PMC 20201215 pmc.key 4880283 CC BY no 1 1 Crystal Structures of Putative Sugar Kinases 10.1371/journal.pone.0156067 4880283 27223615 PONE-D-16-05184 e0156067 5 This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. surname:Xie;given-names:Yuan surname:Li;given-names:Mei surname:Chang;given-names:Wenrui surname:Zeth;given-names:Kornelius surname:Chang;given-names:Wenrui surname:Li;given-names:Mei surname:Chang;given-names:Wenrui surname:Li;given-names:Mei All structural files are available from the Protein Data Bank (accession numbers 5HTN, 5HTP, 5HUX, 5HV7, 5HTJ, 5HU2, 5HTY, 5HTR, 5HTV and 5HTX). TITLE Data Availability front 11 2016 0 Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana 0.99754834 evidence cleaner0 2023-06-29T13:10:44Z DUMMY: Crystal Structures 0.9963206 protein_type cleaner0 2023-06-29T13:00:43Z MESH: Sugar Kinases 0.99516356 species cleaner0 2023-06-29T13:05:32Z MESH: Synechococcus Elongatus PCC 7942 0.9951167 species cleaner0 2023-06-29T12:30:25Z MESH: Arabidopsis Thaliana ABSTRACT abstract 108 The genome of the Synechococcus elongatus strain PCC 7942 encodes a putative sugar kinase (SePSK), which shares 44.9% sequence identity with the xylulose kinase-1 (AtXK-1) from Arabidopsis thaliana. Sequence alignment suggests that both kinases belong to the ribulokinase-like carbohydrate kinases, a sub-family of FGGY family carbohydrate kinases. However, their exact physiological function and real substrates remain unknown. Here we solved the structures of SePSK and AtXK-1 in both their apo forms and in complex with nucleotide substrates. The two kinases exhibit nearly identical overall architecture, with both kinases possessing ATP hydrolysis activity in the absence of substrates. In addition, our enzymatic assays suggested that SePSK has the capability to phosphorylate D-ribulose. In order to understand the catalytic mechanism of SePSK, we solved the structure of SePSK in complex with D-ribulose and found two potential substrate binding pockets in SePSK. Using mutation and activity analysis, we further verified the key residues important for its catalytic activity. Moreover, our structural comparison with other family members suggests that there are major conformational changes in SePSK upon substrate binding, facilitating the catalytic process. Together, these results provide important information for a more detailed understanding of the cofactor and substrate binding mode as well as the catalytic mechanism of SePSK, and possible similarities with its plant homologue AtXK-1. 0.98088884 species cleaner0 2023-06-29T12:30:19Z MESH: Synechococcus elongatus strain PCC 7942 0.9968517 protein_type cleaner0 2023-06-29T13:00:47Z MESH: sugar kinase 0.9925585 protein cleaner0 2023-06-29T12:30:02Z PR: SePSK 0.9407749 protein cleaner0 2023-06-29T13:03:44Z PR: xylulose kinase-1 0.9969945 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99455905 species cleaner0 2023-06-29T12:30:24Z MESH: Arabidopsis thaliana 0.9910189 experimental_method cleaner0 2023-06-29T13:06:49Z MESH: Sequence alignment 0.9706698 protein_type cleaner0 2023-06-29T12:31:13Z MESH: kinases 0.99740136 protein_type cleaner0 2023-06-29T12:31:04Z MESH: ribulokinase-like carbohydrate kinases 0.9950826 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.8419162 experimental_method cleaner0 2023-06-29T13:06:57Z MESH: solved 0.9908178 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9986952 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9972751 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99609536 protein_state cleaner0 2023-06-29T12:30:32Z DUMMY: apo protein_state DUMMY: cleaner0 2023-06-29T13:59:21Z in complex with 0.8922534 chemical cleaner0 2023-06-29T13:44:06Z CHEBI: nucleotide protein_type MESH: cleaner0 2023-06-29T14:04:45Z kinases chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.8761011 protein_state cleaner0 2023-06-29T13:59:31Z DUMMY: absence of substrates 0.99225545 experimental_method cleaner0 2023-06-29T13:07:02Z MESH: enzymatic assays 0.9987288 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9976764 chemical cleaner0 2023-06-29T12:31:20Z CHEBI: D-ribulose 0.99876344 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9303222 experimental_method cleaner0 2023-06-29T13:07:05Z MESH: solved 0.9951799 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.99875295 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.83708745 protein_state cleaner0 2023-06-29T13:59:21Z DUMMY: in complex with 0.99768275 chemical cleaner0 2023-06-29T12:31:20Z CHEBI: D-ribulose 0.99790317 site cleaner0 2023-06-29T12:30:58Z SO: substrate binding pockets 0.9986987 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9952727 experimental_method cleaner0 2023-06-29T13:07:09Z MESH: mutation and activity analysis 0.9891796 experimental_method cleaner0 2023-06-29T13:07:12Z MESH: structural comparison 0.99874437 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9987619 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.995307 taxonomy_domain cleaner0 2023-06-29T12:30:50Z DUMMY: plant 0.997238 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 INTRO title_1 1612 Introduction INTRO paragraph 1625 Carbohydrates are essential cellular compounds involved in the metabolic processes present in all organisms. Phosphorylation is one of the various pivotal modifications of carbohydrates, and is catalyzed by specific sugar kinases. These kinases exhibit considerable differences in their folding pattern and substrate specificity. Based on sequence analysis, they can be divided into four families, namely HSP 70_NBD family, FGGY family, Mer_B like family and Parm_like family. The FGGY family carbohydrate kinases contain different types of sugar kinases, all of which possess different catalytic substrates with preferences for short-chained sugar substrates, ranging from triose to heptose. These sugar substrates include L-ribulose, erythritol, L-fuculose, D-glycerol, D-gluconate, L-xylulose, D-ribulose, L-rhamnulose and D-xylulose. Structures reported in the Protein Data Bank of the FGGY family carbohydrate kinases exhibit a similar overall architecture containing two protein domains, one of which is responsible for the binding of substrate, while the second is used for binding cofactor ATP. While the binding pockets for substrates are at the same position, each FGGY family carbohydrate kinases uses different substrate-binding residues, resulting in high substrate specificity. 0.9974124 chemical cleaner0 2023-06-29T12:31:27Z CHEBI: Carbohydrates 0.99177116 ptm cleaner0 2023-06-29T12:31:34Z MESH: Phosphorylation 0.99604684 chemical cleaner0 2023-06-29T12:31:28Z CHEBI: carbohydrates 0.9974047 protein_type cleaner0 2023-06-29T13:00:53Z MESH: sugar kinases 0.9926248 protein_type cleaner0 2023-06-29T13:00:57Z MESH: kinases 0.95107186 experimental_method cleaner0 2023-06-29T13:07:18Z MESH: sequence analysis 0.99077827 protein_type cleaner0 2023-06-29T13:01:01Z MESH: HSP 70_NBD family 0.9724302 protein_type cleaner0 2023-06-29T13:01:03Z MESH: FGGY family 0.96071815 protein_type cleaner0 2023-06-29T13:01:05Z MESH: Mer_B like family 0.9917743 protein_type cleaner0 2023-06-29T13:01:08Z MESH: Parm_like family 0.9966028 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.9971162 protein_type cleaner0 2023-06-29T13:00:54Z MESH: sugar kinases 0.6016427 chemical cleaner0 2023-06-29T13:44:10Z CHEBI: sugar 0.9989779 chemical cleaner0 2023-06-29T13:44:14Z CHEBI: triose 0.9988084 chemical cleaner0 2023-06-29T13:44:16Z CHEBI: heptose chemical CHEBI: cleaner0 2023-06-29T14:05:17Z sugar 0.9977336 chemical cleaner0 2023-06-29T12:33:14Z CHEBI: L-ribulose 0.998863 chemical cleaner0 2023-06-29T12:33:19Z CHEBI: erythritol 0.997777 chemical cleaner0 2023-06-29T12:33:23Z CHEBI: L-fuculose 0.99766636 chemical cleaner0 2023-06-29T12:33:28Z CHEBI: D-glycerol 0.99771184 chemical cleaner0 2023-06-29T12:33:32Z CHEBI: D-gluconate 0.99763614 chemical cleaner0 2023-06-29T12:33:36Z CHEBI: L-xylulose 0.99765563 chemical cleaner0 2023-06-29T12:31:20Z CHEBI: D-ribulose 0.99760133 chemical cleaner0 2023-06-29T12:33:45Z CHEBI: L-rhamnulose 0.9977079 chemical cleaner0 2023-06-29T12:33:50Z CHEBI: D-xylulose 0.99341464 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: Structures 0.99726695 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.99870217 chemical cleaner0 2023-06-29T12:33:55Z CHEBI: ATP 0.9979714 site cleaner0 2023-06-29T12:34:00Z SO: binding pockets 0.9970257 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.99784184 site cleaner0 2023-06-29T12:34:04Z SO: substrate-binding residues INTRO paragraph 2917 Synpcc7942_2462 from the cyanobacteria Synechococcus elongatus PCC 7942 encodes a putative sugar kinase (SePSK), and this kinase contains 426 amino acids. The At2g21370 gene product from Arabidopsis thaliana, xylulose kinase-1 (AtXK-1), whose mature form contains 436 amino acids, is located in the chloroplast (ChloroP 1.1 Server). SePSK and AtXK-1 display a sequence identity of 44.9%, and belong to the ribulokinase-like carbohydrate kinases, a sub-family of FGGY family carbohydrate kinases. Members of this sub-family are responsible for the phosphorylation of sugars similar to L-ribulose and D-ribulose. The sequence and the substrate specificity of ribulokinase-like carbohydrate kinases are different, but they share the common folding feature with two domains. Domain I exhibits a ribonuclease H-like folding pattern, and is responsible for the substrate binding, while domain II possesses an actin-like ATPase domain that binds cofactor ATP. gene GENE: cleaner0 2023-06-29T13:43:36Z Synpcc7942_2462 0.9932019 taxonomy_domain cleaner0 2023-06-29T12:31:44Z DUMMY: cyanobacteria 0.9948773 species cleaner0 2023-06-29T13:05:38Z MESH: Synechococcus elongatus PCC 7942 0.9971451 protein_type cleaner0 2023-06-29T13:01:17Z MESH: sugar kinase 0.63160545 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9100555 protein_type cleaner0 2023-06-29T12:34:54Z MESH: kinase 0.85704523 residue_range cleaner0 2023-06-29T13:42:07Z DUMMY: 426 0.9747736 gene cleaner0 2023-06-29T12:32:25Z GENE: At2g21370 0.9906274 species cleaner0 2023-06-29T12:30:25Z MESH: Arabidopsis thaliana protein PR: cleaner0 2023-06-29T13:03:44Z xylulose kinase-1 0.993728 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9908381 protein_state cleaner0 2023-06-29T13:59:36Z DUMMY: mature form residue_range DUMMY: cleaner0 2023-06-29T13:42:24Z 436 0.9935946 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9964879 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9976362 protein_type cleaner0 2023-06-29T12:31:04Z MESH: ribulokinase-like carbohydrate kinases 0.9972199 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.69236356 ptm cleaner0 2023-06-29T12:31:34Z MESH: phosphorylation 0.9973399 chemical cleaner0 2023-06-29T13:44:21Z CHEBI: sugars 0.9979513 chemical cleaner0 2023-06-29T12:33:15Z CHEBI: L-ribulose 0.9979672 chemical cleaner0 2023-06-29T12:31:20Z CHEBI: D-ribulose 0.99770737 protein_type cleaner0 2023-06-29T12:31:04Z MESH: ribulokinase-like carbohydrate kinases structure_element SO: cleaner0 2023-06-29T12:45:50Z Domain I structure_element SO: cleaner0 2023-06-29T13:51:28Z ribonuclease H-like folding pattern structure_element SO: cleaner0 2023-06-29T12:39:03Z domain II 0.98265535 structure_element cleaner0 2023-06-29T13:51:37Z SO: actin-like ATPase domain 0.9985184 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP INTRO paragraph 3870 Two possible xylulose kinases (xylulose kinase-1: XK-1 and xylulose kinase-2: XK-2) from Arabidopsis thaliana were previously proposed. It was shown that XK-2 (At5g49650) located in the cytosol is indeed xylulose kinase. However, the function of XK-1 (At2g21370) inside the chloroplast stroma has remained unknown. SePSK from Synechococcus elongatus strain PCC 7942 is the homolog of AtXK-1, though its physiological function and substrates remain unclear. In order to obtain functional and structural information about these two proteins, here we reported the crystal structures of SePSK and AtXK-1. Our findings provide new details of the catalytic mechanism of SePSK and lay the foundation for future studies into its homologs in eukaryotes. 