diff --git "a/IE-en/NER/AnatEM/test.json" "b/IE-en/NER/AnatEM/test.json"
new file mode 100644--- /dev/null
+++ "b/IE-en/NER/AnatEM/test.json"
@@ -0,0 +1,3758 @@
+{"text": "( a ) Schematic drawing of the magnetic tweezers .", "entity": [], "task": "NER"}
+{"text": "A DNA molecule is attached at one end to the bottom of the flow cell and at the other end to a magnetic bead .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [64, 68]}], "task": "NER"}
+{"text": "This molecule can be pulled and twisted using small magnets placed above the flow cell .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [82, 86]}], "task": "NER"}
+{"text": "The position of the magnetic bead is measured using an inverted microscope placed beneath the flow cell .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [99, 103]}], "task": "NER"}
+{"text": "The bead position and thus the end - to - end distance of the DNA molecule is determined using video microscopy and image analysis .", "entity": [], "task": "NER"}
+{"text": "( b ) Extension of a DNA molecule versus the number of turns applied by the magnets for various stretching forces .", "entity": [], "task": "NER"}
+{"text": "At low force , contraction of the molecule is symmetrical under positive and negative applied turns .", "entity": [], "task": "NER"}
+{"text": "At higher force , the molecule ' s extension initially remains constant for positive applied turns .", "entity": [], "task": "NER"}
+{"text": "The induced torque increases linearly with the number of applied turns , as depicted in the top graph until a buckling transition allows the system to saturate its torsional constraint through the formation of plectonemes .", "entity": [{"entity": "plectonemes", "entity_type": "Anatomy", "pos": [210, 221]}], "task": "NER"}
+{"text": "Effect of Trail on the expression of endogenous M2 .", "entity": [], "task": "NER"}
+{"text": "( A ) Effect of Trail on the level of endogenous M2 protein .", "entity": [], "task": "NER"}
+{"text": "The expression level of endogenous M2 protein in HeLa cells was determined using western blot 4 h following Trail ( 250 mug / ml ) treatment .", "entity": [{"entity": "HeLa cells", "entity_type": "Anatomy", "pos": [49, 59]}], "task": "NER"}
+{"text": "( B ) Effect of Trail on the endogenous M2 mRNA .", "entity": [], "task": "NER"}
+{"text": "The expression level of endogenous M2 mRNA in HeLa cells was detected using RNase protection assay 4 h following Trail ( 250 mug / ml ) treatment .", "entity": [{"entity": "HeLa cells", "entity_type": "Anatomy", "pos": [46, 56]}], "task": "NER"}
+{"text": "( C ) Effect of Trail on the synthesis of endogenous M2 protein .", "entity": [], "task": "NER"}
+{"text": "HeLa cells were first treated with 250 mug / ml Trail followed by pulse labeling of newly synthesized proteins with [ 35S ] methionine .", "entity": [{"entity": "HeLa cells", "entity_type": "Anatomy", "pos": [0, 10]}], "task": "NER"}
+{"text": "M2 protein was then immunoprecipitated and separated by SDS - PAGE for autoradiography as described in Materials and Methods .", "entity": [], "task": "NER"}
+{"text": "The most highly represented gene ontology themes in the neurosphere vs . differentiated cells comparison ( F - G ) .", "entity": [{"entity": "neurosphere", "entity_type": "Anatomy", "pos": [56, 67]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [88, 93]}], "task": "NER"}
+{"text": "Planning for the Future : Disaster Preparedness and Mitigation", "entity": [], "task": "NER"}
+{"text": "It is often believed that casualties from natural disasters are unavoidable , but this belief is false [ 8 ] .", "entity": [], "task": "NER"}
+{"text": "There are many measures that can reduce morbidity and mortality following large and potentially catastrophic flooding events [ 19 ] .", "entity": [], "task": "NER"}
+{"text": "Early warning of impending floods and natural events such as hurricanes allows sufficient time for communities to be evacuated to safe areas .", "entity": [], "task": "NER"}
+{"text": "Although Florida experienced one of the worst hurricane seasons on record in 2004 , the number of fatalities was lower than expected because of early warning and evacuation .", "entity": [], "task": "NER"}
+{"text": "Early warning also provides sufficient time to prepare when evacuation is not possible .", "entity": [], "task": "NER"}
+{"text": "Hurricane George in 1998 caused widespread damage and several fatalities in the Dominican Republic , where residents were not warned .", "entity": [], "task": "NER"}
+{"text": "In contrast , Cuba and Puerto Rico experienced relatively limited damage and loss of life , because preparations were made in the hours before the storm .", "entity": [], "task": "NER"}
+{"text": "Disaster preparedness can also be developed for communities that are regularly exposed to flooding disasters .", "entity": [], "task": "NER"}
+{"text": "Cyclone shelters built by the Red Cross in Orissa , India , saved many thousands of lives in 1999 when two cyclones struck .", "entity": [], "task": "NER"}
+{"text": "In the region of the Americas , the Pan American Health Organization has spent many years promoting and integrating disaster preparedness into building health facilities to ensure that medical services needed to treat victims and maintain ongoing care for patients with chronic conditions will not be disrupted by disasters .", "entity": [], "task": "NER"}
+{"text": "A recent global - scale review of health risks from flooding highlights that in flood - prone areas , disaster preparedness within the health system as a whole is particularly important [ 20 ] .", "entity": [], "task": "NER"}
+{"text": "In addition to infrastructure and early - warning systems , another key element in disaster preparedness is education and raising awareness about disaster risks and response plans .", "entity": [], "task": "NER"}
+{"text": "Had there been greater awareness about the risk of tsunamis , perhaps many lives could have been saved in the South Asian disaster in December 2004 .", "entity": [], "task": "NER"}
+{"text": "Discussion", "entity": [], "task": "NER"}
+{"text": "Among adolescent boys in Chapaevsk , Russia , higher serum levels of sum of dioxin - like compounds and sum of dioxin TEQs were positively associated with increased age , consumption of fish , local meats other than chicken , and inversely with weeks of gestation .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [53, 58]}, {"entity": "meats", "entity_type": "Anatomy", "pos": [199, 204]}], "task": "NER"}
+{"text": "The age association was found despite a narrow age range of slightly over two years in our study .", "entity": [], "task": "NER"}
+{"text": "Although not statistically significant , the distance the boy lived from the Khimprom factory at the time of blood draw was inversely associated with serum levels of sum of dioxin - like compounds and sum of dioxin TEQs .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [109, 114]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [150, 155]}], "task": "NER"}
+{"text": "As expected , serum PCBs , specifically PCB 118 , were strongly associated with both sum of dioxin - like compounds and sum of dioxin TEQs .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [14, 19]}], "task": "NER"}
+{"text": "There was no association between the distance of the residence from the Khimprom plant during the pregnancy and subsequent serum dioxin levels .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [123, 128]}], "task": "NER"}
+{"text": "One potential explanation for the lack of association may include misclassification of distance since the mother was asked to recall a time period more than 14 years prior to the study .", "entity": [], "task": "NER"}
+{"text": "However , we would expect that the mother would be able to recall residential history at the time of the birth of their son .", "entity": [], "task": "NER"}
+{"text": "Mother ' s self - reported estimates of current residential distance from Khimprom was generally accurate ; twenty - one of twenty - nine mothers correctly categorized their current residential distance from the Khimprom plants based on cross - referencing using GIS mapping .", "entity": [], "task": "NER"}
+{"text": "Other explanations include that prenatal exposure 14 or more years prior to the current serum sample is not as strong a predictor as are exposures resulting from present residential location .", "entity": [{"entity": "serum sample", "entity_type": "Anatomy", "pos": [88, 100]}], "task": "NER"}
+{"text": "Although there was no association of case status ( cryptorchidism or hypospadias ) with dioxin levels , we did not have sufficient power to definitively assess this relationship .", "entity": [], "task": "NER"}
+{"text": "Perinatal history ( e . g . weeks of breastfeeding ) was generally not associated with exposure measures in this population ; this may be a function of older age of the children .", "entity": [], "task": "NER"}
+{"text": "However , there are limited data on the relationship of perinatal factors with organochlorine exposures in this age group so a null finding is of interest given reports that differences in organochlorine levels among breastfed and non - breastfed are generally no longer discernable by early school age [ 24 , 25 ] and , furthermore , that dietary intake after this age contributes significantly to total dioxin intake [ 26 ] .", "entity": [], "task": "NER"}
+{"text": "In prior studies , substantial emphasis has been placed on pre - and early postnatal ( via breastfeeding ) exposures because of particular vulnerability during fetal and early infant development .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [160, 165]}], "task": "NER"}
+{"text": "The exposure risk factors during peri - adolescence , another period of potential developmental vulnerability , has not been studied in - detail , therefore , the identification of exposure risk factors specific to this period will enhance our understanding of this critical period .", "entity": [], "task": "NER"}
+{"text": "Although data on levels of PCDD / PCDFs in children is limited , our results suggest that the mean total TEQs among Chapaevsk adolescents were higher than most values previously reported in non - occupationally exposed populations of comparable or even older ages .", "entity": [], "task": "NER"}
+{"text": "Figure 2 shows a comparison of the mean PCDD / PCDFs TEQ levels in Chapaevsk boys with other populations ( TEQ from dioxin - like PCBs was not included , since some of these studies did not report them ) .", "entity": [], "task": "NER"}
+{"text": "The mean TEQs of pooled blood samples from 10 year - old German boys in rural and urban settings was 8 . 2 pg TEQ / g lipid for an urban industrial area , 9 . 0 pg TEQ / g lipid for an industrial area within a rural setting , and 10 . 1 pg TEQ / g lipid for a rural area [ 27 ] .", "entity": [{"entity": "blood samples", "entity_type": "Anatomy", "pos": [24, 37]}], "task": "NER"}
+{"text": "In comparison , the mean TEQ in the Chapevsk boys was 19 . 3 pg TEQ / g lipid .", "entity": [], "task": "NER"}
+{"text": "With the exception of children described by Wuthe et al .", "entity": [], "task": "NER"}
+{"text": "[ 27 ] , subjects in the other studies in Figure 2 were significantly older than the Chapaevsk boys .", "entity": [], "task": "NER"}
+{"text": "Despite age differences , the mean TEQ in Chapaevsk boys was comparable to or even higher than the mean TEQ in older populations from other countries .", "entity": [], "task": "NER"}
+{"text": "For example , they were higher than mean TEQs of 18 . 4 pg TEQ / g lipid in adults ( 40 . 6 years old average ) from South Germany [ 27 ] or 16 . 4 pg TEQ / g lipid from 20 year old Japanese women [ 28 ] or pooled samples from randomly selected males and females 18 - 69 years of age from the Spanish city of Mataro [ 29 ] , which were 12 . 5 and 14 . 7 pg TEQ / g lipid respectively .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [214, 221]}], "task": "NER"}
+{"text": "The mean levels in adult female ( mean age 41 years ) non - factory workers in the Russian city of Shelekhovo were also lower at 14 . 5 pg TEQ / g lipid [ 30 ] .", "entity": [], "task": "NER"}
+{"text": "Mean TEQs for the general population ( mean age 44 . 2 years ) in Germany , collected in 1997 - 98 [ 31 ] , and median TEQs for long - term workers of pulp and paper mill and non - workers in the U . S . in 1996 [ 32 ] were similar to levels found in the Chapaevsk boys .", "entity": [{"entity": "pulp", "entity_type": "Anatomy", "pos": [151, 155]}], "task": "NER"}
+{"text": "The mean levels in the study in Germany were 20 . 71 pg TEQ / g lipid and in the U . S . the median levels were 19 . 1 pg TEQ / g lipid for community residents and 21 . 2 pg TEQ / g lipid for low exposure workers .", "entity": [], "task": "NER"}
+{"text": "Figure 2", "entity": [], "task": "NER"}
+{"text": "Mean PCDD / PCDFs TEQ levels in Chapaevsk boys in comparison with other populations .", "entity": [], "task": "NER"}
+{"text": "Although TCDD was largely below the detection limits in this small pilot sample , the two boys with detectable values had high TCDD levels ( 17 . 9 and 21 . 7 pg / g lipid ) , suggesting that exposure for at least some portion of this population is substantially higher than typical of this age group .", "entity": [{"entity": "sample", "entity_type": "Anatomy", "pos": [73, 79]}], "task": "NER"}
+{"text": "In comparison , in a cohort of adult ( mean age of 58 years ) fishermen from a polluted region of Finland , the mean TCDD concentration was 19 pg / g lipid [ 33 ] .", "entity": [], "task": "NER"}
+{"text": "In adult ( mean age of 53 years ) residents from Calcasieu Parish , Louisiana , which is near a chemical industrial complex , the mean TCDD level was 7 . 6 pg / g lipid [ 34 ] .", "entity": [], "task": "NER"}
+{"text": "Not only were the dioxin levels in these two children higher than those found in these studies , but the adults in the previous studies were several decades older and therefore would be expected to have higher dioxin body burdens than younger children [ 35 ] .", "entity": [{"entity": "body", "entity_type": "Anatomy", "pos": [217, 221]}], "task": "NER"}
+{"text": "Potential explanations for the large number of non - detectable samples for TCDD include the small sample volume and young age of the subjects .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [64, 71]}, {"entity": "sample", "entity_type": "Anatomy", "pos": [99, 105]}], "task": "NER"}
+{"text": "In our future studies in this population , we will collect larger volumes of serum for dioxin analysis .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [77, 82]}], "task": "NER"}
+{"text": "In one of the few studies on dioxin - like compounds in which children were included , Eskenazi and coworkers [ 36 ] evaluated the relationship between serum TCDD concentrations and age at exposure of female residents of Seveso , Italy .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [152, 157]}], "task": "NER"}
+{"text": "Residents near the ICMESA chemical plant in Seveso were exposed to some of the highest known residential levels of 2 , 3 , 7 , 8 - TCDD as a result of an explosion at the plant .", "entity": [], "task": "NER"}
+{"text": "Archived serum collected near the time of the accident was used to measure exposures .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [9, 14]}], "task": "NER"}
+{"text": "Residents closest to the plant had a median 2 , 3 , 7 , 8 - TCDD level of 272 ppt ( IQR 92 - 883 ppt ) .", "entity": [], "task": "NER"}
+{"text": "Residential proximity to the plant and younger age ( up to 13 years old ) were the strongest predictors of an individual ' s serum 2 , 3 , 7 , 8 - TCDD level .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [125, 130]}], "task": "NER"}
+{"text": "Other predictors included being outdoors at the time of explosion and consumption of homegrown food .", "entity": [], "task": "NER"}
+{"text": "The higher levels found in children were most likely a result of increased exposure as a result of activity patterns and a greater proportionate consumption of food , water and air than adults [ 37 ] .", "entity": [], "task": "NER"}
+{"text": "Although the exposure scenario ( an acute high exposure event ) is different than the chronic low / moderate exposure occurring in Chapaevsk , the results from Seveso suggest that children may be at increased risk for high dioxin exposure from environmental contamination .", "entity": [], "task": "NER"}
+{"text": "In our study , although distance from the Khimprom plants was a weak predictor of serum dioxin - like compounds , consumption of local foods ( specifically meat and fish ) , as in the Seveso study , was a strong predictor of sum of dioxin - like compounds and dioxin TEQs .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "meat", "entity_type": "Anatomy", "pos": [156, 160]}], "task": "NER"}
+{"text": "This finding is notable given concerns regarding environmental dioxin contamination in the community and suggests that food may be one of the more , if not most , important routes of environmental contaminant exposure for residents in this setting .", "entity": [], "task": "NER"}
+{"text": "In other settings , contaminated food generally contributes much more substantially to human organochlorine burden than air or soil ( which may be related to residential proximity to pollutant sources ) [ 6 ] .", "entity": [], "task": "NER"}
+{"text": "We will investigate this issue in more detail in our ongoing study .", "entity": [], "task": "NER"}
+{"text": "Figures and Tables", "entity": [], "task": "NER"}
+{"text": "Figure 1", "entity": [], "task": "NER"}
+{"text": "Allergen and particle dose - response experiments in BALB / cA and NIH mice Levels of serum OVA - specific IgE ( A , D ) , IgG1 ( B , E ) and IgG2a ( C , F ) on day 26 after injection into one hind footpad of 100 ( open columns ) , 50 ( gray ) or 10 ( black ) mug OVA combined with 100 , 40 , 10 or 0 mug PSP , or buffer ( HBSS ( hatched ) ) , in BALB / cA ( A , B , C ) and NIH ( D , E , F ) mice .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [86, 91]}, {"entity": "hind footpad", "entity_type": "Anatomy", "pos": [193, 205]}], "task": "NER"}
+{"text": "On day 21 the mice were boostered with the same OVA dose in the footpad .", "entity": [{"entity": "footpad", "entity_type": "Anatomy", "pos": [64, 71]}], "task": "NER"}
+{"text": "The PSP - control ( \" PSP ctr \" ) group was given 100 mug PSP on day 0 , followed by HBSS injection on day 21 ( diamonds ) .", "entity": [], "task": "NER"}
+{"text": "Values ( arbitrary units , AU ) for individual mice ( circles ) and median values ( columns ) for groups of eight mice are shown .", "entity": [], "task": "NER"}
+{"text": "Dotted lines indicate the lower or higher detection limits for the ELISA assays .", "entity": [], "task": "NER"}
+{"text": "Note different scales for the two strains of mice .", "entity": [], "task": "NER"}
+{"text": "The adjuvant effect of PSP on OVA - specific IgE and IgG2a responses in different strains of mice Levels of serum OVA - specific IgE ( A ) and IgG2a ( B ) on day 26 after injection into one hind footpad of HBSS ( open columns ) , 10 mug OVA ( gray ) , 40 mug PSP ( hatched ) or 10 mug OVA + 40 mug PSP ( black ) in different mouse strains .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [108, 113]}, {"entity": "hind footpad", "entity_type": "Anatomy", "pos": [190, 202]}], "task": "NER"}
+{"text": "On day 21 all mice were boostered with 10 mug OVA in the footpad .", "entity": [{"entity": "footpad", "entity_type": "Anatomy", "pos": [57, 64]}], "task": "NER"}
+{"text": "Vertical straight lines indicate separate experiments .", "entity": [], "task": "NER"}
+{"text": "Values ( arbitrary units , AU ) for individual mice ( circles ) and median values ( columns ) for groups of mice are shown .", "entity": [], "task": "NER"}
+{"text": "Dotted lines indicate the lower detection limits for the ELISA assays .", "entity": [], "task": "NER"}
+{"text": "Brackets indicate statistically significant differences between groups ( p < 0 . 05 ) .", "entity": [], "task": "NER"}
+{"text": "All experiments were performed twice with similar results , with eight mice per group .", "entity": [], "task": "NER"}
+{"text": "Figure 3", "entity": [], "task": "NER"}
+{"text": "The primary cellular response in the draining lymph node The primary cellular response in the draining PLN was determined five days after a single injection of HBSS ( open columns ) , 10 mug OVA ( gray ) , 40 mug PSP ( hatched ) or 10 mug OVA + 40 mug PSP ( black ) into both hind footpads of BALB / cA , NIH and C3H / HeN mice .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [12, 20]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [46, 56]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [69, 77]}, {"entity": "PLN", "entity_type": "Anatomy", "pos": [103, 106]}], "task": "NER"}
+{"text": "The total lymph node cell numbers ( A ) and IL - 4 ( B ) , IFN - gamma ( C ) and IL - 10 ( D ) secreted from the PLN cells after ex vivo stimulation with Con A were determined .", "entity": [{"entity": "lymph node cell", "entity_type": "Anatomy", "pos": [10, 25]}, {"entity": "PLN cells", "entity_type": "Anatomy", "pos": [113, 122]}], "task": "NER"}
+{"text": "Values for individual samples ( circles ) and group median values ( columns ) are shown .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [22, 29]}], "task": "NER"}
+{"text": "Dotted lines indicate the lower detection limits for the cytokine ELISA assays , and brackets indicate statistically significant differences between groups ( p < 0 . 05 ) .", "entity": [], "task": "NER"}
+{"text": "Stages in the life cycle of Plasmodium falciparum", "entity": [], "task": "NER"}
+{"text": "( Illustration : Coatney GR , Collins WE , Warren M , Contacos PG ( 1971 )", "entity": [], "task": "NER"}
+{"text": "The primate malarias . ( Bethesda ) : U . S . Department of Health , Education and Welfare . )", "entity": [], "task": "NER"}
+{"text": "Images", "entity": [], "task": "NER"}
+{"text": "FIGURE 2 .", "entity": [], "task": "NER"}
+{"text": "A", "entity": [], "task": "NER"}
+{"text": "B", "entity": [], "task": "NER"}
+{"text": "FIGURE 3 .", "entity": [], "task": "NER"}
+{"text": "Supporting Information", "entity": [], "task": "NER"}
+{"text": "Table S1", "entity": [], "task": "NER"}
+{"text": "Supplementary Information on Genes in the Three Gene Sets", "entity": [], "task": "NER"}
+{"text": "( 219 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Click here for additional data file .", "entity": [], "task": "NER"}
+{"text": "Table S2", "entity": [], "task": "NER"}
+{"text": "UFW Primers for Gene Set I", "entity": [], "task": "NER"}
+{"text": "( 36 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Table S3", "entity": [], "task": "NER"}
+{"text": "UFW Primers for Gene Set II", "entity": [], "task": "NER"}
+{"text": "( 44 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Table S4", "entity": [], "task": "NER"}
+{"text": "UFW Primers for Gene Set III", "entity": [], "task": "NER"}
+{"text": "( 31 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Table S5", "entity": [], "task": "NER"}
+{"text": "Transposable Element - Specific Primers for Additional Screens", "entity": [], "task": "NER"}
+{"text": "( 80 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Table S6", "entity": [], "task": "NER"}
+{"text": "Primers for Intergenic Regions", "entity": [], "task": "NER"}
+{"text": "( 58 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Table S7", "entity": [], "task": "NER"}
+{"text": "P Element - Specific Primers for Orientation and Length Determination", "entity": [], "task": "NER"}
+{"text": "( 299 KB PDF )", "entity": [], "task": "NER"}
+{"text": "Background", "entity": [], "task": "NER"}
+{"text": "HIV - 1 infectivity depends on free cholesterol incorporated into the viral envelope .", "entity": [{"entity": "envelope", "entity_type": "Anatomy", "pos": [76, 84]}], "task": "NER"}
+{"text": "Here , we analyze HIV infectivity in the presence of drugs that stimulate cholesterol efflux .", "entity": [], "task": "NER"}
+{"text": "Additional File 1", "entity": [], "task": "NER"}
+{"text": "Appendix 1 .", "entity": [], "task": "NER"}
+{"text": "Indications for liver function tests with no obvious liver disease , and consequent investigations", "entity": [{"entity": "liver", "entity_type": "Anatomy", "pos": [16, 21]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [53, 58]}], "task": "NER"}
+{"text": "Representative PCR / LDR results for HPTs in fimX , BP0059 , BP0880 , sphB2 , ptxA , and bhuR .", "entity": [], "task": "NER"}
+{"text": "Raw capillary electrophoresis data for ligation products ( green ) and molecular weight standards ( red ) displayed as if an electrophoretic gel image .", "entity": [], "task": "NER"}
+{"text": "Assayed locus is indicated at the top of each panel ; strain and length of its HPT allele are noted above each lane .", "entity": [], "task": "NER"}
+{"text": "Representative LDR results are depicted here ; for complete data from all strains see Additional files 8 , 9 , 10 , 11 , 12 , and 13 .", "entity": [], "task": "NER"}
+{"text": "BP0880 , BP0059 , fimX , and sphB2 HPTs were screened by uniplex LDR reactions containing only the discriminating oligonucleotide that targets the Tohama I sequence .", "entity": [], "task": "NER"}
+{"text": "The ptxA and bhuR HPTs were screened by multiplex reactions that contain all three discriminating oligonucleotides .", "entity": [], "task": "NER"}
+{"text": "Letters in teal indicate molecular weight standards as labeled in the corresponding supplementary figures .", "entity": [], "task": "NER"}
+{"text": "Ligation products ( arrows ) are labeled using the notation described in the legend to Figure 1 .", "entity": [], "task": "NER"}
+{"text": "The open arrowhead indicates a synthesis artifact in the BP0059 common oligonucleotide preparation .", "entity": [], "task": "NER"}
+{"text": "INTRODUCTION", "entity": [], "task": "NER"}
+{"text": "Comparing genomic sequences across related species is a fruitful source of biological insight .", "entity": [], "task": "NER"}
+{"text": "Functional elements such as exons tend to exhibit significant sequence similarity due to purifying selection , whereas regions that are not functional tend to be neutrally evolving and thus less conserved .", "entity": [], "task": "NER"}
+{"text": "The first step in comparing genomic sequences is to align them - - to map the letters of the sequences to each other .", "entity": [], "task": "NER"}
+{"text": "After an alignment is computed , visualization frameworks become essential to enable users to interact with the sequence and conservation data , especially in the context of longer DNA sequences or whole genomes .", "entity": [], "task": "NER"}
+{"text": "Visualization frameworks should be easy to understand by a biologist and provide insight into the mutations that a particular genomic locus has undergone .", "entity": [], "task": "NER"}
+{"text": "The VISTA portal is a comprehensive comparative genomics resource that provides biomedical scientists with a single unified framework to generate and download multiple sequence alignments , visualize the results in the context of existing annotations and analyze comparative results in search for important sequence signals in alignments .", "entity": [], "task": "NER"}
+{"text": "The VISTA suite of programs has been in development and continued use since 2000 ( 1 - 4 ) .", "entity": [], "task": "NER"}
+{"text": "It was originally developed for the alignment and comparative analysis of long genomic sequences and later was expanded to pair - wise and multiple alignment of vertebrate genomes .", "entity": [], "task": "NER"}
+{"text": "VISTA has popularized the visualization of the level of conservation in the format of a continuous curve based on the conservation in a sliding window .", "entity": [], "task": "NER"}
+{"text": "This concept proved to be extremely successful due to the easy interpretation of the resulting plots .", "entity": [], "task": "NER"}
+{"text": "VISTA was built through a close collaboration between computational and biological scientists , resulting in a product that is robust , efficient and powerful , yet simple to use for a person without extensive computer experience , as is illustrated by more than 1000 citations to the various VISTA - associated tools ( according to http : / / scholar . google . com ) .", "entity": [], "task": "NER"}
+{"text": "In the last 2 years the VISTA portal has seen many significant improvements .", "entity": [], "task": "NER"}
+{"text": "In addition to updating the whole genome alignments , computed using recent assemblies of vertebrate , insect , plant and microbial genomes , we have added significant new functionality and resources to the Genome Browser and other tools , including :", "entity": [], "task": "NER"}
+{"text": "A novel multiple whole genome alignment algorithm .", "entity": [], "task": "NER"}
+{"text": "A new server for whole - genome alignment of bacterial genomes .", "entity": [], "task": "NER"}
+{"text": "Base - pair level visualization ability within the VISTA browser .", "entity": [], "task": "NER"}
+{"text": "Visual access to the results of the prediction of potential deleteriousness of non - synonymous Single Nucleotide Polymorphisms ( SNPs ) by the algorithm PolyPhen ( 5 ) .", "entity": [], "task": "NER"}
+{"text": "A novel conservation track , Rank - VISTA , to show the statistical significance of conserved regions computed by the Gumby algorithm ( 6 ) .", "entity": [], "task": "NER"}
+{"text": "Whole - genome rVISTA , that allows for evaluation of which conserved transcription factor binding sites ( TFBS ) are over - represented in a group of genes .", "entity": [], "task": "NER"}
+{"text": "Figure 5", "entity": [], "task": "NER"}
+{"text": "Miscellaneous Proteins", "entity": [], "task": "NER"}
+{"text": "Apart from the above - described proteins , several other molecules are also associated with the pathological lesions of AD , and some of these can be regarded as amateur chaperones .", "entity": [{"entity": "pathological lesions", "entity_type": "Anatomy", "pos": [97, 117]}], "task": "NER"}
+{"text": "Acute phase proteins , such as alpha1 - antichymotrypsin ( ACT ) , alpha2 - macroglobulin ( alpha2M ) , and SAP , are all associated with Abeta deposition [ 129 - 132 ] .", "entity": [], "task": "NER"}
+{"text": "ACT is a serine protease inhibitor of the serpin family , and in AD , ACT levels are upregulated , and binding of ACT with Abeta induces Abeta fibrillogenesis [ 133 - 135 ] .", "entity": [], "task": "NER"}
+{"text": "Furthermore , when ACT is overexpressed in transgenic mice , an increased plaque load in the brains of these mice and impaired spatial learning is observed [ 134 , 135 ] .", "entity": [{"entity": "plaque", "entity_type": "Anatomy", "pos": [74, 80]}, {"entity": "brains", "entity_type": "Anatomy", "pos": [93, 99]}], "task": "NER"}
+{"text": "alpha2M also binds Abeta , although in contrast to ACT , this binding prevents Abeta fibril formation and fibril - associated neurotoxicity [ 136 , 137 ] .", "entity": [{"entity": "fibril", "entity_type": "Anatomy", "pos": [85, 91]}, {"entity": "fibril", "entity_type": "Anatomy", "pos": [106, 112]}], "task": "NER"}
+{"text": "alpha2M promotes the protease - mediated degradation of alpha2M / Abeta complexes and contributes to clearance of Abeta from the brain ( discussed in paragraph 4 ) [ 138 , 139 ] .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [129, 134]}], "task": "NER"}
+{"text": "The glycoprotein SAP belongs to the pentraxin family and is a common component of all known types of amyloid fibrils .", "entity": [{"entity": "amyloid fibrils", "entity_type": "Anatomy", "pos": [101, 116]}], "task": "NER"}
+{"text": "SAP is upregulated in AD and protects amyloid fibrils from proteolysis in vitro [ 140 , 141 ] .", "entity": [{"entity": "amyloid fibrils", "entity_type": "Anatomy", "pos": [38, 53]}], "task": "NER"}
+{"text": "SAP not only colocalizes with SPs and interacts with aggregated Abeta ; SAP oligomers also bind and activate C1 [ 142 ] .", "entity": [], "task": "NER"}
+{"text": "Both C1 and SAP may bind to fibrillar Abeta deposits in vivo and induce microglial activation , as cultured human microglial cells show an increase in cytokine production after co - stimulation of Abeta with C1q and SAP [ 104 ] .", "entity": [{"entity": "fibrillar", "entity_type": "Anatomy", "pos": [28, 37]}, {"entity": "microglial", "entity_type": "Anatomy", "pos": [72, 82]}, {"entity": "microglial cells", "entity_type": "Anatomy", "pos": [114, 130]}], "task": "NER"}
+{"text": "These observations further strengthen the above - noted suggestion that not only Abeta , but also several Abeta - binding proteins , are capable of activating the complement system , and thus , contribute to neuroinflammation in AD .", "entity": [], "task": "NER"}
+{"text": "In addition , both alpha2M and ACT , in contrast to SAP , can be regarded as amateur chaperones , as they regulate conformational changes of Abeta .", "entity": [], "task": "NER"}
+{"text": "Tissue - type plasminogen activator ( tPA ) regulates activation of plasminogen into plasmin and is expressed in various regions of the brain especially in the hippocampus [ 143 ] .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [136, 141]}, {"entity": "hippocampus", "entity_type": "Anatomy", "pos": [160, 171]}], "task": "NER"}
+{"text": "Several reports suggested an important role for tPA in AD , as the tPA system is involved in Abeta turnover [ 144 , 145 ] .", "entity": [], "task": "NER"}
+{"text": "Fibrillar forms of Abeta stimulate tPA activity in vitro , whereas in AD patients , a reduction of tPA activity is observed in the affected areas [ 144 , 146 ] .", "entity": [{"entity": "Fibrillar", "entity_type": "Anatomy", "pos": [0, 9]}], "task": "NER"}
+{"text": "Although tPA has no effect on conformational changes of Abeta , it might play a role in the clearance of Abeta from the brain ( paragraph 4 ] .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [120, 125]}], "task": "NER"}
+{"text": "The actin - regulatory protein gelsolin is found both intracellularly and in plasma [ 147 , 148 ] .", "entity": [{"entity": "intracellularly", "entity_type": "Anatomy", "pos": [54, 69]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [77, 83]}], "task": "NER"}
+{"text": "Plasma gelsolin can be considered an amateur chaperone , as it binds Abeta and not only inhibits its Abeta fibrillization but is also capable of degrading preformed Abeta fibrils [ 149 , 150 ] .", "entity": [{"entity": "Plasma", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "fibrils", "entity_type": "Anatomy", "pos": [171, 178]}], "task": "NER"}
+{"text": "Furthermore , gelsolin inhibits Abeta - mediated neurotoxicity [ 151 ] .", "entity": [], "task": "NER"}
+{"text": "One of the major gangliosides in the brain is GM1 .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [37, 42]}], "task": "NER"}
+{"text": "Soluble Abeta binds GM1 and the formed complexes accelerate Abeta fibrillogenesis by acting as a seed for Abeta [ 152 ] .", "entity": [], "task": "NER"}
+{"text": "In the presence of GM1 , Abeta is more neurotoxic than Abeta alone , and cholesterol - rich membranes demonstrate accelerated Abeta binding due to the formation of GM1 clusters [ 153 , 154 ] .", "entity": [{"entity": "membranes", "entity_type": "Anatomy", "pos": [92, 101]}], "task": "NER"}
+{"text": "As GM1 is a major component of lipid rafts and recent studies suggest that Abeta accumulation in these lipid rafts is an early event in AD development , GM1 might play an important role in the early steps in AD pathogenesis [ 155 , 156 ] .", "entity": [{"entity": "lipid rafts", "entity_type": "Anatomy", "pos": [31, 42]}, {"entity": "lipid rafts", "entity_type": "Anatomy", "pos": [103, 114]}], "task": "NER"}
+{"text": "In summary , several proteins are associated with Abeta aggregates in the AD brain and contribute to the aggregation of Abeta and should , therefore , be considered as amateur chaperones .", "entity": [{"entity": "AD brain", "entity_type": "Anatomy", "pos": [74, 82]}], "task": "NER"}
+{"text": "In addition , they might play a role in triggering inflammation .", "entity": [], "task": "NER"}
+{"text": "Mineralization ( red ) of the aorta is prevented by local ( left ) , but not global ( right ) , Mgp expression .", "entity": [{"entity": "aorta", "entity_type": "Anatomy", "pos": [30, 35]}], "task": "NER"}
+{"text": "Basilar papilla", "entity": [], "task": "NER"}
+{"text": "The basilar papilla is found in a recess that opens into the saccular space at one end , and is limited by a thin contact membrane at the other .", "entity": [{"entity": "basilar papilla", "entity_type": "Anatomy", "pos": [4, 19]}, {"entity": "recess", "entity_type": "Anatomy", "pos": [34, 40]}, {"entity": "saccular space", "entity_type": "Anatomy", "pos": [61, 75]}, {"entity": "contact membrane", "entity_type": "Anatomy", "pos": [114, 130]}], "task": "NER"}
+{"text": "The contact membrane separates the endolymphatic fluid in the papillar recess from the perilymphatic fluid at the round window ( Lewis and Narins 1999 ; Wever 1985 ) .", "entity": [{"entity": "contact membrane", "entity_type": "Anatomy", "pos": [4, 20]}, {"entity": "endolymphatic fluid", "entity_type": "Anatomy", "pos": [35, 54]}, {"entity": "papillar recess", "entity_type": "Anatomy", "pos": [62, 77]}, {"entity": "perilymphatic fluid", "entity_type": "Anatomy", "pos": [87, 106]}], "task": "NER"}
+{"text": "The recess perimeter is roughly oval in shape ; in the bullfrog , Rana catesbeiana , its major axis is approximately 200 mum long , while the minor axis measures approximately 150 mum ( Van Bergeijk 1957 ) .", "entity": [{"entity": "recess", "entity_type": "Anatomy", "pos": [4, 10]}], "task": "NER"}
+{"text": "In the leopard frog , Rana pipiens pipiens , it is of similar size ( personal observation , RLMS & JMS ) .", "entity": [], "task": "NER"}
+{"text": "The oval perimeter of the lumen is formed from limbic tissue ; a substance unique to the inner ear , and similar to cartilage ( Wever 1985 ) .", "entity": [{"entity": "lumen", "entity_type": "Anatomy", "pos": [26, 31]}, {"entity": "limbic tissue", "entity_type": "Anatomy", "pos": [47, 60]}, {"entity": "inner ear", "entity_type": "Anatomy", "pos": [89, 98]}, {"entity": "cartilage", "entity_type": "Anatomy", "pos": [116, 125]}], "task": "NER"}
+{"text": "The sensory epithelium is approximately 100 mum long .", "entity": [{"entity": "sensory epithelium", "entity_type": "Anatomy", "pos": [4, 22]}], "task": "NER"}
+{"text": "It occupies a curved area that is symmetrical in the major axis of the elliptical lumen .", "entity": [{"entity": "area", "entity_type": "Anatomy", "pos": [21, 25]}, {"entity": "elliptical lumen", "entity_type": "Anatomy", "pos": [71, 87]}], "task": "NER"}
+{"text": "It contains approximately 60 hair cells ( measured in Rana catesbeiana ) , from which the stereovilli protrude into the lumen and connect to the tectorial membrane ( Frishkopf and Flock 1974 ) .", "entity": [{"entity": "hair cells", "entity_type": "Anatomy", "pos": [29, 39]}, {"entity": "stereovilli", "entity_type": "Anatomy", "pos": [90, 101]}, {"entity": "lumen", "entity_type": "Anatomy", "pos": [120, 125]}, {"entity": "tectorial membrane", "entity_type": "Anatomy", "pos": [145, 163]}], "task": "NER"}
+{"text": "Typically the orientation of the hair cells , as defined by the direction to which the v - shape of the stereovilli bundle points ( Lewis et al . 1985 ) , is away from the sacculus in Ranidae .", "entity": [{"entity": "hair cells", "entity_type": "Anatomy", "pos": [33, 43]}, {"entity": "stereovilli", "entity_type": "Anatomy", "pos": [104, 115]}, {"entity": "sacculus", "entity_type": "Anatomy", "pos": [172, 180]}], "task": "NER"}
+{"text": "The tectorial membrane spans the lumen of the papillar recess .", "entity": [{"entity": "tectorial membrane", "entity_type": "Anatomy", "pos": [4, 22]}, {"entity": "lumen", "entity_type": "Anatomy", "pos": [33, 38]}, {"entity": "papillar recess", "entity_type": "Anatomy", "pos": [46, 61]}], "task": "NER"}
+{"text": "It occludes about half the lumen , and consequently takes an approximately semi - circular shape when viewed from the saccular side ( Frishkopf and Flock 1974 ; Wever 1985 ) .", "entity": [{"entity": "lumen", "entity_type": "Anatomy", "pos": [27, 32]}, {"entity": "saccular", "entity_type": "Anatomy", "pos": [118, 126]}], "task": "NER"}
+{"text": "The membrane has pores at the surface closest to the epithelium , into which the tips of the hair bundles project ( Lewis and Narins 1999 ) . 4", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [4, 12]}, {"entity": "pores", "entity_type": "Anatomy", "pos": [17, 22]}, {"entity": "surface", "entity_type": "Anatomy", "pos": [30, 37]}, {"entity": "epithelium", "entity_type": "Anatomy", "pos": [53, 63]}, {"entity": "tips", "entity_type": "Anatomy", "pos": [81, 85]}, {"entity": "hair bundles", "entity_type": "Anatomy", "pos": [93, 105]}], "task": "NER"}
+{"text": "Haplotype block structure from one replicate generated by the block method ( ALS ) .", "entity": [], "task": "NER"}
+{"text": "Competing interests", "entity": [], "task": "NER"}
+{"text": "The authors declare that they have no competing interests .", "entity": [], "task": "NER"}
+{"text": "Previous publications indicate that acupuncture is efficient for the treatment of pelvic girdle pain , PGP , in pregnant women .", "entity": [{"entity": "pelvic girdle", "entity_type": "Anatomy", "pos": [82, 95]}], "task": "NER"}
+{"text": "However , the use of acupuncture for PGP is rare due to insufficient documentation of adverse effects of this treatment in this specific condition .", "entity": [], "task": "NER"}
+{"text": "The aim of the present work was to assess adverse effects of acupuncture on the pregnancy , mother , delivery and the fetus / neonate in comparison with women that received stabilising exercises as adjunct to standard treatment or standard treatment alone .", "entity": [{"entity": "fetus", "entity_type": "Anatomy", "pos": [118, 123]}], "task": "NER"}
+{"text": "Authors ' contributions", "entity": [], "task": "NER"}
+{"text": "MP prepared the first draft with the assistance of JLdR .", "entity": [], "task": "NER"}
+{"text": "Other authors reviewed the manuscript , provided further contributions and suggestions .", "entity": [], "task": "NER"}
+{"text": "All of the authors worked collectively to develop the algorithms and methods described in this paper .", "entity": [], "task": "NER"}
+{"text": "Study of freeze - thaw effects and CSF pH on tissue RNA integrity", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [45, 51]}], "task": "NER"}
+{"text": "We have long suspected , on the basis of our tissue banking experience , that most of the molecular degradation that occurs in banked tissue is due to repeated freeze - thaw cycles , which occur due to improper handling during dissection for tissue retrieval or due to freezer malfunctions .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [45, 51]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [134, 140]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [242, 248]}], "task": "NER"}
+{"text": "Our freezers are currently protected by temperature - sensitive alarms that automatically telephone maintenance and tissue banking personnel when the temperature reaches a certain level .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [116, 122]}], "task": "NER"}
+{"text": "More protection is preferable , with CO2 tanks for backup cooling the optimum ( but expensive ) approach .", "entity": [], "task": "NER"}
+{"text": "We plan to systematically investigate the effects of thawing and refreezing on RNA integrity , by deliberately thawing and freezing small samples of brain tissue over varying time intervals and temperatures .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [138, 145]}, {"entity": "brain tissue", "entity_type": "Anatomy", "pos": [149, 161]}], "task": "NER"}
+{"text": "Printing solution", "entity": [], "task": "NER"}
+{"text": "Several transfection reagents were tested ( data not shown ) , and we found that the X - tremeGENE siRNA transfection reagent ( Roche ) gave good transfection efficiencies both for plasmids and siRNAs , and chose to use this reagent for all transfected cell microarray experiments in the present study .", "entity": [{"entity": "plasmids", "entity_type": "Anatomy", "pos": [181, 189]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [253, 257]}], "task": "NER"}
+{"text": "For printing the arrays , one major challenge is to find a good balance between high transfection efficiency and spatially confined spots to avoid cross - contamination between the spots .", "entity": [], "task": "NER"}
+{"text": "In order to optimize the reverse transfection protocol for HEK 293ind - ICER IIgamma cells ( see below ) and X - tremeGENE transfection reagent , we investigated the effect of varying the concentrations of gelatine and sucrose in the printing solution .", "entity": [{"entity": "HEK 293ind - ICER IIgamma cells", "entity_type": "Anatomy", "pos": [59, 90]}], "task": "NER"}
+{"text": "These reagents have been reported to influence both the transfection efficiency and spot integrity ( 6 , 27 ) .", "entity": [], "task": "NER"}
+{"text": "Sucrose was observed to be specifically beneficial for obtaining high transfection efficiency when storing the arrays for several weeks before use ( data not shown ) .", "entity": [], "task": "NER"}
+{"text": "Figure 1A and B show representative images of the observed effects of varying the concentrations of gelatine and sucrose .", "entity": [], "task": "NER"}
+{"text": "We observed that the transfection efficiency increased with increasing gelatine concentration ( tested in the range 0 . 01 - 0 . 40 % ) .", "entity": [], "task": "NER"}
+{"text": "However , an increased disturbance of the spatial definition of the spots was observed with increasing concentrations of gelatine or sucrose ( tested in the range 0 - 100 mM ) .", "entity": [], "task": "NER"}
+{"text": "A combined effect of the concentrations of gelatine and sucrose was also observed , as low concentrations of gelatine allowed us to use higher concentrations of sucrose than with higher concentrations of gelatine before cells spread outside the spots .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [220, 225]}], "task": "NER"}
+{"text": "Based on several optimizing experiments , we found that 3 microl X - tremeGENE solution per microgram nucleic acid , 25 mM sucrose and 0 . 1 % gelatine in the final printing solution reproducibly gave spatial restricted transfection with high transfection efficiency printing the arrays with both a pipette tip and a hand - held arrayer ( see below ) .", "entity": [{"entity": "hand", "entity_type": "Anatomy", "pos": [317, 321]}], "task": "NER"}
+{"text": "Figure 1 .", "entity": [], "task": "NER"}
+{"text": "Effects of sucrose and gelatine concentrations on spot integrity and transfection efficiency .", "entity": [], "task": "NER"}
+{"text": "( A ) Array printed with pDsRed ( 50 ng / microl ) in a printing solution with different gelatine and sucrose concentrations .", "entity": [], "task": "NER"}
+{"text": "Scanning image of the whole array and magnifications of specific spots .", "entity": [], "task": "NER"}
+{"text": "( B ) Array printed with pEGFP ( 50 ng / microl ) in a printing solution with 25 mM sucrose and four different concentrations of gelatine .", "entity": [], "task": "NER"}
+{"text": "Top : Box plot of the fluorescence intensities in each spot ( n = 32 - 34 ) .", "entity": [], "task": "NER"}
+{"text": "Bottom : Scanning image showing squares of seven times five spots for the four gelatine concentrations .", "entity": [], "task": "NER"}
+{"text": "From left to right : 0 . 01 , 0 . 05 , 0 . 1 and 0 . 2 % gelatine .", "entity": [], "task": "NER"}
+{"text": "The DNA - lipid - gelatine - sucrose solutions were printed manually with a 10 microl pipette tip ( A ) or by MicroCasterTM manual arrayer system ( B ) .", "entity": [], "task": "NER"}
+{"text": "In a 1 . 5 ml microcentrifuge tube , plasmid ( 1 microg / microl ) and siRNA were mixed with growth medium without fetal calf serum ( FCS ) , 0 . 5 microl 1 . 5 M sucrose and 3 microl X - tremeGENE per microgram nucleic acid to a final volume of 22 . 5 microl .", "entity": [{"entity": "plasmid", "entity_type": "Anatomy", "pos": [37, 44]}, {"entity": "fetal calf serum", "entity_type": "Anatomy", "pos": [115, 131]}, {"entity": "FCS", "entity_type": "Anatomy", "pos": [134, 137]}], "task": "NER"}
+{"text": "After 15 - 20 min of incubation , 7 . 5 microl 0 . 4 % gelatine ( Type B , G9391 , Sigma ) was added to give 30 microl printing solution .", "entity": [], "task": "NER"}
+{"text": "The gelatine solution was prepared as described by Ziauddin and Sabatini ( 1 ) .", "entity": [], "task": "NER"}
+{"text": "To achieve sufficient level of expression from the transfected plasmids , 25 - 50 ng / microl pEGFP - N1 or pDsRed - express - N1 and 50 - 75 ng / microl of CRE or NFkappaB reporter plasmids was used .", "entity": [{"entity": "plasmids", "entity_type": "Anatomy", "pos": [63, 71]}, {"entity": "plasmids", "entity_type": "Anatomy", "pos": [182, 190]}], "task": "NER"}
+{"text": "For siRNA studies , 2 - 30 ng / microl siRNA in the final printing solution was used .", "entity": [], "task": "NER"}
+{"text": "Candle wicks", "entity": [], "task": "NER"}
+{"text": "Candles with a lead metal core contribute to lead in the home ( Nriagu and Kim 2000 ; van Alphen 1999 ) .", "entity": [], "task": "NER"}
+{"text": "Exposure occurs both from air and from hand - to - mouth activity .", "entity": [], "task": "NER"}
+{"text": "However , to date , no children ' s EBLs traceable to candles have been reported .", "entity": [], "task": "NER"}
+{"text": "In 2002 , the CPSC banned candlewicks containing > 0 . 06 % lead ( CPSC 2003 ) .", "entity": [], "task": "NER"}
+{"text": "Variables", "entity": [], "task": "NER"}
+{"text": "Our study used the following 9 HRQOL questions from the 2004 Rhode Island BRFSS : 1 ) self - rated general health status ; and self - reported number of healthy and unhealthy days in the previous 30 days for 2 ) physical health , 3 ) mental health , 4 ) physical or mental health - related activity limitation , 5 ) pain - related activity limitation , 6 ) sad , blue , or depressed , 7 ) worried , tense , or anxious , 8 ) lack of rest or sleep , and 9 ) lack of energy ( 1 , 2 , 15 ) .", "entity": [], "task": "NER"}
+{"text": "We created 9 dichotomous indicator variables .", "entity": [], "task": "NER"}
+{"text": "The responses to the self - rated general health status question were dichotomized into \" poor \" ( poor or fair ) health or \" good \" ( good , very good , or excellent ) health .", "entity": [], "task": "NER"}
+{"text": "The indicators measured in days were dichotomized at a cutoff value of 14 or more days of poor health in the previous month compared to less than 14 days ( 3 ) .", "entity": [], "task": "NER"}
+{"text": "We selected the 14 - day minimum period because most of the publications we reviewed that use the BRFSS HRQOL indicators ( outcomes ) use the cutoff of 14 or more days compared to 13 or fewer days ( 3 - 5 , 7 - 11 , 16 , 17 ) .", "entity": [], "task": "NER"}
+{"text": "Adopting this precedent ensured comparability .", "entity": [], "task": "NER"}
+{"text": "In addition , clinicians and clinical researchers often use this period as a marker for clinical depression and anxiety disorders , and long symptomatic durations are associated with high levels of activity limitation ( 2 , 18 ) .", "entity": [], "task": "NER"}
+{"text": "Detailed definitions of the 9 indicators are available in our previous article ( 1 ) or are accessible through the Centers for Disease Control and Prevention ' s HRQOL Web site ( 2 ) .", "entity": [], "task": "NER"}
+{"text": "We chose 12 predictors for the analysis : 5 standard demographic measures ( age , sex , race / Hispanic ethnicity , annual income , and employment status ) ; 4 health conditions ( asthma , diabetes , obesity , and physical disability ) ; and 3 health risk behaviors ( smoking , chronic alcohol use , and no leisure - time physical activity ) .", "entity": [], "task": "NER"}
+{"text": "These predictors paralleled the results of other studies that have examined relationships between a specific HRQOL indicator and various predictors ( 17 , 19 ) , or that have examined multiple HRQOL indicators in relation to demographics ( 4 , 20 ) , health risks ( 5 , 10 , 21 ) , or specific health conditions ( 6 - 9 , 12 , 22 ) .", "entity": [], "task": "NER"}
+{"text": "We dichotomized some predictors for the analysis ( ie , sex , current smoking , alcohol use , physical activity , asthma , diabetes , obesity , and disability ) , whereas other predictors had multiple categories ( ie , age , race / Hispanic ethnicity , income , and employment status ) .", "entity": [], "task": "NER"}
+{"text": "The definitions of the 12 predictors are available in our previous article ( 1 ) .", "entity": [], "task": "NER"}
+{"text": "Reference groups chosen for the IRT model were those having the lowest risk for poor or fair general health and usually the lowest risk for the other HRQOL variables as well .", "entity": [], "task": "NER"}
+{"text": "Results", "entity": [], "task": "NER"}
+{"text": "1 .", "entity": [], "task": "NER"}
+{"text": "Introduction", "entity": [], "task": "NER"}
+{"text": "Phase I clinical trials of new anticancer agents have been commonly conducted using the method of modified Fibonacci [ 1 ] .", "entity": [], "task": "NER"}
+{"text": "In brief , 3 patients are treated at a starting dose which is typically one tenth of the dose that is lethal to 10 % of animals defined in preclinical studies .", "entity": [], "task": "NER"}
+{"text": "If none of the 3 patients experiences DLT , then the next 3 patients will be treated at the next higher dose .", "entity": [], "task": "NER"}
+{"text": "If DLT is observed , additional patients will be treated at the same or lower dose level to determine MTD according to a predetermined schema .", "entity": [], "task": "NER"}
+{"text": "The MTD is defined as the highest dose reached for which the incidence of DLT occurs in less than 33 % of the subjects .", "entity": [], "task": "NER"}
+{"text": "Typically , intrapatient dose escalation is not allowed .", "entity": [], "task": "NER"}
+{"text": "There are several shortcomings associated with the modified - Fibonacci design .", "entity": [], "task": "NER"}
+{"text": "It has long been recognized that a substantial number of patients are likely to be treated at subtherapeutic doses [ 2 , 3 ] .", "entity": [], "task": "NER"}
+{"text": "This is particularly true for drugs with potential anticancer activity .", "entity": [], "task": "NER"}
+{"text": "Since the primary purpose of phase I trials is to determine DLT and MTD , the efficacy of the drug may not be evident for certain tumor types as there are only a small number of patients enrolled into the trial .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [130, 135]}], "task": "NER"}
+{"text": "Furthermore , the modified - Fibonacci design does not take into account individual variations in therapeutic and toxicologic responses due to genomic polymorphisms [ 4 , 5 ] .", "entity": [], "task": "NER"}
+{"text": "In addition , since there is a limit of 3 subjects allowed for each cohort , a waiting period of up to four weeks is commonly required before enrollment of the next cohort of subjects .", "entity": [], "task": "NER"}
+{"text": "This latter requirement creates anxiety of waiting for eligible patients .", "entity": [], "task": "NER"}
+{"text": "Several alternative phase I designs have been proposed which limit the number of patients accrued at each dose level and accelerate the dose escalation process [ 1 , 6 ] .", "entity": [], "task": "NER"}
+{"text": "There has also been an increase in the number of clinical trials that include a component of intrapatient dose escalation although no formal validation with the modified - Fibonacci approach has been reported [ 7 - 9 ] .", "entity": [], "task": "NER"}
+{"text": "We have pioneered a population - based design to maximize therapeutic efficacy , to provide preliminary efficacy information and to allow derivation of a pMTD for subsequent phase II trials .", "entity": [], "task": "NER"}
+{"text": "Irinotecan and cisplatin have been shown to have promising efficacy in patients with small - cell lung cancer in phase III trial where irinotecan was given on a weekly schedule [ 10 ] .", "entity": [{"entity": "small - cell lung cancer", "entity_type": "Anatomy", "pos": [85, 109]}], "task": "NER"}
+{"text": "We wished to perform a population - based phase I trial of irinotecan , given every 3 weeks , and carboplatin , a platinated anticancer drug which is generally better tolerated than its cisplatin analog .", "entity": [], "task": "NER"}
+{"text": "2 . 2 .", "entity": [], "task": "NER"}
+{"text": "Iris and Ciliary Body", "entity": [{"entity": "Iris", "entity_type": "Anatomy", "pos": [0, 4]}], "task": "NER"}
+{"text": "Serotonin is present in mammalian iris - ciliary body complex ( ICB ) at higher concentration that in non - mammalian species [ 5 , 45 , 73 , 129 , 137 ] .", "entity": [{"entity": "iris - ciliary body complex", "entity_type": "Anatomy", "pos": [34, 61]}, {"entity": "ICB", "entity_type": "Anatomy", "pos": [64, 67]}], "task": "NER"}
+{"text": "Moreover , the presence of serotonergic nerves has been demonstrated in studies conducted on the ICB of various species [ 102 , 137 , 138 ] .", "entity": [{"entity": "nerves", "entity_type": "Anatomy", "pos": [40, 46]}, {"entity": "ICB", "entity_type": "Anatomy", "pos": [97, 100]}], "task": "NER"}
+{"text": "Experimental evidence and radioligand analyses have defined the presence at this level of three different types of serotonin receptors [ 10 , 28 , 85 , 136 , 137 ] , i . e . 5 - HT1A , 5 - HT2A / 2C and 5 - HT7 [ 98 ] , one linked to a stimulation of inositol phosphates ( 5 - HT2 subtype ) , while the others two are linked to cAMP activity .", "entity": [], "task": "NER"}
+{"text": "The plausibility of the existence of more than one 5 - HT receptor type in the ciliary body is confirmed by intraocular pressure ( IOP ) experiments .", "entity": [{"entity": "ciliary body", "entity_type": "Anatomy", "pos": [79, 91]}, {"entity": "intraocular", "entity_type": "Anatomy", "pos": [108, 119]}], "task": "NER"}
+{"text": "Topical application of serotonin has been reported to both elevate [ 84 ] and lower [ 88 ] IOP in rabbit .", "entity": [], "task": "NER"}
+{"text": "A large number of reports have shown that serotonin agonists and antagonists can produce increases and decreases in IOP when given orally , topically to the eye or when they are directly injected in the anterior chamber [ 10 , 26 , 34 , 35 , 64 , 75 , 84 , 87 , 88 , 112 , 113 , 126 , 136 , 137 ] .", "entity": [{"entity": "orally", "entity_type": "Anatomy", "pos": [131, 137]}, {"entity": "eye", "entity_type": "Anatomy", "pos": [157, 160]}, {"entity": "anterior chamber", "entity_type": "Anatomy", "pos": [203, 219]}], "task": "NER"}
+{"text": "A rationale for such apparently contradictory results may be due to the different sites of action , i . e . which class of serotonin receptor is activated .", "entity": [], "task": "NER"}
+{"text": "In fact , in rabbit the administration of 5 - methyl - urapidil ( a combined 5 - HT1A agonist / alpha1 adrenoreceptor antagonist ) and 8 - OH - DPAT ( 8 - hydroxydypropylaminotetralin , a 5HT1A agonist ) reduces IOP , while the administration of 5 - CT ( 5 - carboxamidotryptamine , a 5 - HT1A and 5 - HT7 agonist ) increases IOP [ 36 , 84 , 99 ] .", "entity": [], "task": "NER"}
+{"text": "Chidlow , Le Corre and Osborne [ 28 ] have recently demonstrated that , in section taken through the whole eye and ciliary body , prominent 5 - HT1A and 5 - HT7 receptor messenger ribonucleic acid signals were obtained .", "entity": [{"entity": "section", "entity_type": "Anatomy", "pos": [75, 82]}, {"entity": "eye", "entity_type": "Anatomy", "pos": [107, 110]}, {"entity": "ciliary body", "entity_type": "Anatomy", "pos": [115, 127]}], "task": "NER"}
+{"text": "These signals were evident in both the pigmented and non - pigmented epithelial cell layers of the pars plicata region of the ciliary processes , but not in the pars plana or in the ciliary musculature .", "entity": [{"entity": "epithelial cell", "entity_type": "Anatomy", "pos": [69, 84]}, {"entity": "pars plicata", "entity_type": "Anatomy", "pos": [99, 111]}, {"entity": "ciliary", "entity_type": "Anatomy", "pos": [126, 133]}, {"entity": "pars plana", "entity_type": "Anatomy", "pos": [161, 171]}, {"entity": "ciliary musculature", "entity_type": "Anatomy", "pos": [182, 201]}], "task": "NER"}
+{"text": "5 - HT1A and 5 - HT7 signals were apparent in the posterior processes but not in the iris processes .", "entity": [{"entity": "iris", "entity_type": "Anatomy", "pos": [85, 89]}], "task": "NER"}
+{"text": "The presence of both receptors in the ciliary body would certainly provide an explanation for the shallow displacement curves observed in [ 3H ] 5 - HT binding studies with the tissue [ 110 ] , since this ligand can be used to label both receptors .", "entity": [{"entity": "ciliary body", "entity_type": "Anatomy", "pos": [38, 50]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [177, 183]}], "task": "NER"}
+{"text": "Because the ciliary epithelium of the pars plicata is responsible for the secretion of aqueous humor , an obvious function for these two receptors would be an involvement in the control of aqueous production and , consequently , of the IOP level .", "entity": [{"entity": "ciliary epithelium", "entity_type": "Anatomy", "pos": [12, 30]}, {"entity": "pars plicata", "entity_type": "Anatomy", "pos": [38, 50]}, {"entity": "aqueous humor", "entity_type": "Anatomy", "pos": [87, 100]}], "task": "NER"}
+{"text": "Further , the almost identical distribution of the 5 - HT1A and 5 - HT7 messengers ribonucleic acid indicate that the receptors may be co - localized in epithelial cells .", "entity": [{"entity": "epithelial cells", "entity_type": "Anatomy", "pos": [153, 169]}], "task": "NER"}
+{"text": "The presence of two serotonin receptors with opposing effects on cAMP in the same cell layer prompts the suggestion that they could act antagonistically .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [82, 86]}], "task": "NER"}
+{"text": "The agonism of 5 - HT1A receptors , negatively coupled to cAMP , reduces IOP by decreasing the production of aqueous humor , like beta - receptor antagonists which , diminishing the content of cAMP at the postjunctional site , lowers the aqueous humor secretion with a consequent decrease in IOP [ 98 ] .", "entity": [{"entity": "aqueous humor", "entity_type": "Anatomy", "pos": [109, 122]}, {"entity": "aqueous humor", "entity_type": "Anatomy", "pos": [238, 251]}], "task": "NER"}
+{"text": "On the contrary , the administration of 5 - CT induces a rise in IOP , which is partly or entirely caused by an increase in aqueous humor secretion mediated by 5 - HT7 receptors [ 84 ] .", "entity": [{"entity": "aqueous humor", "entity_type": "Anatomy", "pos": [124, 137]}], "task": "NER"}
+{"text": "The other type of serotonin receptor present in the ICB is a 5 - HT2 type .", "entity": [{"entity": "ICB", "entity_type": "Anatomy", "pos": [52, 55]}], "task": "NER"}
+{"text": "Serotonin stimulates the accumulation of inositol phosphates in the ICB and this effect is partially counteracted by the 5 - HT2 antagonists ketanserin , methysergide and mianserin [ 98 ] .", "entity": [{"entity": "ICB", "entity_type": "Anatomy", "pos": [68, 71]}], "task": "NER"}
+{"text": "Studies with ketanserin have demonstrated that , when orally or topically applied , it lowers IOP in animals , healthy volunteers and in glaucomatous patients [ 26 , 34 , 37 , 64 , 75 , 88 , 113 , 126 ] .", "entity": [{"entity": "orally", "entity_type": "Anatomy", "pos": [54, 60]}, {"entity": "glaucomatous", "entity_type": "Anatomy", "pos": [137, 149]}], "task": "NER"}
+{"text": "It has been emphasized that ketanserin also possesses an affinity for alpha1 - adrenoreceptors [ 27 , 36 , 139 ] , and for this reason the effects of ketanserin on IOP may not be entirely caused by its action on 5 - HT2 receptors .", "entity": [], "task": "NER"}
+{"text": "However , data from human studies conducted after oral or topical administration of ketanserin , in which were determined the variations of IOP , total outflow facility and pupil diameter , demonstrated that the alpha1 - adrenoreceptor blocking effect exerted by ketanserin should represent a further aspect of its mechanism of action , probably due to a functional sharing of these receptors [ 64 , 87 ] .", "entity": [{"entity": "oral", "entity_type": "Anatomy", "pos": [50, 54]}, {"entity": "pupil", "entity_type": "Anatomy", "pos": [173, 178]}], "task": "NER"}
+{"text": "Lastly , already in 1992 Martin and co - workers showed the occurrence of a significant correlation between the content of serotonin in the aqueous humor and IOP in the human eye [ 85 ] .", "entity": [{"entity": "aqueous humor", "entity_type": "Anatomy", "pos": [140, 153]}, {"entity": "eye", "entity_type": "Anatomy", "pos": [175, 178]}], "task": "NER"}
+{"text": "In 1981 , Moro and his collaborators found that intravitreal injection of 5 , 6 - dihydroxytryptamine , a serotonergic neurotoxin , causes miosis [ 91 ] .", "entity": [], "task": "NER"}
+{"text": "The identification of 5 - HT7 , but not of 5 - HT1 receptors in the rabbit iris , suggests that this population of serotonergic receptors is involved in the relaxation of the sphincter of the pupil .", "entity": [{"entity": "iris", "entity_type": "Anatomy", "pos": [75, 79]}, {"entity": "sphincter", "entity_type": "Anatomy", "pos": [175, 184]}, {"entity": "pupil", "entity_type": "Anatomy", "pos": [192, 197]}], "task": "NER"}
+{"text": "In fact , one of the function correlate to 5 - HT7 receptor activation includes smooth muscle relaxation observed in a variety of isolated tissue preparations , in which elevation of cAMP concentration was also detected [ 3 , 44 ] .", "entity": [{"entity": "smooth muscle", "entity_type": "Anatomy", "pos": [80, 93]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [139, 145]}], "task": "NER"}
+{"text": "Further evidence for the mediation of the relaxant response via the 5 - HT7 receptor is provided by the localization of messenger ribonucleic acid transcripts encoding the 5 - HT7 receptor in many blood vessels [ 67 ] .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [197, 210]}], "task": "NER"}
+{"text": "This hypothesized mechanism of action is also supported by the fact that various other receptor types , also positively coupled to cAMP , in the iris cause relaxation of the sphincter muscle [ 1 , 28 ] .", "entity": [{"entity": "iris", "entity_type": "Anatomy", "pos": [145, 149]}, {"entity": "sphincter muscle", "entity_type": "Anatomy", "pos": [174, 190]}], "task": "NER"}
+{"text": "Luciferase Assay", "entity": [], "task": "NER"}
+{"text": "For Fig .", "entity": [], "task": "NER"}
+{"text": "1 , 10 ng of TORC1 , 5 ng of TORC2 , and 15 ng of PKAalpha expression plasmids were transfected into HEK293 cells .", "entity": [{"entity": "plasmids", "entity_type": "Anatomy", "pos": [70, 78]}, {"entity": "HEK293 cells", "entity_type": "Anatomy", "pos": [101, 113]}], "task": "NER"}
+{"text": "2 , 800 ng of total DNA consisted of 200 ng of the pMLHoxb1ARE luciferase reporter and 100 ng of each expression plasmid .", "entity": [{"entity": "plasmid", "entity_type": "Anatomy", "pos": [113, 120]}], "task": "NER"}
+{"text": "A lacZ reporter was co - transfected to normalize transfection efficiency .", "entity": [], "task": "NER"}
+{"text": "3A , the amounts of pENTR T2i shRNA ( TORC2 shRNA ) are given within the panel .", "entity": [], "task": "NER"}
+{"text": "3B , 25 , 000 cells per well were plated in 48 - well plates and transfected using Lipofectamine 2000 with the following vectors : 40 ng of pML5xUAS , 40 ng of pGAL - DBD or pGAL - MEIS1A ( 335 - 390 ) , 40 ng of pRSV - PBS or pRSV - PKA , 40 ng of pENTR U6 ( control shRNA ) or pENTR T2i shRNA ( TORC2 shRNA ) , and 100 ng of pRSV - beta - galactosidase .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [14, 19]}], "task": "NER"}
+{"text": "At 48 h post - transfection , cell lysates were prepared using 100 mul per well of lysis buffer ( 1 % Triton X - 100 , 1 mm dithiothreitol , 92 . 8 mm K2HPO4 , pH 7 . 8 , 9 . 2 mm KH2PO4 , pH 7 . 8 ) and centrifuged for 5 min at 4 degreesC .", "entity": [{"entity": "cell lysates", "entity_type": "Anatomy", "pos": [30, 42]}], "task": "NER"}
+{"text": "A 20 - mul aliquot of the supernatant was added to 12 . 5 mul of assay buffer ( 20 mm ATP , 40 mm MgCl2 , 0 . 4 m Tris - Cl , pH 7 . 8 ) .", "entity": [{"entity": "supernatant", "entity_type": "Anatomy", "pos": [26, 37]}], "task": "NER"}
+{"text": "The mixture was immediately quantified for luciferase activity using a Lumat LB 9507 luminometer ( EG & G Berthold ) that dispensed 100 mul per reaction of luciferin solution , which contains 1 mm d - ( - ) - luciferin ( catalogue number 11626353001 , Roche ) and 0 . 1 m Tris - Cl , pH 7 . 8 .", "entity": [], "task": "NER"}
+{"text": "Implications for Psychological Models of Interval Timing", "entity": [], "task": "NER"}
+{"text": "Several models have been previously applied to interpret data obtained in interval - timing experiments involving gaps ( retention - intervals ) .", "entity": [], "task": "NER"}
+{"text": "A switch model , assuming that during the gap time fails to accumulate due to the opening of a stimulus - controlled switch , predicts that , irrespective of gap and criterion durations , subjects should use a stop rule [ 14 ] , [ 15 ] , [ 30 ] , [ 31 ] .", "entity": [], "task": "NER"}
+{"text": "In contrast , the present data indicate that rats flexibly change their behavior with both gap and criterion duration .", "entity": [], "task": "NER"}
+{"text": "An instructional - ambiguity model proposing that subjects perceive the gap as an ambiguous , ITI - like event , predicts that manipulations that render the gap similar to the ITI should reset the clock , while manipulations that render the gap dissimilar from the ITI should stop the clock [ 37 ] .", "entity": [], "task": "NER"}
+{"text": "Because in our experiment the gap and ITI were identical ( dark ) this hypothesis predicts the use of the same rule ( reset ) at all gap and criteria durations , in contrast to the current data showing the use of different rules for different temporal criteria .", "entity": [], "task": "NER"}
+{"text": "To account for the flexible use of the run / stop / reset rules by rats and pigeons , Cabeza de Vaca et al .", "entity": [], "task": "NER"}
+{"text": "[ 38 ] proposed a passive memory - decay model which assumes that subjective time - - stored in WM - - decays passively during the gap .", "entity": [], "task": "NER"}
+{"text": "This model predicts that the effect of a gap should depend solely on absolute gap duration , but not on criterion duration , as found here ( Fig . 1B - D ) .", "entity": [], "task": "NER"}
+{"text": "These models can not account for the differential effects of gaps on multiple intervals .", "entity": [], "task": "NER"}
+{"text": "In contrast to these alternatives , the present resource allocation model assumes that during the gaps resources are re - allocated ( diverted away from timing ) , each clock is unable to maintain its current subjective time in WM , and the response is delayed [ 16 ] , [ 17 ] , [ 27 ] in proportion to the perceived salience of the distracter relative to the times signal [ 34 ] , [ 35 ] .", "entity": [], "task": "NER"}
+{"text": "Indeed , the effect of a gap is affected by the contrast in intensity between the gap and the timed signal [ 27 ] , [ 34 ] , [ 39 ] and by the perceptual acuity of the subjects [ 27 ] .", "entity": [], "task": "NER"}
+{"text": "Importantly , the predictions of this resource re - allocation model are not restricted to retention - intervals ( i . e . , gaps ) , but extend to distracters presented during the continuous presentation of a timed signal .", "entity": [], "task": "NER"}
+{"text": "Previous data were quantitatively accounted for by assuming that during a gap and / or distracter the accumulated time decays at a rate that varies with the relative salience of the distracter to the timed signal [ 25 ] , [ 26 ] , [ 35 ] .", "entity": [], "task": "NER"}
+{"text": "Here we found that the comparison between the gap and the ( multiple ) timed signal ( s ) extends to the temporal domain .", "entity": [], "task": "NER"}
+{"text": "Simulations indicate that both the differential effect of the gap on multiple durations , and the gradual hierarchical reset due to increasing gap duration can be quantitatively accounted for assuming that the three clocks have separate resources re - allocated independently during a gap at a rate proportional to the ratio g / Tk between the duration of the gap and each criterion duration ( Fig . 2A : D - Model ) .", "entity": [], "task": "NER"}
+{"text": "SUMMARY", "entity": [], "task": "NER"}
+{"text": "This is a prospective study carried out to determine the outcome of patients who refuse cystectomy after receiving neoadjuvant chemotherapy for muscle - invasive bladder cancer .", "entity": [{"entity": "muscle - invasive bladder cancer", "entity_type": "Anatomy", "pos": [144, 176]}], "task": "NER"}
+{"text": "Sixty - three patients were evaluated between 1995 and 2001 who declined to undergo a planned cystectomy because they achieved a complete clinical response to neoadjuvant cisplatin - based chemotherapy .", "entity": [], "task": "NER"}
+{"text": "Herr assessed patient , tumor and treatment features for a median follow - up of 86 months , all patients being followed - up for more than 5 years .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [24, 29]}], "task": "NER"}
+{"text": "Forty patients ( 64 % ) survived , with 54 % of them having an intact functioning bladder .", "entity": [{"entity": "bladder", "entity_type": "Anatomy", "pos": [82, 89]}], "task": "NER"}
+{"text": "The number and size of invasive tumors were strongly associated with the overall survival .", "entity": [{"entity": "invasive tumors", "entity_type": "Anatomy", "pos": [23, 38]}], "task": "NER"}
+{"text": "The most significant treatment variable predicting better survival was complete resection of the invasive tumor on restaging transurethral resection ( TUR ) before starting chemotherapy .", "entity": [{"entity": "invasive tumor", "entity_type": "Anatomy", "pos": [97, 111]}], "task": "NER"}
+{"text": "Of 23 patients ( 36 % ) who subsequently died of disease , 19 ( 30 % ) relapsed with invasive cancer in the bladder .", "entity": [{"entity": "invasive cancer", "entity_type": "Anatomy", "pos": [85, 100]}, {"entity": "bladder", "entity_type": "Anatomy", "pos": [108, 115]}], "task": "NER"}
+{"text": "Over 90 % of the surviving patients had solitary , small and low - stage invasive tumors completely resected and 83 % survived without relapses in the bladder . [ 1 ]", "entity": [{"entity": "invasive tumors", "entity_type": "Anatomy", "pos": [73, 88]}, {"entity": "bladder", "entity_type": "Anatomy", "pos": [151, 158]}], "task": "NER"}
+{"text": "COMMENTS", "entity": [], "task": "NER"}
+{"text": "Recurrent anterior vaginal wall prolapse can develop in more than 20 % of patients undergoing traditional anterior colporrhaphy .", "entity": [{"entity": "anterior vaginal wall", "entity_type": "Anatomy", "pos": [10, 31]}], "task": "NER"}
+{"text": "In light of this high recurrence rate many surgeons have been incorporating synthetic or allograft mesh to augment the repair .", "entity": [], "task": "NER"}
+{"text": "In this study there are some shortcomings , including retrospective design , short follow - up for a study spanning almost six years and a lack of validated questionnaires .", "entity": [], "task": "NER"}
+{"text": "Authors report a negative experience with porcine dermis , both in terms of success and extrusion rate .", "entity": [{"entity": "dermis", "entity_type": "Anatomy", "pos": [50, 56]}], "task": "NER"}
+{"text": "However , others have reported better outcome [ 1 ] which may be due to different follow - up times and outcome measures .", "entity": [], "task": "NER"}
+{"text": "Apart from this , biological grafts are also associated with allergic reactions and disease transmission .", "entity": [{"entity": "grafts", "entity_type": "Anatomy", "pos": [29, 35]}], "task": "NER"}
+{"text": "There is paucity of data regarding prospective randomized trials on the use of these biomaterials prior to their widespread human need which might help in reducing such type of experiences .", "entity": [], "task": "NER"}
+{"text": "Unless such data are available surgeons should give serious thought prior to embarking on the use of such biological materials . [ 2 ]", "entity": [], "task": "NER"}
+{"text": "Opioid analgesics are generally used to combat the pain associated with cancerous conditions .", "entity": [{"entity": "cancerous", "entity_type": "Anatomy", "pos": [72, 81]}], "task": "NER"}
+{"text": "These agents not only inhibit respiratory function and cause constipation , but also induce other significant side effects such as addiction and tolerance , all of which further contribute to a reduced quality of life for cancer patients .", "entity": [{"entity": "respiratory", "entity_type": "Anatomy", "pos": [30, 41]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [222, 228]}], "task": "NER"}
+{"text": "Thus , in the present study , the effects of electro - acupuncture treatment ( EA ) on mechanical allodynia were examined in a cancer pain mouse model .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [127, 133]}], "task": "NER"}
+{"text": "2 . 1 .", "entity": [], "task": "NER"}
+{"text": "Biological samples", "entity": [], "task": "NER"}
+{"text": "Placental tissues from the first trimester legally induced abortions ( 8 - 12 weeks of gestation ) were obtained from the Department of Obstetrics and Gynecology at the Broussais , Saint Vincent de Paul and Cochin Hospitals .", "entity": [{"entity": "Placental tissues", "entity_type": "Anatomy", "pos": [0, 17]}], "task": "NER"}
+{"text": "Second trimester placental tissues were collected at the time of termination of pregnancy at 15 and 25 weeks of gestation ( in weeks of amenorrhea ) in trisomy 21 - affected pregnancies .", "entity": [{"entity": "placental tissues", "entity_type": "Anatomy", "pos": [17, 34]}], "task": "NER"}
+{"text": "Fetal Down syndrome was diagnosed by karyotyping of amniotic fluid cells .", "entity": [{"entity": "Fetal", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "amniotic fluid cells", "entity_type": "Anatomy", "pos": [52, 72]}], "task": "NER"}
+{"text": "The indication of amniocentesis was the maternal age .", "entity": [], "task": "NER"}
+{"text": "Term placentas were obtained after elective cesarean section from healthy mothers near term with uncomplicated pregnancies .", "entity": [{"entity": "placentas", "entity_type": "Anatomy", "pos": [5, 14]}], "task": "NER"}
+{"text": "With written informed consent of the pregnant woman , the following samples were collected at term : a fragment of the placenta , umbilical cord fetal blood and maternal blood .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [68, 75]}, {"entity": "fragment", "entity_type": "Anatomy", "pos": [103, 111]}, {"entity": "placenta", "entity_type": "Anatomy", "pos": [119, 127]}, {"entity": "umbilical cord fetal blood", "entity_type": "Anatomy", "pos": [130, 156]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [170, 175]}], "task": "NER"}
+{"text": "The placenta biopsy sample was collected at a depth of 1 cm and at a distance of 8 cm from the edge of the placenta , with the maternal side facing upward .", "entity": [{"entity": "placenta biopsy sample", "entity_type": "Anatomy", "pos": [4, 26]}, {"entity": "placenta", "entity_type": "Anatomy", "pos": [107, 115]}], "task": "NER"}
+{"text": "The use of these biological samples was approved by local ethical committee .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [28, 35]}], "task": "NER"}
+{"text": "Villous cytotrophoblastic cells were isolated by sequential enzymatic digestion of chorionic villi from the first trimester , second trimester and term placenta and purified on a discontinuous percoll gradient , as described previously . 47 - 49 These cells were positively stained for cytokeratin 7 at 95 % , indicating the cytotrophoblastic origin of the cells .", "entity": [{"entity": "Villous cytotrophoblastic cells", "entity_type": "Anatomy", "pos": [0, 31]}, {"entity": "chorionic villi", "entity_type": "Anatomy", "pos": [83, 98]}, {"entity": "placenta", "entity_type": "Anatomy", "pos": [152, 160]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [252, 257]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [357, 362]}], "task": "NER"}
+{"text": "Placental fibroblasts were isolated by prolonged enzymatic digestion from first trimester chorionic villi as in Malassine et al . 50 Fibroblastic cells ( 1 . 25 x 105 cells / mL ) were plated on 35 - mm plastic dishes ( TPP , Switzerland ) and cultured for 48 h , and the culture medium was changed daily .", "entity": [{"entity": "Placental fibroblasts", "entity_type": "Anatomy", "pos": [0, 21]}, {"entity": "chorionic villi", "entity_type": "Anatomy", "pos": [90, 105]}, {"entity": "Fibroblastic cells", "entity_type": "Anatomy", "pos": [133, 151]}], "task": "NER"}
+{"text": "These cultured fibroblasts were characterized using immunocytochemistry .", "entity": [{"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [15, 26]}], "task": "NER"}
+{"text": "It was found that 98 % of the cells were vimentin positive and also positive for a monoclonal antibody against specific fibroblast antigen ( clone ASO2 , Dianova , Hamburg , Germany ) .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [30, 35]}, {"entity": "fibroblast", "entity_type": "Anatomy", "pos": [120, 130]}], "task": "NER"}
+{"text": "Owing to the limited amount of cells , only DNA was extracted .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [31, 36]}], "task": "NER"}
+{"text": "Methods", "entity": [], "task": "NER"}
+{"text": "Therefore , we developed a reciprocal system of a full - length HIV packaging cell line and a shortened HI - viral shuttle vector .", "entity": [{"entity": "full - length HIV packaging cell line", "entity_type": "Anatomy", "pos": [50, 87]}], "task": "NER"}
+{"text": "The Tat - deficient packaging construct is stably integrated in a VSVG - pseudotyped cell line and transactivated by the shuttle vector by expression of TATGFP from a heterologous promoter which also indicates positive cells .", "entity": [{"entity": "VSVG - pseudotyped cell line", "entity_type": "Anatomy", "pos": [66, 94]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [219, 224]}], "task": "NER"}
+{"text": "Expression of the HI - viral structure proteins is driven by a natural 5 ' LTR promoter and a 3 ' polyadenylation signal , whereas the envelope expression out of the shuttle vector is achieved by an IRES .", "entity": [{"entity": "LTR", "entity_type": "Anatomy", "pos": [75, 78]}, {"entity": "envelope", "entity_type": "Anatomy", "pos": [135, 143]}], "task": "NER"}
+{"text": "This system of two vectors is tightly controllable and bypasses the problem of limited packaging capacity into HIV - 1 virions .", "entity": [], "task": "NER"}
+{"text": "Percutaneous coronary intervention for the very late stent thrombosis in right coronary artery .", "entity": [{"entity": "Percutaneous", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "coronary", "entity_type": "Anatomy", "pos": [13, 21]}, {"entity": "right coronary artery", "entity_type": "Anatomy", "pos": [73, 94]}], "task": "NER"}
+{"text": "A : a balloon angioplasty was performed to treat total occlusion of the stented right coronary artery .", "entity": [{"entity": "right coronary artery", "entity_type": "Anatomy", "pos": [80, 101]}], "task": "NER"}
+{"text": "B : final coronary angiogram showed good distal flow without residual stenosis .", "entity": [{"entity": "coronary", "entity_type": "Anatomy", "pos": [10, 18]}], "task": "NER"}
+{"text": "All - cause mortality in RALES and EPHESUS ( adapted from [ 4 ] and [ 5 ] ) .", "entity": [], "task": "NER"}
+{"text": "Mean follow - up period is 24 months in RALES and 16 months in EPHESUS", "entity": [], "task": "NER"}
+{"text": "Pre - publication history", "entity": [], "task": "NER"}
+{"text": "The pre - publication history for this paper can be accessed here :", "entity": [], "task": "NER"}
+{"text": "http : / / www . biomedcentral . com / 1471 - 2377 / 9 / 57 / prepub", "entity": [], "task": "NER"}
+{"text": "Magnetic resonance imaging of axial plan with intravenous contrast gadolinium - BOPTA demonstrating a mass adherent to the right ventricular wall .", "entity": [{"entity": "intravenous", "entity_type": "Anatomy", "pos": [46, 57]}, {"entity": "mass", "entity_type": "Anatomy", "pos": [102, 106]}, {"entity": "right ventricular wall", "entity_type": "Anatomy", "pos": [123, 145]}], "task": "NER"}
+{"text": "Additional file 3", "entity": [], "task": "NER"}
+{"text": "Primers used in this study .", "entity": [], "task": "NER"}
+{"text": "All of the primers used for generating PCR products for microinjection and site - direct mutagenesis are listed .", "entity": [], "task": "NER"}
+{"text": "2 .", "entity": [], "task": "NER"}
+{"text": "We conducted a systematic study of patients hospitalized from August 2006 until September 2007 at the Yerevan City and the Republican Dispensaries , the two reference TB hospitals in Armenia .", "entity": [], "task": "NER"}
+{"text": "Following focus group discussions and pilot testing to refine the survey instrument , patient interviews began in the fall of 2006 and were conducted by trained students in the public health program of the American University of Armenia .", "entity": [], "task": "NER"}
+{"text": "Students received training by the study designer ( SO ) on principles of interview ethics and interviewing processes .", "entity": [], "task": "NER"}
+{"text": "Most patient interviews were conducted at the Republican Dispensary in Abovian Marz , the national TB diagnostic and treatment facility to which all suspected cases throughout the country are referred for diagnostic confirmation .", "entity": [], "task": "NER"}
+{"text": "In the past several years , strong financial support has been provided to Armenia by a number of international organizations , such as the German Gesellschaft fur Technische Zusammenarbeit ( GTZ ) , the Global Fund to Fight AIDS , Tuberculosis and Malaria , and the Red Cross , which has enabled both microscopic and culture examinations for each TB case to be performed at the National Reference Laboratory located at the Republican TB Dispensary .", "entity": [{"entity": "culture", "entity_type": "Anatomy", "pos": [317, 324]}], "task": "NER"}
+{"text": "All culture - confirmed TB cases are admitted as in - patients while undergoing the initial phase of therapy .", "entity": [{"entity": "culture", "entity_type": "Anatomy", "pos": [4, 11]}], "task": "NER"}
+{"text": "Because all confirmed TB patients in Armenia are referred to one of these dispensaries for treatment , this population represents all known TB cases in the country .", "entity": [], "task": "NER"}
+{"text": "Therefore , all culture - confirmed TB in - patients present at the time of the interviewer visits were eligible for inclusion in the study ( the study group included both new and relapsed patients ) .", "entity": [{"entity": "culture", "entity_type": "Anatomy", "pos": [16, 23]}], "task": "NER"}
+{"text": "Our systematic sample of the inpatient TB population - - in which interviewers visited every hospital room to identify patients willing to participate - - yielded a participation rate of approximately 80 % ( a total of 240 patients ) .", "entity": [], "task": "NER"}
+{"text": "Interviewers collected demographic information and asked each patient to recall when they first began to feel ill , what symptoms they experienced , how long after symptom onset they waited to see a doctor , their reasons for delaying medical evaluation , the type of facility at which they first sought care , the initial diagnosis , if they had been referred for further evaluation , and their adherence to treatment once diagnosed with TB .", "entity": [], "task": "NER"}
+{"text": "In 2006 , 129 of the planned 250 surveys were completed .", "entity": [], "task": "NER"}
+{"text": "Data collection resumed in the fall of 2007 and a total of 240 interviews were conducted .", "entity": [], "task": "NER"}
+{"text": "Summary", "entity": [], "task": "NER"}
+{"text": "Kindt et al . 1 published a report entitled \" Intestinal immune activation in presumed post - infectious functional syspepsia \" in the August issue of Neurogastroenterology and Motility in 2009 .", "entity": [{"entity": "Intestinal", "entity_type": "Anatomy", "pos": [46, 56]}], "task": "NER"}
+{"text": "By comparing the signs of inflammation and the degree of hyperplasia of the enterochromaffin cells ( EC ) in duodenal biopsies obtained from patients with presumed post - infectious functional dyspepsia ( PI - FD ) and unspecified - onset functional dyspepsia ( U - FD ) , they showed that PI - FD is associated with persistence of focal T - cell aggregates , decrease in CD4 + cells and increased macrophage counts surrounding the crypts , without any significant differences in the numbers of EC or chromogranin A ( CA ) - positive cells ( mast cells ) .", "entity": [{"entity": "enterochromaffin cells", "entity_type": "Anatomy", "pos": [76, 98]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [101, 103]}, {"entity": "duodenal biopsies", "entity_type": "Anatomy", "pos": [109, 126]}, {"entity": "T - cell", "entity_type": "Anatomy", "pos": [338, 346]}, {"entity": "CD4 + cells", "entity_type": "Anatomy", "pos": [372, 383]}, {"entity": "macrophage", "entity_type": "Anatomy", "pos": [398, 408]}, {"entity": "crypts", "entity_type": "Anatomy", "pos": [432, 438]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [495, 497]}, {"entity": "chromogranin A ( CA ) - positive cells", "entity_type": "Anatomy", "pos": [501, 539]}, {"entity": "mast cells", "entity_type": "Anatomy", "pos": [542, 552]}], "task": "NER"}
+{"text": "This finding may indicate impaired ability of the immune system in these cases to terminate the inflammatory response after an acute insult .", "entity": [{"entity": "immune system", "entity_type": "Anatomy", "pos": [50, 63]}], "task": "NER"}
+{"text": "Temporary migration module", "entity": [], "task": "NER"}
+{"text": "A temporary migration census module was conducted in 2002 and 2007 .", "entity": [], "task": "NER"}
+{"text": "People who were identified as temporary migrants were entered into the module , and a household respondent answered questions about the migration .", "entity": [], "task": "NER"}
+{"text": "Key areas included the duration of migration , destination , reasons for migration , return pattern , communication pattern , remittances , linked moves and child care arrangements .", "entity": [], "task": "NER"}
+{"text": "MOR1K expression and binding pattern .", "entity": [], "task": "NER"}
+{"text": "( A ) The schematic diagram illustrates the exonic composition and relative positions of PCR primers designed to amplify the major MOR1 isoform and the newly identified alternative MOR1K isoform .", "entity": [], "task": "NER"}
+{"text": "The relative positions of translation initiation start and stop codons are designated by ATG and TGA , respectively .", "entity": [], "task": "NER"}
+{"text": "The predicted protein structure of MOR1 and MOR1K isoforms is schematically presented .", "entity": [], "task": "NER"}
+{"text": "Translation of the MOR1K variant results in a 6TM receptor , truncated at the N - terminus .", "entity": [], "task": "NER"}
+{"text": "( B ) Real - time PCR was performed on total RNA samples from the human brain regions known to express MOR1 .", "entity": [{"entity": "brain regions", "entity_type": "Anatomy", "pos": [72, 85]}], "task": "NER"}
+{"text": "Primers specific for exons 1 and 2 were used to measure MOR1 and primers specific for exons 13 and exon 2 were used to measure MOR1K [ 32 ] .", "entity": [], "task": "NER"}
+{"text": "GAP3DH was used as a control for cDNA loading and PCR efficiency .", "entity": [], "task": "NER"}
+{"text": "( C ) Confocal images of C - terminally MYC - tagged MOR1 or FLAG - tagged MOR1K overexpressed in HEK293 cells and stained with either Anti - MYC - Tag Antibody ( Alexa Fluor 647 Conjugate ) or Anti - DYKDDDDK Tag Antibody ( Alexa Fluor 555 conjugate ) .", "entity": [{"entity": "HEK293 cells", "entity_type": "Anatomy", "pos": [98, 110]}], "task": "NER"}
+{"text": "Cells transfected with MOR1 showed membrane expression of receptor , while cell transfected with MOR1K express receptor only intracellular .", "entity": [{"entity": "Cells", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "membrane", "entity_type": "Anatomy", "pos": [35, 43]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [75, 79]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [125, 138]}], "task": "NER"}
+{"text": "( D ) Confocal images of C - terminally FLAG - tagged MOR1K overexpressed in Be2C cells and stained with either Anti - FLAG M2 Antibody Alexa Fluor Conjugate or fluorescent - labeled naloxone ( FNAL ) .", "entity": [{"entity": "Be2C cells", "entity_type": "Anatomy", "pos": [77, 87]}], "task": "NER"}
+{"text": "Cells transfected with MOR1K showed intracellular retention of FNAL that co - localized with antibody - labeled receptor .", "entity": [{"entity": "Cells", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [36, 49]}], "task": "NER"}
+{"text": "( E ) The binding of naloxone to MOR1K was assessed using flow cytometry to measure FNAL retention .", "entity": [], "task": "NER"}
+{"text": "Be2C cells transfected with either MOR1 or MOR1K isoforms showed increased retention of FNAL at concentrations of 0 . 1 and 1 muM .", "entity": [{"entity": "Be2C cells", "entity_type": "Anatomy", "pos": [0, 10]}], "task": "NER"}
+{"text": "FNAL retention was abolished in the presence of 10 muM unlabelled naloxone ( Nal ) .", "entity": [], "task": "NER"}
+{"text": "In panel E , data are presented as mean + SEM .", "entity": [], "task": "NER"}
+{"text": "* P < 0 . 05 different from controls ) .", "entity": [], "task": "NER"}
+{"text": "MBH made the pathological diagnosis and was responsible for conception and final approval of the manuscript .", "entity": [], "task": "NER"}
+{"text": "MB carried out the literature search and drafted the manuscript .", "entity": [], "task": "NER"}
+{"text": "IC carried out the surgical procedure and reviewed the manuscript .", "entity": [], "task": "NER"}
+{"text": "RM carried out the surgical procedure , provided clinical details , followed up our patient and obtained her consent to publish this case report .", "entity": [], "task": "NER"}
+{"text": "All authors read and approved the final manuscript .", "entity": [], "task": "NER"}
+{"text": "Breast cancer", "entity": [], "task": "NER"}
+{"text": "The incidence of breast cancer is no higher than in the rest of the population .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [17, 30]}], "task": "NER"}
+{"text": "Tamoxifen should not be used as it may worsen symptoms [ 43 ] .", "entity": [], "task": "NER"}
+{"text": "Women need also specific management for treatment of HAE .", "entity": [], "task": "NER"}
+{"text": "Short term prophylaxis : three options are available : attenuated androgens , tranexamic acid or C1Inh concentrate .", "entity": [], "task": "NER"}
+{"text": "There is no specific problem for the use of theses drugs for short course in female patients .", "entity": [], "task": "NER"}
+{"text": "In case of short term prophylaxis with attenuated androgens , no virilisation has been observed [ 44 , 45 ] .", "entity": [], "task": "NER"}
+{"text": "Acute attack treatment : there is no specific problem for the use of C1inh concentrate , tranexamic acid , icatibant ; or ecallantide in female patients .", "entity": [], "task": "NER"}
+{"text": "RNA extraction and reverse transcription", "entity": [], "task": "NER"}
+{"text": "Total RNA were extracted from cells using either Trizol reagent ( Invitrogen ) or RNeasy kit ( Qiagen ) and treated with DNaseI reagent ( Macherey - Nagel ) for 30 min at room temperature .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [30, 35]}], "task": "NER"}
+{"text": "Reverse transcriptions were performed using 1microg total RNA and the High capacity cDNA reverse transcription kit with RNase Inhibitor ( Applied Biosystems ) .", "entity": [], "task": "NER"}
+{"text": "Statistical results showing significant differences between habitats .", "entity": [], "task": "NER"}
+{"text": "Definition of pathogens", "entity": [], "task": "NER"}
+{"text": "It remains difficult to determine whether the organisms detected by the DNA Detection Kit are true pathogens .", "entity": [], "task": "NER"}
+{"text": "This also applies , although to a much lesser degree , to conventional blood culture analysis .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [71, 76]}], "task": "NER"}
+{"text": "However , detected organisms were considered to be pathogens if the results of culture tests from samples of the suspected infectious sites coincided with the results of DNA Detection Kit or blood culture analysis .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [98, 105]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [191, 196]}], "task": "NER"}
+{"text": "The culture data of sputum , urine , pus and drainage fluid were used to define the pathogens .", "entity": [{"entity": "sputum", "entity_type": "Anatomy", "pos": [20, 26]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [29, 34]}, {"entity": "pus", "entity_type": "Anatomy", "pos": [37, 40]}, {"entity": "fluid", "entity_type": "Anatomy", "pos": [54, 59]}], "task": "NER"}
+{"text": "A decision as to whether an identified organism was a pathogen was taken based on the decision tree shown in Figure 1 .", "entity": [], "task": "NER"}
+{"text": "Thus , when the same organism was detected by both DNA Detection Kit and blood culture analysis , the detected organism was considered an infectious pathogen .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [73, 78]}], "task": "NER"}
+{"text": "If there was a discrepancy between the organism that was detected by SeptiFast analysis and that detected by blood culture analysis , or if an organism was only detected in one of these tests , then other samples taken from the infection site were analyzed .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [109, 114]}, {"entity": "samples", "entity_type": "Anatomy", "pos": [205, 212]}], "task": "NER"}
+{"text": "If this second culture test of the suspected infectious site revealed the presence of the same organism , this organism was considered to be a pathogen .", "entity": [], "task": "NER"}
+{"text": "If the microbial strain was only detected once for a sample , we then checked the second culture results in the suspected infectious sites .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [17, 23]}, {"entity": "sample", "entity_type": "Anatomy", "pos": [53, 59]}], "task": "NER"}
+{"text": "If this result identified the same strain as that identified by SeptiFast analysis then it was decided that this strain was a pathogen .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [35, 41]}, {"entity": "strain", "entity_type": "Anatomy", "pos": [113, 119]}], "task": "NER"}
+{"text": "However , if the strain was still only detected in some of the assays , we next determined if the patient involved suffered from sepsis .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [17, 23]}], "task": "NER"}
+{"text": "Sepsis is defined as SIRS caused by infection .", "entity": [], "task": "NER"}
+{"text": "The definition of sepsis that we used was based on the International Sepsis Forum Definition of Infection at the ICU Consensus Conference [ 7 ] .", "entity": [], "task": "NER"}
+{"text": "However , if the underlying disease is acute lymphoma leukemia ( ALL ) , malignant lymphoma ( ML ) , or acute myelogenous leukemia ( AML ) , the definition of infection is defined as the ability to detect infectious organisms by blood culture analysis .", "entity": [{"entity": "acute lymphoma leukemia", "entity_type": "Anatomy", "pos": [39, 62]}, {"entity": "ALL", "entity_type": "Anatomy", "pos": [65, 68]}, {"entity": "malignant lymphoma", "entity_type": "Anatomy", "pos": [73, 91]}, {"entity": "ML", "entity_type": "Anatomy", "pos": [94, 96]}, {"entity": "acute myelogenous leukemia", "entity_type": "Anatomy", "pos": [104, 130]}, {"entity": "AML", "entity_type": "Anatomy", "pos": [133, 136]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [229, 234]}], "task": "NER"}
+{"text": "If the patient was not defined as having sepsis when whole blood was administered to the patient , we decided that the strain detected by subsequent DNA Detection Kit or blood culture analysis was not a pathogen .", "entity": [{"entity": "whole blood", "entity_type": "Anatomy", "pos": [53, 64]}, {"entity": "strain", "entity_type": "Anatomy", "pos": [119, 125]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [170, 175]}], "task": "NER"}
+{"text": "Flowchart for pathogen decision .", "entity": [], "task": "NER"}
+{"text": "Samples were defined as negative for pathogens if a pathogen could not be detected by any method of analysis within seven days , and if another type of culture test did not detect this pathogen but could detect other organisms .", "entity": [{"entity": "Samples", "entity_type": "Anatomy", "pos": [0, 7]}], "task": "NER"}
+{"text": "CoNS bacteria , which are represented by the Staphylococcus epidermidis ( S . epidermidis ) and Streptococcus spp . are indigenous bacteria and often cause contamination in assays of pathogens .", "entity": [], "task": "NER"}
+{"text": "Therefore , when CoNS or Streptococcus spp . were detected by blood culture and SeptiFast analysis , the following criteria were applied to define whether these strains represented a pathogenic infection : ( 1 ) Tests were performed at least twice within 48 hours before and after CoNS were detected by blood culture or SeptiFast analysis ; ( 2 ) CoNS or Streptococcus spp . were detected in two different blood culture tests that were separately performed twice within 48 hours ; and , ( 3 ) CoNS or Streptococcus spp . were detected twice or more in tests that were performed three times [ 11 - 15 ] .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "strains", "entity_type": "Anatomy", "pos": [161, 168]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [303, 308]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [406, 411]}], "task": "NER"}
+{"text": "If a sample ' s results met any of these three criteria , then the sample was evaluated as a pathogen .", "entity": [{"entity": "sample", "entity_type": "Anatomy", "pos": [5, 11]}, {"entity": "sample", "entity_type": "Anatomy", "pos": [67, 73]}], "task": "NER"}
+{"text": "The distinction between pathogen and contamination was also determined for CoNS or Streptococcus spp . from the crossing point ( Cp ) obtained using the LightCycler analysis software v4 . 05 .", "entity": [], "task": "NER"}
+{"text": "The Cp represents the point in the amplification cycle where the amplification curve crosses the detection threshold .", "entity": [], "task": "NER"}
+{"text": "When CoNS or Streptococcus spp . were detected using the LightCycler analysis software v4 . 05 , a Cp of less than 20 was defined as indicating a pathogen and a Cp of over 20 was defined as contamination by checking the amplification curve .", "entity": [], "task": "NER"}
+{"text": "Conclusion :", "entity": [], "task": "NER"}
+{"text": "This study demonstrates that surgery plus chemotherapy and radiation therapy is helpful for treating patients with pelvic Ewing ' s sarcoma , particularly in achieving local control .", "entity": [{"entity": "pelvic Ewing ' s sarcoma", "entity_type": "Anatomy", "pos": [115, 139]}], "task": "NER"}
+{"text": "Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters ( A2 )", "entity": [], "task": "NER"}
+{"text": "x y z Uiso * / Ueq", "entity": [], "task": "NER"}
+{"text": "C1 0 . 3043 ( 3 ) 0 . 1779 ( 4 ) 0 . 79280 ( 13 ) 0 . 0445 ( 6 )", "entity": [], "task": "NER"}
+{"text": "C2 0 . 4358 ( 4 ) 0 . 1697 ( 5 ) 0 . 84058 ( 17 ) 0 . 0604 ( 8 )", "entity": [], "task": "NER"}
+{"text": "H2 0 . 4201 0 . 1476 0 . 8809 0 . 072 *", "entity": [], "task": "NER"}
+{"text": "C3 0 . 5911 ( 4 ) 0 . 1953 ( 6 ) 0 . 8269 ( 2 ) 0 . 0783 ( 12 )", "entity": [], "task": "NER"}
+{"text": "H3 0 . 6811 0 . 1914 0 . 8584 0 . 094 *", "entity": [], "task": "NER"}
+{"text": "C4 0 . 6130 ( 4 ) 0 . 2267 ( 6 ) 0 . 7670 ( 2 ) 0 . 0773 ( 11 )", "entity": [], "task": "NER"}
+{"text": "H4 0 . 7180 0 . 2427 0 . 7582 0 . 093 *", "entity": [], "task": "NER"}
+{"text": "C5 0 . 4818 ( 5 ) 0 . 2344 ( 5 ) 0 . 7202 ( 2 ) 0 . 0746 ( 10 )", "entity": [], "task": "NER"}
+{"text": "H5 0 . 4980 0 . 2547 0 . 6798 0 . 090 *", "entity": [], "task": "NER"}
+{"text": "C6 0 . 3257 ( 4 ) 0 . 2121 ( 4 ) 0 . 73293 ( 15 ) 0 . 0562 ( 7 )", "entity": [], "task": "NER"}
+{"text": "H6 0 . 2360 0 . 2200 0 . 7015 0 . 067 *", "entity": [], "task": "NER"}
+{"text": "C7 0 . 1252 ( 3 ) 0 . 3838 ( 4 ) 0 . 90059 ( 11 ) 0 . 0400 ( 6 )", "entity": [], "task": "NER"}
+{"text": "C8 0 . 2051 ( 4 ) 0 . 5522 ( 4 ) 0 . 90920 ( 13 ) 0 . 0484 ( 6 )", "entity": [], "task": "NER"}
+{"text": "H8 0 . 2132 0 . 6288 0 . 8758 0 . 058 *", "entity": [], "task": "NER"}
+{"text": "C9 0 . 2725 ( 4 ) 0 . 6041 ( 4 ) 0 . 96827 ( 15 ) 0 . 0558 ( 7 )", "entity": [], "task": "NER"}
+{"text": "C10 0 . 2645 ( 4 ) 0 . 4935 ( 4 ) 1 . 01861 ( 14 ) 0 . 0590 ( 8 )", "entity": [], "task": "NER"}
+{"text": "H10 0 . 3122 0 . 5293 1 . 0582 0 . 071 *", "entity": [], "task": "NER"}
+{"text": "C11 0 . 1830 ( 4 ) 0 . 3278 ( 4 ) 1 . 00819 ( 13 ) 0 . 0534 ( 7 )", "entity": [], "task": "NER"}
+{"text": "C12 0 . 1118 ( 3 ) 0 . 2699 ( 4 ) 0 . 95062 ( 12 ) 0 . 0480 ( 6 )", "entity": [], "task": "NER"}
+{"text": "H12 0 . 0561 0 . 1577 0 . 9451 0 . 058 *", "entity": [], "task": "NER"}
+{"text": "N1 0 . 0494 ( 3 ) 0 . 3297 ( 3 ) 0 . 84009 ( 10 ) 0 . 0441 ( 5 )", "entity": [], "task": "NER"}
+{"text": "H1N 0 . 038 ( 4 ) 0 . 418 ( 3 ) 0 . 8138 ( 12 ) 0 . 053 *", "entity": [], "task": "NER"}
+{"text": "O1 - 0 . 0021 ( 3 ) 0 . 1298 ( 3 ) 0 . 74998 ( 9 ) 0 . 0527 ( 5 )", "entity": [], "task": "NER"}
+{"text": "O2 0 . 1112 ( 3 ) - 0 . 0066 ( 3 ) 0 . 85135 ( 10 ) 0 . 0574 ( 6 )", "entity": [], "task": "NER"}
+{"text": "Cl1 0 . 37237 ( 16 ) 0 . 81541 ( 13 ) 0 . 97944 ( 5 ) 0 . 0927 ( 4 )", "entity": [], "task": "NER"}
+{"text": "Cl2 0 . 16462 ( 15 ) 0 . 18752 ( 15 ) 1 . 07089 ( 4 ) 0 . 0834 ( 4 )", "entity": [], "task": "NER"}
+{"text": "S1 0 . 10584 ( 7 ) 0 . 14095 ( 9 ) 0 . 80800 ( 3 ) 0 . 0412 ( 3 )", "entity": [], "task": "NER"}
+{"text": "Crystal data", "entity": [], "task": "NER"}
+{"text": "C16H20N4", "entity": [], "task": "NER"}
+{"text": "M r = 268 . 36", "entity": [], "task": "NER"}
+{"text": "Monoclinic ,", "entity": [], "task": "NER"}
+{"text": "a = 12 . 819 ( 4 ) A", "entity": [], "task": "NER"}
+{"text": "b = 8 . 441 ( 3 ) A", "entity": [], "task": "NER"}
+{"text": "c = 13 . 310 ( 4 ) A", "entity": [], "task": "NER"}
+{"text": "beta = 95 . 462 ( 5 ) degrees", "entity": [], "task": "NER"}
+{"text": "V = 1433 . 7 ( 8 ) A3", "entity": [], "task": "NER"}
+{"text": "Z = 4", "entity": [], "task": "NER"}
+{"text": "Mo Kalpha radiation", "entity": [], "task": "NER"}
+{"text": "mu = 0 . 08 mm - 1", "entity": [], "task": "NER"}
+{"text": "T = 298 ( 2 ) K", "entity": [], "task": "NER"}
+{"text": "0 . 33 x 0 . 28 x 0 . 21 mm", "entity": [], "task": "NER"}
+{"text": "C15H12ClN3O2S2 F ( 000 ) = 752", "entity": [], "task": "NER"}
+{"text": "Mr = 365 . 85 Dx = 1 . 507 Mg m - 3", "entity": [], "task": "NER"}
+{"text": "Monoclinic , P21 / n Mo Kalpha radiation , lambda = 0 . 71073 A", "entity": [], "task": "NER"}
+{"text": "Hall symbol : - P 2yn Cell parameters from 25 reflections", "entity": [{"entity": "Cell", "entity_type": "Anatomy", "pos": [22, 26]}], "task": "NER"}
+{"text": "a = 10 . 175 ( 2 ) A theta = 9 - 12degrees", "entity": [], "task": "NER"}
+{"text": "b = 8 . 4958 ( 17 ) A micro = 0 . 51 mm - 1", "entity": [], "task": "NER"}
+{"text": "c = 19 . 318 ( 4 ) A T = 293 K", "entity": [], "task": "NER"}
+{"text": "beta = 105 . 01 ( 3 ) degrees Block , yellow", "entity": [], "task": "NER"}
+{"text": "V = 1613 . 0 ( 6 ) A3 0 . 25 x 0 . 15 x 0 . 15 mm", "entity": [], "task": "NER"}
+{"text": "Results and Discussion", "entity": [], "task": "NER"}
+{"text": "Figure 4 shows the frequency response of the device before and after plating cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [77, 82]}], "task": "NER"}
+{"text": "In the frequency range measured ( 4 - 600 Hz ) , only two clear peaks can be seen in the bare device .", "entity": [], "task": "NER"}
+{"text": "After cells had adhered to the surface , there is a shift in both the resonant frequency and the height of these peaks .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [6, 11]}], "task": "NER"}
+{"text": "Table 1 shows the results for this trial and a second trial where the experiment was repeated to confirm the initial results .", "entity": [], "task": "NER"}
+{"text": "At a plating density of 1300 cells / mm2 , there were approximately 140 cells on the portion of the cantilever free to vibrate ( dimensions shown in Figure 1 ) .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [29, 34]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [72, 77]}], "task": "NER"}
+{"text": "Table 1", "entity": [], "task": "NER"}
+{"text": "Cantilever response data from two trials", "entity": [], "task": "NER"}
+{"text": "Experiment # 1 Experiment # 2", "entity": [], "task": "NER"}
+{"text": "Freq .", "entity": [], "task": "NER"}
+{"text": "1 ( kHz ) Amp .", "entity": [], "task": "NER"}
+{"text": "1 ( deg ) Freq .", "entity": [], "task": "NER"}
+{"text": "2 ( kHz ) Amp .", "entity": [], "task": "NER"}
+{"text": "2 ( deg ) Freq .", "entity": [], "task": "NER"}
+{"text": "2 ( deg )", "entity": [], "task": "NER"}
+{"text": "Initial 313 . 0 . 086 375 . 5 . 055 313 . 9 . 091 376 . 5 . 071", "entity": [], "task": "NER"}
+{"text": "With cells 307 . 5 . 031 371 . 0 . 018 308 . 052 370 . 5 . 043", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [5, 10]}], "task": "NER"}
+{"text": "Change 5 . 5 . 055 4 . 5 . 037 5 . 9 . 039 6 . 0 . 028", "entity": [], "task": "NER"}
+{"text": "Figure 4", "entity": [], "task": "NER"}
+{"text": "Phase angle vs . frequency .", "entity": [], "task": "NER"}
+{"text": "( left ) Phase angle of impedance with linear regression line .", "entity": [], "task": "NER"}
+{"text": "( right ) To provide an easier comparison , phase angles have been levelled with respect to the linear regression line that passes through each set of data .", "entity": [], "task": "NER"}
+{"text": "The addition of cells causes the peaks to shift to lower frequencies and decrease in amplitude .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [16, 21]}], "task": "NER"}
+{"text": "The two peaks shown were the only detectable resonances despite the relatively wide frequency range measured .", "entity": [], "task": "NER"}
+{"text": "The electrical detection of resonances is critically compromised by the strong damping imposed by the cell media , making these measurements more challenging than those carried out in air or in a vacuum where resonance peaks show much larger amplitude [ 18 ] .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [102, 106]}], "task": "NER"}
+{"text": "In the desired in vivo application for this work , as a sensor for stent healing , it can be expected that in the course of normal healing the stent will be fully populated with a significantly thicker layer of endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [211, 228]}], "task": "NER"}
+{"text": "In the case of restenosis , this lining would be even thicker .", "entity": [], "task": "NER"}
+{"text": "This may hamper any movement of the cantilever and cause the peaks to eventually become undetectable .", "entity": [], "task": "NER"}
+{"text": "Frequent measurements of the resonant frequencies will differentiate this end state with the possibility of device failure .", "entity": [], "task": "NER"}
+{"text": "The noninvasive nature of these measurements that can be transmitted wirelessly to an external device make this an attractive and low risk option for monitoring healing .", "entity": [], "task": "NER"}
+{"text": "Genome sequencing , assembly and validation", "entity": [], "task": "NER"}
+{"text": "DNA shotgun libraries with average insert sizes of 1 . 6 and 6 . 5 kb were constructed in pUC118 ( TaKaRa ) , whereas a fosmid library with average insert size of 37 kb was constructed in pCC1FOS ( EPICENTRE ) as described previously . 18 , 19 A total of 50 400 clones ( 34 560 , 10 752 and 5088 clones from libraries with 1 . 6 , 6 . 5 and 37 kb inserts , respectively ) were subjected to sequencing from both ends of the inserts on either ABI 3730xl DNA Analyzer ( Applied Biosystems ) or Base Station DNA Fragment Analyzer BST - 0100 ( MJ Research , Inc . ) .", "entity": [], "task": "NER"}
+{"text": "Sequence reads were trimmed at a threshold quality value of 20 by Phred and assembled by Phrap and CONSED assembly tools . 20 , 21 For alignment and validation of contigs , Optical Mapping ( OpGen ) was used .", "entity": [], "task": "NER"}
+{"text": "Gaps between contigs were closed by sequencing PCR products , which bridge two neighboring contigs .", "entity": [], "task": "NER"}
+{"text": "Finally , each base of K . setae NBRC 14216T genome was ensured to be sequenced from multiple clones and from both directions with Phrap quality score > = 70 or from one direction with Phrap quality score > = 40 .", "entity": [], "task": "NER"}
+{"text": "Chromosomal terminus was determined after attaching adenine and thymine homopolymers to the naked 3 ' ends of the chromosome as described previously . 5", "entity": [{"entity": "Chromosomal", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "chromosome", "entity_type": "Anatomy", "pos": [114, 124]}], "task": "NER"}
+{"text": "Correlation matrix for ear ( E ) traits in 2006 ; data from water stress plots ( lower left ) and well - watered plots ( upper right ) of 350 maize inbreds", "entity": [{"entity": "ear", "entity_type": "Anatomy", "pos": [23, 26]}], "task": "NER"}
+{"text": "FUNDING", "entity": [], "task": "NER"}
+{"text": "National Institutes of Health grants , National Institute of Environmental Health Sciences and the National Library of Medicine ( R01 ES014065 and R01 ES014065 - 04S1 to CTD ) ; INBRE program of the National Center for Research Resources ( P20 RR016463 ) .", "entity": [], "task": "NER"}
+{"text": "Funding for open access charge : NIEHS grant ( R01 ES014065 ) .", "entity": [], "task": "NER"}
+{"text": "Conflict of interest statement .", "entity": [], "task": "NER"}
+{"text": "None declared .", "entity": [], "task": "NER"}
+{"text": "Tarsoconjunctival flap after division", "entity": [{"entity": "Tarsoconjunctival flap", "entity_type": "Anatomy", "pos": [0, 22]}], "task": "NER"}
+{"text": "MoClo cloning protocol", "entity": [], "task": "NER"}
+{"text": "Restriction - ligations were set up by pipetting in one tube approximately 40 fmol ( ~ 100 ng of DNA for a 4 kb plasmid ) of each DNA component ( PCR product or plasmid ) , 10 U of the required restriction enzyme ( BsaI or BpiI ) and 10 U T4 DNA ligase ( using high concentration ligase , 20 U / microl ) in Promega ligation buffer in a final reaction volume of 20 microl .", "entity": [{"entity": "plasmid", "entity_type": "Anatomy", "pos": [112, 119]}, {"entity": "plasmid", "entity_type": "Anatomy", "pos": [161, 168]}], "task": "NER"}
+{"text": "The reaction was incubated in a thermocycler for 5 hours at 37degreesC , 5 min at 50degreesC and 10 min at 80degreesC .", "entity": [], "task": "NER"}
+{"text": "The reaction mix was then added to 100 microl chemically competent DH10b cells , incubated for 15 - 30 min on ice and transformed by heat shock .", "entity": [{"entity": "DH10b cells", "entity_type": "Anatomy", "pos": [67, 78]}], "task": "NER"}
+{"text": "800 microl of liquid LB was then added to the transformation , and the cells were let to recover 45 min at 37degreesC .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [71, 76]}], "task": "NER"}
+{"text": "Different aliquots of the transformation were plated on LB plates containing the appropriate antibiotic .", "entity": [], "task": "NER"}
+{"text": "The number of colonies was counted for one or two selected plates ( containing countable number of colonies ) , or from a section of the plates when very high number of colonies were obtained even for the lowest volume plated .", "entity": [{"entity": "colonies", "entity_type": "Anatomy", "pos": [14, 22]}, {"entity": "colonies", "entity_type": "Anatomy", "pos": [99, 107]}, {"entity": "colonies", "entity_type": "Anatomy", "pos": [169, 177]}], "task": "NER"}
+{"text": "The number of colonies was then extrapolated for the entire transformation .", "entity": [{"entity": "colonies", "entity_type": "Anatomy", "pos": [14, 22]}], "task": "NER"}
+{"text": "For level 2 - 2 cloning , two type IIS enzymes were required , BpiI and BsaI .", "entity": [], "task": "NER"}
+{"text": "The same protocol was used as described above except that 10 U and 2 . 5 U were used for the enzymes BpiI and BsaI , respectively .", "entity": [], "task": "NER"}
+{"text": "To optimize efficiency of the restriction - ligation for the final construct containing 11 transcription units ( cL2 - 13 * ) , a variation of this protocol was used as follows .", "entity": [], "task": "NER"}
+{"text": "The reaction mix was set up containing 20 U ligase , 5 U BpiI and 5 U BsaI , in a total reaction volume of 20 microl .", "entity": [], "task": "NER"}
+{"text": "The mix was incubated in a thermocycler with the following parameters : incubation for 2 minutes at 37degreesC , 5 minutes at 16degreesC , both steps repeated 45 times , followed by incubation for 5 minutes at 50degreesC and 10 minutes at 80degreesC .", "entity": [], "task": "NER"}
+{"text": "The reaction mix was transformed in E . coli chemically competent cells as described above .", "entity": [{"entity": "competent cells", "entity_type": "Anatomy", "pos": [56, 71]}], "task": "NER"}
+{"text": "Observed type I error for datasets simulated under the null hypothesis", "entity": [], "task": "NER"}
+{"text": "DNA isolation", "entity": [], "task": "NER"}
+{"text": "All solutions used for DNA isolation are purged with nitrogen ( immediately prior to use ) and supplemented with 50 muM phenyl - tert - butyl nitrone to minimise oxidative damage to DNA [ 31 ] .", "entity": [], "task": "NER"}
+{"text": "Qiagen DNAeasy Kit ( # 69506 )", "entity": [], "task": "NER"}
+{"text": "includes : Proteinase K , AW1 , AW2 , AE and Spin - columns", "entity": [], "task": "NER"}
+{"text": "Dithiothreitol ( DTT ; Sigma )", "entity": [], "task": "NER"}
+{"text": "Ethanol ( Ajax Finechem # 214 - 2 . 5L )", "entity": [], "task": "NER"}
+{"text": "Nitrogen ( for purging of buffers )", "entity": [], "task": "NER"}
+{"text": "Genes related to signal transduction", "entity": [], "task": "NER"}
+{"text": "On day 7 , the up - regulated genes related to signal transduction were PDE1A , MYO10 , APOB , and so on , and down - regulated genes were CYTL1 and IL6 .", "entity": [], "task": "NER"}
+{"text": "On day 14 , the up - regulated genes were ANGPTL4 , EPHA3 , RASL10B , etc . , and the down - regulated genes were CXCL12 , CCL8 and VLDLR .", "entity": [], "task": "NER"}
+{"text": "The genes up - regulated on both days were LEP , RAC3 , and RASL11B , and those down - regulated both days were MX1 and WISP2 .", "entity": [], "task": "NER"}
+{"text": "Notably , up - and down - regulated genes PDE1A , APOB , ALCAM , PSCD4 , CYTL1 , and IL6 were more strongly expressed on day 7 than on day 14 , while ANGPTL4 , EPHA3 , RAB12 , CXCL12 , CCL8 , and VLDLR were more strongly expressed on day 14 than on day 7 .", "entity": [], "task": "NER"}
+{"text": "Both the innate and adaptive immune subsystems are necessary to provide an effective immune response whether to an actual pathogenic agent or to an immunization .", "entity": [{"entity": "immune subsystems", "entity_type": "Anatomy", "pos": [29, 46]}], "task": "NER"}
+{"text": "Further , effective immunizations must induce long - term stimulation of both the humoral and cell - mediated arms of the adaptive system by the production of effector cells for the current infection and memory cells for future infections with the pathogenic agent .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [94, 98]}, {"entity": "effector cells", "entity_type": "Anatomy", "pos": [159, 173]}, {"entity": "memory cells", "entity_type": "Anatomy", "pos": [204, 216]}], "task": "NER"}
+{"text": "At least seven different types of vaccines are currently in use or in development that produce this effective immunity and have contributed greatly to the prevention of infectious disease around the world .", "entity": [], "task": "NER"}
+{"text": "Encoding methods of SOLiDzipper .", "entity": [], "task": "NER"}
+{"text": "Notes : A ) The quality value in QV files from ABI SOLiD system ranges from - 1 to 40 , which requires 6 bit space .", "entity": [], "task": "NER"}
+{"text": "The remaining 2 bit space out of 1 byte can be used for storing another quality value in part .", "entity": [], "task": "NER"}
+{"text": "B ) Csfasta files contain the sequence information in four digits , ' 0123 ' , which require 2 bit space .", "entity": [], "task": "NER"}
+{"text": "Provided that ' 0 ' , 1 byte character in csfasta files , is mapped as binary data ' 00 ' , ' 1 ' as ' 01 ' , ' 2 ' as ' 10 ' , ' 3 ' as ' 11 ' , 4 byte data ' 0113 ' can be encoded into 1 byte character 0x17 ( 00010111 ) through shift operation .", "entity": [], "task": "NER"}
+{"text": "C ) Sequence IDs are extracted from QV and csfasta files , combined , and compressed using the general purpose compression methods .", "entity": [], "task": "NER"}
+{"text": "D ) Encoded data are stored as data blocks of fixed size .", "entity": [], "task": "NER"}
+{"text": "This allows for selective decoding .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION", "entity": [], "task": "NER"}
+{"text": "Intra - operative monitoring of partial pressure of tissue oxygen ( PtiO2 ) is a very sensitive method of detecting the decrease of oxygen for cell utilization , due to decreased blood flow , during temporary clipping and after definitive clipping , in middle cerebral artery incidental unruptured aneurysm surgery .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [52, 58]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [143, 147]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [179, 184]}, {"entity": "middle cerebral artery", "entity_type": "Anatomy", "pos": [253, 275]}, {"entity": "aneurysm", "entity_type": "Anatomy", "pos": [298, 306]}], "task": "NER"}
+{"text": "\" Basal values \" , obtained without the influence of subarachnoid blood , were lower than expected in \" uninjured \" brain , and this fact , although unexplained , should be kept in mind in future investigation in this field .", "entity": [{"entity": "subarachnoid blood", "entity_type": "Anatomy", "pos": [53, 71]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [116, 121]}], "task": "NER"}
+{"text": "Although values that could be predictive of brain ischemia could not be established , an incomplete recovery or continuous decrease in PtiO2 values after definitive clipping should be considered an indicator of high risk for the development of post - operative brain infarction , and , therefore , an indication for verification of the position of the clip .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [44, 49]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [261, 266]}], "task": "NER"}
+{"text": "View of the structure of the title compound along the a axis displaying chains alternating with amine groups .", "entity": [], "task": "NER"}
+{"text": "( a ) Sequence alignment of PY - NLSs .", "entity": [], "task": "NER"}
+{"text": "The homologous regions of C - NLS of the EWS protein , NLS of Sam68 and FUS / TLS protein and M9 NLS of hnRNP A1 and hnRNP M , classified as PY - NLS are in yellow boxes .", "entity": [], "task": "NER"}
+{"text": "Phosphorylated Y656 of the EWS protein and Y440 of Sam68 are indicated ( in red ) .", "entity": [], "task": "NER"}
+{"text": "Positions of identical residues in SAM68 and EWS C - NLS are indicated in bold and residues with identical charges are underlined .", "entity": [], "task": "NER"}
+{"text": "Known positions of the FUS / TLS mutations in ALS are in bold .", "entity": [], "task": "NER"}
+{"text": "( b ) Subcellular localization of YFP , the C - terminally tagged EWS - YFP , EWS ( Y656A ) - YFP , EWS ( Y656F ) - YFP , and EWS ( Y656D ) - YFP ( in green ) .", "entity": [{"entity": "Subcellular", "entity_type": "Anatomy", "pos": [6, 17]}], "task": "NER"}
+{"text": "Nuclei are shown by DAPI staining ( in blue ) .", "entity": [{"entity": "Nuclei", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Bars , 15 mum .", "entity": [], "task": "NER"}
+{"text": "Conclusions", "entity": [], "task": "NER"}
+{"text": "Myocardial ischaemia during DCMR is independently predictive of cardiac events among patients with previous myocardial revascularisation .", "entity": [{"entity": "Myocardial", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "cardiac", "entity_type": "Anatomy", "pos": [64, 71]}, {"entity": "myocardial", "entity_type": "Anatomy", "pos": [108, 118]}], "task": "NER"}
+{"text": "Importing citations in different formats using Google Scholar", "entity": [], "task": "NER"}
+{"text": "Subject disposition .", "entity": [], "task": "NER"}
+{"text": "Data from 110 enrolled subjects were eligible for analysis .", "entity": [], "task": "NER"}
+{"text": "The demographics of the study subjects , by site , are recorded in Table 1 .", "entity": [], "task": "NER"}
+{"text": "The population studied was predominantly not HIV infected ( 92 % ) , and by the study entry criteria , their probability of infection was considered to be low .", "entity": [], "task": "NER"}
+{"text": "The risk categories assigned at the time of study entry were combined into groups for analysis , based on the predisposition for PCP .", "entity": [], "task": "NER"}
+{"text": "The analysis groups were as follows : ( i ) HIV / AIDS , ( ii ) lung transplant ( one subject with a dual organ transplant [ lung / kidney ] was included in this category ) , ( iii ) all other organ transplants and allogeneic hematopoietic stem cell transplants ( HSCT ) , ( iv ) leukemia , other hematological disorders , and autologous HSCT , ( v ) other solid tumors , and ( vi ) other nonmalignant conditions .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [64, 68]}, {"entity": "organ", "entity_type": "Anatomy", "pos": [106, 111]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [125, 129]}, {"entity": "kidney", "entity_type": "Anatomy", "pos": [132, 138]}, {"entity": "organ", "entity_type": "Anatomy", "pos": [193, 198]}, {"entity": "allogeneic hematopoietic stem cell", "entity_type": "Anatomy", "pos": [215, 249]}, {"entity": "leukemia", "entity_type": "Anatomy", "pos": [280, 288]}, {"entity": "solid tumors", "entity_type": "Anatomy", "pos": [357, 369]}], "task": "NER"}
