as several different types of spines were not always clearly visible (e.g., thin, mushroom, or branched dendrites). Spine density decreased by 21.6% in the K group compared to the C group (P < 0.05, Figure 3g). Contextual and cued fear conditioning is a standard fear conditioning task that measures the ability of rat pups to learn and remember an association between an averse experience and environmental cues. In contextual and cued fear conditioning, a significant difference was found in CS (p < 0.05), while no significant difference was found between K and C group in other tests (Figure 5b). Olfactory tasks As shown in Figure 6b, during the acquisition stage, no significant differences were found in the investigation time of Hole 1 and Hole 2, indicating that rats had no Figure 1: Mating and drug administration. The Vaginal suppository (b) and sperm (c) were observed and female rats were defined as pregnant at day 0 (P0). Female rats were anesthetized via intravenous ketamine injection on P14. The first day after birth was recorded as B0. During B25-B30, behavioral testing was utilized to test the learning and memory capacities (a). 32434 Figure 2: Nissl’s staining was utilized to observe neuronal cells. a. and b. Areas of 104 μm2 were selected and neuron numbers were counted in the CA1 c. and d. and CA3 e. and f. regions of the hippocampus. g. Cells within K group decreased compared to C group (p < 0.05). 32435 Figure 3: Golgi staining revealed hippocampal dendritic spine density. 10 μm of apical a. and b. and basal c. and d. dendrites were randomly selected from each pyramidal neuron for inspection (via 200 × oil immersion lens) to quantify spinal density. e. Spinal density decreased by 21.6% in K group compared to C group (p < 0.05). 32436 Table 1: Results of CCK-8 test Concentration of ketamine (μg/mL) Cell viability 1 17% 0.9 34% 0.8 39% 0.7 43% 0.6 49% 0.5 53% 0.4 64% 0.3 75% 0.2 76% specific preference for carvone or limonene. During the recall stage, no significant differences were found in the investigation time of novel odor between K group and C group. Ketamine exposure affects protein expression in the hippocampus Results of the CCK-8 test To evaluate the optimum concentration of ketamine for PC12 cells, a CCK8 assay was performed. PC12 cells were exposed to ketamine at different concentrations (0.2 μg/mL, 0.3 μg/mL, 0.4 μg/mL, 0.5 μg/mL, 0.6 μg/ mL, 0.7 μg/mL, 0.8 μg/mL, 0.9 μg/mL, 1μg/mL) for 3 h. According to Table 1, the 50% cell viability of ketamine for PC12 cells was 0.6 μg/mL. To examine whether ketamine treatment has the ability to alter the protein expression of learning and memory related proteins, we measured protein levels of CaMKII, p-CaMKII, CaMKIV, p-CaMKIV, ERK, p-ERK, PKA, p-PKA, p-CREB, and BDNF in the rat hippocampus. As shown in Figure 7 and in comparison to the values of each corresponding C group, no significant difference was found in the protein levels of CaMKII, p-CaMKII, CaMKIV, and p-CaMKIV. However, the protein levels of ERK, p-ERK, PKA, p-PKA, p-CREB, and BDNF had significantly decreased (p < 0.05) to 91.6%, 71.1%, 74.5%, 92.5%, 67.4%, and 64.2% of their original values, respectively, while the CREB protein level significantly increased (p < 0.05) to 129% (Figure 8). Figure 4: To test hippocampus-dependent spatial cognition, rats were trained in the standard morris water maze. Rat pups showed significant main effects in their escape latency during spatial training during testing days 2-3 a. During the 60 s probe trial, we recorded and analyzed the swimming path tracks c. and d.; however, no significant differences were detected in the spatial probe test b. 32437 Figure 5: Contextual and cued fear conditioning is a fear conditioning task that measures the ability of a rat to learn and remember an association between an aversive experience and environmental cues. a. Experimental process of contextual and cued fear conditioning. b. A significant difference was found in CS between K and C group. 32438 Ketamine exposure affects protein expression in PC12 cells No significant difference was found between C and D group. Compared to C group, the protein levels of ERK, p-ERK, PKA, p-PKA, CREB, p-CREB, and BDNF decreased significantly (p < 0.05): p-ERK decreased to 70.9% in S group (p < 0.05), p-PKA decreased to 74.4% in H group (p < 0.05), and the protein levels of p-ERK, Figure 6: Olfactory discrimination tasks are excellent measures of learning and memory in rats. The acquisition test (one session) consisted of presentation of one odor (limonene or carvone), presented in both holes. The recall test consisted of a 3 min session in which one hole was odorized with the previously presented odor, while the other hole with a novel odor (a). There was no significant difference in the investigation time of novel odor between K group and C group (b). 32439 p-PKA, p-CREB, and BDNF decreased to 53.7%, 68.1%, 72.7%, and 66.1% (p < 0.05). The protein levels of p-ERK decreased by 24.3% in S+H group compared to S group, while the p-PKA protein levels decreased by 8.5% in S+H group compared to H group (Figure 9). DISCUSSION The morris water maze task, contextual and cued fear conditioning, and olfactory tasks enable the evaluation of learning and memory of spatial, conditioned, and odor cues in rat pups (Figure 4-6). Nerve density and dendritic spine density decreased, which all influenced the nerve conduction efficiency as well as learning ability and memory capacity [6, 11]. However, during the anaesthetization process, anesthetic stress, oxygen saturation, gastrointestinal tract squeezing the uterus, change of placental blood flow, supine position, oppressing blood vessels, and other factors all impact on fetal rats. To exclude these effects from our analysis, we cultured PC12 cells, exploring the effect of ketamine on the CREB pathway. The prevalence of substance abuse in pregnant women is similar to that of the general population, resulting in an increased fetal exposure rate during the most vulnerable period of neurodevelopment and organogenesis. Many pregnant women are exposed to various types of anesthetics for surgery or diagnostic procedures every year. Furthermore, numerous women will also undergo surgery during pregnancy, unrelated to childbirth. Consensus is that fetal exposure to alcohol is harmful. Prenatal alcohol exposure may induce abnormal brain development as well as decrease the capacity for learning and memory [12, 13]. Similar to alcohol, anticonvulsants, sedatives (such as ketamine), or narcotics can pass through the placental barrier and for ketamine in particular, researches showed its ability to impair the capacity for learning and memory [14, 15]. Evidence links early exposure to anesthesia with cognitive impairment [16]. In addition, ketamine is also one of the most commonly used drugs in pediatric clinical anesthesia and its reported influence on learning and memory has always been of clinical concern. Moreover, ketamine is a frequently abuse drug in the public, which Figure 7: Ketamine exposure affects protein expression in the hippocampus. No signifcant difference was found in the protein levels of CaMKII. a., p-CaMKII b., CaMKIV c., and p-CaMKIV d. 32440 includes pregnant women [17]. Zhang et al. suggests that repeated ketamine exposure induced long-term cognitive impairment via increased NOX2 [18]. Experimental evidence indicates that the NMDAR antagonist ketamine impairs cognition [19]. Prolonged ketamine exposure in neonates at anesthetic doses has been reported to cause long-term impairments of learning and memory [20]. Furthermore, ketamine decreased p-CREB in the hippocampus [21, 22], and decreased levels of BDNF [23]. CREB has been demonstrated to be involved in learning and memory deficits caused by ketamine [10, 22]. These findings raise concern about potential adverse effects of ketamine exposure to fetuses and infants. In our study, the ratio of P-CREB/total CREB was decreased in the rat hippocampus. The function of CREB is dominantly regulated by phosphorylation at Ser133, which results in the activation of gene transcription [24]. The Phosphorylated CREB protein recruits the transcriptional activator CREB-binding protein (CBP), thus stimulating the transcription of CRE-regulated genes that are involved in neurogenesis and neuritogenesis [25]. We therefore hypothesize that P-CREB may be responsible for compensatory increases in CREB protein levels; however, further testing is required to confirm this hypothesis. p-CREB promotes immediate early genes such as the c-fos gene via interaction with the CRE sequence located within promotor regions (TGACGTCA) [26]. Genetic deletion of CREB selectively impaired the hippocampus-dependent spatial memory of mice subjected to the Morris water maze [27], which coincided with our results. Furthermore, CREB phosphorylation is a necessary step in the process leading to the generation of new dendritic spines [27]. In addition, the cAMP–CREB signaling cascade is critical for the generation of new neurons in the rodent hippocampus, also facilitating their subsequent morphological maturation [28]. Several findings have shown that the dysregulation of involved in cognitive impairment [29]. The neurons of the hippocampus of aged animals showed a down-regulation of BDNF and p-CREB expression, associated with learning and memory impairment [30, 31], which was also similar with our result. In this study, BDNF and p-CREB revealed the same tendency (Figure 9g-9h). BDNF has also been reported to elicit rapid action potentials, thus influencing neuronal excitability, and it has a demonstrated role in activity-dependent synaptic plasticity events such as long-term potentiation, learning tasks, and memory [32, 33]. BDNF is involved in structural remodeling, neuronal plasticity, and synaptic restructuring [34, 35]. Several signaling pathways, the CREB-BDNF cascade has been those involving CaMKII, CaMKIV, ERK, and PKA, have been associated with the regulation of de novo protein synthesis in the context of synaptic plasticity, converging on the phosphorylation of CREB at Ser133 residue (Figure 10). It is generally accepted that ketamine blocks NMDAR, thus mediating the neurotransmission of postsynaptic receptors [36]. NMDAR in turn mediates the release of neurotransmitters (such as acetylcholine, dopamine, GABA, and NE), and regulates the levels of sodium and including Figure 8: Ketamine exposure affects protein expression in the hippocampus. Protein levels of ERK a., p-ERK b., PKA c., p-PKA d., p-CREB f., and BDNF g. signifcantly decreased in the hippocampus (p < 0.05) to 91.6%, 71.1%, 74.5%, 92.5%, 67.4%, and 64.2%, of their initial values, while the CREB e. protein level signifcantly increased to 129%.. 32441 calcium. The increased association between CaMK II and CREB, followed by phosphorylation of CREB in response to Wnt5a stimulation was suppressed in a minimal hepatic encephalopathy rat model [37]. Ca2+ signaling not only plays a critical role in regulating apoptosis and autophagy [38], but also affects CREB phosphorylation. Cohen reported that CREB phosphorylation also proceeds with slow, sigmoid kinetics, that are rate-limited due to the paucity of CaMKIV, protecting against saturation of phospho-CREB as a response to increased firing rates and elevated Ca2+ transients [39]. Interestingly, no significance was found in the protein levels of CaMKII, p-CaMKII, CaMKIV, and p-CaMKIV in rat pups (Figure 7). Liu’s research demonstrated that low-intensity pulsed ultrasound increased the intracellular concentration of calcium and enhanced protein levels of CaMKII and CaMKIV; however, it did not promote the activation of CREB [40]. CaMKII was markedly decreased following a stress-priming methamphetamine-induced conditioned place preference reinstatement test; however, p-CREB expressions in the medial prefrontal cortex were increased [41]. Guo reported that ERK and CREB phosphorylation was not mediated by CaMK [42]. Therefore, we speculate here that the effect of ketamine on CaMKII and CaMKIV can only be sustained within a window of time following anesthesia. Consequently, it did not have long-term effects on neurodevelopment, but a proving experiment is still required. To explore whether ERK or PKA influence the phosphorylation of CREB, we cultured PC12 with both a ERK and a PKA inhibitor (SCH772984 and H89). PKA phosphorylates and activates CREB, which then Figure 9: Ketamine exposure affects protein expression in PC12 cells. C: Control group; D: D group, DMSO (solvent of inhibitors); K: K group, ketamine; S: S group, SCH772984 (ERK inhibitor); H: H group, H89 (PKA inhibitor); S+H: S+H group (PKA inhibitor + ERK inhibitor). a. No significant difference was found between C and D group. Compared to the C group, the protein levels of ERK b., p-ERK c., PKA d., p-PKA e., CREB f., p-CREB g., and BDNF h. decreased significantly (p < 0.05). 32442 binds to the CRE domain on DNA and in turn activates genes that are involved in the process of learning and memorization; however, ketamine inhibits this process [10]. N-acetylserotonin appears to partly restore the ketamine-induced decrease of ERK and BDNF to control levels [43]. Phosphorylation of CREB at Ser133 can be catalyzed via a number of protein kinases, including cAMP-dependent PKA [44]. The ERK1/2 are members of the mitogen activated protein kinase (MAPK) family and are necessary for cell growth, differentiation, survival, molecular information processing, and stabilization of structural changes in dendritic spines [45, 46]. When treated with SCH772984 or H89 alone, no change in the protein levels of p-CREB and BDNF were observed; however, these decreased when treated with the SCH772984 or H89 (Figure 9g-9h). This explains how ERK and PKA can regulate the phosphorylation of CREB. Furthermore, when ERK or PKA do not participate in this process, ERK and PKA have the ability to replace each other, thus independently regulating the phosphorylation of CREB. Lin identified the involvement of cAMP/PKA and ERK dependent CREB signaling pathways in the luteolin-mediated miR-132 expression and neuritogenesis of PC12 cells [47]. Won demonstrated that DA-9801 exerts its beneficial effects of stimulating neurite outgrowth through the ERK1/2-CREB pathway Figure 10: CREB pathway. Several signaling pathways, including those involving ERK, and PKA have been associated with the regulation of de novo protein synthesis in the context of synaptic plasticity, converging on the phosphorylation of CREB at Ser133 residue. 32443 in PC12 cells [48]. Behavioral analyses of animals with altered ERK signaling have revealed a central involvement of this cascade in learning and memory [49], and it has been reported that ERK activity was decreased in dentate gyrus of aged rats, which did not sustain LTP [50, 51]. Coccomyxa gloeobotrydiformis (CGD) significantly increased ERK and CREB phosphorylation in the hippocampus, suggesting that the learning and memory- enhancing effects of CGD might be associated with the ERK/CREB pathway [52]. Li et al. reported that pretreatment with resveratrol effectively restored synaptic plasticity in chronic cerebral hypoperfusion rats both functional and structural via PKA-CREB activation [28]. The levels of PKA and cAMP were increased in the rat hippocampus following a step-down inhibitory avoidance task [53]. Furthermore, transgenic mice with the inhibitory regulatory subunit of PKA were impaired in their long- term memory abilities due to contextual fear conditioning [54]. as C group. The first day after birth was recorded as B0. During B25-B30, Morris water maze task, contextual and cued fear conditioning, and olfactory tasks were used to test learning and memory capacity (n = 120, 5/dam, Figure 1). Sample collections Rat pups were sacrificed at B30 via cervical dislocation, and were recovered to collect brain tissue for Nissl staining (n = 24, 1/dam), Golgi staining (n = 24, 1/ dam), and western blotting (n = 72, 3/dam). A subset of their hippocampuses were quickly dispensed on ice, put into a freezing tube, and frozen in liquid nitrogen, while other tissues were preserved in 10% formalin. Nissl’s staining In summary, the present study investigated learning as well as spatial and conditioned memory of rat pups, following ketamine anesthesia during pregnancy. Moreover, ERK and PKA, but not CaMKII or CaMKIV, can regulate the CREB-BDNF pathway in this animal model. Furthermore, ERK and PKA in the regulation of CREB-BDNF pathway are mutually compensating. MATERIALS AND METHODS Coronal brain sections were cut in a vibratome (Leica VT1200S, Germany) after the brains were postfixed in the same fixative. To ensure matching of hippocampal sections between groups, we used anatomical landmarks provided by the brain atlas. The selected brain sections were stained with 0.5% cresyl violet and we selected three 104 μm2 areas for examination with a light microscope (Leica DFC420, Germany) to count neuron numbers in the CA1 and CA3 regions of the hippocampus. Golgi staining Animals Male and female Wistar rats, three months of age, weighing 200 ± 20 g, were purchased from the Animal Experimental Center of the Second Affiliated Hospital of the Harbin Medical University (Harbin, China). Prior to the experiment, rats were quarantined for two weeks at the Northeast Agricultural University (Harbin, China). All experiments were performed in accordance with the guidelines outlined by the Ethical Committee for Animal Experiments (Northeast Agricultural University, Harbin, China). Mating and drug administration Thirty-six Wistar rats were divided into 12 cages (one male and two females per cage) with an iron mesh at the bottom. On the next morning the vaginal suppository was investigated through the iron mesh. When sperm was detected, female rats were annotated as pregnant at day 0 (P0). The female rats were anesthetized via intravenous ketamine injection (200 mg/Kg) for 3 h on P14 [55]. The total volume of ketamine stayed below 2 mL/100 mg. Ketamine-treated offspring were recorded as K group, while individuals within the control group were recorded to obtain hippocampal dendritic spine density via the FD Rapid GolgiStainTM Kit (FD Neuro Technologies Inc), following instructions. Coronal tissue sections of 150 μm thickness were cut at room temperature, using a vibratome (Leica VT1200S, Germany) and then, they were put on gelatin coated slides. Subsequently, slides were dehydrated with a gradient of 50%, 75%, 95%, to 100% ethanol and cleared in xylene, then the specimens were prepared with slide coverslips and sealed with Permount. The slides were then examined in detail with a light microscope (Leica DFC420, Germany). We analyzed the stained spine, using techniques similar to those described in previous study [56]. Five pyramidal neurons were analyzed that were well-impregnated and clearly distinguishable from others in each hippocampus (20 × objective lens). Five segments of 10 μm of apical and basal dendrites respectively, were randomly selected from each pyramidal neuron for inspection (via 200 × oil immersion lens) to quantify the density of spines. Spinal density of secondary apical and basal dendrites was analyzed at proximal segments emerging at more than 50 μm distance from the soma of the hippocampal CA1 neurons. All of these spines were required to exhibit a Golgi-Cox staining was utilized the manufacturer’s 32444 clearly distinguishable base or origin and were isolated from neighboring dendrites. Spine density was calculated per 10 μm of dendritic length. The open-source ImageJ 1.48 r Java image-viewing software and Adobe Photoshop CC 2015 were used to calibrate the scale and enlarge the segments of the spines. An investigator blinded to the experimental condition completed all analyses. Morris water maze test illuminated. During the last seconds of the auditory signal, an unconditioned aversive stimulus, a mild footshock in the range of 0.25 to 0.5 mA, was administered through the grid floor for 2 sec. The number of seconds spent freezing in the test chamber on the training day was considered the control measure of unconditioned fear. The rat pup was left in the conditioning chamber for 1 min after the last pairing, during which the association between the aversive stimulus and the properties of the conditioning chamber was further established. The rat pup was then returned to its home cage. Place navigation trials To test hippocampal-dependent spatial cognition, rats were trained in the standard morris water maze with a hidden platform [57]. A white escape platform (12 cm diameter) was submerged in a circular pool (160 cm diameter, at a 50 cm depth), filled with warm (23–25 °C) opaque water. At B25-29, each rat pup underwent four trial sessions per day (60–70 min inter-trial interval) for five consecutive days. Each trial consisted of releasing the rat into the water, facing the outer edge of the pool at one of the quadrants (in random sequence) and permitting the animal to escape to the platform. They received four trials per day of training in search for the submerged and unmarked platform, with trial durations of 60 s on the platform at the end of trials. All trials were videotaped, and the swimming paths of rats were recorded with the ANY- maze video tracking system (Stoelting Co., IL, USA), which enabled us to measure the time taken (latency) to find the platform (s), as well as other behavioral information obtained during this spatial reference memory test. The animals were dried and placed beneath a heating lamp after completion of each test. Spatial probe test Testing on day 2 began approximately 24 hours after the conditioning session. The rat pup was returned to the same conditioning chamber and scored for bouts of freezing behavior. No footshock was administered on day two. The number of seconds spent freezing in the identical test chamber on day two was considered the measure of contextually conditioned fear, i.e., freezing within identical context. Freezing was defined as a lack of movement other than respiration. Presence or absence of freezing behavior was generally recorded by an investigator, who was blinded to the experimental condition, taking a note every 10 sec for 5 min, for a maximum total score of 30 freezing bouts. The rat pup was then returned to its home cage. The second phase of testing began an hour later. A further testing chamber with very different properties provided the altered context. Changing the sensory cues as much as possible was essential so that the rat pup perceives the novel context as unrelated to the conditioning chamber. Such as triangle-shaped test chamber with different lighting was used and lemon juice was painted on the walls, while a different investigator wore gloves and a lab coat of different texture than on the training day. Freezing behavior was scored for 3 min. Contextual discrimination of fear conditioning was quantified by comparing the number of freezing bouts in the same contextual environment to the number of freezing bouts in the novel contextual environment. A probe trial was performed 1 d after the last trial at B30 where the platform was removed from the pool to assess memory retention for the location of the platform. During the 60 s test trial, we recorded and analyzed the swimming speed (cm/s), the swimming path tracks, and the number of entries into the platform quadrant zone. Contextual and cued fear conditioning At the end of the first 3 min, the tone that was presented on training day one (was well as the light stimulus cue if used on day one) was presented in the novel context environment. Freezing behavior was scored for the next 3 min in the presence of the sound (and light) cues. Cued conditioning was calculated via comparison of the number of freezing bouts in the novel context environment in the presence of the cue with the number of freezing bouts in the novel context environment in the absence of the cue (Figure 5a). Conditioning training on day one consisted of placing the rat pups in the chamber and exposing the animals to a mild footshock paired with an auditory cue. The rat pup was brought from the home cage to the testing room and placed into the conditioning chamber. It had 3 min to explore the novel environment. The auditory cue (a 90 dB tone) was sounded for approximately 30 sec. A stimulus light within the wall of the chamber may also be Olfactory task This task was designed to investigate the olfactory learning and memory abilities [58]. For this experiment, two holes (3 cm diameter and 4.5 cm deep) were used. A polypropylene swab, embedded in a fine plastic mesh and containing 20 µL of diluted odors (1:10) was placed at 32445 the bottom of each hole and covered with wood shavings. The acquisition test (one session) consisted of one odor (either limonene or carvone, Sigma-Aldrich) being presented in both holes for a 5 min period. In a preliminary experiment, with simultaneous presentation of the same pair of odors (one odor in each hole) in a one-trial test, rat pups spent the same amount of time exploring either hole, indicating no preference for one of the two odors. The recall test consisted of a 3 min session in which one hole was odorized with the previously presented odor, while the other hole was odorized with a new odor (Figure 6a). The delay between acquisition and recall tests was 60 min. During the recall test, the cumulated exploration time of each hole was converted as the percentage of the total exploration time of both holes. Rat pups were considered to have remembered the familiar odor when they spent less time exploring the hole containing it, in relation to the time spent exploring the hole containing the new odor. Equal exploration times for both holes during the recall test were considered to indicate that rat pup did not remember the familiar odor. Both odors were used alternatively during acquisition or recall and presented randomly in each of the two holes to avoid place preference bias (Figure 6a). WB 150 µg of protein were separated via 10% SDS- polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane (HybondTM-C Extra, GE Healthcare) via electroblotting. After washing, membranes were blocked with 3% (w/v) BSA (biotopped) for 4 h at room temperature and incubated overnight at 4 °C in BSA with antibodies that are specific for Ca2+/Calmodulin- Dependent Protein Kinase II (CaMKII), p-CaMKII, CaMKIV, p-CaMKIV, ERK, p-ERK, PKA, CREB, p-CREB (1.5:1000, EnoGene), p-PKA, and Brain Derived Neurotrophic Factor (BDNF, 1:1000, abcam). Membranes were washed thrice with PBS containing 0.1% Tween and then incubated for 1 h at room temperature either with a horseradish peroxidase-conjugated secondary antibody (Goat anti-Rabbit IgG Antibody HRP (ABIN) or a goat anti-Mouse IgG Antibody HRP (Sigma)) in BSA. Data analysis Cell culture and drug treatment PC12 cells were obtained from the Northeast Agricultural University, Harbin, China. The cells were cultured in DMEM medium (Gibco), supplemented with 10% (v/v) FBS, penicillin/streptomycin (100 U/mL; 100 μg/mL) at 37 °C under an atmosphere of 5% CO2 and 95% air. The cells were seeded in 6-well plates with 2-9 × 105 cells/well or 96-well plates with 2-9 × 104 cells/well, and the culture medium was changed daily. Cells were pretreated for 3 h with Protein Kinase A (PKA) inhibitor (H89, 10 μM, H group), Extracellular Regulated Protein Kinases (ERK) inhibitor (SCH772984, 10 μM, S group), PKA inhibitor + ERK inhibitor (S+H group), DMSO (solvent of inhibitors, D group), and ketamine (K group). All data were analyzed with GraphPad Prism 7.0 (GraphPad Software Inc., USA) via one-way ANOVA, followed by Turkey’s Post Hoc test or unpaired two-tailed Student t-test. Values were considered to be statistically significant for P < 0.05. Data are presented as means ± standard deviation unless otherwise noted. Authors contribution XL and LG designed the study. XL, CG, and LG designed the behavioral testing. XL, CG, YL, LL, XW, and YZ collected data for behavioral testing. XL, YL, YC, and WL processed the brain tissue. XL and YL collected and analyzed the data. XL, YL, and CG interpreted the data. XL wrote and edited the manuscript. All authors critically reviewed the content and approved the final version for publication. Cell counting kit-8 (CCK-8) assay ACKNOWLEDGMENTS Cell viability was detected via the CCK8 assay (Beyotime Institute of Biotechnology, Suzhou, Jiangsu, China). Following the indicated treatments, CCK8 solution (10 μl) was added to each well (96-well plates). Then, the cells were cultured at 37 °C for one further hour. The optical density of each well was measured at 450 nm with a Bio-Tek microplate reader (Bio-Tek Instruments, Thermo Fisher Scientific, Winooski, VT). This study was supported by the National Natural Science Foundation of China (31572580 and 31372491). CONFLICTS OF INTEREST There is no conflict of interest. REFERENCES 1. Rofael HZ, Turkall RM, Abdel-Rahman MS. Immunomodulation by cocaine and ketamine in postnatal rats. Toxicology. 2003; 188: 101-14. doi: 10.1016/S0300- 483X(03)00081-7. 32446 2. Goodman S. Anesthesia for nonobstetric surgery in the pregnant patient. Seminars in perinatology. 2002; 26: 136- 45. dio: 10.1053/sper.2002.32203. Fulton S, Parrott AC. Motor delays in MDMA (ecstasy) exposed infants persist to 2 years. Neurotoxicol Teratol. 2016; 54: 22-8. doi: 10.1016/j.ntt.2016.01.003. 3. Cheek TG, Baird E. Anesthesia for nonobstetric surgery: maternal and fetal considerations. Clinical obstetrics and gynecology. 2009; 52: 535-45. doi: 10.1097/ GRF.0b013e3181c11f60. 14. Zhang YH, Zhang J, Song JN, Xu X, Cai JS, Zhou Y, Gao JG. The PI3K-AKT-mTOR pathway activates recovery from general anesthesia. Oncotarget. 2016; 7: 40939-52. doi: 10.18632/oncotarget.10172. 4. Kong FJ, Ma LL, Hu WW, Wang WN, Lu HS, Chen SP. Fetal exposure to high isoflurane concentration induces postnatal memory and learning deficits in rats. Biochemical pharmacology. 2012; 84: 558-63. doi: 10.1016/j. bcp.2012.06.001. 5. Zheng H, Dong Y, Xu Z, Crosby G, Culley DJ, Zhang Y, Xie Z. Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice. The Journal of the American Society of Anesthesiologists. 2013; 118: 516-26. doi: 10.1097/ALN.0b013e3182834d5d. 6. Zhao T, Li Y, Wei W, Savage S, Zhou L, Ma D. Ketamine administered to pregnant rats in the second trimester causes long-lasting behavioral disorders in offspring. Neurobiol Dis. 2014; 68: 145-55. doi: 10.1016/j.nbd.2014.02.009. 7. Squire LR. Memory and the hippocampus: a synthesis from findings with rats, monkeys, and humans. Psychol Rev. 1992; 99: 195-231. doi: org/10.1037/0033-295X.99.2.195. 15. Weed MR, Bookbinder M, Polino J, Keavy D, Cardinal RN, Simmermacher-Mayer J, Cometa FN, King D, Thangathirupathy S, Macor JE, Bristow LJ. Negative Allosteric Modulators Selective for The NR2B Subtype of The NMDA Receptor Impair Cognition in Multiple Domains. Neuropsychopharmacology. 2016; 41: 568-77. doi: 10.1038/npp.2015.184. 16. Wilder RT, Flick RP, Sprung J, Katusic SK, Barbaresi WJ, Mickelson C, Gleich SJ, Schroeder DR, Weaver AL, Warner DO. Early exposure to anesthesia and learning disabilities in a population-based birth cohort. Anesthesiology. 2009; 110: 796-804. doi: 10.1097/01. anes.0000344728.34332.5d. 17. Rofael HZ, Turkall RM, Abdel-Rahman MS. Immunomodulation by cocaine and ketamine in postnatal rats. Toxicology. 2003; 188: 101-14. doi: org/10.1016/ S0300-483X(03)00081-7. 8. Wang LQ, Liu SZ, Wen X, Wu D, Yin L, Fan Y, Wang Y, Chen WR, Chen P, Liu Y, Lu XL, Sun HL, Shou W, et al. Ketamine-mediated afferent-specific presynaptic transmission blocks in low-threshold and sex-specific subpopulation of myelinated Ah-type baroreceptor neurons of rats. Oncotarget. 2015; 6: 44108-22. doi: 10.18632/ oncotarget.6586. 9. Chen Q, Min S, Hao X, Peng L, Meng H, Luo Q, Chen J, Li X. Effect of Low Dose of Ketamine on Learning Memory Function in Patients Undergoing Electroconvulsive Therapy-A Randomized, Double-Blind, Controlled Clinical Study. The Journal of ECT. 2016. doi: 10.1097/ YCT.0000000000000365. 10. Peng S, Yang X, Liu GJ, Zhang XQ, Wang GL, Sun HY. From the camp pathway to search the ketamine-related learning and memory. Eur Rev Med Pharmacol Sci. 2015; 19: 161-4. WOS: 000352211700025. 18. Zhang H, Sun XR, Wang J, Zhang ZZ, Zhao HT, Li HH, Ji MH, Li KY, Yang JJ. Reactive Oxygen Species-mediated Loss of Phenotype of Parvalbumin Interneurons Contributes to Long-term Cognitive Impairments After Repeated Neonatal Ketamine Exposures. Neurotox Res. 2016; 30: 593-605. doi: 10.1007/s12640-016-9653-1. 19. Trevlopoulou A, Touzlatzi N, Pitsikas N. The nitric oxide donor sodium nitroprusside attenuates recognition memory deficits and social withdrawal produced by the NMDA receptor antagonist ketamine and induces anxiolytic-like behaviour in rats. Psychopharmacology (Berl). 2016; 233: 1045-54. doi: 10.1007/s00213-015-4181-x. 20. Stevens RA, Butler BD, Kokane SS, Womack AW, Lin Q. Neonatal inhibition of Na+-K+-2Cl—cotransporter prevents ketamine induced spatial learning and memory impairments. Neurotoxicol Teratol. 2016. doi: 10.1016/j. ntt.2016.11.001. 11. Tang X, Wu D, Gu LH, Nie BB, Qi XY, Wang YJ, Wu FF, Li XL, Bai F, Chen XC, Xu L, Ren QG, Zhang ZJ. Spatial learning and memory impairments are associated with increased neuronal activity in 5XFAD mouse as measured by manganese-enhanced magnetic resonance imaging. Oncotarget. 2016;7:57556-57570. doi: 10.18632/ oncotarget.11353. 21. Reus GZ, Abaleira HM, Titus SE, Arent CO, Michels M, da Luz JR, dos Santos MA, Carlessi AS, Matias BI, Bruchchen L, Steckert AV, Ceretta LB, Dal-Pizzol F, et al. Effects of ketamine administration on the phosphorylation levels of CREB and TrKB and on oxidative damage after infusion of MEK inhibitor. Pharmacol Rep. 2016; 68: 177-84. doi: 10.1016/j.pharep.2015.08.010. 