0.99621874 protein_type cleaner0 2023-06-29T13:01:23Z MESH: xylulose kinases 0.9020749 protein cleaner0 2023-06-29T13:03:44Z PR: xylulose kinase-1 0.9957288 protein cleaner0 2023-06-29T13:06:07Z PR: XK-1 protein PR: cleaner0 2023-06-29T13:03:56Z xylulose kinase-2 0.99588984 protein cleaner0 2023-06-29T13:06:17Z PR: XK-2 0.99466956 species cleaner0 2023-06-29T12:30:25Z MESH: Arabidopsis thaliana 0.9965222 protein cleaner0 2023-06-29T13:06:17Z PR: XK-2 gene GENE: cleaner0 2023-06-29T12:32:39Z At5g49650 0.99674535 protein_type cleaner0 2023-06-29T13:01:29Z MESH: xylulose kinase 0.99666864 protein cleaner0 2023-06-29T13:06:07Z PR: XK-1 gene GENE: cleaner0 2023-06-29T12:32:26Z At2g21370 0.997888 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.98438454 species cleaner0 2023-06-29T12:30:19Z MESH: Synechococcus elongatus strain PCC 7942 0.9970591 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99739194 evidence cleaner0 2023-06-29T13:10:49Z DUMMY: crystal structures 0.9986594 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99723387 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99841964 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99531025 taxonomy_domain cleaner0 2023-06-29T12:31:52Z DUMMY: eukaryotes RESULTS title_1 4615 Results and Discussion RESULTS title_2 4638 Overall structures of apo-SePSK and apo-AtXK-1 0.9962684 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9976174 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.998877 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9975981 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9971158 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 RESULTS paragraph 4685 The attempt to solve the SePSK structure by molecular replacement method failed with ribulokinase from Bacillus halodurans (PDB code: 3QDK, 15.7% sequence identity) as an initial model. We therefore used single isomorphous replacement anomalous scattering method (SIRAS) for successful solution of the apo-SePSK structure at a resolution of 2.3 Å. Subsequently, the apo-SePSK structure was used as molecular replacement model to solve all other structures identified in this study. 0.99876773 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9933109 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.97644377 experimental_method cleaner0 2023-06-29T13:07:25Z MESH: molecular replacement method 0.99807465 protein cleaner0 2023-06-29T13:06:31Z PR: ribulokinase 0.99563575 species cleaner0 2023-06-29T13:05:46Z MESH: Bacillus halodurans 0.994757 experimental_method cleaner0 2023-06-29T13:07:31Z MESH: single isomorphous replacement anomalous scattering method 0.8514184 experimental_method cleaner0 2023-06-29T13:07:36Z MESH: SIRAS 0.9976591 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.99857235 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9953922 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9976841 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9983925 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.996648 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9473977 experimental_method cleaner0 2023-06-29T13:07:41Z MESH: molecular replacement model 0.9923522 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures RESULTS paragraph 5168 Our structural analysis showed that apo-SePSK consists of one SePSK protein molecule in an asymmetric unit. The amino-acid residues were traced from Val2 to His419, except for the Met1 residue and the seven residues at the C-termini. Apo-SePSK contains two domains referred to further on as domain I and domain II (Fig 1A). Domain I consists of non-contiguous portions of the polypeptide chains (aa. 2–228 and aa. 402–419), exhibiting 11 α-helices and 11 β-sheets. Among all these structural elements, α4/α5/α11/α18, β3/β2/β1/β6/β19/β20/β17 and α21/α32 form three patches, referred to as A1, B1 and A2, exhibiting the core region. In addition, four β-sheets (β7, β10, β12 and β16) and five α-helices (α8, α9, α13, α14 and α15) flank the left side of the core region. Domain II is comprised of aa. 229–401 and classified into B2 (β31/β29/β22/β23/β25/β24) and A3 (α26/α27/α28/α30) (Fig 1A and S1 Fig). In the SePSK structure, B1 and B2 are sandwiched by A1, A2 and A3, and the whole structure shows the A1/B1/A2/B2/A3 (α/β/α/β/α) folding pattern, which is in common with other members of FGGY family carbohydrate kinases (S2 Fig). The overall folding of SePSK resembles a clip, with A2 of domain I acting as a hinge region. As a consequence, a deep cleft is formed between the two domains. 0.9923353 experimental_method cleaner0 2023-06-29T13:07:44Z MESH: structural analysis 0.9976369 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9985624 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99793905 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.8815784 residue_name_number cleaner0 2023-06-29T13:42:37Z DUMMY: Val2 0.5677447 residue_name_number cleaner0 2023-06-29T13:42:42Z DUMMY: His419 0.99703836 residue_name_number cleaner0 2023-06-29T13:39:17Z DUMMY: Met1 0.99758613 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: Apo 0.99850345 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK structure_element SO: cleaner0 2023-06-29T12:45:50Z domain I structure_element SO: cleaner0 2023-06-29T12:39:03Z domain II 0.7847574 structure_element cleaner0 2023-06-29T12:45:50Z SO: Domain I 0.97053427 residue_range cleaner0 2023-06-29T13:42:48Z DUMMY: 2–228 0.9677195 residue_range cleaner0 2023-06-29T13:42:51Z DUMMY: 402–419 0.98251957 structure_element cleaner0 2023-06-29T13:51:43Z SO: α-helices 0.95828867 structure_element cleaner0 2023-06-29T13:51:46Z SO: β-sheets 0.9965893 structure_element cleaner0 2023-06-29T13:51:48Z SO: α4 0.5221494 structure_element cleaner0 2023-06-29T13:51:51Z SO: α5 0.98980695 structure_element cleaner0 2023-06-29T13:51:54Z SO: α11 0.97880346 structure_element cleaner0 2023-06-29T13:51:56Z SO: α18 0.991999 structure_element cleaner0 2023-06-29T13:51:59Z SO: β3 0.97956353 structure_element cleaner0 2023-06-29T13:52:01Z SO: β2 0.97985715 structure_element cleaner0 2023-06-29T13:52:03Z SO: β1 0.97420245 structure_element cleaner0 2023-06-29T13:52:06Z SO: β6 0.9660877 structure_element cleaner0 2023-06-29T13:52:08Z SO: β19 0.9405666 structure_element cleaner0 2023-06-29T13:52:11Z SO: β20 0.9089153 structure_element cleaner0 2023-06-29T13:52:13Z SO: β17 0.9609138 structure_element cleaner0 2023-06-29T13:52:16Z SO: α21 0.85766864 structure_element cleaner0 2023-06-29T13:52:20Z SO: α32 0.9635641 structure_element cleaner0 2023-06-29T13:52:24Z SO: A1 0.94301206 structure_element cleaner0 2023-06-29T13:52:26Z SO: B1 0.9472735 structure_element cleaner0 2023-06-29T13:52:28Z SO: A2 0.9584068 structure_element cleaner0 2023-06-29T13:52:31Z SO: core region 0.8511612 structure_element cleaner0 2023-06-29T13:52:33Z SO: β-sheets 0.9793401 structure_element cleaner0 2023-06-29T13:52:36Z SO: β7 0.9741762 structure_element cleaner0 2023-06-29T13:52:39Z SO: β10 0.9605815 structure_element cleaner0 2023-06-29T13:52:42Z SO: β12 0.955182 structure_element cleaner0 2023-06-29T13:52:44Z SO: β16 0.9639299 structure_element cleaner0 2023-06-29T13:52:46Z SO: α-helices 0.96275705 structure_element cleaner0 2023-06-29T13:52:48Z SO: α8 0.95128447 structure_element cleaner0 2023-06-29T13:52:51Z SO: α9 0.9159867 structure_element cleaner0 2023-06-29T13:52:53Z SO: α13 0.9050932 structure_element cleaner0 2023-06-29T13:52:56Z SO: α14 0.9102981 structure_element cleaner0 2023-06-29T13:52:58Z SO: α15 0.92403173 structure_element cleaner0 2023-06-29T13:53:00Z SO: core region 0.7898005 structure_element cleaner0 2023-06-29T12:39:04Z SO: Domain II 0.97022057 residue_range cleaner0 2023-06-29T13:42:54Z DUMMY: 229–401 0.9894503 structure_element cleaner0 2023-06-29T13:53:05Z SO: B2 0.8862108 structure_element cleaner0 2023-06-29T13:53:07Z SO: β31 0.8667047 structure_element cleaner0 2023-06-29T13:53:09Z SO: β29 0.84616303 structure_element cleaner0 2023-06-29T13:53:13Z SO: β22 0.8279116 structure_element cleaner0 2023-06-29T13:53:15Z SO: β23 0.8425631 structure_element cleaner0 2023-06-29T13:53:17Z SO: β25 0.8620087 structure_element cleaner0 2023-06-29T13:53:19Z SO: β24 0.98577106 structure_element cleaner0 2023-06-29T13:53:22Z SO: A3 0.92820394 structure_element cleaner0 2023-06-29T13:53:24Z SO: α26 0.8721497 structure_element cleaner0 2023-06-29T13:53:26Z SO: α27 0.875759 structure_element cleaner0 2023-06-29T13:53:28Z SO: α28 0.8336133 structure_element cleaner0 2023-06-29T13:53:31Z SO: α30 0.99854624 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99730116 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9805611 structure_element cleaner0 2023-06-29T13:53:35Z SO: B1 0.9538362 structure_element cleaner0 2023-06-29T13:53:38Z SO: B2 0.94712037 structure_element cleaner0 2023-06-29T13:53:40Z SO: A1 0.9093556 structure_element cleaner0 2023-06-29T13:53:43Z SO: A2 0.9046779 structure_element cleaner0 2023-06-29T13:53:45Z SO: A3 0.9966517 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.99050295 structure_element cleaner0 2023-06-29T13:53:48Z SO: A1 0.9724399 structure_element cleaner0 2023-06-29T13:53:51Z SO: B1 0.9742293 structure_element cleaner0 2023-06-29T13:53:53Z SO: A2 0.97901684 structure_element cleaner0 2023-06-29T13:53:56Z SO: B2 0.97291994 structure_element cleaner0 2023-06-29T13:53:59Z SO: A3 structure_element SO: cleaner0 2023-06-29T13:54:10Z α 0.3309372 structure_element cleaner0 2023-06-29T13:54:13Z SO: β structure_element SO: cleaner0 2023-06-29T13:54:28Z α structure_element SO: cleaner0 2023-06-29T13:54:38Z β structure_element SO: cleaner0 2023-06-29T13:54:48Z α 0.9194723 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.99868494 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.97997653 structure_element cleaner0 2023-06-29T13:54:53Z SO: A2 structure_element SO: cleaner0 2023-06-29T12:45:50Z domain I 0.85653365 structure_element cleaner0 2023-06-29T13:54:56Z SO: hinge region pone.0156067.g001.jpg pone.0156067.g001 FIG fig_title_caption 6599 Overall structures of SePSK and AtXK-1. 0.99674416 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9987685 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9974437 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 pone.0156067.g001.jpg pone.0156067.g001 FIG fig_caption 6639 (A) Three-dimensional structure of apo-SePSK. The secondary structural elements are indicated (α-helix: cyan, β-sheet: yellow). (B) Three-dimensional structure of apo-AtXK-1. The secondary structural elements are indicated (α-helix: green, β-sheet: wheat). evidence DUMMY: cleaner0 2023-06-29T12:36:04Z structure 0.99773824 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.99876773 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99562484 structure_element cleaner0 2023-06-29T13:55:01Z SO: α-helix 0.98599243 structure_element cleaner0 2023-06-29T13:55:03Z SO: β-sheet 0.5304055 evidence cleaner0 2023-06-29T12:36:03Z DUMMY: structure 0.99765897 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9961786 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9946821 structure_element cleaner0 2023-06-29T13:55:05Z SO: α-helix 0.9832224 structure_element cleaner0 2023-06-29T13:55:07Z SO: β-sheet RESULTS paragraph 6910 Apo-AtXK-1 exhibits a folding pattern similar to that of SePSK in line with their high sequence identity (Fig 1B and S1 Fig). However, superposition of structures of AtXK-1 and SePSK shows some differences, especially at the loop regions. A considerable difference is found in the loop3 linking β3 and α4, which is stretched out in the AtXK-1 structure, while in the SePSK structure, it is bent back towards the inner part. The corresponding residues between these two structures (SePSK-Lys35 and AtXK-1-Lys48) have a distance of 15.4 Å (S3 Fig). 0.99779034 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: Apo 0.99601835 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9987596 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99529535 experimental_method cleaner0 2023-06-29T13:07:51Z MESH: superposition 0.995905 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9961788 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9985306 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.8974517 structure_element cleaner0 2023-06-29T13:55:10Z SO: loop regions 0.9978461 structure_element cleaner0 2023-06-29T13:55:13Z SO: loop3 0.9979189 structure_element cleaner0 2023-06-29T13:55:15Z SO: β3 0.9976839 structure_element cleaner0 2023-06-29T13:55:17Z SO: α4 0.9932323 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99584335 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.99782026 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9960836 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9948949 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99823296 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9940054 residue_name_number cleaner0 2023-06-29T13:39:44Z DUMMY: Lys35 0.99420935 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.992396 residue_name_number cleaner0 2023-06-29T13:39:50Z DUMMY: Lys48 RESULTS title_2 7464 Activity assays of SePSK and AtXK-1 0.994784 experimental_method cleaner0 2023-06-29T13:07:58Z MESH: Activity assays 0.9980216 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.997217 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 RESULTS paragraph 7500 In order to understand the function of these two kinases, we performed structural comparison using Dali server. The structures most closely related to SePSK are xylulose kinase, glycerol kinase and ribulose kinase, implying that SePSK and AtXK-1 might function similarly to these kinases. We first tested whether both enzymes possessed ATP hydrolysis activity in the absence of substrates. As shown in Fig 2A, both SePSK and AtXK-1 exhibited ATP hydrolysis activity. This finding is in agreement with a previous result showing that xylulose kinase (PDB code: 2ITM) possessed ATP hydrolysis activity without adding substrate. To further identify the actual substrate of SePSK and AtXK-1, five different sugar molecules, including D-ribulose, L-ribulose, D-xylulose, L-xylulose and Glycerol, were used in enzymatic activity assays. As shown in Fig 2B, the ATP hydrolysis activity of SePSK greatly increased upon adding D-ribulose than adding other potential substrates, suggesting that it has D-ribulose kinase activity. In contrary, limited increasing of ATP hydrolysis activity was detected for AtXK-1 upon addition of D-ribulose (Fig 2C), despite its structural similarity with SePSK. 