DOI,Citation ID,First author,Year,animal type,exposure age,behavior test: Y/N,intervention1,intervention2 （anesthetics only),genetic chain,content,Question 1,Question 1_original_sentences,Question 2,Question 2_original_sentences,Question 3,Question 3_original_sentences,intervention_1,Question 4intervention_1_original_sentences,intervention_2,Question 4intervention_2_original_sentences,Question 5,Question 5_original_sentences,correct_1,correct_2,correct_3,correct_4,correct_5,correct_6,fn 10.1097/ALN.0b013e318289bc9b,905.0,Boscolo,2013,rats,postnatal day 7,N,nitrous oxide,isoflurane,sprague dawley,"PMID: 23411726 PMCID: PMC3879793 DOI: 10.1097/ALN.0b013e318289bc9b Materials and Methods Animals Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments. This postnatal day is when rat pups are most vulnerable to anesthesia-induced neuronal damage.4 Our routine anesthesia protocol was used as previously described.10 Briefly, experimental rat pups were exposed to 6 h of anesthesia and controls were exposed to 6 h of mock anesthesia (vehicle + air). After the administration of anesthesia, rats were randomly divided into three groups: one group for ultrastructural analysis of the subiculum using electron microscopy, one group for assessing expression of several proteins using the Western blotting technique, and one group for functional studies of superoxide dismutase (SOD) and catalase activity using ELISA. Rat pups assigned for histological studies were reunited with their mothers and killed 24 h postanesthesia (at P8). Rat pups assigned for Western blot and ELISA studies were killed immediately postanesthesia (at P7). The experiments were approved by the Animal Use and Care Committee of the University of Virginia Health System, Charlottesville, Virginia, and were performed in accordance with the Public Health Service’s Policy on Human Care and Use of Laboratory Animals. Efforts were made to minimize the number of animals used. Anesthesia We used our routine anesthesia protocol as previously described.10,16 Briefly, nitrous oxide and oxygen were delivered using a calibrated flowmeter. Isoflurane was administered using an agent-specific vaporizer that delivers a set percentage of anesthetic into the anesthesia chamber. Midazolam (Sigma–Aldrich Chemical, St. Louis, MO) was dissolved in 0.1% dimethyl sulfoxide just before administration. For control animals, 0.1% dimethyl sulfoxide was used alone. To administer a specific concentration of nitrous oxide/oxygen and isoflurane in a highly controlled environment, an anesthesia chamber was used. Rats were kept normothermic and normoxic while glucose homeostasis was maintained within normal limits throughout the experiment, as previously described.17,18 For control experiments, air was substituted for the gas mixture. After initial equilibration of the nitrous oxide/oxygen/isoflurane or air atmosphere inside the chamber, the composition of the chamber gas was analyzed by infrared analyzer (Datex Ohmeda, Madison, WI) to establish the concentrations of nitrous oxide, isoflurane, carbon dioxide, and oxygen. P7 rat pups received a single injection of midazolam (9 mg/kg, intraperitoneally) followed by 6 h of nitrous oxide (75%), isoflurane (0.75%), and oxygen (approximately 24%). Thus, the measured fraction of inspired oxygen in both control and experimental conditions was 0.21–0.24. Several studies have shown that this protocol causes significant developmental neuroapoptosis.1,4,10,16,19 Histopathologic Studies On P8, each pup was deeply anesthetized with phenobarbital (65 mg/kg, intraperitoneally) (University of Virginia Pharmacy, Charlottesville, Virginia). Perfusion and fixation of brain tissue were performed as previously described.10,16 Briefly, the left ventricle was cannulated, the descending aorta was clamped, and an initial flush was carried out with Tyrodes solution (30–40 ml) (Sigma–Aldrich Chemical). For morphometric analyses of pyramidal neurons, we perfused with paraformaldehyde (2%) and glutaraldehyde (2%). After the perfusion, we removed the rats’ brains and stored them in the same fixative overnight. Both control and experimental pups were perfused by an experienced experimenter on the same day, using the same solution to assure uniform tissue fixation. Any brain considered to have been inadequately perfused was not processed for electron microscopy analysis. Our routine electron microscopy protocol has been described elsewhere.6,10 Briefly, fixed brains were coronally sectioned (50–75 μm thick) with a DTK-1000 microslicer (Ted Pella, Tools for Science and Industry, Redding, CA). The subiculum was localized as described in anatomical maps,20 fixed in 2% osmium tetroxide (Electron Microscopy Sciences, Hatfield, PA), stained with 4% uranyl acetate (Electron Microscopy Sciences), and embedded in aclar sheets using epon–araldite resins. The subiculum was then dissected from the aclar sheets and embedded in BEEM capsules (Electron Microscopy Sciences). To prepare capsules for microtome cutting (Sorvall MT-2 microtome, Ivan Sorvall, Norwalk, CT), the tips were manually trimmed so that ultrathin slices (silver interference color, 600–900 Å) could be cut using a diamond knife (Diatome, Hatfield, PA). Ultrathin sections were placed on grids and examined using a 1230 TEM electron microscope (Carl Zeiss, Oberkochen, Germany). Morphometric Analyses Our protocol for morphometric analyses of mitochondria was previously described.10 Briefly, as the cytoplasmic soma of pyramidal neurons cannot be captured in their entirety with a single photo frame at such high magnification (×6,000–×12,000), we took multiple sequential pictures using a 16-megapixel digital camera (SIA-12C digital cameras, Scientific Instruments and Applications, Duluth, GA), then tiled them seamlessly together to make a mosaic of one whole cell body. We analyzed 5 neurons from each animal (n = 4 pups/group) for a total of 20 neurons in the control group and anesthesia-treated group each. For statistical analysis, we used n = 4 pups/group after we obtained the average from five neurons in each pup. From these mosaic pictures, the cytoplasmic and mitochondrial areas were measured using Image-Pro Plus 6.1 computer software (MediaCybernetics, Bethesda, MD). The number of animals necessary for these complex and time-consuming ultrastructural histological studies was determined based on our previously published studies (n = 4 pups in each group from four different litters. Equal numbers of male and female pups were used for each experimental condition. Control and experimental pups were equally represented from each litter).6,10 The investigator analyzing electron micrographs was blinded to the experimental conditions. Catalase and SOD Activity Assays Control and experimental groups of rats were killed immediately postanesthesia, and the subicular and thalamic brain tissues were removed quickly. The tissues were homogenized in 20 mm HEPES buffer at pH 7.2, containing 1 mm EDTA, mannitol, and sucrose per gram of brain tissue (for SOD) or cold phosphate-buffered saline (for catalase) with 1mm EDTA. Upon centrifugation at 1,500g, followed by centrifugation at 10,000g at 4°C, the supernatants were collected and the assays were carried out at 25°C. SOD activity was assayed using a commercially available kit (Superoxide Dismutase Assay kit, Cayman Chemical, Ann Arbor, MI) that can detect the activity of all three forms of SOD—Cu/Zn-, Mn-, and Fe-SOD—as absorbance at 440–460 nm. Catalase activity was assayed using a commercially available kit (OxiSelect Catalase Activity Assay kit, Cell Biolabs Inc., San Diego, CA) with absorbance detected at 520 nm. The assays were performed following the manufacturer’s instructions using a microplate reader (VersaMax, Molecular Devices, Chicago, IL). Total protein was measured for each sample on the day of the assay using a commercially available protein determination kit (Bradford method) (Cayman Chemical, Ann Arbor, MI). The activities of SOD and catalase were expressed in arbitrary units per milligram protein. The group sizes for each experimental condition are indicated in the figure legends. Subcellular Fractionation Mainly subicular tissues (with some thalamic contamination) were collected immediately postanesthesia. Briefly, the tissues were cut in small pieces and gently homogenized in ice-chilled Dounce homogenizers (20 strokes) using isotonic extraction buffer A from a Mitochondrial Isolation Kit (Sigma-Aldrich Co.) with protease inhibitor cocktail (Roche, Indianapollis, IN). The homogenates were centrifuged at 1,000g for 5 min to remove unbroken cells and nuclei. Supernatants were transferred into new tubes and centrifuged at low speed (3,500g for 10 min) to yield mitochondria-enriched fractions without lysosome and peroxisome contamination. Supernatants were removed and centrifuged at 70,000g to obtain pure cytosol fractions, and the mitochondria-enriched pellets were carefully resuspended and washed again in 1× extraction buffer A. The mitochondrial fractions then were re-pelleted by centrifugation at 1,000 and 3,500g for 5 and 10 min, respectively. Proteins from the mitochondria-enriched pellets were extracted by vortexing for 1 min in lysis buffer containing 20 mm Tris-HCl at pH 8.0, 137 mm NaCl, 10% glycerol, 1% nonidet P-40, and 2 mm EDTA. Following centrifugation at 13,000g, the supernatants were removed and protein concentration in the pellets was determined using the bicinchoninic acid micro-protein assay (Micro BCA protein assay kit, Pierce Inc., Rockford, IL). Subcelullar fractionation was performed at 4°C. The pellets are considered to contain the “heavy” mitochondrial fraction—enriched with mitochondria with substantially diminished presence of lysosomes and peroxisomes, which are common contaminants of this fraction. Western Blotting The protein concentration of the lysates was determined with the Total Protein kit (Sigma–Aldrich Chemical Co.). For separation of Mfn-2 and Drp-1 monomers, protein samples (30 μg per lane) were heat-denaturized in 2× Laemmli sample buffer, electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel, and transferred to a nitrocellulose membrane (Hybond ECL, Amersham International, Buckinghamshire, United Kingdom). To investigate Drp-1 oligomerization, the boiling step was omitted and 60 μg of samples were subjected to nonreducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (without β-merkaptoethanol or dithlothreltol in 2× loading buffer) on 8% acrylamide gel21 and transferred to a polyvinylidene difluoride membrane (Millipore, Danvers, MA). The membranes subsequently were incubated and probed with the anti-Drp-1 primary antibody or anti-Mfn 2 antibody at a dilution of 1:1000 each (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in Tris-buffered saline–Tween overnight, followed by the incubation with the appropriate secondary antibodies conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Inc.). Immunoreactive bands were visualized using enhanced chemiluminescence (Pierce, Inc.). β-ACTIN (1:10,000, Sigma-Aldrich) and porin (1:2500, Invitrogen, Eugene, OR) were used as loading controls for cytosolic and mitochondrial fraction, respectively. The molecular size of the proteins of interest was determined by comparison to pre-stained protein markers (BioRad, Hercules, CA). All gels were densitometrically analyzed in GBOX-chemi (Syngene, Frederick, MD) using the computerized image analysis program ImageQuant 5.0 (GE Heathcare, Life Sciences, Piscataway, NJ). Data were analyzed first as a ratio between the protein of interest and β-actin (or porin) and expressed as a percent change from a control density. The group sizes for each experimental condition are indicated in the figure Legends. Spectrophotometric Detection of ROS Control and experimental groups of rats were killed immediately postanesthesia, and the subicular and thalamic brain tissues were quickly removed. ROS were measured as hydrogen peroxide using the horseradish peroxidase-linked spectrophotometric assay kit according to the manufacturer’s instructions (Amplex Red, Invitrogen). Briefly, extracted brain mitochondria samples (120 μg) were added to a 96-well plate containing 100 μl of reaction buffer consisting of 0.1 U/ml of the horseradish peroxidase, 50 μm Amplex UltraRed, and 1 μl of dimethyl sulfoxide. Reactions were incubated at room temperature for 30 min and protected from light. Resorufin absorptions were followed at 560 nm using a VersaMax tunable microplate reader (Molecular Devices, Chicago, IL). Hydrogen peroxide levels are expressed in arbitrary units (per milligram protein). The group sizes for each experimental condition are indicated in the figure legends. Statistical Analysis Single comparisons among groups were made using an unpaired two-tailed t test. When ANOVA with repeated measures was needed, the Bonferroni correction was used to help maintain prescribed alpha levels (e.g., 0.05). Histograms in cumulative frequency analysis were compared with chi-square-test. Using the standard version of GraphPad Prism 5.01 software (Media Cybernetics, Inc., Bethesda, MD), we considered P < 0.05 to be statistically significant. All the data are presented as mean + SEM. No experimental data were missing or lost to statistical analysis.",rats,"['Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments.']",postnatal day 7,"['Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,['Isoflurane was administered using an agent-specific vaporizer that delivers a set percentage of anesthetic into the anesthesia chamber.'],midazolam,"['Midazolam (Sigma–Aldrich Chemical, St. Louis, MO) was dissolved in 0.1% dimethyl sulfoxide just before administration.']",sprague dawley,"['Sprague–Dawley rat pups (Harlan Laboratories, Indianapolis, IN) at P7 were used for all experiments.']",True,True,True,False,False,True,[ Passage 1/25 ] 10.1097/ALN.0b013e318289bc9b 10.1016/S1995-7645(14)60066-3,408.0,Cao,2014,rats,postnatal day 7,Y,ketamine,propofol,sprague dawley,"PMID: 25063071 DOI: 10.1016/S1995-7645(14)60066-3 2. Materials and methods 2.1. Animals A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected. All animals were provided by XX University Experimental Animal Center, and were kept in a constant temperature 25 ℃, constant humidity 40% -50% environment, and had freely drank autoclaved water. 2.2. Main reagents and instruments Optical microscope was purchased from Japanese Nikon company,German Leica Microtome was purchased from Dalian Dajian Medical Devices Co., Ltd., Micro pipette and homogenizer were purchased from the German Eppendorf Company, -80 ℃ refrigerator were purchased from China Haier Company. TUNEL assay kit was purchased from Roche Company, IL-4, IL-1毬 and IgE radioimmunoassay kit were purchased from Wuhan Boster Biological Engineering Co., Ltd., Ketamine (100 mg/10 mL) were purchased from Jiangsu Hengrui Limited Company, propofol injection (200 mg/20 mL) were purchased from Sichuan Shule Pharmaceutical Corporation. Experimental animal cages, precision electronic balance, 0.9% saline solution, hematoxylin, eosin staining solution were provided by the laboratory. 2.3. Experimental methods 2.3.1. Experimental animal model and grouping methods A total of 80 young rats were randomly divided into four groups (the control group, experimental group A, experimental group B, experimental group C) (n=20). All young rats received the adaptive breeding for 1 week in animal room. The animals in the control group received 0.9% saline l mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group A received 80 mg/kg ketamine l mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group B received 80 mg/kg propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times. The animals in experiment group C received 80 mg/kg ketamine and propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times. The injection volume was 1 mL, and if it was less than l mL it was supplemented by saline. Half of rats in each group were randomly sacrificed after 15 min of anesthesia, the other half underwent Morris water maze test 3 weeks later. All died or abandoned animals in midway were supplemented by modeling again. 2.3.2. Immune parameters detection Using heparinization disposable 5 mL sterile syringe, 2 mL blood was obtained by percutaneous puncture at the point of maximal impulse and then it was injected into sterile EP tube. After 30 min at 4 ℃, it was centrifuged at 3 000 r/min at low temperature for 10 min. Serum was separated and stored at -80 ℃ for the test. Serum IL-2, IL-4 and IL-10 levels were detected by ELISA. 2.3.3. Brain tissue specimen collection, preparation and indicators test After blood collection, half of the young rats were randomly perfusion needle was inserted to the ascending aorta from the left ventricle, and fixed. The right auricle was cut. It was washed at 4 ℃ saline by perfusion needle until the effluent of the right atrium was clear. Then it was fixed by 4% paraformaldehyde phosphate buffer. Hippocampal was isolated from the brain tissue when the body tissues and organs were hard, they were paraffin-embedded and cut. Neuronal apoptosis detection was performed by terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) method. TUNEL-positive cells showed brown particles in the nucleus. Six horizons were randomly selected and average optical density was measured. Positive intensity and the apoptotic index were calculated. The formula was as follow: apoptotic index (AI) = MOD × Area% × 100, MOD represents the average gray level; area% represents the percentage of the total positive nucleus area in the total nucleus area. The other half young rats cerebral was obtained quickly by sterile opening cranium, and brain tissue was mixed with ice normal saline by homogenizer. 10% brain homogenate was prepared at 4 ℃, and centrifuged at 3 000 r/min for 15 min. The supernatant was stored at -80 ℃ for test. Whole brain IL-1毬 levels were detected by ELISA. 2.3.4. Morris water maze test Behavior of rats was observed by Morris water maze[3]. Round tank has four quadrants. A black platform was fixed at the fourth quadrant, located 1 cm underwater. The rats were put into the water of a randomly select quadrant, swim tracks of the rats were recorded with a camera. How long rats find the platform is the latency. After this test, the platform was removed and the rats were put into water from the same water-entering point, the times of crossing the former platform were measured. 2.4. Statistical analysis Data were expressed as mean依SD values and analyzed with SPSS 13.0 software. After the variance test, the difference between two groups was compared with single factor analysis of variance. P<0.05 was considered as statistical significant difference. ",rats,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",postnatal day 7,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",Y,['Behavior of rats was observed by Morris water maze[3].'],ketamine,"['The animals in experiment group A received 80 mg/kg ketamine l mL by intraperitoneal injection every 2 h, continuous for 3 times.']",propofol,"['The animals in experiment group B received 80 mg/kg propofol 1 mL by intraperitoneal injection every 2 h, continuous for 3 times.']",sprague dawley,"['A total of 80 healthy 7-day-old SD rats, male or female, weighing 12-18 g were selected.']",True,True,True,True,True,True,[ Passage 2/25 ] 10.1016/S1995-7645(14)60066-3 10.1016/j.bbrc.2021.03.063,234.0,Chen,2021,mice,gestational day 14,Y,sevoflurane,none,c57bl/6,"PMID: 33756347 DOI: 10.1016/j.bbrc.2021.03.063 2. Methods and materials 2.1. Animals This study was approved by the Institutional Animal Care and Use Committee of Soochow University. Adult C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Suzhou, China). One male and four female mice were housed per cage for breeding the offspring mice. Six pregnant mice on gestational day 14 were randomly assigned to receive either 2.5% sevoflurane in 100% oxygen or just 100% oxygen as the control. Their offspring mice were correspondingly assigned as the testing mice. Several pregnant mice without any treatment were chosen to produce the offspring mice as the stranger mice. The pups were fostered by their own dams till weaning on postnatal day 21. All mice were raised in a controlled condition (21–22 °C, 12 h light/dark cycle, light on at 7 a.m.), with access to standard mouse chow and water ad libitum. 2.2. Maternal anesthesia A clinically-retired anesthesia machine was used to supply one-way gas flow. A transparent plastic box (20 L × 20 W × 6 H cm) was used as the anesthetizing chamber, with three holes for gas inflow, gas outflow, and gas monitoring. A heating-pad was placed underneath the anesthetizing chamber to keep mice warm during anesthesia. Sevoflurane anesthesia on pregnant mice in this study was strictly performed by the protocols of previous study [10], in which arterial blood pressure and blood gas analysis were demonstrated within normal limits. The pregnant mice retained spontaneous respiration during inhalational anesthesia. Sevoflurane was washed out with pure oxygen for 15 min, and the pregnant mice with right reflex were put back to home cages. 2.3. Social apparatus The three-chambered social box (40L × 60W × 22H cm) with two enclosures (7D × 15H cm) was used for social interaction test (Fig. 1A–C). An improved video-tracking system programed by ANY-maze (Stoelting Co., USA) was used to capture the movement of mouse. Given the testing mouse initiates social approaching to the stranger mouse by nose-to-nose or nose-to-tail sniffing (Fig. 1D), the animal’s head was tracked by the video-tracking system. Four behavioral parameters was automatically measured by ANY-maze program, including the time sniffing at the enclosure and number of sniffs at the enclosure, the time exploring in the side-chamber and number of entries into side chamber. Specifically, “at the enclosure” is defined as the mouse head entering an area of 3 cm around the enclosure. 2.4. Social interaction test The offspring mice (N = 17 Control, 9 males and 8 females; N = 14 Sevoflurane, 9 males and 5 females) were tested at one- and two-month-old (i.e., the juvenile and early-adult age). In advance, the testing mouse was housed single for 1-h isolation in the behavioral room. The stranger mice were the identical background, same gender and similar age as the testing mouse, and they had exactly no contact before. Social interaction test is composed of three 10-min sessions of habituation, sociability, and preference for social novelty. Firstly, the testing mouse was allowed to freely explore in social box with two doorways opening. Next, an unfamiliar conspecific (Stranger 1) was introduced into one enclosure, and the testing mouse was allowed to sniff the stranger 1 or explore the empty enclosure (Fig. 1E, G). After that, another unfamiliar conspecific (Stranger 2) was introduced into the other enclosure, and the testing mouse was allowed to sniff the stranger 1 and stranger 2 (Fig. 1F, H). Placement of the stranger 1 on the left or right side was systematically altered between trials, and social apparatus was cleaned after each trial to minimize olfactory disturbance. 2.5. Statistical analysis Data were shown as Mean ± SD. Graphpad Prism 5.0 software (San Diego, USA) was used for statistical analyses. Social data obtained from the left and right side were mutually exclusive in each 10-min session and they were normally distributed by Kolmogorov-Smirnov tests. Therefore, two-tailed paired t-test was used to compare the side preferences (stranger 1 vs. the opposite). Two-way repeated measures (RM) ANOVAs were used to analyze the interaction effects of treatment (control or sevoflurane) × side (stranger 1 or the opposite). Based on the preliminary study, a sample size of more than 5 (sociability) and 13 (preference for social novelty) could lead to a 90% power to detect a difference in side preference with 5% type I error. P values less than 0.05 (∗), 0.01 (∗∗) and 0.001 (∗∗∗) were considered statistically significant.",mice,"['Adult C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Suzhou, China).']",gestational day 14,['Six pregnant mice on gestational day 14 were randomly assigned to receive either 2.5% sevoflurane in 100% oxygen or just 100% oxygen as the control.'],Y,['The three-chambered social box (40L × 60W × 22H cm) with two enclosures (7D × 15H cm) was used for social interaction test (Fig. 1A–C).'],sevoflurane,['Six pregnant mice on gestational day 14 were randomly assigned to receive either 2.5% sevoflurane in 100% oxygen or just 100% oxygen as the control.'],none,[],c57bl/6,"['Adult C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Suzhou, China).']",True,True,True,True,True,True,[ Passage 3/25 ] 10.1016/j.bbrc.2021.03.063 10.1002/brb3.2556,878.0,Chen,2022,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"PMID: 35726359 PMCID: PMC9304839 DOI: 10.1002/brb3.2556 2 MATERIALS AND METHODS Animals and treatment Seven-day-old Sprague–Dawley rats were used in this study. They were obtained from the GemPharmatech Company (Nanjing, China). All rats were kept on a 12-h light–dark cycle in individually ventilated cages at 21 ± 1°C with free access to food and water. All animal experiments were approved by the Institutional Animal Care and Use Committees and performed according to the institution's guidelines and animal research principles. The rats were randomly divided into three groups: control, sevoflurane, and miRNA-384-3p agomir injection. Each group consisted of 12 rats. Sevoflurane was used to anesthetize rats as previously described (Zhou et al., 2017). Briefly, rats were exposed to 2.3% sevoflurane for 2 h every day for 3 continuous days. The gas flow was 2 L/min, and the concentration of sevoflurane was measured by a gas monitor (Detex Ohmeda, CO, USA). The NPS-A3 heating device (Midea Group, Beijiao, China) was used to heat the chamber up to 38°C. Rats in the sevoflurane group were injected with 2 nmol agomir NC (volume is 2 μl) into the hippocampus on the left lateral cerebral ventricles after the first day of exposure to sevoflurane. The miRNA-384-3p agomir was purchased from RiboBio (Guangzhou, China) and diluted with Entranster transfection reagent (Engreen Biosystem Co., Beijing, China). Then, bilateral intrahippocampal administration was performed by injection with 2 nmol miRNA-384-3p agomir (volume is 2 μl) into the hippocampus using a stereotaxic apparatus (RWD Life Science, Shenzhen, China) and a 33-gauge beveled NanoFil needle. On the first day of exposure to sevoflurane, the cells were exposed to sevoflurane for 2 days. Control group rats were exposed to air for 2 h/day and over 3 consecutive days. After being exposed to sevoflurane for 3 days, the rats were euthanized, and the hippocampus was collected for further experiments. Cell isolation and culture The hippocampus was dissected from neonatal rats (7 days old), triturated, and dissociated through trypsin. The dissociated cells were filtered and centrifuged and then resuspended in Dulbecco's Modified Eagle Medium/F12 medium (DMEM/F12, Thermo-Scientific, MA, USA). Then, the cells were seeded onto dishes coated with poly-D-lysine and cultured with DMEM/F12 supplemented with 10% fetal bovine serum (FBS, Thermo Scientific, MA, USA), 1% glutamine, 4.5 g/L B27 plus glucose, and 1% penicillin–streptomycin (Sigma–Aldrich, MI, USA). After culturing for 3 days, 5 μg/ml cytosine arabinoside C (Sigma–Aldrich, MI, USA) was added to the medium and cultured for 24 h. The neurons were cultured in a humidified incubator at 37°C and 5% CO2 for 14 days. Cell treatment and transfection Neurons were cultured in a humidified incubator chamber with a gas mixture of 1% sevoflurane, 94% air and 5% CO2 for 6 h. Sevoflurane was delivered to the chamber at a rate of 10 L/min through a vaporizer (Datex-Ohmeda, Helsinki, Finland). Control neurons were cultured in a humidified incubator with 95% air and 5% CO2. Hippocampal neurons, including control and sevoflurane-exposed neurons, were seeded into 24-well plates at 104 cells/well. When the confluence of the cells reached 60%, Lipofectamine 3000 (Thermo Scientific, MA, USA) was used for transfection. miRNA-384-3p mimics, NC mimics, pcDNA-Aak1 vector (pc-Aak1), and pcDNA control vector (pc-NC) were obtained from GeneChem (Shanghai, China). miRNA-384-3p mimics and NC mimics were transfected into control neurons. NC mimics and pc-NC were transfected into control neurons simultaneously. NC mimics and pc-NC, miRNA-384-3p mimics and pc-NC, and miRNA-384-3p mimics and pc-Aak1 were transfected into sevoflurane-exposed neurons simultaneously. The transfection concentration was 10 nM. After transfection for 48 h, the cells were collected for further experiments. Real-time quantitative polymerase chain reaction Total RNA was isolated from hippocampal tissue or transfected neurons by using TRIzol reagent (Thermo-Scientific, MA, USA). RNA was reverse transcribed into cDNA by using the PrimeScript RT reagent kit (Takara, Japan). A SYBR green PCR kit (Vazyme, Nanjing, China) was used to perform real-time quantitative polymerase chain reaction (RT–qPCR). U6 and GAPDH were used to normalize the relative expression of miRNA-384-3p and Aak1. The miRNA-384-3p forward primer sequence (5′−3′) was AATTCCTAGAAATTGTT, and the reverse primer sequence (5′−3′) was AGTGCAGGGTCCGAGGTATT. The U6 forward primer sequence (5′−3′) was CTCGCTTCGGCAGCACATATACT, and the reverse primer sequence (5′−3′) was ACGCTTCACGAATTTGCGTGTC. The Aak1 forward primer sequence (5′−3′) was CGGGTCACTTCCGGGTTTA, and the reverse primer sequence (5′−3′) was TTCTTCTCCGGTTTCAGCCC. The GAPDH forward primer sequence (5′−3′) was GAACGGGAAGCTCACTGG, and the reverse primer sequence (5′−3′) was GCCTGCTTCACCACCTTCT. Subcellular fractionation After hippocampal microdissection, tissues were immediately treated with freshly prepared ice-cold homogenization buffer (20 mM HEPES, 2 mM EGTA, 0.3 mg/ml dithioerythritol, 0.16 mg/ml phenylmethylsulfonyl fluoride, and 0.020 mg/ml aprotinin) and homogenized. The homogenate was centrifuged at 17,000  ×  g for 5 min to obtain the cytoplasmic fraction. The pellet was washed with buffer B (150 mM NaCl; 10 mM HEPES; 1 mM EDTA), centrifuged at 17,000  ×  g for 1 min at 4 °C, resuspended in buffer C (25% v/v glycerol; 20 mM HEPES; 400 mM NaCl; 1.2 mM MgCl2; 0.2 mM EDTA), vortexed for 30 s and incubated on ice for 10 min (five times) to finally centrifuge at 17,000  ×  g for 20 min to obtain the nuclear fraction (Caviedes et al., 2021). RNA expression of GAPDH, U6, miRNA-384-3p, and Aak1 in the nuclear and cytoplasmic fractions was detected by RT–qPCR as mentioned above. Hematoxylin and eosin staining Rats were euthanized under the anesthesia of pentobarbital sodium (80 mg/kg), and then the hippocampal tissues were removed. Tissues were fixed with 4% paraformaldehyde for 24 h and paraffin embedded. Sections of 4 μM were cut, and staining was carried out according to the hematoxylin and eosin (HE) protocol. Neural injury scoring was performed according to the following standard: no nerve cell death, 0 points; scattered single nerve cell death, 1 point; slight nerve cell death, 2 points; mass nerve cell death, 3 points; and almost complete nerve cell death, 4 points. Nissl staining Paraffin sections of hippocampal tissues were deparaffinized and stained with cresyl violet solution for 45 min at 37°C. Next, sections were washed with distilled water and differentiated with gradient concentration ethanol. The differentiation was stopped when the tissue was clear by transferring the sections to distilled water. Then, the sections were dehydrated through a gradient concentration of ethanol and covered with neutral resin. Optical microscopy (Nikon, Tokyo, Japan) was used to observe the neurons in the hippocampal CA1 regions. The number of Nissl bodies was analyzed in a double-blinded manner with Image-Pro Plus 6.0. Cell apoptosis The cell apoptosis ratio was measured in transfected neurons and hippocampal tissues by using the In Situ Cell Death Detection kit (Roche, Basel, Switzerland). After staining, the positive neurons were