{"text": "Asthma is a complex genetic disease with more than 20 genome-wide scans conducted so far. Regions on almost every chromosome have been linked to asthma and several genes have been associated. However, most of these associations are weak and are still awaiting replication.In this study, we conducted a second-stage genome-wide scan with 408 microsatellite markers on 201 asthma-affected sib pair families and defined clinical subgroups to identify phenotype-genotype relations.The lowest P value for asthma in the total sample was 0.003 on chromosome 11, while several of the clinical subsets reached lower significance levels than in the overall sample. Suggestive evidence for linkage (p = 0.0007) was found for total IgE on chromosomes 1, 7 and again on chromosome 11, as well as for HDM asthma on chromosome 12. Weaker linkage signals could be found on chromosomes 4 and 5 for early onset and HDM, and, newly described, on chromosome 2 for severe asthma and on chromosome 9 for hay fever.This phenotypic dissection underlines the importance of detailed clinical characterisations and the extreme genetic heterogeneity of asthma. Many chromosomal regions have been shown to be linked or associated to asthma and asthma-associated traits in humans . More reThe mainstay of all genetic studies has been genome-wide linkage scans in families with at least two asthma-affected siblings. Based on a previous analysis of a genome-wide scan of asthma ,8 with i97 families consisting of at least two children with confirmed clinical asthma were collected during the first stage of the German genome scan ,Frequent replication, however, may point toward lead genes. Most regions listed in table The locus on chromosome 12 with suggestive linkage for HDM in our study is known from many other reports. Also our first scan showed weak evidence for linkage in this region at D12S351 (p = 0.01) , whereasOn chromosome 2, we found a locus in families with severe asthma that has not yet been described in other studies. A p-value of 0.007 has already been found in our first genome-wide scan [The German \"summer-type\" locus on chromosome 9 is also not frequent in other studies. This might be due to the fact that many, but not all, genes are necessary for a common trait. Our first asthma scan has already shown linkage in this region with a p-value of 0.007 for D9S1784 [We conclude that this phenotypic dissection is a useful tool to detect linkage in a heterogeneous disease like asthma because some of the sub phenotypes reached even better significance values than the main trait. We show that the precision of the phenotype can be more effective than expanding the sample size only. Unfortunately, large sample sizes are needed to assure at least moderate sample size in subsets. Grouping by early onset or disease severity could be applied to almost every complex disease, but for a more specific dissection, clinical expert knowledge is required. A prior analysis of clinical data can help to identify symptom clustering, which -if consistent within families- can reduce genetic heterogeneity.The author(s) delcare that they have no competing interests.MW, JA, and CS were involved in the study design, JA organised the sample collection, conducted the genetic analysis, and prepared the manuscript, MW organized funding and supervised the study. YAL and PN organised and helped with genotyping and revised the article critically for important intellectual content. SL, FR and MW carried out the statistical analysis and made substantial contributions to its conception and design, CS, DB, FF, HJ, JK, AK, AS, MS, WW, PW assisted in the recruitment of families and examined patients and therefore made substantial contributions to the acquisition of data, asthma severity grades are part of the thesis of CS. GS was responsible for the IgE analysis.The pre-publication history for this paper can be accessed here:"}
{"text": "The relationship between elevated blood pressure and cardiovascular and cerebrovascular disease risk is well accepted. Both systolic and diastolic hypertension are associated with this risk increase, but systolic blood pressure appears to be a more important determinant of cardiovascular risk than diastolic blood pressure. Subjects for this study are derived from the Framingham Heart Study data set. Each subject had five records of clinical data of which systolic blood pressure, age, height, gender, weight, and hypertension treatment were selected to characterize the phenotype in this analysis.p = 0.00002) evidence for linkage was found between this normalized phenotype and a region on chromosome 1. Similar linkage results were obtained when we estimated the phenotype while excluding values obtained during hypertension treatment. The use of linear mixed models to define phenotypes is a methodology that allows for the adjustment of the main factor by covariates. Future work should be done in the area of combining this phenotype estimation directly with the linkage analysis so that the error in estimating the phenotype can be properly incorporated into the genetic analysis, which, at present, assumes that the phenotype is measured (or estimated) without error.We modeled systolic blood pressure as a function of age using a mixed modeling methodology that enabled us to characterize the phenotype for each individual as the individual's deviation from the population average rate of change in systolic blood pressure for each year of age while controlling for gender, body mass index, and hypertension treatment. Significant ( The relationship between elevated blood pressure and cardiovascular and cerebrovascular disease risk is well accepted. The lifetime risk estimate for developing hypertension is 90% in patients who are 55 and 65 years old . Both syIn examining the effect of systolic blood pressure on cardiovascular disease, it is beneficial to utilize subjects' measurements taken over a period of time. This is because multiple longitudinal blood pressure measurements or long-term average blood pressure are more representative of a person's average or true blood pressure than a single measure for risk assessment . Mixed mEvidence shows that one's genetic makeup is a strong determinant of their risk of developing hypertension. Families prone to higher systolic and diastolic blood pressures also show higher rates of blood pressure increase with age; however, few other studies have explored rate of blood pressure increase . The pur. Of the 1671 subjects in Cohort 2, 1590 were included in the linear mixed model analysis, of which the 1308 with genotype data were included in the linkage analysis. Subjects were excluded from the linear mixed model analysis if only one systolic blood pressure measurement was done.Subjects for this study are derived from Cohort 2 of the Framingham Heart Study Data Set. Cohort 2 was selected because it comprises offspring, thereby providing a higher proportion of siblings than Cohort 1, which is the original cohort with complex family structures. For details on Cohort 2 subject selection, exclusion, distribution, and methodology please refer to In the Cohort 2 data set, each subject has five records of clinical data including but not limited to age, height, weight, systolic blood pressure, cholesterol, fasting glucose, and behavioral risk factors. The variables selected for analysis in linear mixed models were systolic blood pressure, age, height, weight, gender, and hypertension treatment. The selection of these variables was based on past studies investigating similar hypotheses ,7 and beAlso considered was the impact of hypertension treatment on the systolic blood pressure readings. Preliminary graphs of individual systolic blood pressure data indicate that subjects on medication have less linear data than subjects not on medication. While subjects who received treatment make up most of the individuals with high blood pressure, we were concerned that measurements from individuals on medication may be biased. Therefore, we defined the phenotype in two ways: 1) we adjusted the phenotype for hypertension treatment (as described above) and 2) we set all blood pressure measures taken while the individual was receiving treatment to missing. We then conducted analyses on both phenotypes using the same methods and presented the results separately for comparison.The linkage analysis phenotype for each individual is the best linear unbiased predictor of the individual's deviation from the population rate of change in SBP for each year of age while controlling for hypertension treatment, sex, and BMI. The SBP for each individual was measured every 4 years as part of the Framingham Heart Study. The measurement data are not complete in every individual and missing values exist. Given the longitudinal nature of the data and the existence of missing data, linear mixed models were utilized for the slope generation. Linear mixed models also allow for selected covariates to be adjusted for in the analysis such as whether the subject was taking hypertension medication. The model form is described below.Yi = Xiβ + WiΓ + Zibi + εI  ,wherei: Ythe vector of systolic blood pressures for individual iβ: vector containing the intercept and slope of the regression of systolic blood pressure on agei: Xdesign matrix associated with βΓ: vector containing regression coefficients on covariates gender, BMI, and hypertension treatmenti: Wdesign matrix associated with covariates gender, BMI, and hypertension treatmenti: bvector of random effects due to age and BMIi: Zdesign matrix associated with random effects due to age and BMII: εrandom error vector for each individual.Assumptions for the random elements are:i ~ i.i.d. N.The εi ~ i.i.d. N.The bi are independent.The ε and b1, was the phenotype in our genetic analysis. The phenotype for each individual was interpreted as the individual's deviation from the population average rate of change in SBP for each year of age while controlling for gender, BMI, and hypertension treatment. Lastly, the phenotype was converted into a Z-score value for use in the S.A.G.E. 4.2 program [Using SAS, we modeled SBP as a function of age using mixed modeling methodology that enabled us to estimate the population average curve as well as the subject-specific curves based on best linear unbiased predictors. The regression model for each individual was adjusted for gender, BMI, and hypertension treatment. The best linear unbiased estimator of the random effect of the regression coefficient on age, b program .A secondary analysis excluding hypertension treatment was conducted to compare with results acquired when adjusting for treatment. To do this analysis, if a SBP measurement was taken while the subject was taking hypertension medication, the SBP measurement was converted to a missing value. Mixed models were then used with the new SBP measurements to get the new phenotype of individual's deviation from the population average rate of change in SBP for each year of age while controlling for gender and BMI. This phenotype was also converted to a Z-score value for use in the S.A.G.E. 4.2 program .Linkage analysis using sibling pairs can be defined by the regression of the squared sib-pair trait difference on the estimated proportion of alleles siblings share identical by descent . The SIBInitially, the pedigree data set was run through the Identical by Descent4.2 (IBD) procedure of SAGE using the single-point option. The resulting IBD file along with a pedigree file and a parameter file were utilized in the nonparametric linkage analysis of SIBPAL4.2 to identify genetic linkage on the basis of sib-pair phenotypes as defined by the mixed model results. Only full sibs were used in this sibship analysis.Descriptive statistics of normalized phenotype values are shown in Table Significance of the linkage results was evaluated using the criteria of Lander and Kruglyak . With adWhen SBP values taken during hypertension treatment are excluded, the same region on chromosome 1 shows significant or suggestive evidence for linkage to SBP rate of change, as indicated by the bold text in Table In this study, a linear mixed modeling methodology was used to identify SBP phenotypes for each subject. The use of mixed models was appropriate here given the longitudinal nature of the data. By using linear mixed models with best linear unbiased predictors, the phenotype of rate of change can be defined as the slope for each subject while adjusting the values for other covariates. Studies have examined various methodologies for using longitudinal data to identify individual phenotypes ,10 and tFor example, Levy et al.  defined We found significant evidence for linkage of SBP rate of change to a region on chromosome 1 ~188–269 cM). Interestingly, we found similar linkage results regardless of whether we excluded values under hypertension treatment or adjusted for hypertension treatment in our definition of the phenotype. A region with at least two statistically significant markers, such as that found on chromosome 1, may indicate a region in which a candidate gene associated with the rate of change in SBP may lie. This region has not been as heavily studied as those mentioned previously, but is a viable candidate region because of the proximity of the angiotensinogen gene (~244–251 cM) . Two pre8–269 cM.The use of linear mixed models to define phenotypes is a methodology that allows for the adjustment of the main factor by covariates. The phenotypes defined for each subject are continuous and generalizable. Future work should be done in the area of combining this phenotype estimation directly with the linkage analysis so that the error in estimating the phenotype can be properly incorporated into the genetic analysis, which, at present, assumes that the phenotype is measured (or estimated) without error."}
{"text": "An initial linkage analysis of the alcoholism phenotype as defined by DSM-III-R criteria and alcoholism defined by DSM-IV criteria showed many, sometimes striking, inconsistencies. These inconsistencies are greatly reduced by making the definition of alcoholism more specific. We defined new phenotypes combining the alcoholism definitions and the latent variables, defining an individual as affected if that individual is alcoholic under one of the definitions (either DSM-III-R or DSM-IV), and indicated having a symptom defined by one of the latent variables. This was done for each of the two alcoholism definitions and five latent variables, selected from a canonical discriminant analyses indicating they formed significant groupings using the electrophysiological variables. We found that linkage analyses utilizing these latent variables were much more robust and consistent than the linkage results based on DSM-III-R or DSM-IV criteria for definition of alcoholism. We also performed linkage analyses on two first prinicipal components derived phenotypes, one derived from the electrophysiolocical variables, and the other derived from the latent variables. A region on chromosome 2 at 250 cM was found to be linked to both of these derived phenotypes. Further examination of the SNPs in this region identified several haplotypes strongly associated with these derived phenotypes. An often challenging and sometimes underappreciated facet of genetic epidemiology is the process of choosing an appropriate definition of the trait of interest. Consider for example Alzheimer's disease. While advanced age is the main risk factor for this disease, and it most often strikes after age 65, there are people that develop this disease before the age of 50. Pathologically, the disease appears the same regardless of the age of onset: microscopic examination of brain tissue from patients that are struck with this disease at any age reveal the presence of both amyloid plaques and neurofibrillary tangles. However, it is now recognized that the patients with the very early ages of onset have a mutation in one of three genes APP, PS1, PS2), and patients that develop Alzheimer's disease at a later age lack these mutations [, PS2, anThis problem is even more complicated with a behaviorally defined phenotype such as alcoholism, as there is no completely objective laboratory test for the phenotype. In this analysis, we explore the problem of phenotype definition with the Collaborative Study on the Genetics of Alcoholism (COGA) dataset, and look at alternate definitions of the phenotype. Of particular interest is the problem of lack of consistency in results due to a change in the definition of alcoholism from DSM-III-R to DSM-IV criteria .We performed model-free linkage analyses using the program SIBPAL, part of the SAGE analysis package . InitialTwo sets of linkage analyses were performed using two different phenotypes: the phenotype of alcoholism defined by each of the two criteria: DSM-IIIR and DSM-IV. These were coded as dichotomous variables, and denoted respectively as Alc1 and Alc2. The following covariates were used in all linkage analyses: dichotomous indicator of habitual smoking; dichotomous indicator of whether an individual was Black (derived from ethnicity); dichotomous indicator of whether an individual was White (derived from ethnicity); age at interview; square of age at interview; cube of age at interview. The results of the initial linkage analyses are shown in Figure p-values are not valid due to the non-independence of family members, they gave us an approximation of the relationships between the latent variables and the EEG variables. We found that latent variables 1 (persistent desire to stop drinking), 2 (morning drinking), 7 (gave up activities to drink), 9 , and 11  showed evidence of significant grouping with the EEG variables. Motivated by these observations, we defined ten derived phenotypes named Ai_j for i = 1, 2 and j = 1, 2, 7, 9, or 11 as defined above; an individual was affected with derived phenotype Ai_j if they were defined as alcoholic under definition 'i' and also had the symptom defined by latent variable 'j'. Correlations between these phenotypes were all higher than those between the original Alc1 and Alc2 variables (data not shown), and as shown in Figure We then made the assumption that the latent variables and electroencephalogram (EEG) variables are phenotypes that could be used to identify more homogeneous alcoholism phenotypes. We performed a canonical discriminant analysis using each of the latent variables as a potential grouping variable for the EEG variables. Although the To investigate linkage for phenotypes derived from the EEG variables and the latent variables, we formed several phenotypes using principal components analysis to summarize collections of variables. We used the first principal component derived from all 13 EEG variables, and also the first principal component derived from alcoholism and latent variables. The comparison of the linkage results for these two outcomes is given in Figure We chose to follow up on these chromosome 2 results, especially in the area around 250 cM, with further analyses using the Affymetrix SNP data. We examined the evidence for linkage using only the SNP data for all of chromosome 2. The linkage results for the EEG principal component outcome is shown in Figure To attempt to narrow the linkage peaks on 2q, we combined the STR and SNP markers, utilizing a combined map based on the map data sent along with the marker file, which produced the linkage results for our alcohol and latent variable and EEG principal component outcomes shown in Figure We used the program FBAT to examine evidence for association between SNP genotypes and each of the outcome variables of interest. There were a total of ten phenotypes of type Ai_j, and the two principal component derived phenotypes mentioned above . Each association can be tested using either a dominant model for mode of inheritance , or an additive model . Thus, for a given SNP, up to a total of 24 association tests can be significant. Figure We followed up on these results by examining the associations between these outcome variables and haplotypes formed from SNPs in this region using the HBAT function in the program FBAT. We chose haplotypes based on three criteria: 1) if there were consecutive SNPs that all showed a large number of significant results in Figure We have identified several alternative phenotypes defined by use of latent and/or EEG variables that provide consistent linkage signals on 2q using STR markers. We confirmed this signal on 2q using the Affymetrix SNP data. We then combined the SNP and STR data and show that the combined information narrows the region and increases the evidence for a candidate region with susceptibility genes for Alcoholism or related traits.Previous linkage analysis on comorbidity of alcohol dependence and habitual smoking revealed a modest peak on chromosome 2 around 90 cM, while evidence for linkage to our region of interest was weak and inconsistent in that study . Linkagep-values. Application of the conservative Bonferroni correction can be easily applied to these p-values, though this study is hypothesis generating rather than hypothesis testing, so we felt this unnecessary. Our results mirror the linkage signal previously found utilizing EEG phenotypes reported by Porjesz et al. [Investigating multi-SNP haplotype associations, we find that there are three SNP haplotypes showing consistent and significant associations at positions ~206, 210, and 228 cM on chromosome 2q. However, the principal component derived phenotypes were not found to show significant haplotype associations as those found with the latent variables. However there is a 5-SNP haplotype at 234.0–234.5 that shows significant association with the EEG principal component. We have analyzed multiple phenotypes and multiple SNP haplotypes for these association-based analyses, a total of 24 separate analyses, and have reported here the uncorrected z et al. .COGA: Collaborative Study on the Genetics of AlcoholismEEG: ElectroencephalogramSNP: Single-nucleotide polymorphismSTR: Short tandem repeatHWW participated in the design of the study and performed the statistical analysis. RCPG conceived of the study design, and participated in the study design and coordination, and helped to draft the manuscript. HT, VG, and GP participated in the selection of appropriate analyses and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "We performed variance components linkage analysis in nuclear families from the Framingham Heart Study on nine phenotypes derived from systolic blood pressure (SBP). The phenotypes were the maximum and mean SBP, and SBP at age 40, each analyzed either uncorrected, or corrected using two subsets of epidemiological/clinical factors. Evidence for linkage to chromosome 8p was detected with all phenotypes except the uncorrected maximum SBP, suggesting this region harbors a gene contributing to variation in SBP. Linkage analysis of quantitative traits holds great promise for dissecting the genetic contribution of phenotypes that vary in the population. While only the extreme trait values may be of clinical relevance, the full distribution in the population provides additional power to identify genetic determinants. However, the variation in trait value will depend on the underlying genes, additional environmental factors, and other correlated phenotypes that may also be under genetic control. The underlying trait distribution after removing these factors may have higher power to detect linkage. However, removing variation due to factors which themselves have a genetic basis  may remove genetic variation due to common genes contributing to both phenotypes, or where the genes for the explanatory variable (weight) contribute a major proportion of the genetic variation in the major phenotype of interest (systolic blood pressure).In this study, we analyzed nine phenotypes from the Genetic Analysis Workshop 13 Framingham Heart Study data, based on systolic blood pressure (SBP). We explore how the choice of underlying phenotype  and correction for other variables affects the results of variance components linkage analysis.Three baseline SBP response variables were used in the analysis: mean SBP, maximum SBP, and SBP at age 40 . Mean and maximum SBP were calculated for all study participants in Cohorts 1 and 2; no age limit was imposed and no minimum number of SBP readings were required for an individual to be included in the analysis. For SBP at age 40, the value from the first visit following a participant's fortieth birthday was used, or the final reading if the participant was under age 40 at their final study visit. Any participant who had no SBP recorded between the ages of 35 and 45 years was excluded from the age 40 analysis. It was assumed that all missing data occurred at random and would not bias results.For each of the three response variables, three levels of correction were applied. As well as the unadjusted response (A), adjustments were made for epidemiological and clinical covariates (B) and epidemiological covariates only (C). Adjusted phenotypes were obtained from the residuals after fitting a linear model using SPLUS v5.1. COHORT was included in all adjusted phenotypes, otherwise only those covariates that were statistically significant at the 5% level using a forward model selection process were included. For adjustment B, covariates included in the variable selection process were age, sex, cigarettes per day (SMOKE), units of alcohol per day (DRINK), treatment for high blood pressure (TREATED), and body mass index (BMI). Adjustment C included all covariates except TREATED and BMI. For maximum SBP and SBP at age 40, the corresponding covariate measure was used. When analyzing mean SBP, the covariates SMOKE, DRINK and TREATED were defined as yes or no according to whether these factors has ever occurred. The resulting nine phenotypes will be referred to as MAXSBP, MEANSBP, and AGE40SBP with suffixes A, B and C referring to the three levels of correction Table .Extended pedigrees were split into nuclear families due to the constraints of GENEHUNTER. In total, 294 nuclear families (242 extended pedigrees) from 330 original pedigrees contributed to the analyses, having two or more genotyped sibs with trait values for at least one of the phenotypes studied Table . QuantitGenome-wide linkage analysis results for each of the nine phenotypes are shown in Figure Chromosomes 12 and 22 showed suggestive linkage with MEANSBP_A only; the highest LOD score in these regions from the remaining phenotypes was 1.1 (chromosome 12 AGE40SBP_A) and 1.4 . In total, 14 regions across the genome attained a LOD score > 1.0. Of these, 11 included a phenotype adjusted for epidemiological and clinical covariates (B), compared with two unadjusted (A) and three adjusted for epidemiological covariates only (C). These results are consistent with the higher sib correlation observed for phenotypes B than C  in this region contribute directly to SBP, and not to an intermediate phenotype which has been corrected for . All SBP-based phenotypes showed some evidence for linkage on chromosome 8 (LOD > 1.5), except the unadjusted MAXSBP. Further analysis of SBP corrected for individual epidemiological and clinical factors might identify the crucial factors to be included in the correction for SBP.The maximum LOD score over the nine traits is 2.5. Although multiple testing has been performed, we note that the traits are not independent  and may reduce much of the age-dependent variation in SBP which is present in other unadjusted phenotypes. For example, the maximum SBP is treated similarly for study participants from age 20–30, or from age 40–70, although the distribution of SBP differs substantially in these age ranges. The linkage results suggest that modelling by age and epidemiological or clinical factors may increase the power to detect linkage to SBP."}
{"text": "To assess the factors affecting the incidence of radiation-induced dermatitis in breast cancer patients treated with adjuvant 3 D conformal radiotherapy by the analysis of dosimetry and topical treatments.in vivo.Between September 2002 and July 2009, 158 breast cancer patients were treated with adjuvant 3 D conformal radiotherapy after undergoing surgery. Before November 2006, 90 patients were subjected to therapeutic skin care group and topical corticosteroid therapy was used for acute radiation dermatitis. Thereafter, 68 patients received prophylactic topical therapy from the beginning of radiotherapy. The two groups did not differ significantly in respect of clinical and treatment factors. Furthermore, the possible mechanisms responsible for the effects of topical treatment on radiation-induced dermatitis were investigated 107%; >28.6%) and volume receiving 110% of prescribed dose within treated volume , and no prophylactic topical therapy for irradiated skin, were associated with higher incidence of acute radiation dermatitis. The protective effect of prophylactic topical treatment was more pronounced in patients with TV-V110% > 5.13%. Furthermore, using irradiated mice, we demonstrated that topical steroid cream significantly attenuated irradiation-induced inflammation, causing a decrease in expression of inflammatory cytokines and TGF-beta 1.The incidence of radiation-induced moist desquamation was 23% across 158 patients. Higher volume receiving 107% of prescribed dose within PTV (PTV-V110% > 5.13% may be an important predictor for radiation induced dermatitis. Prophylactic topical treatment for irradiated skin can significantly improve the tolerance of skin to adjuvant radiotherapy, especially for patients with higher TV-V110%.TV-V Radiotherapy (RT) is commonly used as an adjuvant modality in the treatment of breast cancer ,2. AdjuvRT-induced skin toxicity is a prominent clinical problem affecting the majority of breast cancer patients receiving adjuvant RT and can lead to temporary or permanent cessation of treatment. Severe skin reactions may be painful, lead to localized or occasionally systemic infection, and cause permanent scarring. The incidence of RT-related toxicity may be reduced by refinements in radiation techniques, such as improving dose conformity and dose homogeneity within the irradiated area. It is reported that breast IMRT could reduce approximately 15-20% moist desquamation of the irradiated skin by delivering a more homogenous dose of radiation through the breast and efficiently removing the radiation hot spots ,10. Accoin vivo.It is recommended that skin in the irradiated area be kept clean and free from trauma. Many physicians commence topical therapy at the clinical onset of radiation dermatitis but there is no consensus regarding the most appropriate timing or agents for topical therapy in such instances. Recently, some agents including creams containing urea and steroid, have been investigated and showed significant effects to reduce radiation induced dermatitis -13. HoweThis retrospective study was approved by the Institutional Review Board, and a waiver of informed consent was obtained. The patient data consisted of women who had undergone surgery for breast cancer followed by adjuvant 3D-conformal radiotherapy in our department between September 2002 and July 2009. Patients treated before November 2006 did not receive topical therapy for the skin until the onset of radiation dermatitis (therapeutic skin care group). Patients treated after this date underwent prophylactic topical therapy, including steroid cream (0.1% mometasone) and barrier film spray (3M™Cavilon No-sting Barrier Film) (prophylactic skin care group). Prophylactic medication was applied to the treatment field every three days from the start of RT . In gene107% (percent volume receiving 107% of prescribed dose within PTV) and TV-V110% (percent volume receiving 110% of prescribed dose within treated volume (TV)) to identify the hot spot area within and outside the target. The definition of treated volume is that volume enclosed within the prescribed dose, and the areas receiving excessive dose, especially >10% of prescribed dose, are known as radiation hot spot. Figure 107% and TV-V110% related to the location of moist desquamation.Radiotherapy was planned using the Eclipse Planning System , and treatment was delivered using Varian 21EX. All patients were treated with 3 D conformal radiotherapy. For radiation therapy with 3D-CRT, a customized immobilization device was developed which encompassed the upper extremities, head, neck and chest, to minimize variability in the daily setup. The clinical target volume (CTV) was contoured on the individual axial CT slices with 5 mm slice thickness of each patient. The CTV was expanded by 10 mm, but within 3 mm of the skin surface, to create the planned target volume (PTV). Treatment plans were developed by applying tangential photon fields set up isocentrically, with or without individually weighted segmental fields superimposed on the tangential fields and 1-2 coplanar, different gantry angle fields. Wedges were used in almost all cases. Our planning goals were to provide a homogenous PTV dose of 50.4 Gy, while minimizing the dose delivered to the lung, heart and contralateral breast. Furthermore, to evaluate the effects of dose inhomogeneity on acute skin toxicity, we analyzed several dosimetric factors including the planning target volume (PTV), PTV-V2 test was utilized to compare acute skin toxicity between different sample groups, and to analyze associations between acute toxicity, dosimetric parameters and clinical characteristics. Statistical significance was assumed at p < 0.05.The χThirty male BALB/c mice, aged between 8 and 10 weeks old, were purchased from the National Science Council, Taiwan. Protocols relating to animal experimentation were approved by the Chang Gung Memorial Hospital Laboratory Animal Center. For irradiation experiments, anesthetized mice restrained in modified Perspex tubes and covered with a 0.3 cm bolus, received a irradiation dose of 15 Gy in a single fraction to the skin by 6 MeV electron from a linear accelerator . UnirradAt the indicated times after irradiation, three mice from each group were sacrificed by cervical dislocation, and irradiated skin was dissected and stored at -80°C pending analysis . SpecifiEqual amounts of protein were loaded on to SDS-PAGE gels. After electrophoresis, the proteins were transferred to nitrocellulose membranes. The membranes were incubated with antibodies specific for TGF-β1, IL-6, MCP-1 and COX-2 , followed by incubation with horseradish peroxidase-conjugated secondary antibodies. Signals were detected using enhanced chemiluminescence. To normalize protein loading, the membrane was re-probed with mouse anti-r-tubulin antibody (1:1000).Cellular aspects of inflammation were measured in skin tissue samples using immunochemical staining. Experimental and control mice were sacrificed by cervical dislocation 20 days after exposure to 15 Gy irradiation. The tissues were fixed in 10% buffered formalin, paraffin-embedded and sectioned at an average thickness of 5 μm. Briefly, samples were incubated overnight with goat anti-mouse TGF-β1 antibody  diluted 1:20 in 0.01 M RPMI at room temperature. After washing three times with PBS, the sections were incubated with biotinylated anti-goat IgG (1:100) for 10 min followed by peroxidase-avidin staining. Samples were washed with PBS, followed by addition of 3-amino-9 ethylcarbazole.107% and TV-V110% within the 158 patients were 28.6% and 5.13% respectively. In comparison of dosimetric parameters between the 2 groups, the mean dose, target coverage and dose inhomogeneity did not differ significantly between patients receiving chest wall irradiation or whole breast irradiation (Table 107% and TV-V110%) and surgery type did not differ significantly between the two groups, but the incidence of moist desquamation was significantly greater in the therapeutic skin care group than in the prophylactic skin care group . Furthermore, within the prophylactic skin care group there was no statistical difference in the incidence of radiation dermatitis between those patients treated with topical steroid cream and those treated with barrier film spray .One hundred and fifty-eight patients met the study criteria and completed the planned course of treatment. Ninety patients underwent chest wall irradiation and 68 patients received whole breast irradiation. The mean age (±SD) of the overall study population was 50 ± 11 range 24-86) years. The incidence of moist desquamation was 23% of the total study population, 26% for patients who underwent chest wall irradiation and 19% for those that received whole breast irradiation. Among 37 patients developed moist desquamation,34 patients appeared grade 2 and 3 had grade 3 radiation dermatitis. The details of the treatment parameters are listed in Table 4-86 year107% (>28.6%), higher TV-V110% (> 5.13%) and no prophylactic topical therapy for irradiated skin, were significantly associated with moist desquamation  and group II (comprising 79 patients with TV-V110% > 5.13%), and further analyzed the risk factors associated with higher grade skin toxicity for each group. We found no significant association between the incidence of acute skin toxicity and surgery type, PTV-V107% and prophylactic skin care or not for group I (Table 110% > 5.13%), prophylactic topical therapy significantly decreased the incidence of higher grade skin toxicity (p=0.008)  Table .Real-time RT-PCR was utilized to quantify the expression of cytokines induced by radiation and changes in expression after topical treatment. Low expression levels were noted in unirradiated control mice and there were no significant changes in expression after topical treatment (unirradiated F-mice and S-mice). Irradiation (15 Gy) induced a significant increase in the mRNA levels of the cytokines detected in the experimental groups compared with the unirradiated group after 24 h. Treatment with steroid cream significantly attenuated the increase of pro-inflammatory cytokines in cutaneous tissues; barrier film spray had no effect Figure . WesternTGF-β1 has been reported as an important predictive biological marker for RT-induced inflammation and fibrosis . TherefoPostoperative radiotherapy has become an integral part of the complex treatment of breast cancer. The risk of acute and late RT-induced sequelae increases with radiation exposure of the organ at risk. The development of appropriate methods for preventing and treating established radiation-induced skin toxicity would be helpful for approximately 25% of breast cancer patients who develop moist desquamation or ulceration of the irradiated chest wall/breast skin ,10. At p107%) and > 55.4 Gy within treated volume (TV-V110%) were significant predictors of RT- induced skin toxicity. The similar percentages of patients with higher PTV-V107% and TV-V110% may explain why the mode of surgery did not significantly affect the incidence of radiation dermatitis.In recent years, 3D-CRT, IMRT and tomotherapy have become promising treatments to improve conformality and dose homogeneity for adjuvant RT treatment of breast cancer. However, there have been few studies concerning the correlation between dosimetric parameters and the incidence of radiation-induced skin toxicity. In the present study, we demonstrated that a larger volume receiving >53.9 Gy within PTV  provided significant protection from radiation-induced dermatitis. There are still no well established prophylactic treatments to prevent radiation skin toxicity despite some agents are reported to reduce radiation induced dermatitis, including topical vitamin C, creams containing urea and steroid -13,17-19in vivo is associated with increased TGF-β1 and COX-2 expression, and inflammatory cytokines. Therefore, we assessed the potential of treatment with topical steroid cream to mitigate skin toxicity caused by irradiation in animal studies. Topical steroid cream decreased the RT-induced inflammatory response, causing a reduction in levels of the pro-inflammatory cytokines IL-1α/β, TNF-α, TGF-ß1, IL-6 and MCP-1. Prophylactic barrier film spray had no effect on the production of early inflammatory cytokines after radiation exposure in mice. However, analysis of inflammatory cytokine RNA, TGF-β1 and COX-2 protein expression one week after irradiation, and TGF-β1immunochemical staining 20 days after irradiation, demonstrated that both topical steroid and barrier film spray did have an impact on the mitigation of radiation dermatitis. Based on our clinical data and experiments in vivo, we suggest that prophylactic topical steroid treatment inhibits RT-induced inflammation, leading to decreased radiation dermatitis. The mechanism responsible to barrier film spray- induced decrease in radiation dermatitis might be to decrease skin trauma and skin irritation. However, the effects of barrier film spay on irradiated skin and the underlying mechanisms still need further investigation.Clinically, cutaneous inflammation after irradiation of normal tissue can lead to both temporary and persistent complications. In mice, early radiation dermatitis usually peaks at 20 days . RT-indu107% and TV-V110% have a significant impact on radiation-induced dermatitis. By multivariate analysis, TV-V110% > 5.13% is an important predictor of the incidence of moist desquamation. In addition, prophylactic topical treatment for irradiated skin could significantly improve the tolerance of skin to adjuvant radiotherapy, especially for patients with higher TV-V110%. However, due to the limitation of retrospective study, a larger study and a randomized trial are needed to confirm these findings.Our results suggest that dose inhomogeneity as measured by PTV-VThere is no conflict of interest that could be perceived as prejudicing the impartiality of the research reportedMFC conceived of the study, performed the study, drafted the manuscript and participated in coordination. WCC participated in coordination and assisted in editing of manuscript. CHL helped in the collection and analysis of clinical data. CHH and KCL performed statistical analysis and participated in its design YHC helped in the collection of clinical data. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/508/prepub"}
{"text": "Intestinal atresia is a rare congenital disorder with an incidence of 3/10 000 birth. About one-third of patients have severe intestinal dysfunction after surgical repair. We examined whether prenatal gastrointestinal obstruction might effect on the myenteric plexus and account for subsequent functional disorders.We studied a rat model of surgically induced antenatal atresia, comparing intestinal samples from both sides of the obstruction and with healthy rat pups controls. Whole-mount preparations of the myenteric plexus were stained for choline acetyltransferase (ChAT) and nitric oxide synthase (nNOS). Quantitative reverse transcription PCR was used to analyze mRNAs for inflammatory markers. Functional motility and permeability analyses were performed in vitro. Phenotypic studies were also performed in 8 newborns with intestinal atresia. In the experimental model, the proportion of nNOS-immunoreactive neurons was similar in proximal and distal segments , but proximal segments contained a higher proportion of ChAT-immunoreactive neurons . Phenotypic changes were associated with a 100-fold lower concentration-dependent contractile response to carbachol and a 1.6-fold higher EFS-induced contractile response in proximal compared to distal segments. Transcellular (p = 0.002) but not paracellular permeability was increased. Comparison with controls showed that modifications involved not only proximal but also distal segments. Phenotypic studies in human atresia confirmed the changes in ChAT expression.Experimental atresia in fetal rat induces differential myenteric plexus phenotypical as well as functional changes (motility and permeability) between the two sides of the obstruction. Delineating these changes might help to identify markers predictive of motility dysfunction and to define guidelines for post-surgical care. Intestinal atresia is a common congenital gut disorder characterized by the interruption of intestinal continuity. Its prevalence is about 3/10 000 births (1). The diagnosis is generally made during the second or third trimester, based on ultrasound detection of bowel dilation Initiation and regulation of small-bowel motility depends on normal functioning of several structures, and particularly the enteric nervous system (ENS). The ENS is an integrative network made up of neurons and glial cells derived from the neural crest. It is located all along the gut and regulates intestinal peristalsis and secretion Although it is well recognized that atresia leads to morphological alterations in proximal and distal segments, there is so far little evidence that ENS alterations participate in the motility disorders observed after surgical treatment of congenital intestinal atresia. Only scattered and descriptive assessments of the ENS are available. Current data points largely to alterations in the proximal dilated segment but fail to show major alterations in the distal segment. In particular, decreases in NADPH-diaphorase, PGP9.5 and VIP nerve density have been described upstream of the atresia In the present study, using an experimental rat model of prenatal intestinal atresia Only rat fetuses with successful prenatal obstruction (n = 44) were included in the study. Birth weight was 4.5±0.5 g and total small bowel length was 12.8±1.3 cm. Littermate birth weight was 5.3±0.4 g  and intestinal length 15.3±1.8 cm .The atresia was located at a median of 8 cm (range 2–13 cm) from the duodeno-jejunal junction. The external diameter of the gut was significantly larger (1.8±0.4-fold) in the segments proximal to the atresia than in the distal segments . For eac2)) was significantly lower in the proximal segments than in the distal segments . There was no significant difference in the density of SOX10-IR glial cells  and controls samples (n = 8). Carbachol induced a concentration-dependent contractile response in proximal segments, starting at a concentration of 1 microM . This reThe neurally mediated contractile response of small-intestine longitudinal muscle was also assessed ex vivo in organ chambers in atresia samples (n = 12). EFS-induced contractile responses were 1.6-fold higher in proximal than distal atresia segments  did not significantly modify EFS-induced contractile responses in neither proximal nor distal segments  and distal segments (16.9±5.1 ohms.cm−2) or between atresia segments and control jejunum (18.2±3.5 ohms. cm−2) or control ileum (16.8±7.3 ohms. cm−2).Tissue resistance was not significantly different between proximal  and ileal segments  of controls  flux was significantly higher in the proximal segments than in the distal segments , 2.7-fold higher for Il6 (p = 0.01), 1.7-fold higher for Il10 (p = 0.01) and 1.6-fold higher for Il1 beta (p = 0.03). In contrast, iNos and Ifn gamma mRNA expressions were similar in the two segments (p = 0.77 and p = 0.06 respectively).The human atresia (N = 8) was located at a median of 51 cm (range 3–125 cm) from the duodeno-jejunal junction. The external diameters ranged from 11 to 25 mm for the proximal segments and from 4 to 6 mm for the distal segments. The ratio of the diameters was 3.6±1.3.H&S staining showed a normal mucosa in all cases, with submucosal edema in five cases and mucosal hemorrhagic spots in three cases. In all cases, muscular hypertrophy was present in the proximal segments when compared to the distal segments, with a muscle thickness ratio of 1.4 to 2.2 . As prevIn human atresia, the proportion of ChAT-IR myenteric neurons was higher in the proximal (38±16%) than distal segments (25±12%), although the difference did not reach statistical significance , IL1 beta (p = 0.7), IL6 (p = 0.9), IL-10 (p = 0.8), iNOS (p = 0.8) or IFN gamma (p = 0.4) was observed (data not shown).The experimental protocol was approved by the French animal care and use committee  and all animal procedures were performed according to the French guidelines for animal protection and animal welfare.According to the guidelines of French Ethics Committee for research on human tissues and after Institutional Review Board CPP Necker approval, atresia specimens were considered as “residual tissues”. Parents’ written informed consent was obtained for all the patients and the tissue collection was declared to the Research Ministry N° DC-2009-955.Time-dated pregnant rats were purchased from Janvier Laboratories . The surgical procedure was performed on day 18 of gestation (term: 22 days±1), as previously described Caesarean delivery was performed on day 21 of gestation. The fetuses were killed according to the guidelines of the animal care and use committee and the whole intestine was removed. Atresia was considered successful if the fetus was alive at delivery and if a stricture of the small intestinal was clearly visible, together with a difference in gut diameter above and below the ligation, and a difference in the color of the two segments .We compared two segments from each animal; one located 1 cm immediately above the atresia  and the other 1 cm immediately below it . In addition, segments of intestine from rat pups obtained after caesarian delivery at day 21 were collected and processed similarly to atresia segments. Two different parts were studied: jejunal samples, located at one cm below the duodeno-pancreatic zone and ileal samples, located at one cm before the ileocaecal valve.We studied eight neonates (6 girls and 2 boys) born with isolated intestinal atresia with a median gestational age of 36 weeks (range 32–39) and mean birth weight of 2660±540 g. In keeping with French ethical guidelines on research involving human tissues, intestinal fragments resected during curative surgery at birth were considered as residual tissue. Intestinal dilation had been diagnosed prenatally in all but one of the children, at a median of 27 weeks of gestation (range 22–33). None of the patients had short bowel syndrome but all showed post-operative intestinal dysmotility with a median duration of parenteral nutrition of 36 days (range 22–136 days). The median length of hospital stay was 54 days (range 24–141 days).Because of the small size of the human atresia distal segment samples, ex vivo functional studies could not be performed and the priority for IHC staining and PCR analysis was given.3 containing 0.5% Triton X-100 and 5% horse serum (Sigma), whole-mount preparations of rat and human atresia were incubated overnight with anti-choline acetyltransferase, anti-neuronal nitric oxide synthase and anti-Hu antibodies. Anti-Sox10 and anti-Caspase3 antibodies were only used for rat specimens. Glial cells were counted after Sox10 labeling. Apoptosis was analyzed after Caspase3 staining. The tissue samples were then washed with PBS (3×10 min) and incubated for 12 h with the following secondary antibodies. Antibody sources and concentrations are shown in Intestinal samples were fixed overnight at 4°C in 0.1 mol/l PBS containing 4% paraformaldehyde. Whole mounts of the longitudinal muscle myenteric plexus were prepared by microdissection. After permeabilisation for 3 h in PBS/NaN2), as previously described 2 unit.Specimens were examined with LSM 510 META confocal fluorescence microscope equipped with a 40X objective . The proportion of ChAT-immunoreactive (IR) and nNOS-IR neurons was normalized to the total number of Hu-IR neurons. Contiguous non-overlapping fields were analyzed until 500 Hu-IR neurons had been counted. The packing densities of glia and neurons were also evaluated and expressed as a function of tissue area  according to the manufacturer’s instructions, and transcripts were analyzed with Taqman assays (Applied Biosystem) on a 7300 Applied Biosystems device. Cytokine  were normalized to S6. ChAT and nNos transcripts were normalized to Pgp9.5. Cytokine Results were analyzed with the delta Ct method. Primer sources are shown in 2, 95% O2) Krebs-bicarbonate solution , and allowed to equilibrate for 30 minutes. Isometric contractions were recorded with a force transducer . Electrical field stimulation (EFS) was applied with a stimulator connected to platinum electrodes in order to activate enteric neurons and to characterize neurally mediated contractile responses. The parameters of stimulation were as follows: 12 V, 20 Hz, train duration 10 s and stimulus pulse duration 300 micros. The results were normalized to tissue-wet weight and expressed in N/g.The contractile activity of intestinal segments was analyzed as previously described −6 mol/l; Sigma) and a nitric oxide synthase inhibitor . Atropine and L-NAME were applied 15 minutes before EFS. At the end of the experiments, after abundant washing for 30 minutes, increasing concentrations of the cholinergic agonist carbachol chloride  were added to evaluate contractile responses.The neuropharmacology of EFS-induced contractile responses was analyzed in the presence of a muscarinic antagonist  was added to the luminal buffer 15 min after sample mounting. After 2 hours, the enzymatic activity of intact HRP was measured with a modified Worthington method.Horseradish peroxidase  was used to analyze changes in transcellular permeability. Type VI HRP  was used to analyze changes in paracellular permeability. 14C-mannitol was added to the mucosal side. After 2 hours, 14C-mannitol fluxes  were analyzed with a liquid scintillation counter .Non-parametric tests were used. Results for proximal and distal segments were compared by using Wilcoxon’s paired two-tailed test or the Kruskal-Wallis test. Differences were considered significant at p<0.05.In our experimental model of prenatal intestinal obstruction, prenatal mechanical constraints resulted in major phenotypic and functional differences between the myenteric plexus immediately proximal and distal to the obstacle, whereas these two adjacent segments were expected to be similar. These changes were characterized by a higher proportion of cholinergic neurons and an increased cholinergic neuromuscular contractile response in the proximal segments as compared to the distal segments.The rat model of prenatal obstruction was developed to determine whether and how prenatal atresia might affect the functional and/or phenotypic properties of the upstream and downstream enteric nervous system (ENS). In this model, complete intestinal obstruction is induced prenatally, resulting in dilation of the upstream segment and narrowing of the downstream segment, as observed in other experimental models and in human prenatal atresia A major finding in our study is the identification of neuroplastic changes in the ENS between the segments immediately upstream and downstream of the atresia. We observed a significant reduction in neuronal density in the proximal segments. This difference could result from tissue distension induced by the obstruction. This mechanism has been suggested in an adult rat model of occlusion, where a lower frequency of nerve fibers in the hypertrophic proximal segment was also observed Besides changes in neuronal density, we observed a higher proportion of ChAT-IR neurons in the proximal segments, as compared to the distal segments. As post-natal maturation of the ENS has been associated with an age-dependent increase in the expression of the vesicular acetylcholine transporter and ChAT in myenteric neurons Postnatal maturation of ENS has been associated with increased in neuronal surface Intestinal motor responses to carbachol also differed between the two segments of atresia. In particular, the proximal segments exhibited a stronger contractile response to carbachol as compared to the distal one. Furthermore, carbachol induced dose-responses in the proximal and the distal segment were similar to the one observed in the jejunum and ileum of healthy controls, respectively. This further reinforces the hypothesis of a defect in functional maturity of the distal segment. In controls, the lower contractile response induced by carbachol observed in the ileum vs. jejunum is consistent with the rostro caudal maturation gradient of the gut motor activity previously reported Concerning epithelial barrier function, transcellular permeability to HRP was significantly higher in the proximal segment than distal, and was also higher than in segments from controls. The mechanism underlying this increased permeability is unclear. IFN gamma has been shown to enhance paracellular and transcellular permeability The mechanisms responsible for the changes observed after prenatal intestinal obstruction are unclear, but they might result in part from a lack of mechanical or nutritional stimulation in the distal segment, that is mandatory for phenotypic and functional maturation. Recent studies have shown that activity-dependent and nutrition-dependent mechanisms can participate in the regulation of neuromediator expression in the ENS in embryonic neurons In order to determine if the observations made in the rat model were consistent with the human disorder, phenotypic studies were performed on 8 intestinal samples from babies with atresia and post-operative intestinal dysmotility . Analysis showed neuronal changes between proximal and distal segments similar to those observed in the experimental model. Because the experimental model reproduces the macroscopic findings observed in human atresia, one might expect similar functional findings in humans, although studies of a larger cohort of patients, including a correlation analysis of intestinal motility, are needed to confirm this important point.In conclusion, our findings point to functional and phenotypical changes in both parts of intestinal atresia, whereas these adjacent segments were expected to be comparable. Reduced ChAT expression by myenteric neurons and a reduced contractile response in the intestinal distal segment of the atresia may contribute to the intestinal motility disorders frequently observed after surgical treatment of congenital atresia. Increased transcellular permeability in proximal segments could also contribute to increased risk of bacterial translocation in these patients. Therefore, analysis of phenotypical and functional abnormalities in neonates with intestinal atresia might help to identify markers predictive of the severity of the alterations and to define guidelines for optimal postoperative management.Table S1Antibody references and concentrations for rat and human immunofluorescence analysis.(DOC)Click here for additional data file.Table S2TaqMan oligonucleotide primers used for rat and human PCR analysis.(DOC)Click here for additional data file."}
{"text": "Within the last few years the field personalized medicine entered the stage. Accompanied with great hopes and expectations it is believed that this field may have the potential to revolutionize medical and clinical care by utilizing genomics information about the individual patients themselves. In this paper, we reconstruct the early footprints of personalized medicine as reflected by information retrieved from PubMed and Google Scholar. That means we are providing a data-driven perspective of this field to estimate its current status and potential problems. Human Genome Project (Lander et al., personalized medicine because it aims to integrate genomics and clinical data from individual patients in order to improve patient care by identifying more efficient treatment strategies (Auffray et al., The In this paper we present a data-driven overview of the early history of personalized medicine. We are using information retrieved from PubMed and Google Scholar to obtain quantitative information statistics of published articles and the community structure of scientists that share a common interest in this topic. From this information we try to identify the potential impact personalized medicine has made so far but also to reveal indicators of problems that might prevent its blossoming. Despite the fact that PubMed and Google Scholar provide a wealth of curated data about various aspects of published articles over the last decades and the research interests of thousands of scholars it should be emphasized that neither has been designed to serve the purpose of our analysis. For this reasons, the drawn conclusions should only be seen as an indicator. Nevertheless, utilizing databases like PubMed and Google Scholar allows to present arguments beyond a mere opinion due to the possibility to compare different aspects quantitatively with each other.ad hoc assumptions that may lead to erroneous interpretations if they would be too far-off the truth.Specifically, to allow for a simplified interpretation of the retrieved numbers from PubMed and Google Scholar we present whenever appropriate a comparison with related topics. For example, rather than presenting an interpretation based on absolute numbers of, e.g., published research papers and review or editorial papers published for personalized medicine we perform a similar analysis for related fields like bioinformatics and systems biology and present a comparative interpretation. This relieves us from the burden to introduce to many personalized medicine we extract information from the literature. Specifically, we are using information provided by PubMed and compare publications in personalized medicine to other fields. Further, we investigate also the content of such publications, as far as this information is provided by PubMed.In order to obtain a general overview of the current state of the field FLink provided by the NCBI. FLink allows to perform a conventional PubMed search with the additional feature that the results can be downloaded as a csv file. The obtained csv files are than parsed by scripts we wrote in the statistical programming language R. The advantage of this approach is that we have convenient access to the same information that is visually represented by a conventional PubMed search but can process this information as desired. For the following analysis we retrieved all data in November 2012.For our following analysis we used the tool We start by showing in Figure Next, we try to get an insight into the distribution of research papers and non-research papers from the listed PubMed publications. Specifically, we define as “non-research” papers review, comment and editorial articles and as research papers we define all remaining articles. Figure The red proportion in each bar corresponds to the percentage of publications that are non-research papers, whereas the blue proportion corresponds to all other publication types. From a comparison of the results one finds that in translational research and in personalized medicine there is a larger percentage of publications devoted to strategic and conceptual questions as represented by review articles, comments or editorial papers and a smaller proportion of publications corresponds actually to original research papers. This could be a reflection of the novelty of these fields and the hopes that accompanies them. For this reason there may be a higher proportion of articles that try to pave the way for these fields, instead of actually contributing new results either from experimental or computational work.In general, personalized medicine has been conceived as a way to improve medical and clinical patient care by taking into account patient specific data. Hence, personalized medicine is inherently connected to a clinical application. In Figure It is somewhat surprising to see that the terms “biomarkers” and “computational” are not frequently present either. This is surprising because personalized medicine is data-driven and these data are analyzed by computational methods aiming to identify important signatures, e.g., in form of biomarkers. A possible reason for the underrepresentation of these terms could be again given by the novelty of this field, as discussed for Figure In order to obtain a general overview of the used genomics data types that occur in any publication type, including original research, review and editorial articles, related to personalized medicine, we use again PubMed and search for conjugated hits, i.e., “personalized medicine” and “term,” whereas the queries for “term” correspond to the x-axis in Figure It is not surprising that “sequencing” surmounts all other terms because it is the prototype technology to obtain genetic information about various aspects of the DNA (Mardis et al., Due to the multidisciplinarity of personalized medicine it would be interesting to know what other interests people have that are interested in personalized medicine. In order to answer this question we are using Google Scholar.In Figure Figure It is without a doubt that the principle idea behind personalized medicine holds a great potential for translational medicine by improving diagnostic, prognostic and therapeutic approaches for patient care. However, besides the seminal work of Chen et al.  only relA principal hurdle for a wider and active engagement of the community in this research area is certainly provided by the still considerable costs incurred by the needed patient-based high-throughput experiments. This is despite the steadily declining costs for DNA sequencing. More important, I think that the major problem is a lack of a precise definition of personalized medicine that would allow an efficient experimental design translating the paradigm into practice.Overall, based on the information we retrieved from PubMed and Google Scholar we think that it is fair to say that personalized medicine is still at the very beginning. It is increasingly recognized within the literature, but a wider impact hasn't been achieved yet.