0.9927877 experimental_method cleaner0 2023-06-29T13:08:02Z MESH: structural comparison 0.98594457 experimental_method cleaner0 2023-06-29T13:08:06Z MESH: Dali server 0.9860701 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9985549 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9904278 protein_type cleaner0 2023-06-29T13:01:30Z MESH: xylulose kinase 0.9862346 protein_type cleaner0 2023-06-29T13:01:37Z MESH: glycerol kinase 0.9149159 protein_type cleaner0 2023-06-29T13:01:42Z MESH: ribulose kinase 0.99882716 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.996994 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 protein_type MESH: cleaner0 2023-06-29T14:06:05Z kinases chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.97429013 protein_state cleaner0 2023-06-29T13:59:44Z DUMMY: absence of 0.99876404 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99695987 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.98557127 protein_type cleaner0 2023-06-29T13:01:30Z MESH: xylulose kinase chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.9988098 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99698764 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9979536 chemical cleaner0 2023-06-29T12:31:20Z CHEBI: D-ribulose 0.99782056 chemical cleaner0 2023-06-29T12:33:15Z CHEBI: L-ribulose 0.99789363 chemical cleaner0 2023-06-29T12:33:50Z CHEBI: D-xylulose 0.9978849 chemical cleaner0 2023-06-29T12:33:37Z CHEBI: L-xylulose 0.9986665 chemical cleaner0 2023-06-29T13:44:27Z CHEBI: Glycerol 0.9742984 experimental_method cleaner0 2023-06-29T13:08:11Z MESH: enzymatic activity assays chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.99883 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99776167 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.64733255 protein_type cleaner0 2023-06-29T13:04:22Z MESH: D-ribulose kinase chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.99709326 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99760944 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9988199 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK pone.0156067.g002.jpg pone.0156067.g002 FIG fig_title_caption 8686 The enzymatic activity assays of SePSK and AtXK-1. 0.99519634 experimental_method cleaner0 2023-06-29T13:08:11Z MESH: enzymatic activity assays 0.9988117 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9974227 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 pone.0156067.g002.jpg pone.0156067.g002 FIG fig_caption 8737 (A) The ATP hydrolysis activity of SePSK and AtXK-1. Both SePSK and AtXK-1 showed ATP hydrolysis activity in the absence of substrate. While the ATP hydrolysis activity of SePSK greatly increases upon addition of D-ribulose (DR). (B) The ATP hydrolysis activity of SePSK with addition of five different substrates. The substrates are DR (D-ribulose), LR (L-ribulose), DX (D-xylulose), LX (L-xylulose) and GLY (Glycerol). (C) The ATP hydrolysis activity of SePSK and AtXK-1 with or without D-ribulose. (D) The ATP hydrolysis activity of wild-type (WT) and single-site mutants of SePSK. Three single-site mutants of SePSK are D8A-SePSK, T11A-SePSK and D221A-SePSK. The ATP hydrolysis activity measured via luminescent ADP-Glo assay (Promega). chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.99884677 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99608546 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9987903 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99594265 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.98278284 protein_state cleaner0 2023-06-29T13:59:45Z DUMMY: absence of chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.9987889 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99793214 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9982743 chemical cleaner0 2023-06-29T13:44:34Z CHEBI: DR chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.9987832 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99842155 chemical cleaner0 2023-06-29T13:44:38Z CHEBI: DR 0.9979138 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9984219 chemical cleaner0 2023-06-29T13:44:43Z CHEBI: LR 0.99779844 chemical cleaner0 2023-06-29T12:33:15Z CHEBI: L-ribulose 0.99827313 chemical cleaner0 2023-06-29T13:44:46Z CHEBI: DX 0.99786544 chemical cleaner0 2023-06-29T12:33:50Z CHEBI: D-xylulose 0.9981193 chemical cleaner0 2023-06-29T13:44:51Z CHEBI: LX 0.99784297 chemical cleaner0 2023-06-29T12:33:37Z CHEBI: L-xylulose 0.9980958 chemical cleaner0 2023-06-29T13:44:54Z CHEBI: GLY 0.99852884 chemical cleaner0 2023-06-29T13:44:58Z CHEBI: Glycerol chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.998868 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99602515 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99775594 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.99538165 protein_state cleaner0 2023-06-29T13:59:52Z DUMMY: wild-type 0.99654883 protein_state cleaner0 2023-06-29T12:45:29Z DUMMY: WT 0.9987507 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99850804 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.99760216 mutant cleaner0 2023-06-29T13:38:51Z MESH: D8A 0.91232306 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.997962 mutant cleaner0 2023-06-29T13:38:53Z MESH: T11A 0.8812514 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9981262 mutant cleaner0 2023-06-29T13:38:56Z MESH: D221A 0.91704124 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.9585148 experimental_method cleaner0 2023-06-29T13:08:17Z MESH: luminescent ADP-Glo assay RESULTS paragraph 9478 To understand the catalytic mechanism of SePSK, we performed structural comparisons among xylulose kinase, glycerol kinase, ribulose kinase and SePSK. Our results suggested that three conserved residues (D8, T11 and D221 of SePSK) play an important role in SePSK function. Mutations of the corresponding residue in xylulose kinase and glycerol kinase from Escherichia coli greatly reduced their activity. To identify the function of these three residues of SePSK, we constructed D8A, T11A and D221A mutants. Using enzymatic activity assays, we found that all of these mutants exhibit much lower activity of ATP hydrolysis after adding D-ribulose than that of wild type, indicating the possibility that these three residues are involved in the catalytic process of phosphorylation D-ribulose and are vital for the function of SePSK (Fig 2D). 0.99626297 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9939593 experimental_method cleaner0 2023-06-29T13:08:23Z MESH: structural comparisons 0.98220813 protein_type cleaner0 2023-06-29T13:01:30Z MESH: xylulose kinase 0.99061966 protein_type cleaner0 2023-06-29T13:01:37Z MESH: glycerol kinase protein_type MESH: cleaner0 2023-06-29T13:01:42Z ribulose kinase 0.99799514 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9935463 residue_name_number cleaner0 2023-06-29T13:39:54Z DUMMY: D8 0.99717474 residue_name_number cleaner0 2023-06-29T13:39:57Z DUMMY: T11 0.9975109 residue_name_number cleaner0 2023-06-29T13:40:00Z DUMMY: D221 0.99862444 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9833528 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9122575 experimental_method cleaner0 2023-06-29T13:08:31Z MESH: Mutations 0.96090376 protein_type cleaner0 2023-06-29T13:01:30Z MESH: xylulose kinase 0.98994493 protein_type cleaner0 2023-06-29T13:01:37Z MESH: glycerol kinase 0.9943024 species cleaner0 2023-06-29T13:05:53Z MESH: Escherichia coli 0.99813 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9982863 mutant cleaner0 2023-06-29T13:38:59Z MESH: D8A 0.9981589 mutant cleaner0 2023-06-29T13:39:01Z MESH: T11A 0.9984445 mutant cleaner0 2023-06-29T13:39:03Z MESH: D221A protein_state DUMMY: cleaner0 2023-06-29T14:06:44Z mutants 0.9937988 experimental_method cleaner0 2023-06-29T13:08:12Z MESH: enzymatic activity assays chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.99685556 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9964043 protein_state cleaner0 2023-06-29T12:45:24Z DUMMY: wild type ptm MESH: cleaner0 2023-06-29T12:31:34Z phosphorylation 0.9972331 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.99854565 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK RESULTS title_2 10319 SePSK and AtXK-1 possess a similar ATP binding site 0.9988085 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9974907 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9981734 site cleaner0 2023-06-29T14:02:02Z SO: ATP binding site RESULTS paragraph 10371 To obtain more detailed information of SePSK and AtXK-1 in complex with ATP, we soaked the apo-crystals in the reservoir adding cofactor ATP, and obtained the structures of SePSK and AtXK-1 bound with ATP at the resolution of 2.3 Å and 1.8 Å, respectively. In both structures, a strong electron density was found in the conserved ATP binding pocket, but can only be fitted with an ADP molecule (S4 Fig). Thus the two structures were named ADP-SePSK and ADP-AtXK-1, respectively. The extremely weak electron densities of ATP γ-phosphate in both structures suggest that the γ-phosphate group of ATP is either flexible or hydrolyzed by SePSK and AtXK-1. This result was consistent with our enzymatic activity assays where SePSK and AtXK-1 showed ATP hydrolysis activity without adding any substrates (Fig 2A and 2C). 0.9988488 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9968018 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9100135 protein_state cleaner0 2023-06-29T13:59:21Z DUMMY: in complex with 0.9981864 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.98961544 experimental_method cleaner0 2023-06-29T13:08:38Z MESH: soaked 0.99751925 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9718859 evidence cleaner0 2023-06-29T12:58:48Z DUMMY: crystals 0.99853814 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.996439 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99883145 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9963374 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.96040344 protein_state cleaner0 2023-06-29T14:00:00Z DUMMY: bound with 0.99664634 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.9949189 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.9952722 evidence cleaner0 2023-06-29T12:58:56Z DUMMY: electron density 0.990589 protein_state cleaner0 2023-06-29T14:00:07Z DUMMY: conserved 0.99830914 site cleaner0 2023-06-29T14:02:06Z SO: ATP binding pocket 0.99864465 chemical cleaner0 2023-06-29T13:45:01Z CHEBI: ADP 0.99441355 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures complex_assembly GO: cleaner0 2023-06-29T12:39:32Z ADP-SePSK complex_assembly GO: cleaner0 2023-06-29T12:39:49Z ADP-AtXK-1 0.9916402 evidence cleaner0 2023-06-29T12:40:10Z DUMMY: electron densities chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9949497 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9984862 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.99891424 protein cleaner0 2023-06-29T12:30:03Z PR: SePSK 0.9967306 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9894783 experimental_method cleaner0 2023-06-29T13:08:12Z MESH: enzymatic activity assays 0.9988708 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9964905 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP RESULTS paragraph 11193 To avoid hydrolysis of ATP, we soaked the crystals of apo-SePSK and apo-AtXK-1 into the reservoir adding AMP-PNP. However, we found that the electron densities of γ-phosphate group of AMP-PNP (AMP-PNP γ-phosphate) are still weak in the AMP-PNP-SePSK and AMP-PNP-AtXK-1 structures, suggesting high flexibility of ATP-γ-phosphate. The γ-phosphate group of ATP is transferred to the sugar substrate during the reaction process, so this flexibility might be important for the ability of these kinases. The overall structures as well as the coordination modes of ADP and AMP-PNP in the AMP-PNP-AtXK-1, ADP-AtXK-1, ADP-SePSK and AMP-PNP-SePSK structures are nearly identical (S5 Fig), therefore the structure of AMP-PNP-SePSK is used here to describe the structural details and to compare with those of other family members. As shown in Fig 3A, one SePSK protein molecule is in an asymmetric unit with one AMP-PNP molecule. The AMP-PNP is bound at the domain II, where it fits well inside a positively charged groove. The AMP-PNP binding pocket consists of four α-helices (α26, α28, α27 and α30) and forms a shape resembling a half-fist (Fig 3A and 3B). The head group of the AMP-PNP is embedded in a pocket surrounded by Trp383, Asn380, Gly376 and Gly377. The purine ring of AMP-PNP is positioned in parallel to the indole ring of Trp383. In addition, it is hydrogen-bonded with the side chain amide of Asn380 (Fig 3B). The tail of AMP-PNP points to the hinge region of SePSK, and its α-phosphate and β-phosphate groups are stabilized by Gly376 and Ser243, respectively. Together, this structure clearly shows that the AMP-PNP-β-phosphate is sticking out of the ATP binding pocket, thus the γ-phosphate group is at the empty space between domain I and domain II and is unconstrained in its movement by the protein. 