+{"text": "Table 1 .", "entity": [], "task": "NER"}
+{"text": "Subject enrollment , disposition , and demographics by sitea", "entity": [], "task": "NER"}
+{"text": "Characteristic Valueb", "entity": [], "task": "NER"}
+{"text": "Site 1 Site 2 Site 3 Site 4", "entity": [], "task": "NER"}
+{"text": "Enrollment", "entity": [], "task": "NER"}
+{"text": "Unique subjects 18 29 22 62", "entity": [], "task": "NER"}
+{"text": "Subjects entering into primary analysisc 18 22 22 48", "entity": [], "task": "NER"}
+{"text": "Subjects with repeat visits 0 0 0 16", "entity": [], "task": "NER"}
+{"text": "No . of samples assayed 18 22 22 70", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [8, 15]}], "task": "NER"}
+{"text": "Gender", "entity": [], "task": "NER"}
+{"text": "Male 7 10 13 29", "entity": [], "task": "NER"}
+{"text": "Female 11 12 9 19", "entity": [], "task": "NER"}
+{"text": "Race", "entity": [], "task": "NER"}
+{"text": "Caucasian 12 4 0 48", "entity": [], "task": "NER"}
+{"text": "Black 6 13 0 0", "entity": [], "task": "NER"}
+{"text": "Other ( nonwhite ) 0 5 0 0", "entity": [], "task": "NER"}
+{"text": "No data 0 0 22 0", "entity": [], "task": "NER"}
+{"text": "Mean ( range ) age ( yr ) 57 ( 26 - 78 ) 54 ( 21 - 75 ) 52 ( 26 - 74 ) 56 ( 23 - 73 )", "entity": [], "task": "NER"}
+{"text": "Pretest probability of PCP", "entity": [], "task": "NER"}
+{"text": "Moderate 0 3 4 0", "entity": [], "task": "NER"}
+{"text": "Low 18 19 18 48", "entity": [], "task": "NER"}
+{"text": "Sample type", "entity": [{"entity": "Sample", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "BAL 18 20 20 43", "entity": [], "task": "NER"}
+{"text": "Sputum 0 1 1 0", "entity": [{"entity": "Sputum", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Other LRT 0 1 1 5", "entity": [], "task": "NER"}
+{"text": "At - risk group", "entity": [], "task": "NER"}
+{"text": "HIV / AIDS 0 3 6 0", "entity": [], "task": "NER"}
+{"text": "Lung transplant 8 0 1 31", "entity": [{"entity": "Lung", "entity_type": "Anatomy", "pos": [0, 4]}], "task": "NER"}
+{"text": "Other transplants 1 7 3 0", "entity": [], "task": "NER"}
+{"text": "Leukemia 1 1 7 0", "entity": [{"entity": "Leukemia", "entity_type": "Anatomy", "pos": [0, 8]}], "task": "NER"}
+{"text": "Other solid tumors 2 1 1 7", "entity": [{"entity": "solid tumors", "entity_type": "Anatomy", "pos": [6, 18]}], "task": "NER"}
+{"text": "Other nonmalignant conditions 6 10 4 10", "entity": [], "task": "NER"}
+{"text": "a", "entity": [], "task": "NER"}
+{"text": "The testing and enrollment sites for the study were Duke University School of Medicine , Durham , NC ; Albert Einstein College of Medicine and Montefiore Medical Center , Bronx , NY ; Centre Hospitalier Universitaire Vaudois and University of Lausanne , Lausanne , Switzerland ; and Medizinische Universitat and Landeskrankenhaus Natters , Innsbruck , Austria .", "entity": [], "task": "NER"}
+{"text": "b", "entity": [], "task": "NER"}
+{"text": "Except where otherwise indicated , values are numbers of patients .", "entity": [], "task": "NER"}
+{"text": "c", "entity": [], "task": "NER"}
+{"text": "Subjects were excluded from analysis if they withdrew consent or if there was inadequate sample left for PCR testing .", "entity": [{"entity": "sample", "entity_type": "Anatomy", "pos": [89, 95]}], "task": "NER"}
+{"text": "Acknowledgments and Funding", "entity": [], "task": "NER"}
+{"text": "The authors thank CRB GADIE ( Diane Esquerre ) for BAC clones handling and Brian Smith , Renee Fincham and Kristy Shewbridge for microsatellites genotyping .", "entity": [], "task": "NER"}
+{"text": "We are grateful to Yann Guiguen for help and precious contribution to fund raising for this study .", "entity": [], "task": "NER"}
+{"text": "This work was made possible by financial support of Genoscope .", "entity": [], "task": "NER"}
+{"text": "We acknowledge Rene Guyomard for his initial contribution in BAC library procurement .", "entity": [], "task": "NER"}
+{"text": "The microsatellites genotyping was supported by NRI Grant No . 2007 - 35616 - 17875 from the USDA National Institute of Food and Agriculture .", "entity": [], "task": "NER"}
+{"text": "Confocal and scanning microscopic images of mammoth ' s and human hair .", "entity": [{"entity": "hair", "entity_type": "Anatomy", "pos": [66, 70]}], "task": "NER"}
+{"text": "Taphonomic changes , indicated by arrow - heads and straight white arrow in the confocal image .", "entity": [], "task": "NER"}
+{"text": "Bacterial - fungal colonies are shown by broken arrows .", "entity": [{"entity": "colonies", "entity_type": "Anatomy", "pos": [19, 27]}], "task": "NER"}
+{"text": "Red arrow indicates space between cuticle and hair shaft due to shrinkage .", "entity": [{"entity": "hair shaft", "entity_type": "Anatomy", "pos": [46, 56]}], "task": "NER"}
+{"text": "Extensive taphonomic changes in YUK are evident .", "entity": [], "task": "NER"}
+{"text": "Note the preservation of the cuticle in the human hair in contrast to the craters in the cuticles of the mammoth ' s hair .", "entity": [{"entity": "hair", "entity_type": "Anatomy", "pos": [50, 54]}, {"entity": "hair", "entity_type": "Anatomy", "pos": [117, 121]}], "task": "NER"}
+{"text": "Bacterial biofilms are a feature of human hair ; mammoth ' s hair was protected from bacterial invasion in permafrost .", "entity": [{"entity": "hair", "entity_type": "Anatomy", "pos": [42, 46]}, {"entity": "hair", "entity_type": "Anatomy", "pos": [61, 65]}], "task": "NER"}
+{"text": "Calculation of male mating success", "entity": [], "task": "NER"}
+{"text": "In order to compare whether males ' access to receptive females followed the predictions of the PoA model , we calculated mating success as follows .", "entity": [], "task": "NER"}
+{"text": "For all the mating partners a female had during the receptive period of her conceptive cycle , mating success of each mating partner was calculated as the number of mating series a male was involved in divided by the total number of mating series the female was involved in .", "entity": [], "task": "NER"}
+{"text": "Overall mating success of each male was calculated as the sum of all mating successes calculated for this male as described above .", "entity": [], "task": "NER"}
+{"text": "Tail flick test", "entity": [], "task": "NER"}
+{"text": "CSLE did not show any difference compared with control , at all the tested doses [ Figure 4 ] .", "entity": [], "task": "NER"}
+{"text": "Morphine showed a significant increase of latency time at 45 , 60 and 75 min .", "entity": [], "task": "NER"}
+{"text": "Effect of CSLE ( 100 , 200 and 500 mg / kg ) and morphine on the latency response of mice in the tail flick test .", "entity": [{"entity": "tail", "entity_type": "Anatomy", "pos": [97, 101]}], "task": "NER"}
+{"text": "Values are presented as the mean + / - SEM ( n = 5 ) * P < 0 . 05 , significant increase from control", "entity": [], "task": "NER"}
+{"text": "Details of treatment programs A and B in respect to visits to different health care professionals and treatment activities", "entity": [], "task": "NER"}
+{"text": "Genes associated with nonsegmental vitiligo .", "entity": [], "task": "NER"}
+{"text": "a , b Radiographs of the left elbow and forearm 5 months after the surgery", "entity": [{"entity": "left elbow", "entity_type": "Anatomy", "pos": [25, 35]}, {"entity": "forearm", "entity_type": "Anatomy", "pos": [40, 47]}], "task": "NER"}
+{"text": "The two most important factors leading to the development of hypoxia are biological processes that determine the amount of organic matter available to be degraded and physical factors creating stratification .", "entity": [], "task": "NER"}
+{"text": "Stratification in most areas of the coastal zone of the Baltic Sea is due to seasonal temperature changes , although stratification by occasional inflowing saltier water does occur in some estuaries . ( 14 ) Hypoxia is common in estuaries located in the Danish Straits due to the large load of nutrients sustaining algal production and the strong stratification caused by large differences in surface and bottom water salinity . ( 5 ) Hypoxia in the Swedish and Finnish archipelagos are influenced by phytoplankton growth stimulated by nutrient loads from urban and agricultural sources , but also by restricted water circulation .", "entity": [], "task": "NER"}
+{"text": "The Finnish Archipelago Sea is impacted by drifting algal mats that consume oxygen during their decomposition when they sink to the bottom . ( 15 ) By contrast , hypoxia is rare in the northern Baltic Sea estuaries located in the Bothnian Sea coastal zone where nutrient loads are lower .", "entity": [], "task": "NER"}
+{"text": "Hypoxia is uncommon along the eastern shore from Estonia to Poland due to enhanced circulation of water in open areas along the coastline ( Figure 1 ) .", "entity": [], "task": "NER"}
+{"text": "There are very limited data available to examine how far back in time hypoxia has occurred .", "entity": [], "task": "NER"}
+{"text": "A key question in this ecosystem affected daily by over 85 million people could be \" Is hypoxia a natural phenomenon ? \" . ( 16 ) The large numbers of enclosed areas , in many cases with shallow sills that restrict the exchange of bottom water and often in combination with large irregular changes in salinity , might mean that hypoxia has always been present in the coastal zone .", "entity": [], "task": "NER"}
+{"text": "However , sediment laminations from Stockholm Archipelago , an indicator of past hypoxia , ( 17 ) have been shown to be a recent phenomenon with very few areas with laminated sediments prior to 1900 . 17 , 18 The long - term millennial trends in coastal hypoxia remain unknown , although hypoxia has occurred intermittently throughout the last 8000 years in offshore deep waters of the Baltic Sea . ( 10 ) Further sediment studies are necessary , similar to those carried out in the open Baltic Sea , ( 10 ) to ascertain how far back in time hypoxia was observed in the coastal zone .", "entity": [], "task": "NER"}
+{"text": "Key uncertainties remain including how have the driving forces for hypoxia , e . g . , climate ( 19 ) and nutrient loading , changed through time in the Baltic Sea coastal zone , and do they vary during the same time periods that hypoxia varies in the open waters ? ( 16 )", "entity": [], "task": "NER"}
+{"text": "An important consideration in determining the number of ecosystems experiencing hypoxia is the size of the assessment unit .", "entity": [], "task": "NER"}
+{"text": "We combined numerous monitoring points and sites to form a coherent coastal unit when bottom waters were physically connected to each other .", "entity": [], "task": "NER"}
+{"text": "This means that assessment units considered hypoxic might occur in the same geographical region and could be in close proximately to each other , if their bottom waters were physically disconnected .", "entity": [], "task": "NER"}
+{"text": "The Baltic Sea archipelagos have a complex topography with many basins disjoined by shallow sills resulting in many distinct sites , although they are all affected by similar mechanisms .", "entity": [], "task": "NER"}
+{"text": "In fact , the Stockholm and Finnish archipelagos contributed 21 % of the total assessment units , a relatively large share compared to the total Baltic Sea coastal zone , but > 40 % of the hypoxic sites .", "entity": [], "task": "NER"}
+{"text": "The coastal stretches of the Western Gotland Basin and Gulf of Finland that have a substantial number of hypoxic sites are also archipelagos , which are more prone to hypoxia because of the complex topography , proximity to development , and consequently more sensitive to enhanced nutrient inputs from land .", "entity": [], "task": "NER"}
+{"text": "Surprisingly only 4 . 0 % of all sites were classified as seasonally hypoxic according to our definition when > 50 % and < 80 % of profiles during the stratified period have oxygen concentrations less than 2 mg L - 1 .", "entity": [], "task": "NER"}
+{"text": "A statistically rigorous definition of what constitutes seasonal hypoxia does not currently exist and in fact should be linked to ecological consequences for it to be ecologically relevant and not just connected to absolute concentrations . ( 3 ) Currently coastal marine ecosystems that experience hypoxia for a period of days to months every year are often considered to be seasonally hypoxic , although we have categorized them here as being episodic , because we required the monitoring units to be hypoxic for most of the stratified period .", "entity": [], "task": "NER"}
+{"text": "However , in Limfjorden , Denmark , bottom water oxygen concentrations can vary greatly between weekly samplings ( SI Figure S6 ) , although nearly every year hypoxic conditions are observed somewhere in the Limfjorden .", "entity": [], "task": "NER"}
+{"text": "Our statistical estimation is that Limfjorden is episodically hypoxic .", "entity": [], "task": "NER"}
+{"text": "Diaz and Rosenberg ( 1 ) would classify Limfjorden as periodically hypoxic , although we have found it difficult to create a statistically robust indicator that would classify systems as periodically hypoxic .", "entity": [], "task": "NER"}
+{"text": "Periodic hypoxia is problematic because it never allows for re - establishment of benthic communities . ( 20 )", "entity": [], "task": "NER"}
+{"text": "Currently , there are 416 areas in the world with reported coastal hypoxia with about 30 previously reported sites in the Baltic Sea region , which includes both coastal zone hypoxia and deep water sites in the Baltic Sea . ( 1 ) We have identified an additional 96 sites that have experienced hypoxia , increasing the global total to nearly 500 sites .", "entity": [], "task": "NER"}
+{"text": "Of all the known sites around the world , around 20 % of the sites are found in the Baltic Sea region .", "entity": [], "task": "NER"}
+{"text": "Most sites experienced episodic hypoxia , which is a precursor to development of seasonal hypoxia . ( 20 ) The large number of sites partially reflects the fact that the Baltic Sea is one of the most data rich regions of the world with no tidal mixing and complex bottom topography creating conditions favorable for hypoxia , although these are only the \" monitored areas \" and many more hypoxic sites probably exist in the Baltic Sea coastal zone .", "entity": [], "task": "NER"}
+{"text": "In contrast , there was no evidence of hypoxia at 95 stations in estuarine and coastal waters around Ireland due to sufficient tidal mixing . ( 21 ) If such detailed data existed for other coastal regions around the world , it is likely that the number of areas would increase globally .", "entity": [], "task": "NER"}
+{"text": "Oxygen is an important parameter in water quality assessments since sufficient oxygen is essential to aquatic life and is necessary to support healthy biological communities . ( 3 ) For example , oxygen concentration is a supporting element to the biological quality elements in the European Water Framework Directive , ( 21 ) is one of the ecological objectives in the Helsinki Commission ' s ( HELCOM ) eutrophication assessment of the Baltic Sea , and is included in the European Marine Strategy Framework Directive as an effect parameter of eutrophication .", "entity": [], "task": "NER"}
+{"text": "Accurate data for the concentration of dissolved oxygen are essential for documenting environmental changes in water resources resulting from natural phenomena and human activities .", "entity": [], "task": "NER"}
+{"text": "Reports of hypoxia globally are increasing1 , 22 both due to the recognition of the seriousness of hypoxia on ecosystem functioning and as decades - long monitoring records become available in databases .", "entity": [], "task": "NER"}
+{"text": "How the large number of newly identified hypoxic areas influences nutrient biogeochemical cycles and ecosystem services in the coastal zone in the Baltic Sea is currently unknown , although the functioning of the coastal filter certainly plays an important role in how adjacent marine systems respond to changes in nutrient loading .", "entity": [], "task": "NER"}
+{"text": "Presently about 40 % of the world ' s population lives within 100 km of the coastal zone strongly impacting ocean health , ( 24 ) including increasing the occurrence of hypoxic areas . 1 , 2 What is currently lacking is the link to the driving factors of hypoxia including nutrient enrichment , organic carbon loading and climate change , ( 25 ) and a determination of appropriate nutrient loading targets for guidance to managers to ameliorate the devastating impact of hypoxia . ( 24 )", "entity": [], "task": "NER"}
+{"text": "Pharmacokinetic - pharmacodynamic analysis .", "entity": [], "task": "NER"}
+{"text": "The mean ( 90 % CI ) slope estimate from the linezolid concentration - R - R interval analysis was - 0 . 0017 ( - 0 . 0022 to - 0 . 0011 ) ms / ng / ml .", "entity": [], "task": "NER"}
+{"text": "This translates to mean ( 90 % CI ) predicted decreases in heart rate of approximately 1 . 5 ( 1 . 0 to 2 . 0 ) and 3 . 0 ( 2 . 1 to 4 . 1 ) beats / min at the mean Cmax following the administration of 600 - and 1 , 200 - mg linezolid doses , respectively .", "entity": [{"entity": "heart", "entity_type": "Anatomy", "pos": [59, 64]}], "task": "NER"}
+{"text": "The study - specific mean correction factor estimated from baseline data was 0 . 278 , which is slightly less than Fridericia ' s correction ( 0 . 333 ) .", "entity": [], "task": "NER"}
+{"text": "Evaluation of the various correction factors showed that QTcF most appropriately resolves the relationship between the QT interval and the heart rate in the baseline data from the present study .", "entity": [{"entity": "heart", "entity_type": "Anatomy", "pos": [139, 144]}], "task": "NER"}
+{"text": "This is evident upon inspection of Fig .", "entity": [], "task": "NER"}
+{"text": "4 , since the slope between the QTcF interval and the R - R interval is closest to zero when this correction is applied .", "entity": [], "task": "NER"}
+{"text": "Fig .", "entity": [], "task": "NER"}
+{"text": "4 .", "entity": [], "task": "NER"}
+{"text": "Evaluation of various heart rate correction factors for the QT interval versus the R - R interval .", "entity": [{"entity": "heart", "entity_type": "Anatomy", "pos": [22, 27]}], "task": "NER"}
+{"text": "The predicted line in each figure represents the fit from a linear mixed - effect model with R - R interval as a fixed effect and subject - specific random effects for intercept and slope .", "entity": [], "task": "NER"}
+{"text": "The results from the concentration - QTcF analysis are graphically depicted in Fig .", "entity": [], "task": "NER"}
+{"text": "5 .", "entity": [], "task": "NER"}
+{"text": "The mean ( 90 % CI ) slope estimate from the linezolid concentration - QTcF analysis was - 0 . 0145 ( - 0 . 0768 to 0 . 0477 ) ms / mug / ml .", "entity": [], "task": "NER"}
+{"text": "At the geometric mean Cmax following the infusion of linezolid at 600 mg ( 14 . 9 mug / ml ) and 1 , 200 mg ( 30 . 5 mug / ml ) , the mean ( 90 % CI ) predicted placebo - adjusted changes from the baseline QTcF were - 0 . 217 ( - 1 . 14 to 0 . 710 ) and - 0 . 444 ( - 2 . 34 to 1 . 45 ) ms , respectively , thus confirming a lack of a relationship between linezolid concentrations and QTc interval .", "entity": [], "task": "NER"}
+{"text": "QTcF interval versus plasma linezolid concentrations .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [21, 27]}], "task": "NER"}
+{"text": "primary pancreatic sarcomas are extremely rare .", "entity": [{"entity": "primary pancreatic sarcomas", "entity_type": "Anatomy", "pos": [0, 27]}], "task": "NER"}
+{"text": "Pancreatic sarcomas are more aggressive than other pancreatic neoplasms .", "entity": [{"entity": "Pancreatic sarcomas", "entity_type": "Anatomy", "pos": [0, 19]}, {"entity": "pancreatic neoplasms", "entity_type": "Anatomy", "pos": [51, 71]}], "task": "NER"}
+{"text": "Hip fractures in the aged constitute a major health problem with substantial morbidity [ 1 ] , mortality [ 2 , 3 ] , and , as the ageing population increases , an increasing burden on the health care system [ 4 ] .", "entity": [{"entity": "Hip", "entity_type": "Anatomy", "pos": [0, 3]}], "task": "NER"}
+{"text": "Fracture risk varies markedly between countries [ 5 ] .", "entity": [], "task": "NER"}
+{"text": "In a study by Kanis et al .", "entity": [], "task": "NER"}
+{"text": "[ 6 ] , comparing 10 - year probability of hip fracture , all countries except Norway had lower risk than Sweden .", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [43, 46]}], "task": "NER"}
+{"text": "Other countries categorized at very high risk ( > 75 % of the risk of Sweden ) were Iceland , Denmark and the US .", "entity": [], "task": "NER"}
+{"text": "At the age of 80 , the estimated probability of sustaining a hip fracture the next 10 years is 8 . 6 % and 17 . 7 % in Norwegian men and women , respectively [ 7 ] , and a report from the Norwegian capital Oslo calculated an overall annual fracture rate of 118 . 0 in women and 44 . 0 in men per 10 , 000 [ 8 ] .", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [61, 64]}], "task": "NER"}
+{"text": "Several recent studies are reporting declining fracture incidence [ 9 - 14 ] .", "entity": [], "task": "NER"}
+{"text": "Although the Norwegian hip fracture rates remain the highest reported in the world , data from Oslo in 1996 - 1997 indicated no increasing incidence rates compared to the 1988 - 1989 [ 8 ] . Within Norway , considerable geographic differences have been reported , with substantially lower rates in smaller cities and rural areas compared to Oslo [ 7 , 15 ] .", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [23, 26]}], "task": "NER"}
+{"text": "However , these are reports based on sporadic studies in few regions and in limited time periods [ 16 , 17 ] .", "entity": [], "task": "NER"}
+{"text": "From 1985 to 2003 , the Norwegian Institute of Public Health commissioned four Norwegian hospitals , representing 10 % of the population , to run a national injury registry [ 18 ] .", "entity": [], "task": "NER"}
+{"text": "The registry collected a variety of data connected to the actual injury itself and the event leading to the injury .", "entity": [], "task": "NER"}
+{"text": "In the city of Harstad in Northern Norway , the registration continued and has been running for more than 23 years .", "entity": [], "task": "NER"}
+{"text": "Throughout the years of the National Injury Registry , the injury rates in Harstad closely resembled the rates of the national registry [ 18 ] .", "entity": [], "task": "NER"}
+{"text": "With reference to the recent reports suggesting stabilizing hip fracture incidence internationally as well as nationally , and regional differences within Norway , we have used the hip fracture data in the Harstad Injury Registry to :", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [60, 63]}, {"entity": "hip", "entity_type": "Anatomy", "pos": [181, 184]}], "task": "NER"}
+{"text": "Describe age - and sex - specific incidence of hip fractures in Harstad , Northern Norway and make comparison with rates from the Norwegian capital Oslo", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [47, 50]}], "task": "NER"}
+{"text": "Describe time trends in hip fracture incidence in Harstad from 1994 to 2008", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [24, 27]}], "task": "NER"}
+{"text": "Describe place of injury and seasonal variations in hip fracture incidence in Harstad", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [52, 55]}], "task": "NER"}
+{"text": "Compare 3 - month , 6 - month , and 1 - year mortality after hip fracture between women and men in Harstad", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [61, 64]}], "task": "NER"}
+{"text": "( a ) The Tn6087 target site within S . oralis F . MI . 5 .", "entity": [], "task": "NER"}
+{"text": "( b ) The left end and ( c ) right end of Tn6087 are shown in bold .", "entity": [], "task": "NER"}
+{"text": "( d ) The joint of the circular intermediate of Tn6087 is shown .", "entity": [], "task": "NER"}
+{"text": "The transposon ' s coupling sequences are shown in bold italics .", "entity": [], "task": "NER"}
+{"text": "As can be seen in ( d ) , the coupling sequence at the joint of the circular form is a heteroduplex .", "entity": [], "task": "NER"}
+{"text": "Breeding of p53 mice with BCCIP conditional knockdown mice", "entity": [], "task": "NER"}
+{"text": "The heterozygous p53 knockout mice [ 36 ] were crossed with LoxPshBCCIP + / + - 4 mouse and EIIaCre + / + mouse respectively to generate p53 + / - ; LoxPshBCCIP + / - , and p53 + / - ; EIIaCre + / - mice .", "entity": [], "task": "NER"}
+{"text": "The PCR primers used to genotype p53 are : p53ex6F : 5 ' - GTATCCCGAGTATCTGGAAGACAG - 3 ' , p53neoF : 5 ' - GCCTTCTATCGCCTTCTTGACG - 3 ' , p53ex7RN : 5 ' - AAGGATAGGTCGGCGGTTCATGC - 3 ' .", "entity": [], "task": "NER"}
+{"text": "The same PCR primer pairs as described earlier in this report were used for BCCIPshRNA and EIIaCre genotyping .", "entity": [], "task": "NER"}
+{"text": "The p53 + / - ; LoxPshBCCIP + / + mice were obtained by crossing p53 + / - ; LoxPshBCCIP + / - females with p53 + / - ; LoxPshBCCIP + / - males .", "entity": [], "task": "NER"}
+{"text": "The p53 + / - ; LoxPshBCCIP + / + or p53 + / - ; LoxPshBCCIP + / - mice were crossed with p53 + / - ; EIIaCre + / - mice respectively .", "entity": [], "task": "NER"}
+{"text": "Biochemical traits", "entity": [], "task": "NER"}
+{"text": "ERK signaling is involved in decreasing BDNF - induced gene activity via Eph receptors", "entity": [], "task": "NER"}
+{"text": "Data provided so far suggest that ephrin - A5 might counteract BDNF - mediated gene expression and growth cone responses via decreasing ERK activity and nuclear localization ( Figs . 2 and 3 ) .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [99, 110]}, {"entity": "nuclear", "entity_type": "Anatomy", "pos": [153, 160]}], "task": "NER"}
+{"text": "To test this hypothesis more directly , we analyzed whether Eph forward signaling can still suppress BDNF - stimulated IEG induction and growth cone collapse when ERK kinase activity was experimentally raised .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [137, 148]}], "task": "NER"}
+{"text": "For this , ERK activity was elevated by expressing constitutively - active MEK1 ( CA - MEK1 ) , an ERK upstream activator , in cortical neurons ( Fig . S3 ) .", "entity": [{"entity": "cortical neurons", "entity_type": "Anatomy", "pos": [127, 143]}], "task": "NER"}
+{"text": "Subsequently , neurons were subjected to either an ephrin - A5 mediated growth cone collapse assay ( Fig . 5 ) or stimulated with guidance cues for 20 minutes and IEG mRNA levels were quantified via qRT - PCR ( Fig . 6 ) .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [15, 22]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [72, 83]}], "task": "NER"}
+{"text": "10 . 1371 / journal . pone . 0026089 . g005 Figure 5", "entity": [], "task": "NER"}
+{"text": "Constitutively - active MEK1 blocks ephrin - A5 mediated growth cone collapse .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [57, 68]}], "task": "NER"}
+{"text": "Wild - type neurons were electroporated with vectors expressing GFP ( control ; A , C , E ) or expressing a FLAG - tagged constitutively - active MEK1 ( CA - MEK1 ; B , D , F ) .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [12, 19]}], "task": "NER"}
+{"text": "Neurons were treated with ephrin - A5 - Fc for 30 min followed by visualization of GFP ( A , C , E ) or CA - MEK - 1 ( green in B , D , F ) , F - actin and betaIII tubulin .", "entity": [{"entity": "Neurons", "entity_type": "Anatomy", "pos": [0, 7]}], "task": "NER"}
+{"text": "( A , B ) Overexpression of CA - MEK1 ( B ) reduces mean neurite length compared to a control GFP - expressing neuron ( A ) .", "entity": [{"entity": "neurite", "entity_type": "Anatomy", "pos": [57, 64]}, {"entity": "neuron", "entity_type": "Anatomy", "pos": [111, 117]}], "task": "NER"}
+{"text": "( C - F ) A control growth cone without ephrin - A5 application ( C ) typically protrudes multiple filopodia ( arrow ) .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [20, 31]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [99, 108]}], "task": "NER"}
+{"text": "CA - MEK - 1 expressing growth cones ( D ) were indistinguishable from a GFP - expressing growth cone .", "entity": [{"entity": "growth cones", "entity_type": "Anatomy", "pos": [24, 36]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [90, 101]}], "task": "NER"}
+{"text": "Note that CA - MEK1 was expressed in a dot - like pattern in the growth cone ( arrowheads in D and F ) .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [65, 76]}], "task": "NER"}
+{"text": "Upon ephrin - A5 application , a control growth cone ( E ) collapsed resulting in only few filopodia .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [41, 52]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [91, 100]}], "task": "NER"}
+{"text": "In contrast , a CA - MEK1 expressing growth cone ( F ) was only partially collapsed and many filopodia structures were preserved after ephrin - A5 induction .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [37, 48]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [93, 102]}], "task": "NER"}
+{"text": "( G ) Quantification of average neurite length .", "entity": [{"entity": "neurite", "entity_type": "Anatomy", "pos": [32, 39]}], "task": "NER"}
+{"text": "( H , I ) Quantification of growth cone area ( H ) and filopodia number / growth cone ( I ) in the four conditions .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [28, 39]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [55, 64]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [74, 85]}], "task": "NER"}
+{"text": "Ephrin - A5 induces a growth cone collapse , resulting in reduced growth cone area and filopodia number in GFP but not CA - MEK1 expressing neurons .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [22, 33]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [66, 77]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [87, 96]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [140, 147]}], "task": "NER"}
+{"text": "Scale - bar ( A , B ) = 10 microm ; ( C - F ) = 2 microm .", "entity": [], "task": "NER"}
+{"text": "10 . 1371 / journal . pone . 0026089 . g006 Figure 6", "entity": [], "task": "NER"}
+{"text": "Ephrin - A5 suppresses BDNF - induced IEG responses via MAP kinase signaling .", "entity": [], "task": "NER"}
+{"text": "Wild - type cortical neurons , mock - electroporated ( black bars ) or with a vector expressing constitutively - active MEK1 ( white bars ) , were treated with guidance cues for 20 minutes as depicted , followed by mRNA quantification .", "entity": [{"entity": "cortical neurons", "entity_type": "Anatomy", "pos": [12, 28]}], "task": "NER"}
+{"text": "In mock - electroporated neurons , BDNF induced an IEG response of c - fos ( A ) , Egr1 ( B ) , Egr2 ( C ) and Arc ( D ) .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [25, 32]}], "task": "NER"}
+{"text": "Co - application of ephrin - A5 and BDNF reduced mRNA levels of all four IEGs in mock - electroporated neurons ( A - D ) .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [103, 110]}], "task": "NER"}
+{"text": "In contrast , expression of constitutively - active MEK1 prevented Eph forward signaling from suppressing BDNF - evoked IEG responses .", "entity": [], "task": "NER"}
+{"text": "This was most evident for the IEGs Egr1 ( B ) and Egr2 ( C ) .", "entity": [], "task": "NER"}
+{"text": "First of all , we analyzed the impact of CA - MEK1 on neurite outgrowth and ephrin - A5 mediated growth cone responses ( Fig . 5 ) .", "entity": [{"entity": "neurite", "entity_type": "Anatomy", "pos": [54, 61]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [97, 108]}], "task": "NER"}
+{"text": "The average neurite length of neurons overexpressing CA - MEK1 ( Fig . 5B ) was clearly reduced compared to control GFP expressing neurons ( Fig . 5A ; see quantification in ( G ) ) .", "entity": [{"entity": "neurite", "entity_type": "Anatomy", "pos": [12, 19]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [30, 37]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [131, 138]}], "task": "NER"}
+{"text": "Growth cones of GFP ( C ) and CA - MEK1 expressing neurons were similar and protruded many filopodia ( arrows in Fig . 5C - F ) .", "entity": [{"entity": "Growth cones", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [51, 58]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [91, 100]}], "task": "NER"}
+{"text": "CA - MEK1 expression in growth cones was confined to individual dot - like structures ( arrowheads in Fig . 5D , F ) .", "entity": [{"entity": "growth cones", "entity_type": "Anatomy", "pos": [24, 36]}], "task": "NER"}
+{"text": "Ephrin - A5 application on a GFP expressing control growth cone ( Fig . 5E ) resulted in a growth cone collapse as revealed by reduced overall growth cone area and filopodia number ( quantified in Fig . 5H , I ) .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [52, 63]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [91, 102]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [143, 154]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [164, 173]}], "task": "NER"}
+{"text": "In contrast , in neurons overexpressing CA - MEK1 ( Fig . 5F ) , ephrin - A5 induced only a partial growth cone collapse .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [17, 24]}, {"entity": "growth cone", "entity_type": "Anatomy", "pos": [100, 111]}], "task": "NER"}
+{"text": "Thus , growth cone area and filopodia number were not reduced ( see Fig . 5H , I ) .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [7, 18]}, {"entity": "filopodia", "entity_type": "Anatomy", "pos": [28, 37]}], "task": "NER"}
+{"text": "This result suggests that an ephrin - A5 induced signaling cascade targets MAP kinase signaling to exert a full growth cone collapse .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [112, 123]}], "task": "NER"}
+{"text": "This result is in contrast to a recent report [ 46 ] which excluded ERK signaling downstream of an ephrin - A5 mediated growth cone collapse .", "entity": [{"entity": "growth cone", "entity_type": "Anatomy", "pos": [120, 131]}], "task": "NER"}
+{"text": "Next , we tested whether ephrin - A5 signaling suppresses ERK kinase signaling also to interfere with BDNF - mediated gene expression ( Fig . 6 ) .", "entity": [], "task": "NER"}
+{"text": "In agreement with previous results ( Fig . 4 ) , in mock - electroporated neurons , ephrin - A5 incubation reduced the BDNF - mediated up - regulation of c - fos ( Fig . 6A ) , Egr1 ( Fig . 6B ) , Egr2 ( Fig . 6C ) and Arc ( Fig . 6D ) mRNA .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [74, 81]}], "task": "NER"}
+{"text": "In contrast , in neurons over - expressing CA - MEK1 , ephrin - A5 could not suppress BDNF - induced IEG responses to the same degree .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [17, 24]}], "task": "NER"}
+{"text": "Particularly Egr1 ( Fig . 6B ) and Egr2 ( Fig . 6C ) mRNA levels were almost identical when comparing neurons treated with BDNF alone and neurons with BDNF and ephrin - A5 together .", "entity": [{"entity": "neurons", "entity_type": "Anatomy", "pos": [102, 109]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [138, 145]}], "task": "NER"}
+{"text": "Thus , ephrin - A5 represses gene activity elicited by BDNF at least in part via MAP kinases .", "entity": [], "task": "NER"}
+{"text": "Besides IEGs , we inspected the influence of both guidance cues on cytoskeletal genes , whose gene products might modulate cytoskeletal dynamics evoked by ephrin - As and / or neurotrophins ( Fig . S4 ) .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [67, 79]}, {"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [123, 135]}], "task": "NER"}
+{"text": "Therefore , the filamentous actin ( F - actin ) stabilizing tropomyosins ( Tpm1 and Tpm2 ) , the F - actin cross - linker alpha - actinin 1 ( Actn1 ) and the motor protein dynein light chain 1 ( Dnal1 ) were analyzed .", "entity": [{"entity": "filamentous", "entity_type": "Anatomy", "pos": [16, 27]}], "task": "NER"}
+{"text": "mRNA levels of other cytoskeletal genes were not altered by any of the guidance cues ( i . e . cofilin , filamin A , mena , vinculin and smooth muscle actin ; data not shown ) .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [21, 33]}, {"entity": "smooth muscle", "entity_type": "Anatomy", "pos": [137, 150]}], "task": "NER"}
+{"text": "Short - term stimulation with guidance cues did not result in major alterations of cytoskeletal mRNA levels except for upregulation of Tpm1 by ephrin - A5 ( Fig . S4A ) .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [83, 95]}], "task": "NER"}
+{"text": "At 16h of incubation , both tropomyosin genes were induced by BDNF and ephrin - A5 alone and both together ( Fig . S4B , D ) .", "entity": [], "task": "NER"}
+{"text": "Actn1 levels were induced by individual application of ephrin - A5 and BDNF and by co - application of both ( Fig . S4F ) .", "entity": [], "task": "NER"}
+{"text": "A similar profile was observed for the dynein light chain ( Fig . S4H ) .", "entity": [], "task": "NER"}
+{"text": "Taken together , cytoskeletal gene expression was modulated by ephrin - A5 and BDNF .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [17, 29]}], "task": "NER"}
+{"text": "In contrast to the antagonistic impact on the IEG gene response ( Figs . 4 and 6 ) , ephrin - A5 and BDNF resulted in rather synergistic action on cytoskeletal gene expression .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [147, 159]}], "task": "NER"}
+{"text": "This difference might be due to short - term ( i . e . 20 minutes ) vs . long - term ( i . e . 16h ) exposure of both guidance cues in the IEG and cytoskeletal gene response , respectively .", "entity": [{"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [147, 159]}], "task": "NER"}
+{"text": "Yeast infections cause significant mortality in critically ill and immunocompromised patients .", "entity": [], "task": "NER"}
+{"text": "In particular , Candida species are the 4th most common cause of nosocomial bloodstream infections in the United States , and Cryptococcus neoformans , the commonest cause of fungal meningitis worldwide [ 1 ] , [ 2 ] .", "entity": [{"entity": "bloodstream", "entity_type": "Anatomy", "pos": [76, 87]}], "task": "NER"}
+{"text": "Whilst Candida albicans remains the leading pathogenic yeast , infections due to non - C . albicans species such as Candida glabrata , as well as previously rare opportunists such as Trichosporon and Geotrichum species , are increasingly reported [ 1 ] , [ 3 ] - [ 6 ] .", "entity": [], "task": "NER"}
+{"text": "Novel pathogenic Candida species such as Candida nivariensis and Candida bracarensis have also been described [ 7 ] .", "entity": [], "task": "NER"}
+{"text": "Since many non - C . albicans Candida and non - Candida yeasts are resistant or less susceptible to antifungal agents , rapid accurate species identification is central to timely , effective antifungal therapy [ 3 ] - [ 6 ] , [ 8 ] , [ 9 ] .", "entity": [], "task": "NER"}
+{"text": "Conventional phenotypic - based methods for yeast identification , however , are slow ( 24 - 72 h ) , insensitive and often unable to identify more unusual species .", "entity": [], "task": "NER"}
+{"text": "Various molecular techniques including real - time PCR , DNA sequence analysis , microarray analysis , and fluorescence in - situ hybridization provide accurate identification [ 10 ] , [ 11 ] but are expensive , require substantial specimen processing time ( hours to a day ) and are not easily implemented as routine techniques in the clinical laboratory .", "entity": [{"entity": "specimen", "entity_type": "Anatomy", "pos": [232, 240]}], "task": "NER"}
+{"text": "Matrix - assisted laser desorption ionization - time of flight mass spectrometry ( MALDI - TOF MS ) has emerged as a powerful and rapid tool for the identification of bacterial and yeast pathogens [ 12 ] - [ 17 ] .", "entity": [], "task": "NER"}
+{"text": "Using MALDI - TOF MS , the protein spectral \" fingerprint \" of an isolate is compared to a reference spectral database for identification [ 18 ] .", "entity": [], "task": "NER"}
+{"text": "Previous studies have reported species identification rates of 92 - 99 % amongst collections of yeasts and yeast - like organisms [ 14 ] - [ 17 ] , [ 19 ] , [ 20 ] .", "entity": [], "task": "NER"}
+{"text": "However , taken collectively , the results may not be directly comparable since these studies have used different approaches to assign species - from comparing spectra from test organisms to reference spectra in MALDI - TOF MS databases [ 16 ] , [ 20 ] , to enhancing these databases , and in some instances developing study - specific databases , with \" in - house \" spectral signatures [ 14 ] , [ 15 ] .", "entity": [], "task": "NER"}
+{"text": "There also is a continuing need to extend the repository of reference spectra in MALDI - TOF MS databases .", "entity": [], "task": "NER"}
+{"text": "We therefore undertook the present study to evaluate the utility of the MALDI Biotyper 2 . 0 Microflex LT spectrometer ( Bruker Daltonik GmbH ; Bremen , Germany ) with its current spectral database in comparison with phenotypic - based methods for the identification of a broad range of yeasts in a diagnostic laboratory .", "entity": [], "task": "NER"}
+{"text": "The first part of the study comprised testing of reference and clinical strains from our culture collection .", "entity": [{"entity": "strains", "entity_type": "Anatomy", "pos": [72, 79]}], "task": "NER"}
+{"text": "The second was a blinded prospective analysis of freshly - collected yeast isolates recovered during routine laboratory work flow ; discrepant results between MALDI TOF MS and phenotypic methods were resolved using sequence analysis of the fungal internal transcribed spacer ( ITS ) regions [ 21 ] , [ 22 ] .", "entity": [], "task": "NER"}
+{"text": "Results obtained by preparation of yeasts by extraction of fungal proteins and by direct application of yeast colonies onto the MALDI TOF MS plate were also compared .", "entity": [{"entity": "colonies", "entity_type": "Anatomy", "pos": [110, 118]}], "task": "NER"}
+{"text": "Classification result .", "entity": [], "task": "NER"}
+{"text": "3 . 2 .", "entity": [], "task": "NER"}
+{"text": "Molecular Mechanisms Mediating the Perinatal Beta - Cell Adaptive Response to Early - Life Stressors", "entity": [{"entity": "Beta - Cell", "entity_type": "Anatomy", "pos": [45, 56]}], "task": "NER"}
+{"text": "Molecular mechanisms responsible for impaired beta - cell mass formation after IUCR or IUPR have come under investigation .", "entity": [{"entity": "beta - cell", "entity_type": "Anatomy", "pos": [46, 57]}], "task": "NER"}
+{"text": "First , it has been proposed that IUCR can result in a reduction of the embryonic beta - cell progenitor pool leading to inappropriate postnatal beta - cell formation .", "entity": [{"entity": "embryonic beta - cell progenitor pool", "entity_type": "Anatomy", "pos": [72, 109]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [145, 156]}], "task": "NER"}
+{"text": "Stanger et al .", "entity": [], "task": "NER"}
+{"text": "[ 108 ] demonstrated that selective genetic reduction in the size of PDX - 1 + pancreatic progenitors during the fetal period results in impaired beta - cell formation during the postnatal period with consequent development of glucose intolerance during adulthood .", "entity": [{"entity": "pancreatic progenitors", "entity_type": "Anatomy", "pos": [79, 101]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [113, 118]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [146, 157]}], "task": "NER"}
+{"text": "Consistent with this , maternal food restriction leads to significant reduction in PDX - 1 + and neurogenin - 3 + pancreatic precursors during embryonic development in rats , diminished postnatal beta - cell formation , and inability to expand beta - cell mass in response to pregnancy [ 47 , 94 ] .", "entity": [{"entity": "pancreatic precursors", "entity_type": "Anatomy", "pos": [114, 135]}, {"entity": "embryonic", "entity_type": "Anatomy", "pos": [143, 152]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [196, 207]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [244, 255]}], "task": "NER"}
+{"text": "The UPI model is also characterized by a permanent decrease in islet PDX - 1 mRNA expression .", "entity": [{"entity": "islet", "entity_type": "Anatomy", "pos": [63, 68]}], "task": "NER"}
+{"text": "This decrease has recently been shown to be due to progressive epigenetic silencing of the Pdx1 gene locus secondary to proximal promoter methylation [ 69 , 109 ] , and it may be responsible for the decreased rate of beta - cell replication and inappropriate postnatal beta - cell mass development [ 69 , 110 ] .", "entity": [{"entity": "beta - cell", "entity_type": "Anatomy", "pos": [217, 228]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [269, 280]}], "task": "NER"}
+{"text": "In the same way of thinking , studies have demonstrated that the maintenance of methylated histone H3 Lys4 by Set7 / 9 , a member of the SET methyltransferase family , is crucial to Pdx1 activity in beta - cell lines [ 111 - 113 ] .", "entity": [{"entity": "beta - cell lines", "entity_type": "Anatomy", "pos": [199, 216]}], "task": "NER"}
+{"text": "This led to the hypothesis that Set7 / 9 may represent a novel chromatin - modifying protein that functions in part through its recruitment to target genes by cell - specific transcription factors such as Pdx1 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [159, 163]}], "task": "NER"}
+{"text": "Since then , a role of histone methyl transferases , particularly set7 , has also been demonstrated in the sustained deleterious effects of chronic hyperglycemia on human microvascular endothelial cells [ 114 ] .", "entity": [{"entity": "microvascular endothelial cells", "entity_type": "Anatomy", "pos": [171, 202]}], "task": "NER"}
+{"text": "Such an epigenetic change could potentially be involved in the deleterious effect of high glucose upon the fetal pancreas in the IUED models .", "entity": [{"entity": "fetal pancreas", "entity_type": "Anatomy", "pos": [107, 121]}], "task": "NER"}
+{"text": "Another mechanism proposed to explain reduced beta - cell formation after IUCR is related to prenatal glucocorticoid exposure .", "entity": [{"entity": "beta - cell", "entity_type": "Anatomy", "pos": [46, 57]}], "task": "NER"}
+{"text": "Administration of either dexamethasone or carbenoxolone ( to inhibit 11 beta - hydroxysteroid dehydrogenase type 2 ) to normal pregnant rats also causes fetal growth retardation and the adult offspring are hypertensive and hyperglycemic , with hyperactive hypothalamic - pituitary - adrenal axis [ 115 ] .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [153, 158]}, {"entity": "hypothalamic - pituitary - adrenal axis", "entity_type": "Anatomy", "pos": [256, 295]}], "task": "NER"}
+{"text": "Maternal undernutrition significantly increased both fetal and maternal corticosterone concentrations in rats [ 116 ] .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [53, 58]}], "task": "NER"}
+{"text": "Subsequently , maternal and / or fetal overexposure to glucocorticoids ( via administration of dexamethasone ) impairs both fetal and postnatal beta - cell formation in rodents and nonhuman primates [ 94 , 117 - 119 ] .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [33, 38]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [124, 129]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [144, 155]}], "task": "NER"}
+{"text": "Seckl et al .", "entity": [], "task": "NER"}
+{"text": "[ 115 ] have shown that fetal corticosterone concentrations are inversely correlated with fetal insulin content and postnatal beta - cell formation in rats .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [24, 29]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [90, 95]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [126, 137]}], "task": "NER"}
+{"text": "Evidence suggests that glucocorticoids can exert a direct effect on the developing fetal pancreas via transcriptional modulation of transcription factors involved in beta - cell formation and differentiation [ 117 ] .", "entity": [{"entity": "fetal pancreas", "entity_type": "Anatomy", "pos": [83, 97]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [166, 177]}], "task": "NER"}
+{"text": "Glucocorticoid receptors are present in the pancreas during embryonic development of rodents and humans [ 117 ] , and glucocorticoids can bind to the Pdx1 promoter and thus suppress fetal endocrine cell differentiation [ 117 ] .", "entity": [{"entity": "pancreas", "entity_type": "Anatomy", "pos": [44, 52]}, {"entity": "embryonic", "entity_type": "Anatomy", "pos": [60, 69]}, {"entity": "fetal endocrine cell", "entity_type": "Anatomy", "pos": [182, 202]}], "task": "NER"}
+{"text": "Glucocorticoid treatment has been shown to significantly reduce fetal expression of key endocrine transcription factors such as Pdx1 and Pax6 but simultaneously increase expression of transcription factors that regulate development of the exocrine pancreas [ 119 ] .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [64, 69]}, {"entity": "endocrine", "entity_type": "Anatomy", "pos": [88, 97]}, {"entity": "exocrine pancreas", "entity_type": "Anatomy", "pos": [239, 256]}], "task": "NER"}
+{"text": "It has also been demonstrated that the UPI or the low - protein IUPR offspring experience increased oxidative stress and impaired mitochondrial function [ 96 , 120 ] .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [130, 143]}], "task": "NER"}
+{"text": "The mitochondrial dysfunction was not limited to just the beta cell , as mitochondria from both the liver and skeletal muscle exhibit decreased oxidation of pyruvate , subsequently leading to the development of features commonly found in T2D [ 100 , 121 ] .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [4, 17]}, {"entity": "beta cell", "entity_type": "Anatomy", "pos": [58, 67]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [73, 85]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [100, 105]}, {"entity": "skeletal muscle", "entity_type": "Anatomy", "pos": [110, 125]}], "task": "NER"}
+{"text": "Also exposure to a Western - style diet before and during pregnancy ( an IUEO model ) alters the redox state as early as preimplantation development , leading to mild oxidative stress associated with inflammation .", "entity": [], "task": "NER"}
+{"text": "The finding that administration of antioxidants to the dam reverses oxidative stress and completely prevents the development of glucose intolerance and increased adiposity in the adult offspring suggests that oxidative stress plays an important role in the development of adiposity in this case [ 122 ] .", "entity": [], "task": "NER"}
+{"text": "Some studies in the low - protein IUPR model have demonstrated that oxidative stress is not limited to just mitochondrial DNA damage , but also to genomic DNA , impacting cell - cycle regulation and gene expression [ 123 ] .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [108, 121]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [171, 175]}], "task": "NER"}
+{"text": "While DNA is being targeted throughout by ROS , there are particular regions that are known to be more sensitive to ROS - mediated damage , for example , telomeres .", "entity": [{"entity": "telomeres", "entity_type": "Anatomy", "pos": [154, 163]}], "task": "NER"}
+{"text": "Telomeres comprise GC - rich repeats and are found at the ends of each chromosome .", "entity": [{"entity": "Telomeres", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "chromosome", "entity_type": "Anatomy", "pos": [71, 81]}], "task": "NER"}
+{"text": "They are known to shorten with each cellular division and , hence , can act as a mitotic clock , registering the number of replicative divisions to have taken place within the cell .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [36, 44]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [176, 180]}], "task": "NER"}
+{"text": "Investigations using an IUPR model have indeed reported a decrease in longevity in the offspring [ 123 , 124 ] accompanied by reduction in mitochondrial antioxidant defences [ 96 , 125 ] and telomere length in islets [ 125 ] .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [139, 152]}, {"entity": "telomere", "entity_type": "Anatomy", "pos": [191, 199]}, {"entity": "islets", "entity_type": "Anatomy", "pos": [210, 216]}], "task": "NER"}
+{"text": "Pancreatic islet development has been shown to be influenced by a number of growth factors including the insulin - like growth factors , IGF - I and IGF - II whose expression in utero is regulated by nutrient and hormone concentrations .", "entity": [{"entity": "Pancreatic islet", "entity_type": "Anatomy", "pos": [0, 16]}], "task": "NER"}
+{"text": "IUPR modifies expression of both IGF genes in a variety of fetal tissues .", "entity": [{"entity": "fetal tissues", "entity_type": "Anatomy", "pos": [59, 72]}], "task": "NER"}
+{"text": "In an IUPR rat model with a decreased beta - cell mass and beta - cell replication and an increased rate of beta - cell apoptosis , gene expression for IGF - II but not IGF - I was found reduced in the fetal pancreas [ 126 ] .", "entity": [{"entity": "beta - cell", "entity_type": "Anatomy", "pos": [38, 49]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [59, 70]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [108, 119]}, {"entity": "fetal pancreas", "entity_type": "Anatomy", "pos": [202, 216]}], "task": "NER"}
+{"text": "In a different IUPR model with more severe global food restriction which induced hyperinsulinemia and an increase in beta - cell mass in their fetuses [ 90 ] , the fetal phenotype was unexpectedly associated with an increase in pancreatic IGF - I expression , islet IGF - 1R [ 91 ] , and IRS - 2 [ 92 ] .", "entity": [{"entity": "beta - cell", "entity_type": "Anatomy", "pos": [117, 128]}, {"entity": "fetuses", "entity_type": "Anatomy", "pos": [143, 150]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [164, 169]}, {"entity": "pancreatic", "entity_type": "Anatomy", "pos": [228, 238]}, {"entity": "islet", "entity_type": "Anatomy", "pos": [260, 265]}], "task": "NER"}
+{"text": "In the fetal GK / Par rat exposed to mild hyperglycemia during gestation ( a model of IUED ) , data from our group suggest that the beta - cell deficit ( reduced by more than 50 % ) starts as early as fetal age E16 and reflects decreased beta - cell proliferation , a limitation of beta - cell neogenesis from precursors , and increased apoptosis of both beta cells and their precursors [ 86 ] .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [7, 12]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [132, 143]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [201, 206]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [238, 249]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [282, 293]}, {"entity": "precursors", "entity_type": "Anatomy", "pos": [310, 320]}, {"entity": "beta cells", "entity_type": "Anatomy", "pos": [355, 365]}, {"entity": "precursors", "entity_type": "Anatomy", "pos": [376, 386]}], "task": "NER"}
+{"text": "Notably , Pdx1 and Neurogenin3 expression were decreased on E18 but normally expressed on E13 [ 86 ] .", "entity": [], "task": "NER"}
+{"text": "Defective signalling through the Igf2 / Igf1 - R pathway may represent the primary instrumental anomaly since Igf2 and Igf1 - R protein expressions are already decreased within the GK / Par pancreatic rudiment at E13 , at a time when beta - cell mass ( first wave of beta - cell expansion ) is in fact normal [ 31 ] .", "entity": [{"entity": "pancreatic rudiment", "entity_type": "Anatomy", "pos": [190, 209]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [234, 245]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [267, 278]}], "task": "NER"}
+{"text": "Low levels of pancreatic Igf2 associated with beta - cell mass deficiency are maintained thereafter within the fetal pancreas [ 87 ] .", "entity": [{"entity": "pancreatic", "entity_type": "Anatomy", "pos": [14, 24]}, {"entity": "beta - cell", "entity_type": "Anatomy", "pos": [46, 57]}, {"entity": "fetal pancreas", "entity_type": "Anatomy", "pos": [111, 125]}], "task": "NER"}
+{"text": "Crossbreeding protocols between nondiabetic W and diabetic GK rats showed that , in late gestation ( E18 ) , pancreatic Igf2 protein expression was as low in GKmother / GKfather and Wmother / GKfather crosses as in GKmother / GKfather crosses [ 87 ] .", "entity": [{"entity": "pancreatic", "entity_type": "Anatomy", "pos": [109, 119]}], "task": "NER"}
+{"text": "These findings rather support the hypothesis that the pancreatic Igf2 anomaly in the GK diabetic model is linked to a genetic determinism .", "entity": [{"entity": "pancreatic", "entity_type": "Anatomy", "pos": [54, 64]}], "task": "NER"}
+{"text": "This view is also consistent with the results of genetic analyses that linked a locus containing the gene encoding Igf2 to diabetes in the GK rat [ 127 ] .", "entity": [], "task": "NER"}
+{"text": "The Igf2 gene is subjected to paternal genomic imprinting .", "entity": [], "task": "NER"}
+{"text": "However , because the Igf2 expression is similarly affected in fetuses , regardless of whether the father is W or GK [ 87 ] , we cannot conclude with a simple change of Igf2 gene imprinting in the GK rat .", "entity": [{"entity": "fetuses", "entity_type": "Anatomy", "pos": [63, 70]}], "task": "NER"}
+{"text": "Finally , our understanding of the underlying mechanisms for reduced BCM in response to inappropriate perinatal nutrition is growing rapidly .", "entity": [], "task": "NER"}
+{"text": "However , the relative contribution of the many intrinsic and extrinsic factors which contribute to the adaptive response of the developing endocrine pancreas is still to be established .", "entity": [{"entity": "endocrine pancreas", "entity_type": "Anatomy", "pos": [140, 158]}], "task": "NER"}
+{"text": "Refinement", "entity": [], "task": "NER"}
+{"text": "R [ F 2 > 2sigma ( F 2 ) ] = 0 . 052", "entity": [], "task": "NER"}
+{"text": "wR ( F 2 ) = 0 . 132", "entity": [], "task": "NER"}
+{"text": "S = 1 . 02", "entity": [], "task": "NER"}
+{"text": "3804 reflections", "entity": [], "task": "NER"}
+{"text": "229 parameters", "entity": [], "task": "NER"}
+{"text": "67 restraints", "entity": [], "task": "NER"}
+{"text": "H - atom parameters constrained", "entity": [], "task": "NER"}
+{"text": "Deltarhomax = 0 . 56 e A - 3", "entity": [], "task": "NER"}
+{"text": "Deltarhomin = - 0 . 38 e A - 3", "entity": [], "task": "NER"}
+{"text": "Outcomes", "entity": [], "task": "NER"}
+{"text": "The primary outcomes of this study are smoking abstinence rates post release as well as number of days to first cigarette after release .", "entity": [], "task": "NER"}
+{"text": "Seven day point - prevalence abstinence will be determined by combining self - reported tobacco use over the prior seven days and urine cotinine assays ( below 200 ng / ml versus 200 or above ) .", "entity": [{"entity": "urine", "entity_type": "Anatomy", "pos": [130, 135]}], "task": "NER"}
+{"text": "Participants with self - reported abstinence and cotinine levels below the cut - off will be classified as abstinent .", "entity": [], "task": "NER"}
+{"text": "Participants lost to follow - up will be considered non - abstinent .", "entity": [], "task": "NER"}
+{"text": "A secondary analysis will examine the effect of length of forced abstinence on quit rates .", "entity": [], "task": "NER"}
+{"text": "Abbreviations", "entity": [], "task": "NER"}
+{"text": "ARDS : acute respiratory distress syndrome ; CMV : conventional mechanical ventilation ; HFOV : high - frequency oscillation ventilation ; LPS : lipopolysaccharide ; PEEP : positive end - expiratory pressure ; VILI : ventilator - induced lung injury .", "entity": [{"entity": "respiratory", "entity_type": "Anatomy", "pos": [13, 24]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [238, 242]}], "task": "NER"}
+{"text": "TxA2 , generated from arachidonic acid by cyclooxygenase 1 ( COX - 1 ) and Tx synthase , further amplifies platelet activation .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [107, 115]}], "task": "NER"}
+{"text": "COX - 1 converts arachidonic acid into prostaglandin endoperoxides PGG2 and PGH2 , the latter being , in turn , transformed by Tx synthase into TxA2 , a potent amplifier of platelet aggregation with vasoconstrictive properties .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [173, 181]}], "task": "NER"}
+{"text": "At the site of the atheroma rupture , platelet - released TxA2 leads to downstream micro - vessel contraction and thrombus propagation ( 7 ) .", "entity": [{"entity": "site", "entity_type": "Anatomy", "pos": [7, 11]}, {"entity": "atheroma", "entity_type": "Anatomy", "pos": [19, 27]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "micro - vessel", "entity_type": "Anatomy", "pos": [83, 97]}, {"entity": "thrombus", "entity_type": "Anatomy", "pos": [114, 122]}], "task": "NER"}
+{"text": "In addition to its role in coagulation , thrombin at extremely low concentrations is one of the major platelet activators ( 8 ) .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [102, 110]}], "task": "NER"}
+{"text": "Human platelets express two cell surface G - protein - coupled protease - activated receptors ( PARs ) for thrombin : PAR - 1 and PAR - 4 .", "entity": [{"entity": "platelets", "entity_type": "Anatomy", "pos": [6, 15]}, {"entity": "cell surface", "entity_type": "Anatomy", "pos": [28, 40]}], "task": "NER"}
+{"text": "By binding the hirudin - like extracellular amino terminal domain ( the so - called thrombin receptor ) , thrombin activates platelets and smooth muscle cells , thus promoting platelet pro - coagulant activity , shape change , secretion and release of agonists ( ADP and TxA2 ) , expression of P - selectin , activation of the alphaIIbbeta3 integrin receptor , and aggregation .", "entity": [{"entity": "extracellular", "entity_type": "Anatomy", "pos": [30, 43]}, {"entity": "platelets", "entity_type": "Anatomy", "pos": [125, 134]}, {"entity": "smooth muscle cells", "entity_type": "Anatomy", "pos": [139, 158]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [176, 184]}], "task": "NER"}
+{"text": "Thrombin also binds to GpIbalpha on the surface of platelets , thought to act as a co - factor that localizes the enzyme on the platelet surface and accelerates the hydrolysis of PAR - 1 ( 9 ) .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [40, 47]}, {"entity": "platelets", "entity_type": "Anatomy", "pos": [51, 60]}, {"entity": "platelet surface", "entity_type": "Anatomy", "pos": [128, 144]}], "task": "NER"}
+{"text": "PAR - 1 and P2Y12 cross - react in platelet activation , and Galphaq and Galphai - coupled receptors are involved in this process .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [35, 43]}], "task": "NER"}
+{"text": "Thrombin - dependent platelet aggregation is mediated in part by secreted ADP , acting on the Galphai - linked ADP receptor .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [21, 29]}], "task": "NER"}
+{"text": "By blocking Galphaq via PAR - 1 and Gbetai via P2Y12 , combined inhibition of thrombin and P2Y12 receptors leads to a synergistic inhibitory effect on thrombin - induced platelet aggregation ( 10 ) .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [170, 178]}], "task": "NER"}
+{"text": "5 - HT is a vasoconstrictor agent that binds to 5HT - 2A receptors and amplifies the platelet response by stimulating shape change and enhancing platelet recruitment at sites of injury ( 3 ) .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [85, 93]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [145, 153]}], "task": "NER"}
+{"text": "It may also play a pro - coagulant role by promoting the retention of fibrinogen and thrombospondin on the platelet surface .", "entity": [{"entity": "platelet surface", "entity_type": "Anatomy", "pos": [107, 123]}], "task": "NER"}
+{"text": "Intraplatelet 5 - HT stores are implicated in shear - induced platelet aggregation and thrombus propagation ( 3 ) .", "entity": [{"entity": "Intraplatelet", "entity_type": "Anatomy", "pos": [0, 13]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [62, 70]}, {"entity": "thrombus", "entity_type": "Anatomy", "pos": [87, 95]}], "task": "NER"}
+{"text": "We studied 3 , 574 Canadian children , aged 7 - 8 yr , enrolled in a population - based birth cohort .", "entity": [], "task": "NER"}
+{"text": "Standardized questionnaires were completed by the children ' s parents , and data were analyzed by multivariate logistic regression .", "entity": [], "task": "NER"}
+{"text": "( iii ) HIV testing response rate by educational attainment and gender .", "entity": [], "task": "NER"}
+{"text": "Relative phage haplotype frequencies in PAO1 samples , ( A ) planktonic , ( B ) biofilm 4 days , ( C ) biofilm 11 days .", "entity": [{"entity": "biofilm", "entity_type": "Anatomy", "pos": [80, 87]}, {"entity": "biofilm", "entity_type": "Anatomy", "pos": [103, 110]}], "task": "NER"}
+{"text": "Collaxa BPEL Server Screenshot of Collaxa ' s bpelz design tool , building a choreography of GetHAPI and GetUMLS web services", "entity": [], "task": "NER"}
+{"text": "Ac - DEVD - AMC = N - acetyl - Asp - Glu - Val - Asp - 7 - amino - 4 - methylcoumarin ; Ac - DEVD - CHO = N - acetyl - Asp - Glu - Val - Asp - aldehyde ; COX = cyclooxygenase ; Deltapsim = mitochondrial membrane potential ; DAPI = 4 ' , 6 - diamidino - 2 - phenylindole ; DMEM = Dulbecco ' s modified Eagle ' s medium ; ELISA = enzyme - linked immunosorbent assay ; FCS = fetal calf serum ; FLS = fibroblast - like synoviocytes ; IL = interleukin ; JC - 1 = 5 , 5 ' , 6 , 6 ' - tetrachloro - 1 , 1 ' , 3 , 3 ' - tetraethylbenzimidazole carbocyanide iodide ; MTT = 3 - ( 4 , 5 - dimethylthiazol - 2 - yl ) - 2 , 5 - diphenyltetrazolium bromide ; PBS = phosphate - buffered saline ; PGE2 = prostaglandin E2 ; RA = rheumatoid arthritis .", "entity": [{"entity": "mitochondrial membrane", "entity_type": "Anatomy", "pos": [189, 211]}, {"entity": "FCS", "entity_type": "Anatomy", "pos": [366, 369]}, {"entity": "fetal calf serum", "entity_type": "Anatomy", "pos": [372, 388]}, {"entity": "FLS", "entity_type": "Anatomy", "pos": [391, 394]}, {"entity": "fibroblast - like synoviocytes", "entity_type": "Anatomy", "pos": [397, 427]}], "task": "NER"}
+{"text": "FR initiated and designed the research , collected and analyzed the data and wrote the paper .", "entity": [], "task": "NER"}
+{"text": "FO was the main supervisor , helped in analysis , and revised and edited the drafts .", "entity": [], "task": "NER"}
+{"text": "MN was co - supervisor and revised the drafts .", "entity": [], "task": "NER"}
+{"text": "Conclusion", "entity": [], "task": "NER"}
+{"text": "Artificial addition of siderophores and HSLs may be a possible method to aid in the identification and isolation of marine bacterial species which are thought to be unknown .", "entity": [], "task": "NER"}
+{"text": "Positron emission tomography in a case of intracranial hemangiopericytoma .", "entity": [{"entity": "intracranial hemangiopericytoma", "entity_type": "Anatomy", "pos": [42, 73]}], "task": "NER"}
+{"text": "Due to the low prevalence of hemangiopericytomas ( HPCs ) , data on the biophysiological characteristics of this tumor are rare .", "entity": [{"entity": "hemangiopericytomas", "entity_type": "Anatomy", "pos": [29, 48]}, {"entity": "HPCs", "entity_type": "Anatomy", "pos": [51, 55]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [113, 118]}], "task": "NER"}
+{"text": "Positron emission tomography ( PET ) demonstrated a sixfold increased uptake of [ 11C ] methionine and hyperperfusion in the HPC , whereas glucose utilization was decreased in this area .", "entity": [{"entity": "HPC", "entity_type": "Anatomy", "pos": [125, 128]}], "task": "NER"}
+{"text": "This low glucose utilization is in contrast to the high [ 11C ] methionine uptake and the malignancy of these tumors .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [110, 116]}], "task": "NER"}
+{"text": "The characteristics of HPCs in PET described herein for the first time offer additional diagnostic criteria and may help especially to differentiate these tumors from meningiomas .", "entity": [{"entity": "HPCs", "entity_type": "Anatomy", "pos": [23, 27]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [155, 161]}, {"entity": "meningiomas", "entity_type": "Anatomy", "pos": [167, 178]}], "task": "NER"}
+{"text": "Thyrotropin receptor : a role for thyroid tumourigenesis ?", "entity": [{"entity": "thyroid", "entity_type": "Anatomy", "pos": [34, 41]}], "task": "NER"}
+{"text": "Human thyroid tumours represent an example of the interplay of genetic and non genetic carcinogenesis .", "entity": [{"entity": "thyroid tumours", "entity_type": "Anatomy", "pos": [6, 21]}], "task": "NER"}
+{"text": "Recently , genetic abnormalities in the elements of the Thyrotropin receptor ( TSH - R ) dependent cAMP regulatory cascade have been found to be involved both in benign and malignant thyroid tumours .", "entity": [{"entity": "benign", "entity_type": "Anatomy", "pos": [162, 168]}, {"entity": "malignant thyroid tumours", "entity_type": "Anatomy", "pos": [173, 198]}], "task": "NER"}
+{"text": "The presence of activating mutations has been demonstrated in the TSH - R gene as well as in the Gs alpha protein gene in thyroid toxic adenoma resulting in the constitutive activation of the cAMP pathway and it has been hypothesised that these genetic alterations may play a causative role in the disease .", "entity": [{"entity": "thyroid toxic adenoma", "entity_type": "Anatomy", "pos": [122, 143]}], "task": "NER"}
+{"text": "However , recent observations suggest more caution in accepting such a hypothesis .", "entity": [], "task": "NER"}
+{"text": "The presence of activating TSH - R mutations has also been demonstrated in differentiated thyroid carcinomas .", "entity": [{"entity": "thyroid carcinomas", "entity_type": "Anatomy", "pos": [90, 108]}], "task": "NER"}
+{"text": "At present , the percentage of such a modification is low , unless referred to selected series of tumours .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [98, 105]}], "task": "NER"}
+{"text": "Activating mutations of the TSH - R gene have been detected in a group of differentiated carcinomas with high basal adenylyl cyclase activity , and in a few cases of hyperfunctioning thyroid carcinoma .", "entity": [{"entity": "carcinomas", "entity_type": "Anatomy", "pos": [89, 99]}, {"entity": "thyroid carcinoma", "entity_type": "Anatomy", "pos": [183, 200]}], "task": "NER"}
+{"text": "However , the role of the TSH - R - related cAMP pathway alterations in thyroid transformation remains to be elucidated .", "entity": [{"entity": "thyroid", "entity_type": "Anatomy", "pos": [72, 79]}], "task": "NER"}
+{"text": "In this review , the role of TSH - R gene alterations in benign and malignant thyroid neoplasia is examined .", "entity": [{"entity": "benign", "entity_type": "Anatomy", "pos": [57, 63]}, {"entity": "malignant thyroid neoplasia", "entity_type": "Anatomy", "pos": [68, 95]}], "task": "NER"}
+{"text": "[ Histopathologic examination of rectal carcinoma ] .", "entity": [{"entity": "rectal carcinoma", "entity_type": "Anatomy", "pos": [33, 49]}], "task": "NER"}
+{"text": "In patients with rectal carcinoma , the histopathological evaluation of the surgical specimen provides pivotal prognostic and therapeutic information .", "entity": [{"entity": "rectal carcinoma", "entity_type": "Anatomy", "pos": [17, 33]}, {"entity": "surgical specimen", "entity_type": "Anatomy", "pos": [76, 93]}], "task": "NER"}
+{"text": "Important parameters are tumor site , depth of invasion , histological type and grade , pattern of invasion ( diffusely infiltrating versus expanding margin ) , degree of peritumoral lymphocytic infiltration , and tumor involvement of surgical margins and lymph nodes .", "entity": [{"entity": "tumor site ,", "entity_type": "Anatomy", "pos": [25, 37]}, {"entity": "peritumoral lymphocytic", "entity_type": "Anatomy", "pos": [171, 194]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [214, 219]}, {"entity": "surgical margins", "entity_type": "Anatomy", "pos": [235, 251]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [256, 267]}], "task": "NER"}
+{"text": "Evaluation of the circumferential ( deep , lateral ) margin is of utmost importance .", "entity": [{"entity": "circumferential ( deep , lateral ) margin", "entity_type": "Anatomy", "pos": [18, 59]}], "task": "NER"}
+{"text": "It should be labeled with ink in the gross specimen and should be examined histologically using several tissue blocks .", "entity": [{"entity": "gross specimen", "entity_type": "Anatomy", "pos": [37, 51]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [104, 110]}], "task": "NER"}
+{"text": "The number of lymph node metastases and the total number of lymph nodes examined should be reported .", "entity": [{"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [14, 35]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [60, 71]}], "task": "NER"}
+{"text": "A histological evaluation of the distal mesorectum in its entirety is recommended to detect discontinuous distal mesorectal tumor spread .", "entity": [{"entity": "distal mesorectum", "entity_type": "Anatomy", "pos": [33, 50]}, {"entity": "distal mesorectal tumor", "entity_type": "Anatomy", "pos": [106, 129]}], "task": "NER"}
+{"text": "The histopathological findings should be summarized using the TNM - classification .", "entity": [], "task": "NER"}
+{"text": "Cooccurrence of reduced expression of alpha - catenin and overexpression of p53 is a predictor of lymph node metastasis in early gastric cancer .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [98, 108]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [129, 143]}], "task": "NER"}
+{"text": "BACKGROUND AND OBJECTIVES : Even though the pathological background contributes to lymph node metastasis , the biological characteristics of tumors have also gained wide attention .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [83, 93]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [141, 147]}], "task": "NER"}
+{"text": "In this study , the expression of the cadherin - catenin complex and p53 was studied in early gastric cancer .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [94, 108]}], "task": "NER"}
+{"text": "Their correlation with lymph node metastasis and the predictability of lymph node metastases , by combining these factors , were also discussed .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [23, 33]}, {"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [71, 92]}], "task": "NER"}
+{"text": "METHODS : One hundred and one specimens obtained from surgery were studied by immunohistochemistry using monoclonal anti - E - cadherin , anti - alpha - catenin and anti - p53 antibodies .", "entity": [{"entity": "specimens", "entity_type": "Anatomy", "pos": [30, 39]}], "task": "NER"}
+{"text": "RESULTS : Expression of E - cadherin and alpha - catenin was reduced in 50 . 5 and 64 . 4 % , respectively .", "entity": [], "task": "NER"}
+{"text": "p53 protein staining was positive in 29 . 7 % .", "entity": [], "task": "NER"}
+{"text": "There was a significant correlation between E - cadherin and alpha - catenin expression , but no correlation was found between p53 expression and E - cadherin or alpha - catenin expression .", "entity": [], "task": "NER"}
+{"text": "A reduction in alpha - catenin expression and p53 overexpression correlated to lymph node metastases , respectively .", "entity": [{"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [79, 100]}], "task": "NER"}
+{"text": "Multivariate analysis showed that cooccurrence of reduced expression of alpha - catenin and overexpression of p53 was an independent factor indicating lymph node metastases .", "entity": [{"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [151, 172]}], "task": "NER"}
+{"text": "CONCLUSION : A study of both alpha - catenin and p53 expression may be helpful to predict lymph node metastases in early gastric cancer .", "entity": [{"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [90, 111]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [121, 135]}], "task": "NER"}
+{"text": "Antisense technologies have a future fighting neurodegenerative diseases .", "entity": [], "task": "NER"}
+{"text": "Our growing understanding of the role that unfavorable patterns of gene expression play in the etiology of neurodegenerative disease emphasizes the need for strategies to selectively block the biosynthesis of harmful proteins in the brain .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [233, 238]}], "task": "NER"}
+{"text": "Antisense technologies are ideally suited to this purpose .", "entity": [], "task": "NER"}
+{"text": "Tailor - designed to target specific RNA , antisense oligonucleotides and ribozymes offer tools to suppress the production of proteins mediating neurodegeneration .", "entity": [], "task": "NER"}
+{"text": "Although technical limitations must still be overcome , the antisense approach represents a novel and exciting strategy for intervention in diseases of the central nervous system .", "entity": [{"entity": "central nervous system", "entity_type": "Anatomy", "pos": [156, 178]}], "task": "NER"}
+{"text": "Proto - oncogene N - myc promoter is down regulated by the Wilms ' tumor suppressor gene WT1 .", "entity": [{"entity": "Wilms ' tumor", "entity_type": "Anatomy", "pos": [59, 72]}], "task": "NER"}
+{"text": "The Wilms ' tumor 1 ( WT1 ) gene is a tumor suppressor gene that encodes a zinc - finger transcription factor .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [12, 17]}], "task": "NER"}
+{"text": "WT1 represses transcription of several growth factors and growth factor receptors .", "entity": [], "task": "NER"}
+{"text": "The N - myc proto - oncogene encodes a transcription factor which regulates cell growth and differentiation .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [76, 80]}], "task": "NER"}
+{"text": "N - myc is coexpressed with WT1 in the developing kidney and is overexpressed in many Wilms ' tumors .", "entity": [{"entity": "kidney", "entity_type": "Anatomy", "pos": [50, 56]}, {"entity": "Wilms ' tumors", "entity_type": "Anatomy", "pos": [86, 100]}], "task": "NER"}
+{"text": "Here , we show that the proto - oncogene N - myc promoter was down - regulated by WT1 in transient transfection assays .", "entity": [], "task": "NER"}
+{"text": "However , mutant WT1 ( R394W ) which has a mutation in the DNA binding domain could not repress the N - myc promoter .", "entity": [], "task": "NER"}
+{"text": "Electrophoretic mobility shift assays showed that the oligonucleotides containing the WT1 motifs could bind recombinant WT1 proteins .", "entity": [], "task": "NER"}
+{"text": "This suggests that the repression of the N - myc promoter is mediated through the WT1 binding sites .", "entity": [], "task": "NER"}
+{"text": "This finding may help to elucidate the relationship of WT1 and N - myc in tumorigenesis and renal development .", "entity": [{"entity": "renal", "entity_type": "Anatomy", "pos": [92, 97]}], "task": "NER"}
+{"text": "Spacing effects on the memory for faces .", "entity": [{"entity": "faces", "entity_type": "Anatomy", "pos": [34, 39]}], "task": "NER"}
+{"text": "25 undergraduate women studied 12 stimulus pictures of female faces successively presented in spaced or massed conditions and made affective judgments for the pictures along a dimension of like to dislike .", "entity": [{"entity": "faces", "entity_type": "Anatomy", "pos": [62, 67]}], "task": "NER"}
+{"text": "One week after the exposure ( study ) period , subjects were given an identification test comprised of photographs of the same female faces with different expressions .", "entity": [{"entity": "faces", "entity_type": "Anatomy", "pos": [134, 139]}], "task": "NER"}
+{"text": "Analysis showed that the pictures presented in the spaced condition were more frequently and accurately identified than those presented under the massed condition and that affective judgment was unrelated to conditions of presentation .", "entity": [], "task": "NER"}
+{"text": "Tumour - specific distribution of BRCA1 promoter region methylation supports a pathogenetic role in breast and ovarian cancer .", "entity": [{"entity": "Tumour", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [100, 106]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [111, 125]}], "task": "NER"}
+{"text": "The role of BRCA1 in sporadic breast and ovarian cancers remains elusive .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [30, 36]}, {"entity": "ovarian cancers", "entity_type": "Anatomy", "pos": [41, 56]}], "task": "NER"}
+{"text": "Direct involvement of BRCA1 in the development of breast and ovarian cancer is suggested by the finding that the BRCA1 promoter region CpG island is methylated in a proportion of breast and ovarian cancers .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [50, 56]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [61, 75]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [179, 185]}, {"entity": "ovarian cancers", "entity_type": "Anatomy", "pos": [190, 205]}], "task": "NER"}
+{"text": "The aim of this study was to compare the incidence of BRCA1 promoter region methylation in tumours in which loss of BRCA1 has been shown to play a role in pathogenesis ( breast and ovarian carcinomas ) with the incidence in tumours in which BRCA1 is unlikely to play a role in pathogenesis .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [91, 98]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [170, 176]}, {"entity": "ovarian carcinomas", "entity_type": "Anatomy", "pos": [181, 199]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [224, 231]}], "task": "NER"}
+{"text": "Promoter region hypermethylation was significantly more common ( P < 0 . 008 ) in breast and ovarian cancer ( 6 / 38 tumours methylated ) than in colon cancer ( 0 / 35 tumours methylated ) or in leukaemias ( 0 / 19 samples methylated ) .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [82, 88]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [93, 107]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [117, 124]}, {"entity": "colon cancer", "entity_type": "Anatomy", "pos": [146, 158]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [168, 175]}, {"entity": "leukaemias", "entity_type": "Anatomy", "pos": [195, 205]}, {"entity": "samples", "entity_type": "Anatomy", "pos": [215, 222]}], "task": "NER"}
+{"text": "The restriction of BRCA1 promoter region hypermethylation to breast and ovarian cancer is consistent with a pathogenetic role of BRCA1 promoter methylation in these tumours .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [61, 67]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [72, 86]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [165, 172]}], "task": "NER"}
+{"text": "We suggest that the rarity of observed BRCA1 mutations in sporadic breast and ovarian cancer is due to the greater likelihood of BRCA1 inactivation by non - mutational mechanisms such as methylation .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [67, 73]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [78, 92]}], "task": "NER"}
+{"text": "Regulation of the resident chromosomal copy of c - myc by c - Myb is involved in myeloid leukemogenesis .", "entity": [{"entity": "chromosomal", "entity_type": "Anatomy", "pos": [27, 38]}, {"entity": "myeloid", "entity_type": "Anatomy", "pos": [81, 88]}], "task": "NER"}
+{"text": "c - myb is a frequent target of retroviral insertional mutagenesis in murine leukemia virus - induced myeloid leukemia .", "entity": [{"entity": "myeloid leukemia", "entity_type": "Anatomy", "pos": [102, 118]}], "task": "NER"}
+{"text": "Induction of the leukemogenic phenotype is generally associated with inappropriate expression of this transcriptional regulator .", "entity": [], "task": "NER"}
+{"text": "Despite intensive investigations , the target genes of c - myb that are specifically involved in development of these myeloid lineage neoplasms are still unknown .", "entity": [{"entity": "myeloid", "entity_type": "Anatomy", "pos": [118, 125]}, {"entity": "neoplasms", "entity_type": "Anatomy", "pos": [134, 143]}], "task": "NER"}
+{"text": "In vitro assays have indicated that c - myc may be a target gene of c - Myb ; however , regulation of the resident chromosomal gene has not yet been demonstrated .", "entity": [{"entity": "chromosomal", "entity_type": "Anatomy", "pos": [115, 126]}], "task": "NER"}
+{"text": "To address this question further , we analyzed the expression of c - myc in a myeloblastic cell line , M1 , expressing a conditionally active c - Myb - estrogen receptor fusion protein ( MybER ) .", "entity": [{"entity": "myeloblastic cell line", "entity_type": "Anatomy", "pos": [78, 100]}, {"entity": "M1", "entity_type": "Anatomy", "pos": [103, 105]}], "task": "NER"}
+{"text": "Activation of MybER both prevented the growth arrest induced by interleukin - 6 ( IL - 6 ) and rapidly restored c - myc expression in nearly terminal differentiated cells that had been exposed to IL - 6 for 3 days .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [165, 170]}], "task": "NER"}
+{"text": "Restoration occurred in the presence of a protein synthesis inhibitor but not after a transcriptional block , indicating that c - myc is a direct , transcriptionally regulated target of c - Myb .", "entity": [], "task": "NER"}
+{"text": "c - myc is a major target that transduces Myb ' s proliferative signal , as shown by the ability of a c - Myc - estrogen receptor fusion protein alone to also reverse growth arrest in this system .", "entity": [], "task": "NER"}
+{"text": "To investigate the possibility that this regulatory connection contributes to Myb ' s oncogenicity , we expressed a dominant negative Myb in the myeloid leukemic cell line RI - 4 - 11 .", "entity": [{"entity": "myeloid leukemic cell line RI - 4 - 11", "entity_type": "Anatomy", "pos": [145, 183]}], "task": "NER"}
+{"text": "In this cell line , c - myb is activated by insertional mutagenesis and cannot be effectively down regulated by cytokine .", "entity": [{"entity": "cell line", "entity_type": "Anatomy", "pos": [8, 17]}], "task": "NER"}
+{"text": "Myb ' s ability to regulate c - myc ' s expression was also demonstrated in these cells , showing a mechanism through which the proto - oncogene c - myb can exert its oncogenic potential in myeloid lineage hematopoietic cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "myeloid lineage hematopoietic cells", "entity_type": "Anatomy", "pos": [190, 225]}], "task": "NER"}
+{"text": "Adenovirus - mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [122, 127]}], "task": "NER"}
+{"text": "Inhibition of angiogenesis has been shown to be an effective strategy in cancer therapy in mice .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [73, 79]}], "task": "NER"}
+{"text": "However , its widespread application has been hampered by difficulties in the large - scale production of the antiangiogenic proteins .", "entity": [], "task": "NER"}
+{"text": "This limitation may be resolved by in vivo delivery and expression of the antiangiogenic genes .", "entity": [], "task": "NER"}
+{"text": "We have constructed a recombinant adenovirus that expresses murine endostatin that is biologically active both in vitro , as determined in endothelial cell proliferation assays , and in vivo , by suppression of angiogenesis induced by vascular endothelial growth factor 165 .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [139, 155]}], "task": "NER"}
+{"text": "Persistent high serum levels of endostatin ( 605 - 1740 ng / ml ; mean , 936 ng / ml ) were achieved after systemic administration of the vector to nude mice , which resulted in significant reduction of the growth rates and the volumes of JC breast carcinoma and Lewis lung carcinoma ( P less than 0 . 001 and P less than 0 . 05 , respectively ) .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [16, 21]}, {"entity": "JC breast carcinoma", "entity_type": "Anatomy", "pos": [239, 258]}, {"entity": "Lewis lung carcinoma", "entity_type": "Anatomy", "pos": [263, 283]}], "task": "NER"}
+{"text": "In addition , the endostatin vector treatment completely prevented the formation of pulmonary micrometastases in Lewis lung carcinoma ( P = 0 . 0001 ) .", "entity": [{"entity": "pulmonary micrometastases", "entity_type": "Anatomy", "pos": [84, 109]}, {"entity": "Lewis lung carcinoma", "entity_type": "Anatomy", "pos": [113, 133]}], "task": "NER"}
+{"text": "Immunohistochemical staining of the tumors demonstrated a decreased number of blood vessels in the treatment group versus the controls .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [36, 42]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [78, 91]}], "task": "NER"}
+{"text": "In conclusion , the present study clearly demonstrates the potential of vector - mediated antiangiogenic gene therapy as a component in cancer therapy .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [136, 142]}], "task": "NER"}
+{"text": "Abdominal approach for the ligation of bleeding oesophageal varices .", "entity": [{"entity": "Abdominal", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "oesophageal varices", "entity_type": "Anatomy", "pos": [48, 67]}], "task": "NER"}
+{"text": "The conventional surgical treatment of bleeding oesophageal varices in the emergency situation is based upon the Boerema - Crile operation of transthoracic oesophagotomy and ligation of the varices .", "entity": [{"entity": "oesophageal varices", "entity_type": "Anatomy", "pos": [48, 67]}, {"entity": "transthoracic", "entity_type": "Anatomy", "pos": [142, 155]}, {"entity": "varices", "entity_type": "Anatomy", "pos": [190, 197]}], "task": "NER"}
+{"text": "This and the other methods of treatment of this condition in current practice are discussed .", "entity": [], "task": "NER"}
+{"text": "Two cases are reported in which a transabdominal oesophagogastrotomy was used to approach the site of bleeding .", "entity": [{"entity": "transabdominal", "entity_type": "Anatomy", "pos": [34, 48]}, {"entity": "site", "entity_type": "Anatomy", "pos": [94, 98]}], "task": "NER"}
+{"text": "This operation is described and the theoretical and practical advantages it appears to offer over the standard approach are considered .", "entity": [], "task": "NER"}
+{"text": "High frequency of hypermethylation at the 14 - 3 - 3 sigma locus leads to gene silencing in breast cancer .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [92, 105]}], "task": "NER"}
+{"text": "Expression of 14 - 3 - 3 final sigma ( final sigma ) is induced in response to DNA damage , and causes cells to arrest in G ( 2 ) .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [103, 108]}], "task": "NER"}
+{"text": "By SAGE ( serial analysis of gene expression ) analysis , we identified final sigma as a gene whose expression is 7 - fold lower in breast carcinoma cells than in normal breast epithelium .", "entity": [{"entity": "breast carcinoma cells", "entity_type": "Anatomy", "pos": [132, 154]}, {"entity": "breast epithelium", "entity_type": "Anatomy", "pos": [170, 187]}], "task": "NER"}
+{"text": "We verified this finding by Northern blot analysis .", "entity": [], "task": "NER"}
+{"text": "Remarkably , final sigma mRNA was undetectable in 45 of 48 primary breast carcinomas .", "entity": [{"entity": "primary breast carcinomas", "entity_type": "Anatomy", "pos": [59, 84]}], "task": "NER"}
+{"text": "Genetic alterations at final sigma such as loss of heterozygosity were rare ( 1 / 20 informative cases ) , and no mutations were detected ( 0 / 34 ) .", "entity": [], "task": "NER"}
+{"text": "On the other hand , hypermethylation of CpG islands in the final sigma gene was detected in 91 % ( 75 / 82 ) of breast tumors and was associated with lack of gene expression .", "entity": [{"entity": "breast tumors", "entity_type": "Anatomy", "pos": [112, 125]}], "task": "NER"}
+{"text": "Hypermethylation of final sigma is functionally important , because treatment of final sigma - non - expressing breast cancer cell lines with the drug 5 - aza - 2 ' - deoxycytidine resulted in demethylation of the gene and synthesis of final sigma mRNA .", "entity": [{"entity": "breast cancer cell lines", "entity_type": "Anatomy", "pos": [112, 136]}], "task": "NER"}
+{"text": "Breast cancer cells lacking final sigma expression showed increased number of chromosomal breaks and gaps when exposed to gamma - irradiation .", "entity": [{"entity": "Breast cancer cells", "entity_type": "Anatomy", "pos": [0, 19]}, {"entity": "chromosomal", "entity_type": "Anatomy", "pos": [78, 89]}], "task": "NER"}
+{"text": "Therefore , it is possible that loss of final sigma expression contributes to malignant transformation by impairing the G ( 2 ) cell cycle checkpoint function , thus allowing an accumulation of genetic defects .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [128, 132]}], "task": "NER"}
+{"text": "Hypermethylation and loss of final sigma expression are the most consistent molecular alterations in breast cancer identified so far .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [101, 114]}], "task": "NER"}
+{"text": "Stimulation of the sodium pump by azide and high internal sodium : changes in the number of pumping sites and turnover rate .", "entity": [], "task": "NER"}
+{"text": "The effects of 5 mM azide on [ 3H ] ouabain uptake and 22Na efflux were determined .", "entity": [], "task": "NER"}
+{"text": "Both glycoside uptake and 22Na efflux were enhanced by azide .", "entity": [], "task": "NER"}
+{"text": "Azide stimulated the Na pump in muscles whose pumping sites had been inhibited by ouabain and then transferred to a glycoside - free solution .", "entity": [{"entity": "muscles", "entity_type": "Anatomy", "pos": [32, 39]}], "task": "NER"}
+{"text": "This stimulation was observed before detecting any recovery of the initial pumping activity .", "entity": [], "task": "NER"}
+{"text": "3 .", "entity": [], "task": "NER"}
+{"text": "When both the resting and the azide - stimulated 22Na efflux had been blocked by ouabain , an additional exposure to azide , in a ouabain - free solution , had no further effects on 22Na efflux .", "entity": [], "task": "NER"}
+{"text": "It is concluded that the increase in Na pumping caused by azide is due in part to an increase in the number of pumping sites .", "entity": [], "task": "NER"}
+{"text": "[ 3H ] ouabain binding was measured in muscles with different intracellular alkali cation concentrations .", "entity": [{"entity": "muscles", "entity_type": "Anatomy", "pos": [39, 46]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [62, 75]}], "task": "NER"}
+{"text": "Variations in [ Na ] i from 15 up to 50 mM did not significantly affect the amount of glycoside bound .", "entity": [], "task": "NER"}
+{"text": "A substantial increase in binding occurred when [ Na ] i reached 70 mM .", "entity": [], "task": "NER"}
+{"text": "6 .", "entity": [], "task": "NER"}
+{"text": "It is proposed that the increase in Na extrusion that occurs during the recovery of Na loaded muscles mostly results from an increased turnover rate of the pump rather than from an increase in number of pumping sites .", "entity": [{"entity": "muscles", "entity_type": "Anatomy", "pos": [94, 101]}], "task": "NER"}
+{"text": "Reduced oncogenicity of p190 Bcr / Abl F - actin - binding domain mutants .", "entity": [], "task": "NER"}
+{"text": "The deregulated Bcr / Abl tyrosine kinase is responsible for the development of Philadelphia ( Ph ) - positive leukemia in humans .", "entity": [{"entity": "leukemia", "entity_type": "Anatomy", "pos": [111, 119]}], "task": "NER"}
+{"text": "To investigate the significance of the C - terminal Abl actin - binding domain within Bcr / Abl p190 in the development of leukemia / lymphoma in vivo , mutant p190 DNA constructs were used to generate transgenic mice .", "entity": [{"entity": "leukemia", "entity_type": "Anatomy", "pos": [123, 131]}, {"entity": "lymphoma", "entity_type": "Anatomy", "pos": [134, 142]}], "task": "NER"}
+{"text": "Eight founder and progeny mice of 5 different lines were monitored for leukemogenesis .", "entity": [], "task": "NER"}
+{"text": "Latency was markedly increased and occurrence decreased in the p190 del C lines as compared with nonmutated p190 BCR / ABL transgenics .", "entity": [], "task": "NER"}
+{"text": "Western blot analysis of involved hematologic tissues of the p190 del C transgenics with end - stage disease showed high - level expression of the transgene and tyrosine phosphorylation of Cbl and Hef1 / Cas , proteins previously shown to be affected by Bcr / Abl .", "entity": [{"entity": "hematologic tissues", "entity_type": "Anatomy", "pos": [34, 53]}], "task": "NER"}
+{"text": "These results show that the actin - binding domain of Abl enhances leukemia development but does not appear to be an absolute requirement for leukemogenesis .", "entity": [{"entity": "leukemia", "entity_type": "Anatomy", "pos": [67, 75]}], "task": "NER"}
+{"text": "Building the vertebrate vasculature : research is going swimmingly .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [24, 35]}], "task": "NER"}
+{"text": "The vertebrate vasculature develops in remarkably similar fashion in all vertebrates .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [15, 26]}], "task": "NER"}
+{"text": "A cohort of unspecified mesodermal cells differentiates into primitive endothelial cells , which migrate to and occupy positions within the stereotypical blueprint of the primitive vasculature .", "entity": [{"entity": "mesodermal cells", "entity_type": "Anatomy", "pos": [24, 40]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [71, 88]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [181, 192]}], "task": "NER"}
+{"text": "Once in position , these cells coalesce and form cords , which lumenize and become ensheathed by supporting pericytes and smooth muscle cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [25, 30]}, {"entity": "cords", "entity_type": "Anatomy", "pos": [49, 54]}, {"entity": "pericytes", "entity_type": "Anatomy", "pos": [108, 117]}, {"entity": "smooth muscle cells", "entity_type": "Anatomy", "pos": [122, 141]}], "task": "NER"}
+{"text": "This primitive vascular network is extensively remodeled in some places , and expanded by sprouting in others .", "entity": [{"entity": "vascular network", "entity_type": "Anatomy", "pos": [15, 31]}], "task": "NER"}
+{"text": "Various studies using the mouse , quail / chick , and frog have uncovered a number of signals that guide these complex processes but many gaps still exist in our understanding of the mechanisms by which the embryonic vasculature is built .", "entity": [{"entity": "embryonic vasculature", "entity_type": "Anatomy", "pos": [207, 228]}], "task": "NER"}
+{"text": "Because many questions will require in vivo studies to be properly addressed , the zebrafish , with its unique accessibility to analysis by combined embryological , molecular , and genetic methods , should prove invaluable in identifying new molecules involved in blood vessel development and integrating pathways that influence embryonic blood vessel formation .", "entity": [{"entity": "embryological", "entity_type": "Anatomy", "pos": [149, 162]}, {"entity": "blood vessel", "entity_type": "Anatomy", "pos": [264, 276]}, {"entity": "embryonic blood vessel", "entity_type": "Anatomy", "pos": [329, 351]}], "task": "NER"}
+{"text": "[ Interleukin - 18 and new drugs . Protective effect against tumor growth and infections ] .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [61, 66]}], "task": "NER"}
+{"text": "IL - 18 , originally identified as interferon - gamma inducing factor ( IGIF ) , is related to the IL - 1 family in terms of its structure as well as its processing , receptor , signal transduction pathway and pro - inflammatory properties .", "entity": [], "task": "NER"}
+{"text": "IL - 18 is also functionally related to IL - 12 , as it induces the production of Th1 cytokines and participates in cell - mediated immune cytotoxicity .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [116, 120]}], "task": "NER"}
+{"text": "A summary is made of recent advances in the understanding of IL - 18 structure , processing , receptor expression and immunoregulatory functions .", "entity": [], "task": "NER"}
+{"text": "It focuses on the role of IL - 18 modulation in tumours , infections and autoimmune and inflammatory diseases .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [48, 55]}], "task": "NER"}
+{"text": "Focal congenital alveolar proteinosis associated with abnormal surfactant protein B messenger RNA .", "entity": [{"entity": "alveolar", "entity_type": "Anatomy", "pos": [17, 25]}], "task": "NER"}
+{"text": "Two siblings presented with typical clinical features of congenital pulmonary alveolar proteinosis ( PAP ) .", "entity": [{"entity": "pulmonary alveolar", "entity_type": "Anatomy", "pos": [68, 86]}], "task": "NER"}
+{"text": "Necropsy of one sibling revealed scattered foci of the diagnostic histologic changes in the lung tissue .", "entity": [{"entity": "foci", "entity_type": "Anatomy", "pos": [43, 47]}, {"entity": "lung tissue", "entity_type": "Anatomy", "pos": [92, 103]}], "task": "NER"}
+{"text": "In contrast to infantile and adult PAP , focal distribution is uncommon in congenital PAP .", "entity": [{"entity": "focal", "entity_type": "Anatomy", "pos": [41, 46]}], "task": "NER"}
+{"text": "Defective expression of the granulocyte - macrophage colony - stimulating factor receptor was ruled out .", "entity": [], "task": "NER"}
+{"text": "The surfactant protein B ( SP - B ) content in the lung tissue of the autopsied patient was low , and a deletion in the SP - B messenger RNA was detected .", "entity": [{"entity": "lung tissue", "entity_type": "Anatomy", "pos": [51, 62]}], "task": "NER"}
+{"text": "We speculate that the PAP in our patients was related to the reduced quantity and / or to the altered quality of SP - B .", "entity": [], "task": "NER"}
+{"text": "Tonometry in normal and scarred corneas , and in postkeratoplasty eyes : a comparative study of the Goldmann , the ProTon and the Schiotz tonometers .", "entity": [{"entity": "corneas", "entity_type": "Anatomy", "pos": [32, 39]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [66, 70]}], "task": "NER"}
+{"text": "PURPOSE :", "entity": [], "task": "NER"}
+{"text": "Clinical comparison of intraocular pressure ( IOP ) measured with the Goldmann applanation tonometer ( GAT ) , the ProTon tonometer ( PT ) , and the Schiotz tonometer ( ST ) , in normal eyes , eyes with scarred corneas and postkeratoplasty eyes .", "entity": [{"entity": "intraocular", "entity_type": "Anatomy", "pos": [23, 34]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [186, 190]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [193, 197]}, {"entity": "corneas", "entity_type": "Anatomy", "pos": [211, 218]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [240, 244]}], "task": "NER"}
+{"text": "MATERIAL AND METHODS :", "entity": [], "task": "NER"}
+{"text": "The IOP readings with GAT , PT , and ST were compared in 125 eyes with normal corneas ( Group A ) , 17 eyes with scarred corneas ( Group B ) , and in 21 postkeratoplasty eyes ( Group C ) .", "entity": [{"entity": "eyes", "entity_type": "Anatomy", "pos": [61, 65]}, {"entity": "corneas", "entity_type": "Anatomy", "pos": [78, 85]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [103, 107]}, {"entity": "corneas", "entity_type": "Anatomy", "pos": [121, 128]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [170, 174]}], "task": "NER"}
+{"text": "The data were statistically analysed at 95 % confidence interval ; linear regression analysis and paired t - test were done .", "entity": [], "task": "NER"}
+{"text": "RESULTS :", "entity": [], "task": "NER"}
+{"text": "The mean differences and their standard deviation [ SD ] between GAT and PT readings , and GAT and ST readings respectively were : [ 1 ] in Group A : - 0 . 23 [ SD 2 . 75 ] mmHg and + 0 . 24 [ SD 3 . 18 ] mmHg respectively ; [ 2 ] in Group B : - 1 . 8 [ SD 12 . 67 ] mmHg and - 4 . 5 [ SD 9 . 95 mmHg ; and [ 3 ] in Group C : + 0 . 24 [ SD 8 . 72 ] mmHg and - 0 . 12 [ SD 8 . 7 ] mmHg .", "entity": [], "task": "NER"}
+{"text": "They were not statistically significant .", "entity": [], "task": "NER"}
+{"text": "In Group A the 95 % confidence interval between GAT and PT readings was - 5 . 27 mmHg to 5 . 73 mmHg , and between GAT and ST readings , - 6 . 12 mmHg to 6 . 59 mmHg .", "entity": [], "task": "NER"}
+{"text": "Ninety six [ 77 % ] eyes with the PT and 84 [ 69 % ] eyes with ST measurements were within 3 mmHg of GAT pressure .", "entity": [{"entity": "eyes", "entity_type": "Anatomy", "pos": [20, 24]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [53, 57]}], "task": "NER"}
+{"text": "The correlation coefficients [ r ] for PT and ST were 0 . 93 [ P = 0 . 0000 ] and 0 . 88 [ P = 0 . 0000 ] respectively .", "entity": [], "task": "NER"}
+{"text": "In Group B 95 % confidence interval between GAT and PT readings was - 27 . 17 mmHg to 23 . 51 mmHg , and between GAT and ST measurement , - 24 . 37 mmHg to 15 . 44 mmHg .", "entity": [], "task": "NER"}
+{"text": "The correlation coefficients [ r ] for the PT and ST were 0 . 112 [ P = 0 . 660 ] and 0 . 630 [ P = 0 . 006 ] respectively .", "entity": [], "task": "NER"}
+{"text": "In group C , the 95 % confidence interval between GAT and PT measurements was - 17 . 20 mmHg to 17 . 67 mmHg , and between GAT and ST measurements , - 17 . 51 mmHg to 17 . 27 mmHg .", "entity": [], "task": "NER"}
+{"text": "The correlation coefficients [ r ] for the PT and the ST were 0 . 780 [ P = 0 . 0000 ] and 0 . 740 [ P = 0 . 0001 ] respectively .", "entity": [], "task": "NER"}
+{"text": "CONCLUSIONS :", "entity": [], "task": "NER"}
+{"text": "In clinical practice PT appears to have a higher level of accuracy than ST in normal corneas .", "entity": [{"entity": "corneas", "entity_type": "Anatomy", "pos": [85, 92]}], "task": "NER"}
+{"text": "In scarred corneas and post - penetrating keratoplasty eyes , because of high SD for mean differences and wide confidence interval of 95 % , both PT and ST are inaccurate in measuring IOP as compared to GAT in such eyes .", "entity": [{"entity": "corneas", "entity_type": "Anatomy", "pos": [11, 18]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [55, 59]}, {"entity": "eyes", "entity_type": "Anatomy", "pos": [215, 219]}], "task": "NER"}
+{"text": "A small peptide derived from Flt - 1 ( VEGFR - 1 ) functions as an angiogenic inhibitor .", "entity": [], "task": "NER"}
+{"text": "Vascular endothelial growth factor ( VEGF ) is an angiogenic stimulator which functions through two endothelial specific tyrosine kinase receptors , Flt - 1 and Flk - 1 .", "entity": [{"entity": "endothelial", "entity_type": "Anatomy", "pos": [9, 20]}], "task": "NER"}
+{"text": "In this work , we show that an 11 - amino acid peptide derived from the second immunoglobulin - like domain of Flt - 1 functions as an angiogenic inhibitor in chick chorioallantoic membrane and inhibited VEGF - induced vascular permeability in Miles ' assay without binding to VEGF directly .", "entity": [{"entity": "chorioallantoic membrane", "entity_type": "Anatomy", "pos": [165, 189]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [219, 227]}], "task": "NER"}
+{"text": "Circular dichroism and nuclear magnetic resonance analyses indicate that this peptide forms a stable extended structure in solution , presumably beta - sheet structure and is most likely existing as a dimer .", "entity": [], "task": "NER"}
+{"text": "Our results suggest that this small peptide functions as an angiogenic inhibitor by inhibiting VEGF function through a non - VEGF binding mechanism .", "entity": [], "task": "NER"}
+{"text": "[ H . pylori infection . Our experience with the quadruple and triple therapy as first pharmacologic approach ] .", "entity": [], "task": "NER"}
+{"text": "For now the most used pharmacological treatment of first instance to eradication of Hp foresees utilization of triple therapy ( PPI + two antibiotics ) .", "entity": [], "task": "NER"}
+{"text": "In our study we have compared this kind of treatment with the quadruple therapy ( PPI + three antibiotics ) , that have showed a taller percentage of eradication at the end of first therapeutical cycle with a shorter time and lower price of treatment .", "entity": [], "task": "NER"}
+{"text": "Coexpression of vascular endothelial growth factor and p53 protein in squamous cell carcinoma of the esophagus .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [70, 93]}, {"entity": "esophagus", "entity_type": "Anatomy", "pos": [101, 110]}], "task": "NER"}
+{"text": "OBJECTIVE : p53 plays a role in tumor angiogenesis , and vascular endothelial growth factor ( VEGF ) plays a key role in tumor angiogenesis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [32, 37]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [121, 126]}], "task": "NER"}
+{"text": "The aim of the present study was to clarify how expression of p53 protein participates in angiogenesis , and whether the coexpression of VEGF and p53 protein has a significance for angiogenesis and the clinicopathological features in esophageal squamous cell carcinoma ( SCC ) .", "entity": [{"entity": "esophageal squamous cell carcinoma", "entity_type": "Anatomy", "pos": [234, 268]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [271, 274]}], "task": "NER"}
+{"text": "METHODS : Tissues samples were taken from 60 patients with esophageal SCC after surgery .", "entity": [{"entity": "Tissues samples", "entity_type": "Anatomy", "pos": [10, 25]}, {"entity": "esophageal SCC", "entity_type": "Anatomy", "pos": [59, 73]}], "task": "NER"}
+{"text": "The expression of VEGF and p53 protein in these SCC was examined immunohistochemically .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [48, 51]}], "task": "NER"}
+{"text": "Microvessel density ( MVD ) was determined by counting microvessels in tumor sections stained for Factor VIII - related antigen .", "entity": [{"entity": "Microvessel", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "microvessels", "entity_type": "Anatomy", "pos": [55, 67]}, {"entity": "tumor sections", "entity_type": "Anatomy", "pos": [71, 85]}], "task": "NER"}
+{"text": "Ki - 67 labeling index ( LI ) was calculated , based on Ki - 67 antigen immunostaining , as a proliferative marker .", "entity": [], "task": "NER"}
+{"text": "Apoptotic index ( AI ) was calculated , based on the terminal deoxynucleotidyl transferase - mediated deoxyuridine triphosphate biotin nick end labeling , to evaluate apoptosis .", "entity": [], "task": "NER"}
+{"text": "RESULTS : VEGF expression was observed in 58 . 3 % , and p53 protein expression was observed in 61 . 7 % of the 60 patients .", "entity": [], "task": "NER"}
+{"text": "VEGF and p53 protein were significantly coexpressed in 26 ( 43 . 4 % ) .", "entity": [], "task": "NER"}
+{"text": "Histological venous invasion ( p less than 0 . 01 ) and distant metastasis ( p less than 0 . 05 ) were significantly correlated with p53 protein expression .", "entity": [{"entity": "venous", "entity_type": "Anatomy", "pos": [13, 19]}], "task": "NER"}
+{"text": "The two parameters were more frequently observed in the SCC with VEGF / p53 coexpression than in those without the coexpression .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [56, 59]}], "task": "NER"}
+{"text": "The MVD and Ki - 67 LI were significantly higher ( p less than 0 . 01 and p less than 0 . 001 ) , and the AI was significantly lower ( p less than 0 . 001 ) in the SCC with p53 protein expression than in the SCC without it .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [164, 167]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [208, 211]}], "task": "NER"}
+{"text": "The MVD and Ki - 67 LI were higher , and the AI was lower in the SCC with VEGF / p53 coexpression than in those without the coexpression .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [65, 68]}], "task": "NER"}
+{"text": "The 5 - yr survival rate in patients with the coexpression was poorer than in the other patients .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION : These results suggest that mutant p53 expression is associated with angiogenesis and distant metastasis in esophageal SCC , and that the coexpression of p53 and VEGF may play an important role in angiogenesis , and have important clinical significance .", "entity": [{"entity": "esophageal SCC", "entity_type": "Anatomy", "pos": [120, 134]}], "task": "NER"}
+{"text": "[ mRNA expression of metastasis - suppressor gene nm23 in carcinoma of buccal mucosa . II . Quantitative reverse transcription PCR amplification ] .", "entity": [{"entity": "carcinoma", "entity_type": "Anatomy", "pos": [58, 67]}, {"entity": "buccal mucosa", "entity_type": "Anatomy", "pos": [71, 84]}], "task": "NER"}
+{"text": "The nm23 gene is a conspicuous metastasis - suppressor gene .", "entity": [], "task": "NER"}
+{"text": "The authors detected both nm23 - H1 and nm23 - H2 mRNA levels in 47 tissues samples of patients with carcinoma of buccal mucosa ( CBM ) by quantitative reverse transcription PCR amplification .", "entity": [{"entity": "tissues samples", "entity_type": "Anatomy", "pos": [68, 83]}, {"entity": "carcinoma", "entity_type": "Anatomy", "pos": [101, 110]}, {"entity": "buccal mucosa", "entity_type": "Anatomy", "pos": [114, 127]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [130, 133]}], "task": "NER"}
+{"text": "The results showed that expression levels of both nm23 - H1 and nm23 - H2 mRNA varied in normal buccal mucosa , leukoplakia , adjacent nontumorous mucosa , submandibular gland , CBM and lymph nodes with or without metastasis .", "entity": [{"entity": "buccal mucosa", "entity_type": "Anatomy", "pos": [96, 109]}, {"entity": "leukoplakia", "entity_type": "Anatomy", "pos": [112, 123]}, {"entity": "nontumorous mucosa", "entity_type": "Anatomy", "pos": [135, 153]}, {"entity": "submandibular gland", "entity_type": "Anatomy", "pos": [156, 175]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [178, 181]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [186, 197]}], "task": "NER"}
+{"text": "The nm23 - H1 mRNA expression levels in CBM with lymph nodes metastases were lower than those in CBM without metastases ( P < 0 . 05 ) , while no significance of nm23 - H2 mRNA expression levels was found between CBM with and CBM without metastasis ( P > 0 . 05 ) .", "entity": [{"entity": "CBM", "entity_type": "Anatomy", "pos": [40, 43]}, {"entity": "lymph nodes metastases", "entity_type": "Anatomy", "pos": [49, 71]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [97, 100]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [109, 119]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [213, 216]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [226, 229]}], "task": "NER"}
+{"text": "The results were comparative to those of Northern blotting of the same cases .", "entity": [], "task": "NER"}
+{"text": "The authors concluded that , as also in the study of Northern blotting , the expression of nm23 - H1 mRNA significantly correlated inversely with lymph node metastasis in CBM , while the expression of nm23 - H2 mRNA not .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [146, 156]}, {"entity": "CBM", "entity_type": "Anatomy", "pos": [171, 174]}], "task": "NER"}
+{"text": "Q - RT - PCR was a useful method to detect the mRNA levels of nm23 gene in buccal carcinoma .", "entity": [{"entity": "buccal carcinoma", "entity_type": "Anatomy", "pos": [75, 91]}], "task": "NER"}
+{"text": "Neoplastic transformation and tumorigenesis associated with overexpression of phospholipase D isozymes in cultured murine fibroblasts .", "entity": [{"entity": "Neoplastic", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [122, 133]}], "task": "NER"}
+{"text": "Phospholipase D ( PLD ) has been suggested to play an important role in a variety of cellular functions .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [85, 93]}], "task": "NER"}
+{"text": "PLD activity has been shown to be significantly elevated in many tumours and transformed cells , suggesting the possibility that PLD might be involved in tumorigenesis .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [65, 72]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [89, 94]}], "task": "NER"}
+{"text": "In this study , we have established stable cell lines overexpressing PLD1 and PLD2 from fibroblast cells .", "entity": [{"entity": "cell lines", "entity_type": "Anatomy", "pos": [43, 53]}, {"entity": "fibroblast cells", "entity_type": "Anatomy", "pos": [88, 104]}], "task": "NER"}
+{"text": "These cells , but not control cells , showed altered growth properties and anchorage - independent growth in soft agar .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [6, 11]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [30, 35]}], "task": "NER"}
+{"text": "Both PLD1 and PLD2 also induced an up - regulation of the activity of matrix metalloprotease - 9 as detected by zymograms .", "entity": [], "task": "NER"}
+{"text": "Furthermore , both PLD1 and PLD2 transformants , but not vector - transfectants , induced undifferentiated sarcoma when transplanted into nude mice .", "entity": [{"entity": "PLD1", "entity_type": "Anatomy", "pos": [19, 23]}, {"entity": "PLD2 transformants", "entity_type": "Anatomy", "pos": [28, 46]}, {"entity": "vector - transfectants", "entity_type": "Anatomy", "pos": [57, 79]}, {"entity": "sarcoma", "entity_type": "Anatomy", "pos": [107, 114]}], "task": "NER"}
+{"text": "Both PLD1 - and PLD2 - mediated cell cycle distributions in stable cell lines revealed an increased fraction of cells in the S phase compared with control cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [32, 36]}, {"entity": "cell lines", "entity_type": "Anatomy", "pos": [67, 77]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [112, 117]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [155, 160]}], "task": "NER"}
+{"text": "Interestingly , the level of cyclin D3 protein , known as an activator of G ( 1 ) to S phase transition in the cell cycle , was aberrantly high in cells overexpressing PLD1 and PLD2 compared with control cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [111, 115]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [147, 152]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [204, 209]}], "task": "NER"}
+{"text": "These results suggest that overexpression of PLD isozymes may play an important role in neoplastic transformation .", "entity": [{"entity": "neoplastic", "entity_type": "Anatomy", "pos": [88, 98]}], "task": "NER"}
+{"text": "Renormalization group analysis of autoregressive processes and fractional noise .", "entity": [], "task": "NER"}
+{"text": "A renormalization group analysis is applied to autoregressive processes with an infinite series of coefficients .", "entity": [], "task": "NER"}
+{"text": "A simple fixed point is given by a random walk , and a second class is found that is proportional to the high order coefficients of fractional autoregressive integrated moving average ( ARIMA ) processes .", "entity": [], "task": "NER"}
+{"text": "The approach might be useful to detect nonstationarity in autoregressive processes .", "entity": [], "task": "NER"}
+{"text": "Troponin I inhibits capillary endothelial cell proliferation by interaction with the cell ' s bFGF receptor .", "entity": [{"entity": "capillary endothelial cell", "entity_type": "Anatomy", "pos": [20, 46]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [85, 89]}], "task": "NER"}
+{"text": "Troponin I ( TnI ) is a novel cartilage - derived angiogenesis inhibitor , first demonstrated by Moses et al .", "entity": [], "task": "NER"}
+{"text": "( 1999 , Proc . Natl . Acad . Sci . USA 2645 - 2650 ) to inhibit endothelial cell proliferation and angiogenesis , both in vivo and in vitro , and to inhibit metastasis of a wide variety of tumors in vivo .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [65, 81]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [190, 196]}], "task": "NER"}
+{"text": "Despite convincing evidence of its efficacy , little is known about the mechanism of action of TnI as an anti - proliferative and anti - angiogenic agent .", "entity": [], "task": "NER"}
+{"text": "In the current article we demonstrate that TnI inhibits both bFGF - stimulated and basal levels of endothelial cell proliferation , and we hypothesize that this inhibition is occurring , at least in part , via an interaction of TnI with the cell - surface bFGF receptor on capillary endothelial cells .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [99, 115]}, {"entity": "cell - surface", "entity_type": "Anatomy", "pos": [241, 255]}, {"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [273, 300]}], "task": "NER"}
+{"text": "We further support this hypothesis by providing the first evidence that TnI can act on nonendothelial as well as endothelial cells and by demonstrating that this inhibitory action is specific for the bFGF receptor on the target cells .", "entity": [{"entity": "nonendothelial", "entity_type": "Anatomy", "pos": [87, 101]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [113, 130]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [228, 233]}], "task": "NER"}
+{"text": "Preliminary data suggest that TnI may be competing with bFGF for interaction with the bFGF receptor on responsive cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [114, 119]}], "task": "NER"}
+{"text": "RhoA activation promotes transformation and loss of thyroid cell differentiation interfering with thyroid transcription factor - 1 activity .", "entity": [{"entity": "thyroid cell", "entity_type": "Anatomy", "pos": [52, 64]}], "task": "NER"}
+{"text": "Highly specialized cells , the thyrocytes , express a thyroid - specific set of genes for thyroglobulin ( Tg ) , thyroperoxidase , and the transcription factors TTF - 1 , TTF - 2 , and Pax - 8 .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [19, 24]}, {"entity": "thyrocytes", "entity_type": "Anatomy", "pos": [31, 41]}, {"entity": "thyroid", "entity_type": "Anatomy", "pos": [54, 61]}], "task": "NER"}
+{"text": "The implication of the small GTPase RhoA in TSH - mediated proliferation of FRTL - 5 rat thyroid cells has been previously demonstrated .", "entity": [{"entity": "FRTL - 5 rat thyroid cells", "entity_type": "Anatomy", "pos": [76, 102]}], "task": "NER"}
+{"text": "To further analyze RhoA function in thyroid cell proliferation and differentiation patterns , we combined transient and stable transfection assays to express different mutant RhoA forms in FRTL - 5 cells .", "entity": [{"entity": "thyroid cell", "entity_type": "Anatomy", "pos": [36, 48]}, {"entity": "FRTL - 5 cells", "entity_type": "Anatomy", "pos": [189, 203]}], "task": "NER"}
+{"text": "Constitutively active RhoA ( FRTL - 5 - RhoA QL cells ) exhibited a fibroblast - like phenotype with organized actin fibers , whereas cells expressing the RhoA negative dominant phenotype ( FRTL - 5 - RhoA N19 cells ) present a rounded morphology and lose normal cytoskeletal architecture .", "entity": [{"entity": "FRTL - 5 - RhoA QL cells", "entity_type": "Anatomy", "pos": [29, 53]}, {"entity": "fibroblast", "entity_type": "Anatomy", "pos": [68, 78]}, {"entity": "actin fibers", "entity_type": "Anatomy", "pos": [111, 123]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [134, 139]}, {"entity": "FRTL - 5 - RhoA N19 cells", "entity_type": "Anatomy", "pos": [190, 215]}, {"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [263, 275]}], "task": "NER"}
+{"text": "In addition , expression of the constitutively active form of RhoA results in TSH - independent proliferation and anchorage - independent growth and induces tumors when inoculated in nude mice .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [157, 163]}], "task": "NER"}
+{"text": "Interestingly , FRTL - 5 - RhoA QL cells express less Tg and TTF - 1 than wild - type FRTL - 5 ( FRTL - 5 - vector ) or FRTL - 5 - RhoA N19 , suggesting a loss at the differentiation stage .", "entity": [{"entity": "FRTL - 5 - RhoA QL cells", "entity_type": "Anatomy", "pos": [16, 40]}, {"entity": "FRTL - 5", "entity_type": "Anatomy", "pos": [86, 94]}, {"entity": "FRTL - 5", "entity_type": "Anatomy", "pos": [97, 105]}, {"entity": "FRTL - 5 - RhoA N19", "entity_type": "Anatomy", "pos": [120, 139]}], "task": "NER"}
+{"text": "This effect is mediated , at least in part , by a decrease in TTF - 1 activity , since transient or stable expression of RhoA QL results in a reduction in the activity of the wild - type Tg promoter as well as an artificial promoter the activation of which depends exclusively on TTF - 1 .", "entity": [{"entity": "RhoA QL", "entity_type": "Anatomy", "pos": [121, 128]}], "task": "NER"}
+{"text": "The similarity between RhoA effects and thyroid transformation by Ras suggests that RhoA may act as a downstream effector of Ras ; in fact , the dominant negative RhoA N19 abolished the down - regulatory effect of Ras V12 over the Tg promoter .", "entity": [{"entity": "thyroid", "entity_type": "Anatomy", "pos": [40, 47]}], "task": "NER"}
+{"text": "Taken together , these results show for the first time that active RhoA is able to transform FRTL - 5 cells and that this effect is coupled to a loss of thyroid differentiation due to impaired TTF - 1 activity .", "entity": [{"entity": "FRTL - 5 cells", "entity_type": "Anatomy", "pos": [93, 107]}, {"entity": "thyroid", "entity_type": "Anatomy", "pos": [153, 160]}], "task": "NER"}
+{"text": "Clinical significance of plasma endostatin in acute myeloid leukemia / myelodysplastic syndrome .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [25, 31]}, {"entity": "acute myeloid leukemia", "entity_type": "Anatomy", "pos": [46, 68]}], "task": "NER"}
+{"text": "BACKGROUND : Endostatin , a C - terminal fragment of collagen XVIII , is an endogenous angiogenesis inhibitor .", "entity": [], "task": "NER"}
+{"text": "While endostatin is being investigated for its usefulness in treating solid tumors , its significance in hematologic malignancies is unknown .", "entity": [{"entity": "solid tumors", "entity_type": "Anatomy", "pos": [70, 82]}, {"entity": "hematologic malignancies", "entity_type": "Anatomy", "pos": [105, 129]}], "task": "NER"}
+{"text": "METHODS : The authors evaluated plasma endostatin ( PE ) levels using an enzyme linked immunoassay in 71 patients with acute myeloid leukemia ( AML ) and 43 patients with myelodysplastic syndrome ( MDS ) , and correlated PE with various clinical parameters .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [32, 38]}, {"entity": "acute myeloid leukemia", "entity_type": "Anatomy", "pos": [119, 141]}, {"entity": "AML", "entity_type": "Anatomy", "pos": [144, 147]}], "task": "NER"}