randomly observed by a fluorescence microscope (Nikon, Tokyo, Japan) in five fields. The apoptosis ratio was measured by TUNEL-positive neurons/DAPI-positive neurons. Western blot analysis Protein was extracted from hippocampal tissue or transfected neurons using RIPA lysis buffer containing a protease inhibitor (Promega Corporation, WI, USA). The protein samples were fractionated by SDS–PAGE and transferred to a polyvinylidene difluoride membrane (PVDF, Millipore, MA, USA). Afterwards, the membranes were incubated with 5% nonfat milk for 2 h at room temperature. Then, the membranes were incubated with the primary antibody overnight at 4°C. Then, the membranes were incubated for 2 h with the secondary antibody at room temperature and visualized with a chemiluminescence kit (Vazyme, Nanjing, China). ImageJ software was used to analyze the protein expression. In this study, antibodies against Bax, Bcl-2, cleaved caspase-3, PCNA, and Aak1 were diluted to 1:1000 for use, cleaved caspase-9 was diluted to 1:200, and Ki-67 was diluted to 1:100. β-actin was used as the internal control, and the antibody was diluted to 1:5000. The goat anti-rabbit HRP antibody was used as a secondary antibody and diluted to 1:5000 for use. All antibodies were purchased from Abcam (London, England). Morris water maze test The Morris water maze (MWM) test was used to evaluate the learning and memory abilities of rats at the age of 2 months. The MWM consisted of a pool (100 cm × 100 cm × 60 cm) and a platform (1 cm × 1 cm). The pool was filled with warm water (25°C) to 1 cm. Rats were randomly placed in the pool and allowed to swim to the platform. The time that the rats spent swimming to a hidden platform was measured at 90 s, and the rats were allowed to rest on the platform for 20 s. The time was recorded as 90 s if the rats did not find the platform within 90 s, and the rats were also placed on the platform for 20 s to rest. In the acquisition phase, five training sessions were conducted every day for 5 continuous days. After the training, probe trials were performed. The time of plateau quadrant residence and the number of traversing platforms were recorded by computerized tracking/analyzing video systems to suggest the spatial memory and learning ability of the rats. Dual-luciferase reporter assay Aak1 wild type (Aak1 WT) containing the miRNA-384-3p binding sites in the 3′UTR of Aak1 was inserted into the firefly luciferase vector. To confirm specific binding, an Aak1 mutant (Aak1 Mut) containing the mutated binding sites of miRNA-384-3p in the Aak1 3′UTR was constructed. For the luciferase reporter assay, hippocampal neurons were cultured and plated in 24-well plates. Each well was transfected with 1 μg Aak1 WT vector or Aak1 Mut vector, 1 μg Renilla luciferase plasmid, and 100 pM miRNA-384-3p mimics or NC mimics by using Lipofectamine 3000 (Invitrogen, CA, USA). After 48 h of transfection, the dual-luciferase reporter assay system (Promega Corporation, WI, USA) was used to measure the firefly and Renilla luciferase activities. Cell viability assay Cell viability was detected by the cell counting kit-8 (CCK8) assay. Transfected hippocampal neurons were seeded onto 96-well plates at approximately 103 cells/well (100 μl/well). Then, the neurons were cultured for 1 h and mixed with 10 μl CCK8 reagent (Dojindo, Kumamoto, Japan) for 2 h. Next, the optical density was measured at 450 nm by utilizing a Bio-EL340 automatic microplate reader (Tek Instruments, Hopkinton, USA). Statistical analysis All data are presented as the mean ± standard deviation (SD) of three independent experiments. Unpaired Student's t test and one-way ANOVA were used to test the mean difference between groups. Statistical analysis was carried out using GraphPad Prism 7 (GraphPad Inc., San Diego, CA, USA). A p-value < .05 was considered statistically significant.",rats,['Seven-day-old Sprague–Dawley rats were used in this study.'],postnatal day 7,"['The hippocampus was dissected from neonatal rats (7 days old), triturated, and dissociated through trypsin.']",Y,['The Morris water maze (MWM) test was used to evaluate the learning and memory abilities of rats at the age of 2 months.'],sevoflurane,"['Sevoflurane was used to anesthetize rats as previously described (Zhou et al., 2017).']",none,[],sprague dawley,['Seven-day-old Sprague–Dawley rats were used in this study.'],True,True,True,True,True,True,[ Passage 4/25 ] 10.1002/brb3.2556 10.31083/j.jin2003065,1043.0,Gao,2021,rats,gestational day 14.5,N,sevoflurane,none,sprague dawley,"PMID: 34645094 DOI: 10.31083/j.jin2003065 2. Methods 2.1 Animals Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days. Then the female SD rats were mated with male SD rats with sexual experience at 7:00 PM after adaptive feeding. Vaginal smears were performed the next morning and pregnancy day 0, G0, was defined by sperm detection. The pregnant rats were randomly divided into two groups: a control group (control, n = 3) and a sevoflurane group (SeV, n = 3). The six female SD rats were raised to G14.5 (middle pregnancy). 2.2 Anesthesia On pregnancy day 14.5, the rats allocated to sevoflurane exposure were put inside a 30 cm × 20 cm × 120 cm box. A mixture of oxygen and sevoflurane (2 L/min with 4% sevoflurane) was delivered through an inlet port connected to a vaporizer, while a gas analyzer installed on a second port allowed monitoring of anesthetic gas concentration. Pregnant rats are more sensitive to sevoflurane and a minimum alveolar concentration (MAC) of 2.4% in healthy adult rats [27], so the concentration of sevoflurane (3%) is equivalent to 1.3 MAC to maintain a surgical level of anesthesia. The rats in the control group inhaled oxygen (2 L/min). However, limited to anesthesia machine conditions that it is not completely airtight, the inhalation concentration of sevoflurane should be 4% in order to reach 1.8 MAC to maintain a surgical level of anesthesia in the SeV group. The inhalation time is 3 hours in the SeV group. During the procedure, the skin color of the rats’ mouths, noses, limbs, and respiratory amplitudes and frequencies were observed to avoid hypoxia respiratory depression. After anesthesia, the rats were sent back to their cages after the righting reflex was recovered. After sevoflurane anesthetization, an arterial blood gas analysis was performed to assess gas exchange and glycemic status in female rats. The site of blood sampling was left heart artery. If there was a significant derangement, e.g., severe hypoxemia, these female rats were no longer involved in the follow-up experiments. No female rats were excluded in the study. Then the rat offspring were reared and delivered naturally. 2.3 Tissue section preparation Three offspring were randomly selected from each group with one offspring/dam. The ex vivo brain samples of the offspring rats were harvested at the day 30 of postpartum (P30) for histology, immunostaining and Golgi staining. Rats in both the control and SeV groups were executed and perfused through the left ventricle with precooling saline followed by 4% paraformaldehyde in 0.01 M phosphate buffered saline (PBS) pH 7.35. The brain tissue of the rats was taken and post-fixed for 24 hours for paraffin and frozen sections. To analyze the status of the NRG1–ErbB4 pathway in the interneurons, the expression levels of NRG1 and ErbB4 in LII and III of the ECT were examined via immunohistochemistry. The NRG1–ErbB4 pathway plays an important role in the genesis, migration, differentiation, maturation, and neurotransmitter synthesis of GABAergic interneurons. We assumed that the number of GABAergic interneurons the LII/LIII ECT of offspring in could be affected by alterations of the NRG1–ErbB4 pathway. Therefore, we label GABAergic interneurons with PV to represent PV interneurons. We also used glutamic acid decarboxylase 67 (GAD67) to label GABAergic interneuron (the key enzyme of GABA neurotransmitter synthesis) positive cells to represent the total GABAergic interneurons in the LII/LIII ECT. The expression levels of PV and GAD67 in LII and LIII of the ECT were examined via immunohistochemistry. That is, Interneurons were identified by immunoreactivity to PV and GAD67. To investigate whether NRG1–ErbB4 pathway changes in offspring after prenatal sevoflurane exposure affect the formation of subunits during maturation, we detected NMDA receptor subunit 2A (NR2A) and NMDA receptor subunit 2B (NR2B) by immunofluorescence. The expression levels of NR2A and NR2B in LII and LIII of the ECT were examined via immunohistochemistry to analyze the status of NMDA receptors in the ECT. There is a fixed pattern of neurite growth in the developing brain. We assumed that prenatal sevoflurane exposure could affect the inherent growth pattern of dendrites and dendritic spines in pyramidal neurons through NRG1–ErbB4 alterations. Therefore, we used Golgi silver staining to investigate the length of dendrites and the number of branches and dendritic spines. Golgi staining was performed to analyze the total dendrite length, number of dendritic branches, spatial distribution of dendrites, and density of dendritic spines in the pyramidal neurons in the ECT. 2.4 Histology and immunohistochemistry The coronal sections of the brain were deparaffinized, rehydrated, and immersed in 3% H 2 O 2 at room temperature for 30 min. Antigens were retrieved in a 0.01 mol/L citric buffer (pH 6.0) at 97 ∘ C for 15 min. The coronal sections were cooled down for 1 h before being blocked by 10% bovine serum albumin (BSA) solution. Staining with diluted primary antibodies was conducted at 4 ∘ C overnight (for at least 18 h). The primary antibodies included rabbit anti rat NRG-1 (1:1000, Cat. No Ab191139, Abcam, Cambridge, UK), rabbit anti rat ErbB4 (1:250, Cat. No Sc-283, Santa Cruz, Dallas, Texas, USA), rabbit anti rat NR2A (1:1000, Cat. No cell signaling technology, Massachusetts, USA), rabbit anti rat NR2B (1:1000, Cat. No 06-600, Millipore, Massachusetts, USA), mice anti rat PV (1:1000, Cat. No #2886709, Millipore), and rat anti rat GAD67 (1:2500, Cat. No. MAB5406, Millipore, Massachusetts, USA). After being washed by 0.1% PBST for three times (5 min), the sections were stained with diluted second antibodies at room temperature for 2 h and kept in a dark place. After washed by 0.1% PBST for three times (5 min), the sections were counterstained with hematoxylin, dehydrated with ethanol and mounted with coverslips. Then the expression levels of NRG1, ErbB4, PV, GAD67, NR2, A and NR2B were examined using a fluorescence microscope (Leica DM6000B, Germany). The results were shown as positive cells/sections. In each rat, we randomly select 5–6 coronal sections to count the cells to avoid error resulting from the section status. The brain area sections (ECT) we selected for immunohistochemical section is fixed. There is an inward concave angle under the area of the ECT, which is used to locate the central cortex and reduce the error. The size of the ECT in this part of the rat brain is relatively fixed, so the randomly selected sections can be regarded as roughly the same size which is comparable. 2.5 Golgi stain 150 μ m-thick frozen brain sections were obtained from control and SeV rats. Golgi–Cox staining was performed using the FD Rapid Golgi stain kit (Cat. NO. PK401, FD NeuroTechnologies, Inc. Columbia, USA) according to the manufacturer’s protocols. Ten well-individualized pyramidal neurons in LII and LIII of the ECT were randomly selected from each rat. Sequential optical sections of 1392 × 1040 pixels were taken at 1.5 μ m intervals along the z-axis (Leica, DMi8 + DFC7000J, Germany). The Imaris software (BitPlane AG, Zurich, Switzerland) was used for tridimensional reconstruction. The total dendrite length, number of dendritic branches, and spatial distribution of dendrites in the pyramidal neurons of the ECT were estimated using Sholl analysis [28]. To measure the density of dendritic spines, a straight dendrite was scanned on the z-axis using a 100 × objective microscope. A 40- μ m long dendrite was randomly intercepted with image J 1.46r (National institute of health, Bethesda, Maryland, USA). The number of synaptic spines was counted and the density of synaptic spines (spines/10 μ m) was calculated. At least 10 terminal dendrites were selected for each sample. 2.6 Statistical analysis All the data was expressed as mean ± standard deviation. JMP software version 16.0 (SAS Institute, Cary, NC, USA) was used for statistical processing. All parameters were tested for normal distribution using the Kolmogorov-Smirnov test. Two independent-sample t tests were conducted used to compare the parameters differences between the control and sevoflurane groups, including NRG1, ErbB4, PV, GAD67, NR2B and NR2A. Dendrites were analyzed with Kruskal-Wallis test (Sholl analysis) and Steel Dwass post hoc test using JMP software version 16.0 (SAS Institute, Cary, NC, USA) [28]. It was considered that a difference was statistically significant when P < 0.05. GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA) software was used to make drawings.",rats,"['Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days.']",gestational day 14.5,"['The six female SD rats were raised to G14.5 (middle pregnancy).', 'On pregnancy day 14.5, the rats allocated to sevoflurane exposure were put inside a 30 cm × 20 cm × 120 cm box.']",N,[],sevoflurane,['A mixture of oxygen and sevoflurane (2 L/min with 4% sevoflurane) was delivered through an inlet port connected to a vaporizer.'],none,[],sprague dawley,"['Six adult female Sprague-Dawley (SD) rats, weighing 180–220 g, were raised with free diet and water intake in polypropylene cages for 7 days.']",True,True,True,True,True,True,[ Passage 5/25 ] 10.31083/j.jin2003065 10.3892/mmr.2019.10397,1134.0,Guan,2019,rats,postnatal day 7,N,propofol,none,sprague dawley,"PMID: 31257533 PMCID: PMC6625379 DOI: 10.3892/mmr.2019.10397 Materials and methods Rat HPC model All animal procedures were conducted with the approval of the Animal Care and Use Committee of Guangxi Medical University (Nanning, China). Seven-day-old (P7) male Sprague-Dawley pups (average body weight, 10–15 g, n=70) were identified and numbered using picric acid, which were revealed to the investigator only after the completion of experiments and analyses. All pups were housed in a temperature-controlled room (22±1°C) with a 12-h light/dark schedule. H89 (Selleck Chemicals) and Sp-cAMP (Sigma-Aldrich; Merck KGaA) were prepared in 5 µl double-distilled water. The experimental set-up is illustrated in Fig. 2 (n=10) and the following experimental groupings were used: i) Normal saline group (NS group) received intraperitoneal injections of an equal volume of normal saline; ii) propofol group (P group) received intraperitoneal injections of 100 mg/kg propofol; iii) following the propofol treatment as in the P group, the propofol + Sp-cAMP group (P+Sp-cAMP group) received intracerebroventricular injections of 20 nmol/5 µl Sp-cAMP (a cAMP-dependent protein kinase agonist); iv) HPC+P group rats were placed in a chamber containing 8% oxygen and 92% nitrogen for 10 min, and the pups were subsequently exposed to room air for a further 10 min, and following five HPC cycles, the rats received an intraperitoneal injection of 100 mg/kg propofol; v) HPC+P +H89 group was exposed to 5 µmol/5 µl H89 [a protein kinase A (PKA) inhibitor] by intracerebroventricular injections, followed by the same protocol as in the HPC+P group; vi) the remaining pups in the two blank test groups received intracerebroventricular injections of dimethyl sulfoxide (D-ICV group) or normal saline (NS-ICV group). All pups were sacrificed according to standard protocols (100 mg/kg intraperitoneal sodium pentobarbital). Brain tissue slices were prepared for immunohistochemistry and the levels of PKA, CREB, phosopho (p)-CREB, B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax) and caspase-3 were evaluated by western blotting. Morphological and structural changes were evaluated by haematoxylin and eosin (H&E) staining and transmission electron microscopy. Intraventricular injections As aforementioned, rats were anesthetized with sodium pentobarbital and centralized coordinates of anterior fontanel (x=0, y=0, z=0) using stereotaxic apparatus (Ryward Life Technology Co., Ltd.), the sterile cannula was implanted at AP-2 mm (front and posterior), MLR-1.5 mm (left and right of the midline), and H-2 mm (depth from the left ventricle, x=−1.0 mm, y=2 mm, z=0). After positioning, the skull was drilled, and then Sp-cAMP (5 µl) or H89 (5 µl) was slowly injected at rate of 0.1 µl/min. The blank groups following the same protocol with an equal volume of DMSO or normal saline. ELISA The intracellular concentrations of adenylyl cyclase in the pups was determined by ELISA according to the instructions of the assay manufacturer (cat. no. S0026; Beyotime Institute of Biotechnology). Western blot analysis All pups were sacrificed to harvest the brain tissue. The protein was extracted by RIPA Lysis Buffer (Beijing Solarbio Science & Technology Co., Ltd.) and protein concentration measured using a bicinchoninic acid protein assay (Biotype Biotech Co.). The mass of protein loaded per lane was 20 µl. Equal amounts of proteins were loaded onto 12% SDS-polyacrylamide gels. Electrophoresed proteins were transferred to polyvinylidene difluoride membranes (0.22-µm pore size; EMD Millipore). The membranes were blocked using 5% bovine serum albumin (blocking buffer) for 2 h at room temperature and incubated with the following primary antibodies overnight at 4°C: β-tubulin (1:2,000; cat. no. 48885), caspase-3 (1:1,000; cat. no. 48658) and cleaved caspase-3 (1:1,000; cat. no. 29034; all from Signalway Antibody) Bcl-2 (1:1,000; cat no. ab196495; Abcam), Bax (cat. no. 27727) PKA (cat. no. 5842S), CREB (cat. no. 9197S) and p-CREB (cat. no. 9198S) (all 1:1,000; from Cell Signaling Technology, Inc.), and GAPDH (1:10,000; cat. no. 10494-1-AP; Proteintech, Inc.). The membranes were washed three times with Tris-buffered saline 1% Tween-20 (TBST; pH 7.4) and then incubated in horseradish peroxidase-conjugated secondary antibody (1:10,000; cat. no. 134658; LI-COR Biosciences) for 2 h at room temperature (23–25°C) and washed three times with TBST. The bands were developed using an Odyssey infrared imaging system (LI-COR Biosciences) and evaluated using densitometric analysis (ImageJ 1.52 h, National Institutes of Health). H&E and immunohistochemical staining Morphological and structural changes were observed by H&E staining. Tissues were fixed in 4% ice-cold paraformaldehyde at 4°C for 2 h and paraffin-embedded sections were obtained. The paraffin sections were dewaxed in xylene for 15 min and rehydrated using graded ethanol. The sections were immersed in haematoxylin for 30 sec and then subjected to antigen retrieval using 0.01 mol/l sodium citrate and incubated with 10% normal goat serum at room temperature for 30 min to block nonspecific binding, followed by incubation with the primary antibodies against PKA C and p-CREB (cat. nos. 5842S and 9198S, 1:1,000; Cell Signaling Technology, Inc.) at 4°C overnight. The sections were incubated with streptavidin-horseradish peroxidase at room temperature for 30 min and then stained with 0.05% 3,3-diaminobenzidine substrate, followed by counterstaining with 1% haematoxylin at 37°C for 30 sec. The sections were observed using a microscope (Olympus BX53; Olympus Corporation) and four fields of the hippocampus were randomly selected in every section which represented the areas of interest and the positive cells were counted using Image-Pro Plus version 6.0 software (Media Cybernetics Inc.). Electron microscopy The ultrastructures of neurocytes were observed by transmission electron microscopy (HITACHI H-7650; Hitachi, Ltd.). Briefly, 2.5% glutaraldehyde solution was perfused into the rats, and the tissues were fixed in 1% OsO4 at 4°C for 1 h, dehydrated in increasing concentrations of ethanol and embedded in Epon. Then, the samples were sectioned into semi-thin slices (1 µm) and stained with 1% uranyl acetate and 5% uranyl acetate at 37°C for 20 min. The ultrastructures of the entire mitochondria were measured by manually measuring length using Image Pro Plus (version 6.0.0.260, Media Cybernetics, Inc.). Statistical analysis Data are presented as the mean ± standard error, and were analysed using SPSS version 17.0 (SPSS, Inc.) and GraphPad Prism 5 software (GraphPad Software Inc.). Multiple comparisons were performed using one-way analysis of variance (ANOVA), followed by Dunnett's post hoc test, as appropriate. P<0.05 was considered to indicate a statistically significant difference.",rats,"['Seven-day-old (P7) male Sprague-Dawley pups (average body weight, 10–15 g, n=70) were identified and numbered using picric acid, which were revealed to the investigator only after the completion of experiments and analyses.']",postnatal day 7,"['Seven-day-old (P7) male Sprague-Dawley pups (average body weight, 10–15 g, n=70) were identified and numbered using picric acid, which were revealed to the investigator only after the completion of experiments and analyses.']",N,"['Brain tissue slices were prepared for immunohistochemistry and the levels of PKA, CREB, phosopho (p)-CREB, B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax) and caspase-3 were evaluated by western blotting.', 'Morphological and structural changes were evaluated by haematoxylin and eosin (H&E) staining and transmission electron microscopy.']",propofol,['ii) propofol group (P group) received intraperitoneal injections of 100 mg/kg propofol;'],none,[],sprague dawley,"['Seven-day-old (P7) male Sprague-Dawley pups (average body weight, 10–15 g, n=70) were identified and numbered using picric acid, which were revealed to the investigator only after the completion of experiments and analyses.']",True,True,True,True,True,True,[ Passage 6/25 ] 10.3892/mmr.2019.10397 10.3892/mmr.2014.2751,623.0,Han,2015,mice,postnatal day 7,N,sevoflurane,none,c57bl/6,"PMID: 25338822 DOI: 10.3892/mmr.2014.2751 Materials and methods Animals and sevoflurane exposure All animal experiments were performed using protocols approved by the institutional animal use and care committee of the Zhongshan Hospital, Fudan University (Shanghai, China). At postnatal day 7 (P7), male C57BL/6 mice (weight, 3–5 g; Shanghai Laboratory Animal Center, Shanghai, China) were randomly divided into a sevoflurane-treated group (n=6) and an air-treated control group (n=6) for analysis of the effects of sevoflurane on CREB phosphorylation, BDNF expression and MeCP2 phosphorylation levels. Mice were placed in a plastic container and continuously exposed to 1.5% sevoflurane (Maruishi Pharmaceutical Co., Osaka, Japan) in air, or to air alone for 2 h, with a gas flow of 2 l/min. For further experiments, male C57BL/6 mice at postnatal day 7 (P7) were randomly divided into four groups: The sevoflurane-saline group (sevo group, n=7); the air-saline group (control group, n=6); the sevoflurane-memantine group (sevo+mem group, n=7); and the air-memantine group (mem group, n=6). Mice received 1 mg/kg saline or memantine intraperitoneally prior to sevoflurane or air treatment. The mice were then placed in a plastic container and continuously exposed to 1.5% sevoflurane in air or to air alone for 2 h, with a gas flow of 2 l/min. During exposure to sevoflurane or air, the container was heated to 37°C with a heating pad. The concentrations of sevoflurane, oxygen and carbon dioxide in the container were monitored with a gas monitor (Datex Cardiocap II, Datex-Ohmeda, Madison, WI, USA). Following exposure to sevoflurane or air, the mice were returned to their cages. The mice were housed six per cage and maintained on a 12 h light/dark cycle with access to food and water ad libitum. Two hours post-exposure the mice were sacrificed by decapitation, and their hippocampi were removed. Arterial blood gas analyses Arterial blood samples were obtained from the left cardiac ventricle of the mice immediately after exposure to sevoflurane, and were transferred to heparinized glass capillary tubes. Blood pH, partial pressure of carbon dioxide in mmHg (PaCO2), partial pressure of oxygen in mmHg (PaO2), lactate (Lac), and bicarbonate (HCO3) were analyzed immediately after blood collection using a GEM Premier 3000 analyzer (Instrumentation Laboratory, Lexington, MA, USA). Protein extraction and western blot analysis Resected hippocampi were placed into 1.5-ml centrifuge tubes and preserved in liquid nitrogen. All methods were conducted on ice. An NE-PER Nuclear and Cytoplasmic Extraction kit (cat no.78835; Thermo Fisher Scientific, Waltham, MA, USA) was used to extract protein samples. All steps were conducted according to the manufacturer’s instructions. Sodium dodecyl sulphate (SDS) was added to the samples prior to boiling for 10 min at 100°C. Equal quantities of protein (15 μg) were used to detect the expression of the proteins of interest. Samples were electrophoresed on 10 or 15% SDS polyacrylamide gel, blotted onto polyvinylidine fluoride membranes (Bio-Rad Laboratories, Hercules, CA, USA) and then incubated with the following antibodies overnight at 4°C: Anti-phospho-CREB (ser133), (cat no. 06-519, EMD Millipore, Billerica, MA, USA) 1:4,000 dilution in 5% non-fat milk; anti-CREB (cat no. MAB5432, Millipore) 1:5,000 dilution in 5% non-fat milk; anti-BDNF (cat no. AB1779SP, Millipore) 1:1,000 dilution in 5% non-fat milk; anti-MeCP2 (cat no. 3456P, Cell Signaling Technology, Danvers, MA, USA) 1:4,000 dilution in 5% non-fat milk; anti-phospho-MeCP2-S421 (cat no. AP3693a, Abgent Biotech, Suzhou, China) 1:2,000 dilution in 5% non-fat milk); and anti-actin (cat no. A5441, Sigma-Aldrich, St. Louis, MO, USA) 1:10,000 dilution in 5% non-fat milk. The following day, the blots were incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary goat anti-rabbit or goat anti-mouse immunoglobulin G (Kangchen, Shanghai, China), 1:5,000 dilution in 5% non-fat milk. Immunoreactive bands were visualized using Amersham ECL Prime Western Blotting Detection kit (cat NO.RPN2232; GE Healthcare, Chalfont St. Giles, UK). The protein signals were quantified using Quantity One software and a GS-800 Calibrated Imaging Densitometer (Bio-Rad Laboratories) and normalized to a corresponding internal reference: CREB for the exression of p-CREB-S133, MeCP2 for P-MeCP2-S421 and actin for BDNF. Statistical analysis All data are presented as the mean ± standard error. Data were analyzed using the unpaired Student’s t-test in Origin software, version 7.5 (OriginLab, Northampton, MA, USA). P<0.05 was considered to represent a statistically significant difference.",mice,"['At postnatal day 7 (P7), male C57BL/6 mice (weight, 3–5 g; Shanghai Laboratory Animal Center, Shanghai, China) were randomly divided into a sevoflurane-treated group (n=6) and an air-treated control group (n=6) for analysis of the effects of sevoflurane on CREB phosphorylation, BDNF expression and MeCP2 phosphorylation levels.']",postnatal day 7,"['At postnatal day 7 (P7), male C57BL/6 mice (weight, 3–5 g; Shanghai Laboratory Animal Center, Shanghai, China) were randomly divided into a sevoflurane-treated group (n=6) and an air-treated control group (n=6) for analysis of the effects of sevoflurane on CREB phosphorylation, BDNF expression and MeCP2 phosphorylation levels.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",sevoflurane,"['Mice were placed in a plastic container and continuously exposed to 1.5% sevoflurane (Maruishi Pharmaceutical Co., Osaka, Japan) in air, or to air alone for 2 h, with a gas flow of 2 l/min.']",memantine,['Mice received 1 mg/kg saline or memantine intraperitoneally prior to sevoflurane or air treatment.'],c57bl/6,"['At postnatal day 7 (P7), male C57BL/6 mice (weight, 3–5 g; Shanghai Laboratory Animal Center, Shanghai, China) were randomly divided into a sevoflurane-treated group (n=6) and an air-treated control group (n=6) for analysis of the effects of sevoflurane on CREB phosphorylation, BDNF expression and MeCP2 phosphorylation levels.']",True,True,True,True,False,True,[ Passage 7/25 ] 10.3892/mmr.2014.2751 10.1016/j.ntt.2020.106890,520.0,Burks,2020,rats,postnatal day 7,N,sevoflurane,none,sprague dawley,"PMID: 32413489 DOI: 10.1016/j.ntt.2020.106890 2. Methods 2.1. Animals Pregnant Sprague-Dawley rats (Charles Rivers, USA) arrived on gestational day 5. Litters were culled to four males and four females on PND 4. A within-litter treatment design was used to evaluate the effect of Sevo. Four animals, 2 males and 2 females, were selected from each litter. One animal of each sex was randomly assigned to the Sevo group with the other being assigned to the vehicle condition. Three animals per sex were assigned to each treatment / timepoint combination (N = 72). Multiple stains were used on tissue from the same animal. Two animals were removed from the 72 h Sevo group. One animal was removed for failing to meet inclusion criteria for oxygenation (no hypoxic animals were included in the study), and a second animal died between exposure and sacrifice. Rats were housed in a light (12 h/12 h light/dark cycle) and temperature (22 ± 2 °C) controlled vivarium and given free access to food and water (NIH41 laboratory animal diet, Envigo, Madison, WI). All animal procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals. Animal use and procedures were approved by the NCTR Institutional Animal Care and Use Committee (IACUC), which has full NIH-OLAW accreditation. Animals were housed in the NCTR facility in isolator top boxes with wooden chip bedding and ad libitum food and water. 2.2. Study design On PND 7, rats were exposed to vehicle gas alone (75% oxygen/25% nitrogen) or 2.5% Sevo (in vehicle gas) for 6 h. During anesthesia exposure, each pup was placed in an individual airtight acrylic chamber and the selected gas mixture was delivered at a flow rate of 0.75–1 L/min (Walters et al., 2020). The concentration of Sevo was set using a commercial gas analyzer (Riken, USA). Surface body temperature was collected prior to and every 2 h following the start of Sevo exposure using an infrared thermometer (Micro-Epsilon, Ortenburg, Germany). Heating plates located beneath each chamber were used to maintain body temperatures at baseline levels. In addition, arterial oxygen saturation (SpO2), breath rate, heart rate, and pulse distention were monitored in each pup continuously using a pulse oximeter (Starr Life Sciences Corp, USA). The average SPO2 value was calculated every 30 min (Supplemental Table 1); if an individual rat's SPO2 fell below 85% during any of the 30 min intervals, it was excluded from the study. Upon recovery, the pups were removed from the chambers, rubbed with bedding material from their home cage, and returned to their dams. Control animals were treated the same as the experimental group except they were not exposed to anesthesia and there SPO2 was not monitored. Pups were sacrificed 2 h (PND 7), 24 h (PND 8), and 72 h (PND 10) after the cessation of Sevo or vehicle gas exposure. Briefly, the rats were deeply anesthetized with pentobarbital and transcardially perfused with 0.9% heparinized saline followed by 10% neutral buffered formalin. Brains were removed and post-fixed in 10% neutral buffered formalin for 24 h, cryoprotected in 20% sucrose until they sank, and subsequently frozen on dry ice and stored at −80 °C. Tissue was cut into 30 μm thick coronal sections using a cryostat, stored in 0.08% sodium azide in PBS for up to two weeks and then transferred to freezing solution (0.02 M phosphate buffer (pH 7.4) containing 25% (v/v) glycerol and 30% (v/v) ethylene glycol) until processed for immunohistochemistry or histology. 2.3. FJC immunolabeling For FJC labeling, a modified method (Bowyer et al., 2018b; Schmued et al., 2005) was used. Briefly, sections of interest were removed from freezing solution and rinsed three times in 0.1 M phosphate buffer (PB, pH 7.4) for 1 min. Sections were then mounted on gelatin coated slides in 0.005 M PB (pH 7.4) and dried at 50 °C for 2 h. Subsequently, slides were immersed for: 3 min in basic alcohol, 2 min in 70% ETOH, 2 min in Millipore water, 11 min in 0.06% potassium permanganate, 2 min in Millipore water, 10 min in FJC (0.00001% in 0.1% glacial acetic acid), and three 2 min washes in Millipore water. Slides were then dried at 50 °C for 5–10 min, cleared with xylene for 1 min, and cover-slipped with DPX mounting media. 