Received: 30 October 2021

Revised: 20 January 2022

Accepted: 27 February 2022

DOI: 10.1002/brb3.2556

O R I G I N A L A R T I C L E

miRNA-384-3p alleviates sevoflurane-induced nerve injury by inhibiting Aak1 kinase in neonatal rats

Yuanyuan Chen1

Xuan Gao2

Hao Pei3

1Department of Anesthesiology, Yancheng Maternity and Child Health Care Hospital, Yancheng, Jiangsu, China

Abstract

Objective: Sevoflurane is a common anesthetic and is widely used in pediatric clinical

2Department of Anesthesiology, Shanghai Blue Cross Brain Hospital, Shanghai, China

surgery to induce and maintain anesthesia through inhalation. Increasing studies

3Department of Anesthesiology, Children’s Hospital of Fudan University, Shanghai, China

have revealed that sevoflurane has neurotoxic effects on neurons, apoptosis, and

memory impairment. miR-384 is involved in the process of neurological diseases.

Correspondence Hao Pei, Department of Anesthesiology, Children’s Hospital of Fudan University, No. 399, Wanyuan Road, Minhang District, Shanghai City 201102, China. Email: lebajie_pei@hotmail.com

However, the role of miRNA-384-3p in sevoflurane-induced nerve injury is not clear.

This study focused on exploring the roles and mechanisms of miRNA-384-3p in

sevoflurane-induced nerve injury.

Methods: Seven-day-old rats were exposed to 2.3% sevoflurane to induce nerve injury.

The morphological changes in neurons in the hippocampal CA1 region were detected

Yuanyuan Chen and Xuan Gao contributed equally to this work.

by HE staining and Nissl staining. Neuronal apoptosis was detected by TUNEL and

Western blot assays. Spatial memory and learning ability were detected by the Morris

water maze assay. The target gene of miRNA-384-3p was verified through a luciferase

reporter assay. A rescue experiment was used to confirm the miRNA-384-3p pathway

in sevoflurane-induced nerve injury.

Results: Sevoflurane reduced miRNA-384-3p expression in the rat hippocampus.

miRNA-384-3p alleviated sevoflurane-induced morphological changes in hippocampal

neurons and apoptosis of neurons in the hippocampal CA1 region. Meanwhile, miRNA-

384-3p attenuated the decline in spatial memory and learning ability induced by

sevoflurane. miRNA-384-3p alleviated sevoflurane-induced nerve injury by inhibiting

the expression of adaptor-associated kinase 1 (Aak1).

Conclusion: Our findings revealed the role and mechanism of miRNA-384-3p in

sevoflurane-induced nerve injury, suggesting that miRNA-384-3p could be a novel and

promising strategy for reducing sevoflurane-induced neurotoxicity.

K E Y W O R D S Aak1, miRNA-384-3p, nerve injury, sevoflurane

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2022 The Authors. Brain and Behavior published by Wiley Periodicals LLC.

Brain Behav. 2022;12:e2556. https://doi.org/10.1002/brb3.2556

wileyonlinelibrary.com/journal/brb3

1 of 11

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

2 of 11

CHEN ET AL.

were kept on a 12-h light–dark cycle in individually ventilated cages at 21 ± 1◦C with free access to food and water. All animal experi- ments were approved by the Institutional Animal Care and Use Com-

1

INTRODUCTION

Sevoflurane, an inhalation anesthetic, is widely used in clinical surgical

mittees and performed according to the institution’s guidelines and

operations (Egan, 2015; Yi et al., 2015). However, recent studies have

animal research principles.

shown that sevoflurane has neurotoxic effects, increases neuronal

The rats were randomly divided into three groups: control, sevoflu-

apoptosis, and reduces learning and memory ability (H. He et al., 2018;

rane, and miRNA-384-3p agomir injection. Each group consisted of 12

Perez-Zoghbi et al., 2017). The mechanism of sevoflurane-induced neu-

rats. Sevoflurane was used to anesthetize rats as previously described

rotoxicity remains mostly unknown. Hence, it is necessary to explore

(Zhou et al., 2017). Briefly, rats were exposed to 2.3% sevoflurane

the underlying molecular mechanism of sevoflurane-induced neuro-

for 2 h every day for 3 continuous days. The gas flow was 2 L/min,

toxicity to reduce sevoflurane-induced nerve injury.

and the concentration of sevoflurane was measured by a gas monitor

MicroRNAs (miRNAs) are noncoding RNAs, and their expres-

(Detex Ohmeda, CO, USA). The NPS-A3 heating device (Midea Group, Beijiao, China) was used to heat the chamber up to 38◦C. Rats in the sevoflurane group were injected with 2 nmol agomir NC (volume is 2 μl) into the hippocampus on the left lateral cerebral ventricles

sion is involved in various physiological and pathological processes

(Gjorgjieva et al., 2019; Sun et al., 2018). Some studies have con-

firmed that miRNAs play a vital role in sevoflurane-induced neurotox-

icity. For example, Zhao et al. (2018) found that sevoflurane upregu-

after the first day of exposure to sevoflurane. The miRNA-384-3p

lates miR-34a expression in the hippocampus. miR-34a also promoted

agomir was purchased from RiboBio (Guangzhou, China) and diluted

neuronal apoptosis and memory impairment induced by sevoflurane through the wnt1/β-catenin pathway (Zhao et al., 2018). In neonatal

with Entranster transfection reagent (Engreen Biosystem Co., Beijing,

China). Then, bilateral intrahippocampal administration was per- formed by injection with 2 nmol miRNA-384-3p agomir (volume is 2 μl)

rats, the level of miR-96 is positively correlated with the concentra-

tion of exposed sevoflurane. The increased expression of miR-96 aggra-

into the hippocampus using a stereotaxic apparatus (RWD Life Science,

vates sevoflurane-induced hippocampal neuron apoptosis and cogni-

Shenzhen, China) and a 33-gauge beveled NanoFil needle. On the first

tive function injury (C. Xu et al., 2019). X. He et al. (2007) found that

day of exposure to sevoflurane, the cells were exposed to sevoflurane

miR-384 expression was higher in the hippocampus than in other tis-

for 2 days. Control group rats were exposed to air for 2 h/day and over

sues. In addition, miR-384-5p expression was more than 10 times

3 consecutive days. After being exposed to sevoflurane for 3 days, the

higher than that of miRNA-384-3p in the rat hippocampus (X. He

rats were euthanized, and the hippocampus was collected for further

et al., 2007). Liu et al. found that chronic cerebral ischemia increased

experiments.

miR-384 expression in the hippocampus and hippocampal neurons.

