diff --git "a/deduped/dedup_0967.jsonl" "b/deduped/dedup_0967.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0967.jsonl"
@@ -0,0 +1,60 @@
+{"text": "There are no studies investigating the effect of the contrast infusion on the sensitivity and specificity of the main Doppler criteria of renal artery stenosis (RAS). Our aim was to evaluate the accuracy of these Doppler criteria prior to and following the intravenous administration of perfluorocarbon exposed sonicated albumin (PESDA) in patients suspected of having RAS. Thirty consecutive hypertensive patients  suspected of having RAS by clinical clues, were submitted to ultrasonography (US) of renal arteries before and after enhancement using continuous infusion of PESDA. All patients underwent angiography, and haemodynamically significant RAS was considered when \u226550%. At angiography, it was detected RAS \u226550% in 18 patients, 5 with bilateral stenosis. After contrast, the examination time was slightly reduced by approximately 20%. In non-enhanced US the sensitivity was better when based on resistance index (82.9%) while the specificity was better when based on renal aortic ratio (89.2%). The predictive positive value was stable for all indexes (74.0%\u201388.0%) while negative predictive value was low (44%\u201351%). The specificity and positive predictive value based on renal aortic ratio increased after PESDA injection respectively, from 89 to 97.3% and from 88 to 95%. In hypertensives suspected to have RAS the sensitivity and specificity of Duplex US is dependent of the criterion evaluated. Enhancement with continuous infusion of PESDA improves only the specificity based on renal aortic ratio but do not modify the sensitivity of any index. Renal artery stenosis is the most frequent cause of secondary hypertension  which isThe proposed criteria for the detection of renal artery stenosis by direct Doppler include an increased peak systolic velocity, an increase in renal aortic ratio and also an increased resistance index . The mea\u00ae echo-enhancing ultrasonography in hypertensives with renal artery stenosis. They demonstrated a sensitivity of 85% and a specificity of 79% without contrast and a sensitivity of 94% and a specificity of 88% with contrast, besides an important reduction in the time of procedure. The echo-enhancing agent PESDA  is a second-generation agent, containing high molecular weight gas, whose use results in higher stability and better reflections of Doppler signs . The following spectral Doppler diagnostic criterion for renal arterial stenosis were used: a) PSV > 150 cm/s [26-27]; b) RAR > 3.0 ; c) RI >We also collected clinical data, including number of drugs, serum creatinine and values of blood pressure in baseline conditions. The results of PESDA-enhanced and non-enhanced ultrasound examinations were compared with those from intraarterial angiography. A hemodynamically significant stenosis was defined as diameter reduction of 50% or more at angiography, because it has been widely used in the recent literature . The radSecondary efficacy variables included the duration of each Doppler examination, the detection of supernumerary arteries and adverse effects. The study was approved according to local legal requirements and informed consent was obtained before ultrasound examination from all patients.All patients underwent digital subtraction angiography and non-enhanced US. One patient did not receive the infusion of contrast, because the venous access was not possible. Renal arterial stenosis of 50% or greater was detected at angiography in 18 (60%) patients, 5 of whom had bilateral stenosis. Renal arterial stenosis was excluded in 12 patients. Thus, stenosis by angiography was detected in 23 arteries, while 37 arteries did not present. The clinical and demographic data of patients according to the presence of stenosis are presented in the Table Overall, all patients had the renal arteries assessable with non-enhanced US or after injection of PESDA, although in one patient with a high body mass index, the assessment was better after contrast. Despite an expectation of at least 20% accessory arteries, we did not find any in our population.As stenosis is mostly in ostium and proximal portion of the arteries, we considered for diagnosis of renal artery stenosis the indexes obtained by echo-Doppler in these arterial segments. The mean values of PSV, PDV, RAR, RI and PI in these segments are showed in the tables The sensitivity, specificity, positive predictive value and negative predictive value of each Doppler index for the detection of RAS Table  were calThe receiver operating characteristic curves for each Dopplerdiagnostic criterion showed that the area under the receiver operating characteristic curve for resistance index was greater than the area under the curve for peak systolic velocity and renal aortic ratio. For renal aortic ratio, the cutoff point that provided the best accuracy, 2.7 gave a specificity of 96% but a low sensitivity (60%). For peak systolic velocity, no precise cutoff point could be identified between arteries with stenosis and those without stenosis. For resistance index, a threshold of 0.8 led to a sensitivity of 70% and a low specificity of 56.8%. The median examination time was 35 minutes for enhanced Doppler US and 29 minutes for non-enhanced Doppler US, i.e., a small but significant reduction of 17% (p = 0.03). Only one patient presented adverse events to be potentially related to the injection of PESDA, including sensation of coldness, palpitation and dyspnea. There was no severe adverse event. Although the technique of renal arterial US scanning has been well established for years, a lot of difficulties in reliably identifying main and accessory renal arteries remain -10,25. MThe most important conclusion from this study is that both sensitivity and specificity of Doppler US of renal arteries are strongly dependent on the criterion used, and the infusion of PESDA contrast seems not to improve it significantly, although we observe a slight increase in specificity. Thus, the best sensitivity was obtained when based on resistance index <0.8 (82.9%) but at expense of a low specificity (56.8%). On the other hand, the best specificity was obtained with renal aortic ratio >3 (89.2%), but the sensitivity was low (56.2%). In addition, the sensitivity and specificity for a peak systolic velocity of 1.5 m/sec showed intermediate values, respectively, 61.9% and 64.9%. An analysis of previously published studies ,15,16,20\u00ae in hypertensives with renal artery stenosis. In a more recent multicentric study the contrast Levovist did not affect either sensitivity or specificity: sensitivity was 80.0%\u201383.7%, whereas specificity moderately increased from 80.8% to 83.6% or 86.2%, depending on the subgroups of comparable patients. In two single-center studies in which the value of Doppler US examination after intravenous injection of contrast agents for the diagnosis of renal arterial was also evaluated it was demonstrated an improvement in sensitivity, which increased from 83% to 95% in one study and from 75% to 100% in the other [The continuous infusion of PESDA contrast increased moderately the specificity for renal aortic ratio criteria from 89.2% to 97.3% but at the expense of a significant decrease of sensitivity from 56.2% to 33.3%. For the another criteria, peak systolic velocity and resistance index the infusion of PESDA decreased mildly or did not affect the sensitivity and specificity. MISSOURIS et al  have rephe other ,23. Howehe other  reportedThere is no consensus whether contrast agent injection potentially reduces examination duration. In our study, we found a significant reduction of mean examination time after contrast infusion (17%). In other study, it was reported that the use of Levovist dramatically reduced the mean examination time from 24.5 minutes to 13.5 minutes . This adPESDA was well tolerated and did not compromise the safety of US. This excellent patient tolerance has already been demonstrated in stress echocardiograph studies that used PESDA as contrast agent . The small number of patients impose some limitations to the present study, However, the high prevalence of renal artery stenosis in this selected group of hypertensives counterbalance this limitation. an increase in specificity based on one Doppler criterion. Also, the feasibility of US is dependent of the quality of the machine, and the infusion of contrast does not add advantages if the performance of the US machine is excellent. However, it remains unknown if the PESDA infusion can improve feasibility if the machine does not have a good imaging quality. So, there is a need for establishing a consensus opinion regarding Doppler useful criteria and thresholds for the diagnosis of renal arterial stenosis, regardless of the US equipment used or infusion of ultrasonographic contrast.In conclusion, the detection of renal artery stenosis by Doppler US depends on the criteria used and infusion of PESDA contrast seems not to improve the accuracy, despite a reduction in the examination duration and"}