2.4. Mki67 immunolabeling A buffer of 0.1 M PB (pH 7.4) containing 0.4% Triton X-100 was used in all the steps involving free floating sections agitated on an orbital shaker. Sections containing regions of interest were initially washed in buffer three times (15 min each) to remove excess freezing solution. After a 30 min pre-incubation in 4% normal goat serum, the sections were incubated in 4% serum and chicken polyclonal antibody to Mki67 (1:2000, EnCor Biotechnology, USA) for 1 to 2 h at room temperature followed by 18 to 24 h at 5 °C. Sections were then washed three times for 15 min and incubated in a biotinylated goat anti-chicken antibody (1:350, Invitrogen, USA) for 1 h at room temperature. The sections were then washed three times (15 min per wash) and incubated in Streptavidin TRITC (1:200, Jackson ImmunoResearch, USA) for 1 h. The sections were then washed three times (15 min per wash) and mounted on Superfrost Plus slides (Thermo Fisher Scientific, USA) and dried at room temperature for ≥12 h in the dark. Finally, the slides were cleared in xylene and cover-slipped with DPX mounting medium. 2.5. NeuN immunolabeling Sections containing the four regions (IG, anterior CPu (CPua), anterior thalamus, and CA1) with the highest per mm2 levels of FJC labeled cells were immunolabeled with an antibody to NeuN in conjunction with DAB visualization. Sections were washed in 0.1 M PB (pH 7.4) for 15 min and then incubated in 0.1 M PB containing 0.05% H2O2 for 10 min to suppress the endogenous peroxidases. From this point on, except for the last step of 3,3′-diaminobenzidine (DAB) processing, incubation and washing solutions consisted of 0.1 M PB containing 0.25% Triton X-100. Sections were then washed three times for 5 min. Following a 20 min pre-incubation in 5% normal goat serum, the sections were incubated in rabbit anti-NeuN (1:1000, Abcam, USA) antibody for 18 to 24 h at room temperature. Sections were then washed three times for 5 min and incubated in a biotinylated goat anti-rabbit antibody (1:300, Thermo Fisher Scientific, USA) for 2 h. The signal was then amplified using the avidin and biotinylated horseradish peroxidase macromolecular complex (Vector Laboratories, USA) and visualized with 0.5 mg/mL of DAB in Tris-HCl buffer. Sections were washed twice for 5 min in Tris-HCl, mounted, and dried on a slide warmer for ≥12 h. Finally, the slides were cleared in xylene and cover-slipped with DPX mounting medium. 2.6. Thionine staining Thionine staining was performed to verify brain regions. Sections from regions where the highest levels of FJC staining were observed from PND 7, 8 and 10 were mounted from 0.1 M PB (pH 7.4) on Superfrost Plus slides (Thermo Fisher Scientific, USA) and dried at 55 °C for 15 min. They were then immersed in double distilled water for 4 min. Subsequently, the sections were immersed in a solution of 0.1% thionine acetate (Sigma-Aldrich, USA) in double distilled water for 8 min. The sections were then transferred through two washes of water (2 min each) followed by 70% ethanol in water (2 min), 95% ethanol (2 min) and 100% ethanol (2 min). The sections were then transferred to xylene for ≥2 min and cover-slipped as described above. 2.7. Image capturing and analysis Imaging of brain tissue was conducted using a Nikon Eclipse Ni microscope equipped with digital cameras (Photometrics, USA; Nikon, USA). FJC, Mki67, NeuN, and thionine labeling were quantified in the somatosensory cortex, motor cortex, CPu, thalamus, CA1 region of the hippocampus, septum and amygdala at 10× magnification using NIS Elements AR automated software (Nikon, USA). Brain regions were defined in accordance with brain atlases for adult and neonatal rats (Paxinos and Watson, 2014; Ramachandra and Subramanian, 2011). 2.8. Stereological analysis The brain regions in which the highest levels of FJC positive neurons were identified with the aid of adult and neonatal atlases as guides. Given the absence of a complete neonatal atlas, these locations were verified using thionine stained sections from the same regions that the FJC sections were taken to determine neurodegeneration from the pups sacrificed at PND 7, 8 and 10 [see Fig. 1]. Subsequent to identifying these regions, unbiased stereological estimates of positively immunolabeled cells/structures were performed from images that were captured with Photometrics (fluorescent) or Nikon (brightfield) digital cameras using NIS elements AR software for analysis.",rats,"['Pregnant Sprague-Dawley rats (Charles Rivers, USA) arrived on gestational day 5.']",postnatal day 7,"['On PND 7, rats were exposed to vehicle gas alone (75% oxygen/25% nitrogen) or 2.5% Sevo (in vehicle gas) for 6 h.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",sevoflurane,"['On PND 7, rats were exposed to vehicle gas alone (75% oxygen/25% nitrogen) or 2.5% Sevo (in vehicle gas) for 6 h.']",none,[],sprague dawley,"['Pregnant Sprague-Dawley rats (Charles Rivers, USA) arrived on gestational day 5.']",True,True,True,True,True,True,[ Passage 8/25 ] 10.1016/j.ntt.2020.106890 10.1111/pan.12263,801.0,Hu,2013,rats,postnatal day 7,N,sevoflurane,none,wistar,"PMID: 24102683 DOI: 10.1111/pan.12263 Materials and methods Animals Thirty-six neonatal male Wistar rats aged 7 days were purchased from Zhejiang Academy of Medical Science (Hangzhou, China) (SYXK(zhe)2005-0072). A balanced number of control and experimental animals were drawn from the same litters, so that each experimental condition had its own group of littermate controls. All animals were kept in standard animal cages under conventional housing conditions (12-h light-dark cycle, 22°C), with ad libitum access to food and water. All experimental procedures were in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals, formulated by the Ministry of Science and Technology of China 8. Anesthesia treatment Our research protocol was approved by the institutional animal research review board of Zhejiang University (Zju201301-1-02-021). Thirty-six 7-day-old male rats were allocated by computer-generated random numbers to a 6 h exposure in an anesthesia chamber with either 3% sevoflurane (H20100586; Abbott, Chicago, IL, USA) plus 60% oxygen (group S) or air as a normal control (group NC). Sevoflurane was delivered into the chamber by an agent-specific vaporizer. All anesthetized rats breathed spontaneously and underwent heart rate monitoring. As well, body temperature was monitored with a rectal probe and maintained between 36.0°C and 37.0°C by means of a heating pad. Rats were sacrificed at 1, 7 and 14 days following exposure, respectively, and were thus assigned to sevoflurane group (S1d, S7d, S14d groups, n = 6 in each) and normal control group (NC1d, NC7d, NC14d groups, n = 6 in each). Their brains were removed immediately after death and then frozen in dry ice and stored at −70°C until used. Arterial blood gas analysis To determine the adequacy of ventilation, arterial blood was sampled immediately after removal from the maternal cage (0 h) or at the end of anesthesia (6 h) by obtaining a single sample (100 μl) from the left carotid artery using a 24 gauge SURFLO (Terumo, Tokyo, Japan) catheter. Bicarbonate concentration (millimoles per liter), oxygen saturation (%), pH, paCO2 (mmHg), and paO2 (mmHg) were measured immediately after blood collection, using a Nova Biomedical blood gas apparatus (ABL800; Radiometer, Copenhagen, Denmark). Examination of microtubule structure by electron microscopy The hippocampus was removed and cut into 1 mm3 fragments. These were then fixed in 2.5% glutaraldehyde for 2 hours followed by 1% osmium tetroxide (pH 7.3–7.4) for 1–2 h. After fixation, the samples were rinsed with buffer for 20 min, dehydrated, soaked, and embedded. An ultra-thin slicer was used to cut slices of 1–10 μm thickness that were then stained and viewed under electron microscopy (model CM10; Philips, Eindhoven, the Netherlands). Images were captured through a CCD camera (model C4742-95; Hamamatsu, Bridgewater, NJ, USA) and Advantage CCD Camera System software (Advanced Microscopy Techniques Corporation, Danvers, MA, USA). Western blotting analysis for tau pSer396 and pSer404 For the Western blot analysis, samples (80 μg protein) were prepared using neonatal rat hippocampal tissue. These were mixed with sample buffer, separated by 10% SDS-PAGE and electroblotted to a nitro cellulose membrane. The membrane was blocked for 1 hour at room temperature with blocking solution (5% nonfat milk in Tris-buffered saline with Tween 20 [TBST]). Blots were then incubated overnight at 4°C with the specific rat monoclonal antibodies anti-pSer396 (sc-101815) and anti-pSer40 (sc-12952) (1 : 200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA) or β-actin antibody (Santa Cruz Biotechnology). The samples were then washed three times and incubated with a horseradish peroxidase-labeled second antibody rabbit anti-rat IgG (1 : 2000 dilution; GE Healthcare, Shanghai, China) for 1 h at room temperature prior to visualization with a chemiluminescence detection technique (SuperSignal West Pico Chemiluminescent Substrates; Pierce Biotechnology, Rockford, IL, USA). Densitometric techniques were performed to quantify the protein band absorbance (gel-pro analyzer software; Bio-Rad Laboratories, Hercules, CA, USA) and expressed as relative densitometric units of the corresponding control. Tau assay and quantitative real-time PCR Total RNA was isolated from sevoflurane group and control group. Hippocampus neurons using the RNAeasy mini kit (Takara, Dalian, China) according to the manufacture's instruction. First-strand cDNA was synthesized from 5 μg of total RNA using the Super Script III first-strand synthesis kit (Takara) and random hexamer system (Roche, Shanghai, China). Quantification of the target genes was performed with Power SYBR Green PCR master mix kit (ABI, Carlsbad, CA, USA) in Bio-Rad MX3000P real-time PCR system according to the manufacturer's instructions. Triplicate quantitative reverse transcription PCRs were carried out for each sample. The PCR amplification cycles were as follows: initial denaturation at 95°C for 15 min, followed by 40 cycles with denaturation at 95°C for 20 s, and annealing-extension at 60°C for 35s. The specificity of the SYBR Green PCR signal was confirmed by melting curve analysis. Acquired data were analyzed by lightcycle 2000 software 3.5 (Roche). The Ct value of each gene was normalized against that of GAPDH. Tau primer sequences were as follows: tau-sense 5′ACC CCG CCA GGA GTT TGA C-3′, tau-antisense 5′-GAT CTT CGC CCC CGT TTG-3′ 244 bp, GAPDH-sense 5′-CTA CAA TGA GCT GCG TGT GGC-3′, GAPDH-antisense 5′-CAG GTC CAG ACG CAG GAT GGC-3′ 207 bp. All data are expressed as mean ± sd. spss 12.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Numerical data including Oxygen saturation, PaO2, PaCO2, pH, and the levels of tau phosphorylation at phosphor-Ser396/404 and tau mRNA between groups were analyzed by the Student's t-test, and intragroup numerical data were analyzed by repeated measures anova. Statistical significance was accepted as P < 0.05.",rats,"['Thirty-six neonatal male Wistar rats aged 7 days were purchased from Zhejiang Academy of Medical Science (Hangzhou, China) (SYXK(zhe)2005-0072).']",postnatal day 7,['Thirty-six 7-day-old male rats were allocated by computer-generated random numbers to a 6 h exposure in an anesthesia chamber with either 3% sevoflurane plus 60% oxygen (group S) or air as a normal control (group NC).'],N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",sevoflurane,"['Thirty-six 7-day-old male rats were allocated by computer-generated random numbers to a 6 h exposure in an anesthesia chamber with either 3% sevoflurane (H20100586; Abbott, Chicago, IL, USA) plus 60% oxygen (group S) or air as a normal control (group NC).']",none,['The document only mentions the use of sevoflurane as an intervention.'],wistar,"['Thirty-six neonatal male Wistar rats aged 7 days were purchased from Zhejiang Academy of Medical Science (Hangzhou, China) (SYXK(zhe)2005-0072).']",True,True,True,True,True,True,[ Passage 9/25 ] 10.1111/pan.12263 10.4196/kjpp.2017.21.6.579,827.0,Jiang,2017,rats,postnatal day 7,Y,isoflurane,none,sprague dawley,"PMID: 29200900 PMCID: PMC5709474 DOI: 10.4196/kjpp.2017.21.6.579 METHODS Chemicals and reagents Genistein and isoflurane (0.75%) were obtained from Sigma-Aldrich (St. Louis, MO, USA). For expression analysis, antibodies against CREB, p-CREB, cleaved caspase-3, Bcl-2, Bad, Bcl-xL, Bax, β-actin, phosphatase and tensin homolog (PTEN), and mammalian target of rapamycin complex 1 (mTORc1) were purchased from Cell Signaling Technology (Beverly, MA, USA). Akt, p-Akt, GSK-3β, p- GSK-3β, BDNF, TrkB, and p-TrkB were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). PDE4 and Ca2+/calmodulin-dependent kinase IV (CaMKIV) were from Abcam. All other chemicals and reagents used in the present study were purchased from Sigma-Aldrich unless otherwise noted. Animals This study and its experimental design were approved by the animal experimentation ethics committee of the hospital, and all techniques were performed in compliance with the guidelines issued for the care and use of laboratory animals by the NIH and National Animal Welfare Law of China. Pregnant Sprague–Dawley rats were housed in individual sterile plastic cages under standard animal house conditions (12-h day/night cycle, 23℃±2℃) at 55~65% humidity levels. The rats were given free access to standard pellet food and water. Animals were monitored carefully for the birth of pups, and the day on which pups were born was designated as postnatal day 0 (P0). The pups were housed in sterile cages and carefully maintained under the same conditions as described above. Anesthesia exposure Separate groups of rat pups were treated orally with genistein at 20, 40, or 80 mg/kg body weight every day from P3 to P15 along with the standard diet. On P7, the pups were exposed to 0.75% isoflurane (6 h) in 30% oxygen or air [~0.3 minimum alveolar concentration (MAC)] as described by Orliaguet et al.[36] in a temperature-controlled chamber [5]. Rats in the control group were not exposed to isoflurane and were not given genistein. P7 was chosen for anesthetic exposure based on previous studies suggesting that rats are most sensitive to anesthesia-induced neuronal damage during this period [1]. For analysis of neuroapoptosis, cAMP levels, and gene expression, the rat pups were sacrificed 1 h after anesthetic exposure. The animals were perfused transcardially with ice-cold saline and 4% paraformaldehyde in 0.1 M phosphate buffer. Determination of neuroapoptosis by TUNEL assay The influence of genistein on isoflurane-induced neuronal apoptosis was determined by TUNEL assay as described by Li et al. [5]. The brain tissues were cut into sections at a thickness of 5 µm, and apoptosis was assessed using the Dead End™ fluorometric TUNEL system kit (Promega, Madison, WI, USA) according to the manufacturer's instructions. The numbers of TUNEL-positive cells in the hippocampal CA1, CA3, and dentate gyrus sections were determined and analyzed using NIS-Elements BR image processing and analysis software (Nikon Corporation, Tokyo, Japan). The concentration of TUNEL-positive cells in each region is presented as the number of TUNEL-positive cells/mm2. Fluoro-Jade B staining Fluoro-Jade B (FJB) staining was performed to determine neurodegeneration. Hippocampal sections (30 µm thick) were fixed on slides coated with gelatin and dried at room temperature overnight. Slides were rehydrated and then incubated in potassium permanganate (0.06%) for 15 min, rinsed with distilled H2O, and stained with FJB. The sections were further incubated with 0.1% acetic acid for 30 min and observed under a microscope (DM IRB; Leica, Wetzlar, Germany). Determination of cyclic AMP Cyclic AMP (cAMP) levels in the hippocampal tissues were determined using a cAMP complete ELISA kit in accordance with the manufacturer's protocol (Enzo Life Sciences, Farmingdale, NY, USA). The cAMP levels were expressed as pmol/mg. RT-PCR analysis RT-PCR was performed to assess the influence of genistein on BDNF and TrkB gene expression in the hippocampal tissues of isoflurane anesthesia-treated rat pups. Total RNA was isolated from the hippocampi using Trizol (Invitrogen, Carlsbad, CA, USA), and the RNA concentration was determined using a Nanodrop spectrophotometer (ND 1000; Bio-Rad, Hercules, CA, USA). First-strand complementary DNA (cDNA) was synthesized using the Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA). PCR was performed according to the manufacturer's protocol. The primer sequences for BDNF and TrkB were as follows: BDNF, Forward: 5'-CGAAGAGCTGCTGGATGAG-3', Reverse: 5'-ATGGGATTACACTTGGTCTCG-3'. TrkB, Forward: 5'-CCTCCACGGATGTTGCTGA-3', Reverse: 5'-GGCTGTTGGTGATACCGAAGTA-3'. GAPDH expression was assessed as an internal control using the following primer sequences: Forward: 5'-CCGTATCGGACGCCTGGTTA-3', Reverse: 5'-GGCTGTTGGTGATACCGAAGTA-3'. PCR products were separated on agarose gels (1%) and stained with 0.05% ethidium bromide. Band intensities were analyzed using a Bio Gel imagery apparatus (Bio Rad). Immunoblotting The harvested hippocampal tissues were subjected to expression analysis by Western blotting as described previously [37,38]. Briefly, the tissues were homogenized in lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Nonidet P-40) with protease inhibitors (aprotinin, pepstatin A, and leupeptin) at mg/mL concentrations for protein extraction. The cell lysate was centrifuged (12,000 g for 10 min at 4℃), the supernatant was removed, and the total protein concentration was determined using a protein assay kit (Bio-Rad). Equal amounts of sample protein (50 µg) were electrophoresed in NuPAGE Novex Bis-Tris gradient gels (Invitrogen). The separated bands were then blotted onto nitrocellulose membranes and incubated with blocking solution (0.1% TBST and 5% non-fat milk) for 2 h, followed by incubation with primary antibodies overnight at 4℃. The membranes were washed three times in TBST and then incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology) for 60 min. Following five to six washes in TBST, immunoreactive bands were visualized using an ECL detection kit (GE Healthcare, Fairfield, CT, USA) and analyzed using Image J software (NIH Image, Bethesda, MD, USA). Protein expression was normalized relative to the expression of β-actin as an internal standard. Behavioral analysis: open field test P35 rats exposed to anesthesia on P7 were subjected to open field tests to evaluate their anxiety behavior and general locomotory activity. The rats were placed in a white plastic chamber (100×100×100 cm) for 5 min, and exploratory behavior in the novel environment was recorded using a video tracking system (XR-XZ301; Shanghai Soft maze Information Technology Co., Ltd., Shanghai, China). Fear conditioning test Hippocampal-dependent and -independent responses were assessed by a fear conditioning test performed as described previously [39,40]. P35 rats were subjected to fear stimuli. Each rat was placed in a test chamber in a dark room. The chamber had grid floors with stainless steel bars attached to a shock delivery system (Coulbourn, Whitehall, PA, USA). The animals were exposed to three tone–foot shock pairings (tone: 2000 Hz, 85 db, 30 s followed by foot shock: 1 mA, 2 s) at 1-min intervals. Animals were removed from the chamber 30 s after conditioning. After 24 h, the same animals were placed in the chamber, one animal at a time for a period of 8 min, in the absence of tone and electric shock. The behavior and freezing response of the animals were recorded. Two hours later, the animals were placed in a test chamber that varied from the first test chamber in context and smell (instead of ethanol, as used in the first chamber, 1% acetic acid was used to wipe the second chamber) in a relatively light room. Freezing responses were documented for 3 min without auditory conditioning stimulus. The auditory stimulus was turned on for 30 s in three cycles with a 60 s inter-cycle interval. The freezing behavior was recorded. Learning and memory analysis: Morris water maze test The Morris water maze test was used to assess learning ability and memory retention. For the Morris water maze test (Shanghai Jiliang Software Technology Co. Ltd., Shanghai, China), a circular pool was filled with warm water (25±1℃) approximately 1.5 cm above a transparent round platform 15 cm in diameter that was placed in any of the four quadrants of the pool. The platform was placed in the same position throughout the training period. P31 rats that were administered genistein and/or exposed to isoflurane on P7 were trained to explore the maze. The rats were trained in two sessions/day for 4 consecutive days. The animals were permitted to swim freely in the pool until they reached the platform. If the rats were unable to find the submerged platform within 60 s, they were directed to the platform and allowed to remain there for 30 s. The swimming path was observed using an automated video tracking system (ANY-maze video tracking system; Stoelting Co., Wood Dale, IL, USA). The time taken by the rats to reach the platform was recorded as the latency. After 4 days of trial sessions, cued trials were conducted on P35 to evaluate non-cognitive impairments, such as visual impairments and/or any difficulties in swimming. The circular pool was surrounded with a black cloth to hide any visual cues. The rats were subjected to four trials/day. Each rat was positioned in a defined place within the pool during the trials and was allowed to swim and locate the submerged platform, which was attached to a rod fixed ~20 cm above water level. The rod served as the cue. The time taken to locate the cued platform was recorded as mentioned above. For the place trials, the cloth surrounding the pool and the cue rod attached to the platform were removed. Rats were positioned at random points and allowed to locate the platform; the time taken to locate the platform was recorded. Probe trials were conducted to assess memory retention. The test was performed 24 h after the place trials. The platform was placed in a different quadrant than where the submerged platform had been during the cued and place trials (target quadrant). The time spent by the rats in the target quadrant searching for the submerged platform was recorded. Statistics The results are presented as means±standard deviation (SD) of six independent experiments. Data were analyzed for statistical significance by one-way analysis of variance (ANOVA) followed by Duncan's multiple range test as a post hoc analysis using SPSS (version 22.0; SPSS, Chicago, IL, USA). In all analyses, p<0.05 was taken to indicate statistical significance.",rats,['Pregnant Sprague–Dawley rats were housed in individual sterile plastic cages under standard animal house conditions.'],postnatal day 7,"['On P7, the pups were exposed to 0.75% isoflurane (6 h) in 30% oxygen or air.']",Y,"['Behavioral analysis: open field test P35 rats exposed to anesthesia on P7 were subjected to open field tests to evaluate their anxiety behavior and general locomotory activity.', 'Fear conditioning test Hippocampal-dependent and -independent responses were assessed by a fear conditioning test performed as described previously.', 'Learning and memory analysis: Morris water maze test The Morris water maze test was used to assess learning ability and memory retention.']",isoflurane,"['On P7, the pups were exposed to 0.75% isoflurane (6 h) in 30% oxygen or air.']",none,[],sprague dawley,['Pregnant Sprague–Dawley rats were housed in individual sterile plastic cages under standard animal house conditions.'],True,True,True,True,True,True,[ Passage 10/25 ] 10.4196/kjpp.2017.21.6.579 10.3389/fncel.2020.00004,415.0,Ju,2020,mice,postnatal day 16,N,sevoflurane,none,c57bl/6,"PMID: 32047423 PMCID: PMC6997293 DOI: 10.3389/fncel.2020.00004 Materials and Methods Animals All experiments were approved by the relevant Committees of Chungnam National University, Daejeon, South Korea (CNU-01135). C57BL/6J mice were maintained in a specific pathogen-free (SPF) room maintained at 22°C, with a 12 h light/dark cycle, and fed ad libitum. Animals received anesthesia during the light cycle. This research adheres to the ARRIVE (Animal Research: Reporting in vivo Experiments) guidelines. Anesthesia PND 16/17 mice were randomly divided into three groups: control, sevoflurane, and sevoflurane plus rapamycin groups. Mice in the sevoflurane and sevoflurane plus rapamycin groups were placed in a 1-l plastic chamber and exposed to a constant flow of fresh gas [fraction of inspired oxygen (FiO2) 0.4, 4 L/min] containing 2.5% sevoflurane for 2 h. Full recovery was confirmed 30 min after discontinuing sevoflurane. Control mice were treated identically but without sevoflurane. The anesthesia chamber was placed in a 36°C water bath to maintain a constant temperature. Carbon dioxide and sevoflurane were monitored using an S/5 compact anesthetic monitor and a mCAiO gas analyzer module (Datex-Ohmeda, Helsinki, Finland). Rapamycin Treatment Rapamycin (LC Laboratories, Woburn, MA, USA) was reconstituted in ethanol at a concentration 10 μg/μl and then diluted in 5% Tween-80 (Sigma–Aldrich, St. Louis, MO, USA) and 5% PEG-400 (Sigma–Aldrich, St. Louis, MO, USA), as described (Chen et al., 2009). Mice in the sevoflurane plus rapamycin group were each administered three intraperitoneal injections of rapamycin (5 mg/kg) at 24 h intervals prior to sevoflurane exposure, whereas mice in the control and sevoflurane groups were injected with an identical volume of vehicle. Western blotting Whole-brain samples were obtained from the mice 24 h after sevoflurane exposure. Mice were exposed to carbon dioxide before brain extraction, and each whole brain was homogenized with a tissue grinder in RIPA lysis buffer [ELPIS-BIOTECH, Daejeon, South Korea, 100 mM Tris–hydrochloride (pH 8.5), 200 mM NaCl, 5 mM EDTA, and 0.2% sodium dodecyl sulfate], containing phosphatase and protease inhibitor cocktails (Sigma–Aldrich). After centrifuging the homogenized samples at 12,000× g for 15 min at 4°C, the supernatants were decanted and their protein concentrations were measured using the Bradford assay (Bio-Rad, Hercules, CA, USA). Samples (20 μg) were electrophoresed on SDS PAGE gels, and transferred to nitrocellulose membranes (pore size, 0.2 μm; Amersham Protran®, GE Healthcare, Buckinghamshire, UK) at 200 mA for 2 h. The membranes were blocked for 1 h with Tris-buffered saline-Tween 20 [10 mM Tris–hydrochloride (pH 7.6), 150 mM NaCl, and 0.1% Tween 20], containing 3% bovine serum albumin (BSA), followed by incubation with primary antibodies and the appropriate secondary antibodies coupled to horseradish peroxidase. Specific antibody-labeled proteins were detected using the enhanced chemiluminescence system (WEST-ZOL plus; iNtRON BioTechnology, Seongnam, South Korea). Primary antibodies included antibodies to phospho-mTOR(S2448), mTOR (Cell Signaling Technology, Danvers, MA, USA), postsynaptic density 90 (PSD95; Neuromab, Davis, CA, USA), GAD65 (Abcam, Cambridge, UK), NDUFB8 (a mitochondrial complex I subunit; Santa Cruz Biotechnology, Santa Cruz, TX, USA), COX4 (a mitochondrial complex IV subunit; Novus Biologicals, Centennial, CO, USA) and actin (Santa Cruz Biotechnology, Santa Cruz, TX, USA). Antibodies against GluA1 (1193) and GluA2 (1195) have been described previously (Kim et al., 2009). Oxygen Consumption Rate Mitochondria were isolated from brain tissues 24 h after sevoflurane exposure, as previously described (Chung et al., 2017a). Each brain was homogenized in a mitochondrial isolation buffer [70 mM sucrose, 210 mM mannitol, 5 mM HEPES, 1 mM EGTA, and 0.5% (w/v) fatty acid–free BSA (pH 7.2)] with a Teflon-glass homogenizer (Thomas Fisher Scientific, Swedesboro, NJ, USA). After centrifugation at 600× g for 10 min at 4°C and at 17,000× g for 10 min at 4°C, the mitochondrial fraction was resuspended in a mitochondrial isolation buffer. Protein concentration was measured by the Bradford assay (Bio-Rad), and 20 μg aliquots of protein were diluted with 50 μl mitochondrial assay solution [70 mM sucrose, 220 mM mannitol, 10 mM KH2PO4, 5 mM MgCl2, 2 mM HEPES, 1 mM EGTA, 0.2% (w/v) fatty acid–free BSA, 10 mM succinate, and 2 μM rotenone (pH 7.2)] and seeded in an XF-24 plate (Seahorse Bioscience, North Billerica, MA, USA). The plates were centrifuged at 2,000× g for 20 min at 4°C using a swinging bucket microplate adaptor (Eppendorf, Hamburg, Germany); 450 μl mitochondrial assay buffer was added to each plate, and the plates were maintained at 37°C for 8–10 min. Each plate was transferred to a Seahorse XF-24 extracellular flux analyzer (Seahorse Bioscience) and the oxygen consumption rate (OCR) was measured at five stages: stage I (basal level); stage II, following the addition of adenosine diphosphate (ADP); stage III, following the addition of oligomycin, a mitochondrial oxidative phosphorylation (OXPHOS) complex 5 inhibitor; stage IV, following the addition of carbonyl cyanide m-chlorophenyl hydrazine (CCCP), a mitochondrial OXPHOS complex 4 inhibitor; and stage V, following the addition of antimycin A, a mitochondrial OXPHOS complex 3 inhibitor. OCR was automatically calculated and recorded using Seahorse XF-24 software (Seahorse Bioscience). Electrophysiology Whole-cell voltage-clamp recordings of pyramidal neurons in the CA1 region of the hippocampus were obtained as described (Chung et al., 2015a). Twenty-four hours after exposure to sevoflurane or fresh gas, sagittal slices of the hippocampus (300 μm) were prepared in ice-cold dissection buffer (212 mM sucrose, 25 mM NaHCO3, 5 mM KCl, 1.25 mM NaH2PO4, 10 mM d-glucose, 2 mM sodium pyruvate, 1.2 mM sodium ascorbate, 3.5 mM MgCl2, and 0.5 mM CaCl2) aerated with 95% O2/5% CO2, using a VT1200S vibratome (Leica, Arrau, Switzerland). Slices were transferred immediately to a 32°C chamber containing artificial cerebrospinal fluid (aCSF: 125 mM NaCl, 25 mM NaHCO3, 2.5 mM KCl, 1.25 mM NaH2PO4, 10 mM d-glucose, 1.3 mM MgCl2, and 2.5 mM CaCl2, continuously aerated with 95% O2/5% CO2) and incubated for 30 min. Glass capillaries were filled with two kinds of internal solutions. For miniature excitatory postsynaptic current (mEPSC) recordings, the glass capillaries were filled with an internal solution containing 117 mM CsMeSO4, 10 mM tetraethylammonium chloride, 8 mM NaCl, 10 mM HEPES, 5 mM QX-314-Cl, 4 mM Mg-adenosine triphosphate (ATP), 0.3 mM Na-guanosine triphosphate, and 10 mM EGTA; for miniature inhibitory postsynaptic current (mIPSC) recordings, the glass capillaries were filled with an internal solution containing 115 mM CsCl, 10 mM tetraethylammonium chloride, 8 mM NaCl, 10 mM HEPES, 5 mM QX-314-Cl, 4 mM Mg-ATP, 0.3 mM Na-guanosine triphosphate, and 10 mM EGTA. Whole-cell recordings were performed under visual control (BX50WI; Olympus, Tokyo, Japan) with a multi clamp 700A amplifier (Molecular Devices, San Jose, CA, USA). Data were acquired with Clampex 9.2 (Molecular Devices, San Jose, CA, USA) and analyzed using Clampfit 9 software (Molecular Devices, San Jose, CA, USA). Statistical Analysis The sample size was determined based on previous experience or as previously described (Chung et al., 2015b, 2017b). All statistical analyses were performed using R statistical software (3.1.2: R Core Team, Austria). All continuous variables were tested to determine whether they met conditions of normality and homogeneity of variance. One-way ANOVA with post hoc Tukey HSD test was performed when both conditions were met, Welch’s ANOVA with post hoc Tukey HSD test was performed when homogeneity of variance was unmet, and the Kruskal–Wallis test with post hoc Dunn’s test was performed if normality was unmet. P < 0.05 was considered statistically significant. Statistical results are presented as Supplementary Statistics.",mice,"['C57BL/6J mice were maintained in a specific pathogen-free (SPF) room maintained at 22°C, with a 12 h light/dark cycle, and fed ad libitum.']",postnatal day 16/17,"['PND 16/17 mice were randomly divided into three groups: control, sevoflurane, and sevoflurane plus rapamycin groups.