diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1002_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1002_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9bbbd67bfc105a5595c6853990fe64a086f9144e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1002_en.txt
@@ -0,0 +1,3 @@
+In July 2006, a 41-year-old female presented with a swelling in the right preauricular region, which had persisted for the past two years, and was having difficulty opening her mouth for the past four months. The swelling was insidious in onset and progressive. In the first six months, the patient indicated the swelling was painless, only later becoming painful as the size increased.
+Local examination found a diffuse 5 × 4 cm firm to cystic mass with restricted mobility in the right preauricular region. Examination of the oral cavity, ear, cranial nerves, and other systems was unremarkable. MRI analysis indicated a large mass in the right infratemporal fossa with significant infiltration into the adjoining muscles. This mass was hypo-isointense on T1 and heterogeneously hyperintense on T2 weighted images . The mass had significant enhancement in post-contrast MRI . Hematological and biochemistry analyses were normal. Fine needle aspiration cytology (FNAC) revealed a monotonous population of small, round lymphoid cells with regular nuclei, compact chromatin, inconspicuous nucleoli, and scant basophilic cytoplasm. These findings were consistent with NHL. Diagnostic biopsy of the tissue confirmed small lymphocytic non-Hodgkin's lymphoma. The patient was investigated further to determine the staging of the NHL, but no lymph node or other organ was found to be involved. The patient was scheduled for chemo-radiation treatment and given nine cycles of the CHOP regime (cyclophosphamide, doxarubicine, vicristine, and prednisolone) and a total of 55G radiation in 25 fractions over five weeks. The patient remained asymptomatic for seven months.
+In Nov 2007, the patient again presented with similar symptoms. A computed axial tomography (CT) scan revealed a hypodense mass of 37 Hounsefield unit (HU) density and measuring 4.25 cm × 4.0 cm in the right temporal and infratemporal region. Post-contrast, this mass showed heterogeneous enhancement (66 HU density) and normal contents (muscles) were not identifiable from the mass. The tumor was excised and histopathology again confirmed the diagnosis of NHL. The patient was given six cycles of ifosfamide, metoxantron, and etoposide, with the last cycle on June 3rd, 2008. The patient was on regular follow up, and in Aug 2008 presented with increasing trismus. On examination, the infratemporal fossa was normal but there was a hard, irregular ulcer in the right retromolar area . A punch biopsy of the ulcer found it to be a well-differentiated squamous cell carcinoma. The patient was advised to undergo surgery for this carcinoma, but she did not come in for further follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1006_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1006_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3cab3ffc0bf1c053024c2ce956c043193fc08c16
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1006_en.txt
@@ -0,0 +1 @@
+A 58-year-old Japanese woman complaining of pain and numbness in her left mandible was referred to our hospital in 2014. For a couple of months prior to her visit, she had been aware of an abnormal sensation in her left mandible, which gradually progressed to mild pain and numbness. She visited a general dental practitioner, who diagnosed her condition as osteomyelitis and referred her to our department. Her medical and family histories were unremarkable. On initial assessment, no obvious systemic symptoms were evident. A panoramic radiograph showed a widening of the periodontal ligament space, periapical bone loss in tooth #37, and a diffuse radiolucent lesion involving the left body of her mandible, with an indistinct cortical margin and ill-defined cortical borders of the inferior alveolar nerve canal . Moreover, the radiograph also showed that tooth #37 had previously been treated endodontically. Therefore, a diagnosis of apical periodontitis was suggested and endodontic treatment was performed; however, her symptoms were not relieved. Consequently, a neoplastic lesion was highly suspected and findings of a biopsy of the apical tissue after extraction of tooth #37 resulted in a histopathological diagnosis of tissue inflammation. However, after the biopsy, a gradual progressive swelling of the left mandible occurred . Computed tomography (CT) showed an enhanced lesion on the left mandible, and magnetic resonance image (MRI) showed abnormally high-intensity signal in the bone marrow, with surrounding soft tissue mass . Therefore, we performed an incisional biopsy of the swollen area, the findings of which resulted in a histopathological diagnosis of osteoblastic-type osteosarcoma of the mandible. She was then scheduled for radical surgery combined with neoadjuvant and adjuvant chemotherapy based on the regimen used in a multi-institutional clinical study of neoadjuvant chemotherapy in extragnathic osteosarcoma (NECO study) in Japan . In the NECO study, neoadjuvant chemotherapy consisted of two courses of high-dose (HD) methotrexate (MTX) followed by a course of cisplatin (CDDP) and adriamycin (ADR) as phase I chemotherapy. After phase I chemotherapy was completed, the response to induction chemotherapy was evaluated. If the treatment response was assessed as complete response (CR), partial response (PR), or stable disease (SD), four courses of HD-MTX and a course of CDDP and ADR were administered. In contrast, if the treatment was assessed on the basis of the response as “not effective, with progressive disease (PD),” the chemotherapy regimen was changed to HD ifosfamide (IFO). Toxic effects during chemotherapy were graded according to the Common Terminology Criteria for Adverse Events Version 4.0. Following neoadjuvant chemotherapy, tumors were assessed using response evaluation criteria in solid tumors (RECIST) after determining their sizes using CT and MRI. In the current patient, the swelling increased rapidly during the phase I neoadjuvant chemotherapy . CT and MRI also revealed marked progression of the lesion , and laboratory data showed marked elevation of serum alkaline phosphatase. On the basis of these data, we assessed the response to neoadjuvant chemotherapy as not effective, with PD. Therefore, the neoadjuvant chemotherapy was suspended and radical surgery took precedence before the lesion grew to an unresectable size. She was then treated with radical surgery consisting of a hemimandibulectomy and reconstruction using a free vascularized latissimus dorsi pedicle flap and rigid titanium reconstruction plate. On histologic examination, the tumor was composed of stellate cells, which were large and atypical . Highly atypical cells produced osteoid and immature bone. Moreover, chondroid matrices were also observed. Taken together, these findings indicated that the therapeutic response was poor, assessed as grade 0 (tumor necrosis area <90%). On postoperative day 25, adjuvant chemotherapy was started. Adjuvant chemotherapy was also performed in accordance with the NECO study regimen, with slight modifications. The adjuvant chemotherapy regimen included two courses of HD-IFO followed by a course of CDDP and ADR, and the same regimen was repeated for a total of three cycles. During chemotherapy, hematologic toxicities, grade 4 leukopenia, and thrombocytopenia were detected and the frequency of febrile neutropenia increased, requiring red blood cell and platelet transfusions and the use of granulocyte-colony stimulating factor. The treatment schedule and our patient’s clinical course are summarized in the Table . No evidence of local recurrence and distant metastasis was found at 14 months follow-up after initial treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1010_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1010_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..02feb0e5b5c601aa3db7842a10c0c6589c170e84
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1010_en.txt
@@ -0,0 +1,5 @@
+A 49-year-old woman at first consultation presented at our hospital for surveillance of the pancreas because her father (II-3) and her younger brother (III-6) had pancreatic cancer. She had undergone surgery for subarachnoid hemorrhage at 19 years of age because of an arteriovenous malformation. Her family tree revealed that her younger brother died of pancreatic cancer at 33 years of age; he could not be treated through surgery because of his advanced stage with distant metastasis. The patient’s paternal aunt (II-1) also died of pancreatic cancer at 65 years of age. Her father was also diagnosed with advanced-stage pancreatic cancer, which could not be controlled despite chemotherapy.
+In the first genetic counseling session, the patient was informed that she was likely to have FPC, Lynch syndrome, or HBOC syndrome, all of which follow an autosomal dominant inheritance pattern. Therefore, germline multi-gene panel testing using ACTRisk® (ACT Genomics, Co. Ltd. Taipei, Taiwan) was performed to analyze germline variants in this case.
+In the second genetic counseling session, we informed her that the blood genetic test revealed two germline variants. She harbored a heterozygous PALB2 pathogenic variant, NM_024675(PALB2): c.1675_1676inv (p.Gln559*), and a heterozygous NBN pathogenic variant, NM_002485(NBN): c.265C > T (p.Arg89*). These variants are predicted to cause loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay. Therefore, we advised her to undergo surveillance for breast, ovarian, and pancreatic cancer. Her father died 9 months after her first consultation; however, he had previously provided a blood sample to our department before his death to support her future healthcare. Accordingly, genetic testing of her father’s blood sample was recommended to her.
+In the third genetic counseling session, we explained that her father’s blood revealed the presence of the PALB2 c.1675_1676inv (p.Gln559) pathogenic variant, which was the same as hers. Furthermore, we informed her that her first-degree relatives (FDR) have a 50% chance of testing positive for these variants. Therefore, we recommended genetic counseling for her children at the next session, and she agreed.
+In the fourth genetic counseling session, the patient and her three children, a 28-year-old woman, a 24-year-old man, and a 22-year-old man, presented at our outpatient department. We explained to them that their mother and her father harbored the PALB2 pathogenic variant, which was probably associated with breast, ovarian, pancreatic, and prostate cancer. Furthermore, we informed them that their mother harbored the NBN pathogenic variant, which was potentially associated with breast, ovarian, and pancreatic cancer. Upon surveillance, no issue was noted in the cases’s breasts and ovaries; however, she displayed a branch duct type intraductal papillary mucinous neoplasm (BD-IPMN) in her pancreas. We suggested she continue active surveillance of her breasts, ovaries, and pancreas. Furthermore, her 28-year-old daughter wished to undergo genetic testing because her uncle had died from pancreatic cancer at an early age. Therefore, we performed genetic testing at a single site for the patient’s daughter. Finally, the patient’s daughter underwent genetic counseling and was found to harbor only the NBN c.265C > T(p.Arg89*) pathogenic variant, which was probably associated with breast, ovarian, pancreatic cancer. Thus, the daughter will be recommended to undergo surveillance for breast, ovarian, and pancreatic cancer.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1033_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1033_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dcb5fd1a2bb6717127fab9383e8d4c6cacdcd8a4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1033_en.txt
@@ -0,0 +1,3 @@
+A 43-year-old woman accidentally found a right breast lump on March 2014, with a diameter of 2 × 2 cm and stabbing pain. The mass was not related to the menstrual cycle. There was no redness, swelling, or rupture of the skin near the lump. No erosion, stabbing pain, pruritus, or discharge of the nipple was observed. In 2016, the tumor became progressively enlarged, and a mass of 3 × 2 cm was found under the right axilla. In March 2017, there was pain in the right axilla with obvious tenderness. Physical examination determined with touch indicated a tough mass of 5 × 3 cm in the right breast (between 7 and 9 o'clock), and the lump was characterized by unpolished surface, obscure boundary, and poor activity. A soft mass of 4 × 2 cm was touched in the right axilla, and no obvious abnormality was found during the rest of the physical examination. Ultrasound examination suggested multiple solid masses in the right breast. The dimensions of the tumor determined between 6 and 11 o'clock were 5.3 × 3.4 cm, which was classified as BI-RADS 4C-5; the dimensions of the mass identified at 10 o'clock were 1.2 × 0.5 cm, which was classified as BI-RADS 4a. The dimensions of enlarged lymph nodes in the right axilla were 1.2 × 0.6 cm. Ultrasound-guided needle biopsy showed an invasive carcinoma of the right breast with fibroadenoma. Surgical treatment was performed on 9 March 2017. Intraoperative sentinel lymph node biopsy found metastatic cancer, and simplified radical mastectomy was performed for right breast cancer. Postoperative pathology showed non-specific invasive carcinoma of the right breast (invasive ductal carcinoma SBR II-III) and mucinous carcinoma of high to medium grade (intraductal carcinoma) of the dimension 3.5 × 1.5 × 3.0 cm, as seen in . The other three lesions were non-special invasive carcinoma (invasive ductal carcinoma SBR II), with the dimensions of 0.7 × 0.7 × 0.5 cm, 1.0 × 0.6 × 0.5 cm, and 1.0 × 0.8 × 0.5 cm. No metastasis was found in the right axillary lymph node (0/15). Positive immunohistochemical staining for ER, PR, HER-2, AR, P53, and Ki 67 was performed. The postoperative stage was pT2N2M0 IIIA, Lumina I B. The chemotherapy regimen was EC-TH chemotherapy, with 8 sessions of chemotherapy completed from April 7, 2017 to September 25, 2017.
+During the follow-up, corresponding examinations were made according to the patient's condition. Between the baseline and eighth chemotherapy sessions, ECG, cardiac ultrasonography and breast ultrasound, chest CT and upper abdomen CT, and ECT were performed in the following order: Chest CT, upper abdomen CT, and cardiac ultrasound were performed at baseline; ECG examination was performed after the first chemotherapy and the third chemotherapy. On the fifth chemotherapy session, none of the above examinations were performed. Chest CT, upper abdomen CT, cardiac ultrasonography, and breast ultrasound were performed during the eight chemotherapy session. Breast ultrasound results showed (1) a right breast surgery, (2) multiple cystic nodules in the left breast, and (3) no enlarged lymph nodes under both axilla and supraclavicular, and the rest of the examination results were normal. Degree II myelosuppression occurred during chemotherapy, and hematology returned to normal after treatment with granulocyte colony-stimulating factor (G-CSF).
+In this case, CMR examinations were performed at the beginning of the first chemotherapy (baseline) and after the third, fifth, and eighth chemotherapy sessions, using a 3.0 T magnetic resonance imager (platform HDxt; General Electric Medical Systems, Waukesha, WI) equipped with an 8-channel phased-array cardiac coil. Standard 2-, 3-, and 4-chamber and left ventricle (LV) short-axis cine images from apical to basal were acquired with fast imaging employing a steady-state acquisition sequence. IVIM imaging was performed with the echo planar imaging (EPI) sequence. LV structural and functional parameters were measured by the Qmass package (Medis® Suite MR), as seen in . IVIM parameters were obtained by using GE Functool 9.4.05a software, as seen in . Cine images of 4-chamber, 2-chamber, left ventricle (LV) short-axis and IVIM images of baseline are shown in . IVIM images of the third, fifth, and eighth chemotherapy sessions are shown in .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1067_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1067_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..60ef91786fa8440a4faa3d9969f5660ed96e19b9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1067_en.txt
@@ -0,0 +1 @@
+A 62-year-old woman, G1P1, was referred to a gynecological doctor for a large “vaginal mass”. She did not have abnormal vaginal bleeding but found one vaginal mass by herself 1 month ago. Her age at the beginning of menopause was 52 years old. Her medical and surgical histories were both negative. On gynecological examination, we found that the mass was non-mobile and was 5 × 5 cm2 in size, with a location of approximately 3 cm from the vaginal orifice and closely attached to the vaginal wall. On rectal examination, we found that the mass located on the anterior of the rectal wall was approximately 3 cm from the anal verge. The pelvis MR scan and transvaginal ultrasound results showed a tumor, 5 cm in diameter, was mostly located in the space of the rectovaginal septum, with large portion protruding into the vaginal wall but only a small portion protruding into the rectal wall. Its boundary is clear . Colonoscopy revealed that the root of the tumor was located on the rectal dentate line . The origin of the tumor was uncertain. Based on these examinations, the gastrointestinal doctor and us co-evaluated that if we selected a transvaginal resection, we could intactly excised the tumor with less possible complications such as fecal incontinence or anal sphincter dysfunction due to its special location. The patient refused to radical anal resection for its anal complications. Therefore, we chose transvaginal resection as a better alternative. Under general anesthesia, the patient was placed in a lithotomy position. Epinephrine, diluted at 1:40,000, was injected into the vaginal submucosa for resection. We incised the vaginal mucosa and separated the surrounding tissue until we reached the submucosa, keeping the tumor capsule intact. After exposing the tumor, we confirmed that it was located in the rectovaginal septum and partially encapsulated by the rectal muscle . We mobilized the tumor from the capsule and resected the intact tumor. The defect of rectal muscle was very small but kept the rectal mucosa intact. We vertically stitched the vaginal layers and horizontally stitched the muscular layer of the rectum . The postsurgery biopsy showed spindle-shaped cells were moderate differentiation and regular arrangement with clear margin by pathological examination . The results of histological examination showed that the tumor was positive for CD117, Dog-1, and CD34 . These findings suggest a moderate-risk rectal GIST that required follow-up. The patient recovered quickly. She had not suffered any anal dysfunction nor postoperative vaginal-rectal fistula. She refused to undergo enlarged resection but received imatinib treatment after surgery. She remained tumor-free for 2 years after surgery. She was lost for follow-up thereafter.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1068_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1068_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..029b8026e54387e7092ebd85845844b543fa7148
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1068_en.txt
@@ -0,0 +1,4 @@
+A 69-year-old woman developed a sudden drooping on the left side of the face while having dinner with her family. Her daughter noticed slurred speech and alerted emergency medical services immediately. The patient was pre-announced to the stroke service by the responding emergency medical technician and immediately admitted to the emergency room. Her home medication consisted of pantoprazole only. Upon admission to the emergency room, the patient was alert but slightly confused. Further neurological examination revealed a left-sided hemiparesis and motor speech disorder. The remaining cranial nerves were unaffected. No sensory or coordinative dysfunctions were detected. Muscle stretch reflexes revealed no lateral differences, and plantar reflexes were normal (NIHSS score: 4 points). Shaved hair over the right temple exposed a well-healing, 10-cm-long recent wound. The patient reported having had brain surgery two weeks earlier, but upon further questioning denied a preceding trauma, infection, tumor disease, or cerebral bleeding.
+The non-contrast computed tomography (CT) imaging revealed hypodense areas in the circulation of the middle cerebral artery (MCA) with territorial pattern (mainly pre-Rolandic, but also Rolandic, parietal, and insular branches), moderate swelling, and hemorrhagic transformation of the anterior portion (see Fig. ). A vascular clip in projection on the middle cerebral artery was visible. There was no sign of a subarachnoid hemorrhage (SAH). The CT-angiography revealed no high-grade stenosis or vessel occlusion of the cerebral blood flow in the area of the right middle cerebral artery, even though the presence of a vascular clip reduced reliability of assessment. The cerebral duplex ultrasonography/transcranial Doppler sonography (TCD) showed, in contrast to the left side, markedly increased blood flow velocities in the right MCA with mean values up to 180 cm/s (Vmax up to 300 cm/s), while the blood flow in all of the other cerebral arteries was undisturbed. The increased velocities were traceable along the entire M1 segment as well as in the M2 segments of the right MCA. In contrast to the preoperative transfemoral catheter angiography (TFCA), the subsequent right internal carotid angiogram showed clear signs of vasospasm along the M1 and M2 segments of the right MCA (see Fig. ). However, neither delayed cerebral blood flow nor hypoperfusion were found. A vessel narrowing with consecutive stenosis due to a suboptimally placed clip was ruled out.
+The patient’s recent medical history included the microsurgical treatment of a right-sided MCA aneurysm 12 days prior. The patient had never experienced any episodes of uncommon or severe headaches. The unruptured intracranial aneurysm (UIA) was found incidentally via magnetic resonance imaging ordered after the patient complained of a short period of slight gait disturbances. To avoid an SAH and consecutive complications like vasospasms, the patient elected surgical treatment (see Fig. ). Endovascular management was not feasible due to the configuration of the aneurysm. The review of the operative report and the medical discharge letter attested to an uneventful perioperative course. Clipping was managed by keyhole approach. A craniotomy 30 mm in diameter was performed over the right Sylvian fissure. The aneurysm was dissected after securing proximal control of the distal M1 segment of the right MCA. Temporal clipping of the M1 was not necessary. After clip placement, appropriate flow in all distal segments was confirmed by indocyanine green video-angiography and micro-Doppler. The postoperative imaging showed no sign of decreased cerebral blood flow. The patient was discharged seven days after surgery without neurological deficits. No other vascular diseases were known.
+After admission antithrombotic treatment with acetylsalicylic acid was begun. In accordance with guidelines for the treatment of subarachnoid hemorrhage and vasospasm, nimodipine was added. Periodically performed transcranial duplex sonography showed a further increase of blood flow velocity in the MCA and its branches for four days before a continuous decrease and normalization of flow velocity was observed. Treatment with nimodipine was continued for an additional two weeks. Within this time the symptoms disappeared completely. The patient made a full recovery, which is remarkable in such a major stroke. After 11 days the woman was discharged with no symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1070_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1070_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..502ea2480cb500d3de48f593f369f1e3072620a4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1070_en.txt
@@ -0,0 +1,3 @@
+A 54-year-old man, heavy smoker without underlying disease, was admitted to the local hospital due to progressive weakness of the lower extremities for 1 month. He had no history any injury. Three months earlier, he experienced low back pain radiating to both legs, predominantly affecting the left side. Furthermore, difficulty in urination and constipation were observed 1 week before admission. Magnetic resonance imaging (MRI) of the lumbosacral and thoracic spine revealed abnormal hyperintense T2 signal, representing spinal cord congestion, extending from the conus medullaris to the level of T7. There was abnormal tortuous and dilated flow void, running from the level of L5 to T12 along anterior surface of the spinal cord . A preliminary diagnosis was SDAVF. The patient was transferred to our institute and admitted for further investigation. The neurological examination revealed the evidence of spastic paraparesis (muscle strength 4/5), the lack of pinprick sensation below L2 level, hyperreflexia, and presence of Babinski sign in the lower extremities.
+Spinal angiography demonstrated the fistula at the level of L2 below the conus medullaris, which is supplied by the PSA originating from the left L1 segmental artery with cranial drainage through the paralleling dilated vein into perimedullary vein. Without selective catheterization into both internal iliac arteries, lower aorta and bilateral common iliac arteries angiography reveals no more supply to the fistula . The ASA arose from the left T6 intercostal artery without supplying to the fistula. Initially, we interpreted that this fistula was filum terminale AVF (FTAVF) which is fed by the ASA supplying from the PSA via the vasa corona. Due to small and long distance of the feeder, the patient underwent surgical treatment. On prone position, total laminectomy of L2 and partial laminectomy of L3 were carried out. After durotomy, the filum terminale (FT) was identified and no fistula or abnormal vessels on it. The fistula is located on the left cauda equina nerve root supplied by the proximal radicular artery with cranial drainage through the enlarged radicular vein. Another enlarged arterialized radicular vein running parallel to another cauda equina nerve root is observed with unknown origin . To avoid nerve root injury by heat, the dilated proximal draining vein near the fistula on the cauda equina nerve root was clipped with small silver clips without using bipolar coagulation. Another radicular vein was left for further investigation. After the operation, the patient showed mild improvement of his symptoms. He could walk with the aid of a walker. He was discharged home 7 days later due to his requesting to do some personal issues at home.
+Follow-up MRI and contrast-enhanced MR angiography (MRA) of the thoracolumbar spine, obtained 3 weeks after the operation, revealed mild regression of spinal cord congestion, and remaining of intradural flow void from L5 to L2. Another SDAVF was found at left S1 neural foramen supplied by the left lateral sacral artery (LSA) originating from the left internal iliac artery with venous drainage into perimedullary veins through the dilated and tortuous radicular vein, probably corresponding with another dilated arterialized radicular vein found during the operation [ and ]. Comparing between preoperative the left L1 segmental artery angiography and postoperative contrast-enhanced MRA, there was the same venous drainage pattern, representing sharing the common medullary venous channel . Spinal angiography and probable embolization in the same setting were scheduled for another week. Few days before hospitalization for further treatment, the patient developed loss of consciousness at home and was sent to the emergency department of the local hospital and intubated promptly. Few minutes later, the patient had a cardiac arrest. Immediate cardiopulmonary resuscitation was performed unsuccessfully. Without an autopsy, the cause of death was still unknown.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1072_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1072_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b1d6554843254da5f0f313d9213ea82497a8fedb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1072_en.txt
@@ -0,0 +1,4 @@
+An 8 year old girl with tufting enteropathy on long-term parenteral nutrition presented on 3 occasions with central venous catheter infection due to Bacillus species. On each occasion, she had fever after flushing of the central venous catheter. She had initially presented in the first few months of life with chronic watery diarrhoea and impaired growth, and was found to have tufting enteropathy (intestinal epithelial dysplasia) . This is a rare congenital enteropathy, which requires indefinite dependence on parenteral nutrition from early infancy. The child is on regular parenteral nutrition and has had no previous history of significant infections, except for central venous catheter infections with coagulase negative staphylococci. Immunoglobulins, neutrophil and lymphocyte counts were within the normal range. There was no history of significant trauma, injuries or skin infections prior to this episode, except a small cut on her finger which healed very well and was generally well in herself. She lives with her parents and is well cared for. There is no history of contact with plant growth products or animal probiotics at any time.
+The child presented with fever and rigors to her local hospital. Bacillus species was isolated from blood taken from the central venous catheter, which was reported sensitive to flucloxacillin. She was treated with 4 weeks of intravenous flucloxacillin because bacteraemia had persisted despite 14 days of treatment.
+The child was transferred to our hospital with recurrence of fever and rigors, 10 days after stopping the antibiotics. Empirical treatment was started with intravenous cefotaxime and flucloxacillin. Bacillus species was isolated from central venous catheter cultures both before and whilst on cefotaxime and flucloxacillin. This was later identified as Bacillus pumilus at the National Reference Laboratory (Health Protection Agency, Centre For Infection, London). The methods used to identify the organism were gram stain to determine whether spores are produced, short biochemical profile based on ammonia salt sugars, Lecithinase and mannitol (B. pumilus is lecithinase negative and mannitol positive) and DNA sequencing. B pumilus was reported to be sensitive to vancomycin and erythromycin. There were concerns that the patient had previously reacted to systemic vancomycin, so antibiotics were changed to intravenous clindamycin with vancomycin line locks given for 2 weeks. Blood cultures, taken both during and after this treatment, were negative. Echocardiography showed no evidence of vegetations at the tip of the catheter or in the heart.
+Ten days after stopping the intravenous antibiotics the child presented for the third time with fever and rigors. A Bacillus species was again grown from blood taken from the central venous catheter. The central venous catheter was removed after 5 days treatment with intravenous vancomycin and a new central venous catheter was inserted. Subsequent blood cultures were negative and there has been no recurrence of further fever or infections over a 9-month period, suggesting the infection has been eradicated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1086_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1086_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e27500b2174aa14b522104a2a253447830bf5834
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1086_en.txt
@@ -0,0 +1,3 @@
+A 68-year-old female underwent phacoemulsification + intraocular lens implantation + pars plana vitrectomy (PPV) + ILM peeling + 18% sulfur hexafluoride (SF6) tamponade in January 2016 due to an epiretinal membrane and a lamellar MH. Unfortunately, macular hole retinal detachment (MHRD) occurred one month after surgery. She received PPV + extended ILM peeling + silicone oil tamponade in February 2016 and underwent removal of silicone oil in October 2016. The retina had attached well, although the MH became refractory, and her best-corrected visual acuity (BCVA) was 20/500. She underwent two PPV + free ILM flap transplantation + 15% C3F8 treatments in April 2017 and July 2017, with unsatisfactory results. Due to her repeated surgeries, an autologous free ILM flap could not be harvested. We decided to perform a neurosensory retinal free flap transplantation for the repair of this refractory MH after discussion with the patient.
+A standard 25-g, 3-port PPV (Constellation; Alcon) was performed under general anesthesia. Endolaser photocoagulation was applied to outline the retinal free flap at the temporal retina. The neurosensory retinal free flap was approximately twice the diameter of the MH. The retina was cut with vertical scissors along the inner edge of the laser spots and was gently dissected with back-flush needle irrigation until a neurosensory retinal free flap with a 2-MH diameter area was harvested. The infusion was stopped temporarily to prevent turbulent flow. A drop of whole blood was placed within the MH, and the neurosensory retinal free flap was then placed on the blood. We performed fluid-gas exchange and flushed the vitreous cavity with 15% C3F8 at the end of the surgery . All of the techniques were performed under standard 25-g, 3-port PPV. We did not use a bimanual approach under chandelier illumination (see Additional file ). The patient was instructed to maintain a prone position for 14 days postoperatively and to avoid any unnecessary movement.
+Three weeks after surgery, optical coherence tomography (OCT) revealed closure of the MH. The flap was visible on OCT and had filled the MH without overlapping of the neurosensory retina. The 2-month postoperative OCT examination still showed the MH closure. The patient reported an improvement of visual acuity and a decrease in her scotoma area. The patient’s BCVA improved from 20/500 preoperatively to 20/50 at 2 months postoperatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1106_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1106_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3268dd0ee22cd2647b69eb1533058f544122577e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1106_en.txt
@@ -0,0 +1,8 @@
+A 45-year-old woman presented with a thyroid mass and thrombosis in a middle thyroid vein during a physical examination.
+The patient came to hospital because of thyroid mass found in physical examination 3 mo before. She had no symptoms. The patient requested surgery because of the stress.
+The patient was health in the past.
+The patient had no family history of thyroid carcinoma and no history of radiation exposure in childhood.
+The physical examination showed no positive signs.
+Laboratory tests showed that triiodothyronine, free triiodothyronine, thyroxine, thyroglobulin, and thyroid-stimulating hormone levels were within the normal limits.
+A solid nodule in the left lobe of the thyroid by ultrasound examination. Ultrasound examination revealed a medially echoic mass in the middle thyroid vein.
+Subsequent ultrasonography-guided fine-needle aspiration biopsy results indicated an atypical lesion of ambiguous significance, with some actively growing cells (TBSRTC III) and the BRAFV600E mutation not present.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1116_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1116_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eb72c8a2429114a0e09b477065614042efebccb2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1116_en.txt
@@ -0,0 +1 @@
+A 91-year-old woman presented to our institution with ST-segment elevation myocardial infarction (STEMI). The right radial access was chosen for the performance of percutaneous coronary intervention (PCI). After the introduction of 6 F sheath, there was difficulty in the advancement of 0.035 J wire that was exchanged with a Terumo hydrophilic wire (0.035 × 180) which was advanced easily to the aortic root. Coronary angiography was done and revealed tortuous coronary arteries without significant lesions. Before sheath removal, radial arteriography was done and revealed perforation . Protamine sulfate (1 mg per 100 USP units of heparin) was administered intravenously to reverse the dose of heparin (70 U/kg), and APTT was monitored 15 min after the dose. This was followed by prolonged balloon inflation 2.5/3.0 . The perforation was not sealed so a 7-F-long vascular sheath was inserted to internally tamponade the vessel, and the patient was sent to the coronary care unit for monitoring of the forearm hematoma and the distal pulses . Over the next 3 days, serial radial angiographies were done which revealed the persistence of the perforation. After 4 days, angiography revealed multiple thrombi , and thrombus aspiration was done using Pronto V4 extraction catheter (Vascular Solutions, USA) and was followed by the implantation of a covered stent, which was dislodged, mostly secondary to under expansion, following another run of thrombus aspiration. The stent was successfully snared . Finally, the perforation was sealed spontaneously and there were no signs of intra-arterial thrombi .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1121_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1121_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..64d336900edbd7fa97e59299a3197d4587cdfa3d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1121_en.txt
@@ -0,0 +1,6 @@
+A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic. Her obstetric history mentioned a miscarriage and a pregnancy complicated by intrauterine growth restriction, without signs of preeclampsia. At 37 weeks' gestation, cesarean section was performed because of fetal distress. A boy was delivered, weighing 2015 g, with Apgar scores of 9 and 10 at one and five minutes, respectively. Histology of the placenta revealed 10% infarctions and a thrombus in the umbilical cord. Blood analysis after three months showed no hemostatic abnormalities associated with an increased risk of thrombosis.
+Ultrasound examination of the index pregnancy at 112 weeks' gestation showed a dichorionic diamniotic twin pregnancy with measurements consistent with gestational age. The Crown Rump Lengths were 39 mm, consistent with 106 weeks, and 45 mm, consistent with 112 weeks. Nuchal translucency thickness measurements were not performed. No abnormalities of the placenta were documented.
+Her blood pressure was 125/70 mmHg. The pregnancy was complicated by episodes of vaginal bleeding at 16 weeks' gestation. Ultrasound showed one fetus with normal growth and one with early growth restriction and measurements consistent with 13 weeks. An echogenic area was interpreted as blood clots. At 20 weeks' gestation, fetal death of the abnormal fetus was noticed. One week later, the patient was asymptomatic but her blood pressure increased (154/98) which prompted the suspicion of a partial molar pregnancy. An enlarged placenta of 10 cm × 12 cm with some cysts was prominent on the anterior wall. Blood flow had ceased in this placenta. Urinary protein excretion was 2.5 g/L. Maternal serum beta-human-chorionic-gonadotropin (β-hCG) was markedly raised: 423,000 IU/L. Other laboratory investigations were normal.
+The patient was sent to a University Hospital because of early preeclampsia and suspicion of a triploid twin. We decided to perform a chorionic villous biopsy because the placenta of the dead fetus was on the anterior wall. We did not perform a chorionic villous biopsy of the placenta of the healthy twin because no abnormalities were noticed by ultrasound and the placenta was located on the posterior wall.
+Chorionic villus biopsy confirmed triploidy, 69, XXY. Without pharmacological interventions, the blood pressure stabilized, proteinuria decreased, and β-hCG decreased to 222,835 IU/L. At 22 weeks, the patient was discharged. She was reviewed twice a week. Urinary protein excretion was positive until 23 weeks, and blood pressure slowly decreased and normalized at 30 weeks. The β-hCG further decreased to 27,600 IU/L at 33 weeks. Episodes of some vaginal bleeding and cramps occurred up to 28 weeks' gestation. The placenta of the triploid twin was still enlarged until 23 weeks: 8 cm × 12 cm .
+At 35 weeks, the patient developed preeclampsia again and was hospitalized. Her blood pressure increased to 170/105 mmHg and proteinuria to 0.8 g/L. Methyldopa 3 × 250 mg was initiated to control the blood pressure with good result . Blood analysis showed no signs of hemolysis, elevated liver enzymes, low platelets (HELLP) syndrome. At 38 weeks, a cesarean section was performed for fetal distress. A healthy girl weighing 2,710 g was born with Apgar scores of 9 and 10 at one and five minutes, respectively. The placenta of the triploid fetus was necrotic and as a result of autolysis, no further histologic information on fetus and placenta were available. β-hCG follow-up showed no signs of persistent gestational trophoblastic disease (pGTD). Four days after delivery, the level had already decreased to 440 IU/L.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1124_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1124_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f005e3834358b5605b78f22c189a1fc2c7ec0adf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1124_en.txt
@@ -0,0 +1,5 @@
+A 79-year-old Japanese woman with a leg oedema visited her primary care physician, 3 months before being admitted to our hospital. Outpatient treatment with diuretics was initiated, but the oedema did not improve. Three days before admission, she experienced palpitations and fatigue, prompting her to again visit her primary care physician. Her laboratory data showed severe anaemia (haemoglobin [Hb], 58 g/L). Hence, she was subsequently admitted to our hospital.
+She had no specific medical or any family history of renal disease. Physical examination revealed moderate leg oedema and kyphosis and no other indications of amyloidosis, such as numbness or signs consistent with polyneuropathy, gastrointestinal symptoms, macroglossia, orthostatic hypotension, purpura, or any changes to the skin. Laboratory data revealed microcytic anaemia (Hb, 50 g/L; mean corpuscular volume, 85.9 fL), hypoalbuminemia (albumin, 2.8 g/dL), and a possible slight decline in kidney function (serum creatinine, 0.64 mg/dL; estimated glomerular filtration rate, 66.9 mL/min/1.73 m2). Serum IgG, IgA, and IgM levels were 794 mg/dL, 1006 mg/dL, and 48 mg/dL, respectively. The serum free light chain (FLC) level for kappa and lambda was 77.4 mg/L and 15.2 mg/L, respectively, and the FLC ratio was 5.09. The brain natriuretic peptide level was 72.7 pg/mL. She also had iron and zinc deficiency. Serum and urine electrophoresis revealed the presence of IgA-kappa type M proteins (immunofixation method; Fig. ). Serum β2-microglobulin was 4.6 mg/L. Bone marrow aspiration revealed a slight proliferation of plasma cells (6.8%). Urinalysis revealed an occult haematuria (1 +) and moderate proteinuria (1.34 g/gCr). Electrocardiography and cardiac ultrasound did not show any changes consistent with cardiomyopathy associated with amyloidosis, such as low voltage, thickening of the ventricular wall, or granular sparkling appearance. The chest radiograph revealed a slight bilateral pleural effusion, and the cardiothoracic rate was deemed to be 56.5%. For treating severe anaemia, red blood cell transfusion was administered in conjunction with iron and zinc supplementation, resulting in an improvement in anaemia (Hb 95 g/L) and her subsequent discharge. After discharge, her urinary protein increased to 5.7 g/gCr, and serum albumin decreased to 2.8 g/dL. The patient was then diagnosed with nephrotic syndrome and a renal biopsy was performed.
+Light microscopy revealed methenamine-positive deposits in the mesangial and paramesangial regions . Some glomeruli were accompanied by segmental sclerosis caused by the deposits. Interstitial fibrosis and tubular atrophy were mild. Immunofluorescence staining was positive for IgA and kappa chains in the expanded mesangial area . The tubular basement membrane was partly granular and positive for kappa chains. Additional Congo red staining showed mild positivity in the glomerular deposits, but only faint birefringence. Immunohistochemical staining of the kappa chains was mildly positive . Furthermore, electron microscopy was conducted with formalin-fixed specimen to evaluate glomerular deposits, which revealed unbranched fibrils in glomerular deposits measuring 10–15 nm .
+LMD-LC–MS/MS revealed that the deposits consisted significant amounts of the kappa constant region of immunoglobulin. Additionally, a small amount of the alpha-1 constant region was also detected along with amyloid-associated proteins . Details of the detected protein and an illustration of globulin are presented in Fig. . The emPAI (exponentially modified protein abundance index) is often used as an index for estimating protein abundance during proteomic analyses using mass-spectrometry. The emPAI value represents the relative amount of each protein contained within the sample . Therefore, a higher value emPAI is indicative of a larger amount of protein, compared to the other proteins in the sample.
+Based on the above findings, the patient was diagnosed with LHCDD and focal amyloid deposition. Skin biopsy did not show amyloid deposition, while gastrointestinal biopsy revealed faint birefringence, suggesting that the patient had systemic amyloidosis. Bone marrow aspiration was repeated, which revealed an increase in the plasma cell population (14.4%). The increase in plasma cell population and a concurrent anaemia indicated multiple myeloma . She did not however present any other myeloma-defining events, such as hypercalcemia, decline in renal function, and bone legions. We started cyclophosphamide 300 mg/m2/day, bortezomib 1.3 mg/m2, and dexamethasone treatment 20 mg/week followed by weekly administration of daratumumab (1, 800 mg/week). After 9 months of treatment, proteinuria improved from 8.0 to approximately 5.0 g/gCr in the absence of decrease in eGFR, indicating a renal response . Serum albumin concentration also gradually increased, leading to a reduction in leg oedema. The reduction in serum M-protein (IgA 467 mg/dL) and the difference between involved and uninvolved FLC (dFLC; 20.8 mg/L) was greater than 50%, but less than 90% (haematological partial response ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1125_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1125_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..51b13370a8057fb5173bc78fe6c7e06543a0f29e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1125_en.txt
@@ -0,0 +1,9 @@
+A 43-year-old woman visited the Department of Obstetrics and Gynecology because of fluid collection in her cul-de-sac that was incidentally found 6 months ago at a routine health check. She did not complain of any other symptom except for dull abdominal discomfort. During physical examination, a mass-like hardness could be palpated on the level above the umbilicus. Routine blood analysis was within normal limits.
+A computed tomography (CT) scan of the abdomen was performed, and it revealed a 9.0-cm enhancing mass in the omentum at the right upper quadrant of the abdomen. The mass showed a relatively demarcated margin and some minute cystic changes. The radiologist thought the mass was a gastrointestinal stromal tumor (GIST) or neurogenic tumor. Additionally, there was a noted 2.5-cm corpus luteal cyst in the left ovary but otherwise there were no other abnormalities in the abdominal and pelvic cavities. The clinicians decided to excise the mass due to its huge size and to accurately diagnose the tumor.
+In the operative field, the mass was located around the distal antrum along the greater curvature of the stomach but was easily separated from the stomach wall itself. On the other hand, it was densely adhered to the omentum and mesocolon. The tumor was far away from the reproductive organs, such as the uterus and both ovaries, and urinary structures.
+On gross pathological examination, the excised mass measured 9.5 × 8.0 × 7.5 cm. On sectioning, the cut surface of the mass was yellow pink and showed a solid lobular portion and focal small cystic areas. Its margin was well demarcated from the attached omental fat tissue .
+Microscopically, the tumor showed two histologic components. The first cellular part consisted of well-defined nests of round or polygonal epithelial cells and numerous ill-defined lobular islands of epithelial cells with short spindled features . The nests of polygonal epithelial cells were intimately related to the surrounding epithelial cells with short spindled features . In the well-defined nests, the epithelial cells had elongated nuclei and rather pale eosinophilic cytoplasm. Characteristically, many cells showed a longitudinal groove in the nuclei and frequent perinuclear haloes . Their cytologic features were similar to that of normal urothelial cells. Some nests showed cystic changes of varying degrees . The epithelial cells with short spindled features were arranged into ill-defined lobules or scattered singly and showed poorly defined cytoplasmic outlines . In the nuclei, the nuclear chromatin was fine and the nucleoli were small or inconspicuous. The cells also displayed occasional nuclear grooves. Neither cytologic atypia nor mitotic activity was noted in both types of cells. The second component was densely hyalinized fibrous stroma occupying areasbetween the cellular parts. The microscopic features of this tumor as a whole closely resembled an ordinary ovarian Brenner tumor.
+We performed immunohistochemistry on a Leica Bond-Max automatic slide immunostainer (Leica Biosystems Melbourne Pty., Ltd. VIC, Australia) using a standard protocol. The list of antibodies used is as follows: calretinin (Novocastra, diluted 1:200), CK7 (NeoMarkers, 1:400), CK20 (Novocastra, 1: 100), pancytokeratin (Novocastra, 1:100), CD10 (Novocastra, 1:150), CD34 (DAKO, 1:400), DOG-1 (Cell Marque, 1:250), c-KIT (DAKO, 1:300), p63 (Novocastra, 1:100), PAX-8 (Cell Marque, 1:200), SMA (DAKO, 1:400), vimentin (Zymed, 1:200), WT-1 (DAKO, 1:100), uroplakin-III (Cell Marque, 1:50), and GATA-3 (Cell Marque, 1:100).
+The cellular parts, including the urothelium-like cells and spindled epithelial cells were positive for pancytokeratin, p63, and WT-1 but negative for CD34, CD10, CK20, calretinin, c-KIT, DOG-1, and PAX-8. The urothelium-like cells were positive for CK7 but the spindled epithelial cells were negative. The cytoplasm of the urothelium-like cells was weakly to moderately positive for uroplakin-III, and their nuclei were diffusely strongly positive for GATA-3. The immunoprofiles of the urothelial-type cell nests in this tumor were the same as those of ovarian Brenner tumors. The spindled epithelial cells were negative for both uroplakin-III and GATA-3. The stromal cells only showed focal positivity for SMA .
+Using a representative paraffin block of the tumor, we performed mutation analyses for exons 9, 11, 13, and 17 of the c-KIT gene by polymerase chain reaction (GeneAmp PCR System 2700, USA) using a direct sequencing method (Applied Biosystems 3500 Genetic Analyzer, USA). The results of the c-KIT gene mutation analyses were negative.
+After surgery, the patient had recovered well and showed no recurrence during the 17-month follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1153_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1153_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9e413d89175f3fe2ea8874c8a7ecc8161ddf668f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1153_en.txt
@@ -0,0 +1,3 @@
+A 65-year-old man with severe, symptomatic AS was referred to our heart team. The preoperative echocardiography showed a severely degenerated bicuspid AS with a mean gradient of 41 mmHg (LVEF 47%). With an estimated mortality of 10.12% (Euroscore II) based on various severe co-morbidities, the heart-team recommended an interventional aortic valve approach. Because of furthermore severely calcified and stenotic iliac arteries, an approach via left subclavian artery was chosen using a self-expandable valve (Evolut pro+; Medtronic, Minneapolis, Minnesotta, USA).
+The procedure was performed in a hybrid operating room under general anesthesia. A transesophageal echocardiography (TEE) probe was inserted for periprocedural valve assessment. Via an incision in the infraclavicular fossa the left subclavian artery (8 mm in diameter) was exposed and an 8 mm Dacron tube was grafted for vascular access. The delivery sheath was introduced into the Dacron tube without passing the artery. By advancing the TAVI prosthesis under fluoroscopy within the subclavian artery an impediment at the level of the vertebral artery was sensed. The prosthesis was retracted and the location radiographically inspected. There was no severe kinking or harm to the vessel detected. Hence, the valve was reinserted and under slight resistance positioned in the annulus. After uneventful deployment of the prosthesis, function was assessed with TEE. It showed a 6 cm floating cylindrical structure in the course of the TAVI-prosthesis (Additional file ). Suspecting some intravascular damage, a control angiogram was performed, displaying a filling defect of the subclavian artery . We suspected an intimal tear caused by the valve insertion with subsequent dislocation and fixation in the struts of the TAVI-prosthesis. Since this highly mobile structure was considered to be potentially embolic, we proceeded to surgical extraction via sternotomy. Under CPB a median sternotomy was performed and routine cannulation for cardiopulmonary bypass was initiated. After aortic cross-clamping and cardioplegic arrest, aortotomy was performed. The intraoperative inspection revealed an intimal cylinder of the left subclavian artery nailed by the valve stent into the annulus, subsequently being completely removed leaving the correctly implanted TAVI in situ. Postoperatively, valve function (no regurgitation and a mean gradient of 2 mmHg) and blood circulation of the left arm were uncompromised.
+Yet, on postoperative day 4 absence of pulsation of the left-sided radial artery occurred. The CTA scan showed a dissection flap in the proximal left subclavian artery and distal contrast loss . Catheter-based vascular intervention with Fogarty balloon-removal of the dissected intimal flap was performed. Postoperative control revealed return of peripheral pulse on the radial artery . Further postoperative course was uneventful. The patient presented no new cardiac, vascular or neurologic sequelae at discharge.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1165_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1165_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7d55ae428b8b0579b41add4f453a383f2db227e6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1165_en.txt
@@ -0,0 +1,5 @@
+In November 2017, an asymptomatic 14-year-old boy referred to the authors’ hospital for management of right lateral chest wall mass discovered incidently one month earlier. There was no history of trauma. Clinical examination was unremarkable. Plain chest radiography showed a smooth-walled 6.0 × 3.5 cm homogenous right lateral chest wall mass (A). Computed tomographic (CT) scan revealed right lateral extrapleural soft-tissue mass 6.5 × 4.0 × 5.6 cm in size abutting 5th and 6th ribs and filling the 5th intercostal space (B). There were neither cavitation nor calcification within the mass, and the adjacent ribs were not eroded.
+Magnetic resonance imaging (MRI) revealed right extrapulmonary and extrapleural chest wall soft tissue mass. Tl-weighted MRI demonstrated a solid mass with a low signal intensity (C), while T2-weighted MRI demonstrated a homogeneous mass with high signal intensity similar to that of fat tissue (D). Early phases after administration of contrast, showed characteristic heterogeneous enhancement of the tumor that became more uniform during the delayed phase (E and F).
+The angiogram showed a sizeable vascular mass supplied by a branch of the internal mammary artery. That branch was subsequently embolized with Gelfoam pledgets with no further filling on the post-embolization arteriogram.
+The patient underwent an exploratory video-assisted thoracoscopy (VAT) through the right 8th intercostal space anterior axillary line (A and B). Posterolateral thoracotomy revealed well-demarcated mass abutting the 5th and 6th ribs filling the right 5th intercostal space. En bloc resection of the mass involved ribs and the intercostal muscles were performed (C). Chest wall defect was reconstructed using polytetrafluoroethylene (PTFE) patch (GORE-TEX®, DUALMESH®, W. L. Gore & Associates) (D).
+The surgical specimen measured approximately 6 × 4 × 3.5 cm, which included a hemorrhagic, highly vascular, mass that extended from the intercostal muscles to the extra-pleural space (E). Cut section revealed whitish homogenous material. Microscopically, there were homogeneous thick and thin-walled blood vessels with proliferating vascular spaces of capillaries of the cavernous type with intervening fibrous stroma (F). There was no evidence of recurrence at 3 and six months of follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1203_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1203_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0488c93cc6bcf569842644b4ff5a9763364534fb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1203_en.txt
@@ -0,0 +1,6 @@
+A 37-year-old woman was presented to the emergency room with abrupt severe right upper abdominal pain. The pain was squeezing and started suddenly after breakfast. The pain was not accompanied by vomiting or fever. The patient had previously been treated at the Department of Medicine in Samsung Medical Center with a diagnosis of EGPA. After successful suppression of blood hypereosinophilia with combination of prednisolone and azathioprine in recent months, she had been in the process of tapering prednisolone down to 15 mg per day. However, after dose reduction, her eosinophil counts slowly increased to 1989 cells/µL and levels of aspartate aminotransferase and alanine aminotransferase were elevated from normal to more than 300 U/L with mild abdominal pain. Consequently, her dose of prednisolone was raised back to 60 mg per day. While waiting for admission for further evaluation, abdominal pain brought her to emergency room.
+Five years ago, her first visit was prompted by symptoms of sinusitis, rash and eosinophilia. Three months later, numbness and cutting pain in both upper and lower extremities with fever, myalgia, and asthma developed. A nerve conduction study suggested multifocal sensorimotor neuropathy. Biopsy of the sural nerve revealed ischemic change resulting from vasculitis with prominent eosinophilic infiltration. Although perinuclear anti-neutrophil cytoplasmic antibodies were not detected, the patient was diagnosed as EGPA. After repeated intravenous cyclophosphamide pulse therapy with a high dose of systemic steroids, most symptoms were resolved. Sinusitis, presented as an initial symptom, improved after treatment at an early stage and otolaryngologic complication did not appear afterwards.
+However, whenever the tapering a dose of steroids was attempted, she developed new symptoms such as myalgia and arthralgia. She even experienced dry gangrene in the fingertips of both hands because of arterial thrombosis when her eosinophil count increased up to 6000 cells/µL . Duplex scan for arteries and veins indicated the total occlusion of the right distal ulnar artery and left medial forearm ulnar artery. The study also revealed a total occlusion of both mid-anterior tibial arteries, whereas toes of both feet were intact as other vessels of lower extremities were not involved. Hypercoagulability was thought to be caused either directly or indirectly by hypereosinophilia. We recommended mepolizumab, a monoclonal antibody to interleukin-5 used to interrupt eosinophil production, to reduce eosinophil count. But the patient refused it because of cost. We added aspirin and calcium channel blockers after cardiologic consultation. After the affected fingers were dried up, necrotized fingertips were amputated by orthopedic surgeon.
+Initial vital signs in the ER showed a blood pressure of 85/45 mmHg, a heart rate of 98 beats per minute with a temperature of 36.1’C, and a respiratory rate of 16 breaths per minute. Physical examination revealed mild tenderness in the right upper abdomen without rebound tenderness. The complete blood count revealed leukocytosis of 17,660 white blood cells/µL. Absolute eosinophil count was 1120 cells/µL. The erythrocyte sedimentation rate was 29 mm/hr, CRP was 3.7 mg/dL and total immunoglobulin E was 107 kU/L.
+An abdomen-pelvis CT demonstrated subcapsular hematoma in the right hepatic lobe . Hemoperitoneum probably caused by multifocal hepatic capsular arterial bleeding was also detected. There was no evidence of bowel perforation. In a previous CT scan taken 1 year before, there had been no evidence of any aneurysm changes in the hepatic vessels. A celiac angiogram demonstrated multiple, various sized hepatic aneurysms in both lobes . The small aneurysms resembled the appearance of a string of beads, characteristically observed in polyarteritis nodosa (PAN). Huge aneurysms larger than 1 cm in size were noticed in S7 and S8. Emergency embolization was performed. The huge aneurysm and the aneurysms with bead-like appearance in S7 and S8 were successfully occluded. Although several small aneurysms in S5, S6 and the left lobe still remained, no further embolization was performed to conserve hepatic function.
+Meticulous review of the abdomen-pelvis CT did not reveal evidence of aneurysms in other abdominal organs. After emergency intervention, vital signs became stable and numbness of both hands and feet improved. Based on her clinical course, we strongly recommended to add mepolizumab to control hypereosinophilia and reduce the dose of steroid. After administration of mepolizumab in addition to the previous steroid and cyclophosphamide therapy, eosinophil count became stable and was reduced to a near zero percentage of total white blood cell count.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1239_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1239_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cbccea24dcba64321a76d6919638980e370980b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1239_en.txt
@@ -0,0 +1,7 @@
+A 48-years old Asian female was referred to our hospital with a recent history of weakness, myalgia and arthralgia. She also complained of anorexia with 3 kg weight loss. She had no past medical history and was free of any medication on admission. At presentation, blood pressure was 180/80 mmHg, heart rate was 91/min, temperature was normal. Heart and lung auscultation, as well as abdominal examination, were normal. She had no skin involvement nor lymphadenopathy or synovitis.
+Biology showed acute kidney injury with serum creatinine at 209 μmol/L. White blood cell count (4.8 G/L) and platelet count (269 G/L) were normal, but anemia with hemoglobin at 7.8 g/dL was present. C-reactive protein was slightly increased (14 mg/dL). Urinalysis revealed glomerular proteinuria (proteinuria to creatinine ratio (P/C) 3.6 g/g) and microscopic hematuria. Kidney ultrasound examination showed normal sized kidneys and excluded obstruction. Thus, we concluded to acute glomerular syndrome and performed immunological laboratory tests. Antinuclear antibodies (ANA) (1/2560), as well as anti-dsDNA (292 UI/mL), anti-SSA and anti-SSB antibodies were detected. Type 3 cryoglobulinemia and complement consumption (decreased C3, C4 and CH50) were also present. Search for lupus anticoagulant, IgG anti-cardiolipin and anti-beta-2GP1 antibodies was negative. Finally, pANCA were detected at 1/2000 titer using IIF. ELISA showed the concomitant presence of MPO, PR3 and lactoferrine ANCAs with a strong positivity for MPO and lactoferrine ANCAs and a low positivity for PR3 ANCAs. ANCA detection using multiplex technology also detected MPO ANCA at high level, and low PR3 ANCA level.
+LN was first considered leading us to perform a kidney biopsy. On optical examination, extra-capillary circumferential cellular or fibro-cellular crescents were observed in 10 of 16 glomeruli. Segmental endocapillary proliferation was absent to very modest, without any lesions of capillary necrosis . Immunofluorescence analysis showed strong and diffuse mesangial and parietal C1q staining with a granular deposition pattern, while IgG, IgA, IgM, and C3 deposits were quite limited, of mesangial topography and only segmental .
+Following biopsy, an immunosuppressive treatment was initiated with an association of steroids, hydoxychloroquine and pulse intravenous cyclophosphamide (CYC, 500 mg every two weeks) according to the Euro-Lupus protocol trial . Under this regimen, a progressive improvement of both her general condition and kidney function was observed. At month 3 from treatment initiation (after the 6th CYC injection), serum creatinine was 116 μmol/L and P/C ratio decreased to 0.50 g/g. Antinuclear antibodies decreased to 1/200, anti-dsDNA antibodies became undetectable, and complement returned within normal range. ANCAs were still detectable although at lower titer using IIF (1/200), with only MPO ANCAs remaining slightly positives at ELISA and multiplex assays.
+At that time, we decided to perform a systematic kidney biopsy to analyze histological response to treatment. On optical examination, only fibrotic crescents were observed in 9/14 glomeruli, none of them being cellular of fibro-cellular. Global lesions of endocapillary proliferation were observed in most glomeruli, without lesions of capillary necrosis . Immunofluorescence analysis showed diffuse mesangial and parietal C1q staining at a lower intensity as compared to the diagnostic biopsy. IgG, IgA, IgM, and C3 deposits remained limited, in their pattern and intensity .
+After the biopsy results, we decided to continue CYC. However, after the 8th CYC injection, the patient developed toxidermia which we attributed to CYC. At that time, we decided to start mycophenolate mofetil (MMF) at 1.5 g/day.
+One year after initial admission and under MMF for 12 months, she has no clinical manifestation of SLE and did not relapse nephritis. Renal function returned to near normal values (serum creatinine of 90 μmol/L, MDRD eGFR 60 mL/min/1.73m2). ANCA detection was negative on IIF evaluation and ELISA, with anti-MPO being still detectable at very low level using multiplex assay. ANA were stable at 1/200, complement was in normal range and search for cryoglobulin was negative.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1250_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1250_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5deecb0f8cca95b906ada0941c14312a532479dc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1250_en.txt
@@ -0,0 +1,12 @@
+A 53-year-old male from Kerala, South India presented with loose stools, which were watery in nature and without blood, three–four episodes per day for 3 weeks. He complained of vague abdominal pain on and off, decreased appetite and weight loss of 3–4 kg over 1 month. He gave no history of associated fever, vomiting, urticarial rashes, or any respiratory symptoms.
+In addition to having alcohol use disorder, he was a known case of type II diabetes mellitus, hypertension and hyperlipidaemia and was on regular oral medications for the previous 2 years. He also experienced recurrent episodes of stroke, which resulted in a left-sided hemiparesis 2 years previously. He was also diagnosed as having pulmonary tuberculosis (sputum-positive), for which he had been on anti-tubercular therapy (ATT) for the previous 6 months. He denied intravenous (IV) drug abuse or any high-risk sexual behaviour. He was not on steroids or immunosuppressive drugs and gave no history of travel outside the state. He reported consumption of only cooked food and there was no food intolerance. All his family members were reported to be healthy.
+He was a cattle farmer and worked barefoot on his cattle farm; he also had a shallow pond near to his home where he used to grow freshwater fish for consumption. To his knowledge there was no practice of open field human defecation in the farm area.
+He was treated symptomatically at primary health care facilities and since there was no relief, he was referred to this tertiary care centre.
+On clinical examination, he was not febrile and vitals were within normal limits. He had bilateral pitting pedal oedema and macular erythematous rashes over the anterior aspect of both the legs for 2 weeks, which were non-migratory in nature. Systemic examination was normal.
+Routine blood investigations showed decreased haemoglobin (Hb) 9.6 %, elevated total count (TC) 13 600 cells cumm−1 with differential count (DC), polymorphs 90 %, lymphocyte 6 %, eosinophil 2 % and monocytes 2 %, an erythrocyte sedimentation rate (ESR) of 78 mm h−1, and serum electrolytes showed hypokalaemia (potassium – 2.6 meq l−1). His random blood sugar on admission was elevated (274 mg dl−1). He tested negative for viral markers of human immunodeficiency virus (HIV), hepatitis C virus (HCV) and hepatitis B virus (HBV). Ultrasonography (USG) of the abdomen showed fatty hepatomegaly with focal lesions in the liver, for which computed tomography (CT) of the abdomen and pelvis with contrast was performed. This showed several hypodense lesions involving segment 5 of the liver with mild hepatomegaly. CT of the lungs showed cavitation in the upper lobes of both lungs. Upper gastrointestinal endoscopy was performed, which was normal. Stool was sent for microscopy and bacteriological culture.
+Macroscopically, the stool was watery, yellowish coloured, with no mucus or blood. Wet preparation revealed numerous motile larvae in the rhabditiform stage, which measured 100–400 µm in length×15–20 µm in width and had a short buccal cavity. There were a few oval shaped eggs, ~50–60×30–35 µm in size, with larvae, suggestive of S. stercoralis. There were no pus cells or red blood cells. Stool microscopy following the formal ether concentration technique did not show any additional findings. Stool microscopy was repeated with freshly collected stool samples on three separate occasions, which also demonstrated motile rhabditiform larvae of S. stercoralis . In addition, agar culture method was performed to visualize the positive trail sign. Nearly 2 g of freshly passed stool was placed on an agar plate. The plate was sealed with tape and then incubated at room temperature for 2 days. The plate was later examined and showed a ‘positive trail sign’, that is, there were tracks present as the bacteria were carried over the agar by the migrating larvae. The agar culture method was to be repeated after therapy, if microscopy of stool did not reveal larvae, as it is a more sensitive test for assessing the elimination of the parasite.
+The bacteriological culture of stool yielded Aeromonas sobria, which was sensitive to ciprofloxacin, chloramphenicol, tetracycline and cotrimoxazole. Stool occult blood (Hemospot kit, standard guaiac method, Tulip Diagnostics, Goa, India) and toxin (VIDAS difficile toxin A and B, bioMérieux SA) were negative.
+Hyperinfection syndrome with disseminated strongyloidiasis, alcoholic liver disease, type 2 diabetes mellitus, hypertension, dyslipidaemia and pulmonary tuberculosis.
+Therapy included blood sugar and electrolyte correction and the patient was empirically started on ciprofloxacin intravenously (IV) along with parenteral fluids and other supportive measures.
+Following the stool microscopy report, a stat oral dose of a combination of albendazole 400 mg and ivermectin 6 mg, followed by once daily for 2 days, was given. The patient was continued on ciprofloxacin IV for 4 days. He showed symptomatic improvement by the second day of treatment, his stool became semisolid in consistency and the number of motile larvae in fresh stool showed an appreciable reduction. He was discharged after 4 days on mixtard insulin and oral ciprofloxacin 500 mg twice daily for 3 days.
+The patient was readmitted on the third day of discharge with complaints of fever and recurrence of diarrhoea. His blood sugar value at the time of readmission was again elevated (210 mg dl−1). His total leucocyte count (TLC) was 12 000 cumm−1, with polymorphs 60 %. His blood was sent for culture and empirical therapy was initiated with injected piperacillin/tazobactam and mixtard insulin. Unfortunately, on day 2 of readmission he expired. was isolated from his blood culture 3 days after his readmission, sensitive to cephalosporins, carbapenems, piperacillin/tazobactam and aminoglycosides, but resistant to ciprofloxacin, which he was discharged on for the infection.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1252_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1252_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d203acd9c9bcd3ebeecd032644837e6288b2dbae
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1252_en.txt
@@ -0,0 +1,7 @@
+A 64-year-old male patient was admitted to the hospital because of upper abdominal pain lasting for 1 year.
+The patient had upper abdominal distension and discomfort for more than 1 year, accompanied by poor appetite. After eating, the patient felt upper abdominal fullness and painful discomfort, which could be relieved slightly by resting or taking acid-inhibiting drugs orally. The symptoms were slightly aggravated 3 mo ago, accompanied by weight loss.
+The patient denied any history of hypertension, diabetes, and coronary heart disease; hepatitis, tuberculosis, typhoid fever, malaria, and other infectious diseases; and major trauma, surgery, and drug or food allergies. Vaccination history is unknown. He had a history of smoking and drinking for more than 40 years.
+No significant family history.
+The patient’s weight was 56 kg and his height was 170 cm, with a calculated body mass index of 19.3 kg/cm2. His Karnofsky Performance Scale score was 100. No enlarged superficial lymph nodes were palpable. His abdomen was flat, and there was no gastrointestinal or peristaltic waves. There was mild tenderness in the upper abdomen, but there was no rebound pain. The shifting dullness was negative, and the frequency of borborygmus sounds was 4 times/min.
+Tumor marker levels [carcinoembryonic antigen, cancer antigen (CA)-199, and CA125] and routine laboratory blood test results were within normal ranges.
+Computer tomography examination showed thickening of the gastric angle. Gastroscopic examination was performed, and an ulcer at the gastric horn was found. Then pathological biopsy findings confirmed that the ulcer was a gastric adenocarcinoma (clinical stage: cT1bN0M0).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1260_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1260_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..60ca71149c1500c4e78ceb573738afada5d2f94c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1260_en.txt
@@ -0,0 +1,3 @@
+A four-year-old girl presented to the emergency service with painful left hip and fever. There was no previous relevant medical history. There were no other local or systemic symptoms, except for a cervical adenopathy. On physical examination, she walked with a limp, and movements of the left hip were painful (mainly external rotation), but not restricted. Blood exam revealed anemia (Hb 8.7 gr/dL), normal WBC, ESB of 123 mm, and reactive C protein of 149.7 mg/L. An initial X-ray to the pelvis revealed no changes. An ultrasound of the left hip was performed revealing small infusion and synovitis. Guided puncture was then performed being macroscopically compatible with reactive arthritis, and general and bacteriological tests were demanded. Because of the unusual characteristics of the pain, a CT scan to the abdomen and pelvis was performed revealing a left adrenal mass and retroperitoneal adenopathies in the celiac trunk and superior mesenteric artery .
+Despite the painful complaints of the patient, no bone or articular involvement was found in the CT scan. No further alterations were reported in the thoracic CT scan or in peripheral blood smears. Bacteriological examination of the hip effusion was negative. MRI was also performed. The direct myelogram was compatible with infiltration from neuroblastoma. Bone marrow biopsy and cervical adenopathy specimens were collected to perform histological diagnosis. Skeletal scintigraphy demonstrated numerous points of osteoblastic activity compatible with metastatic activity, and the 12 iodine-123 metaiodobenzylguanidine scintigraphy concluded the following: “Abdominal mass with low expression of noradrenergic transporters. Diffuse bone metastasization with high expression of noradrenergic transporters. No other soft tissue involvement was detected.” In the histological report of the cervical adenopathy, the diagnosis of neuroblastoma NOS was performed. Immunohistochemistry revealed extensive expression for synaptophysin and CD56 (NCAM) and absence of expression of myogenin. .
+Bone marrow biopsy revealed extensive metastatic involvement. The patient started chemotherapy two weeks after admission, with 8 cycles of rapid COJEC protocol. After six months of follow-up, the primary tumor was still without criteria for resection, despite a decrease in the metastatic involvement. Given the chemotherapy-related renal toxicity, it was decided to proceed with irinotecan in combination with temozolomide (TEMIRI). After thirteen months of follow-up, no significant regression of the primary tumor occurred, so surgery was contraindicated and the patient was proposed for stem cell treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1266_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1266_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c00e2abda53c1ab262d026b7e57792252a84b812
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1266_en.txt
@@ -0,0 +1,6 @@
+A 58-year-old Japanese man was presented to our out-patient unit complaining of posterior cervical pain. The pain firstly appeared 3 months before the first contact to us without any particular triggers such as trauma. He was relieved from the pain when lying flat; however, he kept working as a plumber and the pain got worse over the time period. A brain computed tomography (CT) was performed 1.5 months after the onset in another clinic and it revealed bilateral subdural effusion , still, no treatment was given at this point. Later on, when he was presented to our hospital, numbness and weakness of extremities also appeared in addition to the progressive posterior cervical pain as well as headache. He had a medical history of hemorrhoid and no particular familial history.
+The patient admitted to our department soon after the initial contact. A hand-held dynamometer revealed his weakened grip strength of both of his hands by 30–40 kg. He was also presented with bilateral muscle weakness in his lower extremities which was 4 of 5 in the Manual Muscle Test (MMT) score , as well as sensory disturbances in his forearms, hands and the posterior surface of thighs on both sides. His Japanese Orthopedic Association (JOA) score was 13.5.
+A fat suppression T2-weighted MRI without gadolinium enhancement of the cervical spine illustrated a fluid collection in the soft tissue spaces of the retrospinal region at C1-C2 level . Additionally, it demonstrated spinal canal stenosis at C3/4 level. Subsequently, a cisternoscintigram and a CT myelogram were performed with intradural injection of 111In-DTPA (Nihon Mediphysics, Tokyo, Japan) and Omnipaque 240® (Daiichi-Sankyo, Tokyo, Japan), an iodine contrast agent, through a lumber puncture. The 111In-DTPA cisternoscintigram clearly revealed CSF leakage into the retrospinal region at C1-C2 level, as well as blockage of the 111In-DTPA at lower level of the cervical spinal canal . Furthermore, the CT myelogram also suggested blockage at lower level of the cervical spinal canal; though it did not demonstrated the sign of CSF at C1-C2 level or any other sites .
+72 h of conservative therapy, including bed rest, intravenous fluid hydration, muscle relaxants and non-steroidal anti-inflammatory drugs, was ineffective at improving his symptoms, and the re-examination of brain CT showed progression of the bilateral subdural effusions to bilateral subdural hematomas .
+After reviewing of his imaging data and confirmation that no other cause presented in development of subdural hematoma along with careful discussions, we gave a diagnosis of intracranial hypotension due to the CSF leakage from C1-C2 level, which might be caused by spinal canal stenosis at C3/4 level. We, therefore, performed burr-hole drainage of the subdural hematoma, blood-patch therapy at C1/2 level and laminoplasty at C3–4, at the same time. In the laminoplasty, CSF flew out from the epidural space subsequently to the opening of lamina, and after sufficient decompression, the CSF flow was reduced in the operation field, without detection and restoration of dural tear (Video). In the blood-patch therapy, an epidural catheter was inserted from the surgical field at C3–4 level to C1-C2 level under x-ray fluoroscopy observation. Approximately 5 ml of autologous blood sampled from patient’s peripheral vein was injected to the epidural site at C1-C2 level and the blood-patch therapy was achieved.
+Postoperative response was significantly favorable. His symptoms completely improved and the imaging features that suggested CSF leak and intracranial hypotension disappeared . He discharged on postoperative day 10 with satisfaction, and no signs of recurrence were observed for 5 months postoperatively up to this point. The patient returned to his daily life as well as his occupation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1281_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1281_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4a53ae7554c6a838c83b0adb3ee97682022abb69
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1281_en.txt
@@ -0,0 +1,4 @@
+A 33-year-old female presented 3 months postpartum with a headache of moderate severity and progressive visual loss in both eyes. On examination, the patient's Glasgow coma scale (GCS) was 15/15. Visual field examination showed left homonymous incomplete hemianopia. Her visual acuity was 20/25 in the right eye and 20/30 in the left eye. Her discs and macula were healthy bilaterally. Extraocular movements were intact and pupils were reactive. The rest of her examination was unremarkable. Complete endocrine workup was normal.
+Magnetic resonance imaging (MRI) revealed a large heterogeneous, hyperintense, hemorrhagic right suprasellar extra-axial complex cystic structure measuring 31 × 30 × 90 mm on T1-weighted images. There was mass effect on the adjacent hypothalamus and third ventricle displacing them toward the left and superiorly in addition to the optic pathway. The pituitary stalk was displaced toward the left. The lesion encased the right posterior cerebral artery and displaced the right carotid artery laterally . Computed tomography (CT) arteriography demonstrated a completely thrombosed center. The imaging findings were compatible with suprasellar CM.
+The patient underwent right frontal craniotomy and gross total resection of her suprasellar intrachiasmatic large infiltrative hemorrhagic CM. Organizing blood clots with reactive fibrohistiocytic and inflammatory reaction admixed with some ectatic vascular channels suggestive of a vascular malformation were noted. There were small foci admixed with granulation tissue, showing some dilated cavernous spaces that would be compatible with a vascular malformation such as cavernous angioma. On immunohistochemistry, the lesion was CD163+, CD20 rare, CD3+, CD34+, CD31+, CD38+, CTK−, EMA plasma cells, GFAP−, S100 dendritic cells, SMA vascular smooth muscle.
+The patient had an uneventful operative course. Her visual acuity improved to 20/20 in both eyes. Extraocular muscles showed mild limitation of both eyes in an upward gaze. Otherwise, she was stable with no neurological deficits. Follow-up MRI at 12 months revealed complete removal of the suprasellar hemorrhagic CM with no evidence of a residual lesion or recurrence .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1296_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1296_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4259bc43cd9bd9695c7dbc33d5fe1cf993512147
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1296_en.txt
@@ -0,0 +1,5 @@
+A 19-year-old Caucasian man was admitted to our emergency department with a critical ischemia of his right ring finger due to a crushing injury. His finger had been caught between a car and a car-jack while he was working as a mechanic. The first physical examination of the ring finger revealed an open wound of 3 cm on the dorsal side of the middle phalanx. Edges of the wound reached the ulnar and radial digital neurovascular bundle. The patient reported decreased sensibility of the end phalanx including painful range of motion (ROM) but without loss of function of all tendons. We found a restricted finger blood flow detected by nail bed compression in comparison with the uninjured fingers. An X-ray showed an undislocated transverse fracture of the middle phalanx . The patient was immediately transferred to the operating room (OR) where the wound was examined. Severe damage of the surrounding soft tissue was seen. Microscopic examination revealed no defect of the crushed vessels, the radial digital nerve was intact, but an epineural lesion was apparent for the ulnar digital nerve. A minimal osteosynthesis with two Kirschner-wires (K-wires) was performed. X-ray imaging showed an anatomical retention and fixation of the fracture . The dorsal wound of the ring finger was cut out and sutured. The patient was discharged from the hospital on the fourth day without any sign of wound healing disturbance. The ring finger was immobilized with a finger splint including the proximal interphalangeal joint (PIP) and distal interphalangeal joint (DIP).
+The patient was seen five months after initial treatment in our Out-Patient Clinic and reported painful moving of the right ring finger. The examination showed an instability of the middle phalanx with a passive lateral movement. Twenty degrees ulnar deviation of the ring finger with decreased ROM of the PIP joint (E/F 0-0-60˚) was apparent. In addition, the ring finger tended to cross over and overlap the adjacent finger when making a fist. The patient reported that ulna deviation of the ring finger started when K-wires had been removed by an office-based orthopedic surgeon two months after the initial surgery.
+Since that time the finger was fixed again with a splint. He also complained about tingling, coolness and numbness of the injured finger. Since the X-ray showed a nonunion we started treatment with a LIPUS device (Fa. Melmak GmbH, Munich, Germany) three times daily for 20 minutes including the following parameter configuration:
+Average intensity I = 30 mW/cm² (SATA), ultrasound frequency F = 1.5 MHz, signal impulse duration 200 microseconds, repetition rate 1 kHz, effective radiating area 3.88 cm2, temporal average power 117 mW.
+The ring finger was immobilized with a fitted personalized thermoplastic splint for six weeks. Six weeks after LIPUS treatment the patient reported to be without pain when moving his ring finger and clinical examination revealed a slight persistent ulna deviation of five degrees. The clinical examination showed a stable middle phalanx compared to the result six weeks previously. After four weeks of physiotherapy the ROM of the PIP joint was E/F 0-0-85° and the fist closure was full , except for the pre-existent limited ROM of the DIP-Joint (E/F 0-0-15˚). An X-ray confirmed fracture healing and calcification of the soft callus was clearly evident .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1302_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1302_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..14b6b6582aa429feffd521464ed39477866f860e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1302_en.txt
@@ -0,0 +1 @@
+A 46-year-old male with end-stage renal disease of unknown cause had been on hemodialysis for 3 years when he underwent cadaveric renal transplantation 15 months ago. Except for 3 years of hypertension, there was no other remarkable medical history. The kidneys of donor after brain death were procured by an operation group. However, during harvesting of the donor’s kidneys, a branch of right renal artery to renal superior polar was inadvertently cut off. The artery branch with a diameter 0.3 mm arised from the bifurcation of abdominal aorta and renal artery. Subsequently the severed renal artery branch was anastomosed in situ with 7–0 prolene during the repair of the kidney. Although the lengh of the renal artery branch became little shorter, the major trunk of renal artery was not excessively stretched. The cold and warm ischemia time of the kidney were 5 min and 6 h respectively. The right kidney of donor was transplanted in the right iliac fossa. The donor renal artery with a Carrel patch of donor aorta was anastomosed end-to-side to the recipient right external iliac artery with 6–0 prolene, and renal vein was anastomosed end-to-side to the recipient right external iliac vein with 5–0 prolene, and the graft ureter was anastomosed to the urinary bladder of the recipient with a double J stent. Basiliximab was used as immunity induction on the day of surgery and the fourth day after transplantation. His immunosuppression regimen consisted of tacrolimus, mycophenolate sodium, and prednisolone. His immediate postoperative course was unremarkable. His blood pressure was controlled to 140–156/90–105 mmHg with nicardipine spironolactone, and furosemide y. The 24-h urine volume was between 1937 and 4100 ml, and his renal function. Significantly improved, reaching a creatinine of 151 μmol/L on 11st day posttransplantation. However, from the 12nd day after transplantation his blood pressure began to gradually increase to 170–174/103-109 mmHg.There was no positive presentation on clinical examination and ultrasonograph, and the level of creatinine and urine volume were also stable. So the nicardipine was increased. To our surprise, it was still difficult to control his blood pressure even though three antihypertensive medications (sustained-release nifedipine 60 mg twice daily, urapidil 30 mg twice daily, arotinolol 10 mg twice daily) were administrated. His blood pressure reached to 190/120 mmHg on 20th day after transplantation. There was a decrease in 24-h urine volume with 1620-1725 ml, and mild impairment of renal function with a creatinine of 194 μmol/L. A bruit became audible over the site of the transplanted kidney. Color Doppler ultrasonography indicated a decreased RI in intrarenal arteries and increased blood flow of the transplant renal artery, with RI of 0.45, the peak systolic velocity(PSV) of 305 cm/s and the velocity gradient between stenotic and prestenotic segment of more than 3:1, therefore, a vascular complication of TRAS was suspected. Diagnostic arteriography was performed through a retrograde contralateral femoral artery puncture on 22nd day after transplantation, and it showed a 90% stenosis of transplant renal artery, and the TRAS occurred in the distal site of the anastomosis instead of the anastomosis . We considered that the reconstructional renal artery branch stretched the trunk of renal artery, which resulted in the stenosis distal to the suture line. Two days later, after sufficient preparation renal artery angioplasty was undertaken through a retrograde ipsilateral femoral artery approach. As the stenosis might be high elastic due to the stretch, percutaneous transluminal stent implantation was performed. Because the artery branch situated on the stenosis, bare stent (6 × 14 mm, Express Vascular SD) had to be chosen to avoid effecting the flow of the artery branch. After the bare stent was successfully deployed, a second angiographic evaluation verified the effectiveness of the intervention was obvious. After the interventional treatment, the renal function and urine volume recovered, and his blood pressure was stably controlled to 121/80 mmHg with only two antihypertension (nifedipine and arotinolol). He was discharged on 28 day after transplantation with a creatinine of 108 μmol/L. Changes in clinical parameters over the 1-month treatment period is shown in Table . The patient’s renal function remains stable at clinical follow-up of 15 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1317_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1317_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c30e2610d68db2b6da8c71d8213191ede6c5ce36
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1317_en.txt
@@ -0,0 +1,2 @@
+A 25-year-old right-handed male was admitted to our department with a chief complaint of swelling of the dorsal aspect of his right wrist for 3 years. There was no persistent pain in the right wrist. He had not suffered from severe trauma. The patient had undergone an ineffective superficial surgery of the right wrist 2 years earlier and no pathological specimen was sent. The wrist deformity had progressively worsened over the following 2 years. Physical examination showed a range of motion in the wrist of extension to 60°, flexion to 30°, ulnar deviation to 20°, and radial deviation to 0°. The fingers moved normally and functioned normally. Neurological examination of the right hand revealed diminished pain sensation. Apart from that, patients reported an obvious diminishing of pain when injured before. General laboratory tests did not reveal anything specific. X-ray examination confirmed bone resorption of the scaphoid . Magnetic resonance imaging (MRI) examination showed hyperplasia of the surrounding tissue, but no damage to the articular surface of the radiolunate joint . He was at that time diagnosed with synovitis and radiocarpal arthritis. We managed his disease with Four-Corner Arthrodesis and Synoviectomy to alleviate the damage of the joint and preserve motor function. At the time of surgery under general anesthesia, we observed synovial hyperplasia , the collapse of the proximal half of the scaphoid, an intact radiolunate joint surface , wear of the radialis carpal articular surface of radius , and a deformity of dorsal intercalary segment instability (DISI). Following a limited intercarpal arthrodesis, the intraoperative radiograph showed improvement . The wrist was fixed in a functional position, and the patient was then discharged.
+The patient’s right wrist became red, painful, progressively swollen, and immovable over the next 2 months. Imaging indicated increased carpal bone damage . The white blood cell count was 8.81 × 109/L (reference values 4.00 × 109/L–10.00 × 109/L), and the proportion of neutrophils was 65.6% (reference values 50.0%–70.0%). Biopsy results showed no bacteria were cultured. Antinuclear antibody anti-cyclic citrullinated peptide antibodies and rheumatoid factor were negative. Results of acid-fast staining, T-SPOT.TB, and tuberculosis (TB) were both negative. Rheumatoid arthritis, TB arthritis, and infectious diseases were ruled out in this case. Because of the hypalgesia before surgery, a cervical MRI was conducted for further antidiastole, which revealed Chiari II syringomyelia . The patient was eventually diagnosed with destructive NA (syringomyelia), ut refused to undergo carpal and spinal surgery. After 2 months of conservative treatment, the right wrist spontaneously and completely fused and the pain disappeared . During the 1-year follow-up, there was no acute change in the condition . The patient was generally satisfied with the outcomes of the treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1345_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1345_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..302c9b006b8a2b7d809a7316513df5a4b567c806
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1345_en.txt
@@ -0,0 +1,8 @@
+A 32-year-old woman with a gestational age of 32 wk + 4 d experienced epigastric pain. She was asymptomatic for COVID-19.
+She first experienced pain in the epigastrium 2 h before the initial examination, with a gradual worsening of her condition.
+The patient had no comorbidities and was not taking any chronic medication.
+There was no significant personal or family history.
+Physical examination revealed epigastric pain, with a body temperature of 36.5 °C, blood pressure of 17, 6/11 kPa, and oxygen saturation of 97%. Electrocardiogram (ECG) and cardiotocographic findings were normal. We initially suspected her to have hemolysis, elevated liver enzymes, and low platelet count syndrome (HELLP) and performed fetal lung maturity induction while administering 12 mg betamethasone intravenously for 24 h.
+Blood tests results revealed elevated liver enzymes [alanine aminotransferase (ALT): 272.4 IU/L, aspartate transaminase (AST): 159.6 IU/L, and alkaline phosphatase (ALP): 172.8 IU/L], without any findings of viral hepatitis (the samples were negative for hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis E virus, Epstein-Barr virus (EBV), human cytomegalovirus (HCMV). Her coagulation parameters were normal; hence other pregnancy-related liver pathologies were excluded. The hepatologist suggested that her condition was most likely related to hepatopathy of unknown etiology. SARS-CoV-2 positivity on reverse transcription-polymerase chain reaction was confirmed, although the patient was asymptomatic.
+The initial ultrasound examination revealed a live fetus without any abnormal findings.
+Over a week, the liver enzymes and platelet count returned to normal levels. On the fourth day of hospitalization, pain developed in the right subcostal region and physical examination revealed a positive Murphy’s sign, while her ECG was normal, D-dimers concentration was above 10000 µg/L, and liver enzymes were slightly elevated (ALT: 372 IU/L; AST: 258 IU/L). Therefore, we ruled out acute coronary syndrome. Abdominal ultrasound examination confirmed no abnormalities in the abdominal organs, a viable fetus, and no free fluid in the abdominal cavity. We administered anticoagulant therapy (0.3 mL low molecular weight heparin every 12 h). The correlation between the laboratory findings and clinical findings was unclear. Within 2 h, the patient developed a collapsed state without trauma and her blood test showed a marked increase in ALT (1789.8 IU/L) and AST (1747.2 IU/L). In addition, lactate dehydrogenase (LD) levels (1671 IU/L) and platelets (88 × 109/L) were highly elevated. Therefore, an emergency cesarean section was planned.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_134_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_134_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4f6c7714461e0973a425860e548376f244ff6c9c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_134_en.txt
@@ -0,0 +1,4 @@
+The patient was a 48-year-old female with a 20-month history of right-sided orofacial pain. Her main complaint was paroxysmal pain in her auditory canal, pinna, deep in the jaw, and adjacent retromastoid area on the right side. The pain was described as a burning sensation in an area located in the posterior external auditory canal wall and was elicited by chewing, touch, or contact with objects or warm water. It usually lasted for a few seconds to 1–2 min and would remit spontaneously and abruptly. The patient ranked it 10 on the numeric rating scale. She had no odynophagia and was treated with carbamazepine (maximum 1200 mg/day), which proved to be ineffective. Other medications (Sertraline, Amitriptyline, and Pregabalin) also failed to provide clinically significant pain relief. The patient's otoscopic examination was unremarkable bilaterally. There was no sensory loss, facial palsy, or other neurological signs.
+The patient underwent preoperative MRI and MRI angiography, including 3D T2-weighted fast spin echo and 3D constructive interference in the steady-state (CISS) sequences. Images showed the right posterior cerebellar artery crossing the cerebello-pontine cistern [arrow in ] in close contact with the right VII and VIII nerves [arrow in ], near the internal auditory canal.
+A right-sided suboccipital retrosigmoid craniotomy was performed. The patient was put in a left lateral decubitus position, with the head well rotated and fixed in a Mayfield clamp. The dura was opened. Minimal retraction of the cerebellum was performed to achieve cerebrospinal fluid (CSF) drainage. In the cerebello-pontine angle, as shown in , the loop [arrow-head in ] of the PICA was visualized, as well as the close contact between the vascular structure and the VII-VIII nerves complex [* in ]. Additional exploration did not reveal other areas of neurovascular conflict at the roots of the trigeminal nerve or the lower cranial nerves. The artery's arachnoid attachment was dissected, the artery mobilized, and a small Teflon felt was placed to separate the artery from the nerve. Sectioning of the intermediate nerve or excision of the geniculate ganglion (GG) was not necessary.
+Following the decompression, the patient had an uneventful postoperative recovery and the pain resolved immediately with no additional neurological deficits, demonstrating that the compression was the only cause of pain. Postoperative CT scans were unremarkable. Medication was tapered off in the first few weeks after surgery. At 6-months’ follow-up, no further paroxysmal pain had occurred.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_136_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_136_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..67a03452a88bd834820bb036318b910d31f8bc3c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_136_en.txt
@@ -0,0 +1,2 @@
+A 3-year-old girl was transferred to our center for severe cough, shortness of breath, fatigue and fever. Physical examination revealed facial deformities and growth retardation. The patient was diagnosed with hypothyroidism, CHD and PH by examinations at the age of 11 months old. Her transcutaneous finger oxygen saturation was 70%. Echocardiography showed a 0.9cm-wide ASD, a widened pulmonary artery, and severe tricuspid regurgitation . Laboratory tests suggested that NT-proBNP was 3907pg/ml, the C-reaction protein level was 19.83mg/L, and the white blood cell was in the normal range, but the percentage of neutrophils increased to 78.7%, and (respiratory syncytial virus) RSV-IgM was positive. Liver function, kidney function, the level of autoimmune antibodies, and the erythrocyte sedimentation rate were normal. The patient was given anti-infection and cardiotonic drugs as well as respiratory support after admission.
+Meanwhile, the patient underwent right heart catheterization. The results indicated that the mean pulmonary arterial pressure (mPAP, 71mmHg) was markedly increased, the pulmonary vascular resistance (PVR, 27WU) also enlarged, and the pulmonary capillary wedge pressure (PCWP) is normal. Since the ASD was small and the slow flow rate could not result in the tremendous elevation in the pulmonary arterial pressure, the pathogenesis should be further investigated. No obvious abnormalities were found from the results of the pulmonary test, cardiac CTA and other routine etiological examinations in the patient. Nevertheless, the genetic inspection (the accession number for the whole-exome sequencing data is HRA005032) showed that the patient had a KMT2D (ENSMBL reference ID: NM_003482.3) exon 39 c.12209_12210del p.(Ser4070fs) mutation . Based on the genetic results and abnormal countenance, the patient was diagnosed with KS type 1. The patient developed severe PH and poor oxygenation, and she was classified into the high-risk population by risk stratification was. Therefore, she received triple targeted pulmonary vascular pressure reduction treatment, i.e., Ambrisentan (2.5mg once daily) + Tadalafil (10mg once daily) + Remodulin (continuous subcutaneous pumping). The patient was followed up regularly after discharge, but the effect was unsatisfactory. The latest echocardiography reexamination showed no change in the size of the ASD, moderate tricuspid regurgitation, and estimated pulmonary arterial systolic pressure of 96mmHg.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1388_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1388_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ec1cd3d37f970151e88739116d477f855962ec00
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1388_en.txt
@@ -0,0 +1 @@
+A 66-year-old male patient presented with exertional chest tightness, shortness of breath, and right lower limb weakness for two weeks. He was diagnosed with a cardiac mass two months ago in another hospital. He had a history of hypertension from last 20 years which was under control with treatment. He underwent radical rectal surgery for rectal cancer five years ago and experienced intermittent fecal incontinence after surgery. On physical examination, his blood pressure was 124/67 mmHg, temperature 36.6 Co, pulse 64 bpm, RR 20/m. On percussion, the dullness of the left heart border was slightly extended indicating left heart enlargement. On auscultation, heart sounds were normal in all areas with normal rhythm and moist rale in both lung fields. Abdominal ultrasound revealed liver and left renal cyst. The prostate gland was mildly enlarged with calcified plaques. Coronary angiography (CAG) was performed without any remarkable findings. Transthoracic echocardiography (TTE) showed a mitral valve hypoechoic space occupying lesion with clear borders. Color doppler showed no blood flow signals around or inside the cystic mass. Contrast enhanced echo showed no contrast medium perfused into the cyst with moderate mitral regurgitation (MR) and ascending aortic dilation as shown in Fig. . Computed tomography (CT) examination revealed an elliptical low-density filling defect in the mitral valve area of the left atrium with a cross-sectional size of about 2.9*1.2 cm as shown in Fig. . Based on echocardiography, and CT report a preliminary diagnosis of cardiac cystic tumor was made. He underwent thoracoscopic surgery under general anesthesia and a cardiopulmonary bypass. The arterial and venous cannulation was done through the right femoral artery and vein respectively. A 4 cm incision was made in the 4th intercostal space (ICS) at the right anterior axillary line, a 3 cm incision in the 3rd ICS in the mid auxiliary line, and a 3 cm incision in the 2nd ICS in the midclavicular line. The aorta was cross-clamped and the cardiac arrest was achieved with the help of cardioplegia infused through the aortic root. There was no thrombus found in the left atrium. A cyst of about 20*20 mm at the P1 position of the posterior mitral leaflet was observed with mild enlargement of the mitral annulus. The mitral valve showed moderate regurgitation. The cyst was removed and the posterior leaflet of the valve was repaired with a complete semirigid 28 mm annuloplasty ring placed. The saline leakage test showed good competency of the mitral valve. The postoperative histopathology report showed a 2.5*2*0.7 cm gray and white cyst with smooth inner and outer wall. The tissue presented cyst like structure with no clear coated epithelium. There was fibrous hyaline degeneration and mucous degeneration of cystic wall and small foci of hemorrhage which confirmed the diagnosis of the mitral valve blood cyst . The patient recovered well without any complications. The postoperative echocardiography showed no MR. Patient was doing well and was asymptomatic on six months follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1390_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1390_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9c3573fc94bd5e47adadf05bfc31f00ca448683a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1390_en.txt
@@ -0,0 +1,7 @@
+A 28-year-old Caucasian male presented with fever and myalgia at our emergency department (= day 1). The patient reported having been on vacation on La Réunion until nine days prior, where a medium-level dengue epidemic had been declared by the WHO. His past medical history was uneventful; he was not on any medication. Physical examination revealed a body temperature of 39.7 °C but was otherwise unremarkable. Routine laboratory investigations were without pathological findings except for a C-reactive protein (CRP) of 2.5 mg/dl. Tests for Dengue virus and Chikungunya virus were ordered. The patient received metamizole and was discharged with a daily follow-up schedule which, however, he did not comply with. The microbiological laboratory tests returned negative. After three days, fever subsided and was followed by watery diarrhoea which lasted for three more days. On day 7, the patient had fully recovered.
+On day 8, the patient noticed a weakness in his lower limbs which continuously worsened overnight. Thus, he presented in our neurological clinic the next morning. Physical examination revealed flaccid tetraparesis with a level of strength of 4/5 (MRC scale). Muscle reflexes of the upper limbs and patellar reflexes were decreased, Achilles reflexes were absent bilaterally. There were no sensory deficits; position sense and vibration sense were intact. Cerebrospinal fluid analysis was unremarkable. Electroneurography disclosed reduced amplitudes of compound muscle action potentials in tibial, peroneal and ulnar nerves. Half of the examined nerves displayed increased distal motor latency and total loss of F-waves, while sensory nerve action potentials were normal all over. Hence, pure motor axonal demyelinating polyneuropathy with acute onset, consistent with Guillain-Barré syndrome (GBS) was diagnosed. Furthermore, western blot for serum anti-ganglioside antibodies was highly positive for anti-GM2 IgM antibodies and borderline positive for anti-GM1 IgM antibodies, thus supporting the diagnosis of GBS. The occurrence of GBS raised the suspicion of a recent Campylobacter jejuni infection which was serologically confirmed (Mycoplasma pneumonia, another common trigger of GBS, and Zika virus infection were excluded).
+As the clinical condition deteriorated rapidly with inability to walk occurring within the first 48 h, treatment with intravenous immunoglobulins was initiated (total dose 140 g over 5 days). Clinical nadir was reached after three days and the patient regained independent walking within the first week. He was transferred to a neurorehabilitation institution where he was treated for three weeks. Except for a temporary elevation of transaminases (ALT 661 U/l, AST 126 U/l) and a distortion of the left knee due to several falls, further recovery proceeded without complications.
+In week 10, the patient presented at our clinic again. He complained of fever, loss of appetite, abdominal bloating, constipation and a dull pain in the right lower abdomen. He reported suffering from these symptoms periodically; they had first occurred three weeks ago and lasted for a couple of days, then completely disappeared and reoccurred six days ago. The onset as well as the disappearance of these symptoms was sudden. On enquiry, the patient could not think of any potential triggers preceding these episodes. Diarrhoea had not occurred.
+The patient’s vital signs were all normal except for a body temperature of 38.8 °C. Compared to his first presentation, he had lost 11 kg (15% of his previous body weight). The abdominal examination was pertinent for tenderness on palpation in the right lower quadrant. Broad laboratory investigations were unremarkable apart from an elevated CRP of 8.5 mg/dl and a slightly elevated LDH. Abdominal ultrasound revealed a distinct mesenteric lymphadenopathy with > 10 pathological lymph nodes (max. 4 × 1.6 cm) . The largest mesenteric lymph nodes were found in the right lower quadrant and were painful when pressed with the ultrasound probe. Retroperitoneal, inguinal, supraclavicular, axillary and cervical lymph nodes as well as the appendix and colon appeared normal on ultrasound examination.
+A broad microbiological testing was initiated. While stool cultures remained negative, serology was positive for Y. pseudotuberculosis . Antibiotic treatment was initially started with azithromycin (500 mg p.o., QD, for 3 days) and switched to doxycycline (100 mg p.o., BID, for 10 days) after receiving the serology results.
+On control ultrasound two weeks later (week 12), the lymphadenopathy was clearly regressive in all affected regions with the largest mesenteric lymphnode measuring 2 × 0.7 cm. In a telephone follow-up two months later, the patient reported no further episodes of fever or abdominal symptoms. Regarding GBS, he had not regained his full physical capacity but continued to improve constantly.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_139_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_139_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..226c38293ecb4b787fe0e53f7f81a1a21059f4e9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_139_en.txt
@@ -0,0 +1,4 @@
+A 70-year-old man visited our emergency unit with chief complaints of epigastric pain and vomitus niger 2 h after the onset of symptoms. After consultation in our hospital, the patient had black vomit. His blood pressure was 168/109 mmHg, pulse was 73 bpm, and body temperature 36.7 °C. For abdominal findings, he had rebound tenderness, although tenderness was present in the epigastrium. With regard to significant medical history, he had Mallory–Weiss syndrome, high blood pressure, and hyperlipidemia detected 14 years ago, as well as removal of Helicobacter pylori 2 years prior. For relevant lifestyle history, the patient claims to drink five cups of coffee, consumes 360 cc of alcohol each day, and is currently a non-smoker (quit smoking 10 years ago). He is currently medicated with oral antihypertensive agents. Results of his blood tests revealed white blood cell count of 13,560/ml and C-reactive protein of 0.3 mg/dl.
+Contrast computed tomography (CT) revealed empyema and fluid retention in the mediastinum . There were no abnormal findings such as fluid retention and pneumothorax in the thoracic cavity. Upper GI series (with Urografin) detected leakage of contrast media into the mediastinum from the lower intrathoracic esophagus on the left side . We repeated plain CT scans following the upper GI series and confirmed leakage of contrast media into the mediastinum from the site just above the cardia to the tracheal bifurcation. Based on the above findings, the patient was diagnosed with spontaneous esophageal rupture and we decided to perform emergency surgery. Because the location of the perforation was suspected to be the left side of the lower esophagus, the patient’s vital sign was stable, and the area of perforation was localized to the mediastinum, laparoscopic transhiatal simple closure was chosen. We performed the procedure 11 h after the onset of symptoms.
+The ports were inserted using the 5-hole approach. No abnormal findings were found in the abdominal cavity. It was found that contamination was mainly on the left side, and we initially searched for perforation placement from the left side of the esophagus. We removed a volume of tissue equivalent to three quarters of the circumference of the esophagus from the dorsal esophagus to the right dorsal esophagus. A perforation of 2 cm in diameter was observed at the site of the rostral portion at approximately 4 cm from the esophageal hiatus . No intrathoracic perforation was observed. Endoscopy of the upper gastrointestinal tract was performed during surgery, and from the esophageal lumen, it was confirmed that this was the site of perforation. The perforation was closed with three stitches using 3–0 absorbable sutures . Before concluding surgery, the mediastinum was irrigated with saline and two drains were inserted into the subdiaphragm around hiatal space transperitoneally. The total operative time was 178 min, and the total volume of bleeding was 2 ml.
+After surgery, the two drains were used for intermittent suction, and we continued treatment with proton pump inhibitor (30 mg, 2 times a day) and antibiotics (MEPM 1 g, 3 times a day). The patient started ambulation on the first postoperative day. His white cell count was normalized on postoperative day 4. The gastric tube was removed with fluoroscopic guidance. Antibiotics were discontinued on postoperative day 6. Oral intake of food was initiated on postoperative day 7, and after shifting meals to a solid diet, recovery was uneventful. The patient was discharged on postoperative day 15 and continued proton pump inhibitor therapy as an outpatient. Healing cicatrization was found at the site of rupture by endoscopy of the upper gastrointestinal tract . The patient was advised to improve his lifestyle. He showed no signs of recurrence two or more years after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1407_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1407_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c53b498a4ad9bcc82061f85e489a8d601940ead8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1407_en.txt
@@ -0,0 +1,2 @@
+A 36-year-old man was referred to our clinic from his family dentist with a complaint of pain around the anterior maxillary region on the right side. The patient’s medical history was non-contributory. Intraoral examination identified a firm, non-fluctuant mass with no ulceration in the vestibular region between the right upper central incisor and canine . The right upper central and lateral incisors were missing. A computed tomography (CT) showed severe bony resorption between the right upper second premolar and the left upper lateral incisor . Incisional biopsy was performed via vestibular approach. The specimen of the tumor was extirpated with overlying mucosa. During the biopsy, an intact cortex was not observed. The histological diagnosis was moderately differentiated SCC. The connection between the tumor and the overlying mucosa was not observed. Contrast-enhanced computed tomography (CE-CT) revealed a destructive tumor with no cystic lesion, >50 mm in diameter. The tumor pressed the skin around the nasal ala and the nostril of the right side, but no direct connection between the skin and tumor was observed. Although the maxillary sinus and nasal cavity were deformed by the tumor, no abnormal findings were seen for the mucosa of the nasal cavity and maxillary sinus . One swollen and enhanced lymph node was recognized in the submandibular area of the right side. Positron emission tomography (PET) revealed the enhanced lesion in the maxilla and the right submandibular area. There was no evidence of metastatic disease on chest radiography, upper gastric endoscopy or PET. Based on these findings, solid type PIOSCC was diagnosed.
+The patient underwent tumor ablative surgery. After bilateral supraomohyoid neck dissection, the primary tumor was radically excised. The surgical specimen comprised the anterior two-thirds of the hard palate and nasal septum, bilateral inferior nasal conchae and the skin around the nasal ala and nostril of the right side. The surgical defect was reconstructed using a partially double-folded free radial forearm flap and prefabricated denture-based surgical obturator. Microscopic examination of the surgical specimen revealed SCC without cystic component in the maxillary bone. The islands of the tumor cells extended into the bone with no dysplasia or carcinoma in the skin and mucosa of the nasal cavity and maxillary sinus. The dissected surgical specimen of the neck showed one lymph node metastasis of the ipsilateral submandibular region. Although adjuvant radiotherapy was recommended, the patient declined additional treatment. The postoperative course was quite good. Neither recurrence nor metastasis had been found as of 3 years and 1 month postoperatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1413_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1413_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..61b8bee8c4c949ffa84f84887d8bb305a0bd16d8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1413_en.txt
@@ -0,0 +1,7 @@
+A 12-year-old boy was admitted to our hospital for the first time on January 11, 2021 because of dyspnea for 2 wk, left leg pain for 1 wk, and aggravation for 3 d. He also had a fever and occasional cough. On February 24 and April 2, 2021, the patient was admitted to the hospital with a symmetrical, dark red rash on both legs that did not face when pressed, accompanied by ankle swelling and pain.
+The child had a history of respiratory infections prior to labored breathing.
+The child was previously healthy.
+First hospital admission: The patient was 168 cm tall, weighed 76 kg, and had a body mass index (BMI) of 26.9 kg/m2. His vital signs were as follows: Body temperature, 37.4 °C; blood pressure 128/81 mmHg; heart rate, 104 beats per min; respiratory rate 32/min; and SpO2 92% (room air). The patient’s skin was normal, but he displayed slight shortness and exertion of breath. The circumference of his left leg was 39.5 cm and right leg 37.5 cm, and his limb muscle tension was normal.
+Second and third admissions: His legs showed a scattered, symmetrical, pressing dark red rash that did not fade, and both ankles were swollen and painful. On April 4, 2021, the child had decreased pain and temperature sensation in the right plantar, the toe could not bend to the ventral side, and the skin temperature of the right plantar was higher than that of the opposite side.
+His platelet count was 50 × 109/L, and his eosinophil count (EC) was slightly high at 0.63 × 109/L . On the other hand, his D-dimer level was 11.12 μg/mL . Serum potassium was 3.32 mmol/L. On day 8, blood tests showed normal levels of potassium. C4 was slightly high at 0.46 g/L (normal: 0-0.4). Protein C was 50.2% (normal: 75-130). Neuronal enolase was slightly high at 21.96 μg/L (normal: 0-16.3). N-terminal pro-brain natriuretic peptide (NT-proBNP) and troponin I (TnI) were high at 3116 pg/mL and 0.145 ng/mL, respectively, on January 11, 2021. No abnormalities were found in TnI on January 16, 2021 or in NT-proBNP on January 19, 2021. On February 24, 2021, the patient’s IgE level was significantly high at 531 IU/mL (normal: 0-52). No abnormalities were found in hemoglobin, glucose, lipid, liver function, renal function parameters, C-reactive protein, activated partial thromboplastin time, or protein C. Anti-neutrophil cytoplasmic antibody, antinuclear antibodies, anticardiolipin antibody, HIV tests, hepatitis B, hepatitis C, mycoplasma pneumonia antibody, borrelia, and treponema pallidum were negative. Chlamydia pneumoniae IgG was positive. Human chorionic gonadotropin, alpha-fetoprotein, carcinoembryonic antigen, ferritin, and C3 were within the reference ranges. Allergen IgE detection, food intolerance, stool for Giardia lamblia, cryptosporidium, pinworm, and genetics were negative. On February 26, 2021, the microalbumin level in urine was 13.01 mg/L, but total urinary protein was not found due to the problem of specimen retention. The 24-h urinary total protein and microalbumin levels reviewed at later stages are shown in Figure .
+On January 11, 2021, color Doppler echocardiography revealed right atria and ventricle enlargement, mild tricuspid regurgitation with insufficiency, and pulmonary hypertension. Color Doppler ultrasonography of the blood vessels of the legs showed thrombosis of the superficial femoral vein, popliteal vein, and posterior tibial vein of the left leg . The lung computed tomography (CT) showed scattered wedge-shaped consolidation of both lungs with an outward-facing base and apex pointing to the hilum, a relatively widened pulmonary artery, and pulmonary infarction cannot be excluded. CT angiography of the pulmonary artery showed extensive embolization of both pulmonary arteries with enlargement of the pulmonary artery and the right heart . On February 4, 2021, color Doppler ultrasound of the left lower extremity vein showed patency of blood flow. On April 6, 2021, color Doppler echocardiography showed a plump right atrium, mild tricuspid regurgitation with regurgitation insufficiency, and mild pulmonary hypertension. Bone marrow puncture and cranial and spinal MRI were not performed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1489_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1489_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c038b26718e378609d8a3ca28bd323b4ed6607dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1489_en.txt
@@ -0,0 +1,5 @@
+A 28-year-old healthy woman, with a family history of breast and ovarian cancer, was referred to our laboratory for multigene testing. Our proband was informed about the significance of molecular testing, provided information about her personal and family history and signed an informed consent form prior to molecular genetic testing and permission for the anonymous use of her data for research purposes and/or scientific publications.