0.99848014 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP experimental_method MESH: cleaner0 2023-06-29T13:08:39Z soaked 0.9708657 evidence cleaner0 2023-06-29T12:59:03Z DUMMY: crystals 0.9975642 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9987382 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99758816 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.934169 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.997727 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.9949826 evidence cleaner0 2023-06-29T12:40:10Z DUMMY: electron densities chemical CHEBI: cleaner0 2023-06-29T14:07:51Z phosphate 0.99789745 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP chemical CHEBI: cleaner0 2023-06-29T13:47:46Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9224197 complex_assembly cleaner0 2023-06-29T12:47:00Z GO: AMP-PNP-SePSK 0.92574555 complex_assembly cleaner0 2023-06-29T13:37:53Z GO: AMP-PNP-AtXK-1 0.9953816 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures chemical CHEBI: cleaner0 2023-06-29T14:07:09Z ATP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9985719 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP chemical CHEBI: cleaner0 2023-06-29T14:07:22Z sugar 0.9363319 protein_type cleaner0 2023-06-29T13:01:53Z MESH: kinases 0.99482995 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99865365 chemical cleaner0 2023-06-29T13:45:06Z CHEBI: ADP 0.99787015 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.92048323 complex_assembly cleaner0 2023-06-29T13:37:58Z GO: AMP-PNP-AtXK-1 0.80632174 complex_assembly cleaner0 2023-06-29T12:40:00Z GO: ADP-AtXK-1 complex_assembly GO: cleaner0 2023-06-29T12:38:21Z ADP-SePSK 0.858922 complex_assembly cleaner0 2023-06-29T12:47:00Z GO: AMP-PNP-SePSK 0.99605405 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.993999 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9145252 complex_assembly cleaner0 2023-06-29T12:47:00Z GO: AMP-PNP-SePSK 0.95755285 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99582964 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.99785537 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.93380296 structure_element cleaner0 2023-06-29T12:39:03Z SO: domain II 0.99633616 site cleaner0 2023-06-29T14:01:22Z SO: positively charged groove 0.99805367 site cleaner0 2023-06-29T14:02:11Z SO: AMP-PNP binding pocket 0.9860923 structure_element cleaner0 2023-06-29T13:55:23Z SO: four α-helices 0.9966859 structure_element cleaner0 2023-06-29T13:55:25Z SO: α26 0.99637395 structure_element cleaner0 2023-06-29T13:55:27Z SO: α28 0.9963959 structure_element cleaner0 2023-06-29T13:55:30Z SO: α27 0.99632263 structure_element cleaner0 2023-06-29T13:55:32Z SO: α30 protein_state DUMMY: cleaner0 2023-06-29T13:56:12Z shape resembling a half-fist 0.9978635 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.91757286 site cleaner0 2023-06-29T14:01:27Z SO: pocket 0.99911684 residue_name_number cleaner0 2023-06-29T13:40:05Z DUMMY: Trp383 0.99911386 residue_name_number cleaner0 2023-06-29T13:40:07Z DUMMY: Asn380 0.9991211 residue_name_number cleaner0 2023-06-29T13:40:10Z DUMMY: Gly376 0.99910307 residue_name_number cleaner0 2023-06-29T13:40:12Z DUMMY: Gly377 0.997886 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.9991265 residue_name_number cleaner0 2023-06-29T13:40:15Z DUMMY: Trp383 0.9991429 residue_name_number cleaner0 2023-06-29T13:40:17Z DUMMY: Asn380 0.9977692 chemical cleaner0 2023-06-29T12:40:24Z CHEBI: AMP-PNP 0.99663115 structure_element cleaner0 2023-06-29T13:56:17Z SO: hinge region 0.99869126 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.99915516 residue_name_number cleaner0 2023-06-29T13:40:20Z DUMMY: Gly376 0.9991394 residue_name_number cleaner0 2023-06-29T13:40:22Z DUMMY: Ser243 0.99610484 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.99785566 site cleaner0 2023-06-29T14:02:14Z SO: ATP binding pocket chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9083584 structure_element cleaner0 2023-06-29T12:45:50Z SO: domain I 0.8696945 structure_element cleaner0 2023-06-29T12:39:04Z SO: domain II pone.0156067.g003.jpg pone.0156067.g003 FIG fig_title_caption 13053 Structure of SePSK in complex with AMP-PNP. 0.99607456 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: Structure 0.99878126 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9349039 protein_state cleaner0 2023-06-29T13:59:21Z DUMMY: in complex with 0.99783736 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP pone.0156067.g003.jpg pone.0156067.g003 FIG fig_caption 13097 (A) The electron density of AMP-PNP. The SePSK structure is shown in the electrostatic potential surface mode. The AMP-PNP is depicted as sticks with its ǀFoǀ-ǀFcǀ map contoured at 3 σ shown as cyan mesh. (B) The AMP-PNP binding pocket. The head of AMP-PNP is sandwiched by four residues (Leu293, Gly376, Gly377 and Trp383). The protein skeleton is shown as cartoon (cyan). The four α-helices (α26, α28, α27 and α30) are labeled in red. The AMP-PNP and coordinated residues are shown as sticks. The interactions between them are represented as black dashed lines. The numerical note near the black dashed line indicates the distance (Å). 0.99501157 evidence cleaner0 2023-06-29T12:58:57Z DUMMY: electron density 0.9978182 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP 0.9988563 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99646336 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.99791497 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP 0.99490136 evidence cleaner0 2023-06-29T12:59:33Z DUMMY: ǀFoǀ-ǀFcǀ map 0.99810237 site cleaner0 2023-06-29T14:02:19Z SO: AMP-PNP binding pocket 0.99770594 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP 0.9989385 residue_name_number cleaner0 2023-06-29T13:40:26Z DUMMY: Leu293 0.9988998 residue_name_number cleaner0 2023-06-29T13:40:29Z DUMMY: Gly376 0.99890697 residue_name_number cleaner0 2023-06-29T13:40:31Z DUMMY: Gly377 0.9988945 residue_name_number cleaner0 2023-06-29T13:40:34Z DUMMY: Trp383 0.9038727 structure_element cleaner0 2023-06-29T13:56:21Z SO: α-helices 0.9949256 structure_element cleaner0 2023-06-29T13:56:23Z SO: α26 0.9944654 structure_element cleaner0 2023-06-29T13:56:26Z SO: α28 0.994235 structure_element cleaner0 2023-06-29T13:56:28Z SO: α27 0.99400276 structure_element cleaner0 2023-06-29T13:56:30Z SO: α30 0.99779725 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP RESULTS title_2 13759 The potential substrate binding site in SePSK 0.99813384 site cleaner0 2023-06-29T14:01:32Z SO: substrate binding site 0.998784 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK RESULTS paragraph 13805 The results from our activity assays suggested that SePSK has D-ribulose kinase activity. To better understand the interaction pattern between SePSK and D-ribulose, the apo-SePSK crystals were soaked into the reservoir with 10 mM D-ribulose (RBL) and the RBL-SePSK structure was solved. As shown in S6 Fig, two residual electron densities are visible in domain I, which can be interpreted as two D-ribulose molecules with reasonable fit. 0.9912284 experimental_method cleaner0 2023-06-29T13:08:46Z MESH: activity assays 0.99871147 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK protein_type MESH: cleaner0 2023-06-29T13:05:04Z D-ribulose kinase 0.99872583 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9973994 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9976351 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9985197 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.81197965 experimental_method cleaner0 2023-06-29T13:10:28Z MESH: crystals were soaked into 0.5801219 experimental_method cleaner0 2023-06-29T13:09:05Z MESH: reservoir 0.9971234 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.76671934 chemical cleaner0 2023-06-29T12:44:15Z CHEBI: RBL 0.96759635 complex_assembly cleaner0 2023-06-29T13:38:03Z GO: RBL-SePSK 0.98671824 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.7476223 experimental_method cleaner0 2023-06-29T13:09:09Z MESH: solved 0.79123193 evidence cleaner0 2023-06-29T12:40:10Z DUMMY: electron densities structure_element SO: cleaner0 2023-06-29T12:45:50Z domain I 0.99729663 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose RESULTS paragraph 14243 As shown in Fig 4A, the nearest distance between the carbon skeleton of two D-ribulose molecules are approx. 7.1 Å (RBL1-C4 and RBL2-C1). RBL1 is located in the pocket consisting of α21 and the loop between β6 and β7. The O4 and O5 of RBL1 are coordinated with the side chain carboxyl group of Asp221. Furthermore, the O2 of RBL1 interacts with the main chain amide nitrogen of Ser72 (Fig 4B). This pocket is at a similar position of substrate binding site of other sugar kinase, such as L-ribulokinase (PDB code: 3QDK) (S7 Fig). However, structural comparison shows that the substrate ligating residues between the two structures are not strictly conserved. Based on the structures, the ligating residues of RBL1 in RBL-SePSK structure are Ser72, Asp221 and Ser222, and the interacting residues of L-ribulose with L-ribulokinase are Ala96, Lys208, Asp274 and Glu329 (S7 Fig). Glu329 in 3QDK has no counterpart in RBL-SePSK structure. In addition, although Lys208 of L-ribulokinase has the corresponding residue (Lys163) in RBL-SePSK structure, the hydrogen bond of Lys163 is broken because of the conformational change of two α-helices (α9 and α13) of SePSK. These differences might account for their different substrate specificity. 