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",sevoflurane,"['Mice in the sevoflurane and sevoflurane plus rapamycin groups were placed in a 1-l plastic chamber and exposed to a constant flow of fresh gas [fraction of inspired oxygen (FiO2) 0.4, 4 L/min] containing 2.5% sevoflurane for 2 h.']",none,[],c57bl/6,"['C57BL/6J mice were maintained in a specific pathogen-free (SPF) room maintained at 22°C, with a 12 h light/dark cycle, and fed ad libitum.']",True,False,True,True,True,True,[ Passage 11/25 ] 10.3389/fncel.2020.00004 10.1213/ANE.0b013e3182a8c709,815.0,Kato,2013,rats,postnatal day 7,N,sevoflurane,none,wistar/st,"PMID: 24132013 DOI: 10.1213/ANE.0b013e3182a8c709 METHODS Animals The experiments were approved by the Committee for Animal Research of the Hokkaido University Graduate School of Medicine. Pregnant Wistar/ST rats were obtained from Shizuoka Laboratory Animal Center (Hamamatsu, Japan). The animals were housed in a room maintained at 22°C to 25°C with a 12-hour light-dark cycle (light from 06:00 to 18:00) and were given free access to food and water. Rats were handled in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Hokkaido University Graduate School of Medicine. Gas Exposure At postnatal day 7, male pups were divided into 4 treatment groups as follows: animals exposed to (1) 1% sevoflurane with oxygen (O2), (2) 2% sevoflurane with O2, (3) 8% CO2 with O2 to mimic hypercapnia and acidosis caused by 2% sevoflurane exposure, or (4) 100% O2 as a control. Rat pups were placed in an acrylic chamber and exposed to warmed, humidified gas for 2 hours. The total gas flow was 3 L/min to maintain a stable gas concentration. The concentrations of sevoflurane, CO2, and O2 in the chamber were continuously monitored using an anesthetic gas monitor (5250RGM, Datex-Ohmeda GE Healthcare, Chalfont St. Giles, United Kingdom). The gas temperature in the chamber was maintained at 27.5°C to 28.6°C, measured using a TR-200 (F.S.T., Foster City, CA), and the rats’ body temperatures were maintained at 35.1°C to 36.5°C, measured using a Thermofocus® (Tecnimed, Tokyo, Japan). To avoid litter variability, equal numbers of rat pups from each litter were randomly assigned to the 4 treatment groups. After gas exposure, rat pups were brought up in an austere environment in standardized cages to avoid the influence of environmental enrichment on later neurocognitive functions.13 Arterial Blood Gas Assessment To assess respiratory disturbances caused by sevoflurane exposure, arterial blood gas assessment was performed as described previously.19,20 At postnatal day 7, rats underwent arterial blood sampling from the left ventricle via transthoracic puncture under local subcutaneous anesthesia (0.05 mL of 1% lidocaine) at 30, 60, 90, or 120 minutes during 2 hour treatments. Since taking even a single sample of blood could be fatal for the rats, blood sampling was conducted only once for each rat. A small amount of blood (<100 μL) was collected and analyzed immediately using a blood gas analyzer (ABL510, Radiometer Medical, Brønshøj, Denmark) that measured pH, partial pressure of CO2, and O2 (PaCO2 and PaO2 in mm Hg, respectively). In all cases, the procedure was completed within 1 minute in the chamber. Electrophysiological Study Between postnatal days 63 and 70, an electrophysiological study was performed following our reported method.21 Rats were anesthetized with 1% halothane in a mixture of 21% O2 and 79% nitrogen through a tracheal catheter, and their lungs mechanically ventilated (SN-480–7, Shinano, Tokyo, Japan). They were placed in a stereotaxic apparatus with the bregma and lambda in the same horizontal plane, and their body temperatures were maintained at 37°C ± 0.5°C with a heating pad throughout the recording period. The concentration of halothane and expired CO2 tension was continuously monitored through a tracheal catheter using an anesthetic gas monitor (5250RGM, Datex-Ohmeda GE Healthcare), and the expired CO2 tension was maintained between 35 and 45 mm Hg. A monopolar recording electrode was inserted into the pyramidal cell body layer of the hippocampal CA1 region (5.0 mm posterior and 3.0 mm lateral to the bregma and approximately 2.2 mm ventral to the dura), to record extracellular population spike amplitude (PSA) (Fig. 1A). A bipolar stimulating electrode was inserted into the ipsilateral Schaffer collaterals (3.0 mm posterior and 1.5 mm lateral to the bregma, and 2.8 mm ventral to the dura) to deliver cathodal stimulus (frequency 0.1 Hz, pulse duration 250 μs) (Fig. 1A). A single electrical stimulus evoked action potentials in the Schaffer collaterals, resulting in activation of pyramidal cells of the CA1 region, and extracellular PSA was recorded (MacLab, ADInstruments, Sydney, Australia). We measured the PSA following our previous method.21 Briefly, the PSA was defined as the absolute voltage of a vertical line running from the population spike minimum to its intersection with a line tangential to the population spike onset and population spike offset. To adjust the test stimulus, changes in PSA caused by varied stimulus intensity were recorded, and the intensity of the test stimulus was then fixed to produce a half-maximal response for each rat. After establishing a stable baseline for 30 minutes, LTP was induced by applying high-frequency stimulation (HFS; 10 trains at 1 Hz each, composed of 8 pulses at 400 Hz), at the same intensity as the test stimulation. Then relative ratios of PSAs before and after the HFS were then plotted every 5 minutes for 60 minutes after HFS. On completion of the experiment, small lesions were made using a direct electric current (5 µA for 30 seconds) at the tips of the recording and stimulating electrodes. The positions of the electrodes were examined histologically (Fig. 1) according to methods in similar previous reports.22,23 Histological confirmation of the locations of the electrodes showed misplacement of the electrodes in 2 rats in each group, so the data obtained from those electrodes were excluded from the following assessment. All data were collected by investigators who were blinded to treatment assignment. Statistical Methods All statistical analyses were performed using GraphPad Prism version 5.04 (GraphPad Software, Inc., San Diego, CA). First, we confirmed normal distribution of the obtained data by the Shapiro-Wilk test and a normal-probability plot. Data obtained in arterial blood gas analysis were analyzed using 1-way analysis of variance (ANOVA) followed by Bonferroni multiple comparison test for each time point. In the comparisons of LTP data, we used 2-way repeated-measures ANOVA with treatment and time as factors to assess the interaction, and we used 1-way ANOVA followed by Bonferroni multiple comparison test to evaluate differences among the groups at each time point. All averaged data are presented as mean ± SEM. Probability values (P) of <5% were considered significant.",rats,"['Pregnant Wistar/ST rats were obtained from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).']",postnatal day 7,"['At postnatal day 7, male pups were divided into 4 treatment groups as follows:']",N,"['After gas exposure, rat pups were brought up in an austere environment in standardized cages to avoid the influence of environmental enrichment on later neurocognitive functions.']",sevoflurane,"['animals exposed to (1) 1% sevoflurane with oxygen (O2), (2) 2% sevoflurane with O2']",none,[],wistar/st,"['Pregnant Wistar/ST rats were obtained from Shizuoka Laboratory Animal Center (Hamamatsu, Japan).']",True,True,True,True,True,True,[ Passage 12/25 ] 10.1213/ANE.0b013e3182a8c709 10.1016/j.ejphar.2011.08.050,307.0,Kong,2011,rats,gestational day 14,Y,isoflurane,none,none,"PMID: 21930122 DOI: 10.1016/j.ejphar.2011.08.050 2. Materials and methods 2.1. Animals All of the animals were treated according to the guidelines of the Guide for the Care and Use of Laboratory Animals (China Ministry of Health). The Laboratory Animal Care Committee of Zhejiang University approved all experimental procedures and protocols. All efforts were made to minimize the number of animals used and their suffering. The dams were housed in polypropylene cages, and the room temperature was maintained at 22 °C, with a 12-hour light–dark cycle. The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to midgestation in humans (Clancy et al., 2001, Clancy et al., 2007), the period when most nonobstetric surgeries and fetal interventions are performed (Goodman, 2002, Tran, 2010). 2.2. Anesthesia exposure Ten dams were randomly divided into a control and an isoflurane group (n = 5). The dams were placed in plastic containers resting in water baths with a constant temperature of 38 °C. In these boxes, the dams were either exposed to 1.3% isoflurane (Lot 826005U, ABBOTT, USA) in a humidified 30% oxygen carrier gas or simply humidified 30% oxygen without any inhalational anesthetic for 4 h. We chose 1.3% as the anesthetic concentration because it represents 1 minimum alveolar concentration (MAC) in the pregnant rats (Mazze et al., 1985). The determination of anesthetic duration based on our preliminary study which indicated that maternal physiological states remained stable throughout a 4-hour isoflurane exposure. The isoflurane concentration in the box was monitored with an agent gas monitor (Vamos, Drager Medical AG & Co. KgaA). Otherwise, control and experimental animals were under the same treatment and environment. During isoflurane anesthesia, arterial blood gases and blood glucose were measured at the end of the 4-hour anesthetic exposure. The rectal temperature was maintained at 37 ± 0.5 °C. After exposure, the dams were returned to their cages and allowed to deliver naturally. The postnatal body weights of the rat pups were monitored. 2.3. Memory and learning studies Four rat pups (2 females and 2 males) from each dam were selected to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications (Jevtovic-Todorovic et al., 2003). A round pool (diameter, 150 cm; depth, 50 cm) was filled with warm (24 °C) opaque water to a height of 1.5 cm above the top of the movable clear 15-cm-diameter platform in the third quadrant. A video tracking system recorded the swimming motions of animals, and the data were analyzed using motion-detection software for the Morris Water Maze (Actimetrics Software, Evanston, IL, USA). After every trial, each rat was wiped before returning to its regular cage, keeping warm and free diet. 2.3.1. Place trials The place trials were performed at postnatal day 29 for 4 days to determine the rats' ability to obtain spatial information. At postnatal day 28, the rats were made to know the existence of the platform through a 30-second swimming training. A dark black curtain surrounded the pool to prevent confounding visual cues. All rats received 4 trials per day in each of the four quadrants of the swimming pool. On each trial, rats were placed in a fixed position into the swimming pool facing the wall. They were allotted 120 s to find the platform upon which they sat for 20 s before being removed from the pool. If a rat did not find the platform within 120 s, the rat was gently guided to the platform and allowed to remain there for 20 s. For all training trials, swim speed and the time to reach the platform (escape latency) were recorded. The less time it took a rat to reach the platform, the better the learning ability. We took the average of four trials as the escape latency each day. 2.3.2. Probe trials Probe trials were conducted immediately after the four-day period to evaluate memory retention capabilities. The probe trials involved removing the submerged platform from the pool and allowing the rats to swim for 120 s in any of the four quadrants of the swimming pool. Time spent in the third quadrant and the number of original platform crossing in the third quadrant was recorded. 2.4. Transmission electron microscopy After the Morris Water Maze test, three pups per group were anesthetized with a lethal dose of Nembutal. The thoracic cavities were opened and perfused intracardially with 100 mL of normal saline. Then the hippocampus, including CA1 and dentate gyrus area, of each rat was taken out immediately. Immersion fixation was completed on tissues about 1 mm3 from the hippocampus. Samples were rinsed in cold phosphate-buffered saline (PBS) and placed in 2.5% glutaraldehyde at 4 °C for 4 h. The tissue was rinsed in buffer and post-fixed with 1% osmium tetroxide for 1 h. Then, the tissue was rinsed with distilled water before undergoing a graded ethanol dehydration series and was infiltrated using a mixture of half propylene oxide and half resin overnight. Twenty-four hours later, the tissue was embedded in resin. 120 nm sections were cut and stained with 4% uranyl acetate for 20 min and 0.5% lead citrate for 5 min. Ultrastructure changes of synapse in the hippocampus were observed under a transmission electron microscope (Phliphs Tecnai 10, Holland). 2.5. Tissue section preparation After the Morris Water Maze test, two pups from each dam were anesthetized by intraperitoneal injection of a lethal dose of Nembutal. The aorta was cannulated and the animal was firstly perfused with 200 mL of normal saline, then with 250 mL of 4% formaldehyde (freshly made from paraformaldehyde) for 20–30 min. The fixed brain was then removed from the cranial cavity and post-fixed overnight in the same fixative at 4 °C. The tissues were embedded in paraffin, and transverse paraffin sections containing the hippocampal area (5 mm thick) were mounted on silanecoated slides. Sections were deparaffinaged and rehydrated. Then the sections were treated for antigen retrieval with 10.2 mmol/L sodium citrate buffer, pH 6.1, for 20 min at 95 °C for immunohistochemistry. 2.6. Immunohistochemistry analysis The sections mentioned above were washed in 0.01 M PBS containing 0.3% Triton X-100 (pH 7.4, PBS-T), followed by blocking in 5% normal goat serum in 0.01 M PBS. The sections were then incubated in the primary antibodies rabbit polyclonal against anti-CHOP or caspase-12 (1:100, Santa Cruz Biotechnology, USA) overnight at 4 °C. After a thorough wash in PBS, sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200, Boster, China) for 2 h at room temperature, followed by avidin–biotin–peroxidase complex solution (ABC, 1:100, Boster) for 2 h at room temperature. Immunolabeling was visualized with 0.05% diaminobenzdine (DAB) plus 0.3% H2O2 in PBS and the reaction was stopped by rinsing the slides with 0.2 M Tris–HCl. Sections were mounted onto 0.02% poly-l-lysine-coated slides and allowed to dry at room temperature. Then the sections were dehydrated through a graded series of alcohols, cleared in xylene and finally coverslipped. Rat Immunoglobulin IgG (1:200, Biomeda Corporation, USA) was used instead of primary antibody as a negative control. Three sections from each animal were selected at random and images were photographed under 400× magnification in 3 visual fields/per section, the CHOP and caspase-12 positive neurons were counted in the same area. The optical densities of CHOP and caspase-12 positive neurons were measured quantitatively using NIH image software (ImageJ, National Institutes of Health, Bethesda, MD). 2.7. Western blot analysis After Morris Water Maze test, two pups from each pregnant mother were anesthetized with a lethal dose of Nembutal. Then their thoracic cavities were opened and perfused intracardially with 100 mL of normal saline. Hippocampus, including CA1 and dentate gyrus field, of each rat was taken out immediately to obtain fresh tissue specimens. Protein concentration was determined by the BCA method using bovine serum albumin as the standard. Protein samples (50 μg) were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane. The membranes were blocked by nonfat dry milk buffer for 2 h and then incubated overnight at 4 °C with primary antibody against CHOP or caspase-12 (1:500, Santa Cruz Biotechnology, USA). The membranes were subsequently incubated with horseradish peroxidase-conjugated secondary antibodies and developed with ECL kit. The optical densities of bands were quantitatively analyzed using Bio-Rad Quantity One 4.6.2 (Bio-Rad Laboratories, USA). The results were expressed as a relative density. Equal protein loading in each lane was confirmed by hybridization with a 1:2000 dilution of β-actin antibody (Santa Cruz Biotechnology, USA). 2.8. Statistical analysis All data were presented as mean ± S.E.M. Results of weight of postnatal rat pups and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Other data were analyzed using Student's t-test for comparison of two groups. A P value of < 0.05 was considered statistically significant. All statistical tests and graphs were performed or generated, respectively, using GraphPad Prism Version 4.0 (GraphPad Prism Software, Inc. CA, USA).",rats,['All of the animals were treated according to the guidelines of the Guide for the Care and Use of Laboratory Animals (China Ministry of Health).'],gestational day 14,"['The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to midgestation in humans (Clancy et al., 2001, Clancy et al., 2007), the period when most nonobstetric surgeries and fetal interventions are performed (Goodman, 2002, Tran, 2010).']",Y,"['Four rat pups (2 females and 2 males) from each dam were selected to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications (Jevtovic-Todorovic et al., 2003).']",isoflurane,"['In these boxes, the dams were either exposed to 1.3% isoflurane (Lot 826005U, ABBOTT, USA) in a humidified 30% oxygen carrier gas or simply humidified 30% oxygen without any inhalational anesthetic for 4 h.']",none,[],not specified,[],True,True,True,True,True,False,[ Passage 13/25 ] 10.1016/j.ejphar.2011.08.050 10.1371/journal.pone.0105340,269.0,Lee,2014,rats,postnatal day 7,Y,isoflurane,desflurane,sprague dawley,"PMID: 25165850 PMCID: PMC4148240 DOI: 10.1371/journal.pone.0105340 Methods Subjects All experiments were conducted with approval from the Institutional Animal Care and Use Committee at the University of California, San Francisco. Five Sprague-Dawley dams with litters of postnatal day 6 (P6) pups from were obtained from Charles River Laboratories (Gilroy, CA). Each litter contained only males and was culled to ten pups. In total, the males were taken from at least ten different litters. On P7, animals from each litter were randomly assigned to control and treatment groups. They were weaned at P23 and housed three per cage under standard lab housing with 12 h light/dark cycle. Animals were food restricted (access to food only during light cycle) for tasks involving object recognition to increase activity and object exploration. Anesthesia Anesthesia was delivered as described previously [14], [30], [31]. Briefly, animals in the treatment groups received either isoflurane or desflurane as a single agent in air and oxygen (FiO250%) at 1 Minimum Alveolar Concentration [27] for four hours. MAC was determined by tail clamping every 15 minutes, and anesthetic concentration was adjusted accordingly, so that on average 50% of animals would move in response to clamping (Fig. 1). 12 out of 18 animals anesthetized with isoflurane survived to undergo behavioral testing, and 13 out of 18 animals anesthetized with desflurane survived and underwent behavioral testing. Control animals were concurrently placed in an anesthesia glove box of the same material and conditions without being exposed to anesthesia or tail clamping. Animals were kept on a warming blanket, and temperatures were measured using an infrared laser thermometer and maintained with a goal of 35°C. Histology Brains from the two anesthetized groups and the control group (n = 10 per group) were assessed for acute neuronal death. Twelve hours after anesthesia, animals were transcardially perfused with cold 4% paraformaldehyde in phosphate-buffered saline and brains were removed, postfixed, and sunk in sucrose solution. They were then sliced into 60 micron-thick slices and every other slice was mounted and stained with FluoroJade C, a marker specific for neurodegeneration [32], [33] (FJC, 0.001%, Millipore, Billerica, MA). FJ-positive cells were counted using Nikon Eclipse 80i microscope under 20X magnification in each slice containing the structure of interest. Structures included in analysis were the anterodorsal (AD), anteroventral (AV), laterodorsal (LD), and anteromedial (AM) thalamic nuclei, as well as CA1-3 regions of the hippocampus and the dentate gyrus. Object Recognition Tasks Object recognition was assessed using similar arrangements as others [19], [28]. Behavior testing occurred during the light phase of the circadian cycle between 0800 and 1700 hrs in two separate arenas, hereafter referred to as contexts, of identical size (61 cm square base, walls 50 cm high). Context 1 had yellow walls with a base covered in wood-effect vinyl lining, and context 2 had black walls with a black plastic base. Different visual cues were placed on the walls of each context. A video camera (SONY HDR-CX190) was mounted 2 meters above the testing area for recording and observing subjects. For each task, except the allocentric object-location task, subjects were placed into contexts in the same location and facing the south wall (away from the objects). Beginning at P42, subjects were habituated to the two contexts prior to testing by being placed individually into the context for 5 min per day for 4 consecutive days. All animals underwent all behavioral tasks. Subjects were tested on the same day for any given task and in the same sequence of tasks. All tasks were performed in the order presented in subsequent weeks, except for the first two (novel object and object-place) which were performed in the same week. The order of testing during the day was counterbalanced among groups. Investigation of an object was defined as sniffing or placing the nose within 1 cm of and oriented toward the object. Subjects were recorded, and observers blinded to group assignment were used to determine investigation times. Object investigation times during the initial exposure for each task were compared to assess for possible confounding effects of varying investigation times on the ability to recognize objects. All objects and testing arenas were wiped with 70% ethanol between testing. Novel Object Recognition Testing began at P48 with novel object recognition. A single trial was performed for each animal consisting of “exposure” and “test” phases separated by a two-minute delay (Fig. 2A). During the exposure, subjects were placed into the context and allowed to explore two identical objects for four minutes. After the delay, they were placed into the same context for three minutes with one of the objects replaced with a novel object. Half of the subjects were tested in each context with the location (left or right) of the novel object counterbalanced among subjects. Object-Place Recognition Subjects were tested in their ability to recognize an object and its location. Two trials were performed, and investigation times were totaled for the two trials. In the exposure, two different objects were presented in a context for four minutes. After a two-minute delay, two identical copies of one of the previous objects were presented in the same context for three minutes (Fig. 2B). Both objects were equally familiar, but one now occupied a different location within the context. Allocentric Object-Place Recognition For the previous task, subjects were always introduced into the context facing the wall (south wall) opposite the two objects (Fig. 2C). In the allocentric version of the task, for the initial exposure, subjects were again placed into the context facing the south wall. In the test phase, however, the entry point was varied and half of the subjects were introduced facing either the east or west wall (Fig. 2C). Two trials were performed and the entry point was randomized among subjects. Object-Context Recognition Subjects were assessed in their ability to recognize an object with a particular context. The task required two separate exposures, each lasting four minutes and separated by a two-minute delay (Fig. 2D). In the first exposure, a pair of identical objects was presented in a context. Next, subjects were placed in a different context with a different pair of objects. In the test phase, lasting three minutes, subjects were placed into a context with one of each previously encountered object. Thus, one object was presented in the same context as before, while the other object appeared within a context in which it had not been explored. Two trials were conducted, and the test phase occurred in opposite contexts for each trial (Fig. 2D). Object-Place-Context Recognition Subjects were tested in their ability to recognize an object with its location and context (Fig. 2E). In the first exposure, two different objects were presented within a context. Next, subjects were placed in the opposite context with the same two objects and their locations reversed. Thus, after two exposures, each object was observed in both contexts and locations (left and right). In the test phase, two identical copies of either of the previous objects were presented in a context. The location and context associated with one object were familiar, while the other “displaced” object appeared in a location and context in which it had not been observed. Two trials were conducted with the test phase occurring in opposite contexts for each trial (Fig. 2E). Social Behavior and Social Recognition Following object recognition, animals were given unrestricted access to food. Social interaction and recognition were assessed using a discrimination paradigm one week after completing object recognition testing at P80. In the exposure, the subject was presented with a caged stimulus animal and a novel object for five minutes. This arrangement evaluates social behavior by determining whether subjects spend more time investigating the stimulus animal or object7. After a sixty-minute delay, subjects were presented simultaneously with the same “familiar” animal and a novel animal for three minutes. Recognition of the previously encountered animal was demonstrated by decreased investigation of the familiar target relative to the novel one. Same-sex juvenile conspecifics were used as stimulus animals. Male pups five weeks of age were housed individually one week prior to testing. Investigation of the stimulus animal was defined as sniffing or direct contact with the subject’s nose or paws. Investigation of the novel object was defined as sniffing or placing the nose within 1 cm of and oriented toward object. Statistical Analysis Data were analyzed using Prism 6 Software for Mac OSX (GraphPad Software Inc., San Diego, CA). Data were assessed for normal distribution using the D’Agostino and Pearson test. Parametric tests were used for normally distributed data; otherwise, nonparametric tests were used for analysis. All comparisons used a two-tail test and a P value less than 0.05 was considered statistically significant. Total FluoroJade-positive cells for each brain region were compared among the groups – control, desflurane, isoflurane – using one-way ANOVA for parametric data or the Kruskal-Wallis test for nonparametric data. Bonferroni’s post-test with multiple comparisons was used following one-way ANOVA, and Dunn’s post-test was used with the Kruskal-Wallis test. The fold-increase in neuronal death was determined for each structure by dividing the total FJ-positive cells for all anesthetized animals (n = 20) by the average number of FJ-positive cells per structure for control animals (n = 10). Recognition tasks were first assessed by comparing the investigation times of each target using paired tests for each group. Paired t-test was used for normally distributed data, and nonparametric data were analyzed with the Wilcoxon matched-pairs rank test. Also, to identify possible confounding effects of varying investigation times on subsequent object/animal recognition, the times during the exposure phase were compared between the groups using either one-way ANOVA with Bonferroni’s post-test or the Kruskal-Wallis test with Dunn’s post-test. In addition, a “discrimination index” (DI) was calculated and represents the relative time spent exploring each target (eg. Familiar versus Novel). To calculate DI, the time spent investigating the familiar target was subtracted from the time spent on the novel target, and this was divided by the total time spent investigating the two (eg. DI = (Novel-Familiar)/(Total Time)). This value was compared to a theoretical value of zero using one sample t-test to assess whether a preference was shown for one of the objects, and a positive DI indicates preference for the novel aspect of the task. For each task, DI of control animals was compared against DI of all anesthetized animals. Also, within the group of anesthetized animals, the DI of desflurane-treated subjects was compared with that of isoflurane-treated subjects. These comparisons were made using either unpaired t-test for parametric data or the Mann Whitney test for nonparametric data.",rats,"['Five Sprague-Dawley dams with litters of postnatal day 6 (P6) pups from were obtained from Charles River Laboratories (Gilroy, CA).']",postnatal day 7,"['On P7, animals from each litter were randomly assigned to control and treatment groups.']",Y,"['Object recognition was assessed using similar arrangements as others [19], [28].', 'Social interaction and recognition were assessed using a discrimination paradigm one week after completing object recognition testing at P80.']",isoflurane,['animals in the treatment groups received either isoflurane or desflurane as a single agent in air and oxygen (FiO250%) at 1 Minimum Alveolar Concentration [27] for four hours.'],desflurane,['animals in the treatment groups received either isoflurane or desflurane as a single agent in air and oxygen (FiO250%) at 1 Minimum Alveolar Concentration [27] for four hours.'],sprague dawley,"['Five Sprague-Dawley dams with litters of postnatal day 6 (P6) pups from were obtained from Charles River Laboratories (Gilroy, CA).']",True,True,True,True,True,True,[ Passage 14/25 ] 10.1371/journal.pone.0105340 10.1002/brb3.514,299.0,Lin,2016,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"PMID: 27688943 PMCID: PMC5036436 DOI: 10.1002/brb3.514 Materials and Methods Treatment with sevoflurane C57/BL6 mice were used throughout the study, which was approved by the SUNY Downstate IACUC. A total of nine litters of mice were used to establish the approximate MAC for P7 mice. A separate set of 11 litters of mice were used for treatment without tail clamp and mice from this group were used for behavioral tests later on in life. At P7, all male pups from each litter (ranging from 2 to 6 pups) were randomly assigned to either the sevo or the no sevo (control) group, while the female pups remained with the dam. During a 2‐h treatment period, pups from the sevo group were separated from the dam and exposed to sevo in a 40% oxygen (O2) and 60% nitrogen (N2) gas mixture (GTS‐WELCO, Newark Distribution, Morrisville, PA). These pups were placed on a 37°C heating pad to prevent hypothermia during treatment. A pulse oximeter sensor (MSTAT 4 mm, Kent Scientific Corporations, Torrington, CN) was placed on one of the hind paws of the pup and measurements for heart rate (HR) and blood oxygen saturation (SpO2) were recorded every 5 min. To establish the approximate MAC of sevo on P7 mice, each treatment of sevo consisted of two mice and tail clamp was done every 10 min. The sevo concentration was adjusted to a higher concentration if both mice moved during tail clamp, adjusted to a lower concentration when neither