Knockdown of miR-384 inhibits the apoptosis of hippocampal neurons

induced by chronic cerebral ischemia (Liu et al., 2019). Similarly, miR-

2.2

Cell isolation and culture

384-5p promotes neurotoxicity and attenuates learning and memory

in rats (Jiang et al., 2016; Q. Xu et al., 2019). However, whether the

The hippocampus was dissected from neonatal rats (7 days old),

roles of miRNA-384-3p are consistent with those of miR-384-5p in

triturated, and dissociated through trypsin. The dissociated cells were

neurotoxicity remains obscure. Therefore, we focused on exploring the

filtered and centrifuged and then resuspended in Dulbecco’s Modified

effects of miRNA-384-3p on sevoflurane-induced neurotoxicity.

Eagle Medium/F12 medium (DMEM/F12, Thermo-Scientific, MA,

Aak1, adaptor-associated kinase 1, has been reported to be associ-

USA). Then, the cells were seeded onto dishes coated with poly-D-

ated with nervous-related diseases and nerve injury (Shi et al., 2014).

lysine and cultured with DMEM/F12 supplemented with 10% fetal

For instance, Aak1 regulates clathrin-mediated endocytosis, thereby

bovine serum (FBS, Thermo Scientific, MA, USA), 1% glutamine, 4.5 g/L

affecting the cognitive ability of AD mice (Fu et al., 2018). However, the

B27 plus glucose, and 1% penicillin–streptomycin (Sigma–Aldrich, MI, USA). After culturing for 3 days, 5 μg/ml cytosine arabinoside C

role of Aak1 in anesthesia-induced neurotoxicity remains unclear.

The role and mechanism of miRNA-384-3p in sevoflurane-induced

(Sigma–Aldrich, MI, USA) was added to the medium and cultured for 24 h. The neurons were cultured in a humidified incubator at 37◦C and 5% CO2 for 14 days.

neurotoxicity were investigated in this study, and the results confirmed

that miRNA-384-3p attenuated sevoflurane-induced neuronal apop-

tosis and memory disorder by inhibiting the expression of Aak1. Our

findings suggest that miRNA-384-3p may be a promising strategy for

resolving sevoflurane-induced nerve injury during clinical surgery.

2.3

Cell treatment and transfection

2

MATERIALS AND METHODS

Neurons were cultured in a humidified incubator chamber with

a gas mixture of 1% sevoflurane, 94% air and 5% CO2 for 6 h. Sevoflurane was delivered to the chamber at a rate of 10 L/min

Animals and treatment

2.1

through a vaporizer (Datex-Ohmeda, Helsinki, Finland). Control

Seven-day-old Sprague–Dawley rats were used in this study. They were

neurons were cultured in a humidified incubator with 95% air and 5%

obtained from the GemPharmatech Company (Nanjing, China). All rats

CO2.

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

3 of 11

2.6

Hematoxylin and eosin staining

Hippocampal neurons, including control and sevoflurane-exposed neurons, were seeded into 24-well plates at 104 cells/well. When the

confluence of the cells reached 60%, Lipofectamine 3000 (Thermo Sci-

Rats were euthanized under the anesthesia of pentobarbital sodium

entific, MA, USA) was used for transfection. miRNA-384-3p mimics,

(80 mg/kg), and then the hippocampal tissues were removed. Tissues

NC mimics, pcDNA-Aak1 vector (pc-Aak1), and pcDNA control vec-

were fixed with 4% paraformaldehyde for 24 h and paraffin embed- ded. Sections of 4 μM were cut, and staining was carried out according

tor (pc-NC) were obtained from GeneChem (Shanghai, China). miRNA-

384-3p mimics and NC mimics were transfected into control neu-

to the hematoxylin and eosin (HE) protocol. Neural injury scoring was

rons. NC mimics and pc-NC were transfected into control neurons

performed according to the following standard: no nerve cell death, 0

simultaneously. NC mimics and pc-NC, miRNA-384-3p mimics and pc-

points; scattered single nerve cell death, 1 point; slight nerve cell death,

NC, and miRNA-384-3p mimics and pc-Aak1 were transfected into

2 points; mass nerve cell death, 3 points; and almost complete nerve

sevoflurane-exposed neurons simultaneously. The transfection con-

cell death, 4 points.

centration was 10 nM. After transfection for 48 h, the cells were col-

lected for further experiments.