12. Fish EW, Holloway HT, Rumple A, Baker LK, Wieczorek LA, Moy SS, Paniagua B, Parnell SE. Acute alcohol exposure during neurulation: Behavioral and brain structural consequences in adolescent C57BL/6J mice. Behav Brain Res. 2016; 311: 70-80. doi: 10.1016/j.bbr.2016.05.004. 22. Kempf SJ, Metaxas A, Ibanez-Vea M, Darvesh S, Finsen B, Larsen MR. An integrated proteomics approach shows synaptic plasticity changes in an APP/PS1 Alzheimer’s mouse model. Oncotarget. 2016; 7: 33627-48. doi: 10.18632/oncotarget.9092. 13. Singer LT, Moore DG, Min MO, Goodwin J, Turner JJ, 23. Liu WX, Wang J, Xie ZM, Xu N, Zhang GF, Jia M, Zhou ZQ, Hashimoto K, Yang JJ. Regulation of glutamate 32447 transporter 1 via BDNF-TrkB signaling plays a role in the anti-apoptotic and antidepressant effects of ketamine in chronic unpredictable stress model of depression. Psychopharmacology (Berl). 2016; 233: 405-15. doi: 10.1007/s00213-015-4128-2. 24. Montminy MR, Gonzalez GA, Yamamoto KK. Regulation of cAMP-inducible genes by CREB. Trends in neurosciences. 1990; 13: 184-8. doi: 10.1016/0166- 2236(90)90045-C. 35. Alonso M, Medina JH, Pozzo-Miller L. ERK1/2 activation is necessary for BDNF to increase dendritic spine density in hippocampal CA1 pyramidal neurons. Learning & Memory. 2004; 11: 172-8. doi: 10.1101/lm.67804. 36. Rodriguez-Munoz M, Sanchez-Blazquez P, Merlos M, Garzon-Nino J. Endocannabinoid control of glutamate therapeutic potential and NMDA consequences of dysfunction. Oncotarget. 2016; 7:55840- 55862. doi: 10.18632/oncotarget.10095. receptors: the 25. Spencer JP, Vauzour D, Rendeiro C. Flavonoids and cognition: the molecular mechanisms underlying their behavioural effects. Archives of biochemistry and biophysics. 2009; 492: 1-9. doi: 10.1016/j.abb.2009.10.003. 37. Ding S, Xu Z, Yang J, Liu L, Huang X, Wang X, Zhuge Q. The Involvement of the Decrease of Astrocytic Wnt5a in the Cognitive Decline in Minimal Hepatic Encephalopathy. Mol Neurobiol. 2016. doi: 10.1007/s12035-016-0216-5. 26. Berkowitz LA, Riabowol KT, Gilman MZ. Multiple sequence elements of a single functional class are required for cyclic AMP responsiveness of the mouse c-fos promoter. Mol Cell Biol. 1989; 9: 4272-81. doi: 10.1128/ MCB.9.10.4272. 38. Liu F, Li ZF, Wang ZY, Wang L. Role of subcellular in regulating apoptosis and calcium redistribution autophagy in cadmium-exposed primary rat proximal tubular cells. J Inorg Biochem. 2016; 164: 99-109. doi: 10.1016/j.jinorgbio.2016.09.005. 27. Bourtchuladze R, Frenguelli B, Blendy J, Cioffi D, Schutz G, Silva AJ. Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive element- binding protein. Cell. 1994; 79: 59-68. doi: 10.1016/0092- 8674(94)90400-6. 28. Li H, Wang J, Wang P, Rao Y, Chen L. Resveratrol Reverses the Synaptic Plasticity Deficits in a Chronic Cerebral Hypoperfusion Rat Model. J Stroke Cerebrovasc Dis. 2016; 25: 122-8. doi: 10.1016/j.jstrokecerebrovasdis.2015.09.004. 29. Zhao Y, Xiao M, He W, Cai Z. Minocycline upregulates cyclic AMP response element binding protein and brain- derived neurotrophic factor in the hippocampus of cerebral ischemia rats and improves behavioral deficits. Neuropsychiatr Dis Treat. 2015; 11: 507-16. doi: 10.2147/ NDT.S73836. 30. Lim YY, Villemagne VL, Laws SM, Ames D, Pietrzak RH, Ellis KA, Harrington KD, Bourgeat P, Salvado O, Darby D. BDNF Val66Met, Aβ amyloid, and cognitive decline in preclinical Alzheimer’s disease. Neurobiology of Aging. 2013; 34: 2457-64. doi: 10.1016/j. neurobiolaging.2013.05.006. 31. Guerrieri D, van Praag H. Exercise-mimetic AICAR transiently benefits brain function. Oncotarget. 2015; 6: 18293-313. doi: 10.18632/oncotarget.4715. 32. Nacmias B, Piccini C, Bagnoli S, Tedde A, Cellini E, Bracco L, Sorbi S. Brain-derived neurotrophic factor, apolipoprotein E genetic variants and cognitive performance in Alzheimer’s disease. Neuroscience letters. 2004; 367: 379-83. doi: 10.1016/j.neulet.2004.06.039. 33. Fossati P, Radtchenko A, Boyer P. Neuroplasticity: from MRI symptoms. European Neuropsychopharmacology. 2004; 14: S503-S10. doi: 10.1016/j.euroneuro.2004.09.001. to depressive 39. Cohen SM, Ma H, Kuchibhotla KV, Watson BO, Buzsaki G, Froemke RC, Tsien RW. Excitation-Transcription Coupling in Parvalbumin-Positive Interneurons Employs a Novel CaM Kinase-Dependent Pathway Distinct from Excitatory Neurons. Neuron. 2016; 90: 292-307. doi: 10.1016/j.neuron.2016.03.001. 40. Liu SH, Lai YL, Chen BL, Yang FY. Ultrasound Enhances the Expression of Brain-Derived Neurotrophic Factor in Astrocyte Through Activation of TrkB-Akt and Calcium- CaMK Signaling Pathways. Cereb Cortex. 2016. doi: 10.1093/cercor/bhw169. 41. Han WY, Du P, Fu SY, Wang F, Song M, Wu CF, Yang JY. Oxytocin via its receptor affects restraint stress-induced methamphetamine CPP reinstatement in mice: Involvement of the medial prefrontal cortex and dorsal hippocampus glutamatergic system. Pharmacol Biochem Behav. 2014; 119: 80-7. doi: 10.1016/j.pbb.2013.11.014. 42. Guo Y, Feng P. OX2R activation induces PKC-mediated ERK and CREB phosphorylation. Exp Cell Res. 2012; 318: 2004-13. doi: 10.1016/j.yexcr.2012.04.015. 43. Choudhury A, Singh S, Palit G, Shukla S, Ganguly S. Administration of N-acetylserotonin and melatonin alleviate chronic ketamine-induced behavioural phenotype accompanying BDNF-independent dependent converging cytoprotective mechanisms in the hippocampus. Behav Brain Res. 2016; 297: 204-12. doi: 10.1016/j. bbr.2015.10.027. and 44. Hagiwara M, Brindle P, Harootunian A, Armstrong R, Rivier J, Vale W, Tsien R, Montminy M. Coupling of hormonal stimulation and transcription via the cyclic AMP- responsive factor CREB is rate limited by nuclear entry of protein kinase A. Molecular and cellular biology. 1993; 13: 4852-9. doi: 10.1128/MCB.13.8.4852. 34. Duman R. Pathophysiology of depression: the concept of synaptic plasticity. European psychiatry. 2002; 17: 306-10. doi: 10.1016/S0924-9338(02)00654-5. 45. Ivanov A, Pellegrino C, Rama S, Dumalska I, Salyha Y, Ben-Ari Y, Medina I. Opposing role of synaptic and extrasynaptic NMDA receptors in regulation of the extracellular signal-regulated kinases (ERK) activity 32448 in cultured rat hippocampal neurons. The Journal of physiology. 2006; 572: 789-98. doi: 10.1113/ jphysiol.2006.105510. 46. Sindreu CB, Scheiner ZS, Storm DR. Ca 2+-stimulated adenylyl cyclases regulate ERK-dependent activation of MSK1 during fear conditioning. Neuron. 2007; 53: 79-89. doi: 10.1016/j.neuron.2006.11.024 53. Bernabeu R, Bevilaqua L, Ardenghi P, Bromberg E, Schmitz P, Bianchin M, Izquierdo I, Medina JH. Involvement of hippocampal cAMP/cAMP-dependent protein kinase signaling pathways in a late memory consolidation phase of aversively motivated learning in rats. Proceedings of the National Academy of Sciences. 1997; 94: 7041-6. 47. Lin LF, Chiu SP, Wu MJ, Chen PY, Yen JH. Luteolin induces microRNA-132 expression and modulates neurite outgrowth in PC12 cells. PLoS One. 2012; 7: e43304. doi: 10.1371/journal.pone.0043304. 54. Abel T, Nguyen PV, Barad M, Deuel TA, Kandel ER, Bourtchouladze R. Genetic demonstration of a role for PKA in the late phase of LTP and in hippocampus-based long-term memory. Cell. 1997; 88: 615-26. doi: 10.1016/ S0092-8674(00)81904-2. 48. Won JH, Ahn KH, Back MJ, Ha HC, Jang JM, Kim HH, Choi SZ, Son M, Kim DK. DA-9801 promotes neurite outgrowth via ERK1/2-CREB pathway in PC12 cells. Biol Pharm Bull. 2015; 38: 169-78. doi: 10.1248/bpb.b14-00236. 49. Atkins CM, Selcher JC, Petraitis JJ, Trzaskos JM, Sweatt JD. The MAPK cascade is required for mammalian associative learning. Nature neuroscience. 1998; 1: 602-9. doi: 10.1038/2836. 50. McGahon B, Maguire C, Kelly A, Lynch M. Activation of p42 mitogen-activated protein kinase by arachidonic acid and trans-1-amino-cyclopentyl-1, 3-dicarboxylate impacts on long-term potentiation in the dentate gyrus in the rat: analysis of age-related changes. Neuroscience. 1999; 90: 1167-75. doi: 10.1016/S0306-4522(98)00528-4. 51. Drulis-Fajdasz D, Wojtowicz T, Wawrzyniak M, Wlodarczyk J, Mozrzymas JW, Rakus D. Involvement of cellular metabolism in age-related LTP modifications in rat hippocampal slices. Oncotarget. 2015; 6: 14065-81. doi: 10.18632/oncotarget.4188. 55. Clancy B, Darlington RB, Finlay BL. Translating developmental species. Neuroscience. 2001; 105: 7-17. doi: 10.1016/S0306- 4522(01)00171-3. across mammalian time 56. Xiao H, Liu B, Chen Y, Zhang J. Learning, memory and synaptic plasticity in hippocampus in rats exposed to sevoflurane. International Journal of Developmental Neuroscience. 2016; 48: 38-49. doi: 10.1016/j. ijdevneu.2015.11.001. 57. Morris R, Garrud P, Rawlins J, O’Keefe J. Place navigation impaired in rats with hippocampal lesions. Nature. 1982; 297: 681-3. 58. Mandairon N, Sacquet J, Garcia S, Ravel N, Jourdan F, Didier A. Neurogenic correlates of an olfactory discrimination task in the adult olfactory bulb. European journal of neuroscience. 2006; 24: 3578-88. doi: 10.1111/j.1460-9568.2006.05235.x. 52. Sun L, Jin Y, Dong L, Sui HJ, Sumi R, Jahan R, Hu D, Li Z. Coccomyxa Gloeobotrydiformis Improves Learning and Memory in Intrinsic Aging Rats. Int J Biol Sci. 2015; 11: 825-32. doi: 10.7150/ijbs.10861. 32449",rats,['Ketamine administered pregnant rats impair learning and memory in offspring via the CREB pathway'],gestational day 14,"['On the 14th day of gestation (P14), female rats were anesthetized for 3 h via intravenous ketamine injection (200 mg/Kg).']",Y,"['Morris water maze task, contextual and cued fear conditioning, and olfactory tasks were executed between the 25th to 30th day after birth (B25-30) on rat pups']",ketamine,['Ketamine has been reported to impair the capacity for learning and memory.'],none,[],none,[],This study examined whether the capacities of learning and memory were altered in the offspring as well as the ketamine-induced effect on CREB signaling pathways in ketamine-induced pregnant rats on gestational day 14.,"['Therefore, this study examined whether the abilities of learning and memory were altered in the offspring as well as the ketamine-induced effect on CREB signaling pathways in ketamine-induced pregnant rats on gestational day 14.']",None,[],"The study investigates the impact of ketamine on learning and memory in offspring of rats and its effect on the CREB signaling pathway, highlighting the importance of understanding anesthetic effects on fetal brain development.","['Ketamine has been reported to impair the capacity for learning and memory.', 'This study examined whether these capacities were also altered in the offspring and investigated the role of the CREB signaling pathway in pregnant rats, subjected to ketamine-induced anesthesia.']",None,[],The findings could have implications for the use of ketamine in pregnant women and the potential neurodevelopmental impact on the fetus.,"['Therefore, the risks of anesthetic administration (such as ketamine) for the fetus have become more important.']",True,True,True,True,True,False,10.18632/oncotarget.15405 10.1016/j.neulet.2013.04.008,1209.0,Li,2013,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"Neuroscience Letters 545 (2013) 17– 22 Contents lists available at SciVerse ScienceDirect Neuroscience Letters j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / n e u l e t JNK pathway may be involved in isoflurane-induced apoptosis in the hippocampi of neonatal rats Yujuan Li a,∗,1, Fei Wang a,1, Chuiliang Liu b, Minting Zeng a, Xue Han a, Tao Luo c, Wei Jiang c, Jie Xu c, Huaqiao Wang c,∗∗ a Department of Anesthesiology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou 510120, China b Department of Anesthesiology, ChanCheng Central Hospital, Foshan 528031, China c Department of Anatomy and Neurobiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080, China h i g h l i g h t s We investigated the effects of JNK pathway on isoflurane-induced neuroapoptosis. • SP600125 reduced isoflurane-induced apoptosis in the hippocampi of neonatal rats. • Isoflurane-induced activation of JNK and c-Jun was inhibited by SP600125. • SP600125 reversed isoflurane-induced decrease of Bcl-xL. • SP600125 maintained Akt activation. a r t i c l e i n f o a b s t r a c t Article history: Received 14 February 2013 Received in revised form 30 March 2013 Accepted 1 April 2013 Keywords: Apoptosis Anesthetics volatile – isoflurane C-Jun N-terminal kinase Caspase-3 Hippocampus Previous studies have demonstrated that isoflurane, a commonly used volatile anesthetic, can induce widespread apoptosis in the neonatal animal brains and result in persistent cognitive impairment. Isoflurane-induced cytosolic Ca2+ overload and activation of mitochondrial pathway of apoptosis may be involved in this neurodegeneration. The c-Jun N-terminal kinase (JNK) signaling can regulate the expression of the Bcl-2 family members that modulates mitochondrial membrane integrity. Therefore, we hypothesize that JNK signaling pathway activation contributes to isoflurane-induced apoptosis in the brain. In this study, Sprague-Dawley neonatal rats at postnatal day 7 were exposed to 1.1% isoflurane or (cid:2)g or the vehicle was intraventricularly air for 4 h. The JNK inhibitor SP600125 at 5 administered before the exposure. Neuronal apoptosis in the hippocampi of neonatal rats was detected by TUNEL 6 h after isoflurane or air exposure. The protein expression of phospho-JNK, phospho-c-Jun, and caspase-3 as well as the antiapoptotic protein Bcl-xL and Akt/glycogen synthase kinase (GSK)-3(cid:3) pathway was detected by Western blotting. Isoflurane significantly increased apoptotic cells in the hippocampal CA1, CA3, and DG regions. The JNK inhibitor SP600125 dose-dependently inhibited isoflurane-induced neuronal apoptosis and increase of caspase-3 and phospho-JNK. SP600125 also attenuated isoflurane- induced down-regulation of Bcl-xL and maintained the activated Akt level to increase the phosphorylation of GSK-3(cid:3) at Ser9. Our results indicate that JNK activation contributes to isoflurane-induced neuroapopto- sis in the developing brain. Maintaining Bcl-xL and Akt activation may be involved in the neuroprotective effects of SP600125. (cid:2)g, 10 (cid:2)g, 20 (cid:2)g, 30 © 2013 Elsevier Ireland Ltd. All rights reserved. Abbreviations: Akt, protein kinase B; AP-1, activator-protein 1; Bcl-2, B cell lymphoma/lewkmia-2; CNS, central nervouse system; DG, dentate gyrus; GSK-3(cid:3), glycogen synthase kinase 3(cid:3); i.c.v, intracerebroventricular; JNK, c-jun N-terminal kinase; PI3K, phosphatidylinositol 3 kinase; TUNEL, TdT-mediated dUTP nick end labeling. ∗ Corresponding author at: Department of Anesthesiology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, No. 107 Yanjiang West Road, Guangzhou 510120, China. Tel.: +86 02081332060; fax: +86 02081332833. ∗∗ Corresponding author at: Department of Anatomy and Neurobiology, Zhongshan School of Medicine, Sun Yat-sen University, No. 74 Zhongshan Second Road, Guangzhou 510080, China. Tel.: +86 02084111676; fax: +86 02084112545. (M. Zeng), hanmingxuan@rocketmail.com (X. Han), luotao20080808@163.com (T. Luo), jiangweijw@yahoo.com.cn (W. Jiang), xujie@mail.sysu.edu.cn (J. Xu), wanghq@mail.sysu.edu.cn (H. Wang). E-mail addresses: yujuan 04@yahoo.com.cn (Y. Li), 1995wangfei@sina.com.cn (F. Wang), lcl1204@yahoo.com.cn (C. Liu), minting19@163.com 1 Both these authors contributed equally to this work. 0304-3940/$ – see front matter © http://dx.doi.org/10.1016/j.neulet.2013.04.008 2013 Elsevier Ireland Ltd. All rights reserved. 18 Y. Li et al. / Neuroscience Letters 545 (2013) 17– 22 1. Introduction Exposure to anesthetics has been associated with widespread apoptotic neurodegeneration in the developing brains and per- sistent cognitive in animals [5,16,23] Moreover, nociceptive stimuli, such as formalin subcutaneous injection or surgical incision, further augment apoptosis and cognitive impair- ment induced by anesthetics in developing rats [24]. Some clinical retrospective studies have found that anesthesia and surgery in children younger than 4 years increase their probability of devel- oping disabilities in reading, writing and mathematics learning [15,30]. These reports have led to concerns about the possible detrimental effects of anesthesia and sedation in the pediatric pop- ulation. impairment Isoflurane is a commonly used volatile anesthetic. Current stud- ies have suggested that isoflurane causes severe neuroapoptosis in both developing animal brains and primary neuronal cells [5,16,29]. Isoflurane induces neuronal apoptosis and degeneration via [Ca2+]i (cid:4)-aminobutyric acid (GABA)A overload through the opening of the receptor-mediated synaptic voltage-dependent calcium channels (VDCCs) and the excessive Ca2+ release from the endoplasmic reticulum via activation of inositol-1,4,5-trisphosphate (IP3) recep- tors [35,36]. Isoflurane-induced [Ca2+]i overload not only activates mitochondrial pathway of apoptosis [29,33], but also is linked to the activation of c-Jun N-terminal kinase (JNK) because the phosphory- lation of c-Jun is prevented by antagonizing IP3 receptors [5]. The regulation of mitochondrial membrane integrity and the release of apoptogenic factors from mitochondria are tightly controlled by the proteins of Bcl-2 family [34]. The JNK signaling plays a pivotal role in mediating neuronal apoptosis through direct regulation of the expression of Bcl-2 family members and activation of the acti- vator protein 1 (AP-1) transcription factor family member c-Jun [1] that provides indirect transcriptional regulation of the Bcl-2 family members [14,18], including down-regulation of the antiapoptotic proteins Bcl-2 and Bcl-xL [8,14]. (cid:2)g SP600125 or 12% DMSO only. The injection was performed 30 (cid:2)l as described before [6] under isoflurane anesthesia with a 5 microsyringe and 0.4 mm external diameter needle. The location of injection was 2.0 mm rostral, 1.5 mm lateral to the lambda and 2.0 mm deep to the skull surface of rats. The injection solution of (cid:2)l/min. The accuracy 5 of i.c.v. injection was verified by methylene blue in our preliminary experiments. All animals were sacrificed 6 h after termination of gas exposure and their hippocampi were used for Western blot- ting (n = 6) or TdT-mediated dUTP nick end labeling (TUNEL) with fluorescent dye (n = 6). (cid:2)l/rat was infused at a constant rate of 2.5 For Western blotting studies, rat pups were anaesthetized with isoflurane and then sacrificed by decapitation. Hippocampi of rats −80 ◦C until were isolated immediately on ice and then stored at used. Western blotting was performed as we have described pre- viously [20]. In brief, the protein concentrations of samples were determined using the BCA protein assay (Bio-Rad,Herts, UK). Sixty micrograms of each sample were subjected to Western blot analy- sis using the following primary antibodies: anti-cleaved caspase-3 at 1:2000 dilution, anti-phospho-JNK at 1:2000 dilution, anti-JNK at 1:2000 dilution, anti-phospho-c-Jun at 1:1000 dilution, anti- phospho-Akt (Ser 473) at 1:2000 dilution, anti-Akt at 1:5000 dilution, anti- phospho-GSK-3(cid:3) (Ser 9) at 1:2000 dilution, anti- GSK-3(cid:3) at 1:2000 dilution, anti-Bcl-xL at 1:2000 dilution and anti-(cid:3)-actin at 1:2000 dilution. All antibodies were purchased from Cell Signaling Technology Company, USA. Images were scanned by an Image Master II scanner (GE Healthcare) and were analyzed using Image Quant TL software (v2003.03, GE Healthcare). The band signals of phospho-JNK, phospho-Akt and phospho-GSK-3(cid:3) were normalized to their total JNK, Akt and GSK-3(cid:3) from the same sam- ples. The band signals of other interesting proteins were normalized (cid:3)-actin and the results in each group were normalized to those of to that of corresponding control group. Protein kinase B (Akt), a serine/threonine kinase, also plays a prominent role in regulating neuronal survival. Once Akt is acti- vated, it inhibits apoptosis through inactivating Bad and glycogen synthase kinase 3(cid:3) (GSK-3(cid:3)) by phosphorylation [21,25]. Recent studies show that there is a potential crosstalk between JNK and Akt signaling, Akt signaling is involved in the apoptotic effect of JNK [10,31]. SP600125, a selective JNK inhibitor [2], has showed neu- roprotective effects in several neurodegenerative diseases [17,26]. Whether JNK signaling pathway contributes to isoflurane-induced neuroapoptosis remains underdetermined. In this study, we inves- tigated the effects of SP600125 on isoflurane-induced neuronal apoptosis and the expression of the antiapoptotic proteins Bcl-xL and Akt in the hippocampi of neonatal rats. For TUNEL studies, rat pups were anaesthetized with isoflu- rane and perfused transcardially with 4% paraformaldehyde. Their (cid:2)m thickness. brains were paraffin embedded and sectioned at 6 (cid:2)m apart) As we described before [19], four or five sections (200 for each animal at the same plane of the hippocampus were chosen for detecting apoptosis using TUNEL fluorescent method (Promega, Madision, WI, USA). The slides were protected from direct light during experiment. Hoechst was used to stain nuclei. The TUNEL positive cells in CA1, CA3 and dentate gyrus (DG) areas of hippocam- pus were analyzed immediately with NIS-Elements BR imaging processing and analysis software (Nikon Corporation, Japan). The densities of the TUNEL positive cells in CA1, CA3 and DG were cal- culated by dividing the number of TUNEL positive cells by the area of that brain region. 2. Materials and methods All animal procedures were in compliance with the NIH Guide for the Use of Laboratory Animals and approved by the Animal Care and Use Committee of Sun Yat-sen University. Seven-day-old (P7) Sprague-Dawley rat pups (Guangdong Medical Laboratory Animal ± 3 g were exposed to 1.1% isoflu- Co, China) with body weight at 16 rane (about 0.5 MAC in P7 rats [22]) for 4 h to induce neuronal apoptosis, or to air in a temperature-controlled chamber as we described before [21]. The concentrations of anesthetic gas, oxy- gen and carbon dioxide (CO2) in the chamber were measured by a gas analyzer (Datex-Ohmeda, Madison, WI). Four doses of SP600125 (Selleck Chemicals LLC, Houston, TX, (cid:2)g) or 12% dimethyl sulfoxide (DMSO) as USA) (5, 10, 20 or 30 the vehicle were administered by intracerebroventricular (i.c.v.) injection 15 min before isoflurane exposure. Some rats received ± SEM. The Graphpad Prism 4.0 soft- ware was used to conduct the statistical analyses. A two-tailed P value of less than 0.05 was considered statistically significant. One way ANOVA with Newman–Keuls Multiple Comparison Test was used when data was normally distributed and had equal variances. Otherwise, non-parametric test with Dunn’s Multiple Comparisons was used to compare the density of TUNEL positive cells as well as the relative protein abundance data among groups in Western blots. Data are presented in mean 3. Results Our preliminary experiments for arterial blood gas monitoring showed that the neonatal rats had no hypoglycemia and acidosis during isoflurane exposure. Neuronal apoptosis in the hippocam- pal CA1, CA3 and DG regions of P7 rats were detected by TUNEL (Fig. 1). Isoflurane increased the number of apoptotic cells by 498% in CA1 (P < 0.01), 214% in CA3 (P < 0.001) and 217% in DG (P < 0.001) Y. Li et al. / Neuroscience Letters 545 (2013) 17– 22 Fig. 1. JNK/SAPK inhibitor SP600125 inhibited the increase of isoflurane-induced TUNEL positive cells in the hippocampi of P7 rats. Representative images of TUNEL in the (cid:2)m. (C) Quantification of TUNEL hippocampal CA1 region (A) and CA3 region (B). Green staining indicated TUNEL-positive cells, blue staining indicated nuclear. Scan bar = 50 (cid:2)g SP600125; Iso: isoflurane. **P < 0.01, ***P < 0.001, vs. group DMSO; #P < 0.05, ##P < 0.01, ###P < 0.001, positive cells in the hippocampal CA1, CA3 and DG regions. SP30: 30 vs. group SP30; (cid:2)P < 0.05, (cid:2)(cid:2)(cid:2)P < 0.001, vs. group Iso + DMSO. Mean ± SEM, n = 6/group. (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.) (cid:2)g as compared to sham controls. The JNK inhibitor SP600125 at 30 inhibited the increase of isoflurane-induced neuronal apoptosis by 84% in CA1 (P < 0.05), by 84% in CA3 (P < 0.001) and 71% in DG (P < 0.05). In addition, we detected the change of cleaved caspase- 3 protein expression in the hippocampus (Fig. 2). Isoflurane with or without DMSO increased the expression of cleaved caspase-3 by 174.6% (P < 0.001) or 187.2% (P < 0.001), respectively. SP600125 dose-dependently decreased the expression of cleaved caspase-3. (cid:2)g, inhibited isoflurane-induced All doses of SP600125, except for 5 increase of cleaved caspase-3 by 71.3% (P < 0.01), 84.5% (P < 0.001) and 95.5% (P < 0.001), respectively (Fig. 2B). SP600125 alone neither increased the expression of cleaved caspase-3 nor the number of apoptotic cells in hippocampus. Isoflurane increased phospho-JNK at 46 kd by 38.7% (P < 0.05) as (cid:2)g inhibited phospho- compared to sham controls. SP600125 at 30 rylation of the 46 kd (P < 0.001) and 54 kd (P < 0.01) JNK (Fig. 2C). In accord with JNK activation, isoflurane increased the expression of phospho-c-Jun by 47.1% (P < 0.001) and decreased the expression of (cid:2)g significantly Bcl-xL protein by 40.4% (P < 0.05). SP600125 at 30 reversed the isoflurane-induced expression change of phospho-c- Jun (P < 0.01) (Fig. 3A and B) and Bcl-xL (P < 0.05) (Fig. 3C and D). SP600125 attenuated this inhibition by 70.0% (P < 0.05) (Fig. 3E and F). Isoflurane did not significantly influence the protein expression of phospho-GSK-3(cid:3), while isoflurane combined with SP600125 sig- nificantly increased its expression compared with control (P < 0.05) (Fig. 3G and H). 4. Discussion Isoflurane is a commonly used volatile anesthetic during human surgery. Previous studies have demonstrated that it increases neuroapoptosis and induces long-term cognitive dysfunction in developing animals [5,16,29]. The present study demonstrates for the first time the neuroprotective effect of the JNK inhibitor SP600125 against neurodegeneration induced by isoflurane, as evi- denced by diminishing isoflurane-induced activation of caspase-3 and formation of apoptotic cells in the hippocampi of neonatal rats. SP600125 significantly inhibited isoflurane-induced increase of phosphorylation of JNK and c-Jun, downregultion of Bcl-xL, and decrease of Akt activation, which may be involved in its neuropro- tective effects. To investigate whether Akt/GSK signaling is involved in the antiapoptotic effect of SP600125, we measured proteins expres- sion of phospho-Akt and phospho-GSK-3(cid:3). Isoflurane inhibited the expression of phospho-Akt protein by 55.2% (P < 0.001), while Isoflurane, when used in low doses or for short periods, induces small to moderate increases in [Ca2+]i by activating ryanodine and IP3 receptor in endoplasmic reticulum of neuron, which trig- gers important survival signals including phosphorylation of Akt and Bcl-2 families. These signals play very important roles in the 19 20 Y. Li et al. / Neuroscience Letters 545 (2013) 17– 22 Fig. 2. SP600125 dose-dependently inhibited isoflurane-induced increase of caspase-3 and phosphorylation of JNK in the hippocampi of P7 rats. (A) Representative Western (cid:2)g SP600125; blots of caspase-3, phospho-JNK and JNK; (B and C) the quantitative analysis of cleaved caspase-3 (B) and phospho- JNK (C). Con: control; Iso: isoflurane; SP5: 5 (cid:3) (cid:2)g SP600125; SP20: 20 (cid:2)g SP600125; SP30: 30 (cid:2)g SP600125. *P < 0.05, ***P < 0.001, vs. group Con; #P < 0.05, ##P < 0.01, vs. group DMSO; SP10: 10 (cid:2)(cid:2)P < 0.01, (cid:2)(cid:2)(cid:2)P < 0.001, vs. group Iso + DMSO; (cid:2)P < 0.05, (cid:2)(cid:2)P < 0.01, (cid:2)(cid:2)(cid:2)P < 0.001, vs. group Iso. Mean P < 0.05, vs. group SP30; ± SEM, n = 6/group. neuroprotection of isoflurane preconditioning against ischemia or hypoxia in rat brain [3,4]. While when isoflurane is used in high doses or for long periods, especially if developing neurons are exposed to isoflurane, it will induce [Ca2+]i overload and results in neuronal apoptosis. The JNK signaling pathway is implicated in neuronal apo- ptosis such as ischemia/reperfusion and ethanol [9,11–13]. In the present study, our results suggest that JNK signaling also involves in isoflurane- induced neuronal apoptosis. The JNK pathways include nuclear pathway and non-nuclear pathway [11,12]. Activated JNK phos- phorylates nuclear substrate, the transcription factor c-Jun, which leads to increase of AP-1 transcription activity to modulate tran- scription of genes related to apoptosis. On the other hand, activated JNK regulates the activation of non-nuclear substrates including Bcl-2 family members [11,12]. Our current results showed that SP600125 pretreatment prevented isoflurane-induced increase of phosphorylation of JNK and c-Jun as well as increase of caspase- 3, which suggest that activated JNK nuclear pathway is involved in isoflurane-induced neuronal apoptosis. Sevoflurane, another inhaled anesthetic, also leads to an increase of phospho-JNK and apoptosis in neonatal rat brain [27,28]. However, SP600125 did not triggered by several brain injury stimuli, attenuate sevoflurane-induced apoptosis [27], which indicates that isoflurane and sevoflurane may induce neuroapoptosis in develop- ing brain by different mechanisms. The antiapoptotic protein Bcl-xL is widely expressed in the central nervous system (CNS), which enhances cell survival by maintaining mitochondrial membrane integrity and inhibits cytochrome c release [34]. Anesthesia cocktail containing isoflu- rane, nitrous oxide (N2O) and midazolam can downregulate Bcl-xL expression to induce neurotoxicity in developing rat brains [33]. In this context, we observed that isoflurane alone also caused a decreased expression of Bcl-xL in the hippocampi of P7 rats, and that this decrease was blocked by SP606125, thus preventing the mitochondrial membrane alteration and neuronal apoptosis. This result is in agreement with previous studies that suggest that JNK signaling promotes apoptosis possibly via transcriptional regula- tion of Bcl-2 family gene, including Bcl-xL [8,14,18]. Our results indicate that inhibition of Bcl-xL expression is a critical step in the isoflurane-induced apoptosis pathway and that this effect is dependent on JNK activation. Prosurvival pathways, such as Akt, may be inactivated dur- ing the apoptotic process [25,32]. Our experiments showed that isoflurane inhibited Akt phosphorylation while SP600125 Y. Li et al. / Neuroscience Letters 545 (2013) 17– 22 Fig. 3. SP600125 prevented isoflurane-induced increase of phospho-c-Jun and decrease of BcL-xL, and maintained activated Akt level and increased phosphorylation of GSK-3(cid:3) (G); (B, D, F and H) the quantitative analysis of phospho-c-Jun (B), Bcl-xL (D), phospho-Akt (F) and phospho-GSK-3(cid:3) (cid:2)g SP600125. *P < 0.05, ***P < 0.001, vs. group DMSO; (cid:2)P < 0.05, (cid:2)(cid:2)P < 0.01, vs. group Iso + DMSO. Mean in hippocampus of P7 rats. (A, C, E and G) Representative Western blots of phospho-c-Jun (A), Bcl-xL (C), phospho-Akt (E) and phospho-GSK-3(cid:3) (H). Iso: isoflurane; SP30: 30 ± SEM, n = 6/group. maintained the level of activated Akt. This result is supported by the evidence that phospho-GSK-3(cid:3) at Ser9 (inactivated form), one of the Akt phosphorylation site, is increased. This result is in agreement with previous studies that show that there is poten- tial crosstalk between JNK and Akt signaling [10,31]. It is possible that SP600125 maintain the mitochondrial membrane integrity by increasing Bcl-xL expression, thus prevents [Ca2+]i overload induced by isoflurane. However, it should be noted that isoflu- rane inhibited the expression of phospho-Akt but did not influence the expression of phospho-GSK-3(cid:3) at Ser9. The possible reason for this discrepancy may include activation of other intracellular mechanisms as a response to isoflurane, which consequently could also regulate the phosphorylation of GSK-3(cid:3). In our other exper- iments, we found isoflurane also activated p38 mitogen-activated protein kinase. A recent study suggests p38 can increase the phosphorylation of GSK-3(cid:3) at Ser 9 [7]. Thus, it is possible that phospho-GSK-3(cid:3) stays unchangeable due to the effects of isoflu- rane on Akt and p38. This effect on Akt may explain, in part, the antiapoptotic effects of SP600125 against isoflurane-induced neu- ronal cell apoptosis in developing rat brain. Our experiments only observed short-time effects of SP600125 in the hippocampi of neonatal rats, additional studies are needed to test the impact of SP600125 on isoflurane-induced cognitive dysfunction. 5. Conclusions In conclusion, our results are consistent with the hypothesis that the JNK inhibitor SP600125 potentially attenuates isoflurane- induced neuroapoptosis in the hippocampi of developing rats by inhibiting isoflurane-induced JNK activation, the subsequent JNK 21 22 Y. Li et al. / Neuroscience Letters 545 (2013) 17– 22 dependent activation of c-Jun, suppression of Bcl-xL expression, and activation of caspase-3. In addition, maintenance of activated Akt may also be involved in the antiapoptotic effect of SP600125. Our findings suggest that JNK signaling pathway activation is cru- cial for isoflurane-induced neuroapoptosis. [15] C.J. Kalkman, L. Peelen, K.G. Moons, M. Veenhuizen, M. Bruens, G. Sinnema, T.P. de Jong, Behavior and development in children and age at the time of first anesthetic exposure, Anesthesiology 110 (2009) 805–812. [16] F. Kong, L. Xu, D. He, X. Zhang, H. Lu, Effects of gestational isoflurane exposure on postnatal memory and learning in rats, Eur. J. Pharmacol. 670 (2011) 168–174. [17] C.Y. Kuan, R.E. Burke, Targeting the JNK signaling pathway for stroke and Parkinson’s diseases therapy, Curr. Drug Targets CNS Neurol. Disord. 