+{"text": "Renal artery stenosis (RAS) is a known cause of hypertension and ischemic nephropathy. Stenting of the artery is a valid approach, in spite of cases of unexpected adverse evolution of renal function.In this study, 27 patients with unilateral RAS were subjected to stenting and followed for a period of one year, while 19 patients were observed while on medical treatment only. The group of 27 patients, 67.33 \u00b1 6.8 years of age, creatinine of 2.15 \u00b1 0.9 mg/dl, following stenting, were followed at intervals with biochemical tests, renal scintigraphy and doppler ultrasonography. The control group  was also followed for one year.One year after stenting mean creatinine clearance (Ccr) increased from 36.07 \u00b1 17.2 to 40.4 \u00b1 21.6 ml/min (NS). Arterial BP, decreased after 1,3,6, and 12 months (p < 0.05). The number of antihypertensive drugs also decreased (p < 0.05). A significant increase in proteinuria was also observed. In the control group both Ccr, BP and proteinuria did not show significant changes. Based on renal scintigraphy and Ccr at subsequent times, it was possibile to evaluate the timecourse of renal function in both kidneys of the stented patients. In the stented kidneys Ccr increased significantly. On the controlateral kidney a decrease of renal function (p < 0.05) was observed. Resistance index appeared to be a risk factor of the functional outcome.Stenting of RAS due to atherosclerosis is followed by stabilization or improvement of Ccr, mainly at the stented kidney, while contralateral renal function showed a decrease. Renal artery stenosis due to atherosclerotic changes of the renal arteries has become a serious concern as a cause of hypertension and renal ischemia, resulting frequently in end-stage renal failure ,2. SeverThe study has been carried out prospectively on 46 patients affected by hemodynamically significant atherosclerotic renal artery stenosis, detected by Magnetic Resonance Angiography or Selective Digital Angiography. All the patients had a unilateral stenosis. 27 patients (diabetes mellitus in 8 cases) were subjected to stenting of the stenotic renal artery while 19 patients (diabetes mellitus in 9 cases) were kept on medical treatment only. Clinical data of the two groups are reported in table In all these patients the renal artery was approached through the femoral artery. French 6 guiding catheter (type \"Cobra\"or \"Bates\") was used for selective renal artery angiography and for positioning the stent. All stenotic lesions were repaired with stainless stent Express Vascular SD Monorail 5.5-6-15/20 mm.premounted on a balloon catheter on Choice extra support 014\" guide. In these cases primary stenting was performed. The procedure requires, usually, an injection containing 30 ml of 50\u201350 mixture of isotonic contrast and normal saline.The patients were followed at the outpatient clinic of the Nephrology unit. Duplex-doppler sonography and renal scintigraphy were carried out basally and following 1,3,6 and 12 months after the stenting procedure. At the same times, biochemical parameters, like serum creatinine and proteinuria were measured. Creatinine clearance was evaluated with the Cockcroft and Gault formula .Doppler ultrasonography was carried out after fasting, following a three days of a low fibre diet and without smoking for a minimum of six hours before the procedure. Patients were studied with an Acuson 120 XP/4 , equipped with a 3.5 MHz transducer, with longitudinal anterior, lateral and oblique approach, with at least threefold sampling of parameters along the artery. The standard criteria for the diagnosis of significant renal artery stenosis have been previously reported [Renal radionuclide scintigraphy was performed with a gamma camera  with 99mTc-DTPA or with 99mTc-MAG3 (mercaptoacetyltriglycine). MAG3 was chosen in patients with creatinine clearance <25 ml/min. Diuretics and/or ACE inhibitors were discontinued at least three days before, if treatment was underway. The criteria of positivity have previously been reported [Evaluation of single kidney renal creatinine clearance was performed by measurement of creatinine clearance and simultaneous renal scintigraphy with MAG3, with percentage-wise function of each kidney, enabling to calculate the creatinine clearance pertaining to each kidney. The entire set of data for this evaluation was available in 21/27 patients.Statistical analysis. A descriptive univariate analysis, consisting in evaluation of percentages, means and standard deviations has been carried out as first step. To evaluate the dependence among the nominal variables, a Parson's Chi square test was also carried out. In case of not applicable Chi square test due to low theoretical frequencies (<5), Fischer exact test for tables 2 \u00d7 2 was employed. Comparison of means of the two groups was made. Since the data did not show a normal distribution, non parametric tests, as Wilcoxon rank-sum test for paired data and Mann-Whitney test, were employed. The significance level was <0.05, as usual. The more interesting significant and not significant data were represented graphically. The data were evaluated with the statistical package BMDP Release 7 .Clinical and biochemical data of the treated and control groups are reported in Table During 12 months observation period one patient of the stented group began dialysis treatment, while in the control group 4 patients died of cardiovascular events and one patient started the dialysis treatment.A significant drop in systolic and diastolic blood pressure at all control times compared to basal values, was found in the stented patients, while no significant blood pressure drop was found in the patients not undergoing the PTA stenting procedure Table . A signiA significant increase in proteinuria following the stenting was found at 1 and at 12 months, while the increment in proteinuria observed at the other control times was only borderline significant. There was no diference in the increase of proteinuria between patients with and without diabetes mellitus. No changes in proteinuria was observed in the control group.An increase in creatinine clearance and a slight fall in serum creatinine, however not reaching a significance level, was observed in the stented group, while no increment in creatinine clearance was found in the control group Table . This obIn addition, patients with the stent were divided in those cases with a RI above 0.80 and cases with this parameter below 0.80. The patients with lower RI improved, on average, renal function while the patients with elevated RI had a worse outcome Fig. . RI valuThe advantage deriving from positioning a stent in a significantly stenotic renal artery has been debated in recent years. Generally favorable results have been reported by Dorros et al  on a widIn our experience, the fall in blood pressure and of the number of antihypertensive drugs was confirmed. Our results on the overall outcome of renal function, over a one year observation period, in patients with one sided renal artery stenosis of atherosclerotic origin, have been satisfactory. As a risk factor of worse outcome, our data have confirmed that RI above 0.80, results in a less satisfactory outcome compared to patients with RI lower than 0.80, as already reported by Radermacher et al. . The steAs for the increment in proteinuria observed following stenting of renal artery, this finding has not been reported previously, while in basal conditions significant proteinuria in patients with renal artery stenosis has been already reported in the literature . TherefoLess is known of the renal function in the kidney affected by the arterial stenosis, following the stenting procedure, compared to the contralateral kidney. In all our patients renal artery stenosis was of atherosclerotic origin, without cases of fibromuscular dysplasia. In general, no adverse events were found following the stenting in the patients closely followed for one year. In our experience, there were no apparent cases of cholesterol embolization, of thrombosis of the artery, of occlusion of the stent, or of dissecation of the renal artery. The function of the stented kidney improved in most of patients while a reduction of renal function was observed in the controlateral kidney. The overall renal function was stable. Similar findings have been published by Airoldi et al., Leertouwer et al., and La Batide-Alanore et al. ,13,14. HThe reduction in contralateral kidney function has been attributed to ultrafiltration in the non stenotic kidney, declining after stenting of the stenotic contralateral renal artery. In addition, hemodynamic factors consequent to a decrease in renin-angiotensin activity could be considered as a factor. The involvement of the renin angiotensin system in renal artery stenosis should be suspected due to the significant fall in systolic and diastolic blood pressure following the procedure, an occurrence not found in the control group. Actually, a fall in plasma renin activity or concentration following dilatation of the stenotic artery has been reported by Airoldi et al  and by LIn conclusion, the stenting procedure of a stenotic renal artery does not seem to carry important risks, and is accompanied by a definite improvement of the stented kidney, with some reduction of the filtration rate of the controlateral kidney. This event cannot be considered unfavorable, since it denounces a condition of hyperfiltration of the kidney, probably, if left unchanged, able to induce a deterioration of renal function with time. Therefore, also in case of overall stabilization of renal function following the stenting procedure, improvement of the stented side and reduction of hyperfiltration on the contralateral side are both favorable evolutions for long-term success of the revascularization procedure. The results are less satisfactory in patients with RI >0.80. They should probably be excluded from the stenting procedure.The author(s) declare that they have no competing interests.GC, conceived the protocol and cohordinated the studyEM, participated in the design of the study and in the cohordinationCC, was encharged of the magnetic resonance image analysisRL, collaborated in the duplex doppler ultrasonography examinationIN, was responsible of the statistical examination of dataGR, responsible of renal scintigraphic investigationDS, performed all the biochemical testsAZ, performed arteriography and stenting of renal arteriesRC, was active in the ultrasonography investigation and screening of patients with renal artery stenosisThe pre-publication history for this paper can be accessed here:"}
