PMC20140719pmc.key4848090CC BYno0010.7554/eLife.1507548480902705816915075e15075membrane signaling receptor kinase peptide hormone floral abscission plant development protein complexes <i>A. thaliana</i>This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.surname:Santiago;given-names:Juliasurname:Brandt;given-names:Benjaminsurname:Hothorn;given-names:Michaelsurname:Butenko;given-names:Melinka Asurname:Brandt;given-names:Benjaminsurname:Santiago;given-names:Juliasurname:Wildhagen;given-names:Marisurname:Hohmann;given-names:Ulrichsurname:Hothorn;given-names:Ludwig Asurname:Butenko;given-names:Melinka Asurname:Hothorn;given-names:Michaelsurname:Zhang;given-names:Mingjiesurname:Hothorn;given-names:Michaelsurname:Hothorn;given-names:MichaelTITLEAuthor Keywords Research Organismfront520160Mechanistic insight into a peptide hormone signaling complex mediating floral organ abscissionprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormoneABSTRACTabstract95Plants constantly renew during their life cycle and thus require to shed senescent and damaged organs. Floral abscission is controlled by the leucine-rich repeat receptor kinase (LRR-RK) HAESA and the peptide hormone IDA. It is unknown how expression of IDA in the abscission zone leads to HAESA activation. Here we show that IDA is sensed directly by the HAESA ectodomain. Crystal structures of HAESA in complex with IDA reveal a hormone binding pocket that accommodates an active dodecamer peptide. A central hydroxyproline residue anchors IDA to the receptor. The HAESA co-receptor SERK1, a positive regulator of the floral abscission pathway, allows for high-affinity sensing of the peptide hormone by binding to an Arg-His-Asn motif in IDA. This sequence pattern is conserved among diverse plant peptides, suggesting that plant peptide hormone receptors may share a common ligand binding mode and activation mechanism.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZPlantsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:34:57Zleucine-rich repeat receptor kinaseprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:35:06ZLRR-RKproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormoneproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:25ZCrystal structuresproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:35:29Zin complex withproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:30:04Zhormone binding pocketprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12Zactivestructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:45ZdodecamerchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:28:58Zpeptideresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T08:36:09ZhydroxyprolineproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:36:27Zco-receptorproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormonestructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:36:42Zconservedtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01ZplantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:29:02Zpeptidestaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:36:36Zpeptide hormone receptorsABSTRACTabstract1019DOI: http://dx.doi.org/10.7554/eLife.15075.001ABSTRACTabstract_title_11066eLife digestABSTRACTabstract1079Plants can shed their leaves, flowers or other organs when they no longer need them. But how does a leaf or a flower know when to let go? A receptor protein called HAESA is found on the surface of the cells that surround a future break point on the plant. When its time to shed an organ, a hormone called IDA instructs HAESA to trigger the shedding process. However, the molecular details of how IDA triggers organ shedding are not clear.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZPlantsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:38:22Zreceptor proteinproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:38:42ZhormoneproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAABSTRACTabstract1518The shedding of floral organs (or leaves) can be easily studied in a model plant called Arabidopsis. Santiago et al. used protein biochemistry, structural biology and genetics to uncover how the IDA hormone activates HAESA. The experiments show that IDA binds directly to a canyon shaped pocket in HAESA that extends out from the surface of the cell. IDA binding to HAESA allows another receptor protein called SERK1 to bind to HAESA, which results in the release of signals inside the cell that trigger the shedding of organs.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:40:57ZArabidopsisexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:41:04Zprotein biochemistryexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:41:10Zstructural biologyexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:41:13ZgeneticsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:41:17ZhormoneproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:42:02Zbinds directly toprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:41:22Zcanyon shapedsiteSO:melaniev@ebi.ac.uk2023-03-17T08:41:25ZpocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-22T10:16:55ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:41:40Zreceptor proteinproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:42:20Zto bind toproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAABSTRACTabstract2046The next step following on from this work is to understand what signals are produced when IDA activates HAESA. Another challenge will be to find out where IDA is produced in the plant and what causes it to accumulate in specific places in preparation for organ shedding.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01ZplantABSTRACTabstract2317DOI: http://dx.doi.org/10.7554/eLife.15075.002INTROtitle_12364Introductionelife-15075-fig1-figsupp1.jpgfig1s1FIGfig_title_caption2377The HAESA ectodomain folds into a superhelical assembly of 21 leucine-rich repeats.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:05ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomainstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:43:20Zsuperhelical assemblystructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:44:11Zleucine-rich repeatselife-15075-fig1-figsupp1.jpgfig1s1FIGfig_caption2461(A) SDS PAGE analysis of the purified Arabidopsis thaliana HAESA ectodomain (residues 20–620) obtained by secreted expression in insect cells. The calculated molecular mass is 65.7 kDa, the actual molecular mass obtained by mass spectrometry is 74,896 Da, accounting for the N-glycans. (B) Ribbon diagrams showing front (left panel) and side views (right panel) of the isolated HAESA LRR domain. The N- (residues 20–88) and C-terminal (residues 593–615) capping domains are shown in yellow, the central 21 LRR motifs are in blue and disulphide bonds are highlighted in green (in bonds representation). (C) Structure based sequence alignment of the 21 leucine-rich repeats in HAESA with the plant LRR consensus sequence shown for comparison. Conserved hydrophobic residues are shaded in gray, N-glycosylation sites visible in our structures are highlighted in blue, cysteine residues involved in disulphide bridge formation in green. (D) Asn-linked glycans mask the N-terminal portion of the HAESA ectodomain. Oligomannose core structures (containing two N-actylglucosamines and three terminal mannose units) as found in Trichoplusia ni cells and in plants were modeled onto the seven glycosylation sites observed in our HAESA structures, to visualize the surface areas potentially not masked by carbohydrate. The HAESA ectodomain is shown in blue (in surface representation), the glycan structures are shown in yellow. Molecular surfaces were calculated with the program MSMS, with a probe radius of 1.5 Å.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:45:35ZSDS PAGEspeciesMESH:melaniev@ebi.ac.uk2023-03-17T08:47:13ZArabidopsis thalianaproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomainresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T08:47:22Z20–620experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:47:18Zsecreted expression in insect cellsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:47:25Zmass spectrometrychemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:47:39ZN-glycansproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:47:45ZLRR domainresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T08:47:57Z20–88residue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T08:48:04Z593–615structure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:48:11Zcapping domainsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:48:52ZLRR motifsptmMESH:melaniev@ebi.ac.uk2023-03-17T08:49:02Zdisulphide bondsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T08:49:09ZStructure based sequence alignmentstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:44:13Zleucine-rich repeatsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:49:42ZLRRprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:49:46ZConservedprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:49:56Zhydrophobicstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:50:01ZresiduessiteSO:melaniev@ebi.ac.uk2023-03-17T08:50:06ZN-glycosylation sitesevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T08:50:12Zstructuresresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T08:50:25ZcysteineptmMESH:melaniev@ebi.ac.uk2023-03-17T08:50:33Zdisulphide bridgeptmMESH:melaniev@ebi.ac.uk2023-03-17T08:50:57ZAsn-linked glycansproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:51:14ZOligomannosechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:51:20ZN-actylglucosamineschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:51:29ZmannosespeciesMESH:melaniev@ebi.ac.uk2023-03-17T08:51:37ZTrichoplusia nitaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantssiteSO:melaniev@ebi.ac.uk2023-03-17T08:52:19Zglycosylation sitesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T08:51:47ZstructureschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:51:55ZcarbohydrateproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T08:52:03Zglycanelife-15075-fig1-figsupp1.jpgfig1s1FIGfig_caption3975DOI:
http://dx.doi.org/10.7554/eLife.15075.004elife-15075-fig1-figsupp2.jpgfig1s2FIGfig_title_caption4022Hydrophobic contacts and a hydrogen-bond network mediate the interaction between HAESA and the peptide hormone IDA.bond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28ZHydrophobic contactssiteSO:melaniev@ebi.ac.uk2023-06-15T08:44:48Zhydrogen-bond networkproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormoneproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAelife-15075-fig1-figsupp2.jpgfig1s2FIGfig_caption4138(A) Details of the IDA binding pocket. HAESA is shown in blue (ribbon diagram), the C-terminal Arg-His-Asn motif (left panel), the central Hyp anchor (center) and the N-terminal Pro-rich motif in IDA (right panel) are shown in yellow (in bonds representation). HAESA interface residues are shown as sticks, selected hydrogen bond interactions are denoted as dotted lines (in magenta). (B) View of the complete IDA (in bonds representation, in yellow) binding pocket in HAESA (surface view, in blue). Orientation as in (A). (C) Structure based sequence alignment of leucine-rich repeats in HAESA with the plant LRR consensus sequence shown for comparison. Residues mediating hydrophobic interactions with the IDA peptide are highlighted in blue, residues contributing to hydrogen bond interactions and/or salt bridges are shown in red. The IDA binding pocket covers LRRs 2–14 and all residues originate from the inner surface of the HAESA superhelix.siteSO:melaniev@ebi.ac.uk2023-03-17T09:01:38ZIDA binding pocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:02:42ZHyp anchorstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:02:59ZPro-rich motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:03:09ZHAESA interface residuesbond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrogen bond interactionsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:42ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:03:27Zbinding pocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:03:30ZStructure based sequence alignmentstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:44:13Zleucine-rich repeatsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:03:37ZLRRevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:03:40Zconsensus sequencebond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrophobic interactionschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:08:50ZIDA peptidebond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrogen bond interactionsbond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zsalt bridgessiteSO:melaniev@ebi.ac.uk2023-03-17T09:01:38ZIDA binding pocketstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:04:34ZLRRs 2–14proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:04:41Zsuperhelixelife-15075-fig1-figsupp2.jpgfig1s2FIGfig_caption5090DOI:
http://dx.doi.org/10.7554/eLife.15075.005elife-15075-fig1-figsupp3.jpgfig1s3FIGfig_title_caption5137The IDA-HAESA and SERK1-HAESA complex interfaces are conserved among HAESA and HAESA-like proteins from different plant species.complex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:05:48ZIDA-HAESAcomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:05:55ZSERK1-HAESAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:06:00Zinterfacesprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:06:03ZconservedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:06ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:06:10ZHAESA-like proteinstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantelife-15075-fig1-figsupp3.jpgfig1s3FIGfig_caption5267Structure-based sequence alignment of the HAESA family members: Arabidopsis thaliana HAESA (Uniprot (http://www.uniprot.org) ID P47735), Arabidopsis thaliana HSL2 (Uniprot ID C0LGX3), Capsella rubella HAESA (Uniprot ID R0F2U6), Citrus clementina HSL2 (Uniprot ID V4U227), Vitis vinifera HAESA (Uniprot ID F6HM39). The alignment includes a secondary structure assignment calculated with the program DSSP and colored according to Figure 1, with the N- and C-terminal caps and the 21 LRR motifs indicated in orange and blue, respectively. Cysteine residues engaged in disulphide bonds are depicted in green. HAESA residues interacting with the IDA peptide and/or the SERK1 co-receptor kinase ectodomain are highlighted in blue and orange, respectively.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:07:34ZStructure-based sequence alignmentprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:07:37ZHAESA family membersspeciesMESH:melaniev@ebi.ac.uk2023-03-17T08:47:13ZArabidopsis thalianaproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAspeciesMESH:melaniev@ebi.ac.uk2023-03-17T08:47:13ZArabidopsis thalianaproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2speciesMESH:melaniev@ebi.ac.uk2023-03-17T09:07:54ZCapsella rubellaproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAspeciesMESH:melaniev@ebi.ac.uk2023-03-17T09:08:02ZCitrus clementinaproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2speciesMESH:melaniev@ebi.ac.uk2023-03-17T09:08:11ZVitis viniferaproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:08:27Zcapsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:09:03ZLRR motifsresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T08:50:25ZCysteineptmMESH:melaniev@ebi.ac.uk2023-03-17T08:49:02Zdisulphide bondsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:08:59ZIDA peptideproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:09:39Zco-receptor kinasestructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomainelife-15075-fig1-figsupp3.jpgfig1s3FIGfig_caption6017DOI:
http://dx.doi.org/10.7554/eLife.15075.006elife-15075-fig1.jpgfig1FIGfig_title_caption6064The peptide hormone IDA binds to the HAESA LRR ectodomain.protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormoneproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:10:10ZLRR ectodomainelife-15075-fig1.jpgfig1FIGfig_caption6123(A) Multiple sequence alignment of selected IDA family members. The conserved PIP motif is highlighted in yellow, the central Hyp in blue. The PKGV motif present in our N-terminally extended IDA peptide is highlighted in red. (B) Isothermal titration calorimetry of the HAESA ectodomain vs. IDA and including the synthetic peptide sequence. (C) Structure of the HAESA – IDA complex with HAESA shown in blue (ribbon diagram). IDA (in bonds representation, surface view included) is depicted in yellow. The peptide binding pocket covers HAESA LRRs 2–14. (D) Close-up view of the entire IDA (in yellow) peptide binding site in HAESA (in blue). Details of the interactions between the central Hyp anchor in IDA and the C-terminal Arg-His-Asn motif with HAESA are highlighted in (E) and (F), respectively. Hydrogren bonds are depicted as dotted lines (in magenta), a water molecule is shown as a red sphere.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:12:20ZMultiple sequence alignmentprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:19:03ZIDA family membersprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:12:51Zconservedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:12:59ZPIP motifresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T09:13:21ZHypstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:13:30ZPKGV motifprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:24ZN-terminally extendedchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptideexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:14:02ZIsothermal titration calorimetryproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:14:06ZsyntheticchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T09:14:10Zpeptidecomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T16:29:32ZHAESA – IDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:14:20Zpeptide binding pocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:04:34ZLRRs 2–14proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:14:28Zpeptide binding siteproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:02:42ZHyp anchorproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T09:15:02Zwaterelife-15075-fig1.jpgfig1FIGfig_caption7031DOI:
http://dx.doi.org/10.7554/eLife.15075.003INTROparagraph7078During their growth, development and reproduction plants use cell separation processes to detach no-longer required, damaged or senescent organs. Abscission of floral organs in Arabidopsis is a model system to study these cell separation processes in molecular detail. The LRR-RKs HAESA (greek: to adhere to) and HAESA-LIKE 2 (HSL2) redundantly control floral abscission. Loss-of-function of the secreted small protein INFLORESCENCE DEFICIENT IN ABSCISSION (IDA) causes floral organs to remain attached while its over-expression leads to premature shedding. Full-length IDA is proteolytically processed and a conserved stretch of 20 amino-acids (termed EPIP) can rescue the IDA loss-of-function phenotype (Figure 1A). It has been demonstrated that a dodecamer peptide within EPIP is able to activate HAESA and HSL2 in transient assays in tobacco cells. This sequence motif is highly conserved among IDA family members (IDA-LIKE PROTEINS, IDLs) and contains a central Pro residue, presumed to be post-translationally modified to hydroxyproline (Hyp; Figure 1A). The available genetic and biochemical evidence suggests that IDA and HAESA together control floral abscission, but it is poorly understood if IDA is directly sensed by the receptor kinase HAESA and how IDA binding at the cell surface would activate the receptor.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T09:19:27ZArabidopsisstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:19:47ZLRR-RKsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T09:19:35ZHAESA-LIKE 2proteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2proteinPR:melaniev@ebi.ac.uk2023-03-17T09:20:13ZINFLORESCENCE DEFICIENT IN ABSCISSIONproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:19:56ZFull-lengthproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAptmMESH:melaniev@ebi.ac.uk2023-03-17T09:20:35Zproteolytically processedprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:20:38Zconservedresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T09:20:41Zstretch of 20 amino-acidsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:21:35ZEPIPproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:45ZdodecamerchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T09:21:18Zpeptidestructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:21:35ZEPIPproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:21:42Ztransient assaystaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T09:21:57Ztobaccostructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:22:02ZThis sequence motifprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:22:05Zhighly conservedprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:19:03ZIDA family membersprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:22:49ZIDA-LIKE PROTEINSprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T09:23:11ZProprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:23:35Zpost-translationally modifiedresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T09:23:58Zhydroxyprolineresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T09:24:15ZHypproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:24:20Zreceptor kinaseproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-22T10:17:44ZIDARESULTStitle_18403ResultsRESULTStitle_28411IDA directly binds to the LRR domain of HAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:24:55ZLRR domainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAelife-15075-fig2.jpgfig2FIGfig_title_caption8457Active IDA-family peptide hormones are hydroxyprolinated dodecamers.protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12ZActiveprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:25:46ZIDA-family peptide hormonesprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:26:07Zhydroxyprolinatedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:26:18Zdodecamerselife-15075-fig2.jpgfig2FIGfig_caption8526Close-up views of (A) IDA, (B) the N-terminally extended PKGV-IDA and (C) IDL1 bound to the HAESA hormone binding pocket (in bonds representation, in yellow) and including simulated annealing 2Fo–Fc omit electron density maps contoured at 1.0 σ. Note that Pro58IDA and Leu67IDA are the first residues defined by electron density when bound to the HAESA ectodomain. (D) Table summaries for equilibrium dissociation constants (Kd), binding enthalpies (ΔH), binding entropies (ΔS) and stoichoimetries (N) for different IDA peptides binding to the HAESA ectodomain ( ± fitting errors; n.d. no detectable binding). (E) Structural superposition of the active IDA (in bonds representation, in gray) and IDL1 peptide (in yellow) hormones bound to the HAESA ectodomain. Root mean square deviation (r.m.s.d.) is 1.0 Å comparing 100 corresponding atoms.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:29ZN-terminally extendedmutantMESH:melaniev@ebi.ac.uk2023-03-17T09:30:14ZPKGV-IDAproteinPR:melaniev@ebi.ac.uk2023-03-17T09:29:55ZIDL1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:41Zbound toproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAsiteSO:melaniev@ebi.ac.uk2023-03-17T09:30:04Zhormone binding pocketexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:30:18Zsimulated annealingevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:26Z2Fo–Fc omit electron density mapsresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:16ZPro58proteinPR:melaniev@ebi.ac.uk2023-03-17T09:30:56ZIDAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:22ZLeu67proteinPR:melaniev@ebi.ac.uk2023-03-17T09:31:07ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:31Zelectron densityprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:41Zbound toproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:07ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:30Zequilibrium dissociation constantsevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:37ZKdevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:42Zbinding enthalpiesevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:48ZΔHevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:52Zbinding entropiesevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:59ZΔSchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:10:22ZIDA peptidesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomainexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:32:08ZStructural superpositionprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12ZactiveproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:43ZIDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:10:54ZIDL1 peptideprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:41Zbound toproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33ZectodomainevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:33:22ZRoot mean square deviationevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:33:38Zr.m.s.d.elife-15075-fig2.jpgfig2FIGfig_caption9382DOI:
http://dx.doi.org/10.7554/eLife.15075.007elife-15075-fig3.jpgfig3FIGfig_title_caption9429The receptor kinase SERK1 acts as a HAESA co-receptor and promotes high-affinity IDA sensing.protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:35:33Zreceptor kinaseproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:36:35ZHAESA co-receptorproteinPR:melaniev@ebi.ac.uk2023-03-22T10:18:04ZIDAelife-15075-fig3.jpgfig3FIGfig_caption9523(A) Petal break-strength assays measure the force (expressed in gram equivalents) required to remove the petals from the flower of serk mutant plants compared to haesa/hsl2 mutant and Col-0 wild-type flowers. Petal break-strength is measured from positions 1 to 8 along the primary inflorescence where positions 1 is defined as the flower at anthesis (n=15, bars=SD). This treatment-by-position balanced two-way layout was analyzed separately per position, because of the serious interaction, by means of a Dunnett-type comparison against the Col-0 control, allowing for heterogeneous variances. Petal break-strength was found significantly increased in almost all positions (indicated with a *) for haesa/hsl2 and serk1-1 mutant plants with respect to the Col-0 control. Calculations were performed in R (version 3.2.3). (B) Analytical size-exclusion chromatography. The HAESA LRR domain elutes as a monomer (black dotted line), as does the isolated SERK1 ectodomain (blue dotted line). A HAESA – IDA – SERK1 complex elutes as an apparent heterodimer (red line), while a mixture of HAESA and SERK1 yields two isolated peaks that correspond to monomeric HAESA and SERK1, respectively (black line). Void (V0) volume and total volume (Vt) are shown, together with elution volumes for molecular mass standards (A, Thyroglobulin, 669,000 Da; B, Ferritin, 440,00 Da, C, Aldolase, 158,000 Da; D, Conalbumin, 75,000 Da; E, Ovalbumin, 44,000 Da; F, Carbonic anhydrase, 29,000 Da). A SDS PAGE of the peak fractions is shown alongside. Purified HAESA and SERK1 are ~75 and ~28 kDa, respectively. (C) Isothermal titration calorimetry of wild-type and Hyp64→Pro IDA versus the HAESA and SERK1 ectodomains. The titration of IDA wild-type versus the isolated HAESA ectodomain from Figure 1B is shown for comparison (red line; n.d. no detectable binding) (D) Analytical size-exclusion chromatography in the presence of the IDA Hyp64→Pro mutant peptide reveals no complex formation between HAESA and SERK1 ectodomains. A SDS PAGE of the peak fractions is shown alongside. (E) In vitro kinase assays of the HAESA and SERK1 kinase domains. Wild-type HAESA and SERK1 kinase domains (KDs) exhibit auto-phosphorylation activities (lanes 1 + 3). Mutant (m) versions, which carry point mutations in their active sites (Asp837HAESA→Asn, Asp447SERK1→Asn) possess no autophosphorylation activity (lanes 2+4). Transphosphorylation activity from the active kinase to the mutated form can be observed in both directions (lanes 5+6). A coomassie-stained gel loading control is shown below.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:39:22ZPetal break-strength assaysgeneGENE:melaniev@ebi.ac.uk2023-03-17T16:29:45Zserkprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:55Zmutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:03ZhaesageneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:21Zhsl2protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:44Zmutantprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:50Zwild-typegeneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:05ZhaesageneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:23Zhsl2geneGENE:melaniev@ebi.ac.uk2023-03-17T09:44:19Zserk1-1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:58Zmutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:39:31ZAnalytical size-exclusion chromatographyproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:44:40ZLRR domainoligomeric_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:37ZmonomerproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomaincomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:45:13ZHAESA – IDA – SERK1oligomeric_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:45:27ZheterodimerproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1oligomeric_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:45:22ZmonomericproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:16ZThyroglobulinproteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:30ZFerritinproteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:46ZAldolaseproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:00ZConalbuminproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:15ZOvalbuminproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:30ZCarbonic anhydraseexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:45:35ZSDS PAGEproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T16:29:07ZIsothermal titration calorimetryprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:50Zwild-typeptmMESH:melaniev@ebi.ac.uk2023-07-21T12:37:35ZHyp64→ProptmMESH:melaniev@ebi.ac.uk2023-07-21T12:37:24ZHyp64proteinPR:melaniev@ebi.ac.uk2023-07-21T12:36:07ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:27:48Zectodomainsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:46:53ZtitrationproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:50Zwild-typeproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:33Zectodomainexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T16:29:11ZAnalytical size-exclusion chromatographyprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:15Zpresence ofproteinPR:melaniev@ebi.ac.uk2023-07-21T12:36:27ZIDAptmMESH:melaniev@ebi.ac.uk2023-07-21T12:37:35ZHyp64→ProptmMESH:melaniev@ebi.ac.uk2023-07-21T12:37:24ZHyp64protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:46:39ZmutantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T09:46:42ZpeptideproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:27:52Zectodomainsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:45:35ZSDS PAGEexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:45:40ZIn vitro kinase assaysproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-22T10:18:32ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:45:46Zkinase domainsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:50ZWild-typeproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:08ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:27:56Zkinase domainsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:27:59ZKDsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:35ZMutantexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:45:42Zpoint mutationssiteSO:melaniev@ebi.ac.uk2023-03-17T09:46:35Zactive sitesmutantMESH:melaniev@ebi.ac.uk2023-03-17T09:46:22ZAsp837HAESA→AsnmutantMESH:melaniev@ebi.ac.uk2023-03-17T09:46:29ZAsp447SERK1→Asnprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12Zactiveprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:45:58Zmutatedelife-15075-fig3.jpgfig3FIGfig_caption12096DOI:
http://dx.doi.org/10.7554/eLife.15075.008tbl1.xmltbl1TABLEtable_caption12143Crystallographic data collection, phasing and refinement statistics for the isolated A. thaliana HAESA ectodomain.tbl1.xmltbl1TABLEtable_caption12258DOI:
http://dx.doi.org/10.7554/eLife.15075.009tbl1.xmltbl1TABLEtable<?xml version="1.0" encoding="UTF-8"?>
<table frame="hsides" rules="groups"><thead><tr><th valign="top" rowspan="1" colspan="1"/><th valign="top" rowspan="1" colspan="1">HAESA NaI shortsoak</th><th valign="top" rowspan="1" colspan="1">HAESA apo</th></tr></thead><tbody><tr><td valign="top" rowspan="1" colspan="1"><bold>PDB-ID</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">5IXO</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Data collection</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Space group</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>3<sub>1</sub> 21</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>3<sub>1</sub> 21</td></tr><tr><td valign="top" rowspan="1" colspan="1">Cell dimensions</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>a</italic>, <italic>b, c</italic> (Å)</td><td valign="top" rowspan="1" colspan="1">148.55, 148.55, 58.30</td><td valign="top" rowspan="1" colspan="1">149.87, 149.87, 58.48</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>α</italic>, β, γ (°)</td><td valign="top" rowspan="1" colspan="1">90, 90, 120</td><td valign="top" rowspan="1" colspan="1">90, 90, 120</td></tr><tr><td valign="top" rowspan="1" colspan="1">Resolution (Å)</td><td valign="top" rowspan="1" colspan="1">48.63–2.39 (2.45–2.39)</td><td valign="top" rowspan="1" colspan="1">45.75–1.74 (1.85–1.74)</td></tr><tr><td valign="top" rowspan="1" colspan="1">R<sub>meas</sub><sup>#</sup></td><td valign="top" rowspan="1" colspan="1">0.096 (0.866)</td><td valign="top" rowspan="1" colspan="1">0.038 (1.02)</td></tr><tr><td valign="top" rowspan="1" colspan="1">CC(1/2)<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">100/86.6</td><td valign="top" rowspan="1" colspan="1">100/75.6</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>I/σ I<sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">27.9 (4.9)</td><td valign="top" rowspan="1" colspan="1">18.7 (1.8)</td></tr><tr><td valign="top" rowspan="1" colspan="1">Completeness (%)<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">99.9 (98.6)</td><td valign="top" rowspan="1" colspan="1">99.6 (97.4)</td></tr><tr><td valign="top" rowspan="1" colspan="1">Redundancy<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">53.1 (29.9)</td><td valign="top" rowspan="1" colspan="1">14.4 (14.0)</td></tr><tr><td valign="top" rowspan="1" colspan="1">Wilson B-factor (Å<sup>2</sup>)<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">84.45</td><td valign="top" rowspan="1" colspan="1">81.10</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Refinement</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Resolution (Å)</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">45.75 – 1.74</td></tr><tr><td valign="top" rowspan="1" colspan="1">No. reflections</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">71,213</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>R</italic><sub>work/</sub><italic>R</italic><sub>free</sub><sup>$</sup></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">0.188/0.218</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>No. atoms</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Protein/glycan</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">4,533/126</td></tr><tr><td valign="top" rowspan="1" colspan="1">Water</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">71</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Res. B-factors (Å<sup>2</sup>)</bold><sup>$</sup></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Protein</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">77.54</td></tr><tr><td valign="top" rowspan="1" colspan="1">Glycan</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">95.98</td></tr><tr><td valign="top" rowspan="1" colspan="1">Water</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">73.20</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>R.m.s deviations</bold><sup>$</sup></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Bond lengths (Å)</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">0.0095</td></tr><tr><td valign="top" rowspan="1" colspan="1">Bond angles (°)</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1">1.51</td></tr></tbody></table>
12305 HAESA NaI shortsoak HAESA apo PDB-ID 5IXO Data collection Space group P31 21 P31 21 Cell dimensions a, b, c (Å) 148.55, 148.55, 58.30 149.87, 149.87, 58.48 α, β, γ (°) 90, 90, 120 90, 90, 120 Resolution (Å) 48.63–2.39 (2.45–2.39) 45.75–1.74 (1.85–1.74) Rmeas# 0.096 (0.866) 0.038 (1.02) CC(1/2)# 100/86.6 100/75.6 I/σ I# 27.9 (4.9) 18.7 (1.8) Completeness (%)# 99.9 (98.6) 99.6 (97.4) Redundancy# 53.1 (29.9) 14.4 (14.0) Wilson B-factor (Å2)# 84.45 81.10 Refinement Resolution (Å) 45.75 – 1.74 No. reflections 71,213 Rwork/Rfree$ 0.188/0.218 No. atoms Protein/glycan 4,533/126 Water 71 Res. B-factors (Å2)$ Protein 77.54 Glycan 95.98 Water 73.20 R.m.s deviations$ Bond lengths (Å) 0.0095 Bond angles (°) 1.51 tbl1.xmltbl1TABLEtable_footnote13117Highest resolution shell is shown in parenthesis.tbl1.xmltbl1TABLEtable_footnote13167#As defined in XDS.tbl1.xmltbl1TABLEtable_footnote13187$As defined in Refmac5.tbl2.xmltbl2TABLEtable_caption13211Crystallographic data collection and refinement statistics for the HAESA – IDA, – PKGV-IDA, – IDL1 and – IDA – SERK1 complexes.tbl2.xmltbl2TABLEtable_caption13349DOI:
http://dx.doi.org/10.7554/eLife.15075.010tbl2.xmltbl2TABLEtable<?xml version="1.0" encoding="UTF-8"?>
<table frame="hsides" rules="groups"><thead><tr><th valign="top" rowspan="1" colspan="1"/><th valign="top" rowspan="1" colspan="1">HAESA – IDA</th><th valign="top" rowspan="1" colspan="1">HAESA – PKGV-IDA</th><th valign="top" rowspan="1" colspan="1">HAESA – IDL1</th><th valign="top" rowspan="1" colspan="1">HAESA – IDA – SERK1</th></tr></thead><tbody><tr><td valign="top" rowspan="1" colspan="1"><bold>PDB-ID</bold></td><td valign="top" rowspan="1" colspan="1">5IXQ</td><td valign="top" rowspan="1" colspan="1">5IXT</td><td valign="top" rowspan="1" colspan="1">5IYN</td><td valign="top" rowspan="1" colspan="1">5IYX</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Data collection</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Space group</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>3<sub>1</sub> 21</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>3<sub>1</sub> 21</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>3<sub>1</sub> 21</td><td valign="top" rowspan="1" colspan="1"><italic>P</italic>2<sub>1</sub>2<sub>1</sub>2<sub>1</sub></td></tr><tr><td valign="top" rowspan="1" colspan="1">Cell dimensions</td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">