2.7

Nissl staining

Real-time quantitative polymerase chain

2.4 reaction

Paraffin sections of hippocampal tissues were deparaffinized and stained with cresyl violet solution for 45 min at 37◦C. Next, sections were washed with distilled water and differentiated with gradient con-

Total RNA was isolated from hippocampal tissue or transfected neu-

centration ethanol. The differentiation was stopped when the tissue

rons by using TRIzol reagent (Thermo-Scientific, MA, USA). RNA was

was clear by transferring the sections to distilled water. Then, the sec-

reverse transcribed into cDNA by using the PrimeScript RT reagent kit

tions were dehydrated through a gradient concentration of ethanol and

(Takara, Japan). A SYBR green PCR kit (Vazyme, Nanjing, China) was

covered with neutral resin. Optical microscopy (Nikon, Tokyo, Japan)

used to perform real-time quantitative polymerase chain reaction (RT–

was used to observe the neurons in the hippocampal CA1 regions. The

qPCR). U6 and GAPDH were used to normalize the relative expres-

number of Nissl bodies was analyzed in a double-blinded manner with

sion of miRNA-384-3p and Aak1. The miRNA-384-3p forward primer sequence (5′−3′) was AATTCCTAGAAATTGTT, and the reverse primer sequence (5′−3′) was AGTGCAGGGTCCGAGGTATT. The U6 forward primer sequence (5′−3′) was CTCGCTTCGGCAGCACATATACT, and the reverse primer sequence (5′−3′) was ACGCTTCACGAATTTGCGT- GTC. The Aak1 forward primer sequence (5′−3′) was CGGGTCACTTC- CGGGTTTA, and the reverse primer sequence (5′−3′) was TTCTTCTC- CGGTTTCAGCCC. The GAPDH forward primer sequence (5′−3′) was GAACGGGAAGCTCACTGG, and the reverse primer sequence (5′−3′)

Image-Pro Plus 6.0.

2.8

Cell apoptosis

The cell apoptosis ratio was measured in transfected neurons and hip-

pocampal tissues by using the In Situ Cell Death Detection kit (Roche,

Basel, Switzerland). After staining, the positive neurons were ran-

domly observed by a fluorescence microscope (Nikon, Tokyo, Japan)

was GCCTGCTTCACCACCTTCT.

in five fields. The apoptosis ratio was measured by TUNEL-positive

neurons/DAPI-positive neurons.

2.5

Subcellular fractionation

2.9 Western blot analysis

After hippocampal microdissection, tissues were immediately treated

with freshly prepared ice-cold homogenization buffer (20 mM HEPES,

Protein was extracted from hippocampal tissue or transfected neurons

2 mM EGTA, 0.3 mg/ml dithioerythritol, 0.16 mg/ml phenylmethyl-

using RIPA lysis buffer containing a protease inhibitor (Promega

sulfonyl fluoride, and 0.020 mg/ml aprotinin) and homogenized. The homogenate was centrifuged at 17,000 × g for 5 min to obtain the

Corporation, WI, USA). The protein samples were fractionated by

SDS–PAGE and transferred to a polyvinylidene difluoride membrane

cytoplasmic fraction. The pellet was washed with buffer B (150 mM NaCl; 10 mM HEPES; 1 mM EDTA), centrifuged at 17,000 × g for 1 min at 4 ◦C, resuspended in buffer C (25% v/v glycerol; 20 mM HEPES; 400 mM NaCl; 1.2 mM MgCl2; 0.2 mM EDTA), vortexed for 30 s and incubated on ice for 10 min (five times) to finally centrifuge at 17,000 ×

(PVDF, Millipore, MA, USA). Afterwards, the membranes were incu-

bated with 5% nonfat milk for 2 h at room temperature. Then, the

membranes were incubated with the primary antibody overnight at 4◦C. Then, the membranes were incubated for 2 h with the secondary antibody at room temperature and visualized with a chemilumines-

g for 20 min to obtain the nuclear fraction (Caviedes et al., 2021). RNA

cence kit (Vazyme, Nanjing, China). ImageJ software was used to

expression of GAPDH, U6, miRNA-384-3p, and Aak1 in the nuclear

analyze the protein expression. In this study, antibodies against Bax,

and cytoplasmic fractions was detected by RT–qPCR as mentioned

Bcl-2, cleaved caspase-3, PCNA, and Aak1 were diluted to 1:1000 for

above.

use, cleaved caspase-9 was diluted to 1:200, and Ki-67 was diluted to

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

4 of 11

CHEN ET AL.

1:100. β-actin was used as the internal control, and the antibody was

ANOVA were used to test the mean difference between groups. Statis-

diluted to 1:5000. The goat anti-rabbit HRP antibody was used as a

tical analysis was carried out using GraphPad Prism 7 (GraphPad Inc., San Diego, CA, USA). A p-value < .05 was considered statistically sig-

secondary antibody and diluted to 1:5000 for use. All antibodies were

nificant.

purchased from Abcam (London, England).

2.10

Morris water maze test

3

RESULTS

The Morris water maze (MWM) test was used to evaluate the learning

3.1 miRNA-384-3p in the rat hippocampus

Sevoflurane reduces the expression of

and memory abilities of rats at the age of 2 months. The MWM con- sisted of a pool (100 cm × 100 cm × 60 cm) and a platform (1 cm × 1 cm). The pool was filled with warm water (25◦C) to 1 cm. Rats were ran- domly placed in the pool and allowed to swim to the platform. The time

To detect the effect of sevoflurane on miRNA-384-3p expression, we

collected hippocampal tissues from control and sevoflurane-exposed

that the rats spent swimming to a hidden platform was measured at 90

neonatal rats and detected the expression of miRNA-384-3p through

s, and the rats were allowed to rest on the platform for 20 s. The time

RT–qPCR. The results showed that miRNA-384-3p expression was

was recorded as 90 s if the rats did not find the platform within 90 s, and

decreased in the hippocampal tissues of sevoflurane-exposed rats

the rats were also placed on the platform for 20 s to rest. In the acqui-

compared with control rats (Figure 1a). miRNA-384-3p was primarily

sition phase, five training sessions were conducted every day for 5 con-

located in the cytoplasm in hippocampal tissues (Figure 1b). The results

tinuous days. After the training, probe trials were performed. The time

suggested that miRNA-384-3p was downregulated by sevoflurane in

of plateau quadrant residence and the number of traversing platforms

the rat hippocampus.

were recorded by computerized tracking/analyzing video systems to

suggest the spatial memory and learning ability of the rats.

miRNA-384-3p restores sevoflurane-induced

3.2 morphological changes in neurons in the hippocampal CA1 region

Dual-luciferase reporter assay

2.11

Aak1 wild type (Aak1 WT) containing the miRNA-384-3p binding sites in the 3′UTR of Aak1 was inserted into the firefly luciferase vector.