+{"text": "RESULTS : There was no significant difference in the median PE level between AML / MDS patients and the normal controls .", "entity": [{"entity": "AML", "entity_type": "Anatomy", "pos": [77, 80]}], "task": "NER"}
+{"text": "Nevertheless , patients who achieved complete remission ( CR ) had a significantly lower median PE level compared to those who did not .", "entity": [], "task": "NER"}
+{"text": "In multivariate analysis , PE was found to be a significant ( P = 0 . 03 ) predictor of overall survival ( OS ) with adjustment of the other baseline covariates , including patient age , history of antecedent hematologic disorders , and the use of protective environments .", "entity": [{"entity": "hematologic", "entity_type": "Anatomy", "pos": [209, 220]}], "task": "NER"}
+{"text": "The prognostic value of PE was also evaluated by dividing MDS / AML patients into high and low PE groups using the median PE level of normal controls as the cut - off .", "entity": [{"entity": "AML", "entity_type": "Anatomy", "pos": [64, 67]}], "task": "NER"}
+{"text": "The authors found that patients in the high PE group survived for a significantly shorter time than those patients in the low PE group .", "entity": [], "task": "NER"}
+{"text": "CONCLUSIONS : PE is a useful prognostic predictor of CR and OS for AML / MDS patients .", "entity": [{"entity": "AML", "entity_type": "Anatomy", "pos": [67, 70]}], "task": "NER"}
+{"text": "The mechanism underlying the association between high PE and poor clinical outcome is unclear , although it may be related to the possible PE reflection of tumor burden .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [156, 161]}], "task": "NER"}
+{"text": "Modulation of angiogenesis and progelatinase a by thrombin receptor mimetics and antagonists .", "entity": [], "task": "NER"}
+{"text": "The angiogenic action of thrombin has been shown to be mediated by activation of the thrombin receptor .", "entity": [], "task": "NER"}
+{"text": "In this report we studied the effects of SFLLR , an agonist of the activated thrombin receptor and thrombin receptor peptide and non peptide antagonists on angiogenesis in the chick chorioallantoic membrane ( CAM ) system .", "entity": [{"entity": "chorioallantoic membrane", "entity_type": "Anatomy", "pos": [182, 206]}, {"entity": "CAM", "entity_type": "Anatomy", "pos": [209, 212]}], "task": "NER"}
+{"text": "As antagonists were used the tripeptide FPR and non - peptide 1 , 4 - disubstituted piperazine derivatives .", "entity": [], "task": "NER"}
+{"text": "The pentapeptide SFLLR , like thrombin , caused a marked stimulation of angiogenesis in the CAM .", "entity": [{"entity": "CAM", "entity_type": "Anatomy", "pos": [92, 95]}], "task": "NER"}
+{"text": "FPR and the piperazine derivatives caused suppression of angiogenesis and in combination with thrombin antagonized its angiogenic effect .", "entity": [], "task": "NER"}
+{"text": "Thrombin and SFLLR activated progelatinase A ( MMP - 2 ) in the culture medium of human umbilical cord endothelial cells ( HUVECs ) .", "entity": [{"entity": "human umbilical cord endothelial cells", "entity_type": "Anatomy", "pos": [82, 120]}, {"entity": "HUVECs", "entity_type": "Anatomy", "pos": [123, 129]}], "task": "NER"}
+{"text": "MMP - 2 is involved in the early steps of angiogenesis leading to local dissolution of basement membrane collagen and migration of the activated endothelial cells .", "entity": [{"entity": "basement membrane", "entity_type": "Anatomy", "pos": [87, 104]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [145, 162]}], "task": "NER"}
+{"text": "FPR and the piperazine derivatives inhibited the activation of this enzyme .", "entity": [], "task": "NER"}
+{"text": "They also antagonised the effects of both thrombin and SFLLR on MMP - 2 activation .", "entity": [], "task": "NER"}
+{"text": "These results suggest that non - thrombogenic agonists or antagonists of the activated thrombin receptor can be used as modulators of angiogenesis .", "entity": [], "task": "NER"}
+{"text": "Abnormal expression of E - cadherin and beta - catenin may be a molecular marker of submucosal invasion and lymph node metastasis in early gastric cancer .", "entity": [{"entity": "submucosal", "entity_type": "Anatomy", "pos": [84, 94]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [108, 118]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [139, 153]}], "task": "NER"}
+{"text": "BACKGROUND : Impaired expression of E - cadherin and alpha - and beta - catenin is frequently observed in several human cancers .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [120, 127]}], "task": "NER"}
+{"text": "The aim of this study was to examine immunohistochemical expression of these adhesion molecules , focusing on early gastric carcinomas , and to investigate differences between differentiated and undifferentiated gastric cancer at the early phase of carcinogenesis .", "entity": [{"entity": "gastric carcinomas", "entity_type": "Anatomy", "pos": [116, 134]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [212, 226]}], "task": "NER"}
+{"text": "METHODS : Immunohistochemical staining of E - cadherin and alpha - and beta - catenin was performed using specimens from 143 patients with early gastric cancer .", "entity": [{"entity": "specimens", "entity_type": "Anatomy", "pos": [106, 115]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [145, 159]}], "task": "NER"}
+{"text": "RESULTS : Abnormal E - cadherin and beta - catenin staining correlated with depth of tumour invasion in differentiated - type tumours .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [85, 91]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [126, 133]}], "task": "NER"}
+{"text": "In contrast , abnormal staining was frequently found even in intramucosal carcinoma of undifferentiated - type tumours , suggesting an apparent difference in the onset of E - cadherin - catenin complex abnormality between the two cancer types .", "entity": [{"entity": "intramucosal carcinoma", "entity_type": "Anatomy", "pos": [61, 83]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [111, 118]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [230, 236]}], "task": "NER"}
+{"text": "Absent staining of beta - catenin was associated with lymph node metastasis .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [54, 64]}], "task": "NER"}
+{"text": "Multivariate analysis revealed abnormal E - cadherin expression as an independent factor that correlated with submucosal invasion in early gastric cancer .", "entity": [{"entity": "submucosal", "entity_type": "Anatomy", "pos": [110, 120]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [139, 153]}], "task": "NER"}
+{"text": "CONCLUSION : Abnormal E - cadherin expression is a possible marker of submucosal invasion in differentiated - type early gastric cancer and absent beta - catenin staining could be used as a predictor of lymph node metastasis in both types .", "entity": [{"entity": "submucosal", "entity_type": "Anatomy", "pos": [70, 80]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [121, 135]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [203, 213]}], "task": "NER"}
+{"text": "Dominant negative interference of transcription factor AP - 2 causes inhibition of ErbB - 3 expression and suppresses malignant cell growth .", "entity": [{"entity": "malignant cell", "entity_type": "Anatomy", "pos": [118, 132]}], "task": "NER"}
+{"text": "ErbB - 3 ( HER3 ) is a member of the epidermal growth factor receptor family .", "entity": [], "task": "NER"}
+{"text": "Increasing evidence suggests that elevated expression of ErbB - 3 is important for malignancy .", "entity": [], "task": "NER"}
+{"text": "In this study , we found that elevated levels of ErbB - 3 expression did not occur in the absence of AP - 2gamma in a panel of human mammary epithelial and fibroblasts cell lines .", "entity": [{"entity": "mammary epithelial", "entity_type": "Anatomy", "pos": [133, 151]}, {"entity": "fibroblasts cell lines", "entity_type": "Anatomy", "pos": [156, 178]}], "task": "NER"}
+{"text": "In contrast , there was no association between the expression of AP - 2alpha or AP - 2beta and the level of ErbB - 3 , or between AP - 2alpha and AP - 2gamma double positivity and ErbB - 3 expression .", "entity": [], "task": "NER"}
+{"text": "In co - transfection experiments , exogenous expression of AP - 2gamma robustly activated ErbB - 3 promoter activity .", "entity": [], "task": "NER"}
+{"text": "Moreover , expression of a dominant negative AP - 2 protein , AP - 2delta ( deleted residues 31 - 117 ) , not only repressed the ErbB - 3 promoter activity but also suppressed endogenous ErbB - 3 transcription in the ErbB - 3 overexpressing cell line MRC - 5VA .", "entity": [{"entity": "cell line MRC - 5VA", "entity_type": "Anatomy", "pos": [241, 260]}], "task": "NER"}
+{"text": "Overexpression of AP - 2A resulted in a decreased proliferation rate and inhibitin of colony formation .", "entity": [{"entity": "colony", "entity_type": "Anatomy", "pos": [86, 92]}], "task": "NER"}
+{"text": "Taken together , these data strongly support a role for the AP - 2 gene family , in particular , AP - 2gamma , in the control of ErbB - 3 expression .", "entity": [], "task": "NER"}
+{"text": "Interference with the function of transcription factor AP - 2 might provide a potential strategy for modulation of the malignant phenotype .", "entity": [], "task": "NER"}
+{"text": "VEGF165 mediates formation of complexes containing VEGFR - 2 and neuropilin - 1 that enhance VEGF165 - receptor binding .", "entity": [], "task": "NER"}
+{"text": "Co - expression of NRP1 and ( VEGFR - 2 ) KDR on the surface of endothelial cells ( EC ) enhances VEGF165 binding to KDR and EC chemotaxis in response to VEGF165 .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [53, 60]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [64, 81]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [84, 86]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [125, 127]}], "task": "NER"}
+{"text": "Overexpression of NRP1 by prostate tumor cells in vivo results in increased tumor angiogenesis and growth .", "entity": [{"entity": "prostate tumor cells", "entity_type": "Anatomy", "pos": [26, 46]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [76, 81]}], "task": "NER"}
+{"text": "We investigated the molecular mechanisms underlying NRP1 - mediated angiogenesis by analyzing the association of NRP1 and KDR .", "entity": [], "task": "NER"}
+{"text": "An intracellular complex containing NRP1 and KDR was immunoprecipitated from EC by anti - NRP1 antibodies only in the presence of VEGF165 .", "entity": [{"entity": "intracellular", "entity_type": "Anatomy", "pos": [3, 16]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [77, 79]}], "task": "NER"}
+{"text": "In contrast , VEGF121 , which does not bind to NRP1 , did not support complex formation .", "entity": [], "task": "NER"}
+{"text": "Complexes containing VEGF165 , NRP1 , and KDR were also formed in an intercellular fashion by co - culture of EC expressing KDR only , with cells expressing NRP1 only , for example , breast carcinoma cells .", "entity": [{"entity": "intercellular", "entity_type": "Anatomy", "pos": [69, 82]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [110, 112]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [140, 145]}, {"entity": "breast carcinoma cells", "entity_type": "Anatomy", "pos": [183, 205]}], "task": "NER"}
+{"text": "VEGF165 also mediated the binding of a soluble NRP1 dimer to cells expressing KDR only , confirming the formation of such complexes .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [61, 66]}], "task": "NER"}
+{"text": "Furthermore , the formation of complexes containing KDR and NRP1 markedly increased 125I - VEGF165 binding to KDR .", "entity": [], "task": "NER"}
+{"text": "Our results suggest that formation of a ternary complex of VEGF165 , KDR , and NRP1 potentiates VEGF165 binding to KDR .", "entity": [], "task": "NER"}
+{"text": "These complexes are formed on the surface of EC and in a juxtacrine manner via association of tumor cell NRP1 and EC KDR .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [34, 41]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [45, 47]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [94, 104]}, {"entity": "EC", "entity_type": "Anatomy", "pos": [114, 116]}], "task": "NER"}
+{"text": "Hypoxic induction of HIF - 1alpha and VEGF expression in head and neck squamous cell carcinoma lines is mediated by stress activated protein kinases .", "entity": [{"entity": "head and neck squamous cell carcinoma lines", "entity_type": "Anatomy", "pos": [57, 100]}], "task": "NER"}
+{"text": "Solid tumors must establish a blood supply in order to proliferate and grow .", "entity": [{"entity": "Solid tumors", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [30, 35]}], "task": "NER"}
+{"text": "Cancer cells secrete soluble factors which can induce proliferation and migration of capillary endothelial cells .", "entity": [{"entity": "Cancer cells", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [85, 112]}], "task": "NER"}
+{"text": "Among the most potent of the angiogenic factors is vascular endothelial growth factor ( VEGF ) .", "entity": [], "task": "NER"}
+{"text": "Increased VEGF expression by malignant tumors has been associated with high vascularity , increased cancer cell growth , and lymph node metastasis .", "entity": [{"entity": "malignant tumors", "entity_type": "Anatomy", "pos": [29, 45]}, {"entity": "cancer cell", "entity_type": "Anatomy", "pos": [100, 111]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [125, 135]}], "task": "NER"}
+{"text": "Reduced oxygen tension has been shown to increase VEGF production by induction of the transcription factor hypoxia inducible factor 1 alpha ( HIF - 1alpha ) .", "entity": [], "task": "NER"}
+{"text": "The mechanisms by which hypoxic tumor environments induce HIF - 1alpha and VEGF expression are largely unknown .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [32, 37]}], "task": "NER"}
+{"text": "Jun N terminal kinase ( JNK1 ) and p38 kinase are activated by a variety of stress stimuli .", "entity": [], "task": "NER"}
+{"text": "To determine if hypoxic activation of these stress activated protein kinases regulated HIF - 1alpha and VEGF expression , we assayed JNK1 and p38 activity in squamous cell carcinoma ( SCC ) lines grown under normoxic or hypoxic conditions .", "entity": [{"entity": "squamous cell carcinoma ( SCC ) lines", "entity_type": "Anatomy", "pos": [158, 195]}], "task": "NER"}
+{"text": "Hypoxia rapidly induced both JNK1 and p38 activity in these cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [60, 65]}], "task": "NER"}
+{"text": "This activation correlated with induction of HIF - 1alpha expression and DNA binding activity which was blocked by the p38 inhibitor SB203580 .", "entity": [], "task": "NER"}
+{"text": "Hypoxia also increased VEGF production by SCC lines , which was inhibited by treatment with SB203580 .", "entity": [{"entity": "SCC lines", "entity_type": "Anatomy", "pos": [42, 51]}], "task": "NER"}
+{"text": "Overexpression of JNK1 or p38 was sufficient to induce HIF - 1alpha and VEGF expression .", "entity": [], "task": "NER"}
+{"text": "These results indicate that induction of SAPKs by hypoxia regulates HIF - 1alpha and VEGF expression in head and neck carcinoma cell lines .", "entity": [{"entity": "head and neck carcinoma cell lines", "entity_type": "Anatomy", "pos": [104, 138]}], "task": "NER"}
+{"text": "In vitro cytotoxic potential and mechanism of action of selected coumarins , using human renal cell lines .", "entity": [{"entity": "renal cell lines", "entity_type": "Anatomy", "pos": [89, 105]}], "task": "NER"}
+{"text": "This study determined the selective cytotoxicity of eight coumarin compounds to human renal carcinoma cells , relative to non - carcinoma proximal tubular cells .", "entity": [{"entity": "renal carcinoma cells", "entity_type": "Anatomy", "pos": [86, 107]}, {"entity": "non - carcinoma proximal tubular cells", "entity_type": "Anatomy", "pos": [122, 160]}], "task": "NER"}
+{"text": "Selectivity cytotoxicity was observed following exposure to 6 - nitro - 7 - hydroxycoumarin ( 6 - NO ( 2 ) - 7 - OHC ) and 7 , 8 - dihydroxycoumarin ( 7 , 8 - OHC ) .", "entity": [], "task": "NER"}
+{"text": "6 - NO ( 2 ) - 7 - OHC induced cytotoxicity was irreversible in both cell lines , unlike 7 , 8 - OHC , which was reversible in the carcinoma cells only .", "entity": [{"entity": "cell lines", "entity_type": "Anatomy", "pos": [69, 79]}, {"entity": "carcinoma cells", "entity_type": "Anatomy", "pos": [131, 146]}], "task": "NER"}
+{"text": "Mobility shift and BrdU incorporation assays showed that both compounds did not intercalate DNA but had a concentration - dependent inhibitory effect on its synthesis .", "entity": [], "task": "NER"}
+{"text": "All coumarins studied were found to be non - mutagenic using the standard Ames test .", "entity": [], "task": "NER"}
+{"text": "These results would suggest that 6 - NO ( 2 ) - 7 - OHC and 7 , 8 - OHC might have a therapeutic role to play in the treatment of renal cell carcinoma .", "entity": [{"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [130, 150]}], "task": "NER"}
+{"text": "[ Radiologic - pathologic correlations in breast diseases ]", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [42, 48]}], "task": "NER"}
+{"text": "The objective of this article is to explain radiologic patterns of benign and malignant breast lesions ( masses , microcalcifications ) based on histological correlations .", "entity": [{"entity": "benign", "entity_type": "Anatomy", "pos": [67, 73]}, {"entity": "malignant breast lesions", "entity_type": "Anatomy", "pos": [78, 102]}, {"entity": "masses", "entity_type": "Anatomy", "pos": [105, 111]}, {"entity": "microcalcifications", "entity_type": "Anatomy", "pos": [114, 133]}], "task": "NER"}
+{"text": "The stromal fibrous reaction associated to infiltrating carcinomas is responsible of focal increased density , and architectural distorsion , ultrasound acoustic shadowing ; abnormal neoangiogenesis can be detected by Doppler , CT or MR imaging .", "entity": [{"entity": "stromal fibrous", "entity_type": "Anatomy", "pos": [4, 19]}, {"entity": "carcinomas", "entity_type": "Anatomy", "pos": [56, 66]}], "task": "NER"}
+{"text": "Invasive carcinomas without spiculated margins are poorly differentiated tumors .", "entity": [{"entity": "Invasive carcinomas", "entity_type": "Anatomy", "pos": [0, 19]}, {"entity": "spiculated margins", "entity_type": "Anatomy", "pos": [28, 46]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [73, 79]}], "task": "NER"}
+{"text": "Mammographic patterns of microcalcifications depend on their physiopathological process ( necrosis , secretion ) , and the shape of clusters ( round , triangular ) typifies their anatomical site of origin ( lobular , ductal ) .", "entity": [{"entity": "microcalcifications", "entity_type": "Anatomy", "pos": [25, 44]}, {"entity": "clusters", "entity_type": "Anatomy", "pos": [132, 140]}, {"entity": "anatomical site", "entity_type": "Anatomy", "pos": [179, 194]}, {"entity": "lobular", "entity_type": "Anatomy", "pos": [207, 214]}, {"entity": "ductal", "entity_type": "Anatomy", "pos": [217, 223]}], "task": "NER"}
+{"text": "Less frequent lesions ( invasive lobular , mucinous , and medullary carcinomas , radial scar ) will be also explained based on radiopathological correlations .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [14, 21]}, {"entity": "invasive lobular", "entity_type": "Anatomy", "pos": [24, 40]}, {"entity": "mucinous", "entity_type": "Anatomy", "pos": [43, 51]}, {"entity": "medullary carcinomas", "entity_type": "Anatomy", "pos": [58, 78]}, {"entity": "radial scar", "entity_type": "Anatomy", "pos": [81, 92]}], "task": "NER"}
+{"text": "Knowledge of radiopathological correlations in breast diseases helps the radiologists to analyze and characterize breast lesions .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [47, 53]}, {"entity": "breast lesions", "entity_type": "Anatomy", "pos": [114, 128]}], "task": "NER"}
+{"text": "Pten signaling in gliomas .", "entity": [{"entity": "gliomas", "entity_type": "Anatomy", "pos": [18, 25]}], "task": "NER"}
+{"text": "In 1997 , the PTEN gene ( phosphatase and tensin homolog deleted on chromosome 10 ) was identified as a tumor suppressor gene on the long arm of chromosome 10 .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [104, 109]}, {"entity": "chromosome 10", "entity_type": "Anatomy", "pos": [145, 158]}], "task": "NER"}
+{"text": "Since then , important progress has been made with respect to the understanding of the role of the Pten protein in the normal development of the brain as well as in the molecular pathogenesis of human gliomas .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [145, 150]}, {"entity": "gliomas", "entity_type": "Anatomy", "pos": [201, 208]}], "task": "NER"}
+{"text": "This review summarizes the current state of the art concerning the involvement of aberrant Pten function in the development of different biologic features of malignant gliomas , such as loss of cell - cycle control and uncontrolled cell proliferation , escape from apoptosis , brain invasion , and aberrant neoangiogenesis .", "entity": [{"entity": "malignant gliomas", "entity_type": "Anatomy", "pos": [158, 175]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [194, 198]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [232, 236]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [277, 282]}], "task": "NER"}
+{"text": "Most of the tumor - suppressive properties of Pten are dependent on its lipid phosphatase activity , which inhibits the phosphatidylinositol - 3 ' - kinase ( PI3K ) / Akt signaling pathway through dephosphorylation of phosphatidylinositol - ( 3 , 4 , 5 ) - triphosphate .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [12, 17]}], "task": "NER"}
+{"text": "The additional function of Pten as a dual - specificity protein phosphatase may also play a role in glioma pathogenesis .", "entity": [{"entity": "glioma", "entity_type": "Anatomy", "pos": [100, 106]}], "task": "NER"}
+{"text": "Besides the wealth of data elucidating the functional roles of Pten , recent studies suggest a diagnostic significance of PTEN gene alterations as a molecular marker for poor prognosis in anaplastic astrocytomas and anaplastic oligodendrogliomas .", "entity": [{"entity": "anaplastic astrocytomas", "entity_type": "Anatomy", "pos": [188, 211]}, {"entity": "anaplastic oligodendrogliomas", "entity_type": "Anatomy", "pos": [216, 245]}], "task": "NER"}
+{"text": "Furthermore , the possibility of selective targeting of PTEN mutant tumor cells by specific pharmacologic inhibitors of members of the Pten / PI3K / Akt pathway opens up new perspectives for a targeted molecular therapy of malignant gliomas .", "entity": [{"entity": "PTEN mutant tumor cells", "entity_type": "Anatomy", "pos": [56, 79]}, {"entity": "malignant gliomas", "entity_type": "Anatomy", "pos": [223, 240]}], "task": "NER"}
+{"text": "[ A case report of advanced gastric cancer responding to TS - 1 , a novel oral fluorouracil derivative ] .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [28, 42]}, {"entity": "oral", "entity_type": "Anatomy", "pos": [74, 78]}], "task": "NER"}
+{"text": "TS - 1 is a new , oral anticancer agent composed of two modulators , gimeracil ( CDHP ) and oteracil potassium ( Oxo ) are mixed with tegafur in a ratio of 1 : 0 . 4 : 1 .", "entity": [{"entity": "oral", "entity_type": "Anatomy", "pos": [18, 22]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [23, 33]}], "task": "NER"}
+{"text": "We report one case of advanced gastric cancer with lung and lymph node metastases that completely responded to TS - 1 .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [31, 45]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [51, 55]}, {"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [60, 81]}], "task": "NER"}
+{"text": "A 71 - year - old woman was admitted to our hospital because of breathlessness .", "entity": [], "task": "NER"}
+{"text": "A diagnosis of advanced gastric cancer with extensive lymph node metastases and multiple pulmonary metastases was made .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [24, 38]}, {"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [54, 75]}, {"entity": "pulmonary metastases", "entity_type": "Anatomy", "pos": [89, 109]}], "task": "NER"}
+{"text": "One hundred mg / body / day of TS - 1 was orally administrated for 4 weeks .", "entity": [{"entity": "orally", "entity_type": "Anatomy", "pos": [42, 48]}], "task": "NER"}
+{"text": "A partial response ( PR ) was obtained after the first course with regression of multiple pulmonary metastases .", "entity": [{"entity": "pulmonary metastases", "entity_type": "Anatomy", "pos": [90, 110]}], "task": "NER"}
+{"text": "After 1 drug - free week , the second course was administered with 120 mg / body / day of TS - 1 for 4 weeks .", "entity": [], "task": "NER"}
+{"text": "After two courses , the primary tumor was reduced to an ulcer scar with pathological confirmation of a complete disappearance of the cancer tissue .", "entity": [{"entity": "primary tumor", "entity_type": "Anatomy", "pos": [24, 37]}, {"entity": "ulcer scar", "entity_type": "Anatomy", "pos": [56, 66]}, {"entity": "cancer tissue", "entity_type": "Anatomy", "pos": [133, 146]}], "task": "NER"}
+{"text": "Moreover , computed tomography ( CT ) showed a complete regression of the extensive lymph node and diffuse lung metastases , for a complete response ( CR ) .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [84, 94]}, {"entity": "lung metastases", "entity_type": "Anatomy", "pos": [107, 122]}], "task": "NER"}
+{"text": "The serum level of CEA was reduced from 172 . 7 ng / ml to 8 . 1 ng / ml after TS - 1 treatment .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [4, 9]}], "task": "NER"}
+{"text": "As for adverse events , only pigmentation of the skin and Grade 2 oral aphta were observed .", "entity": [{"entity": "skin", "entity_type": "Anatomy", "pos": [49, 53]}, {"entity": "oral aphta", "entity_type": "Anatomy", "pos": [66, 76]}], "task": "NER"}
+{"text": "Systemic regulation of distraction osteogenesis : a cascade of biochemical factors .", "entity": [], "task": "NER"}
+{"text": "This study investigates the systemic biochemical regulation of fracture healing in distraction osteogenesis compared with rigid osteotomy in a prospective in vivo study in humans .", "entity": [], "task": "NER"}
+{"text": "To further clarify the influence of mechanical strain on the regulation of bone formation , bone growth factors ( insulin - like growth factor [ IGF ] I , IGF binding protein [ IGFBP ] 3 , transforming growth factor [ TGF ] beta1 , and basic FGF [ bFGF ] ) , bone matrix degrading enzymes ( matrix - metalloproteinases [ MMPs ] 1 , 2 , and 3 ) , human growth hormone ( hGH ) , and bone formation markers ( ALP , bone - specific ALP [ BAP ] , and osteocalcin [ OC ] ) have been analyzed in serum samples from 10 patients in each group pre - and postoperatively .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [75, 79]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [92, 96]}, {"entity": "bone matrix", "entity_type": "Anatomy", "pos": [259, 270]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [381, 385]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [412, 416]}, {"entity": "serum samples", "entity_type": "Anatomy", "pos": [489, 502]}], "task": "NER"}
+{"text": "In the distraction group , a significant postoperative increase in MMP - 1 , bFGF , ALP , and BAP could be observed during the lengthening and the consolidation period when compared with the baseline levels .", "entity": [], "task": "NER"}
+{"text": "Osteotomy fracture healing without the traction stimulus failed to induce a corresponding increase in these factors .", "entity": [], "task": "NER"}
+{"text": "In addition , comparison of both groups revealed a significantly higher increase in TGF - beta1 , IGF - I , IGFBP - 3 , and hGH in the lengthening group during the distraction period , indicating key regulatory functions in mechanotransduction .", "entity": [], "task": "NER"}
+{"text": "The time courses of changes in MMP - 1 , bone growth factors ( TGF - beta1 and bFGF ) , and hGH , respectively , correlated significantly during the lengthening phase , indicating common regulatory pathways for these factors in distraction osteogenesis .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [41, 45]}], "task": "NER"}
+{"text": "Significant correlation between the osteoblastic marker BAP , TGF - beta1 , and bFGF suggests strain - activated osteoblastic cells as a major source of systemically increased bone growth factors during callus distraction .", "entity": [{"entity": "osteoblastic cells", "entity_type": "Anatomy", "pos": [113, 131]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [176, 180]}], "task": "NER"}
+{"text": "The systemic increase in bFGF and MMP - 1 might reflect an increased local stimulation of angiogenesis during distraction osteogenesis .", "entity": [], "task": "NER"}
+{"text": "Human papillomavirus oncoprotein E6 inactivates the transcriptional coactivator human ADA3 .", "entity": [], "task": "NER"}
+{"text": "High - risk human papillomaviruses ( HPVs ) are associated with carcinomas of the cervix and other genital tumors .", "entity": [{"entity": "carcinomas", "entity_type": "Anatomy", "pos": [64, 74]}, {"entity": "cervix", "entity_type": "Anatomy", "pos": [82, 88]}, {"entity": "genital tumors", "entity_type": "Anatomy", "pos": [99, 113]}], "task": "NER"}
+{"text": "The HPV oncoprotein E6 is essential for oncogenic transformation .", "entity": [], "task": "NER"}
+{"text": "We identify here hADA3 , human homologue of the yeast transcriptional coactivator yADA3 , as a novel E6 - interacting protein and a target of E6 - induced degradation .", "entity": [], "task": "NER"}
+{"text": "hADA3 binds selectively to the high - risk HPV E6 proteins and only to immortalization - competent E6 mutants .", "entity": [], "task": "NER"}
+{"text": "hADA3 functions as a coactivator for p53 - mediated transactivation by stabilizing p53 protein .", "entity": [], "task": "NER"}
+{"text": "Notably , three immortalizing E6 mutants that do not induce direct p53 degradation but do interact with hADA3 induced the abrogation of p53 - mediated transactivation and G ( 1 ) cell cycle arrest after DNA damage , comparable to wild - type E6 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [179, 183]}], "task": "NER"}
+{"text": "These findings reveal a novel strategy of HPV E6 - induced loss of p53 function that is independent of direct p53 degradation .", "entity": [], "task": "NER"}
+{"text": "Given the likely role of the evolutionarily conserved hADA3 in multiple coactivator complexes , inactivation of its function may allow E6 to perturb numerous cellular pathways during HPV oncogenesis .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [158, 166]}], "task": "NER"}
+{"text": "Immunohistochemical staining for thyroid transcription factor - 1 : a helpful aid in discerning primary site of tumor origin in patients with brain metastases .", "entity": [{"entity": "site", "entity_type": "Anatomy", "pos": [104, 108]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [112, 117]}, {"entity": "brain metastases", "entity_type": "Anatomy", "pos": [142, 158]}], "task": "NER"}
+{"text": "Metastatic carcinoma of unknown primary origin is a perplexing but common problem , accounting for up to 10 % to 15 % of all solid tumors at presentation .", "entity": [{"entity": "Metastatic carcinoma", "entity_type": "Anatomy", "pos": [0, 20]}, {"entity": "origin", "entity_type": "Anatomy", "pos": [40, 46]}, {"entity": "solid tumors", "entity_type": "Anatomy", "pos": [125, 137]}], "task": "NER"}
+{"text": "Many of these metastases presumably arise from primary lung carcinomas , but the morphologic features and immunohistochemical profile of lung cancer is often too nonspecific to permit unequivocal confirmation .", "entity": [{"entity": "metastases", "entity_type": "Anatomy", "pos": [14, 24]}, {"entity": "primary lung carcinomas", "entity_type": "Anatomy", "pos": [47, 70]}, {"entity": "lung cancer", "entity_type": "Anatomy", "pos": [137, 148]}], "task": "NER"}
+{"text": "Thyroid transcription factor - 1 ( TTF - 1 ) is expressed in lung adenocarcinomas and thyroid carcinomas but not in adenocarcinomas arising from other sites .", "entity": [{"entity": "lung adenocarcinomas", "entity_type": "Anatomy", "pos": [61, 81]}, {"entity": "thyroid carcinomas", "entity_type": "Anatomy", "pos": [86, 104]}, {"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [116, 131]}, {"entity": "sites", "entity_type": "Anatomy", "pos": [151, 156]}], "task": "NER"}
+{"text": "For patients with adenocarcinomas in the lung , TTF - 1 staining is now routinely used to distinguish a primary lung cancer from a lung metastasis .", "entity": [{"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [18, 33]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [41, 45]}, {"entity": "primary lung cancer", "entity_type": "Anatomy", "pos": [104, 123]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [131, 135]}], "task": "NER"}
+{"text": "Along these same lines , TTF - 1 staining might prove useful in localizing the tumor origin of adenocarcinomas encountered outside of the lung .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [79, 84]}, {"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [95, 110]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [138, 142]}], "task": "NER"}
+{"text": "The archival surgical pathology files of The Johns Hopkins Hospital were searched for cases of brain metastases biopsied between 1990 and 2000 .", "entity": [{"entity": "brain metastases", "entity_type": "Anatomy", "pos": [95, 111]}], "task": "NER"}
+{"text": "Tissue blocks were obtained and immunoperoxidase staining was performed using the TTF - 1 antibody .", "entity": [{"entity": "Tissue blocks", "entity_type": "Anatomy", "pos": [0, 13]}], "task": "NER"}
+{"text": "The medical records were reviewed independent of the staining results to determine site of tumor origin .", "entity": [{"entity": "site", "entity_type": "Anatomy", "pos": [83, 87]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [91, 96]}], "task": "NER"}
+{"text": "Seventy - five patients underwent biopsies of carcinomas metastatic to the brain .", "entity": [{"entity": "carcinomas", "entity_type": "Anatomy", "pos": [46, 56]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [75, 80]}], "task": "NER"}
+{"text": "At the time of brain biopsy , the primary site of tumor origin was known in 45 cases and unknown in 30 cases .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [15, 20]}, {"entity": "site", "entity_type": "Anatomy", "pos": [42, 46]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [50, 55]}], "task": "NER"}
+{"text": "Ultimately , the primary site was established on clinical and radiographic grounds in 71 cases ( 95 % ) .", "entity": [{"entity": "site", "entity_type": "Anatomy", "pos": [25, 29]}], "task": "NER"}
+{"text": "These included 40 ( 56 % ) metastases from a primary lung carcinoma and 31 ( 44 % ) metastases from some nonpulmonary carcinoma .", "entity": [{"entity": "metastases", "entity_type": "Anatomy", "pos": [27, 37]}, {"entity": "primary lung carcinoma", "entity_type": "Anatomy", "pos": [45, 67]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [84, 94]}, {"entity": "nonpulmonary carcinoma", "entity_type": "Anatomy", "pos": [105, 127]}], "task": "NER"}
+{"text": "TTF - 1 staining was present in 31 of the 40 ( 78 % ) metastatic lung carcinomas , but in only 1 of the 31 ( 3 % ) metastatic nonpulmonary carcinomas ( a small - cell carcinoma of the sinonasal tract ) .", "entity": [{"entity": "metastatic lung carcinomas", "entity_type": "Anatomy", "pos": [54, 80]}, {"entity": "metastatic nonpulmonary carcinomas", "entity_type": "Anatomy", "pos": [115, 149]}, {"entity": "small - cell carcinoma", "entity_type": "Anatomy", "pos": [154, 176]}, {"entity": "sinonasal tract", "entity_type": "Anatomy", "pos": [184, 199]}], "task": "NER"}
+{"text": "When the metastatic lung carcinomas were subtyped , TTF - 1 staining was noted in 11 of 11 ( 100 % ) adenocarcinomas , in 6 of 7 ( 86 % ) small - cell carcinomas , in 15 of 19 ( 79 % ) large - cell carcinomas , and in none of 3 ( 0 % ) squamous cell carcinomas .", "entity": [{"entity": "metastatic lung carcinomas", "entity_type": "Anatomy", "pos": [9, 35]}, {"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [101, 116]}, {"entity": "small - cell carcinomas", "entity_type": "Anatomy", "pos": [138, 161]}, {"entity": "large - cell carcinomas", "entity_type": "Anatomy", "pos": [185, 208]}, {"entity": "squamous cell carcinomas", "entity_type": "Anatomy", "pos": [236, 260]}], "task": "NER"}
+{"text": "TTF - 1 staining is very reliable in discerning whether a brain metastasis has arisen from a pulmonary or nonpulmonary site , particularly when dealing with adenocarcinomas and large - cell carcinomas .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [58, 63]}, {"entity": "pulmonary", "entity_type": "Anatomy", "pos": [93, 102]}, {"entity": "nonpulmonary site", "entity_type": "Anatomy", "pos": [106, 123]}, {"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [157, 172]}, {"entity": "large - cell carcinomas", "entity_type": "Anatomy", "pos": [177, 200]}], "task": "NER"}
+{"text": "TTF - 1 immunohistochemistry could focus the search for the primary tumor for patients presenting with brain metastasis as the initial manifestation .", "entity": [{"entity": "primary tumor", "entity_type": "Anatomy", "pos": [60, 73]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [103, 108]}], "task": "NER"}
+{"text": "Protein expression profile of primary human squamous cell lung carcinomas indicative of the incidence of metastases .", "entity": [{"entity": "primary human squamous cell lung carcinomas", "entity_type": "Anatomy", "pos": [30, 73]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [105, 115]}], "task": "NER"}
+{"text": "The purpose of this investigation was to evaluate firstly whether different protein expression patterns exist in primary squamous cell lung carcinomas of patients with and without lymph node involvement and secondly , whether or not different patterns exist in tumours with positive lymph nodes .", "entity": [{"entity": "primary squamous cell lung carcinomas", "entity_type": "Anatomy", "pos": [113, 150]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [180, 190]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [261, 268]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [283, 294]}], "task": "NER"}
+{"text": "For this reason , formalin - fixed , paraffin - embedded specimens from 130 patients with squamous cell lung carcinomas were analyzed by immunohistochemistry .", "entity": [{"entity": "specimens", "entity_type": "Anatomy", "pos": [57, 66]}, {"entity": "squamous cell lung carcinomas", "entity_type": "Anatomy", "pos": [90, 119]}], "task": "NER"}
+{"text": "In a first step , proteins were selected which showed a relationship to lymph node involvement .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [72, 82]}], "task": "NER"}
+{"text": "The expression of JUN , ERBB2 , MYC , cyclin D , PCNA , bFGF , VEGF and Hsp70 proteins revealed a positive correlation to lymph node involvement .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [122, 132]}], "task": "NER"}
+{"text": "In contrast , caspase - 3 , Fas ligand , Fas / CD95 , and PAI showed an inverse correlation to lymph node involvement .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [95, 105]}], "task": "NER"}
+{"text": "In a second step , these parameters were further analyzed by hierarchical cluster analyses .", "entity": [], "task": "NER"}
+{"text": "The resulting clusters were correlated to patients with or without lymph node involvement .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [67, 77]}], "task": "NER"}
+{"text": "The data show that different protein expression patterns exist between primary squamous cell lung carcinomas with and without lymph node involvement and within carcinomas with lymph node involvement .", "entity": [{"entity": "primary squamous cell lung carcinomas", "entity_type": "Anatomy", "pos": [71, 108]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [126, 136]}, {"entity": "carcinomas", "entity_type": "Anatomy", "pos": [160, 170]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [176, 186]}], "task": "NER"}
+{"text": "The data suggest that various metastasis profiles exist .", "entity": [], "task": "NER"}
+{"text": "Antiangiogenic and antitumor effects of a protein kinase Cbeta inhibitor in human breast cancer and ovarian cancer xenografts .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [19, 28]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [82, 95]}, {"entity": "ovarian cancer xenografts", "entity_type": "Anatomy", "pos": [100, 125]}], "task": "NER"}
+{"text": "In cell culture , the compound 317615 2HCl , a potent inhibitor of VEGF - stimulated HUVEC proliferation , was not very effective against MX - 1 breast cancer cells ( IC50 = 8 . 1 microM ) or SKOV - 3 ovarian carcinoma cells ( IC50 = 9 . 5 microM ) .", "entity": [{"entity": "cell culture", "entity_type": "Anatomy", "pos": [3, 15]}, {"entity": "HUVEC", "entity_type": "Anatomy", "pos": [85, 90]}, {"entity": "MX - 1 breast cancer cells", "entity_type": "Anatomy", "pos": [138, 164]}, {"entity": "SKOV - 3 ovarian carcinoma cells", "entity_type": "Anatomy", "pos": [192, 224]}], "task": "NER"}
+{"text": "Exposure to combinations of paclitaxel or carboplatin and 317615 x 2HCl with MX - 1 cells in culture resulted in cell survival that reflected primarily additivity of the two agents .", "entity": [{"entity": "MX - 1 cells", "entity_type": "Anatomy", "pos": [77, 89]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [113, 117]}], "task": "NER"}
+{"text": "Exposure of SKOV - 3 cells to paclitaxel or carboplatin along with 317615 2HCl resulted in cell survivals that reflected additivity of 317615 x 2HCl with paclitaxel and greater - than - additive cytotoxicity with carboplatin .", "entity": [{"entity": "SKOV - 3 cells", "entity_type": "Anatomy", "pos": [12, 26]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [91, 95]}], "task": "NER"}
+{"text": "Administration of 317615 x 2HCI orally twice daily to nude mice bearing subcutaneous MX - 1 tumors or SKOV - 3 tumors resulted in a decreased number of intratumoral vessels as determined by CD31 and CD105 staining with decreases of 35 % and 43 % in MX - 1 tumors and 60 % and 75 % in SKOV - 3 tumors , respectively .", "entity": [{"entity": "orally", "entity_type": "Anatomy", "pos": [32, 38]}, {"entity": "subcutaneous MX - 1 tumors", "entity_type": "Anatomy", "pos": [72, 98]}, {"entity": "SKOV - 3 tumors", "entity_type": "Anatomy", "pos": [102, 117]}, {"entity": "intratumoral vessels", "entity_type": "Anatomy", "pos": [152, 172]}, {"entity": "MX - 1 tumors", "entity_type": "Anatomy", "pos": [249, 262]}, {"entity": "SKOV - 3 tumors", "entity_type": "Anatomy", "pos": [284, 299]}], "task": "NER"}
+{"text": "317615 x 2HCl was an active antitumor agent against the MX - 1 xenograft and increased the tumor growth delay produced by paclitaxel by 1 . 7 - fold and the tumor growth delay produced by carboplatin by 3 . 8 - fold .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [28, 37]}, {"entity": "MX - 1 xenograft", "entity_type": "Anatomy", "pos": [56, 72]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [91, 96]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [157, 162]}], "task": "NER"}
+{"text": "Administration of 317615 x 2HCl also increased the tumor growth delay produced by fractionated radiation therapy in the MX - 1 tumor .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [51, 56]}, {"entity": "MX - 1 tumor", "entity_type": "Anatomy", "pos": [120, 132]}], "task": "NER"}
+{"text": "Treatment with 317615 x 2HCl alone increased the lifespan of animals bearing intraperitoneal SKOV - 3 xenografts by 1 . 9 fold compared with untreated control animals .", "entity": [{"entity": "intraperitoneal SKOV - 3 xenografts", "entity_type": "Anatomy", "pos": [77, 112]}], "task": "NER"}
+{"text": "The combination of paclitaxel and 317615 x 2HCl resulted in 100 % 120 - day survival of SKOV - 3 bearing animals .", "entity": [{"entity": "SKOV - 3", "entity_type": "Anatomy", "pos": [88, 96]}], "task": "NER"}
+{"text": "Administration of 317615 x 2HCl along with carboplatin to animals bearing the SKOV - 3 tumor produced a 1 . 8 - fold increase in lifespan compared with carboplatin alone .", "entity": [{"entity": "SKOV - 3 tumor", "entity_type": "Anatomy", "pos": [78, 92]}], "task": "NER"}
+{"text": "317615 x 2HCl is a promising new antiangiogenic agent that is in early phase clinical testing .", "entity": [], "task": "NER"}
+{"text": "Expression of CD154 on renal cell carcinomas and effect on cell proliferation , motility and platelet - activating factor synthesis .", "entity": [{"entity": "renal cell carcinomas", "entity_type": "Anatomy", "pos": [23, 44]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [59, 63]}], "task": "NER"}
+{"text": "CD40 activation by CD154 may trigger diverse cellular responses , ranging from proliferation and differentiation to growth suppression and cell death , in normal and malignant cells .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [45, 53]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [139, 143]}, {"entity": "malignant cells", "entity_type": "Anatomy", "pos": [166, 181]}], "task": "NER"}
+{"text": "However , the pathophysiologic role of CD154 expressed by tumor cells remains unclear .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [58, 69]}], "task": "NER"}
+{"text": "We have investigated the expression of the CD40 - CD154 system in 24 primary cultures derived from renal cell carcinomas , its correlation with tumor stage and its potential functional significance .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [77, 85]}, {"entity": "renal cell carcinomas", "entity_type": "Anatomy", "pos": [99, 120]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [144, 149]}], "task": "NER"}
+{"text": "We found coexpression of CD40 and CD154 in most of the renal carcinoma cell lines .", "entity": [{"entity": "renal carcinoma cell lines", "entity_type": "Anatomy", "pos": [55, 81]}], "task": "NER"}
+{"text": "CD154 , but not CD40 expression , significantly correlated with tumor stage .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [64, 69]}], "task": "NER"}
+{"text": "Moreover , renal carcinoma cell lines also released the soluble form of CD154 into the supernatant .", "entity": [{"entity": "renal carcinoma cell lines", "entity_type": "Anatomy", "pos": [11, 37]}, {"entity": "supernatant", "entity_type": "Anatomy", "pos": [87, 98]}], "task": "NER"}
+{"text": "CD40 engagement by CD154 did not affect apoptosis or survival .", "entity": [], "task": "NER"}
+{"text": "On the contrary , CD154 stimulated cell proliferation , motility and production of PAF , a phospholipid mediator of inflammation with angiogenic properties .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [35, 39]}], "task": "NER"}
+{"text": "Furthermore , the renal carcinoma cell lines expressed PAF - R .", "entity": [{"entity": "renal carcinoma cell lines", "entity_type": "Anatomy", "pos": [18, 44]}], "task": "NER"}
+{"text": "Blockade of PAF - R by WEB - 2170 , a PAF - R antagonist , abolished the CD154 - dependent motility , indicating a role for PAF synthesized after CD154 stimulation in renal carcinoma cell motility .", "entity": [{"entity": "renal carcinoma cell", "entity_type": "Anatomy", "pos": [167, 187]}], "task": "NER"}
+{"text": "In conclusion , this study identifies new functional properties for CD154 , which are potentially relevant for the growth and dissemination of renal carcinoma cells .", "entity": [{"entity": "renal carcinoma cells", "entity_type": "Anatomy", "pos": [143, 164]}], "task": "NER"}
+{"text": "DNA damage induces a novel p53 - survivin signaling pathway regulating cell cycle and apoptosis in acute lymphoblastic leukemia cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [71, 75]}, {"entity": "acute lymphoblastic leukemia cells", "entity_type": "Anatomy", "pos": [99, 133]}], "task": "NER"}
+{"text": "Survivin is a novel member of the inhibitor of apoptosis protein ( IAP ) family .", "entity": [], "task": "NER"}
+{"text": "Here we report that the chemotherapeutic drug doxorubicin , a DNA - damaging agent , activates a p53 - survivin signaling pathway inducing cell cycle arrest and apoptosis in childhood acute lymphoblastic leukemia ( ALL ) .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [139, 143]}, {"entity": "acute lymphoblastic leukemia", "entity_type": "Anatomy", "pos": [184, 212]}, {"entity": "ALL", "entity_type": "Anatomy", "pos": [215, 218]}], "task": "NER"}
+{"text": "Treatment of wild - type ( wt ) p53 ALL cells ( EU - 3 cell line ) with doxorubicin caused accumulation of p53 , resulting in dramatic down - regulation of survivin , depletion of cells in G ( 2 ) / M , and apoptosis ( increased sub - G ( 1 ) compartment ) .", "entity": [{"entity": "wild - type ( wt ) p53 ALL cells", "entity_type": "Anatomy", "pos": [13, 45]}, {"entity": "EU - 3 cell line", "entity_type": "Anatomy", "pos": [48, 64]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [180, 185]}], "task": "NER"}
+{"text": "In contrast , doxorubicin treatment of mutant ( mut ) p53 cells ( EU - 6 / ALL line ) up - regulated survivin and induced G ( 2 ) / M arrest without inducing apoptosis .", "entity": [{"entity": "mutant ( mut ) p53 cells", "entity_type": "Anatomy", "pos": [39, 63]}, {"entity": "EU - 6 / ALL line", "entity_type": "Anatomy", "pos": [66, 83]}], "task": "NER"}
+{"text": "However , treating EU - 6 with anti - survivin antisense resensitized these cells to doxorubicin , resulting in apoptosis .", "entity": [{"entity": "EU - 6", "entity_type": "Anatomy", "pos": [19, 25]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [76, 81]}], "task": "NER"}
+{"text": "With a p53 - null cell line ( EU - 4 ) , although doxorubicin treatment arrested cells in G ( 2 ) / M , survivin expression was unchanged , and cells underwent only limited apoptosis .", "entity": [{"entity": "p53 - null cell line", "entity_type": "Anatomy", "pos": [7, 27]}, {"entity": "EU - 4 )", "entity_type": "Anatomy", "pos": [30, 38]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [81, 86]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [144, 149]}], "task": "NER"}
+{"text": "However , re - expression of wt - p53 in EU - 4 cells could restore the doxorubicin - p53 - survivin pathway , resulting in significantly decreased survivin expression and increased apoptosis in these cells after doxorubicin treatment .", "entity": [{"entity": "EU - 4 cells", "entity_type": "Anatomy", "pos": [41, 53]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [201, 206]}], "task": "NER"}
+{"text": "Following cotransfection of p53 - null EU - 4 cells with survivin promoter - luciferase constructs and either wt - p53 or different mut - p53 expression vectors , wt - p53 inhibited survivin promoter activity ; p53 - mediated inhibition could be abrogated by overexpression of murine double minute2 ( MDM2 ) protein .", "entity": [{"entity": "p53 - null EU - 4 cells", "entity_type": "Anatomy", "pos": [28, 51]}], "task": "NER"}
+{"text": "Together , these studies define a novel p53 - survivin signaling pathway activated by DNA damage that results in down - regulation of survivin , cell cycle arrest , and apoptosis .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [145, 149]}], "task": "NER"}
+{"text": "Furthermore , our data indicate that loss of wt - p53 function in tumor cells may contribute to up - regulation of survivin and resistance to DNA - damaging agents .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [66, 77]}], "task": "NER"}
+{"text": "On the relationship between the population structure and national economic development in China .", "entity": [], "task": "NER"}
+{"text": "The authors examine the relationship between population reproduction and the production of material goods , with particular reference to the effect of changes in the age composition of the population on the national economy and national income .", "entity": [], "task": "NER"}
+{"text": "An analysis of the population structure of China is presented , with consideration given to age characteristics , occupation , and urban and rural population .", "entity": [], "task": "NER"}
+{"text": "Suggestions for improving the population structure to achieve maximum rates of economic development are presented .", "entity": [], "task": "NER"}
+{"text": "Regional differences in population structure are also discussed .", "entity": [], "task": "NER"}
+{"text": "No evidence for an influence of the human platelet antigen - 1 polymorphism on the antiplatelet effects of glycoprotein IIb / IIIa inhibitors .", "entity": [], "task": "NER"}
+{"text": "This study investigated the hypothesis that the human platelet antigen - 1 ( HPA - 1 ) polymorphism may influence the antiplatelet effects of glycoprotein ( GP ) IIb / IIIa inhibitors .", "entity": [], "task": "NER"}
+{"text": "Adenosine diphosphate ( 30 micro mol ) - induced fibrinogen binding was measured by flow cytometry .", "entity": [], "task": "NER"}
+{"text": "Abciximab ( 0 . 03 - 3 micro g / ml ) , tirofiban ( 0 . 3 - 30 nmol / l ) or eptifibatide ( 0 . 01 - 1 micro g / ml ) were incubated for 15 min with the samples prior to stimulation .", "entity": [], "task": "NER"}
+{"text": "IC ( 50 ) values for the inhibition of fibrinogen binding were determined from each experiment .", "entity": [], "task": "NER"}
+{"text": "All subjects were genotyped by GALIOS and automated fluorescence correlation spectroscopy .", "entity": [], "task": "NER"}
+{"text": "Although a marked variability in the inhibitory effects of all three GPIIb / IIIa inhibitors was confirmed , there were no significant differences between the genotypes with respect to the inhibition of fibrinogen binding .", "entity": [], "task": "NER"}
+{"text": "Thus , the present study does not provide evidence for an effect of HPA - 1 polymorphism on the inter - individual variability in the platelet inhibitory effects of the three GPIIb / IIIa inhibitors approved for clinical use .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [134, 142]}], "task": "NER"}
+{"text": "Effects of 4 - alkylmorpholine N - oxides on ATP - producing processes in Ehrlich ascites and L1210 leukaemia cells .", "entity": [{"entity": "Ehrlich ascites", "entity_type": "Anatomy", "pos": [74, 89]}, {"entity": "L1210 leukaemia cells", "entity_type": "Anatomy", "pos": [94, 115]}], "task": "NER"}
+{"text": "The main purpose of the present investigation was to study the effect of the homologous series of 4 - alkylmorpholine N - oxides on ATP - producing processes in Ehrlich ascites and L1210 murine leukaemia cells .", "entity": [{"entity": "Ehrlich ascites", "entity_type": "Anatomy", "pos": [161, 176]}, {"entity": "L1210 murine leukaemia cells", "entity_type": "Anatomy", "pos": [181, 209]}], "task": "NER"}
+{"text": "The effects on aerobic glucose consumption , lactic acid formation , content of total ( T - SH ) and non - protein thiol groups ( NP - SH ) , endogenous and exogenous respiration and the level of ATP in tumour cells incubated in vitro were investigated .", "entity": [{"entity": "tumour cells", "entity_type": "Anatomy", "pos": [203, 215]}], "task": "NER"}
+{"text": "4 - Dodecylmorpholine N - oxide ( DMNO ) , one of the most active compounds , decreased the level of ATP immediately after addition to the suspension of Ehrlich cells in an ice bath .", "entity": [{"entity": "Ehrlich cells", "entity_type": "Anatomy", "pos": [153, 166]}], "task": "NER"}
+{"text": "After 2 h incubation at 37 degrees C the drop in the ATP level was much lower .", "entity": [], "task": "NER"}
+{"text": "A possible explanation for the decrease in the ATP level might be interaction of the amine oxide with the cell membrane .", "entity": [{"entity": "cell membrane", "entity_type": "Anatomy", "pos": [106, 119]}], "task": "NER"}
+{"text": "The Acute Dialysis Quality Initiative - - part IV : membranes for CRRT .", "entity": [{"entity": "membranes", "entity_type": "Anatomy", "pos": [52, 61]}], "task": "NER"}
+{"text": "The extracorporeal membrane used in a continuous renal replacement therapy ( CRRT ) for the treatment of a critically ill patient with acute renal failure ( ARF ) is vitally important for several reasons , including its influence on biocompatibility and filter performance .", "entity": [{"entity": "extracorporeal membrane", "entity_type": "Anatomy", "pos": [4, 27]}, {"entity": "renal", "entity_type": "Anatomy", "pos": [49, 54]}, {"entity": "renal", "entity_type": "Anatomy", "pos": [141, 146]}], "task": "NER"}
+{"text": "The clinical relevance of membrane - related biocompatibility markers traditionally used in chronic hemodialysis remains unclear in CRRT .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [26, 34]}], "task": "NER"}
+{"text": "Numerous approaches may be used to assess membrane and filter performance in CRRT , but no specific methodology is accepted widely at present .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [42, 50]}], "task": "NER"}
+{"text": "Although a potential benefit of certain membranes used for CRRT is adsorptive removal of inflammatory mediators , this issue has not been assessed carefully in well - designed clinical trials .", "entity": [{"entity": "membranes", "entity_type": "Anatomy", "pos": [40, 49]}], "task": "NER"}
+{"text": "These and other issues should be the subject of future clinical research efforts .", "entity": [], "task": "NER"}
+{"text": "Fibroblast growth factor 2 promotes microvessel formation from mouse embryonic aorta .", "entity": [{"entity": "microvessel", "entity_type": "Anatomy", "pos": [36, 47]}, {"entity": "embryonic aorta", "entity_type": "Anatomy", "pos": [69, 84]}], "task": "NER"}
+{"text": "To delineate the roles that oxygen and fibroblast growth factors ( FGFs ) play in the process of angiogenesis from the embryonic aorta , we cultured mouse embryonic aorta explants ( thoracic level to lateral vessels supplying the mesonephros and metanephros ) in a three - dimensional type I collagen gel matrix .", "entity": [{"entity": "embryonic aorta", "entity_type": "Anatomy", "pos": [119, 134]}, {"entity": "embryonic aorta explants", "entity_type": "Anatomy", "pos": [155, 179]}, {"entity": "thoracic", "entity_type": "Anatomy", "pos": [182, 190]}, {"entity": "lateral vessels", "entity_type": "Anatomy", "pos": [200, 215]}, {"entity": "mesonephros", "entity_type": "Anatomy", "pos": [230, 241]}, {"entity": "metanephros", "entity_type": "Anatomy", "pos": [246, 257]}], "task": "NER"}
+{"text": "During 8 days of culture under 5 % O ( 2 ) , but not room air , the addition of FGF2 to explants stimulated the formation of Gs - IB ( 4 - ) positive , CD31 - positive , and Flk - 1 - positive microvessels in a concentration - dependent manner .", "entity": [{"entity": "Gs - IB ( 4 - ) positive", "entity_type": "Anatomy", "pos": [125, 149]}, {"entity": "CD31 - positive", "entity_type": "Anatomy", "pos": [152, 167]}, {"entity": "Flk - 1 - positive microvessels", "entity_type": "Anatomy", "pos": [174, 205]}], "task": "NER"}
+{"text": "FGF2 - stimulated microvessel formation was inhibited by sequestration of FGF2 via addition of soluble FGF receptor ( FGFR ) chimera protein or anti - FGF2 antibodies .", "entity": [{"entity": "microvessel", "entity_type": "Anatomy", "pos": [18, 29]}], "task": "NER"}
+{"text": "FGFR1 and FGFR2 were present on explants .", "entity": [], "task": "NER"}
+{"text": "Levels of FGFR1 , but not FGFR2 , were increased in embryonic aorta cultured under 5 % O ( 2 ) relative to room air .", "entity": [{"entity": "embryonic aorta", "entity_type": "Anatomy", "pos": [52, 67]}], "task": "NER"}
+{"text": "Our data suggest that low oxygen upregulates FGFR1 expression in embryonic aorta in vitro and renders it more responsive to FGF2 .", "entity": [{"entity": "embryonic aorta", "entity_type": "Anatomy", "pos": [65, 80]}], "task": "NER"}
+{"text": "Insulin - like growth factor - I receptor - mediated vasculogenesis / angiogenesis in human lung development .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [92, 96]}], "task": "NER"}
+{"text": "The structural and functional development of the pulmonary system is dependent upon appropriate early vascularization of the embryonic lung .", "entity": [{"entity": "pulmonary system", "entity_type": "Anatomy", "pos": [49, 65]}, {"entity": "embryonic lung", "entity_type": "Anatomy", "pos": [125, 139]}], "task": "NER"}
+{"text": "Our previous in vitro studies in a rat model indicated that insulin - like growth factor - I ( IGF - I ) is a potent angiogenic agent for fetal lung endothelial cells .", "entity": [{"entity": "fetal lung endothelial cells", "entity_type": "Anatomy", "pos": [138, 166]}], "task": "NER"}
+{"text": "To assess its role on human vascular lung development , we first examined the expression of IGF - I / II and IGF receptor type I ( IGF - IR ) in human embryonic and fetal lung tissues at 4 - 12 wk of gestation .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [28, 36]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [37, 41]}, {"entity": "embryonic", "entity_type": "Anatomy", "pos": [151, 160]}, {"entity": "fetal lung tissues", "entity_type": "Anatomy", "pos": [165, 183]}], "task": "NER"}
+{"text": "Immunohistochemical and in situ hybridization studies revealed the presence of IGF - I / II - IGF - IR ligands and mRNA transcripts in embryonic lungs as early as 4 wk gestation .", "entity": [{"entity": "embryonic lungs", "entity_type": "Anatomy", "pos": [135, 150]}], "task": "NER"}
+{"text": "Immunotargeting using an anti - IGF - IR neutralizing antibody on human fetal lung explants demonstrated a significant blockade of IGF - IR signaling .", "entity": [{"entity": "fetal lung explants", "entity_type": "Anatomy", "pos": [72, 91]}], "task": "NER"}
+{"text": "Inactivation of IGF - IR resulted in a loss of endothelial cells , accompanied by dramatic changes in fetal lung explant morphology .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [47, 64]}, {"entity": "fetal lung", "entity_type": "Anatomy", "pos": [102, 112]}], "task": "NER"}
+{"text": "Terminal transferase dUTP end - labeling assay and TEM studies of anti - IGF - IR - treated lungs demonstrated numerous apoptotic mesenchymal cells .", "entity": [{"entity": "lungs", "entity_type": "Anatomy", "pos": [92, 97]}, {"entity": "mesenchymal cells", "entity_type": "Anatomy", "pos": [130, 147]}], "task": "NER"}
+{"text": "Rat embryonic lung explant studies further validated the importance of the IGF - IGF - IR system for lung vascular development .", "entity": [{"entity": "embryonic lung", "entity_type": "Anatomy", "pos": [4, 18]}, {"entity": "lung vascular", "entity_type": "Anatomy", "pos": [101, 114]}], "task": "NER"}
+{"text": "These data provide the first demonstration of IGF - I / II expression in the human lung in early gestation and indicate that the IGF family of growth factors , acting through the IGF - IR , is required as a survival factor during normal human lung vascularization .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [83, 87]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [243, 247]}], "task": "NER"}
+{"text": "Enhanced expression of vascular endothelial growth factor by periodontal pathogens in gingival fibroblasts .", "entity": [{"entity": "periodontal", "entity_type": "Anatomy", "pos": [61, 72]}, {"entity": "gingival fibroblasts", "entity_type": "Anatomy", "pos": [86, 106]}], "task": "NER"}
+{"text": "Vascular endothelial growth factor ( VEGF ) has recently attracted attention as a potent inducer of vascular permeability and angiogenesis .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [100, 108]}], "task": "NER"}
+{"text": "Aberrant angiogenesis is often associated with lesion formation in chronic periodontitis .", "entity": [{"entity": "lesion", "entity_type": "Anatomy", "pos": [47, 53]}], "task": "NER"}
+{"text": "The aim of the present study was to investigate the properties of VEGF expression in human gingival fibroblasts ( HGF ) culture .", "entity": [{"entity": "gingival fibroblasts", "entity_type": "Anatomy", "pos": [91, 111]}, {"entity": "HGF", "entity_type": "Anatomy", "pos": [114, 117]}], "task": "NER"}
+{"text": "HGF were stimulated with lipopolysaccharide ( LPS ) , vesicle ( Ve ) and outer membrane protein ( OMP ) from Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis .", "entity": [{"entity": "HGF", "entity_type": "Anatomy", "pos": [0, 3]}, {"entity": "vesicle", "entity_type": "Anatomy", "pos": [54, 61]}, {"entity": "Ve", "entity_type": "Anatomy", "pos": [64, 66]}], "task": "NER"}
+{"text": "HGF constitutively produced VEGF and levels were significantly enhanced ( P less than 0 . 01 ) by stimulation with Ve and OMP from A . actinomycetemcomitans and P . gingivalis at concentrations of 10 microg / ml or higher .", "entity": [{"entity": "HGF", "entity_type": "Anatomy", "pos": [0, 3]}, {"entity": "Ve", "entity_type": "Anatomy", "pos": [115, 117]}], "task": "NER"}
+{"text": "On the other hand , VEGF levels were not increased by LPS stimulation .", "entity": [], "task": "NER"}
+{"text": "VEGF mRNA expression was also observed in Ve - and OMP - stimulated HGF .", "entity": [{"entity": "Ve", "entity_type": "Anatomy", "pos": [42, 44]}, {"entity": "HGF", "entity_type": "Anatomy", "pos": [68, 71]}], "task": "NER"}
+{"text": "A vascular permeability enhancement ( VPE ) assay was performed using guinea pigs to ascertain whether supernatant from cultures of Ve - and OMP - stimulated HGF enhance vascular permeability in vivo .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [2, 10]}, {"entity": "supernatant", "entity_type": "Anatomy", "pos": [103, 114]}, {"entity": "cultures", "entity_type": "Anatomy", "pos": [120, 128]}, {"entity": "Ve", "entity_type": "Anatomy", "pos": [132, 134]}, {"entity": "HGF", "entity_type": "Anatomy", "pos": [158, 161]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [170, 178]}], "task": "NER"}
+{"text": "Supernatant from cultures of Ve - and OMP - stimulated HGF strongly induced VPE .", "entity": [{"entity": "Supernatant", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "cultures", "entity_type": "Anatomy", "pos": [17, 25]}, {"entity": "Ve", "entity_type": "Anatomy", "pos": [29, 31]}, {"entity": "HGF", "entity_type": "Anatomy", "pos": [55, 58]}], "task": "NER"}
+{"text": "This was markedly suppressed upon simultaneous injection of anti - VEGF polyclonal antibodies with the supernatant .", "entity": [{"entity": "supernatant", "entity_type": "Anatomy", "pos": [103, 114]}], "task": "NER"}
+{"text": "Heating and protease treatment of the stimulants reduced the VEGF enhancing levels in Ve and OMP in vitro .", "entity": [{"entity": "Ve", "entity_type": "Anatomy", "pos": [86, 88]}], "task": "NER"}
+{"text": "These results suggest that Ve and OMP may be crucial heat - labile and protease - sensitive components of periodontal pathogens that enhance VEGF expression .", "entity": [{"entity": "Ve", "entity_type": "Anatomy", "pos": [27, 29]}, {"entity": "periodontal", "entity_type": "Anatomy", "pos": [106, 117]}], "task": "NER"}
+{"text": "In addition , VEGF might be associated with the etiology of periodontitis in its early stages according to neovascularization stimulated by periodontal pathogens causing swelling and edema .", "entity": [{"entity": "periodontal", "entity_type": "Anatomy", "pos": [140, 151]}, {"entity": "edema", "entity_type": "Anatomy", "pos": [183, 188]}], "task": "NER"}
+{"text": "NF - kappaB / Rel transcriptional pathway : implications in pancreatic cancer .", "entity": [{"entity": "pancreatic cancer", "entity_type": "Anatomy", "pos": [60, 77]}], "task": "NER"}
+{"text": "Despite considerable efforts in understanding the cellular mechanisms contributing to pancreatic cancer , the prognosis of this malignant disease is still extremely poor .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [50, 58]}, {"entity": "pancreatic cancer", "entity_type": "Anatomy", "pos": [86, 103]}, {"entity": "malignant disease", "entity_type": "Anatomy", "pos": [128, 145]}], "task": "NER"}
+{"text": "Although pancreatic cancer is the fifth common cause of cancer death in Western countries , current options in treatment enable a 5 - yr survival rate for all stages of less than 5 % .", "entity": [{"entity": "pancreatic cancer", "entity_type": "Anatomy", "pos": [9, 26]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [56, 62]}], "task": "NER"}
+{"text": "In the face fo the fatal outcome , new approaches to the therapy have been established .", "entity": [], "task": "NER"}
+{"text": "Based on its role in malignant transformation , apoptosis , and cell proliferation , the transcription factor NF - kappaB / Rel has gained the attention of many laboratories .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [64, 68]}], "task": "NER"}
+{"text": "This review provides basic information for the understanding of the biology of NF - kappaB and aims at presenting experimental data illustrating the involvement of NF - kappaB / Rel in pancreatic cancer .", "entity": [{"entity": "pancreatic cancer", "entity_type": "Anatomy", "pos": [185, 202]}], "task": "NER"}
+{"text": "Sickle cell disease : continuous arterial spin - labeling perfusion MR imaging in children .", "entity": [{"entity": "Sickle cell", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "arterial", "entity_type": "Anatomy", "pos": [33, 41]}], "task": "NER"}
+{"text": "Cerebral blood flow ( CBF ) was measured with continuous arterial spin - labeling perfusion magnetic resonance ( MR ) imaging in 14 children with sickle cell disease and seven control subjects .", "entity": [{"entity": "Cerebral", "entity_type": "Anatomy", "pos": [0, 8]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [9, 14]}, {"entity": "arterial", "entity_type": "Anatomy", "pos": [57, 65]}, {"entity": "sickle cell", "entity_type": "Anatomy", "pos": [146, 157]}], "task": "NER"}
+{"text": "Mean CBF values were higher in patients ( P < . 005 ) than in control subjects in all cerebral artery territories .", "entity": [{"entity": "cerebral artery", "entity_type": "Anatomy", "pos": [86, 101]}], "task": "NER"}
+{"text": "Three patients had decreased CBF in right anterior and middle cerebral artery territories compared with CBF on the left , and one patient had a profound decrease in CBF in all three territories in the right hemisphere .", "entity": [{"entity": "right anterior", "entity_type": "Anatomy", "pos": [36, 50]}, {"entity": "middle cerebral artery", "entity_type": "Anatomy", "pos": [55, 77]}, {"entity": "right hemisphere", "entity_type": "Anatomy", "pos": [201, 217]}], "task": "NER"}
+{"text": "Baseline CBF was significantly decreased in territories seen as unaffected on conventional MR images and MR angiograms in four children with sickle cell disease .", "entity": [{"entity": "sickle cell", "entity_type": "Anatomy", "pos": [141, 152]}], "task": "NER"}
+{"text": "Combined topical fluconazole and corticosteroid treatment for experimental Candida albicans keratomycosis .", "entity": [], "task": "NER"}
+{"text": "PURPOSE : To determine the most efficient time point and concentration of topical corticosteroids in Candida albicans keratitis treated with fluconazole .", "entity": [], "task": "NER"}
+{"text": "METHODS : Corneas of 105 rabbits were infected with viable yeast cells of C . albicans ( 2 . 5 x 10 ( 5 ) ) .", "entity": [{"entity": "Corneas", "entity_type": "Anatomy", "pos": [10, 17]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [65, 70]}], "task": "NER"}
+{"text": "After a 48 - hour incubation period , seven groups of animals were treated for 21 days with fluconazole , with group I acting as a control , and groups II to VII receiving adjunct therapy with the corticosteroid prednisolone ( 5 or 10 times daily ; 3 , 9 , or 15 days after infection ) .", "entity": [], "task": "NER"}
+{"text": "The degree of corneal infiltration , ulceration , corneal clouding , hypopyon , conjunctivitis , neovascularization , and corneal perforation was monitored over a 24 - day period , as well as recultivation and resistance to fluconazole of the C . albicans pathogen .", "entity": [{"entity": "corneal", "entity_type": "Anatomy", "pos": [14, 21]}, {"entity": "corneal", "entity_type": "Anatomy", "pos": [50, 57]}, {"entity": "corneal", "entity_type": "Anatomy", "pos": [122, 129]}], "task": "NER"}
+{"text": "RESULTS : The control group showed the highest level of corneal clouding and neovascularization .", "entity": [{"entity": "corneal", "entity_type": "Anatomy", "pos": [56, 63]}], "task": "NER"}
+{"text": "In comparison , by day 24 , the majority of groups also treated with prednisolone displayed significantly less corneal clouding and neovascularization .", "entity": [{"entity": "corneal", "entity_type": "Anatomy", "pos": [111, 118]}], "task": "NER"}
+{"text": "An immediate decrease in corneal clouding was observed in groups treated with additional low - or high - dose prednisolone from day 9 after inoculation .", "entity": [{"entity": "corneal", "entity_type": "Anatomy", "pos": [25, 32]}], "task": "NER"}
+{"text": "After additional prednisolone treatment from day 9 or 15 after inoculation , no significant difference was detected in the recultivation rate of C . albicans compared with the control .", "entity": [], "task": "NER"}
+{"text": "Early administration of prednisolone ( day 3 , low and high dose ) resulted in the recultivation of significantly more C . albicans .", "entity": [], "task": "NER"}
+{"text": "CONCLUSIONS : Fluconazole plus adjunct high - dose prednisolone treatment was most effective when administered 9 days after infection .", "entity": [], "task": "NER"}
+{"text": "The delayed application of corticosteroids after treatment with antimycotic drugs in cases of fungal keratitis is therefore not contraindicated and may be beneficial in patients .", "entity": [], "task": "NER"}
+{"text": "Solid tumor therapy : manipulation of the vasculature with TNF .", "entity": [{"entity": "Solid tumor", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [42, 53]}], "task": "NER"}
+{"text": "Drug delivery to solid tumors is one of the most challenging aspects in cancer therapy .", "entity": [{"entity": "solid tumors", "entity_type": "Anatomy", "pos": [17, 29]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [72, 78]}], "task": "NER"}
+{"text": "Whereas agents seem promising in the test tube , clinical trials often fail due to unfavorable pharmacokinetics , poor delivery , low local concentrations , and limited accumulation in the target cell .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [196, 200]}], "task": "NER"}
+{"text": "A major step forwards in the treatment of solid tumors is the recognition of the tumor - associated vasculature as an important target for therapy .", "entity": [{"entity": "solid tumors", "entity_type": "Anatomy", "pos": [42, 54]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [81, 86]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [100, 111]}], "task": "NER"}
+{"text": "Inhibition of tumor vascular development has a direct effect on the growth and progression of the tumor .", "entity": [{"entity": "tumor vascular", "entity_type": "Anatomy", "pos": [14, 28]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [98, 103]}], "task": "NER"}
+{"text": "Destruction of an existing vasculature also directly inflicts serious damage to the tumor cell .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [27, 38]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [84, 94]}], "task": "NER"}
+{"text": "Moreover , the tumor vascular bed can be manipulated facilitating enhanced permissiveness of the tumor for administered chemotherapeutics .", "entity": [{"entity": "tumor vascular bed", "entity_type": "Anatomy", "pos": [15, 33]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [97, 102]}], "task": "NER"}
+{"text": "In this review , we focus on the use of tumor necrosis factor alpha ( TNF ) in local and systemic therapy in conjunction with chemotherapy .", "entity": [], "task": "NER"}
+{"text": "In these settings TNF demonstrates potent and selective activity on the tumor vascular bed , which strongly improves tumor response .", "entity": [{"entity": "tumor vascular bed", "entity_type": "Anatomy", "pos": [72, 90]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [117, 122]}], "task": "NER"}
+{"text": "The septic abscess wall : a cytokine - generating organ associated with portal venous cytokinemia , hepatic outflow fibrosis , sinusoidal congestion , inflammatory cell sequestration , hepatocellular lipid deposition , and focal cell death .", "entity": [{"entity": "septic abscess wall", "entity_type": "Anatomy", "pos": [4, 23]}, {"entity": "organ", "entity_type": "Anatomy", "pos": [50, 55]}, {"entity": "portal venous", "entity_type": "Anatomy", "pos": [72, 85]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [100, 107]}, {"entity": "sinusoidal", "entity_type": "Anatomy", "pos": [127, 137]}, {"entity": "inflammatory cell", "entity_type": "Anatomy", "pos": [151, 168]}, {"entity": "hepatocellular", "entity_type": "Anatomy", "pos": [185, 199]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [229, 233]}], "task": "NER"}
+{"text": "An acute septic inflammatory response with access to the portal circulation was created in a rat model using an intra - abdominal abscess composed of a sterile agar pellet , or one contaminated with 102 Escherichia coli ( E . coli ) and 109 Bacteriodes fragilis ( B . fragilis ) .", "entity": [{"entity": "intra - abdominal abscess", "entity_type": "Anatomy", "pos": [112, 137]}], "task": "NER"}
+{"text": "After 3 days postimplantation , a well - formed intra - abdominal abscess occurred whose wall showed IL - 6 DNA by PCR and IL - 6 mRNA by in situ hybridization .", "entity": [{"entity": "intra - abdominal abscess", "entity_type": "Anatomy", "pos": [48, 73]}, {"entity": "wall", "entity_type": "Anatomy", "pos": [89, 93]}], "task": "NER"}
+{"text": "Portal venous blood draining into the liver from the intra - abdominal abscess had increased levels of TNF - alpha , IL - 1beta , and IL - 6 in both sterile and septic groups compared with a control normal animal group .", "entity": [{"entity": "Portal venous blood", "entity_type": "Anatomy", "pos": [0, 19]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [38, 43]}, {"entity": "intra - abdominal abscess", "entity_type": "Anatomy", "pos": [53, 78]}], "task": "NER"}
+{"text": "Increased levels of these cytokines were also found in suprahepatic inferior vena caval blood , but were correlated with the higher portal vein levels , suggesting a gradient from abscess wall to portal vein into the systemic circulation via the liver .", "entity": [{"entity": "suprahepatic inferior vena caval blood", "entity_type": "Anatomy", "pos": [55, 93]}, {"entity": "portal vein", "entity_type": "Anatomy", "pos": [132, 143]}, {"entity": "abscess wall", "entity_type": "Anatomy", "pos": [180, 192]}, {"entity": "portal vein", "entity_type": "Anatomy", "pos": [196, 207]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [246, 251]}], "task": "NER"}
+{"text": "Liver histology demonstrated sinusoidal congestion centering on the central vein , growing worse with progression from normal in control , to sterile , to septic .", "entity": [{"entity": "Liver", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "sinusoidal", "entity_type": "Anatomy", "pos": [29, 39]}, {"entity": "central vein", "entity_type": "Anatomy", "pos": [68, 80]}], "task": "NER"}
+{"text": "Similarly , the degree of intrahepatic myeloperoxidase - positive inflammatory cell infiltration and hepatocellular lipid deposition and apoptosis also increased from control , to sterile , to septic .", "entity": [{"entity": "inflammatory cell", "entity_type": "Anatomy", "pos": [66, 83]}, {"entity": "hepatocellular", "entity_type": "Anatomy", "pos": [101, 115]}], "task": "NER"}
+{"text": "Gene expression by in situ hybridization demonstrated a significant increase in IL - 6 and fibrinogen mRNAs in cells surrounding the central vein in sterile and septic animals , being greatest in animals with sepsis , associated with an increased deposition of collagen in the central vein area , most prominent in the septic liver .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [111, 116]}, {"entity": "central vein", "entity_type": "Anatomy", "pos": [133, 145]}, {"entity": "central vein area", "entity_type": "Anatomy", "pos": [277, 294]}, {"entity": "septic liver", "entity_type": "Anatomy", "pos": [319, 331]}], "task": "NER"}
+{"text": "The pericentral vein cells with IL - 6 and fibrinogen mRNA increases paralleled the increases in cells containing IL - 6 and fibrinogen mRNAs in the abscess walls of sterile and septic animals , respectively .", "entity": [{"entity": "pericentral vein cells", "entity_type": "Anatomy", "pos": [4, 26]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [97, 102]}, {"entity": "abscess walls", "entity_type": "Anatomy", "pos": [149, 162]}], "task": "NER"}
+{"text": "The data suggest that an intra - abdominal abscess , especially when contaminated with gram - negative bacteria , induces mRNA - generated cytokine responses in the abscess wall that are related to increased portal venous levels of the inflammatory cytokines TNF - alpha , IL - 1beta , and IL - 6 perfusing the liver .", "entity": [{"entity": "intra - abdominal abscess", "entity_type": "Anatomy", "pos": [25, 50]}, {"entity": "abscess wall", "entity_type": "Anatomy", "pos": [165, 177]}, {"entity": "portal venous", "entity_type": "Anatomy", "pos": [208, 221]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [311, 316]}], "task": "NER"}
+{"text": "These , in turn , induce localized production of IL - 6 and fibrinogen mRNAs in cells at the central vein area with resultant outflow fibrosis and increased inflammatory cell sequestration within the liver lobular sinuses .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [80, 85]}, {"entity": "central vein area", "entity_type": "Anatomy", "pos": [93, 110]}, {"entity": "inflammatory cell", "entity_type": "Anatomy", "pos": [157, 174]}, {"entity": "liver lobular sinuses", "entity_type": "Anatomy", "pos": [200, 221]}], "task": "NER"}
+{"text": "This is associated with a generalized inflammatory response and intrahepatic portal sinusoid congestion .", "entity": [], "task": "NER"}
+{"text": "There is also increased hepatocellular lipid deposition and apoptosis .", "entity": [{"entity": "hepatocellular", "entity_type": "Anatomy", "pos": [24, 38]}], "task": "NER"}
+{"text": "Thus , the cytokine production of the abscess wall itself appears to be a major mediator of the septic hepatic response .", "entity": [{"entity": "abscess wall", "entity_type": "Anatomy", "pos": [38, 50]}, {"entity": "septic hepatic", "entity_type": "Anatomy", "pos": [96, 110]}], "task": "NER"}
+{"text": "Comparison of tissue integration between polyester and polypropylene prostheses in the preperitoneal space .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [14, 20]}, {"entity": "preperitoneal space", "entity_type": "Anatomy", "pos": [87, 106]}], "task": "NER"}
+{"text": "Tissue integration and implant characteristics of various biomaterials commonly used for inguinal hernia repair have not been studied extensively .", "entity": [{"entity": "Tissue", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "inguinal hernia", "entity_type": "Anatomy", "pos": [89, 104]}], "task": "NER"}
+{"text": "The aim of this study is to compare behavior and tissue response between two new polyester prostheses and a commonly used polypropylene ( PP ) mesh .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [49, 55]}], "task": "NER"}
+{"text": "The polyester prostheses utilized were polyester flat ( PF ) and polyester soft three - dimensional ( PS ) ; the PP mesh utilized was Marlex .", "entity": [], "task": "NER"}
+{"text": "Eight randomly assigned 4 x 4 - cm2 pieces of two different meshes were fixed in the preperitoneal space with a centrally placed single suture .", "entity": [{"entity": "preperitoneal space", "entity_type": "Anatomy", "pos": [85, 104]}], "task": "NER"}
+{"text": "Gross evaluation included shrinkage and stiffness .", "entity": [], "task": "NER"}
+{"text": "Histological evaluation included amount of fibrous and fat encapsulation , connective tissue , foreign - body reaction , neovascularization , hemorrhage , necrosis , and exudate .", "entity": [{"entity": "fibrous", "entity_type": "Anatomy", "pos": [43, 50]}, {"entity": "fat", "entity_type": "Anatomy", "pos": [55, 58]}, {"entity": "connective tissue", "entity_type": "Anatomy", "pos": [75, 92]}, {"entity": "exudate", "entity_type": "Anatomy", "pos": [170, 177]}], "task": "NER"}
+{"text": "Evaluations were graded on a zero to four scale .", "entity": [], "task": "NER"}
+{"text": "The area and the area ratio were measured using a calibrated micrometer .", "entity": [], "task": "NER"}
+{"text": "PP mesh resulted in more fibrous encapsulation and stiffness than PF and PS prostheses .", "entity": [{"entity": "fibrous", "entity_type": "Anatomy", "pos": [25, 32]}], "task": "NER"}
+{"text": "PP also resulted in less connective tissue formation and foreign - body reaction than PF and PS prostheses .", "entity": [{"entity": "connective tissue", "entity_type": "Anatomy", "pos": [25, 42]}], "task": "NER"}
+{"text": "There was no difference in fat encapsulation , necrosis , hemorrhage , or exudate between prostheses .", "entity": [{"entity": "fat", "entity_type": "Anatomy", "pos": [27, 30]}, {"entity": "exudate", "entity_type": "Anatomy", "pos": [74, 81]}], "task": "NER"}
+{"text": "Both polyester prostheses ( PF and PS ) have better tissue integration than the PP mesh , as evidenced by the higher amount of connective tissue and lower extent of fibrous encapsulation .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [52, 58]}, {"entity": "connective tissue", "entity_type": "Anatomy", "pos": [127, 144]}, {"entity": "fibrous", "entity_type": "Anatomy", "pos": [165, 172]}], "task": "NER"}
+{"text": "Therapeutic targeting of the survivin pathway in cancer : initiation of mitochondrial apoptosis and suppression of tumor - associated angiogenesis .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [49, 55]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [72, 85]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [115, 120]}], "task": "NER"}
+{"text": "PURPOSE : Molecular antagonists of the inhibitor of apoptosis protein survivin have shown promise as novel anticancer strategies for triggering tumor cell apoptosis , dysregulating mitotic progression , and inhibiting tumor growth in preclinical models .", "entity": [{"entity": "anticancer", "entity_type": "Anatomy", "pos": [107, 117]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [144, 154]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [218, 223]}], "task": "NER"}
+{"text": "However , how survivin couples to the cell death machinery has remained elusive , and the relevant cellular targets of survivin antagonists have not been completely elucidated .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [38, 42]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [99, 107]}], "task": "NER"}
+{"text": "Experimental Design : Human umbilical vein and dermal microvascular endothelial cells were infected with replication - deficient adenoviruses encoding survivin ( pAd - Survivin ) , green fluorescent protein ( pAd - GFP ) , or a phosphorylation - defective survivin Thr ( 34 ) - - > Ala ( pAd - T34A ) dominant negative mutant .", "entity": [{"entity": "umbilical vein", "entity_type": "Anatomy", "pos": [28, 42]}, {"entity": "dermal microvascular endothelial cells", "entity_type": "Anatomy", "pos": [47, 85]}], "task": "NER"}
+{"text": "The effect of wild - type or mutant survivin was investigated on capillary network stability , endothelial cell viability , and caspase activation in vitro and on kinetics of tumor growth and development of angiogenesis in a breast cancer xenograft model in vivo .", "entity": [{"entity": "capillary network", "entity_type": "Anatomy", "pos": [65, 82]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [95, 111]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [175, 180]}, {"entity": "breast cancer xenograft", "entity_type": "Anatomy", "pos": [225, 248]}], "task": "NER"}
+{"text": "The cell death pathway initiated by survivin targeting was mapped with respect to cytochrome c release , changes in mitochondrial transmembrane potential , and apoptosome requirements using mouse embryonic fibroblasts deficient in Apaf - 1 or caspase - 9 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [4, 8]}, {"entity": "mitochondrial transmembrane", "entity_type": "Anatomy", "pos": [116, 143]}, {"entity": "embryonic fibroblasts", "entity_type": "Anatomy", "pos": [196, 217]}], "task": "NER"}
+{"text": "RESULTS : Adenoviral transduction of endothelial cells with pAd - Survivin inhibited growth factor deprivation - or ceramide - induced apoptosis , reduced caspase - 3 and - 7 generation , and stabilized three - dimensional capillary networks in vitro .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [37, 54]}, {"entity": "capillary networks", "entity_type": "Anatomy", "pos": [223, 241]}], "task": "NER"}
+{"text": "Conversely , expression of pAd - T34A caused apoptosis in umbilical vein and dermal microvascular endothelial cells and resulted in caspase - 3 activity .", "entity": [{"entity": "umbilical vein", "entity_type": "Anatomy", "pos": [58, 72]}, {"entity": "dermal microvascular endothelial cells", "entity_type": "Anatomy", "pos": [77, 115]}], "task": "NER"}
+{"text": "Cell death induced by survivin targeting exhibited the hallmarks of mitochondrial - dependent apoptosis with release of cytochrome c and loss of mitochondrial transmembrane potential and was suppressed in Apaf - 1 or caspase - 9 knockout mouse embryonic fibroblasts .", "entity": [{"entity": "Cell", "entity_type": "Anatomy", "pos": [0, 4]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [68, 81]}, {"entity": "mitochondrial transmembrane", "entity_type": "Anatomy", "pos": [145, 172]}, {"entity": "embryonic fibroblasts", "entity_type": "Anatomy", "pos": [244, 265]}], "task": "NER"}
+{"text": "When injected in human breast cancer xenografts , pAd - T34A inhibited growth of established tumors and triggered tumor cell apoptosis in vivo .", "entity": [{"entity": "breast cancer xenografts", "entity_type": "Anatomy", "pos": [23, 47]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [93, 99]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [114, 124]}], "task": "NER"}
+{"text": "This was associated with a approximately 60 % reduction in tumor - derived blood vessels by quantitative morphometry of CD31 - stained tumor areas , and appearance of endothelial cell apoptosis by internucleosomal DNA fragmentation in vivo .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [59, 64]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [75, 88]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [135, 140]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [167, 183]}], "task": "NER"}
+{"text": "CONCLUSIONS : Survivin functions as a novel upstream regulator of mitochondrial - dependent apoptosis , and molecular targeting of this pathway results in anticancer activity via a dual mechanism of induction of tumor cell apoptosis and suppression of angiogenesis .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [66, 79]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [155, 165]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [212, 222]}], "task": "NER"}
+{"text": "Integration of interferon - alpha / beta signalling to p53 responses in tumour suppression and antiviral defence .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [72, 78]}], "task": "NER"}
+{"text": "Swift elimination of undesirable cells is an important feature in tumour suppression and immunity .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [33, 38]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [66, 72]}], "task": "NER"}
+{"text": "The tumour suppressor p53 and interferon - alpha and - beta ( IFN - alpha / beta ) are essential for the induction of apoptosis in cancerous cells and in antiviral immune responses , respectively , but little is known about their interrelationship .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [4, 10]}, {"entity": "cancerous cells", "entity_type": "Anatomy", "pos": [131, 146]}], "task": "NER"}
+{"text": "Here we show that transcription of the p53 gene is induced by IFN - alpha / beta , accompanied by an increase in p53 protein level .", "entity": [], "task": "NER"}
+{"text": "IFN - alpha / beta signalling itself does not activate p53 ; rather , it contributes to boosting p53 responses to stress signals .", "entity": [], "task": "NER"}
+{"text": "We show examples in which p53 gene induction by IFN - alpha / beta contributes to tumour suppression .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [82, 88]}], "task": "NER"}
+{"text": "Furthermore , we show that p53 is activated in virally infected cells to evoke an apoptotic response and that p53 is critical for antiviral defence of the host .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [64, 69]}], "task": "NER"}
+{"text": "Our study reveals a hitherto unrecognized link between p53 and IFN - alpha / beta in tumour suppression and antiviral immunity , which may have therapeutic implications .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [85, 91]}], "task": "NER"}
+{"text": "T140 analogs as CXCR4 antagonists identified as anti - metastatic agents in the treatment of breast cancer .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [93, 106]}], "task": "NER"}
+{"text": "A chemokine receptor , CXCR4 , and its endogenous ligand , stromal cell - derived factor - 1 ( SDF - 1 ) , have been recognized to be involved in the metastasis of several types of cancers .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [181, 188]}], "task": "NER"}
+{"text": "T140 analogs are peptidic CXCR4 antagonists composed of 14 amino acid residues that were previously developed as anti - HIV agents having inhibitory activity against HIV - entry through its co - receptor , CXCR4 .", "entity": [], "task": "NER"}
+{"text": "Herein , we report that these compounds effectively inhibited SDF - 1 - induced migration of human breast cancer cells ( MDA - MB - 231 ) , human leukemia T cells ( Sup - T1 ) and human umbilical vein endothelial cells at concentrations of 10 - 100 nM in vitro .", "entity": [{"entity": "breast cancer cells", "entity_type": "Anatomy", "pos": [99, 118]}, {"entity": "MDA - MB - 231", "entity_type": "Anatomy", "pos": [121, 135]}, {"entity": "leukemia T cells", "entity_type": "Anatomy", "pos": [146, 162]}, {"entity": "Sup - T1", "entity_type": "Anatomy", "pos": [165, 173]}, {"entity": "human umbilical vein endothelial cells", "entity_type": "Anatomy", "pos": [180, 218]}], "task": "NER"}
+{"text": "Furthermore , slow release administration by subcutaneous injection using an Alzet osmotic pump of a potent and bio - stable T140 analog , 4F - benzoyl - TN14003 , gave a partial , but statistically significant ( P < / = 0 . 05 ( t - test ) ) reduction in pulmonary metastasis of MDA - MB - 231 in SCID mice , even though no attempt was made to inhibit other important targets such as CCR7 .", "entity": [{"entity": "subcutaneous", "entity_type": "Anatomy", "pos": [45, 57]}, {"entity": "pulmonary", "entity_type": "Anatomy", "pos": [256, 265]}, {"entity": "MDA - MB - 231", "entity_type": "Anatomy", "pos": [280, 294]}], "task": "NER"}
+{"text": "These results suggest that T140 analogs have potential use for cancer therapy , and that small molecular CXCR4 antagonists could potentially replace neutralizing antibodies as anti - metastatic agents for breast cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [63, 69]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [205, 218]}], "task": "NER"}
+{"text": "Treatment effects on nigrostriatal projection integrity in partial 6 - OHDA lesions : comparison of L - DOPA and pramipexole .", "entity": [{"entity": "nigrostriatal", "entity_type": "Anatomy", "pos": [21, 34]}, {"entity": "lesions", "entity_type": "Anatomy", "pos": [76, 83]}], "task": "NER"}
+{"text": "There is controversy over potential effects of dopaminergic replacement therapies on the partially lesioned nigrostriatal dopaminergic projection .", "entity": [{"entity": "lesioned nigrostriatal", "entity_type": "Anatomy", "pos": [99, 121]}], "task": "NER"}
+{"text": "We evaluated indirect ( levodopa , L - DOPA ) versus direct ( pramipexole , PRA ) dopaminergic treatment effects on nigrostriatal lesion severity as measured with vesicular monoamine transporter type - 2 ( VMAT2 ) binding .", "entity": [{"entity": "nigrostriatal lesion", "entity_type": "Anatomy", "pos": [116, 136]}], "task": "NER"}
+{"text": "Prior studies have shown that striatal VMAT2 density provides an objective estimate of dopaminergic neuronal integrity , without confounding effects of compensatory regulation .", "entity": [{"entity": "striatal", "entity_type": "Anatomy", "pos": [30, 38]}, {"entity": "neuronal", "entity_type": "Anatomy", "pos": [100, 108]}], "task": "NER"}
+{"text": "Partial unilateral median forebrain bundle lesions were made by injection of 6 - hydroxydopamine in adult male Sprague - Dawley rats .", "entity": [{"entity": "unilateral median forebrain bundle lesions", "entity_type": "Anatomy", "pos": [8, 50]}], "task": "NER"}
+{"text": "Lesion severity was estimated using rotational behavior after injections of apomorphine and amphetamine .", "entity": [{"entity": "Lesion", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Rats were ranked and matched in pairs by rotation and assigned to receive either PRA ( 1 mg / kg / day ) or L - DOPA / benserazide ( 100 / 25 mg / kg / day ) ip via osmotic pump .", "entity": [], "task": "NER"}
+{"text": "After 4 weeks of drug treatment , in vitro autoradiography was performed with [ ( 3 ) H ] methoxytetrabenazine to measure striatal VMAT2 binding density .", "entity": [{"entity": "striatal", "entity_type": "Anatomy", "pos": [122, 130]}], "task": "NER"}
+{"text": "Lesion - to - intact VMAT2 density correlated with rotation in both treatment groups .", "entity": [{"entity": "Lesion", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "There was no treatment effect on VMAT2 expression in the partially lesioned striatum and thus no differential effect of indirect versus direct dopamimetic treatment on nigrostriatal integrity .", "entity": [{"entity": "lesioned striatum", "entity_type": "Anatomy", "pos": [67, 84]}, {"entity": "nigrostriatal", "entity_type": "Anatomy", "pos": [168, 181]}], "task": "NER"}
+{"text": "CCL16 activates an angiogenic program in vascular endothelial cells .", "entity": [{"entity": "vascular endothelial cells", "entity_type": "Anatomy", "pos": [41, 67]}], "task": "NER"}
+{"text": "Besides regulating leukocyte trafficking in normal and injured tissues , several chemokines may positively or negatively regulate angiogenesis .", "entity": [{"entity": "leukocyte", "entity_type": "Anatomy", "pos": [19, 28]}, {"entity": "tissues", "entity_type": "Anatomy", "pos": [63, 70]}], "task": "NER"}
+{"text": "Here we report that CCL16 activates an angiogenic program in vascular endothelial cells by activating CCR1 .", "entity": [{"entity": "vascular endothelial cells", "entity_type": "Anatomy", "pos": [61, 87]}], "task": "NER"}
+{"text": "CCL16 induces dose - dependent random and directional migration of endothelial cells isolated from large vessels and liver capillaries without inducing their proliferation .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [67, 84]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [105, 112]}, {"entity": "liver capillaries", "entity_type": "Anatomy", "pos": [117, 134]}], "task": "NER"}
+{"text": "It also promotes endothelial differentiation into capillary - like structures in an in vitro assay and is angiogenic in the chick chorionallantoic membrane .", "entity": [{"entity": "endothelial", "entity_type": "Anatomy", "pos": [17, 28]}, {"entity": "capillary - like structures", "entity_type": "Anatomy", "pos": [50, 77]}, {"entity": "chorionallantoic membrane", "entity_type": "Anatomy", "pos": [130, 155]}], "task": "NER"}
+{"text": "These angiogenic activities are neutralized by a specific antibody against CCL16 .", "entity": [], "task": "NER"}
+{"text": "The direct angiogenic activity of CCL16 is further amplified by its ability to prime endothelium to a mitogen signal induced by vascular endothelial growth factor A and to raise their basal production of CXCL8 and CCL2 , 2 other angiogenic chemokines .", "entity": [{"entity": "endothelium", "entity_type": "Anatomy", "pos": [85, 96]}], "task": "NER"}
+{"text": "BX471 ( R - N - [ 5 - chloro - 2 - [ 2 - [ 4 ( 4 - fluorophenyl ) methyl ] - 2 - methyl - 1 - piperazinyl ] - 2 - oxoethoxy ] phenyl ] urea hydrochloric acid salt ) , a CCR1 antagonist , inhibits angiogenic properties of CCL16 , whereas blocking of CCR8 or desensitizing CCR2 , which are both well known receptors for CCL16 , did not abolish endothelial activation .", "entity": [{"entity": "endothelial", "entity_type": "Anatomy", "pos": [342, 353]}], "task": "NER"}
+{"text": "CCL16 may be specifically cross - linked to CCR1 expressed on endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [62, 79]}], "task": "NER"}
+{"text": "The largely restricted CCL16 expression in the liver suggests that this chemokine may play a role in hepatic vascular formation during development and in angiogenesis associated to hepatic diseases .", "entity": [{"entity": "liver", "entity_type": "Anatomy", "pos": [47, 52]}, {"entity": "hepatic vascular", "entity_type": "Anatomy", "pos": [101, 117]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [181, 188]}], "task": "NER"}
+{"text": "Simvastatin induces apoptosis of B - CLL cells by activation of mitochondrial caspase 9 .", "entity": [{"entity": "B - CLL cells", "entity_type": "Anatomy", "pos": [33, 46]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [64, 77]}], "task": "NER"}
+{"text": "BACKGROUND AND OBJECTIVES : Chronic lymphocytic leukemia ( CLL ) is the most common leukemia in the western world .", "entity": [{"entity": "Chronic lymphocytic leukemia", "entity_type": "Anatomy", "pos": [28, 56]}, {"entity": "CLL", "entity_type": "Anatomy", "pos": [59, 62]}, {"entity": "leukemia", "entity_type": "Anatomy", "pos": [84, 92]}], "task": "NER"}
+{"text": "Despite several advances in therapeutic options , the disease remains incurable .", "entity": [], "task": "NER"}
+{"text": "Recently , it was repeatedly demonstrated that statins , competitive inhibitors of 3 - hydroxy - 3 - methyl glutaryl coenzyme A ( HMG - CoA ) reductase , have antineoplastic effects .", "entity": [{"entity": "antineoplastic", "entity_type": "Anatomy", "pos": [159, 173]}], "task": "NER"}
+{"text": "Therefore we aimed to study the effects of simvastatin ( Sim ) on malignant B cells derived from patients with CLL and mechanisms of action of the drug .", "entity": [{"entity": "malignant B cells", "entity_type": "Anatomy", "pos": [66, 83]}, {"entity": "CLL", "entity_type": "Anatomy", "pos": [111, 114]}], "task": "NER"}
+{"text": "METHODS AND RESULTS : Purified B - CLL cells from 15 patients were cultured either alone or with Sim at concentrations of 10 , 50 , and 100 microM .", "entity": [{"entity": "B - CLL cells", "entity_type": "Anatomy", "pos": [31, 44]}], "task": "NER"}
+{"text": "Viability , measured by the activity of mitochondrial dehydrogenases , was reduced significantly in the cells treated with Sim at 50 and 100 microM for 24 hours ( p < 0 . 005 ) .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [40, 53]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [104, 109]}], "task": "NER"}
+{"text": "The level of apoptosis , as measured by annexin binding to exposed phosphatidylserine moieties , increased significantly in the treated cells at concentrations higher than 50 microM for 24 hours ( p < 0 . 003 ) .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [136, 141]}], "task": "NER"}
+{"text": "The level of necrosis , as measured by propidium iodide internalization , increased significantly after 24 hours exposure to Sim at 50 microM ( p < 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "The apoptotic cascade was studied by immunoblot analysis of caspases following Sim treatment .", "entity": [], "task": "NER"}
+{"text": "These showed cleavage of caspases 9 , 8 , and 3 .", "entity": [], "task": "NER"}
+{"text": "Addition of the caspase inhibitor Z - VAD . fmk inhibited caspase 8 and 3 significantly but did not affect caspase 9 .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION : Exposure of clonal B lymphocytes from patients with CLL to simvastatin decreases viability significantly by the induction of apoptosis .", "entity": [{"entity": "clonal B lymphocytes", "entity_type": "Anatomy", "pos": [25, 45]}, {"entity": "CLL", "entity_type": "Anatomy", "pos": [65, 68]}], "task": "NER"}
+{"text": "The apoptosis induced by Sim is probably initiated by the mitochondrial caspase 9 , which indirectly leads to activation of caspase 3 and 8 .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [58, 71]}], "task": "NER"}
+{"text": "Neutrophil function in chronic neutrophilic leukemia : defective respiratory burst in response to phorbol esters .", "entity": [{"entity": "Neutrophil", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "chronic neutrophilic leukemia", "entity_type": "Anatomy", "pos": [23, 52]}, {"entity": "respiratory", "entity_type": "Anatomy", "pos": [65, 76]}], "task": "NER"}
+{"text": "Functional analyses were performed on neutrophils isolated from 6 patients from two institutions who displayed features of chronic neutrophilic leukemia ( CNL ) .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [38, 49]}, {"entity": "chronic neutrophilic leukemia", "entity_type": "Anatomy", "pos": [123, 152]}, {"entity": "CNL", "entity_type": "Anatomy", "pos": [155, 158]}], "task": "NER"}
+{"text": "These neutrophils demonstrated a consistent deficiency ( 44 + / - 8 % of control values ) in superoxide anion ( O2 - ) production in response to the phorbol ester , phorbol myristate acetate ( PMA ) .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [6, 17]}], "task": "NER"}
+{"text": "O2 - production in response to chemotactic peptides was near normal ( 82 . 3 + / - 10 . 7 % of control values ) .", "entity": [], "task": "NER"}
+{"text": "Bacterial killing was normal in the two patients studied , and chemotaxis was diminished in response to zymosan - activated plasma and to high concentrations of chemotactic peptides in the patients studied .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [124, 130]}], "task": "NER"}
+{"text": "Cytosolic C kinase activity was decreased in one of the two patients studied .", "entity": [], "task": "NER"}
+{"text": "These results suggest that a deficient O2 - release in response to PMA is a hallmark of neutrophils in CNL and may provide a diagnostic indicator of this condition .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [88, 99]}, {"entity": "CNL", "entity_type": "Anatomy", "pos": [103, 106]}], "task": "NER"}
+{"text": "In situ alkylation of cysteine residues in a hydrophobic membrane protein immobilized on polyvinylidene difluoride membranes by electroblotting prior to microsequence and amino acid analysis .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [57, 65]}], "task": "NER"}
+{"text": "For identification of cysteine residues on microsequence analysis it is crucial to derivatize the sulfhydryl groups .", "entity": [], "task": "NER"}
+{"text": "This reaction requires a desalting step which often represents a major obstacle , especially if the sample consists of limited amounts of a hydrophobic membrane protein .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [152, 160]}], "task": "NER"}
+{"text": "An alkylation procedure is described , allowing efficient derivatization ( greater than 90 % ) of cysteines and cystines even in low microgram quantities , as revealed by test analyses with lysozyme and a hydrophobic membrane protein .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [217, 225]}], "task": "NER"}
+{"text": "The modified protein is recovered in high yields in a form suitable for both microsequence analysis and amino acid analysis .", "entity": [], "task": "NER"}
+{"text": "The method involves electrophoretic desalting by miniaturized Tricine - sodium dodecyl sulfate - polyacrylamide gel electrophoresis and in situ alkylation after electro - transfer onto polyvinylidene difluoride membranes .", "entity": [], "task": "NER"}
+{"text": "Precautions against NH2 - terminal blocking during sample preparations are provided .", "entity": [], "task": "NER"}
+{"text": "The general applicability of the method is illustrated by the structural characterization of the low abundance membrane receptor for human urokinase plasminogen activator .", "entity": [{"entity": "membrane", "entity_type": "Anatomy", "pos": [111, 119]}], "task": "NER"}
+{"text": "The effect of p - chlorophenylalanine on the pethidine - or methadone - induced decrease in locomotor activity of rats .", "entity": [], "task": "NER"}
+{"text": "Either pethidine HCl ( 50 mg / kg s . c . ) or methadone HCl ( 8 mg / kg s . c . ) produced a prominent decrease in locomotor activity of rats .", "entity": [], "task": "NER"}
+{"text": "Pretreatment of rats with p - chlorophenylalanine ( p - CPA , 320 mg / kg i . p . ) 48 h before the narcotic injection significantly antagonized the activity - decreasing effects of narcotics .", "entity": [], "task": "NER"}
+{"text": "When rats pretreated with p - CPA were given 5 - hydroxytryptophan ( 75 mg / kg s . c . ) 30 min before narcotic administration , the activity - decreasing response to narcotics was restored .", "entity": [], "task": "NER"}
+{"text": "Thus , a decrease in locomotor activity induced in rats by either pethidine or methadone is probably mediated by serotonergic mechanisms .", "entity": [], "task": "NER"}
+{"text": "Autocrine angiotensin system regulation of bovine aortic endothelial cell migration and plasminogen activator involves modulation of proto - oncogene pp60c - src expression .", "entity": [{"entity": "aortic endothelial cell", "entity_type": "Anatomy", "pos": [50, 73]}], "task": "NER"}
+{"text": "Rapid endothelial cell migration and inhibition of thrombosis are critical for the resolution of denudation injuries to the vessel wall .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [6, 22]}, {"entity": "vessel wall", "entity_type": "Anatomy", "pos": [124, 135]}], "task": "NER"}
+{"text": "Inhibition of the endothelial cell autocrine angiotensin system , with either the angiotensin - converting enzyme inhibitor lisinopril or the angiotensin II receptor antagonist sar1 , ile8 - angiotensin II , leads to increased endothelial cell migration and urokinase - like plasminogen activator ( u - PA ) activity ( Bell , L . , and J . A . Madri . 1990 . Am . J . Pathol . 137 : 7 - 12 ) .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [18, 34]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [227, 243]}], "task": "NER"}
+{"text": "Inhibition of the autocrine angiotensin system with the converting - enzyme inhibitor or the receptor antagonist also leads to increased expression of the proto - oncogene c - src : pp60c - src mRNA increased 7 - 11 - fold , c - src protein 3 - fold , and c - src kinase activity 2 - 3 - fold .", "entity": [], "task": "NER"}
+{"text": "Endothelial cell expression of c - src was constitutively elevated after stable infection with a retroviral vector containing the c - src coding sequence .", "entity": [{"entity": "Endothelial cell", "entity_type": "Anatomy", "pos": [0, 16]}], "task": "NER"}
+{"text": "Constitutively increased c - src kinase activity reconstituted the increases in migration and u - PA observed with angiotensin system interruption .", "entity": [], "task": "NER"}
+{"text": "Antisera to bovine u - PA blocked the increase in migration associated with increased c - src expression .", "entity": [], "task": "NER"}
+{"text": "These data suggest that increases in endothelial cell migration and plasminogen activator after angiotensin system inhibition are at least partially pp60c - src mediated .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [37, 53]}], "task": "NER"}
+{"text": "Elevated c - src expression with angiotensin system inhibition may act to enhance intimal wound closure and to reduce luminal thrombogenicity in vivo .", "entity": [{"entity": "intimal wound", "entity_type": "Anatomy", "pos": [82, 95]}, {"entity": "luminal", "entity_type": "Anatomy", "pos": [118, 125]}], "task": "NER"}
+{"text": "The presence of nitrite during UVA irradiation protects from apoptosis .", "entity": [], "task": "NER"}
+{"text": "Nitrite occurs ubiquitously in biological fluids such as blood and sweat , representing an oxidation product of nitric oxide .", "entity": [{"entity": "biological fluids", "entity_type": "Anatomy", "pos": [31, 48]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [57, 62]}, {"entity": "sweat", "entity_type": "Anatomy", "pos": [67, 72]}], "task": "NER"}
+{"text": "Nitrite has been associated with a variety of adverse effects such as mutagenicity , carcinogenesis , and toxicity .", "entity": [], "task": "NER"}
+{"text": "In contrast , here we demonstrate that the presence of nitrite , but not nitrate , during irradiation of endothelial cells in culture exerts a potent and concentration - dependent protection against UVA - induced apoptotic cell death .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [105, 122]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [223, 227]}], "task": "NER"}
+{"text": "Protection is half - maximal at a concentration of 3 mM , and complete rescue is observed at 10 mM .", "entity": [], "task": "NER"}
+{"text": "Nitrite - mediated protection is mediated via inhibition of lipid peroxidation in a similar manner as seen with butylated hydroxytoluene , a known inhibitor of lipid peroxidation .", "entity": [], "task": "NER"}
+{"text": "Interestingly , nitrite - mediated protection is completely abolished by coincubation with the NO scavenger cPTIO .", "entity": [], "task": "NER"}
+{"text": "Using electron paramagnetic resonance ( EPR ) spectroscopy or Faraday modulation spectroscopy , we directly prove UVA - induced NO formation in solutions containing nitrite .", "entity": [], "task": "NER"}
+{"text": "In conclusion , evidence is presented that nitrite represents a protective agent against UVA - induced apoptosis due to photodecomposition of nitrite and subsequent formation of NO .", "entity": [], "task": "NER"}
+{"text": "Induction of apoptosis in skeletal tissues : phosphate - mediated chick chondrocyte apoptosis is calcium dependent .", "entity": [{"entity": "skeletal tissues", "entity_type": "Anatomy", "pos": [26, 42]}, {"entity": "chondrocyte", "entity_type": "Anatomy", "pos": [72, 83]}], "task": "NER"}
+{"text": "In an earlier study , we have shown that Pi induced apoptosis of terminally differentiated hypertrophic chondrocytes .", "entity": [{"entity": "chondrocytes", "entity_type": "Anatomy", "pos": [104, 116]}], "task": "NER"}
+{"text": "To ascertain whether Ca2 + modulates Pi - induced cell death , we asked the following two questions : First , can we prevent Pi - induced apoptosis by removing Ca2 + from the culture medium ; alternatively , can we potentiate cell death by increasing the Ca2 + concentration ?", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [50, 54]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [226, 230]}], "task": "NER"}
+{"text": "Second , can we inhibit chondrocyte apoptosis by blocking Pi transport ?", "entity": [{"entity": "chondrocyte", "entity_type": "Anatomy", "pos": [24, 35]}], "task": "NER"}
+{"text": "We also explored the mechanism of apoptosis by evaluating mitochondrial activity and reactive oxygen species ( ROS ) generation in cells treated with the ion pair .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [58, 71]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [131, 136]}], "task": "NER"}
+{"text": "We noted that EDTA and EGTA blocked Pi - induced apoptosis in a dose - dependent manner .", "entity": [], "task": "NER"}
+{"text": "While high levels of Ca2 + alone had little effect on chondrocyte viability , the cation enhanced Pi - dependent cell death and greatly increased Pi uptake .", "entity": [{"entity": "chondrocyte", "entity_type": "Anatomy", "pos": [54, 65]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [113, 117]}], "task": "NER"}
+{"text": "When Pi transport was blocked , there was complete inhibition of cell killing .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [65, 69]}], "task": "NER"}
+{"text": "The process of cell death was characterized by mitochondrial hyperpolarization ; two hours following apoptogen treatment , there was a significant decrease in the mitochondrial membrane potential .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [15, 19]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [47, 60]}, {"entity": "mitochondrial membrane", "entity_type": "Anatomy", "pos": [163, 185]}], "task": "NER"}
+{"text": "Coincident with the changes in mitochondrial function , there was an increase in intracellular Ca2 + that was maintained throughout the experimental period .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [31, 44]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [81, 94]}], "task": "NER"}
+{"text": "A raised Ca2 + signal was observed in blebs at the cell membrane .", "entity": [{"entity": "blebs", "entity_type": "Anatomy", "pos": [38, 43]}, {"entity": "cell membrane", "entity_type": "Anatomy", "pos": [51, 64]}], "task": "NER"}
+{"text": "Finally , we noted that , 75 minutes after treatment with the ion pair , there was a six - fold elevation in ROS levels .", "entity": [], "task": "NER"}
+{"text": "This increase declined to baseline values after three hours .", "entity": [], "task": "NER"}
+{"text": "Based on these observations , we suggest that , at the cartilage mineralization front , an elevation in local environmental Ca2 + and Pi concentrations modulates oxidative metabolism , and triggers apoptosis of terminally differentiated chondrocytes .", "entity": [{"entity": "cartilage", "entity_type": "Anatomy", "pos": [55, 64]}, {"entity": "chondrocytes", "entity_type": "Anatomy", "pos": [237, 249]}], "task": "NER"}
+{"text": "Cell type - specific regulation of angiogenic growth factor gene expression and induction of angiogenesis in nonischemic tissue by a constitutively active form of hypoxia - inducible factor 1 .", "entity": [{"entity": "Cell", "entity_type": "Anatomy", "pos": [0, 4]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [121, 127]}], "task": "NER"}
+{"text": "Understanding molecular mechanisms regulating angiogenesis may lead to novel therapies for ischemic disorders .", "entity": [], "task": "NER"}
+{"text": "Hypoxia - inducible factor 1 ( HIF - 1 ) activates vascular endothelial growth factor ( VEGF ) gene expression in hypoxic / ischemic tissue .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [133, 139]}], "task": "NER"}
+{"text": "In this study we demonstrate that exposure of primary cultures of cardiac and vascular cells to hypoxia or AdCA5 , an adenovirus encoding a constitutively active form of HIF - 1alpha , modulates the expression of genes encoding the angiogenic factors angiopoietin - 1 ( ANGPT1 ) , ANGPT2 , placental growth factor , and platelet - derived growth factor - B .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [54, 62]}, {"entity": "cardiac", "entity_type": "Anatomy", "pos": [66, 73]}, {"entity": "vascular cells", "entity_type": "Anatomy", "pos": [78, 92]}], "task": "NER"}
+{"text": "Loss - of - function effects were also observed in HIF - 1alpha - null embryonic stem cells .", "entity": [{"entity": "HIF - 1alpha - null embryonic stem cells", "entity_type": "Anatomy", "pos": [51, 91]}], "task": "NER"}
+{"text": "Depending on the cell type , expression of ANGPT1 and ANGPT2 was either activated or repressed in response to hypoxia or AdCA5 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [17, 21]}], "task": "NER"}
+{"text": "In all cases , there was complete concordance between the effects of hypoxia and AdCA5 .", "entity": [], "task": "NER"}
+{"text": "Injection of AdCA5 into mouse eyes induced neovascularization in multiple capillary beds , including those not responsive to VEGF alone .", "entity": [{"entity": "eyes", "entity_type": "Anatomy", "pos": [30, 34]}, {"entity": "capillary beds", "entity_type": "Anatomy", "pos": [74, 88]}], "task": "NER"}
+{"text": "Analysis of gene expression revealed increased expression of ANGPT1 , ANGPT2 , platelet - derived growth factor - B , placental growth factor , and VEGF mRNA in AdCA5 - injected eyes .", "entity": [{"entity": "eyes", "entity_type": "Anatomy", "pos": [178, 182]}], "task": "NER"}
+{"text": "These results indicate that HIF - 1 functions as a master regulator of angiogenesis by controlling the expression of multiple angiogenic growth factors and that adenovirus - mediated expression of a constitutively active form of HIF - 1alpha is sufficient to induce angiogenesis in nonischemic tissue of an adult animal .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [294, 300]}], "task": "NER"}
+{"text": "Differential regulation of in vivo angiogenesis by angiotensin II receptors .", "entity": [], "task": "NER"}
+{"text": "Angiotensin II ( ANG II ) , a key regulator of blood pressure and body fluid homeostasis , exerts mitogenic effects on endothelial cells .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [47, 52]}, {"entity": "body fluid", "entity_type": "Anatomy", "pos": [66, 76]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [119, 136]}], "task": "NER"}
+{"text": "We therefore hypothesized that ANG II could be a mediator between homeostatic changes within the vascular perfusion bed and growth factor - driven angiogenesis .", "entity": [{"entity": "vascular perfusion bed", "entity_type": "Anatomy", "pos": [97, 119]}], "task": "NER"}
+{"text": "In the present study , we applied the alginate implant angiogenesis model in mice with normal ANG II levels , elevated ANG II levels by transgenic overexpression of angiotensinogen ( AOGEN ) , or in AT2 receptor - deficient mice .", "entity": [], "task": "NER"}
+{"text": "We demonstrate that a decrease in the amount of circulating ANG II by the angiotensin - converting enzyme ( ACE ) inhibitor enalapril or the AT1 receptor antagonist losartan induced a stimulation of in vivo angiogenesis implying an inhibitory function of ANG II through the AT1 receptor .", "entity": [], "task": "NER"}
+{"text": "However , the strong increase of angiogenesis in AOGEN - transgenic mice compared with mice with normal ANG II levels suggests additional stimulatory activity .", "entity": [], "task": "NER"}
+{"text": "We showed that the ANG II - induced stimulation of angiogenesis is linked to the AT2 receptor as an impaired induction of angiogenesis was obtained in AT2 receptor knockout mice .", "entity": [], "task": "NER"}
+{"text": "These findings provide the first evidence that the AT2 receptor mediates a stimulation of in vivo angiogenesis and indicate that ANG II is a humoral regulator of peripheral angiogenesis involving two receptor subtypes with opposing actions .", "entity": [], "task": "NER"}
+{"text": "Insulin - like growth factor 1 receptor enhances invasion and induces resistance to apoptosis of colon cancer cells through the Akt / Bcl - x ( L ) pathway .", "entity": [{"entity": "colon cancer cells", "entity_type": "Anatomy", "pos": [97, 115]}], "task": "NER"}
+{"text": "Colon cancer overexpresses insulin - like growth factor 1 ( IGF1 ) and insulin - like growth factor 1 receptor ( IGF1 - R ) , as compared with normal or adenomatous mucosa , and it has been postulated that colorectal cancer cells depend on the IGF1 / IGF1 - R pathway for their growth and progression .", "entity": [{"entity": "Colon cancer", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "adenomatous mucosa", "entity_type": "Anatomy", "pos": [153, 171]}, {"entity": "colorectal cancer cells", "entity_type": "Anatomy", "pos": [206, 229]}], "task": "NER"}
+{"text": "In this study , using the human colon cancer cell line HCT116 , we find that established HCT116 / IGF1 - R transfectants exhibit a more aggressive transformed phenotype than the parental cell line , as demonstrated by their higher proliferation rate in response to IGF1 , higher degree of anchorage - independent growth , resistance to serum deprivation - induced apoptosis , and higher migratory capability in a monolayer \" wounding assay . \" When injected into nude mice , HCT116 / IGF1 - R transfectants were highly invasive and produced distant metastases , whereas the parental cell did not .", "entity": [{"entity": "colon cancer cell line HCT116", "entity_type": "Anatomy", "pos": [32, 61]}, {"entity": "HCT116 / IGF1 - R transfectants", "entity_type": "Anatomy", "pos": [89, 120]}, {"entity": "parental cell line", "entity_type": "Anatomy", "pos": [178, 196]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [336, 341]}, {"entity": "monolayer", "entity_type": "Anatomy", "pos": [413, 422]}, {"entity": "HCT116 / IGF1 - R transfectants", "entity_type": "Anatomy", "pos": [475, 506]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [549, 559]}, {"entity": "parental cell", "entity_type": "Anatomy", "pos": [574, 587]}], "task": "NER"}
+{"text": "Moreover , the overexpression of IGF1 - R in these cells was associated with IGF1 - R - induced activation of Akt and up - regulation of the antiapoptotic protein Bcl - x ( L ) .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [51, 56]}], "task": "NER"}
+{"text": "We also show that Akt pathway mediates IGF1 - R - induced Bcl - x ( L ) expression at transcriptional level .", "entity": [], "task": "NER"}
+{"text": "Our data demonstrate , for the first time , that IGF1 - R / Akt / Bcl - x ( L ) pathway may contribute to a more aggressive malignant phenotype , in a subset of colorectal cancers .", "entity": [{"entity": "colorectal cancers", "entity_type": "Anatomy", "pos": [161, 179]}], "task": "NER"}
+{"text": "Expression of EphA2 and E - cadherin in colorectal cancer : correlation with cancer metastasis .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [40, 57]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [77, 83]}], "task": "NER"}
+{"text": "Recently , overexpression of EphA2 , a member of the Eph family of receptor tyrosine kinases , has been reported in several cancers .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [124, 131]}], "task": "NER"}
+{"text": "Reduced expression of E - cadherin , an intercellular adhesion molecule of epithelial cells , has been reported to be associated with aggressive clinicopathological phenotypes in various cancers .", "entity": [{"entity": "intercellular", "entity_type": "Anatomy", "pos": [40, 53]}, {"entity": "epithelial cells", "entity_type": "Anatomy", "pos": [75, 91]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [187, 194]}], "task": "NER"}