0.99797374 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9956892 residue_name_number cleaner0 2023-06-29T12:51:27Z DUMMY: RBL1 0.9937836 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9795904 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.9959525 site cleaner0 2023-06-29T14:01:36Z SO: pocket 0.9964199 structure_element cleaner0 2023-06-29T13:56:39Z SO: α21 0.99509996 structure_element cleaner0 2023-06-29T13:56:41Z SO: loop 0.96590996 structure_element cleaner0 2023-06-29T13:56:44Z SO: β6 and β7 0.9849681 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.9991665 residue_name_number cleaner0 2023-06-29T13:40:38Z DUMMY: Asp221 0.9860649 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.99916434 residue_name_number cleaner0 2023-06-29T13:40:42Z DUMMY: Ser72 0.9924704 site cleaner0 2023-06-29T14:01:39Z SO: pocket 0.99791 site cleaner0 2023-06-29T14:01:43Z SO: substrate binding site 0.99478817 protein_type cleaner0 2023-06-29T13:01:17Z MESH: sugar kinase 0.58787787 protein cleaner0 2023-06-29T13:06:42Z PR: L-ribulokinase 0.9893616 experimental_method cleaner0 2023-06-29T13:08:03Z MESH: structural comparison 0.984846 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.93839407 protein_state cleaner0 2023-06-29T14:00:12Z DUMMY: not strictly conserved 0.96085685 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99409026 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.98868424 complex_assembly cleaner0 2023-06-29T13:38:07Z GO: RBL-SePSK 0.9924574 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9991571 residue_name_number cleaner0 2023-06-29T13:40:46Z DUMMY: Ser72 0.99915314 residue_name_number cleaner0 2023-06-29T13:40:49Z DUMMY: Asp221 0.99915004 residue_name_number cleaner0 2023-06-29T13:40:51Z DUMMY: Ser222 0.9974332 chemical cleaner0 2023-06-29T12:33:15Z CHEBI: L-ribulose 0.7296011 protein cleaner0 2023-06-29T13:06:42Z PR: L-ribulokinase 0.99916625 residue_name_number cleaner0 2023-06-29T13:40:55Z DUMMY: Ala96 0.99914515 residue_name_number cleaner0 2023-06-29T13:40:58Z DUMMY: Lys208 0.99915195 residue_name_number cleaner0 2023-06-29T13:41:00Z DUMMY: Asp274 0.9991542 residue_name_number cleaner0 2023-06-29T13:41:03Z DUMMY: Glu329 0.9991345 residue_name_number cleaner0 2023-06-29T13:41:06Z DUMMY: Glu329 0.9835308 complex_assembly cleaner0 2023-06-29T13:38:10Z GO: RBL-SePSK 0.99096465 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9991315 residue_name_number cleaner0 2023-06-29T13:41:12Z DUMMY: Lys208 0.6947624 protein cleaner0 2023-06-29T13:06:42Z PR: L-ribulokinase 0.9991339 residue_name_number cleaner0 2023-06-29T13:41:15Z DUMMY: Lys163 0.97491217 complex_assembly cleaner0 2023-06-29T13:38:12Z GO: RBL-SePSK 0.99150014 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.99914443 residue_name_number cleaner0 2023-06-29T13:41:18Z DUMMY: Lys163 0.97993106 structure_element cleaner0 2023-06-29T13:56:47Z SO: α-helices 0.9958072 structure_element cleaner0 2023-06-29T13:56:50Z SO: α9 0.99544024 structure_element cleaner0 2023-06-29T13:56:52Z SO: α13 0.99875915 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK pone.0156067.g004.jpg pone.0156067.g004 FIG fig_title_caption 15500 The binding of D-ribulose (RBL) with SePSK. 0.9978377 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9984383 chemical cleaner0 2023-06-29T12:44:14Z CHEBI: RBL 0.99876654 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK pone.0156067.g004.jpg pone.0156067.g004 FIG fig_caption 15544 (A) The electrostatic potential surface map of RBL-SePSK and a zoom-in view of RBL binding site. The RBL1 and RBL2 are depicted as sticks. (B) Interaction of two D-ribulose molecules (RBL1 and RBL2) with SePSK. The RBL molecules (carbon atoms colored yellow) and amino acid residues of SePSK (carbon atoms colored green) involved in RBL interaction are shown as sticks. The hydrogen bonds are indicated by the black dashed lines and the numbers near the dashed lines are the distances (Å). (C) The binding affinity assays of SePSK with D-ribulose. Single-cycle kinetic data are reflecting the interaction of SePSK and D8A-SePSK with D-ribulose. It shows two experimental sensorgrams after minus the empty sensorgrams. The original data is shown as black curve, and the fitted data is shown as different color (wild type SePSK: red curve, D8A-SePSK: green curve). Dissociation rate constant of wild type and D8A-SePSK are 3 ms-1 and 9 ms-1, respectively. 0.9894691 evidence cleaner0 2023-06-29T12:59:39Z DUMMY: electrostatic potential surface map 0.9804246 complex_assembly cleaner0 2023-06-29T13:38:17Z GO: RBL-SePSK 0.9982365 site cleaner0 2023-06-29T14:02:25Z SO: RBL binding site 0.94320077 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.89772403 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.99795705 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.6757883 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.7007424 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9981646 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK chemical CHEBI: cleaner0 2023-06-29T12:44:15Z RBL 0.9984713 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK chemical CHEBI: cleaner0 2023-06-29T12:44:15Z RBL 0.9919452 experimental_method cleaner0 2023-06-29T13:10:32Z MESH: binding affinity assays 0.99844223 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9978544 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.87909096 experimental_method cleaner0 2023-06-29T13:09:16Z MESH: Single-cycle kinetic data 0.9979601 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK mutant MESH: cleaner0 2023-06-29T12:43:33Z D8A 0.7842108 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9978338 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.98476356 evidence cleaner0 2023-06-29T12:59:45Z DUMMY: sensorgrams 0.9796078 evidence cleaner0 2023-06-29T12:59:45Z DUMMY: sensorgrams 0.9971192 protein_state cleaner0 2023-06-29T12:45:24Z DUMMY: wild type 0.9978951 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK mutant MESH: cleaner0 2023-06-29T12:43:10Z D8A protein PR: cleaner0 2023-06-29T12:44:03Z SePSK 0.9945125 evidence cleaner0 2023-06-29T12:59:51Z DUMMY: Dissociation rate constant 0.9971053 protein_state cleaner0 2023-06-29T12:45:24Z DUMMY: wild type mutant MESH: cleaner0 2023-06-29T12:43:51Z D8A 0.7984277 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK RESULTS paragraph 16499 The binding pocket of RBL2 with relatively weak electron density is near the N-terminal region of SePSK and is negatively charged. The side chain of Asp8 interacts strongly with O3 and O4 of RBL2. The hydroxyl group of Ser12 coordinates with O2 of RBL2. The backbone amide nitrogens of Gly13 and Arg15 also keep hydrogen bonds with RBL2 (Fig 4B). Structural comparison of SePSK and AtXK-1 showed that while the RBL1 binding pocket is conserved, the RBL2 pocket is disrupted in AtXK-1 structure, despite the fact that the residues interacting with RBL2 are highly conserved between the two proteins. In the RBL-SePSK structure, a 2.6 Å hydrogen bond is present between RBL2 and Ser12 (Fig 4B), while in the AtXK-1 structure this hydrogen bond with the corresponding residue (Ser22) is broken. This break is probably induced by the conformational change of the two β-sheets (β1 and β2), with the result that the linking loop (loop 1) is located further away from the RBL2 binding site. This change might be the reason that AtXK-1 only shows limited increasing in its ATP hydrolysis ability upon adding D-ribulose as a substrate after comparing with SePSK (Fig 2C). 0.99783593 site cleaner0 2023-06-29T14:01:48Z SO: binding pocket 0.9875448 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9649341 evidence cleaner0 2023-06-29T12:58:57Z DUMMY: electron density 0.99888295 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99913883 residue_name_number cleaner0 2023-06-29T13:41:22Z DUMMY: Asp8 0.71752113 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9991345 residue_name_number cleaner0 2023-06-29T13:41:26Z DUMMY: Ser12 0.7989556 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9991352 residue_name_number cleaner0 2023-06-29T13:41:29Z DUMMY: Gly13 0.9991284 residue_name_number cleaner0 2023-06-29T13:41:31Z DUMMY: Arg15 0.5216133 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9917146 experimental_method cleaner0 2023-06-29T13:08:03Z MESH: Structural comparison 0.99887604 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99594635 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.998116 site cleaner0 2023-06-29T14:02:31Z SO: RBL1 binding pocket 0.99576545 protein_state cleaner0 2023-06-29T14:00:18Z DUMMY: conserved 0.99765503 site cleaner0 2023-06-29T14:02:34Z SO: RBL2 pocket 0.9941177 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.99615026 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9577052 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.99713546 protein_state cleaner0 2023-06-29T14:00:21Z DUMMY: highly conserved 0.99430466 complex_assembly cleaner0 2023-06-29T13:38:21Z GO: RBL-SePSK 0.9921163 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.64399064 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.99910873 residue_name_number cleaner0 2023-06-29T13:41:39Z DUMMY: Ser12 0.9906059 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.7845717 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9990852 residue_name_number cleaner0 2023-06-29T13:41:42Z DUMMY: Ser22 0.9911086 structure_element cleaner0 2023-06-29T13:56:58Z SO: β-sheets 0.99780756 structure_element cleaner0 2023-06-29T13:57:01Z SO: β1 0.9975147 structure_element cleaner0 2023-06-29T13:57:03Z SO: β2 0.99682295 structure_element cleaner0 2023-06-29T13:57:05Z SO: linking loop 0.99523675 structure_element cleaner0 2023-06-29T13:57:08Z SO: loop 1 0.9978866 site cleaner0 2023-06-29T14:02:38Z SO: RBL2 binding site 0.99623936 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 chemical CHEBI: cleaner0 2023-06-29T12:33:56Z ATP 0.9972736 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9988605 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK RESULTS paragraph 17671 Our SePSK structure shows that the Asp8 residue forms strong hydrogen bond with RBL2 (Fig 4B). In addition, our enzymatic assays indicated that Asp8 is important for the activity of SePSK (Fig 2D). To further verified this result, we measured the binding affinity for D-ribulose of both wild type (WT) and D8A mutant of SePSK using a surface plasmon resonance method. The results showed that the affinity of D8A-SePSK with D-ribulose is weaker than that of WT with a reduction of approx. two third (Fig 4C). Dissociation rate constant (Kd) of wild type and D8A-SePSK are 3 ms-1 and 9 ms-1, respectively. The results implied that the second RBL binding site plays a role in the D-ribulose kinase function of SePSK. However, considering the high concentration of D-ribulose used for crystal soaking, as well as the relatively weak electron density of RBL2, it is also possible that the second binding site of D-ribulose in SePSK is an artifact. 0.99849105 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9971219 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9986168 residue_name_number cleaner0 2023-06-29T13:41:46Z DUMMY: Asp8 0.85944766 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9923231 experimental_method cleaner0 2023-06-29T13:09:20Z MESH: enzymatic assays 0.99869055 residue_name_number cleaner0 2023-06-29T13:41:51Z DUMMY: Asp8 0.9987179 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99342453 evidence cleaner0 2023-06-29T13:00:02Z DUMMY: binding affinity 0.9973588 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.99713755 protein_state cleaner0 2023-06-29T12:45:23Z DUMMY: wild type 0.99644285 protein_state cleaner0 2023-06-29T12:45:29Z DUMMY: WT 0.99761707 mutant cleaner0 2023-06-29T13:39:07Z MESH: D8A 0.6049578 protein_state cleaner0 2023-06-29T14:00:26Z DUMMY: mutant 0.9978137 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9624258 experimental_method cleaner0 2023-06-29T13:09:25Z MESH: surface plasmon resonance method 0.9864738 evidence cleaner0 2023-06-29T13:00:20Z DUMMY: affinity mutant MESH: cleaner0 2023-06-29T12:47:51Z D8A 0.37831542 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9971581 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9970625 protein_state cleaner0 2023-06-29T12:45:29Z DUMMY: WT 0.99627906 evidence cleaner0 2023-06-29T12:59:52Z DUMMY: Dissociation rate constant 0.99015814 evidence cleaner0 2023-06-29T13:00:28Z DUMMY: Kd 0.99728435 protein_state cleaner0 2023-06-29T12:45:24Z DUMMY: wild type mutant MESH: cleaner0 2023-06-29T12:47:32Z D8A 0.852059 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9975878 site cleaner0 2023-06-29T14:02:41Z SO: second RBL binding site protein_type MESH: cleaner0 2023-06-29T12:45:10Z D-ribulose kinase 0.9986615 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99736065 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.99453807 experimental_method cleaner0 2023-06-29T13:09:35Z MESH: crystal soaking 0.99286854 evidence cleaner0 2023-06-29T12:58:57Z DUMMY: electron density 0.45815828 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.99792475 site cleaner0 2023-06-29T14:01:52Z SO: second binding site 0.99537796 chemical cleaner0 2023-06-29T12:31:21Z CHEBI: D-ribulose 0.9986771 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK RESULTS title_2 18614 Simulated conformational change of SePSK during the catalytic process 0.9988053 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK RESULTS paragraph 18684 It was reported earlier that the crossing angle between the domain I and domain II in FGGY family carbohydrate kinases is different. In addition, this difference may be caused by the binding of substrates and/or ATP. As reported previously, members of the sugar kinase family undergo a conformational change to narrow the crossing angle between two domains and reduce the distance between substrate and ATP in order to facilitate the catalytic reaction of phosphorylation of sugar substrates. After comparing structures of apo-SePSK, RBL-SePSK and AMP-PNP-SePSK, we noticed that these structures presented here