Sevoflurane-induced neurotoxicity has been reported previously

(Perez-Zoghbi et al., 2017). To confirm the role of miRNA-384-3p

To confirm specific binding, an Aak1 mutant (Aak1 Mut) containing the mutated binding sites of miRNA-384-3p in the Aak1 3′UTR was

in sevoflurane-induced neurotoxicity, miRNA-384-3p agomir was

injected into the rat hippocampus after the first day of sevoflurane

constructed. For the luciferase reporter assay, hippocampal neurons

exposure. We detected morphological changes in neurons through HE

were cultured and plated in 24-well plates. Each well was transfected with 1 μg Aak1 WT vector or Aak1 Mut vector, 1 μg Renilla luciferase

and Nissl staining. The HE results showed that sevoflurane induced

neuronal injury and decreased the number of neurons in the hippocam-

plasmid, and 100 pM miRNA-384-3p mimics or NC mimics by using

pal CA1 regions, and the decreased injury and number of neurons were

Lipofectamine 3000 (Invitrogen, CA, USA). After 48 h of transfection,

attenuated by the miRNA-384-3p agomir (Figure 2a). The Nissl

the dual-luciferase reporter assay system (Promega Corporation, WI,

results showed that Nissl bodies and neurons were decreased in the

USA) was used to measure the firefly and Renilla luciferase activities.

hippocampal CA1 regions of sevoflurane-exposed rats compared

with control rats. The sevoflurane-induced decrease in Nissl bodies

was attenuated by the miRNA-384-3p agomir (Figure 2b). These

2.12

Cell viability assay

results demonstrated that miRNA-384-3p restored the sevoflurane-

induced morphological changes in neurons in the hippocampal CA1

Cell viability was detected by the cell counting kit-8 (CCK8) assay.

regions.

Transfected hippocampal neurons were seeded onto 96-well plates at approximately 103 cells/well (100 μl/well). Then, the neurons were cul- tured for 1 h and mixed with 10 μl CCK8 reagent (Dojindo, Kumamoto,

miRNA-384-3p inhibits sevoflurane-induced 3.3 neuronal apoptosis in the hippocampal CA1 region

Japan) for 2 h. Next, the optical density was measured at 450 nm by uti-

lizing a Bio-EL340 automatic microplate reader (Tek Instruments, Hop-

kinton, USA).

We detected the function of miRNA-384-3p in sevoflurane-induced

neuronal apoptosis through the TUNEL assay and Western blot

2.13

Statistical analysis

assay. The TUNEL assay results demonstrated that the apoptosis

ratio of neurons was increased in the hippocampal CA1 region of

All data are presented as the mean ± standard deviation (SD) of

sevoflurane-treated rats compared with control rats. Overexpression

three independent experiments. Unpaired Student’s t test and one-way

of miRNA-384-3p inhibited the apoptosis induced by sevoflurane

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

5 of 11

F I G U R E 1

Sevoflurane reduces the expression of miRNA-384-3p in the rat hippocampus. (a) The expression of miRNA-384-3p was detected

by RT–qPCR in the hippocampus of sevoflurane-exposed rats and control rats. (b) Nuclear and cytoplasmic expression of miRNA-384-3p in the hippocampus from control rats was assessed by RT–qPCR. **p < .01, the difference was compared to control rats. The error bars represent the mean ± SD in three independent repetitions

F I G U R E 2 miRNA-384-3p restores sevoflurane-induced morphological changes in neurons in the hippocampal CA1 region. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal neonatal rats were used as a negative control. (a) HE staining detected morphological changes in neurons in the hippocampal CA1 region. (b) Nissl staining detected Nissl bodies and neurons in the hippocampal CA1 region. The scale bar is 50 μM. Every experiment had three independent repetitions. ***p < .001, **p < .01 vs. the control group, ##p < .01, #p < .05 vs. the sevoflurane group. The error bars represent the mean ± SD in three independent repetitions

3.4 and learning ability of sevoflurane-treated rats

miRNA-384-3p improves the spatial memory

(Figure 3a). Similar to the TUNEL assay results, Western blot results

showed that the expression of Bax, cleaved-caspase-3, and cleaved-

caspase-9 was increased. Meanwhile, Bcl-2 expression was decreased

in the hippocampal CA1 region of sevoflurane-treated rats compared

Next, we tested the function of miRNA-384-3p in sevoflurane-induced

with control rats. Overexpression of miRNA-384-3p attenuated

changes in spatial memory and learning ability through the MWM

sevoflurane-induced expression changes in these apoptosis-related

test. The results showed that the time of plateau quadrant residence

genes (Figure 3b). These results suggested that miRNA-384-3p inhib-

and the number of traversing platforms were reduced in sevoflurane-

ited sevoflurane-induced neuronal apoptosis in the hippocampal CA1

treated rats compared with control rats, suggesting that sevoflurane

region.

impaired the spatial memory and learning ability of rats (Figure 4a,b).

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

6 of 11

F I G U R E 3 miRNA-384-3p inhibits sevoflurane-induced neuronal apoptosis in the hippocampal CA1 region. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal neonatal rats were used as a negative control. (a) Cell apoptosis was detected by a TUNEL assay in the hippocampal CA1 region. (b) Western blot analysis of the expression of apoptosis-related genes. **p < .01. The difference was compared to control rats. ##p < .01, #p < .05, the difference was compared to sevoflurane-treated rats. The error bars represent the mean ± SD in three independent repetitions

Meanwhile, overexpression of miRNA-384-3p increased the plateau

and miRDB databases to predict the target genes of miRNA-384-3p.

quadrant residence time and the number of traversing platforms in

The predicted results showed that Aak1 was the only target gene of

sevoflurane-treated rats, suggesting that miRNA-384-3p attenuated

miRNA-384-3p in the three databases (Figure 5a). The predicted bind-

sevoflurane-induced injury to spatial memory and learning ability

ing sequence of Aak1 and miRNA-384-3p is shown in Figure 5b. The

(Figure 4a,b). These results demonstrated that miRNA-384-3p had a

luciferase assay was used to confirm the binding site, and the results showed that the luciferase activity was decreased in Aak1 3′UTR

protective effect on spatial memory and learning ability in rats.