<italic>a</italic>, <italic>b, c</italic> (Å)</td><td valign="top" rowspan="1" colspan="1">148.55, 148.55, 58.30</td><td valign="top" rowspan="1" colspan="1">148.92, 148.92, 58.02</td><td valign="top" rowspan="1" colspan="1">150.18, 150.18, 60.07</td><td valign="top" rowspan="1" colspan="1">74.51, 100.46, 142.76</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>α</italic>, β, γ (°)</td><td valign="top" rowspan="1" colspan="1">90, 90, 120</td><td valign="top" rowspan="1" colspan="1">90, 90, 120</td><td valign="top" rowspan="1" colspan="1">90, 90, 120</td><td valign="top" rowspan="1" colspan="1">90, 90, 90</td></tr><tr><td valign="top" rowspan="1" colspan="1">Resolution (Å)</td><td valign="top" rowspan="1" colspan="1">48.54–1.86 <break/>(1.97–1.86)</td><td valign="top" rowspan="1" colspan="1">48.75–1.94 (2,06–1.94)</td><td valign="top" rowspan="1" colspan="1">49.16–2.56 (2.72–2.56)</td><td valign="top" rowspan="1" colspan="1">47.59–2.43 (2.57–2.43)</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>R<sub>meas</sub><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">0.057 (1.35)</td><td valign="top" rowspan="1" colspan="1">0.037 (0.97)</td><td valign="top" rowspan="1" colspan="1">0.056 (1.27)</td><td valign="top" rowspan="1" colspan="1">0.113 (1.37)</td></tr><tr><td valign="top" rowspan="1" colspan="1">CC(1/2)<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">100/77.9</td><td valign="top" rowspan="1" colspan="1">100/80.3</td><td valign="top" rowspan="1" colspan="1">100/89.5</td><td valign="top" rowspan="1" colspan="1">100/77.6</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>I</italic>/σ<italic>I<sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">16.7 (2.0)</td><td valign="top" rowspan="1" colspan="1">20.9 (2.4)</td><td valign="top" rowspan="1" colspan="1">26.0 (1.9)</td><td valign="top" rowspan="1" colspan="1">16.12 (2.0)</td></tr><tr><td valign="top" rowspan="1" colspan="1">Completeness<italic><sup>#</sup></italic> (%)</td><td valign="top" rowspan="1" colspan="1">99.8 (98.6)</td><td valign="top" rowspan="1" colspan="1">99.4 (97.9)</td><td valign="top" rowspan="1" colspan="1">99.5 (98.8)</td><td valign="top" rowspan="1" colspan="1">99.4 (96.4s</td></tr><tr><td valign="top" rowspan="1" colspan="1">Redundancy<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">20.3 (19.1)</td><td valign="top" rowspan="1" colspan="1">11.2 (11.1)</td><td valign="top" rowspan="1" colspan="1">14.7 (14.7)</td><td valign="top" rowspan="1" colspan="1">9.7 (9.3)</td></tr><tr><td valign="top" rowspan="1" colspan="1">Wilson B-factor (Å<sup>2</sup>)<italic><sup>#</sup></italic></td><td valign="top" rowspan="1" colspan="1">80.0</td><td valign="top" rowspan="1" colspan="1">81.7</td><td valign="top" rowspan="1" colspan="1">89.5</td><td valign="top" rowspan="1" colspan="1">59.3</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Refinement</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Resolution (Å)</td><td valign="top" rowspan="1" colspan="1">48.54–1.86</td><td valign="top" rowspan="1" colspan="1">48.75–1.94</td><td valign="top" rowspan="1" colspan="1">49.16–2.56</td><td valign="top" rowspan="1" colspan="1">47.59–2.43</td></tr><tr><td valign="top" rowspan="1" colspan="1">No. reflections</td><td valign="top" rowspan="1" colspan="1">58,551</td><td valign="top" rowspan="1" colspan="1">51,557</td><td valign="top" rowspan="1" colspan="1">23,835</td><td valign="top" rowspan="1" colspan="1">38,969</td></tr><tr><td valign="top" rowspan="1" colspan="1"><italic>R</italic><sub>work/</sub><italic>R</italic><sub>free</sub><sup>$</sup></td><td valign="top" rowspan="1" colspan="1">0.190/0.209</td><td valign="top" rowspan="1" colspan="1">0.183/0.208</td><td valign="top" rowspan="1" colspan="1">0.199/0.236</td><td valign="top" rowspan="1" colspan="1">0.199/0.235</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>No. atoms</bold></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Protein/Glycan</td><td valign="top" rowspan="1" colspan="1">4,541/176</td><td valign="top" rowspan="1" colspan="1">4,545/176</td><td valign="top" rowspan="1" colspan="1">4,499/176</td><td valign="top" rowspan="1" colspan="1">5,965/168</td></tr><tr><td valign="top" rowspan="1" colspan="1">Peptide</td><td valign="top" rowspan="1" colspan="1">93</td><td valign="top" rowspan="1" colspan="1">93</td><td valign="top" rowspan="1" colspan="1">90</td><td valign="top" rowspan="1" colspan="1">112</td></tr><tr><td valign="top" rowspan="1" colspan="1">Water</td><td valign="top" rowspan="1" colspan="1">39</td><td valign="top" rowspan="1" colspan="1">40</td><td valign="top" rowspan="1" colspan="1">9</td><td valign="top" rowspan="1" colspan="1">136</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>Res. B-factors (Å<sup>2</sup>)</bold><sup>$</sup></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Protein/Glycan</td><td valign="top" rowspan="1" colspan="1">79.48/109.02</td><td valign="top" rowspan="1" colspan="1">79.63/113.24</td><td valign="top" rowspan="1" colspan="1">102.12/132.49</td><td valign="top" rowspan="1" colspan="1">60.05/73.48</td></tr><tr><td valign="top" rowspan="1" colspan="1">Peptide</td><td valign="top" rowspan="1" colspan="1">87.19</td><td valign="top" rowspan="1" colspan="1">89.50</td><td valign="top" rowspan="1" colspan="1">125.74</td><td valign="top" rowspan="1" colspan="1">51.06</td></tr><tr><td valign="top" rowspan="1" colspan="1">Water</td><td valign="top" rowspan="1" colspan="1">75.32</td><td valign="top" rowspan="1" colspan="1">71.92</td><td valign="top" rowspan="1" colspan="1">74.65</td><td valign="top" rowspan="1" colspan="1">51.47</td></tr><tr><td valign="top" rowspan="1" colspan="1"><bold>R.m.s deviations</bold><sup>$</sup></td><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/><td valign="top" rowspan="1" colspan="1"/></tr><tr><td valign="top" rowspan="1" colspan="1">Bond lengths (Å)</td><td valign="top" rowspan="1" colspan="1">0.0087</td><td valign="top" rowspan="1" colspan="1">0.0091</td><td valign="top" rowspan="1" colspan="1">0.0081</td><td valign="top" rowspan="1" colspan="1">0.0074</td></tr><tr><td valign="top" rowspan="1" colspan="1">Bond angles (°)</td><td valign="top" rowspan="1" colspan="1">1.48</td><td valign="top" rowspan="1" colspan="1">1.47</td><td valign="top" rowspan="1" colspan="1">1.36</td><td valign="top" rowspan="1" colspan="1">1.34</td></tr></tbody></table>
13396 HAESA – IDA HAESA – PKGV-IDA HAESA – IDL1 HAESA – IDA – SERK1 PDB-ID 5IXQ 5IXT 5IYN 5IYX Data collection Space group P31 21 P31 21 P31 21 P212121 Cell dimensions a, b, c (Å) 148.55, 148.55, 58.30 148.92, 148.92, 58.02 150.18, 150.18, 60.07 74.51, 100.46, 142.76 α, β, γ (°) 90, 90, 120 90, 90, 120 90, 90, 120 90, 90, 90 Resolution (Å) 48.54–1.86 (1.97–1.86) 48.75–1.94 (2,06–1.94) 49.16–2.56 (2.72–2.56) 47.59–2.43 (2.57–2.43) Rmeas# 0.057 (1.35) 0.037 (0.97) 0.056 (1.27) 0.113 (1.37) CC(1/2)# 100/77.9 100/80.3 100/89.5 100/77.6 I/σI# 16.7 (2.0) 20.9 (2.4) 26.0 (1.9) 16.12 (2.0) Completeness# (%) 99.8 (98.6) 99.4 (97.9) 99.5 (98.8) 99.4 (96.4s Redundancy# 20.3 (19.1) 11.2 (11.1) 14.7 (14.7) 9.7 (9.3) Wilson B-factor (Å2)# 80.0 81.7 89.5 59.3 Refinement Resolution (Å) 48.54–1.86 48.75–1.94 49.16–2.56 47.59–2.43 No. reflections 58,551 51,557 23,835 38,969 Rwork/Rfree$ 0.190/0.209 0.183/0.208 0.199/0.236 0.199/0.235 No. atoms Protein/Glycan 4,541/176 4,545/176 4,499/176 5,965/168 Peptide 93 93 90 112 Water 39 40 9 136 Res. B-factors (Å2)$ Protein/Glycan 79.48/109.02 79.63/113.24 102.12/132.49 60.05/73.48 Peptide 87.19 89.50 125.74 51.06 Water 75.32 71.92 74.65 51.47 R.m.s deviations$ Bond lengths (Å) 0.0087 0.0091 0.0081 0.0074 Bond angles (°) 1.48 1.47 1.36 1.34 tbl2.xmltbl2TABLEtable_footnote14804Highest resolution shell is shown in parenthesis.tbl2.xmltbl2TABLEtable_footnote14854#As defined in XDS.tbl2.xmltbl2TABLEtable_footnote14874$As defined in Refmac5.RESULTSparagraph14898We purified the HAESA ectodomain (residues 20–620) from baculovirus-infected insect cells (Figure 1—figure supplement 1A, see Materials and methods) and quantified the interaction of the ~75 kDa glycoprotein with synthetic IDA peptides using isothermal titration calorimetry (ITC). A Hyp-modified dodecamer comprising the highly conserved PIP motif in IDA (Figure 1A) interacts with HAESA with 1:1 stoichiometry (N) and with a dissociation constant (Kd) of ~20 μM (Figure 1B). We next determined crystal structures of the apo HAESA ectodomain and of a HAESA-IDA complex, at 1.74 and 1.86 Å resolution, respectively (Figure 1C; Figure 1—figure supplement 1B–D; Tables 1,2). IDA binds in a completely extended conformation along the inner surface of the HAESA ectodomain, covering LRRs 2–14 (Figure 1C,D, Figure 1—figure supplement 2). The central Hyp64IDA is buried in a specific pocket formed by HAESA LRRs 8–10, with its hydroxyl group establishing hydrogen bonds with the strictly conserved Glu266HAESA and with a water molecule, which in turn is coordinated by the main chain oxygens of Phe289HAESA and Ser311HAESA (Figure 1E; Figure 1—figure supplement 3). The restricted size of the Hyp pocket suggests that IDA does not require arabinosylation of Hyp64IDA for activity in vivo, a modification that has been reported for Hyp residues in plant CLE peptide hormones. The C-terminal Arg-His-Asn motif in IDA maps to a cavity formed by HAESA LRRs 11–14 (Figure 1D,F). The COO- group of Asn69IDA is in direct contact with Arg407HAESA and Arg409HAESA and HAESA cannot bind a C-terminally extended IDA-SFVN peptide (Figures 1D,F, 2D). This suggests that the conserved Asn69IDA may constitute the very C-terminus of the mature IDA peptide in planta and that active IDA is generated by proteolytic processing from a longer pre-protein. Mutation of Arg417HSL2 (which corresponds to Arg409HAESA) causes a loss-of-function phenotype in HSL2, which indicates that the peptide binding pockets in different HAESA receptors have common structural and sequence features. Indeed, we find many of the residues contributing to the formation of the IDA binding surface in HAESA to be conserved in HSL2 and in other HAESA-type receptors in different plant species (Figure 1—figure supplement 3). A N-terminal Pro-rich motif in IDA makes contacts with LRRs 2–6 of the receptor (Figure 1D, Figure 1—figure supplement 2A–C). Other hydrophobic and polar interactions are mediated by Ser62IDA, Ser65IDA and by backbone atoms along the IDA peptide (Figure 1D, Figure 1—figure supplement 2A–C).experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:58:05ZpurifiedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomainresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T09:58:08Z20–620experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:58:11Zbaculovirus-infected insect cellsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:58:14Zglycoproteinprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:58:36ZsyntheticchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:11:53ZIDA peptidesexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:58:41Zisothermal titration calorimetryexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:58:49ZITCprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:59:09ZHyp-modifiedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:45Zdodecamerprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:59:16Zhighly conservedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:12:59ZPIP motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:59:53Zdissociation constantevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T09:31:37ZKdevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:25Zcrystal structuresprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:00:06ZapoproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomaincomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T10:00:16ZHAESA-IDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:00:36Zcompletely extended conformationproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomainstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:04:34ZLRRs 2–14ptmMESH:melaniev@ebi.ac.uk2023-07-21T12:39:35ZHyp64proteinPR:melaniev@ebi.ac.uk2023-03-17T10:01:33ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T10:01:41ZpocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:01:50ZLRRs 8–10bond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrogen bondsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:02:03Zstrictly conservedresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:02:08ZGlu266proteinPR:melaniev@ebi.ac.uk2023-03-17T10:02:15ZHAESAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T09:15:02Zwaterresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:02:29ZPhe289proteinPR:melaniev@ebi.ac.uk2023-03-17T10:02:37ZHAESAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:02:42ZSer311proteinPR:melaniev@ebi.ac.uk2023-03-17T10:02:56ZHAESAsiteSO:melaniev@ebi.ac.uk2023-03-17T10:03:01ZHyp pocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAptmMESH:melaniev@ebi.ac.uk2023-03-17T10:03:05ZarabinosylationptmMESH:melaniev@ebi.ac.uk2023-07-21T12:39:50ZHyp64proteinPR:melaniev@ebi.ac.uk2023-03-17T10:03:28ZIDAresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T10:03:54ZHyptaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:04:09ZCLE peptide hormonesstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T10:06:21ZcavityproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:06:28ZLRRs 11–14residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:06:35ZAsn69proteinPR:melaniev@ebi.ac.uk2023-03-17T10:06:46ZIDAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:06:54ZArg407proteinPR:melaniev@ebi.ac.uk2023-03-17T10:06:56ZHAESAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:06:59ZArg409proteinPR:melaniev@ebi.ac.uk2023-03-17T10:07:02ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:07:10ZC-terminally extendedmutantMESH:melaniev@ebi.ac.uk2023-03-17T10:07:16ZIDA-SFVNprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:07:20Zconservedresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:07:23ZAsn69proteinPR:melaniev@ebi.ac.uk2023-03-17T10:07:32ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:07:37ZmaturechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptidetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:00Zplantaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12ZactiveproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:08:09ZMutationresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:11ZArg417proteinPR:melaniev@ebi.ac.uk2023-03-17T10:08:14ZHSL2residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:17ZArg409proteinPR:melaniev@ebi.ac.uk2023-03-17T10:08:19ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2siteSO:melaniev@ebi.ac.uk2023-03-17T10:08:23Zpeptide binding pocketsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:08:25ZHAESA receptorssiteSO:melaniev@ebi.ac.uk2023-03-17T10:08:29ZIDA binding surfaceproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:32ZconservedproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:08:36ZHAESA-type receptorstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:02:59ZPro-rich motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:08:48ZLRRs 2–6bond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrophobic and polar interactionsresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:09:02ZSer62proteinPR:melaniev@ebi.ac.uk2023-03-17T10:09:13ZIDAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:09:16ZSer65proteinPR:melaniev@ebi.ac.uk2023-03-17T10:09:25ZIDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptideRESULTStitle_217511HAESA specifically senses IDA-family dodecamer peptidesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:12:54ZIDA-familystructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:06:17ZdodecamerchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:13:06ZpeptidesRESULTSparagraph17567We next investigated whether HAESA binds N-terminally extended versions of IDA. We obtained a structure of HAESA in complex with a PKGV-IDA peptide at 1.94 Å resolution (Table 2). In this structure, no additional electron density accounts for the PKGV motif at the IDA N-terminus (Figure 2A,B). Consistently, PKGV-IDA and IDA have similar binding affinities in our ITC assays, further indicating that HAESA senses a dodecamer peptide comprising residues 58-69IDA (Figure 2D).proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:12:37ZN-terminally extendedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:13:01ZstructureproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:09ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:35:29Zin complex withmutantMESH:melaniev@ebi.ac.uk2023-03-17T09:30:14ZPKGV-IDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:13:12ZpeptideevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:13:16ZstructureevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:13:19Zelectron densitystructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:13:30ZPKGV motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAmutantMESH:melaniev@ebi.ac.uk2023-03-17T09:30:14ZPKGV-IDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:13:35Zbinding affinitiesexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:13:38ZITC assaysproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:45ZdodecamerchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:14:02Zpeptideresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T10:14:06Z58-69proteinPR:melaniev@ebi.ac.uk2023-03-17T10:14:20ZIDARESULTSparagraph18046We next tested if HAESA binds other IDA peptide family members. IDL1, which can rescue IDA loss-of-function mutants when introduced in abscission zone cells, can also be sensed by HAESA, albeit with lower affinity (Figure 2D). A 2.56 Å co-crystal structure with IDL1 reveals that different IDA family members use a common binding mode to interact with HAESA-type receptors (Figure 2A–C,E, Table 2). We do not detect interaction between HAESA and a synthetic peptide missing the C-terminal Asn69IDA (ΔN69), highlighting the importance of the polar interactions between the IDA carboxy-terminus and Arg407HAESA/Arg409HAESA (Figures 1F, 2D). Replacing Hyp64IDA, which is common to all IDLs, with proline impairs the interaction with the receptor, as does the Lys66IDA/Arg67IDA → Ala double-mutant discussed below (Figure 1A, 2D). Notably, HAESA can discriminate between IDLs and functionally unrelated dodecamer peptides with Hyp modifications, such as CLV3 (Figures 2D, 7).proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:14:03ZIDA peptide family membersproteinPR:melaniev@ebi.ac.uk2023-03-17T09:29:55ZIDL1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:44ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:18:36ZaffinityevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:18:39Zco-crystal structureproteinPR:melaniev@ebi.ac.uk2023-03-17T09:29:55ZIDL1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:19:03ZIDA family membersprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:19:14ZHAESA-type receptorsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:19:21ZsyntheticchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:19:25Zpeptideprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:19:28Zmissing the C-terminalresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:19:34ZAsn69proteinPR:melaniev@ebi.ac.uk2023-03-17T10:19:46ZIDAmutantMESH:melaniev@ebi.ac.uk2023-03-17T10:19:53ZΔN69bond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zpolar interactionsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:20:03ZArg407proteinPR:melaniev@ebi.ac.uk2023-03-17T10:20:06ZHAESAresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:20:09ZArg409proteinPR:melaniev@ebi.ac.uk2023-03-17T10:20:12ZHAESAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:20:15ZReplacingptmMESH:melaniev@ebi.ac.uk2023-07-21T12:37:23ZHyp64proteinPR:melaniev@ebi.ac.uk2023-03-17T10:20:32ZIDAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T10:20:44ZprolinemutantMESH:melaniev@ebi.ac.uk2023-03-17T10:20:55ZLys66IDA/Arg67IDA → Alaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:20:58Zdouble-mutantproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:21:07Zfunctionally unrelatedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:45ZdodecamerchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:21:28ZpeptidesptmMESH:melaniev@ebi.ac.uk2023-03-17T10:21:33ZHyp modificationsproteinPR:melaniev@ebi.ac.uk2023-03-17T10:21:54ZCLV3RESULTStitle_219026The co-receptor kinase SERK1 allows for high-affinity IDA sensingprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:22:26Zco-receptor kinaseproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1RESULTSparagraph19092Our binding assays reveal that IDA family peptides are sensed by the isolated HAESA ectodomain with relatively weak binding affinities (Figures 1B, 2A–D). It has been recently reported that SOMATIC EMBRYOGENESIS RECEPTOR KINASES (SERKs) are positive regulators of floral abscission and can interact with HAESA and HSL2 in an IDA-dependent manner. As all five SERK family members appear to be expressed in the Arabidopsis abscission zone, we quantified their relative contribution to floral abscission in Arabidopsis using a petal break-strength assay. Our experiments suggest that among the SERK family members, SERK1 is a positive regulator of floral abscission. We found that the force required to remove the petals of serk1-1 mutants is significantly higher than that needed for wild-type plants, as previously observed for haesa/hsl2 mutants, and that floral abscission is delayed in serk1-1 (Figure 3A). The serk2-2, serk3-1, serk4-1 and serk5-1 mutant lines showed a petal break-strength profile not significantly different from wild-type plants. Possibly because SERKs have additional roles in plant development such as in pollen formation and brassinosteroid signaling, we found that higher-order SERK mutants exhibit pleiotropic phenotypes in the flower, rendering their analysis and comparison by quantitative petal break-strength assays difficult. We thus focused on analyzing the contribution of SERK1 to HAESA ligand sensing and receptor activation.