Spaces:
Sleeping
Sleeping
| import gradio as gr | |
| #------------------------------------------------------------- | |
| # first function is taken from lecture notes | |
| #------------------------------------------------------------- | |
| dna2dna = {'A':'T', 'T':'A', 'C':'G', 'G':'C'} | |
| def reverse_comp(dna): | |
| """Return a string representing the reverse complement of the single dna strand.""" | |
| other = '' # start with an empty string | |
| for base in dna: | |
| other = other + dna2dna[base] | |
| return other[ : :-1] # python trick to reverse a string | |
| #------------------------------------------------------------- | |
| # second function is your responsibility to implement | |
| #------------------------------------------------------------- | |
| def mutate(dna, motif): | |
| if motif in dna: | |
| reverse_motif='' | |
| #dna[reverse_comp(motif)] | |
| new_dna='' | |
| if reverse_motif in dna: | |
| #My code | |
| #new_dna=dna[:dna.index(motif)]+dna[dna.index(motif)+len(motif):dna.index(reverse_comp(motif))]+dna[dna.index(reverse_comp(motif))+len(reverse_comp(motif)):] | |
| #reverse_motif.index(reverse_comp)+len()] | |
| new_dna = dna[:dna.index(motif)] + dna[dna.find(reverse_comp(motif), dna.index(motif)) + len(reverse_comp(motif)):] | |
| #correct code ^^^ | |
| return new_dna | |
| else: | |
| print('motif not found in sequence: ',end='') | |
| return dna | |
| #def mutate(dna, motif): | |
| #"""Return the result of a mutation based on an inverted repeat of the given motif.""" | |
| # your code here! | |
| #### (1) Check if the motif exists in dna sequence. If not, return the original sequence. | |
| #j = dna.find(motif) | |
| #if j == -1: | |
| # return dna | |
| #### (2) If true, check if the reversed complement of the motif exists in dna sequence, if not, return the orignal sequence. | |
| # k = dna.find(reverse_complement(motif), j+len(motif)) | |
| # if k == -1: | |
| # return dna | |
| #### (3) If the motif and its reversed complements exist, remove the region starting from the motif and ending with the inverted repeat, return the new sequence. | |
| # """Return the result of a mutation based on an inverted repeat of the given motif.""" | |
| #return dna[:j] + dna[k+len(motif): ] | |
| #test_data = """ATCCGAATACGGTTCGGGTA CGAA | |
| #ATCCGAATACGGTTGGGTA CGAA | |
| #ATCCAATACGGTTCGGGTA CGAA | |
| #ATCCGAATACGGTTCGGGTTCGA CGAA | |
| #AGTCACATGATCAGT C""" | |
| #for dna,motif in [line.split() for line in test_data.split('\n')[0:]]: | |
| # print('Executing mutate(%s,%s)...' % (dna,motif)) | |
| # print(' returned: %s' % (mutate(dna,motif))) | |
| input_module1 = gr.inputs.Textbox(label = "Enter your DNA sequence in the box:") | |
| input_module2 = gr.inputs.Textbox(label = "Enter your motif of interest in the box:") | |
| output_module = gr.outputs.Textbox(label = 'new dna') | |
| interface = gr.Interface(fn=mutate, | |
| inputs=[input_module1,input_module2], | |
| outputs=output_module, | |
| title="CSCI1020 Demo 3: Web Application for Finding DNA Inverted Repeats", | |
| description= "Click examples below for a quick demo", | |
| theme = 'huggingface', | |
| layout = 'vertical' | |
| ) | |
| interface.launch() | |