4 (2005) 63–67. Acknowledgments The study was supported by NSFC (30700787) and the GNSF (S2011010004558) to Yujuan Li; NSTFG (2008B030301320 and 2010B031600070), and STFG (2012J410076) to Huaqiao Wang. [18] C. Li, G. Xing, M. Dong, L. Zhou, J. Li, G. Wang, D. Zou, R. Wang, J. Liu, Y. Niu, Beta- asarone protection against beta-amyloid-induced neurotoxicity in PC12 cells via JNK signaling and modulation of Bcl-2 family proteins, Eur. J. Pharmacol. 635 (2010) 96–102. [19] Y. Li, G. Liang, S. Wang, Q. Meng, Q. Wang, H. Wei, Effects of fetal exposure to isoflurane on postnatal memory and learning in rats, Neuropharmacology 53 (2007) 942–950. References [20] Y. Li, C. Liu, Y. Zhao, K. Hu, J. Zhang, M. Zeng, T. Luo, W. Jiang, H. Wang, Sevoflurane induces short-term changes in proteins in the cerebral cortices of developing rats, Acta Anaesthesiol. Scand. 3 (2013) 380–390. [1] A. Behrens, M. Sibilia, E.F. Wagner, Amino-terminal phosphorylation of c-Jun regulates stress-induced apoptosis and cellular proliferation, Nat. Genet. 21 (1999) 326–329. [21] H.R. Luo, H. Hattori, M.A. Hossain, L. Hester, Y. Huang, W. Lee-Kwon, M. Donowitz, E. Nagata, S.H. Snyder, Akt as a mediator of cell death, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 11712–11717. [2] B.L. Bennett, D.T. Sasaki, B.W. Murray, E.C. O’Leary, S.T. Sakata, W. Xu, J.C. Leis- ten, A. Motiwala, S. Pierce, Y. Satoh, S.S. Bhagwat, A.M. Manning, D.W. Anderson, S.P600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 13681–13686. [3] P.E. Bickler, C.S. Fahlman, The inhaled anesthetic, isoflurane, enhances Ca2+- dependent survival signaling in cortical neurons and modulates MAP kinases, apoptosis proteins and transcription factors during hypoxia, Anesth. Analg. 103 (2006) 419–429. [4] P.E. Bickler, X. Zhan, C.S. Fahlman, Isoflurane preconditions hippocam- pal neurons against oxygen-glucose deprivation: role of intracellular Ca2+ and mitogen-activated protein kinase signaling, Anesthesiology 103 (2005) 532–539. [22] G. Orliaguet, B. Vivien, O. Langeron, B. Bouhemad, P. Coriat, B. Riou, Minimum alveolar concentration of volatile anesthetics in rats during postnatal matura- tion, Anesthesiology 95 (2001) 734–739. [23] M.G. Paule, M. Li, R.R. Allen, F. Liu, X. Zou, C. Hotchkiss, J.P. Hanig, T.A. Patterson, W.J. Slikker, C. Wang, Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys, Neurotoxicol. Teratol. 33 (2011) 220–230. [24] Y. Shu, Z. Zhou, Y. Wan, R.D. Sanders, M. Li, C.K. Pac-Soo, M. Maze, D. Ma, Nociceptive stimuli enhance anesthetic-induced neuroapoptosis in the rat developing brain, Neurobiol. Dis. 45 (2012) 743–750. [25] G. Song, G. Ouyang, S. Bao, The activation of Akt/PKB signaling pathway and cell survival, J. Cell. Mol. Med. 9 (2005) 59–71. [5] A.M. Brambrink, A.S. Evers, M.S. Avidan, N.B. Farber, D.J. Smith, X. Zhang, G.A. Dissen, C.E. Creeley, J.W. Olney, Isoflurane-induced neuroapoptosis in the neonatal rhesus macaque brain, Anesthesiology 112 (2010) 834–841. [6] Y. Cheng, J.M. Gidday, Q. Yan, A.R. Shah, D.M. Holtzman, Marked factor injury, Ann. Neurol. 41 (1997) age-dependent neuroprotection by brain-derived neurotrophic against neonatal hypoxic-ischemic brain 521–529. [7] C.H. Choi, B.H. Lee, S.G. Ahn, S.H. Oh, Proteasome inhibition-induced p38 MAPK/ERK signaling regulates autophagy and apoptosis through the dual phosphorylation of glycogen synthase kinase 3beta, Biochem. Biophys. Res. Commun. 418 (2012) 759–764. [8] R. Chu, M. Upreti, W.X. Ding, X.M. Yin, T.C. Chambers, Regulation of Bax by c- Jun NH2-terminal kinase and Bcl-xL in vinblastine-induced apoptosis, Biochem. Pharmacol. 78 (2009) 241–248. [9] J. Fan, G. Xu, D.J. Nagel, Z. Hua, N. Zhang, G. Yin, A model of ischemia and reperfusion increases JNK activity, inhibits the association of BAD and 14-3- 3, and induces apoptosis of rabbit spinal neurocytes, Neurosci. Lett. 473 (2010) 196–201. [10] A. Fornoni, A. Pileggi, R.D. Molano, N.Y. Sanabria, T. Tejada, J. Gonzalez- Quintana, H. Ichii, L. Inverardi, C. Ricordi, R.L. Pastori, Inhibition of c-jun N terminal kinase (JNK) improves functional beta cell mass in human islets and leads to AKT and glycogen synthase kinase-3 (GSK-3) phosphorylation, Dia- betologia 51 (2008) 298–308. [26] W. Wang, L. Shi, Y. Xie, C. Ma, W. Li, X. Su, S. Huang, R. Chen, Z. Zhu, Z. Mao, Y. Han, M. Li, S.P600125, a new JNK inhibitor, protects dopaminergic neurons in the MPTP model of Parkinson’s disease, Neurosci. Res. 48 (2004) 195–202. [27] W.Y. Wang, H. Wang, Y. Luo, L.J. Jia, J.N. Zhao, H.H. Zhang, Z.W. Ma, Q.S. Xue, B.W. Yu, The effects of metabotropic glutamate receptor 7 allosteric ago- nist N,N(cid:4)-dibenzhydrylethane-1,2-diamine dihydrochloride on developmental sevoflurane neurotoxicity: role of extracellular signal-regulated kinase 1 and 2 mitogen-activated protein kinase signaling pathway, Neuroscience 205 (2012) 167–177. [28] Y. Wang, Y. Cheng, G. Liu, X. Tian, X. Tu, J. Wang, Chronic exposure of gestation rat to sevoflurane impairs offspring brain development, Neurol. Sci. 33 (2012) 535–544. [29] H. Wei, B. Kang, W. Wei, G. Liang, Q.C. Meng, Y. Li, R.G. Eckenhoff, Isoflurane and sevoflurane affect cell survival and BCL-2/BAX ratio differently, Brain Res. 1037 (2005) 139–147. [30] R.T. Wilder, R.P. Flick, J. Sprung, S.K. Katusic, W.J. Barbaresi, C. Mickelson, S.J. Gleich, D.R. Schroeder, A.L. Weaver, D.O. Warner, Early exposure to anesthesia and learning disabilities in a population-based birth cohort, Anesthesiology 110 (2009) 796–804. [31] M. Yeste-Velasco, J. Folch, G. Casadesus, M.A. Smith, M. Pallas, A. Camins, Neuro- protection by c-Jun NH2-terminal kinase inhibitor SP600125 against potassium deprivation-induced apoptosis involves the Akt pathway and inhibition of cell cycle reentry, Neuroscience 159 (2009) 1135–1147. [11] Q.H. Guan, D.S. Pei, Q.G. Zhang, Z.B. Hao, T.L. Xu, G.Y. Zhang, The neuro- protective action of SP600125, a new inhibitor of JNK, on transient brain ischemia/reperfusion-induced neuronal death in rat hippocampal CA1 via nuclear and non-nuclear pathways, Brain Res. 1035 (2005) 51–59. [12] Q.H. Guan, D.S. Pei, Y.Y. Zong, T.L. Xu, G.Y. Zhang, Neuroprotection against inhibitor of c-Jun N-terminal ischemic brain kinase (JNK) via nuclear and non-nuclear pathways, Neuroscience 139 (2006) 609–627. injury by a small peptide [13] J.Y. Han, E.Y. Jeong, Y.S. Kim, G.S. Roh, H.J. Kim, S.S. Kang, G.J. Cho, W.S. Choi, C-jun N-terminal kinase regulates the interaction between 14-3-3 and Bad in ethanol-induced cell death, J. Neurosci. Res. 86 (2008) 3221–3229. [14] H.S. Jeong, H.Y. Choi, T.W. Choi, B.W. Kim, J.H. Kim, E.R. Lee, S.G. Cho, Dif- ferential regulation of the antiapoptotic action of B-cell lymphoma 2 (Bcl-2) and B-cell lymphoma extra long (Bcl-xL) by c-Jun N-terminal protein kinase (JNK) 1-involved pathway in neuroglioma cells, Biol. Pharm. Bull. 31 (2008) 1686–1690. [32] G. Yin, L.Y. Li, M. Qu, H.B. Luo, J.Z. Wang, X.W. Zhou, Upregulation of AKT attenuates amyloid-beta-induced cell apoptosis, J. Alzheimers Dis. 25 (2011) 337–345. [33] J.H. Yon, J. Daniel-Johnson, L.B. Carter, V. Jevtovic-Todorovic, Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways, Neuroscience 135 (2005) 815–827. [34] H. Zhao, M.A. Yenari, D. Cheng, R.M. Sapolsky, G.K. Steinberg, Bcl-2 overex- pression protects against neuron loss within the ischemic margin following experimental stroke and inhibits cytochrome c translocation and caspase-3 activity, J. Neurochem. 85 (2003) 1026–1036. [35] Y. Zhao, G. Liang, Q. Chen, D.J. Joseph, Q. Meng, R.G. Eckenhoff, M.F. Eck- enhoff, H. Wei, Anesthetic-induced neurodegeneration mediated via inositol 1,4,5-trisphosphate receptors, J. Pharmacol. Exp. Ther. 333 (2010) 14–22. [36] Y.L. Zhao, Q. Xiang, Q.Y. Shi, S.Y. Li, L. Tan, J.T. Wang, X.G. Jin, A.L. Luo, GABAergic excitotoxicity injury of the immature hippocampal pyramidal neurons’ expo- sure to isoflurane, Anesth. Analg. 113 (2011) 1152–1160.",rats,"['In this study, Sprague-Dawley neonatal rats at postnatal day 7 were exposed to 1.1% isoflurane or air for 4 h.']",postnatal day 7,"['In this study, Sprague-Dawley neonatal rats at postnatal day 7 were exposed to 1.1% isoflurane or air for 4 h.']",N,[],isoflurane,"['In this study, Sprague-Dawley neonatal rats at postnatal day 7 were exposed to 1.1% isoflurane or air for 4 h.']",none,[],sprague dawley,"['In this study, Sprague-Dawley neonatal rats at postnatal day 7 were exposed to 1.1% isoflurane or air for 4 h.']","This study investigates the neuroprotective effects of SP600125 against isoflurane-induced neuroapoptosis in neonatal rats, addressing the role of the JNK signaling pathway in isoflurane-induced brain injury.","['Our results indicate that JNK activation contributes to isoflurane-induced neuroapoptosis in the developing brain.', 'Maintaining Bcl-xL and Akt activation may be involved in the neuroprotective effects of SP600125.']","The study presents the use of SP600125 to investigate its neuroprotective effects against isoflurane-induced apoptosis in neonatal rat hippocampi, focusing on the JNK signaling pathway.",['The JNK inhibitor SP600125 at 5 administered before the exposure.'],"The findings suggest that JNK signaling pathway activation is crucial for isoflurane-induced neuroapoptosis, and inhibiting this pathway could offer a therapeutic approach to protect the developing brain from anesthetic-induced injury.",['Our findings suggest that JNK signaling pathway activation is crucial for isoflurane-induced neuroapoptosis.'],"The study only observes short-time effects of SP600125 in neonatal rats, and additional studies are needed to test its impact on cognitive dysfunction.","['Our experiments only observed short-time effects of SP600125 in the hippocampi of neonatal rats, additional studies are needed to test the impact of SP600125 on isoflurane-induced cognitive dysfunction.']",Potential applications include the development of therapeutic strategies targeting the JNK signaling pathway to prevent or mitigate anesthetic-induced neuroapoptosis in the developing brain.,['Our findings suggest that JNK signaling pathway activation is crucial for isoflurane-induced neuroapoptosis.'],True,True,True,True,True,True,10.1016/j.neulet.2013.04.008 10.1016/j.biopha.2016.01.034,579.0,Lu,2016,rats,postnatal day 7,N,sevoflurane,none,sprague dawley,"Biomedicine & Pharmacotherapy 78 (2016) 322–328 Available online at ScienceDirect www.sciencedirect.com Original article Neuronal apoptosis may not contribute to the long-term cognitive dysfunction induced by a brief exposure to 2% sevoflurane in developing rats Yi Lu, Yan Huang, Jue Jiang, Rong Hu, Yaqiong Yang, Hong Jiang*, Jia Yan* Department of Anesthesiology, Shanghai Ninth People's Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, 639 Zhi Zao Ju Road, Shanghai 200011, China A R T I C L E I N F O A B S T R A C T Article history: Received 7 November 2015 Accepted 26 January 2016 Keywords: Anesthesia Sevoflurane Neurotoxicity Neurodevelopment Apoptosis Developing brain Background: Sevoflurane is an inhaled anesthetic commonly used in the pediatric. Recent animal studies suggest that early exposure to high concentration of sevoflurane for a long duration can induce neuroapoptosis and later cognitive dysfunction. However, the neurodevelopmental impact induced by lower concentration and shorter exposure duration of sevoflurane is unclear. To investigate whether early exposure to 2% concentration of sevoflurane for a short duration (clinically relevant usage of sevoflurane) can also induce neuroapoptosis and later cognitive dysfunction. Methods: Rat pups were subjected to control group, 2% sevoflurane for 3 h and 3% sevoflurane for 6 h. TUNEL assay and apoptotic enzyme cleaved caspase-3 measured by western blot were used for detection of neuronal apoptosis in frontal cortex and CA1 region of hippocampus 24 after sevoflurane treatment. Long-term cognitive function was evaluated by Morris water maze and passive avoidance test as the rats grew up. Results: The apoptotic levels in frontal cortex and CA1 region were significantly increased after rats exposed to 3% sevoflurane for 6 h (P 0.05), but not 2% sevoflurane for 3 h (P > 0.05). Exposure to both 2% sevoflurane for 3 h and 3% sevoflurane for 6 h could cause long-term cognitive dysfunction and animals exposed to 3% sevoflurane for 6 h exhibited worse neurodevelopmental outcomes (P Conclusion: It was suggested that neuronal apoptosis might not contribute to long-term cognitive dysfunction induced by 2% concentration and short exposure time of sevoflurane. Our findings also suggested that the mechanisms of sevoflurane-induced neurodevelopmental impact might be various, depending on the concentration and exposure duration. ã < < 0.05). 2016 Elsevier Masson SAS. All rights reserved. 1. Introduction Over the past two decades, a series of animal experiments have indicated that various general anesthetics may be neurotoxic to the developing brain [1–5]. Thus, the potential for anesthetics-induced developmental neurotoxicity is of concern to the anesthesiologists, surgeons and parents of children undergoing surgery. The risks of childhood anesthesia have recently emerged as a public health concern [6,7]. In 2009, the U.S. Food and Drug Administration (FDA) established a partnership with the International Anesthesia Research Society (IARS) SmartTot to offer funds for preclinical and clinical studies concerning anesthetics-related neurodevelopmen- tal and issues [8]. Moreover, the Pediatric Anesthesia NeuroDevelopment Assessment (PANDA) study team holds a biennial scientific symposia to review recent preclinical and clinical data related to anesthetic neurotoxicity [9,10]. inhaled anesthetics [3]. Sevoflurane is a commonly used inhaled anaes- thetic for the induction and maintenance of general anesthesia during surgery. Because it has the advantage of a low blood–gas partition coefficient and pungency, sevoflurane is widely used as a pediatric anesthetic. Recently, several animal studies reported that early-life long (6–9 h) exposure to high concentrations (3–4%) of sevoflurane could cause neuronal apoptosis and subsequent long- term cognitive impairment [11–15]. However, 3 h exposure to the lower concentrations (1–2%) of sevoflurane more closely approx- imates typical general pediatric anesthetic episodes for anesthesia maintenance [16]. Whether lower concentrations and a shorter duration of exposure to sevoflurane can induce neuronal apoptosis and later cognitive impairment is unclear. Every year, millions of children are exposed to Corresponding authors. E-mail addresses: mzkyanj@163.com (J. Yan), dr_hongjiang@163.com (H. Jiang). http://dx.doi.org/10.1016/j.biopha.2016.01.034 0753-3322/ ã 2016 Elsevier Masson SAS. All rights reserved. Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 323 The immature human brain is most vulnerable to neurotoxic agents during the (BGS), which begins at mid- gestation and continues for 2–3 years after birth [17–19]. In rodents, the window of vulnerability to neurotoxic agents occurs first 2–3 weeks after birth [20,21]. In this primarily during the study, we aimed to investigate whether 3 h of exposure to 2% sevoflurane, as used in clinical practice, has pro-apoptotic effects on the developing brain and impairs the long-term cognitive function in rats in the same manner as prolonged exposure to high concentrations. “brain growth spurt” 2. Materials and methods 2.1. Animals in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study. The housing and treatment of the animals were in accordance with the National Institutes of Health guidelines for animal experimentation and approved by the institutional animal care and use committee. The animals were kept on a 12-h light/dark cycle (light from 7 am to 7 pm) with room temperature (23 Because peak anesthesia-induced neurodegeneration (cid:1) 1 (cid:3)C). Animals were killed by lethal injection of pentobarbital at the time of blood sampling. 2.4. Analysis of apoptotic levels 2.4.1. TUNEL assay of brain Twenty-four hours after sevoflurane exposure, six rats from each group (n = 6) were anesthetized with sodium pentobarbital fixed, dehydrated and made into and the brains were perfused, paraffin sections (5 mm), as described previously [24]. Apoptotic cells in the brain sections were detected by TUNEL Assay using the FragELTM DNA Fragmentation Detection Kit (Merck, Darmstadt, Germany), according to the manufacturer’s protocol. Briefly, brain sections were permeabilized with proteinase K (20 mg/ml) at room temperature for 20 min. Endogenous peroxidase was inactivated by 3% H2O2. Specimens were incubated for 1.5 h with terminal deoxynucleotidyl transferase (TdT) labelling reaction mixture, and apoptotic cells were visualized with 3,30-diaminobenzidine (DAB), and normal nuclei were counterstained with methyl green. Because to anesthetics at PND7 and the hippocampus is closely related to learning and memory [25], the number of apoptotic neurons in the frontal cortex and the CA1 region of the hippocampus was quantified. We selected two random viewing fields (400(cid:5)) per region (frontal cortex and CA1) from one brain section per animal for analysis in a double blinded manner. the cerebral cortex reaches peak vulnerability 2.2. Sevoflurane exposure Rat pups were separated from their mothers for acclimatization prior to sevoflurane exposure. Pups from the same litter were randomly allocated to three different groups. Totally, ninety PND7 rats were included in this study (n = 30 for each group). Rats in the control group received 100% oxygen for 6 h in a chamber at 37 (cid:3)C. Rats in the other two groups were exposed to either 2% sevoflurane (SEVOFRANE1, Osaka, (Sevo1 group) or 3% sevoflurane for 6 h (Sevo2 group) under 100% oxygen in the same chamber at 37 (cid:3)C as described previously [13]. The concentration of sevoflurane in the chamber was monitored and maintained by a flow to the vaporizer as we described previously [23]. The gas chamber was 2 l/min. We chose these treatments because 3 h exposure to 2% seveflurane more closely approximates typical general pediatric anesthetic episodes for anesthesia maintenance [16] and 6 h exposure to 3% sevoflurane can cause neuronal apoptosis in developing animals [11,12,14,15]. Japan) for 3 h 2.3. Arterial blood gas analysis 2.4.2. Western blot Apoptosis was also assessed using western blot to quantify cleaved caspase-3 (Cl-Csp3) in all groups (n = 6). Briefly, tissue samples of the frontal cortex and CA1 region were collected from three groups twenty-four hours after sevoflurane exposure. Tissues were lysed in a buffer containing a protease inhibitor cocktail (Calbiochem, San Diego, CA, USA) and homogenated. The homogenate was centrifuged and the supernatant was collected for further analysis. Protein concentrations were measured by BCA Protein Assay Kit (Novagen, San Diego, CA, USA). Equal amounts of protein were boiled in loading buffer (Beyotime, Beijing, China) and separated by 10% polyacrylamide gel electrophoresis. Proteins were transferred to nitrocellulose, and the blots were probed overnight with anti-cleaved caspase-3 (1:200, Millipore, Darm- stadt, Germany) and b-actin antibodies (1:500, internal standard, Santa Cruz, San Diego, CA, USA) at 4 (cid:3)C. Primary antibodies were visualized using secondary antibodies conjugated to horseradish peroxidase (Santa Cruz, San Diego, CA, USA) and ECL reagent (Pierce, Rockford, IL, USA). Quantitative analysis of Cl-Csp3 was normalized to b-actin using the Quantity One software. To determine adequacy of ventilation and oxygenation, arterial blood samples (n = 6) were obtained from the left cardiac ventricle in each group at the end of anesthesia, and the samples were immediately analyzed by a blood gas analyzer (Radiometer, ABL800, Denmark). We compared the pH, pO2, pCO2, oxygen saturation (sO2), and the concentrations of blood glucose (Glu), (cid:4)) among the groups. lactic acid (Lac) and bicarbonate (HCO3 2.5. Neurologic assessment 2.5.1. Morris water maze To assess neurodevelopmental outcomes, particularly the learning and memory functions of juveniles, rats from all groups Table 1 Arterial blood gas analysis for the three groups. pH pCO2 (mmHg) pO2 (mmHg) sO2 (%) Lac (mmol/l) HCO3 (cid:4) (mmol/l) Glu (mmol/l) Control 2%Sevo 3h 3%Sevo 6h 7.463 7.417 7.404 (cid:1) (cid:1) (cid:1) 0.030 0.025 0.045 29.4 30.6 32.3 (cid:1) (cid:1) (cid:1) 1.2 1.1 1.5 117.5 113.9 108.0 (cid:1) (cid:1) (cid:1) 4.8 6.9 5.4 99.6 99.5 99.3 (cid:1) (cid:1) (cid:1) 0.1 0.1 0.2 1.7 1.8 1.9 (cid:1) (cid:1) (cid:1) 0.2 0.2 0.2 20.2 21.2 21.0 (cid:1) (cid:1) (cid:1) 0.5 0.7 0.8 5.5 5.5 5.9 (cid:1) (cid:1) (cid:1) 0.3 0.4 0.4 aP < 0.05 compared to the control group. 324 Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 Fig. 1. TUNEL assay for apoptosis of frontal cortex and CA1 region of hippocampus in control and treatment groups. (A) Representative images of frontal cortex and CA1 region. TUNEL-positive apoptotic nuclei were stained by brown and normal nuclei were stained by cyan. Scale bar = 50 mm. (B) Quantification of apoptotic nuclei in the frontal cortex and CA1 region. *P < 0.05 compared to control group, #P < 0.05 compared to Sevo1 group. Fig. 2. Western blot analysis of apoptotic enzyme Cl-Csp3 from frontal cortex and CA1 region of hippocampus in control and treatment groups. (A) Representative blots of Cl- Csp3. b-actin was used as the internal standard. (B) Quantification of the target protein expression levels. *P 0.05 compared to Sevo1 group. < 0.05 compared to control group, #P < Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 Fig. 3. Morris water maze test for the evaluation of learning and memory when the rats grew up to adolescence in control and treatment groups. (A) Statistical analysis of finding the former platform. (C) Representative traces of the paths latency in swum by the rats after the end of probe trials. The white circle in left lower quadrant represents the removed platform. (D) Statistical analysis of the number of times the former platform was crossed by the rats. (E) Statistical analysis of the percentage of time spent by the rats in the target quadrant. *P 0.05 compared to control group, #P finding the hidden platform on trial days. (B) Statistical analysis of swimming distance before < < 0.05 compared to Sevo1 group. were subjected to Morris water maze after reaching 6 weeks of age (n = 12), as previously described [24]. Briefly, a circular pool (1.6 m diameter, 60 cm height) was used for the water maze, and a submerged platform (10 cm diameter, 2 cm below the surface of fixed position in the pool. The water the water) was located at a 1 (cid:3)C. Probe trials were conducted twice (cid:1) temperature was set at 23 five consecutive days. In the trials, rats were trained to a day for finding swim to and locate the hidden platform. The time spent in the hidden platform and the swimming distance before reaching the platform were recorded. After the probe trials, the platform was removed, and the rats were allowed to swim freely for 120 s: the number of times that the former platform was crossed and the percentage of time spent in the target quadrant were determined. The entire behavioral test was recorded and analyzed using a MS- type Water Maze Video analysis system (Chengdu Instrument Ltd., Chengdu, China). Finally, to investigate cognitive function during development, the passive avoidance test was performed at 3 months. 2.5.2. Passive avoidance test The passive avoidance test was performed as previously described [26]. The apparatus used for the passive avoidance test included a behavioral stimulation controller and a video shuttle box (Chengdu Instrument Ltd., Chengdu, China). The test relies the natural preference of rats for darkness. Briefly, on the first trial day, the rats were placed in the illuminated compartment after 2 min of habituation to the dark compartment and allowed to re-enter the dark compartment. On the following day, an electric foot shock was 325 326 Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 floor of the dark compartment after the delivered through the grid rats entered. Twenty-four hours later, the retention of passive avoidance was determined by comparing the time elapsed prior to re-entry into the dark compartment with the arbitrary maximum time of 180 s. 2.6. Statistical analysis (cid:1) SEM. SAS 9.2 (SAS Institute Inc., Cary, North Carolina, USA) was used for statistical analysis. One-way ANOVA was used to determine statistically significant differences between the three groups, and Tukey’s post hoc analysis was performed to correct for multiple comparisons when applicable. Statistical significance was accepted as P All data are expressed as the mean < 0.05. 3. Results 3.1. Neonatal sevoflurane exposure does not induce metabolic or respiratory distress indicate any signs of metabolic or respiratory distress in animals exposed to 2% sevoflurane for 3 h or 3% sevoflurane for 6 h, and the pH, pO2, (cid:4) did not differ significantly among pCO2, sO2, Glu, Lac and HCO3 the three groups (Table 1). Thus, there is little probability of brain injury induced by metabolic or respiratory distress during sevoflurane anesthesia. Arterial blood gas analysis did not 3.2. Exposure to 2% sevoflurane for 3 h did not induce neuroapoptosis in the developing brain 0.05, Fig. 3C–E). These parameters were further decreased in 0.05, Fig. 3C–E). Long-term cognitive function of the three groups was also evaluated by the passive avoidance test when these rats became adults (3 months old). The results showed that the latency to re- enter the dark compartment was significantly decreased in both the Sevo1 and Sevo2 groups, with the Sevo2 rats displaying the findings demonstrated a shortest latency (P long-term following early exposure to both 2% sevoflurane for 3 h and 3% sevoflurane for 6 h. < (P the Sevo2 group, compared to the Sevo1 group (P < < 0.05, Fig. 4). These learning and memory deficiencies 4. Discussion Sevoflurane is a volatile anesthetic that is frequently used in children as a sole agent or intravenous anesthetics. It is believed to be a g-aminobutyrate acid agonist (GABAA) [8,27]. Recently, animal experiments have suggested that by promoting neuronal apoptosis, sevoflurane is neurotoxic to the immature brain [3,11,12,14,28]. However, the experimental animals in these studies generally underwent a prolonged exposure to high concentration of sevoflurane by inhalation, which is unusual for clinical practice. In this study, we provided in vivo evidence that a clinically-relevant concentration and exposure duration of sevo- flurane (2% for 3 h) did not enhance neuronal apoptosis in two specific regions of the developing brain, whereas long-term cognitive deficiency still existed. This finding is important because the results indicated that enhanced neuronal apoptosis may not contribute to the long-term cognitive dysfunction induced by sevoflurane in normal clinical applications. Other potential mechanisms of sevoflurane-induced long-term cognitive deficien- cy should be studied to address the possible neurotoxicity. in conjunction with To study whether the clinically-relevant usage of sevoflurane (2% for 3 h) can induce neuroapoptosis similar to prolonged (6 h) exposure to high concentration in the developing brain, we assayed the apoptotic levels of the frontal cortex and CA1 region of the hippocampus after different treatments by using TUNEL assay and detection of the apoptotic enzyme Cl-Csp3 through western blotting. The TUNEL assay demonstrated no significant differences in apoptotic neuronal cells in either the frontal cortex or CA1 region of rats exposed to 2% sevoflurane (P > 0.05). However, exposure to 3% sevoflurane for 6 h increased the numbers of apoptotic cells in both the frontal cortex and CA1 region, compared with the control and Sevo1 groups (P (3%) of sevoflurane for 3 h versus the controls < 0.05, Fig. 1). In addition, there was no significant difference between the Sevo1 and control groups in Cl-Csp3 protein expression analyzed by western blot (P > 0.05). However, Cl-Csp3 expression was significantly increased in the Sevo2 group (P < 0.05, Fig. 2). To study apoptotic effects, it is important to obtain results from more than one independent method (preferably several methods) before drawing a conclusion [29]. Thus, to assess apoptosis, we performed not only TUNEL assays but also detection of the apoptotic enzyme Cl-Csp3. Moreover, two independent behavioral tests were conducted to evaluate long-term cognitive outcomes after the rats reached adulthood. The results of the two assays were equivalent. Early exposure to sevoflurane in rats results in significant concentration and exposure duration-dependent impairment in adulthood memory [13]. In this study, we found that early exposure to 3% sevoflurane for 6 h induced worse neurodevelop- mental outcomes than 2% sevoflurane for 3 h. Our results also confirmed the dose- and time-dependent neurotoxic effect of sevoflurane on the developing brain. Moreover, we demonstrated that a lower inhaled concentration and shorter exposure duration to sevoflurane long-term cognitive dysfunction, although no enhancement of neuronal apoptosis in early life could cause 3.3. Exposure to both 2% sevoflurane for 3 h and 3% sevoflurane for 6 h early in life can cause long-term cognitive dysfunction To investigate the effects of early sevoflurane exposure on long- first subjected the rats from the control term cognitive function, we and treatment groups to the Morris water maze test when they were 6 weeks old. The result showed that the latency and swimming distance were significantly increased in rats from the Sevo1 and Sevo2 groups on trial day 4 and 5, compared to control group (P 0.05, Fig. 3A and B). Moreover, it took the Sevo2 group find the platform on trial day 4 and 5, compared to the more time to Sevo1 group (P 0.05, Fig. 3A). The rats from Sevo2 group also swam further than did the Sevo1 group on trial day 4 and 5 (P 0.05, Fig. 3B). The number of times that the rats crossed the platform and percentage of time spent in the target quadrant were significantly decreased in both the Sevo1 and Sevo2 groups < < < Fig. 4. Passive avoidance test for the cognitive function the rats grew up to adulthood in control and treatment groups. *P 0.05 compared to control group, #P < < 0.05 compared to Sevo1 group. Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 was found. There may be different mechanisms responsible for the neurotoxicity induced by the varying treatment conditions of sevoflurane. The mechanism of neurodevelopmental impairment mediated by a brief exposure to lower concentration of sevoflurane is still not clear. Wu et al. suggested that physiological disturbance may contribute to sevoflurane-induced long-term learning and memo- ry dysfunction immature rats [30]. However, under our sevoflurane treatment conditions, no metabolic or respiratory distress was found in PND7 rats via arterial blood gas analysis. Therefore, physiological disturbance may be excluded in this study. Although the mechanism of neurotoxicity caused by sevoflurane is not fully understood, several recent studies provide clues to possible novel mechanisms of sevoflurane-induced neurotoxicity. First, Hu et al. suggested that by increasing tau protein expression, sevoflurane could change the arrangement of the microtubule cytoskeleton in the hippocampus of the developing rat brain [31]. Second, several researchers have found that early sevoflurane exposure had an impact on rat neuronal ultrastructure compo- nents, such as dendritic spines, synapses and mitochondria [28,32]. However, these studies did not demonstrate whether these mechanisms were associated with the long-term neuro- developmental impact induced by sevoflurane. Therefore, further studies are needed to explore the relationship between neuronal injury mechanisms and neurodevelopmental outcomes. in induce apoptotic neurodegeneration in the infant mouse brain, Br. J. Pharmacol. 146 (2005) 189–197. [2] M.M. Straiko, C. Young, D. Cattano, C.E. Creeley, H. Wang, D.J. Smith, et al., Lithium protects against anesthesia-induced developmental neuroapoptosis, Anesthesiology 110 (2009) 862–868. [3] L. Pellegrini, Y. Bennis, L. Velly, I. Grandvuillemin, P. Pisano, N. Bruder, et al., Erythropoietin protects newborn rat against sevoflurane-induced neurotoxicity, Paediatr. Anaesth. 24 (2014) 749–759. [4] H. Zheng, Y. Dong, Z. Xu, G. Crosby, D.J. Culley, Y. Zhang, et al., Sevoflurane anesthesia in pregnant mice induces neurotoxicity in fetal and offspring mice, Anesthesiology 118 (2013) 516–526. [5] W.-Y. Wang, Y. Luo, L.-J. Jia, S.-F. Hu, X.-K. Lou, S.-L. Shen, et al., Inhibition of aberrant cyclin-dependent kinase 5 activity attenuates isoflurane neurotoxicity in the developing brain, Neuropharmacology 77 (2014) 90–99. [6] K. Servick, Biomedical research: researchers struggle to gauge risks of childhood anesthesia, Science 346 (2014) 1161–1162. [7] A.W. Loepke, T.G. Hansen, Is this your (paediatric patient’s) brain on (anaesthetic) drugs? The search for a potential neurological phenotype of anaesthesia-related neurotoxicity in humans, Eur. J. Anaesthesiol. 32 (2015) 298–300. [8] B.A. Rappaport, S. Suresh, S. Hertz, A.S. Evers, B.A. Orser, Anesthetic neurotoxicity–clinical implications of animal models, N. Engl. J. Med. 372 (2015) 796–797. [9] T.L. Miller, R. Park, L.S. Sun, Report of the third PANDA symposium on anesthesia and neurodevelopment in children, J. Neurosurg. Anesthesiol. 24 (2012) 357–361. [10] T.L. Miller, R. Park, L.S. Sun, Report of the fourth PANDA Symposium on Anesthesia and Neurodevelopment in Children, J. Neurosurg. Anesthesiol. 26 (2014) 344–348. [11] H. Zhou, S. Li, X. Niu, P. Wang, J. Wang, M. Zhang, Protective effect of FTY720 against sevoflurane-induced developmental neurotoxicity in rats, Cell Biochem. Biophys. 