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The prevalence of chronic diseases such as cancer, type 2 diabetes, metabolic syndrome (MetS), and cardiovascular disease increases with age in all populations. Epigenetic features are hypothesized to play important roles in the pathophysiology of age-associated diseases, but a map of these markers is lacking. We searched for genome-wide age-associated methylation signatures in peripheral blood of individuals at high risks for MetS by profiling 485,000 CpG sites in 192 individuals of Northern European ancestry using the Illumina HM450 array. Subjects (ages 6–85 years) were part of seven extended families, and 73% of adults and 32% of children were overweight or obese.Pα=0.05 = 3.65 × 10−7 after correction for multiple testing) of which 14,155 are positively associated with age while 7,967 are negatively associated. By applying a positional density-based clustering algorithm, we generated a map of epigenetic ‘hot-spots’ of age-associated genomic segments, which include 290 age-associated differentially methylated CpG clusters (aDMCs), of which 207 are positively associated with age. Gene/pathway enrichment analyses were performed on these clusters using FatiGO. Genes localized to both the positively (n = 241) and negatively (n = 16) age-associated clusters are significantly enriched in specific KEGG pathways and GO terms. The most significantly enriched pathways are the hedgehog signaling pathway (adjusted P = 3.96 × 10−3) and maturity-onset diabetes of the young (MODY) (adjusted P = 6.26 × 10−3) in the positive aDMCs and type I diabetes mellitus (adjusted P = 3.69 × 10−7) in the negative aDMCs. We also identified several epigenetic loci whose age-associated change rates differ between subjects diagnosed with MetS and those without.We found 22,122 genome-wide significant age-associated CpG sites  contains supplementary material, which is available to authorized users. Chronic diseases such as cancer, type 2 diabetes (T2D), metabolic syndrome (MetS), cardiovascular disease, and dementia constitute the most common health problems seen in developed societies , and their prevalence increases with age in all populations -4. It isEpigenetic mechanisms mediate the interaction between gene and environment throughout the lifespan; while the underlying genetic sequence does not change, environmental influences can alter epigenetic marks and thus alter gene expression and induce long-term changes in phenotype and disease susceptibility . The grain utero but these profiles gradually diverge as they get older [DNA methylation is one of the most extensively studied epigenetic mechanisms and plays an important role in the process of development and differentiation . There iet older -38. Seveet older ,39-41.These age-related methylation changes may play a role in the observed age-related risk of various chronic diseases. For example, studies show that the hyper-methylation of certain CpG loci is associated with increased cancer risk via reduced expression of cancer-suppressor genes ,42. It hStudies of genome-wide DNA methylation can be conducted using various populations, and each design has its advantages and disadvantages. For example, monozygotic twins are genetically identical, so epigenetic differences found in twin pairs are likely to be either stochastic or environmentally induced, rather than genetically inherited . In studWhile no epigenome-wide study of extended, multi-generational families has yet been published, a recent study on a combination of twin and their nuclear family members examined the role of genetic features on DNA methylation . These aWe assembled a cohort comprising several large extended families of Northern European descent that is enriched for obesity, central adiposity, and obesity-associated MetS traits. To identify genomic regions whose methylation status changes with aging, we conducted a genome-wide survey of peripheral blood DNA methylation and interrogated more than 485,000 CpG sites in 192 subjects from seven extended families living in two US Midwestern states, Wisconsin and Illinois.The TOPS Family Study of Epigenetics (TFSE) was designed to study the role of epigenetic mechanisms in linking genes and the environment using related subjects of large extended pedigrees. The average age of the cohort is 36.2 ±18.8) years, 28% of the subjects were 18 years and younger at ascertainment and 55% are females. As the subjects were selected from families that are part of a previous genetic study on the metabolic risk complications of obesity , the coh8.8 yearsWe have implemented a data cleaning procedure aiming to retain only the informative CpG probes for downstream analyses . The characteristics of these age-associated CpG sites are shown in Figures M value per year of age in Figure LEP [OLFM4 [IRS2 [TFAP2B [Using methylation status represented by see the ‘’ sectionsee the ‘’ sectiongure LEP , the chiP [OLFM4 , the T2DM4 [IRS2 , and the [TFAP2B   makes them susceptible to developing obesity and MetS, age-associated DNA methylation is enriched in genes and pathways involved in metabolic homeostasis. Changes caused by aging in these epigenetic states might lead to the malfunctions that underlie the increased prevalence of clinical symptoms of obesity and MetS in the aging population ,3. As thLEP, POMC, PPARG, and CNR1, as well as previous obesity GWAS candidates with unclear roles in obesity etiology, such as SIM1, IRX3, and SLC6A11. Furthermore, four genes identified in GWAS for childhood obesity, such as SDCCAG8, TNKS/MSRA, OLFM4, and HOXB5, were found to be epigenetically age-associated as well.We found that 20 genes out of the 36 listed in a gene list based on genetic studies of human obesity  have onePPARG, HNF1B(TCF2), TCF7L2, IGF2BP2, HHEX/IDE , KCNQ1, MTNR1B, ADAMTS9, THADA, and JAZF1. In one of the most recent studies of T2D genes using genome-wide trans-ancestry meta-analysis, seven novel loci were identified [SSR1/RREB1 and LPP. We also looked for any age-associated epigenetic evidence for genes established through approaches other than GWAS and found that the following known T2D genes are under epigenetic regulation by age: IRS1 [IRS2 [AKT [ABCC8 [HNF4A [IPF-1(PDX1) [NeuroD1 [GCK [Of the 20 T2D susceptibility loci recently identified in GWAS , ten werentified . Of thesge: IRS1 , IRS2 [5S1 [IRS2 , AKT [61T [ABCC8 , HNF4A [8 [HNF4A , IPF-1(P-1(PDX1) , NeuroD1[NeuroD1 , and GCKoD1 [GCK .GRB14, KIAA0754, MACF1, MLXIPL, SKIV2L, STK19, TFAP2B, and TRIB1.Of the 25 genes that have been shown to play pleiotropic roles in MetS and inflammation , we founIRS2) on chromosome 13. This cluster begins within the promoter region ), 5′ untranslated region (UTR) and ends in the first exon . A total of 387 GO terms for biological processes were significantly enriched within the aDMC genes , the methylation aging rates did not show any significant difference between the two groups of subjects  in our dataset after QC. Of these, 23 CpG loci were genome-wide significantly associated with age in our cohort. We examined the aging rate of each of these 23 epigenetic markers in the two groups of adult subjects that were separated using the ATPIII definition of MetS (24% with MetS) and found that four sites of four different genes showed nominal differentiation between the two groups  in genomic regions densely packed with age-associated CpG sites. We have named these clusters as aDMCs  and Illinois (one family) and are mostly categorized as working and/or middle class families . There are likely to be broadly similar household routines of dietary intake and activity within these large families. We therefore expect that by using these families to study epigenetic changes over age, we reduce systematic differences in external environmental factors such as geographical location and dietary and lifestyle patterns.The probands of our TFSE cohort were recruited based on the presence of at least two obese and one never-obese sibling(s) in each family, thus raising the likelihood of having obesity-prone genetic patterns in these families. We hypothesize that since our subjects have an obesity-prone genetic background and live in an obesity-inducing environment, the genomic regions that are strongly associated with age are also enriched in gene groups and pathways involved in metabolism-related cascades.IRS2 works as a signaling mediator between cytoplasmic receptor kinases and downstream effectors including PI3 Kinase, Akt, and mTOR [IL-4), and other cytokines [IRS2 include fatty liver disease and glucose intolerance, which is a precursor to MetS [To find these loci, we first searched in our list of age-associated differentially methylated CpG sites and clusters for any gene(s) previously characterized for a role in the etiology of obesity, T2D, or MetS and inflammation. We found that the majority of previously established obesity, T2D, or MetS and inflammation genes overlap with one or more of our age-associated differentially methylated clusters Figure , and 6. and mTOR  and is aytokines . Disease to MetS ,81.SIM1) is a helix-loop-helix PAS domain transcription factor. Sim, its homologue in Drosophila, is a key factor in determining the differentiation of central nervous system (CNS) midline cells [SIM1 gene locus has been found to have caused profound early-onset obesity [SIM1 has an aDMC that spans 22,914 bp covering the 5′-untranslated region to exon 8 containing 44 CpG sites that were significantly associated with age including five sites situated in the promoter region (TSS1500 to first exon).Single-minded 1 , suggesting a possible explanation for these genes having more profound effect on clinical phenotypes in children than in later life.Multiple obesity and T2D candidate genes identified by the GWAS approach were found to have age-associated DNA methylation associations in our analysis. These genes include extensively replicated genes such as  obesity . FurtherNKS/MSRA  were firdatasets . InteresSHH), Indian Hh (IHH), and Desert Hh (DHH), with receptor PACH1 and PACH2 that release its inhibition on the membrane receptor Smoothened (SMO). Released SMO then activates a complex signaling cascade, which leads to nuclear translocation of transcription factors of the Gli (GLI) family and the resultant activation or repression of downstream genes [IHH and DHH, Hh receptor genes PACH1 and PACH2, and SMO and the downstream effector genes GLI2 and GLI3, and several other regulators of the Hh pathways including SUFU and PKA  encode transcription factors that regulate β-cell homeostasis and/or insulin production and secretion, and gene GK is a glucokinase that is involved in beta cell sensing of blood glucose levels [Diabetes mellitus, like obesity, is a chronic condition that increases in its prevalence as people age ,3, but te levels . In our TFAP2B) (cg06117072) encodes a transcription factor from the AP-2 family. This gene has been implicated in dietary weight maintenance [GRB14) (cg04926134) encodes an adaptor protein that binds with insulin receptors and insulin-like growth factor receptors that may have an inhibitory effect on insulin signaling and may play important roles in metabolic homeostasis and growth regulation [TRIB1) (cg14683125), a mitogen-activated protein kinase (MAPK) activation modulator, was found to control migration and proliferation of smooth muscle cells [MACF1) (cg22697325) is a member of protein family that form bridges between different cytoskeletal elements [In this study, we demonstrated the first evidence of differential methylation aging in MetS genes in MetS subjects as compared with non-MetS subjects. Our results showed an interesting pattern in which the epigenetic changes over age are slower in MetS subjects, and its directionality is the opposite to that in non-MetS subjects in all four of these identified loci Table . Our resntenance ,103. Grogulation -107. Trile cells  and has le cells -111. Micelements .With the size of our sample, we do not have enough statistical power to detect all existing signals for MetS-specific aging methylation. We expect that with a larger sample size, one can discover many more disease state-dependent epigenetic markers not only for MetS but also for other aging relevant conditions such as obesity, T2D, dementia, and cancer. This may eventually lead to new clinical approaches in screening and diagnosing people with differential ‘epigenetic risks’ for developing diseases as they age.We examined the epigenetic changes associated with aging in DNA obtained from peripheral blood, a tissue type that is routinely used as a surrogate for mapping age-related DNA methylation changes  because We conducted our study in a family cohort of Northern European descent. Generalization of our findings requires validation in distinct cohorts with similar pedigree structures. It will also be a valuable expansion of our cross-sectional study if we can recall some of our subjects to obtain longitudinal data on the epigenetic changes as well as on the functional status of metabolic pathways over time in the same individuals. Due to the scope and the focus of the current study, we have not looked at the associations of particular methylation loci with phenotypes in our subjects as this will be approached in the future. The connection between epigenetic status and gene expression in blood and certain target tissue types also warrants further investigation.Although our mapping utilized one of the array-based epigenetic platforms that gave the highest available genomic site coverage, it has not nearly exhausted the epigenome. A next-generation sequencing-based approach such on methyl-binding domain-isolated genomic sequencing (MiGS), MeDIP-seq, or bisulphite-sequencing  will be We have conducted one of the first genome-wide surveys of age-associated DNA methylation in a family cohort with large extended pedigrees. In families at high risks for developing obesity-related metabolic disorders, we found age-associated genomic loci densely situate near genes that function in the hedgehog signaling pathway and in MODY. These findings suggest a novel mechanism underlying the gradual deleterious effects of multiple genes and their interactions with nutrition over time, which may contribute to obesity and its complications. The results from this study shed light on the relationship between aging and increased prevalence of obesity, T2D, and related abnormalities and thus may lead to novel approaches for early detection and prevention of these health-endangering conditions.The study cohort consists of 192 individuals ranging in age from 6 to 85 years old representing seven families. Of these, 53 subjects were 18 years and younger at ascertainment and 106 are females. Details of recruitment and phenotyping procedures have been described previously ,115. BriP values excluding X and Y chromosomes. No background subtraction or control normalization was applied with GenomeStudio.Genomic DNA was isolated from peripheral blood after an overnight fast on the same day when each subject was assayed for obesity and MetS phenotypes; thus, the CpG methylation states profiled from these samples reflect the epigenetic status associated with that individual’s current state of body composition and metabolism. One microgram of human genomic DNA was sodium bisulfite-treated for cytosine (C) to thymine (T) conversion using the EZ DNA Methylation kit (Zymo Research) according to the manufacturer’s guidelines. The converted DNA was purified and prepped for analysis on the Illumina HumanMethylation450 microarray following the manufacturer’s guidelines. The Illumina HumanMethylation450k microarray measures the methylation levels of more than 485,000 methylation sites. It includes CpG sites surrounding the transcription start sites  for 99% of RefSeq genes, CpG sites within non-coding RNAs, intergenic regions identified in genome-wide association studies as well as CpG islands/shores/shelves and open sea of the genome. CpG annotations  were identified using the Illumina manifest 1v2.GenomeStudio software and Methylation Module (Illumina) was used to generate final reports containing signal intensities and detection P values of 22 autosomal chromosomes were extracted from GenomeStudio and loaded into Lumi. Next, quality control of the data resulted in the removal of CpG sites with detection P value ≥ 0.01 in more than 5% of the samples . All samples had at least 99% CpG sites with detection P value ≥ 0.01; thus no samples were removed. Recently, multiple groups have reported that this array contains cross-reacting probes that cannot be distinguished between multiple chromosomal positions and that therefore need to be excluded from downstream analysis [For initial quality control preparation of the Infinium Human Methylation 450 K data, we used the Lumi: QN + BMIQ pipeline described previously . Raw siganalysis . Furtheranalysis . Consideβ’ values are defined as follows:Color bias adjustment (Col.Adj) and quantilenormilzation (QN) were performed on signal intensities as implemented in Lumi. Briefly, the QN works on total signal intensity, assuming that the distributions of the pooled methylated and unmethylated probes are similar for different samples. Intensities were then used to generate Beta values. Within Lumi, ‘IM and IU represent the fluorescence intensity originating from methylated or unmethylated CpG locus and α is a constant. Beta mixture quantile dilation (BMIQ) was then performed on β values of QNed data to account for probe type bias. As the Illumina platforms have been shown to discriminate beta values that differ as little as 17% [β values  to ensure probes analyzed might exert a significant biological change. After these steps, a total of 137,168 CpG sites for all 192 samples were imported into data analysis. BMIQ’ed β values for probes with ≥0.17 variation were then converted to M values for data analysis. Lumi defines M values as:where e as 17% ,121, we M values, which are more statistically valid for analysis of differential methylation levels owing to its more homoscedastic nature [All analyses were run using c nature .To estimate cell-type proportions, we used the R minfi package and estimateCellCounts function ,124. ThiDDO: the forward primer, TGTTTAGGAGAAAGGAGTAAGTGATT; the reverse biotinylated primer, ACCCATTATTCACCATACCTACAA; and the pyrosequencing primer, TTTTATGGAGTTGTTTTTGTTAAG. Sepharose beads containing the PCR product were washed and purified using 0.2 M NaOH and the Pyrosequencing Vacuum Prep Tool (QIAGEN). Five microliters of the PCR products was sequenced, and methylation was quantified using the provided software (QIAGEN).DNA methylation at selected sites was validated in a subset of the original cohort by the bisulfite pyrosequencing. This subset consisted of 47 male subjects ages 6 to 21. One microgram of human genomic DNA was sodium bisulfite converted using the EZ DNA Methylation kit (Zymo Research) according to the manufacturer’s guidelines. Pyrosequencing was performed using the PyroMark MD system  according to the manufacturer’s protocol. Briefly, the PCR was performed with 10 μM primers, one of which was biotinylated for later purification by Streptavidin Sepharose (VWR). The oligonucleotide primers were purchased from IDT and used for the amplified region of i, the value of a trait Y is modeled as:The quantitative genetic analyses program SOLAR  was usedμ is the trait mean, Xi is a vector of fixed effects measured on individual i, β is a corresponding vector of regression coefficients, and gi and εi are, respectively, a random additive genetic effect and an error term. The covariance of the trait in any two individuals i, j is decomposed as:where ϕi,j is a kinship coefficient  and σ2g and σ2ε are, respectively, additive genetic and residual components of variance. Inclusion of the random effect terms appropriately conditions the estimates of the fixed effect parameters on the relatedness of study subjects. Analyses were performed for each CpG site separately, using M values, where M was modeled as a linear function of age with models that included the random effect of kinship. Sex and cell type composition were included as covariates in all models to account for systematic differences in methylation between men and women. Bonferroni correction for multiple testing, Pα=0.05 = 3.65 × 10−7.where 2A candidate CpG site-based regression analysis against MetS status in each subject was performed to determine if there is differential aging of DNA methylation in subjects with metabolic syndrome compared to those without. In this model, two tests were done: in one, the slopes and intercepts of the regression lines are allowed to differ by MetS status, and in another, a null is forced to be the same. The test of statistically equal intercepts asks whether methylation differs by MetS status for the measured span of ages. The test of equal slopes asks whether MetS impacts change in methylation with age.The R package bump hunter  was usedTo account for array bias, we took the minimum and maximum position of each cluster and looked at the total number of probes from that region that were originally implemented into the analysis. To further define our aDMCs, at least ten CpG sites had to be in the original data set which was implemented into the analysis. At least 50% of those sites had to be genome-wide significantly associated with age. Through this method, we identified a total of 246 aDMCs throughout the autosomal genome. We further looked at the direction of effect age has on each CpG within the identified clusters. If 100% of the CpGs in the cluster had the same direction of effect, it was labeled as ‘positive’ or ‘negative’. If there was variable direction of effects within the cluster, it was labeled as ‘varying’.P value < 0.05 are considered significant.Gene Ontology analysis was done with the FatiGO tool , which u"}
{"text": "Background. Light-emitting diode (LED) phototherapy has been reported to relieve pain and enhance tissue repair through several mechanisms. However, the analgesic effect of LED on incised wounds has never been examined. Objectives. We examined the analgesic effect of LED therapy on incision pain and the changes in cyclooxygenase 2 (COX-2), prostaglandin E2 (PGE2), and the proinflammatory cytokines interleukin 6 (IL-6), IL-1β, and tumor necrosis factor α (TNF-α). Methods. Rats received LED therapy on incised skin 6 days before incision (L-I group) or 6 days after incision (I-L group) or from 3 days before incision to 3 days after incision (L-I-L group). Behavioral tests and analysis of skin tissue were performed after LED therapy. Results. LED therapy attenuated the decrease in thermal withdrawal latency in all the irradiated groups and the decrease in the mechanical withdrawal threshold in the L-I group only. The expression levels of COX-2, PGE2, and IL-6 were significantly decreased in the three LED-treated groups, whereas IL-1β and TNF-α were significantly decreased only in the L-I group compared with their levels in the I groups (p < 0.05). Conclusions. LED therapy provides an analgesic effect and modifies the expression of COX-2, PGE2, and proinflammatory cytokines in incised skin. Low-intensity light therapy, commonly referred to as photobiomodulation, uses light in the far-red to near-infrared region (NIR) of the spectrum 630–1000 nm) and modulates numerous cellular functions. The light-emitting diode (LED), a light source, is as efficient as laser light and can be applied more economically 000 nm an, angiogeSurgical trauma produces injuries in skin, fascia, muscle, and the nerve fibers innervating these tissues and induces subsequent postoperative acute pain. Although many basic and clinical research studies have improved our understanding of the pathologic mechanisms, controlling postsurgical pain well remains a challenge for physicians. The behavioral characteristics of a postoperative pain model in rats produced by hind paw incision resemble postoperative hypersensitivity in humans . The natSince LED therapy can reduce the inflammation response, enhance tissue repair, and relieve pain, this therapy is considered a suitable method for preventing and treating symptoms of tissue damage after trauma or surgery. Thus, the antinociceptive effect of 940 nm wavelength LED therapy on acute pain resulting from tissue injury in a rat incision model was examined and the mechanism of antinociception was explored in this study.Male Sprague–Dawley rats (180–220 g) were used in this study and were purchased from the National Science Council (Taiwan) according to the guidelines for pain research  and the n = 6) after behavioral testing. The staff members who performed the behavioral tests and collected and analyzed the skin tissues were blinded to the animal groups.The rats were randomly assigned to the following groups. Rats received LED therapy 6 days before incision  or 6 days after incision  or from 3 days before incision to 3 days after incision . Three groups of control rats received only a skin incision  and underwent behavioral tests and tissue dissection at 3 hours, 3 days, or 6 days after skin incision for comparison to the L-I, L-I-L, and I-L groups, respectively. Three groups of LED-treated rats received a sham incision and the same LED therapy procedure on the contralateral paw for 6 days and were also considered as control (C) groups. The baseline mechanical withdrawal threshold and baseline thermal withdrawal latency were tested in naïve rats before undergoing a skin incision or LED irradiation, that is, before the incision was made in the I-6 d and I-L groups and before LED irradiation in the other groups. The mechanical withdrawal threshold and thermal withdrawal latency were then tested 3 hours after incision in the L-I and I-3 h groups, 3 days after incision in the L-I-L and I-3 d groups, and 6 days after incision in the I-L and I-6 d groups. Skin tissues dissected from all groups were collected for mRNA and protein analyses  were tested perpendicular to the plantar surface for 5-6 s for each filament. The 50% paw withdrawal threshold was determined using Dixon's up-and-down method . Each th2 of energy density at a power output of 160 mW. The therapeutic procedure began before or after the incision according to the assigned groups and was repeated every 24 hours. The rats were held in the ventral decubitus position to receive LED irradiation. The LED source was kept 1 cm above the injury at a 90° angle. A power checker  was used to check the optical output power of the light source before the beginning of the experimental procedure. The equipment was specially developed for this experiment at the Department of Electronic Engineering of I-Shou University, Taiwan. After LED therapy, the animals were kept in their cages and observed until recovery from anesthesia.The rats in the LED-treated groups received LED irradiation on the left hind paw at a 940 nm wavelength for a period of 30 min to administer 4 J/cmβ-Actin was used as a reference gene. The mRNA amounts of the genes of interest and β-actin were calculated from the threshold cycle (Ct) number. The relative expression level of each sample was normalized to the β-actin expression as an endogenous RNA control. The ΔCt values of the samples were determined as the difference between the Ct of the sample mRNA and the reference gene. ΔΔCt was determined as the difference between the ΔCt of the control groups (C groups) and the ΔCt of the other LED-treated groups. Data were expressed as 2−ΔΔCt to provide an estimate of the amount of sample mRNA present in the LED-treated groups relative to the control group.One microgram of total RNA was used for cDNA synthesis and qRT-PCR gene expression analysis. First, reverse transcription (RT) was performed using a High Capacity cDNA Reverse Transcription Kit according to the manufacturer's protocol . The reaction mixtures were incubated at 25°C for 10 min, 37°C for 120 min, and then 85°C for 5 sec. The final cDNA products were stored at −20°C until use. Next, the cDNA products were amplified by qRT-PCR on a 7500 Real-Time PCR System  using the SYBR® Green PCR Master Mix . The following thermal cycling program was used: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and at 60°C for 1 min. Experiments were performed in triplicate for each data point. The primers used for qRT-PCR are listed in g for 15 min at 48°C. Proteins (30 μg per lane) were separated in a 10% sodium dodecyl sulfate- (SDS-) polyacrylamide gel and transferred onto a polyvinylidene difluoride membrane . The membrane was blocked with blocking solution  for 0.5 hours and was rinsed briefly in TBST. The membrane was incubated overnight at 4°C with rabbit anti-PGE2 polyclonal antibody  . A mouse anti-actin monoclonal antibody   was used as a control.Total protein from skin tissue was prepared by the addition 1 : 20 of T-PER Tissue Protein Extraction Reagent   containing protease inhibitors . The tissue was homogenized with a homogenizer. After being placed on ice for 30 min, the homogenate was centrifuged at 10,000β-actin immunoreactivity.After being rinsed with washing buffer for 30 min, the membrane was incubated for 1.5 hours with a horseradish peroxidase-conjugated secondary antibody: goat anti-rabbit IgG-HRP  . The membrane was washed in washing buffer for 30 min, and the antibodies were then revealed using an enhanced chemiluminescence (ECL) detection kit . For densitometric analyses, the blots were scanned and quantified with Image-Pro Plus analysis software , and the results were expressed as the ratio of PGE2 immunoreactivity to t-test. The qRT-PCR data for COX-2, IL-6, IL-1β, and TNF-α and the western blot data for PGE2 were analyzed by the Kruskal-Wallis test to determine differences among groups followed by the Mann–Whitney U test for intergroup differences. The data were expressed as the means and standard deviation. Differences were considered statistically significant at p < 0.05. The statistical analysis was performed with SPSS software .The Kolmogorov–Smirnov test was performed to verify the dependent variables' normality of distribution. The comparison of the mechanical withdrawal threshold and thermal withdrawal latency after treatment and baseline value in each group was analyzed using the paired p < 0.05), but not in the three LED-treated groups    .In the present study, LED irradiation significantly alleviated thermal hyperalgesia in all three LED-treated groups and mechanical allodynia in only the L-I group. LED irradiation also significantly decreased the expression of IL-6, COX-2, and PGE2 in all the treatment groups and decreased IL-1β or TNF-α, in circulating blood 3 hours after carrageenan-induced inflammation. A prior injection of IL-6 antiserum abolished the induction of COX-2 activity and PGE2 release in vascular endothelial cells and attenuated thermal hyperalgesia [A previous study reported an increase in the level of IL-6, but not of IL-1ralgesia , 15. A-nralgesia . Thermalralgesia . Prostagralgesia . Thermalralgesia . Thus, tβ, TNF-α, and IL-6) [α and IL-1β were not suppressed by LED irradiation in the I-L and L-I-L groups. A possible reason why TNF-α and IL-1β were not suppressed by LED irradiation in the I-L and L-I-L groups is that some amount of TNF-α and IL-1β was secreted by Schwann cells that were not inhibited by LED irradiation. LED irradiation was reported to be able to reduce the influx of inflammatory cells to the inflammation site [α and IL-1β, is regulated at local inflammatory sites [β and TNF-α have also been reported to be associated with the development of allodynia and hyperalgesia [The peripheral actions of cytokines in inflammatory pain include the activation of immune cells, such as mast cells, macrophages, and Schwann cells, to produce proinflammatory cytokines  . These cnd IL-6) . We showion site . Howeverry sites , 23, wheralgesia , 25; thiIn addition to being blocked by IL-6, COX activity could be inhibited by LED irradiation. A study by Xavier et al.  showed tHow does 940-nm light therapy inhibit the activation of COX enzymes and decrease the production of PGE2? In a previous study , light iβ and TNF-α 3 hours after the incision, but there was no effect on IL-1β or TNF-α more than three days after the incision. Similar results were reported by previous studies showing that the antinociceptive effects produced by nonsteroidal anti-inflammatory drugs  were the same whether the NSAID was administered before or after the noxious stimulus [Preemptive analgesia is an antinociceptive treatment administered before a noxious stimulus to prevent the establishment of neural nociception processing. Basic physiologic research has created great interest in the potential benefits of preemptive analgesia . Howeverstimulus , 38.β, and TNF-α. Preemptive LED phototherapy transiently suppressed the expression of IL-1β and TNF-α several hours after incision. However, LED phototherapy could not suppress the expression of IL-1β or TNF-α beyond 3 days after incision. This LED therapy holds therapeutic potential for postsurgical pain.In conclusion, the results of the present study demonstrated that 940-nm LED phototherapy could effectively reduce incision-induced thermal hyperalgesia in all the LED-treated groups, regardless of whether irradiation occurred before or after the skin incision, whereas mechanical allodynia was reduced only 1 day after incision. The antithermal hyperalgesic and mechanical allodynic effects of this treatment are probably related to the decreased expression of COX-2, PGE2, IL-6, IL-1"}
{"text": "Coordinated shifts of neuronal activity in the prefrontal cortex are associated with strategy adaptations in behavioural tasks, when animals switch from following one rule to another. However, network dynamics related to multiple-rule changes are scarcely known. We show how firing rates of individual neurons in the prelimbic and cingulate cortex correlate with the performance of rats trained to change their navigation multiple times according to allocentric and egocentric strategies. The concerted population activity exhibits a stable firing during the performance of one rule but shifted to another neuronal firing state when a new rule is learnt. Interestingly, when the same rule is presented a second time within the same session, neuronal firing does not revert back to the original neuronal firing state, but a new activity-state is formed. Our data indicate that neuronal firing of prefrontal cortical neurons represents changes in strategy and task-performance rather than specific strategies or rules. Population activity of neurons in the prefrontal cortex has been shown to represent cognitive strategy and rules. Here the authors report that when the same rule is repeated on multiple occasions in the task, it is accompanied each time by a new prefrontal firing rate state. We aim to address the question how a certain behavioural strategy, applied on two different occasions within the same session, is represented in the neuronal firing rate of the prefrontal cortex. The prefrontal cortex is a central structure for executive control of flexible behaviour to assess new rules and strategies, not only in humans5 but also in monkeys7 and rodents10, and is highly interconnected with other brain regions12 indicative of an integrative structure13 and a multifunctional role during cognitive tasks14. The importance of the prefrontal cortex is highlighted by neuronal firing patterns contributing to error-related activity17, working memory23, decision making28, and reward encoding33. It has been shown that lesions of the medial prefrontal cortex lead to an impairment of the ability to follow changing spatial rules34. Prefrontal neurons also change their firing activity when animals are switching between different strategies1. This indicates the importance of the prefrontal cortex for rule-guided behaviour. In addition, behavioural rule changes can lead to abrupt neuronal population activity changes within a very short period of time2. Furthermore, abrupt and coordinated changes of neuronal firing have been reported when animal behaviour reflects uncertainty and evaluation of possible new strategies3. However, the following questions remain unclear: (1) how multiple and consecutive changes of strategy would be reflected in the firing of prefrontal neurons and (2) how the same repeated strategy would be represented on different occasions.In ancient Greek, Heraclitus famously stated that “No man ever steps in the same river twice, for it’s not the same river and he’s not the same man”. He referred to the ambiguity that conscious actions and plans are never truly experienced the same way, however similar they may appear. Earlier research demonstrated how distinct behavioural rules and strategies are entailed in the activity of prefrontal neurons10. In our task design, animals managed to perform under multiple rules during a single recording session, which allowed us to study the neuronal representations when animals changed new rules and acquired new strategies. Additionally, we examined how neuronal population states are changing during the presentation and repetition of multiple rules in the course of a single session.To address neuronal computations in consecutive rule presentations, we used single-unit recordings in freely moving rats to assess neuronal activity during a prefrontal cortex-dependent rule-switching taskThe results of this study show that the neuronal population forms a different and stable firing-state every time a new rule is learnt, even when the same rule is presented twice during the same session. This implies that the concerted neuronal population in the prelimbic cortex does not represent individual rules permanently, but it reflects a change of strategies.n = 5) performed a strategy-switching task with multiple rule changes  within each behavioural session . However, during egocentric rules, the removal or addition of landmarks did not alter performance (p = 0.53)  Fig. . This inn = 95, 54, 74 and 84 for the entire trial, run, reward and inter-trial period, respectively) with either significant negative or positive correlations between their firing rate and task performance  in different trial segments . By examining the firing rate of individual neurons during consecutive trials and different behavioural segments, we observed the following two groups of neurons Fig. : 1) pos posn = 9nts Fig.  indicate38, we divided neurons into two groups: one group of neurons with firing rate higher or equal to 10 Hz, in which an enriched—but not exclusive—population of fast-spiking interneurons is expected, and another group of neurons with firing rates lower than 10 Hz, in which an enriched—but not exclusive—population of pyramidal cells is expected .As fast-spiking GABAergic interneurons might be important for computations involving negative feedback and conflicting resultsted Fig. . When co2. However, the neuronal state dynamics remain unclear when multiple rule changes are presented in the same recording session. As the activity of the prefrontal cells reflects behavioural performance, we tested changes in population activity during multiple rules presentations in a single recording session. For this, each trial was represented as a population vector of neuronal activity: T. For this analysis, we only used trials during learning and learnt phases of the presented rules. We excluded naive phases because they consist of mainly persistent behaviour of the animal still following the previous rule  between observed and shuffled data, when the clusters were defined by the centre of mass. Overall, due to the observation that N-dimensional population vectors of neuronal activity can be clustered, this implies that neuronal activity of the prefrontal cortex holds some form of a representation of rules.The neuronal state representation in the prefrontal cortex changes during rule switchesule Fig. . We obseule Fig. . To test39, which may account for the clustered organisation of our data across consecutive trials and rules. To address this possibility, we performed a multiple linear regression in which we explained the distance between the N-dimensional centres of two clustered rules either by the number of trials (as a measure of time) or by the number of rules separating them. The distance between two rules was calculated by measuring the Euclidean distance between the N-dimensional centres of mass of both clusters. The resulting plane of the regression showed a significant explanation of the distance due to the number of rules in between (p = 2.81e−08) but not due to the trials in between . To further elucidate the contribution of both time and rules to the distance between the rules, two partial correlations were calculated  when the number of rules in-between is taken into account. On the contrary, the partial correlation of the distance of two rules and the number of rules in-between is significant , even when the number of trials in-between is taken into account. Moreover, when Mahalanobis distance was used instead of Euclidean, similar results were obtained. The Mahalanobis distance between clusters is significantly explained by the number of rules (p = 4.756e−05) but not by the number of trials in between the clusters (p = 0.76405). In addition, the interaction term is not significant (p = 0.646). The partial correlations, using Mahalanobis distances, follow the same tendency , Spearman correlation). Overall, this data indicates that the distance of firing vectors between rule clusters is better explained by the presentation of rules per se, rather than by time that has passed between rules, suggesting that rule-dependent switches in strategy may drive the population activity rather than just the passing of time.Nonetheless, it has been shown previously that representations in the prefrontal cortex are drifting over timen p = 2.8e−08 but ted Fig. . The parp < 1e−20, Logistic regression − > p < 1e−20). These analyses suggest that the neuronal firing state during a rule repetition is different from the firing during the initial rule.Having discovered a clustering of neural firing patterns in the prefrontal cortex based on rules, this leads to the question whether those firing patterns could reflect persistent representations of a specific rule. To address this question, we presented the animals with the same rule twice within a single recording session Fig. . Strikinp = 0.58, Wilcoxon rank-sum test and Supplementary Fig. p = 0.248, Wilcoxon rank-sum test), indicating that the repetition of the rule is perceived by the prefrontal cortex’s neuronal population in a similar way as if another new rule was presented.Interestingly, both the Euclidean and Mahalanobis distance between two repeated rules are not significantly different from the distance between two different rule clusters with the same number of rules in between  than those between trials only within ‘A’ with very different trajectories. This implies that the trajectories per se do not explain the separated clustering of the rule repetition.It is known that firing in the prefrontal cortex neurons reflects animal trajectories and movementent Fig. . Differeent Fig. . We compent Fig. . Even foa, b, c are the coefficients of the quadratic equation and ‘s’ is the speed in m/s in a given trial ‘T ’.However, trajectories and speed still might have a more subtle effect. Therefore, we modelled the firing rate of a neuron by using the coefficients of the quadratic equation and the speed of the animal as follows: r = 0.9123, p < 1 × 10−20 and r = 0.9326, p < 1e−20, Spearman correlation).As expected, close to a 30% of the neurons showed a significant correlation to at least one of the coefficients in each of the 4 possible paths (Supplementary Table p = 0.00053) and not the number of trials in between (p = 0.97). In addition, there is not a significant difference between the distances from data of non-repeated and repeated rules .Moreover, projections of the residuals on the first two principal components of the multi-unit activity, still remain clustered Fig.  and ruleOverall, these results support that both the neuronal representations of cognitive rules and the new formation of a neuronal firing state upon the repetition of a rule are not an artefact of the movement of the animals.1. We managed to assess multiple rule changes within the same session, which allowed the possibility to study neuronal population dynamics while following several behavioural changes in strategy. We found two complementary neuronal groups, which dynamically changed their firing during behaviour and their firing rates were significantly correlated with performance. In addition, when multiple rules were presented on the same day, neuronal populations formed new neural states for each rule, even when the same rule was presented twice.To investigate the computations of neuronal populations in the prefrontal cortex during flexible behaviour, we recorded neuronal activity while animals were performing a prefrontal cortex-dependent strategy-switching task41, reward44, encoding of memory and executive functions46 or confidence24. But how do diverse firing patterns adapt when the strategy of an animal changes? Lesions48, optogenetic inactivation49 and pharmacological inactivation10 of the prefrontal cortex have been reported to induce impairment in cognitive flexibility. In the prelimbic cortex, changes in firing rates of single neurons50 and neuronal populations51 have been observed in relation to flexibility in strategy during a rule switching task. Often those changes are presented as a global change of activity and might relate to a complete switch to a different network state, as shown for synchronised changes of neuronal populations during an uncertainty task3. In fact, after lesioning the medial prefrontal cortex, animals could not follow a change of spatial related rules34.Neurons in the prefrontal cortex have a multitude of different firing patterns, which reflect many aspects of the external environment as well as internal computations, including goal-related firing52. This may contribute to the reason why neuronal ensembles in the prefrontal cortex often present abrupt changes in activity whenever a new strategy is behaviourally required2, denoting a flexible state. During the subsequent learning of the new rule, the representation of neuronal responses tends to be more stable and less sensitive to noise53. We show that firing rates of individual neurons are correlated with the behavioural performance of the rat during a rule switching task. We observed two groups of neuron with a different performance-related activity. For one group of neurons, the firing rate was negatively correlated with the performance of the animal, while for a second, complementary group of neuron, there was a positive correlation. Additionally, we also show that these correlations can be found without taking into account the firing information during reward, demonstrating that it is not only a reward-monitoring value of performance. These complementary neuronal assemblies with opposite correlations between firing rate and performance might reflect the simultaneous ability of the network to maintain rewarding behaviours and perform the task with high success or to induce flexible changes when the success rate is low.We assessed how changes in network activity are related to the performance of the animal during multiple rule changes that are presented within the same session, reflecting a high demand on cognitive flexibility. In order to perform a goal-guided behaviour, often the right choice between stability and flexibility has to be found. Thus, the prefrontal network operations should be flexible enough to take into account different sensory inputs and experiences, which provide evidence for a different and more successful strategy, but at the same time should remain stable enough to ignore irrelevant information2, we show that vector populations of trials belonging to the same rule tended to be clustered together, in contrast to vector populations with an intrinsic random organisation. However, by examining the neuronal population dynamics using population vectors, we extended the rule-change analyses to multiple rule changes presented during the same recording session, including in some cases the repeated presentation of the same rule. Not only was each rule reflected by an independent state representation or “rule cluster” different from firing during other rules, but when the same rule was presented again later in that session, the second presentation fell into a new network state, different from the first presentation of this particular rule. Our results suggest that identical rules in a prefrontal cortex-dependent task will not lead to a similar neuronal encoding, but rather to a new set of prefrontal network activity. In line with Heraclitus’s quote, we provide evidence that the same action plan is not “perceived” identically a second time, as the new experiences shaped a new cognitive state. One explanation for this phenomenon might be that firing rates of the prefrontal cortex are context dependent57 and could be influenced not only by past events but also by multiple inputs that the prefrontal cortex is receiving from other areas58. This implies that even when the rule is the same in the second presentation, the actual context in which the rule has been presented differs from the previous presentation. Indeed, due to the fact that time has been shown to be responsible for state changes or drifts in the neuronal activity of the prefrontal cortex39, we decided to test the contribution of time for the new encoding of the repeated rule. Interestingly, when corrected by the number of rules appearing, time was no longer explanatory for the drift , were kept in 12 h light cycle during behavioural experiments (performed during light cycle). All experimental procedures were performed under an approved licence of the Austrian Ministry of Science and the Medical University of Vienna.® 2%) was used before the incision. In order to avoid dehydration, saline solution was injected subcutaneously every 2 h. Seven stainless steel screws were anchored into the skull to improve the stability of the construct and two of the screws were placed onto the cerebellum as references for the electrophysiological recordings. Subsequently, based on the rat brain atlas63, a craniotomy was performed above the prefrontal cortex area , where, after removal of the dura mater, an array of 12 independently movable, gold plated (100–500 kΩ) wire tetrodes  mounted in a microdrive  were implanted. Then, paraffin wax was applied around the tetrode array and the lower part of the microdrive was cemented (Refobacin® Bone Cement) to the scalp. At the end, the surgery site was sutured and systemic analgesia  was given. Animals were given post-operative analgesia (Dipidolor 60 mg diluted per 500 ml drinking water) and were allowed at least 7 days of recovery time.Animals were anaesthetised with Isoflurane  and fixed on a stereotaxic frame, where body temperature was stabilised using a heating pad. Iodine solution was applied to disinfect the surgery site and eye cream was used to protect the corneas. Local anesthetic . The maze consisted of a plus-maze  composed of four arms (80 × 11 cm) with a 90° angle separation between them. Two opposite arms (named North and South) were starting arms and the other two (named East and West) were rewarded arms. The maze was located within four synthetic wall panels to maintain the uniformity of the environment. Three landmarks  were visible and attached to different panels. Reward  was delivered by dispensers (Campden Instruments Ltd). The entire automation of the maze (sensors and pellet feeder controls) was controlled by self-made scripts in MATLAB. Tracking of the rats’ movement was monitored by triangulating the signal from three LEDs  placed on the implanted headstage and recorded at 25 frames per second by an overhead video camera (Sony). One week after surgery, habituation to the maze started. Rats were food-restricted to maintain 85% of their weight. First, during two consecutive days, animals were placed inside of the recording room for a period of around 1–3 h. From the third day on, rats were placed in a ceramic bin at the centre of the maze for an hour and were later positioned on the maze in order to start exploration. Some sugar pellets were placed on the maze and several more at the reward zone. Once the animals learned to explore the maze and consumed the sugar pellets , they were habituated to the activation sound of the pellet feeders, by only giving reward once they entered the reward zone and activated the pellet feeder. After that, the training phase started. It consisted of manually placing the animals at one of the two possible starting points; in this case, the rats had to reach any of the two reward zones, where the reward was given indistinctly. After reward was consumed, rats were manually placed in the bin located at the centre of the maze. Once 30–50 trials were successfully performed by the rat, the full strategy switching task was presented on all subsequent sessions with either rewarded or non-rewarded trials, depending on the actual rule and decision. A typical recording day took place as follows: The rat was kept for 10 min inside of the ceramic bin at the centre of the maze, where baseline recordings were made. Then the task started and the initial rule to be presented was given pseudo-randomly by the script used to control the maze and the task. The animal was taken from the bin and located at one of the two possible starting positions (North or South pseudo-randomly selected) and the bin, where the animal was before was placed to block the opposite starting arm. The rat then ran towards one of the two possible goal arms. After crossing a sensor located at the end of the arm, reward was given in case of being correct. Independently of the correctness of the trial, the animal was taken 2 or 3 s later, placed again in the ceramic bin at the centre of the maze, and after 3–7 s the rat was placed again at one of the two possible starting arms and a new trial was started. The same starting arm could not be selected more than four consecutive times. During the task, when an animal achieved 13 out of 15 possible correct trials, the rule was changed without warning. Four different rules were presented in the task 1: naive ; learning ; and learnt (over 0.6).A strategy switching task based on the consecutive learning of allocentric and egocentric spatial navigation rulesask Fig. : two areThe data presented here correspond to behavioural controls and electrophysiological recordings. Behavioural controls were performed in two animals with a total of 48 rules tested  in 17 sessions performed. The electrophysiological data corresponds to 26 sessions performed by 3 animals . In total, 66 rules changes were achieved (median number of changes per session = 3). For each session, the rules were selected pseudo-randomly (trying to secure at least a switch between strategies and a change of rules within the same strategy). The median number of trials per session is 98.5 trials.64.A headstage  was used to pre-amplify the extracellular electric signals from the tetrodes. Output signals were amplified 1000 × via a 64-channel amplifier and then digitised with a sampling rate of 24 kHz at 16-bit resolution, using a 64-channel analogue-to-digital converter computer card (Axona Ltd). Single-unit offline detection was performed by thresholding the digitally filtered signal (0.8 – 5 kHz) over 5 standard deviations from the root mean square on 0.2 ms sliding windows. For each single-unit, 32 data points (1.33 ms) were sampled. A principal component analysis was implemented to extract the first three components of spike waveforms of each tetrode channel65. Using the Klusters software66, individual single units were isolated manually by verifying the waveform shape, waveform amplitude across tetrode’s channels, temporal autocorrelation (to assess the refractory period of a single-unit) and cross-correlation (to assess a common refractory period across single-units). The stability of single-units was confirmed by examining spike features over time.Spike waveforms from individual neurons were detected using the KlustaKwik automatic clustering softwareAt the end of recordings, animals were anaesthetised with urethane and micro-lesions were made at the tip of the tetrodes by using a 30 µA unipolar current for 10 s . Rats were perfused using saline solution, followed by 20 min fixation with 4% paraformaldehyde, 15% (v/v) saturated picric acid and 0.05% glutaraldehyde in 0.1 M phosphate buffer. Serial coronal sections were cut at 70 µm with a vibratome (Leica). Sections containing a lesion were Nissl-stained to verify the position of the tetrodes.Firing rates were determined in each recording session and for each neuron by dividing the number of spikes over the corresponding time of the trial. Every trial started the moment that the rat initiated movement from the starting arm towards the end arm. The trial can be divided into 3 different behavioural segments , plus another segment which consists on the entire duration of the trial. The run segment was defined as the period from the beginning of rat movement, at the starting arm, towards the reward arm, until the rat crossed a reward sensor located 10 cm at the terminal part of the rewarded area. The reward zone segment was defined as two seconds starting from the moment the animal crossed the reward sensor. The inter-trial segment was defined from the end of the reward segment until the beginning of the next run segment . The entire trial spans from the start of a trial until the start of the next one. Therefore, in total, 4 firing rates were calculated by counting the spikes present during the specific segment and dividing it by the time spent in that segment. The average length (in seconds) for each segment , specified as median, 25th and 75th percentile were: Run , Inter-trial  and the entire trial .mxn, where ‘m’ are the trials and ‘n’ the number of neurons, together with a response vector  RVmx1, shuffle was performed by rearranging the rows of both the firing rate matrix and the response vector, therefore disarranging the temporal organisation of the recording session but keeping the relation between firing rate and responses. The performance was recalculated over this new shuffled data, generating a shuffled performance curve, which was later correlated with the firing rates.Correlation of individual firing rates for each different segment and the entire trial were correlated to the observed performance of the animal using Spearman correlation. In addition, Bonferroni–Holm correction was used to correct for false positives. For the comparison made in Fig. z-scored firing rates of the neurons recorded during that sessionn’ in that specific trial  and Mahalanobis (2) distances were used, ending up with similar results. Euclidean distance is defined as follows:Ta and Tb, defined by the firing rate (FR) of all neurons ‘n’ at that trial Given two trials (or centre of masses of rule clusters) Mahalanobis distance was used mainly between a trial and a rule cluster; therefore, it is defined as follows:n is the mean firing rate of a cell (n) over all the trials conforming the rule cluster, the Mahalanobis distance between the trial and the rule cluster is:Given a trial −1 is the inverse of the covariance matrix.where the operator (‘) is the transpose and SThe similarity index was defined as the normalised Euclidean distance between the coefficients of the quadratic equation modelling a trajectory. The higher the index, the more different are the trajectories.m) can be represented with the coefficients of a quadratic equation:Any given trajectory (TR) in a trial  between two trajectories is defined as:where Clustering was performed using the K-means clustering algorithm. This method requires the number of clusters to be given, and initialisation of the cluster centres (one per cluster to be found). Then, we computed the distance from each point to each centroid and assigned the point to the centroid from which the shortest distance is measured. Thus, a new centroid is calculated from the newly assigned points and the iteration continued until it found a balance (no change in the assignment of new points). For the data in Fig. z-scored firing rate of all the neurons during that trial) to belonging to a given rule ‘A’. The following procedure was done in each recording session, which contained a rule repetition (‘A’ as the rule and ‘A°’ as the rule repetition): Classifiers were trained with a set consisting of random selection of 70% of the trials of rule A, labelled as ‘1’, and the rest of trials of the other rules labelled as ‘0’. Trials of the rule repetition ‘A°’ were not included in the training set. Classifiers were later tested by a data composed of the trials in the rule repetition ‘A°’ and the remaining 30% of trials of rule ‘A’, not used in the training set. Due to the random assignment of trials of rule ‘A’, to both training and test set, the procedure was repeated 1000 times. Figure A logistic regression and a support vector machine with linear kernel were used to create two classifiers which classify a trial  and statistical analyses were performed with MATLAB and Microsoft Excel. All the statistical tests used were non-parametric with Bonferroni–Holm correction unless stated differently in the text. The data used in linear regressions were checked for homoscedasticity. The principal component reduction was performed using a dimensionality reduction toolbox for MatlabThe computer code that supports the findings of this study is available from the corresponding authors upon reasonable request.The data that support the findings on this study are available from the corresponding authors upon reasonable request.Supplementary InformationPeer Review File"}
{"text": "The Gram-positive Group A Streptococcus (GAS) is a pathogen that infects multiple tissues in the human host. The virulence regulator Mga in GAS can be phosphorylated by the PTS, affecting Mga activity based on carbohydrate availability. Here, we explored the effects of glucose availability on the Mga regulon. RNA-seq was used to identify transcriptomic differences between the Mga regulon grown to late log phase in the presence of glucose (THY) or after glucose has been expended (C media). Our results revealed a correlation between the genes activated in C media with those known to be repressed by CcpA, indicating that C media mimics a non-preferred sugar environment. Interestingly, we found very little overlap in the Mga regulon from GAS grown in THY versus C media beyond the core virulence genes. We also observed an alteration in the phosphorylation status of Mga, indicating that the observed media differences in the Mga regulon may be directly attributed to glucose levels. Thus, these results support an  In fact, many pathogens have been shown to coordinately regulate the expression of carbohydrate metabolism genes with disease progression during in vivo studies9.Coordinated expression of virulence factors is essential for bacterial pathogens to successfully colonize and elicit an infection in the host. Since expression of virulence genes is often linked to the availability of essential nutrients such as carbohydrates, pathogenic bacteria often utilize carbon catabolism regulatory pathways to sense the presence of preferred carbohydrates and repress the genes involved in alternative sugar utilization1 via two cytoplasmic enzymes, EI (ptsI) and Hpr (ptsH), and several sugar-specific EII components. Each EII comprises two cytosolic subunits (EIIAB), an integral membrane transporter (EIIC), and sometimes a second membrane component (EIID). Phosphotransfer begins when the PEP generated from glycolysis transfers its phosphate to EI, which then is transferred to Hpr on His-15, then a a sugar-specific EIIA, then EIIB and finally to the transported sugar via its EIIC1. When Gram-positive bacteria are in nutrient rich conditions, Hpr is phosphorylated at Ser-46 by the kinase, HprK, allowing HprSer~P to dimerize with the carbon catabolite protein, CcpA, and elicit carbon catabolite repression (CCR) by binding to catabolite response elements (cre) found in promoter sequences10. In the absence of a preferred carbon source, Hpr-His15~P and EIIB~P are capable of phosphorylating histidines within PTS regulatory domains (PRDs) of transcriptional regulators , regulating their activity and the expression of non-preferred sugar operons1. Thus, the PTS represents a signal transduction network through which Gram-positive pathogens alter gene regulation in response to carbohydrate utilization.The phosphoenolpyruvate (PEP)-phosphotransferase system (PTS) allows bacteria to uptake carbohydrates and monitor carbon utilizationStreptococcus pyogenes) is a Gram-positive pathogen that can colonize a variety of tissues in the human host, resulting in both life-threatening invasive as well as benign diseases. Each year around the world, GAS elicits over 700 million self-limiting infections and results in more than 500,000 deaths due to invasive infections and nonsuppurative sequelae11. Both ex vivo and in vivo studies have established that GAS exhibits significant changes in its transcriptome during infection15. As a fastidious fermentative organism that relies heavily on carbohydrates, metabolic genes under CCR are induced in vivo and are often required for full virulence in GAS21, directly linking GAS carbohydrate metabolism and virulence. Here we use the M1T1 strain 5448, a representative of one of the most prevalent serotypes of GAS isolated from invasive forms of infections worldwide.The Group A Streptococcus , including transcription of several sugar transport and utilization operons27. The ‘core’ Mga regulon consists of virulence genes critical for attachment and immune evasion such as M protein (emm), the emm-superfamily , C5a peptidase (scpA), and fibronectin-binding protein (fba)28. The Mga regulon was found to be expressed during the acute phase of GAS-mediated pharyngitis in macaques concurrently with the PTS and sugar metabolism operons15. Taken together, these data underscore that Mga and its virulence regulon are linked to carbohydrate utilization.GAS utilizes global transcriptional regulators such as the ubiquitous stand-alone regulator Mga to coordinate transcriptome changes impacting virulence29. Genetic, biochemical, and structural studies on the homologous Bacillus anthracis toxin regulator, AtxA, indicate that it is also a PCVR33. Two reiterative PRD domains (PRD-1 and PRD-2) of Mga allow PTS phosphorylation to impact its function likely through controlling dimerization of the carboxy-terminal EIIBGat-like domain comparable to AtxA and other Gram-positive sugar-specific PRD-containing activators34. Although it is known that Mga activity is modulated by the PTS, we still do not know whether carbohydrate availability affects Mga-dependent gene regulation. In this study, we explored the effects of glucose availability on Mga and its impact on the Mga regulon. RNA-Seq was used to identify transcriptomic differences between the Mga regulon grown to late exponential phase either in the presence (THY) or absence (C media) of glucose. We observed that Mga was differentially phosphorylated in THY in comparison to C media, which led to a high degree of plasticity of the regulon that is correlated to glucose availability.Mga belongs to a novel family of PTS regulatory domain (PRD)-containing virulence regulators (PCVR) that allows the PTS to directly phosphorylate and affect the activity of Mga based on carbohydrate availability35. Here, we wanted to assess whether the presence or absence of glucose in the environment has an impact on the Mga virulence regulon of the M1T1 GAS 5448. The rich Todd-Hewitt Yeast (THY) media has an initial level of 0.5% glucose (w/v) and was used as a representative of a glucose-rich environment, while C media has a much lower initial level of 0.05% glucose (w/v) and was used to mimic a low- or no-glucose deep-tissue environment35. We directly assayed the change in the concentration of carbohydrates (primarily glucose) in THY  and C media  over an 8-h time course during GAS 5448 growth  and a p value of ≤0.05 were considered significant  were found to be differentially expressed  in C media compared to THY Fig. . Analysii.e., CCR) through directly binding to cre sites under favorable glucose-replete conditions. Since C media contains no glucose at the time point taken, we predicted that CCR would be relieved. 119 (~24%) of the genes differentially expressed in C media , mannitol (spy_1664), galactose (spy_1399), both cellobiose operons (spy_1079–1083 and celB), and trehalose (treCB). The ABC transporters for sialic acid (spy_0213–0215) and cyclomaltodextrin  were also upregulated. Interestingly, the β-glucoside-specific EIIABC and both mannose operons ptsABCD and manLMN were repressed in C media, suggesting they may represent sugar uptake systems for more preferred sugars  sugars were induced during late logarithmic phase growth in C media. These included many alternative PTS carbohydrate EII transporter genes such as those for 3-keto-L-gulonate (has (capsule synthesis) and sag (Streptolysin S) operons; which are also under CCR18. Although there is a considerable overlap between the C media and CcpA regulons, there were also media-specific regulatory phenotypes. An additional 25 genes found in this study have been previously shown to be regulated by CcpA18, but were regulated in a different direction. Interestingly, we observed a significant increase in the expression of the lacD.1 operon and rgg/ropB, both of which encode for regulators of the secreted cysteine protease virulence factor gene speB. C media is an inducer of speB expression in M14 GAS35; however, we did not see speB being differentially expressed in M1T1 GAS 5448. We also found several genes of the core Mga virulence regulon to be down regulated in C media  and the C5A peptidase (scpA) were down regulated.Several virulence-related genes were upregulated during growth in C media, including the mga itself, is also reduced in C media compared to a glucose-rich environment.Taken together, the transcriptome of M1T1 GAS 5448 in C media exhibits similarity to the release of CcpA-mediated repression likely due to the absence of glucose in C media at late logarithmic phase. Additionally, expression of some of the Mga regulon, but not mga itself, we hypothesized that the Mga regulon in these two medias would vary. An insertional inactivation of mga in M1T1 5448 was constructed using a temperature-sensitive plasmid to generate the mga mutant, 5448.930 (see Methods). Growth kinetics of 5448.930 were found to be comparable to WT 5448 in both THY and C media (data not shown). Total RNA was isolated in two biological replicates from the WT 5448 and the ∆mga mutant grown in either THY (+glucose) or C media (low glucose) to late logarithmic phase and processed for RNA-seq as described in Methods. Data obtained from the WT 5448 was compared to the ∆mga grown cells in either media (WT/∆mga) with changes in gene expression over 1.8-fold (log2 ≤ −0.90 or ≥0.90) and a p value of ≤0.05 considered significant , showing between 7-fold to 18-fold reduction in transcript levels in the ∆mga mutant (Table S4). Interestingly, we did not observe a Mga-specific phenotype for sclA in our RNA-Seq datasets, a gene considered to be part of the core Mga regulon39. The mga mutant 5448.930 was passaged at the permissive temperature to generate the 5448.930R rescue strain as a complement control  encoded in the GAS genome, the second of which is not regulated by Mga.The most activated genes in both media conditions were those of the core Mga regulon  were significantly regulated by Mga with approximately equal numbers of repressed (73) and activated (75) genes , exhibited 4-fold lower transcript in the mutant compared to WT 5448  and its inhibitor (spi) in the M1T1 5448 background in THY  that were regulated by Mga  in C media, representing 7.2% of the GAS genome  was also activated by Mga. In addition, the phage-encoded streptodornases sdaD2 (Sda1) and spd3 (Spd-3) were also regulated by Mga in C media, with both exhibiting ca. 5-fold reduction in a ∆mga mutant  that could be complemented upon glucose supplementation, indicating that Mga regulation of this streptodornase occurs in a glucose-dependent manner. In support of this finding, E64-treated (cysteine protease inhibitor) supernatants from ∆mga mutants grown to late logarithmic phase in C media exhibited a decrease in steady-state Sda1 levels compared to WT 5448 . As with THY, the chromosomally-encoded sagA-H), Streptolysin O (slo), Streptokinase (ska), Streptococcal secreted esterase (sse), the heme utilization operon (hupYZ), and the osmotic stress operon (opuAA/opuABC) were regulated by Mga only in the glucose-depleted C media , mac (IgG-degrading protease), spd , M5005_spy0522 (sugar hydrolase), M5005_ spy0143 , and spxA.2 . Despite the stark difference in genes that are regulated by Mga in a glucose versus a no glucose condition, the broad COG categories represented were not different. In THY, the top three categories of Mga-regulated genes were unknown function , carbohydrate utilization , and defense mechanism/virulence   in comparison to THY (+glucose) Fig. . We wereTHY Fig.  and emm,speB in THY at late log phase  the majority of the changes appear to be specific to glucose availability, and (2) some changes in the regulon dynamics are due to C media-specific differences.Mga was shown to repress the transcription of mga itself was not affected (Table 3 an M4 ∆mga (79% identity to M1 Mga) GAS strain (KSM547) that expressed a His-tagged version of either WT Mga (pKSM808) or a phosphoablative A/A/A Mga (pKSM871) that substitutes all three PTS-phosphorylatable histidines with alanines from a replicating plasmid (see Methods). The two strains were grown in either THY or C media to late log growth, whole cell lysates were isolated, and separated by Phos-tag SDS-PAGE for Western blot using α-Mga4 antibodies. The blot revealed two bands for WT 5448 lysates grown in THY, a slow-migrating more diffuse upper band arising from phosphorylated Mga at one or several of 3 potential histidines  and a larger fast-migrating band corresponding to non-phosphorylated Mga . In C media at a point where glucose is depleted, the slow-migrating Mga4~P-His6 is reduced, indicating less PTS phosphorylation  compared to C media (low glucose), yet ed Table . Since Mion Fig. . As wouldia Fig. . The ratach Fig. . This shach Fig. . While aemm and mga itself. There was a strong correlation between the genes activated in C media (low glucose) with those known to be repressed by CcpA, indicating that C media relieves CCR. Interestingly, when comparing the Mga regulon in both medias, we found very little overlap beyond the core virulence genes, despite regulating similar functional categories (COGs). Many of these differences in Mga-regulated genes between the two medias could be directly attributed to glucose levels, which led to an alteration in the PRD-mediated phosphorylation patterns of Mga. Thus, Mga and its regulon are likely influenced by glucose and further support an in vivo link between glucose availability and virulence regulation in GAS.The current study was undertaken to assess how glucose affects global transcriptional changes in the GAS cell through Mga. Our RNA-seq results revealed that in the WT M1T1 5448 some of the Mga regulon is up regulated in THY (+glucose), but not cre) sites. Metabolic genes that enable the utilization of alternative (non-glucose) sugars are classically induced in the absence of the preferred carbohydrate source, glucose. For GAS, two studies have determined the genome-wide, CcpA-induced regulons in M1T1 serotype18, which found that ~8% of the GAS genome was regulated by CcpA in THY. Here, we observed that 16% of the GAS genome was differentially expressed when grown in the absence of glucose (C media at late log phase), which overlapped with the published CcpA regulons18. Thus, it appears that the lack of glucose encountered by GAS in C media at this point in growth is capable of relieving CCR and stimulating the transcription of alternative carbohydrate uptake systems. Although there are clear commonalities, our data also showed that GAS undergoes a much broader transcriptomic change during growth in C media  when compared to growth in THY  is controlled by the master regulator, CcpA, through direct binding to catabolite response elements  grown to late-logarithmic growth in THY, involving ~10% of the GAS genome that encompassed mostly virulence and carbohydrate metabolism genes27. Recently, RNA-seq of Mga-regulated genes in an M59 (mga-2) serotype, also at late-logarithmic growth in THY, revealed ~7% of the genome was involved, primarily related to virulence, metabolism, and unknown functions29. Our RNA-seq results revealed that the Mga regulon in an M1T1 GAS strain under similar growth conditions regulated ~8% of the genome, in line with the recent M59 regulon. Although the M1 (SF370) and M1T1 (5448) strains analyzed differ by only 7% in their genomes (mostly prophage content), comparison of the Mga  regulon datasets revealed very little overlap. A similar trend was observed when regulons from strains expressing two mga-2 alleles (M59 and M4) were compared29. We saw that SF370 and 5448 shared only 8 Mga-regulated genes that were regulated in the same direction, with 5 genes being members of the core Mga-regulated virulence genes , although the degree of activation appears to vary29.The Mga regulon was initially determined by our group based on microarray analysis of 3 diverse serotypes representing both lacG , lctO (lactate oxidase), and M5005_spy0143 . Both lacG and lctO are involved in lactose metabolism. LctO converts lactate into pyruvate and leads to production of hydrogen peroxide (H2O2) in a growth phase- and glucose-dependent manner through direct repression by CcpA19. In S. pneumoniae, increase of H2O2 production acts as a virulence trait that aids in colonization by slowing the clearance of bacteria through the inhibition of ciliary beating in the upper respiratory tract and by promoting bactericidal activity to outcompete other microbial species from the microflora44. Therefore, it’s possible that Mga activates the transcription of lctO in order to up regulate hydrogen peroxide production just enough to aid in colonization, which is the stage of infection that correlates with the highest level of Mga activation15. Interestingly, M5005_spy0143 encoding a small hypothetical protein was also found to be regulated in C media  were both observed as being repressed by Mga in M1T1 5448 grown in THY  DmgB, both of which are homologs of Mga24. Therefore, a potential link between bicarbonate transport and Mga gene regulation may exist. Since the number of genes that overlap between the THY and C media Mga regulon are so few, we propose that this set of nine novel genes may also be a part of the core M1T1 Mga regulon.In both THY and C media, Mga regulates the same approximate number  of the non-prophage GAS genome and representing comparable COG categories Figs  and the sda1and spd3) were activated by Mga in C media  in vivo51. It has been suggested that in the covS+ M1T1 MGAS2221, the Mga regulon, not Sda1, plays a much more important role in the covS switch in vivo52. It may be that during invasive infection with covS+ M1T1 strains, a glucose-deplete environment leads to Mga-dependent activation of sdaD2 (and other streptodornases) that impacts the covS switch.Both M1T1 phage-encoded DNases  in C Media (Table emm was not observed. Two possibilities for the reduction of Mga regulon expression in C media compared to THY are: (1) CcpA has been shown to bind to a cre site located upstream of the P1 promoter region of mga and stimulates transcription53; therefore, in the low-glucose environment of C media, CCR is relieved, causing a decrease in expression of the Mga regulon under a low glucose condition. Alternatively, (2) PTS-mediated phosphorylation of Mga activity may impact regulation of the core genes29. The latter scenario is the most probable, as the transcript levels of mga were not significantly different between THY and C media, indicating possible posttranslational modification. The lack of differential emm expression is not clear at this time and we are exploring this mechanism further.We observed a 4- to 5-fold repression of some core Mga regulon genes  would result in an active non-phosphorylated Mga and remain active. Hence this would help explain the activation of the regulon in THY over C media  no phosphorylation produces an active Mga, (2) phosphorylation on only PRD2 can cause an increase in activity, and (3) phosphorylation on PRD1 inhibits Mga activity, and is dominant over PRD2 phosphorylation no phospet al.3, since glucose is initially present in both THY and C media. Further, since RNA was isolated from strains grown to late log, there still may be a small but significant amount of glucose present in C media to maintain the phosphorylation status of Mga. Regardless, we now believe it may not only be the level of glucose that is important for Mga activity, but the mere presence of it during growth which could affect the phosphorylation status of Mga. The unphosphorylated band for the A/A/A Mga in both C media and THY indicates that phosphorylation by the PTS occurs at the phosphohistidines on the PRD domains of Mga.Surprisingly, Mga from GAS grown in THY showed two bands on a Phos-tag gel representing a phosphorylated and unphosphorylated species. In C media, far less of the phosphorylated form of Mga was observed, while the phosphoablative (A/A/A) construct was unphosphorylated under both media conditions Fig. . TherefoThis work shows that glucose directly affects Mga activity and the composition of the Mga regulon. Furthermore, the differences between the regulons in the presence or absence of glucose is most likely attributed to a phosphorylation event that occurs on the phosphohistidines located on the PRD domains of Mga. While it is unclear which phosphohistdine(s) are affected and the mechanism by which Mga is able to regulate genes alternatively, it is clear that in the presence of glucose, the PTS plays an important role in activating this global transcriptional regulator and virulence genes downstream.Streptococcus pyogenes (GAS) strain M1T1 544854 is isolated from an invasive infection. The reference genome used in this study was generated from the M1T1 strain MGAS500555. GA40634 is a clinical isolate of the GAS M4 serotype and SF370 is a sequenced M1 strain. KSM547 and KSM165-L are isogenic strains of GA40634 and SF370, respectively, with an insertional inactivation of the mga gene38. GAS bacteria were either cultured in Todd-Hewitt medium supplemented with 0.2% yeast extract (THY) or in C Media56 buffered to pH 7.5 with NaOH. A 25% (w/v) stock solution of glucose was used to supplement C media to the levels indicated in select experiments. GAS growth was assayed via absorbance using a Klett-Summerson colorimeter (A filter) and expressed in Klett Units.Escherichia coli (E. coli) strain DH5α (hsdR17 recA1 gyrA endA1 relA1) and C43[DE]57 were used as the host for plasmid constructions, and C41[DE3]57 was used for protein expression, as indicated in Table E. coli strains were grown in Luria-Bertani (LB) broth or ZYP-505258 for protein expression. Antibiotics were added to media, as needed, at the following concentrations: spectinomycin at 100 µg/ml for both E. coli and GAS, kanamycin at 50 µg/ml for E. coli and 300 µg/ml for GAS, and 100 µg/ml of ampicillin for E. coli.E. coli using the Wizard Plus SV miniprep system (Promega). DNA fragments were agarose gel purified using the Wizard SV gel and PCR cleanup system (Promega). PCR for generating probes and cloning was conducted using Accuprime Pfx (Life Technologies) according to the manufacturer’s recommended protocol. PCR for diagnostic assays was performed using Taq DNA polymerase (NEB). Genewiz, Inc performed all DNA sequencing. The Master-Pure complete DNA and RNA purification kit for Gram-positive bacteria  was used to extract genomic DNA.Plasmid DNA was extracted from mga from 5448 gDNA, which was amplified using the primers Mga InIn F and Mga InIn R  were identified following selection with spectinomycin and growth at the non-permissive temperature (37 °C). PCR on isolated gDNA was used to confirm plasmid insertion for each GAS mutant using primers SPR1 and SPR2  transposon mutants generated in 544859. Library #16 was screened using AP-PCR60 followed by sequencing and alignment of sequence to the 5448 genome. Transposant #1 (16.1) was mapped to the 5′-end of mga in the sense direction.A transposon insertion in 21. Briefly, Direct-zol RNA MiniPrep kit (Zymo Research) was used to isolate total RNA using a modified procedure to improve GAS cell disruption. Frozen cell pellets were resuspended in 700 µl of Trizol plus 300 mg of acid-washed glass beads (Sigma Life Science) and disrupted by vortexing for 5 min. RNA samples were DNase-treated using the Turbo DNase-free kit (Life Technologies). A total of 5 µg of this RNA was treated for ribosomal RNA (rRNA) removal using the Ribo-Zero Magnetic kit for Gram-positive bacteria (Epicentre). Quality and quantity were assessed using a 2100 Bioanalyzer (Agilent) NanoDrop 8000 spectrophotometer (Thermo Scientific), respectively. Directional RNA-Seq libraries were created using the ScriptSeq v2 RNA-Seq Library Preparation kit (Illumina) according to the manufacturer’s recommendations.RNA sequencing (RNA-Seq) was performed as previously describedA rapid-run 100 bp single-read DNA sequencing was then performed at the Institute for Bioscience and Biotechnology Research (IBBR) Sequencing Facility at the University of Maryland, College Park, using the Illumina HiSeq 1500 platform. Data were generated in the standard Sanger FastQ format and raw reads were deposited with the Sequence Read Archive (SRA) at the National Center for Biotechnology Institute (accession PRJN412519).61, filtered and trimmed using trimmomatic62 and mapped against the MGAS5005 genome (accession CP000017) using alignment software, as previously described. Differential expression analyses were performed following size-factor and quantile normalization of read counts. Limma63 and DESeq64 statistical models were used to account for batch effects. The resulting metrics of expression were visualized using Circos65, and tested for ontology enrichment using a variety of ontology software packages .Read quality was measured using FastQC21. Briefly, DNase-treated total RNA from strains were added to SYBR green master mix (Applied Biosystems) with 6.5 µl of each gene-specific real-time primer from a 20 nM stock (Table http://biotools.umassmed.edu/bioapps/primer3_www.cgi).The quantitative  reverse transcription-PCR (qRT-PCR) experiments were performed as previously described21, using cDNA generated separately in a two-step protocol in order to take into account the strand-specificity of the RNA-Seq results.RNA-Seq data validation was performed as previously describedgyrA transcripts, which acts as an internal control. Standard error was calculated from three biological replicates, and differences over 2-fold in expression were considered significant. Correlation coefficients were determined by graphing the log value of the RNA-seq result on the X-axis to the log value of the RT-qPCR on the Y-axis. The R2 value was calculated using a linear regression model, which represented the fitness of the data . Although typically used to monitor blood sugar, we used this apparatus to monitor glucose concentration of THY, CDM, and whole human blood during GAS growth. Values are given in mg/dl. Readings were taken by first inserting a test strip (AimStrip® Plus) into the monitor, placing the test strip into the culture to draw up liquid droplets, and waiting for 10 seconds for the final reading.6 was purified as previously described34. Briefly, E. coli containing the plasmid pMga1-His was grown in ZYP auto-induction media for ~50 h at 37 °C. Cells were harvested by centrifugation at 4 °C. Pellets were then resuspended in Lysis Buffer A  and 1× EDTA-free cOmplete protease inhibitor (Roche), and incubated on ice with lysozyme for 30 min followed by sonication using a Branson Sonifier 450 with a tapered microtip  pulsing 3 × 1 min with 3 min breaks on ice between cycles. The lysate was spun for clarification at 20,000 × g for 30 min at 4 °C 3–4 times. The lysate was loaded on a 5 ml NiNTA agarose resin (Qiagen) and rotated at 4 °C for 1 h. The column was then washed twice with NiNTA Wash Buffer . Protein was eluted with 10 ml of NiNTA elution buffer  and chosen fractions were stored at −20 °C. Protein concentration was analyzed using the Bio-Rad protein assay kit, reading the absorbance at 595 nm on a spectrophotometer.GAS Mga1-His34. Briefly, GAS cells were inoculated 1:20 into 12 ml of THY or C media56, grown to late-log, and pelleted by centrifugation for 15 min at 6,000 × g. Pellets were resuspended in 200 µl of Buffer D  glycerol), 1 × cOmplete EDTA-free protease inhibitor (Roche), 10 µl (20 U) of Turbo DNase (Life Technologies), and 5 µl (250 U) of PlyC71. The cells were mixed by flicking and incubated on ice for 20 min, followed by centrifugation at 13,000 × g for 10 min at 4 °C. Clarified supernatants containing soluble proteins were extracted and boiled with 3 × cracking buffer  at 95 °C for 5 min, and stored at −20 °C. Protein concentration was assayed using the Bio-Rad protein assay kit, reading the absorbance at 595 nm on a spectrophotometer.Soluble GAS protein extractions were performed using the bacteriophage lysine, PlyC (kindly provided by D. Nelson) as previously describedSelected protein samples were run on a 10% SDS-PAGE, with 6% stacking gel, for 1 h at 180 V. The gels were then transferred to nitrocellulose membranes using the Mini-Protean apparatus (Bio-Rad) in 1X transfer buffer . Membranes were blocked overnight at 4 °C in blocking solution (5% (w/v) dried milk in PBS-tween). Primary antibodies were incubated at a 1:1,000 dilution, unless otherwise stated. The following primary antibodies were used at a 1:1,000 dilution: α-His antibody (Roche), α-Mga4, α-Mga1-HRP, and α-Sda1 . Blots were then washed three times for 5 min in PBS-tween. The primary antibody Hsp60 (Enzo Life Sciences) was used at a 1:2,500 dilution. Blots were then incubated with secondary antibodies: α-rabbit-HRP  or α-mouse-HRP  for 1 h. The blots were then washed with PBS-tween three times for 5 min, and visualized using SuperSignal West Femto Substrate (Thermo Scientific) and a LAS-3000 CCD camera (FUJIFILM).2+-Phos-tag 10% SDS-PAGE gel (WAKO), with 6% stacking gel. The resolving gel was made as follows: 1.75 ml of 1.5 M Tris-HCl, 1.75 ml of 40% bis-acrylamide, 140 µl of 10 mM MnCl, 140 µl of phos-tag solution, 3.1 ml of dH2O, 100 µl of 10% ammonium persulfate, and 20 µl of TEMED (Bio-Rad). Protein samples were run for 2 h at room temperature and 2 h on ice, for a total of 4 h at 180 V, prior to western blot as described above.The phos-tag gel system was used to visualize the phosphorylation state of Mga. Briefly, GAS whole cell lysates were run on a MnThe authors have deposited all RNA-seq raw sequencing reads with the Sequence Read Archive (SRA) at the National Center for Biotechnology Institute (accession PRJN412519) for public availability.Supplementary Materials"}