+{"text": "In epithelial cells , EphA2 and E - cadherin co - localize to sites of cell - cell contact , and it has been shown that E - cadherin regulates EphA2 .", "entity": [{"entity": "epithelial cells", "entity_type": "Anatomy", "pos": [3, 19]}, {"entity": "cell - cell contact", "entity_type": "Anatomy", "pos": [71, 90]}], "task": "NER"}
+{"text": "This study aimed to clarify the relationship between the expression of the EphA2 and E - cadherin proteins and clinicopathological characteristics , with reference to the expression levels of both EphA2 and E - cadherin , in patients with colorectal cancer .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [239, 256]}], "task": "NER"}
+{"text": "We performed immunohistochemical staining of EphA2 and E - cadherin with EphA2 and E - cadherin monoclonal antibodies in samples from 194 primary lesions of colorectal cancer .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [121, 128]}, {"entity": "primary lesions", "entity_type": "Anatomy", "pos": [138, 153]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [157, 174]}], "task": "NER"}
+{"text": "The expression level of EphA2 had a statistically significant relationship with liver metastasis , lymphatic vessel invasion and clinical stage ( p = 0 . 0477 , 0 . 0316 and 0 . 0467 , respectively ) .", "entity": [{"entity": "liver", "entity_type": "Anatomy", "pos": [80, 85]}, {"entity": "lymphatic vessel", "entity_type": "Anatomy", "pos": [99, 115]}], "task": "NER"}
+{"text": "In addition , the positivity rate of EphA2 was significantly higher in primary lesions with lymph node metastasis than in those without metastasis ( p = 0 . 0014 ) .", "entity": [{"entity": "primary lesions", "entity_type": "Anatomy", "pos": [71, 86]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [92, 102]}], "task": "NER"}
+{"text": "However , the expression level of E - cadherin had an inverse relationship with both differentiation level of the tumor and lymphatic vessel invasion ( p = 0 . 0430 and 0 . 0320 , respectively ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [114, 119]}, {"entity": "lymphatic vessel", "entity_type": "Anatomy", "pos": [124, 140]}], "task": "NER"}
+{"text": "Furthermore , a significant relationship between the expression of EphA2 and E - cadherin was observed .", "entity": [], "task": "NER"}
+{"text": "In conclusion , our study revealed that the overexpression of EphA2 protein in colorectal carcinoma tissue correlates closely with cancer progression and hematogenous and lymphogenous metastasis , suggesting that both EphA2 and E - cadherin may play an important role in tumor metastasis in colorectal cancer .", "entity": [{"entity": "colorectal carcinoma tissue", "entity_type": "Anatomy", "pos": [79, 106]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [131, 137]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [271, 276]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [291, 308]}], "task": "NER"}
+{"text": "Outcomes of cefazolin versus ceftriaxone therapy in treating lower respiratory tract infections in adults .", "entity": [{"entity": "lower respiratory tract", "entity_type": "Anatomy", "pos": [61, 84]}], "task": "NER"}
+{"text": "OBJECTIVE :", "entity": [], "task": "NER"}
+{"text": "To determine whether choice of a first - versus third - generation cephalosporin as initial therapy for lower respiratory tract infections in hospitalized adults affects the course and duration of care , both of which may influence antimicrobial treatment cost .", "entity": [{"entity": "lower respiratory tract", "entity_type": "Anatomy", "pos": [104, 127]}], "task": "NER"}
+{"text": "DESIGN :", "entity": [], "task": "NER"}
+{"text": "Retrospective analysis of discharge abstracts and hospital pharmacy records .", "entity": [], "task": "NER"}
+{"text": "SETTING :", "entity": [], "task": "NER"}
+{"text": "Forty - eight US acute - care hospitals .", "entity": [], "task": "NER"}
+{"text": "PATIENTS :", "entity": [], "task": "NER"}
+{"text": "One thousand ninety - two hospitalized adults ( aged > 17 y ) with principal diagnoses of lower respiratory tract infections ( DRGs 79 - 80 , 89 - 90 ) .", "entity": [{"entity": "lower respiratory tract", "entity_type": "Anatomy", "pos": [90, 113]}], "task": "NER"}
+{"text": "INTERVENTIONS :", "entity": [], "task": "NER"}
+{"text": "Cefazolin or ceftriaxone , given as sole antimicrobial therapy for at least one day .", "entity": [], "task": "NER"}
+{"text": "MAIN OUTCOME MEASURES :", "entity": [], "task": "NER"}
+{"text": "( 1 ) The number of patients who received another parenteral antibiotic anytime prior to hospital discharge ; ( 2 ) the number of days during which patients received any parenteral antibiotic while in the hospital ; and ( 3 ) the number of days patients remained hospitalized following the start of antibiotic therapy .", "entity": [], "task": "NER"}
+{"text": "Patients treated with cefazolin ( n = 763 ) were more likely to receive another parenteral antibiotic while in the hospital ( 30 . 3 vs . 20 . 7 percent ; p < 0 . 001 ) and received more total days of therapy ( 7 . 2 vs . 6 . 7 d ; p < 0 . 05 ) than those treated with ceftriaxone ( n = 329 ) .", "entity": [], "task": "NER"}
+{"text": "Although the time to hospital discharge did not differ in the full sample ( 9 . 2 d for both groups ) , it was greater among those receiving cefazolin ( 8 . 6 vs . 8 . 0 d ; p < 0 . 05 ) when patients with lengths of stay exceeding 24 days were excluded from both groups .", "entity": [], "task": "NER"}
+{"text": "In addition to acquisition cost , differences in course and duration of care should be considered when determining the most cost - effective choice for antimicrobial therapy .", "entity": [], "task": "NER"}
+{"text": "Nuclear translocation of a clusterin isoform is associated with induction of anoikis in SV40 - immortalized human prostate epithelial cells .", "entity": [{"entity": "Nuclear", "entity_type": "Anatomy", "pos": [0, 7]}, {"entity": "prostate epithelial cells", "entity_type": "Anatomy", "pos": [114, 139]}], "task": "NER"}
+{"text": "Clusterin gene expression is potently induced in experimental models in which apoptosis is activated , such as rat prostate involution following castration .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [115, 123]}], "task": "NER"}
+{"text": "Nevertheless , its precise physiological role has not yet been established , and both anti - apoptotic and pro - apoptotic functions have been suggested for this gene .", "entity": [], "task": "NER"}
+{"text": "Clusterin expression level depends on cell proliferation state , and we recently showed that its over - expression inhibited cell cycle progression of SV40 - immortalized human prostate epithelial cells PNT2 and PNT1a .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [38, 42]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [125, 129]}, {"entity": "prostate epithelial cells PNT2", "entity_type": "Anatomy", "pos": [177, 207]}, {"entity": "PNT1a", "entity_type": "Anatomy", "pos": [212, 217]}], "task": "NER"}
+{"text": "Here we studied clusterin expression in PNT1a cells subjected to serum - starvation with the aim of defining clusterin early molecular changes following apoptosis induction .", "entity": [{"entity": "PNT1a cells", "entity_type": "Anatomy", "pos": [40, 51]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [65, 70]}], "task": "NER"}
+{"text": "Under serum - starvation conditions , decreased growth rate , slow rounding - up of cells , cell detachment , and formation of apoptotic bodies indicative of anoikis ( detachment - induced apoptosis ) were preceded by significant downregulation of 70 kDa clusterin precursor and upregulation of 45 - 40 kDa isoforms .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [6, 11]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [84, 89]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [92, 96]}, {"entity": "apoptotic bodies", "entity_type": "Anatomy", "pos": [127, 143]}], "task": "NER"}
+{"text": "On the 8th day of serum - free culturing , only the higher molecular weight protein - band of about 45 kDa was clearly induced and accumulated in detached cells and apoptotic bodies in which PARP was activated .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [18, 23]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [155, 160]}, {"entity": "apoptotic bodies", "entity_type": "Anatomy", "pos": [165, 181]}], "task": "NER"}
+{"text": "Anoikis was preceded by induction and transloction of a 45 - kDa clusterin isoform to the nucleus .", "entity": [{"entity": "nucleus", "entity_type": "Anatomy", "pos": [90, 97]}], "task": "NER"}
+{"text": "Thus , nuclear targeting of a specific 45 - kDa isoform of clusterin appeared to be an early and specific molecular signal triggering anoikis - death .", "entity": [{"entity": "nuclear", "entity_type": "Anatomy", "pos": [7, 14]}], "task": "NER"}
+{"text": "Considering also that clusterin is downregulated during prostate cancer onset and progression , and that its upregulation has inhibited DNA synthesis and cell cycle progression of immortalized human prostate epithelial cells , we suggest that clusterin might be a new anti - oncogene in the prostate .", "entity": [{"entity": "prostate cancer", "entity_type": "Anatomy", "pos": [56, 71]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [154, 158]}, {"entity": "prostate epithelial cells", "entity_type": "Anatomy", "pos": [199, 224]}, {"entity": "prostate", "entity_type": "Anatomy", "pos": [291, 299]}], "task": "NER"}
+{"text": "Levels of expression of CYR61 and CTGF are prognostic for tumor progression and survival of individuals with gliomas .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [58, 63]}, {"entity": "gliomas", "entity_type": "Anatomy", "pos": [109, 116]}], "task": "NER"}
+{"text": "The biological properties of CCN proteins include stimulation of cell proliferation , migration , and adhesion , as well as angiogenesis and tumorigenesis .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [65, 69]}], "task": "NER"}
+{"text": "We quantified CYR61 , CTGF , WISP - 1 , and NOV mRNA expression levels in samples from sixty - six primary gliomas and five normal brain samples using quantitative real - time PCR assay .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [74, 81]}, {"entity": "primary gliomas", "entity_type": "Anatomy", "pos": [99, 114]}, {"entity": "brain samples", "entity_type": "Anatomy", "pos": [131, 144]}], "task": "NER"}
+{"text": "Statistical analysis was performed to explore the links between expression of the CCN genes and clinical and pathological parameters .", "entity": [], "task": "NER"}
+{"text": "Overexpression of CYR61 , CTGF , WISP - 1 , and NOV occurred in 48 % ( 32 of 66 ) , 58 % ( 38 of 66 ) , 36 % ( 24 of 66 ) , and 15 % ( 10 of 66 ) of primary gliomas , respectively .", "entity": [{"entity": "primary gliomas", "entity_type": "Anatomy", "pos": [149, 164]}], "task": "NER"}
+{"text": "Interestingly , significant associations were found between CYR61 expression versus tumor grade , pathology , gender , and age at diagnosis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [84, 89]}], "task": "NER"}
+{"text": "Also , a significant correlation existed between CTGF mRNA levels versus tumor grade , gender , and pathology .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [73, 78]}], "task": "NER"}
+{"text": "In contrast to CYR61 and CTGF , no significant association was found between expression of either WISP - 1 or NOV versus any of the pathological features .", "entity": [], "task": "NER"}
+{"text": "Furthermore , Cox regression analysis showed that CYR61 and CTGF expression had a significant correlation with patient survival .", "entity": [], "task": "NER"}
+{"text": "These results suggest that CYR61 and CTGF may play a role in the progression of gliomas ; their levels at diagnosis may have prognostic significance ; and these proteins might serve as valuable targets for therapeutic intervention .", "entity": [{"entity": "gliomas", "entity_type": "Anatomy", "pos": [80, 87]}], "task": "NER"}
+{"text": "Targeting wide - range oncogenic transformation via PU24FCl , a specific inhibitor of tumor Hsp90 .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [86, 91]}], "task": "NER"}
+{"text": "Agents that inhibit Hsp90 function hold significant promise in cancer therapy .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [63, 69]}], "task": "NER"}
+{"text": "Here we present PU24FCl , a representative of the first class of designed Hsp90 inhibitors .", "entity": [], "task": "NER"}
+{"text": "By specifically and potently inhibiting tumor Hsp90 , PU24FCl exhibits wide - ranging anti - cancer activities that occur at similar doses in all tested tumor types .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [40, 45]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [93, 99]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [153, 158]}], "task": "NER"}
+{"text": "Normal cells are 10 - to 50 - fold more resistant to these effects .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [7, 12]}], "task": "NER"}
+{"text": "Its Hsp90 inhibition results in multiple anti - tumor - specific effects , such as degradation of Hsp90 - client proteins involved in cell growth , survival , and specific transformation , inhibition of cancer cell growth , delay of cell cycle progression , induction of morphological and functional changes , and apoptosis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [48, 53]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [134, 138]}, {"entity": "cancer cell", "entity_type": "Anatomy", "pos": [203, 214]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [233, 237]}], "task": "NER"}
+{"text": "In concordance with its higher affinity for tumor Hsp90 , in vivo PU24FCl accumulates in tumors while being rapidly cleared from normal tissue .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [44, 49]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [89, 95]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [136, 142]}], "task": "NER"}
+{"text": "Concentrations achieved in vivo in tumors lead to single - agent anti - tumor activity at non - toxic doses .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [35, 41]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [72, 77]}], "task": "NER"}
+{"text": "Differential proteomic analysis of human hepatocellular carcinoma cell line metastasis - associated proteins .", "entity": [{"entity": "hepatocellular carcinoma cell line", "entity_type": "Anatomy", "pos": [41, 75]}], "task": "NER"}
+{"text": "PURPOSE : The comparative study of differentially expression of protein profiles of hepatocellular carcinoma cell lines with various metastasic potential and screening key molecules related to hepatocellular carcinoma metastasis and recurrence .", "entity": [{"entity": "hepatocellular carcinoma cell lines", "entity_type": "Anatomy", "pos": [84, 119]}, {"entity": "hepatocellular carcinoma", "entity_type": "Anatomy", "pos": [193, 217]}], "task": "NER"}
+{"text": "METHODS : Using two - dimensional electrophoresis and liquid chromatography - electrospray ionization - tandem mass spectrometry ( LC - ESI - MS / MS ) , we analyzed differentially displayed proteomics of human hepatocellular carcinoma cell lines Hep3B , MHCC97L , MHCC97H with different metastasic potential .", "entity": [{"entity": "hepatocellular carcinoma cell lines Hep3B", "entity_type": "Anatomy", "pos": [211, 252]}, {"entity": "MHCC97L", "entity_type": "Anatomy", "pos": [255, 262]}, {"entity": "MHCC97H", "entity_type": "Anatomy", "pos": [265, 272]}], "task": "NER"}
+{"text": "RESULTS : Approximate 1 , 000 protein spots were detected on silver - stained gel by ImageMaster ( 977 + / - 113 spots in Hep3B , 1092 + / - 40 in MHCC97L , and 889 + / - 14 in MHCC97H ) .", "entity": [{"entity": "Hep3B", "entity_type": "Anatomy", "pos": [122, 127]}, {"entity": "MHCC97L", "entity_type": "Anatomy", "pos": [147, 154]}, {"entity": "MHCC97H", "entity_type": "Anatomy", "pos": [177, 184]}], "task": "NER"}
+{"text": "Fifty distinct different protein spots were analyzed with online LC - ESI - MS / MS .", "entity": [], "task": "NER"}
+{"text": "Only 26 protein spots had a positive result , including annexin1 , S100A4 , and so on .", "entity": [], "task": "NER"}
+{"text": "In comparison with nonmetastasis Hep3B cell lines , there were 16 proteins overexpressed in MHCC97H and MHCC97L , 10 proteins underexpressed in MHCC97H and MHCC97L .", "entity": [{"entity": "Hep3B cell lines", "entity_type": "Anatomy", "pos": [33, 49]}, {"entity": "MHCC97H", "entity_type": "Anatomy", "pos": [92, 99]}, {"entity": "MHCC97L", "entity_type": "Anatomy", "pos": [104, 111]}, {"entity": "MHCC97H", "entity_type": "Anatomy", "pos": [144, 151]}, {"entity": "MHCC97L", "entity_type": "Anatomy", "pos": [156, 163]}], "task": "NER"}
+{"text": "Applying cell immunohistochemistry and RT - PCR , we further validated two interesting and different proteins , annexin1 and S100A4 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [9, 13]}], "task": "NER"}
+{"text": "CONCLUSION : The protein profile of metastatic hepatocellular carcinoma cell lines displayed obvious differences compared with non - metastatic liver cancer cell lines .", "entity": [{"entity": "metastatic hepatocellular carcinoma cell lines", "entity_type": "Anatomy", "pos": [36, 82]}, {"entity": "non - metastatic liver cancer cell lines", "entity_type": "Anatomy", "pos": [127, 167]}], "task": "NER"}
+{"text": "The results imply that various different proteins may lead to HCC metastasis together .", "entity": [{"entity": "HCC", "entity_type": "Anatomy", "pos": [62, 65]}], "task": "NER"}
+{"text": "Clinical implication of expression of cyclooxygenase - 2 and peroxisome proliferator activated - receptor gamma in epithelial ovarian tumours .", "entity": [{"entity": "epithelial ovarian tumours", "entity_type": "Anatomy", "pos": [115, 141]}], "task": "NER"}
+{"text": "Expression of cyclooxygenase ( COX ) - 2 plays a key role in tumorigenesis and development and peroxisome proliferator - activated receptor gamma ( PPARgamma ) has been implicated in the control of COX - 2 expression in some tissues .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [225, 232]}], "task": "NER"}
+{"text": "The aim of this study is to investigate ( 1 ) whether expression of COX - 2 and PPARgamma is associated with ovarian carcinogenesis and progression of ovarian tumours and ( 2 ) whether COX - 2 expression is controlled through ligand - mediated activation of PPARgamma in ovarian carcinoma cells .", "entity": [{"entity": "ovarian", "entity_type": "Anatomy", "pos": [109, 116]}, {"entity": "ovarian tumours", "entity_type": "Anatomy", "pos": [151, 166]}, {"entity": "ovarian carcinoma cells", "entity_type": "Anatomy", "pos": [271, 294]}], "task": "NER"}
+{"text": "For this purpose , the presence of COX - 2 and PPARgamma was immunohistochemically examined in 71 epithelial ovarian carcinomas , 18 borderline tumours and 23 benign tumours and the levels of COX - 2 and PPARgamma proteins were determined by enzyme immunoassay in four benign tumours , three borderline tumours and 12 carcinomas .", "entity": [{"entity": "epithelial ovarian carcinomas", "entity_type": "Anatomy", "pos": [98, 127]}, {"entity": "borderline tumours", "entity_type": "Anatomy", "pos": [133, 151]}, {"entity": "benign tumours", "entity_type": "Anatomy", "pos": [159, 173]}, {"entity": "benign tumours", "entity_type": "Anatomy", "pos": [269, 283]}, {"entity": "borderline tumours", "entity_type": "Anatomy", "pos": [292, 310]}, {"entity": "carcinomas", "entity_type": "Anatomy", "pos": [318, 328]}], "task": "NER"}
+{"text": "The frequency of COX - 2 and PPARgamma detection was significantly increased and decreased as lesions progressed to carcinoma , respectively .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [94, 101]}, {"entity": "carcinoma", "entity_type": "Anatomy", "pos": [116, 125]}], "task": "NER"}
+{"text": "The COX - 2 protein was not detected in the three borderline tumours , whereas PPARgamma protein was detected in all of them .", "entity": [{"entity": "borderline tumours", "entity_type": "Anatomy", "pos": [50, 68]}], "task": "NER"}
+{"text": "COX - 2 protein was detected in eight of the 12 carcinomas , whereas PPARgamma protein was detected in only two cases .", "entity": [{"entity": "carcinomas", "entity_type": "Anatomy", "pos": [48, 58]}], "task": "NER"}
+{"text": "In addition , PPARgamma protein was not detected in all of the eight carcinomas in which COX - 2 protein was detected , suggesting that expression of PPARgamma and COX - 2 was in a reciprocal relationship .", "entity": [{"entity": "carcinomas", "entity_type": "Anatomy", "pos": [69, 79]}], "task": "NER"}
+{"text": "Furthermore , in cultured ovarian carcinoma cells , Western blot revealed that PPARgamma and COX - 2 expression was regulated conversely as a result of stimulation by 15 - deoxy - Delta ( 12 , 14 ) PGJ ( 2 ) ( 15 - PGJ ( 2 ) ) , a PPARgamma activator .", "entity": [{"entity": "ovarian carcinoma cells", "entity_type": "Anatomy", "pos": [26, 49]}], "task": "NER"}
+{"text": "In addition , 15d - PGJ ( 2 ) suppressed tumour necrosis factor - alpha - induced - COX - 2 expression , confirming the reciprocal correlation between COX - 2 and PPARgamma .", "entity": [], "task": "NER"}
+{"text": "From these results , it was suggested that PPARgamma activation might suppress COX - 2 expression via the nuclear factor - kappaB pathway in the ovarian carcinoma cells and that low expression of PPARgamma and high expression of COX - 2 might be involved in carcinogenesis and progression of ovarian tumours .", "entity": [{"entity": "ovarian carcinoma cells", "entity_type": "Anatomy", "pos": [145, 168]}, {"entity": "ovarian tumours", "entity_type": "Anatomy", "pos": [292, 307]}], "task": "NER"}
+{"text": "Is there an upper limit of intracranial pressure in patients with severe head injury if cerebral perfusion pressure is maintained ?", "entity": [{"entity": "intracranial", "entity_type": "Anatomy", "pos": [27, 39]}, {"entity": "head", "entity_type": "Anatomy", "pos": [73, 77]}, {"entity": "cerebral", "entity_type": "Anatomy", "pos": [88, 96]}], "task": "NER"}
+{"text": "Authors of recent studies have championed the importance of maintaining cerebral perfusion pressure ( CPP ) to prevent secondary brain injury following traumatic head injury .", "entity": [{"entity": "cerebral", "entity_type": "Anatomy", "pos": [72, 80]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [129, 134]}, {"entity": "head", "entity_type": "Anatomy", "pos": [162, 166]}], "task": "NER"}
+{"text": "Data from these studies have provided little information regarding outcome following severe head injury in patients with an intracranial pressure ( ICP ) greater than 40 mm Hg , however , in July 1997 the authors instituted a protocol for the management of severe head injury in patients with a Glasgow Coma Scale score lower than 9 .", "entity": [{"entity": "head", "entity_type": "Anatomy", "pos": [92, 96]}, {"entity": "intracranial", "entity_type": "Anatomy", "pos": [124, 136]}, {"entity": "head", "entity_type": "Anatomy", "pos": [264, 268]}], "task": "NER"}
+{"text": "The protocol was focused on resuscitation from acidosis , maintenance of a CPP greater than 60 mm Hg through whatever means necessary as well as elevation of the head of the bed , mannitol infusion , and ventriculostomy with cerebrospinal fluid drainage for control of ICP .", "entity": [{"entity": "cerebrospinal fluid", "entity_type": "Anatomy", "pos": [225, 244]}], "task": "NER"}
+{"text": "Since the institution of this protocol , nine patients had a sustained ICP greater than 40 mm Hg for 2 or more hours , and five of these had an ICP greater than 75 mm Hg on insertion of the ICP monitor and later experienced herniation and expired within 24 hours .", "entity": [], "task": "NER"}
+{"text": "Because of the severe nature of the injuries demonstrated on computerized tomography scans and their physical examinations , these patients were not aggressively treated under this protocol .", "entity": [], "task": "NER"}
+{"text": "The authors vigorously attempted to maintain a CPP greater than 60 mm Hg with intensive fluid resuscitation and the administration of pressor agents in the four remaining patients who had developed an ICP higher than 40 mm Hg after placement of the ICP monitor .", "entity": [{"entity": "fluid", "entity_type": "Anatomy", "pos": [88, 93]}], "task": "NER"}
+{"text": "Two patients had an episodic ICP greater than 40 mm Hg for more than 36 hours , the third patient had an episodic ICP greater than of 50 mm Hg for more than 36 hours , and the fourth patient had an episodic ICP greater than 50 mm Hg for more than 48 hours .", "entity": [], "task": "NER"}
+{"text": "On discharge , all four patients were able to perform normal activities of daily living with minimal assistance and experience ongoing improvement .", "entity": [], "task": "NER"}
+{"text": "Data from this preliminary study indicate that intense , aggressive management of CPP can lead to good neurological outcomes despite extremely high ICP .", "entity": [{"entity": "neurological", "entity_type": "Anatomy", "pos": [103, 115]}], "task": "NER"}
+{"text": "Aggressive CPP therapy should be performed and maintained even though apparently lethal ICP levels may be present .", "entity": [], "task": "NER"}
+{"text": "Further study is needed to support these encouraging results .", "entity": [], "task": "NER"}
+{"text": "Newly recognized syndrome with heminasal aplasia and ocular anomalies or wider spectrum of heminasal aplasia / atypical clefting syndrome ?", "entity": [{"entity": "ocular", "entity_type": "Anatomy", "pos": [53, 59]}], "task": "NER"}
+{"text": "We report on five unrelated Brazilian patients with heminasal aplasia associated with diverses anomalies , including lateral proboscis , and anomalies of the eye and first branchial arch .", "entity": [{"entity": "eye", "entity_type": "Anatomy", "pos": [158, 161]}, {"entity": "branchial arch", "entity_type": "Anatomy", "pos": [172, 186]}], "task": "NER"}
+{"text": "We suggest that these patients represent different conditions within the spectrum of the heminasal aplasia malformation .", "entity": [], "task": "NER"}
+{"text": "Clinical , genetic , and differential diagnosis are discussed .", "entity": [], "task": "NER"}
+{"text": "Role of osteopontin in adhesion , migration , cell survival and bone remodeling .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [46, 50]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [64, 68]}], "task": "NER"}
+{"text": "Osteopontin ( OPN ) is a secreted adhesive glycophosphoprotein expressed by several cell types .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [84, 88]}], "task": "NER"}
+{"text": "It is normally produced in bone , teeth , kidney and epithelial lining tissues and is found in plasma and breast milk .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [27, 31]}, {"entity": "teeth", "entity_type": "Anatomy", "pos": [34, 39]}, {"entity": "kidney", "entity_type": "Anatomy", "pos": [42, 48]}, {"entity": "epithelial lining tissues", "entity_type": "Anatomy", "pos": [53, 78]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [95, 101]}, {"entity": "breast milk", "entity_type": "Anatomy", "pos": [106, 117]}], "task": "NER"}
+{"text": "It is involved in a number of physiologic and pathologic events including angiogenesis , apoptosis , inflammation , wound healing and tumor metastasis .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [116, 121]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [134, 139]}], "task": "NER"}
+{"text": "In this review focus will be on OPN in bone and its role in adhesion , migration and cell survival .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [39, 43]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [85, 89]}], "task": "NER"}
+{"text": "These aspects of OPN biology are important in tumorigenesis .", "entity": [], "task": "NER"}
+{"text": "Neurologic diagnosis and treatment in patients with computed tomography and nasal endoscopy negative facial pain .", "entity": [{"entity": "Neurologic", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "nasal", "entity_type": "Anatomy", "pos": [76, 81]}, {"entity": "facial", "entity_type": "Anatomy", "pos": [101, 107]}], "task": "NER"}
+{"text": "To determine the helpfulness of specialist neurology referral for patients with facial pain , a normal sinus computed tomography ( CT ) scan , and normal nasal endoscopy findings .", "entity": [{"entity": "facial", "entity_type": "Anatomy", "pos": [80, 86]}, {"entity": "sinus", "entity_type": "Anatomy", "pos": [103, 108]}, {"entity": "nasal", "entity_type": "Anatomy", "pos": [154, 159]}], "task": "NER"}
+{"text": "STUDY DESIGN :", "entity": [], "task": "NER"}
+{"text": "Prospective identification of patients and analysis of data approved by the Institutional Review Board .", "entity": [], "task": "NER"}
+{"text": "METHODS :", "entity": [], "task": "NER"}
+{"text": "The data of 104 consecutive patients presenting with facial pain , a normal sinus CT scan , and normal nasal endoscopy findings were reviewed .", "entity": [{"entity": "facial", "entity_type": "Anatomy", "pos": [53, 59]}, {"entity": "sinus", "entity_type": "Anatomy", "pos": [76, 81]}, {"entity": "nasal", "entity_type": "Anatomy", "pos": [103, 108]}], "task": "NER"}
+{"text": "The patients presented to a single rhinologist in a tertiary care institution .", "entity": [], "task": "NER"}
+{"text": "All patients were referred for specialist neurologic evaluation and potential treatment .", "entity": [{"entity": "neurologic", "entity_type": "Anatomy", "pos": [42, 52]}], "task": "NER"}
+{"text": "Further information was obtained from a patient survey .", "entity": [], "task": "NER"}
+{"text": "Of the 104 patients , 81 were women and 23 were men .", "entity": [], "task": "NER"}
+{"text": "The average age was 46 years ( range , 22 - 85 ) .", "entity": [], "task": "NER"}
+{"text": "Fifty - six had clear CT scans , 48 had minimal change , and all had negative endoscopies .", "entity": [], "task": "NER"}
+{"text": "Twenty - nine had previous unsuccessful sinus surgery .", "entity": [{"entity": "sinus", "entity_type": "Anatomy", "pos": [40, 45]}], "task": "NER"}
+{"text": "The average follow - up period was 10 . 5 months .", "entity": [], "task": "NER"}
+{"text": "Forty of 75 patients seeing a neurologist were seen on multiple occasions .", "entity": [], "task": "NER"}
+{"text": "Four percent of patients seen by a neurologist had an unsuspected serious intracranial diagnosis .", "entity": [{"entity": "intracranial", "entity_type": "Anatomy", "pos": [74, 86]}], "task": "NER"}
+{"text": "The most common diagnoses were migraine ( 37 % ) , rebound headache ( 17 % ) , chronic daily headache ( 17 % ) , and obstructive sleep apnea ( 16 % ) .", "entity": [], "task": "NER"}
+{"text": "Overall , 58 % improved on medical therapy ; 60 % of those with a clear CT scan improved , and 53 % of those with minimal change on CT scan improved ( P = . 749 ) .", "entity": [], "task": "NER"}
+{"text": "Facial pain remains a difficult symptom to diagnose and treat in rhinologic practice .", "entity": [{"entity": "Facial", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Patients often undergo surgery without help .", "entity": [], "task": "NER"}
+{"text": "Most patients with facial pain , a normal sinus CT scan , and normal endoscopy findings benefit from neurologic consultation .", "entity": [{"entity": "facial", "entity_type": "Anatomy", "pos": [19, 25]}, {"entity": "sinus", "entity_type": "Anatomy", "pos": [42, 47]}, {"entity": "neurologic", "entity_type": "Anatomy", "pos": [101, 111]}], "task": "NER"}
+{"text": "Serious intracranial pathologic conditions can be excluded and diagnosis - specific pharmacogenetic therapy instituted with improvement in more than 50 % .", "entity": [{"entity": "intracranial", "entity_type": "Anatomy", "pos": [8, 20]}], "task": "NER"}
+{"text": "Oxidation in rheumatoid arthritis .", "entity": [], "task": "NER"}
+{"text": "Oxygen metabolism has an important role in the pathogenesis of rheumatoid arthritis .", "entity": [], "task": "NER"}
+{"text": "Reactive oxygen species ( ROS ) produced in the course of cellular oxidative phosphorylation , and by activated phagocytic cells during oxidative bursts , exceed the physiological buffering capacity and result in oxidative stress .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [58, 66]}, {"entity": "phagocytic cells", "entity_type": "Anatomy", "pos": [112, 128]}], "task": "NER"}
+{"text": "The excessive production of ROS can damage protein , lipids , nucleic acids , and matrix components .", "entity": [{"entity": "matrix components", "entity_type": "Anatomy", "pos": [82, 99]}], "task": "NER"}
+{"text": "They also serve as important intracellular signaling molecules that amplify the synovial inflammatory - proliferative response .", "entity": [{"entity": "intracellular", "entity_type": "Anatomy", "pos": [29, 42]}, {"entity": "synovial", "entity_type": "Anatomy", "pos": [80, 88]}], "task": "NER"}
+{"text": "Repetitive cycles of hypoxia and reoxygenation associated with changes in synovial perfusion are postulated to activate hypoxia - inducible factor - 1alpha and nuclear factor - kappaB , two key transcription factors that are regulated by changes in cellular oxygenation and cytokine stimulation , and that in turn orchestrate the expression of a spectrum of genes critical to the persistence of synovitis .", "entity": [{"entity": "synovial", "entity_type": "Anatomy", "pos": [74, 82]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [249, 257]}], "task": "NER"}
+{"text": "An understanding of the complex interactions involved in these pathways might allow the development of novel therapeutic strategies for rheumatoid arthritis .", "entity": [], "task": "NER"}
+{"text": "Glucocorticoid receptor - induced MAPK phosphatase - 1 ( MPK - 1 ) expression inhibits paclitaxel - associated MAPK activation and contributes to breast cancer cell survival .", "entity": [{"entity": "breast cancer cell", "entity_type": "Anatomy", "pos": [146, 164]}], "task": "NER"}
+{"text": "Glucocorticoid receptor ( GR ) activation has recently been shown to inhibit apoptosis in breast epithelial cells .", "entity": [{"entity": "breast epithelial cells", "entity_type": "Anatomy", "pos": [90, 113]}], "task": "NER"}
+{"text": "We have previously described a group of genes that is rapidly up - regulated in these cells following dexamethasone ( Dex ) treatment .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [86, 91]}], "task": "NER"}
+{"text": "In an effort to dissect the mechanisms of GR - mediated breast epithelial cell survival , we now examine the molecular events downstream of GR activation .", "entity": [{"entity": "breast epithelial cell", "entity_type": "Anatomy", "pos": [56, 78]}], "task": "NER"}
+{"text": "Here we show that GR activation leads to both the rapid induction of MAPK phosphatase - 1 ( MKP - 1 ) mRNA and its sustained expression .", "entity": [], "task": "NER"}
+{"text": "Induction of the MKP - 1 protein in the MCF10A - Myc and MDA - MB - 231 breast epithelial cell lines was also seen .", "entity": [{"entity": "MCF10A - Myc", "entity_type": "Anatomy", "pos": [40, 52]}, {"entity": "MDA - MB - 231 breast epithelial cell lines", "entity_type": "Anatomy", "pos": [57, 100]}], "task": "NER"}
+{"text": "Paclitaxel treatment resulted in MAPK activation and apoptosis of MDA - MB - 231 breast cancer cells , and both processes were inhibited by Dex pretreatment .", "entity": [{"entity": "MDA - MB - 231 breast cancer cells", "entity_type": "Anatomy", "pos": [66, 100]}], "task": "NER"}
+{"text": "Furthermore , induction of MKP - 1 correlated with the inhibition of extracellular signal - regulated kinase ( ERK1 / 2 ) and c - Jun N - terminal kinase ( JNK ) activity , whereas p38 activity was minimally affected .", "entity": [], "task": "NER"}
+{"text": "Blocking Dex - induced MKP - 1 induction using small interfering RNA increased ERK1 / 2 and JNK phosphorylation and decreased cell survival .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [126, 130]}], "task": "NER"}
+{"text": "ERK1 / 2 and JNK inactivation was associated with Ets - like transcription factor - 1 ( ELK - 1 ) dephosphorylation .", "entity": [], "task": "NER"}
+{"text": "To explore the gene expression changes that occur downstream of ELK - 1 dephosphorylation , we used a combination of temporal gene expression data and promoter element analyses .", "entity": [], "task": "NER"}
+{"text": "This approach revealed a previously unrecognized transcriptional target of ELK - 1 , the human tissue plasminogen activator ( tPA ) .", "entity": [], "task": "NER"}
+{"text": "We verified the predicted ELK - 1 - - > tPA transcriptional regulatory relationship using a luciferase reporter assay .", "entity": [], "task": "NER"}
+{"text": "We conclude that GR - mediated MAPK inactivation contributes to cell survival and that the potential transcriptional targets of this inhibition can be identified from large scale gene array analysis .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [64, 68]}], "task": "NER"}
+{"text": "TBX21 : a functional variant predicts improvement in asthma with the use of inhaled corticosteroids .", "entity": [], "task": "NER"}
+{"text": "TBX21 encodes for the transcription factor T - bet ( T - box expressed in T cells ) , which influences naive T lymphocyte development and has been implicated in asthma pathogenesis .", "entity": [{"entity": "T cells", "entity_type": "Anatomy", "pos": [74, 81]}, {"entity": "T lymphocyte", "entity_type": "Anatomy", "pos": [109, 121]}], "task": "NER"}
+{"text": "Specifically , the T - bet knockout mouse spontaneously develops airway hyperresponsiveness and other changes consistent with asthma .", "entity": [{"entity": "airway", "entity_type": "Anatomy", "pos": [65, 71]}], "task": "NER"}
+{"text": "Because airway responsiveness is moderated by the use of inhaled corticosteroids in asthma , it is conceivable that genetic variation in TBX21 may alter asthma phenotypes in a treatment - specific fashion .", "entity": [{"entity": "airway", "entity_type": "Anatomy", "pos": [8, 14]}], "task": "NER"}
+{"text": "Here we demonstrate that the nonsynonymous variation in TBX21 coding for replacement of histidine 33 with glutamine is associated with significant improvement in the PC ( 20 ) ( a measure of airway responsiveness ) of asthmatic children in a large clinical trial spanning 4 years .", "entity": [{"entity": "airway", "entity_type": "Anatomy", "pos": [191, 197]}], "task": "NER"}
+{"text": "We note that this increase occurs only in the children randomized to inhaled corticosteroids and that it dramatically enhances the overall improvement in PC ( 20 ) associated with inhaled corticosteroid usage .", "entity": [], "task": "NER"}
+{"text": "The average PC ( 20 ) at trial end for subjects on inhaled corticosteroids possessing a variant allele was in the normal range for nonasthmatics .", "entity": [], "task": "NER"}
+{"text": "In cellular models , we show that the TBX21 variant increases T helper 1 and decreases T helper 2 cytokine expression comparably with wild type .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [3, 11]}, {"entity": "T helper 1", "entity_type": "Anatomy", "pos": [62, 72]}, {"entity": "T helper 2", "entity_type": "Anatomy", "pos": [87, 97]}], "task": "NER"}
+{"text": "TBX21 may thus be an important determinant pharmacogenetic response to the therapy of asthma with inhaled corticosteroids .", "entity": [], "task": "NER"}
+{"text": "Investigating the causes of low birth weight in contrasting ovine paradigms .", "entity": [], "task": "NER"}
+{"text": "Intrauterine growth restriction ( IUGR ) still accounts for a large incidence of infant mortality and morbidity worldwide .", "entity": [], "task": "NER"}
+{"text": "Many of the circulatory and transport properties of the sheep placenta are similar to those of the human placenta and as such , the pregnant sheep offers an excellent model in which to study the development of IUGR .", "entity": [{"entity": "placenta", "entity_type": "Anatomy", "pos": [62, 70]}, {"entity": "placenta", "entity_type": "Anatomy", "pos": [105, 113]}], "task": "NER"}
+{"text": "Two natural models of ovine IUGR are those of hyperthermic exposure during pregnancy , and adolescent overfeeding , also during pregnancy .", "entity": [], "task": "NER"}
+{"text": "Both models yield significantly reduced placental weights and an asymmetrically growth - restricted fetus , and display altered maternal hormone concentrations , indicative of an impaired trophoblast capacity .", "entity": [{"entity": "placental", "entity_type": "Anatomy", "pos": [40, 49]}, {"entity": "fetus", "entity_type": "Anatomy", "pos": [100, 105]}, {"entity": "trophoblast", "entity_type": "Anatomy", "pos": [188, 199]}], "task": "NER"}
+{"text": "Additionally , impaired placental angiogenesis and uteroplacental blood flow appears to be an early defect in both the hyperthermic and adolescent paradigms .", "entity": [{"entity": "placental", "entity_type": "Anatomy", "pos": [24, 33]}, {"entity": "uteroplacental blood", "entity_type": "Anatomy", "pos": [51, 71]}], "task": "NER"}
+{"text": "The effects of these alterations in placental functional development appear to be irreversible .", "entity": [{"entity": "placental", "entity_type": "Anatomy", "pos": [36, 45]}], "task": "NER"}
+{"text": "IUGR fetuses are both hypoxic and hypoglycaemic , and have reduced insulin and insulin - like growth factor - 1 ( IGF - 1 ) , and elevated concentrations of lactate .", "entity": [{"entity": "fetuses", "entity_type": "Anatomy", "pos": [5, 12]}], "task": "NER"}
+{"text": "However , fetal utilization of oxygen and glucose , on a weight basis , remain constant compared with control pregnancies .", "entity": [{"entity": "fetal", "entity_type": "Anatomy", "pos": [10, 15]}], "task": "NER"}
+{"text": "Maintained utilization of these substrates , in a substrate - deficient environment , suggests increased sensitivities to metabolic signals , which may play a role in the development of metabolic diseases in later adult life .", "entity": [], "task": "NER"}
+{"text": "p53 mutation heterogeneity in cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [30, 36]}], "task": "NER"}
+{"text": "The p53 gene is inactivated in about 50 % of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [51, 58]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [112, 116]}], "task": "NER"}
+{"text": "It is therefore highly likely that these alterations are an important component in tumor resistance to therapy .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [83, 88]}], "task": "NER"}
+{"text": "The particular characteristics of these alterations , 80 % of which are missense mutations leading to functionally heterogeneous proteins , make p53 a unique gene in the class of tumor suppressor genes .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [179, 184]}], "task": "NER"}
+{"text": "A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [126, 130]}], "task": "NER"}
+{"text": "The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia .", "entity": [{"entity": "neoplasia", "entity_type": "Anatomy", "pos": [197, 206]}], "task": "NER"}
+{"text": "Sox9 neural crest determinant gene controls patterning and closure of the posterior frontal cranial suture .", "entity": [{"entity": "neural crest", "entity_type": "Anatomy", "pos": [5, 17]}, {"entity": "posterior frontal cranial suture", "entity_type": "Anatomy", "pos": [74, 106]}], "task": "NER"}
+{"text": "Cranial suture development involves a complex interaction of genes and tissues derived from neural crest cells ( NCC ) and paraxial mesoderm .", "entity": [{"entity": "Cranial suture", "entity_type": "Anatomy", "pos": [0, 14]}, {"entity": "tissues", "entity_type": "Anatomy", "pos": [71, 78]}, {"entity": "neural crest cells", "entity_type": "Anatomy", "pos": [92, 110]}, {"entity": "NCC", "entity_type": "Anatomy", "pos": [113, 116]}, {"entity": "paraxial mesoderm", "entity_type": "Anatomy", "pos": [123, 140]}], "task": "NER"}
+{"text": "In mice , the posterior frontal ( PF ) suture closes during the first month of life while other sutures remain patent throughout the life of the animal .", "entity": [{"entity": "posterior frontal ( PF ) suture", "entity_type": "Anatomy", "pos": [14, 45]}, {"entity": "sutures", "entity_type": "Anatomy", "pos": [96, 103]}], "task": "NER"}
+{"text": "Given the unique NCC origin of PF suture complex ( analogous to metopic suture in humans ) , we performed quantitative real - time PCR and immunohistochemistry to study the expression pattern of the NCC determinant gene Sox9 and select markers of extracellular matrix .", "entity": [{"entity": "NCC", "entity_type": "Anatomy", "pos": [17, 20]}, {"entity": "PF suture", "entity_type": "Anatomy", "pos": [31, 40]}, {"entity": "metopic suture", "entity_type": "Anatomy", "pos": [64, 78]}, {"entity": "NCC", "entity_type": "Anatomy", "pos": [199, 202]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [247, 267]}], "task": "NER"}
+{"text": "Our results indicated a unique up - regulated expression of Sox9 , a regulator of chondrogenesis , during initiation of PF suture closure , along with the expression of specific cartilage markers ( Type II Collagen and Type X Collagen ) , as well as cartilage tissue formation in the PF suture .", "entity": [{"entity": "PF suture", "entity_type": "Anatomy", "pos": [120, 129]}, {"entity": "cartilage", "entity_type": "Anatomy", "pos": [178, 187]}, {"entity": "cartilage tissue", "entity_type": "Anatomy", "pos": [250, 266]}, {"entity": "PF suture", "entity_type": "Anatomy", "pos": [284, 293]}], "task": "NER"}
+{"text": "This process was followed by expression of bone markers ( Type I Collagen and Osteocalcin ) , suggesting endochondral ossification .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [43, 47]}], "task": "NER"}
+{"text": "Moreover , we studied the effect of haploinsufficiency of the NCC determinant gene Sox9 in the NCC derived PF suture complex .", "entity": [{"entity": "NCC", "entity_type": "Anatomy", "pos": [62, 65]}, {"entity": "NCC", "entity_type": "Anatomy", "pos": [95, 98]}, {"entity": "PF suture", "entity_type": "Anatomy", "pos": [107, 116]}], "task": "NER"}
+{"text": "A decrease in dosage of Sox9 by haploinsufficiency in NCC - derived tissues resulted in delayed PF suture closure .", "entity": [{"entity": "NCC - derived tissues", "entity_type": "Anatomy", "pos": [54, 75]}, {"entity": "PF suture", "entity_type": "Anatomy", "pos": [96, 105]}], "task": "NER"}
+{"text": "These results demonstrate a unique development of the PF suture complex and the role of Sox9 as an important contributor to timely and proper closure of the PF suture through endochondral ossification .", "entity": [{"entity": "PF suture", "entity_type": "Anatomy", "pos": [54, 63]}, {"entity": "PF suture", "entity_type": "Anatomy", "pos": [157, 166]}], "task": "NER"}
+{"text": "Randomized , open label , prospective study on the effect of zoledronic acid on the prevention of bone metastases in patients with recurrent solid tumors that did not present with bone metastases at baseline .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [98, 113]}, {"entity": "solid tumors", "entity_type": "Anatomy", "pos": [141, 153]}, {"entity": "bone metastases", "entity_type": "Anatomy", "pos": [180, 195]}], "task": "NER"}
+{"text": "OBJECTIVES : Bisphosphonates have been used successfully in the treatment of hypercalcemia and to reduce skeletal - related complications of bone metastases .", "entity": [{"entity": "skeletal", "entity_type": "Anatomy", "pos": [105, 113]}, {"entity": "bone metastases", "entity_type": "Anatomy", "pos": [141, 156]}], "task": "NER"}
+{"text": "Recent in vitro and in vivo evidence suggest that they may also have direct antitumor effects via induction of apoptosis , inhibition of the invasive potential of tumor cell lines in vitro , inhibition of angiogenesis , and reduction in tumor growth indirectly via effects on accessory cells .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [76, 85]}, {"entity": "tumor cell lines", "entity_type": "Anatomy", "pos": [163, 179]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [237, 242]}, {"entity": "accessory cells", "entity_type": "Anatomy", "pos": [276, 291]}], "task": "NER"}
+{"text": "This is a randomized , open label , prospective study that examined the effect of preventive zoledronic acid treatment on the development of bone metastases in patients with recurrent solid tumors , without bone metastases at the time of randomization .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [141, 156]}, {"entity": "solid tumors", "entity_type": "Anatomy", "pos": [184, 196]}, {"entity": "bone metastases", "entity_type": "Anatomy", "pos": [207, 222]}], "task": "NER"}
+{"text": "METHODS : Forty patients with recurrent or metastatic advanced cancer , without bone metastases , were randomized into the trial to either receive zoledronic acid or no treatment .", "entity": [{"entity": "metastatic advanced cancer", "entity_type": "Anatomy", "pos": [43, 69]}, {"entity": "bone metastases", "entity_type": "Anatomy", "pos": [80, 95]}], "task": "NER"}
+{"text": "Patients were followed up until bone metastases were established .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [32, 47]}], "task": "NER"}
+{"text": "RESULTS : The percentage of patients being bone metastases free at 12 mo was 60 % in the zoledronic acid and 10 % in the control group ( p less than 0 . 0005 ) , while the percentages at 18 mo were 20 % and 5 % respectively ( p = 0 . 0002 ) .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [43, 58]}], "task": "NER"}
+{"text": "CONCLUSIONS : The results have shown that bisphosphonates as adjuvant treatment might be useful for the prevention of bone metastases ; however , there is need for blinded randomized data before such an approach would be confirmed .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [118, 133]}], "task": "NER"}
+{"text": "In the meantime preventive use of bisphosphonates in patients without any bone metastases should not be used outside the scope of a clinical trial .", "entity": [{"entity": "bone metastases", "entity_type": "Anatomy", "pos": [74, 89]}], "task": "NER"}
+{"text": "Experimental investigation of equibiaxial extension and breakup of drops in a molten two - phase polymer blend .", "entity": [], "task": "NER"}
+{"text": "We experimentally investigate the breakup of an equibiaxially elongated polystyrene ( PS ) drop in a poly ( methyl methacrylate ) ( PMMA ) matrix during relaxation after melt elongation .", "entity": [], "task": "NER"}
+{"text": "In equibiaxial elongation , the initially spherical PS drop is deformed into an ellipsoidal disclike shape for our test parameters .", "entity": [], "task": "NER"}
+{"text": "Using a hotstage in combination with a light microscope , we observe the evolution of the drop shape during relaxation .", "entity": [], "task": "NER"}
+{"text": "In the initial stage of relaxation , fingers and holes are formed .", "entity": [], "task": "NER"}
+{"text": "The holes are located preferentially near the rim of the drop .", "entity": [], "task": "NER"}
+{"text": "The number and the size of the holes increase with time such that the elongated PS drop attains a complex shape during relaxation .", "entity": [], "task": "NER"}
+{"text": "The fingers form bulbous ends which separate from the fingers .", "entity": [], "task": "NER"}
+{"text": "We discuss the dynamics of this breakup process by taking into account the interfacial energy between PS and PMMA .", "entity": [], "task": "NER"}
+{"text": "Our analysis shows that a very large number of small PS droplets can be generated by the sequential breakup of the elongated PS drop .", "entity": [], "task": "NER"}
+{"text": "Management of extremity trauma and related infections occurring in the aquatic environment .", "entity": [], "task": "NER"}
+{"text": "Wounds sustained in oceans , lakes , and streams are exposed to a milieu of bacteria rarely encountered in typical land - based injuries .", "entity": [{"entity": "Wounds", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "These include Vibrio species , Aeromonas hydrophila , Pseudomonas and Plesiomonas species , Erysipelothrix rhusiopathiae , Mycobacterium marinum , and other microbes .", "entity": [], "task": "NER"}
+{"text": "Failure to recognize and treat these less common pathogens in a timely manner may result in significant morbidity or death .", "entity": [], "task": "NER"}
+{"text": "Initial antibiotic therapy should address common gram - positive and gram - negative aquatic bacteria , depending on the environment .", "entity": [], "task": "NER"}
+{"text": "Trauma occurring in brackish or salt water should be treated with doxycycline and ceftazidime , or a fluoroquinolone ( eg , ciprofloxacin or levofloxacin ) .", "entity": [], "task": "NER"}
+{"text": "Freshwater wounds should be managed with ciprofloxacin , levofloxacin , or a third - or fourth - generation cephalosporin ( eg , ceftazidime ) .", "entity": [{"entity": "wounds", "entity_type": "Anatomy", "pos": [11, 17]}], "task": "NER"}
+{"text": "Injuries sustained in a marine or freshwater environment may result from bites or venomous stings of aquatic organisms as well as from accidental trauma .", "entity": [], "task": "NER"}
+{"text": "Musculoskeletal trauma caused by venomous underwater species ( eg , stingrays , stinging fish , sea urchins , and coral ) requires immediate neutralization of the heat - labile toxin with immersion in nonscalding water for 30 to 90 minutes .", "entity": [{"entity": "Musculoskeletal trauma", "entity_type": "Anatomy", "pos": [0, 22]}], "task": "NER"}
+{"text": "Appropriate management of aquatic wounds requires recognition of the mechanism of injury , neutralization of venom , antibiotic administration , radiographic assessment , surgical debridement with irrigation , wound cultures , and structural repair or amputation as indicated by the severity of the injury .", "entity": [{"entity": "wounds", "entity_type": "Anatomy", "pos": [34, 40]}, {"entity": "venom", "entity_type": "Anatomy", "pos": [109, 114]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [210, 215]}], "task": "NER"}
+{"text": "Impaired coronary collateral vessel development in patients with proliferative diabetic retinopathy .", "entity": [{"entity": "coronary collateral vessel", "entity_type": "Anatomy", "pos": [9, 35]}], "task": "NER"}
+{"text": "BACKGROUND : Diabetic patients have been reported to have impaired coronary collateral vessel growth , although they have excessive neovascularization in the retina .", "entity": [{"entity": "coronary collateral vessel", "entity_type": "Anatomy", "pos": [67, 93]}, {"entity": "retina", "entity_type": "Anatomy", "pos": [158, 164]}], "task": "NER"}
+{"text": "HYPOTHESIS : This study was designed to compare coronary collateral circulation ( CCC ) in patients with proliferative diabetic retinopathy ( PDR ) with that in patients without DR .", "entity": [{"entity": "coronary collateral", "entity_type": "Anatomy", "pos": [48, 67]}], "task": "NER"}
+{"text": "METHODS : Ninety diabetic patients with chronic total occlusion in at least one major epicardial coronary artery were enrolled in the study .", "entity": [{"entity": "epicardial coronary artery", "entity_type": "Anatomy", "pos": [86, 112]}], "task": "NER"}
+{"text": "Groups 1 and 2 consisted of 48 patients without DR and 42 patients with PDR , respectively .", "entity": [], "task": "NER"}
+{"text": "Coronary collateral circulation ( CCC ) was analyzed according to the Rentrop system .", "entity": [{"entity": "Coronary collateral", "entity_type": "Anatomy", "pos": [0, 19]}], "task": "NER"}
+{"text": "Each group was also divided into two subgroups according to poor and good CCC .", "entity": [], "task": "NER"}
+{"text": "Serum vascular endothelial growth factor ( VEGF ) levels were measured using the enzyme - linked immunosorbent assay ( ELISA ) kit .", "entity": [{"entity": "Serum", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "RESULTS : The mean Rentrop collateral score was higher in Group 1 than in Group 2 ( 2 . 39 + / - 1 . 07 vs . 1 . 76 + / - 0 . 76 , respectively , p less than 0 . 001 ) .", "entity": [], "task": "NER"}
+{"text": "When the two groups were compared with respect to poor and good CCC , poor CCC was higher in patients with PDR ( 64 vs . 36 % , respectively , p = 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "Serum VEGF levels were higher in patients with PDR than in those without DR ( 219 + / - 99 vs . 139 + / - 98 pg / ml , p less than 0 . 001 ) ; however , patients with poor and good CCC had similar VEGF levels .", "entity": [{"entity": "Serum", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "CONCLUSIONS : We have shown that patients with PDR have a lower coronary collateral score than patients without DR .", "entity": [{"entity": "coronary collateral", "entity_type": "Anatomy", "pos": [64, 83]}], "task": "NER"}
+{"text": "Also , serum VEGF was significantly higher in patients with PDR than in those without DR .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [7, 12]}], "task": "NER"}
+{"text": "These findings have suggested that diabetes mellitus may have a different action on retinal and coronary circulation .", "entity": [{"entity": "retinal", "entity_type": "Anatomy", "pos": [84, 91]}, {"entity": "coronary", "entity_type": "Anatomy", "pos": [96, 104]}], "task": "NER"}
+{"text": "VEGFR1 - positive haematopoietic bone marrow progenitors initiate the pre - metastatic niche .", "entity": [{"entity": "VEGFR1 - positive haematopoietic bone marrow progenitors", "entity_type": "Anatomy", "pos": [0, 56]}], "task": "NER"}
+{"text": "The cellular and molecular mechanisms by which a tumour cell undergoes metastasis to a predetermined location are largely unknown .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [4, 12]}, {"entity": "tumour cell", "entity_type": "Anatomy", "pos": [49, 60]}], "task": "NER"}
+{"text": "Here we demonstrate that bone marrow - derived haematopoietic progenitor cells that express vascular endothelial growth factor receptor 1 ( VEGFR1 ; also known as Flt1 ) home to tumour - specific pre - metastatic sites and form cellular clusters before the arrival of tumour cells .", "entity": [{"entity": "bone marrow - derived haematopoietic progenitor cells", "entity_type": "Anatomy", "pos": [25, 78]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [178, 184]}, {"entity": "pre - metastatic sites", "entity_type": "Anatomy", "pos": [196, 218]}, {"entity": "cellular clusters", "entity_type": "Anatomy", "pos": [228, 245]}, {"entity": "tumour cells", "entity_type": "Anatomy", "pos": [268, 280]}], "task": "NER"}
+{"text": "Preventing VEGFR1 function using antibodies or by the removal of VEGFR1 ( + ) cells from the bone marrow of wild - type mice abrogates the formation of these pre - metastatic clusters and prevents tumour metastasis , whereas reconstitution with selected Id3 ( inhibitor of differentiation 3 ) - competent VEGFR1 + cells establishes cluster formation and tumour metastasis in Id3 knockout mice .", "entity": [{"entity": "VEGFR1 ( + ) cells", "entity_type": "Anatomy", "pos": [65, 83]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [93, 104]}, {"entity": "pre - metastatic clusters", "entity_type": "Anatomy", "pos": [158, 183]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [197, 203]}, {"entity": "VEGFR1 + cells", "entity_type": "Anatomy", "pos": [305, 319]}, {"entity": "cluster", "entity_type": "Anatomy", "pos": [332, 339]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [354, 360]}], "task": "NER"}
+{"text": "We also show that VEGFR1 + cells express VLA - 4 ( also known as integrin alpha4beta1 ) , and that tumour - specific growth factors upregulate fibronectin - - a VLA - 4 ligand - - in resident fibroblasts , providing a permissive niche for incoming tumour cells .", "entity": [{"entity": "VEGFR1 + cells", "entity_type": "Anatomy", "pos": [18, 32]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [99, 105]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [192, 203]}, {"entity": "tumour cells", "entity_type": "Anatomy", "pos": [248, 260]}], "task": "NER"}
+{"text": "Conditioned media obtained from distinct tumour types with unique patterns of metastatic spread redirected fibronectin expression and cluster formation , thereby transforming the metastatic profile .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [41, 47]}, {"entity": "cluster", "entity_type": "Anatomy", "pos": [134, 141]}], "task": "NER"}
+{"text": "These findings demonstrate a requirement for VEGFR1 + haematopoietic progenitors in the regulation of metastasis , and suggest that expression patterns of fibronectin and VEGFR1 + VLA - 4 + clusters dictate organ - specific tumour spread .", "entity": [{"entity": "VEGFR1 + haematopoietic progenitors", "entity_type": "Anatomy", "pos": [45, 80]}, {"entity": "VEGFR1 + VLA - 4 + clusters", "entity_type": "Anatomy", "pos": [171, 198]}, {"entity": "organ", "entity_type": "Anatomy", "pos": [207, 212]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [224, 230]}], "task": "NER"}
+{"text": "The Kaposi ' s sarcoma - associated herpesvirus G protein - coupled receptor as a therapeutic target for the treatment of Kaposi ' s sarcoma .", "entity": [{"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [4, 22]}], "task": "NER"}
+{"text": "The Kaposi ' s sarcoma - associated herpesvirus ( KSHV ) encodes a G protein - coupled receptor ( vGPCR ) that has been implicated in the initiation of Kaposi ' s sarcoma , identifying vGPCR as an attractive target for preventing Kaposi ' s sarcoma .", "entity": [{"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [4, 22]}, {"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [152, 170]}], "task": "NER"}
+{"text": "However , as only a fraction of cells in advanced Kaposi ' s sarcoma lesions express vGPCR , it is unclear whether this unique viral oncogene contributes to Kaposi ' s sarcoma progression .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [32, 37]}, {"entity": "Kaposi ' s sarcoma lesions", "entity_type": "Anatomy", "pos": [50, 76]}, {"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [157, 175]}], "task": "NER"}
+{"text": "We therefore set out to determine whether the few cells that express vGPCR in established tumors represent an appropriate therapeutic target for the treatment of patients with preexisting Kaposi ' s sarcoma .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [50, 55]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [90, 96]}, {"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [188, 206]}], "task": "NER"}
+{"text": "To this end , we generated endothelial cell lines stably expressing vGPCR or key KSHV latently expressed proteins ( vCyclin , vFlip , and LANA1 ) .", "entity": [{"entity": "endothelial cell lines", "entity_type": "Anatomy", "pos": [27, 49]}], "task": "NER"}
+{"text": "The endothelial cell line expressing vGPCR was rendered sensitive to treatment with the nucleoside analogue ganciclovir by using a bicistronic construct coexpressing the herpes simplex virus 1 thymidine kinase .", "entity": [{"entity": "endothelial cell line", "entity_type": "Anatomy", "pos": [4, 25]}], "task": "NER"}
+{"text": "S . c . injection into nude mice with mixed - cell populations formed tumors that approximate the ratio of vGPCR - expressing and KSHV latent gene - expressing cells .", "entity": [{"entity": "mixed - cell populations", "entity_type": "Anatomy", "pos": [38, 62]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [70, 76]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [160, 165]}], "task": "NER"}
+{"text": "These mice were then treated with ganciclovir to specifically target only the vGPCR - expressing cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [97, 102]}], "task": "NER"}
+{"text": "Surprisingly , despite the expression of KSHV latent genes in the vast majority of tumor cells , specifically targeting only the few vGPCR - expressing cells in established tumors resulted in tumor regression .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [83, 94]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [152, 157]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [173, 179]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [192, 197]}], "task": "NER"}
+{"text": "Moreover , we observed an increase in apoptosis of latent gene - expressing cells after the pharmacologic deletion of the vGPCR - expressing cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [76, 81]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [141, 146]}], "task": "NER"}
+{"text": "These findings indicate that vGPCR may play a key role in Kaposi ' s sarcoma progression and provide experimental justification for developing molecular - based therapies specifically targeting vGPCR and its effectors for the treatment of Kaposi ' s sarcoma patients .", "entity": [{"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [58, 76]}, {"entity": "Kaposi ' s sarcoma", "entity_type": "Anatomy", "pos": [239, 257]}], "task": "NER"}
+{"text": "Mechanisms of pericyte recruitment in tumour angiogenesis : a new role for metalloproteinases .", "entity": [{"entity": "pericyte", "entity_type": "Anatomy", "pos": [14, 22]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [38, 44]}], "task": "NER"}
+{"text": "Pericytes occur in tumour blood vessels and are critical for the development of a functional vascular network .", "entity": [{"entity": "Pericytes", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "tumour blood vessels", "entity_type": "Anatomy", "pos": [19, 39]}, {"entity": "vascular network", "entity_type": "Anatomy", "pos": [93, 109]}], "task": "NER"}
+{"text": "Targeting tumour pericytes is a promising anti - angiogenic therapy but requires identifying the mechanisms of their recruitment in tumour and addressing whether these mechanisms can be selectively harnessed .", "entity": [{"entity": "tumour pericytes", "entity_type": "Anatomy", "pos": [10, 26]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [132, 138]}], "task": "NER"}
+{"text": "Among the pathways involved in pericyte recruitment during embryonic development , the contribution of platelet - derived growth factor B and sphingosine 1 - phosphate is confirmed in tumour angiogenesis .", "entity": [{"entity": "pericyte", "entity_type": "Anatomy", "pos": [31, 39]}, {"entity": "embryonic", "entity_type": "Anatomy", "pos": [59, 68]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [184, 190]}], "task": "NER"}
+{"text": "The effect of angiopoietin 1 depends on the tumour model .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [44, 50]}], "task": "NER"}
+{"text": "Transforming growth factor - beta1 enhances tumour vascularization and microvessel maturation .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [44, 50]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [71, 82]}], "task": "NER"}
+{"text": "Recent reports suggest a participation of matrix metalloproteinases ( MMP ) in tumour pericyte recruitment that is consistent with the effect of certain MMPs in the development of microvasculature in embryonic development and in in vitro models of vascular remodelling .", "entity": [{"entity": "tumour pericyte", "entity_type": "Anatomy", "pos": [79, 94]}, {"entity": "microvasculature", "entity_type": "Anatomy", "pos": [180, 196]}, {"entity": "embryonic", "entity_type": "Anatomy", "pos": [200, 209]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [248, 256]}], "task": "NER"}
+{"text": "Here , we discuss the possibility for MMPs to contribute to pericyte recruitment at six levels : ( 1 ) direct promotion of pericyte invasion by extracellular matrix degradation ; ( 2 ) stimulation of pericyte proliferation and protection against apoptosis by modification of the ECM ; ( 3 ) activation of pericytes through the release of growth factor bound to the ECM ; ( 4 ) transactivation of angiogenic cell surface receptor ; ( 5 ) propagation of angiogenic signalling as cofactor ; and ( 6 ) recruitment of bone marrow - derived stem cells .", "entity": [{"entity": "pericyte", "entity_type": "Anatomy", "pos": [60, 68]}, {"entity": "pericyte", "entity_type": "Anatomy", "pos": [123, 131]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [144, 164]}, {"entity": "pericyte", "entity_type": "Anatomy", "pos": [200, 208]}, {"entity": "ECM", "entity_type": "Anatomy", "pos": [279, 282]}, {"entity": "pericytes", "entity_type": "Anatomy", "pos": [305, 314]}, {"entity": "ECM", "entity_type": "Anatomy", "pos": [365, 368]}, {"entity": "cell surface", "entity_type": "Anatomy", "pos": [407, 419]}, {"entity": "bone marrow - derived stem cells", "entity_type": "Anatomy", "pos": [513, 545]}], "task": "NER"}
+{"text": "Involvement of de novo ceramide synthesis in radiocontrast - induced renal tubular cell injury .", "entity": [{"entity": "renal tubular cell", "entity_type": "Anatomy", "pos": [69, 87]}], "task": "NER"}
+{"text": "We reported previously that various radiocontrast media cause apoptosis in porcine proximal tubular ( LLC - PK ( 1 ) ) cells , in which reduction in B - cell lymphoma ( Bcl ) - 2 expression and caspase - 3 activation are implicated .", "entity": [{"entity": "proximal tubular ( LLC - PK ( 1 ) ) cells", "entity_type": "Anatomy", "pos": [83, 124]}], "task": "NER"}
+{"text": "In the present study , we investigated a role for ceramide in radiocontrast media - induced apoptosis in renal tubular cells .", "entity": [{"entity": "renal tubular cells", "entity_type": "Anatomy", "pos": [105, 124]}], "task": "NER"}
+{"text": "LLC - PK ( 1 ) cells were exposed to radiocontrast media for 30 min , followed by incubation for 24 h in normal medium .", "entity": [{"entity": "LLC - PK ( 1 ) cells", "entity_type": "Anatomy", "pos": [0, 20]}], "task": "NER"}
+{"text": "Cell viability was assessed by 2 - ( 2 - methoxy - 4 - nitrophenyl ) - 3 - ( 4 - nitrophenyl ) - 5 - ( 2 , 4 - disulfophenyl ) - 2H - tetrazolium monosodium salt assay , while apoptosis was determined by terminal deoxynucleotidyl transferase - mediated dUTP nick end labeling stain .", "entity": [{"entity": "Cell", "entity_type": "Anatomy", "pos": [0, 4]}], "task": "NER"}
+{"text": "Immunofluorescent stains were performed using antibodies against phosphorylated Akt ( pAkt ) and cAMP response element binding protein ( CREB ) ( pCREB ) , and ceramide .", "entity": [], "task": "NER"}
+{"text": "The mRNA expression and protein content of Bcl - 2 were determined by reverse transcriptase - polymerase chain reaction and enzyme immunoassay , respectively .", "entity": [], "task": "NER"}
+{"text": "In vivo model of contrast - induced renal injury was induced in mice with unilateral renal occlusion .", "entity": [{"entity": "renal", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "renal", "entity_type": "Anatomy", "pos": [85, 90]}], "task": "NER"}
+{"text": "The cell injury induced by the nonionic radiocontrast medium ioversol was reversed by inhibiting de novo ceramide synthesis with fumonisin B ( 1 ) ( FB ( 1 ) ) and L - cycloserine , but not by suppressing sphingomyelin breakdown with D609 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [4, 8]}], "task": "NER"}
+{"text": "FB ( 1 ) reversed ioversol - induced decrease in the immunoreactivities of pAkt and pCREB , reduction in Bcl - 2 expression and caspase - 3 activation .", "entity": [], "task": "NER"}
+{"text": "Like ioversol , C2 ceramide and the Akt inhibitor Src homology - 6 induced apoptosis by reducing pAkt and pCREB - like immunoreactivities , lowering Bcl - 2 expression and enhancing caspase - 3 activity .", "entity": [], "task": "NER"}
+{"text": "Indeed , various radiocontrast media , excluding iodixanol which showed the least nephrotoxicity , enhanced ceramide - like immunoreactivity .", "entity": [], "task": "NER"}
+{"text": "The role for de novo ceramide synthesis was also shown in the in vivo model of radiocontrast nephropathy .", "entity": [], "task": "NER"}
+{"text": "We demonstrated here for the first time that the enhancement of de novo ceramide synthesis contributes to radiocontrast nephropathy .", "entity": [], "task": "NER"}
+{"text": "Sensitization to gimatecan - induced apoptosis by tumor necrosis factor - related apoptosis inducing ligand in prostate carcinoma cells .", "entity": [{"entity": "prostate carcinoma cells", "entity_type": "Anatomy", "pos": [111, 135]}], "task": "NER"}
+{"text": "Since the intrinsic resistance of prostate carcinoma likely reflects a low susceptibility to drug - induced apoptosis , in this study we explored the possibility of sensitizing prostate carcinoma cells to apoptosis by combination of TRAIL with camptothecins .", "entity": [{"entity": "prostate carcinoma", "entity_type": "Anatomy", "pos": [34, 52]}, {"entity": "prostate carcinoma cells", "entity_type": "Anatomy", "pos": [177, 201]}], "task": "NER"}
+{"text": "Indeed , these agents are known to activate different pathways of apoptosis .", "entity": [], "task": "NER"}
+{"text": "Topotecan - and gimatecan induced moderate up - regulation of TRAIL - R1 and - R2 which resulted in a different cell response to the combination in androgen - independent cells ( DU - 145 and PC - 3 ) .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [112, 116]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [171, 176]}, {"entity": "DU - 145", "entity_type": "Anatomy", "pos": [179, 187]}, {"entity": "PC - 3", "entity_type": "Anatomy", "pos": [192, 198]}], "task": "NER"}
+{"text": "In DU - 145 cells apoptosis was increased by lower TRAIL concentrations and was earlier than in PC - 3 cells , as shown using Annexin V - binding assay .", "entity": [{"entity": "DU - 145 cells", "entity_type": "Anatomy", "pos": [3, 17]}, {"entity": "PC - 3 cells", "entity_type": "Anatomy", "pos": [96, 108]}], "task": "NER"}
+{"text": "The relative resistance of PC - 3 cells to drug - induced apoptosis was associated with constitutive Akt activation , higher levels of cFLIP - L and Bcl - 2 , and lower levels of Bax .", "entity": [{"entity": "PC - 3 cells", "entity_type": "Anatomy", "pos": [27, 39]}], "task": "NER"}
+{"text": "The different expression / activation of apoptosis - related factors appears to influence the sensitization of prostate carcinoma cells by TRAIL .", "entity": [{"entity": "prostate carcinoma cells", "entity_type": "Anatomy", "pos": [111, 135]}], "task": "NER"}
+{"text": "Potentiation of camptothecin - induced apoptosis by TRAIL appears dependent on cooperation between extrinsic and intrinsic pathways , as documented by loss of the sensitization to apoptosis following reduction of caspase 8 after small interfering RNA transfection .", "entity": [], "task": "NER"}
+{"text": "The efficacy of the approach may be critically dependent on the intrinsic susceptibility to apoptosis of different tumors .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [115, 121]}], "task": "NER"}
+{"text": "These observations support that the activation of multiple signals could enhance apoptotic response and suggest the therapeutic interest of the TRAIL / camptothecin combination .", "entity": [], "task": "NER"}
+{"text": "c - Met expression is regulated by Mitf in the melanocyte lineage .", "entity": [{"entity": "melanocyte lineage", "entity_type": "Anatomy", "pos": [47, 65]}], "task": "NER"}
+{"text": "Hepatocyte growth factor ( HGF ) / c - Met signaling is thought to be a key pathway in both melanocyte development and melanoma metastasis .", "entity": [{"entity": "melanocyte", "entity_type": "Anatomy", "pos": [92, 102]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [119, 127]}], "task": "NER"}
+{"text": "Here , HGF stimulation of melanocytes was seen to up - regulate c - Met expression .", "entity": [{"entity": "melanocytes", "entity_type": "Anatomy", "pos": [26, 37]}], "task": "NER"}
+{"text": "In an effort to decipher the mechanism by which HGF up - regulates its receptor , we found that c - Met is a direct transcriptional target of Mitf .", "entity": [], "task": "NER"}
+{"text": "This was confirmed with chromatin immunoprecipitation experiments of the human c - Met promoter , as well as by the ability of adenovirally expressed Mitf to modulate endogenous c - Met protein levels in melanocytes .", "entity": [{"entity": "chromatin", "entity_type": "Anatomy", "pos": [24, 33]}, {"entity": "melanocytes", "entity_type": "Anatomy", "pos": [204, 215]}], "task": "NER"}
+{"text": "Disruption of Mitf blocked HGF - dependent increases in endogenous c - Met message and protein levels , indicating that HGF regulates its own receptor levels via Mitf .", "entity": [], "task": "NER"}
+{"text": "Finally , dominant - negative inhibition of Mitf resulted in profound resistance of melanocytes and melanoma cells to HGF - dependent matrix invasion , suggesting a physiologic role for this pathway in melanocytic development and melanoma .", "entity": [{"entity": "melanocytes", "entity_type": "Anatomy", "pos": [84, 95]}, {"entity": "melanoma cells", "entity_type": "Anatomy", "pos": [100, 114]}, {"entity": "matrix", "entity_type": "Anatomy", "pos": [134, 140]}, {"entity": "melanocytic", "entity_type": "Anatomy", "pos": [202, 213]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [230, 238]}], "task": "NER"}
+{"text": "Targeting PIM kinases impairs survival of hematopoietic cells transformed by kinase inhibitor - sensitive and kinase inhibitor - resistant forms of Fms - like tyrosine kinase 3 and BCR / ABL .", "entity": [{"entity": "hematopoietic cells", "entity_type": "Anatomy", "pos": [42, 61]}], "task": "NER"}
+{"text": "Previous studies have shown that activation of the signal transducer and activator of transcription 5 ( STAT5 ) plays an essential role in leukemogenesis mediated through constitutive activated protein tyrosine kinases ( PTK ) .", "entity": [], "task": "NER"}
+{"text": "Because PIM - 1 is a STAT5 target gene , we analyzed the role of the family of PIM serine / threonine kinases ( PIM - 1 to PIM - 3 ) in PTK - mediated transformation of hematopoietic cells .", "entity": [{"entity": "hematopoietic cells", "entity_type": "Anatomy", "pos": [169, 188]}], "task": "NER"}
+{"text": "Ba / F3 cells transformed to growth factor independence by various oncogenic PTKs ( TEL / JAK2 , TEL / TRKC , TEL / ABL , BCR / ABL , FLT3 - ITD , and H4 / PDGFbetaR ) show abundant expression of PIM - 1 and PIM - 2 .", "entity": [{"entity": "Ba / F3 cells", "entity_type": "Anatomy", "pos": [0, 13]}], "task": "NER"}
+{"text": "Suppression of PIM - 1 activity had a negligible effect on transformation .", "entity": [], "task": "NER"}
+{"text": "In contrast , expression of kinase - dead PIM - 2 mutant ( PIM - 2KD ) led to a rapid decline of survival in Ba / F3 cells transformed by FLT3 - ITD but not by other oncogenic PTKs tested .", "entity": [{"entity": "Ba / F3 cells", "entity_type": "Anatomy", "pos": [109, 122]}], "task": "NER"}
+{"text": "Coexpression of PIM - 1KD and PIM - 2KD abrogated growth factor - independent growth of Ba / F3 transformed by several PTKs , including BCR / ABL .", "entity": [{"entity": "Ba / F3", "entity_type": "Anatomy", "pos": [88, 95]}], "task": "NER"}
+{"text": "Targeted down - regulation of PIM - 2 by RNA interference ( RNAi ) selectively abrogated survival of Ba / F3 cells transformed by various Fms - like tyrosine kinase 3 ( FLT3 ) - activating mutants [ internal tandem duplication ( ITD ) and kinase domain ] and attenuated growth of human cell lines containing FLT3 mutations .", "entity": [{"entity": "Ba / F3 cells", "entity_type": "Anatomy", "pos": [101, 114]}, {"entity": "cell lines", "entity_type": "Anatomy", "pos": [286, 296]}], "task": "NER"}
+{"text": "Interestingly , cells transformed by FLT3 and BCR / ABL mutations that confer resistance to small - molecule tyrosine kinase inhibitors were still sensitive to knockdown of PIM - 2 , or PIM - 1 and PIM - 2 by RNAi .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [16, 21]}], "task": "NER"}
+{"text": "Our observations indicate that combined inactivation of PIM - 1 and PIM - 2 interferes with oncogenic PTKs and suggest that PIMs are alternative therapeutic targets in PTK - mediated leukemia .", "entity": [{"entity": "leukemia", "entity_type": "Anatomy", "pos": [183, 191]}], "task": "NER"}
+{"text": "Targeting the PIM kinase family could provide a new avenue to overcome resistance against small - molecule tyrosine kinase inhibitors .", "entity": [], "task": "NER"}
+{"text": "A potential role for the Src - like adapter protein SLAP - 2 in signaling by the colony stimulating factor - 1 receptor .", "entity": [], "task": "NER"}
+{"text": "The development of macrophages from myeloid progenitor cells is primarily controlled by the growth factor colony stimulating factor - 1 ( CSF - 1 ) and its cognate receptor , a transmembrane tyrosine kinase encoded by the c - Fms proto - oncogene .", "entity": [{"entity": "macrophages", "entity_type": "Anatomy", "pos": [19, 30]}, {"entity": "myeloid progenitor cells", "entity_type": "Anatomy", "pos": [36, 60]}, {"entity": "transmembrane", "entity_type": "Anatomy", "pos": [177, 190]}], "task": "NER"}
+{"text": "The CSF - 1 receptor exerts its biological effects on cells via a range of signaling proteins including Erk1 / 2 and Akt .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [54, 59]}], "task": "NER"}
+{"text": "Here we have investigated the potential involvement of the Src - like adapter protein ( SLAP - 2 ) in signaling by the CSF - 1 receptor in mouse bone marrow - derived macrophages .", "entity": [{"entity": "bone marrow", "entity_type": "Anatomy", "pos": [145, 156]}, {"entity": "macrophages", "entity_type": "Anatomy", "pos": [167, 178]}], "task": "NER"}
+{"text": "RT - PCR analysis revealed constitutive expression of the SLAP - 2 gene in bone marrow macrophages .", "entity": [{"entity": "bone marrow macrophages", "entity_type": "Anatomy", "pos": [75, 98]}], "task": "NER"}
+{"text": "Surprisingly , co - immunoprecipitation and GST binding experiments demonstrated that the CSF - 1 receptor could bind to SLAP - 2 in a ligand - independent manner .", "entity": [], "task": "NER"}
+{"text": "Furthermore , the binding of SLAP - 2 to the CSF - 1 receptor involved multiple domains of SLAP - 2 .", "entity": [], "task": "NER"}
+{"text": "SLAP - 2 also bound c - Cbl , with the interaction being mediated , at least in part , by the unique C - terminal domain of SLAP - 2 .", "entity": [], "task": "NER"}
+{"text": "Overexpression of SLAP - 2 in bone marrow macrophages partially suppressed the CSF - 1 - induced tyrosine phosphorylation and / or expression level of a approximately 80 kDa protein without affecting CSF - 1 - induced global tyrosine phosphorylation , or activation of Akt or Erk1 / 2 .", "entity": [{"entity": "bone marrow macrophages", "entity_type": "Anatomy", "pos": [30, 53]}], "task": "NER"}
+{"text": "Significantly , CSF - 1 stimulation induced serine phosphorylation of SLAP - 2 .", "entity": [], "task": "NER"}
+{"text": "Pharmacologic inhibition of specific protein kinases revealed that CSF - 1 - induced phosphorylation of SLAP - 2 was dependent on JNK activity .", "entity": [], "task": "NER"}
+{"text": "Taken together , our results suggest that SLAP - 2 could potentially be involved in signaling by the CSF - 1 receptor .", "entity": [], "task": "NER"}
+{"text": "Ectopic localization of mitochondrial ATP synthase : a target for anti - angiogenesis intervention ?", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [24, 37]}], "task": "NER"}
+{"text": "A receptor for angiostatin was identified on the surface of endothelial cells as F ( 1 ) - F ( 0 ) ATP synthase ( Moser et al . , 1999 ) .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [49, 56]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [60, 77]}], "task": "NER"}
+{"text": "Proc .", "entity": [], "task": "NER"}
+{"text": "Natl .", "entity": [], "task": "NER"}
+{"text": "Acad .", "entity": [], "task": "NER"}
+{"text": "Sci .", "entity": [], "task": "NER"}
+{"text": "U . S . A .", "entity": [], "task": "NER"}
+{"text": "96 , 2811 - 2816 .", "entity": [], "task": "NER"}
+{"text": "This ectopic ATP synthase catalyzes ATP synthesis and is inhibited by angiostatin over a wide pH range .", "entity": [], "task": "NER"}
+{"text": "Endothelial cells grown at normal pH suffer no ill effects from this angiostatin - mediated inhibition of ATP synthase , whereas endothelial cells grown at low , tumor - like extracellular pH cannot maintain a normal intracellular pH and die .", "entity": [{"entity": "Endothelial cells", "entity_type": "Anatomy", "pos": [0, 17]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [129, 146]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [162, 167]}, {"entity": "extracellular", "entity_type": "Anatomy", "pos": [175, 188]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [217, 230]}], "task": "NER"}
+{"text": "Angiostatin inhibits both ATP synthesis and ATP hydrolysis ( Moser et al . , 2001 ) and interferes with intracellular pH regulation ( Wahl and Grant , 2002 ; Wahl et al . , 2002 ) .", "entity": [{"entity": "intracellular", "entity_type": "Anatomy", "pos": [104, 117]}], "task": "NER"}
+{"text": "Although angiostatin administered intravenously is cleared from the circulation in a matter of minutes , angiostatin - mimetics that are more stable have potential for clinical application .", "entity": [{"entity": "intravenously", "entity_type": "Anatomy", "pos": [34, 47]}], "task": "NER"}
+{"text": "An angiostatin - mimetic activity has recently been observed using a polyclonal antibody against the beta catalytic subunit of ATP synthase .", "entity": [], "task": "NER"}
+{"text": "In order to explore the mechanism of action of angiostatin and its mimetics , further work needs to be done to evaluate clinical applicability , specificity , and contraindications for this class of therapeutics .", "entity": [], "task": "NER"}
+{"text": "Hepatitis B virus integration event in human chromosome 17p near the p53 gene identifies the region of the chromosome commonly deleted in virus - positive hepatocellular carcinomas .", "entity": [{"entity": "chromosome 17p", "entity_type": "Anatomy", "pos": [45, 59]}, {"entity": "chromosome", "entity_type": "Anatomy", "pos": [107, 117]}, {"entity": "virus - positive hepatocellular carcinomas", "entity_type": "Anatomy", "pos": [138, 180]}], "task": "NER"}
+{"text": "The development of hepatocellular carcinoma ( HCC ) presumably occurs in multiple steps and is influenced by numerous factors .", "entity": [{"entity": "hepatocellular carcinoma", "entity_type": "Anatomy", "pos": [19, 43]}, {"entity": "HCC", "entity_type": "Anatomy", "pos": [46, 49]}], "task": "NER"}
+{"text": "Hepatitis B virus ( HBV ) is strongly associated with the development of HCC in people chronically infected with the virus , but the mechanism of viral involvement remains unclear .", "entity": [{"entity": "HCC", "entity_type": "Anatomy", "pos": [73, 76]}], "task": "NER"}
+{"text": "One possibility is that the gross chromosomal alterations frequently observed in HCC DNA at the site of HBV integration may alter the expression of important nearby cellular genes .", "entity": [{"entity": "chromosomal", "entity_type": "Anatomy", "pos": [34, 45]}, {"entity": "HCC", "entity_type": "Anatomy", "pos": [81, 84]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [165, 173]}], "task": "NER"}
+{"text": "We previously reported the cloning and characterization of a HBV insert from a Chinese HCC .", "entity": [{"entity": "HCC", "entity_type": "Anatomy", "pos": [87, 90]}], "task": "NER"}
+{"text": "The viral insert mapped to chromosome 17p11 . 2 - 12 , and cellular sequences were duplicated at the site of viral integration .", "entity": [{"entity": "chromosome 17p11 . 2 - 12", "entity_type": "Anatomy", "pos": [27, 52]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [59, 67]}], "task": "NER"}
+{"text": "In the present study a DNA probe derived from cellular DNA sequences adjacent to the previously characterized HBV insert was used to analyze a set of 19 matched normal liver and HBV - positive hepatoma samples obtained from the same region of China , near Shanghai .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [46, 54]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [168, 173]}, {"entity": "hepatoma samples", "entity_type": "Anatomy", "pos": [193, 209]}], "task": "NER"}
+{"text": "Tumor - specific DNA changes were detected in two additional HCCs , suggesting that the small region of chromosome 17p defined by the flanking cell DNA probe is commonly altered in hepatomas .", "entity": [{"entity": "Tumor", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "HCCs", "entity_type": "Anatomy", "pos": [61, 65]}, {"entity": "chromosome 17p", "entity_type": "Anatomy", "pos": [104, 118]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [143, 147]}, {"entity": "hepatomas", "entity_type": "Anatomy", "pos": [181, 190]}], "task": "NER"}
+{"text": "Restriction fragment length polymorphism studies demonstrated that the loss of one copy of portions of chromosome 17 occurred in 10 ( 53 % ) of the 19 patients .", "entity": [{"entity": "chromosome 17", "entity_type": "Anatomy", "pos": [103, 116]}], "task": "NER"}
+{"text": "The loss of one allele of the p53 gene ( located on chromosome 17p13 ) occurred in at least 6 ( 60 % ) of the 10 patients who were heterozygous at the p53 locus .", "entity": [{"entity": "chromosome 17p13", "entity_type": "Anatomy", "pos": [52, 68]}], "task": "NER"}
+{"text": "As the p53 gene is known to possess tumor suppressor activity , the functional loss of this gene may be a significant step in the development of a subset of HCCs .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "HCCs", "entity_type": "Anatomy", "pos": [157, 161]}], "task": "NER"}
+{"text": "High levels of allele loss also were detected for chromosomes 8q ( 4 of 9 ; 44 % ) and 16p ( 5 of 6 ; 83 % ) and may indicate the presence of additional cellular genes whose functional loss is important in the development of HCCs .", "entity": [{"entity": "chromosomes 8q", "entity_type": "Anatomy", "pos": [50, 64]}, {"entity": "16p", "entity_type": "Anatomy", "pos": [87, 90]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [153, 161]}, {"entity": "HCCs", "entity_type": "Anatomy", "pos": [225, 229]}], "task": "NER"}
+{"text": "Prostate - specific membrane antigen regulates angiogenesis by modulating integrin signal transduction .", "entity": [], "task": "NER"}
+{"text": "The transmembrane peptidase prostate - specific membrane antigen ( PSMA ) is universally upregulated in the vasculature of solid tumors , but its functional role in tumor angiogenesis has not been investigated .", "entity": [{"entity": "transmembrane", "entity_type": "Anatomy", "pos": [4, 17]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [108, 119]}, {"entity": "solid tumors", "entity_type": "Anatomy", "pos": [123, 135]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [165, 170]}], "task": "NER"}
+{"text": "Here we show that angiogenesis is severely impaired in PSMA - null animals and that this angiogenic defect occurs at the level of endothelial cell invasion through the extracellular matrix barrier .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [130, 146]}, {"entity": "extracellular matrix barrier", "entity_type": "Anatomy", "pos": [168, 196]}], "task": "NER"}
+{"text": "Because proteolytic degradation of the extracellular matrix is a critical component of endothelial invasion in angiogenesis , it is logical to assume that PSMA participates in matrix degradation .", "entity": [{"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [39, 59]}, {"entity": "endothelial", "entity_type": "Anatomy", "pos": [87, 98]}, {"entity": "matrix", "entity_type": "Anatomy", "pos": [176, 182]}], "task": "NER"}
+{"text": "However , we demonstrate a novel and more complex role for PSMA in angiogenesis , where it is a principal component of a regulatory loop that is tightly modulating laminin - specific integrin signaling and GTPase - dependent , p21 - activated kinase 1 ( PAK - 1 ) activity .", "entity": [], "task": "NER"}
+{"text": "We show that PSMA inhibition , knockdown , or deficiency decreases endothelial cell invasion in vitro via integrin and PAK , thus abrogating angiogenesis .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [67, 83]}], "task": "NER"}
+{"text": "Interestingly , the neutralization of beta ( 1 ) or the inactivation of PAK increases PSMA activity , suggesting that they negatively regulate PSMA .", "entity": [], "task": "NER"}
+{"text": "This negative regulation is mediated by the cytoskeleton as the disruption of interactions between the PSMA cytoplasmic tail and the anchor protein filamin A decreases PSMA activity , integrin function , and PAK activation .", "entity": [{"entity": "cytoskeleton", "entity_type": "Anatomy", "pos": [44, 56]}, {"entity": "cytoplasmic", "entity_type": "Anatomy", "pos": [108, 119]}], "task": "NER"}
+{"text": "Finally , the inhibition of PAK activation enhances the PSMA / filamin A interaction and , thus , boosts PSMA activity .", "entity": [], "task": "NER"}
+{"text": "These data imply that PSMA participates in an autoregulatory loop , wherein active PSMA facilitates integrin signaling and PAK activation , leading to both productive invasion and downregulation of integrin beta ( 1 ) signaling via reduced PSMA activity .", "entity": [], "task": "NER"}
+{"text": "Therefore , we have identified a novel role for PSMA as a true molecular interface , integrating both extracellular and intracellular signals during angiogenesis .", "entity": [{"entity": "extracellular", "entity_type": "Anatomy", "pos": [102, 115]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [120, 133]}], "task": "NER"}
+{"text": "Heparin immobilized porous PLGA microspheres for angiogenic growth factor delivery .", "entity": [], "task": "NER"}
+{"text": "PURPOSE : Heparin immobilized porous poly ( D , L - lactic - co - glycolic acid ) ( PLGA ) microspheres were prepared for sustained release of basic fibroblast growth factor ( bFGF ) to induce angiogenesis .", "entity": [], "task": "NER"}
+{"text": "MATERIALS AND METHODS : Porous PLGA microspheres having primary amine groups on the surface were prepared using an oil - in - water ( O / W ) single emulsion method using Pluronic F - 127 as an extractable porogen .", "entity": [], "task": "NER"}
+{"text": "Heparin was surface immobilized via covalent conjugation .", "entity": [], "task": "NER"}
+{"text": "bFGF was loaded into the heparin functionalized ( PLGA - heparin ) microspheres by a simple dipping method .", "entity": [], "task": "NER"}
+{"text": "The bFGF loaded PLGA - heparin microspheres were tested for in vitro release and in vivo angiogenic activity .", "entity": [], "task": "NER"}
+{"text": "RESULTS : PLGA microspheres with an open - porous structure were formed .", "entity": [], "task": "NER"}
+{"text": "The amount of conjugated amine group onto the microspheres was 1 . 93 + / - 0 . 01 nmol / mg - microspheres , while the amount of heparin was 95 . 8 pmol / mg - microspheres .", "entity": [], "task": "NER"}
+{"text": "PLGA - heparin microspheres released out bFGF in a more sustained manner with a smaller extent of initial burst than PLGA microspheres , indicating that surface immobilized heparin controlled the release rate of bFGF .", "entity": [], "task": "NER"}
+{"text": "Subcutaneous implantation of bFGF loaded PLGA - heparin microspheres in mice significantly induced the formation of new vascular microvessels .", "entity": [{"entity": "Subcutaneous", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "vascular microvessels", "entity_type": "Anatomy", "pos": [120, 141]}], "task": "NER"}
+{"text": "CONCLUSIONS : PLGA microspheres with an open porous structure allowed significant amount of heparin immobilization and bFGF loading .", "entity": [], "task": "NER"}
+{"text": "bFGF loaded PLGA - HP microspheres showed sustained release profiles of bFGF in vitro , demonstrating reversible and specific binding of bFGF to immobilized heparin .", "entity": [], "task": "NER"}
+{"text": "They also induced local angiogenesis in vivo in an animal model .", "entity": [], "task": "NER"}
+{"text": "The role of syndecans in disease and wound healing .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [37, 42]}], "task": "NER"}
+{"text": "Syndecans are a family of transmembrane heparan sulfate proteoglycans widely expressed in both developing and adult tissues .", "entity": [{"entity": "transmembrane", "entity_type": "Anatomy", "pos": [26, 39]}, {"entity": "developing", "entity_type": "Anatomy", "pos": [95, 105]}, {"entity": "adult tissues", "entity_type": "Anatomy", "pos": [110, 123]}], "task": "NER"}
+{"text": "Until recently , their role in pathogenesis was largely unexplored .", "entity": [], "task": "NER"}
+{"text": "In this review , we discuss the reported involvement of syndecans in human cancers , infectious diseases , obesity , wound healing and angiogenesis .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [75, 82]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [117, 122]}], "task": "NER"}
+{"text": "In some cancers , syndecan expression has been shown to regulate tumor cell function ( e . g . proliferation , adhesion , and motility ) and serve as a prognostic marker for tumor progression and patient survival .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [8, 15]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [65, 75]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [174, 179]}], "task": "NER"}
+{"text": "The ectodomains and heparan sulfate glycosaminoglycan chains of syndecans can also act as receptors / co - receptors for some bacterial and viral pathogens , mediating infection .", "entity": [], "task": "NER"}
+{"text": "In addition , syndecans bind to obesity - related factors and regulate their signaling , in turn modulating food consumption and weight balance .", "entity": [], "task": "NER"}
+{"text": "In vivo animal models of tissue injury and in vitro data also implicate syndecans in processes necessary for wound healing , including fibroblast and endothelial proliferation , cell motility , angiogenesis , and extracellular matrix organization .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [25, 31]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [109, 114]}, {"entity": "fibroblast", "entity_type": "Anatomy", "pos": [135, 145]}, {"entity": "endothelial", "entity_type": "Anatomy", "pos": [150, 161]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [178, 182]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [213, 233]}], "task": "NER"}
+{"text": "These new insights into the involvement of syndecans in disease and tissue repair coupled with the emergence of syndecan - specific molecular tools may lead to novel therapies for a variety of human diseases .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [68, 74]}], "task": "NER"}
+{"text": "Structure of the genetic code suggested by the hydropathy correlation between anticodons and amino acid residues .", "entity": [], "task": "NER"}
+{"text": "The correlation between hydropathies of anticodons and amino acids , detected by other authors utilizing scales of amino acid molecules in solution , was improved with the utilization of scales of amino acid residues in proteins .", "entity": [], "task": "NER"}
+{"text": "Three partitions were discerned in the correlation plot with the principal dinucleotides of anticodons ( pDiN , excluding the wobble position ) .", "entity": [], "task": "NER"}
+{"text": "( a ) The set of outliers of the correlation : Gly - CC , Pro - GG , Ser - GA and Ser - CU .", "entity": [], "task": "NER"}
+{"text": "The amino acids are consistently small , hydro - apathetic , stabilizers of protein N - ends , preferred in aperiodic protein conformations and belong to synthetases class II .", "entity": [], "task": "NER"}
+{"text": "The pDiN sequences are representative of the homogeneous sector ( triplets NRR and NYY ) , distinguished from the mixed sector ( triplets NRY and NYR ) , that depict a 70 % correspondence to the synthetases class II and I , respectively .", "entity": [], "task": "NER"}
+{"text": "The triplet pairs proposed to be responsible for the coherence in the set of outliers are of the palindromic kind , where the lateral bases are the same , CCC : GGG and AGA : UCU .", "entity": [], "task": "NER"}
+{"text": "This suggests that UCU previously belonged to Ser , adding to other indications that the attribution of Arg to YCU was due to an expansion of the Arg - tRNA synthetase specificity .", "entity": [], "task": "NER"}
+{"text": "The other attributions produced two correlation sets .", "entity": [], "task": "NER"}
+{"text": "( b ) One corresponds to the remaining pDiN of the homogeneous sector , containing both synthetase classes ; its regression line overlapped the one formed by the remaining attributions to class II .", "entity": [], "task": "NER"}
+{"text": "( c ) The other contains the pDiN of the mixed sector and produced steeper slopes , especially with the class I attributions .", "entity": [], "task": "NER"}
+{"text": "It is suggested that the correlation was established when the amino acid composition of the protein synthetases became progressively enriched and that the set of outliers were the earliest to have been fixed .", "entity": [], "task": "NER"}
+{"text": "C / EBPbeta is over - expressed in gastric carcinogenesis and is associated with COX - 2 expression .", "entity": [{"entity": "gastric", "entity_type": "Anatomy", "pos": [35, 42]}], "task": "NER"}
+{"text": "The CCAAT / enhancer - binding protein beta ( C / EBPbeta ) transcription factor has been associated with several cancer models .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [114, 120]}], "task": "NER"}
+{"text": "In this study , the expression of C / EBPbeta was analysed in a series of 90 gastric carcinomas ( GCs ) .", "entity": [{"entity": "gastric carcinomas", "entity_type": "Anatomy", "pos": [77, 95]}, {"entity": "GCs", "entity_type": "Anatomy", "pos": [98, 101]}], "task": "NER"}
+{"text": "We also assessed the effect of C / EBPbeta on COX - 2 expression .", "entity": [], "task": "NER"}
+{"text": "In normal gastric mucosa , C / EBPbeta expression was restricted to cells in the proliferative zone .", "entity": [{"entity": "gastric mucosa", "entity_type": "Anatomy", "pos": [10, 24]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [68, 73]}, {"entity": "zone", "entity_type": "Anatomy", "pos": [95, 99]}], "task": "NER"}
+{"text": "In intestinal metaplasia , dysplasia , and GC of the intestinal and atypical subtypes , C / EBPbeta was over - expressed ( p < 0 . 0001 , for the association with histological type ) .", "entity": [{"entity": "intestinal metaplasia", "entity_type": "Anatomy", "pos": [3, 24]}, {"entity": "dysplasia", "entity_type": "Anatomy", "pos": [27, 36]}, {"entity": "GC", "entity_type": "Anatomy", "pos": [43, 45]}, {"entity": "intestinal", "entity_type": "Anatomy", "pos": [53, 63]}], "task": "NER"}
+{"text": "C / EBPbeta and Ki67 , a marker of cell proliferation , were also co - expressed in primary GC .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [35, 39]}, {"entity": "primary GC", "entity_type": "Anatomy", "pos": [84, 94]}], "task": "NER"}
+{"text": "We also observed an overlap between C / EBPbeta and COX - 2 expression in GC .", "entity": [{"entity": "GC", "entity_type": "Anatomy", "pos": [74, 76]}], "task": "NER"}
+{"text": "Using GC cell lines we show that C / EBPbeta can regulate the expression of endogenous COX - 2 and transactivate the promoter of the COX - 2 gene , depending on its methylation status .", "entity": [{"entity": "GC cell lines", "entity_type": "Anatomy", "pos": [6, 19]}], "task": "NER"}
+{"text": "These results suggest that C / EBPbeta may be a marker of neoplastic transformation and also play an active role in gastric tumourigenesis by regulating COX - 2 expression .", "entity": [{"entity": "neoplastic", "entity_type": "Anatomy", "pos": [58, 68]}, {"entity": "gastric", "entity_type": "Anatomy", "pos": [116, 123]}], "task": "NER"}
+{"text": "Hypocholesterolaemic and antioxidant effects of Glycyrrhiza glabra ( Linn ) in rats .", "entity": [], "task": "NER"}
+{"text": "The hypocholesterolaemic and antioxidant effects of Glycyrrhiza glabra ( GG ) root powder were examined in hypercholesterolaemic male albino rats .", "entity": [{"entity": "root", "entity_type": "Anatomy", "pos": [78, 82]}], "task": "NER"}
+{"text": "A 4 - week administration of GG root powder ( 5 and 10 gm % in diet ) to hypercholesterolaemic rats resulted in significant reduction in plasma , hepatic total lipids , cholesterol , triglycerides and plasma low - density lipoprotein and VLDL - cholesterol accompanied by significant increases in HDL - cholesterol levels .", "entity": [{"entity": "root", "entity_type": "Anatomy", "pos": [32, 36]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [137, 143]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [146, 153]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [201, 207]}], "task": "NER"}
+{"text": "Furthermore , significant increases in fecal cholesterol , neutral sterols and bile acid excretion along with an increase in hepatic HMG - CoA reductase activity and bile acid production were observed in these animals .", "entity": [{"entity": "fecal", "entity_type": "Anatomy", "pos": [39, 44]}, {"entity": "bile", "entity_type": "Anatomy", "pos": [79, 83]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [125, 132]}, {"entity": "bile", "entity_type": "Anatomy", "pos": [166, 170]}], "task": "NER"}
+{"text": "The root powder administration to hypercholesterolaemic rats also decreased hepatic lipid peroxidation with a concomitant increase in superoxide dismutase ( SOD ) and catalase activities and total ascorbic acid content .", "entity": [{"entity": "root", "entity_type": "Anatomy", "pos": [4, 8]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [76, 83]}], "task": "NER"}
+{"text": "Thus , the hypocholesterolaemic and antioxidant effects of GG root appeared to be mediated via ( i ) accelerated cholesterol , neutral sterol and bile acid elimination through fecal matter with an increased hepatic bile acid production and ( ii ) improving the activities of hepatic SOD , catalase and increasing the ascorbic acid content .", "entity": [{"entity": "root", "entity_type": "Anatomy", "pos": [62, 66]}, {"entity": "bile", "entity_type": "Anatomy", "pos": [146, 150]}, {"entity": "fecal matter", "entity_type": "Anatomy", "pos": [176, 188]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [207, 214]}, {"entity": "bile", "entity_type": "Anatomy", "pos": [215, 219]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [275, 282]}], "task": "NER"}
+{"text": "The normo - cholesterolaemic animals when fed with GG root powder at 10 gm % level , registered a significant decline in plasma lipid profiles and an increase in HDL - cholesterol content .", "entity": [{"entity": "root", "entity_type": "Anatomy", "pos": [54, 58]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [121, 127]}], "task": "NER"}
+{"text": "The antioxidant status of these animals also was improved upon treatment .", "entity": [], "task": "NER"}
+{"text": "Multicentre study on peri - and postoperative central venous oxygen saturation in high - risk surgical patients .", "entity": [{"entity": "central venous", "entity_type": "Anatomy", "pos": [46, 60]}], "task": "NER"}
+{"text": "INTRODUCTION :", "entity": [], "task": "NER"}
+{"text": "Low central venous oxygen saturation ( ScvO2 ) has been associated with increased risk of postoperative complications in high - risk surgery .", "entity": [{"entity": "central venous", "entity_type": "Anatomy", "pos": [4, 18]}], "task": "NER"}
+{"text": "Whether this association is centre - specific or more generalisable is not known .", "entity": [], "task": "NER"}
+{"text": "The aim of this study was to assess the association between peri - and postoperative ScvO2 and outcome in high - risk surgical patients in a multicentre setting .", "entity": [], "task": "NER"}
+{"text": "Three large European university hospitals ( two in Finland , one in Switzerland ) participated .", "entity": [], "task": "NER"}
+{"text": "In 60 patients with intra - abdominal surgery lasting more than 90 minutes , the presence of at least two of Shoemaker ' s criteria , and ASA ( American Society of Anesthesiologists ) class greater than 2 , ScvO2 was determined preoperatively and at two hour intervals during the operation until 12 hours postoperatively .", "entity": [{"entity": "abdominal", "entity_type": "Anatomy", "pos": [28, 37]}], "task": "NER"}
+{"text": "Hospital length of stay ( LOS ) mortality , and predefined postoperative complications were recorded .", "entity": [], "task": "NER"}
+{"text": "The age of the patients was 72 + / - 10 years ( mean + / - standard deviation ) , and simplified acute physiology score ( SAPS II ) was 32 + / - 12 .", "entity": [], "task": "NER"}
+{"text": "Hospital LOS was 10 . 5 ( 8 to 14 ) days , and 28 - day hospital mortality was 10 . 0 % .", "entity": [], "task": "NER"}
+{"text": "Preoperative ScvO2 decreased from 77 % + / - 10 % to 70 % + / - 11 % ( p < 0 . 001 ) immediately after surgery and remained unchanged 12 hours later .", "entity": [], "task": "NER"}
+{"text": "A total of 67 postoperative complications were recorded in 32 patients .", "entity": [], "task": "NER"}
+{"text": "After multivariate analysis , mean ScvO2 value ( odds ratio [ OR ] 1 . 23 [ 95 % confidence interval ( CI ) 1 . 01 to 1 . 50 ] , p = 0 . 037 ) , hospital LOS ( OR 0 . 75 [ 95 % CI 0 . 59 to 0 . 94 ] , p = 0 . 012 ) , and SAPS II ( OR 0 . 90 [ 95 % CI 0 . 82 to 0 . 99 ] , p = 0 . 029 ) were independently associated with postoperative complications .", "entity": [], "task": "NER"}
+{"text": "The optimal value of mean ScvO2 to discriminate between patients who did or did not develop complications was 73 % ( sensitivity 72 % , specificity 61 % ) .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION :", "entity": [], "task": "NER"}
+{"text": "Low ScvO2 perioperatively is related to increased risk of postoperative complications in high - risk surgery .", "entity": [], "task": "NER"}
+{"text": "This warrants trials with goal - directed therapy using ScvO2 as a target in high - risk surgery patients .", "entity": [], "task": "NER"}
+{"text": "Lysophosphatidic acid downregulates tissue inhibitor of metalloproteinases , which are negatively involved in lysophosphatidic acid - induced cell invasion .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [142, 146]}], "task": "NER"}
+{"text": "Ovarian cancer is a highly metastatic disease .", "entity": [{"entity": "Ovarian cancer", "entity_type": "Anatomy", "pos": [0, 14]}], "task": "NER"}
+{"text": "Lysophosphatidic acid ( LPA ) levels are elevated in ascites from ovarian cancer patients , but its potential role in ovarian cancer metastasis has just begun to be revealed .", "entity": [{"entity": "ascites", "entity_type": "Anatomy", "pos": [53, 60]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [66, 80]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [118, 132]}], "task": "NER"}
+{"text": "In this work , we show that LPA stimulates invasion of primary ovarian cancer cells , but not ovarian epithelial or borderline ovarian tumor cells , although these benign cells indeed respond to LPA in cell migration .", "entity": [{"entity": "primary ovarian cancer cells", "entity_type": "Anatomy", "pos": [55, 83]}, {"entity": "ovarian epithelial", "entity_type": "Anatomy", "pos": [94, 112]}, {"entity": "borderline ovarian tumor cells", "entity_type": "Anatomy", "pos": [116, 146]}, {"entity": "benign cells", "entity_type": "Anatomy", "pos": [164, 176]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [202, 206]}], "task": "NER"}
+{"text": "We have found that LPA downregulates tissue inhibitor of metalloproteinases ( TIMPs ) .", "entity": [], "task": "NER"}
+{"text": "TIMP2 and TIMP3 play functional role in LPA - induced invasion as negative regulators .", "entity": [], "task": "NER"}
+{"text": "G ( i ) protein , phosphatidylinositol - 3 kinase ( PI3K ) , p38 mitogen - activated protein kinase ( MAPK ) , cytosolic phospholipase A ( 2 ) and urokinase type plasminogen activator ( uPA ) are required for LPA - induced cells invasion .", "entity": [{"entity": "cytosolic", "entity_type": "Anatomy", "pos": [111, 120]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [223, 228]}], "task": "NER"}
+{"text": "TIMP3 may affect two independent downstream targets , vascular endothelial growth factor receptor and p38 MAPK .", "entity": [], "task": "NER"}
+{"text": "In vivo , LPA stimulates tumor metastasis in an orthotopic ovarian tumor model , which can be inhibited by a PI3K inhibitor , LY294002 .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [25, 30]}, {"entity": "ovarian tumor", "entity_type": "Anatomy", "pos": [59, 72]}], "task": "NER"}
+{"text": "In summary , LPA is likely a key component for promoting ovarian metastasis in vivo .", "entity": [{"entity": "ovarian", "entity_type": "Anatomy", "pos": [57, 64]}], "task": "NER"}
+{"text": "LPA downregulates TIMP3 , which may have targets other than metalloproteinases .", "entity": [], "task": "NER"}
+{"text": "Our in vivo metastasis mouse model is useful for studying the efficacy of therapeutic regimes of ovarian cancer .", "entity": [{"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [97, 111]}], "task": "NER"}
+{"text": "[ Treatment of squamous intraepithelial lesion of type CIN2 et CIN3 with laser CO2 vaporization : retrospective study of 52 cases ] .", "entity": [{"entity": "squamous intraepithelial lesion", "entity_type": "Anatomy", "pos": [15, 46]}], "task": "NER"}
+{"text": "OBJECTIVES :", "entity": [], "task": "NER"}
+{"text": "This study was carried out over an 8 - year period in order to evaluate the long - term effectiveness of laser CO2 vaporization in the treatment of squamous intraepithelial lesion of type CIN2 and CIN3 .", "entity": [{"entity": "squamous intraepithelial lesion", "entity_type": "Anatomy", "pos": [148, 179]}], "task": "NER"}
+{"text": "MATERIALS AND METHODS :", "entity": [], "task": "NER"}
+{"text": "A retrospective study of 52 cases of cervical lesions of type CIN2 and CIN3 treated in first intention by laser CO2 vaporization was carried out at the hospital Jeanne - de - Flandre in CHRU of Lille from 1996 to 2003 .", "entity": [{"entity": "cervical lesions", "entity_type": "Anatomy", "pos": [37, 53]}], "task": "NER"}
+{"text": "This treatment was performed on only high - grade exo - cervical lesions , of small size ( < 2cm2 ) , after a complete colposcopic examination .", "entity": [{"entity": "high - grade exo - cervical lesions", "entity_type": "Anatomy", "pos": [37, 72]}], "task": "NER"}
+{"text": "Fifty - two patients were treated by first - intention laser vaporization only .", "entity": [], "task": "NER"}
+{"text": "Mean age was 29 . 4 years and 51 . 9 % were nulliparous .", "entity": [], "task": "NER"}
+{"text": "At the first cyto - colposcopic control , there were 17 persistent lesions ( 32 . 7 % ) .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [67, 74]}], "task": "NER"}
+{"text": "Among the 35 patients without persistent lesion , 29 achieved cure ( absence of recurrence ) , 4 presented a recurrence and 2 were lost to follow - up .", "entity": [{"entity": "lesion", "entity_type": "Anatomy", "pos": [41, 47]}], "task": "NER"}
+{"text": "The current data of the literature concerning the treatment by laser CO2 vaporization authorize application of this method for certain high - grade exocervical lesions after a complete colposcopic examination .", "entity": [{"entity": "high - grade exocervical lesions", "entity_type": "Anatomy", "pos": [135, 167]}], "task": "NER"}
+{"text": "This type of treatment remains less aggressive than a surgical treatment .", "entity": [], "task": "NER"}
+{"text": "The high rate of residual lesions in particular in the event of CIN3 can be due to an incomplete destruction of the lesion .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [26, 33]}, {"entity": "lesion", "entity_type": "Anatomy", "pos": [116, 122]}], "task": "NER"}
+{"text": "Patients should thus be advised that monitoring is an integral part of the treatment .", "entity": [], "task": "NER"}
+{"text": "Laser vaporization could be limited to CIN1 and CIN2 lesions .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [53, 60]}], "task": "NER"}
+{"text": "Role of the fibrinolytic and matrix metalloproteinase systems in development of adipose tissue .", "entity": [{"entity": "adipose tissue", "entity_type": "Anatomy", "pos": [80, 94]}], "task": "NER"}
+{"text": "Obesity is a common disorder and related diseases such as diabetes , atherosclerosis , hypertension , cardiovascular disease and cancer are a major cause of mortality and morbidity in Western - type societies .", "entity": [{"entity": "cardiovascular", "entity_type": "Anatomy", "pos": [102, 116]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [129, 135]}], "task": "NER"}
+{"text": "Development of obesity is associated with extensive modifications in adipose tissue involving adipogenesis , angiogenesis and extracellular matrix proteolysis .", "entity": [{"entity": "adipose tissue", "entity_type": "Anatomy", "pos": [69, 83]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [126, 146]}], "task": "NER"}
+{"text": "The fibrinolytic ( plasminogen / plasmin ) and matrix metalloproteinase ( MMP ) systems cooperate in these processes .", "entity": [], "task": "NER"}
+{"text": "A nutritionally induced obesity model in transgenic mice has been used extensively to study the role of the fibrinolytic and MMP systems in the development of obesity .", "entity": [], "task": "NER"}
+{"text": "These studies support a role of both systems in adipogenesis and obesity ; the role of specific members of these families , however , remains to be determined .", "entity": [], "task": "NER"}
+{"text": "Recombinant human prothrombin kringle - 2 inhibits B16F10 melanoma metastasis through inhibition of neovascularization and reduction of matrix metalloproteinase expression .", "entity": [{"entity": "B16F10 melanoma", "entity_type": "Anatomy", "pos": [51, 66]}], "task": "NER"}
+{"text": "Angiogenesis , a multi - step process which involves endothelial cell proliferation , adhesion , migration , and basement membrane ( BM ) degradation , is essential for tumor metastasis .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [53, 69]}, {"entity": "basement membrane", "entity_type": "Anatomy", "pos": [113, 130]}, {"entity": "BM", "entity_type": "Anatomy", "pos": [133, 135]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [169, 174]}], "task": "NER"}
+{"text": "Here we show that recombinant human prothrombin kringle - 2 ( rk - 2 ) inhibited bovine capillary endothelial cell migration with an IC ( 50 ) ( concentration for half maximal inhibition ) of 38 nM and inhibited adhesion to extracellular matrix ( ECM ) proteins .", "entity": [{"entity": "capillary endothelial cell", "entity_type": "Anatomy", "pos": [88, 114]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [224, 244]}, {"entity": "ECM", "entity_type": "Anatomy", "pos": [247, 250]}], "task": "NER"}
+{"text": "Because tumor metastasis requires angiogenesis , we examined whether rk - 2 could inhibit metastases induced by injection of B16F10 melanoma cells into mice .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [8, 13]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [90, 100]}, {"entity": "B16F10 melanoma cells", "entity_type": "Anatomy", "pos": [125, 146]}], "task": "NER"}
+{"text": "The results revealed that the metastatic tumors in mouse lung were markedly decreased in a dose - dependent manner and acute lung injury induced by B16F10 melanoma metastasis was diminished by systemic rk - 2 treatment .", "entity": [{"entity": "metastatic tumors", "entity_type": "Anatomy", "pos": [30, 47]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [57, 61]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [125, 129]}, {"entity": "B16F10 melanoma", "entity_type": "Anatomy", "pos": [148, 163]}], "task": "NER"}
+{"text": "In immunohistochemical analysis , rk - 2 reduced expression of vascular endothelial growth factor , which is a potent angiogenic activator and neovascularization in the mouse lung .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [175, 179]}], "task": "NER"}
+{"text": "Also , rk - 2 diminished the expression of matrix metalloproteinase - 2 and - 9 in the mouse lung which induces tumor metastasis and angiogenesis .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [93, 97]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [112, 117]}], "task": "NER"}
+{"text": "These data suggest that inhibition of B16F10 melanoma metastasis by rk - 2 was caused by inhibition of neovascularization and reduction of matrix metalloproteinase expression .", "entity": [{"entity": "B16F10 melanoma", "entity_type": "Anatomy", "pos": [38, 53]}], "task": "NER"}
+{"text": "Extracellular matrix as a bioactive material for soft tissue reconstruction .", "entity": [{"entity": "Extracellular matrix", "entity_type": "Anatomy", "pos": [0, 20]}, {"entity": "soft tissue", "entity_type": "Anatomy", "pos": [49, 60]}], "task": "NER"}
+{"text": "The extracellular matrix ( ECM ) directs all phases of healing following trauma or disease and is therefore a natural source of prosthetic mesh material that can be used strategically to induce the repair and restoration of soft tissues following surgery .", "entity": [{"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [4, 24]}, {"entity": "ECM", "entity_type": "Anatomy", "pos": [27, 30]}, {"entity": "soft tissues", "entity_type": "Anatomy", "pos": [224, 236]}], "task": "NER"}
+{"text": "Biomaterials such as Surgisis ( Cook Biotech Incorporated , West Lafayette , IN , USA ) , which are derived from natural ECM , provide the extracellular components necessary to direct the healing response , allow for the proliferation of new , healthy tissue and restore tissue integrity to the damaged site .", "entity": [{"entity": "ECM", "entity_type": "Anatomy", "pos": [121, 124]}, {"entity": "extracellular components", "entity_type": "Anatomy", "pos": [139, 163]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [252, 258]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [271, 277]}, {"entity": "site", "entity_type": "Anatomy", "pos": [303, 307]}], "task": "NER"}
+{"text": "The 3 - D organization of these extracellular components distinguishes the Surgisis mesh from synthetic materials and is associated with constructive tissue remodelling instead of scar tissue .", "entity": [{"entity": "extracellular components", "entity_type": "Anatomy", "pos": [32, 56]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [150, 156]}, {"entity": "scar tissue", "entity_type": "Anatomy", "pos": [180, 191]}], "task": "NER"}
+{"text": "Common features of this ECM - assisted tissue remodelling include angiogenesis , recruitment of circulating progenitor cells and constructive remodelling of damaged tissue structures .", "entity": [{"entity": "ECM", "entity_type": "Anatomy", "pos": [24, 27]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [39, 45]}, {"entity": "progenitor cells", "entity_type": "Anatomy", "pos": [108, 124]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [165, 171]}], "task": "NER"}
+{"text": "The tissue response to this biologic mesh is discussed in the context of recent reports on clinical hernia repair .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [4, 10]}, {"entity": "hernia", "entity_type": "Anatomy", "pos": [100, 106]}], "task": "NER"}
+{"text": "Segmental atrial contraction in patients restored to sinus rhythm after cardioversion for chronic atrial fibrillation : a colour Doppler tissue imaging study .", "entity": [{"entity": "atrial", "entity_type": "Anatomy", "pos": [10, 16]}, {"entity": "atrial", "entity_type": "Anatomy", "pos": [98, 104]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [137, 143]}], "task": "NER"}
+{"text": "AIMS :", "entity": [], "task": "NER"}
+{"text": "There is little known about segmental atrial function in patients with atrial arrhythmias .", "entity": [{"entity": "atrial", "entity_type": "Anatomy", "pos": [38, 44]}, {"entity": "atrial", "entity_type": "Anatomy", "pos": [71, 77]}], "task": "NER"}
+{"text": "We evaluated segmental atrial contractility using colour Doppler tissue imaging ( CDTI ) in patients with chronic atrial fibrillation ( CAF ) who were successfully restored and maintained in sinus rhythm ( SR ) .", "entity": [{"entity": "atrial", "entity_type": "Anatomy", "pos": [23, 29]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [65, 71]}, {"entity": "atrial", "entity_type": "Anatomy", "pos": [114, 120]}], "task": "NER"}
+{"text": "METHODS AND RESULTS :", "entity": [], "task": "NER"}
+{"text": "We compared the segmental atrial contractility in 39 CAF patients who were successfully cardioverted and maintained in SR for 6 months .", "entity": [{"entity": "atrial", "entity_type": "Anatomy", "pos": [26, 32]}], "task": "NER"}
+{"text": "Follow up echocardiograms were performed at baseline , 1 week , 1 month and 6 months and compared to a normal age matched cohort ( n = 34 ) .", "entity": [], "task": "NER"}
+{"text": "Using CDTI , mean peak velocities of atrial contraction were measured from annular , mid and superior segments of lateral and septal walls of the left atrium and right atrium in the apical four - chamber view .", "entity": [{"entity": "atrial", "entity_type": "Anatomy", "pos": [37, 43]}, {"entity": "annular", "entity_type": "Anatomy", "pos": [75, 82]}, {"entity": "mid", "entity_type": "Anatomy", "pos": [85, 88]}, {"entity": "superior segments", "entity_type": "Anatomy", "pos": [93, 110]}, {"entity": "lateral", "entity_type": "Anatomy", "pos": [114, 121]}, {"entity": "septal walls", "entity_type": "Anatomy", "pos": [126, 138]}, {"entity": "left atrium", "entity_type": "Anatomy", "pos": [146, 157]}, {"entity": "right atrium", "entity_type": "Anatomy", "pos": [162, 174]}, {"entity": "chamber", "entity_type": "Anatomy", "pos": [196, 203]}], "task": "NER"}
+{"text": "Segmental velocities from the posterior and anterior walls of the left atrium were measured from the apical two - chamber view .", "entity": [{"entity": "posterior", "entity_type": "Anatomy", "pos": [30, 39]}, {"entity": "anterior walls", "entity_type": "Anatomy", "pos": [44, 58]}, {"entity": "left atrium", "entity_type": "Anatomy", "pos": [66, 77]}, {"entity": "chamber", "entity_type": "Anatomy", "pos": [114, 121]}], "task": "NER"}
+{"text": "Segmental left atrial velocities improved over time in the CAF group , with the majority of the recovery occurring in the first month , but failed to normalise even at 6 months .", "entity": [{"entity": "left atrial", "entity_type": "Anatomy", "pos": [10, 21]}], "task": "NER"}
+{"text": "In comparison , the right atrial velocities in the AF group had normalised at 1 month .", "entity": [{"entity": "right atrial", "entity_type": "Anatomy", "pos": [20, 32]}], "task": "NER"}