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:27:24Zbinding assayschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:27:28ZIDA family peptidesprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:27:31ZisolatedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34ZectodomainevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:27:34Zbinding affinitiesprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:38ZSOMATIC EMBRYOGENESIS RECEPTOR KINASESprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:47ZSERKsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:45ZHSL2protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:28:50ZSERK family memberstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:28:16ZArabidopsistaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:28:38ZArabidopsisexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:28:43Zpetal break-strength assayprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:28:50ZSERK family membersproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1geneGENE:melaniev@ebi.ac.uk2023-03-17T09:44:19Zserk1-1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:29:05Zmutantsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:05ZhaesageneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:23Zhsl2protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:29:10ZmutantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T09:44:19Zserk1-1geneGENE:melaniev@ebi.ac.uk2023-03-17T10:29:18Zserk2-2geneGENE:melaniev@ebi.ac.uk2023-03-17T10:29:27Zserk3-1geneGENE:melaniev@ebi.ac.uk2023-03-17T10:29:36Zserk4-1geneGENE:melaniev@ebi.ac.uk2023-03-17T10:29:45Zserk5-1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:29:49Zmutantprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:47ZSERKsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:30:01Zquantitative petal break-strength assaysproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESARESULTSparagraph20558In vitro, the LRR ectodomain of SERK1 (residues 24–213) forms stable, IDA-dependent heterodimeric complexes with HAESA in size exclusion chromatography experiments (Figure 3B). We next quantified the contribution of SERK1 to IDA recognition by HAESA. We found that HAESA senses IDA with a ~60 fold higher binding affinity in the presence of SERK1, suggesting that SERK1 is involved in the specific recognition of the peptide hormone (Figure 3C). We next titrated SERK1 into a solution containing only the HAESA ectodomain. In this case, there was no detectable interaction between receptor and co-receptor, while in the presence of IDA, SERK1 strongly binds HAESA with a dissociation constant in the mid-nanomolar range (Figure 3C). This suggests that IDA itself promotes receptor – co-receptor association, as previously described for the steroid hormone brassinolide and for other LRR-RK complexes. Importantly, hydroxyprolination of IDA is critical for HAESA-IDA-SERK1 complex formation (Figure 3C,D). Our calorimetry experiments now reveal that SERKs may render HAESA, and potentially other receptor kinases, competent for high-affinity sensing of their cognate ligands.structure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:10:10ZLRR ectodomainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1residue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:12Z24–213protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:19Zstableprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:23ZIDA-dependentoligomeric_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:39Zheterodimericprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:43Zcomplexes withproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:34:47Zsize exclusion chromatographyproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:29ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-22T10:19:27ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:34:51Zbinding affinityprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:13Zpresence ofproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:24Zpeptide hormoneexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:35:24ZtitratedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomainprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:15Zpresence ofproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:53Zdissociation constantproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:35:59Zsteroid hormonechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:36:07Zbrassinolidecomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-21T18:20:42ZLRR-RKptmMESH:melaniev@ebi.ac.uk2023-03-17T10:36:41ZhydroxyprolinationproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAcomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-21T18:20:42ZHAESA-IDA-SERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:37:07Zcalorimetryprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:47ZSERKsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:37:12Zreceptor kinasesRESULTSparagraph21738Upon IDA binding at the cell surface, the kinase domains of HAESA and SERK1, which have been shown to be active protein kinases, may interact in the cytoplasm to activate each other. Consistently, the HAESA kinase domain can transphosphorylate SERK1 and vice versa in in vitro transphosphorylation assays (Figure 3E). Together, our genetic and biochemical experiments implicate SERK1 as a HAESA co-receptor in the Arabidopsis abscission zone.proteinPR:melaniev@ebi.ac.uk2023-03-22T10:19:41ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:39:05Zkinase domainsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12Zactiveprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:39:17Zprotein kinasesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:39:23Zkinase domainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:39:26Ztransphosphorylation assaysexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T10:39:45Zgenetic and biochemical experimentsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:39:59ZHAESA co-receptortaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:40:29ZArabidopsisRESULTStitle_222181SERK1 senses a conserved motif in IDA family peptidesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:41:04Zconservedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:41:07ZmotifchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T10:41:10ZIDA family peptideselife-15075-fig4.jpgfig4FIGfig_title_caption22235Crystal structure of a HAESA – IDA – SERK1 signaling complex.evidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:41:33ZCrystal structurecomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:45:14ZHAESA – IDA – SERK1elife-15075-fig4.jpgfig4FIGfig_caption22301(A) Overview of the ternary complex with HAESA in blue (surface representation), IDA in yellow (bonds representation) and SERK1 in orange (surface view). (B) The HAESA ectodomain undergoes a conformational change upon SERK1 co-receptor binding. Shown are Cα traces of a structural superposition of the unbound (yellow) and SERK1-bound (blue) HAESA ectodomains (r.m.s.d. is 1.5 Å between 572 corresponding Cα atoms). SERK1 (in orange) and IDA (in red) are shown alongside. The conformational change in the C-terminal LRRs and capping domain is indicated by an arrow. (C) SERK1 forms an integral part of the receptor's peptide binding pocket. The N-terminal capping domain of SERK1 (in orange) directly contacts the C-terminal part of IDA (in yellow, in bonds representation) and the receptor HAESA (in blue). Polar contacts of SERK1 with IDA are shown in magenta, with the HAESA LRR domain in gray. (D) Details of the zipper-like SERK1-HAESA interface. Ribbon diagrams of HAESA (in blue) and SERK1 (in orange) are shown with selected interface residues (in bonds representation). Polar interactions are highlighted as dotted lines (in magenta).proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:10ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34ZectodomainproteinPR:melaniev@ebi.ac.uk2023-03-22T10:20:00ZSERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T09:32:08Zstructural superpositionprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:44:20Zunboundprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:44:23ZSERK1-boundproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:28:03ZectodomainsevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:44:48Zr.m.s.d.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:45:02ZLRRsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:15Zcapping domainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1siteSO:melaniev@ebi.ac.uk2023-03-17T09:14:20Zpeptide binding pocketstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:15Zcapping domainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:45:34ZreceptorproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAbond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28ZPolar contactsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:45:41ZLRR domainstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:46:04Zzipper-likesiteSO:melaniev@ebi.ac.uk2023-03-17T10:46:09ZSERK1-HAESA interfaceproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1siteSO:melaniev@ebi.ac.uk2023-03-17T10:46:15Zinterface residuesbond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28ZPolar interactionselife-15075-fig4.jpgfig4FIGfig_caption23453DOI:
http://dx.doi.org/10.7554/eLife.15075.011RESULTSparagraph23500To understand in molecular terms how SERK1 contributes to high-affinity IDA recognition, we solved a 2.43 Å crystal structure of the ternary HAESA – IDA – SERK1 complex (Figure 4A, Table 2). HAESA LRRs 16–21 and its C-terminal capping domain undergo a conformational change upon SERK1 binding (Figure 4B). The SERK1 ectodomain interacts with the IDA peptide binding site using a loop region (residues 51-59SERK1) from its N-terminal cap (Figure 4A,C). SERK1 loop residues establish multiple hydrophobic and polar contacts with Lys66IDA and the C-terminal Arg-His-Asn motif in IDA (Figure 4C). SERK1 LRRs 1–5 and its C-terminal capping domain form an additional zipper-like interface with residues originating from HAESA LRRs 15–21 and from the HAESA C-terminal cap (Figure 4D). SERK1 binds HAESA using these two distinct interaction surfaces (Figure 1—figure supplement 3), with the N-cap of the SERK1 LRR domain partially covering the IDA peptide binding cleft.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-22T10:20:17ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T10:50:47Zcrystal structurecomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:45:14ZHAESA – IDA – SERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:05ZLRRs 16–21structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:15Zcapping domainproteinPR:melaniev@ebi.ac.uk2023-03-22T10:20:28ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34ZectodomainsiteSO:melaniev@ebi.ac.uk2023-03-17T10:51:25ZIDA peptide binding sitestructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:29Zloop regionresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T10:51:32Z51-59proteinPR:melaniev@ebi.ac.uk2023-03-17T10:51:35ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:43ZcapproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:46Zloopbond_interactionMESH:melaniev@ebi.ac.uk2023-07-28T14:22:28Zhydrophobic and polar contactsresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T10:51:55ZLys66proteinPR:melaniev@ebi.ac.uk2023-03-17T10:52:10ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:15ZLRRs 1–5structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:15Zcapping domainstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:29Zzipper-likesiteSO:melaniev@ebi.ac.uk2023-03-17T10:52:33ZinterfaceproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:36ZLRRs 15–21proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:39ZcapproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAsiteSO:melaniev@ebi.ac.uk2023-03-17T10:52:44Zinteraction surfacesstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:47ZN-capproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:52:51ZLRR domainsiteSO:melaniev@ebi.ac.uk2023-03-17T10:52:56ZIDA peptide binding cleftelife-15075-fig5.jpgfig5FIGfig_title_caption24478The IDA C-terminal motif is required for HAESA-SERK1 complex formation and for IDA bioactivity.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:56:03ZC-terminal motifcomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-21T18:20:42ZHAESA-SERK1elife-15075-fig5.jpgfig5FIGfig_caption24574(A) Size exclusion chromatography experiments similar to Figure 3B,D reveal that IDA mutant peptides targeting the C-terminal motif do not form biochemically stable HAESA-IDA-SERK1 complexes. Deletion of the C-terminal Asn69IDA completely inhibits complex formation. Void (V0) volume and total volume (Vt) are shown, together with elution volumes for molecular mass standards (A, Thyroglobulin, 669,000 Da; B, Ferritin, 440,00 Da, C, Aldolase, 158,000 Da; D, Conalbumin, 75,000 Da; E, Ovalbumin, 44,000 Da; F, Carbonic anhydrase, 29,000 Da). Purified HAESA and SERK1 are ~75 and ~28 kDa, respectively. Left panel: IDA K66A/R67A; center: IDA ΔN69, right panel: SDS-PAGE of peak fractions. Note that the HAESA and SERK1 input lanes have already been shown in Figure 3D. (B) Isothermal titration thermographs of wild-type and mutant IDA peptides titrated into a HAESA - SERK1 mixture in the cell. Table summaries for calorimetric binding constants and stoichoimetries for different IDA peptides binding to the HAESA – SERK1 ectodomain mixture ( ± fitting errors; n.d. no detectable binding) are shown alongside. (C) Quantitative petal break-strength assay for Col-0 wild-type flowers and 35S::IDA wild-type and 35S::IDA K66A/R67A mutant flowers. Petal break is measured from positions 1 to 8 along the primary inflorescence where positions 1 is defined as the flower at anthesis (n=15, bars=SD). The three treatment groups in this unbalanced one-way layout were compared by Tukey’s all-pairs comparison procedure using the package multcomp in R (version 3.2.3). 35S::IDA plants showed significantly increased abscission compared to Col-0 controls in inflorescence positions 2 and 3 (a). Up to inflorescence position 4, petal break in 35S::IDA K66A/R67A mutant plants was significantly increased compared to both Col-0 control plants (b) and 35S::IDA plants (c) (D) Normalized expression levels (relative expression ± standard error; ida: -0.02 ± 0.001; Col-0: 1 ± 0.11; 35S::IDA 124 ± 0.75; 35S::IDA K66A/R67A: 159 ± 0.58) of IDA wild-type and mutant transcripts in the 35S promoter over-expression lines analyzed in (C). (E) Magnified view of representative abscission zones from 35S::IDA, Col-0 wild-type and 35S::IDA K66A/R67A double-mutant T3 transgenic lines. 15 out of 15 35S::IDA plants, 0 out of 15 Col-0 plants and 0 out of 15 35S::IDA K66A/R67A double-mutant plants, showed an enlarged abscission zone, respectively (3 independent lines were analyzed).experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:45:52ZSize exclusion chromatographyproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:45ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:45:44ZmutantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T14:45:47Zpeptidesstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T14:45:50ZC-terminal motifprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:45:56Zbiochemically stablecomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T14:45:41ZHAESA-IDA-SERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:45:59ZDeletionresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T14:46:02ZAsn69proteinPR:melaniev@ebi.ac.uk2023-03-17T14:44:34ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:45:11ZinhibitsproteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:16ZThyroglobulinproteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:30ZFerritinproteinPR:melaniev@ebi.ac.uk2023-03-17T09:47:46ZAldolaseproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:00ZConalbuminproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:15ZOvalbuminproteinPR:melaniev@ebi.ac.uk2023-03-17T09:48:30ZCarbonic anhydraseexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T16:29:17ZPurifiedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1mutantMESH:melaniev@ebi.ac.uk2023-03-17T14:46:11ZIDA K66A/R67AmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:46:14ZIDA ΔN69experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:46:23ZSDS-PAGEproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1evidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T14:46:31ZIsothermal titration thermographsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typeprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:46:34ZmutantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:11:55ZIDA peptidesexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:47:02ZtitratedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1evidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T14:47:09Zcalorimetric binding constantschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:11:55ZIDA peptidesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:11ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomainexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:47:42Zpetal break-strength assayprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typegeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:18Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typegeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:19Z35SmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:51:06ZIDA K66A/R67Aprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:51:10ZmutantgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:54:27ZIDA K66A/R67Aprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:54:31Zmutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:55:03ZIDA K66A/R67AproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typeprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:55:07Zmutantexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:55:28Z35S promoter over-expression linesgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typegeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:56:01ZIDA K66A/R67Aprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:56:05Zdouble-mutantexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T14:56:07ZT3 transgenic linesgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SmutantMESH:melaniev@ebi.ac.uk2023-03-17T14:56:22ZIDA K66A/R67Aprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T14:56:25Zdouble-mutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantselife-15075-fig5.jpgfig5FIGfig_caption27046DOI:
http://dx.doi.org/10.7554/eLife.15075.012RESULTSparagraph27093The four C-terminal residues in IDA (Lys66IDA-Asn69IDA) are conserved among IDA family members and are in direct contact with SERK1 (Figures 1A, 4C). We thus assessed their contribution to HAESA – SERK1 complex formation. Deletion of the buried Asn69IDA completely inhibits receptor – co-receptor complex formation and HSL2 activation (Figure 5A,B). A synthetic Lys66IDA/Arg67IDA → Ala mutant peptide (IDA K66A/R66A) showed a 10 fold reduced binding affinity when titrated in a HAESA/SERK1 protein solution (Figures 5A,B, 2D). We over-expressed full-length wild-type IDA or this Lys66IDA/Arg67IDA → Ala double-mutant to similar levels in Col-0 Arabidopsis plants (Figure 5D). We found that over-expression of wild-type IDA leads to early floral abscission and an enlargement of the abscission zone (Figure 5C–E). In contrast, over-expression of the IDA Lys66IDA/Arg67IDA → Ala double mutant significantly delays floral abscission when compared to wild-type control plants, suggesting that the mutant IDA peptide has reduced activity in planta (Figure 5C–E). Comparison of 35S::IDA wild-type and mutant plants further indicates that mutation of Lys66IDA/Arg67IDA → Ala may cause a weak dominant negative effect (Figure 5C–E). In agreement with our structures and biochemical assays, this experiment suggests a role of the conserved IDA C-terminus in the control of floral abscission.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAresidue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T15:01:23ZLys66IDA-Asn69IDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:01:26Zconservedprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:19:03ZIDA family membersproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:30ZSERK1complex_assemblyGO:melaniev@ebi.ac.uk2023-03-21T18:20:42ZHAESA – SERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:02:08ZDeletionresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:02:11ZAsn69proteinPR:melaniev@ebi.ac.uk2023-03-17T15:02:22ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:02:41Zcompletely inhibitsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:03:03ZsyntheticmutantMESH:melaniev@ebi.ac.uk2023-03-17T15:03:05ZLys66IDA/Arg67IDA → Alaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:03:08ZmutantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:03:10ZpeptidemutantMESH:melaniev@ebi.ac.uk2023-03-17T15:03:20ZIDA K66A/R66AevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:03:24Zbinding affinityexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:03:27ZtitratedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:03:29Zover-expressedprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:19:56Zfull-lengthprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typeproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAmutantMESH:melaniev@ebi.ac.uk2023-03-17T15:03:32ZLys66IDA/Arg67IDA → Alaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:03:35Zdouble-mutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T15:03:48ZArabidopsistaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:03:57Zover-expressionprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typeproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:04:00Zover-expressionmutantMESH:melaniev@ebi.ac.uk2023-03-17T15:04:04ZIDA Lys66IDA/Arg67IDA → Alaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:04:06Zdouble mutantprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:49Zplantsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:04:14ZmutantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptidetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:00ZplantageneGENE:melaniev@ebi.ac.uk2023-03-17T14:52:20Z35SproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:44:51Zwild-typeprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:04:49Zmutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:50Zplantsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:04:52ZmutationmutantMESH:melaniev@ebi.ac.uk2023-03-17T15:04:54ZLys66IDA/Arg67IDA → AlaevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:04:56Zstructuresexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:05:00Zbiochemical assaysprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:05:02ZconservedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDADISCUSStitle_128494DiscussionDISCUSSparagraph28505In contrast to animal LRR receptors, plant LRR-RKs harbor spiral-shaped ectodomains and thus they require shape-complementary co-receptor proteins for receptor activation. For a rapidly growing number of plant signaling pathways, SERK proteins act as these essential co-receptors (; ). SERK1 has been previously reported as a positive regulator in plant embryogenesis, male sporogenesis, brassinosteroid signaling and in phytosulfokine perception. Recent findings by and our mechanistic studies now also support a positive role for SERK1 in floral abscission. As serk1-1 mutant plants show intermediate abscission phenotypes when compared to haesa/hsl2 mutants, SERK1 likely acts redundantly with other SERKs in the abscission zone (Figure 3A). It has been previously suggested that SERK1 can inhibit cell separation. However our results show that SERK1 also can activate this process upon IDA sensing, indicating that SERKs may fulfill several different functions in the course of the abscission process.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T15:08:22Zanimalprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:08:27ZLRR receptorstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:19:47ZLRR-RKsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:08:34Zspiral-shapedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:28:09Zectodomainsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:08:38Zshape-complementaryprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:08:42Zco-receptor proteinstaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:01Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:08:47ZSERK proteinsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:08:50Zco-receptorsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02ZplantproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1geneGENE:melaniev@ebi.ac.uk2023-03-17T09:44:19Zserk1-1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:40Zmutanttaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:33:50ZplantsgeneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:05ZhaesageneGENE:melaniev@ebi.ac.uk2023-03-17T09:43:23Zhsl2protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:44ZmutantsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:47ZSERKsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-22T10:21:16ZIDAprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T10:27:47ZSERKsDISCUSSparagraph29513While the sequence of the mature IDA peptide has not been experimentally determined in planta, our HAESA-IDA complex structures and calorimetry assays suggest that active IDLs are hydroxyprolinated dodecamers. It will be thus interesting to see if proteolytic processing of full-length IDA in vivo is regulated in a cell-type or tissue-specific manner. The central Hyp residue in IDA is found buried in the HAESA peptide binding surface and thus this post-translational modification may regulate IDA bioactivity. Our comparative structural and biochemical analysis further suggests that IDLs share a common receptor binding mode, but may preferably bind to HAESA, HSL1 or HSL2 in different plant tissues and organs.protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:11:07ZmaturechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptidetaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T10:08:00Zplantacomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T10:00:16ZHAESA-IDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:11:39ZstructuresevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:11:42Zcalorimetry assaysprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:12Zactiveprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:11:57Zhydroxyprolinatedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:16:45Zdodecamersprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:19:56Zfull-lengthproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T15:12:16ZHypproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAsiteSO:melaniev@ebi.ac.uk2023-03-17T15:12:28Zpeptide binding surfaceproteinPR:melaniev@ebi.ac.uk2023-03-22T10:21:31ZIDAexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:12:43Zcomparative structural and biochemical analysisprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T16:27:35ZHSL1proteinPR:melaniev@ebi.ac.uk2023-03-17T09:07:46ZHSL2taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02ZplantDISCUSSparagraph30229In our quantitative biochemical assays, the presence of SERK1 dramatically increases the HAESA binding specificity and affinity for IDA. This observation is consistent with our complex structure in which receptor and co-receptor together form the IDA binding pocket. The fact that SERK1 specifically interacts with the very C-terminus of IDLs may allow for the rational design of peptide hormone antagonists, as previously demonstrated for the brassinosteroid pathway. Importantly, our calorimetry assays reveal that the SERK1 ectodomain binds HAESA with nanomolar affinity, but only in the presence of IDA (Figure 3C). This ligand-induced formation of a receptor – co-receptor complex may allow the HAESA and SERK1 kinase domains to efficiently trans-phosphorylate and activate each other in the cytoplasm. It is of note that our reported binding affinities for IDA and SERK1 have been measured using synthetic peptides and the isolated HAESA and SERK1 ectodomains, and thus might differ in the context of the full-length, membrane-embedded signaling complex.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T16:29:22Zquantitative biochemical assaysprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:15Zpresence ofproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:31:21ZstructuresiteSO:melaniev@ebi.ac.uk2023-03-17T09:01:38ZIDA binding pocketproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:31:45Zpeptide hormone antagonistsexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:31:48Zcalorimetry assaysproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T08:34:34Zectodomainprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:32:04ZbindsproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T10:35:15Zpresence ofproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:32:32Zkinase domainsevidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:18Zbinding affinitiesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:32:35ZsyntheticchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:32:38Zpeptidesexperimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:32:41ZisolatedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:32:49Zectodomainsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:19:56Zfull-lengthprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:32:45Zmembrane-embeddedelife-15075-fig6.jpgfig6FIGfig_title_caption31293SERK1 uses partially overlapping surface areas to activate different plant signaling receptors.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:33:24Zsignaling receptorselife-15075-fig6.jpgfig6FIGfig_caption31389(A) Structural comparison of plant steroid and peptide hormone membrane signaling complexes. Left panel: Ribbon diagram of HAESA (in blue), SERK1 (in orange) and IDA (in bonds and surface represention). Right panel: Ribbon diagram of the plant steroid receptor BRI1 (in blue) bound to brassinolide (in gray, in bonds representation) and to SERK1, shown in the same orientation (PDB-ID. 4lsx). (B) View of the inner surface of the SERK1 LRR domain (PDB-ID 4lsc, surface representation, in gray). A ribbon diagram of SERK1 in the same orientation is shown alongside. Residues interacting with the HAESA or BRI1 LRR domains are shown in orange or magenta, respectively.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T16:29:27ZStructural comparisontaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02ZplantchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:44:58Zsteroidprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:51:22Zpeptide hormoneprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:45:38Zmembrane signaling complexesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:46ZIDAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:45:44Zsteroid receptorproteinPR:melaniev@ebi.ac.uk2023-03-17T15:45:52ZBRI1protein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T09:30:41Zbound tochemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:46:03ZbrassinolideproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:46:33ZLRR domainproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T15:45:52ZBRI1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:46:36ZLRR domainselife-15075-fig6.jpgfig6FIGfig_caption32056DOI:
http://dx.doi.org/10.7554/eLife.15075.013DISCUSSparagraph32103Comparison of our HAESA – IDA – SERK1 structure with the brassinosteroid receptor signaling complex, where SERK1 also acts as co-receptor, reveals an overall conserved mode of SERK1 binding, while the ligand binding pockets map to very different areas in the corresponding receptors (LRRs 2 – 14; HAESA; LRRs 21 – 25, BRI1) and may involve an island domain (BRI1) or not (HAESA) (Figure 6A). Several residues in the SERK1 N-terminal capping domain (Thr59SERK1, Phe61SERK1) and the LRR inner surface (Asp75SERK1, Tyr101SERK1, SER121SERK1, Phe145SERK1) contribute to the formation of both complexes (Figures 4C,D, 6B). In addition, residues 53-55SERK1 from the SERK1 N-terminal cap mediate specific interactions with the IDA peptide (Figures 4C, 6B). These residues are not involved in the sensing of the steroid hormone brassinolide. In both cases however, the co-receptor completes the hormone binding pocket. This fact together with the largely overlapping SERK1 binding surfaces in HAESA and BRI1 allows us to speculate that SERK1 may promote high-affinity peptide hormone and brassinosteroid sensing by simply slowing down dissociation of the ligand from its cognate receptor.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:52:04ZComparisoncomplex_assemblyGO:melaniev@ebi.ac.uk2023-03-17T09:45:14ZHAESA – IDA – SERK1evidenceDUMMY:melaniev@ebi.ac.uk2023-03-17T15:52:17ZstructureproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:52:55Zco-receptorprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T15:52:32ZconservedproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1siteSO:melaniev@ebi.ac.uk2023-03-17T15:52:39Zligand binding pocketsstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:53:01ZLRRs 2 – 14proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:53:05ZLRRs 21 – 25proteinPR:melaniev@ebi.ac.uk2023-03-17T15:45:52ZBRI1proteinPR:melaniev@ebi.ac.uk2023-03-17T15:45:52ZBRI1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T10:51:15Zcapping domainresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:53:40ZThr59proteinPR:melaniev@ebi.ac.uk2023-03-17T15:53:42ZSERK1residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:53:46ZPhe61proteinPR:melaniev@ebi.ac.uk2023-03-17T15:53:49ZSERK1siteSO:melaniev@ebi.ac.uk2023-03-17T15:53:58ZLRR inner surfaceresidue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:54:01ZAsp75proteinPR:melaniev@ebi.ac.uk2023-03-17T15:54:03ZSERK1residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:54:06ZTyr101proteinPR:melaniev@ebi.ac.uk2023-03-17T15:54:09ZSERK1residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:54:12ZSER121proteinPR:melaniev@ebi.ac.uk2023-03-17T15:54:15ZSERK1residue_name_numberDUMMY:melaniev@ebi.ac.uk2023-03-17T15:54:18ZPhe145proteinPR:melaniev@ebi.ac.uk2023-03-17T15:54:21ZSERK1residue_rangeDUMMY:melaniev@ebi.ac.uk2023-03-17T15:54:27Z53-55proteinPR:melaniev@ebi.ac.uk2023-03-17T15:54:31ZSERK1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:54:42ZcapchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:09:00ZIDA peptidechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:55:13Zsteroid hormonechemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:55:15ZbrassinolidesiteSO:melaniev@ebi.ac.uk2023-03-17T09:30:04Zhormone binding pocketsiteSO:melaniev@ebi.ac.uk2023-03-17T15:55:24ZSERK1 binding surfacesproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAproteinPR:melaniev@ebi.ac.uk2023-03-17T15:45:52ZBRI1proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T08:29:25Zpeptide hormoneelife-15075-fig7.jpgfig7FIGfig_title_caption33296Different plant peptide hormone families contain a C-terminal (Arg)-His-Asn motif, which in IDA represents the co-receptor recognition site.taxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:56:16Zpeptide hormone familiesstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T15:56:20Z(Arg)-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:47ZIDAsiteSO:melaniev@ebi.ac.uk2023-03-17T15:56:23Zco-receptor recognition siteelife-15075-fig7.jpgfig7FIGfig_caption33437Structure-guided multiple sequence alignment of IDA and IDA-like peptides with other plant peptide hormone families, including CLAVATA3 – EMBRYO SURROUNDING REGION-RELATED (CLV3/CLE), ROOT GROWTH FACTOR – GOLVEN (RGF/GLV), PRECURSOR GENE PROPEP1 (PEP1) from Arabidopsis thaliana. The conserved (Arg)-His-Asn motif is highlighted in red, the central Hyp residue in IDLs and CLEs is marked in blue.experimental_methodMESH:melaniev@ebi.ac.uk2023-03-17T15:57:40ZStructure-guided multiple sequence alignmentproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:47ZIDAchemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T15:58:54ZIDA-like peptidestaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:07Zpeptide hormone familiesprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:18ZCLAVATA3 – EMBRYO SURROUNDING REGION-RELATEDprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:28ZCLV3/CLEprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:39ZROOT GROWTH FACTOR – GOLVENprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:49ZRGF/GLVprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T15:59:59ZPRECURSOR GENE PROPEP1protein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:00:10ZPEP1speciesMESH:melaniev@ebi.ac.uk2023-03-17T08:47:13ZArabidopsis thalianaprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:00:15Zconservedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:00:17Z(Arg)-His-Asn motifresidue_nameSO:melaniev@ebi.ac.uk2023-03-17T16:00:30ZHypprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T09:23:05ZIDLsprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:00:44ZCLEselife-15075-fig7.jpgfig7FIGfig_caption33838DOI:
http://dx.doi.org/10.7554/eLife.15075.014DISCUSSparagraph33885Our experiments reveal that SERK1 recognizes a C-terminal Arg-His-Asn motif in IDA. Importantly, this motif can also be found in other peptide hormone families (Figure 7). Among these are the CLE peptides regulating stem cell maintenance in the shoot and the root. It is interesting to note, that CLEs in their mature form are also hydroxyprolinated dodecamers, which bind to a surface area in the BARELY ANY MERISTEM 1 receptor that would correspond to part of the IDA binding cleft in HAESA. Diverse plant peptide hormones may thus also bind their LRR-RK receptors in an extended conformation along the inner surface of the LRR domain and may also use small, shape-complementary co-receptors for high-affinity ligand binding and receptor activation.proteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:31ZSERK1structure_elementSO:melaniev@ebi.ac.uk2023-03-17T09:01:51ZArg-His-Asn motifproteinPR:melaniev@ebi.ac.uk2023-03-17T08:32:47ZIDAstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:03:02Zthis motifprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:03:13Zpeptide hormone familieschemicalCHEBI:melaniev@ebi.ac.uk2023-03-17T16:03:28ZCLE peptidesprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:03:38ZCLEsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:03:41Zmature formprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:04:05Zhydroxyprolinatedstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:16:25ZdodecamerssiteSO:melaniev@ebi.ac.uk2023-03-17T16:04:41Zsurface areaprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:04:44ZBARELY ANY MERISTEM 1 receptorsiteSO:melaniev@ebi.ac.uk2023-03-17T16:04:48ZIDA binding cleftproteinPR:melaniev@ebi.ac.uk2023-03-17T08:33:12ZHAESAtaxonomy_domainDUMMY:melaniev@ebi.ac.uk2023-03-17T08:34:02Zplantprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:05:02Zpeptide hormonesprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:05:07ZLRR-RK receptorsprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:05:10Zextended conformationstructure_elementSO:melaniev@ebi.ac.uk2023-03-17T16:28:14ZLRR domainprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:49Zsmallprotein_stateDUMMY:melaniev@ebi.ac.uk2023-03-17T16:28:53Zshape-complementaryprotein_typeMESH:melaniev@ebi.ac.uk2023-03-17T16:05:29Zco-receptorsMETHODStitle_134637Materials and methodsMETHODStitle_234659Protein expression and purificationMETHODSparagraph34695Synthetic genes coding for the Arabidopsis thaliana HAESA (residues 20–620) and SERK1 ectodomains (residues 24–213, carrying Asn115→Asp and Asn163→Gln mutations), codon optimized for expression in Trichoplusia ni (Geneart, Germany), were cloned into a modified pBAC-6 transfer vector (Novagen, Billerica, MA), providing an azurocidin signal peptide and a C-terminal TEV (tobacco etch virus protease) cleavable Strep-9xHis tandem affinity tag. Recombinant baculoviruses were generated by co-transfecting transfer vectors with linearised baculovirus DNA (ProFold-ER1, AB vector, San Diego, CA) followed by viral amplification in Spodoptera frugiperda Sf9 cells. The HAESA and SERK1 ectodomains were individually expressed in Trichoplusia ni Tnao38 cells using a multiplicity of infection of 3, and harvested from the medium 2 days post infection by tangential flow filtration using 30 kDa MWCO and 10 kDa MWCO (molecular weight cut-off) filter membranes (GE Healthcare Life Sciences, Pittsburgh, PA), respectively. Proteins were purified separately by sequential Ni2+ (HisTrap HP, GE Healthcare) and Strep (Strep-Tactin Superflow high-capacity, IBA, Germany) affinity chromatography. Next, affinity tags were removed by incubating the purified proteins with recombinant Strep-tagged TEV protease in 1:100 molar ratio. The cleaved tag and the protease were separated from HAESA and SERK1 by a second Strep affinity step. The purified HAESA ectodomain was incubated with a synthetic IDA peptide (YVPIPPSA-Hyp-SKRHN, the N-terminal Tyr residue was added to allow for peptide quantification by UV absorbance) and the SERK1 ectodomain in 1:1:1.5 molar ratio. The HAESA-IDA-SERK1 complex was purified by size exclusion chromatography on a Superdex 200 HR10/30 column (GE Healthcare) equilibrated in 20 mM citric acid pH 5.0, 100 mM NaCl). Peak fractions containing the complex were concentrated to ~10 mg/mL and immediately used for crystallization. About 0.2 mg of purified HAESA and 0.1 mg of purified SERK1 protein were obtained from 1 L of insect cell culture, respectively.METHODStitle_236785Crystallization and data collectionMETHODSparagraph36821Hexagonal crystals of the isolated HAESA ectodomain developed at room-temperature in hanging drops composed of 1.0 μL of protein solution (5.5 mg/mL) and 1.0 μL of crystallization buffer (21% PEG 3,350, 0.2 M MgCl2 · 6 H2O, 0.1 M citric acid pH 4.0), suspended above 1.0 mL of crystallization buffer. For structure solution crystals were derivatized and cryo-protected by serial transfer into crystallization buffer supplemented with 0.5 M NaI and 15% ethylene glycol and cryo-cooled in liquid nitrogen. Redundant single-wavelength anomalous diffraction (SAD) data to 2.39 Å resolution were collected at beam-line PXII at the Swiss Light Source (SLS), Villigen, CH with λ=1.7 Å. A native data set to 1.74 Å resolution was collected on a crystal from the same drop cryo-protected by serial transfer into crystallization buffer supplemented with 15% (v/v) ethylene glycol only (λ=1.0 Å; Table 1).METHODSparagraph37745HAESA complexes with IDA (PIPPSA-Hyp-SKRHN), PKGV-IDA (YPKGVPIPPSA-Hyp-SKRHN) and IDL1 (LVPPSG-Hyp-SMRHN) peptide hormones were obtained by soaking apo crystals in crystallization buffer containing the respective synthetic peptide at a final concentration of 15 mM. Soaked crystals diffracted to 1.86 Å (HAESA – IDA), 1.94 Å (HAESA-PKGV-IDA) and 2.56 Å resolution (HAESA – IDL1), respectively (Table 2). Orthorhombic crystals of the HAESA-IDA-SERK1 complex developed in 18% PEG 8000, MgCl2 · 6 H2O, 0.1 M citric acid and diffracted to 2.43 Å resolution (Table 2). Data processing and scaling was done in XDS (version: Nov 2014).METHODStitle_238395Structure solution and refinementMETHODSparagraph38429The SAD method was used to determine the structure of the isolated HAESA ectodomain. SHELXD located 32 iodine sites (CC All/Weak 37.7/14.9). 20 consistent sites were input into the program SHARP for phasing and identification of 8 additional sites at 2.39 Å resolution. Refined heavy atom sites and phases were provided to PHENIX.AUTOBUILD for density modification and automated model building. The structure was completed in alternating cycles of model building in COOT and restrained TLS refinement in REFMAC5 (version 5.8.0107) against an isomorphous high resolution native data set. Crystals contain one HAESA monomer per asymmetric unit with a solvent content of ~55%, the final model comprises residues 20 – 615. The refined structure has excellent stereochemistry, with 93.8% of all residues in the favored region of the Ramachandran plot, no outliers and a PHENIX.MOLPROBITY score of 1.34 (Table 1).METHODSparagraph39342The HAESA – IDA – SERK1 complex structure was determined by molecular replacement with the program PHASER, using the isolated HAESA and SERK1 (PDB-ID: 4LSC) LRR domain structures as search models. The solution comprises one HASEA-IDA-SERK1 complex in the asymmetric unit. The structure was completed in iterative cycles of manual model-building in COOT and restrained TLS refinement in REFMAC5. Amino acids whose side-chain position could not be modeled with confidence were truncated to alanine (0.6 – 1% of total residues), the stereochemistry of N-linked glycan structures was assessed with the CCP4 program PRIVATEER-VALIDATE. The refined model has 94.44% of all residues in the favored region of the Ramachandran plot, no outliers and a PHENIX.MOLPROBITY score of 1.17 (Table 2). Structural visualization was done with POVScript+ and POV-Ray (http://www.povray.org).METHODStitle_240220Size-exclusion chromatographyMETHODSparagraph40250Gel filtration experiments were performed using a Superdex 200 HR 10/30 column (GE Healthcare) pre-equilibrated in 20 mM citric acid (pH 5) and 100 mM NaCl. 100 μL of the isolated HAESA ectodomain (5.5 mg/mL), of the purified SERK1 LRR domain (3 mg/mL) or of mixtures of HAESA and SERK1 (either in the presence or absence of synthetic wild-type IDA, wild-type IDL1 or mutant IDA peptides at a concentration of 25 μM; 10 mg/mL; samples contained HAESA and SERK1 in 1:1 molar ratio) were loaded sequentially onto the column and elution at 0.5 mL/min was monitored by ultraviolet absorbance at 280 nm.METHODStitle_240861Isothermal titration calorimetryMETHODSparagraph40894ITC experiments were performed using a Nano ITC (TA Instruments, New Castle, DE) with a 1.0 mL standard cell and a 250 μL titration syringe. Proteins were dialyzed extensively against ITC buffer (20 mM citric acid pH 5.0, 100 mM NaCl) and synthetic wild-type or point-mutant peptides (with wild-type IDA sequence YVPIPPSA-Hyp-SKRHN, PKGV-IDA YPKGVPIPPSA-Hyp-SKRHN, IDA-SFVN YPIPPSA-Hyp-SKRHNSFVN, IDL1 YLVPPSG-Hyp-SMRHN and CLV3 sequence YRTV-Hyp-SG-Hyp-DPLHH) were dissolved in ITC buffer prior to all titrations. Molar protein concentrations for SERK1 and HAESA were calculated using their molar extinction coefficient and a molecular weight of 27,551 and 74,896 Da, respectively (determined by MALDI-TOF mass spectrometry). Experiments were performed at 25°C. A typical experiment consisted of injecting 10 μL aliquots of peptide solution (250 μM) into 20 μM HAESA. The concentrations for the complex titrations were 150 μM of ligand (either wild-type or point-mutant IDA peptides) in the syringe and 10 μM of a 1:1 HAESA – SERK1 protein mixture in the cell at time intervals of 150 s to ensure that the titration peak returned to the baseline. Binding of SERK1 to HAESA was assessed by titrating SERK1 (100 μM) into a solution containing HAESA (10 μM) in the pre- or absence of 150 μM wild-type IDA peptide. ITC data were corrected for the heat of dilution by subtracting the mixing enthalpies for titrant solution injections into protein free ITC buffer. Data were analyzed using the NanoAnalyze program (version 2.3.6) as provided by the manufacturer.METHODStitle_242490In vitro kinase trans-phosphorylation assayMETHODSparagraph42534Coding sequences of SERK1 kinase domain (SERK1-KD) (residues 264–625) and HAESA-KD (residues 671–969) were cloned into a modified pET (Novagen) vector providing an TEV-cleavable N-terminal 8xHis-StrepII-Thioredoxin tag. Point mutations were introduced into the SERK1 (Asp447→Asn; mSERK1) and HAESA (Asp837→Asn; mHAESA) coding sequences by site directed mutagenesis, thereby rendering the kinases inactive. The plasmids were transformed into E.coli Rosetta 2 (DE3) (Novagen). Protein expression was induced by adding IPTG to final concentration of 0.5 mM to cell cultures grown to an OD600 = 0.6. Cells were then incubated at 16°C for 18 hr, pelleted by centrifugation at 5000 x g and 4°C for 15 min, and resuspended in buffer A (20 mM Tris-HCl pH 8, 500 mM NaCl, 4 mM MgCl2 and 2 mM β-Mercaptoethanol) supplemented with 15 mM Imidazole and 0.1% (v/v) Igepal. After cell lysis by sonication, cell debris was removed by centrifugation at 35,000 x g and 4°C for 30 min. The recombinant proteins were isolated by Co2+ metal affinity purification using a combination of batch and gravity flow approaches (HIS-Select Cobalt Affinity Gel, Sigma, St. Louis, MO). After washing the resin with the wash buffer (buffer A + 15 mM Imidazole) proteins were eluted in buffer A supplemented with 250 mM Imidazole. All elutions were then dialyzed against 20 mM Tris-HCl pH 8, 250 mM NaCl, 4 mM MgCl2 and 0.5 mM TCEP. For SERK1-KD and mSERK1-KD the 8xHis-StrepII-Thioredoxin tag was removed with 6xHis tagged TEV protease. TEV and the cleaved tag were removed by a second metal affinity purification step. Subsequently, all proteins were purified by gel filtration on a Superdex 200 10/300 GL column equilibrated in 20 mM Tris pH 8, 250 mM NaCl, 4 mM MgCl2 and 0.5 mM TCEP. Peak fractions were collected and concentrated using Amicon Ultra centrifugation devices (10,000 MWCO). For in vitro kinase assays, 1 μg of HAESA-KD, 0.25 μg of SERK1-KD and 2 μg of mSERK1 and mHAESA were used in a final reaction volume of 20 μl. The reaction buffer consisted of 20 mM Tris pH 8, 250 mM NaCl, 4 mM MgCl2 and 0.5 mM TCEP. The reactions were started by the addition of 4 μCi [γ-32P]-ATP (Perkin-Elmer, Waltham, MA), incubated at room temperature for 45 min and stopped by the addition of 6x SDS-loading dye immediately followed by incubating the samples at 95°C. Proteins of the whole reaction were subsequently separated via SDS-PAGE in 4–15% gradient gels (TGX, Biorad, Hercules, CA) and stained with Instant Blue (Expedeon, San Diego, CA). After pictures were taken of the stained gel, 32P-derived signals were visualized by exposing the gel to an X-ray film (Fuji, SuperRX, Valhalla, NY).METHODStitle_245274Plant material and generation of transgenic linesMETHODSparagraph4532435S::IDA wild-type and 35S::IDA (R66 → Ala/K67 → Ala) over-expressing transgenic lines in Col-0 background were generated as follows: The constructs were introduced in the destination vector pB7m34GW2 and transferred to A. tumefaciens strain pGV2260. Plants were transformed using the floral dip method. Transformants were selected in medium supplemented with BASTA up to the T3 generation. For phenotyping, plants were grown at 21°C with 50% humidity and a 16h light: 8 hr dark cycle.METHODStitle_245816RNA analysesMETHODSparagraph45829Plants were grown on ½ Murashige and Skoog (MS) plates supplemented with 1% sucrose. After 7 d, ∼30 to 40 seedlings were collected and frozen in liquid nitrogen. Total RNA was extracted using a RNeasy plant mini kit (Qiagen, Valencia, CA), and 1 μg of the RNA solution obtained was reverse-transcribed using the SuperScritpVILO cDNA synthesis kit (Invitrogen, Grand Island, NY). RT-qPCR amplifications and measurements were performed using a 7900HT Fast Real Time PCR-System by Applied Biosystems (Carlsbad, CA). RT-qPCR amplifications were monitored using SYBR-Green fluorescent stain (Applied Biosystems). Relative quantification of gene expression data was performed using the 2−ΔΔCT (or comparative CT) method. Expression levels were normalized using the CT values obtained for the actin2 gene (forward: TGCCAATCTACGAGGGTTTC; reverse: TTCTCGATGGAAGAGCTGGT). For detection and amplification of IDA sequence we used specific primers (forward: TCGTACGATGATGGTTCTGC; reverse: GAATGGGAACGCCTTTAGGT). The presence of a single PCR product was further verified by dissociation analysis in all amplifications. All quantifications were made in quadruplicates on RNA samples obtained from three independent experiments.METHODStitle_247053Petal break measurementsMETHODSparagraph47078serk1-1, serk2-2, serk3-1, serk4-1 and serk5-1 and Col-0 wild-type plants were grown in growth chambers at 22°C under long days (16 hr day/8 hr dark) at a light intensity of 100 µE·m-2·sec-1. Petal break-strength was quantified as the force in gram equivalents required for removal of a petal from a flower when the plants had a minimum of twenty flowers and siliques. Measurements were performed using a load transducer as described in. Break-strength was measured for 15 plants and a minimum of 15 measurements at each position.ACK_FUNDtitle_147617Funding InformationACK_FUNDparagraph47637This paper was supported by the following grants:ACK_FUNDparagraph47687 to Michael Hothorn.ACK_FUNDparagraph47709 to Michael Hothorn.ACK_FUNDparagraph47731 to Michael Hothorn.ACK_FUNDparagraph47753 to Melinka A Butenko.ACK_FUNDparagraph47777 to Benjamin Brandt.ACK_FUNDparagraph47799 to Julia Santiago.ACK_FUNDtitle_147820Additional informationCOMP_INTtitle_147843Competing interestsCOMP_INTfootnote47863The authors declare that no competing interests exist.AUTH_CONTtitle_147918Author contributionsAUTH_CONTfootnote47939JS, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.AUTH_CONTfootnote48058BB, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.AUTH_CONTfootnote48154MW, Acquisition of data, Analysis and interpretation of data.AUTH_CONTfootnote48216UH, Acquisition of data, Analysis and interpretation of data.AUTH_CONTfootnote48278LAH, Analysis and interpretation of data, Drafting or revising the article.AUTH_CONTfootnote48354MAB, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.AUTH_CONTfootnote48474MH, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article.REFtitle48593References52535261surname:Aalen;given-names:RBsurname:Wildhagen;given-names:Msurname:Stø;given-names:IMsurname:Butenko;given-names:MA10.1093/jxb/ert33824151306REFJournal of Experimental Botanyref64201348604Ida: A peptide ligand regulating cell separation processes in Arabidopsis33373349surname:Albrecht;given-names:Csurname:Russinova;given-names:Esurname:Hecht;given-names:Vsurname:Baaijens;given-names:Esurname:de Vries;given-names:S10.1105/tpc.105.03681416284305REFThe Plant Cellref17200548678The Arabidopsis thaliana SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASES1 and 2 control male sporogenesis611619surname:Albrecht;given-names:Csurname:Russinova;given-names:Esurname:Kemmerling;given-names:Bsurname:Kwaaitaal;given-names:Msurname:de Vries;given-names:SC10.1104/pp.108.12321618667726REFPlant Physiologyref148200848780Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE proteins serve brassinosteroid-dependent and -independent signaling pathways3143surname:Bojar;given-names:Dsurname:Martinez;given-names:Jsurname:Santiago;given-names:Jsurname:Rybin;given-names:Vsurname:Bayliss;given-names:Rsurname:Hothorn;given-names:M10.1111/tpj.1244524461462REFThe Plant Journalref78201448907Crystal structures of the phosphorylated BRI1 kinase domain and implications for brassinosteroid signal initiationR225R226surname:Brandt;given-names:Bsurname:Hothorn;given-names:M10.1016/j.cub.2015.12.01427003880REFCurrent Biologyref26201649022SERK co-receptor kinases20232030surname:Bricogne;given-names:Gsurname:Vonrhein;given-names:Csurname:Flensburg;given-names:Csurname:Schiltz;given-names:Msurname:Paciorek;given-names:W10.1107/S090744490301769414573958REFActa Crystallographica. Section D, Biological Crystallographyref59200349047Generation, representation and flow of phase information in structure determination: Recent developments in and around SHARP 2.022962307surname:Butenko;given-names:MAsurname:Patterson;given-names:SEsurname:Grini;given-names:PEsurname:Stenvik;given-names:GEsurname:Amundsen;given-names:SSsurname:Mandal;given-names:Asurname:Aalen;given-names:RB10.1105/tpc.01436512972671REFThe Plant Cellref15200349176Inflorescence deficient in abscission controls floral organ abscission in Arabidopsis and identifies a novel family of putative ligands in plants255263surname:Butenko;given-names:MAsurname:Vie;given-names:AKsurname:Brembu;given-names:Tsurname:Aalen;given-names:RBsurname:Bones;given-names:AM10.1016/j.tplants.2009.02.00219362511REFTrends in Plant Scienceref14200949322Plant peptides in signalling: Looking for new partners18381847surname:Butenko;given-names:MAsurname:Wildhagen;given-names:Msurname:Albert;given-names:Msurname:Jehle;given-names:Asurname:Kalbacher;given-names:Hsurname:Aalen;given-names:RBsurname:Felix;given-names:G10.1105/tpc.113.12007124808051REFThe Plant Cellref26201449377Tools and strategies to match peptide-ligand receptor pairs1562915634surname:Cho;given-names:SKsurname:Larue;given-names:CTsurname:Chevalier;given-names:Dsurname:Wang;given-names:Hsurname:Jinn;given-names:TLsurname:Zhang;given-names:Ssurname:Walker;given-names:JC10.1073/pnas.080553910518809915REFProceedings of the National Academy of Sciences of the United States of Americaref105200849437Regulation of floral organ abscission in Arabidopsis thaliana20572067surname:Clark;given-names:SEsurname:Running;given-names:MPsurname:Meyerowitz;given-names:EMREFDevelopmentref121199549499CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1735743surname:Clough;given-names:SJsurname:Bent;given-names:AF10.1046/j.1365-313x.1998.00343.x10069079REFThe Plant Journalref16199849614Floral dip: A simplified method for agrobacterium-mediated transformation of Arabidopsis thaliana33503361surname:Colcombet;given-names:Jsurname:Boisson-Dernier;given-names:Asurname:Ros-Palau;given-names:Rsurname:Vera;given-names:CEsurname:Schroeder;given-names:JI10.1105/tpc.105.03673116284306REFThe Plant