{"text": "Copper, which can potentially be a highly toxic agent, is an essential nutrient due to its role as a cofactor for cuproenzymes and its participation in signaling pathways. In mammals, the liver is a central organ that controls copper turnover throughout the body, including copper absorption, distribution, and excretion. In ontogenesis, there are two types of copper metabolism, embryonic and adult, which maintain the balance of copper in each of these periods of life, respectively. In the liver cells, these types of metabolism are characterized by the specific expression patterns and activity levels of the genes encoding ceruloplasmin, which is the main extracellular ferroxidase and copper transporter, and the proteins mediating ceruloplasmin metalation. In newborns, the molecular genetic mechanisms responsible for copper homeostasis and the ontogenetic switch from embryonic to adult copper metabolism are highly adapted to milk ceruloplasmin as a dietary source of copper. In the mammary gland cells, the level of ceruloplasmin gene expression and the alternative splicing of its pre-mRNA govern the amount of ceruloplasmin in the milk, and thus, the amount of copper absorbed by a newborn is controlled. In newborns, the absorption, distribution, and accumulation of copper are adapted to milk ceruloplasmin. If newborns are not breast-fed in the early stages of postnatal development, they do not have this natural control ensuring alimentary copper balance in the body. Although there is still much to be learned about the neonatal consequences of having an imbalance of copper in the mother/newborn system, the time to pay attention to this problem has arrived because the neonatal misbalance of copper may provoke the development of copper-related disorders. A suboptimal content of micronutrients in a mother’s diet during pregnancy and lactation may be a cause of developmental defects in newborns. The data show that severe neonatal defects can be prevented by correcting a mother’s diet  ,5,6,7,8.In newborns, the mechanisms for excreting copper through bile and controlling copper absorption in the small intestine do not operate . TherefoCopper is an essential component of the cells of almost all modern organisms. It was involved in the metabolic processes in the early stages of the Earth’s evolution, possibly at the beginning of the Great Oxygenation Event, when it became bioavailable due to the oxidation of insoluble sulfides . In aqueThe native tertiary structure of cuproenzymes is formed during the successful metabolic insertion of copper ion(s). The removal of copper from holoenzymes in vitro or defects in the processes of the metalation of apo-enzymes in vivo can cause the disruption of the tertiary structure and the loss of catalytic functions . TherefoIn the past few years, evidence of the existence of a regulatory role of copper has accumulated. This role has remained elusive for a long time, although the first evidence for the involvement of copper in the regulation of endothelial cell growth was obtained almost 40 years ago . RecentlTwo prerequisites are implied from the existence of copper regulatory functions: (1) a pool, in which copper is accumulated and from which it is liberated on demand, and (2) copper-regulated sensors. In cells, two copper pools that may take part in the rapid, local change of copper concentrations exist .The first pool is a system that includes metallothionein-Cu(I), glutathione (Cu(I)/Cu(II)), and COMMD1-Cu(II) (Copper Metabolism gene MURR Domain 1), which possibly controls the changes of the copper concentration in the cytosol . The mem64Cu is taken up through the basolateral membrane Cp and [125I]-Cp pass on [64Cu] into the cytosol, and the protein moiety (apo-Cp) is absorbed by endocytosis, desyalated in endolysosomal vesicles, and then returned into circulation. This Cp with a processed carbohydrate moiety is then captured by endocytosis in hepatocytes through the group-specific receptor of acidic desalted glycoproteins Cp into the milk [14C]-Cp was measured. The mRNA coding the secretory form of Cp is found in the transcriptome of the cells of the lactating mammary glands. The length of milk Cp-mRNA and the molecular mass of milk Cp do not differ from hepatic Cp-mRNA and plasma Cp correspondingly [In adult mammals, copper assimilated in the small intestine is typically absorbed completely by the liver in several minutes. In approximately 90 min, copper is returned to the bloodstream as a component of serum Cp ,137. Howthe milk . This haondingly ,141. Milondingly ,143,144.ondingly ,143,144.Cp gene, as well as the Ctr1 and Atp7b genes, which provide Cp metalation, are observed shortly before the end of gestation [Cp, Ctr1, and Atp7b genes gradually decrease according to the change in the Cp concentration in the milk. The same pattern of Cp gene expression was reproduced in vitro in the PMC42-LA mammary epithelial cell culture models [In the mammary gland cells, strong and rapid upregulation of the estation . During e models . The acte models ,148,149.Cp gene (at position—1966). This nucleotide is part of the cis-element for transcription factor C/EBPβ (CCAAT/enhancer-binding protein beta), which may potentially take part in the gradual suppression of the Cp gene activity [Cp gene in breast cells during lactation has been preserved by natural selection.In milk, copper is present in a nondialyzable fraction, and approximately 75–80% of copper is found in Cp . In the activity . In Turkactivity . In all activity ,154,155.−/−Cp gene in mice causes a decrease in the copper concentration in the milk of females and copper misbalance in the pups [Atp7b gene in the toxic milk line of mice [tx/tx mice dies because of the copper deficiency in the mother’s milk, but it completely survives if fed from the first day of life by a wild-type ‘nurse’ [The high biological importance of milk Cp is demonstrated by the following facts. Copper atoms that are associated with Cp molecules are assimilated by newborns more easily . The knothe pups . The sam of mice . The pro ‘nurse’ . In the  ‘nurse’ , perhaps ‘nurse’ . A speci ‘nurse’ ,160. It It is worth nothing that the data discussed in this section were obtained from rats. Although the infant liver is different from the rat pup liver with respect to some species-specific features, the facts obtained for rodent copper metabolism are valuable for humans. In both species, at the ETCM stage, the copper status (low copper and ceruloplasmin concentrations in the serum), the copper accumulation in the liver tissue, the excretion of copper with urine but not with feces, and the switching to the ATCM , as well as the dynamics of the decrease in the copper and Cp concentrations in milk during lactation, are similar. These data allow us to determine that during development, the expression of the copper metabolism genes in the liver and mammary gland develop similarly in rats and humans.2Cu(II) complex. In infant formula, the copper is dialyzable, it is not “packed” into Cp, and its concentration in the diet from birth up to 6 months of age does not change. Therefore, newborns fed with such formulas receive copper in a highly mobile form, which easily gets to the bloodstream but is not delivered to the endosomes of hepatocytes. Additionally, the daily copper supply progressively increases along with the volume of consumed food. By the end of the first month, the copper consumption of formula-fed infants exceeds the normal copper consumption of breastfed infants by many times [Children exclusively fed cow milk, which contains copper and milk Cp but at concentrations that are lower than those of human milk, at an age of 6 months develop severe anemia, neutropenia, hypocupremia and display malformation of their bones and defects in erythrocyte maturation and so on . These sny times . In ratsny times ).Cp gene at the transcription and translation levels. The copper status was also affected in the cerebrospinal fluid. The concentration of copper and Cp was increased by a factor of 7. The specific content of copper in the brain cells did not change. In newborn rats with ETCM and ATCM, which were supplemented with copper ions, the Ctr1, Atp7b, and metallothionein mRNA levels in the liver increased [The transition manifests as an abrupt drop in the copper concentration in the liver, an increase in the blood serum copper levels, and preterm activation of the ncreased . Simultancreased  and coppncreased  showed tncreased .Milk proteins are divided into two groups: nutritive proteins, which are used for growth, and bioactive proteins, which perform regulatory and transport functions . In milkThe reviewed data suggest that the copper imbalance in the early postnatal period, which is induced by feeding infants formula, influences various aspects of copper metabolism. This is primarily an increase in the Cp and copper concentrations in the blood serum and cerebrospinal fluid, but there is no evidence that it can affect the formation of cuproenzymes. It is possible that, in individuals that carry no latent inherited defects in copper homeostasis, the nutrient copper excess is compensated in further development and has no significant impact on health. However, the individuals carrying heterozygous mutations in genes related to copper homeostasis  may be especially sensitive to copper imbalance in early childhood . The disThe delayed effects of the impairments of copper homeostasis in early infancy remain poorly studied. If this problem is ignored, there is a risk that it will impact the development of intellectual abilities and physical and mental health. Although many aspects of copper metabolism need further thorough investigation, it may be stated that for the ideal development of the intellectual and physical qualities of the individual, significant attention should be given to the balanced content of copper in the diet of infants."}
{"text": "It has been shown that near-perfect thermal camouflage can be continuously achieved for background temperatures ranging from 30 °C to 50 °C by tuning the emissivity of the device, which is attained by controlling the GST phase change. The thermal camouflage is robust when the observation angle is changed from 0° to 60°. This demonstration paves the way toward dynamic thermal emission control both within the scientific field and for practical applications in thermal information.Camouflage technology has attracted growing interest for many thermal applications. Previous experimental demonstrations of thermal camouflage technology have not adequately explored the ability to continuously camouflage objects either at varying background temperatures or for wide observation angles. In this study, a thermal camouflage device incorporating the phase-changing material Ge Thermal camouflage surfaces developed by Chinese researchers can be tailored to hide objects in front of different backgrounds. Traditional thermal camouflage comprises low-emissivity cloaks that lower the apparent temperature of vehicles or people to match their surroundings; however, objects can only be well-hidden when the background is one particular temperature. Qiang Li and co-workers at Zhejiang University in Hangzhou deposited a germanium-antimony-tellurium alloy onto gold film, before thermally annealing their samples at 200 °C. By varying the annealing time, the researchers prepared samples that were completely amorphous (randomly structured), completely crystalline (ordered), or intermediate states between the two. They found that the more crystalline samples had higher apparent temperatures, meaning the surfaces could be tailored to work at a range of background temperature. As well as benefitting military, such technology could allow better heat management during space travel. In terms of the physical mechanisms behind it, camouflage technology can be divided into two categories: color camouflage and thermal camouflage. Color camouflage is achieved by tuning light reflection or transmission to match the object’s appearance to the background in the visible or near-infrared range4. Many natural creatures such as cephalopods or chameleons can rapidly change their skin color to camouflage in this way6. The function of thermal camouflage, however, is to match the radiation temperature of a given object Tr (defined as the temperature at which a blackbody has an integrated radiance Bbb(Tr) equal to that of the object at temperature T, Bbb(Tr) = B(T)) with that of the background by controlling thermal emission. Therefore, thermal camouflage can befool the thermal imagers, which distinguish the object from the background based on their radiation temperature difference. Traditional thermal camouflage uses a low-emissivity coating, which reduces the object’s radiation temperature, to make the object blend into the background7. However, the emissivity of a traditional camouflage coating is fixed, and the objects can only be camouflaged in a fixed background temperature. Once the background temperature changes, the object can be easily discovered by the thermal imagers because of the radiation temperature difference between the object and the background. In addition, the observation angle robustness of thermal camouflage is an important factor for practical applications, as the targets can be discovered from wide observation angles. Therefore, thermal camouflage technology that can be used at varying background temperatures and wide observation angles needs to be explored.Camouflage technology, which has the ability to hide or disguise an object  in the background24 and contribute to a number of applications, including radiative cooling28, thermophotovoltaics35, and sensing37. Recent works have extended emissivity control to dynamically reconfigurable materials, including graphene38, quantum wells39, doped zinc oxide40, and thermochromic metamaterials41. However, these works have not investigated their potential uses for creating thermal camouflage. It has, however, been demonstrated that the thermal emission of a device consisting of vanadium dioxide (VO2) can be controlled dynamically and it can therefore be used for thermal camouflage43. Moreover, thermal camouflage for a specific background temperature distribution can be created using natural materials44 or metamaterials based on transformation thermotics45. However, the ability to continuously camouflage objects either at varying background temperatures or for wide observation angles has not yet been experimentally explored.Thermal camouflage with the ability to tune the thermal emissivity of the object can be used at varying background temperatures. Most of the methods to engineer emissivity and thermal emission are static2Sb2Te5 (GST) film on top of a metal film is experimentally demonstrated. The phase-changing material GST has been used in various switchable optoelectronic devices62. Here we report the first thermal camouflage device incorporating the phase-changing material GST, which can camouflage at varying background temperatures and for wide observation angles. Continuous thermal camouflage is achieved by controlling the GST phase transition, during which the imaginary part of the permittivity of the GST increases, which, in turn, increases the emissivity. This thermal camouflage device presents several advantages as follows: (1) large background camouflage temperature range: thermal camouflage is experimentally demonstrated when the background temperature changes from 30 °C to 50 °C. (2) Robust with regard to the observation angle: the thermal camouflage is robust over a large range of observation angles, from 0° to 60°. (3) Size flexibility: the emissivity of the surface can be spatially tuned with a patterned layer of GST. We have demonstrated that the spatial emissivities of patterned GST-Au samples exhibit a spatial resolution of 500 μm (checkerboard pattern) and 100 μm (ZJU pattern). (4) Easy fabrication: the fabrication involves only simple film deposition. This thermal camouflage technology, based on phase-changing material, can be applied to dynamically control the thermal emission in fundamental science and significantly benefit a number of applications, including thermal camouflage and heat management for outer space.In this study, a thermal camouflage device consisting of a Ge−4 Pa and 0.1 Pa separately, to maintain the deposition rate at 0.53 nm s−1.To fabricate GST-Au devices, a 100 nm-thick Au film and subsequently a 350 nm GST film are deposited on a silicon substrate by high vacuum magnetron sputtering under room temperature. Both the GST thickness and the metallic material have been optimized to achieve a large camouflage temperature range  is then spun onto the Au film and annealed for 5 min at 105 °C. The photoresist is exposed to define a checkerboard pattern and a ZJU pattern using a double-sided mask aligner system (MA6–BSA). The photoresist is then developed in 1:6 AR 300-26/ Deionized (DI) water followed by rinsing in DI water. After development, a 350 nm-thick GST film is then deposited onto the sample by magnetron sputtering. The spatially resolved GST-Au devices are created after lift-off by ultrasonic processing in acetone for 1 min.The infrared images are recorded by an infrared camera (FLIR S65). The spectral range of the infrared camera is between 7.5 μm and 13 μm. The spatial resolution of the infrared camera is 500 μm. The spectral radiance is measured by a Fourier transform infrared spectrometer (FTIR) with a room-temperature doped triglycine sulfate detector.The finite-difference time-domain method  is used to compute the optical responses of the MIM thermal emitter. The relative permittivity of gold is obtained from Palik’s handbook. The relative permittivities of GST (2.5 µm–15 µm) are obtained experimentally from the fabricated GST films  of an object recorded in infrared images is not equal to its real temperature (T) unless the object is a blackbody. The radiation temperature is related to several factors, which are included in the following equation:Tris the radiation temperature detected by an infrared (IR) camera, C is the specific constant of the IR camera, Pobj is the emitted power of the object detected by the IR camera, Iobj is the spectral radiance of the object, εobj is the emissivity of the object, and  is the spectral range of the IR camera (FLIR S65: 7.5 μm–13 μm). The radiation temperature of the object is directly related to the emitted power of the object Pobj, which is determined by the emissivity of the object, the real temperature of the object, and the spectral range of the IR camera. Most natural environments, such as bare soil (emissivity ε = 0.91), grass (ε = 0.95), and shrub (ε = 0.98), have emissivity close to a blackbody. Furthermore, the temperature of the environmental background keeps changing while the temperature of the object, such as a vehicle, remains fixed under most circumstances. This makes the direct camouflage of a fixed object in a varying background difficult. By covering the object with camouflage coating with tunable emissivity, the radiation temperature of the object can be controlled to match that of the background so that an infrared camera cannot distinguish the object from the background. In this study, thermal camouflage is explored in the situation in which the object temperature is fixed at 60 °C and the background temperature is changed from 30 °C to 50 °C, to mimic the situation of an object at varying background temperatures. Thermal camouflage is not investigated at background temperatures below 30 °C in this study, as this would necessitate an additional cooling system.The radiation temperature (T1 to T3 (T3 > T2 > T1), the background color changes from blue (cold: a low radiation temperature) to red (hot: a high radiation temperature) in the thermal images. The surface of the tank’s upper body at a fixed temperature T0 (T0 > T3) can be made to blend into the background by controlling the thermal emission based on different GST phases. The as-deposited GST is in the amorphous phase (termed aGST) with a disordered atomic distribution. Intermediate GST (termed iGST) and crystalline GST (termed cGST) with a well-organized atomic distribution are obtained by annealing it at 200 °C on a hot plate for less than and greater than 60 s, respectively  patterns of GST films with different annealing time  is shown in Fig. SThe experimental setup is shown in Fig. Infrared images are recorded to show the ability to achieve thermal camouflage at different background temperatures. When the background temperature is 30 °C, the radiation temperatures of both the object and the background are approximately 30 °C, and the object can hardly be distinguished from the background in the infrared image Fig. . To mimiThe measured spectral radiance at different temperatures of the background (termed BG) and different annealing time of the object (termed OB) is shown in Fig. P (Pmax − Pmin) is the difference between the emitted power of the cGST-Au and aGST-Au devices. If the emitted power of the background is in the range from Pmin to Pmax, then thermal camouflage can be achieved by controlling the GST phase to match the emitted power of the GST-Au device with that of the background. The temperature of the background at which its emitted power is the same as Pmax is Tmax. Similarly, the temperature of the background Tmin corresponds to Pmin. The background camouflage temperature range ΔT is the difference between Tmin and Tmax. The object can be camouflaged for a larger background temperature range by simply increasing the object temperature, as shown in Fig. SThe emitted powers of the background, aGST-Au device, and cGST-Au device are shown in Fig. The robustness of thermal camouflage to the observation angle over a large range from 0° to 60° is presented in Fig. The emissivities of GST-Au devices at different observation angles are calculated to validate the robustness of the thermal camouflage over different observation angles. The infrared camera receives the thermal emission of both Transverse Electric (TE) and Transverse Magnetic (TM) polarizations. Therefore, we calculate the average emissivities of TM and TE polarizations for aGST-Au and cGST-Au devices, which are shown in Fig. w = 1 mm and w = 500 µm), the smallest squares cannot be clearly identified from the background  before annealing. This is because both the GST and the metallic background have a low radiation temperature. When the annealing time is increased gradually, the GST squares (red color) become prominent and can be distinguished from the metallic background (blue color) as the radiation temperature of the GST squares increases. When the square pixel size w is reduced to 500 µm, which is close to our infrared camera’s spatial resolution, the contrast of the adjacent areas decreases, but the squares can still be identified from the background. For the ZJU pattern, it can be identified even though the line width of the ZJU pattern is 100 μm. For the checkerboard pattern, the spatial camouflage resolution is limited by the resolution of the infrared camera. However, this limit is broken in case of the ZJU pattern, as it has much less disturbance from adjacent GST structures. Therefore, it can be concluded that the spatial camouflage resolution is limited by the surrounding structures and the infrared camera resolution. The two blocks in Fig. To explore the camouflage limit for microscopic objects, the spatial emissivities of patterned GST-Au devices with different GST phases are studied further. The spatial shaping of the GST-Au devices’ emissivities can encode spatial information in infrared images by patterning the top layer GST. Spatially resolved infrared images of the checkerboard pattern and ZJU (abbreviated form of Zhejiang University) pattern are shown in Fig. Ts − Tb) between the GST film and the metallic background for different annealing time are shown in Fig. Ts and Tb are calculated by averaging the radiation temperature of ten arbitrarily selected points from GST and the metal background, respectively. The radiation temperature difference in the checkerboard pattern (w = 1 mm) increases from near 1 °C to 27 °C when the annealing time is increased from 0 s to 1000 s. For the square pixel size 500 µm, the radiation temperature difference can only increase up to 15 °C from 1 °C when the annealing time is increased from 0 s to 1000 s. The lower value of the radiation temperature difference for this checkerboard (w = 500 μm) can be attributed to the fact that the thermal camera spatial resolution is close to the size of the smallest GST squares. This leads to the lower average radiation temperature of the GST squares, whereas the average radiation temperature for the metal background is increased. The radiation temperature difference for the ZJU pattern increases up to approximately 6 °C from less than 1 °C when the annealing time of GST is increased from 0 s to 1000 s. The radiation temperature difference in the ZJU pattern is far less than that in the checkerboard pattern, because the ZJU line width (100 μm) is much less than the infrared camera’s spatial resolution (500 μm), and thermal emission from the ZJU line is averaged along with the adjacent low-emission metal background. This patterned GST on metal film can also be used to carry encoded spatial information, which can later be decoded using a thermal camera.The radiation temperature differences . The thermal camouflage is robust over a large range of observation angles, from 0° to 60°. Furthermore, it has been experimentally demonstrated that GST-Au devices with a top layer of patterned GST can encode spatial information, which can later be decoded using a thermal camera. This device also has the potential to work in a background changing from a high temperature to a low temperature by controlling the phase transition of GST from crystalline to amorphous (reamorphization). This reamorphization can be achieved by laser pulses (fs or ns)Supporting information"}
{"text": "The entrance region constitutes a considerable fraction of the channel length in miniaturized devices. Laminar slip flow in microchannel plate fin heat sinks under hydrodynamically developing conditions is investigated semi-analytically and numerically in this paper. The semi-analytical model for the pressure drop of microchannel plate fin heat sinks is obtained by solving the momentum equation with the first-order velocity slip boundary conditions at the channel walls. The simple pressure drop model utilizes fundamental solutions from fluid dynamics to predict its constitutive components. The accuracy of the model is examined using computational fluid dynamics (CFD) simulations and the experimental and numerical data available in the literature. The model can be applied to either apparent liquid slip over hydrophobic and superhydrophobic surfaces or gas slip flow in microchannel heat sinks. The developed model has an accuracy of 92 percent for slip flow in microchannel plate fin heat sinks. The developed model may be used to predict the pressure drop of slip flow in microchannel plate fin heat sinks for minimizing the effort and expense of experiments, especially in the design and optimization of microchannel plate fin heat sinks. Fluid flow in microchannels has emerged as an important research area. This has been motivated by their various applications such as medical and biomedical use, computer chips, and chemical separations. The high level of heat dissipation requires a dramatic reduction in the channel dimensions. The high flux heat dissipation from high-speed microprocessors provided the impetus for studies on heat transfer in microchannels . It is wMicrochannels are the fundamental part of microfluidic systems. In addition to connecting different devices, microchannels are also utilized as biochemical reaction chambers, in physical particle separation, in inkjet print heads, in infrared detectors, in diode lasers, in miniature gas chromatographs, in aerospace technology, or as heat exchangers for cooling computer chips. Understanding the flow characteristics of microchannel flows is very important in determining the pressure drop, heat transfer, and transport properties of the flow for minimizing the effort and expense of experiments, especially in the design and optimization of microchannel plate fin heat sinks. Microchannel heat sinks have received considerable attention owing to their high surface-area-to-volume ratio, large convective heat transfer coefficient, and small mass and volume. For the effective design and optimization of microchannel heat sinks, it is significant to understand the fundamental characteristics of fluid flow and heat transfer in microchannels.The purpose of this paper is to study the pressure drop characteristics of fluid flow through microchannel plate fin heat sinks. The developing slip flow friction factor Reynolds number parameter is determined for the laminar regime. Following this, there we analyze the pressure drop through microchannel plate fin heat sinks.In this study, the developing laminar flow is analyzed through plate fin heat sinks with velocity slip boundary conditions, and semi-analytical closed-form solutions are obtained for the friction factor and Reynolds number product and pressure drop in terms of the channel aspect ratio, channel length, hydraulic diameter, Reynolds number, and modified Knudsen number. The primary goal of the present paper is to provide a general simple pressure drop model of fluid flow through microchannel plate fin heat sinks.Kn) relates the molecular mean free path of gas to a characteristic dimension of the duct. The Knudsen number is very small for continuum flows. However, for microscale gas flows, the gas mean free path becomes comparable to the characteristic dimension of the duct. Rarefaction effects must be considered in gases in which the molecular mean free path is comparable to the channel’s characteristic dimension. The continuum assumption is no longer valid, and the gas exhibits non-continuum effects such as velocity slip and temperature jump at the channel walls. Traditional examples of non-continuum gas flows in channels include low-density applications such as high-altitude aircraft or vacuum technology. The recent development of microscale fluid systems has motivated great interest in this field of study. Microfluidic systems should take into account slip effects. There is strong evidence to support the use of Navier–Stokes and energy equations to model the slip flow problem, while the boundary conditions are modified by including velocity slip and temperature jump at the channel walls. The slip length can be interpreted as the distance from the wall that the slip velocity profile extends to if extrapolated away from the boundary. In gas flows, the slip length is related to the Knudsen number, while in liquid flows, the slip length depends on the surface microstructure [The Knudsen number  and mean velocity The geometry of a microchannel heat sink is shown in Po is interpreted as the fully developed dimensionless average wall shear. The fully developed mean wall shear stress may also be related to the pressure gradient by means of the force balance The above grouping ξ is the non-dimensional channel length. This analysis demonstrates that inertial forces are quite important for short ducts where ξ << 1. The fluid flow behavior in the developing region differs from that in the fully developed region. The parameter We examine the momentum equation and consider the various force balances using the method of scale analysis. Comparing the force scale between friction and inertial forces, we obtain the following relation: fapp, must be utilized to calculate the factual pressure drop. The apparent flow friction factor is used in this paper since it incorporates the pressure drops caused both by the wall shear stress due to the significant velocity gradient normal to the wall and by the momentum flux variation due to the change of velocity field from a uniform profile at the inlet to a specific profile downstream in the channel. Researchers have generally assumed microchannel heat sink flows to be fully developed, ignoring entrance effects; therefore, care should be exercised as most of the statements, formulas, and charts are valid only for long ducts. The long duct criterion will be discussed later in this paper.In many practical applications, the length of the channel in the developing region therefore forms a major portion of the flow length through a microchannel. To account for the developing region, the pressure drop equations are presented in terms of an apparent friction factor. The apparent friction factor accounts for the actual pressure drop due to friction and the developing region effects. It represents an actual value of the friction factor over the flow length between the inlet and the location under consideration. Therefore, the apparent friction factor, cK and eK represent the contraction and expansion loss coefficients due to area changes. The friction factor used in Equation (3) is the apparent friction factor and accounts for the developing region. Fluid flow modelling in a plate fin heat sink is essentially a simultaneously developing hydraulic and thermal boundary layer problem in rectangular ducts. The flow may become fully developed if the heat sink channel is sufficiently long in the flow direction or with relatively small fin spacing; however, this is very unlikely for microchannel heat sinks for electronic cooling applications. The hydrodynamically developing flow can become quite important in microchannels. Due to the often-short lengths, the developing flow could dominate the entire flow length of the microchannel. When considering the developing flows, the pressure drop is now related to an apparent friction factor. The apparent friction factor, fapp, for a rectangular channel may be computed using a form of the model developed by Duan and Muzychka [G(ξ) representing additional pressure drop which exceeds the fully developed pressure drop. Thus, the difference between the apparent friction factor and Reynolds number product over a length and the fully developed friction factor and Reynolds number product is expressed in terms of an incremental pressure defect G(ξ):Generally, there are three main components that contribute to the overall pressure drop. The inlet and exit losses need to be quantified for the microchannel. The hydrodynamic frictional pressure loss needs to be carefully evaluated. Summing all of the frictional and inlet and exit dynamic losses, the total pressure drop model function is given in terms of Bernoulli’s equation,Muzychka  for deveMuzychka  demonstrThe commonly used customary incremental pressure drop number  is given byξ >> 1, the fully developed flow momentum equation in Cartesian coordinates reduces to the formThe Navier–Stokes equations are assumed to be valid in their traditional form, and wall slip is merely modeled through a modification of the boundary condition. Rectangular geometries are of particular interest in microfluidics applications. We may now examine the solution for rectangular ducts for slip flow. A schematic diagram of the rectangular cross section is showed in λ generally denotes the slip length for either gases or liquids, which is defined based on the physics of the fluid flow. The slip length can be used to characterize the type of flow in channels: if λ = 0, the flow is no-slip flow; if λ = λ represent partial slip flow. For gas slip flow, Maxwell’s first order correction givespλ is the molecular mean free path. The constant σ denotes the tangential momentum accommodation coefficient. Equations (11) and (12) are mathematically equivalent to the first-order correction commonly employed in the analysis of rarefied gas flow in the slip flow regime. It is convenient to define a modified Knudsen number as Kn* = Kn(2 − σ)/σ. A nondimensional number similar to the modified Knudsen number (Kn*) can be defined for liquid slip flow, i.e., the ratio of slip length to a characteristic dimension of the flow field, and the presently developed model can then be utilized for liquid flows over superhydrophobic surfaces to predict pressure drop. To look at it from a slightly more general mathematical point of view, when the no-slip condition on the solid surfaces is partially relaxed, the molecular mean free path and the term involving the accommodation coefficient  are a set of eigenfunctions. This solution satisfies the boundary condition, Equation (9). Furthermore, substituting the velocity solution into the boundary condition, Equation (7), we obtainFollowing Ebert and Sparrow , using tThe characteristic length scale in the present analysis is defined as the hydraulic diameter.Thus,nδ can be obtained from Equation (16). Finally, the velocity distribution is obtained as follows:The eigenvalues The mean velocity is found by integration of Equation (17) across the section of the duct.We can obtain the friction factor and Reynolds number product from the above equations in terms of the aspect ratio and the slip coefficient.ε→0:The limit of Equation (19) corresponds to a parallel-plate channel for *Kn→0. The relationship between the flow friction coefficient, f, and Reynolds number, Re, for a fully developed laminar flow regime in a rectangular channel is only a function of the aspect ratio and may be calculated as follows:It can also be demonstrated that Equation (19) reduces to its no-slip flow limits as ε = 1, which gives an fRe value 0.7 percent below the exact value. When greater accuracy is desired, two terms are absolutely enough due to very rapid convergence, and the largest error is less than 0.05%. Considering only the two terms of the exact series, Equation (21) givesExamination of the single-term solution reveals that the single-term approximation is accurate enough for engineering applications. The largest difference occurs when This equation is founded on theory and is more accurate compared to those obtained by curve fitting .α depends on the duct geometry.The slip flow friction factor results can be presented conveniently in terms of the normalized Poiseuille number. The Poiseuille number reduction depends on the geometry of the cross section. It is convenient that the Poiseuille number results are expressible to good accuracy by the relationα are derived from a least-square fit of the Poiseuille number results. The constants α are a weak function of the aspect ratio, and the data points are fitted to a simple correlation [For rectangular ducts, the constants relation :(24)α=11Then, Equation (19) can be simplified to facilitate practical application as follows:*Kn but independent of the cross-sectional geometry [ξ ≤ 0.001), fappRe is nearly equivalent and independent of duct shape. The boundary layer behavior in the tube entry is substantially identical to that on a flat plate. At the entrance of the duct, the velocity boundary layer starts developing at each wall under the imposed flow acceleration. As long as the thickness of the boundary layer is small compared to the duct dimensions, the boundary layers from different walls do not affect each other appreciably. This explains why very near the inlet of ducts, fappRe is nearly equivalent and independent of duct shape. As the boundary layer develops further downstream (ξ > 0.001), the effects of geometry become gradually more pronounced. The incremental pressure defect G(ξ) for a rectangular channel may be computed using a form of the model developed by Duan and Muzychka [It is found that the entrance friction factor and Reynolds number product is of finite value and dependent on geometry . Duan angeometry  also demMuzychka  for deveν. While typical microflows are characterized by Re < 100, in a few microfluidic applications such as micro heat exchangers and micromixers, the Reynolds number can reach the order of a few hundreds. It is emphasized that several eigenvalues are sufficiently accurate for all values of ξ of engineering interest. The negative exponentials cause rapid convergence, especially if ξ is not too small. As an illustration, for a practical engineering application limit of ξ ≥ 0.01, only two terms in the summation are really required. It can be demonstrated [ξ→0 asymptote ξ→Equation (26) is nearly independent of the duct shape and may be used to calculate the friction factor and Reynolds number product for the short asymptote of rectangular ducts for slip flow. We will take advantage of the asymptotic limit for developing an approximate model for predicting pressure drop for plate fin heat sinks. The eigenvalue equation :(27)αiJ0nstrated  that theφ = 2b/(2b + t). The graphs of experimental data for laminar flow in Reference [For the inlet and exit pressure losses for a heat sink, Kays and London  provide eference  have beefappRe in slip flow for various aspect ratios of the rectangular cross section. From an inspection of the graphs, it is seen that fappRe monotonically decreases in the entrance region, and fappRe decreases as the modified Knudsen number increases for the same aspect ratio. The effect of increasing Kn* is to decrease the apparent friction and pressure drop over the channel length very significantly. In addition, the fappRe values decrease with increasing ε for the same Kn*. Moreover, it is obvious that the pressure gradient for a slip flow is less than that for the corresponding no-slip flow. This effect of the developing region is significant for microchannel plate fin heat sinks.The developing apparent friction factor and Reynolds number parameter as a function of aspect ratio and modified Knudsen number is illustrated clearly in some graphs. ξ is the proper parameter. ξ. The effects of the aspect ratios on the pressure drop in the slip flow region are investigated in The values in the entrance region are larger than those in the fully developed region, which demonstrates the critical importance of the entrance region in determining the pressure drop characteristics in microchannel heat sinks. To take into account the entrance effects on the overall pressure drop in the microchannel region, clearly, the dimensionless developing length Numerical simulations were conducted using the commercial solver ANSYS Fluent 14.0  with user-defined functions. A structured mesh composed of rectilinear elements was constructed in a preprocessor to define the flow domains. The governing equations were solved with a commercial implementation of the finite volume method using a pressure-based solver and the SIMPLE algorithm. The slip boundary condition was implemented as a user-defined function in FLUENT. The solution algorithms were considered converged when the convergence criterion was satisfied. Local mesh refinement was performed using FLUENT’s grid adaption utility at the flow inlet.fappRe does not depend on the dimensionless hydrodynamic length when the dimensionless hydrodynamic length is approximately unity, which should be the long duct criterion. In the range of ξ < 0.06, the fappRe decreases rapidly with increasing ξ due to the finite thickness of the boundary layer at the microchannel entrance region. With an increase of ξ, the fappRe has a comparatively gently downward tendency.Shah and London  presentefappRe with the non-dimensional flow distance and the comparison between the proposed model Equation (28) and slip flow numerical results when the aspect ratio ε = 1. It is found that the model predictions agree with our numerical results. The maximum deviation between the numerical results and the proposed model is less than 2.6%. It is clear that Equation (28) characterizes the pressure drop in microchannel plate fin heat sinks. The maximum deviation of exact values is less than 8 percent. The pressure drop may be predicted from Equation (28), unless greater accuracy is desired. The developed pressure drop model may be suitable for the parametric design of and optimization studies on microchannel plate fin heat sinks.The fluid flow behavior in the developing region differs from that in the fully developed region. The parameter ξ values, with low-aspect-ratio ducts reaching it a little earlier. The fully developed flow is attained when ξ is approximately 1 for rectangular ducts, as seen from these figures. The dimensionless developing length ξ is the proper parameter to take into account the entrance effects on the overall friction factor and pressure drop. The friction factor is higher in the developing flow region. Finally, beyond the entry region, the conventional theory for fully developed flow applies. Generally, the entrance region effects are less than 2% for the friction factor and Reynolds number product and can be neglected when It can be seen that fully developed flow is attained at different This paper investigated pressure drop in the fluid flow in microchannel plate fin heat sinks. The paper deals with issues of hydrodynamic flow development in microchannel plate fin heat sinks. A model was proposed for predicting the pressure drop in microchannel plate fin heat sinks for developing slip flow and continuum flow. The accuracy of the developed model was found to be within 5 percent for practical configurations. Errors of this magnitude are acceptable for most engineering purposes. The model can be considered adequate and sufficiently reliable to analyze the pressure drop in microchannel plate fin heat sinks. As for slip flow, no solutions or tabulated data exist for microchannel plate fin heat sinks, so this developed model may be used to predict pressure drop in slip flow in microchannel plate fin heat sinks. The developed model is simple and founded on theory, and it may be used by the research community for the practical engineering design and optimization of microchannel plate fin heat sinks.The goal of this investigation was to predict the pressure drop of the flow in microchannel plate fin heat sinks. The fully developed flow or long duct criterion for pressure drop is given. It is clearly shown that the entrance effects could be the source of the often-conflicting results previously reported in the literature."}
{"text": "Re < 1000), channel aspect ratio (0 < ε < 1), and Knudsen number (0.001 < Kn < 0.1) on the dimensionless hydrodynamic entrance length, and the apparent friction factor, and Reynolds number product, are examined in detail. The numerical solution of LBM can recover excellent agreement with the available data in the literature, which proves its accuracy in capturing fundamental fluid characteristics in the slip-flow regime.Developing a three-dimensional laminar flow in the entrance region of rectangular microchannels has been investigated in this paper. When the hydrodynamic development length is the same magnitude as the microchannel length, entrance effects have to be taken into account, especially in relatively short ducts. Simultaneously, there are a variety of non-continuum or rarefaction effects, such as velocity slip and temperature jump. The available data in the literature appearing on this issue is quite limited, the available study is the semi-theoretical approximate model to predict pressure drop of developing slip flow in rectangular microchannels with different aspect ratios. In this paper, we apply the lattice Boltzmann equation method (LBE) to investigate the developing slip flow through a rectangular microchannel. The effects of the Reynolds number (1 <  In recent years, rapid development in manufacturing technologies, together with a motivation toward MEMS ,2,3,4, h> 10). Here we pay special attention on the slip flow, where the rarefaction effect may be significant, and the conventional Navier–Stokes simulation can be used with appropriate s velocity slip boundary conditions. This regime has attracted extensive attention from the engineering research community because of its significance associated with many of the practical microfluidic devices. It has been the subject of many studies employing continuum modeling to examine the slip-flow convection at the microscale [Rarefaction effects, usually characterized by the Knudsen number, which is defined as the ratio of the molecular mean free path of gas to a characteristic dimension of flow domain. According to the value of croscale ,6,7,8 ovLiquid slip is very important in microfluidic devices with a superhydrophobic surface because it reduces the required pressure in pressure-driven flows. Due to the lack of molecular based theory of liquids, a nondimensional number  has attracted a variety of researchers to apply it to simulate microchannel flows ,24,25,26Chen and Doolen  first apDorari et al.  investigSucci  proposedr = 0.59, in the specular bounce-back scheme. They exhibited a mathematical formulation of kinetic boundary conditions for LBE schemes, in terms of reflection, slip, and accommodation coefficients.Sbragaglia and Succi  simulateKn-τ relation that differs from that of Lim et al. [With an equilibrium wall boundary condition, Lee and Lin  employedm et al.  by a facm et al. .Jeong et al.  applied Tang et al.  later siAs shown by Guo and Zheng , VerhaegMontessori et al. ,39,40,41articles ,43 have Owing to its kinetic characteristics and distinctive advantages over conventional numerical methods, the LBM has been a new potential tool and attained great success in studying microflows. To the authors’ best knowledge, there are no systematical investigations reported in using LBM to study the developing laminar flow for rectangular microchannels in the slip regime, especially focusing on the aspect ratios and hydrodynamic development length of rectangular microchannels.In the open literature, the only fluid flow data available for the laminar entrance region of rectangular microchannels may be the model proposed by Duan and Muzychka ,45, whicThe aim of this paper is to analyze hydrodynamic characteristics of the entrance region for laminar flow in three-dimensional rectangular ducts with aspect ratios from 0.1 to 1. By means of LBE method, we concentrate on the effects of rarefaction on the hydrodynamically-developing flow and pressure drop in the entrance region for rectangular ducts. In the present investigation, the role of the Reynolds number, aspect ratios and Knudsen number on the hydrodynamic development length of rectangular microchannels is also examined and investigated.It is assumed that this internal flow is three-dimensional, incompressible, laminar, isothermal, and steady in the entrance region of rectangular microchannels. There exists a velocity slip on the wall. Assuming the working fluid is a Newtonian fluid, according to the proposed hypotheses, the continuity equation and momentum equation in its most common general form are:λ is the molecular mean free path, n.The velocity distribution must be satisfactory for the slip boundary condition at the walls. According to gas kinetic theory, the gas velocity at the wall is different from the wall velocity, which is expressed in terms of the local velocity gradient at the wall. The first-order Maxwell boundary condition for the velocity at the wall is:Since the pressure gradients found in microchannels are quite high, the flow lengths are generally kept low. To account for the developing region, the pressure drop equations are presented in terms of an apparent friction factor For the slip flow entrance region problem, the available data are given by the approximately analytical solutions presented by Duan and Muzychka , where tHere, For the semi-theoretical analytical model, we can use Equation (10) to investigate the apparent friction factor and Reynolds number product for developing slip flow in rectangular ducts. With arbitrary aspect ratios and axial distances, it is of great convenience to calculate the apparent friction factor and Reynolds number product To demonstrate the utility of LBE method for simulating the three-dimensional flow in a rectangular channel, we consider the isothermal D3Q15 BGK-LBE  model  to derivFor the square lattice LBGK model D3Q15, the basic discrete-velocity Boltzmann kinetic equation is:Here i = 0), i = 1, 2, 3, 4, 5, 6), i = 7, 8, 9, 10, 11, 12, 13, 14), The equilibrium distribution By undertaking a multiscale technique, we can recover the macroscopic equations of the model. As a result, it is considered as a numerical solver of the Navier–Stokes equation.They are given by the continuity equation and the momentum equation:In the LBM simulation, we must give appropriately the relationship between the relaxation time erically .The mean free-path Therefore, with Equation (21) we have:τ and the kinematic viscosity of the fluid satisfy the relation In the LBGK model, As usual, the LBE method consists of two steps, collisions and streaming. After one time step The collision step without forcing function is:For a certain site, there are other particles coming from different directions, collision occurs among them at this site, and the original particle numbers moving in each direction will be changed. In a LBM simulation, such streaming and collision processes are repeated again and again until satisfied results are achieved.Correct boundary conditions are crucially important for the accuracy and stability of the LBM. In this work, assuming a uniform velocity at the inlet of the microchannel, and the pressure is known and equal to 1 atm at the outlet boundary. Two types of boundary conditions must be dealt with: (a) the slip boundary conditions at the walls, (b) velocity boundary conditions at the inlet and pressure boundary conditions at the outlet. In the LBE techniques this flow can be simulated with the bounce-back of the non-equilibrium approach originally proposed by Zou and He  at the iNon-equilibrium extrapolation scheme proposed by Guo et al.  is used When the flow encounters the slip-flow regime, the velocity slip occurs. The velocity slip near the wall plays an important role, which makes the implementation of boundary condition critical for the microflow simulation. For the wall boundaries, we apply the combined bounce-back and specular-reflection (CBBSR) boundary condition. The slip boundary conditions are given in the following form:ondition ,49,50,51o et al. ,49 pointc et al.  pointed x with the microchannel width on the z-axis, and with the theoretical maximum centerline fully-developed axial velocity on the x-axis The development of the three dimensional, laminar velocity profiles in the entrance region of a rectangular duct are investigated, the velocity profiles for aspect ratio As demonstrated in the analytical section, the pressure-drop results are presented conveniently in terms of the grouping apparent friction factor and Reynolds number product In this part, we use the calculated results from Equation (10) in Duan and Muzychka  as the rx+ values, with the low aspect ratio ducts reaching it earlier. As described earlier, initially, the change in Knudsen number (due to the density variation) plays a vital role in determining the friction coefficient behavior. In addition, compared with the traditional numerical methods for microflow simulation, such as the finite volume method, the computation effort of the lattice Boltzmann method may increase. An excellent agreement between the numerical and analytical results in the range 0.001 < Due to the relatively short lengths employed in microchannels, the influence of the entrance region cannot be neglected. The entrance region effects become more pronounced at smaller Knudsen numbers in part explaining the trend of decreasing Slip flow in the entrance region of rectangular microchannels was investigated numerically by Renksizbulut et al.  and Niaztal data  is from U is a function of the independent variables U can be estimated by Equation (32):To account for this discrepancy, a careful analysis of the experimental uncertainty in this study is critical to the interpretation of experimental data and exploration of deviation from the LBE method. An uncertainty analysis is performed on relevant parameters using the root sum square method described by Moffat . AssuminUncertainty analysis provides a reasonable method to evaluate the significance of the scatter on experiments. This is a powerful tool in locating the source of trouble in an experiment.For incompressible flow through horizontal pipes or channels of constant cross-sectional area, the friction factor and Reynolds number product can be expressed as follows:Equation (34) offered for the discrepancy of the fully developed laminar flow’s predictions and that obtained for an incompressible developing flow with the entrance section effects. The final expression for uncertainty in estimating LK(x+) represents the losses due to the hydrodynamic developing region. The product of the measured friction factor and Reynolds number can then be compared to the theoretical value for laminar flows. For flows in ducts of various cross-sections, a relationship of the form According to Equation (35), the experimental uncertainties in It can be seen that the most dominant terms in the The flow-developing region is very important, particularly in microchannels, when dealing with fluid flow within micro-channels, as these ducts are usually very short. In most applications, the short length of the channels is not enabling the flow to reach the fully developed regime. Thus, the length of the hydrodynamic developing region Several hydrodynamic entrance length studies have been explored both experimentally and numerically. Regarding numerical studies for rectangular ducts and parallel plate channels, results found by groups, such as Han , FlemingFor low Reynolds numbers one can consider entrance length correlations given by Atkinson et al. , Chen 5, Durst eChen  proposedRe < 100:Durst et al.  employedRe, which considered the effects of slip flow:Duan and Muzychka  applied Re is high, an approximately linear curve is depicted. However, at very low Re, Re.These correlations were established in common through a combination of the creeping flow and boundary-layer type solutions. Looking at these above correlations, when Re < 1000; however, a limited range of rectangular channel aspect ratios Re range of 0.5–200. Galvis et al. [Re < 200), hydraulic diameter  indicates that the entrance length has a rational relationship with the Reynolds number when the Reynolds number is small. The entrance length does not vanish as i et al. . It is fIn this paper, we have performed an investigation in slip flow through a rectangular microchannel using an improved incompressible LBGK D3Q15 model. The combined effects of aspect ratios and rarefaction on friction distribution characteristics have been investigated by employing the model. Our numerical results show that the entrance friction factor and Reynolds number product is of finite value and that the friction factor and Reynolds number product reduces with the decrease in Knudsen numbers and the increase in the channel aspect ratios. Various comparisons are presented among the available literature, including the numerical, experimental, and the semi-theoretical analytical data, which are in excellent agreements. Note that the solutions of the linearized Boltzmann equation are remarkably close to analytical results by solving the Navier–Stokes equation with slip boundary conditions in the slip regime. This means that the lattice Boltzmann method with a scheme of combining the bounce-back reflection with specular reflection applying to the boundary condition treatment can be capable of predicting the slip flow at the entrance region well.Re < 1000 under slip condition. The entrance length generally increases with the increase of In addition, numerical simulations have been used to study the developing flows in rectangular microchannels, focusing on the entrance length and its dependence on the Reynolds number and channel aspect ratio. Novelty correlation for the entrance length was proposed for rectangular channels with The results presented here are remarkable because they uncover the effects of rarefaction and aspect ratios on flow behavior at the entrance region in the slip regime which were not systematically reported earlier. These detailed results can also be used for benchmarking future microdevice designing. Furthermore, the present study serves as a baseline case for understanding transition flow in complex microchannels."}