+{"text": "Patients with CAF have persistent segmental left atrial dysfunction even 6 months after restoration and maintenance of SR , though right atrial velocities appear to normalise .", "entity": [{"entity": "left atrial", "entity_type": "Anatomy", "pos": [44, 55]}, {"entity": "right atrial", "entity_type": "Anatomy", "pos": [131, 143]}], "task": "NER"}
+{"text": "This differential recovery indicates that left atrial function remains subnormal in patients with CAF despite maintenance of SR , suggesting underlying atrial myopathy or fibrosis as a consequence of CAF .", "entity": [{"entity": "left atrial", "entity_type": "Anatomy", "pos": [42, 53]}, {"entity": "atrial", "entity_type": "Anatomy", "pos": [152, 158]}], "task": "NER"}
+{"text": "[ Study on the expression of angiogenesis and spontaneous apoptosis and their relevance in laryngeal squamous cell carcinoma ]", "entity": [{"entity": "laryngeal squamous cell carcinoma", "entity_type": "Anatomy", "pos": [91, 124]}], "task": "NER"}
+{"text": "OBJECTIVE : To investigate the relationship among angiogenesis , spontaneous apoptosis and clinicopathological parameters in laryngeal squamous cell carcinoma ( LSCC ) .", "entity": [{"entity": "laryngeal squamous cell carcinoma", "entity_type": "Anatomy", "pos": [125, 158]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [161, 165]}], "task": "NER"}
+{"text": "METHOD : The intratumor microvessel density ( IMVD ) , apoptotic index ( AI ) and vascular endothelial growth factor ( VEGF ) expression were detected by immunohistochemistry SABC and terminal uridine deoxynucleotidyl transferase mediated nick end labeling ( TUNEL ) methods in34 LSCC patients .", "entity": [{"entity": "intratumor microvessel", "entity_type": "Anatomy", "pos": [13, 35]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [280, 284]}], "task": "NER"}
+{"text": "RESULT : The average IMVD was ( 21 . 50 + / - 8 . 87 ) , and median of AI was 1 . 15 % .", "entity": [], "task": "NER"}
+{"text": "The average IMVD in positive and negative cervical lymphatic metastasis was ( 26 . 33 + / - 9 . 70 ) and ( 17 . 68 + / - 6 . 06 ) respectively , and the IMVD with positive lymphatic metastasis tumors was statistical significantly higher than those with negative cervical lymphatic metastasis tumors ( P less than 0 . 01 ) .", "entity": [{"entity": "cervical lymphatic", "entity_type": "Anatomy", "pos": [42, 60]}, {"entity": "lymphatic metastasis tumors", "entity_type": "Anatomy", "pos": [172, 199]}, {"entity": "cervical lymphatic metastasis tumors", "entity_type": "Anatomy", "pos": [262, 298]}], "task": "NER"}
+{"text": "The average IMVD had statistical difference in histological grading ( P less than 0 . 01 ) , and analysis by one to one , the average IMVD had statistical difference between high and median grading .", "entity": [], "task": "NER"}
+{"text": "Expression of VEGF had a significantly positive correlation with IMVD ( r = 0 . 51 , P less than 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "Statistical analysis revealed a significantly inverse correlation between AI and IMVD ( r = - 0 . 53 , P less than 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "We failed to find the statistical difference between IMVD and tumor T - stage in LSCC .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [81, 85]}], "task": "NER"}
+{"text": "CONCLUSION : IMVD may be an important indicator to predict cervical lymphatic metastasis in LSCC .", "entity": [{"entity": "cervical lymphatic", "entity_type": "Anatomy", "pos": [59, 77]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [92, 96]}], "task": "NER"}
+{"text": "VEGF might be an important angiogenic factor , and could promote tumor angiogenesis in LSCC .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [65, 70]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [87, 91]}], "task": "NER"}
+{"text": "Tumor angiogenesis might contribute to tumor malignant progression by inhibiting spontaneous apoptosis in LSCC .", "entity": [{"entity": "Tumor", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [39, 44]}, {"entity": "LSCC", "entity_type": "Anatomy", "pos": [106, 110]}], "task": "NER"}
+{"text": "[ Anomalous origin of the right coronary artery from the left sinus of Valsalva : case report and literature review ] .", "entity": [{"entity": "right coronary artery", "entity_type": "Anatomy", "pos": [26, 47]}, {"entity": "left sinus", "entity_type": "Anatomy", "pos": [57, 67]}], "task": "NER"}
+{"text": "We describe the case of a patient in whom evaluation of effort angina revealed a tight stenosis of a right coronary artery anomalously arising from the left sinus of Valsalva , which was successfully treated by stent implantation .", "entity": [{"entity": "right coronary artery", "entity_type": "Anatomy", "pos": [101, 122]}, {"entity": "left sinus", "entity_type": "Anatomy", "pos": [152, 162]}], "task": "NER"}
+{"text": "The abnormal origin of the right coronary artery from the left aortic sinus coursing between the aorta and the pulmonary trunk is a rare congenital anomaly .", "entity": [{"entity": "right coronary artery", "entity_type": "Anatomy", "pos": [27, 48]}, {"entity": "left aortic sinus", "entity_type": "Anatomy", "pos": [58, 75]}, {"entity": "aorta", "entity_type": "Anatomy", "pos": [97, 102]}, {"entity": "pulmonary trunk", "entity_type": "Anatomy", "pos": [111, 126]}], "task": "NER"}
+{"text": "It may remain asymptomatic , but can also cause major cardiac events , even in the absence of coronary atherosclerosis .", "entity": [{"entity": "cardiac", "entity_type": "Anatomy", "pos": [54, 61]}, {"entity": "coronary", "entity_type": "Anatomy", "pos": [94, 102]}], "task": "NER"}
+{"text": "We discuss the clinical importance of this anomaly and review the literature concerning current views and therapy .", "entity": [], "task": "NER"}
+{"text": "The cancer cell ' s \" power plants \" as promising therapeutic targets : an overview .", "entity": [{"entity": "cancer cell", "entity_type": "Anatomy", "pos": [4, 15]}], "task": "NER"}
+{"text": "This introductory article to the review series entitled \" The Cancer Cell ' s Power Plants as Promising Therapeutic Targets \" is written while more than 20 million people suffer from cancer .", "entity": [{"entity": "Cancer Cell", "entity_type": "Anatomy", "pos": [62, 73]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [183, 189]}], "task": "NER"}
+{"text": "It summarizes strategies to destroy or prevent cancers by targeting their energy production factories , i . e . , \" power plants . \" All nucleated animal / human cells have two types of power plants , i . e . , systems that make the \" high energy \" compound ATP from ADP and P ( i ) .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [47, 54]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [162, 167]}], "task": "NER"}
+{"text": "One type is \" glycolysis , \" the other the \" mitochondria . \" In contrast to most normal cells where the mitochondria are the major ATP producers ( > 90 % ) in fueling growth , human cancers detected via Positron Emission Tomography ( PET ) rely on both types of power plants .", "entity": [{"entity": "mitochondria", "entity_type": "Anatomy", "pos": [45, 57]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [89, 94]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [105, 117]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [183, 190]}], "task": "NER"}
+{"text": "In such cancers , glycolysis may contribute nearly half the ATP even in the presence of oxygen ( \" Warburg effect \" ) .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [8, 15]}], "task": "NER"}
+{"text": "Based solely on cell energetics , this presents a challenge to identify curative agents that destroy only cancer cells as they must destroy both of their power plants causing \" necrotic cell death \" and leave normal cells alone .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [16, 20]}, {"entity": "cancer cells", "entity_type": "Anatomy", "pos": [106, 118]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [186, 190]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [216, 221]}], "task": "NER"}
+{"text": "One such agent , 3 - bromopyruvate ( 3 - BrPA ) , a lactic acid analog , has been shown to inhibit both glycolytic and mitochondrial ATP production in rapidly growing cancers ( Ko et al . , Cancer Letts . , 173 , 83 - 91 , 2001 ) , leave normal cells alone , and eradicate advanced cancers ( 19 of 19 ) in a rodent model ( Ko et al . , Biochem . Biophys . Res . Commun . , 324 , 269 - 275 , 2004 ) .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [119, 132]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [167, 174]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [245, 250]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [282, 289]}], "task": "NER"}
+{"text": "A second approach is to induce only cancer cells to undergo \" apoptotic cell death . \" Here , mitochondria release cell death inducing factors ( e . g . , cytochrome c ) .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [36, 48]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [72, 76]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [94, 106]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [115, 119]}], "task": "NER"}
+{"text": "In a third approach , cancer cells are induced to die by both apoptotic and necrotic events .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [22, 34]}], "task": "NER"}
+{"text": "In summary , much effort is being focused on identifying agents that induce \" necrotic , \" \" apoptotic \" or apoptotic plus necrotic cell death only in cancer cells .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [151, 163]}], "task": "NER"}
+{"text": "Regardless how death is inflicted , every cancer cell must die , be it fast or slow .", "entity": [{"entity": "cancer cell", "entity_type": "Anatomy", "pos": [42, 53]}], "task": "NER"}
+{"text": "Determination of eprosartan in human plasma and urine by LC / MS / MS .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [37, 43]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [48, 53]}], "task": "NER"}
+{"text": "A protein precipitation , liquid chromatography / tandem mass spectrometry ( LC / MS / MS ) method has been developed and validated for the determination of eprosartan in human plasma and urine .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [177, 183]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [188, 193]}], "task": "NER"}
+{"text": "The solvent system also served as a protein precipitation reagent .", "entity": [], "task": "NER"}
+{"text": "The chromatographic separation was achieved on a CAPCELL PAK C18 column ( 50 mmx2 . 0 mm , 5 microm , Shiseido ) .", "entity": [], "task": "NER"}
+{"text": "A mobile phase was consisted of 0 . 5 % formic acid in water and 0 . 5 % formic acid in acetonitrile ( 72 : 28 ) .", "entity": [], "task": "NER"}
+{"text": "Detection was by positive ion electrospray tandem mass spectrometry on a Sciex API3000 .", "entity": [], "task": "NER"}
+{"text": "The standard curves , which ranged from 5 to 2000 ng / mL in human plasma and from 0 . 25 to 50 microg / mL in urine , were fitted to a 1 / x weighted quadratic regression model .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [67, 73]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [111, 116]}], "task": "NER"}
+{"text": "The method proved to be accurate , specific and sensitive enough to be successfully applied to a pharmacokinetic study .", "entity": [], "task": "NER"}
+{"text": "Pathological animal models in the experimental evaluation of tumour microvasculature with magnetic resonance imaging .", "entity": [{"entity": "tumour microvasculature", "entity_type": "Anatomy", "pos": [61, 84]}], "task": "NER"}
+{"text": "PURPOSE : The purpose of this study was to evaluate the applications of magnetic resonance imaging ( MRI ) , and in particular , dynamic contrast - enhanced MRI ( DCE - MRI ) , in the assessment of tumour microvasculature by means of animal tumour models evaluated before and after antiangiogenic treatment .", "entity": [{"entity": "tumour microvasculature", "entity_type": "Anatomy", "pos": [198, 221]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [241, 247]}], "task": "NER"}
+{"text": "MATERIALS AND METHODS : Forty - two MRI exams were performed with intravascular contrast media in 21 rats : tumours were induced by subcutaneous injection of colon carcinoma cells in 7 rats and mammary adenocarcinoma cells in 14 rats .", "entity": [{"entity": "intravascular", "entity_type": "Anatomy", "pos": [66, 79]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [108, 115]}, {"entity": "subcutaneous", "entity_type": "Anatomy", "pos": [132, 144]}, {"entity": "colon carcinoma cells", "entity_type": "Anatomy", "pos": [158, 179]}, {"entity": "mammary adenocarcinoma cells", "entity_type": "Anatomy", "pos": [194, 222]}], "task": "NER"}
+{"text": "Perfusion and permeability parameters of the implanted tumours were evaluated by using two contrast media ( B22956 / 1 and Gd - DTPA37 - albumin ) to establish response to treatment with two different antiangiogenic drugs ( tamoxifen and SU6668 ) .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [55, 62]}], "task": "NER"}
+{"text": "These parameters were correlated with histology to obtain a radiological - histological map of tumour microvasculature .", "entity": [{"entity": "tumour microvasculature", "entity_type": "Anatomy", "pos": [95, 118]}], "task": "NER"}
+{"text": "RESULTS : DCE - MRI revealed greater enhancement in the peripheral area than in the central area in all the examined animal models .", "entity": [{"entity": "peripheral area", "entity_type": "Anatomy", "pos": [56, 71]}, {"entity": "central area", "entity_type": "Anatomy", "pos": [84, 96]}], "task": "NER"}
+{"text": "In the mammary carcinoma experiment , vascular permeability measured by means of B22956 / 1 in the animals treated with the antiangiogenic drug ( 0 . 0043317 + / - 0 . 0040418 ml / min ( - 1 ) / ml ( - 1 ) ) was significantly less than in untreated animals ( 0 . 0090460 + / - 0 . 0043680 ml / min ( - 1 ) / ml ( - 1 ) ) , whereas no significant difference was observed with Gd - DTPA - albumin ( 13 . 14 + / - 13 . 94 ml / min ( - 1 ) / ml ( - 1 ) in treated animals and 18 . 07 + / - 11 . 92 ml / min ( - 1 ) / ml ( - 1 ) in untreated animals ) .", "entity": [{"entity": "mammary carcinoma", "entity_type": "Anatomy", "pos": [7, 24]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [38, 46]}], "task": "NER"}
+{"text": "In the colon carcinoma experiment , mean permeability and perfusion decreased by 51 % ( from 5 . 2 + / - 1 . 1 to 2 . 5 + / - 0 . 8 ml / 100 ml ) and 59 % ( from 0 . 00165 + / - 5 . 1 to 0 . 0067 + / - 4 . 8 ml / min ( - 1 ) / ml ( - 1 ) of tissue ) , respectively , in all animals after antiangiogenic drug administration .", "entity": [{"entity": "colon carcinoma", "entity_type": "Anatomy", "pos": [7, 22]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [241, 247]}], "task": "NER"}
+{"text": "CONCLUSIONS : DCE - MRI permits a noninvasive evaluation of tumour microcirculation and in particular of its dynamic characteristics and vascularity before and after antiangiogenic treatment .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [60, 66]}], "task": "NER"}
+{"text": "[ Synthetic fragments of the NS1 protein of the tick - borne encephalitis virus exhibiting a protective effect ] .", "entity": [], "task": "NER"}
+{"text": "Potentially immunoactive regions of the NS1 nonstructural protein of the tick - borne encephalitis virus that can stimulate the antibody formation in vivo and protect animals from this disease were chosen on the basis of theoretical calculations .", "entity": [], "task": "NER"}
+{"text": "Eleven 16 - to 27 - aa peptides containing the chosen regions were synthesized .", "entity": [], "task": "NER"}
+{"text": "The ability of the free peptides ( without any high - molecular - mass carrier ) to stimulate the production of antipeptide antibodies in mice of three lines and ensure the formation of protective immunity was studied .", "entity": [], "task": "NER"}
+{"text": "Most of these peptides were shown to exhibit the immunogenic activity in a free state .", "entity": [], "task": "NER"}
+{"text": "Five fragments that can protect mice from the infection by a lethal dose of tick - borne encephalitis virus were found .", "entity": [], "task": "NER"}
+{"text": "Angiogenesis in the caprine caruncles in non - pregnant and pregnant normal and swainsonine - treated does .", "entity": [{"entity": "caruncles", "entity_type": "Anatomy", "pos": [28, 37]}], "task": "NER"}
+{"text": "Microvascular corrosion casts of caruncles from non - pregnant and pregnant doe goats at 4 , 7 , 10 , 13 , 16 , and 18 weeks were examined with scanning electron microscopy .", "entity": [{"entity": "Microvascular", "entity_type": "Anatomy", "pos": [0, 13]}, {"entity": "caruncles", "entity_type": "Anatomy", "pos": [33, 42]}], "task": "NER"}
+{"text": "The internal convex surface of the caruncles of non - pregnant does was covered with capillary meshes of regular diameter and form , without crypts .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [20, 27]}, {"entity": "caruncles", "entity_type": "Anatomy", "pos": [35, 44]}, {"entity": "capillary meshes", "entity_type": "Anatomy", "pos": [85, 101]}, {"entity": "crypts", "entity_type": "Anatomy", "pos": [141, 147]}], "task": "NER"}
+{"text": "As pregnancy advanced the complexity of the vasculature increased : at 4 weeks the surface showed a pattern of ridges separated by troughs .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [44, 55]}, {"entity": "surface", "entity_type": "Anatomy", "pos": [83, 90]}], "task": "NER"}
+{"text": "At later stages , branches of radial arteries penetrated the periphery forming an extensive mesh of capillaries on the concave surface .", "entity": [{"entity": "branches", "entity_type": "Anatomy", "pos": [18, 26]}, {"entity": "radial arteries", "entity_type": "Anatomy", "pos": [30, 45]}, {"entity": "capillaries", "entity_type": "Anatomy", "pos": [100, 111]}, {"entity": "surface", "entity_type": "Anatomy", "pos": [127, 134]}], "task": "NER"}
+{"text": "Capillary diameters increased significantly during pregnancy , especially after 4 weeks , when large flattened sinusoids formed .", "entity": [{"entity": "Capillary", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "sinusoids", "entity_type": "Anatomy", "pos": [111, 120]}], "task": "NER"}
+{"text": "These sinusoids had a great deal of surface area for potential contact with the fetal component .", "entity": [{"entity": "sinusoids", "entity_type": "Anatomy", "pos": [6, 15]}, {"entity": "surface area", "entity_type": "Anatomy", "pos": [36, 48]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [80, 85]}], "task": "NER"}
+{"text": "The caprine placenta is usually considered to have increased interhemal distance compared with endotheliochorial and hemochorial types : our results suggest that the very extensive development of sinusoids and crypts may compensate for any negative consequences of the placental architecture .", "entity": [{"entity": "placenta", "entity_type": "Anatomy", "pos": [12, 20]}, {"entity": "interhemal", "entity_type": "Anatomy", "pos": [61, 71]}, {"entity": "endotheliochorial", "entity_type": "Anatomy", "pos": [95, 112]}, {"entity": "hemochorial types", "entity_type": "Anatomy", "pos": [117, 134]}, {"entity": "sinusoids", "entity_type": "Anatomy", "pos": [196, 205]}, {"entity": "crypts", "entity_type": "Anatomy", "pos": [210, 216]}, {"entity": "placental", "entity_type": "Anatomy", "pos": [269, 278]}], "task": "NER"}
+{"text": "Placental angiogenesis , which is physiologically normal , may serve as a general model of this process in other circumstances , such as tumor .", "entity": [{"entity": "Placental", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [137, 142]}], "task": "NER"}
+{"text": "The effect of swainsonine ( active compound of locoweed and a potential anticancer drug ) on vascular development showed no differences in sinusoidal diameters at 7 weeks , but a decrease in capillary density was noted .", "entity": [{"entity": "anticancer", "entity_type": "Anatomy", "pos": [72, 82]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [93, 101]}, {"entity": "sinusoidal", "entity_type": "Anatomy", "pos": [139, 149]}, {"entity": "capillary", "entity_type": "Anatomy", "pos": [191, 200]}], "task": "NER"}
+{"text": "Swainsonine caused a great distortion to the vasculature at 18 weeks .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [45, 56]}], "task": "NER"}
+{"text": "The effects of this compound on the vascular development lend credibility to its potential as an anticancer agent .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [36, 44]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [97, 107]}], "task": "NER"}
+{"text": "High - grade clear cell renal cell carcinoma has a higher angiogenic activity than low - grade renal cell carcinoma based on histomorphological quantification and qRT - PCR mRNA expression profile .", "entity": [{"entity": "clear cell renal cell carcinoma", "entity_type": "Anatomy", "pos": [13, 44]}, {"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [95, 115]}], "task": "NER"}
+{"text": "Clear cell renal cell carcinoma ( CC - RCC ) is a highly vascularised tumour and is therefore an attractive disease to study angiogenesis and to test novel angiogenesis inhibitors in early clinical development .", "entity": [{"entity": "Clear cell renal cell carcinoma", "entity_type": "Anatomy", "pos": [0, 31]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [34, 42]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [70, 76]}], "task": "NER"}
+{"text": "Endothelial cell proliferation plays a pivotal role in the process of angiogenesis .", "entity": [{"entity": "Endothelial cell", "entity_type": "Anatomy", "pos": [0, 16]}], "task": "NER"}
+{"text": "The aim of this study was to compare angiogenesis parameters in low nuclear grade ( n = 87 ) vs high nuclear grade CC - RCC ( n = 63 ) .", "entity": [{"entity": "nuclear", "entity_type": "Anatomy", "pos": [68, 75]}, {"entity": "nuclear", "entity_type": "Anatomy", "pos": [101, 108]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [115, 123]}], "task": "NER"}
+{"text": "A panel of antibodies was used for immunohistochemistry : CD34 / Ki - 67 , carbonic anhydrase IX , hypoxia - inducible factor - 1alpha ( HIF - 1alpha ) and vascular endothelial growth factor ( VEGF ) .", "entity": [], "task": "NER"}
+{"text": "Vessel density ( MVD - microvessel density ) , endothelial cell proliferation fraction ( ECP % ) and tumour cell proliferation fraction ( TCP % ) were assessed .", "entity": [{"entity": "Vessel", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [23, 34]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [47, 63]}, {"entity": "tumour cell", "entity_type": "Anatomy", "pos": [101, 112]}], "task": "NER"}
+{"text": "mRNA expression levels of angiogenesis stimulators and inhibitors were determined by quantitative RT - PCR .", "entity": [], "task": "NER"}
+{"text": "High - grade CC - RCC showed a higher ECP % ( P = 0 . 049 ) , a higher TCP % ( P = 0 . 009 ) , a higher VEGF protein expression ( P less than 0 . 001 ) , a lower MVD ( P less than 0 . 001 ) and a lower HIF - 1alpha protein expression ( P = 0 . 002 ) than low - grade CC - RCC .", "entity": [{"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [13, 21]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [267, 275]}], "task": "NER"}
+{"text": "Growth factor mRNA expression analyses revealed a higher expression of angiopoietin 2 in low - grade CC - RCC .", "entity": [{"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [101, 109]}], "task": "NER"}
+{"text": "Microvessel density and ECP % were inversely correlated ( Rho = - 0 . 26 , P = 0 . 001 ) .", "entity": [{"entity": "Microvessel", "entity_type": "Anatomy", "pos": [0, 11]}], "task": "NER"}
+{"text": "Because of the imperfect association of nuclear grade and ECP % or MVD , CC - RCC was also grouped based on low / high MVD and ECP % .", "entity": [{"entity": "nuclear", "entity_type": "Anatomy", "pos": [40, 47]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [73, 81]}], "task": "NER"}
+{"text": "This analysis revealed a higher expression of vessel maturation and stabilisation factors ( placental growth factor , PDGFB1 , angiopoietin 1 ) in CC - RCC with high MVD , a group of CC - RCC highly enriched in low nuclear grade CC - RCC , with low ECP % .", "entity": [{"entity": "vessel", "entity_type": "Anatomy", "pos": [46, 52]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [147, 155]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [183, 191]}, {"entity": "nuclear", "entity_type": "Anatomy", "pos": [215, 222]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [229, 237]}], "task": "NER"}
+{"text": "Our results suggest heterogeneity in angiogenic activity and vessel maturation of CC - RCC , to a large extent linked to nuclear grade , and , with probable therapeutic implications .", "entity": [{"entity": "vessel", "entity_type": "Anatomy", "pos": [61, 67]}, {"entity": "CC - RCC", "entity_type": "Anatomy", "pos": [82, 90]}, {"entity": "nuclear", "entity_type": "Anatomy", "pos": [121, 128]}], "task": "NER"}
+{"text": "Deletion of Tip30 leads to rapid immortalization of murine mammary epithelial cells and ductal hyperplasia in the mammary gland .", "entity": [{"entity": "mammary epithelial cells", "entity_type": "Anatomy", "pos": [59, 83]}, {"entity": "ductal hyperplasia", "entity_type": "Anatomy", "pos": [88, 106]}, {"entity": "mammary gland", "entity_type": "Anatomy", "pos": [114, 127]}], "task": "NER"}
+{"text": "Transformation of mammary epithelial cells ( MECs ) from the normal to the neoplastic stage requires the dysregulation of tumor suppressor genes and proto - oncogenes .", "entity": [{"entity": "mammary epithelial cells", "entity_type": "Anatomy", "pos": [18, 42]}, {"entity": "MECs", "entity_type": "Anatomy", "pos": [45, 49]}, {"entity": "neoplastic", "entity_type": "Anatomy", "pos": [75, 85]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [122, 127]}], "task": "NER"}
+{"text": "Tip30 is a tumor suppressor that can inhibit estrogen receptor - mediated transcription in MECs , but its role in MEC proliferation remains unknown .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [11, 16]}, {"entity": "MECs", "entity_type": "Anatomy", "pos": [91, 95]}, {"entity": "MEC", "entity_type": "Anatomy", "pos": [114, 117]}], "task": "NER"}
+{"text": "Here , we show that deleting the Tip30 gene leads to ductal hyperplasia in mouse mammary glands early in life and extensive mammary hyperplasia with age .", "entity": [{"entity": "ductal hyperplasia", "entity_type": "Anatomy", "pos": [53, 71]}, {"entity": "mammary glands", "entity_type": "Anatomy", "pos": [81, 95]}, {"entity": "mammary hyperplasia", "entity_type": "Anatomy", "pos": [124, 143]}], "task": "NER"}
+{"text": "Tip30 ( - / - ) mammary glands transplanted into wild - type mammary fat pads also display mammary trees with extensive ductal hyperplasia .", "entity": [{"entity": "Tip30 ( - / - ) mammary glands", "entity_type": "Anatomy", "pos": [0, 30]}, {"entity": "mammary fat pads", "entity_type": "Anatomy", "pos": [61, 77]}, {"entity": "mammary trees", "entity_type": "Anatomy", "pos": [91, 104]}, {"entity": "ductal hyperplasia", "entity_type": "Anatomy", "pos": [120, 138]}], "task": "NER"}
+{"text": "Strikingly , Tip30 deletion promotes proliferation of primary MECs and results in rapid immortalization of MECs in vitro relative to wild - type cells .", "entity": [{"entity": "MECs", "entity_type": "Anatomy", "pos": [62, 66]}, {"entity": "MECs", "entity_type": "Anatomy", "pos": [107, 111]}, {"entity": "wild - type cells", "entity_type": "Anatomy", "pos": [133, 150]}], "task": "NER"}
+{"text": "Gene array analysis identified significant increases in the expression of mammary epithelial growth factors Wisp2 and Igf - 1 in Tip30 ( - / - ) cells .", "entity": [{"entity": "mammary epithelial", "entity_type": "Anatomy", "pos": [74, 92]}, {"entity": "Tip30 ( - / - ) cells", "entity_type": "Anatomy", "pos": [129, 150]}], "task": "NER"}
+{"text": "Knockdown of either Wisp2 or Igf - 1 using short interfering RNA dramatically inhibited proliferation of Tip30 ( - / - ) cells .", "entity": [{"entity": "Tip30 ( - / - ) cells", "entity_type": "Anatomy", "pos": [105, 126]}], "task": "NER"}
+{"text": "Together , these results suggest that Tip30 is an intrinsic and negative regulator of MEC proliferation partly through the inhibition of Wisp2 and Igf - 1 expression , and its absence in the mammary gland may predispose MECs to neoplastic transformation .", "entity": [{"entity": "MEC", "entity_type": "Anatomy", "pos": [86, 89]}, {"entity": "mammary gland", "entity_type": "Anatomy", "pos": [191, 204]}, {"entity": "MECs", "entity_type": "Anatomy", "pos": [220, 224]}, {"entity": "neoplastic", "entity_type": "Anatomy", "pos": [228, 238]}], "task": "NER"}
+{"text": "Long - term immunosuppression in burned patients assessed by in vitro neutrophil oxidative burst ( Phagoburst ) .", "entity": [{"entity": "neutrophil", "entity_type": "Anatomy", "pos": [70, 80]}], "task": "NER"}
+{"text": "To assess the duration and magnitude of immunosuppression induced by burns as measured by the neutrophil oxidative burst in vitro .", "entity": [{"entity": "neutrophil", "entity_type": "Anatomy", "pos": [94, 104]}], "task": "NER"}
+{"text": "Prospective exploratory cohort study .", "entity": [], "task": "NER"}
+{"text": "Tertiary referral unit , University Hospital , Linkoping , Sweden ( National Burn Unit ) .", "entity": [], "task": "NER"}
+{"text": "PATIENTS AND HEALTHY VOLUNTEERS ( CONTROLS ) : Twenty - eight subjects consecutively admitted to the Burn Unit .", "entity": [], "task": "NER"}
+{"text": "The mean total burn surface area ( TBSA % ) was 36 ( range 13 - 87 ) and mean age 44 years ( range 14 - 89 ) .", "entity": [{"entity": "surface area", "entity_type": "Anatomy", "pos": [20, 32]}], "task": "NER"}
+{"text": "Patients ' data were collected prospectively in the burn unit , which also included sequential organ failure assessment ( SOFA ) score .", "entity": [{"entity": "organ", "entity_type": "Anatomy", "pos": [95, 100]}], "task": "NER"}
+{"text": "None .", "entity": [], "task": "NER"}
+{"text": "MEASUREMENTS AND RESULTS :", "entity": [], "task": "NER"}
+{"text": "To assess the changes in the oxidative capacity of neutrophils after the burn , blood samples for the Phagoburst analysis were taken on admission and at least once every second week for the duration of stay in hospital and thereafter monthly up to 12 months after the burn .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [51, 62]}, {"entity": "blood samples", "entity_type": "Anatomy", "pos": [80, 93]}], "task": "NER"}
+{"text": "Neutrophils were stimulated in vitro by Escherichia coli , phorbol 12 - phorbol myristate 13 - acetate ( PMA ) , and peptide N - formyl - Met - Leu - Phe ( fMLP ) .", "entity": [{"entity": "Neutrophils", "entity_type": "Anatomy", "pos": [0, 11]}], "task": "NER"}
+{"text": "Oxidative burst was measured by flow cytometry .", "entity": [], "task": "NER"}
+{"text": "Oxidative capacity of the neutrophils decreased similarly for all three stimulants : there was a pathological decrease shortly after admission , with the lowest value occurring between days 7 and 10 , followed by a gradual recovery during the ensuing months .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [26, 37]}], "task": "NER"}
+{"text": "Full recovery ( to the values of the controls ) was seen first 3 . 5 months after the burn .", "entity": [], "task": "NER"}
+{"text": "Using multiple regression , we found that only age and time since the burn significantly ( p < 0 . 05 ) affected the oxidative burst .", "entity": [], "task": "NER"}
+{"text": "White cell count ( WCC ) and C - reactive protein ( CRP ) values returned to reference ranges long before the oxidative burst .", "entity": [{"entity": "White cell", "entity_type": "Anatomy", "pos": [0, 10]}], "task": "NER"}
+{"text": "This study provides evidence that immunosuppression in those injured by burns , as assessed by the in vitro oxidative burst of neutrophils , remains long after the event of the burn ( up to 3 . 5 months after burn ) .", "entity": [{"entity": "neutrophils", "entity_type": "Anatomy", "pos": [127, 138]}], "task": "NER"}
+{"text": "Absence of correlations to TBSA % , FTB % , blood transfusion , opiates provided , and multiple organ failure score and laboratory infection variables together with the finding that decreased oxidative burst was uniform after the injury , suggesting that this immunosuppression is primarily due to the general metabolic response rather than recurring infections .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [44, 49]}, {"entity": "organ", "entity_type": "Anatomy", "pos": [96, 101]}], "task": "NER"}
+{"text": "A pivotal role for p53 : balancing aerobic respiration and glycolysis .", "entity": [], "task": "NER"}
+{"text": "The genetic basis of increased glycolytic activity observed in cancer cells is likely to be the result of complex interactions of multiple regulatory pathways .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [63, 75]}], "task": "NER"}
+{"text": "Here we review the recent evidence of a simple genetic mechanism by which tumor suppressor p53 regulates mitochondrial respiration with secondary changes in glycolysis that are reminiscent of the Warburg effect .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [74, 79]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [105, 118]}], "task": "NER"}
+{"text": "The biological significance of this regulation of the two major pathways of energy generation by p53 remains to be seen .", "entity": [], "task": "NER"}
+{"text": "The contribution of Harold F . Dvorak to the study of tumor angiogenesis and stroma generation mechanisms .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [54, 59]}, {"entity": "stroma", "entity_type": "Anatomy", "pos": [77, 83]}], "task": "NER"}
+{"text": "In 1983 , Harold Dvorak and his colleagues were the first to show that tumor cells secreted vascular permeability factor ( VPF ) and that a blocking antibody to VPF could prevent the edema and fluid accumulation that is characteristic of human cancers .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [71, 82]}, {"entity": "edema", "entity_type": "Anatomy", "pos": [183, 188]}, {"entity": "fluid", "entity_type": "Anatomy", "pos": [193, 198]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [244, 251]}], "task": "NER"}
+{"text": "In 1986 , Dvorak went on to demonstrate that VPF was secreted by a variety of human tumor cell lines and proposed that VPF was in part responsible for the abnormal vasculature seen in human tumors .", "entity": [{"entity": "tumor cell lines", "entity_type": "Anatomy", "pos": [84, 100]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [164, 175]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [190, 196]}], "task": "NER"}
+{"text": "As a result , he and other investigators demonstrated that VPF was capable of stimulating endothelial cell growth and angiogenesis .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [90, 106]}], "task": "NER"}
+{"text": "These fundamental discoveries led to additional research conducted by Napoleone Ferrara and his laboratory , confirming the cloning of VPF and renaming the protein vascular endothelial growth factor ( VEGF ) .", "entity": [], "task": "NER"}
+{"text": "In 1986 , Dvorak proposed that by secreting VPF , tumors induce angiogenesis by turning on the wound healing response .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [50, 56]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [95, 100]}], "task": "NER"}
+{"text": "He noted that wounds , like tumors , secrete VPF , causing blood vessels to leak plasma fibrinogen , which stimulates blood vessel growth and provides a matrix on which they can spread .", "entity": [{"entity": "wounds", "entity_type": "Anatomy", "pos": [14, 20]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [28, 34]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [59, 72]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [81, 87]}, {"entity": "blood vessel", "entity_type": "Anatomy", "pos": [118, 130]}], "task": "NER"}
+{"text": "Unlike wounds , however , that turn off VPF production after healing , tumors did not turn off their VPF production and instead continued to make large amounts of VPF , allowing malignant cells to continue to induce new blood vessels and so to grow and spread .", "entity": [{"entity": "wounds", "entity_type": "Anatomy", "pos": [7, 13]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [71, 77]}, {"entity": "malignant cells", "entity_type": "Anatomy", "pos": [178, 193]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [220, 233]}], "task": "NER"}
+{"text": "Thus , tumors behave like wounds that fail to heal .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [7, 13]}, {"entity": "wounds", "entity_type": "Anatomy", "pos": [26, 32]}], "task": "NER"}
+{"text": "This work is again extremely significant for patients worldwide , as Dvorak ' s scientific research is leading his colleagues all over the world to examine how to treat a tumor through its blood supply .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [171, 176]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [189, 194]}], "task": "NER"}
+{"text": "Neurohypophyseal granulomatous germinoma invading the right cavernous sinus : case report and review of the literature .", "entity": [{"entity": "Neurohypophyseal granulomatous germinoma", "entity_type": "Anatomy", "pos": [0, 40]}, {"entity": "right cavernous sinus", "entity_type": "Anatomy", "pos": [54, 75]}], "task": "NER"}
+{"text": "We encountered a rare case of neurohypophyseal germinoma with a prominent granulomatous reaction , which invaded the right cavernous sinus .", "entity": [{"entity": "neurohypophyseal germinoma", "entity_type": "Anatomy", "pos": [30, 56]}, {"entity": "right cavernous sinus", "entity_type": "Anatomy", "pos": [117, 138]}], "task": "NER"}
+{"text": "The neuroimaging and histopathology features in this case were unique , distinguishing it from other types of suprasellar lesions .", "entity": [{"entity": "suprasellar lesions", "entity_type": "Anatomy", "pos": [110, 129]}], "task": "NER"}
+{"text": "A 13 - year - old boy presented with loss of appetite and polyuria ; both symptoms were present for 1 year , and headache , general fatigue and blurred vision present for the prior 2 months .", "entity": [], "task": "NER"}
+{"text": "On admission , neurological examination indicated bitemporal hemianopsia and optic atrophy .", "entity": [{"entity": "neurological", "entity_type": "Anatomy", "pos": [15, 27]}], "task": "NER"}
+{"text": "Endocrinological exam showed panhypopituitarism .", "entity": [], "task": "NER"}
+{"text": "Tumor markers such as alpha - fetoprotein , human growth hormone , carcinoembryonic antigen , and placental alkaline phosphatase were negative .", "entity": [{"entity": "Tumor", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "placental", "entity_type": "Anatomy", "pos": [98, 107]}], "task": "NER"}
+{"text": "Brain CT revealed a suprasellar tumor with calcification .", "entity": [{"entity": "Brain", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "suprasellar tumor", "entity_type": "Anatomy", "pos": [20, 37]}], "task": "NER"}
+{"text": "MR T ( 1 ) - weighted and T ( 2 ) - weighted images showed the tumor to be isointense to normal brain parenchyma and to be enhanced densely .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [63, 68]}, {"entity": "brain parenchyma", "entity_type": "Anatomy", "pos": [96, 112]}], "task": "NER"}
+{"text": "The tumor also involved the right cavernous sinus , so that a biopsy was performed by the transsphenoidal approach .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [4, 9]}, {"entity": "right cavernous sinus", "entity_type": "Anatomy", "pos": [28, 49]}, {"entity": "transsphenoidal", "entity_type": "Anatomy", "pos": [90, 105]}], "task": "NER"}
+{"text": "On pathologic examination of the specimen , typical large tumor cells with lymphocytic cell infiltration and prominent granulomatous reaction were observed .", "entity": [{"entity": "specimen", "entity_type": "Anatomy", "pos": [33, 41]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [58, 69]}, {"entity": "lymphocytic cell", "entity_type": "Anatomy", "pos": [75, 91]}], "task": "NER"}
+{"text": "Neurohypophyseal granulomatous germinoma was diagnosed .", "entity": [{"entity": "Neurohypophyseal granulomatous germinoma", "entity_type": "Anatomy", "pos": [0, 40]}], "task": "NER"}
+{"text": "Radiotherapy was performed with a total dose of 51 Gy and the tumor shrank remarkably .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [62, 67]}], "task": "NER"}
+{"text": "The patient returned to school under hormone replacement therapy .", "entity": [], "task": "NER"}
+{"text": "Melissoidesin G , a diterpenoid purified from Isodon melissoides , induces leukemic - cell apoptosis through induction of redox imbalance and exhibits synergy with other anticancer agents .", "entity": [{"entity": "leukemic - cell", "entity_type": "Anatomy", "pos": [75, 90]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [170, 180]}], "task": "NER"}
+{"text": "Melissoidesin G ( MOG ) is a new diterpenoid purified from Isodon melissoides , a plant used in Chinese traditional medicine as antitumor and anti - inflammatory agents .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [128, 137]}], "task": "NER"}
+{"text": "In our study , MOG was shown to specifically inhibit the growth of human leukemia cell lines and primary acute myeloid leukemia ( AML ) blasts via induction of apoptosis , with the evidence of mitochondrial DeltaPsim loss , reactive oxygen species production , caspases activation and nuclear fragmentation .", "entity": [{"entity": "leukemia cell lines", "entity_type": "Anatomy", "pos": [73, 92]}, {"entity": "primary acute myeloid leukemia ( AML ) blasts", "entity_type": "Anatomy", "pos": [97, 142]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [193, 206]}, {"entity": "nuclear", "entity_type": "Anatomy", "pos": [285, 292]}], "task": "NER"}
+{"text": "Furthermore , it was shown that thiol - containing antioxidants completely blocked MOG - induced mitochondrial DeltaPsim loss and subsequent cell apoptosis , while the inhibition of apoptosis by benzyloxy - carbonyl - Val - Ala - Asp - fluoromethylketone only partially attenuated mitochondrial DeltaPsim loss , indicating that MOG - induced redox imbalance is an early event upstream to mitochondrial DeltaPsim loss and caspase - 3 activation .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [97, 110]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [141, 145]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [281, 294]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [388, 401]}], "task": "NER"}
+{"text": "Consistently , it was found that MOG rapidly decreased the intracellular glutathione ( GSH ) content in a dose - dependent manner and the significance of GSH depletion in MOG - induced apoptosis was further supported by the protective effects of tert - butylhydroquinone ( tBHQ ) and the facilitative effects of DL - buthionine ( S , R ) - sulfoximine ( BSO ) .", "entity": [{"entity": "intracellular", "entity_type": "Anatomy", "pos": [59, 72]}], "task": "NER"}
+{"text": "Furthermore , it was showed that GSH depletion induced by MOG rendered some leukemia cell lines more sensitive to arsenic trioxide ( As2O3 ) , doxorubicin or cisplatin .", "entity": [{"entity": "leukemia cell lines", "entity_type": "Anatomy", "pos": [76, 95]}], "task": "NER"}
+{"text": "Additionally , the synergistic apoptotic effects of MOG with As2O3 were detected in HL - 60 and primary AML cells , but not in normal cells , suggesting the selective toxicity of their combination to the malignant cells .", "entity": [{"entity": "HL - 60", "entity_type": "Anatomy", "pos": [84, 91]}, {"entity": "primary AML cells", "entity_type": "Anatomy", "pos": [96, 113]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [134, 139]}, {"entity": "malignant cells", "entity_type": "Anatomy", "pos": [204, 219]}], "task": "NER"}
+{"text": "Together , we proposed that MOG alone or administered with other anticancer agents may provide a novel therapeutic strategy for leukemia .", "entity": [{"entity": "anticancer", "entity_type": "Anatomy", "pos": [65, 75]}, {"entity": "leukemia", "entity_type": "Anatomy", "pos": [128, 136]}], "task": "NER"}
+{"text": "Hedgehog signaling in the murine melanoma microenvironment .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [33, 41]}], "task": "NER"}
+{"text": "The Hedgehog intercellular signaling pathway regulates cell proliferation and differentiation .", "entity": [{"entity": "intercellular", "entity_type": "Anatomy", "pos": [13, 26]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [55, 59]}], "task": "NER"}
+{"text": "This pathway has been implicated to play a role in the pathogenesis of cancer and in embryonic blood vessel development .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [71, 77]}, {"entity": "embryonic blood vessel", "entity_type": "Anatomy", "pos": [85, 107]}], "task": "NER"}
+{"text": "In the current study , Hedgehog signaling in tumor related vasculature and microenvironment was examined using human umbilical vein endothelial cells and B16F0 ( murine melanoma ) tumors models .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [45, 50]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [59, 70]}, {"entity": "human umbilical vein endothelial cells", "entity_type": "Anatomy", "pos": [111, 149]}, {"entity": "B16F0", "entity_type": "Anatomy", "pos": [154, 159]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [169, 177]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [180, 186]}], "task": "NER"}
+{"text": "Use of exogenous Sonic hedgehog ( Shh ) peptide significantly increased BrdU incorporation in endothelial cells in vitro by a factor of 2 ( P less than 0 . 001 ) .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [94, 111]}], "task": "NER"}
+{"text": "The Hedgehog pathway antagonist cyclopamine effectively reduced Shh - induced proliferation to control levels .", "entity": [], "task": "NER"}
+{"text": "To study Hedgehog signaling in vivo a hind limb tumor model with the B16F0 cell line was used .", "entity": [{"entity": "hind limb tumor", "entity_type": "Anatomy", "pos": [38, 53]}, {"entity": "B16F0 cell line", "entity_type": "Anatomy", "pos": [69, 84]}], "task": "NER"}
+{"text": "Treatment with 25 mg / kg cyclopamine significantly attenuated BrdU incorporation in tumor cells threefold ( P less than 0 . 001 ) , in tumor related endothelial cells threefold ( P = 0 . 004 ) , and delayed tumor growth by 4 days .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [85, 96]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [136, 141]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [150, 167]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [208, 213]}], "task": "NER"}
+{"text": "Immunohistochemistry revealed that the Hedgehog receptor Patched was localized to the tumor stroma and that B16F0 cells expressed Shh peptide .", "entity": [{"entity": "tumor stroma", "entity_type": "Anatomy", "pos": [86, 98]}, {"entity": "B16F0 cells", "entity_type": "Anatomy", "pos": [108, 119]}], "task": "NER"}
+{"text": "Furthermore , mouse embryonic fibroblasts required the presence of B16F0 cells to express Patched in a co - culture assay system .", "entity": [{"entity": "embryonic fibroblasts", "entity_type": "Anatomy", "pos": [20, 41]}, {"entity": "B16F0 cells", "entity_type": "Anatomy", "pos": [67, 78]}], "task": "NER"}
+{"text": "These studies indicate that Shh peptide produced by melanoma cells induces Patched expression in fibroblasts .", "entity": [{"entity": "melanoma cells", "entity_type": "Anatomy", "pos": [52, 66]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [97, 108]}], "task": "NER"}
+{"text": "To study tumor related angiogenesis a vascular window model was used to monitor tumor vascularity .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [9, 14]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [80, 85]}], "task": "NER"}
+{"text": "Treatment with cyclopamine significantly attenuated vascular formation by a factor of 2 . 5 ( P less than 0 . 001 ) and altered vascular morphology .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [52, 60]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [128, 136]}], "task": "NER"}
+{"text": "Furthermore , cyclopamine reduced tumor blood vessel permeability to FITC labeled dextran while having no effect on normal blood vessels .", "entity": [{"entity": "tumor blood vessel", "entity_type": "Anatomy", "pos": [34, 52]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [123, 136]}], "task": "NER"}
+{"text": "These studies suggest that Hedgehog signaling regulates melanoma related vascular formation and function .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [56, 64]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [73, 81]}], "task": "NER"}
+{"text": "Expression of epidermal growth factor receptor , transforming growth factor - alpha and Ki - 67 in relationship to malignant transformation of pleomorphic adenoma .", "entity": [{"entity": "pleomorphic adenoma", "entity_type": "Anatomy", "pos": [143, 162]}], "task": "NER"}
+{"text": "CONCLUSION : Quantitative assessment is more sensitive as a measure of cellular protein content as compared with standard optical density measurements .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [71, 79]}], "task": "NER"}
+{"text": "The data support the hypothesis that increased epidermal growth factor receptor ( EGFR ) and transforming growth factor ( TGF ) - alpha expression is associated with early events in malignant transformation of pleomorphic adenoma ( PA ) .", "entity": [{"entity": "pleomorphic adenoma", "entity_type": "Anatomy", "pos": [210, 229]}, {"entity": "PA", "entity_type": "Anatomy", "pos": [232, 234]}], "task": "NER"}
+{"text": "OBJECTIVE : In the present study , we attempted to identify EGFR and TGF - alpha expression and Ki - 67 index in carcinoma ex - pleomorphic adenoma ( Ca ex - PA ) and PA .", "entity": [{"entity": "carcinoma ex - pleomorphic adenoma", "entity_type": "Anatomy", "pos": [113, 147]}, {"entity": "Ca ex - PA", "entity_type": "Anatomy", "pos": [150, 160]}, {"entity": "PA", "entity_type": "Anatomy", "pos": [167, 169]}], "task": "NER"}
+{"text": "We also compared the presence of EGFR and TGF - alpha and Ki - 67 index with clinical data .", "entity": [], "task": "NER"}
+{"text": "MATERIALS AND METHODS : The tissues were stained with monoclonal antibodies to EGFR , TGF - alpha and Ki - 67 .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [28, 35]}], "task": "NER"}
+{"text": "The results were analysed using quantitative immunohistochemical analysis .", "entity": [], "task": "NER"}
+{"text": "We also analysed the association of patients ' prognosis with clinical parameters and the histological classification of the carcinomatous component .", "entity": [{"entity": "carcinomatous component", "entity_type": "Anatomy", "pos": [125, 148]}], "task": "NER"}
+{"text": "RESULTS : As regards the association of patients ' prognosis with EGFR staining and Ki - 67 index , a significant increase was observed in patients who died or had residual disease compared with patients who were alive without disease .", "entity": [], "task": "NER"}
+{"text": "In the immunohistochemical analysis of EGFR and TGF - alpha and Ki67 index , a significant increase was observed in Ca ex - PA , especially with adenocarcinoma , compared with PA and sialadenitis .", "entity": [{"entity": "Ca ex - PA", "entity_type": "Anatomy", "pos": [116, 126]}, {"entity": "adenocarcinoma", "entity_type": "Anatomy", "pos": [145, 159]}, {"entity": "PA", "entity_type": "Anatomy", "pos": [176, 178]}], "task": "NER"}
+{"text": "CX3CR1 - dependent subretinal microglia cell accumulation is associated with cardinal features of age - related macular degeneration .", "entity": [{"entity": "subretinal microglia cell", "entity_type": "Anatomy", "pos": [19, 44]}, {"entity": "macular", "entity_type": "Anatomy", "pos": [112, 119]}], "task": "NER"}
+{"text": "The role of retinal microglial cells ( MCs ) in age - related macular degeneration ( AMD ) is unclear .", "entity": [{"entity": "retinal microglial cells", "entity_type": "Anatomy", "pos": [12, 36]}, {"entity": "MCs", "entity_type": "Anatomy", "pos": [39, 42]}, {"entity": "macular", "entity_type": "Anatomy", "pos": [62, 69]}], "task": "NER"}
+{"text": "Here we demonstrated that all retinal MCs express CX3C chemokine receptor 1 ( CX3CR1 ) and that homozygosity for the CX3CR1 M280 allele , which is associated with impaired cell migration , increases the risk of AMD .", "entity": [{"entity": "retinal MCs", "entity_type": "Anatomy", "pos": [30, 41]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [172, 176]}], "task": "NER"}
+{"text": "In humans with AMD , MCs accumulated in the subretinal space at sites of retinal degeneration and choroidal neovascularization ( CNV ) .", "entity": [{"entity": "MCs", "entity_type": "Anatomy", "pos": [21, 24]}, {"entity": "subretinal space", "entity_type": "Anatomy", "pos": [44, 60]}, {"entity": "sites", "entity_type": "Anatomy", "pos": [64, 69]}, {"entity": "retinal", "entity_type": "Anatomy", "pos": [73, 80]}, {"entity": "choroidal", "entity_type": "Anatomy", "pos": [98, 107]}], "task": "NER"}
+{"text": "In CX3CR1 - deficient mice , MCs accumulated subretinally with age and albino background and after laser impact preceding retinal degeneration .", "entity": [{"entity": "MCs", "entity_type": "Anatomy", "pos": [29, 32]}, {"entity": "subretinally", "entity_type": "Anatomy", "pos": [45, 57]}, {"entity": "retinal", "entity_type": "Anatomy", "pos": [122, 129]}], "task": "NER"}
+{"text": "Raising the albino mice in the dark prevented both events .", "entity": [], "task": "NER"}
+{"text": "The appearance of lipid - bloated subretinal MCs was drusen - like on funduscopy of senescent mice , and CX3CR1 - dependent MC accumulation was associated with an exacerbation of experimental CNV .", "entity": [{"entity": "subretinal MCs", "entity_type": "Anatomy", "pos": [34, 48]}, {"entity": "drusen", "entity_type": "Anatomy", "pos": [53, 59]}, {"entity": "MC", "entity_type": "Anatomy", "pos": [124, 126]}], "task": "NER"}
+{"text": "These results show that CX3CR1 - dependent accumulation of subretinal MCs evokes cardinal features of AMD .", "entity": [{"entity": "subretinal MCs", "entity_type": "Anatomy", "pos": [59, 73]}], "task": "NER"}
+{"text": "These findings reveal what we believe to be a novel pathogenic process with important implications for the development of new therapies for AMD .", "entity": [], "task": "NER"}
+{"text": "Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice .", "entity": [{"entity": "somatic cells", "entity_type": "Anatomy", "pos": [43, 56]}, {"entity": "gonads", "entity_type": "Anatomy", "pos": [76, 82]}, {"entity": "metastatic tumor", "entity_type": "Anatomy", "pos": [92, 108]}], "task": "NER"}
+{"text": "The transforming growth factor beta ( TGFbeta ) family has critical roles in the regulation of fertility .", "entity": [], "task": "NER"}
+{"text": "In addition , the pathogenesis of some human cancers is attributed to misregulation of TGFbeta function and SMAD2 or SMAD4 mutations .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [45, 52]}], "task": "NER"}
+{"text": "There are limited mouse models for the BMP signaling SMADs ( BR - SMADs ) 1 , 5 , and 8 because of embryonic lethality and suspected genetic redundancy .", "entity": [{"entity": "embryonic", "entity_type": "Anatomy", "pos": [99, 108]}], "task": "NER"}
+{"text": "Using tissue - specific ablation in mice , we deleted the BR - SMADs from somatic cells of ovaries and testes .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [6, 12]}, {"entity": "somatic cells", "entity_type": "Anatomy", "pos": [74, 87]}, {"entity": "ovaries", "entity_type": "Anatomy", "pos": [91, 98]}, {"entity": "testes", "entity_type": "Anatomy", "pos": [103, 109]}], "task": "NER"}
+{"text": "Single conditional knockouts for Smad1 or Smad5 or mice homozygous null for Smad8 are viable and fertile .", "entity": [], "task": "NER"}
+{"text": "Female double Smad1 Smad5 and triple Smad1 Smad5 Smad8 conditional knockout mice become infertile and develop metastatic granulosa cell tumors .", "entity": [{"entity": "metastatic granulosa cell tumors", "entity_type": "Anatomy", "pos": [110, 142]}], "task": "NER"}
+{"text": "Male double Smad1 Smad5 conditional knockout mice are fertile but demonstrate metastatic testicular tumor development .", "entity": [{"entity": "metastatic testicular tumor", "entity_type": "Anatomy", "pos": [78, 105]}], "task": "NER"}
+{"text": "Microarray analysis indicated significant alterations in expression of genes related to the TGFbeta pathway , as well as genes involved in infertility and extracellular matrix production .", "entity": [{"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [155, 175]}], "task": "NER"}
+{"text": "These data strongly implicate the BR - SMADs as part of a critical developmental pathway in ovaries and testis that , when disrupted , leads to malignant transformation .", "entity": [{"entity": "ovaries", "entity_type": "Anatomy", "pos": [92, 99]}, {"entity": "testis", "entity_type": "Anatomy", "pos": [104, 110]}], "task": "NER"}
+{"text": "Melanoma / skin cancer screening clinics : experiences in The Netherlands .", "entity": [{"entity": "Melanoma", "entity_type": "Anatomy", "pos": [0, 8]}, {"entity": "skin cancer", "entity_type": "Anatomy", "pos": [11, 22]}], "task": "NER"}
+{"text": "In 1989 and 1990 we conducted two free melanoma / skin screening clinics in Oss and Arnhem in the Netherlands .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [39, 47]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [50, 54]}], "task": "NER"}
+{"text": "The study was carried out along the lines of the recent campaigns supported by the American Academy of Dermatology .", "entity": [], "task": "NER"}
+{"text": "Of 2564 persons screened , 53 had melanoma or nonmelanoma skin cancer ( 2 . 1 % ) .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [34, 42]}, {"entity": "nonmelanoma skin cancer", "entity_type": "Anatomy", "pos": [46, 69]}], "task": "NER"}
+{"text": "Compliance with follow - up for persons with suspected melanoma / skin cancer was adequate ( 93 of 103 ; 90 . 3 % ) .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [55, 63]}, {"entity": "skin cancer", "entity_type": "Anatomy", "pos": [66, 77]}], "task": "NER"}
+{"text": "[ Clinical significance of interleukin - 6 ( IL - 6 ) as a prognostic factor of cancer disease ]", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [80, 86]}], "task": "NER"}
+{"text": "Interleukin - 6 ( IL - 6 ) is proinflammatory cytokine that produces multifunctional effects .", "entity": [], "task": "NER"}
+{"text": "It is also involved in the regulation of immune reactions , hematopoiesis and inflammatory state .", "entity": [], "task": "NER"}
+{"text": "Interleukin - 6 has been shown to be associated with tumor progression including inhibition of cancer cells apoptosis and stimulation of angiogenesis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [53, 58]}, {"entity": "cancer cells", "entity_type": "Anatomy", "pos": [95, 107]}], "task": "NER"}
+{"text": "Anti - IL - 6 therapy is a new strategy in the inflammatory autoimmune diseases and cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [84, 90]}], "task": "NER"}
+{"text": "Clinical studies have shown elevated serum IL - 6 concentrations in patients with endometrial cancer , non - small cell lung carcinoma , colorectal cancer , renal cell carcinoma , breast and ovarian cancer .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [37, 42]}, {"entity": "endometrial cancer", "entity_type": "Anatomy", "pos": [82, 100]}, {"entity": "non - small cell lung carcinoma", "entity_type": "Anatomy", "pos": [103, 134]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [137, 154]}, {"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [157, 177]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [180, 186]}, {"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [191, 205]}], "task": "NER"}
+{"text": "Serum IL - 6 levels correlate with tumor stage , and survival of patients .", "entity": [{"entity": "Serum", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [35, 40]}], "task": "NER"}
+{"text": "In this article we have focused on a role of IL - 6 as a prognostic factor in several malignancies such as colorectal cancer , breast cancer , gastric cancer and pancreatic cancer .", "entity": [{"entity": "malignancies", "entity_type": "Anatomy", "pos": [86, 98]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [107, 124]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [127, 140]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [143, 157]}, {"entity": "pancreatic cancer", "entity_type": "Anatomy", "pos": [162, 179]}], "task": "NER"}
+{"text": "Expression of CDK4 or CDK2 in mouse oral cavity is retained in adult pituitary with distinct effects on tumorigenesis .", "entity": [{"entity": "oral cavity", "entity_type": "Anatomy", "pos": [36, 47]}, {"entity": "pituitary", "entity_type": "Anatomy", "pos": [69, 78]}], "task": "NER"}
+{"text": "The keratin 5 ( K5 ) promoter drives transgenic expression to the basal cell layer of stratified epithelia .", "entity": [{"entity": "basal cell", "entity_type": "Anatomy", "pos": [66, 76]}, {"entity": "epithelia", "entity_type": "Anatomy", "pos": [97, 106]}], "task": "NER"}
+{"text": "Surprisingly , analysis of K5CDK4 and K5CDK2 transgenic mouse embryos showed CDK4 and CDK2 expression not only in the expected tissues , but also in the adenohypophysis .", "entity": [{"entity": "embryos", "entity_type": "Anatomy", "pos": [62, 69]}, {"entity": "tissues", "entity_type": "Anatomy", "pos": [127, 134]}, {"entity": "adenohypophysis", "entity_type": "Anatomy", "pos": [153, 168]}], "task": "NER"}
+{"text": "This organ is derived from an upwards growth of the primitive oropharynx , a K5 - expressing tissue .", "entity": [{"entity": "organ", "entity_type": "Anatomy", "pos": [5, 10]}, {"entity": "oropharynx", "entity_type": "Anatomy", "pos": [62, 72]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [93, 99]}], "task": "NER"}
+{"text": "We show that transgenic expression of CDKs in the embryonic oral ectoderm is specifically retained in undifferentiated cells from the pars intermedia of the adenohypophysis .", "entity": [{"entity": "embryonic oral ectoderm", "entity_type": "Anatomy", "pos": [50, 73]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [119, 124]}, {"entity": "pars intermedia", "entity_type": "Anatomy", "pos": [134, 149]}, {"entity": "adenohypophysis", "entity_type": "Anatomy", "pos": [157, 172]}], "task": "NER"}
+{"text": "Interestingly , we found that K5CDK4 mice show a decreased number of pituitary stem cells , even though CDK4 is not expressed in the stem cells but in transit - amplifying ( TA ) - like cells .", "entity": [{"entity": "pituitary stem cells", "entity_type": "Anatomy", "pos": [69, 89]}, {"entity": "stem cells", "entity_type": "Anatomy", "pos": [133, 143]}, {"entity": "transit - amplifying ( TA ) - like cells", "entity_type": "Anatomy", "pos": [151, 191]}], "task": "NER"}
+{"text": "Interestingly , CDK4 - expressing cells , but not CDK2 - expressing cells , strongly synergize with lack of p27 ( Kip1 ) to generate pituitary carcinomas that appear with shortened latency and are drastically more aggressive than those arising in p27 ( - / - ) mice .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [34, 39]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [68, 73]}, {"entity": "pituitary carcinomas", "entity_type": "Anatomy", "pos": [133, 153]}], "task": "NER"}
+{"text": "Thus , we show that deregulation of CDK expression in the primitive oral epithelium plays a unique function , providing a selective advantage that gives rise to transgene - positive TA - like pituitary cells .", "entity": [{"entity": "primitive oral epithelium", "entity_type": "Anatomy", "pos": [58, 83]}, {"entity": "transgene - positive TA - like pituitary cells", "entity_type": "Anatomy", "pos": [161, 207]}], "task": "NER"}
+{"text": "Furthermore , retention of CDK4 in these TA - like pituitary cells synergizes with loss of p27 ( Kip1 ) to induce pituitary adenocarcinomas .", "entity": [{"entity": "TA - like pituitary cells", "entity_type": "Anatomy", "pos": [41, 66]}, {"entity": "pituitary adenocarcinomas", "entity_type": "Anatomy", "pos": [114, 139]}], "task": "NER"}
+{"text": "This model suggests that forced expression of CDK4 sensitizes cells and synergizes with a second change resulting in tumor development .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [117, 122]}], "task": "NER"}
+{"text": "Survivin expression in breast carcinoma : correlation with apoptosis and prognosis .", "entity": [{"entity": "breast carcinoma", "entity_type": "Anatomy", "pos": [23, 39]}], "task": "NER"}
+{"text": "BACKGROUND : Survivin is a novel inhibitor of apoptosis commonly detected in tissues during fetal development and in cancer , but not usually in normal tissues .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [77, 84]}, {"entity": "fetal", "entity_type": "Anatomy", "pos": [92, 97]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [117, 123]}, {"entity": "tissues", "entity_type": "Anatomy", "pos": [152, 159]}], "task": "NER"}
+{"text": "It has been suggested that the expression of this protein may be of prognostic significance in gastric , colorectal , and bladder carcinomas .", "entity": [{"entity": "gastric", "entity_type": "Anatomy", "pos": [95, 102]}, {"entity": "colorectal", "entity_type": "Anatomy", "pos": [105, 115]}, {"entity": "bladder carcinomas", "entity_type": "Anatomy", "pos": [122, 140]}], "task": "NER"}
+{"text": "We assessed survivin expression in breast carcinomas correlating results with expression of other antiapoptotic ( bcl - 2 , bcl - x ) and proapoptotic ( bax ) markers , with prognostic parameters , and with prognosis .", "entity": [{"entity": "breast carcinomas", "entity_type": "Anatomy", "pos": [35, 52]}], "task": "NER"}
+{"text": "DESIGN : Paraffin - embedded sections of 37 breast carcinomas were immunostained for survivin , bcl - 2 , bcl - x , and bax .", "entity": [{"entity": "sections", "entity_type": "Anatomy", "pos": [29, 37]}, {"entity": "breast carcinomas", "entity_type": "Anatomy", "pos": [44, 61]}], "task": "NER"}
+{"text": "Expression was evaluated in normal breast tissue and carcinoma , nuclei and cytoplasm , as intensity ( 0 to 3 + ) , and percentage of positive cells .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [35, 48]}, {"entity": "carcinoma", "entity_type": "Anatomy", "pos": [53, 62]}, {"entity": "nuclei", "entity_type": "Anatomy", "pos": [65, 71]}, {"entity": "cytoplasm", "entity_type": "Anatomy", "pos": [76, 85]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [143, 148]}], "task": "NER"}
+{"text": "RESULTS : Survivin expression was noted in 30 ( 81 % ) of breast carcinomas , and in normal breast tissue , in nuclei , and cytoplasm .", "entity": [{"entity": "breast carcinomas", "entity_type": "Anatomy", "pos": [58, 75]}, {"entity": "breast tissue", "entity_type": "Anatomy", "pos": [92, 105]}, {"entity": "nuclei", "entity_type": "Anatomy", "pos": [111, 117]}, {"entity": "cytoplasm", "entity_type": "Anatomy", "pos": [124, 133]}], "task": "NER"}
+{"text": "There was a significant correlation ( P = 0 . 022 ) between survivin and bcl - x expression ; survivin and bcl - x tended to correlate with overall survival ( P = 0 . 072 and 0 . 075 , respectively ) , but not with disease - free survival ( P = 0 . 19 and 0 . 18 , respectively ) .", "entity": [], "task": "NER"}
+{"text": "There was no correlation of survivin with bcl - 2 or bax expression , or with other prognostic parameters ( age , tumor size , histologic type , histologic grade , nodal status , and tumor stage ) ( P > 0 . 05 ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [114, 119]}, {"entity": "nodal", "entity_type": "Anatomy", "pos": [164, 169]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [183, 188]}], "task": "NER"}
+{"text": "CONCLUSION : The majority ( 81 % ) of breast carcinomas show survivin expression which correlates with bcl - x , another antiapoptotic marker , and both markers tend to correlate with prognosis .", "entity": [{"entity": "breast carcinomas", "entity_type": "Anatomy", "pos": [38, 55]}], "task": "NER"}
+{"text": "Impact of dexamethasone - induced immunosuppression on the duration and level of shedding of Escherichia coli O157 : H7 in calves .", "entity": [], "task": "NER"}
+{"text": "The goal of this study was to determine whether immunosuppression plays a role in the level and duration of fecal shedding of Escherichia coli O157 .", "entity": [{"entity": "fecal", "entity_type": "Anatomy", "pos": [108, 113]}], "task": "NER"}
+{"text": "Immunosuppression was induced in calves by administering dexamethasone .", "entity": [], "task": "NER"}
+{"text": "Six 1 - week - old Holstein bull calves were injected intramuscularly with dexamethasone and orally inoculated with 10 ( 9 ) CFU of a mixture of three nalidixic - acid resistant strains of E . coli O157 : H7 .", "entity": [{"entity": "intramuscularly", "entity_type": "Anatomy", "pos": [54, 69]}, {"entity": "orally", "entity_type": "Anatomy", "pos": [93, 99]}, {"entity": "strains", "entity_type": "Anatomy", "pos": [178, 185]}], "task": "NER"}
+{"text": "Five 1 - week - old Holstein bull calves that were given the same oral inoculation of E . coli O157 : H7 , but not the dexamethasone injections , served as controls .", "entity": [{"entity": "oral", "entity_type": "Anatomy", "pos": [66, 70]}], "task": "NER"}
+{"text": "All calves were examined daily and fecal samples were collected three times a week for detection and enumeration of the nalidixic - acid resistant E . coli O157 .", "entity": [{"entity": "fecal samples", "entity_type": "Anatomy", "pos": [35, 48]}], "task": "NER"}
+{"text": "Four weeks after the last calf stopped shedding , all calves were necropsied and samples from the gastrointestinal tract were taken for the detection of the nalidixic - acid resistant E . coli O157 .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [81, 88]}, {"entity": "gastrointestinal tract", "entity_type": "Anatomy", "pos": [98, 120]}], "task": "NER"}
+{"text": "Dexamethasone - injected calves shed at higher levels ( P = 0 . 04 ) on days 4 and 7 postinoculation , but not thereafter .", "entity": [], "task": "NER"}
+{"text": "None of the samples collected at necropsy were positive for E . coli O157 .", "entity": [{"entity": "samples", "entity_type": "Anatomy", "pos": [12, 19]}], "task": "NER"}
+{"text": "Data from this study suggest that there may be a time - dependent relationship between dexamethasone immunosuppression and the fecal concentration of E . coli O157 but that transient immunosuppression does not appear to prolong shedding of E . coli O157 .", "entity": [{"entity": "fecal", "entity_type": "Anatomy", "pos": [127, 132]}], "task": "NER"}
+{"text": "Functional significance of VEGF - a in human ovarian carcinoma : role in vasculogenic mimicry .", "entity": [{"entity": "ovarian carcinoma", "entity_type": "Anatomy", "pos": [45, 62]}], "task": "NER"}
+{"text": "Ovarian cancer is a silent killer , and shows early extensive tumor invasion and peritoneal metastasis .", "entity": [{"entity": "Ovarian cancer", "entity_type": "Anatomy", "pos": [0, 14]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "peritoneal", "entity_type": "Anatomy", "pos": [81, 91]}], "task": "NER"}
+{"text": "The microcirculation of most tumors includes cooperation of pre - existing vessels , intussusceptive microvascular growth , postnatal vasculogenesis , glomeruloid angiogenesis and vasculogenic mimicry ( VM ) .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [29, 35]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [75, 82]}, {"entity": "microvascular", "entity_type": "Anatomy", "pos": [101, 114]}, {"entity": "glomeruloid", "entity_type": "Anatomy", "pos": [151, 162]}], "task": "NER"}
+{"text": "VM is critical for a tumor blood supply and is asscociated with aggressive features and metastasis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [21, 26]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [27, 32]}], "task": "NER"}
+{"text": "Our studies highlight the plasticity of aggressive human ovarian carcinoma cells and call into question the underlying significance of their ability to form VM in vitro induced by VEGF - a .", "entity": [{"entity": "ovarian carcinoma cells", "entity_type": "Anatomy", "pos": [57, 80]}], "task": "NER"}
+{"text": "These studies also show their clinicalpathological features of the cancers with human Paraffin - embedded tumor tissue samples .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [67, 74]}, {"entity": "tumor tissue samples", "entity_type": "Anatomy", "pos": [106, 126]}], "task": "NER"}
+{"text": "Results show that the process : VEGF - a - - greater than EphA2 - - greater than MMPs - - greater than VM is the main pathway for VM formation and VEGF - a appears to play an important role in the formation of VM based on our in vitro assays and clinical immunohistochemical analyses .", "entity": [], "task": "NER"}
+{"text": "VM - targeting strategies for ovarian cancer include anti - VEGF - a treatment , knocking down the EphA2 gene and using antibodies against human MMPs if the tumor is VM positive .", "entity": [{"entity": "ovarian cancer", "entity_type": "Anatomy", "pos": [30, 44]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [157, 162]}], "task": "NER"}
+{"text": "This strategy may be of significant value in laying the foundation for a more explicit anti - tumor angiogenesis therapy .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [94, 99]}], "task": "NER"}
+{"text": "A novel role of thrombospondin - 1 in cervical carcinogenesis : inhibit stroma reaction by inhibiting activated fibroblasts from invading cancer .", "entity": [{"entity": "cervical", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "stroma", "entity_type": "Anatomy", "pos": [72, 78]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [112, 123]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [138, 144]}], "task": "NER"}
+{"text": "Thrombospondin ( TSP ) - 1 , a potent angiogenesis inhibitor , has been shown to exert different biological functions on various cell types .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [129, 133]}], "task": "NER"}
+{"text": "Here , we investigate the role of TSP - 1 in tumor - stroma reaction , which is mainly characterized by fibroblast activation to create a permissive microenvironment for tumor progression .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [45, 50]}, {"entity": "stroma", "entity_type": "Anatomy", "pos": [53, 59]}, {"entity": "fibroblast", "entity_type": "Anatomy", "pos": [104, 114]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [170, 175]}], "task": "NER"}
+{"text": "Immunohistochemistry examinations in the human surgical specimens have shown that a downregulation of TSP - 1 during the progression of cervical carcinogenesis was accompanied by an emergence in the upregulation of stroma markers , alpha - smooth muscle actin ( alpha - SMA ) and desmin .", "entity": [{"entity": "surgical specimens", "entity_type": "Anatomy", "pos": [47, 65]}, {"entity": "cervical", "entity_type": "Anatomy", "pos": [136, 144]}, {"entity": "stroma", "entity_type": "Anatomy", "pos": [215, 221]}], "task": "NER"}
+{"text": "Transfection of SiHa cervical cancer cells with a plasmid expressing the TSP - 1 protein exhibited antiangiogenic activity in vitro and resulted in reduced tumor growth in severe combined immunodeficiency ( SCID ) mice , which was accompanied by a decrease in tumor vascularization and lower expressions of alpha - SMA and desmin than those in the vector controls .", "entity": [{"entity": "SiHa cervical cancer cells", "entity_type": "Anatomy", "pos": [16, 42]}, {"entity": "plasmid", "entity_type": "Anatomy", "pos": [50, 57]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [156, 161]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [260, 265]}], "task": "NER"}
+{"text": "Transfection with TSP - 1 and purified TSP - 1 added to NIH3T3 cells did not alter the protein levels of alpha - SMA and desmin but significantly inhibited matrix metalloprotease - 2 activity .", "entity": [{"entity": "NIH3T3 cells", "entity_type": "Anatomy", "pos": [56, 68]}], "task": "NER"}
+{"text": "Transforming growth factor - beta ( TGF - beta ) , a major factor in the activation of fibroblasts , increased alpha - SMA and desmin expression and the ability of cell migration and invasion in NIH3T3 cells .", "entity": [{"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [87, 98]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [164, 168]}, {"entity": "NIH3T3 cells", "entity_type": "Anatomy", "pos": [195, 207]}], "task": "NER"}
+{"text": "The increased migration ability and the invasive ability into tumor cluster of TGF - beta - treated NIH3T3 cells were dose dependently inhibited by TSP - 1 .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "NIH3T3 cells", "entity_type": "Anatomy", "pos": [100, 112]}], "task": "NER"}
+{"text": "In contrast , ectopic TSP - 1 expression in SiHa cells has little effect on the invasive ability of the NIH3T3 cells .", "entity": [{"entity": "SiHa cells", "entity_type": "Anatomy", "pos": [44, 54]}, {"entity": "NIH3T3 cells", "entity_type": "Anatomy", "pos": [104, 116]}], "task": "NER"}
+{"text": "Together , our findings demonstrate a novel role of TSP - 1 to inhibit tumor - stroma reaction that could be attributed to the blockage of activated fibroblasts from invading cancer cells .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [71, 76]}, {"entity": "stroma", "entity_type": "Anatomy", "pos": [79, 85]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [149, 160]}, {"entity": "cancer cells", "entity_type": "Anatomy", "pos": [175, 187]}], "task": "NER"}
+{"text": "Targeting a tumor - specific laminin domain critical for human carcinogenesis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [12, 17]}], "task": "NER"}
+{"text": "Laminin - 332 is critical for squamous cell carcinoma ( SCC ) tumorigenesis , but targeting it for cancer therapy has been unachievable due to key role of laminin - 332 in promoting tissue integrity .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [30, 53]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [56, 59]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [99, 105]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [182, 188]}], "task": "NER"}
+{"text": "Here , we show that a portion of laminin - 332 , termed G45 , which is proteolytically removed and absent in normal tissues , is prominently expressed in most human SCC tumors and plays an important role in human SCC tumorigenesis .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [116, 123]}, {"entity": "SCC tumors", "entity_type": "Anatomy", "pos": [165, 175]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [213, 216]}], "task": "NER"}
+{"text": "Primary human keratinocytes lacking G45 ( DeltaG45 ) showed alterations of basal receptor organization , impaired matrix deposition , and increased migration .", "entity": [{"entity": "keratinocytes lacking G45", "entity_type": "Anatomy", "pos": [14, 39]}, {"entity": "DeltaG45", "entity_type": "Anatomy", "pos": [42, 50]}, {"entity": "matrix", "entity_type": "Anatomy", "pos": [114, 120]}], "task": "NER"}
+{"text": "After SCC transformation , the absence of G45 domain in DeltaG45 cells was associated with deficient extracellular signal - regulated kinase and phosphotidylinositol 3 - kinase ( PI3K ) pathway activation , impaired invasion , deficient metalloproteinase activity , and absent tumorgenicity in vivo .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [6, 9]}, {"entity": "DeltaG45 cells", "entity_type": "Anatomy", "pos": [56, 70]}], "task": "NER"}
+{"text": "Expression of G45 or activated PI3K subunit in DeltaG45 cells reversed these abnormalities .", "entity": [{"entity": "DeltaG45 cells", "entity_type": "Anatomy", "pos": [47, 61]}], "task": "NER"}
+{"text": "G45 antibody treatment induced SCC tumor apoptosis , decreased SCC tumor proliferation , and markedly impaired human SCC tumorigenesis in vivo without affecting normal tissue adhesion .", "entity": [{"entity": "SCC tumor", "entity_type": "Anatomy", "pos": [31, 40]}, {"entity": "SCC tumor", "entity_type": "Anatomy", "pos": [63, 72]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [117, 120]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [168, 174]}], "task": "NER"}
+{"text": "These results show a remarkable selectivity of expression and function for laminin - 332 G45 in human SCC tumorigenesis and implicate it as a specific target for anticancer therapy .", "entity": [{"entity": "SCC", "entity_type": "Anatomy", "pos": [102, 105]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [162, 172]}], "task": "NER"}
+{"text": "Analysis of processivity of mungbean dideoxynucleotide - sensitive DNA polymerase and detection of the activity and expression of the enzyme in the meristematic and meiotic tissues and following DNA damaging agent .", "entity": [{"entity": "meristematic", "entity_type": "Anatomy", "pos": [148, 160]}, {"entity": "meiotic tissues", "entity_type": "Anatomy", "pos": [165, 180]}], "task": "NER"}
+{"text": "Analysis of the processivity of mungbean ddNTP - sensitive DNA polymerase showed the incorporation of approximately 35 - 40 nucleotides per binding event in the replication assays involving M13 ss DNA template with 5 ' - labeled 17 - mer primer .", "entity": [], "task": "NER"}
+{"text": "Optimal processivity was obtained with 100 - 150 mM KCl and 6 - 8 mM Mg2 + at pH 7 . 5 .", "entity": [], "task": "NER"}
+{"text": "The enzyme showed preference for Mg2 + over Mn2 + as the metal activator for processivity .", "entity": [], "task": "NER"}
+{"text": "2 ' , 3 ' dideoxythymidine 5 ' triphosphate ( ddTTP ) and rat DNA pol beta antibody strongly influenced distributive synthesis .", "entity": [], "task": "NER"}
+{"text": "Considerable enhancement in processivity was noticed at 1mM ATP and 2 - 4 mM spermidine while higher concentrations of spermidine caused distributive synthesis .", "entity": [], "task": "NER"}
+{"text": "The enzyme was found to be active in both meristematic and meiotic tissues and distinctly induced by EMS treatment .", "entity": [{"entity": "meristematic", "entity_type": "Anatomy", "pos": [42, 54]}, {"entity": "meiotic tissues", "entity_type": "Anatomy", "pos": [59, 74]}], "task": "NER"}
+{"text": "DNA - binding assays revealed distinct binding ability of the enzyme to template / primer and damaged DNA substrate .", "entity": [], "task": "NER"}
+{"text": "Together these observations illustrate the probable involvement of the enzyme in replication and repair machinery in higher plants .", "entity": [], "task": "NER"}
+{"text": "Management of early and advanced colorectal cancer : therapeutic issues .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [33, 50]}], "task": "NER"}
+{"text": "PURPOSE : The staging of colorectal cancer , therapeutic decision making in the management of early and advanced colorectal cancer , and dilemmas posed by drug - related toxicity are discussed .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [25, 42]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [113, 130]}], "task": "NER"}
+{"text": "SUMMARY : Staging of colorectal cancer occurs after surgery and is based on the extent of disease invasiveness and dissemination .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [21, 38]}], "task": "NER"}
+{"text": "Surgery is the primary treatment for stage I disease .", "entity": [], "task": "NER"}
+{"text": "Adjuvant chemotherapy is recommended after resection in selected high - risk patients with stage II disease and in all patients with stage III disease .", "entity": [], "task": "NER"}
+{"text": "Convenience of administration , tolerability , and patient factors not necessarily age may be considerations in decisions about adjuvant therapy after resection .", "entity": [], "task": "NER"}
+{"text": "Treatment of stage IV colorectal cancer is based on the type of prior therapy and patient - specific factors .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [22, 39]}], "task": "NER"}
+{"text": "Recently , significant improvements in survival have been achieved through the use of combination chemotherapy and monoclonal antibody regimens .", "entity": [], "task": "NER"}
+{"text": "Bevacizumab in combination with chemotherapy is first - line therapy for stage IV disease .", "entity": [], "task": "NER"}
+{"text": "Age alone should not preclude the use of chemotherapy in stage IV colorectal cancer , although the ability to tolerate drug - related toxicity may be a consideration .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [66, 83]}], "task": "NER"}
+{"text": "The optimal duration of chemotherapy in patients with early and metastatic colorectal cancer is unclear .", "entity": [{"entity": "metastatic colorectal cancer", "entity_type": "Anatomy", "pos": [64, 92]}], "task": "NER"}
+{"text": "CONCLUSION : The optimal approach to the treatment of colorectal cancer depends on several considerations , including patient - specific factors .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [54, 71]}], "task": "NER"}
+{"text": "Serum and urine levels of interleukin - 8 in patients with non - Hodgkin ' s lymphoma .", "entity": [{"entity": "Serum", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [10, 15]}, {"entity": "non - Hodgkin ' s lymphoma", "entity_type": "Anatomy", "pos": [59, 85]}], "task": "NER"}
+{"text": "Angiogenesis plays an important role in many types of cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [54, 60]}], "task": "NER"}
+{"text": "Interleukin - 8 ( IL - 8 ) is known to be a pro - inflammatory and pro - angiogenic cytokine , and IL - 8 has been reported to be associated with tumor progression , prognosis and survival in several types of cancers .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [146, 151]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [209, 216]}], "task": "NER"}
+{"text": "However , the role of IL - 8 in non - Hodgkin ' s lymphoma ( NHL ) has not been fully determined .", "entity": [{"entity": "non - Hodgkin ' s lymphoma", "entity_type": "Anatomy", "pos": [32, 58]}, {"entity": "NHL", "entity_type": "Anatomy", "pos": [61, 64]}], "task": "NER"}
+{"text": "Here , we evaluated the usefulness of measuring serum and urine IL - 8 levels in patients with NHL .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [48, 53]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [58, 63]}, {"entity": "NHL", "entity_type": "Anatomy", "pos": [95, 98]}], "task": "NER"}
+{"text": "We developed reference intervals for serum and urine IL - 8 level in 131 control individuals .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [37, 42]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [47, 52]}], "task": "NER"}
+{"text": "We measured serum IL - 8 and urine IL - 8 levels in patients with NHL , and we compared the concentrations with those of control individuals .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [12, 17]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [29, 34]}, {"entity": "NHL", "entity_type": "Anatomy", "pos": [66, 69]}], "task": "NER"}
+{"text": "The reference intervals for serum IL - 8 and urine IL - 8 corrected by creatinine ( Cr ) were 15 . 9 - 430 . 3 pg / mL and 0 . 0 - 28 . 4 pg / mg Cr , respectively .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [28, 33]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [45, 50]}], "task": "NER"}
+{"text": "The concentrations of urine IL - 8 / Cr were significantly higher in patients than in controls ( 48 . 9 + / - 194 . 4 vs . 5 . 2 + / - 13 . 8 pg / mg Cr , P less than 0 . 001 ) .", "entity": [{"entity": "urine", "entity_type": "Anatomy", "pos": [22, 27]}], "task": "NER"}
+{"text": "However , there were no significant differences in serum IL - 8 concentrations between NHL patients and controls ( 159 . 2 + / - 40 . 4 vs . 99 . 6 + / - 107 . 1 pg / mL ; P = 0 . 099 ) .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [51, 56]}, {"entity": "NHL", "entity_type": "Anatomy", "pos": [87, 90]}], "task": "NER"}
+{"text": "Receiver operating characteristic ( ROC ) analysis gave 0 . 83 and 0 . 43 ROC area values for urine IL - 8 / Cr and serum IL - 8 , respectively .", "entity": [{"entity": "urine", "entity_type": "Anatomy", "pos": [94, 99]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [116, 121]}], "task": "NER"}
+{"text": "There was no correlation between the serum and urine concentrations of IL - 8 and clinical variables , the only exception being the international prognostic index ( IPI ) , which showed a marginal correlation with urine IL - 8 / Cr levels ( P = 0 . 07 ) .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [37, 42]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [47, 52]}, {"entity": "urine", "entity_type": "Anatomy", "pos": [214, 219]}], "task": "NER"}
+{"text": "This study indicated that urine IL - 8 / Cr levels might be useful as a diagnostic marker of NHL .", "entity": [{"entity": "urine", "entity_type": "Anatomy", "pos": [26, 31]}, {"entity": "NHL", "entity_type": "Anatomy", "pos": [93, 96]}], "task": "NER"}
+{"text": "Microscopic technique for the detection of nitric oxide - dependent angiogenesis in an animal model .", "entity": [], "task": "NER"}
+{"text": "Nitric oxide ( NO ) plays an important role in maintaining vascular homeostasis .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [59, 67]}], "task": "NER"}
+{"text": "The importance of NO in the vasculature is demonstrated by several experimental conditions , such as vascular endothelial growth factor ( VEGF ) - induced angiogenesis .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [28, 39]}], "task": "NER"}
+{"text": "Thus , the NO metabolic pathway in endothelial cells could be one of the main contributing factors for angiogenesis .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [35, 52]}], "task": "NER"}
+{"text": "Although several methods have been used for measuring in vitro angiogenesis , a proper technique has not been developed for identifying in vivo NO - dependent angiogenesis .", "entity": [], "task": "NER"}
+{"text": "This chapter provides a new intravital microscopic method for detecting and measuring NO - dependent angiogenesis in a mouse model .", "entity": [], "task": "NER"}
+{"text": "This technique showed strong abdominal neovascularization in wild - type mice , but not eNOS knockout mice , locally injected with VEGF , as well as stimulation of angiogenesis in NO donor - injected mice .", "entity": [{"entity": "abdominal", "entity_type": "Anatomy", "pos": [29, 38]}], "task": "NER"}
+{"text": "This technique also revealed the inhibitory effect of the NOS inhibitor N ( G ) - iminoethyl - L - ornithine in VEGF - mediated in vivo angiogenesis .", "entity": [], "task": "NER"}
+{"text": "This chapter describes intravital microscopy as a new imaging technique for detecting NO - dependent angiogenesis in an animal model .", "entity": [], "task": "NER"}
+{"text": "Effects of cyclooxygenase - 2 non - selective and selective inhibitors on proliferation inhibition and apoptosis induction of esophageal squamous carcinoma cells .", "entity": [{"entity": "esophageal squamous carcinoma cells", "entity_type": "Anatomy", "pos": [126, 161]}], "task": "NER"}
+{"text": "The objective of this study is to investigate the effects of aspirin and nimesulide on cell proliferation , apoptosis and its potential mechanisms in EC9706 and EC109 esophageal squamous carcinoma cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [87, 91]}, {"entity": "EC9706", "entity_type": "Anatomy", "pos": [150, 156]}, {"entity": "EC109 esophageal squamous carcinoma cells", "entity_type": "Anatomy", "pos": [161, 202]}], "task": "NER"}
+{"text": "EC9706 and EC109 cells were incubated with varying concentrations of aspirin and nimesulide , and the effects on cell proliferation and apoptosis were monitored by 3 - ( 4 , 5 - dimethyl - thiazol - 2yl ) - 2 , 5 - diphenyltetrazolium bromide and flow cytometry .", "entity": [{"entity": "EC9706", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "EC109 cells", "entity_type": "Anatomy", "pos": [11, 22]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [113, 117]}], "task": "NER"}
+{"text": "Reverse transcription - polymerase chain reaction and Western blot assays were used to investigate expression of Bcl - 2 and Bax .", "entity": [], "task": "NER"}
+{"text": "Prostaglandin E2 production was measured by enzyme linked immunosorbent assay .", "entity": [], "task": "NER"}
+{"text": "Pretreatment with aspirin and nimesulide inhibited EC9706 and EC109 cell growth in a time and dose - dependent manner , accompanied with a decrease of prostaglandin E2 production .", "entity": [{"entity": "EC9706", "entity_type": "Anatomy", "pos": [51, 57]}, {"entity": "EC109 cell", "entity_type": "Anatomy", "pos": [62, 72]}], "task": "NER"}
+{"text": "In EC9706 cells , the mechanism of aspirin and nimesulide induced growth inhibition was a consequence of cell cycle arrest at the G ( 0 ) / G ( 1 ) check point .", "entity": [{"entity": "EC9706 cells", "entity_type": "Anatomy", "pos": [3, 15]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [105, 109]}], "task": "NER"}
+{"text": "In EC109 cells , growth arrest was by induction of apoptosis , associated with downregulation of Bcl - 2 , but not Bax .", "entity": [{"entity": "EC109 cells", "entity_type": "Anatomy", "pos": [3, 14]}], "task": "NER"}
+{"text": "In conclusion , aspirin and nimesulide could inhibit cell proliferation and induce apoptosis in esophageal squamous carcinoma cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [53, 57]}, {"entity": "esophageal squamous carcinoma cells", "entity_type": "Anatomy", "pos": [96, 131]}], "task": "NER"}
+{"text": "Cyclooxygenase - 2 inhibitor may be a promising therapeutic agent for human esophageal squamous cell carcinoma .", "entity": [{"entity": "esophageal squamous cell carcinoma", "entity_type": "Anatomy", "pos": [76, 110]}], "task": "NER"}
+{"text": "Neurotrophin p75 receptor ( p75NTR ) promotes endothelial cell apoptosis and inhibits angiogenesis : implications for diabetes - induced impaired neovascularization in ischemic limb muscles .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [46, 62]}, {"entity": "limb muscles", "entity_type": "Anatomy", "pos": [177, 189]}], "task": "NER"}
+{"text": "Diabetes impairs endothelial function and reparative neovascularization .", "entity": [{"entity": "endothelial", "entity_type": "Anatomy", "pos": [17, 28]}], "task": "NER"}
+{"text": "The p75 receptor of neurotrophins ( p75 ( NTR ) ) , which is scarcely present in healthy endothelial cells ( ECs ) , becomes strongly expressed by capillary ECs after induction of peripheral ischemia in type - 1 diabetic mice .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [89, 106]}, {"entity": "ECs", "entity_type": "Anatomy", "pos": [109, 112]}, {"entity": "capillary ECs", "entity_type": "Anatomy", "pos": [147, 160]}, {"entity": "peripheral", "entity_type": "Anatomy", "pos": [180, 190]}], "task": "NER"}
+{"text": "Here , we show that gene transfer - induced p75 ( NTR ) expression impairs the survival , proliferation , migration , and adhesion capacities of cultured ECs and endothelial progenitor cells ( EPCs ) and inhibits angiogenesis in vitro .", "entity": [{"entity": "ECs", "entity_type": "Anatomy", "pos": [154, 157]}, {"entity": "endothelial progenitor cells", "entity_type": "Anatomy", "pos": [162, 190]}, {"entity": "EPCs", "entity_type": "Anatomy", "pos": [193, 197]}], "task": "NER"}
+{"text": "Moreover , intramuscular p75 ( NTR ) gene delivery impairs neovascularization and blood flow recovery in a mouse model of limb ischemia .", "entity": [{"entity": "intramuscular", "entity_type": "Anatomy", "pos": [11, 24]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "limb", "entity_type": "Anatomy", "pos": [122, 126]}], "task": "NER"}
+{"text": "These disturbed functions are associated with suppression of signaling mechanisms implicated in EC survival and angiogenesis .", "entity": [{"entity": "EC", "entity_type": "Anatomy", "pos": [96, 98]}], "task": "NER"}
+{"text": "In fact , p75 ( NTR ) depresses the VEGF - A / Akt / eNOS / NO pathway and additionally reduces the mRNA levels of ITGB1 [ beta ( 1 ) integrin ] , BIRC5 ( survivin ) , PTTG1 ( securin ) and VEZF1 .", "entity": [], "task": "NER"}
+{"text": "Diabetic mice , which typically show impaired postischemic muscular neovascularization and blood perfusion recovery , have these defects corrected by intramuscular gene transfer of a dominant negative mutant form of p75 ( NTR ) .", "entity": [{"entity": "muscular", "entity_type": "Anatomy", "pos": [59, 67]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [91, 96]}, {"entity": "intramuscular", "entity_type": "Anatomy", "pos": [150, 163]}], "task": "NER"}
+{"text": "Collectively , our data newly demonstrate the antiangiogenic action of p75 ( NTR ) and open new avenues for the therapeutic use of p75 ( NTR ) inhibition to combat diabetes - induced microvascular liabilities .", "entity": [{"entity": "microvascular", "entity_type": "Anatomy", "pos": [183, 196]}], "task": "NER"}
+{"text": "Tumor endothelial cell targeted cyclic RGD - modified heparin derivative : inhibition of angiogenesis and tumor growth .", "entity": [{"entity": "Tumor endothelial cell", "entity_type": "Anatomy", "pos": [0, 22]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [106, 111]}], "task": "NER"}
+{"text": "PURPOSE : We prepared tumor endothelium targeted cRGD - modified heparin derivative ( cRGD - HL ) by coupling heparin - lithocholic acid ( HL ) with cRGDyK , and evaluated inhibition effects of cRGD - HL on angiogenesis and tumor growth .", "entity": [{"entity": "tumor endothelium", "entity_type": "Anatomy", "pos": [22, 39]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [224, 229]}], "task": "NER"}
+{"text": "METHODS : To evaluate antiangiogenic activity of cRGD - HL , we performed tests on endothelial cell adhesion and migration to vitronectin , tube formation , binding affinity to purified alpha ( v ) beta ( 3 ) integrin , and in vivo Matrigel plug assay .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [83, 99]}, {"entity": "tube", "entity_type": "Anatomy", "pos": [140, 144]}], "task": "NER"}
+{"text": "The antitumor activity of cRGD - HL was also evaluated by monitoring tumor growth and microvessel formation in squamous cell carcinoma ( SCC7 ) tumor .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [4, 13]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [69, 74]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [86, 97]}, {"entity": "squamous cell carcinoma ( SCC7 ) tumor", "entity_type": "Anatomy", "pos": [111, 149]}], "task": "NER"}
+{"text": "RESULTS : The cRGD - HL significantly inhibited adhesion and migration of endothelial cells to vitronectin , and tubular structures of endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [74, 91]}, {"entity": "tubular structures", "entity_type": "Anatomy", "pos": [113, 131]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [135, 152]}], "task": "NER"}
+{"text": "Compared to cRGDyK and HL , cRGD - HL has high binding affinity to purified alpha ( v ) beta ( 3 ) integrin .", "entity": [], "task": "NER"}
+{"text": "The enhanced antiangiogenic effect of cRGD - HL was confirmed in Matrigel assay by showing the significant inhibition of bFGF - driven angiogenesis and blood vessel formation .", "entity": [{"entity": "blood vessel", "entity_type": "Anatomy", "pos": [152, 164]}], "task": "NER"}
+{"text": "It was thought that potent antiangiogenic effect of cRGD - HL was probably due to the interference of alpha ( v ) beta ( 3 ) - mediated interaction , resulting in the enhanced antitumoral activity against SCC7 tumor .", "entity": [{"entity": "antitumoral", "entity_type": "Anatomy", "pos": [176, 187]}, {"entity": "SCC7 tumor", "entity_type": "Anatomy", "pos": [205, 215]}], "task": "NER"}
+{"text": "CONCLUSION : These results demonstrated that cRGD - modified heparin derivative enhanced anti - angiotherapeutic effects against solid tumor , and therefore , it could be applied to treat various cancers and angiogenic diseases as a potent angiogenesis inhibitor .", "entity": [{"entity": "solid tumor", "entity_type": "Anatomy", "pos": [129, 140]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [196, 203]}], "task": "NER"}
+{"text": "[ Inhibitory effect of adenovirus - mediated endostatin gene transfer on transplanted lung carcinoma in mice ]", "entity": [{"entity": "lung carcinoma", "entity_type": "Anatomy", "pos": [86, 100]}], "task": "NER"}
+{"text": "OBJECTIVE : To investigate the effect of adenovirus - mediated endostatin gene transfer on transplanted lung cancer in mice and its mechanism of action .", "entity": [{"entity": "lung cancer", "entity_type": "Anatomy", "pos": [104, 115]}], "task": "NER"}
+{"text": "METHODS : Transplant tumor model was induced by subcutaneous inoculation of 2 x 10 ( 6 ) Lewis lung cancer ( LLC ) cells into the back of C57BL / 6 mice .", "entity": [{"entity": "Transplant tumor", "entity_type": "Anatomy", "pos": [10, 26]}, {"entity": "subcutaneous", "entity_type": "Anatomy", "pos": [48, 60]}, {"entity": "Lewis lung cancer ( LLC ) cells", "entity_type": "Anatomy", "pos": [89, 120]}, {"entity": "back", "entity_type": "Anatomy", "pos": [130, 134]}], "task": "NER"}
+{"text": "The mice were treated by intratumoral injection of 2 x 10 ( 9 ) pfu Ad - mEndostatin .", "entity": [{"entity": "intratumoral", "entity_type": "Anatomy", "pos": [25, 37]}], "task": "NER"}
+{"text": "The expression of endostatin in situ and its maintaining time were detected by immunohistochemistry and Western Blot , respectively .", "entity": [], "task": "NER"}
+{"text": "The endostatin level in serum was determined by ELISA .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [24, 29]}], "task": "NER"}
+{"text": "The inhibition of tumor growth and changes of survival were recorded and the microvessel density ( MVD ) was determined by histochemical stainingwith CD31 and CD105 antibodies .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [18, 23]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [77, 88]}], "task": "NER"}
+{"text": "The tumor apoptosis was observed by electron microscopy .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [4, 9]}], "task": "NER"}
+{"text": "RESULTS : In comparison with controls , intratumoral injection of Ad - mEndostatin significantly inhibited the tumor growth and metastasis , and prolonged the survival rate of mice ( P less than 0 . 05 ) .", "entity": [{"entity": "intratumoral", "entity_type": "Anatomy", "pos": [40, 52]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [111, 116]}], "task": "NER"}
+{"text": "Strong positive expression of mEndostatin was seen in the tumor tissue after injection of Ad - mEndostatin , immunhistochemically ostained by mouse endostatin monoclonal antibody , while the control groups showed only very low expression or absence .", "entity": [{"entity": "tumor tissue", "entity_type": "Anatomy", "pos": [58, 70]}], "task": "NER"}
+{"text": "Serum endostatin concentration was 1540 + / - 560 ng / ml at the second week of administration , the expression of endostatin diminished a month later .", "entity": [{"entity": "Serum", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "The microvessel density ( MVD ) ) decreased from 42 . 4 + / - 4 . 8 to 10 . 5 + / - 3 . 2 per x 200 magnificetion microscopic field by CD10 staining and from 68 . 5 + / - 4 . 5 to 37 . 5 + / - 4 . 6 by CD31 staining , respectively ( P less than 0 . 05 ) .", "entity": [{"entity": "microvessel", "entity_type": "Anatomy", "pos": [4, 15]}], "task": "NER"}
+{"text": "More apoptotic tumor cells were seen under the transmission electron microscope .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [15, 26]}], "task": "NER"}
+{"text": "CONCLUSION : Endostatin gene therapy mediated by adenoviral vector efficiently induces expression of endostatin in vivo , and inhibits the growth and metastasis of tumor .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [164, 169]}], "task": "NER"}
+{"text": "It is concluded that its action is targeted to tumor neovasculature and the mechanism is inhibition of tumor angiogenesis .", "entity": [{"entity": "tumor neovasculature", "entity_type": "Anatomy", "pos": [47, 67]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [103, 108]}], "task": "NER"}
+{"text": "The role of p53 in pigmentation , tanning and melanoma .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [46, 54]}], "task": "NER"}
+{"text": "p53 has a central role in skin pigmentation and may impact on melanoma at all stages , however , as it ' s mutation frequency in melanoma is low , it ' s role has been somewhat under - appreciated .", "entity": [{"entity": "skin", "entity_type": "Anatomy", "pos": [26, 30]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [62, 70]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [129, 137]}], "task": "NER"}
+{"text": "During normal skin function , p53 in the keratinocyte is a transducer of the skin tanning signal and an essential component of what is effectively a keratinocyte - melanocyte signaling cycle that regulates skin pigmentation .", "entity": [{"entity": "skin", "entity_type": "Anatomy", "pos": [14, 18]}, {"entity": "keratinocyte", "entity_type": "Anatomy", "pos": [41, 53]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [77, 81]}, {"entity": "keratinocyte", "entity_type": "Anatomy", "pos": [149, 161]}, {"entity": "melanocyte", "entity_type": "Anatomy", "pos": [164, 174]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [206, 210]}], "task": "NER"}
+{"text": "It is clear that this cycle functions optimally in skin of dark pigmentation .", "entity": [{"entity": "skin", "entity_type": "Anatomy", "pos": [51, 55]}], "task": "NER"}
+{"text": "When melanin biosynthesis is genetically disrupted in skin of white complexion , we propose that this cycle operates as a promoter of melanocyte proliferation .", "entity": [{"entity": "skin", "entity_type": "Anatomy", "pos": [54, 58]}, {"entity": "melanocyte", "entity_type": "Anatomy", "pos": [134, 144]}], "task": "NER"}
+{"text": "The cell autonomous function of p53 in melanocytes is not well described , however , the balance of the evidence suggests that p53 is an effective tumor suppressor and the myriad of mechanisms by which the p53 pathway may be dysregulated in tumors attests to it importance as a tumor suppressor .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [4, 8]}, {"entity": "melanocytes", "entity_type": "Anatomy", "pos": [39, 50]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [147, 152]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [241, 247]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [278, 283]}], "task": "NER"}
+{"text": "In this review , we outline the known mechanisms that impair p53 itself and its immediate regulators or target genes during melanomagenesis .", "entity": [], "task": "NER"}
+{"text": "Due to the importance of this pathway , it is clear that p53 disruptions may relate directly to a patient ' s prognosis .", "entity": [], "task": "NER"}
+{"text": "This pathway will continue to be a focus of investigation , particularly with respect to targeted experimental chemotherapeutics .", "entity": [], "task": "NER"}
+{"text": "Enhancement of docetaxel - induced cytotoxicity and apoptosis by all - trans retinoic acid ( ATRA ) through downregulation of survivin ( BIRC5 ) , MCL - 1 and LTbeta - R in hormone - and drug resistant prostate cancer cell line , DU - 145 .", "entity": [{"entity": "prostate cancer cell line", "entity_type": "Anatomy", "pos": [202, 227]}, {"entity": "DU - 145", "entity_type": "Anatomy", "pos": [230, 238]}], "task": "NER"}
+{"text": "BACKGROUND : The management of hormone - refractory prostate cancer ( HRPC ) still remains as an important challenge of daily oncology practice .", "entity": [{"entity": "hormone - refractory prostate cancer", "entity_type": "Anatomy", "pos": [31, 67]}, {"entity": "HRPC", "entity_type": "Anatomy", "pos": [70, 74]}], "task": "NER"}
+{"text": "Docetaxel has proved to be a first line treatment choice .", "entity": [], "task": "NER"}
+{"text": "All - trans retinoic acid ( ATRA ) could potently inhibit the growth of prostate cancer cells in vitro and its combination with various anticancer agents results in increased cytotoxicity .", "entity": [{"entity": "prostate cancer cells", "entity_type": "Anatomy", "pos": [72, 93]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [136, 146]}], "task": "NER"}
+{"text": "Based on these data , our aim was to examine the synergistic / additive cytotoxic and apoptotic effects of combination of docetaxel and ATRA , in hormone - and drug refractory human DU - 145 prostate cancer cells .", "entity": [{"entity": "DU - 145 prostate cancer cells", "entity_type": "Anatomy", "pos": [182, 212]}], "task": "NER"}
+{"text": "Furthermore , we have searched for the underlying mechanisms of apoptosis by demonstrating apoptosis - related genes .", "entity": [], "task": "NER"}
+{"text": "METHODS : XTT cell proliferation assay was used for showing cytotoxicity .", "entity": [{"entity": "XTT cell", "entity_type": "Anatomy", "pos": [10, 18]}], "task": "NER"}
+{"text": "For verifying apoptosis , both DNA Fragmentation by ELISA assay and caspase 3 / 7 activity measurement were used .", "entity": [], "task": "NER"}
+{"text": "For detecting the mechanism of apoptosis induced by docetaxel - ATRA combination , OligoGeArray which consists of 112 apoptosis related genes was used .", "entity": [], "task": "NER"}
+{"text": "RESULTS : Our results revealed that docetaxel and ATRA were synergistically cytotoxic and apoptotic in DU - 145 cells , in a dose - and time dependent manner .", "entity": [{"entity": "DU - 145 cells", "entity_type": "Anatomy", "pos": [103, 117]}], "task": "NER"}
+{"text": "It was also shown by our studies that apoptosis was induced in DU - 145 prostate carcinoma cells with significant cytotoxicity , no matter which agent applied first .", "entity": [{"entity": "DU - 145 prostate carcinoma cells", "entity_type": "Anatomy", "pos": [63, 96]}], "task": "NER"}
+{"text": "We have found out that docetaxel - ATRA combination significantly downregulates survivin ( BIRC5 ) , myeloid cell leukemia - 1 ( MCL - 1 ) and lymphotoxin beta - receptor ( LTbetaR ) genes , which all three have pivotal roles in regulation of apoptosis and cell cycle progression .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [109, 113]}], "task": "NER"}
+{"text": "CONCLUSION : In conclusion , we strongly suggest that docetaxel and ATRA combination is a good candidate for this challenging era of daily oncologic practice .", "entity": [], "task": "NER"}
+{"text": "Also , the combination of docetaxel and ATRA might allow a reduction in docetaxel doses and by this way may diminish docetaxel adverse effects while maintaining the therapeutic effect in patients with HRPC .", "entity": [{"entity": "HRPC", "entity_type": "Anatomy", "pos": [201, 205]}], "task": "NER"}
+{"text": "Diverse cell signaling events modulated by perlecan .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [8, 12]}], "task": "NER"}
+{"text": "Perlecan is a ubiquitous pericellular proteoglycan ideally placed to mediate cell signaling events controlling migration , proliferation , and differentiation .", "entity": [{"entity": "pericellular", "entity_type": "Anatomy", "pos": [25, 37]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [77, 81]}], "task": "NER"}
+{"text": "Its control of growth factor signaling usually involves interactions with the heparan sulfate chains covalently coupled to the protein core ' s N - terminus .", "entity": [], "task": "NER"}
+{"text": "However , this modular protein core also binds with relatively high affinity to a number of growth factors and surface receptors , thereby stabilizing cell - matrix links .", "entity": [{"entity": "surface", "entity_type": "Anatomy", "pos": [111, 118]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [151, 155]}, {"entity": "matrix", "entity_type": "Anatomy", "pos": [158, 164]}], "task": "NER"}
+{"text": "This review will focus on perlecan - growth factor interactions and describe recent advances in our understanding of this highly conserved proteoglycan during development , cancer growth , and angiogenesis .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [173, 179]}], "task": "NER"}
+{"text": "The pro - angiogenic capacities of perlecan that involve proliferative and migratory signals in response to bound growth factors will be explored , as well as the anti - angiogenic signals resulting from interactions between the C - terminal domain known as endorepellin and integrins that control adhesion of cells to the extracellular matrix .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [310, 315]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [323, 343]}], "task": "NER"}
+{"text": "These two somewhat diametrically opposed roles will be discussed in light of new data emerging from various fields which converge on perlecan as a key regulator of cell growth and angiogenesis .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [164, 168]}], "task": "NER"}
+{"text": "Activation of signal transducer and activator of transcription 3 through a phosphomimetic serine 727 promotes prostate tumorigenesis independent of tyrosine 705 phosphorylation .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [110, 118]}], "task": "NER"}
+{"text": "Aberrantly activated signal transducer and activator of transcription 3 ( Stat3 ) is implicated in the development of various human cancers .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [132, 139]}], "task": "NER"}
+{"text": "Y705 phosphorylation is conventionally thought to be required for Stat3 signal - dependent activation and seems to play an essential role in some malignancies .", "entity": [{"entity": "malignancies", "entity_type": "Anatomy", "pos": [146, 158]}], "task": "NER"}
+{"text": "Recently , it was shown that Stat3 is activated through novel and noncanonical mechanisms , including phosphorylation at S727 .", "entity": [], "task": "NER"}
+{"text": "Here , we investigate S727 phosphorylation of Stat3 and its subsequent effects in prostate cancer development , independent of Y705 phosphorylation , using mutated Stat3 in the human prostate cancer cell line LNCaP .", "entity": [{"entity": "prostate cancer", "entity_type": "Anatomy", "pos": [82, 97]}, {"entity": "prostate cancer cell line LNCaP", "entity_type": "Anatomy", "pos": [183, 214]}], "task": "NER"}
+{"text": "We show mutation of S727 to the phosphomimetic residue Glu , and inactivation of Y705 ( Y705F / S727E ) resulted in a remarkable growth advantage in low - serum , enhanced anchorage - independent growth in soft agar , and increased tumorigenicity in nonobese diabetic / severe combined immunodeficient ( NOD / SCID ) mice , possibly by direct activation of downstream proto - oncogenes c - myc , mcl - 1 , and survivin .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [155, 160]}], "task": "NER"}
+{"text": "Y705F / S727E mutant cells were more invasive than Y705F / S727A ( inactivation of Y705 and S727 ) mutant cells , and more Y705F / S727E mutant Stat3 was localized in the nuclei relative to Y705F / S727A mutant Stat3 at the steady state .", "entity": [{"entity": "Y705F / S727E mutant cells", "entity_type": "Anatomy", "pos": [0, 26]}, {"entity": "Y705F / S727A ( inactivation of Y705 and S727 ) mutant cells", "entity_type": "Anatomy", "pos": [51, 111]}, {"entity": "nuclei", "entity_type": "Anatomy", "pos": [171, 177]}], "task": "NER"}
+{"text": "Furthermore , the Y705F / S727E but not the Y705F / S727A mutant induced anchorage - independent growth of noncancerous prostate epithelial cells ( RWPE - 1 ) .", "entity": [{"entity": "noncancerous prostate epithelial cells", "entity_type": "Anatomy", "pos": [107, 145]}, {"entity": "RWPE - 1", "entity_type": "Anatomy", "pos": [148, 156]}], "task": "NER"}
+{"text": "We further show that Stat3 is phosphorylated at S727 in 65 % of malignant prostate tissues ( n = 20 ) relative to 25 % of normal prostate tissues ( n = 4 ) .", "entity": [{"entity": "malignant prostate tissues", "entity_type": "Anatomy", "pos": [64, 90]}, {"entity": "prostate tissues", "entity_type": "Anatomy", "pos": [129, 145]}], "task": "NER"}
+{"text": "Moreover , there is a positive correlation between phosphoS727 - Stat3 expression and Gleason score in these prostate cancer tissues ( P = 0 . 05 ) .", "entity": [{"entity": "prostate cancer tissues", "entity_type": "Anatomy", "pos": [109, 132]}], "task": "NER"}
+{"text": "Our data suggest for the first time that S727 phosphorylation is sufficient to activate Stat3 , thereby driving prostate tumorigenesis independent of Y705 phosphorylation .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [112, 120]}], "task": "NER"}
+{"text": "Allergic pulmonary inflammation promotes the recruitment of circulating tumor cells to the lung .", "entity": [{"entity": "pulmonary", "entity_type": "Anatomy", "pos": [9, 18]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [72, 83]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [91, 95]}], "task": "NER"}
+{"text": "Allergen - induced respiratory inflammation facilitates and / or elicits the extravasation of proinflammatory leukocytes by well - understood mechanisms that mediate the movement of multiple cell types .", "entity": [{"entity": "respiratory", "entity_type": "Anatomy", "pos": [19, 30]}, {"entity": "proinflammatory leukocytes", "entity_type": "Anatomy", "pos": [94, 120]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [191, 195]}], "task": "NER"}
+{"text": "The nonspecific character of these pathways led us to hypothesize that circulating cancer cells use similar mechanisms , promoting secondary tumor formation at distal sites .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [83, 95]}, {"entity": "secondary tumor", "entity_type": "Anatomy", "pos": [131, 146]}, {"entity": "distal sites", "entity_type": "Anatomy", "pos": [160, 172]}], "task": "NER"}
+{"text": "To test this hypothesis , the frequency of metastasis to the lung as a function of allergic pulmonary inflammation was assessed following the i . v . injection of B16 - F10 melanoma cells in mice .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [61, 65]}, {"entity": "pulmonary", "entity_type": "Anatomy", "pos": [92, 101]}, {"entity": "i . v .", "entity_type": "Anatomy", "pos": [142, 149]}, {"entity": "B16 - F10 melanoma cells", "entity_type": "Anatomy", "pos": [163, 187]}], "task": "NER"}
+{"text": "These studies showed that allergen - induced pulmonary inflammation resulted in a > 3 - fold increase in lung metastases .", "entity": [{"entity": "pulmonary", "entity_type": "Anatomy", "pos": [45, 54]}, {"entity": "lung metastases", "entity_type": "Anatomy", "pos": [105, 120]}], "task": "NER"}
+{"text": "This increase was dependent on CD4 ( + ) T - cell activities ; however , it occurred independent of the induced eosinophilia associated with allergen provocation .", "entity": [{"entity": "CD4 ( + ) T - cell", "entity_type": "Anatomy", "pos": [31, 49]}], "task": "NER"}
+{"text": "Interventional strategies showed that existing therapeutic modalities for asthma , such as inhaled corticosteroids , were sufficient to block the enhanced pulmonary recruitment of cancer cells from circulation .", "entity": [{"entity": "pulmonary", "entity_type": "Anatomy", "pos": [155, 164]}, {"entity": "cancer cells", "entity_type": "Anatomy", "pos": [180, 192]}], "task": "NER"}
+{"text": "Additional mechanistic studies further suggested that the ability of circulating cancer cells to extravasate to surrounding lung tissues was linked to the activation of the vascular endothelium via one or more Galpha ( i ) - coupled receptors .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [81, 93]}, {"entity": "lung tissues", "entity_type": "Anatomy", "pos": [124, 136]}, {"entity": "vascular endothelium", "entity_type": "Anatomy", "pos": [173, 193]}], "task": "NER"}
+{"text": "Interestingly , a survey of a clinical breast cancer surgical database showed that the incidence of asthma was higher among patients with lung metastases .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [39, 52]}, {"entity": "lung metastases", "entity_type": "Anatomy", "pos": [138, 153]}], "task": "NER"}
+{"text": "Thus , our data show that allergic respiratory inflammation may represent a risk factor for the development of lung metastases and suggest that amelioration of the pulmonary inflammation associated with asthma will have a direct and immediate benefit to the 7 % to 8 % of breast cancer patients with this lung disease .", "entity": [{"entity": "respiratory", "entity_type": "Anatomy", "pos": [35, 46]}, {"entity": "lung metastases", "entity_type": "Anatomy", "pos": [111, 126]}, {"entity": "pulmonary", "entity_type": "Anatomy", "pos": [164, 173]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [272, 285]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [305, 309]}], "task": "NER"}
+{"text": "Inhibition of energy - producing pathways of HepG2 cells by 3 - bromopyruvate .", "entity": [{"entity": "HepG2 cells", "entity_type": "Anatomy", "pos": [45, 56]}], "task": "NER"}
+{"text": "3 - BrPA ( 3 - bromopyruvate ) is an alkylating agent with anti - tumoral activity on hepatocellular carcinoma .", "entity": [{"entity": "tumoral", "entity_type": "Anatomy", "pos": [66, 73]}, {"entity": "hepatocellular carcinoma", "entity_type": "Anatomy", "pos": [86, 110]}], "task": "NER"}
+{"text": "This compound inhibits cellular ATP production owing to its action on glycolysis and oxidative phosphorylation ; however , the specific metabolic steps and mechanisms of 3 - BrPA action in human hepatocellular carcinomas , particularly its effects on mitochondrial energetics , are poorly understood .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [23, 31]}, {"entity": "hepatocellular carcinomas", "entity_type": "Anatomy", "pos": [195, 220]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [251, 264]}], "task": "NER"}
+{"text": "In the present study it was found that incubation of HepG2 cells with a low concentration of 3 - BrPA for a short period ( 150 microM for 30 min ) significantly affected both glycolysis and mitochondrial respiratory functions .", "entity": [{"entity": "HepG2 cells", "entity_type": "Anatomy", "pos": [53, 64]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [190, 203]}], "task": "NER"}
+{"text": "The activity of mitochondrial hexokinase was not inhibited by 150 microM 3 - BrPA , but this concentration caused more than 70 % inhibition of GAPDH ( glyceraldehyde - 3 - phosphate dehydrogenase ) and 3 - phosphoglycerate kinase activities .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [16, 29]}], "task": "NER"}
+{"text": "Additionally , 3 - BrPA treatment significantly impaired lactate production by HepG2 cells , even when glucose was withdrawn from the incubation medium .", "entity": [{"entity": "HepG2 cells", "entity_type": "Anatomy", "pos": [79, 90]}], "task": "NER"}
+{"text": "Oxygen consumption of HepG2 cells supported by either pyruvate / malate or succinate was inhibited when cells were pre - incubated with 3 - BrPA in glucose - free medium .", "entity": [{"entity": "HepG2 cells", "entity_type": "Anatomy", "pos": [22, 33]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [104, 109]}], "task": "NER"}
+{"text": "On the other hand , when cells were pre - incubated in glucose - supplemented medium , oxygen consumption was affected only when succinate was used as the oxidizable substrate .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [25, 30]}], "task": "NER"}
+{"text": "An increase in oligomycin - independent respiration was observed in HepG2 cells treated with 3 - BrPA only when incubated in glucose - supplemented medium , indicating that 3 - BrPA induces mitochondrial proton leakage as well as blocking the electron transport system .", "entity": [{"entity": "HepG2 cells", "entity_type": "Anatomy", "pos": [68, 79]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [190, 203]}], "task": "NER"}
+{"text": "The activity of succinate dehydrogenase was inhibited by 70 % by 3 - BrPA treatment .", "entity": [], "task": "NER"}
+{"text": "These results suggest that the combined action of 3 - BrPA on succinate dehydrogenase and on glycolysis , inhibiting steps downstream of the phosphorylation of glucose , play an important role in HepG2 cell death .", "entity": [{"entity": "HepG2 cell", "entity_type": "Anatomy", "pos": [196, 206]}], "task": "NER"}
+{"text": "[ Retinochoroidopathy after intravitreal anti - VEGF treatment ]", "entity": [], "task": "NER"}
+{"text": "A 74 - year - old man presented with persistent metamorphopsias of the right eye 2 weeks after intravitreal injection of bevacizumab to treat choroidal neovascularization due to exudative age - related macular degeneration .", "entity": [{"entity": "right eye", "entity_type": "Anatomy", "pos": [71, 80]}, {"entity": "choroidal", "entity_type": "Anatomy", "pos": [142, 151]}, {"entity": "macular", "entity_type": "Anatomy", "pos": [202, 209]}], "task": "NER"}
+{"text": "The diagnosis reached was retinochoroiditis as an occult manifestation of sarcoidosis , possibly resulting from an intravitreal injection of bevacizumab .", "entity": [], "task": "NER"}
+{"text": "The patient received a prescription for 100 mg Ultralan to be taken daily for 3 days and then tapered in 3 day steps .", "entity": [], "task": "NER"}
+{"text": "During the further course no deterioration of the condition was observed .", "entity": [], "task": "NER"}
+{"text": "The detection of macrosomia at a teaching hospital .", "entity": [], "task": "NER"}
+{"text": "We sought to determine the detection ( clinical or sonographic ) rate of macrosomic newborns ( at least 4000 g ) and the peripartum factors among those who were or were not identified accurately .", "entity": [], "task": "NER"}
+{"text": "We retrospectively reviewed all deliveries over 1 year and all maternal and neonatal charts of macrosomic newborns delivered during that year .", "entity": [], "task": "NER"}
+{"text": "Odds ratio ( ORs ) and 95 % confidence intervals ( CIs ) were calculated .", "entity": [], "task": "NER"}
+{"text": "Over a 12 - month period , the rate of macrosomia was 10 % ( 421 / 4194 ) and of those , only 11 % ( 95 % CI 8 to 14 % ) were suspected clinically or sonographically .", "entity": [], "task": "NER"}
+{"text": "None of the newborns weighing 4500 g or more were recognized before birth ( 0 / 57 ; 95 % CI 0 to 6 % ) .", "entity": [], "task": "NER"}
+{"text": "The rate of cesarean delivery was significantly higher among newborns correctly identified as macrosomic ( 58 % ) versus those missed ( 36 % ; OR 2 . 76 , 95 % CI 1 . 46 , 5 . 16 ) .", "entity": [], "task": "NER"}
+{"text": "The incidence of newborns weighing in excess of 4000 g is 10 % , and approximately 90 % of these macrosomic newborns were unsuspected before birth .", "entity": [], "task": "NER"}