+{"text": "Renal artery stenosis (RAS) is one of the main causes of secondary systemic arterial hypertension. Several non-invasive diagnostic methods for RAS have been used in hypertensive patients, such as color Doppler ultrasound (US). The aim of this study was to assess the sensitivity and specificity of a new renal Doppler US direct-method parameter: the renal-renal ratio (RRR), and compare with the sensitivity and specificity of direct-method conventional parameters: renal peak systolic velocity (RPSV) and renal aortic ratio (RAR), for the diagnosis of severe RAS.Our study group included 34 patients with severe arterial hypertension , mean age 54 (\u00b1 8.92) years old consecutively evaluated by renal color Doppler ultrasound (US) for significant RAS diagnosis. All of them underwent digital subtraction arteriography (DSA). RAS was significant if a diameter reduction > 50% was found. The parameters measured were: RPSV, RAR and RRR. The RRR was defined as the ratio between RPSV at the proximal or mid segment of the renal artery and RPSV measured at the distal segment of the renal artery. The sensitivity and specificity cutoff for the new RRR was calculated and compared with the sensitivity and specificity of RPSV and RAR.The accuracy of the direct method parameters for significant RAS were: RPSV >200 cm/s with 97% sensitivity, 72% specificity, 81% positive predictive value and 95% negative predictive value; RAR >3 with 77% sensitivity, 90% specificity, 90% positive predictive value and 76% negative predictive value. The optimal sensitivity and specificity cutoff for the new RRR was >2.7 with 97% sensitivity (p < 0.004) and 96% specificity (p < 0.02), with 97% positive predictive value and 97% negative predictive value.The new RRR has improved specificity compared with the direct method conventional parameters (RPSV >200cm/s and RAR >3). Both RRR and RPSV show better sensitivity than RAR for the RAS diagnosis. Renovascular hypertension might account for 1\u20135% of all cases of hypertension . HoweverA diagnosis of atherosclerotic RAS can be suspected on the clinical grounds mentioned, but can only be established through specific diagnostic procedures ,9,10. BeThe direct method Doppler parameters evaluate the renal artery peak systolic velocity (RPSV) and the aortic peak systolic velocity to determine the maximal RPSV and the renal aortic ratio (RAR). The new direct method Doppler parameter, the renal renal ratio (RRR), was defined as the rate between RPSV at the proximal or mid segment of the renal artery and RPSV measured at the distal segment of the renal artery.The indirect method Doppler parameters evaluate the post stenostic \"tardus-parvus\" phenomenon in the intrarenal arterial Doppler waveforms . We did The aim of this study was to assess the sensitivity and specificity of a new renal Doppler US direct method parameter, the renal renal ratio (RRR), and to compare it with the sensitivity and specificity of another direct method conventional parameters, renal peak systolic velocity (RPSV) and renal aortic ratio (RAR), for the diagnosis of severe RAS.Between October 2001 and October 2003, 34 consecutive patients who had severe hypertension and more than three of clinical features suggestive of RAS . In an attempt to improve the detection of RAS, a new direct method Doppler parameter, RRR, was also evaluated. The RRR was defined as the RPSV at the proximal or mid renal artery segment divided by the RPSV at the distal renal artery segment Figure. . and 2.RRR = RPSV /RPSV We have only evaluated the main renal arteries, we did not use the RRR to analize the accessory arteries.Renal Doppler US was performed in our departments using a Toshiba Nemio 30 machine with low-frequency curve transducers (3\u20136 MHz) and low-frequency sectorial transducers (2\u20134 MHz) to allow greater penetration of the US beam.All examinations were performed by a single physician with more than five-years experience in vascular sonography. The examinations were performed in the morning if possible and the patients were recommended to observe a 10-hour fasting period beforehand. The complete procedure was generally completed within approximately 30\u201335 minutes. All examinations were started with the patients in the supine position, in order to visualize the abdominal aorta and the origin and proximal course of the main renal artery. The patients were then kept recumbent in various different positions: the left decubitus position to explore the right renal artery, the ventral decubitus position to explore the left renal artery or the right decubitus position in a few cases.The maximum diameter and the peak systolic velocity in the abdominal aorta were obtained in a longitudinal section of its proximal segment.Epigastric transverse scans allowed us to identify the main renal arteries, which originate laterally  in the abdominal aorta about 1 cm under the emergence of the superior mesenteric artery. The right and left renal arteries also have a proximal course just posterior to the left renal vein under normal conditions. Therefore, the origin and the proximal segment of the renal arteries were initially assessed in a transverse section of the abdominal aorta in the epigastric region. Every patient had all segments of bilateral renal arteries interrogated: proximal, mid and distal. Depending on the anatomy of the patient, almost the entire length of the renal arteries could be assessed.We performed direct imaging of the main renal artery with the color window and pulsed wave (PW) Doppler. When the renal artery image showed homogeneous color and standard velocity, we diagnosed normal renal artery patency.For the diagnosis of RAS using the conventional technique, we performed direct imaging of the main renal artery. Color imaging revealed the presence of stenosis through signs of turbulence in the systolic phase, which was generally yellow and green. Subsequently, the PW Doppler was positioned in the area of interest in the center of the vessel, at the site identified by increased flow velocities and turbulence. The gain, filter and scales of the velocity curves of the PW Doppler were adjusted to provide an adequate curve for measuring the velocities. When the renal artery PW Doppler showed increased peak systolic velocity, we suspected RAS. The highest value of the three measurements of RPSV performed from different views was chosen in each case.For the abdominal aorta and main renal arteries, the angle of incidence of the pulsed Doppler was maintained less than 60\u00b0, which was essential in order to obtain accurate measurements. We used the same or very similar angle correction at proximal, mid and distal segments of the renal artery. It was a very important technical detail. The velocities at proximal, mid and distal segments of the renal artery were assessed using obliqual sections.Doppler samples were taken in apnoea, when the image of the artery was found to be optimal in the respiratory cycle.We did not use contrast echo in case of difficult renal artery imaging.Digital subtraction angiography was performed in all patients. This was performed using a 5-F pigtail catheter, with the tip positioned through the right or left femoral artery just proximal to the renal arteries. A non-ionic contrast material was injected and the images were obtained in the anteroposterior, left anterior oblique and right anterior oblique projections. The criterion for anatomically significant RAS at angiography was 50% or greater renal artery narrowing. The stenosis was assesed by calipers.The sensitivity, specificity, positive predictive value and negative predictive value for the detection of significant RAS were calculated independently for the three parameters: RPSV, RAR and RRR, and its sensitivity and specificity were compared. The sensitivity for detecting stenosis was calculated as the number of true-positive findings according to color Doppler US divided by the number of positive findings by DSA. The specificity was calculated as the number of true-negative findings according to color Doppler US divided by the number of negative findings by DSA.Additionally, receiver operating characteristic (ROC) curves were computed to compare the parameters, which provided a graphic description of the performance of the tested variables towards RAS detectability. The curves were generated from data obtained through sensitivity/specificity analysis of the variables.The chi square test was used to evaluate the difference among the three direct method color Doppler US parameters. All statistical tests were two-tailed and performed at the 0.05 level of significance. The confidence intervals were two-sided with 95% intervals. The SPSS 10.0 statistical package was used for all the calculations. The protocol was approved by our institutional ethics committee and all the patients provided written informed consent.Ninety seven percent of our patients were successfully examined with color Doppler US, and the results were good enough to be included in the analysis in all cases. The intra-examiner variability was good . The sensitivity, specificity and predictive values of the direct method renal Doppler parameters were assessed in 34 patients. We found with DSA 35 main stenotic renal arteries and 29 main normal renal arteries  were evaluated. We found that RPSV >200 cm/s and RAR >3 were indicative of severe RAS as it is referred in the literature . RPSV >2Additionally, the RRR sensitivity (97%) and specificity (96%) values were compared with the other mentioned direct-method parameters (RPSV >200 cm/s and RAR >3) Table . The senThe ROC curve analysis showed that the area under the curve for RRR(0.99) was greater than that for both RPSV and RAR (0.95 and 0.93 respectively) . However, their study used an invasive approach and had a higher risk than the RRR proposed in our current research .Our best cutoff value for RRR was 2.7 in accordance with an angiographic RAS >50%; however, we found an angiographic RAS >50% with an RRR >2.5. We did not find RAS when the RRR was <2, so we proposed this cutoff to be the normal value.2. (Table Body mass index (BMI) was calculated for each patient. The mean BMI was 30 (\u00b1 5) kg/mThis index was assessed in all patients with only one exception. This patient had RAS at the end of the distal renal artery segment, so we could not take a distal velocity to compare with the RPSV at the RAS. We therefore used to replace the distal renal artery segment velocity, the measurement at non-stenotic distal branch of the main renal artery at the extraparenchymal level.The main limitation of this study was that we evaluated only the main renal arteries because these vessels have a more important role at the renovascular disease and were able to undergo endovascular treatment. Neither we compared the color Doppler US with other diagnostic non-invasive diagnostic methods as computed tomographic, magnetic resonance angiography or captopril renography for the diagnosis of RAS. We did not considerate these diagnostic methods in this study because their high cost and not widespread availability of all of them may somehow avoid a routine use in clinical practice .The new RRR, with a cutoff value >2.7, shows significantly improved specificity compared with conventional direct method Doppler parameters (RPSV > 200 cm/s and RAR >3). Both RRR and RPSV show better sensitivity than RAR for RAS diagnosis. The results indicate that RRR and RPSV were the best criteria for RAS diagnosis. The RRR improves the diagnostic effectiveness of the color Doppler US.RPSV = renal peak systolic velocityRAR = renal aortic ratioRRR = renal-renal ratioRAS = renal artery stenosisRenal color Doppler ultrasound = color Doppler USDSA = digital subtraction arteriographyROC curve = receiver-operating characteristic curvePW Doppler = pulsed wave DopplerThe author(s) declare that they do not have competing interests.SC designed the study and carried out the sonographic evaluations.HL, GF, SB, JO and JM performed literature research and prepared, edited and reviewed the manuscript.EME and RR participated in the design and coordination of the study, and SC, HL, GF and SF guarantors of its integrity.All authors read and approved the final manuscript."}