{"text": "ABP). We have challenged its anti-inflammatory and immuno-modulatory properties in a robust rat model of acute uveitis induced by lipopolysaccharide (LPS). We show that dendrimer ABP at 2 µg/eye is as efficient as the “gold standard” dexamethasone at 20 µg/eye. We have demonstrated that the effect of dendrimer ABP is mediated at least through an increase of the production of the anti-inflammatory Interleukin(IL)-10 cytokine.Over the last decade, different types of dendrimers have shown anti-inflammatory properties in their own right. In particular, we have shown that poly(phosphorhydrazone) (PPH) dendrimers are able to foster an efficient anti-inflammatory response in human monocytes and can resolve the main physiopathological features of chronic arthritis in mice at 1 mg/kg. Here we afford new insights into the therapeutic potential of an azabisphosphonate-capped dendrimer (dendrimer  ABP  cells  [ABP, activates human monocytes in vitro [ABP has emerged as an anti-inflammatory “lead” dendrimer after the screening of the in vitro bio-activity of almost eighty dendrimers of different series [Poly(phosphorhydrazone) (PPH) dendrimers are synthesized according to a simple and efficient divergent strategy involving phosphorus-containing building blocks; and their surface functions can be easily modified to afford rationally-designed dendrimers . In thisABP , can act cancer) . We havein vitro  toward ain vitro ; and dent series ,7,8.per se [in vivo anti-inflammatory effects of dendrimer ABP in two mouse models of experimental arthritis: the IL1ra-/- and K/BxN models [ABP at 1 and 10 mg/kg weekly (for 12 weeks). Moreover, serum concentrations of pro-inflammatory cytokines and matrix metallo-proteases decreased significantly during treatment. We have also shown that per os administration of dendrimer ABP at 10 mg/kg/week for twelve weeks resolves experimental arthritis in this mouse model [ABP have also been demonstrated in the K/BxN serum transfer mouse model [ABP has become a serious drug candidate and is currently in pre-clinical development for the treatment of rheumatoid arthritis (RA) and potentially other inflammatory diseases [ABP in this highly competitive market, and to accelerate the bench to market process, it appeared appropriate to evaluate the activity of this compound in a relevant acute disease necessitating topical administration. In this regard, we have chosen the Endotoxin-Induced Uveitis (EIU) in the rat. This model is considered as a clinically relevant model for human anterior uveitis [ABP in the robust model of EIU in rats, in comparison with the “gold standard” dexamethasone.So far, only a few types of dendrimers have anti-inflammatory properties per se . In 2011N models . In IL1rekly for  weeks. Mdiseases ,14. In v uveitis ,16,17. I uveitis . The worABP for seven consecutive days following a single intra-vitreal injection in both eyes of rats. Three groups of three male Sprague-Dawley rats have been set up: the first group received the saline vehicle; the second and third groups received 20 µg (low-dose group) and 100 µg (high-dose group) of dendrimer ABP per eye, respectively.First, we have assessed the ocular tolerability of dendrimer During the study, no mortality and no effect on weight gain have been observed. Clinical observations revealed no detectable adverse effect on vision or eyesight in any of the treated animals. Gross clinical signs were limited to ocular observations of cloudiness in the vitreous of all animals of the high-dose group from day 1 to the end of the study, confirmed at necropsy. A slight cloudiness in the vitreous of one low-dose treated animal out of three was also noted from day 2 to the end of the study, but this cloudiness was not confirmed at necropsy two days later. Thus, cloudiness was found to be systematic and more important and persistent in the high-dose group than in the low-dose group.ABP-related.After dosing, McDonald-Shadduck scores elaborated from funduscopies and slit-lamp examinations (SLE) were consistently zero, with two exceptions when fluorescein staining of the cornea  was seen in one eye of an animal of the high-dose group at day 1 and in one eye of the low-dose group at day 6. The lack of any corneal findings during SLE examinations or histological studies suggests that the fluorescein staining did not indicate any underlying pathology but are likely spontaneous incidental background findings and not dendrimer Exhaustive histological studies were performed on eyeball tissue sections , and it ABP, while the 100 µg/eye dose was associated with inflammation in the vitreous. Having in hands these results, we have then decided to gain the “Proof of Concept” of the efficacy of dendrimer ABP in ophthalmology by the intra-vitreal route in a rat model of Endotoxin-Induced Uveitis (EIU). Increasing doses were chosen according to the tolerability study: 2, 10, 20 and 60 µg/eye, the latter being the only value over the NOAEL.Taking into account these data, we have considered the 20 µg/eye dose as a No Observed Adverse Effect Level (NOAEL) dose of dendrimer ABP in this model of acute inflammatory disease and challenged the “gold standard” dexamethasone. Six groups of six animals (n = 12 eyes) have been studied: vehicle only (group 1), dendrimer at 2 µg/eye (group 2), dendrimer at 10 µg/eye (group 3), dendrimer at 20 µg/eye (group 4), dendrimer at 60 µg/eye (group 5), dexamethasone at 20 µg/eye (group 6). Clinical scores of the six groups are presented in ABP-treated group has been excluded due to important hyphema, which could potentially modify clinical scoring, which led to work with n = 12 in all groups except in group 2 (n = 11).EIU is induced with injection of bacterial lipopolysaccharide (LPS) in the foot-pad of female albino Lewis rats and clinical scores are evaluated 24 h after induction. We have evaluated the effect of dendrimer ABP-treated eyes was statistically different from the mean score of vehicle group for the doses 2, 10 and 60 μg/eye with 33% (p < 0.01), 23% (p < 0.05) and 29% (p < 0.05) reduction, respectively. The mean clinical score of both eyes from dexamethasone-treated group was statistically reduced compared to the score from saline vehicle treated group with 49% (p < 0.001). Thus, these results show that a single intra-vitreal administration of dendrimer ABP at the time of LPS injection induces a significant reduction of ocular inflammation at the doses of 2, 10 and 60 µg/eye but does not exert any anti-inflammatory effect at the dose of 20 µg/eye, suggesting an inverse dose-response effect. It is important to note that the tolerability study revealed that administration of the molecule could induce sub-acute inflammation at the site of injection. Considering the small time scale of the assay (24 h), one can assume that the intrinsic anti-inflammatory properties of dendrimer ABP can be temporarily thwarted by the topical administration. Despite the fact that this effect could not be fully rationalized, this series of results show that in the most favorable case the effect of dendrimer ABP is not statistically different from the effect of the “gold standard” dexamethasone. In fact, the difference in the mean values of the two groups is not great enough to reject the possibility that the difference is due to random sampling variability (p = 0.1455).The mean clinical score evaluated 24 h after intra-vitreal saline vehicle administration was 3.83 ± 0.21. The mean clinical score of dendrimer ABP, we have assessed its effect at this dose by measuring local (in the aqueous humor and vitreous) and systemic (in the serum) concentrations of pro- and anti-inflammatory cytokines. Cytokine concentrations measured in aqueous humor and vitreous are presented in As the most important and significant effect is obtained with the dose of 2 µg/eye of dendrimer p < 0.05). On the contrary, TNF-α, IL-1β, IL-2 and IL-10 concentrations were not reduced in animals treated with 2 µg/eye of dendrimer ABP as compared to the one treated with saline vehicle alone.At 24 h post-induction and treatment, concentrations of pro-inflammatory/inflammatory cytokines TNF-α, IL-1β, IL-2 and anti-inflammatory cytokine IL-10 in ocular fluids were significantly reduced in the dexamethasone-treated group compared to the saline vehicle treated group (at least p < 0.001), due to the anti-inflammatory effect of the “gold standard” drug. In the dendrimer ABP-treated group, IL-6 and IL-17 concentrations tended to be reduced, although this reduction was not found significant. However, the statistical test indicates that the effect of dendrimer-ABP at 2 µg is not significantly different from that of dexamethasone (p > 0.05). Finally, it was found that the concentration of anti-inflammatory cytokine IL-4 and the concentration of pro-inflammatory cytokine IFN-γ in ocular fluids were not affected by dendrimer ABP or dexamethasone treatments at 24 h. In order to evaluate the influence of loco-regional applications on systemic inflammation marker response, we have then assessed the serum concentrations of IFNγ, TNFα, IL-2, IL-4 and IL-10  statements for the use of animals in ophthalmic and vision research ,21. OnlyABP per eye, respectively. On days 0 to 6, at approximately the same time on each day (±1 h), each animal was assessed by clinical observation and eye examinations. Ocular examinations included: funduscopy, slit-lamp examination (SLE) of the cornea using fluorescein dye enabling McDonald-Shadduck scoring. The McDonald-Shadduck Scoring System addresses: conjunctival parameters , aqueous flare  as presumptive evidence of breakdown of the blood-aqueous barrier; injection of secondary and tertiary vessels in the iris; cloudiness, relative area thereof, neo-vascularization and epithelial integrity (fluorescein labeling) of the cornea; integrity of the lens. On day 8, i.e., 2 days after the final ocular examination, all of the animals were sacrificed. Eyes were collected at necropsy, fixed in modified Davidson’s solution for 12 h, followed by 10% neutral buffered formalin and processed for histology. Hematoxylin-Eosin stained tissue sections were evaluated via light microscopy by a board-certified veterinary pathologist.The study consisted of three groups of three male Sprague-Dawley rats. On day 0, animals were weighed, anesthetized and administered by a single 5 µL intra-vitreal injection in both eyes. The first group received the saline vehicle (NaCl 0.9%), the second and third groups received 20 µg (low-dose group) and 100 µg (high-dose group) of dendrimer Salmonella typhimurium, Sigma-Aldrich, Saint-Quentin, France). Animals were treated immediately before EIU induction by a 5 µL intra-vitreal injection in both eyes of a saline solution (NaCl 0.9%) containing no active ingredient (group 1), or 2 µg of dendrimer ABP (group 2), or 10 µg of dendrimer ABP (group 3), or 20 µg of dendrimer ABP (group 4), or 60 µg of dendrimer ABP (group 5), or 20 µg of dexamethasone (group 6). Animals were examined by slit-lamp (SLE) at 24 h, i.e., the clinical peak of the disease in this model. The intensity of clinical ocular inflammation was scored on a scale from 0 to 5 for each eye. Grade 0 indicates no inflammation. Grade 1 indicates the presence of a minimal iris and conjunctival vasodilatation but without the observation of flare or cells in the anterior chamber (AC). Grade 2 indicates the presence of moderate iris and conjunctival vessel dilation but without evident flare or cells in the AC. Grade 3 indicates the presence of intense iris vessel dilation, flare and less than ten cells per slit-lamp field in the AC. Grade 4 indicates the presence of more severe clinical signs than Grade 3, with more than ten cells per slit-lamp field in the AC, with or without the formation of a hypopyon. Grade 5 indicates the presence of intense inflammatory reaction, fibrin formation in the AC and total seclusion of the pupil. Clinical evaluation was performed in a blinded manner. At the end of experiment, i.e., 24 h after LPS challenge, rats were anesthetized by intra-peritoneal injection of pentobarbital  then killed with a lethal dose of pentobarbital.Thirty-six female albino Lewis rats were randomly divided into six groups of six animals each. EIU was induced by a 100 µL footpad injection of sterile pyrogen-free saline solution containing 200 µg of LPS .ABP 2 µg and dexamethasone) were collected at the end of the experiment and stored at −80 °C. They were used for the simultaneous determination of five cytokine  levels with Cytometric Bead Array  on a FACS Calibur flow cytometer (BD Biosciences) according to the manufacturer’s instructions. The amounts of each of the cytokines were analyzed in relation to standard curves using the FCAP Array software (BD Biosciences).Sera from the three groups of rats . Data were compared with adequate non parametric Kruskal-Wallis ANOVA on Ranks to assess statistical significance with Sigma Stat software . ABP has anti-inflammatory and immuno-regulatory therapeutic effects in a mouse model of chronic arthritic inflammation when administered by systemic routes [ABP in a robust model of acute inflammation, namely the EIU in rats, performing a loco-regional administration of the molecule by the intra-vitreal route.Previously we have shown that dendrimer c routes , making c routes . In thisABP was evaluated after ocular administration in rats. The NOAEL dose was established at 20 µg/eye. The intensity of the clinical ocular EIU disease was evaluated by funduscopy and SLE 24 h after induction by LPS injection. We have shown that a single intra-vitreal administration of dendrimer ABP at the time of LPS injection induces a significant reduction of ocular inflammation. The strongest effect was observed at the lowest dose (2 µg/eye), and the effect dendrimer ABP was not found to be statistically different from the effect of the “gold standard” dexamethasone at higher dose (20 µg/eye).The tolerability of the dendrimer ABP at 2 µg/eye. IL-6 and IL-17 concentrations tend clearly to be reduced by this low dose, even though the reduction observed is not significant. Nevertheless, dendrimer ABP does not down-regulate important pro-inflammatory cytokines such as TNFα and IL-1β. Moreover, in serum, both dexamethasone and dendrimer ABP induced a strong increase of IL-10, the paradigm of anti-inflammatory and immuno-modulatory cytokines. This latter result suggests that these anti-inflammatory drugs might undergo a systemic passage while administered by a loco-regional route [We have also demonstrated that cytokine dosage in ocular fluids is also consistent with an anti-inflammatory effect of dendrimer al route ,23.ABP targets monocytes and triggers their anti-inflammatory activation [ABP in the EIU model may be mediated through anti-inflammatory activation of monocytes/macrophages, leading to systemic IL-10 production. Moreover, we have also shown that dendrimer ABP inhibits human CD4+ T lymphocytes [ABP in this model.In the EIU rat model, the LPS administration may induce ocular inflammation by stimulating the production of pro-inflammatory cytokines by activated monocytes/macrophages . We havetivation ,7. Therephocytes , these cABP has a significant anti-inflammatory activity in a clinically relevant rat model of anterior uveitis. This idea is supported by the fact that dendrimer ABP at 2 µg/eye is as active as “gold standard” dexamethasone at 20 µg/eye. This strengthens the anti-inflammatory and immuno-regulatory properties of dendrimer ABP for both chronic and acute inflammatory diseases, and makes it a possible drug-candidate for inflammatory diseases in ophthalmology.Taken together these results indicate that topical administration of dendrimer"}
{"text": "M entries, each represented by n bits, the method requires O(n) qubits and O(Mn) steps. With post-selection at an additional cost, our method can also store continuous data as probability amplitudes. As an example, we present a procedure to convert classical training data for a quantum supervised learning algorithm to a quantum state. Further improvements can be achieved by reducing the number of state preparation queries with the introduction of quantum forking.A prerequisite for many quantum information processing tasks to truly surpass classical approaches is an efficient procedure to encode classical data in quantum superposition states. In this work, we present a circuit-based flip-flop quantum random access memory to construct a quantum database of classical information in a systematic and flexible way. For registering or updating classical data consisting of  The ability to efficiently convert classical data into quantum states is essential in many algorithms with complex data sets, such as quantum searching3, collision finding4, and quantum Fourier transform5. The demand for such ability has continued to grow with recent discoveries of quantum algorithms for data analysis and machine learning applications with large classical data10. Quantum simulation also requires the preparation of a quantum register in the initial physical state of the simulated system11. One promising avenue is to use quantum random access memory (QRAM)12, a device that stores either classical or quantum data with the ability to query the data with respect to superposition of addresses. The bucket brigade (BB) model for QRAM proposed in refs13 requires O(M) qutrits for routing, and O(M) classical or quantum memory cells for M binary data. The content of multiple data cells can be returned in superposition with only The theory of quantum information processing promises to accelerate certain computational tasks substantially. In practice, the computational cost of generating an arbitrary quantum input stateM classical data represented as n bits of information and bl is the attribute of O(n) qubits and O(Mn) quantum operations that are commonly found in many known algorithms. The probability amplitudes can be modified by post-selection at an additional cost of repeating the process and single qubit measurement. In addition, the FF-QRAM architecture can serve as a building block for the classical-quantum interface.Since quantum operations are applied directly to the qubits that form a QRAM as the state preparation is followed by a quantum algorithm, it is favorable to build a QRAM based on the quantum circuit model. At the same time, a QRAM should be a good interface to classical data for big data applications. In this work, we propose a flip-flop (FF) QRAM, which is constructed with the standard circuit-based quantum computation and without relying on a routing algorithm. The FF-QRAM can read unsorted classical data stored in memory cells, and superpose them in the computational basis states with non-uniform probability amplitudes to create a specific input state required in a quantum algorithm. Also, the classical information stored in the quantum state can easily be updated with the same FF-QRAM process. The cost for writing or modifying 14. Quantum forking is a framework to split unitary processes in superposition, with which the number of QRAM queries can be reduced in certain applications.A quantum state prepared by QRAM as an input to a specific algorithm cannot be reused once measured (the quantum measurement postulate), nor be copied (the no-cloning theorem) for another task. Thus, in general, the QRAM cost seems unavoidable per algorithm run, even when performing a set of algorithms with an identical input state. Here we introduce a process of quantum forking inspired by process forking in computer operating systems, which creates a child process that can evolve independentlyM is the number of data. For big data applications, a typical quantum representation of l denote a data entry and the corresponding label, respectively10. The probability amplitude, bl, can encode continuous data as required in some applications15, or represent the normalized occurrence of the data entry M numbers of n-bit data, n + m qubits are sufficient to realize the QDB, where n and A quantum superposition state prepared with respect to classical data for quantum computation can be referred to as quantum database (QDB). In most general form, a QDB can be expressed asn + m)-qubit bus state to encode a big data class database. The bus qubit state can be arbitrary, and it defines which computational basis states, |j〉B, are accessed with probability amplitudes, D asB (R) indicates the bus (register) qubit, and the register qubit can include the probability amplitudes for encoding the analog data. The FF-QRAM is implemented systematically with standard quantum circuit elements, which include the classically-controlled Pauli X gate, n-qubit controlled rotation gate, CnRp(θ). The CnRp(θ) gate rotates the target qubit by θ around the p-axis of the Bloch sphere only if all n control qubits are 1.The FF-QRAM is used to generate a QDB as follows. Consider a quantum computer with an (n + 1) qubits in the process of writing the lth data entry, observed at the sth step in Fig. The underlying idea of the FF-QRAM model is depicted in Fig. mentclass2pt{minimθl), which is data dependent. In some instances, such as in the distance-based quantum classifier10, the post-selection success probability can be improved by pre-processing the classical data so that θl) flip-register-flop steps, the total FF-QRAM cost must include the resource overhead for the register operations. In fact, the number of elementary gates needed for this step can dominate the runtime of the entire QRAM process. Thus efficient realization of CnRp(θ) is critical for the practicality of our scheme. Though the optimal circuit depth reduction can be carried out based on the naturally available set of gates in a specific experimental setup, and is beyond the primary scope of this paper, we briefly mention some examples on how to implement CnRp(θ) here. If energy splittings between all pairs of the computational basis states are distinct, then in principle, a resonant pulse at the frequency corresponding to the energy difference between CnRp(θ). But this condition becomes exponentially challenging to satisfy in practice as the number of qubits increases. On the other hand, we can decompose the controlled rotation as Ry(θ/2) CnNOT nNOT gate can be further decomposed into 2n − 3 Toffoli gates with n − 2 ancilla qubits prepared in 16. Other methods for implementing CnNOT using O(n) number of elementary gates and ancillary space are discussed in refs18. The circuit optimization in terms of Clifford and T gates can be performed using the techniques presented in refs20.In addition to ε, and remains unchanged with probability nNOT, 2n − 1 qubits undergo M classical bit strings of length n with arbitrary probability amplitudes is M classical bit strings with arbitrary probability amplitudes, assuming ps of the total QRAM process. A milder assumption that the imperfect CnRp(θ) operation causes independent errors on n + 1 qubits yields a better success probability, We investigate the robustness of the FF-QRAM shown in Fig. entclass1pt{minima23 can be employed to enhance the accuracy. In contrast, if quantum error correction is applied to BB-QRAM, all routing components are activated at a physical level and make the scheme equivalent to the conventional fanout architecture24. In addition, depending on the physical setup, the quantum circuit can be further optimized using various gate decomposition techniques26.Since our scheme is based on the quantum circuit model, fault-tolerant quantum error correction techniquesM denotes the number of training data samples8. The quantum circuit for preparing this QDB is depicted in Fig. i, where without loss of generality, M and N are assumed to be powers of two. An equal superposition state for log2(M) and log2(N) qubits is used as the bus qubit for providing the computational basis states k and i, respectively. The jth element of y-axis rotation of the register qubit. Note that the gates shaded in gray are included only to show the full flip-flop process for addressing a specific computational basis state, but they can be omitted in the implementation. The state shown in Eq. (O(MN) flip-register-flop operations.As an example, we demonstrate the FF-QRAM process for preparing a training data state in the quantum support vector machine. The classified training examples, n-qubit QDB state n-qubit state s in Fig. n-qubit swap gate between Here, we introduce a concept of quantum forking (QF) with which a qubit can undergo independent processes in superposition. This can be utilized as a means to reduce the number of QRAM queries in certain applications. Let us consider a quantum state n-qubit data block if the control qubit is 0, and in the second n-qubit data block if the control qubit is 1. Then by applying two unitary evolutions activated by different computational basis states of the control qubit to each n-qubit block, In other words, the QDB is encoded in the first 27 and the inner product calculation. Here we focus on the inner product evaluation problem as an example. The inner product between 28. Alternatively, starting from the state shown in Eq.  additional gates, but reduces the number of QRAM queries by a factor of ~1/2. Note that the conventional swap test can only estimate the magnitude of the inner product. Thus the QF based approach not only reduces the number of QRAM queries, but also allows for the determination of the sign of the inner product. This is a consequence of an important property of the QF circuit; since different unitary operators can be applied to each branch (subspace), the global phase that a unitary operator introduces become distinguishable. Clearly, the quantum circuit shown on the left side of Fig. 27.Finally, the probability of measuring the control qubit in d (or log2(d) qubits), and O(nd) gates.Generalizing above idea, a quantity such as H3 represents the qutrit Hadamard operation for preparing the equal superposition of the three computational basis states. This circuit produces an entangled state The quantum forking for implementing three different unitary processes in superposition is depicted in Fig. n-bit classical data with arbitrary probability amplitudes stored in M memory cells into quantum format using O(n) qubits and O(Mn) flip-register-flop steps. The versatility of the architecture allows to create a complex data structure via encoding any classical information, either discrete or continuous, as quantum bits or as probability amplitudes of a quantum state. An example of the amplitude encoding is the application to a quantum state generation for a quantum support vector machine algorithm in which the training data is represented with the probability amplitudes as shown in Fig. CnRp(θ). For the uniform weight which is, for example, encountered in the parity learning algorithm30, the multi-qubit controlled gate is simply CnNOT. For the amplitude encoding, the final QDB state is obtained by post-selecting on the register qubit being 20 introduces a procedure inspired by classical alias sampling to assign the probability amplitude μ + 2n + O(1) ancilla qubits, where μ-bit binary approximation to the desired non-negative real value, ρ. In ref.11, adiabatic-diabatic state preparation is used to generate superposition states with squared amplitudes.Encoding large classical data into a quantum database must be done efficiently in a way that the potential advantages of the quantum algorithms for big data applications do not vanish. We proposed the flip-flop QRAM, a systematic architecture, for preparing a quantum database using the quantum circuit model. The circuit-based construction is imperative since it provides flexibility and compatibility with existing quantum computing techniques. Our process can register L identical QRAM processes in parallel. Then the success probability of the post-selection improves by a factor of L while also increasing the number of qubits and the gates by the same factor. Note that the time complexity remains the same. Second, the QDB is not reusable once it is consumed by a quantum algorithm since the measurement collapses the state. Motivated by the above, we introduced the concept of quantum forking that allows to reduce the number of QRAM queries in some instances, in particular, when evaluating the inner product. Finding other instances for which the quantum forking can reduce the number of QRAM calls, even by a constant amount, remains an interesting open problem.We point out potential solutions to several issues for meaningful applications of QRAM. First, when the FF-QRAM process leaves the last term in Eq.  that cornNOT gate can be decomposed into a Cn−1NOT and a C2NOT (Toffoli) using an ancilla qubit prepared in n = 4 as an example. Then by recursion, CnNOT can be realized using 2n − 3 Toffoli gates and n − 2 ancilla qubits prepared in n − 2 Toffoli gates are added after the Toffoli gate for conditionally flipping the target qubit in order to unentangle the ancilla qubits from the system. The quantum circuit can be rearranged to further reduce the depth as shown in the last step in Fig. The CCnRy(θl) and before CnRy(θl+1) can be merged. The combined operation flips the jth qubit only if M classical data of length n is n(M + 1). Each CnRy(θ) uses two single qubit gates and two CnNOT gates. In the CnNOT implementation described above  undergo We assume that the ove Fig. , 2n − 1 τ that are subject to noise can be counted asTherefore, the total number of time steps CnRy(θ) can be implemented with only n + 1 independent errors, then τ can be further reduced to If"}
{"text": "Word embedding technologies, a set of language modeling and feature learning techniques in natural language processing (NLP), are now used in a wide range of applications. However, no formal evaluation and comparison have been made on the ability of each of the 3 current most famous unsupervised implementations  to keep track of the semantic similarities existing between words, when trained on the same dataset.The aim of this study was to compare embedding methods trained on a corpus of French health-related documents produced in a professional context. The best method will then help us develop a new semantic annotator.Unsupervised embedding models have been trained on 641,279 documents originating from the Rouen University Hospital. These data are not structured and cover a wide range of documents produced in a clinical setting . In total, 4 rated evaluation tasks were defined  and applied on each model, as well as embedding visualization.Word2Vec had the highest score on 3 out of 4 rated tasks , particularly regarding the skip-gram architecture.Although this implementation had the best rate for semantic properties conservation, each model has its own qualities and defects, such as the training time, which is very short for GloVe, or morphological similarity conservation observed with FastText. Models and test sets produced by this study will be the first to be publicly available through a graphical interface to help advance the French biomedical research. The use of clinically derived data from electronic health records (EHRs) and other clinical information systems can greatly facilitate clinical research as well as optimize diagnosis-related groups or other initiatives. The main approach for making such data available is to incorporate them from different sources into a joint health data warehouse (HDW), thus containing different kinds of natural language documents, such as prescription, letters, surgery reports—all written in everyday language .Clinical named entity recognition (NER) is a critical natural language processing (NLP) task to extract concepts from named entities found in clinical and health documents (including discharge summaries). A semantic health data Warehouse (SHDW) was developed by the Department of Biomedical Informatics of the Rouen University Hospital (RUH), Normandy, France. It is composed of 3 independent layers based on a NoSQL architecture:A cross-lingual terminology server, HeTOP, which contains 75 terminologies and ontologies in 32 languages A semantic annotator based on NLP bag-of-word methods (ECMT) A semantic multilingual search engine To improve the semantic annotator, it is possible to implement deep learning techniques to the already existent one. To do so, a new text representation, which keeps the most semantic similarities existing between words, has to be designed to fit the input of neural networks algorithms (text embedding).distributional hypothesis.In NLP, finding a text representation that retains the meaning proximities has always been a moot point. Indeed, the chosen representation has to keep the semantic similarities between different words from a corpus of texts to allow indexation methods to output a correct annotation. Thus, the representation of a unique token has to show the proximity with other related meaning concepts , as illustrated in the quotation “You shall know a word by the company it keeps” , now knon dimensions, n representing the vocabulary size). In fact, a compact and precise representation of words could bring several benefits. First comes the computational aspect. Computers are way better to perform operations on low-dimensional objects. This then permits to calculate the probability of a specific concept to appear close to another one. Moreover, the vectors’ dimensions created to represent a word can be used to fit this word in a space and thus make distance comparisons with other tokens. Current unsupervised embedding techniques provide dense and low-dimensional information about a word, either with count-based or predictive-based methods  + Term 3 ~ Term 4)). Then, the operation was performed using vectors Term 1, Term 2, and Term 3 extracted from each model. The resulting vector was compared with the Term 4 vector, the operation being considered as correct if this Term 4 vector was found to be the closest one regarding the cosine distance with the operation resulting one, indicating a semantic similarity between Term 3 and Term 4, similar to the one between Term 1 and Term 2.Mikolov’s paper presenting Word2Vec showed that mathematical operations on vectors such as additions or subtractions are possible, such as the famous  were used for model pretraining. Then, this resulting embedding was trained a second time on the documents from the RUH without changing any parameter. All of the automatic tests were performed for this model a second time to assess if the added academic data improved the model’s quality regarding our evaluation.SD 207.42). The 10 most common words are listed in In total, 641,279 documents from the RUH have been de-identified and preprocessed. With regard to the vocabulary, texts have been split into 180,362,939 words in total, representing 355,597 unique tokens. However, this number can be pondered with 170,433 words appearing only once in the entire corpus . In total, 50,066 distinct words were found more than 20 times in the corpus, thus present in the models (minimum count parameter set to 20). On average, each document contains 281.26 words (K=5). To visualize their distribution on 2 dimensions, t-SNE algorithm had been used (These documents were decomposed using the Term-Frequency Inverse-Document-Frequency (TF-IDF) algorithm that resulted in a frequency matrix. Each row, representing an article, had been used to cluster those documents with a kMeans algorithm (number of classes een used  29]..K=5). ToThose main classes were well separated, thus the vocabulary itself contained in the documents from the HDW was sufficient to clusterize each type of text. However, discharge summaries, surgery, or procedure reports were a bit more mixed because of the words used in these kinds of context . With regard to drug prescriptions and letters to a colleague or from a general practitioner, they present a more specific vocabulary , involving more defined clusters for these 2 groups.Regarding the training time, models were very different. GloVe was the fastest algorithm to train with 18 min to process the entire corpus. The second position was occupied by Word2Vec with 34 min and 3 hours 02 min . Finally, FastText was the slowest algorithm with a training time of 25 hours 58 min with SG and 26 hours 17 min with CBOW .context || target pairs highly increases the time to go through all possibilities.GloVe performs much better in terms of computational time because of the way it handles the vocabulary. It is stored as a huge co-occurrence matrix and thanks to its count-based method, which is not computationally heavy, it can be highly parallelized. It was expected that FastText would take a lot of time to train, because of the high number of word subvectors it creates. However, for Word2Vec, the difference between the 2 available subarchitectures is highly visible (33 min to 3 hours 02 min). This difference could come from the hierarchical softmax and one-hot vector used by the CBOW architecture, which reduces the usage of the CPU. With SG, the minibatch parsing of all the The total number of UMNSRS pairs successively retrieved by each model has been extracted . The percentages of validated pairs from the UMNSRS datasets are presented in the With regard to the odd one similarity task, models are quite different . Word2VeWith regard to the subarchitectures presented by both Word2Vec and FastText, the SG always performed better than the CBOW, possibly because of the negative sampling. Indeed, the studied corpus is quite heterogeneous and words can be listed as items  instead of being used in correct sentences. Thus sometimes, the complete update of vectors’ dimensions generates non-senses in the models .The evaluation focused on 1796 terms  rated from 0 to 2 by 2 evaluators. First, the agreement between CM and SJD was assessed with a weighted kappa test . A kappaMoreover, to assess if human evaluators remained coherent regarding the cosine distance computed by each model, the average note given by the 2 evaluators was compared with the average of the cosine distance computed for each model . Word2VeTo go further, the cosine distances between the 112 sent concepts and the 1796 returned were plotted for each of the 3 modalities rated by the evaluators . In fact, allowing to check if the similarity between Term 1 and Term 2 is the same as the one between Term 3 and Term 4. These operations have been defined to cover a wide range of subjects .A list of 6 mathematical operations has been defined with the help of an MD and a university pharmacist , while CBOW only reached (3/6)). FastText, independently of the architecture studied, obtained a score of (3/6). GloVe got the lowest score by reaching (2/6).Each operation mélanome [melanoma] and adénome [adenoma]) were cited far from their localization . This distance may be too high for the context-window size (7 words).Interestingly, no operation has been failed by the 5 models, indicating that none of them is simply not logical or just too hard to perform for word embedding models. Operation 2 has been missed by both Word2Vec and FastText SG, whereas CBOW architectures succeeded to perform it for both algorithms. In the corpus, tumors . The subword decomposition performed by this algorithm was keeping track of the context, but was not as accurate as Word2Vec SG in this task. This imbalance was not compensated by the SG architecture, which performed better for Word2Vec, indicating that this subword decomposition has a really strong impact on the embedding.(cardiologie - coeur) + poumon ~ pneumologie(cardiology - heart) + lung ~ pneumology(mélanome - peau) + glande ~ adénome(melanoma - skin) + gland ~ adenoma(globule - sang) + immunitaire ~ immunoglobuline(corpuscle - blood) + immune ~ immunoglobulin(rosémide - rein) + coeur ~ fosinopril(furosemide - kidney) + heart ~ fosinopril(membre - inférieur) + supérieur ~ bras(limb - lower) + upper ~ arm(morphine - opioide) + antalgique ~ perfalgan(morphine - opioid) + antalgic ~ perfalganAs a visual validation, t-SNE algorithm was applied on vectors extracted from each of the 5 models. To investigate how word vectors are arranged, clusters had been manually searched on the projection. Word2Vec clustered words with a good quality regarding the context they could be used in. Both SG and CBOW architectures had logical word clusters, for example, related to time .an [year] to 8 for semaines [weeks]) or the composition of letters (no letters in common between the 2 neighbors semaine [week] and jour [day]).Many other clusters were found by reducing the dimension of both Word2Vec SG and CBOW results; some are showed on By looking at the dimensional reduction of vectors produced by GloVe, it is visible how co-occurence matrix used by this algorithm is affecting the placement of vectors in the VSM. In fact, words often used close to each other  are clusterizing well. In the group given as an example in With regard to FastText, it is interesting to notice that clusters of words used in a similar context were found but other variables do influence the spatial arrangement of the vectors a lot when projected on 2 dimensions: word size and composition. Indeed, as seen on the With regard to the global shape of the 5 projections on the So far, Word2Vec with the SG architecture showed the best results in average . Thus, aWhen this model trained on 2 different datasets is compared with the initial Word2Vec model (without any pretraining), scores were not changed with regard to the cosine and odd one tests . Interestingly, the grade coming from analogy-based operations decreased, lowered from 5/6 to 3/6. This could come from the fact that documents used for pretraining (scientific articles) were highly specialized in a domain, leading to already strongly associated vectors.In this study, the 3 most famous word embeddings have been compared on a corpus of challenging documents  with 5 different evaluating tasks. The positive and negative semantic relationships have been assessed, as well as the word sense conservation by human and analogy-based evaluation.Gensim, which could have brought a bias in this study. This model is computing a cosine distance closer to 1 in average between queried word and close ones, whereas human judgment shows the lowest grade. With regard to FastText, it is interesting to notice that the morphological similarities are kept in account in the vector space creation. In fact, word clusters are highly impacted by the word’s composition in letters and by its size. However, the subvector decomposition of words allows this kind of model to be queried by words absent in the original training corpus, which is impossible with others. Therefore, this model could be used for orthographic correction or acronym disambiguation, for example.The training in our 600,000 of challenging documents showed that Word2Vec SG got the best score for 3 on the 4 rated tasks (FastText SG is the best regarding the cosine one). These results are coherent with those obtained by Th et al, who compared Word2Vec and GloVe with the cosine similarity task . More spThe medical corpus used as a training set for these embedding models is coming from a real work environment. First, finding a good evaluation for embeddings produced in such a context is a hard task. The performances shown by some models trained on scientific literature or on other well-written corpus should be biased regarding their utilization on a very specific work environment. Second, based on our results, an amount of 26.1% of unique tokens found in the health-related documents are not present in an academic corpus of scientific articles, indicating a weakness of the pretrained embedding models. Documents produced in a professional context are highly different compared with this kind of well-written texts. Finally, in this study, pretraining an embedding with an academic corpus and then on the specific one does not improve the model’s performances. It even lowers the score associated to analogy-based operations, indicating strongly associated vectors in the VSM, which leads to a loose of the inherent plasticity of this kind of model to deeply understand the context of a word.There are a few limitations in our study. First, other embedding models, newly released, could have been compared as well , representing 72.3% of the total number of word pairs searched that cannot be found in the models.Regarding the cosine annotation, low scores could be explained by the number of occurrences of each term from the 625 words pairs in the corpus of texts. The UMNSRS-Rel dataset contains 257 unique terms for 317 word pairs, whereas the UMNSRS-Sim contains 243 terms for 308 word pairs. First, 128 words in total (25.6%) have been found less than 20 times regarding all of the 641,279 documents, thus being absent in the model because of the disulfirame). The natural medical language used in the RUH by the practitioners prevents some words to be found: use of an acronym  or of a synonym . Another explanation could come from the fact that some associations defined in those UMNSRS datasets can be true in an academic context, but will be very rarely found in a professional context.Most of the words absent from the models are drugs’ molecular names, whereas practitioners from the RUH often use the trade names to refer to a drug  is mainly composed of clinical symptoms or diseases. This validation corpus seems to be just not suitable to investigate the quality of embedding trained on such a corpus.With a median number of occurrences of 230 in the entire corpus of health documents, 176 words (28.1%) have been found more than 1000 times. Whereas the biggest proportion of the low-frequency words was composed of drugs or molecules names, the high-frequency group of words (up to 134,371 times for the word In our case, Word2Vec with the SG architecture got the best grade in 3 out of the 4 rated tasks. This kind of embedding seems to preserve the semantic relationships existing among words and will soon be used as the embedding layer for a deep learning based semantic annotator. More specifically, this model will be deployed for semantic expansion of the labels from medical controlled vocabularies. To keep the multilingual properties of the actual annotator, a method of alignment between the produced embedding and other languages will also be developed. Other recently tested unsupervised embedding methods exhibit a certain quality, but their ability to preserve the semantic similarities between words seems weaker or influenced by other variables than word context.As soon as the paper is submitted, any end user will be able to query the word embedding models produced by each method on a dedicated website as well as to download high quality dimension reduction images and test sets . This em"}
{"text": "Age-related cataract (ARC) is one of the major causes of visual impairment and reversible blindness worldwide. Accumulating evidence has revealed that circular RNAs (circRNAs) are involved in multiple regulatory processes in various ocular diseases. However, the expression profile, regulatory roles, and underlying mechanisms of circRNAs in ARC remain largely unknown. Herein we deep-sequenced circRNAs of anterior lens capsules from normal and ARC lenses, and detected 23,787 candidate circRNAs. Of these, 466 were significantly differentially expressed, and a higher correlation in down-regulated circRNAs between ARC and diabetic cataract was observed compared with up-regulated ones. Subsequent bioinformatics analysis disclosed that certain differentially expressed circRNAs participated in oxidative stress and apoptosis-related signaling pathways in ARC. Notably, the level of circZNF292 was significantly decreased, while miR-23b-3p was significantly increased in ARC. The target region prediction and dual-luciferase reporter assays proved that circZNF292 acted as a competitive endogenous RNA to regulate the expression of anti-oxidative genes through competing with miR-23b-3p. Our results indicate that circZNF292, a down-regulated circRNA in the anterior lens capsule of ARC patients, may be involved in resistance to oxidative damage and apoptosis of lens epithelial cells by sponging miR-23b-3p, providing a potential target for prevention and treatment of ARC. Cataract is one of the most common eye diseases which result in visual impairment and reversible blindness , 2. TherIn previous studies on the pathogenesis of ARC, oxidative stress was demonstrated to directly cause lens opacity and assumed to be a key factor during the development of cataracts , 8. FromWith the rapid advance of high-throughput sequencing technology, the role of circular RNAs (circRNAs), which emerge as vital regulators in various diseases, has drawn increasing attentions –17. UnliMoreover, numerous non-coding RNAs participate in oxidative damage during the cataract formation –34. ChenIn the current research, we explored the underlying mechanisms of circRNAs in the process of resisting oxidative damage by characterizing the interactions among circRNAs, miRNAs, and mRNAs in ARC for the first time. Among the differentially expressed circRNAs, circZNF292 was disclosed to act as a competitive endogenous RNA (ceRNA) of miR-23b-3p and be involved in reducing the oxidative damage to LECs by binding to anti-oxidative genes, thereby delaying the occurrence and development of ARC.To understand the regulatory roles of circRNAs in ARC, we first characterized the expression profile of circRNAs in anterior lens capsules. Briefly, we performed RNA sequencing (RNA-Seq) of ribosomal RNA (rRNA)-deleted total RNAs from normal  and ARC anterior lens capsules   on an IlP < 0.05) were set to elect differentially expressed circRNAs  was found to be significantly down-regulated in the ARC sample tissues [In our study, we detected circRNA expression profiles in ARC in detail using second generation sequencing technology to explore their potential clinical value. A total of 466 significantly different circRNAs were detected, 92 of which were newly detected molecules. Similarly, in our sequencing data, circHIPK3 , aged 54 to 81 years , who underwent ARC surgery at our institution. All these patients had no diabetes, hypertension or other ocular diseases. The capsules were removed by the same experienced surgeon (YH) during continuous curvilinear anterior capsulorhexis of cataract surgery. Moreover, nine transparent anterior lens capsules from healthy donor eyes were used as normal controls. All samples were immediately flash-frozen in liquid nitrogen before stored at -80 °C. Because the content of RNAs of a single lens anterior capsule was not adequate for RNA sequencing, three samples were combined for RNA extraction. Hence there were six replicates in the ARC group and three replicates in the control group . For subTotal RNAs were extracted from frozen anterior lens capsule tissues using TRIzol reagent  in accordance with the instructions. The concentration of total RNAs was measured by a NanoDrop instrument , and the ratio of OD260/OD280 (between 1.8 and 2.1) was used as an indicator of RNA purity. The integrity of RNAs was also detected on the denaturing agarose gel electrophoresis according to the morphology of the 28S and 18S rRNA bands. Then library construction for sequencing was performed. Briefly, rRNAs in total RNAs were removed, and the purified RNAs were reverse-transcribed into complementary DNAs (cDNAs), adaptor ligated, and PCR amplified following the instructions of the TruSeq Stranded Total RNA Library Prep Kit (Illumina). RNA libraries were quality-controlled and quantified using the BioAnalyzer 2100 system  before sequenced on the Illumina HiSeq4000 Platform with a read length of paired-end 150 bp.http://www.circbase.org) and circ2Trait [http://gyanxet-beta.com/circdb/) were used to annotate the identified circRNAs.The 3' adaptor sequences were trimmed with cutadapt software (v1.9.3) . Clean rrc2Trait    was usedCompared with the same control group, we performed RNA-seq on the human anterior capsule tissues of patients with ARC and DC . R packehttp://www.geneontology.org) and KEGG (http://www.genome.jp/kegg) enrichment analyses on the host genes of differentially expressed circRNAs. GO developed a structured, controlled vocabulary to describe genes and gene product attributes in organisms. The ontology covered molecular function, biological process, and cell component. Through the KEGG pathway analysis of host genes, we inferred the signaling pathways involved in circRNAs and their biological functions. The P value was obtained using fisher’s exact test, with a recommended cut-off at 0.05.We performed GO (https://web.archive.org/web/20110222111721/http://starbase.sysu.edu.cn/), which provides miRNA-target interaction prediction based on high-throughput CLIP-Seq data [To clarify the role of differential circRNAs in cataracts, miRNA targets for circRNAs were predicted using target prediction software based on miRanda and TargetScan . StarBase . qRT-PCR was performed on the ViiA 7 Real-time PCR System (Applied Biosystems) using the qPCR SYBR Green Master Mix (Applied Biosystems). Specific primers for circRNAs were designed by primer 5.0 according to the sequence of the linear transcripts. Primer sequences of selected circRNAs and miRNA are shown in http://genome.ucsc.edu/cgi-bin/hgGateway) and circPrimer1.2 (http://www.bioinf.com.cn/) provided a visual representation of the circZNF292 composition and its location on the parental genes.To further elucidate the functional role of circRNAs, we selected circZNF292, which was markedly down-regulated in ARC plasma tissues, for further analysis. TargetScan and StarBase were applied to predict the mRNA targets of miRNAs. Based on a previous report , oxidatiRenilla were detected 48 hours after transfection according to the manual of the Dual-Luciferase Reporter Assay System (Progema), and the relative fluorescence value was calculated.A dual-luciferase reporter assay was performed to confirm the direct binding of miR-23b-3p and circZNF292. The wild-type and mutant sequences of circZNF292 were subcloned into multiple cloning regions (1640–1674 bp) of psiCHECK-2 luciferase reporter vectors (Progema). Then target-site containing plasmids, together with miR-23b-3p mimics or miRNA negative controls, were co-transfected into cells with Lipofectamine 2000 transfection reagent (Thermo Fisher). The fluorescence activities of firefly and Anterior lens capsules used in this study were collected from patients undergoing surgery for ARC and healthy donor eyes provided by the eye bank of our institution. The study was performed in accordance with the tenets of the Declaration of Helsinki. The protocol was reviewed and approved by the Ethics Committee of Shandong Eye Institute. We informed the patients of the use of their specimens and obtained their consent.Supplementary Table 1"}
{"text": "We investigated the intracellular metabolic mechanisms driving oxLDL-induced trained immunity in human primary monocytes and observed concomitant upregulation of glycolytic activity and oxygen consumption. In two separate cohorts of healthy volunteers, we assessed the impact of genetic variation in glycolytic genes on the training capacity of monocytes and found that variants mapped to glycolytic enzymes PFKFB3 and PFKP influenced trained immunity by oxLDL. Subsequent functional validation with inhibitors of glycolytic metabolism revealed dose-dependent inhibition of trained immunity in vitro. Furthermore, in vivo administration of the glucose metabolism modulator metformin abrogated the ability for human monocytes to mount a trained response to oxLDL. These findings underscore the importance of cellular metabolism for oxLDL-induced trained immunity and highlight potential immunomodulatory strategies for clinical management of atherosclerosis.Stimulation of monocytes with microbial and non-microbial products, including oxidized low-density lipoprotein (oxLDL), induces a protracted pro-inflammatory, atherogenic phenotype sustained by metabolic and epigenetic reprogramming via a process called Brief stimulation of monocytes to oxLDL induces a prolonged inflammatory phenotype.This is due to upregulation of glycolytic metabolism.Genetic variation in glycolytic genes modulates oxLDL-induced trained immunity.Pharmacological inhibition of glycolysis prevents trained immunity.The online version of this article (10.1007/s00109-020-01915-w) contains supplementary material, which is available to authorized users. We receimmunity , 3. Impoimmunity –6. Cellsimmunity . Therefoimmunity . To thisimmunity , 9. Indeimmunity , 11.Trained immunity induced by β-glucan or BCG is associated with profound intracellular metabolic reprogramming, characterized by increased glycolytic metabolism and intracellular accumulation of fumarate and mevalonate , 12–14. At the level of gene regulation, trained immunity is characterized by epigenetic changes that modulate transcriptional programs. Studies of cells trained with β-glucan  and BCG The current study is aimed at unraveling the role of metabolic reprogramming in oxLDL-induced trained immunity.Escherichia coli lipopolysaccharide , Pam3Cys , 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one , and 2-deoxy-d-glucose . Low-density lipoprotein was isolated from pooled human serum by ultracentrifugation and oxidized by incubating with 20 μmol CuSO4/L for 16 h at 37 °C followed by dialysis, as previously described [Buffy coats from healthy donors were obtained after written informed consent . Human peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient centrifugation over Ficoll-Paque . Percoll isolation of monocytes was performed as previously described as yielding a level of T cell contamination, measured by fluorescence-activated cell sorting of only 5% , 17. Pur2. For pharmacological inhibition experiments, cells were co-incubated with inhibitors  for the 24 h of oxLDL stimulation. For glucose experiments, cells were incubated with oxLDL (10 μg/mL) in culture medium supplemented with 5 mM glucose (+ 20 mM mannitol) or 25 mM glucose for 24 h, washed with warm PBS, and incubated with RPMI supplemented with 6 mM glucose and 10% pooled human serum  at 37 °C, 5% CO2. Following 5 days in culture, cells were restimulated with medium alone, 10 ng/mL LPS.Adherent monocytes were trained as described previously . BrieflyCytokine production in supernatants after 24 h or 7 days was determined using commercial enzyme-linked immunosorbent assay kits for TNF-α and IL-6  according to the instructions of the manufacturers.18s was used as a housekeeping gene. RT-PCR primers are listed in Table S1.Total RNA was isolated from macrophages using TRIzol reagent according to the manufacturer’s instructions. 0.5–1 μg of total RNA was used to synthesize cDNA with the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific) according to the manufacturer’s protocol. Quantitative RT-PCR was performed using an Applied Biosciences StepOnePLUS qRT-PCR machine using SYBR Green (Invitrogen). All reactions were performed for at least 6 biological replicates and the values expressed as log2 fold increase in mRNA levels relative to those in non-trained cells. Trained monocytes on day 6 were cross-linked in methanol-free 1% formaldehyde, followed by sonication and immunoprecipitation using antibodies against H3K4me3 . Immunoprecipitated chromatin was processed further for qRT-PCR analysis using the MinElute DNA Purification Kit (Qiagen). Primers used in the reaction are listed in Table 7 monocytes were trained with oxLDL (10 μg/mL) in 10-cm Petri dishes (Greiner) in 10 mL medium volumes for 24 h, washed with warm PBS, and incubated in normal culture medium at 37 °C, 5% CO2. Following 5 days in culture, cells were detached with Versene solution (Thermo Fisher Scientific) and 1 × 105 cells were plated in quintuplicate to overnight-calibrated cartridges in assay medium  and incubated for 1 h in a non-CO2-corrected incubator at 37 °C. Trained and untrained macrophages for each respective donor were included in the same assay. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Cell Mito Stress Kit (for OCR) or a glycolysis stress test (for ECAR) kit in an XFp Analyzer (Seahorse Bioscience), with final concentrations of 1 μmol/L oligomycin, 1 μmol/L FCCP, and 0.5 μmol/L rotenone/antimycin A.Approximately 1 × 10www.humanfunctionalgenomics.org). Genotype information on approximately 8 million single-nucleotide polymorphisms (SNPs) was obtained using Illumina HumanOmniExpressExome SNP chip upon imputation. Only SNPs with a minor allele frequency of ≥ 5% that passed standard quality filters were included in the analysis. Raw cytokine levels were log-transformed and the ratio between trained and non-trained cytokine levels was used to quantify the trained immunity response. They were subsequently mapped to genotype data using a linear regression model with age and gender as covariates [We conducted in vitro oxLDL training of adherent PBMCs from 119 healthy individuals of Western European ancestry from the 200 Functional Genomics cohort (2011/399) of the Human Functional Genomics Project .We also conducted in vitro oxLDL training of adherent PBMCs in a second cohort of 243 healthy individuals of Western European ancestry from the 300BCG cohort (NL58553.091.16). DNA samples of the individuals from the second cohort were genotyped using the commercially available SNP chip, Infinium Global Screening Array MD v1.0 from Illumina. Genotype information on approximately 4 million SNPs was obtained upon imputation . Inclusion of volunteers and experiments were conducted according to the principles expressed in the Declaration of Helsinki. All volunteers gave written informed consent before any material was taken.In this prospective study, 11 healthy non-obese volunteers received increasing doses of metformin for a total of 6 days (starting at 500 mg once per day and ending with 1000 mg twice per day). Baseline characteristics of the participants are described in Table p value < 0.05 (*) was considered statistically significant, (**) p < 0.01. Data represent mean ± SEM.Ex vivo and in vitro monocyte experiments were analyzed using a Wilcoxon signed-rank test. R-package Matrix eQTL was used for cytokine QTL mapping. A To investigate the metabolic phenotype of monocytes trained with oxLDL, we incubated human primary monocytes with culture medium or oxLDL (10 μg/mL) for 24 h. On day 6, the cells were restimulated with culture medium alone or the Toll-like receptor 4 ligand lipopolysaccharide  for 24 h, after which pro-inflammatory cytokine production was measured Fig. . Tumor nPFKP, PKM1, and PKM2 in cells incubated with RPMI. Statistically significant differences were observed for HK2 and PFKFB3 in untrained macrophages stimulated with LPS. Training with oxLDL exacerbated this effect, particularly for PFKFB3 mRNA expression. In contrast, the expression of genes encoding pyruvate kinase enzymes PKM1 and PKM2 was not significantly altered by oxLDL training  Fig. , signifying Fig. .. Furthermore, we observed considerable inter-individual variation in cytokine production by oxLDL-trained cells . To investigate the sources of this variation, we explored the potential influence of factors known to affect cytokine production and observed no effect of age  for 24 h. We confirmed that the oxLDL-dependent augmented production of TNF-α and IL-6 previously seen in enriched monocyte fractions was also detectable in PBMCs Fig. . Furtherlls Fig. . To inveage Fig.  or sex  QTLs were not observed. However, to increase sensitivity, we studied all SNPs with a p value < 9.99 × 10−3 Using this approach, we identified several SNPs suggestively associated with adaptive changes in cytokine production mapped within 250 kB of genes encoding key glycolytic enzymes. Specifically, genetic variation in genes encoding the inducible PFK-2/FBPase isozyme 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3) and phosphofructokinase (PFKP) were associated with the potentiation of TNF-α and IL-6 production upon training with oxLDL  which is located within an enhancer region approximately 100 kB downstream of PFKP (GeneHancer ID: GH10J003171). For IL-6 production, the SNP most strongly associated with oxLDL training was rs4747882    and rs55643411 , whereas SNPs strongly associated with IL-6 production included rs10762282  and rs55643411   Fig. . We vali−3) Fig. . Like th01) Fig. . TogetheTo determine the physiological significance of changes in glycolytic metabolism, we used two distinct approaches to pharmacologically target glycolysis. First, we inhibited PFKFB3, a crucial rate-limiting enzyme in glycolysis, which is upregulated in oxLDL-trained cells . Co-incuPFKFB3 and HK2 induced by training with oxLDL, which was also attenuated when glycolysis was inhibited by 2-DG. On the other hand, we did not observe H3K4me3 enrichment at the PFKP promoter, which is in line with the lack of transcriptional upregulation following LPS exposure  risk is severely elevated in individuals with diabetes . MoreoveMetformin is the antihyperglycemic drug of first choice in patients with type 2 diabetes mellitus. While the mechanism of action is complex, metformin is known to activate AMP-activated protein kinase and subsequently inhibit mechanistic target of rapamycin (mTOR) . In addiLdlr−/− mice and likely represents an important novel mechanism in atherogenesis [The ability of human innate immune cells to build a de facto immunological memory of infectious challenges has been recently described . In paraogenesis . We now HK2) and PFKFB3 is significantly elevated in monocytes isolated from patients with symptomatic atherosclerosis [Pfkfb3 in high fat-fed ApoE−/− mice correlated with a significant reduction in aortic tissue levels of TNF-α and CCL2 [The importance of changes in cellular glucose metabolism was previously indicated for the development of atherosclerosis . In atheclerosis . Furtherand CCL2 . This asand CCL2 .HK2 and PFKP modulates the induction of trained immunity by BCG [Here, we describe the critical importance of glucose metabolism for monocytes to build an immunological memory after oxLDL stimulation, underwriting their capacity to mount a subsequently heightened response to TLR stimulation. Our results closely mirror aspects of the metabolic reprogramming induced by microbial stimulators of trained immunity. Indeed, genetic variation in y by BCG . FurtherBy supplying the energy required for different states of activation, metabolic pathways distinguish and support the spectrum of macrophage phenotypes. Though energetically less efficient than OXPHOS, a potential explanation for the dependency on glycolysis is that this metabolic pathway can be rapidly amplified to meet the ATP requirements of trained cells, and that the ATP producing capacity of the TCA cycle is limited by anaplerotic repurposing of TCA cycle intermediates, as described for β-glucan-induced training . Indeed,Our observation that pharmacological blockade of glycolysis prevents oxLDL-mediated trained immunity suggests that this pathway represents a potential therapeutic target to prevent ASCVD. Similar to findings reported for β-glucan-induced trained immunity , inhibitAccelerated atherosclerosis is the principal cause of mortality in patients with diabetes . Our obsIn conclusion, we show distinguishable changes in the glucose metabolism of human primary monocytes mediated by brief exposure to a low concentration of oxLDL. Our cohort analyses revealed the importance of genetic variation in glycolytic regulators for the induction of trained immunity, and by targeting this metabolic pathway, we demonstrate the critical importance of glycolysis for the induction of a pro-inflammatory monocyte phenotype in oxLDL-trained macrophages. We propose that strategies interfering with glucose utilization specifically in the context of trained immunity may represent novel approaches to the treatment of vascular inflammation and atherosclerosis. However, further studies are necessary to strengthen the connection between our findings and human disease. For example, the use of recombinant high-density lipoprotein nanoparticles to deliver statins directly to macrophages in atherosclerotic lesions  could beESM 1(PDF 53 kb).ESM 2(PDF 50 kb)."}