+Genomic DNA was extracted from peripheral blood leukocytes using MagCore® Genomic DNA Whole Blood Kit (RBC Bioscience) according to the manufacturer’s instructions.
+The analysis of genes involved in hereditary cancer predisposition was performed using a solution-based capture approach. Targeted NGS was performed with a panel of 33 genes (Roche NimbleGen SeqCap EZ Choice) [APC (NM_000038.5), ATM (NM_000051.3), BARD1 (NM_000465.2), BMPR1A (NM_004329.2), BRCA1 (NM_007294.2), BRCA2 (NM_000059.3), BRIP1 (NM_032043.2), CDH1 (NM_004360.4), CDK4 (NM_000075.3), CDKN2A (NM_000077.4), CHEK1 (NM_001114121.2), CHEK2 (NM_007194.3), EPCAM (NM_002354.2), MEN1 (NM_000244.3), MLH1 (NM_000249.3), MRE11 (NM_005591.3), MSH2 (NM_000251.2), MSH6 (NM_000179.2), MUTYH (NM_001128425.1), NBN (NM_002485.4), NF1 (NM_000267.3), PALB2 (NM_024675.3), PMS2 (NM_000535.5), PTEN (NM_000314.4), RAD50 (NM_005732.3), RAD51B (NM_133509.3), RAD51C (NM_058216.2), RAD51D (NM_002878.3), RET (NM_020975.4), SMAD4 (NM_005359.5), STK11 (NM_000455.4), TP53 (NM_000546.5), VHL (NM_000551.3)]. The sample preparation was performed according to the manufacturer’s instructions in the SeqCap EZ Choice Library User’s Guide (Roche NimbleGen). Sequencing was carried out using the Miseq Illumina NGS technology and sequence changes were identified and interpreted in the context of a single clinically relevant transcript using the commercially available software suite SeqNext (JSI medical systems GmbH, Germany).
+The clinical significance of variants was further examined using standards and guidelines for the interpretation of sequence variants recommended by the ACMG Laboratory Quality Assurance Committee and the Association for Molecular Pathology (AMP) . The impact of missense substitutions on protein function or structure was analyzed using computational (in silico) predictive algorithms combined with the ensemble mutational impact score of MetaSVM . The effect on splicing was computationally examined using Human Splicing Finder .
+Total RNA was extracted from peripheral blood lymphocytes using Trizol (Invitrogen, Paisley, UK) following standard protocol. cDNA was synthesized using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher Scientific) as described by the supplier. The resulting cDNA was amplified with the CHEK2 specific primers CHEK2X5F_RNA:5′-ACATCATGTCAAAAACTCTTGGAA-3′ and CHEK2X8-9R_RNA: 5′-CCCCTTCCATCAATTCCAAAACAA-3′ and the PCR-products were purified using NucleoFast® 96 PCR Clean-up kit (Macherey-Nagel GmbH and Co., Düren, Germany). The purified PCR product were used for each sequencing reaction, which was performed using the BigDye® Terminator v1.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and Sequencing reaction products were purified prior to electrophoresis using the Montage™ SEQ96 Sequencing Reaction kit (EMD Millipore Corp., Billerica, MA, USA) and sequenced using an Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_148_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_148_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cd20dd40c24ed9184a7656a1a7116663e147584f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_148_en.txt
@@ -0,0 +1,4 @@
+A 45-year-old female presented to the emergency with complaints of blood-stained stool for 1 day. The patient was apparently well until 7 days back when she developed pain over the right lower abdomen. The pain was colicky in nature, moderate intensity, and non-radiating, with no aggravating or relieving factors. The pain was associated with vomiting for 2 days which was non-bilious, occurred two to three times per day, and contained only food particles. On further inquiry, the patient reported having constipation for 6 months which occurred in an on-and-off pattern. She did not report any pain during defecation nor any protruding mass per rectum. There was no history of melena, anorexia, weight loss, or fever.
+No significant past medical and surgical history.
+No family history of similar presentations exists.
+No significant drug and allergy history. The patient denied the use of tobacco or illicit drugs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_151_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_151_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..885c2f929cb97b584f117b868858b90309978a89
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_151_en.txt
@@ -0,0 +1,6 @@
+A 73 years-old man was admitted to the hospital after experiencing dyspnea and chest tightness for 3 days. He has a 6 years history of gout, 5 years history of coronary heart disease, and a 2 years history of hypertension. He had long been treated for his disease with nifedipine GITS, clonidine, bisoprolol, and febuxostat. In addition, he received a diagnosis of systemic lupus erythematosus (SLE) due to skin erythema, photosensitivity, joint pain, positive for anti-dsDNA (228.65, normal <71 U/mL), anti-ANA (1.80), anti-Ro52 (99, normal <25), and decreases in complement C3 (0.574, normal 0.9–1.8 g/L) and C4 (0.088, normal 0.1–0.4 g/L) 2 years prior to admission and was taking prednisone 10 mg and hydroxychloroquine 100 mg daily, respectively. The patient’s laboratory results are displayed in .
+After admission, the pulmonary computer tomography (CT) scan was performed, and the results revealed pulmonary interstitial changes, pulmonary edema, and a small amount of pleural effusion on both sides, and his blood oxygen saturation was 75% (93% after oxygen inhalation), and the pulmonary infection was treated with cefminox sodium, piperacillin/tazobactam, and meropenem successively. Otherwise, a total of 120 grams of human immunoglobulin were administered to help improve the immune system of the patient.
+The patient was given oral voriconazole (200 mg/day) for 25 days after the patient’s sputum culture revealed Candida albicans infection and the serum (1,3)-β-D-glucan (+) (542 pg/mL, normal <60 pg/mL). Following the administration of voriconazole, we noticed a progressive decline in the patient’s hemoglobin, leukocyte, and platelet counts in the patient’s CBC test , accompanied by symptoms including visual impairment，nausea, vomiting, hiccups, middle and lower abdominal pain, disorders of consciousness, delirium, hallucination, slow response, and subcutaneous ecchymosis. AKI diagnosis criteria were also met by the patient’s oliguria, gradually rising serum creatinine level, aggravated pleural effusion, and lower limb edema. The patient was treated with hemodialysis and intravenous methylprednisolone (40 mg) daily. When renal function, heart failure, pleural effusion, and edema rapidly improved and urine volume returned to above 1,000 mL per day, hemodialysis was discontinued. The patient’s hemoglobin, leukocyte, and platelets gradually increased once the voriconazole was discontinued. At a follow-up of 14 days, we observed that these markers continued to improve.
+During the course of the patient’s treatment, red blood cells (600 mL), fresh frozen plasma (800 mL), and platelet concentrate (400 mL) were transfused. The blood alterations are depicted in , but there was no discernible improvement in stopping the decreasing trend of blood cell count. We performed a bone marrow biopsy the day after discontinuing voriconazole to rule out any potential pathology that might cause hematopenia. Bone marrow aspirate showed active bone marrow hyperplasia. Nucleated cells proliferated actively, and the ratio of granulocytes to red blood cells was 0.387:1. Granular proliferation decreased, accounting for 27.5% of nuclear cells, with primitive cells accounting for 4.5%, the proliferation was mainly characterized by neutrophils, late promyelocytes, rod-shaped nuclei, and lobulated nuclei, with no abnormalities in morphology or size. Erythrocytosis was extremely active, accounting for 71% of nuclear cells, among them, primary red blood accounts for 5.5%, mainly consisting of proliferation of middle and late erythroblasts, imbalance in nuclear and cytoplasmic development, nuclear abnormalities, and megaloblastic transformation of erythroblasts could be observed, the size of mature red blood cells varies significantly, pathological hematopoiesis was very obvious. Megakaryocyte proliferation is very active with maturation disorders. Iron staining: external iron: 2 (+), internal iron: 80% iron granulosa erythrocytes. In addition, genetic testing was negative. Fluorescence in situ hybridization (FISH) was used to perform genetic testing on bone marrow aspirates and did not find any chromosomal abnormalities or gene deletions, including –7/7q–, +8, p53 (17p13.1), EGR1 (5q31), D20S108, etc. Flow cytometry detection of bone marrow showed that 1.6% of myeloid cells were primitive or immature. Microscope (,) indicated that myelodysplastic syndrome (MDS) should be considered, erythroid hyperplasia is significantly active with megaloblastic transformation.
+To ascertain whether the patient had fully recovered, we conducted another bone marrow puncture after a 6 months follow-up. The results of the second bone marrow aspiration revealed a significant reduction in the abnormal proliferation of erythroid, granulocytic, and megakaryocytic cells compared to the first, and no obvious MDS-like bone marrow abnormal proliferation was discovered. Flow cytometry results demonstrated that no significant evidence of acute leukemia, NHL, or high-risk MDS-related immunophenotypic abnormalities were detected. Microscopic results bone marrow test was negative, no indication of MDS (,).
+Overall, when treating the patient with voriconazole during the first-hospital admission, we observed decreases in peripheral blood cells and diagnosed MDS-like changes in bone marrow by bone marrow puncture. After voriconazole withdrawal, drug-related side effects vanished, and the MDS alterations were significantly improved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1538_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1538_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..11aa10c861602abf3a0f0bcc7bcf98d0e189c225
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1538_en.txt
@@ -0,0 +1,4 @@
+A 77-year-old woman was admitted to a neighboring hospital presenting with severe anemia and increasing exertional dyspnea. Her hemoglobin level was found to be 6.1 g/dL. Thereafter, she had been receiving medical treatment for congestive heart failure due to severe AS and was receiving repeated blood transfusion for recurrent anemia. GI bleeding was considered as a possible cause of the severe anemia and she was referred to the Gastroenterology Department in our hospital. Upper and lower GI endoscopies revealed angiodysplasia in the transverse colon with visible acute bleeding. Endoscopic hemostasis was successfully performed using hemoclips.
+During hospitalization echocardiography showed severe AS, with a peak aortic pressure gradient of 100 mmHg, and left ventricular ejection fraction of 70%. Although laboratory examinations confirmed mild anemia (hemoglobin level, 10.5 g/dL) after endoscopic hemostasis, a more subtle bleeding disorder could not be detected using global anticoagulation tests. The activity of vWF was normal (155%), but further analysis using gel electrophoresis revealed loss of large vWF multimers, which was a typical finding of acquired type 2A von Willebrand disease . The diagnosis of Heyde syndrome was established and aortic valve replacement was planned on an elective basis. A brain computed tomography (CT) performed as a routine preoperative examination 1 week preoperatively showed no abnormal findings except for mild global cortical atrophy. She also had no previous head injuries.
+Under general anesthesia, the patient underwent surgery through a median sternotomy. Cardiopulmonary bypass was established with ascending aorta and bicaval cannulation. Anticoagulation during cardiopulmonary bypass was maintained with the use of heparin to a target activated clotting time (ACT) of 300 to 400 s. After aortic cross clamping, cardiac arrest was achieved with a cardioplegic solution. The aortic valve was tricuspid and severely calcified. The valve and the calcified nodule were excised, and a 21-mm SOLO SMART stent-less bovine pericardial valve (Sorin Group, Saluggia, Italy) was implanted. Weaning from cardiopulmonary bypass was uneventful and no abnormal high ACT was recognized. Continuous real-time monitoring of regional oxygen saturation in the brain revealed no abnormalities throughout the operation.
+Postoperative hemodynamics were stable, but bilateral dilated pupils and loss of light reflex were noticed by an intensivist soon after intensive care unit admission. Her level of consciousness deteriorated to a Glasgow Coma Scale score of 3 and a Japan Coma Scale of III-300. An emergent brain CT revealed a large right subdural hematoma with severe midline shift . In spite of her poor clinical condition, the decision of immediate surgical drainage was made by the neurosurgeons. Despite prompt surgical evacuation of the hematoma, her neurological condition did not improve. The volume drained from the chest tube was not significant. Recurrent GI bleeding was not observed during the postoperative period. She did not regain consciousness at all and she died 31 days after the cardiac operation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1539_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1539_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a7704d3903137bfa079c7961443baa93707dfb27
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1539_en.txt
@@ -0,0 +1,6 @@
+A 74-year-old woman was referred to our hospital and admitted for progressive speech and language difficulties. The patient was unable to recall the names of things or persons and was unable to communicate with others for about 1 year prior to admission, though she was able to shop and do housework without difficulty. She had no significant medical history; however, regarding her family history, her elder brother had developed word-finding difficulty with verbal paraphasia and right-hand limb-kinetic apraxia at the age of 62 years of age, and was diagnosed with CBS at 69 years of age. He had frontal lobe signs such as forced grasping, total aphasia, and right-limb kinetic apraxia; moreover, brain magnetic resonance imaging (MRI) demonstrated frontal and temporal lobar atrophy dominantly affecting the left side . The patient’s brother and parents had passed away; therefore, we could not obtain their detailed clinical information.
+Neurological findings indicated that our patient was lucid, but showed thought laziness. The cranial nerves, including those related to eye movement, were normal. The patient had normal muscle tonus and did not show muscle weakness or involuntary movement, but all extremity tendon reflexes were slightly increased. There was no evidence of sensory impairment or cerebellar ataxia. It was noted that speech required significant effort, was slow and non-fluent, and showed anarthria and aphasia. The patient’s Mini-Mental Scale Examination score was 4/30.
+Language function was assessed using the Western Aphasia Battery (WAB) Japanese edition once and SLTA (standard language test of aphasia) two times within 2 months. The scores of WAB subtests were as follows: spontaneous speech, 13 points; auditory verbal comprehension, 5.5 points; repetition, 0 points; naming, 0 points; reading, 4.3 points; writing, 2.2 points; praxis, 6.8 points; and construction, drawing, block design & calculation, 6.6 points. Raven’s score was 25/37 (average ± standard deviation: 26.9 ± 5.4). Aphasia quotient was 36.8. The results of SLTA were similar to those of WAB. Naming, writing, and repetition were impaired. However, auditory verbal comprehension and reading concerning words and short sentences were relatively preserved. Spatial perception and visual perception were also normal. Verbal comprehension via visual perception was approximately normal. Therefore, it is likely that auditory verbal comprehension was complemented by visual perception. Constructional dysfunction, limb-kinetic apraxia, ideational apraxia, and motor apraxia were not observed. Laboratory blood examinations did not reveal any particular abnormalities that could have caused cognitive dysfunction. Cell counts and protein concentrations in the patient’s cerebrospinal fluid were within normal ranges, and concentrations of tau protein (282 pg/mL) and phosphorylated tau protein (31.3 pg/mL or lower) were also normal. Brain MRI demonstrated cerebral atrophy dominantly affecting the left frontotemporal lobes .
+Clinically, the main patient symptoms were difficulty in verbal expression and non-fluent aphasia in the absence of visual memory impairment or behavioral abnormalities. On this premise, the patient was diagnosed with PPA according to Mesulam’s criteria . Furthermore, the aphasia was classified as non-fluent progressive aphasia because, while speech itself required effort, the patient retained knowledge about objects and the ability to understand words. Brain MRI demonstrated cerebral cortical atrophy dominantly affecting the left frontal and temporal lobes, consistent with previous reports of non-fluent aphasia [, ]. Thus, FTLD was diagnosed according to the patient’s clinical symptoms. Since the patient’s elder brother had been diagnosed with CBS, and similar familial cases of FTLD due to GRN and microtubule-associated protein tau gene (MAPT) mutations had been reported , we performed genetic analyses on the patient.
+Genomic deoxyribonucleic acid (DNA) was extracted from peripheral leukocytes isolated from the patient. The exon/intron boundary of GRN was amplified by polymerase chain reaction (PCR) according to a previously reported method and the PCR products were sequenced in both directions. Briefly, blood was collected into a PAXgene® RNA tube, total ribonucleic acid (RNA) was extracted from the sample, and cDNA was prepared from total RNA by a reverse transcriptase reaction. cDNA was then amplified by reverse transcriptase–polymerase chain reaction (RT-PCR) (forward primer: 5′-ACCCAGGCTGTGTGCTG-3′; reverse primer: 5′-GACAGCCTCTGGGATTGGAC-3′) and the gene expression of GRN was analyzed. Then, the amplified PCR product was extracted and its sequence was analyzed.
+The genetic examination identified a novel mutation (c.1118_1119delCCinsG) in exon10 of GRN, which was thought to cause a frameshift mutation (p.Pro373ArgX38). No pathological mutations of MAPT were identified. The GRN mRNA sequence was analyzed by RT-PCR; however, a mutant allele product was not detected, suggesting degradation of the mutant allele by the nonsense-mediated RNA decay system. Accordingly, haploinsufficiency due to reduced expression of progranulin was considered to be a possible pathogenic mechanism of FTLD in these cases .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1559_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1559_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..74d8c320c3d73369c57d91eeca9249b60d0e2159
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1559_en.txt
@@ -0,0 +1,4 @@
+A 65-year-old woman was referred to our hospital for assessment of a gallbladder tumor that had been detected by abdominal ultrasonography during a medical checkup. She had no symptoms. Contrast-enhanced computed tomography revealed a papillary lesion (25 mm in diameter) in the fundus of the gallbladder with irregular thickening of the gallbladder wall. The boundary between the tumor and liver was unclear, and the wall thickening extended from the fundus to the cystic duct . Endoscopic retrograde cholangiography showed a complete filling defect in the cystic duct . Blood test showed inflammatory maker did not elevate. Serum carcinoembryonic antigen level was 2.1 ng/ml, and serum carbohydrate antigen 19-9 level was 24 U/ml. According to these findings, we diagnosed the tumor as gallbladder cancer invading the liver and cystic duct, and we decided to perform extended cholecystectomy.
+There were no adhesions around the gallbladder, while the gallbladder wall was thickened. The hard tumor was detected at the fundus. Intraoperative ultrasonography revealed the tumor did not invade liver obviously. Inflammation changes were seen around the neck and Calot triangle. After ligation and dissection of the cystic duct at the junction, the intraoperative frozen section of the cystic duct stump and 2 sentinel lymph nodes were negative for malignancy; therefore, we performed extended cholecystectomy with liver bed resection.
+Macroscopic examination of the resected specimen showed a superficially spreading papillary tumor with thick mucus on its surface . The gallbladder wall was diffusely thickened. Pathological examination revealed that the gallbladder neoplasm was composed of atypical cells arranged in a papillary architecture along with the development of fibrovascular stalks. These tall columnar cells contained large amounts of mucus . Ovarian-like stroma was not detected. The nucleolus body was remarkable, but the tumor was noninvasive and showed no evidence of lymph node metastasis. These pathological findings were compatible with ICPN. In immunohistochemical staining, MUC5AC and MUC6 were strongly positive. CK7 and MUC1 were also positive, but not CK20, MUC2, estrogen receptor, and progesterone receptor. Immunohistochemistry indicated that ICPN was predominantly gastric type, with focal pancreatobiliary type. In addition, many lymphocytes and multinucleated giant cells had infiltrated the thickened gallbladder wall with prominent Rokitansky–Aschoff sinuses. These finding were especially seen at the fundus and were indicative of chronic granulomatous changes within the fundus . Based on these pathological findings, we diagnosed the tumor as an ICPN concomitant with XGC.
+The patient was discharged on postoperative day 8 with no complications. She was clinically well with no evidence of recurrence at 3 months after resection.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1568_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1568_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d59ff1503cffafadafb5de3fcdfba3952f67f7f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1568_en.txt
@@ -0,0 +1,3 @@
+A 70-year-old woman Gravid 12 was referred to the Tumor Clinic of Ghaem Hospital, Mashhad University of Medical Sciences in September 2013. Her symptoms were abdominal pain, loss of appetite, nausea, and vomiting from 20 days ago with a history of moderate hematemesis. No severe disease was observed in her medical records. She looked dehydrated and ill in terms of general appearance. Vital signs were blood pressure 70/50 Hgmm, pulse rate 100/minute, temperature 36.1°C and respiratory rate 14/minute. Laboratory studies detected leukocytes 20000 and PMN 87%. Liver and kidney function tests were normal. She was misdiagnosed with the left bundle block view in ECG and the AF rhythm in auscultation which caused her to undergo medical therapy in CCU. At first admission in hospital, abdominal examination revealed tenderness in the right and left lower quadrant of abdomen without rebound tenderness and guarding, and evidence of rigidity and abdominal distention.
+In sonography evaluation, size of uterus was 133.5 × 80.5 cm with hypoechoic mass 101 × 109 cm in the left lateral of uterine body, which could be probably interpreted as uterine myoma, and some free fluid in peritoneal cavity was also reported. Paracentesis 5 mL suppurative fluid was aspirated under the guidance of sonography. Findings of CT-scan were a round cystic mass with focal calcification at its periphery located in the pelvic cavity with the diameter about 14 × 11.5 cm probably ovarian cyst adenoma ( and ).
+Based on the diagnosis of peritonitis (suppurative fluid aspirated), emergency laparotomy was performed and 700 mL of suppurative fluid in the abdominal cavity with normal appearance bowel and liver was found. The origin of pus draining was a 1 × 1 cm rupture in the anterior wall of uterus. However, there were multiple polypoid tumors in cervical canal yielded stenosis of cervical discharge. After peritoneal irrigation with 5 to 6 L of normal saline, total hysterectomy with bilateral salpango-oophorectomy was performed. Then, the patient received board-spectrum antibiotic. But in recovery image, the patient became oliguria with rise of creatinine level, and decrease of the blood pressure, despite normal hemoglobin level. Despite all medication and efforts performed, the general condition of the patient deteriorated and she expired ten hours after operation probably because of the septic or cardiogenic shock.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1573_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1573_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8ba950c2a57d15585cc989738bbb2da3bc624eb1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1573_en.txt
@@ -0,0 +1,4 @@
+A 54-year-old Caucasian man with no known previous comorbidity developed sudden-onset severe right-sided calf pain. The pain occurred while he was taking a casual walk in the evening. The pain intensity gradually worsened over the next few hours. The patient also noted progressive swelling of the calf of the right leg, gradually extending to the ankle. He denied trauma and could not recall a history of animal or insect bite. There was also no recent history of immobility. He was on no medication, either prescription or over-the-counter. The symptom onset was spontaneous and unprecipitated. The patient sought initial pain relief and self-medicated with codeine-paracetamol 30/500 mg and ibuprofen 400 mg. Failure to achieve adequate pain relief, along with evolution of symptoms with the development of numbness on the same side below the knee, prompted the patient to seek medical assistance.
+On clinical examination, the patient appeared to be in severe pain. He was afebrile with normal hemodynamic parameters, with a pulse rate of 85 beats per minute. Systolic and diastolic blood pressure measurements were 133 mmHg and 76 mmHg, respectively. Oxygen saturation was 97% on room air. His National Early Warning Score 2 (NEWS2) was 0 based on clinical assessment. Systemic clinical examination was normal. On examination of the lower limbs, the right calf measured 45 cm in circumference and the left calf measured 44 cm in circumference. On visual assessment there was no rubor or blisters. However, the skin appeared tense and stretched. The right leg and calf were tender to the touch. The right-sided dorsal and posterior tibial pulses were present and capillary refill time was < 2 seconds, which was normal. The anterior and peroneal compartment was visually tense, which was more evident with toe movement. A reduction in sensation to light touch was also noted.
+Bedside venous blood gas analysis revealed a normal pH of 7.4 and a normal electrolyte profile, with blood glucose of 5.8 mmol/L (normal reference = 7–11.1). The serum lactate level was 1.6 mmol/L (normal < 1.8). Whole blood analysis revealed hemoglobin of 155 g/L (normal reference = 130–180), with a total white blood cell count of 9.9 × 109/L (normal reference = 3.7–11) and a normal differential count. Platelet count was 275 × 109/L (normal reference = 150–450). Renal and liver function and coagulation parameters were all normal. C-reactive protein was 4.3 mg/L (normal reference = < 5) and the D-dimer level was normal at 327 µg/L (normal reference = 0–500). Considering the clinical context and near normal biochemical parameters, the initial working clinical suspicion was compartment syndrome of the right leg despite the absence of an obvious etiology. This was based on the classical presentation, especially when D-dimers were negative, making deep vein thrombosis unlikely. Urgent magnetic resonance imaging of the lower limbs was done, which revealed gross edema and swelling of the right lateral leg compartment involving the peroneus and longus muscle, consistent with acute lateral compartment syndrome .
+The patient received analgesia with intravenous administration of morphine 5 mg. The leg was kept in an elevated position. Urgent surgical consult was taken, and the patient underwent emergency anterior and peroneal compartment fasciotomy on the same evening of presentation. Subsequently he underwent a second-look washout and graft fasciotomy of the right lateral leg. He had an uncomplicated clinical course and underwent physiotherapy and recovered well, and was discharged 3 days after initial admission with a plan for review in 5 days to assess the graft and in 2 weeks to reassess the fasciotomy site. He was discharged on oral pain relief medication.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1589_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1589_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fc00e98fa8fbeafc87599b80a051d12a6828a185
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1589_en.txt
@@ -0,0 +1,6 @@
+A 15-year-old boy was diagnosed with spastic diplegia cerebral palsy, Gross Motor Function Classification System level IV, knee flexion contracture, equinus foot, and paralysis of right upper extremity with adduction contracture. His height was 160.0 cm and his weight was 50.2 kg. He underwent tendon fractional release of the bilateral tendons of the semitendinosus muscle, semimembranosus muscle, and biceps femoris muscle. Achilles tendon lengthening was performed on the right equinus foot using Vulpius elongation. His lower limbs were fixed with above knee plaster splints in the knee extended position and intermediate ankle position 2 weeks after surgery, and he subsequently used short leg braces. Preoperative passive range of joint motion values were as follows: right knee 35–130/left knee 20–130, ankle dorsiflexion with knee extension (DKE) 15/15, and ankle dorsiflexion with knee flexion (DKF) 35/35. At 6 postoperative months, range of joint motion was right knee 15–130/left knee 10–130, DKE 15/10, and DKF 25/20. Knee extension range and DKF improved postoperatively. Preoperative manual muscle testing showed the following: knee extension 3/3, knee flexion 4/4, ankle dorsiflexion 1/1, and ankle plantar flexion 1/1. Before surgery, he had begun crawling in the house. Before HAL intervention, he could not move with crawling because of postoperative muscle weakness. It was thought that muscle weakness was due to disuse muscle atrophy after surgery.
+Hybrid Assistive Limb intervention was administered twice during postoperative months 10 and 11 in an outpatient department. Normal outpatient physical therapy was carried out in combination. The patient used the HAL for clinical study type S size (target 145–165 cm). A walking device (All-in-One Walking Trainer; Healthcare Lifting Specialist, Denmark) with a harness was used for safety, and the HAL intervention consisted of walking with the assistance of two physical therapists (Additional files and ). The HAL intervention session lasted 60 min, including rests (10 min) and time for attachment/detachment (20 min). The HAL suit has a hybrid control system comprising the CVC and CAC. The CVC mode of the HAL suit can support the patient’s voluntary motion by providing assistive torque to each joint according to voluntary muscle activity. This study used the CVC mode, which allows the operator to adjust the degree of physical support to the patient’s comfort and gradually reduce support as training progresses. Functional ambulation was assessed with the 10 m-walk test without wearing HAL and video analysis preoperatively and pre- and post- each HAL intervention (Additional files and ). We analyzed one gait cycle of the patient with Dartfish. Walking speed, stride, and cadence in the 10 m-walk test were analyzed. We took a walking video from the sagittal plane and analyzed the video in slow motion, pausing the image to measure the joint angle using the Dartfish Team Pro ver5.5. The angle of the hip, knee, ankle, and trunk in walking and in the gait cycle was analyzed using video. Video images were played back frame by frame, and the phase at the beginning of each gait cycle was confirmed. One gait cycle is defined as the movement starting from initial contact on one side till the next initial contact on the same side. The beginning of the loading response phase is defined as the initial contact, the beginning of mid stance is defined as opposite side toe off, the beginning of terminal stance is defined as heel off, the beginning of pre swing is defined as opposite side initial contact, the beginning of initial swing is defined as toe off, the beginning of the mid swing is defined as intersection of the feet, and the beginning of the terminal stance is defined as the vertical lower leg.
+In the 10 m-walk test, the patient used ankle foot orthosis preoperatively, and did not use orthosis pre- and post-HAL intervention. He used the walker as a walking aid.
+Table shows the results of the 10 m-walk test. Speed, stride, and cadence for walking were almost the same preoperatively and pre-HAL intervention. Post-first HAL intervention, speed, stride, and cadence were increased compared to pre-HAL intervention. This was maintained until the next HAL intervention and further improved after the second HAL intervention. HAL intervention increased walking speed from 21.7 to 32.1 m/min, stride from 0.40 to 0.47 m, and cadence from 54.23 to 68.9 steps/min.
+Ankle angle during walking showed little change because he wore a short leg brace while walking preoperatively. Pre-HAL intervention, the dorsiflexion angle was large in the terminal stance and pre-swing, the plantar flexion angle was large in the initial swing, and there was a large difference between the right and left ankle angle . Post-HAL intervention, range of movement of the ankle joint became more narrow, left-right symmetry increased , and extension angles of the knee in the stance phase increased . Excessive dorsiflexion and plantar flexion of the ankle joint disappeared due to extension of the angle of the knee . His extension angle of the hip did not increase and the trunk was leaning forward . Flexion of the upper limbs was strong due to spastic diplegia; therefore, he walked with the head bent forward. Because of the anteversion position, his hip joint did not show extension in walking . Although the horizontal plane and the hip joint were examined, extension of the hip angle in the pre-swing phase was increased . In the gait cycle, asymmetry between the left and right was prominent preoperatively . Comparing pre- and post-HAL, the proportion of terminal stance in the stance phase and swing phase was increased. Since the length of stride was expanded due to increased extension angles of the knee and hip, the ratio of terminal stance and terminal swing increased .
+After HAL intervention, he was able to crawl and gained the ability to move within his house, similar to his status before operation. There was no adverse event such as fall or fractures during the HAL intervention. The patient was able to walk easily while wearing HAL, and he actively participated in HAL intervention.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1590_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1590_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..be83e3c7f7bf782e70ec60aba86676ab9bf65570
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1590_en.txt
@@ -0,0 +1,2 @@
+A 35-year-old woman was found to have a few shadows with GGOs on chest CT in 2012. She was monitored and a shadow in right S10 was found to increase in size, which suggested lung adenocarcinoma. The patient was referred to our hospital for further evaluation. The patient had a history of bronchial asthma. The shadow in right S10 had increased to 14 × 8 mm by 2015 . Other shadows also appeared . After preoperative CT-guided marking, the patient underwent video-assisted thoracoscopic surgery with a right wedge resection of the lower lobe that included the largest nodule in S10 and other nodules. Her postoperative course was uneventful.
+Grossly, the surgical specimen contained pale, somewhat yellow lesions . Histopathological examination of the right S10 lesion and other nodules revealed small- or medium-sized lymphocyte-like cells that were located in the alveolar interseptal spaces. The alveolar walls remained intact . Immunohistochemical staining showed that tumor cells were positive for CD20 (1:400 dilution; DAKO, Carpinteria, CA, USA, Fig. ), CD79a (1:200 dilution; DAKO, Carpinteria, CA, USA), and BCL2 (1:50 dilution; DAKO, Carpinteria, CA, USA, Fig. ) expression and negative for CD10 (1:50 dilution; Novocastra, Newcastle upon Tyne, UK), cyclin D1 (1:75 dilution; DAKO, Carpinteria, CA, USA) and CD30 (1:40 dilution; DAKO, Carpinteria, CA, USA). The lesions were diagnosed as extranodal marginal zone B-cell lymphoma of MALT. The patient has remained well during 12 months of follow up after surgery. Although she did not receive chemotherapy because the MALT lymphoma lesions have been stable without progression, the patient is kept under close observation because of potential progression of the disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1629_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1629_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4c145cbdc8f9f586ad3362a62d58c798b954b4ad
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1629_en.txt
@@ -0,0 +1,3 @@
+A 54 year old man presented in the emergency department of our hospital with a three weeks history of fever, shivering, abdominal discomfort and watery, unbloody diarrhoea. The patient's medical history was otherwise remarkable for a metabolic syndrome with arterial hypertension, diabetes mellitus type 2 and obesity. His regular medication consisted of metformin and enalapril/hydrochlorothiazide. The clinical examination confirmed a bad general health condition with intermittent fever up to 40°C and shivering. He was hypotensive (85/55 mmHg), had a normal pulse rate and was tachypnoic (20 breaths/min.). The abdomen was distended; showed normal bowel sounds and rebound tenderness – consistent with a diffuse peritonism. Furthermore the clinical examination was unremarkable. Laboratory profile was consistent with systemic inflammation, acute renal failure and hepatopathy. Platelets were low with 41 G/l (normal range 150–450 G/l). Lactate and coagulation parameters were within normal limits. Antibodies for hepatitis A, B and C were negative. Urine analysis was unremarkable. The abdominal computerized tomography (CT scan) showed a big retroperitoneal abscess provoked by a diverticulitis of the sigmoid colon, as well as air in the portal vein system and in the inferior mesenteric vein (pylephlebitis). Ascites and hepatosplenomegaly were present .
+Sepsis due to the described intraabdominal focus was diagnosed and a broad-spectrum antibiotic treatment with intravenous piperacillin/tazobactam and amikacin was started. After administration of fluids blood pressure stabilized. Cultures of ascites fluid were positive for Klebsiella pneumoniae, Escherichia coli and Candida albicans. In blood cultures Escherichia coli, Klebsiella oxytoca and Bacteroides fragilis could be isolated without resistances against piperacillin/tazobactam. In order to treat the intraabdominal growth of Candida albicans high-dose fluconazole was added. The patient was operated on the second hospital day to evacuate the retroperitoneal abscess (Hartmann's operation: sigma resection, generating a colostomy with the proximal end of the descending colon and a blind rectal pouch with the proximal end of the distal segment). Because of anuria haemofiltration was started after surgery. During haemofiltration low doses of unfractionated heparin were administered to keep the filter patent.
+One week later – on day 9 of hospitalisation – secretions from abdominal drainages became bloody and cloudy with an amount of 2000 ml/day. The coagulation profile at this time was: thrombocytes 52 G/l, international normalized ratio (INR) 1.3 (normal range <1.3), prothrombin time (PT) 14.5 s (normal range <11 s), activated partial thromboplastin time (aPTT) 44 s (normal range 25–34 s), fibrinogen 3.2 g/l (normal range 1.7–4 g/l) and factor VII 29% (normal range 70–120%). There was a progressive metabolic acidosis with lactate levels around 6 to 17 mmol/l (normal range <1.8 mmol/l). As the treatment with metformin had been stopped at admission, when lactate levels were within normal limits, the current progressive lactate acidosis was ascribed to ongoing sepsis. With raising inflammatory markers, antibiotic therapy was changed to meropenem and a second laparotomy was performed. A putrid retroperitoneal haematoma was removed. During surgery, diffuse intraabdominal bleeding required extended surgical blood coagulation and the substitution of 1 platelet (TC) and 6 packed red cell concentrates (RC), as well as 7 units of fresh frozen plasma (FFP). At this time the patient received intraoperatively one dose of rFVIIa (70 μg/kg). The coagulation profile at this time was consistent with a DIC with platelets 62 G/l, INR 1.4, PT 16 s, D-Dimers 3.22 μg/ml (normal range <0.5 μg/ml), fibrinogen 1.2 g/l and aPTT 80 s. Because of the sustained bleeding the abdomen was left open to prevent intraabdominal compartment syndrome. Postoperatively high doses of vasoactive drugs had to be administered to maintain circulation. Severe metabolic acidosis (pH 6.9) with a lactate of 22 mmol/l was present because haemofiltration had to be discontinued during surgery. The bleeding remained uncontrolled despite further substitution of 1 TC and 6 RC, 5 FFP, tranexamic acid (Cyclokapron®), protamin hydrochloride (Protamin®) and von Willebrand factor concentrate (Haemate®). Therefore, a second dose of rFVIIa (70 μg/kg) was given. Twelve hours after the second laparotomy – in the morning of day 10 – a third laparotomy was performed. Again, a haematoma with diffuse retroperitoneal bleeding had to be removed. Surgical haemostasis and retroperitoneal cloth packing for tamponade were performed. The patient received intraoperatively 4 EC, 6 FFP and 2 doses of rFVIIa (each 70 μg/kg). After the surgery, the bleeding remained uncontrolled despite the administration of 3 FFP every 8 hours, rFVIIa every 4 hours (35 μg/kg) and TC and RC as needed . The patient died 15 hours after the third operation in multiorgan failure. No autopsy was performed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1640_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1640_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6bb62dcb5a99a54917317cc5e12fa64a89578ab7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1640_en.txt
@@ -0,0 +1 @@
+Our patient was a 42-year-old Tajik, Afghan man with no known medical illness who presented to our institution with lethargy, anorexia, pallor, and progressive abdominal distension that had developed over a duration of 4 months. On examination, the patient was pale, not in distress, and had no lymphadenopathy. His abdominal examination revealed gross splenomegaly crossing the midline with the liver just two finger breadths in the subcostal region. His complete blood count revealed moderate anemia, thrombocytosis, and hyperleukocytosis (450,000 white blood cells per microliter), showing predominance of granulocytes with a bimodal peak of mature neutrophils (68%) and myelocytes (33%). The patient’s blast count was 4% with normal basophil count. The clinical impression at that time was CML in CP based on the initial clinical and hematological evaluation. The patient was counseled to proceed with cytogenetic analysis for confirmation and prognostication of disease, but, due to financial constraints, he opted to start on TKI therapy. Accordingly, the patient was started on conventional imatinib therapy 400 mg/day. Initially, he responded well with resolution of hyperleukocytosis and improvement in hemoglobin and platelet count toward normal, but he did not achieve complete hematological remission. A repeated complete blood count analysis revealed moderate anemia, mild thrombocytopenia, and the presence of >90% blast cells in a total white cell count of 62,000/μl. After detailed counseling, the patient agreed to proceed with cytogenetic analysis, in which the analyzed metaphases of all 20 cells revealed 45,XY, presence of Ph chromosome (9q34;22q11.2), and additional complex chromosomal abnormalities, including deletion of chromosomes 6q23.3 to q27, monosomy 11, monosomy 12, insertion 12p13.3, and a marker chromosome, as shown in Fig. . Ultimately, the patient and his family were advised to proceed with allogeneic bone marrow transplant, considering the patient’s complex karyotype and nonresponsiveness to TKI therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1667_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1667_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2cac7ae3dd3734367b2bdebcc21b4a2790d79956
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1667_en.txt
@@ -0,0 +1,9 @@
+A 25-year-old previously well white woman presented with two generalized tonic–clonic seizures, which were preceded by a 2-week history of prodromal flu-like symptoms and nonspecific headache. She was agitated in the emergency department for which she required midazolam.
+Her routine bloods were unremarkable. A computed tomography (CT) scan of her brain showed mild generalized cerebral edema and a magnetic resonance imaging (MRI) showed bilateral temporal lobe lesions involving her hippocampi and amygdala, which were more extensive on the right; this is an appearance in keeping with limbic encephalitis. An electroencephalogram (EEG) showed periodic lateralized epileptiform discharges and slow wave changes, which were maximal in the frontal and temporal regions.
+She was initially treated with acyclovir for possible HSV encephalitis. She also received levetiracetam to prevent seizures. However, she deteriorated over the next week with behavioral changes, memory impairment, hypoventilation, and coma. She was admitted to ICU 9 days after admission for airway support.
+Investigations revealed that her cerebrospinal fluids (CSF) had an elevated lymphocyte count and anti-NMDAR antibodies were strongly positive. Anti-NMDAR antibodies were also detected in her serum. The diagnosis of anti-NMDAR encephalitis was made 11 days after admission. She was commenced on a 5-day course of methylprednisolone, 5 days of plasmapheresis, and 5 days of immunoglobulin administered intravenously. She continued to have features of orofacial dyskinesia (that is, jaw opening and closing, chewing, facial grimacing, lip pouting) and tongue protrusion, which are characteristic features of this illness with autonomic instability; she remained intubated.
+During the search for an ovarian teratoma, an MRI of her abdomen and pelvis showed a left ovarian 2.6 cm simple cyst and a right ovarian 19 mm hemorrhagic cyst with no evidence of a teratoma. A whole body positron emission tomography (PET) scan was negative for malignancy. The serum tumor markers carcinoembryonic antigen (CEA) and CA-125 were also negative.
+A multidisciplinary team discussed with her family the risks and benefits of bilateral oophorectomy including premature menopause, the need for hormone replacement therapy (HRT), and fertility issues balanced with the chances of neurological recovery. A decision was made to proceed with laparoscopic bilateral salpingo-oophorectomy and harvesting of ovarian tissue for cryopreservation, despite no convincing radiological evidence of an ovarian teratoma; the procedure was performed 29 days after admission. Histopathology of her left ovary revealed a mature cystic teratoma/dermoid cyst with mature neuroglial elements resembling a cerebral ventricle . The ovarian teratoma had a prominent inflammatory response associated with the neural/glial elements: cytotoxic T lymphocytes (CD8-positive cells) were prominent; CD4-positive T helper cells and CD20-positive B lymphocytes were also found. This inflammatory response is unusual for teratomas, and points to the cellular immune response involved in our patient’s encephalitis.
+Postoperatively she continued to receive rituximab followed by cyclophosphamide. She started to show signs of improvement with fluctuating level of consciousness: intermittently obeying commands, spontaneous eye opening, mouthing words, and smiling. She suddenly improved and a repeat CT of her head showed some volume loss of her right hippocampus.
+One month later she was oriented with a Glasgow Coma Scale of 15/15 and was transferred to our medical ward where she remained seizure free on levetiracetam. A cognitive screen showed no deficits with a Mini–Mental State Examination (MMSE) score of 26/30, a repeat EEG showed a major reduction in the severity of the slow wave change and the disappearance of epileptogenic activity. A follow-up brain MRI showed developing hippocampal atrophy on the right.
+At 3 months, our patient maintained an excellent recovery, apart from mild short-term memory impairment. She regained strength and was mobilizing independently with no further involuntary movements or seizures. She remained well at 7 months post-diagnosis and was fully independent in all acts of daily living, with some symptomatic improvement in memory, such that her MMSE was 30/30 and her Addenbrooke’s Cognitive Examination score was 98/100. Her EEG had normalized and MRI revealed persistent involutional change to the right hippocampal head. The NMDAR antibodies remained positive in her blood, one year after recovery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1678_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1678_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c1e42eb6b4639a43e7851225ea82423f5b293ebb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1678_en.txt
@@ -0,0 +1,2 @@
+A previously healthy 48-year-old woman, with no significant past medical history and no family history of colorectal diseases, presented to the emergency room with abdominal distension, colicky pain, and a history of repeated episodes of lower gastrointestinal hemorrhage for as long as couple of months. She also complained of 8 kg weight loss in the last 2 months. She denied taking any prescription or over-the-counter medications. Clinical examination revealed a malnourished woman in severe distress due to diffuse abdominal tenderness. Signs of colonic obstruction were apparent. Digital rectal examination was indicative for rectal bleeding. Her vital signs were temperature 38°C, pulse 118/min, blood pressure 105/60 mmHg, and respiratory rate 20/min. Blood counts showed Hb 7.4 g/dl and a white blood count of 16.000. Serum electrolytes, liver function tests, and urinalysis were unremarkable. A plain abdominal X-ray and abdominal CT scan confirmed the signs of large bowel obstruction, along with a polypoid mass fully occluding the lumen of the terminal sigmoid colon. The patient was taken to the operating room where a standard left hemicolectomy was performed because of the malignant appearance of the mass and the extensive lymph node involvement that was found intraoperatively .
+Histological examination revealed a branching polypoid lesion characterized by mucosa projections with a central muscular core . Additionally, misplaced mucosa was encountered within the submucosa forming cystic structures, while partly preserved continuity with the polypoid part of the lesion could be demonstrated . The colonic epithelium both of the exophytic and the endophytic component showed extensive adenomatous transformation with high-grade dysplasia . A lesion-restricted transmural Crohn-like inflammation with prominent lymphoid aggregates was also present. The final diagnosis was consistent with a solitary hamartomatous polyp of Peutz-Jeghers type characterized by an inverted component, analogous to colitis cystica profunda, and by extensive high-grade dysplastic changes. The patient had an uneventful postoperative recovery and complete resolution of her symptoms. Follow-up colonoscopy 3 months after surgery showed no abnormal findings. The patient remains free of symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_167_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_167_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..291b6a41315f1e239c07f1337130ff18ce2def0d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_167_en.txt
@@ -0,0 +1,5 @@
+A 53-year-old white man presented to our knee clinic with knee pain. The pain was located in the posteromedial aspect of his left knee and first presented whilst training for a marathon. The pain was a continuous dull ache, which would often wake him from sleep. He had no improvement from conservative management trialled by his general practitioner, which included rest, ice, elevation, orally administered non-steroidal anti-inflammatory drugs, and physiotherapy. There was no history of trauma, locking, or giving way of the knee. He was otherwise fit and well with no medical co-morbidities; he was very active and had not had any previous injuries or surgeries to his left knee.
+A physical examination revealed normal alignment of his knee and hindfoot, no effusion, and an area of point tenderness posteromedially, not over the hamstrings or the pes anserinus. There was full range of movement with a positive medial step off and good tracking of the patella with no gross patellofemoral crepitus. He also did not have any significant ligamentous instability and an examination of his ipsilateral hip joint was normal.
+Plain radiographs taken at the time of presentation did not reveal any significant abnormalities and magnetic resonance imaging (MRI) was organized, which demonstrated the presence of a cord-like structure that originated from the fabella and passed medially, dividing into two parts around the semimembranosus tendon . The superficial part appeared to blend in with the semimembranosus tendon sheath itself, whereas the deeper part was thought to blend in with the superficial fascia of the gracilis and semitendinosus. This was associated with the presence of diffuse thickening of the distal semimembranosus tendon suggesting impingement of the tendon .
+As he continued to be symptomatic, and conservative measures had failed, he underwent a knee arthroscopy which demonstrated a grossly thickened semimembranosus with fluid collection around it. A band arising from the fabella, running transversely across the popliteal fossa and around the semimembranosus tendon was noted, confirming the diagnosis of semimembranosus impingement. This band, thought to be congenital in nature, was divided, and the semimembranosus fully released .
+Postoperatively, he recovered well and was allowed to fully weight bear with crutches. He was followed up at 6 weeks post-surgery, at which time his symptoms had resolved and he was back to training for a marathon.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1680_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1680_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ddd15cc82c35b593f30ac0a11e92eff0fceffb05
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1680_en.txt
@@ -0,0 +1 @@
+A 83-year-old hypertensive man presented to the Emergency Department for dizziness and hypotension. He was treated by β-blockers (bisoprolol), diuretics (hydrochlorothiazide), ACE inhibitors (valsartan) and platelet inhibitors (lysine acetylsalicylate) for hypertension and arythmia. The patient denied any thoracic pain or recent trauma. Upon admission, blood pressure was 60/40 mmHg on both arms, and hypotension persisted despite a fluid loading of 2.5 L. A vasopressor support was promptly initiated (norepinephrin: 1,2 μg/kg/min). A bradycardia (54 bpm) with decreased cardiac sounds and distended jugular veins were noted. The patient had oliguria and mottled skin. A severe metabolic acidosis was observed (pH: 7.31; BD: -10.4 mmol/L; lactate: 6.76 mmol/L). ALAT level was moderately increased (62 UI/L) without increase in bilirubin or troponin. The electrocardiogram recorded a normal sinus rhythm with an incomplete left bundle branch block. Transthoracic echocardiography disclosed a circumferential pericardial effusion with a compressed right atrium and increased respiratory variations of tricuspidal mitral Doppler velocities. Left ventricular systolic function was normal, without regional wall motion abnormality. Contrast-enhanced thoracic CT scan ruled out an acute dissection of the ascending aorta and confirmed the presence of the circumferential pericardial effusion . A pig-tail catheter was placed within the pericardial sac using the subcostal approach under echocardiographic guidance. There were withdrawn 500 ml of blood, which resulted in a transient improvement of hemodynamics. Rapidly, hypotension resumed despite increasing doses of Norepinephrine (up to 0,7 μg/kg/min) and the pericardial drainage remained productive (450 ml/hour of fresh blood). This prompted a reoperation under extracorporeal circulation. The surgeon confirmed the presence of a hemopericardium with numerous clots in the dependent region of the pericardial sac. An active bleeding was identified at the level of the retroventricular coronary artery and of the epicardial surface which was related to a superficial laceration of the posterolateral wall of the left ventricle. The pericardium was thickened with several "sharping" calcified plaques in the vicinity of the bleeding areas. Hemostatic patches were placed and the posterior aspect of the pericardium was resected and replaced by a pericardial patch. The postoperative course was uneventful. On day 2, vasopressors were stopped and the patient was successfully extubated. The pathologic examination of pericardial plaques disclosed a calcified pericardium without specific tumoral infiltration or inflammatory process . No any sign of a tuberculosis origin was evidenced. One month later, the patient remained asymptomatic. Final diagnosis was a spontaneous cardiac tamponade secondary to a coronary artery injury attributed to a "sharping"calcified pericardial plaque.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1706_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1706_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..42707a95ea8d9b35c65a041f5ef6501009f79c3e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1706_en.txt
@@ -0,0 +1,5 @@
+We present a 26-year-old Hispanic gravida 0 with a known history of Bardet-Biedl syndrome and abnormal uterine bleeding (AUB). She was evaluated in the emergency room (ER) for heavy vaginal bleeding and dizziness and was found to have profound anemia with a hemoglobin and hematocrit of 5.4 g/dL and 15%, respectively. The patient was seen in the ER one week prior with same symptoms and was then started on conjugated equine estrogen (Premarin 5 mg twice daily). Her gynecologic history was notable for menarche at the age of 13 followed by regular periods until 2 years prior to her presentation. She remained amenorrheic for 1.5 years until she resumed regular 5-day periods with normal flow 6 months ago. The patient had been sexually active but denied history of sexually transmitted diseases. Review of her records revealed three prior abnormal Pap smears (abnormal squamous cells of undetermined significance in association with positive high-risk HPV testing). Three prior colposcopies with cervical biopsies were negative.
+The patient's past medical history included Bardet-Biedl syndrome, morbid obesity with body mass index (BMI) of 54 kg/m2, severe persistent asthma, congenital absence of one kidney, obstructive sleep apnea, and scoliosis. She reported no pertinent past surgical or social history. Her family history was notable for unprovoked deep vein thrombosis in the patient's sister. She denied any known medical allergies. Her medication list included conjugated estrogen (Premarin) 5 mg twice daily, fluticasone/salmeterol (Advair) twice daily, and albuterol (Proventil) as needed. Social history was unremarkable.
+On presentation to the ER, the patient's vital signs included blood pressure of 132/66 mmHg, heart rate of 115 bpm, respiratory rate of 16, oxygen saturation of 98%, temperature of 37.6 C, and weight of 146.5 kg. Her physical exam was notable for morbid obesity, no abdominal tenderness, and a 30 mL blood clot at cervical os. Bimanual exam demonstrated closed nontender cervix. Fundus and adnexa were not palpated due to body habitus. Laboratory findings were otherwise unremarkable except for anemia indices mentioned above. Urine pregnancy test was negative. Pelvic anatomy was evaluated with transvaginal sonography, which revealed a thickened, 1.6 cm mildly heterogeneous and hypervascular endometrium without identification of a discrete mass but with a possible hypervascular stalk suggestive of polyp . The uterus measured 8.3 × 5.1 × 5.3 cm and was mildly heterogeneous. Right ovary appeared morphologically normal, whereas the left ovary was not visualized. She was admitted to gynecology service for further management. Patient was transfused 2 units of packed red blood cells. Medroxyprogesterone (Depo-Provera) 150 mg IM was given to stabilize her endometrium, and patient was started on medroxyprogesterone 20 mg orally every 8 hours with quick control of her bleeding.
+Patient subsequently underwent hysteroscopy, dilation, and curettage which revealed hypertrophic, vascular appearing endometrial tissue with presumed endometrial polyp. Patient was then discharged home on oral medroxyprogesterone and close follow-up.
+Final pathology from her endometrial sampling was reported as FIGO grade 1, nuclear grade 1 endometrioid adenocarcinoma with squamous metaplasia. She was then referred to a gynecologic oncologist for further care. Pelvic and abdominal MRI were performed and revealed less than 50% invasion into the myometrium and no apparent extra uterine disease . After extensive discussion the decision was made to proceed with definitive surgical management and the patient underwent robotic assisted total laparoscopic hysterectomy and bilateral salpingectomy with ovarian preservation and bilateral pelvic lymph node dissection with sentinel node biopsy. Intraoperative findings were notable for a 12-week sized globular uterus, normal fallopian tubes and ovaries, and fatty liver. No extra uterine masses were identified. Patient was discharged home on postoperative day 1. Final pathology assessment was FIGO grade 2, nuclear grade 2, endometrioid adenocarcinoma with squamous differentiation, with her background endometrium demonstrating complex atypical hyperplasia. Final TNM staging was pT1aN0, FIGO stage IA . The patient is currently recovering well from the surgery. No further chemotherapy was recommended.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1709_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1709_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c5e93e5e2c7ca42afe3b2e28328ee163b7709566
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1709_en.txt
@@ -0,0 +1,6 @@
+A 57-year-old male presented with painful swelling in the left orbit that had occurred for 11 months. The medical history showed no chronic systemic disease, sinus infection, mucocele, previous trauma, previous eye surgery or irradiation.
+We performed a complete ophthalmic examination. Best-corrected visual acuity was 20/25 OD and 20/70 OS. Examination of the left eye revealed a 3 mm proptosis and maximal restriction of extraocular movements in all gazes. Funduscopic examination revealed diffuse choroidal fold in the left eye . Right eye examination was unremarkable.
+Computed tomography (CT) of the orbit revealed an atypical, well-circumscribed homogeneous calcified mass attached to the posterior globe of the left orbit . Orbital magnetic resonance imaging showed a mixed heterogeneous mass with hypo and hyperintense regions . The mass was measured 1.77 × 1.41 × 2.42 cm in size in the left orbit and was located within the muscle cone.
+The patient underwent an anterior inferior orbitotomy, and complete excision of the mass. Intraoperatively, the tumour was attached to the sclera but not attached to any of the orbital structures. The tumour wraps the inferior oblique, lateral rectus, and part of the inferior rectus muscle. The sclera was intact and the surface was slightly rough. The tumour caused indentation of the globe but did not enter the globe. Gross examination revealed an atypical, well-encapsulated grey-brown bony mass with several small, separate, nodules. The cut surface was grey-white, lobulated and bony hard in consistency. Microscopic examination revealed malignant spindle cells with abundant neoplastic bone and cartilage formation . Immunohistochemical examination was positive for vimentin and S-100 and negative for desmin, CD99 and EMA. The patient underwent PET-CT examination before surgery and found no distant metastases from this lesion or for occult primary lesions that may have led to a metastatic lesion within the orbit.
+The 13-month follow-up included CT scans every 3 months and subsequently every 6 months. The patient encountered recurrence of the tumour. A complete ophthalmic examination was performed. Visual acuity was 20/25 OD and 20/200 OS. Examination of the left eye revealed a 1 mm proptosis and restriction of extraocular movements in all gazes. Funduscopic examination revealed diffuse choroidal fold in the left eye. Right eye examination was unremarkable. The latest orbital CT showed an irregular shape of the soft tissue in the muscle cone of the left eyeball. The lesions showed irregular massive calcification, and the tumour was close to the posterior pole, which was compressed and deformed. The boundary between the mass and the medial rectus muscle and the inferior rectus muscle was unclear, which revealed that the muscle was probably attached. The CT value of the soft tissue lesions was 52 ± 7.62 HU, while that of calcification was 319.09 ± 84.31HU. Considering the patient’s medical history, due to the invasive nature of the tumour, the patient then underwent orbital exenteration of the left orbit. The tumour was confirmed after surgery. Pathological examination showed a recurrence of extraskeletal osteosarcoma outside the orbit, and the lesion was extensively invaded by the soft tissue and the posterior sclera.
+The pathological diagnosis was recurrent orbital extraskeletal osteosarcoma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1726_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1726_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..40fe756096c74726b0ff473aaced74daf5b0e45a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1726_en.txt
@@ -0,0 +1,6 @@
+A 32-year-old man who experienced a recurrent fracture after sudden syncope was admitted to the First Hospital of China Medical University. Six months before the current time, he had sudden syncope while lying in bed; he felt low back pain after regaining consciousness. A computed tomography (CT) scan in the local hospital indicated multiple thoracolumbar fractures, and he was treated with external belt fixation. One month prior, he experienced another sudden syncope episode when he while sitting in the driver’s seat but before driving; he felt pain in his left shoulder upon waking. X-ray analysis indicated multiple fractures of the left proximal humerus, and he was treated with external fixation. He was then admitted to our hospital for further examination.
+Laboratory assessment revealed elevated β-C-terminal telopeptides of type I collagen (β-CTX) (981.8 pg/ml; normal range<584 pg/ml) and N-terminal propeptides of type I collagen (P1NP) (81.93 ng/ml; normal range 20.00–80.00 ng/ml) and decreased 25(OH)D3 (12.99 ng/ml); serum calcium (2.3 mmol/L), phosphorus (1.27 mmol/L), magnesium (0.96 mmol/L), alkaline phosphatase (ALP) (93 U/L; normal range 35–100 U/L) and parathyroid hormone (PTH) (24.92 pg/ml; normal range 15.00–65.00 pg/ml) levels were normal. HLA-B27, arterial blood gas, kidney function, and liver function were all within normal ranges.
+X-ray radiographs of the skull, bilateral hands, left shoulder joint, and bilateral hips were performed. The skull image revealed a suspicious light transmission shadow at the left frontal bone. A bone island was detected in the left thumb proximal phalanx. The bilateral hips showed mild degenerative changes, and a comminuted fracture of the left greater tuberosity of the humerus were observed on X-ray and CT scans of the left shoulder joint. Magnetic resonance imaging (MRI) of thoracic and lumbar vertebrae is shown in Fig. , revealing L3 vertebral compression fracture, local kyphosis, spinal canal stenosis, and cauda equina compression. Vertebral endplate alterations were found in L1 to S1, and L2-S1 disc bulges and slight L4-S1 disc protrusions were noted. Schmorl’s nodes were observed in multiple thoracic and lumbar vertebrae (T8, T12, L1, and L5). Although bone mineral density (BMD) examined by dual-energy X-ray absorptiometry (DXA) of the hip joint was normal, the L2 (0.820 g/cm2, Z-score − 1.4) and L4 (0.877 g/cm2, Z-score − 1.7) BMD values were low.
+The electrocardiogram performed indicated sinus tachycardia, and his heart rate was 107 beats/min. Cardiac ultrasound showed ventricular septum hypertrophy (9–11 mm), but left ventricular systolic function was normal in the resting state. CT angiography of the head and neck arteries indicated thinning of the right vertebral artery.
+The patient had a 4-year history of hypertension. The patient had not suffered from any fracture in the past. His father had hypertension and cerebral thrombosis, and he had a 9-year-old son with Kawasaki disease. His mother and sister were healthy. The patient presented with normal stature and appearance (height, 173 cm; weight, 72 kg; BMI, 24 kg/m2; lack of blue sclera). The patient also had normal teeth and hearing, and no obvious kyphosis was observed.
+Blood samples were collected from the patient and his family members, and genomic DNA was extracted using a blood extraction kit (Tian Jing Biochemical Technology Beijing, Ltd.). Gene regions, including splicing and coding regions of exons, of a panel of genes associated with bone metabolism were amplified by PCR and then sequenced using the Illumina NextSeq 500 system (Illumina, San Diego, CA, USA). Variations were confirmed by Sanger sequencing (ABI 3730, Applied Biosystems, Foster City, CA, USA). This analysis revealed a heterozygous mutation in COL1A2 (NM_000089; c.4048G > A, (p.G1350S)) in the proband. Family investigation revealed that the proband’s sister and her daughter (his niece) carry this mutation. The proband’s sister was found to be an asymptomatic heterozygous carrier, and the niece previously experienced a fracture of the ankle and had mild dentinogenesis imperfecta without blue sclera . Predictions for the c.4048G > A mutation in COL1A2 are as follows: PolyPhen2 (Probably damaging, score = 1), FATHMM (Tolerated, score=-1.11), SIFT (Deleterious, score = 0.002) and PROVEAN (Deleterious, score=-4.84).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1738_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1738_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..abfe694a991247a7a91152e0333e55ba649f2266
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1738_en.txt
@@ -0,0 +1,5 @@
+A 40 year old Malay male was seen at the emergency department with 1 week history of left hypochondriac pain with concurrent abdominal distention. He also complained of loss of appetite and feeling lethargic for 1 month duration. He had no fever, nausea, vomiting, changes in bowel habits or any history of bleeding diathesis. There was no history of trauma. Neither there were any significant past medical history nor family history of malignancy. He was an active smoker for 20 years but denied any alcohol consumption or substance abuse.
+On clinical examination, he was afebrile, with an elevated heart rate of 110 beats per minute and a blood pressure measurement of 121/79 mmHg. Patient appeared pale. Abdominal examination revealed enlarged, non-tender liver and spleen. There was no ascites or peripheral lymphadenopathy. Cardiovascular and respiratory examinations were otherwise unremarkable.
+Haematological investigation revealed a low haemoglobin level at 6.4 g/dl. The patient had a white cell count (WCC) of 33.3 × 10^3 /uL and a platelet count of 568 × 10^3/uL. Differential WCC showed a predominant neutrophil count of 79.9%, lymphocyte count 8.9%, monocytes 9.6%, eosinophils 0.8%, basophils 0.8%, absolute neutrophil count of 25.63 × 10^3 /uL and absolute lymphocyte count of 2.95 × 10^3 /uL. There was an increase in lactate dehydrogenase levels (LDH) from 534 to 666 u/L. Peripheral blood film revealed leucocytosis with neutrophilia with no evidence of blast cells or atypical lymphocytes. Patient was reluctant to undergo a bone marrow aspiration and trephine biopsy. Abdominal ultrasonography demonstrated a large splenic collection. A contrast enhanced computerized tomography of the abdomen further revealed a large heterogenous splenic collection measuring 18 cm × 15 cm × 16.9 cm which was suggestive of a splenic haematoma [Fig. , and ]. There were no intra abdominal or pelvic lymph nodes enlargement. Based on computed tomography findings, a preliminary diagnosis of spontaneous splenic rupture was made. A surgical consult was obtained and an explorative laparotomy was performed on the patient. Intra operative findings showed a ruptured spleen with extensive adhesions to the omentum. No intra peritoneal lymph nodes enlargement were found. Splenectomy was then performed and subsequently, the patient was transferred to intensive care unit for close observation.
+From a histological perspective, the gross appearance of the obtained specimen revealed an enlarged spleen with irregular outer surfaces. A cut section of the spleen showed a firm, cream coloured layer occupying almost entire spleen with large area of necrosis with splenic infarcts. There as minimal amount of normal looking parenchyma tissues at the peripheral aspect of the specimen. Further histological examination revealed a diffuse infiltration of malignant lymphoid cells, which exhibited irregular nuclear membrane with vesicular nuclear chromatin and prominent nucleoli. The adjacent splenic parenchyma showed a congested and expanded red pulp with infiltration by atypical lymphoid cells [Fig. ].
+The histological report confirmed the presence of diffuse large B-cell non-Hodgkin’s lymphoma (NHL) via immunohistochemical testing. Immunohistochemical staining showed the cells to be positive to CD20 (diffuse), BCL-2, BCL-6 (> 30%), and MUM-1 (> 30%) and negative to CD3, CD10, Cyclin-D1, Tdt, CD30 and ALK. Ki67 proliferative index was > 80%. In accordance with the WHO classification of Lymphoid Neoplasm [, ], these findings were consistent with the diagnosis of a diffuse large B-cell non-Hodgkin’s lymphoma, non-germinal center B-cell (non-GCB) type. Further molecular studies to assess MYC / BCL-2 / BCL-6 translocation or rearrangement was not done as the fluorescence in situ hybridization (FISH) analysis was not available in our local laboratory settings. Thirteen days later, the patient was discharged with prophylactic meningococcal, pneumococcal and influenza vaccinations. He was referred to the haemato-oncologist outpatient clinic at a tertiary care centre for post - operative chemotherapy. Unfortunately, the patient did not turn up for subsequent follow ups, rendering it difficult to further document any information with regards to treatment response in this report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1742_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1742_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8c92d095b36281782b3e6f016ff93cda2eb2ec46
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1742_en.txt
@@ -0,0 +1,4 @@
+A 22-year-old female with no past medical history presented to our hospital with a rash for several months that started on her face, then spread to her fingertips, the tips of her toes and her scalp . She also had some upper lip swelling without associated dyspnea, dysphonia or dysphagia. The patient reported feeling more fatigued for the last several months, subjective fevers and easy fatigability of her proximal lower extremities. She had been prescribed minocycline one month prior to her presentation for presumed acne by an outside provider with minimal improvement in her rash. Her physical examination was notable for an ill-defined, erythematous to violaceous, papular rash involving the nasal bridge, cheeks, ears, scalp, her bilateral upper and lower extremities and multiple dime-sized hairless lesions on the scalp . She was noted to have an edematous upper lip as well as oral and nasal ulcers and an enlarged cervical lymph node. Strength and sensation were noted to be intact in all four extremities with an objective muscle strength of 5/5 in all muscle groups and without any joint tenderness or swelling. Her laboratory workup showed pancytopenia with a hemoglobin of 11.9 g/dL (ref 12.0–14.6), a white cell count of 2.2 K/cumm (ref 4.5–10.0) and a platelet count of 120 K/cumm (ref 160–360). Transaminases were markedly elevated and continued to rise after admission (AST up to 3205 U/L (ref 15–41) and ALT up to 1058 U/L (ref 14–54). CK was mildly elevated at 239 U/L (ref 26–174). Lipase was found to be increased > 4400 U/L (ref 22–51). Additional laboratory workup revealed a positive ANA with a titer of 1:2560 and a speckled ANA pattern, positive anti-Smith antibodies, positive SSA, positive SM/RNP with negative anti-dsDNA antibodies. C3 and C4 were found to be decreased at 21 mg/dL (ref 90–180) and 5.5 mg/dL (ref 10–40) respectively. HIV testing was negative. The patient was found to meet the 2019 ACR/EULAR classification criteria for SLE (positive ANA, fever, acute cutaneous lupus, oral ulcers, nonscarring alopecia, leukopenia, thrombocytopenia, anti-Sm antibodies, and low complement levels) and the 2016 ACR/EULAR classification criteria for Sjögren’s (positive anti-SSA and positive Schirmer’s test), so a diagnosis of SLE overlap with Sjögren’s syndrome was made and the patient was started on hydroxychloroquine 200 mg daily.
+During her hospital course, she spiked a fever and was started on empiric antibiotics. A thorough infectious workup remained negative. She underwent a CT of the neck which demonstrated numerous enlarged lymph nodes of variable size bilaterally with enlarged bilateral adenoids, raising concern for lymphoma. A CT of the chest, abdomen and pelvis showed bilateral axillary lymphadenopathy, hepatic steatosis and mild hepatomegaly. A fine needle aspiration lymph node biopsy of the enlarged cervical lymph node was performed and showed a low cellular specimen comprised of a polymorphous lymphoid population with scattered atypical cells. She was found to have a ferritin > 11,000 ng/ml (ref 5–204) and an IL-2R of 4995 pg/ml (ref 532–1891). A bone marrow biopsy resulted with hemophagocytosis consistent with hemophagocytic lymphohistiocytosis (HLH). The patient was started on dexamethasone 10 mg/m2 daily for macrophage activation syndrome (MAS). Cyclosporine 75 mg twice daily and mycophenolate mofetil 500 mg twice daily were added as steroid-sparing agents.
+An MRI of the pelvis revealed abnormal muscle signal on fluid-sensitive (STIR, short tau inversion recovery) sequences indicating edematous changes of the muscles of the pelvis and proximal thighs . A quadriceps femoris muscle biopsy was performed and showed nemaline rod myopathy with fiber type disproportion and type 1 myofiber predominance . Light microscopy was followed by electron microscopy to confirm the findings of nemaline rods . A comprehensive genetic neuromuscular disorder panel was negative for any known pathogenic mutations.
+Throughout the hospital course the patient experienced marked improvement in her strength, fatigue, rash, cytopenias, transaminases, lipase, ferritin, CK and aldolase. We were finally able to discharge her home on hydroxychloroquine, mycophenolate mofetil, cyclosporine and a dexamethasone taper. On follow-up several months after discharge, her symptoms continued to improve with her strength back to her baseline.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1758_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1758_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1cd35f784f5dce7cb996ab76f30d4a4569dfcd42
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1758_en.txt
@@ -0,0 +1,5 @@
+A 43-year-old male presented with 16 months of a progressive paraparesis to final paraplegia, hypoesthesia below the T10 sensory level, and loss of sphincter function. Interestingly, there was no past medical history or family history of neurofibromatosis. All lab studies were normal.
+A whole spine MRI revealed a posterior isointense soft-tissue mass, measuring 69.5 × 16 mm at the T2-T4 levels that markedly compressed the cord . It was strongly homogenously enhanced with contrast .
+The patient underwent a T2-T4 laminectomy for posterior extradural tumor resection followed by pedicle screw stabilization. The lesion had a well-defined border and was removed in a piecemeal fashion; the dura remained intact .
+On gross analysis, the specimen consisted of an aggregate of brownish-white soft-tissue fragments with a spongy consistency (i.e., weight 15 g; largest measurements were 1.5 × 2 × 0.6 cm). Histopathology revealed brisk mitotic activity with the cellular area consisting of spindle nuclei arranged in a palisading pattern . There was perivascular hypercellularity and slight intraluminal herniation along with well-delineated geographical necrosis with some areas with enlarged round nuclei [-]. Immunohistochemistry staining was positive for S100, CD99, and Ki67 , supporting the final diagnosis of thoracic spinal MPNST.
+Postoperatively, the numbness in the lower extremities largely resolved but the motoric deficit improved only marginally. The patient was referred to an oncologist and received adjuvant radiotherapy with total dose of 45 Gray divided into 22 fractions. Six months later, after completion of radiotherapy, the thoracic spine MRI without contrast demonstrated cord swelling at the T2-T3-T4 levels . By 18 months, the patient was bedridden without bladder control.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1763_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1763_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..141cc1b329eb3873513698d0b4267abad3fe7446
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1763_en.txt
@@ -0,0 +1,3 @@
+A 42-year-old man (lowlander, Beijing, China, 43.5 m/142.7 ft. above mean sea level) presented with acute, painless visual loss and visual field loss in his left eye. The patient travelled to Tibet before the onset of symptoms when he took 1 day to ascend to the high altitude by car. He spent 1 week at high altitude before the descent back, which also took him 1 day by car. The complaints began at a low altitude after the end of his journey. The patient had type II diabetes, which was controlled by insulin for 10 years. He also used metformin for some time. The patient underwent binocular subtotal panretinal photocoagulation for the treatment of DR at 3 months before his journey. The patient did not have any other ocular treatments, such as intravitreal injections or intraocular surgery. According to the severity of DR from the description of the patient, the left eye was slightly worse than the right eye. Blood glucose was not monitored during the high-altitude journey. The patient had no history of smoking, hypertension, and hypercholesterolemia. Multiple carotid atherosclerotic plaques were shown by the Doppler examination. Increased blood cell counts for white blood cell (WBC), red blood cell (RBC), hemoglobin (HB) and packed cell volume (PCV) were revealed by hematologic examination. Decreased prothrombin time (PT) and increased prothrombin time activity were revealed by hematologic examination. All of the systemic examination parameters are shown in Table .
+The best-corrected visual acuity (BCVA) in the right and the left eye were 20/25 and 20/40 (Snellen Chart), respectively. Non-contact intraocular pressure was 17 mmHg in the right eye and 18 mmHg in the left eye. Anterior segment examinations were normal in both eyes. Ophthalmoscopy revealed hemorrhages, cotton wool spots, and laser spots in both eyes. Superficial retinal whitening inferior to the fovea along the distribution of the inferotemporal branch retinal artery was revealed by color fundus photograph of the left eye . Delayed arterial filling corresponding to the area of retinal edema in the early phase and capillary nonperfusion around the optic disc, leakage at the posterior pole in the late phase were revealed by ultra-widefield fluorescein angiography (UWFA) . Hyper-reflective band in the inner plexiform and inner nuclear layers and thickening of the retinal layers were shown by spectral-domain optical coherence tomography (SD-OCT) . Central scotomas corresponding to the area of BRAO in the left eye were shown in the Humphrey visual field .
+The HBO treatment, which included daily sessions lasting for 110 min at 2.0 absolute atmospheres, was performed for 10 days. The BCVA in the left eye on the fourth and sixth day of the HBO treatment were 20/33 and 20/25, respectively. On the first day after the end of the HBO treatment, the BCVA in the left eye was 20/20, and it remained unchanged at 1 month after the HBO treatment. Superficial retina whitening of the left eye disappeared, which was revealed by color fundus photograph . The narrowing of the hyper-reflective band and the thinning of the retinal layers were shown in SD-OCT . Central scotomas of the Humphrey visual field had become smaller in the left eye .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1784_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1784_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c2216fb14157d1e26ba5ef6305543ea0c67ca01b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1784_en.txt
@@ -0,0 +1,10 @@
+We report the case of a 48-year-old female who checked into the emergency room (ER) having experienced pain in her chest and left shoulder since the previous evening. The patient was of normal weight and reported a positive family history for coronary artery disease, but denied other cardiovascular risk factors such as hypercholesterinaemia, hypertension, diabetes, or nicotine consumption. The patient had no past medical history and was taking no medication. At presentation, her vital signs were stable. The physical and cardiovascular examination revealed no abnormalities. The chest pain receded after one gram of paracetamol.
+A 12-lead electrocardiogram (ECG) was performed in the ER at presentation, showing inverted T-waves in II, III, aVF, V4, V5, and V6 . Bedside echocardiography revealed hypokinesis in the apical inferior segment of the left ventricle. The laboratory results showed significantly increased values for high-sensitivity troponin I (upward of 25 000 pg/mL, reference range: 0.0–51.4 pg/mL) and creatine kinase (CK) (540 U/L, reference range: 0–145 U/L). Therefore, a non-ST-elevation myocardial infarction was suspected, and the local interventional cardiology centre was contacted to perform coronary angiography (CAG).
+The patient was swabbed before transfer to exclude a SARS-CoV-2 infection, as per the Medical University of Innsbruck (MUI) guidelines during the SARS-CoV-2 pandemic; surprisingly she tested positive for SARS-CoV-2 on the real-time reverse transcriptase-polymerase chain reaction assay. After further questioning, she reported having experienced isolated throat discomfort since the beginning of February, but denied contact with individuals with confirmed infections or flu-like symptoms; she also denied fever, cough, malaise, dyspnoea, or anosmia.
+After further discussion with the cardiology department, the ER team revised the working diagnosis to viral myocarditis and referred the patient to our infectious diseases ward, where she was promptly isolated and received cardiac and haemodynamic monitoring. We started therapy with acetylsalicylic acid, prophylactic-dose low-molecular-weight heparin, a statin, and a proton-pump inhibitor.
+A computed tomography coronary angiography (CTCA) was performed to exclude a coronary origin for the complaints and for the laboratory and ECG abnormalities, which revealed no significant coronary obstruction (Coronary Artery Disease Reporting and Data System: 0; Coronary Artery Calcium – Data and Reporting System: 0) .
+To further confirm the diagnosis of viral myocarditis, a cardiac magnetic resonance imaging (CMR) was arranged. Surprisingly, CMR showed features of myocardial oedema restricted to the mid-ventricular to apical territory of the right coronary artery (RCA), as evidenced on T2 short tau inversion recovery sequence (signal intensity ratio of myocardium over skeletal muscle 2.3, ) and on T1 maps (increased native T1 of 1313 ms at inferior wall; reference value 980 ms, ). Based on subendocardial to partially transmural late gadolinium enhancement in the mid-ventricular to apical inferior wall, an acute myocardial infarction was diagnosed .
+Meanwhile, troponin T and CK values decreased , and episodes of mild chest pain were sufficiently controlled with paracetamol.
+After further communication with our interventional cardiology department the diagnosis was revised to a posterior MINOCA; the cardiologists advised against a CAG, due to the absence of coronary obstruction on the CTCA scan.
+Further diagnostics with cardiac positron emission tomography–computed tomography showed evidence of reduced metabolic activity in the area affected by the infarction .
+We prescribed dual anti-platelet therapy and an angiotensin-converting-enzyme inhibitor. A beta-blocker was not started due to a resting heart rate of 60 beats per minute. After two negative SARS-CoV-2 swab results in over 24 h and absence of COVID-19 typical symptoms, the patient was no longer considered infectious and could be assigned to a cardiac rehabilitation program. Follow-up echocardiography 2 days after discharge revealed a normal ejection fraction (58%) despite persistent inferior apical akinesia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1793_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1793_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b41dd9e4a4fca5fcaabf227658868d9aa2abb08f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1793_en.txt
@@ -0,0 +1,6 @@
+An 89 years old woman presented with an inability to swallow one day after band ligation of esophageal varices.
+The patient experienced almost immediate regurgitation after any oral intake on the way home from endoscopy. Her initial esophagogastroduodenoscopy (EGD) was performed for surveillance of varices. She was found to have large, non-bleeding esophageal varices and type 1 gastroesophageal varices. Two bands were placed on the esophageal varices in the lower esophagus in an upward spiral motion for primary prophylaxis and varices were completely eradicated. She reported feeling well in recovery after the procedure and was discharged.
+She has a past medical history of nonalcoholic steatohepatitis cirrhosis.
+Upon arrival to the hospital the day after endoscopy, her vital signs were stable. The patient appeared uncomfortable and was not able to tolerate her oral secretions. Her physical exam was otherwise unremarkable with pertinent negatives including ascites, hepatic encephalopathy, hepatosplenomegaly, lower extremity edema or crepitus.
+Initial blood work revealed a Model of End Organ Liver Disease score of 7. The rest of her blood work was unremarkable including a complete blood count, chemistry and liver function tests. She underwent a chest X-ray, which did not reveal any acute abnormalities.
+She was treated symptomatically with sublingual nitroglycerin for esophageal spasm, which is a known complication after esophageal banding and was the presumed issue here. She failed to improve with intravenous fluids and conservative management for several days and, therefore, underwent an EGD for further evaluation. Images from endoscopy five days after initial band placement are shown in Figure . Endoscopy revealed the mucosa surrounding the banded varix was now necrosed and blocking the lumen of the esophagus.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_179_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_179_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..76a8dd9e6668ab48f3829be9dba2eddb40f28d26
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_179_en.txt
@@ -0,0 +1,2 @@
+A 71-year-old male was admitted to our clinic with complaints of left shoulder pain, swelling in the left anterolateral chest wall, jaundice, weight loss, dyspnea and weakness. At three months prior to admission, he had noticed a less movable mass approximately 2 cm in diameter and then the tumor had grown rapidly, becoming increasingly painful during exertion. There was no history of expectoration, fever, or night sweats. The patient's physical examination revealed yellow discoloration of the sclerae, pitting edema up to the knees and a 5 cm × 6 cm fixed mass in the left axillary region. There was mild splenomegaly but no hepatomegaly, liver masses or ascites. Laboratory findings were as follows: sedimentation rate: 90 mm/hr; Hb: 11.5 mg/dL; WBC: 3900/mm3; Plt: 126 000/mm3; PT: 15.6 sec; INR:1.3; total protein: 6.5 g/dL (N: 6.4–8.5 g/dL); albumin: 2.2 g/dL (N: 3.4–4.8 g/dL); AST: 124 iu/L (N: 15–40); ALT: 52 iu/L (N: 10–40); ALP: 173 iu/L (N: 37–147); GGT: 213 iu/L (N:0–40); total bilirubin: 3.8 mg/dL (N: 0.1–1.2), and direct bilirubin: 1.57 mg/dL (N: 0–0.3). Hepatitis B virus surface antigen, IgG antibody to the core antigen, anti-HBe and HBV DNA with polymerase chain reaction were positive. HBe antigen, anti-Delta and serological markers of hepatitis C were negative.
+Abdominal ultrasonography showed ascites, splenomegaly and diffusely nodular and heterogeneous echogenic patterns in the liver. There was no history of chronic liver disease. Upper gastrointestinal endoscopy was normal except for esophageal varices. Computerized tomography of the thorax revealed a mass on the left anterolateral chest wall . Cytological examination of a fine needle aspirate taken from the mass was consistent with metastatic hepatocellular carcinoma . Abdominal computerized tomography detected thrombosis in the right portal vein. The liver parenchyma was diffusely heterogeneous with irregular borders and without a clear mass or infiltrating lesion. There was no lymphadenopathy on thoracic, abdominal or pelvic computerized tomography. The patient had an elevated serum alpha-feto protein (AFP) level of 60 000 ng/mL (0 – 13.6 ng/ml). Cytological examination of the liver confirmed the diagnosis of hepatocellular carcinoma. The patient was discharged on palliative treatment, and he died 21 days later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1816_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1816_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d053b6778da40bb93e025a0def41a6cf887c89ff
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1816_en.txt
@@ -0,0 +1,6 @@
+A 53-year-old Nigerian male with hepatitis C virus (HCV) infection treated with peginterferon alfa-2a and ribavirin, to which he showed a null response, presented to our hospital. Three months after the initial visit, multiple hepatocellular carcinomas (HCCs) were detected in segments 7 and 8 of the liver according to the Brisbane 2000 Nomenclature of Liver Anatomy and Resections , and radiofrequency ablation (RFA) was performed for each HCC. Seventeen months after RFA, a recurrence of HCC was detected in segment 4 (the medial section) by follow-up computed tomography (CT), and the patient was referred to our department.
+Physical examination showed that the patient was an 87.9 kg, 168.5 cm male in good condition. The patient received medical treatment for diabetes mellitus and hypertension. He had neither a history of transfusion nor a history of SCT. The laboratory test results showed moderate liver damage, as shown in Table . Microscopic examination of peripheral blood erythrocytes did not show any morphological abnormalities.
+Contrast-enhanced CT showed a 4.0 × 3.4 × 3.2 cm tumor in segment 4 adjacent to the left branch of the portal vein and the middle hepatic vein . An irregular liver surface; the hypertrophy of segments 1, 2 and 3; and splenomegaly all suggested the presence of cirrhosis. The normal liver parenchyma of the medial section accounted for 10% of the total liver volume according to CT volumetry.
+With the diagnosis of solitary HCC in segment 4, left medial sectionectomy was conducted. Hepatic resection was performed with intraoperative ultrasonography (IOUS) guidance with Pringle’s maneuver (hepatic inflow occlusion time 15–30 min and reperfusion time 5 min; the total blood flow occlusion time was 165 min). Multiple IOUS examinations and inspections of the liver surface revealed no hepatic blood flow impairment during surgery . At the end of the operation, laboratory data showed no conspicuous abnormalities, with total bilirubin (T-Bil) 1.6 mg/dL, aspartate aminotransferase (AST) 316 IU/L, alanine aminotransferase (ALT) 323 IU/L, hemoglobin (Hb) 11.6 g/dL, and prothrombin time (PT)% 52.5%. A drain was inserted along the resected plane of the liver. The operation time was 305 min, and the estimated blood loss was 714 mL. No blood transfusion was performed.
+However, the laboratory tests on postoperative day (POD) 1 revealed severe liver damage and acidosis: T-Bil 2.8 mg/dL, AST 9250 IU/L, ALT 6120 IU/L, PT% 20.9%, blood pH 7.29, lactate 6.6 mmol/L, and base excess − 5.4 mmol/L. Figure shows the trends of postoperative laboratory data. The bedside US did not indicate an impairment of hepatic blood perfusion. The drain output was 460 mL/15 h, with serosanguineous appearance. Because his vital signs were stable and it was difficult to identify a cause of the acute severe liver damage, we selected conservative management while performing fresh frozen plasma transfusion. The values of AST and ALT declined gradually, but the level of T-Bil continued to increase, and renal and respiratory dysfunction emerged and subsequently deteriorated; therefore, we initiated continuous hemodiafiltration and plasma exchange under mechanical ventilation. Contrast-enhanced CT showed a slightly heterogeneous enhancement of the liver parenchyma without apparent major vessel occlusion on POD 13 , and diffuse cerebral infarction on POD 16 .
+Although clinico-radiological examinations could not identify the cause of acute liver damage, the pathological examination of the resected specimen revealed that the intrahepatic peripheral blood vessels were occluded by sickled erythrocytes . Morphological abnormalities were not found by microscopic examination of the peripheral blood erythrocytes after surgery, but we requested an analysis of the patient’s hemoglobin by high-performance liquid chromatography (HPLC) with a suspicion of hemoglobinopathy. HPLC demonstrated an abnormal sharp peak indicating the presence of abnormal hemoglobin, which accounted for 34.4% of total hemoglobin . These findings strongly suggested the presence of HbS. Despite intensive treatments, he died of multiple organ failure on POD 20. Autopsy was rejected by his bereaved family for religious reasons.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1831_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1831_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58d848a5e7f0eba9d353c9cceda3abdf28b34469
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1831_en.txt
@@ -0,0 +1,58 @@
+A 20-year-old black woman, previously healthy, was admitted to the emergency
+department (ED) of the University Hospital of Londrina (UH) complaining of
+odynophagia, a single episode of unmeasured fever and generalized myalgia with onset
+five days past. She was self-medicated with dipyrone and ibuprofen but did not get
+better and sought a basic health unit where amoxicillin was prescribed. On the same
+day, she reported appearance of petechiae on the face, and upper and lower limbs.
+She sought the secondary hospital, where she developed an large amount of petechiae
+, followed by confluence to
+clusters, worsening of general condition, and alteration of laboratory tests
+results; she was then referred to the UH. In the physical examination, she was
+slightly hypertensive (150/70 mmHg), pale, tachycardic, hyperemic, with purulent
+tonsils, cyanosis of the extremities, and purpuric plaques on the face and upper and
+lower limbs. The patient was anuric and required dialysis on admission. Laboratory
+tests showed anemia (Hb 10.7 g/dL), leukocytosis (44,990/µL),
+thrombocytopenia (24,000/µL), impaired renal function (Cr 4.15 mg/dL),
+hyponatremia and hyperkalemia, and elevation of LDH to 3,579 U/L.
+The initial diagnostic hypotheses on admission were meningococcemia and
+staphylococci. Blood cultures were collected and antibiotic therapy (ceftriaxone and
+vancomycin) was started. Despite the antibiotics, the patient continued with
+worsening of the clinical condition, hypotension, tachycardia, and tachypnea, and
+purpuric lesions became bullous . The
+presence of schistocytes and elevated serum LDH levels indicated a possible TMA. The
+patient did not present neurological alterations, thus excluding the diagnosis of
+thrombotic TTP. Considering the hypothesis of aHUS, we started investigating the
+possible causes of TMA. All blood cultures and rheumatologic tests were negative.
+The serology performed was also negative, except IgM positive for dengue, collected
+on the sixth, twelve and twenty-eight days of medical history, all positive. The
+result for arboviruses (dengue 1, 2, 3 and 4, chikungunya and zika) was negative.
+However, this was collected on the sixth day of the onset of the disease, and
+ideally, the arbovirus survey sample is collected on the first day of symptoms and
+is acceptable up to the fifth day of the disease.
+The patient completed the antibiotic regimen and afterwards, she was maintained only
+in supportive treatment, performing daily hemodialysis due to anuria and frequent
+need for transfusion of red blood cells due to anemia. On the fifteenth day of
+hospitalization, after sustained improvement in thrombocytopenia, she underwent
+renal laparoscopic biopsy, which identified extensive areas of ischemic and
+hemorrhagic infarction, interstitial hemorrhage, and medium-sized vessels with
+fibrin thrombi . Skin lesions were
+also analyzed by biopsy, which identified inflammatory infiltrate with extensive
+necrosis in adipose tissue, absence of signs of vasculitis in muscles, and absence
+of dermis and local epidermis surrounded by areas of epidermal repair. These lesions
+evolved with rupture of blisters and necrotic areas that progressively deepened,
+reaching the dermis, subcutaneous tissue, musculature, and tibial bone exposure
+. There was a need for frequent
+debridement of the necrotic areas in lower limbs, performed by the plastic surgery
+team of the burn treatment center of the service. As there was incessant progression
+of the lesions in legs and feet soft tissues, it was considered that the underlying
+disease that was causing the necrosis was be active. All available markers were
+negative for vasculitis and there was no purulent secretion or positive culture that
+would justify the clinical evolution. On the 32nd day of hospitalization,
+plasmapheresis was chosen as an alternative measure since there was association with
+TMA, and initially, aHUS was one of the diagnostic hypotheses. Around the
+40th day of hospitalization, the patient started to show a
+significant diuresis and the necrotic areas in the legs stabilized. Hemodialysis was
+suspended and the plastic surgery team started skin grafting with good response
+. The patient was discharged
+after 68 days of hospitalization and the diagnosis of TMA and idiopathic PF
+associated with AKI was established.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1850_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1850_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..64884485cb46e35128f42477278ebfa64617b3f8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1850_en.txt
@@ -0,0 +1,2 @@
+The patient was a 75-year-old woman who presented with severe bilateral leg edema and epigastralgia. There was no past history of chronic hepatitis or blood transfusion. Admission laboratory tests revealed an elevated serum aspartate aminotransferase level (48 U/L), mildly decreased serum albumin (3.6 g/dL), mildly decreased serum (74%), mildly elevated D-dimer (12.9 μg/mL), and mildly elevated fibrin degradation product (12.6 μg/mL). The tumor marker AFP was slightly elevated to 585 ng/mL. The Child-Pugh classification was A, and the indocyanine green retention rate at 15 min was 12%. CT scans showed a huge tumor, 21 cm in diameter, in the right liver and TT, 37 mm in diameter, in the right atrium . The TT was pedunculated, swung like a pendulum with the heartbeat, and reached the tricuspid valve on a transesophageal ultrasound video . The symptomatic patient had a risk of sudden death due to TT in the right atrium. Therefore, we explained the high surgical mortality rate to the patient and her family, and they decided to proceed with surgery.
+At first, a partial sternotomy was made, and cardiopulmonary bypass (CPB) via the aorta, superior vena cava, and right femoral vein and electrical ventricular fibrillation were performed after intravenous injection of 25,000 units of heparin sodium. Although the TT in the right atrium was very soft and fragile, thrombectomy from the right atrium and inferior vena cava (IVC) was successful . After the removal of TT, the IVC was clamped with a tourniquet above the diaphragm and the right atrium was sutured with 5–0 Prolene. After DC defibrillation was carried out, CPB was stopped, the tourniquet on the IVC was released, and 100 mg protamine was administered for the neutralization of heparin. The open heart surgery time was 23 min, and the CPB time was 42 min. Next, a reverse T incision was made, and right hepatectomy by anterior approach and IVC tumor thrombectomy were performed. After ligation of the anterior and posterior Glissonean pedicles, the liver parenchyma was transected under the Pringle maneuver and IVC clamping below the liver. After the IVC and right hepatic vein were confirmed by anterior approach, the IVC was opened and a residual TT in the IVC was removed under total hepatic vascular exclusion (THVE) . Finally, the huge tumor was removed with the diaphragm without pulmonary embolism. The total operation time was 9 h, and the total blood loss was 8200 mL. The tumor was of the massive type macroscopically , and cancer cells showed moderately to poorly differentiated HCC with invasion to the portal vein, hepatic vein, and diaphragm. The patient’s postoperative course was uneventful, and she was discharged 14 days after surgery. She is still alive 14 months after surgery with recurrence in the lung.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_185_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_185_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..05a55d13eead8dda840ae3d02bb2ceabdda2df72
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_185_en.txt
@@ -0,0 +1,2 @@
+A 43-year-old male sustained an extensive penetrating injury to his left frontotemporal and preauricular region—from a broken grass-cutting blade—with an incompressible pulsating lesion . He was immediately transferred to a trauma center. His vital signs showed systolic blood pressure of 60–70 millimeters of mercury and his pulse rate was 140 beats per minute and oxygen saturation was 80%. The physical examination suggested an active arterial bleed from the maxillary artery, anterior to the mandibular neck. A few minutes after the patient arrived, his consciousness was deteriorating to E1V1M5 and an endotracheal tube was inserted. An immediate transfusion of group O red blood cell was initiated.
+The trauma plus protocol (The protocol trauma team activation for severe trauma patient of institute) was activated and the patient was immediately transferred to the operating room. A longitudinal skin incision along the anterior margin of the left sternocleidomastoid muscle was performed. The posterior belly of the digastric muscle was cut to reveal the carotid bifurcation clearly. The left common facial vein was divided. The left common carotid artery, external and internal carotid arteries were exposed and encircled by vascular slings. Transient left ECA occlusion by application of a Rumel tourniquet was performed . A massive artery bleedwas controlled. The duration between the activation of the trauma protocol and the occlusion of the ECA was 8 minutes. The penetrating tract at the preauricular region was tamponaded by balloon . Subsequently, the patient was transferred to computed tomographic angiography (CTA) of the brain and neck to evaluate the adjacent structure and intracranial vascular injury. The study revealed a metallic foreign body with multiple left side skull fractures with multiple comminuted fractures involving the zygomatic process of the left temporal bone, lateral wall of left orbit, left orbit apex, left superior orbital fissure and left optic canal, squamous part of left temporal bone, wall of sphenoid and ethmoid sinuses, and the greater and lesser wing of the sphenoid bone . There was acute subarachnoid hemorrhage along the left Sylvian fissure and an acute subdural hemorrhage along the frontotemporal convexity with brain swelling . There was no evidence of intracranial arterial injury . The patient was returned to the operating room and the foreign body was carefully removed. A completed transection of the maxillary artery was identified and ligated, then the ECA was released and revealed no active bleeding site. The total duration of the transient ECA occlusion was 100 minutes. The foreign body fragments were removed. The dura was repaired and a subgaleal drain was placed. The patient had received 6 units of packed red cells, 6 units of fresh frozen plasma and 4 units of single donor platelets. Ongoing resuscitation continued in the trauma intensive care unit (ICU). The preauricular area was re-explored over the next 2 days. The left mandible condyle fixation with plate and screw was performed and the complete transection of the facial nerve was re-anastomosed to the great auricular nerve. The duration of stay was 10 days. The patient had good levels of conscious with a GCS of E4V5M6 and motor power grade V. The patient was paralyzed on the left side of the face from the facial nerve injury and suffered permanent visual loss in the left eye due to extensive optic nerve damage.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1863_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1863_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..178ca0d7de6bfb91560b4c5a57b47cdc8ced3e6c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1863_en.txt
@@ -0,0 +1,2 @@
+A 32- day-old girl with fever and restlessness was admitted in the hospital. Parents reported fever and restlessness on the day before admission. There was no coryza or conjunctivitis. Left facial swelling was found during physical examination. Left sub-mandibular swelling was noted in physical examinations. Redness was observed in the face. Prenatal history was normal. Postnatal history was normal. Parents were close relatives. Cesarean section was used for the delivery because of breech presentation. Birth weight was 3500 g. Body weight, length, and head circumference were 4300 g (75 th percentile), 52 cm (50 th percentile), and 38 cm (75 th percentile), respectively. She was breastfed. Pulse and respiratory rates were 130/min and 50/min, respectively. Axillary temperature was 37.8°C. Head examination revealed normal sized fontanel (1.5×1.5 cm) without bulging. Facial examination revealed swelling and erythema over the parotid gland. The patient showed irritability during inspection of the area of swelling. Eye and ear were normal. Abdominal examination revealed no abnormal findings.
+Chest examination revealed no abnormality. Red blood cell (RBC) and white blood cell (WBC) counts were 3.1 × 1012 cells/L and 12.6 × 109/L (neutrophil: 60%), respectively. Erythrocyte sedimentation rate and C-reactive protein were 20 mm/L and negative, respectively. Results of urine analysis and culture were normal. Blood urea nitrogen, sodium, potassium, and blood sugar were normal. Blood amylase was 10 U/L. Bilateral multiple reactive lymph node (size = 6×10 mm) at anterior cervical chain with a left facial swelling was observed in ultrasonography report. Chest roentgenogram was normal. Due to suspected neonatal parotitis, with gentle pressure on Stensen’s duct, pus was evacuated and transferred to the laboratory. Microscopic examinations of the smear revealed Gram-positive cocci. Culture showed coagulase positive S. aureus. Patient received vancomycin and amikacin for a seven-day period. She was discharged in a good condition.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1868_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1868_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..da5c0d8d7e820feefbe2dc54f42c8ab607e783d8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1868_en.txt
@@ -0,0 +1 @@
+A 79-year-old Black female patient was referred for percutaneous LAAO. Past medical history was significant for mitral regurgitation, tricuspid regurgitation, and persistent atrial fibrillation complicated by recurrent significant gastrointestinal haemorrhage on anticoagulation secondary to diverticulosis. Five months prior to referral, she underwent surgical mitral and tricuspid valve repair, as well as LAA ligation with 35 mm AtriClip due to elevated stroke risk (CHA2DS2-VASc score 5) with intolerance to oral anticoagulation. Initial pre-procedural clinical examination revealed a haemodynamically stable, well-appearing female with regular heart rate and irregular rhythm. Pre-operative laboratory assessment revealed normal kidney function (serum creatinine 0.81 mg/dL) and mild anaemia (haemoglobin 10.8 g/dL, reference 12.0–15.0 g/dL). Intra-operative transoesophageal echocardiogram (TEE) demonstrated closure of the LAA. However, 40-day post-operative TEE and cardiac computed tomography (CT) imaging demonstrated a significant persistent communication between the left atrium and LAA with no evidence of LAA thrombus ( and ). After comprehensive review of the TEE and CT scan images, we felt that a LAAO device could be used to achieve adequate occlusion of the residual LAA pouch. For LAAO device implantation, trans-septal atrial imaging was performed using fluoroscopic and TEE guidance, with a mid-septal puncture chosen using intracardiac ultrasound guidance. Intra-procedural TEE was used for sizing of the LAA, and based on these measurements, a 27 mm LAAO device (WATCHMAN™) was selected and deployed, with all the P.A.S.S. (Position, Anchor, Size, and Seal) criteria satisfied . Only 1.4 mm PDL was present. She continued on apixaban 5 mg twice daily and aspirin 81 mg daily post-operatively. Follow-up TEE at 6 weeks demonstrated a trivial PDL measuring 1.9 mm along posterior aspect, with no thrombus seen. At that point, the decision was made to continue aspirin 81 mg daily and clopidogrel 75 mg daily, with discontinuation of apixaban. The patient has not experienced any further episodes of major bleeding, and we are tentatively planning to stop clopidogrel at 6 months post-operatively, with continuation of aspirin 81 mg daily indefinitely thereafter.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1871_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1871_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d5efcb6865f8d04f9591d6575a8cb140a9fcac86
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1871_en.txt
@@ -0,0 +1,2 @@
+The 6-year-old boy complained of nausea, vomiting and headache for one week. He received medical treatment at local medical clinics initially, but his condition still persisted without improvement. Progressed symptoms and fever were also noted after initial medical treatment, and, he was transferred to our emergency department (ED) for further evaluation. At the ED, the previous history of the patient was obtained from his family. This boy had experienced one earlier episode of AOM in his young-infant stage and experienced a single episode of acute sinusitis about 2 months prior to admission. Moreover, no any history of skull trauma was noted before admission. However, the physical examinations revealed general appearance as lethargy and neck stiffness with positive meningitis signs (Brudzinski’s sign and Kerning sign). After admission, blood was sampled for complete blood count (CBC) with differential count (DC) analysis, biochemistry, glucose levels, and blood culture. Immediately lumbar puncture with CSF survey (CSF analysis, bacterial culture, virus culture and CSF biochemistry test) was also performed. The blood laboratory tests showed leukocytosis with shift to the left (white blood cell (WBC) count: 29190/mm3, and bands: 4 %), and the results of CSF analysis revealed WBC count as 3240/uL with predominant neutrophils as 91 %, glucose levels as 55 mg/dL, and total protein levels as 160.5 mg/dL. Moreover, the gram stain of CSF showed Sptreptococcus Pneumoniae , and antibiotics with vancomycin and cefotaxime were given immediately. The cultures of CSF and blood both showed Sptreptococcus Pneumoniae 23 F. Based on the report of the sensitivity to antibiotics in the strain of 23 F, vancomycin was useful and given continuously for 14 days. To trace back his past history, about 6 months ago, this pediatric patient suffered from bacterial meningitis, and was admitted for survey and treatments. The CSF gram stain showed Sptreptococcus Pneumoniae. Both CSF and blood cultures also showed Sptreptococcus Pneumoniae 23 F. After complete antimicrobial treatment with vancomycin for 14 days, he was discharged home without complication.
+To further survey the cause of recurrent bacteria meningitis in such short period, we analyzed immunological functions of this boy, including complements and various immunoglobulins. However, the results showed normal immunity. According to the previous history of recurrent sinusitis for several weeks, we suspected that recurrent meningitis may be due to a bony defect caused by chronic sinusitis. Sinus computed tomography (CT) was performed but only right side maxillary sinusitis was noted without any bony defect. Moreover, nuclear scan was arranged and performed for studying CSF leakage. Notably, the results showed CSF leaked originating from the right petrooccpital region into the middle ear . Subsequent high resolution CT (HRCT) and magnetic resonance imaging (MRI) of bilateral ears were both carried out. The HRCT reports showed focal enlargement of the right facial nerve canal, erosion of the bony canal at geniculate ganglion and tympanic segment with tiny high-density spots and the reconstruction HRCT showed multiple bony defect at petrous part of temporal bone . The MRI reports revealed multifocal bony destruction with CSF collection in the right petrous ridge (near the Meckel cave and facial nerve canal at geniculate body ganglion region), carotid canal and jugular foramen . Eventually, CSF leakage to the right middle ear was confirmed and this may explain the cause of the recurrent bacteria meningitis in this boy. Further surgical approach for bony defect was suggested, but his family refused and asked for medical treatments. Therefore, after complete antimicrobial treatments with vancomycin for 14 days, this patient was discharged home, and received conjugated streptococcus pneumoniae vaccination (Prevenar 7) by self-payment, which is not included in the program of our national schedule vaccination at that time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1873_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1873_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..01a8bbb0cf1737814bf414c39867279546706250
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1873_en.txt
@@ -0,0 +1 @@
+A 42 year-old, right hand dominant male presented with 10 years of atraumatic right shoulder pain, exacerbated by overhead activity and weightlifting. He denied any history of trauma or instability. Physical examination revealed no gross deformities and no tenderness at the acromioclavicular joint or along the bicipital tunnel. Internal rotation was slightly limited compared to his contralateral side. The rotator cuff (RC) demonstrated mild weakness and was easily fatigued. Neer and Hawkins impingement tests were markedly positive. The active compression test (O’Brien Sign) was also positive as indicated by reproduction of the patient’s symptoms - pain deep within the glenohumeral joint - during phase one (thumb down) that were alleviated in phase two (thumb up). Cross-body adduction, speeds, and Yergason tests were all negative, and there was no evidence of shoulder instability. Magnetic resonance imaging demonstrated a partial-thickness articular-sided tearing of the supraspinatus (SS) and degenerative labrum tearing The biceps tendon was noted to have an accessory slip originating from the anterior aspect of the SS. Conservative efforts including oral anti-inflammatories, activity modification, corticosteroid injection, and physical therapy failed to provide longstanding relief. The patient elected to undergo definitive surgical intervention to include labral debridement, subacromial decompression, and biceps tenodesis. During diagnostic arthroscopy, the origin of the LHBT was found to be trifurcate, with origins arising from the SS tendon, superior labrum, and rotator interval (RI). At the articular margin, the LHBT was bifurcate . The more anterior of these two structures (2.8 cm) attached to the RI with its fibers blending such that the tendon was grossly indistinguishable from the interval tissue itself and separate from the leading edge of the SS. The more posterior bifurcate portion of the LHBT (3.8 cm) itself bifurcated with one portion attaching directly to the undersurface of the SS, while the remaining band attached to the superior labrum/supraglenoid tubercle . No fraying or gross inflammatory changes of the LHBT were appreciated . Tenotomy of all three origins was carried out using a radiofrequency ablation wand with care to avoid damaging either the SS or the RI tissue. Subpectoral biceps tenodesis was selected for definitive management to enable fixation of a single tendon. Postoperatively, the patient was started on early range of motion with limitations of active elbow flexion to less than 1 pound for the first 6 weeks followed by progressive strengthening. By 3 months postoperatively, the patient maintained normal biceps contour, regained full shoulder motion, and was progressing his activities without limitation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1881_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1881_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..abf1d748332342f195512321f36f2e6e720654d7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1881_en.txt
@@ -0,0 +1,4 @@
+A 68-year-old woman without previous relevant medical or traumatic history consulted the orthopedic surgery department for the left upper limb numbness and left neck pain. Noncontrast brain computed tomography and cervical vertebral X-ray were normal. She was prescribed analgesics and followed for about a year, but her symptoms worsened. The patient underwent cervical magnetic resonance imaging (MRI) and was found to have abnormal blood vessels. Thus, she was referred to our neurosurgery department for further evaluation and management.