67 (2013) 591–598. limitations. Although we provided evidence that apoptosis was not responsible for the long-term cognitive dysfunction induced by 3 h exposure to 2% sevoflurane, the mechanism was not demonstrated in our study, as described above. Furthermore, due to interspecies variability, experimental animal models may not completely represent the pathophysiologi- cal processes in humans. There are inherent limitations to translate preclinical data to human practice. However, the animal data should not be ignored. Our work has several 5. Conclusion [12] W.Y. Wang, R. Yang, S.F. Hu, H. Wang, Z.W. Ma, Y. Lu, N-stearoyl-L-tyrosine ameliorates sevoflurane induced neuroapoptosis via MEK/ERK1/2 MAPK signaling pathway in the developing brain, Neurosci. Lett. 541 (2013) 167–172. [13] X. Shen, Y. Liu, S. Xu, Q. Zhao, X. Guo, R. Shen, et al., Early life exposure to sevoflurane impairs adulthood spatial memory in the rat, Neurotoxicology 39 (2013) 45–56. [14] X. Lei, W. Zhang, T. Liu, H. Xiao, W. Liang, W. Xia, et al., Perinatal supplementation with omega-3 polyunsaturated fatty acids improves sevoflurane-induced neurodegeneration and memory impairment in neonatal rats, PLoS One 8 (2013) e70645. [15] W.Y. Wang, H. Wang, Y. Luo, L.J. Jia, J.N. Zhao, H.H. Zhang, et al., The effects of metabotropic glutamate receptor 7 allosteric agonist N,N'- dibenzhydrylethane-1,2-diamine dihydrochloride on developmental sevoflurane neurotoxicity: role of extracellular signal-regulated kinase 1 and 2 mitogen-activated protein kinase signaling pathway, Neuroscience 205 (2012) 167–177. In this study, we have shown that early exposure to both 2% sevoflurane impair adulthood learning and memory function but only exposure to 3% sevoflurane for 6 h could reinforce neuronal apoptosis. We therefore concluded that neuronal apoptosis might not contribute to the long-term cognitive dysfunction induced by a brief exposure to a in developing rats. Moreover, the mechanisms of sevoflurane-induced neurodevelopmental impact might be vari- ous, depending on the concentration and exposure duration. Further studies regarding the mechanism for the sevoflurane- induced neurodevelopmental impact are urgently needed to develop methods to protect the immature brain. for 3 h and 3% sevoflurane for 6 h may lower concentration of sevoflurane findings suggested the that [16] X. Zou, T.A. Patterson, N. Sadovova, N.C. Twaddle, D.R. Doerge, X. Zhang, et al., Potential neurotoxicity of ketamine in the developing rat brain, Toxicol. Sci. 108 (2009) 149–158. [17] H. Hayashi, P. Dikkes, S.G. Soriano, Repeated administration of ketamine may lead to neuronal degeneration in the developing rat brain, Paediatr. Anaesth. 12 (2002) 770–774. [18] C. Ikonomidou, P. Bittigau, C. Koch, K. Genz, F. Hoerster, U. Felderhoff-Mueser, et al., Neurotransmitters and apoptosis in the developing brain, Biochem. Pharmacol. 62 (2001) 401–405. [19] L. Sun, Early childhood general anaesthesia exposure and neurocognitive development, Br. J. Anaesth. 105 (2010) i61–i68. [20] A. Fredriksson, T. Archer, H. Alm, T. Gordh, P. Eriksson, Neurofunctional deficits and potentiated apoptosis by neonatal NMDA antagonist administration, Behav. Brain Res. 153 (2004) 367–376. [21] F. Liu, M.G. Paule, S. Ali, C. Wang, Ketamine-induced neurotoxicity and changes in gene expression in the developing rat brain, Curr. Neuropharmacol. 9 (2011) 256–261. [22] A.W. Loepke, F.X. McGowan Jr., S.G. Soriano, CON: the toxic effects of Conflict of interest anesthetics in the developing brain: the clinical perspective, Anesth. Analg. 106 (2008) 1664–1669. [23] H. Jiang, Y. Huang, H. Xu, Y. Sun, N. Han, Q.F. Li, Hypoxia inducible factor-1alpha No conflicts of interest declared. is involved in the neurodegeneration induced by isoflurane in the brain of neonatal rats, J. Neurochem. 120 (2012) 453–460. [24] J. Yan, Y. Huang, Y. Lu, J. Chen, H. Jiang, Repeated administration of ketamine Acknowledgment can induce hippocampal neurodegeneration and long-term cognitive impairment via the ROS/HIF-1alpha pathway in developing rats, Cell. Physiol. Biochem. 33 (2014) 1715–1732. This work was supported by research funds from Shanghai Municipal Commission of Health and Family Planning (grant number: 201440356). [25] J.H. Yon, J. Daniel-Johnson, L.B. Carter, V. Jevtovic-Todorovic, Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways, Neuroscience 135 (2005) 815–827. [26] M. Ozarowski, P.L. Mikolajczak, A. Bogacz, A. Gryszczynska, M. Kujawska, J. References Jodynis-Liebert, et al., Rosmarinus officinalis L. leaf extract improves memory impairment and affects acetylcholinesterase and butyrylcholinesterase activities in rat brain, Fitoterapia 91 (2013) 261–271. [1] C. Young, V. Jevtovic-Todorovic, Y.Q. Qin, T. Tenkova, H. Wang, J. Labruyere, et al., Potential of ketamine and midazolam, individually or in combination, to [27] B.H. Lee, O.D. Hazarika, G.R. Quitoriano, N. Lin, J. Leong, H. Brosnan, et al., Effect of combining anesthetics in neonates on long-term cognitive function, Int. J. Dev. Neurosci. 37 (2014) 87–93. 327 328 Y. Lu et al. / Biomedicine & Pharmacotherapy 78 (2016) 322–328 [28] L.G. Amrock, M.L. Starner, K.L. Murphy, M.G. Baxter, Long-term effects of single or multiple neonatal sevoflurane exposures on rat hippocampal ultrastructure, Anesthesiology 122 (2015) 87–95. [31] Z.Y. Hu, H.Y. Jin, L.L. Xu, Z.R. Zhu, Y.L. Jiang, R. Seal, Effects of sevoflurane on the expression of tau protein mRNA and Ser396/404 site in the hippocampus of developing rat brain, Paediatr. Anaesth. 23 (2013) 1138–1144. [29] D.R. Schultz, W.J. Harrington Jr., Apoptosis: programmed cell death at a [32] A. Briner, M. De Roo, A. Dayer, D. Muller, W. Habre, L. Vutskits, Volatile molecular level, Semin. Arthritis Rheum. 32 (2003) 345–369. [30] B. Wu, Z. Yu, S. You, Y. Zheng, J. Liu, Y. Gao, et al., Physiological disturbance may contribute to neurodegeneration induced by isoflurane or sevoflurane in 14 day old rats, PLoS One 9 (2014) e84622. anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis, Anesthesiology 112 (2010) 546–556.",rats,"['Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",postnatal day 7,"['Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",Y,"['Long-term cognitive function was evaluated by Morris water maze and passive avoidance test as the rats grew up.', 'To assess neurodevelopmental outcomes, particularly the learning and memory functions of juveniles, rats from all groups were subjected to Morris water maze after reaching 6 weeks of age (n = 12), as previously described [24].', 'Long-term cognitive function during development, the passive avoidance test was performed at 3 months.']",sevoflurane,"['However, the neurodevelopmental impact induced by lower concentration and shorter exposure duration of sevoflurane is unclear.']",none,[],sprague dawley,"['Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",The study addresses the unclear impact of lower concentration and shorter exposure duration of sevoflurane on neurodevelopment.,"['However, the neurodevelopmental impact induced by lower concentration and shorter exposure duration of sevoflurane is unclear.']",None,[],The findings suggest that neuronal apoptosis might not contribute to long-term cognitive dysfunction induced by a brief exposure to a lower concentration of sevoflurane in developing rats.,['It was suggested that neuronal apoptosis might not contribute to long-term cognitive dysfunction induced by 2% concentration and short exposure time of sevoflurane.'],The study has limitations in translating preclinical data to human practice due to interspecies variability.,"['Furthermore, due to interspecies variability, experimental animal models may not completely represent the pathophysiological processes in humans.']",None,[],True,True,False,True,True,True,10.1016/j.biopha.2016.01.034 10.1007/s12035-017-0730-0,230.0,Obradovic,2018,mice,postnatal day 7,N,ketamine,none,cd-1,"Mol Neurobiol (2018) 55:164–172 DOI 10.1007/s12035-017-0730-0 Early Exposure to Ketamine Impairs Axonal Pruning in Developing Mouse Hippocampus Aleksandar Lj. Obradovic 1 & Navya Atluri 2 & Lorenza Dalla Massara 3 & Azra Oklopcic 4 & Nikola S. Todorovic 5 & Gaurav Katta 6 & Hari P. Osuru 2 & Vesna Jevtovic-Todorovic 2 Published online: 24 August 2017 # Springer Science+Business Media, LLC 2017 Abstract Mounting evidence suggests that prolonged expo- sure to general anesthesia (GA) during brain synaptogenesis damages the immature neurons and results in long-term neurocognitive impairments. Importantly, synaptogenesis re- lies on timely axon pruning to select axons that participate in active neural circuit formation. This process is in part depen- dent on proper homeostasis of neurotrophic factors, in partic- ular brain-derived neurotrophic factor (BDNF). We set out to examine how GA may modulate axon maintenance and prun- ing and focused on the role of BDNF. We exposed post-natal day (PND)7 mice to ketamine using a well-established dosing regimen known to induce significant developmental neurotox- icity. We performed morphometric analyses of the infrapyramidal bundle (IPB) since IPB is known to undergo intense developmental modeling and as such is commonly used as a well-established model of in vivo pruning in rodents. When IPB remodeling was followed from PND10 until PND65, we noted a delay in axonal pruning in ketamine- treated animals when compared to controls; this impairment coincided with ketamine-induced downregulation in BDNF protein expression and maturation suggesting two conclu- sions: a surge in BDNF protein expression Bsignals^ intense IPB pruning in control animals and ketamine-induced down- regulation of BDNF synthesis and maturation could contrib- ute to impaired IPB pruning. We conclude that the combined effects on BDNF homeostasis and impaired axon pruning may in part explain ketamine-induced impairment of neuronal cir- cuitry formation. Keywords Infrapyramidal bundle . Synaptogenesis . Brain-derived neurotrophic factor . Mossy fibers . General anesthesia . Immature brain Introduction Vesna Jevtovic-Todorovic vesna.jevtovic-todorovic@ucdenver.edu 1 Department of Neuroscience, Mount Sinai School of Medicine, New York, NY, USA 2 Department of Anesthesiology, University of Colorado School of Medicine, 12401 East 17th Avenue, Aurora, CO 80045, USA 3 Department of Anesthesiology and Pharmacology, University of Padua, Padua, Italy 4 Department of Medicine, University of Virginia Health System, Charlottesville, VA, USA 5 University of Virginia College of Arts and Sciences, Charlottesville, VA, USA 6 Department of Anesthesiology, University of Michigan, Ann Arbor, MI, USA Advances in modern medicine enable us to care for sick and premature children but force us to rely on extensive and fre- quent use of sedatives and general anesthetics during painful interventions. Unfortunately, recent discoveries show that ex- posure to sedation and general anesthesia (GA) during critical stages of brain development (i.e. synaptogenesis) may be damaging to immature neurons by causing extensive apopto- tic cell death ultimately resulting in long-term neurocognitive and behavioral impairments [1–7]. Synaptogenesis involves two equally important regressive events: (1) naturally occurring neuronal death by apoptosis to eliminate neurons that are not appropriately connected with their targets [8, 9] and (2) axon pruning to select axons that participate in active neural circuits [8, 9]. We know that GA exacerbates neuronal apoptosis, thus causing widespread de- letion of developing neurons in vulnerable brain regions. However, it is not yet clear whether or how GA impairs Mol Neurobiol (2018) 55:164–172 selection of appropriate axons and elimination of redundant axons, two balancing forces necessary for the formation and fine-tuning of neuronal networks. Considering the protracted nature of cognitive and behavioral impairments that appear to worsen over a lifetime [1, 10], we set out to examine whether an early exposure to GA causes long-term impairments of proper axon maintenance and pruning in neurons that survive the initial apoptotic Battack.^ It seems that axon pruning manifests through at least two major phases: one, more robust and related to interplay of major neurotrophic factors and later phase, dominated by lo- cally produced and secreted neuronal growth factors. Hence, to begin to understand the mechanisms of anesthesia-induced modulation of axon maintenance and pruning, we focused on the role of neurotrophic factors. Brain-derived neurotrophic factor (BDNF) was of particular interest for this study because the disturbances in BDNF expression and function have been shown to impair axon pruning. For example, sympathetic neu- ron targets are inappropriately innervated in BDNF(+/−) knock- out mice [11], whereas BDNF deprivation in neuronal cultures impairs axonal growth, causes extensive axonal degeneration and impairs axon competition [11]. Given that GA exposure during critical stages of synaptogenesis causes perturbation in BDNF regulation and impairment of Trk pathway activation [12, 13] while decreasing neuronal activity, we hypothesize that GA impairs the axon selection and pruning, which may explain long-term defects in neuronal networking and may in turn be the culprit for reported functional impairments. We used an early exposure to ketamine as a well- established model of anesthesia-induced developmental neu- rotoxicity in mice [14] and developmental modeling of infrapyramidal bundle as a well-established model of in vivo pruning [15]. We report that an early exposure to ketamine delays axonal pruning; this impairment coincides with ketamine-induced downregulation in BDNF expression and maturation suggesting that ketamine-induced modulation of BDNF synthesis and maturation could at least in part contrib- ute to the impairment of neuronal circuitry formation. Materials and Methods Animals We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments. We chose this age be- cause (1) it is when rodents are most vulnerable to GA- induced developmental neurotoxicity [16] and (2) it falls be- fore developmental pruning of the infrapyramidal bundle (IPB) begins [15]. Our ketamine anesthesia protocol was as follows: experimental mouse pups were exposed to 6 h of ketamine anesthesia, and controls were exposed to 6 h of mock anesthesia (vehicle) injected IM. During anesthesia, pups were carefully monitored. After the administration of anesthesia, mice were reunited with their mothers until sacri- fice (from P8 until P65). The weaning was done at P21 using the standard protocol. At the desired age, mice were divided randomly into two groups: one group for assessing expression of pro- and the mature form of BDNF using the Western blotting technique and the second group for morphometric studies of IPB development. Our randomization process was designed to provide each group with roughly equal represen- tation of pups from each dam. The experiments were approved by the Animal Use and Care Committees at the University of Colorado, the Office of Laboratory Animal Resources (OLAR), Aurora, Colorado and the Animal Use and Care Committees of the University of Virginia, Charlottesville, Virginia. The experiments were done in accordance with the Public Health Service’s Policy on Humane Care and Use of Laboratory Animals. Efforts were made to minimize the number of animals used while being able to conduct meaningful statistical analyses. Anesthesia Administration To achieve general anesthesia state, we used a ketamine pro- tocol known to cause significant developmental neurotoxicity in PND7 mice whereby mouse pups received a total of four doses of ketamine, at 75 mg/kg, IM every 90 min so that the loss of righting reflex and lack of response to tail pinch could be maintained for 6 h [14]. For control animals, saline was administered using the same volume and administration schedule. During entire anesthesia procedure, animals were kept away from their mother and were housed in standard, tightly closed mice cages, with free air flow through air filters. Animals were kept in close proximity to each other in the cages, so they could preserve, even under anesthesia, impor- tant olfactory cues and stimuli, necessary to bust and sustain their metabolic output. During the experiment, we carefully monitored animals and measured environmental temperature in their breeding cages. We established that the ambient tem- perature in the breeding cage was around 37.0 ± 1 °C. Considering that animals at this age are very sensitive to change in body temperature, they were kept under constant ambient temperature maintained with heating pads conve- niently set up around the cages. The ambient temperature was assessed at frequent time intervals using a thermometer. Western Blot Studies For BDNF protein quantification, we dissected the hippocampus immediately after the brains were removed from the individual pups using a dissecting scope (10× magnification). Tissue was collected on ice and was snap-frozen in liquid nitrogen immedi- ately. The protein concentration of the lysates was determined with the Total Protein Kit using the Bradford method (Cayman 165 166 Chemical, Ann Arbor, MI). Approximately 10–25 μg of total protein was heat-denatured and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) through 4–20% Tris-glycine polyacrylamide gradient gels (BioRad, Hercules, CA). Separated proteins were transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA), blocked at room temperature for 1 h in 3% bovine serum albumin (BSA) followed by incubation at 4 °C overnight with primary antibody, anti-BDNF (1:500, Alomone Labs, Jerusalem, Israel), and anti-β-actin antibody (1:10,000, Sigma- Aldrich, USA) as a loading control. Membranes were incubated for 1 h at room temperature with horseradish peroxidase (HRP)-conjugated secondary antibodies—goat anti-rabbit or goat anti-mouse IgG (1:10,000, Santa Cruz, Dallas, TX). Three washes with 0.3% Tween-20 in Tris-buffered saline were performed between all steps. Immunoreactivity was detected using en- hanced chemiluminescence substrate (SuperSignal West Femto, Thermo Scientific, UT). Images were captured using GBOX (Chemi XR5, Syngene, MD), and gels were analyzed densitometrically with the computerized image analysis pro- gram ImageQuant 5.0 (GE Healthcare, Life Sciences, Piscataway, NJ). Histological Preparation Mice were deeply anesthetized with 2% isoflurane and imme- diately perfused with 4% paraformaldehyde in 0.1 M phos- phate buffer (at pH 7.4). Brains were extracted and immersed in fresh 4% paraformaldehyde and incubated at 4 °C for ad- ditional 2–3 days before being embedded in agar. Briefly, brain coronal sections (50 μm thickness) were cut using vibratome. Tissue sections were blocked with 1× TBS con- taining 5% normal goat serum, 1% BSA and 0.1% Triton X- 100 for 1 h at room temperature before incubated with primary antibodies against calbindin (anti-calbindin D-28K antibody, 1:1000; Gene Tex, CA, USA) overnight at 4 °C. Free floating sections were then washed three times with TBS and then incubated with corresponding HRP-conjugated secondary an- tibodies (1:200) at room temperature for 2 h. Tissue sections were mounted on glass slides and air-dried. For detection, we used DAB Peroxidase substrate kit (Vector Laboratories) fol- lowing manufacturer’s instructions. Histological Morphometric Assessment The morphometric analyses of IBP developmental shortening (from PND10 until PND65 in both control and ketamine- treated mice) were performed using coronal hippocampal slices (50 μm) cut from bregma − 1.34 to − 2.30 mm (as determined using a mouse brain atlas). The images were scanned at 20× magnification using an Aperio Scanscope XT digital slide scanner (Aperio Technologies Inc., Vista, Mol Neurobiol (2018) 55:164–172 CA) at the University of Virginia, Charlottesville, VA and at the University of Colorado, Aurora, CO. The hippocampal area in digital sections (.svs file) was extracted at 600 μm scale to convert to a .tiff file and was spatially calibrated using 1000 μm2 grid prior to quantifying using Image-Pro Plus 7.0 software (Media Cybernetics, MD). The morphometric ap- proach was used to evaluate so-called Bnormalized length of IPB,^ which takes into consideration individual variability and developmental growth of hippocampus. The IPB length was approximated from the tip of the inferior blade of the dentate granule cell layer (Ba^). The length of CA3 was approximated from the tip of the inferior blade to the apex of the curvature of the CA3 pyramidal cell layer (Bb^). Normalized IPB length was taken as a ratio between Ba^ and Bb.^ The values from serial sections (n = 3–6 serial sections per animal from 6 to 7 animals per age group) were averaged to provide a single data point and were presented as normalized IPB length. The re- sults from different age groups were statistically analyzed by t test and between both groups by two-way ANOVA using GraphPad Prism 5.01 software (GraphPad, CA). The experi- menters were blinded to the experimental condition. Statistical Analysis Comparisons among groups were made using one-way and two-way ANOVAs followed by Tukey’s post-hoc test. Using the standard version of GraphPad Prism 5.01 software (Media Cybernetics, Inc., Bethesda, MD), we considered p < 0.05 to be statistically significant. All data are presented as mean ± SD or mean ± SEM. The sample sizes reported throughout the BResults^ section and in the figure legends were based on previous experience. Results To begin to understand the effects of general anesthesia on neuronal circuitry remodeling, we focused on well- established IPB model of in vivo axon connectivity. The IPB is formed from the axons of granule cells in the dentate gyrus projecting to pyramidal cells mostly in region CA3 (Fig. 1). During normal development, the IPB undergoes a progressive decrease in size due to tightly controlled axon selection and pruning, a process necessary to assure proper circuitry forma- tion in developing hippocampus [15]. The IPB Fails to Undergo Proper Shortening in Ketamine-Treated Mice To begin to understand whether an early GA exposure impairs axon pruning, we examined the IPB length in CD-1 mice that were exposed to either saline (vehicle control) or ketamine at post-natal day (PND)7 (Fig. 2a). We chose this age because (1) Mol Neurobiol (2018) 55:164–172 Fig. 1 Schematic representation of the infrapyramidal bundle (IPB). The IPB is formed from the axons of granule cells in the dentate gyrus projecting to pyramidal cells in region CA3. During normal development, the IPB undergoes progressive decrease in size due to tightly controlled axon selection and pruning it is when rodents are most vulnerable to GA-induced develop- mental neurotoxicity [16] and (2) it falls immediately before developmental pruning of the IPB begins [15]. As stated earlier, a total of four doses of ketamine, at 75 mg/kg, IM, were admin- istered every 90 min so that the loss of righting reflex and lack of response to tail pinch could be maintained for 6 h. The IPB length was measured at different age points—when IPB length is about maximal (PND10); the IPB length begins to decrease (PNDs 20 and 30); and the IPB length reaches its final length (PNDs 40 and 65) [15]. The morphometric approach used to evaluate so-called Bnormalized length of IPB,^ which takes into consideration individual variability and developmental growth of hippocampus, is shown in Fig. 2b. The IPB length was measured from the tip of the inferior blade of the dentate gran- ule cell layer (Ba^). The length of CA3 was measured from the tip of the inferior blade to the apex of the curvature of the CA3 pyramidal cell layer (Bb^). Normalized IPB length was taken as a ratio between Ba^ and Bb^ [15]. As shown in Fig. 3, control animals underwent substan- tial shortening of the IPB from PND20 until the PND65 compared to PND10 (shortening from 20 to 80%, Fig. 2 The time line of the experimental design and the IPB morphometry in mice. a Ketamine exposure occurred at post-natal day (PND)7 when synaptogenesis is at the peak in mice. The IPB length was measured at different age points—when IPB length is about maximal (PND10); IPB length begins to decrease (PNDs 20 and 30); and IPB length reaches its final length (PNDs 40 and 65). b The morphometric approach used to evaluate so-called Bnormalized length of IPB,^ which respectively; see table for pairwise comparison to PND10), whereas ketamine-treated ones maintained the the PND30 IPB length close to PND10 level until (p = 0.572), resulting in a significantly longer IPB throughout the experimental time line [two-way ANOVA main effect on treatment (F (1,56) = 9.247); (**, p < 0.01)] (n = 6–7 pups per data point) suggesting a rightward shift with ketamine treatment (Fig. 3a). Representative microphotographs from the control and ex- perimental animals are depicted in Fig. 3b (black line underlines the IBP length. As stated earlier, we used calbindin staining (with anti-calbindin D-28K antibody) to label mossy fibers in the IPB since it labels long un- myelinated axons [17]. BDNF Protein Expression is Downregulated in Ketamine-Treated Mice To begin to decipher the mechanism of ketamine-induced delay in the IPB pruning, we assessed BDNF protein ex- pression changes during early stages of brain development. takes into consideration individual variability and developmental growth of hippocampus. The IPB length was approximated from the tip of the inferior blade of the dentate granule cell layer (Ba^). The length of CA3 was approximated from the tip of the inferior blade to the apex of the curvature of the CA3 pyramidal cell layer (Bb^). Normalized IPB length was taken as a ratio between Ba^ and Bb^ 167 168 Fig. 3 Ketamine exposure impairs IPB pruning in young mice. a Control animals underwent significant shortening of the IPB from PND20 until the PND65 compared to PND10, whereas ketamine-treated ones maintained the IPB length at PND10 level until the PND30 (see the table depicting within- the-group comparisons). The IPB remained longer throughout the experimental time line in ketamine-treated animals suggesting a rightward shift with ketamine treatment [two-way ANOVA main effect on treatment (F (1, 56) = 9.247); (**, p < 0.01)] (n = 6–7 pups per data point). b Representative microphotographs from the control and experimental animals are depicted from PND10 to PND65. To label mossy fibers in the IPB, we used calbindin staining (with anti-calbindin D-28K antibody) since it labels long unmyelinated axons (magnification 20×). Note a delay in the IPB shortening in ketamine- treated animals (right panels) when compared to controls (left panels) We measured protein levels of mature (Fig. 4a; n = 3–4) and pro- (Fig. 4b; n = 3–4) forms of BDNF in saline- and ketamine-treated mice. The treatment was performed at PND7, and the Western blot analyses of hippocampal tis- sue were performed in frequent intervals (until PND30) to capture the BDNF changes during the initial phase of IPB pruning. As shown in Fig. 4a, the mature BDNF levels rise steadily in both control and ketamine-treated mice over the course of first 20 post-natal days, peak around PND22, and slowly decline thereafter in controls (PND22 vs. PND19, ††, p < 0.01 and PND22 vs. PND26, †, p < 0.05). Mol Neurobiol (2018) 55:164–172 Ketamine-treated animals exhibit a much less robust in- crease in BDNF levels throughout with a lower BDNF level when compared to age-matched controls. Note that there is over a twofold decrease in BDNF expression in the ketamine group on PND22 as compared with age-matched controls (***, p < 0.001). Interestingly, pro-BDNF levels appeared to be somewhat elevated in ketamine-treated an- imals shortly after the treatment (Fig. 4b). However, starting from PND13, there was a precipitous decline in their pro-BDNF levels that was significant on PND22 as compared with age-matched controls (*, p < 0.05). Mol Neurobiol (2018) 55:164–172 The Impairment of BDNF Homeostasis Corresponds with the Timing of Intense IPB Pruning To assess how the changes in mature BDNF levels correspond to the time line of the IPB pruning, we superimposed the IPB pruning curve on the mature (Fig. 5a) and pro-BDNF expres- sion curves (Fig. 5b) and discovered that around the time when intense IPB pruning is normally initiated (the time course of normal IPB pruning is superimposed with a blue dashed line), there is a peak in BDNF expression followed by a precipitous decline in control animals suggesting that under normal circumstance, an increase in pro- and mature ƒFig. 4 Ketamine exposure impairs BDNF homeostasis in young mice. a Mature BDNF protein expression was examined during the early stage of brain development in saline and ketamine-treated mice. The treatment was performed at PND7, and the Western blot analyses of hippocampus were performed in frequent intervals as indicated (until PND30). The mature BDNF levels rise steadily in both control and ketamine-treated mice over the course of first 20 post-natal days, peak around PND22, and slowly decline thereafter in controls (PND22 vs. PND19, ††, p < 0.01 and PND22 vs. PND26, †, p < 0.05). Ketamine-treated animals exhibit much less robust increase in BDNF levels throughout with a lower BDNF level when compared to age-matched controls. Note that there is over a twofold decrease in BDNF expression on PND22 in the ketamine group as compared with age-matched controls (***, p < 0.001) (n = 3–4 animals per data point). b Pro-BDNF protein expression was examined during the early stage of brain development in saline and ketamine-treated mice. The treatment was performed at PND7, and the Western blot analyses of CA3 and dentate gyrus were performed in frequent intervals (until PND30). Pro-mature BDNF levels appeared to be somewhat elevated (although not significantly) in ketamine-treated animals shortly after the treatment. However, starting from PND13, there was a precipitous decline in their pro-BDNF levels found to be significant on PND22 as compared with age-matched controls (*, p < 0.05) (n = 3–4 animas per data point) BDNF provides a homeostatic Bsignal^ for intense IPB prun- ing (around PND22; marked with shaded rectangles). Discussion We show in this study that ketamine exposure during the crit- ical stages of mouse brain development impairs timely IPB pruning. Since both pro- and mature BDNF forms exhibit a significant decline at the time when intense IBP shortening begins (around PND20), we propose that ketamine-induced impairment in developmental axon pruning could be, at least in part, BDNF-dependent. We further hypothesize that distur- bance in axonal selection and pruning may result in faulty formation of functional neuronal networks among the remain- ing (Bnormal^) neurons. This notion remains to be confirmed in future mechanistic and functional studies. The importance of neuronal activity in regulating develop- mental axon competition is well-established. For example, developing rat sympathetic eye-projecting neurons initially extend axon collaterals to two different eye sections, but then axon elimination occurs, so that any individual neuron ulti- mately only projects to one section [18]. If, however, the ac- tivity is disturbed during this critical time period, axon selec- tion does not occur, thus affecting the innervations of an eye. Although the effect of general anesthesia on neuronal activity in vast brain circuitries is complex and not well understood, it is clear that a substantial decrease in neuronal activity has to occur to induce the state of unconsciousness, amnesia, and insensitivity to pain—three key features of the general anes- thesia state. Hence, GA-induced neuronal inhibition may be the cause of improper axon selection manifested as delayed pruning. 