{"text": "A systematic and reproducible “workflow”—the process that moves a scientific investigation from raw data to coherent research question to insightful contribution—should be a fundamental part of academic data-intensive research practice. In this paper, we elaborate basic principles of a reproducible data analysis workflow by defining 3 phases: the Explore, Refine, and Produce Phases. Each phase is roughly centered around the audience to whom research decisions, methodologies, and results are being immediately communicated. Importantly, each phase can also give rise to a number of research products beyond traditional academic publications. Where relevant, we draw analogies between design principles and established practice in software development. The guidance provided here is not intended to be a strict rulebook; rather, the suggestions for practices and tools to advance reproducible, sound data-intensive analysis may furnish support for both students new to research and current researchers who are new to data-intensive work. The importance and effective development of a workflow should, in turn, be a cornerstone of the data science education designed to prepare researchers across disciplinary specializations.Both traditional science fields and the humanities are becoming increasingly data driven and computational. Researchers who may not identify as data scientists are working with large and complex data on a regular basis. A systematic and reproducible computational tools, software, and programming languages. In scientific fields, education and training includes a review of domain-specific methods and tools, but generally omits guidance on the coding practices relevant to developing new analysis software—a skill of growing relevance in data-intensive scientific fields [reproducible science (providing the necessary data and code to recreate the results) and effective career building, researchers should be primed to regularly generate outputs over the course of their workflow.Data science education tends to review foundational statistical analysis methods  and furnc fields . Meanwhidata-intensive research project, demonstrating how both design principles and software development methods can motivate the creation and standardization of practices for reproducible data and code. The implementation of such practices generates research products that can be effectively communicated, in addition to constituting a scientific contribution. Here, “data-intensive” research is used interchangeably with “data science” in a recognition of the breadth of domain applications that draw upon computational analysis methods and workflows. .Assertion: An expression that is expected to be true at a particular point in the code.Computational tool: May include libraries, packages, collections of functions, and/or data structures that have been consciously designed to facilitate the development and pursuit of data-intensive questions (synonymous term: software tool).Continuous integration: Automatic tests that updated code.Gut check: Also “data gut check.” Quick, broad, and shallow testing [ testing  before a testing , consistData-intensive research: Research that is centrally based on the analysis of data and its structural or statistical properties. May include but is not limited to research that hinges on large volumes of data or a wide variety of data types requiring computational skills to approach such research (synonymous term: data science research). “Data science” as a stand-alone term may also refer more broadly to the use of computational tools and statistical methods to gain insights from digitized information.Data structure: A format for storing data values and definition of operations that can be applied to data of a particular type.Defensive programming: Strategies to guard against failures or bugs in code; this includes the use of tests and assertions.Design thinking: The iterative process of defining a problem then identifying and prototyping potential solutions to that problem, with an emphasis on solutions that are empathetic to the particular needs of the target user.Docstring: A code comment for a particular line of code that describes what a function does, as opposed to how the function performs that operation.DOI: A digital object identifier or DOI is a unique handle, standardized by the International Organization for Standardization (ISO), that can be assigned to different types of information objects.Extensibility: The flexibility to be extended or repurposed in a new scenario.Function: A piece of more abstracted code that can be reused to perform the same operation on different inputs of the same type and has a standardized output [d output –52.Getter function: Another term for an accessor function.Integrated Development Environment (IDE): A software application that facilitates software development and minimally consists of a source code editor, build automation tools, and a debugger.Modularity: An ability to separate different functionality into stand-alone pieces.Mutator method: A function used to control changes to variables. See “setter function” and “accessor function.”Notebook: A computational or physical place to store details of a research process including decisions made.Mechanistic code: Code used to perform a task as opposed to conduct an analysis. Examples include processing functions and plotting functions.Overwrite: The process, intentional or accidental, of assigning new values to existing variables.Package manager: A system used to automate the installation and configuration of software.Pipeline: A series of programmatic processes during data analysis and data cleaning, usually linear in nature, that can be automated and usually be described in the context of inputs and outputs.Premature optimization: Focusing on details before the general scheme is decided upon.Refactoring: A change in code, such as file renaming, to make it more organized without changing the overall output or behavior.Replicable: A new study arrives at the same scientific findings as a previous study, collecting new data (with the same or different methods) and completes new analyses [analyses –55.Reproducible: Authors provide all the necessary data, and the computer codes to run the analysis again, recreating the results [ results –55.Script: A collection of code, ideally related to one particular step in the data analysis.Setter function: A type of function that controls changes to variables. It is used to directly access and alter specific values (synonymous term: mutator method).Serialization: The process of saving data structures, inputs and outputs, and experimental setups generally in a storable, shareable format. Serialized information can be reconstructed in different computer environments for the purpose of replicating or reproducing experiments.Software development: A process of writing and documenting code in pursuit of an end goal, typically focused on process over analysis.Source code editor: A program that facilitates changes to code by an author.Technical debt: The extra work you defer by pursuing an easier, yet not ideal solution, early on in the coding process.Test-driven development: Each change in code should be verified against tests to prove its functionality.Unit test: A code test for the smallest chunk of code that is actually testable.Version control: A way of managing changes to code or documentation that maintains a record of changes over time.White paper: An informative, at least semiformal document that explains a particular issue but is not peer reviewed.Workflow: The process that moves a scientific investigation from raw data to coherent research question to insightful contribution. This often involves a complex series of processes and includes a mixture of machine automation and human intervention. It is a nonlinear and iterative exercise.pipeline” in the context of software development and engineering. Pipelines are often described as a series of processes that can be programmatically defined and automated and explained in the context of inputs and outputs. However, in this paper, we offer an important distinction between pipelines and workflows: The former refers to what a computer does, for example, when a piece of software automatically runs a series of Bash or R scripts. For the purpose of this paper, a workflow describes what a researcher does to make advances on scientific questions: developing hypotheses, wrangling data, writing code, and interpreting results.Discussions of “workflow” in data science can take on many different meanings depending on the context. For example, the term “workflow” often gets conflated with the term “replicable  or academia (research papers). Rather, the workflow that a researcher defines and iterates over the course of a data science project can lead to intellectual contributions as varied as novel data sets, new methodological approaches, or teaching materials in addition to the classical tools, packages, and papers. While the workflow should be designed to serve the researcher and their collaborators, maintaining a structured approach throughout the process will inform results that are design thinking and software development. While the 3 phases described here are not intended to be a strict rulebook, we hope that the many references to additional resources—and suggestions for nontraditional research products—provide guidance and support for both students new to research and current researchers who are new to data-intensive work.In the following sections, we explain the basic principles of a constructive and productive data analysis workflow by defining 3 phases: the Explore, Refine, and Produce Phases. Each phase is roughly centered around the audience to whom research decisions, methodologies, and results are being immediately communicated. Where relevant, we draw analogies to the realm of We partition the workflow of a data-intensive research process into 3 phases: Explore, Refine, and Produce. These phases, collectively the ERP workflow, are visually described in Each phase has an immediate audience—the researcher themselves, their collaborative groups, or the public—that broadens progressively and guides priorities. Each of the 3 phases can benefit from standards that the software development community uses to streamline their code-based pipelines, as well as from principles the design community uses to generate and carry out ideas; many such practices can be adapted to help structure a data-intensive researcher’s workflow. The Explore and Refine Phases provide fodder for the concurrent Produce Phase. We hope that the potential to produce a variety of research products throughout a data-intensive research process, rather than merely at the end of a project, motivates researchers to apply the ERP workflow.Data-intensive research projects typically start with a domain-specific question or a particular data set to explore . There iTrial and error is the hallmark of the Explore Phase , rather than building new computational capabilities ourselves. For example, during this phase, a common activity includes surveying the software available for our data set or problem space and estimating its utility for the unique demands of our current analysis. Through exploration, we learn about relevant computational and analysis tools while concurrently building an understanding of our data.functions therein—that are best suited to our data and domain area, we also start putting those tools to use [A second important goal of the Explore Phase is data cleaning and developing a strategy to analyze our data. This is a dynamic process that often goes hand in hand with improving our understanding of the data. During the Explore Phase, we redesign and reformat data structures, identify important variables, remove redundancies, take note of missing information, and ponder outliers in our data set. Once we have established the software tools—the programming language, data analysis packages, and a handful of the useful s to use . In addiThe Explore Phase is often a solo endeavor; as shown in premature optimization [However, there are strategies—inspired by analogous software development principles—that can help set us up for success in meeting the standards of reproducibility  relevantmization  while wedocstrings detailing function capabilities, and vignettes providing example applications. Documentation provides both a user manual for particular tools within a project , and a reference log describing scientific research decisions and their rationale .Software engineers typically value formal documentation that is readable by software users. While the audience for our data analysis code may not be defined as a software user per se, documentation is still vital for workflow development. Documentation for data analysis workflows can come in many forms, including comments describing individual lines of code, README files orienting a reader within a code repository, descriptive commit history logs tracking the progress of code development, In the Explore Phase, we may identify with the type of programmer described by Brant and colleagues as “opportunistic” . This tyEven if the code that is used for data exploration is not developed into a software-based final research product, the exploratory process as a whole should exist as a permanent record: Future scientists should be able to rerun our analysis and work from where we left off, beginning from raw, unprocessed data. Therefore, documenting choices and decisions we make along the way is crucial to making sure we do not forget any aspect of the analysis workflow, because each choice may ultimately impact the final results. For example, if we remove some data points from our analyses, we should know which data points we removed—and our reason for removing them—and be able to communicate those choices when we start sharing our work with others. This is an important argument against ephemerally conducting our data analysis work via the command line.notebook [Instead of the command line, tools like a computational notebook  can helpnotebook . A compunotebook –14. Suchnotebook  to recorversion control system such as Git. With its issues, branches, and informative commit messages, Git is another useful way to maintain a record of our trial-and-error process and track which files are progressing toward which goals of the overall project. Using Git together with a public online hosting service such as GitHub allows us to share our work with collaborators and the public in real time, if we so choose.To go a step beyond annotated scripts or notebooks, researchers might employ a A researcher dedicated to conducting an even more thoroughly documented Explore Phase may take Ford’s advice and include notes that explicitly document our stream of consciousness . Our nottest-driven development. This is a tension between the code-based work conducted in scientific research versus software development: Tests help build confidence in analysis code and convince users that it is reliable or accurate, but tests also imply finality and take time to write that we may not be willing to allocate in the experimental Explore Phase. However, software development style tests do have useful analogs in data analysis efforts: We can think of tests, in the data analysis sense, as a way of checking whether our expectations match the reality of a piece of code’s output.As Ford  explainsImagine we are looking at a data set for the first time. What weird things can happen? The type of variable might not be what we expect . The data set could also include unexpected aspects . The amount of missing data may be larger than we thought, and this missingness could be coded in a variety of ways . Finally, the dimensions of a data frame after merging or subsetting it for data cleaning may not match our expectations. Such gaps in expectation versus reality are “silent faults” . WithoutFor these reasons, every data exploration should include quantitative and qualitative “gut checks”  that candefensive programming techniques that help guard against specific mistakes. An example of defensive programming in the Julia language is the use of assertions, such as the @assert macro to validate values or function outputs. Another option includes writing “chatty functions” [We perform these manual checks to reassure ourselves that our actions at each step of data cleaning, processing, or preliminary analysis worked as expected. However, these types of checks often rely on us as researchers visually assessing output and deciding if we agree with it. As we transition to needing to convince users beyond ourselves of the correctness of our work, we may consider employing nctions”  that sigA researcher in the Explore Phase experiments with a variety of potential data configurations, analysis tools, and research directions. Not all of these may bear fruit in the form of novel questions or promising preliminary findings. Learning how to find a balance between the breadth and depth of data exploration helps us understand when to transition to the Refine Phase of data-intensive research. Specific questions to ask ourselves as we prepare to transition between the Explore Phase and the Refine Phase can be found in This box provides guiding questions to assist readers in navigating through each workflow phase. Questions pertain to planning, organization, and accountability over the course of workflow iteration.Questions to ask in the Explore PhaseGood: Ourselves Better: Our small team who has specialized knowledge about the context of the problem.Best: Anyone with experience using similar tools to us.Who can read through our materials and understand our workflow?Good: Dead ends marked differently than relevant and working code.Better: Material connected to a handful of promising leads.Best: Material connected to a clearly defined scope.What material do we think is worth continuing into the next phase?Good: Backed up in a second location in addition to our computer.Better: Within a shared space among our team .Best: Within a version control system  that furnishes a complete timeline of actions taken.Where does the code live?Good: Noted in a separate place from our code .Better: Noted in comments throughout the code itself, with expectations informally checked.Best: Noted systematically throughout code as part of a narrative, with expectations formally checked.Why did we make particular data cleaning and analysis decisions?Questions to ask in the Refine PhaseWho is in our team?Consider career level, computational experience, and domain-specific experience.What are our teammates’ skill levels?How do we communicate methodology with our teammates’ skills in mind?What reproducibility tools can be agreed upon?Are there established standards within the team that need to be adopted or conflict with our Explore Phase workflow?How can our work be packaged into impactful research products?Can we explain the same important results across different platforms ?What is the main takeaway of our findings?How can we alert these people and make our work accessible?Who will be affected by the outcomes of our work?How can we use narrative to make this clear?Why is our work important for our domain-specific field? For broader society?Questions to ask in the Produce PhaseDo we have more than 1 audience?Who is the intended audience for our research product(s)?What is the next step in our research?Can we turn our work into more than 1 publishable product?Where do we plan to publish?Consider products throughout the entire workflow.When do we expect a research product to be ready for a broader audience?See suggestions in the Tool development guide .Why should we decide to build a software tool based on our work?Imposing structure at certain points throughout the Explore Phase can help to balance our wide search for solutions with our deep dives into particular options. In an analogy to the software development world, we can treat our exploratory code as a code release—the marker of a stable version of a piece of software. For example, we can take stock of the code we have written at set intervals, decide what aspects of the analysis conducted using it seem most promising, and focus our attention on more formally tuning those parts of the code. At this point, we can also note the presence of research “dead ends” and perhaps record where they fit into our thought process. Some trains of thought may not continue into the next phase or become a formal research product, but they can still contribute to our understanding of the problem or eliminate a potential solution from consideration. As the project matures, computational pipelines are established. These inform project workflow, and tools, such as Snakemake and Nextflow, can begin to be used to improve the flexibility and reproducibility of the project –23. As wJust as Cross  finds thInevitably, we reach a point in the Explore Phase when we have acquainted ourselves with our data set, processed and cleaned it, identified interesting research questions that might be asked using it, and found the analysis tools that we prefer to apply. Having reached this important juncture, we may also wish to expand our audience from ourselves to a team of research collaborators. It is at this point that we are ready to transition to the Refine Phase. However, we should keep in mind that new insights may bring us back to the Explore Phase: Over the lifetime of a given research project, we are likely to cycle through each workflow phase multiple times.In the Refine Phase, the extension of our target audience demands a higher standard for communicating our research decisions as well as a more formal approach to organizing our workflow and documenting and testing our code. In this section, we will discuss principles for structuring our data analysis in the Refine Phase. This phase will ultimately prepare our work for polishing into more traditional research products, including peer-reviewed academic papers.serialization of experimental setups. Finally, standards of reproducibility should be maintained throughout. Each of these aspects constitutes an important goal of the Refine Phase as we determine the most promising avenues for focusing our research workflow en route to the polished research products that will emerge from this phase and demand even higher reproducibility standards.The Refine Phase encompasses many critical aspects of a data-intensive research project. Additional data cleaning may be conducted, analysis methodologies are chosen, and the final experimental design is decided upon. Experimental design may include identifying case studies for variables of interest within our data. If applicable, it is during this phase that we determine the details of simulations. Preliminary results from the Explore Phase inform how we might improve upon or scale up prototypes in the Refine Phase. Data management is essential during this phase and can be expanded to include the All of these goals are developed in conjunction with our research team. Therefore, decisions should be documented and communicated in a way that is reproducible and constructive within that group. Just as the solitary nature of the Explore Phase can be daunting, the collaboration that may happen in the Refine Phase brings its own set of challenges as we figure out how to best work together. Our team can be defined as the people who participate in developing the research question, preparing the data set it is applied to, coding the analysis, or interpreting the results. It might also include individuals who offer feedback about the progress of our work. In the context of academia, our team usually includes our laboratory or research group. Like most other aspects of data-intensive research, our team may evolve as the project evolves. But however we define our team, its members inform how our efforts proceed during the Refine Phase: Thus, another primary goal of the Refine Phase is establishing group-based standards for the research workflow. Specific questions to ask ourselves during this phase can be found in In recent years, the conversation on standards within academic data science and scientific computing has shifted from “best” practices  to “goodThe concept of literate programming  is at thThe same strategies that promote scientific reproducibility for traditional laboratory notebooks can be applied to the computational notebook . After apackage manager, simplifying matters and painlessly raising the standards of reproducibility in a research team. The unprecedented levels of reproducibility possible in modern computational environments have produced some variance in the expectations of different research communities; it behooves the research team to investigate the community-level standards applicable to our specific domain science and chosen programming language.As scientists, we should keep a record of the tools we use to obtain our results in addition to our methodological process. In a data-intensive research workflow, this includes documenting the specific version of any software that we used, as well as its relevant dependencies and compatibility constraints. Recording this information at the top of the computational notebook that details our data science experiment allows future researchers—including ourselves and our teams—to establish the precise computational environment that was used to run the original research analysis. Our chosen programming language may supply automated approaches for doing this, such as a A notebook can include more than a deep dive into a full-fledged data science experiment. It can also involve exploring and communicating basic properties of the data, whether for purposes of training team members new to the project or for brainstorming alternative possible approaches to a piece of research. In the Exploration Phase, we have discovered characteristics of our data that we want our research team to know about, for example, outliers or unexpected distributions, and created preliminary visualizations to better understand their presence. In the Refine Phase, we may choose to improve these initial plots and reprise our data processing decisions with team members to ensure that the logic we applied still holds.Computational notebooks can live in private or public repositories to ensure accessibility and transparency among team members. A version control system such as Git continues to be broadly useful for documentation purposes in the Refine Phase, beyond acting as a storage site for computational notebooks. Especially as our team and code base grows larger, a history of commits and pull requests helps keep track of responsibilities, coding or data issues, and general workflow.technical debt in the form of duplications or overwritten variables. As our research project grows in complexity and size, or gains team members, we may want to transition to an Integrated Development Environment (IDE) or a source code editor—which interact easily with container environments like Docker and version control systems such as GitHub—to help scale our data analysis, while retaining important properties like reproducibility.Importantly however, all tools have their appropriate use cases. Researchers should not develop an overt reliance on any one tool and should learn to recognize when different tools are required. For example, computational notebooks may quickly become unwieldy for certain projects and large teams, incurring mechanistic code, especially in “big data” statistical analyses or complex dynamic simulations where optimized computation becomes a concern. Keeping the immediate audience of this workflow phase, our research team, at the forefront of our mind can help us take steps to structure both mechanistic and analysis code in a useful way.Code in data-intensive research is generally written as a means to an end, the end being a scientific result from which researchers can draw conclusions. This stands in stark contrast to the purpose of code developed by data engineers or computer scientists, which is generally written to optimize a mechanistic function for maximum efficiency. During the Refine Phase, we may find ourselves with both analysis-relevant and Unit tests and so-called accessor functions or getter and setter functions that extract parameter values from data structures or set new values are examples of mechanistic code that might be included in a data-intensive research analysis. Meanwhile, code that is designed to gain statistical insight into distributions or model scientific dynamics using mathematical equations are 2 examples of analysis code. Sometimes, the line between mechanistic code and analysis code can be a blurry one. For example, we might write a looping function to sample our data set repeatedly, and that would classify as mechanistic code. But that sampling may be designed to occur according to an algorithm such as Markov Chain Monte Carlo that is directly tied to our desire to sample from a specific probability distribution; therefore, this could be labeled analysis and mechanistic code. Keep your audience in mind and the reproducibility of your experiment when considering how to present your code.Mechanistic code, which is designed for repeated use, often employs abstractions by wrapping code into functions that apply the same action repeatedly or stringing together multiple scripts into a computational pipeline. modularity while reducing the propensity for user-induced error. However, the scripts and programming notebooks so useful to establishing a narrative and documenting work in the Refine Phase are set up to be read in a linear fashion. Embedding mechanistic functions in the midst of the research narrative obscures the utility of the notebooks in telling the research story and generally clutters up the analysis with a lot of extra code. For example, if we develop a function to eliminate the redundancy of repeatedly restructuring our data to produce a particular type of plot, we do not need to showcase that function in the middle of a computational notebook analyzing the implications of the plot that is created—the point is the research implications of the image, not the code that made the plot. Then where do we keep the data-reshaping, plot-generating code?It is common practice to wrap code that we use repeatedly into functions to increase readability and Strategies to structure the more mechanistic aspects of our analysis can be drawn from common software development practices. As our team grows or changes, we may require the same mechanistic code. For example, the same data-reshaping, plot-generating function described earlier might be pulled into multiple computational experiments that are set up in different locations, computational notebooks, scripts, or Git branches. Therefore, a useful approach would be to start collecting those mechanistic functions into their own script or file, sometimes called “helpers” or “utils,” that acts as a supplement to the various ongoing experiments, wherever they may be conducted. This separate script or file can be referenced or “called” at the beginning of the individual data analyses. Doing so allows team members to benefit from collaborative improvements to the mechanistic code without having to reinvent the wheel themselves. It also preserves the narrative properties of team members’ analysis-centric computational notebooks or scripts while maintaining transparency in basic methodologies that ensure project-wide reproducibility. The need to begin collecting mechanistic functions into files separate from analysis code is a good indicator that it may be time for the research team to supplement computational notebooks by using a code editor or IDE for further code development.continuous integration is often employed [control data sets where we know the result of a particular analysis to make sure our analysis code is functioning as we expect. Alternatively, we could also use a regression test to compare computational outputs before and after changes in the code to make sure we haven’t introduced any unanticipated behavior.Testing scientific software is not always perfectly analogous to testing typical software development projects, where automated employed . Howeveremployed . Formal Workflows in data science are rarely linear; it is often necessary for researchers to iterate between the Refine and Explore Phases . For exaIteration between the Refine and Explore Phases is a careful balance. On the one hand, we should be careful not to allow “scope creep” to expand our problem space beyond an area where we are able to develop constructive research contributions. On the other hand, if we are too rigid about decisions made over the course of our workflow and refuse to look backwards as well as forwards, we may risk cutting ourselves off from an important part of the potential solution space.Agile frameworks, to help guide the careful balancing act required to conduct research that is both comprehensive and able to be completed [Data-intensive researchers can once more look to principles within the software development community, such as ompleted ,35. How In the previous sections of this paper, we discussed how to progress from the exploration of raw data through the refinement of a research question and selection of an analytical methodology. We also described how the details of that workflow are guided by the breadth of the immediately relevant audience: ourselves in the Explore Phase and our research team in the Refine Phase. In the Produce Phase, it becomes time to make our data analysis camera ready for a much broader group, bringing our research results into a state that can be understood and built upon by others. This may translate to developing a variety of research products in addition to—or instead of—traditional academic outputs like peer-reviewed publications and typical software development products such as computational tools.The main goal of the Produce Phase is to prepare our analysis to enter the public realm as a set of products ready for external use, reflection, and improvement. The Produce Phase encompasses the cleanup that happens prior to initially sharing our results to a broader community beyond our team, for example, ahead of submitting our work to peer review. It also includes the process of incorporating suggestions for improvement prior to finalization, for example, adjustments to address reviewer comments ahead of publication. The research products that emerge from a given workflow may vary in both their form and their formality—indeed, some research products, like a code base, might continually evolve without ever assuming “final” status—but each product constitutes valuable contributions that push our field’s scientific boundaries in their own way.Importantly, producing public-facing products over the course of an entire workflow  rather twhite papers, and preprints. Researchers would also be well advised to register for a unique and persistent digital identifier to be associated with their name, called an ORCID iD (https://orcid.org), as an additional method of tracking and attributing their personal outputs over the course of their career.Building our data science research portfolio requires a method for tracking and attributing the many products that we might develop. One important method for tracking and attribution is the digital object identifier or DOI. It is a unique handle, standardized by the International Organization for Standardization (ISO), that can be assigned to different types of information objects. DOIs are usually connected to metadata, for example, they might include a URL pointing to where the object they are associated with can be found online. Academic researchers are used to thinking of DOIs as persistent identifiers for peer-reviewed publications. However, DOIs can also be generated for data sets, GitHub repositories, computational notebooks, teaching materials, management plans, reports, A third, longer-term goal of the Produce Phase involves establishing a researcher’s professional trajectory. Every individual needs to gauge how their compendium of research products contribute to their career and how intentional portfolio building might, in turn, drive the research that they ultimately conduct. For example, researchers who wish to work in academia might feel obliged to obtain “academic value” from less traditional research products by essentially reprising them as peer-reviewed papers. But judging a researcher’s productivity by the metric of paper authorship can alter how and even whether research is performed . Increashttp://www.datadryad.org) and Figshare (https://figshare.com/) among others.The old adage that one person’s trash is another’s treasure is relevant to the Explore Phase of a data science analysis: Of the many potential applications for a particular data set, there is often only time to explore a small subset. Those applications which fall outside the scope of the current analysis can nonetheless be valuable to our future selves or to others seeking to conduct their own analyses. To that end, the documentation that accompanies data exploration can furnish valuable guidance for later projects. Further, the cleaned and processed data set that emerges from the Explore Phase is itself a valuable outcome that can be assigned a DOI and rendered a formal product of this portion of the data analysis workflow, using outlets like Dryad (https://dwc.tdwg.org) for biodiversity data and EML (https://eml.ecoinformatics.org) for ecological data. To maximize the utility of a publically accessible data set, during the Produce Phase, researchers should confirm that it includes descriptive README files and field descriptions and also ensure that all abbreviations and coded entries are defined. In addition, an appropriate license should be assigned to the data set prior to publication: The license indicates whether, or under what circumstances, the data require attribution.Publicly sharing the data set, along with its metadata, is an essential component of scientific transparency and reproducibility, and it is of fundamental importance to the scientific community. Data associated with a research outcome should follow “FAIR” principles of findability, accessibility, interoperability, and reusability. Importantly, discipline-specific data standards should be followed when preparing data, whether the data are being refined for public-facing or personal use. Data-intensive researchers should familiarize themselves with the standards relevant to their field of study and recognize that meeting these standards increases the likelihood of their work being both reusable and reproducible. In addition to enabling future scientists to use the data set as it was developed, adhering to a standard also facilitates the creation of synthetic data sets for later research projects. Examples of discipline-specific data standards in the natural sciences are Darwin Core (https://gist.github.com/). Tools such as Dr.Watson (https://github.com/JuliaDynamics/DrWatson.jl) and Snakemake [The Git repositories or computational notebooks that archive a data scientist’s approach, record the process of uncovering coding bugs, redundancies, or inconsistencies and note the rationale for focusing on specific aspects of the data are also useful research products in their own right. These items, which emerge from software development practices, can provide a touchstone for alternative explorations of the same data set at a later time. In addition to documenting valuable lessons learned, contributions of this kind can formally augment a data-intensive researcher’s registered body of work: Code used to actively clean data or record an Explore Phase process can be made citable by employing services like Zenodo to add a DOI to the applicable Git commit. Smaller code snippets or data excerpts can be shared—publicly or privately—using the more lightweight GitHub Gists  are marked as such.Potential Products in the Explore PhasePublication of cleaned and processed data set (DOI)Citable GitHub repository and/or computational notebook that shows data cleaning/processing, exploratory data analysis.  (DOI)GitHub Gists White paper Blog post Teaching/training materials Preprint  (DOI)Peer-reviewed publication  (DOI)Potential Products in the Refine PhaseWhite paper Citable GitHub repository and/or computational showing methodology and results (DOI)Blog post Teaching/training materials Preprint  (DOI)Peer-reviewed publication  (DOI)Grant application incorporating the data management procedureMethodology  (DOI)This might include a package, a library, or an interactive web application.See A software toolIn the Refine Phase, documentation and the ability to communicate both methods and results become essential to daily management of the project. Happily, the implementation of these basic practices can also provide benefits beyond the immediate team of research collaborators: They can be standardized as a Data Management Plan or Protocol (DMP). DMPs are a valuable product that can emerge from the Refine Phase as a formal version of lessons learned concerning both research and team management. This product records the strategies and approaches used to, for example, describe, share, store, analyze, and preserve data.While DMPs are often living documents over the course of a research project, evolving dynamically with the needs or restrictions that are encountered along the way, there is great utility to codifying them either for our team’s later use or for others conducting similar projects. DMPs can also potentially be leveraged into new research grants for our team, as these protocols are now a common mandate by many funders . The groRio Journal). Importantly, when new members join a research team, they should receive a copy of the group’s DMP. If any additional training pertinent to plans or protocols is furnished to help get new members up to speed, these materials too can be polished into research products that contribute to scientific advancement. For a list of potential research product examples for the Refine Phase, see As with the research products that are generated by the Explore Phase, DMPs can lead to polished blog posts, training materials, white papers, and preprints that enable researchers to both spread the word about their valuable findings and be credited for their work. In addition, peer-reviewed journals are beginning to allow the publication of DMPs as a formal outcome of the data analysis workflow  that allows the easy exploration of cleaned data sets or demonstrates the outcomes of alternative research questions. More complex examples include a software package that builds an open-source analysis pipeline or a data structure that formally standardizes the problem space of a domain-specific research area. In all cases, the README files, docstrings, example vignettes, and appropriate licensing relevant to the Explore phase are also a necessity for open-source software. Developers should also specify contributing guidelines for future researchers who might seek to improve or extend the capabilities of the original tool. Where applicable, the dynamic equations that inform simulations should be cited with the original scientific literature where they were derived.One very simple example of a tool might be an interactive web application built in RShiny ?Domain expertise?Programming expertise?Collaborative research partners with either time, funding, or relevant expertise?Will the process of creating the new tool be valued/helpful for your career goals?Do we have the resources required to develop a new tool?Should I make a tool?Should we build on an existing tool or make a new one?What research area is it designed for?Who is the envisioned end user? What is the goal of the end user? What is the scope of a new tool?What tool should we create?What are field norms?Is it accessible ?Language choiceWhat is the likely form and type of data input to our tool?What is the desired form and type of data output from our tool?Are there preexisting structures that are useful to emulate, or should we develop our own?Data structures and typesIs there an existing package that provides basic structure or building block functionalities necessary or useful for our tool, such that we do not need to reinvent the wheel?Platform or frameworkHow should we structure the tool?Defining principles for data analysis workflows is important for scientific accuracy, efficiency, and the effective communication of results, regardless of whether researchers are working alone or in a team. Establishing standards, such as for documentation and unit testing, both improves the quality of work produced by practicing data scientists and sets a proactive example for fledgling researchers to do the same. There is no single set of principles for performing data-intensive research. Each computational project carries its own context—from the scientific domain in which it is conducted, to the software and methodological analysis tools we use to pursue our research questions, to the dynamics of our particular research team. Therefore, this paper has outlined general concepts for designing a data analysis such that researchers may incorporate the aspects of the ERP workflow that work best for them. It has also put forward suggestions for specific tools to facilitate that workflow and for a selection of nontraditional research products that could emerge throughout a given data analysis project.Aiming for full reproducibility when communicating research results is a noble pursuit, but it is imperative to understand that there is a balance between generating a complete analysis and furnishing a 100% reproducible product. Researchers have competing motivations: finishing their work in a timely fashion versus having a perfectly documented final product, while balancing how these trade-offs might strengthen their career. Despite various calls for the creation of a standard framework ,46, achiIn addition to amassing outputs beyond the peer-reviewed academic publication, there are increasingly venues for writing less traditional papers that describe or consist solely of a novel data set, a software tool, a particular methodology, or training materials. As the professional landscape for data-intensive research evolves, these novel publications and research products are extremely valuable for distinguishing applicants to academic and nonacademic jobs, grants, and teaching positions. Data scientists and researchers should possess numerous and multifaceted skills to perform scientifically robust and computationally effective data analysis. Therefore, potential research collaborators or hiring entities both inside and outside the academy should take into account a variety of research products, from every phase of the data analysis workflow, when evaluating the career performance of data-intensive researchers ."}
{"text": "We aimed to develop a clinical applicable nomogram to predict overall survival (OS) for patients with curatively resected nonmetastatic colorectal cancer.Records from a retrospective cohort of 846 patients with complete information were used to construct the nomogram. The nomogram was validated in a prospective cohort of 379 patients. The performance of the nomogram was evaluated with concordance index (c‐index), time‐dependent receiver operating characteristic (ROC) curves, calibration plots, and decision curve analyses for discrimination, accuracy, calibration ability, and clinical net benefits respectively, and further compared with AJCC 8th TNM staging and the MSKCC nomogram. Risk stratification based on nomogram scores was performed with recursive partitioning analysis.P < .05).The nomogram incorporated age, Glasgow prognostic score, pretreatment carcinoembryonic antigen levels, T staging, N staging, number of harvested lymph nodes, and histological grade. Compared with the 8th AJCC staging and MSKCC model, the nomogram had a statistically higher c‐index , bigger areas under the time‐dependent ROC curves , and improved clinical net benefits. Calibration plots revealed no deviations from reference lines. All results were reproducible in the validation cohort. Nomogram‐based risk stratification successfully discriminated patients within each AJCC stage . The nomogram outperformed the 8th AJCC staging and the MSKCC model and could aid in personalized treatment and follow‐up strategy for CRC patients. We developed and validated a prognostic nomogram for non‐metastatic colorectal cancer incorporating routinely available factors. Nomogram based risk stratification successfully discriminated patients within each AJCC stage. The nomogram outperformed the 8th AJCC staging and the MSKCC model. They utilize computational integration of multiple prognostic factors to quantify risks individually, rather than produce risk groups.Compared to tumor‐related factors, patient factors draw less attention. However, patient factors, for example, age, systemic inflammatory status, and nutritional status, are equally contributed to patients' prognosis.The goal of this project is to develop and assess a prognostic nomogram for curatively resected CRC by incorporating clinical available tumor‐ and patient‐related factors. We hope such a tool could help physicians to convey individualized survival information to every patient in daily practice without incurring additional cost.22.1The data of patients with surgically treated nonmetastatic CRC patients were retrieved from a prospectively maintained cancer registry database of affiliated hospital of Jiangnan University as previously mentioned.Patients who received curative CRC surgery between 2008 and 2013 were as the primary cohort and those treated between 2014 and 2015 as the validation cohort. The inclusion criteria for the primary cohort were as follows: (a) Patients who had curative resection of primary CRC malignancies. (b) Who had histologically confirmed colorectal adenocarcinoma. (c) Who had the full blood cell count, biochemical profile, and tumor biomarker test at the hospital within 2 weeks before surgery. Patients with any of the following conditions were excluded: (a) Who had either imaging or histologically confirmed metastatic CRC diagnosed either preoperatively or intraoperatively. (b) Who had metastatic disease within 1 month after surgery. (c) Who had neo‐adjuvant chemotherapy, radiotherapy, or targeted therapy. (d) Who had bowel obstruction or perforation with emergency presentation. (e) Who was complicated with other acute diseases such as pneumonia, urinary tract infection, and cholecystitis. (f) Who had a history of chronic inflammatory diseases such as inflammatory bowel diseases and rheumatoid arthritis. (g) Who had a previous history of malignancies including CRC at different sites. (h) Who died within 1 month after surgery. (i). Whose survival status could not be ascertained. (j) Whose number of sampled lymph nodes was below 12.The information for potential prognostic variables was collected: demographic characteristics including age and sex; pathological characteristics including primary site of tumor, histology, depth of primary tumor invasion (T), number of total lymph nodes sampled (TLN), number of metastasized lymph nodes (LNM), histological grade (G1‐4), the presence of peri‐neural invasion (PNI) and lymph‐vascular invasion (LVI) and number of tumor deposits (TDs); blood biomarkers including carcinoembryonic antigen (CEA), white blood cell count, neutrophil count, lymphocyte count, albumin, and C‐reactive protein (CRP). GPS was derived as previously stated.Informed consent to the usage of social‐demographic and clinical information in scientific endeavors was obtained from every participant. This study was approved by the ethics review board of the hospital, adhered to the Declaration of Helsinki for medical research involving human subjects, and conducted according to the TRIPOD statement.2.2The endpoint for this study was overall survival (OS), which was defined as the time from the date of surgery to the date of death from any cause or the last date of follow‐up. Patients were censored if they were diagnosed with second malignancies after surgery. Only cases with complete information were used in the final analysis.P < .2) in a backward stepwise selection with minimal AIC (the Akaike information criterion) value. Nomogram based on the final model was constructed for the likelihood of overall survival at 3 and 5 years of surgery.Normally distributed continuous variables were described as mean with standard error (SD), otherwise median values with interquartile ranges (IQR). Cox proportional hazards regression modeling was used to assess the relationship of OS with predictive variables. For continuous variables, possible nonlinearity effects on the log relative hazard of outcome were tested by modeling with restricted cubic splines, whereas statistically significant nonlinearity was identified, restricted cubic splines were used in the multivariable modeling. If restricted cubic spline modeling was failed, continuous variables were dichotomized, for which the optimal cut‐points were determined by the maximally selected rank statistics to maximize the correlation with survival. The proportional hazards assumption for each variable was checked by the test proposed by Grambsch and Therneau. Multivariate models were built by including all variables from univariate models . External validation was conducted in the prospective validation cohort. Briefly, the validation cohort was individually given a risk score calculated with the nomogram equation.The performance of the nomogram was assessed and compared with the MSKCC modelP < .05 as significant and conducted with Stata 14 or R studio software (version 1.1.456).All statistical analyses were two sided with 33.1A total of 1576 patients were initially screened for enrollment eligibility in the study. After application of exclusion criteria, 836 patients with complete information were included in the final analysis for the primary cohort. For the validation cohort, a total of 379 patients of 505 patients were included in the final analysis after application of the same inclusion and exclusion criteria. The major reason for exclusion was less than 12 lymph nodes sampled, followed by metastasized disease and preoperative treatment. The percentage of patients excluded for missing data was less than 10%.The baseline characteristics of the primary cohort and validation cohort were listed in Table 3.2P = .016 and <.001, respectively). Restricted cubic spline modeling was applied to all other continuous variables with nonlinear effects, except for CEA. CEA more than 20.03 ng/mL was regarded as high CEA level, otherwise as low. The results of univariate cox regression survival analysis for the primary cohort were presented in Table Among continuous variables, only age and LNM had linear effects . For the external validation, the score for the individual case in the validation cohort was calculated according to the established nomogram and was then used in the Cox regression model. C‐index for the validation cohort was 0.79 (95% CI: 0.73‐0.85).3.4The calibration plots showed a good agreement between observed and nomogram predicted 3‐ Figure  and 5‐ye3.5The nomogram had a statistically higher c‐index compared with the MSKCC model and AJCC staging in both the primary cohort and validation cohort. The c‐indexes were 0.77 (95% CI: 0.73‐0.80), 0.73 (95% CI: 0.70‐0.76), 0.69 (95% CI: 0.66‐0.92) for the nomogram, MSKCC model, and AJCC staging respectively in the primary cohort and 0.79 (95% CI: 0.73‐0.85), 0.75 (95% CI: 0.68‐0.81), 0.68 (95% CI: 0.61‐0.75) in the validation cohort. The nomogram had the lowest AIC value among the three models .P < .05, all pair‐wise comparisons)    Figure . In the ) Figure .Decision curve plots showed the nomogram was associated with improved clinical net benefits over the MSKCC model and AJCC stages (higher lines of prediction by the nomogram) within a practical range of threshold probabilities in both the primary cohort Figure  and the 3.6Patients were stratified into three risk groups based on nomogram derived risk scores with a recursive partitioning analysis. The subgroups were as follows: low‐risk group (risk score ≤12.68), intermediate‐risk group (12.68 < risk score ≤ 14.07), and high‐risk group (risk score >14.07). Kaplan‐Meier survival curve analysis showed the three groups had statistically different prognosis in both primary cohort Figure  and vali4In the present study, a nomogram was developed to estimate 3‐year and 5‐year survival probability for curatively resected nonmetastatic CRC patients. This nomogram outperformed the MSKCC model and AJCC TNM staging in terms of discrimination, calibration abilities, and clinical utilities. The nomogram was validated in a prospective cohort and demonstrated to be quite reliable.The selection of factors in this study was based on their availability in routine practice and established associations with overall survival in previous publications.To date, there are four published nomograms predicting survival after radical surgery for nonmetastatic CRC. Two were developed from SEER database.The strengths of our nomogram include an appreciable size of representative patients in real clinical setting, a prospective validation cohort and readily available factors in routine practice. The variables used in the nomogram could be easily obtained by physicians in many community hospitals without any technical or cost barriers. Risk group stratification defined by the nomogram was a good complement to the 8th AJCC stage. The nomogram gives accurate and individualized mortality risk predictions and can discriminate different prognosis groups within the same TNM stage. It should enable improved patient counseling regarding treatment selection and follow‐up strategy. The nomogram itself is not intended to make treatment decisions, but the nomogram directed treatment strategy could be investigated in clinical trials.There are several points should be addressed. First and foremost, this nomogram was developed from a cohort of patients treated at a single institution including only Chinese patients. Although internal validation and prospective external validation were performed to prevent over‐fit of current data, it would be better to validate the nomogram in patients from other institutions with diversified ethnicities. Second, important molecular factors such as KRAS/NRAS/BRAF and MSI were not investigated. These factors were good treatment efficacy predictors, but their prognostic roles were controversial. In a recent meta‐analysis, they were found to be not significantly or differentially associated with survival.5In conclusion, we propose a nomogram that could provide individualized outcome predictions with good accuracy, reliability, availability, and applicability. It could be helpful to physicians and patients in the treatment decision‐making process.All authors declare no conflict of interest.Tingting hong and Xiaohong Wu designed the study. Tingting hong analyzed and interpretated the data and wrote the manuscript. Dongyan cai and Ying zhang collected the data. Dong hua, Linfang Jin, and Tingxun Lu provided valuable insights into data interpretation and manuscript writing."}
{"text": "Subclinical, low-grade, inflammation is one of the main pathophysiological mechanisms underlying the majority of chronic and non-communicable diseases. Several methodological approaches have been applied for the assessment of the anti-inflammatory properties of nutrition, however, their impact in human body remains uncertain, because of the fact that the majority of the studies reporting anti-inflammatory effect of dietary patterns, have been performed under laboratory settings and/or in animal models. Thus, the extrapolation of these results to humans is risky. It is therefore obvious that the development of an inflammatory model in humans, by which we could induce inflammatory responses to humans in a regulated, specific, and non-harmful way, could greatly facilitate the estimation of the anti-inflammatory properties of diet in a more physiological way and mechanistically relevant way. We believe that exercise-induced muscle damage (EIMD) could serve as such a model, either in studies investigating the homeostatic responses of individuals under inflammatory stimuli or for the estimation of the anti-inflammatory or pro-inflammatory potential of dietary patterns, foods, supplements, nutrients, or phytochemicals. Thus, in this review we discuss the possibility of exercise-induced muscle damage being an inflammation model suitable for the assessment of the anti-inflammatory properties of diet in humans. Subclinical, low-grade, inflammation is one of the main pathophysiological mechanisms underlying the majority of chronic and non-communicable diseases ,2,3,4,5.The inflammatory responses are integral parts of the normal innate immune response conferring protection to infection and initiating mechanisms of repair and regeneration of damaged tissues ,21. UndeIt is well documented that a subclinical activation of the inflammatory mechanisms may be a predisposing risk factor for non-communicable diseases such as cardiovascular disease, cancer, metabolic syndrome, diabetes, depression, dementia, and biological aging in general ,34,35,36It is now known that prudent dietary patterns, such as the Mediterranean Diet ,39,44,45Several methodological approaches have been applied for the assessment of the anti-inflammatory properties of nutrition. The majority of them is based on cellular and animal models of inflammation. Cellular models of inflammation include LPS-induced secretion of cytokines, expression of adhesion molecules in the surface of cells, phagocytosis activity, natural killer cells lysing capability against cancer cells etc. Cell-based assays were mainly utilized for the identification of the anti-inflammatory properties of isolated nutrients, extracts, and phytochemicals. Despite their usefulness for screening purposes and mechanistic studies the results of those studies cannot be extrapolated directly to humans ,13,40,46The rapid growth of genetic engineering enabled the development of a plethora of animal models of inflammation by which the anti-inflammatory properties of diet could be assessed, in a more physiological way. Moreover, animal experiments provide wider access to the immune system . However, after many years of studying and working with animals in biomedical research, ethical issues have emerged concerning the reproducibility of animal models and their relevance with human inflammatory diseases ,40,46,48The majority of human studies, investigating the association between diet and inflammation, are cross-sectional and prospective epidemiological studies ,52,53,54EIMD is a phenomenon that occurs either after a prolonged unaccustomed exercise, or after a very intense, high-demanding exercise , as a consequence of the very high mechanical and metabolic demands during the exercise ,73,74,75The type of exercise and the type of muscle contractions applied are crucial determinants of the damaging and inflammatory responses. It is well established that the eccentric exercise, which involves only lengthening muscle actions, could lead to extensive EIMD and inflammation ,86,87,882+ concentrations in the cytoplasm lead to degradation of muscle proteins and membrane phospholipids by activation of calpains and phospholipases A2 [The inflammatory response, after EIMD, has been characterized quite well and several excellent original and review articles describe it in detail ,93,119. pases A2 . MeanwhiTheir main purpose is to degrade the damaged tissue by releasing active oxygen/nitrogen forms, and induce oxidative stress which is crucial for muscle regeneration after EIMD ,123,124.EIMD can be easily accepted by the volunteers and the bioethics committees. It can be easily induced by different types of exercise/training either in the lower or the upper limbs (see below). The inflammatory response can be applied to all kinds of populations irrespective of their health and training status, age, gender, race, body composition etc. Most importantly, volunteers easily consent to this kind of intervention which is actually just about exercise for them. In addition, most bioethics committees would have no objections to this kind of experimentation in humans.EIMD can be easily applied to humans in a regulated manner. Exercise scientists can induce muscle damage by forcing muscles to lengthen while generating active tension, with various stimuli. As it has been discussed in the previous section, EIMD can be easily induced through eccentric training after 85 to 300 maximal eccentric contractions, while the magnitude and the extent of EIMD from eccentric exercise, seems to be higher and prolonged (lasting for 72 h until 1–2weeks) compared to other type of exercises ,199,200.The inflammatory mechanisms underlying EIMD are well defined. The muscle microtrauma, induced by the different types of exercise, but mostly from eccentric exercise, can trigger a typical cascade of inflammatory events that resemble aseptic inflammation after tissue damage (see above). It is therefore easier for researchers to identify the crucial mechanistic points that each intervention could affect.One of the biggest advantages of EIMD, is that researchers could have the whole picture of the inflammatory response and its lysis in a strict and regulated time course. In contrast, when individuals with already established low-grade, chronic inflammation are recruited, the variability of the clinical and biochemical phenotypes, pharmacology, and medical history is usually large even in well-controlled studies. Thus, even in the best controlled cross sectional studies, the diversity between the participants would have a strong conflicting impact on research outcomes.Biological sampling. Apart from the classical blood or saliva samples, that are usually collected before and several time points after the exercise trial this type of experiments allow you to take samples of the inflamed tissue, namely muscle biopsies. This technique has been used in many studies, investigating either the training-induced adaptations on muscle fibers The kinetics of clinical phenotypes linked to the inflammatory response can be easily determined. Such phenotypes are delayed-onset muscle soreness, maximum isometric torque, range of motion, limb circumference, and several other types of ergometric tests according to the inflamed limb.In our opinion, EIMD is a convenient, dynamic, and informative model of inflammation. It can be applied either in studies investigating the homeostatic responses of individuals under inflammatory stimuli or for the estimation of the anti-inflammatory or pro-inflammatory potential of dietary patterns, foods, supplements, nutrients or phytochemicals. The main advantages of EIMD are the following :EIMD canAcute and chronic inflammations. EIMD inflammatory response share similar pathophysiological and biochemical responses with acute and chronic inflammation. Thus, EIMD could find application in studies investigating the effect of nutrition and/or exercise, in acute and chronic inflammatory conditions such as those observed before and/or during the majority of chronic and non-communicable diseases ,128,272.Considering the pathophysiology behind conditions such as muscle/neurogenic inflammation, atrophy, cachexia, sarcopenia, and chronic muscle protein degradation EIMD can serve as a very reliable and regulated model to investigate how nutrition and or exercise may affect the physiological and biochemical background of those conditions.Ischemic preconditioning (IPC). After an EIMD stimuli, the following exercise bouts induce lower muscle damage and inflammation, due to the specific muscle adaptations, that minimize the extent of muscle damage, a phenomenon that it is known as “repeated bout effect” RBE ,275,276),276275,2Rhabdomyolysis. Rhabdomyolysis is a pathophysiological condition of extensive skeletal muscle cell damage which could be induced from many physical  and non-physical causes  . This isFibromyalgia (FM). FM is a complex syndrome characterized by widespread pain that affects many tissues and the presence of allodynia and hyperalgesia ,287. FatThe EIMD model can serve as a precise model, in studies investigating the effects of nutritional and training interventions, on acute and chronic inflammation conditions, mainly in metabolic-related inflammatory conditions. As for example, EIMD could serve as a useful model in human studies investigating:According to the above, it seems that EIMD is a controlled, highly regulated tool in the hands of researchers, to investigate the ability of different types of nutritional and training interventions to interfere with the progression and lysis of acute inflammatory conditions. It is worth testing if the ability of those interventions to attenuate acute inflammatory responses after EIMD can predict their ability to also act protectively against chronic inflammation although such as link has not been established yet. Nevertheless, EIMD allows the assessment of the putative anti-inflammatory, hermetic, or immunomodulatory properties of dietary intervention directly to human beings under real, dynamic conditions."}
{"text": "Mesenchymal stem cells (MSCs) have been identified as potential therapeutic candidates for cardiovascular disease (CVD). However, the molecular mechanism underlying their therapeutic effects is unknown.Recently, Chen et al. showed that an exosomal lncRNA derived from MSCs protected against cardiomyocyte apoptosis in vivo, which provided new insight into our understanding of the functions of MSCs. Other exosomal lncRNAs from MSCs have been shown to play pivotal roles in the development of CVD.Exosomal lncRNAs are important molecules in the application of MSCs, which reveals, at least in part, the functional mechanism of MSCs. Dear Editor,Cardiovascular disease (CVD) is the leading cause of morbidity and mortality worldwide. Mesenchymal stem cells (MSCs) were identified as potential therapeutic candidates for CVD many years ago. Delivery of MSCs decreased infarcted size, improved cardiac function, regulated cardiac cell function, and provided a histological network for cell attachment. However, the underlying molecular mechanism remains to be elucidated.2O2-induced apoptosis in cardiomyocytes by modulating the expression of miR-142-3p and activating Forkhead class O1 (FOXO1). This finding suggests the potential of exosomal lncRNA-mediated therapy for clinical applications [Exosomes have recently been shown to be important mediators of cell-to-cell communication. Exosomes are lipid bilayer-enclosed nanovesicles containing multiple molecules, including proteins, DNAs, and RNAs, that can transfer biological information under both normal physiological and pathological conditions. Recently, Chen et al. reported that exosomal long non-coding RNA (lncRNA) derived from MSCs protected cardiomyocytes against apoptosis in vivo, which provided new insight into our understanding of the functional role of MSCs. According to the study, lncRNA-NEAT1 derived from exosomes prepared from macrophage migration inhibitory factor (MIF)-induced MSCs blocked HSimilar to lncRNA-NEAT1, other MSC-derived exosomal lncRNAs showed activity in CVD. Exosomal metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), derived from human umbilical cord MSCs, blocked aging-induced cardiac dysfunction by inhibiting the nuclear factor kappa B (NF-κB)/tumor necrosis factor-α (TNF-α) signaling pathway . In addiTaken together, these findings demonstrate that exosomal lncRNAs are important molecules in the application of MSCs, and at least partially reveal the functional mechanism underlying the effects of MSCs. Nevertheless, our understanding of the precise regulatory mechanisms of exosomal lncRNAs in different cells is still in its infancy. For example, while it is known that some lncRNAs are expressed at low levels in cells but are enriched in secreted exosomes, how the exosome “captures” these lncRNA molecules is yet unknown. Although lncRNAs may have a better chance of escaping ribonuclease degradation through their association with exosomes, it is not known whether lncRNAs are modified within the exosome. In addition, lncRNAs, miRNAs, and mRNAs can be regulated by other molecules, which makes determining the regulatory relationships challenging. Therefore, further study is needed to fully understand the characteristics of exosomal lncRNAs."}