+Neurological examination revealed left C5 radiculopathy and worsening pain and hyperesthesia in the left arm and scapula. Other neurological findings included left deltoid and biceps brachii weakness. A vascular murmur was also heard in the left neck. Cervical spine MRI revealed an extramedullary structure, demonstrated by flow voids with abnormal vascular morphology, adjacent to the left neural foramen from C4 to C6, with compression of nerve roots and spinal cord . MR angiography (MRA) revealed a left VVAVF with left VA ectasia, but could not accurately identify the fistulous point. Subsequently, the left VA digital subtraction angiography demonstrated a high-flow VVAVF connecting the left VA to the vertebral venous plexus, with a single fistulous point at the C5 level of the V2 segment , and large venous plexus with drainage into the anterior internal vertebral venous plexus. The anterior cerebral circulation was normal in all angiogram phases. There was no filling of the fistula from the anterior circulation. The contralateral vertebrobasilar circulation was normal with no steal flow into the fistula, except the VVAVF.
+We chose compact microballoon-assisted coil embolization of the left expanded paravertebral venous plexus, that is, target shunt occlusion. Heparin (3000 IU intravenously) was administered preoperatively. Under general anesthesia, a 10 cm 7-French femoral short sheath (TERUMO, Tokyo, Japan) was placed into the right common femoral artery. A 90 cm 7-French Guider Guiding Catheter ST (Stryker Japan K.K., Tokyo, Japan) was placed in the left VA. A 150 cm 2.5-French Renegade-18 microcatheter (Stryker Japan K.K., Tokyo, Japan) was transarterially guided to the left paravertebral venous plexus through the shunt using a 180 cm 0.016-inch GT wire double angle (TERUMO corporation, Tokyo, Japan) through the guiding catheter. In addition, a 4–15 mm HyperGlide microballoon catheter (Medtronic, Tokyo, Japan) was introduced into the left VA shunt point to regulate blood flow, prevent coil migration, and stabilize the microcatheter, so coils would not prolapse into the parent artery. While controlling shunt flow by inflating the microballoon placed in the left VA, the left vertebral venous plexus was embolized tightly and stably over a short distance with the Axium 3D coils 4 × 100 mm and 3.5 × 120 mm (Medtronic, Minneapolis, Minnesota, USA), and Tornado embolization coil 4 × 20 mm and 3 × 20 mm (COOC Medical, Tokyo, Japan). The microcatheter was gradually pulled back while placing the coils, and the fistula was firmly embolized with ED coil 10 ExtraSoft Type R 3.5 × 80 mm, 3 × 60 mm, 3 × 30 mm and 1.5 × 20 mm (Kaneka Medics, Osaka, Japan). The final angiogram from the left VA demonstrated complete disappearance of the VVAVF, with stable coils . Immediately after the procedure, the vascular murmur disappeared and we did not prescribe antithrombotic therapy. The patient was discharged 3 days postprocedure.
+Pain and numbness in the left upper limb were diminished at 1 month after the procedure. More than 4 years after the procedure, the patient remained well, without any complaint attributable to the endovascular embolization, and equally importantly, her symptoms, such as numbness and weakness, had improved. MRI 4 years postprocedure revealed that the flow void on the left side of the spinal canal had completely disappeared and compression of C4-6 nerve roots and spinal cord released . Likewise, no recurrence of the shunt was confirmed by MRA, with patency of the right VA .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1889_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1889_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fddc0465020d6220848f583041bba1a3feafb035
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1889_en.txt
@@ -0,0 +1,2 @@
+A 61-year-old male presented to the emergency department (ED) with difficulty breathing, stridor, and fever (100°Farenheit) that developed over the course of 24 hours. Laboratory studies were significant for borderline leukocytosis with elevated neutrophil count. Contrast-enhanced computed tomography (CT) of the neck demonstrated a peripherally enhancing, lobulated fluid collection with layering debris within the right paraglottic space, with external extension through the right thyrohyoid membrane and severe airway compromise .
+Imaging characteristics in conjunction with the clinical findings were consistent with pyolaryngocele. Emergency tracheostomy was performed to relieve the dyspnea, followed by surgical incision and drainage of the fluid collection, which was notable for pus. The patient was discharged in stable condition and was without complication at outpatient follow-up visit.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1917_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1917_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..abb40ff75633bcf165033720eb4458e67ac6b8a2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1917_en.txt
@@ -0,0 +1,3 @@
+A 62-year-old woman complaining of dizziness was admitted to our college hospital. The patient had a past medical history of thyroid dysfunction. She was neurologically intact, and had no abnormalities in her blood tests. Magnetic resonance imaging (MRI) showed an extended intrasellar tumor, which measured 25-mm in its greatest diameter and did not attach to the optic chiasm. The lesion infiltrated the right cavernous sinus, and extended to the pharynx . Initially, the tumor was considered to be a nonfunctional pituitary adenoma.
+The patient consented to TSS, and TSS was performed without incident . Seven days after TSS, the patient presented with associated hyponatremia . Approximately, 10 days after TSS, the patient complained of blurred near vision.
+In the ophthalmological examination before TSS, her vision was almost completely intact without visual field loss. The corrected visual acuity of both eyes was 20/20, the spherical equivalent of the right eye was −2.125 diopters, and that of the left eye was −2.0 diopters before TSS. However, 11 days after TSS, the spherical equivalent of the right eye had changed to −0.75 diopters, and that of the left eye had changed to −1.125 diopters. Figure shows the time course of serum electrolyte and glucose levels, corneal radius, spherical equivalent, axial length, anterior chamber depth, and lens thickness of both eyes. Axial length, anterior chamber depth and lens thickness were calculated by A-mode ultrasonography. Lens power was calculated with Bennett’s formula at the onset of blurred vision (11 days after surgery) and follow up (264 days), but could not be calculated before onset (i.e. before surgery and upto 10 days after) because we did not calculate axial length, anterior chamber depth and lens thickness over this time frame. There were no changes in axial length during follow up; however, both spherical equivalent and lens thickness were decreased, while in contrast the anterior chamber depth was increased. In addition, the size of both the decrease in lens thickness and the increase in anterior chamber depth was the same. The lens power (right eye: 17.52 diopters, left eye: 18.30 diopters) at onset increased to 20.27 diopters (right eye) and 20.11 diopters (left eye) at follow up . Although her hyponatremia rapidly improved over a period of one week, the refractive change persisted for 6 weeks (43 days) after TSS and 4 weeks after onset. During her 7 months of follow-up, the level of serum glucose was not changed from a normal and the patient had no apparent recurrence. And also, the corrected visual acuity was not changed during the follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1920_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1920_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fc69fb9f84021de7f1eed3b54a36cf804aa98fe0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1920_en.txt
@@ -0,0 +1 @@
+A 58-year-old man was receiving pembrolizumab as a 1st line treatment for NSCLC (showing differentiation into adenocarcinoma and squamous cell carcinoma) and multiple bone metastases for 9 months. The patient presented with anemia and bloody stools. Colonoscopy revealed a type 3 lesion at the transverse colon, and the biopsy showed an undifferentiated carcinoma. Computed tomography showed multiple swollen lymph nodes along the superior mesenteric artery. 18F-fluorodeoxyglucose positron emission tomography was performed for disease evaluation, and accumulation was observed in the right colon (maximum standardized uptake value of 22) . The preoperative diagnosis was cT3N1bM0 stage IIIB (union for international cancer control (UICC) 8th edition) locally advanced transverse colon cancer. We performed laparoscopic right hemicolectomy with lymphadenectomy. He was discharged on the 10 days after the surgery without postoperative complications. The resected specimen showed a tumor measuring 75 × 46 mm . Histologically, undifferentiated cancer cells and diffuse invasion of rhabdoid tumors were observed. Immunohistochemically, the tumor cells tested positive for AE1/AE3 and focally positive for CAM5.2 and epithelial membrane antigen. Programmed death-ligand 1 (PD-L1) tested positive . Synaptophysin, chromogranin A, thyroid transcription factor-1, surfactant protein A, cytokeratin 5/6, p40, S-100P, D2-40, leukocyte common antigen, α-smooth muscle actin, desmin, calponin, h-caldesmon, cytokeratin 20, and E-cadherin were all tested negative. The microsatellite instability (MSI) status was low. The final diagnosis was undifferentiated carcinoma with rhabdoid features and lymph node metastasis (pT3N2aM0 Stage IIIB, UICC 8th edition). He continued to be received pembrolizumab for NSCLC. There have been no signs of colon cancer recurrence and progression of NSCLC for 15 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1939_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1939_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b17953bb49e0d9805c9a872b2c2ac29c2e9346e7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1939_en.txt
@@ -0,0 +1,12 @@
+We report the case of a 52-year-old woman, autonomous and professionally active, without family or social support, with an Eastern Cooperative Oncology Group Performance Status (ECOG-PS) of 1. She noted a lump in her right breast and was diagnosed with breast cancer in 2019: invasive carcinoma of the breast, of no special type, G2, estrogen receptor (ER)-positive (90%), progesterone receptor-negative, HER2 3+, Ki67 60%, staged as cT3(m)N3M0—prognostic stage group IIIB.
+Her medical family history included maternal breast cancer at 68 years old and paternal CKD. The patient had multiple comorbidities, namely, CKD. When she was 9 years old, she was diagnosed with Fanconi syndrome. She has been on hemodialysis three times a week (medium 3.7 hours per session) since 1998. From 1982 to 1990, the patient was on hemodialysis as well, having received a transplant in 1990 that failed in 1998. At the time of the first oncology consultation, the patient presented a left arm aneurysm of the arteriovenous fistula, secondary hyperparathyroidism, secondary hypertension, severe pulmonary hypertension, uremic neuropathy, malnutrition, chronic hepatitis C virus infection genotype 2, prior acute colonic diverticulitis complicated with abscess with surgical management and colostomy, major depression, and status post-thyroidectomy and right neck dissection (May 2017) for papillary thyroid carcinoma.
+The patient was asthenic, and her physical exam denoted malnutrition, a right breast lesion measuring 10 × 7 cm, right axilla and right supra- and infraclavicular lymphadenopathies, and right arm lymphedema. The remaining physical exam found no evidence of breast cancer metastatic disease (cM0).
+Given the diagnosis of locally advanced HER2-positive, ER-positive breast cancer, along with the patient’s comorbidities and preferences (prioritizing tolerability and flatly refusing chemotherapy), neoadjuvant therapy with subcutaneous trastuzumab and oral tamoxifen was started in January 2020. The best response was a partial response with good tolerance and no cardiac toxicity. After 6 months of therapy, and repeatedly thereafter, curative surgery was proposed, which the patient refused, maintaining trastuzumab and hormonal therapy up until July 2022, when after 30 months of therapy, locoregional, skin, pleural, peritoneal, and lymph node progression was confirmed . During this period (until July 2022), the case was rediscussed in the tumor board, and alternatives such as radiotherapy were discussed and dismissed considering it would not be curative by itself nor effective palliating the lymphedema—the only local symptom the patient presented at that point.
+At the tumor board and considering the advice of the patient’s nephrologist, first-line treatment with paclitaxel, trastuzumab, and pertuzumab was recommended.
+The patient refused chemotherapy, so she was started on Phesgo® combined with exemestane in August 2022 (by then, the patient was postmenopausal). Phesgo® was administered every 21 days, 24 hours after the last hemodialysis session and 24 hours before the next.
+Three weeks after starting Phesgo® and exemestane, a reduction in the dimensions of the breast and skin lesions was already noted .
+In the first response evaluation by positron emission tomography (PET) with fluorine-18 fluorodeoxyglucose (FDG), a partial metabolic response was documented with a clear decrease in the uptake in the breast lesion, the lymph nodes, and the pleural nodules, in addition to a decrease in the pleural effusion volume . In January 2023, all the skin lesions had disappeared.
+No adverse events were noted, and the left ventricle ejection fraction and strain remained within the normal range .
+The patient completed 10 cycles of Phesgo® until April 2023, when some of the skin lesions reappeared, the breast lesion increased in size, and new left axillary lymph nodes were identified . FDG-PET in April 2023 documented disease progression in the breast, pleura, peritoneum, and lymph nodes . The patient maintained an ECOG-PS of 1 and started a second-line anti-HER2 therapy recommended by the tumor board.
+Our report is, to our best knowledge, the first published case report of Phesgo® treatment in a patient on hemodialysis. The choice of Phesgo®, a subcutaneous fixed-dose formulation of pertuzumab and trastuzumab, instead of the intravenous formulation was justified by the right arm lymphedema, the left arm aneurysm of the arteriovenous fistula, and the limited vascular access options. Also, according to PHranceSCa trial results, most patients prefer the subcutaneous formulation, with the most common reasons being “less time in the clinic” and “more comfortable during administration”, which were very important to this professionally active patient, already spending much time in the hemodialysis center . In the absence of dose and schedule recommendations, we chose to administer Phesgo® on a different day from dialysis, which was conducted at another institution. Due to pertuzumab’s high molecular weight (148 kDa), removal of Phesgo® by hemodialysis was not expected . Despite prior reports suggesting that a lower glomerular filtration rate could be associated with an increased risk of cardiotoxicity for both trastuzumab and pertuzumab, our patient did not experience cardiac toxicity. Considering the limited safety and dosage data for aromatase inhibitors (AI) in patients with a glomerular filtration rate under 30 mL/min, we chose exemestane due to its minimal renal elimination (<1%) compared to other options (anastrozole 11%, letrozole 90%, and fulvestrant 8%) . In the case presented, Phesgo progression-free survival (PFS) was 8 months, lower than reported in the phase II PERTAIN trial, which compared the combination of trastuzumab plus pertuzumab plus an AI with trastuzumab plus an AI, with a median PFS of 20.6 vs. 15.8 months [hazard ratio (HR) 0.67, p = 0.006]. While these results are encouraging for a chemotherapy-free regimen, it must be noted that one-half of patients received induction chemotherapy with a taxane prior to switching to maintenance exemestane. Furthermore, patients with CKD or other comorbidities and patients with disease progression on prior trastuzumab were excluded from the trial, which may explain the lower PFS observed in this case (–). One limitation of this report is the absence of pharmacokinetic data, which were not collected considering that they would not lead to therapy modification (in the absence of guidance for that) but would add morbidity and costs to the patient’s care.
+To conclude, our report demonstrates the safe and effective use of the association of trastuzumab plus pertuzumab in a patient with end-stage renal disease undergoing RRT and raises no red flags to the administration of the subcutaneous fixed-dose formulation in this setting. More studies are needed to assess the PK of anticancer drugs in patients on RRT and its efficacy and security in a real-world population. Meanwhile, some important lessons can be taken from this case, such as the importance of a multidisciplinary approach including medical subspecialties, in this case, nephrology. This was key to allowing the patient access to innovative oncological treatment despite her comorbidities and in accordance with her preferences. Raising awareness and special recommendations are needed for this patient’s subgroup not only to guide drug use and dosing but also to preclude undertreatment, especially in the curative setting.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_196_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_196_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1bf51dce059feb2b3389efccb790d03c97881df5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_196_en.txt
@@ -0,0 +1,2 @@
+A 33-year-old man with a history of blindness in his right eye from a congenital cataract presented to the emergency department with blunt head trauma sustained during a motor vehicle collision. He complained of right eye pain and foreign body sensation. On examination, a round white object was visualized within the anterior chamber; his head was otherwise atraumatic. The patient stated that the white spot had been present prior to the accident but had now changed in size and appearance, noting that the spot had enlarged following his injury.
+Fluorescein staining showed no abnormalities, and intraocular pressures were normal (18 millimeters mercury [mm Hg] right eye; 20 mm Hg left eye). Light perception was not present. Slit lamp examination demonstrated a round, white-speckled object in the dependent portion of the anterior chamber. Bedside ocular ultrasonography revealed a retinal detachment and an anterior dislocation of a cataract lens through the iris (–). Ophthalmology was consulted; anterior lens dislocations are considered an ocular emergency as they can result in acute angle-closure glaucoma and corneal edema; however, given the patient’s previous right-sided blindness they recommended next-day follow-up for operative repair.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1975_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1975_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7b8bf805245336801e63c3fca27cd74c2ad3ce1b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1975_en.txt
@@ -0,0 +1,2 @@
+The 46-year-old female patient was diagnosed with relapsing-remitting MS in 2005. She started on interferon-beta 1a in 2005 presenting a stable disease course in the following years. In 2010, severe idiopathic pulmonary arterial hypertension (IPAH) and one-vessel coronary artery disease were diagnosed after progressive exertional dyspnea, dizziness, marked restricted physical performance and mild stenocardia since 10 months, characterizing heart failure stage III of classification of the New York Heart Association (NYHA). Echocardiography showed right ventricular hypertrophy, moderate reduction of left ventricular and severe reduction of right ventricular function, paradox septum deviation and severe tricuspid valve insufficiency with an estimated systolic pressure of 90 mmHg . Routine echocardiography 12 months before was without abnormal results. Combined left and right heart catheterization demonstrated one-vessel coronary artery disease and severe pre-capillary pulmonary hypertension with a mean pulmonary arterial pressure of 66 mmHg (normal: 10–20 mmHg), left ventricular end-diastolic pressure of 12 mmHg (normal: 3–12 mmHg), cardiac index of 1.5 L/min/m2 (normal: 2.5-4.0 L/min/m2) and pulmonary vascular resistance of 14.1 wood units (normal: 0.25-1.6 wood units). The initial level of N-terminal pro-hormone of brain natriuretic peptide (NT-proBNP) presented with an increase up to 207 pmol/L (normal: ≤17 pmol/L). One week after placing a drug eluding stent in the left main coronary artery (LMCA) control echocardiography revealed an unchanged severe pulmonary hypertension with near normalized left ventricular function. Diagnosis of severe IPAH was established by exclusion of other causes of pulmonary hypertension according to the diagnostic criteria reported by Galie et al. . Compression of the LMCA by an enlarged pulmonary artery was excluded by CT-angiography of the pulmonary arteries. The patient started on the endothelin receptor antagonist ambrisentan and phosphodiesterase inhibitor tadalafil. By this treatment, the patient reported an improvement of physical performance, no more dizziness and stenocardia as well as a stable disease course corresponding to heart failure of stage NYHA II. In further evaluations, mild right ventricular hypertrophy and insufficiency, mild tricuspid valve insufficiency, decrease of right ventricular-systolic pressure in echocardiography, normal lung function, mild impairment in diffusion capacity of carbon monoxide and mild hypocapnia was detectable in the following years .
+In 2013, she demonstrated with significant clinical disease activity of MS with two relapses and MRI activity with three gadolinium-enhancing lesions and an Expanded Disability Status Scale (EDSS) of 4.0. Because of positive JC-virus serology, fingolimod was selected as second line treatment. Before first dose application, extensive cardio-pulmonary testing demonstrated stable cardiovascular parameters as described above . The baseline electrocardiogram (ECG) showed a sinus rhythm with a right bundle branch block. During first dose, heart rate (HR) decreased at maximum by 13 bpm at 4 hours and reached baseline HR 6 hours after initial fingolimod administration. 12 lead ECG as well as Holter ECG did not demonstrate any significant abnormalities . Blood pressure (BP) in lying and tilted up position presented within normal range during the whole 6 hours monitoring . The patient did not complain any findings in the first 6 hours after fingolimod application. Cardio-pulmonary testing one week, one, three and nine months after first dose application demonstrated stable parameters in ECG, BP, echocardiography, body plethysmography and blood gas analysis . Especially relevant parameters of right ventricular and pulmonary circulation including right ventricular hypertrophy, right ventricular end-systolic pressure (RVESP), right-ventricular ejection fraction and tricuspid annular plane systolic excursion (TAPSE) kept stable on fingolimod treatment . Detailed testing of the autonomic nervous system demonstrated no change of the efferent sympathetic regulation and left ventricular function after orthostatic stress before, 2 hours, 4 hours, and 6 hours after fingolimod first dose application as well as in three and nine month follow up . Maximal heart rate variability measured by expiration/inspiration quotient (E/I) during deep metronomic breathing showed a decrease to 1.06, which stabilized over time back to 1.09 . There were no additional cardiac or pulmonary symptoms than known before fingolimod treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1987_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1987_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..22926231c7f6fc4bfbed10ddef35cdf5735276c9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1987_en.txt
@@ -0,0 +1,7 @@
+We report on a male patient in his fifties of North European ancestry with stage IV colorectal cancer and no known familial history of cancer. The patient had not participated in colon cancer screening tests. Clinical symptoms were unexplained weight loss for a period of six months before diagnosis. Initial diagnosis then presented a primarily metastasized adenocarcinoma of the cecum and bilobular hepatic metastases. Due to polytope bilobular liver metastasis surgical resection was not indicated, and he was admitted to a palliative chemotherapy (CTX). Figure shows the course of events.
+The patient gave informed written consent for serial blood sample collection for biomarker analysis and the study was approved by Kiel University’s medical faculty ethics board (#A110/99). For analysis of ctDNA, we obtained a pre-treatment blood sample in week 2 and a mid-treatment blood sample in week 10, after three cycles of chemotherapy. The patient opted out of further blood sampling when he progressed. The blood samples were collected in Streck cfDNA BCT tubes from which plasma was centrifuged according to the manufacturer’s recommendations and stored at − 20 °C until DNA isolation. The plasma was thawed at room temperature. DNA was isolated from the plasma using the PerkinElmer NEXTprep-Mag cfDNA kit according to the manufacturer’s protocol. Ultra-deep sequencing of the ctDNA was performed on Illumina NextSeq 500 with 2x150bp reads using the PANCeq pan-cancer panel .
+For analysis of tumour tissue mutations, we obtained DNA from a pre-treatment colonoscopy biopsy from the primary tumour in the cecum in week 0 and four tissue samples from an emergency hemicolectomy in week 19 (cecum, lymph node, pericolonic and peritoneal metastases). The tissue samples were obtained from formalin-fixed paraffin embedded samples after HE staining and histological identification and marking of cancer cell regions by the pathological laboratory. Tumour DNA was isolated from the tissue using the RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE (ThermoFisher Scientific Inc) according to the manufacturer’s protocol. Exome sequencing of the tissue DNA samples, and a patient-matched blood buffy coat DNA sample was performed on Illumina NovaSeq 6000 with 2x150bp reads using the IDT xGen Exome Research Panel (Integrated DNA Technologies, Inc.) according to the manufacturers’ protocols. Sequence data analysis was performed with GenSearchNGS (Phenosystems S.A.), Alamut Visual (Interactive Biosoftware), IGV and pibase [–].
+Initial mutational profiling of a colonoscopy sample from week 0 within the routine diagnostics of the pathological analysis revealed the following: KRAS mutation p.G12D; no mutation in exon 15 of BRAF; MSI stable. Our blood sample from week 2 revealed the KRAS mutation and four more major tumour mutations in the following genes (see Table ): APC (in 49% of sequences), TP53 (39%), KRAS (32%), THSD7B (20%), and a copy number amplification of a chromosomal segment on chromosome 4 containing FBXW7. The copy number amplification was deduced from a genomic stretch of germline polymorphisms with near-identical allele frequencies of around 0.25 (see Additional file : Table S1) instead of the expected allele frequency of 0.50. Retrospective exome sequencing of the initial cecum tumour tissue biopsy confirmed these mutations and the FBXW7 amplification and detected further major clonal mutations (Additional file : Table S2) that were not covered by the ctDNA sequencing panel.
+Based on the mutation in the KRAS gene, chemotherapy with FOLFIRI + Bevacizumab (standard dosages) commenced shortly after initial diagnosis. After three cycles of chemotherapy, the blood sample from week 10 revealed major changes in the tumour allele frequencies: TP53 (6%), APC (5.5%), KRAS (4%), and THSD7B (3%). The amplification of the chromosome segment with FBXW7 was not clearly detectable any longer in the cfDNA (polymorphism allele frequencies 43–52%). After six cycles of chemotherapy, a re-staging by CT-scan was performed in week 15 and suggested a stable disease of the primary tumour and showed a regression of the liver metastasis . In parallel, the routinely tested cancer markers CEA and CA19–9 dropped, from 18.5 μg/l to 8.7 μg/l, and from 906kU/l to 394kU/l, respectively.
+However, four weeks after the CT scan the patient was admitted to the emergency room with an ileus caused by a substantial increase in size of the primary tumour, a circumferentially growing tumour of 4 × 3.5 cm size at the ileocecal valve. In emergency surgery a right hemicolectomy was performed. Retrospective exome sequencing of the tissue samples obtained from the hemicolectomy (cecum, lymph node, pericolonic and peritoneal metastases) confirmed that the FBXW7 amplification was no longer clearly detectable in the cecum, lymph node, or peritoneal metastasis, but possibly in the pericolonic metastasis sample. The major clonal mutations detected in the pre-treatment biopsy remained conserved in all post-treatment samples, with no new major clonal mutations detected .
+After surgery, a second line chemotherapy with FOLFOX + Bevacizumab was started. Unfortunately, short-term imaging of the tumour burden exposed progressive disease, so that shortly afterwards a 3rd line chemotherapy by Trifluridin + Tipiracil was started. Therapy monitoring by ultrasound imaging of the hepatic metastasis presented substantial progression of the tumour load and hence inefficiency of the systemic therapy. The patient was transferred to best supportive care and deceased 8 months after initial diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1995_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1995_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..48386deff5b2cb96e78cb8fdadfcbc01232c1ee5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1995_en.txt
@@ -0,0 +1,5 @@
+A 90-year-old Caucasian man, in otherwise good health, presented with a left scrotal mass that had been present for eight months and was occasionally painful. The man had no fever, weight loss or night sweats; there was no lymphadenopathy, hepatosplenomegaly or mass in the right testis.
+The patient underwent left radical orchiectomy. Macroscopically, the specimen consisted of testis, epididymis and spermatic cord. On the cut surface, the epididymis was replaced completely by a uniform tan mass that measured 6 × 3 cm without areas of necrosis or hemorrhage. No invasive lesions were observed in the testis and spermatic cord and the neoplastic tissue was restricted to the epididymis.
+Microscopically, the testicular parenchyma showed no evidence of lymphomatous involvement . The epididymis contained a dense lymphoid infiltrate predominantly composed of small cleaved cells (centrocytes) with admixed small and large non-cleaved cells (centroblasts). The number of centroblasts ranged between five and 15. The neoplasm predominantly displayed a follicular growth pattern . Neoplastic follicles were quite expansive and irregular and were coalescent in some areas. Well formed mantle zones were absent. No tangible-body macrophages were present.
+Immunohistochemistry (IHC) investigation demonstrated that neoplastic cells strongly expressed CD45RB (LCA, clone 2B11+PD7/26, Dako), CD20 (clone L26, Dako), CD79a (clone JCB117, Dako), bcl-6 (clone PG-B6p, Dako) and CD10 (clone 56C6, Dako) . On the other hand, staining for CD3 (clone F7.2.38, Dako), CD45RO (clone UCHL1, Dako), CD5 (clone 4C7, Thermo Scientific), CD23 (clone SP23, Dako) and bcl-2 (clone 124, Dako and clone 100/D5, Novocastra) were negative . Immunostaining for CD21/CD35 (clone 1F8/Ber-MAC-DRC, Dako) demonstrated expanded networks of follicular dendritic cells within the nodules. Approximately 60% of the neoplastic cells reacted positively when stained with antibody against Ki-67 (clone MIB1, Dako). The proliferation index of follicular lymphoma generally correlates with tumor grade. The proliferation index reported here was independently performed by more than one pathologist and, although it is somewhat high for a low grade follicular lymphoma, discordances are known to occur in follicular lymphoma . Finally, polymerase chain reaction (PCR) analysis revealed a monoclonal immunoglobulin heavy chain gene rearrangement and the detection of t(14;18)(IgH/BCL2) revealed the BCL/JH rearrangement . The lymphoma was classified on the basis of the World Health Organization's (WHO) 2008 guidelines as follicular lymphoma, low grade, grade 1-2, with follicular pattern. The disease was staged as IE (extranodal) primary epididymal lymphoma. Commercial kits by AB Analitica (Padua, Italy) were used to perform both procedures according to the manufacturer's instructions. All used products are compliant with the requirements of the in vitro diagnostic directive (IVDD) 98/79/EC. IHC and molecular analyses were carried out as previously described [-].
+The patient underwent full staging for lymphoma, including computed tomography of the total body which did not reveal any evidence of extratesticular involvement (image not shown) and did not receive chemotherapy. Bone marrow biopsy showed no evidence of lymphoma (data not shown). A post-operative follow-up of more than 15 months has been uneventful, without disease recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1996_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1996_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aae8fd578ea47b94bee420f5ed2823072b80dc89
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1996_en.txt
@@ -0,0 +1,14 @@
+Our work is a single case report and has been reported in line with the SCARE criteria .
+A healthy 59-year-old woman on long-term therapy with Hydroxyurea 500 mg daily for essential thrombocytosis, presented with a painless slow-growing lesion of the jaw that had persisted and increased in size for six months, the appearance of the lesion is correlated to the administration of the hydroxyurea treatment. There was no history of local trauma, radiotherapy, HPV infections, or family history of malignancy. She was referred to our department's consultation for specialized care. No other personal or family history was raised during the patient interrogation. Clinical examination revealed a large nodular lesion with irregular borders of the right cheek, infiltrated into underlying tissue, the lesion extending to the free border of the right lower eyelid with dimensions 4 × 4 cm, without sensory disturbances or diplopia (.). In the nose, black horn-shaped hyperkeratosis lesion in the nasal pyramid (.).
+There were no palpable neck lymph nodes on the left side.
+A biopsy of surgical material was performed, showing a well-differentiated squamous cell carcinoma.
+The definitive diagnosis of malignancy was made; metastatic investigations were performed, including chest radiography, abdominal echography, PET scan. The results of these exams were normal.
+The computed tomography (CT) was performed and found free lymph node.
+On the biological level, the patient presented anemia at 7.4 g / dl for which she was transfused; a thrombocytosis at 548.000, the rest of the assessment was without particularities.
+Based on the positive medical history and clinical examination, the patient was diagnosed clinically with hydroxyurea-induced squamous cell carcinoma, the hydroxyurea was ceased and the hematological therapy was switched to busulfan. The surgery was indicated and performed by the chief professor of our department who has 15 years of operative experience. The surgical procedure had the aim of the restoration of the anatomic landmarks after a large excision of the tumor and reconstruction of full-thickness eyelid defect with a local flap under general anesthesia.
+Duration of surgery: 60 min; estimation of blood loss: 150 ml; duration of hospital stay: 3 days.
+The patient received amoxicillin/clavulanic acid 1 g twice daily and antalgics for 8 days.
+Post-operative histopathology confirmed SCC proliferation; the different margins of excision were healthy.
+The multidisciplinary team deciding on the treatment options included surgeons, oncologists, radiotherapists, ophthalmologist surgeons, radiologists. The decision was made to treat the patient with the surgical approach (surgical excision of the tumor) with 1.5 cm free margins and reconstruction; the authors used the superior pedicle nasolabial island flap; with postoperative radiotherapy (PORT) and postoperative chemotherapy (POCRT). Considering the patient's age, general history, the size of the tumor, the prognosis was average.
+Postoperative periods were favorable; the scar was clean and non-inflammatory.
+Routine follows up 3, 6, and 12 months showed no signs of recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1997_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1997_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..02b30b7110d3eca87ca675b0473354b6999bc2e5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1997_en.txt
@@ -0,0 +1,2 @@
+A 62-year-old non-Asian Spanish man was admitted to the emergency room for abdominal pain of epigastric origin, which evolved over the next 3 days to diffuse pain with constipation, but with no fever or vomiting. He had a 32-pack-year smoking history and had completed disulfiram treatment for alcohol cessation 10 years previously. He had residual pain in lower limbs after lumbar disc herniation surgery 15 years previously, for which he was taking naproxen, and had a medical history of a mild factor XII deficiency. He had no other relevant medical, surgical, or family history. On physical examination, palpation showed he had a contracted abdomen, with lividity and signs of peritonism but with no signs of deep vein thrombosis in the lower limbs. Blood pressure was 112/88 mmHg, heart rate 122 beats per minute, and temperature 35.8 ℃. There were no other findings on physical and neurological examination. A thoracoabdominal computed tomography (CT) scan revealed “findings suggestive of intestinal perforation (probably in the upper hemiabdomen), without being able to clearly identify the point of perforation.” Laboratory parameters in the emergency room showed glucose 123 mg/dL, urea 238 mg/dL, creatinine 4.29 mg/dL (previously, normal), total bilirubin 1.45 mg/dL (conjugated 0.91 mg/dL), and amylase 111 mg/dL. Sodium and potassium were in normal range, and the hemogram was also normal. Intravenous fluid resuscitation and empiric antimicrobial therapy with piperacillin–tazobactam 3.375 g/8 hours intravenous for 10 days, fluconazole 400 mg/24 hours for 6 days, and vancomycin 1 g/12 hours for 4 days were started. The patient underwent urgent surgical intervention, which revealed generalized peritonitis, perforation at the pylorus, necrosis of the greater omentum, and an abundance of free fluid in all abdominal quadrants (surgical intervention consisted of pyloric suture and resection of the greater omentum). The pathology report revealed “pyloric wall with signs of perforation and epiplon with adiponecrosis, microabscesses and exudative-fibrinoid serositis.” In the immediate postoperative period, the patient had a low level of consciousness and saturation of up to 80%, with acute lung edema observed on the CT scan (“extensive bilateral pulmonary consolidations associated with bilateral pleural effusion and evidence of anasarca due to probable fluid overload/decompensated heart failure”). The patient was intubated to achieve oxygen saturation > 98% with an FiO2 of 0.4. The patient was sedated and on analgesic, responding to painful stimuli. Hemodynamically, he was mostly stable with a need for norepinephrine at 0.3 mg/kg/minute and tension readings of 123/73 and 90 beats per minute. However, liver function progressively worsened, reaching total bilirubin levels of 4.15 mg/dL. Likewise, the patient was in acute renal failure AKIN III, with diuresis dependent on furosemide at 30 mg/hour, creatinine levels > 4 mg/dL, and urea > 290 mg/dL. The patient presented poor postoperative course, with progressively higher fluid outflow through abdominal drains and abdominal sepsis, as revealed by symptoms and microbiology (Klebsiella pneumoniae was isolated in blood culture; Enterococcus faecalis and Escherichia coli in the drains; E. coli and Streptococcus anginosus in the surgical wound), which raised suspicion of perforation of the previous surgical suture. As intraabdominal pressure increased progressively, the patient underwent a second surgical intervention at 9 days after the first surgery, which revealed a biliopurulent contamination in the peritoneal cavity caused by a previous dehiscence from a pyloric suture line. Therefore, based on intraoperative findings, duodenal exclusion was performed by gastric antrectomy followed by retrocolic Roux-en-Y (end-to-side) gastrojejunostomy and jejunojejunal distal (side-to-side) anastomosis. Cholecystectomy was then followed by external drainage of the common bile duct by placement of a T-tube, to prevent cholecystitis. Splenectomy was performed because of intraoperative bleeding.
+The patient remained intubated and sedated, maintaining good saturation. He also had hemodynamic stability without vasoactive amines. However, total bilirubin levels continued to rise (from 4.15 to 6.8 mg/dl), and the patient continued to exhibit anuria, with urea 291 mg/dl, creatinine 4.02 mg/dl; pH 7.35, HCO3- 26.5 mmol/L, pCO2 47 mmHg, and normal anion gap (AG). The patient began treatment with an infusion of caspofungin for 13 days at 50 mg/24 hours, meropenem for 21 days at 1 g/8 hours, and again with vancomycin for 6 days. As the patient again presented very poor postoperative evolution, with fecal contamination of the abdominal drainage, a third surgery was performed 4 days after the second one, in which the patient underwent partial colectomy (due to the intraoperative ischemic appearance of the colon) and resuture of the pyloric repair. Pathological anatomy showed gastric and duodenal dehiscence, with an ischemic appearance of the transverse colon and perforations, foci of hemorrhagic necrosis (both mucosal and submucosal), secondary gangrenous inflammation, and multiple intestinal ulcerations related to calcified phlebosclerosis of the submucosal vessels. After the third intervention, the patient was in stable but serious condition. Hemodynamically, the patient was stable, with some hypertensive peaks (160/70 mmHg). Bilirubin levels improved, down to 2.19 mg/dl; however, the patient continued to have poor kidney function that required hemodialysis sessions at 6 days after the third surgery. Due to the improvement in respiratory function, extubation was carried out but failed due to weakness in the musculature. For this reason, a tracheostomy was performed at 29 days after admission. Teicoplanin was delivered at 3 days after the third surgery, at 400 mg/12 hours for 6 days by isolation in surgical wound exudate of Enterococcus gallinarum. An infusion of ertapenem and ampicillin at 1 g/24 hours and 1 g/6 hours, respectively, was started at 16 days after the third surgery but was suspended because of a skin rash. Linezolid infusion (600 mg/12 hours) was also started at 20 days after the last intervention in order to treat for Gram-positive bacteria. In the last days of life, the patient showed increased overall deterioration, with disconnection to his environment, oscillation between normothermia and hypothermia, and systolic blood pressure < 70 mmHg, which forced hemodialysis to be suspended. Furthermore, despite hemodialysis, creatinine peaks continued at 8.11 mg/dl, and urea at 190 mg/dl. After receiving palliative care, the patient died, 35 days after admission. No autopsy was requested.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2042_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2042_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e215f0bee88e50562aa9a1e82a6393dc1679451c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2042_en.txt
@@ -0,0 +1,10 @@
+A 62-year-old man with metastatic stage IV squamous cell cancer (SCC) and no prior history of autoimmune disease was treated with nivolumab every 2 weeks (3 mg/kg) from July 2016 to April 2017, resulting in complete clinical remission of his SCC. Nivolumab was ceased in April 2017, after he developed musculoskeletal irAEs with disabling polyarthritis involving shoulders, elbows, proximal interphalangeal joints and right knee, classified as a grade 3 irAE. C reactive protein (CRP) was markedly elevated at 210 mg/L. Rheumatoid factor (RF), anticyclic-citrullinated peptide antibody (ACPA) and HLA-B27 were negative, and radiographs demonstrated no erosive changes. Despite prednisolone (20–25 mg daily), intra-articular corticosteroid and sequential hydroxychloroquine (200 mg daily) and methotrexate (20 mg weekly; ), his synovitis remained active.
+Given the lack of definitive therapeutic guidelines for rheumatic irAEs, the emergence of synovial biopsy-guided therapeutic approaches in RA and following our experience with arthroscopic ST biopsies, the patient underwent arthroscopic ST biopsy of his right knee in November 2017 (200 days following cessation of nivolumab).
+At arthroscopy, nivolumab-induced synovitis was more severe macroscopically than the synovitis in comparator treatment-naïve early RA ST, with florid synovial hyperplasia and hypervascularization throughout (, and see ). Several ST biopsies were undertaken from areas of synovitis within the knee. Matched peripheral blood mononuclear cell (PBMC) and SF samples were collected. ST, SF and PBMC samples from this patient were compared with samples from three treatment-naïve patients with RF and/or ACPA-positive early RA (defined as within 12 months of onset of symptoms and fulfilling the 2010 American College of Rheumatology/European League Against Rheumatism classification criteria), from whom samples were collected at the time of diagnosis. Additional PBMC and SF samples were collected from the irAE patient at the conclusion of 6 months infliximab therapy. All patients gave written informed consent.
+ST samples were analyzed using histology, and flow cytometry following disaggregation. Histology was performed on serial 5m sections from formalin-fixed paraffin-embedded ST blocks. Sections were stained with H&E or labeled with the following primary antibodies for immunohistochemistry (IHC): CD45RO (Dako; UCHL1), CD55 (BioRad; C67), CD68 (Dako; KP1), TNFα (LifeSpan; C7952), IL-6 (Santa Cruz; 130326), and via a National Association of Testing Authorities approved protocol with PD-1 (CellMarque; MRQ22), PDL-1 (Ventana; SP263). Antibody-stained sections were incubated with horseradish peroxidase linked secondary antibody, followed by colorimetric visualization with either 3-amino-9-ethylcarbazole substrate-chromogen (for CD45RO, CD55, CD68, TNFα and IL-6) or 3,3′-Diaminobenzidine (for PD-1 and PDL-1). Nuclear counterstaining was performed with Mayer’s haematoxylin. Negative controls included the use of IgG isotype controls or omission of the primary antibody. Whole slide scans were captured on an Olympus VSI120 bright-field microscope at x20 magnification and sequential regions of interest compared for staining intensity. Semiquantative assessment of staining intensity was perfomed by two independent assessors using previously described techniques.
+For flow cytometry, fresh ST was dissociated using Milytenyi Tumour Dissociation Kit (Milytenyi; 130-095-929) and the gentleMACS dissociator as per manufacturer’s recommendations. Matched SF and whole blood was collected for each patient at arthroscopy and for irAE only, after 6 months of infliximab treatment. PBMCs were purified using Lymphoprep reagent. Cells were washed and counted prior to staining for flow cytometry with Zombie UV (BioLegend) in serum free PBS, followed by washing and staining with CD45RO-UV395 (BD; UCHL1), PD1-BV421 (BD; EH12.1), CD3-PerCP/Cy5.5 (BD; SK7), CD8-Alexa647 (BD; RPA-T8), CD4-Alexa700 (BD; SK3), CD20-APC/H7 (BD; L27) in 2% Fetal calf serum. Cells were resuspended in 2% fetal calf serum ready for FACS acquisition on a BD FACSAria Fusion flow cytometer. Analysis of cytometry data was performed using FlowJo 10.4
+Analysis of the IHC inflammatory cell infiltrate pathotype revealed lymphoid (follicular) pattern of the patient with irAE and a similar pattern in one of the RA controls; of the two other RA controls, one had diffuse and the other low (or pauci) immune infiltration. IHC of ST from the patient with irAE revealed infiltrating memory T-cells (CD45RO+) and extensive CD68 expressing macrophages (lining and sublining) , and there were no detectable B cells; in comparison, two (of the 3) RA ST revealed presence of B cells within the lymphoid aggregates and slightly less extensive CD68 expressing lining/sublining macrophages. The irAE ST displayed abundant TNFα, compared with lower levels of IL-6 labeling . This differential cytokine expression was similar to that previously observed in a proportion of patients with RA. Finally, we detected abundant levels of PDL-1 labeling in both RA and irAE ST but there was no detectable PD-1 in ST from the patient with irAE . In summary, the synovial cellular infiltrate in ST was similar to the RA ST and was indicative of TNFα dominant RA-like disease. Critically, the presence of cellular intense and dominant staining of the proinflammatory cytokine TNFα in irAE ST influenced our decision to prescribe Infliximab (an TNF antagonist) instead of an alternative bDMARD such as Tocilizumab (an IL-6R antagonist) for this irAE.
+We then performed multiparameter flow cytometry to further characterize infiltrating T-cells in ST, SF and PBMCs in response to nivolumab-induced irAE, and, to identify changes in peripheral and SF T-cells after infliximab treatment.
+CD4 +T cells were gated and CD45RO and PD-1 expressing cells were identified . Abundant memory T-cell infiltration was observed in both ST and SF compartments for RA and irAE samples, with samples from PBMCs exhibiting lower memory T-cell frequency. Importantly, we detected a reduction in PD-1 labeling on T-cells from irAE samples compared with early RA controls. In particular, prior to commencing infliximab, there was approximately a 20-fold reduction of PD-1 +memory T cells in the SF compartment and 4-fold reduction in the ST compartment when compared with RA . Furthermore, while early RA comparators exhibited fewer peripheral PD-1 +memory T-cells in PBMCs compared with RA ST and SF compartments, we observed complete ablation of PD-1 labeling in irAE PBMC memory T-cells .
+Commencement of infliximab (5 mg/kg) led to a dramatic clinical response , coupled with a precipitous fall in CRP to 0.36 mg/L. This improvement persisted despite weaning of prednisolone to 5 mg/d and methotrexate to 10 mg/week . Infliximab was ceased after 6 months and at last follow-up—18 months after nivolumab cessation—he continues to have minimal synovitis, well controlled on low-dose methotrexate and prednisolone (5 mg daily) and, critically, no recurrence of his lung cancer.
+Interestingly, in PBMCs and SF collected after 6 months of infliximab therapy, we identified a near restoration (compared with RA) of PD-1 expressing CD4 +memory T-cell frequency .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2044_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2044_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8e53a810dc44e0b65e1ed2b67d5e27ad58da61ca
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2044_en.txt
@@ -0,0 +1,5 @@
+A 57-year-old Asian man without relevant previous medical history was hospitalized following a fall from the 15th floor of a condominium. A witness said he had fallen from the condominium and had contacted electrical wires before hitting the ground. Prior to being transferred to the hospital, when the emergency medical service personnel arrived on scene, the patient had no pulse, but spontaneous circulation returned after 4 min of chest compression. On hospital arrival, the patient’s airway was maintained spontaneously, respiratory rate was 30 breaths/min, blood pressure was unmeasurable but the left femoral artery pulse was weakly palpable, heart rate was regular at 136 beats/min, body temperature was 36.1 °C, and Glasgow Coma Scale was E3V1M5. His right inner thigh was lacerated halfway around, and he was actively bleeding from this site. Blood analysis data on admission are shown in Table . We immediately initiated a massive transfusion protocol, secured the airway of the patient with endotracheal intubation and temporarily ligated the proximal exposed superficial femoral artery (SFA), deep femoral artery (DFA) just distal part after branching lateral femoral circumflex artery (LFCA), and superficial femoral vein separately. As we could not detect backflow from the distal artery, possibly because of intimal injury, spasm, or thrombus, and also as there was no time to expose this artery, we could not temporarily shunt it. As well, a tourniquet could not be applied because the injury site was too proximal to the torso. In parallel with preparations to initiate resuscitative endovascular balloon occlusion of the aorta via the left femoral artery, we packed the thigh and sequentially searched for other sites of bleeding because of the patient’s continued hemodynamic instability. Although we found no other sites of bleeding according to an extended focused assessment with sonography for trauma examination, subsequent plain pelvic radiography suggested the potential for retroperitoneal bleeding with iliac fracture. Considering the patient’s hemodynamics, we performed retroperitoneal packing by making suprapubic incision and entering preperitoneal space comprising the para-vesical and presacral space and then packing pads were placed.
+After this was completed, the patient was stable enough to undergo contrast-enhanced computed tomography (CECT). CECT showed fractures of the 4th lumbar vertebra and right iliac body concomitant with arterial extravasation at this site , so we performed transcatheter arterial embolization . Although CECT showed that the right SFA and DFA just distal part after branching LFCA were interrupted , narrow blood flow in the distal popliteal artery seemed to be maintained by collateral perfusion from LFCA as pulse doppler detected a weak pulse in the dorsal pedis artery. The ankle brachial pressure index at this time was approximately 0.54. After confirming good consciousness of the patient and resolving resuscitation-related conditions such as hypothermia and acidosis, we decided to perform revascularization of the femoral artery and vein by bypassing them with great saphenous vein grafts at approximately 24 h after the initial injury. The operation was performed with the patient in the supine position. Minor fresh thrombus was obtained from distal side of SFA and SFV by Fogarty catheter insertion and we could obtain sufficient back flow from both vessels. We decided to sacrifice the DFA and vein and bypass the SFA. The great saphenous vein was harvested from the left limb, and a graft of about 7 cm in length was anastomosed to the intact intima of the SFA . As the superficial femoral vein also appeared to be bypassable, we bypassed it with a great saphenous vein . All anastomoses were performed by use of 6-0 monofilament suture with the parachute technique.
+The soft tissue was also severely injured with some loss of tissue apparent. We initially considered covering the anastomosed vessels with viable muscle, but as the tissue deficit was not completely uncoverable, negative pressure wound therapy was applied over the muscle tissue.
+The patient was extubated on the 4th hospital day, and musculocutaneous grafting was performed 22 days after the initial operation following completion of negative pressure wound therapy. Postoperative CECT showed the patency of flow through the femoral vessels and the score of ABI improved 1.15. As adjuvant therapy, although we could not administrate anticoagulant drugs prior to surgery on the basis of concomitant injury, systemic unfractionated heparin infusion was used during and post 10 days after bypass surgery. And then we converted to oral administration of warfarin and controlled the international normalized ratio of prothrombin time at the range of 2.0–2.5.
+The patient was transferred to a rehabilitation hospital 52 days after admission without any symptom such as swelling or intermittent claudication.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2069_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2069_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2ad6e727463ed0c247a5f1e68be3da16e97d7917
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2069_en.txt
@@ -0,0 +1,6 @@
+A 56-year-old man developed isolated paresthesias, weakness and cramps of the right upper limb over a period of three months. Previously he had been healthy with no history of long-term medications, engaging in variety of sports (cycling, running, cross-country skiing, bow-shooting). Neurological examination revealed isolated distal muscle weakness of the right upper limb (MRC 3), normal muscle strength of the left upper limb (MRC 5), generalized hyporeflexia and the presence of pes cavus bilaterally with normal muscle strength (MRC 5) and reduced vibration sense (ankle 4/8, toe 2/8) in the lower limbs. Slightly reduced pin prick and thermic sensation was detected. The patient was able to walk on heels and tiptoes. Mild ataxia when standing with eyes closed (positive Romberg sign) was also present. Chronic progression of muscle weakness followed during the next six months. The right upper limb showed increased distal weakness (wrist extensors MRC 3, finger extensors MRC 1, wrist and finger flexors MRC 3, intrinsic hand muscles MRC 3). Afterwards, involvement of the left upper limb with mild weakness and paresthesia also appeared (wrist extensors MRC 5, finger extensors MRC 3, wrist and finger flexors MRC 4, intrinsic hand muscles MRC 4). As a result, the patient had difficulties with fine motor tasks, such as buttoning or unbuttoning of clothes, unscrewing bottle caps and turning door-knobs. No weakness of proximal upper limb muscles was registered (MRC 5). Muscle strength in lower limbs was normal (MRC 5).
+Nerve conduction studies (NCS) were consistent with moderate primary demyelinating sensory-motor polyneuropathy of the upper limbs with partial conduction blocks in some nerves (median, ulnar) and severe sensory-motor polyneuropathy of the lower limbs. Compound muscle action potentials (CMAPs) showed prolonged distal motor latencies, reduced nerve conduction velocities and low amplitudes with prolonged minimal F wave latencies. Sensory nerve action potentials (SNAPs) in the upper limbs showed prolonged distal latencies, reduced velocities and low amplitudes. SNAPs in lower limbs were absent . Needle electromyography revealed a severe chronic denervation syndrome with sporadic spontaneous activity in upper limb muscles (biceps brachii, deltoideus, extensor digitorum communis, interosseus dorsalis primus, and abductor pollicis).
+Laboratory tests revealed normal values, including the absence of paraprotein. CK (creatine kinase) levels were two-fold greater than normal. Antineuronal, antiganglioside and anti-MAG (myelin-associated glycoprotein precursor) antibodies were negative. Nodal/paranodal antibodies (NF 155, 140/186, contactin 1 and Caspr) were also negative. Genetic testing for CMT1A and HNPP (hereditary neuropathy with pressure palsies) yielded negative results. CSF (cerebrospinal fluid) showed a protein level of 0.54 g/L, normal cell count and absent oligoclonal bands. MRI of the brain, cervical spine and both plexus brachialis showed normal findings.
+The diagnosis of Lewis-Sumner syndrome (MADSAM) was made at the time (according to EFNS/PNS criteria 2010). The treatment started with methylprednisolone 4 g intravenously. Oral prednisone (1 mg/kg/day) continued for two months. No clinical improvement led us to start with immunoglobulin therapy (IVIG, 0.4 g/kg/day, five days every month). After the 3rd cycle of IVIG, upper limb weakness transiently improved (right upper limb wrist extensors MRC 4, finger extensors MRC 3, left upper limb wrist extensors MRC 5 and finger extensors MRC 4). Despite the frequent and highly dosed IVIG therapy during the next two-year treatment period, weakness progression continued. Later, patient underwent three cycles of plasma exchange in period of six months (five exchanges in each cycle) without any clinical improvement. Finally, one dose of ocrelizumab (two 300 mg infusions) was administered off label as the last therapeutic attempt. The patient continued to progress despite ocrelizumab treatment (right wrist extensors MRC 1, finger extensors MRC 1, wrist and finger flexors MRC 2, intrinsic hand muscles MRC 2, left wrist extensors MRC 2, finger extensors MRC 1, wrist and finger flexors MRC 3, intrinsic hand muscles MRC 2). Moreover, weakness and muscle wasting spread to proximal upper limb muscles bilaterally (supinator, pronator, biceps, brachialis, deltoideus with MRC 4). Minimal weakness progression was also registered in the distal muscles of both lower limbs with (MRC 4). Therefore, in conclusion, intensive long-lasting immunomodulatory therapy was unsuccessful .
+A survey of the patient´s family revealed signs of polyneuropathy in two other family members: the proband’s mother (79 years old, I.2) and his son (31 years old, III.7, Fig. ). Both of them were asymptomatic (they did not complain about any motor or sensory disturbance in the upper or lower limbs). However, both of them had an evident bilateral pes cavus, generalized areflexia and decreased vibratory sense in the lower limbs. NCS revealed moderate primary demyelinating sensory-motor polyneuropathy of the upper limbs and severe demyelinating polyneuropathy of the lower limbs with partial conduction blocks and prolonged distal CMAP duration in some nerves .
+The LITAF/SIMPLE (ENST00000339430) bidirectional sequencing of the proband’s sample (II.5, Fig. ) showed a G > C transversion in exon 4 at position 348 (c.348G > C/p.Trp116Cys, Fig. and Fig. ) present in the heterozygous state. This novel, missense variant of LITAF had not been previously reported elsewhere and was scored as pathogenic by Predict Protein Open (Effect of Protein Mutations) software and other predictive software programs (GERP, MetaSVM, PolyPhen 2 and MutationTaster). Furthermore, the mutation was scored as 'pathogenic' by the ACMG (American College of Medical Genetics) criteria (PS1 + PM2 + PM5 + PP1 + PP2 + PP3 + PP4) . No other plausible, causative candidate variants were found in the proband’s genetic material by WES (whole exome sequencing). WES results were verified by the amplicon deep sequencing (ADS) method. PCR amplicons (545 bp long) were generated using specific primers (forward: actggtgttccttccccttt, reverse: tcgtttgaacctgagcagtg). The amplicons were prepared for sequencing using a Nextera XT kit (Illumina) according to the manufacturer’s instructions. Libraries were paired-end (2 × 100 bp) sequenced on an Illumina HiSeq1500. The results were visualized on the Integrative Genomics Viewer and analysed for the presence of the particular variant in proband. The ADS verification resulted in obtaining coverage > 6000 × in all cases. The missense variant c.348G > C of LITAF was also identified in family members I.2 and III.7 which correlated with autosomal dominant pattern of inheritance . Genetic analysis did not confirm the missense variant in healthy family members (father I.1, proband´s brother II.2, other son III.6).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_206_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_206_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ee8a89c510b260c7ec664488ab07c2c33ab5be7a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_206_en.txt
@@ -0,0 +1,3 @@
+A 12-year-old boy presented with a complaint of swelling above his left upper lid from a few months prior to admission. He did not experience pain, diplopia, irritation, and itching. Past medical and ophthalmic history were unremarkable. Visual acuity was 20/20 in both eyes. Slit lamp and fundus exams were normal. There was fullness above the medial part of left upper lid and globe was displaced laterally [Figure 1a]. Ocular motility was intact.
+Magnetic resonance imaging revealed a heterogeneous ill-defined mass in the superomedial part of the mid-orbit, involving the medial rectus and superior oblique muscles. The approximate size of the lesion was 1.51.21.2 cm. Magnetic resonance imaging showed an indistinct orbital lesion. The lesion had low signal in T1-weighted and high signal in T2-weighted imaging. It showed severe enhancement after gadolinium injection [Figure 2]. Considering the patient's age, and the clinical and imaging characteristics, malignant orbital neoplasms including rhabdomyosarcoma was on the top of the list of possible diagnoses. The high signal part of the lesion in T2-weighted acquisition was considered as a probable associated necrotic area. We assumed the worst-case scenario and decided to perform an orbitotomy and excision of the lesion. Under general anesthesia, an upper eyelid crease incision was made, and tissue dissection exposed the mass between the superior oblique and superior rectus muscles [Figure 3a]. A meticulous dissection was done with special attention to keep the integrity of globe, extraocular muscles, and the lesion [Figures 3b & 3c]. The mass had tight adhesion to the surrounding structures and was finally excised in toto. Upon bisection of the mass on the operating table, the lesion showed as a multilayered wall, consisting of fibrotic bands, and a gelatinous center with a threadlike structure inside the core. There was putrid fluid and a thread-like object in the center of the lesion [Figure 3d], which were sent for histologic, parasitology, and microbiology laboratory work-up.
+Histopathologic examination showed the mass to be composed of granulomatous inflammation and the thread-like object to be D. repens [Figure 4]. On the first follow-up visit, there was no palpable mass, nor any motility or visual disturbance. No other systemic involvement was found in the systemic evaluations. Considering the resolution of signs and symptoms and after consulting with infectious diseases specialists, systemic anti-parasite medications were not administered. At this time, when inquired about contact with probable infected animals, the boy disclosed that he was taking care of a stray dog. On the last follow-up about six months after the operation, the patient had no complaints, normal orbital exams, extra-ocular movements, and there was no recurrence of the disease [Figure 1b].
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2078_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2078_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d407500c84e59aa4c6a71338fc042db60f095498
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2078_en.txt
@@ -0,0 +1,3 @@
+A 38-year-old male, not known to have any medical illnesses, presented to our ophthalmology clinic complaining of blurred vision in the left eye for five days. On past medical history, no history of taking any systemic medications or prior eye trauma or surgery were evident. On detailed ophthalmologic examination, best-corrected visual acuity (BCVA) in the right eye was 20/20 and in the left eye was 20/80, intraocular pressure was 15 mmHg in both eyes, normal color vision was evident in both eyes, there was no afferent pupillary defect (APD), the confrontation visual field was fully normal in both eyes, and there was full normal extra-ocular muscle function in both eyes. Anterior segment examination of both eyes revealed normal cornea, deep and quiet anterior chamber; the iris was round and regular, and the lens was clear. Dilated fundus examination of the right eye showed flat retina, normal macular reflex, healthy optic nerve head and the left eye showed blunt foveal reflex with neurosensory retinal detachment at the macula and subretinal fluid, leading to the impression of central serous chorioretinopathy (CSCR).
+Upon acquiring further history from the patient, he denied having features of type A personality or using steroids. However, he reported that blurred vision was preceded by using a special type of honey that he used to improve sexual function. On search back about that indigested honey, we found a recent announcement by the Saudi food and drug authority to stop using it because it was adulterated by tadalafil.
+Optical coherence tomography (OCT) of the left eye on presentation confirmed the diagnosis of CSCR . Four weeks after stopping taking the adulterated honey, BCVA in the left eye improved to 20/20 with a flat retina and no subretinal fluid. OCT was repeated, which confirmed the complete resolution of CSCR .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2083_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2083_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..985bade1baf29a539e04271c9b905dc199d70217
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2083_en.txt
@@ -0,0 +1,4 @@
+A 59-year-old woman of sober habits with a 10-year history of poorly controlled Type 2 diabetes, hypertension, and no history of ARF, prior myocarditis, or other known structural heart disease presented with acutely decompensated heart failure. She reported in the past 2 months symptoms of breathlessness, shortness of breath, declining effort tolerance, orthopnoea, bipedal oedema, and paroxysmal nocturnal dyspnoea. Her performance status declined from a NYHA functional Classes II–IV within 3 months.
+Physical examination revealed no fever, no arthritis, no chorea, no erythema magnatum nor subcutaneous nodules. Further examination showed a normal blood pressure of 140/60 mmHg with a wide pulse pressure, a heart rate of 98 bpm, a collapsing pulse, displaced apical impulse, and elevated jugular venous pressure. Cardiac auscultation showed a normal soft S1, a normal S2, and an S3 gallop. A 3/6 pansystolic murmur in the mitral area, loudest on expiration, was heard, in keeping with MR. She also had a 2/4 early diastolic murmur with arterial findings of severe AR and a widened pulse pressure. The 12-lead ECG showed abnormal QRS wave pattern, repolarization changes, and 1st degree atrioventricular (A-V) block (PR 330 ms) . On chest radiography, there was cardiomegaly, bilateral pleural effusions, upper lobe pulmonary venous diversion in keeping with heart failure, and prominent pulmonary arteries . Transthoracic echocardiography (TTE) with two-dimensional (2D) Doppler imaging showed mildly dilated LV size and normal LV function (LV dimension in diastole (d) 54 mm, and LVEF 60%). The echocardiographic assessment of the right ventricle (RV) and the pulmonary valve showed pulmonary hypertension with normal sized RV with normal RV function and normal pulmonary valve with mild tricuspid regurgitation (TR − TR Vmax 3.66 m/s, TR Pmax 54 mmHg, right atrial (RA) pressure 20 mmHg, RV systolic pressure 74 mmHg, RA area 19.7 cm2). Further, left atrial assessment showed a mildly dilated left atrium (43 mm). Preoperative TTE showed a tri-leaflet AV with calcified lesions on the non-coronary cusps (NCC), and severe AR. Transthoracic echocardiography of MV showed thickened leaflet tips with severe MR ( and ). Coronary angiography showed unobstructed epicardial coronary vessels and confirmed severe AR and MR. Laboratory examination showed elevated CRP 9 mg/dL, and normal white blood cells 7.62 × 109/L. Anti-DNAse B and anti-steptolysin O-titres were not performed. Blood cultures were performed but the bacterial growth had not occurred by the time the patient underwent valve replacement surgery. Microbiology tests for gram-negative bacteria were negative and polymerase chain reaction testing for common bacteria was also negative.
+The patient was diagnosed with valvular heart disease of probable rheumatic aetiology and with severe AR and MR complicated by heart failure. She was started on heart failure pharmacotherapy and referred for double valve replacement surgery. On-table, transoesophageal echocardiography was performed and showed a large vegetation on the anterior MV leaflet, and another on the NCC of the AV. In addition, Grade III diastolic dysfunction was noted, a large pleural effusion on the right was also seen. She underwent open-heart surgery and had AV and MV replacement, both with bioprosthetic tissue valves, based on patient’s preference. During the operation, it was evident that below the AV there was small root abscess and vegetation on the AV and MV, confirming chronic infective endocarditis. The patient was treated for culture-negative infective endocarditis. The patient was started on an antibiotic therapy (penicillin G 5 million Unit IV 6 hourly for 4 weeks, gentamycin 80 mg IV three times a day for 2 weeks, doxycycline 100 milligrams orally twice a day for 4 weeks), discharged home well, and has been doing well on follow-up visits. Her post-surgical course was uneventful.
+The histopathological assessment showed features of concomitant ARF in a background of chronic RHD. The MV showed evidence of a chronic RHD, with moderate-to-severe fibrosis of the valves, scattered stromal histiocytes, and foci of neovascularization with characteristic thick-walled vessels . The AV showed chronic RHD with stromal neovascularization, fibrosis, and chronic inflammation. Additionally, discrete foci of acute rheumatic valvulitis were evident, with Aschoff bodies containing Anitschkow cells and central fibrinoid necrosis .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2088_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2088_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..924c6bb6b7cc2de80d9b6d4677f936fe5f80131f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2088_en.txt
@@ -0,0 +1,4 @@
+A 21-year-old male was referred to our hospital due to worsening pain in his right shoulder. He denied any history of trauma or excessive load-bearing activities, and there was no family history of cancer. During the physical examination, we observed a deformity in his right shoulder, which appeared asymmetrical compared to the left side, and he experienced pain upon palpation of the distal third of the clavicle. Plain radiographs revealed an osteolytic lesion with cortical thinning in the distal third of the clavicle, while axial and sagittal views of the MRI showed tumor growth on the lateral third of the right clavicle with contrast enhancement (a-c). Before surgery, Multislice-Computed Tomography (MSCT) scans of the abdomen, and thorax, and a complete bone survey were conducted, revealing no additional masses in other regions. Based on the clinical and radiological results, we suspected a primary benign bone lesion with a Bone RADS score of 1, in accordance with the guidelines of the American College of Radiology. We planned for an open biopsy along with curettage and internal fixation of the clavicle which was performed three days later.
+During the surgery, we used the anterior clavicle approach to remove the tumor. We confirmed that there was no fracture. The tumor was sent for diagnosis and the cavity left was filled with bone graft and fixed with a 6-hole plate with a locking mechanism .
+Microscopic examination revealed bone tissue with diffuse tumor cells, of moderate size, with eosinophilic cytoplasm. Some cells exhibited oval nuclei, some eccentric, some showing grooves. Among them were numerous eosinophils and lymphocytes, as well as multinucleated osteoclastic giant cells. We proceeded with Immunohistochemistry staining, which yielded positive results for CD1a (+) and negative results for LCA (CD45) (−), CD30 (−), and CD138 (−). Therefore, based on these findings, a diagnosis of Langerhans cell histiocytosis was concluded .
+We brought our patient's findings along with our treatment result for clinicopathologic conference with multidisciplinary team, which all agreed on LCH to be the diagnosis. On his nine-month follow-up, no tumor-progressive changes were seen on examination nor complained by the patient . However, the callous formation has been minimal which concerned us for potentially impaired bone healing. The patient has then received radiotherapy and his latest MRI only showed no residual mass and excellent clavicle alignment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2107_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2107_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cb2ab0ef819ed191ee8f30590cace96b26034b5f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2107_en.txt
@@ -0,0 +1,5 @@
+Our patient was a 79-year-old retired African American woman with advanced angle-closure glaucoma in both eyes (OU). Her past medical history was significant for diabetes, hypertension, and gastroesophageal reflux disease. Past ocular history was significant for laser iridotomies OU, bilateral upper lid ptosis repair, cataract extraction with intraocular lenses OU, mini-shunt OS, selective laser trabeculoplasty (SLT) OS, bilateral lower lid punctal cautery, laser capsulotomies OU, and Baerveldt glaucoma tube implants OU. Her medications for diabetes included insulin glargine 100 U/mL injection every night at bedtime, humalog injection for blood glucose over 150 mg/dL, metformin 500 mg tablet twice daily, gabapentin 600 mg every night at bedtime, and Kenalog cream twice daily for diabetic neuropathy. Her medications for hypertension and cholesterol were lisinopril 40 mg tablet once daily, Lipitor 20 mg tablet every night at bedtime, and clonidine tablet twice daily. She was taking omeprazole for her acid reflux. She occasionally took aspirin 81 mg and Tylenol 325 mg tablets for her arthritis pain. Her social history was significant for one cigarette per day. She did not drink alcohol. She had worked as a machine operator but was currently retired.
+On routine follow-up examination, she was in good general health. There were no neurologic findings. VA in the right eye (OD) was 20/25 and OS 20/40. Her IOP values were 12 and 17 mmHg on latanoprostene bunod (Vyzulta) OU every night at bedtime. She was also taking Restasis OU twice a day for her dry eyes. Slit lamp examination revealed clear corneas, well-placed glaucoma tube implants OU in the anterior chambers, intraocular lenses, and enlarged optic nerve cupping of 0.9 OU, with normal vessels, maculae, and periphery. Her central corneal thickness (CCT) values were 562 microns (µm) and 557 µm. Visual field testing revealed worsening visual field defects OU (with an inferior arcuate defect OD and superior arcuate and inferior Bjerrum defects OS). Rhopressa was then added to OS every night at bedtime.
+After 5 days, the patient complained of blurry vision OS and slight pain over the past 2 days. Her VA was 20/20 OD and 20/200 OS. IOPs were 12 and 7 mmHg. Slit lamp examination revealed 2+ conjunctival injection OS and 2+ corneal edema with Descemet folds OS . Her anterior chamber was deep and quiet. Optic nerve cupping was 0.9 OU. Her fundus examination was otherwise normal. CCT values were 549 µm OD and thick at 808 µm OS . Rhopressa OS was discontinued. Sodium chloride drops and ointment OS were prescribed. Vyzulta OU every night at bedtime and Restasis OU twice a day were continued.
+The patient returned the following week with improved vision OS. She reported persistent mild blurred vision OS but had significant improvement in pain. Her VA was 20/20 OD and 20/40 OS. Her IOP values were 15 and 17 mmHg. CCT OS was significantly improved to 589 µm.
+Follow-up visits with our patient showed controlled IOP; however, she had mild increases in CCT. Over a 2-month period, the CCT values OS increased 30 µm. By month 3, her VA had worsened to 20/70, and her CCT increased to 633 µm. Topical loteprednol drops were prescribed OS every 2 hours. After 2 weeks, she improved significantly. The topical steroids were tapered. The patient had significant improvement and fortunately made a complete recovery by month 4 of discontinuation of Rhopressa .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2155_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2155_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..def27c9e155307e3005ded1fa91cae44e59136d0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2155_en.txt
@@ -0,0 +1,6 @@
+A 63-year-old man presented with hematuria and urinary obstruction symptoms. He came to the hospital four times each with presence of gross hematuria. Moreover, the patient suffered from frequency and nocturia at least for six months. Physical examination revealed enlargement of prostate, but there was no palpable nodule on the digital rectal examination. PSA was normal and there was also no evidence of hepatomegaly or splenomegaly.
+The first transurethral resection of the prostate (TURP) and biopsy was done for him, but pathologic results showed the evidence of BPH. After 28 days, the patient was admitted again due to gross hematuria. Rectal examination was normal. Pelvic CT-scan revealed a big clot in bladder without any lymphadenopathy. There was a significant heterogeneity in prostate. In second TURP, clot evacuation and biopsy were performed on more than 15 different areas of prostate. During the next 2 weeks, the patient underwent 3 other trans-urethral coagulation and clot evacuations due to hematuria.
+However, laboratory tests such as prothrombin time (PT) , partial thromboplastin time (PTT), clotting time (CT), bleeding time (BT) and platelet count were normal. After 15 days hematuria was stopped and was not repeated. Sections from prostate show foci of hemorrhage, and ).
+The first transfusion was 2 units of PC during the second surgery. The second transfusion was 2 units of PC and 2 FFP, two days later. The consecutive third and fourth transfusions were done two days later during which the patient received 3 units of FFP, and 3 units of whole blood.
+Immunohistochemistry studies demonstrate CD20-positive in 90% of lymphoid cells and in the lymphoepithelial lesions , CD5-positive in background lymphocytes, CD43-positive in 90% of lymphoid cells, CD3-positive in background lymphocytes, CK and PSA markers are negative in neoplastic cells. Further evaluation and examination such as bone marrow biopsy, abdominal and pelvic CT-scan did not show other involvement.
+In the last fallow up, around eight months after discharging, the patient was alive and asymptomatic. Moreover, there is no evidence of other organ involvement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2168_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2168_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..17be4d257505a4dc72f0195d07e5639bdde048c3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2168_en.txt
@@ -0,0 +1 @@
+In March 2017, a 56-year-old Caucasian male was admitted to San Giovanni di Dio and Ruggi D’Aragona University Hospital for mild abdominal pain and nausea. The patient’s past medical history included i) Hodgkin’s lymphoma of the spleen in 1987, treated with splenectomy and radiotherapy; ii) myocardial infarction in 2006, treated with coronary angioplasty; and iii) myocardial infarction in 2012, treated with multiple coronary artery bypass grafting. He was also a former-smoker. Patient did not present with any ICC risk factors including biliary lithiasis, alcoholic liver disease, chronic hepatitis B or C infections, or primary sclerosing cholangitis. His family history was negative for any inherited-familial cancers. Abdominal ultrasound and computed tomography (CT) scan revealed a 10 cm intrahepatic lesion in the left lobe of the liver, as well as stable right basal lung thickening . The latter was already described in a previous chest CT scan. Ultrasound guided biopsy of the liver mass demonstrated ICC (CK7+, CK19+, HepPar1-, AFP-). In April 2017, the patient underwent a left hepatectomy and sub-total gastrectomy and cholecystectomy. Histological examination demonstrated a Stage II ICC with vascular invasion [TNM staging, American Joint Committee on Cancer (AJCC) 8th edition]. Post operatively he was seen by the multidisciplinary team. Genomic analysis of NRAS, KRAS and BRAF V600 by polymerase chain reaction (PCR) sequencing, as well as immunohistochemical (IHC) staining for detection of HER2 amplification were performed on ICC tumor tissue. Both analyses did not show any type of alteration . Further genomic testing of EGFR was performed by sanger sequencing, but no alterations were found in exons 18, 19, 20, and 21 . In October 2017, a whole body CT scan demonstrated a 2.0 cm local recurrence in segment V of the liver . Patient received a percutaneous thermal ablation (PTA) of the lesion. In February 2018, a whole body CT scan demonstrated a new 3.6 cm local recurrence in segment V of the liver, close to the previously treated lesion for which patient received a new PTA. In May 2018, a whole body CT scan demonstrated a new local recurrence in segment V of liver and multiple lesions in segment VII and VIII . He then started a chemotherapeutic regimen with cisplatin (25 mg/m2) followed by gemcitabine (1,000 mg/m2), each administered on days 1 and 8 every 3 weeks. Due to his poor prognosis, patient requested additional testing of the ICC specimen. An IHC analysis of ROS1 rearrangements and NTRK fusions did not demonstrate any alterations . A Short Tandem Repeat (STR) analysis by PCR of BAT25, BAT26, D2S123, D5S346, D17S250, NR-21, and MONO-27 showed a Microsatellite Stable (MSS) tumor profile. Lastly an IHC analysis of MSH2, MSH6, PMS2, and MLH1 demonstrated no alterations of the mismatch repair system . Following six cycles of cisplatin and gemcitabine, in September 2018, a whole-body CT scan demonstrated a stable disease (according to RECIST criteria v 1.1). The patient received an additional PTA of the lesions in segments V, VII, and VIII of the liver. In February 2019, the CT scan demonstrated progression of disease (PD) (according to RECIST criteria v 1.1) due to the development of multiple small lesions localized at the hepatic dome and around the area of previous PTA, long with a large bone metastasis to the 12th vertebral body and a left upper lobe pulmonary nodule . Based on the availability of additional formalin fixed tumor tissue obtained from a novel tumor biopsy, three different NGS platform studies were requested by the patient: Oncomine Comprehensive Assay (implemented at Istituto Tumori Milano, Milan, Italy) , Oncofocus test [Oncologica® UK ltd (Cambridge, UK)] and Foundation One CDx [Foundation Medicine (Cambridge, MA)] . Both the Oncomine Comprehensive Assay and the Oncofocus test did not detect any alterations of analyzed genes. In contrast the Foundation One CDx demonstrated the presence of a deletion in BAP1 (splice site c.581-17_585del22) and amplification of RAD21. Analysis of BAP1 by sanger sequencing on primary ICC tumor tissue confirmed the presence of BAP1 (splice site 581-17_585del22) alteration . In contrast no alterations were identified in BAP1 from nucleic acids extracted from buffy coat . Because of the involvement of RAD21 in the DNA repair pathway, the interaction of BAP1 with BRCA1 and the enhanced sensitivity to PARP inhibitor administration in presence of alterations in the BRCA1-mediated DNA repair pathway, it was decided first to treat the patient with FOLFIRI every 2 weeks [irinotecan 180 mg/m2, folinic acid 400 mg/m2, 5-fluorouracil (5-FU) 400 mg/m2 intravenous infusion bolus, then 5-FU 2400 mg/m2 intravenous infusion over 46 h] and then to start a PARP inhibitor. FOLFIRI is a conventional second-line chemotherapy regimen for ICC. In addition, irinotecan is a DNA-damaging agent. Following six cycles of FOLFIRI, in June 2019, a whole-body CT scan demonstrated PD . A third-line therapy of off-label use with the PARP inhibitor olaparib at 800 mg/die and palliative radiotherapy (10 Gy) on the vertebral lesion was begun. In September 2019, a whole-body CT scan demonstrated a partial response (PR) . The latter was confirmed on successive restaging scans in November 2019 and February 2020 . Following 11 cycles of olaparib, the progression free survival has been 11.0 months. Currently, the patient has an overall survival of 37.2 months from the time of diagnosis of his ICC and has continued treatment with olaparib. He is in good health conditions and no treatment-related adverse events have been reported.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2169_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2169_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5e5132cdbc1e67667505e53092037230c6580495
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2169_en.txt
@@ -0,0 +1,5 @@
+A 33-year-old man presented with a five-month history of bilateral radiating pain through the hips, legs and ankles. Additionally, he reported numbness, paresthesia and mild weakness in one lateral lower extremity. A pin-prick sensation test showed bilateral patchy loss of sensation and vibration in the legs and feet. The patient did not report bowel or bladder problems. He did not exhibit hyper-reflexia and was negative for Babinski’s sign.
+Magnetic resonance imaging (MRI) revealed a lesion extending from L3 to L5. T1-weighted MRI of the lumbar spine revealed an intradural, extra-medullary, isointense mass behind the vertebral bodies of L3 to L5 that was eccentric to the left and showed homogenous enhancement with contrast. The vertebral body of L4 exhibited a compressed deformation . Extensive examination, including gastroscopy, colonoscopy and computed tomography scans of the abdomen and the thorax, identified no additional masses in the body.
+A lumbar laminectomy of L3 to L5 was performed. The tumor was soft with a rich blood supply and closely adhered to the medulla spinalis. There were no signs of dural invasion and it maintained a clear separating plane. A total tumor resection was performed.
+The patient recovered well from the operation. Lower extremity pain resolved immediately following surgery, and lower limb strength began to improve within a few days. The patient reported symptoms of postoperative dysuria, which could be attributed to intraoperative injury to the nerve roots. Dysurea symptoms showed improvement after one week. During the two-year postoperative follow-up examination the patient exhibited no clinical or MRI radiological signs of tumor recurrence or metastasis .
+Postoperative histopathology of the tumor confirmed a completely resected solid tumor. The specimen was a fully encapsulated smooth soft-tissue mass. Standard hematoxylin and eosin staining revealed sheet-like proliferation of NET cells in a trabecular pattern and no visible mitoses or necrosis. Additional immunohistochemical staining demonstrated that the tumor was positive for synaptophysin, chromogranin (CgA), cytokeratin and CD56, and negative for S-100 . The Ki-67 labeling index was 2%. These findings are consistent with the known cellular characteristics of a typical CT.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2208_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2208_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..767f682b60057abe3c9d93f4efe5e0e92113a757
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2208_en.txt
@@ -0,0 +1,5 @@
+In April 2015, a 23-year-old male was referred to our Faculty (Oral and Maxillofacial disease department of Mashhad university of Medical sciences). His chief complaint was an ulcer of the uvulae from three months ago, oropharyngeal dysphagia, pharyngitis, and mild fever with unintentional 20-pound weight loss over the course of 4 months. Also he was on a mechanical soft diet. Over the past four years, he had severe episodes of Pharyngitis without response to the usual administered drugs, as well as a history of severe dental infection involving the brain. He did not have any systemic disorders and no history of smoking, abusing drugs or drinking alcohol. He was a construction worker and often dealt with rock wool. Upon physical examination, two painful destructive ulcers were observed. One of them was about 2cm × 1 cm, extending from the soft palate to hard palate, exposing the underlying bone and another one was destructing the uvulae . The ulcers were covered with a thick fibrinoleukocyter membrane with erythematous borders. He had no history of such lesions. His oral hygiene was in good condition. Cervical lymph nodes were not appreciable. Disseminated hypopigmented maculopapular rash throughout the skin, from nine years ago, was also observed. Examination of vital signs revealed a blood pressure of 110/70 mm Hg, a heart rate of 80 beats per minute, and a body temperature of 100°F. The rest of his physical examination did not raise any concerns.
+The patient had been initially admitted to the Ear, Nose and Throat department two months ago. Due to suspicion of an infective condition (Trench mouth), some antibiotics such as Ceftriaxone, Metronidazole and Clindamycin were administered for about one month but without significant improvement.
+Because of the negative response to the drugs mentioned above the suspicion of an immunosuppressive condition was raised. Therefore, the patient was admitted to the allergy and immunology department. After consultation with an infectious disease specialist, the administered antibiotics were altered to Ceftazidime, Vancomycin, and Metronidazole. However, despite taking these remedies for about three weeks, no improvement was observed. Along with these treatments, some laboratory tests and paraclinical modalities had been requested below:
+The blood test only showed Neutrophilia (about 80% of the white blood cell count) and Lymphocytopenia. Erythrocyte sedimentation rate was high and C-reactive protein was positive. Serum chemistry parameters were in normal range. All of the virology, microbiology and parasitology tests; such as Anti-HIV, Tuberculin skin testing, etc.; were negative. He had a high Lactate dehydrogenase level of about 595 IU/L. Given the patient's fevers, history of recurrent upper respiratory tract infection with depigmented skin rashes, Infectious mononucleosis was a concern when white blood cell morphology was studied and viral type Lympho-Mono were seen. Also viral capsid antigen (VCA)-IgM and VCA-IgG were dramatically high in the patient’s serum. The results of nitro blue Tetrazolium test NBT and Dihydrorhodamine Flow cytometric Assay (DHR) and other immunological laboratory findings were in normal ranges, except for high IgE (2375 µ/dl) and a slightly low IgM (25 mg/dl). Consequently Immunodeficiency and autoimmune disease were not confirmed. Paraclinical modalities such as Abdominal, Inguinal and Neck ultrasonography, Chest X-ray, Posterior-Anterior Skull X-ray were requested and no abnormalities were observed, except for multiple reactive lymph nodes up to 12 millimeters in size at the anterior cervical lymph node chain, which were detected by ultrasonography. Computed tomography (CT) scan of the head and neck with contrast medium revealed nothing of note. In addition, biopsy from palatal ulcers with fungal culture revealed a non-specific ulcer with extensive necrosis and bacterial colonies, fibrin deposition and vasculitis. Dysplasia, malignancy any fungal elements were not evident.
+A biopsy of the palatal ulcers was repeated and the histopathological examination of the specimen showed very dense lymphocyte infiltration. In the background of the tissue, lymphoid cell with atypia, irregular and prominent nuclei were seen. The benign inflammatory cell infiltration with geographic necrosis in the background was evident . After consultation, the patient was referred to our Faculty and two clinical provisional diagnoses were made: The first one was a Lymphoproliferative disease such as Non-Hodgkin lymphoma and the second one was necrotizing stomatitis accompagnied by immunocompromised conditions and viral infections like EBV, cytomegaloviruses (CMV) and Herpes simplex viruses (HSV). Hence immunohistochemical analysis of paraffin blocks was requested. CD3 was expressed in some background lymphoid cells, CD56 was positive in some lymphoid cells, CD20 was positive in some background lymphocytes, and the Ki-67 marker was positive in 60% of background of Lymphoid cells. Terminal deoxynucleotidyl transferase (TdT) was negative and finally the diagnosis of ENKL was confirmed . Clinical staging of the lymphoma according to the Ann Arbor classification was determined as stage IE (4). The patient was referred to the oncologist and a CHOP regimen of chemotherapy was administered every three weeks. After the third cycle of CHOP therapy, the patient unfortunately died due to sepsis and infection (about 3 months after treatment).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2228_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2228_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..76b82e74bf9aff49b28aceb99a0ba4abf09620f5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2228_en.txt
@@ -0,0 +1,8 @@
+A 68 year-old male patient was referred to our surgical department from another hospital's medical department with a presenting clinical picture of sudden right upper quadrant abdominal pain, nausea and dark urine. With an initial diagnosis of obstructive jaundice possibly due to choledocholithiasis the patient was admitted to our department for further investigation. The patient's past medical history included upper gastrointestinal bleeding and chronic pulmonary obstructive disease.
+Tumor markers (CEA, CA19-9, a-FP) were normal, while a mild elevation of the cholestatic enzymes (ALP = 138 IU/L, γ-GT = 95 IU/L) were demonstrated with return to normal of bilirubin and transaminases.
+Abdominal ultrasound, computed tomography and magnetic resonance imaging demonstrated dilatation of the left intrahepatic bile ducts without the presence of any space-occupying lesion. Triplex ultrasonography of the liver confirmed the patency of portal and hepatic veins and of the hepatic artery.
+Endoscopic retrograde and magnetic resonance cholangio-pancreatographies showed anomalous dilatation of the left intrahepatic bile ducts with a concomitant milder dilatation of the pancreatic duct, as well as mucus discharge from the papilla of Vater during endoscopy.
+Colonoscopy was performed to rule out primary bowel neoplasm and revealed the presence of large bowel polyps. Snare polypectomies were performed and the histological analysis demonstrated the presence of tubulous and tubulovillous adenomas of the colon with mild to moderate degree of epithelial dysplasia.
+Total bone scan with Tc99 m MDP, thoracic computed tomography and brain magnetic resonance imaging were negative for secondary deposits.
+With a diagnosis of a cholangiocarcinoma a left hepatectomy with inflow occlusion (Pringle's maneuver) and selective hepatic vascular exclusion and cholecystectomy were carried out. The histology report describes the presence of foci of papillary adenomas with a fibrovascular core connecting each of them with the ductal wall, the cuboidal or columnar cells lining the bile duct epithelium and the presence of excessive intraductal mucus, as well as foci of a moderately to poorly differentiated carcinoma, with sporadic necrotic areas and invasion of the fibrously thickened intrahepatic bile ducts .
+The postoperative course was uneventful and the patient was discharged on the 9th postoperative day. Despite an uncomplicated 2 year follow-up period, the patient rapidly deteriorated and died from multiple pulmonary metastatic deposits.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2232_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2232_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cebf3cbe01fa20636c0628e5597258109b464581
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2232_en.txt
@@ -0,0 +1,4 @@
+A 47-year-old man, with a 9-year history of UC was referred to Huai’an First People's Hospital, Nanjing Medical University in March 2017. It was not the first time for him to our hospital for medical help. During the past 9 years, he had received 5-ASA including sulfasalazine and mesalazine and irregular oral steroid therapy. However, administration of 5-ASA led to red itchy rash on his face and torso, although the rash disappeared after 5-ASA was stopped. But it appeared again if 5-ASA was re-used, suggesting that he was allergic to 5-ASA. Owing to reluctant use of immunosuppressive agents and tumor necrosis factor inhibitors, he routinely received intravenous steroid therapy every 2 to 3months because of worsening condition. On March 25th, he was hospitalized again because of suffering from gradually aggravated abdominal pain and frequent bloody diarrhea with an average of 8 times daily. Colonoscopy showed that a continuous distribution of superficial erosion and ulceration . As previous, we gave him intravenous steroid therapy (methyl-prednisolone, 60 mg daily). Unlike before, his symptoms did not improve after 3-day use of steroid. The following treatment was limited. Considering all that, after informed consent, FMT was performed after stopping steroid treatment.
+The fecal microbes for FMT were obtained from a healthy 13-year-old boy according to the selection criteria described in our previous report.[ Fecal microbes were purified in our laboratory according to Filtration Plus Centrifugation method.[ The donor stool (about 200 g) was dissolved in 1000 mL of sterile saline, then the suspension was poured into several filters with different apertures to remove the scum. The filtered liquid was separated into several 50-mL tubes for centrifugation (2000 rpm/min, 3 minutes), and then we removed the supernatant, added sterile saline, and mixed for centrifugation again. This process was repeated 3 times. Finally, the sediment was obtained and diluted with 200-mL sterile saline. The whole processing time was about 1 hour. Thus, fresh fecal microbes’ suspension was prepared and immediately transplanted into the terminal ileum and the right colon by colonoscopy. The endoscopic image during fecal microbes’ infusion is shown in Figure B.
+After FMT, food intake was limited to 500 g semi-liquid in the first 24 hours and then normal diet was followed. One week after FMT, the patient was assessed by gastrointestinal symptoms. We found that the frequency and severity of abdominal pain significantly reduced. The stool frequency decreased to 2 to 3 times daily and the bloody stool was also significantly improved. At one month after FMT; reviewed colonoscopy revealed significant improvement in colonic mucosal lesions . During the colonoscopy, the patient received the second FMT as planned using the same donor . Three months after the second FMT, the patient had no diarrhea and any blood in stool. He underwent colonoscopy again and the damaged colon mucosa had reached full healing . During the 9-month follow-up, his condition did not recur without any treatment. No adverse event was observed during the FMT and follow-up.
+To evaluate the disease activity and efficacy of FMT, Mayo scores were calculated before and after FMT. The score that ranges from 0 to 12 point was based on the total of stool frequency, rectal bleeding, endoscopic findings, and a physician's global assessment. The total Mayo score and sub-item score were listed in Table . As shown, clinical and endoscopic remission was induced and maintained by FMT. The clinical response of this patient to FMT was considered effective.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2233_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2233_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..20e3b53cfa03728e222f58ddddd47bdc17e9cc96
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2233_en.txt
@@ -0,0 +1,2 @@
+A 75-year-old Japanese man was admitted to our hospital with a gradually growing cutaneous polypoid mass that had appeared on the skin of the left scrotum approximately one year before. The tumor measured 13mm in diameter with relatively well-defined whitish-yellow outlines . Histological examination of an excisional biopsy revealed epidermal papillary proliferation with parakeratosis, hyperkeratosis, and neutrophil infiltration . Although mitotic figures were noted in the basal layer , cellular atypia was not prominent. Besides abundant plasma cells in the upper dermis, numerous foamy macrophages infiltrated the dermal papillae, forming a characteristic clear zone beneath the basement membrane . Histopathologically, the tumor was diagnosed as a benign cutaneous verruciform xanthoma with negative lateral and deep surgical margins.
+To determine which cells release chemoattractants for macrophages, formalin-fixed and paraffin-embedded sections were stained for cytokeratin (AE1/AE3, M3515; Dako, Carpinteria, CA, USA; 1:200), CD68 (M0876; Dako; 1:100) and MCP-1 (DA103; BD Biosciences, San Diego, CA, USA; 1:40, 1:200, 1:800). After microwave heat-induced epitope retrieval, endogenous peroxidase activity was blocked with hydrogen peroxide (H2O2) in methanol. Indirect immunohistochemistry with the use of horseradish peroxidase conjugated anti-mouse rabbit antibody revealed that cytokeratin AE1/AE3 was strongly positive in differentiating epidermal keratinocytes, and weakly positive in keratinocytes in the basal and parabasal layers . However, strong CD68 staining was observed almost exclusively in foamy cells infiltrating beneath the basal cells . The parts densely stained for MCP-1 were observed in the differentiating cytokeratin AE1/AE3-positive keratinocytes. Clusters of the infiltrating macrophages also stained positive for MCP-1 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2248_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2248_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e7e6bcf8e661834fa386d8d5955ab2e4d836ec38
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2248_en.txt
@@ -0,0 +1,7 @@
+On January 8, 2019, a 28-year-old primigravid woman at 27th wk of gestation was admitted to our hospital with edema of both lower limbs for 4 d, elevated blood pressure (150/98 mmHg) and proteinuria (4+) for 1 d.
+Examination results on the tenth week of gestation showed blood pressure of 110/60 mmHg, negative urine protein and a platelet count of 234 × 109/L. Antenatal checkup was conducted regularly and showed normal outcomes except for edema in both limbs, hypertension and proteinuria before admission.
+There was no history of past illness.
+She was married without the history of pregnancy or contraception. Her spouse was healthy and her family history was unremarkable.
+Physical examination revealed that her blood pressure was 141/90 mmHg, temperature was 36.5 °C, pulse rate was 92 bpm and respiratory rate was 18 breaths/min. The uterine height was 24 cm and abdominal circumference was 96 cm. Fetal weight was estimated to be 800 g.
+On the 1st day of admission, routine blood examination showed a white blood cell count of 8.43 × 109/L, red blood cell count of 3.37 × 1012/L and platelet count of 86 × 109/L. An examination of blood coagulation function showed a D-dimer level of 1309 ng/mL (fibrinogen equivalent units). Liver and renal function examinations showed decreased albumin (33 g/L) and increased lactate dehydrogenase (345 U/L), urea nitrogen (9.1 mmol/L) and uric acid (539 μmol/L) with normal levels of alanine transaminase (17 U/L) and aspartate aminotransferase (32 U/L).
+Color Doppler ultrasound examination at admission showed a second trimester pregnancy equivalent to 26 wk of gestation as well as normal fetal movement and a fetal heart rate of 160 bpm. The fetal head was located at the uterine fundus. The placenta of Grade I was in the anterior uterine wall. The fetal weight was estimated as 790 g and conditions of the fetus growth were as following: biparietal diameter: 6.6 cm; femur length: 4.6cm; humeral length: 4.5 cm; head circumference: 24.8 cm; and abdominal circumference: 20.1 cm. Systolic/diastolic ratio of the umbilical artery and the fetal middle cerebral artery was 3.10 and 3.30, respectively. The amniotic fluid index was 12.9 cm.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2251_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2251_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c15c30edcfa73b058d540098a9cb6f6c0aee8e7d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2251_en.txt
@@ -0,0 +1,5 @@
+Here, we present a 29-year-old lady who presented to our hospital with a history of two months of progressive, painless abdominal distension and progressively increasing yellowish discoloration of the eyes. She also had generalized weakness and weight loss of 4.5 kg in the same duration. She denied changes to appetite or bowel habits, melena, hematemesis, and altered sensorium. She had no personal or family history of chronic liver disease, no history of alcohol, or use of any drug or alternative medicine. Besides jaundice, there were no peripheral stigmata of chronic liver disease. Abdominal examination revealed a grossly distended abdomen with fluid thrill consistent with ascites. Similarly, examination of breast revealed a hard, non-tender irregular mobile mass measuring 3cm × 4 cm on the left upper quadrant of the left breast and another hard, non-tender, immobile irregular mass measuring 3cm × 2cm in the lower quadrant of the right breast.
+Liver function tests were deranged with impaired synthetic function. Viral screening and autoantibody tests were negative. Serum Ceruloplasmin level was normal. She had normal alpha-fetoprotein but elevated cancer antigen 125 and carcinoembryonic antigen. Laboratory findings are listed in . Ascitic fluid analysis showed high SAAG (1.7g/dl) and low protein (1.2 g/dl) ascites. Three samples of ascitic fluid for malignant cytology were negative. UGI Endoscopy showed Grade 2 oesophageal varices without any red colour signs and mild portal hypertensive gastropathy.
+Abdominal ultrasound showed hepatomegaly with coarse echotexture and a few well-defined hyperechoic nodules with surrounding hypoechoic rim, ascites, and a patent portal vein without splenomegaly. The chest X-ray was normal. Breast ultrasound showed spiculated, hypoechoic lesion (2.5 × 2.2 × 1.8 cm) in the right breast suspicious of malignancy and multiple well-defined hypoechoic oval lesions in bilateral breasts. Tru-cut biopsy from the right breast showed nests, cords, and a few tubules of tumor-infiltrating the fibro adipose tissue, which was suggestive of infiltrating duct carcinoma (Nottingham Histological score 8, Grade 3), while a tru-cut biopsy from the left breast was suggestive of a fibroepithelial tumor.
+Triple phase CECT showed the enlarged and irregular outline of the liver with multiple variable-sized hypodense lesions with slight enhancement in the arterial phase and washout in the delayed phase with the dilated portal vein (13.4mm) and gross ascites but no splenomegaly (, , ).
+However, the patient died after three weeks of presentation to the hospital before any therapeutic measures were initiated concerning the liver metastasis, with the primary being breast carcinoma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2254_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2254_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1dc3adb1e8022027f514a5973fe89b41707c4b52
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2254_en.txt
@@ -0,0 +1,3 @@
+A previously healthy 56-year-old man developed gradual left- side hemiparesis, more accentuated in the lower limb (July 2016). A brain computerized tomography (CT)-scan and complementary magnetic resonance imaging (MRI) showed a solitary metastatic lesion (Met 1) in the right central sulcus (11.95 cc) with extensive perilesional edema [ and ]. The investigative tumor screening, including a CT- scan of the thorax and abdomen, revealed a suspect primary tumor in the left kidney as well as multiple, disseminated metastatic lesions in the lungs, liver, peri-aortic abdominal nodes, and left adrenal gland. A thrombotic mass positioned within the boundaries of the left renal vein was also reported. The subsequent biopsy revealed a clear cell renal cancer, Fuhrman Grade 2, as the primary. Due to the underlying extension of metastatic activity, nephrectomy was not indicated. Because of his relatively young age and previous healthy condition, the patient was accepted for upfront RRR- treatment of Met 1, structured on three separate fractions (GKRS 1–3) over a 7-day period [ and ]. This strategy aimed to sustain the patient’s performance status by avoiding further neurological deterioration while providing a window to start first-line targeted therapy (sunitinib). The rationale behind RRR can be found elsewhere in the literature.[-,]
+Follow-up MRI at 1, 3, and 6 months confirmed subsequent tumor volume reduction of Met 1 with ensuing significant improvement of the patient’s motor function . Notably, a discrete, nonsymptomatic adverse radiation effect (ARE) around Met 1 was reported at 3 months, however, this subsequently resolved at 6 and 10 months. Despite the positive evolution of Met 1, the corresponding follow-up MRI at 10 months demonstrated a new, large metastatic lesion (17.3 cc) with extensive perilesional edema within the confinements of the left frontotemporal region, threatening the area of Broca and the insular region (Met 2). A parasagittal micrometastasis in the posterior boundaries of the left temporal lobe was also reported (Met 3). Despite further thoracic disease progression on anti-PD1 treatment (nivolumab), the patient’s clinical condition remained stable (Karnofsky Performance Scale [KPS] 90, recursive partitioning analysis [RPA] Class II); it was, therefore, decided to treat Met 2 with RRR and Met 3 with SF-GKRS [ and ] before switching systemic treatment to axitinib.
+Met 2 decreased in volume by 15% between GKRS 1 and GKRS 3. Follow-up MRI at 14 months after RRR-treatment of Met 1 (=2 months after RRR-treatment of Met 2) showed further tumor volume reduction of Met 2 while Met 1 and Met 3 remained unchanged [-]. However, edema increment around Met 2 was also reported, suggesting an additional focal (yet asymptomatic) ARE. Due to further radiological evidence of extracranial disease progression (CT-scan thorax and abdomen, October 2017), low- tolerance to axitinib and the patient’s own choice, further systemic therapy was altogether disrupted 14 months post- RRR of Met 1. Last follow-up MRI (20 months after RRR of Met 1) showed almost complete ablation of all GKRS-treated lesions and a reduction in perifocal edema surrounding Met 2, without major corticosteroid intervention [- and -]. Despite remaining free from motor-sensory deficits, epileptic seizures (Engel score of 1) or cognitive impairment, the patient promptly deteriorated at this stage due to extracranial disease progression (KPS 50, RPA 3). The patient succumbed to his disease 21 months post-RRR-treatment of Met 1.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2256_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2256_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..878d788947818fedcd79962781d5e68089d2a13e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2256_en.txt
@@ -0,0 +1,2 @@
+An 85-year-old male, who had been able to walk with a wheeled walker and had no definitive cognitive problem, was admitted to our hospital because of mild disturbance of consciousness and right hemiparesis. He had no history of head trauma but had been taking oral antiplatelet agent for previous ischemic heart disease. Computed tomography (CT) revealed left CSDH with moderate rightward midline shift [, left]. Emergency irrigation and drainage through a left frontal burr hole was performed under local anesthesia. Thick outer membrane was observed during the operation. After removal of the hematoma with irrigation [, right], a drainage tube was placed posteriorly. His symptoms disappeared immediately and he was discharged after 12 days. He visited our hospital again because of headache and mild right hemiparesis 8 days after the discharge. CT revealed recurrence of the CSDH [, left]. Second irrigation and drainage was performed similar to the first operation. His symptoms improved, however, he was transferred to a rehabilitation hospital because of general muscle weakness 37 days after the surgery. The oral antiplatelet medication was stopped after the second surgery. Fifteen days after the transfer, he was admitted to our hospital again because of right hemiparesis. CT showed recurrent CSDH [, right], and hence we considered applying middle meningeal artery (MMA) embolization to him. However, because his previous imaging studies revealed severe arteriosclerosis, we abandoned the procedure. Instead, we performed third irrigation and drainage through the same burr hole. The hematoma cavity was irrigated with artificial cerebrospinal fluid (CSF). The right hemiparesis disappeared after the surgery. The patient was admitted to observe any recurrence of CSDH as well as for rehabilitation. Twenty-seven days after the third surgery, he suffered gait disturbance, and CT revealed recurrent CSDH [ left]. Fourth irrigation and drainage through another burr hole on the left parietal convexity was performed. The drain was placed anteriorly to reduce postoperative air collection [, right]. Unfortunately, the CSDH recurred with mild right hemiparesis after 9 days [, left].
+Fifth surgery was supplemented by a simple noninvasive treatment, fibrin glue injection into the hematoma cavity through the drainage tube. Fifth irrigation and drainage through the former parietal burr hole was performed, the hematoma was removed and the cavity thoroughly irrigated, and then a drainage tube was placed anteriorly toward the frontal tip, minimizing the hematoma cavity. On the following day, CT confirmed the collapsed hematoma cavity with minimum air collection [, right]. After obtaining informed consent, fibrin glue was injected through the drainage tube. The patient was placed in the left lateral position so that the affected side was lower. First, 12 ml of the residual hematoma was carefully evacuated through the drainage tube. Then, 5 ml of solution A of fibrin glue (Beriplast® P Combi-Set, Aventis Behring GmbH) was injected through the drainage tube and flushed with a few ml of saline, and subsequently 5 ml of solution B was injected. Finally, the drainage tube was slowly pulled away during flushing with a few ml of saline . No harmful event occurred during and after the procedure. CSDH did not recur after the procedure and the patient was discharged. No further recurrence was confirmed in 6 months after the treatment , and the patient has been free from symptoms for over 2 years.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2258_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2258_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..42dbcff3c18ff9b8922196ff10c07af6ca09c62c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2258_en.txt
@@ -0,0 +1,50 @@
+We present the case of an 81-year-old male who presented from a skilled nursing
+facility with persistent fevers, confusion, and sepsis, secondary to a suspected
+urinary tract infection that failed to respond to outpatient levofloxacin. His past
+medical history included hypertension, cerebral hemorrhage, atrioventricular block,
+and benign prostatic hyperplasia. Pertinent vital signs and laboratories include
+heart rate of 94 beats per minute, respiratory rate of 23 breaths per minute, white
+blood cell (WBC) of 15.2 K/mcL, temperature of 100.7°F, and blood pressure of
+128/70 mmHg. Medications on admission included tamsulosin, clonidine, and
+levofloxacin. He reported an allergy to sulfonamides. Blood and urine cultures were
+collected, levofloxacin was discontinued, and ceftriaxone 1 g intravenously (IV)
+every 24 h was subsequently initiated. A Foley catheter was in place but changed
+upon admission. An initial chest X-ray revealed no acute process.
+On day 2 of admission, both blood and urine cultures were positive for S.
+aureus, mecA positive by polymerase chain reaction. Susceptibilities
+were performed by VITEK2 which demonstrated a vancomycin MIC ⩽ 0.5 mg/L and a
+daptomycin MIC = 0.25 mg/L (see ). Ceftriaxone was discontinued, and vancomycin was initiated at
+15 mg/kg IV every 12 h. On day 3, a transthoracic echocardiogram (TTE) of adequate
+diagnostic quality found no evidence of endocarditis. Transesophageal echocardiogram
+was attempted on day 7 but was aborted due to complications. A repeat TTE was
+considered but not performed as it was unlikely to change the course of therapy.
+Vancomycin troughs were monitored twice weekly and maintained greater than 10 mg/L
+(range 10.2–12.2 mg/L). Subsequent blood cultures drawn on days 3, 5, and 15
+remained positive. On day 17, a magnetic resonance imaging was performed to evaluate
+the lumbar spine, demonstrating no evidence of osteomyelitis, discitis, or abscess.