Cellref17200549712Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASES1 and 2 are essential for tapetum development and microspore maturationW375W383surname:Davis;given-names:IWsurname:Leaver-Fay;given-names:Asurname:Richardson;given-names:DCsurname:Chen;given-names:VBsurname:Block;given-names:JNsurname:Kapral;given-names:GJsurname:Wang;given-names:Xsurname:Murray;given-names:LWsurname:Arendall;given-names:WBsurname:Snoeyink;given-names:Jsurname:Richardson;given-names:JS10.1093/nar/gkm21617452350REFNucleic Acids Researchref35200749834Molprobity: All-atom contacts and structure validation for proteins and nucleic acids21262132surname:Emsley;given-names:Psurname:Cowtan;given-names:K10.1107/S090744490401915815572765REFActa Crystallographica Section D Biological Crystallographyref60200449920Coot : Model-building tools for molecular graphics944947surname:Fenn;given-names:TDsurname:Ringe;given-names:Dsurname:Petsko;given-names:GA10.1107/S0021889803006721REFJournal of Applied Crystallographyref36200349971Povscript+ : A program for model and data visualization using persistence of vision ray-tracinge15075surname:Gou;given-names:Xsurname:Yin;given-names:Hsurname:He;given-names:Ksurname:Du;given-names:Jsurname:Yi;given-names:Jsurname:Xu;given-names:Ssurname:Lin;given-names:Hsurname:Clouse;given-names:SDsurname:Li;given-names:J10.1371/journal.pgen.1002452REFPLoS Geneticsref8201250067Genetic evidence for an indispensable role of somatic embryogenesis receptor kinases in brassinosteroid signalinge15075surname:Hashimoto;given-names:Ysurname:Zhang;given-names:Ssurname:Blissard;given-names:GW10.1186/1472-6750-10-50REFBMC Biotechnologyref10201050181Ao38, a new cell line from eggs of the black witch moth, Ascalapha odorata (Lepidoptera: Noctuidae), is permissive for AcMNPV infection and produces high levels of recombinant proteins793800surname:Hasler;given-names:Msurname:Hothorn;given-names:LA10.1002/bimj.20071046618932141REFBiometrical Journalref50200850366Multiple contrast tests in the presence of heteroscedasticity803816surname:Hecht;given-names:Vsurname:Vielle-Calzada;given-names:JPsurname:Hartog;given-names:MVsurname:Schmidt;given-names:EDsurname:Boutilier;given-names:Ksurname:Grossniklaus;given-names:Usurname:de Vries;given-names:SC10.1104/pp.01032411706164REFPlant Physiologyref127200150428The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE 1 gene is expressed in developing ovules and embryos and enhances embryogenic competence in culture346363surname:Hothorn;given-names:Tsurname:Bretz;given-names:Fsurname:Westfall;given-names:P10.1002/bimj.20081042518481363REFBiometrical Journalref50200850582Simultaneous inference in general parametric models467471surname:Hothorn;given-names:Msurname:Belkhadir;given-names:Ysurname:Dreux;given-names:Msurname:Dabi;given-names:Tsurname:Noel;given-names:JPsurname:Wilson;given-names:IAsurname:Chory;given-names:J10.1038/nature1015321666665REFNatureref474201150634Structural basis of steroid hormone perception by the receptor kinase BRI1108117surname:Jinn;given-names:TLsurname:Stone;given-names:JMsurname:Walker;given-names:JC10.1101/gad.14.1.10810640280REFGenes & Developmentref14200050709HAESA, an Arabidopsis leucine-rich repeat receptor kinase, controls floral organ abscission25772637surname:Kabsch;given-names:Wsurname:Sander;given-names:C10.1002/bip.3602212116667333REFBiopolymersref22198350801Dictionary of protein secondary structure: Pattern recognition of hydrogen-bonded and geometrical features795800surname:Kabsch;given-names:W10.1107/S0021889893005588REFJournal of Applied Crystallographyref26199350908Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants845848surname:Kondo;given-names:Tsurname:Sawa;given-names:Ssurname:Kinoshita;given-names:Asurname:Mizuno;given-names:Ssurname:Kakimoto;given-names:Tsurname:Fukuda;given-names:Hsurname:Sakagami;given-names:Y10.1126/science.112843916902141REFScienceref313200651021A plant peptide encoded by CLV3 identified by in situ MALDI-TOF MS analysis2surname:Lease;given-names:KAsurname:Cho;given-names:SKsurname:Walker;given-names:JC10.1186/1746-4811-2-216483376REFPlant Methodsref2200651097A petal breakstrength meter for Arabidopsis abscission studies817828surname:Lewis;given-names:MWsurname:Leslie;given-names:MEsurname:Fulcher;given-names:EHsurname:Darnielle;given-names:Lsurname:Healy;given-names:PNsurname:Youn;given-names:JYsurname:Liljegren;given-names:SJ10.1111/j.1365-313X.2010.04194.x20230490REFThe Plant Journalref62201051160The SERK1 receptor-like kinase regulates organ separation in Arabidopsis flowers402408surname:Livak;given-names:KJsurname:Schmittgen;given-names:TD10.1006/meth.2001.126211846609REFMethodsref25200151241Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method10651067surname:Matsuzaki;given-names:Ysurname:Ogawa-Ohnishi;given-names:Msurname:Mori;given-names:Asurname:Matsubayashi;given-names:Y10.1126/science.119113220798316REFScienceref329201051352Secreted peptide signals required for maintenance of root stem cell niche in Arabidopsis658674surname:McCoy;given-names:AJsurname:Grosse-Kunstleve;given-names:RWsurname:Adams;given-names:PDsurname:Winn;given-names:MDsurname:Storoni;given-names:LCsurname:Read;given-names:RJ10.1107/S002188980702120619461840REFJournal of Applied Crystallographyref40200751441Phaser crystallographic software23612372surname:Meng;given-names:Xsurname:Chen;given-names:Xsurname:Mang;given-names:Hsurname:Liu;given-names:Csurname:Yu;given-names:Xsurname:Gao;given-names:Xsurname:Torii;given-names:KUsurname:He;given-names:Psurname:Shan;given-names:L10.1016/j.cub.2015.07.06826320950REFCurrent Biologyref25201551474Differential function of Arabidopsis SERK family receptor-like kinases in stomatal patterning13301338surname:Meng;given-names:Xsurname:Zhou;given-names:Jsurname:Tang;given-names:Jsurname:Li;given-names:Bsurname:de Oliveira;given-names:MVVsurname:Chai;given-names:Jsurname:He;given-names:Psurname:Shan;given-names:L10.1016/j.celrep.2016.01.02326854226REFCell Reportsref14201651568Ligand-induced receptor-like kinase complex regulates floral organ abscission in Arabidopsis240255surname:Murshudov;given-names:GNsurname:Vagin;given-names:AAsurname:Dodson;given-names:EJ10.1107/S090744499601225515299926REFActa Crystallographica Section D Biological Crystallographyref53199751661Refinement of macromolecular structures by the maximum-likelihood method44134419surname:Muto;given-names:Tsurname:Todoroki;given-names:Y10.1016/j.bmc.2013.04.04823673217REFBioorganic & Medicinal Chemistryref21201351734Brassinolide-2,3-acetonide: A brassinolide-induced rice lamina joint inclination antagonist12511263surname:Niederhuth;given-names:CEsurname:Cho;given-names:SKsurname:Seitz;given-names:Ksurname:Walker;given-names:JC10.1111/jipb.1211624138310REFJournal of Integrative Plant Biologyref55201351826Letting go is never easy: Abscission and receptor-like protein kinasese15075surname:Niederhuth;given-names:CEsurname:Patharkar;given-names:ORsurname:Walker;given-names:JC10.1186/1471-2164-14-37REFBMC Genomicsref14201351897Transcriptional profiling of the Arabidopsis abscission mutant hae hsl2 by RNA-Seq294surname:Ogawa;given-names:Msurname:Shinohara;given-names:Hsurname:Sakagami;given-names:Ysurname:Matsubayashi;given-names:Y10.1126/science.115008318202283REFScienceref319200851980Arabidopsis CLV3 peptide directly binds CLV1 ectodomain578580surname:Ohyama;given-names:Ksurname:Shinohara;given-names:Hsurname:Ogawa-Ohnishi;given-names:Msurname:Matsubayashi;given-names:Y10.1038/nchembio.18219525968REFNature Chemical Biologyref5200952036A glycopeptide regulating stem cell fate in Arabidopsis thalianaREFR Foundation for Statistical Computingref201452101709714surname:Salaj;given-names:Jsurname:von Recklinghausen;given-names:IRsurname:Hecht;given-names:Vsurname:de Vries;given-names:SCsurname:Schel;given-names:JHsurname:van Lammeren;given-names:AA10.1016/j.plaphy.2008.04.01118515128REFPlant Physiology and Biochemistryref46200852102AtSERK1 expression precedes and coincides with early somatic embryogenesis in Arabidopsis thaliana305320surname:Sanner;given-names:MFsurname:Olson;given-names:AJsurname:Spehner;given-names:JC10.1002/(SICI)1097-0282(199603)38:3&lt;305::AID-BIP4&gt;3.0.CO;2-Y8906967REFBiopolymersref38199652201Reduced surface: An efficient way to compute molecular surfaces889892surname:Santiago;given-names:Jsurname:Henzler;given-names:Csurname:Hothorn;given-names:M10.1126/science.124246823929946REFScienceref341201352265Molecular mechanism for plant steroid receptor activation by somatic embryogenesis co-receptor kinases4126341269surname:Shah;given-names:Ksurname:Vervoort;given-names:Jsurname:de Vries;given-names:SC10.1074/jbc.M10238120011509554REFThe Journal of Biological Chemistryref276200152368Role of threonines in the Arabidopsis thaliana somatic embryogenesis receptor kinase 1 activation loop in phosphorylation112122surname:Sheldrick;given-names:GM10.1107/S010876730704393018156677REFActa Crystallographica Section A Foundations of Crystallographyref64200852490A short history of SHELX845854surname:Shinohara;given-names:Hsurname:Moriyama;given-names:Ysurname:Ohyama;given-names:Ksurname:Matsubayashi;given-names:Y10.1111/j.1365-313X.2012.04934.x22321211REFThe Plant Journalref70201252515Biochemical mapping of a ligand-binding domain within Arabidopsis BAM1 reveals diversified ligand recognition mechanisms of plant LRR-RKs14671476surname:Stenvik;given-names:GEsurname:Butenko;given-names:MAsurname:Urbanowicz;given-names:BRsurname:Rose;given-names:JKsurname:Aalen;given-names:RB10.1105/tpc.106.04203616679455REFThe Plant Cellref18200652653Overexpression of INFLORESCENCE DEFICIENT IN ABSCISSION activates cell separation in vestigial abscission zones in Arabidopsis18051817surname:Stenvik;given-names:GEsurname:Tandstad;given-names:NMsurname:Guo;given-names:Ysurname:Shi;given-names:CLsurname:Kristiansen;given-names:Wsurname:Holmgren;given-names:Asurname:Clark;given-names:SEsurname:Aalen;given-names:RBsurname:Butenko;given-names:MA10.1105/tpc.108.05913918660431REFThe Plant Cellref20200852780The EPIP peptide of INFLORESCENCE DEFICIENT IN ABSCISSION is sufficient to induce abscission in Arabidopsis through the receptor-like kinases HAESA and HAESA-LIKE213261329surname:Sun;given-names:Ysurname:Han;given-names:Zsurname:Tang;given-names:Jsurname:Hu;given-names:Zsurname:Chai;given-names:Csurname:Zhou;given-names:Bsurname:Chai;given-names:J10.1038/cr.2013.13124126715REFCell Researchref23201352944Structure reveals that BAK1 as a co-receptor recognizes the BRI1-bound brassinolide110120surname:Tang;given-names:Jsurname:Han;given-names:Zsurname:Sun;given-names:Ysurname:Zhang;given-names:Hsurname:Gong;given-names:Xsurname:Chai;given-names:J10.1038/cr.2014.16125475059REFCell Researchref25201553028Structural basis for recognition of an endogenous peptide by the plant receptor kinase PEPR1e15075surname:Taylor;given-names:Isurname:Wang;given-names:Ysurname:Seitz;given-names:Ksurname:Baer;given-names:Jsurname:Bennewitz;given-names:Ssurname:Mooney;given-names:BPsurname:Walker;given-names:JC10.1371/journal.pone.0147203REFPLOS ONEref11201653121Analysis of phosphorylation of the receptor-like protein kinase HAESA during arabidopsis floral abscission6169surname:Terwilliger;given-names:TCsurname:Grosse-Kunstleve;given-names:RWsurname:Afonine;given-names:PVsurname:Moriarty;given-names:NWsurname:Zwart;given-names:PHsurname:Hung;given-names:L-Wsurname:Read;given-names:RJsurname:Adams;given-names:PD10.1107/S090744490705024X18094468REFActa Crystallographica Section D Biological Crystallographyref64200853228Iterative model building, structure refinement and density modification with the PHENIX autobuild wizard265268surname:Wang;given-names:Jsurname:Li;given-names:Hsurname:Han;given-names:Zsurname:Zhang;given-names:Hsurname:Wang;given-names:Tsurname:Lin;given-names:Gsurname:Chang;given-names:Jsurname:Yang;given-names:Wsurname:Chai;given-names:J10.1038/nature1485826308901REFNatureref525201553333Allosteric receptor activation by the plant peptide hormone phytosulfokineREFparagraph5340810.7554/eLife.15075.017REVIEW_INFOtitle53432Decision letterREVIEW_INFOparagraph53448ZhangREVIEW_INFOparagraph53454MingjieREVIEW_INFOparagraph53462In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.REVIEW_INFOparagraph53746Thank you for submitting your article "Mechanistic insight into a peptide hormone signaling complex mediating floral organ abscission" to eLife for consideration by eLife. Your article has been favorably evaluated by John Kuyiyan (Senior editor) and three reviewers, one of whom, (Mingjie Zhang) is a member of our Board of Reviewing Editors.REVIEW_INFOparagraph54089The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. As you will see that the required revisions are essentially clarifications and some additional analysis of existing data in nature.REVIEW_INFOparagraph54372Summary:REVIEW_INFOparagraph54381In this work, Hothorn and colleagues investigated the structural basis governing the recognition of peptide hormone IDA during plant floral abscission process. Through an array of complex structures, supplemented with biochemical and genetic experiments, the authors uncovered the IDA recognition mechanism by a co-receptor (HAESA and SERK1) detection mechanism. The structures also reveal the specific recognition mechanism of the 12-residue IDA core peptide sequence by the co-receptors, and suggest that this 12-residue IDA sequence is likely to be the mature peptide hormone functioning in plants. The comparison of the structures of the HAESA/SERK1/IDA complex and the previously determined BRA1/SERK1/brassinolide complex by the same group also suggests a co-receptor pairing mechanism for various plant hormones. The story gives detailed and novel mechanistic insights in the perception of IDA during floral abscission, and is convincing and worthy to be considered for publication in eLife with the following revisions.REVIEW_INFOparagraph55409Key issues which need to be addressed:REVIEW_INFOparagraph554481) As the results reported here rest largely on the interpretation of the structural data, the following points need to be addressed by the authors. i) Temperature factors (Wilson B and residual) are unusually high for the reported resolution. Are there portions of the structure that exhibit more disorder or are these high temperature factors throughout the structure? Are there potential problems with radiation damage due to the high multiplicity? ii) A simulated annealing omit map figure should be provided as the peptides all exhibit very high temperature factors. iii) How many side chains were trimmed due to poor electron density? If this is a significant percentage, it should be noted.REVIEW_INFOparagraph561462) A further discussion comparing the mechanisms of BRI1-BL-SERK1 and HAESA-IDA-SERK1 would be helpful as a structural comparison is presented. As BR1 binds its ligand with high affinity, the low affinity of HAESA for IDA could be further discussed.REVIEW_INFOparagraph563963) Are the results here applicable to the related receptor HSL2? Are the residues that interact with SERK1 and IDA conserved in HSL2?REVIEW_INFOparagraph565304) The authors show that N-terminal extension of the peptide does not impact on binding efficiency, but what would happen if the peptide was extended at the C-terminal end, at the suggested cleavage site? Would cleavage be required for recognition? A brief discussion on this point may help.REVIEW_INFOparagraph568225) Figure 3C: Could the authors comment on the difference between the blue (SERK1 vs. HAESA-IDA) and the black (IDA vs. HAESA-SERK1) line? SERK1 vs. HAESA-IDA gives a Kd of 75 nM, yet IDA vs. SERK1-HAESA gives a Kd of 350 nM. In the text the authors keep referring to the 75 nM Kd, but not the 350 nM Kd. Is it really fair to say the Kd is 75 nM?REVIEW_INFOparagraph571696) In the Discussion, can the authors comment further on the discrepancy between their study and the study of Lewis et al. (Plant J, 2010) concerning the role of SERK1 in floral abscission? Similarly, could the authors comment on the fact that the LRR-RLP EVD/SOBIR seems to be a negative regulator of the HAESA/HSL2 pathway (Leslie et al., Development, 2010), which seems puzzling given that EVD/SOBIR function is normally restricted to LRR-RLPs (Gust & Felix, Curr Op Plant Biol, 2014).REVIEW_INFOparagraph576587) Given that the central hydroxyproline in IDA is of such crucial importance for binding, isn't it surprising that IDAΔ69N does not bind to HAESA at all? Wouldn't it be expected that the remaining part of the peptide still binds to HAESA?REVIEW_INFOparagraph579028) Figure 1—figure supplement 2: How is it possible that charged amino acids are involved in hydrophobic interactions?REVIEW_INFOparagraph580239) Are the distances shown in the graphical representation of the structures proportional? It would seem that some of the aromatic rings could cause steric hindrance.REVIEW_INFOparagraph5819010) Why did the authors decide to express HAESA and SERK1 without signal peptide? Would it make a difference for binding of IDA, if they leave the SP on?REVIEW_INFOparagraph5834411) Figure 7: Are the homologous regions also the active parts of these peptides? And could the authors display amino acids numbers on either side of the fragments?REVIEW_INFOparagraph5850912) Have the authors ever measured dissociation of the peptide from the complex? And in this regard, to what does "highly stable receptor – co-receptor complex" refer/compare to?REVIEW_INFOparagraph5869013) Figures 3A and 5C require statistical analyses.REVIEW_INFOparagraph5874210.7554/eLife.15075.018REVIEW_INFOtitle58766Author responseREVIEW_INFOparagraph58782 1) As the results reported here rest largely on the interpretation of the structural data, the following points need to be addressed by the authors. i) Temperature factors (Wilson B and residual) are unusually high for the reported resolution. REVIEW_INFOparagraph59028We thank the reviewer(s) for pointing out this issue: Indeed our mean B-values deviate substantially from the expected mean B-values (resolution 1.75 – 2.00 A, B(Wilson) ~ 27.0 over 5,510 structures in the PDB; Pavel Afonine, personal communication). We would like to note that due to the many N-glycosylation sites dispersed over the HAESA LRR domain (shown in Figure 1—figure supplement 1D), we find relatively few crystal contacts in our P3121 crystal form, which may rationalize our high B-values. We have reanalyzed our space group assignment (using the CCP4 program ZANUDA) and checked for any signs of problems during data collection (ice rings, multiple crystal lattices, splitting, using the programs XDS and XDSSTAT), as well as for twinning and pseudosymmetry (using phenix.xtriage). No such problems appear to exist, our structures refine very well and our refined B-values are in good agreement with our Wilson B-factors (see Table 2). Thus, the high B-values appear to represent an intrinsic property of our crystals and are not the result of a poor data collection strategy or inappropriate crystallographic analysis.REVIEW_INFOparagraph60165Are there portions of the structure that exhibit more disorder or are these high temperature factors throughout the structure? elife-15075-resp-fig1.jpgfig8FIGfig_title_caption60293Cα trace of the HAESA LRR domain and IDA peptide colored according to B-factor from low (60.9, in blue) to high (134.7, in red).elife-15075-resp-fig1.jpgfig8FIGfig_caption60426Mean B-value is 79.5.elife-15075-resp-fig1.jpgfig8FIGfig_caption60448DOI:
http://dx.doi.org/10.7554/eLife.15075.015REVIEW_INFOparagraph60495Yes. As shown in revised Figure 4B, the Cterminal LRRs of HAESA in contact with SERK1 in our complex structure appear to be somewhat flexible. Author response image 1. illustrates that the B-values are significantly higher in the C-terminal part of the HAESA LRR domain (with the Cterminal capping domain being the most flexible), while both the N-terminal LRRs of HAESA (with exception of the LRR N-terminal capping domain) and the IDA peptide appear better ordered in our P3121 crystals form.REVIEW_INFOparagraph60990Are there potential problems with radiation damage due to the high multiplicity? REVIEW_INFOparagraph61072No. Data were collected at SLS beamline PXIII equipped with a Dectris Pilatus 2M-F detector. We perform all our data collections at very low dose and high multiplicity of measurement, which at this beam-line produces similar results compared to exposing the crystal at higher dose for a smaller angular range. We collected 360 deg with 0.1 deg slices and obtained a Wilson B-value of 80, with no sign of radiation damage in our data processing (subroutine COLSPOT in XDS over all frames). To test the reviewer's hypothesis we cut the data after 90 deg (when completeness approaches 100%) and we obtained a Wilson B-value of 78 and a refined mean B-value of around 75. These value do not significantly differ from our presented 360 deg data set and thus it is unlikely that radiation damage produces these high B-values. Again, they rather appear to be an intrinsic property of our crystals.REVIEW_INFOparagraph61963ii) A simulated annealing omit map figure should be provided as the peptides all exhibit very high temperature factors.REVIEW_INFOparagraph62083Thank you for this suggestion. In our first submission, we presented 2Fo-Fc omit electron density maps for our HAESA-IDA/IDL complex structures. As suggested, we now present simulated annealing omit maps in revised Figure 2A, B, C. The maps were generated like this: phenix.composite_omit_map *.pdb *.mtz *.cif nproc=8 anneal=True We would like to note that our peptide are well ordered in our structures, and their B-values match the B-values of their interacting LRR surface (compare Author response image 1).REVIEW_INFOparagraph62595iii) How many side chains were trimmed due to poor electron density? If this is a significant percentage, it should be noted. REVIEW_INFOparagraph62722Here are the requested numbers (trimmed residues out of total residues in asymmetric unit, percentage):REVIEW_INFOparagraph62826HAESA apo: 7 out of 595 (1%)REVIEW_INFOparagraph62855HAESA IDA: 6 out of 597 + 12 (1%)REVIEW_INFOparagraph62889HAESA IDL1: 6 out of 597 + 12 (1%)REVIEW_INFOparagraph62924HAESA – IDA – SERK1: 5 out of 594 + 12 + 185 (0.6%)REVIEW_INFOparagraph62980We have included a statement in the Methods section that reads: “Amino acids whose side-chain position could not be modeled with confidence were truncated to alanine (0.6 – 1% of total residues)[…]”REVIEW_INFOparagraph63187 2) A further discussion comparing the mechanisms of BRI1-BL-SERK1 and HAESA-IDA-SERK1 would be helpful as a structural comparison is presented. REVIEW_INFOparagraph63333We have expanded our discussion of the HAESA – SERK1 and BRI1 – SERK1 interfaces. We now specify the SERK1 residues in contact with both receptors and the SERK1 residues unique to HAESA/IDA sensing. We also comment on the very different ligand binding modes in HAESA and BRI1 and specify that different LRR segments contribute to the formation of the respective steroid and peptide hormone binding pockets. We feel however that an in-depth comparison of the interacting surfaces is beyond the scope of this report and partially redundant with our earlier work (Santiago et al., Science, 2013). In our opinion, such an analysis seems more appropriate for a review on the subject, which we are currently preparing. Our revised Discussion now reads: “Comparison of our HAESA – IDA – SERK1 structure with the brassinosteroid receptor signaling complex, where SERK1 also acts as co-receptor (Santiago, Henzler, and Hothorn 2013), reveals an overall conserved mode of SERK1 binding, while the ligand binding pockets map to very different areas in the corresponding receptors (LRRs 2 – 14; HAESA; LRRs 21 – 25, BRI1) and may involve an island domain (BRI1) or not (HAESA) (Figure 6A).[…] These residues are not involved in the sensing of the steroid hormone brassinolide (Santiago, Henzler, and Hothorn 2013). In both cases however, the co-receptor completes the hormone binding pocket.”REVIEW_INFOparagraph64732As BR1 binds its ligand with high affinity, the low affinity of HAESA for IDA could be further discussed. REVIEW_INFOparagraph64839High affinity brassinosteroid binding to BRI1 was previously shown using BRI1-enriched plant extracts and radiolabeled brassinolide (Wang et al., Nature410:380-383, 2001). We now know that co-immunoprecipitations of BRI1 from Arabidopsis contain SERK proteins (compare for example Jaillais et al., PNAS, 2011) and thus the reported binding constants likely correspond to steroid binding to BRI1-SERK complexes, not to BRI1 alone. We would thus prefer not to compare the binding affinities for brassinosteroid and peptide hormone ligands at this point.REVIEW_INFOparagraph653913) Are the results here applicable to the related receptor HSL2? Are the residues that interact with SERK1 and IDA conserved in HSL2? REVIEW_INFOparagraph65526Yes. We present a structure-based sequence alignment of AtHAESA and AtHSL2, as well as other HAESA-type receptors from different plant species in Figure 1—figure supplement 3. In the peptide binding surface, 17 out of 26 contributing amino-acids are conserved among AtHAESA and AtHSL2. 13 out of 19 interacting residues in the HAESA – SERK1 complex are also present in AtHSL2. We feel that this is strong conservation given that the AtHAESA and AtHSL2 ectodomains share 45% overall sequence identity. We have included a statement in our manuscript that reads: “Indeed, we find many of the residues contributing to the formation of the IDA binding surface in HAESA to be conserved in HSL2 and other HAESA-type receptors in different plant species (Figure 1—figure supplement 3).”REVIEW_INFOparagraph663154) The authors show that N-terminal extension of the peptide does not impact on binding efficiency, but what would happen if the peptide was extended at the C-terminal end, at the suggested cleavage site? elife-15075-resp-fig2.jpgfig9FIGfig_title_caption66521Isothermal titration calorimetry thermograph of the C-terminally extended IDA-SFVN peptide (200 μM) titrated into a solution containing 20 μM of the purified HAESA ectodomain.elife-15075-resp-fig2.jpgfig9FIGfig_caption66699No detectable binding is observed.elife-15075-resp-fig2.jpgfig9FIGfig_caption66734DOI:
http://dx.doi.org/10.7554/eLife.15075.016REVIEW_INFOparagraph66781Thank you for suggesting this experiment. We synthesized a C-terminally extended version of the IDA peptide (IDA-SFVN with sequence YPIPPSA-Hyp- SKRHN SFVN) and performed quantitative binding assays by ITC. As shown in Author response image 2, we cannot observe any detectable binding of this C-terminally extended peptide to the HAESA ectodomain, consistent with our crystallographic models that suggest that HAESA specifically senses an active IDA 12mer. We have incorporated this new result in Figure 2D. We have included a new statement in the manuscript that reads: “The COO- group of Asn69IDA is in direct contact with Arg407HAESA and Arg409HAESA and HAESA cannot bind a C-terminally extended IDA-SFVN peptide (Figures 1D, F, 2D).”REVIEW_INFOparagraph67523Would cleavage be required for recognition? A brief discussion on this point may help. REVIEW_INFOparagraph67611Yes. We have modified our manuscript accordingly: “This suggests that the conserved Asn69 may constitute the very C-terminus of the mature IDA peptide in planta and that active IDA is generated by proteolytic processing from a longer pre-protein (Stenvik et al. 2008).“REVIEW_INFOparagraph678855) Figure 3C: Could the authors comment on the difference between the blue (SERK1 vs. HAESA-IDA) and the black (IDA vs. HAESA-SERK1) line? SERK1 vs. HAESA-IDA gives a Kd of 75 nM, yet IDA vs. SERK1-HAESA gives a Kd of 350 nM. In the text the authors keep referring to the 75 nM Kd, but not the 350 nM Kd. Is it really fair to say the Kd is 75 nM?REVIEW_INFOparagraph68232Yes and No. These are two different experiments. We first measured (by ITC) the binding affinity of IDA (in the syringe) binding to a protein solution containing equimolar ratios of HAESA and SERK1 (Kdis 350 nM in this case). Next, we titrated a concentrated SERK1 solution (in the syringe) into a solution of HAESA containing IDA in 10fold molar excess (Kdin this case is 75 nM). Given that the experimental conditions (protein and peptide concentrations and molar ratios between the components) are very different, we feel that the Kd 's obtained by these experiments are in good agreement (4.5 fold difference vs. a 60-260 fold difference when compared to the isolated HAESA ectodomain). Nevertheless, we addressed the reviewer's concern by modifying our manuscript which now states: “In this case, there was no detectable interaction between receptor and co-receptor, while in the presence of IDA, SERK1 strongly binds HAESA with a dissociation constant in the mid-nanomolar range. (Figure 3C).”REVIEW_INFOparagraph692366) In the Discussion, can the authors comment further on the discrepancy between their study and the study of Lewis et al. (Plant J, 2010) concerning the role of SERK1 in floral abscission? REVIEW_INFOparagraph69427The process of floral organ abscission in Arabidopsis is divided into distinct steps where a gradual loosening of the cell wall between abscising cells can be measured as a reduction in petal breakstrength (Bleecker and Patterson, 1997). During floral abscission in wild-type plants a significant drop in breakstrength occurs shortly before the petals drop (shown in Figure 3A in our manuscript). Previously reported negative regulators of abscission, such as the transcription factor KNAT1, have an earlier reduction in breakstrength, indicative of early cell wall remodeling (Shi et al. 2011). Our results show that serk1 mutant plants, contrary to knat1 mutants and wild type, have a delay in cell wall loosening and organ separation (Figure 3A) thus positively regulating organ separation during abscission. The weaker phenotype when compared to haesa/hsl2 mutants is likely due to the redundant nature of other SERKs inthe abscission zone (recent work of Meng et al. 2016, cited in the Results and Discussion sections of our manuscript).REVIEW_INFOparagraph70470It has previously been reported that mutations in SERK1 can rescue the block in abscission in plants without the functional ADP-ribosylation factor GTPase-activating protein NEVERSHED (NEV) (Lewis et al. 2010). However, as a mutation in SERK1 is not capable of rescuing the ida mutant phenotype (Lewis et al. 2010) and revertant mutants capable of rescuing the abscission defect of ida do not complement nev, it has been suggested that NEV and IDA function in parallel pathways to promote cell separation (Liu 2013). Our work does not rule out a function for SERK1 in such a parallel pathway, we merely report SERK1 can ALSO act as a positive regulator of abscission by interacting with HAESA in an IDA-dependent manner. We do not observe negative regulation of floral abscission using our SERK1 mutant alleles. Based on the available evidence there is thus little to discuss and speculate about the different functions of SERK1 in abscission, as no molecular mechanism for the negative role of SERK1 in this pathway has been reported thus far. We feel that it is beyond the scope of our manuscript to clarify the different roles of SERK1 in the Arabidopsis abscission zone.REVIEW_INFOparagraph71645Similarly, could the authors comment on the fact that the LRR-RLP EVD/SOBIR seems to be a negative regulator of the HAESA/HSL2 pathway (Leslie et al., Development, 2010), which seems puzzling given that EVD/SOBIR function is normally restricted to LRR-RLPs (Gust & Felix, Curr Op Plant Biol, 2014).REVIEW_INFOparagraph71944We did attempt to express and purify the EVR/SOBIR extracellular domain, but in our hands the protein is not properly secreted and hence unfolded. We thus could not further investigate the potential mechanism of EVR/SOBIR in the HAESA pathway.REVIEW_INFOparagraph721887) Given that the central hydroxyproline in IDA is of such crucial importance for binding, isn't it surprising that IDAΔ69N does not bind to HAESA at all? Wouldn't it be expected that the remaining part of the peptide still binds to HAESA? REVIEW_INFOparagraph72433We thank the reviewers for pointing this out to us. Indeed, we find several structural and sequence features in IDA peptide to be important determinants for HAESA binding, namely the correct size of the peptide, the presence of a central Hyp residue and an intact C-terminal Arg-His-Asn motif that is buried in the structure. In the revised manuscript we now provide new experiments (binding of a C-terminal extended IDA peptide to HAESA) that clarifies this point (summarized in revised Figure 2D). We have revised our statement in the Discussion accordingly: “The central Hyp residue in IDA is found buried in the HAESA peptide binding surfaceand thus this post-translational modification may regulateIDA bioactivity.”REVIEW_INFOparagraph731588) Figure 1—figure supplement 2: How is it possible that charged amino acids are involved in hydrophobic interactions? REVIEW_INFOparagraph73280We apologize for this confusing statement. It now reads: “A N-terminal Pro-rich motif in IDA makes contacts LRRs 2-6 of the receptor(Figure 1D, Figure 1—figure supplement 2A-C).”REVIEW_INFOparagraph734659) Are the distances shown in the graphical representation of the structures proportional? It would seem that some of the aromatic rings could cause steric hindrance. REVIEW_INFOparagraph73633No. The graphical representation are proportional and e.g. Trp218 in the back of the binding pocket is not producing steric clashes with the peptide with the closest distance being 4.5 A.REVIEW_INFOparagraph7382110) Why did the authors decide to express HAESA and SERK1 without signal peptide? Would it make a difference for binding of IDA, if they leave the SP on? REVIEW_INFOparagraph73976No. We did express both the HAESA and SERK1 ectodomains fused to the signal peptide of human azurocidin, which provides very efficient secretion of LRR proteins in insect cells (Olczak & Olczak, Anal. Biochem., 2006) (see Methods, subsection “Protein Expression and Purification“). Both the native signal peptides for SERK1 and HAESA as well as the azurocidin signal peptide are being recognized and cleaved by the Trichoplusia ni signal peptidase. This results, just like in planta, in a mature receptor/coreceptor ectodomain starting with the first α-helix of the N-terminal capping domain (residues 20 and 24, respectively). Thus, there is no reason to believe that the signal peptide would play a role in IDA sensing. Using our system, we cannot produce HAESA and/or SERK1 ectodomains with an intact signal peptide, as this would impair folding and proper secretion of the recombinant proteins.REVIEW_INFOparagraph7488011) Figure 7: Are the homologous regions also the active parts of these peptides? REVIEW_INFOparagraph74963Yes. We have included three additional references in the Discussion section of our manuscript, which report the bioactive regions of CLV3/CLE, RGF and PEP peptides shown in Figure 7. The revised section now reads: “Importantly, this motif can also be found in other peptide hormone families (Kondo et al. 2006; Matsuzaki et al. 2010; Tang et al. 2015)(Figure 7). Among these are the CLE peptides regulating stem cell maintenance in the shoot and the root (Clark, Running, and Meyerowitz 1995). It is interesting to note, that CLEs in their mature form are also hydroxyprolinated dodecamers, which bind to a surface area in the BARELY ANY MERISTEM 1 receptor that would correspond to part of the IDA binding cleft in HAESA (Kondo et al. 2006;Ogawa et al. 2008; Shinohara et al. 2012).”REVIEW_INFOparagraph75752And could the authors display amino acids numbers on either side of the fragments? REVIEW_INFOparagraph75836Yes. We have now included the residues number of each peptide in Figure 7.REVIEW_INFOparagraph7591112) Have the authors ever measured dissociation of the peptide from the complex? REVIEW_INFOparagraph75993No. We have not performed any biochemical experiment that would allow us to quantify the dissociation of the peptide from the ternary complex. In qualitative terms it is however of note that HAESA-IDA-SERK1 complexes do not dissociate in size exclusion chromatography experiments, even when the peptide is not provided in excess or supplied in the running buffer.REVIEW_INFOparagraph76357And in this regard, to what does "highly stable receptor – co-receptor complex" refer/compare to? REVIEW_INFOparagraph76458The reviewers are correct, we should not claim that the complex is 'highly stable' if we have not quantified the dissociation rate. The revised sentence reads: “This ligand-induced formation of a receptor – co-receptor complex may allow the HAESA and SERK1 kinase domains to efficiently trans-phosphorylate and activate each other in the cytoplasm.”REVIEW_INFOparagraph7681413) Figures 3A and 5C require statistical analyses.REVIEW_INFOparagraph76866Thank you for pointing this out to us. The statistical analysis of the petal break-strength assays shown in Figures 3A and 5C has been carried out by Prof. Ludwig A. Hothorn, Institute for Biostatistics, University of Hannover, Germany, whom we have added as an author on our manuscript:REVIEW_INFOparagraph77154Statistical analysis for Figure 3A: The statistical analysis is described in the figure legend of Figure 3A; statistical significant changes are indicated by a * in the Figure itself. The revised figure legend reads: “Petal break-strength assays measure the force (expressed in gram equivalents) required to remove the petals from the flower of serk mutant plants compared to haesa/hsl2 mutant and Col-0 wild-type flowers. […] Petal break was found significantly increased in almost all positions (indicated with a *) for haesa/hsl2 and serk1-1 mutant plants with respect to the Col-0 control. Calculations were performed in R (R Core Team 2014) (version 3.2.3).” The two new references have been added to the Reference section of the manuscript.REVIEW_INFOparagraph77907We have changed our Results section accordingly: “Our experiments suggest that among the SERK family members, SERK1 is a positive regulator offloral abscission. We found that the force required to remove the petals of serk1-1 mutants is significantlyhigher than that needed for wild-type plants, as previously observed for haesa/hsl2 mutants (Stenvik et al. 2008), and that floral abscission is delayed in serk1-1 (Figure 3A). The serk2-2, serk3-1, serk4-1 and serk5-1 mutant lines (Albrecht et al. 2008) showed a petal break-strength profile not significantly differentfrom wild-type plants.”REVIEW_INFOparagraph78505Statistical analysis for Figure 5C: The statistical analysis is described in the figure legend of Figure 5C; statistical significant changes are indicated by * and # symbols in the Figure itself. The revised figure legend reads:”Quantitative petal break assay for Col-0 wild-type flowers and 35S::IDA wild-type and 35S::IDA K66A/R67A mutant flowers. […] Up to inflorescence position 4, petal break in 35S::IDA K66A/R67A mutant plants was significantly increased compared to both Col-0 control plants (b) and 35S::IDA plants (c).”REVIEW_INFOparagraph79041We have changed our Results section accordingly: “We overexpressed full-length wild-type IDA or this Lys66IDA/Arg67IDA → Ala double-mutant to similar levels in Col-0 Arabidopsis plants (Figure 5D). […] Comparison of 35S::IDA wild-type and mutant plants further indicates that mutation of Lys66IDA/Arg67IDA→ Ala may cause a weak dominant negative effect (Figure 5C-E).”REVIEW_INFOparagraph79420Following the suggestions from for example Nuzzo (Nature506:150-152, 2014) and Trafirmow and Marks (Basic and Applied Social Psychology37:1-2, 2015), we decided not to report p-values.