{"text": "MAPK). Attenuation of the MAPK-inflammatory/apoptotic pathway in SH-SY5Y cells concurrent with protection of rotenone-triggered motor impairment in rats, is a manifestation of the combined antioxidant/anti-inflammatory activity of SD and SDA together with levodopa release. The concept of joined therapies into a single molecule, where levodopa precursors confer antioxidant activity by enabling NAC delivery across the BBB, provides a potential disease-modifying treatment for slowing PD progression.Parkinson’s disease (PD) is characterized by a gradual degeneration of the dopaminergic neurons in the substantia nigra pars compacta (SNpC). Levodopa, the standard PD treatment, provides the missing dopamine in SNpC, but ultimately after a honeymoon with levodopa treatment the neurodegenerative process and the progression of the disease continue. Aimed at prolonging the life of dopaminergic cells, we prepared the levodopa precursors SuperDopa (SD) and SueprDopamide (SDA), in which levodopa is merged with the antioxidant N-acetylcysteine (NAC) into a single molecule. Rotenone is a mitochondrial complex inhibitor often used as experimental model of PD. In vivo, SD and SDA treatment show a significant relief of motor disabilities in rotenone-injected rats. SD and SDA also lower rotenone-induced-α-synuclein (α-syn) expression in human SH-SY5Y cells, and α-syn oligomerization in α-syn-overexpressing-HEK293 cells. In the neuronal SH-SY5Y cells, SD and SDA reverse oxidative stress-induced phosphorylation of cJun-N-terminal kinase (JNK) and p38-mitogen-activated kinase (p38 Neurodegenerative diseases share neuroinflammation as a common mechanism resulting from activated microglia that release pro-inflammatory cytokines. The loss of 9-type dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc) has been shown to be responsible for the first motor symptoms of Parkinson’s disease (PD).Virtually all PD patients will require levodopa therapy. However, PD progresses with time, and patients experience diminished duration of benefit from each dose. The diminished effectiveness over time is also accompanied by the development of medication-related complications such as motor fluctuations, and levodopa-induced dyskinesia . The decMAPK)  during the oxidative metabolism of dopamine within the DA cells, and impaired bioenergetics in the mitochondria contribute to premature cell death. Oxidative stress also triggers the mitogen-activated protein kinases (MAPKs) inflammatory/apoptotic pathways through the phosphorylation of cJun N-terminal kinase (JNK) and p38-mitogen protein kinase (p38 review –7)..MAPK) (rA53T) A9 DA neurons [Mitochondrial toxins including herbicide paraquat, pesticide rotenone, or the funcocide MB-manganese, target a variety of redox-sensitive proteins in the brain contributing to sporadic PD . These t neurons .A53T are linked to genetic mutations that generate intracellular inclusions called Lewy body that contribute to the neuronal dysfunction and pathology of DA cells [Oxidative/nitrosative stress induced by paraquat has been shown to modify α-syn by nitration of a tyrosine residue and oxidation of a methionine residue, thereby contributing to its aggregation –13. ThesDA cells –17. ThesDA cells –20.To develop a disease-modifying strategy for PD, we designed two dopamine precursors, AcCys-L-Dopa-Cys-amide, called SuperDopa (SD), and AcCys-L-Dopa amide, called SuperDopAmide (SDA).SD is a family member of the thioredoxin mimetic peptides (TXM-peptides). TXM- peptides protect neuronal and non-neuronal cells from apoptosis in vitro and in vivo, by inhibiting the oxidative stress-induced MAPK-inflammatory/apoptotic pathway and catalyzing S-denitrosylation , 21–30.SDA is a dipeptide comprising of N-acetylcysteine (NAC) and DopAmide. DopAmide itself is a levodopa precursor that confers a sustained release of dopamine in 6-OH-dopamine-lesioned rats .To recapitulate in vivo features of SD and SDA we used the highly reproducible rotenone rat model, in which rotenone-treated rats develop PD features like bradykinesia, postural instability and/or rigidity, thus providing an excellent tool to test potential PD neuroprotective reagents . In vitrAs demonstrated, both SD and SDA appeared to combine anti-inflammatory/antioxidant activities with the ability to replenish the cells with levodopa. The impact of joined activities into a single molecule is often greater than administrating each molecule separately.The concept of combined therapies of levodopa precursor with antioxidant activity into a single molecule that enables NAC delivery across the BBB and inhibition of the neurodegenerative process, could become a disease-modifying treatment with an outlook for slowing PD progression.SD (AcCys-L-DOPA-Cys-amide) is N-acetylated tri-peptide comprising of two Cys residues that flank levodopa Fig. ; upper. SDA (N-Acetylcysteine-L-DOPA-amide) is an N-acetyl blocked dipeptide comprising of a single Cys and a single residue of levodopa modified at the carboxy-terminal to an amide. SDA was synthesized , and its purity (98%) and molecular weight were determined by HPLC Fig. S, and masHere, SD and SDA were tested in vivo using the rotenone rat model, which mimics PD motor dysregulations and is one of the most reliable animal models of PD. Three groups of rats were injected intraperitoneally (i.p) in the morning with rotenone (3.0 mg/kg/day) in a specialized vehicle, for 9 days. In the afternoon, one group was i.p injected with SDA (33 mg/kg/day) and another group, with SD (33 mg/kg/day), for 9 days (“Methods”).Body weight was monitored on days 4, 7, and 10 Fig. . A slighMotor coordination and balance were evaluated using the rotarod behavior test at days 4, 7, and 10 Fig.  left. ThThe rearing cylinder test was used to evaluate locomotor activity in rodent models of CNS disorders. A gradual decrease in the ability of the rotenone-treated rats to place the palm on the wall of the cylinder was monitored at days 4, 7, and 10, indicating impaired body support Fig. , left. RRat beam walk test was applied for examining SDA and SD effects on motor coordination and balance in the rotenone rat model. The goal of this assay was to test the rat ability to stay upright and walk across an elevated narrow beam to a safe platform. After 2 days training, the assay examined the time it takes for the rat to traverse the beam and the number of paw slips that occur in the process. This test is complementary to the rotarod, and can detect subtle deficits in motor skills and balance.A significant improvement in the time required for terminating the walk was observed in the rotenone/SD or rotenone/SDA treated rats, compared to rotenone/only, at days 4, 7, and 10 Fig.  left. QuTo assess a putative neuroprotective mechanism, and cell permeation we examined the antioxidant/anti-inflammatory activities of SD and SDA, by monitoring the oxidative stress-induced MAPK-apoptotic/inflammatory pathway in human neuroblastoma SH-SY5Y cells. Oxidative stress was induced by auranofin (Auf), an inhibitor of thioredoxin reductase. SH-SY5Y cells are often used as a cellular model of various neurological oxidative stress-related disorders such as PD and Alzheimer’s disease , 34.Initially, we explored the effects of Auf on the mitochondria, recording mitochondrial membrane potential (MMP). Similar to rotenone and paraquat, we found that Auf lowered the MMP Fig. S. These rNext, we wanted to assess the effects of SD and SDA on Auf- or rotenone-induced cell morphology. SH-SY5Y were incubated with 3 µM Auf for 30 min, washed, and incubated for 3.5 h at 37 °C with or without SD or SDA. As shown in Fig. SNext, to investigate the possible anti-apoptotic/anti-inflammatory activity of SD and SDA we explored Auf-induced JNK phosphorylation in SH-SY5Y cells. The cells were treated with 3 μM Auf for 30 min, washed, and then incubated for 3.5 h at 37 °C with or without SD Fig.  or SDA  see Fig, at the MAPK phosphorylation was examined in SH-SY5Y cells. The cells were treated for 30 min with 3 μM Auf, washed, and incubated for 3.5 h at 37 °C, with or without SD   Fig. S. This reMAPK phosphorylation in SH-SY5Y cells. The cells were treated for 30 min with 3 μM Auf, washed, and then incubated for 3.5 h at 37 °C, with or without increasing concentrations of LDEE .The antioxidant activity of SD and SDA was compared to another levodopa precursor, LDEE , testingEE Fig. S. As oppoµM Fig. S.MAPK phosphorylation are compared Copper ions play a role in synucleopaties, while the Cys-sulfhydryl group are known as copper chelators. These activities led us to investigate the effect of SD or SDA on rotenone-induced expression of α-syn in SH-SY5Y cells. Cells treated for 60 min with SDA Fig.  or SD F at the i12The efficacy of SDA in preventing α-syn aggregation was tested also in HEK293 overexpressing α-syn. HEK293 cells were transfected with cDNA encoding wt α-syn. Forty-eight hours after transfection, the cells exhibited high levels of monomers, and aggregated forms of α-syn, monitored by the corresponding α-syn antibodies Fig.  see Fig. PreincuSlowing the progression of PD remains a critical need in the therapy of the disease. Levodopa, the presently used treatment like dopamine itself, is known to form toxic semiquinones by auto‐oxidation. This in turn leads to a decrease in GSH level and cell death (review ).In the present study our goal is to characterize two novel levodopa precursors comprising of anti-inflammatory/anti-apoptotic activities, which may well protect DA neurons from neuroinflammation and premature cell death. Small molecular weight levodopa analogs were prepared, in which the antioxidant NAC is linked via a peptide bond to either the N-terminal of L-DOPA-Cys-amide, forming SD or to the N-terminal of L-DOPA amide, forming SDA. Both SD and SDA were designed to provide NAC and Cys into nigral DA cells concomitantly with L-DOPA delivery, aimed at replenishing the missing dopamine simultaneously with reversing oxidative stress/inflammatory damages. Treatment with SD and SDA having multifaceted activities combined into a single molecule have the potential to delay the onset of both motor fluctuations and dyskinesias and slow premature loss of nigrostriatal denervation of the dorsal putamen and nigral cells.To assess the neuroprotective properties of SD and SDA in vivo, we used the systemic acute rotenone rat model that reproducibly mimics many aspects of the pathology of human PD . In thisSince the rotenone-treated animals develop bradykinesia, postural instability, and/or rigidity , this moMotor coordination and balance were monitored in the rotenone/only, rotenone/SD and rotenone/SDA treated rats, using rotarod, beam walking, and rearing activity. Postural instability, and/or rigidity were developed by all rotenone/only-treated animals, and reversed in the rotenone/SD- or rotenone/SDA-treated rats. The significant rescue of impaired motor activities subsequent to intraperitoneal injection strongly suggests that both SD and SDA may well cross the BBB, reversing the rotenone-triggered toxicity of the DA neurons. The intraperitoneal injection of the TXM-peptide, TXM-CB3, was previously shown to reverse inflammatory consequences in the brain of diabetes Zucker rats . These rred). This ASK1/Trx1red complex is unable to activate the MAPK-apoptotic pathway. Upon oxidation of Trx1red to Trx1ox, the complex dissociates enabling free ASK1 to activate the MAPK-inflammatory/apoptotic pathway.It is well established that the inflammatory/apoptotic pathway is activated by the apoptosis signal-regulating kinase1 (ASK1) . ASK1 foThe anti-inflammatory/antioxidant properties of SD and SDA have been demonstrated in vitro, monitoring the activation of MAPK pathway in the neuronal human neuroblastoma SH-SY5Y cells. Oxidative stress was induced in the cells by Auf, an organogold selective inhibitor of thioredoxin reductase, known to activate ASK1 by maintaining Trx1 in the oxidized form. Through the activation of the MAPK-inflammatory/apoptotic pathway, Auf also inhibits the mitochondrial Trx2 causing the failure of mitochondrial function in the brain . Furtherox to Trx1red with resultant activation of ASK1, and/or a direct effect of ROS scavenging and elevation of GSH levels. These effects establish the anti-apoptotic/anti-inflammatory activities of SD and SDA in neuronal cells, promoting potential clinical relevance in protecting nigrostriatal denervation of the dorsal putamen and slowing nigral cell loss.The ability of SD and SDA to reverse the Auf-oxidizing effects implies a dual mechanism of action. SD and SDA exert an indirect antioxidant effect by reducing Trx1The in vivo studies suggest that SD or SDA, which have both NAC and levodopa moieties within them, appear to cross the BBB, thereby facilitating delivery of both components to the targeted cells. This is in contrast to NAC which is BBB-impermeable. Acting as a vehicle to bring NAC into the brain, SD and SDA might provide antioxidant protection to DA neurons, simultaneously with replenishing the missing dopamine in the nigral cells. The data suggest that the combined activities of SD and SDA into a single molecule, might have a significant advantage over NAC and levodopa administrated separately. In the absence of a clinically efficient neuroprotective treatment to slow PD progression, SD and SDA might have a putative disease-modifying effects by conferring antioxidant/anti-apoptotic activity within the DA neurons.Alpha-synuclein (α-syn) is abundantly expressed in neurons and is the major constituent of Lewy bodies, which are the hallmarks of neurodegenerative diseases called synucleinopathies, which like PD, results in multiple system atrophy, Lewy body dementia, Alzheimer’s disease, and frontotemporal dementia.The prevalence of misfolded fibrillar aggregates of α-syn associated with Lewy bodies is consistent with the role of copper ions and oxidative stress, forming highly toxic α-syn oligomers and α-syn aggregation . Copper Since sulfhydryl groups are known to chelate copper ions, SD and SDA were examine for the effects on α-syn expression and aggregation.Both SD and SDA showed a reduction in α-syn expression in SH-SY5Y cells exposed to a high dose of rotenone. Also, production of aggregated forms of α-syn was significantly lower in HEK293 cells overexpressing α-syn in the presence of SDA. The precise mechanism by which SD or SDA prevent stress-induced α-syn expression in neuronal cells is not yet clear and requires further study.The second experiment investigated a direct effect of SDA on α-syn oligomerization, using α-syn transiently transfected HEK293 cells, which express high levels of α-syn monomers and oligomers . PreincuThe newly designed levodopa precursors, SD and SDA appear to relieve motor impairment in the rotenone rat model and inhibit oxidative stress-induced activation of the inflammatory MAPK-apoptotic pathway in neuronal cells. Initial data also suggest that SDA reverses α-syn oligomerization.To date, there is no clinically disease-modifying treatment that can halt PD progression. The failure to develop neuroprotective or disease-modifying strategies results mainly because treatment starts with the appearance of motor symptoms, long after a significant nigral cell loss. Nevertheless, the standard treatment of levodopa, which is almost entirely centered on dopamine replenishment performs rather efficiently during the initial 4–5 years of treatment, implying viability of the remaining DA neurons. Therefore replacing levodopa treatment with SD or SDA may possibly attenuate the loss of the remaining nigral cells and slow PD progression. Future toxicology studies and subsequent clinical testing of SD or SDA alongside levodopa could establish their potential clinical benefits and advantage in halting disease progression.The combined redox activity and levodopa release with lowering α-syn aggregation might potentially slow-down nigral cell loss, protect nigrostriatal denervation of the dorsal putamen, and attenuate Lewy pathology. Hence, SD and SDA have the potential to become a disease-modifying treatment of PD or other LB-like pathologies.Auranofin , triethylphosphine  gold(I); LDEE from TEVA Ltd Israel. SD, SDA, and TXM-peptide TXM-CB3, and AD4 (NAC-amide), were custom synthesized by Novetide, Ltd, Haifa, Israel. All other materials were purchased from Sigma, Jerusalem. α-syn plasmid was a kind gift of Dr. R. Sharon .2, as previously reported [2 in RPMI 1640 supplemented with: l-alanyl-l-glutamine (4.4 mM); 10% fetal bovine serum; penicillin (100 U/ml) and streptomycin (100 μg/ml); HEPES pH 7.3 (10 mM). Cells were plated at a density of 6.25 × 104/cm2 and incubated for 24 h, after which they were exposed to different treatments. Tissue culture serum and medium were from Biological Industries .Human neuroblastoma SH-SY5Y cells were cultured in DMEM/F12 HAM 1:1 medium supplemented with 10% fetal bovine serum (FBS) and penicillin–streptomycin, incubated at 37 °C with 5% COreported . Human eThe anti-inflammatory activity of SD and SDA was tested essentially as previously reported for TXM-CB3 . SH-SY5YMAPK (Thr180/Tyr182), rabbit mAb; p38, rabbit Ab; GAPDH ; α-syn, Abcam, Cambridge, UK EPR20535; β Catenin, mouse mAb  diluted in 5% BSA, 0.04% Azide in TBS-T. Proteins were detected with Anti-Mouse or Anti-Rabbit IgG-HRP linked antibody .Western blot analysis were performed essentially as previously published . Twenty HEK293 cells were plated on collagen (rat tail)  and incubated for 16 h in 24-well plates and allowed to reach 70–80% confluency in 1 ml of culture medium. The next day, the cells were washed twice with regular DMEM, incubated at 37 °C, for 5 h in Opti MEM  containing the transfection mixtures of 0.75 μg plasmid cDNA encoding wt α-syn and polyethyleneimine (PEI) at a ratio of 1:3 (DNA to PEI) in 400 µl Opti MEM after vortex for 10 s, and incubated at RT for 15 min. After 5 h the medium was replaced by regular DMEM containing 10% FBS solution. Cell media was replaced after overnight incubation, with DMEM containing 10% FBS solution with or w/o 500 µM of SDA and incubated for 48 h. Then the cells were lysed with 0.12 ml ice-cold lysis buffer , 10% glycerol, 0.6% SDS, bromophenol blue, supplemented with 7 μl β-mercaptoethanol, and heated overnight at 65 °C. Proteins were separated on SDS-PAGE α-syn monomers, dimers, and trimers were detected after blotting to nitrocellulose with the corresponding α-syn antibodies.P value < 0.05; **P value < 0.01.SH-SY5Y cells were treated with increasing concentration of SD or SDA for 60 min. Then the cells were washed and incubated with 5 µM rotenone for 16 h. The level of α-synuclein in cell lysates was determined after protein separation on 12% SDS-PAGE using α-syn antibodies. The values calculated by densitometry shown as averages (±SEM) of two independent experiments normalized with housekeeping level of β-catenin; Student’s t-test (two populations) was performed for rotenone-treated cells. *A commercial company Science in Action, Nes-Ziona, Israel, uses its ethical permission to do animal studies as an outsourcing service (#C148210).2 and decapitated.All animals were treated according to the National Institute of Health (NIH) guidelines for the care and use of laboratory animals. Animal ethics committee accredits the company, and licensed veterinarians conducted the experiments. Rat were sacrificed by an overdose of COoC. Twenty male Sprague Dawley rats 7-8 weeks  were divided into 4 experimental groups. The four groups comprised of rotenone only (n = 6), rotenone with SD (33 mg/kg) (n = 6), rotenone with SDA (33 mg/kg) (n = 6), and naive rats (n = 2) that were not treated and kept under the same conditions throughout the experiment. SD and SDA were administered intraperitoneally (i.p.) once a day in the afternoon (days 1–9).The experiments were performed by “Science in Action” Rehovot, according to Cannon et al. . RotenonAnimals body weight was determined before initiation of treatment (day 0), on days 4, 7, 10 during the experiment and on termination day 11. On day 11 the animals were sacrificed.Rearing behavior, rotarod, and beam walk tests were performed before initiation of treatment (day 0) and on days 4, 7, and 10 of the experiment.Motor coordination and balance was evaluated on the rotarod, which was set to accelerate from 4 to 40 rpm in 300 sec. Animals were placed at separate lanes on the rotarod with initial rotation set on 4 rpm.Animals were placed in a clear glass cylinder (40 cm high × 20 cm diameter) and number of rears in 2 min was monitored. Rear was considered when animals raised their front legs above the shoulder and made a contact with the wall of the cylinder with their forelimb.Animals were trained for 2 days to traverse the length of the beam. On the day of the test animals were gently placed on the 1 m long narrow aluminum beam facing one of the ends and allowed to walk along the beam, monitoring the time taken to reach the end of the beam.P < 0.05 level [All values were presented as mean ± standard deviation (SD) or standard error of mean (SEM), and differences were considered to be statistically significant at the *05 level . StatistMarked-up manuscriptSupplemental Material"}
{"text": "Players who completed more than 60 min in the previous game had significantly increased pregame CK levels and fatigue in multi-match weeks. Midfielders had both significantly increased pregame CK and muscle soreness in multi-match weeks. Midfielders and players with an exposure time of at least 60 min showed higher pregame CK values that should play a key role for deciding substitutions.The current study was conducted to compare muscle damage biomarkers in single- vs. multi-match weeks in elite soccer players for two consecutive seasons. A secondary objective was to analyze the influence of playing position and exposure time on muscle damage in single- vs. multi-match weeks. This is a prospective cohort study performed in a professional elite soccer club in the English Premier League during the 2018–2019 and 2019–2020 seasons up until the lockdown due to the COVID-19 pandemic. Data were collected in the Medical Department Room of an English Premier League Club before and after the soccer game from a total of 29 elite soccer players  who were enrolled in the club during both seasons. The main outcome measurements were creatine kinase (CK), weight, lean mass, % fat DEXA, high speed running, total distance, density of total distance and high-speed running and wellbeing questionnaires. Significance was set at  Professional sport has been affected by the COVID-19 pandemic . Since lThis extraordinary situation may have several consequences in clinical practice, provided that insufficient recovery may reduce athletic performance and increase the risk of sport-related injuries ,3. In faIn a more detailed way, creatine kinase (CK) levels have been used to monitor muscle damage in elite soccer players ,8,9,10 aThe current prospective cohort study was conducted to compare muscle damage in single- vs. multi-match weeks in Premier League soccer players for two seasons in a row. A secondary objective was to analyze the influence of playing position on muscle damage in congested versus standard schedules.This is a prospective cohort study performed in a professional elite soccer club in the English Premier League during the 2018–2019 and 2019–2020 seasons up until the lockdown due to the COVID-19 pandemic. The current study was approved by the Ethics Committee of Camilo José Cela University  and adhered to the tenets of the Declaration of Helsinki [Data were collected from 29 elite soccer players  who were enrolled in the club during both seasons. Goalkeepers were excluded due to their specific role in the team. The positional breakdown assigned to the players was: defender, midfielder, and striker ,21,22. AData were related to 38 matches in the 2018–2019 season and 29 matches in the 2019–2020 season. Since fixtures were not distributed homogeneously during the whole season, weeks were considered as multi-match weeks or single-match weeks when the time between matches was shorter or longer than 4 days (96 h), respectively . So, for−1), walking (0.2–2 m.s−1), jogging (2–4 m.s−1), running (4–5.5 m.s−1), high-speed running (5.5–7 m.s−1) and sprinting (>7 m.s−1), as in previous investigations [Match performance data were collected across both seasons by the English Premier League—with TRACAB  in 2018–2019 and Second Spectrum  in 2019–2020 installed at the stadiums of the home team. The data supplied provided different information about total distance and different velocities of the players during the game. Kick off time was from 12:30 to 19:00 depending on the fixture and television broadcasting. To develop the player’s activity profiles, movements were coded into the following categories and speed thresholds: standing  in combination with a spring-loaded AccuChek lancet device . A 30 μL capillary blood sample was placed on the measurement strip and analyzed by Reflotron Plus  system according to the manufacturer’s recommendations. Capillary blood was analyzed using this method and displayed an intraassay reliability of <3% coefficient of variation . Pre-gamWellbeing questionnaires were collected everyday through a software program  on an iPad Air  located in the changing room of the players. Players were familiarized with this questionnaire, which was distributed according to previous recommendations ,28,29 anBody fat and lean mass percentages were evaluated by means of dual-energy x-ray absorptiometry (DEXA) using a total body scanner  according to the manufacturer’s procedure. All the scanning and analyses were performed by the same specialist to ensure consistency.p < 0.05.All statistical tests were performed using the package IBM SPSS Statistics v. 26.0 . A descriptive study was carried out to analyze the data. Continuous variables were presented as mean values and standard deviation (SD) along with 95% confidence intervals (CI). When appropriate, data were provided as percentages. The Shapiro–Wilk test was used to identify normal distribution of the data. The Mann–Whitney U test was used to analyze differences between multi-match weeks and single-match weeks. One-way ANOVA or multivariate data analysis was used to test the profile of the values, depending on the playing position, in the congested weeks and non-congested weeks. Analysis was performed at the 95% confidence level. Significance was set at Out of the 55 analyzed matches, 22 were considered to belong to multi-match weeks and 33 to single-match weeks. In addition, CK pre-match multi-match data involved a mean of 9.77 players per match, while single-match data involved a mean of 9.75 players per match.p = 0.029) (p = 0.015) (p = 0.036) (p = 0.029). No more significant changes were found in this group. These results are listed in Players who completed more than 60 min in the previous game had significantly increased pregame CK levels in multi-match compared to single-match weeks  . In addi= 0.015)  and dens= 0.036)  in multip = 0.045). Similarly, midfielders’ muscle soreness  and total distance  were also significantly higher in multi-match vs. single-match weeks. Conversely, no significant changes were found in defenders and strikers. These results are summarized in Regarding player position, our results clearly demonstrate that midfielders had pregame CK values that were significantly increased in multi-match weeks when compared to single-match weeks (295.16 ± 185.26 vs. 240.58 ± 134.97; To the best of our knowledge, this was the first study that compared muscle damage in single- vs. multi-match weeks for two consecutive seasons in English Premier League soccer players.Our results clearly demonstrate that pre-game levels of CK were significantly higher in congested compared to non-congested weeks when players played more than 60 min. Similarly, internal training load expressed as fatigue and muscle soreness were also significantly increased. As the biomarker is an individual independent value, clinically this difference suggests that changes in pre-game CK levels intra-individually in a congested week would help us to understand how close the player is to the baseline of a single-match week. This pre-game CK level could be taken as an important factor by the coaches and the medical department when deciding the availability of players for the next game. Conversely, in spite of post-game CK levels being higher in multi-match weeks, differences were not statistically significant with respect to single-match weeks. The latter finding could be explained considering that in periods of congested scheduling, soccer players reduced the number of low and medium intensity actions they participated in, but maintained the number of higher intensity actions . In addiOur study also shows that there is no difference in total distance between players due to playing in a single- or multi-match week, which is similar to other previous research , and posIt is widely accepted that there are position-specific differences in soccer players’ match performance ,36,37. ARecent studies have emphasized that professional soccer matches can be carried out safely during the COVID-19 pandemic . It was The strengths of the current prospective cohort study include that it was conducted in a professional soccer club in the English Premier League for two consecutive seasons. In contrast to previous cross-sectional studies  or shortThe present study had some limitations that should be also addressed. Firstly, data from a single club were assessed, meaning that the current results may have limited application. Secondly, considering the fact that collecting data during official top-level competitions is a complex institutional mission within a particular ecological environment, we could not repeat postgame CK levels in a strict 24- or 48-h cycle after the end of the match, as shown in previous studies on this topic ,34.Thirdly, it is well-known in the related literature that CK values are individualized and highly dependent on multiple factors as lean mass , race 4, the levIt was concluded that pregame CK levels were significantly increased in multi-match weeks when players had less than 4 days of recovery between consecutive matches. Conversely, no significant changes were found in postgame CK levels, suggesting that player rotation and early recovery strategies were adequate in both single- and multi-match weeks. Regarding playing position, midfielders exhibited higher pregame CK levels when compared to forwards and defenders. Similar results were reported in soccer players who played more than 60 min in the previous game. Accordingly, individualized training loads and recovery protocols are strongly encouraged. Furthermore, prospective cohort studies, involving a larger sample of clubs from elite soccer leagues, are necessary to confirm the current findings."}
{"text": "Wolbachia are endosymbionts of numerous arthropod and some nematode species, are important for their development and if present can cause distinct phenotypes of their hosts. Prophage DNA has been frequently detected in Wolbachia, but particles of Wolbachia bacteriophages (phage WO) have been only occasionally isolated. Here, we report the characterization and isolation of a phage WO of the southern ground cricket, Allonemobius socius, and provided the first whole-genome sequence of phage WO from this arthropod family outside of Asia. We screened A. socius abdomen DNA extracts from a cricket population in eastern Missouri by quantitative PCR for Wolbachia surface protein and phage WO capsid protein and found a prevalence of 55% and 50%, respectively, with many crickets positive for both. Immunohistochemistry using antibodies against Wolbachia surface protein showed many Wolbachia clusters in the reproductive system of female crickets. Whole-genome sequencing using Oxford Nanopore MinION and Illumina technology allowed for the assembly of a high-quality, 55 kb phage genome containing 63 open reading frames (ORF) encoding for phage WO structural proteins and host lysis and transcriptional manipulation. Taxonomically important regions of the assembled phage genome were validated by Sanger sequencing of PCR amplicons. Analysis of the nucleotides sequences of the ORFs encoding the large terminase subunit (ORF2) and minor capsid (ORF7) frequently used for phage WO phylogenetics showed highest homology to phage WOAu of Drosophila simulans (94.46% identity) and WOCin2USA1 of the cherry fruit fly, Rhagoletis cingulata (99.33% identity), respectively. Transmission electron microscopy examination of cricket ovaries showed a high density of phage particles within Wolbachia cells. Isolation of phage WO revealed particles characterized by 40–62 nm diameter heads and up to 190 nm long tails. This study provides the first detailed description and genomic characterization of phage WO from North America that is easily accessible in a widely distributed cricket species. Wolbachia, obligate intracellular bacteria belonging to the order Rickettsiales [Wolbachia cause phenotypes such as cytoplasmic incompatibility (CI) and feminization in arthropods, or support growth and reproduction in filarial nematodes [Wolbachia-induced phenotype in insect hosts and presents a form of conditional sterility whereby crosses between infected males and uninfected females produce unviable offspring; infected females may successfully mate with Wolbachia-infected or uninfected males, conferring them a selective advantage [Wolbachia are divided into several supergroups based on their ftsZ gene sequence, with supergroups A and B found exclusively in arthropods and supergroups C and D found exclusively in nematodes [Wolbachia are abundant in male and female germlines and are enriched along the reproductive tract, but also present in somatic structures  of select host species. Transmission is predominantly vertical, from female to offspring, although horizontal transmission has been documented in nature [Wolbachia (phage WO) were first discovered in 2000 and remain one of few published cases of bacteriophages that infect intracellular bacteria [Wolbachia taxa in the supergroups A and B, but are believed to be absent from Wolbachia supergroups C and D [Wolbachia or arthropod host [Wolbachia density and therefore, affect development and phenotype of its eukaryotic host [Wolbachia with accessory genes for cytoplasmic compatibility and male killing [It is estimated that 66% of all insect species and the majority of filarial parasites that infect humans are infected/colonized with ttsiales  Wolbachiematodes , 3. Cytodvantage , 5. Wolbn nature , 5, 7. Abacteria . Phages  C and D . The perpod host . Phage Wtic host . Further killing , 13.Wolbachia genomes have been sequenced and phage WO is of interest for being the only known mobile genetic element in Wolbachia, and its hypothesized role in generating the high level of diversity seen among Wolbachia today [Wolbachia strains mediated by WO phages [Wolbachia phages, sequence data is limited to the minor capsid protein-coding gene, and there remain entire families and genera of Wolbachia-harboring arthropods in which phage has not yet been described [Gryllidae) of the genus Allonemobius (ground crickets), whose members include A. socius (the southern ground cricket) and A. maculatus (the spotted ground cricket), found throughout North America. Wolbachia belonging to supergroup B has been identified in A. socius (strain: wSoc), where it is hypothesized to play a role in lengthening female crickets’ spermathecal ducts, thus increasing their control over mate choice. [Allonemobius.In recent years, an increasing number of ia today , 14. EviO phages . For a mescribed . One suc choice. –18. HoweAllonemobius crickets (phage WOSoc) and estimated its prevalence in a local A. socius population. We characterized the novel phage WOSoc by immunohistochemistry, transmission electron microscopy, and whole genome sequencing, expanding the limited set of fully described bacteriophages of Wolbachia by adding this novel bacteriophage for which we provide evidence of phage particle production, and complete genes which may mediate bacterial cell wall lysis and manipulation of host translation.In the present study we identified, for the first time, a phage WO in A. socius crickets (n = 40) were collected in the summer of 2019 from Forest Park, St. Louis, Missouri, USA . Crickets were sexed based on the presence  or absence  of an ovipositor and ecological data including morphological features and geographical distribution were used to confirm species identification. All insects were euthanized by placement at -20° C for 30 minutes before dissection and homogenization of abdomens in 500 μL of phosphate buffered-saline by 15-minute high-intensity beating with a 3.2 mm chrome Disruption Bead  on the Vortex-Genie 2 mixer . The homogenate was spun down, and DNA was prepared from the supernatant using the DNeasy Blood & Tissue Kit  according to manufacturer recommendations, with elution into 100 μL sterile water and storage at -20°C or 4°C until use.Adult Wolbachia surface protein (WSP) gene [Wolbachia phage capsid protein (WPCP) gene [Conventional PCR reactions with total cricket abdomen genomic DNA template were run using previously validated primers to the conserved SP) gene  and to tCP) gene . PCR waswSoc and WOSoc sequences  for 1 hour at room temperature or overnight at 4°C using the alkaline phosphatase-anti-alkaline-phosphatase (APAAP) technique according to the manufacturer’s protocol . Hybridoma supernatant was kindly provided by Dr. Patrick Lammie and the antibody was purified as described previously [B. malayi worms from previous studies [FAST Fast Red TR/Naphthol AS-MX (Millipore Sigma) Tablets were used, and sections were counterstained with Mayer’s hematoxylin (Millipore Sigma). Sections were analyzed using an Olympus-BX40 microscope and photographed with an Olympus DP70 camera.For immunohistology, 10 whole eviously . All ant studies  were useHigh molecular weight (HMW) DNA was purified from a homogenate of a whole single adult female cricket prepared by 15 min beating with a lead bead using the MagAttract HMW DNA Kit (Qiagen) according to manufacturer specifications, eluting in 100 μL sterile water. Presence of HMW was visualized by gel electrophoresis as a dark band  above the 15 kb DNA ladder limit . Presence of WPCP in HMW DNA was confirmed by qPCR. DNA was then purified further using AMPure XP beads  at a ratio of 1.8:1 bead to DNA sample. Library was prepared according to Oxford Nanopore’s 1D Genomic DNA Ligation Protocol (Version GDE_9063_v109_revA) using the LSK-109 Ligation Sequencing Kit  with DNA fragments of all sizes purified using the Short Fragment Buffer. 60 μL of library containing 12 μL genomic DNA was loaded as input into the flow cell and the sequencing reaction run for 20 hours using MinKNOW GUI software (Oxford Nanopore Technologies) set to the High Accuracy Flip-Flop Model, generating 6.1 giga base pairs of data (estimated N50: 2.46 kb). Basecalling of Fast5 files into Fastq format was performed using Guppy neural network basecalling software . Base stWolbachia phage WO (taxid:112596); features automatically assigned “hypothetical protein” were relabeled with known function if homologous  to a described phage protein. Genomic features were visualized in scaffolds independently and manually color-coded by function using Gene Graphics visualization application [Putative WOSoc reads were extracted by mapping MinION sequences against published phage WO reference genomes using Minimap2 software . Mapped lication .Primers were manually designed to amplify phage tail and capsid regions based on the MinION reads . ConventDNA sequences of phage WO open reading frames 2 (ORF2) and 7 (ORF7), respectively coding for the large terminase subunit and minor capsid, are biomarkers known to produce highly congruent phage WO phylogenies . NucleotA. socius males and females (N = 70) were euthanized and thoroughly homogenized in 40 mL of SM buffer . Homogenate was incubated on ice for 1 hour followed by 11,000xg centrifugation for 10 minutes at 4˚C to remove debris. Solid polyethylene glycol (PEG) was added to homogenate to a final concentration of 10% and mixed by manual shaking for 1 minute, followed by an additional 1-hour incubation on ice and 11,000xg centrifugation for 10 minutes at 4˚C. Supernatant was discarded and the remaining pellet was resuspended in 10 mL of SM buffer. To the suspension, an equal volume of chloroform was added followed by centrifugation at 3,000xg for 15 minutes at 4˚C to remove the PEG. The aqueous layer containing phage was filtered through a 0.22 μM vacuum filter to remove Wolbachia and other bacteria. Phage lysate was concentrated using Amicon Ultra-15 100 kDA Centrifugal Units  according to [Phage was purified according to the protocol described in  with slirding to  and recoA. socius, ovaries were dissected and adsorbed to an electron transparent sample support (EM) grid. Tissue was washed in PBS and fixed in 1% glutaraldehyde for 5 minutes at room temperature, followed by two 30-second washes with deionized water. Phage particles were negatively stained in 1% uric acid for 1 minute and wicked gently and placed in a grid box to dry. Phage suspension was processed identically, with 50 μL of the concentrated suspension adsorbed to an EM grid. Samples were observed on a JEOL 1200 EX transmission electron microscope  equipped with an AMT 8-megapixel digital camera From freshly caught adult female Wolbachia by TEM, one half of the ovaries of each of 6 crickets was fixed in 2% paraformaldehyde/2.5% glutaraldehyde  in 100 mM phosphate buffer, pH 7.2, for 1 hour at room temperature. The other half of the ovary sample was added to 1X PBS for DNA extraction and confirmation of Wolbachia presence by PCR. Only samples that were positive by PCR for Wolbachia were further processed for TEM. These samples were washed in phosphate buffer and post-fixed in 1% osmium tetroxide (Polysciences Inc.) for 1 hour. Samples were then rinsed extensively in distilled water prior to staining with 1% aqueous uranyl acetate  for 1 hour. Following several rinses in distilled water, samples were dehydrated in a graded series of ethanol and embedded in Eponate 12 resin (Ted Pella Inc.). Sections of 95 nm were cut with a Leica Ultracut UCT ultramicrotome , stained with uranyl acetate and lead citrate, and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA Inc.) equipped with an AMT 8-megapixel digital camera (Advanced Microscopy Techniques) [To confirm the presence of phage in hniques) .Wolbachia in crickets. In order to confirm the DNA sequence of WSP of Missouri crickets, DNA was amplified by conventional PCR using the pre-validated WSP primers. WSP sequence showed 100% identity to WSP of A. socius from Virginia (Accession: AY705236.1). A 400 bp amplicon of phage DNA was amplified by conventional PCR using pre-validated primers corresponding to nucleotide positions 7353–7761 of phage WO of cricket Teleogryllys taiwanemma cricket and showed close homology to the capsid protein genes from phage WO of Supella longipalpa  and Cadra cautella . The A. socius WSP and phage WOSoc WPCP gene sequences were used to design SYBR-based real-time PCR assays for WSP and WPCP, respectively. Using the strict CT cutoff of 23 cycles, we determined that from 40 insects sampled 19 (47.5%) were positive for both WPCP and WSP DNA via qPCR with our optimized primers; three samples (7.5%) were WSP-positive but WPCP-negative  as a reference genome, we identified 511 homologous WOSoc reads from the MinION run of whole-cricket homogenate HMW DNA with an average quality per read (Phred Score) of 23, corresponding to an overall base call accuracy exceeding 99%. From these reads, we assembled 12 contigs totaling 53,916 bp at an average depth of 14.6X and a GC content of 35%. After confirming and extending these contigs with Illumina reads and removing low quality reads and reads derived from the Wolbachia genome, the WOSoc genome was captured in 4 high-quality scaffolds totaling 55,288 bp , while phage WOSoc ORF7 was most similar to WOCin2USA1 of cherry fruit fly, Rhagoletis cingulata , both insects of the order Diptera.  and vector competence [Wolbachia populations is important to optimize these intervention strategies, which are limited by Wolbachia’s host specificity and phenotypic effects. Future studies are needed to show whether phage WOSoc can be utilized to manipulate Wolbachia in A. socius or other host species infected by Wolbachia.ematodes  and as aematodes . Traditiematodes , 63. Trampetence –66. A beS1 FileSequences in FASTA format of the assembled scaffolds 1–4, the head decoration protein, major capsid protein, and minor capsid protein.(DOCX)Click here for additional data file.S2 FileGenome annotation showing start and stop of 63 open reading frames.(XLS)Click here for additional data file."}
{"text": "Plasmodium vivax was the predominant species (96.6%). The number of indigenous cases decreased gradually and since 2017, no indigenous cases have been reported. Malaria cases were mainly distributed in the southern and southwestern areas of the county; 55.6% of the indigenous cases were reported in Nabang Township, which also had the highest risk of imported malaria. The “1–3–7” approach has been implemented effectively, with 100% of cases reported within 24 h, 88.9% cases investigated and confirmed within 3 days and 98.5% of foci responded to within 7 days. Although malaria elimination has been achieved in Yingjiang County, sustaining elimination and preventing the re-establishment of malaria require the continued strengthening of case detection, surveillance and response systems targeting the migrant population in border areas.Yingjiang County, which is on the China–Myanmar border, is the main focus for malaria elimination in China. The epidemiological characteristics of malaria in Yingjiang County were analysed in a retrospective analysis. A total of 895 malaria cases were reported in Yingjiang County between 2013 and 2019. The majority of cases occurred in males (70.7%) and individuals aged 19–59 years (77.3%).  It has been estimated that there were at least 30 million malaria cases annually before 19492. Following the implementation of a significant integrated malaria control and elimination programme for more than seven decades and specifically the “1–3–7” surveillance and response strategy that was developed and has been implemented since 20104, the disease burden has been greatly reduced5. Since 2017, no indigenous cases have been reported, achieving the standard of national malaria elimination6. Currently, China is ready for nationwide malaria elimination certification by the World Health Organization (WHO).Malaria, an infectious disease, has had the longest epidemic duration, and the broadest impact in the history of China7. According to malaria epidemiological data collected from surveillance systems in China's border areas, the population crossing the border and border residents of Yunnan Province, China, have a higher risk of malaria transmission8. Historically, malaria has been serious in Yunnan Province with more than 400 thousand malaria cases10. Since 2010, Yunnan has been the only province with Plasmodium falciparum transmission in China11. The last indigenous malaria case in China was reported in Yingjiang County of Yunnan Province in 20166; there have been no indigenous cases reported nationwide since, which allowed Yunnan Province to achieve verification of malaria elimination in June 2020.Yunnan Province borders Myanmar, Laos, and Vietnam; the border extends 4060 km, touching 25 counties, with 17 border ports, and 643 border crossings. There is no natural barrier along the border10. The border areas on both sides are rural, hard-to-reach, poverty-stricken areas inhabited by minority nationalities13. The county has nine townships bordering Myanmar, five entry-exit highways, two provincial ports, four passages, and 33 boundary passages14. The climate, landscape and vectors of malaria on both sides of the border are similar13. In the last 10 years, the incidence of malaria in Yingjiang County has declined remarkably and this progress was made possible through greater access to effective malaria control tools. The last indigenous malaria case in China was caused by P. vivax infection in April 2016, located in Taiping Township of Yingjaing County6.A total of 18 counties in Yunnan Province sit on the China–Myanmar border. One of them, Yingjiang County, is located in western Yunnan Province and having a border length of 214.6 km; it borders Kachin State, Myanmar, in the western region15. According to a malaria report from the China–Myanmar Joint Prevention and Control Information Exchange Mechanism, thousands of malaria cases were reported in Laiza in 2016 and 2017. However, the number of malaria cases has decreased dramatically in the last three years, supported by cross-border cooperation to achieve malaria elimination, timely case detection and appropriate treatment, and vector control and surveillance. The number of cases increased in 2020 as an effect of the COVID-19 pandemic . The majority of cases occurred in individuals aged 19–59 years . Most patients were outdoor workers , who have the highest risk of malaria infection (P < 0.0001); while indoor workers accounted for 27.8% (249/895) of the cases.A total of 895 malaria cases were reported in the entire county in 2013–2019, including 45 indigenous cases and 850 imported cases. All cases were diagnosed by microscopy, and except 7, were also confirmed by polymerase chain reaction (PCR). There were no malaria-associated deaths reported during this period. The number of malaria cases was the lowest, at 72, in 2013 and reached a peak of 186 in 2016; then, it decreased to 92 in 2019. Malaria cases occurred predominantly in males , with a sex ratio of 2.42:1, but the difference was not significant . P. vivax infection was the most common cause of malaria in Yingjiang County, as well as in Yunnan Province. The annual reported number of P. falciparum cases was less than 10 from 2013–2019, and no P. falciparum cases was reported in 2019. One P. malariae infection and two mixed infections involving P. falciparum and P. vivax were reported  in 2013 to 0.05% (1/185) in 2016. The last indigenous malaria case reported in 2016 in Yunnan Province, was also the last in the whole country. Since 2017, no indigenous cases have been reported. 8/72 in 2There are 15 townships in Yingjiang County and nine of which border Myanmar . A total of 261 foci were identified during the study period, and 98.5% (256/261) were investigated and responded to within 7 days.The “1–3–7” approach describes a system of activities dependent on timely diagnosis and response to malaria cases; the strategy includes strict hourly timelines to be followed. Within 24 h, any malaria case must be reported. By the end of day 3, the county’s Center for Disease Control and Prevention (CDC) must confirm and investigate the case and determine whether there is a risk of spread. By the end of day 7, the county CDC must perform measures or interventions to prevent further spread by testing residents and family members in the community where the malaria case was identified. From 2013 to 2019, there were no delays in the reporting of malaria cases, and 895 malaria cases in Yingjiang County were reported within 1 day. In terms of case investigation and confirmation, an average of 88.9% (range: 64.2–100%) of cases were investigated within 3 days, and this indicator reached 100% in 2014, 2015, and 2016  were diagnosed in a health facility of a county CDC/hospital or township hospital . For example, people engaged in frontier trade may frequently cross the border, while local farmers may go to Myanmar for logging or mining during the slack seasons in farming. In November 2019, the Hongbenghe Water Conservancy Construction Site, which was located at the China–Myanmar border in Taiping Township of Yingjiang County, was identified as an epidemic focus, and a total of 22 P. vivax malaria cases were identified. According to the case investigation, the source of infection was the bite of an Anopheles mosquito carrying malaria parasites that was transported from overseas; therefore, these cases were classified as imported malaria cases. This epidemic cluster caused another peak in monthly malaria cases in Yingjiang in 2019 , Yingjiang County was a Type I county  that was targeted for the implementation of key strategies to strengthen surveillance and reduce the incidence in the pre-elimination stage010–2020,P. vivax is the most geographically widespread parasite causing human malaria, and over 2.5 billion people are at risk of infection26. P. vivax malaria is mainly endemic in Southeast Asia and Central and South America. As reported by the WHO, more than half of P. vivax infections (53%) occur in the WHO South-East Asia region27. The proportion of vivax malaria cases in Yingjiang County increased from 2013 to 2019 and no falciparum malaria cases were reported in 2019, indicating that P. vivax was the predominant species on the Myanmar side and the rate of P. falciparum infection in Myanmar was very low because more than 95% of the imported cases were from Myanmar. This change was similar to that in other countries in the Greater Mekong sub-region29. The epidemiology of vivax malaria in this region is highly heterogeneous and P. vivax has become a major challenge to malaria elimination in this region31.3. In this study, we analysed the three indicators included in the “1–3–7” approach in Yingjiang County. All malaria cases were reported to the CIDRS within 24 h, indicating that the web-based case reporting system is sensitive, as it allowed a prompt response, even in township hospitals. The proportion of case investigations and confirmations completed within 3 days was 88.9%, compared with only 64.2% in 2017  pandemic has affected the availability of key malaria control interventions and may cause malaria-associated morbidity and mortality to increase in the future41.Although great achievements have been made in reducing the overall number of cases of malaria and eliminating indigenous cases in China, the elimination campaign faces challenges in areas near international bordersSubstantial gains have been made in reducing the number of malaria cases and eliminating indigenous malaria in Yingjiang County. Sustaining elimination and preventing the re-establishment of malaria require the strengthening of case detection, surveillance and response system targeting migrant populations in border areas.. The land area of Yingjiang County is 4429 km2, with a local population of 316,990 people. Yingjiang County is mountainous with several alluvial plains. The county has various climate types, ranging from tropical to subtropical and temperate zones, and has an average annual temperature of 22.7 °C and annual rainfall of 2.65 m. Intact forests exist in the mountains above 2000 m. The elevation varies from 210 to 3404 m. The county is within a very active seismic zone and was affected by violent earthquakes in 2008, 2009 and 2011. Migration, plantation and logging activities are frequent along the border42. An. sinensis and An. minimus are reported to be the dominant vectors for malaria parasites43.Yingjiang County is located in western Yunnan Province . It shares a long border with Kachin State, Myanmar and had the highest risk of malaria transmission in Yunnan Province , or PCR, or clinically diagnosed malaria, which referred to patients with malaria–like signs and symptoms but without the detection of parasites on blood examination46. Malaria case data from 15 townships were extracted to map the malaria distribution at the township level. In addition, according to the Technical Program for Malaria Elimination in China47, indigenous malaria was defined as malaria infection obtained from within the province in which the diagnosis was made, while imported malaria was defined as malaria whose origin can be traced to a transmission area outside the province in which the malaria diagnosis of malaria was made; moreover, the following criteria for imported malaria was also applied: the patient has received a malaria diagnosis; the patient had a travel history to a malaria-endemic area outside China during the malaria transmission season; and the onset time for malaria was less than 1 month after returning to China during the local transmission season.Malaria case data and demographic information, including sex, age, occupation, residential address, type of disease, date of onset, and date of confirmation were collected from the web-based Chinese Infectious Disease Report System (CIDRS) from 2013 to 2019www.R-project.org)48 and SAS software  were used for data processing and statistical analysis. The chi-squared test was used to evaluate differences among the different sub-groups; Fisher's exact test was used if 25% of the cells had expected counts less than 5. Maps were created using ArcGIS 10.1 . The indicators used to evaluate the implementation of the “1–3–7” approach were determined from the individual case reports downloaded from the CIDRS. A P value < 0.05 was considered statistically significant.R software (Version 4.0.3; R Core Team, Vienna, Austria, 2020; This study has been approved by the Ethical Review Committee of National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, No. 2019008.Supplementary Information 1.Supplementary Information 2."}
{"text": "Peripheral inflammatory conditions, including those localized to the gastrointestinal tract, are highly comorbid with psychiatric disorders such as anxiety and depression. These behavioral symptoms are poorly managed by conventional treatments for inflammatory diseases and contribute to quality of life impairments. Peripheral inflammation is associated with sustained elevations in circulating glucocorticoid hormones, which can modulate central processes, including those involved in the regulation of emotional behavior. The endocannabinoid (eCB) system is exquisitely sensitive to these hormonal changes and is a significant regulator of emotional behavior. The impact of peripheral inflammation on central eCB function, and whether this is related to the development of these behavioral comorbidities remains to be determined. To examine this, we employed the trinitrobenzene sulfonic acid-induced model of colonic inflammation (colitis) in adult, male, Sprague Dawley rats to produce sustained peripheral inflammation. Colitis produced increases in behavioral measures of anxiety and elevations in circulating corticosterone. These alterations were accompanied by elevated hydrolytic activity of the enzyme fatty acid amide hydrolase (FAAH), which hydrolyzes the eCB anandamide (AEA), throughout multiple corticolimbic brain regions. This elevation of FAAH activity was associated with broad reductions in the content of AEA, whose decline was driven by central corticotropin releasing factor type 1 receptor signaling. Colitis-induced anxiety was reversed following acute central inhibition of FAAH, suggesting that the reductions in AEA produced by colitis contributed to the generation of anxiety. These data provide a novel perspective for the pharmacological management of psychiatric comorbidities of chronic inflammatory conditions through modulation of eCB signaling. In peripheral inflammatory conditions, such as inflammatory bowel diseases (IBD), comorbid anxiety and depression are associated with increased disease activity, greater rate of relapse and reduced responsiveness to therapies –5, signiPeripheral inflammation, particularly within the gut, is known to be a potent activator of the hypothalamic-pituitary-adrenal (HPA) axis , 38. SusConstitutive eCB signaling constrains anxiety, as acute pharmacological disruption of eCB function rapidly produces a state of anxiety –46. SimiTo further examine the relationship between eCBs and peripheral inflammation, we utilized a rat model of colitis to investigate the potential role that the eCB system plays in the mechanisms underlying psychiatric comorbidity in chronic inflammatory diseases. Colitis represents an ideal condition for this investigation, as humans afflicted with colitis exhibit considerable psychiatric comorbidities, particularly anxiety –5, and aad libitum access to food and water. All experiments were conducted during the light phase of the cycle. All animal protocols were approved by the University of Calgary Animal Care Committee and followed guidelines from the Canadian Council for Animal Care. For each set of experiments described below, animals from a minimum of 2, and up to 4, cohorts were used, aside from locomotor activity which was assessed in a single cohort.All experiments utilized adult (~300–350 g at time of colitis induction), male or female, Sprague Dawley rats from Charles River . Animals were allowed to acclimate for at least one week prior to experiment onset. Rats were paired-housed under specified pathogen free conditions on a 12:12 h light/dark cycle with Under brief isoflurane anesthesia, rats received an intracolonic bolus of 2,4,6-trinitrobenzenesulfonic acid (TNBS) , via a cannula, inserted 7 cm proximal to the anus –77. TNBSAmbulatory activity was assessed using the Opto-Varimex-5 Auto Track  infrared beam activity monitor with a 17.5”x17.5” arena as previously described . Day 0 tAnimals were subjected to handling and body weight measurement in the behavior testing room at least 5 days prior to anxiety testing. EPM  testing occurred on Day 7 following colitis induction under dim light and with a white noise background. EPM was performed for 5 min as previously described  and is dAfter behavioral experiments were completed on Day 7 after the induction of colitis, trunk blood was collected as previously described , 84 and Excisions of brain structures were performed on ice as described previously  and sampBrain structures were excised on ice  and samp3H]-AEA to [3H]-ethanolamine [3H]-2-oleoylglycerol (2-OG) to [3H]-glycerol ) or a FAAH inhibitor (PF-04457845 (PF); Pfizer, New York, NY, USA; 100 ng and 1 µg) [As global FAAH inhibition is associated with suppression of colonic inflammation –97, we and 1 µg) –100. Inf−1, subcutaneously)) treatment, the unilateral cannula was placed into the lateral ventricle, −0.90 mm anteroposterior and 1.4 mm mediolateral from Bregma, and the pump was placed subcutaneously. Surgeries were performed on the same day, but prior to, TNBS or saline administration. One week following surgery and colitis onset, brain regions were isolated as described above for eCB analysis. Ventricular cannula placement was confirmed post-mortem with dye infusion.To understand the role of CRF signaling on the colitis-induced reductions of AEA signaling, we examined the impact of sustained disruption of CRF-R1 signaling during the entire duration of colitis  utilizing continuous drug infusion with an osmotic mini-pump  connected to a 5 mm cannula  . The osmt tests were used . For comparison of repeated measures, a repeated measure analysis of variance (ANOVA) or mixed-effect analysis was performed. For comparisons between two independent variables, two-way ANOVAs were performed. For all ANOVA analyses, significant interactions and main effects were reported, and specific group comparisons were made using Fisher’s Least Significant Difference tests. Planned comparisons based on a priori hypothesis were performed using independent t tests. t- or F-values, p values and eta squared (R2) are reported, as well as Pearson correlation coefficients (r) . Data are presented as mean ± standard error of the mean (SEM). Outliers were removed using the ROUT method [p < 0.05 was considered statistically significant. Detailed statistics for data represented in figures, as well as correlation values, are reported in Tables All statistics were carried out using Prism v8. For comparison of two groups, one-tailed  or two-tailed Student’s T method , set to T method . p < 0.0Data presented on colitis phenotype , in the amygdala and medial prefrontal cortex, but not in the hypothalamus or hippocampus   Table  in the amax; Fig. m  acutely at two doses and examined anxiety-like behavior in the EPM in order to investigate the relevance of changes in eCB levels to the increase in anxiety-like behavior.Open arm time was reduced with TNBS-induced colitis and increased with administration of the FAAH inhibitor Fig. . Based oMacroscopic damage of the colon was increased in TNBS-treated rats, but this was lower in the 1 µg PF dose compared to its vehicle Fig. . SpecifiAs increased FAAH activity was found to contribute to the generation of colitis-induced anxiety, and given previous work that showed that activation of CRF-R1 can induce FAAH hydrolysis of AEA during psychological stress , 106, weWe investigated if blocking central CRF-R1 with an antagonist, antalarmin, for the 7-days post-TNBS administration altered colitis-induced changes in AEA levels. While this caused no changes to TNBS-induced increases in macroscopic tissue damage Table , antalarp > 0.05)  in 2-AG levels in any of these areas  Fig.  were noteas Fig. . Unlike We demonstrate that the TNBS-model of colitis in rats, consistent with other rodent models of colitis , 107–109Endocannabinoid signaling is well established to regulate affective behavioral processes such as anxiety through actions localized within the amygdala, medial prefrontal cortex and hippocampus , 110. ThRecent work from our group shows that both male and female mice exhibit anxiety-like behavior in a dextran sulfate sodium model of colitis . Here weCrh [Crh expression in rodent models of gut inflammation [The finding that CRF-R1 activity mediates the colitis-induced reduction in AEA content broadens previous work indicating that CRF and FAAH exhibit an intricate relationship in the regulation of affective behavior , 106. ChCrh , 106. InCrh , 115. CoCrh , 117 shoammation , 69, 89.ammation , this efAn unexpected finding of this study was that acute central inhibition of FAAH reduced the severity of colitis. Endocannabinoids are well-established anti-inflammatory molecules , 119, anIn addition to reduced AEA, we also found that colitis was associated with elevations in 2-AG throughout several corticolimbic structures ; Alberta Innovates Health Solutions (AIHS) CRIO Project 201200828-QJP, KAS. HAV received stipend funding from CIHR (Vanier CGS), University of Calgary , AIHS and Branch Out Neurological Foundation (BONF); MM received fellowship support from AIHS and CIHR; VC received a studentship from UofC; KT received studentships from the National Sciences and Engineering Research Council (NSERC) and AIHS; KL received a studentship from BONF; AS received salary support from the UofC Mathison Centre for Mental Health Research and Education. MNH is the recipient of a Tier II Canada Research Chair. KAS holds the Crohn’s and Colitis Canada Chair in IBD Research at the UofC. Funding agencies had no influence on the design, execution or publishing of this work. MNH is a scientific advisor for Sophren Therapeutics and Lundbeck. All other authors have no disclosures to report.SupplementalSupplemental Table 1Supplemental Table 2Supplemental Table 3Supplemental Table 4Supplemental Figure 1"}
{"text": "This editorial summarizes the contributions to the Frontiers Research topic “Innovative Analysis Ecosystems for HEP Data”, established under the Big Data and AI in High Energy Physics section and appearing under the Frontiers in Big Data and Frontiers in Artificial Intelligence journals. High energy physics (HEP) experiments are collecting an unprecedented amount of data. Major upgrades of the current HEP experiments already in progress will further increase the volume and complexity of these data. This new territory of extremely large data is inspiring and challenging physicists to devise new and more advanced analysis techniques, which feature increasingly more elaborate procedures such as machine learning and deep neural networks, to maximize the physics outcome of these studies. These developments, which will have a growing impact on HEP in the coming years, require fast and efficient analysis ecosystems and state-of-the-art hardware infrastructures. Exploiting recent advancements in data science and machine learning has already led to a significant leap in HEP data analysis. It is therefore of high interest to continue in this effect to maximize the impact of these new techniques in HEP.This research topic aimed to explore recent developments in this area with a focus on 1) innovative, user-friendly and preservable analysis frameworks and dedicated languages describing analysis algorithms, 2) fast analyses on high performance computing centers (HPCs) using modern parallelization techniques, and 3) development of analysis infrastructures based on optimization pipelines and new data formats, which can be efficiently interfaced to machine learning utilities.Šimko et al. explored a novel approach for experimental HEP data analyses based on a declarative rather than imperative paradigm to describe the analysis computational workflow. In this study, the analysis process is structured in the form of a Directed Acyclic Graph, with graph vertices representing a computation unit with its inputs and outputs, and graph edges describing the interconnections of different computational steps. The REANA analysis platform featured here allows one to express the computational analysis steps based on the declarative paradigm implemented via the Yadage workflow specification language. REANA parses the analysis workflow and dispatches its computational steps to various supported computing backends . The approach was tested on two analysis examples from the LHC: 1) reinterpretation of a search for dark matter production in association with a Higgs boson decaying to One study, Mosciatti et al., focused on improving the effectiveness of software containers which provide all dependencies needed to run a software workload independently on a host environment, enabling full reproducibility of the workloads and consequently their analysis content and results. Containers are extremely important at the LHC where software environments and operating systems become quickly outdated. One issue is that, the increase in the complexity of analysis software increases the size of container hosting the analysis, making its download and execution unpractical and slow. The study explored a new method to speed up the container download and execution by combining the so-called lazy pulling method, which allows to download image data as needed, and cache on demand in the CERN Virtual Machine File system (CVMFS). This method, which is implemented in the Kubernetes platform, reduces the container start time by at least a factor two compared to the standard download utilities.A second study Unel et al., focused on techniques to effectively express the physics content of HEP data analyses. It features a domain-specific, declarative language called Analysis Description Language (ADL) that describes the contents of an analysis in a standard and unambiguous way, independent of any computing framework. ADL can be used by experimental and phenomenological communities to facilitate the abstraction, design, visualization, validation, combination, reproduction, interpretation, overall communication and long-term preservation of analysis contents. In ADL, analyses are written in plain text files consisting of blocks separating object, variable and event selection definitions. Blocks have a keyword-expression structure, where keywords specify analysis concepts and operations. Syntax includes mathematical and logical operations, comparison and optimisation operators, reducers, four-vector algebra and commonly used functions. Analyses written in ADL can be executed on event data either via converting ADL to a compilable code by a transpiler, or via direct runtime interpretation. This study described recent advancements in ADL and in particular CutLang, a runtime interpreter of ADL.Another study Diblen et al., presents works on building a versatile vizualization tool of scientific data that allows analysis of data over the web. The study features SPOT, a tool that can be interfaced to scientific repositories such as Zenodo and HEPData. The main aim of the tools presented here is the quick and convenient re-analysis and comparisons of phenomenological data, which may lead to finding new correlations in published data. SPOT can create 1-3 dimensional visualisations by creating histograms of high-dimensional datasets, and perform interpolation to generalize data. The functionality was demonstrated and benchmarked using different examples that range from the visualization of the parameters of a 19-dimensional supersymmetry model dataset versus their exclusion status by the ATLAS experiment or their consistency with the galactic center excess model, and visualization of simulated LHC data and of the Fermi FL8Y Point Source Catalogue.Another study Adams, presented a new technique to remove background particles in events collected by the SBND detector, the near detector in the Fermilab Short-Baseline Neutrino Program, by applying deep learning on full detector images. The paper explored techniques to discriminate the origin of recorded activity to be from cosmic particles, neutrino interactions or background-noise at a single pixel level using deep convolutional neural networks on simulated data from the SBND LArTPC detector. Various DNNs were designed and different metrics were considered to optimize the prediction accuracy. The technique developed is applicable to other LArTPC detectors running at surface level, such as MicroBooNE, ICARUS and ProtoDUNE.Machine learning methods are becoming more central in HEP data analysis due to their extensive discrimination and regression powers. Another study"}
{"text": "Background: The aim of the study was to perform a functional and structural evaluation of the anterior visual pathway in patients with Graves’ Orbitopathy (GO) using electrophysiological tests and OCT, as well as to identify potential parameters that could be useful in detecting early optic nerve damage. Methods: 47 GO patients were enrolled in the study and divided into three groups, depending on their disease severity: Group 1 with mild GO, Group 2 with moderate-to-severe GO, and Group 3 with dysthyroid optic neuropathy (DON). Pattern visual evoked potential (PVEP), flash visual evoked potential (fVEP), pattern electroretinogram (pERG), and optical coherence tomography (OCT) findings were compared between the groups. Results: In the DON Group (Group 3), N75, P100, and P2 latencies were significantly extended, whereas P100, P50, and N95 amplitudes were significantly reduced as compared to the non-DON group (Groups 1 and 2). Group 3 also had significantly thinner peripapillary retinal nerve fiber layer (RNFL) and macular ganglion cell complex (GCC). In Group 2, as compared to Group 1, P100 amplitudes were significantly reduced for all check sizes, while P100 latency was elongated for the check size of 0.9°. Group 2 also had a significantly thinner average GCC and GCC in the superior quadrant. Conclusions: Electrophysiological examinations may be of use in diagnosis of DON. OCT findings and electrophysiological responses vary in patients with different GO severity. Including regular electrophysiological evaluation and OCT in the examination of patients with GO could be of benefit. However, more research is needed to establish the true significance of pVEP, fVEP, pERG, and OCT in monitoring patients with GO. Graves’ Orbitopathy (GO) is the most common extrathyroidal expression of Graves’ disease (GD). It is an autoimmune, antibody-mediated disorder leading to the inflammation and remodeling of orbital tissues. Excessive production of glycosaminoglycans (GAGs), adipogenesis, oedema, and inflammatory infiltration induce muscle enlargement and orbital fat expansion within the constrained space of the orbit. This process may result in apical crowding and in the direct compression of the optic nerve or its blood supply .Dysthyroid optic neuropathy (DON) is a rare condition with an insidious onset, affecting approximately 5–8% of patients with Graves’ Orbitopathy. It requires urgent management as it can potentially lead to irreversible visual loss ,3. A thoThe objective of our research was to perform a functional and morphological examination of the visual pathway in patients with Graves’ Orbitopathy using pVEP, fVEP, pERG, and OCT, as well as to compare the results in patients with different degrees of severity of the disease.47 patients with Graves’ Orbitopathy were enrolled in the study, including 13 men (28%) and 34 women (72%). The patients’ mean age was 52.1 years ± 14.8 SD. The research protocol was approved by the Jagiellonian University Bioethical Committee  and the study adhered to the tenets of the Declaration of Helsinki. All patients signed a written informed consent. The exclusion criteria were other ocular diseases, high myopia greater than—6.0 D, intraocular pressure above 21 mmHg, neurological diseases , diabetes with polyneuropathy or diabetic retinopathy, and other diseases that could have an impact on electrophysiological or OCT examinations. The ophthalmological examination included visual acuity assessment, color vision assessment using Ishihara tables, tonometry, biomicroscopic anterior segment examination, cover test and Hess’s screen, indirect fundus examination, Hertel exophthalmometry, and manual kinetic Goldmann perimetry. GO severity was evaluated according to the European Group on Graves’ Orbitopathy (EUGOGO) classification  [17]. PaOptical coherence tomography was performed after pupil dilation. An RTVue OCT device  was used. An RNFL scan of 3.45 diameters, centered on the optic nerve head, was performed. The analysis of the peripapillary retinal nerve fiber layer thickness was presented in µm as Average RNFL, Superior RNFL, and Inferior RNFL.The greatest number of ganglion cells is found in the central 8 degrees of the retina; therefore, a macular ganglion cell complex (GCC) analysis was performed. The GCC consists of 3 layers of the retina, i.e., the retinal nerve fiber layer, the retinal ganglion cell layer, and the inner plexiform layer. The GCC protocol comprised 15 vertical scans and 1 horizontal scan covering an area of 7 by 7 mm, localized 1mm temporally from the macula. The analysis of GCC thickness was presented in µm as Average GCC, Superior GCC, and Inferior GCC. Additionally, the Focal Loss Volume (FLV) and Global Loss Volume (GLV) were analyzed.The patients were divided according to the EUGOGO severity classification: into mild (Group 1), moderate-to-severe (Group 2), and sight-threatening (Group 3). The groups comprised 16, 23, and 8 patients, respectively. We compared the results of electrophysiological examinations and OCT of patients with no clinical evidence of DON (Groups 1 and 2) with patients with confirmed DON (Group 3). Subsequently, we compared patients with mild GO (Group 1) with patients with moderate-to-severe GO (Group 2) in terms of their electrophysiological responses and OCT parameters.t-test and Mann–Whitney’s u-test (for independent samples).A Student’s t-test for independent samples was used to test differences between groups of patients. To test if the variances of two populations are equal, an F-test for equality of two variances was used additionally. Age and sex differences of patients between the groups were estimated using Student’s p = 0.2402 and p = 0.0771, respectively)The non-DON Group (Groups 1 and 2) comprised of 39 patients (9 men and 30 women). The mean age of patients in this group was 50.4 ± 14.7. Group 3 comprised 8 patients (4 men and 4 women). The mean age of patients in this group was 60.5 ± 12.8. The differences between the groups in terms of patients’ sex and age were statistically insignificant  with GO patients with no clinical evidence of DON (Groups 1 and 2). The comparison revealed a significant increase in N75 and P100 latencies for all check sizes and a significant reduction of P100 amplitudes for all check sizes except for check size of 1.5° in Group 3 . The difp = 0.0001) in the DON group (Group 3) and in the non-DON Group (Groups 1 and 2), respectively. There was no statistically significant difference in the P2 amplitude between the two groups (10.1 ± 7.0 vs. 12.0 ± 6.5 p = 0.2828).As for fVEP, the mean latency of P2 was 133.4 ± 16 ms vs. 118.0 ± 13.7 ms . The mean age of patients in this group was 47.1 ± 16.2.p = 0.0420), which was to be expected since men tend to have more severe GO. The percentage of men in the groups in this study increased along with GO severity. The age differences between the groups were statistically insignificant (p = 0.2490).Group 2 comprised of 23 patients (8 men and 15 women). The mean age of patients in this group was 52.7 ± 13.5. There were more men in Group 2 . Our results are in contradiction to those of Tsaloumas et al., who reported no difference in P2 latency between the DON and thyroid-associated orbitopathy (TAO) groups (112.0 ± 4.46 ms vs. 110.1 ± 2.65 ms) but found a significantly smaller P2 amplitude in DON patients (6.83 ± 0.92 ms vs. 12.4 ± 1.05 µV). Tsaloumas et al. admitted, however, that in their study, reductions in amplitude occurred more frequently than delays as compared to other studies [A visual evoked potential is produced by activated neurons of the occipital cortex. It is generated in response to visual stimulation: a flashing light (fVEP) or an alternating checkboard pattern (pVEP). The fVEP consists of several positive and negative components, among which P2 is the most commonly used in clinical assessment. We found a significantly prolonged P2 latency in patients with dysthyroid optic neuropathy, as compared to GO patients without evident signs of DON (133.4 ± 16 ms vs. 118.0 ± 13.7 ms), but we did not find any differences in P2 amplitudes between the groups  has an impact on pVEP responses . Some auThe pattern visual evoked potential is not specific to optic nerve damage as it depends on good macular function. Pattern electroretinogram is a complementary technique to visual evoked potentials. It enables simultaneous assessment of retinal ganglion cell and macular function. The P50 component of the pERG is generated by inner- and outer-retinal neurons, whereas the N95 component represents retinal ganglion cell function ,30. To tWe found significantly reduced P50 and N95 amplitudes in patients with DON as compared to GO patients without confirmed DON. The P50 latency was significantly prolonged, whereas the N95 latency was reduced in those patients. The differences in latencies, however, were much less pronounced than those in amplitudes  and wereIn patients with DON, a significant reduction in P50 amplitude may be secondary to retrograde damage of the retinal ganglion cells or may be due to ischemic changes in the outer retinal layers. The elongated P50 latency, which is characteristic of macular involvement, is more suggestive of the latter ,36. We cOur analysis of OCT parameters in GO patients revealed that patients with DON had a significantly thinner average peripapillary RNFL, as well as RNFL in the upper and lower quadrants. Our results are in agreement with the study by Park et al., who reported a significantly smaller mean temporal peripapillary RNFL thickness in patients with long-lasting DON (≥6 months) in comparison to healthy controls and patients with acute DON . In contWhen comparing the macular ganglion cell complex in DON patients and in GO patients without any clinical signs of DON, we found significant differences in all the parameters. The average GCC, as well as inferior and superior quadrant GCC, were significantly thinner in DON patients. Both the foveal loss volume (FLV) and the global loss volume (GLV) were significantly increased in DON patients. Our results are in line with the study by Romano et al., who compared patients with optic nerve compression due to GO with normal controls and found a significantly thinner average GCC, inferior GCC, as well as significantly thinner RNFL in the superior and inferior quadrant in the first group . Since tOrbital MRI was not performed in each patient, which is a limitation of this study as such scans would have revealed the factors which contributed to the changes found in the electrophysiological tests. Moreover, an additional comparison with a healthy control group would have given us a more complete picture of the morphological and functional changes in patients with GO.Dysthyroid optic neuropathy may have an insidious onset. Hence, assessing optic nerve function in electrophysiological examinations may be of use in the diagnosis of DON. In our study, we observed significantly reduced P100, P50, and N95 amplitudes, as well as significant increased N75, P100, and P2 latencies in patients with DON. Combining pVEP with pERG may be helpful in distinguishing between changes resulting from macular and ganglion cell dysfunction. fVEP may be useful in patients with severe eye surface disorders and corneal or lens opacities. Previous studies have shown that changes in electrophysiological and OCT results are likely to be present in GO patients without clinical signs of DON. In this study, patients with moderate-to-severe GO had significantly reduced P100 amplitudes, a significantly longer P100 latency for the check size of 0.9°, and reduced average and superior GCC thickness as compared to patients with mild GO. Therefore, we conclude that electrophysiological responses and OCT parameters vary in patients with different GO severity. Including regular electrophysiological evaluation and OCT in the examination of patients with GO could be of benefit. However, more research is needed to establish the true significance of pVEP, fVEP, pERG, and OCT in monitoring patients with GO."}