+On day 18, therapy was changed to daptomycin 6 mg/kg IV every 24 h. Creatinine
+phosphokinase was monitored weekly and remained within normal limits. Blood cultures
+on days 19 and 23 remained positive. On day 25, daptomycin was increased to 8 mg/kg
+IV every 24 h, and gentamicin 1 mg/kg IV every 8 h was added. Gentamicin levels were
+monitored to maintain peaks above 3 mg/L and troughs below 1 mg/L. In addition, a
+whole body indium-111 tagged WBC scan was performed and did not reveal any evidence
+metastatic infection.
+Blood cultures were repeated on day 28 which subsequently turned positive on day 29.
+Hospice care was discussed with the patient and family due to his continued fevers,
+increasing confusion, declining clinical status, and overall poor prognosis. The
+family requested to continue care for an additional week. The infectious diseases
+service switched to the salvage regimen of vancomycin 15 mg/kg IV every 12 h plus
+nafcillin 2 g IV every 4 h. Vancomycin troughs ranged from 10.7 to 12.3 mg/L,
+similar to the previous course. Blood cultures drawn on day 32, 3 days after
+starting vancomycin and nafcillin, were negative. A peripherally inserted central
+venous catheter was placed on day 16 which was removed with the tip sent for culture
+on day 33 which showed no evidence of growth. Local wound care had been continuously
+provided for an unstageable decubitus ulcer. A bedside debridement procedure was
+also performed on day 34, 2 days after the negative blood cultures. After 11 days,
+nafcillin was changed to piperacillin–tazobactam 3.375 g IV every 6 h, based on a
+culture of Pseudomonas aeruginosa growing from an infected
+decubitus ulcer. The patient continued to improve and was discharged on day 44 to a
+skilled nursing facility to continue vancomycin and piperacillin–tazobactam to
+complete 42 days of therapy following the negative blood culture, which was 71 days
+after the initial presentation. Renal function was monitored throughout therapy
+without any significant changes.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2280_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2280_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0eeffb0936cd9e6701c391eaf373c37ba686dc5d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2280_en.txt
@@ -0,0 +1,2 @@
+A previously healthy 7-year-old Caucasian girl was admitted to our hospital with a history of abdominal pain, labial swelling and a large ecchymosis extending from the left subcostal area to the left lower quadrant. Two weeks before being admitted to the hospital, she experienced symptoms of an upper respiratory infection followed by joint discomfort, peripheral edema and a palpable, purpuric rash. She presented to a smaller community hospital, where the additional findings of hypertension and a Group A beta-hemolytic streptococcus-positive throat swab were discovered by a consulting pediatrician. She was diagnosed with Henoch-Schönlein purpura (HSP) and treated with two weeks of Penicillin V for her tonsillitis. Her symptoms improved, but over the course of the next six days, she developed increasing abdominal pain and "distention". She also experienced significant pain in her genital area with associated labial swelling. She was transferred to our institution, a tertiary care Pediatric Center, for further evaluation. There was no history of abdominal trauma.
+On admission, she was found to be hypertensive, with a blood pressure just above the 90th percentile for age and height. She had an exudative plaque on the left tonsil, but a throat swab was negative. Her abdomen revealed a large ecchymosis, 10 cm in diameter over the left quadrant, with significant edema/swelling extending from the left flank to the labia majora . The abdomen was diffusely tender to palpation, and a faint raised papular rash was noted on her lower abdomen, buttocks and lower extremities. A complete blood count revealed a leukocytosis with a left shift and a normal platelet count. Urine analysis was positive for blood (microscopic) and an abdominal ultrasound was "normal" but incomplete. The ultrasound was performed to rule out intussusception, but had to be abandoned due to the extreme abdominal wall tenderness. A computed tomography (CT) scan of the abdomen was then performed, and this revealed markedly increased attenuation within the subcutaneous tissues of the left side of the abdominal wall and flank, extending to the groin and labia majora, consistent with hemorrhage or edema . No intra-abdominal pathology was seen. Our patient was treated with 2 mg/kg/day of intravenous methylprednisolone for 48 hours, and then switched to 2 mg/kg/day of oral prednisone for seven days. Within 36 hours of initiation of treatment, her abdominal pain and distention improved significantly and her hematuria resolved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2287_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2287_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bee929dd96c8a5a131544e0d50c8d4a7a6cdb575
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2287_en.txt
@@ -0,0 +1,4 @@
+A 69-year-old man visited our hospital with a complaint of acute onset abdominal pain 3 years previously. Laboratory investigation revealed that his serum amylase level was high, and computed tomography (CT) revealed fluid collection around the pancreas and a pseudocyst . He was diagnosed with acute pancreatitis without gallstones. He had no history of diabetes or any other medical conditions. The smoking history was 20 cigarettes/day for about 50 years, and the drinking history was about 500 ml of beer about 2 times a week. Magnetic resonance cholangiopancreatography (MRCP) revealed a pseudocyst without an intraductal papillary mucinous neoplasm (IPMN) . The patient was discharged, and CT recorded 1 year after discharge revealed shrinkage of the pseudocyst with slightly dilated distal pancreas duct . He developed acute pancreatitis 1 year previously. Subsequently, acute pancreatitis recurred three times. Endoscopic retrograde cholangiopancreatography (ERCP) revealed no stenosis or dilatation of the pancreatic duct at that time , and repeated pancreatic juice cytology showed no evidence of malignancy. Endoscopic ultrasound (EUS) was performed; however, no mass lesion was found in the distal pancreatic parenchyma. Acute pancreatitis recurred again this year, and CT revealed fluid retention around the tail of the pancreas and the splenic hilum, and a pseudoaneurysm of the splenic artery . Therefore, abdominal angiography and transcatheter arterial embolization was performed .
+The possibility of pancreatic cancer could not be completely ruled out for causing repeated episodes of distally localized pancreatitis, and to treat secondary splenic artery aneurysm; therefore, surgical resection was planned after full-informed consent .
+The tumor markers 2 months prior to surgery were within the normal range as follow; carcinoembryonic antigen 4.5 ng/mL, carbohydrate antigen 19–97 U/mL, and Duke pancreatic monoclonal antigen type 2 25 U/mL. Laparoscopy-assisted distal pancreatectomy was performed, with an operation time of 293 min, and a blood loss of 200 mL . The pancreas was resected on the left side of the portal vein. Preoperative examination revealed no findings suspicious of malignancy and considering the severe inflammatory changes due to repeated pancreatitis, D1 lymph node dissection was performed without rapid intraoperative pathology of pancreatic stump. A single tufted cyst 25 mm in size was found in the tail of the pancreas and a coil embolus was found in the dilated splenic artery; a part of the blood vessel wall was ruptured, and the coil embolus was exposed in the cyst . Pathological examination revealed a non-invasive cancer component in the specimen, i.e., carcinoma in situ . No lymph node metastasis was detected, and PanIN with carcinoma in situ was finally diagnosed.
+The patient recovered satisfactorily and was discharged on postoperative day 10. The pancreatitis did not recur after surgery and there was no recurrence of pancreatic cancer; the patient still has regular follow-ups at our hospital.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2317_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2317_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f3ea8790a541c40565df4227e38e158e0b562b1f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2317_en.txt
@@ -0,0 +1 @@
+A 52-year-old male, with a history of heart transplantation, presented to the emergency department (ED) with the abrupt onset of upper and lower lip edema, without concurrent respiratory symptoms. The patient had no known allergies to medications or foods and had been on a long-term daily regimen of lisinopril 5 mg. Sirolimus 1 mg daily was introduced 20 days prior as part of a renal-sparing immunosuppressive protocol. Upon ED admission, the patient’s vital signs were stable with a blood pressure of 139/83 mmHg, a pulse rate of 88 beats/min, a respiratory rate of 20, and a pulse oximetry reading of 98%. The patient exhibited no signs of difficulty swallowing. Clinical examination revealed significant edema affecting both the upper and lower lips . A prompt diagnosis of angioedema was established, and treatment was initiated with intravenous methylprednisolone (125 mg), famotidine (20 mg), and diphenhydramine (50 mg). Subsequently, both lisinopril and sirolimus were discontinued. The patient’s ability to tolerate a clear liquid diet improved, and he was successfully transitioned to a soft diet. He was subsequently discharged with a prescription for oral antihistamines, demonstrating sustained improvement in the following days .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2336_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2336_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1b9186167c59e78bb024c0b5741f49bb1436d557
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2336_en.txt
@@ -0,0 +1,7 @@
+A 63-year old female was admitted to the neurology department with a chief complaint of progressive forward and leftward flexion of the spine that was exacerbated during walking but lessened on recumbent position. Two years earlier, she had been diagnosed with a mild degree of lumbar spinal stenosis at L3–4 and L4–5 levels by an orthopedic specialist. Even though she still experienced intermittent radiating pain from the left hip down to her left leg, she was still able to do mountain climbing and carry out her usual activities of living. One month prior to her admission to the neurology department, she started to notice progressive forward and leftward flexion of the back and new-onset lower back pain. She went back to the orthopedic specialist for medical advice. Non-contrast-enhanced magnetic resonance imaging (MRI) of the lumbar spine revealed alterations of muscle signal intensity in the right paraspinal muscles at the L1–2 level on T2-weighted imaging (T2WI) , but no significant interval change of the known spinal canal stenosis. A facet joint injection of triamcinolone at right L4–5 level didn’t relieve her pain and it didn’t halt the progression of the spinal deformity. She was referred to the movement disorder clinic.
+Upon examination, the patient did not have weakness, dysarthria or decreased sensation despite her history of infarction twenty years earlier in the territory of right middle cerebral artery (MCA) involving the right pre-rolandic area, corona radiata, and postcentral gyrus . Muscle tone and deep tendon reflexes of the left extremities were unremarkable. Her sensation to proprioception was intact in all four extremities. She had action tremors of both hands, moderate bradykinesia and rigidity on her left side, and postural instability during turning. Her gait was not wide-based and she had no difficulty performing finger-to-nose and heel-to-shin. With definite evidence of parkinsonism, we gave her a trial of levodopa/carbidopa. Initially, levodopa equivalent daily dose (LEDD) of 150 mg per day was prescribed. Over a week, it was gradually increased to 600 mg per day. Even though the medication improved her gait by increasing step length without causing serious side effects, the forward flexion of the spine only became more apparent . Serum creatine kinase (CK) was not checked at the time.
+She continued to experience severe back pain in the following months, besides which she developed erythematous pitting edema of and multiple bullae on both legs. She was subsequently admitted to the rheumatology. Her thyroid function was normal. CK was within normal limits. A repeat MRI scan of the spine, compared to the initial scan taken three months ago, showed diffuse enlargement and patchy enhancement of the paraspinal muscles on T1-weighted imaging (T1WI) from T4 through sacrum bilaterally . Electromyography (EMG) demonstrated a mild to moderate amount of ongoing denervation potentials in the thoracic and lumbosacral paraspinal muscles but no evidence of myopathic motor unit action potentials in either the paraspinal muscles or the lower extremity muscles – the left tibialis anterior, peroneus longus, and gastrocnemius. Atorvastatin, which she had been taking since five years ago, was discontinued as the possibility of drug-induced myopathy could not be ruled out. At discharge, she was on opioids for unremitting lower back pain.
+A year later she was re-admitted to the neurology department for evaluation of focal atrophy of the back muscles on the right. The pain had subsided considerably for a year now. MRI of the lumbar spine again confirmed the presence of non-specific myopathic changes of thoracolumbar paraspinal muscles. Patchy contrast enhancement along myotendinous or myofascial junction on T1WI and diffuse enlargement of thoracolumbar paraspinal muscles were still seen. But the extent of contrast enhancement and that of muscle enlargement were less compared to the MRI taken one year ago. She finally underwent an ultrasound-guided gun biopsy of the paraspinal muscles.
+The biopsy specimen contained myofibers with moderate size variation. Degenerated, atrophic and regenerating fibers were abundant and mostly round in shape. Atrophic myofibers were not angular in shape. The increase in the number of internalized nuclei was seen in many myofibers. There was marked endomysial and perimysial fibrosis of the biopsied muscles but merely mild infiltration of inflammatory cells in endomysial and perivascular space . Overall, myopathic changes were evident, but the pathologist was unable to find clues with respect to the cause of fibrosis.
+Two years after the onset of camptocormia, as her clinical course was not consistent with idiopathic PD with camptocormia being the presenting symptom, fluorine-18 labeled N-3-fluoropropyl-2β-carboxymethoxy-3β-(4-iodophenyl)-nortropane (FP-CIT) positron emission tomography (PET) was done to confirm degenerative parkinsonism in this patient. The PET imaging revealed severely decreased radiotracer uptake in both putamina, even after taking into account the old infarct in the right MCA territory . The bilateral caudate nuclei were not spared.
+Since she continued to experience back pain, follow-up spine MRI was done a year after the biopsy. Findings suggestive of active inflammation – contrast enhancement on T1WI and hyperintensity of the paraspinal muscles on T2WI – were still present albeit to a lesser extent. Newly identified hypointense signals on T1WI and T2WI were indicative of fibrotic changes. On account of persistent pain and MRI results indicative of the presence of ongoing inflammation, she was prescribed glucocorticoid, which she refused to take. Now merely two and a half years after the onset of camptocormia, she is in Hoehn and Yahr stage 4. The patient is still on levodopa currently at the LEDD of 420 mg per day. She hasn’t developed supranuclear gaze palsy, freezing of gait, blepharospasm, or gait ataxia. She has urinary dysfunction – urinary frequency starting a year before the onset of camptocormic symptom along with documented evidence of urinary retention (post-voiding residual volume > 200 ml). However, aside from urinary dysfunction, she has not developed other symptoms or signs of autonomic dysfunction (e.g., orthostatic hypotension and constipation).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2343_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2343_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fe8f6b1fe0228255ad360be003cd33c8354d2699
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2343_en.txt
@@ -0,0 +1,9 @@
+An 8-year-old girl presented in August 2015 to the Royal Belfast Hospital for Sick Children’s Accident and Emergency department with headache for 2 months. These had been increasing in intensity and frequency for the preceding 3 weeks requiring her to take paracetamol on a daily basis. At times the headache was associated with redness and watering of her left eye. She attended her optician due to the headaches who noted an abnormal appearance of her left fundus. She denied any visual loss or any other visual symptoms. There were no previous eye problems known.
+Systemic enquiry revealed she had occasional nosebleeds. There was no foreign travel except for a family holiday in Spain twelve months previously. As her grandfather was from South Africa, she had received the Bacillus Calmette-Guérin (BCG) vaccine. Her family had a pet dog that lives outside. There were no cats and she did not live on a farm. There was no history of tick bites or cat scratches. She reported no recent viral illness or vaccinations and no recent pyrexia, fatigue, cough or sore throat. She had no known underlying medical conditions. She was not on any medications except for paracetamol as required for her headaches.
+Aged 7, she had previously been admitted for investigation of pyrexia and left knee swelling. At that time, mum described her as having a bruise-like rash around the affected left knee. She was extensively investigated as a Magnetic Resonance Imaging (MRI) scan showed abnormal changes in and around both knees. Bilateral bone marrow trephine of each posterior iliac crest and bone morrow aspirate and biopsy of the affected distal femur were all negative. Haematological malignancy was excluded. Of note, at that time her C-Reactive Protein (CRP) was 69 mg/L and Erythrocyte Sedimentation Rate (ESR) was 110 mm/hr. but otherwise blood testing did not identify any specific underlying diagnosis for her peculiar presentation.
+The examination findings at presentation are shown in Table and Fig. .
+She was admitted with findings of left posterior uveitis and mild vitritis for further investigation. A differential diagnosis of unilateral chorioretinitis included infectious chorioretinitis such as toxoplasma, toxocara, tuberculosis, syphilis, borriella burgdorferi (B.burgdorferi) and post-streptococcal syndrome and inflammatory chorioretinitis such as sarcoidosis, multifocal choroiditis and other white dot syndromes. An infiltrative cause was also considered.
+Extensive investigations, as presented in Table , failed to identify a specific cause for her unilateral chorioretinitis.
+Over the following 4 months, without treatment, her vision increased in the left eye to 6/12 unaided and the fundal appearance improved showing reduced sub-retinal infiltration; however, a focal circular area of chorioretinitis developed along the superotemporal arcade . One month later, the circular area of chorioretinitis had faded but a new active area of chorioretinitis was noted superior to the disc. Within this area, an elongated, white, glistening nematode was identified with an estimated size of 1500 μm when compared with the optic disc diameter . Ocular coherence tomography horizontally through this new area of active chorioretinitis indicated a nematode with tapered end curling upwards from subretinal space into deep retinal layers . This led to a working diagnosis of diffuse unilateral subacute neuroretinitis (DUSN).
+Following diagnosis of DUSN, diode laser was performed under general anaesthetic to the superior area of active chorioretinitis and presumed nematode. The patient was also commenced on oral albendazole 200 mg twice daily for 1 month and a reducing course of oral prednisolone starting at 25 mg daily and tapered over 30 days. After another month, her visual acuity had improved further to 6/9 and the treated area of chorioretinitis superior to the optic disc had disappeared. However, new areas of chorioretinitis had appeared temporal to the superotemporal arcade and in the inferonasal fundus . A further course of oral albendazole 200 mg twice daily and oral prednisolone 7.5 mg was commenced and planned for 30 days but was discontinued by the patient after 2 weeks. After a further 2 months, the fundal appearance had changed once again and new areas of chorioretinitis had appeared in the superotemporal retina with resolution of the areas inferonasally and temporal to the superotemporal arcade . Further laser was administered to the new superior lesion where a nematode was suspected. Despite additional anti-helminthic treatment with ivermectin, recurrence of active chorioretinitis lesions continued and electrophysiology testing indicated significant left retinal dysfunction.
+A specialist uveitis opinion was sought from a tertiary centre in London that concurred with the diagnosis of DUSN; but it was thought that a secondary immune-mediated inflammatory response might be contributing to the clinical picture. Another tapering course of oral prednisolone along with mycophenolate mofetil was trialled without success. At last review, 19 months from initial presentation, the fundal appearance continued to change and a new area of focal chorioretinitis had appeared at the temporal macula .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2346_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2346_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..af868daa9ce90169edba364cf08cfd62770e05c4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2346_en.txt
@@ -0,0 +1,8 @@
+A 51-year-old man was admitted to our hospital because of a two-year history of repeated episodes of epigastric pain and fullness without any obvious causes.
+Two years ago, the patient began to present recurrent upper abdominal pain. The recurrent episodes of pain lasted approximately 1 h and were associated with nausea.
+The patient denied any past surgical interventions.
+Initial evaluation in the hospital showed no remarkable clinical examination findings.
+Laboratory test results were within normal limits.
+An abdominal ultrasound showed a large cystic lesion in the upper left quadrant abdomen, which was initially thought to be retroperitoneal . No significant vascular flow was seen on Doppler .
+A contrast-enhanced abdominal computed tomography (CT) scan was performed for further evaluation . The scan showed a large cystic hypodense lesion, measuring 95 mm × 61 mm × 66 mm, between the spleen and stomach, which was anterior to the left renal fascia and in close proximity to lateral limb of the left adrenal gland. The lesion was lobulated and well-circumscribed with a small amount of wall calcification.
+A cystic lymphangioma was the primary diagnostic consideration prior to pathological confirmation according to the imaging examination.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2349_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2349_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b9f1019725fde02d745b2e39535f0d456dde6917
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2349_en.txt
@@ -0,0 +1,3 @@
+A 59-year-old woman with a history of congenital high myopia and a 3-year history of Sjogren's syndrome complained of the onset of vision loss in her left eye without any clear triggers. In less than a month, her left eye (left eye: no light perception, NLP; corrected vision of right eye: 20/32, ) completely lost sight without ophthalmodynia or pain in eye movement. Regretfully, despite visiting several hospitals, her eyesight in her left eye remained unchanged. In the 6th month, she was diagnosed with ischemic optic neuropathy. Although she was given a compound anisodine hydrobromide injection (2 ml i.h., qd), her vision in the right eye similarly declined within a month (left eye: NLP, corrected vision of right eye: 20/500). In the 7th month, she went to the department of neurology at other hospitals, where positive aquaporin 4-IgG (AQP4-IgG) was found in the serum (titre: 1:320, cell-based assay, CBA) and cerebrospinal fluid (CSF, titre: 1:10, CBA); NMOSD was thereby diagnosed. Then she received IVMP 500mg × 5d (oral prednisone taper from 60mg/d) and IVIG (20g × 5d i.v.) sequentially. However, she felt that her right eye vision did not improve significantly (left eye: NLP, corrected vision of right eye: 20/100) and subsequently remained at that level. In the 10th month, she suffered numbness in four limbs and recurring visual loss, which had a significant impact on her daily activities. Therefore, she went to our department for further treatment.
+Neurological examination: A fundus examination revealed retinal and choroid atrophy surrounding the optic disc. The bilateral pupils had a diameter of 4mm, with the left pupil fixed and the right pupillary light reflex sensitive. Vision in her left eye: NLP, corrected vision in the right eye: 20/200. There was diminished pinprick sensitivity below C5 on both sides. She had no other neurological abnormalities. Expanded disability status scale, EDSS = 4.5 (ambulation 1, visual functions 6, pyramidal functions 0, sensory functions 2). Average thickness of retinal nerve fibre layer (RNFL): 29μm (left eye), 37μm (right eye). MRI scan of the brain and spinal cord, after admission, revealed multifocal T2-hyperintensity in the cerebral white matter, brainstem and cervical cord without enhancement. Orbital MRI revealed that bilateral optic nerve sheath were enhanced, and suspicious enhancement was observed in the intracranial segments of both optic nerves ( a-f). Because of her symptoms of dry mouth and dry eyes, we conducted a re-examination related to Sjogren's syndrome for her. Schirmer I: 2mm in both eyes. Ocular staining score: 6 (left eye), 5 (right eye). Natural salivary flow rate: 0.4ml/min. Anti–SS–A antibody (+++), anti-Ro-52 antibody (+++), which confirmed the diagnosis of Sjogren's syndrome. The following are the results of her laboratory testing: IgG in serum: 12.60g/L, IgA in serum: 1.74g/L, IgM in serum: 0.49g/L, IgE in serum: 5 IU/mL; CSF white cell count: 2 × 106/L, CSF protein: 46 mg/dl, oligoclonal bands (−), AQP4-IgG in serum: 1:320 (CBA), AQP4-IgG in CSF: 1:10 (CBA). Her visual alterations are depicted in .
+Then she was given IVMP 1000mg × 5d. However, her right eye vision did not improve a lot (left eye: NLP, corrected vision of right eye: 20/100), which is a common treatment dilemma in the NMOSD acute phase when there is poor response to conventional treatments. The patient sincerely desired to improve her vision. As an invasive therapy approach, PE has a limited therapeutic effect. Efgartigimod was accessible in some countries at that moment and licensed for generalized myasthenia gravis. As a result, we chose to prioritize Efgartigimod as an add-on therapy according to the drug instructions (10 mg/kg IV, weekly × 4) after she signed the informed consent form. After 3 days of the first dose of Efgartigimod treatment (Day 4), the IgG level in her serum decreased by around 34.5 % (IgG before Efgartigimod treatment (Day 0):12.60g/L; Day 4: 8.26g/L; Day 30: 5.81g/L, ). On Day 8, her corrected vision of the right eye improved to 20/50 (EDSS = 3, ambulation 1, visual functions 5, pyramidal functions 0, sensory functions 0) and her numbness entirely disappeared, then she received her second dose of Efgartigimod (10 mg/kg IV). The serum AQP4-IgG titer decreased to 1:100 (serum, CBA) on Day 30 . Cytokine levels in her peripheral blood also changed (Before Efgartigimod therapy: interleukin-6, IL-6 4.53pg/ml; interleukin-8, IL-8 6.92pg/ml; interleukin-17, IL-17 5.52pg/ml; interferon-γ, IFN-γ 5.52pg/ml; interleukin-10, IL-10 11.71pg/ml. Day 30: IL-6 3.03pg/ml, IL-8 4.67pg/ml, IL-17 5.03pg/ml, IFN-γ 2.26pg/ml, IL-10 23.36pg/ml). During the subsequent 4-month follow-up, the corrected vision in the right eye in this patient stayed at 20/50.There were no obvious adverse effects during the administration of Efgartigimod and subsequent 4-month follow-up. However, long-term monitoring is still required for potential side effects such as hypogammaglobulinemia and concerns about opportunistic infections related to Efgartigimod.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2354_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2354_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8b74f06b1adb5756a1b99e4e3cf661a6652cae60
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2354_en.txt
@@ -0,0 +1,12 @@
+A 22-year-old Caucasian lady presented in 2014 with features of pulmonary fibrosis, chronic cutaneous problems, and symmetrical polyarthritis. She had previously been well without any comorbidities. A high-resolution computed tomography (CT) chest and lung biopsy were performed, with a diagnosis of hypersensitivity pneumonitis being made, in the context of significant mould exposure. Skin biopsies demonstrated spongiotic dermatitis (eczema). Echocardiography revealed right ventricular dilatation with mild tricuspid regurgitation. Left ventricular size and function was normal.
+She was discharged and attended as an outpatient to a specialist centre for pulmonary hypertension, as it was assumed at the time that the right ventricular dilatation was a consequence of undiagnosed pulmonary hypertension. Here, right heart catheterization indicated normal pulmonary arterial pressure. Subsequently, no cardiology follow-up was arranged. The patient was treated with methotrexate, sulfasalazine, and intermittent prednisone over the next 4 years, although a single unifying diagnosis to explain her all of her symptoms was not identified.
+In 2018, the patient attended a rheumatology clinic. The rheumatologist was concerned that there were clinical signs of pulmonary hypertension detected on physical examination, and thus a routine echocardiogram was performed. This study demonstrated severe right ventricular dilatation . There was now severe tricuspid valve regurgitation . The left ventricular size was normal, as was systolic and diastolic left ventricular function. There was no significant left-sided valvular disease. The patient was experiencing dyspnoea on walking 50 m on a flat surface, or at the top of a single flight of stairs. Additionally, she described four episodes of unheralded syncope, all occurring whilst seated. On physical examination, the blood pressure was 130/70 mmHg, the heart rate 88 b.p.m., and regular, with oxygen saturation of 99% on room air. The jugular venous pressure was elevated with prominent V waves. There was a right ventricular heave and a loud pan-systolic murmur audible at the left sternal edge. Pulsatile hepatomegaly was present. Fine crackles were present in both lung bases. Electrocardiogram demonstrated atrial fibrillation with a right bundle branch block .
+Due to the concerning features on echocardiography and the symptoms of dyspnoea and syncope, the patient was admitted to a monitored cardiac ward for further investigation. Telemetry demonstrated non-sustained ventricular tachycardia (VT) at a rate of 150 b.p.m. , of which the patient was symptomatic with palpitations but there was no haemodynamic compromise.
+Right heart catheterization revealed normal pulmonary arterial pressures (22/10 mmHg), but elevated right atrial pressures (16/14 mmHg). Cardiac output (5.4 L/min) and pulmonary vascular resistance (88 dynes.s/cm5) were normal.
+The patient underwent transoesophageal echocardiography (TOE) and successful electrical cardioversion, restoring sinus rhythm. The TOE excluded atrial thrombus, any intracardiac left-to-right shunt, and all four pulmonary veins communicated with the left atrium.
+Cardiac magnetic resonance imaging (MRI) did not show any late gadolinium enhancement in either ventricle, and congenital anatomical anomalies were excluded. Cardiac positron emission tomography ( PET) did not reveal increased metabolic activity to indicate inflammation or features of active cardiac sarcoidosis. A CT chest demonstrated unchanged features of pulmonary fibrosis.
+Myocardial biopsy was performed under fluoroscopic guidance. Histopathology revealed a predominantly lymphocytic chronic inflammatory infiltrate . A single well-formed small granuloma as well as a second focus of scattered giant cells was noted. Moderate to severe myopathic features were seen, including myocyte necrosis with features of myocytolysis and anisonucleosis, and patchy regenerative interstitial fibrosis. The diagnosis was consistent with lymphocytic myocarditis. The morphological pattern that comprised myocyte necrosis and a widespread lymphocytic infiltrate without predominating giant cells and granulomas was less likely to be consistent with cardiac sarcoidosis or giant cell myocarditis. There was a paucity of eosinophils, making the diagnosis of hypersensitivity myocarditis highly unlikely. The classic features of arrhythmogenic cardiomyopathy (AC) were also not seen, i.e. patchy to diffuse irregular replacement of myocytes by adipose tissue, with associated variable amounts of fibrosis, lack of significant lymphocytic infiltrate, and scattered enlarged degenerate vacuolated myocytes. A broad range of serological investigations had also been conducted, with no significant positive results.
+Given the documented symptomatic VT, and the history of syncope, the patient was referred for a cardiac electrophysiology study, which demonstrated inducible VT originating from the RV apex that lasted for over 30 s. Following a multidisciplinary discussion, the patient consented to the implantation of an automated implantable cardioverter-defibrillator (AICD).
+The patient was commenced on prednisone 25 mg daily, as well as sotalol 80 mg twice daily and apixaban 5 mg twice daily, prior to discharge. Since discharge, her prednisone has been ceased after being systematically weaned following commencement of azathioprine 100 mg daily. She has been stable thereafter, with no further arrhythmias and has returned to work. Occasional episodes of decompensated mild right heart failure have been treated successfully with oral diuretics, without the need for intravenous therapy or inpatient admission. An echocardiogram performed 12 months after discharge revealed a marginal improvement in right ventricular function, with residual severe tricuspid regurgitation. As the overall clinical condition of the patient has remained stable, repeat myocardial biopsy was not performed.
+The process is considered chronic based on the first detection of right ventricular abnormalities 4 years prior. In addition, the chronic inflammatory infiltrate and interstitial fibrosis supports this conclusion.
+Thus, we describe a case of an immunosuppressed young lady who was suffering from a chronic low-grade lymphocytic myocarditis of the RV resulting in dilatation of the chamber, severe functional tricuspid regurgitation, and arrhythmic complications including atrial fibrillation and VT. All cardiac imaging modalities demonstrated normal left ventricular size and function, suggesting this process demonstrated a preponderance to the RV.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_235_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_235_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e73c0786f199aa44d731a1f066410f009d93d07f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_235_en.txt
@@ -0,0 +1,4 @@
+In August 2008, a 44-year-old female had undergone surgery for resection of a malignant melanoma in the right lower leg and a right inguinal metastatic lymph node , followed by chemotherapy with doxorubicin, adriamycin, vincristine, and interferon beta (DAV-feron). In March 2012, computed tomography (CT) revealed brain and lung metastases, so the patient began radiation therapy to treat these lesions.
+In September 2012, the patient was admitted to our hospital for back pain. Abdominal CT and magnetic resonance imaging detected new multiple hepatic metastases of melanoma. A transcatheter arterial infusion of cisplatin was administered, and transcatheter arterial embolization (TAE) was performed. In October 2012, she began treatment with vemurafenib, based on the finding of a positive BRAF V600E mutation in the resected primary site of the skin, which was analyzed by direct sequencing analysis using DNA from the paraffin-embedded primary cutaneous melanoma. She tolerated the treatment remarkably well, and the size of the multiple hepatic and lung metastases decreased, while the size of the brain metastases did not. In addition, the serum concentration of 5-S-cysteinyldopa (5-S-CD), a biological marker of melanoma progression, was also decreased from 40.1 ng/mL to 5.2 ng/mL.
+In December 2012, she suddenly developed severe abdominal pain. Abdominal CT revealed ruptured hepatic metastases accompanied by massive intra-peritoneal hemorrhage. A retrospective and sequential analysis of the CT images suggested that a part of the liver metastases had enlarged rapidly and then ruptured with intratumoral hemorrhage during vemurafenib treatment . An emergency TAE was performed by selective occlusion of the right hepatic artery using gelatin sponge particles. The postoperative course was uneventful for several days. However, on the 26th postoperative day, she developed hemorrhagic shock and died of renewed intra-abdominal bleeding.
+An autopsy examination revealed hemoperitoneum due to rupture of the liver metastases. Metastases were also discovered in the brain and lungs as well as in the kidneys, adrenal gland, and lymph nodes, although these had not been detected on imaging while she was alive. There was also massive bloody ascites (1700 mL). The background liver was completely normal, whereas exposed necrotic tissue and intratumoral hemorrhage were observed at the site of tumor rupture . We concluded that the cause of death was hemorrhagic shock from ruptured hepatic metastases of malignant melanoma. Finally, for improved understanding of the mechanism of refractory metastasis, we conducted an immunohistochemical analysis of the signal transduction molecules, phosphorylated extracellular signal-regulated kinase (p-ERK), and phosphorylated Akt (p-Akt), as well as the melanocyte marker Melan-A and Ki-67 in tumor cells of the primary malignant melanoma obtained from the right lower leg and in hepatic and lymph node metastases obtained on autopsy . Our findings showed that hepatic and lymph node metastases were positive for p-ERK and negative for p-AKT, even though the primary tumor was negative for both.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2371_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2371_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cdf641eed31ddd3a1a6e8cf4e3534d55cd221dce
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2371_en.txt
@@ -0,0 +1,2 @@
+A 54-year-old Caucasian man with a 14-year history of Parkinson's disease (PD) was scheduled for DBS of the sub-thalamic nucleus (STN) bilaterally. His anti-parkinsonian medication consisted of 600 mg/day levodopa, 125 mg/day carbidopa, 1200 mg/day entacapone, and 0.54 mg/day pramipexole. This regimen was discontinued 18 hours prior to the DBS procedure, according to our standard protocol, to avoid medication-induced dyskinesias during surgery and to allow for the patient to be in an off-state, thus maximizing the clinical information gained by intra-operative stimulation . The procedure itself was uneventful, with implantation of the DBS electrodes in the STN bilaterally (Medtronic 3389 electrodes; Medtronic, Minneapolis, MN, USA). Three hours post-operatively the patient developed tremor, muscle rigidity, and high fever resistant to common anti-pyretic drugs (paracetamol 1 g). The tremor and rigidity were attributed to PD and 200 mg levodopa three times daily was administered through a nasogastric tube. Systemic and central nervous system infection were also considered in the differential diagnosis; however, cerebrospinal fluid analysis, a chest X-ray, and blood and urine cultures were all within normal limits. A subsequent brain magnetic resonance imaging scan depicted no intracranial pathology and confirmed optimal lead placement. Twelve hours postoperatively the patient's PD features worsened: He developed severe axial and appendicular rigidity, coarse resting tremor, and prolonged spasms of the extremities.
+His temperature had risen to 40°C, and his blood pressure had increased to 165/94 mmHg. A new laboratory investigation showed leukocytosis (leukocyte count, 19.4 × 109/L with a shift to the left (neutrophil count, 167 × 109/l). His serum levels of creatine kinase (CK) were markedly elevated to 1500 U/l with a normal CK-MB fraction, and his cardiac troponin levels were normal, indicating that the CK elevation was not of cardiac origin. At that point, the diagnosis of NMS was established on the basis of the clinical examination and the laboratory findings. Malignant hyperthermia was excluded after a negative caffeine-halothane contracture test . The patient was intubated and transferred to the intensive care unit (ICU). Treatment by intravenous administration of 3 mg/kg/day dantrolene, 600 mg/day levodopa, and 60 mg apomorphine was initiated. After copious ICU treatment, the patient was extubated on the ninth post-operative day. Fifteen days post-operatively he still appeared lethargic and confused. The DBS device was consequently activated on the 20th post-operative day, as it was considered that it could accelerate the patient's recovery. Indeed, after DBS activation, the patient showed a good recovery pace and was discharged from the hospital on the 32nd post-operative day. At his six-month follow-up examination, he demonstrated an overall improvement of 15% in the Unified Parkinson Disease Rating Scale.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2373_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2373_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..033d004a1489b33ab053b910b3d6dd1c71cf2402
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2373_en.txt
@@ -0,0 +1 @@
+We present the case of a 38-year-old man with end-stage renal disease secondary to diabetes mellitus type 1 on CAPD for 18 months and on APD for 40 months. The patient, who had no previously reported episode of PD-related bacterial peritonitis, was admitted to our department with a 2-day history of emesis, cloudy peritoneal dialysate, and abdominal pain in the upper abdomen as well as diarrhea. On admittance, he was afebrile and normotensive with a blood pressure of 125/85mmHg; his pulse was regular but tachycardic at 143 beats per minute. There was no abdominal tenderness. The PD catheter exit site was clean. An electrocardiogram (ECG) showed sinus tachycardia with a rate 143 beats per minute, but no signs of myocardial ischemia were seen. The complete blood count showed white blood cells of 14.6 cells/mm3 with 83% segmented neutrophils, 1% unsegmented neutrophils, 7% lymphocytes, 7% monocytes, and 2% eosinophils; hematocrit 33%; and platelets of 313 × 103/μL. C-reactive protein was 138mg/L and procalcitonin was 1.1ng/mL. The first dialysate leukocyte count was 1055/μL with 93% segmented neutrophils, 3% lymphocytes and 4% monocytes. The usual PD-related peritonitis was suspected and after sending the first PD effluent for culture to the laboratory, we started treatment with antibiotics according to hospital protocol: intra-peritoneal cefazoline and ceftazidime. The Gram stain of the first effluent was negative. The second Gram stain of the PD effluent 3 days after admittance was also negative. The exit site culture and coproculture were negative. The abdominal X-ray and abdominal ultrasound (US) were unrevealing. After 3 days of antibiotic therapy the clinical status of the patient did not improve. Furthermore, abdominal tenderness in the epigastrium and the upper right quadrant, inappetence and anuria, appeared. The patient was switched to hemodialysis using a central venous catheter in the vena jugularis interna. On the sixth day after admission the patient complained, for the first time, about pain in his left arm; his ECG was without signs of ischemia, and his troponin T was slightly elevated (0.19μg/L). On the seventh day after admission we decided to remove the peritoneal catheter in a surgical procedure under general anesthesia. The dialysate leukocyte count just before the operation was 4385/μL with 99% segmented neutrophils. After the surgical procedure the patient was treated with intravenous vancomycin and ceftazidime, but over the next few days his clinical situation was no better (severe abdominal pain with nausea and vomiting). On the 11th day the patient complained of pain in both arms; on the ECG signs of ischemia (T-wave inversion in inferior leads) were found. The troponin T on the same day was 1.13μg/L and non-ST elevation myocardial infarction was suspected. Regarding this clinical condition a cardiologist was consulted about a coronarography and an abdominal surgeon about a relaparotomy. On the same day a decision was made for surgery to be carried out. Surgeons performed an explorative laparotomy and found diffuse peritonitis and gangrenous appendicitis. An appendectomy was performed. The patient was admitted to the intensive care unit. Mechanical ventilation support was needed. The next day on an ECG ST elevation in the anterior wall was present, and troponin T was 6.22μg/L; the echocardiography showed hypokinetic anteroapical wall of the left ventricle, the ejection fraction was 40%. The patient was treated with vasopressors, intravascular antibiotics and antimycotic therapy with vancomycin, imipenem-cilastatin and fluconazole. On the 15th day of admission paralytic ileus appeared. A relaparotomy and an ileostomy were performed. After this operation the patient improved. He was extubated, lucid and talking. On the 17th day of admission the patient became worse again, he was hypotensive, in shock, and between vomiting he aspirated. On the 19th day of hospitalization bradycardia developed and cardiopulmonary resuscitation was performed. On the 20th day of admission the patient died of septic-toxic shock and multisystem failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2386_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2386_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..149cb69c63d30c9ef293c34e178d379d4a6d8682
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2386_en.txt
@@ -0,0 +1,7 @@
+We report a case of 46-year-old male complaining of abdominal pain and obstructive jaundice. He was referred to the digestive surgeon at Fatmawati Central General Hospital. The physical examination revealed that the abdomen was distended with palpably enlarged spleen and liver. An abdominal contrast computed tomography (CT) scan found lobulated masses in the duodenal and ampulla of vater projection. Surgical intervention was decided and the patient was admitted to the intensive care unit (ICU) after a total pancreato-splenectomy due to a stage IIIb duodenal tumor.
+During the preoperative assessment, we concluded that this patient was high risk due to anemia, obstructive jaundice, and decreased liver function. Intraoperatively, massive surgical bleeding (2500 cc) was sustained due to extensive tumor resection, and thus massive blood product transfusion was necessary.
+Upon arrival at the ICU, our patient had decreased urine output. Therefore, we had to increase the vasopressor dose to 0.3 µg/kg/minute to maintain the mean arterial pressure above 65 mmHg and systolic blood pressure above 95 mmHg. Laboratory examination revealed a lactate level of 5.8 mmol/L, C-reactive protein (CRP) level of 30 mg/dL, white blood cell counts of 26,700/μL, and procalcitonin level of > 32 ng/mL. These findings showed that the patient had a systemic inflammation response syndrome (SIRS) due to the surgery. Furthermore, 12 hours after the surgery, he showed signs of AKI, including urine production of < 0.3 cc/kg/hour. Hyperglycemia was another problem observed in the patient, with the highest glucose level recorded at 511 mg/dL within 3 hours after the surgery. Glucose management therapy was started with an insulin infusion drip of up to 7 IU/hour.
+We decided to initiate early continuous renal replacement therapy (CRRT) for this patient. The CRRT was initiated within 24 hour following the diagnosis of postoperative AKI on the basis of Kidney Disease Improving Global Outcome (KDIGO) criteria stage 2. CRRT was conducted using the continuous veno-venous hemofiltration (CVVH) method. The effluent dose was 27 cc/kg/hour with 0 cc fluid removal. After 3 hours of CVVH initiation, the patient showed signs of improvement. His urine output increased to 0.5–0.6 cc/kg/hour, and the vasopressor dose was quickly tapered. We decided to administer furosemide infusion within 18 hours after CVVH, and the patient’s urine output increased to 1–4 cc/kg/hour .
+The patient’s inflammation was assessed on the basis of his CRP levels. On day 1 after the surgery, the patient’s CRP level was 35 mg/dL. Following the initiation of CVVH on the third postoperative day, his CRP level decreased significantly to 15.1 mg/dL. The inflammation was significantly reduced as the CVVH continued . After the initiation of CVVH, the patient’s blood glucose was controlled and the insulin infusion drip rate was reduced to 0.3 U/hour .
+On the second postoperative day, the patient’s white blood cell count and procalcitonin level increased, indicating an ongoing infection. We changed the antibiotic course and administered an empirical broad-spectrum antibiotic instead, with 3 × 2 g intravenous meropenem. We observed a good clinical response after the CRRT was initiated . Urine output was increasing and we could reduce the norepinephrine dose. The CRRT was stopped on the third postoperative day and furosemide was started at 1 mg/hour for renal support.
+On the fourth postoperative day, the patient was alert and cooperative with minimal ventilatory and hemodynamic support. The patient was extubated and respiratory support was provided with a nasal cannula .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2415_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2415_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..85e67c393e675e4f5080102808f456f76524a778
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2415_en.txt
@@ -0,0 +1,8 @@
+In February 2017, a 56-year old woman was transferred from a peripheral hospital to the department of Urology (University of Bonn) due to left sided flank pain and elevated serum infection parameters. An abdominal computed tomography scan showed an obstruction of the renal pelvis caused by an amorphous mass .
+The patient had neither relevant urologic medical history nor hematuria but she reported intermittent shivering since one week. The physical examination showed severe left sided flank pain on palpation. Extensive laboratory examination revealed leucocytosis (22.53 G/l), elevated C-reactive protein (253 mg/dl) and creatinin (1.4 mg/dl) as well as significant leucocyturia. A calculated antibiotic therapy with ceftriaxone and tobramycin was initiated and a double-J-stent was inserted into the left ureter. The urine culture of the admission day did not reveal bacterial growth.
+Due to missing clinical recovery with persistent fever and elevated serum infection parameters, the antibiotic treatment was changed to meropenem after four days.
+Eventually, repeated urine culture and blood cultures revealed fungaemia with Candida glabrata. Therefore, intravenous antifungal therapy with caspofungin was started. Due to an allergic reaction with exanthema the therapy was shifted to amphotericin B. Blood tests ruled out HIV infection and Diabetes and there was no evidence for other immune deficiencies.
+Cerebral and thoracoabdominal computed tomography scan excluded an extrarenal focus of infection and echocardiography did not show any intracardial fungal vegetations. Although the patient did not suffer from any visual impairment we initiated ophthalmoscopic examination as recommended in literature in case of fungaemia . Funduscopy revealed fungal parapapillary chorioretinal infiltrates . Under the antimycotic treatment, the inflammatory parameters were regressive and the patient’s clinical condition improved significantly. Ureterorenoscopic examination revealed a tough yellowish-gray mass in the renal pelvis.
+Due to insufficient ureterorenoscopic removal of the mass, it was decided to perform percutaneous “nephrolitholapaxy”. Thus the material could be extracted completely . Microbiological and histological work-up revealed fungal bezoar colonized with Candida glabrata. Seven days after intervention urine culture control proved the absence of fungal colonization.
+Finally, after 22 days of amphotericin B therapy, ophthalmologic re-examination showed a complete regression of the chorioretinal candida infiltrates and the patient was discharged in good general condition with normalized infection parameters.
+After a follow up of two months the patient felt well and urine culture was sterile.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2422_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2422_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c824558cc583ba7174db2fa391b7d3a0121c0e48
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2422_en.txt
@@ -0,0 +1 @@
+A 69-year-old Caucasian woman presented to our emergency department with a 2-h history of dyspnoea, following a family quarrel. Her past medical history included mitral valve prolapse with mild mitral regurgitation diagnosed in young age and colon cancer successfully treated by surgery and chemotherapy 3 years before. The patient suffered from anxiety, occasionally treated with anxiolytic drugs. Physical exam revealed apical systolic murmur 2/6 Levine scale with systolic click and crackles at both lung bases. Blood pressure was 110/70 mmHg, heart rate 73 b.p.m., respiratory rate 22 b.p.m., and O2 saturation 96%. The ECG showed sinus rhythm, ST-segment elevation up to 1.5 mm in lateral and anterior leads and prolonged QTc interval (496 ms). Increased high-sensitivity cardiac troponin (937 ng/L—URL 20 ng/L) and no other abnormalities were detected on blood sample analysis. Haemoglobin (13.8 g/dL), white blood cells (7.8 × 103/µL), platelets (189 × 103/µL), prothrombin time (12.3 s), and activated partial thromboplastin time (31 s) were within normal range. Transthoracic echocardiography (TTE) showed reduced left ventricular ejection fraction (LVEF, 38%) due to akinesia of cardiac apex . The patient was immediately referred to the cath lab with an initial diagnosis of ST-elevation myocardial infarction and treated with unfractionated heparin 5000 IU i.v. and dual antiplatelet therapy (aspirin 250 mg i.v. and ticagrelor 180 mg per os) according to current guidelines. Unexpectedly, coronary angiography revealed normal coronary arteries while left ventriculography confirmed the echo finding of extensive systolic dysfunction of the apical segments with hyperkinesia of the basal segments resembling ‘takotsubo’ morphology . Considering the preceding trigger event and the apical akinesia despite normal coronary arteries, the suspicion of typical TTS arose. This hypothesis was reinforced by an InterTAK diagnostic score value of >70. The patient remained under close clinical observation in the intensive care unit for 2 days receiving the following therapy: low molecular weight heparin (LMWH) 6000 IU s.c. twice daily, aspirin 100 mg/day, metoprolol 50 mg twice daily, ramipril 2.5 mg/day. Due to signs of heart failure, furosemide 20 mg i.v. twice daily was added. On the 4th day of hospitalization, the patient was transferred to the cardiology unit. Therapy remained unchanged, except for LMWH which was withdrawn. Two days later, the patient developed dysarthria and right hemiparesis. Head computed tomography (CT) scan revealed a small hypodense area at the cortico-subcortical site of the left parietal lobe. The day after, due to sudden disappearance of spontaneous speech, a new head CT was performed, revealing an additional ischaemic hypodense area localized at the cortex of the precentral gyrus, whilst no hyperdense area suggestive of ongoing intracranial haemorrhage was detected. TTE showed persisting apical akinesia and detected a small apical thrombus (1.2 mm × 3.2 mm) attached to the apical segment of the left ventricular (LV) lateral wall . Therefore, anticoagulation therapy with acenocoumarol per os was started, with dose adjustment according to periodic laboratory testing of international normalized ratio. At 72 h from the onset of neurological symptoms, head magnetic resonance imaging (MRI) confirmed the diagnosis of ischaemic stroke showing diffuse cardioembolic lesions mainly involving the left parietal and frontal lobes . Ten days after hospitalization, LV systolic function improved significatively (LVEF 48%) and the size of the apical thrombus appeared reduced . Owing to the persistence of the neurological disorders, the patient was transferred 3 days later to a neurological rehabilitation institute, in stable haemodynamic conditions. At 1-month follow-up, she was asymptomatic, hemiparesis was no more detectable and dysarthria was slowly but significantly improving. The ECG showed only diffuse negative T-waves. TTE showed normal LVEF (58%) and no apical thrombus . At 3-month follow-up, the patient was in good clinical conditions. Speech had further improved, albeit still slower than normal. No more ST-T segment abnormalities were identifiable at ECG. Cardiac MRI confirmed the complete recovery of LV systolic function and the absence of thrombi . No areas of oedema or late gadolinium enhancement were appreciated . Therefore, anticoagulation therapy was withdrawn. At 5-month follow-up, the patient fully recovered speech without any relevant symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2449_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2449_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0a30b81611644d7d85d0fa7f50e3f82285fd1253
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2449_en.txt
@@ -0,0 +1,6 @@
+We present the case of a 72-year-old Caucasian woman with a history of childhood encephalitis with motor sequelae, who presented with a 10-year history of full-thickness rectal prolapse that had progressively worsened despite two surgical procedures, namely, anal encirclement 13 years before presentation and a new encirclement associated with stapler mucous prolapsectomy 6 years before presentation. For 2 years, severe fecal incontinence associated with repeated rectal bleeding had prevented her from sitting down, had severely impeded her walking and induced pain. The patient's Wexner incontinence score was 19, and anorectal manometry showed marked hypotonia of the anal canal at rest (20 mmHg) and during contraction (40 mmHg). Endorectal ultrasonographic examination revealed no documentable sphincter lesions although the muscle fibers appeared markedly thinned. Electromyographic (EMG) recordings disclosed severe neurogenic damage to her external anal sphincter. The patient declined to undergo construction of a definitive colostomy.
+The operation proceeded in three steps. First, the full-thickness rectal wall was incised circumferentially at 2 cm from the pectinate line. The pouch of Douglas was opened and about 20 cm of bowel was prepared before the peritoneal fossa was reconstructed. Once the bowel was resected a coloanal anastomosis was constructed with a 29 circular stapler. The operation proceeded with dynamic graciloplasty. Through two longitudinal incisions on the medial face of the right thigh, the gracile muscle was mobilized down to its insertion on the tibial tuberosity. Once the muscle was prepared for tunneling, electrical stimuli were delivered to identify the neurovascular peduncle. This step is crucial to identify the site for definitive intramuscular electrode implantation that guarantees an effective gracilis muscle contraction.
+Second, the gracile muscle was tunnelled and wrapped around the sigmoid colon anastomosed to the residual rectum after preparing the peri-anastomotic space using two longitudinal perianal incisions. This fixed the muscle tendon on the perineal skin.
+Finally, a subcutaneous pouch was created in the right iliac fossa to house the neurostimulator. The leads connecting the neurostimulator to the gracile muscle were then tunnelled subcutaneously. This entailed constructing a temporary transverse colostomy to minimize the risk of infections involving the perianal accesses that can damage the neosphincter or cause its disinsertion.
+The patient had an uneventful postoperative course, and on day 7 began regular leg gymnastics with a soft balloon placed between her knees. Neurostimulation delivered at low frequency began on day 20 and continued for about 2 months before the frequency was increased. In the sixth month, clinical examination and manometric evaluation showed a slight improvement in sphincter tone, that is, pressure at 30 mmHg without electrical stimulation and 55 mmHg with electrical stimulation. One year after the operation, the colostomy was closed under manometric evaluation (pressure at 40 mmHg without electrical stimulation and 65 mmHg with electrical stimulation).
+Two years after the combined operation, no further recurrent rectal prolapse was visible. The patient was already continent for solids (Wexner incontinence score 9) and could switch the pacemaker device on and off without help.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_244_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_244_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c60ea517fc01279b8cd4e8dbdbe22cdfff48e2de
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_244_en.txt
@@ -0,0 +1,5 @@
+A 74 year-old Caucasian woman with complete heart block had dual chamber pacemaker implanted in 1990. Her initial system included a Medtronic 4504 passive fixation atrial lead and a Medtronic 4004 passive fixation ventricular lead. She subsequently underwent replacement of her pulse generator in 1998 and insertion of a new Medtronic 5568 active fixation atrial lead and a Medtronic 4068 ventricular leads in August 2003 due to lead failure. She underwent a subsequent generator change in June 2011. The original atrial and ventricular leads were abandoned when the new leads were added in 2003. All procedures had been undertaken at a referring institution and she had not had any prior open-heart surgical procedures. The patient presented at her home hospital with a swollen and erythematous pacemaker pocket in February 2014. Blood cultures did not grow any bacterial or fungal organisms. A trans-esophageal echocardiogram was performed to assess for vegetations on the leads. No vegetations were identified, but there was suspicion that one her atrial lead was extravascular. She underwent chest computerized tomographic imaging and this study revealed that one of her right atrial lead tips was approximately 2 cm within the pericardial space . The patient was treated with vancomycin and ceftriaxone based on a diagnosis of suspected pacemaker pocket infection. She underwent pacemaker pocket exploration and debridement, but extraction was not undertaken due to the increased risks involved with the lead being extra-vascular. No organism was identified from samples of fluid cultured during that initial debridement procedure. Despite that debridement procedure and prolonged antibiotics there was clinical recurrence of the infection and the patient was subsequently transferred to our center for complex lead extraction.
+To minimize the risk of vascular disruption and tamponade given the chronic right atrial lead perforation, a combined transvenous and open surgical extraction approach was undertaken. Using a dedicated hybrid operating theatre with cardiopulmonary bypass support if necessary, midline sternotomy was performed. Dense adhesions were found within the pericardial space consistent with likely prior pericarditis. Given the location of the RA lead, care was taken to leave the right atrial dissection until all other vascular structures were exposed. With uneventful dissection of the right atrium, direct visualization of the protruding passive fixation lead was obtained . To avoid the risks associated with cardiopulmonary bypass and given the good visualization of the perforating atria lead, an off-pump technique was considered using a “lead-inverting stitch”. To achieve hemostatic control over the region of the atrial wall where the lead exited, a purse-string stitch was placed circumferentially around the lead tip using 3–0 prolene with multiple pledgets . The externalized tip of the perforating atrial lead was then mobilized by cutting a rim of surrounding atrial tissue. This allowed the end of the lead to be dunked within the right atrial chamber while the purse-string suture was tightened for hemostasis . With this “lead inverting stitch”, the lead was free within the right atrium and could now be safely extracted using transvenous laser extraction techniques.
+With the heart partially verticalized, the lateral wall of the left ventricle was exposed and an epicardial lead (Medtronic 4968) was placed. It was then tunnelled through the subcutaneous tissue above the rectus sheath, secured and connected to the new pacemaker. The new pacemaker was then placed in a newly created pocket, below the left costal margin. The sternotomy wound was covered with sterile surgical towels.
+The infected pacemaker pocket was then opened and direct visualization confirmed the presence of a small amount of murky fluid. This fluid was sent for culture. The pocket was then extensively debrided and the four transvenous pacemaker leads were prepared for complex extraction in a standard manner beginning with retraction of the distal screw to facilitate separation of the active fixation lead tip from the myocardium interface during laser extraction. A purse string suture was subsequently positioned along the pectoral muscle around each lead at its insertion site to avoid any significant bleeding when the leads are completely removed. The lumen of each lead was then probed for patency with a standard stylet to ensure that a lead-locking-stylet can be utilized and advanced deep into the lead lumen for adequate gripping during the extraction process. Appropriate sizing of each lumen and distal delivery of the locking stylets was subsequently performed. A long silk suture thread was then tied to the outside of the lead near its insertion site, extended along the length of the lead, and tied to its end to provide further support along with the lead-locking-stylet when applying traction on the lead during laser extraction. Now that the leads have been prepared, transvenous lead extraction with a #14 French laser sheath was attempted. Due to the presence of multiple biding sites, up-sizing to a #16 laser sheath was required along with the use of a less compliant outer sheath (Visi-sheath). All the leads were removed entirely, with the perforating atrial lead removed last. There was no hemodynamic compromise throughout the procedure and no mechanical complications related to the procedure. The “lead inverting stitch” retained its integrity and hemostasis was preserved throughout the transvenous lead extraction.
+Following successful lead extraction, the median sternotomy and old pacemaker pocket incisions were closed in a standard fashion and the patient was transferred to the intensive care unit for post-operative monitoring. The total procedure time from incision to wound closure was 5 hours and 24 minutes. Post-operative course was complicated with hypoxia secondary to atelectasis and aspiration pneumonia that resolved after 5 days. The patient was discharged back to her home hospital for ongoing rehabilitation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2467_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2467_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..35abbe9d83846ed0e464961fc36376632b8668f0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2467_en.txt
@@ -0,0 +1,65 @@
+The patient was a 70-year-old Japanese man (172.0 cm tall, weighing 68.0 kg, body
+mass index 23.0 kg/m2) who had smoked 20 cigarettes a day for 47 years
+until 5 years ago. He was under treatment and follow-up for essential hypertension,
+dyslipidemia and chronic kidney disease, and his blood pressure and lipid levels
+were well controlled with administration of 40 mg of olmesartan medoxomil (Olm) and
+5 mg of atorvastatin calcium hydrate. His renal function was stable. The patient
+presented with nasal discharge, malaise and a mild cough, and tested positive for
+SARS-CoV-2 by the polymerase chain reaction (PCR) test three days after coming in
+extended contact with a colleague who was also diagnosed with SARS-CoV-2. Since he
+had many risk factors for disease aggravation, he was urgently admitted to our
+hospital (Day 1) the day after symptom onset and confirmation of the diagnosis.
+At admission, his body temperature was 36.4 °C, blood pressure was 185/72 mm Hg,
+pulse was 86 beats/min, respiratory rate was 20 beats/min and peripheral oxygen
+saturation on pulse oximetry (SpO2) was 97.0%. Laboratory findings at
+this time showed lymphocyte depletion and coagulation abnormalities [lymphocytes
+8.5%, fibrinogen 518 mg/dL, fibrinogen degradation products 5.26 μg/mL and D-dimer
+(D-D) 1.68 μg/mL] . In addition, iron deficiency anemia was observed (he was
+scheduled for close examination of the gastrointestinal tract after COVID-19 was
+cured), and hence, it was difficult to evaluate the clinical implication of the
+observed low ferritin level . CT showed emphysematous changes in the lung field. Ground
+glass opacities with neither a crazy-paving pattern nor consolidation was found
+below the dorsal pleura of the upper right lobe, and the total CT score was 1/25
+points (upper right lobe 1/5 points, middle lobe 0/5 points, lower right lobe 0/5
+points, upper left lobe 0/5 points and lower left lobe 0/5 points), based on the
+scoring system described by Pan et al. In addition, fibrosis, subpleural lines, the reversed “halo sign”, pleural
+effusion and lymphadenopathy were not observed. It was considered to be a typical
+findings of early mild COVID-19 pneumonia .
+Although no decrease in SpO2 was observed, administration of favipiravir
+(Fav) 3600 mg daily was started from the evening of the same day, due to the
+presence of mild pneumonia as seen on CT and the presence of multiple comorbidities.
+In addition, since SpO2 decreased a little the following day, 1 L/min
+oxygen administration via a nasal cannula was also started. Weakness and a decreased
+level of consciousness (tendency to somnolence) appeared from the early morning of
+Day 2, but a neurologist ruled out stroke. Since somnolence and weakness were
+considered as side effects of Fav, the drug was discontinued on the evening of Day
+2, and his symptoms improved by the morning of Day 3. Thereafter, since his
+temperature increased again, the frequency of administration of acetaminophen 500 mg
+was increased from 0 to 3 times a day. In addition, his CRP level increased and
+SpO2 decreased, requiring an increase in oxygen flow rate from 1 to
+3 L/min by nasal cannula. CT performed on Day 4 showed slight deterioration in the
+pneumonia. The total CT score was 2/25 points (ground-glass opacities only below the
+dorsal pleura of the upper right lobe) . Therefore, 200 mg of remdesivir
+(Rem) was administered on Day 4, with 100 mg daily being administered from Day 5
+until Day 10, for a total of seven days . On Day 7, blood gas data under
+administration of 4 L/min oxygen by nasal cannula showed that the alveolar-arterial
+oxygen difference (A-aDO2) had increased to 122.1 mm Hg , indicating an
+imbalance between ventilation and blood flow. However, no pulmonary hypertension was
+observed on electrocardiogram or echocardiography. Furthermore, since a tendency of
+increasing D-D levels was also observed , the combination of nafamostat
+mesylate (Naf) 100 mg daily by continuous intravenous infusion and dexamethasone
+(Dex) 6 mg daily was administered for four days from Day 7 . The treatment was remarkably
+effective, resulting in fever reduction and a decrease in CRP and D-D levels (, c and d). On Day
+10, oxygen administration could be discontinued, and at the same time , his blood
+pressure control improved . By Day 13, A-aDO2 had also significantly improved
+to 33.2 mm Hg without supplementary oxygen , and CT showed a tendency for
+improvement in pneumonia. The total CT score at this time was still 2/25 points
+(ground-glass opacities only below the dorsal pleura of the upper right lobe) .
+For blood pressure control during the course of his hospitalization, continuous
+intravenous infusion of pernidipine (4-9 mg/h) was performed for two days when oral
+intake was difficult due to the decreased consciousness level, and from day 4, Olm
+40 mg and nifedipine 20 mg were administered in combination. With the treatment of
+COVID-19, his blood pressure gradually stabilized, and the dose of nifedipine was
+reduced from Day 14 to 10 mg, and nifedipine was discontinued from Day 19 .
+It took some more time for SpO2 to stabilize, but it eventually improved
+and the patient was discharged on Day 21 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_246_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_246_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..62c078306ec9de7b4d0f03704cc14099e886554f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_246_en.txt
@@ -0,0 +1,3 @@
+An 86-year-old man was treated for symptomatic (transient left hemiparesis) right internal carotid artery (ICA) with CAS in his local hospital. One month after stenting, he suffered aspiration pneumonia and septicemia, and Klebsiella oxytoca was isolated on blood culture. Three months after stenting, swelling and tenderness of the right side of his neck appeared. His general condition deteriorated due to septicemia and he was unable to ingest anything by mouth because of his decreasing level of consciousness. Five months after stenting, he was transferred to our hospital . Doppler ultrasound showed an iso-and high-echoic mass around the stent and multiple arterial fistulas between the right ICA and the mass. Computed tomography angiography (CTA) revealed a pseudoaneurysm around the stent . The distal edge of the stent was at the level of the superior aspect of the C2 vertebral body. Balloon test occlusion revealed no tolerance to scarification of the affected right ICA. The neck mass rapidly increased in size, getting larger every day , and this growth of the neck mass was confirmed with CTA and digital subtraction angiography (DSA) [ and ]. Therefore, 15 days after admission, we performed an interposition with a tapered (4–6 mm) type PTFE synthetic vessel graft (ADVANTA VXT: GETINGE group, Gothenburg, Sweden).
+The operation was performed under general anesthesia. A skin incision was made over the anterior border of the sternocleidomastoid muscle extending to the root of the zygoma. First, the common carotid artery (CCA) proximal to the stent was secured. Then, the styloid process and mandibular angle distal to the stent and pseudoaneurysm were cut to secure the ICA . After securing both sides of the stent and pseudoaneurysm, we attempted to detach the pseudoaneurysm from the surrounding tissue to the greatest extent possible. A massive amount of purulent material emerged during detachment, and K. oxytoca was later isolated by bacterial test. The external carotid artery was cut at the distal aspect of the pseudoaneurysm . After clamping the proximal CCA and distal ICA , the pseudoaneurysm was removed and interposition of the PTFE synthetic vessel graft through a continuous suture using CV-5 Gore-Tex suture was performed . The wound was thoroughly lavaged and then closed over a subcutaneous drain. The patency of the graft was confirmed at 1 and 35 days after surgery through CTA and DSA, respectively [ and ]. The patient returned to his local hospital 36 days after surgery and had a modified Rankin score of 5.
+Histopathological investigation showed rupture of the arterial wall and formation of a pseudoaneurysm [ and ]. Infiltration of plasma cells, hemosiderin-laden macrophages, and neutrophils was confirmed in the neck of the aneurysm. These results indicated that inflammation around the stent caused the arterial wall to rupture, and then form a pseudoaneurysm [ and ].
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2474_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2474_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d8e2f637110de2579fd0990a41d4b78ba3022c3e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2474_en.txt
@@ -0,0 +1,7 @@
+A 19-year-old Saudi male was referred to the Department of ENT at our institution with the complaint of facial pain over the upper jaw area along with post-nasal discharge. This complaint has developed over a period of 6 months prior to his presentation. The patient gave a history of recurrent sinusitis but had no other systemic illness, no past surgical history and no history of trauma. No known drug history, no family history of any genetic disorder. The patient and both parents are non-smokers.
+Endoscopic examination was unremarkable except for a septal spur to the left side. Paranasal sinuses computed tomography (CT) scan showed bilateral cystic lesions and ectopic teeth in both maxillary sinuses .
+The patient was booked for endonasal endoscopic enucleation of the cysts and extraction of the ectopic impacted teeth.
+Intra-operative, bilateral big cystic masses completely filling both maxillary sinuses were visualized along with a tooth impacted in the floor of the left maxillary sinus and another tooth identified within the right osteomeatal complex obstructing the right maxillary ostium.
+Bilateral endoscopic wide middle meatal antrostomies were performed under general anesthesia. The cystic masses were dissected from the wall of both maxillary sinuses and removed by using different angel forceps and endoscopes. The right tooth was obstructing the maxillary sinus drainage removed with the cyst while the left was impacted in the left inferiolateral walls of left maxillary sinus removed completely with angled giraffe forceps . Homeostasis was achieved in both sinuses and no nasal packing was needed.
+The specimen was sent for histopathologic examination which confirmed the diagnosis of dentigerous cysts.
+The patient’s symptoms were resolved completely post-operatively and remained free of symptoms for 5 years follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2489_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2489_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e06e126ad9069a9132cf93c1b6e39a69af878a08
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2489_en.txt
@@ -0,0 +1,10 @@
+A 26-year-old pregnant woman with a gestational age of 25 + 2 weeks was admitted to hospital for more than 2 months after the discovery of pancytopenia and increased creatinine. She was admitted to the hospital for further diagnosis and treatment and categorized as “acute kidney injury, pancytopenia, and pregnancy” by the outpatient clinic.
+The patient reported that her gums bled when she brushed her teeth; she had large, long-lasting bruises when she collided with hard objects; and she experienced no lower limb edema or backache. In terms of previous medical history, the patient was healthy, with no history of surgery, food or drug allergies, substance abuse, or exposure to toxins, dust, or harmful substances.
+The patient did not undergo genetic testing before pregnancy, and the disease was not discovered until the second-trimester. Concerning menstrual history, the patient had normal menstrual volume, no dysmenorrhea, and a regular menstrual period. She had no fertility problems, had not experienced menopause, and currently had no children. Furthermore, her family had no history of malignant tumors.
+The patient’s physical examination results were as follows. Her body temperature was 36.5 °C, pulse was 76 beats/min, respiration was 20 breaths/min, and blood pressure was 140/88 mmHg. She was conscious with satisfactory mental wellbeing. She had a centered trachea and clear respiratory sounds with no abnormal sounds in either lung. Her heart rate was normal with no abnormal sounds. Abdominal distension; consistent with gestational age; no tenderness; rebound tenderness. Her liver was not palpable under the ribs, but her spleen was palpable 1 cm under the ribs and hard with no tenderness. No tenderness or percussion pain were noted in either kidney, and no tenderness was noted in either ureter.
+The patient’s laboratory examination results were as follows: white blood cells: 2.32*109/L; hemoglobin: 65 g/L; red blood cells: 2.65*1012/L; platelets: 31*109/L; serum ferritin: 7.1 μg/L; and creatinine 246 μmol/L. CA19–9, CA-125 alpha-fetoprotein, and carcinoembryonic antigen were in the normal range. Blood electrolytes were normal. A bone marrow examination was performed on July 17, 2020, and the results were as follows. The bone marrow morphological description revealed active nucleated cell proliferation; active granulocyte hyperplasia, mainly in the myelocyte and metamyelocyte stages; active erythrocyte hyperplasia, mainly in the immediate and late erythroblast stages; and reduced nucleoplasm in some early erythroblasts. Her bone marrow morphology revealed iron-deficiency anemia.
+The patient underwent ultrasonography, magnetic resonance imaging (MRI), and magnetic resonance cholangiopancreatography (MRCP) examinations. Ultrasonic examination revealed an enlarged left liver lobe and a moderately sized and abnormally shaped right liver lobe. The width of the main vein of the porta hepatis was approximately 1.7 cm with local tortuous dilatation in a “vermis” shape . Color Doppler flow imaging (CDFI) indicated that the main portal vein was the signal of blood flowing into the liver, and its peak flow velocity measured by pulse-Doppler was approximately 35.8 cm/s; the accompanying dilated vein near the portal trunk was the signal of hepatic outflow, and its peak flow velocity measured by pulse-Doppler was approximately 21.4 cm. The spleen was approximately 5.3 cm thick; it was plump with a smooth outline, a strong echo in essence, and a dilated splenic vein, which was approximately 1.5 cm wide at the hilum of the spleen . Both kidneys were obviously enlarged, abnormally shaped, and covered with anechoic dark areas of different sizes ; no abnormal blood flow signal was detected by CDFI.
+Regarding the fetus, the gestational age was approximately 25 weeks, which was consistent with the actual fetal age. No significant abnormalities were observed except for polyhydramnios. The limb structure and face of the fetus were normal. In addition, no abnormalities were observed in the fetal spine, intracranial pressure, heart, lungs, kidneys, gastric vesicles, intestines, gallbladder, or bladder. The amniotic fluid index was 24–25 cm (reference value is 8–18 cm) with a maximum depth was 10.2 cm.
+Maternal MRI revealed that the liver was plump with disproportionate liver lobes. Furthermore, it revealed hepatomegaly as well as multiple tortuous dilated bile duct shadows near the liver surface, among which polycystic liver disease was identified near the top of the diaphragm. The T1 weighted image (WI) was the low signal, the T2WI was the high signal, and no dilation was observed in the common bile duct ; furthermore, the portal vein was widened and the spleen volume was enlarged. The volume of the kidneys had increased to an abnormal shape, with multiple, long, roundish T1 and T2 abnormal signals were observed . MRCP revealed that the intrahepatic cystic lesions were connected to the intrahepatic bile ducts . In conclusion, CD, polycystic kidney disease, cirrhosis, portal hypertension, and splenomegaly were revealed.
+The patient’s venous blood samples were taken in July 2020 for genetic testing (whole exome sequencing, WES). The results revealed that the patient carried two heterozygous mutations in PKHD1: c.2854G > A, causing a change in amino acid P.(Gly952Arg), and in c.4682G > A, causing a change in amino acid P.(Cys1561Tyr).
+According to the imaging examinations and genetic testing, the patient was finally diagnosed with CD with concomitant ARPKD. In this state, the ongoing pregnancy would lead to higher risks for both the mother and fetus. Iron sucrose was infused to correct the iron-deficiency anemia. In addition, methylprednisolone succinate (20 mg) was prescribed to increase platelets, supplemented by stomach protection and calcium supplement supportive treatments. Cesarean section was performed after 36 weeks of pregnancy, the baby is normal after examination. Three months later in October 2020, the baby underwent a genetic test (WES), the result showed that the patient carried one heterozygous mutations in PKHD1: c.2854G > A, causing a change in amino acid P.(Gly952Arg), which indicated the baby was a PKHD1 carrier.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2497_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2497_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..23bfd6c7b546d60f9bb293af928744dce9d6c184
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2497_en.txt
@@ -0,0 +1,2 @@
+A 59-year-old Korean male with complaints of sudden metamorphopsia and reduced visual acuity for three days in the left eye was referred to our clinic. His past ophthalmological and other medical history was unremarkable except for hypertension.
+On examination, the best-corrected distance visual acuity (BCVA) was 20/20 in the right eye and 20/200 in the left eye. On slit-lamp examination, the cornea and conjunctiva were unremarkable, and there was no evidence of active inflammation in the anterior chamber or neovascularization in the iris. Fundus photography and fluorescein angiography showed BRVO in the left eye . Optical coherence tomography showed ME in the left eye . We performed intravitreal dexamethasone implantation and scatter laser photocoagulation in the left eye. The intravitreal dexamethasone implant injection was performed inferotemporally, 3.5 mm from the limbus. The implant was properly positioned in the vitreous chamber after the injection. One month after the intravitreal dexamethasone implantation, a decrease in the ME and an improvement of the BCVA to 20/40 was observed on left eye examination. Three months after the intravitreal dexamethasone implantation, recurrence of the ME and deterioration of the BCVA to 20/200 was observed on left eye examination. Therefore, we performed the second intravitreal dexamethasone implantation in the left eye in the same manner. One month after the second intravitreal dexamethasone implantation, the ME improved and the BCVA was 20/60 in the left eye. The ME recurred and the BCVA was 20/200 about four months after the second intravitreal injection. Therefore, we performed the third intravitreal dexamethasone implantation in the left eye in the same manner. Every intravitreal injections and the consequent follow-up examinations were performed by an experienced, single vitreoretinal specialist. On every follow-up examinations performed a day after the three dexamethasone implantations, the implant was positioned properly in the vitreous chamber, away from the crystalline lens. On slit-lamp examination performed one week after the third injection, grade 1 posterior subcapsular opacity was observed and the IOP was 42 mmHg by Goldmann applanation tonometer; however, there was improvement in the ME and the BCVA was 20/100. He was treated with oral acetazolamide, topical dorzolamide/timolol, and topical bimatoprost in the left eye. His IOP decreased to 18 mmHg in the left eye. He was discharged and prescribed topical dorzolamide/timolol and topical bimatoprost in the left eye and oral acetazolamide 10 mg/kg three times a day. Three weeks after the treatment, on slit-lamp examination, we observed that the posterior subcapsular cataract had progressed to mature stage ; anterior chamber was shallower than that observed in the previous examination. The IOP was 18 mmHg and the BCVA was reduced to hand motion in the left eye. Phacoemulsification and the consequent posterior chamber intraocular lens implantation was performed to treat the mature cataract, and intravitreal ranibizumab was performed in order to decrease the remnant ME in the left eye. The procedure was uneventful. His BCVA in the left eye was 20/60 one week after the procedure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2510_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2510_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6365ca289d00926eb7568b1d026e7f6d4986cc0a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2510_en.txt
@@ -0,0 +1,7 @@
+A 15-year-old male (height, 159 cm; weight, 43 kg) presented to the emergency department with sudden severe central chest pain radiating to the left shoulder. His blood pressure was 83/56 mmHg, pulse 84 beats/minute, and body temperature 36.1°C. His cardiovascular physical examination was unremarkable, and no evidence of connective tissue disorder and vasculitis was apparent.
+He and his family history were unremarkable for cardiovascular disease, vasculitis, and connective tissue diseases including Marfan syndrome. He had undergone video-assisted thoracic surgery (VATS) for bilateral spontaneous pneumothorax 3 months before and for left pneumothorax 2 months before at the former hospital.
+The initial electrocardiogram (ECG) showed sinus tachycardia with ST-segment elevation in leads I, II, III, aVF, and V2 to V6 . Laboratory investigations showed an elevated white blood cell count at 25.0 × 109/L (normal value: 3.3–8.6 × 109/L) and a normal level of C-reactive protein at 0.1 mg/L (normal value: 0.0–1.4 mg/L). Creatine kinase (CK), CKMB, and troponin I were within normal limits at 75 U/L (normal value: 59–248 U/L), 17 U/L (normal value: 0–20 U/L), 0.01 ng/mL (normal value: 0.00–0.09 ng/mL), respectively. Chest X-ray revealed a slightly enlarged cardiac silhouette . Contrast-enhanced computed tomography (CT) revealed significant pericardial effusion of which Hounsfield unit was approximately 50 HU, suggesting that it might be high protein fluid or bloody. There was no evidence of pulmonary embolism or aortic dissection. Transthoracic echocardiogram revealed a large pericardial effusion with normal left ventricular size and function with an ejection fraction of 68% (Videos 1 and 2).
+Based on the clinical history and the ECG findings, our working diagnosis was pericarditis of unknown origin. The differential diagnosis included infectious pericarditis (viral or tubercular) and non-infectious pericarditis (autoimmune or autoinflammatory diseases, pericardial injury syndromes, and malignancies).
+We managed him with a conservative strategy, including treatment with ibuprofen. On the third day after admission, echocardiogram showed decreasing pericardial effusion and ECG showed improvement of ST elevation. Laboratory investigations for bacteria, Mycobacterium tuberculosis, and collagen vascular diseases were negative. His course was carefully monitored because he was young and had near-fatal event. On the morning of the day 12, we confirmed that the pericardial effusion had decreased. On hospital day 13, he experienced sudden severe chest pain after vomiting, became diaphoretic, and developed cardiogenic shock. An echocardiogram revealed the pericardial effusion to have increased to > 30 mm with tamponade physiology. He underwent emergent pericardiocentesis and drainage of 300 mL of blood (haemoglobin of the fluid was 12.8 g/dL). Bacterial cultures and cytology were negative. A full body 18F-fluorodeoxyglucose (FDG) positive emission tomography scan for detecting malignancies revealed no significant FDG uptake. Coronary angiography showed a 2 mm saccular-shaped pseudoaneurysm in the posterolateral (PL) branch of right coronary artery (RCA) (Video 3). We recognized that rupture of the coronary pseudoaneurysm caused the acute haemopericardium. Based on his past medical history, we speculated that the coronary pseudoaneurysm was caused by trauma associated with prior procedures for pneumothoraces.
+We treated the coronary pseudoaneurysm by percutaneous management with coil embolization. The procedure was performed via the right femoral artery approach. Using Runthrough NS floppy (Terumo, Tokyo, Japan) guidewire with Heartrail II JR3.5 catheter (Terumo, Tokyo, Japan), the guidewire and Excelsior SL-10 (Stryker Neurovascular, Fremont, CA, USA) microcatheter were successfully inserted to the PL branch of RCA (, ). One detachable coil; 2 mm × 8 mm Trufill DCS Orbit® (Codman Neurovascular, Raynham, MA, USA) was delivered through a microcatheter (, ). A final angiogram showed obliteration of blood flow to the pseudoaneurysm (, ).
+The patient experienced chest pain for 1 day after the procedure, although post-procedural echocardiogram did not show any abnormality (, and ). He had no symptoms on the second post-procedural day. Post-procedural electrocrdiogram showed inverted T waves in leads III, aVF . He was discharged 12 days after the procedure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2520_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2520_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..22c1f16716f942f0386019cfe8217dead405ec4b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2520_en.txt
@@ -0,0 +1,10 @@
+Our patient was a 20-year-old woman with a history of a sacral mass diagnosed by CT-guided needle biopsy 7 years before as benign fibrohistiocytoma. A repeat biopsy of her lesion through an open approach revealed myofibroblastic sarcoma. Consideration was given for reduction of tumor burden and lumbopelvic reconstruction to facilitate long-term progression-free survival and to improve quality of life, respectively.
+The extension of tumor into both sacroiliac joints prohibited sparing S1; thus, a two-staged total sacrectomy was planned, as previously described. Briefly, the first stage of the procedure included a midline laparotomy, mobilization of the visceral and neural structures, and ligation of the internal iliac vessels. A colostomy was performed, and a right vertical rectus abdominus myocutaneous flap based on the inferior epigastric vessels was mobilized, wrapped in a bowel bag, and placed in the pelvis. The second stage was performed the next day, and it included L5 and S1 laminectomies, bilateral osteotomies and disarticulation of the sacrum from the ilium at the sacroiliac joints, ligation of the thecal sac inferior to the takeoff of the L5 nerve roots, complete L5–S1 discectomy, and transection of the S1–S5 nerve roots. The entire sacrum, along with the tumor, was removed piecemeal. This was followed by lumbopelvic reconstruction with spinal instrumentation and bone graft.
+The patient underwent a long inpatient postoperative course. She responded well to intensive physical rehabilitation. Her postoperative course was complicated by the development of a small superficial soft tissue Staphylococcus epidermidis abscess in the operative bed treated with percutaneous drainage and a full course of intravenous and oral antibiotics. The patient also developed a small ischial decubitus ulcer, remote from the surgical incision, treated with local wound care. At 3 months after surgery, the patient was able to ambulate with the assistance of a walker. She had normal strength in her left leg, except for plantarflexion (S1). Her right leg was more impaired, with normal proximal strength but significant weakness in hip extension (L4 and L5), dorsiflexion (L4), extensor hallucis longus (L5), and plantarflexion (S1), suggesting sciatic nerve injury. She was discharged home and was pain-free off narcotics.
+At 5 years after surgery, the patient remains pain-free. She was able to ambulate independently with a right ankle-foot orthosis. There was no evidence of locally progressive or metastatic disease on follow-up imaging. Postoperative imaging showed settling and a stable fibrous pseudoarthrosis .
+The patient’s first pregnancy was unbeknownst to us during a period of follow-up loss after sacrectomy. However, she gave birth to a healthy 5-lb, 2-oz baby girl through a cesarean delivery at 37 weeks’ gestation by a community obstetrician. There were no birth complications. The baby, now 3½ years old, is meeting developmental milestones.
+The Baylor Maternal-Fetal Medicine Service at Texas Children’s Pavilion for Women followed her second pregnancy closely. Frequent visits every 2 to 3 weeks were scheduled to monitor maternal status (e.g., weight gain and blood pressure). The pregnancy was carefully documented with monthly fetal ultrasound and MRI . At each outpatient visit, catheterization was performed to send urine culture, and the patient was on Keflex suppression throughout the pregnancy. Routine prenatal labs were obtained, and routine vaccines were administered. A repeat elective cesarean was performed at 37 weeks of gestation. Great care was taken to identify the right inferior epigastric vessels, the pedicle of the rectus abdominis musculocutaneous flap used for closure of the sacral defect . Plastic surgery was available at the time of delivery, but the right rectus abdominis muscle flap was not seen and was assumed to be posterior to the uterus. A healthy baby girl was delivered . The birth weight was recorded as 6 lb and 9 oz. Apgar scores of 8 and 9 were assigned at 1 and 5 min, respectively.
+Table summarizes the patient history in timeline format.
+Prior to the patient’s second pregnancy, we collected standardized and validated indices data to quantitate Health-Related Quality of Life (HRQoL) outcomes through the Oswestry Disability Index (ODI) and MOS Short Form 36 (SF-36).
+Our patient’s ODI score was 30 %, representing mild disability.
+SF-36 Physical Component Summary for our patient was calculated as 28.6 (national average, 53.5), and SF-36 Mental Component Summary was 52.9 (national average, 46.19). Our patient’s scores compared favorably in the domains of social functioning and mental health but were below the population norms across the remaining scales of physical functioning.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2534_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2534_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1f7ef27987e4b54b8c1c8ff1637d38d790ac4a8a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2534_en.txt
@@ -0,0 +1,10 @@
+A 49-year-old non-smoker female with known afibrinogenemia and antithrombin (AT) deficiency was admitted to the emergency room (ER) for acute substernal chest pain. She had a history of pyelonephritis, had received treatment for a multinodular goiter that had caused hypothyroidism, and also had congenital deafness. Her parents were consanguineous, and her father died from a surgically-induced pulmonary embolism. Her brother suffered from the same combined afibrinogenemia and AT deficiency. Her sister died from pulmonary embolism during her first pregnancy, at the age of 22, and had also suffered from AT deficiency yet with normal fibrinogen levels.
+Afibrinogenemia was diagnosed when the patient was 3 months old, following a trauma-induced intracranial hemorrhage. DNA sequencing, performed several years after the diagnosis, highlighted a homozygous (c.510 + 1G > T) substitution in the splicing site of the 4th intron of the fibrinogen alpha-chain. Routine coagulation test results revealed dramatically-prolonged activated partial thromboplastin time (aPTT) (>240 s) and a prothrombin time (PT) >120 s, with undetectable levels of either fibrinogen activity or antigen <0.1 g/L, and normal platelet count of 240.10 /L. Thrombin time and reptilase time were also significantly prolonged (>120 s; normal values below 20 s).
+The patient had a history of several severe thromboses and bleeding episodes. Her bleeding history started with intracranial bleeding induced by severe head trauma suffered at 3 months old, which was followed by several trauma-induced hematomas, spontaneous meningeal hemorrhage at 11 years old, intra-alveolar pulmonary hemorrhage at 23, menorrhagia, two episodes of hemoperitoneum induced by ruptured ovarian cysts, six first-trimester miscarriages due to severe hemorrhagic complications, and acute unprovoked cerebellar hemorrhage at 30 years old. Most of the bleeding episodes that occurred during her childhood and youth were treated with cryoprecipitate and fresh frozen plasma. She was shown to be hepatitis C antibody- and RNA-positive, with normal liver enzyme levels. The patient was taking several supplements for iron deficiency anemia due to heavy menstrual blood loss, and refused prophylaxis with fibrinogen concentrates, as they require regular intravenous infusions. Moreover, she was working in the traveling family circus with a lifestyle of “perpetual traveler”, rendering clinical follow-up very difficult.
+At the age of 30, she exhibited a spontaneous cerebellar hemorrhage and received her first replacement therapy with fibrinogen concentrates, after which she developed a proximal deep vein thrombosis (DVT) complicated by pulmonary embolism (PE) four days after the introduction of fibrinogen concentrate, while her plasma fibrinogen level was 1.2 g/L. The fibrinogen infusions were immediately stopped, and unfractionated heparin (UFH) was initiated. When her fibrinogen level dropped to <0.5 g/L, 24 h following withdrawal of the fibrinogen concentrate, fibrinogen replacement therapy was reinitiated, with a target plasma fibrinogen of 0.5–0.8 g/L, and UFH was concomitantly administered for a total duration of 6 weeks. No bleeding complications occurred, and her cerebellar bleeding was not aggravated during UFH therapy. The patient fully recovered from this episode.
+Two years later, at 32 years, she presented an acute coronary syndrome (ACS) with an ulcerated atheromatous plaque in the left anterior descending coronary artery. However, due to there being only a limited perfusion defect and no occlusion on coronary angiography, reperfusion therapy was not initiated given her high risk of bleeding. She had no cardiovascular risk factors, except for slightly-elevated cholesterol levels. A combined treatment of low molecular weight heparin (LMWH) and fibrinogen was prescribed. On replacement therapy, the patient exhibited bilateral calf DVT, which was treated with LMWH until complete resolution of the venous clots, achieved in 10 days. Following hospital discharge, the patient pursued a treatment at home consisting of 40 mg atorvastatin per day, with a target LDL cholesterol level < 1 g/L. No aspirin was prescribed for this patient due to her high bleeding risk. As several thromboses were reported in the patient’s family, and given the known AT deficiency of her sister, thrombophilia testing was then performed, revealing heterozygous antithrombin (AT) deficiency at 65% by means of chromogenic assay (Biophen AT anti-(h)-Xa LRT, Hyphen BioMed, Neuville sur Oise, France). The reference AT in adults ranges between 80 and 120%. Genetic sequencing revealed a point mutation L131F in the 2nd exon of the AT gene. As a result, this proved to be a very rare case of combined afibrinogenemia and AT deficiency. Plasma AT was therefore measured in her brother, confirming similar combined inherited AT and fibrinogen deficiencies.
+Thrombin generation was measured using Calibrated automated thrombin generation assay (Stago, les Asnières, France) in the presence of a low concentration of tissue factor 1pM, in accordance with the recent recommendations of the ISTH . Thrombin generation (TG) assay revealed the patent had a higher TG capacity compared to other afibrinogenemia patients . The area under the thrombin generation curve (ETP) representing the enzymatic activity of thrombin was very high (ETP = 2670 nM.min) in the patient, in accordance with her clinical history of thrombosis. AT deficiency was probably the main reason of the increased thrombin generation capacity in our patient. A slight TG decrease was observed following infusion of AT concentrate at 30 U/Kg . In light of these clinical and laboratory findings, we decided to normalize the patient’s AT level prior to any fibrinogen concentrate infusion, in an effort to reduce the risk of thrombosis related to replacement therapy.
+At 49 years old, the patient consulted at the ER for severe acute chest pain. Her blood pressure on admission was 87/57 mmHg, her heart rate 87 bpm, and her physical examination unremarkable. Upon admission, laboratory tests revealed increased alanine aminotransferase activity (50 U/L [normal: 3–26 U/L]) and aspartate aminotransferase (121 U/L [normal: 6–18 U/L). Her troponin-T level was dramatically increased (24,693 ng/L [normal: <20 ng/L]). Her C-reactive protein was 62.6 mg/L (normal <5 mg/lL). Routine coagulation tests showed activated partial thromboplastin time (aPTT) >240 s and prothrombin time (PT) >120 s. The patient’s plasma fibrinogen level was undetectable for both activity and antigen assays. The electrocardiogram (ECG) was normal. Non-ST-elevated myocardial infarction (NSTEMI) was suspected. Echocardiography confirmed the diagnosis and revealed an impaired ejection fraction of 45%, with akinesia in the anteroseptal, anteromedial, and apical segments. The CT coronary angiogram revealed 80% stenosis in the common trunk of the left coronary artery and 50% stenosis in the anterior interventricular branch of the left coronary artery . The right coronary artery and circumflex coronary artery were normal. A diagnosis of NSTEMI was established, and double coronary artery bypass surgery was scheduled.
+The surgery was performed, following replacement therapy with 30 U/Kg antithrombin concentrate (Aclotine®, LFB-Biomedicaments, Les Ulis, France) and 1.5 g fibrinogen (Clottafact®, LFB-Biomedicaments), along with UFH at the typical coronary bypass dosage. The surgery was successful, whilst carefully controlling the combined anticoagulant and procoagulant molecules. No excessive bleeding occurred. UFH was maintained for 3 weeks following surgery. Antithrombin and fibrinogen infusions were calculated following laboratory results with the aim of maintaining plasma AT >80% and fibrinogen between 0.5 and 1 g/L. All pro- and anti-coagulant treatments were discontinued 2 days before hospital discharge, on post-op Day 23. Two days after treatment withdrawal, the patient developed a segmental PE treated with LMWH in association with antithrombin and fibrinogen concentrates for 2 months, as described above.
+In this patient who had suffered two acute coronary heart attacks, secondary prophylaxis with 75 mg aspirin/day was recommended, combined with antithrombin and fibrinogen infusions administered at least once a week, in order to keep plasma fibrinogen >0.5 g/L. However, the patient refused fibrinogen and AT prophylaxis, for his would require weekly injections. Therefore, antithrombotic prophylaxis with antiplatelet therapy (APT) was not initiated.
+Five months later, the patient was admitted to the ER for spontaneous left upper limb monoplegia associated with left-sided facial paralysis, dysarthria, and left homonymous hemianopia. Cerebral computed tomography (CT) revealed multiple hypodense ischemic lesions in the right frontal and parietal lobes associated with a thrombus in the right internal carotid artery. Echocardiogram, Holter ECG, and supra-aortic branch evaluation using Doppler ultrasonography disclosed no additional lesions indicative of stroke. On admission, plasma fibrinogen was <0.1 g/L, and daily aspirin at 75 mg was initiated. No fibrinogen replacement therapy was prescribed, given her several previous VTE episodes following fibrinogen concentrate infusions. The follow-up CT, performed one week after starting aspirin, revealed an acute subdural hematoma (SDH) measuring 27 mm, probably induced by aspirin. As the patient was asymptomatic, aspirin was immediately discontinued, and she was administered antithrombin and fibrinogen concentrates twice a week for 4 months, resulting in significant regression of the SDH to 10 mm in its largest diameter. Eventually, she accepted long-term antithrombin and fibrinogen prophylaxis based on weekly infusions (30 U/Kg and 1.5 g, respectively), rendering anti-thrombotic prophylaxis with aspirin again possible, which was very carefully reintroduced at low doses of 75 mg, arbitrarily, administered every 3 days. Under prophylaxis, her fibrinogen trough levels were ≥0.3 g/L. The patient has not reported any breakthrough bleeds with the current prophylactic regimen. No recent thrombosis has occurred and follow-up cerebral CTs have shown that the SDH is remaining stable.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2545_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2545_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..396e5853da24393f52f7a1fca0e74831730364fc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2545_en.txt
@@ -0,0 +1,7 @@
+A 21-year-old Caucasian patient assigned male at birth presented with 2 days of severe rectal, abdominal, testicular pain, and loose stools. He reported history of hemorrhoids with intermittent bright red blood per rectum over 9 months. History was notable for prior appendectomy and allergies to penicillin (rash), pollen, and several raw fruits/vegetables. He took emtricitabine/tenofovir/disoproxil fumarate for HIV pre-exposure prophylaxis. He recently received prophylactic chlamydia treatment and one dose of the mpox vaccine series approximately 1 month prior to presentation. He was a student. He had a non-monogamous relationship with a male partner and reported receptive and insertive anal intercourse with inconsistent condom use and intermittent use of sex toys, including anal beads. He had recently traveled to Hawaii, California, Michigan, and Maine in the summer. Two years prior to presentation he had traveled to Japan. He had multiple pet dogs and cats. He reported having a younger sibling with lymphomatoid papulosis.
+In the emergency room, vital signs were normal. On examination, he had tender bilateral inguinal lymphadenopathy, mild right lateral testicular tenderness when palpated, and tenderness in the right lower abdominal quadrant and suprapubic region. No hemorrhoids or anal fissures were visualized. Initial workup included complete blood count remarkable for low platelet count of 125,000 cells/µL (reference: 150,000–420,000 cells/µL) and increased atypical lymphocytes at 3% (reference: 0–1%); white blood cell count was normal at 6000 cells/µL (reference: 3800–10,800 cells/µL). Computed tomography (CT) of the abdomen/pelvis showed mesorectal lymphadenopathy and rectal wall thickening with circumferential fat stranding consistent with acute proctitis, without abnormalities of the prostate, testicle, or epididymis. Basic metabolic panel, urinalysis, and throat/urine/rectal gonorrhea/chlamydia testing were normal. He received ketorolac for pain and was started on ceftriaxone/metronidazole/doxycycline prior to medical admission for further management of proctitis.
+He was promptly switched from ceftriaxone to ciprofloxacin after a scrotal/testicular ultrasound (performed 12 hours after the CT abdomen) confirmed left epididymitis. He was transitioned from ceftriaxone to ciprofloxacin to cover for Pseudomonas, which is a common bacterial organism that can be associated with epididymitis. On hospitalization day 2, metronidazole and doxycycline were discontinued, and acyclovir was started for empiric herpes simplex virus (HSV) coverage. Additional infectious workup was notable for detection of CMV on initial quantitative polymerase chain reaction (PCR) testing of the blood, albeit with quantitation < 137 IU/mL (reference: < 137 IU/mL). CMV immunoglobulin M (IgM) was negative, as were the following studies: Monospot testing, hepatitis panel (including hepatitis C antibody), treponemal antibody, rectal mpox/HSV/varicella zoster virus (VZV) PCRs, repeat gonorrhea/chlamydia (urine/rectal/throat), respiratory viral panel, serum HIV PCR, serum enterovirus and adenovirus PCRs, tick-borne serology panel, and urine mycoplasma/ureaplasma PCR. He had stool studies performed including Helicobacter pylori stool antigen, Clostridium difficile enzyme immunoassay, stool ova and parasites, stool pathogen PCR panel (Campylobacter, Salmonella, Shigella, Yersinia enterocolitica, Shiga Toxin 1 and 2, Vibrio), and stool Giardia antigen that were negative. Calprotectin had initially been sent due to concern for possible inflammatory bowel disease and was noted to be elevated to 1110 µg/g (reference: < 50 µg/g).
+Over a period of days, he also developed myalgias and arthralgias. Due to lack of improvement in rectal pain over a period of days, colorectal surgery and gastroenterology advised additional workup with colonoscopy. On hospital day 7, colonoscopy was remarkable for irregular ulcerations with exudate in the distal rectum, mild-to-moderate patchy erythema in the more proximal rectum, and mild mucosal edema in the sigmoid colon. Biopsies were taken from the terminal ileum, colon, and rectum and sent for tissue culture and pathology. Rectal pathology demonstrated findings consistent with CMV-associated proctitis . These findings included patchy inflammatory changes in the rectum with ulceration, ischemic-type changes, and prominent apoptosis within crypts. CMV inclusions were seen in the stroma and focal epithelial cells, and had positive CMV immunostaining. Colonic and ileal mucosa samples had no significant abnormalities and did not show findings of inflammatory bowel disease. Immunohistochemistry stains for Treponema spp. and HSV were negative.
+Valganciclovir was initiated for treatment of CMV proctitis; all other antibiotic/antiviral treatments were discontinued. Repeat Epstein–Barr virus (EBV)/CMV quantitative viral load testing and serologies were sent. The EBV serum panel result was consistent with prior infection. The initial CMV IgG was mildly positive at 0.28 U/mL (reference: < 0.20 U/mL). Add-on studies from hospital day 4 showed that CMV IgG had been negative (reference: < 0.20 U/mL), while CMV IgM had become positive at 70.60 AU/mL (reference: < 8 AU/mL) . On hospital day 10, CMV IgG and IgM were both positive at 1.4 U/mL (reference: < 0.20 U/mL) and > 240 AU/mL (reference: < 8 AU/mL), respectively. Given the evolution in serology with rising CMV IgM titers and development of positive IgG over time, the clinical presentation was thought to be consistent with acute primary CMV infection. A T lymphocyte subset panel was also sent to determine CD4 count and evaluate for possible undiagnosed immunodeficiency. He had a low-normal CD4 count of 513 cells/µL (reference: 490–1740 cells/µL), elevated CD8 count of 1867 cells/µL (reference: 153–980 cells/µL), and a low CD4/CD8 ratio at 0.27 (reference: 0.73–5.86). A decreased CD4/CD8 ratio can be seen with viral infections, including CMV infection.
+The hospital course was also complicated by mildly elevated liver transaminases that trended upward to peak of 189 U/L (reference: 10–35 U/L), prior to discharge on day 14. CT of the abdomen and pelvis with intravenous contrast had not shown any hepatobiliary pathology, and a viral hepatitis panel was negative. The transaminitis was ultimately attributed to CMV infection.
+The patient was discharged with a 3-week course of valganciclovir and recommended to follow-up with primary care, infectious diseases, and immunology physicians. He was counseled to abstain from sexual intercourse until treatment completion. At a follow-up visit with the infectious diseases physician 3 weeks later, the patient had significantly improved with near complete abatement of rectal and testicular pain, myalgias, and arthralgias. Repeat liver function tests 2 weeks post-hospital discharge were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2550_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2550_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a6f9aebcc9d461e54ce457f90ae50f5857ed04a2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2550_en.txt
@@ -0,0 +1,5 @@
+A 55-year-old male patient, who present to our hospital in August 2021, because of repeated infection at multiple incisions for more than 1 year after laparoscopic cholecystectomy surgery done for gallstone complicated with cholangitis. On examination, the incisions under the xiphoid process were red and swollen, the incisions were dehiscent, local tenderness, high skin temperature and a little suppuration .
+The patient had multiple incisions infections and repeated purulent exudates after surgery, with an average recurrence about 25 days, but the blood routine results shown no abnormality. According to the B-ultrasound results , considering the formation of sinus tract under xiphoid process. In September 2021, laparoscopic re-surgery and abdominal exploration were performed, the sinus trace was cut and drainage of abscess. Then given piperacillin sodium and tazobactam sodium anti-infection treatment, but the effect was still poor after a period of time. We discovered the surgical incisions still were not healing, the skin surrounding the incisions was red, swollen and painful, and suppuration was present .
+Since admission, the patient's body temperature and blood routine results were normal . Additionally, regular bacterial culture and acid-fast bacillus (AFB) staining were negative, but blood samples for the tubercle bacillus antibody (TB-Ab) test were positive. Combined with the patient's chest CT , tuberculosis related examination and the patient's clinical symptoms, they did not support tuberculosis-related diseases. In order to further resolve the question and determine the pathogens, the mategenomic sequencing technology covering the pathogen is used to accurately identify pathogens.
+On November 29, 2021, the tissue from the incisions of the patient was sampled for DNA metagenomic next-generation sequencing (mNGS) (KingMed Diagnostics, Changsha, China). It detected 53 sequences that could be mapped to M. senegalense in a total of 113 sequences, and the coverage was 0.09%, making up 58.76% of the total microbe sequences . Targeted PCR of M. senegalense using two pairs of primers was applied: 16S RNA forward 5′-AGCGGCGGAGCATGTGGATTA-3′, reverse 5′-GCTGATCTGCGATTACTAGCGACTC-3′ (GenBank: ); rpoB forward 5′-TGCGTGCCATCTTCGGTGAGA-3′, reverse 5′-GTCGATGTTCCAGCCTGCCTTG-3′ (GenBank: ). The primers were designed and verified using Primer-BLAST based on the reference genome sequence of M. senegalense in NCBI. Subsequently, the capillary electrophoresis technique (Qsep 100TM; Bioptic) also curtained the M. senegalense infection .
+According to the results, the patient was initiated with oral clarithromycin (500 mg, twice daily), moxifloxacin (400 mg, once daily), rifampicin (450 mg, once daily) and doxycycline (100 mg, once every 12 hours). Then the swelling gradually subsided and there was no obvious purulent exudation. After 20 days, the patient's incisions healed well, and there was no sign of recurrence in the 60th day after quadruple therapy .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2564_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2564_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9ff7d9adc5992bf42a6d51357db3a95605d241a9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2564_en.txt
@@ -0,0 +1,3 @@
+An 8-year-old male with a history of autism spectrum disorder presented to our hospital with idiopathic right posterior neck pain and torticollis. The patient had no sign of infection around the neck or neurological disorders, such as numbness or muscle weakness. The ADI was 3.6 mm in the plain lateral radiograph of the cervical spine . Plain computed tomography (CT) showed that the atlas was rotated 32° to the right relative to the axis . The patient was diagnosed with AARF type II according to the Fielding classification, and Glisson traction therapy was initiated. After 26 days of Glisson traction, magnetic resonance imaging (MRI) was performed, which revealed a C1–2 rotation of 19°. Reduction under general anesthesia was performed; however, the procedure was complicated by soft tissue tension associated with the chronic nature of the condition. After reduction, the rotation angle of C1–2 was 15° and was not sufficiently improved. Therefore, Glisson traction was continued for an additional 3 weeks. An MRI scan after 3 weeks of Glisson traction revealed an improved rotation angle for C1–2 of 11° , preserved atlantoaxial distance, and no signs of cervical canal stenosis. By the end of the 3-week Glisson traction, 3 months had passed since AARF onset. The patient was discharged with a neck collar and rehabilitated at an outpatient clinic. Although there were no traumatic episodes, a plain lateral radiograph of the cervical spine taken 2 months after discharge showed that the ADI had increased to 8.9 mm. MRI revealed mild spinal cord compression at the C1 level, and the patient was diagnosed with ASS .
+Since the rotation angle of C1–2 improved to 5° on CT, the AARF appeared to be improving; unfortunately, atlantoaxial instability was present . Considering the risk of fatal complications due to progressive dislocation, posterior cervical fusion was performed. After wearing the halo vest, the patient’s ADI was 4.3 mm. C1–2 fusion was performed using C1 lateral mass screw and C2 pars screw and connected to the rod in situ .
+Post-operative CT revealed improved spinal canal stenosis and he was discharged 8 days post-operatively. In the 6 months since the operation, the patient has progressed well.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2567_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2567_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..21f1377513cae5b026022b8b1716881c55833011
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2567_en.txt
@@ -0,0 +1,6 @@
+In September 2014, an 18-year-old, non-smoking male was diagnosed with an open fracture of the right tibia, Gustilo’s classification grade IIIB following a traffic accident. The patient weighed 65 kg. Emergency debridement was performed at the local hospital following injury . The fracture and wound had not healed 3 months after injury. Copious pus was drained and the patient was transferred The Second People’s Hospital of Yunnan for further treatment.
+The patient was admitted to The Second People’s Hospital of Yunnan 97 days after the injury. A physical examination of the patient’s right calf revealed a soft tissue defect and exposed tibia. A 4 × 10 cm incision was observed on the anterior medial side of the upper calf and a 3 × 12 cm-sized wound was seen on the anterior medial side of the lower leg. Significant foot drop was observed. The patient experienced hypoesthesia on the lateral side of right calf and the dorsal surface of the foot; however, normal sensation was felt on the plantar surface of the foot and the dorsalis pedis artery appeared normal. The range of motion of the knee was 0–80°, and ankle extension and flexion were 10 and 20°, respectively. Level III myodynamia was observed in the pretibial muscle and the triceps surae .