WT and miRNA-384-3p mimic cotransfected neurons compared with Aak1 3′UTR WT and NC mimic cotransfected neurons. However, the luciferase activity was not significantly changed in Aak1 3′UTR

3.5

Aak1 is a target gene of miRNA-384-3p

MUT-transfected neurons (Figure 5c). To confirm that miRNA-384-3p

To explore the underlying mechanism of miRNA-384-3p in

regulates Aak1 expression, Western blotting was performed on neu-

sevoflurane-induced nerve injury, we used the TargetScan, miRWalk,

rons transfected with NC mimics or miRNA-384-3p mimics. The results

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

7 of 11

F I G U R E 4 miRNA-384-3p improves the spatial memory and learning ability of sevoflurane-treated rats. Neonatal rats were exposed to sevoflurane-induced nerve injury and were divided into two groups; one group was injected with miRNA-384-3p agomir into the hippocampus. Normal rats were used as a negative control. When rats were at the age of 2 months, plateau quadrant residence (a) and the number of traversing platforms (b) were detected by the MWM test. *p < .05 vs. the control group, #p < .05 vs. the sevoflurane group. The error bars represent the mean ± SD. Every experiment had three independent repetitions

F I G U R E 5 Aak1 is a target gene of miRNA-384-3p. (a) Prediction of target genes of miRNA-384-3p through the miRDB, miRWalk, and TargetScan databases. (b) The putative target sequence of miRNA-384-3p in the 3′UTR of Aak1 and the mutated sequence. (c) Luciferase assays in neurons transfected with Aak1 WT or Aak1 Mut and NC mimics or miR-384 mimics. (d) Western blot analysis of Aak1 expression in neurons transfected with miRNA-384-3p mimics or NC mimics. (e) RT-qPCR detected Aak1 expression in the hippocampus of sevoflurane-treated rats and control rats. (f) Nuclear and cytoplasmic expression of Aak1 in the hippocampus from normal rats was assessed by RT-qPCR. **p < .01. The difference was compared to control rats or transfected NC mimic neurons. The error bars represent the mean ± SD in three independent repetitions

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

8 of 11

CHEN ET AL.

showed that the expression of Aak1 was decreased in miRNA-384-3p

neurodevelopmental defects (Warner et al., 2018; Zhang et al., 2016).

For instance, ropivacaine exposure induces significant sciatic nerve

mimic-transfected neurons compared with NC mimic-transfected

injury in diabetic rats (Yu et al., 2019). Ketamine, midazolam, or a

neurons (Figure 5d). Additionally, RT-qPCR results showed that Aak1

combination of the two drugs induce apoptotic neurodegeneration in

was upregulated in the hippocampus of sevoflurane-treated rats

the developing mouse brain (Young et al., 2005). Therefore, exploring

compared with control rats (Figure 5e). Moreover, Aak1 was primarily

the methods of reducing the injury induced by anesthesia is impor-

located in the cytoplasmic fraction in the hippocampus of control rats

tant and necessary. Sevoflurane is an anesthetic and contributes to

(Figure 5f). These results demonstrated that Aak1 was a target gene

neurological disorders and neurodegeneration in the development of

of miRNA-384-3p and that its expression was negatively regulated by

miRNA-384-3p.

the brain and affects memory and cognition (O’Farrell et al., 2018;

Zhang et al., 2016). Sevoflurane at subanesthetic concentrations trig-

gers neuronal apoptosis in 7-day-old mouse brains (Zhang et al., 2008).

3.6 neuronal apoptosis and nerve injury through Aak1

miRNA-384-3p alleviates sevoflurane-induced

Sevoflurane exposure repeatedly induces cognition-related biochem-

ical changes in the hippocampus and impairs learning and memory

ability (Guo et al., 2018). Therefore, we established a sevoflurane

To confirm whether miRNA-384-3p plays a role in sevoflurane-induced

neurotoxicity model in neonatal rats through repeated exposure to

nerve injury through Aak1, we transfected miRNA-384-3p mimics and

sevoflurane.

the Aak1 vector into hippocampal neurons simultaneously, and the

Previous studies have reported that neurotoxicity induced by anes-

neurons were cultured with sevoflurane. The RT-qPCR results showed

thesia is regulated by miRNA (Bahmad et al., 2020). For example,

that miRNA-384-3p expression was decreased in sevoflurane-treated

miR-34a expression is upregulated in propofol-treated neurons and

neurons compared to control neurons, and miRNA-384-3p mimics

rats. Meanwhile, inhibition of miR-34a improves propofol-induced

restored the expression of miRNA-384-3p. Meanwhile, the expres-

cognitive dysfunction by suppressing cell apoptosis and recovering

sion of Aak1 was increased in sevoflurane-treated neurons compared

the expression of MAPK/ERK pathway genes (Xin, 2018). miR-124

with control neurons. miRNA-384-3p mimics decreased the expres-

increases ketamine-induced apoptosis in the hippocampal CA1 region

sion of Aak1 in sevoflurane-treated neurons, and the miRNA-384-3p-

and improves the memory performance of mice (H. Xu et al., 2015).

induced decrease in Aak1 was partially restored by transfection with

miR-384 is also involved in the progression of brain development, cog-

the Aak1 vector (Figure 6a). To detect whether Aak1 participated in

nition, and pathophysiology of neurological disorders (Gu et al., 2015).