are similar. Superposing the structures of RBL-SePSK and AMP-PNP-SePSK, the results show that the nearest distance between AMP-PNP γ-phosphate and RBL1/RBL2 is 7.5 Å (RBL1-O5)/6.7 Å (RBL2-O1) (S8 Fig). This distance is too long to transfer the γ-phosphate group from ATP to the substrate. Since the two domains of SePSK are widely separated in this structure, we hypothesize that our structures of SePSK represent its open form, and that a conformational rearrangement must occur to switch to the closed state in order to facilitate the catalytic process of phosphorylation of sugar substrates. structure_element SO: cleaner0 2023-06-29T12:45:50Z domain I structure_element SO: cleaner0 2023-06-29T12:39:04Z domain II 0.99632156 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.99829966 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.99598795 protein_type cleaner0 2023-06-29T13:01:17Z MESH: sugar kinase 0.9983065 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP ptm MESH: cleaner0 2023-06-29T12:31:34Z phosphorylation 0.9965299 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99774003 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9985146 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.8958693 complex_assembly cleaner0 2023-06-29T13:38:25Z GO: RBL-SePSK complex_assembly GO: cleaner0 2023-06-29T12:46:36Z AMP-PNP-SePSK 0.9932585 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99514425 experimental_method cleaner0 2023-06-29T13:09:38Z MESH: Superposing 0.9604764 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.93207264 complex_assembly cleaner0 2023-06-29T13:38:30Z GO: RBL-SePSK complex_assembly GO: cleaner0 2023-06-29T12:47:00Z AMP-PNP-SePSK chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.96116656 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.9353864 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.8891231 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.8204545 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.9982406 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.99869305 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9967721 evidence cleaner0 2023-06-29T12:36:04Z DUMMY: structure 0.9964838 evidence cleaner0 2023-06-29T12:36:09Z DUMMY: structures 0.99859387 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9968291 protein_state cleaner0 2023-06-29T14:00:30Z DUMMY: open 0.9961675 protein_state cleaner0 2023-06-29T14:00:33Z DUMMY: closed ptm MESH: cleaner0 2023-06-29T12:31:34Z phosphorylation RESULTS paragraph 19898 For studying such potential conformational change, a simulation on the Hingeprot Server was performed to predict the movement of different SePSK domains. The results showed that domain I and domain II are closer to each other with Ala228 and Thr401 in A2 as Hinge-residues. Based on the above results, SePSK is divided into two rigid parts. The domain I of RBL-SePSK (aa. 1–228, aa. 402–421) and the domain II of AMP-PNP-SePSK (aa. 229–401) were superposed with structures, including apo-AtXK-1, apo-SePSK, xylulose kinase from Lactobacillus acidophilus (PDB code: 3LL3) and the S58W mutant form of glycerol kinase from Escherichia coli (PDB code: 1GLJ). The results of superposition displayed different crossing angle between these two domains. After superposition, the distances of AMP-PNP γ-phosphate and the fifth hydroxyl group of RBL1 are 7.9 Å (superposed with AtXK-1), 7.4 Å (superposed with SePSK), 6.6 Å (superposed with 3LL3) and 6.1 Å (superposed with 1GLJ). Meanwhile, the distances of AMP-PNP γ-phosphate and the first hydroxyl group of RBL2 are 7.2 Å (superposed with AtXK-1), 6.7 Å (superposed with SePSK), 3.7 Å (superposed with 3LL3), until AMP-PNP γ-phosphate fully contacts RBL2 after superposition with 1GLJ (Fig 5). This distance between RBL2 and AMP-PNP-γ-phosphate is close enough to facilitate phosphate transferring. Together, our superposition results provided snapshots of the conformational changes at different catalytic stages of SePSK and potentially revealed the closed form of SePSK. 0.9933035 experimental_method cleaner0 2023-06-29T13:09:44Z MESH: simulation 0.9314792 experimental_method cleaner0 2023-06-29T13:09:47Z MESH: Hingeprot Server 0.9705146 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.8122375 structure_element cleaner0 2023-06-29T12:45:50Z SO: domain I 0.81924534 structure_element cleaner0 2023-06-29T12:39:04Z SO: domain II 0.99919015 residue_name_number cleaner0 2023-06-29T13:41:56Z DUMMY: Ala228 0.9991621 residue_name_number cleaner0 2023-06-29T13:41:58Z DUMMY: Thr401 0.9935452 structure_element cleaner0 2023-06-29T13:57:16Z SO: A2 structure_element SO: cleaner0 2023-06-29T12:49:01Z Hinge-residues 0.9967945 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.97336656 structure_element cleaner0 2023-06-29T12:45:50Z SO: domain I 0.8564523 complex_assembly cleaner0 2023-06-29T13:38:38Z GO: RBL-SePSK 0.9739439 residue_range cleaner0 2023-06-29T13:43:01Z DUMMY: 1–228 0.9688861 residue_range cleaner0 2023-06-29T13:43:03Z DUMMY: 402–421 0.9628848 structure_element cleaner0 2023-06-29T12:39:04Z SO: domain II complex_assembly GO: cleaner0 2023-06-29T12:47:00Z AMP-PNP-SePSK 0.9754912 residue_range cleaner0 2023-06-29T13:43:06Z DUMMY: 229–401 0.9953492 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed evidence DUMMY: cleaner0 2023-06-29T12:36:10Z structures 0.9979248 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.98395985 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9979678 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9985403 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.6744378 protein_type cleaner0 2023-06-29T13:01:30Z MESH: xylulose kinase 0.99515074 species cleaner0 2023-06-29T13:06:00Z MESH: Lactobacillus acidophilus 0.99639267 mutant cleaner0 2023-06-29T13:39:12Z MESH: S58W 0.98757553 protein_state cleaner0 2023-06-29T14:00:36Z DUMMY: mutant 0.82658494 protein_type cleaner0 2023-06-29T13:01:37Z MESH: glycerol kinase 0.995497 species cleaner0 2023-06-29T13:05:53Z MESH: Escherichia coli 0.99414694 experimental_method cleaner0 2023-06-29T13:07:51Z MESH: superposition 0.99029946 experimental_method cleaner0 2023-06-29T13:07:51Z MESH: superposition chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.47843257 residue_name_number cleaner0 2023-06-29T12:51:28Z DUMMY: RBL1 0.9856103 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed 0.973536 protein cleaner0 2023-06-29T12:30:10Z PR: AtXK-1 0.9896381 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed 0.9963516 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9665063 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed 0.96540505 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.65726316 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9834472 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed 0.97864777 protein cleaner0 2023-06-29T12:30:11Z PR: AtXK-1 0.9775199 experimental_method cleaner0 2023-06-29T13:09:52Z MESH: superposed 0.99551105 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9601499 experimental_method cleaner0 2023-06-29T13:09:53Z MESH: superposed chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate 0.47177985 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 0.9726828 experimental_method cleaner0 2023-06-29T13:07:51Z MESH: superposition 0.5351513 residue_name_number cleaner0 2023-06-29T12:51:47Z DUMMY: RBL2 chemical CHEBI: cleaner0 2023-06-29T13:47:47Z AMP-PNP chemical CHEBI: cleaner0 2023-06-29T14:07:52Z phosphate chemical CHEBI: cleaner0 2023-06-29T13:58:27Z phosphate 0.9943678 experimental_method cleaner0 2023-06-29T13:07:51Z MESH: superposition 0.99855286 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99732554 protein_state cleaner0 2023-06-29T14:00:39Z DUMMY: closed 0.99819595 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK pone.0156067.g005.jpg pone.0156067.g005 FIG fig_title_caption 21433 Simulated conformational change of SePSK during the catalytic process. 0.99879944 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK pone.0156067.g005.jpg pone.0156067.g005 FIG fig_caption 21504 The structures are shown as cartoon and the ligands are shown as sticks. Domain I from D-ribulose-SePSK (green) and Domain II from AMP-PNP-SePSK (cyan) are superposed with apo-AtXK-1 (1st), apo-SePSK (2nd), 3LL3 (3rd) and 1GLJ (4th), respectively. The numbers near the black dashed lines show the distances (Å) between two nearest atoms of RBL and AMP-PNP. 0.9796005 evidence cleaner0 2023-06-29T12:36:10Z DUMMY: structures 0.71441394 structure_element cleaner0 2023-06-29T12:45:50Z SO: Domain I complex_assembly GO: cleaner0 2023-06-29T12:53:01Z D-ribulose-SePSK 0.7680092 structure_element cleaner0 2023-06-29T12:39:04Z SO: Domain II complex_assembly GO: cleaner0 2023-06-29T12:47:00Z AMP-PNP-SePSK 0.99386805 experimental_method cleaner0 2023-06-29T13:09:53Z MESH: superposed 0.99759597 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9718533 protein cleaner0 2023-06-29T12:30:11Z PR: AtXK-1 0.9976769 protein_state cleaner0 2023-06-29T12:30:33Z DUMMY: apo 0.9985405 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9970982 chemical cleaner0 2023-06-29T12:44:15Z CHEBI: RBL 0.9981644 chemical cleaner0 2023-06-29T12:40:25Z CHEBI: AMP-PNP RESULTS paragraph 21862 In summary, our structural and enzymatic analyses provide evidence that SePSK shows D-ribulose kinase activity, and exhibits the conserved features of FGGY family carbohydrate kinases. Three conserved residues in SePSK were identified to be essential for this function. Our results provide the detailed information about the interaction of SePSK with ATP and substrates. Moreover, structural superposition results enable us to visualize the conformational change of SePSK during the catalytic process. In conclusion, our results provide important information for a more detailed understanding of the mechanisms of SePSK and other members of FGGY family carbohydrate kinases. 0.9951409 experimental_method cleaner0 2023-06-29T13:10:02Z MESH: structural and enzymatic analyses 0.99875736 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK protein_type MESH: cleaner0 2023-06-29T12:53:50Z D-ribulose kinase 0.9950805 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases 0.29086307 site cleaner0 2023-06-29T14:01:57Z SO: conserved 0.99886703 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.998818 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9985494 chemical cleaner0 2023-06-29T12:33:56Z CHEBI: ATP 0.9941108 experimental_method cleaner0 2023-06-29T13:10:37Z MESH: structural superposition 0.99877065 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.9988788 protein cleaner0 2023-06-29T12:30:04Z PR: SePSK 0.99508905 protein_type cleaner0 2023-06-29T12:31:09Z MESH: FGGY family carbohydrate kinases METHODS title_1 22537 Materials and Methods METHODS title_2 22559 Cloning, expression and purification of SePSK METHODS paragraph 22605 The gene encoding SePSK was amplified by polymerase chain reaction (PCR) with forward primer 5' CATGCCATGGGCATGGTCGTTGCACTTGGCCTCG 3' containing an internal Nco I restriction site (underlined) and reverse primer 5' CCGCTCGAGGGTTCTCTTTAACCCCGCCG 3' including an internal Xho I restriction site (underlined) from Synechococcus elongatus PCC 7942 genomic DNA. The amplified PCR product was digested with Nco I and Xho I (Takara) and ligated into linearized pET28-a vector (Novagen) between Nco I and Xho I restriction sites with a C-terminal his6 tag. The recombinant plasmids were transformed into competent Escherichia coli Trans10 cells for DNA production and purification, and the final constructs were verified by sequencing. The recombinant vectors were transformed into Escherichia coli BL21 (DE3) to express the protein. After induction with the 1 mM IPTG at 289 K in Luria-Bertani medium until the cell density reached an OD 600 nm of 0.6–0.8, the cells were harvested by centrifugation at 6,000 g at 4°C for 15 min, re-suspended in buffer A (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5 mM imidazole) and disrupted by sonication. After centrifuge 40,000 g for 30 min, the protein was purified by passage through a Ni2+ affinity column in buffer A, and then washed the unbound protein with buffer B (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 60 mM imidazole), and eluted the fraction with the buffer C (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 500 mM imidazole). After that, the protein was further purified by size exclusion chromatography with Superdex 200 10/300 GL (GE Healthcare) equilibrated with the buffer D (20 mM Tris-HCl, pH 8.0, 300 mM NaCl). The eluted major peak fraction was concentrated to 20 mg/mL protein using 10,000 MCWO centrifugal filter units (Millipore) and stored at -80°C for crystallization trials. The purified product was analyzed by SDS-PAGE with a single band visible only. METHODS title_2 24505 Cloning, expression and purification of AtXK-1 METHODS paragraph 24552 The gene encoding AtXK-1 was amplified by PCR using a forward primer 5' TACTTCCAATCCAATGCTGTTATGAGTGGCAATAAAGGAACGA 3' and reverse primer 5' TTATCCACTTCCAATGTTACAAACCACTGTTCTGTTTTGCGCCC 3' from cDNA library of Arabidopsis thaliana. The underlined nucleotides were used for the ligation-independent cloning. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans10 cells. The recombinant vectors were transformed into Escherichia coli BL21 (DE3) for protein expression. After induction with 1 mM IPTG at 289 K in Luria-Bertani medium, cells were grown until the cell density reached an OD 600 nm of 0.6–0.8. Subsequent purification was identical to that used for SePSK, except that there was one additional step, during which tobacco etch virus protease was used to digest the crude AtXK-1 protein for removal of the N-terminal his6 tag following Ni2+ affinity purification. Ni2+ affinity column buffer contained extra 20% glycerol. The protein was further purified by size exclusion chromatography with Superdex 200 10/300 GL (GE Healthcare) in elution buffer consisting of 20 mM HEPES, pH 7.5, 100 mM NaCl. Finally, AtXK-1 protein was concentrated to 40 mg/mL protein using 10,000 MCWO centrifugal filter units (Millipore) and stored at -80°C prior to crystallization trials. Purity was verified by SDS-PAGE with a single band visible only. METHODS title_2 26192 Site-directed mutagenesis of SePSK METHODS paragraph 26227 The gene of D8A and T11A mutations were amplified by PCR with the forward primer 5' CATGCCATGGGCATGGTCGTTGCACTTGGCCTCGCCTTCGGCAC 3' and forward primer 5' CATGCCATGGGCATGGTCGTTGCACTTGGCCTCGACTTCGGCGCCTCTGGAGCCC 3' (mismatched base pairs are underlined). The reverse primers of D8A and T11A mutants, the further constructions and purification procedures were identical with those used for wild type SePSK. METHODS paragraph 26631 The N-terminal sequence of D221A was amplified with forward primer (T7 promoter primer) 5' TAATACGACTCACTATA 3' and reverse primer 5' AGCAGCAATGCTAGCCGTTGTACCG 3’, and the C-terminal sequence of D221A was amplified with forward primer 5' TGCCGGTACAACGGCTAGCATTGCT 3' and reverse primer (T7 terminator primer) CGATCAATAACGAGTCGCC (mismatched base pairs are underlined). The second cycle PCR used the above PCR products as templates, and the construction and purification procedures were identical to those used for wild type SePSK. METHODS title_2 27164 Crystallization and data collection METHODS paragraph 27200 Crystallization trials of SePSK and AtXK-1 were carried out at 281 K by mixing equal volume of 20 mg/ml protein and reservoir solution with the sitting-drop vapor diffusion method. The reservoir solution was PEG Rx I-35 (0.1 M BIS-TRIS pH 6.5, 20% w/v Polyethylene glycol monomethyl ether 5,000) (Hampton research). After 2 or 3 days, the rod-like crystals could be observed. For phasing, the high-quality apo-SePSK crystals were soaked in mother liquor containing 1 mM ethylmercuricthiosalicylic acid, sodium salt (Hampton research, heavy atom kit) overnight at 281 K. In order to get the complexes with ATP and AMP-PNP, the crystals of apo-SePSK and apo-AtXK-1 were incubated with the reservoir including 10 mM ATP and 20 mM MgCl2 as well as 10 mM AMP-PNP and 20 mM MgCl2, respectively. The apo-SePSK crystals were incubated with the reservoir including 10 mM D-ribulose in order to obtain the complex D-ribulose-bound SePSK (RBL-SePSK). The crystals of three mutants (D8A, T11A and D221A) grew in the same condition as that of the wild type SePSK. The crystals were dipped into reservoir solution supplemented with 15% glycerol and then flash frozen in a nitrogen gas stream at 100 K. All data sets were collected at Shanghai Synchrotron Radiation Facility, Photo Factory in Japan and Institute of Biophysics, Chinese Academy of Sciences. Diffraction data were processed using the HKL2000 package. METHODS title_2 28601 Structure determination and refinement METHODS paragraph 28640 The initial phases of SePSK were obtained from the Hg-derivative crystals by single isomorphous replacement anomalous scattering (SIRAS) using AutoSol from the PHENIX suite. AutoBuild from the PHENIX suite was used to build 75% of the main chain of apo-SePSK, and the remaining residues were built manually by Coot. All other structures were solved by molecular replacement method using apo-SePSK as an initial model. The model was refined using phenix.refine and REFMAC5. The final model was checked with PROCHECK. All structural figures were prepared by PyMOL. The summary of the data-collection and structure-refinement statistics is shown in Table 1 and S1 Table. Atomic coordinates and structure factors in this article have been deposited in the Protein Data Bank. The deposited codes of all structures listed in the Table 1 and S1 Table. pone.0156067.t001.xml pone.0156067.t001 TABLE table_title_caption 29485 Data collection and refinement statistics. pone.0156067.t001.xml pone.0156067.t001 TABLE table <?xml version="1.0" encoding="UTF-8"?> <table frame="hsides" rules="groups"><colgroup span="1"><col align="left" valign="middle" span="1"/><col align="left" valign="middle" span="1"/><col align="left" valign="middle" span="1"/><col align="left" valign="middle" span="1"/><col align="left" valign="middle" span="1"/><col align="left" valign="middle" span="1"/></colgroup><thead><tr><th align="justify" rowspan="1" colspan="1">Data set</th><th align="justify" rowspan="1" colspan="1">Hg-SePSK</th><th align="justify" rowspan="1" colspan="1">apo-SePSK</th><th align="justify" rowspan="1" colspan="1">AMP-PNP-SePSK</th><th align="justify" rowspan="1" colspan="1">RBL-SePSK</th><th align="justify" rowspan="1" colspan="1">apo-AtXK-1</th></tr></thead><tbody><tr><td align="justify" rowspan="1" colspan="1">Data collection</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/></tr><tr><td align="justify" rowspan="1" colspan="1">Space group</td><td align="justify" rowspan="1" colspan="1">C 1 2 1</td><td align="justify" rowspan="1" colspan="1">C 1 2 1</td><td align="justify" rowspan="1" colspan="1">C 1 2 1</td><td align="justify" rowspan="1" colspan="1">C 1 2 1</td><td align="justify" rowspan="1" colspan="1">P21</td></tr><tr><td align="justify" rowspan="1" colspan="1">Wavelength (Å)</td><td align="justify" rowspan="1" colspan="1">1.54178</td><td align="justify" rowspan="1" colspan="1">1.54178</td><td align="justify" rowspan="1" colspan="1">1.54178</td><td align="justify" rowspan="1" colspan="1">1.54178</td><td align="justify" rowspan="1" colspan="1">1.54178</td></tr><tr><td align="justify" rowspan="1" colspan="1">Cell parameters</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/></tr><tr><td align="justify" rowspan="1" colspan="1">a/b/c(Å)</td><td align="justify" rowspan="1" colspan="1">103.1, 46.6, 88.3</td><td align="justify" rowspan="1" colspan="1">110.2, 49.0, 86.9</td><td align="justify" rowspan="1" colspan="1">103.5, 46.6, 88.0</td><td align="justify" rowspan="1" colspan="1">102.6, 47.0, 88.7</td><td align="justify" rowspan="1" colspan="1">49.7, 87.9, 53.6</td></tr><tr><td align="justify" rowspan="1" colspan="1">α/β/γ(°)</td><td align="justify" rowspan="1" colspan="1">90.0, 91.9, 90.0</td><td align="justify" rowspan="1" colspan="1">90.0, 110.3, 90.0</td><td align="justify" rowspan="1" colspan="1">90.0, 91.0, 90.0</td><td align="justify" rowspan="1" colspan="1">90.0, 91.4, 90.0</td><td align="justify" rowspan="1" colspan="1">90.0, 97.0, 90.0</td></tr><tr><td align="justify" rowspan="1" colspan="1">Resolution (Å)<xref ref-type="table-fn" rid="t001fn001">^a</xref></td><td align="justify" rowspan="1" colspan="1">50.00–2.20(2.28–2.20)</td><td align="justify" rowspan="1" colspan="1">50.00–2.30(2.38–2.30)</td><td align="justify" rowspan="1" colspan="1">50.00–2.30(2.38–2.30)</td><td align="justify" rowspan="1" colspan="1">50.00–2.35(2.43–2.35)</td><td align="justify" rowspan="1" colspan="1">50.00–2.00(2.07–2.00)</td></tr><tr><td align="justify" rowspan="1" colspan="1">R merge<xref ref-type="table-fn" rid="t001fn002">^b</xref></td><td align="justify" rowspan="1" colspan="1">0.105(0.514)</td><td align="justify" rowspan="1" colspan="1">0.149(0.501)</td><td align="justify" rowspan="1" colspan="1">0.082(0.503)</td><td align="justify" rowspan="1" colspan="1">0.095(0.507)</td><td align="justify" rowspan="1" colspan="1">0.106(0.454)</td></tr><tr><td align="justify" rowspan="1" colspan="1">〈 I/σ(I)〉</td><td align="justify" rowspan="1" colspan="1">28.89(4.07)</td><td align="justify" rowspan="1" colspan="1">13.85(4.10)</td><td align="justify" rowspan="1" colspan="1">10.18(1.79)</td><td align="justify" rowspan="1" colspan="1">19.4(4.6)</td><td align="justify" rowspan="1" colspan="1">12.91(4.08)</td></tr><tr><td align="justify" rowspan="1" colspan="1">Completeness (%)</td><td align="justify" rowspan="1" colspan="1">92.3(99.2)</td><td align="justify" rowspan="1" colspan="1">96.1(94.2)</td><td align="justify" rowspan="1" colspan="1">98.9(99.8)</td><td align="justify" rowspan="1" colspan="1">99.8(100.0)</td><td align="justify" rowspan="1" colspan="1">97.1(94.5)</td></tr><tr><td align="justify" rowspan="1" colspan="1">Redundancy</td><td align="justify" rowspan="1" colspan="1">6.7(5.1)</td><td align="justify" rowspan="1" colspan="1">7.4(7.5)</td><td align="justify" rowspan="1" colspan="1">2.4(2.4)</td><td align="justify" rowspan="1" colspan="1">6.9(6.7)</td><td align="justify" rowspan="1" colspan="1">7.2(6.9)</td></tr><tr><td align="justify" rowspan="1" colspan="1">Refinement statistics</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/></tr><tr><td align="justify" rowspan="1" colspan="1">Resolution (Å)</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">32.501–2.301</td><td align="justify" rowspan="1" colspan="1">24.707–2.300</td><td align="justify" rowspan="1" colspan="1">24.475–2.344</td><td align="justify" rowspan="1" colspan="1">23.771–1.998</td></tr><tr><td align="justify" rowspan="1" colspan="1">R_work/ R_free<xref ref-type="table-fn" rid="t001fn003">^c</xref></td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">0.1834/0.2276</td><td align="justify" rowspan="1" colspan="1">0.1975/0.2327</td><td align="justify" rowspan="1" colspan="1">0.2336/0.2687</td><td align="justify" rowspan="1" colspan="1">0.1893/0.2161</td></tr><tr><td align="justify" rowspan="1" colspan="1">No. atoms</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/></tr><tr><td align="justify" rowspan="1" colspan="1">Protein</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">3503</td><td align="justify" rowspan="1" colspan="1">3196</td><td align="justify" rowspan="1" colspan="1">3209</td><td align="justify" rowspan="1" colspan="1">3256</td></tr><tr><td align="justify" rowspan="1" colspan="1">ligand/ion</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">-</td><td align="justify" rowspan="1" colspan="1">31</td><td align="justify" rowspan="1" colspan="1">20</td><td align="justify" rowspan="1" colspan="1">-</td></tr><tr><td align="justify" rowspan="1" colspan="1">Water</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">313</td><td align="justify" rowspan="1" colspan="1">146</td><td align="justify" rowspan="1" colspan="1">143</td><td align="justify" rowspan="1" colspan="1">486</td></tr><tr><td align="justify" rowspan="1" colspan="1">RMSD Bond lengths (Å)<xref ref-type="table-fn" rid="t001fn004">^d</xref></td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">0.003</td><td align="justify" rowspan="1" colspan="1">0.005</td><td align="justify" rowspan="1" colspan="1">0.003</td><td align="justify" rowspan="1" colspan="1">0.003</td></tr><tr><td align="justify" rowspan="1" colspan="1">RMSD Bond angles (°)<xref ref-type="table-fn" rid="t001fn004">^d</xref></td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">0.674</td><td align="justify" rowspan="1" colspan="1">0.886</td><td align="justify" rowspan="1" colspan="1">0.649</td><td align="justify" rowspan="1" colspan="1">0.838</td></tr><tr><td align="justify" rowspan="1" colspan="1">Ramachandran plot (%)</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1"/></tr><tr><td align="justify" rowspan="1" colspan="1">favoured</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">98.1</td><td align="justify" rowspan="1" colspan="1">97.8</td><td align="justify" rowspan="1" colspan="1">96.7</td><td align="justify" rowspan="1" colspan="1">99.1</td></tr><tr><td align="justify" rowspan="1" colspan="1">allowed</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">1.9</td><td