+{"text": "Renovascular hypertension is defined as hypertension caused by renal artery stenosis. The two main etiologies are atherosclerosis and fibromuscular dysplasia. Fibromuscular dysplasia in an accessory renal artery as a cause of renovascular hypertension is uncommon.In this report, we present a relatively uncommon case of renovascular hypertension in a 35-year-old female with a history of intractable hypertension as a result of fibromuscular dysplasia involving an accessory renal artery. Selective renal angiography was performed and revealed a single renal artery on the right and two renal arteries supplying the left kidney, upper and lower poles. Selective renal angiography showed the typical fibromuscular dysplasia lesion characterized by its classic \"string of beads\" appearance, consisting of alternating areas of narrowing and dilatation, located in the middle portion of the lower left renal artery (accessory artery) associated with moderate stenosis. Percutaneous balloon dilatation of the stenotic lesion was successfully performed. Following angioplasty, her blood pressure normalized over a period of several months using a single antihypertensive medication (rather than 3 medications).Fibromuscular dysplasia in an accessory renal artery can, even though rarely, be responsible for renovascular hypertension. Selective renal angiography is the 'gold standard' test and should be performed when renovascular intervention is contemplated. Renovascular hypertension (RVH) is defined as hypertension caused by renal artery stenosis (RAS) and accounts for less than 5% of all cases of hypertension in the general population . The twoSelective renal angiography (SRA) remains the gold standard for the diagnosis of renal artery stenosis. However, noninvasive diagnostic techniques such as Doppler ultrasound (DU), MR angiography (MRA) and CT angiography (CTA) have proved to be accurate in assessment of RAS and provide valuable alternatives to diagnostic angiography -6. In thA 35-year-old female with a history of intractable hypertension (for the duration of a year), probably renovascular, was referred by her nephrologist to our department for SRA. She was a smoker. The patient denied any family history of hypertension. Her physical examination revealed a blood pressure of 150/100 mmHg (multiple readings taken from both arms on different occasions were similar). Her cardiovascular, respiratory, and central nervous system examinations were unremarkable. No evidence of retinopathy on fundus examination. There was no carotid, abdominal or femoral arterial bruits. ECG, chest radiograph and transthoracic echocardiography were normal. Her blood urea nitrogen (BUN) and serum creatine were within normal limits. The patient received 3 antihypertensive medications including a beta-blocker, diuretic and a calcium channel blocker. SRA was performed and revealed a single renal artery on the right and two renal arteries supplying the left kidney, upper and lower poles . SRA showed the typical FMD lesion which is characterized by its classic \"string of beads\" appearance, consisting of alternating areas of narrowing and dilatation, located in the middle portion of the lower left renal artery (accessory artery) associated with moderate stenosis  Figure . FollowiFMD is a nonatherosclerotic angiopathy of unknown etiology. Medial FMD represents the most common type and is characterized by the classic \"string of beads\" appearance. FMD usually affects females between 15 and 50 years of age, frequently involves the mid or/and distal segments of the renal artery and is bilateral in 2/3 of the patients . It is tRVH is the clinical consequence of renin-angiotensin-aldosterone system activation as a result of renal ischemia. Unilateral renal ischemia initiates an increased secretion of renin, which accelerates the conversion of angiotensin I to angiotensin II and enhances the adrenal release of aldosterone. The result is profound angiotensin-mediated vasoconstriction and aldosterone-induced sodium and water retention, causing RVH. Goldblatt  (1934) dIn about one-third of the general population there are variations in number, location, and branching patterns of the renal arteries, with over 30% of subjects having one or more accessory renal arteries . This isSRA remains the gold standard for the diagnosis of renal artery stenosis. However, because of the invasive nature of this procedure, various non-invasive imaging modalities have been applied to detect renal artery stenosis including DU, MRI and CTA. Duplex ultrasonography can provide images of the renal arteries and asses blood-flow velocity and pressure waveforms, however there is a 10% to 20% rate of failure due to the operator's inexperience, the presence of obesity or bowel gas, respiratory renal movements, and poor patient compliance. In addition, visualization of a single normal renal artery does not exclude the possibility of a stenotic accessory renal artery. At present the most important role of ultrasonography is its apparent ability to predict functional recovery based on the measurement of resistive index. Captopril renography is a non-invasive and safe technique to evaluate renal blood flow and excretory function providing indirect evidence of the presence of renal artery stenosis and has proven helpful in screening patients with this condition. The efficacy of the test is increased when 25\u201350 mg of captopril is administered one hour prior to the injection of the radioisotope. However, data concerning the reliability of this technique are inconsistent and vary among studies. The sensitivity and specificity of captopril renography decrease in the presence of azotemia, bilateral disease, or disease in a solitary functioning kidney .Multidetector CTA is the most widely used scan in the diagnosis of RAS. It permits rapid volumetric acquisition with high-contrast enhancement of the vessel lumen. Due to the high spatial resolution (submillimeter) it provides excellent visualization of the renal arteries as well as side branches. The study conducted by Sabharwal et al , reporteFibromuscular dysplasia in an accessory renal artery can, even though infrequently, be responsible for renovascular hypertension. Selective renal angiography is the 'gold standard' test and should be performed when renovascular intervention is contemplated.CTA; computed tomography angiography, FMD; fibromuscular dysplasia, MDCT; multidetector computed tomography, RAS; renal artery stenosis, RVH; Renovascular hypertension.The author(s) declare that they have no competing interests.All authors have read and approved the final manuscript.ARZ (Consultant Radiologist): Involved in the conception of the report, literature review, manuscript preparation, manuscript editing and manuscript submission.WV (Consultant Radiologist): Involved in the manuscript editing and manuscript review.EB (Consultant Radiologist): Involved in the manuscript editing and manuscript review."}
+{"text": "Fibromuscular dysplasia (FMD), formerly called fibromuscular fibroplasia, is a group of nonatherosclerotic, noninflammatory arterial diseases that most commonly involve the renal and carotid arteries. The prevalence of symptomatic renal artery FMD is about 4/1000 and the prevalence of cervicocranial FMD is probably half that. Histological classification discriminates three main subtypes, intimal, medial and perimedial, which may be associated in a single patient. Angiographic classification includes the multifocal type, with multiple stenoses and the 'string-of-beads' appearance that is related to medial FMD, and tubular and focal types, which are not clearly related to specific histological lesions. Renovascular hypertension is the most common manifestation of renal artery FMD. Multifocal stenoses with the 'string-of-beads' appearance are observed at angiography in more than 80% of cases, mostly in women aged between 30 and 50 years; they generally involve the middle and distal two-thirds of the main renal artery and in some case also renal artery branches. Cervicocranial FMD can be complicated by dissection with headache, Horner's syndrome or stroke, or can be associated with intracerebral aneurysms with a risk of subarachnoid or intracerebral hemorrhage. The etiology of FMD is unknown, although various hormonal and mechanical factors have been suggested. Subclinical lesions are found at arterial sites distant from the stenotic arteries, and this suggests that FMD is a systemic arterial disease. It appears to be familial in 10% of cases. Noninvasive diagnostic tests include, in increasing order of accuracy, ultrasonography, magnetic resonance angiography and computed tomography angiography. The gold standard for diagnosing FMD is catheter angiography, but this invasive procedure is only used for patients in whom it is clinically pertinent to proceed with revascularization during the same procedure. Differential diagnosis include atherosclerotic stenoses and stenoses associated with vascular Ehlers-Danlos and Williams' syndromes, and type 1 neurofibromatosis. Management