169 170 Fig. 5 The peak of BDNF protein expression coincides with the initiation of intense IPB pruning in young mice. a When the IPB pruning curve (dashed blue line) was superimposed on the mature BDNF protein expression curve in control animals, it showed that a substantial peak in BDNF expression occurs around the time when intense IPB pruning is normally initiated. b When the IPB pruning curve (dashed blue line) was superimposed on the pro-BDNF protein expression curve in control animals, it showed that an increase in pro- BDNF expression occurs around the time when intense IPB pruning is normally initiated The role of neurotrophic factors in developmental axon competition is becoming more appreciated. We, along with others have previously reported that the exposure to GA causes profound disturbances in homeostasis of the neuro- trophic factor, BDNF. This, in turn, leads to the inhibition of Trk-B-dependent pathways, either directly or indirectly via p75NTR signaling, ultimately resulting in neuronal death [12, 13] since both Trk and p75NTR receptors modulate the activa- tion of major survival pathways for neurons [19, 20]. However, after a decade of intense investigation, we question whether the detrimental effects of GA on BDNF signaling have consequences beyond inducing neuronal death to in- clude compromising the development and function of the re- maining surviving neurons by impairing not only current but also future connections, maintenance of neuronal circuits, and general plasticity of dentate gyrus-CA3 communications. We base this hypothesis on data presented herein which suggests the impairment of proper and timely axon pruning, a crucial process during normal development that allows removal of exuberant or misguided axon branches while maintaining oth- er appropriate connections of the same neuron. If, indeed, GA Mol Neurobiol (2018) 55:164–172 impairs axon selection during critical stages of synaptogene- sis, this effect may account for long-lasting impairment of neuronal networking and circuitry formation [21]. We find that the time course of this impairment correlates with GA-induced downregulation of BDNF protein expres- sion in developing hippocampus in vivo. Although our work was not focused on studying Trk-mediated signaling, based on presently available knowledge, the basic mechanism suggests that active axons secrete BDNF enabling extensive activation of p75NTR receptors located on a Blosing^ (less active) axon. p75NTR activation inhibits Trk-mediated signaling, which is essential for axon maintenance, thus promoting degeneration and pruning of losing axons [11, 22]. When BDNF levels are downregulated, this timely activation of p75NTR receptors is impaired resulting in faulty axon pruning similar to the one we report herein. Our findings indicate that GA impairs the normal progres- sive decrease in the IPB of mossy fiber projections (IMF) in the hippocampus, an important event in the formation of proper circuitry between the dentate gyrus and the CA3 region, a neu- ronal circuitry that plays a crucial role in learning and memory [23]. We focused on this well-established IPB model of in vivo axon connectivity because during normal development, the IPB undergoes a progressive decrease in size due to tightly con- trolled axon selection and pruning, a process necessary to assure proper circuitry formation in developing hippocampus [15]. The size of the IPB correlates inversely with performance in a variety of cognitive tasks, i.e. the longer the IPB, the more learning and memory development (in particular spatial learn- ing) [23] are impaired, suggesting that subtle disturbances in hippocampal circuitries could have detrimental long-term ef- fects on cognitive development. Because spatial learning is im- paired in animals exposed to ketamine [24] (intravenous anes- thetics used in pediatric medicine) and because our data suggest that ketamine compromises IPB pruning, we propose a tempo- ral association between ketamine-induced impairment of BDNF homeostasis and disturbances in normal development of IPB. It remains to be determined whether this temporal asso- ciation could explain the impairment in cognitive functioning previously reported. This notion could be considered based on the observation that BDNF is critical for cognitive development [25], modulates the strength of existing synaptic connections, and assists in the formation of new synaptic contacts [26, 27]. In addition, pro- and mature forms of BDNF can induce long-term potentiation and depression [28], known to be impaired after an early exposure to anesthesia [1]. A decrease greater than two- fold in BDNF expression in the ketamine group around the time of intense IPB pruning approaches a reduction in BDNF previ- ously reported to be sufficient to eliminate the competitive ad- vantage of active neurons, thus resulting in impaired pruning [29]. It is noteworthy that somewhat elevated pro-BDNF levels in ketamine-treated animals we report herein could be an at- tempt to compensate for a decrease in mature BDNF. Mol Neurobiol (2018) 55:164–172 In conclusion, we report that ketamine exposure during critical stages of mammalian brain development leads to an impaired BDNF homeostasis and delayed pruning of axons known to be critically important for proper cognitive develop- ment. We suggest that disturbance in axonal selection and pruning may lead to a faulty formation of functional neuronal networks among the remaining (Bnormal^) neurons thus resulting in an impaired synaptic neurotransmission we and others have previously reported [1, 21]. Further studies of neuronal circuitry formations vis-à-vis the studies of axonal selection and pruning are needed to make final determination. Acknowledgments This study was supported by the grants R0144517 (NIH/NICHD), R0144517-S (NIH/NICHD), R01 GM118197 (NIH/ NIGMS), R21 HD080281 (NIH/NICHD), John E. Fogarty Award 007423-128322 (NIH), and March of Dimes National Award, USA (to Vesna Jevtovic-Todorovic). Vesna Jevtovic-Todorovic was an Established Investigator of the American Heart Association. We thank Jonathan Park for his assistance with the morphometric analysis of the IPB pruning. Compliance with Ethical Standards Conflicts of Interest The authors declare that they have no competing interests. Human and Animal Rights and Informed Consent The experiments were approved by the Animal Use and Care Committees at the University of Colorado, the Office of Laboratory Animal Resources (OLAR), Aurora, Colorado and the Animal Use and Care Committees of the University of Virginia, Charlottesville, Virginia. The experiments were done in accordance with the Public Health Service’s Policy on Humane Care and Use of Laboratory Animals. References 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF (2003) Early exposure to common anesthetic agents causes widespread neurode- generation in the developing rat brain and persistent learning defi- cits. J Neurosci 23(3):876–882 2. Loepke AW, Istaphanous GK, McAuliffe JJ 3rd, Miles L, Hughes EA, McCann JC, Harlow KE, Kurth CD et al (2009) The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and memory. Anesth Analg 108(1):90–104 3. Paule MG, Li M, Allen RR, Liu F, Zou X, Hotchkiss C, Hanig JP, Patterson TA et al (2011) Ketamine anesthesia during the first week of life can cause long-lasting cognitive deficits in rhesus monkeys. Neurotoxicol Teratol 33(2):220–230 4. Rizzi S, Carter LB, Ori C, Jevtovic-Todorovic V (2008) Clinical anesthesia causes permanent damage to the fetal guinea pig brain. Brain Pathol 18(2):198–210 5. Fredriksson A, Pontén E, Gordh T, Eriksson P (2007) Neonatal exposure to a combination of N-methyl-D-aspartate and gamma- aminobutyric acid type A receptor anesthetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. Anesthesiology 107(3):427–436 6. Viberg H, Pontén E, Eriksson P, Gordh T, Fredriksson A (2008) Neonatal ketamine exposure results in changes in biochemical substrates of neuronal growth and synaptogenesis, and alters adult behavior irreversibly. Toxicology 249(2–3):153–159 7. Kodama M, Satoh Y, Otsubo Y, Araki Y, Yonamine R, Masui K, Kazama T (2011) Neonatal desflurane exposure induces more ro- bust neuroapoptosis than do isoflurane and sevoflurane and impairs working memory. Anesthesiology 115(5):979–991 8. Bishop DL, Misgeld T, Walsh MK, Gan WB, Lichtman JW (2004) Axon branch removal at developing synapses by axosome shed- ding. Neuron 44:651–661 9. Luo L, O’Leary DD (2005) Axon retraction and degeneration in development and disease. Annu Rev Neurosci 28:127–156 10. Wilder RT, Flick RP, Sprung J et al (2009) Early exposure to anes- thesia and learning disabilities in a population-based birth cohort. Anesthesiology 110:796–804 11. Singh KK, Park KJ, Hong EJ, Kramer BM, Greenberg ME, Kaplan DR, Miller FD (2008) Developmental axon pruning mediated by BDNF-p75NTR-dependent axon degeneration. Nat Neurosci 11: 649–658 12. Lu LX, Yon JH, Carter LB, Jevtovic-Todorovic V (2006) General anesthesia activates BDNF-dependent neuroapoptosis in the devel- oping rat brain. Apoptosis 11:1603–1615 13. Pearn ML, Hu Y, Niesman IR, Patel HH, Drummond JC, Roth DM, Akassoglou K, Patel PM et al (2012) Propofol neurotoxicity is mediated by p75 neurotrophin receptor activation. Anesthesiology 116:352–361 14. Young C, Jevtovic-Todorovic V, Qin YQ, Tenkova T, Wang H, Labruyere J, Olney JW (2005) Potential of ketamine and midazo- lam, individually or in combination, to induce apoptotic neurode- generation in the infant mouse brain. Br J Pharmacol 146(2):189– 197 15. Bagri A, Cheng HJ, Yaron A, Pleasure SJ, Tessier-Lavigne M (2003) Stereotyped pruning of long hippocampal axon branches triggered by retraction inducers of the semaphorin family. Cell 113:285–299 16. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V (2005) Anesthesia induces neuronal cell death in the developing rat brain via the intrinsic and extrinsic apoptotic pathways. Neuroscience 135:815–827 17. Liu XB, Low LK, Jones EG, Cheng HJ (2005) Stereotyped axon pruning via plexin signaling is associated with synaptic complex elimination in the hippocampus. J Neurosci 25:9124–9134 18. Lawrence JM, Black IB, Mytilineou C, Field PM, Raisman G (1979) Decentralization of the superior cervical ganglion in neo- nates impairs the development of the innervations of the iris. A quantitative ultrastructural study. Brain Res 168:13–19 19. Majdan M, Miller FD (1999) Neuronal life and death decisions: functional antagonism between the Trk and p75 neurotrophin re- ceptors. Int J Dev Neurosci 17:153–161 20. Miller FD, Kaplan DR (2001) Neurotrophin signaling pathways regulating neuronal apoptosis. Cell Mol Life Sci 58:1045–1053 21. Mintz CD, Barrett KM, Smith SC, Benson DL, Harrison NL (2013) Anesthetics interfere with axon guidance in developing mouse neo- cortical neurons in vitro via a γ-aminobutyric acid type A receptor mechanism. Anesthesiology 118:825–833 22. Singh KK, Miller FD (2005) Activity regulates positive and nega- tive neurotrophin-derived signals to determine axon competition. Neuron 45:837–845 23. Crusio WE, Schwegler H (2005) Learning spatial orientation tasks in the radial-maze and structural variation in the hippocampus in inbred mice. Behav Brain Funct 1(1):3–11 24. Fredriksson A, Archer T, Alm H, Gordh T, Eriksson P (2004) Neurofunctional deficits and potentiated apoptosis by neonatal NMDA antagonist administration. Behav Brain Res 153:367–376 25. Lu Y, Christian K, Lu B (2008) BDNF: a key regulator for protein synthesis-dependent LTP and long-term memory? Neurobiol Learn Mem 89(3):312–323 171 172 26. Thoenen H (1995) Neurotrophins and neuronal plasticity. Science 270:593–598 27. Lu B, Figurov A (1997) Role of neurotrophins in synapse develop- ment and plasticity. Rev Neurosci 8:1–12 28. Woo NH, Teng HK, Siao CJ, Chiaruttini C, Pang PT, Milner TA, Hempstead BL, Lu B (2005) Activation of p75NTR by proBDNF Mol Neurobiol (2018) 55:164–172 facilitates hippocampal long-term depression. Nat Neurosci 8: 1069–1077 29. Chen ZY, Ieraci A, Teng H, Dall H, Meng CX, Herrera DG, Nykjaer A, Hempstead BL et al (2005) Sortilin controls intracellu- lar sorting of brain-derived neurotrophic factor to the regulated secretory pathway. J Neurosci 25:6156–6166",mice,['We exposed post-natal day (PND)7 mice to ketamine using a well-established dosing regimen known to induce significant developmental neurotox- icity.'],postnatal day 7,['We exposed post-natal day (PND)7 mice to ketamine using a well-established dosing regimen known to induce significant developmental neurotox- icity.'],N,[],ketamine,['We exposed post-natal day (PND)7 mice to ketamine using a well-established dosing regimen known to induce significant developmental neurotox- icity.'],none,[],cd-1,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']","The study addresses the issue of how general anesthesia may modulate axon maintenance and pruning, focusing on the role of BDNF.","['However, it is not yet clear whether or how GA impairs selection of appropriate axons and elimination of redundant axons, two balancing forces necessary for the formation and fine-tuning of neuronal networks.']",None,[],The study suggests that ketamine-induced impairment of BDNF homeostasis and impaired axon pruning may explain ketamine-induced impairment of neuronal circuitry formation.,['We conclude that the combined effects on BDNF homeostasis and impaired axon pruning may in part explain ketamine-induced impairment of neuronal cir- cuitry formation.'],None,[],None,[],True,True,True,True,True,True,10.1007/s12035-017-0730-0 10.1007/s10072-014-1726-4,4902.0,Ren,2014,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"Neurol Sci (2014) 35:1401–1404 DOI 10.1007/s10072-014-1726-4 O R I G I N A L A R T I C L E Sevoflurane postconditioning provides neuroprotection against brain hypoxia–ischemia in neonatal rats Xiaoyan Ren • Zhi Wang • Hong Ma • Zhiyi Zuo Received: 25 February 2014 / Accepted: 15 March 2014 / Published online: 5 April 2014 (cid:2) Springer-Verlag Italia 2014 Abstract Application of volatile anesthetics after brain ischemia provides neuroprotection in adult animals (anes- thetic postconditioning). We tested whether postcondi- tioning with sevoflurane, the most commonly used general anesthetic in pediatric anesthesia, reduced neonatal brain injury in rats. Seven-day-old Sprague–Dawley rats were subjected to brain hypoxia–ischemia (HI). They were postconditioned with sevoflurane in the presence or absence of 5-hydroxydecanoic acid, a mitochondrial KATP channel inhibitor. Sevoflurane postconditioning dose- dependently reduced brain tissue loss observed 7 days after brain HI. This effect was induced by clinically relevant concentrations and abolished by 5-hydroxydecanoic acid. These results suggest that sevoflurane postconditioning protects neonatal brain against brain HI via mitochondrial KATP channels. Abbreviations 5-HD KATP channels HI 5-Hydroxydecanoic acid ATP sensitive potassium channels Hypoxia–ischemia Introduction Neonatal brain injury occurs at about one in every 4,000 live births [1]. Most of them survive to adulthood and can long-term neurological and cognitive have significant impairment, such as cerebral palsy and epilepsy [2–4]. Thus, neonatal brain injury has a major impact on patients, their families and our society. However, there are no effective and practical interventions available for use in clinical practice to reduce neonatal brain injury, indicating an urgent need to identify these interventions. Keywords Brain hypoxia–ischemia (cid:2) Neonates (cid:2) Postconditioning (cid:2) Sevoflurane X. Ren (cid:2) H. Ma (&) Department of Anesthesiology, The First Hospital of China Medical University, Shenyang 110001, People’s Republic of China e-mail: mahong5466@yahoo.com X. Ren (cid:2) Z. Wang (cid:2) Z. Zuo (&) Department of Anesthesiology, University of Virginia Health System, 1 Hospital Drive, PO Box 800710, Charlottesville, VA 22908-0710, USA e-mail: zz3c@virginia.edu Neonatal brain injury is usually caused by brain hypoxia, ischemia or the combination of hypoxia and ischemia [1]. This situation is often modeled in rodents by inducing brain hypoxia–ischemia (HI) [5]. It has been shown that applica- tion of isoflurane, a volatile anesthetic used clinically, after focal brain ischemia provides neuroprotection in adult rodents [6]. This isoflurane postconditioning effect also protects brain against neonatal brain HI in rats [7]. However, isoflurane is now not commonly used in pediatric anesthesia in the USA. Sevoflurane is the most commonly used general anesthetic in pediatric anesthesia and also more commonly used in adults than isoflurane in current clinical practice in the USA and many other developed countries [8]. However, it is not known yet whether sevoflurane can induce a post- conditioning effect against neonatal brain HI. Z. Wang Department of Anesthesiology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, China Based on the information of isoflurane postconditioning, we hypothesize that sevoflurane postconditioning reduces 123 1402 neonatal brain injury. To test this hypothesis, we applied sevoflurane after brain HI in neonatal rats. Because mito- chondrial ATP-sensitive potassium (KATP) channels may be involved in neuroprotection and cardioprotection induced by volatile anesthetics [6, 9], we also determined whether mitochondrial KATP channels played a role in the sevoflurane postconditioning effects on neonatal rats using 5-hydroxydecanoic acid (5-HD), a specific inhibitor of mitochondrial KATP channels. Methods All experimental protocols were approved by the Institu- tional Animal Care and Use Committee of the University of Virginia (Charlottesville, VA). All surgical and experi- mental procedures were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH publications number 80-23) revised in 2011. Efforts were made to minimize the number of animals used and their suffering. Neonatal brain hypoxia–ischemia modal Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11]. In brief, neonates were anesthetized by isoflurane and their left common carotid arteries were permanently ligated with a double 7-0 surgical silk. The procedure lasted \5 min. After surgery, neonates were returned to the cages with their mothers for 3 h. The neonates were then placed in a chamber filled with humidified 8 % oxygen–92 % nitrogen for 2 h at 37 (cid:3)C. The oxygen concentration and tempera- ture in the chamber were continuously monitored. Drug application The neonates were randomly divided into the following groups: (1) control, (2) brain HI, (3) brain HI and post- conditioning with 1, 2 and 3 % sevoflurane, (4) brain HI and 5-HD treatment (10 mg/kg) and (5) brain HI, 5-HD treatment and postconditioning with 2 % sevoflurane. Sevoflurane postconditioning was performed by exposing neonates to various concentrations of sevoflurane in 30 % O2 for 1 h immediately after brain HI. Neonates of brain HI alone group were placed in a chamber flushed with 30 % O2 for 1 h. The mitochondrial KATP channel inhibitor 5-HD was dissolved in normal saline and administered intraperitoneally just before the start of brain HI. The dose of 5-HD was based on a previous study in which intra- peritoneal injection of 10 mg/kg 5-HD blocked ischemic preconditioning-induced protection [12]. 123 Neurol Sci (2014) 35:1401–1404 Fig. 1 Neuroprotective effects of sevoflurane. Seven-day-old rats were subjected to or were not subjected to the brain HI and then postconditioned with various concentrations of sevoflurane. Brain was harvested at 7 days after the brain HI. The results are mean ± SD (n = 8–10). *P \ 0.05 compared with control rats. ^P \ 0.05 com- pared with rats that had brain HI only Brain injury/tissue loss quantification After 7 days of the brain HI, rats were sacrificed under deep isoflurane anesthesia and then their brains were har- vested as described previously [11, 13]. The hindbrain was removed from cerebral hemispheres and bilateral hemi- spheres were weighed separately. The weight ratio of left to right hemispheres was calculated. Statistical analysis The results are presented as mean ± SD (n C 6). Statisti- cal analysis was performed by one-way analysis of vari- ance followed by the Tukey’s test. A P B 0.05 was considered statistically significant. Results The control rats had similar right and left hemisphere weights. The left brain HI significantly reduced left cere- bral hemisphere weight examined 7 days after brain HI (weight to right cerebral hemispheres: 0.987 ± 0.012 of control group vs. 0.740 ± 0.049 of brain HI group, n = 8–10, P \ 0.001), suggesting brain tissue loss in this side of brain. This tissue loss was dose- dependently reduced by sevoflurane postconditioning, an effect that was already significant even after being post- conditioned with 1 % sevoflurane (Fig. 1) (weight ratio of left to right cerebral hemispheres: 0.740 ± 0.049 of brain HI group vs. 0.820 ± 0.051 of brain HI plus 1 % sevo- flurane group, n = 8–10, P = 0.003). The sevoflurane ratio of left Neurol Sci (2014) 35:1401–1404 Fig. 2 Inhibition of sevoflurane postconditioning-induced neuropro- tection by a mitochondrial KATP inhibitor. Seven-day-old rats were subjected to or were not subjected to the brain HI and then postconditioned with 2 % sevoflurane in the presence or absence of 10 mg/kg 5-HD. a Representative brain images. The inserted length marker = 2 mm; b Quantification results. The results are mean ± SD (n = 6–10). *P \ 0.05 compared with control rats, ^P \ 0.05 com- pared with rats that had brain HI only, #P \ 0.05 compared with rats that had brain HI and sevoflurane postconditioning. HD 5-HD, Sevo sevoflurane postconditioning effects were abolished by 5-HD (weight ratio of left to right cerebral hemispheres: 0.884 ± 0.049 of brain HI plus 2 % sevoflurane group vs. 0.759 ± 0.044 of brain HI plus 2 % sevoflurane plus 5-HD group, n = 8–10, P \ 0.001), although 5-HD alone did not affect the brain tissue loss caused by brain HI (Fig. 2). Discussion Our results clearly showed that postconditioning with sevoflurane-induced neuroprotection against neonatal brain HI. These results extend the previous finding of isoflurane postconditioning effects in neonatal rats [7] to sevoflurane, 1403 the most commonly used general anesthetic in pediatric anesthesia. To test the effects of sevoflurane, we used the classical Rice–Vannucci model, a widely used and well- characterized animal model to study neonatal brain injury. This model incorporates both brain ischemia and hypoxia, factors that contribute to neonatal brain injury in humans [1, 5]. We monitored brain tissue loss that signifies brain structure damage as showed in our previous studies [11, 13]. Our results suggest that the sevoflurane postconditioning effects may be mediated by mitochondrial KATP channels because 5-HD, a mitochondrial KATP channel inhibitor, abolished sevoflurane effects and 5-HD alone did not alter brain tissue loss after brain HI. Consistent with this finding, our previous study has implicated the involvement of mitochondrial KATP channels in isoflurane postcondition- ing-induced neuroprotection in adult rats after focal brain ischemia [6]. These channels are inhibited by ATP and activated under energy-depleted conditions. They also can be activated by volatile anesthetics [14]. The opening of these channels produces an outward current. This current can maintain the mitochondrial membrane potential and reduce the opening of mitochondrial permeability transi- tion pore to inhibit cell injury and death [15, 16]. Of note, previous studies have shown that application of sevoflurane before brain ischemia (sevoflurane preconditioning) also provides neuroprotection. This effect may be mediated by inhibition of brain inflammation and activation of gluta- mate transporters in the brain [17–19]. Although these mechanisms play a role in the sevoflurane postcondition- ing-induced neuroprotection and whether there is a rela- tionship between these mechanisms and the mitochondrial KATP channel pathway require further investigation. We used cerebral weight ratio to quantify the brain tissue loss after brain HI. The method is used by many studies before and the brain injury quantified by this method is highly correlated with that measured by bio- chemical, electrophysiological and morphometric methods [20, 21]. In addition, the cerebral weight ratio method is simple to perform and very objective. Our finding may have clinical translational implications. Sevoflurane is the most commonly used general anesthetic in pediatric population [8]. It is often used in patients for Cesarean section if general anesthesia is used. One mini- mum alveolar concentration (the concentration in the lungs to prevent movement in 50 % subjects in response to sur- gical stimuli) of sevoflurane is *2 % in human [22] and 2.9 % in rats younger than 30 days [23]. Our results showed that sevoflurane at a concentration as low as 1 % was effective to induce neuroprotection, suggesting that a subclinical concentration for anesthesia can induce the postconditioning effect. In addition, we have demonstrated the postconditioning effect, which may be easy to apply 123 1404 clinically because its application does not require the predication of ischemia occurrence. However, exposure of neonatal mice to 3 % sevoflurane for 6 h can lead to brain cell apoptosis and increase in brain tumor necrosis factor a [24]. Thus, it is judicious to avoid exposure to a high concentration of sevoflurane for a long time so that the potential sevoflurane-induced neurotoxicity will not occur. In summary, we have shown that sevoflurane at clini- cally relevant concentrations can induce a postconditioning effect against neonatal brain injury. This effect may be mediated by mitochondrial KATP channels. Acknowledgments This study was supported by Grants (R01 GM065211 and R01 GM098308 to Z. Zuo) from the National Insti- tutes of Health, Bethesda, Maryland, by a Grant from the International Anesthesia Research Society (2007 Frontiers in Anesthesia Research Award to Z. Zuo), Cleveland, Ohio, by a Grant-in-Aid from the American Affiliate (10GRNT3900019 to Z. Zuo), Baltimore, Maryland, and the Robert M. Epstein Professorship Endowment, University of Virginia. Heart Association Mid-Atlantic Conflict of interest None. References 1. Ferriero DM (2004) Neonatal brain injury. N Engl J Med 351(19):1985–1995 2. Lynch JK, Nelson KB (2001) Epidemiology of perinatal stroke. Curr Opin Pediatr 13:499–505 3. Sran SK, Baumann RJ (1988) Outcome of neonatal strokes. Am J Dis Child 142:1086–1088 4. Sreenan C, Bhargave R, Robertson CM (2000) Cerebral infarc- tion in the term new-born: clinical presentation and long-term outcome. J Pediatr 137:351–355 5. Silbereis JC, Huang EJ, Back SA, Rowitch DH (2010) Towards improved animal models of neonatal white matter injury associ- ated with cerebral palsy. Dis Models Mech 3(11–12):678–688 6. Lee JJ, Li L, Jung H–H, Zuo Z (2008) Postconditioning with isoflurane reduced ischemia-induced brain injury in rats. Anes- thesiology 108:1055–1062 7. Zhou Y, Lekic T, Fathali N, Ostrowski RP, Martin RD, Tang J et al (2010) Isoflurane posttreatment reduces neonatal hypoxic- ischemic brain injury in rats by the sphingosine-1-phosphate/ phosphatidylinositol-3-kinase/Akt 41(7): 1521–1527 pathway. Stroke 8. Fox AJ, Rowbotham DJ (1999) Anaesthesia. BMJ 319(7209): 557–560 9. Obal D, Dettwiler S, Favoccia C, Scharbatke H, Preckel B, Schlack W (2005) The influence of mitochondrial KATP-chan- nels in the cardioprotection of preconditioning and postcondi- tioning by sevoflurane in the rat in vivo. Anesth Analg 101(5):1252–1260 123 Neurol Sci (2014) 35:1401–1404 10. Zhao P, Peng L, Li L, Xu X, Zuo Z (2007) Isoflurane precon- ditioning improves long-term neurologic outcome after hypoxic- rats. Anesthesiology brain ischemic 107(6):963–970 neonatal injury in 11. Wang Z, Zhao H, Peng S, Zuo Z (2013) Intranasal pyrrolidine dithiocarbamate decreases brain inflammatory mediators and provides neuroprotection after brain hypoxia-ischemia in neona- tal rats. Exp Neurol 249:74–82 12. Gozen A, Demiryurek S, Taskin A, Ciralik H, Bilinc H, Kara S et al (2013) Protective activity of ischemic preconditioning on rat testicular ischemia: effects of Y-27632 and 5-hydroxydecanoic acid. J Pediatr Surg 48(7):1565–1572 13. Zhao P, Zuo Z (2004) Isoflurane preconditioning induces neu- roprotection that is inducible nitric oxide synthase-dependent in the neonatal rats. Anesthesiology 101:695–702 14. Jiang MT, Nakae Y, Ljubkovic M, Kwok WM, Stowe DF, Bosnjak ZJ (2007) Isoflurane activates human cardiac mito- chondrial adenosine triphosphate-sensitive K? channels recon- stituted in lipid bilayers. Anesth Analg 105(4):926–932 table of contents 15. Kowaltowski AJ, Seetharaman S, Paucek P, Garlid KD (2001) Bioenergetic consequences of opening the ATP-sensitive K(?) channel of heart mitochondria. Am J Physiol Heart Circ Physiol 280(2):H649–H657 16. Gateau-Roesch O, Argaud L, Ovize M (2006) Mitochondrial permeability transition pore and postconditioning. Cardiovasc Res 70(2):264–273 17. Wang H, Lu S, Yu Q, Liang W, Gao H, Li P et al (2011) Sevoflurane preconditioning confers neuroprotection via anti- inflammatory effects. Front Biosci 3(1):604–615 18. Sanders RD, Manning HJ, Robertson NJ, Ma D, Edwards AD, Hagberg H et al (2010) Preconditioning and postinsult therapies for perinatal hypoxic-ischemic injury at term. Anesthesiology 113(1):233–249 19. Wang C, Lee J, Jung H, Zuo Z (2007) Pretreatment with volatile anesthetics, but not with the nonimmobilizer 1,2-dichlorohexa- fluorocyclobutane, reduced cell injury in rat cerebellar slices after an in vitro simulated ischemia. Brain Res 1152:201–208 20. Andine P, Thordstein M, Kjellmer I, Nordborg C, Thiringer K, Wennberg E et al (1990) Evaluation of brain damage in a rat model of neonatal hypoxic-ischemia. J Neurosci Methods 35(3):253–260 21. McDonald JW, Roeser NF, Silverstein FS, Johnston MV (1989) Quantitative assessment of neuroprotection against NMDA- induced brain injury. Exp Neurol 106(3):289–296 22. Behne M, Wilke HJ, Harder S (1999) Clinical pharmacokinetics of sevoflurane. Clin Pharmacokinet 36(1):13–26 23. Orliaguet G, Vivien B, Langeron O, Bouhemad B, Coriat P, Riou B (2001) Minimum alveolar concentration of volatile anesthetics in rats during postnatal maturation. Anesthesiology 95(3): 734–739 24. Lu Y, Wu X, Dong Y, Xu Z, Zhang Y, Xie Z (2010) Anesthetic sevoflurane causes neurotoxicity differently in neonatal naive and Alzheimer disease transgenic mice. Anesthesiology 112(6): 1404–1416",rats,['Seven-day-old Sprague–Dawley rats were subjected to brain hypoxia–ischemia (HI).'],postnatal day 7,['Seven-day-old Sprague–Dawley rats were subjected to brain hypoxia–ischemia (HI).'],N,[],sevoflurane,"['We tested whether postconditioning with sevoflurane, the most commonly used general anesthetic in pediatric anesthesia, reduced neonatal brain injury in rats.']",none,[],sprague dawley,['Seven-day-old Sprague–Dawley rats were subjected to brain hypoxia–ischemia (HI).'],"The study addresses the challenge of identifying effective and practical interventions to reduce neonatal brain injury, which has not been resolved in existing literature.","['However, there are no effective and practical interventions available for use in clinical practice to reduce neonatal brain injury, indicating an urgent need to identify these interventions.']",None,[],"The findings suggest that sevoflurane postconditioning protects neonatal brain against brain hypoxia-ischemia via mitochondrial KATP channels, which may have clinical translational implications.",['These results suggest that sevoflurane postconditioning protects neonatal brain against brain HI via mitochondrial KATP channels.'],None,[],The potential application of sevoflurane postconditioning in clinical settings to reduce neonatal brain injury.,['Our finding may have clinical translational implications.'],True,True,True,False,True,True,10.1007/s10072-014-1726-4 10.1097/ALN.0000435846.28299.e7,1054.0,Takaenoki,2014,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Neonatal Exposure to Sevoflurane in Mice Causes Deficits in Maternal Behavior Later in Adulthood Yumiko Takaenoki, M.D., Yasushi Satoh, Ph.D., Yoshiyuki Araki, M.D., Mitsuyoshi Kodama, M.D., Ph.D., Ryuji Yonamine, M.D., Shinya Yufune, M.D., Tomiei Kazama, M.D., Ph.D. ABSTRACT Background: In animal models, exposure to general anesthetics induces widespread increases in neuronal apoptosis in the developing brain. Subsequently, abnormalities in brain functioning are found in adulthood, long after the anesthetic exposure. These abnormalities include not only reduced learning abilities but also impaired social behaviors, suggesting pervasive deficits in brain functioning. But the underlying features of these deficits are still largely unknown. Methods: Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture. At 7–9 weeks of age, they were mated with healthy males. The first day after parturition, the maternal behaviors of dams were evaluated. The survival rate of newborn pups was recorded for 6 days after birth. Results: Female mice that received neonatal exposure to sevoflurane could mate normally and deliver healthy pups similar to controls. But these dams often left the pups scattered in the cage and nurtured them very little, so that about half of the pups died within a couple of days. Yet, these dams did not show any deficits in olfactory or exploratory behaviors. Notably, pups born to sevoflurane-treated dams were successfully fostered when nursed by control dams. Mice coadministered of hydrogen gas with sevoflurane did not exhibit the deficits of maternal behaviors. Conclusion: In an animal model, sevoflurane exposure in the developing brain caused serious impairment of maternal behav- iors when fostering their pups, suggesting pervasive impairment of brain functions including innate behavior essential to spe- cies survival. (Anesthesiology 2014; 120:403-15) A CCUMULATING evidence indicates that exposure What We Already Know about This Topic to general anesthetics at clinically effective concentra- tions induces widespread increases in neuronal apoptosis in the developing brain of a variety of animals ranging from rodents to rhesus monkeys.1–10 Furthermore, long after the anesthetic exposure, learning deficits are manifested later in adulthood1–5 even though a significant increase in neuro- nal apoptosis is no longer evident.11 The primary cause of these learning deficits in the adults is not fully understood, which hinders identification of the underlying pathophysiol- ogy. The impairment of brain function caused by neonatal exposure to sevoflurane is not specific to the learning deficit. We previously reported that neonatal exposure to sevoflu- rane induced a disturbance in social behaviors in mice that resembles those observed in subjects with autism.3 This evi- dence suggests that pervasive deficits in brain functioning may be induced. However, there is not enough evidence to support this hypothesis. Anesthetic exposure to neonatal animals results in increased programmed cell death in the brain and altered neurocognitive development The effects of this exposure on innate behavior are relatively unexplored What This Article Tells Us That Is New Female mouse pups exposed to sevoflurane anesthesia ex- hibited deficits in classic maternal behaviors after delivery, an effect which was prevented by coadministration of the antioxi- dant, hydrogen gas with sevoflurane Previous anesthesia exposure did not alter oxytocin or vaso- pressin release in the maternal mice after delivery behavioral task for mice in normal laboratory conditions. Although it is believed that maternal behavior is influenced by hormones,15,16 accumulating evidence suggests a specific hormonal condition is not necessary to induce maternal behaviors. For instance, even nonpregnant nulliparous mice can exhibit maternal behaviors when extensively exposed to pups17 although they are rarely maternal spontaneously and actively avoid pups.18 This evidence indicates that sensory stimuli provided by newborns are important in the rapid onset of maternal behaviors in mammals.19–22 Animals must adapt rapidly to changing environmental conditions. In mammals, pregnant females undergo fun- damental behavioral changes: the pattern of care by moth- ers to their offspring, which is called maternal behavior, is induced in female mothers. Maternal behavior is critical in rodents because pups are born deaf and blind. Neural mechanisms for maternal behavior have been studied most extensively in rodents,12–14 and it may be the most complex Recently, we found a high rate of mortality in pups born to female mice that were exposed to sevoflurane in their early Submitted for publication November 9, 2012. Accepted for publication August 29, 2013. From the Department of Anesthesiology, National Defense Medical College, Tokorozawa, Saitama, Japan. Copyright © 2013, the American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins. Anesthesiology 2014; 120:403-15 Anesthesiology, V 120 • No 2 403 February 2014 Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice stage after birth. In this study, to examine the deficient sur- vival of pups, we investigated whether maternal behavior was impaired in these dams. These mice showed serious impair- ment of maternal behaviors when they fostered their pups although parturition was normal, which severely impaired the survival of their offspring. We hypothesized two possible mechanisms for impairment of maternal behaviors in these dams: circulating neurohormones, vasopressin and oxytocin, which are related to maternal behaviors,23–26 could have been altered by neonatal exposure to general anesthetics. Alter- natively, activation of central circuits underlying maternal behaviors could have been altered without a change in release of vasopressin and oxytocin into the circulation. Accumu- lating evidence suggests the existence of central circuit for maternal behaviors in the medial preoptic area (MPOA) in the rostral hypothalamus.19,27,28 In addition, we hypoth- esized that neonatal exposure to sevoflurane could have altered maternal behavior by a mechanism reversible by anti- oxidant: antioxidant reportedly mitigated behavioral deficits caused by neonatal exposure to general anesthetics.29,30 important difference was set at a 30% decrease from the baseline level in the control group. 