+{"text": "Silencing of directional migration in roundabout4 knockdown endothelial cells .", "entity": [{"entity": "roundabout4 knockdown endothelial cells", "entity_type": "Anatomy", "pos": [38, 77]}], "task": "NER"}
+{"text": "BACKGROUND : Roundabouts are axon guidance molecules that have recently been identified to play a role in vascular guidance as well .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [106, 114]}], "task": "NER"}
+{"text": "In this study , we have investigated gene knockdown analysis of endothelial Robos , in particular roundabout 4 ( robo4 ) , the predominant Robo in endothelial cells using small interfering RNA technology in vitro .", "entity": [{"entity": "endothelial", "entity_type": "Anatomy", "pos": [64, 75]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [147, 164]}], "task": "NER"}
+{"text": "RESULTS : Robo1 and Robo4 knockdown cells display distinct activity in endothelial cell migration assay .", "entity": [{"entity": "Robo1", "entity_type": "Anatomy", "pos": [10, 15]}, {"entity": "Robo4 knockdown cells", "entity_type": "Anatomy", "pos": [20, 41]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [71, 87]}], "task": "NER"}
+{"text": "The knockdown of robo4 abrogated the chemotactic response of endothelial cells to serum but enhanced a chemokinetic response to Slit2 , while robo1 knockdown cells do not display chemotactic response to serum or VEGF .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [61, 78]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "robo1 knockdown cells", "entity_type": "Anatomy", "pos": [142, 163]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [203, 208]}], "task": "NER"}
+{"text": "Robo4 knockdown endothelial cells unexpectedly show up regulation of Rho GTPases .", "entity": [{"entity": "Robo4 knockdown endothelial cells", "entity_type": "Anatomy", "pos": [0, 33]}], "task": "NER"}
+{"text": "Zebrafish Robo4 rescues both Rho GTPase homeostasis and serum reduced chemotaxis in robo4 knockdown cells .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [56, 61]}, {"entity": "robo4 knockdown cells", "entity_type": "Anatomy", "pos": [84, 105]}], "task": "NER"}
+{"text": "Robo1 and Robo4 interact and share molecules such as Slit2 , Mena and Vilse , a Cdc42 - GAP .", "entity": [], "task": "NER"}
+{"text": "In addition , this study mechanistically implicates IRSp53 in the signaling nexus between activated Cdc42 and Mena , both of which have previously been shown to be involved with Robo4 signaling in endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [197, 214]}], "task": "NER"}
+{"text": "CONCLUSION : This study identifies specific components of the Robo signaling apparatus that work together to guide directional migration of endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [140, 157]}], "task": "NER"}
+{"text": "p53 hot - spot mutants increase tumor vascularization via ROS - mediated activation of the HIF1 / VEGF - A pathway .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [32, 37]}], "task": "NER"}
+{"text": "The function of p53 tumor suppressor is often altered in various human tumors predominantly through missense - mutations resulting in accumulation of mutant proteins .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [20, 25]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [71, 77]}], "task": "NER"}
+{"text": "We revealed that expression of p53 proteins with amino - acid substitutions at codons 175 ( R175H ) , 248 ( R248W ) , and 273 ( R273H ) , representing the hot - spots of mutations in various human tumors , increased the number of vessels in HCT116 human colon carcinoma xenografts and , as a result , accelerated their growth .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [197, 203]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [230, 237]}, {"entity": "HCT116 human colon carcinoma xenografts", "entity_type": "Anatomy", "pos": [241, 280]}], "task": "NER"}
+{"text": "Stimulation of tumor angiogenesis was connected with about 2 - fold increase in intracellular level of reactive oxygen species ( ROS ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [15, 20]}, {"entity": "intracellular", "entity_type": "Anatomy", "pos": [80, 93]}], "task": "NER"}
+{"text": "Antioxidant N - acetyl - l - aspartate ( NAC ) decreased vessels number in tumors formed by cells with inactivated p53 and inhibited their growth .", "entity": [{"entity": "vessels", "entity_type": "Anatomy", "pos": [57, 64]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [75, 81]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [92, 97]}], "task": "NER"}
+{"text": "Effect of ROS on angiogenesis in tumors expressing hot - spot p53 mutants was correlated with their ability to increase a content of HIF1 transcriptional factor responsible for up - regulation of VEGF - A mRNAs .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [33, 39]}], "task": "NER"}
+{"text": "The Akt / mTOR pathway assures the synthesis of HIF - 1alpha protein in a glucose - and reoxygenation - dependent manner in irradiated tumors .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [135, 141]}], "task": "NER"}
+{"text": "Transcriptional activity of HIF - 1 ( hypoxia - inducible factor - 1 ) has been reported to be up - regulated in solid tumors after ionizing radiation ; however , the molecular mechanism underlying the response remains to be elucidated .", "entity": [{"entity": "solid tumors", "entity_type": "Anatomy", "pos": [113, 125]}], "task": "NER"}
+{"text": "In the present study , we performed a series of molecular imaging experiments using a HIF - 1 - dependent reporter gene , 5HREp - ODD - luc , and found an essential role of the Akt / mTOR pathway .", "entity": [], "task": "NER"}
+{"text": "Hypoxic tumor cells distant from blood vessels were dramatically reoxygenated at 24 h postirradiation , and HIF - 1 activity increased as HIF - 1alpha accumulated in the reoxygenated regions .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [8, 19]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [33, 46]}], "task": "NER"}
+{"text": "The accumulation was inhibited with a nonmetabolizable glucose analog , 2 - deoxy - d - glucose , through the suppression of radiation - induced phosphorylation of Akt in the reoxygenated regions .", "entity": [], "task": "NER"}
+{"text": "Akt knockdown and an mTOR inhibitor revealed the importance of the Akt / mTOR pathway in the postirradiation accumulation of HIF - 1alpha .", "entity": [], "task": "NER"}
+{"text": "In vitro experiments confirmed that an increase in glucose availability induced Akt phosphorylation under reoxygenated conditions and consequently up - regulated HIF - 1alpha translation .", "entity": [], "task": "NER"}
+{"text": "Moreover , both the accelerated translation and the previously reported reactive oxygen species - mediated stabilization of HIF - 1alpha protein were essential to the activation of HIF - 1 .", "entity": [], "task": "NER"}
+{"text": "All of these results indicate that Akt / mTOR - dependent translation of HIF - 1alpha plays a critical role in the postirradiation up - regulation of intratumoral HIF - 1 activity in response to radiation - induced alterations of glucose and oxygen availability in a solid tumor .", "entity": [{"entity": "intratumoral", "entity_type": "Anatomy", "pos": [150, 162]}, {"entity": "solid tumor", "entity_type": "Anatomy", "pos": [267, 278]}], "task": "NER"}
+{"text": "Estradiol increases IL - 8 secretion of normal human breast tissue and breast cancer in vivo .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [53, 66]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [71, 84]}], "task": "NER"}
+{"text": "IL - 8 or CXCL8 has been associated with tumor angiogenesis , metastasis , and poor prognosis in breast cancer .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [41, 46]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [97, 110]}], "task": "NER"}
+{"text": "Estrogen is crucial in breast carcinogenesis and tumor progression .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [23, 29]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [49, 54]}], "task": "NER"}
+{"text": "Whether sex steroids affect IL - 8 secretion of normal breast tissue or breast cancer is not known .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [55, 68]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [72, 85]}], "task": "NER"}
+{"text": "Several cell types in a tissue secrete IL - 8 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [8, 12]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [24, 30]}], "task": "NER"}
+{"text": "Hence , regulatory mechanisms of IL - 8 need to be investigated in whole tissue .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [73, 79]}], "task": "NER"}
+{"text": "We used microdialysis to sample IL - 8 in normal human breast tissue in situ in pre - and postmenopausal women , preoperatively in breast cancers of women , and in experimental breast cancer in mice .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [55, 68]}, {"entity": "breast cancers", "entity_type": "Anatomy", "pos": [131, 145]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [177, 190]}], "task": "NER"}
+{"text": "We found a significant positive correlation between IL - 8 and estradiol in normal breast tissue and hormone - dependent breast cancer in vivo .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [83, 96]}, {"entity": "hormone - dependent breast cancer", "entity_type": "Anatomy", "pos": [101, 134]}], "task": "NER"}
+{"text": "Ex vivo , estradiol exposure increased the IL - 8 secretion of normal whole breast tissue in culture .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [76, 89]}], "task": "NER"}
+{"text": "In experimental breast cancer , estradiol increased IL - 8 whereas the anti - estrogen tamoxifen inhibited the secretion of IL - 8 both in vitro and extracellularly in vivo in tumors of nude mice .", "entity": [{"entity": "breast cancer", "entity_type": "Anatomy", "pos": [16, 29]}, {"entity": "extracellularly", "entity_type": "Anatomy", "pos": [149, 164]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [176, 182]}], "task": "NER"}
+{"text": "An anti - IL - 8 Ab inhibited endothelial cell proliferation induced by cancer cell produced IL - 8 and tumors with low IL - 8 levels exhibited decreased angiogenesis .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [30, 46]}, {"entity": "cancer cell", "entity_type": "Anatomy", "pos": [72, 83]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [104, 110]}], "task": "NER"}
+{"text": "Our results strongly suggest that estradiol has a critical role in the regulation of IL - 8 in normal human breast tissue and human breast cancer .", "entity": [{"entity": "breast tissue", "entity_type": "Anatomy", "pos": [108, 121]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [132, 145]}], "task": "NER"}
+{"text": "IL - 8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression .", "entity": [{"entity": "breast", "entity_type": "Anatomy", "pos": [66, 72]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [92, 97]}], "task": "NER"}
+{"text": "Chemokine receptor CXCR4 expression , function , and clinical implications in gastric cancer .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [78, 92]}], "task": "NER"}
+{"text": "The chemokine receptor CXCR4 is associated with the biological behavior of cancer , but few studies have addressed the expression and function of CXCR4 in human gastric cancer and its impact on disease prognosis .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [75, 81]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [161, 175]}], "task": "NER"}
+{"text": "We studied the expression of CXCR4 using RT - PCR , Western blotting , flow cytometry , and confocal microscopy in five gastric cancer cell lines .", "entity": [{"entity": "gastric cancer cell lines", "entity_type": "Anatomy", "pos": [120, 145]}], "task": "NER"}
+{"text": "We also examined cell proliferation , migration , and anti - apoptotic activity in response to stromal cell - derived factor ( SDF ) - 1alpha and evaluated SDF - 1alpha / CXCR4 signaling pathways .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [17, 21]}], "task": "NER"}
+{"text": "Furthermore , we investigated the correlation between CXCR4 expression and the clinical features of 221 gastric cancer tissue samples .", "entity": [{"entity": "gastric cancer tissue samples", "entity_type": "Anatomy", "pos": [104, 133]}], "task": "NER"}
+{"text": "CXCR4 transcripts and proteins were detectable in all five gastric cancer cell lines .", "entity": [{"entity": "gastric cancer cell lines", "entity_type": "Anatomy", "pos": [59, 84]}], "task": "NER"}
+{"text": "However , MKN - 28 , MKN - 45 , MKN - 74 , and SNU16 cells did not express membrane CXCR4 .", "entity": [{"entity": "MKN - 28", "entity_type": "Anatomy", "pos": [10, 18]}, {"entity": "MKN - 45", "entity_type": "Anatomy", "pos": [21, 29]}, {"entity": "MKN - 74", "entity_type": "Anatomy", "pos": [32, 40]}, {"entity": "SNU16 cells", "entity_type": "Anatomy", "pos": [47, 58]}, {"entity": "membrane", "entity_type": "Anatomy", "pos": [75, 83]}], "task": "NER"}
+{"text": "In contrast , KATO III cells expressed membrane CXCR4 .", "entity": [{"entity": "KATO III cells", "entity_type": "Anatomy", "pos": [14, 28]}, {"entity": "membrane", "entity_type": "Anatomy", "pos": [39, 47]}], "task": "NER"}
+{"text": "In these cells , SDF - 1alpha - induced migration was observed and was blocked by AMD3100 , a specific inhibitor of CXCR4 .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [9, 14]}], "task": "NER"}
+{"text": "SDF - 1alpha induced rapid phosphorylation of Erk1 / 2 MAPK but did not promote phosphorylation of Stat3 or Akt .", "entity": [], "task": "NER"}
+{"text": "Gastric cancer tissue samples expressed CXCR4 with variable intensities .", "entity": [{"entity": "Gastric cancer tissue samples", "entity_type": "Anatomy", "pos": [0, 29]}], "task": "NER"}
+{"text": "Strong CXCR4 expression was significantly associated with lymph node metastases ( P = 0 . 028 ) and higher stages III / IV ( P = 0 . 047 ) , and further tended to be correlated with a reduced 5 - year survival rate ( 42 . 6 % vs . 53 . 9 % ; P = 0 . 1 ) .", "entity": [{"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [58, 79]}], "task": "NER"}
+{"text": "In conclusion , CXCR4 expression is associated with gastric cancer cell migration in vitro , and strong expression of CXCR4 by gastric cancer cells is significantly associated with lymphatic metastasis in patients with gastric cancer , suggesting that CXCR4 plays an important role during gastric cancer progression .", "entity": [{"entity": "gastric cancer cell", "entity_type": "Anatomy", "pos": [52, 71]}, {"entity": "gastric cancer cells", "entity_type": "Anatomy", "pos": [127, 147]}, {"entity": "lymphatic", "entity_type": "Anatomy", "pos": [181, 190]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [219, 233]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [289, 303]}], "task": "NER"}
+{"text": "Effect of estrogen and progesterone on macrophage activation during wound healing .", "entity": [{"entity": "macrophage", "entity_type": "Anatomy", "pos": [39, 49]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [68, 73]}], "task": "NER"}
+{"text": "Age - related impaired wound healing leads to substantial morbidity and mortality along with a large financial burden to health services .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [23, 28]}], "task": "NER"}
+{"text": "There is accumulating evidence that the tissue damage associated with chronic wounds is initiated and propagated by an inappropriately excessive inflammatory response .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [40, 46]}, {"entity": "wounds", "entity_type": "Anatomy", "pos": [78, 84]}], "task": "NER"}
+{"text": "Research on age - related impaired wound healing suggests that the decline in sex steroid hormones with age may have a substantial influence on the inflammatory response in vivo .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [35, 40]}], "task": "NER"}
+{"text": "Topical and systemic estrogen treatments have shown an increased rate of healing by reducing inflammation , however the underlying mechanisms are little understood .", "entity": [], "task": "NER"}
+{"text": "In vitro studies also suggest progesterone may play a role in modulating inflammation .", "entity": [], "task": "NER"}
+{"text": "Macrophages are essential mediators of inflammation and wound healing .", "entity": [{"entity": "Macrophages", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [56, 61]}], "task": "NER"}
+{"text": "Macrophages can be activated in a classical or alternative manner in parallel with the T ( H ) 1 / T ( H ) 2 dichotomy , respectively .", "entity": [{"entity": "Macrophages", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "T ( H ) 1", "entity_type": "Anatomy", "pos": [87, 96]}, {"entity": "T ( H ) 2", "entity_type": "Anatomy", "pos": [99, 108]}], "task": "NER"}
+{"text": "Using a murine incisional wound healing model this study was carried out to investigate the roles of estrogen and progesterone on macrophage activation during the wound healing response .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [26, 31]}, {"entity": "macrophage", "entity_type": "Anatomy", "pos": [130, 140]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [163, 168]}], "task": "NER"}
+{"text": "Our findings suggest with a reduction of steroid hormones following ovariectomy , alternatively activated macrophage markers ( Fizz1 and Ym1 ) were reduced , with this effect being reversed with the administration of estrogen or progesterone ; suggesting that with the reduction of steroid hormones macrophages are activated in a classical manner , promoting inflammation , whereas estrogen or progesterone are contributing toward macrophage activation in an alternative manner , driving wound repair , angiogenesis , and remodeling .", "entity": [{"entity": "macrophage", "entity_type": "Anatomy", "pos": [106, 116]}, {"entity": "macrophages", "entity_type": "Anatomy", "pos": [299, 310]}, {"entity": "macrophage", "entity_type": "Anatomy", "pos": [431, 441]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [488, 493]}], "task": "NER"}
+{"text": "Heart sound and electrocardiogram recording devices for telemedicine environments .", "entity": [{"entity": "Heart", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "There is currently a worldwide trend to bring healthcare services as close as possible to the patient , either through home healthcare systems , or telemedicine .", "entity": [], "task": "NER"}
+{"text": "There is thus a general need for equipment that can capture patient data electronically for automated review or analysis by a medical practitioner .", "entity": [], "task": "NER"}
+{"text": "This paper presents prototype systems that were developed with the ultimate aim for use in telemedicine settings in rural Africa .", "entity": [], "task": "NER"}
+{"text": "These devices can be used to electronically capture data on patients from several sensors in a quick an easy manner .", "entity": [], "task": "NER"}
+{"text": "In our presented cases we focus on cardiovascular information .", "entity": [{"entity": "cardiovascular", "entity_type": "Anatomy", "pos": [35, 49]}], "task": "NER"}
+{"text": "One of the main advantages of the proposed systems is that the data are captured simultaneously from multiple sensors .", "entity": [], "task": "NER"}
+{"text": "The data can be stored and sent electronically for review and analysis , and knowledge - based systems or neural network type models can be used in the future for semi - autonomous screening of the recordings , before a patient is referred to a specialist .", "entity": [], "task": "NER"}
+{"text": "Effect of platelet - rich plasma and fibrin glue on healing of critical - size calvarial bone defects .", "entity": [{"entity": "platelet - rich plasma", "entity_type": "Anatomy", "pos": [10, 32]}, {"entity": "calvarial bone", "entity_type": "Anatomy", "pos": [79, 93]}], "task": "NER"}
+{"text": "Despite the insufficient number of experimental studies , platelet - rich plasma ( PRP ) including high amounts of growth factors is introduced to clinical use rapidly .", "entity": [{"entity": "platelet - rich plasma", "entity_type": "Anatomy", "pos": [58, 80]}, {"entity": "PRP", "entity_type": "Anatomy", "pos": [83, 86]}], "task": "NER"}
+{"text": "The aim of this study was to compare the effects of PRP and platelet - poor plasma ( PPP ) on healing of critical - size bone defects . Bilateral full - thickness , critical - size bone defects were created in the parietal bones of 32 rabbits , which had been studied in 4 groups .", "entity": [{"entity": "PRP", "entity_type": "Anatomy", "pos": [52, 55]}, {"entity": "platelet - poor plasma", "entity_type": "Anatomy", "pos": [60, 82]}, {"entity": "PPP", "entity_type": "Anatomy", "pos": [85, 88]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [121, 125]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [181, 185]}, {"entity": "parietal bones", "entity_type": "Anatomy", "pos": [214, 228]}], "task": "NER"}
+{"text": "Saline , thrombin solution , PPP , and PRP were applied to the created defects before closure .", "entity": [{"entity": "PPP", "entity_type": "Anatomy", "pos": [29, 32]}, {"entity": "PRP", "entity_type": "Anatomy", "pos": [39, 42]}], "task": "NER"}
+{"text": "Radiologic defect area measurement results at 0 , 4 , and 16 weeks were compared between the groups .", "entity": [], "task": "NER"}
+{"text": "In addition , densities of the newly formed bones at 16th week were studied .", "entity": [{"entity": "bones", "entity_type": "Anatomy", "pos": [44, 49]}], "task": "NER"}
+{"text": "Histologic parameters ( primary and secondary bone trabecula , neovascularization , and bone marrow and connective tissue formation ) were compared between 4 - and 16 - week groups . More rapid decrease in defect size was observed in groups 3 and 4 than in groups 1 and 2 , both in the 4th and 16th weeks .", "entity": [{"entity": "bone trabecula", "entity_type": "Anatomy", "pos": [46, 60]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [88, 99]}, {"entity": "connective tissue", "entity_type": "Anatomy", "pos": [104, 121]}], "task": "NER"}
+{"text": "Newly formed bone densities were also found to be higher in these 2 groups .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [13, 17]}], "task": "NER"}
+{"text": "New bone formation was detected to be more rapid considering histologic parameters , in groups 3 and 4 at 4th and 16th weeks . Study demonstrates that PRP and PPP might have favorable effects on bone healing .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [4, 8]}, {"entity": "PRP", "entity_type": "Anatomy", "pos": [151, 154]}, {"entity": "PPP", "entity_type": "Anatomy", "pos": [159, 162]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [195, 199]}], "task": "NER"}
+{"text": "Although we cannot reveal any statistical difference between these 2 substances considering osteoinductive potential , PRP group has demonstrated superior results compared with fibrin glue group .", "entity": [{"entity": "PRP", "entity_type": "Anatomy", "pos": [119, 122]}], "task": "NER"}
+{"text": "Higher platelet concentrations may expose beneficial effects of PRP .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [7, 15]}, {"entity": "PRP", "entity_type": "Anatomy", "pos": [64, 67]}], "task": "NER"}
+{"text": "Host - derived angiopoietin - 2 affects early stages of tumor development and vessel maturation but is dispensable for later stages of tumor growth .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [56, 61]}, {"entity": "vessel", "entity_type": "Anatomy", "pos": [78, 84]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [135, 140]}], "task": "NER"}
+{"text": "The angiopoietin / Tie2 system has been identified as the second vascular - specific receptor tyrosine kinase system controlling vessel assembly , maturation , and quiescence .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [65, 73]}, {"entity": "vessel", "entity_type": "Anatomy", "pos": [129, 135]}], "task": "NER"}
+{"text": "Angiopoietin - 2 ( Ang - 2 ) is prominently up - regulated in the host - derived vasculature of most tumors , making it an attractive candidate for antiangiogenic intervention .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [81, 92]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [101, 107]}], "task": "NER"}
+{"text": "Yet , the net outcome of Ang - 2 functions on tumor angiogenesis is believed to be contextual depending on the local cytokine milieu .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [46, 51]}], "task": "NER"}
+{"text": "Correspondingly , Ang - 2 manipulatory therapies have been shown to exert protumorigenic as well as antitumorigenic effects .", "entity": [], "task": "NER"}
+{"text": "To clarify the role of Ang - 2 for angiogenesis and tumor growth in a definite genetic experimental setting , the present study was aimed at comparatively studying the growth of different tumors in wild - type and Ang - 2 - deficient mice .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [52, 57]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [188, 194]}], "task": "NER"}
+{"text": "Lewis lung carcinomas , MT - ret melanomas , and B16F10 melanomas all grew slower in Ang - 2 - deficient mice .", "entity": [{"entity": "Lewis lung carcinomas", "entity_type": "Anatomy", "pos": [0, 21]}, {"entity": "MT - ret melanomas", "entity_type": "Anatomy", "pos": [24, 42]}, {"entity": "B16F10 melanomas", "entity_type": "Anatomy", "pos": [49, 65]}], "task": "NER"}
+{"text": "Yet , tumor growth in wild - type and Ang - 2 - deficient mice dissociated during early stages of tumor development , whereas tumor growth rates during later stages of primary tumor progression were similar .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [6, 11]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [98, 103]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [126, 131]}, {"entity": "primary tumor", "entity_type": "Anatomy", "pos": [168, 181]}], "task": "NER"}
+{"text": "Analysis of the intratumoral vascular architecture revealed no major differences in microvessel density and perfusion characteristics .", "entity": [{"entity": "intratumoral vascular architecture", "entity_type": "Anatomy", "pos": [16, 50]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [84, 95]}], "task": "NER"}
+{"text": "However , diameters of intratumoral microvessels were smaller in tumors grown in Ang - 2 - deficient mice , and the vasculature had an altered pattern of pericyte recruitment and maturation .", "entity": [{"entity": "intratumoral microvessels", "entity_type": "Anatomy", "pos": [23, 48]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [65, 71]}, {"entity": "vasculature", "entity_type": "Anatomy", "pos": [116, 127]}, {"entity": "pericyte", "entity_type": "Anatomy", "pos": [154, 162]}], "task": "NER"}
+{"text": "Ang - 2 - deficient tumor vessels had higher pericyte coverage indices .", "entity": [{"entity": "Ang - 2 - deficient tumor vessels", "entity_type": "Anatomy", "pos": [0, 33]}, {"entity": "pericyte", "entity_type": "Anatomy", "pos": [45, 53]}], "task": "NER"}
+{"text": "Recruited pericytes were desmin and NG2 positive and predominately alpha - smooth muscle actin negative , indicative of a more mature pericyte phenotype .", "entity": [{"entity": "pericytes", "entity_type": "Anatomy", "pos": [10, 19]}, {"entity": "pericyte", "entity_type": "Anatomy", "pos": [134, 142]}], "task": "NER"}
+{"text": "Collectively , the experiments define the role of Ang - 2 during tumor angiogenesis and establish a better rationale for combination therapies involving Ang - 2 manipulatory therapies .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [65, 70]}], "task": "NER"}
+{"text": "Liposomal honokiol inhibits VEGF - D - induced lymphangiogenesis and metastasis in xenograft tumor model .", "entity": [{"entity": "Liposomal", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "xenograft tumor", "entity_type": "Anatomy", "pos": [83, 98]}], "task": "NER"}
+{"text": "Lymph nodes metastasis of tumor could be a crucial early step in the metastatic process .", "entity": [{"entity": "Lymph nodes", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [26, 31]}], "task": "NER"}
+{"text": "Induction of tumor lymphangiogenesis by vascular endothelial growth factor - D may play an important role in promoting tumor metastasis to regional lymph nodes and these processes can be inhibited by inactivation of the VEGFR - 3 signaling pathway .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [13, 18]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [119, 124]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [148, 159]}], "task": "NER"}
+{"text": "Honokiol has been reported to possess potent antiangiogenesis and antitumor properties in several cell lines and xenograft tumor models .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [66, 75]}, {"entity": "cell lines", "entity_type": "Anatomy", "pos": [98, 108]}, {"entity": "xenograft tumor", "entity_type": "Anatomy", "pos": [113, 128]}], "task": "NER"}
+{"text": "However , its role in tumor - associated lymphangiogenesis and lymphatic metastasis remains unclear .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [22, 27]}, {"entity": "lymphatic", "entity_type": "Anatomy", "pos": [63, 72]}], "task": "NER"}
+{"text": "Here , we established lymph node metastasis models by injecting overexpressing VEGF - D Lewis lung carcinoma cells into C57BL / 6 mice to explore the effect of honokiol on tumor - associated lymphangiogenesis and related lymph node metastasis .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [22, 32]}, {"entity": "Lewis lung carcinoma cells", "entity_type": "Anatomy", "pos": [88, 114]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [172, 177]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [221, 231]}], "task": "NER"}
+{"text": "The underlying mechanisms were systematically investigated in vitro and in vivo .", "entity": [], "task": "NER"}
+{"text": "In in vivo study , liposomal honokiol significantly inhibited the tumor - associated lymphangiogenesis and metastasis in Lewis lung carcinoma model .", "entity": [{"entity": "liposomal", "entity_type": "Anatomy", "pos": [19, 28]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [66, 71]}, {"entity": "Lewis lung carcinoma", "entity_type": "Anatomy", "pos": [121, 141]}], "task": "NER"}
+{"text": "A remarkable delay of tumor growth and prolonged life span were also observed .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [22, 27]}], "task": "NER"}
+{"text": "In in vitro study , honokiol inhibited VEGF - D - induced survival , proliferation and tube - formation of both human umbilical vein endothelial cells ( HUVECs ) and lymphatic vascular endothelial cells ( HLECs ) .", "entity": [{"entity": "tube -", "entity_type": "Anatomy", "pos": [87, 93]}, {"entity": "human umbilical vein endothelial cells", "entity_type": "Anatomy", "pos": [112, 150]}, {"entity": "HUVECs", "entity_type": "Anatomy", "pos": [153, 159]}, {"entity": "lymphatic vascular endothelial cells", "entity_type": "Anatomy", "pos": [166, 202]}, {"entity": "HLECs", "entity_type": "Anatomy", "pos": [205, 210]}], "task": "NER"}
+{"text": "Western blotting analysis showed that liposomal honokiol - inhibited Akt and MAPK phosphorylation in 2 endothelial cells , and downregulated expressions of VEGFR - 2 of human vascular endothelial cells and VEGFR - 3 of lymphatic endothelial cells .", "entity": [{"entity": "liposomal", "entity_type": "Anatomy", "pos": [38, 47]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [103, 120]}, {"entity": "vascular endothelial cells", "entity_type": "Anatomy", "pos": [175, 201]}, {"entity": "lymphatic endothelial cells", "entity_type": "Anatomy", "pos": [219, 246]}], "task": "NER"}
+{"text": "Thus , we identified for the first time that honokiol provided therapeutic benefit not only by direct effects on tumor cells and antiangiogenesis but also by inhibiting lymphangiogenesis and metastasis via the VEGFR - 3 pathway .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [113, 124]}], "task": "NER"}
+{"text": "The present findings may be of importance to investigate the molecular mechanisms underlying the spread of cancer via the lymphatics and explore the therapeutical strategy of honokiol on antilymphangiogenesis and antimetastasis .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [107, 113]}, {"entity": "lymphatics", "entity_type": "Anatomy", "pos": [122, 132]}], "task": "NER"}
+{"text": "Short pigment epithelial - derived factor - derived peptide inhibits angiogenesis and tumor growth .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [86, 91]}], "task": "NER"}
+{"text": "PURPOSE : Pigment epithelial - derived factor ( PEDF ) is a potent angiogenesis inhibitor with multiple other functions , some of which enhance tumor growth .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [144, 149]}], "task": "NER"}
+{"text": "Our previous studies mapped PEDF antiangiogenic and prosurvival activities to distinct epitopes .", "entity": [], "task": "NER"}
+{"text": "This study was aimed to determine the minimal fragment of PEDF , which maintains antiangiogenic and antitumor efficacy .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [100, 109]}], "task": "NER"}
+{"text": "EXPERIMENTAL DESIGN : We analyzed antigenicity , hydrophilicity , and charge distribution of the angioinhibitory epitope ( the 34 - mer ) and designed three peptides covering its COOH terminus , P14 , P18 , and P23 .", "entity": [], "task": "NER"}
+{"text": "We analyzed their ability to block endothelial cell chemotaxis and induce apoptosis in vitro and their antiangiogenic activity in vivo .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [35, 51]}], "task": "NER"}
+{"text": "The selected peptide was tested for the antitumor activity against mildly aggressive xenografted prostate carcinoma and highly aggressive renal cell carcinoma .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [40, 49]}, {"entity": "prostate carcinoma", "entity_type": "Anatomy", "pos": [97, 115]}, {"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [138, 158]}], "task": "NER"}
+{"text": "To verify that P18 acts in the same manner as PEDF , we used immunohistochemistry to measure PEDF targets , vascular endothelial growth factor receptor 2 , and CD95 ligand expression in P18 - treated vasculature .", "entity": [{"entity": "vasculature", "entity_type": "Anatomy", "pos": [200, 211]}], "task": "NER"}
+{"text": "RESULTS : P14 and P18 blocked endothelial cell chemotaxis ; P18 and P23 induced apoptosis .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [30, 46]}], "task": "NER"}
+{"text": "P18 showed the highest IC50 and blocked angiogenesis in vivo : P23 was inactive and P14 was proangiogenic .", "entity": [], "task": "NER"}
+{"text": "P18 increased the production of CD95 ligand and reduced the expression of vascular endothelial growth factor receptor 2 by the endothelial cells in vivo .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [127, 144]}], "task": "NER"}
+{"text": "In tumor studies , P18 was more effective in blocking the angiogenesis and growth of the prostate cancer than parental 34 - mer ; in the renal cell carcinoma , P18 strongly decreased angiogenesis and halted the progression of established tumors .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [3, 8]}, {"entity": "prostate cancer", "entity_type": "Anatomy", "pos": [89, 104]}, {"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [137, 157]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [238, 244]}], "task": "NER"}
+{"text": "CONCLUSIONS : P18 is a novel and potent antiangiogenic biotherapeutic agent that has potential to be developed for the treatment of prostate and renal cancer .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [132, 140]}, {"entity": "renal cancer", "entity_type": "Anatomy", "pos": [145, 157]}], "task": "NER"}
+{"text": "An introduction to evidence - based practice for hand surgeons and therapists .", "entity": [{"entity": "hand", "entity_type": "Anatomy", "pos": [49, 53]}], "task": "NER"}
+{"text": "Evidence - based practice is a methodical approach to clinical practice where experience , best research evidence , and patient goals and values are integrated to make optimal decisions when making a diagnosis , selecting a diagnostic test , picking an intervention or determining prognosis .", "entity": [], "task": "NER"}
+{"text": "There are five steps in this process .", "entity": [], "task": "NER"}
+{"text": "Hand surgeons and therapists can use the evidence - based process to attain optimal management of individual patients , manage their overall practice , guide the ongoing professional development , and deal with funding and policy makers .", "entity": [{"entity": "Hand", "entity_type": "Anatomy", "pos": [0, 4]}], "task": "NER"}
+{"text": "Prolonged control of patterned biofilm formation by bio - inert surface chemistry .", "entity": [{"entity": "biofilm", "entity_type": "Anatomy", "pos": [31, 38]}], "task": "NER"}
+{"text": "A bio - inert surface chemistry was developed that can confine biofilm formation in designed patterns for at least 26 days .", "entity": [{"entity": "biofilm", "entity_type": "Anatomy", "pos": [63, 70]}], "task": "NER"}
+{"text": "Women ' s attitudes , preferences , and perceived barriers to treatment for perinatal depression .", "entity": [], "task": "NER"}
+{"text": "BACKGROUND :", "entity": [], "task": "NER"}
+{"text": "Perinatal depression is associated with potential negative consequences for the mother and infant , and therefore efforts to improve treatment access and efficacy are warranted .", "entity": [], "task": "NER"}
+{"text": "The purpose of this study was to examine pregnant women ' s preferences and attitudes about treatment for depression , and perceived potential barriers to accessing treatment .", "entity": [], "task": "NER"}
+{"text": "Data were collected by means of a questionnaire from a convenience sample of 509 predominantly well - educated , high - income , married women in the northeastern United States during the last trimester of pregnancy .", "entity": [], "task": "NER"}
+{"text": "Participants were queried as to treatment modalities in which they would most likely participate if they wanted help for depression , their attitudes toward psychotherapeutic and pharmacological treatments , and perceived barriers to receiving help .", "entity": [], "task": "NER"}
+{"text": "Most women ( 92 % ) indicated that would likely participate in individual therapy if help was needed .", "entity": [], "task": "NER"}
+{"text": "Only 35 percent stated that they would likely take medication if recommended , and 14 percent indicated that they would participate in group therapy .", "entity": [], "task": "NER"}
+{"text": "The greatest perceived potential barriers to treatment were lack of time ( 65 % ) , stigma ( 43 % ) , and childcare issues ( 33 % ) .", "entity": [], "task": "NER"}
+{"text": "Most women indicated a preference to receive mental health care at the obstetrics clinic , either from their obstetrics practitioner or from a mental health practitioner located at the clinic .", "entity": [], "task": "NER"}
+{"text": "Factors associated with acceptability of various depression treatments are presented .", "entity": [], "task": "NER"}
+{"text": "Understanding what prevents women from seeking or obtaining help for depression and determining what they prefer in the way of treatment may lead to improved depression treatment rates and hold promise for improving the overall health of childbearing women .", "entity": [], "task": "NER"}
+{"text": "Distinct role of PLCbeta3 in VEGF - mediated directional migration and vascular sprouting .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [71, 79]}], "task": "NER"}
+{"text": "Endothelial cell proliferation and migration is essential to angiogenesis .", "entity": [{"entity": "Endothelial cell", "entity_type": "Anatomy", "pos": [0, 16]}], "task": "NER"}
+{"text": "Typically , proliferation and chemotaxis of endothelial cells is driven by growth factors such as vascular endothelial growth factor ( VEGF ) and basic fibroblast growth factor ( bFGF ) .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [44, 61]}], "task": "NER"}
+{"text": "VEGF activates phospholipases ( PLCs ) - specifically PLCgamma1 - that are important for tubulogenesis , differentiation and DNA synthesis .", "entity": [], "task": "NER"}
+{"text": "However , we show here that VEGF , specifically through VEGFR2 , induces phosphorylation of two serine residues on PLCbeta3 , and this was confirmed in an ex vivo embryoid body model .", "entity": [{"entity": "embryoid body", "entity_type": "Anatomy", "pos": [163, 176]}], "task": "NER"}
+{"text": "Knockdown of PLCbeta3 in HUVEC cells affects IP3 production , actin reorganization , migration and proliferation ; whereas migration is inhibited , proliferation is enhanced .", "entity": [{"entity": "HUVEC cells", "entity_type": "Anatomy", "pos": [25, 36]}], "task": "NER"}
+{"text": "Our data suggest that enhanced proliferation is precipitated by an accelerated cell cycle , and decreased migration by an inability to activate CDC42 .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [79, 83]}], "task": "NER"}
+{"text": "Given that PLCbeta3 is typically known as an effector of heterotrimeric G - proteins , our data demonstrate a unique crosstalk between the G - protein and receptor tyrosine kinase ( RTK ) axes and reveal a novel molecular mechanism of VEGF signaling and , thus , angiogenesis .", "entity": [], "task": "NER"}
+{"text": "The impact of tracheal intubation on host defenses and risks for nosocomial pneumonia .", "entity": [{"entity": "tracheal", "entity_type": "Anatomy", "pos": [14, 22]}], "task": "NER"}
+{"text": "Nosocomial pneumonia remains a common complication in patients treated with endotracheal intubation and mechanical ventilation and continues to have a significant impact on the mortality rate of these patients .", "entity": [{"entity": "endotracheal", "entity_type": "Anatomy", "pos": [76, 88]}], "task": "NER"}
+{"text": "Epidemiologic studies have shown that the risk of pneumonia increases with the duration of intubation but that the period of highest risk is the first 2 weeks of therapy .", "entity": [], "task": "NER"}
+{"text": "Gram - negative bacteria account for most nosocomial pneumonias in intubated patients , but Staphylococcus aureus may also play a role in what may be a polymicrobial infection .", "entity": [], "task": "NER"}
+{"text": "In the most seriously ill individuals , and in those treated with long - term mechanical ventilation , Pseudomonas aeruginosa is a common pathogen .", "entity": [], "task": "NER"}
+{"text": "Endotracheal intubation and mechanical ventilation predispose to pneumonia for a variety of reasons ( see Fig . 1 ) .", "entity": [{"entity": "Endotracheal", "entity_type": "Anatomy", "pos": [0, 12]}], "task": "NER"}
+{"text": "The endotracheal tube can have direct effects on the airway that result in a reduction in local host defenses .", "entity": [{"entity": "endotracheal tube", "entity_type": "Anatomy", "pos": [4, 21]}, {"entity": "airway", "entity_type": "Anatomy", "pos": [53, 59]}], "task": "NER"}
+{"text": "Thus , mucosal injury can reduce mucociliary function , while upper airway defenses are bypassed and the effectiveness of cough is reduced .", "entity": [{"entity": "mucosal", "entity_type": "Anatomy", "pos": [7, 14]}, {"entity": "mucociliary", "entity_type": "Anatomy", "pos": [33, 44]}, {"entity": "airway", "entity_type": "Anatomy", "pos": [68, 74]}], "task": "NER"}
+{"text": "Indirectly , intubation can result in an enhanced capacity of tracheobronchial cells to bind gram - negative bacteria , an effect that favors airway colonization and pneumonia .", "entity": [{"entity": "tracheobronchial cells", "entity_type": "Anatomy", "pos": [62, 84]}, {"entity": "airway", "entity_type": "Anatomy", "pos": [142, 148]}], "task": "NER"}
+{"text": "The injury to the airway can create binding sites for bacteria in the basement membrane of the bronchial tree and the stimulation of the secretion of mucus , which then stagnates and can create potential sites for bacterial adherence .", "entity": [{"entity": "airway", "entity_type": "Anatomy", "pos": [18, 24]}, {"entity": "basement membrane", "entity_type": "Anatomy", "pos": [70, 87]}, {"entity": "bronchial tree", "entity_type": "Anatomy", "pos": [95, 109]}, {"entity": "mucus", "entity_type": "Anatomy", "pos": [150, 155]}], "task": "NER"}
+{"text": "The endotracheal tube also enhances bacterial entry to the lung by serving as a reservoir for bacteria to remain sequestered , safe from host defenses .", "entity": [{"entity": "endotracheal tube", "entity_type": "Anatomy", "pos": [4, 21]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [59, 63]}], "task": "NER"}
+{"text": "Respiratory therapy devices can allow bacteria to proliferate and can then introduce them into the patient if not handled properly .", "entity": [{"entity": "Respiratory", "entity_type": "Anatomy", "pos": [0, 11]}], "task": "NER"}
+{"text": "Finally , patients who are ill enough to require intubation also have disease - associated impairments in systemic host defense , which add to the impairments caused by the use of an artificial airway .", "entity": [{"entity": "airway", "entity_type": "Anatomy", "pos": [194, 200]}], "task": "NER"}
+{"text": "The host defense impairments that occur in mechanically ventilated patients can lead to respiratory tract infection in the form of either febrile tracheobronchitis or pneumonia .", "entity": [{"entity": "respiratory tract", "entity_type": "Anatomy", "pos": [88, 105]}], "task": "NER"}
+{"text": "The diagnosis of pneumonia in intubated patients is difficult and controversial .", "entity": [], "task": "NER"}
+{"text": "It can be made by either clinical criteria or microbiologic criteria , the latter by using a bronchoscopically directed protected specimen brush .", "entity": [], "task": "NER"}
+{"text": "Therapy of pneumonia in mechanically ventilated patients is not always successful , and systemic antibiotics may need to be supplemented by topical antimicrobials .", "entity": [], "task": "NER"}
+{"text": "No clearly effective prophylactic strategy currently exists , but our understanding of pneumonia pathogenesis has led to some promising directions .", "entity": [], "task": "NER"}
+{"text": "As more data are collected , inhaled antibiotics , selective digestive decontamination , and enhancement of host defenses by cytokines and pre - formed antibodies may emerge as useful approaches .", "entity": [], "task": "NER"}
+{"text": "Antivascular actions of microtubule - binding drugs .", "entity": [{"entity": "Antivascular", "entity_type": "Anatomy", "pos": [0, 12]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [24, 35]}], "task": "NER"}
+{"text": "Microtubule - binding drugs ( MBD ) are widely used in cancer chemotherapy and also have clinically relevant antiangiogenic and vascular - disrupting properties .", "entity": [{"entity": "Microtubule", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [55, 61]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [128, 136]}], "task": "NER"}
+{"text": "These antivascular actions are due in part to direct effects on endothelial cells , and all MBDs ( both microtubule - stabilizing and microtubule - destabilizing ) inhibit endothelial cell proliferation , migration , and tube formation in vitro , actions that are thought to correspond to therapeutic antiangiogenic actions .", "entity": [{"entity": "antivascular", "entity_type": "Anatomy", "pos": [6, 18]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [64, 81]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [104, 115]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [134, 145]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [172, 188]}, {"entity": "tube", "entity_type": "Anatomy", "pos": [221, 225]}], "task": "NER"}
+{"text": "In addition , the microtubule - destabilizing agents cause prominent changes in endothelial cell morphology , an action associated with rapid vascular collapse in vivo .", "entity": [{"entity": "microtubule", "entity_type": "Anatomy", "pos": [18, 29]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [80, 96]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [142, 150]}], "task": "NER"}
+{"text": "The effects on endothelial cells occur in vitro at low drug concentrations , which do not affect microtubule gross morphology , do not cause microtubule bundling or microtubule loss and do not induce cell cycle arrest , apoptosis , or cell death .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [15, 32]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [97, 108]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [141, 152]}, {"entity": "microtubule", "entity_type": "Anatomy", "pos": [165, 176]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [200, 204]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [235, 239]}], "task": "NER"}
+{"text": "Rather , it has been hypothesized that , at low concentrations , MBDs produce more subtle effects on microtubule dynamics , block critical cell signaling pathways , and prevent the microtubules from properly interacting with transient subcellular assemblies ( focal adhesions and adherens junctions ) whose subsequent stabilization and / or maturation are required for cell motility and cell - cell interactions .", "entity": [{"entity": "microtubule", "entity_type": "Anatomy", "pos": [101, 112]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [139, 143]}, {"entity": "microtubules", "entity_type": "Anatomy", "pos": [181, 193]}, {"entity": "subcellular assemblies", "entity_type": "Anatomy", "pos": [235, 257]}, {"entity": "focal adhesions", "entity_type": "Anatomy", "pos": [260, 275]}, {"entity": "adherens junctions", "entity_type": "Anatomy", "pos": [280, 298]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [369, 373]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [387, 391]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [394, 398]}], "task": "NER"}
+{"text": "This review will focus on recent studies to define the molecular mechanisms for the antivascular actions of the MBDs , information that could be useful in the identification or design of agents whose actions more selectively target the tumor vasculature .", "entity": [{"entity": "antivascular", "entity_type": "Anatomy", "pos": [84, 96]}, {"entity": "tumor vasculature", "entity_type": "Anatomy", "pos": [236, 253]}], "task": "NER"}
+{"text": "Neurovascular effects of CD47 signaling : promotion of cell death , inflammation , and suppression of angiogenesis in brain endothelial cells in vitro .", "entity": [{"entity": "Neurovascular", "entity_type": "Anatomy", "pos": [0, 13]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [55, 59]}, {"entity": "brain endothelial cells", "entity_type": "Anatomy", "pos": [118, 141]}], "task": "NER"}
+{"text": "The concept of the neurovascular unit emphasizes that common signals and substrates underlie the physiology and pathophysiology of neuronal and endothelial compartments in brain .", "entity": [{"entity": "neurovascular", "entity_type": "Anatomy", "pos": [19, 32]}, {"entity": "neuronal", "entity_type": "Anatomy", "pos": [131, 139]}, {"entity": "endothelial compartments", "entity_type": "Anatomy", "pos": [144, 168]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [172, 177]}], "task": "NER"}
+{"text": "Recent data suggest that activation of the integrin - associated protein CD47 promotes neuronal cell death .", "entity": [{"entity": "neuronal cell", "entity_type": "Anatomy", "pos": [87, 100]}], "task": "NER"}
+{"text": "Is it possible that CD47 may also negatively affect cerebral endothelial cells ?", "entity": [{"entity": "cerebral endothelial cells", "entity_type": "Anatomy", "pos": [52, 78]}], "task": "NER"}
+{"text": "Exposure of wild - type primary mouse cerebral endothelial cells to the CD47 ligand thrombospondin 1 ( TSP - 1 ) induced an increasing amount of cell death , whereas cytotoxicity was significantly decreased in cerebral endothelial cells derived from CD47 knockout mice .", "entity": [{"entity": "cerebral endothelial cells", "entity_type": "Anatomy", "pos": [38, 64]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [145, 149]}, {"entity": "cerebral endothelial cells", "entity_type": "Anatomy", "pos": [210, 236]}], "task": "NER"}
+{"text": "The specific CD47 - activating peptide , 4N1K , similarly induced cell death in human brain microvascular endothelial cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [66, 70]}, {"entity": "brain microvascular endothelial cells", "entity_type": "Anatomy", "pos": [86, 123]}], "task": "NER"}
+{"text": "Promotion of inflammation was also involved because lower TSP - 1 was able to up - regulate the adhesion molecules intercellular adhesion molecule - 1 and vascular cell adhesion molecule - 1 .", "entity": [], "task": "NER"}
+{"text": "Finally , CD47 signaling may suppress angiogenesis because 4N1K significantly inhibited endothelial cell migration and tube formation in vitro .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [88, 104]}, {"entity": "tube", "entity_type": "Anatomy", "pos": [119, 123]}], "task": "NER"}
+{"text": "We conclude that CD47 signaling can negatively affect the viability and function of cerebral endothelial cells , further supporting the notion that CD47 may be a potential neurovascular target for stroke and brain injury .", "entity": [{"entity": "cerebral endothelial cells", "entity_type": "Anatomy", "pos": [84, 110]}, {"entity": "neurovascular", "entity_type": "Anatomy", "pos": [172, 185]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [208, 213]}], "task": "NER"}
+{"text": "Cisplatin reduces endothelial cell migration via regulation of type 2 - matrix metalloproteinase activity .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [18, 34]}], "task": "NER"}
+{"text": "AIMS : In this study we investigated the effect of cisplatin on endothelial cell migration , an essential process for vascular remodeling and regeneration in several physiological and pathological situations .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [64, 80]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [118, 126]}], "task": "NER"}
+{"text": "MATERIAL AND METHODS : Human umbilical vein endothelial cells ( HUVEC ) were treated with cisplatin and endothelial cell migration analyzed by fluorescence and scratch - wound migration assay .", "entity": [{"entity": "Human umbilical vein endothelial cells", "entity_type": "Anatomy", "pos": [23, 61]}, {"entity": "HUVEC", "entity_type": "Anatomy", "pos": [64, 69]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [104, 120]}, {"entity": "scratch - wound", "entity_type": "Anatomy", "pos": [160, 175]}], "task": "NER"}
+{"text": "MMP2 and MMP9 activity were determined by zymographic assay , and MAPK activation by Western blotting analysis .", "entity": [], "task": "NER"}
+{"text": "RESULTS : We demonstrated that cisplatin provoked a time - and dose - dependent decrease of HUVEC migration ; this effect was clearly independent from its well known cytotoxic activity .", "entity": [{"entity": "HUVEC", "entity_type": "Anatomy", "pos": [92, 97]}], "task": "NER"}
+{"text": "In addition , cisplatin markedly reduced MMP2 activity in both conditioned media and cell lysates , increased p38 MAPK and JNK phosphorylation , but did not affect ERK phosphorylation .", "entity": [{"entity": "cell lysates", "entity_type": "Anatomy", "pos": [85, 97]}], "task": "NER"}
+{"text": "Endothelial cell migration was attenuated by treatment of cells with GM6001 , a non - specific inhibitor of MMPs , or by a selective anti - MMP2 antibody .", "entity": [{"entity": "Endothelial cell", "entity_type": "Anatomy", "pos": [0, 16]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [58, 63]}], "task": "NER"}
+{"text": "However , treatment of cells with SB202190 or SP600125 , inhibitors of p38 MAPK and JNK respectively , did not affect HUVEC migration .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [23, 28]}, {"entity": "HUVEC", "entity_type": "Anatomy", "pos": [118, 123]}], "task": "NER"}
+{"text": "CONCLUSION : These results suggested that cisplatin induced a reduction of endothelial cell migration through an inhibition of MMP2 activity by downstream signal transduction pathways independent of JNK and p38 MAPK activation .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [75, 91]}], "task": "NER"}
+{"text": "The modulation of platelet and endothelial cell adhesion to vascular graft materials by perlecan .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [18, 26]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [31, 47]}, {"entity": "vascular graft", "entity_type": "Anatomy", "pos": [60, 74]}], "task": "NER"}
+{"text": "Controlled neo - endothelialisation is critical to the patency of small diameter vascular grafts .", "entity": [{"entity": "vascular grafts", "entity_type": "Anatomy", "pos": [81, 96]}], "task": "NER"}
+{"text": "Endothelialisation and platelet adhesion to purified endothelial cell - derived perlecan , the major heparan sulfate ( HS ) proteoglycan in basement membranes , were investigated using in vivo and in vitro assays .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [23, 31]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [53, 69]}, {"entity": "basement membranes", "entity_type": "Anatomy", "pos": [140, 158]}], "task": "NER"}
+{"text": "Expanded polytetrafluoroethylene ( ePTFE ) vascular grafts were coated with perlecan and tested in an ovine carotid interposition model for a period of 6 weeks and assessed using light and scanning microscopy .", "entity": [{"entity": "vascular grafts", "entity_type": "Anatomy", "pos": [43, 58]}, {"entity": "carotid", "entity_type": "Anatomy", "pos": [108, 115]}], "task": "NER"}
+{"text": "Enhanced endothelial cell growth and reduced platelet adhesion were observed on the perlecan coated grafts when compared to uncoated controls implanted in the same sheep ( n = 5 ) .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [9, 25]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [45, 53]}, {"entity": "grafts", "entity_type": "Anatomy", "pos": [100, 106]}], "task": "NER"}
+{"text": "Perlecan was also found to stimulate endothelial cell proliferation in vitro over a period of 6 days in the presence of plasma proteins and fibroblastic growth factor 2 ( FGF - 2 ) , however in the absence of FGF - 2 endothelial cell growth could not be maintained during this period .", "entity": [{"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [37, 53]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [120, 126]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [217, 233]}], "task": "NER"}
+{"text": "Perlecan was found to be anti - adhesive for platelets , however after removal of the HS chains attached to perlecan , platelet adhesion and aggregation were supported .", "entity": [{"entity": "platelets", "entity_type": "Anatomy", "pos": [45, 54]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [119, 127]}], "task": "NER"}
+{"text": "These results suggest a role for HS chains of perlecan in improving graft patency by selectively promoting endothelial cell proliferation while modulating platelet adhesion .", "entity": [{"entity": "graft", "entity_type": "Anatomy", "pos": [68, 73]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [107, 123]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [155, 163]}], "task": "NER"}
+{"text": "Tumour angiogenesis : its mechanism and therapeutic implications in malignant gliomas .", "entity": [{"entity": "Tumour", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "malignant gliomas", "entity_type": "Anatomy", "pos": [68, 85]}], "task": "NER"}
+{"text": "Angiogenesis is a key event in the progression of malignant gliomas .", "entity": [{"entity": "malignant gliomas", "entity_type": "Anatomy", "pos": [50, 67]}], "task": "NER"}
+{"text": "The presence of microvascular proliferation leads to the histological diagnosis of glioblastoma multiforme .", "entity": [{"entity": "microvascular", "entity_type": "Anatomy", "pos": [16, 29]}, {"entity": "glioblastoma multiforme", "entity_type": "Anatomy", "pos": [83, 106]}], "task": "NER"}
+{"text": "Tumour angiogenesis involves multiple cellular processes including endothelial cell proliferation , migration , reorganisation of extracellular matrix and tube formation .", "entity": [{"entity": "Tumour", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [67, 83]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [130, 150]}, {"entity": "tube", "entity_type": "Anatomy", "pos": [155, 159]}], "task": "NER"}
+{"text": "These processes are regulated by numerous pro - angiogenic and anti - angiogenic growth factors .", "entity": [], "task": "NER"}
+{"text": "Angiogenesis inhibitors have been developed to interrupt the angiogenic process at the growth factor , receptor tyrosine kinase and intracellular kinase levels .", "entity": [{"entity": "intracellular", "entity_type": "Anatomy", "pos": [132, 145]}], "task": "NER"}
+{"text": "Other anti - angiogenic therapies alter the immune response and endogeneous angiogenesis inhibitor levels .", "entity": [], "task": "NER"}
+{"text": "Most anti - angiogenic therapies for malignant gliomas are in Phase I / II trials and only modest efficacies are reported for monotherapies .", "entity": [{"entity": "malignant gliomas", "entity_type": "Anatomy", "pos": [37, 54]}], "task": "NER"}
+{"text": "The greatest potential for angiogenesis inhibitors may lie in their ability to combine safely with chemotherapy and radiotherapy .", "entity": [], "task": "NER"}
+{"text": "Regulation of thrombospondin - 1 by natural and synthetic progestins in human breast cancer cells .", "entity": [{"entity": "breast cancer cells", "entity_type": "Anatomy", "pos": [78, 97]}], "task": "NER"}
+{"text": "Our recent studies show that progestins induce vascular endothelial growth factor ( VEGF ) in breast cancer cells that express mutant p53 protein .", "entity": [{"entity": "breast cancer cells", "entity_type": "Anatomy", "pos": [94, 113]}], "task": "NER"}
+{"text": "Here , we show that natural and synthetic progestins also induce thrombospondin - 1 ( TSP - 1 ) mRNA and protein in T47 - D and BT - 474 breast cancer cells .", "entity": [{"entity": "T47 - D", "entity_type": "Anatomy", "pos": [116, 123]}, {"entity": "BT - 474 breast cancer cells", "entity_type": "Anatomy", "pos": [128, 156]}], "task": "NER"}
+{"text": "Antiprogestin RU - 486 inhibits the induction of VEGF and TSP - 1 by progestins , suggesting that this effect of progestin is mediated by the progesterone receptor ( PR ) .", "entity": [], "task": "NER"}
+{"text": "Actinomycin - D , but not puromycin , also blocks progestin - dependent induction of TSP - 1 .", "entity": [], "task": "NER"}
+{"text": "A putative progestin - response element was identified in the human TSP - 1 promoter , which is consistent with the hypothesis that a progestin - PR complex might directly regulate transcription of the TSP - 1 gene in human cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [224, 229]}], "task": "NER"}
+{"text": "Conditioned medium from progestin - treated breast cancer cells stimulates endothelial cell proliferation in the absence though not in the presence of antibody to TSP - 1 , indicating that TSP - 1 secreted by breast cancer cells could be pro - angiogenic .", "entity": [{"entity": "breast cancer cells", "entity_type": "Anatomy", "pos": [44, 63]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [75, 91]}, {"entity": "breast cancer cells", "entity_type": "Anatomy", "pos": [209, 228]}], "task": "NER"}
+{"text": "Since tumor cell - derived TSP - 1 has the potential to promote angiogenesis in the tumor microenvironment , it could be a potential target for breast cancer therapy .", "entity": [{"entity": "tumor cell", "entity_type": "Anatomy", "pos": [6, 16]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [84, 89]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [144, 157]}], "task": "NER"}
+{"text": "WNT / TCF signaling through LEF1 and HOXB9 mediates lung adenocarcinoma metastasis .", "entity": [{"entity": "lung adenocarcinoma", "entity_type": "Anatomy", "pos": [52, 71]}], "task": "NER"}
+{"text": "Metastasis from lung adenocarcinoma can occur swiftly to multiple organs within months of diagnosis .", "entity": [{"entity": "lung adenocarcinoma", "entity_type": "Anatomy", "pos": [16, 35]}, {"entity": "organs", "entity_type": "Anatomy", "pos": [66, 72]}], "task": "NER"}
+{"text": "The mechanisms that confer this rapid metastatic capacity to lung tumors are unknown .", "entity": [{"entity": "lung tumors", "entity_type": "Anatomy", "pos": [61, 72]}], "task": "NER"}
+{"text": "Activation of the canonical WNT / TCF pathway is identified here as a determinant of metastasis to brain and bone during lung adenocarcinoma progression .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [99, 104]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [109, 113]}, {"entity": "lung adenocarcinoma", "entity_type": "Anatomy", "pos": [121, 140]}], "task": "NER"}
+{"text": "Gene expression signatures denoting WNT / TCF activation are associated with relapse to multiple organs in primary lung adenocarcinoma .", "entity": [{"entity": "organs", "entity_type": "Anatomy", "pos": [97, 103]}, {"entity": "primary lung adenocarcinoma", "entity_type": "Anatomy", "pos": [107, 134]}], "task": "NER"}
+{"text": "Metastatic subpopulations isolated from independent lymph node - derived lung adenocarcinoma cell lines harbor a hyperactive WNT / TCF pathway .", "entity": [{"entity": "Metastatic subpopulations", "entity_type": "Anatomy", "pos": [0, 25]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [52, 62]}, {"entity": "lung adenocarcinoma cell lines", "entity_type": "Anatomy", "pos": [73, 103]}], "task": "NER"}
+{"text": "Reduction of TCF activity in these cells attenuates their ability to form brain and bone metastases in mice , independently of effects on tumor growth in the lungs .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [35, 40]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [74, 79]}, {"entity": "bone metastases", "entity_type": "Anatomy", "pos": [84, 99]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [138, 143]}, {"entity": "lungs", "entity_type": "Anatomy", "pos": [158, 163]}], "task": "NER"}
+{"text": "The WNT / TCF target genes HOXB9 and LEF1 are identified as mediators of chemotactic invasion and colony outgrowth .", "entity": [{"entity": "colony", "entity_type": "Anatomy", "pos": [98, 104]}], "task": "NER"}
+{"text": "Thus , a distinct WNT / TCF signaling program through LEF1 and HOXB9 enhances the competence of lung adenocarcinoma cells to colonize the bones and the brain .", "entity": [{"entity": "lung adenocarcinoma cells", "entity_type": "Anatomy", "pos": [96, 121]}, {"entity": "bones", "entity_type": "Anatomy", "pos": [138, 143]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [152, 157]}], "task": "NER"}
+{"text": "For a video summary of this article , see the PaperFlick file available with the online Supplemental Data .", "entity": [], "task": "NER"}
+{"text": "c - Ski overexpression promotes tumor growth and angiogenesis through inhibition of transforming growth factor - beta signaling in diffuse - type gastric carcinoma .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [32, 37]}, {"entity": "gastric carcinoma", "entity_type": "Anatomy", "pos": [146, 163]}], "task": "NER"}
+{"text": "c - Ski , originally identified as a proto - oncogene product , is an important negative regulator of transforming growth factor ( TGF ) - beta family signaling through interaction with Smad2 , Smad3 , and Smad4 .", "entity": [], "task": "NER"}
+{"text": "High expression of c - Ski has been found in some cancers , including gastric cancer .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [50, 57]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [70, 84]}], "task": "NER"}
+{"text": "We previously showed that disruption of TGF - beta signaling by dominant - negative TGF - beta type II receptor in a diffuse - type gastric carcinoma model accelerated tumor growth through induction of tumor angiogenesis by decreased expression of the anti - angiogenic factor thrombospondin ( TSP ) - 1 .", "entity": [{"entity": "gastric carcinoma", "entity_type": "Anatomy", "pos": [132, 149]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [168, 173]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [202, 207]}], "task": "NER"}
+{"text": "Here , we examined the function of c - Ski in human diffuse - type gastric carcinoma OCUM - 2MLN cells .", "entity": [{"entity": "gastric carcinoma", "entity_type": "Anatomy", "pos": [67, 84]}, {"entity": "OCUM - 2MLN cells", "entity_type": "Anatomy", "pos": [85, 102]}], "task": "NER"}
+{"text": "Overexpression of c - Ski inhibited TGF - beta signaling in OCUM - 2MLN cells .", "entity": [{"entity": "OCUM - 2MLN cells", "entity_type": "Anatomy", "pos": [60, 77]}], "task": "NER"}
+{"text": "Interestingly , c - Ski overexpression resulted in extensive acceleration of the growth of subcutaneous xenografts in BALB / c nu / nu female mice ( 6 weeks of age ) .", "entity": [{"entity": "subcutaneous xenografts", "entity_type": "Anatomy", "pos": [91, 114]}], "task": "NER"}
+{"text": "Similar to tumors expressing dominant - negative TGF - beta type II receptor , histochemical studies revealed less fibrosis and increased angiogenesis in xenografted tumors expressing c - Ski compared to control tumors .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [11, 17]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [166, 172]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [212, 218]}], "task": "NER"}
+{"text": "Induction of TSP - 1 mRNA by TGF - beta was attenuated by c - Ski in vitro , and expression of TSP - 1 mRNA was decreased in tumors expressing c - Ski in vivo .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [125, 131]}], "task": "NER"}
+{"text": "These findings suggest that c - Ski overexpression promotes the growth of diffuse - type gastric carcinoma through induction of angiogenesis .", "entity": [{"entity": "gastric carcinoma", "entity_type": "Anatomy", "pos": [89, 106]}], "task": "NER"}
+{"text": "Angiogenesis - a novel therapeutic approach for ischemic heart disease .", "entity": [{"entity": "heart", "entity_type": "Anatomy", "pos": [57, 62]}], "task": "NER"}
+{"text": "Angiogenesis is the biologic process of forming new blood vessels .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [52, 65]}], "task": "NER"}
+{"text": "Undoubtedly , blood vessels growth regulation is a vital aspect in health and disease .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [14, 27]}], "task": "NER"}
+{"text": "Under physiological conditions , angiogenesis is regulated by local balance between endogenous stimulators and inhibitors of this process .", "entity": [], "task": "NER"}
+{"text": "In many diseases state body loses control over angiogenesis .", "entity": [{"entity": "body", "entity_type": "Anatomy", "pos": [23, 27]}], "task": "NER"}
+{"text": "Angiogenesis - dependent diseases result when new blood vessels either grow excessively or insufficiently .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [50, 63]}], "task": "NER"}
+{"text": "Insufficient angiogenesis occurs in diseases such as coronary artery disease , stroke and chronic wounds .", "entity": [{"entity": "coronary artery", "entity_type": "Anatomy", "pos": [53, 68]}, {"entity": "wounds", "entity_type": "Anatomy", "pos": [98, 104]}], "task": "NER"}
+{"text": "Myocardial ischemia both acute and chronic has been clearly shown to stimulate angiogenesis in many experimental models .", "entity": [{"entity": "Myocardial", "entity_type": "Anatomy", "pos": [0, 10]}], "task": "NER"}
+{"text": "Therapeutic angiogenesis is the biological agents or bioactive material to stimulate the growth of new blood vessels .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [103, 116]}], "task": "NER"}
+{"text": "Traditional coronary revascularization therapies such as coronary angioplasty or bypass graft surgery , act by restoring blood flow through the preexisting coronary vessels .", "entity": [{"entity": "coronary", "entity_type": "Anatomy", "pos": [12, 20]}, {"entity": "coronary", "entity_type": "Anatomy", "pos": [57, 65]}, {"entity": "bypass graft", "entity_type": "Anatomy", "pos": [81, 93]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [121, 126]}, {"entity": "coronary vessels", "entity_type": "Anatomy", "pos": [156, 172]}], "task": "NER"}
+{"text": "One limitation of these approaches , however , may be the failure to normalize myocardial perfusion , due to the concomitant presence or small of resistance vessel disease .", "entity": [{"entity": "myocardial", "entity_type": "Anatomy", "pos": [79, 89]}, {"entity": "vessel", "entity_type": "Anatomy", "pos": [157, 163]}], "task": "NER"}
+{"text": "In contrast , therapeutic angiogenesis is based on the concept that coronary collateral development may be stimulated by pharmacological or molecular means and can limit myocardial ischemia .", "entity": [{"entity": "coronary collateral", "entity_type": "Anatomy", "pos": [68, 87]}, {"entity": "myocardial", "entity_type": "Anatomy", "pos": [170, 180]}], "task": "NER"}
+{"text": "Studies , both in human and animal models support the notion that , various angiogenic growth factors and progenitor cells can enhance new blood vessels .", "entity": [{"entity": "progenitor cells", "entity_type": "Anatomy", "pos": [106, 122]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [139, 152]}], "task": "NER"}
+{"text": "Vascular endothelial growth factor ( VEGF ) , fibroblast growth factor ( FGF ) , recombinant proteins and bone marrow stem cells are currently used therapeutic stimulators for angiogenesis .", "entity": [{"entity": "bone marrow stem cells", "entity_type": "Anatomy", "pos": [106, 128]}], "task": "NER"}
+{"text": "As coronary artery disease is the major cause of death in the developed societies and also an emerging health problem in developing countries like Bangladesh therapeutic angiogenesis may provide hope as a new treatment modality for ischemic heart disease with or in place of current therapies .", "entity": [{"entity": "coronary artery", "entity_type": "Anatomy", "pos": [3, 18]}, {"entity": "heart", "entity_type": "Anatomy", "pos": [241, 246]}], "task": "NER"}
+{"text": "Use of uteroglobin for the engineering of polyvalent , polyspecific fusion proteins .", "entity": [], "task": "NER"}
+{"text": "We report a novel strategy to engineer and express stable and soluble human recombinant polyvalent / polyspecific fusion proteins .", "entity": [], "task": "NER"}
+{"text": "The procedure is based on the use of a central skeleton of uteroglobin , a small and very soluble covalently linked homodimeric protein that is very resistant to proteolytic enzymes and to pH variations .", "entity": [], "task": "NER"}
+{"text": "Using a human recombinant antibody ( scFv ) specific for the angiogenesis marker domain B of fibronectin , interleukin 2 , and an scFv able to neutralize tumor necrosis factor - alpha , we expressed various biologically active uteroglobin fusion proteins .", "entity": [], "task": "NER"}
+{"text": "The results demonstrate the possibility to generate monospecific divalent and tetravalent antibodies , immunocytokines , and dual specificity tetravalent antibodies .", "entity": [], "task": "NER"}
+{"text": "Furthermore , compared with similar fusion proteins in which uteroglobin was not used , the use of uteroglobin improved properties of solubility and stability .", "entity": [], "task": "NER"}
+{"text": "Indeed , in the reported cases it was possible to vacuum dry and reconstitute the proteins without any aggregation or loss in protein and biological activity .", "entity": [], "task": "NER"}
+{"text": "Mapping of the L - methylmalonyl - CoA mutase gene to mouse chromosome 17 .", "entity": [{"entity": "chromosome 17", "entity_type": "Anatomy", "pos": [60, 73]}], "task": "NER"}
+{"text": "In humans , methylmalonyl acidemia is caused by a deficiency of L - methylmalonyl - CoA mutase ( MUT ) controlled by a gene that has been mapped to chromosome 6 .", "entity": [{"entity": "chromosome 6", "entity_type": "Anatomy", "pos": [148, 160]}], "task": "NER"}
+{"text": "The mouse homolog of this gene has now been mapped to mouse chromosome 17 .", "entity": [{"entity": "chromosome 17", "entity_type": "Anatomy", "pos": [60, 73]}], "task": "NER"}
+{"text": "Recombinant inbred and congenic strains place the mouse Mut locus 1 . 06 cM distal to H - 2 , between Pgk - 2 and Ce - 2 .", "entity": [], "task": "NER"}
+{"text": "The relative order of syntenic probes flanking H - 2 on mouse chromosome 17 and HLA on human chromosome 6 is shown to be different .", "entity": [{"entity": "chromosome 17", "entity_type": "Anatomy", "pos": [62, 75]}, {"entity": "chromosome 6", "entity_type": "Anatomy", "pos": [93, 105]}], "task": "NER"}
+{"text": "Netrin - 1 up - regulation in inflammatory bowel diseases is required for colorectal cancer progression .", "entity": [{"entity": "bowel", "entity_type": "Anatomy", "pos": [43, 48]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [74, 91]}], "task": "NER"}
+{"text": "Chronic inflammation and cancer are intimately associated .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [25, 31]}], "task": "NER"}
+{"text": "This is particularly true for inflammatory bowel diseases ( IBD ) , such as ulcerative colitis and Crohn ' s disease , which show a major increased risk for colorectal cancer .", "entity": [{"entity": "bowel", "entity_type": "Anatomy", "pos": [43, 48]}, {"entity": "ulcerative", "entity_type": "Anatomy", "pos": [76, 86]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [157, 174]}], "task": "NER"}
+{"text": "While the understanding of the molecular pathogenesis of IBD has recently improved , the mechanisms that link these chronic inflammatory states to colorectal cancer development are in large part unknown .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [147, 164]}], "task": "NER"}
+{"text": "One of these mechanisms is NF - kappaB pathway activation which in turn may contribute to tumor formation by providing anti - apoptotic survival signals to the epithelial cells .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [90, 95]}, {"entity": "epithelial cells", "entity_type": "Anatomy", "pos": [160, 176]}], "task": "NER"}
+{"text": "Based on the observation that netrin - 1 , the anti - apoptotic ligand for the dependence receptors DCC and UNC5H is up - regulated in colonic crypts in response to NF - kappaB , we show here that colorectal cancers from inflammatory bowel diseases patients have selected up - regulation of netrin - 1 .", "entity": [{"entity": "colonic crypts", "entity_type": "Anatomy", "pos": [135, 149]}, {"entity": "colorectal cancers", "entity_type": "Anatomy", "pos": [197, 215]}, {"entity": "bowel", "entity_type": "Anatomy", "pos": [234, 239]}], "task": "NER"}
+{"text": "Moreover , we demonstrate that this inflammation - driven netrin - 1 up - regulation is causal for colorectal cancer development as interference with netrin - 1 autocrine loop in a mouse model for ulcerative colitis - associated colorectal cancer , while showing no effect on inflammation , inhibits colorectal cancer progression .", "entity": [{"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [99, 116]}, {"entity": "ulcerative", "entity_type": "Anatomy", "pos": [197, 207]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [229, 246]}, {"entity": "colorectal cancer", "entity_type": "Anatomy", "pos": [300, 317]}], "task": "NER"}
+{"text": "[ Prognostic significance of cellular vascular endothelial growth factor ( VEGF ) expression in the course of chronic myeloid leukaemia ]", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [29, 37]}, {"entity": "chronic myeloid leukaemia", "entity_type": "Anatomy", "pos": [110, 135]}], "task": "NER"}
+{"text": "INTRODUCTION : Increased angiogenesis in bone marrow is one of the characteristics of chronic myeloid leukaemia ( CML ) , a clonal myeloproliferative disorder that expresses a chimeric bcr / abl protein .", "entity": [{"entity": "bone marrow", "entity_type": "Anatomy", "pos": [41, 52]}, {"entity": "chronic myeloid leukaemia", "entity_type": "Anatomy", "pos": [86, 111]}, {"entity": "CML", "entity_type": "Anatomy", "pos": [114, 117]}], "task": "NER"}
+{"text": "Vascular endothelial growth factor ( VEGF ) is one of the most potent and a specific regulator of angiogenesis which principally targets endothelial cells and regulates several of their functions , including mitogenesis , permeability and migration .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [137, 154]}], "task": "NER"}
+{"text": "The impact of elevated VEGF expression on the course of chronic myeloid leukaemia is unknown .", "entity": [{"entity": "chronic myeloid leukaemia", "entity_type": "Anatomy", "pos": [56, 81]}], "task": "NER"}
+{"text": "OBJECTIVE : The aim of this study was the follow - up of VEGF expression during the course of CML .", "entity": [{"entity": "CML", "entity_type": "Anatomy", "pos": [94, 97]}], "task": "NER"}
+{"text": "METHODS : We studied VEGF expression of 85 CML patients ( median age 50 years , range 16 - 75 years ) .", "entity": [{"entity": "CML", "entity_type": "Anatomy", "pos": [43, 46]}], "task": "NER"}
+{"text": "At the commencement of the study , 29 patients were in chronic phase ( CP ) , 25 in an accelerated phase ( AP ) , and 31 in the blast crisis ( BC ) .", "entity": [], "task": "NER"}
+{"text": "The temporal expression ( percentage positivity per 1000 analysed cells ) VEGF proteins over the course of CML were studied using the immunohistochemical technique utilizing relevant monoclonal antibodies .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [66, 71]}, {"entity": "CML", "entity_type": "Anatomy", "pos": [107, 110]}], "task": "NER"}
+{"text": "It was correlated with the laboratory ( Hb , WBC and platelet counts , and the percentage of blasts ) and clinical parameters ( organomegaly , duration of CP , AP , and BC ) of disease progression .", "entity": [{"entity": "WBC", "entity_type": "Anatomy", "pos": [45, 48]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [53, 61]}], "task": "NER"}
+{"text": "RESULTS : The expression ofVEGF protein was most pronounced in AP ( ANOVA , p = 0 . 033 ) .", "entity": [], "task": "NER"}
+{"text": "The level of VEGF expression correlated inversely with the degree of splenomegaly ( Pearson , r = - 0 . 400 , p = 0 . 011 ) .", "entity": [{"entity": "splenomegaly", "entity_type": "Anatomy", "pos": [69, 81]}], "task": "NER"}
+{"text": "High expression of VEGF correlated with a shorter overall survival ( log rank , p = 0 . 042 ) .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION : Immunohistochemically confirmed significance of the expression of VEGF in dependence of the CML stage could be of clinical importance in deciding on the timing therapy .", "entity": [{"entity": "CML", "entity_type": "Anatomy", "pos": [105, 108]}], "task": "NER"}
+{"text": "These data suggest that VEGF plays a role in the biology of CML and that VEGF inhibitors should be investigated in CML .", "entity": [{"entity": "CML", "entity_type": "Anatomy", "pos": [60, 63]}, {"entity": "CML", "entity_type": "Anatomy", "pos": [115, 118]}], "task": "NER"}
+{"text": "Pbx1 is a downstream target of Evi - 1 in hematopoietic stem / progenitors and leukemic cells .", "entity": [{"entity": "hematopoietic stem / progenitors", "entity_type": "Anatomy", "pos": [42, 74]}, {"entity": "leukemic cells", "entity_type": "Anatomy", "pos": [79, 93]}], "task": "NER"}
+{"text": "Ecotropic viral integration site - 1 ( Evi - 1 ) is a nuclear transcription factor , which is essential for the proliferation / maintenance of hematopoietic stem cells ( HSCs ) .", "entity": [{"entity": "nuclear", "entity_type": "Anatomy", "pos": [54, 61]}, {"entity": "hematopoietic stem cells", "entity_type": "Anatomy", "pos": [143, 167]}, {"entity": "HSCs", "entity_type": "Anatomy", "pos": [170, 174]}], "task": "NER"}
+{"text": "Aberrant expression of Evi - 1 has been frequently found in myeloid leukemia , and is associated with a poor patient survival .", "entity": [{"entity": "myeloid leukemia", "entity_type": "Anatomy", "pos": [60, 76]}], "task": "NER"}
+{"text": "Recently , we reported candidate target genes of Evi - 1 shared in HSCs and leukemic cells using gene expression profiling analysis .", "entity": [{"entity": "HSCs", "entity_type": "Anatomy", "pos": [67, 71]}, {"entity": "leukemic cells", "entity_type": "Anatomy", "pos": [76, 90]}], "task": "NER"}
+{"text": "In this study , we identified Pbx1 , a proto - oncogene in hematopoietic malignancy , as a target gene of Evi - 1 .", "entity": [{"entity": "hematopoietic malignancy", "entity_type": "Anatomy", "pos": [59, 83]}], "task": "NER"}
+{"text": "Overexpression of Evi - 1 increased Pbx1 expression in hematopoietic stem / progenitor cells .", "entity": [{"entity": "hematopoietic stem / progenitor cells", "entity_type": "Anatomy", "pos": [55, 92]}], "task": "NER"}
+{"text": "An analysis of the Pbx1 promoter region revealed that Evi - 1 upregulates Pbx1 transcription .", "entity": [], "task": "NER"}
+{"text": "Furthermore , reduction of Pbx1 levels through RNAi - mediated knockdown significantly inhibited Evi - 1 - induced transformation .", "entity": [], "task": "NER"}
+{"text": "In contrast , knockdown of Pbx1 did not impair bone marrow transformation by E2A / HLF or AML1 / ETO , suggesting that Pbx1 is specifically required for the maintenance of bone marrow transformation mediated by Evi - 1 .", "entity": [{"entity": "bone marrow", "entity_type": "Anatomy", "pos": [47, 58]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [172, 183]}], "task": "NER"}
+{"text": "These results indicate that Pbx1 is a target gene of Evi - 1 involved in Evi - 1 - mediated leukemogenesis .", "entity": [], "task": "NER"}
+{"text": "Tumor Angiogenesis : Initiation and Targeting - Therapeutic Targeting of an FGF - Binding Protein , an Angiogenic Switch Molecule , and Indicator of Early Stages of Gastrointestinal Adenocarcinomas - .", "entity": [{"entity": "Tumor", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "Gastrointestinal Adenocarcinomas", "entity_type": "Anatomy", "pos": [165, 197]}], "task": "NER"}
+{"text": "Tumor angiogenesis has been related to the initiation as well as progression toward more aggressive behavior of human tumors .", "entity": [{"entity": "Tumor", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [118, 124]}], "task": "NER"}
+{"text": "In particular , the activity of angiogenic factors is crucial for tumor progression .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [66, 71]}], "task": "NER"}
+{"text": "We previously characterized a secreted fibroblast growth factor - binding protein ( FGF - BP ) as a chaperone molecule , which binds to various FGFs , enhances FGF - mediated biochemical and biologic events and importantly is a crucial rate - limiting factor for tumor - dependent angiogenesis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [263, 268]}], "task": "NER"}
+{"text": "We generated monoclonal antibodies that target FGF - BP protein and used them as a tool to evaluate frequency and pattern of FGF - BP expression during the malignant progression of pancreas and colorectal carcinoma in archival tissue samples .", "entity": [{"entity": "pancreas", "entity_type": "Anatomy", "pos": [181, 189]}, {"entity": "colorectal carcinoma", "entity_type": "Anatomy", "pos": [194, 214]}, {"entity": "tissue samples", "entity_type": "Anatomy", "pos": [227, 241]}], "task": "NER"}
+{"text": "We found that FGF - BP is dramatically upregulated during the initiation of colorectal and pancreatic adenocarcinoma .", "entity": [{"entity": "colorectal", "entity_type": "Anatomy", "pos": [76, 86]}, {"entity": "pancreatic adenocarcinoma", "entity_type": "Anatomy", "pos": [91, 116]}], "task": "NER"}
+{"text": "Crucial genetic events underlying the initiation and progression of colorectal and pancreatic adenocarcinoma with a particular focus on the modulation of angiogenesis and antiangiogenic therapies are discussed .", "entity": [{"entity": "colorectal", "entity_type": "Anatomy", "pos": [68, 78]}, {"entity": "pancreatic adenocarcinoma", "entity_type": "Anatomy", "pos": [83, 108]}], "task": "NER"}
+{"text": "We propose that the upregulation of the secreted FGF - BP protein during early phases of pancreas and colon cancer could make this protein a possible serum marker indicating the presence of high - risk premalignant lesions .", "entity": [{"entity": "pancreas", "entity_type": "Anatomy", "pos": [89, 97]}, {"entity": "colon cancer", "entity_type": "Anatomy", "pos": [102, 114]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [150, 155]}, {"entity": "premalignant lesions", "entity_type": "Anatomy", "pos": [202, 222]}], "task": "NER"}
+{"text": "Furthermore , the biological activity of FGF - BP is neutralized by monoclonal antibodies suggesting the potential for antibody - based therapeutic targeting .", "entity": [], "task": "NER"}
+{"text": "Range of motion limitation after rotator cuff repair .", "entity": [{"entity": "rotator cuff", "entity_type": "Anatomy", "pos": [33, 45]}], "task": "NER"}
+{"text": "HYPOTHESIS :", "entity": [], "task": "NER"}
+{"text": "This study was conducted to identify preoperative factors correlating with limited motion after rotator cuff repair ( RCR ) and to evaluate the affect of loss of motion on outcome .", "entity": [{"entity": "rotator cuff", "entity_type": "Anatomy", "pos": [96, 108]}], "task": "NER"}
+{"text": "We hypothesized that patients with preoperative ROM loss , diabetes , and workman ' s compensation claims would exhibit postoperative ROM loss at 3 months .", "entity": [], "task": "NER"}
+{"text": "Preoperative and postoperative evaluations , including outcomes assessment and physical examination parameters , were reviewed for 345 patients who underwent RCR .", "entity": [], "task": "NER"}
+{"text": "Correlations between demographic , physical examination , and surgical variables and postoperative limitation of motion and need for capsular release were determined .", "entity": [], "task": "NER"}
+{"text": "At 3 - month follow - up , mean active forward elevation ( AFE ) , active external rotation ( AER ) , and passive internal rotation ( PIR ) were 90 % , 78 % , and 80 % of the contralateral side .", "entity": [], "task": "NER"}
+{"text": "Limitation of preoperative motion correlated with limitation of postoperative AFE , AER , and PIR ( P < . 001 ) .", "entity": [], "task": "NER"}
+{"text": "Forty - seven patients considered clinically stiff were followed at 1 year postoperatively .", "entity": [], "task": "NER"}
+{"text": "Three patients required arthroscopic capsular release for persistent range of motion loss .", "entity": [], "task": "NER"}
+{"text": "Early postoperative limitation of motion after RCR is associated with restricted preoperative motion .", "entity": [], "task": "NER"}
+{"text": "Other factors , including diabetes mellitus and worker ' s compensation claim , are also associated with range of motion loss .", "entity": [], "task": "NER"}
+{"text": "Most shoulders with early motion loss recover motion and rarely require capsular release .", "entity": [{"entity": "shoulders", "entity_type": "Anatomy", "pos": [5, 14]}], "task": "NER"}
+{"text": "The role of hypoxia in 2 - butoxyethanol - induced hemangiosarcoma .", "entity": [{"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [51, 66]}], "task": "NER"}
+{"text": "To understand the molecular mechanisms underlying compound - induced hemangiosarcomas in mice , and therefore , their human relevance , a systems biology approach was undertaken using transcriptomics and Causal Network Modeling from mice treated with 2 - butoxyethanol ( 2 - BE ) .", "entity": [{"entity": "hemangiosarcomas", "entity_type": "Anatomy", "pos": [69, 85]}], "task": "NER"}
+{"text": "2 - BE is a hemolytic agent that induces hemangiosarcomas in mice .", "entity": [{"entity": "hemangiosarcomas", "entity_type": "Anatomy", "pos": [41, 57]}], "task": "NER"}
+{"text": "We hypothesized that the hemolysis induced by 2 - BE would result in local tissue hypoxia , a well - documented trigger for endothelial cell proliferation leading to hemangiosarcoma .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [75, 81]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [124, 140]}, {"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [166, 181]}], "task": "NER"}
+{"text": "Gene expression data from bone marrow ( BM ) , liver , and spleen of mice exposed to a single dose ( 4 h ) or seven daily doses of 2 - BE were used to develop a mechanistic model of hemangiosarcoma .", "entity": [{"entity": "bone marrow", "entity_type": "Anatomy", "pos": [26, 37]}, {"entity": "BM", "entity_type": "Anatomy", "pos": [40, 42]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [47, 52]}, {"entity": "spleen", "entity_type": "Anatomy", "pos": [59, 65]}, {"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [182, 197]}], "task": "NER"}
+{"text": "The resulting mechanistic model confirms previous work proposing that 2 - BE induces macrophage activation and inflammation in the liver .", "entity": [{"entity": "macrophage", "entity_type": "Anatomy", "pos": [85, 95]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [131, 136]}], "task": "NER"}
+{"text": "In addition , the model supports local tissue hypoxia in the liver and spleen , coupled with increased erythropoeitin signaling and erythropoiesis in the spleen and BM , and suppression of mechanisms that contribute to genomic stability , events that could be contributing factors to hemangiosarcoma formation .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [39, 45]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [61, 66]}, {"entity": "spleen", "entity_type": "Anatomy", "pos": [71, 77]}, {"entity": "spleen", "entity_type": "Anatomy", "pos": [154, 160]}, {"entity": "BM", "entity_type": "Anatomy", "pos": [165, 167]}, {"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [284, 299]}], "task": "NER"}
+{"text": "Finally , an immunohistochemistry method ( Hypoxyprobe ) demonstrated that tissue hypoxia was present in the spleen and BM .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [75, 81]}, {"entity": "spleen", "entity_type": "Anatomy", "pos": [109, 115]}, {"entity": "BM", "entity_type": "Anatomy", "pos": [120, 122]}], "task": "NER"}
+{"text": "Together , the results of this study identify molecular mechanisms that initiate hemangiosarcoma , a key step in understanding safety concerns that can impact drug decision processes , and identified hypoxia as a possible contributing factor for 2 - BE - induced hemangiosarcoma in mice .", "entity": [{"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [81, 96]}, {"entity": "hemangiosarcoma", "entity_type": "Anatomy", "pos": [263, 278]}], "task": "NER"}
+{"text": "Pancreatic endocrine tumors : expression profiling evidences a role for AKT - mTOR pathway .", "entity": [{"entity": "Pancreatic endocrine tumors", "entity_type": "Anatomy", "pos": [0, 27]}], "task": "NER"}
+{"text": "PURPOSE : We investigated the global gene expression in a large panel of pancreatic endocrine tumors ( PETs ) aimed at identifying new potential targets for therapy and biomarkers to predict patient outcome .", "entity": [{"entity": "pancreatic endocrine tumors", "entity_type": "Anatomy", "pos": [73, 100]}, {"entity": "PETs", "entity_type": "Anatomy", "pos": [103, 107]}], "task": "NER"}
+{"text": "PATIENTS AND METHODS : Using a custom microarray , we analyzed 72 primary PETs , seven matched metastases , and 10 normal pancreatic samples .", "entity": [{"entity": "primary PETs", "entity_type": "Anatomy", "pos": [66, 78]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [95, 105]}, {"entity": "pancreatic samples", "entity_type": "Anatomy", "pos": [122, 140]}], "task": "NER"}
+{"text": "Relevant differentially expressed genes were validated by either quantitative real - time polymerase chain reaction or immunohistochemistry on tissue microarrays .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [143, 149]}], "task": "NER"}
+{"text": "RESULTS : Our data showed that : tuberous sclerosis 2 ( TSC2 ) and phosphatase and tensin homolog ( PTEN ) were downregulated in most of the primary tumors , and their low expression was significantly associated with shorter disease - free and overall survival ; somatostatin receptor 2 ( SSTR2 ) was absent or very low in insulinomas compared with nonfunctioning tumors ; and expression of fibroblast growth factor 13 ( FGF13 ) gene was significantly associated with the occurrence of liver metastasis and shorter disease - free survival .", "entity": [{"entity": "primary tumors", "entity_type": "Anatomy", "pos": [141, 155]}, {"entity": "insulinomas", "entity_type": "Anatomy", "pos": [323, 334]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [364, 370]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [486, 491]}], "task": "NER"}
+{"text": "TSC2 and PTEN are two key inhibitors of the Akt / mammalian target of rapamycin ( mTOR ) pathway and the specific inhibition of mTOR with rapamycin or RAD001 inhibited cell proliferation of PET cell lines .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [168, 172]}, {"entity": "PET cell lines", "entity_type": "Anatomy", "pos": [190, 204]}], "task": "NER"}
+{"text": "CONCLUSION : Our results strongly support a role for PI3K / Akt / mTOR pathway in PET , which ties in with the fact that mTOR inhibitors have reached phase III trials in neuroendocrine tumors .", "entity": [{"entity": "PET", "entity_type": "Anatomy", "pos": [82, 85]}, {"entity": "neuroendocrine tumors", "entity_type": "Anatomy", "pos": [170, 191]}], "task": "NER"}
+{"text": "The finding of differential SSTR expression raises the potential for SSTR expression to be evaluated as a marker of response to somatostatin analogs .", "entity": [], "task": "NER"}
+{"text": "Finally , we identified FGF13 as a new prognostic marker that predicted poorer outcome in patients who were clinically considered free from disease .", "entity": [], "task": "NER"}
+{"text": "Neural network analysis of spectroscopic data of lycopene and beta - carotene content in food samples compared to HPLC - UV - vis .", "entity": [], "task": "NER"}
+{"text": "In this study a neural network ( NN ) model was designed to predict lycopene and beta - carotene concentrations in food samples , combined with a simple and fast technique , such as UV - vis spectroscopy .", "entity": [], "task": "NER"}
+{"text": "The measurement of the absorbance at 446 and 502 nm of different beta - carotene and lycopene standard mixtures was used to optimize a neural network based on a multilayer perceptron ( MLP ) ( learning and verification process ) .", "entity": [], "task": "NER"}
+{"text": "Then , for validation purposes , the optimized NN has been applied to determine the concentration of both compounds in food samples ( fresh tomato , tomato concentrate , tomato sauce , ketchup , tomato juice , watermelon , medlar , green pepper , and carrots ) , comparing the NN results with the known values of these compounds obtained by analytical techniques ( UV - vis and HPLC ) .", "entity": [{"entity": "tomato", "entity_type": "Anatomy", "pos": [140, 146]}, {"entity": "tomato", "entity_type": "Anatomy", "pos": [149, 155]}, {"entity": "tomato", "entity_type": "Anatomy", "pos": [170, 176]}, {"entity": "tomato juice", "entity_type": "Anatomy", "pos": [195, 207]}, {"entity": "watermelon", "entity_type": "Anatomy", "pos": [210, 220]}, {"entity": "medlar", "entity_type": "Anatomy", "pos": [223, 229]}, {"entity": "green pepper", "entity_type": "Anatomy", "pos": [232, 244]}, {"entity": "carrots", "entity_type": "Anatomy", "pos": [251, 258]}], "task": "NER"}
+{"text": "It was concluded that when the MLP - NN is used within the range studied , the optimized NN is able to estimate the beta - carotene and lycopene concentrations in food samples with an adequate accuracy , solving the UV - vis interference of beta - carotene and lycopene .", "entity": [], "task": "NER"}
+{"text": "ICAM - 3 enhances the migratory and invasive potential of human non - small cell lung cancer cells by inducing MMP - 2 and MMP - 9 via Akt and CREB .", "entity": [{"entity": "non - small cell lung cancer cells", "entity_type": "Anatomy", "pos": [64, 98]}], "task": "NER"}
+{"text": "We have previously reported that intercellular adhesion molecule - 3 ( ICAM - 3 ) is associated with an increase of cellular radio - resistance and cancer cell proliferation .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "cancer cell", "entity_type": "Anatomy", "pos": [148, 159]}], "task": "NER"}
+{"text": "In this study , we hypothesized that ICAM - 3 has an additional effect on cancer cell migration and invasion because molecules induced by ICAM - 3 are known as regulators of cell migration and invasion .", "entity": [{"entity": "cancer cell", "entity_type": "Anatomy", "pos": [74, 85]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [174, 178]}], "task": "NER"}
+{"text": "To examine this hypothesis , we used NCI - H1299 non - small cell lung cancer ( NSCLC ) cell line ( p53 and PTEN null cell ) and constructed an ICAM - 3 - over - expressing stable transfectant , which exhibited increased cell migration and invasion .", "entity": [{"entity": "NCI - H1299 non - small cell lung cancer ( NSCLC ) cell line", "entity_type": "Anatomy", "pos": [37, 97]}, {"entity": "p53 and PTEN null cell", "entity_type": "Anatomy", "pos": [100, 122]}, {"entity": "transfectant", "entity_type": "Anatomy", "pos": [180, 192]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [221, 225]}], "task": "NER"}
+{"text": "The increased migration and invasion resulted from up - regulation of expression and activities of MMP - 2 and MMP - 9 .", "entity": [], "task": "NER"}
+{"text": "ICAM - 3 also increased Akt phosphorylation , which caused an increase in cellular migration / invasion and MMP activities .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [74, 82]}], "task": "NER"}
+{"text": "Activity of several transcriptional factors located downstream in the Akt pathway was also tested , and constitutive activation of adenosine 3 ' , 5 ' - monophosphate response element - binding protein ( CREB ) by ICAM - 3 was detected .", "entity": [], "task": "NER"}
+{"text": "Blockage of the Akt pathway attenuated CREB activation , and a decrease in CREB expression reduced cellular migration / invasion and activity of MMPs .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [99, 107]}], "task": "NER"}
+{"text": "This result indicates that CREB functions in the signaling pathway between Akt and MMP .", "entity": [], "task": "NER"}
+{"text": "We also showed ICAM - 3 - induced cell migration and invasion in NCI - H460 NSCLC cells ( wild - type p53 and PTEN cell ) through the same signaling pathway .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [34, 38]}, {"entity": "NCI - H460 NSCLC cells", "entity_type": "Anatomy", "pos": [65, 87]}, {"entity": "wild - type p53 and PTEN cell", "entity_type": "Anatomy", "pos": [90, 119]}], "task": "NER"}
+{"text": "Taken together , our findings suggest that ICAM - 3 stimulates cancer cell migration / invasion via ICAM - 3 / Akt / CREB / MMP pathway regardless of p53 and PTEN status , and this reflects the possibility that ICAM - 3 could be considered as a candidate for anti - cancer drug development and as a cancer diagnostic marker .", "entity": [{"entity": "cancer cell", "entity_type": "Anatomy", "pos": [63, 74]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [266, 272]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [299, 305]}], "task": "NER"}
+{"text": "Costs of hip fracture .", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [9, 12]}], "task": "NER"}
+{"text": "Rehabilitation of 180 patients in primary health care .", "entity": [], "task": "NER"}
+{"text": "Costs related to functional status were calculated for 180 consecutive hip fracture patients ( mean age 78 years ) who were admitted from their own home and rehabilitated in primary health care .", "entity": [{"entity": "hip", "entity_type": "Anatomy", "pos": [71, 74]}], "task": "NER"}
+{"text": "Within 4 months after the fracture , 75 percent of the patients had been discharged to their own home , 9 percent were dead , and the short - term medical treatment costs per patient were SEK 43 , 000 , whereas the total costs including communal help and costs for living accommodations after discharge were twice as high .", "entity": [], "task": "NER"}
+{"text": "The total costs per patient for long - term medical treatment ( from 4 months up to 3 years after fracture ) were 7 percent of the short - term medical treatment costs .", "entity": [], "task": "NER"}
+{"text": "Patients with a cervical fracture discharged to their own home and with good functional status consumed only one fifth of the resources that patients with a trochanteric fracture discharged to institutional care and who had reduced functional status consumed .", "entity": [{"entity": "cervical", "entity_type": "Anatomy", "pos": [16, 24]}, {"entity": "trochanteric", "entity_type": "Anatomy", "pos": [157, 169]}], "task": "NER"}
+{"text": "A substantial part of the costs can be saved by improved organization of rehabilitation after discharge from the hospital .", "entity": [], "task": "NER"}
+{"text": "A further cost reduction would require a combination of technologic , social , and organizational changes aimed at early discharge and continued follow - up in primary health care .", "entity": [], "task": "NER"}
+{"text": "The role of p53 in glucose metabolism .", "entity": [], "task": "NER"}
+{"text": "The p53 protein functions to prevent tumour development by inhibiting the outgrowth of stressed or damaged cells .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [37, 43]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [107, 112]}], "task": "NER"}
+{"text": "In addition to well established functions to block cell proliferation , recent studies have revealed a role for p53 in the regulation of pathways involved in glucose metabolism .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [51, 55]}], "task": "NER"}
+{"text": "The metabolic functions of p53 resist the shift to glycolysis that is characteristically seen in cancers , and also help cells adapt to and survive limited periods of metabolic stress .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [97, 104]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [121, 126]}], "task": "NER"}
+{"text": "Such activities of p53 would not only help to prevent cancer development , but might also contribute to non - tumour related roles for p53 , such as in the regulation of longevity .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [54, 60]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [110, 116]}], "task": "NER"}
+{"text": "These new functions of p53 are providing interesting possibilities for the development of novel therapies .", "entity": [], "task": "NER"}
+{"text": "14 - 3 - 3zeta Overexpression and abnormal beta - catenin expression are associated with poor differentiation and progression in stage I non - small cell lung cancer .", "entity": [{"entity": "stage I non - small cell lung cancer", "entity_type": "Anatomy", "pos": [129, 165]}], "task": "NER"}
+{"text": "Recent studies have shown that 14 - 3 - 3zeta interacted with other key cellular proteins involved in the tumor development and progression .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [72, 80]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [106, 111]}], "task": "NER"}
+{"text": "Knowledge of 14 - 3 - 3zeta and beta - catenin expression and clinical significance in the same tumor tissues is limited .", "entity": [{"entity": "tumor tissues", "entity_type": "Anatomy", "pos": [96, 109]}], "task": "NER"}
+{"text": "The purpose of this study was to investigate the expression and significance of 14 - 3 - 3zeta and beta - catenin in stage I non - small - cell lung cancer ( NSCLC ) .", "entity": [{"entity": "non - small - cell lung cancer", "entity_type": "Anatomy", "pos": [125, 155]}, {"entity": "NSCLC", "entity_type": "Anatomy", "pos": [158, 163]}], "task": "NER"}
+{"text": "Specimens of NSCLC and adjacent normal lung tissues were collected from 110 patients .", "entity": [{"entity": "Specimens", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "NSCLC", "entity_type": "Anatomy", "pos": [13, 18]}, {"entity": "lung tissues", "entity_type": "Anatomy", "pos": [39, 51]}], "task": "NER"}
+{"text": "The expressions of 14 - 3 - 3zeta and beta - catenin were detected by western blotting , double labeling immunofluorescence , confocal laser scanning microscopy and immunohistochemistry .", "entity": [], "task": "NER"}
+{"text": "The expression of 14 - 3 - 3zeta was upregulated in stage I NSCLC .", "entity": [{"entity": "stage I NSCLC", "entity_type": "Anatomy", "pos": [52, 65]}], "task": "NER"}
+{"text": "Further , the overexpression of 14 - 3 - 3zeta correlated with histological grades , lymph node metastasis and poor clinical outcome .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [85, 95]}], "task": "NER"}
+{"text": "Abnormal expression of beta - catenin was significantly correlated with poor differentiation and lymph node metastasis .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [97, 107]}], "task": "NER"}
+{"text": "Abnormal beta - catenin expression was associated significantly with positive 14 - 3 - 3zeta expression .", "entity": [], "task": "NER"}
+{"text": "In conclusion , 14 - 3 - 3zeta and beta - catenin might have an important role in development , progression and metastatic process of NSCLC .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [134, 139]}], "task": "NER"}
+{"text": "14 - 3 - 3zeta might be used as prognostic biomarkers for NSCLC .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [58, 63]}], "task": "NER"}
+{"text": "A randomized pilot study of the Engaging Moms Program for family drug court .", "entity": [], "task": "NER"}
+{"text": "In response to the need for effective drug court interventions , the effectiveness of the Engaging Moms Program ( EMP ) versus Intensive Case Management Services ( ICMS ) on multiple outcomes for mothers enrolled in family drug court was investigated .", "entity": [], "task": "NER"}
+{"text": "In this intent - to - treat study , mothers ( N = 62 ) were randomly assigned to either usual drug court care or the Engaging Moms drug court program .", "entity": [], "task": "NER"}
+{"text": "Mothers were assessed at intake and 3 , 6 , 12 , and 18 months following intake .", "entity": [], "task": "NER"}
+{"text": "Results indicated that at 18 months post drug court enrollment , 77 % of mothers assigned to EMP versus 55 % of mothers assigned to ICMS had positive child welfare dispositions .", "entity": [], "task": "NER"}
+{"text": "There were statistically significant time effects for both intervention groups on multiple outcomes including substance use , mental health , parenting practices , and family functioning .", "entity": [], "task": "NER"}
+{"text": "EMP showed equal or better improvement than ICMS on all outcomes .", "entity": [], "task": "NER"}
+{"text": "The results suggest that EMP in family drug court is a viable and promising intervention approach to reduce maternal addiction and child maltreatment .", "entity": [], "task": "NER"}
+{"text": "p24 family type 1 transmembrane proteins are required for insulin biosynthesis and secretion in pancreatic beta - cells .", "entity": [{"entity": "transmembrane", "entity_type": "Anatomy", "pos": [18, 31]}, {"entity": "pancreatic beta - cells", "entity_type": "Anatomy", "pos": [96, 119]}], "task": "NER"}
+{"text": "The p24 protein family have multiple functions in protein transport in the early secretory pathway .", "entity": [], "task": "NER"}
+{"text": "In this study we examined the role of p24 proteins in insulin transport .", "entity": [], "task": "NER"}
+{"text": "Several members were detected in insulinoma cell lines and rat islets and expression levels positively correlated with insulin abundance , particularly for p24delta1 and p24beta1 .", "entity": [{"entity": "insulinoma cell lines", "entity_type": "Anatomy", "pos": [33, 54]}, {"entity": "islets", "entity_type": "Anatomy", "pos": [63, 69]}], "task": "NER"}
+{"text": "Knocking down p24delta1 in insulinoma cell lines , which also resulted in the concomitant knock - down of other family members , impaired glucose - stimulated insulin secretion , decreased total cellular insulin content and reduced proinsulin biosynthesis .", "entity": [{"entity": "insulinoma cell lines", "entity_type": "Anatomy", "pos": [27, 48]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [195, 203]}], "task": "NER"}
+{"text": "There was no effect on overall protein biosynthesis or ER stress .", "entity": [], "task": "NER"}
+{"text": "These results suggest that p24delta1 and possibly other p24 family proteins are required for normal insulin biosynthesis and subsequent secretion in pancreatic beta - cells .", "entity": [{"entity": "pancreatic beta - cells", "entity_type": "Anatomy", "pos": [149, 172]}], "task": "NER"}
+{"text": "Absence of microbiota ( germ - free conditions ) accelerates the atherosclerosis in ApoE - deficient mice fed standard low cholesterol diet .", "entity": [], "task": "NER"}
+{"text": "AIM :", "entity": [], "task": "NER"}
+{"text": "The aim of our work was to determine the influence of intestinal bacteria on the development of atherosclerotic lesions using apolipoprotein E ( ApoE ) - deficient knockout mice .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [54, 64]}, {"entity": "atherosclerotic lesions", "entity_type": "Anatomy", "pos": [96, 119]}], "task": "NER"}
+{"text": "The experiments were performed on ApoE - / - - deficient mouse strain C57BL / 6 , bred under germ - free ( GF ) conditions for two generations or under conventional conditions with defined microflora ( CV ) .", "entity": [], "task": "NER"}
+{"text": "The mice were fed a standard low cholesterol diet or cholesterol - rich diet for 3 - 4 months .", "entity": [], "task": "NER"}
+{"text": "We studied the development of advanced lesions in the thoracic and abdominal aorta by histological , morphometric and immunohistological methods .", "entity": [{"entity": "lesions", "entity_type": "Anatomy", "pos": [39, 46]}, {"entity": "thoracic", "entity_type": "Anatomy", "pos": [54, 62]}, {"entity": "abdominal aorta", "entity_type": "Anatomy", "pos": [67, 82]}], "task": "NER"}
+{"text": "Conventionally reared ApoE - / - mice ( containing no pathogenic intestinal microbiota ) and fed a standard low cholesterol diet in contrast to a high cholesterol diet did not develop atherosclerotic aortic plaques .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [65, 75]}, {"entity": "atherosclerotic aortic plaques", "entity_type": "Anatomy", "pos": [184, 214]}], "task": "NER"}
+{"text": "In contrast , ApoE - / - mice reared under germfree conditions for 2 generations and fed a low cholesterol diet exhibited atherosclerotic plaques in the aorta .", "entity": [{"entity": "atherosclerotic plaques", "entity_type": "Anatomy", "pos": [122, 145]}, {"entity": "aorta", "entity_type": "Anatomy", "pos": [153, 158]}], "task": "NER"}
+{"text": "Characteristic lipid deposition with foam cells and macrophages was found in their arterial walls .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [42, 47]}, {"entity": "macrophages", "entity_type": "Anatomy", "pos": [52, 63]}, {"entity": "arterial walls", "entity_type": "Anatomy", "pos": [83, 97]}], "task": "NER"}
+{"text": "In contrast to the absence of atherosclerotic plaques in conventionally reared ApoE - deficient mice , germ - free ApoE - / - mice consuming the same low cholesterol standard diet developed atherosclerotic plaques in the aorta .", "entity": [{"entity": "atherosclerotic plaques", "entity_type": "Anatomy", "pos": [30, 53]}, {"entity": "atherosclerotic plaques", "entity_type": "Anatomy", "pos": [190, 213]}, {"entity": "aorta", "entity_type": "Anatomy", "pos": [221, 226]}], "task": "NER"}
+{"text": "Differences in atherosclerotic plaques between GF and CV ApoE - / - mice are not so apparent when mice are fed a high cholesterol diet .", "entity": [{"entity": "atherosclerotic plaques", "entity_type": "Anatomy", "pos": [15, 38]}], "task": "NER"}
+{"text": "Our findings thus document the protective effect of microbiota ( commensal bacteria ) on atherosclerosis development .", "entity": [], "task": "NER"}
+{"text": "Expression of KISS1 and MMP - 9 in non - small cell lung cancer and their relations to metastasis and survival .", "entity": [{"entity": "non - small cell lung cancer", "entity_type": "Anatomy", "pos": [35, 63]}], "task": "NER"}
+{"text": "KISS1 and matrix metalloproteinase - 9 ( MMP - 9 ) may play important roles as metastasis suppressor and metastasis promoter genes , respectively , in a variety of malignancies .", "entity": [{"entity": "malignancies", "entity_type": "Anatomy", "pos": [164, 176]}], "task": "NER"}
+{"text": "However , there is little information about their possible roles in non - small cell lung cancer ( NSCLC ) .", "entity": [{"entity": "non - small cell lung cancer", "entity_type": "Anatomy", "pos": [68, 96]}, {"entity": "NSCLC", "entity_type": "Anatomy", "pos": [99, 104]}], "task": "NER"}
+{"text": "The goals of this study were to determine the mRNA and protein expressions of KISS1 and MMP - 9 in NSCLC and their relations to metastasis and prognosis .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [99, 104]}], "task": "NER"}
+{"text": "The mRNA and protein expressions of KISS1 and of MMP - 9 protein were detected by in situ hybridization and immunohistochemistry respectively in 85 cases of NSCLC , and their matched lymph node metastases .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [157, 162]}, {"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [183, 204]}], "task": "NER"}
+{"text": "Expressions of KISS1 mRNA and protein were significantly higher in low TNM stages of NSCLC ( I - II ) compared to more advanced stages ( III - IV ) ( p < 0 . 05 ) .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [85, 90]}], "task": "NER"}
+{"text": "Moreover , in advanced TNM stages , cases without metastasis had higher KISS1 gene expression compared to those with lymph node metastasis ( p < 0 . 05 ) .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [117, 127]}], "task": "NER"}
+{"text": "In contrast , MMP - 9 expression was higher in stage III - IV NSCLC cases compared to stage I - II tumors ( p < 0 . 05 ) and higher in NSCLC cases with metastasis than those without metastasis ( p < 0 . 05 ) .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [99, 105]}, {"entity": "NSCLC", "entity_type": "Anatomy", "pos": [135, 140]}], "task": "NER"}
+{"text": "There was negative correction between KISS1 and MMP - 9 protein expression ( p < 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "The 5 - year survival rate in cases with higher KISS1 protein expression was significantly higher than in those with low expression ( 20 . 9 vs . 2 . 4 % , p < 0 . 01 ) .", "entity": [], "task": "NER"}
+{"text": "However , the 5 - year survival rate of patients with high MMP - 9 protein expression were lower than those with low expression ( 19 vs . 4 . 7 % , p < 0 . 05 ) .", "entity": [], "task": "NER"}
+{"text": "Our data suggest that KISS1 and MMP - 9 may serve as potential prognostic and therapeutic markers in lung cancer .", "entity": [{"entity": "lung cancer", "entity_type": "Anatomy", "pos": [101, 112]}], "task": "NER"}
+{"text": "A generative model for image segmentation based on label fusion .", "entity": [], "task": "NER"}
+{"text": "We propose a nonparametric , probabilistic model for the automatic segmentation of medical images , given a training set of images and corresponding label maps .", "entity": [], "task": "NER"}
+{"text": "The resulting inference algorithms rely on pairwise registrations between the test image and individual training images .", "entity": [], "task": "NER"}
+{"text": "The training labels are then transferred to the test image and fused to compute the final segmentation of the test subject .", "entity": [], "task": "NER"}
+{"text": "Such label fusion methods have been shown to yield accurate segmentation , since the use of multiple registrations captures greater inter - subject anatomical variability and improves robustness against occasional registration failures .", "entity": [], "task": "NER"}
+{"text": "To the best of our knowledge , this manuscript presents the first comprehensive probabilistic framework that rigorously motivates label fusion as a segmentation approach .", "entity": [], "task": "NER"}
+{"text": "The proposed framework allows us to compare different label fusion algorithms theoretically and practically .", "entity": [], "task": "NER"}
+{"text": "In particular , recent label fusion or multiatlas segmentation algorithms are interpreted as special cases of our framework .", "entity": [], "task": "NER"}
+{"text": "We conduct two sets of experiments to validate the proposed methods .", "entity": [], "task": "NER"}
+{"text": "In the first set of experiments , we use 39 brain MRI scans - with manually segmented white matter , cerebral cortex , ventricles and subcortical structures - to compare different label fusion algorithms and the widely - used FreeSurfer whole - brain segmentation tool .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [44, 49]}, {"entity": "white matter", "entity_type": "Anatomy", "pos": [86, 98]}, {"entity": "cerebral cortex", "entity_type": "Anatomy", "pos": [101, 116]}, {"entity": "ventricles", "entity_type": "Anatomy", "pos": [119, 129]}, {"entity": "subcortical structures", "entity_type": "Anatomy", "pos": [134, 156]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [245, 250]}], "task": "NER"}
+{"text": "Our results indicate that the proposed framework yields more accurate segmentation than FreeSurfer and previous label fusion algorithms .", "entity": [], "task": "NER"}
+{"text": "In a second experiment , we use brain MRI scans of 282 subjects to demonstrate that the proposed segmentation tool is sufficiently sensitive to robustly detect hippocampal volume changes in a study of aging and Alzheimer ' s Disease .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [32, 37]}, {"entity": "hippocampal", "entity_type": "Anatomy", "pos": [160, 171]}], "task": "NER"}
+{"text": "Relationship and prognostic significance of SPARC and VEGF protein expression in colon cancer .", "entity": [{"entity": "colon cancer", "entity_type": "Anatomy", "pos": [81, 93]}], "task": "NER"}
+{"text": "BACKGROUND : SPARC ( secreted protein , acidic and rich in cysteine ) is closely related with the progress , invasion and metastasis of malignant tumor and angiogenesis .", "entity": [{"entity": "malignant tumor", "entity_type": "Anatomy", "pos": [136, 151]}], "task": "NER"}
+{"text": "METHODS : Using human colon adenocarcinoma tissues ( hereinafter referred to as colon cancer ) and their corresponding non - diseased colon from 114 patients ' biopsies , the expression of SPARC and vascular endothelial growth factor ( VEGF ) were investigated by immunohistochemistry staining to assessment the relationship between SPARC and VEGF , as well as their prognostic significance in patients .", "entity": [{"entity": "colon adenocarcinoma tissues", "entity_type": "Anatomy", "pos": [22, 50]}, {"entity": "colon cancer", "entity_type": "Anatomy", "pos": [80, 92]}, {"entity": "non - diseased colon", "entity_type": "Anatomy", "pos": [119, 139]}, {"entity": "biopsies", "entity_type": "Anatomy", "pos": [160, 168]}], "task": "NER"}
+{"text": "Evaluation of VEGF expression level with the same tissues was used to establish the antigenic profiles , and the marker of CD34 staining was used as an indicator of microvessel density ( MVD ) .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [50, 57]}, {"entity": "microvessel", "entity_type": "Anatomy", "pos": [165, 176]}], "task": "NER"}
+{"text": "RESULTS : SPARC expression was mainly in the stromal cells surrounding the colon cancer , and was significant difference in those tissues with the lymph node metastasis and differentiation degree of tumor .", "entity": [{"entity": "stromal cells", "entity_type": "Anatomy", "pos": [45, 58]}, {"entity": "colon cancer", "entity_type": "Anatomy", "pos": [75, 87]}, {"entity": "tissues", "entity_type": "Anatomy", "pos": [130, 137]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [147, 157]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [199, 204]}], "task": "NER"}
+{"text": "Expression of SPARC was significantly correlated with the expression of VEGF and MVD in colon cancer tissues .", "entity": [{"entity": "colon cancer tissues", "entity_type": "Anatomy", "pos": [88, 108]}], "task": "NER"}
+{"text": "Patients with low or absence expressing SPARC had significantly worse overall survival and disease - free survival in a Single Factor Analysis ; Cox Regression Analysis , SPARC emerged as an overall survival and disease - free survival independent prognostic factor for colon cancer .", "entity": [{"entity": "colon cancer", "entity_type": "Anatomy", "pos": [270, 282]}], "task": "NER"}
+{"text": "CONCLUSION : The low expression or absence of stromal SPARC was an independent prognostic factor for poor prognosis of colon cancer .", "entity": [{"entity": "stromal", "entity_type": "Anatomy", "pos": [46, 53]}, {"entity": "colon cancer", "entity_type": "Anatomy", "pos": [119, 131]}], "task": "NER"}
+{"text": "SPARC maybe involved in the regulation of anti - angiogenesis by which it may serve as a novel target for colon cancer treatment as well as a novel distinctive marker .", "entity": [{"entity": "colon cancer", "entity_type": "Anatomy", "pos": [106, 118]}], "task": "NER"}
+{"text": "Listerine : past , present and future - - a test of thyme .", "entity": [], "task": "NER"}
+{"text": "Listerine , a mouthrinse composed of a mixture of essential oils , was created in 1879 and was originally formulated as a surgical antiseptic .", "entity": [{"entity": "essential oils", "entity_type": "Anatomy", "pos": [50, 64]}], "task": "NER"}
+{"text": "In spite of its known antimicrobial properties it was thought of as a product in search of a use and promoted as a deterrent for halitosis and as a floor cleaner .", "entity": [], "task": "NER"}
+{"text": "In the last several years Listerine has emerged as a bona fide therapeutic agent for reduction of plaque induced oral diseases .", "entity": [{"entity": "plaque", "entity_type": "Anatomy", "pos": [98, 104]}, {"entity": "oral", "entity_type": "Anatomy", "pos": [113, 117]}], "task": "NER"}
+{"text": "In contrast to the inconsistent history of Listerine , systemic antibiotics discovered in the 1940 ' s were heralded as miracle drugs .", "entity": [], "task": "NER"}
+{"text": "However , the value of prophylactic usage of antibiotics has come under scrutiny as a result of increasing resistance and adverse reactions .", "entity": [], "task": "NER"}