of cases with renovascular hypertension includes antihypertensive therapy, percutaneous angioplasty of severe stenoses, and reconstructive surgery in cases with complex FMD that extends to segmental arteries. The therapeutic options for securing ruptured intracerebral aneurysms are microvascular neurosurgical clipping and endovascular coiling. Stenosis progression in renal artery FMD is slow and rarely leads to ischemic renal failure. McCormack n [et al  observedn [et al . FMD is et al [et al analyzed arterial segments from 33 patients and found that more than one artery layer was involved in 25 (66%) of the 38 specimens studied [A pathological classification of renal artery FMD was proposed by McCormack et al ,5 and reet al . It was et al , and theet al . Intimalet al ; and AliSince reports of successful outcomes of angioplasty in patients with renal artery FMD , surgeryet al described angiographic features in 125 patients with FMD, including 60 patients who underwent surgery and provided arterial tissue for histological examination [Kincaid mination . They prmination . The \"stmination , whereasmination ,4,10 andmination , whereasMost commonly affected are the renal and carotid arteries. Involvement of the axillary, iliac, basilar, hepatic and intracranial arteries has also been reported. In a comprehensive review of the literature, Mettinger and Ericson analyzed reports concerning a total of 1197 patients with FMD , 81 . As intracranial aneurysms may rupture and lead to subarachnoid or intracerebral hemorrhage, the American Heart Association recommends performing magnetic resonance angiography of the head in patients with cervical artery FMD . SpontanThe prevalence of FMD is not precisely known. Ten to 20% of documented renal artery stenoses are the consequence of FMD, and renovascular hypertension is documented in less than 1 to 2% of hypertensive patients. Assuming a 20% prevalence of hypertension in middle-aged subjects, the prevalence of clinically significant renal artery FMD can be estimated to be about 0.4%. The prevalence of asymptomatic renal artery FMD is, however, one order of magnitude higher: four reports of angiographic findings for a total of 3181 potential kidney donors describe 139 subjects (4.4%) with evidence of FMD -22. The et al had renal artery aneurysms [Renal artery aneurysms were identified in four of 716 (0.6%) potential kidney donors in one series, all four having lesions suggestive of FMD ; similarneurysms . The preneurysms  but was neurysms . The preMedial-type FMD and/or FMD showing the \"string-of-beads\" appearance at angiography are usually diagnosed in young adults and are more than four times as frequent in women as in men. A male predominance in found in cases with intimal-type FMD or with focal stenoses at angiography, but these cases make up only a minority of patients with FMD  Figure .The most common clinical presentation of FMD is renovascular hypertension secondary to renal artery involvement. Renal artery stenosis due to FMD may be associated with all stages of hypertension, but it is most commonly detected in patients with stage 2\u20133 hypertension, or abrupt onset or resistant hypertension, since these are the individuals who undergo the most comprehensive etiological examinations. Upper abdominal quadrant or flank bruits are common in patients with renal artery FMD ,12 but tCervical artery FMD, mainly affecting the internal carotid artery, is seldom symptomatic. It can be discovered incidentally by Doppler ultrasound during evaluation of dizziness, headache, or an asymptomatic cervical bruit . NeuroloFMD affecting extra-renal and extra-cervical arteries has been reported in celiac, superior and inferior mesenteric, hepatic, splenic, and coronary arteries . AlthougRenal artery FMD has been tentatively associated with environmental factors and it is likely that there is a genetic predisposition.et al found that kidney mobility during maximal respiratory cycle or during a change in posture did not differ between patients with FMD and matched controls with normal renal arteries [More patients with FMD than matched controls smoke ,28,29 ani.e. conditions more likely to be associated with atherosclerosis than with FMD. Our retrospective analysis of 104 patients with renal FMD showed a prevalence of 11% for familial cases, i.e. 11% of cases had at least one sibling with angiographic evidence of renal artery FMD [The occurrence of renal FMD in sib pairs or identical twins  suggeststery FMD . Howevertery FMD . Using ttery FMD .\u03b1-1 antitrypsin gene [et al reported an association with polymorphisms of the renin angiotensin system [Few molecular genetic studies have been conducted, because of the absence of large affected pedigrees and/or the absence of large and well-phenotyped cohorts allowing powerful case-control studies. Autoimmunity has been implicated by a limited study showing an association with HLA Drw6  but thissin gene . Bofingen system  but thisThe presence of renal artery FMD can be documented by the following non-invasive tests (in increasing order of accuracy): the captopril test, captopril renal scintigraphy, Doppler ultrasound, magnetic resonance angiography, gadolinium-enhanced magnetic resonance angiography, and computed tomographic angiography . DopplerThere is no published comparative study of non-invasive tests for detecting carotid artery FMD, although Doppler ultrasound may disclose irregular patterns of stenosis that are suggestive. Computed tomographic angiography and magnetic resonance angiography are probably more effective than ultrasonography for detecting lesions of the middle and distal portions of the carotid and vertebral arteries and may also document or rule out the association of intracranial aneurysms.The commonly accepted gold standard for diagnosing renal artery FMD is intra-arterial angiogram with digital subtraction. This invasive test should be reserved for patients in whom it is clinically justified to proceed with revascularization in the same procedure. Stenosis quantification is, however, frequently difficult in medial FMD with the \"string-of-beads\" appearance because multiple web-like defects are often present in patients with FMD, contributing to clinically significant stenoses that may not be apparent on angiography.COL3A1 gene mutations) [The characteristic \"string-of-beads\" feature is found in the majority of patients with FMD Table . In casetations) ; facial tations) ; and spetations) .i.e. with bilateral stenoses or a unilateral stenosis causing more than 60% reduction in luminal diameter \u2013 and accelerated hypertension, resistant hypertension, malignant hypertension, hypertension with an unexplained unilateral small kidney, and hypertension with intolerance to medication [The value of treatment has not been established for renal artery FMD without hypertension. The management of hypertension associated with renal artery FMD involves revascularization and/or antihypertensive medication. There have been no controlled trials comparing revascularization to medication in FMD. Current recommendations reflect the knowledge acquired concerning atherosclerotic renovascular hypertension, although indications for balloon angioplasty are wider in FMD than in atherosclerotic renovascular disease because the blood pressure outcome of angioplasty is more favorable in FMD than in atherosclerosis . Revascudication . It is adication . AntihypManagement of dissecting carotid artery FMD includes anticoagulation and, in cases with expanding or symptomatic pseudoanevrysm, percutaneous angioplasty or surgical repair . TherapeRenal artery FMD, mainly of focal or tubular types, may progress to more severe stenosis and rarely to renal artery occlusion ,7,45-47.The major aims of current research are to unravel the pathophysiological mechanisms of FMD; to seek gene(s) that predispose to the condition; to assess more accurately the risk of disease progression in focal or multifocal FMD, and in FMD affecting renal or extrarenal arteries; and to improve the detection and quantification of renal artery stenoses.The author(s) declare that they have no competing interests.All authors participated in the drafting and editing of this manuscript and have seen and approved the final version."}
+{"text": "A 4-year-old boy with hypertension due to renal artery stenosis and neurofibromatosis type 1 is presented for its rarity. Renal artery stenosis due to neurofibromatosis is underrecognized and may masquerade Takayasu\u2019s arteritis in Asian children. Hypertension in children is frequently underdiagnosed. Severe secondary hypertension may result from renal artery stenosis apart from other causes. The most common cause of renal artery stenosis in children is Takayasu\u2019s arteritis, which may be angiographically indistinguishable from renal artery stenosis due to neurofibromatosis Type 1 (NF1). NF1, an autosomal dominant hamartomatosis, affects 1 in 3000 people. Early diA 4-year-old boy presented with a 6 month history of breathlessness, cough, and headache. There was no history of oliguria, hematuria, lower limb pain, visual disturbances, or seizures. Early infancy was uneventful with normal development. Family history was notable for the absence of any history of hypertension or neurofibromatosis.th percentile for age, gender, and height). A systemic examination revealed bibasilar crepitations, cardiomegaly, left ventricular third heart sound, and hepatomegaly. Grade I hypertensive retinopathy was present on fundus examination.A clinical examination revealed axillary freckles, multiple caf\u00e9 au lait spots over the trunk, and axilla and firm skin swellings in the left axilla and over the spine Figures  and 2. HLaboratory parameters including hemogram, renal and liver function tests, urine examination, and serum catecholamines were within normal limits. An electrocardiogram revealed left ventricular hypertrophy with strain pattern and left atrial enlargement. Cardiomegaly (cardiothoracic ratio 70%) and moderate pulmonary venous hypertension was noted on chest x-ray. An echocardiogram demonstrated concentric left ventricular hypertrophy, global hypokinesia, severe left ventricular dysfunction with ejection fraction of 20%, and normal aortic