align="justify" rowspan="1" colspan="1">2.2</td><td align="justify" rowspan="1" colspan="1">3.3</td><td align="justify" rowspan="1" colspan="1">0.9</td></tr><tr><td align="justify" rowspan="1" colspan="1">disallowed</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">0.0</td><td align="justify" rowspan="1" colspan="1">0.0</td><td align="justify" rowspan="1" colspan="1">0.0</td><td align="justify" rowspan="1" colspan="1">0.0</td></tr><tr><td align="justify" rowspan="1" colspan="1">PDB code</td><td align="justify" rowspan="1" colspan="1"/><td align="justify" rowspan="1" colspan="1">5HTN</td><td align="justify" rowspan="1" colspan="1">5HTP</td><td align="justify" rowspan="1" colspan="1">5HV7</td><td align="justify" rowspan="1" colspan="1">5HTR</td></tr></tbody></table> 29528 Data set Hg-SePSK apo-SePSK AMP-PNP-SePSK RBL-SePSK apo-AtXK-1 Data collection Space group C 1 2 1 C 1 2 1 C 1 2 1 C 1 2 1 P21 Wavelength (Å) 1.54178 1.54178 1.54178 1.54178 1.54178 Cell parameters a/b/c(Å) 103.1, 46.6, 88.3 110.2, 49.0, 86.9 103.5, 46.6, 88.0 102.6, 47.0, 88.7 49.7, 87.9, 53.6 α/β/γ(°) 90.0, 91.9, 90.0 90.0, 110.3, 90.0 90.0, 91.0, 90.0 90.0, 91.4, 90.0 90.0, 97.0, 90.0 Resolution (Å)a 50.00–2.20(2.28–2.20) 50.00–2.30(2.38–2.30) 50.00–2.30(2.38–2.30) 50.00–2.35(2.43–2.35) 50.00–2.00(2.07–2.00) R mergeb 0.105(0.514) 0.149(0.501) 0.082(0.503) 0.095(0.507) 0.106(0.454) 〈 I/σ(I)〉 28.89(4.07) 13.85(4.10) 10.18(1.79) 19.4(4.6) 12.91(4.08) Completeness (%) 92.3(99.2) 96.1(94.2) 98.9(99.8) 99.8(100.0) 97.1(94.5) Redundancy 6.7(5.1) 7.4(7.5) 2.4(2.4) 6.9(6.7) 7.2(6.9) Refinement statistics Resolution (Å) 32.501–2.301 24.707–2.300 24.475–2.344 23.771–1.998 Rwork/ Rfreec 0.1834/0.2276 0.1975/0.2327 0.2336/0.2687 0.1893/0.2161 No. atoms Protein 3503 3196 3209 3256 ligand/ion - 31 20 - Water 313 146 143 486 RMSD Bond lengths (Å)d 0.003 0.005 0.003 0.003 RMSD Bond angles (°)d 0.674 0.886 0.649 0.838 Ramachandran plot (%) favoured 98.1 97.8 96.7 99.1 allowed 1.9 2.2 3.3 0.9 disallowed 0.0 0.0 0.0 0.0 PDB code 5HTN 5HTP 5HV7 5HTR pone.0156067.t001.xml pone.0156067.t001 TABLE table_footnote 30913 a The values in parentheses correspond to the highest resolution shell. pone.0156067.t001.xml pone.0156067.t001 TABLE table_footnote 30985 b Rmerge = ∑j∑h|Ij,h-<Ih>|/∑j∑h<Ih> where h are unique reflection indices and Ij,h are intensities of symmetry-related reflections and <Ih> is the mean intensity. pone.0156067.t001.xml pone.0156067.t001 TABLE table_footnote 31156 c R-work and R-free were calculated as follows: R = Σ (|Fobs-Fcalc|)/Σ |Fobs| ×100, where Fobs and Fcalc are the observed and calculated structure factor amplitudes, respectively. pone.0156067.t001.xml pone.0156067.t001 TABLE table_footnote 31344 d Root mean square deviations (r.m.s.d.) from standard values. METHODS title_2 31407 ADP-Glo kinase assay METHODS paragraph 31428 ADP-Glo kinase assay was used according to the manufacturer’s instructions (Promega). Each reaction mixture system consisted of 8 uM enzyme, 100 uM ATP, 1 mM MgCl2, 20 mM HEPES (pH 7.4), 5 mM substrate. The reaction was initiated by adding the purified enzyme into the reaction system. After incubation at 298 K for different time, equal volume ADP-Glo™ reagent was added to terminate the kinase reaction and to deplete any remaining ATP. Subsequently, kinase detection reagent with double volume of reaction system was added to convert ADP to ATP and allowed the newly synthesized ATP to be measured using a luciferase/luciferin reaction which produced luminescence signal and could be recorded. After incubation at room temperature for another 60 min, luminescence was detected by Varioskan Flash Multimode Reader (Thermo). The reference experiment was carried out in the same reaction system without the enzyme. For each assay, at least three repeats were performed for the calculation of mean values and standard deviations (SDs). The purity of five substrates in the activity assays was ≥98% (D-ribulose, Santa cruz), 99.7% (L-ribulose, Carbosynth), 99.3% (D-xylulose, Carbosynth), 99.5% (L-xylulose, Carbosynth) and 99.0% (Glycerol, AMRESCO). METHODS title_2 32683 Surface plasmon resonance METHODS paragraph 32709 Surface plasmon resonance (SPR) was used to analyze the interaction of SePSK and D-ribulose. The SPR experiments were performed on a Biacore T100 system using series S CM5 sensor chips (GE Healthcare). All sensorgrams were recorded at 298 K. The proteins in buffer containing 20 mM HEPES, pH 7.5, 100 mM NaCl, was diluted to 40 ug/ml by 10 mM sodium acetate buffer at pH 4.5. All flow cells on a CM5 sensor chip were activated with a freshly prepared solution of 0.2 M 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and 0.05 M N-hydroxysuccinimide (NHS) in a ratio of 1:1 at a constant flow rate of 10 ul/min for 420 s. Deactivation of the surface was performed with an injection of a 1 M solution of ethanolamine-HCl (pH 8.5) using the same flow rate and duration. Kinetic parameters were derived from data sets acquired in single-cycle mode. Each run consisted of five consecutive analytic injections at 125, 250, 500, 1000 and 2000 uM. Analytic injections lasted for 60 s, separated by 30 s dissociation periods. Each cycle was completed with an extended dissociation period of 300 s. The specific binding to a blank flow cell was subtracted to obtain corrected sensorgrams. Biacore data were analyzed using BiaEvaluation software (GE Healthcare) by fitting to a 1:1 Langmuir binding fitting model. METHODS title_2 34017 Accession Codes METHODS paragraph 34033 Coordinates and structure factors for all the structures in this article have been deposited in the Protein Data Bank. These accession codes are 5HTN, 5HTP, 5HUX, 5HV7, 5HTJ, 5HU2, 5HTY, 5HTR, 5HTV and 5HTX. The corresponding-structures are apo-SePSK, AMP-PNP-SePSK, ADP-SePSK, RBL-SePSK, D8A-SePSK, T11A-SePSK, D221A-SePSK, apo-AtXK1, AMP-PNP-AtXK1 and ADP-AtXK1, respectively. SUPPL title_1 34412 Supporting Information REF title 34435 References e1002318 12 surname:Zhang;given-names:Y surname:Zagnitko;given-names:O surname:Rodionova;given-names:I surname:Osterman;given-names:A surname:Godzik;given-names:A 10.1371/journal.pcbi.1002318 22215998 REF PLoS computational biology ref 7 2011 34446 The FGGY carbohydrate kinase family: insights into the evolution of functional specificities 1643 3 52 surname:Bunker;given-names:RD surname:Bulloch;given-names:EM surname:Dickson;given-names:JM surname:Loomes;given-names:KM surname:Baker;given-names:EN 10.1074/jbc.M112.427997 23179721 REF Journal of Biological Chemistry ref 288 2013 34539 Structure and function of human xylulokinase, an enzyme with important roles in carbohydrate metabolism 261 1 8 surname:Agarwal;given-names:R surname:Burley;given-names:SK surname:Swaminathan;given-names:S 10.1002/prot.23202 22072612 REF Proteins ref 80 2012 34643 Structural insight into mechanism and diverse substrate selection strategy of L-ribulokinase 783 3 98 surname:Di Luccio;given-names:E surname:Petschacher;given-names:B surname:Voegtli;given-names:J surname:Chou;given-names:H-T surname:Stahlberg;given-names:H surname:Nidetzky;given-names:B 17123542 REF Journal of molecular biology ref 365 2007 34736 Structural and Kinetic Studies of Induced Fit in Xylulose Kinase from Escherichia coli 978 5 84 surname:Emanuelsson;given-names:O surname:Nielsen;given-names:H surname:Von Heijne;given-names:G 10338008 REF Protein Sci ref 8 1999 34823 ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites 441 2 57 surname:Hemmerlin;given-names:A surname:Tritsch;given-names:D surname:Hartmann;given-names:M surname:Pacaud;given-names:K surname:Hoeffler;given-names:J-F surname:van Dorsselaer;given-names:A 16920870 REF Plant physiology ref 142 2006 34931 A cytosolic Arabidopsis D-xylulose kinase catalyzes the phosphorylation of 1-deoxy-D-xylulose into a precursor of the plastidial isoprenoid pathway 3508 12 18 surname:Bystrom;given-names:CE surname:Pettigrew;given-names:DW surname:Branchaud;given-names:BP surname:O'Brien;given-names:P surname:Remington;given-names:SJ 10090737 REF Biochemistry ref 38 1999 35079 Crystal structures of Escherichia coli glycerol kinase variant S58→ W in complex with nonhydrolyzable ATP analogues reveal a putative active conformation of the enzyme as a result of domain motion 1407 11 18 surname:Feese;given-names:MD surname:Faber;given-names:HR surname:Bystrom;given-names:CE surname:Pettigrew;given-names:DW surname:Remington;given-names:SJ 9817843 REF Structure ref 6 1998 35278 Glycerol kinase from Escherichia coli and an Ala65→ Thr mutant: the crystal structures reveal conformational changes with implications for allosteric regulation 787 3 97 surname:Grueninger;given-names:D surname:Schulz;given-names:GE 16674975 REF Journal of molecular biology ref 359 2006 35441 Structure and Reaction Mechanism of l-Rhamnulose Kinase from Escherichia coli 1469 7 82 surname:Higgins;given-names:MA surname:Suits;given-names:MD surname:Marsters;given-names:C surname:Boraston;given-names:AB 10.1016/j.jmb.2013.12.006 24333485 REF Journal of molecular biology ref 426 2014 35519 Structural and Functional Analysis of Fucose-Processing Enzymes from Streptococcus pneumoniae 236 2 45 surname:Pettigrew;given-names:DW surname:Smith;given-names:GB surname:Thomas;given-names:KP surname:D'Nette;given-names:CD 9448710 REF Archives of biochemistry and biophysics ref 349 1998 35613 Conserved active site aspartates and domain–domain interactions in regulatory properties of the sugar kinase superfamily 136 1 47 surname:Karlsson;given-names:R surname:Katsamba;given-names:PS surname:Nordin;given-names:H surname:Pol;given-names:E surname:Myszka;given-names:DG 16337141 REF Analytical biochemistry ref 349 2006 35736 Analyzing a kinetic titration series using affinity biosensors 362 2 73 surname:Yeh;given-names:JI surname:Charrier;given-names:V surname:Paulo;given-names:J surname:Hou;given-names:L surname:Darbon;given-names:E surname:Claiborne;given-names:A 14717590 REF Biochemistry ref 43 2004 35799 Structures of enterococcal glycerol kinase in the absence and presence of glycerol: correlation of conformation to substrate binding and a mechanism of activation by phosphorylation 137 62 surname:Hurley;given-names:JH 8800467 REF Annual review of biophysics and biomolecular structure ref 25 1996 35981 The sugar kinase/heat shock protein 70/actin superfamily: implications of conserved structure for mechanism 1219 4 27 surname:Emekli;given-names:U surname:Schneidman-Duhovny;given-names:D surname:Wolfson;given-names:HJ surname:Nussinov;given-names:R surname:Haliloglu;given-names:T 17847101 REF Proteins ref 70 2008 36089 HingeProt: automated prediction of hinges in protein structures 8 1 15 surname:Stols;given-names:L surname:Gu;given-names:M surname:Dieckman;given-names:L surname:Raffen;given-names:R surname:Collart;given-names:FR surname:Donnelly;given-names:MI 12071693 REF Protein Expr Purif ref 25 2002 36153 A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site 307 26 surname:Otwinowski;given-names:Z surname:Minor;given-names:W REF Methods In Enzymology ref 276 1997 36269 Processing of X-ray diffraction data collected in oscillation mode 213 2 21 surname:Adams;given-names:PD surname:Afonine;given-names:PV surname:Bunkóczi;given-names:G surname:Chen;given-names:VB surname:Davis;given-names:IW surname:Echols;given-names:N 20124702 REF Acta Crystallographica Section D: Biological Crystallography ref 66 2010 36336 PHENIX: a comprehensive Python-based system for macromolecular structure solution 2126 12 32 surname:Emsley;given-names:P surname:Cowtan;given-names:K 15572765 REF Acta Crystallographica Section D: Biological Crystallography ref 60 2004 36418 Coot: model-building tools for molecular graphics 1194 11 7 surname:Afonine;given-names:PV surname:Grosse-Kunstleve;given-names:RW surname:Adams;given-names:PD surname:Lunin;given-names:VY surname:Urzhumtsev;given-names:A 18007035 REF Acta Crystallographica Section D: Biological Crystallography ref 63 2007 36468 On macromolecular refinement at subatomic resolution with interatomic scatterers 283 2 91 surname:Laskowski;given-names:RA surname:MacArthur;given-names:MW surname:Moss;given-names:DS surname:Thornton;given-names:JM REF Journal of applied crystallography ref 26 1993 36549 PROCHECK: a program to check the stereochemical quality of protein structures REF ref 36627 DeLano. W. The PyMOL Molecular Graphics System. Available: http://www.pymol.org. 615 6 22 surname:Sanghera;given-names:J surname:Li;given-names:R surname:Yan;given-names:J 10.1089/adt.2009.0237 20105027 REF Assay and drug development technologies ref 7 2009 36708 Comparison of the luminescent ADP-Glo assay to a standard radiometric assay for measurement of protein kinase activity