+Following discussion with the patient, a limb salvage protocol was adopted in favor of amputation. The treatment plan consisted of two stages. The first step was to treat the infection by performing repeated debridement, replacing the external fixation, vacuum sealing drainage (VSD) and local and systemic application of antibiotics. In the second stage, the bone transport technique was used to repair the bone defect, and rehabilitation exercise was performed to restore the function of the affected limb as much as possible. The patient was informed about the treatment plan and the associated risks. A series of examinations were performed to assess the tibial infection. An X-ray revealed necrosis and hyperplasia in the middle of tibia . Single-photon emission computed tomography showed radionucleotide accumulation in the midtibial region and computed tomography angiography confirmed that the anterior and posterior tibial arteries were normal. Laboratory investigations were as follows: i) C-reactive protein, 21.6 mg/l: ii) erythrocyte sedimentation rate, 35 mm/h; iii) white blood cell count, 16.47 × 109/l; and iv) Neutrophil percentage, 84.51[50–70]. The final diagnosis was an infected right tibial nonunion with a soft tissue defect.
+Debridement to completely remove the infected and devitalized bone, inflammatory and scar tissue was performed on the second day after admission . The debrided bone was replaced with a three-segment monolateral external fixator (Third Medical Instrument Company; Fig. ) followed by the implantation of vancomycin-impregnated cement beads (4 g vancomycin and 80 g cement) in the bone defects . The wound was partially closed and the dressing was changed regularly following surgery. The second debridement was performed 5 days after the initial procedure and involved the removal of inflammatory tissue and the antibiotic beads. VSD was used to cover the wound and to promote the growth of granulation tissue while simultaneously draining pus. The third debridement was performed 5 days after the second procedure, and involved the removal of the VSD. The wound appeared clean and was subsequently sutured. At this point, the bone defect measured 25 cm in length. Antibiotic sensitivity testing was performed following each of the three debridement procedures and Methicillin-resistant Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis were identified. Vancomycin and meropenem through the veins were used to treat the infection. Wound healing and infection control marked the end of the first stage of the treatment plan.
+The repair of the massive bone defect posed the biggest challenge during the second stage of the treatment plan. As bone transfer technology has a number of advantages, this technique was applied. Wound healing and infection control were assessed through relevant indicators and when satisfactory, a single osteotomy was performed 2 cm away from the ankle joint surface . Bone transport was initiated 1 week later at a rate of 1 mm per day (0.25 mm four times a day). The quality of the newly formed bone was assessed 2, 4 and 6 months after osteotomy using X-rays , which revealed satisfactory osteogenesis was occurring. A total of 15 months after osteotomy, the distracted bone had reached docking site, which resulted in skin invagination and axis deviation . The embedded soft tissue was removed and the axis was adjusted. To promote docking site union, the external fixation was loosened and increasing load across the site of osteogenesis were gradually added. The total length of transport was 24.5 cm. After 40 months, union was achieved and the consolidation of the newly formed bone was complete . The patient exhibited the following range of motion: i) Knee extension, 0°; ii) knee flexion, 110°; iii) ankle extension, 10°; and iv) knee flexion, 10° . A knee valgus deformity angle of 4° and a 10 mm shortening of the tibia were observed. The bone healing index was 1.6 months/cm. When the bone and soft tissue wound have healed, the patient was able to walk painlessly without ambulatory assistive devices and resumed daily activities successfully. The ASAMI was used to assess the limb function and bone healing, and revealed a good functional and bone repair result. Similarly, the KSS of functional outcome yielded good result and the LEFS was 65.
+Eighteen months after the bone and soft tissue wound have healed, we performed a follow-up evaluation with Short Form-36 (SF-36) score and LEFS (Additional files , and ). The SF-36 score was 86, and the LEFS was 70. The overall treatment progress is briefly presented in Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2573_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2573_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e56ca40805e73591dd21392b95547db2f90fb808
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2573_en.txt
@@ -0,0 +1,3 @@
+An 87-year-old female patient with no history of diabetes or other conditions causing blood glucose abnormalities was brought to our emergency department due to an acutely altered mental state after a few-week course of headaches and decreased left vision. Notably, 2 months before admission, she was incidentally found to have a sellar mass . Initial workup revealed severe hypoglycemia (17 mg/dL), and the administration of glucose restored consciousness. Given the mild hyponatremia (131 mEq/L), relatively low levels of serum cortisol (13.3 μg/dL) and adrenocorticotropic hormone (39.7 pg/mL) despite the acute sick condition, as well as a known history of sellar mass, central adrenal insufficiency was suspected, and the patient was initiated on hydrocortisone. Further, the endocrinological evaluation revealed hypothyroidism (thyroid-stimulating hormone level, 0.36 μIU/mL; free T4 level, 0.58 ng/dL; and free T3 level, 1.5 pg/mL). Her visual field was significantly narrowed, with mildly decreased visual acuity (20/200) on the left side, although these deteriorations were deemed to be attributable to glaucoma rather than the mass, considering the mild compression of the optic apparatus as well as the atypical pattern of visual field disturbance. Given her senility, she and her family initially refused surgical intervention and imaging surveillance with cortisol replacement was initiated. Two months later, however, she complained of rapid deterioration of her left eye vision and loss of light perception. Repeat magnetic resonance imaging (MRI) revealed rapid mass growth [ and ]. Imaging studies demonstrated a T1-isointense, T2-hyperintense, heterogeneously enhanced, and irregularly shaped mass with restricted diffusion in the sellar and suprasellar regions [-]. Marked bony erosion of the posterior clinoid process and dorsum sellae was noted . On 18fluorodeoxyglucose positron-emission tomography, the mass exhibited a maximum standardized uptake value of 6.2 . After a thorough discussion with the patient and her family, we decided to proceed with the surgery.
+During surgery, a transnasal corridor was created using endoscopic visualization. The mass had destroyed the sellar floor. After opening the dura in a U-shaped fashion, the mass was piecemeal removed. It was soft, grayish, and gelatinous, compressing the normal pituitary gland to the left and invading the right cavernous sinus . Notably, the bony dorsum sellae was absent, and the sellar side of the dural membrane was almost completely torn by the mass . A bony prominence was observed on the left side of the sellar floor , which also lost its covering dura. The bony prominence was removed using a high-speed drill to access the tumor behind it. Finally, the suprasellar mass was removed while preserving the surrounding dural membrane and diaphragm. Although intraoperative cerebrospinal fluid leakage was not apparent, we decided to reinforce the diaphragm in a multilayered fashion since the diaphragm was already thin, and we were considering postoperative radiotherapy for this patient. The sellar defects were reconstructed using in- and on-lay fascial grafts with abdominal fat pieces. The dura covering the dorsum sellae was sutured with a 4–0 STRATAFIX Spiral (Ethicon, Johnson and Johnson, NJ, US) in a non-watertight fashion and was covered with pedicled sphenoid mucosa.
+Postoperative imaging revealed no residual masses [ and b]. Her visual acuity improved significantly (20/40). Histological examination revealed the presence of physaliphorous cells with a background of myxoid stroma and positive immunostaining for brachyury , leading to a diagnosis of conventional chordoma. Although the Ki-67 index was not extremely high (3%), the patient was treated with upfront adjuvant stereotactic radiosurgery (20 Gy in a single fraction), given the previous rapid progression and possible minor tumor remnants around the right carotid artery. She has been free from tumor progression for 12 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2578_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2578_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f93c16762edf707073509b92b50260635714f269
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2578_en.txt
@@ -0,0 +1,3 @@
+A 45-year-old male presented with cough for more than two months without obvious cause in August 2022. He claimed no other notable symptoms, and no evident abnormality was found in the laboratory blood test. Thus, infectious diseases were preliminarily excluded. For further examination, a chest CT scan showed that there were multiple nodules in both lungs with enlarged hilar lymph nodes, and multiple filling defects in both pulmonary arteries, consistent with pulmonary thromboembolism It was considered as tumor metastasis. An abdominal CT was performed for further evaluation. It showed an enlarged heterogeneous left renal mass almost completely replacing the left kidney (size 12.2 cm*9.7 cm), with mild perirenal fluid and fat stranding. There was associated tumor thrombus present in the left renal vein, along with enlarged metastatic retroperitoneal lymph nodes. The patient had a history of hypertension and diabetes, which were under well control with regular medication, and had no history of other diseases or surgery.
+The patient underwent lung and kidney percutaneous core needle biopsy and the histological manifestations and immunochemistry (IHC) findings of the two samples are similar. Microscopically, the tumor cells were small to medium sized round or oval cells with poor adhesion. The cytoplasm was eosinophilic but scant, and the nucleoli were prominent with rough chromatin. The mitotic rate was high (> 10 mitotic figures per 10 high power field). Most of the tumor cells were organized in a solid sheets pattern. Large aeras of necrosis and partial myxoid stromal changes were observed . And in some aeras, the tumor cells were distributed around the open thin-walled vessels. Immunohistochemically, the tumor cells were focal positive for CD99 ; multifocal positive for WT1 with unequal strength, BRG1, focal weak positive for AE1/AE3 and diffuse positive for GATA3 , whereas S-100, Synaptophysin, Vimentin, CK7, PAX8 and TTF-1 were negative. The Ki67 proliferation index was high (> 80%). The fluorescence in situ hybridization (FISH) assay showed separated red and green signals or single red signals seen in the nuclei of 30% of tumor cells, suggesting the existence of CIC gene translocation . Moreover, the next generation sequencing (NGS) assay confirmed the existence of a fusion of CIC-LEUTX genes. The breakpoints were at chr19: 42799274 and chr19: 40276608 for CIC and LEUTX, respectively .
+The patient received chemotherapy (paclitaxel + carboplatin) and immunotherapy(pabolizumab). However, brain metastases were found 2 months after diagnosis. Due to the rapid progression, a new chemotherapy regimen (Doxorubicin + vincristine + cyclophosphamide) and radiotherapy was applied. Unfortunately, treatment was not effective enough and the patient passed away 7 months after diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2580_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2580_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7bdbae6f7f19fa053d2e2432f67ea4e153bebdbb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2580_en.txt
@@ -0,0 +1,3 @@
+A 54-year-old Thai man presented with low back pain lasting for 2 months. The symptom was gradually progressive and was aggravated by movements. The pain was referred to both legs and did not improve with medications. Later, the patient experienced weakness and numbness in his right leg and had walking difficulties. In addition, he had urinary retention which required urinary catheterization. The patient's symptoms worsened and limited his daily activities. Examination revealed generalized erythematous plaques on his head, trunk, back, and extremities. He also had several flaccid blisters. The patient had grade III motor weakness and paresthesia in his entire right leg; however, there was minimal motor weakness on the left side. Sacral sensation and sphincter tone were intact. Magnetic resonance imaging (MRI) of the lumbar spine showed a pattern of arachnoiditis at the L1-5 level. There were also multiple hypersignal intensity bead-like lesions on T2-weighted images in the spinal canal of the L4-5 vertebral level. The lesions were not enhanced with contrast . Laminectomy in the L4-5 with lesionectomy was performed because we considered a spinal infection resulting in the recent neurological deficits. During surgery, we observed that the nerve roots were severely clumped together and had arachnoid adhesion. The lesions were found to be multiple tapeworms between the nerve roots and were completely removed with partial lysis of the adhesions under nerve root monitoring . Microscopic examination demonstrated the presence of spargana with thick outer eosinophilic teguments and inner calcospherites . Therefore, spinal sparganosis was diagnosed.
+The patient was a monk on pilgrimage and had ingested uncooked frogs, snakes, and other amphibians for 10 years. The year prior to his visit he was diagnosed with bullous pemphigoid and was on high-dose prednisolone since then. Further investigation was done to rule out potentially disseminated sparganosis. In addition, the patient had a history of epilepsy, which was neither investigated nor treated. Although brain MRI indicated cerebral atrophy with surrounding hypersignal intensity in the left parieto-occipital area on T2-weighted images, which is compatible with old inflammation, there was no evidence of the live parasite in the brain . An ocular examination by an ophthalmologist indicated the presence of an abnormal cystic, worm-like mass with calcification in the right conjunctiva. This was considered a nonactive lesion. However, we did not perform an enzyme-linked immunosorbent assay (ELISA) for sparganum or a cerebrospinal fluid (CSF) study. A stool examination revealed no evidence of parasite infection.
+In the early postoperative period, the patient still had severe back pain; however, this improved during follow-up after a few months. Radicular pain, and weakness were also improved; however, neurological function of the urinary bladder was still deficit.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2582_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2582_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a9c06464fd2b1e90659c228103f5c49c86d5aade
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2582_en.txt
@@ -0,0 +1,5 @@
+A 46-year-old female patient was previously diagnosed with breast cancer (right breast, cT2N1M0 Stage IIB, invasive ductal carcinoma, ER-positive, HER2-positive) at the age of 44. After initially completing preoperative chemotherapy (anthracycline and taxane plus anti-HER2 therapy), the patient underwent curative surgery. The final pathological diagnosis was pathological complete response (ypT0N0). Adjuvant treatment of 10-year TAM concomitantly with 1-year trastuzumab was planned. There was no previous or family history of cardiac disease, and no abnormal findings on cardiac function evaluated after surgery. The patient had a history of hepatitis C and was treated with antiviral agents (sofosbuvir and ribavirin) for 12 weeks resulting in a sustained virological response (SVR).
+Two months after starting TAM and resuming trastuzumab, the patient visited her general physician with a complaint of fever and dyspnea. Blood tests showed a marked increase in hepatic enzymes, and the patient was rushed to our emergency room on suspicion of drug-induced liver injury. Upon arrival at the hospital, the patient was conscious, temperature was 36.6 °C, blood pressure was 110/70 mmHg, pulse was 80 bpm, respiratory rate was 20 breaths/min, and SpO2 was 99% (in-room air). Blood tests revealed elevated hepatic enzymes, decreased coagulability, thrombocytopenia and marked metabolic acidosis. Table A shows the blood test findings at the time of the emergency room visit. The patient was observed in the emergency room with bed rest and intravenous fluids, while the hospitalization process was underway based on the initial diagnosis of drug-induced fulminant hepatitis caused by TAM. During this time, tachycardia (140 beats/min) with ST-segment elevation appeared on the monitored electrocardiogram (ECG), and the ECG indicated anterior wall myocardial ischemia and third-degree atrioventricular block. Shortly thereafter, the patient went into cardiac arrest. Approximately 24 h had passed since the initial visit to her general physician. Resuscitation was started immediately, and because acute coronary syndrome was suspected, the patient was moved to the cardiac angiography room, where tracheal intubation, intra-aortic balloon pumping, and extracorporeal membrane oxygenation (V-A ECMO) were started.
+Coronary angiography (CAG) results were negative for ischemic heart disease. A diagnosis of fulminant myocarditis was made based on the pathophysiology and a myocardial biopsy was performed. Blood tests at the time showed CK 761 (U/μL), CK-MB 24 (U/μL), troponin T 1010 (ng/mL) and proBNP 7204 (pg/mL), with a significant increase in myocardial enzymes . Steroid pulse therapy (methylprednisolone 1000 mg × 5 days) and immunoglobulin therapy (1.0 g/day × 2 days) were started immediately after admission. Details of the main treatment after cardiac arrest are shown in Fig. . After the start of treatment, the symptoms of heart failure improved steadily and the patient was transferred to a general ward on the 14th day before being discharged on the 28th day.
+Histological findings of the myocardial biopsy taken at the time of CAG are shown in Fig. . Within the myocardial tissue, degeneration and necrosis of myocardial cells were observed with marked lymphocytic infiltration. There was no infiltration of eosinophils or multinucleated giant cells. The infiltrating lymphocytes were predominantly CD8-positive T cells, a finding consistent with the histology of lymphocytic myocarditis. Serum cytomegalovirus, coxsackie B virus and adenovirus antibodies were elevated eightfold, fourfold and fourfold (based on complement fixation test), respectively. Taken together, these findings were consistent with acute viral myocarditis. HCV–RNA was tested before steroid administration and RNA was not detected.
+After intensive care, despite the improvement in symptoms of heart failure, the patient’s heart rate remained at 20–30 bpm. Hence, a permanent pacemaker was inserted and the patient was discharged on the 28th day. After discharge from the hospital, an attempt was made to remove the pacemaker, but bradyarrhythmia remained, thus the pacemaker was retained and remains to date. Ten months have passed, since the TAM was recommenced, and the patient remains on a good course with no elevation of liver enzymes or any findings that suggest recurrence of breast cancer.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2587_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2587_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2f30c77964eb8581325bd556e643a6f9b8ce721e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2587_en.txt
@@ -0,0 +1,7 @@
+An 81-year-old man presented to the emergency department complaining of epigastric pain and tarry stool passage that lasted for 3 d.
+Of 3 d prior to admission, the patient developed epigastric pain and tarry stool passage. Because of progressive symptoms, he was brought to the emergency department of our hospital.
+Prior to this incident, he was admitted to the hospital three times in 6 mo due to acute cardiopulmonary distress. The first admission was for lung fibrosis exacerbated by pneumonia, pleural effusion, and congestive heart failure, with an ejection fraction of 25%; the second admission occurred 2 mo later for pulmonary edema; and the third admission occurred in the following month as a result of coronary artery disease (CAD) accompanied by cardiogenic shock and acute pulmonary congestion. His CAD was treated using percutaneous transluminal coronary angioplasty with the initiation of antiplatelet therapy.
+No remarkable history.
+The patient presented with slight hypotension without tachycardia or fever (blood pressure, 92/60 mmHg; pulse rate, 62 bpm; body temperature, 36.9 °C). The patient appeared mild confused with limited activity due to general weakness. Mild abdominal distension with poor appetite was complained, but no dizziness, shortness of breath, chest tightness, abdominal pain or decreased urine amount was noticed. Further physical examination revealed a soft abdomen without obvious point tenderness, muscle guarding or rebounding pain. He was not pale nor icteric.
+Laboratory tests indicated leukocytosis with left shift (white blood cell count, 10600/μL; segment, 73.3%), direct bilirubinemia (direct bilirubin, 0.7 mg/dL; total bilirubin, 1.6 mg/dL) and elevated liver enzyme levels (alanine aminotransferase, 648 IU/L; aspartate aminotransferase, 130 IU/L); anemia, thrombocytopenia, renal insufficiency, and electrolyte imbalance were not detected. Virology tests also confirmed the absence of hepatitis B or C viral infection.
+The patient was then admitted to a gastroenterology ward owing to suspicion of cholecystitis and upper gastrointestinal bleeding. Abdominal ultrasound revealed the presence of gallbladder sludge. An abdominal computed tomography (CT) scan with contrast was performed the next afternoon; the scan revealed an enhancing pseudoaneurysm of the cystic artery with high-density material in the gallbladder and common bile duct (CBD) and mild dilatation of the bilateral intrahepatic duct (IHD) and CBD .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2616_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2616_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..09b4d7ed075683b86f24119409e19c8f68082dc8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2616_en.txt
@@ -0,0 +1,3 @@
+A 54-year-old man was referred to the outpatient clinic of our Division for surgical resection of giant emphysematous bullae. He had no smoking history, and he had previous pneumonia episodes and recently experienced intermittent shortness of breath associated with presyncope episodes. Seven days previously, dyspnea worsened (MRC Grade IV) . On general inspection, the patient was alert and stable. A review of his medical record showed a progressive decline in lung function with forced expiratory volume in one second (FEV1) that was 65% of the value predicted 6 months previously and FEV1 of 1.19 L that was 50% of that predicted 6 months previously. Arterial blood gas showed a pH of 7.41, partial pressure of CO2 (PCO2) of 43 mmHg, and partial pressure of oxygen (PO2) of 69 mmHg. The left hemithorax was hyperresonant to percussion, and decreased breath sounds were apparent upon auscultation. The chest radiography showed progressive enlargement of the bulla in the left lung of over 10 years (A). A CT scan obtained during the current admission revealed a giant bulla with a diameter of 10.5 × 11 cm in the left lobe, causing significant compression of fairly normal lung parenchyma (B).
+Surgical criteria for resecting bullae are generally based on symptoms, particularly poor pulmonary function, inducing dyspnea. Moreover, the grade of dyspnea was previously classified : grade I is minimal dyspnea on running or on exerting more than an ordinary effort, grade II is dyspnea on ordinary effort, grade III is considerable dyspnea on exerting less than an ordinary effort, and grade IV is dyspnea at rest. In our case, the patient was of grade II.
+The patient underwent surgical resection of the bulla firstly by VATS approach, converted after 30 min into a left thoracotomy for dense pleural adhesions (A and B). The bulla presented as a sessile plant 8–10 cm in length from the apical segment of the upper lobe to the lower lobe of the lung, and it appeared to be of normal consistency. We proceeded to deflate and mobilize the bulla from the parietal pleura and mediastinal adhesions. Bullectomy section was performed by GIA Stapler-75 and reinforced with interrupted sutures of Vycril 2/0 (A). Lysis of the pulmonary ligament was performed. The patient did well postoperatively. Air leakage from the left chest tube stopped on the 3rd postoperative day, and the chest tube was removed. The follow-up chest X-ray showed no pneumothorax, and the patient was discharged in good general clinical condition on the sixth day (B).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2627_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2627_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..66ef84bc951a77a9f4e7f09884613dad75c9cf61
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2627_en.txt
@@ -0,0 +1,6 @@
+A 37-year-old woman visited our hospital complaining of weakness in both hands. Five years prior to admission, she had noticed mild weakness of insidious onset in her left hand. However, she did not undergo medical treatment or visit clinics. Weakness developed in her right hand 2 years later. The weakness in both hands progressed gradually and the severity increased. She began to experience difficulty in writing, handling chopsticks, and making a fist. The patient visited local clinics, but was not sufficiently evaluated. On admission the patient had severe weakness and muscle atrophy in both hands, without sensory change. Her past medical history and the antenatal and postnatal periods had been uneventful. She had attended school and had led an apparently normal life until she noticed neurological manifestations. Relevant diseases, a familial history of neurological disease, smoking, and alcohol were not noted. She had taken an antihypertension drug and oral thyroid hormone at a local clinic. On examination, her vitals sign were stable, with a blood pressure of 140/90 mmHg and a heart rate of 72 beats/min. A neurological examination revealed that she was alert and her orientation was intact. Cognitive impairment was not detected. There were no abnormal findings on cranial nerve examination.
+Motor system examinations using the Medical Research Council (MRC) grade revealed severe motor weakness in both hands (flexor pollicis longus, MRC grades 3/5 and 2/5 on the right and left, respectively; flexor digitorum profundus and sublimis, MRC grades 3/5 and 3/5; flexor carpi ulnaris and radialis, MRC grades 3/5 and 3/5; extensor pollicis brevis and longus, MRC grades 3/5 and 2/5; extensor carpi radialis, MRC grade 3/5 and 2/5; extensor carpi ulnaris, MRC grades 3/5 and 3/5; extensor digitorum communis, MRC grades 2/5 and 2/5; abductor pollicis brevis, MRC grades 3/5 and 3/5; and abductor digiti minimi, MRC grades 2/5 and 2/5). Prominent muscle atrophy and deformities were observed distally in both hands . The motor power of both lower extremities was normal. The deep tendon reflex was decreased in the upper extremities.
+The patient exhibited symmetric and intact responses to all sensory stimuli, and her cortical senses were intact. Her neck was supple, no carotid bruit was audible, and the results of a cerebellar function test were normal.
+Laboratory investigations revealed a normal hemogram, serum electrolytes, and renal function. Cerebrospinal fluid findings were normal. Evaluations for vasculitis involving rheumatoid factor, anti-dsDNA antibody, lupus anticoagulant, anticardiolipin antibody, antithrombin III, antineutrophil cytoplasmic antibody, anti-SSA and SSB (Sjogren syndrome A and B) antibody, complement 3/4, anti-jo-1 antibody, cryoglobulin, immunofixation electrophoresis/protein electrophoresis, anti-GM1 antibody, and anti-GD1b antibody were within the normal range or negative, with the exception of a mildly elevated fluorescent antinuclear antibody titer (1 : 40). The results of tumor screening tests involving alpha-fetoprotein, carcinoembryonic antigen, cancer antigen (CA)-19-9, and CA-125 were normal. Hexosaminidases A and B, and creatine kinase were also within the normal ranges. However, a thyroid function test revealed an abnormally elevated antithyroglobulin antibody titer (794 U/mL, normal range: 0-100 U/mL) and antimicrosomal antibody (26,030 U/mL, normal range: 0-100 U/mL), but the thyroid hormone levels, including T3, free T4, and thyroid stimulating hormone, were normal.
+Cervical magnetic resonance imaging revealed no prominent abnormalities except mild disc protrusion at the C5-6 and C6-7 levels. NCSs and electromyography were performed using standard techniques of percutaneous supramaximal stimulation and recordings. These examinations revealed motor neuropathies in the median motor nerve, ulnar motor nerve, and radial motor nerve, with definite motor conduction block manifesting as the compound muscle action potential amplitude being more than 50% lower for proximal than for distal stimulation across a standard peripheral nerve segment . However, the findings of sensory NCSs in the upper extremities, and motor and sensory NCSs in the lower extremities were normal. Thus, even though the patient was negative for antiganglioside antibodies, the electrophysiological study and clinical manifestations resulted in a diagnosis of MMN.
+A biopsy of the patient's thyroid tissue by ultrasound-guided aspiration revealed diffuse lymphocyte infiltration, a finding that is consistent with Hashimoto's thyroiditis . She was treated with high-dose intravenous immunoglobulin (0.4 g/kg/day) for 5 consecutive days and then discharged. When she visited our Outpatient Department 1 month later, the weakness and deformity in her right hand was considerably improved and the conduction block of the motor nerves were mildly improved, as evaluated by follow-up NCSs . This patient will be continuously followed up at the Outpatient Department.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2636_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2636_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..66f1841d3c9433dd5ad372be81c5d5fb6f8736fb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2636_en.txt
@@ -0,0 +1,5 @@
+A 72-year-old male patient underwent D2 radical gastrectomy in October 2017 due to elevated carbohydrate antigen 199 (CA199, 902 U/mL) detected by routine examination and subsequently GC revealed by abdominal MRI and gastric adenocarcinoma by gastroscopy. Postoperative histopathological diagnosis was poorly differentiated from adenocarcinoma (Diffuse type) with HER2 positive (immunohistochemical), TNM staging (7th edition) was p-T4aN3aM0 (stage IIIC). After surgery, CA199 fell to 198 U/mL and the patient received six cycles of SOX (oxaliplatin 130 mg/m2, Tegafur Gimeracil Oteracil Potassium Capsule 60mg/d d1-14) regimens of adjuvant chemotherapy. In April 2018, Positron Emission Tomography-Computed Tomography (PET-CT) scan showed multiple larger lymph nodes in the right upper mesentery and abdominal aorta, the larger one was about 1.52×1.03 cm, and the maximum SUV was 3.84, indicating lymph node metastasis. According to the consensus, this postoperative adjuvant chemotherapy should be considered as a first-line treatment. – show the whole treatment process and the corresponding changes in PET-CT and computed tomography (CT) scan, as well as the changes in CA199 and carcinoembryonic antigen (CEA) levels.
+In June 2018, CA199 (1239.0 U/mL) and CEA (18.7 ng/mL) were significantly elevated in this patient. We suggested that the patient should take trastuzumab combined with chemotherapy, but because trastuzumab was not covered by the medical insurance of Chinese residents at that time, the patient refused to use trastuzumab, so we gave the DP (docetaxel 75mg/m2, cisplatin 75mg/m2) chemotherapy to the patient. After two cycles of chemotherapy, a CT scan of the patient’s abdomen revealed a slight reduction in retroperitoneal lymph nodes. Until November 2018, new metastases were found on chest CT scan, accompanied by a significant increase in CA199 (8078.0 U/mL) and CEA (49.1 ng/mL). Subsequently, he underwent two cycles of third-line chemotherapy with irinotecan (250mg/m2). However, this regimen did not show therapeutic effect, accompanied by the continuous increase of CA199 (16644.0 U/mL) and CEA (65.6 ng/mL).
+In January 2019, the patient developed back pain when a CT scan demonstrated progressive disease (PD) in the retroperitoneal lymph nodes. At this time, trastuzumab had been included in the medical insurance coverage of Chinese residents, so we treated the patient with trastuzumab (6mg/kg) combined with DCF (docetaxel 60mg/m2, cisplatin 60mg/m2, 5-fluorouracil 600mg/m2/d d1-5) regimen. After two cycles of therapy, the abdominal CT showed partial response (PR) of retroperitoneal lymph nodes, the back pain was significantly reduced. After four cycles of therapy, chest CT showed that pulmonary metastases disappeared, and abdominal CT showed PR of retroperitoneal lymph nodes. By August 2019, the patient received a total of 9 cycles of this regimen, during which CA199 was reduced to the lowest value of 206.0 U/mL and CEA to the lowest value of 9.3 ng/mL. In September 2019, PET-CT showed new nodules in left lung and right lung, and multiple enlarged lymph nodes in retroperitoneal. The largest lymph node had a length of about 2.4 cm, and the maximum SUV was 10.75. At the same time, CA199 (3988.0 U/mL) and CEA (30.2 ng/mL) increased significantly. Comprehensive consideration, the patient’s condition progress.
+After the fourth-line treatment of GC, there is no standard treatment. We suggested genetic testing, and the patient refused. After comprehensive consideration, the patient was treated with anti-angiogenesis (apatinib 250mg/d) combined with anti-PD-1 inhibitor (camrelizumab, SHR-1210, 200mg every 3 weeks). After two cycles of treatment, the abdominal CT scan showed no significant change in the size of the lesions. After that, we gave the patient two cycles of treatment again. In January 2020, CT scan showed that the retroperitoneal lymph nodes were enlarged, and CA199 (13725.0 U/mL) and CEA (48.3 ng/mL) were obviously increased.
+After the patient’s disease progresses, we recommend genetic testing again. Peripheral blood tests were performed because the patient’s pathological tissue was difficult to obtain. Next-generation sequencing (NGS) (543 genes; GeneCast Biotechnology Co. Ltd., Beijing, China) was performed. NGS results showed that the patient had an increased copy number of HER2 gene, no HER2 gene mutation, and a negative expression of programmed cell death ligand 1 (PD-L1). Detailed results are listed in . We conducted a multidisciplinary treatment discussion on the patient’s condition in our hospital, and found that there is no standard treatment plan for the six-line treatment of advanced GC, and no relevant clinical trial has been carried out in our hospital. According to the NGS results, the copy number of the HER2 gene was significantly increased in this patient. Pyrotinib, a novel HER2 inhibitor, has been approved in combination with capecitabine in China for patients with relapsed or metastatic breast cancer who had previously received trastuzumab. We hypothesized that pyrotinib combined with capecitabine might be effective in this patient. Therefore, with the patient’s informed consent, the patient was administered pyrotinib (400mg/d) plus capecitabine (1000 mg/m2, bid, d1-14, every 3 weeks) treatment in January 2020. After three cycles, abdominal CT scans showed PR in the retroperitoneal lymph node. After four cycles, chest CT scans showed that pulmonary nodules disappeared. At the same time, CA199 and CEA decreased steadily. In August 2020, abdominal CT still showed PR in retroperitoneal lymph nodes. The patient tolerated treatment with pyrotinib well. No adverse events were observed. Until the submission of the case draft, the patient has survived for over 30 months since postoperative recurrence and now continues to receive the combination treatment of pyrotinib plus capecitabine, and the PFS is over 8.5 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2660_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2660_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..156cec6d696040ccb2987701ed459591a0cae996
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2660_en.txt
@@ -0,0 +1,7 @@
+A 55-year-old male patient was admitted to Shanghai Xuhui Central Hospital due to fever, cough, and expectoration for 3 days on 9 April 2021. The patient had a history of hypertension, long-term smoking, chronic bronchitis, and emphysema. On 17 March 2021, the patient visited a tertiary general hospital in Shanghai and received a radical resection of right lower lung cancer and right upper lobectomy, and the postoperative pathology changes were various. Invasive adenocarcinoma was identified in the right lower lung, with alveolar and adherent growth, not involving the visceral pleura. A large number of acute and chronic inflammatory cells were infiltrated the right upper lobe, and fungal hyphae were specifically visible, considering fungal infections (Candida infection was suspected, and mucormycosis and aspergillosis were ruled out). On 7 April 2021, the patient developed a high fever, with chest computed tomography (CT) in that hospital revealing possible empyema on the right side, postoperative changes in the right lung with scattered infection, multiple fractures of the right ribs with chest wall pneumatosis, and enlarged lymph nodes in the mediastinum. His vital signs upon admission to our hospital were as follows: temperature, 39.0°C; blood pressure, 134/70 mmHg; respiratory rate, 20 breaths/min; pulse, 112 beats/min; blood oxygen saturation level (SpO2), 92% (without oxygen inhalation); clear mind, stable breathing, no cyanosis of lips, the disappearance of breath sounds in the right lower lung, dullness to percussion in the right lower lung, and no dry or moist rales heard. As given above, the patient was diagnosed with right hydropneumothorax and empyema, pneumonia, postoperative malignant tumor of the right lower lobe (adenocarcinoma), and hypertension.
+After admission, the patient was given empirical anti-infective treatment with flucloxacillin (2 g Bid) plus levofloxacin (0.5 g Qd) injection. In addition, treatment for reducing phlegm, pleural effusion puncture and drainage, and other symptomatic treatments were given. On 10 April 2021, the patient had a sudden high fever without explained causes, accompanied by dyspnea, profuse sweating, and a large amount of purulent sputum. Physical examination revealed a heart rate of 108 bpm/min, an SpO2 of 75% (without oxygen inhalation), a blood pressure of 118/88 mmHg, a respiratory rate of 34 breaths/min, wheezing appearance, clear consciousness, coarse breath sounds, and a large number of palpable moist rales. Blood gas analysis showed a decreased pH of 7.237 and an elevated PCO2 and PO2 level (62.1 and 97.2 mmHg, respectively), indicating type II respiratory failure. The patient was given Bipap ventilator-assisted ventilation (A/C mode, inspired positive airway pressure (IPAP) 18 cm H2O, expired positive airway pressure (EPAP) 4 cm H2O, f = 24, O2 = 5 L/min) and transferred to the intensive care unit. Meropenem injection 0.5 g q8h and linezolid injection 0.6 g q12h were given immediately. The bedside chest x-ray showed infectious lesions and pleural effusion in the right lung (, ). The patient refused bronchoscopy. Sputum and blood samples were sent for mNGS (Vision medicals, Guangzhou, China), but both showed negative results. On 11 April 2021, the bedside chest x-ray was repeated, and the symptoms improved (, ). On 12 April 2021, the culture of pleural effusion in the microbiology laboratory reported Gram-negative bacteria, which was preliminarily considered as Eikenella corrodens based on morphology. Chest CT was performed on the same day, indicating a right lung abscess with cavitation (, ). The patient was given a meropenem injection of 0.5 g q8h alone for anti-infection. On 17 April 2021, the symptoms of cough, expectoration, chest distress, and shortness of breath were improved, without fever. The patient was transferred to the respiratory medicine ward. On 23 April 2021, the re-examination of chest CT showed that the lesion was continuously absorbed .
+The patient was discharged on 25 April 2021. Amoxicillin 1.0 g q8h continued for 1 week. The conditions of the patient were stable. On 24 May 2021 and 9 July 2021 (, ), the re-examination of chest CT showed further absorption of the lesion. To date, the patient had no fever, dyspnea, or other symptoms.
+Under aseptic operation, B ultrasound-guided thoracentesis was performed on 9 April 2021. A total of 15 ml of dark red pleural effusion was withdrawn and sent to the microbiology laboratory for aerobic and anaerobic culture. Direct smear staining showed elongated Gram-negative bacteria . The culture was transferred to a Columbia blood agar plate and incubated at 35°C under 5% CO2 for 72 h. We observed a typical straw cap colony on the plate, which was flat, with central convex and smooth round . A 16S rRNA gene sequencing was performed. The pathogen was detected as Eikenella at the genus level.
+To further confirm the pathogen at the species level, a sputum sample collected on 11 April 2021 was sent for mNGS (Hugobiotech, Beijing, China), identifying the pathogens as E. halliae (82 specific reads, ,). Considering the rarity of the pathogen in this patient, the previously negative mNGS data were reanalyzed, and E. corrodens (91 unique reads, ,) were found in the background microorganisms. Interestingly, the pathogens detected by the two mNGS tests were different at the species level. So, high-throughput whole genome sequencing (WGS) was finally applied, of which the result showed that the isolate had the best concordance with E. halliae .
+DNA was extracted from sputum samples using the QIAamp DNA Micro Kit (QIAGEN, Hilden, Germany) according to its manual. DNA libraries were then constructed by QIAseqTM Ultralow Input Library Kit (Illumina, California, USA), and the quality of libraries was estimated using Qubit (Thermo Fisher, Massachusetts, USA) and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). The qualified libraries were finally sequenced on the Nextseq 550 platform (Illumina, California, USA). Reads of short length, low quality, and low complexity were removed from the raw data. Human DNA was also removed after mapping the human reference genome database (hg38). The remaining reads were finally aligned to the National Center for Biotechnology Information (NCBI) Microbial Genome Databases. The detailed method is shown in the .
+The patient was initially treated with ß-amides and quinolones, but his conditions progressed, and respiratory failure occurred during treatment. According to the susceptibility protocol of rare bacteria and aerobic bacteria in the Clinical and Laboratory Standards Institute (CLSI) M45-A3 document, this bacterium was highly sensitive to amoxicillin/clavulanic acid. To further determine the sensitive drugs, the broth microdilution method was used for the susceptibility test in this case, and it was found that amoxicillin/clavulanic acid was the best antibiotic drug for the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2673_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2673_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cb32b15e8ecfda178389dfd15720d45d81dfc27d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2673_en.txt
@@ -0,0 +1,8 @@
+A 17 year old horse-rider girl was referred to our clinic for 2 weeks history of moderate continuous, crampy abdominal pain, starting in the epigastric region and shifted to the left upper quadrant. This pain was associated with fatigue, loss of appetite. Patient denies any nausea, vomiting, diarrhea, fever, night sweats. She reported a remoteleft shoulder pain with negative MRI. Her physical exam was positive for splenomegaly 9 cm below costal margins, and left upper quadrant tenderness, with no rebound tenderness. Her laboratory examination showed a Hg:12.8 g/dL, platelet: 124,000/mm, WBC: 6500/mm with 62% neutrophils, 24% lymphocytes, and 7% eosinophils, platelet: 124,000/mm, a CRP:0.78 mg/L. The Liver enzymes, Bilirubin, Albumin, LDH, the Chemistry panel were all in normal range. Abdominal ultrasound showed a large splenic cyst of 15 cm containing homogenous internal debris . An abdominal computed tomography scan showed the same 15 cm splenic cyst with parietal calcifications, compressing the stomach, most likely of hydatid origin (a, b). Abdominal MRI showed unilocular splenic cyst hypo-intense T1, hyper-intense T2 (a, b). Differential diagnosis for described findings include; Splenic abscess, Hydatid cyst, epithelial cyst and post traumatic hemorrhage in pre-existing epithelial cyst. Based on clinical picture and endemic status for hydatid cyst differential can be narrowed.
+Serologic test for Hepatitis B virus (HBV), hepatitis C virus (HCV), Cytomegalovirus (CMV), HIV, Toxoplasmosis, Entamoeba histolytica, Leishmania brazilensis, donovani, and EBV IgM were all negative. EBV IgG was elevated showing prior immunization. The immune-diffusion test for Echinococus multilocularis was negative. The Indirect hemagglutination test and the Elisa test for Echinococcus granulosus were also negative.
+Nevertheless, due to an elevated IgE level: 317 kU/L, the patient was considered as having splenic hydatid cyst and was treated by albendazole PO with meals in a dose of 400 mg twice daily for 28 days, and received the anti-pneumococcal vaccine.
+Due to the severe continuous pain, the large size, the risk of spontaneous rupture and the patient’s wishes to resume her hobby as a horse-rider as soon as possible, she was consented for operative exploration via a laparotomy incision for splenic cyst un-roofing.
+Exploration was done, abdominal cavity was protected by hypertonic saline (3%NaCl) filled pads, cyst was punctured, 2 liters of dark green fluid was aspirated. Hypertonic saline was injected in the cyst, and then aspirated after 15 min. Un-roofing and partial resection was done afterward.
+The postoperative course was un-eventful and the patient was discharged home on the post-operative day 5.
+The pathology report showed stratified epithelium with fibro-inflammatory reaction in the pericystic zone compatible with splenic epithelial cyst.
+The patient still symptom free after 5 years of follow up and her labs showed a WBC: 7700/mm3 normalization of eosinophils (2.5%).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2681_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2681_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cfe15c4f2ecb8fb29112023cde9a81e04be7f08f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2681_en.txt
@@ -0,0 +1,16 @@
+An 83-year-old Caucasian male was hospitalized at a local hospital for erysipelas on both legs. Upon admission, the patient was routinely tested for COVID-19 by a reverse transcriptase-polymerase chain reaction test and was found to be positive. The patient was not vaccinated against COVID-19. While in the hospital, the patient did not develop any COVID-19-related symptoms. After receiving treatment for erysipelas for seven days, the patient was stable and was discharged. While at home, COVID-19 symptoms—fever, cough, weakness, and diarrhea appeared, gradually worsened, and 13 days after the onset of symptoms, the patient was admitted to the Latvian Centre of Infectious Diseases (LCID). Upon admission to LCID, the patient did not display any neurological problems as contact with the patient could be established, and he could orient in time and space. The skin and mucous membranes were pale and dry, with signs of recurrent erysipelas on both legs. During auscultation, diffuse crackles on both sides of the lungs were found, and palpation of the abdomen did not show any pathology, including no signs of dysuria; the patient had mild peripheral edema on both legs. The patient had a febrile body temperature of 38.0 ºC, tachycardia with a heart rate of 100/min, blood pressure was 110/70 mmHg, and respiratory rate was 24/min with blood oxygen saturation of 89% on room air. The patient was diagnosed with clinically severe COVID-19 with bilateral pneumonia, as determined with radiological imaging , and respiratory failure type I .
+From the second to the fourth day of hospitalization, as antibacterial and symptomatic treatment was started, the patient's body temperature remained subfebrile with cough, watery stool 3–4 times a day, dyspnea, and tachypnea with low blood oxygen saturation (93%), supplemented with 4–6 L of oxygen per minute through a nasal cannula.
+On the fifth day of hospitalization at LCID, a Clostridium difficile infection was confirmed. Patient fecal samples were collected according to the hospital's guidelines, and tests for C. difficile glutamate dehydrogenase and C. difficile toxin A/B were performed.
+From the sixth to the ninth day of hospitalization, the patient remained stable but required oxygen supplementation; the diarrhea had resolved by day seven.
+On the tenth day of hospitalization, the patient presented with recurrent febrile body temperature of 38.5–39.0 ºC, severe malaise, disorientation, and blood oxygen desaturation. In addition, laboratory findings showed significantly elevated inflammatory markers, and the decision was made to switch to antibacterial therapy and to start oxygen supplementation through a high-concentration oxygen mask with a reservoir bag of 15 L per minute.
+From the eleventh to the fourteenth day of hospitalization, the patient's medical condition stabilized yet remained severe, showing little to no improvement. From day 15 patient's dyspnea worsened, and the blood oxygen saturation fell to 88% despite the oxygen supplementation. Oxygen supplementation was continued through a high-concentration oxygen mask with a reservoir bag of 25 L per minute, with some improvements to blood oxygen saturation (92–93%).
+Gradually the patient's condition worsened with no improvements, despite the treatments. The patient died from COVID-19-associated lung damage and respiratory failure on November 2020 after being treated for 19 days. An autopsy was not performed at the request of the patient's relatives.
+The patient had a history of cardiovascular problems (coronary heart disease, myocardial infarction, followed by percutaneous coronary intervention with stent implantation, permanent atrial fibrillation, stable angina pectoris) and a myriad of other chronic health problems, including non-Hodgkin's lymphoma, melanoma, lymphostasis in both legs after erysipelas, vitiligo, benign prostatic hyperplasia. Diffuse large B cell lymphoma was histologically diagnosed in June 2020, and since October, the patient was treated with rituximab. For the lymphoma treatment patient also took methylprednisolone 4 mg per os (p/o) once per day, allopurinole 300 mg p/o once per day, and trimethoprim-sulfamethoxazole 400–80 mg p/o twice a week. Before hospital admission, the patient was treated for his cardiovascular diseases with dabigatran 110 mg p/o twice a day, torasemide 10 mg p/o once a day, and atorvastatin 20 mg p/o once a day.
+The patient was a non-smoker and had no history of alcohol abuse. The patient lived in a countryside house with his oldest son. The patient was retired, and no information on past employment or the patient's family history could not be obtained from the patient.
+At LCID, the patient was treated with oxygen through a nasal cannula (4–6 L per minute) for 9 days, and a high-concentration oxygen mask with a reservoir bag (15–25 L per minute) for 10 days, dexamethasone 8 mg intravenously (i/v) once daily for 19 days, dual antibacterial therapy—ceftriaxone 2000 mg i/v once daily for 12 days and doxycycline 100 mg p/o twice a day for 11 days, then switching to piperacillin/tazobactam 4000 mg/500 mg i/v three times a day for nine days, enoxaparin-sodium 0.4 mL subcutaneously once daily for 19 days, metoprolol 50 mg p/o once daily for 19 days, torasemide 5 mg p/o once daily nine days, spironolactone 25 mg p/o once daily for 11 days, omeprazole 20 mg p/o once daily for 19 days, metamizole 1000 mg i/v in case of febrile temperature, and troxerutin 2% gel for local use for 16 days. On the day the patient died, he received methylprednisolone 1000 mg i/v and morphine 1%—3 ml i/v.The patient did not receive any antiviral drugs because he did not meet the criteria needed. The patient did not receive monoclonal antibodies or convalescent plasma because at the time the patient was hospitalized, these medications were unavailable in the country.
+The patient's blood was tested upon admission to LCID, on the 5th, 10th, 13th, and 19th day of hospitalization. Nasopharyngeal swab, blood, urine, and fecal samples were collected from the patient on the 14th day.
+Blood test results are illustrated in Table . The parameters analyzed differed between the tests. Analysis of circulating blood cells revealed that the patient had elevated leukocyte count since day 10, reaching 14.96 × 103 cells/µL on day 19. Upon admission, the neutrophil count was normal (6.13 × 103 cells/µL, ref. range 2.0–7.0 × 103/µL) but then increased and stayed elevated since day 10. Upon admission, lymphocyte count was significantly decreased (0.23 × 103 cells/µL, ref. range 1.2–3.5 × 103/µL) falling to 0.06 on day 19. Several markers of inflammation and infection were found to be elevated. Procalcitonin levels were high upon admission, but decreased (while still being higher then normal) by day five after being treated (0.61 vs 0.24, ref. range 0.00–0.05). IL-6 was also severely elevated (93.0 pg/mL, ref. range 0.0–3.4 pg/mL). CRP levels were elevated in all of the time-points, reaching levels as high as 239.3 mg/L on the day the patient died.
+Blood plasma and peripheral blood mononuclear cells (PBMC) were isolated immediately upon receiving the peripheral blood samples. PBMCs were isolated using HISTOPAQUE by Sigma (United Kingdom) gradient. RNA was isolated from all samples obtained using the Ribospin vRD kit by GeneAll (South Korea) according to the manufacturer's instructions (adapted specifically for fecal samples). SARS-CoV-2 was detected using the Direct SARS-CoV-2 Realtime PCR kit by Vircell (Spain), and the viral load was determined using the quanty COVID-19 kit by Clonit (Italy).
+SARS CoV-2 genomic sequence was detected in all biological samples analyzed—nasopharyngeal swab, plasma, PBMCs, urine, and feces. As expected, the highest viral load was observed in the nasopharyngeal swab sample (517,000,000.0 viral copies/mL), but the viral load in feces was also notable. We believe that the detected loads illustrate an extreme case. As these patient samples were collected as a part of a larger research project, we could compare the determined viral loads with other hospitalized COVID-19 patients. The viral load of the described patient's fecal sample was significantly higher when compared to the median viral loads of the fecal samples obtained from 139 hospitalized individuals—7,224,091 vs 14,164 copies/mL (p < 0.0001), and an even more pronounced difference was observed in the case of the nasopharyngeal swab load—517,000,000 vs 5752 copies/mL (p < 0.0001) (unpublished data). Interestingly SARS-CoV-2 sequence was detectable in both cell-free blood plasma and PBMCs .
+Plasma samples were used to semi-quantitatively detect SARS-CoV-2 specific (nucleocapsid protein (NCP) and spike protein subunit 1 (S1)) IgA and IgG class antibodies using Anti-SARS-CoV-2 ELISA by Euroimmun (Germany), to quantitatively detect SARS-CoV-2 specific IgM and IgG class antibodies using Anti-SARS-CoV-2 ELISA by Antibodies-online (Germany), and to determine the levels of inflammatory cytokines using custom multiplex assay by Merck Millipore (Germany). Neither quantitative nor semi-quantitative analysis of SARS-CoV-2 antibodies detected antibody titers, indicating seronegativity.
+Levels of 14 cytokines were analyzed—granulocyte–macrophage colony-stimulating factor (GM-CSF), interferon-gamma (IFN-γ), interleukin 1β (IL-1β), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 17A (IL-17A), interleukin 18 (IL-18), interferon gamma-induced protein 10 (IP-10), monocyte chemotactic protein 1 (MCP-1), macrophage inflammatory protein-1 alpha and beta (MIP-1α/β), platelet-derived growth factor (PDGF-AB/BB), tumor necrosis factor-alpha (TNF-α) and vascular endothelial growth factor A (VEGF-A). Levels of 5 of the analyzed cytokines—GM-CSF (< 2.6), IFN-γ (< 1.3), IL-1β (< 1.6), IL-17A (< 1.3), and MIP-1α (< 3.0), were below the detection limit of the test utilized, even though detectable and elevated levels of these cytokines could be found in a group of other hospitalized COVID-19 patients. The described patient exhibited severely elevated levels in comparison to median levels of other hospitalized patients, for example, in the case of IL-6 (20.2 vs 4.9 pg/mL), IL-18 (105.2 vs 53.6 pg/mL), and IP-10 (2007.5 vs 639.2 pg/mL), respectively. On the other hand, the level of PDGF-AB/BB was significantly lower in the patient's plasma when compared to the median levels of other hospitalized patients—1399.0 vs 25,606.0 pg/mL (unpublished data).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2690_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2690_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c710a245354659614baf82783a8423b905be1fd2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2690_en.txt
@@ -0,0 +1,4 @@
+A 59-year-old male patient was diagnosed in 2003 with a smoldering multiple myeloma (IgG lambda) with bone marrow infiltration of 10 to 20% (negative CRAB criteria at that time). In 2004, he developed nephrotic syndrome and a histological diagnosis of focal segmental glomerulosclerosis was made. Immunofluorescence showed C3c deposition but dense deposits were absent on electron microscopy. Six months later, the patient developed progressive renal failure with nephritic syndrome. A subsequent kidney biopsy revealed crescentic membranoproliferative glomerulonephritis with dense deposits (dense deposit disease; DDD). Immunohistochemistry was negative for IgG, IgA, IgM and C1q. Despite treatment with cyclophosphamide, his kidney function rapidly decreased to end-stage renal disease (ESRD) in 2004. In the light of a stable remission of his multiple myeloma for 10 years (stage I Salmon/Durie; stage III ISS in 2014; positive CRAB-criteria: renal failure, anemia), a kidney transplantation was planned.
+After deceased donor kidney transplantation in October 2015, a kidney biopsy was performed at day seven because of delayed graft function. Immunosuppressive medication consisted of cyclosporine, mycophenolate mofetile and oral glucocorticoids without prior induction therapy. The biopsy revealed acute tubular necrosis, acute cellular rejection and an intracapillary proliferative glomerulonephritis (Banff IA; Fig. ). The biopsy result before receiving the additional immunohistochemical staining was compatible with mixed cellular and humoral rejection. The patient received four sessions of plasmapheresis and three doses of antithymocyte globuline (75 mg each) in combination with glucocorticoid pulse therapy. Cyclosporine was switched to tacrolimus. Additional immunohistochemical stainings revealed C3c deposition and on electron microscopy mesangial and dense intramembranous osmiophilic deposits were present, indicating an early recurrence of DDD in the allograft . Graft function improved to a stable creatinine of 2.6 mg/dl over several weeks .
+In December 2015, creatinine increased to 3.2 mg/dl. Serum C3 was low (55 mg/dl) and the patient had active urine sediment. Tacrolimus trough levels were stable. A successive kidney biopsy confirmed C3G and minimal residual tubulitis diagnostic of borderline cellular rejection . CRAB criteria were positive for renal insufficiency and anemia. The concentration of free lambda light chain was 10.2 mg/l. Another course of high-dose corticosteroids was combined with five sessions of plasmapheresis and subsequent induction therapy with bortezomib and dexamethasone. Myeloma bone marrow infiltration was 20% at that time. After short-term stabilization (creatinine 3.2 mg/dl over 14 days), graft function rapidly deteriorated over several days . Despite four sessions of plasmapheresis, allograft function further declined and hemodialysis treatment was startet on 30th Dec 2015. Because of refractory MG-C3G, treatment was switched to eculizumab. The first infusion of 900 mg was given on 4th Jan 2016 followed by three infusions of 900 mg eculizumab weekly and one additional dose of 1200 mg 2 weeks thereafter. Graft function improved promptly and tapering of oral steroids was possible. Serum C3 increased from 55 mg/dl before treatment to 84 mg/dl after the induction course of eculizumab. Bortezomib had to be stopped after three cycles because of polyneuropathy.
+In March 2016, creatinine increased and the patient developed nephrotic-range proteinuria . A graft biopsy showed active DDD without any sign of myeloma infiltration . The myeloma bone marrow infiltration at this time was 6% and free lambda light chain concentration was 10.4 mg/l. After restarting eculizumab 1200 mg every other week, creatinine and proteinuria improved quickly, indicating a rapid clinical response to complement inhibition. At the last follow-up in March 2018, the patient was well and had a stable allograft function (creatinine of 1.9 mg/dl) without proteinuria (230 mg/g creatinine). Serum C3 was decreased with 57 mg/dl, indicating persisting subclinical immunological activity of MG-C3G. Free lambda light chain concentration at last follow-up was 8.9 mg/l. No progression of myeloma occurred during a 28-months-follow-up after kidney transplantation and besides bortezomib-induced polyneuropathy, no adverse treatment effects were observed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2704_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2704_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a35b71213964f41960c6caca1a2bfdd4928486e8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2704_en.txt
@@ -0,0 +1 @@
+A 46-year-old man presented with generalized seizures. He was on venlafaxine therapy for depression and anxiety disorder. He had taken venlafaxine for sex weeks. He started on 75 mg/day which was increased to 150 mg/day after two weeks. He was told to continue the medication in that dose. Blood pressure was monitored and he was all the time normotensive. There was no history of seizures, hypertension or other diseases. He had no other medications. The seizures were followed by nausea, vomiting, severe headache, visual disturbances and confusion. He also experienced severe shortness of breath and began to cough up frothy pink sputum. On presentation in the emergency department, he was sleepy, had a pulse of 135 beats/min, a blood pressure of 231/133 mm Hg, and a respiratory rate of 35-38. His chest X-ray indicated pulmonary oedema. He was treated for acute congestive heart failure due to severe hypertension. The hypertension was treated with labetalol and enalaprilat intravenously. Venlafaxine therapy was stopped. Complete blood picture, and blood biochemistry were normal. On day 2 of admittance he experienced further seizures. Treatment with phenytoin and levetiracetam intravenously proved to be effective and the seizures stopped. An electroencephalogram showed diffuse slowing indicating an encephalopathy. Cerebrospinal examination was normal. Echocardiography was normal. Magnetic resonance imaging (MRI) of the brain, pre and post gadolinium, carried out on day 2, displayed an increased T2 signal in the cortex on both the T2 and FLAIR images throughout the frontal and temporal lobes and in the cerebellum consistent with hypertensive encephalopathy/PRES . No contrast enhancement was seen and diffusion weighted imaging showed no signs of ischemia. The mental status changes improved after treatment. Oral anticonvulsive and antihypertensive treatment continued. Other secondary causes of hypertension were excluded. The patient gradually improved and he became seizure free and the blood pressure successively became normal. Physical examination showed no signs of heart disease. Repeated chest X-ray was normal. The patient was discharged to his home on day 12. A MRI after six weeks displayed marked regression of the abnormalities . The patient was seen again after three months. The prescribed antiepileptic drug was discontinued as well as antihypertensive treatment. His blood pressure had been normal and he had not had any seizures. He denied any cardiac symptoms. He had not experienced any new symptoms at follow-up after one year. He is recurrently evaluated by psychiatrist. He now uses a different medicine for his depression and anxiety disorder.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2717_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2717_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..87e729a1e0075fe6dc5110cf3a28ec396d9f4912
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2717_en.txt
@@ -0,0 +1,4 @@
+A 61-year-old obese male underwent laparoscopic partial nephrectomy due to an incidental tumor in the left kidney that was found during a work-up for hypertension. Microscopic examination of the tumor revealed that this was a chromophobe renal cell carcinoma. After one year of surveillance, a routine follow-up evaluation revealed a tumor in the left seminal vesicle. Magnetic resonance imaging (MRI) showed a well-circumscribed heterogeneous solid tumor in the left seminal vesicle measuring 32 mm across its largest dimension, with well-defined cleavage planes with the rectum and bladder walls . The patient then underwent laparoscopic surgical excision of the left seminal vesicle.
+Grossly, the seminal vesicle measured 6 x 3 x 2 cm, and the cut surface showed a solid, well-circumscribed, brownish and smooth nodule measuring 30 mm across its largest dimension. The surgical margins were free from tumor. Microscopic examination of the tumor disclosed well-defined nests of cuboidal cells separated by vascular fibrous septa without evidence of vascular invasion, mitotic figures or necrosis. Gland-like structures were identified focally. The individual tumor cells had a large central nucleus and small to medium-sized nucleoli, and granular eosinophilic cytoplasm .
+The diagnostic possibilities at this point included metastasis of the previous chromophobe renal cell carcinoma, adenocarcinoma of the seminal vesicle and paraganglioma. Immunohistochemical characterization was used for the differential diagnosis (antibodies summarized in ). The tumor cells were immunoreactive for chromogranin and synaptophysin . At the periphery of the tumor nests, S100 protein-positive cells were identified, probably corresponding to sustentacular cells, in the absence of tumor keratin expression . Absence of immunoreactivity for keratins (AE1/AE3, CK7 and CK8/18) ruled out the hypothesis of primary or metastatic carcinoma, and supported the diagnosis of seminal vesicle paraganglioma. The Ki-67 labeling index was less than 2%. VHL and SDHB mutations were investigated using genomic DNA extracted from paraffin-embedded tumor sections (both from the seminal vesicle tumor and from the chromophobe renal cell carcinoma). No genetic alterations were found either in the VHL or in the SDHB genes.
+Thorough imaging analysis showed that there was no tumor elsewhere, which therefore reinforced the diagnosis of primary seminal vesicle paraganglioma. The patient is still alive after 14 months of follow-up and his blood pressure is under control.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2723_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2723_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9af59730cff88256f24e667be142d85c64553e44
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2723_en.txt
@@ -0,0 +1,5 @@
+A 30-year-old man with no significant past medical history or family history had felt numb of his left extremities for 1 month. He also complained of mild headache and interrupted vomiting. Physical examination at admission revealed no abnormal signs such as asymmetric pupils or hemiparesis. Cranial magnetic resonance imaging (MRI) showed multifocal lesions of the brain. The largest one was an occupying lesion at his right thalamus, with a compressive deformation of the right ventricle. This mass was mostly hyperintense on T1-weighted (T1W) and T2-weighted (T2W) images. After gadolinium (Gd) administration, the whole mass presented a heterogeneously enhanced character. While at the frontal angle of the left ventricle as well as pineal body region, two nodules with isointensity on both T1W and T2W images were detected, and they also mildly enhanced after Gd administration .
+The patient underwent a right occipitotemporal craniotomy after admission. With ultrasound guidance, a 4-cm-deep colostomy was carried out through the patient’s supramarginal gyrus to the occipital angle of the right ventricle. The mass was seen at the lateral wall of the ventricle, with grey and red appearance, uneven texture, and rich blood supply. There was an obscure boundary between the mass and normal tissue aside, as the tumor showed an infiltrative pattern of growth. Resection within the mass had alleviated the pressure, thus releasing some cerebrospinal fluid, which lowered the pressure even more. Then a total resection of the mass around its approximate boundary was achieved .
+The examination was approved by the Institutional Review Board of Beijing Tiantan Hospital, Capital Medical University. On gross examination, the surgically excised tissue, with a volume of 5.0 × 5.0 × 4.0 cm3 approximately, was heterogeneously soft and rough with pinkish color. On microscopic examination, the tumor was composed of a mount of large and bizarre giant cells with abundant eosinophilic cytoplasm on hematoxylin-eosin (H-E) staining, which was compatible with a diagnosis of glioblastoma. Scattered cells with loosely cohesive cytoplasm (that is, ‘vacuole sign’) could be seen, which indicated the presence of an oligodendroglioma component . Immunohistochemically, the astrocytic tumor cells showed weakly positive on the methylation of genes of O-6-methylguanine DNA methyltransferase (MGMT) promoter and strong mutation of phosphatase and tensin homolog (PTEN) genes . Additionally, the tumor cells were both immunoreactive for P53 and had amplificated vascular endothelial growth factor (VEGF) genes . The immunofluorescent staining of 1p19q showed there were no mutations existed .
+After the resection, the patient presented with lucid mind but mental fatigue, his left extremities’ muscle strength is grade I, while his right ones’ is grade V. The patient left the neurosurgery department with a wheelchair, and his Karnofsky Performance Scale (KPS) score is 50. Concurrent radiotherapy and chemotherapy were administered 1 week later, and the radiotherapy was three-dimension conformal and intensity-modulated which covered both the left ventricle and the surgical cavity of the right thalamus, with a dosage of 58.0 Gy in 29 fractions. At the meantime, the patient had continuous temozolomide, 160 mg (75 mg/m2/day) per day for 42 days. During this adjuvant therapy, the patient’s mental status got normalized, and his left hemiparesis was gradually improved with grade-IV strength of the arm and grade-III strength of the leg at the end of the medication. Complications other than mild nausea did not occur.
+A follow-up MRI study performed 4 weeks after radiotherapy (14 weeks after resection) showed thickened enhancement after Gd administration in the pineal body region and the frontal angle of the left ventricle, compared with the pre-radiation MRI study, which might indicate tumor dissemination to these areas. Adjuvant temozolomide with 150 to 200 mg/m2 for 5 days every 28 days was then administered to the patient for 12 cycles. During the long-term therapy, the patient was followed by MRI and clinical visits every 2 to 4 months. Blood testing for hematologic toxicity was performed every cycle, and the results did not show abnormal blood cell counting or changes in liver and kidney functions. Gastrointestinal toxicity or allergy was also not seen. After 8 cycles, the MRI showed significantly weakened signal in the frontal angle of left ventricle as well as the pineal body region on the Gd enhanced images. At the end of the 12-cycle therapy, the enhancement area of left ventricle almost disappeared, the same change presented in the pineal body region as well . At the recent clinical visit, the patient showed normal mental status, along with grade-IV muscle strength of his left extremities. The patient was back to work as a green worker, and his KPS score was improved to 90.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2727_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2727_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..76d2e954e830dc6068f213af269c820a9edd33e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2727_en.txt
@@ -0,0 +1,6 @@
+A 25-year-old man residing in the hilly district of Nepal presented with a 10-year history of pain and swelling in both hands and feet of insidious onset, progressive in nature without radiation but exacerbated during long travel and dangling of limbs associated with profuse sweating (hyperhidrosis) and progressive enlargement of hands and feet. He also gives a history of easy fatigability, heat intolerance and skin changes like acne, scalp dandruff and thickened eyelids. He had visited multiple health care centres for this concern for the past 10 years as the suspected diagnosis could not be confirmed by any laboratory results. None of the family members had a similar history.
+The patient was moderately built with marked thickening of skin folds in his forehead and evident swelling of bilateral ankle joints along with grade IV clubbing on both upper and lower limbs . Systemic examinations were otherwise normal. A clinical diagnosis of PDP, a rare genetic disease characterised by pachyderma, digital clubbing and periostosis was made. Normal serum insulin-like growth factor-1 (IGF-1) level and thyroid function tests ruled out our other differentials such as acromegaly and hyperthyroidism. Routine blood investigations including blood counts, liver function tests and renal function tests were also normal. Psoriatic arthritis was ruled out on the basis of the clinical history, which is generally limited to the extremities with psoriatic nail involvement and tests for rheumatoid factor and anti-cyclic citrullinated peptide were normal, ruling out suspicion of rheumatoid arthritis.
+Radiography of the ankle joint showed symmetric, shaggy subperiosteal new bone formation and cortical thickening leading to the characteristic dripping candle wax appearance of the fibula; coarse periosteal new bone formation in the distal tibia and fibula leading to distortion of the medial malleolus and periarticular osteopenia with preserved articular surface along with hyperostosis of the metatarsal bones .
+Hyperostosis of the metacarpal bones, proximal and middle phalanx with unaffected articular surfaces along with increased soft tissue shadow showing characteristic sausage finger appearance was also seen in the radiograph, which was supported by the clinical picture . Hair on the end appearance of the parietal bone along with hyperostosis of the skull bones and normal appearing Sella turcica was witnessed .
+After the diagnosis of PDP was made, he was prescribed with selective COX-2 inhibitor (etoricoxib 90 mg oral once a day) and he showed partial improvement in joint pain and swelling along with a gradual reduction of pachyderma making his daily life easier with treatment thereafter. Additionally, retinoid ointment was also used during this course, which might have improved symptoms of facial acne and skin changes whereas physical therapy also helped to improve joint mobility. Radiological follow-up after 6 months showed improvement in soft tissue thickening near the occiput and supraorbital ridge of the skull as well as in soft tissue swelling of the lower limb .
+Continuous pain and change in his physical appearance affected his personal and social life. Ambiguous diagnosis and deteriorating symptoms made the process of seeking medical help overwhelming. Over the course of treatment, the physical and mental well-being is now improving. For follow-up, he visits our outpatient clinic or communicates via telephone with the consultant. The patient experienced no complications from the condition or the medications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2737_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2737_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d0d8784be5b21d026d37b5fe0f84d976726eec4a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2737_en.txt
@@ -0,0 +1,10 @@
+A 22-year-old young man presented with diarrhea for nearly 1 year and diagnosed of thymoma for 4 months. He is a Chinese college student, with no medical history. He denied any tobacco, alcohol, drug and family history.
+The patient presented with diarrhea by sudden, did not have any recognizable precipitating factors. The frequency was 6 to 8 watery stools daily with tenesmus. There was no abdominal pain, hematochezia, or melena. The conventional antidiarrheal drugs and gluten-free diet were ineffective.
+Four months ago, because of cough and shortness of breath, he underwent a chest computed tomographic (CT) examination, revealing a huge anterior mediastinal mass that measured 7.2 cm craniocaudally, 6.7 cm transversely, and 4 cm anteroposteriorly, as well as invading into the left anonymous vein . 18F-flurodeoxyglucose positron emission tomography/CT showed the mediastinal mass was malignant, and no other malignant lesion was observed. Pathological examination by a core-needle biopsy specimen confirmed the diagnosis of thymoma. The abdomen and pelvis CT film showed the diffuse wall thickening of the colon . The enteroscopy showed the small intestinal villus atrophy, and the sigmoid colonic mucosa was markedly thinner than normal . The pathological examination confirmed the diagnosis of autoimmune enteropathy . In addition, the anti-intestinal goblet antibody, anti-centromere protein B antibody were also positive. Flow cytometric evaluation of lymphocyte subsets showed: CD3, 2266/µL, (reference range, 1185–1,901); CD4+, 782/µL, (reference range, 561–1,137); CD8+, 1334/µL, (reference range, 404–754). Assay of serum immunoglobulin levels showed: IgG levels higher than normal, while IgM, IgE, and IgD are normal.
+Considered that autoimmune enteropathy might be associated with thymoma, the patient was admitted to Beijing Tongren Hospital for tumor resection. On physical examination, the patient was severely malnourished and the vital signs were normal. Auscultation of the chest revealed scattered rales. The abdomen was soft, non-tender, and the bowel sound was exaggerated. The remainder of the physical examination was normal. On laboratory examination, levels of troponin I (TNI), B-type natriuretic peptide (BNP), creatine kinase-MB (CK-MB), and lactate dehydrogenase (LDH) were mildly higher than normal . The patient was positive for anti–RO-52, anti-titin, and anti-myocardial antibody, negative for anti-body and DNA of cytomegalovirus, and suspected clinically of having autoimmune myocarditisr .
+The oxygen saturation, renal-function and thyroid-function tests were normal; fecal occult blood tests (FOBT), hanging drop test, parasitological test, clostridium difficile toxin of stool were negative. The other laboratory results were shown in .
+Thymoma, left anonymous vein and involved anterior segment of the left-upper lobe were completely resected via median sternotomy . The surgical procedure was smooth. The amount of intraoperative bleeding was 200 ml and no transfusion.
+The patient and his parents provided written informed consent for their participation in the study, specimen collection, and publication of the results. During the consenting process, risks and benefits of research-based whole exome sequencing (WES), immunohistochemistry (IHC) and drug sensitivity testing (DST) were explained.
+Genomic DNA was isolated from peripheral blood and tumor tissue, detected among the whole exome of more than 20,000 exons by SureSlect Human All Exon V6 of Agilent Technologies, Inc.
+The paraffin-embedded thymoma tissues were cut into 4 µm of sections, stained with hematoxylin and eosin (H&E) and analyzed by immunohistochemistry (IHC).
+The collagen gel droplet embedded culture-drug sensitivity test (CD-DST) was performed as we described previously (, ). A sample of thymoma was collected from the fresh specimen during surgery. After 5–7 days’ growth, the colonies of thymoma cells were cultured in collagen gel droplets with Nutlin-3a (1.0 μg/ml) and analyzed by the image analysis method (the software Primage 1.0.6.3). The drug sensitivity was measured by the size of colonies. By measuring the size of colonies, drug sensitivity was tested.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2788_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2788_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d56210519f48ec9ff723160e0e4b4b9ca10eb5cf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2788_en.txt
@@ -0,0 +1,3 @@
+The patient was a one-day-old boy with a prenatally diagnosed omphalocele. A 34-year-old pregnant mother was referred to our hospital at 17 weeks (approximately 4 months) of gestation with the chief concern of a singleton fetus with a 30 mm (approximately 1.18 in.) cystic lesion near the umbilical cord base. A fetal magnetic resonance image (MRI) scan (25 weeks of gestation) revealed a 30 × 33 mm (approximately 1.3 in.) cystic lesion as shown in Fig. which was suspected to be an umbilical cyst. A follow-up MRI (at 34 weeks) revealed an umbilical cord hernia instead of a cystic lesion. The baby was born vaginally at 38 weeks, weighing 2956 g, with APGAR scores of 8 and 9 at 1 and 5 min, respectively. An omphalocele (hernial orifice diameter, 4 cm × 3 cm) with bladder prolapse was recognized as shown in Fig. . Based on appearance of umbilical site, physical examination and abdominal ultrasonography, the patient was diagnosed with a small omphalocele with bladder evagination. The small intestine prolapsed only while straining associated with crying, however, this was minimal, and we estimated that there would be low risk for hernia incarceration. So we planned the surgery for omphalocele with bladder evagination 1 day after birth.
+Under general anesthesia, the patient was placed in supine position. After hernia sac excision, the intestine was naturally reducible and there were no other structural anomalies. In order to secure sufficient bladder volume, we estimated the minimum residual volume as 21 ml after bladder plasty. For bladder capacity, the simplified formula: Capacity (mL) = 7 × weight (kg) was a reliable estimate of expected bladder capacity in infants independent of age . As shown in Fig. a, 8Fr. tube (Atom Multipurpose Tube, Atom Medical Corp, Tokyo, Japan) was inserted and the bladder was clamped as the maximum residual volume remained. And then clamped bladder was confirmed to be kept within the abdominal cavity. The bladder volume was also confirmed to be 30 ml using contrast medium. After the resection line was determined as shown in Fig. b, partial cystectomy was performed. The prolapsed bladder was resected and closed with two-layer continuous sutures with 4-0 PDS. The actual remaining bladder capacity was confirmed to be 30 ml by injecting a contrast dye and saline into the bladder. The patient had no associated cardiac, urogenital or skeletal anomalies. On pathological examination, bladder wall which was composed of mucosa and muscular layer was detected in the entire resected specimen.
+Postoperative course was uneventful. He was regularly followed up for 2 years after surgery , and underwent umbilicoplasty at 2 years old of age . He had no trouble with urinary function.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_278_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_278_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..16091a7cb3297b01bc84f7f4ed2c764d4e64b55a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_278_en.txt
@@ -0,0 +1,3 @@
+A 43-year-old man underwent radical total gastrectomy for gastric cancer. He was not taking medications for specific diseases such as hypertension or diabetes, and had no other familial, environmental, or social problems. A postoperative intra-abdominal abscess developed around the anastomotic site due to an esophagojejunal anastomotic leak, which improved after percutaneous drainage and conservative therapy. Histopathological examination of the tumor revealed mixed differentiated adenocarcinoma; the tumor was classified as stage IB (pT1bN1M0) according to the 7th TNM classification of the International Union Against Cancer. He received adjuvant chemotherapy with oral 5-FU for 2 years. Analysis of tumor marker levels (CEA and CA19-9) was performed every 3 months and computed tomography (CT) imaging and gastrofibroscopy (GFS) every 6 months. About 29 months after gastrectomy, CT imaging was performed and revealed a solitary localized mass measuring 43 mm in diameter among the retroperitoneal lymph nodes of the posterior inferior vena cava (IVC) (A). The patient’s physical examination, neurological examination, laboratory including tumor marker analysis, and other radiologic findings (including positron emission tomography-CT) were unremarkable. We considered that his previous gastric cancer recurred either in a lymph node or the retroperitoneum. Second-line chemotherapy consisting of oxaliplatin and 5-FU (FOLFOX) was administered in four cycles. However, a follow-up CT scan indicated that the tumor rapidly enlarged (59 mm); no new lesions were observed (B). Hence, we decided to completely resect the tumor due to lack of response to the chemotherapy. His vital signs and laboratory findings upon admission were normal, including CEA level (1.9 ng/mL) and CA19-9 level (10.6 U/mL). His operative finding was the tumor strongly adhered to the IVC; therefore, this part of the IVC was also removed via an en bloc resection of the tumor mass. Ascites and peritoneal disseminated lesions were not detected during the procedure. Macroscopically, the tumor was hard and fibrotic, measuring 66 × 58 × 50 mm. The cut surfaces were multinodular, diffusely edematous, and myxoid with focal petechial hemorrhagic necrosis (approximately 15%) and had a fish-flesh appearance . The pathological examination showed pleomorphism with bizarre multinucleated tumor cells and an average of 19 mitoses per 10 high-power fields in the tumors (A). The tumor was immunohistochemically positive for smooth muscle actin (SMA), desmin, and H-caldesmon and negative for c-KIT, CD34, and S-100 (B).
+Finally, the patient was diagnosed with pleomorphic and epithelioid leiomyosarcoma with high mitotic activity. We assumed that the leiomyosarcoma was a second primary malignancy that developed from the retroperitoneum.
+The patient’s postoperative course was favorable. He received adjuvant chemotherapy and radiotherapy. He did not experience disease recurrence for 3 years and underwent surgical resection of locoregional and lung metastasis. He survived for 5 years.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2802_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2802_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e537ef436d3c493992ca56a02a96621b217d3ab9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2802_en.txt
@@ -0,0 +1,4 @@
+A 69-year-old Japanese man who sustained an injury in a car collision received first aid at a nearby hospital and underwent craniotomy surgery for traumatic acute subdural hematoma, traumatic subarachnoid hemorrhage, and traumatic localized brain contusion. Conservative treatment was given for left-sided condylar process fracture, axis fracture, right clavicle fracture, and right fracture of the distal radius. After his consciousness disorder improved, 4 months after injury, it became clear that the patient was unable to close his mouth. His TMJ may have been dislocated during intubation. The mouth presented in an open state, with lip closure incapacity . Stenosis of the jaw dentition was demonstrated with labioclination of the front tooth, open bite, and xerostomia. The patient had a tracheostomy and could not evaluate the verbal response, Glasgow Coma Scale (GCS) 11. Traumatic brain injury left paralysis of his right upper extremity. The patient was at high risk of aspiration pneumonia due to diminished swallowing function, so the previous doctor had performed an additional gastrostomy, which recovered his ability to eat.
+Panoramic radiography examination revealed a left condylar process fracture and dislocation of the bilateral mandibular condyles. On computed tomography examination, the left condylar process fracture on the medial side and both mandibular condyles greatly exceeded the articular tubercle .
+We attempted a manual reduction owing to the existing diagnosis of old left condylar fracture and bilateral anterior dislocation of the TMJ, but reduction was impossible. Therefore, we planned to perform right condylar resection using an intraoral approach. In addition, we evaluated the planned procedure using a three-dimensional model and confirmed that it would not disturb the jaw reposition, because the left condylar process fractures to medial. We confirmed that it was difficult to reduce and fix the old fracture and that it did not interfere with the reproduction of the original occlusion on the three-dimensional model, so we decided to treat it conservatively.
+We performed right condylectomy with the patient under general anesthesia. Manual reduction was performed again in a state of muscle relaxation, but reduction was not possible. After an incision was made in the buccal mucosa according to the sagittal split ramus osteotomy, the inside and outside of the mandibular ramus was revealed, and the coronoid process and the neck of the mandible were confirmed . The coronoid process obstructed the visual field, so it was cut and resected with a reciprocating saw . Using a saw and osteotome, the base of the condylar was cut and separated from the surrounding soft tissue to remove the condylar head . We confirmed that the mandibular body had moved backward and that the molars could achieve the occlusion, and the wound was closed. Intermaxillary traction was started during the postoperative period using an intermaxillary fixation screw inserted in the alveolar region to improve occlusal deviation. Twenty-one days after the operation, a normal occlusion was obtained, and intermaxillary fixation screw was removed. During the 12-month postoperative follow-up period, no TMJ dislocation recurred, and the occlusion remained stable . After the operation, he was able to open and close the mouth by himself, and the lips could be closed, so that hypersalivation did not occur. His left condylar process was displaced inward owing to a fracture, but the opening and closing movements were possible because the hinge movement centered on the left condylar process.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2803_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2803_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cb10f79d4984b81de423544fca0a1287e1b78653
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2803_en.txt
@@ -0,0 +1,3 @@
+A three-year-old girl was first referred to us at nine weeks of age with persistently high inflammatory markers and neutropenia. She was born at full term to two healthy, non-consanguineous parents of African descent. An emergency caesarean section was required for fetal distress and a poor fetal blood gas and meconium-stained liquor was noted at delivery. She required 25 min of supplementary oxygen to maintain her saturations shortly after birth.
+At 12 h of age, she was admitted to the neonatal unit for treatment of suspected sepsis. Three hours later, she developed left sided partial seizures for which she was treated with phenobarbitone. Seizures ceased but monitoring continued to show seizure-like activity. Magnetic resonance imaging (MRI) on day four of life showed changes consistent with bilateral infarction and electroencephalogram (EEG) was consistent with multifocal epilepsy. Full body MRI was normal. A decision was made by neurology to hold off commencing regular antiepileptic medication at this point.
+Despite several negative blood cultures, a negative meningitis screen and multiple courses of antibiotics, inflammatory markers remained high. C-reactive protein (CRP) fluctuated but never normalised despite the apparent clinical improvement with no further seizures or systemic symptoms. Her feeding, growth and development were normal and examination was otherwise unremarkable. However, at the age of nine weeks, she was persistently anaemic with an ongoing raised CRP. She was therefore referred to the rheumatology clinic with a suspected inflammatory disease and was seen in the autoinflammatory clinic due to her age and presentation with an apparently early onset inflammatory disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2808_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2808_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eec7cf85f50964d24ac8e3262cde687b90b8f74d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2808_en.txt
@@ -0,0 +1,10 @@
+A 32-year-old woman was admitted to our hospital with a progressively enlarged mass in the rectovaginal space for 9 years.
+The mass was found during a routine examination 9 years ago and no obvious progression was seen in following annual examinations until a year ago. The maximum diameter of the mass had significantly grown from 4.0 cm to 9.7 cm in a year, with dents in stools, which was caused by tumor compression. The patient had a submucosal protrusion demonstrated by endoscopy in a local hospital. However, no absolute tumor tissue but only inflammation was found after several times of endoscopic biopsies in the latest 2 years, which was not consistent with clinical estimation. Therefore, she came to our hospital for further diagnosis .
+The patient had no previous medical history.
+The patient and family had no history of previous similar illness.
+The patient’s mental status, appetite, sleep, and weight were normal without any obvious symptoms of abdominal distension, tenesmus, prolapse, diarrhea, or constipation. The anterior rectum wall was plump during digital rectal examination without tenderness or blood stain on the fingertip.
+Laboratory examinations were normal, including routine blood analysis, carcinoembryonic antigen, α-fetoprotein, carbohydrate antigen (CA) 19-9, and CA125.
+Contrast-enhanced CT (CECT) showed a mass with liquefaction necrosis (low density area) inside the rectovaginal space, with an obscure margin . Transabdominal US was performed. A heterogeneous hypoechoic mass with a maximum diameter of 9.7 cm was also seen in the rectovaginal space , which was suspected to be a rectal GIST or exophytic uterine fibroid.
+Transabdominal CNB (MG1522 BARD MAGNUM Biopsy Instrument; Tempe, AZ, United States; disposable core tissue biopsy needle, gauge size and needle length: 16 G and 16 cm) was performed to make a definite diagnosis . Before the operation, written informed consent was obtained from the patient, and her preoperative regular laboratory examinations were normal, including routine blood test, coagulation function, and blood transfusion set. Some hemorrhage occurred from the vagina, causing premature end of the biopsy, and spontaneously relieved several days later. Strips of greyish shattered tissue were obtained, with the largest diameter smaller than 0.3 cm. Pathology indicated inadequate biopsy tissue for diagnosis. Another biopsy after ERUS assessment was recommended by multiple disciplinary treatment (MDT).
+First, ERUS was performed with the MyLab Twice US system (Esaote, Genoa, Italy) equipped with a biplane endoscopic probe (TRT33, linear frequency of 4–13 MHz, convex frequency of 3-9 MHz), recording the location, size, stratification, adjacence, and echogenicity of the tumor. Then CEUS was performed with a bolus injection through the elbow vein of 2.4 mL SonoVue (Bracco, Milan, Italy) . Because of the heterogeneity of the tumor, it was difficult to recognize the necrotic from non-necrotic part in B mode, which can be clearly depicted by CEUS as nonenhanced vs enhanced area. As previous CECT has pointed out necrosis, CEUS was performed right before puncture to confirm the substantial part of the tumor for biopsy guidance for the second time, avoiding the failed samples inside presumptive solid area, which turned to be non-enhanced after CEUS. This guarantees the precision and efficiency of biopsy samples.
+The probe was switched to linear mode. The transperineal puncture site and path were decided, and disinfection as well as drape were also completed. After local anesthesia, a freehand biopsy of the lesion was performed with the guidance of in-plane needle. The needle tip and its movements were continuously monitored in real time by ERUS during the whole puncture procedure to procure the tissue of lesion from enhanced area of the tumor on CEUS . Several strips of greyish tissue were obtained with a length of 0.3-1.2 cm . No complications occurred.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2838_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2838_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6bbfbb60ff58821a68a760efccb9772b8d83ad95
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2838_en.txt
@@ -0,0 +1,2 @@
+A 54-year-old Caucasian male patient with no previous history of any disease was referred to our clinic on January 2001 with rectal bleeding. A colonoscopy showed an ulcerated polypoid mass in his rectum that was 12 cm distant from the anal verge. A pathological examination of the biopsied specimens revealed a GIST. Surgery was performed and the mass was excised by en bloc resection technique. A computed tomography (CT) scan of his thorax demonstrated no pathological finding. Multiple and non-resectable bilobar liver metastases were found on abdominal magnetic resonance imaging (MRI). Our patient was started on imatinib 400 mg daily in 2001. After an event-free follow-up period, our patient was readmitted in 2010 with complaints of right shoulder pain and limitation of shoulder movement. His liver metastases were seen to be stable on the abdominal and pelvic MRI. No local recurrence was found during a colonoscopic examination.
+MRI showed a 13 cm × 10 cm × 7 cm mass with partial contrast-enhancement that was T1- and T2-hyperintense and heterogeneous. The mass was destroying the body of his right scapula and had widespread involvement in the infraspinatus muscle. A fluorodeoxyglucose positron emission tomography (PET)-CT showed a hypermetabolic mass in his posterior right shoulder . The mass was resected . On microscopy, the tumor was composed of an interlacing pattern of spindle cells that stained negative for smooth muscle actin, and positive for CD117 (c-kit) and CD34 . Pathologic findings were compatible with metastasis of GIST to the scapula. Following resection, his imatinib therapy was changed to sunitinib. At the time this report was written, our patient was still taking sunitinib 50 mg daily.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2852_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2852_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..94d948ad972e2ad65c5bd6306178ebb1fef26709
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2852_en.txt
@@ -0,0 +1,10 @@
+In October 2006, a 46-year-old man received brain MRI, advised by a family doctor to investigate the persistency of memory loss and headaches unresponsive to pain killers medications. MRI evidenced a previously unknown infra- and supra-sellar mass of 3.5 × 2.6 cm, with high pressure on the third ventricle and on the interpenducular cistern; with MRI contrast, peripheral highlighting and an 8 mm enhanced solid nodule were found; the imaging was consistent with a diagnosis of cystic craniopharyngioma .
+Subsequently, the patient underwent fronto-temporal trans-cranial excision of the lesion and histological examination confirmed the diagnosis of PCP. In January 2007, the patient was referred by a multidisciplinary committee for discussion of adjuvant radiotherapy (RT), which was confirmed and then administered (total of 50 Gy in 25 fractions). Follow-up visits with clinical and radiological evaluations were periodically performed until 2013, every 3 months when the patient decided to discontinue medical examinations.
+In November 2019, for the onset of vertigo and episodes of lipothymia, the patient accessed the emergency department where he performed computed tomography (CT), which showed an iso-dense infra and supra-sellar solid mass of 19 × 23 mm.
+Additionally, a brain MRI was also performed, which confirmed the presence of a 25 × 38 × 23 mm lesion that extended to the chiasmatic and inter-peduncular cisterns and the flooring of the third ventricle; mass effect had displaced the pituitary gland to the right and had caused compression of the pons .
+Thus, a second surgery was indicated for avoiding medical complications. Preliminary endocrinological and ophthalmological evaluations were performed and showed no critical signs. Therefore, in January 2020, the patient underwent total resection of the neoformation via endonasal endoscopic approach and the histological examination confirmed the recurrence of craniopharyngioma. The postoperative course was complicated by polyuria, mental confusion, dysphasia, ptosis, mydriasis, and ophthalmoplegia, and partially improved by palliative treatment with prednisolone and mannitol. Late surgery-related complications were anosmia and psychomotor impairment. At this stage, considering the young age of the patient and the clinical aggressiveness of the tumor, not controlled by curative treatments with surgery and RT, molecular analysis on the surgical sample was carried out: real-time polymerase chain reaction (PCR) for BRAF gene mutation and then next-generation sequencing analysis for a panel of >300 genes was carried out and the canonical mutation V600E in the exon 15 of BRAF gene was identified as the only relevant mutation (c.t1799a, p. V600E). As previously anticipated, the BRAF mutation had been recognized as a characteristic mutation of PCP, being identified in most, but not all, PCP and never in adamantinomatous craniopharyngioma (ACP). Post-operative brain MRI performed in February 2020 revealed residual tissue with dimensions of 19 × 22 × 19 mm, and after contrast, an inhomogeneous increase in this lesion occurred . The timeline of the clinical course is highlighted in .
+Due to the lack of standardized therapeutic approaches, an off-label therapy has been requested, considering BRAF mutation status. In literature, there have been several reports of remarkable responses to BRAF and/or MEK inhibitors (vemurafenib, dabrafenib, and combination therapy) in craniopharyngiomas in various stages, since the discovery that PCPs often harbor BRAF gene mutation .
+The patient started combination treatment with double inhibition of BRAF and MEK with Dabrafenib 300 mg/day and Trametinib 2 mg/day .
+The patient was consequently evaluated monthly clinically and with a biochemical profile. The treatment was initially well tolerated with no relevant adverse reactions.
+At 4 months, laboratory results showed a pathological increase intriglyceride and Cholesterol levels, graded 3 on the CTCAE scale, rarely described during treatment with BRAF/MEK inhibitors. Anti-BRAF and anti-MEK were then suspended temporary and the patient was referred to an endocrinologist: a new medical treatment was established with Fenofibrate and Omega 3 with following the reduction in laboratory levels: oncological treatment was then resumed with dose reduction in accordance to European Medical Agency (EMA) recommendation (Dabrafenib 200 mg/day, Trametinib 1.5 mg/day) when levels reached grade 1, according to CTCAE scale. This was the only adverse event reported by the patient and it did not influence his quality of life. At the time of writing, treatment is ongoing (the total time of treatment until now is 14 months).
+First radiological evaluation with MRI after 4 months of treatment showed not only a significant volume reduction of the tumor (14 × 9 × 5 mm vs. 19 × 22 × 19 mm) but also a reduction of the mass effect on the surrounding tissue, for example, realignment of chiasmatic structure . The last radiological evaluation, performed in August 2021 with MRI after 1 year of treatment, showed overall stability of tumor burden compared to November 2020 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2855_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2855_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..794c209f49ed0eabe567e760e2a52cfb140ac93a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2855_en.txt
@@ -0,0 +1 @@
+A 67-year-old Caucasian female with glipizide- and metformin-treated diabetes mellitus and enalapril-treated arterial hypertension presented for open reposition and Zuggurtung fixation of a fracture of the olecranon. The elbow was fractured in a bicycle accident and had been conservatively treated for 14 days prior to surgery. The patient had suffered from diarrhoea and signs of confusion in the period between the trauma and surgery, but had been free of gastrointestinal or neurological symptoms during the week before surgery. The patient had not sought professional medical advice for these symptoms. When the patient presented for surgery, she was lucid, without any gastrointestinal symptoms and otherwise physically well. The preoperative laboratory work-up tests were without pathological signs . At the operating ward, 1 g paracetamol, 100 mg diclofenac, 10 mg oxycodone and 25 mg meclizine were administered orally as premedication. The anaesthesia was induced with propofol and fentanyl. The airway was secured by orotracheal intubation after which the anaesthesia was maintained with sevoflurane. The time of surgery was 31 min and the total anaesthesia duration was 70 min. After uncomplicated surgery and anaesthesia, the patient was transferred to the postoperative unit from where the patient went home after 3 h accompanied by her next of kin. During the first postoperative evening and night, the patient’s next of kin observed that the patient had problems with articulating words followed by increasing anxiety and confusion. At the next morning, the patient only spoke unrecognizable words, and by the afternoon, she could not walk. Approximately 24 h after leaving the hospital, the patient presented at the emergency ward. Respiration and circulation were normal and the patient was afebrile. A computed tomography (CT) scan of the brain was performed as well as an analysis of the cerebrospinal fluid, with both indicating no pathological signs. A neurological consult ordered an electroencephalogram (EEG) and a magnetic resonance imaging (MRI) of the brain to be performed as soon as possible at a secondary hospital to which the patient was referred. At arrival to the secondary hospital on the second postoperative day, the patient did not respond verbally, could not open her eyes spontaneously and the best motor response was withdrawal of the limbs on pain stimulation (Glasgow Coma Scale, GCS 9). It was noted that plasma creatinine was elevated to 313 μmol × L-1. Except for an elevated C-reactive protein (CRP) at 76 mg × L-1, all blood analyses were in the normal range, including haemoglobin, leucocyte and platelet count. On the night between the second and third postoperative day, the patient suffered a generalised tonic-clonic seizure. The patient was transferred to the intensive care unit, where she, was orotracheally intubated and mechanically ventilated. A second CT scan of the brain showed no bleeding or ischaemic signs. The patient was respiratory and circulatory stable and did not require an increased oxygen fraction or vasoactive drugs. The patient was anuric, was not icteric and did not have any pathological signs on the skin. Blood cultures were drawn and an antibiotic was given based on a body temperature of 38.9°C and tachycardia. The patient was started at 4 g piperacillin-tazobactam 3 times per day intravenously (i.v.). The cultures did not show any bacterial growth. Because the patient had elevated serum potassium of 5.8 mmol × L-1 and hyponatraemia of 131 mmol × L-1, blood was analysed for serum cortisol on the suspicion of Addison’s disease. Accordingly, the patient was given 100 mg hydrocortisone i.v. Cortisol in serum was found to be 796 nmol × L-1 and thus the suspicion of Addison’s disease was refuted. The patient was now anaemic with a haemoglobin of 86 g × L-1 and thrombocytopenic with a platelet count of 31 × 109 × L-1. Lactate dehydrogenase was elevated to 21.5μkat × L-1 and haptoglobin low at 0.07 g × L-1, which indicate haemolysis. The blood film showed schistocytosis., On the third postoperative day, plasmapheresis was started on the indication of HUS/TTP. One plasma volume was replaced daily for four days and continuous veno-venous haemodiafiltration was performed between plasmapheresis treatments. The patient’s haemoglobin and platelet count improved during treatment . The same positive development was seen for creatinine. Neurological status improved slowly and on the seventh postoperative day, GCS was 6 with withdrawal of the limbs on pain stimulation. Polymerase chain reaction (PCR) revealed enterohaemorrhagic E. coli (EHEC) in faeces. The serotype was non-O157, produced verotoxin type 2 and was eae-gene negative. Blood analysis of Adamts-13 protein activity showed normal levels and antibodies against the protein were not observed. Signs of multiple small ischaemic fronto-temporal cortical lesions were noted on an MRI scan, as well as lesions in the circulus Willisi and the basilar artery with narrowing and more distal dilatations of the vessels. Analyses of anti-neutrophil antibodies and anti-neutrophil cytoplasmic antibodies were negative. The neurological consult assessed the clinical picture together with the MRI findings as thrombotic microangiopathy. The patient continued to show slow improvement in neurological status with spontaneous eye opening and the ability to move all limbs, although with substantial weakness. The patient could make eye contact on instructions on the 20th postoperative day but was still anuric and in need of intermittent haemodialysis and mechanical ventilatory support. On the 21st postoperative day, the patient suffered a generalised tonic-clonic seizure followed by deep coma (GCS 3). EEG showed generalised deeply suppressed activity. A joint decision was made with the next of kin to withdraw all treatment. The patient died 6 h later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2883_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2883_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3f462d6e375f4d9e51e68f231163297100b5ef7f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2883_en.txt
@@ -0,0 +1,3 @@
+An 83-year-old woman with permanent AF, undergoing treatment with direct oral anticoagulant therapy (rivaroxaban 15 mg once daily), was referred to our hospital due to fatigue and worsening dyspnoea. Upon admission, the patient was afebrile (36°C), and exhibited a blood pressure of 125/78 mmHg, a pulse rate of 96 beats per minute, and an oxygen saturation of 92% on room air. Cardiac auscultation revealed a 2–3/6 systolic murmur at the lower sternal border and at the apex of the heart, radiating to the left axilla. Laboratory tests revealed severe microcytic anaemia, with a haemoglobin level of 4.9 g/dL (normal range: 13.8–18.0 g/dL). No signs of haemolytic anaemia were identified. The patient presented a CHA2DS2-VASc risk score of 4 and a HAS-BLED score of 4. Previous medical history was characterized by degenerative mitral valve disease complicated by severe mitral regurgitation. In 2016, patient underwent mitral valve repair with ring annuloplasty, tricuspid annuloplasty, and surgical LAA ligation. Her past medical history was also remarkable for arterial hypertension, dyslipidaemia, chronic anaemia, and previous erosive gastritis. Endoscopic examinations revealed gastric polyps, colonic diverticulosis, and enlarged haemorrhoids, with no evidence of recent or ongoing haemorrhage. The search for Helicobacter pylori yielded negative results. Transthoracic echocardiography showed normal left and right ventricular systolic function, residual mild to moderate mitral regurgitation, and severe tricuspid regurgitation. Transoesophageal echocardiography (TEE) ruled out intracardiac thrombi but revealed incomplete surgical LAA occlusion with a narrow neck of 5 mm in conventional 2D images and 13 × 6 mm using multiplanar reconstruction of acquired 3D datasets (, , , , and ).
+The patient was transfused with six units packed red blood cells, with clinical improvement. Rivaroxaban was discontinued. Based on both the high bleeding risk and the results of the echocardiography study, the Heart Team members indicated percutaneous transcatheter LAAC to best manage the patient. Pre-procedural imaging with cardiac computed tomography (CCT) scanning was performed, showing a bilobed LAA with dehiscence of the ostium and a neck of 13 × 8 mm (, , ). The LAA presented an elliptic landing zone with a major axis of 22 mm and a depth of 17 mm .
+The procedure of LAAC was carried out with the patient under general anaesthesia. Adequate anticoagulation with heparin was maintained throughout the procedure (activated clotting time [ACT] 250–300 s). The intra-procedural combined angiographic and echocardiographic evaluation demonstrated a maximum LAA diameter ranging from 20–22 mm ( and ): thus, an Amplatzer Amulet 28 mm was considered to be the best choice. The device was delivered with good LAA sealing by the body of the prosthesis (see , and ), without peri-device leak. A slight protrusion of the external disc in the left atrium was observed without impeding of the mitral valve leaflets excursion (, , ). No pericardial effusion was detected, and the patient was discharged on single antiplatelet therapy (clopidogrel), remaining clinically stable on post-operative Day 2. One month post-procedure, the patient was asymptomatic with a haemoglobin level of 11.2 g/dL, and no complications were recorded. Transoesophageal echocardiography examination confirmed the device’s position without signs of thrombosis. After three months, the stability of the haemoglobin level and the absence of device thrombosis allowed the discontinuation of antithrombotic therapy . One year after hospital discharge, the patient did not experience adverse clinical events. Transthoracic echocardiography confirmed the stable position of the device.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2892_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2892_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7323f29c55af7a3412fc7ba35d2b4d99402506d7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2892_en.txt
@@ -0,0 +1,4 @@
+A 39-year-old woman was admitted complaining of sudden-onset headache, nausea, and vomiting for 1 day. She had a history of hypertension for 10 years and denied any history of diabetes, hyperlipidemia, autoimmune diseases, or other remarkable illnesses. She was alert and could correctly obey commands. Physical examination was unremarkable except for neck stiffness. Her blood glucose, electrolytes, blood cell counts, coagulation test, and antinuclear antibody series were within normal limits during laboratory investigations.
+Head computed tomography (CT) showed a subarachnoid hemorrhage (SAH) concentrated in the perimesencephalic cistern . CT angiography (CTA) showed that the bilateral ICAs were absent in the skull base . The bilateral MCAs and anterior arteries were normal. An aneurysm was identified in the PCA region .
+Head digital subtraction angiography (DSA) showed that the bilateral internal maxillary arteries and ascending pharyngeal arteries were confluent with the cavernous portion of the ICAs at the skull base. And the bilateral ICAs above the cavernous portion of the ICAs, the MCAs, and the anterior cerebral arteries were normal . The right vertebral artery (VA) was fine, while the left VA was well developed . Moyamoya-pattern collateral vessels could be seen in the bilateral PCAs region, the distal part of the PCA was composed of abnormally fine vessels, and an aneurysm was clearly identified in the left moyamoya-pattern collateral vessels .
+She was diagnosed as bilateral carotid RM, moyamoya-like vessels in the PCA region, intracranial pseudoaneurysm, and SAH. Management of the aneurysm was difficult, and wait and see management was adopted. The patient experienced an uneventful recovery and was discharged 1 week later. Follow-up CT performed 44 days later showed complete resolution of the SAH . Head DSA revealed that the pseudoaneurysm disappeared spontaneously while the moyamoya-pattern collateral vessels were unchanged, the distal part of the PCAs became finer and smaller, and the transdural compensation of the posterior meningeal artery was visible . The patient was in good condition during follow-up, she returned to her normal activities.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2900_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2900_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ff8a3e3dfd95e6ada6a7c05600ba6fe01e41e24c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2900_en.txt
@@ -0,0 +1,5 @@
+A 32-year-old Caucasian woman with atopy and relevant seasonal allergic rhinitis in the springtime was diagnosed EoE in 09/2018. Symptoms were somewhat atypical with postprandial coughing, especially after consumption of pasta and bread, regurgitation and intermittent dyspnea. After diagnosing EoE, treatment with fluticasone powder was initiated and continued for 16 months. Induction therapy was started at 2x1000μg/day for 2 weeks, then reduced to 2x500μg/day and 3x250μg/day, respectively. This therapy with fluticasone was in off-label prescription. When the orodispersible budesonide tablet became available in Switzerland, a change in therapy was planned. The switch to orodispersible budesonide 2x1mg/day is called day 1. Approximately 8 hours after the intake of the first effervescent tablet, a “strange pruritus” was felt in the throat. This sensation worsened with each subsequent intake. Three days later (day 4) approximately 1 h after the intake of the evening dose symptoms progressed and the patient complained of dysphagia and dysarthria. On day 5, she consulted an otolaryngologist office because of persisting tongue-numbness and a burning throat sensation. In the evening of day 5 tongue, lips, face and the oral mucosa became swollen. She was unable to lie down because of swallowing difficulties due to increased mucus production. She felt a burning pain behind the sternum and experienced a feeling of tightness. In the morning of day 6, she was referred to the emergency unit of the local hospital. The orodispersible budesonide was stopped. Clinical examination showed a generalized intraoral swelling and deep mucosal redness. In addition, small transparent vesicles grouped in the middle of the hard palate were noticed. A smear test of the vesicles on the palate was positive for H. simplex virus type 1. CRP was slightly elevated (10,9 mg/l), eosinophil count was normal (0.30G/l).
+After treatment with clemastine (3 mg) and methylprednisolone 40 mg i.v. facial and mucosal swelling subsided within a few hours. A consecutive oral therapy with cetirizine 10 mg was prescribed. Swelling of the upper lips reoccurred the next day (day 7), but symptoms disappeared with oral prednisolone 50 mg/day over a period of 2 days. Dose was tapered to 20 mg and finally to 10 mg/day over a week. This dose was maintained for 2 weeks. Because allergy to budesonide was suspected, the patient was referred to an allergy workup.
+The allergy workup was performed within 2 months after the reaction and included patch tests to Jorveza® and the corticosteroids tixocortol pivalate 1%, hydrocortisone 1%, prednisolone 1%, budesonide 0.1%, amicinonide 0.1%, triamcinolonacetonide 0.1%, dexamethasone 0.1%, hydrocortisone-17-butyrate 0.1%, betametasone-17-valerate 0.12% and clobetasol-17-propionate 0.25% and tixocortol-21-pivalate 3 μg/cm2, budesonide 1 μg/cm2, hydrocortizone-17-butyrate 20 μg/cm2 (allergEAZE® and T.R.U.E. TEST® SmartPractice, Hillerod, Denmark). Petrolatum was used as a negative control. Patch tests were removed 48 h after application and skin reactions were read after 48 and 72 h. Significantly positive reactions (++) with erythematous papules and isolated vesicules were observed to budesonide (tested twice) , (b)) and the incriminated medication Jorveza® ). Overnight after test application, a mild itchy flexural exanthema involving the insight of both elbows, neck, behind the ears and the décolleté area developed ).
+Since the patient subsequently developed coughing and dysphagia again as before EoE treatment, the therapy was switched back to the formerly well tolerated fluticasone on day 45 with 500 μg/day for 5 days following which the dose was raised to 1000 μg/day. No side effects have been observed since.
+Retrospectively, the patient was already treated with inhaled budesonide (Symbicort®, AstraZeneca AB, Sweden) 17 years ago for 6 months, but did not develop any symptoms at that time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2926_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2926_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4f6bbc8577632fe852c00a9527f15e029a534c25
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2926_en.txt
@@ -0,0 +1,8 @@
+A 31-year-old woman presented with a 5-day history of double vision in all directions, holocephalic headaches, and nausea. Radiologic workup showed a hyperintense lesion extending from the fourth ventricle to the lamina quadrigemina and causing a hydrocephalus occlusus . An external ventricular drainage (EVD) was immediately inserted, and 1 day after, the resection of the ventricular mass was scheduled.