the regulation of miRNA-384-3p on sevoflurane-induced cell viability,

However, the roles of miRNA-384-3p in anesthesia-induced neurotox-

a CCK8 assay was used. The results showed that miRNA-384-3p atten-

icity remain unclear. Here, we detected the expression of miRNA-384-

uated the inhibitory effect of sevoflurane on cell viability, while the

3p in sevoflurane-exposed rat hippocampi and found that sevoflurane

miRNA-384-3p effect was remarkably undermined after the overex-

decreased the expression of miRNA-384-3p. A miRNA-384-3p agomir

pression of Aak1 (Figure 6b). Western blotting was used to measure

was injected into neonatal rats to overexpress miRNA-384-3p. We fur-

proliferation-related gene expression at the protein level. The results

ther confirmed that miRNA-384-3p improved neuronal morphology,

showed that sevoflurane inhibited the expression of PCNA and Ki-

neuronal apoptosis, and learning and memory ability in sevoflurane-

67, which was partially restored by miRNA-384-3p. Meanwhile, over-

treated rats.

expression of Aak1 attenuated miRNA-384-3p-mediated expression

miRNAs mainly regulate the mRNA degradation or posttranscrip-

changes in PCNA and Ki-67 in sevoflurane-treated neurons (Figure 6c).

tional repression of the targeted gene (Saliminejad et al., 2019). To

The TUNEL assay was used to detect whether Aak1 participated in

explore the mechanism of miRNA-384-3p in sevoflurane-induced

the regulation of miRNA-384-3p on sevoflurane-induced cell apop-

nerve injury, we predicted and confirmed that Aak1 is a target

tosis, and the results showed that overexpression of miRNA-384-3p

gene of miRNA-384-3p. Aak1 plays vital roles in neuropathic pain,

reduced the apoptosis of hippocampal neurons induced by sevoflu-

schizophrenia, Parkinson’s disease and other neuropathic disorders

rane, while the miRNA-384-3p effect was inhibited by increasing the

(Abdel-Magid, 2017). For example, Fu et al. found that Aak1 expression is highest on day 14 and is reduced on day 30 in the Aβ1-42-induced AD model. The expression of Aak1 is negatively correlated with cognitive

expression of Aak1 (Figure 6d). Similar to the results, the Western blot

results demonstrated that sevoflurane-induced changes in apoptosis-

related genes were attenuated by miRNA-384-3p. Meanwhile, Aak1

ability by regulating the process of clathrin-mediated endocytosis (Fu

overexpression restored the miRNA-384-3p-mediated changes in the

et al., 2018). Kostich, Walter et al. discovered that Aak1 knockout mice

expression of these genes in sevoflurane-treated hippocampal neurons

have an antinociceptive phenotype, which may be a novel therapeutic

(Figure 6e). These results demonstrated that miRNA-384-3p allevi-

approach for neuropathic pain by inhibiting Aak1 kinase (Kostich et al.,

ated sevoflurane-induced neuronal apoptosis and nerve injury through

2016). Leger, Helene et al. found that Ndr kinases inhibit the prolifer-

Aak1.

ation of terminally differentiated cells and modulate the function of

interneuron synapses through Aak1 (Leger et al., 2018). However, the

DISCUSSION

4

role of Aak1 in anesthesia-mediated nerve injury remains unknown.

Here, we confirmed that Aak1 expression was negatively regulated

Anesthesia is widely used in modern medicine; however, a multitude

by miRNA-384-3p in hippocampal neurons. Meanwhile, we demon-

of evidence has demonstrated that anesthesia increases the risk of

strated that miRNA-384-3p alleviated sevoflurane-induced neuronal

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

9 of 11

F I G U R E 6 miRNA-384-3p alleviates sevoflurane-induced neuronal apoptosis and nerve injury through Aak1. Hippocampal neurons were divided into four groups, including NC mimic- and pc-NC-transfected neurons cultured under control conditions, NC mimic- and pc-NC-transfected neurons cultured with 1% sevoflurane, miRNA-384-3p mimic- and pc-NC-transfected neurons cultured with sevoflurane, miRNA-384-3p mimic-, and pc-Aak1-transfected neurons cultured with sevoflurane. (a) RT-qPCR detected miRNA-384-3p and Aak1 levels. (b) CCK8 assay detected cell viability. (c) Western blot analysis of the expression of proliferation-related genes. (d) TUNEL assay detected cell apoptosis. (e) Western blot analysis of apoptosis-related gene levels. **p < .01 vs. the NC mimics + pc-NC group. ###p < .001, ##p < .01 vs. the sevoflurane group. &&&p < .001, &&p < .01, &p < .05 vs. the miR-384-3p mimic + pc-NC + sevoflurane group. The error bars represent the mean ± SD in three independent repetitions

apoptosis and nerve injury by inhibiting the expression of Aak1 via

CONFLICT OF INTEREST

rescue experiments.

The authors declare that they have no conflict of interest.

AUTHOR CONTRIBUTIONS

CONCLUSION

5

Xuan Gao and Hao Pei conceived and designed the study. Xuan Gao and

Yuanyuan Chen performed the literature search and data extraction.

Hao Pei drafted the manuscript. All authors read and approved the final

In neonatal rats, we confirmed the roles and mechanisms of

version of the manuscript.

miRNA-384-3p in sevoflurane-induced nerve injury,

including hip-

pocampal neuron apoptosis and memory impairment. The findings

of our study suggest that miRNA-384-3p could be a promising

DATA AVAILABILITY STATEMENT

strategy for reducing sevoflurane-induced nerve injury in clinical

All data generated or analyzed during this study are included in the

surgery.

article.

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

10 of 11

CHEN ET AL.