mouse moved during tail clamp, and no adjustment was made when only one mouse responded to stimuli. This was our approach to determine that with a given sevo concentration, 50% of mice did not respond to stimuli. The sevo concentration was recorded every 5 min since that was the time interval that we used to record peripheral capillary oxygen saturation (SpO2) and HR. The pups from the control group were also separated from the dam and exposed only to 40% O2 and 60% N2. At the end of the 2‐h treatment the pups were returned to their home cage and reunited with their dams. All pups were then reared and weaned following standard institution procedures. Behavior tests The mice that were involved in the behavior tests had undergone a 2‐h sevo or no sevo treatment at P7 without tail clamping. They were reared and group housed under standard conditions. The sevo‐treated mice were marked to distinguish them from the no‐sevo–treated mice within a litter. We examined at most one to two litters of mice at a time for each behavior, with at least 1 week of resting time in between different behavioral tests. The behavior tests were given sequentially for the active place avoidance (APA), reciprocal social interaction, and olfaction habituation/dishabituation. After completion of these tests, we then introduced three‐chamber interaction, open field, and novel object recognition (NOR). All behavioral apparatus were assembled and remained in their original locations throughout the entire duration of the project. The APA test was done on mice starting at the age of P27. All other behaviors were conducted on mice within the age range of 1.5–5 months old. The following reasons contributed to variation in the number of mice used for some tests. First, we were not able to examine all treated mice on the APA due to irreparable malfunctioning of the APA apparatus. Therefore, we introduced NOR as a second cognition test on mice that had not been used for the APA. Second, some mice were not included in testing if they were not within the age range at the time of the test, specifically the second group of tests such as three‐chamber interaction, open field, and NOR. Besides the APA and the open field, all other tests that required manual scoring were first videotaped and then scored by experimenters who were blind to the treatment status of the mice. Locomotion and anxiety‐like behavior Open field test An open field apparatus was used to assess the general physical and anxiety‐like performance of the mice based on their ambulatory locomotion in the arena (Crawley 1985). In a well‐lit novel room, each mouse was given 30 min to explore the open field arena. Locomotion activities such as distance and time in different compartments of the arena were automatically measured using a computerized tracking apparatus (Versadat, Versamax, Groovy, CA). Learning and memory‐like behavior Active place avoidance test The APA test is a hippocampus‐dependent spatial memory test. A rotating arena consisting of a circular platform (40 cm diameter) was placed in the center of a dimly lit room. The mouse was trained to avoid a 60° shock zone, which could be defined within a region of the room identified by multiple visual cues (Fenton et al. 1998; Wesierska et al. 2005). Two‐day trials were performed as described previously (Burghardt et al. 2012). Briefly, the mouse was given 10 min for each trial with at least a 50‐min intertrial interval. The locomotion of the mouse was tracked by computer‐based software that analyzed images from an overhead camera and delivered shocks appropriately (Tracker, Bio‐Signal Group Corp., Brooklyn, NY). A brief constant current foot shock (500 msec, 60 Hz, 0.2 mA) across pairs of rods was delivered to the shock zone upon entrance of the mouse. Track analysis software (Bio‐Signal Group Corp.) was used to compute the number of times that the mouse entered the shock zone. Novel object recognition test This is a two consecutive day test examining learning and memory‐like behavior on adult male mice (3–5 months of age; Leger et al. 2013). The test was conducted in a room with dim lighting. Day 1 is considered the familiarization phase. Mice were individually habituated in a standard open field apparatus for 10 min. They were then taken out of the arena briefly and two identical glass bottles filled with pink silica gel were placed in the center of the arena. The glass bottles were positioned 5 inches from each other such that the mouse can travel freely across the center of the arena without obstruction. The mouse was then put back in the arena and allowed 10 min to become familiar with the two identical objects. Day 2 is the test phase. One of the glass bottles is taken out of the arena and replaced with a yellow laboratory tube rack (H 6.5, W 3.5, D 2 inches) as a novel object. The holes on the sides of the tube rack were taped to prevent the mouse from climbing on them during the experiment. The same mouse was placed in the arena for 10 min in an identical manner as day 1 and allowed 10 min of exploration time. The times spent sniffing and interacting with (attempting to climb up or jump on or at) the familiar and the novel objects were scored for each mouse. Social interactions Reciprocal social interaction The subject mouse (P7 sevo treated or no sevo control) was transferred from his home cage to a new cage with fresh bedding and allowed to habituate to the cage for 10 min. At the end of this 10‐min session, a novel male target mouse (that had not undergone treatment during P7) of similar age was introduced into the same cage. The subject and the target mice were allowed to interact for 10 min. The amount of time that the subject mouse spent interacting with the target mouse (push–crawl/following behavior), self‐grooming, and exploring the arena and the total time the mouse was mobile were scored manually (Silverman et al. 2010). Three‐chamber interaction A three‐chamber apparatus made of clear plexiglass was used for this study (Nadler et al. 2004). The apparatus is divided into three equally sized compartments (H 9.5, W 8, D 16 inches). First, the subject mouse was habituated for 10 min in the center chamber. Then the doors that give access to the left and right sides of the chamber were opened allowing the subject mouse to freely explore all three chambers for 10 min. During this time, the novel target mouse was habituated under a wire pencil cup on a separate tabletop. After 10 min of three‐chamber exploration, the doors were closed and the subject mouse was briefly confined in the center chamber. During this time, we set up the three‐chamber apparatus such that the novel target mouse was placed on one side of the chamber and a novel empty pencil cup on the other side. A weighted plastic cup was placed on the top of each pencil holder to prevent the subject mouse from climbing on the top of it. The doors were then opened to allow the subject mouse to explore the three chambers for 10 min. Communication Olfaction habituation/dishabituation The mouse was transferred to a new cage containing a thin layer of fresh bedding and a hole for inserting a cotton tipped swab. After a 10‐min habituation period in the new cage, the mouse was presented with nonsocial and social odors. Each odor was presented for three consecutive times; the order of presentation was water, almond extract (1:100, Spice Supreme), orange extract (1:100, McCormick), mouse socials 1 and 2. The mouse social odors were taken by wiping in a zigzag pattern across the bottom surface of different cages for odors 1 and 2; each cage housed unfamiliar mice of the same sex and strain. Each presentation of odor lasted 2 min. The amount of time that the mouse spent sniffing the cotton swab, including nose poking, chewing, sniffing, and close proximity (2 cm) of the nose to cotton swab was scored (Silverman et al. 2010). Statistical analysis All statistical analysis was done using GraphPad Prism 5.0 (GraphPad, San Diego, CA). Data with one variable such as the open field and the reciprocal social interaction were analyzed by t test. Data with two variables such as the APA, the NOR, the three‐chamber interaction, and the olfaction habituation/dishabituation were analyzed by two‐way ANOVA, followed by Bonferroni posttests.",mice,"['C57/BL6 mice were used throughout the study, which was approved by the SUNY Downstate IACUC.']",postnatal day 7,"['A separate set of 11 litters of mice were used for treatment without tail clamp and mice from this group were used for behavioral tests later on in life. At P7, all male pups from each litter (ranging from 2 to 6 pups) were randomly assigned to either the sevo or the no sevo (control) group, while the female pups remained with the dam.']",Y,"['The behavior tests were given sequentially for the active place avoidance (APA), reciprocal social interaction, and olfaction habituation/dishabituation.', 'After completion of these tests, we then introduced three‐chamber interaction, open field, and novel object recognition (NOR).']",sevoflurane,"['Treatment with sevoflurane', 'During a 2‐h treatment period, pups from the sevo group were separated from the dam and exposed to sevo in a 40% oxygen (O2) and 60% nitrogen (N2) gas mixture.']",none,[],c57bl/6,"['C57/BL6 mice were used throughout the study, which was approved by the SUNY Downstate IACUC.']",True,True,True,True,True,True,[ Passage 15/25 ] 10.1002/brb3.514 10.1097/ALN.0000000000002904,263.0,Li,2019,mice,postnatal day 7,Y,isoflurane,none,c57bl/6,"PMID: 31436548 PMCID: PMC6800770 DOI: 10.1097/ALN.0000000000002904 Materials and Methods Animal paradigm and experimental timeline. A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study. 84 (44 male and 40 female) of them were randomly selected for the rapamycin experiment and 36 (17 male and 19 female) for the clemastine experiment. Sex was not factored into research design as a biological variable. Both sexes were equally represented in all experiments. All study protocols involving mice were approved by the Animal Care and Use Committee at the Johns Hopkins University and conducted in accordance with the NIH guidelines for care and use of animals. Experimental procedures followed the modified protocols from a previously published journal.7 At postnatal day 7, animals were exposed to isoflurane or room air for 4 hours. From postnatal days 21-35, half of the isoflurane-exposed mice were injected (i.p.) bi-daily with rapamycin (n=28 per group) or fed daily with clemastine through gastric gavage (n=12 per group). The other half were injected with vehicle of rapamycin or fed with vehicle of clemastine. For the rapamycin experiment, a subset of mice from each group were sacrificed at postnatal day 35 for immunohistochemistry (n=8 per group) or Western blotting (n=8 per group). The remaining mice underwent behavioral testing for spatial learning and memory functions between postnatal days 56-62 (n=12 for each group). After behavior tests, two mice from each group were processed for electron microscopy at postnatal day 63. Only behavior tests were conducted for clemastine feeding experiment (n=12 for each group) (Fig. 1A). Isoflurane exposure. At postnatal day 7, two-thirds of the mice were evenly distributed across littermate groups and were randomly selected for isoflurane exposure. The other one-third of the mice stayed in room air as a naïve control. Volatile anesthesia exposure was accomplished using a Supera tabletop portable non-rebreathing anesthesia machine. 3% isoflurane mixed in 100% oxygen was initially delivered in a closed chamber for 3-5 min and after loss of righting reflex, animals were transferred to the specially designed plastic tubes. A heating pad (36.5ºC) was placed underneath the exposure setup. The mice were exposed to 1.5% isoflurane carried in 100% oxygen for 4 hours. A calibrated flowmeter was used to deliver oxygen at a flow rate of 5 L/min and an agent specific vaporizer was used to deliver isoflurane. During isoflurane exposure, mice were monitored for change in physiological state using the non-invasive MouseOx plus instrument (STARR Life Sciences, Holliston, MA, USA). A collar clip connected to the instrument was placed on the neck and a temperature probe placed on the skin of the abdomen. Ten-minute readings with 1-hour intervals were taken. Data was collected in four time-points and averaged for each case. The skin temperature (34.1±0.8ºC), pulse distention (168.9±36.6 μm), heart rate (376.8±94.1 bpm), breath rate (77.4±35.8 brpm), and oxygen saturation (99.3±0.3%) were recorded. After the isoflurane exposure, mice were returned to their moms together with their littermates upon regaining righting reflex. All animals (100%) survived the isoflurane exposure.7 Rapamycin injection. A total of 84 mice were equally divided into three groups: 1) naïve control; 2) isoflurane exposure plus vehicle; and 3) isoflurane plus rapamycin injection. From postnatal days 21-35, half of the isoflurane-exposed mice (group 3; n=28 per group) were injected intraperitoneally with 0.2% rapamycin dissolved in vehicle solution and the other half with vehicle only (group 2; n=28 per group). Vehicle consisted of 5% Tween 80 (Sigma Aldrich, St. Louis, MO, USA), 10% polyethylene glycol 400 (Sigma-Aldrich, St. Louis, MO, USA), and 8% ethanol in saline. Mice received 100 μl rapamycin or vehicle for each injection at 48 hour intervals from postnatal days 21-35. 7 Clemastine feeding. In this experiment, 36 animals were also equally divided into three groups as above. Clemastine (Tocris Bioscience, Bristol, UK) was dissolved in DMSO (Sigma-Aldrich, St. Louis, MO, USA) at 10 mg/ml followed by further dilution in ddH2O into 1 mg/ml. From postnatal days 21-35, half of the isoflurane exposed mice (n=12 for each group) were fed clemastine (10 mg/kg) daily via gastric gavage using plastic feeding tubes (gauge 22; Instech, Plymouth Meeting, PA, USA), and the other half (n=12 for each group) were fed same volume of 10% DMSO as vehicle.16,17 Behavior tests. The novel object position recognition test and Y-maze test were performed at the last week of the survival period (postnatal days 56-62).7 Experimenters were blinded to condition when behavioral tests were carried out and quantified. 1). Novel object position recognition test: The test was assessed in a 27.5 cm × 27.5 cm × 25 cm opaque chamber. During the pre-test day (day 1), each mouse was habituated to the chamber and allowed to explore 2 identical objects (glass bottles, 2.7 cm diameter, 12 cm height, and colored paper inside) for 15 minutes. The mouse was then returned to its home cage for a retention period of 24 hours. On the test day (day 2), the mouse was reintroduced to the chamber and presented with one object that stayed in the same position (old position) while the other object was moved to a new position (novel position). A five-minute period of movement and interaction with the objects was recorded with a video camera that was mounted above the chamber and exploratory behavior was measured by a blinded observer. Exploratory behavior was defined as touching the object with snouts. The numbers of exploratory contacts with the novel object and with the old object were respectively recorded, and the ratios over the total exploratory contact numbers were calculated. 2). Y-maze test: In the pre-test phase (day 1), mice explored and habituated in the start arm (no visual cue) and 1 out of 2 possible choice arms with overt visual cue (old arm) for 15 minutes. This was followed by the recognition phase (day 2) 24 hours later, in which the animals could move freely in the three arms and choose between the 2 choice arms (old arm and novel arm) after being released from the start arm. The timed trials (5 minutes) were video recorded as well as graded by an observer blinded to the conditions for exploration time in each choice arm and the percentages over total exploratory time were calculated. Immunohistochemistry. During postnatal days 30-35, 5-bromo-2’-deoxyuridine (Abcam, Cambridge, UK) was injected intraperitoneally at 50mg/kg daily in animals randomly selected from three groups (n=8 for each group). At postnatal day 35, mice were perfused with 40 ml 4% paraformaldehyde in PBS. Brains were removed and post-fixed at 4ºC overnight, followed by 30% sucrose in PBS at 4°C for 48 hours. The brains were coronally sectioned in 40 μm thickness using a freezing microtome. For each brain, 72 sections containing fimbria were collected in a 24-well tissue culture plate and they were divided into twelve wells in a rotating order (6 sections per well). Seven wells of sections were immunostained for: (1) phospho-S6 and adenomatous polyposis coli; (2) 5-bromo-2’-deoxyuridine and neural/glial antigen 2 ; (3) adenomatous polyposis coli and platelet-derived growth factor receptor alpha; (4) vesicular glutamate transporter 1 and neural/glial antigen 2; (5) myelin basic protein; (6) DNA methyltransferase 1 and Olig2 (oligodendrocyte transcription factor marker); (7) 5-methylcytosine (5-mC) and adenomatous polyposis coli. For 5-bromo-2’-deoxyuridine staining, sections were pretreated with 2N HCl to denature DNA (37°C; 45min), and with 2 × 15min borate buffer (pH 8.5) to neutralize the HCl. After 3×10min PBS washing, sections were blocked in 10% normal goat serum and 0.1% triton X-100 for 60min, followed by primary antibody incubation at 4ºC overnight. Primary antibodies used in this study were: rabbit anti-phospho-S6 (1:1,000; Cell Signaling, Boston, MA, USA), mouse anti-5-bromo-2’-deoxyuridine (1:200; Abcam, Cambridge, UK), rabbit anti-neural/glial antigen 2 (1:200; Millipore, Burlington, MA, USA), mouse anti-adenomatous polyposis coli (1:2,000; Millipore, Burlington, MA, USA), mouse anti-myelin basic protein (1:500; Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti- platelet-derived growth factor receptor alpha (1:500; Lifespan Bio, Seattle, WA, USA), mouse anti- vesicular glutamate transporter 1 (1;200; Abcam, Cambridge, UK), mouse anti-DNA methyltransferase 1 (1:100; Santa Cruz Biotechnology, Dallas, TX, USA), rabbit anti-Olig2 (1:2,000; Abcam, Cambridge, UK), and rabbit anti-5-methylcytosine (1:2,500; Abcam, Cambridge, UK). After 3×10min washes in PBS, sections were incubated with secondary antibodies for 2 hours: Alexa 488 conjugated goat anti-rabbit IgG (1:300; Invitrogen, Eugene, OR, USA) mixed with Cy3 conjugated goat anti-mouse IgG (1:600; Jackson ImmunoResearch Labs, West Grove, PA, USA), or Alexa 488-goat anti-mouse IgG (1:300; Invitrogen, Eugene, OR, USA) mixed with Cy3 conjugated goat anti-rabbit IgG (1:600; Jackson ImmunoResearch labs, West Grove, PA, USA). After 3×10min PBS washes, sections were mounted onto slides, air-dried, and cover-slipped.21 Cell counting and immuno-fluoresce intensity analysis in fimbria The sections were observed and imaged using a Leica 4000 confocal microscope (Wetzlar, Germany). All single- or double- immunolabeled cells within hippocampal fimbria area were counted using ImageJ with cell counter plugin (NIH, Bethesda, MD, USA). The criteria for counting mTOR active oligodendrocytes required a cell to have both phospho-S6+ (in red channel) and adenomatous polyposis coli+ (in green channel) cytoplasm and merged image of double labeled cells appeared yellow color (Fig. 1B). Proliferating oligodendrocyte progenitor cells and 5-methylcytosine+ oligodendrocytes were counted for cells that have 5-bromo-2’-deoxyuridine+ or 5-methylcytosine + nuclei and neural/glial antigen 2+ or adenomatous polyposis coli+ cytoplasm. However, both DNA methyltransferase 1 and Olig2 reactivity were seen in nuclei. Identification of excitatory axon-oligodendrocyte progenitor cell synapses involved vesicular glutamate transporter 1+ terminal boutons closely apposing on the surface of neural/glial antigen 2+ oligodendrocyte progenitor cells. For adenomatous polyposis coli and platelet-derived growth factor receptor alpha double-stained sections, almost no double-labeled cells were seen, which means these two markers label cells in different oligodendrocyte development stages without overlapping. Images containing fimbria were taken at 20x magnification in red (Cy3), green (Alexa 488), and merged channels. All single- (Cy3+ or Alexa488+) and double-labeled cells in fimbria were counted. Images were opened and initialized in ImageJ. The fimbria area was outlined using the ‘‘Freehand’’ tool. “Plugins”, “Analysis”, and ‘‘Cell Counter’’ tools were selected, and each labeled cell inside was clicked, with which each counted cell was marked preventing the same cell from being counted twice. The numbers of counted cells were automatically recorded. The ratio of a specific marker labeled oligodendrocytes (such as yellow-colored phospho-S6+/ adenomatous polyposis coli+ cells over all green adenomatous polyposis coli+ cells in Fig. 1B) was calculated. For each case, numbers from 12 fimbria images (6 sections, both sides) were averaged. There was almost no double staining for adenomatous polyposis coli and platelet-derived growth factor receptor alpha. We the used ratio of adenomatous polyposis coli+ over platelet-derived growth factor receptor alpha+ cells to evaluate the maturation of oligodendrocyte lineage cells. For axon- oligodendrocyte progenitor cells synapse, five neural/glial antigen 2 positive cells from each image (60 cells for each case) were randomly selected and photos were taken in a higher magnification (40x). Every vesicular glutamate transporter 1+ terminal boutons apposing on each selected cell were counted with imageJ and average numbers were calculated. The fluorescence intensity of myelin basic protein immunoreactivity in fimbria were also quantitatively analyzed using ImageJ. Photos of the fimbria area from immunostained sections were taken at 20x magnification. Identical photo exposure was set for all groups. The image was opened with ImageJ and outline of fimbria was drawn with “Freehand” tool. The “set measurements” was selected from the analyze menu and “integrated density” was activated. A region in lateral ventricle was selected as background. The final myelin basic protein intensity of fimbria area equals measured density minus background. Western blotting. Eight animals from each group were quickly perfused with cold saline on day 35. From the medial aspect of the hemisphere, the hippocampus was exposed and separated from brain tissue. Fimbria located in the ventrolateral side of the hippocampus were easily identified by bright white color under dissection microscope, and then removed with fine forceps. Fimbria tissue was lysed in the lysis buffer, homogenized with a bullet bender (Next Advance, Troy, NY, USA), and centrifuged. The supernatant was taken and stored in −80°C. The next day, samples were prepared with 1:1 denaturing sample buffer (Bio-Rad, Hercules, CA, USA), boiled for 5 min, and run on 4-12% Bis-Tris Protein Gels (Invitrogen, Carlsbad, CA, USA) in running buffer (Invitrogen, Carlsbad, CA, USA) with 150 volts for about 1 hour. The proteins were transferred to nitrocellulose blotting membranes (Invitrogen, Carlsbad, CA, USA). Blots were probed with anti-neural/glial antigen 2 (1:200; Millipore, Burlington, MA, USA), anti-NK2 homeobox 2 (1:200; Abcam, Cambridge, UK), anti-myelin basic protein (1:500; Santa Cruz Biotechnology, Dallas, TX, USA), anti-DNA methyltransferase 1 (1:100; Santa Cruz Biotechnology, Dallas, TX, USA) and anti-β-actin antibodies (1:1,000; Cell Signaling Technology, Boston, MA, USA). The membranes with the primary antibodies were stored in 4°C overnight. After incubation in secondary antibodies (1:2,000; Cell Signaling Technology, Boston, MA, USA) for 1 hour, blots were visualized using ECL western blotting substrate kit (Pierce Biotechnology, Waltham, MA, USA). Images were acquired using ChemiDoc imaging system (Bio-Rad, Hercules, CA, USA) and were quantitated with ImageJ (NIH, Bethesda, MD, USA). First, the images were opened using File>Open. The rectangles around all lanes (each lane includes bands for detected marker and β-actin) were drawn by choosing “Rectangular Selection”. Then proceeding to “Analyze>Gels>Plot Lanes”, peaks were generated representing the density of bands, followed by clicking “Straight Line” tool to enclose the peaks and selecting the “Wand” tool to highlight the peaks. After this, Analyze>Gels>Label Peaks was used to get numbers for peak area (band intensity). The ratios of band density of oligodendrocyte lineage markers over β-actin were calculated.21 Electron microscopy. Two animals from each group were perfused with 2% glutaraldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) plus 2% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) in PBS at postnatal day 63 (after behavior tests) and post-fixed at 4°C for 1 week. Brains containing fimbria were dissected into small blocks (2mm × 2mm × 2mm). The blocks were placed into 1% OsO4 (Electron Microscopy Sciences, Hatfield, PA, USA) for 1 hour, stained in 0.5% uranyl acetate (Electron Microscopy Sciences, Hatfield, PA, USA) overnight, and dehydrated in a series of alcohols followed by propylene oxide for 3 hours. After being infiltrated with a 1:1 mixture of propylene oxide and EMBed-812 embedding resin (Electron Microscopy Sciences, Hatfield, PA, USA) for 3 hours, the blocks were embedded with the same resin in the plastic templates at 60ºC overnight.21 Parasagittal semi-thin sections (1 μm) were cut and stained with 1% Toluidine blue for preliminary light microscopy observation. Then, 90 nm ultrathin sections were cut, picked up on Forvar-coated slotted grids, and stained with 0.5% uranyl acetate and 0.5% lead citrate (Electron Microscopy Sciences, Hatfield, PA, USA). Thin sections were observed and imaged with a Hitachi 7600 transmission electron microscope (Chiyoda, Tokyo, Japan). For each case, 10 photos were randomly photographed at 20,000×. The thickness of myelin was quantitatively measured by determining g-ratio, which was calculated by dividing the diameter of the axon by the diameter of the entire myelinated fiber as previously described. ImageJ (NIH, Bethesda, MD, USA) was used by first opening ultrastructural images. The scale was set according to the scale bar in the images by selecting “Analyze>Set Scale”. The “straight line tool” was selected to measure axonal caliber and diameter of myelinated axons. One hundred axons per group (two animals, fifty from each) were randomly selected and quantitatively analyzed (n=100).16 Statistical analysis. The statistics were performed with GraphPad Prism 6 (La Jolla, CA, USA) program. The sample size was based on our previous experience with this design. No a priori statistical power calculation was conducted. Normal distribution was verified using the D’Agostino Pearson test. Data for immunohistochemistry, Western blotting, and electron microscopy were analyzed using one-way analysis of variance (ANOVA). The factor of variable was comparisons among groups (control vs. isoflurane plus vehicle vs. isoflurane plus rapamycin). The behavior tests were analyzed with two-way ANOVA. For this analysis, the second factor was animal’s choice between old vs. novel positions (or arms) and only the values for this variable in each individual group were compared. The Tukey post hoc test was employed for intergroup comparisons. The two-tailed test was set according to convention. The criteria for significant difference was set a priori at p<0.05. In this study, all results were expressed as mean ± standard deviation (SD). The sample size “n” represents the number of animals for each group. Only exception is g-ratio analysis with electron microscopy in which “n” indicates the number of randomly selected axons from two mice per group (n=100). This analysis way is extensively applied for g-ratio study.16 Because all animals survived tests, there were no missing data in this study. No exclusions for outliers were made in this study. In some experiments, the sample size was increased in response to peer review.",mice,['A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study.'],postnatal day 7,"['At postnatal day 7, animals were exposed to isoflurane or room air for 4 hours.']",Y,['The novel object position recognition test and Y-maze test were performed at the last week of the survival period (postnatal days 56-62).'],isoflurane,"['At postnatal day 7, two-thirds of the mice were evenly distributed across littermate groups and were randomly selected for isoflurane exposure.']",none,[],c57bl/6,['A total of 120 (61 male and 59 female) immature C57BL/6 mice (body weight = 4.4±0.9 g. at postnatal day 7) were used in this study.'],True,True,True,True,True,True,[ Passage 16/25 ] 10.1097/ALN.0000000000002904 10.3892/etm.2017.5651,1395.0,Liu,2018,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"PMID: 29434807 PMCID: PMC5776508 DOI: 10.3892/etm.2017.5651 Materials and methods Animals The current study was approved by the Animal Care Committee at Sun Yat-sen University (Guangzhou, China) and performed in accordance with the National Institutes of Health Guide for the Use of Laboratory Animals (27). A total of 24 C57BL/6 male mouse pups, aged 7 days (P7) and weighing 3.5–4.5 g were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China; permission no. SCXK2011-0029). The pups were housed in the same cage as their mothers and were kept under temperature-controlled environmental conditions (26°C) on a 14:10 constant light-dark cycle until P7. The mother mice had free access to food and water. The mouse pups at P7 were exposed to 2.6% sevoflurane (Jiangsu Hengrui Medicine Co., Ltd., Lianyungang, China) for 6 h [~1.0 minimal alveolar concentration (MAC) in P7 mice] in 50% oxygen in a temperature-controlled chamber, following a previously described protocol (n=12) (17). The control mice were exposed to normal air for 6 h under the same condition (n=12). The concentrations of anesthetic gas, oxygen and carbon dioxide in the chamber were measured using a gas analyzer (Datex-Ohmeda; GE Healthcare, Chicago, IL, USA). All animals were sacrificed 2 h following termination of sevoflurane/oxygen exposure and their cortices were used for western blotting (sevoflurane group, n=6; control group, n=6) or TdT-mediated dUTP nick end labeling (TUNEL) with fluorescent dye (sevoflurane group, n=6; control group, n=6). Tissue preparation Half of the mice in each group were used for western blotting and half of the mice for TUNEL studies. For western blotting, mouse pups were anaesthetized by inhaling 3% of sevoflurane until loss of the righting reflex (LORR), which indicated the mice had lost consciousness. Then the mice were sacrificed by decapitation. Cortices were isolated immediately on ice and then stored at −80°C until use. For TUNEL studies, mouse pups were sacrificed by inhaling 3% of sevoflurane until LORR and perfused transcardially with ice-cold normal saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer for 10 min at 4°C. Their brains were post-fixed in the same fixative for 48 h at 4°C, and then paraffin embedded and sectioned into 6-µm-thick sections. As described in previous studies (15,16,25), at least three sections in the same plane of the hippocampus for each animal were selected to detect cells that exhibited positive TUNEL staining; all sections used in TUNEL were 100 µm apart and the sections were according to Figures 129–131 in the Atlas of the Developing Mouse Brain (28). Western blotting Western blotting was performed as previously described (15,16,25). Briefly, the protein concentration in each sample was determined using a BCA protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Sample proteins (40 µg/lane) were separated on 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. Membranes were blocked with 5% bovine serum albumin (Beyotime Institute of Biotechnology, Shanghai, China) in Tris-buffered saline with Tween-20 (TBST) at room temperature for 1 h. Membranes were subsequently incubated at 4°C overnight with the following primary antibodies: Anti-cleaved caspase-3 (cat no. 9664) at 1:2,000 dilution, anti-α-fodrin (which contain SBDP145 and SBDP120 fragments; cat no. 2122) at 1:2,000 