+Surgical strategy and patient positioning were discussed based on routinely used 2D DICOM (Digital Imaging and Communications in Medicine) images and further analyzed using 3D MxR technology.
+The novel MxR system utilized for holographic rendering and 3D visualization consisted of different components . The primary component was a CE-certified cloud environment (Lumi, Augmedit bv, Naarden, Netherlands) providing a direct MxR output using a validated expanding mesh algorithm (Disior, Helsinki, Finland) (, ). The Lumi cloud environment had associated applications for MxR glasses, which represented the second component of the system and the main tool for 3D visualization of the hologram (Hololens 2, Microsoft Corporation, Redmond, WA, USA).
+2D DICOM images from an external institution were loaded in a completely anonymized form on the novel CE-certified cloud environment (Lumi by Augmedit bv, Utrecht, Netherlands) starting from the acquisition of an axial T1 MPRAGE with contrast medium (Siemens Skyra 3 T MRI, TR = 1,800 ms, 168 slices, slice thickness = 1.0 mm, acquisition matrix = 256 × 232, FOV: 90.62, pixel spacing: 0.48828125). The magnetic resonance study was automatically segmented on the platform to highlight the skin, skull, brain, ventricular system, and tumor. Following the automatic segmentation, the tumor was further refined by means of manual segmentation on 3D Slicer (3D Slicer image computing platform | 3D Slicer) .
+Through the MxR glasses, the primary user could visualize the hologram in 3D and interact with it and project it onto the real anatomy of the patient, manually matching it using her head to review and plan surgical positioning and the approach .
+To manage the increased intracranial pressure caused by an occluded hydrocephalus due to the mass effect, a right frontal EVD was inserted a day prior to the removal of the tumor.
+Based on the combined analysis of 2D images and, most importantly, the 3D model, the patient underwent a parietal craniotomy with a subsequent interhemispheric transtentorial approach to the fourth ventricle. The MxR-3D visualization of the venous anatomy and the relationship of the tumor with the ventricular system was decisive in choosing a right parietal craniotomy to release maximally the right parietal vein frontally. This approach granted a straight trajectory posteriorly from the right parietal vein and right in the axis of the tumor. The 3D holographic visualization greatly helped in planning and rehearsing a surgical trajectory that could avoid the risk of injury of the basal cerebral veins. Furthermore, surgical planning with the 3D hologram endorsed the need to open the tentorium parallel to the straight sinus to achieve better intraoperative vision and control of the tumor . Patient positioning was designed according to the MxR planning, and the patient was positioned three-quarters prone with the head secured in a skull clamp slightly elevated and tilted toward the floor. A linear occipito–parietal incision along the midline was the approach chosen.
+To confirm gross–total resection of the tumor, an intraoperative MRI was performed, revealing 98% removal of the lesion with a small remnant at the tectal level, which was too adherent to the great vein of Galen to be safely removed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2934_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2934_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99329a87357883541b51e5aac47cc730d407e4e1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2934_en.txt
@@ -0,0 +1,7 @@
+A 27-year-old man, a laborer from Vietnam, sustained head injury and severe pain as well as swelling and deformity in both lower limbs as a result of a road traffic accident on July 7, 2018.
+The patient had no medical history.
+The patient had no special past illness.
+The patient had no history of drug allergies, smoking, or drinking, and no relevant family history.
+The patient was brought by ambulance to our emergency room (ER) for treatment. A general examination revealed that the patient had a head injury with a Glasgow Coma Scale score of E4V5M3 and clear consciousness, and he was able to communicate. The initial vitals revealed hypotension (82/55 mmHg), tachycardia (107 beats/min), and a respiration rate of 26 breaths/min. During the clinical physical examination, the patient was bedridden and was incapable of stepping on or making small motions with either foot. Multiple bleeding lacerations were observed on the left forehead (3.0 × 2.0 cm), lower lip (2.0 × 1.0 cm), anterior neck (4.0 × 1.0 cm), left anterior thigh (2.5 × 2.0 cm), left posterior heel (4.0 × 1.0 cm), and right posterior thigh (3.0 × 1.0 cm). Multiple abrasions were also identified on his face, body and limbs. The thighs and lower limbs appeared deformed, with free floating bone fragments. Distal pulses, including in the bilateral popliteal artery, posterior tibial artery, and pedal dorsal artery, were palpable.
+Routine blood tests revealed that hemoglobin was 9.5 mg/dL, and other blood chemistry results, including for liver and kidney function and electrolyte assessment, were all within the normal range.
+A plain radiograph revealed displaced bilateral femoral, tibial, and fibular midshaft fractures . Computed tomography (CT) identified no notable intracranial, intrathoracic, or intra-abdominal bleeding.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2935_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2935_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..be7f4b4cd567482ae3047ba11240a98cb66f56e4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2935_en.txt
@@ -0,0 +1,5 @@
+A 52-year-old gentleman was admitted electively for his third redo debulking of right occipital parafalcine meningioma in November 2017. At the time of anesthetic induction, he desaturated and required high ventilator pressure support and high FiO2 requirements to maintain oxygen saturation over 90%. An urgent chest X-ray (CXR) revealed that the endotracheal tube was appropriately positioned, and an incidental large well-delineated left upper lobe nodule was noted. The lung fields were otherwise clear, and there was no associated lung parenchymal abnormality. The following day, a formal CXR was performed , the patient was back to his baseline and the surgery was postponed. A CXR performed in 2016 revealed no lung lesions.
+A subsequent chest computed tomography (CT) was arranged and confirmed the presence of a 19-mm left upper lobe nodule and a total of five other smaller bilateral pulmonary nodules ranging from 4 to 13 mm, giving a cannonball appearance [Figures and ]. As these nodules were very well circumscribed and appeared benign, the respiratory and multidisciplinary teams felt that the best course of action in this patient would be a repeat chest CT in 6 months.
+This patient's medical history included right occipital parafalcine meningioma diagnosed in 1994 which was surgically resected in Auckland, New Zealand. This was followed by the insertion of a left-sided ventriculoperitoneal shunt for postoperative hydrocephalus. Histopathology confirmed WHO Grade I meningioma. On surveillance imaging in Melbourne, Australia, in 2013, he was found to have a recurrence, leading to the first redo craniotomy and debulking. Histopathology in this instance revealed transformation to atypical WHO Grade II meningioma. In February 2016, he developed intractable seizures which lead to his second redo debulking at the same unit. The histopathology remained unchanged.
+This patient's third redo debulking procedure was rescheduled to February 2018, approximately 3 months after the diagnosis of the multiple pulmonary lesions. A Simpson Grade 2 resection of recurrent right occipital parafalcine meningioma was performed. Histopathology again showed features consistent with atypical WHO Grade II meningioma ; however, although it did not fulfill criteria for anaplastic WHO Grade III meningioma, the higher Ki-67 proliferation index suggested that it may behave more aggressively than the conventional WHO Grade II meningioma. Postoperatively, he developed no new focal neurology and had significant improvement in seizure-free periods. He was treated with postoperative radiation therapy 60 Gy in 30 fractions and had no symptoms to suggest residual acute radiation toxicity.
+A repeat chest CT was performed in May 2018 and revealed all six lung lesions with interval increase in size, the largest now measuring 27 mm. A chest CT-guided core biopsy of the largest lesion was performed. This confirmed histopathological features consistent with metastatic meningioma .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_294_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_294_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5dff269d7992fe7f3656b7dc0ecbac289ce63039
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_294_en.txt
@@ -0,0 +1 @@
+A 61-year-old woman affected by non-small-cell lung carcinoma from 12 years presented to our department with pustules, erythema, and desquamation of all hands and feet fingers, psoriatic onychodystrophy, and erythematous-desquamative plaques with pustular lesions in the inguinal region and trunk. Moreover, she presented multiple raised well-demarcated red plaques with a white scaly surface on the lower limbs and on the sub-mammary sulcus. She complained of intense itching and huge impairment of the quality of life, especially for the destructive nail alterations (, ). Seven months before admission, she started a treatment with atezolizumab at the dosage of 1,200 mg every 3 weeks. The patient had no personal and familiar history of any skin diseases, but she suffered from hypercholesterolaemia, hypothyroidism, and chronic kidney disease. A skin biopsy specimen, taken from a new lesion, revealed epidermal hyperplasia, hypogranulosis, and the presence of tortuous papillary blood vessels with an inflammatory infiltrate in the dermis characterised by T lymphocytes, some macrophages, and prevalence of neutrophils, some of them within the epidermis. A diagnosis of atezolizumab-induced pustular psoriasis was performed. Therefore, the patient started treatment with salicylic acid in 20% cream, topical fusidic acid, and betamethasone every day. Two weeks later, the patient showed a slight benefit only. The patient’s oncologists did not allow to begin a treatment with biologics, methotrexate, cyclosporine, and apremilast due to the patient’s renal failure, so we decided to initiate a treatment with acitretin 10 mg per os every day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2952_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2952_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..354d6d24b3f684ef4b52862782bf1de51f834dac
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2952_en.txt
@@ -0,0 +1,2 @@
+A 28-year-old woman consulted the hospital for left chest paroxysmal pricking in 2014. Chest plain computed tomography (CT) scans revealed approximately 10 demarcated, round, homogeneous, unequally sized nodules without evidence of calcification, necrosis, or cavitation in the left lower lobe. Regular follow-up was suggested, and the same CT findings were obtained in 2016. In March 2019, she was admitted to our hospital for further evaluation because a plain chest CT scan showed larger, more numerous nodules. There were approximately 49 nodules, the largest of which was 2.8 cm in diameter . Interestingly, all nodules were in the left lower lobe. Contrast-enhanced arterial phase CT showed intense heterogeneous enhancement , and the delay phase showed homogenous nodules . CT-guided biopsy was performed to determine the nodule’s nature. Pathology indicated CCTL. No distal metastasis was found; therefore, left lower lobectomy and mediastinal lymph node dissection (stations 5, 7, 8, 9, 10, and 11) were performed. Postoperative pathological analysis confirmed the diagnosis of CCTL. Grossly, the tumor was solid, gray-white, with a soft texture and clear boundaries . The largest CCTL nodule measured 2.8 cm.
+HE staining showed that the tumor consisted of round, clear cells with distinct cell borders and a granular eosinophilic cytoplasm . Histology revealed cytoplasmic PAS-positive clear cells without atypia, mitosis, or necrosis . The immunohistochemical profile of the clear cells was positive for HMB45 , CD34 , and Vimentin. Tumor reactivity was negative for cytokeratin , SMA , S-100, CD10, PAX-8, desmin, and Myo-D1. No lymphatic metastasis was observed. The postoperative course was uneventful. No evidence of metastasis or recurrence was observed during the 6-month follow-up period after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2974_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2974_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..436433b6a680824cee61f74843e670441d2b2c33
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2974_en.txt
@@ -0,0 +1,8 @@
+Multiple joint swelling for 10 years, which was aggravated for 1 year.
+The patient was a 67-year-old woman who experienced bilateral knee swelling and pain 10 years ago without apparent cause and was diagnosed with rheumatoid arthritis at a local hospital. She treated herself with over-the-counter oral anti-rheumatic drugs. In the past year, the joint swelling and pain gradually worsened and affected the entire body, mainly involving the bilateral joints of the hands, knees, wrists, and shoulders. The swelling and pain were slightly more serious on bilateral shoulder joints and right knee. In addition, the patient had dry eyes and mouth and should drink water when eating dried food. She was then presented to Division of Rheumatology and Immunology. According to laboratory testing results, she was diagnosed with rheumatoid arthritis. Computed tomography (CT) revealed an anterior mediastinal tumor. She was subsequently transferred to the Department of Thoracic Surgery for surgical treatment.
+Ten years of hypertension, without any medical treatment; systolic blood pressure 150 -160 mmHg, and diastolic blood pressure 95-105 mmHg.
+There was no remarkable family history of related diseases.
+Multiple joint swelling.
+Laboratory testing results were as follows: SS-A, weakly positive; erythrocyte sedimentation rate, 39 mm/h; antinuclear antibody, 1:320 (+); immunoglobulin G, 17.10 g/L; immunoglobulin M, 2.58 g/L; C-reactive protein, 11.10 mg/L; and rheumatoid factor, 941 IU/mL.
+Chest CT showed a shadow of dense fat visible in the anterior mediastinum. Multiple fat-dense nodules of varying sizes were observed, with a maximum diameter of 44 mm × 28 mm. Calcification was observed around some nodules. No enhancement was seen on enhanced CT .
+The border of the tumor and tissue was well-defined. The cut surface was grayish white or grayish yellow. The tumor had a soft to firm texture depending on the fat contents. Microscopically, the tumor cells were highly pleomorphic. Mature adipocyte areas admixed with spindle cells were observed. Some nuclei were mildly atypical. Floret-like giant cells were observed, and focal calcification was present. Thick-walled blood vessels were visible. Spindle cells with mild nuclear atypia and hyperchromatic nuclei were observed. The results of immunohistochemical analysis were CD117 (-), Dog-1 (-), S-100 (partial +), SMA (partial +), CK (-), desmin (-), vimentin (+), Ki67 (5%), CD34 (+), and CD68 (-) .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2989_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2989_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3a994574a0e74b799bae1b02a2ec0fc7dea49fbe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2989_en.txt
@@ -0,0 +1,4 @@
+A 14-year-old male of Eastern European descent was referred to pediatric gastroenterology for severe malnutrition and epigastric abdominal pain initially attributed to gastroesophageal reflux disease. He had been experiencing eight months of daily postprandial periumbilical abdominal pain. At the time of the initial GI assessment in clinic, he was taking omeprazole for the past few months with some improvement in abdominal pain, but he had experienced a 9% weight loss over the past six months with his weight below the 3rd percentile (Z-score < -6). His past medical history is notable for NBS that was diagnosed at six months of age, with combined immunodeficiency phenotype with low B cell and poor T cell function. He was diagnosed after his older sister underwent genetic testing and was found to have a NBS1 657del5 mutation. His family history is notable for two siblings with NBS along with a first cousin. He has associated microcephaly, short stature with height below the 3rd percentile (Z-score < -2), bronchiectasis, and lymphopenia with IgG deficiency, requiring routine IVIG infusions. He has a history of diffuse large B-cell lymphoma that was diagnosed at age eight during a hospitalization for pneumonia and pleural effusion. On initial labs, he was noted to have an elevated uric acid of 7.2 mg/dL and LDH of 2711 U/L, leading to further diagnostic work-up. MRI of the chest revealed a large right chest mass and multiple lesions in his kidneys, spleen, pelvis, and tibias. Bone marrow biopsies revealed patchy tumor involvement and he was treated with the ANHL1131 protocol at reduced dose given his chromosomal instability and has been in remission for 6 years.
+On presentation to the pediatric GI clinic, the physical exam was unremarkable. The abdomen was soft, non-distended, and non-tender with no masses appreciable. The oropharynx was clear and there was no significant cervical, axillary, or inguinal adenopathy. Initial laboratory workup for abdominal pain and weight loss included a complete blood count, complete metabolic panel, c-reactive protein, and celiac antibodies which were all within normal limits. Additional diagnostic work-up to look for inflammatory or malabsorption etiologies of his symptoms were pursued due to the extent of his weight loss. His fecal calprotectin was elevated to 318.2 mcg/g (normal < 50 mcg/g) and given his constellation of symptoms, an endoscopy and colonoscopy were performed. Endoscopy revealed white nummular lesions , chronic gastritis without evidence of H. pylori, and focal active ileitis. Colonoscopy showed a < 5 mm tubular adenoma in the sigmoid colon.
+Pathology of this lesion showed Reed-Sternberg cells and neoplastic cells strongly/diffusely positive for CD30 and CD15, and with dim/partial positivity for CD20, PAX5, CD79a, and BCL6 . CD19, CD22, CD43, CD45, and ALK were negative. CD10 stain was predominately negative and testing for cytomegalovirus and Epstein-Barr virus were negative. MRI of the chest, abdomen, and pelvis was used for staging of disease and showed lymphadenopathy of the lesser sac and gastric cardia . A lumbar puncture and bone marrow were performed and were negative for disease. He was diagnosed with stage IIB Classical Hodgkin’s disease of stomach.
+He underwent two cycles of OEPA chemotherapy (vincristine, etoposide, prednisone, and doxorubicin) at 30% and 40% full dose. The remainder of standard Hodgkin’s treatment consisting of two cycles of COPDAC (cyclophosphamide, vincristine, prednisone, and dacarbazine) was not recommended to avoid alkylating agents in a patient prone to malignancy. He tolerated the treatment well without any complications and achieved complete remission. Unfortunately, 9 months later, he was admitted for a bowel perforation and found to have recurrent Hodgkin disease. He completed one cycle of OEPA chemotherapy at 30% dosing and transitioned to pembrolizumab while considering a bone marrow transplant.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2992_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2992_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ea33db2ecab735dc686fa7ec17f0197e0b1dd4eb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2992_en.txt
@@ -0,0 +1,5 @@
+This case concerns an 86-year-old man who used to be a soldier. He found a mass on the right thigh with a 2.5×2.0×1.2 cm red nodule at the beginning of May 2017. Surgical resection was performed at the local People’s Hospital. The results of pathological examination after surgery in local hospital showed a right thigh subcutaneous small cell malignant tumor of about 2.5×2.0×1.2 cm . The pathology immunohistochemistry in our hospital indicated CK-L+, Syn++, CgA+, CD56++, Ki67+, CK-H−, CK7−, CK20+, TTF-1−, CD20−, CD3−, and S100−, implying MCC. According to the pathology and immunohistochemistry, he was diagnosed with MCC T2N1M0.
+In mid-July 2017, multiple red masses appeared in the surgical incision area, of which the largest was hard and about 1.5 cm in diameter . A metastatic lymph node was found in the right inguinal region on computed tomography (CT), ~2.2 cm in diameter without distant metastasis . Next-generation sequencing from his peripheral blood showed KDM5AG931D mutation, which may have been associated with oncogenesis.
+Due to his old age, the patient and his family members refused radiotherapy and chemotherapy. As MCC is closely related to neovascularization, antivascular therapy can be an effective treatment. As such, endostar 30 mg was administered intravenously on day 1–4 as the first cycle from August 2, 2017. After two cycles, the diameter of the major mass in the right thigh had reduced to 1 cm, and the remaining masses gradually subsided . According to the RECIST standard, efficacy reached partial response. Before the third treatment, the masses became protruding, with a recurrent trend . On CT, there was no change from before . Therefore, apatinib was added at 250 mg every other day from the third cycle beginning October 22, 2017. After the next three cycles of treatment, the masses were disappearing , while the diameter of the lymph node in the right inguinal region had reduced to 1.3 cm . In summary, after nearly 5 months (five cycles) of endostar and apatinib treatment, clinical efficacy had reached a partial response. During treatment, common adverse reactions of endostar and apatinib, such as proteinuria, hypertension, hand– foot syndrome, and hematological toxicity, did not appear.
+However, from the beginning of the sixth cycle on February 14, 2018, there was a new lesion of 1.2 cm diameter at the right thigh , which indicated progressive disease. He then continued to receive endostar and apatinib. At the same time, everolimus 5 mg daily and tegafur 50 mg twice daily were administered. However, he stopped taking everolimus due to serious adverse effects of weakness and vomiting after 2 months. Three treatment cycles later, the diameter of the mass had gradually increased to 3 cm . The latest CT on March 5, 2018 showed no significant changes compared with previously . The patient was followed up for about 12 months. Finally, he died of infection at the beginning of June 2018. Progression-free survival was 6.5 months and overall survival 13.0 months.
+The patient’s family provided written informed consent for publication of this report and accompanying images. We confirmed with the institutional review board of the First Affiliated Hospital of Nanjing Medical University that institutional approval was not required to publish this case report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2996_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2996_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7442a3de16d482e44117325554aca139452876a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2996_en.txt
@@ -0,0 +1,7 @@
+An 84-year-old male patient (163 cm in height, 41 kg in weight) presenting with esophageal cancer was administered with radiotherapy and chemotherapy 11 years prior, after which he got better.
+In December 2020, the patient was diagnosed with advanced esophageal squamous cell carcinoma with liver metastasis, classified as stage TxN1M1. Based on the 2020 Chinese Society of Clinical Oncology guidelines, the patient was administered the first immunotherapeutic (camrelizumab 200 mg/each time + 0.9% NS 100 mL, intravenous infusion, q3w) and did not exhibit any adverse reactions. On January 12, 2021, the patient was admitted to the hospital for the second time to be administered the same therapy. On January 19, 2021, the patient was introduced to intravenous infusions of camrelizumab. However, 10 min after initiating intravenous camrelizumab, he suddenly developed a generalized rash in the chest and upper limbs. He also experienced chest tightness without chest pain, palpitations, and breathing difficulties with a sense of dying.
+The patient had a previous medical history free of allergy.
+The patient had no significant personal or family history.
+Electrocardiograph (ECG) monitoring revealed a pulse rate of 70 beats/min, blood pressure of 69/24 mmHg, a respiratory rate of 28 breaths/min, and a pulse oximetry of 86% in room air (no other medication was administered concomitantly). The patient presented with drowsiness and weakened cardiac sounds as well as a weak major arterial pulse.
+Blood analysis revealed white blood cell count of 7.04 × 109/L, neutrophil count of 2.81 × 109/L (normal range: 2.0-7.5 × 109/L), neutrophil percentage of 39.90%, red blood cell count of 2.35 × 1012/L, hemoglobin level of 66.00 g/L (normal range: 110-160 g/L), platelet count of 219.00 × 109/L (normal range: 100-300 × 109/L), C-reactive protein level of 31.61 mg/L (normal range: < 0.5 mg/L), potassium level of 2.12 mmol/L (normal range: 3.5-5.0 mmol/L), chloride level of 117.80 mmol/L (normal range: 96-108 mmol/L), and calcium level of 1.41 mmol/L (normal range: 2.0-2.6 mmol/L). Markers of renal function and levels of cardiac enzyme and troponin were normal.
+ECG revealed a sinus rhythm. Enhanced computed tomography scan revealed chronic inflammation of the right lower lobe with left-side pleural slight effusion .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e3cbcc93d3a31a03d78f8c84329bb8ae45ca18c7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2_en.txt
@@ -0,0 +1,8 @@
+A 71-year-old man presented to his family physician with upper right leg pain. His symptoms progressed with deterioration in his balance and decreased strength and coordination in his upper limbs. Functionally, the patient remarked being clumsy at home, dropping objects on a regular basis, unable to do buttons and/or zippers, and excluded several activities of daily living due to these limitations. The patient had no previous spinal trauma and an unremarkable family history. His previous surgical history included a bilateral hip replacement, tonsillectomy, and carpal tunnel release. A referral was then made to neurosurgery for further management.
+Neurological examination revealed an unsteady gait with the inability to heel-to-toe walk and a positive Romberg’s sign. He was unable to sit comfortably and exhibited a reduced range of motion of the neck in all planes. Examination of his upper limbs revealed deficits that were particular to his right side. This included atrophy in the first web space, decreased grip strength (4−/5), poor finger function and reduced sensation. Left arm and hand involvement was present but to a lesser degree. Lower limb involvement included decreased sensation in both feet and in the right L3 dermatome. Reflexes were brisk.
+Due to the neurological findings, computed tomography (CT), and nerve conduction study (NCS) were obtained. NCS revealed no abnormal findings while the CT scan showed a mass (28x15x39mm) that compressed the cervical spinal cord at C2.
+Magnetic resonance imaging (MRI) was obtained revealing a congenitally narrow cervical spinal canal and significant compression of the spinal cord at C1 and C2 . Some canal stenosis, in the thoracic and lumbar regions, was present. This was secondary to degenerative changes and ligamentous hypertrophy.
+A diagnosis of cervical myelopathy secondary to a C2 mass was made. Informed consent for surgery was obtained. Surgical management consisted of decompression of the cervical spinal cord with a posterior cervical fusion of C1-C3. Tissue biopsies were obtained and sent to pathology for investigation.
+CT imaging was performed in the early postoperative period which demonstrated no bony or hardware complications. MRI imaging was done 6 months postoperatively which illustrated the decompression of the cervical spinal cord. Follow-up clinical examination at that stage found increased grip strength, mobility, and balance with an overall improvement as compared to pre-operative symptomology. He was referred to physiotherapy to aid with rehabilitation.
+Further radiological investigations were obtained to verify that the mass was not secondary to systemic amyloidosis. Results were negative, leading to the confirmation of primary solitary amyloidosis treated with uncomplicated cervical spine surgery.
+Furthermore, the patient has been referred to Cardiology and completed a MIBI scan with no evidence of cardiac infiltration. Additional cardiac studies and genetic assessment are planned but have not yet been completed at the time of this report; however, it is suspected the ATTR subtype is non-genetic in nature. The patient is receiving further work-up regarding his lumbar spinal stenosis as it requires treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3004_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3004_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..161591c73374d0ccb88c5c09cf79276ea0611ca1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3004_en.txt
@@ -0,0 +1,3 @@
+A 68-year-old woman presented to our hospital complaining of dyspnea at rest for approximately 2 months and was classified as New York Heart Association functional class III. She had previously been treated for breast and colon cancers and had not suffered from cardiovascular disease. Her height, weight, and body mass index were 150.0 cm, 91.0 kg, and 40.4 kg/m2, respectively. A grade IV/VI pan-systolic murmur was heard at the apex on cardiac auscultation. Her pulse rate was 105 beats/min and she was diagnosed with an irregularly rapid heartbeat (tachycardia). Her blood pressure was 124/76 mmHg. A chest radiograph revealed severe cardiomegaly with a cardiothoracic ratio of 80%, while an electrocardiogram showed persistent atrial fibrillation with a low-voltage F-wave. Computed tomography demonstrated the retention of pleural fluid or abdominal dropsy and hepatosplenomegaly. No significant coronary stenosis was observed by coronary angiography. Transthoracic echocardiography revealed severe mitral regurgitation with annular enlargement and severe tricuspid regurgitation. The cause of mitral regurgitation was severe tethering due to extreme annular enlargement, and the prolapse of the anterior leaflet. The left ventricular ejection fraction was 49%, the left ventricular diastolic diameter was 63 mm, and the left atrial diameter was 71 mm. Laboratory evaluations did not show any abnormalities, apart from an N-terminal-proB-type natriuretic peptide level of 7439 pg/ml. Because of the medication-refractory heart failure, we decided to perform surgery after a written informed consent was obtained.
+
+A median sternotomy was performed and standard cardio-pulmonary bypass was initiated with ascending aortic and bicaval cannulation. A left atrial vent was introduced from the right upper pulmonary vein. Myocardial protection was achieved in an antegrade and retrograde fashion. The retrograde cardioplegia cannula was inserted smoothly under direct vision. After aortic cross-clamping, the left atrium was opened through a longitudinal left atriotomy, revealing the tethering mechanism secondary to the prolapse of the anterior leaflet of the mitral valve. The clear zone of the anterior leaflet was excised and the rough zone with its attached chord were divided equally. Each divided structure was transferred to the anterolateral and the posteromedial commissures separately. The posterior leaflet, including the subvalvular apparatus, was wholly preserved. The mitral valve was replaced with a 29-mm St. Jude mechanical valve (St. Jude Medical Inc., St. Paul, MN) in an intra-annular position using everting mattress sutures. Subsequently, tricuspid annuloplasty was performed with a 32-mm Carpentier-Edwards PhysioTricuspid ring (Edwards LifeSciences, Irvine, CA) for annular enlargement. Weaning from the cardio-pulmonary bypass was successful. After closing the thorax, to our surprise, an atrial mass of 3 cm × 2 cm was detected by TEE, which showed an oval hypoechoic appearance extending from the posterior annulus of the mitral valve to the posterior wall of the left atrium. Although it occupied one-third of the left atrium, there was no significant obstruction of the pulmonary venous return and left ventricular filling. The prosthetic valve movement was unobstructed and there were no paravalvular leaks or pericardial effusion. No communication between the mass and the atrial true lumen was detected using color Doppler echocardiogram. We diagnosed the mass as LAD. Because hemodynamic conditions were stable after a consulting with the anesthesiologist, the patient was deemed unsuitable for surgery. She was transferred to the intensive care unit and remained under close observation. On postoperative day 2, TEE showed that the atrial mass had vanished and the broken piece of the endocardium merely remained fluttering in the atrium. On postoperative day 6, the appearance of the left atrium had normalized completely, leaving no traces of LAD. The patient had an uneventful postoperative course, except for prolonged respiratory failure. She was discharged from the hospital on postoperative day 47 and is currently being followed up once a month.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3007_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3007_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..16ab043700c821d3987118ee4d825a7099dcdd7e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3007_en.txt
@@ -0,0 +1 @@
+A 25-year-old female with a history of substance abuse (smoking and daily cannabis use) and a 2017 arthroscopy of the right knee for pigmented villonodular synovitis presents to the emergency department. She presents for medical evaluation due to a severe acute pain syndrome localized to the right knee, which partially resolves with the use of non-steroidal anti-inflammatory drugs. On physical examination, the right knee is enlarged with evidence of free fluid in the joint and limited range of motion. As part of the evaluation, a magnetic resonance imaging of the knee is performed, which reveals extensive diffuse oedema in the subcutaneous cellular tissue, with involvement of the popliteal fossa muscle groups. Multiple multilobulated cystic images are observed with dimensions of approximately 34 mm, as well as hypointense nodules in the supra and infrapatellar bursae with dimensions of 29 mm. Edema is observed in the lateral portion of the outer femoral condyle that encompasses the anterior and posterior regions, as well as edema in the inner tibial plate, the medial region of the patella and signs of lateralization of the patella, suggestive of dislocation. With the suspicion of a recurrence of pigmented villonodular synovitis of the knee, the patient is scheduled for surgery, which consists of an open medial and lateral resection of the affected knee, preserving the neurovascular structures of the popliteal fossa. During surgery, severe synovial infiltration with hypertrophy and hyperpigmentation of a soft tumor that affects both the intraarticular and periarticular space, compromising approximately 190 degrees of the popliteal artery, is observed. Extensive synovectomy is performed and irrigation with 200 cm3 of solution is performed. Macroscopically, a membranous lesion of reddish brown appearance, with a medium consistency and dimensions of 10 × 8 cm is described and a sample is sent for histopathological analysis. The patient recovers in the postoperative period without complications. The histological analysis confirms the presence of villonodular synovial tissue-derived villous structures associated with a dense stromal tissue with inflammatory cells, giant cells and abundant histiocytes. This confirms the diagnosis of recurrent pigmented villonodular synovitis with extension to the soft tissue, without the presence of a sarcomatoid component. The patient is discharged with a pain management regimen, with no reported complications.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3018_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3018_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..139d565e4335eec4f36209c195ff0003774102ec
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3018_en.txt
@@ -0,0 +1,6 @@
+We report the case of a 66-year-old female patient with no prior medical history, she was operated for a transverse colon tumor she had an extended right hemicolectomy. Histopathological examination of the specimen revealed a well differentiated adenocarcinoma of the colon classified pT4aN1b.No distant metastases were detected by the pre-operative CT scan of chest and abdomen. The patient received an adjuvant chemotherapy (XELOX 6 cycles) and was regularly monitored in our outpatient department.
+During follow up, the patient was asymptomatic with a soft abdomen on clinical examination, laboratory test especially liver enzymes and tumor markers ACE and CA19-9 were in normal range. However, the CT scan after two years of the surgery revealed intrahepatic biliary duct dilation particularly in segments VI and II of the liver, with subtle low dense lesions in these bile ducts. The CT scan revealed also multiple millimetric nodules of the spleen. Hepatic MRI showed two endoluminal biliary nodules in segments VII and I, measuring 30 mm and 10 mm respectively with upstream biliary duct dilation, suggestive of secondary lesions with multiple metastatic splenic nodules.
+
+The patient underwent a percutaneous biopsy of the hepatic lesions, histopathological and immuhistochemical findings confirmed the presence of adenocarcinoma cells of primary colonic origin.
+
+The standard hematoxylin eosin-stained slides showed tubulo-papillary carcinomatous expansion budding in intra-lumen bordered by a biliary epithelium, the neoplastic cells were all positive for CDX2 and negative for CD20 supporting the diagnosis of intrabiliary colonic metastasis. After multidisciplinary discussion it was decided to put the patient under chemotherapy (FOLFIRINOX).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3023_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3023_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8a04ad64a88fee508ca5faa840fab31a3c36046d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3023_en.txt
@@ -0,0 +1,19 @@
+A 66-year-old man, without known systemic diseases, was referred to our department with a progressive decrease in visual acuity of his right eye (RE).
+
+He had been assisted at our department more than 10 years before due to exudative bilateral maculopathy of unknown etiology. At that time, exuberant atrophic macular abnormalities had been recorded in both eyes, more pronounced in the LE. He had been submitted to full dose photodynamic therapy with verteporfin (PDT) and several anti-VEGF intravitreal injections. He underwent cataract surgery with intraocular lens implant. In the last registered visit, he presented a corrected distance visual acuity (CDVA) of 20/32 on his RE and counting fingers on his LE.
+
+The patient was lost to follow-up at our department for 10 years and he returned in December 2020 complaining of RE vision loss. The CDVA was 20/63 on the RE and counting fingers on the LE. On slit-lamp examination, no anterior chamber reaction was observed but a vitreous haze was present on the RE. Fundoscopy revealed bilateral large, yellowish lesions located in the macula, associated with significant atrophy, particularly in the LE. No changes were observed in peripheral retina.
+
+Optical coherence tomography (OCT) showed a flat retinal pigmented epithelium (RPE) detachment with hyper-reflective material under RPE, damage of external retinal layers, including external limiting membrane, ellipsoid zone and RPE, and cystoid macular edema on the RE. The LE showed a large area of macular atrophy, with subretinal fibrosis; both eyes exhibited an anomalous OCT pattern of the inner choroid with extensive loss of choriocapillaris. Fundus autofluorescence (FAF) showed central hypoautofluorescence secondary to RPE and photoreceptors loss.
+
+The RE FA showed an early irregular pattern with significant late hyperfluorescence due to staining. On the LE, a large early hypofluorescent lesion involving all macular areas and extending to the temporal optic disc border, with well-defined edges and late internal hyperfluorescent areas, was defined. In the indocyanine green angiography (ICGA), an heterogenous pattern with anomalous dilated choroidal vessels could be observed.
+
+The OCT angiography (OCTA) of the RE demonstrated an anomalous vascular network, suggestive of choroidal neovascularization.
+
+Systemic work-up revealed a positive TPHA test and a negative VDRL. The patient confirmed a known past history of syphilis of more than 30 years eventually treated with oral antibiotics, when living in a sub-Saharan African country. Since then, the patient did not develop any other symptoms or signs suggestive of syphilis. No other significant changes were found on the systemic work-up, including evidence of other infectious or immune diseases.
+
+With collaboration of the Infectious Diseases department, the patient was admitted in the hospital and started systemic treatment with intravenous Penicillin G for 14 days as well as intravitreal ranibizumab injections on the RE in a PRN regimen.
+
+After systemic and intravitreal treatment, the patient experienced visual acuity improvement to 20/25, without metamorphopsia. There was a regression of the RPE detachment and cystoid macular edema, since the first month after systemic treatment.
+
+A regular follow-up is maintained in order to evaluate the need for repeated intravitreal injections.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3025_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3025_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..905a741509ea9e8672c835193ce5c1119129f464
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3025_en.txt
@@ -0,0 +1,3 @@
+A 43-year-old female presented at our Emergency Department complaining of an acute generalized abdominal pain. Eight days ago, the patient was hit by a motorbike, resulting in a closed left tibial plateau fracture. The patient underwent bone fusion surgery and was discharged after four days without any complications. The patient could urinate independently after the injury, and routine urine analysis showed no obvious abnormalities. Two days ago, the patient experienced hypogastric discomfort accompanied by urinary retention. One hour before admission, the patient felt severe bladder retention and then heard a “poof” sound from her abdomen, which relieved the bladder retention but caused generalized abdominal pain. At admission, the patient reported a sudden, constant, dull pain in the lower abdomen, along with a gradually distending abdomen. Physical examination revealed a pulse of 110 beats per minute, blood pressure of 80/60 mmHg, oxygen saturation of 92 %, and a respiratory rate of 22 breaths per minute. Laboratory tests showed elevated white blood cells (17.55 K/uL) with 91.6 % neutrophils, elevated creatinine (331 umol/L), and high potassium (6 mmol/L). Urinalysis results indicated significant hematuria (+++). No abnormal findings were found on the abdominal X-ray. A point-of-care ultrasound (POCUS) revealed large amounts of abdominal fluid. Subsequently, abdominal paracentesis showed a yellow-like urine fluid, increasing creatinine levels (1383 umol/L) and urea (44.4 mmol/L).
+
+The patient was diagnosed with generalized peritonitis due to a late bladder rupture and underwent exploratory laparoscopic surgery. During the surgery, approximately 2.4 L of clear yellow fluid was suctioned from the abdomen, and a hole about 2x3cm in size with rough edges was found at the top of the bladder. The surgical team decided to biopsy the edge of the perforation and suture it with two-layer Vloc 3.0 sutures, placing an abdominal drain at Douglas. Post-surgery, the patient received intravenous antibiotics, fluids, and painkillers. On the first postoperative day, kidney function and potassium levels returned to normal, and abdominal fluid culture results showed no bacteria. Postoperative pathology results indicated acute cystitis. A follow-up ultrasound on the fourth postoperative day revealed no abdominal fluid. The drainage tube was removed on day five, and the patient was discharged on day nine in stable condition with average laboratory results. A two-week follow-up showed an asymptomatic patient without signs of recurrence or complications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3041_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3041_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2e5db301686eae56c5f02240019cf392427a290a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3041_en.txt
@@ -0,0 +1,9 @@
+A 68-year-old man presented to the emergency department with progressive dyspnea and lower-limb edema leading to anasarca associated with neuropathic pain. The patient had no significant past medical history but reported undergoing outpatient evaluation in which a transthoracic echocardiogram (TTE) revealed reduced left ventricular ejection fraction (LVEF) and a pattern of left ventricular hypertrophy. His vital signs were within the normal limits but jugular engorgement, ascites, and lower limb edema up to the point of anasarca were observed. Physical examination notably revealed a rupture of the right biceps brachii tendon. Laboratory tests showed a hemoglobin level of 13.8 g/dL, creatinine 1.42 mg/ dL, blood urea nitrogen of 18 mg/dL, and N-terminal pro B-type natriuretic peptide (NT-proBNP) of 7461 pg/mL.
+
+Chest X-ray reported cardiomegaly with aortic elongation. An electrocardiogram revealed sinus rhythm, right-axis deviation, low QRS voltage, first-degree atrioventricular block, pseudo-infarct pattern in precordial leads V1–V3, poor R progression, and alterations in high lateral repolarization.
+
+The TTE indicated a non-dilated left ventricle with concentric hypertrophy as well as severely thickened walls with a speckled appearance, LVEF of 30%, and severely reduced longitudinal strain (−6.2%), demonstrating higher strain in apical segments than basal segments in a relative apical sparing. The left ventricular posterior wall measured 21.3 mm, interatrial septum thickness was 5.35 mm, and there was severe dilation of the left atrium, dilated right ventricle with decreased global contractility, moderate mitral regurgitation, and a small pericardial effusion. A coronary angiogram was done to rule out ischemic cardiomyopathy.
+
+Cardiac magnetic resonance imaging (CMRI) revealed severe symmetric hypertrophy, significant dilation of the left atrium, marked thickening with involvement of papillary muscles, diffuse thickening of both ventricles, severe biventricular systolic dysfunction with an LVEF of 32% and right ventricular ejection fraction of 26%. A native T1 value of 1225 ms (normal value is less than 1000 ms) was obtained at the septum on mid-cavity short-axis map. Post-gadolinium enhancement displayed marked hypointensity of the blood pool, patchy up-take involving the entire myocardium, subendocardium, and epicardium, and the zebra sign. T1 mapping post-gadolinium revealed a severely increased extracellular volume of 72% (normal less than 30%), consistent with cardiac amyloidosis. Pyrophosphate scintigraphy indicated Perugini grade 3.
+
+Hematologic tests were conducted to rule out light-chain amyloidosis, which is revealed by free Lambda light chains of 32.6 mg/L and Kappa light chains of 95.7 mg/L (with a ratio of 2.9). Serum and urine immunofixation found that these light chains were undetectable, protein electrophoresis showed no monoclonal peaks, and bone marrow flow cytometry indicated no plasma cell neoplasia. A subcutaneous adipose tissue biopsy was negative by Congo red staining for amyloid. A myocardial biopsy revealed myocytes with broad cytoplasm surrounded by clear pinkish amorphous material, which was focal positive for Congo red staining, showing as apple green in color. A genetic study was conducted, reporting a variant c.424G>A (p.Val142Ile) in heterozygosity in the exon of the TTR gene, confirming the presence of TTRv amyloidosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3050_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3050_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c4ffa78febdf0c888afefc950e63bda6071dbd6d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3050_en.txt
@@ -0,0 +1,11 @@
+A 26-year-old married Ethiopian women presented to renal clinic with 4 year history of progressive proximal symmetric weakness described as inability to get up from chair, walk upstairs, and comb hair, which eventually led to inability to ambulate without aid. She also complained of generalized bone pain, and easy fatigability. She also had a history of shortness of breath, palpitation, dizziness, tinnitus, and loss of appetite. Also gave a history of poor sunlight exposure. She did not provide history of urinary incontinence or retention, fecal incontinence, sensory loss, visual disturbance, headache, and loss of consciousness. She denied having fever, weight loss, night sweating, skin or facial rash, oral lesion, joint pain or swelling and other systemic symptom. Four years before current presentation she was evaluated for weakness, undergone blood work up and imaging, and told to have muscle disease. She was born and raised in the eastern part of Ethiopia; she is married and delivered a dead fetus because of prolonged labour. She did not use alcohol or tobacco. Family history was negative for any disorders of calcium or tumors. Her social functioning and activities of daily living were markedly affected which resulted in significant psychological distress.
+
+On general examination the patient appeared to be chronically sick looking and walking with the aid of a stick. Vital signs were stable There was conjunctival pallor; skeletal examination revealed diffuse bony tenderness which was more prominent at pelvic and proximal tibia, chest wall deformity, and scoliosis. Nervous system examination revealed a hypotonic muscle tone, a proximal muscle power of 3/5 (both upper and lower extremity bilaterally) and a distal muscle power of 5/5 (both upper and lower extremity bilaterally), deep tendon reflex of +2, and down-going plantar reflex. Cranial nerve and sensory examination was normal. She initially presented as an outpatient to the neurology clinic for evaluation of weakness and later linked to renal clinic after blood work up revealed raised serum creatinine. With impression of SHPT further blood work up and imaging was undertaken.
+
+Skeletal X-ray revealed sub-periosteal erosion of radial border of middle phalanx of second and third digits associated with acro-osteolysis of distal phalanx; generalized osteopenia, cystic lesion of distal metaphysis of both femur and proximal metaphysis of both tibia and insufficiency fracture diaphysis of left tibia; bilateral displaced femoral neck fracture; resorption and end plate sclerosis of lumbar vertebra with compression fracture; and osteopenia, lytic lesion, and sub-periosteal erosion of left humeral head, and lytic lesion of distal end of clavicle.
+
+Laboratory test was performed. It showed; ionized calcium: 1 mmol/L, intact PTH: 1604 pg/mL, vitamin D: 10.2 ng/mL, creatinine: 3.8 mg/dL, ALP: 1780 iu/mL. Abdominal ultrasound revealed bilaterally shrunken echogenic kidney (right=6.7 cm and left=6.9 cm) with loss of cortico-medullary differentiation. Electromyography finding was consistent with proximal myopathy. Whereas, nerve conduction test and muscle biopsy results were normal. Laboratory investigations were carried out using the following kits and assays: hematology (HumaCount 30, Human, Germany), biochemistry (Humalyzer 3000, Human, Germany), and the assay method used for PTH was immunometric (IMA).
+
+With the above findings a diagnosis of OFC due to secondary hyperparathyroidism associated with CKD was reached. Additional diagnosis was severe vitamin D deficiency, metabolic myopathy, and anemia.
+
+The patient was started on dietary phosphate restriction, calcium carbonate 1 g/day with meal, vitamin D3 50,000 IU by mouth weekly for 8 weeks, ferrous sulphate 325 mg po tid, and paracetamol 1 g per need for pain control. Alfacalcidol 0.25 µg/day was prescribed, but it was not available in the city. She was counselled on prognosis, need for renal replacement therapy (RRT), and nephrologist evaluation. However, because of financial reason she declined referral and RRT. At 2 month follow up visit, she had some improvement in bone pain and weakness. On laboratory test, vitamin D level returned to normal (34 ng/mL), serum ionized calcium had risen to 4.8 mg/dL, and PTH became 58 pg/mL (this was due to laboratory error). At this point vitamin D and calcium dose was reduced to 800 iu/day and 500 mg/day respectively. At 5 months of follow up the patient developed severe symptomatic hypocalcemia and hyperkalemia, ECG revealed prolonged QT interval. Subsequently the patient was admitted and received intravenous infusion of calcium gluconate and potassium shift therapy. She was discharged on oral calcium 2 g/day and alfacalcidol 0.25 µg/day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3060_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3060_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8f83c29fa822b3b159ee9e37264a4f4ad53ecc34
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3060_en.txt
@@ -0,0 +1,7 @@
+A 13-year-old girl was referred to our hospital due to mild proteinuria which was detected at a school urinary screening. No urinary abnormalities had been detected previously. She was born at a gestational age of 23 weeks and 6 days because of maternal fever, with a very LBW of 630 g, equivalent in size to 23 weeks of pregnancy. She had chronic lung disease and premature infant retinitis. She required O2 until she was 1 year of age; however, her growth and development had reached the normal range by that time. Apart from retinopathy of prematurity, she had been generally healthy, both physically and mentally.
+
+Physical examination showed the following: height 154 cm, weight 50 kg, body mass index 21.1, and blood pressure 115/73 mmHg. Dipstick urinalysis revealed grade (2+) proteinuria. Her serum creatinine level was 1.02 mg/dL, and she was diagnosed as having stage 2 CKD based on reference serum creatinine levels of Japanese male and female children aged 12 to 15 years. Her serum uric acid level was 7 mg/dL (normal level was less than 4.6 mg/dL based on reference serum levels of female children aged 12 to 14 years), she had hyperuricemia. Her mother and her 16-years old brother had hyperuricemia, too.
+
+A percutaneous renal biopsy demonstrated that 1 out of 8 glomeruli had segmental sclerosis with adhesion to the Bowman’s capsule (black arrow), and white arrow indicated partial focal interstitial fibrosis. The mean diameter of the glomeruli was 348.23 μm, which was much larger than that of normal glomeruli (168 ± 12 μm). Immunofluorescence analyses (IgG, IgA, IgM, C3, C1q and C4) were all negative. These biopsy findings supported a diagnosis of FSGS.
+
+After 3 years of treatment with an angiotensin receptor blocker (ARB), her proteinuria decreased. However, her serum creatinine level was 1.07 mg/dL, and she still had stage 2 CKD.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3078_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3078_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..16e213ec644b707c1603d5ba1e1837eb2b939b39
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3078_en.txt
@@ -0,0 +1,10 @@
+Clinical information
+The patient, female, 57 years old. In September 2021, lung tumors were found during the examination in The First Affiliated Hospital of Dalian Medical University. The chief complaint was chest pain and fatigue for half a year. For further treatment, the outpatient department was admitted to the hospital on the grounds of “lung shadow.” The patient’s mental state is good, appetite is reasonable, sleep is good, and weight has no significant change. Based on MSCT plain scan of the chest, partial solid nodules appeared in the posterior segment of the upper lobe of the patient’s right lung (21 mm * 13 mm), with signs of lobulation, burrs, pleural indentation, and vacuole. Multiple small nodules in both lungs. Blood test: neutrophils↑, lymphocytes↓. The patient underwent surgical treatment and part of lung tissue was removed. Pathology revealed invasive adenocarcinoma in the upper lobe of the right lung, and no metastasis in the parbronchial lymph nodes.
+
+TCM therapy
+In November 2022, when the patient returned to the doctor, it was found that there were ground glass nodules in the upper lobe of the left lung, about 18 mm * 9 mm, indicating the recurrence of the primary cancer. The patient refused a second surgical treatment. The symptoms were fatigue, pale tongue, white fur, and weak pulse. TCM syndrome is Qi and blood deficiency, the treatment principle is tonifying Qi and blood, attacking evil, and removing blood stasis. The Chinese medicine prescription is as follows: Shashen (Adenophora stricta) 20 g, Baihe (Lilium brownii) 20 g, Dangshen (Codonopsis pilosula) 20 g, Chuanbeimu (Sichuan fritillary bulb) 15 g, Baihuasheshecao (Hedyotis diffusa Willd) 15 g, Jiegeng (Platycodon grandiflorus) 20 g, Maidong (Ophiopogon japonicus) 20 g, Sangbaipi (Mulberry root bark) 15 g, Shudi (Rehmannia glutinosa) 10 g, Danggui (Chinese angelica) 8 g, Fuling (Poria cocos) 20 g, Guiban (tortoiseshell) 8 g, Biejia (Carapax trionycis) 8 g, Gouqizi (Lycium chinense) 15 g, Niuxi (radix achyranthis bidentatae) 15 g, Muli (Concha Ostreae) 20 g. One dose per day, totaling 180 mL, twice a day in the morning and evening, half an hour after meals, lasting 1.5 months.
+
+Treatment outcomes
+After that, the patient took Chinese medicine and had a semiannual physical examination. In January 2024, The CT examination revealed a recurrent tumor shrinkage of about 7 × 9 mm, which was undoubtedly amazing. Blood routine examination was normal, liver and kidney function was normal. The patient had no signs of fatigue or wasting, and diet, bowel movements and sleep were normal. It shows that the treatment plan of traditional Chinese medicine is correct and the medication is symptomatic.
+
+From 2021 to 2024, the patient underwent a follow-up examination of the lung tissue, and CT showed that the size of the lung masses changed, indicating that the lung tumors became significantly smaller during treatment after lung CT examination. The level of carcino-embryonic antigen tends to be normal. For this patient, the lung cancer recurred after surgery and could not tolerate another operation, so she sought Chinese medicine treatment. And achieved the expected desired efficacy. Before TCM treatment, the CT showed that dense shadows and cord foci could be seen in the hilar area of the lung. Ground glass nodules were observed in the upper lobe of the left lung. There are small nodules in both lungs and multiple small lymph nodes in the mediastinum. After treatment, the image showed that the lung texture became clearer and the nodules shrinked. Calcification shadow and cord foci lessened or even disappeared. The author believes that this treatment plan is worth promoting.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_309_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_309_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..df1d34cca8323e3eb22c75d73f8eae04e3c2b175
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_309_en.txt
@@ -0,0 +1,7 @@
+A 42-year-old man presented with cough that had started 1 wk earlier and chest pain that had begun 2 d earlier.
+The patient presented with cough that had started 1 wk earlier; he was treated with azithromycin (500 mg, qd, i.v.) for a common cold at a private clinic. His symptoms were alleviated after treatment. However, 2 d later, the patient experienced chest pain radiating to the right arm while walking in a cold wind. He was evaluated at another hospital, where his hypersensitive troponin T level was found to be 34.34 pg/mL (normal range: 3-14 pg/mL). He also exhibited increased white blood cell and platelet counts and an increased neutrophil percentage. His ECG was normal. Echocardiography showed that the left ventricular ejection fraction (LVEF) was 59%, with mild regional abnormalities in the ventricular and apical septa and a dilated left atrium. The patient’s hypersensitive troponin T was 685.30 pg/mL and the creatine kinase isozyme (CK-MB) level was 11.85 ng/mL (normal range: 0.1-4.94 ng/mL) after 8 h. Based on these findings, the patient was admitted to our hospital.
+The patient had a 2-year history of hypertension and a smoking history for 20 years.
+No specific personal or family history of disease was recorded.
+The patient's temperature was 37.8 °C, his body mass was 78 kg, his blood pressure was 164/114 mmHg, and there were no positive signs on a physical examination.
+Laboratory testing showed the following on admission: serum TnI, 2.57 ng/mL (normal range: 0-0.034 ng/mL); hypersensitive C-reactive protein, 4.95 mg/L (normal range: 0-2.87 mg/L); erythrocyte sedimentation rate, 45 mm/h; brain natriuretic peptide, 168 pg/mL; white blood cell count, 13.30 × 109/L; neutrophil percentage, 0.735; and platelet count, 312 × 109/L. His liver function, kidney function, thyroid function, D-dimer, electrolytes, blood lipids, and blood glucose levels showed no significant abnormalities; however, his rubella virus immunoglobulin G (IgG) and immunoglobulin M (IgM) antibody levels were elevated on admission.
+The patient’s ECG showed II, III, and aVF T-wave inversions, and a wide range of precordial segment T-wave inversions that exhibited dynamic changes compared with the previous ECG. Electrocardiography revealed the abovementioned segment T-wave inversion after 20 h. Coronary angiography was performed on day 5 after admission. There was no obvious coronary stenosis during the operation. Cine CMR imaging showed wall motion abnormalities (mid septal, apical septal, and apical anterior), and the anterior walls were obviously thicker than the normal walls , with the thickest part of the ventricular wall being approximately 20 mm. Fat suppressed T2-weighted imaging showed the edema of the mid septal, apical septal, and apical anterior walls . We observed the myocardial edema more specifically on T1 mapping . The endocardium and middle myocardium of the mid septal and apical septal walls showed patchy late gadolinium enhancement (LGE) . The high signal area was smaller than the area of edema.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3103_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3103_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..27bacf33ca132c6b1b852d8327ba3088b0949289
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3103_en.txt
@@ -0,0 +1,12 @@
+A 20-year-old Gravida 1 presented to the emergency department multiple times between 32- and 34-weeks gestational age before ultimately being admitted for preterm labor to the antepartum unit. The patient’s past medical history was significant for morbid obesity (body mass index (BMI) 65 kg/m2) and a reported prior diagnosis of non-alcoholic hepatosteatosis; however, her prenatal care had been uncomplicated to date. Vital signs and labs are noted for the three emergency department visits prior to her antepartum admission. With each subsequent visit, her complaints progressed. Her initial complaint included four days of waxing and waning fevers associated with weakness. At that time, tachycardia was present, and labs were notable for elevated liver enzymes (AST=779 U/L; ALT=876 U/L). Test results for RSV, SARS-CoV-2, and Influenza were negative. A right upper quadrant ultrasound was performed, and the findings suggested steatohepatitis. At the second emergency room visit, she complained of ongoing persistent fevers now associated with dyspnea with exertion. A computed tomography of the chest utilizing a pulmonary embolism protocol was unremarkable. Labs were notable for a white blood cell count of 4.0 K/µL and persistently elevated liver enzymes (AST=606 U/L; ALT=470 U/L). Upon presentation for the third time, she complained of 10 days of waxing and waning fevers, worsening dyspnea, which was now present at rest, and a new onset cough. The patient tested positive for SARS-CoV-2. She was given intravenous methylprednisolone and discharged home. Of note, her lactic acid was never greater than 2.0 mmol/L at any emergency department visit.
+
+The patient presented for a fourth time 13 days after initial presentation. The patient complained of abdominal pain and vaginal bleeding and was admitted for preterm labor at 34 weeks gestation. She still complained of persistent dyspnea and fevers but was oxygenating well on room air without supplemental oxygen. She received standard care, including betamethasone for late preterm antenatal corticosteroid treatment. She was also treated with acetaminophen for her fever, which was no more than 1 g per day. Due to the concern for a urinary tract infection, she was started on daily ceftriaxone on admission, although urine cultures were negative. After two days of uterine quiescence, her amniotic membranes spontaneously ruptured. The patient was switched to intravenous penicillin for group beta-strep prophylaxis and underwent an uncomplicated spontaneous vaginal delivery with a small left labial laceration repaired in a routine fashion.
+
+Five hours after delivery, internal medicine was consulted for persistent tachycardia. An electrocardiogram demonstrated sinus tachycardia. Temperature ranged from 36.5 °C to a maximum of 39.8 °C throughout postpartum day zero. Antibiotics were expanded to cefepime. Eventually, she became slightly hypotensive but responded to fluid administration. She was upgraded to the intensive care unit for suspected septic shock. Antibiotic therapy was broadened to include piperacillin/tazobactam, and blood cultures were repeated. Tylenol was discontinued and N-acetyl cysteine (NAC) was also initiated at this time. Labs are most notable for elevated liver enzymes and elevated lactic acid. Similar temperature ranges are noted on postpartum day one as well as worsening liver enzyme function testing, hypoglycemia that responded to IV dextrose administration, and a slight decrease in the lactic acid (from an average of 9.6 mmol/L to 6.0 mmol/L). On postpartum day one, the decision was made to transfer the patient for a higher level of care.
+
+The patient arrived at our hospital on postpartum day two with clinical findings significant for anasarca, respiratory distress, tachycardia, and persistent fevers. On genitourinary examination, the previous left labial laceration was healing well; however, severe tenderness on bimanual was noted. The clinical diagnosis was postpartum endometritis, and antibiotics were changed to ampicillin, gentamicin, and clindamycin per obstetrical guidelines. Computed tomography of the abdomen and pelvis with contrast was significant for hepatosplenomegaly, abdominal ascites, and complex echogenic material in the lower uterine segment with concern for possible retained products of conception. Findings were consistent with a transvaginal ultrasound. A duplex ultrasound of the liver was also performed, which was significant for hepatic steatosis with a limited examination of the flow due to habitus. The results of a comprehensive hepatology panel, autoimmune panel, and viral panel, including EBV, were negative.
+
+On postpartum day three, the patient was taken to the operating room due to a lack of clinical improvement with antibiotic therapy although multiple sets of blood cultures previously drawn were negative. In the operating room, an external genitourinary examination did not reveal any evidence of purulent discharge or necrosis, and the previous left labial laceration appeared to be healing well. Dilation and curettage was performed under ultrasound guidance. The endometrial stripe appeared thin, little tissue was obtained, and excellent uterine resistance was noted with a low suspicion for endomyonecrosis. Simultaneously, a culdocentesis was performed to collect ascitic fluid. Both peritoneal fluid and endometrial tissue were sent for gram stain and culture. The results of both samples were negative on gram stain and did not reveal any underlying infectious etiology. A histological review of the endometrial tissue was negative for retained products of conception or acute inflammation. During the procedure, she received norepinephrine to support her blood pressure and was started on propofol and fentanyl for analgesia and sedation. In addition, she received 100 mg of intravenous hydrocortisone.
+
+Given her clinical condition postoperatively, the patient returned to the intensive care unit, remained intubated, sedated, and on minimal pressor support. Of note, when a sedation pause was performed at this time, the patient was alert and answering questions appropriately. As part of the protocol for propofol use in the ICU, serum triglycerides were checked and noted to be 1,513 mg/dL, for which an insulin drip was then initiated. There was a concern for possible HLH, and a ferritin level was acquired, which measured 23,173 ng/mL. She improved throughout the morning on postpartum day four (postoperative day 1), but by early evening, the patient began to have increased pressor requirements and persistent hypoglycemia despite stopping insulin drip and IV dextrose administration and her mental status became more altered. A transthoracic echocardiogram was performed which showed a left ventricular ejection fraction greater than 70 %, normal right ventricular systolic function, negative bubble study, and a right atrial pressure of 15  mmHg. Her pressor requirements continued to escalate, and maximal doses of norepinephrine, vasopressin, and phenylephrine were reached. Soluble IL-2 receptor and CXCL9 were collected earlier but required processing at an outside laboratory. She developed renal failure alongside her worsening shock and she was initated on continuous renal replacement therapy. The patient was given a pulse dose of 500 mg of IV methylprednisolone with the plan for a bone marrow biopsy the next day prior to initiating HLH-specific treatment. Unfortunately, the next morning, on postpartum day five, she rapidly declined and demised. Labs resulted 48 h after the patient’s death, which demonstrated a soluble IL-2 receptor 11,735 U/mL and a CXCL9 value of >608,000 pg/mL, which secured the diagnosis of HLH.
+
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3122_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3122_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..539f1882838b05433ecc08749b15a7bc495b2dd7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3122_en.txt
@@ -0,0 +1,5 @@
+A 41-year-old male was referred to our tertiary cardiovascular center for advanced evaluation of HF.
+He had a history of progressive dyspnea, orthopnea, bilateral leg swelling, and palpitations for 6 months.
+A coronary angiography procedure had been performed 12 months earlier via the left transfemoral access. The initial vital signs recorded included a heart rate of 130 beats per minute, blood pressure of 135/78 mm Hg, respiratory rate of 36 breaths per minute, and oxygen saturation of 88% at room air. Bilateral, severe, pretibial pitting edema and inspiratory rales auscultable at the base of the lungs were the main findings of his physical examination.
+Additionally, a palpable, continuous thrill at the right lower quadrant of the abdomen was confirmed by auscultation as a grade-5, systolodiastolic murmur over the left iliac artery. An electrocardiogram revealed nothing unusual other than sinus tachycardia. A chest X-ray revealed cardiomegaly, pulmonary arterial (PA) enlargement, and pulmonary congestion consistent with high-output HF. Echocardiography also revealed enlargement in the PAs, right atrium, right ventricle (RV); a D-shaped septum at diastole; severe tricuspid regurgitation; and moderate mitral regurgitation with a normal left ventricle ejection fraction. The estimated PA systolic pressure from the tricuspid regurgitant jet was 55 mm Hg. In addition, a continuous shunt flow from the left common iliac artery (LCIA) to the left common iliac vein (LCIV) was detected on a Doppler examination. Computed tomography (CT) angiography disclosed an enlarged inferior vena cava (IVC), and an AVF between the LCIA and the LCIV. Right and left heart catheterization and coronary angiography was performed in order to both exclude coronary artery disease and to perform further evaluation of the PH. Systolic, diastolic, mean, and wedge PA pressure was measured as 63, 33, 46, and 14 mm Hg, respectively. The Qp/Qs ratio of 2.5 was consistent with hemodynamically significant systemic to pulmonary shunting via a large AVF. The pulmonary vascular resistance (PVR) and systemic vascular resistance (SVR) were 2.7 and 15 Wood U, respectively. The diagnosis was high-output HF with PH due to a peripheral AVF, and it was decided that the shunt would be closed percutaneously.
+Using the left femoral arterial access, a 6-F right Judkins catheter was engaged at the site of the AVF, and a 0.035-mm hydrophilic guidewire was crossed over the defect and advanced to the IVC. A snare was advanced from the right femoral vein to the IVC, and following the capture and retrieval of the guidewire, a veno-arterial (VA) loop was created between the right femoral vein and the left femoral artery systems. The delivery sheath of the occluder was pushed forward through this VA loop to the LCIA. Initial attempts to use a 16-mm Amplatzer patent ductus arteriosus (PDA) occluder device (St. Jude Medical, Inc., St. Paul, MN, USA) to close the AVF failed to close the shunt. The use of an Amplatzer atrial septal defect (ASD) occluder (St. Jude Medical, Inc., St. Paul, MN, USA) also failed as a result of malorientation of the device within the LCIA. Finally, shunt closure was achieved with the original 16-mm Amplatzer PDA occluder device in another effort. The signs and symptoms of AVF and high-output HF were markedly relieved immediately after device implantation. A 90th-day control CT and conventional angiography confirmed the stability of device without any significant leakage or luminal narrowing in the LCIA. The invasively evaluated mean PA pressure was determined to be 30 mm Hg, the PVR was 3.1 Wood U, and the Qp/Qs ratio was almost 1.0. Due to the borderline PVR measures, pulmonary arterial hypertension-targeted treatment with bosentan 62.5 mg twice daily followed by 125 mg twice daily was initiated to be accompanied by periodic follow-up. His initial clinical, echocardiographic, hemodynamic, and neurohormonal measurements showed marked and progressive improvement after the procedure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3129_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3129_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d0310d1ef49e89ec5e1e65c3ac90f39e6b001315
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3129_en.txt
@@ -0,0 +1,9 @@
+A 44-year-old man who presented with shortness of breath on effort was admitted to our hospital. He had no history of hypertension, diabetes mellitus, or cardiovascular diseases. His blood pressure was 106/78 mmHg, pulse rate was 108 bpm, and blood oxygen saturation was 97% on room air. A Levine 3/6 holosystolic murmur and the third heart sound at the apex and bilateral rales were audible. Jugular venous distention and moderate pitting edema of the bilateral pretibials were noted.
+
+Chest radiography revealed cardiac enlargement (cardiothoracic ratio 66%), pulmonary congestion, and mild pleural effusion. An electrocardiogram (ECG) showed sinus rhythm and complete left bundle branch block (QRS width: 132 ms). Regarding laboratory data, serum aspartate transaminase, serum creatinine, and serum uric acid were mildly elevated. The brain natriuretic peptide level was 885 pg/mL, and the troponin T level was 0.057 ng/mL (Table). Transthoracic echocardiography demonstrated LV dilatation [LV end-diastolic diameter (LVDd): 70 mm], global hypokinesis with an ejection fraction of 25%, prominent and deep intertrabecular recesses, increased noncompacted (NC) endomyocardial layer depth compared to the compacted (C) epicardial layer (NC 28.5 mm, C 8.3 mm, NC/C ratio >2.0), and apical aneurysm with spontaneous echo contrast and 2 thrombi (10×13 mm in the inferior wall, 15×8 mm in the anterior wall).
+
+The NC region was localized at the mid-inferior and posterolateral LV and adjacent to the apical aneurysm. These thrombi were relatively highly echogenic and immobile and were detected in the apical aneurysm, not the NC region. Cardiac magnetic resonance imaging (cMRI) showed late gadolinium enhancement (LGE) in the endocardium in the apical anterolateral wall, an increased NC/C ratio (>2.3), and 2 thrombi in the apical aneurysm. Coronary angiography revealed no significant obstructive stenosis, but a left ventriculogram showed an aneurysm in the apex. A pathological analysis demonstrated no evidence of secondary cardiomyopathy, such as myocarditis, sarcoidosis, amyloidosis or hemochromatosis. Based on these findings, he was diagnosed with LVNC complicated with apical aneurysm.
+
+To determine the link between gene mutations and LV aneurysm in this case, we performed a genetic test to diagnose the LVNC. However, we detected no genetic mutations associated with LVNC or other cardiomyopathies. This patient did not have a family history of LVNC or a history of other congenital, acquired, significant valvular heart disease or neuro-muscular disease. This patient was therefore thought to be an isolated case of LVNC with LV dysfunction.
+
+Carvedilol, enalapril, furosemide, and warfarin were started to manage HF and prevent stroke or systemic thromboembolism. Although the multiple apical thrombi disappeared without clinical signs of embolism after four weeks of anticoagulation, computed tomography (CT) revealed right cerebellar infarction. Eight months after medical therapy, despite the improvement in the LV dimension (LVDd: 63 mm) and systolic function (LVEF: 34%), the thicknesses of the NC and C layers were not markedly changed (NC: 28.8 mm, C: 8.2 mm).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3157_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3157_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4c4fae07b2a4965ddd947e7bdfab7bb56095771f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3157_en.txt
@@ -0,0 +1,7 @@
+A 62-year-old male presented with acute LUTS, including severe nocturia (six times per night) and burning micturition lasting two weeks. Physical examination showed tenderness in the bilateral testes and epididymis without abscess or scrotal discoloration. Initial diagnosis included prostatitis and epididymo-orchitis. Conservative management with alpha-blockers, antibiotics, anti-inflammatory agents, and herbal medications was initiated, with laboratory work-up—including PSA, serum creatinine, FBC, CRP, urinalysis, and urine culture—collected. Results revealed normal parameters, with PSA at 1 ng/mL (later declining to 0.8 ng/mL). However, symptoms persisted.
+
+A digital rectal examination (DRE) was performed, revealing a stony-hard, tender prostate with an irregular and asymmetric surface. Prostate MRI demonstrated a large, irregular mass on the right side of the prostate with capsular infiltration and bilateral lymphadenopathy, rated PI-RADS 5. This unusual presentation, despite a normal PSA level, raised suspicion of a rare prostate malignancy.
+
+A trans-perineal biopsy guided by MRI-fusion transrectal ultrasound was performed. Initial histopathology showed high-grade adenocarcinoma (Gleason 5 + 4); however, slide re-evaluation confirmed small cell neuroendocrine carcinoma involving 85–90 % of the prostate tissue cores bilaterally. Immunohistochemical staining was positive for racemase, chromogranin, CD56, and synaptophysin, while PSA, CK7, CK20, and GATA3 were negative, excluding gastrointestinal origin. TTF-1 positivity was noted, which, although often seen in lung origin, can occur in urogenital neuroendocrine carcinoma.
+
+An F-18 PSMA PET scan demonstrated moderate PSMA avidity in the prostate with focal intense avidity in the mid-prostate (SUVmax 11.6) and mildly avid iliac lymph nodes (SUVmax 3.2), with no evidence of metastasis to bone or lungs. CT imaging confirmed prostate enlargement, seminal vesicle involvement, and lymphadenopathy. The patient began treatment with Bicalutamide (50 mg OD) and was subsequently admitted to oncology for first-line chemotherapy (Cisplatin/Etoposide) and immunotherapy (Durvalumab).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3177_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3177_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3b26daa7123a489950eadda229f2ab733261266e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3177_en.txt
@@ -0,0 +1,7 @@
+A 46-year-old female with a history of classical HL nodular sclerosis subtype complained of a right cervical lymph node enlargement after 3 cycles of first-line chemotherapy ABVD (adriamycin, bleomycin, vinblastine, and dacarbazine) three months ago. There were no fever, night sweats, and weight loss. She had no other pre-existing illness. On physical examinations, we found an enlargement of multiple right anterior cervical lymph nodes. No tenderness and no signs of inflammation.
+
+The surgeon performed an excisional biopsy to confirm the refractory of the disease. The cervical lymph node biopsy specimen (Hematoxylin & Eosin staining (H&E)) showed lymph nodes with nodular growth pattern surrounded by collagen bands. There were Hodgkin Reed-Sternberg cells, lacunar cells, small lymphocytes, and other inflammatory cells as background. The immunohistochemistry (IHC) showed positive for CD 30, CD 15, and MUM1, dim positive for PAX. The morphological features and IHC result confirmed the classical HL nodular sclerosis subtype; therefore, we established the diagnosis of refractory nodular sclerosis HL.
+
+We performed 18-Fluorodeoxyglucose positron emission tomography (PET) scan for staging and revealed lymph nodes involvement of right inferior jugular, right posterior cervical, right supraclavicular, right superior paratracheal, aorta para-arcus, aortopulmonary window, upper lobe of the left lung, peritoneum, and mesenterial with diffuse metabolic activity of all bone marrow. These findings are suggested as an extranodal extension. We did not find metastatic lung disease. Clinical staging was restaged with Clinical Stage (CS) IV according to the Ann-Arbor staging system.
+
+We offered salvage treatment with conventional chemotherapy with DHAP followed by HDT and ASCT; however, the patient hesitated since she was worried about the toxicities which could make her more susceptible to getting COVID-19 infection in the era of the COVID-19 pandemic. After discussion and explanation to the patient and the family about the efficacy and side-effect profile of BV, finally, the patient chose BV for second-line treatment to control the tumor. We administered BV monotherapy 1.8 mg/m2 every 3 weeks for up to 16 cycles. The patient tolerated BV well for eight cycles without any significant toxicities and side effects. We stopped the administration of BV because the patient had already reached remission after 8 cycles, and she was not willing to continue the chemotherapy until 16 cycles. The evaluation of the PET scan after the end of cycle-8 showed complete remission. We then suggested the patient to control every 3 months to observe the remission status with HDT and ASCT as an option to salvage if the cHL further relapsed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3185_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3185_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..878f3bd5e2cc68e1cf0fa0b10bca61e1998021a5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3185_en.txt
@@ -0,0 +1,3 @@
+Male patient, 4 months old, from a low-income area of Cartagena de Indias, Colombia, with a history of seborrheic dermatitis and tinea capitis. He presented to the emergency room with a week-old fever associated with a nodular lesion on the parietal region of the skull with edema, tenderness, pain, and spontaneous purulent drainage. He was started on oral antibiotics with no improvement. The lesion progressed to an ulcer approximately 3 cm in diameter and, at admission to the hospital, D. hominis larvae were evident in the ulcerated orifice.
+
+Treatment with cefalotin was initiated and a surgical procedure was performed to remove the larvae, of which about ten were found. However, the patient persisted with fever, purulent drainage and presence of larvae even after six days of antibiotic treatment; thus, administration of clindamycin and ivermectin was initiated. A skull radiograph showed osteolytic lesion and a 3D-reconstructed computed tomography confirmed osteomyelitis of the outer surface of the parietal bone. The patient was treated for six weeks with clindamycin and for four weeks with rifampicin, and a scalp flap was also used. Testing for the human immunodeficiency virus (HIV) primary and secondary was negative. The patient was discharged, and outpatient treatment with antibiotics and follow-up visits continued.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3189_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3189_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e29915116436cfb98f2caea30b328b5575c99f23
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3189_en.txt
@@ -0,0 +1,15 @@
+A 36-year-old male came to our emergency room with a chief complaint of jaw stiffness that made him difficult to open his mouth. He also complained of having difficulty swallowing. No complaint of abdominal muscle stiffness or whole body spasms. He also did not complain about having palpitation, difficulty in breathing, excessive salivation, nor sweating. He admitted that he had a fever for 2 days and a fishing hook wound on his index right fingertip around 5 days prior. He had dental cavities and did not have history of TB in any form. The patient could not recall his tetanus immunization status.
+
+Upon examination in the emergency room, a slight fever was observed. Other vital signs were within normal limits. On neurological examination, we found meningismus, 2 cm trismus, abdominal spasm, opisthotonus posturing, and spontaneous muscle spasms without dysautonomia. No other neurological findings nor spinal deformity was observed. Laboratory findings showed a slight increase in leukocyte count (12,700 cell/μL), normal electrocardiogram (ECG), normal blood electrolyte and renal function, and no pneumonia in his chest x-ray.
+
+The diagnosis was general tetanus Grade 3 Patel Joag, and he received intravenous metronidazol, human tetanus immunoglobulin, and tetanus toxoid. Benzodiazepine was used to control the spasms in titrated doses. He underwent wound care to eliminate the source of infection, but treatment for dental cavities was postponed due to his locked jaw condition. A tracheostomy was planned as part of the standard procedure, but the patient refused to get one.
+
+During hospitalization, spontaneous and stimulated spasms worsened, and he developed dysautonomia with tachycardia, hyperthermia, hyperhydration, and hypersalivation. On observation, no signs of myocarditis or prolonged Qtc in ECG were found.
+
+In the third week of treatment, while his tetanus condition improved, the patient started to complain about motor weakness in both legs. On examination, we observed 4 out of 5 motor scales, in the British Medical Research Council’s (MRC) motor scale, and increased knee-jerk reflexes. Inspection showed painful bulging/gibbus on the patient’s back with no pathological reflexes. The findings did not fit features of vertebral compression fracture due to tetanus which is usually mid-thoracic and painless.
+
+The patient underwent a vertebral x-ray and magnetic resonance imaging (MRI). X-ray images showed a wedge-shaped fracture at the 11th-12th thoracic vertebrae. MRI images showed a compression fracture of 11th-12th thoracic vertebrae with gibbus and change of body intensity that compressed the spinal canal and pressed the spinal cord. Inhomogeneous vertebral body intensity changes in the 11th-12th thoracic vertebrae and the intervertebral disc were also observed, which was in line with the diagnosis of spondylosis TB and spondylodiscitis TB.
+
+A thorough history taking following the MRI revealed a history of backache for 3 years, presumably due to spinal TB. On a deeper anamnesis, it was revealed that he had the diagnosis of spinal TB and had received TB treatment for several months, but he did not realize that the present condition might be related to that.
+
+Treatment for spinal TB was then started using a standard regimen. A consultation for spinal surgery was made, but the patient refused to get operated. After 27 days of hospitalization, the patient recovered from tetanus and went home with 4 on the MRC motor scale. At follow-up, 3 months later, the patient has returned to his routine activity as a food hawker with no motor deficits.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3197_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3197_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..29f24b07c96a844a35c552caa5b65584cbd54c2b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3197_en.txt
@@ -0,0 +1 @@
+The case of a 65-year-old man with a history of hypertension and smoking was admitted from another institution with a diagnosis of acute abdomen, reporting a picture of approximately 48 hours of pain in the lower abdominal area that did not subside with common analgesics, associated with nausea. On admission, he presented a positive Blumberg sign, for which a study was completed with a blood count, showing a leukocytosis of 18,320 mm³ and neutrophilia of 85%. A computed tomography (CT) of the abdomen with intravenous contrast was performed, showing a saccular image of 52 x 41 mm, dependent on the loop of the terminal ileum, with a pattern of bread crumbs, which presented peripheral enhancement, rarefaction of adjacent fat and at the root of the mesentery, findings that were related to Meckel's diverticulitis, also observing pneumoperitoneum and free liquid in the abdominal cavity, for which signs of associated peritonitis were considered. Laparoscopic surgery was performed, which showed a prominent diverticulum dependent on the small intestine, located 25 cm from the ileocecal valve, which was perforated, for which an enterotomy of approximately 5 cm of the small intestine and a lateral-lateral anastomosis with mechanical suture were performed, after washing the abdominal cavity and finally closing the abdominal wall. The pathological anatomy described a segment of the small intestine with a lesion of saccular appearance, measuring 35 x 25 mm, which after the histological cuts of its wall showed ulceration of the mucosa and submucosa and acute inflammation in the serosa, without significant alteration of the enteric wall away from the lesion. This description confirmed the diagnosis of perforated Meckel's diverticulitis, proposed by previously described images.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3233_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3233_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..798e7fcb131bbcc1c92db33ee0491d1f8db08b5b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3233_en.txt
@@ -0,0 +1,19 @@
+Female patient, 13 years old, from Cajamarca (Peru's highlands) and from Lima, with no relevant pathological or surgical history.
+
+She consulted in the emergency department due to diffuse and intermittent abdominal pain of 1 month evolution, which subsided with oral analgesics, associated with weight loss. One week prior to admission, the patient developed intermittent fever, nausea and vomiting after eating and a progressive increase in the intensity of abdominal pain.
+
+On admission, the abdominal physical examination did not reveal air-bubble sounds; superficial palpation revealed pain that increased in the left hypochondrium, where the spleen was palpated 3 cm below the left costal margin. Deep palpation revealed pain that increased in the mesogastrium. Laboratory studies reported anemia with a hemoglobin value of 10.1 g/dL (VN: 12-16); neutrophil count of 7.85 x 103/uL (VN: 1.8-8), platelets of 371 x 103/uL (VN: 150-350), lactate dehydrogenase (LDH) of 4,242 U/L (VN: 240-435) and a sedimentation rate of 35 mm/h (VN: 0-20). Serology for hepatitis B and C, HIV, syphilis and Koch bacillus (BK) in sputum and faeces was negative.
+
+In the presence of suspected surgical acute abdomen, an abdominal tomography was performed, which showed two areas with intussusception, one at the ileo-ileal level and another at the mesenterio-ileal level, and a spleen of normal size for the age, but with the presence of a solid mass of 34 x 41 x 43 mm in size, with soft parts density, in addition to a hypodens mass of 30 x 42 x 77 mm in size, with probable ganglion conglomerate at the level of the splenic hilum.
+
+Following the CT scan, laboratory tests were expanded and a B2 microglobulin value of 2.79 mg/L (normal range: 0.8-2.2) and a positive viral load for EBV of 227 copies/ml were observed. Tumour markers such as carcinoembryonic antigen and alpha-fetoprotein, as well as TORCH IgM serology (Toxoplasma, Rubella, Cytomegalovirus, Herpes) were negative; immunoglobulins remained within the appropriate ranges.
+
+A percutaneous ultrasound-guided biopsy of the splenic mass was performed. The histopathological analysis revealed a lymphoid proliferation of medium-sized, monotonous cells with round nuclei, clumped chromatin, interspersed with histiocytes and staining bodies (so-called "starry sky" appearance). Immunohistochemical markers (BCL6+, CD10+, BCL2-, TdT-, CD30-, LMP1 (EBV)-, CD21-, Ki close to 100%, cMYC+, MUM1-, CD5-, CD3-) were analyzed and were consistent with the final diagnosis of Burkitt's lymphoma.
+
+Follow-up tests: bone marrow biopsy and flow cytometry of cerebrospinal fluid (CSF) were negative for marrow and central nervous system (CNS) infiltration. However, cytospin analysis of CSF was positive for the presence of lymphoid neoplasm, which was classified as clinical stage IV by Murphy.
+
+Before the beginning of systemic therapy, the patient presented a negative evolution related to the intussusception, for which an exploratory laparotomy was performed. During the procedure, an ileo-ileal intussusception was found 70 cm from the Treitz angle, with an invaginated area of 20 cm, in addition to multiple areas of thickening of the wall of thin loops, which in the context of the patient were attributed to infiltration by the lymphoma diagnosed by the biopsy of the tumor in the spleen. The intussusception was disinvaginated. In the postoperative period, total parenteral nutrition support was used and the antibiotic coverage was expanded to meropenem, vancomycin and caspofungin, due to persistence of fever and elevation of inflammatory parameters.
+
+With clinical improvement, the patient initiated chemotherapy according to institutional protocol based on the BFM-NHL95 scheme for risk group R4 for detection of malignant neoplasia by cytomorphology of the cerebrospinal fluid. Ultrasound checks were performed to rule out the appearance of new foci of intussusception. After completing the first cycle of chemotherapy, no new foci of intussusception were detected by ultrasound; consequently, the patient tolerated oral diet, so total parenteral nutrition was suspended. Studies were performed to rule out CNS infections due to the appearance of post chemotherapy headaches, with negative viral loads. In addition, flow cytometry was repeated and was negative; while cytospin showed a positive result for lymphoid neoplasia.
+
+A positron emission tomography-computed tomography (PET-CT) was performed after her first cycle of treatment, which showed the disappearance of intussusception foci and the absence of hypermetabolic foci in intestinal walls, in the splenic lesion and at the CNS level. After 2 years of follow-up, the patient is asymptomatic, with a PET-CT negative for lymphoproliferative disease.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3244_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3244_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..950e7d06aeeefc053710108c0216982adb5213f2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3244_en.txt
@@ -0,0 +1 @@
+An 8-year-old child presented with easy fatigability and intermittent difficulty swallowing solid food over the past two years. The patient experienced dizziness. During a visit to the cardiac clinic of Ethiopia, a physical examination revealed the following vital signs: body temperature, 370°C; blood pressure, 90/40 mmHg; and pulse rate, 104 beats per minute. He had blue lips and fingers. He also had grade 1 clubbing, with a systolic ejection murmur at the left sternal junction. Echocardiography revealed severe pulmonary valvular stenosis with right ventricular dilatation, subaortic ventricular septal defect (VSD), and the absence of the left pulmonary artery. A chest CT scan revealed that the main pulmonary artery (MPA) was 103 mm in size and the right pulmonary artery (RPA) was 101 mm. The RPA size divided by the body surface area (BSA) was used to calculate the Nakata index, which was 134 mm2/m2. An additional diagnosis of an aberrant left subclavian artery with the right arch was made via CT scan.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3272_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3272_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4afd4ac9d875d49ca1782d95ab84c5ebe78d7efd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3272_en.txt
@@ -0,0 +1,7 @@
+This was a 67-year-old female patient with a history of non-Hodgkin lymphoma in remission for 3 years who presented to her oncologist for worsening night sweats and 2 weeks of progressive shortness of breath with exertion. A positron emission tomography (PET) scan and a computed tomography scan (CT) scan were ordered 6 months prior, but the patient was lost to follow-up, and she did not complete the study at that time. The non-Hodgkin lymphoma the patient was previously diagnosed with was a stage IV double-hit DLBCL, the tumor was c-Myc and B-cell lymphoma 6-positive and was treated with 6 cycles of rituximab, etoposide phosphate, prednisone, vincristine sulfate, cyclophosphamide, doxorubicin hydrochloride (R-EPOCH), completed in October 2019. Since that time, she was in remission, based on the results of a follow-up confirmed on PET/CT scan in March 2021 that showed no evidence of malignancy.
+
+On further questioning, the patient was found to have had a concomitant 4.5-kg weight gain over 2 weeks, along with bilateral leg swelling. The patient used to walk 90 min daily but over the prior 2 weeks was unable to complete even half of her usual exercise route. The patient had no cardiac history, such as heart failure, prior to this presentation. Nuclear medicine PET/CT, was obtained and completed 1 week later, revealing hypermetabolic activity localizing to a large, ill-defined right lower anterior mediastinal mass that appeared to extend into the right ventricular myocardium as well as the entire cardiac base, most consistent with malignancy. Additionally, it revealed cardiophrenic adenopathy and mildly active bilateral distal retroperitoneal lymph nodes that were highly worrisome for additional low volume disease. The patient was urged to present to the Emergency Department. Her blood pressure was 106/65 mmHg and heart rate was regular and bradycardic, at 56 bpm. Her vital signs were otherwise unremarkable. On physical examination, the patient’s cardiac and pulmonary examination was unremarkable, but the patient was found to have 2+ pitting edema in the bilateral lower extremities, without skin changes consistent with chronic edema or venous stasis. A complete blood count and comprehensive metabolic panel values were within normal limits. Troponins were trended, and all were negative. Brain natriuretic peptide was found to be elevated at 710 pq/mL (≤100 pq/mL). Lactate dehydrogenase was elevated at 458 u/L (140–271 u/L). Electrocardiogram (EKG) on admission was notable for a complete heart block, with a normal heart rate maintained by a junctional escape rhythm. Chest X-ray on admission was notable only for moderate right pleural effusion. Bedside transthoracic echocardiogram was attempted in the Emergency Department but was not able to visualize the right ventricle well.
+
+Oncology and cardiac electrophysiology teams were consulted for management. The patient was determined to have International Prognostic Index of 4. Transcutaneous pacing was discussed but was not indicated, due to the stability of the patient’s junctional escape rhythm. Intravenous furosemide 40 mg twice daily was started. Coronary CT angiogram was obtained and redemonstrated the large mass in the anterior mediastinum, extending along the entire right ventricular free wall and invading the right ventricular myocardium, with impingement into the cavity as well as extension in to the right atrium, interatrial septum, and interventricular groove.
+
+Biopsies of the anterior mediastinal mass and the patient’s bone marrow were obtained. Biopsy results showed double-hit high-grade B-cell lymphoma. Epstein-Barr encoding region in situ hybridization was negative. The patient was started on rituximab, ifosfamide, carboplatin, and etoposide (RICE) chemotherapy after the pathology was confirmed. The patient was observed inpatient during the first cycle to monitor hemodynamic stability during lymphoma retreat and was discharged with improvement in her heart failure symptoms and close cardiology and oncology follow-up. Abnormal EKG findings resolved following her chemotherapy treatment, and atrioventricular block did not recur. Follow-up PET/CT obtained 7 months later revealed complete resolution of the mediastinal mass and adenopathy, with no remaining evidence of malignancy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3274_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3274_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a2df6700c23972a9a3cc91c88f590876c363c599
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3274_en.txt
@@ -0,0 +1,21 @@
+A 62-year-old female patient with a history of hypertension, rheumatoid arthritis since 2010 and osteoporosis since 2015, treated with ibandronic acid (Bonames® tablets) 150 mg, orally, once a month, presented with bone exposure in the alveolar margin of the third quadrant after extraction in the area, accompanied by pain and bleeding to the touch at the periphery of the lesion.
+
+Histopathologic examination showed bone tissue with areas of necrosis, extensive chronic inflammation, prominent foci of neutrophilic polymorphonuclear cells, and abundant bacterial colonies. Computed tomography revealed a hyperdense image with irregular borders consistent with bone sequestration. Based on clinical, radiographic, and histopathologic findings, the diagnosis of stage II medication-related osteonecrosis of the jaw (MRONJ) was made according to the classification of the American Association of Oral and Maxillofacial Surgeons (AAOMS).
+
+A visual analogue scale (VAS) was used to assess pain, where 0 represents no pain and 10 represents the worst possible pain. Before any intervention, the patient reported a VAS score of 3/10.
+
+Treatment protocol
+With prior informed consent, minimally invasive surgery was performed on the affected area. Under local anesthesia, tissue debridement was performed for the excision of the bone sequestrum with a piezoelectric (piezotome®). The surgery continued until the bone began to bleed, indicating the arrival of healthy bone. Then, Blue®M gel was applied, left on for 2 minutes and washed off with saline. Platelet-rich fibrin (PRF) was then applied and finished with simple stitches using 5/0 non-absorbable nylon suture (ARIZI®).
+
+The following postoperative care was indicated: antibiotic therapy with amoxicillin plus clavulanic acid (875+125 mg) once daily for 7 days, and ibuprofen (400 mg) every 8 hours for 3 days, only in case of pain. In addition, a daily tablet of Teeth&Bone formula Blue®M was prescribed for 30 days. Mouth rinsing was not recommended during the first 72 hours; after this period, the use of mouth rinse Blue®M was indicated once daily by swishing for 60 seconds. In the immediate postoperative period, topical therapy with gel Blue®M was performed on the wound, leaving it to act for 2 minutes, and its application was continued on an outpatient basis every morning for 15 days.
+
+FBM therapy was performed using a dual diode laser 650-808 (model Therapy EC DMC®) with a power of 100 mW. An infrared wavelength of 808 nm with continuous emission was selected for application, with an irradiation area of 0.0984 cm². Laser application was performed with perpendicular contact to the area, in a point-like manner and following the protocol described in the literature, with a distance of 1 cm between points along the wound path. FBM therapy was performed in daily sessions of 4 joules per 2 cm² until day 3, and then twice a week for 4 weeks.
+
+The energy density was calculated as dE = E/A. As a result, the following energy densities were used:
+
+dE = E/A dE = Energy density E = energy (4J) A = area (0.0984 cm2)
+
+dE = 4J/ 0.0984 cm2 = 40.64 J/cm2
+
+Evolution
+Daily checks were performed during the first 4 days, and then at 7, 15, 25, 30 and 60 days. At the beginning of treatment, the patient reported a pain of 3/10, according to EVA, which decreased to 0/10 at the end of treatment. Clinically, a complete healing of the soft tissue was observed 30 days after the start of treatment. In the tomographic control performed at 60 days, a hyperdense spongy bone was observed with a well-formed cortical and without alterations. The patient reported being satisfied with the treatment, highlighting the absence of pain and a significant improvement in the ability to swallow and the quality of life.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3283_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3283_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0688661347df6c399e195722a7c1f7c9f11e7d2f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3283_en.txt
@@ -0,0 +1,21 @@
+An 87-year-old woman with dyspnea on exertion and lower limb pitting edema was referred to our hospital because of suspected heart failure. She also noticed watery melena 3 months before and slight fever and bilateral lower limb pitting edema 2 weeks before admission. She had been diagnosed as having hypertension and had been taking calcium antagonist and angiotensin receptor blocker. She had no history of taking statin-based medicine.
+
+On admission, her vitals were as follows: body temperature, 38.8 °C; heart rate, 70 beats/min; respiration rate, 25 breaths/min; and blood pressure, 186/91 mmHg. Her oxygen saturation was 97% at room air.
+
+Physical examination revealed bilateral lower limb pitting edema and a Levine 2/6 systolic regurgitation murmur at the apex. She had no signs or symptoms that indicated dermatomyositis (i.e., muscle grasping pain, Gottron’s papule, and heliotrope rash). Neurological examinations revealed proximal limb motor weakness (manual muscle test score, 3–4/4), mainly in the neck flexor, deltoid, iliopsoas, gluteus maximus, and quadriceps muscle. We did not observe cranial nerve palsies, muscle pains, fasciculation, sensory disturbances, cerebellar ataxia, or abnormal deep tendon reflexes.
+
+Laboratory examinations revealed high serum levels of the muscle-related enzymes (CK, 4195 mg/dL and CK-Mb, 191.8 ng/mL) and brain natriuretic peptide (285.9 pg/mL). She also showed anemia (hemoglobin level, 10.2 g/dL), hyponatremia (Na, 126 mEq/L), and thyroidal dysfunction (thyroid-stimulating hormone, 8.3 μIU/mL; free T3, 1.5 pg/mL; and free T4, 1.0 ng/dL). Renal function, glycometabolism, and other myocardial markers were within the normal ranges.
+
+Electrocardiography revealed sinus rhythm with the narrow QRS complex. The p-wave morphology was biphasic. The findings met the criteria of left ventricular high voltage without ST-segment abnormalities. Transthoracic echocardiography revealed diastolic left ventricular dysfunction (E/e′ = 19.2) with well-preserved ejection fraction (73%), along with left ventricular wall hypertrophy (end-diastolic intraventricular septal thickness, 13 mm) and pericardial effusion.
+
+Chest computed tomography (CT) revealed bilateral pleural fluid retention and pericardial effusion without lung congestion indicating right heart failure. An abdominopelvic CT scan showed wall thickening of the Ra region on the rectum and lateral lymphadenopathy, indicating advanced rectal cancer. Colonoscopy revealed a type I progressive rectal tumor located 5 cm proximal to the anal verge and a type I primary rectal tumor located 18 cm proximal to the anal verge. In addition, primary colon cancer was found in the ascending colon. Histological results confirmed triple adenocarcinomas of the rectum and ascending colon with no evidence of metastasis.
+
+Femoral magnetic resonance imaging (MRI) of the short T1 inversion recovery (STIR) sequence revealed high-intensity lesions in the left vastus lateralis muscle. A needle electromyographic study (nEMG) showed fibrillation potential, positive sharp wave, and poly-phasic motor unit potential on the right vastus lateralis muscle but not on the right tibialis anterior muscle.
+
+A muscle biopsy from her left vastus lateralis muscle revealed muscle fibers of various sizes accompanied by necrotic and regenerating fibers along with immunopositivity for major histocompatibility complex class I, whereas only slight to mild inflammatory cell infiltration was noted around the muscle fibers. Furthermore, membrane attack complex (MAC) equivocally deposited on some muscular surfaces. The patient’s serum was positive for anti-SRP antibodies, but negative for anti-HMGCR antibodies and other myositis-specific antibodies. On the basis of the pathological findings and additional serum examinations, she was diagnosed as having anti-SRP antibody-positive NM.
+
+The muscle weakness progressed rapidly after admission. The patient underwent laparoscopic lower anterior/ileocecal resection of the rectal/colon cancer and received high-dose methylprednisolone (1000 mg/day × 3 days intravenously) as initial treatment. Prednisolone (50 mg/day [1 mg/kg] orally) was administered after the initial treatment. Although her serum CK level decreased with the prednisolone therapy, her muscle weakness did not improve. After initiating IVIg therapy (400 mg/[kg·day]), her muscle weakness recovered remarkably. She was discharged 94 days after admission. Her prednisolone dose was gradually tapered to 8 mg/day without relapse 12 months after discharge.
+
+For heart failure, administration of diuretics was initiated immediately after admission. During the in-hospital treatment, paroxysmal supraventricular tachycardia, atrial fibrillation, and non-sustained ventricular tachycardia were observed. Parallel with the improvement in muscle strength, her arrhythmia, diastolic left ventricular dysfunction, and pericardial effusion also improved.
+
+The contrast-enhanced cardiac MRI performed 5 months after discharge revealed a spotty late gadolinium enhancement in the middle inferior wall of the left ventricle. T2-weighted imaging did not show any high-intensity area, suggesting a post-myocarditis change.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3310_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3310_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ea76c9a63343de07e136c62e16929e9c360b2e87
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3310_en.txt
@@ -0,0 +1,2 @@
+A 16-year-old Ukrainian boy was admitted to the Department of Children’s Infectious Diseases in Warsaw, Poland, due to jaundice lasting for four days with malaise, diarrhoea, and vomiting. The boy has lived in Poland for 1.5 years; he was working (training) in the profession of a hairdresser. The medical interview revealed that he had a tattoo made at home by his mother’s partner six months earlier and a finger was also cut by hairdressing scissors six weeks before the admission. The patient confirmed that he had two secured heterosexual encounters during the last six months. In Ukraine, he had been vaccinated against tuberculosis, diphtheria, tetanus, pertussis, poliomyelitis, measles, mumps, and rubella; he has not been vaccinated against hepatitis B. He negated any dietary errors and had never had blood transfusion nor surgery. He was once hospitalized due to acute gastroenteritis (in Ukraine). The physical examination revealed jaundice, hepatomegaly (2 cm below the rib arch), and a tattoo on the right forearm. Laboratory tests showed a significantly elevated level of aminotransferases (alanine aminotransferase (ALT) 2439 IU/L and aspartate aminotransferase (AST) 1418 IU/L). Serological testing was positive for HBsAg and anti-Hbc IgM antibodies, and negative for hepatitis A and hepatitis C viruses. The HBV viral load was 5.82 copies/mL and HBV genotype A was confirmed. Acute hepatitis B was diagnosed and the patient was treated conservatively. There were no signs of hepatic failure. During observation, hepatic parameters were firstly elevated, but after 14 days they improved and the patient was discharged home with the recommendation to appear for the follow-up examinations after six months (in order to exclude or confirm chronic hepatitis B). The patient did not appear for the visit. After 15 months, he wrote a message on Facebook to his practitioner asking if he had to report on a follow-up, as he felt good. A visit in the clinic was arranged for him. Hepatic parameters were normal, testing towards the hepatitis B antigen was negative, and the chronic HBV infection was excluded. The extended interview revealed a urinary tract infection a year before and unprotected sexual encounters of both homo and heterosexual relations. During physical examination, a small ulcer around his anus was found. Thus, additional tests for HIV, syphilis, gonorrhoea, and chlamydia trachomatis were ordered and they were all negative except for syphilis. Due to risky sexual behaviour, the patient was offered pre-exposure prophylaxis. The patient applied for further treatment of syphilis to the Clinic of Dermatology and Venereology in Warsaw.
+
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3311_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3311_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..69ff4e4b3563c1de413529822e388c661c9e8277
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3311_en.txt
@@ -0,0 +1,15 @@
+63-year-old male, smoker, hypertensive, presented to the emergency department with a history of left upper motor weakness and a new onset speech articulation disorder at 4:30 a.m. after a previously asymptomatic awakening at 4:00 a.m. with no other associated somatic or neurologic findings. Physical examination was normal and neurologic examination revealed mild dysarthria and a motor balance of 4/5 in the distal region of the left upper limb according to the Medical Research Council Scale of the United Kingdom; the rest of the neurologic examination was normal. He had a National Institute of Health Stroke Scale score of 2.
+
+Blood tests for ion balance, renal and liver function, blood count and coagulation were normal. Cardiological examination with an electrocardiogram and transthoracic echocardiography was normal.
+
+Urgent neuroimaging was performed by cranial computed tomography, which showed a chronic lacunar infarction in the outer capsule and the bilateral lenticular nucleus, and a small hypodensia lesion in the right posteroinferior frontal gyrus of acute chronology. Also, the neurosonological study did not reveal alterations.
+
+The patient was discharged with the diagnosis of lacunar syndrome of dysarthria-torpe hand in the context of a minor right hemispheric ischemic stroke, clinically LACI (lacunar infarction), of probable hypertensive etiology, and it was decided to discharge him at home with secondary preventive treatment with double antiplatelet aggregation, antihypertensive and statins.
+
+The patient returned to the emergency department 48 hours later with a sudden onset of pain and hypoesthesia in the left calf and posterior thigh, with no previous history of intermittent claudicatio. Physical examination revealed pallor of the extremity and weakness of the femoral, popliteal, and left lower limb pulses, with the rest of the physical examination normal.
+
+Urgent neuroimaging study was decided to be extended by computed tomography angiography, which excluded extracranial and intracranial stenosis; however, a focal endoluminal replenishment defect was observed in the aortic arch apex with a slightly triangular morphology, occupying 20-30% of the vessel lumen, compatible with a floating thrombus in the aortic arch, with subsequent pathological confirmation. Ultrasound of the left lower limb showed absence of arterial and venous Doppler in the anterior tibial/posterior tibial region, without popliteal arterial Doppler signal and evidence of terminal embolism in the common femoral artery bifurcation, as well as in the origin of the superficial femoral artery and the deep femoral artery.
+
+The patient was diagnosed with acute ischemic syndrome of the left lower extremity and a transfemoral embolectomy was performed. He was discharged with therapeutic doses of enoxaparin and dual antiplatelet therapy due to the embologenic mechanism.
+
+However, he returned to the emergency room a third time 24 hours later with pain and numbness in the right upper limb. Vascular examination revealed a right humeral rebound pulse with no distal pulses, and ultrasound showed thrombi in the bifurcation of the brachial artery and in the radial artery. He was diagnosed with acute ischemic syndrome of the right upper limb and a transhumeral embolectomy was performed. Finally, in the follow-up computed tomography angiography performed one month later, the floating thrombus disappeared and anticoagulation was optimized.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3332_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3332_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a25cf66465af421b4eb37f9f66394c71d3306da4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3332_en.txt
@@ -0,0 +1,3 @@
+Mr OI is a 44-year-old black African patient of Burkinabè origin. He is a smoker with 10 packs a year and has sickle-cell anaemia, who has been followed for about ten years and is taking 5 mg of folic acid daily. He has no notion of tuberculosis infection or particular pathological history. He was admitted to the rheumatology department for chronic inflammatory lower back pain associated with inflammatory left knee pain that had been going on for about seven months. He had apparently taken a drinkable decoction with no effect on the symptoms. The symptoms were accompanied by a cough with phlegm in the context of evening fever, moderate physical asthenia, anorexia and significant weight loss. On physical examination, clinical anaemia was observed that was not decompensated, a spinal syndrome and bilateral psoitis. On examination of the right shoulder, a soft, purulent swelling of 4x5 cm was observed in the sterno-clavicular joint and normal mobility of the right shoulder. On examination of the knee, a monoarthritis was found, the puncture of which revealed a purulent, fluid liquid. The respiratory tract examination showed a condensation syndrome in the left pulmonary field and a purulent pleural effusion on the right. A right inguinal lymphadenopathy with pus was observed. The examination of the other joints and other organs was without particularity. On biology, a biological inflammatory syndrome was observed with a microcytic hypochromic anaemia of 8.1 g/dl and a C reactive protein (CRP) of 98 mg/l, without hyperleucocytosis.
+
+The renal and hepatic findings were unremarkable. The serology for retroviral HIV was negative. The intradermal reaction (IDR) to the tuberculin was positive at 18 mm. The cytobacteriological examination, the GeneXpert MTB/RIF test and the search for acid-fast bacilli (AFB) in the pus from the different sites (pleura, knee, inguinal lymphadenopathy and sterno-clavicular cold abscess) did not find any germ. On the imaging, the thoracic computed tomography showed a right sterno-clavicular arthrosis with anterior muscular and mediastinal extension associated with a pyothorax and a right lung abscess. The thoracic computed tomography (CT) showed a L3-L4 spondylodiscitis with calcifying abscesses of the psoas and paravertebral muscles. The standard radiography of the left knee showed signs in favour of arthritis. The diagnosis of tuberculosis with multifocal, pleuropulmonary and lymph node involvement was retained in the face of this clinical and biological picture. The patient was put on rifampicin 600 mg daily, isoniazid 300 mg daily, pyrazinamide 2000 mg daily and ethambutol 1600 mg daily for two months. The same doses of rifampicin and isoniazid were continued for 10 months. The patient also received thoracic drainage of the pyothorax in the operating theatre and a joint lavage of the left knee, as well as a drainage of the cold abscess in the sterno-clavicular joint. Finally, local care with antiseptic was applied to the fistula of the inguinal lymphadenopathy and the cold abscess until complete healing. Folic acid treatment was continued in the context of sickle cell anaemia. The immediate evolution was marked by a clinical and biological improvement with disappearance of the inflammatory syndrome and reduction of the fever. The evolution at three months was characterised by an improvement of the psoitis and lower back pain, and a weight gain estimated at 5%.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3342_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3342_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1e69b4c6ec0f3977f2a5ada42e66da70f8c8e679
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3342_en.txt
@@ -0,0 +1,22 @@
+14-year-old female patient with CF of severe phenotype, heterozygous for the PheF508del mutation (Phe508del/1078delT, variants of classes II and I respectively), with pulmonary compromise and pancreatic insufficiency. She was diagnosed at 3 months of age, by the association of respiratory symptoms, persistent diarrhea and poor weight gain, by the electrolyte test in sweat, with a chloride of 88 meq/l (normal value < 30 meq/l). The pancreatic failure led to chronic malnutrition very early, so at 7 months of age a gastrostomy was installed that has been maintained until today.