+{"text": "Moreover , reports by both American and British professional societies have led to a re - evaluation of the relative risks associated with plaque induced bacteremia when twice - yearly visits to dental professionals are compared to daily activities .", "entity": [{"entity": "plaque", "entity_type": "Anatomy", "pos": [139, 145]}, {"entity": "dental", "entity_type": "Anatomy", "pos": [195, 201]}], "task": "NER"}
+{"text": "These new recommendations and revelations open the door for local antimicrobial approaches to reduce the challenge of plaque - induced bacteremias .", "entity": [{"entity": "plaque", "entity_type": "Anatomy", "pos": [118, 124]}], "task": "NER"}
+{"text": "These issues will be discussed in the context of Listerine , its intricate and complicated past , and its connection to current uses in oral health and beyond .", "entity": [{"entity": "oral", "entity_type": "Anatomy", "pos": [136, 140]}], "task": "NER"}
+{"text": "The neural stem cell fate determinant TLX promotes tumorigenesis and genesis of cells resembling glioma stem cells .", "entity": [{"entity": "neural stem cell", "entity_type": "Anatomy", "pos": [4, 20]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [80, 85]}, {"entity": "glioma stem cells", "entity_type": "Anatomy", "pos": [97, 114]}], "task": "NER"}
+{"text": "A growing body of evidence indicates that deregulation of stem cell fate determinants is a hallmark of many types of malignancies .", "entity": [{"entity": "body", "entity_type": "Anatomy", "pos": [10, 14]}, {"entity": "stem cell", "entity_type": "Anatomy", "pos": [58, 67]}, {"entity": "malignancies", "entity_type": "Anatomy", "pos": [117, 129]}], "task": "NER"}
+{"text": "The neural stem cell fate determinant TLX plays a pivotal role in neurogenesis in the adult brain by maintaining neural stem cells .", "entity": [{"entity": "neural stem cell", "entity_type": "Anatomy", "pos": [4, 20]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [92, 97]}, {"entity": "neural stem cells", "entity_type": "Anatomy", "pos": [113, 130]}], "task": "NER"}
+{"text": "Here , we report a tumorigenic role of TLX in brain tumor initiation and progression .", "entity": [{"entity": "brain tumor", "entity_type": "Anatomy", "pos": [46, 57]}], "task": "NER"}
+{"text": "Increased TLX expression was observed in a number of glioma cells and glioma stem cells , and correlated with poor survival of patients with gliomas .", "entity": [{"entity": "glioma cells", "entity_type": "Anatomy", "pos": [53, 65]}, {"entity": "glioma stem cells", "entity_type": "Anatomy", "pos": [70, 87]}, {"entity": "gliomas", "entity_type": "Anatomy", "pos": [141, 148]}], "task": "NER"}
+{"text": "Ectopic expression of TLX in the U87MG glioma cell line and Ink4a / Arf - deficient mouse astrocytes ( Ink4a / Arf ( - / - ) astrocytes ) induced cell proliferation with a concomitant increase in cyclin D expression , and accelerated foci formation in soft agar and tumor formation in in vivo transplantation assays .", "entity": [{"entity": "U87MG glioma cell line", "entity_type": "Anatomy", "pos": [33, 55]}, {"entity": "Ink4a / Arf - deficient mouse astrocytes", "entity_type": "Anatomy", "pos": [60, 100]}, {"entity": "Ink4a / Arf ( - / - ) astrocytes", "entity_type": "Anatomy", "pos": [103, 135]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [146, 150]}, {"entity": "foci", "entity_type": "Anatomy", "pos": [234, 238]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [266, 271]}], "task": "NER"}
+{"text": "Furthermore , overexpression of TLX in Ink4a / Arf ( - / - ) astrocytes inhibited cell migration and invasion and promoted neurosphere formation and Nestin expression , which are hallmark characteristics of glioma stem cells , under stem cell culture conditions .", "entity": [{"entity": "Ink4a / Arf ( - / - ) astrocytes", "entity_type": "Anatomy", "pos": [39, 71]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [82, 86]}, {"entity": "neurosphere", "entity_type": "Anatomy", "pos": [123, 134]}, {"entity": "glioma stem cells", "entity_type": "Anatomy", "pos": [207, 224]}, {"entity": "stem cell", "entity_type": "Anatomy", "pos": [233, 242]}], "task": "NER"}
+{"text": "Our results indicate that TLX is involved in glioma stem cell genesis and represents a potential therapeutic target for this type of malignancy .", "entity": [{"entity": "glioma stem cell", "entity_type": "Anatomy", "pos": [45, 61]}, {"entity": "malignancy", "entity_type": "Anatomy", "pos": [133, 143]}], "task": "NER"}
+{"text": "Acute ablation of Langerhans cells enhances skin immune responses .", "entity": [{"entity": "Langerhans cells", "entity_type": "Anatomy", "pos": [18, 34]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [44, 48]}], "task": "NER"}
+{"text": "Understanding the function of Langerhans cells ( LCs ) in vivo has been complicated by conflicting results from LC - deficient mice .", "entity": [{"entity": "Langerhans cells", "entity_type": "Anatomy", "pos": [30, 46]}, {"entity": "LCs", "entity_type": "Anatomy", "pos": [49, 52]}, {"entity": "LC", "entity_type": "Anatomy", "pos": [112, 114]}], "task": "NER"}
+{"text": "Human Langerin - DTA mice constitutively lack LCs and develop exaggerated contact hypersensitivity ( CHS ) responses .", "entity": [{"entity": "LCs", "entity_type": "Anatomy", "pos": [46, 49]}], "task": "NER"}
+{"text": "Murine Langerin - diphtheria toxin receptor ( DTR ) mice allow for the inducible elimination of LCs and Langerin ( + ) dermal dendritic cells ( dDCs ) after administration of diphtheria toxin , which results in reduced CHS .", "entity": [{"entity": "LCs", "entity_type": "Anatomy", "pos": [96, 99]}, {"entity": "Langerin ( + ) dermal dendritic cells", "entity_type": "Anatomy", "pos": [104, 141]}, {"entity": "dDCs", "entity_type": "Anatomy", "pos": [144, 148]}], "task": "NER"}
+{"text": "When Langerin ( + ) dDCs have partially repopulated the skin but LCs are still absent , CHS returns to normal .", "entity": [{"entity": "Langerin ( + ) dDCs", "entity_type": "Anatomy", "pos": [5, 24]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [56, 60]}, {"entity": "LCs", "entity_type": "Anatomy", "pos": [65, 68]}], "task": "NER"}
+{"text": "Thus , LCs appear to be suppressive in human Langerin - DTA mice and redundant in murine Langerin - DTR mice .", "entity": [{"entity": "LCs", "entity_type": "Anatomy", "pos": [7, 10]}], "task": "NER"}
+{"text": "To determine whether inducible versus constitutive LC ablation explains these results , we engineered human Langerin - DTR mice in which diphtheria toxin ablates LCs without affecting Langerin ( + ) dDCs .", "entity": [{"entity": "LC", "entity_type": "Anatomy", "pos": [51, 53]}, {"entity": "LCs", "entity_type": "Anatomy", "pos": [162, 165]}, {"entity": "Langerin ( + ) dDCs", "entity_type": "Anatomy", "pos": [184, 203]}], "task": "NER"}
+{"text": "The inducible ablation of LCs in human Langerin - DTR mice resulted in increased CHS .", "entity": [{"entity": "LCs", "entity_type": "Anatomy", "pos": [26, 29]}], "task": "NER"}
+{"text": "Thus , LC - mediated suppression does not require their absence during ontogeny or during the steady - state and is consistent with a model in which LCs actively suppress Ag - specific CHS responses .", "entity": [{"entity": "LC", "entity_type": "Anatomy", "pos": [7, 9]}, {"entity": "LCs", "entity_type": "Anatomy", "pos": [149, 152]}], "task": "NER"}
+{"text": "The proenkephalin - A - derivative Met - enkephalin - Arg - Gly - Leu is not present in the feline species .", "entity": [], "task": "NER"}
+{"text": "No opioid octapeptide Met - enkephalin - Arg - Gly - Leu was detected either in the brain or in the adrenal gland of the cat using a specific radioimmunoassay .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [84, 89]}, {"entity": "adrenal gland", "entity_type": "Anatomy", "pos": [100, 113]}], "task": "NER"}
+{"text": "Whereas it was possible to determine the Met - enkephalin and Leu - enkephalin contents .", "entity": [], "task": "NER"}
+{"text": "The Met - enkephalin versus Leu - enkephalin concentration ratio was around five in each area of the brain assayed .", "entity": [{"entity": "area", "entity_type": "Anatomy", "pos": [89, 93]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [101, 106]}], "task": "NER"}
+{"text": "The presence of authentic Met - enkephalin and Leu - enkephalin was confirmed by high performance liquid chromatography analysis .", "entity": [], "task": "NER"}
+{"text": "All in all , these data seem to indicate that the cat proenkephalin is partly different from that previously analysed in mammalian species including humans , rats and cows .", "entity": [], "task": "NER"}
+{"text": "Expression profiling in progressive stages of fumarate - hydratase deficiency : the contribution of metabolic changes to tumorigenesis .", "entity": [], "task": "NER"}
+{"text": "Hereditary leiomyomatosis and renal cell carcinoma ( HLRCC ) is caused by mutations in the Krebs cycle enzyme fumarate hydratase ( FH ) .", "entity": [{"entity": "Hereditary leiomyomatosis and renal cell carcinoma", "entity_type": "Anatomy", "pos": [0, 50]}, {"entity": "HLRCC", "entity_type": "Anatomy", "pos": [53, 58]}], "task": "NER"}
+{"text": "It has been proposed that \" pseudohypoxic \" stabilization of hypoxia - inducible factor - alpha ( HIF - alpha ) by fumarate accumulation contributes to tumorigenesis in HLRCC .", "entity": [{"entity": "HLRCC", "entity_type": "Anatomy", "pos": [169, 174]}], "task": "NER"}
+{"text": "We hypothesized that an additional direct consequence of FH deficiency is the establishment of a biosynthetic milieu .", "entity": [], "task": "NER"}
+{"text": "To investigate this hypothesis , we isolated primary mouse embryonic fibroblast ( MEF ) lines from Fh1 - deficient mice .", "entity": [{"entity": "mouse embryonic fibroblast ( MEF ) lines", "entity_type": "Anatomy", "pos": [53, 93]}], "task": "NER"}
+{"text": "As predicted , these MEFs upregulated Hif - 1alpha and HIF target genes directly as a result of FH deficiency .", "entity": [{"entity": "MEFs", "entity_type": "Anatomy", "pos": [21, 25]}], "task": "NER"}
+{"text": "In addition , detailed metabolic assessment of these MEFs confirmed their dependence on glycolysis , and an elevated rate of lactate efflux , associated with the upregulation of glycolytic enzymes known to be associated with tumorigenesis .", "entity": [{"entity": "MEFs", "entity_type": "Anatomy", "pos": [53, 57]}], "task": "NER"}
+{"text": "Correspondingly , Fh1 - deficient benign murine renal cysts and an advanced human HLRCC - related renal cell carcinoma manifested a prominent and progressive increase in the expression of HIF - alpha target genes and in genes known to be relevant to tumorigenesis and metastasis .", "entity": [{"entity": "Fh1 - deficient benign murine renal cysts", "entity_type": "Anatomy", "pos": [18, 59]}, {"entity": "HLRCC - related renal cell carcinoma", "entity_type": "Anatomy", "pos": [82, 118]}], "task": "NER"}
+{"text": "In accord with our hypothesis , in a variety of different FH - deficient tissues , including a novel murine model of Fh1 - deficient smooth muscle , we show a striking and progressive upregulation of a tumorigenic metabolic profile , as manifested by increased PKM2 and LDHA protein .", "entity": [{"entity": "FH - deficient tissues", "entity_type": "Anatomy", "pos": [58, 80]}, {"entity": "Fh1 - deficient smooth muscle", "entity_type": "Anatomy", "pos": [117, 146]}], "task": "NER"}
+{"text": "Based on the models assessed herein , we infer that that FH deficiency compels cells to adopt an early , reversible , and progressive protumorigenic metabolic milieu that is reminiscent of that driving the Warburg effect .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [79, 84]}], "task": "NER"}
+{"text": "Targets identified in these novel and diverse FH - deficient models represent excellent potential candidates for further mechanistic investigation and therapeutic metabolic manipulation in tumors .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [189, 195]}], "task": "NER"}
+{"text": "A STAT3 - mediated metabolic switch is involved in tumour transformation and STAT3 addiction .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [51, 57]}], "task": "NER"}
+{"text": "The pro - oncogenic transcription factor STAT3 is constitutively activated in a wide variety of tumours that often become addicted to its activity , but no unifying view of a core function determining this widespread STAT3 - dependence has yet emerged .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [96, 103]}], "task": "NER"}
+{"text": "We show here that constitutively active STAT3 acts as a master regulator of cell metabolism , inducing aerobic glycolysis and down - regulating mitochondrial activity both in primary fibroblasts and in STAT3 - dependent tumour cell lines .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [76, 80]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [144, 157]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [183, 194]}, {"entity": "tumour cell lines", "entity_type": "Anatomy", "pos": [220, 237]}], "task": "NER"}
+{"text": "As a result , cells are protected from apoptosis and senescence while becoming highly sensitive to glucose deprivation .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [14, 19]}], "task": "NER"}
+{"text": "We show that enhanced glycolysis is dependent on HIF - 1alpha up - regulation , while reduced mitochondrial activity is HIF - 1alpha - independent and likely caused by STAT3 - mediated down - regulation of mitochondrial proteins .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [94, 107]}, {"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [206, 219]}], "task": "NER"}
+{"text": "The induction of aerobic glycolysis is an important component of STAT3 pro - oncogenic activities , since inhibition of STAT3 tyrosine phosphorylation in the tumour cell lines down - regulates glycolysis prior to leading to growth arrest and cell death , both in vitro and in vivo .", "entity": [{"entity": "tumour cell lines", "entity_type": "Anatomy", "pos": [158, 175]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [242, 246]}], "task": "NER"}
+{"text": "We propose that this novel , central metabolic role is at the core of the addiction for STAT3 shown by so many biologically different tumours .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [134, 141]}], "task": "NER"}
+{"text": "Dissecting genetic networks underlying complex phenotypes : the theoretical framework .", "entity": [], "task": "NER"}
+{"text": "Great progress has been made in genetic dissection of quantitative trait variation during the past two decades , but many studies still reveal only a small fraction of quantitative trait loci ( QTLs ) , and epistasis remains elusive .", "entity": [], "task": "NER"}
+{"text": "We integrate contemporary knowledge of signal transduction pathways with principles of quantitative and population genetics to characterize genetic networks underlying complex traits , using a model founded upon one - way functional dependency of downstream genes on upstream regulators ( the principle of hierarchy ) and mutual functional dependency among related genes ( functional genetic units , FGU ) .", "entity": [], "task": "NER"}
+{"text": "Both simulated and real data suggest that complementary epistasis contributes greatly to quantitative trait variation , and obscures the phenotypic effects of many ' downstream ' loci in pathways .", "entity": [], "task": "NER"}
+{"text": "The mathematical relationships between the main effects and epistatic effects of genes acting at different levels of signaling pathways were established using the quantitative and population genetic parameters .", "entity": [], "task": "NER"}
+{"text": "Both loss of function and \" co - adapted \" gene complexes formed by multiple alleles with differentiated functions ( effects ) are predicted to be frequent types of allelic diversity at loci that contribute to the genetic variation of complex traits in populations .", "entity": [], "task": "NER"}
+{"text": "Downstream FGUs appear to be more vulnerable to loss of function than their upstream regulators , but this vulnerability is apparently compensated by different FGUs of similar functions .", "entity": [], "task": "NER"}
+{"text": "Other predictions from the model may account for puzzling results regarding responses to selection , genotype by environment interaction , and the genetic basis of heterosis .", "entity": [], "task": "NER"}
+{"text": "Roles of brca2 ( fancd1 ) in oocyte nuclear architecture , gametogenesis , gonad tumors , and genome stability in zebrafish .", "entity": [{"entity": "oocyte nuclear", "entity_type": "Anatomy", "pos": [29, 43]}, {"entity": "gonad tumors", "entity_type": "Anatomy", "pos": [75, 87]}], "task": "NER"}
+{"text": "Mild mutations in BRCA2 ( FANCD1 ) cause Fanconi anemia ( FA ) when homozygous , while severe mutations cause common cancers including breast , ovarian , and prostate cancers when heterozygous .", "entity": [{"entity": "cancers", "entity_type": "Anatomy", "pos": [117, 124]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [135, 141]}, {"entity": "ovarian", "entity_type": "Anatomy", "pos": [144, 151]}, {"entity": "prostate cancers", "entity_type": "Anatomy", "pos": [158, 174]}], "task": "NER"}
+{"text": "Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis .", "entity": [], "task": "NER"}
+{"text": "Experiments showed that mutant embryos and mutant cells in culture experienced genome instability , as do cells in FA patients .", "entity": [{"entity": "mutant embryos", "entity_type": "Anatomy", "pos": [24, 38]}, {"entity": "mutant cells", "entity_type": "Anatomy", "pos": [43, 55]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [106, 111]}], "task": "NER"}
+{"text": "In wild - type zebrafish , meiotic cells expressed brca2 ; and , unexpectedly , transcripts in oocytes localized asymmetrically to the animal pole .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [35, 40]}, {"entity": "oocytes", "entity_type": "Anatomy", "pos": [95, 102]}, {"entity": "animal pole", "entity_type": "Anatomy", "pos": [135, 146]}], "task": "NER"}
+{"text": "In juvenile brca2 mutants , oocytes failed to progress through meiosis , leading to female - to - male sex reversal .", "entity": [{"entity": "oocytes", "entity_type": "Anatomy", "pos": [28, 35]}], "task": "NER"}
+{"text": "Adult mutants became sterile males due to the meiotic arrest of spermatocytes , which then died by apoptosis , followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end ( dnd ) - knockdown males , which lack germ cells .", "entity": [{"entity": "spermatocytes", "entity_type": "Anatomy", "pos": [64, 77]}, {"entity": "neoplastic", "entity_type": "Anatomy", "pos": [123, 133]}, {"entity": "gonad somatic cells", "entity_type": "Anatomy", "pos": [151, 170]}, {"entity": "neoplasia", "entity_type": "Anatomy", "pos": [191, 200]}, {"entity": "germ cells", "entity_type": "Anatomy", "pos": [268, 278]}], "task": "NER"}
+{"text": "The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 ( p53 ) rescued brca2 - dependent sex reversal .", "entity": [], "task": "NER"}
+{"text": "Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors .", "entity": [{"entity": "oocytes", "entity_type": "Anatomy", "pos": [25, 32]}, {"entity": "embryos", "entity_type": "Anatomy", "pos": [88, 95]}, {"entity": "invasive ovarian tumors", "entity_type": "Anatomy", "pos": [125, 148]}], "task": "NER"}
+{"text": "Oocytes in double - mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole , but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles ; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture .", "entity": [{"entity": "Oocytes", "entity_type": "Anatomy", "pos": [0, 7]}, {"entity": "animal pole", "entity_type": "Anatomy", "pos": [101, 112]}, {"entity": "vegetal pole", "entity_type": "Anatomy", "pos": [141, 153]}, {"entity": "nucleus", "entity_type": "Anatomy", "pos": [200, 207]}, {"entity": "nucleoli", "entity_type": "Anatomy", "pos": [233, 241]}, {"entity": "chromosomes", "entity_type": "Anatomy", "pos": [246, 257]}, {"entity": "nuclear poles", "entity_type": "Anatomy", "pos": [270, 283]}, {"entity": "oocyte nuclear", "entity_type": "Anatomy", "pos": [361, 375]}], "task": "NER"}
+{"text": "Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males , suggesting that brca2 plays an essential role in zebrafish spermatogenesis .", "entity": [], "task": "NER"}
+{"text": "Overall , this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture .", "entity": [{"entity": "oocyte nuclear", "entity_type": "Anatomy", "pos": [143, 157]}], "task": "NER"}
+{"text": "3 - [ ( Methyl - carbamo - yl ) amino ] - 1H - isoindolium chloride .", "entity": [], "task": "NER"}
+{"text": "The title compound , C ( 10 ) H ( 12 ) N ( 3 ) O ( + ) . Cl ( - ) , is a derivative of o - phthaldehyde and methyl - thio - urea .", "entity": [], "task": "NER"}
+{"text": "The mol - ecules form dimers through intra - and inter - molecular N - H . . . O hydrogen bonds .", "entity": [], "task": "NER"}
+{"text": "The dimers are further linked into chains through one C - H . . . Cl and two N - H . . . Cl hydrogen bonds .", "entity": [], "task": "NER"}
+{"text": "KISS1 methylation and expression as tumor stratification biomarkers and clinical outcome prognosticators for bladder cancer patients .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "bladder cancer", "entity_type": "Anatomy", "pos": [109, 123]}], "task": "NER"}
+{"text": "KISS1 is a metastasis suppressor gene that is lost in several malignancies , including bladder cancer .", "entity": [{"entity": "malignancies", "entity_type": "Anatomy", "pos": [62, 74]}, {"entity": "bladder cancer", "entity_type": "Anatomy", "pos": [87, 101]}], "task": "NER"}
+{"text": "We tested the epigenetic silencing hypothesis and evaluated the biological influence of KISS1 methylation on its expression and clinical relevance in bladder cancer .", "entity": [{"entity": "bladder cancer", "entity_type": "Anatomy", "pos": [150, 164]}], "task": "NER"}
+{"text": "KISS1 hypermethylation was frequent in bladder cancer cells analyzed by methylation - specific PCR and bisulfite sequencing and was associated with low gene expression , being restored in vitro by demethylating azacytidine .", "entity": [{"entity": "bladder cancer cells", "entity_type": "Anatomy", "pos": [39, 59]}], "task": "NER"}
+{"text": "Hypermethylation was also frequently observed in a large series of bladder tumors ( 83 . 1 % , n = 804 ) .", "entity": [{"entity": "bladder tumors", "entity_type": "Anatomy", "pos": [67, 81]}], "task": "NER"}
+{"text": "KISS1 methylation was associated with increasing stage ( P = 0 . 001 ) and tumor grade ( P = 0 . 010 ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [75, 80]}], "task": "NER"}
+{"text": "KISS1 methylation was associated with low KISS1 transcript expression by quantitative RT - PCR ( P = 0 . 037 ) .", "entity": [], "task": "NER"}
+{"text": "KISS1 transcript expression was also associated with histopathological tumor stage ( P < 0 . 0005 ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [71, 76]}], "task": "NER"}
+{"text": "Low transcript expression alone ( P = 0 . 003 ) or combined with methylation ( P = 0 . 019 ) was associated with poor disease - specific survival ( n = 205 ) .", "entity": [], "task": "NER"}
+{"text": "KISS1 transcript expression remained an independent prognosticator in multivariate analyses ( P = 0 . 017 ) .", "entity": [], "task": "NER"}
+{"text": "KISS1 hypermethylation was identified in bladder cancer , providing a potential mechanistic explanation ( epigenetic silencing ) for the observed loss of KISS1 in uroepithelial malignancies .", "entity": [{"entity": "bladder cancer", "entity_type": "Anatomy", "pos": [41, 55]}, {"entity": "uroepithelial malignancies", "entity_type": "Anatomy", "pos": [163, 189]}], "task": "NER"}
+{"text": "Associations of KISS1 methylation and its expression with histopathological variables and poor survival suggest the utility of incorporating KISS1 measurement using paraffin - embedded material for tumor stratification and clinical outcome prognosis of patients with uroepithelial neoplasias .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [198, 203]}, {"entity": "uroepithelial neoplasias", "entity_type": "Anatomy", "pos": [267, 291]}], "task": "NER"}
+{"text": "Oscillatory alpha - band mechanisms and the deployment of spatial attention to anticipated auditory and visual target locations : supramodal or sensory - specific control mechanisms ?", "entity": [], "task": "NER"}
+{"text": "Oscillatory alpha - band activity ( 8 - 15 Hz ) over parieto - occipital cortex in humans plays an important role in suppression of processing for inputs at to - be - ignored regions of space , with increased alpha - band power observed over cortex contralateral to locations expected to contain distractors .", "entity": [{"entity": "parieto - occipital cortex", "entity_type": "Anatomy", "pos": [53, 79]}, {"entity": "cortex", "entity_type": "Anatomy", "pos": [242, 248]}], "task": "NER"}
+{"text": "It is unclear whether similar processes operate during deployment of spatial attention in other sensory modalities .", "entity": [], "task": "NER"}
+{"text": "Evidence from lesion patients suggests that parietal regions house supramodal representations of space .", "entity": [{"entity": "lesion", "entity_type": "Anatomy", "pos": [14, 20]}, {"entity": "parietal regions", "entity_type": "Anatomy", "pos": [44, 60]}], "task": "NER"}
+{"text": "The parietal lobes are prominent generators of alpha oscillations , raising the possibility that alpha is a neural signature of supramodal spatial attention .", "entity": [{"entity": "parietal lobes", "entity_type": "Anatomy", "pos": [4, 18]}, {"entity": "neural", "entity_type": "Anatomy", "pos": [108, 114]}], "task": "NER"}
+{"text": "Furthermore , when spatial attention is deployed within vision , processing of task - irrelevant auditory inputs at attended locations is also enhanced , pointing to automatic links between spatial deployments across senses .", "entity": [], "task": "NER"}
+{"text": "Here , we asked whether lateralized alpha - band activity is also evident in a purely auditory spatial - cueing task and whether it had the same underlying generator configuration as in a purely visuospatial task .", "entity": [], "task": "NER"}
+{"text": "If common to both sensory systems , this would provide strong support for \" supramodal \" attention theory .", "entity": [], "task": "NER"}
+{"text": "Alternately , alpha - band differences between auditory and visual tasks would support a sensory - specific account .", "entity": [], "task": "NER"}
+{"text": "Lateralized shifts in alpha - band activity were indeed observed during a purely auditory spatial task .", "entity": [], "task": "NER"}
+{"text": "Crucially , there were clear differences in scalp topographies of this alpha activity depending on the sensory system within which spatial attention was deployed .", "entity": [{"entity": "scalp", "entity_type": "Anatomy", "pos": [44, 49]}], "task": "NER"}
+{"text": "Findings suggest that parietally generated alpha - band mechanisms are central to attentional deployments across modalities but that they are invoked in a sensory - specific manner .", "entity": [], "task": "NER"}
+{"text": "The data support an \" interactivity account , \" whereby a supramodal system interacts with sensory - specific control systems during deployment of spatial attention .", "entity": [], "task": "NER"}
+{"text": "Correlation of lymphatic vessel density and vascular endothelial growth factor with nodal metastasis in papillary thyroid microcarcinoma .", "entity": [{"entity": "lymphatic vessel", "entity_type": "Anatomy", "pos": [15, 31]}, {"entity": "nodal", "entity_type": "Anatomy", "pos": [84, 89]}, {"entity": "papillary thyroid microcarcinoma", "entity_type": "Anatomy", "pos": [104, 136]}], "task": "NER"}
+{"text": "BACKGROUND : The aim of this study was to investigate not only the intratumoral and peritumoral lymphatic vessel density ( ILD and PLD ) but also the expression of vascular endothelial growth factors ( VEGFs ) and to test their correlation with regional lymph nodal metastases in papillary thyroid microcarcinoma ( PTMC ) .", "entity": [{"entity": "intratumoral", "entity_type": "Anatomy", "pos": [67, 79]}, {"entity": "peritumoral lymphatic vessel", "entity_type": "Anatomy", "pos": [84, 112]}, {"entity": "lymph nodal metastases", "entity_type": "Anatomy", "pos": [254, 276]}, {"entity": "papillary thyroid microcarcinoma", "entity_type": "Anatomy", "pos": [280, 312]}, {"entity": "PTMC", "entity_type": "Anatomy", "pos": [315, 319]}], "task": "NER"}
+{"text": "METHODS : A clinicopathologic data review was performed in 60 patients with PTMC treated with total thyroidectomies involving neck dissections .", "entity": [{"entity": "PTMC", "entity_type": "Anatomy", "pos": [76, 80]}, {"entity": "neck", "entity_type": "Anatomy", "pos": [126, 130]}], "task": "NER"}
+{"text": "The patterns of lymphatic vessels , the expression of VEGFs , and their correlation with neck metastases were assessed .", "entity": [{"entity": "lymphatic vessels", "entity_type": "Anatomy", "pos": [16, 33]}, {"entity": "neck metastases", "entity_type": "Anatomy", "pos": [89, 104]}], "task": "NER"}
+{"text": "RESULTS : PLD was significantly higher than ILD ( p < . 001 ) .", "entity": [], "task": "NER"}
+{"text": "Patients with high PLD ( > 8 . 0 ) showed higher rates of neck metastases than low PLD ( < = 8 . 0 ) ( 74 . 0 % vs 46 . 8 % , p = . 03 ) .", "entity": [{"entity": "neck metastases", "entity_type": "Anatomy", "pos": [58, 73]}], "task": "NER"}
+{"text": "Univariate and multivariate analyses revealed high PLD as the only independent variable predictive of neck metastasis .", "entity": [{"entity": "neck", "entity_type": "Anatomy", "pos": [102, 106]}], "task": "NER"}
+{"text": "The expression of VEGFs did not correlate with either lymphatic density or neck metastasis .", "entity": [{"entity": "lymphatic", "entity_type": "Anatomy", "pos": [54, 63]}, {"entity": "neck", "entity_type": "Anatomy", "pos": [75, 79]}], "task": "NER"}
+{"text": "CONCLUSIONS : PLD may be of potential benefit in the prediction of neck metastasis in PTMC .", "entity": [{"entity": "neck", "entity_type": "Anatomy", "pos": [67, 71]}, {"entity": "PTMC", "entity_type": "Anatomy", "pos": [86, 90]}], "task": "NER"}
+{"text": "Inhibition of autophagy potentiates the antitumor effect of the multikinase inhibitor sorafenib in hepatocellular carcinoma .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [40, 49]}, {"entity": "hepatocellular carcinoma", "entity_type": "Anatomy", "pos": [99, 123]}], "task": "NER"}
+{"text": "Multikinase inhibitor sorafenib inhibits proliferation and angiogenesis of tumors by suppressing the Raf / MEK / ERK signaling pathway and VEGF receptor tyrosine kinase .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [75, 81]}], "task": "NER"}
+{"text": "It significantly prolongs median survival of patients with advanced hepatocellular carcinoma ( HCC ) but the response is disease - stabilizing and cytostatic rather than one of tumor regression .", "entity": [{"entity": "hepatocellular carcinoma", "entity_type": "Anatomy", "pos": [68, 92]}, {"entity": "HCC", "entity_type": "Anatomy", "pos": [95, 98]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [177, 182]}], "task": "NER"}
+{"text": "To examine the mechanisms underlying the relative resistance in HCC , we investigated the role of autophagy , an evolutionarily conserved self - digestion pathway , in hepatoma cells in vitro and in vivo .", "entity": [{"entity": "HCC", "entity_type": "Anatomy", "pos": [64, 67]}, {"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [168, 182]}], "task": "NER"}
+{"text": "Sorafenib treatment led to accumulation of autophagosomes as evidenced by conversion from LC3 - I to LC3 - II observed by immunoblot in Huh7 , HLF and PLC / PRF / 5 cells .", "entity": [{"entity": "autophagosomes", "entity_type": "Anatomy", "pos": [43, 57]}, {"entity": "Huh7", "entity_type": "Anatomy", "pos": [136, 140]}, {"entity": "HLF", "entity_type": "Anatomy", "pos": [143, 146]}, {"entity": "PLC / PRF / 5 cells", "entity_type": "Anatomy", "pos": [151, 170]}], "task": "NER"}
+{"text": "This induction was due to activation of autophagic flux , as there was further increase in LC3 - II expression upon treatment with lysosomal inhibitors , clear decline of the autophagy substrate p62 , and an mRFP - GFP - LC3 fluorescence change in sorafenib - treated hepatoma cells .", "entity": [{"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [268, 282]}], "task": "NER"}
+{"text": "Sorafenib inhibited the mammalian target of rapamycin complex 1 and its inhibition led to accumulation of LC3 - II .", "entity": [], "task": "NER"}
+{"text": "Pharmacological inhibition of autophagic flux by chloroquine increased apoptosis and decreased cell viability in hepatoma cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [95, 99]}, {"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [113, 127]}], "task": "NER"}
+{"text": "siRNA - mediated knockdown of the ATG7 gene also sensitized hepatoma cells to sorafenib .", "entity": [{"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [60, 74]}], "task": "NER"}
+{"text": "Finally , sorafenib induced autophagy in Huh7 xenograft tumors in nude mice and coadministration with chloroquine significantly suppressed tumor growth compared with sorafenib alone .", "entity": [{"entity": "Huh7 xenograft tumors", "entity_type": "Anatomy", "pos": [41, 62]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [139, 144]}], "task": "NER"}
+{"text": "In conclusion , sorafenib administration induced autophagosome formation and enhanced autophagic activity , which conferred a survival advantage to hepatoma cells .", "entity": [{"entity": "autophagosome", "entity_type": "Anatomy", "pos": [49, 62]}, {"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [148, 162]}], "task": "NER"}
+{"text": "Concomitant inhibition of autophagy may be an attractive strategy for unlocking the antitumor potential of sorafenib in HCC .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [84, 93]}, {"entity": "HCC", "entity_type": "Anatomy", "pos": [120, 123]}], "task": "NER"}
+{"text": "Desensitization of prostaglandin F2 alpha - stimulated inositol phosphate generation in NIH - 3T3 fibroblasts transformed by overexpression of normal c - Ha - ras - 1 , c - Ki - ras - 2 and c - N - ras genes .", "entity": [{"entity": "NIH - 3T3 fibroblasts", "entity_type": "Anatomy", "pos": [88, 109]}], "task": "NER"}
+{"text": "The stimulation of inositol phosphate generation in control and ras - gene - transformed NIH - 3T3 cells by prostaglandin F2 alpha ( PGF2 alpha ) was investigated .", "entity": [{"entity": "NIH - 3T3 cells", "entity_type": "Anatomy", "pos": [89, 104]}], "task": "NER"}
+{"text": "Compared with the control cells , a desensitization of the response was observed in cells transformed by the overexpression of N - , Ha - , or Ki - ras genes .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [26, 31]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [84, 89]}], "task": "NER"}
+{"text": "This desensitization was without effect upon the concentration causing half - maximal effect ( EC50 ) , dissociation constant ( Kd ) or number of PGF2 alpha receptors .", "entity": [], "task": "NER"}
+{"text": "Inhibition of PG synthesis was without effect upon desensitization , demonstrating that the effect was not agonist - induced .", "entity": [], "task": "NER"}
+{"text": "Desensitization could be induced in NIH - 3T3 cells by culturing under conditions where the cells were all in the exponential growth phase , or by a 12 h exposure to a C - kinase - activating phorbol ester .", "entity": [{"entity": "NIH - 3T3 cells", "entity_type": "Anatomy", "pos": [36, 51]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [92, 97]}], "task": "NER"}
+{"text": "These results suggest that desensitization of certain agonist - induced inositol phospholipid responses in ras - transformed cells is a consequence of increased cell proliferation and associated amplification in C - kinase activity and is an indirect consequence of transformation by ras .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [125, 130]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [161, 165]}], "task": "NER"}
+{"text": "Absence of antisperm antibodies in anejaculatory men .", "entity": [], "task": "NER"}
+{"text": "Antisperm antibodies were assessed in the serum samples of 73 men unable to ejaculate naturally and on the sperm cells of 13 of these men .", "entity": [{"entity": "serum samples", "entity_type": "Anatomy", "pos": [42, 55]}, {"entity": "sperm cells", "entity_type": "Anatomy", "pos": [107, 118]}], "task": "NER"}
+{"text": "None of the serum samples were found to be positive by sperm agglutination or sperm immobilization methods and antibodies were detected by an immunobead assay on the sperm cells of one of the 13 men examined .", "entity": [{"entity": "serum samples", "entity_type": "Anatomy", "pos": [12, 25]}, {"entity": "sperm", "entity_type": "Anatomy", "pos": [55, 60]}, {"entity": "sperm", "entity_type": "Anatomy", "pos": [78, 83]}, {"entity": "sperm cells", "entity_type": "Anatomy", "pos": [166, 177]}], "task": "NER"}
+{"text": "Relationship between of blood flow , glucose metabolism , protein synthesis , glucose and ATP content in experimentally - induced glioma ( RG1 2 . 2 ) of rat brain .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [24, 29]}, {"entity": "glioma", "entity_type": "Anatomy", "pos": [130, 136]}, {"entity": "RG1 2 . 2", "entity_type": "Anatomy", "pos": [139, 148]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [158, 163]}], "task": "NER"}
+{"text": "In experimental RG1 2 . 2 glioma of rat brain , local blood flow , glucose utilization , protein synthesis , glucose and ATP content were measured by means of triple tracer autoradiography and bioluminescence technique , respectively , to determine hemodynamic and metabolic thresholds for local tumor energy failure .", "entity": [{"entity": "RG1 2 . 2 glioma", "entity_type": "Anatomy", "pos": [16, 32]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [40, 45]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [54, 59]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [296, 301]}], "task": "NER"}
+{"text": "Perfusion thresholds were estimated at tumor blood flow values of 69 . 0 + / - 0 . 1 ml / 100 g / min ( estimate + / - standard error ) and of 69 + / - 7 . 1 ml / 100 g / min for the beginning of the decline in regional ATP and glucose content , respectively .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [39, 44]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [45, 50]}], "task": "NER"}
+{"text": "Metabolic thresholds were derived at tumor glucose utilization values of 70 . 6 + / - 8 . 3 mumol / 100 g / min for reduced protein synthesis , of 55 . 0 + / - 0 . 2 mumol / 100 g / min for the decrease in glucose content , and 34 . 7 + / - 4 . 7 mumol / 100 g / min for decline in ATP content .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [37, 42]}], "task": "NER"}
+{"text": "Our results suggest that blood flow limits glucose supply to tumor tissue at much higher flow rates than in normal brain which , in turn , is associated with a decrease in tumor glucose utilization .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [25, 30]}, {"entity": "tumor tissue", "entity_type": "Anatomy", "pos": [61, 73]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [115, 120]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [172, 177]}], "task": "NER"}
+{"text": "A reduction and not an increase in tumor glucose availability could be a more appropriate strategy for the induction of energy failure in tumors .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [35, 40]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [138, 144]}], "task": "NER"}
+{"text": "Inactivation of androgen - induced regulator ARD1 inhibits androgen receptor acetylation and prostate tumorigenesis .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [93, 101]}], "task": "NER"}
+{"text": "Androgen signaling through androgen receptor ( AR ) is critical for prostate tumorigenesis .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [68, 76]}], "task": "NER"}
+{"text": "Given that AR - mediated gene regulation is enhanced by AR coregulators , inactivation of those coregulators is emerging as a promising therapy for prostate cancer ( PCa ) .", "entity": [{"entity": "prostate cancer", "entity_type": "Anatomy", "pos": [148, 163]}, {"entity": "PCa", "entity_type": "Anatomy", "pos": [166, 169]}], "task": "NER"}
+{"text": "Here , we show that the N - acetyltransferase arrest - defect 1 protein ( ARD1 ) functions as a unique AR regulator in PCa cells .", "entity": [{"entity": "PCa cells", "entity_type": "Anatomy", "pos": [119, 128]}], "task": "NER"}
+{"text": "ARD1 is up - regulated in human PCa cell lines and primary tumor biopsies .", "entity": [{"entity": "PCa cell lines", "entity_type": "Anatomy", "pos": [32, 46]}, {"entity": "primary tumor biopsies", "entity_type": "Anatomy", "pos": [51, 73]}], "task": "NER"}
+{"text": "The expression of ARD1 was augmented by treatment with synthetic androgen ( R1881 ) unless AR is deficient or is inhibited by AR - specific siRNA or androgen inhibitor bicalutamide ( Casodex ) .", "entity": [], "task": "NER"}
+{"text": "Depletion of ARD1 by shRNA suppressed PCa cell proliferation , anchorage - independent growth , and xenograft tumor formation in SCID mice , suggesting that AR - dependent ARD1 expression is biologically germane .", "entity": [{"entity": "PCa cell", "entity_type": "Anatomy", "pos": [38, 46]}, {"entity": "xenograft tumor", "entity_type": "Anatomy", "pos": [100, 115]}], "task": "NER"}
+{"text": "Notably , ARD1 was critical for transcriptionally regulating a number of AR target genes that are involved in prostate tumorigenesis .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [110, 118]}], "task": "NER"}
+{"text": "Furthermore , ARD1 interacted physically with and acetylated the AR protein in vivo and in vitro .", "entity": [], "task": "NER"}
+{"text": "Because AR - ARD1 interaction facilitated the AR binding to its targeted promoters for gene transcription , we propose that ARD1 functions as a unique AR regulator and forms a positive feedback loop for AR - dependent prostate tumorigenesis .", "entity": [{"entity": "prostate", "entity_type": "Anatomy", "pos": [218, 226]}], "task": "NER"}
+{"text": "Disruption of AR - ARD1 interactions may be a potent intervention for androgen - dependent PCa therapy .", "entity": [{"entity": "PCa", "entity_type": "Anatomy", "pos": [91, 94]}], "task": "NER"}
+{"text": "The role of Hes genes in intestinal development , homeostasis and tumor formation .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [25, 35]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [66, 71]}], "task": "NER"}
+{"text": "Notch signaling regulates intestinal development , homeostasis and tumorigenesis , but its precise downstream mechanism remains largely unknown .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [26, 36]}], "task": "NER"}
+{"text": "Here we found that inactivation of the Notch effectors Hes1 , Hes3 and Hes5 , but not Hes1 alone , led to reduced cell proliferation , increased secretory cell formation and altered intestinal structures in adult mice .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [114, 118]}, {"entity": "secretory cell", "entity_type": "Anatomy", "pos": [145, 159]}, {"entity": "intestinal structures", "entity_type": "Anatomy", "pos": [182, 203]}], "task": "NER"}
+{"text": "However , in Apc mutation - induced intestinal tumors , inactivation of Hes1 alone was sufficient for reducing tumor cell proliferation and inducing differentiation of tumor cells into all types of intestinal epithelial cells , but without affecting the homeostasis of normal crypts owing to genetic redundancy .", "entity": [{"entity": "intestinal tumors", "entity_type": "Anatomy", "pos": [36, 53]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [111, 121]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [168, 179]}, {"entity": "intestinal epithelial cells", "entity_type": "Anatomy", "pos": [198, 225]}, {"entity": "crypts", "entity_type": "Anatomy", "pos": [276, 282]}], "task": "NER"}
+{"text": "These results indicated that Hes genes cooperatively regulate intestinal development and homeostasis and raised the possibility that Hes1 is a promising target to induce the differentiation of tumor cells .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [62, 72]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [193, 204]}], "task": "NER"}
+{"text": "Activation - induced cytidine deaminase in antibody diversification and chromosome translocation .", "entity": [{"entity": "chromosome", "entity_type": "Anatomy", "pos": [72, 82]}], "task": "NER"}
+{"text": "DNA damage , rearrangement , and mutation of the human genome are the basis of carcinogenesis and thought to be avoided at all costs .", "entity": [], "task": "NER"}
+{"text": "An exception is the adaptive immune system where lymphocytes utilize programmed DNA damage to effect antigen receptor diversification .", "entity": [{"entity": "immune system", "entity_type": "Anatomy", "pos": [29, 42]}, {"entity": "lymphocytes", "entity_type": "Anatomy", "pos": [49, 60]}], "task": "NER"}
+{"text": "Both B and T lymphocytes diversify their antigen receptors through RAG1 / 2 mediated recombination , but B cells undergo two additional processes - - somatic hypermutation ( SHM ) and class - switch recombination ( CSR ) , both initiated by activation - induced cytidine deaminase ( AID ) .", "entity": [{"entity": "B", "entity_type": "Anatomy", "pos": [0, 1]}, {"entity": "T lymphocytes", "entity_type": "Anatomy", "pos": [11, 24]}, {"entity": "B cells", "entity_type": "Anatomy", "pos": [105, 112]}], "task": "NER"}
+{"text": "AID deaminates cytidines in DNA resulting in U : G mismatches that are processed into point mutations in SHM or double - strand breaks in CSR .", "entity": [], "task": "NER"}
+{"text": "Although AID activity is focused at Immunoglobulin ( Ig ) gene loci , it also targets a wide array of non - Ig genes including oncogenes associated with lymphomas .", "entity": [{"entity": "lymphomas", "entity_type": "Anatomy", "pos": [153, 162]}], "task": "NER"}
+{"text": "Here , we review the molecular basis of AID regulation , targeting , and initiation of CSR and SHM , as well as AID ' s role in generating chromosome translocations that contribute to lymphomagenesis .", "entity": [{"entity": "chromosome", "entity_type": "Anatomy", "pos": [139, 149]}], "task": "NER"}
+{"text": "Incidence of BRAF p . Val600Glu and p . Val600Lys mutations in a consecutive series of 183 metastatic melanoma patients from a high incidence region .", "entity": [{"entity": "metastatic melanoma", "entity_type": "Anatomy", "pos": [91, 110]}], "task": "NER"}
+{"text": "AIM : Approximately 40 - 60 % of melanomas from Caucasian populations carry activating mutations in the BRAF oncogene , with the most common being the p . Val600Glu ( V600E ) hotspot mutation in exon 15 .", "entity": [{"entity": "melanomas", "entity_type": "Anatomy", "pos": [33, 42]}], "task": "NER"}
+{"text": "The aim of the present study was to investigate the frequency of the less common p . Val600Lys ( V600K ) mutation in metastatic melanoma from a high incidence region .", "entity": [{"entity": "metastatic melanoma", "entity_type": "Anatomy", "pos": [117, 136]}], "task": "NER"}
+{"text": "METHOD : Dideoxy sequencing and fluorescent single strand conformation analysis were used to screen for mutations in exon 15 of BRAF in 183 cases of metastatic melanoma .", "entity": [{"entity": "metastatic melanoma", "entity_type": "Anatomy", "pos": [149, 168]}], "task": "NER"}
+{"text": "RESULTS : The overall incidence of BRAF mutation ( 89 / 183 , 49 % ) was very similar to other large studies of Caucasian populations .", "entity": [], "task": "NER"}
+{"text": "However , the frequency of the p . Val600Lys mutation was higher than in most other studies and comprised almost one - third of all BRAF mutations in our cohort ( 27 / 89 , 30 % ) .", "entity": [], "task": "NER"}
+{"text": "CONCLUSION : BRAF p . Val600Lys mutations were present at a relatively high frequency in this cohort of metastatic melanoma patients ( 27 / 183 , 15 % ) .", "entity": [{"entity": "metastatic melanoma", "entity_type": "Anatomy", "pos": [104, 123]}], "task": "NER"}
+{"text": "Assays used to screen for BRAF mutations in the clinic should be robust enough to detect the p . Val600Lys mutation , as this may have therapeutic implications .", "entity": [], "task": "NER"}
+{"text": "[ Biotechnological and biomedical aspects of production and study of metal cation - phospholipid complexes ] .", "entity": [], "task": "NER"}
+{"text": "Problems relating to the technology of a phospholipid preparation from natural materials , liposome production , and studies into the mechanisms of interaction between metal ( trace elements ) cations and model bilayer lipid membranes are discussed .", "entity": [{"entity": "liposome", "entity_type": "Anatomy", "pos": [91, 99]}, {"entity": "bilayer lipid membranes", "entity_type": "Anatomy", "pos": [211, 234]}], "task": "NER"}
+{"text": "The proposed technology of extraction allows for preparation of phospholipids utilizable for liposome formation .", "entity": [{"entity": "liposome", "entity_type": "Anatomy", "pos": [93, 101]}], "task": "NER"}
+{"text": "The cation specificity of lipid bilayers is found to be determined by the presence of anionic phosphate adsorption sites on their surface .", "entity": [{"entity": "lipid bilayers", "entity_type": "Anatomy", "pos": [26, 40]}, {"entity": "surface", "entity_type": "Anatomy", "pos": [130, 137]}], "task": "NER"}
+{"text": "Alterations in carbohydrate metabolism in canine lymphoma .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [49, 57]}], "task": "NER"}
+{"text": "Following an overnight fast , blood samples were obtained from 14 dogs with previously untreated lymphoma before and 5 , 15 , 30 , 45 , 60 , and 90 minutes following an intravenous challenge with 500 mg / kg dextrose .", "entity": [{"entity": "blood samples", "entity_type": "Anatomy", "pos": [30, 43]}, {"entity": "lymphoma", "entity_type": "Anatomy", "pos": [97, 105]}, {"entity": "intravenous", "entity_type": "Anatomy", "pos": [169, 180]}], "task": "NER"}
+{"text": "Samples were assayed for glucose , lactate , and insulin concentrations and compared statistically with ten control dogs of similar weight and age undergoing an identical dextrose challenge .", "entity": [{"entity": "Samples", "entity_type": "Anatomy", "pos": [0, 7]}], "task": "NER"}
+{"text": "Dogs with lymphoma had similar glucose tolerance curves when compared with controls .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [10, 18]}], "task": "NER"}
+{"text": "Lactate concentrations were significantly higher ( P less than 0 . 001 ) at baseline and all time periods of the glucose tolerance test in dogs with lymphoma when compared with controls .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [149, 157]}], "task": "NER"}
+{"text": "Rise in lactate concentrations over baseline levels in the first 30 minutes of the glucose tolerance test were significantly higher in dogs with lymphoma ( P = 0 . 011 ) .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [145, 153]}], "task": "NER"}
+{"text": "Insulin concentrations were significantly higher ( P less than 0 . 001 ) at baseline and at the 5 - , 45 - , 60 - , and 90 - minute time periods of the glucose tolerance test in dogs with lymphoma .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [188, 196]}], "task": "NER"}
+{"text": "Rise in insulin concentrations over baseline in the first 5 minutes of the glucose tolerance test were also significantly greater in dogs with lymphoma ( P = 0 . 021 ) .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [143, 151]}], "task": "NER"}
+{"text": "These results indicate carbohydrate metabolism is altered in dogs with lymphoma .", "entity": [{"entity": "lymphoma", "entity_type": "Anatomy", "pos": [71, 79]}], "task": "NER"}
+{"text": "Many of these alterations parallel those observed in human patients suffering from cancer cachexia making canine lymphoma a potential model for further study of the pathogenesis and therapy of cancer cachexia .", "entity": [{"entity": "cancer cachexia", "entity_type": "Anatomy", "pos": [83, 98]}, {"entity": "lymphoma", "entity_type": "Anatomy", "pos": [113, 121]}, {"entity": "cancer cachexia", "entity_type": "Anatomy", "pos": [193, 208]}], "task": "NER"}
+{"text": "Members of the src and ras oncogene families supplant the epidermal growth factor requirement of BALB / MK - 2 keratinocytes and induce distinct alterations in their terminal differentiation program .", "entity": [{"entity": "keratinocytes", "entity_type": "Anatomy", "pos": [111, 124]}], "task": "NER"}
+{"text": "BALB - / MK - 2 mouse epidermal keratinocytes required epidermal growth factor for proliferation and terminally differentiated in response to high Ca2 + concentration .", "entity": [{"entity": "epidermal keratinocytes", "entity_type": "Anatomy", "pos": [22, 45]}], "task": "NER"}
+{"text": "Infection with retroviruses containing transforming genes of the src and ras oncogene families led to rapid loss of epidermal growth factor dependence , in some cases , accompanied by alterations in cellular morphology .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [199, 207]}], "task": "NER"}
+{"text": "The virus - altered cells continued to proliferate in the presence of high levels of extracellular calcium but exhibited alterations in normal keratinocyte terminal differentiation that appear to be specific to the particular oncogene .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [20, 25]}, {"entity": "extracellular", "entity_type": "Anatomy", "pos": [85, 98]}, {"entity": "keratinocyte", "entity_type": "Anatomy", "pos": [143, 155]}], "task": "NER"}
+{"text": "These alterations bore similarities to abnormalities in differentiation observed in naturally occurring squamous epithelial malignancies .", "entity": [{"entity": "squamous epithelial malignancies", "entity_type": "Anatomy", "pos": [104, 136]}], "task": "NER"}
+{"text": "Experimental drug therapy of peritumoral brain edema .", "entity": [{"entity": "peritumoral brain edema", "entity_type": "Anatomy", "pos": [29, 52]}], "task": "NER"}
+{"text": "Four drugs with potential anti - peritumoral brain edema activity were studied using the VX2 rabbit brain tumor model .", "entity": [{"entity": "peritumoral brain edema", "entity_type": "Anatomy", "pos": [33, 56]}, {"entity": "VX2", "entity_type": "Anatomy", "pos": [89, 92]}, {"entity": "brain tumor", "entity_type": "Anatomy", "pos": [100, 111]}], "task": "NER"}
+{"text": "Meclofenamate and indomethacin were tested in an attempt to confirm recent reports of anti - edema activity in non steroidal anti - inflammatory drugs ( NSAID ' s ) .", "entity": [{"entity": "edema", "entity_type": "Anatomy", "pos": [93, 98]}], "task": "NER"}
+{"text": "The ' angiostatic ' steroids 17 hydroxyprogesterone and epicortisol were tested because of their lack of glucocorticoid and mineralocorticoid effects and their structural similarity to glucocorticoids .", "entity": [], "task": "NER"}
+{"text": "The protein and water component of brain edema were indirectly quantitated .", "entity": [{"entity": "brain edema", "entity_type": "Anatomy", "pos": [35, 46]}], "task": "NER"}
+{"text": "None of the test drugs demonstrated significant anti - edema activity .", "entity": [{"entity": "edema", "entity_type": "Anatomy", "pos": [55, 60]}], "task": "NER"}
+{"text": "This work does not confirm reports that NSAID ' s have anti - edema activity and suggests that there may be no correlation between ' angiostatic ' and anti - edema activity in certain steroid compounds .", "entity": [{"entity": "edema", "entity_type": "Anatomy", "pos": [62, 67]}, {"entity": "edema", "entity_type": "Anatomy", "pos": [158, 163]}], "task": "NER"}
+{"text": "Identification of a small region of the v - fos gene product that is sufficient for transforming potential and growth - stimulating activity .", "entity": [], "task": "NER"}
+{"text": "To analyze the structure - function relationship for the v - fos protein , we constructed in - frame insertion and deletion mutants of the v - fos gene carried by FBJ - MuSV , and expressed them in chicken primary cells using retrovirus vectors .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [214, 219]}], "task": "NER"}
+{"text": "We assessed the effects of these mutations on the ability of the v - fos protein to transform chicken embryo fibroblasts and to stimulate cellular proliferation of chicken neuroretinal cells .", "entity": [{"entity": "embryo fibroblasts", "entity_type": "Anatomy", "pos": [102, 120]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [138, 146]}, {"entity": "neuroretinal cells", "entity_type": "Anatomy", "pos": [172, 190]}], "task": "NER"}
+{"text": "The mutant which retains only the central region of the v - fos protein ( Met111 - Ile206 ) have both activities , but the mutants which have deletions in this region , and one of the mutants that has a four amino acid insertion in it , lost both activities .", "entity": [], "task": "NER"}
+{"text": "The central region that is sufficient for these activities includes the evolutionarily highly conserved region among human , mouse and chicken c - fos proteins .", "entity": [], "task": "NER"}
+{"text": "Additionally , this sequence shares some homology with the DNA binding domain of GCN4 and c - jun protein .", "entity": [], "task": "NER"}
+{"text": "The truncated fos protein that contains only part of the central region is not phosphorylated in chicken embryo fibroblasts , indicating that phosphorylation of the fos protein is not necessary for the transforming activity .", "entity": [{"entity": "embryo fibroblasts", "entity_type": "Anatomy", "pos": [105, 123]}], "task": "NER"}
+{"text": "Inhibition by retinoic acid of type IV collagenolysis and invasion through reconstituted basement membrane by metastatic rat mammary adenocarcinoma cells .", "entity": [{"entity": "basement membrane", "entity_type": "Anatomy", "pos": [89, 106]}, {"entity": "mammary adenocarcinoma cells", "entity_type": "Anatomy", "pos": [125, 153]}], "task": "NER"}
+{"text": "The activity of type IV collagenase , which enables tumor cells to degrade collagen type IV found in the subendothelial basement membrane , has been correlated with the metastatic potential in several tumor types , including the rat 13762NF mammary adenocarcinoma cell line and its clones .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [52, 63]}, {"entity": "subendothelial basement membrane", "entity_type": "Anatomy", "pos": [105, 137]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [201, 206]}, {"entity": "13762NF mammary adenocarcinoma cell line", "entity_type": "Anatomy", "pos": [233, 273]}, {"entity": "clones", "entity_type": "Anatomy", "pos": [282, 288]}], "task": "NER"}
+{"text": "In this study , we examined whether all - trans - retinoic acid ( all - trans - RA ) and other retinoids , which exhibit antitumor activity in vitro and in vivo , affect the collagenolytic activity of metastatic rat 13762NF mammary adenocarcinoma cells .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [121, 130]}, {"entity": "13762NF mammary adenocarcinoma cells", "entity_type": "Anatomy", "pos": [216, 252]}], "task": "NER"}
+{"text": "Cells of the highly metastatic lung - colonizing clone MTF7 . T35 . 3 , derived from the 13762NF cell line , were treated for 3 days with 0 . 1 , 1 , or 10 microM all - trans - RA , harvested , and seeded on [ 3H ] proline - labeled extracellular matrix deposited by cultured rat lung endothelial cells or on a film of purified [ 3H ] proline - labeled type IV collagen .", "entity": [{"entity": "Cells", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [31, 35]}, {"entity": "clone MTF7 . T35 . 3", "entity_type": "Anatomy", "pos": [49, 69]}, {"entity": "13762NF cell line", "entity_type": "Anatomy", "pos": [89, 106]}, {"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [233, 253]}, {"entity": "lung endothelial cells", "entity_type": "Anatomy", "pos": [280, 302]}], "task": "NER"}
+{"text": "The amount of radioactivity released into the medium during the subsequent 24 to 72 h was measured , and it was found that all - trans - RA treatment inhibited degradation of extracellular matrix and type IV collagen by 50 to 60 % .", "entity": [{"entity": "extracellular matrix", "entity_type": "Anatomy", "pos": [175, 195]}], "task": "NER"}
+{"text": "This effect was observed whether the cells had been treated with all - trans - RA in serum - free medium or in medium supplemented with heat - inactivated or acid - treated fetal bovine serum .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [37, 42]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [85, 90]}, {"entity": "fetal bovine serum", "entity_type": "Anatomy", "pos": [173, 191]}], "task": "NER"}
+{"text": "The growth of the cells was not inhibited under these conditions , except after treatment with 10 microM all - trans - RA in serum - free medium .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [18, 23]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [125, 130]}], "task": "NER"}
+{"text": "The reduction in collagenolytic activity was observed in viable cells as well as in conditioned medium .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [64, 69]}], "task": "NER"}
+{"text": "A 24 - h exposure of cells to all - trans - RA was sufficient to cause a 30 % decrease in the collagenolytic activity , and this inhibitory effect was reversible .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [21, 26]}], "task": "NER"}
+{"text": "The direct addition of all - trans - RA to conditioned medium had no effect on secreted collagenase activity .", "entity": [], "task": "NER"}
+{"text": "The apparent molecular weights of the collagenolytic enzymes were determined by electrophoresis of cell extracts and concentrated conditioned medium in type IV collagen - embedded polyacrylamide gels followed by renaturation and activation of the enzymes within the gels .", "entity": [{"entity": "cell extracts", "entity_type": "Anatomy", "pos": [99, 112]}], "task": "NER"}
+{"text": "Two major type IV collagenolytic metalloproteinases exhibiting molecular weights of 64 , 000 and 88 , 000 , respectively , were detected by this method .", "entity": [], "task": "NER"}
+{"text": "These two enzymes were also found to have specificity for gelatin .", "entity": [], "task": "NER"}
+{"text": "The Mr 64 , 000 enzyme could be extracted from viable cells ( presumably from the cell membrane ) by 2 % 1 - butanol .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [54, 59]}, {"entity": "cell membrane", "entity_type": "Anatomy", "pos": [82, 95]}], "task": "NER"}
+{"text": "Treatment with all - trans - RA decreased the level of these enzymes in the cellular , cell membrane , and conditioned medium compartments . ( ABSTRACT TRUNCATED AT 400 WORDS )", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [76, 84]}, {"entity": "cell membrane", "entity_type": "Anatomy", "pos": [87, 100]}], "task": "NER"}
+{"text": "Endoscopic injection therapy for acute upper GI bleeding .", "entity": [{"entity": "upper GI", "entity_type": "Anatomy", "pos": [39, 47]}], "task": "NER"}
+{"text": "In summary , we have found this technique to be useful in patients in whom coagulation therapy is not possible or effective .", "entity": [], "task": "NER"}
+{"text": "It must still be considered a technique which is undergoing evaluation .", "entity": [], "task": "NER"}
+{"text": "Prospective randomized trials comparing this therapy with other currently available therapies such a electrocoagulation , laser and conservative management must be completed to firmly define its place in treatment strategy for acute upper GI bleeding .", "entity": [{"entity": "upper GI", "entity_type": "Anatomy", "pos": [233, 241]}], "task": "NER"}
+{"text": "Effects of hypertension and sympathetic denervation on cerebral blood flow in newborn pigs .", "entity": [{"entity": "cerebral", "entity_type": "Anatomy", "pos": [55, 63]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [64, 69]}], "task": "NER"}
+{"text": "To investigate the potential role of sympathetic nerves in preventing pronounced increases in cerebral blood flow , we evaluated the effects of abrupt hypertension on the cerebral circulation of newborn pigs with intact cerebral sympathetic innervation and after cerebral sympathetic denervation .", "entity": [{"entity": "sympathetic nerves", "entity_type": "Anatomy", "pos": [37, 55]}, {"entity": "cerebral", "entity_type": "Anatomy", "pos": [94, 102]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [103, 108]}, {"entity": "cerebral", "entity_type": "Anatomy", "pos": [171, 179]}, {"entity": "cerebral", "entity_type": "Anatomy", "pos": [220, 228]}, {"entity": "cerebral", "entity_type": "Anatomy", "pos": [263, 271]}], "task": "NER"}
+{"text": "Epinephrine infusion was used to induce abrupt increases in mean ( + / - SEM ) arterial pressure ( innervated pigs , 62 + / - 3 mm of Hg to 115 + / - 3 mm of Hg ; denervated pigs , 71 + / - 4 mm of Hg to 132 + / - 4 mm of Hg ) that remained increased for the 3 minutes of the study .", "entity": [{"entity": "arterial", "entity_type": "Anatomy", "pos": [79, 87]}], "task": "NER"}
+{"text": "Abrupt hypertension increased blood flow to all brain regions .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [30, 35]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [48, 53]}], "task": "NER"}
+{"text": "In denervated pigs , the increased flow to the cerebrum was prolonged , compared with that in pigs with intact sympathetic innervation .", "entity": [{"entity": "cerebrum", "entity_type": "Anatomy", "pos": [47, 55]}], "task": "NER"}
+{"text": "Differences between pigs of the innervated and denervated groups were not apparent , with respect to blood flow to any other region ( caudate region , brain stem , cerebellum ) .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [101, 106]}, {"entity": "caudate region", "entity_type": "Anatomy", "pos": [134, 148]}, {"entity": "brain stem", "entity_type": "Anatomy", "pos": [151, 161]}, {"entity": "cerebellum", "entity_type": "Anatomy", "pos": [164, 174]}], "task": "NER"}
+{"text": "In newborn pigs , sympathetic nerves may attenuate hypertension - induced increases in blood flow to the cerebrum , but do not appear to affect flow to the rest of the brain .", "entity": [{"entity": "sympathetic nerves", "entity_type": "Anatomy", "pos": [18, 36]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [87, 92]}, {"entity": "cerebrum", "entity_type": "Anatomy", "pos": [105, 113]}, {"entity": "brain", "entity_type": "Anatomy", "pos": [168, 173]}], "task": "NER"}
+{"text": "Malate - citrate cycle during glycolysis and glutaminolysis in Ehrlich ascites tumor cells .", "entity": [{"entity": "Ehrlich ascites tumor cells", "entity_type": "Anatomy", "pos": [63, 90]}], "task": "NER"}
+{"text": "The malate - citrate cycle was studied during aerobic glycolysis and glutaminolysis in a strain of Ehrlich ascites tumor cells which showed a very low malate - aspartate shuttle system activity .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [89, 95]}, {"entity": "Ehrlich ascites tumor cells", "entity_type": "Anatomy", "pos": [99, 126]}], "task": "NER"}
+{"text": "The experimental approach includes : estimation of mitochondrial NAD [ P ] + - dependent malic enzyme activity ; respiratory activity of freshly harvested or fasted cells , and of isolated mitochondria ; and determination of the metabolites involved in the glycolytic and glutaminolytic pathways .", "entity": [{"entity": "mitochondrial", "entity_type": "Anatomy", "pos": [51, 64]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [165, 170]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [189, 201]}], "task": "NER"}
+{"text": "The results suggest that in this strain , the malate - citrate shuttle is not an effective pathway for transferring glycolytic reducing equivalents from cytosol to mitochondria .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [33, 39]}, {"entity": "cytosol", "entity_type": "Anatomy", "pos": [153, 160]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [164, 176]}], "task": "NER"}
+{"text": "Less than 15 % of the glucose uptake was affected by the 1 , 2 , 3 - benzenetricarboxylate inhibition of the malate - citrate shuttle .", "entity": [], "task": "NER"}
+{"text": "Moreover , in the presence of glucose , the malate - citrate cycle did not appear to play an important role in the glutaminolytic process .", "entity": [], "task": "NER"}
+{"text": "The present work supports and extends the finding of previous studies , since the results showed that the glucose metabolism depressed the oxidative processes in Ehrlich ascites tumor mitochondria , not only alone , but also in the presence of glutamine .", "entity": [{"entity": "Ehrlich ascites tumor", "entity_type": "Anatomy", "pos": [162, 183]}, {"entity": "mitochondria", "entity_type": "Anatomy", "pos": [184, 196]}], "task": "NER"}
+{"text": "Interestingly , the high glutamine uptake was maintained in the presence of glucose .", "entity": [], "task": "NER"}
+{"text": "N - methyl - N - nitrosourea - induced transformation of rat urothelial cells in vitro is not mediated by activation of ras oncogenes .", "entity": [{"entity": "urothelial cells", "entity_type": "Anatomy", "pos": [61, 77]}], "task": "NER"}
+{"text": "Adult rat urothelial cells were transformed in vitro following treatment with a single dose of N - methyl - N - nitrosourea ( MNU ) or MNU treatment followed by promotion with sodium saccharin .", "entity": [{"entity": "urothelial cells", "entity_type": "Anatomy", "pos": [10, 26]}], "task": "NER"}
+{"text": "This in vitro transformation process involves multiple steps : slow - growing ' pre - neoplastic ' epithelial foci are induced 70 - 100 days after MNU treatment and from such foci rapidly proliferating immortal cell lines were established , some of which became tumorigenic after a further latent period .", "entity": [{"entity": "' pre - neoplastic ' epithelial foci", "entity_type": "Anatomy", "pos": [78, 114]}, {"entity": "foci", "entity_type": "Anatomy", "pos": [175, 179]}, {"entity": "cell lines", "entity_type": "Anatomy", "pos": [211, 221]}], "task": "NER"}
+{"text": "A series of epithelial cell lines and a single fibroblast cell line established in this way were analysed for the presence of transforming genes by DNA transfection into NIH3T3 cells .", "entity": [{"entity": "epithelial cell lines", "entity_type": "Anatomy", "pos": [12, 33]}, {"entity": "fibroblast cell line", "entity_type": "Anatomy", "pos": [47, 67]}, {"entity": "NIH3T3 cells", "entity_type": "Anatomy", "pos": [170, 182]}], "task": "NER"}
+{"text": "None of the epithelial cell lines induced foci in a focus formation assay .", "entity": [{"entity": "epithelial cell lines", "entity_type": "Anatomy", "pos": [12, 33]}, {"entity": "foci", "entity_type": "Anatomy", "pos": [42, 46]}, {"entity": "focus", "entity_type": "Anatomy", "pos": [52, 57]}], "task": "NER"}
+{"text": "The single non - epithelial line induced foci and was found to contain an activated c - Ki - ras gene with a G - - - - A transition in codon 12 .", "entity": [{"entity": "non - epithelial line", "entity_type": "Anatomy", "pos": [11, 32]}, {"entity": "foci", "entity_type": "Anatomy", "pos": [41, 45]}], "task": "NER"}
+{"text": "To assay for the possible presence of transforming genes which were not active in a focus formation assay , two of the epithelial lines were analysed further by co - transfection with a dominant selectable marker , followed by selection and inoculation into nude mice .", "entity": [{"entity": "focus", "entity_type": "Anatomy", "pos": [84, 89]}, {"entity": "epithelial lines", "entity_type": "Anatomy", "pos": [119, 135]}], "task": "NER"}
+{"text": "No tumours were induced within the latent period for tumour production by control cells transfected with NIH3T3 cell DNA ( 40 - 60 days ) .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [3, 10]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [53, 59]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "NIH3T3 cell", "entity_type": "Anatomy", "pos": [105, 116]}], "task": "NER"}
+{"text": "These results suggest that there is cell type specificity for oncogene activation during in vitro rat bladder transformation initiated by a single carcinogen and that ras gene activation is not a necessary step in urothelial transformation in vitro .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [36, 40]}, {"entity": "bladder", "entity_type": "Anatomy", "pos": [102, 109]}, {"entity": "urothelial", "entity_type": "Anatomy", "pos": [214, 224]}], "task": "NER"}
+{"text": "Sensitivity analysis of the influence of source - term and environmental parameters on the radiological risk of coal - fired plants .", "entity": [], "task": "NER"}
+{"text": "A sensitivity analysis was undertaken to determine the influence of different source - term and environmental parameters on the radiological risks from a coal - fired plant ( CFP ) .", "entity": [], "task": "NER"}
+{"text": "It was found that the release rate of radionuclides and the effective release height most significantly influence radiological risk .", "entity": [], "task": "NER"}
+{"text": "Site characteristics , such as rain scavenging coefficients and food acquirement habits , have a lesser influence , and some parameters , such as time delay before ingestion of contaminated food , have practically no influence on the radiological impact of a CFP .", "entity": [], "task": "NER"}
+{"text": "The contribution to radiation risks of different exposure modes ( i . e . inhalation , ingestion and contact with ground surface ) were also analyzed , as well as of specific radionuclides and human body organs .", "entity": [{"entity": "body organs", "entity_type": "Anatomy", "pos": [199, 210]}], "task": "NER"}
+{"text": "Results of the sensitivity analysis were interpreted in terms of the characteristics of the fuel , facilities and site of a CFP .", "entity": [], "task": "NER"}
+{"text": "It is concluded that by proper choice of coal , furnace , ash filtration and stack height , as well as by proper siting , the radiological impact of a CFP can be drastically reduced .", "entity": [], "task": "NER"}
+{"text": "Antishock trousers : a collective review .", "entity": [], "task": "NER"}
+{"text": "Antishock trousers have become an integral part of emergency medical care for many traumatic and life - threatening emergencies .", "entity": [], "task": "NER"}
+{"text": "This article represents a summary of the current state of knowledge concerning the use of this device .", "entity": [], "task": "NER"}
+{"text": "A brief history of the development of antishock garments is discussed .", "entity": [], "task": "NER"}
+{"text": "This is followed by a discussion of human clinical studies and results of clinical research on hemodynamics , respiration , use in head injury , and effects on vascular hemostasis .", "entity": [{"entity": "head", "entity_type": "Anatomy", "pos": [131, 135]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [160, 168]}], "task": "NER"}
+{"text": "Indications , contraindications , complications , and recommended procedure for use are discussed .", "entity": [], "task": "NER"}
+{"text": "Based on randomized prospective studies , antishock garments have not , as yet , been shown to improve patient morbidity or mortality .", "entity": [], "task": "NER"}
+{"text": "Proper use of antishock garments requires an understanding of both their function and their limitations .", "entity": [], "task": "NER"}
+{"text": "Measurement of serum glycosylated proteins and glycosylated low density lipoprotein fraction in diabetes mellitus .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [15, 20]}], "task": "NER"}
+{"text": "A simple method was developed for estimating serum glycosylated protein levels using gel filtration with Bio - Gel P6 by determining the protein and sugar content in the void volume fraction .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [45, 50]}], "task": "NER"}
+{"text": "The glycosylated protein levels ( GSP ) correlated well with fasting blood sugar levels and glycosylated albumin level ( G - ALB ) determined by affinity chromatography with Blue Sepharose CL6B .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [69, 74]}], "task": "NER"}
+{"text": "The glycosylation level of heparin - citrate precipitable fraction of serum which predominantly contained low density lipoprotein ( G - LDL ) also correlated well with GSP and LDL - cholesterol levels .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [70, 75]}], "task": "NER"}
+{"text": "Significantly different values were obtained for GSP , G - ALB , and G - LDL between normals and diabetics .", "entity": [], "task": "NER"}
+{"text": "The origin of yolk - DNA in Xenopus laevis .", "entity": [{"entity": "yolk", "entity_type": "Anatomy", "pos": [14, 18]}], "task": "NER"}
+{"text": "Xenopus laevis serum and plasma was found to contain an average of 25 microgram DNA / ml .", "entity": [{"entity": "serum", "entity_type": "Anatomy", "pos": [15, 20]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [25, 31]}], "task": "NER"}
+{"text": "Isolated X . laevis oocytes incubated in medium containing 25 microgram DNA / ml labeled with either 125I , 32P or 14C and from three different sources ( bovine , E . coli and X . laevis ) , incorporated the label at an average rate of 0 . 11 ng . mm - 2 . hr - 1 .", "entity": [{"entity": "oocytes", "entity_type": "Anatomy", "pos": [20, 27]}], "task": "NER"}
+{"text": "Sucrose gradient fractionation of oocytes revealed that 40 - 75 % of the acid - precipitable label incorporated was associated with the yolk platelets .", "entity": [{"entity": "oocytes", "entity_type": "Anatomy", "pos": [34, 41]}, {"entity": "yolk platelets", "entity_type": "Anatomy", "pos": [136, 150]}], "task": "NER"}
+{"text": "Additional incubations of oocytes in unlabeled medium demonstrated that the DNA incorporated into the yolk platelets was undergoing turnover ; only 20 % of the yolk - associated DNA was still present after a one - week incubation .", "entity": [{"entity": "oocytes", "entity_type": "Anatomy", "pos": [26, 33]}, {"entity": "yolk platelets", "entity_type": "Anatomy", "pos": [102, 116]}, {"entity": "yolk", "entity_type": "Anatomy", "pos": [160, 164]}], "task": "NER"}
+{"text": "Our data suggest that yolk - DNA arises by the adventitious uptake of DNA present in the maternal serum by vitellogenic oocytes .", "entity": [{"entity": "yolk", "entity_type": "Anatomy", "pos": [22, 26]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [98, 103]}, {"entity": "oocytes", "entity_type": "Anatomy", "pos": [120, 127]}], "task": "NER"}
+{"text": "Low - level X - radiation effects on functional vascular changes in Syrian hamster cheek pouch epithelium during hydrocarbon carcinogenesis .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [48, 56]}, {"entity": "cheek pouch epithelium", "entity_type": "Anatomy", "pos": [83, 105]}], "task": "NER"}
+{"text": "Effects of repeated low - level X radiation on functional microvascular changes in hamster cheek pouch epithelium during and following carcinogenesis by 7 , 12 - dimethylbenz [ a ] anthracene ( DMBA ) were studied .", "entity": [{"entity": "microvascular", "entity_type": "Anatomy", "pos": [58, 71]}, {"entity": "cheek pouch epithelium", "entity_type": "Anatomy", "pos": [91, 113]}], "task": "NER"}
+{"text": "Prior studies showed enhancement of such carcinogenesis by repeated 20 rad head and neck X - radiation exposures , and it was proposed that one possible mechanism was radiogenic alteration of the functional microvasculature in a manner which favored subsequent tumor development .", "entity": [{"entity": "head", "entity_type": "Anatomy", "pos": [75, 79]}, {"entity": "neck", "entity_type": "Anatomy", "pos": [84, 88]}, {"entity": "microvasculature", "entity_type": "Anatomy", "pos": [207, 223]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [261, 266]}], "task": "NER"}
+{"text": "Hamsters were treated with either radiation , DMBA , radiation + DMBA , or no treatment .", "entity": [], "task": "NER"}
+{"text": "Animals were sacrificed at 3 - week intervals from 0 to 39 weeks after treatments began .", "entity": [], "task": "NER"}
+{"text": "Pouch vascular volume and permeability changes were studied by fractional distributions of radiotracers and were analyzed by a variety of statistical methods which explored the vascular parameters , treatment types , elapsed time , presence of the carcinogen , and histopathologic changes .", "entity": [{"entity": "Pouch vascular", "entity_type": "Anatomy", "pos": [0, 14]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [177, 185]}], "task": "NER"}
+{"text": "All treatments resulted in significant changes in vascular volume with time , while only DMBA treatments alone resulted in significant changes in vascular permeability with time .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [50, 58]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [146, 154]}], "task": "NER"}
+{"text": "Prior to the appearances of frank neoplasms , volumetric changes in DMBA only and radiation only groups were similar , while volume changes in DMBA + radiation groups increased slowly to a peak later than in other groups and then declined steadily to levels similar to the radiation only group .", "entity": [{"entity": "neoplasms", "entity_type": "Anatomy", "pos": [34, 43]}], "task": "NER"}
+{"text": "As in prior studies , there were significant vascular volume differences between DMBA and DMBA + radiation groups of tumor - bearing cheek pouches .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [45, 53]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [117, 122]}, {"entity": "cheek pouches", "entity_type": "Anatomy", "pos": [133, 146]}], "task": "NER"}
+{"text": "DMBA maxima were significantly higher than those of DMBA + radiation .", "entity": [], "task": "NER"}
+{"text": "Radiation significantly affected DMBA - associated vascular volume and permeability changes during carcinogenesis .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [51, 59]}], "task": "NER"}
+{"text": "Several possible explanations for the relationship of these changes to the enhancement of DMBA carcinogenesis include : radiation blocking normal capillary proliferative and / or dilatory responses to inflammation secondary to neoplastic changes ; radiation - induced focal increases in the pericapillary connective tissue histohematic barrier , stimulating angiogenesis but reducing nutrient diffusion ; radiation exposures sensitizing vascular endothelium to subsequent angiogenic stimulation from premalignant tissues ; DMBA vascular and epithelial effects partially or completely blocking radiation effects on epithelial and / or endothelial cells ; and radiation damage to vessel walls partially or fully inhibiting normal physiologic mechanisms of repairing DMBA damage to the vessels .", "entity": [{"entity": "capillary", "entity_type": "Anatomy", "pos": [146, 155]}, {"entity": "neoplastic", "entity_type": "Anatomy", "pos": [227, 237]}, {"entity": "pericapillary connective tissue", "entity_type": "Anatomy", "pos": [291, 322]}, {"entity": "histohematic barrier", "entity_type": "Anatomy", "pos": [323, 343]}, {"entity": "vascular endothelium", "entity_type": "Anatomy", "pos": [437, 457]}, {"entity": "premalignant tissues", "entity_type": "Anatomy", "pos": [500, 520]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [528, 536]}, {"entity": "epithelial", "entity_type": "Anatomy", "pos": [541, 551]}, {"entity": "epithelial", "entity_type": "Anatomy", "pos": [614, 624]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [634, 651]}, {"entity": "vessel walls", "entity_type": "Anatomy", "pos": [678, 690]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [783, 790]}], "task": "NER"}
+{"text": "Immunoglobulins associated with elevated riboflavin binding by plasma from cancer patients .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [63, 69]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [75, 81]}], "task": "NER"}
+{"text": "Plasma from 182 patients with different malignant diseases was tested for riboflavin binding by immunoglobulins , which have been recently identified as major carriers of this micronutrient .", "entity": [{"entity": "Plasma", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "malignant diseases", "entity_type": "Anatomy", "pos": [40, 58]}], "task": "NER"}
+{"text": "A wide range of binding ( 5 . 9 to 130 pmole / ml plasma ) was observed , and significant elevations were found for patients having breast cancer ( 21 . 2 + / - 1 . 9 , P less than 0 . 05 ) and melanoma ( 25 . 7 + / - 1 . 9 , P less than 0 . 001 ) compared to controls ( 15 . 5 + / - 1 . 9 ) .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [50, 56]}, {"entity": "breast cancer", "entity_type": "Anatomy", "pos": [132, 145]}, {"entity": "melanoma", "entity_type": "Anatomy", "pos": [194, 202]}], "task": "NER"}
+{"text": "The proteins responsible for a majority of the higher binding were identified as immunoglobulins , based on their elution from gel filtration columns and the removal of 57 - 88 % of the non - albumin binding by treating of plasma with Protein A - agarose .", "entity": [{"entity": "plasma", "entity_type": "Anatomy", "pos": [223, 229]}], "task": "NER"}
+{"text": "The binding was only weakly related to the total concentration of immunoglobulins ( r = 0 . 11 by linear regression analysis ) , however , and is apparently due to a subclass that is elevated in some types of cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [209, 215]}], "task": "NER"}
+{"text": "Elevated levels of these immunoglobulins may contribute to the lower urinary levels and clearance of riboflavin in cancer .", "entity": [{"entity": "urinary", "entity_type": "Anatomy", "pos": [69, 76]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [115, 121]}], "task": "NER"}
+{"text": "Postpartum rubella immunization : association with development of prolonged arthritis , neurological sequelae , and chronic rubella viremia .", "entity": [{"entity": "neurological", "entity_type": "Anatomy", "pos": [88, 100]}], "task": "NER"}
+{"text": "Six women developed chronic long - term arthropathy after postpartum immunization against rubella .", "entity": [], "task": "NER"}
+{"text": "All individuals developed acute polyarticular arthritis within 12 days to three weeks postimmunization and have had continuing chronic or recurrent arthralgia or arthritis for two to seven years after vaccination .", "entity": [], "task": "NER"}
+{"text": "Acute neurological manifestations , consisting of carpal tunnel syndrome or multiple paresthesiae , developed postvaccination in three women .", "entity": [{"entity": "neurological", "entity_type": "Anatomy", "pos": [6, 18]}], "task": "NER"}
+{"text": "Two have developed continuing active or chronic recurrent episodes of blurred vision , paresthesiae , and painful limb syndromes together with recurrent joint symptoms .", "entity": [{"entity": "limb", "entity_type": "Anatomy", "pos": [114, 118]}, {"entity": "joint", "entity_type": "Anatomy", "pos": [153, 158]}], "task": "NER"}
+{"text": "Chronic rubella viremia has been detected in peripheral blood mononuclear cell ( MNC ) populations in five of the six women up to six years after vaccination .", "entity": [{"entity": "peripheral blood mononuclear cell", "entity_type": "Anatomy", "pos": [45, 78]}, {"entity": "MNC", "entity_type": "Anatomy", "pos": [81, 84]}], "task": "NER"}
+{"text": "In addition rubella virus was isolated from breast milk MNCs in one individual at nine months postvaccination and from peripheral blood MNCs in two of four breast - fed infants studied at 12 - 18 months of age .", "entity": [{"entity": "breast milk MNCs", "entity_type": "Anatomy", "pos": [44, 60]}, {"entity": "peripheral blood MNCs", "entity_type": "Anatomy", "pos": [119, 140]}, {"entity": "breast", "entity_type": "Anatomy", "pos": [156, 162]}], "task": "NER"}
+{"text": "Immune responses to rubella virus studied at sequential intervals after vaccination correlated with development of rheumatologic and neurological manifestations .", "entity": [{"entity": "neurological", "entity_type": "Anatomy", "pos": [133, 145]}], "task": "NER"}
+{"text": "Cardiac gap junction configuration after an uncoupling treatment as a function of time .", "entity": [{"entity": "Cardiac", "entity_type": "Anatomy", "pos": [0, 7]}], "task": "NER"}
+{"text": "Rabbit ventricle either was fixed in glutaraldehyde without injury ( control ) or was injured before fixation , presumably causing electrical uncoupling of the gap junctions .", "entity": [{"entity": "ventricle", "entity_type": "Anatomy", "pos": [7, 16]}], "task": "NER"}
+{"text": "All tissue was then processed for freeze - fracture .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [4, 10]}], "task": "NER"}
+{"text": "Replicas of control gap junctions exhibited irregular packing of the P - face particles and E - face pits .", "entity": [], "task": "NER"}
+{"text": "Average center - to - center spacing of the particles was 10 . 5 nm .", "entity": [], "task": "NER"}
+{"text": "Tissue fixed 1 - 5 min after injury showed clumping of gap junctional particles and pits .", "entity": [{"entity": "Tissue", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Within the clumps , the particles and pits were hexagonally packed and the center - to - center spacing of the particles averaged 9 . 5 nm .", "entity": [], "task": "NER"}
+{"text": "In tissue fixed 15 - 30 min after injury , the clumps of gap junctional particles had coalesced into a homogeneous structure in most junctions .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [3, 9]}], "task": "NER"}
+{"text": "The packing of the particles and pits was hexagonal and the spacing of the particles averaged 9 . 5 nm .", "entity": [], "task": "NER"}
+{"text": "A few pieces of rabbit atrium were frozen without prior fixation or cryoprotection to try to assess the effect of glutarldehyde fixation on gap junction structure .", "entity": [{"entity": "pieces", "entity_type": "Anatomy", "pos": [6, 12]}, {"entity": "atrium", "entity_type": "Anatomy", "pos": [23, 29]}], "task": "NER"}
+{"text": "In this tissue the gap junctional particles were irregularly packed and their spacing averaged 10 . 0 nm .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [8, 14]}], "task": "NER"}
+{"text": "Absence of effect of prenatal ethanol on adult emotionality and ethanol consumption in rats .", "entity": [], "task": "NER"}
+{"text": "Lower peak blood ethanol concentrations after 1 and 2 g of ethanol per kg were found in pregnant rats than in virgin females .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [11, 16]}], "task": "NER"}
+{"text": "No significant differences in adult \" emotionality \" or ethanol consumption were found in rats exposed to prenatal alcohol and in pair - fed and untreated controls .", "entity": [], "task": "NER"}
+{"text": "Tropical splenomegaly syndrome in Zambia : further observations and effects of cycloguanil and proguanil .", "entity": [{"entity": "splenomegaly", "entity_type": "Anatomy", "pos": [9, 21]}], "task": "NER"}
+{"text": "Nineteen Zambian patients with the tropical splenomegaly syndrome and sinusoidal lymphocytosis on liver biopsy were studied .", "entity": [{"entity": "splenomegaly", "entity_type": "Anatomy", "pos": [44, 56]}, {"entity": "sinusoidal", "entity_type": "Anatomy", "pos": [70, 80]}, {"entity": "liver", "entity_type": "Anatomy", "pos": [98, 103]}], "task": "NER"}
+{"text": "The association of macrobulinaemia with the tropical splenomegaly syndrome has again been confirmed .", "entity": [{"entity": "splenomegaly", "entity_type": "Anatomy", "pos": [53, 65]}], "task": "NER"}
+{"text": "Sixteen patients were treated with antimalarials - 12 with cycloguanil pamoate alone , 3 with cycloguanil and proguanil , and 1 with proguanil alone .", "entity": [], "task": "NER"}
+{"text": "Twelve patients were observed for periods of sufficient length for the drug effect to be assessed , and in 11 there was a good response in terms of decrease in spleen size . Cycloguanil pamoate may be of value both for prophylaxis and treatment in areas where tropical splenomegaly syndrome is endemic .", "entity": [{"entity": "spleen", "entity_type": "Anatomy", "pos": [160, 166]}, {"entity": "splenomegaly", "entity_type": "Anatomy", "pos": [269, 281]}], "task": "NER"}
+{"text": "Regulation of glucosyl - and fructosyltransferase synthesis by continuous cultures of Streptococcus mutans .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [74, 82]}], "task": "NER"}
+{"text": "Streptococcus mutans strains Ingbritt , and its derivative B7 which had been passaged through monkeys , have been used to investigate how the synthesis of extracellular glucosyl - and fructosyltransferases is regulated .", "entity": [{"entity": "strains", "entity_type": "Anatomy", "pos": [21, 28]}, {"entity": "extracellular", "entity_type": "Anatomy", "pos": [155, 168]}], "task": "NER"}
+{"text": "The most active enzyme from carbon - limited continuous cultures was a fructosyltransferase ; enzymes catalysing the formation of water - insoluble glucans from sucrose were relatively inactive .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [56, 64]}], "task": "NER"}
+{"text": "Dextransucrase ( EC 2 . 4 . 1 . 5 ) , which catalyses soluble glucan synthesis , was most active in the supernatant fluid from cultures grown with excess glucose , fructose or sucrose , but full activity was detected only when the enzyme was incubated with both sucrose and dextran .", "entity": [{"entity": "supernatant", "entity_type": "Anatomy", "pos": [104, 115]}, {"entity": "cultures", "entity_type": "Anatomy", "pos": [127, 135]}], "task": "NER"}
+{"text": "Little dextransucrase activity was detected in carbon - limited cultures .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [64, 72]}], "task": "NER"}
+{"text": "It is concluded that glucosyl - and fructosyltransferases are constitutive enzymes in that they are synthesized at similar rates during growth with an excess of the substrate or of the products of the reactions which they catalyse .", "entity": [], "task": "NER"}
+{"text": "Although the Ingbritt strain was originally isolated from a carious lesion , it is now a poor source of glucosyltransferase activity .", "entity": [{"entity": "strain", "entity_type": "Anatomy", "pos": [22, 28]}, {"entity": "carious lesion", "entity_type": "Anatomy", "pos": [60, 74]}], "task": "NER"}
+{"text": "Glucosyltransferases were extremely active in cultures of a recent clinical isolate , strain 3209 , and were apparently induced during growth with excess glucose .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [46, 54]}, {"entity": "strain 3209", "entity_type": "Anatomy", "pos": [86, 97]}], "task": "NER"}
+{"text": "Scanning electron microscopy of vascular casts in experimental ocular vasoproliferation .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [32, 40]}, {"entity": "ocular", "entity_type": "Anatomy", "pos": [63, 69]}], "task": "NER"}
+{"text": "Scanning electron microscopy of vascular casts was used to investigate three experimental models of neovascularization .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [32, 40]}], "task": "NER"}
+{"text": "In each experimental situation , the casts provided a valuable three dimensional representation of the newly formed blood vessels and permitted subclassification of the vessels within normal and proliferating vascular networks .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [116, 129]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [169, 176]}, {"entity": "vascular networks", "entity_type": "Anatomy", "pos": [209, 226]}], "task": "NER"}
+{"text": "They defined also the predominant origin of new vessels from venules and capillaries , and enabled the evolution of proliferating vessels into arterioles and venules to be documented .", "entity": [{"entity": "vessels", "entity_type": "Anatomy", "pos": [48, 55]}, {"entity": "venules", "entity_type": "Anatomy", "pos": [61, 68]}, {"entity": "capillaries", "entity_type": "Anatomy", "pos": [73, 84]}, {"entity": "vessels", "entity_type": "Anatomy", "pos": [130, 137]}, {"entity": "arterioles", "entity_type": "Anatomy", "pos": [143, 153]}, {"entity": "venules", "entity_type": "Anatomy", "pos": [158, 165]}], "task": "NER"}
+{"text": "Although vascular casts must be interpreted with caution in light of the possibility of incomplete filling and other artifacts , they are a valuable tool in the study of ocular vasoproliferation .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [9, 17]}, {"entity": "ocular", "entity_type": "Anatomy", "pos": [170, 176]}], "task": "NER"}
+{"text": "Participation of p53 cellular tumour antigen in transformation of normal embryonic cells .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [21, 29]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [30, 36]}, {"entity": "embryonic cells", "entity_type": "Anatomy", "pos": [73, 88]}], "task": "NER"}
+{"text": "The cellular tumour antigen p53 is found at elevated levels in a wide variety of transformed cells ( for reviews see refs 1 , 2 ) .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [4, 12]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [13, 19]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [93, 98]}], "task": "NER"}
+{"text": "Very little is yet known about the precise relationship of p53 to malignant transformation .", "entity": [], "task": "NER"}
+{"text": "Although the increase in p53 levels could be a secondary by - product of the transformed state , it is equally possible that p53 is actively involved in altering cellular growth properties , especially as it has been implicated in the regulation of normal cell proliferation .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [162, 170]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [256, 260]}], "task": "NER"}
+{"text": "We sought to test whether p53 could behave in a manner similar to known genes in a biological test system , and we demonstrate here that p53 can cooperate with the activated Ha - ras oncogene to transform normal embryonic cells .", "entity": [{"entity": "embryonic cells", "entity_type": "Anatomy", "pos": [212, 227]}], "task": "NER"}
+{"text": "The resultant foci contain cells of a markedly altered morphology which produce high levels of p53 .", "entity": [{"entity": "foci", "entity_type": "Anatomy", "pos": [14, 18]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [27, 32]}], "task": "NER"}
+{"text": "Cell lines established from such foci elicit tumours in syngeneic animals .", "entity": [{"entity": "Cell lines", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "foci", "entity_type": "Anatomy", "pos": [33, 37]}, {"entity": "tumours", "entity_type": "Anatomy", "pos": [45, 52]}], "task": "NER"}
+{"text": "Interaction between cellular and viral genes in the expression of the RSV - induced transformation - specific cell - surface antigen VCSA .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [20, 28]}, {"entity": "cell - surface", "entity_type": "Anatomy", "pos": [110, 124]}], "task": "NER"}
+{"text": "Transformation of BHK hamster fibroblasts by an env - strain of Rous sarcoma virus ( RSV ) leads to the appearance at the cell surface of a virus - induced nonvirion antigen ( VCSA ) , specific for transformation , whose expression is controlled by the transforming src gene .", "entity": [{"entity": "BHK hamster fibroblasts", "entity_type": "Anatomy", "pos": [18, 41]}, {"entity": "cell surface", "entity_type": "Anatomy", "pos": [122, 134]}], "task": "NER"}
+{"text": "Previous work has shown that a rabbit anti - VCSA serum lyses specifically , in the presence of complement , 51Cr - labelled RSV - transformed cells from different animal species .", "entity": [{"entity": "serum lyses", "entity_type": "Anatomy", "pos": [50, 61]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [143, 148]}], "task": "NER"}
+{"text": "Now , by competition experiments with a panel of different unlabelled cells we show that the VCSA expressed on RSV - transformed hamster fibroblasts is a complex of at least three distinct antigenic specificities : ( 1 ) one expressed on all RSV - transformed fibroblasts , regardless their species and the subgroup or strain of the transforming virus ; ( 2 ) one cross - reacting with a cell - surface antigen ( CSA ) expressed at various degrees on untransformed avian fibroblasts , but not on mammalian fibroblasts ; ( 3 ) one species - specific , present only on RSV - transformed hamster fibroblasts .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [70, 75]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [137, 148]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [260, 271]}, {"entity": "cell - surface", "entity_type": "Anatomy", "pos": [388, 402]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [471, 482]}, {"entity": "mammalian fibroblasts", "entity_type": "Anatomy", "pos": [496, 517]}, {"entity": "fibroblasts", "entity_type": "Anatomy", "pos": [593, 604]}], "task": "NER"}
+{"text": "It is concluded that VCSA is a complex of several antigenic determinants , and that some of these differ in different cells transformed by RSV .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [118, 123]}], "task": "NER"}
+{"text": "This observation indicates that VCSA expression at the cell surface is likely to be the result of the interaction between the viral src gene product pp60src with host cell gene ( s ) or gene product ( s ) , rather than the simple expression of this molecule at the cell surface .", "entity": [{"entity": "cell surface", "entity_type": "Anatomy", "pos": [55, 67]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [167, 171]}, {"entity": "cell surface", "entity_type": "Anatomy", "pos": [265, 277]}], "task": "NER"}
+{"text": "Role of interleukin 1 in antigen - specific T cell proliferation .", "entity": [{"entity": "T cell", "entity_type": "Anatomy", "pos": [44, 50]}], "task": "NER"}
+{"text": "The role of interleukin 1 ( IL 1 ) in human antigen - specific T cell proliferation was examined .", "entity": [{"entity": "T cell", "entity_type": "Anatomy", "pos": [63, 69]}], "task": "NER"}
+{"text": "Nylon wool - purified T cells proliferated in the presence of autologous monocytes ( Mo . ) pulsed for 18 h with tetanus toxoid ( TT ) antigen ( Mo . TT ) .", "entity": [{"entity": "T cells", "entity_type": "Anatomy", "pos": [22, 29]}, {"entity": "autologous monocytes", "entity_type": "Anatomy", "pos": [62, 82]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [85, 87]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [145, 147]}], "task": "NER"}
+{"text": "Irradiation of Mo . TT with ultraviolet ( UV ) light ( 72 J / m2 ) abolished their capacity to support T cell proliferation and drastically reduced their capacity to secrete IL 1 after stimulation with Staphylococcus albus .", "entity": [{"entity": "Mo", "entity_type": "Anatomy", "pos": [15, 17]}, {"entity": "T cell", "entity_type": "Anatomy", "pos": [103, 109]}], "task": "NER"}
+{"text": "The defect in antigen presentation induced by UV irradiation of Mo . TT was reversed in a dose - dependent manner by the addition of two different preparations containing human interleukin 1 ( IL 1 ) .", "entity": [{"entity": "Mo", "entity_type": "Anatomy", "pos": [64, 66]}], "task": "NER"}
+{"text": "The first preparation consisted of supernatants of Mo . stimulated with Con A for 18 hr and in which Con A activity was blocked by alpha - D - methyl - mannoside ( Mo . - Con A - Sup ) .", "entity": [{"entity": "supernatants", "entity_type": "Anatomy", "pos": [35, 47]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [51, 53]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [164, 166]}], "task": "NER"}
+{"text": "The second preparation consisted of human IL 1 partially purified from supernatants of human peripheral blood mononuclear cells stimulated with S . albus .", "entity": [{"entity": "supernatants", "entity_type": "Anatomy", "pos": [71, 83]}, {"entity": "peripheral blood mononuclear cells", "entity_type": "Anatomy", "pos": [93, 127]}], "task": "NER"}
+{"text": "This IL 1 copurified with human leukocyte pyrogen ( LP ) and was termed IL 1 / LP .", "entity": [{"entity": "leukocyte", "entity_type": "Anatomy", "pos": [32, 41]}], "task": "NER"}
+{"text": "Both IL 1 - containing preparations enhanced the response of C57BL / 6 mouse thymocytes to phytohemagglutinin .", "entity": [{"entity": "thymocytes", "entity_type": "Anatomy", "pos": [77, 87]}], "task": "NER"}
+{"text": "A rabbit antibody to human IL 1 / LP inhibited the capacity of T cells to proliferate in response to Mo . TT and inhibited the capacity of Mo . - Con A - Sup to reconstitute the T cell response to UV - irradiated Mo . TT .", "entity": [{"entity": "T cells", "entity_type": "Anatomy", "pos": [63, 70]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [101, 103]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [139, 141]}, {"entity": "T cell", "entity_type": "Anatomy", "pos": [178, 184]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [213, 215]}], "task": "NER"}
+{"text": "IL 1 / LP was not necessary for T cells to recognize the immunogenic moiety presented by Mo . , because monolayers of UV - irradiated Mo . TT were equivalent to monolayers of unirradiated MO . TT in their capacity to adsorb TT - reactive T cells specifically .", "entity": [{"entity": "T cells", "entity_type": "Anatomy", "pos": [32, 39]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [89, 91]}, {"entity": "monolayers", "entity_type": "Anatomy", "pos": [104, 114]}, {"entity": "Mo", "entity_type": "Anatomy", "pos": [134, 136]}, {"entity": "monolayers", "entity_type": "Anatomy", "pos": [161, 171]}, {"entity": "MO", "entity_type": "Anatomy", "pos": [188, 190]}, {"entity": "T cells", "entity_type": "Anatomy", "pos": [238, 245]}], "task": "NER"}
+{"text": "Furthermore , the addition of rabbit antibody to IL 1 / LP did not interfere with the capacity of UV - irradiated Mo . TT to adsorb TT - reactive T cells .", "entity": [{"entity": "Mo", "entity_type": "Anatomy", "pos": [114, 116]}, {"entity": "T cells", "entity_type": "Anatomy", "pos": [146, 153]}], "task": "NER"}
+{"text": "The results obtained in this study indicate that IL 1 is involved in optimal antigen - driven proliferation of human T lymphocytes .", "entity": [{"entity": "T lymphocytes", "entity_type": "Anatomy", "pos": [117, 130]}], "task": "NER"}
+{"text": "Ca + + distribution after Na + pump inhibition in cultured neonatal rat myocardial cells .", "entity": [{"entity": "myocardial cells", "entity_type": "Anatomy", "pos": [72, 88]}], "task": "NER"}
+{"text": "The influence of inhibition of the Na + pump , with secondary stimulation of Na + - Ca + + exchange , on cellular Ca + + distribution is examined using the on - line scintillation disk technique and cultured neonatal rat myocardial cells .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [105, 113]}, {"entity": "myocardial cells", "entity_type": "Anatomy", "pos": [221, 237]}], "task": "NER"}
+{"text": "Under control conditions , La + + + displaced 78 . 1 + / - 1 . 13 % ( SEM ) of the total cell associated 45Ca .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [89, 93]}], "task": "NER"}
+{"text": "Application of 1 mm ouabain or reduction of [ K + ] o to 0 . 5 mM resulted in a net increase of 10 . 6 + / - 1 . 3 % and 13 . 8 + / - 2 % , respectively , in total cell - associated Ca + + .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [164, 168]}], "task": "NER"}
+{"text": "Of this added 45Ca , 75 . 9 + / - 2 . 7 % and 78 . 4 + / - 2 . 1 % , respectively remained La + + + - displaceable .", "entity": [], "task": "NER"}
+{"text": "The 45Ca - binding characteristics of isolated sarcolemma , prepared from the cultured neonatal rat myocardial cells using the gas dissection technique , were examined .", "entity": [{"entity": "sarcolemma", "entity_type": "Anatomy", "pos": [47, 57]}, {"entity": "myocardial cells", "entity_type": "Anatomy", "pos": [100, 116]}], "task": "NER"}
+{"text": "When treated with either ouabain or low [ K + ] o solutions , sarcolemmal 45Ca binding did not change .", "entity": [{"entity": "sarcolemmal", "entity_type": "Anatomy", "pos": [62, 73]}], "task": "NER"}
+{"text": "This result indicates that functional , intact tissue is necessary to observe the Ca + + increase .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [47, 53]}], "task": "NER"}
+{"text": "Treatment of the cells with verapamil before and during ouabain exposure failed to inhibit the ouabain - induced increase in cell - associated 45Ca .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [17, 22]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [125, 129]}], "task": "NER"}
+{"text": "The evidence indicates that inhibition of the Na + - pump , and secondary stimulation of Na + - Ca + + exchange , result in a net increase of 11 - 15 % in cell - associated Ca + + , 78 % of which remains La + + + - displaceable and is , therefore , localized to the sarcolemma - glycocalyx complex .", "entity": [{"entity": "sarcolemma", "entity_type": "Anatomy", "pos": [266, 276]}, {"entity": "glycocalyx", "entity_type": "Anatomy", "pos": [279, 289]}], "task": "NER"}
+{"text": "Oesophageal candidiasis and croup in a child with defective neutrophil motility .", "entity": [{"entity": "Oesophageal", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "neutrophil", "entity_type": "Anatomy", "pos": [60, 70]}], "task": "NER"}
+{"text": "Severe oesophageal candidiasis and croup due to involvement of the larynx developed insidiously in a girl aged 20 months .", "entity": [{"entity": "oesophageal", "entity_type": "Anatomy", "pos": [7, 18]}, {"entity": "larynx", "entity_type": "Anatomy", "pos": [67, 73]}], "task": "NER"}
+{"text": "There had been delayed separation of the umbilical cord and repeated infections associated with a defect of neutrophil motility .", "entity": [{"entity": "umbilical cord", "entity_type": "Anatomy", "pos": [41, 55]}, {"entity": "neutrophil", "entity_type": "Anatomy", "pos": [108, 118]}], "task": "NER"}
+{"text": "The significance of the early clinical features was not fully appreciated and the diagnosis considered only when stricture of the oesophagus became evident .", "entity": [{"entity": "oesophagus", "entity_type": "Anatomy", "pos": [130, 140]}], "task": "NER"}
+{"text": "She was treated with oral ketoconazole 100 mg daily .", "entity": [{"entity": "oral", "entity_type": "Anatomy", "pos": [21, 25]}], "task": "NER"}
+{"text": "After one month ' s treatment there was striking radiological improvement apart from the persistence of the oesophageal stricture .", "entity": [{"entity": "oesophageal", "entity_type": "Anatomy", "pos": [108, 119]}], "task": "NER"}
+{"text": "The croup resolved completely but there was only partial relief of dysphagia because of the residual stricture .", "entity": [], "task": "NER"}
+{"text": "We would emphasis that candidiasis should be anticipated and treated vigorously in children with such a defect of neutrophil motility .", "entity": [{"entity": "neutrophil", "entity_type": "Anatomy", "pos": [114, 124]}], "task": "NER"}
+{"text": "The effect of translocations on the cellular myc gene in Burkitt lymphomas .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [36, 44]}, {"entity": "Burkitt lymphomas", "entity_type": "Anatomy", "pos": [57, 74]}], "task": "NER"}
+{"text": "Chromosomal translocations are found to be a characteristic feature of Burkitt lymphomas .", "entity": [{"entity": "Chromosomal", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "Burkitt lymphomas", "entity_type": "Anatomy", "pos": [71, 88]}], "task": "NER"}
+{"text": "Similar translocations are found in mouse plasmacytomas and both diseases involve interchanges between one of the immunoglobulin loci and DNA in the vicinity of the myc gene .", "entity": [{"entity": "plasmacytomas", "entity_type": "Anatomy", "pos": [42, 55]}], "task": "NER"}
+{"text": "The structure of the myc gene has been elucidated from studies on translocated versions of the gene .", "entity": [], "task": "NER"}
+{"text": "Activation of the myc gene may play a role in transformation by promoting growth of the cells bearing the rearranged chromosomes .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [88, 93]}, {"entity": "chromosomes", "entity_type": "Anatomy", "pos": [117, 128]}], "task": "NER"}
+{"text": "[ Suppurated acute obstructive cholangitis . Anatomoclinical and therapeutic aspects ] .", "entity": [], "task": "NER"}
+{"text": "A total of 134 cases are discussed , with suppurated acute obstructive angiocholitis , that underwent surgical treatment over a period of 10 years , representing 12 , 8 % of the total number of organic obstructions of the hepato - choledocus .", "entity": [{"entity": "hepato - choledocus", "entity_type": "Anatomy", "pos": [222, 241]}], "task": "NER"}
+{"text": "From the standpoint of the etiopathogenic mechanisms the angiocholitis was determined by biliary lithiasis in 59 cases , by sclerosis of the Oddi sphincter in 5 cases , by postoperative cicatriceal stenosis of the main biliary pathway in 2 cases , by hepatic hydatitosis in 16 cases , by Vater ampuloma in 10 cases by cancers of the main biliary pathway in 40 cases and by the congenital cyst of the choledocus in one case .", "entity": [{"entity": "Oddi sphincter", "entity_type": "Anatomy", "pos": [141, 155]}, {"entity": "hepatic", "entity_type": "Anatomy", "pos": [251, 258]}, {"entity": "cancers", "entity_type": "Anatomy", "pos": [318, 325]}, {"entity": "cyst", "entity_type": "Anatomy", "pos": [388, 392]}, {"entity": "choledocus", "entity_type": "Anatomy", "pos": [400, 410]}], "task": "NER"}
+{"text": "The high frequency was noted , of the severe forms of ictero - uremigenic angiocholitis ( representing 68 cases , or 50 , 7 % of the total , with a death rate of 34 % ) .", "entity": [], "task": "NER"}
+{"text": "Medico - surgical treatment should be performed as early as possible , and it must be intensive , complex , and adapted to the anatomo - clinical forms .", "entity": [], "task": "NER"}
+{"text": "The authors performed evacuation choledocotomy with external draining in 22 cases ( 3 deaths ) , and choledoco - duodenal anastomosis in 46 cases ( 10 deaths ) , choledoco - jejunostomia in 3 cases , Oddi sphincterotomia in 12 cases ( 2 deaths ) ampulectomia in 5 cases ( 2 deaths ) .", "entity": [], "task": "NER"}
+{"text": "Peripheral bilio - hepatodigestive anastomoses were performed in 40 cases with 5 deaths .", "entity": [], "task": "NER"}
+{"text": "[ Reactive states among psychopathic personalities of different clinical groups ] .", "entity": [], "task": "NER"}
+{"text": "On the basis of a clinical follow - up of 71 psychopaths with manifestations of reactive psychosis , the authors established the clinico - typological characteristics of both groups of pathology and the system of correlations between them .", "entity": [], "task": "NER"}
+{"text": "They also described the structure of the psychopathic and psychogenic syndromes , the type of psychopathic personality reaction and the form of psychogenic responses and proved statistically their close interrelationship .", "entity": [], "task": "NER"}
+{"text": "Data were obtained on some general regularities of interrelations of reactive psychoses with a psychopathic background which are important for the prognosis , prophylaxis and therapy of reactive states .", "entity": [], "task": "NER"}
+{"text": "Inhibition by N - ( phosphonacetyl ) - L - aspartate of Ehrlich ascites tumour growth and glucose transport .", "entity": [{"entity": "Ehrlich ascites tumour", "entity_type": "Anatomy", "pos": [56, 78]}], "task": "NER"}
+{"text": "N - ( Phosphonacetyl ) - L - aspartate ( PALA ) suppressed the growth of Ehrlich ascites tumour cells in vivo in a dose - dependent manner .", "entity": [{"entity": "Ehrlich ascites tumour cells", "entity_type": "Anatomy", "pos": [73, 101]}], "task": "NER"}
+{"text": "Simultaneously as the growth rate decreased , the cellular uptake of glucose and the density of a class of glucose - reversible binding sites for cytochalasin B on the cell surface were also found to be reduced .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [50, 58]}, {"entity": "cell surface", "entity_type": "Anatomy", "pos": [168, 180]}], "task": "NER"}
+{"text": "There is a highly significant correlation between the magnitude of changes in the number of cytochalasin B binding sites and the magnitude of changes in glucose uptake .", "entity": [], "task": "NER"}
+{"text": "The physiological significance of these observations are discussed .", "entity": [], "task": "NER"}
+{"text": "Effects of 3 - chloromethylthiochromone - 1 , 1 - dioxide on nucleic acid , protein , and aerobic and anaerobic metabolism of Ehrlich ascites tumor cells .", "entity": [{"entity": "Ehrlich ascites tumor cells", "entity_type": "Anatomy", "pos": [126, 153]}], "task": "NER"}
+{"text": "3 - Chloromethylthiochromone - 1 , 1 - dioxide was observed to be a potent inhibitor of Ehrlich ascites carcinoma growth and a moderate inhibitor of P - 388 lymphocytic leukemia growth at 10 mg / kg / day .", "entity": [{"entity": "Ehrlich ascites carcinoma", "entity_type": "Anatomy", "pos": [88, 113]}, {"entity": "P - 388 lymphocytic leukemia", "entity_type": "Anatomy", "pos": [149, 177]}], "task": "NER"}
+{"text": "Preliminary in vitro studies showed that the agents significantly inhibited RNA and DNA synthesis in Ehrlich ascites cells .", "entity": [{"entity": "Ehrlich ascites cells", "entity_type": "Anatomy", "pos": [101, 122]}], "task": "NER"}
+{"text": "In vivo studies after dosing on Days 6 , 7 , and 8 demonstrated the same reductions in nucleic acid synthesis and a moderate reduction in protein synthesis .", "entity": [], "task": "NER"}
+{"text": "The primary site of nucleic acid synthesis , which was blocked by 3 - chloromethylthiochromone , was at orotidine monophosphate decarboxylase in the primidine pathway .", "entity": [], "task": "NER"}
+{"text": "Other enzymes , in anaerobic and aerobic glycolysis , which were blocked include hexokinase , phosphofructokinase , succinic and alpha - ketoglutarate dehydrogenases , as well as States 3 and 4 of oxidative phosphorylation .", "entity": [], "task": "NER"}
+{"text": "An unusual case of benign mucous membrane pemphigoid .", "entity": [{"entity": "mucous membrane", "entity_type": "Anatomy", "pos": [26, 41]}], "task": "NER"}
+{"text": "This case of benign mucous membrane pemphigoid ( BMMP ) is unusual in that blistering , scarring lesions were confined to the skin for 15 years before mucous membranes were involved .", "entity": [{"entity": "mucous membrane", "entity_type": "Anatomy", "pos": [20, 35]}, {"entity": "lesions", "entity_type": "Anatomy", "pos": [97, 104]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [126, 130]}, {"entity": "mucous membranes", "entity_type": "Anatomy", "pos": [151, 167]}], "task": "NER"}
+{"text": "The onset of this disorder at the age of 38 is also unusual .", "entity": [], "task": "NER"}
+{"text": "Detailed immunological investigation was performed on this patient but the results in no way clarify the present confusion regarding the immunopathological processes in BMMP related to those operative in bullous pemphigoid .", "entity": [], "task": "NER"}
+{"text": "Mast cell heparin stimulates migration of capillary endothelial cells in vitro .", "entity": [{"entity": "Mast cell", "entity_type": "Anatomy", "pos": [0, 9]}, {"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [42, 69]}], "task": "NER"}
+{"text": "Migration of capillary endothelial cells is an important component of angiogenesis in vivo .", "entity": [{"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [13, 40]}], "task": "NER"}
+{"text": "Increased numbers of mast cells have been associated with several types of angiogenesis .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [21, 31]}], "task": "NER"}
+{"text": "We have used a quantitative assay in vitro to demonstrate that mast cells release a factor that significantly increases bovine capillary endothelial cell migration .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [63, 73]}, {"entity": "capillary endothelial cell", "entity_type": "Anatomy", "pos": [127, 153]}], "task": "NER"}
+{"text": "The factor is present in medium conditioned by mast cells as well as lysates of mast cells .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [47, 57]}, {"entity": "mast cells", "entity_type": "Anatomy", "pos": [80, 90]}], "task": "NER"}
+{"text": "The stimulatory effect of mast cells on migration is specific for capillary endothelial cells .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [26, 36]}, {"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [66, 93]}], "task": "NER"}
+{"text": "Furthermore , mast cells have no mitogenic activity for capillary endothelial cells .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [14, 24]}, {"entity": "capillary endothelial cells", "entity_type": "Anatomy", "pos": [56, 83]}], "task": "NER"}
+{"text": "Of all the secretory products of mast cells tested , only heparin stimulated capillary endothelial cell migration in vitro .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [33, 43]}, {"entity": "capillary endothelial cell", "entity_type": "Anatomy", "pos": [77, 103]}], "task": "NER"}
+{"text": "Heparin preparations from a variety of sources stimulated capillary endothelial cell migration to the same degree but did not stimulate migration of several other cell types .", "entity": [{"entity": "capillary endothelial cell", "entity_type": "Anatomy", "pos": [58, 84]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [163, 167]}], "task": "NER"}
+{"text": "The migration activity of heparin and mast cell conditioned medium was blocked by specific antagonists of heparin ( protamine and heparinase ) , but not by chondroitinase ABC .", "entity": [{"entity": "mast cell", "entity_type": "Anatomy", "pos": [38, 47]}], "task": "NER"}
+{"text": "The migration activity of mast cell conditioned medium was resistant to heat ( 100 degrees C ) and incubation with proteolytic enzymes .", "entity": [{"entity": "mast cell", "entity_type": "Anatomy", "pos": [26, 35]}], "task": "NER"}
+{"text": "These results suggest that the role of mast cells in angiogenesis may be to enhance migration of the endothelial cells of growing capillaries .", "entity": [{"entity": "mast cells", "entity_type": "Anatomy", "pos": [39, 49]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [101, 118]}, {"entity": "capillaries", "entity_type": "Anatomy", "pos": [130, 141]}], "task": "NER"}
+{"text": "Cancer progression and p53 .", "entity": [{"entity": "Cancer", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "In a complex organism , somatic cells are under intermittent selection pressure for the emergence of mutants that can survive environmental insults and that can grow autonomously despite adverse conditions .", "entity": [{"entity": "somatic cells", "entity_type": "Anatomy", "pos": [24, 37]}], "task": "NER"}
+{"text": "Repeated rounds of mutation , selection , and proliferation may lead to cancer .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [72, 78]}], "task": "NER"}
+{"text": "The organism prevents malignant transformation by assuring accurate DNA repair before cell division , by forcing the death of cells with excessive DNA damage , and by placing limits on the replicative lifespans of most somatic cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [86, 90]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [126, 131]}, {"entity": "somatic cells", "entity_type": "Anatomy", "pos": [219, 232]}], "task": "NER"}
+{"text": "The p53 gene is a \" guardian of the genome \" - - it regulates multiple components of the DNA damage control response and promotes cellular senescence .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [130, 138]}], "task": "NER"}
+{"text": "Disabling mutations and deletions of p53 occur in 50 % of human tumours .", "entity": [{"entity": "tumours", "entity_type": "Anatomy", "pos": [64, 71]}], "task": "NER"}
+{"text": "p53 - deficient cancers are often unstable , aggressive , and resistant to therapy .", "entity": [{"entity": "p53 - deficient cancers", "entity_type": "Anatomy", "pos": [0, 23]}], "task": "NER"}
+{"text": "The Met proto - oncogene mesenchymal to epithelial cell conversion .", "entity": [{"entity": "mesenchymal", "entity_type": "Anatomy", "pos": [25, 36]}, {"entity": "epithelial cell", "entity_type": "Anatomy", "pos": [40, 55]}], "task": "NER"}
+{"text": "Coexpression of the human Met receptor and its ligand , hepatocyte growth factor / scatter factor ( HGF / SF ) , in NIH 3T3 fibroblasts causes the cells to become tumorigenic in nude mice .", "entity": [{"entity": "NIH 3T3 fibroblasts", "entity_type": "Anatomy", "pos": [116, 135]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [147, 152]}], "task": "NER"}
+{"text": "The resultant tumors display lumen - like morphology , contain carcinoma - like focal areas with intercellular junctions resembling desmosomes , and coexpress epithelial ( cytokeratin ) and mesenchymal ( vimentin ) cytoskeletal markers .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [14, 20]}, {"entity": "lumen", "entity_type": "Anatomy", "pos": [29, 34]}, {"entity": "carcinoma - like focal areas", "entity_type": "Anatomy", "pos": [63, 91]}, {"entity": "intercellular junctions", "entity_type": "Anatomy", "pos": [97, 120]}, {"entity": "desmosomes", "entity_type": "Anatomy", "pos": [132, 142]}, {"entity": "epithelial", "entity_type": "Anatomy", "pos": [159, 169]}, {"entity": "mesenchymal", "entity_type": "Anatomy", "pos": [190, 201]}, {"entity": "cytoskeletal", "entity_type": "Anatomy", "pos": [215, 227]}], "task": "NER"}
+{"text": "The tumor cells also display enhanced expression of desmosomal and tight - junction proteins .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [4, 15]}, {"entity": "desmosomal", "entity_type": "Anatomy", "pos": [52, 62]}, {"entity": "tight - junction", "entity_type": "Anatomy", "pos": [67, 83]}], "task": "NER"}
+{"text": "The apparent mesenchymal to epithelial conversion of the tumor cells mimics the conversion that occurs during embryonic kidney development , suggesting that Met - HGF / SF signaling plays a role in this process as well as in tumors that express both epithelial and mesenchymal markers .", "entity": [{"entity": "mesenchymal", "entity_type": "Anatomy", "pos": [13, 24]}, {"entity": "epithelial", "entity_type": "Anatomy", "pos": [28, 38]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [57, 68]}, {"entity": "embryonic kidney", "entity_type": "Anatomy", "pos": [110, 126]}, {"entity": "tumors", "entity_type": "Anatomy", "pos": [225, 231]}, {"entity": "epithelial", "entity_type": "Anatomy", "pos": [250, 260]}, {"entity": "mesenchymal", "entity_type": "Anatomy", "pos": [265, 276]}], "task": "NER"}
+{"text": "Ultraviolet B irradiation promotes tumorigenic and metastatic properties in primary cutaneous melanoma via induction of interleukin 8 .", "entity": [{"entity": "primary cutaneous melanoma", "entity_type": "Anatomy", "pos": [76, 102]}], "task": "NER"}