dilution, anti-phosphorylated-(p)-JNK (cat no. 4668) at 1:2,000 dilution, anti-JNK (cat no. 9252) at 1:2,000 dilution, anti-p-ERK1/2 (cat no. 4376) at 1:1,000 dilution, anti-ERK1/2 (cat no. 4695) at 1:1,000 dilution, anti-p-P38 (cat no. 4631) at 1:1,000 dilution, anti-P38 (cat no. 9212) at 1:1,000 dilution, anti-p-CREB (cat no. 9198) at 1:1,000 dilution, anti-p-nuclear factor-κB (NF-κB) (cat no. 3033) at 1:1,000 dilution, anti-p-Akt (Ser 473) (cat no. 4060) at 1:2,000 dilution, anti-Akt (cat no. 4685) at 1:5,000 dilution, anti-p-GSK-3β (Ser 9) (cat no. 5558) at 1:2,000 dilution, anti-GSK-3β (cat no. 9315) at 1:2,000 dilution, anti-p-CRMP-2 (Thr 514) (cat no. 9397) at 1:2,000 dilution, anti-CRMP-2 (cat no. 9393) at 1:2,000 dilution and anti-β-actin (cat no. 3700) at 1:2,000 dilution (all Cell Signaling Technology, Inc., Danvers, MA, USA) and anti-p-GSK-3β (Ty 216) (cat no. ab75745; Abcam, Cambridge, USA) at 1:2,000 dilution. The membranes were washed with TBST three times and incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies (goat anti-mouse IgG, cat no. A0216; goat anti-rabbit IgG, cat no. A0208; 1:2,000; Beyotime Institute of Biotechnology) at room temperature for 1 h. The membranes were washed with TBST three times and visualized using an enhanced chemiluminescence detection system (cat no. 34580; Thermo Fisher Scientific, Inc.). Images were scanned using an Image Master II scanner (GE Healthcare) and were analyzed using Image Quant TL software (v2003.03, GE Healthcare). The band signals of p-ERK1/2, p-JNK, p-p38, p-Akt, p-GSK-3 and p-CRMP-2 were normalized to the bands of total ERK1/2, JNK, p38, Akt, GSK-3β and CRMP-2 from the same samples. The band signals of the other proteins were normalized to those of β-actin and the results in each group were normalized to that of the corresponding control group. TUNEL assay TUNEL was performed following a previously described protocol (15,16). A Dead End™ fluorometric TUNEL system (Promega Corporation, Madison, WI, USA) was used and staining following the manufacturer's protocol. Briefly, TUNEL labeling was conducted with a mix of 45 µl equilibration buffer, 5 µl nucleotide mix and 1 µl recombinant terminal deoxynucleotidyl transferase (rTdT) enzyme in a humidified, lucifugal chamber for 1 h at 37°C, and then Hoechst 33258 (H-33258; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was used to stain nuclei for 10 min at room temperature. The sections were protected by anti-Fade solution and mounted on glass coverslips with clear nail polish sealing the edges. Slides were protected from direct light during the experiment. The images of TUNEL positive cells in the retrosplenial cortex (RS), frontal cortex (FC) and parietal association cortex (PtA) areas were acquired by Ti-S inverted fluorescence microscope (Nikon Corporation, Tokyo, Japan) and analyzed using NIS-Elements Basic Research imaging processing and analysis software (version 3.0; Nikon Corporation). The density of TUNEL positive cells in the three cortical regions was calculated by dividing the number of TUNEL positive cells by the area of that brain region. Statistical analysis Sample size was calculated using PASS 11 software (NCSS, LLC, Kaysville, UT, USA) to achieve 80% power at a significance level of P<0.05. All data were determined to be normally distributed using the Shapiro-Wilk test and had no significant heterogeneity of variance as detected by Levene's test. GraphPad Prism 6.0 software (GraphPad Software Inc., La Jolla, CA, USA) was used to conduct all statistical analyses. Data were presented as mean ± standard deviation and were analyzed by Student's t-test. P<0.05 was considered to indicate a statistically significant difference.",mice,"['A total of 24 C57BL/6 male mouse pups, aged 7 days (P7) and weighing 3.5–4.5 g were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China; permission no. SCXK2011-0029).']",postnatal day 7,"['A total of 24 C57BL/6 male mouse pups, aged 7 days (P7) and weighing 3.5–4.5 g were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China; permission no. SCXK2011-0029).']",N,"['The mouse pups at P7 were exposed to 2.6% sevoflurane (Jiangsu Hengrui Medicine Co., Ltd., Lianyungang, China) for 6 h [~1.0 minimal alveolar concentration (MAC) in P7 mice] in 50% oxygen in a temperature-controlled chamber, following a previously described protocol (n=12) (17).']",sevoflurane,"['The mouse pups at P7 were exposed to 2.6% sevoflurane (Jiangsu Hengrui Medicine Co., Ltd., Lianyungang, China) for 6 h [~1.0 minimal alveolar concentration (MAC) in P7 mice] in 50% oxygen in a temperature-controlled chamber, following a previously described protocol (n=12) (17).']",none,[],c57bl/6,"['A total of 24 C57BL/6 male mouse pups, aged 7 days (P7) and weighing 3.5–4.5 g were obtained from Guangdong Medical Laboratory Animal Center (Guangdong, China; permission no. SCXK2011-0029).']",True,True,False,True,True,True,[ Passage 17/25 ] 10.3892/etm.2017.5651 10.3389/fncel.2019.00251,435.0,Li,2019,rats,postnatal day 7,N,ketamine,none,sprague dawley,"PMID: 31263401 PMCID: PMC6585163 DOI: 10.3389/fncel.2019.00251 Materials and Methods Animal Protocols We performed all the experimental protocols according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80–23). The animal procedures were approved by the Animal Care and Use Committee of Xi’an Jiaotong University and designed to minimize the number and suffering of rats used. PND 7 and embryonic day 18–19 Sprague-Dawley rats were obtained from Laboratory Animal Centre of Xi’an Jiaotong University. Morris Water Maze The spatial learning and memory function of rats after ketamine exposure were tested by MWM experiments as described in a previous study (Shen et al., 2013). Specifically, PND 42–47 rats (n = 10 per group) were trained for place trials and spatial probe tests in a large tank (diameter: 150 cm, depth: 60 cm), which was filled to a depth of 32 cm of warm water (maintained around 25 ± 1°C) and divided into four quadrants. A platform (diameter: 12 cm, height: 30 cm) was placed in the center of the third quadrant (the target) and submerged approximately 2 cm beneath the water surface. We poured milk powder into the water to make the water opaque. We conducted the place trials at PND 42–46 with 4 trials daily at the same time point and performed the probe trials on PND 47 after 5 days’ training. The swimming of rats during the tests was recorded by a video tracking system installed above the tank. In place trials, rats were placed into four quadrants (spaced 20 min apart) to swim freely for a maximum of 120 s. If the rats could not find the platform within 120 s, they were allowed to stay on the platform for 20 s to observe the environment by guiding. The time for rats to reach the platform and swimming speed were recorded. In probes trials, the platform was removed and the rats were put into the first quadrant and allowed to swim for 120 s. The times of rats crossing the original platform were recorded. Anesthetic Exposure in vivo and Tissue Preparation The PND 7 rats, weighing 13–18 g, were housed with their mother and maintained at a temperature of 24°C in a 12 h/12 h light/dark cycle with free access to food and water. We assigned the rats randomly into three groups (28 rats from 7 nests in each group, 4 pups per nest): (i) the rats in control group received equal volume of normal saline by intraperitoneal injection as ketamine solution at corresponding time points; (ii) the rats in ketamine group received 40 mg/kg ketamine, diluted in normal saline and administrated by intraperitoneal injection (ketamine, Sigma–Aldrich Inc. St. Louis, MO, United States), the initial injection was considered to be the loading dose, 30% of it was injected at approximately 40 min intervals to maintain the anesthesia for 4 h (Lu et al., 2017); (iii) the rats in the 17β-estradiol group received 17β-estradiol (17β-estradiol, Tocris, Minneapolis, MN, United States; DMSO, Sigma–Aldrich, St Louis, MO, United States) dissolved in dimethylsulfoxide (DMSO) at a concentration of 100 ug/ml, 100 ug/kg 17β-estradiol administered intraperitoneally 8 h, 1 h prior to and 3 h after ketamine’s initial injection (Liu et al., 2007). During anesthesia, all pups were kept on an electric blanket with the temperature set at 36.5 ± 1°C to maintain body temperature and reduce stress. We observed the respiratory rate, skin color, and body movement of rats carefully and tested the voluntary movement by clamping the pup tails. Pulse oxygen saturation (SpO2) was detected by attaching the infant pulse oximetry probes to the rat abdomen. After the anesthesia, the pups received BrdU (50 mg/kg, intraperitoneal injection) every 24 h for 7 consecutive days. On PND 14, the rats were decapitated and the brain tissues of SVZ and SGZ were harvested to detect neurogenesis. At 12 h after anesthesia, rat pups (n = 6 per group, captured randomly) were sacrificed by decapitation. Both the brain tissue from SVZ and SGZ were isolated immediately on ice and the stored at −80°C until use for western blotting. The rats (n = 6 per group, captured randomly) were sacrificed and perfused transcardially with 0.9% saline 7 days after anesthesia, followed by cold 4% paraformaldehyde in PBS. Then the harvested brains were postfixed in 4% paraformaldehyde overnight at 4°C and dehydrated in 30% sucrose solution for 3–4 days, as we described previously (Lu et al., 2017). The brain tissue from bregma +0.2 mm to bregma −6.0 mm was the region of interest, which were cut into 16 μm coronary tissue slices by freezing microtome (SLEE, Germany). These brain slices were collected and used for future immunohistochemistry staining. The rest of the rat pups (n = 10 per group) were bred for behavior study at adulthood. Immunohistochemistry Immunohistochemistry was used to evaluate NSC proliferation in SVZ and SGZ by BrdU staining. Firstly, the brain slices were incubated with 2 N HCl for 30 min to denaturate the DNA at 37°C. After being incubated with 0.1 mol L−1 boric acid (pH 8.5) for 10 min at room temperature followed by three times washing with 0.1 M PBS, the slices were blocked by 2% goat serum and 0.3% Triton X-100 for 2 h at room temperature, then incubated with the mouse monoclonal anti-BrdU antibody (1:200, Abcam, United Kingdom) at 4°C overnight. The next day, after three washings with 0.1 M PBS, the slices were incubated with tetramethyl rhodamine isothiocyanate (TRITC)-conjugated secondary antibodies for 2 h at room temperature. BrdU-positive cells were counted within defined regions of interest in the SVZ and SGZ. In total, the mean numbers of BrdU-positive cells of six brain slices for each rat, spaced approximately 200 μm apart, were examined by the observer blindly. For each slice, five regions were captured by fluorescence microscopy (BX51, Olympus, Tokyo, Japan), and the planar area enclosed by each region was 50 × 50 μm. The edges of the captured regions were defined according to structural details to ensure the fields did not overlap (Zhang et al., 2009). The density of positive cells was presented as the total number of BrdU-positive cells in the SVZ and SGZ. NSC Culture Primary cultured NSCs were obtained from the cortex of rat at embryonic day 18–19 under sterile conditions. Briefly, the forebrain portion was isolated and placed in ice-cold Hank’s solution (without Mg2+ and Ca2+, Gibco, Carlsbad, CA, United States). The tissues were then dissociated and triturated mechanically by a fire-polished Pasteur pipette softly. After centrifugation, the isolated cells were collected and re-suspended in free-serum DMEM/F12 medium (Gibco, Carlsbad, CA, United States) which was supplemented with 2% B27 (Gibco, Carlsbad, CA, United States), 20 ng/ml EGF (Gibco, Carlsbad, CA, United States), 20 ng/ml bFGF (Gibco, Carlsbad, CA, United States), and 100 U/ml penicillin and phytomycin. Cells were cultured for 7 days to form enough neurospheres and then passaged at a density of 2 × 105 cells/ml followed by collection and dissociation as previously described by Reynolds and Weiss (Reynolds et al., 1992). Half of the medium was changed every 3 days. After the second passage, the cells were ready for future experiments. For identification assessment, the cells after passage were seeded onto 100 μg/mL poly-L-lysine-coated coverslips and cultured in differentiating medium that contained 100× N2 supplement, 100× B27 supplement, and 1% fetal bovine serum (FBS, Gibco, Carlsbad, CA, United States) in DMEM/F12 (without b-FGF) for 7 days. Drug Exposure and Neurogenesis Analysis in vitro The cells were assigned to the following groups: control group, ketamine group, and 17β-estradiol group. No drug treatment was added to the control group. NSCs in the ketamine group were exposed to 100 μM ketamine for 24 h. NSCs in the 17β-estradiol group were pretreated with 17β-estradiol (100 nM) for 30 min and then 100 μM of ketamine was added to the culture medium for 24 h. For proliferative analysis, NSCs were seeded on cover slips which were pre-coated with 100 μg/mL poly-L-lysine and incubated with BrdU for the last 4 h. Following being fixed with 4% paraformaldehyde, the cells were stained with BrdU antibody (1:200, Abcam, United Kingdom) and DAPI. As for neuronal differentiation analysis, after being exposed to ketamine with or without 17β-estradiol for 24 h, the cells were seeded on cover slips which were pre-coated with 100 μg/mL poly-L-lysine and incubated with differentiating medium for 7 days, then the cells were harvested for immunohistochemical staining. The cells were labeled with β-tubulin III antibody (1:500; Sigma-Aldrich Inc. St. Louis, MO, United States). Briefly, 5–7 randomly selected fields were captured in each coverslip, and the numbers of β-tubulin III-positive cells were counted (at least 200 cells per test case). Data were collected from three independent experiments. Cell Apoptosis Test We used terminal dUTP nick-end Labeling (TUNEL) assay to detect cell apoptosis. Briefly, after passage, the dissociated cells were exposed to ketamine with or without 17β-estradiol for 24 h. After the treatments, cells were fixed with 4% paraformaldehyde for 15 min. The TUNEL assay was performed according to the instruction of in situ Cell Death Detection Kit (Roche Inc. Roche, Mannheim, Germany). Data were collected from three independent experiments. Western Blot Analysis Brain tissues from the SVZ and SGZ of rats (n = 6 per group) at 12 h after anesthesia and cell cultures at 24 h following drug exposure were subjected to Western blot analyses as described in our previous studies (Lu et al., 2017). Briefly, the tissues were lysed by RIPA lysis buffer with protease and phosphatase inhibitors. The lysates were homogenized with an electric homogenizer and maintained on ice for 15 min. After being centrifuged for 15 min at 14000 rpm at 4°C, the supernatant was aspirated and the resulting lysates were placed in a new tube. We used the BCA protein assay kit to examine the protein concentrations. Bovine serum albumin (BSA) was used as a standard. An equal amount of the resulting lysate was resolved by sodium dodecyl sulfate-polyacrylamide gel and the separated proteins were transferred to polyvinylidene fluoride membranes. After being blocked for 1 h at room temperature, the membranes were then incubated with appropriate dilutions of primary antibodies at 4°C overnight. The used antibodies included anti-caspase-3 (cleaved, 17 KDa, 1:1000, Cell Signal Technology Inc. Beverly, MA, United States), anti-phosophorylated GSK-3β (p-GSK-3β, 1:1000, Cell Signal Technology Inc. Beverly, MA, United States), anti-GSK-3β (1:1000, Cell Signal Technology Inc. Beverly, MA, United States), and anti-β-actin (1:1000, Cell Signal Technology Inc., Beverly, MA, United States). The following day, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit or anti-mouse) for 2 h at room temperature. After being enhanced by chemiluminescence (ECL), the signals were then exposed to X-ray films. Each band in the Western blot represented an independent experiment and at least three independent experiments were conducted. Data were expressed as the ratio to optical density (OD) values of the corresponding controls. The Western blots were quantified as described in our previous study. Statistical Analysis Data obtained from the study were presented as mean ± SEM. Every data point represented a mean for each animal in a single case. SigmaPlot 12.0 was used for all statistical analysis. Data were tested and then confirmed with normality and equal variance criteria. A one-way analysis of variance (ANOVA) following the post hoc Holm-Sidak method was used to analyze the differences among different groups. A two-tailed probability value P < 0.05 was considered statistically significant.",rats,['PND 7 and embryonic day 18–19 Sprague-Dawley rats were obtained from Laboratory Animal Centre of Xi’an Jiaotong University.'],postnatal day 7,"['The PND 7 rats, weighing 13–18 g, were housed with their mother and maintained at a temperature of 24°C in a 12 h/12 h light/dark cycle with free access to food and water.']",Y,"['The spatial learning and memory function of rats after ketamine exposure were tested by MWM experiments as described in a previous study (Shen et al., 2013).']",ketamine,"['the rats in ketamine group received 40 mg/kg ketamine, diluted in normal saline and administrated by intraperitoneal injection (ketamine, Sigma–Aldrich Inc. St. Louis, MO, United States)']",17β-estradiol,"['the rats in the 17β-estradiol group received 17β-estradiol (17β-estradiol, Tocris, Minneapolis, MN, United States; DMSO, Sigma–Aldrich, St Louis, MO, United States) dissolved in dimethylsulfoxide (DMSO) at a concentration of 100 ug/ml, 100 ug/kg 17β-estradiol administered intraperitoneally 8 h, 1 h prior to and 3 h after ketamine’s initial injection (Liu et al., 2007).']",sprague dawley,['PND 7 and embryonic day 18–19 Sprague-Dawley rats were obtained from Laboratory Animal Centre of Xi’an Jiaotong University.'],True,True,False,True,False,True,[ Passage 18/25 ] 10.3389/fncel.2019.00251 10.1016/j.neuropharm.2007.09.005,531.0,Li,2007,rats,gestational day 21,Y,isoflurane,none,sprague dawley,"PMID: 17959201 PMCID: PMC2170454 DOI: 10.1016/j.neuropharm.2007.09.005 2. Materials and methods 2.1. Animals Institute of Animal Care and Use Committee (IACUC) at the University of Pennsylvania approved all experimental procedures and protocols used in this study. All efforts were made to minimize the number of animals used and their suffering. Sprague–Dawley pregnant rats (Charles River Laboratories, Inc Wilmington, MA) were housed in polypropylene cages and the room temperature was maintained at 22 °C, with a 12 h light–dark cycle. Pregnant rats at gestation day 21 (E21) were used for all experiments because it approximately corresponds to mid-gestation in human beings according to the theory of brain growth spurt (Dobbing and Sands, 1979, Jevtovic-Todorovic et al., 2003), and is a common time for most fetal surgeries (18–25 weeks) (Myers et al., 2002). We have designed the following three related studies: (1) pilot study; (2) neurodegeneration study; (3) finally a behavioral study. A pilot study was first conducted to find the highest concentration of isoflurane not accompanied by significant arterial blood gas (ABG) and mean arterial blood pressure (MABP) changes in the mothers. A neurodegeneration study was used to determine the appearance of apoptosis by detection of caspase-3 and TUNEL (terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling) positive cells in the fetal brain (2 and 18 h post-exposure) or neonatal brain at postnatal day 5 (P5). We have chosen the above time points to detect apoptosis in fetal or newborn brains, based on previously published work (Jevtovic-Todorovic et al., 2003). The behavioral study was performed to investigate the effects of fetal exposure to isoflurane on postnatal memory and learning. The pregnant rats used in each study were not reused in the other two studies. Within each study described above, animals were randomly divided into either isoflurane treatment or sham control groups. Pregnant rats in the isoflurane treatment groups inhaled isoflurane for 6 h, while those in the sham control group only inhaled a carrier gas (30% oxygen, balanced with nitrogen) for 6 h under the same experimental conditions. The distribution of pregnant rats and pups in all three groups is illustrated in Fig. 1. 2.2. Anesthetic exposure Isoflurane is used clinically at a wide range of concentrations (about 0.2–3%), depending on the presence of other kinds of anesthetics or narcotics and the type and duration of surgery. As isoflurane neurotoxicity is concentration-dependent (Jevtovic-Todorovic et al., 2003, Wei et al., 2005), a primary goal of this study was to investigate if the highest isoflurane concentration used clinically is harmful to the fetal brain. Due to our concern that the physiological side effects of these drugs would contaminate the interpretation, we conducted a pilot study to determine the highest anesthetic concentration we could use without invasive support (tracheal intubation and ventilation) that would not significantly affect arterial blood gas (ABG) and mean arterial blood pressure (MABP) in the mothers, and then used this concentration in the subsequent formal study. We wanted to avoid tracheal intubation, as it could possibly affect the hemodynamics of pregnant rats and the apoptosis in the fetal brains. In addition, this makes it more difficult to set up the sham control groups without anesthesia. In the pilot study, five pregnant rats were initially anesthetized with 2% isoflurane in 30% oxygen via a snout cone for approximately 1 h and the right femoral artery was catheterized for blood sample collection and measurement of MABP by a pressure transducer/amplifier (AD Instruments Inc., Colorado Springs, CO, USA). The rats were recovered for 2 h and then exposed to isoflurane, starting at 1.5% in a humidified carrier gas of 30% oxygen, balance nitrogen for 6 h in a monitored chamber in hood. The pregnant rats breathed spontaneously without intubation or other support while being warmed using a deltaphase isothermal pad (Braintree Scientific Inc, Braintree, MA, USA). The rectal temperature was maintained (Fisher Scientific, Pittsburgh, PA, USA) at 37 ± 0.5 °C. We monitored isoflurane concentration in the chamber using IR absorbance (Ohmeda 5330, Detex-Ohmeda, Louisville, CO, USA). Arterial blood (0.1 ml) from previously placed femoral arterial catheter was collected and ABG determined every 2 h for up to 6 h by an ABG analyzer (Nova Biomedical, Waltham, MA, USA). Blood glucose was simultaneously measured with a glucometer (ACCU-CHECK Advantage, Roche Diagnostics Corporations, Indianapolis, IN, USA). Control rats were exposed only to humidified 30% O2 balanced by N2 (carrier gas for isoflurane in the treatment group) for 6 h in the same chamber under the same experimental conditions as in the treatment group. Because one pregnant rat treated with 1.5% isoflurane showed obvious acidemia (which reversed after termination of anesthesia), we decreased the isoflurane concentration to 1.3%, and subsequently found no significant changes in the ABG or MABP between the treatment group and the sham control group (Table 1). Therefore, 1.3% isoflurane was used in the ensuing neurodegeneration and behavioral studies. In the behavioral study, pregnant rats were treated with 1.3% isoflurane (n = 8) or carrier gas (sham controls, n = 7) for 6 h. The monitoring was the same as that in the pilot study except that femoral artery catheters were not placed. After the exposures, the animals were returned to their cages and the rat pups were delivered naturally. Four rat pups from each pregnant mother were raised to P28 (Juvenile) and P118 (adult), and then used to determine memory and learning ability with a Morris Water Maze (MWM). Two rat pups from the control group and one from the isoflurane group died unexpectedly, leaving a total of 26 and 31 rat pups in the control and isoflurane treatment groups respectively (Fig. 1). In the fetal brain apoptosis study, pregnant rats were treated with either 1.3% isoflurane or carrier gas for 6 h. At 2 and 18 h after exposure, the rat pups were delivered by C-section under sodium pentobarbital (100 mg/kg, i.p.) anesthesia. The fetal brains were removed and snap frozen for immunohistochemical analysis. Two fetal brains from each pregnant rat were studied. In addition, newborn brains from the rat pups born to the pregnant rats in the behavioral study group (one pup from each pregnant rat, treatment n = 8, control n = 7) were also obtained at postnatal day 5 and prepared for the apoptosis study at P5 (Fig. 1). 2.3. Measurement of isoflurane concentration in the brain tissues To confirm that the isoflurane concentration in the fetal brain correlated with the inhaled concentration and brain concentration in the pregnant mothers, we measured the brain isoflurane concentrations in the fetus and the mother simultaneously in one rat. Briefly, after the pregnant rat was exposed to 1.3% isoflurane for 6 h, the brains of both mother and fetuses were removed and the brain tissue was immediately placed into 4 ml of 0.02 M phosphate buffer (with 1 mM halothane as internal standard) and homogenized in a glass homogenizer. The homogenate was centrifuged (30,000 × g at 4 °C for 30 min), the supernatant collected and then loaded onto C18 cartridge that had been conditioned with 2 ml methanol and washed with water, for solid phase extraction. The final sample was eluted with 0.5 ml solution of methanol and 2-propanol (vol:vol 2:1) with 0.1% trifluoroacetic acid. All procedures were performed in the cool room (4 °C). A 250 μl aliquot of each final elute was injected into a high performance liquid chromatography (HPLC) system, equipped with a refractive index monitor, for quantitation. 2.4. Tissue preparation After treatment with isoflurane or carrier gas alone (control), pregnant rats were anesthetized with sodium pentobarbital intraperitoneally (i.p. 100 mg/kg) at either 2 or 18 h after the end of isoflurane exposure, and the fetuses removed by cesarean section. Likewise, postnatal pups at day 5 (P5) were given the same dose of sodium pentobarbital. All fetuses and pups were then perfused transcardially with ice-cold normal saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The brains were then removed and post-fixed overnight in the same fixative at 4 °C, and cryoprotected in 30% (wt/vol) sucrose in 0.1 M phosphate buffer (pH 7.4) at 4 °C for 24 h. Thereafter, the brains were frozen in isopentane at −20 °C and stored at −80 °C until use. Serial coronal sections (10 μm) were cut in a cryostat (Dolbey–Jamison Optical Company, Inc., Pottstown, PA, USA), mounted on gelatin-coated slides and stored at −80 °C. Coronal brain sections from the same brain corresponding to figure 96 of the rat fetal brain atlas (Paxinos et al., 1990) were chosen for detection of apoptosis by caspase-3 immunohistochemistry and TUNEL staining. In the initial examination of brains sections from the neurodegeneration study, we noticed that apoptosis was most apparent in the hippocampus CA1 region and the retrosplenial cortex, and thus we chose these two brain regions to quantify apoptosis. 2.5. Immunohistochemistry for caspase-3 Caspase-3 positive cells were detected using immunohistochemical methods described previously (Gown and Willingham, 2002). Briefly, brain sections were first incubated in 3% hydrogen peroxide in methanol for 20 min to quench endogenous peroxidase activity. Sections were then incubated with blocking solution containing 10% normal goat serum in 0.1% phosphate buffered saline with 0.1% Tween 20 (PBST) for 1 h at room temperature after washing with 0.1% PBST. The anti-activated caspase-3 primary antibody (1/200, Cell Signaling Technology, Inc Danvers, MA, USA) was then applied in blocking solution and incubated at 4 °C overnight. Tissue sections were biotinylated with goat anti-rabbit antibody (1/200, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) in 0.1% PBST for 40 min, followed by incubation with the avidin–biotinylated peroxidase complex (Vectostain ABC-Kit, Vector Lab, Burlingame, CA, USA) for 40 min. Tissue sections were colorized with diaminobenzidine (DAB, Vector Laboratories, Burlingame, CA, USA) for 8 min and counterstained with modified hematoxylin. Negative control sections were incubated in blocking solution that did not contain primary antibody. Images were acquired and assessed at 200× using IP lab 7.0 software linked to an Olympus IX70 microscope (Olympus Corporation, Japan) equipped with a Cooke SensiCam camera (Cooke Corporation, Romulus, MI, USA). Three brain tissue sections at 10 μm corresponding to the Atlas of the Developing Rat Brain, Figure 96 (Paxinos et al., 1990) were chosen from each animal and analyzed for caspase-3 positive cells in the two brain regions. Two persons blinded to the treatments counted the total number of caspase-3 positive cells in the hippocampal CA1 region and retrosplenial cortex. The areas of entire hippocampal CA1 region and retrosplenial cortex were defined according to the Atlas of the Developing Rat Brain, Figure 96 (Paxinos et al., 1990) and the area measured using IPLab Suite v3.7 imaging processing and analysis software (Biovision Technologies, Exton, PA, http://www.BioVis.com). The density of caspase-3 positive cells in a particular brain region was calculated by dividing the number of caspase-3 positive cells by the area of that brain region. 2.6. TUNEL for DNA fragmentation Three brain sections (10 μm) adjacent to the sections used for caspase-3 detection were used for TUNEL staining using the DeadEnd™ Colorimetric TUNEL System Kit (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocol (Gavrieli et al., 1992). Briefly, sections were permeabilized by proteinase K solution (20 μg/ml) for 8 min, incubated in equilibration buffer for 10 min and the terminal deoxynucleotidyl transferase (TdT) and biotinylated nucleotide were added to the section and incubated in a humidified chamber at 37 °C for 1 h. The reaction was then stopped, followed by incubation with horseradish peroxidase-labeled streptavidin, colorization with DAB/ H2O2 and counterstained with modified hematoxylin. For positive-controls, the tissue sections were first treated with DNase I (1000 U/ml, pH 7.6) for 10 min at room temperature to initiate breakdown of DNA. Incubation of sections in reaction buffer without TdT provided negative controls. Images were acquired, and TUNEL quantitation performed as described above for caspase-3. 2.7. Spatial reference memory and learning performance 2.7.1. Morris Water Maze (MWM) Pregnant rats were allowed to deliver after the isoflurane treatment and 4 pups per litter (2 females and 2 males) were raised. The body weights of the rat pups were recorded at P0, P3, P5, P11, P17 and P28 to determine growth rate. We determined spatial reference memory and learning with the MWM as reported previously with some modification (Jevtovic-Todorovic et al., 2003). A schematic of the experimental paradigm is shown in Fig. 2. A round, fiberglass pool, 150 cm in diameter and 60 cm in height, was filled with water to a height of 1.5 cm above the top of the movable clear 15 cm diameter platform. The pool was located in a room with numerous visual cues (including computers, posters and desks) that remained constant during the studies. Water was kept at 20 °C and opacified with titanium dioxide throughout all training and testing. A video tracking system recorded the swimming motions of animals and the data were analyzed using motion-detection software for the MWM (Actimetrics Software, Evanston, IL, USA). After every trial, each rat was placed in a holding cage, under an infrared heat lamp, before returning to its regular cage. 2.7.2. Cued trials The cued trials were performed only for postnatal rats at P28 and P29 (28 rats in control group and 31 rats in treatment group) to determine whether any non-cognitive performance impairments (e.g. visual impairments and/or swimming difficulties) were present, which might affect performance on the place or probe trials. A white curtain surrounded the pool to prevent confounding visual cues. All rats received 4 trials per day. On each trial, rats were placed in a fixed position in the swimming pool facing the wall and were allowed to swim to a platform with a rod (cue) 20 cm above water level randomly placed in any of the 4 quadrants of the swimming pool. They were allotted 60 s to find the platform upon which they sat for 30 s before being removed from the pool. If a rat did not find the platform within 60 s, the rat was gently guided to the platform and allowed to remain there for 30 s. The time for each rat to reach the cued platform and the swim speed was recorded and the data at P28/29 were analyzed. 