{"text": "Automatic personality trait recognition has attracted increasing interest in psychology, neuropsychology, and computer science, etc. Motivated by the great success of deep learning methods in various tasks, a variety of deep neural networks have increasingly been employed to learn high-level feature representations for automatic personality trait recognition. This paper systematically presents a comprehensive survey on existing personality trait recognition methods from a computational perspective. Initially, we provide available personality trait data sets in the literature. Then, we review the principles and recent advances of typical deep learning techniques, including deep belief networks (DBNs), convolutional neural networks (CNNs), and recurrent neural networks (RNNs). Next, we describe the details of state-of-the-art personality trait recognition methods with specific focus on hand-crafted and deep learning-based feature extraction. These methods are analyzed and summarized in both single modality and multiple modalities, such as audio, visual, text, and physiological signals. Finally, we analyze the challenges and opportunities in this field and point out its future directions. The trait theory  and linear regressors, are usually used. In this survey, we focus on the advances of feature extraction algorithms ranging from 2012 to 2022 in a basic personality trait recognition system. In this work, our contributions can be summarized as follows:We provide an up-to-date literature survey on deep personality trait analysis from a perspective of both single modality and multiple modalities. In particular, this work focuses on a systematical single and multimodal analysis of human personality. To the best of our knowledge, this is the first attempt to present a comprehensive review covering both single and multimodal personality trait analysis related to hand-crafted and deep learning-based feature extraction algorithms in this field.We summarize existing personality trait data sets and review the typical deep learning techniques and its recent variants. We present the significant advances in single modality personality trait recognition related to audio, visual, text, etc., and multimodal personality trait recognition related to bimodal and trimodal modalities.We analyze and discuss the challenges and opportunities faced to personality trait recognition and point out future directions in this field.The remainder of this paper is organized as follows. Section “Personality Trait Databases” describes the available personality trait data sets. Several typical deep learning techniques and its recent variants are reviewed in detail in Section “Review of Deep Learning Techniques.” Section “Review of Single Modality Personality Trait Recognition Techniques” introduces the related techniques of single modality personality trait recognition. Section “Multimodal Fusion for Personality Trait Recognition” provides the details of multimodal fusion for personality trait recognition. Section “Challenges and Opportunities” discusses the challenges and opportunities in this field. Finally, the conclusions are given in Section “Conclusion.”To evaluate the performance of different methods, a variety of personality trait data sets, as shown in The SSPNet  speaker The Emergent LEAder ELEA;  data setThe SEMAINE  audio-viThe YouTube Vlogs  data setThe ChaLearn First Impression data set has been developed into two versions: the ChaLearn First Impression V1 , and theThe multimodal human–human–robot interactions MHHRI;  data setThe understanding dyadic interactions from video and audio signals UDIVA;  data setFrom In recent years, deep learning techniques have been an active research subject and obtained promising performance in various applications, such as object detection and classification, speech processing, natural language processing, and so on . In esseDeep belief networks DBNs;  developeSeveral improved versions of DBNs are developed in recent years. Convolutional neural networks (CNNs) were originally proposed by In recent years, several advanced versions of deep CNNs have been presented in various applications. The representative deep CNN models include AlexNet , VGGNet Compared with the above-mentioned deep CNNs processing 2D images, the recently developed 3D-CNNs  aim to lRecurrent neural networks RNNs;  are a siLong short-term memory LSTM; , proposeIn recent years, a variant of LSTMs called gated recurrent unit GRU; , was devAutomatic personality trait recognition aims to adopt computer science techniques to realize the modeling of personality trait recognition problems in cognitive science. It is one of the most important research subjects in the field of personality computing . AccordiThe early-used audio features for automatic personality trait recognition are hand-crafted low-level descriptive (LLD) features, such as prosody , voice quality (formants), spectral features , and so on. Specially, The recently used audio features for automatic personality trait recognition are deep audio features extracted by deep learning techniques. According to the type of vision-based input data, visual-based personality trait recognition can be categorized into two types: static images and dynamic video sequences. Visual feature extraction is the key step related to the input static images and dynamic video sequences for personality trait recognition. As far as static image-based personality trait recognition is concerned, researchers have found that a facial image presents most of meaningful descriptive cues for personality trait recognition . Hence, via fine-tuning a pretrained VGG-face model for feature learning so as to predict personality traits and intelligence jointly. They aimed to explore whether self-reported personality traits and intelligence can be jointly measured from facial images. In recent years, CNNs were also widely used for facial feature extraction on static image-based personality trait recognition tasks. Dynamic video sequences consist of a series of video image frames, thereby providing temporal information and scene dynamics. This brings about certain useful and complementary cues for personality trait analysis .In , the autIn consideration of the tremendous progress in the areas of deep learning, CNNs and LSTMs are widely for personality trait analysis from dynamic video sequences. In addition to the above-mentioned audio and visual modality, there are other single modalities, such as text, and physiological signals, etc., which can be applied for personality trait recognition. The text modality can effectively display traces of the user’s personality . One of via deep learning, which integrated semantic and emotional features from social media texts. They conducted sentence-level extraction of both semantic and emotion features by means of a BERT model and a SentiNet5 . As the simplest way of implementing feature integration, feature-level fusion has relatively low cost and complexity. Moreover, it considers the correlation between modalities. However, integrating different time scale and metric level of features from multimodal modalities will significantly increase the dimensionality of the concatenated feature vector, resulting in the difficulty of training models.In decision-level fusion, each modality is firstly modeled independently, and then these obtained results from single-modality are combined to produce final results by using a certain number of decision fusion rules. Decision-level fusion is thus called late fusion (LF). The commonly used decision fusion rules include “Majority vote,” “Max,” “Sum,” “Min,” “Average,” “Product,” etc. . Since dModel-level fusion aims to separately model each modality while taking into account the correlation between modalities. Therefore, it can consider the inter-correlation among different modalities and loose the demand of timing synchronization of these modalities.For bimodal modalities based personality trait recognition, the widely used one is audio-visual modality. In order to effectively extract audio-visual feature representations of short video sequences, numerical studies have been conducted for audio-visual personality trait recognition.Zhang et al., developed a deep bimodal regression (DBR) method so as to capture rich information from the audio and visual modality in videos . Figure via concatenation of their obtained latent features. For text modality, two language models, such as a skip-thought vector model and a bag-of-words model, were employed for text feature extraction. Finally, a concatenation of audio, visual, text-based latent features was implemented at feature-level for multimodal first-impression analysis.Escalante et al. explored the explainability in first impressions analysis from video sequences at the first time. They provided a baseline method of integrating audio, visual, and text (audio transcripts) information . They usn-gram CNN model, respectively. These extracted audio, visual, and text features were fed into a fully connected layer followed by a sigmoid function for the final personality trait prediction. It was concluded that the concatenation of audio, visual, and text features in feature-level fusion showed comparable performance with the averaging method in decision-level fusion.To date, although there are a number of literature related to multimodal personality trait prediction, showing its certain advance, a few challenges still exist in this area. In the following, we discuss these challenges and opportunities, and point out potential research directions in future.Although researchers have developed a variety of relevant data sets for personality trait recognition, as shown in In addition, owing to the difference of data collecting and annotating environment, data bias and inconsistent annotations usually exist among these different data sets. Most researchers conventionally verify the performance of their proposed methods within a specific data set, resulting in promising results. Such trained models based on intra-data set protocols commonly lack generalizability on unseen test data. Therefore, it is interesting to investigate the performance of multimodal personality trait recognition methods in cross-data set environment. To address this issue, deep domain adaption methods  may be aFor multimodal personality trait recognition, bimodal modalities like audio-visual, or trimodal modalities like audio, visual, and text, are usually employed. Note that the user’s physiological responses to affective stimuli are highly correlated with personality traits. However, few researchers explore the performance of integrating physiological signals with other modalities for multimodal personality trait recognition. This is because so far these are few multimodal personality trait recognition data sets, which incorporate physiological signals with other modalities. Hence, one may challenge is how to combine physiological signals and other modalities, such as audio, visual, and text clues, based on the corresponding developed multimodal data sets.Besides, other behavior signals, such as head and body pose information, which is related to personality trait clues , may preSo far, a variety of representative deep leaning methods have been successfully applied to learn high-level feature representations for automatic personality trait recognition. Moreover, these deep learning methods usually beat other methods adopting hand-crafted features. Nevertheless, these used deep learning techniques have a tremendous amount of network parameters, resulting in its large computation complexity. In this case, for real-time application sceneries it is often difficult to implement fast automatic personality trait prediction with these complicated deep models. To alleviate this issue, a deep model compression  may presAlthough deep learning has become a state-of-the-art technique in term of the performance measure on various feature learning tasks, the black box problem still exists. In particular, it is unknown that what exactly are various internal representations learned by multiple hidden layers of a deep model. Owing to its multilayer non-linear structure, deep learning techniques are usually criticized to be non-transparent, and their prediction results are often not traceable by human beings. To alleviate this problem, directly visualizing the learned features has become the widely used way of understanding deep models . Neverthvia the Big-Five personality model. This is because almost all of the current data sets were developed based on the Big-Five personality measures, as shown in It is noted that most researchers focus on personality trait analysis Due to the strong feature learning ability of deep learning, multiple recent works using deep learning have been developed for personality trait recognition associated with promising performance. This paper attempts to provide a comprehensive survey of existing personality trait recognition methods with specific focus on hand-crafted and deep learning-based feature extraction. These methods systematically review the topic from the single modality and multiple modalities. We also highlight numerous issues for future challenges and opportunities. Apparently, personality trait recognition is a very broad and multidisciplinary research issue. This survey only focuses on reviewing existing personality trait recognition methods from a computational perspective and does not take psychological studies into account on personality trait recognition.In future, it is interesting to explore the application of personality trait recognition techniques to personality-aware recommendation systems . In addiXZ contributed to the writing and drafted this article. ZT contributed to the collection and analysis of existing literature. SZ contributed to the conception and design of this work and revised this article. All authors contributed to the article and approved the submitted version.This work was supported by Zhejiang Provincial National Science Foundation of China and National Science Foundation of China (NSFC) under Grant Nos. LZ20F020002, LQ21F020002, and 61976149.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Recently, personality trait recognition, which aims to identify people’s first impression behavior data and analyze people’s psychological characteristics, has been an interesting and active topic in psychology, affective neuroscience and artificial intelligence. To effectively take advantage of spatio-temporal cues in audio-visual modalities, this paper proposes a new method of multimodal personality trait recognition integrating audio-visual modalities based on a hybrid deep learning framework, which is comprised of convolutional neural networks (CNN), bi-directional long short-term memory network (Bi-LSTM), and the Transformer network. In particular, a pre-trained deep audio CNN model is used to learn high-level segment-level audio features. A pre-trained deep face CNN model is leveraged to separately learn high-level frame-level global scene features and local face features from each frame in dynamic video sequences. Then, these extracted deep audio-visual features are fed into a Bi-LSTM and a Transformer network to individually capture long-term temporal dependency, thereby producing the final global audio and visual features for downstream tasks. Finally, a linear regression method is employed to conduct the single audio-based and visual-based personality trait recognition tasks, followed by a decision-level fusion strategy used for producing the final Big-Five personality scores and interview scores. Experimental results on the public ChaLearn First Impression-V2 personality dataset show the effectiveness of our method, outperforming other used methods. In personality psychology, researchers believe that human personality is innate, and have developed various theoretical methods to understand and measure a person’s personality. In recent years, researchers have employed computational techniques such as machine learning and deep learning methods  to modelIn a basic personality trait recognition system, two important steps are involved: feature extraction and personality trait classification or prediction . FeatureAccording to the types of extracted features characterizing personality traits, personality trait recognition techniques can be divided into hand-crafted based methods and deep learning based methods. Based on the extracted hand-crafted or deep learning features, previous works  focus onTo address these two issues above-mentioned, this paper proposes a multimodal personality trait recognition method integrating audio and visual modalities based on a hybrid deep learning framework. As depicted in The main contributions of this paper are summarized as follows:(1)This paper proposes a multimodal personality trait recognition method integrating audio and visual modalities based on a hybrid deep learning framework, in which CNN, Bi-LSTM, and Transformer are combined to capture high-level audio-visual spatio-temporal feature representations for personality trait recognition.(2)Extensive experiments are performed on the public ChaLearn First Impressions-V2 dataset and experimental results show that the proposed method outperforms other comparing methods on personality trait recognition tasks.The majority of prior works for personality trait recognition concentrates on single modality such as audio or visual cues, as described below.In early works, the conventional extracted hand-crafted audio features are low-level descriptor (LLD) features including intensity, pitch, formants, Mel-Frequency Cepstrum Coefficients (MFCCs), and so on. In recent years, researchers have tried to leverage deep learning  models wIn terms of the input type of visual data, visual-based personality trait recognition can be divided into two groups: static images-based and dynamic video sequences-based personality trait recognition.For static images-based personality trait recognition, the extracted visual features mainly come from facial features, since facial morphology provides explicit cues for personality trait recognition. In early works, the commonly used hand-crafted facial features are color histograms, local binary patterns (LBP), global descriptor, aesthetic features, etc. For dynamic video sequences-based personality trait recognition, dynamic video sequences contain temporal information related to facial activity statistics, thereby providing useful and complementary cues for personality trait recognition . In earlTo alleviate the problem of single modality based personality trait recognition, this paper proposes a multimodal personality trait recognition method integrating audio and visual modalities based on a hybrid deep learning framework. For audio signals in the video data, we use the pre-trained VGGish model  to extraFor visual signals in the video data, two preprocessing tasks are implemented. For global scene images in a video, 100 scene images are selected at equal intervals form each original video sample. Then, the resolution of each global scene image is resampled from the original 1280×720 pixels to 224×224 as inputs of VGG-Face model . For locAudio-visual feature extraction aims to learn the local and global feature representations from original audio and visual signals in a video for personality trait recognition, as described below.For the divided audio segment with 0.96 s, we leverage the VGGish model  pre-traiFor each scene and face image in a video, we employ the VGG-Face model  pre-traii-th input video clip ai  and its corresponding Big-Five personality score yi, we fine-tune the pre-trained VGGish network  represents the output of the last full connected layer in the VGGish network. θVG and VGW separately denotes the network parameters of the VGGish network and the weights of the sigmoid layer. The cross-entropy loss function L is defined as:where ηyj is the j-th ground-truth Big-Five personality score, and where For deep visual scene and face feature extraction on each frame of video, we fine-tune the pre-trained VGG-Face network  to learnAfter completing the local audio and visual feature extraction tasks, it is necessary to individually learn the global audio features, visual scene features, and visual face features from the entire videos so as to conduct personality trait prediction tasks. To this end, we adopt the Bi-LSTM  and receet, the learning process of the Bi-LSTM network is:Given an input sequence E ∈ ℝd1× is the learned temporal features, and WBi–LSTM is weight parameters of Bi-LSTM.where Q), key (K), and value (V), the output of each SDPA module is defined as:The original Transformer  is develdk is the feature dimension of the key matrix K.where After obtaining audio-visual global features extracted by a Bi-LSTM model and a Transformer model, we adopt a linear regression layer to predict the Big-Five personality and interview scores. The linear regression layer is calculated as follows:xi, wi, and b represent the i-th input sample, the corresponding weight value, and bias, respectively. fi(x) is the i-th prediction score value.where As shown in i is the weight value, fi(x) is the predicted value of each type of features, and where αY is the ground-truth score. Our goal is to minimize the MSE loss subject to where where λ is the Lagrange multiplier.m for m = 1,2,⋯6, as defined as:Then, we calculate the partial derivation of Eq. 8 based on αWe set the gradient to be 0, and get:1,α2,α3,α4,α5,α6]T = E[(fi(X)−Y)(fj(X)−Y)], Eq. 10 can be transformed as:Let α = Then, the optimal weight vector α can be obtained by:To verify the effectiveness of the proposed method, the public ChaLearn First Impression-V2  is emploe−4. After each epoch, the learning rate will become a half of the original learning rate. The maximum epoch number of is 30, and the Adam optimizer is used. The MSE loss function is adopted. The experimental platform is NVIDIA GPU Quadro M6000 with 24 GB memory. In order to improve the generalization performance of trained deep learning models and avoid overfitting, the early stopping strategy  with polynomial (poly), radial basis function (RBF), and linear kernel functions, Decision Tree Regression (DTR) are employed. In the SVR model, the degree of polynomial kernel function is 3, the penalty factor “The evaluation metric for evaluating the predicted personality trait or interview scores is defined as:N is the number of samples, yj is the ground-truth value. The higher the value S is, the better the obtained performance on personality or interview prediction tasks is.where In this section, two groups of experiments are carried out on the ChaLearn First Impression-V2 data set to verify the effectiveness of all used methods. One is the single-modal personality trait recognition, the other is multi-modal personality trait recognition.For single-modal personality recognition, we present the experiment results and analysis based on the single extracted audio features, visual scene features, and visual face features by using the pre-trained deep models.In summary, the results in For multimodal personality recognition tasks, we compare the performance of three typical multimodal information fusion methods, such as feature-level fusion, decision-level fusion, and model-level fusion. In feature-level fusion, the audio-visual global features learned by Bi-LSTM and Transformer networks, are concatenated into a whole feature vector as input of the linear regression layer for personality trait prediction. In this case, feature-level fusion is also called early fusion (EF). In model-level fusion (MF), the concatenated audio-visual global features are fed into a 4-layer full-collection layer network (1024-512-256-128) for personality trait prediction. In decision-level fusion, we adopt Eq. 12 to obtain the analytical solution of the optimal weight values in Eq. 6. In this case, decision-level fusion is also called late fusion (LF).To further verify the effectiveness of the proposed method, This paper presents a multimodal personality trait recognition method based on CNN + Bi-LSTM + Transformer network. In this work, CNN, Bi-LSTM, and Transformer are combined to capture high-level audio-visual spatio-temporal feature representations for personality trait recognition. Finally, we compare multimodal personality prediction results based on three different fusion methods such as feature-level fusion, model-level fusion, and decision-level fusion. Experiments on the public ChaLearn First Impression-V2 dataset show that decision-level fusion achieves the best multimodal personality trait recognition results with an average score of 0.9167, outperforming other existing methods.It is noted that this work only focuses on integrating audio and visual modalities for multimodal personality trait recognition. Considering the diversity of modal information related to the expression of personality traits, it is interesting to combine current audio-visual modalities with other modalities such as physiological signals, text cues, etc., to further improve the performance of personality trait recognition. In addition, exploring a more advanced deep learning model for personality trait recognition is also an important direction in our future work.https://chalearnlap.cvc.uab.cat/dataset/24/description/.Publicly available datasets were analyzed in this study. This data can be found here: XZ contributed to the writing and drafted the article. YL, ZT, YX, XT, DW, and GW contributed to the data preprocessing and analysis, software and experiment simulation. HL contributed to the project administration and writing—reviewing and editing. All authors contributed to the article and approved the submitted version."}
{"text": "First Person is a series of interviews with the first authors of a selection of papers published in Disease Models & Mechanisms, helping early-career researchers promote themselves alongside their papers. Stanley ‘Michii’ Kanai is first author on ‘ How would you explain the main findings of your paper to non-scientific family and friends?PLCB4 that produce mutated versions of the phospholipase C β4 (PLCB4) protein, although it was not clear if and how they cause ARCND2 in humans. PLCB4 normally acts as a relay that converts signals from outside the cell to a response inside the cell, but we show that this process is disrupted by mutant PLCB4 in a dominant-negative manner in cell culture experiments. Based on these results, we hypothesize that mutant PLCB4 is likely to prevent cells from forming correct facial bones and cartilages during embryonic development. Our experiments show that introducing a human PLCB4 gene variant into mice results in facial defects similar to those seen in individuals with ARCND2. In addition, we found a new bone containing tooth-like structures in the skull of Plcb4 mutant mice, and then compared with human anatomy to find these structures in the skull of an individual with ARCND2. The tooth-like structure resembles a bone present in the skull of reptiles, suggesting that disrupting PLCB4 can re-activate ancient programs governing facial development, resulting in facial birth defects.Craniofacial defects in newborns are one of the leading causes of infant mortality and can have life-long consequences for affected individuals. The overall goal of our research is to understand the causes of facial birth defects and to explore potential treatment strategies to prevent or mitigate these defects. In this study, we investigated auriculocondylar syndrome 2 (ARCND2), a rare disorder characterized by lower jaw defects, fusion of jaw joint bones and misshapen ear lobes (referred to as question mark ear). ARCND2 is associated with gene variations in What are the potential implications of these results for your field of research?“By establishing the role of a specific signal transduction pathway in ARCND2, we now have an opportunity to target this pathway, pharmacologically or otherwise, to prevent craniofacial anomalies.”These results lay the groundwork for investigating other puzzling aspects of ARCND2. For example, there is considerable phenotypic variation in individuals with ARCND2, both within family members and between families, suggesting that additional factors influence the severity of craniofacial malformations. By establishing PLCB4 variants as a causative factor for ARCND2, we and others can begin to explore whether environmental or genetic factors modify disease severity. These results may also have implications for personalized medicine. By establishing the role of a specific signal transduction pathway in ARCND2, we now have an opportunity to target this pathway, pharmacologically or otherwise, to prevent craniofacial anomalies. My hope is that our results will motivate future studies to determine the feasibility of this approach. Finally, our findings raise interesting questions about the plasticity of evolutionary adaptations; it would be exciting to see whether minor modifications in other signalling factors can also re-activate ancient developmental programs.What are the main advantages and drawbacks of the model system you have used as it relates to the disease you are investigating?PLCB4 locus. Although F0 animals are mosaic, our results indicate that the ARCND2 gene variants are pathogenic and provides motivation to invest additional time and resources to generate a stable mouse line for future studies. Overall, the tandem use of cell culture assays and an F0 mouse model offers a relatively rapid and rigorous approach towards establishing the genetic and cellular basis of a disease.We began our study using a mammalian cell culture model to characterize the functional consequence of PLCB4 variants. These results provided a strong rationale to extend our investigation into a mouse model. The main advantage of the mouse model is that the developmental processes and anatomy of the craniofacial skeleton in mice are highly conserved in humans. Therefore, craniofacial anomalies in mutant mice likely reflect the disease state in humans. The drawbacks, however, are that generating mouse models of disease is slower and more expensive relative to other model systems. We circumvented these issues by generating an F0 mouse model for ARCND2, using CRISPR/Cas9 to knock in a disease allele into the What has surprised you the most while conducting your research?I was surprised that all PLCB4 variants examined in this study behaved in a dominant-negative manner. Although our structural modelling predicted that the missense mutations in the catalytic pocket of PLCB4 would result in some kind of functional consequence, why these mutations cause dominant-negative interference rather than loss of function is not clear. I was also shocked to find that the ectopic bone structures in our mouse model were also present in human individuals with ARCND2. This was another reminder of the power of the mouse model for studying craniofacial development.Describe what you think is the most significant challenge impacting your research at this time and how will this be addressed over the next 10 years?in vitro and in vivo approaches. The second challenge is in understanding how disease variants, like those studied here, affect cell signalling pathways in vivo. Engineering genetically encoded signalling sensors that work in vertebrate model organisms is not trivial, as in vivo sensors often require greater selectivity and sensitivity than those used in cell culture models to account for the complexity of a living organism. Fortunately, many different sophisticated signalling sensors are being developed for in vitro use, with multiple groups also establishing reporter lines in zebrafish to detect acute signalling events such as calcium flux and MAP kinase activity. Over the next 10 years, I hope to build on these innovations and develop a research program that investigates the mechanism of human disease variants using in vitro assays, novel in vivo signalling reporters, and model organisms.I see two major challenges in our research. The first challenge is to understand the functional consequences of disease-associated gene variants. Advances in sequencing technology have made it possible to identify genetic variants associated with common and rare diseases at an unprecedented rate, although determining the functional significance and causal role of these variants is lagging. A coordinated effort between clinical geneticists and basic scientists is needed to accelerate the pace of variant validation using What changes do you think could improve the professional lives of early-career scientists?The academic research career-path is challenging, but having institutional support specifically for postdocs makes a big difference. For example, my institution, the University of Colorado Anschutz Medical Campus, has a dedicated office that provides guidance for long-term career planning, grant-writing workshops and resources for wellness management.What's next for you?In addition to mice, I am using zebrafish to study mechanisms of craniofacial development and disorders. I am currently generating zebrafish models for several craniofacial disorders and zebrafish lines that express fluorescent signalling reporters, including the one used in this study, so that we can monitor signalling events in real time during normal and abnormal development."}
{"text": "Gluconobacter oxydans only recently the first plasmids became available. These systems solely enable AraC- and TetR-dependent induction. In this study we showed that the l-rhamnose-dependent regulator RhaS from Escherichia coli and its target promoters PrhaBAD, PrhaT, and PrhaSR could also be used in G. oxydans for regulatable target gene expression. Interestingly, in contrast to the responsiveness in E. coli, in G. oxydans RhaS increased the expression from PrhaBAD in the absence of l-rhamnose and repressed PrhaBAD in the presence of l-rhamnose. Inserting an additional RhaS binding site directly downstream from the −10 region generating promoter variant PrhaBAD(+RhaS-BS) almost doubled the apparent RhaS-dependent promoter strength. Plasmid-based PrhaBAD and PrhaBAD(+RhaS-BS) activity could be reduced up to 90% by RhaS and l-rhamnose, while a genomic copy of PrhaBAD(+RhaS-BS) appeared fully repressed. The RhaS-dependent repression was largely tunable by l-rhamnose concentrations between 0% and only 0.3% (w/v). The RhaS-PrhaBAD and the RhaS-PrhaBAD(+RhaS-BS) systems represent the first heterologous repressible expression systems for G. oxydans. In contrast to PrhaBAD, the E. coli promoter PrhaT was almost inactive in the absence of RhaS. In the presence of RhaS, the PrhaT activity in the absence of l-rhamnose was weak, but could be induced up to 10-fold by addition of l-rhamnose, resulting in a moderate expression level. Therefore, the RhaS-PrhaT system could be suitable for tunable low-level expression of difficult enzymes or membrane proteins in G. oxydans. The insertion of an additional RhaS binding site directly downstream from the E. coli PrhaT −10 region increased the non-induced expression strength and reversed the regulation by RhaS and l-rhamnose from inducible to repressible. The PrhaSR promoter appeared to be positively auto-regulated by RhaS and this activation was increased by l-rhamnose. In summary, the interplay of the l-rhamnose-binding RhaS transcriptional regulator from E. coli with its target promoters PrhaBAD, PrhaT, PrhaSR and variants thereof provide new opportunities for regulatable gene expression in G. oxydans and possibly also for simultaneous l-rhamnose-triggered repression and activation of target genes, which is a highly interesting possibility in metabolic engineering approaches requiring redirection of carbon fluxes.For regulatable target gene expression in the acetic acid bacterium (AAB)  Gluconobacter oxydans harbors the beneficial ability of regio- and stereoselective incomplete oxidation of a variety of sugars, sugar alcohols and other substrates in the periplasm by membrane-bound dehydrogenases (mDHs) and release of resulting products into the cultivation medium  n medium . Therefomiglitol . The indrecently .G. oxydans, only constitutive promoters were used in the past due to the lack of a regulatable promoter. For expression, derivatives of the pBBR1MCS plasmid family obtained from the endogenous plasmid pBBR1 from Bordetella bronchiseptica were the most successful shuttle and expression vectors used  to consensus recognition sequences found in all three Prha promoters and interaction of CRP with the RNA polymerase, which depends on the bending of the promoter DNA by RhaS or RhaR. In G. oxydans CRP is absent since the predicted CRP gene (GOX0974/GOX_RS06010) was shown to encode an iron–sulfur cluster protein termed GoxR, an FNR-type transcriptional regulator of genes involved in respiration and redox metabolism 2SO4, and 2.5 g L−1 MgSO4 × 7 H2O at 30°C. The initial pH of the medium was set to 6 by the addition of KOH (5 M stock). Because G. oxydans possesses a natural resistance toward cefoxitin, 50 μg ml−1 of the antibiotic was routinely added to the medium as a precaution to prevent bacterial contaminations. Stock solutions of cefoxitin (50 mg ml−1) and d-mannitol (200 g L−1) were sterile-filtered and added to autoclaved medium. Unless stated otherwise, for shake flask cultivations cells from 10 ml overnight pre-cultures were used to inoculate 50 ml d-mannitol medium in 500 ml shaking flasks with three baffles to an initial optical density at 600 nm (OD600) of 0.3 . All shake flasks cultures were grown on a rotary shaker at an agitation speed of 180 rpm. G. oxydans cells harboring pBBR1MCS-5-based plasmids were supplemented with 10 μg ml−1 gentamicin (Escherichia coli strains were cultivated at 37°C and 160 rpm in lysogeny broth (LB) medium. Medium of E. coli carrying pBBR1MCS-5-based plasmids was supplemented with 10 μg ml−1 gentamicin. Escherichia coli S17-1 was used as donor strain to transform G. oxydans by conjugation  was used according to the manufacturer’s protocol. The correctness of the plasmid inserts was checked by DNA sequencing (Eurofins MWG).All DNA oligonucleotides used in this study were obtained from Eurofins Genomics and are listed in TGOX0028 . All DNAgdhM-MCS-TGOX0028 that we created previously for the TetR-Ptet system (gdhM) and GOX0028 (TGOX0028) flank the multiple cloning site (MCS) to reduce potential interferences caused by genetic elements on the plasmid backbone. Unless stated otherwise, pBBR1MCS-5-TgdhM-MCS-TGOX0028 was restricted for insert integration with the restriction endonucleases XbaI and EcoRI. Furthermore, in all constructs using the promoters PrhaBAD, PrhaSR, PrhaT, PGOX0264, or PGOX0452 to express the reporter gene mNeonGreen (mNG), the ribosome binding site (RBS) AGGAGA was placed upstream from mNG and downstream from the naturally occurring RBS of the respective promoter region.In this study, all plasmids were constructed using the vector pBBR1MCS-5-Tt system . The terrhaSR-PrhaSR-PrhaBAD-mNG, two DNA fragments were inserted in pBBR1MCS-5-TgdhM-MCS-TGOX0028: DNA fragment with rhaSR-PrhaSR-PrhaBAD-RBS amplified with the primer pair PF1/PF2 from the genome of E. coli LJ110 and DNA fragment with mNG-TBBa_B1002 amplified with the primer pair PF3/PF4 from pBBR1MCS-5-araC-PBAD-mNG -mNG containing an additional RhaS binding site (+RhaS-BS) directly downstream from the −10 region of PrhaBAD, a DNA fragment consisting of (+RhaS-BS)-RBS-mNG-TBBa_B1002 was amplified with the primer pair PF25/PF4 from pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG and integrated into the EcoRI-restricted plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG. The additional RhaS binding site was introduced by primer PF25.For construction of plasmid pBBR1MCS-5-rhaSR-rhaS was constructed from plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG by EcoRI digestion and religation. Two EcoRI sites were located perfectly to remove mNG without the need of further cloning steps.The plasmid pBBR1MCS-5-PrhaT-mNG lacking rhaS was constructed with the DNA fragments PrhaT-RBS generated with the primer pair PF26/PF27 from the genome of E. coli LJ110 and the fragment mNG-TBBa_B1002 generated with the primer pair PF28/PF4 from plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG.The plasmid pBBR1MCS-5-PrhaS-PrhaSR-PrhaT-mNG was created with two DNA fragments. The first DNA fragment contained rhaS-PrhaSR amplified with the primer pair PF5/PF29 from pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG. The second DNA fragment contained PrhaT-RBS-mNG-TBBa_B1002 amplified with the primer pair PF30/PF4 from pBBR1MCS-5-PrhaT-mNG.The plasmid pBBR1MCS-5-rhaS-PGOX0264-PrhaT-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0264 was amplified from template pBBR1MCS-5-rhaS-PGOX0264-PrhaBAD-mNG with the primer pair PF5/PF34. The fragment containing PrhaT-mNG was amplified from template pBBR1MCS-5-rhaS-PrhaSR-PrhaT-mNG with the primer pair PF4/PF37.The plasmid pBBR1MCS-5-rhaS-PGOX0452-PrhaT-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0452 was amplified from template pBBR1MCS-5-rhaS-PGOX0452-PrhaBAD-mNG with the primer pair PF5/PF38. The fragment containing PrhaT-mNG was amplified from template pBBR1MCS-5-rhaS-PrhaSR-PrhaT-mNG with the primer pair PF4/PF39.The plasmid pBBR1MCS-5-rhaS-PGOX0264-PrhaT(−10-RhaS-BS)-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0264 and the 5′ part of PrhaT was amplified from template pBBR1MCS-5-rhaS-PGOX0264-PrhaT-mNG with the primer pair MM14/PF5. The fragment containing the remaining 3′ part of PrhaT followed by mNG was amplified from template pBBR1MCS-5-rhaS-PGOX0264-PrhaT-mNG with the primer pair MM13/PF4. The additional RhaS binding site directly downstream from the −10 region of PrhaT was created and introduced by the primers MM13 and MM14.The plasmid pBBR1MCS-5-rhaS-PGOX0452-PrhaT(−10-RhaS-BS)-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0452 and the 5′ part of PrhaT was amplified from template pBBR1MCS-5-rhaS-PGOX0452-PrhaT-mNG with the primer pair MM14/PF5. The fragment containing the remaining 3′ part of PrhaT followed by mNG was amplified from template pBBR1MCS-5-rhaS-PGOX0452-PrhaT-mNG with the primer pair MM13/PF4. The additional RhaS binding site directly downstream from the −10 region of PrhaT was created and introduced by the primers MM13 and MM14.The plasmid pBBR1MCS-5-rhaS-PGOX0264-PrhaT(TSS-RhaS-BS)-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0264 and the 5′ part of PrhaT was amplified from template pBBR1MCS-5-rhaS-PGOX0264-PrhaT-mNG with the primer pair MM16/PF5. The fragment containing the remaining 3′ part of PrhaT followed by mNG was amplified from template pBBR1MCS-5-rhaS-PGOX0264-PrhaT-mNG with the primer pair MM15/PF4. The additional RhaS binding site directly downstream from the E. coli transcriptional start of PrhaT was created and introduced by the primers MM15 and MM16.The plasmid pBBR1MCS-5-rhaS-PGOX0452-PrhaT(TSS-RhaS-BS)-mNG was constructed using two fragments. The fragment containing rhaS-PGOX0452 and the 5′ part of PrhaT was amplified from template pBBR1MCS-5-rhaS-PGOX0452-PrhaT-mNG with the primer pair MM16/PF5. The fragment containing the remaining 3′ part of PrhaT followed by mNG was amplified from template pBBR1MCS-5-rhaS-PGOX0452-PrhaT-mNG with the primer pair MM15/PF4. The additional RhaS binding site directly downstream from the E. coli transcriptional start of PrhaT was created and introduced by the primers MM15 and MM16.The plasmid pBBR1MCS-5-mNG for genomic labelling of G. oxydans 621H by mNG under control of PrhaBAD(+RhaS-BS) in igr3 was constructed with three fragments. The upstream and downstream flanking regions of igr3 were amplified from genomic DNA of G. oxydans 621H with the primer pairs PF31/PF32 and PF33/PF34, respectively. The fragment containing PrhaBAD(+RhaS-BS)-mNG was amplified from plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG with the primer pair PF35/PF36.The plasmid pKOS6b-igr3::GOX0264-rhaS for genomic integration of a PGOX0264-rhaS copy into igr2 of G. oxydans mNG was constructed with three fragments. The upstream and downstream flanking regions of igr2 were amplified from genomic DNA of G. oxydans 621H with the primer pairs PF40/PF41 and PF42/PF43, respectively. The fragment containing PGOX0264-rhaS was amplified from plasmid pBBR1MCS-5-rhaS-PGOX0264-PrhaBAD-mNG with the primer pair PF44/PF45.The plasmid pKOS6b-igr2::PrhaSR-rhaS for genomic integration of a PrhaSR-rhaS copy into igr2 of G. oxydans mNG was constructed with three fragments. The upstream and downstream flanking regions of igr2 were amplified from genomic DNA of G. oxydans 621H with the primer pairs PF40/PF46 and PF42/PF43, respectively. The fragment containing PrhaSR-rhaS was amplified from plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG with the primer pair PF44/PF47.The plasmid pKOS6b-igr2::PGOX0264-rhaS for genomic integration of a PGOX0264-rhaS copy into igr1 of G. oxydans mNG igr2::PGOX0264-rhaS was constructed with three fragments. The upstream and downstream flanking regions of igr1 were amplified from genomic DNA of G. oxydans 621H with the primer pairs MH3/MH10 and MH6/MH9, respectively. The fragment containing PGOX0264-rhaS was amplified from plasmid pBBR1MCS-5-rhaS-PGOX0264-PrhaBAD-mNG with the primer pair MH4/MH5.The plasmid pKOS6b-igr1::PrhaSR-rhaS for genomic integration of a PrhaSR-rhaS copy into igr1 of G. oxydans mNG igr2::PGOX0264-rhaS was constructed with three fragments. The upstream and downstream flanking regions of igr1 were amplified from genomic DNA of G. oxydans 621H with the primer pairs MH7/MH10 and MH6/MH9, respectively. The fragment containing PrhaSR-rhaS was amplified from plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG with the primer pair MH5/MH8.The plasmid pKOS6b-igr1::PG. oxydans 621H and selection of excised plasmid backbones were carried out using pKOS6b plasmid derivatives and counterselection by cytosine deaminase, encoded by codA from E. coli, in the presence of the fluorinated pyrimidine analogue 5-fluorocytosine (FC). The cytosine deaminase converts nontoxic FC to toxic 5-fluorouracil, which is channeled into the metabolism by the uracil phosphoribosyltransferase, encoded by the chromosomal upp gene of Gluconobacter. The details of the method are described elsewhere  using a 40% (w/v) stock solution. Equal volumes of medium were added to non-supplemented reference cultures. Throughout the cultivation, growth (OD600) and fluorescence emission were monitored in intervals using a spectrophotometer  and an Infinite M1000 PRO Tecan reader . For microscale BioLector cultivations, overnight starter cultures were used to inoculate 800 μl batches of d-mannitol medium in 48-well Flowerplates® (m2p-labs) to an initial OD600 of 0.3. Sealed with disposable foil (m2p-labs), plates were cultivated for 24 h at 1,200 rpm, 85% humidity and 30°C. Growth was monitored in each well as backscattered light at 620 nm (A620 nm) and protein fluorescence was monitored as emission (λex 510 nm/λem 532 nm). For backscatter signal amplification, gain 20 was applied. Signal amplification of fluorescence emission varied (gain 40–70) and is indicated in the figure legends. All BioLector data shown in a diagram were measured in the same run of a growth experiment.The regulation and relative strength of the promoters on constructed plasmids was monitored in tein mNG . For anaG. oxydans 621H harboring either plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD-mNG or pBBR1MCS-5-rhaS-PrhaSR-PrhaT-mNG. The FACS was operated with a 70 μm nozzle and run with a sheath pressure of 70 psi. The forward scatter (FSC) and side scatter (SSC) were recorded as small-angle scatter and orthogonal scatter, respectively, by means of a 488 nm solid blue laser beam. For analysis, only particles/events above 200 a.u. for FSC-H and above 300 a.u. for SSC-H as the thresholds were considered. The mNG fluorescence emission was detected from the SSC through the combination of a 502 nm long-pass and 530/30 nm band-pass filter. Prior to data acquisition, the FSC-A vs. SSC-A plot was employed to gate the population and to exclude signals originating from cell debris or electronic noise. In a second and third gating step, from the resulting population, the SSC-H signal was plotted against the SSC-W signal and this population was subsequently gated in a FSC-H vs. FSC-W plot to exclude doublets. From this resulting singlet population, 100,000 events were recorded at a rate of <10,000 events/s for fluorescence data acquisition. For data analysis and visualization of all gated events  FlowJo 10.7.2 for Windows  was applied.For single cell analysis, a FACSAria™ cell sorter controlled by FACSDiva 8.0.3 software (BD Biosciences) was used to analyze the mNG reporter protein signals in G. oxydans cells were grown to an OD600 of 1.3, centrifuged  and washed twice with 50 mM phosphate buffer (pH 6). After the second washing step, cells were resuspended in biotransformation buffer  supplemented with 2% (w/v) l-rhamnose and incubated for 24 h at 30°C and 200 rpm. Then, the cells were removed from the buffer  and the supernatant was used for analysis by gas chromatography  coupled to a Waters Micromass GCT Premier high-resolution time-of-flight mass spectrometer (Waters). Sample handling for derivatization, GC-TOF-MS operation, and peak identification were carried out as described . DNA concentrations were measured using a Qubit 2.0 fluorometer (Thermo Fisher Scientific). Illumina sequencing and data analysis of the indicated Pescribed . For theere used .G. oxydans cells carrying plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG were cultivated in shake flasks with 50 ml complex d-mannitol medium. Cells were harvested at OD600 of 1.5 in the mid-exponential phase and total RNA was extracted as described (G. oxydans genome and the pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG plasmid sequence using the RNA-seq analysis tool implemented in the CLC software. Read mapping settings used were 80% length fraction and 80% similarity fraction. The starts of mapped reads and total nucleotide coverage according to the mappings were used to assess transcriptional starts on the expression plasmid with the promoters PrhaSR and PrhaBAD(+RhaS-BS).escribed . The RNArhaBAD system from E. coli responds to the monosaccharide rhamnose in the uncommon l conformation, which is similar to the AraC-ParaBAD system and its effector l-arabinose. Like l-arabinose, the inducer l-rhamnose needs to enter the cell to interact with its targeted regulators RhaR and RhaS  l-rhamnose instead of d-mannitol, there was no growth of G. oxydans 621H and the initial start OD600 of 0.04 did not change within 24 h (d-mannitol medium supplemented with 1% (w/v) l-rhamnose, the strain 621H grew very similar and without a significant difference compared to the growth in the d-mannitol complex medium without l-rhamnose supplement. Furthermore, with and without l-rhamnose the initial pH 6 of the growth medium was acidified to pH 4.3 after 24 h, suggesting no relevant oxidation of l-rhamnose to a corresponding acid. Therefore, there was no negative or supportive effect of l-rhamnose on the growth of G. oxydans 621H up to 1% (w/v).The results confirmed that ter 24 h . Hence, hin 24 h . In 4%  was used to measure the PrhaBAD-controlled expression by placing the mNG gene downstream from PrhaBAD. On the plasmid, the elements rhaSR-PrhaSR-PrhaBAD-mNG were flanked by three terminators, TgdhM downstream from rhaR, and TBBa_B1002 and TGOX0028 downstream from mNG  l-rhamnose. Overnight pre-cultures were split to inoculate main cultures in d-mannitol medium with and without l-rhamnose. Growth and mNG fluorescence was monitored in a BioLector.First, we tested the inducibility of Pfrom mNG . Further systems , 2021b. l-rhamnose supplementation  was observed  l-rhamnose, the mNG fluorescence was ~2,200-fold higher compared to the mNG fluorescence in cultures without l-rhamnose (data not shown). To verify that the reversed responsiveness of RhaSR-PrhaBAD indeed was observed in G. oxydans 621H carrying the intended plasmid without mutations possibly acquired later during growth, G. oxydans cells of an induced culture were harvested at the end of the cultivation (24 h) for isolation of total DNA and Illumina sequencing. The read data analysis excluded unexpected contamination of the culture, since 99.48% of 1,402,738 trimmed and quality-filtered reads mapped to the updated reference sequences of the G. oxydans 621H genome (88-fold coverage), the 5 endogenous plasmids, and the mNG expression plasmid with rhaSR-PrhaSR-PrhaBAD-mNG . In rhaS there was the silent mutation of CTG to CTT (Leu166) and the mutation of GGG to TGG resulting in the exchange Gly136Trp in RhaS. All three mutations were present already on the plasmid when it was cloned in E. coli. To exclude an effect of these mutations on the reversed responsiveness only in G. oxydans, the plasmid was cloned again using a new rhaS DNA template from E. coli MG1655. This plasmid lacked the two point mutations in rhaS and also showed the reversed responsiveness in G. oxydans 621H with the same extent of repression (data not shown). Thus, the DNA point mutations in rhaS did not affect the regulatory properties of the system in G. oxydans. In summary, these results showed that in contrast to E. coli the PrhaBAD promoter is repressed in G. oxydans in the presence of l-rhamnose.To test whether the G. oxydans protein is responsible for the reversed responsiveness of the RhaSR-PrhaBAD system, we constructed derivatives of the expression plasmid either lacking in-frame a substantial part of rhaS, or lacking rhaR, or lacking both genes, yet keeping all the elements upstream and downstream from rhaS and rhaR (G. oxydans clones carrying one of these plasmid derivatives were grown in d-mannitol medium without and with 1% (w/v) l-rhamnose and cultivated in a BioLector to monitor growth and mNG fluorescence. Regardless of the plasmid used, all G. oxydans cultures exhibited very similar growth with and without l-rhamnose , regardless of l-rhamnose supplementation , suggesting a general negative effect of RhaR on the PrhaBAD activity regardless of the presence or absence of l-rhamnose. This is in line with the observation that with the plasmid lacking only rhaR, expression from PrhaBAD increased in the absence of l-rhamnose by ~20% (513 a.u.) compared to the plasmid with both regulator genes (431 a.u.). Furthermore, with 1% (w/v) l-rhamnose the mNG expression from PrhaBAD was more reduced with the rhaS-PrhaBAD construct (94 a.u.) than with the rhaSR-PrhaBAD construct (122 a.u.).To analyze whether RhaS and/or RhaR, or an interfering endogenous and rhaR . G. oxydrhamnose . The difentation . The clorhaBAD promoter in the absence of l-rhamnose and represses PrhaBAD in the presence of l-rhamnose, and thus is exerting a dual role in G. oxydans  in the absence of l-rhamnose. These results suggested that PrhaSR is a very strong promoter per se, or because it is positively auto-regulated by RhaS. However, the RhaS protein was reported to severely aggregate when overexpressed . The mNG expression obtained with rhaS-PGOX0264-PrhaBAD-mNG and with rhaS-PGOX0452-PrhaBAD-mNG was reduced by 77% (from 212 to 48 a.u.) and by 68% (from 95 to 30 a.u.), respectively (In the presence of 1% (w/v) ectively .rhaSR in G. oxydans and the influence of RhaS on PrhaSR activity, we created plasmids with mNG under the control of PrhaSR and with rhaS under the control of the constitutive promoters PGOX0452 or PGOX0264, or lacking rhaS  l-rhamnose. This l-rhamnose-dependent increase was less pronounced with rhaS under control of the stronger PGOX0264 where the RhaS level was expected to be higher. Here, the mNG fluorescence increased only 1.3-fold from 144 to 187 a.u.  l-rhamnose in a BioLector (l-rhamnose strongly reduced the mNG fluorescence after ~7 h by 75% (225 vs. 55 a.u.). This indicated that the RhaS-PrhaBAD system is quite sensitive and already low l-rhamnose concentrations should enable a tuning of target gene repression. Supplementation with 1% and 3% (w/v) l-rhamnose reduced mNG fluorescence by 83% (38 a.u.) and 85% (34 a.u.), respectively. This suggested that already 1% (w/v) l-rhamnose was sufficient to reach almost maximal possible repression of plasmid-based PrhaBAD copies in G. oxydans.Since from all tested plasmid variants the one lacking ioLector ,B. AlrearhaBAD-based expression toward relatively low l-rhamnose concentrations was also observed in shake flask cultivations. When grown in 50 ml d-mannitol medium supplemented with 0.25% l-rhamnose, the mNG fluorescence was reduced to 24%  after 9 h .This responsiveness of Pfter 9 h ,D. In shrhaBAD-derived mNG expression on the single cell level. In the absence of l-rhamnose, 7 h after inoculation 95.5% of the analyzed cells showed strong mNG fluorescence , while when grown with 1% (w/v) l-rhamnose, 96.4% of the analyzed cells showed a 89% reduced fluorescence  directly downstream from the annotated E. coli −10 region of PrhaBAD. Additional binding of the RhaS-l-rhamnose complex downstream from the −10 region should potentially contribute to the repression of PrhaBAD. Also, it was interesting to see the general impact of this additional RhaS BS on the PrhaBAD activity in the absence of l-rhamnose.In an attempt to reduce the residual expression from PrhaS-PrhaSR-PrhaBAD-mNG as template and created a copy of the 50 bp region comprising the native RhaS-BS present in PrhaBAD. This copy was inserted directly downstream from the −10 region of PrhaBAD. The resulting plasmid was termed pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG and its expression performance was compared with that of the template plasmid (d-mannitol medium without and with 1% (w/v) l-rhamnose, both strains showed similar growth independent of the plasmids or l-rhamnose supplementation  that of the parental plasmid (225 a.u.), suggesting additional activation of PrhaBAD by RhaS in the absence of l-rhamnose or a new transcriptional start increasing the mNG expression .We used plasmid pBBR1MCS-5- plasmid . In d-maentation . Interespression . In the rhaBAD(+RhaS-BS) repression was tested with 0.05%, 0.1%, 0.2%, 0.3%, 1%, and 3% (w/v) l-rhamnose  is also almost maximally repressed by 1% (w/v) l-rhamnose. The calculated residual mNG expression from PrhaBAD(+RhaS-BS) was 11% and 10%, respectively. With 0.3% (w/v) l-rhamnose, the residual mNG fluorescence was 17% (405 vs. 69 a.u.). With only 0.05% (w/v) l-rhamnose, the mNG fluorescence was reduced approximately by half (from 406 to 197 a.u.), showing the sensitivity and tunability of the system. In shake flask cultivations with 0.25% and 1% (w/v) l-rhamnose, PrhaBAD(+RhaS-BS) showed a similar repression performance as in microscale BioLector conditions. After 9 h of growth in shake flasks, the maximal mNG fluorescence without l-rhamnose  was reduced to 1,060 and 600 a.u. in the presence of 0.25% and 1% (w/v) l-rhamnose -derived mNG fluorescence vs. the l-rhamnose concentrations illustrates the responsiveness of both promoters toward low l-rhamnose concentrations (rhaBAD(+RhaS-BS) was two-fold stronger than PrhaBAD and therefore offers a wider dynamic range of expression.Plotting the relative maximal Ptrations . While trhaBAD variant can be completely repressed in a plasmid-free strain when this modified target promoter and rhaS are genomically integrated and present as a single copy instead of being present on a plasmid with medium copy number (mNG under control of PrhaBAD(+RhaS-BS) into the intergenic region igr3 (GOX0038/GOX_RS01330–GOX0039/GOX_RS01335). The resulting strain was termed G. oxydans mNG. For single-copy rhaS expression, we tested the promoters PrhaSR and PGOX0264 and integrated both rhaS constructs in G. oxydans mNG separately into igr2 (GOX0028/GOX_RS01280–GOX0029/GOX_RS01285). The resulting G. oxydans strains mNG igr2::PGOX0264-rhaS and mNG igr2::PrhaSR-rhaS were cultivated and analyzed in a BioLector (l-rhamnose expression of single-copy rhaS under control of PrhaSR resulted in higher activity of PrhaBAD(+RhaS-BS) than with PGOX0264-rhaS. However, with rhaS under control of PGOX0264 a much higher extent of repression was observed with 1% (w/v) l-rhamnose. Here, the maximal mNG signals were reduced by 64% from 217 to 78 a.u. (rhaS expression is not sufficient to completely repress PrhaBAD(+RhaS-BS). We then tested if a second genomic rhaS copy could be sufficient and integrated both PGOX0264-rhaS and PrhaSR-rhaS into strain mNG igr2::PGOX0264-rhaS separately into igr1 (GOX0013/GOX_RS01200–GOX0014/GOX_RS01205). The two resulting G. oxydans strains mNG igr1::PGOX0264-rhaS igr2::rhaS and mNG igr1::PrhaSR-rhaS igr2::rhaS were cultivated and analyzed in a BioLector . With one copy of PrhaSR-rhaS and one copy of PGOX0264-rhaS the maximal mNG signals were reduced by 78% from 435 to 96 a.u. With two genomic copies of PGOX0264-rhaS, the maximal mNG signals were reduced by 84% from 444 to 73 a.u.  can be completely repressed at all, we constructed the rhaS expression plasmid pBBR1MCS-5-PrhaSR-rhaS and introduced it into the single-copy rhaS strain G. oxydans mNG igr2::PGOX0264-rhaS already showing 64% promoter repression (rhaBAD(+RhaS-BS) appeared completely repressed by 3% and possibly also by 1% (w/v) l-rhamnose. To test the tunability of this repression with plasmid-based expression of rhaS, we also tested lower l-rhamnose concentrations  l-rhamnose, the maximal mNG signals were reduced by 78% from 216 to 47 a.u.. These results indicated a relatively high sensitivity of the system toward lower l-rhamnose concentrations and that a genomic copy of the RhaS target promoter variant can be tuned.To test if a genomic single-copy Ppression . The respression ,C. Accortrations . In the E. coli RhaS also activates the promoter PrhaT of the l-rhamnose transporter gene rhaT. Similar to PrhaBAD, PrhaT contains two regulatory elements, one for RhaS and one for CRP binding. Contrary to PrhaBAD, the RhaS binding site on PrhaT is differently composed and slightly shifted, so that the binding site does not overlap with the −35 element of PrhaT  l-rhamnose increased mNG fluorescence ~7.5-fold (from 36 to 266 a.u.) within 8 h. The values indicated a weak or moderate strength of PrhaT in G. oxydans . Again, growth of G. oxydans cells with pBBR1MCS-5-rhaS-PrhaSR-PrhaT-mNG was largely unaffected by up to 2% (w/v) l-rhamnose  l-rhamnose already half of the maximal induction was reached showing that the weak to moderate PrhaT-derived mNG expression could be nicely tuned by low l-rhamnose concentrations  l-rhamnose . In the presence of 1% (w/v) l-rhamnose, 96.9% of the population showed approximately 9-fold higher mNG fluorescence signals . We also tested the inducible PrhaT-derived mNG expression in shake flask cultures with 0.3% and 1% (w/v) l-rhamnose. Under these conditions, all cultures with pBBR1MCS-5-rhaS-PrhaSR-PrhaT-mNG exhibited very similar growth (mNG expression was similarly induced as in the BioLector cultivations (l-rhamnose (50 vs. 297 a.u.), respectively.The homogeneity of Prhamnose . In the r growth . The mNGivations . The maxrhaS expression strength from different promoters on the performance of the RhaS-PrhaT system, we replaced PrhaSR and constructed plasmid variants with PGOX0264-rhaS and PGOX0452-rhaS  l-rhamnose were ~25% lower compared to that obtained with PrhaSR-rhaS. Since the non-induced maximal mNG signals obtained with PrhaT were somewhat higher with PGOX0264-rhaS (46 a.u.) and were approximately 3-fold higher with PGOX0452-rhaS (104 a.u.) compared to PrhaSR-rhaS (36 a.u.), the maximal induction fold changes with 4% (w/v) l-rhamnose were only 5-fold with PGOX0264-rhaS and 2.4-fold with PGOX0452-rhaS. Thus, compared to PrhaSR-rhaS the non-induced basal expression level was not lowered and the induction fold changes of the RhaS-PrhaT system were not improved by using PGOX0264 or PGOX0452 for rhaS expression.To test the influence of 452-rhaS . The G. f PrhaSR –E. For brhaT, we inserted the RhaS binding site sequence from PrhaBAD on the one hand directly downstream from the E. coli −10 region (−10-RhaS-BS) and on the other hand downstream from the E. coli TSS (TSS-RhaS-BS), and constructed for both PrhaT variants expression plasmids with rhaS under control of either PGOX0264 or PGOX0452 (rhaT(−10-RhaS-BS) was repressible. The maximal mNG signals in the absence of l-rhamnose for both rhaS constructs PGOX0264-rhaS (250 a.u.) and PGOX0452-rhaS (214 a.u.) were reduced by 65%  was still inducible, yet showed increased and relatively high non-induced mNG signals in the absence of l-rhamnose, which could maximally only be doubled by induction with 4% (w/v) l-rhamnose  can interact with the RNA polymerase (RNAP) and thereby activates transcription of rhaSR  of genes involved in respiration and redox metabolism  subunit RpoD of the RNAP. This mode of activation is often indicated by regulator binding sites overlapping with the −35 element of the target promoter  to the other side of the DNA strand when comparing the theoretical binding of RhaS and σ70-RNAP to PrhaBAD with the binding to PrhaT. Because of this theoretical difference in the orientation of RhaS toward σ70-RNAP, RhaS possibly interacts with the α-CTD of the RNAP in the case of PrhaT and with σ70 in the case of PrhaBAD. Since the α-CTD and σ70 from G. oxydans and E. coli differ to some extent, the conformational changes of RhaS induced by the binding of l-rhamnose may affect the interactions of RhaS with the α-CTD and with σ70 from G. oxydans differently compared to the interactions with the α-CTD and with σ70 from E. coli, finally resulting in the different modes of the regulation of PrhaBAD and PrhaT in G. oxydans. Interestingly, in the case of PrhaSR, the RhaR binding site also overlaps with the −35 region as the RhaS binding site in PrhaBAD. Moreover, one of the major groove regions of each RhaR half site on PrhaSR is nearly identical to the corresponding half site for RhaS binding on PrhaBAD and RhaS can also bind to the RhaR binding site in PrhaSR as mentioned above  within the three E. coli promoter regions PrhaBAD, PrhaT, and PrhaSR in G. oxydans is required to better explain the effects, including the activation of PrhaBAD by RhaS in the absence of l-rhamnose, the repression, and the effects of the additional RhaS binding site inserted into PrhaBAD and PrhaT.As mentioned above, in Pupstream . These ded above . DespiteG. oxydans 621H with plasmid pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG cultivated in the complex medium with d-mannitol in the absence of l-rhamnose and harvested in the mid-exponential phase. The RNA sample was sent to Vertis Biotechnologie AG for sample processing and Illumina sequencing to obtain high-quality TSS data . The resulting fastq file comprised 10,255,084 reads (75 bp). After reads trimming and quality filtering, 1,023,259 reads mapped to the sequence of pBBR1MCS-5-rhaS-PrhaSR-PrhaBAD(+RhaS-BS)-mNG. The overall reads mapping showed three prominent reads stacks indicating the three most active transcriptional starts on the plasmid (gmR (aacC1) conferring gentamycin resistance and was oriented toward gmR. The second-highest stack  was upstream from rhaS and oriented toward rhaS. In contrast to the expectation for rhaS, the start position of this stack was not within PrhaSR, but upstream from PrhaSR within the PrhaBAD region between its −35 and −10 regions from E. coli. The third-highest stack  was found within the coding region of rhaS and oriented toward the 3′ end of rhaS. For PrhaBAD, the insertion of an additional RhaS binding site could possibly generate an additional transcriptional start site in G. oxydans enabling the two-fold increased mNG signals described above for PrhaBAD(+RhaS-BS). However, in contrast to the expectations, no one or two major TSSs with high coverage toward mNG corresponding to the reported E. coli TSS and a potential new TSS could be seen. Instead, the detailed reads mapping showed several reads stacks of only medium coverage, partially with scattering start positions, in the PrhaBAD(+RhaS-BS) region and the 5′ region of mNG , yet it is likely that also with PrhaBAD and PrhaT(−10-RhaS-BS) complete repression of a genomic copy could be achieved. These promoters cover different ranges of expression strength, which could be selected according to the requirements of the genomic target gene. Tunable and complete promoter repression is also useful for the functional study of essential genes that cannot be deleted. Optimizing genomic rhaS expression or further increasing the genomic rhaS copy number beyond two to achieve a sufficient RhaS level may finally overcome the necessity of plasmid-based rhaS expression to achieve complete chromosomal promoter repression. Furthermore, more TSS data sets and deeper analysis are required to better understand the regulations of the target promoters by RhaS in G. oxydans. The TSS results also suggested to analyze the TSSs of heterologous promoters when they are transferred and used in G. oxydans or AAB in general. It can be expected that TSS data sets will help to better understand and overcome the difficulties in getting transferred heterologous regulatable expression systems functional and high-performant in AAB.Summing up and looking ahead, in The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. The Illumina sequencing data are available in the NCBI sequence read archive via the accession numbers PRJNA854345 and PRJNA854679.TP and PF designed and supervised the study. PF, MLG, MM, and MH carried out cloning and experiments. JG performed the GC-TOF analysis. PF, MLG, MM, MH, and TP performed data analysis. PF and TP wrote the manuscript. All authors contributed to the article and approved the submitted version.We are grateful to the Federal Ministry of Education and Research (BMBF) for financial support of the project IMPRES (031B0370B). The funding organization did not influence the design of the study or collection, analysis, and interpretation of data, or writing the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Noise management associated with input signals in sensor devices arises as one of the main problems limiting robot control performance. This article introduces a novel neuromorphic filter model based on a leaky integrate and fire (LIF) neural model cell, which encodes the primary information from a noisy input signal and delivers an output signal with a significant noise reduction in practically real-time with energy-efficient consumption. A new approach for neural decoding based on the neuron-cell spiking frequency is introduced to recover the primary signal information. The simulations conducted on the neuromorphic filter demonstrate an outstanding performance of white noise rejecting while preserving the original noiseless signal with a low information loss. The proposed filter model is compatible with the CMOS technology design methodologies for implementing low consumption smart sensors with applications in various fields such as robotics and the automotive industry demanded by Industry 4.0. The term neuromorphic, coined by Mead , refers Traditional analog filters are designed based on scaling specific frequency domain signal components and attenuating the rest. This approach has been proven effective with noise that is primarily out of signal frequency range. However, linear filters cannot clear noisy signals when disturbance affectation is in the same frequency range as primary signal. In this context, digital filters, especially average filter techniques, take precedence at the cost of resources expense. For this reason, some filter proposals based on the use of several SNs have been made  to a reference voltage level (VRef). It also assumes the generation of a convenient spike shape, compliant with memristors technology to allow weight adjustment during the learning phase.There are several proposals reported on analog implementations of neural model circuits Abbott, . ThroughIin, flowing at its negative input. At the integration mode, the voltage level at the output of the OPAMP decreases until it reaches a determined threshold voltage, Vthr. The comparator circuit compares the membrane voltage, Vmem, with vthr, to generate a signal activating the Phase Control block when the descending Vref reaches Vthr. At this moment, the Phase Control block commands the Spike Generator block to initiate a spike event with a predefined waveform and it changes the control signals, αfire to ON state, while αint to OFF state. These control signals are complementary. The neural circuit is reconfigured by the current states of αfire and αint. If αint is ON, the OPAMP works in the integration mode, if αfire is ON the neuron is in fire mode. During integration mode the neuron output Vout is set in Vref, at the same time, the spike generator block must hold a Vref at the positive OPAMP input, which is buffered at the negative OPAMP input. In the firing mode, Vout, is connected to Vmem, generating a spike event, feedbacking, Vmem to the negative OPAMP input. At the end of the firing mode, Cmem is reset to a Vref, potential.Wu's neural circuit shown in The equivalent model of the LI section is presented in Equation (1).Vp is the voltage objective, while the circuit is in integration mode Vp corresponds to Vthr.Where Wu's circuit functioning could still be simplified to implement the proposed methodology, performing a noise signal filtering process. The simplification consists of establishing constant delays before switching states and restarting the integration phase. It imposes a period of neuron inactivity corresponding to the refractory period, seen in biological brains. This behavior is modeled as shown below:Once the neuron is in the refractory period, it maintains its state for a predefined period, after which it returns to the previous (integration) state.t0, t1, ..., tn, where 0 ≤ ti ≤ T, with i = 0, 1, 2, ..., n is the i-th spike time in an observed period T . By repeating this operation for a certain number of different stimuli, it is possible to estimate a function, The time between spikes in the circuit presented in Rearranging elements from Equation (1), we find the next expression.Iin = IRLeak+ICmem, where IRLeak(t) is the current across RLeak, which behavior is unknown in advance, thus:Equation (2) corresponds to Current Kirchhoff's Law, producing a summation of all the currents at input node, Now, integrating both sides of Equation (3) with the defined time intervals limits between neural events (spike occurrences) results in Equation (4). Internal values of the neuromorphic units are reset at the end of each neural event,Solving integrals on both sides:Vmem = Vthr−Vref results at the end of the integration period. Equation (5) corresponds to the Mean Value Theorem for integrals  on the same period. Particularly, Iin can be seen as the mean value of current on the period tn−tn−1 plus a constant value (CmemVmem).Where the value Stewart, . Thus, aIin value on Equation (5). The methodology proposed to use a neural circuit as a signal filter is depicted in Our proposal consists of using the tuning curve function of the neuromorphic circuit to estimate the Iin of Equation (1) between a current interval ∈μA, considering the following electrical and timing parameters: Cmem = 1μF, Rleak = 10kΩ, and a refractory period of 10μs, we proceed to measure the time elapsed between potential membrane spikes. The below equation is proposed as a prototype to estimate function f.The tuning curve for the circuit introduced in a = 1724.8761, b = 21.6051, c = −161.1285, are determined using nonlinear least squares curve fitting .Because Equation (6) is invertible, we can take two produced spikes and calculate the current in the elapsed period between spikes. That is to say, Where:p = tn−tn−1. tn is the time of the n-th spike. In order to maintain values on a more convenient time-scale α = 1 × 104 and β = 1 × 10−6 are added as scale factors. Equation (7) is evaluated at each spike and the value is held until the next spike occurs, refer to with: Observe that Equation (7) is a decaying exponential function; therefore, it is possible to define a circuit that reproduces this behavior by using the capacitor discharging dynamic in a commuted capacitor scheme working as follows. At each spike event, a low impedance branch quickly charges a capacitor during the refractory period of the SN unit. Once the refractory period concludes, the charging branch for the capacitor is open, and discharge becomes through a branch with fixed impedance such that the current on the capacitor has a behavior similar to Equation (7), refer to This scheme based on frequency shows a better performance than other strategies previously introduced . As each filter introduces a different amount of time delay caused by the filtering process, Euclidean distance is not an appropriate choice since filtering techniques with a minimum delay will tend to render better results. Therefore, Fast Dynamic Time Wrapping  minimizing digital electronics, thus reducing the required number of transistors. Our frequency base decoding scheme has proven to have a good noise rejection, specially added white noise, but maintaining good performance with other types of noise, bringing artificial intelligence closer to circuit technology to deliver innovative solutions to filter white noise with the same frequency domain as the original signal, with minimal latency and low information loss. It is also a promising approach to, i.e., the conception of future innovative lab-on-chip implementations. Increasing the signal-to-noise ratio rejection ratio, cost efficiency, and sensitivity, is essential in these devices.