3. Behavioral studies: control, sevoflurane, and sevo- flurane + hydrogen groups (n = 10–11 dams for each group); the primary outcome measure was latencies for pup retrieval; in the pup retrieval test, a minimum bio- logically important difference was set at a 30% increase from the baseline level in the control group. 4. Hormonal assay: control, hydrogen, sevoflurane, and sevoflurane + hydrogen groups (n = 4–5 dams for each group); a minimum biologically important difference was set as 30% decrease from the baseline level in the control group. Immunohistochemical study: control and sevoflurane groups (n = 5 dams for each group); a minimum bio- logically important difference was set at a 30% decrease from the baseline level in the control group. 5. In total, we prepared 160 female pups, which received anesthesia or hydrogen treatment at P6 (55 of control, 56 of sevoflurane, 40 of sevoflurane + hydrogen, and 9 of hydrogen groups). Among them, eight pups with sevoflurane and one pup with sevoflurane + hydrogen died during the treatment. Then, these siblings from the same litter were reunited and cohoused till the experiment (mice were similarly caged and housed in all groups). At 3 weeks of age, mice were weaned and allowed to further mature. At 7–9 weeks of age, female mice were mated with healthy males that had not been exposed to any anesthetic. Among them, 23 female mice did not get pregnant (eight of control, six of sevoflurane, five of sevoflurane + hydrogen, and four of hydrogen groups) and 1 control mouse died due to failure of delivery. These mice were excluded from the final analysis. Thus, for first delivery experiments, we used 46 control dams, 42 sevoflu- rane-treated dams, 34 sevoflurane + hydrogen–treated dams, and 5 hydrogen-treated dams. These mice were allocated as described above (1–5 in this section). Materials and Methods Animals All experiments were conducted according to the insti- tutional ethical guidelines for animal experiments of the National Defense Medical College and were approved by the Committee for Animal Research at National Defense Medi- cal College (Tokorozawa, Saitama, Japan). Inbred C57BL/6 mice were used in this study and maintained as described previously.5 Anesthesia and Hydrogen Treatment Sevoflurane anesthesia was carried out as described previously.5 In brief, on postnatal day 6 (P6), pups were placed in a humid chamber immediately after removal of mice from the maternal cage. A 3% concentration of sevoflurane was administered in 30% oxygen as the carrier gas. Control mice were exposed to 30% oxygen. Hydrogen gas (1.3%) was supplied as described previously.30 Total gas flow rate was 2 l/min. Among them, some dams were further analyzed for behavioral studies of parous dams: the same sets of mice for behavioral studies in first-time delivery were reused in behavioral studies in second-time (parous) delivery (control: 7 for survival rate and 11 for behavioral studies; sevoflurane- treated: 8 for survival rate and 10 for behavioral studies). Mouse Study Design In each experiment, siblings from the same litter were ran- domly allocated into one of the following groups so that each group was balanced on littermate. No obvious differ- ences (e.g., body size and weight) were observed within the litters, and there was no significant difference in mean body weight among the groups (data not shown). For paternal study experiments, 26 age-matched male mice were either subjected to anesthesia (n = 13) or control (n = 13) treatment at P6 (no mice died during the treatment). Siblings from the same litter were allocated into each group almost equally (i.e., groups were balanced on littermate). 1. Survival rate of delivered pups: control, sevoflurane, and sevoflurane + hydrogen groups (n = 17–19 dams for each group); a minimum biologically important dif- ference was set at a 30% decrease from the baseline level in the control group. Oxytocin and Vasopressin Assay Plasma concentrations of oxytocin and vasopressin in dams at 10 weeks of age were examined by enzyme-linked immu- nosorbent assay using commercially available kits (Oxytocin enzyme-linked immunosorbent assay kit and arg8-Vasopres- sin enzyme-linked immunosorbent assay kit; Enzo Life Sci- ences, Farmingdale, NY). Assays were performed according 2. Pup exchange test: control and sevoflurane groups (n = 6 dams for each group); a minimum biologically Anesthesiology 2014; 120:403-15 404 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE to the manufacturer’s instructions. Blood samples were col- lected from the inferior vena cava within 6 h after parturition. sniff a pup for the first time and to return each pup to the nest were evaluated. Immunohistochemical Study Immunohistochemical studies using the anti-c-Fos antibody (rabbit polyclonal; sc-52; Santa Cruz Biotechnology, Santa Cruz, CA) were performed as previously described.30 Sam- ples were obtained within 6 h after parturition. The num- bers of immunoreactive cells were counted by an observer blinded to the groups. Evaluation of Parental Behavior Parental behavior of virgin male mice toward pups was eval- uated for 20 min. At the beginning, each mouse was put in one corner of a cage and three new born pups were placed in different corners of the same cage as described in the pup retrieval test. Latencies to sniff a pup for the first time and the numbers of males which committed attacks toward pups were evaluated. If any of the pups was attacked during the test, all pups were removed immediately and this subject was considered as “attack.” Behavioral Studies On the morning of parturition, maternal behaviors were examined. Maternal behavioral studies using first-time mothers were performed at 10–12 weeks of age. The same sets of female mice were reused in the maternal behavioral studies for second-time (parous) mothers: those mice were mated again at 19–25 weeks of age, and maternal behav- iors were examined at 22–28 weeks of age. Paternal behav- ioral studies using male mice were performed at 11 weeks of age. Survival rate (percentage of the number of pups at the indicated day compared with that at birth) was recorded until P6. In each experiment, observation was made by the same observer who was blinded to the groups. All appara- tus used in this study was made by O’Hara & CO., LTD. (Tokyo, Japan). Pup Exchange Test The pup exchange test was conducted as described previ- ously with some modifications.14 Pups born to a female dam couple (a dam with sevoflurane exposure at P6 and a control), which were born on the same day, were exchanged within 12 h after delivery. The number of surviving pups was evaluated for 6 days after birth. Olfactory Test The olfactory test was conducted as described previously.3 Statistical Analysis Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA). Comparisons of the means of each group were performed using Student t test, one-way ANOVA followed by Bonferroni post hoc test, and two-way ANOVA followed by Bonferroni post hoc test. Comparisons of the survival rate until P6 were performed using a log-rank (Mantel-Cox) test. We did not exclude any data in this study. P values of less than 0.05 were considered statistically significant. Values are presented as the mean ± SEM in bar graphs. Evaluation of Maternal Behavior Pregnant females were individually housed for a few days before parturition and examined for maternal behavior on the morning of parturition. The number of pups with milk in their digestive tract and that of poorly cleaned pups (with pla- centa, amniotic membrane, or umbilical cords) was recorded on that day. Nest quality was also evaluated at the same time using the score system described previously31 with some modifications: grade 3, shaped like a deep hollow surrounded by high banks; grade 2, a hollow with medium-height banks; grade 1, flat with low banks, but still discrete; grade 0, no depression in bedding with no banks. Each new dam was also evaluated for time spent crouching over pups and the percentage of newborns scattered for 20 min with minimal disturbance as described previously.32 The percentage of scat- tered pups was expressed as a percentage with respect to time. We calculated the percentage of scatter as follows for each pup: (duration of scatter/total time observed (20 min) × 100). We then calculated the average for each group. These evalua- tions were carried out before the pup retrieval test. Results Survival Was Significantly Impaired in Pups Born to Mothers Exposed to Sevoflurane in Their Early Stage after Birth Female mice were exposed to 3% sevoflurane for 6 h and allowed to mature. These female mice appeared to grow nor- mally and could bear pups. But we found that about half of their pups died within 2 days after birth, whereas pups born to control mice (without exposure to sevoflurane) showed more than 80% survival rate at 6 days after birth (fig. 1). A log-rank analysis confirmed the difference, indicating a significantly lower survival rate in pups from sevoflurane- treated dams compared with those from control dams (P < 0.0001). The number of delivered pups in sevoflurane- treated dams was not significantly differ from control dams (sevoflurane group, n = 110 from 17 dams; control group, n = 124 from 19 dams), indicating that parturition was nor- mal in sevoflurane-treated dams. Pup Retrieval Test The pup retrieval test was performed essentially as described previously.14 Before the test, pups were separated from dams for 30 min. At the beginning, each mouse was put in one corner of a cage and three of her pups were placed in differ- ent corners of the same cage. The cages were continuously observed for 10 min with minimal disturbance. Latencies to Anesthesiology 2014; 120:403-15 405 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice returned to the nest by a dam using mouth grip. Sevoflu- rane-treated dams displayed a significantly longer latency to retrieve the pups than control dams (fig. 3, A–C; t test, sevoflurane-treated dams vs. control dams, t = 2.25, P < 0.05 [first retrieval]; t = 2.33, P < 0.05 [second retrieval]; and t = 2.78, P < 0.05 [complete retrieval]). The impairment of retrieval was not caused by failure of the dams to detect the pups, because latency to approach and sniff a pup for the first time was indistinguishable between sevoflurane-treated and control dams (fig. 3D; t test, sevoflurane-treated dams vs. control dams, t = 0.52, P > 0.05). Furthermore, the olfac- tory test showed that olfactory function was also normal in sevoflurane-treated dams (fig. 3E; t test, sevoflurane-treated dams vs. control dams, t = 0.10, P > 0.05). These results indi- cated that exploratory and investigative behaviors toward pups were normal in sevoflurane-treated dams, yet they were unable to effectively perform maternal behaviors. Fig. 1. Neonatal exposure to sevoflurane in female mice caused insufficient survival of their pups. Pup survival rate was assessed for 6 days using 110 (born to sevoflurane- treated dams [n = 17]) and 124 pups (born to control dams [n = 19]). About half of the pups born to sevoflurane-treated dams died, whereas pups born to control dams showed >80% surviving rate. Maternal Nurturing Was Impaired in Mice Exposed to Sevoflurane in Their Early Stage after Birth The number of pups that did not have milk in their diges- tive tracts was increased in pups born to sevoflurane-treated dams when compared with pups born to control dams (fig. 2, A and B). However, the ratio of poorly cleaned pups was indistinguishable between them (fig. 2C). Survival Deficits of the Pups Lay Entirely with Dams The reduced pup survival was likely caused by the impair- ment of maternal behaviors in sevoflurane-treated dams. To confirm whether the high mortality rate of pups born to sevo- flurane-treated dams was caused by dams or pups, we carried out the pup exchange test. In this test, pups born to sevoflu- rane-treated dams were successfully fostered when nursed by control dams (fig. 4A). But, more than half of pups born to control dams died when nursed by sevoflurane-treated dams (fig. 4A). A log-rank analysis indicated that the survival rate of pups nurtured by sevoflurane-treated dams was significantly lower than the survival rate of pups nurtured by control dams during the 6 days after birth (P < 0.0001). In addition, the pups born to 3% sevoflurane-treated dams but nursed by control dams had milk in their digestive tracts, whereas pups born to controls but nursed by sevoflurane-treated mice did not (fig. 4B). Thus, we concluded that the sevoflurane-treated dams caused the survival deficit of the pups. Furthermore, to assess whether the excess mortality of pups born to sevoflurane-treated dams was caused by defects in nurturing, we investigated maternal behaviors in sevoflu- rane-treated dams. Around the time of delivery, mice usu- ally prepare a high-walled, corner nest, which is significantly different from the flat, centrally located, sleeping pad of the nonpregnant female.20 Because these features are characteris- tic of maternal females, the evaluation of nest quality is often used as an indicator of maternal behavior.20 We found that sevoflurane-treated dams exhibited incomplete nest building compared with control dams (fig. 2, D–G). Comparison of the nest quality scores confirmed the difference, indicating the significant difference between sevoflurane-treated dams and controls (fig. 2G; t test, t = 3.32, P < 0.01). In addition, we examined the ratio of scattered pups as another indicator of maternal behavior.32,33 We found that the ratio of scat- tered pups out of the nest was significantly higher in the sevoflurane-treated dams (fig. 2H; t test, sevoflurane-treated group vs. control group, t = 2.17, P < 0.05). Maternal Behavior Was Not Impaired in Second-time Parous Dams that Were Exposed to Sevoflurane in Their Early Stage after Birth Subsequent to the first delivery, mice usually show a perma- nently enhanced rate of induction of maternal behaviors20 although the underlying mechanism is largely unknown. Therefore, we investigated whether maternal behaviors were also impaired in second-time parous mice that were exposed to sevoflurane at P6. We found that pup survival rate was indistinguishable between the sevoflurane-treated second-time parous dams and the second-time parous con- trol dams during the 6 days after birth (fig. 5). A log-rank analysis indicated that the survival rate of pups nurtured by sevoflurane-treated second-time parous dams was not sig- nificantly different from those of control dams during the 6 days after birth (P > 0.05). Majority of pups born to parous dams exposed to sevoflurane were cleaned and had milk in their digestive tracts, similar to pups born to parous control When all pups are in the nest, the dam normally hov- ers over them, allowing pups to suckle (crouching). We found that sevoflurane-treated dams exhibited a significantly shorter duration of crouching compared with control dams (fig. 2I; t test, sevoflurane-treated dams vs. control dams, t = 3.84, P < 0.01). Maternal behavior was further evaluated by the pup retrieval test, which is frequently used to measure maternal behavior.14,32,34,35 In the test, we monitored the response of dams to three pups placed in different corners of the cage for 10 min. Pups that wander from the nest are usually Anesthesiology 2014; 120:403-15 406 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE A B C D E F G H I Fig. 2. Neonatal exposure to sevoflurane in mice caused deficits in maternal behaviors later in adulthood. The aspects of maternal behaviors were assessed on the day of parturition. The same sets of mice were used in all tests shown in figure 2 (control dams, n = 11; sevoflurane-treated dams, n = 10). (A) Pups nursed by control dams (Cont) had milk in their digestive tract (arrow), whereas pups nursed by sevoflurane-treated dams (Sevo) did not. (B) Ratio of pups with or without milk in the digestive tract. (C) Ratio of cleaned or poorly cleaned pups. (D–F) Representative images of nests made by sevoflurane-treated mice and controls. (D) A control dam built a crater-like hollow with high banks, and no pups were scattered outside of the nest. (E) When the dam was removed from the nest, pups under the crouching dam in the deep bottom were apparent. Sevoflurane-treated dams built much shallower or flat nests. (F) Significantly more pups were scattered outside of the nest. (G) The nest quality scores (grade 0–3). (H) Percentage of scattered pups outside of the nest. (I) Time spent crouching over the pups in the nest. *P < 0.05, **P < 0.01 (t test). dams (fig. 6, A and B). Sevoflurane-treated parous dams also exhibited nest quality scores similar to parous control dams (fig. 6C; t test, sevoflurane-treated dams vs. control dams, t = 0.61, P > 0.05). The ratio of scattered pups was not sig- nificantly different between sevoflurane-treated parous dams and parous control dams (fig. 6D; t test, sevoflurane-treated group vs. control group, t = 0.93, P > 0.05). Time spent crouching was also indistinguishable between them (fig. 6E; t test, sevoflurane-treated dams vs. control dams, t = 0.36, P > 0.05). t = 0.07, P > 0.05 [first retrieval]; t = 0.06, P > 0.05 [second retrieval]; and t = 0.04, P > 0.05 [complete retrieval]). The latency to approach and sniff a pup for the first time was also indistinguishable between them (fig. 7B; t test, sevoflurane- treated dams vs. control dams, t = 0.83, P > 0.05). These results indicated that maternal behaviors of parous dams were indistinguishable regardless of sevoflurane exposure in their early stage after birth. Parental Behaviors Were Impaired in Male Mice That Were Exposed to Sevoflurane in Their Early Stage after Birth Accumulating evidence suggests that the neural circuit for maternal behavior exists in males as well as female mice.20 In the pup retrieval test, sevoflurane-treated parous dams displayed latencies to retrieve the pups similar to controls (fig. 7A; t test, sevoflurane-treated dams vs. control dams, Anesthesiology 2014; 120:403-15 407 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice A B A B C Fig. 4. The pup exchange test demonstrated that the re- duced survival of pups lay entirely with dams. Pups were cross-fostered by sevoflurane-treated dams and control dams. (A) Six paired sevoflurane-treated and control dams that produced six to nine pups each were exchanged within 12 h after delivery. Pup survival rate was assessed for 6 days using 44 (born to sevoflurane-treated dams but nursed by control dams) and 45 pups (born to control dams but nursed by sevoflurane-treated dams). (B) Pups born to sevoflurane- treated dams had milk in the digestive tract (arrow) when nursed by control mice (Cont), whereas pups born to con- trol dams had no milk in the digestive tract when nursed by sevoflurane-treated dams (Sevo). D E Hydrogen Coadministration Mitigated Impairments of Maternal Behavior Caused by Sevoflurane Exposure in Their Early Stage after Birth We recently showed that the antioxidative effects of molecu- lar hydrogen gas suppressed neurotoxicity caused by neo- natal exposure to anesthetics in the developing brain.30 Hydrogen gas can be easily supplied as part of the carrier gas mixture during anesthesia. Thus, we sought to investigate whether coadministration of hydrogen gas with sevoflurane could effectively suppress impairments of maternal behaviors caused by neonatal anesthetic exposure. Fig. 3. Pup retrieval responses were impaired in sevoflurane- exposed, first-time dams on the day of parturition. Same sets of dams for figure 2 were used. At the beginning, each dam was put in one corner of a cage and three of her pups were placed in different corners of the same cage. (A and B) Representative images of dams in the retrieval test at 2 min. (A) Control dams retrieved all pups within a couple of minutes. (B) But majority of pups born to sevoflurane-treated dams were still scattered out- side of the nest at 2 min (right). (C) Latency to retrieve each pup by sevoflurane-treated dams or control dams. (D) Latency to sniff a pup for the first time. (E) The olfactory test. *P < 0.05 (t test). The survival deficits of pups born to dams exposed to sevoflurane at P6 was prevented by coadministration of 1.3% hydrogen gas with sevoflurane (fig. 9). A log-rank anal- ysis indicated that pup survival rate was indistinguishable between the control dams and the sevoflurane + hydrogen– treated dams (P > 0.05). Furthermore, a log-rank analysis In some rodents, behavior toward the young is essentially the same for each sex.36,37 To investigate whether parental behavior is impaired by neonatal exposure to sevoflurane, sevoflurane-treated virgin male mice were exposed to three newborn pups for 20 min. The latency to approach and sniff a pup for the first time was indistinguishable regard- less of neonatal exposure to sevoflurane (fig. 8A; t test, sevo- flurane-treated male vs. control male, t = 0.37, P > 0.05). But we observed that some of sevoflurane-treated males bit pups within a few minutes after exposure to newborn pups, whereas control males did not commit attacks (fig. 8B). Thus, nurturing behaviors were impaired in male mice simi- lar to first-time mothers. Fig. 5. Maternal behavior was not impaired in parous dams that were exposed to sevoflurane at P6. Pup survival rate was assessed for 6 days using 59 pups (born to sevoflurane-treat- ed parous [second-time] dams [n = 8]) and 48 (born to control parous [second-time] dams [n = 7]). Anesthesiology 2014; 120:403-15 408 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE A B C D E Fig. 6. Maternal behaviors in sevoflurane-treated parous dams were normal. The aspects of maternal behaviors were assessed on the day of parturition. Same sets of mice were used in all tests shown in figure 6 (parous control dams, n = 11; sevoflurane- treated parous dams, n = 10). (A) The ratio of pups with or without milk in the digestive tract. (B) The ratio of cleaned or poorly cleaned pups. (C) The nest quality scores (grade 0–3). (D) Percentage of scattered pups outside of the nest. (E) Time spent crouching over the pups in the nest. also indicated that the pup survival rate of the sevoflurane + hydrogen–treated dams was significantly higher than that of the sevoflurane-treated dams (P < 0.0001). between them (fig. 10B). Furthermore, we found that the sevoflurane + hydrogen–treated dams exhibited a normal nest-building score (fig. 10C), a normal ratio of scattered pups in their home cage (fig. 10D), and a normal duration of crouching (fig. 10E) compared with those of the con- trol dams. A one-way ANOVA followed by Bonferroni post hoc test confirmed these findings, indicating no significant The number of pups that did not have milk in their digestive tracts was indistinguishable between the control group and sevoflurane + hydrogen–treated dams (fig. 10A). The ratio of poorly cleaned pups was also indistinguishable A B 0 Fig. 7. Pup retrieval responses were normal in sevoflurane-treated parous mice. Same sets of dams for figure 6 were used. (A) Latency to retrieve each pup by sevoflurane-treated parous dams and parous control dams. (B) Latency to sniff a pup for the first time. Anesthesiology 2014; 120:403-15 409 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice Plasma Concentrations of Oxytocin and Vasopressin Were Not Significantly Changed in Sevoflurane-treated Dams Oxytocin and vasopressin are known to be implicated in the induction of maternal behaviors.23–26 It is possible that neo- natal exposure to anesthetics might alter the release of these hormones, leading to the impairment of maternal behav- ior. Therefore, we sought to examine whether the plasma concentration levels of oxytocin and vasopressin could be disrupted in sevoflurane-treated dams by the use of enzyme- linked immunosorbent assay. Furthermore, to exclude the possibility that the exposure to hydrogen gas per se counter- acts perturbations in hormonal levels, we also examined the plasma concentration levels of these hormones in hydrogen- treated mice. We found that there was no significant change in plasma oxytocin concentration on the day of parturition when comparing control, sevoflurane, hydrogen, and sevo- flurane + hydrogen groups (fig. 12A). A two-way ANOVA confirmed this, indicating no significant main effect of sevo- flurane treatment (F = 0.005, P > 0.05) and of hydrogen treatment (F = 0.012, P > 0.05). The interaction between sevoflurane and hydrogen treatment was not significant as well (F = 0.446, P > 0.05). A B Fig. 8. Parental behaviors were impaired in male mice that were exposed to sevoflurane at P6. Each mouse (control group: n = 13; sevoflurane-treated group: n = 13) was put in one corner of a cage, and three pups from healthy dams were placed in different corners of the same cage. (A) Latency to sniff a pup for the first time. (B) Percentage of attacking and not attacking male mice. differences between sevoflurane + hydrogen–treated dams and controls in these tests (fig. 10, C–E; F and P values are presented below each panel; post hoc test, P > 0.05 for each test). In the pup retrieval test, the sevoflurane + hydro- gen–treated dams performed similar to the control dams (fig. 11A). A one-way ANOVA followed by Bonferroni post hoc test confirmed this, indicating no significant difference between sevoflurane + hydrogen–treated dams and controls in each retrieval (fig. 11A; F and P values are presented below each panel; post hoc test, P > 0.05 for each retrieval). We did not detect significant differences in the analysis for laten- cies to approach and to sniff a pup for the first time among groups (fig. 11B; one-way ANOVA, F = 0.19, P > 0.05). Olfaction abilities were also indistinguishable among groups (fig. 11C; one-way ANOVA, F = 0.008, P > 0.05). Together, it can be concluded that concomitant hydrogen inhalation significantly mitigated impairment of maternal behaviors caused by neonatal exposure to sevoflurane. Similarly, there was no significant change in plasma vaso- pressin concentration on the day of parturition when com- paring control, sevoflurane, hydrogen, and sevoflurane + hydrogen groups (fig. 12B). A two-way ANOVA confirmed this, indicating no significant main effect of sevoflurane treatment (F = 0.018, P > 0.05) and of hydrogen treat- ment (F = 1.194, P > 0.05). The interaction between sevo- flurane and hydrogen treatment was not significant as well (F = 0.206, P > 0.05). Therefore, we concluded that neither neonatal exposure to sevoflurane nor to hydrogen altered the blood concentration levels of oxytocin and vasopressin when fostering their pups. The Number of c-Fos–Immunopositive Cells Decreased in the MPOA in Sevoflurane-treated Dams Modification of neurons in the MPOA in the rostral hypo- thalamus is required to express maternal behaviors.19,27,28 It was reported that when a mouse takes care of pups, c-Fos is induced in the MPOA.38,39 Thus, we set out to quantify the number of c-Fos–immunopositive cells in the MPOA from maternal dams when fostering their pups. In sevoflurane- treated dams, the number of c-Fos–immunopositive cells was significantly reduced in the MPOA when compared with control dams (fig. 13, A and B; t test, sevoflurane-treated dams vs. control dams, t = 6.92, P < 0.001). This finding suggested that neonatal exposure to sevoflurane disrupted neural mechanism to induce maternal behavior. Fig. 9. Hydrogen coadministration mitigated the deficient sur- vival rate in pups caused by sevoflurane exposure to dams in their early stage after birth. Pup survival rate was assessed for 6 days using 124 (born to control dams [n = 19]), 110 (born to sevoflurane-treated dams [n = 17]), and 128 pups (born to sevoflurane + hydrogen-treated dams [n = 19]). The same data for the control group and sevoflurane-treated group in figure 1 are reused. Discussion In this study, we showed that sevoflurane exposure in the developing brain of female mice caused serious impair- ment of maternal behaviors when fostering their pups although parturition was normal. Furthermore, survival Anesthesiology 2014; 120:403-15 410 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE A B C D E Fig. 10. Hydrogen coadministration mitigated impairments of maternal behavior caused by sevoflurane exposure to dams in their early stage after birth. The aspects of maternal behaviors were assessed on the day of parturition. Same sets of mice were used in all tests shown in figure 10 (control dams, n = 11; sevoflurane-treated dams, n = 10; sevoflurane + hydrogen coadmin- istered dams, n = 10). The same data for the control dams and sevoflurane-treated dams in figure 2 are reused. (A) Ratio of pups with or without milk in the digestive tract. (B) Ratio of cleaned or poorly cleaned pups. (C) The nest quality score (grade 0–3). (D) Percentage of scattered pups outside of the nest. (E) Time spent crouching over the pups in the nest. Comparisons were performed using a one-way ANOVA followed by Bonferroni post hoc test. F and P values are presented below each panel. *P < 0.05, **P <0.01, ***P < 0.001. (placentophagia).20 Because these behaviors are char- acteristic of maternal females, some researchers classify them as one of maternal behaviors. However, from the dam’s perspective, afterbirth materials contain attractive substances such as placental opioid-enhancing factor that potentiate the antihyperalgesic properties of endogenous opioids.20 Thus, cleaning pup is not a maternal behavior in the sense of pup-directed caretaking behavior. rate was severely impaired in pups born to sevoflurane- treated dams. Pup exchange test showed that the sur- vival impairment of the pups lay entirely with dams. Taken together, deficits in maternal behavior of sevoflu- rane-treated dams caused the impaired survival of their offspring. The deficits in maternal behavior in sevoflu- rane-treated virgin females were not attributed to the secondary effect of other changes such as locomotor or olfactory functions because exploratory and investiga- tive behaviors toward pups were normal in these dams. It should be noted that all dams, irrespective of sevo- flurane treatment, promptly approached pups when the pups were placed outside the nest, indicating that neo- natal exposure to sevoflurane might not cause an inabil- ity to detect sensory cues emanating from pups. We did not find significant difference in pup-cleaning behavior between sevoflurane-treated dams and controls. At deliv- ery, normal dams usually devote an inordinate amount of attention to birth material and ingest the afterbirth We found that blood concentrations of oxytocin and vasopressin were not significantly changed in sevoflurane- treated dams compared with controls when fostering their pups. However, some studies reported that neonatal expo- sure to general anesthetics increased proinflammatory cyto- kines and stress hormones shortly after the anesthesia.40–44 Because some hormones are known to play important roles in neuronal development,45,46 we cannot exclude the pos- sibility that neonatal exposure to general anesthetics could cause impairment to hormone dynamics shortly after the anesthesia, which might affect neuronal development. Anesthesiology 2014; 120:403-15 411 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice A A B Fig. 12. Plasma concentrations of oxytocin and vasopressin were not significantly changed in sevoflurane-treated dams. (A) Levels of plasma oxytocin concentration (control dams, n = 5; sevoflurane-treated