2.7.3. Place trials After completion of cued trials, we used the same rats to perform the place trials to determine the rat's ability to learn the spatial relationship between distant cues and the escape platform (submerged, no cue rod), which remained in the same location for all place trials. The starting points were random for each rat. The time to reach the platform was recorded for each trial. The less time it took a rat to reach the platform, the better the learning ability. The juvenile rats (P32) received two blocks of trials (two trials per block, 30 s apart, 60 s maximum for each trial and 2 h rest between blocks) each day for 5 days. The adult rats (P115) received only one block of trials each day for 5 days using a new platform location in an effort to increase task difficulty and improve test sensitivity. 2.7.4. Probe trials Probe trials were conducted after the last place trials for the juveniles (P36) and adults (P119) to evaluate memory retention capabilities. After all rats completed the last place trial on the fifth day, the platform was removed from the water maze and rat was started to swim in the quadrant opposite to one the platform was placed before. The rats were allowed to swim for 60 s during each probe trial and the time the rats spent in each quadrant was recorded. The percentage of the swimming time spent in the target (probe) quadrant where the platform was placed before was calculated. The time spent in the target quadrant compared to other quadrants was an indication of memory retention. 2.7.5. Learning to reach criterion test After the last probe test for the adult rats, the animals performed the learning to reach criterion test during the next 9 days as described previously (Chen et al., 2000). The experimental procedure was similar to the place trial except that the platform location was changed. For each rat, the platform was moved between nine different locations set up by the computer. Each rat received up to eight trials per day. In order to advance to the next platform location, each rat had to reach the criterion of three successive trials with escape latency of 20 s or less. If a rat reached a criterion in 8 or less trials, a new platform location would be selected the following day. The numbers of learned platforms and the number of trials used to reach the criteria were recorded and compared. The number of platforms learned and the number of trials to reach a criterion indicated the learning ability of the rats. 2.8. Statistical analysis To reduce variance from different size litters, we averaged the data from all fetal or postnatal rats from the same mother and considered them as a single sample. Results of weight gain of postnatal rat pups, ABG and MABP of pregnant rats and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Data for immunohistochemistry, TUNEL and other behavioral studies were analyzed using Student’s t-test for comparison of two groups or by ANOVA followed by Fisher's post hoc multiple comparison tests for those with more than two groups. In all experiments, difference were considered statistically significant at P < 0.05.",rats,"['Sprague–Dawley pregnant rats (Charles River Laboratories, Inc Wilmington, MA) were housed in polypropylene cages and the room temperature was maintained at 22 °C, with a 12 h light–dark cycle.']",gestational day 21,"['Pregnant rats at gestation day 21 (E21) were used for all experiments because it approximately corresponds to mid-gestation in human beings according to the theory of brain growth spurt (Dobbing and Sands, 1979, Jevtovic-Todorovic et al., 2003), and is a common time for most fetal surgeries (18–25 weeks) (Myers et al., 2002).']",Y,"['The behavioral study was performed to investigate the effects of fetal exposure to isoflurane on postnatal memory and learning.', 'In the behavioral study, pregnant rats were treated with 1.3% isoflurane (n = 8) or carrier gas (sham controls, n = 7) for 6 h.', 'We determined spatial reference memory and learning with the MWM as reported previously with some modification (Jevtovic-Todorovic et al., 2003).']",isoflurane,"['A pilot study was first conducted to find the highest concentration of isoflurane not accompanied by significant arterial blood gas (ABG) and mean arterial blood pressure (MABP) changes in the mothers.', 'Isoflurane is used clinically at a wide range of concentrations (about 0.2–3%), depending on the presence of other kinds of anesthetics or narcotics and the type and duration of surgery.']",none,[],sprague dawley,"['Sprague–Dawley pregnant rats (Charles River Laboratories, Inc Wilmington, MA) were housed in polypropylene cages and the room temperature was maintained at 22 °C, with a 12 h light–dark cycle.']",True,True,True,True,True,True,[ Passage 19/25 ] 10.1016/j.neuropharm.2007.09.005 10.1371/journal.pone.0160826,935.0,Luo,2016,rats,gestational day 18,N,isoflurane,none,sprague dawley,"PMID: 27536989 PMCID: PMC4990207 DOI: 10.1371/journal.pone.0160826 Experimental Procedures Subjects This protocol was approved by the institutional review board of the First Affiliated Hospital of Nanchang University on the Use of Animals in Research and Teaching. Seventy-day-old female Sprague-Dawley (SD) rats (maternal rats) were supplied by the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011–0030). The learning and memory functions of the parental rats were assessed with the MWM before mating. Female rats were then housed with a male rat (2 female: 1 male rat per cage) for mating. Pregnant rats were identified and divided into the isoflurane exposure 2h (I2), 4h (I4), 8h (I8) and control (C) groups (n = 10 per group) based on the MWM test results to minimize the effects of maternal differences in learning and memory. Anesthesia On E18, gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane (Abbott laboratories Ltd, Worcester, MA, USA) in 100% oxygen for 2, 4 and 8 hours, respectively, while those in the control group received 100% oxygen only. Electrocardiogram, saturation of pulse oximetry, and the respiratory rate of the rats as well as the inhaled concentration of isoflurane were monitored continuously with a Datex-Ohmeda ULT-I analyzer. The tail invasive blood pressure was monitored intermittently. The rectal temperature was maintained at 37 ± 0.5°C with heating pads. The exposure time began from the loss of the righting reflex. The depth and rate of breath was monitored. The exposure durations were selected because different lengths of surgeries are performed [29], and neuronal damage or apoptosis reaches a maximum when general anesthetic exposure time reaches 6 to 8 hours [30]. Our preliminary study showed that maternal exposure to 1.5% isoflurane for 8 hours did not significantly change blood pressure, blood glucose or venous blood gases. The concentration of isoflurane was selected because 1.5% isoflurane in 100% oxygen equals approximately 1 MAC (minimum alveolar concentration) in gestating rats and caused righting reflex loss in our preliminary studies. At the end of the exposure time, all of the rats were exposed to 100% oxygen for 30 min for anesthesia recovery in an anesthesia chamber (40 × 40 × 25 cm). If the cumulative time of SpO2 <95% and/or the systolic blood pressure (SBP) decreased by more than 20% of baseline more than 5 minutes, the dam would be excluded from the study, and another dam was selected to supplement the sample size, thereby excluding the harmful effect of maternal ischemia or hypoxia on offspring rats. Furthermore, to clarify whether exposure to isoflurane caused a significant effect on the internal environment of maternal rats, 10 additional rats at gestational day 18 were selected. Five were exposed to 1.5% isoflurane in 100% oxygen for 8 hours, and the other five were exposed to 100% oxygen for 8 hours. Femoral vein blood was harvested for blood gas analysis. Morris Water Maze (MWM) Test The age of P30 in rat corresponds to preschool age in human [31]. Therefore, we evaluated the spatial learning and memory of the offspring begining on P30 with MWM according previous report [32]. All of the offspring were acclimated to the experimental environment for 30 min before testing. The Morris water maze is a black circular steel pool with a diameter of 150 cm and a height of 60 cm, filled with 24 ± 1°C water to a depth of 20 cm. A circular escape platform of 10 cm in diameter was submerged 1 cm below the water surface in the second quadrant. The swimming trail and speed of the rats was automatically recorded by the SLY-WMS Morris water maze test system (Beijing Sunny Instruments Co. Ltd., Beijing, China). The escape latency (time needed to find the platform), platform crossing times (number of times the rat swam across the submerged platform), and the target quadrant traveling time (time spent in the platform-hidden quadrant) were recorded automatically by the test system. The tests were begun at 9:00 am, one time per day for seven consecutive days. Each offspring rat was put into the pool to search for the platform one time per day for six days (training trial). The starting point was in the third quadrant, the farthest quadrant from the platform-hidden quadrant (the second quadrant in the present study, named the target quadrant). The rats were placed in the water facing the wall of the pool. The same starting point was used for each rat (with a colour marker on the pool wall). The animals were allowed to stay on the platform for 30 seconds when they found the platform. If an animal could not find the platform within 120 s, the escape latency was recorded as 120 s for that trial. The animal was then guided to the platform and allowed to stay on it for 30 s. On the seventh day, the platform was removed. Rats were allowed to swim for 120s to test their memory (platform-crossing times and target quadrant traveling time). The mean of the latencies, platform-crossing times and target quadrant traveling time of the offspring rats born by the same mother rat were calculated as the final results. The offspring born to the same dam in each group were subdivided into the SAHA subgroup (I2S, I4S, I8S and CS subgroup) and the non-SAHA subgroup (I2N, I4N, I8N and CN subgroup) (Fig 1). Two hours before each MWM test, 90 mg/kg SAHA (Selleck Chemicals, Houston, TX, USA), at a concentration of 0.6 μM in dimethyl sulfoxide (DMSO) was given intraperitoneally to the offspring in the SAHA subgroups. An equal volume of DMSO was given to the rats in the non-SAHA subgroups. We selected 2 h before each MWM trial as the administration time point for SAHA based on the fact that 2 h after SAHA administration, the expression of NR2B increased in the hippocampus of Sprague-Dawley rats by enhancing histone acetylation, thus facilitating fear extinction [17].",rats,['Seventy-day-old female Sprague-Dawley (SD) rats (maternal rats) were supplied by the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011–0030).'],gestational day 18,"['On E18, gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane...']",Y,"['The learning and memory functions of the parental rats were assessed with the MWM before mating.', 'Therefore, we evaluated the spatial learning and memory of the offspring begining on P30 with MWM according previous report [32].']",isoflurane,"['gravid rats in the I2, I4 and I8 groups were exposed to 1.5% isoflurane (Abbott laboratories Ltd, Worcester, MA, USA) in 100% oxygen for 2, 4 and 8 hours, respectively']",none,[],sprague dawley,['Seventy-day-old female Sprague-Dawley (SD) rats (maternal rats) were supplied by the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011–0030).'],True,True,False,True,True,True,[ Passage 20/25 ] 10.1371/journal.pone.0160826 10.3892/etm.2018.5950,1455.0,Lu,2018,mice,postnatal day 7,Y,sevoflurane,isoflurane,c57bl/6,"PMID: 29731813 PMCID: PMC5920718 DOI: 10.3892/etm.2018.5950 Materials and methods Animal model All experiments were performed according to the guidelines of the Guide for the Care and Use of Laboratory Animals (22) and were approved by the Institutional Animal Care and Use Committee of Ruijin Hospital Affiliated to Shanghai Jiaotong University (Shanghai, China). A total of 174 C57BL/6 mice (sex ratio, 1:1), were provided by the Model Animal Research Center of Nanjing University (Nanjing, China). They were housed in polypropylene cages (5 or 6 animals per cage) and kept at a 12 h light-dark cycle at room temperature (21–24°C) in 55% humidity for 7 days prior to testing. All animals had free access to food and water. Experimental protocols There were two experimental protocols used based on the sevoflurane concentration used in previous studies (23,24) and 1.3 and 2.6% sevoflurane was used in the present study. For protocol one, 36 mice were randomly assigned into 3 groups with 12 mice in each group: The 2.6 and 1.3% sevoflurane groups and the control group (exposed to 30% O2). Following exposure to sevoflurane or O2 for 6 h, the mice from all 3 groups were sacrificed by intraperitoneal injection of 1.5% pentobarbital sodium (375 mg/kg) (Dalian Idery Biotechnology Co., Ltd., Dalian, China). Hippocampal tissue samples from these mice were collected to measure the expression of caspase-3 using immunohistochemistry, the cleavage of PARP by western blotting, and levels of BDNF, Ntrk2, pro-BDNF, p75NTR and PKB/Akt by ELISA. To evaluate whether hypoxia and respiratory depression occurred in mice during anesthesia, blood gas analysis was performed in another 78 mice, which were randomly assigned into 3 groups: 2.6% sevoflurane (n=36), 1.3% sevoflurane (n=36) and control (n=6) groups. The mice in the 1.3 and 2.6% sevoflurane groups were divided into subgroups based on the length of time they were exposed to sevoflurane (1, 2, 3, 4, 5 and 6 h), with 6 mice in each subgroup. For protocol two, a total of 60 mice were randomly assigned into 3 groups with 20 mice in each group: 2.6, 1.3% sevoflurane and control groups. Following exposure to sevoflurane for 4 weeks, the MWM test was performed in half of the mice in each group. The MWM test was conducted on the remaining mice at week 12. Sevoflurane exposure As stated in a previous study (25), animals were placed in a temperature-controlled (37–38°C) transparent anesthetic chamber that was connected to an anesthetic gas monitor (Datex-Ohmeda S/5, Datex-Ohmeda; GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). For mice in the 1.3 and 2.6% sevoflurane groups, mixed gas (5% sevoflurane and 30% O2) was pre-aerated at a flow rate of 10 l/min until the concentration of sevoflurane reached 5% in the chamber and prior to placing mice in the chamber. Subsequently, these mice were placed into the chamber immediately. Following maintenance of 5% sevoflurane for 30 sec, mice were exposed to 1.3 or 2.6% sevoflurane for the indicated time periods (1–6 h), during which 30% O2 was continually gassed into the chamber at a flow rate of 3 l/min. For mice in the control group, 30% O2 alone was aerated into the chamber for 6 h, with a flow rate of 3 l/min. Blood gas analysis The mice were anesthetized by intraperitoneal injection of 1.5% sodium pentobarbital (50 mg/kg). Then blood samples (0.2 ml) were obtained from the left ventricle by cardiac puncture, after which the mice were sacrificed by intraperitoneal injection of 1.5% sodium pentobarbital (375 mg/kg). The partial pressure of oxygen (PaO2), partial pressure of carbon dioxide (PaCO2) and arterial oxygen saturation (SaO2) were detected using a portable blood gas analyzer (OPTI Medical Systems Inc., Roswell, GA, USA). Tissue sample collection Following sevoflurane exposure, all the mice were sacrificed by intraperitoneal injection of 1.5% pentobarbital sodium (375 mg/kg). The brain was then rapidly removed and the complete hippocampus was dissected. Hippocampal tissue samples were stored at −80°C prior to use in laboratory experiments. Immunohistochemistry The hippocampal tissues were fixed overnight in 4% paraformaldehyde at 4°C. The hippocampal slices (5-µm-thick) were subsequently prepared using a vibrating tissue slicer (Campden Instruments, Ltd., Loughborough, UK). Immunohistochemical staining was performed as previously described (26,27). Briefly, slices were incubated with hydrogen peroxide in methanol to block endogenous peroxidase activity and 10% normal goat serum (cat. no. C0265; Beyotime Institute of Biotechnology, Haimen, China) to reduce non-specific antibody binding prior to immunohistochemical staining. Slices were then incubated with a rabbit anti-caspase-3 antibody (1:200; cat. no. AC033; Beyotime Institute of Biotechnology) at 4°C for 12 h, followed by three washes with PBS. Subsequently, these slices were incubated with secondary antibody (1:4,000; cat. no. A0562; biotinylated goat anti-rabbit antibody; Beyotime Institute of Biotechnology) for 30 min at 37°C. Following washing with PBS, immunoreactivity was visualized using the streptavidin-peroxidase complex and 3,3′-diaminobenzidine (both from Beyotime Institute of Biotechnology). A DM5000B light microscope (Leica Microsystems GmBH, Wetzlar, Germany) was used to observe and collect images. The image analysis software Image Pro Plus version 4.0 (Media Cybernetics, Inc., Rockville, MD, USA) was used to count the number of caspase-3 positive cells. Western blotting The preparation of hippocampus protein extraction was performed as previously described (28,29). Total proteins were extracted with radioimmunoprecipitation assay buffer [1% Triton X-100, 50 mM Tris, (pH 7.4), 150 mM NaCl, M, 0.1% sodium dodecyl sulfate (SDS), 1 mM EDTA and 1% sodium deoxycholate]. Following 13,000 × g centrifugation at 4°C for 20 min, the supernatant was used for western blotting (30,31). The BCA method was used to assay protein concentrations. In brief, hippocampal tissue proteins were separated by 10% SDS polyacrylamide gel electrophoresis and then electrotransferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat powdered milk for 1 h at 25°C. The proteins were probed with rabbit anti-PARP antibodies (1:200, cat. no. AP102) or rat anti-GAPDH antibodies (1:5,000, cat. no. AG019) overnight at 4°C. Then, goat anti-rabbit (1:4,000; cat. no. A0208) or goat anti-rat (1:4,000; cat. no. A0192) horseradish peroxidase-conjugated secondary antibodies were used for 2 h incubation at room temperature (all from Beyotime Institute of Biotechnology). Proteins were visualized by an enhanced chemiluminescence method and analyzed with the Dolphin-Doc Plus Gel Documentation system (version 1141002; Wealtec Corp., Sparks, NV, USA). This procedure was repeated twice for all 3 groups. The relative level of PARP was presented as the band intensity and normalized to the corresponding band intensities of GAPDH. ELISA The method of hippocampus protein extraction mentioned above was also used for ELISA. The levels of BDNF, Ntrk2, pro-BDNF, p75NTR and PKB/Akt were measured using an ELISA kit (cat. no. EK0312; Wuhan Boster Bio-Engineering Co., Ltd., Wuhan, China) according to the manufacturer's instructions. Briefly, protein samples were added to the enzyme label plate and incubated for 1.5 h at 37°C. Next, the biotin-labeled antibodies were added for 1 h incubation at 37°C. Following washing, 30 min incubation with avidin peroxidase complex was conducted at 37°C. Color was developed using 3,3′,5,5′-tetramethylbenzidine following 20 min incubation at 37°C. Following reaction termination with a ‘stop’ solution, the products were measured at 450 nm using a microplate spectrophotometer (Spectramax 190; Molecular Devices LLC, Sunnyvale, CA, USA). All samples were assayed in duplicate and the readings were normalized to the amount of standard protein. Behavioral studies Prior to the MWM test, mice received 2 min of touch for 5 days to avoid the fear to touch during the test. The MWM test was performed as previously described (32,33), with minor modifications. The round pool (diameter, 122 cm) was filled with warm water, made opaque by the addition of titanium dioxide and an escape platform was placed in the northwest quadrant and hidden 0.5 cm below the surface of the water. The MWM test was performed on 7 consecutive days (6 days for training and 1 day for the probe test). Briefly, mice received 4 training sessions daily for 6 consecutive days. Each trial began from a different point and ended when the mice found the platform. The time from beginning to end was considered to be the time of escape latency. If mice could not find the platform within 90 sec, the time of escape latency was recorded as 90 sec. If mice found the platform within 90 sec, the real time from beginning to end was recorded as the time of escape latency. The swim rate during training was also recorded. On day 7, the probe test was performed by allowing the mice to swim for 60 sec in the absence of the platform. During 60 sec swimming, the time spent in the northwest quadrant and platform site crossovers was recorded and analyzed using the MWM JLBehv-FCS video analysis system (DigBehv-MG; Shanghai Jiliang Software Technology Co., Ltd., Shanghai, China). Statistical analysis All data are presented as the mean ± standard error of the mean. A repeated measures analysis of variance (ANOVA) was used to measure the differences within groups over time. Meanwhile, one-way ANOVA was applied for comparison among groups (2.6, 1.3% sevoflurane and control groups), followed by Student Newman-Keuls post hoc test. The correlation between the swim rate and time of escape latency was identified using the Pearson Correlation coefficient. For all the analysis, P<0.05 was used to indicate a statistically significant difference. Additionally, SPSS 11.5 (SPSS, Inc., Chicago, IL, USA) was used for the analysis of the present study.",mice,"['A total of 174 C57BL/6 mice (sex ratio, 1:1), were provided by the Model Animal Research Center of Nanjing University (Nanjing, China).']",postnatal day ,[],Y,"['The MWM test was performed in half of the mice in each group.', 'The MWM test was conducted on the remaining mice at week 12.']",sevoflurane,"['For protocol one, 36 mice were randomly assigned into 3 groups with 12 mice in each group: The 2.6 and 1.3% sevoflurane groups and the control group (exposed to 30% O2).']",none,[],c57bl/6,"['A total of 174 C57BL/6 mice (sex ratio, 1:1), were provided by the Model Animal Research Center of Nanjing University (Nanjing, China).']",True,False,True,True,False,True,[ Passage 21/25 ] 10.3892/etm.2018.5950 10.4149/BLL_2017_017,282.0,Ozer,2017,rats,postnatal day 7,N,sevoflurane,none,wistar-albino,"PMID: 28814087 DOI: 10.4149/BLL_2017_017 Materials and methods The preclinical animal study was conducted at the Firat University Experimental Research Centre in December 2012. After receiving approval from the institutional Animal Experimentation Ethics Committee, seven-day-old male Wistar-Albino rats were obtained from the Experimental Research Centre. The Helsinki Universal Declaration of Animal Rights was followed at every stage of the study. The rats were kept in the rooms with ambient temperature of 22–24 °C and with 12/12 hour day/night cycle. Except for the time it took for the experimental tests, the subjects were kept in the same cage with their mothers until postnatal day 21 (PN21). After the 21st day, the rats were put in separate cages and fed with standard rat chow and tap water. Using permuted block randomisation methods, the subjects were divided into the two groups: Group C acted as the control and did not receive any anaesthesia, and in Group S, anaesthesia was achieved with 2.3 % sevofl urane in 50 % oxygen (O2 )-air mixture. The concentration of sevofl urane was adjusted according to the tail test. The tail test was applied every 15 minutes. The middle 1/3 of the tail was clamped, and if there was response, sevofl urane concentration was increased 15 %. All subjects were put in a plastic, transparent anaesthesia chamber that was connected to the anaesthesia device and was ventilated with 4 L/min fl ow and 50 % O2-air mixture. Immediately after the six-hour administration of anaesthesia, oxygen arterial blood gases were evaluated in 3 subjects from each group. At the end of the application period, half of the subjects were sacrifi ced to determine the early effects of sevofl urane (Group SE and Group CE), while the rest of the subjects were sacrifi ced 6 weeks after the application to determine the late effects of sevofl urane (Group SL and Group CL). In addition, the levels of serum BDNF, brain tissue BDNF and caspase 3 were evaluated for all subjects. The anaesthesia chamber was heated from the outside during the entire experiment to prevent hypothermia. Glucose and saline were administered intradermally to prevent hypoglycaemia and hypovolaemia. Subjects that experienced discolouration of the skin (cyanosis) or a decrease in respiratory rate that did not improve with stimuli, were excluded from the study. The study’s primary outcomes were serum BDNF levels, cortex and hippocampal BDNF levels and neurocognitive status. Secondary outcomes were cortex and hippocampal caspase 3 levels. Blood samples were taken at decapitation phase into serum separator tube to evaluate serum BDNF. Blood samples were centrifuged at 1000 x g for 15 minute and stored at –20 °C. Serum BDNF levels were measured by the enzyme-linked immunosorbent assay (ELISA) method (EK0308, Boster Biological Technology, Ltd.). Brain tissue samples were kept for 24 hours in 10 % formaldehyde prepared with phosphate buffer saline. Brain tissue samples were taken for routine tissue processing for immunohistochemical (IHC) examination procedure following the sagittal reduction process. Brain tissue was divided at the midline on the sagittal plane. The BDNF levels (Abcam, ab108319, Cambridge, UK) and caspase 3 levels (Abcam, ab13847, Cambridge, UK) were assessed with IHC in brain hemispheres (0 – no staining, 1 – mild, 2 – moderate, 3 – severe). The behaviour, anxiety states and spatial learning abilities of the subjects during the long-term period (6 weeks later) were evaluated by using the plus arm test and the Morris water test, respectively. Open arm avoidance index was calculated according to the formula 100 – ((% of the time spent in the open arms + % of the entrance to the open arms)/2), while the total locomotor activity was calculated based on line crossings + rearing. Swimming tests were done 4 times a day for a period of 4 days. The test was repeated 2 days after training and the time it took to reach the platform (latency) and the time spent in the platform quadrant after the platform was removed were recorded. The subjects that completed the swimming test were put back into their heated cages. Those conducting the experiment knew, which group of subjects they were dealing with, but those evaluating biochemical, IHC and neurocognitive tests did not know, which samples and subjects belonged to which group. SPSS 15 was used for a statistical evaluation. Nonparametric methods were used for all variables because the sample size was small. Kruskal–Wallis test was used for one-way analysis of variance (ANOVA) of nonparametric data, therefore median values were calculated instead of mean. When it was determined not to the equal of medians with Kruskal–Wallis test, Mann–Whitney U test was used for post-hoc multiple comparisons. The escape latency within the group was evaluated by Wilcoxon test. The correlation between parameters was assessed by Spearman correlation test and p < 0.05 was considered signifi cant.",rats,"['After receiving approval from the institutional Animal Experimentation Ethics Committee, seven-day-old male Wistar-Albino rats were obtained from the Experimental Research Centre.']",postnatal day 7,"['After receiving approval from the institutional Animal Experimentation Ethics Committee, seven-day-old male Wistar-Albino rats were obtained from the Experimental Research Centre.']",Y,"['The behaviour, anxiety states and spatial learning abilities of the subjects during the long-term period (6 weeks later) were evaluated by using the plus arm test and the Morris water test, respectively.']",sevoflurane,"['and in Group S, anaesthesia was achieved with 2.3 % sevoflurane in 50 % oxygen (O2 )-air mixture.']",none,[],wistar-albino,"['After receiving approval from the institutional Animal Experimentation Ethics Committee, seven-day-old male Wistar-Albino rats were obtained from the Experimental Research Centre.']",True,True,False,True,True,True,[ Passage 22/25 ] 10.4149/BLL_2017_017 10.1097/ALN.0b013e3181974fa2,722.0,Satomoto,2009,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"PMID: 19212262 DOI: 10.1097/ALN.0b013e3181974fa2 Materials and Methods The experiments were approved by the Committee for Animal Research at National Defense Medical College (Tokorozawa, Saitama, Japan). Pregnant C57BL/6 mice were purchased from SLC (SLC Japan Inc., Shizuoka, Japan). The animals were illuminated with a 12-h light–dark cycle (light from 07:00 to 19:00), and room temperature was maintained at 21°± 1°C. At the age of 3 weeks, the mice were weaned and housed in groups of 4 animals in a room. Mice had ad libitum access to water and food. Previous studies reported that there is litter variability in the rate of apoptosis that occurs spontaneously in neonate mice.11Therefore, a balanced number of control and experimental animals were drawn from the same litters, so that each experimental condition had its own group of littermate controls. Only the male offspring were used in this study. A total of 51 litters, 101 control and 103 treated pups, were used in this study. Anesthesia Treatment Postnatal day 6 (P6) male mice were placed in an acrylic box and exposed to 3% sevoflurane or no anesthetics for 6 h. The total gas flow was 2 l/min, using air as a carrier. During anesthetic exposure, the mice were kept warm on a plate heated to 38°C. Control and experimental animals were under the same treatment and environment except that the control animals were exposed only to air. Arterial Blood Gas Analysis Arterial blood analysis was performed essentially as described previously.5,12Briefly, the pups underwent a quick arterial blood sampling from the left cardiac ventricle, and the samples were transferred into heparinized glass capillary tubes. A single sample (55 μl) was analyzed immediately after blood collection by blood gas analyzer (ABL800; Radiometer, Copenhagen, Denmark). Samples were obtained immediately after removal from the maternal cage (0 h) or at the end of anesthesia (6 h). At the time of blood sampling, the experiments were terminated by decapitation. Laser Color Doppler Cerebral blood flow (CBF) was measured by a laser-Doppler blood perfusion imager (Peri Scan PIM II; Perimed, Stockholm, Sweden). Mice were taken out of the chamber before and every hour during anesthetic treatment and were placed face down on the floor while being continuously exposed to sevoflurane via a tube with its opening positioned at the nose of the animals. Their head skins were peeled for scanning CBF, and data were captured using appropriate software (LDPIwin version 2.6; Lisca, Linköping, Sweden). The perfusion response is presented in arbitrary perfusion units. Because the arbitrary perfusion units values are not absolute blood flow, the magnitude of the difference in perfusion was calculated as the ratio between the area of maximum peak perfusion and areas of baseline perfusion. Arbitrary