arch. Ultrasound examination of the abdomen was normal. Both kidneys were of normal size (right kidney was 6 cm in length and the left kidney was 6.5 cm in length). A computed tomography (CT) scan of the chest showed a soft tissue mass in the posterior mediastinum and widening of the intervertebral foramina due to neurofibroma at the C6-C7 and C7-T1 level. Abdominal CT scan did not show any adrenal or other abdominal mass. A CT angiography of the renal vessels showed left renal artery stenosis, which was ostial in location. There was no abdominal coarctation of aorta. The final diagnosis of NF1 with left renal artery stenosis, secondary hypertension with severe left ventricular dysfunction, and congestive heart failure was made.The patient was treated with intravenous nitroglycerine, diuretics, and amlodepine. After the initial stabilization, he underwent percutaneous transluminal renal angioplasty (PTRA). Renal angiography revealed left renal artery stenosis at the ostium . The rigRenovascular hypertension is an important cause of secondary hypertension in children. It is re5NF1 typically presents with caf\u00e9 au lait spots, multiple neurofibroma, axillary freckling, and ocular Lisch nodules. Hypertension is present in 1% of NF1 patients and is significantly associated with mortality and morbidity. The most frequent cause of hypertension in a child with neurofibromatosis is renal artery stenosis with the median age at diagnosis of hypertension being 5 years. PhaeochrTreatment modalities in renovascular hypertension secondary to NF1 involve a combination of drug therapy, PTRA, and surgery. A review of 16 patients of NF1 and renal artery stenosis who underwent PTRA showed a 33% success rate of PTRA for primary stenoses. The success rate was higher (67%) in post-surgery residual stenoses.  Because 9In addition to renal artery stenosis, vascular lesions in NF1 may involve mesenteric vessels, aorta, and cerebral vessels. Vasculopathy of NF1 tends to be progressive and is one of the leading causes of death in this population.  Careful NF1 may present with hypertension due to renal artery stenosis in children. A wider appreciation of this entity is warranted for early diagnosis and appropriate and prompt treatment."}
+{"text": "The scintigraphy showed signs of acute renal failure while the patient was on enalapril for controlling her hypertension. Bilateral renal artery stenosis was confirmed with computed tomography angiography. Hypertension resolved after bilateral renal artery angioplasty.The authors report and discuss a case of bilateral renal artery stenosis in a hypertensive 9 year-old girl that was first suspected with  Renal artery stenosis (RAS) is a relatively common cause of secondary hypertension, accounting for 1% of unselected hypertensive children, but rises to as high as 10 to 40% in patients with severe or refractory hypertension . BilaterThe blood pressure of the affected children can be controlled with combination of mild diuretic and angiotensin-converting enzyme (ACE) inhibitors or an angiotensin 2 receptor blocker (ARBs).99mtechnetium-diethylene triamine penta-acetic acid (99mTc-DTPA), 99mtechnetium-ethylenedicysteine (99mTc-EC) or 99mtechnetium-mercapto acetyl triglycine (99mTc-MAG3) is a widely accepted tool for the diagnosis of hemodynamically significant renal artery stenosis (RAS) [99mTc-DMSA is also used for the diagnosis of RAS with good sensitivity and specificity [Captopril- or enalapril- enhanced renal scintigraphy with either is (RAS) ,5. Althocificity .99mTc-DMSA findings. The diagnosis was confirmed by computed tomography (CT) angiography.We are reporting a child with severe hypertension that was suspected to have bilateral RAS based on 99mTC-DMSA renal scintigraphy. The scintigraphy showed globally decreased cortical function of both kidneys with increased background activity and radiotracer uptake in the liver  secondary to persistent arterial hypertension was found on echocardiography. Complete blood count, blood chemistry profile and urinalysis were in normal limits. On ultrasonography renal length was 66 mm and 81 mm in the right and left sides respectively and both kidneys showed normal echogenicity. As full doses anti-hypertensive treatment with different kinds of anti-hypertensive agents was unsuccessful enalapril was started with a dose of 0.1 mg/kg/day. The blood pressure was controlled after this drug regimen. The patient was referred to the nuclear medicine department for he liver  which weConsidering the baseline normal serum creatinine level, treatment with enalapril and the scan pattern; possibility of enalapril- enhanced acute renal failure due to bilateral renal artery stenosis was suggested.Further evaluation showed an increase in the level of serum BUN and creatinine from 18 to 114 mg/dl and 0.54 to 6.4 mg/dl respectively. Enalapril was stopped immediately and the patient was transferred to pediatric ICU. The levels of BUN and serum creatinine returned to pre-treatment values in the following 7 days. Patient underwent CT angiography for the evaluation of the renal arteries and confirmed the presence of bilateral renal artery stenosis .Follow-up DMSA renal scan after 2 weeks of enalapril discontinuation showed marked improvement in the renal function with decrease in background activity and liver uptake. Although the cortical function of both kidneys was significantly improved, the left kidney function failed to show complete return to normal . PatientSystemic hypertension is less common in children than in adults but the incidence of hypertension in children is reported to be as high as 1-5% , using e99mTc-DTPA, 99mTc-EC or 99mTc-MAG3 is a widely accepted tool for the diagnosis of hemodynamically significant renal artery stenosis in cases with high pretest probability of secondary hypertension [99mTc-DMSA renal scintigraphy is mostly used in the diagnosis of acute pyelonephritis and post-infection renal scars [99mTc-DMSA renal scan for the diagnosis of RAS (as in this case) is well documented with reasonably good sensitivity and specificity [99mTc-DMSA renal scan and later was confirmed with other imaging modalities.Captopril- or enalapril- enhanced renal scintigraphy with rtension ,5. Althocificity . In this"}
+{"text": "Urethral hemangiomas are rare benign vascular tumors with varying size and usually present as urethral bleeding and/ or hematuria. Treatment depends on the size and site of the lesion. We present a 27 year old male with a two year history of intermittent episodes of urethral bleeding. Cystourethroscopy showed a solitary hemangioma in the penile urethra. The patient was treated with simple transurethral excision with the biopsy forceps. The catheter was removed 48 hours later. He remains symptom free four months later. Simple excision of small hemangiomas may be an effective treatment especially for young patients in order to avoid the side effects of diathermy and when facilities such is laser are not available. Urethral hemangiomas are rare benign vascular tumors which on histology consist of thin walled vascular spaces lined by endothelial cells. Their origin still remains an enigma. It has been suggested they originate from unipotent angioblastic cells that fail to develop into normal blood vessels. The most common type is cavernous hemangioma . TreatmeN. Gonorrhoea was negative. Biochemical, haematological and clotting studies were normal. Ultrasound scan of the kidneys and bladder was normal. The urethral bleeding was controlled with an indwelling catheter 16 Fr which was kept in place for 48 hours. Flexible cystoscopy under local anaesthesia showed a reddish lesion 5 mm about 5 cm from the external urethral meatus (A 27 year old white man presented in our hospital with a two years history of intermittent urethral bleeding. He did not describe any bladder symptoms or any kind of urethral trauma. All the episodes were self-limited. Many of them had been treated as recurrent episodes of urethritis. The patient reported episodes of urethral bleeding and initial hematuria 2-3 times per week and sometimes 2-3 times per day, without any obvious precipitating factor. He did not report any hemospermia. On physical examination vital sings were normal. Examination of the abdomen and external genitalia was normal. The urethral meatus had a normal caliber. There was urethral discharge of fresh blood. The prostate gland was soft, small and non tender on digital rectal examination. Midstream urine analysis was normal and urethral culture of swabs for l meatus . The patl meatus . Four moUrethral hemangiomas can occur at any age. Most cases are encountered in males and only a few have been reported in female . They arAsymptomatic lesions do not require any treatment but extensive lesions may require open excision and urethral reconstruction . TreatmeSimple transurethral excision of small urethral hemangiomas may be an effective treatment especially for young patients in order to avoid the side effects of diathermy and when laser facilities are not available. The cornerstone of the right management of urethral hemangiomas is still careful preoperative definition of the extension of the lesion."}