dams, n = 4; sevoflurane and hy- drogen–treated dams, n = 5; and hydrogen-treated dams, n = 5). (B) Levels of plasma vasopressin (control dams, n = 5; sevoflurane-treated dams, n = 4; sevoflurane and hydrogen– treated dams, n = 4; and hydrogen-treated dams, n = 5). B C density protein-95 in the hippocampus.40 Because postsyn- aptic density protein-95 is a candidate molecule implicated in synaptic plasticity,49,50 neonatal exposure to anesthetics might impair synaptic plasticity, which is required to mod- ulate neuronal circuit. Thus, one might speculate that the impairment of the hippocampus was involved in the impair- ment of maternal behaviors in sevoflurane-treated dams. Fur- thermore, it was reported that lesions in the hippocampus disrupted maternal behavior in rats although the underlying mechanism was largely unknown.51 However, some studies reported that limbic structures including the hippocampus are important but not essential for maternal behavior.52–54 One might also speculate that the defect in maternal behav- iors was secondary to learning or memory deficits in sevoflu- rane-treated mice. However, a defect in maternal behavior is not necessarily indicative of these deficits. Indeed, there are mice that have deficits in maternal behaviors but not in learn- ing and memory. For instance, mice lacking the immediate early gene fosB showed deficits in maternal behaviors but not in learning ability.13 Fig. 11. Pup retrieval responses were mitigated in sevoflu- rane + hydrogen–treated dams. Same sets of dams for fig- ure 10 were used. The same data for the control dams and sevoflurane-treated dams in figure 3 are reused. (A) Latency to retrieve pups by sevoflurane-treated dams, sevoflurane + hydrogen–treated dams and control dams. (B) Latency to sniff a pup for the first time. (C) The olfactory test. Comparisons were performed using a one-way ANOVA followed by Bonfer- roni post hoc test. F and P values are presented below each panel. *P < 0.05, **P < 0.01. We found that the number of c-Fos–immunoreactive cells was significantly decreased in the MPOA from sevo- flurane-treated dams when compared with controls. Accu- mulating evidence indicates that the MPOA in the rostral hypothalamus plays critical roles in the induction of mater- nal behavior.19,27,28 Stimulation from pups converges on the MPOA, and it activates neurons in the MPOA. Then, the activated neurons induce the expression of transcription fac- tors such as c-Fos and its homolog FosB. These transcription factors are known to be essential for the facilitation of mater- nal behaviors.13,31,34 Thus, the reduced induction of c-Fos in the MPOA suggested that neonatal exposure to anesthet- ics impaired neuronal mechanism that plays critical role in maternal behavior. How does neonatal exposure to general anesthetics cause impairment of maternal behaviors in mice? Although the molecular, cellular, and neurological mechanisms are largely unknown, accumulating evidence indicated that expression of maternal behaviors seems to require change of the neu- ral circuit in the brain.34 Generally, once virgin females are sensitized by extensive exposure to pups, maternal behaviors last for at least several days without further pup exposure. Therefore, the experience of pup exposure may be important to elicit changes in the neural circuit for maternal behav- iors, which modify maternal responsiveness in a long-lasting manner. Taking this into consideration, one possible expla- nation for the impairment of maternal behavior in sevoflu- rane-treated mice is that the neural circuit indispensable for this type of behavior might be stunted in these mice. But the mothering experience at the first delivery might add an additional redundant route, via memory, to the process of activating the maternal neural circuit. Thus, second-time The hippocampus plays critical roles in multiple brain functions including working memory, which is required to do complex cognitive tasks.47,48 Hippocampus is known to be vulnerable to neonatal exposure to general anesthetics. For instance, it was reported that neonatal exposure to general anesthetics reportedly decreased the expression of postsynaptic Anesthesiology 2014; 120:403-15 412 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE A B Fig. 13. The number of c-Fos–immunopositive cells in the medial preoptic area (MPOA) decreased in sevoflurane-treated dams on the day of parturition. (A) Immunohistochemical staining for c-Fos in the MPOA (control dams: n = 5; sevoflurane-treated dams: n = 5). Scale bars: 250 μm. (B) Quantification of the immunohistochemical staining. ***P < 0.001 (t test). parous dams could foster pups irrespective of sevoflurane exposure. An alternative explanation is that stimuli ema- nating from newborn pups might not sufficiently activate the maternal neural circuit in the sevoflurane-treated mice: because of the failure to change the neural circuit effectively in sevoflurane-treated dams, they could not overcome the threshold to express maternal behavior. However, the par- tial change of the maternal neural circuit induced at the first delivery might contribute to overcome the threshold at the second delivery. In both cases, the adaptation to induce maternal behavior might depend on finely tuned neuronal mechanisms in the circuit for maternal behavior. It should be noted that the capacity to learn still remained in sevo- flurane-treated mice because maternal behavior deficit was no longer apparent after the birth of the second litter. This is consistent with a report that environmental enrichment reversed anesthetic-induced memory impairments in the rat developing brain almost completely even when instituted with substantial delay.55 Although there are interpretative limitations to translate ani- mal models to humans, an understanding of the neurobio- logical basis for the deficits of maternal behavior caused by neonatal exposure to sevoflurane is important in psychiatric medicine and would be helpful for ensuring safer anesthesia in pediatric medicine. In conclusion, sevoflurane exposure in the mouse devel- oping brain causes serious impairment of maternal behav- iors when the females foster their pups although parturition is normal. We previously showed that neonatal exposure to sevoflurane caused impairments of social behaviors that resemble those observed in autism.3 Together with the previous reports, it may be concluded that in an animal model, neonatal exposure to general anesthetics causes pervasive deficits in brain functioning including even an innate behavior that is essential to species survival. Further molecular neuropathological investigations are necessary to fully explain the diverse behavioral alterations caused by neonatal exposure to general anesthetics. It was reported that oxidative stress was involved in anesthetic-induced neurotoxicity in the developing brain.29 Hydrogen has recently received attention as an effective antioxidant because of its small size and electrically neutral properties, enabling it to reach target organs easily, to diffuse across cell membranes rapidly, and to penetrate the blood– brain barrier for the protection of neurons.56 We previously showed that coadministation of hydrogen gas significantly suppressed the increase in neuroapoptosis and subsequently mitigated the deficits in social behaviors as well as learn- ing deficits caused by neonatal exposure to sevoflurane.30 In the current study, we show that coadministration of hydrogen gas significantly reduced impairment of mater- nal behaviors caused by neonatal exposure to sevoflurane, suggesting further potential of hydrogen coadministration for therapeutic use. Acknowledgments The authors thank Ms. Kiyoko Takamiya and Mrs. Yuko Ogura (Department of Anesthesiology, National Defense Medical College, Tokorozawa, Saitama, Japan) for excellent technical help in this study. This work was supported by Japan Society for the Pro- motion of Science ( JSPS; Tokyo, Japan); grant numbers 22500304, 23791734, 25861404, and 25293331. Competing Interests The authors declare no competing interests. Correspondence Address correspondence to Dr. Satoh: Department of Anes- thesiology, National Defense Medical College, 3-2 Namiki, Tokorozawa 359–8513, Japan. wndlt3@gmail.com. Informa- tion on purchasing reprints may be found at www.anesthe- siology.org or on the masthead page at the beginning of this issue. ANeSTheSIOlOgY’s articles are made freely accessible to all readers, for personal use only, 6 months from the cover date of the issue. Similarities in the maternal behaviors of humans and rodents suggest an existence of a general neural circuit for these behaviors. In humans, child abuse and neglect are global problems with serious life-long consequences, includ- ing increased likelihood for a wide range of mental disorders. Anesthesiology 2014; 120:403-15 413 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 Maternal Behavior in Sevoflurane-treated Mice nulliparous and parturient females. Physiol Behav 1981; 27:863–8 References 1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND, Dikranian K, Zorumski CF, Olney JW, Wozniak DF: Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J Neurosci 2003; 23:876–82 19. Numan M: Motivational systems and the neural circuitry of maternal behavior in the rat. Dev Psychobiol 2007; 49:12–21 20. Kristal MB: The biopsychology of maternal behavior in non- human mammals. ILAR J 2009; 50:51–63 2. Stratmann G, Sall JW, May LD, Bell JS, Magnusson KR, Rau V, Visrodia KH, Alvi RS, Ku B, Lee MT, Dai R: Isoflurane differ- entially affects neurogenesis and long-term neurocognitive function in 60-day-old and 7-day-old rats. ANESTHESIOLOGY 2009; 110:834–48 21. Stern JM, Lonstein JS: Neural mediation of nursing and related maternal behaviors. Prog Brain Res 2001; 133:263–78 22. Brunelli SA, Shair HN, Hofer MA: Hypothermic vocalizations of rat pups (Rattus norvegicus) elicit and direct maternal search behavior. J Comp Psychol 1994; 108:298–303 3. Satomoto M, Satoh Y, Terui K, Miyao H, Takishima K, Ito M, Imaki J: Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. ANESTHESIOLOGY 2009; 110:628–37 23. Bick J, Dozier M: Mothers’ and children’s concentrations of oxytocin following close, physical interactions with bio- logical and non-biological children. Dev Psychobiol 2010; 52:100–7 4. Fredriksson A, Pontén E, Gordh T, Eriksson P: Neonatal exposure to a combination of N-methyl-D-aspartate and gamma-aminobutyric acid type A receptor anes- thetic agents potentiates apoptotic neurodegeneration and persistent behavioral deficits. ANESTHESIOLOGY 2007; 107:427–36 24. van Leengoed E, Kerker E, Swanson HH: Inhibition of post- partum maternal behaviour in the rat by injecting an oxyto- cin antagonist into the cerebral ventricles. J Endocrinol 1987; 112:275–82 25. Lee HJ, Macbeth AH, Pagani JH, Young WS III: Oxytocin: The great facilitator of life. Prog Neurobiol 2009; 88:127–51 26. Bosch OJ, Neumann ID: Brain vasopressin is an important regulator of maternal behavior independent of dams’ trait anxiety. Proc Natl Acad Sci U S A 2008; 105:17139–44 5. Kodama M, Satoh Y, Otsubo Y, Araki Y, Yonamine R, Masui K, Kazama T: Neonatal desflurane exposure induces more robust neuroapoptosis than do isoflurane and sevoflu- rane and impairs working memory. ANESTHESIOLOGY 2011; 115:979–91 27. Numan M: A neural circuitry analysis of maternal behavior in the rat. Acta Paediatr Suppl 1994; 397:19–28 6. Brambrink AM, Evers AS, Avidan MS, Farber NB, Smith DJ, Zhang X, Dissen GA, Creeley CE, Olney JW: Isoflurane- induced neuroapoptosis in the neonatal rhesus macaque brain. ANESTHESIOLOGY 2010; 112:834–41 28. Numan M: Hypothalamic neural circuits regulating maternal responsiveness toward infants. Behav Cogn Neurosci Rev 2006; 5:163–90 29. Boscolo A, Starr JA, Sanchez V, Lunardi N, DiGruccio MR, Ori C, Erisir A, Trimmer P, Bennett J, Jevtovic-Todorovic V: The abolishment of anesthesia-induced cognitive impairment by timely protection of mitochondria in the developing rat brain: The importance of free oxygen radicals and mitochon- drial integrity. Neurobiol Dis 2012; 45:1031–41 7. Cattano D, Young C, Straiko MM, Olney JW: Subanesthetic doses of propofol induce neuroapoptosis in the infant mouse brain. Anesth Analg 2008; 106:1712–4 8. Palanisamy A, Baxter MG, Keel PK, Xie Z, Crosby G, Culley DJ: Rats exposed to isoflurane in utero during early gestation are behaviorally abnormal as adults. ANESTHESIOLOGY 2011; 114:521–8 30. Yonamine R, Satoh Y, Kodama M, Araki Y, Kazama T: Coadministration of hydrogen gas as part of the carrier gas mixture suppresses neuronal apoptosis and subsequent behavioral deficits caused by neonatal exposure to sevoflu- rane in mice. ANESTHESIOLOGY 2013; 118:105–13 9. Johnson SA, Young C, Olney JW: Isoflurane-induced neuro- apoptosis in the developing brain of nonhypoglycemic mice. J Neurosurg Anesthesiol 2008; 20:21–8 10. Slikker W Jr, Zou X, Hotchkiss CE, Divine RL, Sadovova N, Twaddle NC, Doerge DR, Scallet AC, Patterson TA, Hanig JP, Paule MG, Wang C: Ketamine-induced neuronal cell death in the perinatal rhesus monkey. Toxicol Sci 2007; 98:145–58 11. Loepke AW, Istaphanous GK, McAuliffe JJ III, Miles L, Hughes EA, McCann JC, Harlow KE, Kurth CD, Williams MT, Vorhees CV, Danzer SC: The effects of neonatal isoflurane exposure in mice on brain cell viability, adult behavior, learning, and memory. Anesth Analg 2009; 108:90–104 31. Kuroda KO, Meaney MJ, Uetani N, Kato T: Neurobehavioral basis of the impaired nurturing in mice lacking the immedi- ate early gene FosB. Brain Res 2008; 1211:57–71 32. Takayanagi Y, Yoshida M, Bielsky IF, Ross HE, Kawamata M, Onaka T, Yanagisawa T, Kimura T, Matzuk MM, Young LJ, Nishimori K: Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc Natl Acad Sci U S A 2005; 102:16096–101 33. Brooks LR, Le CD, Chung WC, Tsai PS: Maternal behavior in transgenic mice with reduced fibroblast growth factor recep- tor function in gonadotropin-releasing hormone neurons. Behav Brain Funct 2012; 8:47 12. Numan M, Numan MJ, Marzella SR, Palumbo A: Expression of c-fos, fos B, and egr-1 in the medial preoptic area and bed nucleus of the stria terminalis during maternal behavior in rats. Brain Res 1998; 792:348–52 34. Kuroda KO, Meaney MJ, Uetani N, Fortin Y, Ponton A, Kato T: ERK-FosB signaling in dorsal MPOA neurons plays a major role in the initiation of parental behavior in mice. Mol Cell Neurosci 2007; 36:121–31 13. Brown JR, Ye H, Bronson RT, Dikkes P, Greenberg ME: A defect in nurturing in mice lacking the immediate early gene fosB. Cell 1996; 86:297–309 14. Satoh Y, Endo S, Nakata T, Kobayashi Y, Yamada K, Ikeda T, Takeuchi A, Hiramoto T, Watanabe Y, Kazama T: ERK2 con- tributes to the control of social behaviors in mice. J Neurosci 2011; 31:11953–67 35. Liu HX, Lopatina O, Higashida C, Fujimoto H, Akther S, Inzhutova A, Liang M, Zhong J, Tsuji T, Yoshihara T, Sumi K, Ishiyama M, Ma WJ, Ozaki M, Yagitani S, Yokoyama S, Mukaida N, Sakurai T, Hori O, Yoshioka K, Hirao A, Kato Y, Ishihara K, Kato I, Okamoto H, Cherepanov SM, Salmina AB, Hirai H, Asano M, Brown DA, Nagano I, Higashida H: Displays of paternal mouse pup retrieval following commu- nicative interaction with maternal mates. Nat Commun 2013; 4:1346 15. Rosenblatt JS, Mayer AD, Giordano AL: Hormonal basis dur- ing pregnancy for the onset of maternal behavior in the rat. Psychoneuroendocrinology 1988; 13:29–46 16. Mann PE, Bridges RS: Lactogenic hormone regulation of maternal behavior. Prog Brain Res 2001; 133:251–62 17. Rosenblatt JS: Nonhormonal basis of maternal behavior in the rat. Science 1967; 156:1512–4 36. Lonstein JS, De Vries GJ: Sex differences in the parental behavior of rodents. Neurosci Biobehav Rev 2000; 24:669–86 37. Wynne-Edwards KE, Timonin ME: Paternal care in rodents: Weakening support for hormonal regulation of the transition 18. Fleming AS, Luebke C: Timidity prevents the virgin female rat from being a good mother: Emotionality differences between Anesthesiology 2014; 120:403-15 414 Takaenoki et al. Downloaded From: http://anesthesiology.pubs.asahq.org/pdfaccess.ashx?url=/data/journals/jasa/930985/ on 06/09/2018 PERIOPERATIVE MEDICINE to behavioral fatherhood in rodent animal models of bipa- rental care. Horm Behav 2007; 52:114–21 47. Saxe MD, Battaglia F, Wang JW, Malleret G, David DJ, Monckton JE, Garcia AD, Sofroniew MV, Kandel ER, Santarelli L, Hen R, Drew MR: Ablation of hippocampal neurogenesis impairs contextual fear conditioning and synaptic plasticity in the dentate gyrus. Proc Natl Acad Sci U S A 2006; 103:17501–6 48. Jones MW: A comparative review of rodent prefrontal cortex and working memory. Curr Mol Med 2002; 2:639–47 38. Calamandrei G, Keverne EB: Differential expression of Fos protein in the brain of female mice dependent on pup sen- sory cues and maternal experience. Behav Neurosci 1994; 108:113–20 39. Numan M, Numan MJ: Expression of Fos-like immunoreac- tivity in the preoptic area of maternally behaving virgin and postpartum rats. Behav Neurosci 1994; 108:379–94 49. Ehrlich I, Klein M, Rumpel S, Malinow R: PSD-95 is required for activity-driven synapse stabilization. Proc Natl Acad Sci U S A 2007; 104:4176–81 40. Shen X, Dong Y, Xu Z, Wang H, Miao C, Soriano SG, Sun D, Baxter MG, Zhang Y, Xie Z: Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. ANESTHESIOLOGY 2013; 118:502–15 50. Béïque JC, Andrade R: PSD-95 regulates synaptic transmis- sion and plasticity in rat cerebral cortex. J Physiol 2003; 546(Pt 3):859–67 41. Patanella AK, Zinno M, Quaranta D, Nociti V, Frisullo G, Gainotti G, Tonali PA, Batocchi AP, Marra C: Correlations between peripheral blood mononuclear cell production of BDNF, TNF-alpha, IL-6, IL-10 and cognitive performances in multiple sclerosis patients. J Neurosci Res 2010; 88:1106–12 42. Tan EK, Chan LL: Neurovascular compression syndromes and hypertension: Clinical relevance. Nat Clin Pract Neurol 2007; 3:416–7 51. Kimble DP, Rogers L, Hendrickson CW: Hippocampal lesions disrupt maternal, not sexual, behavior in the albino rat. J Comp Physiol Psychol 1967; 63:401–7 52. Lamb ME: Physiological mechanisms in the control of mater- nal behavior in rats: A review. Psychol Bull 1975; 82:104–19 53. Steele MK, Rowland D, Moltz H: Initiation of maternal behav- ior in the rat: Possible involvement of limbic norepinephrine. Pharmacol Biochem Behav 1979; 11:123–30 43. van Gool WA, van de Beek D, Eikelenboom P: Systemic infection and delirium: When cytokines and acetylcholine collide. Lancet 2010; 375:773–5 54. Slotnick BM: Disturbances of maternal behavior in the rat following lesions of the cingulate cortex. Behaviour 1967; 29:204–36 44. Nishiyama T, Yamashita K, Yokoyama T: Stress hormone changes in general anesthesia of long duration: Isoflurane- nitrous oxide vs sevoflurane-nitrous oxide anesthesia. J Clin Anesth 2005; 17:586–91 55. Shih J, May LD, Gonzalez HE, Lee EW, Alvi RS, Sall JW, Rau V, Bickler PE, Lalchandani GR, Yusupova M, Woodward E, Kang H, Wilk AJ, Carlston CM, Mendoza MV, Guggenheim JN, Schaefer M, Rowe AM, Stratmann G: Delayed environmental enrichment reverses sevoflurane-induced memory impair- ment in rats. ANESTHESIOLOGY 2012; 116:586–602 45. Thompson CC, Potter GB: Thyroid hormone action in neural development. Cereb Cortex 2000; 10:939–45 46. Grober MS, Winterstein GM, Ghazanfar AA, Eroschenko VP: The effects of estradiol on gonadotropin-releasing hor- mone neurons in the developing mouse brain. Gen Comp Endocrinol 1998; 112:356–63 56. Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S, Ohta S: Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat Med 2007; 13:688–94 Anesthesiology 2014; 120:403-15 415 Takaenoki et al.",mice,['Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture.'],postnatal day 6,['Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture.'],Y,"['The first day after parturition, the maternal behaviors of dams were evaluated.', 'The survival rate of newborn pups was recorded for 6 days after birth.', 'The pup retrieval test was performed essentially as described previously.', 'The olfactory test was conducted as described previously.']",sevoflurane,['Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture.'],hydrogen,['Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture.'],c57bl/6,['Six-day-old C57BL/6 female mice were exposed to 3% sevoflurane for 6 h with or without hydrogen (1.3%) as part of the carrier gas mixture.'],The study addresses the pervasive deficits in brain functioning including innate behavior essential to species survival caused by neonatal exposure to sevoflurane.,"['In an animal model, sevoflurane exposure in the developing brain caused serious impairment of maternal behaviors when fostering their pups, suggesting pervasive impairment of brain functions including innate behavior essential to species survival.']",None,[],The article argues the impact of findings in terms of the potential pervasive impairment of brain functions including innate behavior essential to species survival due to neonatal exposure to sevoflurane.,"['In an animal model, sevoflurane exposure in the developing brain caused serious impairment of maternal behaviors when fostering their pups, suggesting pervasive impairment of brain functions including innate behavior essential to species survival.']",None,[],Potential applications emerge in understanding the neurotoxic effects of sevoflurane on developing brains and mitigating these effects with antioxidants like hydrogen.,['Coadministration of hydrogen gas as part of the carrier gas mixture suppresses neuronal apoptosis and subsequent behavioral deficits caused by neonatal exposure to sevoflurane in mice.'],True,True,True,True,False,True,10.1097/ALN.0000435846.28299.e7 10.1097/01.anes.0000291447.21046.4d,845.0,Zhao,2007,rats,postnatal day 6,Y,isoflurane,none,sprague dawley,"Anesthesiology 2007; 107:963–70 Copyright © 2007, the American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins, Inc. Isoflurane Preconditioning Improves Long-term Neurologic Outcome after Hypoxic–Ischemic Brain Injury in Neonatal Rats Ping Zhao, M.D., Ph.D.,* Longyun Peng, M.D., Ph.D.,† Liaoliao Li, M.D., Ph.D.,† Xuebing Xu, M.D., Ph.D.,‡ Zhiyi Zuo, M.D., Ph.D.§ Background: Preconditioning the brain with relatively safe drugs seems to be a viable option to reduce ischemic brain injury. The authors and others have shown that the volatile anesthetic isoflurane can precondition the brain against isch- emia. Here, the authors determine whether isoflurane precon- ditioning improves long-term neurologic outcome after brain ischemia. Methods: Six-day-old rats were exposed to 1.5% isoflurane for 30 min at 24 h before the brain hypoxia–ischemia that was induced by left common carotid arterial ligation and then ex- posure to 8% oxygen for 2 h. The neuropathology, motor coor- dination, and learning and memory functions were assayed 1 month after the brain ischemia. Western analysis was per- formed to quantify the expression of the heat shock protein 70, Bcl-2, and survivin 24 h after isoflurane exposure. Results: The mortality was 45% after brain hypoxia–isch- emia. Isoflurane preconditioning did not affect this mortality. However, isoflurane preconditioning attenuated ischemia-in- duced loss of neurons and brain tissues, such as cerebral cortex and hippocampus in the survivors. Isoflurane also improved the motor coordination of rats at 1 month after ischemia. The learning and memory functions as measured by performance of Y-maze and social recognition tasks in the survivors were not affected by the brain hypoxia–ischemia or isoflurane precondi- tioning. The expression of Bcl-2, a well-known antiapoptotic protein, in the hippocampus is increased after isoflurane expo- sure. This increase was reduced by the inhibitors of inducible nitric oxide synthase. Inducible nitric oxide synthase inhibition also abolished isoflurane preconditioning–induced neuropro- tection. Conclusions: Isoflurane preconditioning improved the long- term neurologic outcome after brain ischemia. Inducible nitric oxide synthase may be involved in this neuroprotection. PERINATAL hypoxic–ischemic brain injury is estimated to occur in 1 of 4,000 births.1 Most of the survivors (approximately 60%) have long-term neurologic or cog- nitive disability.1–3 Because of the huge impact on hu- man health and financial burden on our society, finding methods to reduce ischemic brain injury has been a focus of medical research. Many interventions have been explored for potential neuroprotection. However, clini- cally practical methods to reduce ischemic brain injury have not been well established yet. One of the important advances on ischemic brain in- jury research in the recent years is the recognition that ischemic injury is a dynamic process characterized by ongoing neuronal loss for a long period of time after ischemia (for weeks in rodents).4,5 Various methods or approaches have been shown to be neuroprotective in animal studies. However, few of them are effective in improving neurologic outcome in clinical studies. One of the possible reasons for this phenomenon is that previous animal studies often examined the neurologic outcome a few days after the brain ischemia and that human studies frequently evaluated neurologic outcome a few months later. It is now a well-known phenomenon that some of the protective methods may just delay cell death after brain ischemia.6 – 8 Therefore, it is important to evaluate the long-term neuroprotective effects of a method in preclinical studies. Pretreatment of various organs, including brain, with brief episodes of ischemia has been shown to reduce injury after a prolonged episode of ischemia.9 This phe- nomenon is called ischemic preconditioning. Various other stimuli, such as hypoxia and hypothermia, have been shown to induce preconditioning effects.10 –13 However, the utility of the preconditioning effects in- duced by these stimuli in clinical practice is questionable because of the danger or the complex biologic effects of the stimuli. We and others have shown that isoflurane can induce preconditioning effects in the brain.14 –16 Isoflurane is a commonly used volatile anesthetic and has been safely used in clinical practice for decades. We designed this study to test the hypothesis that isoflurane preconditioning can improve long-term neurologic out- come after brain ischemia. Research Associate, † Postdoctoral Research Fellow, Department of Anes- thesiology, § Associate Professor, Departments of Anesthesiology, Neuroscience, and Neurological Surgery, University of Virginia. ‡ Postdoctoral Research Fel- low, Departments of Anesthesiology, University of Virginia and The First Munic- ipal People’s Hospital of Guangzhou, Guangzhou, China. Received from the Department of Anesthesiology, University of Virginia, Charlottesville, Virginia. Submitted for publication March 20, 2007. Accepted for publication August 9, 2007. Supported by grant Nos. R01 GM065211 and R01 NS045983 (to Dr. Zuo) from the National Institutes of Health, Bethesda, Mary- land. Drs. Peng and Li contributed equally to the project, and both can be considered as second authors of the article. Address correspondence to Dr. Zuo: Department of Anesthesiology, Univer- sity of Virginia Health System, 1 Hospital Drive, P.O. Box 800710, Charlottesville, Virginia 22908-0710. zz3c@virginia.edu. Information on purchasing reprints may be found at www.anesthesiology.org or on the masthead page at the beginning of this issue. ANESTHESIOLOGY’s articles are made freely accessible to all readers, for personal use only, 6 months from the cover date of the issue. Materials and Methods The animal protocol was approved by the institutional Animal Care and Use Committee of the University of Virginia, Charlottesville, Virginia. All animal experiments were conducted in accordance with the National Insti- tutes of Health Guide for the Care and Use of Labora- tory Animals (National Institutes of Health publication No. 80-23) revised in 1996. All reagents unless specified Anesthesiology, V 107, No 6, Dec 2007 963 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 964 below were obtained from Sigma Chemical (St. Louis, MO). Neonatal Cerebral Hypoxia–Ischemia Model Cerebral hypoxia–ischemia was induced as we previ- ously described.17 Briefly, 7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane in 30% O2–70% N2, and their left common carotid arteries were permanently ligated with a double 7-0 surgical silk. The rats were allowed to awake and were returned to their cages with the mothers for 3 h. The neonates were then placed in a chamber containing humidified 8% O2–92% N2 for 2 h at 37°C. The air temperature in the chamber was continuously monitored and maintained at 37°C. The chamber was then opened to room air for 15 min, and the animals were returned to their cages. Isoflurane Preconditioning and Study Groups Six-day-old rats were placed in a chamber containing 1.5% isoflurane carried by 30% O2–70% N2 for 30 min at 24 h before the cerebral hypoxia–ischemia. The neo- nates usually started to feed within 30 min after the isoflurane application. In the first set of experiments, six groups of neonates were studied: (1) control, (2) 1.5% isoflurane treatment only, (3) cerebral hypoxia–isch- emia, (4) 1.5% isoflurane pretreatment and then cerebral hypoxia–ischemia, (5) 1 mg/kg N-(3-(aminomethyl)ben- zyl)acetamidine (1400 W; BIOMOL Research Laborato- ries Inc., Plymouth Meeting, PA) injected intraperitone- ally 24 h before cerebral hypoxia–ischemia, and (6) 1 mg/kg 1400 W injected intraperitoneally 30 min before the isoflurane pretreatment and then cerebral hypoxia– ischemia. Neonates from the same mother were assigned to these six experimental conditions. Neonates in groups 2, 4, and 6 were pretreated with isoflurane, whereas the others from the same mother were placed in a chamber containing 30% O2–70% N2 but no isoflu- rane for 30 min and were assigned to groups 1, 3, and 5. In the second set of experiments, four groups of rats were studied: (1) control, (2) 1.5% isoflurane treatment, (3) 200 mg/kg aminoguanidine administered intraperito- neally 30 min before the isoflurane treatment, and (4) 1 mg/kg 1400 W injected intraperitoneally 30 min before the isoflurane treatment. Aminoguanidine and 1400 W were dissolved in normal saline, and the injected volume was from 0.16 to 0.2 ml per rat. Rats in the control group and isoflurane treatment only group received 0.2 ml normal saline at the corresponding times. Aminoguani- dine and 1400 W are inducible nitric oxide synthase (iNOS) inhibitors that have been shown to inhibit iNOS activity in rat brain18 and iNOS-mediated neuroprotec- tion induced by isoflurane and prenatal hypoxic precon- ditioning at the regimen used in this study.11,17 The rat brains were harvested 24 h after isoflurane treatment for Western analysis. Anesthesiology, V 107, No 6, Dec 2007 ZHAO ET AL. Mortality and Body Weight Monitoring Death during the period from the onset of cerebral hypoxia–ischemia to 1 month afterward was recorded, and the mortality rate was calculated. Rat body weights were measured just before and 1 month after the cere- bral hypoxia–ischemia. Brain Histopathology Brain histopathologic evaluation was performed in rats in the first set of experiments. One month (30 days) after the cerebral hypoxia–ischemia, rats were euthanized by isoflurane and transcardially perfused with 30 ml saline. Brains were removed and stored in 4% phosphate-buff- ered paraformaldehyde for 4 h at room temperature. Eight-micrometer-thick cryostat coronal sections at ap- proximately 3.3 mm caudal to bregma were obtained and subjected to Nissl staining. These sections were examined by an observer blinded to the group assign- ment of the sections. The cerebral cortical and hip- pocampal areas in each of the hemispheres were mea- sured by using National Institutes of Health Image 1.60 (Bethesda, MD). The area ratio of the cerebral cortex and hippocampus in the left hemisphere to those in the right hemisphere was calculated and used to reflect brain tissue loss in the left hemisphere after brain hypoxia– ischemia. Neuronal density in the perirhinal cortex was determined as follows. A reticle (approximately 0.034 mm2) was used to count cells in the same size area. Nissl staining–positive cells were counted in the area. Three determinations, each on different locations in the left perirhinal cortex, were performed and averaged to yield a single number (density of the neurons) for the brain region of each individual rat. The neuronal density in the right perirhinal cortex was determined in the same way. The neuronal density ratio in the left/right perirhinal cortex was then calculated to measure the neuronal loss after brain hypoxia–ischemia. Motor Coordination Evaluation This evaluation was performed just before the rats were killed for brain histopathology. Rats were placed on a rotarod whose speed increased from 4 to 40 rpm in 5 min. The latency and the speed of rats’ falling off the rod were recorded. Each rat was tested three times, and the speed–latency index (latency in seconds (cid:1) speed in rpm) for each trial was calculated. The mean index value of the three trials was used to reflect the motor coordi- nation functions of each rat. Y Maze and Social Recognition The Y-maze and social recognition tests were per- formed as described previously19 at 1 day before the rats were killed for brain histopathology. During Y-maze test, rats were placed in the center of a symmetrical Y maze and were allowed to explore freely in the maze for 8 min. The total number and sequence of arms entered D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 ISOFLURANE PRECONDITIONING–INDUCED NEUROPROTECTION were recorded. An arm was entered if the hind paws of the rat were completely in the arm. The percentage alternation that was the percentage of the number of entry into