perfusion unit values were compared between anesthetized animals and those with mock anesthesia at baseline and at 1-h intervals for 6 h. Histopathologic Studies Animals from both treatment and control groups were perfused transcardially with 0.1 m phosphate buffer containing 4% paraformaldehyde immediately after 6 h of sevoflurane anesthesia, and then the brains were exposed to immersion fixation for 24 h at 4°C. The brains were histologically analyzed using paraffin-embedded sections (5 μm thick). For immunohistochemistry, anti–active caspase-3 antiserum (D175; Cell Signaling Technology, Beverly, MA) was used at dilutions of 1:400 in antibody diluent (Dako, Glostrup, Denmark). Before to use, sections were dewaxed in xylene and hydrated using a graded series of ethanol. Antigenic retrieval was performed by immersing mounted tissue sections in 0.01 mm sodium citrate (pH 6.0) and heating in an autoclave (121°C) for 5 min. Deparaffinized sections were blocked for endogenous peroxidase activity as described previously,13followed by blocking with a nonspecific staining blocking reagent (Dako) for 1 h to reduce background staining. The sections were then incubated overnight in a humidified chamber at 4°C. Subsequently, peroxidase-conjugated secondary antibody (DAKO En Vision + system; Dako) and 3,3-diaminobenzine-tetrachloride (DAB; Vector Laboratories, Burlingame, CA) were used according to the manufacturer’s instructions. Finally, the sections were counterstained with Nissl. Activated caspase-3–positive cells were counted by the investigator who was blinded to the treatment conditions. Terminal deoxynucleotidyl transferase–mediated deoxyuridine 5-triphosphate–biotin nick end labeling staining was performed using an in situ apoptosis detection kit (ApopTag fluorescein; CHEMICON, Temecula, CA) according to the manufacturer’s protocol. Sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). Fluorescein was histochemically examined with a fluorescent microscope (TE-2000E; Nikon, Tokyo, Japan) equipped with interlined charge-coupled device camera (DS-U1; Nikon). Preparation of Protein Extracts Mice forebrain was quickly removed and were homogenized in four volumes of 20 mm Tris-HCl, pH 7.4, 2 mm EDTA, protease inhibitor cocktail (Complete, Roche Diagnostics, Penzberg, Germany), and phosphatase inhibitors (20 mm glycerophosphate, 1 mm Na3VO4, 2 mm NaF). After homogenization, a portion of each sample was immediately frozen at −80°C. The rest of the homogenate was centrifuged at 15,000g for 30 min at 4°C. The supernatant solutions were separated and stored at −80°C until use. The amount of protein in each sample was measured using a protein assay kit (BCA; Pierce, Rockford, IL). Western Blot Analysis The homogenate proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis. The proteins were transferred onto polyvinylidene fluoride membranes (Immobilon-P; Millipore, Bedford, MA). The blots were immunoreacted with anti–cleaved poly(adenosine diphosphate–ribose) polymerase (PARP; 1:1,000, rabbit polyclonal, Asp214; Cell Signaling) or anti–β-actin (1:5,000, mouse monoclonal, AC-15; Sigma, St. Louis, MO) antibodies, and the protein bands were visualized by chemiluminescence detection system (SuperSignal West Pico; Pierce). Behavioral Studies As described previously for CBF and histopathologic studies, some sets of mice for behavioral studies were exposed to 3% or 0% sevoflurane for 6 h at P6. They were allowed to mature, and at the appropriate ages, sevoflurane and control mice underwent behavioral tests, namely, open-field, elevated plus-maze, Y-maze, fear conditioning, social recognition, social interaction, olfactory, and novelty tests. The movement of each mouse was monitored and analyzed using a computer-operated video tracking system (SMART, Barcelona, Spain). In the tasks using apparatus with arms, arm entry was counted when all four legs of the animal entered each arm. The apparatus was cleaned after each trial. All apparatus used in this study were made by O’Hara & Co., Ltd. (Tokyo, Japan). Open-field Test. Emotional responses to a novel environment were measured by an open-field test using 8-week-old mice, by a previously described method.14Activity was measured as the total distance traveled (meters) in 10 min. Elevated Plus-maze Test. The elevated plus-maze test was performed as previously described.14The elevated plus maze consisted of two open arms (25 × 5 cm) and two enclosed arms being elevated to a height of 50 cm above the floor. Normally, mice prefer a closed environment to an open area. Mouse behavior was recorded during a 10-min test period. The percentage of time spent in the open arms was used as an index of anxiety-like behavior. Mice used for the test were aged 8 weeks. Spontaneous Alternation in the Y-maze Test. This study was performed as previously described.14This study allowed us to assess spatial working memory. The symmetrical Y maze made of acrylic consists of three arms (25 × 5 cm) separated by 120° with 15-cm-high transparent walls. Each mouse was placed in the center of the Y maze, and the mouse was allowed to freely explore the maze for 8 min. The sequence and the total number of arms entered were recorded. The percentage of alternation is the number of triads containing entries into all three arms divided by the maximum possible number of alternations (total number of arm entries minus 2) × 100. Mice used for the test were aged 11 weeks. The motion of the animals was manually recorded. Fear Conditioning Test. This is a simple and sensitive test of hippocampal-dependent and hippocampal-independent learning as previously described.14Briefly, the conditioning trial for contextual and cued fear conditioning consisted of a 5-min exploration period followed by three conditioned stimulus–unconditioned stimulus pairings separated by 1 min each: unconditioned stimulus, 1 mA foot shock intensity, 1 s duration; conditioned stimulus, 80 db white noise, 20 s duration; unconditioned stimulus was delivered during the last seconds of conditioned stimulus presentation. A contextual test was performed in the conditioning chamber for 5 min in the absence of white noise at 24 h after conditioning. A cued test (for the same set of mice) was performed by presentation of a cue (80 db white noise, 3 min duration) in alternative context with distinct visual and tactile cues. The rate of freezing response (absence of movement in any parts of the body during 1 s) was scored automatically and used to measure fear memory. The test was performed on mice of two different age groups: 8 weeks or between 14 and 17 weeks. Social Recognition Test. Social recognition test was conducted as described previously.15We transferred 18-week-old mice from group to individual housing for 7 days before testing to permit establishment of a home cage territory. Testing began when a stimulus female mouse was introduced into the home cage of each male mouse for 1-min confrontation. At the end of the 1-min trial, the stimulus animal was removed and returned to an individual cage. This sequence was repeated for four trials with 10-min intertrial intervals, and each stimulus was introduced to the same male resident in all four trials. In a fifth trial, another stimulus mouse was introduced to a resident male mouse. Social Interaction Test. Caged social interaction for social versus inanimate targets was performed in an open field using two cylinder cages allowing olfactory and minimal tactile interaction as described previously.16The cylinder cages were 10 cm in height, with a bottom diameter of 9 cm and bars spaced 7 mm apart. Olfactory Test. Fifteen-week-old mice were habituated to the flavor of a novel food (blueberry cheese) for 3 days before testing. On the fourth day, after 24 h of food deprivation, a piece of blueberry cheese was buried under 2 cm of bedding in a clean cage. The mice were placed in the cage, and the time required to find the food was measured manually. Novelty Test. Activity was measured as the total duration of interaction with an inanimate novel object (red tube) in 10 min. The same set of mice underwent social recognition (at 19 weeks of age), social interaction (at 14 weeks of age), olfactory (at 15 weeks of age), and novelty (at 15 weeks of age) tests. In other analyses, each test was conducted with a new set of animals. Statistical Analysis Statistical analysis was performed using Statview software (SAS, Cary, NC). Comparisons of the means of two groups were performed using the Student t test. In the Y-maze task, comparisons of group performance relative to random levels were performed using the one-sample t test. Data of the social recognition task were analyzed by repeated-measures two-way analysis of variance. Values are presented as mean ± SEM.",mice,"['Pregnant C57BL/6 mice were purchased from SLC (SLC Japan Inc., Shizuoka, Japan).']",postnatal day 6,['Postnatal day 6 (P6) male mice were placed in an acrylic box and exposed to 3% sevoflurane or no anesthetics for 6 h.'],Y,"['Behavioral Studies', 'As described previously for CBF and histopathologic studies, some sets of mice for behavioral studies were exposed to 3% or 0% sevoflurane for 6 h at P6.', 'Open-field Test.', 'Elevated Plus-maze Test.', 'Spontaneous Alternation in the Y-maze Test.', 'Fear Conditioning Test.', 'Social Recognition Test.', 'Social Interaction Test.', 'Olfactory Test.', 'Novelty Test.']",sevoflurane,['Postnatal day 6 (P6) male mice were placed in an acrylic box and exposed to 3% sevoflurane or no anesthetics for 6 h.'],none,[],c57bl/6,"['Pregnant C57BL/6 mice were purchased from SLC (SLC Japan Inc., Shizuoka, Japan).']",True,True,True,True,True,True,[ Passage 23/25 ] 10.1097/ALN.0b013e3181974fa2 10.3389/fncel.2017.00373,243.0,Xiao,2017,mice,postnatal day 7,N,propofol,none,c57bl/6,"PMID: 29249940 PMCID: PMC5715384 DOI: 10.3389/fncel.2017.00373 Materials and Methods Animals Male and female C57/BL6 mice were provided by the Third Military Medical University and housed under a 12 h light/dark cycle in a temperature-controlled room with free access to food and water. All the experimental procedures were performed in accordance with the guidelines for laboratory animal care and use and were approved by Third Military Medical University. Each litter was kept together with its mother throughout the experiment, except for the brief intervals of separation required for the daily injections. At least five mice in each group were analyzed for immunofluorescence staining and three mice for western blot. Drug Treatment The day of birth was designated postnatal day 0 (P0). On P7, pups received a vehicle or propofol injection intraperitoneally (i.p.) at a subanesthetic dose of 30 or 60 mg/kg (Cattano et al., 2008; Yang B. et al., 2014), according to our previous study (Huang et al., 2016). The same volume of intralipid was administered i.p. as a vehicle control for propofol. All the neonatal mice were grouped randomly with a random number table base for similar body weight. To explore the morphological changes in the Purkinje cells, Bergmann glia and granule neuron, pups were sacrificed 24 h (P8) after drug treatment. To evaluate whether propofol affected the radial migration of the granule neurons, a single-dose BrdU injection (50 mg/kg i.p., dissolved in saline) was administered to the pups at P8, which was 1 day after injection with propofol or vehicle. Pups were sacrificed 2 days after the BrdU injection (P10). To maintain a mouse body temperature of 37°C, the pups were primitively anesthetized in their home cage and then transferred to a Thermocare® ICS therapy warmer unit (Thermocare, Incline Village, NV, USA) after being sedated to keep warm in all the experiments. Meanwhile, mouse normal skin color and respiration were observed. Immunofluorescence The dissected cerebella were soaked in 4% paraformaldehyde for 24 h. For cryosections, the tissues (P8) were embedded and sectioned in the sagittal plane at 30 μm. The remaining tissues (P8) and tissues collected on P10 were embedded in paraffin and sagittal sections (5 μm thickness) were collected. Cryosections were used for all the immunofluorescence staining for P8 and paraffin sections were used for Hematoxylin-eosin (HE) staining and BrdU immunofluorescence staining. The sections were pretreated with 3% bovine serum albumin (BSA) (37°C, 1 h) to block non-specific binding and 0.3% Triton X-100 (37°C, 30 min) to increase permeability. Then, the sections were incubated with the following primary antibodies in 1% BSA (4°C, 18 h): (1) mouse anti-calbindin D-28K (CB) (1:1000, Swant, Bellinzona, Switzerland); (2) rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (1:200, Merck Millipore, Darmstadt, Germany); (3) rabbit polyclonal anti-brain lipid binding protein (BLBP) (1:400, Merck Millipore, Darmstadt, Germany); and (4) mouse anti-neuronal nuclei (NeuN) (1:200, Merck Millipore, Darmstadt, Germany). One percent BSA served as the negative control. After three washing steps with phosphate-buffered saline (PBS, pH 7.4), the sections were incubated with the following secondary antibodies in PBS (room temperature (RT), 3 h): (1) Alexa Fluor 488-conjugated anti-mouse IgG (1:400, Jackson ImmunoResearch, West Grove, PA, USA) for CB and NeuN staining; and (2) cy3-conjugated anti-rabbit IgG (1:400, Jackson ImmunoResearch, West Grove, PA, USA) for BLBP and GFAP staining. All the sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St. Louis, MO, USA) and then mounted in Vectashield (Vector Laboratories, Burlingame, CA, USA). For BrdU staining, the paraffin sections were deparaffinized in xylene, rehydrated in graded alcohol and processed for antigen retrieval by boiling in citrate buffer (pH 6.0) for 5 min. After incubation in 2 M HCl (37°C, 30 min) and 0.3% Triton X-100 (37°C, 30 min), the sections were exposed to mouse anti-BrdU IgG (37°C for 2 h and then RT for 22 h) (1:600, BD Pharmingen™, Palo Alto, CA, USA) in 1% BSA, followed by the cy3-conjugated anti-mouse IgG secondary antibody (RT, 3 h) (1:400, Jackson ImmunoResearch, West Grove, PA, USA) and DAPI counterstaining. Fluorescence micrographs of the whole parasagittal cerebellar slices were acquired under a Zeiss (Oberkochen, Germany) Axiovert microscope equipped with a Zeiss AxioCam digital color camera connected to the Zeiss Axiovision 3.0 system. The pictures of the Purkinje dendrite and Bergmann fiber contact points were taken with a TCS-SP8 (Leica, Germany) laser scanning confocal microscope connected to a LAS AF Lite system. A z-stack of images, consisting of 6 image planes taken at 1 μm interval was obtained (for a total stack depth of 5 μm). The 5 μm z-stack was taken from the middle of the section to minimize the potential artificial bias. Western Blot Cerebella were harvested on P8 and then isolated and homogenized in ice-cold RIPA Lysis buffer (Beyotime, Shanghai, China). After centrifuging the lysates (15,000× g, 5 min at 4°C), the protein concentration was calculated using the Bicinchoninic Acid Kit (Beyotime, Shanghai, China). Then, 50 μg of protein from each sample was separated by 10% SDS-polyacrylamide electrophoresis (120 min 80 V) and then transferred to a nitrocellulose (NC) membrane (90 min at 210 mA). The membranes were incubated in 5% fat-free milk in Tris-buffered saline containing 0.1% Tween 20 (3 h at RT). Membranes were then incubated with the following primary antibodies (4°C, overnight): (1) hamster monoclonal anti-Notch1 (1:500, Santa Cruz Biotechnology, Santa Cruz, CA, USA); (2) rabbit polyclonal anti-Jagged1 (1:500, Santa Cruz Biotechnology, USA); (3) mouse anti-β-actin (1:1000, Cell Cwbio, Beijing, China); and (4) rabbit anti-GAPDH (1:1000, Cell Cwbio, China), followed by the following peroxidase-conjugated secondary antibodies (RT, 2 h): (1) goat anti-mouse IgG (1:1000, Santa Cruz Biotechnology, USA); (2) goat anti-rabbit IgG (1:1000, Santa Cruz Biotechnology, USA); and (3) goat anti-Syrian hamster IgG (1:1000, Santa Cruz Biotechnology, USA). All the bands were exposed to X-ray films (Kodak, Rochester, NY, USA), detected using an enhanced chemiluminescence detection kit (Pierce, Rockford, IL, USA), and analyzed with the Gel-Pro analyzer (Quantity One 4.0; Bio-Rad Laboratories, Hercules, CA, USA). Quantification of Jagged1 and Notch1 were normalized to the internal reference protein β-actin or GAPDH, and then normalized to the control values. Quantification The quantification was obtained from regional analysis of lobe IX. All the sections were taken from similar medial-lateral position within the cerebellum, and each count area was chosen from the same field by the middle of the lobe IX. Calbindin-positive cells were analyzed along the long axis for 500 μm in the middle, and the dendrite length of Purkinje cells was evaluated by measuring the primary dendrite from the soma up to the surface of the ML (three Purkinje dendrites were measured per picture). Number of the NeuN-positive granule neurons were analyzed in the center region of the IGL in lobe IX along the long axis (unit area 2000 μm2). The number of BLBP- and GFAP-positive Bergmann fibers was counted from a 100-μm length in the middle area of lobe IX according to our previous methods (Yamada et al., 2000; Eiraku et al., 2005; Yang Y. et al., 2014). To analyze the astrocytes in the deep white matter, we compared the intensity of the GFAP-positive cells and fibers. Both the background integrated optical density (IOD) and surveyed area (same center area of the white matter from each group) were acquired, and the relative optical density (ROD) was calculated by subtracting the background from the IOD of the positive staining (Bao et al., 2017). Contact points between the calbindin-positive Purkinje cells and GFAP-positive Bergmann fibers were defined as where the tips of growing Purkinje cell dendrites were aligned parallel and attached directly to the rod-like domain of Bergmann fibers, entering the base of the overlying EGL, as previously reported (Yamada et al., 2000; Yamada and Watanabe, 2002; Lordkipanidze and Dunaevsky, 2005). Points were counted per image (212.5-μm length) at the interface between the EGL and ML. Only the yellow dots at the end of the dendrites in the direction of the Bergmann fiber were included, while the crossed ones were excluded in case of false positive. For quantifying granule neuron migration, BrdU-labeled cells were counted in a rectangular box (200 μm width and about 100 cells were counted) extending from the pial surface to the end of the IGL; this value was expressed as a percentage of the total number of BrdU-labeled cells. At least five sections were analyzed in each mouse and five mice from each group. All the quantitative statistics were performed blind to the experimental treatment. Statistical Analysis All the data were presented as the mean ± standard deviation and analyzed using one-way analysis of variance (ANOVA) followed by Fisher’s protected least- significant difference post hoc test or a least-significant difference multiple-comparison. The differences were statistically significant when the P value was less than 0.05. Statistical analysis was performed using the SPSS 19.0 software (SPSS Inc., Chicago, IL, USA).",mice,['Male and female C57/BL6 mice were provided by the Third Military Medical University and housed under a 12 h light/dark cycle in a temperature-controlled room with free access to food and water.'],postnatal day 7,"['On P7, pups received a vehicle or propofol injection intraperitoneally (i.p.) at a subanesthetic dose of 30 or 60 mg/kg.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",propofol,"['On P7, pups received a vehicle or propofol injection intraperitoneally (i.p.) at a subanesthetic dose of 30 or 60 mg/kg.']",none,[],c57bl/6,['Male and female C57/BL6 mice were provided by the Third Military Medical University and housed under a 12 h light/dark cycle in a temperature-controlled room with free access to food and water.'],True,True,True,True,True,True,[ Passage 24/25 ] 10.3389/fncel.2017.00373 10.1097/ALN.0b013e3182834d5d,268.0,Zheng,2013,mice,gestational day 14,Y,sevoflurane,none,c57bl/6,"PMID: 23314109 PMCID: PMC3580035 DOI: 10.1097/ALN.0b013e3182834d5d Materials and Methods Mice Anesthesia The protocol was approved by the Massachusetts General Hospital Standing Committee (Boston, Massachusetts) on the Use of Animals in Research and Teaching. Three-month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice. The pregnant mice were identified and then housed individually. The offspring mice were weaned 21 days after birth. Animals were kept in a temperature-controlled (22°–23°C) room under a 12-h light/dark period (light on at 7:00 AM); standard mouse chow and water were available ad libitum . At gestational day (G) 14, the pregnant mice were assigned randomly to an anesthesia group or a control group. Mice randomized to the anesthesia group received 2.5% sevoflurane in 100% oxygen for 2 h in an anesthetizing chamber. The control group received 100% oxygen at an identical flow rate for 2 h in an identical chamber as described in our previous studies.9The mice breathed spontaneously, and concentrations of anesthetic and oxygen were measured continuously (Datex-Ohmeda Inc., Tewksbury, MA). The temperature of the anesthetizing chamber was controlled to maintain rectal temperature of the animals at 37° ± 0.5°C. Mean arterial blood pressure was not measured in these mice because the same sevoflurane anesthesia was shown not to alter the values of blood pressure and blood gas in our previous studies.9Anesthesia was terminated by discontinuing sevoflurane and placing the animals in a chamber containing 100% oxygen until 20 min after return of the righting reflex. The anesthesia with 2.5% sevoflurane (approximately 1.1 minimum alveolar concentration) for 2 h in mice was used to demonstrate whether clinically relevant sevoflurane anesthesia in pregnant mice, which had been shown to induce neurotoxicity in adult mice,9could also induce neurotoxicity in fetal mice and then neurobehavioral deficits in offspring mice. Twenty pregnant mice were included in the experiments, which generated a sufficient number of fetal mice for the biochemistry studies (n = 6 per arm), and offspring mice for the biochemistry (n = 6 per arm) and behavioral studies (n = 15 per arm). Our pilot studies showed a mean difference of 1.5 (3 vs. 1.5) in platform crossing times, with an SD of 1.8 in the control group and 1.3 in the anesthesia group. From the pilot study, we also estimated a mean difference of 150% (250% vs. 100%) in interleukin (IL)-6 levels in brain tissues, with an SD of 51 in the control group and 54 in the anesthesia group. Assuming this study would have similar effect sizes, a sample size of 6 per arm for the biochemistry studies and a sample size of 15 per arm for the behavioral studies would lead to a 90% or larger power to detect the differences using two-sample Student t test with 5% type I error. Mouse Primary Neurons The protocol was approved by the Massachusetts General Hospital Standing Committee on the Use of Animals in Research and Teaching. The harvest of neurons was performed as described in our previous studies.13,14Seven to 10 days after harvesting, the neurons were treated with 4.1% sevoflurane for 6 h as described in our previous studies.9The treatment with 4.1% sevoflurane for 6 h was used to determine whether the sevoflurane anesthesia, which can induce cytotoxicity,9could also reduce levels of postsynaptic density-95 (PSD-95), the marker for synapse. The IL-6 antibody (10 μg/ml) was administrated to the neurons 1 h before the sevoflurane treatment. The neurons were harvested at the end of anesthesia and were subjected to Western blot analysis. Brain Tissue Harvest and Protein Level Quantification Immediately after the sevoflurane anesthesia, we performed a cesarean section to extract the fetal mice and harvested their brain tissues. We also used decapitation to kill postnatal day (P) 31 offspring mice and harvested their brain tissues. Separate groups of mice were used for the Western blot analysis and the immunohistochemistry studies, respectively. For the Western blot analysis, the harvested brain tissues were homogenized on ice using immunoprecipitation buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM ethylenediaminetetraacetic acid, and 0.5% Nonidet P-40) plus protease inhibitors (1 μg/ml aprotinin, 1 μg/ml leupeptin, and 1 μg/ml pepstatin A) as described in our previous studies.15The lysates were collected, centrifuged at 12,000 rpm for 15 min, and quantified for total proteins with bicinchoninic acid protein assay kit (Pierce Technology Co., Iselin, NJ).15 Western Blot Analysis Western blot analysis was performed using the methods described in our previous studies.15Whole cerebral hemispheres were used for Western blot analysis because there would be an insufficient amount of hippocampus tissues from the fetal mice for Western blot analysis. IL-6 antibody (1:1,000 dilution; Abcam, Cambridge, MA) was used to recognize IL-6 (24 kDa). PSD-95 antibody (1:1,000; Cell Signaling Technology, Danvers, MA) was used to detect PSD-95 (95 kDa). A caspase-3 antibody (1:1,000 dilution; Cell Signaling Technology) was used to recognize full-length caspase-3 (35–40 kDa) and caspase-3 fragment (17–20 kDa) resulting from cleavage at aspartate position 175. Antibody anti–β-actin (1:10,000; Sigma, St. Louis, MO) was used to detect β-actin (42 kDa). Western blot quantification was performed as described by Xie et al. 16Briefly, signal intensity was analyzed using a Bio-Rad (Hercules, CA) image program (Quantity One). We quantified the Western blots in two steps. First, we used β-actin levels to normalize (e.g. , determining the ratio of IL-6 to β-actin amount) protein levels and control for loading differences in the total protein amount. Second, we presented changes in protein levels in mice or neurons undergoing sevoflurane anesthesia as a percentage of those in the control group. One hundred percent of protein level changes refer to control levels for the purpose of comparison with experimental conditions. The quantification of Western blot was based not only on the images presented in figures but also on the images not presented in the figures to have adequate effect size (e.g. , n = 6 in biochemistry studies).15 Immunohistochemistry Immunohistochemistry was performed using the methods described in our previous studies.17P31 offspring mice were anesthetized with sevoflurane briefly (2.5% sevoflurane for 4 min) and perfused transcardially with heparinized saline followed by 4% paraformaldehyde in 0.1M phosphate buffer at pH 7.4. The anesthesia with 2.5% sevoflurane for 4 min in mice provided adequate anesthesia for the perfusion procedure without causing statistically significant changes in blood pressure and blood gas according to our previous studies.9Mouse brain tissues were removed and kept at 4°C in paraformaldehyde. Five-micron frozen sections from the mouse brain hemispheres were used for the immunohistochemistry staining.17The sections were incubated with the primary antibody synaptophysin (1:500; Sigma) dissolved in 1% bovine serum albumin in phosphate-buffered saline at 4°C overnight. The next day, the sections were exposed to secondary antibody (Alexa Fluor 594 goat anti-rabbit IgG [H+L]; Invitrogen, Grand Island, NY). Finally, the sections were wet mounted and viewed immediately using a fluorescence microscope (60×). We used the mouse hippocampus in the studies of immunohistochemistry density quantification to determine whether sevoflurane anesthesia can induce neurotoxicity in the hippocampus. The photographs were taken and an investigator who was blind to the experimental design counted the density of synaptophysin using ImageJ version 1.38 (National Institutes of Health, Bethesda, MD).17 Morris Water Maze A round steel pool, 150 cm in diameter and 60 cm in height, was filled with water to a height of 1.0 cm above the top of a 10-cm diameter platform. The pool was covered with a black curtain and was located in an isolated room with four visual cues on the wall of the pool. Water was kept at 20°C and opacified with titanium dioxide. The P31 offspring mice were tested in the Morris water maze (MWM) four times per day for 7 days. Each of the mice was put in the pool to search for the platform, and the starting points were random for each mouse. When the mouse found the platform, the mouse was allowed to stay on it for 15 s. If a mouse did not find the platform within a 90-s period, the mouse was gently guided to the platform and allowed to stay on it for 15 s. A video tracking system recorded the swimming motions of the animals, and the data were analyzed using motion-detection software for the MWM (Institute of Materia Medica, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, People’s Republic of China). At the end of the reference training (P37), the platform was removed from the pool and the mouse was placed in the opposite quadrant. Mice were allowed to swim for 90 s and the times the mouse swam to cross the platform area was recorded (platform crossing times). Mouse body temperature was maintained by active heating as described by Bianchi et al .18Specifically, after every trial, each mouse was placed in a holding cage under a heat lamp for 1 to 2 min until dry before being returned to its regular cage. Environmental Enrichment The EE in the current experiment was created in a large cage (70 × 70 × 46 cm) that included five or six toys (e.g ., wheels, ladders, and small mazes) as described in previous studies, with modification.10,11The pregnant mice were put in the EE every day for 2 h before delivery. The pregnant mice delivered offspring mice at G21. Then, the mother and the babies were put in the EE again every day for 2 h from P4 to P30. The objects were changed two to three times per week to provide newness and challenge. Statistical Analysis The nature of the hypothesis testing was two-tailed. Data were expressed as mean ± SD. The data for platform crossing time were not distributed normally and thus were expressed as median and interquartile range (IQR). The number of samples varied from 6–15, and the samples were distributed normally, with the exception of platform crossing time (tested by normality test, data not shown). Two-way ANOVA was used to determine the interaction of IL-6 antibody and sevoflurane treatment, and the interaction of EE and sevoflurane anesthesia. Interaction between time and group factors in a two-way ANOVA with repeated measurements was used to analyze the difference of learning curves (based on escape latency) between mice in the control group and mice treated with anesthesia in the MWM. Multiple comparisons in escape latency of MWM were adjusted using the Bonferroni method (with seven tests and a threshold of 0.05/7 = 0.0071). There were no missing data for the variables of MWM (escape latency and platform crossing time) during the data analysis. The Student two-sample t test was used to determine the difference between the sevoflurane and control conditions on levels of IL-6, PSD-95, and synaptophysin. Finally, the Mann–Whitney U test was used to determine the difference between the sevoflurane and control conditions on platform crossing times. Values of P < 0.05 were considered statistically significant. SAS software version 9.2 (SAS Institute Inc., Cary, NC) was used to analyze the data.",mice,"['Three-month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice.']",gestational day 14,"['At gestational day (G) 14, the pregnant mice were assigned randomly to an anesthesia group or a control group.']",Y,['The P31 offspring mice were tested in the Morris water maze (MWM) four times per day for 7 days.'],sevoflurane,"['Mice randomized to the anesthesia group received 2.5% sevoflurane in 100% oxygen for 2 h in an anesthetizing chamber.', 'The neurons were treated with 4.1% sevoflurane for 6 h as described in our previous studies.']",none,[],c57bl/6,"['Three-month-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were mated with male mice.']",True,True,True,True,True,True,[ Passage 25/25 ] 10.1097/ALN.0b013e3182834d5d