Update app.py

app.py

@@ -42,27 +42,28 @@ def get_current_time_in_timezone(timezone: str) -> str:
 
 @tool
 def run_blast(arguments_string: str) -> str:
-    """
-    Submits a BLAST job to NCBI and retrieves the results.
-    Parses arguments from a string input.  Now accepts a sequence directly, not a file.
+    """Submits a BLAST job to NCBI and retrieves the results.
+
+    Parses arguments from a string input. Accepts a sequence directly as input, not a file.
 
     Args:
-        arguments_string (str): String containing program, database, and query sequence.
-                                 e.g., "blastp nr ATGCGTAGCTAGCTAG...".  Sequence should be directly in the string.
+        arguments_string: A string containing the BLAST program, database, and query sequence.
+            The string should be formatted as: "program database query_sequence".
+            For example: "blastp nr ATGCGTAGCTAGCTAG...".
+            The query sequence should be provided directly within the string.
 
     Returns:
-        str: BLAST results in text format on success, or an error message string on failure.
-             Possible error messages include:
-                "Error: Invalid arguments"
-                "Error submitting request: {error_details}"
-                "Error: Could not parse RID or RTOE from BLAST response."
-                "Search {rid} failed; please report to blast-help@ncbi.nlm.nih.gov."
-                "Search {rid} expired."
-                "No hits found."
-                "Unknown error during polling."
-                "Error polling for results: {error_details}"
-                "Error retrieving results: {error_details}"
-        The arguments_string passed to run_blast contains everything needed: "blastp nr ATGCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC". The function will parse this string, run the BLAST with the provided sequence, and return the results.
+        BLAST results in text format on success, or an error message string on failure.
+        Possible error messages include:
+            "Error: Invalid arguments"
+            "Error submitting request: {error_details}"
+            "Error: Could not parse RID or RTOE from BLAST response."
+            "Search {rid} failed; please report to blast-help@ncbi.nlm.nih.gov."
+            "Search {rid} expired."
+            "No hits found."
+            "Unknown error during polling."
+            "Error polling for results: {error_details}"
+            "Error retrieving results: {error_details}"
     """
 
     parser = argparse.ArgumentParser(