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.LG-S proposed, developed, programmed the neural filter code, conducted the simulation runs, and wrote the first draft of the manuscript. VP-P and HS proposed modifications to the encoding and decoding strategy architectures. ER-E reviewed the test bench for the filter experiments. JM-N helped with the neural modeling in Python. All authors contributed to the conception and design of the study, manuscript revision, read, and approved the submitted version.The authors would like to thank the economic support of the projects SIP 20210124, 20221780, 20211657, 20220268, 20212044, 20221089, 20210788, 20220226, and COFAA and CONACYT FORDECYT-PRONACES 6005.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer AZ declared a shared affiliation with the authors to the handling editor at the time of review.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "To evaluate the safety and efficacy of recannulating the axillary artery in reoperative proximal thoracic aortic surgery.Between 2008 and 2020, we evaluated patients who underwent reoperative proximal thoracic aortic surgery. The patients were divided into 2 groups: (i) patients with no previous right axillary artery cannulation (primary cannulation group) and (ii) patients with a previous cannulated right axillary artery (recannulation group). We analysed the intraoperative data, cannulation-related complications, postoperative outcomes and compared the 2 groups (primary cannulation versus recannulation).n = 132) baseline characteristics did not differ significantly between the 2 groups. There was no statistically significant difference in regard to the duration of surgery, cardiopulmonary bypass, aortic cross-clamp and antegrade cerebral perfusion time nor in regard to the total number of patients with cannulation-related complications between the 2 groups . The incidence of iatrogenic axillary artery dissection, iatrogenic aortic dissection, iatrogenic aortic dissection leading to death, axillary artery thrombosis, need for surgical repair, brachial plexus injury rates, malperfusion, high perfusion resistance and hyperperfusion syndrome revealed no significant difference between the 2 groups (P > 0.05). There were 11 (11.0%) cases of stroke in the primary cannulation group and 1 (3.1%) in the recannulation group (P = 0.18).The patient  has emerged as a routine method in aortic surgery for establishing selective antegrade cerebral perfusion (ACP) [1–4]. The cannulation of the artery was performed by using a side-graft in 69 (69.0%) patients in the primary cannulation group and in 30 (93.8%) in the recannulation group, P = 0.005.Intraoperative data are summarized in Table n = 8 (8.0%) vs n = 1 (3.1%), P = 0.34] (Table P > 0.05). No case of axillary cannulation attempt and break-off for technical reasons was documented or remembered by the aortic team.There was no statistically significant difference in regard to the total number of patients with cannulation-related complications between the primary cannulation group and recannulation group [vs n = 1 .1%, P = P = 0.18. Other postoperative complications also revealed no statistically significant differences. The need for transfusion of erythrocyte concentrates and platelet concentrates were numeric slightly higher in the recannulation group but did not attained statistical significance .The postoperative outcomes are summarized in Table In the present study, we compared clinical outcomes of recannulation of the RAA with primary cannulation of the RAA in reoperative proximal thoracic aortic surgery and found no statistically significant differences neither in regard to cannulation-related complications nor postoperative complications.Aortic and cardiac reoperations are complex procedures with high operative risk requiring careful preoperative planning, preventive strategies and compensatory rescue measures. Safely and promptly establishing CPB is of the utmost importance, especially in the event of a re-entry catastrophic injury allowing the repair and limiting the haemodynamic instability. It has been previous shown that careful preoperative planning using computed tomography scanning and using peripheral arterial cannulation is associated with less injuries to vital structures .RAA is supported by growing evidence as the arterial cannulation site of first choice in aortic surgery. It allows establishing selective ACP, avoiding flow reversal and it has been shown to be more beneficial than other cannulation sites in terms of early embolic stroke, mortality and neurological dysfunction , 2, 10. In reoperative aortic surgery, cannulation of the RAA represents both a preventive strategy and a compensatory rescue measure—selective ACP and hypothermia can be initiated during or before re-entry and surgical dissection; in the case of a catastrophic injury repair can be initiated undelayed.et al. [Shetty et al.  reportedet al.  also repThe results of the present study confirm and extend these previous observations. In our series, by comparing 32 recannulation cases with 100 primary cannulations, all within a reoperative proximal thoracic aortic surgery cohort, we could not identify any statistically significant differences in regard to multiple clinical outcomes like cannulation-related complications or postoperative complications. We have previously shown that cannulation of the RAA through a side-graft is superior to direct cannulation in regard to cannulation-related complications and stroke rates  and our Our data show that recannulation of the RAA in proximal thoracic aortic surgery is efficient and safe. All the advantages of this beneficial cannulation site are preserved—no flow reversal, the possibility of establishing selective ACP, hypothermia and CPB and in the specific case of redo surgery even expanded by the role of RAA recannulation as a preventive and rescue measure.This is a retrospective study with all the inherent limits and risks for confounding and bias. Our clinical database might under-report events and risk factors and we were not able to gather late clinical outcome data or data on quality of life. The operations were performed in a high-volume centre with experience in aortic surgery and the choice of cannulation site and cerebral protection strategy was surgeon’ preference. Also, in the recannulation group, a side-graft was more often used as in the primary cannulation group, fact that could also be responsible for the rate of complications observed , 14.A major limitation of the study is the limited number of cases. Furthermore, our results are not adjusted for major confounders. Larger multicentric trials should further clarify the safety of the procedure.Recannulation of the RAA in reoperative proximal thoracic aortic surgery is not associated with worse clinical outcomes and can be safely and effectively performed. In complex redo proximal thoracic aortic operations, all the reported advantages of RAA cannulation are extended by the role of preventive and rescue measure that this inflow site can play; previous cannulation of the axillary artery is not an impediment and should not hinder the decision for recannulation.Conflict of interest: The conflict of interest of Martin Czerny with Terumo, Medtronic and Cryolife does not have anything in common with materials used in the study or with the conclusions. All relevant data are within the manuscript and its supporting information files.Paul-Cătălin Puiu: Conceptualization; Data curation; Formal analysis; Investigation; Methodology; Project administration; Software; Supervision; Validation; Visualization; Writing—original draft. Clarence Pingpoh: Conceptualization; Supervision; Validation; Visualization. Maximilian Kreibich: Conceptualization; Data curation; Investigation; Supervision; Validation. Martin Czerny: Conceptualization; Investigation; Methodology; Supervision; Validation. Emmanuel Zimmer: Conceptualization; Data curation; Supervision; Writing—review & editing. Friedhelm Beyersdorf: Conceptualization; Methodology; Project administration; Visualization; Writing—review & editing. Matthias Siepe: Conceptualization; Methodology; Project administration; Resources; Supervision; Writing—review & editing.Interactive CardioVascular and Thoracic Surgery thanks Mitsuru Asano and the other, anonymous reviewer(s) for their contribution to the peer review process of this article."}
{"text": "Miscarriage poses a significant threat to pregnant women globally. Recurrent miscarriages or potential poor embryonic development indicated by early drops in serum human chorionic gonadotrophin (hCG) are even more catastrophic for pregnant women. However, these patients receive either individualized medical intervention supported by limited evidence or no treatment at all. In this study, we report ten patients who shared at least one episode of an early decline of hCG in the first trimester and were treated with compassionate use of tumor necrosis factor-alpha inhibitor (TNFi). They were then followed up regularly with caution. Their hCG trajectory all resumed a normal pattern within one week and the obstetric outcomes were promising. No adverse fetal, neonatal, or maternal health issues have been observed. This case series supports current safety evidence of TNFi and provides new insight into its use in pregnancy when the embryo is in danger. Further well-designed clinical trials should be carried out to consolidate the evidence. Miscarriage is defined as the loss of pregnancy before viability. It causes significant psychological and economic damage to the family and society . AdoptinhCG is a glycoprotein with a molecular weight of 36,000 to 40,000 Dalton. It is almost exclusively produced by trophoblast cells and placenta after placental formation . An earlTumor necrosis factor-alpha (TNF-α) is an inflammatory cytokine belonging to Th1 lymphocytes. TNF-α blockers inhibit the effect of TNF-α. The agents were used in rheumatoid arthritis (RA), ankylosing spondylitis, inflammatory bowel disease (IBD), and psoriasis . It has In this case series, we report the trial of TNFi-led pregnancy-rescue management (TPRM) to help women with early signs of miscarriage. Most of the women in our study had a history of recurrent pregnancy loss according to the definition from the European Society of Human Reproduction and Embryology (ESHRE) guideline . Some caThe basic characteristics include women’s age, body mass index (BMI), previous obstetric background, and obstetric outcomes in current pregnancies. Details can be seen in The overall serial serum levels of hCG are shown in Three out of the ten cases were pregnancies following ART. Case No. 3 and 6 were diagnosed with unexplained infertility with at least two episodes of early embryonic failures after ART, while case No. 5 was affected by tubal factors. In case 3, upon the first episode, when hCG declined from 43,271 to 43,185, the patient had concurrent minor vaginal bleeds, indicating a threatened miscarriage. She received 1g tranexamic acid twice daily and a single dose of adalimumab (40mg) for one day and the bleeds stopped. A further decline on Day 55 prompted a second off-label use of adalimumab. Six days after injection, the serum hCG level went back on track . In contrast, case No.6 received only one dose of adalimumab despite having experienced two episodes of early declines of hCG. Case No. 5 had only experienced one episode of hCG early decline and received one single dose of adalimumab on that day. She is now 33wks and is followed up regularly in the antenatal clinic and no stillbirth or any other adverse fetal or maternal outcome has been reported.Among the seven patients who were conceptualized naturally, case No. 9 and 10 had two and four previous spontaneous miscarriages, respectively. Case No. 2 and 7 had a successful obstetric history before the current pregnancy. Case No. 8 was not complicated with pre-existing maternal medical conditions, nor did she have a previous history of miscarriage. However, she suffered from a long-lasting early decrease of hCG for more than ten days, suggesting an adverse embryonic outcome. A similar case was observed in No. 4, who is now 31wks, after being offered a single dose of certolizumab pegol (200mg) at 7wks when hCG fell from 58,016 to 54,438 mIU/mL the following day.Eight out of the ten women have delivered so far. The average birth weight was 3377.50g (2780-3850g), which fell into the normal reference range. Despite uneventful pregnancies after the rescue therapy, we identified a disproportionally high cesarean section rate in the study group. Case No. 8 is the only one so far who has delivered vaginally. Case No. 3 and 6 had cesarean for fetal distress in labor, possibly resulted from oligohydramnios (not an absolute indication for cesarean but could lead to increased emergency cesarean delivery in labor). Case No. 2 and 7 had CS (C-sections) indicated for previous CS delivery, a major obstetric indication in China. The other three cases had requested a cesarean delivery  in spite of any obstetric indications. This partly reflects China’s high rate of CS in the low obstetric risk population .In most cases, women would generally be offered expectant management if a spontaneous miscarriage is highly anticipated. However, the novel use of TNF-α blocker therapy has rendered promising obstetric outcomes in all patients. Safety concerns have also been addressed as no maternal-fetal or neonatal adverse consequences are reported in any patient. To our knowledge, this is the first report on the compassionate use of TNF-α blocker therapy to rescue endangered pregnancies.There are guidelines for pre-conceptional and prenatal care in China, but they aim to serve the general population . Anxiousvia ultrasound despite falling hCG levels.Highly individualized therapies are currently practiced in response to unexpected results revealed in early pregnancy, particularly in women with a history of multiple pregnancy losses but without definite explanatory causes for their recurrent pregnancy losses , 23. We The maternal immune system strikes an intricate balance between supporting embryonic development and maintaining immune responses in pregnancy. A dysregulated maternal immune system in pregnancy can affect obstetric outcomes , 25. TNFWe used adalimumab (Humira) and certolizumab pegol (Cimzia) in all cases. Adalimumab is a monoclonal IgG1 antibody, which is actively transported across the placenta by the neonatal Fc receptor (FcRn) . CertoliIn our case series, we proposed a different therapeutic strategy only when pregnancies were endangered. All cases were closely monitored with serial serum hCG tests before and after adalimumab or certolizumab injection. The trajectory of hCG resumed a normalized pattern day 4.9 on average. In contrast, it takes about two weeks for TNF-α blockers to relieve the symptoms in patients with diseases such as RA. Hence, we assume from the data that it takes much less time for the agents to modulate the microenvironment in the maternal-fetal interface .Compared with low-dose aspirin and LMWH or progesterone used in other clinical trials to prevent miscarriages in recent years, we use the TNFi as the primary therapy for rescuing pregnancies instead of preventing miscarriages , 23, 29.With this trial, we are the first to report a novel strategy with the use of TNFi that could save pregnancies with potential risks of miscarriage. It offers insights to other healthcare providers when they have patients with reduced hCG in early pregnancy. This may benefit pregnancy in the specific situation without compromising maternal and neonatal health. However, there are some limitations to our study. First, the number of this series is too small to reach a consolidated conclusion. Second, all women have been offered a range of medications rather than TNFi-only therapy. The use of medicines could compromise the pharmacological effect of TNF-α blockers in rescuing pregnancy. Third, although all early declines of hCG were observed in the same hospital, human factors could add to inaccurate testing of serum hCG levels in early pregnancy. However, even if we consider this, a sub-optimal growth is still considered to indicate possibly poor embryonic development.Our study has demonstrated that TNFi can reverse potentially poor pregnancy outcomes in the first trimester. However, it can only be used in the context of a clinical research setting, and further trials and experiments should be carried out to confirm the pharmacological effect of TNFi in rescuing pregnancies at risk.Case No. 1: I agree to the novel use of TNFi-led therapy for my specific situation and to report any problems for a better medical understanding and improvement of treatment options for women with a potential risk of miscarriage. I hope this enables the doctors to help pregnant women with safe and effective treatment. I am now very happy with my newborn baby.Case No. 2: I agree to report on my case, the pregnancy, and the data of my baby. I hope this article can help other women like me get appropriate therapy for their threatened miscarriages.Case No. 4: I agree to report my particular condition for a better medical understanding and improvement of treatment options for pregnant women whose hCG declines in early pregnancy. At present, I am 31 weeks pregnant. The antenatal examination and investigations have been normal and the fetus is developing well. I hope that this report could help more patients who share similar conditions with me in China and other countries worldwide.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Ethics Committee of Zhejiang Provincial People’s Hospital. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.ZZ and FZ developed the idea for this study. ZZ wrote the manuscript and FZ reviewed it. YW and GW are involved in the diagnostic and therapeutic care and follow-up of the patients. YW and ZZ are also responsible for the tables and figures formation and revision. All authors contributed to the article and approved the submitted version.This study is co-supported by Zhejiang Provincial Project for Medical and Health Science and Technology (Grant no. 2022503241) and Zhejiang Provincial Project for Medical Education (Grant no. Y202146113).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Cerebral palsy (CP) is an umbrella term where an injury to the immature brain affects muscle tone and motor control, posture, and at times, the ability to walk and stand. Orthoses can be used to improve or maintain function. Ankle-foot orthoses (AFOs) are the most frequently used orthoses in children with CP. However, how commonly AFOs are used by children and adolescents with CP is still unknown. The aims of this study were to investigate and describe the use of AFOs in children with CP in Sweden, Norway, Finland, Iceland, Scotland, and Denmark, and compare AFO use between countries and by gross motor function classification system (GMFCS) level, CP subtype, sex, and age.Aggregated data on 8,928 participants in the national follow-up programs for CP for the respective countries were used. Finland does not have a national follow-up program for individuals with CP and therefore a study cohort was used instead. Use of AFOs were presented as percentages. Logistic regression models were used to compare the use of AFOs among countries adjusted for age, CP subtype, GMFCS level, and sex.The proportion of AFO use was highest in Scotland  and lowest in Denmark . After adjusting for GMFCS level, children in Denmark, Finland, and Iceland had statistically significantly lower odds of using AFOs whereas children in Norway and Scotland reported statistically significantly higher usage than Sweden.In this study, the use of AFOs in children with CP in countries with relatively similar healthcare systems, differed between countries, age, GMFCS level, and CP subtype. This indicates a lack of consensus as to which individuals benefit from using AFOs. Our findings present an important baseline for the future research and development of practical guidelines in terms of who stands to benefit from using AFOs.The online version contains supplementary material available at 10.1186/s12891-023-06554-z. Cerebral palsy (CP) is an umbrella term where an injury to the immature brain affects muscle tone and motor control, and oftentimes also posture and ability to walk and stand . In seveOrthoses, often in combination with other treatments, are used to improve or maintain function. Orthoses might enable activity and participation by facilitating movement, providing stabilization, and to lesser extent reducing pain in children with CP , 5. In SAnkle-foot orthoses (AFO) are the most frequently used orthoses in children with CP –8. In SwIn this study, we described the use of AFOs in children with CP in Sweden, Norway, Finland, Iceland, Scotland, and Denmark, and compared AFO use by country, gross motor function, CP subtype, sex, and birth year.This study was based on cross-sectional register data from children ages 0–18 years included in the follow-up program and national register for individuals with CP in each participating country, Sweden (CPUP); Norway (NorCP); Iceland (CPEF); Scotland (CPIPS); and Denmark (CPOP) . With thhttps://www.arcada.fi/en/research/key-research-activities/cp-north) [Due to the national regulations in some of the countries included, we were not permitted to share individual data across borders. Therefore, data from the latest PT assessments performed in 2017 or 2018 were de-identified and aggregated in each country and compiled per birth year, by CP subtype, sex, gross motor function, and the use of AFOs for all children born between 2000 and 2018 in the register/cohort. Based on the assessment schedules, the participants are assessed once or twice per year or every other year (depending on age and level of gross motor function) by PTs and OTs  and datap-north) .AFO included all types of orthoses that start below the knees, end on the feet, and provide direct control over the foot and ankle joints. Use of AFOs was dichotomized (yes/no). Birth years were categorized into three groups: 2000–2005, 2006–2011, and 2012–2018. Gross motor function was classified according to the Gross Motor Function Classification System (GMFCS) levels (I-V or not classified). GMFCS level I indicates the highest gross motor function and level V the lowest . CP subtThe use of AFOs was presented as percentages (%) and the raw numbers of the denominators (n) were presented by country, birth year group, GMFCS level, CP subtype, and sex. Linearity of the participants’ AFO use by birth year was first inspected through a bar chart of merged data from all countries birth year data. Because there was a peak in AFO use for children born 2006–2011, the decision was made to categorize the participants into three birth year groups. Logistic regression was used to compare the use of orthoses (yes/no) among countries adjusted for birth year group, GMFCS level, CP subtype, and sex. In the regression analysis, data were included only for those children who had subtypes and GMFCS level recorded. Sweden, with the most participants, was set as the reference country.p < 0.05. Given the small sample from Iceland (N = 70), logistic regressions were performed with and without the Icelandic data included. However, the results were similar, and therefore the findings were presented with the Icelandic data included. SPSS v27 was used for all analyses.As the data were aggregated, it was not possible to adjust for sex, CP subtype, and GMFCS level in the same model. Instead, one model that included only country and birth year group, which were available for all participants was used. Subsequently, we adjusted for CP subtype, GMFCS level, and sex in three logistic regressions with AFO use as the dependent variable with 95% confidence intervals (CI) and level of statistical significance set to The proportion of children reported to use AFOs was highest in Scotland with 57% of 1,955 children and lowest in Denmark with 35% of 1,196  of the boys and 31% (10/32) of the girls were reported to use AFOs. In Finland, 44% (115/262) of the boys used AFOs compared to 43% (87/203) of the girls.The use of AFOs differed statistically significantly by country Table . The difDenmark and Finland had statistically significantly lower AFO use ORs in all four models (Denmark range of OR 0.43–0.50 and Finland range of OR 0.68–0.74) than Sweden. In Iceland, the ORs were lower for AFO use than Sweden but this was only statistically significant when adjusting for CP subtype (OR 0.52 CI 0.31–0.86) and GMFCS level (OR 0.58 CI 0.35–0.95). Differences in AFO use between the sexes were close to statistically significant  with higher odds of using AFOs for the girls (OR 1.09 CI 1.00-1.18).In this study, we investigated the prevalence of AFO use in Sweden, Norway, Iceland, Finland, Scotland, and Denmark by birth year group, CP subtype, GMFS level, and sex. Despite having similar healthcare systems and follow-up programs for children with CP, the reported use of AFOs differed substantially among the countries, even after controlling for birth year, CP subtype, GMFCS level, and sex. The results may reflect the heterogeneity of the study population and the subjective decision of when and to whom AFOs should be prescribed. The findings could also be explained by country-specific preferences and traditions in terms of who is believed to benefit from using AFOs. To explain the reasons for the observed differences, more research is needed. The use of AFOs in Sweden has been studied previously by Wingstrand et al. in 2014  and our Prescribing orthoses to children with CP when they may not actually be beneficial to the child is probably not harmful or detrimental to their musculoskeletal care. However, it might restrict the child in terms of participation and carrying out certain physical activities. For example, a child with AFOs might have better stability in standing but may not be able to put on his/her shoes without assistance, which might infringe on their independence. In Firouzeh et al’s review in 2019 they describe the lack of evaluating AFOs in participation and activity outcomes which is important given that more than every second child with CP use AFOs in some countries. Anti et al. suggested already in 2006 that daily routine and floor mobility in small children might be challenged by AFO use , 26. ThiOwen (2020) discusses the importance of goalsetting in terms of activity and participation in addition to biomechanical control , and howThe GMFCS level was the strongest predictor in terms of estimating AFO use in children and adolescents with CP and data on GMFCS level were recorded for almost every child in the study . The GMFCS level associated with the greatest proportion of AFO use, differed among the countries, however. For instance, in Sweden and Norway, individuals at GMFCS level IV were more likely to report AFO use, compared to individuals at GMFCS level III in Finland, Iceland, Scotland, and Denmark. The fact that there were no statistically significant differences between the proportions of AFO use by sex is encouraging given that there are no apparent reasons as to why the use of AFOs should differ between boys and girls.The predictive value determined by Nagelkerke R was low overall (< 16), indicating that CP subtype and GMFCS level are not strong factors in terms of predicting which children with CP will use AFOs, although both are important factors in the prescribing process. This highlights the need for clearer evidence-based guidelines to help providers and families decide who should be prescribed AFOs. If the work on when to use lower extremity orthoses begun by Owen  is develThe fact that we had to use aggregated data affects the ability to adjust for country, gross motor function, CP subtype, sex, and birth year group in the same model, which might have given us a more precise view of who is the most typical AFO user. Although not included as an aim, it would still have been helpful to have had more information available regarding if and when a child might have used AFOs in the past. Despite this study being population-based in Scotland, Norway, Denmark, and Sweden, the small, perhaps not representative, number of participants in Iceland and Finland might limit the generalizability. In addition to this, a small number of individuals from Iceland were included, which means that the data from a few individuals had a large impact on the group percentages. However, this also reflects the small overall population of Iceland. Furthermore, given that the CP subtype is not always determined before the child’s fourth birthday, the subtypes for the children under five years of age should be interpreted with caution. In addition, Sweden had a large percentage of missing diagnoses of CP subtype (38%), which has been an ongoing problem due to lack of neuropediatricians. This is currently being remedied and future studies including Swedish CPUP data should have less missing data on CP subtype. Finally, some children with suspected but not diagnosed CP might have been included in the study given that also children younger than 4–5 years of age, the age when a diagnosis of CP is generally made, were included. However, we know from many years’ experience that most young children included in the follow-up program do eventually get a diagnosis of CP.This study contributes to our understanding of the use of AFOs in children with CP in Northern Europe, where AFOs are provided free of charge at the point of use. We found that the AFO use in children with CP in countries with similar healthcare systems, differed between countries, age, level of gross motor function, and CP subtype. Our findings present a baseline for the future research development of practical guidelines in terms of who stands to benefit from using AFOs.Below is the link to the electronic supplementary material.Supplementary Material 1"}
{"text": "The suspension of the penis is provided by two ligaments: fundiform and suspensory. These ligaments are sectioned during some augmentative surgical procedures. The structure, the relations and the variability of these ligaments have been demonstrated. The penile neurovascular bundle and its relationships have also been emphasized. A clear knowledge of these details should ensure a reduction of the risk of surgical injury during augmentation procedures.We dissected the ligaments providing the suspension of the penis in 7 formalized corpses. We identified, for each of the ligaments, the origin, the insertion and the relations. The dissection pieces were photographed and the images obtained were discussed upon. We described the variability of the anatomical distribution and highlighted the relations with the vascular and nervous structures for each of these ligaments. The anatomical variability of the fascia and the relations with the base of the penis were also emphasized. For the suspensory ligament, we identified three groups of fibers through which it is attached to the penile body.The dissections were conducted in layers, corresponding to the operative steps for the penile augmentation procedures. We believe that our study highlights the anatomical basis necessary to safely perform these surgeries. The study contributes to the description of the anatomical variability of the ligaments and logically presents details that contribute to preventing most surgical incidents. There are two ligaments that contribute to the maintaining of the physiological prepubic curvature of the penis: a superficial one, known as the fundiform ligament, and a deeper one, known as the suspensory ligament . These lIn the context of a considerable amount of social pressure that links sexual performance to the size of the penis, penile lengthening surgeries have been proposed to men with true congenital microphallus, which is defined as a penis with normal anatomy, but with a size less than 2.5 SD below the normal population  or condiLittara et al.  stated tThe surgical lengthening technique mainly involves an inverted \"V–Y\" penopubic skin advancement , with idThe procedure might require the addition of a silicone spacer placed between the penis and the pubis, mainly to prevent the ligaments from reattaching . The surIn the literature, however, we have encountered terminology that can often be confusing. For example, in “Traité d'Anatomie humaine—par L. Testut” only the suspensory ligament is described, while other publications such as “Gray's Anatomy – The Anatomical Basis of Clinical Practice 41st Edition” do not mention the fundiform ligament. In other articles, the term fascia Scarpa is used to describe the fundiform ligament , 15. On In this study, we aim to identify these ligaments by dissection, to describe the important vascular and nervous relations and to demonstrate the distribution of the different structural bundles.The dissections were performed on seven cadavers in the laboratory of the Anatomy Department of the “Carol Davila” University of Medicine and Pharmacy.The cadavers have been previously formalized by injection into the femoral artery with a 10% formalin solution and then kept for 30 days in tanks containing the same concentration of formalin.The dissections were performed in anatomical layers. The fundiform and suspensory ligaments were identified and the origin, insertion, dimensions and relations with the penile sheaths were described. The dissection pieces were photographed and discussed upon. The images have been digitally edited without altering the scientific content.To identify the fundiform ligament, we sectioned and then removed the skin and the superficial abdominal fascia.A unique triangular structure;A double structure accompanied by accessory fascicles;A ligament structure with the aspect of an undifferentiated fibrous connective band.We have identified three types of fundiform ligament:In four cadavers, the fundiform ligament was identified in the form of a unique triangular-looking fibrous structure, with the superior angle attached to the abdominal linea alba. Its length was between 5–7 cm, measured from the dorsal aspect of the penis to the apex of the ligament. Its width at the base is between 2–3 cm.Figure In the upper part, the deep aspect of the ligament is attached to the abdominal linea alba. The ligament descends anteriorly from the pubic symphysis. The insertion allows a relatively easy separation of the ligament from the white line and its isolation by surgical dissection. Some of the fibers of the suspensory ligament are attached to the superficial fascia of the penis, while others surround the penile body. This arrangement explains the formation of the prepubic curvature of the penis. Sometimes this attachment can have a lower placement .In one cadaver, we identified a fundiform ligament with a complex appearance. See Fig. Figure This double structure must be taken into account when the surgeon intends to section the fundiform ligament. It is obvious that there may be a risk of sectioning a single ligament component. As can be seen in Fig. The additional lateral ligament bundles were detached and folded down in the next step of the dissection of the cadaver depicted in Fig. The third variant of fundiform ligament is presented in Fig. In the situation depicted in Fig. In the dissection depicted in Figs. The suspensory ligament originates on the subsymphyseal angle and attaches to the dorsal aspect of the penis, deep to the fundiform ligament , 19.It mainly consists of two laminas that fuse anteriorly in a unique border, creating the appearance of a triangular pyramid , 17. TheFigure In Fig. In Fig. Figure After the complete removal of the two ligaments and of the deep fascia of the penis, the dorsal neurovascular bundle becomes apparent in Fig. The issue of maintaining the penile body in position whilst also keeping it on the midline during penile aesthetic surgeries is solved in a complex way. Both the fundiform and the suspensory ligaments connect the penis to the pelvic wall. The terminal fibers of these ligaments surround the penile body in a hammock-like manner and create the presymphyseal curvature of the penis. However, the median bundle fibers of the suspensory ligament that originate on the inferior aspect of the symphyseal arch end directly on the deep penile fascia and keep the penile body on the median line. The possibility of damaging either the external pudendal vessels (located at the base of the fundiform ligament) or the dorsal neurovascular bundle of the penis (located at the base of the suspensory ligament) represents a real surgical risk in ligamentolysis.The space between the penis and the symphyseal arch is closed from superficial to deep by the divergent bundles of the fundiform ligament, the lateral blades of the suspensory ligament and the median bundle of the suspensory ligament. This space is also limited by the connective fibers system that early anatomists called the Luschka ligament .It is obvious that if the suspensory apparatus is sectioned, this morphofunctional unit located between the penis and the pelvic wall loses its function and the movements of the penile body no longer faithfully follow the movements of the pelvis. Furthermore, this can also result in changes in the anterior curvature of the penis.Regarding penile augmentation following the sectioning of the suspensory apparatus, we state that the relative penile elongation is the result of the decrease of the penile presymphyseal curvature. The possible aesthetic benefit is drastically impaired by the dynamic functional disadvantage, as mentioned above. The main surgical risk is the injury of the external pudendal vessels or of the dorsal vascular bundle of the penis, in which case, a local hematoma may form and subsequently migrate inside the pelvis, through the space between the dorsal aspect of the penis and the symphyseal arch."}
{"text": "Early-life animal exposure has been associated with both protective and harmful effects on asthma and allergic disease. We aimed to explore factors that may modify associations of early-life animal exposure with asthma and allergic disease, so as to better understand these differences in findings.We used data from ≤84 478 children from the Danish National Birth Cohort recruited during pregnancy between 1996 and 2002, and linked registry data up to the child’s 13th birthday. Adjusted Cox models were used to examine associations of early-life cat, dog, rabbit, rodent, bird and livestock exposure with atopic dermatitis, asthma and allergic rhinoconjunctivitis overall, and by source of exposure (domestic or occupation), parental history of asthma or allergy, maternal education level and timing of exposure.Overall, associations between animal exposure and the three outcomes of interest were weak. However, dog exposure was associated with marginally lower risk of atopic dermatitis and asthma , whereas prenatal domestic bird exposure was associated with slightly increased risk of asthma . Source of exposure, parental history of asthma or allergy and timing of exposure modified associations. Early-life animal exposure did not appear to increase the risk of allergic rhinoconjunctivitis .The overall weak associations observed between animal exposure and atopic dermatitis, asthma and allergic rhinoconjunctivitis were modified by type of animal, source of exposure, parental history of asthma or allergy and timing of exposure, suggesting that these factors should be considered when assessing the risks associated with early-life animal exposure. Key MessagesWe used data from a large prospective birth cohort to examine associations of early-life animal exposure with childhood atopic dermatitis, asthma and allergic rhinoconjunctivitis, including potential modifying factors.Overall, associations between animal exposure and the three outcomes of interest were weak.Early-life dog exposure was associated with marginally lower risk of atopic dermatitis and asthma, whilst early-life bird exposure was associated with marginally increased risk of asthma.There was no evidence of early-life animal exposure increasing the risk of allergic rhinoconjunctivitis.Source of exposure, parental history of asthma or allergy and timing of exposure were observed to modify associations, suggesting that these factors should be considered when assessing the risks associated with early-life animal exposure.Atopic dermatitis (AD), asthma and allergic rhinoconjunctivitis (AR) are complex, multifactorial diseases that commonly co-exist as multiple morbidities,,Studies have shown that exposure to animals can increase the diversity of the gut microbiomeAlthough most studies have focused on the risks associated with cats and dogs or ‘furry pets’ as a single entity, it is also likely that associated risks will vary depending on the type of animal. For example, animals such as rabbits, rodents and birds are less popular as pets ,The aim of the current study was to comprehensively examine associations of early-life animal exposure with later risk of AD, asthma and AR, including potential modifying factors, in a large prospective birth cohort. We specifically examine: (i) overall associations between prenatal species-specific animal exposure and risk of AD, asthma and AR; (ii) whether associations vary by source of exposure; (iii) the possibility of reverse causation; and (iv) the relative influence of prenatal vs early-childhood exposure.The Danish National Birth Cohort (DNBC) is a nationwide birth cohort study that was established between 1996 and 2002.IJE online).The current study includes all live-born singleton children participating in the DNBC with information on maternal animal exposure during pregnancy and relevant covariates . ParticiIJE online).,Children with AD, asthma and AR were identified using linked hospital episode (inpatient and ambulatory) and/or prescription data held in the Danish National Patient RegisterIJE online).In sensitivity analyses, we used the following outcome definitions based on parental-reported symptoms and/or disease outcomes obtained from questionnaires: AD derived from a validated algorithm created for DNBC at 18 months;IJE online).Information on mothers’ animal exposure was obtained during the first prenatal telephone interview, at ∼16 weeks’ gestation, where mothers were asked about their domestic (pet), occupational and farm-related contact with animals, including type of animal (questions are provided in These data were used to create six binary variables (yes/no) capturing combined domestic, occupational or farm-related prenatal exposure to dogs, cats, rabbits, rodents, birds and livestock. Six categorical variables were also created detailing source of exposure for each animal group .IJE online). These data were combined with information on prenatal animal exposure to create categorical variables relating to the timing of cat, dog, rabbit, rodent and bird exposure .Information on the index child’s exposure to animals in the first 2 years of life was obtained during the 18-month telephone interview, in which mothers were asked to name any animals the child was in contact with (detailed in IJE online). Potential confounders included: (i) maternal asthma (yes/no); (ii) maternal inhalant allergy (yes/no); (iii) paternal asthma (yes/no); (iv) paternal allergy (yes/no); (v) maternal education (low/medium/high); (vi) quartiles of equivalized disposable household income the year prior to the child’s birth; (vii) maternal age at birth; (viii) number of children living in the home (0/1/≥2); (ix) household crowding (≤0.5/>0.5–1/>1 person per room); (x) smoking during pregnancy (yes/no); (xi) living in Copenhagen at birth (yes/no); (xii) sex.Potential confounders were identified based on the literature and the causal model represented in a directed acyclic graph .In sensitivity analyses, we explored the sensitivity of findings to the applied definition of AD, asthma and AR. For these analyses, questionnaire-derived and register-based outcomes were analysed using logistic regression, restricted to the same children . Interestingly, any protective effect of animal exposure on asthma or AR was negated if the child developed AD (IJE online). In some instances risks were elevated, notably for associations of early-life rabbit or livestock exposure with asthma  (IJE online).Overall, effect estimates were relatively small for all prenatal animal exposures . PrenataIJE online).In sensitivity analyses, results were largely consistent for reported and register-based outcomes  exposures , which iIJE online).Since evidence suggests that families with asthma or allergies may avoid petsPinteraction > 0.10) (IJE online).We explored the potential for reverse causation further by examining whether maternal education modified associations. Knowledge acquired through education may affect receptiveness to medical advice,n = 61 290, In a subset of children with information on both prenatal and early-childhood animal exposure (IJE online) and also the large proportion of farm and occupationally related prenatal bird exposures (For rabbits, rodents and birds, the majority of exposures occurred prenatally only . This poxposures . The infxposures .In this study of ≤84 537 children from the DNBC, we used detailed information on early-life animal exposure, including type of animal, source and timing of exposure, and linked population-based register data to examine how early-life animal exposure influences the risk of AD, asthma and AR. Overall, effect estimates for animal exposure were relatively small. We did, however, observe evidence that early-life exposure to dogs may offer some slight protection against AD and asthma, but that prenatal exposure to birds may slightly increase the risk of asthma. We also observed evidence that source of exposure, parental history of asthma or allergy and timing of exposure may modify associations. Associations with AR were weak but did not indicate any harmful effect of early-life animal exposure.The strengths of this study include its large size, prospective design and detailed information on prenatal animal exposures, encompassing domestic, occupational and farm-related exposures, as well as exposure to animals other than cats and dogs, which have been less studied. We based our outcome measures on linked hospital episode and/or disease-specific prescription data, which allowed complete follow-up, thereby minimizing selection bias due to non-participation. Using registry-based outcomes likely increased the specificity of our outcome measures,,However, our study also has several limitations. First, our register-based AR outcome will lack sensitivity to identify milder cases of the disease that can be treated using over-the-counter medication. This may explain the small effect estimates observed for AR. Similarly, due to the lack of specificity of medication used to treat AD, we based our definition of AD solely on ICD-10 codes and will have missed milder cases of AD. Nonetheless, effect estimates for AD were similar to those obtained using caregiver-reported symptoms in sensitivity analyses. We also did not consider different disease phenotypes in our analyses, which may have different environmental associations.,,,,,,,,The literature regarding the influence of early-life animal exposure on later risk of asthma and allergic disease is conflicting.The literature regarding the effects of early-life exposure to rabbits, rodents and birds on the risk of asthma and allergic disease is sparser. A meta-analysis of European birth cohort data found no association between rodent or bird exposure and school-age asthma or AR,The tendency we observed for animal exposure to be associated with lower rates of AD, asthma and AR among children with parental history of asthma or allergy compared with children without could be consistent with reverse causation, namely the avoidance of pets by families with pet allergies,In conclusion, whereas overall our findings do not indicate a strong role for early-life animal exposure in the development of AD and asthma, they do point towards early-life dog exposure offering some slight protection against AD and asthma, and bird exposure increasing the risk of asthma. Source of exposure, parental history of asthma or allergy and timing of exposure may also modify risks. Our results were more consistent for AR and did not suggest an increased risk with early-life animal exposure.The DNBC is approved by the Danish Data Protection Agency and the Committee on Health Research Ethics. The DNBC participants were enrolled by informed consent. This study received approval from University of Copenhagen Faculty of Health and Medical Sciences under case number 514–0538/20–3000.dyad040_Supplementary_DataClick here for additional data file."}
{"text": "The COVID-19 pandemic has had an impact on the emergency department (ED). Door-to-needle time (DNT) could be prolonged for intravenous thrombolysis (IVT) treatment. We aimed to investigate the impact of two COVID-19 pandemics on the workflow of IVT in our neurovascular ED.We performed a retrospective analysis of patients who received IVT treatment in the neurovascular ED of Beijing Tiantan Hospital, Beijing, from January 20, 2020, to October 30, 2020, covering two COVID-19 pandemics in China. The time-based performances of IVT treatment including onset-to-arrival time, arrival-to-CT time, CT-to-needle time, door-to-needle time, and onset-to-needle time were recorded. Data on clinical characteristics and imaging information were also collected.n = 95). Longer DNT  interval delays were observed during the two pandemics (p = .016). More patients admitted during the two pandemics had an ‘unknown’ subtype . The percentage of the cardiac embolism subtype was higher during the Wuhan pandemic (20.0%) than during other periods. The median admission NIHSS score increased during the Wuhan pandemic and the Beijing pandemic .Four hundred forty patients that received IVT were enrolled in this study. The number of patients admitted to our neurovascular ED began to decrease in December 2019 and was the lowest in April 2020 (The number of patients who received IVT decreased during the Wuhan pandemic. Higher admission NIHSS scores and prolonged DNT intervals were also observed during the Wuhan pandemic and the Beijing pandemic. The COVID-19 pandemic has had a great impact on global medical systems including the neurology department and other internal medicine departments [rd among the top 10 causes of disability-adjusted life-years in 2019 [Stroke ranked the 3 in 2019 , and neu in 2019 . During  in 2019  due to t in 2019 –9. How tWe retrospectively analyzed the data from our stroke center before, during and after the two COVID-19 pandemics in China to investigate the impact of the COVID-19 pandemic on IVT treatment to help improve the workflow of IVT treatment in neurovascular emergencies.We performed a retrospective analysis of patients who received IVT treatment in the neurovascular emergency department of Beijing Tiantan Hospital, Beijing, from January 20, 2020, to October 30, 2020, covering two COVID-19 pandemics in China . Pandemic response measures, including lockdowns, were triggered in Wuhan in January 2020, and it was the first COVID-19 pandemic in China. Xinfadi is a large market of vegetables and fruit near our stroke center at Beijing Tiantan Hospital in Beijing. Xinfadi experienced a COVID-19 pandemic in June 2020, and the emergency rooms of Beijing Tiantan Hospital, including its neurovascular emergency department, were influenced. Patients who received IVT treatment from January 2019 to October 2019 were included as a reference. Based on the periods of the two pandemics, we divided our participants into 5 groups: pre-COVID-19 group, from January 1, 2019 to October 30, 2019; Wuhan pandemic group, from January 20, 2020 to April 26, 2020; post-Wuhan-pandemic group, from April 27, 2020 to June 10, 2020; Beijing pandemic group, from June 11, 2020 to July 21, 2020; and post-Beijing-pandemic group, from July 22, 2020 to October 30, 2020.The study was conducted in accordance with the Declaration of Helsinki. The fully deidentified data on the patients enrolled in the current study and its retrospective study design enabled this study to be conducted under a waiver of informed consent by the local institutional review board. The study was approved by the ethics committee of Beijing Tiantan Hospital (No.: KY2015-001–01). This manuscript was based on the Strengthening the Reporting of Observational Studies in Epidemiology statement to report the results of the current study.All patients who received IVT treatment were consecutively enrolled. The inclusion criteria were as follows: 1) diagnosed with acute ischemic stroke in our neurovascular emergency department; 2) received IVT with alteplase (0.9 mg/kg) within 4.5 h from symptoms onset; and 3) had a cranial CT/MR scan within 24 h of IVT treatment.The demographic information among the enrolled patients included age, sex, medical history, alcohol and tobacco intake and medication history. Onset-to-arrival time , arrival-to-CT time , CT-to-needle time (defined as time of the first CT scan to time of the IVT initiation), door-to-needle time  and onset-to-needle time (from stroke onset to time of the IVT initiation) were recorded to evaluate the influence of the COVID-19 pandemic on the workflow of IVT treatment in our neurovascular emergency department. Patients confirmed to have large vessel occlusion of the anterior circulation were evaluated if they were eligible for bridging mechanical thrombectomy (MT) therapy. Stroke severity was measured by the NIHSS score . The TriP value < 0.05 was considered statistically significant.Continuous variables are expressed as the mean ± SD for normally distributed data and median (interquartile range) for nonnormally distributed data. Categorical variables are expressed as numbers (percentage). Normally distributed data were compared using one-way ANOVA, and nonnormally distributed data were compared using the Kruskal–Wallis test. Categorical variables were compared using the χ2 test, as appropriate. All statistical analyses were performed with SPSS 26.0. A p = 0.072). The percentages of males during the Wuhan and Beijing pandemics were 70.7% and 82.9%, respectively   and IVT bridging MT (n = 11) . However, the percentage of DNT time ≤ 60 min did not decrease significantly during the two pandemics (p = 0.146). Compared with the CT-to-tPA time, the arrival-to-CT time was prolonged during the two pandemics .Longer DNT interval delays were observed during the two pandemics . The percentage of the CE subtype during the Wuhan pandemic was higher than that during the other periods (20.0%). The median admission NIHSS score during the Wuhan pandemic increased compared with that during the pre-COVID-19 period . The Beijing pandemic had a higher median admission NIHSS score than the Wuhan and Beijing pandemics . While this difference remained after the intravenous tPA drip finished (p = 0.013), the NIHSS score was similar at 2 h (p = 0.411) and 24 h after IVT (p = 0.275). Lower percentages of minor stroke (NIHSS score ≤ 3) were observed during the two pandemics . Patients who received IVT treatment during the Wuhan pandemic had the highest percentage of sICH of the SITS classification, (7.3%) and patients who received IVT treatment after the Beijing pandemic had the highest percentage of sICH of the ECASS II classification (11.7%).For the TOAST subtype of ischemic stroke, more patients admitted during the two pandemics had stroke of undetermined etiology . However, during the Beijing pandemic, the percentage of CE subtypes was the lowest (5.71%). Many patients receiving IVT rejected admission to neurology inpatient wards to complete further examinations on the TOAST subtype during the Beijing pandemic. Some patients with the CE subtype might be classified into the unknown subtype (30%). During the Wuhan pandemic, four stroke centers from Wuhan also admitted more patients with the CE subtype and an elevated percentage of stroke of undetermined etiology, which is consistent with our study . A largeAs the global pandemic of COVID-19 shows no tendency to cease, stroke centers are faced with its impact on neurovascular emergencies, including prolonged DNT time and a shortage of stroke team members. Studies on the workflow of neurovascular emergencies are warranted to minimize the DNT delay and door-to-puncture time to achieve rapid recanalization and more favorable functional outcomes . Most ofSeveral limitations have to be admitted in our study. The retrospective and single-center study design may introduce selection bias. However, as the Chinese government transferred many doctors to fever clinics during the COVID-19 pandemics, stroke emergency and neurology inpatient wards lacked doctors to conduct a prospective cohort or registry study that included hospitals from different regions. Second, the sample size of our study may be small. However, our single-center, retrospective study did not depend on a large study sample, and our study provided a larger sample than another retrospective study from China . Third, Our study found that the number of patients who received IVT decreased during the Wuhan pandemic. Higher admission NIHSS scores and prolonged DNT intervals were also observed during the Wuhan pandemic and the Beijing pandemic."}
{"text": "To analyze corneal sensitivity with a new noncontact and hand-held esthesiometer  in patients with dry eye disease (DED) and patients on hypotensive drops, and to compare it with healthy subjects.31 patients (57 eyes) with DED, 23 patients (46 eyes) with glaucoma and 21 healthy patients (33 eyes) were recruited. In all patients, corneal sensitivity was measured. Subsequently, a keratography test  was carried out to measure tear meniscus height (TMH), non-invasive break up time (NIBUT), bulbar redness  and corneal staining . Both corneal sensitivity and ocular surface parameters were compared between DED, glaucoma, and healthy subjects. Linear mixed models were constructed to utilize data from both eyes of patients. A 95% confidence level was considered statistically significant.The mean age was 56.1±16.1 years in DED group, 69.5±11.7 years in the glaucoma group and 36.3±10.5 years in the control group. Adjusting for age and sex, esthesiometry was significantly worse in DED and glaucoma vs control group . NIBUT was lower in DED and glaucoma patients . Redness and CS values were higher in DED group . TMH was lower in the glaucoma patients (p = 0.03).Corneal sensitivity measured with a novel noncontact esthesiometer was reduced in DED and glaucoma patients compared to controls. In clinical practice, this esthesiometer could be an easy-to-use device to evaluate for patients with subclinical neurotrophic keratopathy. Dry eye syndrome is one of the most frequent ocular surface diseases (OSD), and is characterized by a loss of tear film homeostasis followed by ocular symptoms. Inflammation and damage to the ocular surface, neurosensory abnormalities, tear film instability, and hyperosmolarity all play etiological roles . AnotherThe stimulation of sensory nerves at the ocular surface may explain why symptoms are present . HoweverIn vivo confocal microscopy (IVCM) can be used to observe and evaluate morphology and number of corneal nerves  , 40 in pThis study was approved by the Institutional Review Board of the University of Miami Miller School of Medicine. The protocol conformed to the requirements of the United States Health Insurance Portability and Accountability Act and the tenets of the Declaration of Helsinki. The DED group in the study were those with Ocular Surface Disease Index (OSDI) score ≥ 13 and/or signs of DED, corneal staining (CS) ≥ 2 and/or non-invasive break up time (NIBUT) average < 10. The calculation of these metrics is discussed below. The glaucoma group included those who use or used at any time in the past ocular hypotensive medications. Finally, the control group was comprised of healthy patients who were asymptomatic with no signs or symptoms of dry eye and did not use any type of eye drops or topical medication that may affect the ocular surface. Exclusion criteria for both groups included pregnancy and ages less than 21 or over 90 years. Patients in the study were evaluated at the Bascom Palmer Eye Institute and informed consent was obtained from all of them prior to clinical examination. All patients were asked about ocular pathologies, use of contact lenses or eye drops, and previous ophthalmologic surgeries.Ocular symptoms were evaluated using the OSDI test before performing the rest of the clinical examinations. It is the most used questionnaire for determining symptom severity in ocular surface disease patients. It is comprised of 12 questions about the signs and symptoms of dry eye, how they affect vision, the restrictions they bring about, and environmental variables that may contribute to dry eye. Each question is given a score between 0 and 4. The values are then summed, and a subject with a score ≥ 13 was considered symptomatic.The corneal sensitivity was measured using a non-contact esthesiometer . This device produces pulses of air at different intensities, with five levels and a pressure range of 2 mbar to 10 mbar. Each pressure range is defined as the average estimated pressure over a 0.4 mm diameter surface which is 4 mm distant from the outlet nozzle. To ensure that the assessment is performed at the correct distance, it has a camera and an electronic positioning system. The test was performed by placing the device on the slit lamp. Three measurements at each level were taken, in the lower quadrant of the cornea, starting at the lowest level (level 1–2mbar) and increasing it until the patient sensed the air puff. The lowest level that the patient could feel the air was recorded. In patients who denied any sensation, the value was recorded as 11 mbar, one mbar above the maximum value of the instrument.The Oculus Keratograph 5M Topographer  was used for the examination of the ocular surface. The following parameters were measured: tear meniscus height , average non-invasive break up time , and bulbar redness . After applying topical fluorescein, CS was determined, using the OXFORD Scheme grading scale .Statistical analysis was performed using R 4.2.2 . Analyses were completed using linear mixed models with random effects placed at the patient level to account for inter-eye correlations as previously completed . Data weThis study evaluated a total of 136 eyes from 75 subjects. A total of 57 eyes from 31 subjects were in the DED group, 46 eyes from 23 subjects were in the glaucoma group, and 33 eyes from 21 subjects were controls. Demographic data are provided in P = 0.009 and P = 0.023, respectively  with significant differences observed between the glaucoma and DED eyes when compared to controls (ectively .P = 0.04). When evaluating the relationship between corneal sensitivity and the total number of IOP-lowering medications that an eye was receiving, there was a trend towards lower corneal sensitivity in those eyes on ≥ 3 IOP-lowering medications but no statistical significance (P = 0.059).Relationships between the number of daily IOP-lowering drop applications and topical hypotensive medications with corneal sensitivity levels were examined. Corneal sensitivity levels in eyes that receive ≥ 3 administrations of IOP-lowering hypotensive eyedrops daily were significantly lower compared to eyes receiving 2 or fewer applications of hypotensive eyedrops daily , but not in the glaucoma group (P = 0.35 and P = 0.09 respectively). TMH was significantly lower in glaucoma eyes compared to controls (P = 0.03). OSDI score was significantly higher in DED group, but in not the glaucoma group, compared to controls .NIBUT was significantly reduced in DED and patients using IOP-lowering medications, with significant differences observed  were NIBUT, TMH, conjunctival redness and CS. NIBUT was significantly lower in the DED and glaucoma group compared to controls, as shown in other previous studies , 44. TheDED eyes had significantly higher OSDI test scores compared to controls. It is interesting how in these patients, symptoms are greater than in healthy subjects despite having decreased corneal sensitivity. This has already been shown in some studies that have observed that there is no correlation between symptoms and signs in patients with OSD , 8. But Corneal sensitivity measured with this novel noncontact esthesiometer was reduced in DED patients compared to controls. This finding is consistent with prior studies in which esthesiometry was analyzed , 46, 47.Sensitivity was also significantly reduced in glaucoma patients who used ocular hypotensive eye drops, compared to dry eye patients and controls, which has been reported previously by other groups , 19. It Non-contact corneal esthesiometry may be an excellent diagnostic tool, which can be easily performed by any ophthalmic technician, to determine when corneal sensitivity starts to decline in patients using topical glaucoma medications. At this point, it may be appropriate to switch these patients to preservative-free hypotensive medications, perform laser trabeculoplasty or consider surgical intervention to eliminate or reduce the number of glaucoma medications. This strategy may avoid causing an irreversible neurotrophic keratopathy .This study also evaluated whether corneal sensitivity levels had a relationship with topical medications used in the glaucoma group. For the analysis we have utilized two different metrics, the number of drops applications daily and the number of different IOP-lowering medications. For example, a patient on timolol twice daily and latanoprost nightly would have 3 drop administrations daily but would only be on two medications. On one hand, the relationship between the number of daily drop instillations and corneal sensitivity showed a significant reduction in those who used ≥ 3 IOP-lowering drops per day. On the other hand, when examining the relationship between the number of medications used and corneal sensitivity, a tendency to lower sensitivity was observed in patients using ≥ 3 different medications, but it was not statistically significant. These differences in results may be because the use of a greater number of drops per day also involves a greater application of preservatives, which have been associated with corneal nerve damage in glaucoma patients . TherefoThere are various limitations to this study. First, sensitivity testing is subjective because the patient determines whether they perceive the stimulus or not. The differences between esthesiometry levels are minimal and sometimes patients did not perceive the air puff, but when repeating the measurement with the same pressure they did feel it. For this reason, the measurement was repeated three times at each level. Second, patients in this study were not separated based on the type or duration of the hypotensive eye drops they were using. Further studies will be required to elucidate this aspect.Despite its limitations, to our knowledge this study is the first to evaluate corneal sensitivity in patients with dry eye disease and patients using glaucoma medications using Brill’s non-contact air esthesiometer. In clinical practice, this esthesiometer is a portable and easy to use screening device to evaluate corneal sensitivity in dry eye disease and glaucoma patients. This may allow to detect early stages of neurotrophic keratopathy and, consequently, implement therapeutic actions to avoid long-term damage of corneal nerves."}