PEER REVIEW

Leger, H., Santana, E., Leu, N. A., Smith, E. T., Beltran, W. A., Aguirre, G. D., & Luca, F. C. (2018). Ndr kinases regulate retinal interneuron prolifera- tion and homeostasis. Science Reports, 8, 12544. https://doi.org/10.1038/ s41598-018-30492-9

The peer review history for this article is available at https://publons.

com/publon/10.1002/brb3.2556

Liu, J., An, P., Xue, Y., Che, D., Liu, X., Zheng, J., Liu, Y., Yang, C., Li, Z., & Yu, B. (2019). Mechanism of Snhg8/miR-384/Hoxa13/FAM3A axis regulating neuronal apoptosis in ischemic mice model. Cell Death & Disease, 10, 441. https://doi.org/10.1038/s41419-019-1631-0

ORCID

Hao Pei

https://orcid.org/0000-0002-6777-5463

O’Farrell, R. A., Foley, A. G., Buggy, D. J., & Gallagher, H. C. (2018). Neurotox- icity of inhalation anesthetics in the neonatal rat brain: Effects on behav- ior and neurodegeneration in the piriform cortex. Anesthesiology Research and Practice, 2018, 6376090.

REFERENCES

Abdel-Magid, A. F. (2017). Inhibitors of adaptor-associated kinase 1 (AAK1) may treat neuropathic pain, schizophrenia, Parkinson’s disease, and other disorders. ACS Medicinal Chemistry Letters, 8, 595–597. https://doi. org/10.1021/acsmedchemlett.7b00208

Perez-Zoghbi, J. F., Zhu, W., Grafe, M. R., & Brambrink, A. M. (2017). against sevoflurane-induced neurotoxicity extends to several brain regions in neonatal rats. British Journal of Anaesthesia, 119, 506–516. https://doi.org/10.1093/bja/aex222

Dexmedetomidine-mediated

neuroprotection

Bahmad, H. F., Darwish, B., Dargham, K. B., Machmouchi, R., Dargham, B. B., Osman, M., Khechen, Z. A., El Housheimi, N., Abou-Kheir, W., & Chamaa, F. (2020). Role of microRNAs in anesthesia-induced neurotoxicity in animal models and neuronal cultures: A systematic review. Neurotoxic- ity Research, 37, 479–490. https://doi.org/10.1007/s12640-019-00135- 6

Saliminejad, K., Khorram Khorshid, H. R., Soleymani Fard, S., & Ghaffari, S. H. (2019). An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. Journal of Cellular Physiology, 234, 5451–5465. https: //doi.org/10.1002/jcp.27486

Shi, B., Conner, S. D., & Liu, J. (2014). Dysfunction of endocytic kinase AAK1 in ALS. International Journal of Molecular Sciences, 15, 22918–22932. https://doi.org/10.3390/ijms151222918

Caviedes, A., Maturana, B., Corvalán, K., Engler, A., Gordillo, F., Varas-Godoy, M., Smalla, K. H., Batiz, L. F., Lafourcade, C., Kaehne, T., & Wyneken, U. (2021). eNOS-dependent S-nitrosylation of the NF-κB subunit p65 has neuroprotective effects. Cell Death & Disease, 12, 4. https://doi.org/10. 1038/s41419-020-03338-4

Sun, Z., Shi, K., Yang, S., Liu, J., Zhou, Q., Wang, G., Song, J., Li, Z., Zhang, Z., & Yuan, W. (2018). Effect of exosomal miRNA on cancer biology and clinical applications. Molecular Cancer, 17, 147. https://doi.org/10.1186/ s12943-018-0897-7

Egan, T. D. (2015). Total intravenous anesthesia versus inhalation anesthe- sia: A drug delivery perspective. Journal of Cardiothoracic and Vascular Anesthesia, 29 Suppl (1), S3–S6. https://doi.org/10.1053/j.jvca.2015.01. 024

Warner, D. O., Zaccariello, M. J., Katusic, S. K., Schroeder, D. R., Hanson, A. C., Schulte, P. J., Buenvenida, S. L., Gleich, S. J., Wilder, R. T., Sprung, J., Hu, D., Voigt, R. G., Paule, M. G., Chelonis, J. J., & Flick, R. P. (2018). Neuropsychological and behavioral outcomes after exposure of young children to procedures requiring general anesthesia: The Mayo Anes- thesia Safety in Kids (MASK) Study. Anesthesiology, 129, 89–105. https: //doi.org/10.1097/ALN.0000000000002232

Fu, X., Ke, M., Yu, W., Wang, X., Xiao, Q., Gu, M., & Lu, Y. (2018). Periodic vari- ation of AAK1 in an Abeta1-42-induced mouse model of Alzheimer’s dis- ease. Journal of Molecular Neuroscience, 65, 179–189. https://doi.org/10. 1007/s12031-018-1085-3

Gjorgjieva, M., Sobolewski, C., Dolicka, D., Correia de Sousa, M., & Foti, M. (2019). miRNAs and NAFLD: From pathophysiology to therapy. Gut, 68, 2065–2079. https://doi.org/10.1136/gutjnl-2018-318146

Xin, P., Kuang, H. X., Li, X. L., Wang, Y., Zhang, B. M., Bu, H., Wang, Z. B., Meng, Y. H., Wang, Y. H., & Wang, Q. H. (2018). Proteomics and its application to determine mechanism of action of traditional Chinese medicine. Zhong- guo Zhong Yao Za Zhi = Zhongguo Zhongyao Zazhi = China Journal of Chi- nese Materia Medica, 43, 904–912.