+{"text": "While Auditory Verbal Hallucinations (AVH) refer to specific experiences shared by all subjects who have AVH\u2014the perception of auditory speech without corresponding external stimuli, the characteristics of these experiences differ from one subject to another. These characteristics include aspects such as the location of AVH (inside or outside the head), the linguistic complexity of AVH , the range of content of AVH (repetitive or systematized content), and many other variables. In another word, AVH are phenomenologically heterogeneous experiences. After decades of research focused on a few explanatory mechanisms for AVH, it is apparent that none of these mechanisms alone explains the wide phenomenological range of AVH experiences. To date, our phenomenological understanding of AVH remains largely disjointed from our understanding of the mechanisms of AVH. For a cohesive understanding of AVH, I review the phenomenology and the cognitive and neural basis of AVH. This review indicates that the phenomenology of AVH is not a pointless curiosity. How a subject describes his AVH experiences could inform about the neural events that resulted in AVH. I suggest that a subject-specific combinatoric associations of different neural events result in AVH experiences phenomenologically diverse across subjects. Decades of neuroscience research demonstrate that mental disorders are heterogeneous at the levels of neural circuits and genes Insel, , and thaAVH are encountered in multiple psychiatric and neurological diseases and in non-clinical populations and are phenomenologically diverse. While all subjects with AVH necessarily share a common experience [the perception of speech in the auditory modality without corresponding external stimuli  to the brain . Based on current phenomenological and neural knowledge of AVH, I suggest an integrated phenomenological-neural framework.Phenomenology as a philosophical discipline is a method for the study of first person (subjective) experiences for the purpose of identifying invariant inter-subjective (shared) phenomena \u201cessences\u201d Zahavi, . In a laPhenomenological research of AVH shows that while all subjects with AVH share a common experience\u2014hearing auditory speech without corresponding external stimuli, they differ from each other with respect to a number of characteristics of this common experience. For example, AVH differ across-subject in respect to space location (inside or outside the head), clarity , content , linguistic complexity , concomitancy to normal external speech , insight, or nosognosia [defined as awareness or not of the perceptions/object dissociation  differences in hallucinatory experiences\u2014that is, for example, AVH associated with AVH-anosognosia are qualitatively different from AVH with preserved nosognosia. As any given phenomenological variable is invariant only in a subset of subjects with AVH, they divided AVH, although inconsistently, into multiple sub-categories. For example, Claude and Ey  identifiThe above sub-categorization of AVH was considered as a premature closer; , our research group carried out a study to investigate the phenomenological space of AVH as a means to investigate the neural circuitry of AVH , content (systematized or repetitive), space location (inner or outer space), and familiarity and the gender of the \u201cvoices.\u201d Anosognosia of neurological symptoms  is associated with symptom-specific neural correlates\u2014lesions of the visual associative cortex . One study has shown that, in patients with AVH, abnormalities in the right temporoparietal junction, a key area in the \u201cwhere\u201d auditory system, depend on the spatial location of the experience of AVH (inner or outer space)  validation to the patients' first person subjective experiences of AVH. Whether such validation would extend to the other phenomenological variables is possible but remains to be proven.Three categories of cognitive models could be identified, including: inner speech, bottom-up and top-down processing of perceptions, and intrusions of thoughts and memories.Inner speech was a natural place to start in AVH research as this type of hallucinations refers to the perception of speech. In the mid twentieth century, based on observations that AVH are associated with lip movements without audible speech Forrer, , subvocaThe vast majority of studies on this line of research focused on explaining the attribution to other of a self-generated inner speech. In the literature, inner speech theory is sometimes equated with a particular model (the forward model)  could result from a variety of deficits in metacognition (knowing that we know) as conceptualized by the American psychologist John H. Flavell  model could explain AVH consisting of words or sentences, but not conversations. Intrusive memories and intrusive thoughts could account for AVH with certain characteristics but not with others. Intrusions usually refer to singular events . When the hallucinations are repetitive words or sentences, it could be easily conceived that the hallucinations result from intrusions. However, when the hallucinations consist of complex multi-element auditory objects such as familiar voices issuing tirades of abuse untypical of the speaker (to whom the voices are attributed), or conversations with variable rich content (systematized), intrusions may not explains these hallucinatory experiences as well. Furthermore, metacognitive beliefs related cognitive dissonance does not account for AVH with positive content. Finally, inner speech, intrusive memories and intrusive thoughts are all experienced in inner space, and, as such, don't account for the outer space location of AVH. Of the above models, only models involving deficits in the inner space-outer space distinction, the \u201cwhere\u201d and \u201cwhat\u201d pathways, and top-down/bottom-up interaction could explain the outer space location of AVH.Thus far it appears that AVH experiences are associated with rather complex patterns of commonality and differences across subjects, and that combinatoric association of AVH phenomenological variables accounts nicely for the observed phenomenological heterogeneity. Taking in considerations that at least some of the phenomenological variables appear to point to specific deficits in brain function, and that any given single deficit model does not adequately account for AVH, it could be concluded that the diverse AVH phenomenology results from combinatoric association of neural deficits. I suggest that AVH experiences require necessarily activity in Wernicke's area, which constitute a final common pathway  could improve the signal/noise ratio. If indeed the neural basis of AVH differs in specific aspects according to AVH subtypes , an experimental design that include both subtypes in one group would add noise to the signal generated by the aspect that differentiate the two subtypes. Thus, this approach could maximize the chance of understanding of the cognitive and neural basis of AVH. Better understanding of the cognitive basis could also facilitate treatment efforts for AVH through cognitive remediation.Second, the phenomenological subgroups could also inform the experimental design. Any given AVH characteristic could provide clues about the malfunctioning cognitive and neural processes that resulted in AVH with that particular characteristic. For example AVH with lexical, sentencial, and discourse linguistic complexity could point to dysfunction in lexical, sentential, and discourse processes, respectively. Therefore, the appropriate cognitive task could be designed for the appropriate phenomenological type.Finally, the success of phenomenological research depends in no small measures on the reliable identification of the phenomenological subtypes.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Soils are among the most complex, diverse and competitive habitats on Earth and soil biota are responsible for ecosystem services such as nutrient cycling, carbon sequestration and remediation of freshwater. The extreme biodiversity prohibits the making of a full inventory of soil life. Hence, an appropriate indicator group should be selected to determine the biological condition of soil systems. Due to their ubiquity and the diverse responses to abiotic and biotic changes, nematodes are suitable indicators for environmental monitoring. However, the time-consuming microscopic analysis of nematode communities has limited the scale at which this indicator group is used. In an attempt to circumvent this problem, a quantitative PCR-based tool for the detection of a consistent part of the soil nematofauna was developed based on a phylum-wide molecular framework consisting of 2,400 full-length SSU rDNA sequences. Taxon-specific primers were designed and tested for specificity. Furthermore, relationships were determined between the quantitative PCR output and numbers of target nematodes. As a first field test for this DNA sequence signature-based approach, seasonal fluctuations of nematode assemblages under open canopy (one field) and closed canopy (one forest) were monitored. Fifteen taxa from four feeding guilds  were detected at two trophic levels. These four feeding guilds are composed of taxa that developed independently by parallel evolution and we detected ecologically interpretable patterns for free-living nematodes belonging to the lower trophic level of soil food webs. Our results show temporal fluctuations, which can be even opposite within taxa belonging to the same guild. This research on nematode assemblages revealed ecological information about the soil food web that had been partly overlooked. The biotic soil fraction is the source of major ecosystem services like water holding, nutrient cycling, and carbon sequestration e.g. These vermiform invertebrates, mostly with body lengths ranging between 0.2 and 2.5 mm Moreover, the nature and rate by which nematodes respond to changes in the (a)biotical soil condition varies amongst different families and genera. At community level, this variation in responsiveness reflects itself changes in the numerical abundance, species composition, feeding traits and trophic distribution. The interconnected positions in the soil food web, in combination with taxon-specific responsiveness towards environmental stressors, make these invertebrates suitable as indicators.Over the last decade, substantial progress has been made in collecting phylum-wide genetic information of nematodes Caenorhabditis elegans (Rhabditidae) the number of non-gonadal cells increase from \u2248 550 (first stage juveniles) to \u2248 810 (mature hermaphrodite) Panagrellus silusiae (Panagrolaimidae) the number of somatic nuclei was shown to increase from \u2248 410 (second stage juvenile) to \u2248 590 (adult) For DNA-based quantitative community analysis, the effect of the (unknown) life-stage distribution within individual taxa should be considered. In the past, nematodes were thought to exhibit cell constancy; all individuals of a given species have the same number of cells. However, at least for one organ, the epidermis, this was shown to be incorrect According to Neher Fagus sylvatica forest.Seasonal fluctuations of non-parasitic nematode assemblages were studied in De Planken Wambuis, a nature reserve located on the