+
+She presented with numerous endobronchial infections requiring oral and intravenous antibiotic treatment, and was hospitalised 15 times for periods of 2 weeks to 85 days. Most of these infections were due to multi-resistant Staphylococcus aureus, which became chronic, and intermittent Pseudomonas aeruginosa, which was found twice.
+
+At 12 years of age, a glucose tolerance test confirmed the diagnosis of CF-related diabetes mellitus as a complication of her pancreatic damage.
+
+His respiratory treatment consisted of respiratory kinesiotherapy three times a day, preceded by nebulization of a-dornase once a day and 7% hypertonic NaCl solution twice a day. The nutritional and digestive treatment included pancreatic enzymes (Zenpep®) before each feeding, vitamins A, D, E, K, lansoprazole, hyper-caloric feeding by mouth and gastrostomy. The radiological bone density measured by densitometry was within the low normal range and diabetes was maintained with ultra-rapid insulin treatment.
+
+Pulmonary damage was moderate to severe, manifested in pulmonary function with FEV1 at 66% of predicted, and thoracic axial tomography that showed diffuse, cylindrical and saccular bronchiectasis in all pulmonary segments, fibrosis and diffuse mucous impaction. The pulmonary impairment intensified, the patient presented persistent bronchorrhea and progressive fall of FEV1. Therefore, bronchoalveolar lavage (BAL) was performed at the level of the LSD, whose culture only showed Staphylococcus aureus multisensible, endobronchial infection by other bacterial agents was discarded, as well as non-tuberculous bacilli and fungi. Despite the management with antibiotics, kinesiological support, adequate nutrition, good control of diabetes, α-dornase and hypertonic serum, pulmonary function did not improve.
+
+The patient’s parents opted to initiate treatment with CFTR modulators. Advised by our multidisciplinary team, the parents purchased tri-associated therapy with the ETI combination (Trikafta®) from the United States, which they initiated without discontinuing their background treatment. The drug was administered in two daily doses, one morning dose of 2 fixed-dose tablets of Elexacaftor 100 milligrams, Tezacaftor 50 milligrams, and Ivacaftor 75 milligrams, and another evening dose twelve hours later of 1 tablet of Ivacaftor 150 milligrams. The tablets were administered with a high-fat diet and pancreatic enzymes to maximize their efficacy.
+
+The response to the ETI tritherapy was decided to be monitored by measuring the quality of life, pulmonary function and nutritional status. This was done in five clinical evaluations: the day of the start of the therapy, which we called day 0 or baseline, then 45, 90, 180 and 365 days from the start of the therapy. The evaluations were performed with informed consent from the parents and the agreement of the patient.
+
+The Cystic Fibrosis Questionnaire Revised (CFQ-R 14+) was administered in Spanish in a self-administered, validated, paper version for adolescents over 14 years of age and adults.13 The survey was completed by the patient in all five assessments without problems and took approximately 15 minutes per assessment.
+
+
+Pulmonary function was measured by spirometry using a Vyaire Vyntus v-176430 spirometer in accordance with international standards. In spirometry, forced vital capacity in liters and percent predicted (CVF L, CVF%), forced expiratory volume in one second in liters and percent predicted (VEF1 L, VEF1%), and flow between 25% and 75% of CVF in liters and percent predicted (FEF25-75 L, FEF 25%-75%) were measured using Quanjer's multi-ethnic predictive values. The patient was able to perform baseline spirometry without difficulty in all five assessments. The three pulmonary function parameters tested showed percent improvements from predicted values from the second visit. The evolution of CVF% was 74% (baseline), 95% (45 days), 95% (90 days), 94% (180 days) and 96% (365 days). The evolution of VEF1% was 69% (baseline), 89% (45 days), 96% (90 days), 95% (180 days) and 96% (365 days). The evolution of FEF 25%-75% was 53% (baseline), 76% (45 days), 90% (90 days), 80 (180 days) and 90% (365 days).
+
+The patient was weighed and measured on a digital scale with a measuring rod, SECA model 769. The nutritional status was calculated by measuring the percentile of BMI (pBMI) in each evaluation, according to the WHO curves. From the initial evaluation to the completion of the 12-month follow-up, the patient gained 1.8 kg and increased her pBMI by 2.8.
+
+During the follow-up period, the patient did not have exacerbations, nor did she require hospitalization or unscheduled medical consultations. She continued with her usual therapy plus the ETI tritherapy for 12 months. Adherence to the treatment was adequate and no adverse effects related to the tritherapy were detected. For this, the liver function was monitored periodically and remained normal and abdominal ultrasound was performed to rule out liver involvement. During the follow-up period, no dermatological manifestations or symptoms suggestive of visual alterations were found, which was also corroborated with an ophthalmological evaluation before starting the tritherapy and once the follow-up was completed.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3361_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3361_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e6fdd1ebb083165218a954607a64f9a295bfc78e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3361_en.txt
@@ -0,0 +1,25 @@
+Patient history
+An 11-year-old female patient diagnosed with high-grade osteosarcoma of the left distal femur underwent wide resection and subsequent prosthetic reconstruction with an endoprosthesis. Six months after the index surgery, immediately after completing the last cycle of adjuvant chemotherapy, the patient was admitted to the hospital with septic shock due to an acute deep infection. Extensive pus formation led to skin tearing on the anteromedial aspect of the knee exposing the implant.
+
+First stage - explantation of the infected endoprosthesis
+Surgical revision was indicated for infection control. The original implant was removed, and thorough debridement of soft tissues and intramedullary canals was performed, including high-pressure lavage irrigation. A reinforced temporary cement spacer with antibiotics was used to fill the defect after explanting the prosthesis. Calcium phosphate beads with Vancomycin (STIMULAN®) were placed inside the medullary canals as well as into the soft tissues. A vacuum-assisted device was used to cover the surgical site. Microbiological and bacterial PCR testing turned positive for polymicrobial flora including Staphylococcus Epidermidis, Neisseria Mucosa, Cutibacterium Acnes and Bacillus sp. Genetic testing turned negative for all tested genotypes of antibiotic resistance. Laboratory tests showed standard antibiotic sensitivity.
+
+Interim period
+Empiric antibiotic therapy with Ciprofloxacin and Metronidazole was started. These were switched to Linezolid and Cefixime once cultures were finalized. Clinical improvement with wound healing and normalization of inflammatory markers was achieved. Unfortunately, despite the recommended activity restriction, the patient developed a Salter-Harris type V-like fracture of the proximal tibia due to independent transition to full weight-bearing. This resulted in the formation of a bony bridge across the lateral half of the physis eliminating the growth potential of proximal tibia.
+
+The treated lower extremity had now lost the distal femur and the proximal tibia physes, resulting in a 5 cm leg length discrepancy at the time of the planned second stage. The length of the cement spacer was 10 cm, which is too short for an expandable prosthesis as the shortest distal femur implant is 18 cm in length.
+
+The expected length discrepancy at the end of growth was calculated at 10 cm which is unmanageable without the use of a lengthening implant. However, we wanted to avoid resecting additional bone and using a massive implant in the setting of a previous deep infection. A decision was then made to use the bioexpandable MUTARS® BioXpand prosthesis (Implantcast, Germany). The prosthesis is 10 cm long and connected to the FITBONE® extendable motorized nail (Wittenstein, Germany), allowing non-invasive lengthening through callus distraction. The total lengthening potential of this implant is 8 cm.
+
+Second stage - implantation of the bioexpandable endoprosthesis
+The cement spacer was removed and a reconstruction with the BioXpand prosthesis was performed. Since the tibia growth plate was nonfunctional we used a definitive cemented proximal tibial MUTARS component, which is fully compatible with the BioXpand system. A femoral osteotomy site was marked with a Kirschner wire according to the manufacturer’s manual. The osteotomy was performed through a separate anterior thigh incision. The FITBONE® nail was then inserted into the femoral canal and connected to the BioXpand femoral component. The nail was proximally fixed with one bicortical screw, and the distal femoral fragment was fixed to the prosthesis using screws and plates. A receiver for transcutaneous energy transmission was placed subcutaneously on the lateral side of the knee. The implant was lengthened intraoperatively 1 cm. A medial gastrocnemius muscle flap was advanced over the femoral component. All intraoperative cultures were negative.
+
+Five days after the surgery, the nail elongation at 1 mm per day started. The distraction consisted of external transmission of electromagnetic pulses to the subcutaneous receiver. Unfortunately, a bony callus was observed at the 3-month follow-up at the osteotomy site. Following a discussion with the family, this was attributed to poor compliance of the family with the recommended protocol. The lengthening intervals were inconsistent, and they avoided using an stethoscope for auditory control.
+
+A re-osteotomy was performed from a lateral incision to protect the medial gastrocnemius flap. The functionality of the lengthening mechanism was verified intraoperatively and the nail elongated by 1 cm. Postoperatively all subsequent elongations were carried out by the medical team without complications.
+
+Conversion to definitive endoprosthesis
+Once the maximum lengthening of 8 cm was reached, an exchange of the bioexpandable prosthesis for the definitive modular MUTARS® Distal Femur MK implant (Implantcast, Germany) was performed. An extended lateral approach including the previous approach used for the re-osteotomy was utilized. The newly formed bone was noted to be firm. Additionally, we enhanced the regenerated bone with iliac crest cancellous graft and bone from the reamers. The final uncemented stem was inserted with good primary stability and secured proximally with two bicortical screws. The final adult-size femoral component was connected to the previously implanted tibial part. Primary closure of the wound was achieved. All intraoperative cultures were negative.
+
+Outcomes
+At the 12-month follow-up after implantation of the definitive endoprosthesis the patient was doing well with no evidence of infection or tumor recurrence. Despite the initial arthrofibrosis resulting from the infection and multiple surgical procedures, the patient progressively regained knee range of motion (0-100°) with full active extension allowing her to independently climb stairs. The affected left leg was 1.5 cm longer in the immediate postoperative period, however, this discrepancy decreased over time with a subsequent discrepancy of less than 1 cm at the last follow-up. Nevertheless, the proximal tibia growth arrest led to an unequal knee joint level of approximately 3 cm. At the last follow-up the patient was painless, full weight-bearing and had resumed all daily routine activities including recreational sports. Final Musculoskeletal Tumor Society (MSTS) and Toronto Extremity Salvage Scores (TESS) were 27/30 and 87%, respectively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3366_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3366_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..987d61d9adec4662ab09c0c0ec983739557adaae
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3366_en.txt
@@ -0,0 +1,13 @@
+A 76-year-old male complained with shortness of breath, systemic edema for one month. He had been diagnosed as “multiple peripheral neuropathy” in several hospitals due to progressive numbness, pain and weakness of limbs, sweating, constipation and unexplained weight loss for 7 years. He had a history of hypertension for 13 years, but his blood pressure is normal without therapy in the recent two years. The patient had no history of diabetes, smoking, alcohol over consumption in the past. His father had a history of limb numbness and systemic edema. The patient had no other family history of genetic diseases.
+
+On physical examination, malnourished, anemic, lethargic, limb muscle weakness, decreased muscle tone, weakened tendon reflex, sacroiliac decubital necrosis and severe edema.
+
+Laboratory tests revealed myocardial damage with persistent elevation of hs-TnI and NT-proBNP, neutrophilic leukocytosis, moderate anemia with decrease in erythrocytes and hematocrit, mild hypoxemia. Furthermore, other abnormal parameters are listed in Table 1. Chest X-ray showed bilateral pulmonary inflammation with pleural effusion. Electrocardiogram (ECG) indicated low QRS voltage of limb leads, abnormal Q wave of II, III and aVF, and poor increase of V1-V6 R wave. Echocardiography revealed cardiac hypertrophy, left ventricular diastolic dysfunction (grade II) and small amount of pericardial effusion. There was discordance between the low QRS voltage and left ventricular hypertrophy, which may be a vital clue to the diagnosis of cardiac amyloidosis (CA). The speckle tracking imaging showed reduced global longitudinal strain (GLS) with apical sparing and with an apical-to-basal strain ratio 2.7 and the ejection fraction (EF) to GLS ratio (EFSR) was 4.4, which were consistent with the ultrasonic characteristics of CA. A thorough diagnostic approach was followed, in order to detect the underlying pathological condition. Several computed tomography (CT) scans of the chest showed diffuse pulmonary interstitial changes, cystic changes and shadows of lung consolidation, gradually increased shadow of small calcification on the lung surface at the bottom of both lungs, which were typical manifestations of pulmonary amyloid deposition. Whether there is pulmonary inflammation and infection needs to be determined in combination with blood cell examination and C-reactive protein level. The CMR and nuclear medicine modalities (PYP) were not performed because of his critical condition.
+
+For the differential diagnosis between hereditary transthyretin cardiac amyloidosis and AL amyloidosis, this patient had three serum-free light chain assays and immunofixation electrophoresis. The first results were that Fκ and Fλ were 3.05 g/L (normal range: 3.3~19.4mg/L) and 1.37g/L (normal range: 5.7 ~ 26.3 mg/L), respectively. The second result was that elevated free light chain κ (90.9 mg/L, normal range: 3.3~19.4mg/L)) and free light chain λ (62.2 mg/L, normal range: 5.7 ~ 26.3 mg/L), and Fκ/Fλ ratio was 1.46 (normal range: 0.26~1.65). The third results were elevated free light chain κ (124.78 mg/L, normal range: 3.3~19.4mg/L) and free light chain λ (74.10mg/L, normal range: 5.7 ~ 26.3 mg/L), and Fκ/Fλ ratio was 1.68 (normal range: 0.26~1.65). Serum immunofixation electrophoresis was negative for the patient, and serum-free light chain Fκ/Fλ ratio is normal or close to normal (0.26–1.65), so AL amyloidosis can be excluded.1
+
+Abdominal subcutaneous fat biopsy was negative, and no other tissue biopsy was done because of his critical condition. Although the patient is an elderly male, we did not consider the patient as senile wild-type amyloid transthyretin (wtATTR) amyloidosis and insisted on TTR genetic sequencing because the latter generally does not cause progressive polyneuropathy and autonomic dysfunction. A missense mutation c. 148 G-A (p. V50M, Val30Met) was detected in TTR genetic sequencing. It is the pathological mutation site of patients with hereditary amyloid transthyretin (hATTR) amyloidosis.
+
+The genetic finding confirmed late-onset transthyretin Val30Met-associated hereditary amyloid transthyretin (hATTR) amyloidosis, familial amyloid polyneuropathy (FAP) and cardiac amyloidosis (CA) for the patient. Recently, the patient’s first son developed limb numbness and found the same TTR gene abnormality.
+
+The patient had received doxycycline + ursodeoxycholic acid, tafamidis (chlorobenzoic acid, a stable TTR tetramer). The patient had intractable intestinal obstruction on 7 days after treatment, and had to stop taking the medicine. After 80 days of treatment, the patient tragically died of cardiac involvement. We did not perform a biopsy of the heart and lung on autopsy to confirm ATTR amyloidosis deposits because the patient’s son refused.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_337_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_337_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d54adf8e315aafb75c98c6ace38f02aa50c1301
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_337_en.txt
@@ -0,0 +1,3 @@
+A 56-year-old previously healthy Chinese female was admitted to our medical center because of detection of a malignancy-suspected nodule in the right lobe of the thyroid by a routine ultrasonography examination two months ago, which displayed a 1.28 cm*1.14 cm hypoechoic nodule inside the right lobe of thyroid with irregular shape and fairly clear margins close to the posterior capsule, and the Color-flow Doppler imaging showed short-trip blood flows inside . There were no complaints of palpitation, hyperhidrosis, hoarseness, dyspnea, dysphagia, osteoporosis or convulsion of limbs. The patient was soon scheduled for surgery, before which a preoperative assay of level of serum calcium (Ca) and phosphorus (P) showed normal (Ca 2.50 mmol per liter, P 0.94 mmol per liter).
+During the operation, it was found that the tumor was completely located inside the right lobe of thyroid, the texture of which was soft, and the thyroid membrane was intact while no infiltration of adjacent structures was seen. The intraoperative rapid pathology highly suspected malignancy while no characteristic papillary pathological structure was detected, remaining further classification still in need of postoperative paraffin pathology. In addition, during the operation, we detected that some right VI lymph nodes were abnormal swell and hyperplasia, consequently, we finally performed right thyroid lobectomy combined with right VI lymphadenectomy.
+The patient was sent back to ward in generally good condition after a smooth surgery and an immediate postoperative assay of calcitonin (CT) and carcinoembryonic(CEA)antigen showed no abnormality (CT < 1.5 pg per milliliter, CEA 2.32 ng per milliliter). After three days of medical care, the patient recovered well and was discharged smoothly. The postoperative paraffin pathological diagnosis revealed adenocarcinoma of parathyroid and the level of serum parathormone (PTH), Ca and P showed no abnormality (PTH 66.1 pg per milliliter, Ca 2.31 mmol per liter, P 1.17 mmol per liter). In addition, 99 m-Tc-MIBI-Pertechnetate imaging showed that the rest parathyroid appeared no abnormality. At a six-month follow up visit after operation, no discomforts or side effects were complained by the patient as well as no obvious locally recurrence were indicated by ultrasonography and the patient is still under regular routine follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_368_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_368_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..940227ebc034f7bc57418e36f06e2303d36cce5f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_368_en.txt
@@ -0,0 +1,11 @@
+This is the case of a 49-year-old man, a smoker at 20 pack-years, with no medical history except retrobulbar optic neuritis and an appendectomy. A family history of elevated blood pressure was reported in his father.
+The patient was diagnosed with axial SpA in 2017. The diagnosis was made according to Assessment in Spondyloarthritis International Society (ASAS) 2009 criteria: inflammatory back pain for more than a year, age of onset<45 years, bilateral grade II sacroiliitis on radiographs, and elevated positive C-Reactive Protein (CRP) at 164mg/l [normal value (NV)≤8 mg/l]. No extra-articular manifestations were identified at the time of diagnosis. Blood pressure and blood sugar levels were normal. Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) treatment (diclofenac and indomethacin) was initiated for the first two months after diagnosis. This treatment was quickly stopped upon the discovery of proteinuria at 0.3 g/24h. A corticosteroid therapy was therefore prescribed (10 mg of Prednisone) and we decided to start a biologic drug. Unfortunately, the patient was lost to follow-up from 2017 to 2020. During this time, he was self-medicated with NSAIDs and analgesics.
+He consulted in December 2020 for white, soft, and pitting edema of the lower extremities. On examination, he weighed 78 kilograms, his body mass index was 24.6 kg/m. His blood pressure was elevated at 180–200 mmHg for systolic and 100–120 mmHg for diastolic. Cardiac examination was normal. There was no hepatomegaly or pathological jugular turgor. Pulmonary examination found decreased breath sounds on pulmonary auscultation, which were absent at the base. Oxygen saturation was 97%. The abdomen was distended but painless to palpation. Bilateral flank dullness was noted on percussion. Examination of the external genitalia revealed a bilateral hydrocele. Osteoarticular examination revealed stiffness of the back without mobility limitation, and mobility limitation of the hips. There were no other joint involvements or abnormalities on general examination.
+Laboratory examinations had shown: CRP at 51 mg/l [NV≤8 mg/l], creatinine and estimated glomerular filtration rate (eGFR) at 53.04 μmol/l [NV: 55–100 μmol/l] and 151 ml/min [NV: 90–130 ml/min] respectively, 24-hour proteinuria at 5.9 g/24h [NV<30 mg/24h], total serum protein at 46 g/l [NV: 60–80 g/l], and serum albumin at 14.4 g/l [NV: 35–50 g/l]. Otherwise, there was no hematuria. These clinical and biological data led to the diagnosis of impure nephrotic syndrome with hypertension. Furthermore, the SpA was highly active, according to the disease activity scores (BASDAI: Bath Ankylosing Spondylitis Disease Activity and ASDAS-CRP: Ankylosing Spondylitis Disease Activity Score) which were 6.3 and 4.95, respectively.
+In order to explore the nephrotic syndrome; we performed a renal biopsy whose histologic examination concluded with an FSGS involvement. In fact, the biopsy was performed under ultrasound guidance and brought 3 cortical fragments with 25 glomeruli, none of which were sclerotic. In light microscopy, segmental and focal hyalinosis lesions were observed in 5 glomeruli per section plane. Podocytes had a turgid appearance with abundant cytoplasm. The walls of the glomerular capillaries were normal in appearance, no visible deposits were observed, and Cango Red staining was negative. Moreover, a non-inflammatory interstitial fibrosis and tubular atrophy occupying 20% of the examined parenchyma was observed. As for the vessels, there were 2 to 3 interlobular arteries of normal appearance. The arteriolar sections showed moderate hyalinosis .
+For immunofluorescence, hematoxylin and eosin staining was performed in 7 glomeruli and revealed membrane staining with IgA antisera, segmental glomerular IgM deposition and negative fibrin, C1q, C3, and IgG antibodies.
+Only light microscopy and immunofluorescence analyses were performed, as an electron microscope was not available.
+The patient was hospitalised and an etiological investigation has been initiated. We ruled out viral infections (human immunodeficiency virus, hepatitis B virus, parvovirus B19, and cytomegalovirus) by negative viral serology, drug and toxic causes by interrogation, and causes of FSGS by glomerular hyperfiltration by normal renal ultrasound and urological exploration and given the absence of diabetes, obesity, sickle cell disease and cyanotic cardiac disease. At the same time, we started corticosteroid therapy (Prednisone) at a dose of 1 mg/kg/day in association with furosemide (initially intravenously at a dose of 200 mg then a gradual decrease to 40 mg per OS), spironolactone (100 mg per OS per day), and ramipril (2.5 mg per OS per day). In addition, five albumin infusions were prescribed.
+The patient was initially monitored daily (during his stay in hospital). Then he was examined as an outpatient every week for the first month and then every 2 weeks. Proteinuria was assessed at each visit by urine dipstick, and a 24-hour proteinuria determination was performed every 4 weeks. Blood analysis (serum protein, albumin, and creatinine) was also performed.
+After 12 weeks of treatment, the patient lost 15 kg of weight. His creatinine and eGFR levels were 51.33 μmol/l and 156 ml/min, respectively. His total serum protein and albumin levels were 64 g/L and 32.4 g/L, respectively. However, he still had an estimated proteinuria of 2.3 g/24h (3 crosses on the urine dipstick).
+Concerning SpA management, the patient is currently waiting for an agreement for the coverage of a biologic drug (Adalimumab) from the social insurance funds. He is only receiving analgesic treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_385_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_385_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..df7b6c1765024f0bc635b3f0f75bb275f117a309
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_385_en.txt
@@ -0,0 +1,3 @@
+A 23-year-old man presented with a posterior occipitocervical subcutaneous mass that had been present since birth and had been growing for years. He complained of neck pain and stiffness for approximately 5 months, with no symptoms of extremity numbness or pain. There was no history of trauma or weight loss and was no family history of cancer. Physical examination revealed a partially spherical lesion, compressible, with mild tenderness. Laboratory data showed no infectious or inflammatory findings.
+Magnetic resonance imaging (MRI) examination was performed preoperatively, in order to establish the extent of the tumor and define its association with the surrounding tissues. The occipitocervical MRI scan showed an approximate lesion measuring 11.2 × 3.5 × 6.9 cm with an irregular shape, unclear boundary, and uneven signal intensity on sagittal T2-weighted imaging (WI), dominantly high signal intensity on T2-WI fat suppressed, and markedly heterogeneous enhancement on coronal enhanced scan in the occipitocervical subcutaneous tissue.
+The patient was admitted for surgery. During the operation, the boundary of the mass was unclear. Macroscopically, the mass spaces between all mass measurements were 10.8 × 3.4 × 6.2 cm. It was polycystic and soft in consistency. Histopathological examination revealed abnormal lymphatic and blood vessels with polycystic spaces, thin wall, and dyed red lymph and blood cells within the lumen, which confirmed a diagnosis of hemolymphangioma. The postoperative course of the patient was uneventful, and the patient was discharged 2 weeks following the surgery. At 8 months of follow-up, he had no visible recurrence of the subcutaneous lesion and no evidence of neck pain and stiffness.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_392_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_392_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9deb2a206be88e7e6e3a9e4cb0728d744178526d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_392_en.txt
@@ -0,0 +1,9 @@
+Preoperative tests, including corneal topography utilizing a Zeiss ATLAS 9000 (Carl Zeiss AG, Oberkochen, Germany), were performed on a 44-year-old Caucasian male patient considering CLRS. The patient did not have medical, family, or psychosocial history that could indicate predisposition or existence of corneal abnormalities, nor did he show any symptoms that could suggest corneal aberrations. Moreover, the patient had never undergone previous eye interventions. No financial, language, or cultural challenges occurred regarding the management of this case. The results from the initial presentation (T = 0) (that is, topographic examination) did not indicate corneal abnormalities in either eye of the patient , nor any other ocular pathologies. For GP, a buccal mucosa sample was collected by using an iSWAB collection kit (Mawi DNA Technologies, Hayward, CA, USA). After DNA was extracted (QIAamp DNA mini kit, QIAGEN Inc. Hilden, Germany) from the sample, a next-generation sequencing (NGS) test (AvaGen, Avellino Lab, Menlo Park, CA, USA) targeting 75 genes specific to the structure and health of the eye was used to analyze the patient’s DNA. The sequencing results identified four potentially pathogenic variants located on chr 5 (ADGRV1), chr 8 (PTK2), chr 16 (ZNF469), and chr 17 (KRT15) within the patient’s genome . These DNA mutations were found to carry a risk factor for ECD based on the following analysis.
+Adhering to the guidelines put forward by the American College of Medical Genetics and Genomics (ACMG) for the interpretation of sequence variants , the following criteria were applied to determine which variants within the patient’s test results were most likely damaging and thus carry a risk for ECD. Sequence variants were filtered based on their minor allele frequency (MAF) in the general population and protein coding changes, categorized as missense, STOP gain/loss, nonsense, or frameshift/non-frameshift indels. Variants with an MAF < 0.01 based on The Genome Aggregation Database were considered to be possibly pathogenic. The pathology for each variant was also gauged by using three in silico prediction tools: PolyPhen2-HDIV, LRT, and PROVEAN. Each tool aims to determine the likely impact on the transcribed amino acid sequence and translated protein due to a change in the DNA sequence. All genome positions were based on the Genome Reference Consortium Human genome build 37 (GRCh37.p13).
+The filtering criteria resulted in the four heterozygous, missense mutations detailed in Table . The ADGRV1 and KRT15 variants were classified as possibly damaging, deleterious, and damaging by PolyPhen2-HDIV, LRT, and PROVEAN respectively, while the variants in the PTK2 and ZNF469 genes were classified as benign, neutral, or no data available by the in silico prediction tools we used.
+A further analysis was conducted by using the GeneMANIA server to provide insight of gene function for the four genes and how these variants within each gene could affect the health of the cornea via coordinated molecular pathways . This analysis found that ADGRV1 and KRT15 are coexpressed and that ADGRV1, KRT15, and ZNF469 interact with PTK2 via integrins, transmembrane cell adhesion receptors that play important roles in the regulation of cell migration during development, wound healing, and inflammatory response . All four genes are integral to eye development and various molecular pathways. A few have been indicated in eye diseases of various types.
+The missense variant located in ADGRV1 results in a change in the amino acid sequence of histidine to arginine at position 4661 (H4661R) within a region of the ADGRV1 protein that overlaps with a Calx-beta domain. The Calx-beta motif is a protein motif that is used for calcium binding and regulation, and this variant may lead to conformational changes in the protein that affects the binding of the ADGRV1 protein to its interacting partners by disrupting calcium binding sites. ADGRV1 is part of the USH2 complex, which plays an essential role in the development of hearing and vision via cell surface receptor signaling pathways . A variant within this gene has previously been reported in two brothers suffering from KC .
+Currently, there is no evidence that links PTK2 to ECD. However, the PTK2 variant found in the proband induces an amino acid change of tyrosine to cystine (Y726C) in the functional domain of the PTK2 protein. PTK2 plays an essential role in regulating cell migration, adhesion, spreading, and reorganization of the actin cytoskeleton .
+This missense variant in the ZNF469 gene results in the conversion of amino acid 3585 from glycine to valine (G3585V) within the ZNF469 protein. It is considered benign and neutral by PolyPhen2-HDIV and PROVEAN, respectively; however, the region where it is located overlaps with two regulatory regions that may affect binding of certain transcription factors (TFs) to their sites. There are numerous studies that have linked mutations in ZNF469 to KC and to brittle cornea syndrome (BCS), an extreme form of ECD [–].
+KRT15 is expressed in corneal limbal epithelial cells and is involved in wound healing [, ]. The missense variant found in this gene, which results in an amino acid change from arginine to cysteine (R115C), overlaps with an intermediate filament rod domain in the protein structure. This plays a significant role during the protein assembly process, and mutations in this functionally important area disrupt end-to-end keratin interactions that could subsequently affect the corneal epithelia . This variant also falls within a regulatory region that serves as a TF binding site . Based on tissue and upstream signaling pathways, the related TF either enhances or suppresses the transcription of KRT15. Any dysregulation of KRT15 at this TF binding site caused by this variant could affect changes in the cytoskeleton and could possibly affect the development of the lacrimal gland .
+After the results of GP determined the presence of potentially pathogenic variants, the patient was recalled and reevaluated with three different advanced tomographers (T = 52 days after initial presentation): a Pentacam (OCULUS, Wetzlar, Germany), an Orbscan (Bausch & Lomb, Rochester, NY, USA), and a SIRIUS (CSO, Florence, Italy). A deformity of the posterior profile of the cornea in the left eye (LE) was identified with all three instruments. The tomography measurements are shown in Fig. . The Pentacam produced a Belin/Ambrósio Enhanced Ectasia Display that highlighted a “warning” signal (yellow) that showed an elevation of 12 microns in the differential map of the back surface of the cornea . The Orbscan showed the presence of an alteration of the corneal posterior elevation of 0.058 mm . The results of the Sirius further confirmed the presence of an asymmetry of the curvature expressed in D (diopters) between the front and back face of the cornea in the LE, Slb = 0.24 D .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_41_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_41_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..70f1ed70a9e9c1a4d509860fcacf40f805e65482
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_41_en.txt
@@ -0,0 +1,8 @@
+A 76-year-old White male was referred for esophagogastroduodenoscopy (EGD) after an episode of upper gastrointestinal bleeding.
+The patient reported recurrent epigastric pain, transient fatigue and melena.
+The patient’s comorbidities were type 2 diabetes mellitus, arterial hypertension and benign prostatic hyperplasia. Past medical history was relevant for coronavirus disease 2019, ischemic stroke, appendectomy, viscerocranial abscess and surgically-treated cataract.
+The patient had a history of smoking in the past (30 pack-years). However, he had not smoked for 4 years and denied drinking alcohol. There was no relevant family history.
+The patient’s height was 183 cm, weight was 80 kg, and body mass index was 23.89. Vitals upon admission were: heart rate, 50 beats/min; blood pressure, 118/48 mmHg; respiratory rate, 14/min; and body temperature, 36 °C. There was no abdominal tenderness and no peripheral edema.
+Laboratory results were not relevant. Serum protein or albumin levels were not tested because Ménétrier’s disease was not suspected at the time.
+EGD revealed a polypoid mass (4 cm × 1 cm) with enlarged mucosal folds in the body of the stomach between the lesser curvature and posterior wall . The mass was cohesive and somewhat stiff in contact with the forceps. A small ulcer at the distal end of the mass was identified as the source of the bleeding . Standard and deep biopsy were taken from the distal end of the mass, and both were negative for neoplasia. Except for the mass, the mucosa was normal, and gastric folds were not enlarged.
+Computed tomography of the abdomen with contrast enhancement showed a submucosal lipoma (49 mm × 19 mm) in the body of the stomach, elevating the mucosa . The stomach was otherwise normal. There was no visible infiltration of surrounding tissue and no enlarged lymph nodes.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_442_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_442_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b86b2431b0432b4fccd8418ca15663b1f24a4e1b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_442_en.txt
@@ -0,0 +1,6 @@
+A 46-year-old Korean man, a general office worker, was referred to our institution for the evaluation of congenital heart disease with severe pulmonary arterial hypertension (PAH). He was a social drinker and current tobacco smoker. He had a history of type 2 diabetes controlled with orally administered hypoglycemic agents (metformin, linagliptin, and glimepiride). A cardiac defect was suspected when he was young, but he was asymptomatic and his somatic growth was normal. Detailed assessment of his cardiac lesion was conducted when he was 30-years old. Even after the detection of cardiac defects, he missed routine follow-ups because he was asymptomatic. One month prior to admission, he suddenly developed intermittent chest pain at rest that continued for several minutes. At the primary hospital, he was diagnosed as having a congenital heart disease of VSD, tricuspid regurgitation, and severe PAH; he was transferred to our hospital for further evaluation and management. His general condition was quite good and there was no evidence of neurological or cardiovascular disorder except a pansystolic murmur. His vital signs were as follows: blood pressure of 129/79 mmHg, heart rate of 78 beats/minute, respiratory rate of 18 breaths/minute, and body temperature of 36.6 °C. Electrocardiography demonstrated a sinus rhythm with an incomplete right bundle branch block and bi-atrial abnormality, and a chest X-ray showed mild cardiomegaly. The results of laboratory tests were within normal limits: white blood cells of 6600/μL, hemoglobin of 16.1 g/dL, platelets of 212 k/μL, blood urea nitrogen of 12 mg/dL, serum creatinine of 0.93 mg/dL, aspartate aminotransferase of 28 IU/L, and alanine aminotransferase of 26 IU/L.
+On TTE, the pulmonary valve was at the center position of the parasternal short axis view , and was opening well and arising from the right-sided ventricle. The aortic valve was on the left anterior side of the pulmonary valve, suggesting ventriculo-arterial discordance . CCT and three-dimensional modeling demonstrated the aorta and pulmonary trunk to be in similar positions to those shown by TTE , and demonstrated the parallel arrangement of the great arteries . TTE and CCT showed atrioventricular discordance in addition to ventriculo-arterial discordance . The left-sided morphologically RV was a systemic ventricle with prominently coarse trabeculation and an apically displaced atrioventricular valve as a tricuspid valve. The other smooth-wall right-sided pulmonic ventricle was morphologically a LV. Three-dimensional modeling of the chamber revealed similar information . The ejection fraction of the left-sided systemic ventricle (RV) was 58%.
+A large VSD was also detected by TTE and CCT . While the left-sided atrioventricular (tricuspid) valve of the systemic ventricle was free of regurgitation, a moderate amount of regurgitant flow, with a peak velocity of 5.0 m/second, was noticed at the right-sided atrioventricular (mitral) valve , which we assumed was the reason why our patient was diagnosed as having tricuspid regurgitation and severe PAH at the primary hospital. However, we also detected pulmonic stenosis, with a maximal velocity of 4.2 m/second , even with the normal morphology and opening of the pulmonic valve .
+Pressure measurement of each chamber by cardiac catheterization demonstrated almost equalization of both the ventricles; the systolic/diastolic/mean pressure of the LV and RV were 114/12/78 mmHg and 120/13/80 mmHg, respectively. Importantly, while the pressure of the aorta was 117/76/94 mmHg, the pulmonary arterial pressure was 36/17/24 mmHg, suggesting the protection of pulmonary vasculature by the presence of severe pulmonic stenosis. Oxygen saturation at the superior and inferior vena cava was 72.3% and 69.2%, respectively, but there was unexpectedly high oxygen saturation (93.9%) at the LV (pulmonic ventricle) near the VSD. Oxygen saturation at the pulmonary artery returned to 88.0% and the saturation at the aorta was 96.9%.
+We thought it necessary to assess the detailed morphological features to explain the anatomic substrates of the pulmonary stenosis and the discrepancy in the oxygen saturation data at the right-sided LV. Detailed morphological analysis of the CCT and three-dimensional modeling and printing data were applied to understand the mitral/tricuspid valves and the VSD . The pulmonary trunk was shifted to the left and overrode the ventricular septum to become a double outlet RV relation of the arterial trunks. However, the outflows to the aorta and pulmonary trunk were separated by a prominent outlet septum . Because of the prominent outlet septum, the actual interventricular communication was smaller at the lower end of the outlet septum than at the real VSD . In addition, there was a straddling of the mitral valve, with a chordal attachment of the mitral valve to the outlet septum of the RV near the pulmonary valve . The straddling mitral valve and the outlet septum together formed a severe subvalvular pulmonic stenosis . In addition, the subvalvular structure of the tricuspid valve was connected to the interventricular septum . We interpreted these anomalies to reflect the mitral valve straddling over the posteriorly positioned VSD and hypertrophied outlet septum, which together could explain the functional and anatomical sub-pulmonary stenosis and a small amount of shunt flow through the large VSD. Based on these results, we decided to continue medical management, as well-balanced systemic/pulmonary circulations would be maintained with this particular combination of cardiac lesions.
+Fifteen days after discharge, our patient visited our emergency room for chest pain, similar to the pain that occurred a month prior. Electrocardiography demonstrated atrial fibrillation with a rapid ventricular response. After direct current cardioversion, his rhythm was converted to sinus rhythm and his chest pain was relieved. He was subsequently started on aspirin and amiodarone and has been asymptomatic for 3 years.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_46_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_46_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e2490c15ef85221c9f608094c1623157319ae109
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_46_en.txt
@@ -0,0 +1 @@
+A 58-year-old female presented with a one-week history of blurred vision associated with photophobia and redness. The episode started when she tapered her loteprednol from twice a day to once a day. The patient underwent DSAEK regrafting 1 year before her presentation. Her first DSAEK procedure had been performed 4 years prior for a decompensated cornea secondary to an iris-fixated anterior chamber lens. Her best corrected visual acuity in the right eye was 20/200, and the intraocular pressure was 9 mmHg. Slit-lamp examination showed a mildly injected conjunctiva with 1+ corneal oedema . On the posterior surface of the cornea, there was an endothelial rejection line (Khodadoust line) with KPs extending from 4 to 8 o’clock . Additionally, there were multiple areas of anterior synechia. The pupil was irregular and oval in shape, and the anterior chamber was deep with occasional cells. Examination of the left eye was unremarkable. The patient had a central corneal thickness of 659 μm (measured by anterior segment optical coherence tomography) on initial presentation . The diagnosis of graft rejection was made, and the patient was started on prednisolone acetate 1% drops every 1 h. After 1 month of follow-up, the patient’s vision improved from 20/200 to 20/60, and the corneal oedema also improved .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_476_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_476_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..09459a7043308f7daa59d95a4caefade23285532
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_476_en.txt
@@ -0,0 +1 @@
+An 8-year-old girl presented with a 4 months history of right parietal bone swelling with an offensive odor. There was no discharge and no history of vomiting or trauma. She has taken no medications lately and had no allergic reactions. In the clinic, she had a mild headache with no fever, no symptoms of increased intracranial pressure, and no neurological abnormalities. A head computed tomography (CT) scan showed a parietal bone lesion. After that, an MRI scan of the brain showed a 2.5 × 1.5 cm bone lesion extended as swelling and suggested the diagnosis of EG . Histopathology was performed and revealed proliferation of monotonous population of discohesive cells composed of oval nuclei with open chromatin and coffee bean grooves with abundant pale cytoplasm. Immunohistochemistry for these cells was positive for CD1a and S100 . Initial treatment with augmentin was performed to relieve the infection and the odor. After that, a CT scan showed that the swelling is disappeared, but there was a lytic bone lesion . On examination, there was a feeling of soft tissue. Thereupon, a surgical procedure was done by excision of the lesion with a 3 mm safety margin, and a titanium mesh was inserted . During the surgery, the patient was given cefazolin. Laboratory values before and after the surgery were within the normal range. The patient was discharged home with augmentin and analgesia. In the clinic, the follow-up of the patient was performed with no post-operative complications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_483_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_483_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7caf38f292e77be995df26f0723e2bb9dbb8962c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_483_en.txt
@@ -0,0 +1,3 @@
+A 68-year-old Asian man presented to our cardiologic clinic with chief complaints of long-term swelling of his ankles, intermittent palpitations, and a propensity for becoming easily fatigued. On arrival, he presented the following vital signs: blood pressure of 121/71mmHg, body temperature of 35.9°C, and a heart rate of 52/minute. A physical examination revealed a grade III/VI blowing pansystolic murmur, best heard low over the left lower sternal border, an irregular heartbeat, jugular vein engorgement, and bilateral grade III pitting edema of his lower legs. The electrocardiogram showed sinus rhythm with frequent premature ventricular contractions. Color flow Doppler echocardiography showed an enlarged, hypokinetic right ventricle with a paper-thin right ventricular free wall and dilatation of his tricuspid valve annulus compatible with tricuspid regurgitation. Given the evidence from a serial laboratory study and image examination, the cardiologist had a high level of suspicion for arrhythmogenic right ventricular dysplasia. An EMB was arranged subsequently for sampling of the patient’s right ventricular pathological tissue via his right internal jugular vein. Using Seldinger’s technique, a 9 French silicone-locked catheter introducer sheet was applied. The bioptome was introduced via the sheet and then directed toward his right atrium. However, the cardiologist felt kinking while introducing the bioptome within the sheet just above the level of the patient’s right subclavian vein. A metallic cup tip was lost when the bioptome was withdrawn. The silicone introducer sheet was later removed without incident.
+Out of concern for the floating foreign body inside the vasculature, an angiography via a right femoral approach was performed promptly, but no visible radiopaque foreign body was found within the patient’s vasculature with fluoroscopic guidance. He did not experience any immediate neurological or cardiovascular catastrophe. The cardiologist immediately arranged a computed tomography (CT) scan, and detected a high density lesion within the patient’s prevertebral musculature.
+The head-and-neck surgeons arranged neck exploration the next day. Out of consideration for safe surgical removal, we adopted a right lateral cervical approach. After developing superior and inferior subplatysmal flaps, the patient’s carotid sheath was opened by retracting the sternocleidomastoid muscle posteriorly. We explored between his internal jugular vein and his common carotid artery after identifying the vagus nerve, and then continued dissection deep down to the buccopharyngeal fascia. However, we were unable to approach the foreign body using physical digital examination, even after identifying the vertebral transverse process and sympathetic trunk. We then applied a mobile C-arm (X-ray image intensifier, Figure b) to check the exact three-dimensional relationship of the foreign body to the vertebral body. We then identified the missing metallic cup tip, just medial to a vertebral vein, and stuck within the deep prevertebral muscles . The patient underwent surgery to remove the metallic cup tip uneventfully, with no immediate sequela. He was discharged 10 days later. The wound healed well during follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_493_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_493_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a2dbb8ce6df94b6aa86f855505838ba492fa49c5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_493_en.txt
@@ -0,0 +1,5 @@
+A 62-year old male patient had a robot-assisted laparoscopic prostatectomy in August 2014 for a Gleason 4 + 3 multifocal adenocarcinoma with tertiary grade 5 disease and extraprostatic extension (pT3aN0Mx). The pre-operative PSA was 5.3 μg/L and the post-operative PSA was unchanged at 5.63 μg/L, despite negative surgical margins . The PSA, 6 months post-operatively, had increased to 10.06 μg/L. Pelvic MRI showed no local recurrence or residual prostatic tissue and a bone scan was also negative. Androgen deprivation therapy (ADT) was commenced with a subsequent fall in PSA to < 0.02 μg/L, but it was discontinued after a year due to side effects.
+Serum PSA tests were undertaken regularly . 4.5 years post-operatively, the PSA increased to 2.33 μg/L and staging CT and whole-body bone scintigram showed no evidence of metastatic disease.
+Five years after prostatectomy, the PSA reached 10.6 μg/L, and the patient underwent a [68Ga]Ga-THP-PSMA PET/CT using a cold kit PSMA formulation [–]. Sixty minutes after intravenous injection of 204 MBq of tracer a [68Ga]Ga-THP-PSMA PET/CT was acquired from proximal thighs to skull base on a GE Discovery 690 PET-CT scanner (GE Healthcare, Chicago, USA) according to current guidelines (4 min per bed position with 23% overlap and axial field of view of 16 cm). A low-dose unenhanced CT scan (120 kVp, 0.5 s rotation time, 3.75 mm slices, Noise Index 45, 10–180 mA) was performed for attenuation correction and localization purposes. PET reconstructions included corrections for radiotracer decay, attenuation, modeled scatter, randoms and dead-time, both for time-of-flight (TOF ordered subset expectation maximisation with 24 subsets and 2 iterations) and scatter-limit correction series. The PET/CT showed increased focal uptake in the right mid-cranial fossa, with no focal uptake in the rest of the body. The differential considered at this point was a meningioma, glioma or a prostate metastasis, all known to express PSMA [–]. The patient had no neurological symptoms at the time of presentation.
+A subsequent contrast-enhanced MRI head showed a well-demarcated enhancing dural-based lesion in the floor of the right middle cranial fossa, projecting into the right temporal lobe, with surrounding T2 hyperintense changes in the right temporal lobe, believed to be extra-axial on MRI. The lesion was thought initially to represent a meningioma, both on the [68Ga]Ga-THP-PSMA PET/CT (SUVmax TOF = 6.2) and contrast-enhanced MRI, although the PET/CT had raised the suspicion of a prostate cancer metastasis given its unusually intense uptake .
+As uncertainty remained between the two possible diagnoses (meningioma or prostate cancer metastasis) in the neuro-oncology multidisciplinary team meeting, the patient was referred for a neurosurgical opinion, which advised the lesion’s surgical resection and dexamethasone 4 mg bd, to reduce surrounding oedema. A second MRI head, performed 1 month later for pre-surgical planning, confirmed a 23 × 18 mm solitary tumour with surrounding oedema in the anterior part of the right inferior temporal gyrus. The tumour contained heterogeneous low and high areas of T2 signal, patchy heterogeneous contrast enhancement and dural extension to the brain surface inferiorly. The second MRI suggested that the lesion was intra-axial. The contrast-enhanced post-operative MRI head showed complete resection of the tumour with a reduction in serum PSA to 2.93 μg/L. The histopathology report confirmed an intra-axial right temporal lobe metastatic prostatic adenocarcinoma with dural extension and intense PSA and PSAP staining. Three months after neurosurgery the patient had recovered well with only mild neurological deficit (left foot drop). Surveillance MRI showed no intracranial mass or abnormal contrast enhancement to indicate residual or recurrent tumour and only expected post-operative encephalomalacia in the anterior inferior part of the right temporal lobe. The serum PSA remained elevated (2.28 μg/l). Currently, the patient is followed up with 3-monthly MRIs and PSA monitoring. ADT has not been restarted. Although the post-operative MRI head showed complete resection, the fact that histopathology documented dural involvement could explain the elevated PSA after surgery and potential presence of residual microscopic meningeal disease. The patient is currently asymptomatic, but he will undergo further PSMA PET/CT if the PSA continues to rise.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_495_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_495_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dcff18b82a9cb373bb81efcaa5a474f7cad92659
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_495_en.txt
@@ -0,0 +1,3 @@
+A 48-year-old woman presented with crushing chest pain at rest with an elevated troponin I of 2.72 μg/L (normal <0.04 μg/L) and a normal electrocardiogram (ECG). Her background history includes 30 pack years of cigarette smoking, obesity, gastric banding, fibromyalgia, and depression/anxiety. On examination, her heart rate was 70 b.p.m., her blood pressure was 127/82 mmHg, and her oxygen saturation was 98%. Cardiac and pulmonary auscultations were normal. She was given loading doses of aspirin and ticagrelor. She had a coronary angiogram which showed first diagonal artery (D1) and right marginal branch (RM) occlusion with an angiographic appearance that is consistent with SCAD. It did not resolve with intracoronary nitrate. We performed a computed tomography aortogram to look for fibromuscular dysplasia in the carotid, renal, and iliac arteries and they were absent. She was medically managed on aspirin 100 mg and clopidogrel 75 mg daily, and metoprolol 25 mg twice daily.
+She represented 2 months later with similar symptoms with a troponin elevation of 2500 ng/L (normal <18 ng/L) and a normal ECG. She had another coronary angiogram which showed healing SCAD in the D1 and RM, but a new SCAD in the first obtuse marginal artery (OM1) . She was managed conservatively on the same medications.
+She represented 4 months later complaining of angina every 2 days with a normal troponin and ECG. This time her coronary angiogram showed healed SCAD in OM1 and RM, but the recurrence of SCAD in D1. Given that she had recurrent events despite medical therapy, we decided to proceed with PCI. After cautious wiring and confirmation of guidewire placement in the true lumen with selective coronary contrast injection, we deployed a 2.25 × 15 mm Resolute Onyx (Medtronic, CA, USA) in D1, with excellent final result . She remained on the same medications. She presented with an atypical chest pain 10 months later and her coronary angiogram showed complete healing of all coronary arteries and a patent stent in D1. She has remained symptom free.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_496_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_496_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..558ffdcc80ada651bba5d4979d9e06e4907a364d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_496_en.txt
@@ -0,0 +1,3 @@
+A 75-year-old Japanese man was referred for sudden asymptomatic gross hematuria. Ultrasonography and abdominal X-ray suggested bladder calculus, and computed tomography (CT) was performed. CT showed intramural right ureteral calculus (1.8 cm in diameter) and a well-circumscribed hypervascular mass measuring approximately 2.1 cm at the right trigone of his urinary bladder . Hydronephrosis was absent in bilateral kidneys. We then performed a cystoscopy to confirm the bladder mass. Examination revealed a non-papillary nodular mass located at the right trigone . The mass appeared to be completely covered by normal urothelium, suggesting a submucosal tumor. The mucosa was elevated behind the mass; however, we were unable to confirm the right ureteral orifice and calculus preoperatively. Since CT showed the mass to be adjacent to the calculus, the tumor may have interfered with the discharge of the calculus. No invasive growth was observed by magnetic resonance imaging . Urine cytology was negative for malignant cells. We then performed transurethral resection (TUR) of the mass. Following resection, we confirmed right ureteral orifice and intra-ureteral calculus. As a result, we performed transurethral lithotripsy. Our patient recovered without perioperative complications and has remained free of recurrence for 5 months.
+On gross examination, the resected surface of the mass specimens was solid, firm, and tan-white to yellow without apparent necrosis and hemorrhage.
+On histologic examination, the urothelium was largely denuded; however, residual urothelium showed no atypia. In the submucosal lesion, we observed spindle-shaped to oval-shaped cells that had mildly hyperchromatic nuclei and eosinophilic elongated or tapering cytoplasm arranged in loose fascicles or perivascular whorls around often-hyalinized blood vessels or in a vague storiform-growth fashion, embedded in variably fibromyxoid or edematous stroma associated with dilated thin-walled blood vessels . Mitotic figures are rare. On immunohistochemical examination, the tumor cells were positive for alpha-smooth muscle actin (SMA), desmin, CD34, and h-caldesmon, and CD99 was weakly and focally expressed . The cells were negative for S-100, CAM5.2, AE1/AE3, epithelial membrane antigen (EMA), STAT6, MUC4, and claudin-1.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_498_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_498_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fc9ef9cd2db6d7261810869c3e807a9dfae8ff53
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_498_en.txt
@@ -0,0 +1,7 @@
+A 73-year-old male presented to Urology Specialists of the Lehigh Valley in October 2010 with a right renal pelvis filling defect, potentially a urothelial carcinoma. The lesion was detected by CT scan performed for unrelated reasons and had not been visible on prior CT scans.
+The patient had smoked for 20 years but had stopped smoking approximately 10 years prior. He previously had non-small cell lung cancer that was treated with radiation and chemotherapy in 2001–2002 and was in remission. In 2001–2002 he had a coronary artery bypass graft and an abdominal aortic aneurysm repaired. The patient was asymptomatic from these conditions at the time of presentation.
+A physical examination was normal. The laboratory values were within normal limits. The patient had no urinary complaints. Urine cytology and cystoscopy were negative. Right retrograde pyelogram disclosed a complete ureteral duplication. Complete ureteropyeloscopy was not possible due to the narrow ureters. Retrograde pyelogram of the lower pole was performed and was normal. It was not possible to perform a retrograde pyelogram of the upper pole unit because the ureter was only about 1 mm in diameter, where a normal ureter is 3–4 mm in diameter. The instruments used in our practice are sized and scaled for a normal ureter and not for this small ancillary ureter. An attempted pyelogram was unsuccessful as the contrast did not fill the ureter or renal pelvis.
+Approximately 6-months following initial urological evaluation, CT scan confirmed the presence of the mass which now appeared larger . These findings were consistent with urothelial carcinoma of the renal pelvis, although urine cytology was again negative.
+Prior to initiating more invasive diagnostic methods, a real-time PCR-based genetic assay was used to determine if the patient’s urine contained DNA that carried FGFR3 mutations in exons 7, 10, or 15 . This assay has 99.9% specificity for urothelial carcinoma. A mutation was detected in exon 10 (Y375C) of FGFR3, indicating a high probability (94.7% PPV) that the patient had urothelial carcinoma.
+The patient underwent right nephroureterectomy. The arterial anatomy precluded an upper pole nephroureterectomy. The tumor involved the renal pelvis of the upper pole collecting system. Upon cut sections, the kidney exhibited an ill-defined partially raised, partially nodular tan-pink dense focus, located in the renal pelvis of the upper pole, which measured 1.5 cm greatest dimension. This focal area appeared limited to the upper pole renal pelvis/calyx and abutted but did not involve kidney parenchyma or peripelvic fat. Due to autolysis, tumor grade was somewhat difficult to provide definitively. However, the pathologist favored a designation of low grade urothelial carcinoma (WHO 2004). No lamina propria, renal parenchyma or peri-nephric fat involvement was identified such that the tumor stage was Ta,N0,M0. Tumor tissue obtained from the archival paraffin block was found, using quantitative PCR, to have an exon 10 (Y375C) mutation, which is consistent with the tumor being the source of the mutant DNA found in the urine.
+Since the nephroureterectomy, the patient has been monitored for recurrent cancer. We performed a postoperative CertNDx test in March 2012, 7 months after the nephroureterectomy, which was negative for the presence of FGFR3 mutant DNA. In addition following the uncomplicated postoperative course, the patient had surveillance cystoscopies in November 2011 and February 2012, both of which were negative. As part of the continuing follow-up, the patient will undergo surveillance cystoscopy several times per year for the foreseeable future. In view of the negative CertNDx test, upper tract imaging has not yet been performed. The left kidney has not been examined as it was normal at the time of the most recent CT scan (June 2011).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_499_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_499_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..70da8f4284aef4dfce53f0221d1ea0e75b7126b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_499_en.txt
@@ -0,0 +1,2 @@
+A 12-year-old boy with KD and major acquired coronary abnormalities was admitted to our hospital for follow-up at the request of his former physician in Ukraine. Initial diagnosis of KD was in 2019. He was initially treated with immunoglobulins and acetylsalicylic acid (ASA). Despite the treatment, follow-up cardiology assessments revealed giant CAAs, whereupon antiplatelet therapy and oral anticoagulation with warfarin were started. Computed tomography performed in November 2021 (images are not available), and cardiac catheterization in February 2022 showed chronic occlusion of the right coronary artery (RCA) with bridging collateral vessels ( and ). In 2022, the patient and his family fled Ukraine to Germany because of the war. At our initial encounter, the patient was asymptomatic and clinical examination was unremarkable except for mild right ventricular conduction delay . Cardiopulmonary exercise testing showed reduced functional capacity but no ECG changes suspicious for myocardial ischaemia. Blood test showed an International Normalized Ratio (INR) value of 2.8, which lays within an effective therapeutic range (2.0–3.0). Additional cardiovascular magnetic resonance (CMR) imaging was performed and confirmed RCA and left anterior descending artery (LAD) aneurysms with a maximum transverse diameter of 11 × 12 mm (RCA) and of 11 × 15 mm (LAD). In addition, there was also evidence of chronic occlusion of the RCA with bridging collateral vessels and mural thrombi in LAD (; also see ). Late-gadolinium enhancement imaging did not show any evidence for myocardial infarction suggesting a chronic aetiology of coronary artery disease and not an acute thrombotic event ( and ). No obvious perfusion defect was detected during stress perfusion imaging. Physical stress echocardiography did not show significant wall motion abnormalities. Further history revealed that he is on antiplatelet medication since spring 2021 and that oral anticoagulation was started in October 2021. Thus, we suspect that inadequate antithrombotic medication contributed to CA thromboses. The patient’s findings were discussed in a multidisciplinary team meeting. As there was no clear evidence for myocardial ischaemia, a decision against CABG and for continuing warfarin and ASA was made.
+Follow-up assessments are performed in accordance with the American Heart Association consensus statement (3). Currently, the patient is seen in the paediatric cardiology clinic every 3–6 months with investigations for inducible myocardial ischaemia every 6–12 months. Follow-up CMR was performed 5 months after the first study including stress perfusion and did not differ compared to the first scan. Clinically, the patient is well and free of cardiac symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_50_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_50_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6eeafd75500f600606f9f55ad5a18bcff9e6da2b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_50_en.txt
@@ -0,0 +1,11 @@
+A 32-year-old Caucasian woman presented to our facility at 39 weeks gestation for an emergency cesarean section due to prolapse of the umbilical cord and fetal distress. The course of her pregnancy had been uneventful and our patient was admitted after the onset of regular contractions. When the cervix was dilated at 5 cm, the amniotic membranes ruptured and the fetus quickly developed signs of fetal distress, including fetal bradycardia down to 100 beats/minute and variant decelerations. A vaginal examination revealed prolapse of the umbilical cord.
+Our patient was immediately brought to the operating room for an urgent cesarean section. A pre-operative anesthetic examination did not reveal any coexisting medical conditions, though she had a predictive difficult airway: Mallampati score III, thyromental distance measured 4 cm, no prominent incisors, limited neck extension and limited mouth opening (3 cm). Her blood pressure measured 110/70, heart rate 80 beats/minute, pulse oximetry (saturated O2 (SaO2)) was 99% on room air. Our patient was 180 cm tall and weighed 100 kg. She was denied food and water for nine hours for food and three hours for clear liquids. She refused an epidural catheter.
+Considering the urgency of the surgery due to severe fetal distress it was decided to proceed immediately with general anesthesia via rapid sequence induction. Considering the risk of difficult intubation, the difficult intubation cart was brought and an attending anesthesiologist experienced in the difficult airway management of patients in childbirth was called in. An attempt to perform a conscious fiber-optic intubation was considered but not performed because of the urgency of the situation and 'pressure' from the obstetricians. Our patient was attached to standard monitors, including pulse oximetry, non-invasive blood pressure, electrocardiogram (ECG), end-tidal carbon dioxide (ETCO2) analyzer, and nerve stimulator.
+Our patient received aspiration prophylaxis with metoclopramide 10 mg intravenously prior to induction. After a short pre-oxygenation step (four deep breaths), anesthesia was induced with propofol 2 mg/kg and succinylcholine 1 mg/kg. Cricoid pressure was applied immediately after the injection of propofol. Direct laryngoscopy (DL) was then attempted using a Macintosh (number 3 blade). The first attempt at intubation was performed by an experienced resident, and was unsuccessful because of an inability to visualize the vocal cords (grade III view) and an inability to pass the ETT blindly. Mask ventilation with 100% oxygen was performed easily, and SaO2 remained 99%. The second and third attempts at DL were made unsuccessfully by the attending anesthesiologist. All attempts to improve visualization, including repositioning the head and the use of a laryngoscope with Miller's blade, were unsuccessful. Mask ventilation was applied between the attempts at intubation.
+After the third attempt, an LMA size 4 was successfully placed and positive pressure ventilation was applied with following parameters: tidal volume (TV) 500 mL, respiratory rate (RR) 12 breaths/minute, positive-end expiratory pressure (PEEP) 0, inspiratory/expiratory (I/E) ratio 1:2. Peak inspiratory pressure did not exceed 25 cm H2O and no leak was detected. Cricoid pressure was maintained during the entire procedure to prevent possible aspiration. Anesthesia was maintained with isoflurane 1.2% in pure oxygen. 100% oxygen was maintained to optimize the conditions if the airway was lost. The surgical incision was made immediately after the insertion of the LMA and the fetus was delivered 10 minutes later. Apgar scores were 7 and 10 at the first and 10th minute, respectively.
+Our patient remained hemodynamically stable during the surgery, though her SaO2 decreased gradually, reaching 90% by the end of the surgery. Her trachea was suctioned, revealing the accumulation of a significant amount of blood in both the pharynx and trachea. Her pulse oximetry (SpO2) did not improve after suctioning, and her peak inspiratory pressure increased by 30 cm H2O, suggesting aspiration of blood and possibly of gastric contents. The decision was made to intubate our patient in order to facilitate suctioning the tracheobronchial tree and providing ventilatory support for respiratory failure.
+Considering that intubation under DL was unsuccessful and fiber-optic intubation with a flexible fiber-optic bronchoscope (FOB) would be extremely difficult due to the presence of upper airway bleeding and swelling from traumatic attempts at intubation, the decision was made to intubate using an AIC dressed over a FOB, via LMA in situ. The procedure was performed by the attending anesthesiologist with experience in difficult intubations with patients who are pregnant. An AIC (19 F/56 cm; Cook Inc., Bloomington, IN, USA) was placed on a FOB (Olympus model LF-2 with an external diameter of 4.0 mm). Continuous fresh gas flow of oxygen at 4 L/minute was maintained via the suction port of the FOB in order to maintain better oxygenation and improve visualization by blowing out the blood bubbles. After suctioning the LMA, the FOB was easily passed between the grids of the LMA, the epiglottis and vocal cords were visualized, and the FOB was passed between the vocal cords into the trachea and introduced almost until the tracheal bifurcation. The AIC was then slid down over the FOB, and the FOB was removed .
+We attempted to 'railroad' a cuffed ETT with an internal diameter of 6.5 mm down to the trachea using the AIC as a guide. Because our patient was tall, a significant length of the AIC had to be inserted into our patient in order for the distal tip of the AIC to be positioned just before the carina. This left only a short length of the proximal portion of the AIC available for the ETT to be 'railroaded' over (the portion of the AIC that was outside our patient). However, this free portion of the AIC was shorter than the ETT. Therefore, the ETT could not be safely slid over the AIC while simultaneously holding the proximal end of the AIC to maintain its position and prevent its slipping from within the trachea. . Additionally, the catheter was very slippery because of our patient's secretions and blood. Our patient's SaO2 dropped to 80%. Attempts to introduce the ETT were postponed to allow for mask ventilation, and the ETT was removed while the position of the AIC was maintained.
+After two minutes of mask ventilation, when the SaO2 reached 90%, another attempt at introducing the ETT was made. With this attempt, however, a novel approach was used to create a longer guide as illustrated in Figure . After positioning of AIC via LMA with FOB . The AIC was replaced with an exchange catheter for a double-lumen ETT (14 F/100 cm, Cook Inc.). The exchange catheter was lubricated and inserted into the trachea via the inner port of AIC until mild resistance of the tracheobronchial tree was felt (60 cm deep) . The AIC was slowly removed over the exchange catheter, with careful attention made to keep the exchange catheter in place . Fortunately, this was easily accomplished because the exchange catheter was very long.
+After the Aintree catheter was removed, a cuffed ETT size 6.5 was easily introduced into the trachea over the exchange catheter until 21 cm deep, and the exchange catheter was removed . The cuff of the ETT was inflated and mechanical ventilation was resumed with the following parameters: TV 500 mL, RR 12 breaths/minute, PEEP 7.5 cm H2O, I/E ratio 1:2, fraction of inspired O2 (FiO2) 1.0. Our patient's peak inspiratory pressure measured 30 cm H2O (including PEEP). The position of the ETT was verified by both the appearance of ETCO2 waveform on the monitor and via bronchoscopy (the tip of the ETT was observed 3 to 4 cm above the carina). The bronchoscopy revealed traces of blood in the trachea, which was suctioned via the suction port of the bronchoscope. No food particles were detected in the trachea. Her SaO2 level gradually reached 99%. Analysis of arterial blood revealed moderate hypercapnia (partial pressure CO2 (pCO2) of 50 mmHg) and relative hypoxemia (partial pressure of O2 in blood (PaO2) of 110 mmHg).
+Considering our patient's risk of developing aspiration pneumonitis and upper airway edema, sedation with a propofol drip at a dose of 3 mg/kg/hour was initiated and our patient was transferred to the intensive care unit. Fortunately, our patient remained hemodynamically stable and was well oxygenated and ventilated. Our patient did not receive any antibiotics or steroids. She was subsequently extubated 24 hours later, after performing a leak test to rule out pharyngeal or vocal cord edema. No additional complications were noted and our patient was discharged home without any sequelae 48 hours after she was extubated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_515_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_515_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..55dee6e7b075d3eeb2e327fafc4738bf0caf4321
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_515_en.txt
@@ -0,0 +1,6 @@
+A 65-year-old, right-handed Caucasian man was initially admitted to another hospital after a motor vehicle accident. Prior to the accident, he was an independent truck driver who lived with his wife. He was an ex-smoker of 50 pack-years, and had a significant family history in first-degree relatives of lung, brain, and cervical cancer. Other medical conditions included hypertension, psoriasis, and diverticular disease requiring bowel resection.
+The patient was driving a truck alone when he crashed. When paramedics attended, the patient was found in the passenger seat, conscious but confused and combative. At this time, pulse and blood pressure were unmeasurable. Primary and secondary surveys in hospital showed no evidence of chest trauma, and the patient suffered only minor soft tissue injuries. In hospital telemetry revealed paroxysmal atrial fibrillation with rapid ventricular response, which was without symptoms and managed only with metoprolol – to the best of our knowledge, no other antiarrhythmic agents were used. Occasional 5-second sinus pauses were also noted, with preceding seizure activity and post-ictal altered level of consciousness for several minutes. Between events, electrocardiography (ECG) was otherwise unremarkable, with no evidence of ischemic changes or other conduction abnormalities. On the fourth day of admission, he became bradycardic and progressed to asystolic arrest requiring 4 minutes of cardiopulmonary resuscitation (CPR). Spontaneous circulation returned in the form of rapid atrial fibrillation. The patient was intubated, and had a temporary pacing wire inserted until a permanent pacemaker was inserted the next day. Cardiac workup, including troponin and electrolyte levels were within normal range. Echocardiography showed a mildly dilated left atrium of 25 cm2, with no other valvular, structural or wall motion abnormalities noted. There was no evidence of right heart strain on echocardiogram or ECG suggestive of pulmonary embolus. A diagnosis of sick sinus syndrome was made, and he was commenced on metoprolol and apixaban. His behavior remained impulsive after extubation, demanding to leave the hospital, and he was discharged several days later. All other investigations at this time, including chest X-ray, electroencephalogram (EEG) and a computed tomography (CT) brain scan, were unremarkable.
+One week after discharge, he presented to our hospital with his first observed generalized tonic-clonic seizure (GTCS) lasting 3 minutes, with urinary incontinence and prolonged post-ictal confusion. Repeat EEG and CT brain were reported as normal. This episode was thought to be secondary to hypoxic brain injury after asystolic arrest. He was discharged on levetiracetam 1 g twice daily. Two weeks later he presented with another GTCS, and was discharged once stable from Emergency. His third seizure occurred 6 days later, at which time he was admitted and commenced on sodium valproate 500 mg twice daily in addition to levetiracetam. His EEG and CT brain scan were again normal. Two weeks later, his fourth GTCS prompted addition of carbamazepine 200 mg controlled release twice daily. An outpatient magnetic resonance imaging (MRI) brain scan showed no abnormality at this time.
+He had three further seizures in 3 weeks, and tolerated several antiepileptic drugs poorly. He was admitted to our hospital 10 weeks after his first seizure due to confusion. Retrospectively, there was significant deterioration in his confusion, agitation, and impulsivity since his initial presentation, in addition to more frequent seizures. Of note, his wife also reported progressive slurring of his speech, difficulty walking, and ongoing back pain over the preceding weeks. Medications at this point were lacosamide 100 mg twice daily, and sodium valproate 1 g twice daily. He suffered no further seizures, but became agitated and aggressive, requiring one-to-one nursing, regular olanzapine, and four-point limb restraints.
+His refractory and progressive symptoms prompted further investigation. EEG was again normal. Lumbar puncture showed normal opening pressures, with CSF findings as follows: leukocytes 2 × 106/L, mononuclear cells 2 × 106/L, protein 0.61 mg/dL, glucose 3.2 mmol/L. ANNA-1 (Hu) antibodies, GABAB-R antibodies and unmatched oligoclonal bands were also present. Serum was also positive for GABAB-R antibodies but not for anti-Hu antibodies. A chest CT scan revealed a spiculated mass in the right lung and perihilar lymphadenopathy. A biopsy was obtained via endobronchial ultrasound, which revealed small cell neuroendocrine tumor. A subsequent MRI spine scan revealed diffuse vertebral metastases.
+He was commenced on etoposide and carboplatin, as well as a trial of intravenous immunoglobulin (IVIg). Although suffering chemotherapy-related side effects including febrile neutropenia from staphylococcal septicemia, he showed some improvement with this therapy. He remained seizure free, was able to hold a conversation and mobilise independently. His modified Rankin scale (mRS) was 4 prior to treatment, and improved to a mRS of 2 with IVIg and chemotherapy. At 12 weeks follow-up, our patient had only mild short-term memory deficits, but was otherwise at his premorbid level of function.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_517_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_517_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3d8da2ea15f21781836cb0d672c4ebe1f2ed5e09
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_517_en.txt
@@ -0,0 +1,5 @@
+A 6-month-old male infant was referred with different types of skin lesions, persistent blistering, and frequent spontaneous flushing since birth. The child did not have any physical or psychomotor disturbances. No significant family or antenatal history data existed. Intermittent courses with oral H1 blockers and topical antibiotics and corticosteroids had been administered without improvement.
+On admission, vital signs and chest and abdomen examinations were unremarkable, while hepatosplenomegaly and lymphadenopathy were absent. A variety of skin lesions (reddish-brown, partially with peau d’orange appearance, macules, papules, plaques, and nodules), sized 4–65 mm, were distributed on the neck, trunk, buttocks, and extremities. Tense bullae, erosions, and crusts were revealed to overlay plaque surfaces . Darier’s sign was demonstrated . Oral mucosa was not affected. Within the first 2 days, we observed several flushing episodes, unprovoked by any triggering factors.
+Laboratory findings did not disclose hematologic, biochemical, or liver function abnormalities. Serum tryptase level (STL) was 11.8 ng/ml (reference range <11.4 ng/ml). A biopsy taken from an elevated plaque with vesiculation revealed melanin in the basal/suprabasal layer, subepidermal bulla, dense mast cell infiltration, and some eosinophils in the dermis . Immunohistochemical staining for CD117 antibody was positive . Toluidine blue and Giemsa stainings showed metachromatic granules in the cytoplasm of the infiltrating cells . The pediatric consultation did not reveal systemic symptoms.
+The patient was initially treated with methylprednisolone 0.6 mg/kg once daily (o.d.) intramuscularly (3 days), oral levocetirizine 1.25 mg o.d, 2% topical fusidic acid, and 0.1% betamethasone valerate cream. Subsequently, the dose of methylprednisolone was tapered, given orally (0.5 mg/kg o.d [4 days], 0.5 mg/kg every other day [2 weeks], 0.5 mg/kg twice a week [2 weeks]) and stopped. After 10 days, levocetirizine was replaced with ketotifen 0.05 mg/kg twice daily for eight more weeks and the cream was replaced with 1% hydrocortisone cream for a month. The child was closely followed up during the treatment. His symptoms improved remarkably. There were no adverse effects of the therapy. Over the following 3 years, the clinical manifestations were successfully managed with intermittent ketotifen and topical hydrocortisone treatments. Parents were counseled on the avoidance of triggering factors for mediator release. At the last follow-up (3.5 years of age), only a few pale-brownish macules were seen with no blistering or isolated flushing episodes. The STL declined to 7.2 ng/ml. For 3 years the patient did not show any symptoms consistent with systemic mastocytosis.
+All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1964, as revised in 2013. Informed consent was obtained from the parent for the child being included in the study and for the publication of the patient photographs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_549_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_549_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..68ae04e61f53d64cdd8be0682e35fe348d030865
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_549_en.txt
@@ -0,0 +1,2 @@
+A 60 year old Caucasian gentleman with rheumatoid arthritis on infliximab therapy for one year presented with acute onset palpitations. Which started within three hours after receiving the eight weekly infliximab infusion for his rheumatoid arthritis. There was no past medical history of diabtes mellitus, ischemic heart disease, hypertension or heart failure. He has never smoked cigarettes and there was no history of alcohol or illicit drug use. He had no known drug or food allergies. His medical therapy on admission included azathioprine, prednisolone, diclofenac, omeprazole, Dihydrocodeine, paracetamol, salbutamol inhaler and eight weekly Infliximab infusions.
+On examination he was tachycardic at 168 beats per minute. Blood pressure was 110/90 and respiratory rate of 16 per minute; oxygen saturation was 99% on room air. Systemic examination was unremarkable. The electrocardiogram showed a supraventricular tachycardia (SVT), which reverted rapidly to sinus rhythm with intravenous adenosine therapy (9 milligrams). His complete blood count, cardiac enzymes, troponinI, serum electrolytes, renal functions and liver enzymes all were normal. Chest X-ray did not show any evidence of cardiomegaly or pulmonary congestion and 2-D echocardiogram revealed normal left ventricular systolic and diastolic functions.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_571_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_571_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1680c2fb56cbecdce7a0c0a7aa89760af091d110
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_571_en.txt
@@ -0,0 +1,7 @@
+An 84-year-old Japanese man was bitten by a Mamushi on the right fifth finger and presented to our emergency department. He had a history of benign prostatic hyperplasia and an overactive bladder. He was taking mirabegron at a dosage of 50 mg/day and had an oxybutynin patch that delivered a dose of 73.5 mg/day. The patient was treated on surgical admission. On the second day of hospitalization, the bite reached Grade 4 (redness and swelling of the whole extremity) . Creatine kinase (CK) level was maximal at 1770 U/L on the fourth day of admission. Cephalantin (10 mg/day), acetate ringer (1000 mL/day), and maintenance fluid (sodium 35 mEq/L, potassium 20 mEq/L, and glucose 4.3% isotonic solution [1000 mL/day]) had been administered since the second day of admission. The total in–out balance had roughly passed zero.
+On the eighth day of hospitalization, vomiting occurred. In the early hours of the ninth day of hospitalization, the patient experienced restlessness, and blood tests revealed hyponatremia. The patient was transferred to the department of internal medicine.
+At the time of transfer to the department of internal medicine, the patient’s vital signs were as follows: consciousness level of 13 points (E3V4M6) on the Glasgow Coma Scale, blood pressure of 142/79 mmHg, pulse rate of 59 beats/min, respiratory rate of 24 breaths/min, SpO2 of 97% (room air), and body temperature of 37.2 °C in the axilla. Physical examination revealed no rigidity of the neck, no enlarged cervical lymph nodes, and clear respiratory sounds and no heart murmur on chest auscultation. The abdomen was flat and soft with no tenderness. No edema of the lower legs was observed, and tenderness, swelling, and heat were present from the right upper arm to the dorsum of the right hand. The findings in the right upper extremity remained unchanged from those on the previous day.
+Table shows the laboratory findings at the time of transfer to the department of internal medicine. Blood tests showed that the CK level was elevated again to 2267 U/L. The serum Na level was 114 mE/L, and serum osmolality was 237 mOsm/L. Urinalysis revealed a urine specific gravity of 1.020, urinary Na level of 195 mEq/L, and urine osmolality of 613 mOsm/L. Despite the hyponatremia, the urine was hypertonic.
+Figure shows the clinical course of the patient after admission. We determined that the CK re-elevation was due to hyponatremia. Severe symptomatic hyponatremia was corrected with administration of 3% sodium chloride solution. On the 10th day of admission, the serum Na level improved to 120 mEq/L, and the level of consciousness improved as the serum Na level improved. Since the blood cortisol level was low at 4.0 µg/dL (reference value 4.5–21.11 µg/dL), adrenal insufficiency was suspected, and administration of corticosteroids (dexamethasone 6.6 mg/day, then hydrocortisone 100 mg/day) was initiated on the 10th day of admission. On the 11th day of admission, the 3% sodium chloride solution was discontinued, and on the 15th day of admission, the corticosteroids were discontinued; however, the serum Na level did not decrease. An adrenocorticotrophin hormone (ACTH) loading test was performed on the 16th day of admission. Pituitary contrast-enhanced magnetic resonance imaging (MRI) and a corticotropin-releasing hormone / growth hormone-releasing factor / thyrotropin-releasing hormone / luteinizing hormone-releasing hormone (CRH/GRF/TRH/LHRH) stimulation test was performed on the 19th and 23rd day of admission, respectively. The results of the ACTH loading test and CRH/GRF/TRH/LHRH stimulation test are shown in Table . The peak blood cortisol levels after the ACTH loading and CRH/GRF/TRH/LHRH stimulation tests were below 18 µg/dL, and the peak ACTH level after the CRH/GRF/TRH/LHRH stimulation test was less than two-folds the basal value; thus, a diagnosis of pituitary adrenal insufficiency was made .
+Contrast-enhanced MRI of the pituitary gland is shown in Fig. . The sella turcica was markedly enlarged and filled with cerebrospinal fluid.
+After discontinuation of corticosteroids, the hyponatremia did not recur, and the swelling in the right upper extremity improved. The patient was discharged on the 24th day of admission. He visited the outpatient clinic 9 and 16 days after discharge, and there was no hyponatremia relapse. The patient has not experienced hyponatremia in the three years since the Mamushi bite.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_584_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_584_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f014ff04554380b3b6c8fd041cb0d41fa05c2ad9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_584_en.txt
@@ -0,0 +1,8 @@
+An 86-year-old woman was brought to the emergency department after she was found unresponsive by her husband. She was known with insulin-dependent type II diabetes mellitus and an anaplastic oligodendroglioma with epileptic seizures, diagnosed 1 year ago, for which she was started on levetiracetam and recently received radiotherapy.
+The first cardiac rhythm recorded by the ambulance personnel was third-degree AV block in absence of an escape rhythm. Transcutaneous pacing with an external defibrillator was started, which resulted in return of circulation with a systolic blood pressure of around 90 mmHg.
+Upon arrival in the hospital, however, she was accidently disconnected from the external pacemaker, which went unnoticed until she was connected to the electrocardiogram (ECG) monitor. At that moment, the patient had complete heart block with no escape rhythm, an agonal breathing, and was peripherally cold. A second attempt of transcutaneous pacing was made, which at first had non-capture, but after increasing the output of the pacemaker, circulation was restored. A point-of-care arterial blood gas revealed a pH of 7.22, a pCO2 of 40 mmHg, a pO2 of 136 mmHg, a bicarbonate of 16.2 mmol/L, and a base excess of −12 mmol/L. The lactate level was 11.7 mmol/L.
+It then became known from the medical record that the patient had previously signed a ‘do not resuscitate’ (DNR) order. However, her wishes concerning intubation and mechanical ventilation were not further specified. Yet, due to the high amperage of the transcutaneous pacing, she was in acute distress, demanding sedation and intubation if transcutaneous pacing was to be continued.
+The dilemma regarding intubation and mechanical ventilation was discussed with the family. Her husband made clear that she would not have wanted to be kept alive by mechanical support if there was no chance for a meaningful recovery. Due to the combination of a malignant brain tumour and prolonged cerebral hypoxia caused by substantial delay in adequate pacing (out-of-hospital before ambulance arrival ∼10 min, in-hospital ∼5 min), we considered the chances of neurological recovery highly unlikely. Therefore, in agreement with the family, it was decided to stop the transcutaneous pacing, after which an agonal heart rhythm of <20 b.p.m. was seen. The family was then given some time alone with the patient during her (presumed) final moments.
+However, when the patient was reassessed 20 min later, she was breathing spontaneously, had a faint pulse and had regained a junctional escape rhythm of 50 b.p.m. Considering the poor prognosis, we decided together with the family, to admit her to the ward for palliative sedation to limit physical distress.
+In the next hour, intermittent sinus bradycardia and total AV block with a nodal escape rhythm were seen. However, 1 h later, heart rate slowed down, resulting in complete heart block and asystole, which lasted for ∼4 min . Again, an escape rhythm of around 40 b.p.m. reappeared.
+Another 2 h later, the family informed the medical staff that the patient had regained consciousness, despite continuous sedation with infusion of midazolam of 1.5 mg/h. When we reassessed her, she opened her eyes spontaneously and could obey simple commands. She had a heart rate of 40 b.p.m., a blood pressure of 130/60 mmHg, a temperature of 36.7°C, and an oxygen saturation of 95% at room air. The ECG showed a third-degree AV block with a ventricular escape rhythm of 40/min with a left bundle branch block morphology . The midazolam infusion was stopped. One hour later, the patient was fully awake and had a maximal score on the Glasgow coma scale. In the following hours and days, no neurological sequalae of the prolonged cardiac arrest were seen. Furthermore, AV conduction recovered completely . Two days after the event, a permanent dual-chamber pacemaker was implanted and the patient was discharged home.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_593_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_593_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8449d9c2eae7401f663a55db3ae92e07ea2c6f50
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_593_en.txt
@@ -0,0 +1,3 @@
+A 45-year-old man with a half-year history of hyperglycemia presented to endocrinology. The patient denied attacks of headache, hypertension, palpitation and sweating. He was kept for observation with 24-h electrocardiography (ECG) and blood pressure monitoring which was normal. His glycaemia returned to normal level under the action of insulin. Haematological and biochemical investigations were normal except for elevated serum and urinary catecholamines . Abdominal-pelvic CT scan with contrast injection had revealed a 7.2 × 6.5 cm inhomogeneous, right para-aortic mass located at the level of the inferior mesenteric artery . Both the adrenals were normal. With these findings, a diagnosis of POZ was reached. However, due to the patient's family economic reasons and the lack of MIBG scan examination equipment in our hospital, our patient did not undergo further MIBG scan examination. Then he was transferred to our center where attempts to preoperative preparation included expansion of intravascular volume and alpha blockade with phenoxybenzamine for 2 weeks even with the situation of normal blood pressure.
+We made full consideration and preparation for possible conversion to open surgery before deciding to adopt laparoscopic surgery. If there were acute bleeding, small operation space, malignant tumor invasion or other parts of the injury that have to be converted to open surgery, we will use a longitudinal incision under the right costal margin for open surgery. In addition, we also communicated with vascular surgeons that if the aorta or the inferior vena cava were damaged, open resection and reconstruction of these vessels might be warranted.
+The patient was placed in 70° left lateral decubitus position, and a 10-mm trocar was inserted above the umbilicus for telescope using. Another 10-mm, 10-mm and 5-mm trocar were placed under the right costal margin, right anterior axillary line and subxiphoid, respectively . A steep Trendelenburg position allowed the small bowel and omentum to be moved away from the mass. First, cut the hepatic triangular ligament and hepatocolicum ligament with an ultrasonic shears, and lift the liver to expose the upper pole of the right kidney. The ascending mesocolon is then longitudinally incised and pushed open to expose the right kidney and the right renal vein, and the descending and horizontal parts of the duodenum are separated and pushed open, showing that the upper pole of the exposed tumor is filled with nourishing vessels. Then the vessels of nutritional tumors were separated and ligated one by one. Uncovering the lower part of the tumor, it can be seen that the inferior vena cava and abdominal aorta, and the abdominal aorta send out a thicker vascular supply tumor, which was ligated by Hem-o-lock. The tumor and its surrounding tissues were then clipped along the tumor capsule and separated gradually. The well-encapsulated mass was excised. The mass was placed in a sample collection bag and removed through a 5-cm right upper abdomen incision that incorporated the incision made for the costal margin 10-mm port. Except for upon contact with the tumor blood pressure rose up to 160 mmHg he remained stable throughout surgery. The total operative time was 120 min and intraoperative blood loss was around 50 mL. The post-operative period was uneventful and he was discharged on post-operative day 5. The histopathology found the tissue was consistent with a benign PGL and DNA analysis of SDHB and SDHD revealed no mutation. During 6 months follow-up after post-operative, urinary and serum catecholamines were within normal range but glycaemia remained high level .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_594_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_594_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dbd4988835f3f9dc720afe2d905867fa9864edd0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_594_en.txt
@@ -0,0 +1,3 @@
+A 46-year-old woman was hospitalized with a 2-year history of dull pain in the right upper abdomen. Her appetite was normal and she had no history of diarrhea, flushes or dyspnea. There was no pertinent past medical or surgical history. On examination, she was well nourished with stable vital signs, and no pallor, jaundice, or significant lymphadenopathy. Abdominal examination revealed no tenderness, organomegaly, or abnormal mass.
+Laboratory investigation revealed normal hematological findings and serum electrolyte levels. The laboratory data of Liver function were within normal limits. The results of assays for tumor-associated antigen revealed that the serum levels of CEA, CA-50, CA19-9 and CA125 were within normal limits. Urine and stool routine examinations proved normal. Because of no suspicion for the diagnosis of carcinoid tumor before treatment, we did not measure the levels of the urinary 5-hydroxyindoleacetic acid (5HIAA) and plasma serotonin. The chest X-ray revealed no unusual findings. Abdominal ultrasound showed a 4.5 cm protruding tissue mass in the body and fundus of the gallbladder lumen . This mass appeared to arise from the wall of the gallbladder. Contrast-enhance abdominal computed tomography was performed and revealed a high-density mass in the gallbladder on the atrial phase . Low-density lesions in the right hepatic lobe were not detected. No evidences of calcification in the mass and biliary dilatation were noted.
+With a preoperative diagnosis of gallbladder carcinoma, the patient was referred for surgical opinion and laparotomy was subsequently performed. At laparotomy, a 4 × 5 cm mass was found within the gallbladder, located on the free surface of the body and fundus of the gallbladder. Neither metastases nor direct invasion to the liver was found. The entire mass and gallbladder were excised and intact. Pathological findings were as follows: On grass inspection of the operated material, the gallbladder measured 10 × 6 × 5 cm, and had a smooth external surface. On opening the specimen, an intramural tumor 5 cm in diameter located in the free wall of the body and fundus of the gallbladder . Histologically, the tumor was seen infiltrating into the mucosa extensively, and some penetrated the muscular layer but not through the serosa of the gallbladder into the liver. The gallbladder with tumor was completely excised with free resection margins. The tumor consisted of nests of small oval cells with round-to-oval neclei and these nests were separated from each other by thin fibrovascular bands. The tumor showed moderate pleomorphism with scattered mitotic figures, but no definite evidence of vascular permeation, perineural invasion or lymphatic permeation was seen . Immunohistochemical studies of paraffin sections revealed strong positivity for chromogranin A and neuron-specific enolase (NSE) . It was diagnosed as a classical carcinoid tumor of the gallbladder. After surgery, the patient had an uneventful recovery without incident. No recurrent lesion was found using abdominal ultrasound examination and CT scan 12 months after cholecystectomy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_598_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_598_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..810d8fe3dc5bfab905db80d510e43d24aa08f55d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_598_en.txt
@@ -0,0 +1,7 @@
+The proband was an 18-year-old female who was hospitalized with abnormal behavior for 3 d beginning October 19, 2021.
+Three days before she visited the local psychiatric hospital, she suddenly refused to eat, accompanied by glazed eyes and with no definitive causes.
+She was born by cesarean section at the 33rd week of her mother’s second pregnancy. Her weight was 3.8 kg [+1 standard deviation (SD)], and her height was 48 cm (-1 SD) at birth. Fontanel closure was delayed until she was 5 years old. During her childhood, she was always shorter than other children of the same age, but her body weight was overweight. She had occasional muscle tetany and limb numbness. Her studying ability in school was slightly poorer than that of her classmates. Menarche started at the age of 13 years, followed by irregular periods (cycle of 28-90 d).
+Her parents were not consanguineous and were in good health. The growth and development of her two sisters were normal, and there was no family history of hereditary diseases.
+The patient’s blood pressure was 104/78 mmHg; her height was 132 cm (-5 SD), weight was 40 kg (-2 SD), waist circumference was 80 cm, and head circumference was 48 cm; and some peculiar clinical characteristics were observed, including cheek freckles, high anterior hairline, sparse scalp hair, prominent forehead, depressed nasal bridge, low-set ears, partially absent dentition, small mandible, slightly higher mandibular arch, increased quilt hair, stubby limbs, small hands and feet and short bilateral 4th toes . She had no cubitus valgus, no nail thickening or roughness and no scoliosis. Gynecological examination showed breast development at Tanner stage 4 and pubic hair at Tanner stage 4. Her Mini-Mental State Examination (MMSE) score was 28 points after her symptoms improved.
+The patient had low calcium, low potassium, low magnesium, and high phosphorus levels. Her serum aspartate aminotransferase (AST) level was 94 U/L (reference range: 0 to 40), and her serum alanine transaminase (ALT) level was 70 U/L (reference range: 7 to 40). Serum potassium was 2.57 mmol/L (reference range: 3.5 to 5.3), chlorine was 96.4 mmol/L (reference range: 99.0 to 110.0), corrected calcium level was 1.06 mmol/L (reference range: 2.11 to 2.52), magnesium was 0.45 mmol/L (reference range: 0.75-1.02), and phosphorus was 1.86 mmol/L (reference range: 0.85 to 1.51). Details of laboratory findings are listed in Table . Therefore, she was referred to our hospital for further diagnosis and treatment.
+Ophthalmological examination revealed hyperopia. Visual acuity was 0.15 in the left eye and 0.8 in the right eye. No evidence of cataract or papilledema was observed. Her hearing test results were normal. Cranial computed tomography showed sporadic symmetrical calcifications in the cerebellar hemisphere, frontotemporal parietal lobe, basal ganglia, and thalamus. Thyroid ultrasonography showed a cystic-solid mixed nodule measuring approximately 2.3 mm × 1.2 mm in the right lobe, with a Thyroid Imaging Reporting and Data System grade of 2. X-rays of the left knee, anteroposterior pelvis, left hand, and both feet showed a smaller right ilium compared to the contralateral side, shallow acetabular fossa on both sides, and no obvious abnormalities in the bone structure of the remaining pelvis or the structures of the sacroiliac and hip joints on either side . No abnormal density was observed in the pelvis. The phalanges of the left little finger were short, with thickening of the cortex of the tubular bone and narrowing of the medulla. The 4th and 5th metatarsal bones and the corresponding phalanges of both feet were short and small. Ultrasonography of the pelvic cavity showed an anteverted uterus measuring approximately 2.7 cm × 1.9 cm × 3.0 cm. Uniform endometrial echogenicity was observed with no obvious tumor-like structures. The endometrial thickness was approximately 0.4 cm. The bilateral ovaries were normal in size, with no obvious space-occupying lesions in the bilateral adnexal areas.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_5_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_5_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a676f03e3be69fbab7cae3d518db6f20a8ad3d5d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_5_en.txt
@@ -0,0 +1,13 @@
+A 24-year-old Sundanese primigravid woman was referred from a peripheral hospital at 38 weeks of gestation due to her deteriorating condition. She presented initially for 5 days of high grade fever, retro-orbital pain, and a blood examination which revealed thrombocytopenia, elevated liver enzymes, and a positive immunoglobulin M (IgM) and immunoglobulin G (IgG) dengue serology. She was diagnosed as having dengue fever in pregnancy and treated with fluid administered intravenously and antipyretics. However, her condition started to worsen on day five of hospitalization with repeated bouts of vomiting and she became lethargic. Her weight was 45 kg and her antenatal history did not reveal hypertension, pre-eclampsia, coagulation abnormalities, or epilepsy.
+During her transport, she received 10 liters of oxygen by non-rebreathing mask and had experienced two episodes of generalized tonic–clonic seizure, each lasting less than 1 minute which terminated with 10 mg diazepam administered intravenously. On admission to our ICU, she was responsive only to pain with a blood pressure of 92/76 mmHg, heart rate 124/minute, respiratory rate 30/minute, body temperature 36.6 °C, and oxygen saturation of 95%. A physical examination revealed diffuse rales on both lungs with cold and clammy extremities. Her chest X-ray revealed marked bronchovascular marking on her left and right basal lung regions . Arterial blood gas analysis revealed an acute metabolic alkalosis: pH 7.510, partial pressure of oxygen in arterial blood (PaO2) 166 mmHg, partial pressure of carbon dioxide in arterial blood (PaCO2) 41.3 mmHg, bicarbonate (HCO3
+-) 33.0 mmol/L, and base excess (BE) 9.3 mmol/L. An initial diagnosis of dengue encephalitis, and dengue shock syndrome with acute pulmonary edema was made.
+She was immediately intubated and placed on mechanical ventilation using adaptive support ventilation mode with the following settings: minute ventilation of 4.5 L, positive end-expiratory pressure (PEEP) 5 cmH2O, and fraction of inspired oxygen (FiO2) of 50% and received continuous sedation under morphine and midazolam infusion. During anesthesia induction, her blood pressure dropped to 60/40 mmHg and a fluid bolus of 300 mL normal saline was given to which she responded. Arterial blood gas analyses taken 2 hours post-intubation with a FiO2 0.7 were as follows: pH 7.475, PaO2 159.1 mmHg, PaCO2 32.1 mmHg, HCO3
+- 24.2 mmol/L and BE 1.1 mmol/L. Another important event included traumatic gum bleeding from biting during her seizure episode which took 1 hour to attain hemostasis, and insertion of a nasogastric tube which yielded 100 mL of dark brown fluid.
+On day 1, hematologic results revealed hemoglobin (Hgb) of 11.7 g/dL (normal range, N, 11.70 to 15.50 g/dL), hematocrit (Hct) of 36.80% (N, 35.00 to 47.00), and white cell count (WBC) of 10,430/mm3 (N, 3600 to 11,000/ mm3) with 53% neutrophil predominance and 35% lymphocytes. Her platelet (Plt) count was 25,000/uL (N, 150,000 to 440,000), prothrombin time (PT) 10.40 seconds (N, 9.4 to 11.3) with an international normalized ratio (INR) of 1.00, activated partial thromboplastin time (aPTT) of 48.70 (N, 31 to 45 seconds), and a slightly elevated D-dimer of 1.91 ng/mL (N, 0.00 to 0.30). Her bilirubin levels were normal, she had an alanine aminotransferase (ALT) level of 116 U/L (N, 0 to 55), aspartate transaminase (AST) of 359 U/L (N, 5 to 34), urea of 49.0 mg/dL (N, <50), creatinine of 0.85 mg/dL (N, 0.5 to 1.1), lactic acid of 4.7 mmol/L (N, <0.6 to 2.2) and procalcitonin of 0.25 ng/mL (N, <0.15). Her urine was tinted red and complete analysis revealed the presence of slight proteinuria (100 mg/dL) and occult blood (200 cells/uL). Cardiotocography (CTG) monitoring revealed a fetal heart rate of 177 beats per minute (bpm) with no uterine contractions.
+On day 2, a routine CTG monitoring revealed fetal distress which prompted an emergency cesarean section. She received 500 mL fresh frozen plasma (FFP) before being rushed for cesarean section under general anesthesia. Intraoperative bleeding was 500 mL, an intra-abdominal drain was placed and she received 460 mL of packed red cell (PRC), intraoperatively. A 2.1 kg baby girl was delivered with an appearance, pulse, grimace, activity and respiration (APGAR) score of 4/7. The baby was intubated and transferred to our neonatal ICU (NICU) due to hypoventilation. Our patient was transferred back to ICU and fundal height was noted at the level of umbilicus with good contractions.
+On day 3, blood clots were seen oozing from her vagina and a vaginal exploration evacuated 200 mL of blood. The intra-abdominal drain collected 50 mL/24 hours of hemoserous fluid and hematologic results revealed Hgb 5.9 g/dL, Hct 18.20%, and Plt 141,000/uL. Upon this substantial drop, 680 mL of PRC, 210 mL of FFP, and 2 units of thrombocyte concentrate apheresis (TCA) were given. Her vital parameters were stable and she remained sedated. A follow-up chest radiography revealed improved clearance of vascular markings on both lung fields confirmed by vesicular lung sounds and a normal acid-base balance with a PaO2/FiO2 of 600 .
+On day 4, a follow up hematologic examination revealed Hgb 6.96 g/dL, Hct 20.16%, WBC 10,660/mm3, Plt 98,630/uL, albumin 2.63 g/dL, fibrinogen 140 mg/dL (N, 300 to 600), PT 10.90 seconds, and a prolonged aPTT of 56.90 seconds. The intra-abdominal drain collected 450 mL/24 hours of hemoserous fluid and her lower abdomen was noted to be slightly distended. Thereafter, another 230 mL of PRC, 240 mL of FFP, and 2 units of thrombocyte concentrate (TC) was transfused.
+On day 5, 3 days post-cesarean section, our patient became tachycardic with a blood pressure of 80/60 mmHg, which prompted the use of norepinephrine at 0.08 μg/kg/minute. Uterine contractions were adequate with normal colored lochia, but her lower abdomen appeared distended as before. The intra-abdominal drain collected 360 mL/24 hours of hemoserous fluid and laboratory results were as follow: Hgb 5.90 g/dL, Hct 17.80%, WBC14,020/mm3, Plt 107,000/uL, and albumin of 2.26 g/dL. She was given 20% albumin infusion, 230 mL of PRC, and 220 mL of FFP.
+On day 6, she remained tachycardic and her mentation did not improve despite stopping sedation. At this time, her lower abdomen appeared more distended and abdominal guarding was noted upon palpation. The intra-abdominal drain had collected 850 mL/24 hours of hemoserous fluid. An urgent blood workup revealed a drop in Hgb to 4.20 g/dL, Hct 12.50%, WBC 10,160/mm3, Plt 84,000/uL, PT 10.40 seconds, aPTT 49.50 seconds, and a spiked D-dimer level (20.25 ug/mL). An emergent ultrasound revealed free fluid on her lower abdominal region which required her to be rushed for an exploratory laparotomy. The procedure evacuated 2000 mL of blood intra-abdominally, and she received 640 mL of PRC and 500 mL FFP, intraoperatively.
+On day 7, her hematologic examination revealed Hgb 9.60 g/dL, Hct 28.50%, WBC 8,150/mm3, Plt 67,000/uL, normalized coagulation profile, and a lowered D-dimer level (13.98 ug/mL). One unit of TC was transfused and norepinephrine infusion was tapered down with strict vital sign monitoring. Sedation was stopped and her mentation greatly improved. A follow-up chest radiograph revealed clear lung fields and she was placed on a spontaneous breathing trial which was successful and she was later extubated.
+On day 8, an additional 230 mL PRC was given and her hematologic examination revealed Hgb 11.50 g/dL, Hct 34.40%, and Plt 83,000/uL. Aside from transfusions and vasopressors, she received meropenem 1 gram every 8 hours, early enteral nutrition of 1000 kcal/24 hours, gastric acid prophylaxis agent, gastric motility agents, and anticonvulsants. She was transferred to our general ward on day 8 and discharged from our hospital on day 11, uneventfully. Her neonate was extubated on day 2 of her NICU stay, after complete recovery from sedative drugs in utero and discharged home at day 5 without any negative sequel .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_613_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_613_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5b6d820c0367688b791c584c289b60e5b1ea4bd4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_613_en.txt
@@ -0,0 +1,3 @@
+A 60-year-old female presented to us with severe neck pain and stiffness, as well as standing and walking difficulty that had been persisting the last four days. Ten years earlier, she had been diagnosed with RA, on the basis of symmetrical polyarthritis, affecting the small joints of the hands and wrists bilaterally, high erythrocyte sedimentation rate (ESR) 68 mm/h, C-reactive protein (CRP) 49 mg/dl, positive rheumatoid factor (RF) 680 U, and positive anticitrullinated protein antibodies (ACPA) 410 U.
+She reported that she did not receive any conventional synthetic disease-modifying antirheumatic drugs (csDMARDs), nor biological (b) DMARDs except for paracetamol, and, occasionally, non-steroidal anti-inflammatory drugs (NSAIDs). Past medical and family history were unremarkable. Clinical examination showed swelling and tenderness of the metacarpophalangeal (MCP) and proximal interphalangeal (PIP) joints bilaterally, as well as muscle atrophy . Clinical evaluation of the CS showed severe neck pain and stiffness at any head movement. Neurological examination revealed brisk tendon reflexes, symmetrical on the upper and lower extremities, and Babinski sign along with clones on the right foot. Laboratory tests revealed anaemia of chronic disease (ACD, Hb 9 g/dl, serum ferritin 158 mg/dl and serum ferrum 7 mg/dl), elevated acute phase reactants and high titres of RF and ACPA antibodies.
+Radiological evaluation of the CS disclosed extensive degenerative changes involving the C3, C4 and C5 vertebral bodies, as well as fusion of the apophyseal joints C2,C3 and C4,C5 . Magnetic resonance imaging (MRI) showed SAS and spinal cord compression at C3 level and to a less extent in other levels . Hand x-rays showed severe erosive changes and subluxations of the MCP joints bilaterally, fusion of the carpal bones and severe osteopenia . The patient was admitted and directed to the neurosurgery department and underwent multi-level cervical laminectomy and spinal cord decompression with excellent results. Before discussing our case, we review the CS anatomy, its imaging evaluation, the role of conventional radiography (CR), the radiographic changes of CS, and the studies investigating the CS involvement in the setting of RA patients.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_616_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_616_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0fa4965b3f61f9ab29f58841c3b06594d88db362
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_616_en.txt
@@ -0,0 +1,4 @@
+A 54-year-old man was referred to our hospital after his previous doctor thoroughly examined him for right-sided abdominal pain. His previous diagnosis based on computed tomography (CT) was a right mesenteric tumor. Mild tenderness was noted on the right side of the abdomen, but there were no palpable masses. His medical history included diabetes mellitus and hypertension. Blood chemistry tests showed mild elevation of liver enzymes levels and elevated blood glucose and hemoglobin A1c levels, which are associated with diabetes mellitus. The tumor marker carcinoembryonic antigen level was mildly elevated at 6.2 ng/mL. Contrast-enhanced abdominal CT revealed a mesenteric lobulated mass with an artery running through the center . FDG-PET revealed slight FDG uptake (maximum standardized uptake value, 2.0) in the right abdomen; hence, a benign or low-grade malignant tumor was suspected .
+Based on the imaging findings, we suspected a malignant mesenchymal tumor, and because the tumor was painful, surgery was performed to diagnose and treat it. The tumor was located in the mesentery of the ileum and retracted into the mesentery . Surgery was performed via a laparotomy. Initially, the small mesenteric mass was resected along with the surrounding mesentery . However, resection of the tumor and mesentery resulted in impaired blood flow to the ileum in that area, and eventually, a 90-cm ileum was also resected . The cut surface of the 55 × 33 × 33 mm3 tumor was pale yellowish-white . Anastomotic reconstruction was performed using an instrumental functional end-to-end anastomosis. Our intraoperative search did not reveal any small bowel tumor, and an additional search of the resected ileum did not reveal any tumor. Thus, we diagnosed the patient with a primary ileal mesenteric tumor rather than a metastatic tumor.
+Histological examination showed proliferative infiltration of atypical cells of unequal size and irregular spore structure. Some atypical cells infiltrated the surrounding adipose tissues and proliferating atypical cells had round nuclei and a relatively abundant cytoplasm with pale eosinophilia. There were narrow fibrovascular interstitial spaces between atypical cell foci . Immunohistochemical staining was positive for CD56 , chromogranin A , and synaptophysin . The Ki-67 index was 3% . The final pathological diagnosis was NET G2.
+The patient’s postoperative course was good, and he was discharged 10 days after the surgery. The patient developed no recurrence for 1.5 years. Postoperative antitumor therapy was not performed for this patient because the histological diagnosis was NET G2, and it was determined that the tumor could be completely resected by surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_621_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_621_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..88ef26bf99f06f4b0bc0d246d7f3b5785d6e7c0e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_621_en.txt
@@ -0,0 +1,8 @@
+This is the case of a 18-year-old woman who visited the surgery due to discomfort caused by hypertrophy of the upper lip.
+No findings were found on preoperative examination and electrocardiogram (ECG) .
+No specific findings were found on the patient's history.
+The patient had no family or genetic disease history.
+Vital signs were assessed before anesthesia induction: Blood pressure, 111/79 mmHg; HR, 94 beats/min; and SpO2, 99%.
+On perioperative laboratory examinations and the C-reactive protein (CRP) level were within normal range.
+She was diagnosed with hemangioma by ultrasound . Intraoperative picture, tracing with black silk to expose the surgical site during the approach to the surgical site .