+{"text": "UV radiation has been shown to play a role in the initiation of human cutaneous melanoma , but its role in the development of malignant melanoma to the metastatic state is not very well defined .", "entity": [{"entity": "cutaneous melanoma", "entity_type": "Anatomy", "pos": [70, 88]}, {"entity": "malignant melanoma", "entity_type": "Anatomy", "pos": [126, 144]}], "task": "NER"}
+{"text": "Although previous studies have concentrated on the effect of UV - B on the host immune response , the effect of UV - B on the tumor cells was not elucidated .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [126, 137]}], "task": "NER"}
+{"text": "Here we show that UV - B can induce interleukin 8 ( IL - 8 ) mRNA and protein secretion in human cutaneous melanoma with negligible expression of IL - 8 .", "entity": [{"entity": "cutaneous melanoma", "entity_type": "Anatomy", "pos": [97, 115]}], "task": "NER"}
+{"text": "UV - B - induced IL - 8 was constitutively expressed 60 days after irradiation in tumors implanted in mice .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [82, 88]}], "task": "NER"}
+{"text": "Induction of IL - 8 was UV - B dose dependent and blocked by cyclohexamide , indicating that de novo protein synthesis is required for its expression .", "entity": [], "task": "NER"}
+{"text": "The UV - irradiated cells demonstrated enhanced tumorigenicity and metastatic potential in nude mice .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [20, 25]}], "task": "NER"}
+{"text": "The increase in tumorigenicity and metastatic ability could be explained by the increase in Mr 72 , 000 type IV collagenase activity and angiogenesis attributed to the induction of IL - 8 after irradiation .", "entity": [], "task": "NER"}
+{"text": "The acquisition of the metastatic phenotype induced by UV - B could not be attributed to abnormalities in the p53 or MTS - 1 ( p16INK4 ) genes .", "entity": [], "task": "NER"}
+{"text": "To the best of our knowledge , this is the first report to show that UV - B can increase the aggressiveness of human cutaneous melanoma for growth and metastasis .", "entity": [{"entity": "cutaneous melanoma", "entity_type": "Anatomy", "pos": [117, 135]}], "task": "NER"}
+{"text": "The LHRH pulse generator : a mediobasal hypothalamic location .", "entity": [{"entity": "mediobasal hypothalamic", "entity_type": "Anatomy", "pos": [29, 52]}], "task": "NER"}
+{"text": "The location and mechanism of LHRH pulse generator are discussed based on our series of experiments .", "entity": [], "task": "NER"}
+{"text": "Suckling stimulus is a novel stimulus that inhibits LH pulses without any cooperation from ovarian steroids , unlike other stimuli such as stress , photoperiod etc .", "entity": [{"entity": "ovarian", "entity_type": "Anatomy", "pos": [91, 98]}], "task": "NER"}
+{"text": "It is directly involved in suppressing the activity of the LHRH pulse generator .", "entity": [], "task": "NER"}
+{"text": "The information from teats suckled by pups or babies is conveyed dorsally to the mediobasal hypothalamus ( MBH ) , where the LHRH pulse generator may be located .", "entity": [{"entity": "mediobasal hypothalamus", "entity_type": "Anatomy", "pos": [81, 104]}, {"entity": "MBH", "entity_type": "Anatomy", "pos": [107, 110]}], "task": "NER"}
+{"text": "Experiments using various types of deafferentation and fetal brain tissue transplantation confirmed that the LHRH pulse generator is located in the MBH and suggested that LHRH pulse generator consists of nonLHRH neurons .", "entity": [{"entity": "fetal brain tissue", "entity_type": "Anatomy", "pos": [55, 73]}, {"entity": "MBH", "entity_type": "Anatomy", "pos": [148, 151]}, {"entity": "neurons", "entity_type": "Anatomy", "pos": [212, 219]}], "task": "NER"}
+{"text": "Endogenous excitatory amino acid is one of the possible neurotransmitters that regulate LHRH release at the nerve terminal in ME .", "entity": [{"entity": "nerve terminal", "entity_type": "Anatomy", "pos": [108, 122]}], "task": "NER"}
+{"text": "Cancer metastasis : negative regulation by an invasion - suppressor complex .", "entity": [{"entity": "Cancer", "entity_type": "Anatomy", "pos": [0, 6]}], "task": "NER"}
+{"text": "Invasion is the hallmark of tumor malignancy .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [28, 33]}], "task": "NER"}
+{"text": "We situate invasion within microecosystems comprising neoplastic cells as well as host cells .", "entity": [{"entity": "neoplastic cells", "entity_type": "Anatomy", "pos": [54, 70]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [87, 92]}], "task": "NER"}
+{"text": "Modulation of invasion within such systems is ascribed to balances between promoter and suppressor pathways .", "entity": [], "task": "NER"}
+{"text": "The E - cadherin / alpha - , beta - , gamma - catenin complex has an invasion - suppressor function as evidenced by transfections either with sense cDNA encoding these molecules or with antisense cDNA inhibiting their expression .", "entity": [], "task": "NER"}
+{"text": "Loss of heterozygosity at the E - Cadherin ( uvo ) locus has been reported , but mutations in the E - cadherin gene seem to be rare .", "entity": [], "task": "NER"}
+{"text": "Downregulation of E - cadherin occurred at the level of transcription or of mRNA stability .", "entity": [], "task": "NER"}
+{"text": "Ex vivo cultures from invasive tumors or metastases produced cells that were homogeneously E - cadherin - positive and noninvasive in vitro .", "entity": [{"entity": "cultures", "entity_type": "Anatomy", "pos": [8, 16]}, {"entity": "invasive tumors", "entity_type": "Anatomy", "pos": [22, 37]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [41, 51]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [61, 66]}], "task": "NER"}
+{"text": "These observations have led to the idea that factors in the host downmodulate the E - cadherin complex and promote invasion most probably in a transient way .", "entity": [], "task": "NER"}
+{"text": "Heparin - steroid conjugates : new angiogenesis inhibitors with antitumor activity in mice .", "entity": [{"entity": "antitumor", "entity_type": "Anatomy", "pos": [64, 73]}], "task": "NER"}
+{"text": "Inhibitors of angiogenesis hold potential in the treatment of cancer and other diseases where the disease is caused or maintained by the inappropriate growth of blood vessels .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [62, 68]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [161, 174]}], "task": "NER"}
+{"text": "In the present study , a novel inhibitor of angiogenesis was synthesized by covalently linking a nonanticoagulating derivative of heparin , heparin adipic hydrazide ( HAH ) , by an acid - labile bond to the antiangiogenic steroid , cortisol .", "entity": [], "task": "NER"}
+{"text": "The rationale was that the heparin derivative , which binds to sulfated polyanion receptors on endothelial cells , should concentrate the steroid on the surface of vascular endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [95, 112]}, {"entity": "surface", "entity_type": "Anatomy", "pos": [153, 160]}, {"entity": "vascular endothelial cells", "entity_type": "Anatomy", "pos": [164, 190]}], "task": "NER"}
+{"text": "Endocytosis of the conjugate and decomposition of the acid - labile linkage inside lysosomes and other acidic intracellular compartments should then lead to release of the cortisol and expression of its antiproliferative activity .", "entity": [{"entity": "lysosomes", "entity_type": "Anatomy", "pos": [83, 92]}, {"entity": "intracellular compartments", "entity_type": "Anatomy", "pos": [110, 136]}], "task": "NER"}
+{"text": "Analysis of the stability of HAH - cortisol showed that it was stable at pH 7 . 4 and broke down rapidly ( t1 / 2 15 min ) at pH 4 . 8 at 37 degrees C .", "entity": [], "task": "NER"}
+{"text": "Treatment of murine pulmonary capillary endothelial cells with HAH - cortisol at 10 ( - 5 ) M ( with respect to cortisol ) suppressed their DNA synthesis by 50 % and inhibited their migration into wounded areas of confluent monolayers .", "entity": [{"entity": "pulmonary capillary endothelial cells", "entity_type": "Anatomy", "pos": [20, 57]}, {"entity": "wounded areas", "entity_type": "Anatomy", "pos": [197, 210]}, {"entity": "monolayers", "entity_type": "Anatomy", "pos": [224, 234]}], "task": "NER"}
+{"text": "HAH - cortisol at 10 ( - 4 ) M ( with respect to cortisol ) did not suppress the DNA synthesis of Lewis lung carcinoma cells .", "entity": [{"entity": "Lewis lung carcinoma cells", "entity_type": "Anatomy", "pos": [98, 124]}], "task": "NER"}
+{"text": "Daily i . p . injections of HAH - cortisol into mice bearing s . c . sponge implants retarded vascularization of the sponge , and injections directly into the sponge abolished vascularization for as long as the injections were continued .", "entity": [], "task": "NER"}
+{"text": "Daily i . v . injections of HAH - cortisol at doses causing no apparent toxicity retarded the growth of solid s . c .", "entity": [{"entity": "i . v .", "entity_type": "Anatomy", "pos": [6, 13]}], "task": "NER"}
+{"text": "Lewis lung carcinomas in mice by up to 65 % .", "entity": [{"entity": "Lewis lung carcinomas", "entity_type": "Anatomy", "pos": [0, 21]}], "task": "NER"}
+{"text": "In all of these assays , equivalent treatments with a mixture of the HAH plus cortisol was significantly less effective .", "entity": [], "task": "NER"}
+{"text": "The antiproliferative effect of HAH - cortisol on endothelial cells appeared independent of the glucocorticoid activity of the steroid since HAH conjugated to 5 beta - pregnane - 3 alpha , 17 alpha , 21 - triol - 20 - one , a steroid lacking glucocorticoid or mineralocorticoid activity , was even more effective at inhibiting DNA synthesis by murine pulmonary capillary endothelial cells than was HAH - cortisol .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [50, 67]}, {"entity": "pulmonary capillary endothelial cells", "entity_type": "Anatomy", "pos": [351, 388]}], "task": "NER"}
+{"text": "In conclusion , HAH - cortisol represents the prototype of a new class of angiogenesis inhibitors for the treatment of cancer and other angiogenic diseases .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [119, 125]}], "task": "NER"}
+{"text": "Colorimetrical rate assay for urinary dipeptidyl peptidase IV ( DPPIV ) activity using a new substrate .", "entity": [{"entity": "urinary", "entity_type": "Anatomy", "pos": [30, 37]}], "task": "NER"}
+{"text": "We synthesized a new substrate glycyl - L - proline 3 , 5 - dibromo - 4 - hydroxyanilide ( Gly - Pro - DBAP ) , for dipeptidyl peptidase IV ( DPPIV ) .", "entity": [], "task": "NER"}
+{"text": "Its hydrolysis by DPPIV resulted in the formation of a chromophore , 2 , 6 - dibromophenol - indo - p - xylenol , and its maximal absorption wavelength ( 600 nm ) was longer than that of p - nitroaniline ( 415 nm ) released from conventional substrate , glycyl - L - proline p - nitroanilide ( Gly - Pro - pNA ) .", "entity": [], "task": "NER"}
+{"text": "We also established the rate assay for urinary DPPIV activity using Gly - Pro - DBAP .", "entity": [{"entity": "urinary", "entity_type": "Anatomy", "pos": [39, 46]}], "task": "NER"}
+{"text": "The optimum pH was between 8 . 5 and 9 . 0 .", "entity": [], "task": "NER"}
+{"text": "The apparent Km was 1 . 1 mmol / 1 .", "entity": [], "task": "NER"}
+{"text": "The detectable range was 2 . 5 - 350 U / l .", "entity": [], "task": "NER"}
+{"text": "No changes in blank values occurred throughout the enzyme reaction in the optimum pH .", "entity": [], "task": "NER"}
+{"text": "Its value was also much lower than Gly - Pro - pNA .", "entity": [], "task": "NER"}
+{"text": "CVs for within - run and between - run were 1 . 1 % ( n = 10 ) and 3 . 0 % ( n = 10 ) , respectively .", "entity": [], "task": "NER"}
+{"text": "Among tested peptidases , only DPPIV could hydrolyze Gly - Pro - DBAP .", "entity": [], "task": "NER"}
+{"text": "Among the protease inhibitors , only two , diprotin - A and phenylmethylsulfonyl fluoride ( PMSA ) , could inhibit DPPIV activity .", "entity": [], "task": "NER"}
+{"text": "The present method did not interfere with urinary ingredients such as hemoglobin .", "entity": [{"entity": "urinary", "entity_type": "Anatomy", "pos": [42, 49]}], "task": "NER"}
+{"text": "The correlation between the present ( y ) and conventional ( x ) methods is presented by the equation y = 1 . 121x + 0 . 096 ( r = 0 . 993 ) .", "entity": [], "task": "NER"}
+{"text": "Thus the present method provides practical advantages over the conventional method for routine laboratory use .", "entity": [], "task": "NER"}
+{"text": "Primary hyperparathyroidism and the heart : cardiac abnormalities correlated to clinical and biochemical data .", "entity": [{"entity": "heart", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "cardiac", "entity_type": "Anatomy", "pos": [44, 51]}], "task": "NER"}
+{"text": "Comparing patients with primary hyperparathyroidism ( PHP ) to a normocalcemic control population , those with PHP have a higher incidence of cardiovascular disease and cardiac abnormalities .", "entity": [{"entity": "cardiovascular", "entity_type": "Anatomy", "pos": [142, 156]}, {"entity": "cardiac", "entity_type": "Anatomy", "pos": [169, 176]}], "task": "NER"}
+{"text": "This study aimed at correlating cardiac findings ( valvular and myocardial calcification , myocardial hypertrophy ) with clinical data ( age , sex , clinical manifestation , nephrolithiasis , nephrocalcinosis , hypertension , skeletal abnormalities , hypercalcemic syndrome ) and biochemical data ( serum calcium , serum phosphate , serum iPTH level , serum creatinine ) .", "entity": [{"entity": "cardiac", "entity_type": "Anatomy", "pos": [32, 39]}, {"entity": "valvular", "entity_type": "Anatomy", "pos": [51, 59]}, {"entity": "myocardial", "entity_type": "Anatomy", "pos": [64, 74]}, {"entity": "myocardial", "entity_type": "Anatomy", "pos": [91, 101]}, {"entity": "skeletal", "entity_type": "Anatomy", "pos": [226, 234]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [299, 304]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [315, 320]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [333, 338]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [352, 357]}], "task": "NER"}
+{"text": "A group of 132 consecutive patients with surgically verified PHP ( 94 women , 38 men ; ages 15 - 86 , mean age 57 + / - 16 years ) were included in this study .", "entity": [], "task": "NER"}
+{"text": "Blood chemistry , clinical presentation , radiography , and echocardiography were carried out in all patients for univariate and multivariate analyses of all parameters .", "entity": [{"entity": "Blood", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "There was no statistical correlation between clinical symptoms , biochemical data , and cardiac calcific alterations .", "entity": [{"entity": "cardiac", "entity_type": "Anatomy", "pos": [88, 95]}], "task": "NER"}
+{"text": "Typical skeletal manifestations ( osteolysis / subperiostal resorption ) and valvular calcifications were significantly correlated to left ventricular hypertrophy ( p = 0 . 005 ) .", "entity": [{"entity": "skeletal", "entity_type": "Anatomy", "pos": [8, 16]}, {"entity": "valvular", "entity_type": "Anatomy", "pos": [77, 85]}, {"entity": "left ventricular", "entity_type": "Anatomy", "pos": [134, 150]}], "task": "NER"}
+{"text": "Cardiac abnormalities such as calcific myocardial deposits or mitral and aortic valvular calcifications do not correlate with laboratory findings and clinical presentation at the time of diagnosis .", "entity": [{"entity": "Cardiac", "entity_type": "Anatomy", "pos": [0, 7]}, {"entity": "myocardial", "entity_type": "Anatomy", "pos": [39, 49]}, {"entity": "mitral", "entity_type": "Anatomy", "pos": [62, 68]}, {"entity": "aortic valvular", "entity_type": "Anatomy", "pos": [73, 88]}], "task": "NER"}
+{"text": "There was no biochemical or clinical variable that could predict the frequency or severity of valvular sclerosis or calcific deposits in the myocardium .", "entity": [{"entity": "valvular", "entity_type": "Anatomy", "pos": [94, 102]}, {"entity": "myocardium", "entity_type": "Anatomy", "pos": [141, 151]}], "task": "NER"}
+{"text": "However , PHP - related skeletal abnormalities and valvular calcification were predicting factors for left ventricular hypertrophy , a reversible cardiac manifestation of PHP .", "entity": [{"entity": "skeletal", "entity_type": "Anatomy", "pos": [24, 32]}, {"entity": "valvular", "entity_type": "Anatomy", "pos": [51, 59]}, {"entity": "left ventricular", "entity_type": "Anatomy", "pos": [102, 118]}, {"entity": "cardiac", "entity_type": "Anatomy", "pos": [146, 153]}], "task": "NER"}
+{"text": "Myocardial hypertrophy is more often found with classic symptomatic PHP with osseous abnormalities .", "entity": [{"entity": "Myocardial", "entity_type": "Anatomy", "pos": [0, 10]}, {"entity": "osseous", "entity_type": "Anatomy", "pos": [77, 84]}], "task": "NER"}
+{"text": "Selenoperoxidase - dependent glutathione cycle activity in peroxide - challenged leukemia cells .", "entity": [{"entity": "leukemia cells", "entity_type": "Anatomy", "pos": [81, 95]}], "task": "NER"}
+{"text": "Murine leukemia L1210 cells rendered deficient in glutathione peroxidase ( GPX ) and phospholipid hydroperoxide glutathione peroxidase ( PHGPX ) by Se deprivation ( L . Se ( - ) cells ) were found to be more sensitive to tert - butyl hydroperoxide ( t - BuOOH ) cytotoxicity than Se - replete controls ( L . Se ( + ) cells ) .", "entity": [{"entity": "leukemia L1210 cells", "entity_type": "Anatomy", "pos": [7, 27]}, {"entity": "L . Se ( - ) cells", "entity_type": "Anatomy", "pos": [165, 183]}, {"entity": "L . Se ( + ) cells", "entity_type": "Anatomy", "pos": [304, 322]}], "task": "NER"}
+{"text": "Human K562 cells , which express PHGPX , but not GPX , were also more sensitive to t - BuOOH in the Se - deficient ( K . Se ( - ) ) than Se - satisfied ( K . Se ( + ) ) condition .", "entity": [{"entity": "K562 cells", "entity_type": "Anatomy", "pos": [6, 16]}, {"entity": "K . Se ( - )", "entity_type": "Anatomy", "pos": [117, 129]}, {"entity": "K . Se ( + )", "entity_type": "Anatomy", "pos": [154, 166]}], "task": "NER"}
+{"text": "In examining the metabolic basis for selenoperoxidase - dependent resistance , we found that glucose - replete Se ( - ) cells reduce t - BuOOH to t - butanol far more slowly than Se ( + ) cells , the ratio of the first - order rate constants approximating that of the GPX activities ( L1210 cells ) or PHGPX activities ( K562 cells ) .", "entity": [{"entity": "Se ( - ) cells", "entity_type": "Anatomy", "pos": [111, 125]}, {"entity": "Se ( + ) cells", "entity_type": "Anatomy", "pos": [179, 193]}, {"entity": "L1210 cells", "entity_type": "Anatomy", "pos": [285, 296]}, {"entity": "K562 cells", "entity_type": "Anatomy", "pos": [321, 331]}], "task": "NER"}
+{"text": "Monitoring peroxide - induced changes in GSH and GSSG gave consistent results ; e . g . , glucose - depleted L . Se ( + ) cells exhibited a first order loss of GSH that was substantially faster than that of glucose - depleted L . Se ( - ) cells .", "entity": [{"entity": "L . Se ( + ) cells", "entity_type": "Anatomy", "pos": [109, 127]}, {"entity": "L . Se ( - ) cells", "entity_type": "Anatomy", "pos": [226, 244]}], "task": "NER"}
+{"text": "Under the conditions used , peroxide - induced conversion of GSH to GSSG could be stoichiometrically reversed by resupplying D - glucose , indicating that no significant lysis or GSSG efflux and / or interchange had taken place .", "entity": [], "task": "NER"}
+{"text": "The apparent first - order rate constant for GSH decay increased progressively for L1210 cells expressing a range of GPX activities from approximately 5 % to 100 % , demonstrating that peroxide detoxification is strictly dependent on enzyme content .", "entity": [{"entity": "L1210 cells", "entity_type": "Anatomy", "pos": [83, 94]}], "task": "NER"}
+{"text": "The initial rate of 14CO2 release from D - [ 1 - 14C ] glucose supplied in the medium was much greater for L . Se ( + ) or K . Se ( + ) cells than for their respective Se ( - ) counterparts , consistent with greater hexose monophosphate shunt activity in the former .", "entity": [{"entity": "L . Se ( + )", "entity_type": "Anatomy", "pos": [107, 119]}, {"entity": "K . Se ( + ) cells", "entity_type": "Anatomy", "pos": [123, 141]}, {"entity": "Se ( - )", "entity_type": "Anatomy", "pos": [168, 176]}], "task": "NER"}
+{"text": "These results highlight the importance of selenoperoxidase action in the glutathione cycle as a means by which tumor cells cope with hydroperoxide stress .", "entity": [{"entity": "tumor cells", "entity_type": "Anatomy", "pos": [111, 122]}], "task": "NER"}
+{"text": "Differential expression and mutation of NME genes in autologous cultured human melanoma cells with different metastatic potentials .", "entity": [{"entity": "melanoma cells", "entity_type": "Anatomy", "pos": [79, 93]}], "task": "NER"}
+{"text": "The putative metastasis suppressor genes , NME1 ( nm23 - 1 ) and NME2 ( nm23 - 2 ) , were examined in a model system we developed to approximate the dissemination of melanoma from a primary skin tumor .", "entity": [{"entity": "melanoma", "entity_type": "Anatomy", "pos": [166, 174]}, {"entity": "primary skin tumor", "entity_type": "Anatomy", "pos": [182, 200]}], "task": "NER"}
+{"text": "We utilized two autologous human melanoma cell lines , IV Cl 1 and IV Cl 3 , which displayed qualitatively different metastatic phenotypes following subdermal inoculation into nude mice .", "entity": [{"entity": "melanoma cell lines", "entity_type": "Anatomy", "pos": [33, 52]}, {"entity": "IV Cl 1", "entity_type": "Anatomy", "pos": [55, 62]}, {"entity": "IV Cl 3", "entity_type": "Anatomy", "pos": [67, 74]}, {"entity": "subdermal", "entity_type": "Anatomy", "pos": [149, 158]}], "task": "NER"}
+{"text": "Highly metastatic IV Cl 1 cells expressed approximately 5 fold lower levels of protein encoded by NME genes than non - metastatic IV Cl 3 cells .", "entity": [{"entity": "metastatic IV Cl 1 cells", "entity_type": "Anatomy", "pos": [7, 31]}, {"entity": "non - metastatic IV Cl 3 cells", "entity_type": "Anatomy", "pos": [113, 143]}], "task": "NER"}
+{"text": "Similar differences in NME protein levels were observed in tumors induced by the two cell lines in nude mice .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [59, 65]}, {"entity": "cell lines", "entity_type": "Anatomy", "pos": [85, 95]}], "task": "NER"}
+{"text": "There were no differences in NME mRNA levels between these two cell lines , suggesting that expression of these proteins is regulated at a post - transcriptional level .", "entity": [{"entity": "cell lines", "entity_type": "Anatomy", "pos": [63, 73]}], "task": "NER"}
+{"text": "We found a ser122 - pro mutation in the NME2 gene of metastatic IV Cl 1 cells .", "entity": [{"entity": "metastatic IV Cl 1 cells", "entity_type": "Anatomy", "pos": [53, 77]}], "task": "NER"}
+{"text": "A similar ser120 - gly mutation in NME1 has been found in human neuroblastoma , suggesting that mutation in this region may be a general phenomenon related to tumor progression .", "entity": [{"entity": "neuroblastoma", "entity_type": "Anatomy", "pos": [64, 77]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [159, 164]}], "task": "NER"}
+{"text": "These mutations may have functional consequences since they eliminate potential phosphorylation sites and may affect the tertiary structure of mature protein complexes .", "entity": [], "task": "NER"}
+{"text": "Image - directed and color Doppler studies of gallbladder tumors .", "entity": [{"entity": "gallbladder tumors", "entity_type": "Anatomy", "pos": [46, 64]}], "task": "NER"}
+{"text": "Thirteen cases of primary adenocarcinoma of the gallbladder ( GB ) , 1 of malignant fibrous histocytoma , 3 of metastatic adenocarcinoma , 5 of adenoma , 5 of polypus , 2 of xanthogranuloma , 6 of chronic cholecystitis , 4 of acute cholecystitis , and 8 of subacute cholecystitis were studied by image - directed and color Doppler ultrasonography ( CDUS ) .", "entity": [{"entity": "primary adenocarcinoma", "entity_type": "Anatomy", "pos": [18, 40]}, {"entity": "gallbladder", "entity_type": "Anatomy", "pos": [48, 59]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [62, 64]}, {"entity": "malignant fibrous histocytoma", "entity_type": "Anatomy", "pos": [74, 103]}, {"entity": "metastatic adenocarcinoma", "entity_type": "Anatomy", "pos": [111, 136]}, {"entity": "adenoma", "entity_type": "Anatomy", "pos": [144, 151]}, {"entity": "polypus", "entity_type": "Anatomy", "pos": [159, 166]}, {"entity": "xanthogranuloma", "entity_type": "Anatomy", "pos": [174, 189]}], "task": "NER"}
+{"text": "All of the 14 cases of primary GB cancer ( 10 masses , 4 thickening wall ) were found to have a high velocity arterial blood flow signal in the wall of the GB .", "entity": [{"entity": "primary GB cancer", "entity_type": "Anatomy", "pos": [23, 40]}, {"entity": "masses", "entity_type": "Anatomy", "pos": [46, 52]}, {"entity": "wall", "entity_type": "Anatomy", "pos": [68, 72]}, {"entity": "arterial blood", "entity_type": "Anatomy", "pos": [110, 124]}, {"entity": "wall", "entity_type": "Anatomy", "pos": [144, 148]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [156, 158]}], "task": "NER"}
+{"text": "In contrast , the 3 cases of metastatic cancer of the GB had no blood flow signal in the wall of the GB .", "entity": [{"entity": "metastatic cancer", "entity_type": "Anatomy", "pos": [29, 46]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [54, 56]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [64, 69]}, {"entity": "wall", "entity_type": "Anatomy", "pos": [89, 93]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [101, 103]}], "task": "NER"}
+{"text": "For the 30 cases of benign lesions of the GB , only in 12 cases was a low velocity blood flow signal found .", "entity": [{"entity": "benign lesions", "entity_type": "Anatomy", "pos": [20, 34]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [42, 44]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [83, 88]}], "task": "NER"}
+{"text": "Nine of 10 cases of primary GB malignancy were found to have high velocity arterial blood flow signals in the tumor masses .", "entity": [{"entity": "primary GB malignancy", "entity_type": "Anatomy", "pos": [20, 41]}, {"entity": "arterial blood", "entity_type": "Anatomy", "pos": [75, 89]}, {"entity": "tumor masses", "entity_type": "Anatomy", "pos": [110, 122]}], "task": "NER"}
+{"text": "No blood flow signal was observed in the masses of 13 cases ( 3 of metastatic adenocarcinoma , 5 of adenoma , 5 of polypus ) .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [3, 8]}, {"entity": "masses", "entity_type": "Anatomy", "pos": [41, 47]}, {"entity": "metastatic adenocarcinoma", "entity_type": "Anatomy", "pos": [67, 92]}, {"entity": "adenoma", "entity_type": "Anatomy", "pos": [100, 107]}, {"entity": "polypus", "entity_type": "Anatomy", "pos": [115, 122]}], "task": "NER"}
+{"text": "An abnormal high velocity arterial blood flow signal observed within masses in the GB or in the GB wall is a significant feature of primary GB cancer and thus helps to differentiate primary GB cancer from metastatic and benign lesions of the GB .", "entity": [{"entity": "arterial blood", "entity_type": "Anatomy", "pos": [26, 40]}, {"entity": "masses", "entity_type": "Anatomy", "pos": [69, 75]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [83, 85]}, {"entity": "GB wall", "entity_type": "Anatomy", "pos": [96, 103]}, {"entity": "primary GB cancer", "entity_type": "Anatomy", "pos": [132, 149]}, {"entity": "primary GB cancer", "entity_type": "Anatomy", "pos": [182, 199]}, {"entity": "metastatic", "entity_type": "Anatomy", "pos": [205, 215]}, {"entity": "benign lesions", "entity_type": "Anatomy", "pos": [220, 234]}, {"entity": "GB", "entity_type": "Anatomy", "pos": [242, 244]}], "task": "NER"}
+{"text": "Inhibition of calmodulin - dependent myosin light - chain kinase by growth - hormone - releasing factor and vasoactive intestinal peptide .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [119, 129]}], "task": "NER"}
+{"text": "In view of the ability of calmodulin to bind vasoactive intestinal peptide ( VIP ) and growth - hormone - releasing factor ( GRF ) with high affinity [ Stallwood , Brugger , Baggenstoss , Stemmer , Shiraga , Landers and Paul ( 1992 ) J . Biol . Chem . 267 , 19617 - 19621 ] , the effects of these neuropeptides on a model calmodulin - dependent enzyme , myosin light - chain kinase ( MLCK ) , were studied .", "entity": [{"entity": "intestinal", "entity_type": "Anatomy", "pos": [56, 66]}], "task": "NER"}
+{"text": "Both peptides were potent inhibitors of MLCK activity .", "entity": [], "task": "NER"}
+{"text": "The inhibition of enzyme activity by VIP and GRF was progressively overcome with increasing calmodulin concentrations , with no inhibition observed at a saturating calmodulin concentration .", "entity": [], "task": "NER"}
+{"text": "Nanomolar concentrations of MLCK blocked the formation of calmodulin - [ 125I - Tyr10 ] VIP complexes .", "entity": [], "task": "NER"}
+{"text": "These data provide support for a functional role of VIP and GRF binding by calmodulin .", "entity": [], "task": "NER"}
+{"text": "Cyclin D1 / bcl - 1 cooperates with myc genes in the generation of B - cell lymphoma in transgenic mice .", "entity": [{"entity": "B - cell lymphoma", "entity_type": "Anatomy", "pos": [67, 84]}], "task": "NER"}
+{"text": "The chromosomal translocation t ( 11 : 14 ) is associated with human lymphoid neoplasia affecting centrocytic B - cells of intermediate differentiation .", "entity": [{"entity": "chromosomal", "entity_type": "Anatomy", "pos": [4, 15]}, {"entity": "lymphoid neoplasia", "entity_type": "Anatomy", "pos": [69, 87]}, {"entity": "centrocytic B - cells", "entity_type": "Anatomy", "pos": [98, 119]}], "task": "NER"}
+{"text": "As a consequence the cyclin D1 ( bcl - 1 ) gene is juxtaposed to the immunoglobulin heavy chain enhancer E mu .", "entity": [], "task": "NER"}
+{"text": "To show that transcriptional activation of cyclin D1 is causally involved in the generation of B - cell neoplasia we have generated transgenic mice that carry a cyclin D1 gene under the transcriptional control of the E mu element .", "entity": [{"entity": "B - cell neoplasia", "entity_type": "Anatomy", "pos": [95, 113]}], "task": "NER"}
+{"text": "E mu cyclin D1 transgenic mice show only very subtle alterations in the cycling behaviour of B - cell populations in the bone marrow compared with normal mice and do not develop lymphoid tumours .", "entity": [{"entity": "B - cell populations", "entity_type": "Anatomy", "pos": [93, 113]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [121, 132]}, {"entity": "lymphoid tumours", "entity_type": "Anatomy", "pos": [178, 194]}], "task": "NER"}
+{"text": "However , E mu - directed coexpression of cyclin D1 and N - MYC or L - MYC in double transgenic mice reveals a strong cooperative effect between MYC and cyclin D1 provoking the rapid development of clonal pre - B and B - cell lymphomas .", "entity": [{"entity": "clonal pre - B", "entity_type": "Anatomy", "pos": [198, 212]}, {"entity": "B - cell lymphomas", "entity_type": "Anatomy", "pos": [217, 235]}], "task": "NER"}
+{"text": "Interestingly , crossing of cyclin D1 transgenic mice with E mu L - myc transgenics that express their transgene in both B - and T - cells but predominantly develop T - cell tumours leads in double transgenics exclusively to B - cell neoplasia .", "entity": [{"entity": "B -", "entity_type": "Anatomy", "pos": [121, 124]}, {"entity": "T - cells", "entity_type": "Anatomy", "pos": [129, 138]}, {"entity": "T - cell tumours", "entity_type": "Anatomy", "pos": [165, 181]}, {"entity": "B - cell neoplasia", "entity_type": "Anatomy", "pos": [225, 243]}], "task": "NER"}
+{"text": "The data presented here demonstrate that transcriptional activation of cyclin D1 can oncogenically transform B - cells in concert with a myc gene .", "entity": [{"entity": "B - cells", "entity_type": "Anatomy", "pos": [109, 118]}], "task": "NER"}
+{"text": "They establish cyclin D1 as a proto - oncogene whose activity appears to depend on a specific cell type as well as on a specific cooperating partner and link disturbances in the regulation of cell cycle progression to the development of human malignancies .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [94, 98]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [192, 196]}, {"entity": "malignancies", "entity_type": "Anatomy", "pos": [243, 255]}], "task": "NER"}
+{"text": "Elevated expression of the junB proto - oncogene is essential for v - fos induced transformation of Rat - 1 cells .", "entity": [{"entity": "Rat - 1 cells", "entity_type": "Anatomy", "pos": [100, 113]}], "task": "NER"}
+{"text": "We previously described the isolation of non - tumorigenic revertants from mutagenized populations of v - fos - transformed Rat - 1 cells ( Zarbl et al . , 1987 ) .", "entity": [{"entity": "revertants", "entity_type": "Anatomy", "pos": [59, 69]}, {"entity": "populations", "entity_type": "Anatomy", "pos": [87, 98]}, {"entity": "Rat - 1 cells", "entity_type": "Anatomy", "pos": [124, 137]}], "task": "NER"}
+{"text": "In the present study we examined the possibility that the revertant phenotype resulted from mutations that altered the expression or activities of the c - jun or junB proto - oncogenes .", "entity": [{"entity": "revertant", "entity_type": "Anatomy", "pos": [58, 67]}], "task": "NER"}
+{"text": "The results demonstrated that levels of the c - jun mRNA and protein were unchanged in the revertants when compared to the transformed parental cells , and ectopic overexpression of c - jun failed to retransform the revertants .", "entity": [{"entity": "revertants", "entity_type": "Anatomy", "pos": [91, 101]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [144, 149]}, {"entity": "revertants", "entity_type": "Anatomy", "pos": [216, 226]}], "task": "NER"}
+{"text": "Although one mutant allele was detected in revertant EMS - 1 - 19 , overexpression of this mutant allele failed to inhibit v - fos induced cell transformation .", "entity": [{"entity": "revertant EMS - 1 - 19", "entity_type": "Anatomy", "pos": [43, 65]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [139, 143]}], "task": "NER"}
+{"text": "Together these results indicated that the revertant phenotype did not result from altered expression or mutations in the c - jun gene .", "entity": [{"entity": "revertant", "entity_type": "Anatomy", "pos": [42, 51]}], "task": "NER"}
+{"text": "In contrast to the results obtained with c - jun , the levels of junB mRNA and protein were found to be reduced two - or threefold in revertant EMS - 1 - 19 .", "entity": [{"entity": "revertant EMS - 1 - 19", "entity_type": "Anatomy", "pos": [134, 156]}], "task": "NER"}
+{"text": "Ectopic overexpression of junB induced transformation of revertant EMS - 1 - 19 , but failed to transform Rat - 1 cells .", "entity": [{"entity": "revertant EMS - 1 - 19", "entity_type": "Anatomy", "pos": [57, 79]}, {"entity": "Rat - 1 cells", "entity_type": "Anatomy", "pos": [106, 119]}], "task": "NER"}
+{"text": "Moreover , about 10 % of v - fos transformed cells transfected with vectors that express antisense junB mRNA acquired a non - transformed phenotype .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [45, 50]}], "task": "NER"}
+{"text": "Together these results indicate that expression of junB above a threshold level is essential for v - fos - induced transformation of Rat - 1 fibroblasts .", "entity": [{"entity": "Rat - 1 fibroblasts", "entity_type": "Anatomy", "pos": [133, 152]}], "task": "NER"}
+{"text": "Methotrexate osteopathy in rheumatic disease .", "entity": [], "task": "NER"}
+{"text": "To determine whether two adults with stress fractures receiving low weekly doses of methotrexate had methotrexate osteopathy .", "entity": [], "task": "NER"}
+{"text": "CASE REPORTS :", "entity": [], "task": "NER"}
+{"text": "Two adult patients developed features consistent with methotrexate osteopathy while receiving low weekly doses of methotrexate .", "entity": [], "task": "NER"}
+{"text": "Iliac crest biopsy samples were taken and bone histomorphometry carried out .", "entity": [{"entity": "Iliac crest biopsy samples", "entity_type": "Anatomy", "pos": [0, 26]}, {"entity": "bone", "entity_type": "Anatomy", "pos": [42, 46]}], "task": "NER"}
+{"text": "Symptoms resolved when the methotrexate was discontinued .", "entity": [], "task": "NER"}
+{"text": "Bone histology showed changes consistent with osteoblast inhibition by methotrexate .", "entity": [{"entity": "Bone", "entity_type": "Anatomy", "pos": [0, 4]}, {"entity": "osteoblast", "entity_type": "Anatomy", "pos": [46, 56]}], "task": "NER"}
+{"text": "When given in low doses for prolonged periods , methotrexate may have adverse effects on bone , particularly in post - menopausal women .", "entity": [{"entity": "bone", "entity_type": "Anatomy", "pos": [89, 93]}], "task": "NER"}
+{"text": "Methodologies for measuring carcinogen adducts in humans .", "entity": [], "task": "NER"}
+{"text": "In summary , although some of the more optimistic aspirations for human biomonitoring studies envisaged a decade ago have not been realized thus far , some considerable advances have been made .", "entity": [], "task": "NER"}
+{"text": "The examples cited above indicate that the feasibility of biomonitoring has been clearly established .", "entity": [], "task": "NER"}
+{"text": "In addition , they demonstrate the need for preliminary biomarker testing and validation through transitional studies prior to their field application .", "entity": [], "task": "NER"}
+{"text": "In the next decade of research into carcinogen adducts in humans , continued improvements in the reproducibility and specificity of assays for DNA adducts will be needed .", "entity": [], "task": "NER"}
+{"text": "Perhaps the increasing use of hybrid methodologies to concentrate adducts followed by specific chemical analyses will allow such adducts to be monitored more precisely .", "entity": [], "task": "NER"}
+{"text": "Of course , further basic research into the mechanisms of carcinogenesis will allow the measurement of specific novel markers which are more closely tied to the disease endpoint than adducts .", "entity": [], "task": "NER"}
+{"text": "The development of new assays for determining metabolic phenotypes and genotypes relevant to carcinogenesis should improve our estimates of susceptibility ( 46 - 48 ) .", "entity": [], "task": "NER"}
+{"text": "Such new approaches along with the sustained improvement of current assays will allow molecular approaches to continue to enrich cancer epidemiology in the future .", "entity": [{"entity": "cancer", "entity_type": "Anatomy", "pos": [129, 135]}], "task": "NER"}
+{"text": "[ Treatment of the diabetic foot by hyperbaric oxygen ]", "entity": [{"entity": "foot", "entity_type": "Anatomy", "pos": [28, 32]}], "task": "NER"}
+{"text": "Diabetic foot wounds are consequences of the neuropathy and the small and large vessel disease that complicate diabetes .", "entity": [{"entity": "foot wounds", "entity_type": "Anatomy", "pos": [9, 20]}, {"entity": "vessel", "entity_type": "Anatomy", "pos": [80, 86]}], "task": "NER"}
+{"text": "At the cellular level , the result is hypoxia which impairs wound healing .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [7, 15]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [60, 65]}], "task": "NER"}
+{"text": "Hyperbaric oxygenation ( HBO ) may be a useful adjuvant to wound care .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [59, 64]}], "task": "NER"}
+{"text": "It leads to enhanced oxygenation of the affected tissues , has an antiseptic effect , reduces edema , and accelerates collagen production and angiogenesis , thus enhancing tissue repair .", "entity": [{"entity": "tissues", "entity_type": "Anatomy", "pos": [49, 56]}, {"entity": "edema", "entity_type": "Anatomy", "pos": [94, 99]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [172, 178]}], "task": "NER"}
+{"text": "14 diabetics with chronic nonhealing wounds which did not respond to treatment for at least 3 months were treated by HBO .", "entity": [{"entity": "chronic nonhealing wounds", "entity_type": "Anatomy", "pos": [18, 43]}], "task": "NER"}
+{"text": "All had palpable pedal pulses .", "entity": [], "task": "NER"}
+{"text": "Transcutaneous measurements of tissue pO2 showed elevation from 20 + / - 10 mm Hg during air breathing to 643 + / - 242 mm Hg while breathing pure oxygen at 2 . 5 ATA .", "entity": [{"entity": "Transcutaneous", "entity_type": "Anatomy", "pos": [0, 14]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [31, 37]}], "task": "NER"}
+{"text": "They were treated with HBO in 56 + / - 10 consecutive HBO sessions .", "entity": [], "task": "NER"}
+{"text": "In 11 there was complete wound healing , while in 1 there was partial response , in 1 minimal response , and in 1 a transient response .", "entity": [{"entity": "wound", "entity_type": "Anatomy", "pos": [25, 30]}], "task": "NER"}
+{"text": "HBO is useful in chronic nonhealing wounds of the diabetic foot and of the diabetic foot with impending amputation .", "entity": [{"entity": "chronic nonhealing wounds", "entity_type": "Anatomy", "pos": [17, 42]}, {"entity": "foot", "entity_type": "Anatomy", "pos": [59, 63]}, {"entity": "foot", "entity_type": "Anatomy", "pos": [84, 88]}], "task": "NER"}
+{"text": "It is a safe mode of therapy , but further studies are required to establish its efficacy and to ascertain which diabetic patients and wounds will benefit the most from it .", "entity": [{"entity": "wounds", "entity_type": "Anatomy", "pos": [135, 141]}], "task": "NER"}
+{"text": "Lactotransferrin binding to its platelet receptor inhibits platelet aggregation .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [32, 40]}, {"entity": "platelet", "entity_type": "Anatomy", "pos": [59, 67]}], "task": "NER"}
+{"text": "A fluorescent lactotransferrin probe was prepared by coupling 5 - ( ( [ 2 - ( carbhydrazino ) methyl ] - thio ) acetyl ) amino fluorescein to aldehyde groups that were produced by a mild periodic - acid oxidation of the glycan moieties of lactotransferrin .", "entity": [], "task": "NER"}
+{"text": "In this manner , the receptor - binding site of the lactotransferrin remains active in contrast to the binding site of the lactotransferrin derivatized with fluorescein isothiocyanate .", "entity": [], "task": "NER"}
+{"text": "The fluorescent probe allowed us to characterize , by flow cytometry , the binding of lactotransferrin to non - activated human platelets .", "entity": [{"entity": "platelets", "entity_type": "Anatomy", "pos": [128, 137]}], "task": "NER"}
+{"text": "The putative lactotransferrin platelet receptor was purified and its immunological and physico - chemical properties were found to be very similar to those of the receptor previously isolated from activated human lymphocytes .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [30, 38]}, {"entity": "lymphocytes", "entity_type": "Anatomy", "pos": [213, 224]}], "task": "NER"}
+{"text": "Lactotransferrin inhibits ADP - induced platelet aggregation at concentrations down to 5 nM , which can be reached in the plasma after leukocyte degranulation .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [40, 48]}, {"entity": "plasma", "entity_type": "Anatomy", "pos": [122, 128]}, {"entity": "leukocyte", "entity_type": "Anatomy", "pos": [135, 144]}], "task": "NER"}
+{"text": "Inhibition of platelet aggregation was also observed with the N - terminal fragment of lactotransferrin ( residues 3 - 281 ; 50 % inhibition = 2 microM ) and with CFQWQRNMRKVRGPPVSC synthetic octodecapeptide ( residues 20 - 37 ; 50 % inhibition = 20 microM ) corresponding to one of the two external loops ( residues 28 - 34 and 39 - 42 ) where we recently located the receptor - binding site .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [14, 22]}], "task": "NER"}
+{"text": "The activity ( 50 % inhibition = 500 microM ) of the tetrapeptide KRDS ( residues 39 - 42 ) , which has already been described , was at least 25 - times and 16000 - times lower than the activity of the octodecapeptide and of the lactotransferrin molecules , respectively .", "entity": [], "task": "NER"}
+{"text": "Finally , the inhibition was demonstrated to be mediated by a mechanism which requires the binding of lactotransferrin to its putative receptor and not to platelet glycoprotein IIb - IIIa .", "entity": [{"entity": "platelet", "entity_type": "Anatomy", "pos": [155, 163]}], "task": "NER"}
+{"text": "Appearance of tumorous phenotypes in goldfish erythrophores transfected with ras , src , and myc oncogenes and spontaneous differentiation of the transformants in vitro .", "entity": [{"entity": "tumorous", "entity_type": "Anatomy", "pos": [14, 22]}, {"entity": "erythrophores", "entity_type": "Anatomy", "pos": [46, 59]}, {"entity": "transformants", "entity_type": "Anatomy", "pos": [146, 159]}], "task": "NER"}
+{"text": "When goldfish erythrophores isolated from the skin by tissue digestion and centrifugation in a Percoll density gradient were transfected in a monolayer - culture with v - Ha - ras or v - src oncogene either singly or in combination with v - myc by means of calcium phosphate - DNA co - precipitation , there appeared a certain number of transformants manifesting a chromatoblast - like profile and tumorous phenotypes as seen in the capability for unlimited growth , and piling - up in a monolayer - culture or colony formation in semi - solid soft agar .", "entity": [{"entity": "erythrophores", "entity_type": "Anatomy", "pos": [14, 27]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [46, 50]}, {"entity": "tissue", "entity_type": "Anatomy", "pos": [54, 60]}, {"entity": "monolayer - culture", "entity_type": "Anatomy", "pos": [142, 161]}, {"entity": "transformants", "entity_type": "Anatomy", "pos": [337, 350]}, {"entity": "chromatoblast", "entity_type": "Anatomy", "pos": [365, 378]}, {"entity": "tumorous", "entity_type": "Anatomy", "pos": [398, 406]}, {"entity": "monolayer - culture", "entity_type": "Anatomy", "pos": [488, 507]}, {"entity": "colony", "entity_type": "Anatomy", "pos": [511, 517]}], "task": "NER"}
+{"text": "After successive growth in vitro for longer than one month which was scarcely observed with the erythrophores , the vast majority of such transformants began to differentiate into erythrophores and ceased proliferation spontaneously .", "entity": [{"entity": "erythrophores", "entity_type": "Anatomy", "pos": [96, 109]}, {"entity": "transformants", "entity_type": "Anatomy", "pos": [138, 151]}, {"entity": "erythrophores", "entity_type": "Anatomy", "pos": [180, 193]}], "task": "NER"}
+{"text": "The onset of their differentiation was ascertained by the deposition of marker pteridine pigments .", "entity": [], "task": "NER"}
+{"text": "None of the transformants differentiated into melanophores or iridophores or other neural crest derivatives as seen in goldfish erythrophoroma cells .", "entity": [{"entity": "transformants", "entity_type": "Anatomy", "pos": [12, 25]}, {"entity": "melanophores", "entity_type": "Anatomy", "pos": [46, 58]}, {"entity": "iridophores", "entity_type": "Anatomy", "pos": [62, 73]}, {"entity": "neural crest", "entity_type": "Anatomy", "pos": [83, 95]}, {"entity": "erythrophoroma cells", "entity_type": "Anatomy", "pos": [128, 148]}], "task": "NER"}
+{"text": "Little difference was observed in their transforming efficiency ( 0 . 2 - 0 . 3 transformants / micrograms DNA ) between the combinations of oncogenes applied but a tendency was noted that cells transfected with ras or src in combination with myc developed the capacity to grow for a longer period and differentiated at a later stage than those transfected solely with ras or src .", "entity": [{"entity": "transformants", "entity_type": "Anatomy", "pos": [80, 93]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [189, 194]}], "task": "NER"}
+{"text": "One cell line ( ESM - 1 ) derived from the erythrophores transfected with src / myc grew successively over nine months , indicating its acquisition of immortality .", "entity": [{"entity": "cell line", "entity_type": "Anatomy", "pos": [4, 13]}, {"entity": "ESM - 1", "entity_type": "Anatomy", "pos": [16, 23]}, {"entity": "erythrophores", "entity_type": "Anatomy", "pos": [43, 56]}], "task": "NER"}
+{"text": "The expression of the transfected oncogenes in this cell line was examined in comparison with the erythrophoroma cells by Western and Northern blot analyses .", "entity": [{"entity": "cell line", "entity_type": "Anatomy", "pos": [52, 61]}, {"entity": "erythrophoroma cells", "entity_type": "Anatomy", "pos": [98, 118]}], "task": "NER"}
+{"text": "Immune consequences of burn injury .", "entity": [], "task": "NER"}
+{"text": "The purpose of the immune system is to protect cells from invasion by microorganisms .", "entity": [{"entity": "immune system", "entity_type": "Anatomy", "pos": [19, 32]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [47, 52]}], "task": "NER"}
+{"text": "The body has three equally important interactive immune defense systems , all of which are profoundly disrupted with major burn injury .", "entity": [{"entity": "body", "entity_type": "Anatomy", "pos": [4, 8]}, {"entity": "immune defense systems", "entity_type": "Anatomy", "pos": [49, 71]}], "task": "NER"}
+{"text": "The immune response to burn injury is immediate , prolonged , and severe .", "entity": [], "task": "NER"}
+{"text": "The end result in individuals surviving burn shock is immunosuppression , with increased susceptibility to potentially fatal systemic burn wound or pulmonary sepsis .", "entity": [{"entity": "burn wound", "entity_type": "Anatomy", "pos": [134, 144]}, {"entity": "pulmonary", "entity_type": "Anatomy", "pos": [148, 157]}], "task": "NER"}
+{"text": "Nursing actions to support the humoral and cell - mediated immune system of the burned patient include providing nutritional support to maintain serum protein levels at optimal levels ; measures to decrease edema and promote angiogenesis in areas of partial - thickness injury ; meticulous treatment of the wound to prevent infection and promote healing ; monitoring of antibiotic use ; conservative use of invasive techniques , including intubation and vascular access devices ; maintenance of fluid and electrolyte balance and body temperature ; and energy conservation measures .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [43, 47]}, {"entity": "immune system", "entity_type": "Anatomy", "pos": [59, 72]}, {"entity": "serum", "entity_type": "Anatomy", "pos": [145, 150]}, {"entity": "edema", "entity_type": "Anatomy", "pos": [207, 212]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [307, 312]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [454, 462]}, {"entity": "fluid", "entity_type": "Anatomy", "pos": [495, 500]}, {"entity": "body", "entity_type": "Anatomy", "pos": [529, 533]}], "task": "NER"}
+{"text": "Autocrine angiogenic vascular prosthesis with bone marrow transplantation .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [21, 29]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [46, 57]}], "task": "NER"}
+{"text": "Synthetic vascular prostheses are foreign bodies , so that blood coagulation can occur on their luminal surfaces , causing graft occlusion very frequently in prostheses of small diameter .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [10, 18]}, {"entity": "blood", "entity_type": "Anatomy", "pos": [59, 64]}, {"entity": "luminal surfaces", "entity_type": "Anatomy", "pos": [96, 112]}, {"entity": "graft", "entity_type": "Anatomy", "pos": [123, 128]}], "task": "NER"}
+{"text": "A vascular prosthesis needs angiogenesis for endothelialization of the luminal surface , as endothelial cells have natural and permanent antithrombogenic properties .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [2, 10]}, {"entity": "luminal surface", "entity_type": "Anatomy", "pos": [71, 86]}, {"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [92, 109]}], "task": "NER"}
+{"text": "To induce capillary growth into the graft , we developed a method of transplanting bone marrow cells , which are primitive , strong enough to survive , and create blood cells , resulting in the inducement of capillary growth .", "entity": [{"entity": "capillary", "entity_type": "Anatomy", "pos": [10, 19]}, {"entity": "graft", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "bone marrow cells", "entity_type": "Anatomy", "pos": [83, 100]}, {"entity": "blood cells", "entity_type": "Anatomy", "pos": [163, 174]}, {"entity": "capillary", "entity_type": "Anatomy", "pos": [208, 217]}], "task": "NER"}
+{"text": "In an animal experiment , marrow cells were infiltrated into the walls of long - fibril expanded polytetrafluoroethylene ( ePTFE ) vascular grafts .", "entity": [{"entity": "marrow cells", "entity_type": "Anatomy", "pos": [26, 38]}, {"entity": "vascular grafts", "entity_type": "Anatomy", "pos": [131, 146]}], "task": "NER"}
+{"text": "The grafts were implanted in the abdominal aortic position of 24 dogs autologously .", "entity": [{"entity": "grafts", "entity_type": "Anatomy", "pos": [4, 10]}, {"entity": "abdominal aortic", "entity_type": "Anatomy", "pos": [33, 49]}], "task": "NER"}
+{"text": "Marrow cells survived and continued exogenous hemopoiesis for up to six months and were immunohistochemically reactive to basic fibroblast growth factor ( bFGF ) .", "entity": [{"entity": "Marrow cells", "entity_type": "Anatomy", "pos": [0, 12]}], "task": "NER"}
+{"text": "All the grafts older than three weeks had complete endothelialization and maintained their patency .", "entity": [{"entity": "grafts", "entity_type": "Anatomy", "pos": [8, 14]}], "task": "NER"}
+{"text": "Twenty grafts without bone marrow were implanted as controls .", "entity": [{"entity": "grafts", "entity_type": "Anatomy", "pos": [7, 13]}, {"entity": "bone marrow", "entity_type": "Anatomy", "pos": [22, 33]}], "task": "NER"}
+{"text": "Endothelialization was present at anastomotic sites , but other areas were covered with fresh thrombi .", "entity": [{"entity": "anastomotic sites", "entity_type": "Anatomy", "pos": [34, 51]}, {"entity": "thrombi", "entity_type": "Anatomy", "pos": [94, 101]}], "task": "NER"}
+{"text": "Four out of seven control grafts were patent with endothelial cell lining at six months , but three were occluded and one of the four grafts was still covered with a thrombus layer .", "entity": [{"entity": "grafts", "entity_type": "Anatomy", "pos": [26, 32]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [50, 66]}, {"entity": "grafts", "entity_type": "Anatomy", "pos": [134, 140]}, {"entity": "thrombus layer", "entity_type": "Anatomy", "pos": [166, 180]}], "task": "NER"}
+{"text": "Bone marrow with its unique native properties produced autocrine angiogenicity in the graft .", "entity": [{"entity": "Bone marrow", "entity_type": "Anatomy", "pos": [0, 11]}, {"entity": "graft", "entity_type": "Anatomy", "pos": [86, 91]}], "task": "NER"}
+{"text": "Application of clonal analysis .", "entity": [], "task": "NER"}
+{"text": "Differential diagnosis for synchronous primary ovarian and endometrial cancers and metastatic cancer .", "entity": [{"entity": "primary ovarian", "entity_type": "Anatomy", "pos": [39, 54]}, {"entity": "endometrial cancers", "entity_type": "Anatomy", "pos": [59, 78]}, {"entity": "metastatic cancer", "entity_type": "Anatomy", "pos": [83, 100]}], "task": "NER"}
+{"text": "Simultaneous involvement of the endometrium and the ovary by carcinoma is a familiar problem in the routine practice of surgical pathology .", "entity": [{"entity": "endometrium", "entity_type": "Anatomy", "pos": [32, 43]}, {"entity": "ovary", "entity_type": "Anatomy", "pos": [52, 57]}, {"entity": "carcinoma", "entity_type": "Anatomy", "pos": [61, 70]}], "task": "NER"}
+{"text": "Such cases may be considered either examples of a single primary carcinoma with metastasis or as synchronous primary neoplasms .", "entity": [{"entity": "primary carcinoma", "entity_type": "Anatomy", "pos": [57, 74]}, {"entity": "synchronous primary neoplasms", "entity_type": "Anatomy", "pos": [97, 126]}], "task": "NER"}
+{"text": "The distinction between these two possibilities is made based on clinicopathologic observations , and therefore may not be definitive .", "entity": [], "task": "NER"}
+{"text": "In the present study , the authors used molecular techniques to analyze the clonal composition of five cases of concurrent adenocarcinomas of the endometrium and ovary that were clinicopathologically diagnosed as synchronous primary tumors .", "entity": [{"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [123, 138]}, {"entity": "endometrium", "entity_type": "Anatomy", "pos": [146, 157]}, {"entity": "ovary", "entity_type": "Anatomy", "pos": [162, 167]}, {"entity": "synchronous primary tumors", "entity_type": "Anatomy", "pos": [213, 239]}], "task": "NER"}
+{"text": "Patterns of X - chromosome inactivation , mutations in the K - ras gene , mutations or allelic loss of the p53 gene , or human papillomavirus detection were identical in both endometrial and ovarian lesions in three of the cases suggesting that those three cases represented single primary tumors with metastases .", "entity": [{"entity": "X - chromosome", "entity_type": "Anatomy", "pos": [12, 26]}, {"entity": "endometrial", "entity_type": "Anatomy", "pos": [175, 186]}, {"entity": "ovarian lesions", "entity_type": "Anatomy", "pos": [191, 206]}, {"entity": "primary tumors", "entity_type": "Anatomy", "pos": [282, 296]}, {"entity": "metastases", "entity_type": "Anatomy", "pos": [302, 312]}], "task": "NER"}
+{"text": "In both of the other two cases , the patterns of X - chromosome inactivation clearly demonstrated the presence of independent primary tumors .", "entity": [{"entity": "X - chromosome", "entity_type": "Anatomy", "pos": [49, 63]}, {"entity": "primary tumors", "entity_type": "Anatomy", "pos": [126, 140]}], "task": "NER"}
+{"text": "The application of molecular technology may play an important role for the differential diagnosis between synchronous primary carcinomas and a single carcinoma with metastasis .", "entity": [{"entity": "synchronous primary carcinomas", "entity_type": "Anatomy", "pos": [106, 136]}, {"entity": "carcinoma", "entity_type": "Anatomy", "pos": [150, 159]}, {"entity": "metastasis", "entity_type": "Anatomy", "pos": [165, 175]}], "task": "NER"}
+{"text": "Molecular biology of cervical cancer and its precursors .", "entity": [{"entity": "cervical cancer", "entity_type": "Anatomy", "pos": [21, 36]}, {"entity": "precursors", "entity_type": "Anatomy", "pos": [45, 55]}], "task": "NER"}
+{"text": "Cervical cancer develops from well - defined precursor lesions referred to as either cervical intraepithelial neoplasia or squamous intraepithelial lesions .", "entity": [{"entity": "Cervical cancer", "entity_type": "Anatomy", "pos": [0, 15]}, {"entity": "precursor lesions", "entity_type": "Anatomy", "pos": [45, 62]}, {"entity": "cervical intraepithelial neoplasia", "entity_type": "Anatomy", "pos": [85, 119]}, {"entity": "squamous intraepithelial lesions", "entity_type": "Anatomy", "pos": [123, 155]}], "task": "NER"}
+{"text": "It is now known that specific types of human papillomaviruses ( HPV ) are the principal etiologic agents for both cervical cancer and its precursors .", "entity": [{"entity": "cervical cancer", "entity_type": "Anatomy", "pos": [114, 129]}, {"entity": "precursors", "entity_type": "Anatomy", "pos": [138, 148]}], "task": "NER"}
+{"text": "The high - oncogenic - risk HPV types associated with invasive cervical cancer produce two oncoproteins , designated E6 and E7 , which interact with endogenous cell cycle regulatory proteins , including p53 and Rb .", "entity": [{"entity": "invasive cervical cancer", "entity_type": "Anatomy", "pos": [54, 78]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [160, 164]}], "task": "NER"}
+{"text": "The interaction of virally derived and endogenous cellular proteins converges in deregulation of cell cycle progression and appears to be critical for the development of cervical cancers .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [50, 58]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [97, 101]}, {"entity": "cervical cancers", "entity_type": "Anatomy", "pos": [170, 186]}], "task": "NER"}
+{"text": "However , the development of cervical cancer is a multistep process that cannot be explained simply by infection with specific types of HPV .", "entity": [{"entity": "cervical cancer", "entity_type": "Anatomy", "pos": [29, 44]}], "task": "NER"}
+{"text": "One additional event that appears to play a role in tumor progression is integration of HPV DNA into the host genome .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [52, 57]}], "task": "NER"}
+{"text": "Integration of HPV DNA frequently disrupts the E2 open reading frames , resulting in overexpression of the E6 and E7 oncoproteins and possibly causing genomic instability .", "entity": [], "task": "NER"}
+{"text": "Additional cofactors and mutational events may be important in the pathogenesis of invasive cervical cancers and may include chromosomal rearrangements , loss of constitutional heterozygosity , and proto - oncogene activation .", "entity": [{"entity": "invasive cervical cancers", "entity_type": "Anatomy", "pos": [83, 108]}, {"entity": "chromosomal", "entity_type": "Anatomy", "pos": [125, 136]}], "task": "NER"}
+{"text": "The effects of radiation on neovascularization in a rat model .", "entity": [], "task": "NER"}
+{"text": "It is thought that radiation treatment inhibits neovascularization of recipient and / or graft tissues , and this may account in part for abnormalities in wound healing associated with radiation therapy .", "entity": [{"entity": "graft tissues", "entity_type": "Anatomy", "pos": [89, 102]}, {"entity": "wound", "entity_type": "Anatomy", "pos": [155, 160]}], "task": "NER"}
+{"text": "We have examined this hypothesis using a model that measures the neovascularization of an implanted foreign material .", "entity": [], "task": "NER"}
+{"text": "Expanded polytetrafluoroethylene ( PTFE ) sheets were implanted adjacent to both superficial epigastric vascular pedicles of 63 rats distributed into 7 groups ( n = 7 ) that differed with respect to dose and timing of irradiation .", "entity": [{"entity": "epigastric vascular pedicles", "entity_type": "Anatomy", "pos": [93, 121]}], "task": "NER"}
+{"text": "Zero to 10 daily fractions of electron - beam radiation ( 300 cGy each ) were delivered to the implant in the right groin , while the implant in the left groin served as a nonirradiated internal control .", "entity": [{"entity": "right groin", "entity_type": "Anatomy", "pos": [110, 121]}, {"entity": "left groin", "entity_type": "Anatomy", "pos": [149, 159]}], "task": "NER"}
+{"text": "Unirradiated animals showed equal neovascularization of both implants .", "entity": [], "task": "NER"}
+{"text": "Rats that were irradiated twice ( single fractions at 0 and 24 hours after implantation ) did not show a significant decrease in the neovascularization of the irradiated implant compared with the contralateral control implant .", "entity": [], "task": "NER"}
+{"text": "In contrast , the implants that were irradiated three times ( single fractions at 0 , 24 , and 48 hours after implantation ) demonstrated significantly diminished ( greater than 25 percent , p less than 0 . 05 ) neovascularization beyond day 7 , whereas implants irradiated only at 48 hours after implantation did not .", "entity": [], "task": "NER"}
+{"text": "Interestingly , neovascularization of the implants irradiated with 10 fractions ( 3000 cGy ) was not significantly decreased compared with irradiation with three fractions ( 900 cGy ) .", "entity": [], "task": "NER"}
+{"text": "Irradiation delivered before implantation ( 900 cGy ) inhibited neovascularization significantly less than the same dose administered after implantation .", "entity": [], "task": "NER"}
+{"text": "The results of this study suggest that a subclinical cumulative dose of 900 cGy is the threshold for impaired tissue revascularization provided that treatment is delivered immediately after implantation over a 48 - hour interval .", "entity": [{"entity": "tissue", "entity_type": "Anatomy", "pos": [110, 116]}], "task": "NER"}
+{"text": "Prognostic value of angiogenesis in operable non - small cell lung cancer .", "entity": [{"entity": "non - small cell lung cancer", "entity_type": "Anatomy", "pos": [45, 73]}], "task": "NER"}
+{"text": "Tumour angiogenesis is an important factor for tumour growth and metastasis .", "entity": [{"entity": "Tumour", "entity_type": "Anatomy", "pos": [0, 6]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [47, 53]}], "task": "NER"}
+{"text": "Although some recent reports suggest that microvessel counts in non - small cell lung cancer are related to a poor disease outcome , the results were not conclusive and were not compared with other molecular prognostic markers .", "entity": [{"entity": "microvessel", "entity_type": "Anatomy", "pos": [42, 53]}, {"entity": "non - small cell lung cancer", "entity_type": "Anatomy", "pos": [64, 92]}], "task": "NER"}
+{"text": "In the present study , the vascular grade was assessed in 107 ( T1 , 2 - N0 , 1 ) operable non - small cell lung carcinomas , using the JC70 monoclonal antibody to CD31 .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [27, 35]}, {"entity": "non - small cell lung carcinomas", "entity_type": "Anatomy", "pos": [91, 123]}], "task": "NER"}
+{"text": "Three vascular grades were defined with appraisal by eye and by Chalkley counting : high ( Chalkley score 7 - 12 ) , medium ( 5 - 6 ) , and low ( 2 - 4 ) .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [6, 14]}, {"entity": "eye", "entity_type": "Anatomy", "pos": [53, 56]}], "task": "NER"}
+{"text": "There was a significant correlation between eye appraisal and Chalkley counting ( P less than 0 . 0001 ) .", "entity": [{"entity": "eye", "entity_type": "Anatomy", "pos": [44, 47]}], "task": "NER"}
+{"text": "Vascular grade was not related to histology , grade , proliferation index ( Ki67 ) , or EGFR or p53 expression .", "entity": [{"entity": "Vascular", "entity_type": "Anatomy", "pos": [0, 8]}], "task": "NER"}
+{"text": "Tumours from younger patients had a higher grade of angiogenesis ( P = 0 . 05 ) .", "entity": [{"entity": "Tumours", "entity_type": "Anatomy", "pos": [0, 7]}], "task": "NER"}
+{"text": "Apart from the vascular grade , none of the other factors examined was statistically related to lymph node metastasis ( P less than 0 . 0001 ) .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [15, 23]}, {"entity": "lymph node", "entity_type": "Anatomy", "pos": [96, 106]}], "task": "NER"}
+{"text": "A univariate analysis of survival showed that vascular grade was the most significant prognostic factor ( P = 0 . 0004 ) , followed by N - stage ( P = 0 . 001 ) .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [46, 54]}], "task": "NER"}
+{"text": "In a multivariate analysis , N - stage and vascular grade were not found to be independent prognostic factors , since they were strongly related to each other .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [43, 51]}], "task": "NER"}
+{"text": "Excluding N - stage , vascular grade was the only independent prognostic factor ( P = 0 . 007 ) .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [22, 30]}], "task": "NER"}
+{"text": "Kaplan - Meier survival curves showed a statistically significant worse prognosis for patients with high vascular grade , but no difference was observed between low and medium vascular grade .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [105, 113]}, {"entity": "vascular", "entity_type": "Anatomy", "pos": [176, 184]}], "task": "NER"}
+{"text": "These data suggest that angiogenesis in operable non - small cell lung cancer is a major prognostic factor for survival and , among the parameters tested , is the only factor related to cancer cell migration to lymph nodes .", "entity": [{"entity": "non - small cell lung cancer", "entity_type": "Anatomy", "pos": [49, 77]}, {"entity": "cancer cell", "entity_type": "Anatomy", "pos": [186, 197]}, {"entity": "lymph nodes", "entity_type": "Anatomy", "pos": [211, 222]}], "task": "NER"}
+{"text": "The integration of vascular grading in clinical trials on adjuvant chemotherapy and / or radiotherapy could substantially contribute in defining groups of operable patients who might benefit from cytotoxic treatment .", "entity": [{"entity": "vascular", "entity_type": "Anatomy", "pos": [19, 27]}], "task": "NER"}
+{"text": "Vitamin E inhibits experimental carcinogenesis and tumour angiogenesis .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [51, 57]}], "task": "NER"}
+{"text": "In an experiment in which vitamin E inhibited carcinogenesis , it was found that tumour angiogenesis and tumour growth - factor alpha ( TGF alpha ) expression were also inhibited .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [81, 87]}], "task": "NER"}
+{"text": "Forty male golden hamsters were divided into four equal groups .", "entity": [], "task": "NER"}
+{"text": "Group 1 animals had the left buccal pouches painted three times weekly with 7 , 12 - dimethylbenz ( a ) anthracene ( DMBA ) for 14 weeks .", "entity": [{"entity": "left buccal pouches", "entity_type": "Anatomy", "pos": [24, 43]}], "task": "NER"}
+{"text": "Group 2 animals had the same procedure of DMBA applications but also received alpha tocopherol .", "entity": [], "task": "NER"}
+{"text": "Groups 3 and 4 were vitamin E and untreated controls .", "entity": [], "task": "NER"}
+{"text": "Angiogenesis was studied with factor 8 - related antigen ( F8 - RA ) which identifies endothelial cells .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [86, 103]}], "task": "NER"}
+{"text": "TGF alpha was studied with the appropriate antibody .", "entity": [], "task": "NER"}
+{"text": "Staining was effected by the standard avidin - biotin horseradish peroxidase system .", "entity": [], "task": "NER"}
+{"text": "Mean tumour volume was significantly lower in the DMBA - vitamin E group compared to the tumour control group .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [5, 11]}, {"entity": "tumour", "entity_type": "Anatomy", "pos": [89, 95]}], "task": "NER"}
+{"text": "Angiogenesis was significantly inhibited in the DMBA - vitamin E group and TGF alpha expression was also inhibited .", "entity": [], "task": "NER"}
+{"text": "It is suggested that inhibition of tumour angiogenesis by vitamin E may be an additional mechanism for the anticancer action of vitamin E .", "entity": [{"entity": "tumour", "entity_type": "Anatomy", "pos": [35, 41]}, {"entity": "anticancer", "entity_type": "Anatomy", "pos": [107, 117]}], "task": "NER"}
+{"text": "Curcumin induces apoptosis in immortalized NIH 3T3 and malignant cancer cell lines .", "entity": [{"entity": "NIH 3T3", "entity_type": "Anatomy", "pos": [43, 50]}, {"entity": "malignant cancer cell lines", "entity_type": "Anatomy", "pos": [55, 82]}], "task": "NER"}
+{"text": "Curcumin , which is a widely used dietary pigment and spice , has been demonstrated to be an effective inhibitor of tumor promotion in mouse skin carcinogenesis .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [116, 121]}, {"entity": "skin", "entity_type": "Anatomy", "pos": [141, 145]}], "task": "NER"}
+{"text": "We report that curcumin induces cell shrinkage , chromatin condensation , and DNA fragmentation , characteristics of apoptosis , in immortalized mouse embryo fibroblast NIH 3T3 erb B2 oncogene - transformed NIH 3T3 , mouse sarcoma S180 , human colon cancer cell HT - 29 , human kidney cancer cell 293 , and human hepatocellular carcinoma Hep G2 cells , but not in primary culture of mouse embryonic fibroblast C3H 10T1 / 2 , rat embryonic fibroblast , and human foreskin fibroblast cells in a concentration - and time - dependent manner .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [32, 36]}, {"entity": "chromatin", "entity_type": "Anatomy", "pos": [49, 58]}, {"entity": "embryo fibroblast NIH 3T3", "entity_type": "Anatomy", "pos": [151, 176]}, {"entity": "NIH 3T3", "entity_type": "Anatomy", "pos": [207, 214]}, {"entity": "sarcoma S180", "entity_type": "Anatomy", "pos": [223, 235]}, {"entity": "colon cancer cell HT - 29", "entity_type": "Anatomy", "pos": [244, 269]}, {"entity": "kidney cancer cell 293", "entity_type": "Anatomy", "pos": [278, 300]}, {"entity": "hepatocellular carcinoma Hep G2 cells", "entity_type": "Anatomy", "pos": [313, 350]}, {"entity": "culture", "entity_type": "Anatomy", "pos": [372, 379]}, {"entity": "embryonic fibroblast C3H 10T1 / 2", "entity_type": "Anatomy", "pos": [389, 422]}, {"entity": "embryonic fibroblast", "entity_type": "Anatomy", "pos": [429, 449]}, {"entity": "foreskin fibroblast cells", "entity_type": "Anatomy", "pos": [462, 487]}], "task": "NER"}
+{"text": "Many cellular and biochemical effects of curcumin in mouse fibroblast cells have been reported , such as inhibition of protein kinase C ( PKC ) activity induced by phorbol 12 - myristate 13 - acetate treatment , inhibition of tyrosine protein kinase activity , and inhibition of arachidonic acid ( AA ) metabolism .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [5, 13]}, {"entity": "fibroblast cells", "entity_type": "Anatomy", "pos": [59, 75]}], "task": "NER"}
+{"text": "Treatment of NIH 3T3 cells with the PKC inhibitor staurosporine , the tyrosine kinase inhibitor herbimycin A , and the AA metabolism inhibitor quinacrine induces apoptotic cell death .", "entity": [{"entity": "NIH 3T3 cells", "entity_type": "Anatomy", "pos": [13, 26]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [172, 176]}], "task": "NER"}
+{"text": "These results suggest that , in some immortalized and transformed cells , blocking the cellular signal transduction might trigger the induction of apoptosis .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [66, 71]}, {"entity": "cellular", "entity_type": "Anatomy", "pos": [87, 95]}], "task": "NER"}
+{"text": "Do we know how much people like one another ?", "entity": [], "task": "NER"}
+{"text": "Metaperception is a person ' s perception about a second person ' s perception of a third person .", "entity": [], "task": "NER"}
+{"text": "The purpose of this article is to examine the accuracy of metaperceptions of liking .", "entity": [], "task": "NER"}
+{"text": "A related question concerns whether the heuristics of balance , reciprocity , and agreement are used by perceivers when forming such judgments .", "entity": [], "task": "NER"}
+{"text": "The authors present analyses from 5 diverse research studies that used an adaptation of the social relations model for triads ( C . F . Bond , E . M . Horn , & D . A . Kenny , in press ) .", "entity": [], "task": "NER"}
+{"text": "The results indicate that people know how much people like one another , even with small amounts of information .", "entity": [], "task": "NER"}
+{"text": "Although there is evidence for the use of heuristics , particularly reciprocity and agreement , accuracy is sometimes enhanced by using these heuristics .", "entity": [], "task": "NER"}
+{"text": "Genetic heterogeneity evidenced by low incidence of KAL - 1 gene mutations in sporadic cases of gonadotropin - releasing hormone deficiency .", "entity": [], "task": "NER"}
+{"text": "Isolated GnRH deficiency is a heritable condition characterized by a functional deficit in GnRH secretion .", "entity": [], "task": "NER"}
+{"text": "Familial cases with different modes of inheritance have been described , and the gene responsible for the X - linked form ( KAL - 1 ) has been identified .", "entity": [], "task": "NER"}
+{"text": "However , sporadic cases with no documented family history of GnRH deficiency account for the majority of the affected patients .", "entity": [], "task": "NER"}
+{"text": "For this reason , we sought to determine the frequency with which KAL - 1 gene mutations occur in patients with sporadic GnRH deficiency .", "entity": [], "task": "NER"}
+{"text": "Only 1 of 21 patients with sporadic GnRH deficiency was found to bear a defect in the KAL - 1 gene ( a deletion of 14 bases starting at codon 464 ) .", "entity": [], "task": "NER"}
+{"text": "Three types of polymorphic single base substitutions with no apparent correlation with GnRH deficiency were also detected in several patients .", "entity": [], "task": "NER"}
+{"text": "In each of 3 different patients with an X - linked mode of inheritance , 3 genetic defects , 2 point mutations and a small intragenic deletion , were detected .", "entity": [], "task": "NER"}
+{"text": "These defects consist of a single base mutation introducing a stop codon at position 328 , a single base mutation resulting in a phenylalanine to leucine substitution at position 517 , and a 9 - base deletion at the 3 ' - exon - intron splice site of exon 8 , respectively .", "entity": [], "task": "NER"}
+{"text": "All identified genetic defects occur within the fibronectin type III repeats of the predicted protein encoded by the KAL - 1 gene .", "entity": [], "task": "NER"}
+{"text": "In conclusion , our study indicates that the incidence of genetic defects within the coding region of the KAL - 1 gene in patients with sporadic GnRH deficiency is low ( 5 - 8 % ) , thus supporting the idea that the X - linked form of inheritance represents the least common form of the disease .", "entity": [], "task": "NER"}
+{"text": "The effect of early diagnosis and treatment in cystic fibrosis : a seven - year study of 16 sibling pairs .", "entity": [], "task": "NER"}
+{"text": "Data on 16 sibling pairs with cystic fibrosis were analyzed to test the hypothesis that early treatment of this condition improves prognosis .", "entity": [], "task": "NER"}
+{"text": "Younger siblings ' conditions were diagnosed before 1 year of age , usually before the onset of pulmonary disease .", "entity": [{"entity": "pulmonary", "entity_type": "Anatomy", "pos": [96, 105]}], "task": "NER"}
+{"text": "Older siblings ' conditions were diagnosed after 1 year of age and after the onset of pulmonary disease .", "entity": [{"entity": "pulmonary", "entity_type": "Anatomy", "pos": [86, 95]}], "task": "NER"}
+{"text": "Although the sibling pairs received similar treatment , comparison at 7 years of age showed that the younger siblings had significantly better chest roentgenogram scores , total clinical scores , residual lung volumes , and ratios of residual volume to total lung volume .", "entity": [{"entity": "chest", "entity_type": "Anatomy", "pos": [143, 148]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [205, 209]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [259, 263]}], "task": "NER"}
+{"text": "Younger siblings also required fewer hospital admissions to control their lung disease .", "entity": [{"entity": "lung", "entity_type": "Anatomy", "pos": [74, 78]}], "task": "NER"}
+{"text": "The results suggest that , in general , early initiation of therapy is beneficial for patients with cystic fibrosis .", "entity": [], "task": "NER"}
+{"text": "Fas - signaling and effects on receptor tyrosine kinase signal transduction in human breast epithelial cells .", "entity": [{"entity": "breast epithelial cells", "entity_type": "Anatomy", "pos": [85, 108]}], "task": "NER"}
+{"text": "Fas - mediated cell death was examined in MCF - 10AT preneoplastic human breast epithelial cells .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [15, 19]}, {"entity": "MCF - 10AT preneoplastic human breast epithelial cells", "entity_type": "Anatomy", "pos": [42, 96]}], "task": "NER"}
+{"text": "Treatment with anti - Fas for 48 h induced apoptosis with cells exhibiting typical apoptotic features including loss of cell contact , condensation of chromatin , and increased staining of the nuclear membrane .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [58, 63]}, {"entity": "cell", "entity_type": "Anatomy", "pos": [120, 124]}, {"entity": "chromatin", "entity_type": "Anatomy", "pos": [151, 160]}, {"entity": "nuclear membrane", "entity_type": "Anatomy", "pos": [193, 209]}], "task": "NER"}
+{"text": "DNA fragmentation occurred in response to anti - Fas treatment .", "entity": [], "task": "NER"}
+{"text": "Anti - Fas treatment resulted in decreased p53 protein levels , while bcl - 2 and bax protein levels remained unaffected .", "entity": [], "task": "NER"}
+{"text": "Cells treated with anti - Fas also exhibited increased tyrosine phosphorylation of the c - met growth factor receptor tyrosine kinase .", "entity": [{"entity": "Cells", "entity_type": "Anatomy", "pos": [0, 5]}], "task": "NER"}
+{"text": "Immunoprecipitation experiments demonstrated that Fas associated with c - erbB2 and c - met in untreated cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [105, 110]}], "task": "NER"}
+{"text": "Treatment with anti - Fas , however , significantly decreased Fas - c - erbB2 and Fas - c - met association .", "entity": [], "task": "NER"}
+{"text": "Anti - Fas treatment of these cells caused a significant decrease in p120 - GAP levels , ERK - 1 levels , and phosphorylation , as well as Grb2 - Sosl and MEK - 1 - ERK - 1 association .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [30, 35]}], "task": "NER"}
+{"text": "These results show that Fas - signaling exerted a suppressive effect on p53 levels and on downstream effectors of receptor tyrosine kinase signal transduction , thereby ensuring cell death .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [178, 182]}], "task": "NER"}
+{"text": "Prevention of hepatic tumor metastases in rats with herpes viral vaccines and gamma - interferon .", "entity": [{"entity": "hepatic tumor", "entity_type": "Anatomy", "pos": [14, 27]}], "task": "NER"}
+{"text": "Previous studies showed that gammaIFN decreases metastatic hepatic tumor growth by stimulating Kupffer cells ( KC ) .", "entity": [{"entity": "metastatic hepatic tumor", "entity_type": "Anatomy", "pos": [48, 72]}, {"entity": "Kupffer cells", "entity_type": "Anatomy", "pos": [95, 108]}, {"entity": "KC", "entity_type": "Anatomy", "pos": [111, 113]}], "task": "NER"}
+{"text": "The present studies examine whether lymphocyte stimulation via cells engineered to secrete GM - CSF or IL - 2 decreases hepatic tumor growth , and whether stimulation of both macrophages and lymphocytes is more effective than either individually .", "entity": [{"entity": "lymphocyte", "entity_type": "Anatomy", "pos": [36, 46]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [63, 68]}, {"entity": "hepatic tumor", "entity_type": "Anatomy", "pos": [120, 133]}, {"entity": "macrophages", "entity_type": "Anatomy", "pos": [175, 186]}, {"entity": "lymphocytes", "entity_type": "Anatomy", "pos": [191, 202]}], "task": "NER"}
+{"text": "Rats were immunized with irradiated hepatoma cells transduced by herpes viral amplicon vectors containing the genes for GM - CSF , IL - 2 or LacZ .", "entity": [{"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [36, 50]}], "task": "NER"}
+{"text": "On day 18 , half of each group was treated with 5 x 10 ( 4 ) U gammaIFN , or saline intraperitoneally for 3 d .", "entity": [{"entity": "intraperitoneally", "entity_type": "Anatomy", "pos": [84, 101]}], "task": "NER"}
+{"text": "On day 21 , all rats received 5 x 10 ( 5 ) hepatoma cells intrasplenically .", "entity": [{"entity": "hepatoma cells", "entity_type": "Anatomy", "pos": [43, 57]}, {"entity": "intrasplenically", "entity_type": "Anatomy", "pos": [58, 74]}], "task": "NER"}
+{"text": "On day 41 , rats were killed and tumor nodules were counted .", "entity": [{"entity": "tumor nodules", "entity_type": "Anatomy", "pos": [33, 46]}], "task": "NER"}
+{"text": "Separate rats underwent splenocyte and KC harvest for assessment of lymphocyte - and macrophage - mediated tumor cell kill in vitro .", "entity": [{"entity": "splenocyte", "entity_type": "Anatomy", "pos": [24, 34]}, {"entity": "KC", "entity_type": "Anatomy", "pos": [39, 41]}, {"entity": "lymphocyte", "entity_type": "Anatomy", "pos": [68, 78]}, {"entity": "macrophage", "entity_type": "Anatomy", "pos": [85, 95]}, {"entity": "tumor cell", "entity_type": "Anatomy", "pos": [107, 117]}], "task": "NER"}
+{"text": "GM - CSF or IL - 2 vaccines or gammaIFN decreased tumor nodules significantly ( GM - CSF 13 + / - 4 , IL - 2 14 + / - 6 vs . control 75 + / - 24 , P < 0 . 001 ) .", "entity": [{"entity": "tumor nodules", "entity_type": "Anatomy", "pos": [50, 63]}], "task": "NER"}
+{"text": "Combination therapy was more effective , and completely eliminated tumor in 4 of 12 IFN - GM - CSF and 8 of 11 IFN - IL - 2 animals .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [67, 72]}], "task": "NER"}
+{"text": "Additional rats underwent partial hepatectomy , an immunosuppressive procedure known to accelerate the growth of hepatic tumor , following tumor challenge .", "entity": [{"entity": "hepatic tumor", "entity_type": "Anatomy", "pos": [113, 126]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [139, 144]}], "task": "NER"}
+{"text": "Therapy was equally effective in this immunosuppressive setting .", "entity": [], "task": "NER"}
+{"text": "Vaccination is associated with enhancement of splenocyte - mediated tumoricidal activity , whereas the effect of gammaIFN is mediated by KC .", "entity": [{"entity": "splenocyte", "entity_type": "Anatomy", "pos": [46, 56]}, {"entity": "KC", "entity_type": "Anatomy", "pos": [137, 139]}], "task": "NER"}
+{"text": "GM - CSF and IL - 2 vaccine therapy and pretreatment with gammaIFN represent effective strategies in reducing hepatic tumor .", "entity": [{"entity": "hepatic tumor", "entity_type": "Anatomy", "pos": [110, 123]}], "task": "NER"}
+{"text": "Combination therapy targets both lymphocytes and macrophages , and is more effective in reducing tumor than either therapy alone .", "entity": [{"entity": "lymphocytes", "entity_type": "Anatomy", "pos": [33, 44]}, {"entity": "macrophages", "entity_type": "Anatomy", "pos": [49, 60]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [97, 102]}], "task": "NER"}
+{"text": "The effects of oxidative stress on in vivo brain GSH turnover in young and mature mice .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [43, 48]}], "task": "NER"}
+{"text": "Glutathione ( GSH ) synthetase activities and GSH turnover rates were examined during severe oxidative stress in the mouse brain as induced by t - butylhydroperoxide ( t - BuOOH ) .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [123, 128]}], "task": "NER"}
+{"text": "Brain GSH synthetase activities in 8 - mo - old mice in the cortex , striatum , thalamus , hippocampus , midbrain , and cerebellum were found to increase following t - BuOOH treatment .", "entity": [{"entity": "Brain", "entity_type": "Anatomy", "pos": [0, 5]}, {"entity": "cortex", "entity_type": "Anatomy", "pos": [60, 66]}, {"entity": "striatum", "entity_type": "Anatomy", "pos": [69, 77]}, {"entity": "thalamus", "entity_type": "Anatomy", "pos": [80, 88]}, {"entity": "hippocampus", "entity_type": "Anatomy", "pos": [91, 102]}, {"entity": "midbrain", "entity_type": "Anatomy", "pos": [105, 113]}, {"entity": "cerebellum", "entity_type": "Anatomy", "pos": [120, 130]}], "task": "NER"}
+{"text": "The effect of GSH synthesis on brain GSH turnover rates for 2 - and 8 - mo - old mice were determined after intracerebroventricular ( icv ) injection of [ 35S ] cysteine .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [31, 36]}], "task": "NER"}
+{"text": "Rate constants for GSH turnover were determined by least - squares iterative minimization from the specific activity data from 20 min to 108 h after [ 35S ] cysteine administration .", "entity": [], "task": "NER"}
+{"text": "GSH and glutathione disulfide ( GSSG ) specific activities were determined after separation by high - pressure liquid chromatography ( HPLC ) .", "entity": [], "task": "NER"}
+{"text": "The half - life of GSH in the 2 - mo - old mouse was 59 . 5 h and in the 8 - mo - old mouse was 79 . 1 h .", "entity": [], "task": "NER"}
+{"text": "In summary , defense mechanisms against oxidative stress in the brain differ with age .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [64, 69]}], "task": "NER"}
+{"text": "Young mice can increase the cellular availability of GSH , whereas mature mice can increase GSH synthetase activity during oxidative stress .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [28, 36]}], "task": "NER"}
+{"text": "These differences make mature mice more susceptible to brain oxidative damage .", "entity": [{"entity": "brain", "entity_type": "Anatomy", "pos": [55, 60]}], "task": "NER"}
+{"text": "Insulin - like growth factor I induces tumor hexokinase RNA expression in cancer cells .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [39, 44]}, {"entity": "cancer cells", "entity_type": "Anatomy", "pos": [74, 86]}], "task": "NER"}
+{"text": "Increased glycolysis is a characteristic of cancer cells .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [44, 56]}], "task": "NER"}
+{"text": "Though less efficient in energy production , it ensures continuous supply of energy and phosphometabolites for biosynthesis enabling metastatic and less vascularized cancer cells to proliferate even under hypoxic conditions .", "entity": [{"entity": "metastatic", "entity_type": "Anatomy", "pos": [133, 143]}, {"entity": "vascularized cancer cells", "entity_type": "Anatomy", "pos": [153, 178]}], "task": "NER"}
+{"text": "Since hexokinase is the first rate limiting enzyme in the glycolytic pathway , elevated levels of Type II like hexokinase in tumors are of great significance in this context .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [125, 131]}], "task": "NER"}
+{"text": "Under normal conditions insulin regulates expression of hexokinase Type II isoenzyme , which is predominantly expressed in muscle .", "entity": [{"entity": "muscle", "entity_type": "Anatomy", "pos": [123, 129]}], "task": "NER"}
+{"text": "On the other hand cancer cells overexpress insulin - like growth factors and their receptors which mimic many activities of insulin .", "entity": [{"entity": "cancer cells", "entity_type": "Anatomy", "pos": [18, 30]}], "task": "NER"}
+{"text": "This prompted us to examine a hypothesis that insulin - like growth factors may be responsible for overexpression of tumor hexokinase .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [117, 122]}], "task": "NER"}
+{"text": "Our experiments demonstrate that insulin - like growth factor I indeed induces hexokinase gene expression in a concentration and time dependent manner in two cancer cell lines we studied .", "entity": [{"entity": "cancer cell lines", "entity_type": "Anatomy", "pos": [158, 175]}], "task": "NER"}
+{"text": "Suppression of tumor growth by the 3 ' untranslated region of mel - 18 in 3Y1 cells transformed by the E6 and E7 genes of human papillomavirus type 18 .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [15, 20]}, {"entity": "3Y1 cells", "entity_type": "Anatomy", "pos": [74, 83]}], "task": "NER"}
+{"text": "By introducing a cDNA library derived from rat embryonic fibroblast cells , we isolated several morphologically flat revertants of rat 3Y1 cells transformed by the E6 and E7 genes of human papillomavirus type 18 ( HPV18 ) .", "entity": [{"entity": "embryonic fibroblast cells", "entity_type": "Anatomy", "pos": [47, 73]}, {"entity": "revertants", "entity_type": "Anatomy", "pos": [117, 127]}, {"entity": "3Y1 cells", "entity_type": "Anatomy", "pos": [135, 144]}], "task": "NER"}
+{"text": "From one of the revertants , we recovered a 0 . 2 - kb cDNA , N56 , that suppresses the tumor growth of the transformed 3Y1 cells irrespective of the expression of the E6 and E7 genes .", "entity": [{"entity": "revertants", "entity_type": "Anatomy", "pos": [16, 26]}, {"entity": "tumor", "entity_type": "Anatomy", "pos": [88, 93]}, {"entity": "transformed 3Y1 cells", "entity_type": "Anatomy", "pos": [108, 129]}], "task": "NER"}
+{"text": "The nucleotide sequence of the cDNA was shown to be identical to that of the 3 ' untranslated region of a putative mammalian polycomb group gene , mel - 18 .", "entity": [], "task": "NER"}
+{"text": "Calretinin .", "entity": [], "task": "NER"}
+{"text": "A selective marker of normal and neoplastic mesothelial cells in serous effusions .", "entity": [{"entity": "neoplastic mesothelial cells", "entity_type": "Anatomy", "pos": [33, 61]}, {"entity": "serous effusions", "entity_type": "Anatomy", "pos": [65, 81]}], "task": "NER"}
+{"text": "OBJECTIVE : To document that a polyclonal antiserum to calretinin , a 29 - kd calcium - binding protein , consistently decorates normal and tumor mesothelial cells in cytologic preparations .", "entity": [{"entity": "antiserum", "entity_type": "Anatomy", "pos": [42, 51]}, {"entity": "tumor mesothelial cells", "entity_type": "Anatomy", "pos": [140, 163]}, {"entity": "cytologic preparations", "entity_type": "Anatomy", "pos": [167, 189]}], "task": "NER"}
+{"text": "STUDY DESIGN : Thirty - three archival cytologic specimens from eight patients with histologically confirmed malignant mesothelioma and 13 from patients with metastatic serous effusions were destained and then immunostained with anticalretinin antiserum .", "entity": [{"entity": "cytologic specimens", "entity_type": "Anatomy", "pos": [39, 58]}, {"entity": "malignant mesothelioma", "entity_type": "Anatomy", "pos": [109, 131]}, {"entity": "metastatic serous effusions", "entity_type": "Anatomy", "pos": [158, 185]}, {"entity": "antiserum", "entity_type": "Anatomy", "pos": [244, 253]}], "task": "NER"}
+{"text": "For investigation of cell suspensions , four pleural fluids were incubated with anticalretinin antiserum .", "entity": [{"entity": "cell suspensions", "entity_type": "Anatomy", "pos": [21, 37]}, {"entity": "pleural fluids", "entity_type": "Anatomy", "pos": [45, 59]}, {"entity": "antiserum", "entity_type": "Anatomy", "pos": [95, 104]}], "task": "NER"}
+{"text": "After cytocentrifugation the specimens were stained in accordance with the alkaline phosphatase anti - alkaline phosphatase ( APAAP ) method .", "entity": [{"entity": "specimens", "entity_type": "Anatomy", "pos": [29, 38]}], "task": "NER"}
+{"text": "For electron microscopic examination the cell suspensions were then incubated with gold - labeled antirabbit antibody .", "entity": [{"entity": "cell suspensions", "entity_type": "Anatomy", "pos": [41, 57]}], "task": "NER"}
+{"text": "RESULTS : The diagnostic sensitivity of this new immunocytochemical approach reached 100 % for the eight malignant mesotheliomas investigated .", "entity": [{"entity": "malignant mesotheliomas", "entity_type": "Anatomy", "pos": [105, 128]}], "task": "NER"}
+{"text": "Only 3 of the 13 adenocarcinomas metastatic to the serous membranes included in this study were weakly reactive , accounting for 81 % specificity .", "entity": [{"entity": "adenocarcinomas", "entity_type": "Anatomy", "pos": [17, 32]}, {"entity": "serous membranes", "entity_type": "Anatomy", "pos": [51, 67]}], "task": "NER"}
+{"text": "Binding of anticalretinin antiserum to living mesothelial cells was consistently documented in all four cases investigated .", "entity": [{"entity": "antiserum", "entity_type": "Anatomy", "pos": [26, 35]}, {"entity": "mesothelial cells", "entity_type": "Anatomy", "pos": [46, 63]}], "task": "NER"}
+{"text": "CONCLUSION : Calretinin is a very useful marker for positive identification of normal and tumor mesothelial cells in serous effusions .", "entity": [{"entity": "tumor mesothelial cells", "entity_type": "Anatomy", "pos": [90, 113]}, {"entity": "serous effusions", "entity_type": "Anatomy", "pos": [117, 133]}], "task": "NER"}
+{"text": "Prognostic value of HLA - DR expression and dendritic cell infiltration in gastric cancer .", "entity": [{"entity": "dendritic cell", "entity_type": "Anatomy", "pos": [44, 58]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [75, 89]}], "task": "NER"}
+{"text": "We attempted to correlate the expression of human leukocyte antigen DR ( HLA - DR ) and tumor infiltration by S - 100 - protein - positive dendritic cells with clinicopathologic features in 165 patients with gastric cancer .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [88, 93]}, {"entity": "S - 100 - protein - positive dendritic cells", "entity_type": "Anatomy", "pos": [110, 154]}, {"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [208, 222]}], "task": "NER"}
+{"text": "The expression of HLA - DR was correlated with the histologic type .", "entity": [], "task": "NER"}
+{"text": "Infiltration of dendritic cells correlated negatively with distant lymph node metastases , clinical stage , and peritoneal invasion .", "entity": [{"entity": "dendritic cells", "entity_type": "Anatomy", "pos": [16, 31]}, {"entity": "lymph node metastases", "entity_type": "Anatomy", "pos": [67, 88]}, {"entity": "peritoneal", "entity_type": "Anatomy", "pos": [112, 122]}], "task": "NER"}
+{"text": "There was no correlation between the expression of HLA - DR and infiltration by dendritic cells .", "entity": [{"entity": "dendritic cells", "entity_type": "Anatomy", "pos": [80, 95]}], "task": "NER"}
+{"text": "In patients with resectable gastric cancer , the grade of infiltrating dendritic cells may be a suitable predictor of prognosis .", "entity": [{"entity": "gastric cancer", "entity_type": "Anatomy", "pos": [28, 42]}, {"entity": "dendritic cells", "entity_type": "Anatomy", "pos": [71, 86]}], "task": "NER"}
+{"text": "Integrin alphavbeta3 requirement for sustained mitogen - activated protein kinase activity during angiogenesis .", "entity": [], "task": "NER"}
+{"text": "Angiogenesis depends on growth factors and vascular cell adhesion events .", "entity": [{"entity": "vascular cell", "entity_type": "Anatomy", "pos": [43, 56]}], "task": "NER"}
+{"text": "Integrins and growth factors are capable of activating the ras / MAP kinase pathway in vitro , yet how these signals influence endothelial cells during angiogenesis is unknown .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [127, 144]}], "task": "NER"}
+{"text": "Upon initiation of angiogenesis with basic fibroblast growth factor ( bFGF ) on the chick chorioallantoic membrane ( CAM ) , endothelial cell mitogen - activated protein ( MAP ) kinase ( ERK ) activity was detected as early as 5 min yet was sustained for at least 20 h .", "entity": [{"entity": "chorioallantoic membrane", "entity_type": "Anatomy", "pos": [90, 114]}, {"entity": "CAM", "entity_type": "Anatomy", "pos": [117, 120]}, {"entity": "endothelial cell", "entity_type": "Anatomy", "pos": [125, 141]}], "task": "NER"}
+{"text": "The initial wave of ERK activity ( 5 - 120 min ) was refractory to integrin antagonists , whereas the sustained activity ( 4 - 20 h ) depended on integrin alphavbeta3 , but not beta1 integrins .", "entity": [], "task": "NER"}
+{"text": "Inhibition of MAP kinase kinase ( MEK ) during this sustained alphavbeta3 - dependent ERK signal blocked the formation of new blood vessels while not influencing preexisting blood vessels on the CAM .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [126, 139]}, {"entity": "blood vessels", "entity_type": "Anatomy", "pos": [174, 187]}, {"entity": "CAM", "entity_type": "Anatomy", "pos": [195, 198]}], "task": "NER"}
+{"text": "Inhibition of MEK also blocked growth factor induced migration but not adhesion of endothelial cells in vitro .", "entity": [{"entity": "endothelial cells", "entity_type": "Anatomy", "pos": [83, 100]}], "task": "NER"}
+{"text": "Therefore , angiogenesis depends on sustained ERK activity regulated by the ligation state of both a growth factor receptor and integrin alphavbeta3 .", "entity": [], "task": "NER"}
+{"text": "Basic fibroblast growth factor : a missing link between collagen VII , increased collagenase , and squamous cell carcinoma in recessive dystrophic epidermolysis bullosa .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [99, 122]}], "task": "NER"}
+{"text": "BACKGROUND : Patients with recessive dystrophic epidermolysis bullosa ( RDEB ) have deficiencies of collagen type VII and have elevated levels of fibroblast collagenase , and a greatly increased risk of cutaneous squamous cell carcinoma .", "entity": [{"entity": "cutaneous squamous cell carcinoma", "entity_type": "Anatomy", "pos": [203, 236]}], "task": "NER"}
+{"text": "Patients with other genetic blistering disorders do not have elevated collagenase or an increased risk of squamous cell carcinoma , despite chronic wounding .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [106, 129]}], "task": "NER"}
+{"text": "The connection between collagen type VII deficiency , increased collagenase , and squamous cell carcinoma is not understood .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [82, 105]}], "task": "NER"}
+{"text": "MATERIALS AND METHODS : Urine from 81 patients with RDEB ( 39 patients ) , junctional epidermolysis bullosa ( JEB ; 12 patients ) , and epidermolysis bullosa simplex ( EBS ; 30 patients ) , as well as unaffected family members of RDEB patients ( 33 patients ) , was tested for the presence of basic fibroblast growth factor ( bFGF ) using a sensitive radioimmunoassay .", "entity": [{"entity": "Urine", "entity_type": "Anatomy", "pos": [24, 29]}], "task": "NER"}
+{"text": "These patients included many who were enrolled in the Epidermolysis Bullosa Registry and others who were referred by their physicians .", "entity": [], "task": "NER"}
+{"text": "RESULTS : Fifty - one percent of patients with RDEB had elevated levels ( greater than 5000 pg / g ) of urinary bFGF .", "entity": [{"entity": "urinary", "entity_type": "Anatomy", "pos": [104, 111]}], "task": "NER"}
+{"text": "In contrast , none of the patients with JEB had elevated levels of bFGF .", "entity": [], "task": "NER"}
+{"text": "Twenty - one percent of clinically unaffected family members had elevated levels of bFGF , and 13 % of patients with EBS had elevated levels of bFGF .", "entity": [], "task": "NER"}
+{"text": "The frequency of elevated bFGF values among all groups was statistically significant ( p = 0 . 002 ) , and the levels of bFGF in RDEB patients were significantly elevated compared with those of other groups ( p less than 0 . 05 ) .", "entity": [], "task": "NER"}
+{"text": "CONCLUSIONS : We have found that patients with RDEB have elevated levels of bFGF , which may contribute to increased fibroblast collagenase and the development of squamous cell carcinoma .", "entity": [{"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [163, 186]}], "task": "NER"}
+{"text": "These results suggest a novel treatment for RDEB , namely , angiogenesis inhibitors , which may antagonize the effects of bFGF in this disorder .", "entity": [], "task": "NER"}
+{"text": "There are currently no other means of treatment for this disorder , which has a high morbidity and mortality rate .", "entity": [], "task": "NER"}
+{"text": "Multiple phosphotyrosine phosphatase mRNAs are expressed in the human lung fibroblast cell line WI - 38 .", "entity": [{"entity": "lung fibroblast cell line WI - 38", "entity_type": "Anatomy", "pos": [70, 103]}], "task": "NER"}
+{"text": "Protein tyrosine phosphatases are important components of signal transduction pathways .", "entity": [], "task": "NER"}
+{"text": "The authors have used reverse transcription / polymerase chain reactions to accomplish a comprehensive examination of the RNA expression for 58 distinct mammalian protein tyrosine and dual specificity phosphatase ( PTPase ) and PTPase - like genes in the normal human diploid fibroblast cell line WI - 38 .", "entity": [{"entity": "diploid fibroblast cell line WI - 38", "entity_type": "Anatomy", "pos": [268, 304]}], "task": "NER"}
+{"text": "Thirty - seven of these PTPase genes express easily measurable RNA , and four simultaneously express the RNA for two or more isoforms .", "entity": [], "task": "NER"}
+{"text": "Messages for an additional eight PTPase genes are detectable at low levels .", "entity": [], "task": "NER"}
+{"text": "Only 14 known PTPase genes do not express measurable RNA under our conditions .", "entity": [], "task": "NER"}
+{"text": "For purposes of comparison , the authors also assessed the PTPases expressed in the WI - 38 cell line using highly degenerate primers to conserved motifs found in the classical tyrosine - specific PTPases .", "entity": [{"entity": "WI - 38 cell line", "entity_type": "Anatomy", "pos": [84, 101]}], "task": "NER"}
+{"text": "Only eight of the 22 classic tyrosine - specific PTPases detected using the specific primers were detected using these degenerate primers .", "entity": [], "task": "NER"}
+{"text": "Our panel of specific PTPase primers should be very useful for semiquantitatively assessing the repertoire of PTPases expressed by cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [131, 136]}], "task": "NER"}
+{"text": "Epstein - Barr virus - associated nonsmall cell lung carcinoma : undifferentiated \" lymphoepithelioma - like \" carcinoma as a distinct entity with better prognosis .", "entity": [{"entity": "nonsmall cell lung carcinoma", "entity_type": "Anatomy", "pos": [34, 62]}, {"entity": "\" lymphoepithelioma - like \" carcinoma", "entity_type": "Anatomy", "pos": [82, 120]}], "task": "NER"}
+{"text": "Epstein - Barr virus ( EBV ) infection in nonsmall cell lung carcinoma ( NSCLC ) has been demonstrated in some ethnic groups .", "entity": [{"entity": "nonsmall cell lung carcinoma", "entity_type": "Anatomy", "pos": [42, 70]}, {"entity": "NSCLC", "entity_type": "Anatomy", "pos": [73, 78]}], "task": "NER"}
+{"text": "The pathobiology and the role of EBV and oncoprotein expression in these tumors have not been studied extensively .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [73, 79]}], "task": "NER"}
+{"text": "In this study , the authors investigated EBV - encoded RNA - 1 ( EBER1 ) transcripts by in situ hybridization and the expression of latent membrane protein - 1 ( LMP - 1 ) and bcl - 2 protein by immunohistochemistry in NSCLC patients from Taiwan , where nasopharyngeal carcinoma is endemic .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [219, 224]}, {"entity": "nasopharyngeal carcinoma", "entity_type": "Anatomy", "pos": [254, 278]}], "task": "NER"}
+{"text": "A total of 127 cases of NSCLC ( 43 cases of squamous cell carcinoma [ SCC ] , 67 cases of adenocarcinoma [ AD ] , 12 cases of large cell carcinoma [ LCC ] , and 5 cases of lymphoepithelioma - like carcinoma [ LE ] ) were included .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [24, 29]}, {"entity": "squamous cell carcinoma", "entity_type": "Anatomy", "pos": [44, 67]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [70, 73]}, {"entity": "adenocarcinoma", "entity_type": "Anatomy", "pos": [90, 104]}, {"entity": "AD", "entity_type": "Anatomy", "pos": [107, 109]}, {"entity": "large cell carcinoma", "entity_type": "Anatomy", "pos": [126, 146]}, {"entity": "LCC", "entity_type": "Anatomy", "pos": [149, 152]}, {"entity": "lymphoepithelioma - like carcinoma", "entity_type": "Anatomy", "pos": [172, 206]}, {"entity": "LE", "entity_type": "Anatomy", "pos": [209, 211]}], "task": "NER"}
+{"text": "A sensitive polymerase chain reaction - derived , digoxigenin - labeled DNA probe for in situ detection of EBER1 transcripts was performed for the detection of EBV .", "entity": [], "task": "NER"}
+{"text": "Immunohistochemistry using the avidin - biotin - immunoperoxidase method was also performed to evaluate the expression of bcl - 2 and LMP - 1 .", "entity": [], "task": "NER"}
+{"text": "EBER1 was detected in 11 of the 127 NSCLC cases ( 8 . 7 % ; 6 SCC cases and 5 LE cases ) .", "entity": [{"entity": "NSCLC", "entity_type": "Anatomy", "pos": [36, 41]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [62, 65]}, {"entity": "LE", "entity_type": "Anatomy", "pos": [78, 80]}], "task": "NER"}
+{"text": "All 5 LE cases were EBV - positive , whereas only 6 of the 43 SCC cases ( 14 % ) , 0 of 67 AD cases , and 12 LCC cases were EBV - positive ( P < 0 . 05 ) .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [6, 8]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [62, 65]}, {"entity": "AD", "entity_type": "Anatomy", "pos": [91, 93]}, {"entity": "LCC", "entity_type": "Anatomy", "pos": [109, 112]}], "task": "NER"}
+{"text": "All five LE cases showed diffuse , strong , positive staining of tumor cells ; five of the six SCC cases showed diffuse but weak staining .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [9, 11]}, {"entity": "tumor cells", "entity_type": "Anatomy", "pos": [65, 76]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [95, 98]}], "task": "NER"}
+{"text": "Among the nontumor epithelial cells , there was no EBER1 staining of any of the 11 EBER1 - positive cases .", "entity": [{"entity": "nontumor epithelial cells", "entity_type": "Anatomy", "pos": [10, 35]}], "task": "NER"}
+{"text": "The mean age of the LE patients was 10 years younger than that of the patients with other histological types .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [20, 22]}], "task": "NER"}
+{"text": "All 5 LE patients were nonsmokers , whereas 3 of the 6 patients with EBER1 - positive SCC ( 50 % ) were smokers .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [6, 8]}, {"entity": "SCC", "entity_type": "Anatomy", "pos": [86, 89]}], "task": "NER"}
+{"text": "EBER1 expression did not correlate with the 2 - year survival rate of overall cases , but all 5 LE patients were alive without clinical evidence of disease at last follow - up .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [96, 98]}], "task": "NER"}
+{"text": "Gender , lymph node or distant metastasis , and clinical stage were not found to have any correlation with EBER1 expression ( P > 0 . 05 ) .", "entity": [{"entity": "lymph node", "entity_type": "Anatomy", "pos": [9, 19]}], "task": "NER"}
+{"text": "All LE cases had bcl - 2 oncoprotein expression ( 100 % ) .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [4, 6]}], "task": "NER"}
+{"text": "This frequency was significantly different from other histologic types ( P < 0 . 05 ) .", "entity": [], "task": "NER"}
+{"text": "The LMP - 1 detection rate was low and demonstrated no correlation with bcl - 2 expression .", "entity": [], "task": "NER"}
+{"text": "In this study , the authors found that the primary LE of the lung is associated with young age , a history of not smoking , high bcl - 2 immunoreactivity , and better survival rate .", "entity": [{"entity": "primary LE", "entity_type": "Anatomy", "pos": [43, 53]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [61, 65]}], "task": "NER"}
+{"text": "These characteristics demonstrate that EBV - associated LE of the lung is a unique entity .", "entity": [{"entity": "LE", "entity_type": "Anatomy", "pos": [56, 58]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [66, 70]}], "task": "NER"}
+{"text": "The findings of the current study suggest that EBV infection may play a different role in the tumorigenesis of primary LE of the lung than it does in other EBER1 - positive NSCLCs .", "entity": [{"entity": "primary LE", "entity_type": "Anatomy", "pos": [111, 121]}, {"entity": "lung", "entity_type": "Anatomy", "pos": [129, 133]}, {"entity": "EBER1 - positive NSCLCs", "entity_type": "Anatomy", "pos": [156, 179]}], "task": "NER"}
+{"text": "Antisocial patients : a comparison of those with and those without childhood conduct disorder .", "entity": [], "task": "NER"}
+{"text": "The purpose of this study was to compare persons with antisocial personality disorder ( ASP ) with those who meet the adult criteria for ASP but fail to meet the criteria for childhood conduct disorder .", "entity": [], "task": "NER"}
+{"text": "Sociodemographic data , medical history , and psychiatric symptoms exhibited during a recent hospital admission were compared in the two groups by chart review .", "entity": [], "task": "NER"}
+{"text": "The two groups were virtually indistinguishable , except that patients without childhood conduct disorder were less likely to smoke or consume alcohol , were less likely to have spent time in a training school / boot camp as a child or adolescent , were less likely to have been admitted for a recent suicide attempt , and were less likely to have conned others .", "entity": [], "task": "NER"}
+{"text": "We conclude that persons meeting the adult criteria for ASP but not the childhood conduct disorder criteria essentially suffer the same disorder as those who meet full ASP criteria but are less severely affected .", "entity": [], "task": "NER"}
+{"text": "The myoadipose flap : a new composite .", "entity": [{"entity": "myoadipose flap", "entity_type": "Anatomy", "pos": [4, 19]}], "task": "NER"}
+{"text": "A prefabricated composite fat flap consisting of muscle woven into an anatomically distinct fat pad was studied in a rabbit model .", "entity": [{"entity": "composite fat flap", "entity_type": "Anatomy", "pos": [16, 34]}, {"entity": "muscle", "entity_type": "Anatomy", "pos": [49, 55]}, {"entity": "fat pad", "entity_type": "Anatomy", "pos": [92, 99]}], "task": "NER"}
+{"text": "In 17 rabbits , a 2 - cm strip of latissimus dorsi was woven into the parascapular fat pad on one side , with the contralateral fat pad serving as a control .", "entity": [{"entity": "strip", "entity_type": "Anatomy", "pos": [25, 30]}, {"entity": "latissimus dorsi", "entity_type": "Anatomy", "pos": [34, 50]}, {"entity": "parascapular fat pad", "entity_type": "Anatomy", "pos": [70, 90]}, {"entity": "contralateral fat pad", "entity_type": "Anatomy", "pos": [114, 135]}], "task": "NER"}
+{"text": "At 3 weeks , the endogenous blood supply of both the control and the experimental fat pads was isolated and ligated , and the composite fat / muscle flap was transferred to the chest wall .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [28, 33]}, {"entity": "fat pads", "entity_type": "Anatomy", "pos": [82, 90]}, {"entity": "composite fat / muscle flap", "entity_type": "Anatomy", "pos": [126, 153]}, {"entity": "chest wall", "entity_type": "Anatomy", "pos": [177, 187]}], "task": "NER"}
+{"text": "At 6 weeks , animals were killed , and flaps were analyzed for length , width , and weight ; perfused with fluorescein or lead oxide ; and examined histologically .", "entity": [{"entity": "flaps", "entity_type": "Anatomy", "pos": [39, 44]}], "task": "NER"}
+{"text": "Significant differences were found between the control and experimental fat pads with regard to weight and length .", "entity": [{"entity": "fat pads", "entity_type": "Anatomy", "pos": [72, 80]}], "task": "NER"}
+{"text": "Experimental flaps were found to be perfused fully with fluorescein and lead oxide ; control fat pads were found not to be perfused .", "entity": [{"entity": "flaps", "entity_type": "Anatomy", "pos": [13, 18]}, {"entity": "fat pads", "entity_type": "Anatomy", "pos": [93, 101]}], "task": "NER"}
+{"text": "The lead oxide group revealed extensive growth of blood vessels from the latissimus graft into the experimental fat pad .", "entity": [{"entity": "blood vessels", "entity_type": "Anatomy", "pos": [50, 63]}, {"entity": "latissimus graft", "entity_type": "Anatomy", "pos": [73, 89]}, {"entity": "fat pad", "entity_type": "Anatomy", "pos": [112, 119]}], "task": "NER"}
+{"text": "No vessels were visualized in the controls .", "entity": [{"entity": "vessels", "entity_type": "Anatomy", "pos": [3, 10]}], "task": "NER"}
+{"text": "Finally , sections of the control and experimental flaps were analyzed histologically .", "entity": [{"entity": "sections", "entity_type": "Anatomy", "pos": [10, 18]}, {"entity": "flaps", "entity_type": "Anatomy", "pos": [51, 56]}], "task": "NER"}
+{"text": "A preponderance of viable fat , with evidence of neovascularization , was found in experimental flaps , compared with the necrotic fat that characterized the controls .", "entity": [{"entity": "fat", "entity_type": "Anatomy", "pos": [26, 29]}, {"entity": "flaps", "entity_type": "Anatomy", "pos": [96, 101]}, {"entity": "fat", "entity_type": "Anatomy", "pos": [131, 134]}], "task": "NER"}
+{"text": "We conclude that prefabrication of a fat flap is possible and may have extensive application in various areas of plastic surgery .", "entity": [{"entity": "fat flap", "entity_type": "Anatomy", "pos": [37, 45]}], "task": "NER"}
+{"text": "Brainstem auditory - evoked potential evaluation in children with meningitis .", "entity": [{"entity": "Brainstem", "entity_type": "Anatomy", "pos": [0, 9]}], "task": "NER"}
+{"text": "Brainstem auditory - evoked potential ( BAEP ) was performed on 101 children with meningitis to assess the incidence of hearing impairment .", "entity": [{"entity": "Brainstem", "entity_type": "Anatomy", "pos": [0, 9]}], "task": "NER"}
+{"text": "Fifty - two ( 51 . 5 % ) children had bacterial meningitis , six ( 5 . 9 % ) had viral meningitis , and 43 ( 42 . 6 % ) had aseptic meningitis .", "entity": [], "task": "NER"}
+{"text": "Fifty - one ( 50 . 5 % ) patients were assessed before discharge and 50 ( 49 . 5 % ) 9 days to 17 months later ( mean = 4 months ) .", "entity": [], "task": "NER"}
+{"text": "BAEP impairment was found in 28 ( 27 . 7 % ) of 101 patients ; 24 had sensorineural and four had conductive type of hearing loss , and 17 ( 60 . 7 % ) had unilateral and 11 ( 39 . 3 % ) had bilateral impairment .", "entity": [], "task": "NER"}
+{"text": "Hearing threshold was elevated in 22 ( 21 . 8 % ) patients , and the other six had increased latency and interpeak latencies with normal threshold .", "entity": [], "task": "NER"}
+{"text": "Frequency of BAEP impairment or hearing loss associated with bacterial meningitis was 34 . 6 % and 30 . 8 % , respectively ; frequency associated with aseptic meningitis was 20 . 9 % and 13 . 9 % , respectively .", "entity": [], "task": "NER"}
+{"text": "One child with viral meningitis ( coxsackie virus ) had mild BAEP impairment .", "entity": [], "task": "NER"}
+{"text": "Most of the BAEP impairment in the bacterial meningitis group was associated with H . influenzae .", "entity": [], "task": "NER"}
+{"text": "Prospective BAEP study was performed in 20 patients randomly at 0 . 3 to 18 months to assess hearing status after antibiotic treatment , 10 with normal and 10 with abnormal BAEP .", "entity": [], "task": "NER"}
+{"text": "All the initially normal BAEP patients remained normal .", "entity": [], "task": "NER"}
+{"text": "Of the 10 patients with abnormal BAEP results initially , four returned to normal , two improved , three remained unchanged , and one deteriorated .", "entity": [], "task": "NER"}
+{"text": "The incidence of hearing loss after bacterial and aseptic meningitis is high .", "entity": [], "task": "NER"}
+{"text": "BAEP is useful to screen for possible hearing loss in children with meningitis , and follow - up BAEP is necessary for those patients with initially abnormal BAEP .", "entity": [], "task": "NER"}
+{"text": "[ The assessment of flow velocity in carotid and intracranial arteries in three different age groups ] .", "entity": [{"entity": "carotid", "entity_type": "Anatomy", "pos": [37, 44]}, {"entity": "intracranial arteries", "entity_type": "Anatomy", "pos": [49, 70]}], "task": "NER"}
+{"text": "In this report we assess the systolic maximal flow velocity in carotid and intracranial arteries in 191 subjects with no history of cerebral vascular disease in 3 age groups : 20 - 40 years ( 1 group ) , 41 - 60 years ( 2 group ) , and above 60 years ( 3 group ) .", "entity": [{"entity": "carotid", "entity_type": "Anatomy", "pos": [63, 70]}, {"entity": "intracranial arteries", "entity_type": "Anatomy", "pos": [75, 96]}, {"entity": "cerebral vascular", "entity_type": "Anatomy", "pos": [132, 149]}], "task": "NER"}
+{"text": "The subjects were assessed using Sonomed Transcranial Doppler Spectrograph according to generally accepted principles .", "entity": [], "task": "NER"}
+{"text": "The purpose of the study was to establish the mean value of maximal flow velocity in each particular artery in three age groups , and to observe the changes in this parameter with age .", "entity": [{"entity": "artery", "entity_type": "Anatomy", "pos": [101, 107]}], "task": "NER"}
+{"text": "The results were analyzed using statistical methods and a significant decrease in blood flow , Vmax , was found in all investigated arteries .", "entity": [{"entity": "blood", "entity_type": "Anatomy", "pos": [82, 87]}, {"entity": "arteries", "entity_type": "Anatomy", "pos": [132, 140]}], "task": "NER"}
+{"text": "A mean decrease of 8 . 02 % in flow velocity Vmax was found , when comparing groups 2 and 1 , and difference 15 . 99 % comparing 3 and 1 .", "entity": [], "task": "NER"}
+{"text": "Requirement of estrogen receptor expression and function for [ 12Val ] K - Ras - mediated NIH3T3 cell transformation .", "entity": [{"entity": "NIH3T3 cell", "entity_type": "Anatomy", "pos": [90, 101]}], "task": "NER"}
+{"text": "We investigated the biological significance of estrogen receptors ( ERs ) in NIH3T3 cell transformation by the [ 12Val ] K - Ras mutant .", "entity": [{"entity": "NIH3T3 cell", "entity_type": "Anatomy", "pos": [77, 88]}], "task": "NER"}
+{"text": "This mutant enhanced the steady - level and transcriptional activity of ER .", "entity": [], "task": "NER"}
+{"text": "Coexpression of the progesterone receptor with mutant K - Ras led to suppression of tumorigenicity and inhibition of the activation of ER .", "entity": [], "task": "NER"}
+{"text": "The antisense oligomers complementary to the ER suppressed proliferation and transformed phenotypes of K12V cells .", "entity": [{"entity": "K12V cells", "entity_type": "Anatomy", "pos": [103, 113]}], "task": "NER"}
+{"text": "These observations support the importance of ER in Ras - mediated cell transformation .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [66, 70]}], "task": "NER"}
+{"text": "Gene therapy for gliomas : p53 and E2F - 1 proteins and the target of apoptosis .", "entity": [{"entity": "gliomas", "entity_type": "Anatomy", "pos": [17, 24]}], "task": "NER"}
+{"text": "Current therapy for glioma is suboptimal .", "entity": [{"entity": "glioma", "entity_type": "Anatomy", "pos": [20, 26]}], "task": "NER"}
+{"text": "The transfer of apoptosis genes to tumors constitutes one of the most promising strategies for cancer gene therapy .", "entity": [{"entity": "tumors", "entity_type": "Anatomy", "pos": [35, 41]}, {"entity": "cancer", "entity_type": "Anatomy", "pos": [95, 101]}], "task": "NER"}
+{"text": "We have previously shown that massive apoptosis occurs when wild - type p53 or E2F - 1 expression is induced in glioma .", "entity": [{"entity": "glioma", "entity_type": "Anatomy", "pos": [112, 118]}], "task": "NER"}
+{"text": "However , the mechanism of action and the efficiency in inducing apoptosis of these two proteins are not similar .", "entity": [], "task": "NER"}
+{"text": "Adenovirus - mediated p53 gene transfer is ineffective in causing apoptosis in glioma cells that retain wild - type p53 genotype or overexpress the p21 protein .", "entity": [{"entity": "glioma cells", "entity_type": "Anatomy", "pos": [79, 91]}], "task": "NER"}
+{"text": "The p16 / Rb / E2F pathway is the most frequent target of genetic alterations in gliomas , and therefore constitutes a suitable target for gene therapy strategies .", "entity": [{"entity": "gliomas", "entity_type": "Anatomy", "pos": [81, 88]}], "task": "NER"}
+{"text": "However , the transfer of either the p16 or Rb gene to glioma cells results in cytostatic effect .", "entity": [{"entity": "glioma cells", "entity_type": "Anatomy", "pos": [55, 67]}], "task": "NER"}
+{"text": "The E2F - 1 protein is able to induce generalized apoptosis in gliomas independently of the p53 , p16 or Rb status .", "entity": [{"entity": "gliomas", "entity_type": "Anatomy", "pos": [63, 70]}], "task": "NER"}
+{"text": "In addition , p21 - or p16 - mediated growth arrest did not protect glioma cells from E2F - 1 - mediated apoptosis .", "entity": [{"entity": "glioma cells", "entity_type": "Anatomy", "pos": [68, 80]}], "task": "NER"}
+{"text": "The apoptotic molecule bax is induced in p53 - mediated apoptosis , but bax is not induced in E2F - 1 - mediated apoptosis in glioma cells .", "entity": [{"entity": "glioma cells", "entity_type": "Anatomy", "pos": [126, 138]}], "task": "NER"}
+{"text": "Careful selection of patients may be necessary before designing therapeutic strategies using either p53 or E2F - 1 as a therapeutic tools for glioma patients .", "entity": [{"entity": "glioma", "entity_type": "Anatomy", "pos": [142, 148]}], "task": "NER"}
+{"text": "Protective function of von Hippel - Lindau protein against impaired protein processing in renal carcinoma cells .", "entity": [{"entity": "renal carcinoma cells", "entity_type": "Anatomy", "pos": [90, 111]}], "task": "NER"}
+{"text": "The absence of functional von Hippel - Lindau ( VHL ) tumor suppressor gene leads to the development of neoplasias characteristic of VHL disease , including renal cell carcinoma ( RCC ) .", "entity": [{"entity": "tumor", "entity_type": "Anatomy", "pos": [54, 59]}, {"entity": "renal cell carcinoma", "entity_type": "Anatomy", "pos": [157, 177]}, {"entity": "RCC", "entity_type": "Anatomy", "pos": [180, 183]}], "task": "NER"}
+{"text": "Here , we compared the sensitivity of RCC cells lacking VHL gene function with that of RCC cells expressing the wild - type VHL gene ( wtVHL ) after exposure to various stresses .", "entity": [{"entity": "RCC cells", "entity_type": "Anatomy", "pos": [38, 47]}, {"entity": "RCC cells", "entity_type": "Anatomy", "pos": [87, 96]}], "task": "NER"}
+{"text": "While the response to most treatments was not affected by the VHL gene status , glucose deprivation was found to be much more cytotoxic for RCC cells lacking VHL gene function than for wtVHL - expressing cells .", "entity": [{"entity": "RCC cells", "entity_type": "Anatomy", "pos": [140, 149]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [204, 209]}], "task": "NER"}
+{"text": "The heightened sensitivity of VHL - deficient cells was not attributed to dissimilar energy requirements or to differences in glucose uptake , but more likely reflects a lesser ability of VHL - deficient cells to handle abnormally processed proteins arising from impaired glycosylation .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [46, 51]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [204, 209]}], "task": "NER"}
+{"text": "In support of this hypothesis , other treatments which act through different mechanisms to interfere with protein processing ( i . e . , tunicamycin , brefeldin A , and azetidine ) were also found to be much more toxic for VHL - deficient cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [239, 244]}], "task": "NER"}
+{"text": "Furthermore , ubiquitination of cellular proteins was elevated in VHL - deficient cells , particularly after glucose deprivation , supporting a role for the VHL gene in ubiquitin - mediated proteolysis .", "entity": [{"entity": "cellular", "entity_type": "Anatomy", "pos": [32, 40]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [82, 87]}], "task": "NER"}
+{"text": "Accordingly , the rate of elimination of abnormal proteins was lower in cells lacking a functional VHL gene than in wtVHL - expressing cells .", "entity": [{"entity": "cells", "entity_type": "Anatomy", "pos": [72, 77]}, {"entity": "cells", "entity_type": "Anatomy", "pos": [135, 140]}], "task": "NER"}
+{"text": "Thus , pVHL appears to participate in the elimination of misprocessed proteins , such as those arising in the cell due to the unavailability of glucose or to other stresses .", "entity": [{"entity": "cell", "entity_type": "Anatomy", "pos": [110, 114]}], "task": "NER"}