all three arms in the maximum possible alter- nations (the total number of arms entered divided by 3) was calculated for each rat. The social recognition task was tested by placing a test rat in a clean acrylic cage. A male juvenile (3- to 4-week- old) rat was placed into the cage with the test rat for 2 min. The two rats were separated for 3 h and were placed together again for 2 min. The duration of social investigation of the juvenile rat by the test rat during the two 2-min periods was recorded. Social investigation behaviors include direct contact with the juvenile for inspection and close following ((cid:2) 1 cm) of the juvenile. If there was any aggressive encounter between the rats, the experiments were terminated and the data were excluded from analysis. The ratio of duration of the social investigation during the second 2-min period in the duration of the first 2-min period was calculated to measure the social recognition memory. Western Blot Analysis Cerebral cortex and hippocampus were dissected from the rats in the second set of experiments and were sonicated in ice-cold 20 mM Tris-HCl (pH 7.5) containing 5 mM Mg Cl2, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 20 (cid:1)g/ml aprotinin, 1 mM DL-dithiothreitol, and 2 mM sodium orthovanadate. The sample was centri- fuged at 1,000g at 4°C for 10 min. The protein concen- trations in the supernatants were determined by the Lowry assay using a protein assay kit. Equal protein samples (50 (cid:1)g per lane) were separated by 12% sodium dodecyl sulfate–polyacrylamide gels and then electro- transferred onto nitrocellulose membranes (Bio-Rad, Hercules, CA). The primary antibodies were rabbit poly- clonal anti– heat shock protein 70 (HSP70) antibody (1: 1,500 dilution, catalog No. SPA-812; Stressgen, Victoria, British Columbia, Canada), antisurvivin antibody (1:500 dilution, catalog No. S8191), antiactin antibody (1:2,000 dilution, catalog No. A2066), and mouse monoclonal anti–Bcl-2 antibody (1:2,000 dilution, catalog No. sc-509; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Protein bands were visualized by the enhanced chemilumines- cence detection method with reagents from Amersham Pharmacia Biotech (Piscataway, NJ). The protein band volumes were quantified by a densitometry with Image- Quant 5.0 Windows NT software (Molecular Dynamics, Sunnyvale, CA). The volumes of Bcl-2, HSP70, and sur- vivin protein bands were normalized to those of actin to control for errors in protein sample loading and trans- ferring during the Western blot analysis. The results in the groups after isoflurane exposure were then normal- ized to those of control animals. Statistical Analysis Our previous study showed that a 2-h left hemisphere hypoxia–ischemia reduced the weight of left brain hemi- sphere by approximately 30% and isoflurane precondi- tioning decreased this brain loss to approximately 10% with an SD of approximately 12% when the brains were examined at 7 days after the brain hypoxia–ischemia.17 Based on these results, it was estimated that 7 rats per group would be needed to detect the protective effects (brain loss reduction/brain pathology) of isoflurane pre- conditioning with a desired power of 80% at an (cid:2) level of 0.05 by t test. However, this sample estimate was used only as a reference in the experimental design of this study because of the obvious differences in the duration of observation after brain hypoxia–ischemia (1 week vs. 1 month) and outcome parameters between this study and our previous study.17 Data are presented as mean (cid:3) SD. Results of hip- pocampal and cortical area ratio, neuronal density ratio, speed–latency index, percentage of alternation, and the ratio of the investigation times of the different study groups were compared by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls (SNK) method or by one-way ANOVA on ranks followed by the Dunn method as appropriate. The Western blot data were analyzed by one-way ANOVA on ranks followed by the Dunn method. The mortality rates among groups were analyzed by Z test. The comparison of body weight among groups was performed by ANOVA for repeated measures followed by the SNK method. P (cid:2) 0.05 was considered significant. All statistical analyses were per- formed with SigmaStat (Systat Software, Inc., Point Rich- mond, CA). Results General characteristics of various study groups in the first set of experiments are presented in table 1. The mortality was 45% in rats that had brain hypoxia–isch- emia for 2 h. This mortality was not significantly altered by isoflurane preconditioning or application of 1400 W. The body weight of 7-day-old neonates (just before the brain hypoxia–ischemia) and 37-day-old neonates (30 days after the brain hypoxia–ischemia) among all study groups including control rats was not different (table 1). There were significant differences among the various groups of rats in the left brain loss/damage as assessed grossly (fig. 1) or by the ratio of left/right cerebral cor- tical area (F(5, 45) (cid:4) 13.82, P (cid:2) 0.001), hippocampal area (F(5, 45) (cid:4) 10.98, P (cid:2) 0.001), and neuronal density in the perirhinal cortex (F(5, 45) (cid:4) 15.61, P (cid:2) 0.001) (fig. 2). Brain hypoxia–ischemia caused significant brain loss/damage in the left hemisphere assessed at 30 days after the injury (compared with control group by SNK method, q (cid:4) 7.75, P (cid:2) 0.001 for cortical area; q (cid:4) 8.36, Anesthesiology, V 107, No 6, Dec 2007 965 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 966 ZHAO ET AL. Table 1. General Characteristics Fate after Brain Hypoxia–Ischemia Body Weight of the Survivors, g Dead Survived Mortality, % 7 days old 37 days old Control 1.5% Iso HI 1.5% Iso (cid:6) HI 1400 W (cid:6) HI 1400 W (cid:6) 1.5% Iso (cid:6) HI 0 0 25 38 9 9 24 23 30 30 9 9 0 0 45* 56* 50* 50* 13.7 (cid:3) 1.9 13.7 (cid:3) 1.4 14.3 (cid:3) 2.0 14.4 (cid:3) 2.0 14.9 (cid:3) 1.7 14.9 (cid:3) 1.2 143 (cid:3) 30 150 (cid:3) 35 161 (cid:3) 23 144 (cid:3) 35 156 (cid:3) 13 153 (cid:3) 5 Values (body weight) are mean (cid:3) SD. * P (cid:2) 0.05 compared with control. 1400 W (cid:4) 1 mg/kg N-(3-(aminomethyl)benzyl)acetamidine injected intraperitoneally; HI (cid:4) brain hypoxia–ischemia that was induced by left common carotid artery ligation plus hypoxia with 8% O2 for 2 h at 37°C to 7-day-old rats; Iso (cid:4) isoflurane for 30 min. P (cid:2) 0.001 for hippocampal area; and q (cid:4) 9.49, P (cid:2) 0.001 for neuronal density in the perirhinal cortex) (figs. 1 and 2). This hypoxia-ischemia–induced brain loss/dam- age was significantly attenuated by preconditioning with 1.5% isoflurane (comparison between hypoxia–ischemia and isoflurane preconditioning plus hypoxia–ischemia by SNK method, q (cid:4) 3.69, P (cid:4) 0.033 for cortical area; q (cid:4) 3.87, P (cid:4) 0.043 for hippocampal area; and q (cid:4) 4.40, P (cid:4) 0.016 for neuronal density in the perirhinal cortex) (fig. 2). These results indicated that isoflurane precondi- tioning improved neuropathology even at 1 month after brain hypoxia–ischemia. This isoflurane precondition- ing–induced improvement was attenuated by the iNOS inhibitor 1400 W (fig. 1 and 2), suggesting a role of iNOS in this protection. Fig. 1. Brain hypoxia-ischemia–induced brain tissue loss. Rep- resentative brains of 37-day-old rats with various treatments. 1400 W (cid:1) 1 mg/kg N-(3-(aminomethyl)benzyl)acetamidine in- jected intraperitoneally 30 min before the isoflurane exposure or 24 h before the cerebral hypoxia–ischemia; Con (cid:1) control; HI (cid:1) cerebral hypoxia–ischemia that was induced by left com- mon carotid artery ligation plus hypoxia with 8% O2 for 2 h at 37°C to 7-day-old rats; Iso (cid:1) 1.5% isoflurane for 30 min. The motor coordination functions as reflected by the speed–latency index in the rotarod test among the rats in various groups were statistically different (F(5, 112) (cid:4) 8.66, P (cid:2) 0.001) (fig. 3). The brain hypoxia–ischemia impaired motor coordination functions (compared with control group by SNK method, q (cid:4) 4.53, P (cid:4) 0.005). This impairment was significantly attenuated by isoflu- rane preconditioning (comparison between hypoxia– ischemia and isoflurane preconditioning plus hypoxia– ischemia by SNK method, q (cid:4) 3.26, P (cid:4) 0.023) (fig. 3), suggesting that isoflurane preconditioning improved mo- tor functions after brain ischemia. The iNOS inhibitor 1400 W abolished this improvement caused by isoflu- rane preconditioning (comparison between isoflurane preconditioning plus hypoxia–ischemia and 1400 W plus isoflurane preconditioning plus hypoxia–ischemia by SNK method, q (cid:4) 5.28, P (cid:4) 0.002), indicating the role of iNOS in the isoflurane preconditioning–induced motor coordination improvement. There was no differ- ence among the rats from various groups in the perfor- mance of Y maze (by one-way ANOVA on ranks, H5 (cid:4) 7.82, P (cid:4) 0.166) or the social recognition tasks (by one-way ANOVA on ranks, H5 (cid:4) 4.29, P (cid:4) 0.509) (fig. 3), suggesting that brain hypoxia–ischemia or isoflurane treatment did not affect the performance of rats in the Y-maze and social recognition tasks. Of note, the total numbers of arms entered by control rats and rats with cerebral hypoxia–ischemia only were 15 (cid:3) 9 and 16 (cid:3) 12, respectively (P (cid:5) 0.05), suggesting that cerebral hypoxia–ischemia did not impair the motor functions severely enough to affect the performance of rats in the Y-maze test. Western analysis showed that there was significant difference in Bcl-2 expression in the hippocampus Anesthesiology, V 107, No 6, Dec 2007 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 ISOFLURANE PRECONDITIONING–INDUCED NEUROPROTECTION Fig. 2. Isoflurane preconditioning re- duced brain hypoxia-ischemia–induced neuropathology. (A) Representative coro- nal sections at approximately 3.3 mm caudal to bregma from 37-day-old rats and after Nissl staining. (B) Area ratio of left/right cerebral cortex. (C) Area ratio of left/right hippocampus. (D) Neuronal density ratio in the left/right perirhinal cortex. Results are mean (cid:2) SD (n (cid:1) 6 –11). * P < 0.05 compared with control. # P < 0.05 compared with cerebral hy- poxia–ischemia only. 1400 W (cid:1) 1 mg/kg N-(3-(aminomethyl)benzyl)acetamidine injected intraperitoneally 30 min before the isoflurane exposure or 24 h before the cerebral hypoxia–ischemia; Con (cid:1) control; HI (cid:1) cerebral hypoxia–ischemia that was induced by left common carotid artery ligation plus hypoxia with 8% O2 for 2 h at 37°C to 7-day-old rats; Iso (cid:1) 1.5% isoflurane for 30 min. among the various groups (by one-way ANOVA on ranks, H3 (cid:4) 13.18, P (cid:4) 0.004). Isoflurane significantly in- creased the expression of Bcl-2 in the hippocampus (comparison between control and isoflurane exposure groups by Dunn method, Q (cid:4) 2.98, P (cid:2) 0.05). This increased expression was decreased by aminoguanidine and 1400 W, two iNOS inhibitors, suggesting that isoflu- rane-induced Bcl-2 expression was iNOS dependent (fig. 4). Isoflurane exposure did not change the expression of survivin and HSP70 in the hippocampus or cerebral cortex (fig. 4). Discussion These results suggest that isoflurane preconditioning im- proves the long-term neurologic outcome after brain ischemia. We used 1.5% isoflurane in this study. This concentra- tion was the highest concentration that did not signifi- cantly affect the blood gases and pH but induced pre- conditioning effects on the brain in our previous study using the same animal model.17 One minimum alveolar concentration (the concentration to inhibit 50% of sub- jects to respond to surgical stimuli) of isoflurane is 1.12% and 1.15%, respectively, for adult rats and humans22,23 and 1.6% for human neonates.24 Therefore, the isoflu- rane concentration used in this study is clinically rele- vant. Early studies showed infarct maturation after 2 days in rat models of stroke.20,21 Studies in the recent years have shown that ischemic injury is a dynamic process charac- terized by ongoing neuronal loss for at least 14 days after ischemia in rodents.4,5 Protective methods, such as postinjury mild hypothermia, reduced brain injury eval- uated a few days after the ischemia but did not show protection when the evaluation was performed 1 month after the brain ischemia.7,8 These studies underscore the importance of examining the long-term neurologic out- come of any protective methods. Our study showed that isoflurane preconditioning reduced cerebral cortical and loss and improved motor coordination hippocampal functions at 1 month after the brain hypoxia–ischemia. We ligated one common carotid artery and then ex- posed 7-day-old neonates to 8% oxygen to induce hy- poxic–ischemic brain injury. This is a widely used animal model to simulate human perinatal brain ischemia.25 The maturation of the brain in the 7-day-old rat is similar to that of human newborn brain.25,26 Perinatal brain isch- emia in human is often caused by brain ischemia super- imposed on severe systemic hypoxia.27 Therefore, the brain injury in the animal model used in our study shares many features of the human perinatal brain injury. We monitored the mortality and body weight gain to measure the general well being of the rats in each study group. The hypoxic–ischemic injury caused 45% mortal- ity and isoflurane preconditioning did not affect this Anesthesiology, V 107, No 6, Dec 2007 967 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 968 Fig. 3. Isoflurane preconditioning improved motor coordina- tion after brain hypoxia–ischemia. (A) Speed–latency index of 37-day-old rats with various treatments in the rotarod test. (B) Percentage of alternation of 37-day-old rats with various treat- ments in the Y-maze test. (C) Ratio of the investigation times in the second trial over those in the first trial. Results are mean (cid:2) SD (n (cid:1) 9 –30). * P < 0.05 compared with control. # P < 0.05 compared with cerebral hypoxia–ischemia only. ^ P < 0.05 compared with isoflurane preconditioning plus cerebral hy- poxia–ischemia. 1400 W (cid:1) 1 mg/kg N-(3-(aminomethyl)benzy- l)acetamidine injected intraperitoneally 30 min before the isoflurane exposure or 24 h before the cerebral hypoxia–isch- emia; HI (cid:1) cerebral hypoxia–ischemia that was induced by left common carotid artery ligation plus hypoxia with 8% O2 for 2 h at 37°C to 7-day-old rats; Iso (cid:1) 1.5% isoflurane for 30 min. mortality rate. These results are consistent with those of our previous report.17 The body weights of the survivors at the end of the study in all four groups are not signif- icantly different, suggesting the body weight gain is not a sensitive parameter to reflect the degree of brain injury in this animal model. These results are also similar to our previous data.17 We quantified hypoxia-ischemia–induced brain loss by the cortical and hippocampal area and neuronal density in the perirhinal cortex at approximately 3.3 mm caudal to bregma. The section at this level was used to reflex the brain injury because this section contains hippocam- Anesthesiology, V 107, No 6, Dec 2007 ZHAO ET AL. pus and the degree of brain injury was similar in sections from 1 mm rostral to 5 mm caudal to bregma in this brain hypoxia–ischemia model.28 We chose to count neuronal density in the perirhinal cortex because this brain region is easily recognized and localization of this region in brain sections can be very accurate. Blood supply of the perirhinal cortex is mainly from the ipsilateral internal carotid artery. Therefore, significant neuronal injury in the perirhinal cortex was anticipated in our newborn rats after the cerebral hypoxia–ischemia. Our study showed that the cortical and hippocampal area and the neuronal density in the perirhinal cortex of the ischemic hemisphere were significantly decreased by the hypoxi- a–ischemia and this decrease was attenuated by isoflu- rane preconditioning. These results are strong evidence that isoflurane preconditioning improves neuropatho- logical outcome at 1 month after brain hypoxia–isch- emia. Two types of neurologic functions were monitored in our study. The motor coordination functions of the rats were assayed by the rotarod test. Hypoxic–ischemic brain injury significantly reduced the duration and speed that the rats could stay on the rotarod compared with control rats, suggesting that these rats had impaired motor coordination functions. Rats preconditioned by isoflurane before the hypoxic–ischemic injury per- formed better than rats subjected to hypoxic–ischemic injury only. Therefore, isoflurane preconditioning im- proves not only the neuropathologic outcome but also neurologic functions after brain ischemia. The learning and memory functions were evaluated by the Y-maze and social recognition tasks. These two tasks are very sensitive for measuring early learning and mem- ory deficits.19 The social recognition tests rats to identify and remember con-specifics, whereas the spontaneous alternation Y maze assesses spatial working memory. Because these two tasks measure hippocampus-depen- dent learning and memory functions19 and the hip- pocampus in the ischemic hemisphere in our model was obviously injured, one would expect that the rats after hypoxic–ischemic brain injury would have had worse performance than did control rats in the Y-maze and social recognition tasks. To our surprise, there was no significant difference in the performance of these two tasks among the six groups of rats. Poor performance on water maze tasks that examine long-term spatial learning and reference memory was found with the neonatal rats after hypoxic–ischemic brain injury.29 However, the per- formance of those rats on eight-arm maze tasks that test long-term reference memory and short-term working memory was not significantly different from the control rats in the same study.29 The reasons for the apparent discrepancy of the findings from water maze and eight- arm maze tasks in this previous study and the obvious brain structure injury and the maintained learning and memory functions assayed by the Y-maze and social D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 ISOFLURANE PRECONDITIONING–INDUCED NEUROPROTECTION Fig. 4. The effects of isoflurane on the expression of heat shock protein 70 (HSP70), Bcl-2, and survivin proteins in the cerebral cortex and hippocampus of 7-day-old rats. Six-day-old rats were exposed to 1.5% isoflurane for 30 min, and the cerebral cortex and hippocampus were removed for Western analysis at 24 h after the isoflurane exposure. (A and C) A representative film image of the bands. (B and D) The graphic presentation of HSP70, Bcl-2, and survivin protein abundance quantified by integrating the volume of bands from 5–10 rats for each experimental condition and normalizing the data by those of actin. Values in graphs are mean (cid:2) SD of the fold changes over the controls, with the controls being set as 1. * P < 0.05 compared with controls. # P < 0.05 compared with isoflurane only. 1400 W (cid:3) Iso (cid:1) 1 mg/kg N-(3-(aminomethyl)benzyl)acetamidine (1400 W) injected intraperitoneally 30 min before the isoflurane exposure; Ag (cid:3) Iso (cid:1) 200 mg/kg aminoguanidine injected intraperitoneally at 30 min before the isoflurane exposure; Iso (cid:1) 1.5% isoflurane for 30 min. recognition tasks in our study are not known. Y-maze, social recognition, and eight-arm tasks are nonstressful, and the water maze test is stressful. One explanation for the discrepancy is that rats after hypoxic–ischemic brain injury can compensate well with various mechanisms, such as through the functions of the nonischemic hemi- sphere, in performing nonstressful tasks but not perform well in the stressful tasks that measure the learning and memory functions. It has been proposed that delayed neuroprotection that occurs a few hours after the application of precon- ditioning stimuli involves synthesis of protective pro- teins.30 Bcl-2 can reduce ischemia-induced increase of mitochondrial membrane permeability and cytochrome c release from the mitochondrion.31 The released cyto- chrome c will bind with protease-activating factor 1 to form the apoptosome that will activate caspase 9. This process ultimately will activate caspase 3 to induce cell apoptosis. Bcl-2 can bind with the C terminus of pro- tease-activating factor 1 to inhibit the association of caspase 9 with protease-activating factor 1.32–34 Thus, Bcl-2, via acting on various steps, inhibits apoptosis and is a protective protein. Our results showed that rats exposed to isoflurane had an increased Bcl-2 in the hippocampus and this increase was inhibited by amino- guanidine and 1400 W, two iNOS inhibitors. Isoflurane preconditioning–induced neuroprotection observed 1 week after the brain ischemia was shown to be iNOS dependent in our previous study using the same animal model.17 In this study, 1400 W abolished the isoflurane preconditioning–induced neuroprotection. Therefore, our results suggest that the increased Bcl-2 expression contributes to the neuroprotection induced by isoflu- it is rane preconditioning. Consistent with this idea, known that brain injury in the neonatal brain hypoxia– ischemia model is caused, at least partly, by apopto- sis.35,36 Our results also suggest a link between iNOS and Bcl-2. Nitric oxide can induce Bcl-2 expression.37 Nitric oxide produced by iNOS can activate signal transducer and activator of transcription 3,38 a transcription factor that increases Bcl-2 expression.39 These previous stud- ies, along with the results presented here, suggest that iNOS is a signaling molecule upstream of Bcl-2 to medi- ate isoflurane preconditioning–induced neuroprotec- tion. Survivin is a member of the inhibitor of apoptosis gene family and may be through its association with caspases to inhibit apoptosis.40,41 Our results showed that isoflu- rane exposure did not alter the expression of survivin in the cerebral cortex and hippocampus of rats, suggesting that isoflurane preconditioning–induced neuroprotec- tion does not involve survivin. Isoflurane exposure also did not change the expression of HSP70. HSP70 is mo- lecular chaperons for damaged proteins and can be in- to provide protec- duced by various stress stimuli tion.42,43 Our results indicate that HSP70 is not involved Anesthesiology, V 107, No 6, Dec 2007 969 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3 970 in the isoflurane preconditioning–induced neuroprotec- tion. However, caution should be exercised regarding the suggestion of noninvolvement of survivin and HSP70 in the isoflurane preconditioning–induced neuroprotec- tion because the expression change of these two pro- teins may occur at other time points after isoflurane preconditioning. We chose to quantify protein expres- sion at 24 h after isoflurane exposure in this study be- cause we subjected the rats to the brain hypoxic–isch- emic injury at this time point and reasoned that the involved protective proteins should be expressed at this time to reduce brain injury. In summary, we have shown that preconditioning with isoflurane at a clinically relevant concentration can in- duce a long-lasting neuroprotection in rats. This effect may involve an increased expression of Bcl-2. Because isoflurane is a commonly used and relatively safe drug, our finding may have implications in clinical situations that brain ischemia occurs as a planned or anticipated event, such as perceived difficult labor with potential newborn brain ischemia, newborns for open heart sur- gery and newborns with high risks of intraventricular or periventricular hemorrhage. References 1. Lynch JK, Nelson KB: Epidemiology of perinatal stroke. Curr Opin Pediatr 2001; 13:499–505 2. Sran SK, Baumann RJ: Outcome of neonatal strokes. Am J Dis Child 1988; 142:1086–8 3. Sreenan C, Bhargave R, Robertson CM: Cerebral infarction in the term new-born: Clinical presentation and long-term outcome. J Pediatr 2000; 137: 351–5 4. Li Y, Chopp M, Jiang N, Yao F, Zaloga C: Temporal profile of in situ DNA fragmentation after transient middle cerebral artery occlusion in the rat. J Cereb Blood Flow Metab 1995; 15:389–97 5. Du C, Hu R, Csernansky CA, Hsu CY, Choi D: Very delayed infarction after mild focal cerebral ischemia: A role for apoptosis? J Cereb Blood Flow Metab 1996; 16:195–201 6. Kawaguchi M, Kimbro JR, Drummond JC, Cole DJ, Kelly PJ, Patel PM: Isoflurane delays but does not prevent cerebral infarction in rats subjected to focal ischemia. ANESTHESIOLOGY 2000; 92:1335–42 7. Dietrich WD, Busto R, Alonso O, Globus MY, Ginsberg MD: Intraischemic but not postischemic brain hypothermia protects chronically following global forebrain ischemia in rats. J Cereb Blood Flow Metab 1993; 13:541–9 8. Trescher WH, Ishiwa S, Johnston MV: Brief post-hypoxic-ischemic hypo- thermia markedly delays neonatal brain injury. Brain Dev 1997; 19:326–38 9. Nandagopal K, Dawson TM, Dawson VL: Critical role for nitric oxide signaling in cardiac and neuronal ischemic preconditioning and tolerance. JPET 2001; 297:474–8 10. Gidday JM, Shah AR, Maceren RG, Wang Q, Pelligrino DA, Holtzman DM, Park TS: Nitric oxide mediates cerebral ischemic tolerance in a neonatal rat model of hypoxic preconditioning. J Cereb Blood Flow Metab 1999; 19:331–40 11. Zhao P, Zuo Z: Prenatal hypoxia-induced adaptation and neuroprotection that is inducible nitric oxide synthase-dependent. Neurobiol Dis 2005; 20:871–80 12. Yuan H-B, Huang Y, Zheng S, Zuo Z: Hypothermic preconditioning in- creases survival of Purkinje neurons in rat cerebellar slices after an in vitro simulated ischemia. ANESTHESIOLOGY 2004; 100:331–7 13. Yuan HB, Huang Y, Zheng S, Zuo Z: Hypothermic preconditioning reduces Purkinje cell death possibly by preventing the over-expression of inducible nitric oxide synthase in rat cerebellar slices after an in vitro simulated ischemia. Neuroscience 2006; 142:381–9 14. Zheng S, Zuo Z: Isoflurane preconditioning reduces Purkinje cell death in an in vitro model of rat cerebellar ischemia. Neuroscience 2003; 118:99–106 15. Zheng S, Zuo Z: Isoflurane preconditioning induces neuroprotection Anesthesiology, V 107, No 6, Dec 2007 ZHAO ET AL. against ischemia via activation of p38 mitogen-activated protein kinase. Mol Pharmacol 2004; 65:1172–80 16. Kapinya KJ, Lowl D, Futterer C, Maurer M, Waschke K, Isaev NK, Dirnagl U: Tolerance against ischemic neuronal injury can be induced by volatile anes- thetics and is inducible NO synthase dependent. Stroke 2002; 33:1889–98 17. Zhao P, Zuo Z: Isoflurane preconditioning induces neuroprotection that is inducible nitric oxide synthase-dependent in the neonatal rats. ANESTHESIOLOGY 2004; 101:695–702 18. Nagayama M, Zhang F, Iadecola C: Delayed treatment with aminoguani- dine decreases focal cerebral ischemic damage and enhances neurologic recov- ery in rats. J Cereb Blood Flow Metab 1998; 18:1107–13 19. Ohno M, Sametsky EA, Younkin LH, Oakley H, Younkin SG, Citron M, Vassar R, Disterhoft JF: BACE1 deficiency rescues memory deficits and cholin- ergic dysfunction in a mouse model of Alzheimer’s disease. Neuron 2004; 41: 27–33 20. Garcia J, Yoshida Y, Chen H, Li Y, Zhang Z, Lian J, Chen S, Chopp M: Progression from ischemic injury to infarct following middle cerebral artery occlusion in the rat. Am J Pathol 1993; 142:623–35 21. Lin T, He Y, Wu G, Khan M, Hsu C: Effect of brain edema on infarct volume in a focal cerebral ischemia model in rats. Stroke 1993; 24:117–21 22. Orliaguet G, Vivien B, Langeron O, Bouhemad B, Coriat P, Riou B: Mini- mum alveolar concentration of volatile anesthetics in rats during postnatal mat- uration. ANESTHESIOLOGY 2001; 95:734–9 23. Eger EI: Uptake and distribution, Anesthesia. Edited by Miller RD. Phila- delphia, Churchill Livingstone, 2000, pp 74 –95 24. LeDez KM, Lerman J: The minimum alveolar concentration (MAC) of isoflurane in preterm neonates. ANESTHESIOLOGY 1987; 67:301–7 25. Hagberg H, Bona E, Gilland E, Puka-Sundvall M: Hypoxia-ischaemia model in the 7-day-old rat: Possibilities and shortcomings. Acta Paediatr Suppl 1997; 422:85–8 26. Dobbing J, Sands J: The brain growth spurt in various mammalian species. Early Hum Dev 1979; 3:79–84 27. Johnston MV: Neonatal hypoxic-ischemic brain insults and their mecha- nisms, New Concepts in Cerebral Ischemia. Edited by Simon SA, Nicolelis MAL. Boca Raton, CRC Press, 2002, pp 31– 61 28. Ma D, Hossain M, Chow A, Arshad M, Battson RM, Sanders RD, Mehmet H, Edwards AD, Franks NP, Maze M: Xenon and hypothermia combine to provide neuroprotection from neonatal asphyxia. Ann. Neurol 2005; 58:182–93 29. Ikeda T, Mishima K, Yoshikawa T, Iwasaki K, Fujiwara M, Xia YX, Ikenoue T: Selective and long-term learning impairment following neonatal hypoxic- ischemic brain insult in rats. Behav Brain Res 2001; 118:17–25 30. Dirnagl U, Simon RP, Hallenbeck JM: Ischemic tolerance and endogenous neuroprotection. Trends Neurosci 2003; 26:248–54 31. Kluck RM, Bossy-Wetzel E, Green DR, Newmeyer DD: The release of cytochrome c from mitochondria: A primary site for Bcl-2 regulation of apopto- sis. Science 1997; 275:1132–6 32. Hu Y, Benedict MA, Wu D, Inohara N, Nunez G: Bcl-XL interacts with Apaf-1 and inhibits Apaf-1-dependent caspase-9 activation. Proc Natl Acad Sci U S A 1998; 95:4386–91 33. Huang DC, Adams JM, Cory S: The conserved N-terminal BH4 domain of Bcl-2 homologues is essential for inhibition of apoptosis and interaction with CED-4. EMBO J 1998; 17:1029–39 34. Pan G, O’Rourke K, Dixit VM: Caspase-9, Bcl-XL, and Apaf-1 form a ternary complex. J Biol Chem 1998; 273:5841–5 35. Nakajima W, Ishida A, Lange MS, Gabrielson KL, Wilson MA, Martin LJ, Blue ME, Johnston MV: Apoptosis has a prolonged role in the neurodegeneration after hypoxic ischemia in the newborn rat. J. Neurosci 2000; 20:7994–8004 36. Gill R, Soriano M, Blomgren K, Hagberg H, Wybrecht R, Miss MT, Hoefer S, Adam G, Niederhauser O, Kemp JA, Loetscher H: Role of caspase-3 activation in cerebral ischemia-induced neurodegeneration in adult and neonatal brain. J Cereb Blood Flow Metab 2002; 22:420–30 37. Nishikawa M, Takeda K, Sato EF, Kuroki T, Inoue M: Nitric oxide regulates energy metabolism and Bcl-2 expression in intestinal epithelial cells. Am J Physiol 1998; 274:G797–801 38. Hierholzer C, Kalff JC, Billiar TR, Bauer AJ, Tweardy DJ, Harbrecht BG: Induced nitric oxide promotes intestinal inflammation following hemorrhagic shock. Am J Physiol Gastrointest Liver Physiol 2004; 286:G225–33 39. Alas S, Emmanouilides C, Bonavida B: Inhibition of interleukin 10 by rituximab results in down-regulation of bcl-2 and sensitization of B-cell non- Hodgkin’s lymphoma to apoptosis. Clin Cancer Res 2001; 7:709–23 40. Altieri DC: Survivin in apoptosis control and cell cycle regulation in cancer. Prog Cell Cycle Res 2003; 5:447–52 41. Kobayashi K, Hatano M, Otaki M, Ogasawara T, Tokuhisa T: Expression of a murine homologue of the inhibitor of apoptosis protein is related to cell proliferation. Proc Natl Acad Sci U S A 1999; 96:1457–62 42. Kelly S, Yenari MA: Neuroprotection: Heat shock proteins. Curr Med Res Opin 2002; 18 (suppl 2):s55–60 43. Giffard RG, Yenari MA: Many mechanisms for hsp70 protection from cerebral ischemia. J Neurosurg Anesthesiol 2004; 16:53–61 D o w n o a d e d l f r o m h t t p : / / p u b s . a s a h q o r g a n e s t h e s o o g y / a r t i c e - p d . / i l l f / 1 0 7 6 9 6 3 6 5 5 5 2 7 0 0 0 0 5 4 2 - 2 0 0 7 1 2 0 0 0 - 0 0 0 1 6 p d / / / / . f b y g u e s t o n 2 0 N o v e m b e r 2 0 2 3",rats,['Six-day-old rats were exposed to 1.5% isoflurane for 30 min at 24 h before the brain hypoxia–ischemia that was induced by left common carotid arterial ligation and then exposure to 8% oxygen for 2 h.'],postnatal day 6,['Six-day-old rats were placed in a chamber containing 1.5% isoflurane carried by 30% O2–70% N2 for 30 min at 24 h before the cerebral hypoxia–ischemia.'],Y,"['The motor coordination functions as reflected by the speed–latency index in the rotarod test among the rats in various groups were statistically different.', 'The learning and memory functions were evaluated by the Y-maze and social recognition tasks.']",isoflurane,['Six-day-old rats were exposed to 1.5% isoflurane for 30 min at 24 h before the brain hypoxia–ischemia that was induced by left common carotid arterial ligation and then exposure to 8% oxygen for 2 h.'],none,[],sprague dawley,"['Briefly, 7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane in 30% O2–70% N2, and their left common carotid arteries were permanently ligated with a double 7-0 surgical silk.']",Finding methods to reduce ischemic brain injury has been a focus of medical research due to its huge impact on human health and financial burden on society.,"['Because of the huge impact on human health and financial burden on our society, finding methods to reduce ischemic brain injury has been a focus of medical research.']",The study designed to test the hypothesis that isoflurane preconditioning can improve long-term neurologic outcome after brain ischemia.,['We designed this study to test the hypothesis that isoflurane preconditioning can improve long-term neurologic outcome after brain ischemia.'],"Isoflurane preconditioning improved the long-term neurologic outcome after brain ischemia, suggesting a potential clinical application in reducing brain injury.",['Conclusions: Isoflurane preconditioning improved the long-term neurologic outcome after brain ischemia.'],None,[],The findings suggest potential clinical applications in using isoflurane preconditioning to reduce brain injury in situations where brain ischemia occurs as a planned or anticipated event.,"['Because isoflurane is a commonly used and relatively safe drug, our finding may have implications in clinical situations that brain ischemia occurs as a planned or anticipated event.']",True,True,True,True,True,True,10.1097/01.anes.0000291447.21046.4d