+Anesthesia was induced by injecting 2 mg/kg of IV propofol, ventilating with 5%–6 vol % of desflurane using a mask, and simultaneously administering remifentanil at the target site with a concentration of 2.0 ng/mL for balanced anesthesia using a target- controlled infusion pump (Orchestra®, Fresenius Vial, France). After the loss of consciousness was confirmed by a bispectral index (BIS) of less than 40, rocuronium 0.6 mg/kg IV was administered. After confirming that the muscle had appropriately relaxed, endotracheal intubation was performed. The blood pressure measured after intubation was 110/62 mmHg, and the heart rate was 59 beats/min. During the operation, the respiratory rate was controlled to maintain the end-tidal CO2 partial pressure of 32–38 mmHg, and mechanical ventilation was performed with oxygen 1 L/min and air 2 L/min. Desflurane was controlled to maintain BIS from 40 to 60. The operation proceeded normally for about 1 hour, but a constant 1:1 premature ventricular complex (PVC) was detected in the course of approaching the more profound part with more strong traction for exposure of the part , and blood pressure was decreased from 97/60 mmHg to 88/47 mmHg, respectively. The procedure was stopped after vital signs and ECG had changed. Arrhythmia disappeared shortly after traction was released, and vital signs were stabilized within a few seconds. When traction stimulation started for surgery again, bradycardia recurred with 35 PVCs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_628_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_628_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0c94280ed561026de539b4670354054ac567eed3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_628_en.txt
@@ -0,0 +1 @@
+A 59 year old male was admitted to the Department of Gastroenterology of our hospital on June 16, 2020 due to jaundice of the skin and sclera for more than 15 days and progressive weight loss about 5 kg. He had a history of brain stem infarction with left lower limb weakness and occasionally chokes on drinking water. He denied a history of hepatitis, tuberculosis or other infectious diseases. Physical examination showed that he had chronic disease appearance with jaundice of the skin and sclera, but no obvious enlargement of superficial lymph nodes and no obvious positive signs in the abdomen. Laboratory data on the day of admission were as follows: hemoglobin 101 g/L, glutamic-pyruvic transaminase 158 U/L, glutamic-oxaloacetic transaminase 150 U/L, total bilirubin 217.3 umo/L, direct bilirubin 152.4 umo/L, indirect bilirubin 64.9 umol/L, hypersensitive C-reactive protein 5.8 mg/L, procalcitonin 0.11 ng/ml, carcinoembryonic antigen (CEA) 6.19 μg/L, carbohydrate antigen 125 (CA125) 117.1 kU/L. On June 17 abdominal ultrasonography showed gallbladder enlargement, cholecystitis, cholestasis, and dilatation of intrahepatic and extrahepatic bile ducts. On June 18 magnetic resonance cholangiopancreatography (MRCP) and abdominal magnetic resonance (MRI) considered neoplastic lesions of the duodenal papilla, severe dilatation of intrahepatic and extrahepatic bile ducts, bile stasis in common bile duct, large gallbladder. On June 19 ultrasound gastroscopy revealed that a neoplasms of approximately 2.5 × 2.5 cm in size could be seen at the duodenal papilla, with ulceration on the surface, covered with yellow and white slough, and contact bleeding. Three biopsies were taken. The patient was transferred to our department from the Department of Gastroenterology on June 20. The results of abdominal enhanced computed tomography (CT) on June 23 were similar to MRI. On the same day cholangiograms of percutaneous transhepatic biliary drainage (PTBD) was performed for jaundice reduction. On June 29 we prepped the patient for pancreaticoduodenectomy after discussion and obtaining informed consent from the patient and his family. However, histopathological examination on June 30 showed severe chronic active inflammation with ulcers, infiltrated by large number of atypical lymphocytes. Mitotic figures were visible, and the cytoplasm of tumor cells was empty and bright. Immunohistochemical results were as follows: LCA ( +), CD34 (vascular +), Ki67 (Li80%), CD20 ( +), LCA ( +), CD34 (vascular +). Aggressive Non-Hodgkin’s B-cell lymphoma was diagnosed on the basis of this results. The surgical plan was cancelled after a consultation with a haematology, chemotherapy was indicated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_636_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_636_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95d30df903bd142ae5e42bc06f63947086643af7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_636_en.txt
@@ -0,0 +1 @@
+A 37-year-old female complained of dizziness. She had started experiencing dizziness 3 years ago, following the infertility treatment that she had received. She experienced dizziness following an injection of human menopausal gonadotropin administered by a gynecologist and a visit psychologist. In addition to her dizziness, she also suffered from insomnia, tinnitus, and anxiety. Therefore, she was referred to a psychologist. However, the treatment of tranquilizers such as benzodiazepines and antidepressants such as serotonin selective re-uptake inhibitors (SSRIs) failed to cure the dizziness and only slightly improved her insomnia. She was therefore referred to our department for further examination and treatment. She expressed her dizziness as an event wherein she experienced frequent paroxysmal earthquakes occurring within seconds. The frequency of such episodes had recently increased to once every 5 minutes. She felt stable while doing her household tasks and she had never fallen. Audio-vestibular examination, including pure tone audiometry, posturography, and head MRI, revealed no abnormal findings. Her blood examination findings were normal; there was no spontaneous or evoked nystagmus. However, the peripheral part of her hand and foot often became pale due to poor peripheral circulation, an observation similar to Raynaud's phenomenon. She also experienced chronic headache and insomnia, whereby she woke up every 2 hours during the night. The results of the psychological examination were as follows: Self-rating Depression Scale (SDS), 47; Japanese version of the Cornell Medical Index (CMI), III; Manifest Anxiety Scale (MAS), 27; and Maudsley Obsessional-Compulsive Inventory (MOCI ), 9. MAS indicated a high level of anxiety. We deduced that her dizziness was due to psychosomatic reasons together with poor peripheral circulation. We prescribed setiptiline maleate and an additional herbal medicine, which is known to improve peripheral circulation. Within 2 weeks her symptoms slightly improved and the level of dizziness reduced to less than one third. However she didn't want to keep taking these drugs, since she want to have a baby. No abnormality was reported in any physical examination, including posturography. We diagnosed the patient's condition as phobic postural vertigo. Although she often experienced palpitations, cardiological examination reported no abnormal findings. These results indicate the existence of autonomic dysfunction due to psychological stress, including anxiety. We decided to focus on treating the patient's anxiety and the supposed autonomic dysfunction. After 1 month following the patient's first visit, AT was introduced by a clinical psychologist so as to ease her mental stress. The psychotherapy consisted of one 45-minute session every 3 weeks. The first session began with a brief introduction to the general background information about the cognitive approach, after which the patient was instructed how to perform AT. Thereafter, the patient performed AT in a relaxed sitting position on a chair for 10 minutes 3 times a day. No self-monitoring was advised. The patient was instructed to carry out slow and deep abdominal breathing at the beginning of AT and regular breathing during AT. She diligently and regularly continued this AT routine 3 times a day at her home, according to a written timetable. She learned all 6 standard formulas of AT in 6 psychotherapy sessions. Astonishingly, after the introduction of AT, her mood stabilized and her dizziness, insomnia, and headache disappeared in a few weeks. The dose of clotiazepam was reduced to 5 mg once a day. No additional treatment was administered. At 6- and 9-month follow-ups, the patient was free from dizziness, insomnia, and headache.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_649_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_649_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..efd57e734f8c2b0a91c9de29169c92b43928a7dc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_649_en.txt
@@ -0,0 +1,5 @@
+This is a 50-year-old woman with an established diagnosis of MS manifested by transverse myelitis. She had been treated with intravenous (IV) steroids and glatiramer acetate with excellent results in the past for episodes of left-sided weakness after MR imaging of the brain done 1 year before this presentation revealed a deep white matter lesion with an incomplete ring-enhancing pattern without midline shift or edema .
+On the current admission, she presented with nausea, vomiting, and lethargy. A computed tomographic (CT) scan of the head demonstrated subfalcine herniation secondary to extensive vasogenic edema, which explained her obtundation. She was admitted to the intensive care unit and placed on 1000 mg of IV methylprednisone on a daily basis. Considerable improvement in her mentation was noted over the next day.
+On the third day of her stay in the intensive care unit, she developed a nonreactive dilated right pupil and was found to be somnolent. A repeat CT scan revealed worsening edema, causing transtentorial herniation . She was taken immediately to the operating room for a right decompressive hemicraniectomy.
+Intraoperatively, after removal of the bone flap, the right cerebral hemisphere herniated through the bony defect. Underlying the dura, there was a significant amount of abnormal brain tissue that was grayish in color. A biopsy of the tissue was performed, and the skin edges were closed. The patient was continued on the high-dose steroid therapy and remained under close observation in the intensive care unit. Over the next 3 days, she became more alert and her right pupil returned to normal size and reactivity. She regained her previous baseline neurologic status with a left hemiparesis and was able to communicate easily.
+The results of the pathologic examination were consistent with demyelinating disease. Due to the enhancing nature of the lesion as well as the extensive edema, there was a concern for an underlying pathology that was not obvious. It was decided to continue treatment with immunosuppressive therapies and repeat neuroimaging in a few weeks after interval resolution of the edema. After 5 weeks, the patient's skin flap had become sunken; however, given her ongoing immunotherapy, a cranioplasty was not performed. She was transferred to a rehabilitation facility.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_651_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_651_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c0d999b4a2993b89b3b371f692ee9275b57729d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_651_en.txt
@@ -0,0 +1,9 @@
+The reported patient is a 15-year-old girl with βTI, who presented at the age of 3 years with pallor, decreased growth rate and decreased activity. She had severe microcytic, hypochromic anemia with hemoglobin (Hb) of 7.3 g/dL.
+Pediatric hematologist workup proved the diagnosis of βTI. Her Hb electrophoresis showed; 69.9% HbA, 27.2% HbF, and 2.9% HbA2. Genetic molecular testing revealed compound heterozygosity for cd-27 (G>T) and cd-39 (C>T) mutations. Hydroxyurea at a dose of 15 mg/kg per day was started, in addition to folic acid.
+She was then followed at the pediatric hematology unit at regular intervals to monitor her tolerance to drug therapy, with special attention to hematological toxicity. There were no significant side effects during seven years of therapy, and the patient showed good response with occasional need for blood transfusions. She underwent splenectomy during her late teens.
+At the age of 15 years, she developed generalized bone aches, abdominal pain, persistent fever, and dyspnea, and so she was referred to our hospital.
+On physical examination, there was severe pallor, tachypnea, tachycardia, and hepatomegaly.
+Initial complete blood picture showed a Hb level 3.9 g/dL, white blood cell count of 250 × 109/L, and platelets count of 640 × 10-9/L.
+Serum electrolytes, cerebrospinal fluid analysis, and kidney and liver function tests were normal, expect for mild elevation of total serum bilirubin, which was 1.3 mg/dL.
+Serum ferritin was 877 ng/dL. Serological studies including Epstein-Barr virus, cytomegalovirus, human immunodeficiency virus, hepatitis C virus and hepatitis B virus were negative. Lactate dehydrogenase was 974 U/L, and serum uric acid was 5.6 mg/dL.
+Her chest X-ray was normal. Abdominal ultrasonography revealed hepatomegaly with calcular cholecystitis and bilateral diffuse renal enlargement. Echocardiography showed mitral valve prolapse with trivial mitral regurgitation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_655_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_655_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1d146c8807c502ecca276bf43702ee8969ed7fc5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_655_en.txt
@@ -0,0 +1,11 @@
+A 41-year-old Hispanic man with history of rheumatoid arthritis (RA) and type2 diabetes mellitus was referred to the emergency room (ER) of a large urban city hospital from the rheumatology clinic for newly developed bilateral lower extremity rashes and edema after 1 year of being lost to follow-up. He was diagnosed with RA 2 years prior to admission after presenting with polyarthritis and strongly positive serum immunologic markers (rheumatoid factor titer 1220 IU/ml [normal range, < 20 IU/ml], anti-cyclic citrullinated peptide titer 240.05 U/ml [normal range, < 20 U/ml; strongly positive, > 60 U/ml]). Methotrexate, low dose prednisone and sulfasalazine had resulted in better control of disease activity. Unfortunately, the patient was lost to follow-up. He had been off of disease-modifying antirheumatic drugs (DMARDs) for RA and was only taking ibuprofen 800 mg every 8 h as needed for about a month for joint pain.
+When the patient was seen in the ER (day 0), the physical exam showed pinpoint, non-tender, non-blanchable purpuric macules coalescing into large patches on the left leg, with smaller areas of involvement on the right leg. The skin lesions were in a dependent distribution involving more of the flexor surface than extensor surface. Joint exam revealed polyarticular arthritis with pain and swelling in the right 2nd and 3rd metacarpophalangeal (MCP) joints and left 3rd (MCP). Boutonniere deformities were observed in both hands (left more than right), as well as subcutaneous nodules under the elbow. Significant pitting edema was found in the lower extremities. The rest of the physical exam was unremarkable.
+His urinalysis showed red blood cell of 21/high power field (hpf) and white blood cell 7/hpf. His creatinine was 0.9 mg/dl, with estimated GFR of 93 ml/min using MDRD equation. The diagnosis of nephrotic syndrome was established given large proteinuria (11 g/gm) on the spot urine sample, hypoalbuminemia (2.2 g/dL), and peripheral edema.
+Further serology work-up showed low C3 of 86 (normal range 88–201), C4 of 24 (normal range 16–47), positive cryoglobulin qualitative with < 1% Cryocrit, as well as negative c-ANCA, p-ANCA, and ANA (including Anti-dsDNA, Anti-Smith, Anti-SSA and Anti-SSB). He had a polyclonal elevation in IgG (1790 mg/dl, normal range 694-1618 mg/dl) and IgA (661 mg/dl, normal range 68-378 mg/dl), with a normal IgM (181 mg/dl, normal range 77-220 mg/dl). There was absence of M-spike on serum protein electrophoresis. HIV, Hepatitis C and hepatitis B serologies were negative. Unfortunately, rheumatoid factor (RF) titer was not checked at that point of time. Prednisone was started at 10 mg daily empirically for treatment of nephrotic syndrome and active RA, and patient was referred to renal clinic for further diagnosis and monitoring of therapy.
+Three days after being discharged (Day 5) and prior to being seen in the renal clinic, the patient developed painful purplish discoloration of the distal right thumb, which prompted another ER visit (Day 12). On exam, the distal phalanx was cool to touch and exquisitely tender on palpation with signs of onycholysis. There was no sign of cutaneous necrosis or surrounding cellulitis. Doppler ultrasound showed good radial and ulnar pulses with good blood flow to the distal phalanx of the right thumb. He was discharged from the ER since no macrovascular signs were found, and he was given follow up with rheumatology. On Day 16, rheumatology noticed new lower lip purpuric lesions, which, in conjunction to the positive cryoglobulin qualitative test along with the thumb and lower leg lesions, prompted an increase in Prednisone dose to 80 mg daily for treatment of systemic cryoglobulinemic vasculitis. Unfortunately, his skin lesions were not biopsied.
+Renal biopsy was performed on day 28. A total of 23 glomeruli were obtained, of which 1 was sclerosed. Light microscopy showed diffuse capillary wall thickening with rare eosinophilic intracapillary thrombi . Silver stain showed spikes and holes in the glomerular basement membrane. Immunofluorescence (IF) staining showed diffuse, finely granular deposits of IgG , IgA, IgM, κ and γ light chains, C1q and C3. Anti-phospholipase A2 receptor (PLA2R) stain was negative. Electron microscopy (EM) showed widespread subepithelial and intramembranous electron-dense deposits, with diffuse foot process effacement . Subendothelial or mesangial tubuloreticular inclusions suggestive of lupus nephritis were not found. The final pathologic diagnosis was compatible with membranous nephropathy with features of cryoglobulinemic glomerulonephritis. There were no signs of diabetic nephropathy on light microscopy.
+Given the multisystem involvement (purpuric, non-blanching lesions in multiple skin and mucosal surfaces), characteristic pathological features (intracapillary thrombi) on renal biopsy and positive cryoglobulin qualitative test, a decision was made to start treatment empirically as systemic cryoglobulinemic vasculitis with Rituximab, considering that this is the first line treatment for hepatitis C-related cryoglobulinemic disease and evidence is limited for treatment of renal involvement in non-infectious mixed cryoglobulinemia. Unfortunately, treatment was delayed due to indeterminate Quantiferon and PPD tests.
+One and a half months after starting high dose steroids (day 62), his right thumb and lower lip lesions had resolved, and his urine protein/creatinine ratio had decreased to 3.4 g/g.
+Patient was started on Rituximab 1 g every 2 weeks and received 2 doses on day 67 and day 88, resulting in improvement of his proteinuria to 1.3 g/g (day 88). By this time, patient was on Prednisone 40 mg daily. Due to the persistently elevated blood sugar and Cushingoid features, a taper of the steroids occurred over the following 2 months.
+Two months after he completed rituximab, the patient was admitted for presumed pneumonia (day 158) secondary to immunosuppression after presenting with 2-week history of dyspnea and cough. He underwent a CT scan of the chest with contrast, which showed hilar and mediastinal adenopathy without parenchymal consolidations. He underwent bronchoscopy with endobronchial ultrasound (EBUS), and the transbronchial lymph node biopsy of the mediastinal lymph node showed non-caseating granulomas. Acid fast stain and mycobacterium culture were negative. To rule out a lymphoproliferative disorder as a differential of non-caseating granulomas, PET scan, bone marrow biopsy and flow cytometry were performed, and they were negative for clonal lymphocytic proliferation. A clinical diagnosis of sarcoidosis was made, and his Prednisone dose was increased to 40 mg daily (patient was on a steroid taper and taking Prednisone 20 mg daily prior to this admission), resulting in rapid pulmonary symptoms improvement. No extrapulmonary signs of sarcoidosis developed in the course of his illness (e.g. erythema nodosum).
+Six months after his first course of Rituximab, his proteinuria had increased back to 7 g/gm (day 291), so a decision to repeat Rituximab course was made. Unfortunately, this was again delayed due to patient’s personal issues, and he started it 2 months later. This time he received weekly Rituximab 750 mg for a total of 4 doses. Patient again manifested a dramatic initial response to the treatment with reduction of proteinuria to 1.1 g/g (day 371), but with a slow increase in his urine protein to creatinine ratio over the following 3 months, to an average of 3.8 g/g, compatible with an overall partial response if compared with his initial proteinuria of 11 g/g on presentation . His Creatinine level has remained stable between 0.8 ~ 1.1 mg/dl during the period of one and half year follow-up. His skin lesions and articular manifestations have completely resolved since the initiation of high dose steroids on day 62. Repeat Cryoprecipitate levels has been persistently positive. A timeline of the disease course is summarized in Fig. .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_656_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_656_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..92b24a6e70b6ca3939d0bf6ff3e0fc6c331975b4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_656_en.txt
@@ -0,0 +1,4 @@
+A 42-year-old man presented to Feiz Eye Hospital with sudden persistent painless loss of vision in April 2013. He had been diagnosed with GPA 10 months before. His presenting symptoms at that time were high fever and left eye redness along with nasal congestion, sinonasal obstruction, breathing difficulties, and joint pain. Laboratory tests revealed proteinuria. After physical examination, laboratory investigations, kidney biopsy, and imaging studies, GPA was diagnosed. The patient was hospitalized and treated with cyclophosphamide for 14 days. On discharge, he was prescribed high dose corticosteroid (prednisone: 100 mg daily) as a maintenance therapy.
+The patient's symptoms improved until April 2013, when sudden severe visual loss in the left eye caused admission to the hospital. The patient described the sudden appearance of a black spot in his vision that spread all over his left visual field in 1 minute. He also had severe headache, redness of the left eye, and pain for three days.
+In the ophthalmologic examination, visual acuity of the right eye was 10/10 and the left eye had only light perception. Relative afferent pupillary defect was positive in the left eye. Slit lamp examination was normal in the right eye but in the left eye there was a 4 mm round, fixed and painless mass in the upper eyelid . Conjunctiva was hyperemic, and an area of 2 mm necrotizing nodular scleritis in superonasal quadrant was noted . The cornea, iris, lens and vitreous cavity were normal. Intraocular pressure of the left eye was normal. Dilated funduscopic examination showed a white, swollen retina, particularly in the posterior pole, with a cherry-red spot. There was arterial attenuation and intravascular segmentation of the blood column in the posterior pole, but no emboli were noted [Figures and ].
+The patient's description of painless, sudden loss of vision and appearance of the cherry-red spot on examination of the fundus indicated. Therefore, we gave him nasal O2, and performed ocular massage and paracentesis of the anterior chamber. The patient was hospitalized for 7 days and was treated with intravenous cyclophosphamide as per internal medicine consult. Aggressive lubrication of the ocular surface and frequent instillation of topical steroids and cycloplegics was prescribed. After several weeks, eyelid nodule and scleritis improved, but vision loss remained.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_664_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_664_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..27fbc1f9d967cbb3786a9f72d75285f45c90ef71
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_664_en.txt
@@ -0,0 +1,5 @@
+A 24-year-old man was referred to our center complaining of bilateral ocular irritation and progressive visual deterioration over the past 4 years. Past ocular history was negative for wearing contact lenses or previous ocular infections and there was no family history of ocular disorders. Previous records revealed no gross ocular abnormalities until 4 years ago. The patient reported pain, redness and swelling in the distal joints of his hands, and had been diagnosed with seropositive rheumatoid arthritis since the age of sixteen. The proximal interphalangial (PIP) and metacarpophalangial (MCP) joints in both hands were principally involved resulting in significant deformity in the fifth fingers . At presentation, rheumatoid arthritis was well controlled with hydroxychloroquine under observation of a rheumatologist.
+On ophthalmic examination, uncorrected visual acuity (UCVA) was 20/50 bilaterally which improved to 20/20 in both eyes with − 0.25 − 4.25@48 ° and − 0.75 − 2.00@100 ° in the right and left eyes respectively. Keratometric readings were 47.00×140, 43.25×50; and 43.00×100, 44.75×10 in the right and left eyes, respectively.
+Slit lamp biomicroscopy revealed normal lid margins without any signs of meibomian gland dysfunction or blepharitis; the tear meniscus and tear break up time were within normal limits. The conjunctiva was slightly injected near the limbus but the sclera was normal. Marked corneal thinning and bulging was noted in the whole periphery of the cornea; this circumferential gutter was 1.5–2 millimeters in width with superficial vascularization but had an intact epithelium. Circumferential lipid deposition was detected in front of the leading vascular edge. The central cornea however, was clear and free of lipid deposits and vascularization . These features were similar to manifestations of Terrien’s marginal degeneration.
+In addition to the above-mentioned findings, broad bands and vesicles were present on the corneal endothelial surface. The band-like lesions had parallel scalloped edges which did not taper toward the ends and were more prominent with retroillumination . The appearance of the lesions was typical for posterior polymorphous corneal dystrophy.
+The anterior chamber was deep and the lens and iris were normal with no sign of current or previous inflammation. Intraocular pressure measured with Goldmann applanation tonometry was 6 and 7 mmHg in the right and left eyes, respectively. Gonioscopy was unremarkable and the angle appeared open. Posterior segment examination was also unremarkable. Ultrasonic pachymetry revealed central and mean peripheral thickness of 450 μm and 390 μm respectively in the right cornea. Corresponding values for the left cornea were 506 μm and 250 μm. Corneal thickness was most significantly attenuated in the superior corneal periphery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_66_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_66_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8fb6d4e5d323774b2eedd81481c2ebcd821784d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_66_en.txt
@@ -0,0 +1,4 @@
+A 68-year-old male noticed headaches on July 8, 2012, and then right hemiparesis on July 19 of the same year. The primary care physician diagnosed stroke, and he was admitted to hospital. He had no medical history of head trauma, sinusitis, or diabetes, but he drank 1,800 mL of a distilled spirit (equivalent to 330 g of ethanol) with blue cheese every day, and had alcoholic liver cirrhosis (Child-Pugh grade B). He was febrile (39.0℃) and had become progressively paralyzed on the right side of his body. Brain magnetic resonance imaging (MRI) disclosed several ring-enhancing lesions in the brainstem and cerebral hemispheres. A cerebrospinal fluid (CSF) examination revealed pleocytosis, and a blood examination revealed an increased titer of Aspergillus antigen without inflammatory reaction; the (1→3)-β-D-glucan test was negative.
+Bacterial cultures taken from two independent vessels grew L. monocytogenes, which led to a diagnosis of multiple brain abscesses due to L. monocytogenes infection. He was treated with ampicillin (ABPC; 2 g every 4 h i.v.) and voriconazole (200 mg/day), but he developed consciousness disturbance and complete right-sided hemiparesis. Follow-up brain MRI disclosed extended lesions, and the patient was transferred to our hospital. Upon admission he had a body temperature of 36.9℃, and a physical examination revealed neither superficial lymphadenopathy nor hepatosplenomegaly. A neurologic examination revealed that he was in a comatose state (score on the Japan Coma Scale of 30-200). Right blepharoptosis and anisocoria (3.0 mm on the right and 4.0 mm on the left) was observed. The left light reflex was attenuated, while that on the right was preserved. His oculocephalic reflex was positive. The right hemiparesis was severe but without muscular waste and fasciculation. The tendon reflexes were exaggerated in the right upper and lower limbs, but without pathologic reflexes. Neither neck stiffness nor Kernig's sign was detected. Laboratory data revealed no inflammatory reaction such as leukocytosis or elevation of C-reactive protein, but pleocytosis was evident in the CSF: 101 cells/mm3 (96.6% monomorphonuclear and 3.4% polymorphonuclear cells); protein, 201 mg/dL; and glucose, 58 mg/dL (plasma glucose, 78 mg/dL). No pathogenic bacteria grew in bacterial cultures of the CSF, blood, urine, and a nasopharyngeal swab.
+Brain MRI disclosed several ring-enhancing lesions on the left cerebral hemisphere and brainstem . High-intensity signals were present inside the mass lesions in diffusion-weighted imaging . Susceptibility-weighted imaging disclosed a dual rim sign, defined as two concentric rims at the lesion margins, with the outer rim being hypointense and the inner rim hyperintense relative to the cavity contents . MR spectroscopy revealed no elevation of choline in the lesions. Positron-emission tomography (PET) demonstrated no uptake of 2-[fluorine-18]-fluoro-2-deoxy-D-glucose, suggesting the absence of malignancy.
+Treatment with ABPC (2 g every 4 h i.v.) and voriconazole (100 mg every 12 h i.v.) was continued. Diagnostic and therapeutic drainage for brainstem lesions is not favored at our neurosurgical department, and so the patient instead underwent HBO therapy (100% O2 at 196.1 kPa abs at 1 h/day, for 25 days) from August 17. After the treatment, his consciousness status and pleocytosis gradually improved. The anisocoria had resolved by August 20, and voluntary movements of the right upper and lower limbs were possible by September 5 . Since the lesions were dramatically ameliorated on follow-up MRI, we terminated the voriconazole and ABPC therapy on October 3 and 10, respectively. The patient was transferred to another hospital for rehabilitation on October 17.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_69_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_69_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9db60d571a2d87b17a2b72ad897e37dd5b017c27
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_69_en.txt
@@ -0,0 +1,64 @@
+A 17-year-old neutered male European Shorthair cat was presented owing to an
+inability to jump, weakness and respiratory stridor. All these signs had started a
+few months previously. The cat was kept strictly indoors, had no history of trauma
+and the owner did not report any other clinical signs or pre-existing disease. The
+physical examination revealed a plantigrade stance, pelvic limb muscle atrophy that
+was more severe on the right, broad facial features and inspiratory stridor.
+Neurological examination showed the cat had a reluctance to move, lameness of the
+hindlimbs and paraparesis with plantigradism. Postural reactions and flexor reflexes
+were reduced in both pelvic limbs. Neurological signs were more severe on the right
+pelvic limb. A lesion affecting the sciatic nerves, more severe on the right side,
+was suspected because the cat was not ataxic, and the other nerves originating from
+L4–S3 spinal cord (femoral nerve, pelvic nerve, pudendal nerve, etc) were apparently
+not affected. A lesion affecting the nerve roots of the sciatic nerve at the level
+of the cauda equina could not be excluded, but was considered less likely because of
+the marked asymmetry of the clinical signs and the absence of evidence of
+involvement of the pelvic and pudendal nerve and coccigeal nerves. Degenerative
+(lumbosacral stenosis, disc herniation), neoplastic (lymphoma, paraneoplastic
+polyneuropathy) or metabolic (lumbosacral stenosis associated with acromegaly,
+diabetic polyneuropathy) conditions were included as differential diagnoses.
+Routine laboratory examination, including a complete blood count, serum biochemistry
+and complete urinalysis, was unremarkable. Serum glucose concentration was
+5.4 mmol/l (reference interval [RI] 4.1–6.4 mmol/l) and serum fructosamine
+concentration was 211 µmol/l (RI 220–350 µmol/l). Serum total thyroxine
+concentration was also normal (32 nmol/l; RI 10–60 nmol/l). Serum IGF-1
+concentration, measured with a validated commercially available chemiluminescence
+assay (Immulite; IDEXX Laboratories), was higher than the assay detection limit (1000 ng/ml). Basal GH
+concentration was not measured. Abdominal ultrasound evaluation revealed visceral
+organs of normal size (liver, spleen, pancreas, kidneys and adrenal glands). An
+echocardiography was performed, which showed no evidence of cardiac hypertrophy.
+A CT scan of the lumbosacral spine and the head was performed with a single slice
+helical scanner (Siemens Somatom Emotion). The cat was placed in sternal recumbency
+under general anaesthesia and a scan of the lumbosacral spine was obtained with a
+2 mm slice thickness. Subsequently, the head was scanned with 1 mm slice thickness,
+pre- and post-contrast (Iomeprol with an iodine concentration of 300 mg/ml, dosage
+of 600 mg iodine/kg EV [Iomeron 300; Bracco]). In the precontrast CT examination,
+the right cranial articular process of S1 was hypertrophic, with severe impingement
+on the right L7–S1 foramen . The left L7–S1 foramen was also mildly stenotic due to mild bony
+hypertrophy of the left caudal articular process of L7 . Ventral spondylosis between L6 and
+L7 without involvement of the L6–L7 foramina was also detected. Post-contrast CT
+examination showed an enlarged pituitary gland (4 mm in height, 4.5 mm in width,
+4 mm in length) with a mild suprasellar extension . Hypertrophic ethmoidal turbinates
+and left fluid-filled tympanic bulla indicating otitis media were other
+findings.
+In order to better characterise the peripheral neuropathy, electrodiagnostic tests
+were performed. Electromyography showed mild spontaneous pathological activity of
+the appendicular muscles innervated by the right sciatic nerve. Motor nerve
+conduction studies (MNCS) and sensory nerve conduction studies (SNCS) of both
+sciatic tibial nerves and of the right ulnar nerve were within normal limits.
+Minimum F waves latencies and F ratio were severely increased in the right tibial
+nerve. Onset latency of cord dorsum potential obtained by stimulating the tibial
+nerve was increased in both pelvic limbs, and more severely in the right one.
+Electrodiagnostic findings were indicative of a lesion of the proximal portion of
+both sciatic nerves or their roots, which was more severe on the right side .
+The final diagnosis was acromegaly and entrapment neuropathy of the sciatic nerve as
+a consequence of lumbosacral/foraminal stenosis due to bone hypertrophy. Medical
+treatment for acromegaly using cabergoline was suggested, but the owner declined it.
+Surgical treatment of the foraminal stenosis was discussed, but a medical approach
+was preferred owing to the age of the cat. As a result, treatment was aimed to
+control and prevent neuropathic pain (gabapentin 10 mg/kg q12h) and re-checks were
+arranged every 3 months to evaluate neurological condition and glycaemic control.
+The clinical condition slightly improved in the first weeks of treatment. Sixteen
+months after the first presentation, the cat was still euglycaemic and neurological
+signs were stable. Serum IGF-1 concentration was re-evaluated at the time and was
+still over the detection limit of the assay.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_705_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_705_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e1fc9fc224953724cbe27f96d403646ed54eaefb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_705_en.txt
@@ -0,0 +1,12 @@
+A 52-year-old Chinese man presented with thrombus formation in the left hepatic vein and suprahepatic IVC 2 months after treatment of hepatic metastases by MWA.
+In April 2020, the patient received a diagnosis of rectal adenocarcinoma. Magnetic resonance imaging (MRI) showed that the lesion was located in the lower part of the rectum, and there was no lateral lymph node metastasis in the pelvis . CT showed no metastatic lesions in the liver . The preoperative clinical stage was cT3N + M0. Preoperative neoadjuvant therapy was recommended, but the patient refused for economic reasons.
+Laparoscope-assisted abdominal resection of rectal cancer (the Dixon procedure) was performed on April 14, 2020. Postoperative pathologic examination showed stage IIIA (pT4aN1cM0), moderately differentiated, KRAS-mutated (exon 4) adenocarcinoma with nodal involvement (0/13) and cancerous node formation in the rectal mesentery. The circumferential resection margin (CRM) was negative. Immunohistochemical markers were as follows: HER-2 (-), MSH2 (+), MSH6 (+), MLH1 (+), and PMS2 (+).
+Between May and October 2020, the patient began adjuvant chemotherapy after surgery, receiving oxaliplatin and capecitabine (the CAPEOX regimen) for eight cycles. The patient refused postoperative radiotherapy due to economic reasons.
+In January 2022, MRI revealed a single metastatic lesion (2.5 cm) in segment IV(S4) of the liver, with no lesions in the lung or pelvis . Between February 2022 and May 2022, a regimen of FOLFIRI plus bevacizumab was applied for 6 cycles. In April 2022, MRI showed that the metastatic lesion measured 1.9 cm . In June 2022, MRI showed that the lesion (1.3 cm) in S4 of the liver was significantly reduced, and no new metastatic lesions were detected .
+On June 27, 2022, after providing informed consent, the patient underwent ultrasound-guided MWA of the lesion. Intraoperatively, a medium-sized nodule of approximately 18 × 9 mm with poorly defined borders and uneven internal echogenicity was observed in S4 on ultrasound. A total of 2.0 mL of microbubble contrast agent was injected via the antecubital vein, and the lesion began to show enhancement at 24 s, began to fade at 45 s, and was completely cleared of the contrast agent after a delay period .
+The hepatic mass in S4 was selected as the target for ablation under general anesthesia . Ultrasound-guided subdiaphragmatic artificial ascites placement was performed with a continuous saline drip to separate the diaphragm from the intestinal canal. The needle was then guided by ultrasound to the upper left posterior of the tumor in the lower right anterior abdomen. Subsequently, the ablation button was pressed. The ablation zone covering the tumor was not enhanced and was approximately 50 mm×25 mm in size.
+After the treatment, the patient was in good general condition, with no nausea or vomiting, no dyspnea, no lower limb edema, normal eating and sleeping habits, and normal stool and urine.He had no history of hypertension, diabetes or heart disease and had no family history of cancer.His supraclavicular lymph nodes were not palpable, the abdominal incision was well healed, no abnormal masses were palpated in the abdomen, the rectal anastomosis was well healed, and the mucosa of the rectal wall was smooth.
+Laboratory studies (reference ranges in parentheses) revealed the following. White blood cell count: 6000k/µL (4800–10,800k/µL), neutrophil count: 5400k/µL (2400–7200k/µL), platelet count: 196,000/µL (164,000-446,000/µL), total protein: 61 g/L (60–80 g/L), albumin: 42 g/L(40–55 g/L), hemoglobin: 13 g/dL (12–16 g/dL), C-reactive protein: 4.23 mg/L (< 6 mg/L), erythrocyte sedimentation rate: 5 mm/hr (< 20 mm/hr), D-dimer: 0.24 µg/mL (< 0.5 µg/mL), protein C: 106% (64–147%), protein S: 86% (78–124%), antithrombin III:90%(80-120%), anti-phospholipid antibodies: negative (negative), homocysteine: 11.5 µmol/L (< 15 µmol/L), and normal liver and kidney function tests.
+The patient had no history of PTE or venous thromboembolism (VTE) and had no family history of thrombosis. According to the risk stratification method based on the Caprini score, the patient’s score of 3 corresponded to an intermediate risk of thrombosis. Considering the patient’s previous experience with bevacizumab and MWA therapy, early exercise and icosapent ethyl (IPE) were commended as antithrombotic prophylaxis.
+On July 29, 2022, MRI showed an S4 microwave ablation zone, left hepatic vein visualization, and no obvious thrombus in the suprahepatic IVC . On August 26, 2022, MRI revealed an S4 microwave ablation zone, thrombosis of the left hepatic vein and IVC, and extension of the head of the thrombus into the right atrium .Factor V Leiden and PT20210 genetic mutation tests were recommended, but the patient refused for economic reasons.
+The patient was placed on bed rest and given anticoagulation therapy for two weeks (enoxaparin, 40 mg every 12 h). His blood count and coagulation function were closely followed. On September 12, 2022, MRI showed that the left hepatic vein and IVC venous thrombi had essentially disappeared . The patient continued to be treated with rivaroxaban (20 mg once a day) for three months and was in good general condition with no particular discomfort.No widespread metastasis or local progression was found in the latest follow-up .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_716_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_716_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eeaf5b55df4e8d9cab228161675a355858a87a45
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_716_en.txt
@@ -0,0 +1 @@
+A 49-y-old man admitted to an emergency department in 21 December 2005, with the complaint of drowsiness and quadriparesia. On admission, the patient was afebrile and had a blood pressure of 200/110 mmHg, pulse rate of 95/min and, a body mass index of 32 kg/m2. On physical examination, he had facial plethora, central obesity, pitting edema of limbs, without evidence of purple striae or hyperpigmentation. On neurologic examination, cranial nerves function was intact, proximal and distal force were 3/5, and tendon reflexes were diminished. Other examination was unremarkable. His problem was started a year ago with weight gain (4 kg), fatigue, proximal muscle weakness, easy bruising and hypertension. He didn’t complaint paroxysmal hypertension, headache, palpitation, or sweating. He had been smoker of 20 pack/y for almost 30 years, with no previous medical or surgical history, and no family history for endocrine disease. Initial work up on admission revealed marked hypokalemia (2.1 mEq/L), metabolic alkalosis (pH: 7.58, HCO3:57.2 mEq/L) and blood glucose of 330 mg/dL. Electrocardiogram showed long QT interval (0.52 s), inverted T wave, and prominent U wave in precordial leads. The patient admitted in coronary care unit. According to high suspicious of CS, 24-h urine for urinary free cortisol (UFC) was collected. Laboratory data revealed UFC greater than 1000 μg/24 h (reference value: 50–149 μg/24 h), serum ACTH 257 pg/mL at 8 AM (reference value: 9–46 pg/mL), and morning serum cortisol 57 μg/dL (reference value:5.5–26.1 μg/dL) . Following 8 mg oral administration of dexamethasone at 11 PM, no suppression was found at morning serum cortisol level (67 μg/dL). Considering ACTH-dependent CS, dynamic pituitary magnetic resonance imaging (MRI) was done that did not show pituitary adenoma; spiral chest and abdominopelvic computed topographies (CT) were unremarkable, except of the significant enlargement of bilateral adrenal glands. Treatment with ketoconazole, 200 mg every 12 h, was initiated to control hypercortisolism. According to persistent hypokalemia despite excess potassium supplement (> 120 mEq/day) 2 days after starting ketoconazole, the patient was scheduled for bilateral trans-abdominal open adrenalectomy on 28 December 2005. The weights and sizes of excised right and left adrenal glands were 18 g, 6× 3× 0.8 cm and 20 g, 6× 3.5× 1 cm, respectively. Microscopic examination revealed diffuse adrenocortical hyperplasia. Three days after surgery, 24-h UFC, morning serum cortisol and ACTH levels decreased to 27 μg/24-h, 2.2 μg/dL, 44 pg/mL, respectively, furthermore blood pressure and serum potassium and glucose levels were normalized. The patient was discharged on daily dose of 5 mg prednisolone and 0.1 mg fludrocortisone. All signs and symptoms of CS were resolved gradually during 4 months, and 24-h UFC was consistently less than 4 μg/24-h. He remained asymptomatic and during annual laboratory follow-ups results of serum ACTH and UFC were unremarkable, i.e. ACTH < 50 pg/mL, UFC < 4 μg/24-h. In November 2016, serum ACTH began to rise, and in November 2017 reached to 341 pg/mL . Reassessment for ectopic ACTH producing NET was performed using spiral neck, chest, and abdominopelvic CT-scans. A 2 cm mass in the middle lobe of the right lung was found and dynamic contrast enhanced pituitary MRI and Technetium-99 m-octerotide scan were normal . A CT-guided biopsy from the lung mass showed a tumor composed of solid nests of small monotonous cells with no atypia or mitotic activity, suggesting an ACTH-producing carcinoid tumor. Histologic examination of the resected right middle lobe revealed carcinoid tumor without involvement of hilar, subcarinal and intralobar lymph nodes. Immunohistochemical (IHC) staining showed diffuse positivity for chromogranin, synaptofysine, and ACTH ; the proliferation marker of Ki-67 was positive in 1% of the neoplastic cells, with the final diagnosis of ACTH-producing carcinoid tumor. Postoperative course was uneventful, and serum ACTH level decreased to less than 100 pg/mL. Approximately 7 months later, serum ACTH level had an upward trend to 171 pg/mL . Spiral chest CT scan revealed at least 2 nodules measuring up to 5 mm in the lower lobe of the right lung. There were also suspicious lytic bone lesions in thoraco-abdominal CT. Subsequently, whole body bone scan with TC99 was performed suggesting multiple metastatic bone lesions at clavicles, ribs, iliac, temporal and parietal bones . CT-guided left iliac wing biopsy revealed thick sclerotic osteoid tissue, without neoplastic involvement, IHC staining for cytokeratin and chromogranin were negative, although serum chromogranin level was reported 2062 ng/mL (reference value: < 100 ng/mL). Hence, according to the high level of the chromogranin, as well as the presence of nodular lesions in the lung, the patient was managed as a metastatic NET, treatment with bisphosphonate and somatostatin receptor analogous was started.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_723_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_723_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f2196080bb97adf489785872823922c9c36905e4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_723_en.txt
@@ -0,0 +1,5 @@
+We report the case of a 2 years and-5-month-old boy admitted in our clinic for fever with the onset 3 days before admission associating abdominal pain and diarrhea within the last 24 hours. The anamnesis did not reveal any possible exposure to COVID-19 infections or other chronic underlying pathologies.
+The clinical exam at the time of admission revealed influenced general status, bilateral palpebral edema and conjunctivitis, mucocutaneous signs of dehydration, abdominal tenderness at palpation. The patient weighed 15 kilograms.
+The laboratory test performed on the day of admission pointed out lymphopenia (1560/mm3), thrombocytopenia (108x103/mm3), anemia (hemoglobin – Hb 10.9 g/dL), elevated C-reactive protein – CRP (162 mg/L), erythrocyte sedimentation rate (50 mm/h) and ferritin levels (389.3 ng/mL), hyponatremia (132 mmol/ L), hypopotassemia (3.94 mmol/L), hypertriglyceridemia (476.3 mg/dL), elevated D-dimer (>5 μg/ml), increased troponin (16.6 ng/L) and NT-proBNP (19,831 pg/ml). The rapid urine exam was negative. The chest X-ray, abdominal ultrasound and echocardiography showed no pathological findings. The blood and urine culture were negative. Corroborating the previously mentioned findings we raised the suspicion of pediatric inflammatory multisystem syndrome possibly associated to COVID-19. We performed a RT-PCR test for SARS-CoV-2 infection, but it was negative. Nevertheless, the serology (IgG anti-SARS-CoV-2) for this infection was positive. Thus, established the diagnosis of PIMS-TS.
+We initiated intravenous immunoglobulin in a dose of 2 g/kg/day associated with empirical antibiotic (ceftriaxone), anticoagulation therapy (low-molecular weight heparin) and symptomatic drugs (antipyretics, antiemetics, and antidiarrheics). In spite of this therapeutic approach, the fever persisted for the following 36 hours with no clinical improvement. Moreover, the laboratory test performed on the 3rd day of admission showed an increase of the CRP value (216.65 mg/L), and the persistence of elevated NT-proBNP (9,884.2 pg/mL) and D-dimer (1,198 ng/mL), associating also hypoalbuminemia (2.45 g/dL). Therefore, we initiated intravenous methylprednisolone (10 mg/kg/day) for 3 days followed by slow tapering and substitutive treatment with human albumin. We also repeated the echocardiography and we found minimal pericardial effusion, slight dilation of the left cavities (left ventricle - LV z score: 1.6, LV sphericity index: 1.66), regional wall motion abnormalities with dyskinesia of the inferior and infero-septal basal segments of the LV. Moreover, the LV systolic dysfunction was affected, with LV ejection fraction of 40%, with mild mitral regurgitation ; but no coronary impairment. Thus, following pediatric cardiologist’s recommendation, we associated angiotensin converting enzyme inhibitors (Lisinopril), Spironolactone and Hydrochlorothiazide. The serial echocardiography performed during the following days of admission revealed the resorption of the pericardial effusion, with improvement of LV function, correlated with decreased serum levels of NT-proBNP (123.1 pg/mL) and troponin (5.2 pg/mL).
+The patient was discharged on the 11th day of admission without any complaints and most of the laboratory parameters within normal ranges, except of D-dimer. We recommended the continuation of anticoagulant therapy for another week, as well as Lisinopril, Spironolactone and Hydrochlorothiazide for the following 2 weeks.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_724_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_724_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..64082b20c189e6b95b3e3b17b71549c74fbe090c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_724_en.txt
@@ -0,0 +1 @@
+A 60-year-old male patient diagnosed with non-ischemic dilated cardiomyopathy with reduced LVEF and LBBB was referred to our clinic for progressive exertional dyspnea and fatigue symptoms developed over the previous two years. The patient was in functional NYHA class II despite maximally tolerated doses of angiotensin receptor-neprilysin inhibitors, beta-blockers, mineralocorticoid receptor antagonists, and sodium-glucose cotransporter-2 inhibitors for the past six months. The presenting ECG showed sinus rhythm with an LBBB morphology and a QRS duration of 160 ms . Echocardiography revealed an enlarged left ventricle (LV) with an ejection fraction of 26%, normal wall thickness, overt signs of intraventricular dyssynchrony (apical rocking and septal flash), moderate mitral regurgitation, biatrial enlargement, and non-dilated right ventricle. The lab results were unremarkable. Given the clinical, electrocardiographic, and echocardiographic findings, the patient had a class I recommendation for CRT. Our laboratory has adopted CSP as the first option for patients with CRT indications for the past two years. For this case with potentially difficult anatomy (dilated LV and atria possibly displacing and modifying the trajectory of the conduction system), we decided to perform the procedure guided by a 3D mapping system, the Ensite Precision system (Abbott Cardiovascular, Plymouth, MN, USA), to reduce the X-ray exposure. After obtaining two separate entry sites in the axillary vein, a conventional atrial lead was placed at the right ventricular apex and connected to the 3D system to serve as a reference and backup pacing. Using the other axillary route, a deflectable decapolar EP catheter was used to create the anatomy of the right atrium, the coronary sinus, and the basal part of the right ventricle. After delineating the tricuspid valve, we thoroughly mapped and tagged the His bundle (HB) cloud from proximal to distal (a). With the map completed, the EP catheter was withdrawn, and a deflectable Medtronic C304 His catheter (Medtronic Inc., Minneapolis, MN, USA) with a Medtronic SelectSecure 3830 lead (Medtronic Inc., Minneapolis, MN, USA) inside was introduced. The lead was connected in a unipolar fashion to the 3D system so that the tip of the lead would be visible on the map (a). The catheter was placed at the distal part of the HB cloud (b), where repeated pacing showed complete correction of the LBBB, but unfortunately, at unacceptably high thresholds (3 V at 1ms pulse duration) (c). In the next step, a point was marked on the 3D map at 1.5 cm from the distal His location towards the right ventricular apex (d). The catheter was placed at that spot, and the lead was screwed deep into the septum under minimal fluoroscopic guidance until fixation beats with right bundle branch block morphology were observed (a,b). Pacing at that site revealed a narrow QRS complex with a QR morphology in lead V1, a duration of 125 ms, and an LVAT of 70 ms (c). Differential pacing with two extra stimuli showed an evident change in the morphology of the premature complex, proving the initial capture of more than one structure and, implicitly, the LBB capture (d). The catheter was retracted and slit, followed by atrial lead placement in the right atrial appendage under fluoroscopy. The procedural pacing threshold was 0.75 V at 0.4 ms pulse duration with a detection of 12 mV and a fluoroscopy time of 2 min. The total procedural time was 120 min, with 17 min dedicated to 3D mapping. The final electrocardiography showed atrial synchronized, narrow-paced QRS complexes with different degrees of fusion . There were no periprocedural complications, and the patient was discharged uneventfully the next day. The pacing and sensing thresholds were stable over the follow-up period. The 3-month echocardiography follow-up revealed a significant increase in LVEF (from 26% to 43%) and a decrease in left ventricular volumes (the end-systolic volume decreased from 174 mL to 132 mL). The patient also had a substantial clinical improvement with no heart failure symptoms during normal daily activities.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_805_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_805_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b1922f56ccee769586aa24c30d9120501be5b425
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_805_en.txt
@@ -0,0 +1,11 @@
+A 69-year-old Chinese woman with a 6-month history of remittent fever, chilling, jaundice, myalgia, fatigue, and mild headache without abdominal pain was referred to our department. The patient had undergone a BillrothII subtotal gastrectomy for the duodenal ulcer with stenosis 14 years before and cholecystectomy, T-tube choledochostomy and choledochoduodenostomy due to CBD inflammatory stenosis 10 years before. There was no tenderness in her abdomen during admission.
+Blood investigations showed marked impaired liver function of TBIL 19.5 umol/L, ALT 102 U/L and AST 214 U/L. Markers of inflammation were shown to be elevated in patients, such as WBC 15.38 × 10^9/L, NEU% 88.3, procalcitonin (PCT) 4.40 ng/ml (range, 0–0.05). CA19–9 was elevated at 56.52 U/ml (range, 0–27). Ultrasonographic examination of the biliary tract showed choledocholithiasis (4.4 cm × 2.0 cm) with dilatation of intrahepatic and extrahepatic bile duct . Of note, the outer layer of the stone was hyperechoic while the inner layer was hypoechoic. The strange phenomenon suggested that calculi may be made of two components at least. Then the patient underwent the upper abdominal enhanced computed tomography (CT), and the results revealed the muddy stone in intrahepatic bile duct with dilatation and pneumatosis and showed post-subtotal gastrectomy feature. However, the most critical finding which CT revealed was a strip of hyperdense inside the CBD, which was 4.0*2.5 cm with CT values about 57HU . It was worth mentioning that the patient didn’t have any past medical history about stents implantation. We diagnosed choledocholithiasis with acute obstructive cholangitis initially. However, we still didn’t know the essence of the hyperdense hidden in the bile duct.
+To prevent the patient from getting worse, we recommended ERC or PTC or surgery as a choice to the patient and her family. As the success ratio of ERC or PTC was decreased due to the large size of the choledocholithiasis and the surgery history, which increased the difficulty of ERC and PTC, the patients and her family chose to perform the surgery. Under general anesthesia, laparoscopic common bile duct exploration (LCBDE) was performed on June 19, 2017. The gallbladder had been removed before, and postoperative adhesion of abdominal cavity was severe. After removed the adhesion, the dilated CBD with a diameter of 2.5 cm was revealed. A small incision was made into the CBD on the upper margin of the duodenum. Intraoperative choledochoscope revealed the massive sandy stone in the CBD.
+What’s more, a considerable stone about 4.0 cm × 2.0 cm with irregular shape adhered severely to the adjacent structures. The stone was extracted with a retrieval balloon and basket catheter. When we checked out the calculi removed from the bile duct, unexpectedly the stone was broken down, and we found a fishbone inside. The mass with a strip of hyperdense revealed by CT scan was a fishbone, which migrated into the CBD . The patient was uneventful when discharged on the eighth postoperative day, and without recurrence until 21 months after the operation (Additional file ).
+We reported an unusual case of fishbone-induced choledocholithiasis. In this case, the patient’s Oddi sphincter had lost function due to choledochoduodenostomy before, and the fishbone was able to pass through the choledochoduodenal anastomosis and migrate into the CBD. The fishbone acted as a core to form a mixed stone, with cholesterol as its main component ultimately.
+It was secluded that the foreign body was hidden in the bile duct. These clinical manifestations always presented a diagnostic dilemma. This case’s only diagnostic clue was linear and sharp calcification within the mass. However, it was hard to connect the linear calcification to the accidentally ingested fishbone because the CBD was isolated from the digestive tract in principle. Thus, identification and removal of the fishbone as soon as possible are essential.
+On the other hand, the hidden foreign body in the CBD is rare and can lead to complications which include foreign body related biliary stones. Most cases have been reported as case reports. This study reviews cases of foreign body migration reported in the literature. Method searches and reviews of the literature from “PubMed” search engines using the keywords “foreign body case” and “bile duct” were carried out. Three hundred ninety-seven papers were identified, but details for only 144 cases were available for the present study [–]. We specified a protocol for the inclusion of the literature. First of all, the foreign body doesn’t belong to the human body or isn’t a parasite. Secondly, foreign body causes diseases with abnormal migration. Thirdly, the foreign body was hidden in the CBD.
+The median age at diagnosed as stones caused by foreign body was 62 years old (range 5 to 91 years). The senior people (range 41 to 80 years) were too fragile to prevent the foreign body from migrating. There was no statistical significance between the genders (the male made up 47.92% versus female 51.39%).
+Details of the clinical presentations and past medical history were depicted in Table . The most common clinical presentations were abdominal pain, fever/chills, and jaundice . Most of these patients had suffered cholecystectomy, and ERCP, followed by bullet injury or shrapnel wounds in third place before the foreign body induced choledocholithiasis .
+There are different kinds of foreign bodies . The postoperative complications were the most common cause. The surgical clips (49 accounts for 34.0%), stents (14 accounts for 9.7%) and the fragment of the T-tube (12 accounts for 8.3%) were the most CBD foreign body. There was another kind of foreign body that would pass through the human digestive tract and migrated to the CBD, which included the phytobezoar (9 accounts for 6.3%), fishbone (6 accounts for 4.2%), metal pin (3 accounts for 2.1%), chicken bone (2 accounts for 1.4%)and toothpick (1 accounts for 0.7%). The third significant categories included the debris of bullet or shrapnel (18 accounts for 12.5%).
+To choose the best way to remove the foreign body from the CBD, we selected the valid data about the treatment and follow-up. After we made a non-parametric test to compare the outcome about ERCP, surgery and conservative treatment, the Jonckheere-Terpstra test found a significant statistical difference(P = 0.044) and indicated the ERCP was the best way to extract the foreign body while the surgery was chasing closely behind . Only a relatively small proportion of people used the methods of conservative treatment [–], PTC [–] and ESWL . The vast majority of victims (92 accounts for 63.89%) recovered uneventfully and were perfectly well at the follow-up clinical examination, but for others the CBD foreign body migration was an omen of misfortune and disaster, it pushed through victims with long-term problems or complications, such as pancreatitis , recurrence of cholesterol stones [, ], bile leak [, , ], subhepatic abscess , even death [, ].
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_827_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_827_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ccdd998cc57483a1fa02fb76ece54173138c4060
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_827_en.txt
@@ -0,0 +1,2 @@
+A 55-year-old male farmer with a history of trauma to the left eye with vegetative matter presented at the ophthalmology clinic with complaints of diminution of vision, redness, photophobia, and black discoloration of his left eye. The visual acuity in the right eye was 6/6, while vision in the affected eye was restricted to the perception of light.
+Slit lamp biomicroscopy revealed conjunctival congestion, a central pigmented corneal ulcer, and hypopyon. There were no other predisposing factors such as diabetes or other immunocompromised states. The central ulcer measured 6.5 x 5.5 mm, and showed a pigmented, elevated brownish-black plaque measuring 4 x 4 mm, with surrounding infiltrates. The ulcer appeared dry, with the presence of immobile hypopyon [Figures 1(a) and (b)]. The right eye presented with a clear cornea, early cataract, and a normal fundus. The plaque was scraped off and used to inoculate culture media. Due to the typical appearance of the ulcer (dry, pigmented plaque), we initiated hourly topical antifungal natamycin 5% treatment along with two-hourly topical moxifloxacin 0.5%, and cycloplegic and lubricating eyedrops. The culture revealed growth of the Bipolaris species. Lactophenol cotton blue staining showed acute-angled septate hyphae with boat-shaped conidia [Figure 2]. The hypopyon remained refractory to treatment after which amphotericin B (5 μg/mL) was injected intracamerally. The infiltrates became organized and the hypopyon disappeared. The lesion healed completely with central scarring and vascularization [Figure 3]. The final visual acuity was finger counting close to the face with accurate projection of light.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_830_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_830_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..71d7992a8ae638b7ead795479e30cc618e52f271
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_830_en.txt
@@ -0,0 +1,3 @@
+The reported patient was a 33-year-old man complaining of decreased urine volume, urine color change, and lower abdominal pain. He was admitted to the emergency department of a general university hospital in one of the northern cities of Iran in winter, 2016. After preliminary examinations, he was transferred to the department of nephrology for dialysis and other treatments because of high levels of urea and creatinine as well as ARF. Because of a history of drug dependence, a request for psychiatric consultation was submitted to psychiatric service department of the hospital. During clinical diagnostic interviews, the patient was determined as suffering from substance-related disorder and borderline personality disorder on the basis of the Axes I and II dimensions, respectively, of the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5).
+He had a history of hospitalization for methamphetamine rehabilitation, after which the patient turned to methadone, tramadol, and opium. To prevent the weight loss caused by these drugs, he arbitrarily used oxymetholone for two months. The patient was observed for the onset of urinary symptoms for four days prior to admission. The first laboratory findings for ARF included a urea level of 238 mg/dL and a creatinine level of 11 mg/dL. Muscle injury and rhabdomyolysis were confirmed through the analysis of experimental data (myoglobinuria, CPK: 10726 IU/L and LDH: 4383 U/L). Concentrations of electrolytes, such as potassium and sodium (Na: 130 mEq/L and K: 4.9 mEq/L), and serum levels of liver enzymes (alanine transaminase and aspartate transaminase) and coagulation factors were normal. Liver and kidney ultrasonography was performed shortly after hospitalization.
+Liver size and echogenicity were normal. The right kidney was 136 mm in size, with a cortical echo and increased corticomedullary differentiation. A small amount of perinephric fluid was evident around the kidney. The left kidney was 102 mm in size, with a normal paranshyal echo and reduced focal thickness. Based upon physical examination of the patient, the heart, lungs, and nervous system showed normal functioning. After diagnostic confirmation, the primary therapeutic purpose was to prevent ARF risk factors, including the reduction of fluid volume, the blocking of tubules, release of free radicals, and aciduria. The patient underwent seven rounds of hemodialysis and hydration. Eight days after the first day of hospitalization, his CPK and LDH levels declined rapidly (CPK: 365 IU/L and LDH: 855 U/L). When ARF was settled and the values were normal, the patient was discharged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_853_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_853_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..61f591f919318857369c55828fca670fa7fae73f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_853_en.txt
@@ -0,0 +1,7 @@
+A 24-year-old man was transferred to our department with the complaint of dyspnea for 5 d after burnt lime aspiration after an accidental high fall.
+The patient fell head down 5 d before admission from a height of 2 m into a truck of burnt lime and inhaled a large amount. He had severe dyspnea and was immediately admitted to a local hospital. Computed tomography (CT) showed a high-intensity mass in the right principle bronchus, and pneumomediastinum . Blood gas analysis demonstrated severe hypoxemia [partial pressure of oxygen (PaO2) 70 mmHg, fraction of inspired oxygen (FiO2) 50%]. Bronchoscopy and mechanical ventilation were carried out. Because of limited conditions, clearance of lime from the airway was not performed. The patient’s condition became more severe with additional symptoms such as disturbance of consciousness and fever (maximum 38.0°C). Follow-up CT at 1 d before admission showed a high-intensity mass in the right primary bronchus, right pulmonary atelectasis, right aeropleura, and pneumomediastinum. Blood gas analysis demonstrated severer hypoxemia (PaO2 48 mmHg, FiO2 100%). He then underwent closed drainage of the right thorax and was transferred to our department.
+The patient had no history of illness.
+The patient had no medical history.
+The patient had dysphoria and was delirious. His body temperature was 39.5°C, respiratory rate 35–40 breaths/min, blood pressure 130/65 mmHg, pulse oxygen saturation (SpO2) 60% (FiO2 100%), missed respiratory sound in the right lung, crude respiratory sound in the left lung, no visible injury of the body skin, and conjunctival suffusion.
+Blood gas analysis demonstrated severer hypoxemia (PaO2 48 mmHg, FiO2 100%).
+CT showed a high-intensity mass in the right principle bronchus and pneumomediastinum . Follow-up CT showed a high-intensity mass in the right primary bronchus, right pulmonary atelectasis, right aeropleura, and pneumomediastinum.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_870_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_870_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..77827447fa707705553f1e58b08f5d0aea5d3ee0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_870_en.txt
@@ -0,0 +1 @@
+The patient was a six-month-old female with a red patch on her back found more than 20 days after birth. Later, a gradually enlarged mass was found over the surrounding skin, which slowly increased in size as the child grew, measuring approximately 11 cm × 6 cm . No urinary dribbling, lower extremity deformity or scoliosis, anorectal malformation or sphincter dysfunction was observed. The infant was uncooperative for neurological examination and no signs of lower limb paresis or paralysis were found. Ultrasonography revealed an infantile hemangioma. Complete blood count showed white blood cell, red blood cell, hemoglobin, and platelet levels of 7.62 × 109/L, 3.98 × 1012/L, 112 g/L, and 436 × 109/L, respectively. On laboratory tests, no significant abnormality was found. A small portion of the tumor was taken for histopathological examination, and lipofibromatosis was suspected. Upon consulting at the pathology department of another hospital, fibrous hamartoma of infancy was suspected. The mass was subsequently excised completely under general anesthesia with preoperative blood preparation . A fusiform incision was made 0.5 cm along the outer edge of the tumor, after which, both sides of the incision were widely free to the outer edge and sutured layer by layer. On pathological examination, spindle cell tumor was confirmed. The tumor consisted of adipose tissue and fusiform fibroblasts, which tended to be lipofibromatosis (Observed under the microscope OLYMPUS CX31, Olympus Corporation, Japan; photographed by the software Oplenic Pro, Hangzhou Chroma Optronics CO., LTD, China). Immunohistochemistry results included the following: CD99 (focal +), smooth muscle actin (SMA) (-), ki67 (+5-15%), CD34 (++++) , CD31 (-), ERG (-), SOX10(-), S-100 (-) , BCL2 (-), P1H3 (+8%), P53 (-), Desmin (-) Myogenin (-), MyoD1 (-), and pan-TRK (-) (Observed under the microscope Pannoramic MIDI, 3DHISTECH Ltd, Hungary; photographed by the software Pannoramic Scanner, 3DHISTECH Ltd, Hungary). Genetic testing showed no positive mutations in exons 18, 19, 20, and 21 of the EGFR gene. The author detected the NTRK1 gene by FISH and found no fusion or rearrangement of the NTRK1 gene . (Observed under the microscope Pannoramic MIDI, 3DHISTECH Ltd, Hungary; photographed by the software Pannoramic Scanner, 3DHISTECH Ltd, Hungary).The patient was eventually diagnosed with lipofibromatosis. One year later, the patient was reassessed, and no signs of recurrence were found , with scarring of the incision remnants. The scar will be repaired after the child grows up, and follow-up is continuing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_882_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_882_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b3ff18c23aa2a2778351d22e9bf59bbbadb533c2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_882_en.txt
@@ -0,0 +1,2 @@
+An 11-year-old male patient who had an accidental fall in December 2018 with no other past medical history was seen in our hospital. Subsequent head and whole spinal cord MRI showed lesions in the fourth ventricle, suggesting a likelihood of medulloblastoma . On 2019-01-10, following general anesthesia, a cranial fossa craniotomy, cerebellar tumor resection, dural repair, and decompressive craniectomy were performed. After the surgical treatment and five cycles of temozolomide, the patient is stable. Postoperative pathology diagnosis was cerebellum medulloblastoma (WHO-IV). Immunohistochemistry showed Vimentin (−), CK (−), GFAP (−), S-100 (+/−), KI67 (30% +), P53 (−), CD99 (−), CD56 (+), SYN (+), and NSE (+) .
+The patient’s parents were concerned a second child might be affected. Therefore, genetic testing was done in which three mutations were detected, including a c.505A > G point mutation in the MSH2 gene (NM_000251 transcript), a c. 6139A > G point mutation in the MED12 gene (NM_005120 transcript) and a c.765_779del deletion mutation in the PHOX2B gene (NM_003924 transcript). The c.505A > G point mutation and the c.765_779del deletion were heterozygous mutations, while the c.6139A > G point mutation was a homozygous mutation. According to the ClinVar database, the c.505A > G point mutation in the MSH2 gene is a possible benign variation (Likely benign), the c.6139A > G point mutation in MED12 is of unknown clinical significance, and the c.765_779del deletion mutation of PHOX2B is Benign/Likely benign. Further familial genetic testing showed that the c.505A > G point mutation of MSH2 and the c.6139A > G point mutation of MED12 were inherited from his mother. Of note, the c.765_779del deletion mutation of PHOX2B was a de novo mutation . These germline mutations were confirmed by Sanger sequencing on samples obtained from patient’s peripheral blood, saliva, hair, and urine. We also conducted DNA paternity testing to confirm that the parents are the patient’s biological parents .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_889_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_889_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..78e715d2892b74efd569b7d86ef1668d5bb23a6c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_889_en.txt
@@ -0,0 +1,16 @@
+A 61-year-old male with a medical history of diabetes mellitus Type II, diabetic neuropathy, and hypertension presented to the emergency department with bilateral lower extremity and right upper extremity pain after a mechanical fall resulting in the right lower extremity deformity and inability to ambulate. He reported 2 years of progressive pain and weakness in the bilateral thighs necessitating walker use, and 1 year of intermittent night sweats and bilateral shoulder pain (right greater than left). He denied weight loss, change in appetite, bisphosphonate use, osteoporosis, or previous cancers.
+Radiographs demonstrated a displaced transverse right subtrochanteric femur fracture at a stress fracture-like lesion, left incomplete transverse subtrochanteric fracture, and a large lytic lesion involving the right humeral shaft .
+The patient’s history and multi-focal pathology were concerning for underlying malignancy. The course proceeded with biopsy and operative stabilization of his right femur. Definitive fixation of the left femur and right humerus was delayed until biopsy results and oncologic evaluation were obtained.
+A lateral approach to the right femur was utilized and a superficial vastus lateralis muscle specimen and a bone specimen from the fracture site and surrounding soft tissues were collected and sent for frozen section. These were reported as benign hematoma and cancellous bone, so additional biopsy of the intramedullary canal was performed with the Reamer/Irrigator/Aspirator [RIA]© (Depuy Synthes, West Chester, PA) before nailing and fixation with a long trochanteric-entry cephalomedullary nail.
+After initial procedure, the orthopedic oncology and hematology/oncology teams were consulted. Final pathology demonstrated simple marrow elements without evidence of malignancy. Given the lytic lesion in the right humerus, work-up included prostate specific antigen, serum/urine protein electrophoresis, parathyroid hormone-related protein, quantitative immunoglobulins, kappa/lambda light chains, carcinoembryonic antigen, and carbohydrate antigen 19–9. All markers were negative, but metabolic panel was notable for slightly low serum calcium at 7.7 mg/dL, elevated intact PTH at 114.2 PG/ML, and low phosphorus level at 1.1 mg/dl, suggesting paraneoplastic syndrome versus metabolic tumor (i.e., brown tumor of the parathyroid).
+The otolaryngology service was consulted and CT imaging demonstrated multiple rib and transverse process fractures but no primary tumor or lymphadenopathy. Positron emission tomography (PET) scan showed mild diffuse nonspecific metabolic activity. CT-guided biopsy of the 3.8 × 1.5 × 0.9 cm right humerus periosteal lesion revealed bland spindle cell proliferation suggesting mixed connective tissue PMT (Image 4). FGF-23 was not available at the institution, but somatostatin receptor 2A showed variable positivity supporting the diagnosis of PMT.
+Following biopsy, the team proceeded with definitive management of the left subtrochanteric femur fracture and open biopsy and curettage of the right humeral lesion on hospital day 14. The patient underwent placement of a long trochanteric-entry cephalomedullary nail for the incomplete left subtrochanteric femur fracture with opening reamer biopsy.
+The humerus lesion was then localized under fluoroscopic guidance and an anterolateral approach was used. Following dissection to the brachialis, the muscle was incised at the defect and multiple specimens were obtained. Frozen section pathology revealed spindle cell process with few atypical cells , but definitive diagnosis could not be made. During attempted curettage, the lesion was noted to be in contact with the radial nerve. Careful dissection from the nerve was performed and curettage and saucerization of the bone defect followed. The specimen was sent to pathology for definitive diagnosis and prophylactic nailing was deferred.
+Final diagnosis of benign mixed connective tissue PMT was made on hospital day 15 and prophylactic intramedullary nailing of the right humerus was performed on hospital day 16.
+Endocrinology was consulted following definitive surgical intervention. Phosphorous and Vitamin D supplementation were initiated, and an octreotide scan was performed to rule out additional foci of PMT. Quarterly endocrinology follow-up was scheduled.
+Medical and radiation oncology were consulted during hospitalization; however, no additional treatment was recommended before discharge to skilled nursing facility on hospital day 19.
+At the 3-, 6-, and 8-week post-operative appointments, the patient returned to the orthopedic trauma and oncology clinics noting improvement in pain and mobility. Radiographs were performed at orthopedic follow-up at 2–3-month intervals .
+Endocrinology continued to manage his persistent osteomalacia. Despite medical management, he developed delayed union of the bilateral femur fractures and multiple nonoperatively treated osteomalacia-induced fractures (fifth metatarsal fracture and bilateral ilium fractures).
+Due to insurance, the patient was unable to continue endocrinologic follow-up at 15 months postoperatively and discontinued vitamin supplementation. Eighteen months following initial presentation, he returned to orthopedic oncology with increased pain and swelling in the right thigh and humerus concerning for tumor recurrence. PET scan revealed increased metabolic activity in the right humerus. Given previous excision, the patient underwent radiation (4500 cGy) to the right humeral lesion with resolution of pain without further lucency or fracture.
+Despite radiotherapy and vitamin supplementation, the patient continued to report right thigh pain 2-year post-surgery. Laboratory evaluation revealed PTH of 118.4 pg/mL and calcium of 8.1 mg/dL. His failure to return to normal PTH (despite imaging indicating resolution of the PMT) was concerning for alternative cause of hyperparathyroidism. Further work-up and bone stimulator were initiated. Endocrinologic and otolaryngologic evaluations for primary hyperparathyroidism were negative. Vitamin D, phosphate, and alendronate therapies were initiated to improve bone density. Within 5 months, his PTH decreased to 97.5 pg/mL, calcium increased to 9.7 mg/dL, and his femur fracture had healed with complete resolution of pain.
+The patient continues to follow-up with the orthopedic oncology and orthopedic trauma service now 6-year post-surgical intervention without recurrence .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_907_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_907_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7c18236f7bf9978895e56a67aad1af0171da71ce
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_907_en.txt
@@ -0,0 +1,4 @@
+An 80-year-old man presented with a progressive decrease in hearing on the right side accompanied by dizziness and disturbance of balance 10 months prior to admission. The neurological examination revealed right hypoglossal nerve palsy. Audiometry documented complete sensorineural hearing loss on the right side.
+Skull x-ray and cranial computed tomography (CT) scans showed a large osteolytic lesion with bone destruction, including the temporal bone, occipital bone, clivus, jugular foramen, and hypoglossal canal . Magnetic resonance imaging (MRI) revealed an 8 × 7 cm homogeneous enhancing mass in the right posterior fossa related to the petrous part of the temporal bone, with extension to the cervical region . The cerebellum was displaced, and definite brain invasion was not seen. The preoperative diagnosis was a temporal bone origin malignancy such as squamous cell carcinoma or meningioma with invasion of the petrous bone.
+The patient underwent surgery to obtain a pathological diagnosis and for complete removal of the mass. A C-shaped postauricular skin incision was made that extended to the neck. The scalp was reflected anteriorly, and the mass infiltrating the subcutaneous tissue was exposed. The lesion appeared as a firm gray mass that had destroyed the temporal and occipital bones. The dura was intact with no invasion, and the lesion was easily peeled off. For the cervical part of the tumor, the major vessels were secured inferiorly, and the mass was removed up to the skull base. The tumor was removed entirely, except for a small portion around the jugular foramen to avoid lower cranial nerve injury. Finally, the large empty space was filled with a sternocleidomastoid muscle flap . There were no neurological deficits after surgery.
+Histopathological studies confirmed a WHO (World Health Organization) grade II atypical meningioma with up to 6 mitoses per 10 high-power fields . The Ki-67 proliferation index was 15%. The results of immunohistochemical staining are provided in Additional file : Figure S1.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_917_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_917_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e453ec617ab3ac85ec69c094ece91899de8f28cf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_917_en.txt
@@ -0,0 +1,3 @@
+A 65 year old woman was referred with the compression fracture of the first lumbar vertebrae (L1) due to falling down, two week ago. Her visual analogue pain score (VAS) was 8 out of 10 in lumbar region, and did not had paresthesia or limb weakness. CT and MRI showed acute wedge fracture of the first lumbar vertebrae which resulted in 30%–40% decrease of vertebral height (. In the physical examination, no nerve defect and intestine or urinary bladder dysfunction were seen. In straight leg raising test (SLR), no radiculopathy sign was seen. In palpation, first to forth lumbar vertebrae were painful. The patient had an acute heart diseases (33%) ejection fraction, heart’s enlargement, twice its standard size and pace maker. The patient was diabetic and had high blood pressure and pulmonary disease (COPD) (. The patient was taking 15 drugs daily (such as dilantin, losartan, spironolacton, furosemide, warfarin, digoxin, citalopram, serteralin, alprazolam, clonazepam, atrovastatin, aspirin, salmetrol, flixotide, and carvedilol). Laboratory tests were normal except coagulation time due to the intake of warfarin for cardiovascular problems and after correcting that she was a candidate for Kyphoplasty.
+After i.v. premedication (fentanyl 50 mcg and midazolam 1 mg), cefazolin 1 g and hydrocortisone 100 mg were injected. Under sterile condition, an anterior-posterior projection was obtained by fluoroscopy, so that the first lumbar and its pedicle were detected. Then, the fluoroscope was moved 10 degrees towards caudo-cephalic direction and 20 degrees oblique so that the pedicle was seen as a circular shape. The entrance of the needle was chosen in 1/4 outer-upper of the pedicle by Transpedicular approach. Local anesthesia was made by lidocaine 1%. A 5 mm skin incision was done. The trocar needle was introduced by fluoroscopic guidance in a tunnel view and the needle was advanced. After confirmation of the correct position of the needle in the several lateral and anteroposterior views in the vertebral body, the guide wire was placed inside of the needle, and the first trocar was replaced by No.11 trocar over the guide wire. After that, the guide wire was removed, and a drill was placed into the trocar. By drilling, a primary cavity was made in the vertebral body to provide for insertion of the balloon into the body. Then, the drill was removed, and the containing balloon with contrast media was placed into the cavity and was inflated up to 15 PSA (. The balloon was kept in this position for 5 minute restore the vertebral height. Then two filler needles were filled up by 2 ml of cement (Poly-Methylene-Methacrylate). The filler needle was replaced instead of the balloon, and 4 ml of cement was injected under the live fluoroscopy, in order to control the leakage of cement into the spinal cord and disc. The patient was kept in the same position for 15 minutes for cement stabilization. The patient was monitored in the recovery. After two hours, a CT scan was taken, and the vertebral body was correctly filled by cement and no evidence of leakage was obsereved (.
+After the procedure, the pain was decreased quickly and the pain score (VAS) was decreased to 1. The patient was discharged next day with overall good condition and without any neurological complications. During two next weeks, she was in a very good condition.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_922_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_922_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..87580286ebff3648e323d3660316b6474eba6962
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_922_en.txt
@@ -0,0 +1,16 @@
+A 48-year-old male patient presented to the emergency department with headache, dizziness, unstable gait, limb weakness, accentuation of eyelid ptosis, external ophthalmoplegia, and sinus tachycardia. The disease manifested in the patient at the age of 16, initially presenting with a small stature and symptoms related to the extraocular muscles. As the disease progressed, the patient experienced a gradual onset of additional clinical characteristics such as heart conduction issues, endocrine dysfunction, and a slight cognitive decline.
+The diagnosis of KSS was supported by identifying relevant clinical characteristics that indicated an abnormality in the patient's ophthalmologic system: bilateral ptosis, diplopia, chronic progressive external ophthalmoplegia, and a moderate decrease in visual acuity . Considering that the patient's ophthalmoplegia did not match a specific group of cranial nerve palsies (oculomotor nerve palsy, fourth nerve palsy, and sixth nerve palsy), the likelihood for myopathies was even higher. Paralysis of the vertical movements of the eyeballs was observed . No retinitis pigmentosa was discovered during the fundus examination performed by the ophthalmologist, but retinal angiosclerosis has been described.
+Following ophthalmologic observations, the neurological examination highlights mild generalized muscle weakness, cerebellar ataxia, cerebellar tremor, and a slight cognitive impairment (Mini-Mental State Examination score of 22 points).
+The patient had endocrinological symptoms and signs that preceded the neurological manifestations, including short stature (154 cm) caused by growth hormone insufficiency, delayed puberty, primary hypogonadism, hypothyroidism, secondary hyperparathyroidism, gynecomastia, frontal baldness, and brachydactily. The patient had no children.
+Cardiac involvement is common in disorders characterized by mitochondrial dysfunction due to their impact on organs that rely heavily on energy . Following the confirmation of the diagnosis, the patient underwent a series of medical tests, including 12-lead surface electrocardiography (ECG), transthoracic echocardiography, and 24-h Holter monitoring. Conduction abnormalities were seen, including first-degree atrioventricular block (AVB), significant right bundle branch block (RBBB), and sinus tachycardia . The echocardiogram revealed mild anterior mitral valve prolapses (MVP) and type I diastolic and systolic LV dysfunction (LVEF = 40%).
+Given the presence of many clinical features suggesting KSS in this patient, we conducted a comprehensive analysis of biochemical and genetic tests related to cardiovascular risk factors. The lab testing demonstrated WBC of 12,460/μl (NV 4,000–9,500/μl), hemoglobin of 17.9 g/dl (NV 13.6–17.2 g/dl), hematocrit of 53.6% (NV 39–51%), blood glucose of 101 mg/dl (NV 74–106 mg/dl), aspartate aminotransferase of 58 U/L (NV 15–37 U/L), alanine aminotransferase of 71 U/L (NV 30–65 U/L), lactic dehydrogenase of 356 U/L (NV 85–227 U/L), creatinine kinase of 308 U/L (NV 39–308 U/L), and creatinine kinase-MB of 42 U/L (NV 7–25 U/L). The serum ionogram revealed ionic calcium of 3.95 mg/dl (NV 4.2–5.2 mg/dl), magnesium of 2.2 mg/dl (NV 1.8–2.4 mg/dl), potassium of 5.5 mmol/L (NV 3.5–5.1 mmol/L), and sodium of 149 mmol/L (NV 136–145 mmol/L).
+Endocrinological analyses showed the following values: growth hormone (hGH) < 0.050 ng/ml (NV 0.4–10 ng/ml) and the thyroid hormone levels were FT3 of 3.35 pmol/L (NV 3.54–6.47 pmol/L), FT4 of 15.19 pmol/L (NV 11.48–22.70 pmol/L), TSH of 0, 150 mIU/ml (NV 0.55–4.78 mIU/ml), anti-TG of 24.6 U/ml (NV 0–60 U/ml), and anti-TPO of 31.9 U/ml (NV 0–60 U/ml). Intact PTH was 61.8 pg/ml (NV 7.5–53.5 pg/ml) with a low level of ionic calcium (3.95 mg/dl). Gonadotropic hormones were testosterone of 182.76 ng/dl (NV 241–827 ng/dl), FSH of 22.56 mIU/mL (NV 1.4–18.1 mIU/mL), and LH of 24.39 mIU/mL (NV 1.5–9.3 mIU/mL). Serum cortisol was normal (15.16 μg/dl). CSF indicated a high protein level of 91 mg/dl (NV 0.12–0.60 mg/dl) and a high glucose level of 131 mg/dl (NV 40–70 mg/dl) in the absence of white blood cells during a lumbar puncture procedure. For the differential diagnosis of myasthenia gravis, we tested anti-acetylcholine receptor antibodies, which were normal (AChR < 0.2 nmol/L).
+Performing next-generation sequencing (NGS) on mitochondrial DNA extracted from peripheral blood leukocyte samples is the primary diagnostic method for identifying deletions in situations where KSS is clinically suspected (, ). We requested the testing for sequence analysis of the MT-TL2 gene; this test was developed and its performance was validated by CENTOGENE AG (Rostock, Germany) for clinical purposes. The blood sample was processed by enriching targeted sequences, and sequencing was done using NGS Technologies.
+We did not detect any clear pathogenic variant in the MT-TL2 gene sequencing, including the variant m.12315G>A, which has been reported to be associated with KSS. However, it should be noted that the variants encoded in the mitochondrial genome may not be detected in blood if the percentage of heteroplasmy is low (typically < 15% heteroplasmy) . In this situation, it is recommended to test a sample from an affected tissue, but the patient did not agree to the muscle biopsy.
+Electromyography (EMG) showed a myogenic pathway with small amplitude and short-duration motor unit potentials with an early recruitment pattern (bilateral frontal and deltoid muscles). Electroencephalography (EEG) revealed a generalized theta background pattern; the lesion-type route was maintained even when activated by hyperventilation or intermittent light stimulation (6–12 Hz).
+Upon admission to our clinic, brain magnetic resonance imaging (MRI) was performed with and without contrast. The results revealed symmetrical high-T2 and Flair signals in the cerebral white matter of both temporal lobes and in the bilateral insula of the Reil lobes .
+The appearance of brain lesions did not change; the patient underwent several brain MRIs in the year in which he was supervised. Unusual high-T2 signals were identified in the white matter of the cerebellum. shows the presence of cerebellar atrophy.
+The patient was discharged in stable condition with the recommendation of cardiological monitoring. There is now no known remedy for this uncommon condition, and all available therapies only provide support. It was advised to undergo hormone replacement therapy and take Coenzyme Q10 (CoQ10). The patient presented at the emergency department 1 month later with a severe case of bilateral pulmonary embolism, accompanied by syncope at the onset, acute cardiorespiratory failure, proximal deep vein thrombosis in the left limb (the femoral-popliteal veins), and altered neurological status characterized by a depressed level of consciousness and extreme agitation. He received intubation and mechanical ventilation in the critical care unit.
+The patient's laboratory results showed WBC of 10,800/μl, hemoglobin of 16.1 g/dl, hematocrit of 48.6%, platelets of 263,000/μl, blood glucose of 128 mg/dl, aspartate aminotransferase of 6,570 U/L, alanine aminotransferase of 5,735 U/L, lactic dehydrogenase of 4,736 U/L, creatinine kinase of 535 U/L, creatinine kinase-MB of 48 U/L, cholinesterase of 14,428 U/L (NV 5,320–12,920 U/L), and lactic acid of 3.2 mmol/L (NV 0.5–2.2 mmol/L). Serum inflammatory workup showed elevated hsCRP of 71.98 mg/L (NV 0–10 mg/L) and fibrinogen of 599 mg/L (NV 200–393 mg/L). The hepatitis panel (AcHBs, aHCV, and HAV Ig M) was negative. The hormone levels were FT3 of 2.55 pmol/L, FT4 of 15.08 pmol/L, TSH of 1,003 mIU/ml, and anti-TPO of 45.3 U/L; FSH of 2.76 mIU/ml, LH of 3.70 mIU/ml, and testosterone of 66.80 ng/dl. Coagulation tests were prothrombin time of 16.0 s (NV 9.4–12.5 s), APTT of 74.1 s (NV 25.1–36.5 s), and INR of 1.43 (NV 0.80–1.07).
+Chest-computed tomography (chest-CT) revealed massive bilateral pulmonary embolism with multifocal infiltrates. The echocardiogram showed dilation of the right cardiac chambers and moderate secondary pulmonary hypertension. The venous Doppler ultrasonography of the lower extremities detected recent total thrombosis in the left femoral and popliteal veins. The patient was tested for inherited thrombophilia, obtaining the following genetic mutations: homozygous Factor V G1691A Leiden, MTHFR gene polymorphism C677T and A1298C, and PAI-1 675 homozygous genotype 5G/5G. The patient did not present a prothrombin G20210A mutation or protein C, protein S, or antithrombin deficiencies. In individuals with Kearns-Sayre syndrome, the presence of inherited thrombophilia, together with pre-existing cardiovascular disease, is indicative of a poor prognosis.
+Significant improvement was seen after 2 weeks, and the patient returned home in stable conditions on a novel treatment with an oral anticoagulant drug (Rivaroxaban 20 mg/day). At 6 months of follow-up, ECG-Holter monitoring and MRI brain images remain unchanged. After 3 months, the patient died suddenly while sleeping at home.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_926_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_926_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c2f7c8c270e7fce8a677acbe65a0573172e4e76d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_926_en.txt
@@ -0,0 +1,5 @@
+A 69-year-old Japanese woman was referred to our hospital with a chief complaint of abdominal discomfort. She had no history of smoking and was a social drinker. She also had a history of hyperlipidemia, depression, and uterine myoma. Body temperature was normal. Physical examination revealed no swelling of superficial lymph nodes. The patient had regular bowel movements with normal stools. She had no B symptoms, including fever, night sweats, or weight loss. Laboratory data were unremarkable: white blood cell (WBC) count, 5890/µL; hemoglobin, 13.2 g/dL; platelet count, 254,000/µL; and lactate dehydrogenase (LDH) level, 217 U/L. Tumor markers, including carcinoembryonic antigen and carbohydrate antigen 19-9, were within normal ranges. The serum soluble interleukin-2 receptor (sIL-2R) level was also within normal ranges.
+Abdominal ultrasonography revealed a well-circumscribed hypoechoic mass, contiguous with the proper muscle layer, approximately 70 mm in size, located at the middle stomach on the lesser curve . Contrast-enhanced CT of the abdomen demonstrated an extraluminal tumor with heterogeneous enhancement at the middle stomach on the lesser curve, accompanied with one swollen lymph node approximately 10 mm in size and several small lymph nodes in the perigastric region . These lymph nodes were flat; therefore, we considered them to be non-metastatic. No liver metastasis, peritoneal dissemination, pleural fluid, ascites, or splenomegaly was observed. Endoscopy indicated compression of the anterior wall of the gastric body along with normal mucosa . Several biopsy specimens were taken, which showed evidence of erosive hyperplastic gastritis. Endoscopic ultrasonography and endoscopic ultrasound-guided fine needle aspiration were not performed for the diagnosis because a SMT greater than 50 mm in size is an indication for surgery regardless of the preoperative definitive diagnosis .
+Surgical exploration of the abdomen revealed no evidence of ascites or metastasis to the liver or peritoneum. An extraluminal tumor arising from the middle body of the stomach on the lesser curve was noted. The tumor was removed via wedge resection. Soft and slightly swollen lymph nodes, which were compatible with the lymph nodes noted in the preoperative CT, were found near the main tumor in the fatty tissue at the lesser curvature of the stomach. An excisional biopsy of the largest lymph node, likely compatible with the swollen lymph node seen in the preoperative CT, was performed for the diagnosis. At this point, we believed these lymph nodes to represent reactive lymphadenopathy.
+The resected specimen was 80 × 60 × 50 mm in size. The tumor grew exophytically. The cut surface of the tumor revealed a well-circumscribed yellowish-white solid mass . Hematoxylin–eosin staining disclosed a bundle-like growth of the spindle-shaped tumor cells with acidophilic cytoplasm . These were composed predominantly of tumor cells arranged haphazardly (Antoni type B) and secondarily of tumor cells with nuclear palisading (Antoni type A). A peritumoral lymphoid cuff was recognized . The mitotic count was 0 to 1 per 50 high-power fields (HPFs). The tumor contained no necrosis and atypical mitosis was not identified. The resection margins were free of tumor cells. Immunohistochemical staining revealed that the tumor was negative for KIT, CD34, and desmin and positive for S-100 protein . The MIB-1 labeling index of the tumor cells was 1% to 2%. Hematoxylin–eosin staining of the lymph node showed nodular proliferation of atypical lymphoid cells composed predominantly of centrocytes with admixed scattered centroblasts . Immunohistochemical staining revealed that the lymph node was positive for bcl-2, CD20, and CD79a and negative for CD3 and CD30 . These histopathological and immunohistochemical findings were consistent with a gastric schwannoma and FL. The centroblasts were noted 2 to 3 per 50 HPFs; therefore, histological grading of FL was Grade 1 .
+The patient had an uneventful postoperative course and was discharged from our hospital on postoperative day 9. Postoperative positron emission tomography (PET) revealed no significant accumulation of 18F-fluorodeoxyglucose. Bone marrow aspiration indicated no bone marrow invasion of FL. The patient was diagnosed with a grading of stage I according to the Ann Arbor classification. The Groupe d’Etude des Lymphomes Folliculaires (GELF) criteria were applicable as low-tumor burden FL and the patient was asymptomatic; therefore, the watchful waiting approach was decided upon as follow-up . The patient is doing well without recurrence of either the gastric schwannoma or FL 28 months postsurgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_929_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_929_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fd07ec542b57a5b7ac01ded7cf7e58971d3a8bf9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_929_en.txt
@@ -0,0 +1,2 @@
+A 61-year-old male patient sought treatment for an infiltrating erythematous plaque on the nasal tip, which gradually enlarged with ulceration and haemorrhage over the prior 2 months. The patient developed a red papule on the nasal tip 2 months prior. The skin lesion gradually enlarged to the size of a broad bean. In the past 2 weeks, a plaque developed, with ulcerations and bleeding, and a black crust formed. The patient had a 40-year history of hepatitis B and had not received standardized antiviral therapy. Three years ago, a 2.0×1.5 cm space-occupying mass in the left lobe of the liver was found through a physical examination. Local surgical resection was performed. The patient was diagnosed with well-differentiated hepatocellular carcinoma and nodular cirrhosis based on postoperative histopathological and immunohistochemical examinations, and further treatment was not administered.
+The patient’s systemic examination showed no obvious abnormalities. A dermatological examination showed that no obvious yellow staining in the skin and mucous membranes of the whole body. A red infiltrating nodule was seen on the nasal tip, without peduncles, with a hard and tough texture; the nodule was raised, ulcerated, and covered with a black crust . No similar lesions were found on the skin of any other area of the body. The alpha-fetoprotein level in peripheral blood was 260 μg/L (normal level ≤ 25 μg/L). Whole-body computed tomography (CT) showed irregular liver margins, an enlarged left hepatic lobe, a slightly low-density mass in the left hepatic lobe, an enlarged spleen, and a widened portal vein , findings that were consistent with liver cirrhosis and liver cancer. No space-occupying lesion was observed in other organs. Skin biopsy was performed after local anaesthesia. Histopathology showed epidermal necrosis with ulceration, a dense tumour cell mass in the dermis, with a sinus-like, nodular and cord-like distribution, and some atypical tumour cells . Immunohistochemistry of intradermal tumour cells revealed the following: HepPar-1(+), Arg-1(+), CK8(+), Villin(+), CK7(-), CK20(-), and Ki-67 positive (approximately 90%) . Based on the clinical manifestations, medical history, imaging results, and histopathology results, the patient was diagnosed with cutaneous metastases of hepatocellular carcinoma. The patient gave up systemic treatment and subsequently lost the visit.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_959_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_959_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..45faceabf9371ff5da6fc9af6081d9c44ce63ecc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_959_en.txt
@@ -0,0 +1,7 @@
+We reported a case of a 46 years old woman admitted to our hospital because of prolonged recurrent vomiting in a severe state of malnutrition. A year before she had been submitted to duodenopancreatectomy because of a stenotic duodenal adenocarcinoma. Immediately, after hospital admission she underwent to a new explorative laparotomy because of worsening symptoms. In this second abdominal surgery she underwent to gastric enteric anastomosis because of sub-occlusion.
+Her ability to absorb substances was already compromised by the first operation. During the last year she did not received an adequate nutrition, moreover she had no vitamins supplement in her diet. After the second surgery she was fed by total parenteral nutrition with glucose solutions, amino-acids solutions and vitamins complex (Cernevit – Baxter@ spa, Roma, Italy) commonly administered to post-surgical patients containing 3,51 mg of thiamine.
+After five days from the gastric enteric anastomosis, she developed a Pseudomonas Aeruginosa’s severe sepsis with acute renal failure; so, she was transferred to our Intensive Care Unit (ICU). At ICU admission, she was agitated but she still had a normal Glasgow Coma Scale (GCS 15/15). Brain Computed Tomography (CT) scan control was negative and altered neurological status of the patient was imputed to the severe sepsis. Her blood tests showed leucopenia (1680/ml) and thrombocytopenia (34000/μl).
+We performed an electroencephalogram (EEG) control that evidenced slow diffused anomalies, without paroxysms or focal signs. During the night she was sedated with benzodiazepines and intubated because of respiratory worsening.
+The following day, at the neurological examination she was drowsy, she had no response to pain stimuli, no oculocephalic reflex, limbs areflexia and negative Babinski reflex. A new EEG control pointed out a diffused cerebral suffering state. Simultaneously her renal and liver function got worse due to the evolution of the septic state. Her feeding was still composed by glucose solutions, vitamins (Cernevit – Baxter@ spa, Roma, Italy) and amino acid intravenously administered. Then, we decided to perform a new brain CT scan with contrast in order to diagnose the cause of the worsening. This CT scan was performed at day 7 after surgery. The report of the CT scan showed a faded hyperdensity of the mammillary bodies and symmetrical hemorrhagic lesions in the quadrigeminal plate . The report suggested the need of a further diagnostic study with MRI because of the suspicion of a possible metabolic encephalopathy compatible with WE complicated by petechial hemorrhages.After the CT scan, we introduced thiamine 100 mg intravenously once a day, as supplement to the usual feeding. At the following neurological examination her GCS was 7/15, she did not open her eyes, did not emit verbal responses and localized with the right arm to painful stimuli. So 2 days later, we performed a brain magnetic resonance imaging (MRI). The MRI confirmed the lesions described in the CT scan and also added some elements compatible with WE: hyperintensity lesions in T-2 weighted images in the hypothalamus, medial thalamus, periaqueductal grey matter, anatomical regions of the mammillary bodies and superior cerebellar peduncles. , Mammillary bodies and optic tracts were difficult to assess due to a sub acute blood clot occupying the lower anterior portion of the third ventricle. The study was concluded with the MRI angiography to exclude a malformation of the vessels that had been able to generate the bleeding. Anyway, MRI angiography 3D-TOF was negative for vascular malformations. All these radiological findings were consistent with the diagnosis of WE. In the meantime, patients developed septic shock due to multi-resistant drug Enterococcus Faecium with severe low platelets count needing a mean of 20 Units of platelets transfused per day to maintain a serum level greater than 30000/μl.
+No neurosurgical indications were given for the hemorrhagic brain lesions. So, we increased thiamine dosage up to 250 mg intravenously three times per day. This therapy was prolonged for one week, and after 4 days of high-dose thiamine supplementation neurological status of the patient had a significant improvement despite severe septic shock, she was able to open her eyes spontaneously and she performed simple commands.
+Nevertheless, septic shock worsened and thrombocytopenia became refractory to platelets transfusions, hemodynamic instability became unresponsive to vasopressors and liver hypoperfusion worsened. Despite severe efforts used to control septic shock and thrombocytopenia, she died on the 21st day after surgery because of massive cerebral bleeding and unresponsive cerebral edema. The macroscopic autopsy of the brain was not nullifying because intracerebral hemorrhage and severe cerebral edema led to colliquation the typical areas of the Wernicke’s disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_974_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_974_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fdf41bf644c43bc59d294eb99ebb154fce3c0ad1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_974_en.txt
@@ -0,0 +1,5 @@
+A 47-year-old man with a history of hypertension and diabetes mellitus presented to the emergency room with sudden-onset hemiplegic paralysis on the left side, which had persisted for 3 h. Acute cerebral ischemia was confirmed by magnetic resonance imaging (MRI; Fig. A). The patient suffered from hemiparesis, with a score of 2 points according to the National Institutes of Health Stroke Scale (NIHSS), as evaluated by two neurologists.
+However, computed tomography (CT) performed before the MRI revealed a subacute SAH ; thus, intravenous thrombolysis with a recombinant tissue plasminogen activator could not be performed. DSA performed after CT and MRI revealed a dissecting aneurysm in the M1 section of the MCA and distal occlusion further along the aneurysm . Based on the DSA images, we postulated that recanalization of the occluded MCA was too high risk. Furthermore, we considered extracranial-intracranial bypass; however, this was declined by the patient and his family. Thus, conservative treatment was administered with dual antiplatelets (100 mg aspirin and 75 mg clopidogrel daily) and lipid-lowering therapy (40 mg atorvastatin calcium tablet daily), without endovascular treatment. We planned to embolize the dissecting aneurysm in the right MCA one week later.
+Unfortunately, the patient experienced more severe neurological deficits within 24 h, resulting in a new NIHSS score of 12 points. Repeated CT scans excluded intracranial hemorrhage or hemorrhagic transformations. Additional cerebral ischemia was detected using diffusion-weighted imaging (DWI) . We continued the conservative therapeutic strategy. Although hypertension and diabetes mellitus were confirmed by biomedical tests, arterial pressure and blood glucose levels were normal. The neurological function of the patient remained stable. All Glasgow Coma Scale and NIHSS scores are presented in Supplementary Data A, and arterial pressure monitoring data are presented in Supplementary Data B.
+One week later, endovascular treatment was administered to the M1 aneurysm according to the therapeutic procedure. During this procedure, we observed that the dissecting aneurysm had enlarged significantly, with the volume having more than tripled in one week . The endovascular procedure was completed satisfactorily and the patient underwent neurological rehabilitation. We performed a second DSA nine days after the endovascular procedure, which confirmed successful treatment of the MCA aneurysm . A CT scan performed before DSA revealed that the SAH was barely detectable (Supplementary Data ).
+However, the patient experienced a severe headache 5 days after the repeat DSA. CT confirmed a new acute SAH . CT angiography was performed immediately, which revealed no evidence of re-rupture of the treated aneurysm or other new aneurysms (Supplementary Data ). To exclude other hemorrhagic cerebral vascular diseases, such as arterial venous malformation and carotid-cavernous sinus fistula, we performed a fourth DSA on the day after the hemorrhage recurrence. The DSA revealed that an enlarging dissecting aneurysm had been detected in the right PCA , which had not been seen previously. In addition, a new SAH was confirmed on CT during DSA . We intended to perform endovascular treatment by trapping the enlarging dissecting aneurysm and parent artery; however, the patient’s family declined further invasive treatment. Thus, we administered conservative treatment to the patient who died two days later. A schematic diagram details the course of the multiple aneurysms and the treatment modality employed in the present case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_986_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_986_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..894841f08b31516e8144d7277057d3037e0821c8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_986_en.txt
@@ -0,0 +1,11 @@
+This was a 9-year-old female patient referred from Kibuye Hospital in the Western province of Rwanda for further investigations and management of the left calcaneal mass suspected to be an osteosarcoma. The condition had persisted for 4 months before consulting our clinic at Kigali University Teaching Hospital CHUK for the left heel pain and swelling. The examination noted a history of fever, weight loss and swelling of the left foot extending to the whole lower limb without cough. Consulted, as structured health system, Birambo Health Centre, then Kirinda district hospital where she received different treatment (that we are unable to get their records for proper identification), without improvement. After 2 weeks, a pus discharging sinus appeared on the heel mass. Two months later, the patient noted right hip swelling with inability to stand and walk. She consulted Kibuye Referral Hospital, from where she was referred at CHUK on December 1, 2017, for further management of possible osteosarcoma of the left calcaneus. No history of trauma nor TB contact.
+On physical examination: Temperature was 37.6°C, respiratory rate of 20 cycles/min, pulse of 97 beats/min; two ulcerated wounds on the lateral aspect of left ankle and heel, swollen and tender ankle joint, two mobile, non-tender, small inguinal lymph nodes on the left side, limited range of motion of right hip joint with tenderness and mild shortening of right lower limb.
+COM of the left calcaneum with pus discharging sinuses Left foot synovial sarcoma/Ewing sarcoma TB of the left calcaneum and right hip.
+As management, she received analgesics, daily wounds care and different clinical pathology tests were requested . Imaging studies including computed tomography (CT) scan of the left foot (, and ) and pelvic X-ray .
+CT scan results (December 8, 2017): Lytic and sclerotic calcaneal tumor consistent with osteogenic sarcoma, the differential diagnosis is COM.
+She was admitted on December 14, 2017, on December 18, 2017, curettage and biopsy were performed under general anesthesia and pre-operative chest X-ray was normal. The patient was discharged home on December 20, 2017.
+On January 10, 2018, microscopic examination of the calcaneal mass curettings revealed rare poorly formed granuloma, rare multinucleated giant cells, and mixed acute and chronic inflammatory cell infiltrates in favor of possible extrapulmonary TB. The special auramine-rhodamine stain was positive for acid-fast bacilli .
+On February 8, 2018, the patient was referred to pediatric outpatient department (OPD) seen in OPD for TB treatment, as follows: Rifampicin, isoniazid, pyrazinamid, and ethambutol (R75 mg H50 mg Z50 mg E100 mg) 8 tablets per dose for 12 days and then for 48 days. Rifampicin, isoniazid (R75H50) for the remaining period. Pyridoxine 25 mg/day was associated for the two 1st month.
+On July 9, 2018, she was reviewed in OPD with persistent small sinus on the left heel. Walking with axillary crutches. The X-rays showed sequestrum and sclerosis of calcaneum, distal tibia, and fibula .
+We did a sequestrectomy under general anesthesia at Kibuye Hospital in citizen outreach program. She was discharged and advised to continue anti-TB.
+On November 29, 2018, she was reviewed and had significantly improved and gained weight; sinuses healed, mild limping with limb length discrepancy of around 1 cm (right being short) and she could stand and walk with the aid of one axillary crutch. Had a limb length discrepancy of around 1 cm (right being short). The liver function test, renal function test, and hemogram test were normal. Control X-rays and morphology picture of the limb were obtained at the same time .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_995_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_995_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..114cb5fb1d6856f91aff70de04a24f3c28d238d9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_995_en.txt
@@ -0,0 +1,3 @@
+A 21-year-old man presented to the emergency room (ER) complaining of stomach and serious back pain 2 months after spinal surgical intervention. Two months before his visit, he fell from a 10 m tall building. He was confirmed as suffering fracture and dislocation from T11 to L2 by a computed tomography (CT) examination. The patient complained of severe back pain. There was no neural deficit. The patient underwent thoracolumbar pedicle screw implant surgery using ‘freehand technique’ under fluoroscopic guidance in a local hospital. Eight pedicle screws with contoured rods were placed spanning T11 to L2 after the correction of deformities. The patient tolerated the procedure well and developed no neurodeficits postoperatively. Radiological examination revealed a partial correction of the deformity.
+The patient was presented with a recurrence of pain at the operated site 10 days postoperatively. The pain was a dull ache, non-radiating, and showed a progressive increase in intensity. This was accompanied by constitutional symptoms like poor appetite and a general feeling of being unwell. In view of the non-specific nature of the complaints, no further investigation was carried out and the patient was advised to attend regular follow-ups.
+In our hospital, enhanced CT and X-rays were performed after thorough clinical evaluation. The CT scan revealed the malposition of a pedicle screw on both sides at the T11, T12, and L1 levels, which was a disaster. The left side T12 and L1 malpositioned screws had exited the lateral pedicle cortex and were clearly abutting the posteromedial aspect of the descending thoracic aorta , with the formation of associated pseudoaneurysms in the thoracic aorta. The right side of T11 and both sides of T12 screws also had exited the lateral pedicle cortex and were abutting the wall of the pseudoaneurysm. The left side screw in L2 perforated the lateral pedicle cortex but did not abut the aorta . A re-surgery with the interdisciplinary collaboration of orthopaedics and vascular surgery teams was recommended and was subsequently performed in another hospital. In the surgery, after the anesthesia and cardiopulmonary bypass, pseudoaneurysm and malpositioned screws were found under direct vision. An ascending aorta replacement with artificial tissue was performed (Vascutek Ltd., diameter 16 × 8 mm, usable length 45 cm). The extruded part of the pedicle screw was cut in situ so as to avoid any chance of re-injury. The patient endured the surgery well and had a good recovery in his 4-month follow-up examination.
\ No newline at end of file