Gu, Q. H., Yu, D., Hu, Z., Liu, X., Yang, Y., Luo, Y., Zhu, J., & Li, Z. (2015). miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Nature Communication, 6, 6789. https://doi.org/10.1038/ ncomms7789

Xu, C., Niu, J. J., Zhou, J. F., & Wei, Y. S. (2019). MicroRNA-96 is respon- sible for sevoflurane-induced cognitive dysfunction in neonatal rats via inhibiting IGF1R. Brain Research Bulletin, 144, 140–148. https://doi.org/ 10.1016/j.brainresbull.2018.09.001

Guo, S., Liu, L., Wang, C., Jiang, Q., Dong, Y., & Tian, Y. (2018). Repeated expo- sure to sevoflurane impairs the learning and memory of older male rats. Life Sciences, 192, 75–83. https://doi.org/10.1016/j.lfs.2017.11.025 He, H., Liu, W., Zhou, Y., Liu, Y., Weng, P., Li, Y., & Fu, H. (2018). Sevoflurane post-conditioning attenuates traumatic brain injury-induced neuronal apoptosis by promoting autophagy via the PI3K/AKT signaling pathway. Drug Design, Development and Therapy, 12, 629–638. https://doi.org/10. 2147/DDDT.S158313

Xu, H., Zhang, J., Zhou, W., Feng, Y., Teng, S., & Song, X. (2015). The role of miR-124 in modulating hippocampal neurotoxicity induced by ketamine anesthesia. International Journal of Neuroscience, 125, 213–220. https:// doi.org/10.3109/00207454.2014.919915

Xu, Q., Ou, J., Zhang, Q., Tang, R., Wang, J., Hong, Q., Guo, X., Tong, M., Yang, L., & Chi, X., (2019). Effects of aberrant miR-384-5p expression on learn- ing and memory in a rat model of attention deficit hyperactivity disor- der. Frontiers in Neurology, 10, 1414. https://doi.org/10.3389/fneur.2019. 01414

He, X., Zhang, Q., Liu, Y., & Pan, X. (2007). Cloning and identification of novel microRNAs from rat hippocampus. Acta Biochimica et Biophys- ica Sinica (Shanghai), 39, 708–714. https://doi.org/10.1111/j.1745-7270. 2007.00324.x

Yi, W., Zhang, Y., Guo, Y., Li, D., & Li, X. (2015). Elevation of Sestrin-2 expres- sion attenuates sevoflurane induced neurotoxicity. Metabolic Brain Dis- ease, 30, 1161–1166. https://doi.org/10.1007/s11011-015-9673-1 Young, C., Jevtovic-Todorovic, V., Qin, Y. Q., Tenkova, T., Wang, H., Labruyere, J., & Olney, J. W. (2005). Potential of ketamine and midazolam, individ- ually or in combination, to induce apoptotic neurodegeneration in the infant mouse brain. British Journal of Pharmacology, 146, 189–197. https: //doi.org/10.1038/sj.bjp.0706301

Jiang, M., Yun, Q., Shi, F., Niu, G., Gao, Y., Xie, S., & Yu, S. (2016). Down- regulation of miR-384-5p attenuates rotenone-induced neurotoxicity in dopaminergic SH-SY5Y cells through inhibiting endoplasmic reticulum stress. American Journal of Physiology. Cell Physiology, 310, C755–C763. https://doi.org/10.1152/ajpcell.00226.2015

Kostich, W., Hamman, B. D., Li, Y. W., Naidu, S., Dandapani, K., Feng, J., Easton, A., Bourin, C., Baker, K., Allen, J., Savelieva, K., Louis, J. V., Dokania, M., Elavazhagan, S., Vattikundala, P., Sharma, V., Das, M. L., Shankar, G., Kumar, A., . . . Albright, C. F. (2016). Inhibition of AAK1 kinase as a novel therapeutic approach to treat neuropathic pain. Journal of Pharmacology and Experimental Therapeutics, 358, 371–386. https://doi. org/10.1124/jpet.116.235333

Yu, Z. Y., Geng, J., Li, Z. Q., Sun, Y. B., Wang, S. L., Masters, J., Wang, D. X., Guo, X. Y., Li, M., & Ma, D. (2019). Dexmedetomidine enhances ropivacaine- induced sciatic nerve injury in diabetic rats. British Journal of Anaesthesia, 122, 141–149. https://doi.org/10.1016/j.bja.2018.08.022

21579032, 2022, 7, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/brb3.2556 by Johns Hopkins University, Wiley Online Library on [20/11/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

CHEN ET AL.

11 of 11

Zhang, X., Xue, Z., & Sun, A. (2008). Subclinical concentration of sevoflu- rane potentiates neuronal apoptosis in the developing C57BL/6 mouse brain. Neuroscience Letters, 447, 109–114. https://doi.org/10.1016/j. neulet.2008.09.083

sevoflurane-induced apoptosis in the developing rat brain potentially via the mitochondrial pathway. Molecular Medicine Reports, 15, 2204–2212. https://doi.org/10.3892/mmr.2017.6268

Zhang, X., Zhou, Y., Xu, M., & Chen, G. (2016). Autophagy is involved in the sevoflurane anesthesia-induced cognitive dysfunction of aged rats. Plos One, 11, e0153505. https://doi.org/10.1371/journal.pone.0153505 Zhao, X., Sun, Y., Ding, Y., Zhang, J., & Li, K. (2018). miR-34a inhibitor may effectively protect against sevoflurane-induced hippocampal apopto- sis through the Wnt/beta-catenin pathway by targeting Wnt1. Yonsei Medical Journal, 59, 1205–1213. https://doi.org/10.3349/ymj.2018.59. 10.1205

How to cite this article: Chen, Y., Gao, X., & Pei, H. (2022).

miRNA-384-3p alleviates sevoflurane-induced nerve injury by

inhibiting Aak1 kinase in neonatal rats. Brain and Behavior, 12,

e2556. https://doi.org/10.1002/brb3.2556

Zhou, X., Xian, D., Xia, J., Tang, Y., Li, W., Chen, X., Zhou, Z., Lu, D., & Feng, X. (2017). MicroRNA-34c is regulated by p53 and is involved in