Veluwe, the largest moraine complex in The Netherlands. Due to the absence of endangered and/or protected species, this investigated area of approximately 100 m length is not protected by law and no specific permits were required. Sandy soil samples were taken from two sites: a 30-year-ago abandoned arable field, known as Dennenkamp , and an adjacent more than 100-year-old Plantagini-Festucion association  is a relatively open area with a on sensu growing 2 and thoroughly mixed. Nematodes were extracted from 100 ml of soil using an elutriator Nematode assemblages were monitored throughout 2009 in an abandoned field and an adjacent pristine beech forest. On these sites, the upper 25 cm of the soil were sampled 18 times from March 17 (week 1) until December 18 (week 40). The humus fraction was still observable as a stratified layer in the forest moder . At eighteen time points (every 2\u20134 weeks), we randomly took four composite soil samples from the field, and two composite samples from the adjacent forest. Each sample consisted of 8\u201310 cores  taken from a surface of \u223c0.25 msensu Bongers To make a selection of monitored taxa for this study, suspensions from both sites were analysed microscopically twice . In total, 38 genera et al. et al. 10E1  and immediately used or stored at \u221220\u00b0C. These purified lysates were used for quantitative PCR analysis. We kept this DNA extraction procedure consistent for all samples in our study to ensure full comparability of results (Nematode suspensions (100 ml) were concentrated by centrifugation at 4,000 rpm, supernatant was removed until an end-volume of approximately 1.5 ml. This volume was further concentrated in a small vial at 14,000 rpm. The supernatant was removed until the final volume of 140 \u00b5l was reached. Subsequently, like in Holterman e.g., fungivorous Diphtherophoridae \u2013 separate specific primer combinations were developed for each of the constituting genera. In the case of the poly- and paraphyletic Rhabditidae, embracing 27 genera according to the Fauna Europaea [http://www.faunaeur.org (Accessed 2012 June 6)], no comprehensive DNA barcodes could be generated at such a large family level, albeit for some monophyletic genera, specific primers can still be developed.For the development of taxon specific PCR primers, a molecular framework consisting of \u2248 2,400 (nearly) full-length SSU rDNA sequences representing all major groups of terrestrial nematodes was used. ARB, a LINUX-based software package in silico using the program MELTING a) of 63\u00b0C. Based on an experimental temperature range test, only target-specific primer combinations with a sharp optimum were selected. This approach allows for a quantitative detection of combinations of taxa with the same PCR temperature profile.When designing the primer combinations, the annealing temperature of the oligonucleotides was assessed Primer combinations were tested in 25 \u00b5l containing 3 \u00b5l of 1,000 times diluted template , 1 \u00b5l of each of the taxon-specific primers , 7.5 \u00b5l Milli-Q water and 12.5 \u00b5l Absolute SYBR Green Fluorescein Mix (Thermo Fisher). For amplification on a thermal cycler (Bio-Rad iQ5), the following quantitative PCR temperature profile was used: 95\u00b0C, 15 min followed by 60\u00d7  followed by a melting curve program 47\u00d7 (15 sec from 72 to 95\u00b0C with steps of 0.5\u00b0C).i.e., largest \u0394Ct) between target(s) and close non-target(s); assays with a \u0394Ct lower than 12 were discarded. Here, Ct value is defined as the number of PCR cycles (\u2018C\u2019) at which the reporter dye emission intensity exceeds a predetermined threshold (\u2018t\u2019). In case of similar specificities, primer combinations with lowest Ct value per unit of template were preferred.For each taxon, one primer combination was selected on the basis of optimal specificity (Each purified lysate (DNA extract from 100 ml elutriated soil) was used as template with 15 primer combinations on a thermal cycler (Bio-Rad iQ5). A separate primer combination was used to quantify the internal standard  in each sample to estimate the efficiency of the lysis and purification procedure. Reaction volume of the quantitative PCR was 25 \u00b5l containing 3 \u00b5l of 50 times diluted template, 2 \u00b5l taxon-specific primers (end concentrations 200 \u00b5g/\u00b5l), 4.5 \u00b5l PVP40, 12.5 \u00b5l Absolute SYBR Green Fluorescein Mix (Thermo Fisher). The following quantitative PCR protocol was used: 95\u00b0C, 1 min followed (as before) by 60\u00d7  followed by a melting curve program 47\u00d7 (15 sec from 72 to 95\u00b0C with steps of 0.5\u00b0C).t units. The copy number and quantities of the target template are inversely proportional to Ct and can be calculated by direct comparison with Ct values for known standards et al. The quantitative PCR output is expressed in Ct-test . To visualize seasonal patterns and site-dependent differences, trend lines are shown for each family or genus per location. Inter-site comparisons were made for each of the detected families and genera and for the two basal trophic guilds (here as summed \u2018bacterivores\u2019 and summed \u2018fungivores\u2019) using independent Mann Whitney-U test (\u03b1\u200a=\u200a0.05). To get the temporal variation of the nematode community between our two habitats, a partial Mantel analysis was performed.The total numbers of nematodes were log transformed and an overall comparison  was made between the two ecosystem types (\u2018forest\u2019 and \u2018field\u2019) using sensuversus 3,222\u00b12,033 SD individuals; unweighted t-test P\u200a=\u200a0.023).While the air temperature fluctuated between 20.4\u00b0C (week 14) and \u22123.5\u00b0C (week 39) and the cumulative rainfall of the latest 21 days before sampling sensu fluctuati.e. 2 predatory families (here: Mylonchulidae and Mononchidae M3) and one omnivore family (here: Dorylaimidae D3), for monitoring using real time PCR , Prismatolaimidae (cp-3), Cephalobidae (cp-2), all in the left panel; Plectidae (cp-2) and the genus Anaplectus (cp-2), both in the red box; Alaimidae (cp-4), Metateratocephalidae (cp-3), and Monhysteridae (cp-2), all in the right panel. In particular, bacterivores show distinct temporal patterns in abundances in the two habitats, but also a taxon dependency was observed .In contrast to the total nematode densities, individual taxa show distinct temporal and site-specific patterns. The seasonal fluctuations for 7 bacterivorous families are shown in observed . For insTeratocephalus and Monhysteridae (\u03b1\u200a=\u200a0.05). Two families, Prismatolaimidae and Metateratocephalidae, were consistently more abundant in the forest, whereas Alaimidae, Cephalobidae, members of Plectidae and the genus Anaplectus were present in significantly higher densities in the field , Aphelenchoididae (cp-2), and Diphtherophoridae (cp-3). Ribosomal DNA sequences suggest that Diphtherophoridae are not monophyletic Tylolaimophorus and Diphtherophora, were detected separately. The composition of this guild is site-specific: whereas the forest was dominated by Tylolaimophorus, the fungal pathway of the nematofauna in the field was more diverse  of 63\u00b0C. To optimize the foreseeable specificity, selected primer combinations showed a sharp increase in Ct (threshold cycle) upon further Ta increase  measured 26 cycles  and the corresponding number of target nematodes , two series of handpicked individuals were generated. The resulting dataset, five Ct values for each Metateratocephalus and Euteratocephalus (y-intercept of the regression line describing the linear relationship between log (# nematodes) and the corresponding Ct values . Discrepancies between counts and qPCR in one fifth of our samples are either due to underestimation or to overestimation of the nematode biomasses. On one hand, lacking appropriate molecular assays are a caveat that explains underestimation. For a number of non-monophyletic taxa such as the Rhabditidae, in fact, no molecular assays could be designed. Members of this family (cp-1) can respond very quickly to both local environmental changes (e.g. eutrification) as to microbial pulses. If such a family would be abundant in a given sample, this would automatically result in a drop of the coverage. On the other hand, though unusual, averages of body-mass values at genus level can be very different within a single family. This phenomenon can be illustrated by the \u201cPlectidae minus Anaplectus\u201d. In this group, the fresh weight per individual  varies substantially between genera : throughout the seasons, this genus occurred at relatively constant density in the field, whereas it was virtually absent in the forest. This result confirms the outcome of a qualitative study of nematode communities in moder and mull  beech forest soils, where, Anaplectus granulosus was shown to be exclusively present in mull soils Comparison of the abundances of eight bacterivorous taxa during the entire experiment resulted in a diverse picture: for two taxa no difference was detected between the habitats, whereas six differed (four taxa were consistently more abundant in the field and two were present in significantly higher densities in the forest). Lumping the estimated nematode abundances into the feeding guild \u2018bacterivores\u2019 masks the taxon- and site-specific differences. One of those differences is the high density of Prismatolaimidae in the acidic moder. A factor that often contributes to this asymmetric distribution is pH, as some actively migrate downwards because of the leaching of certain groups of bacteria, their main resource. The passive transport of bacterial cells as a result of rainfall is a well-documented phenomenon Regarding seasonal changes in bacterivorous nematodes, a decreasing trend was observed for Teratocephalidae and Plectidae in June and July (week 13 to 17 in Diphtherophora and Tylolaimophorus. Whereas representatives of the genus Diphtherophora were constantly present in the field from week 15 onwards (though in low densities), they were lacking in the adjacent forest. Tylolaimophorus, on the other hand, was the dominant fungivorous nematode in the forest . If soil acidity is so important for belowground Operational Taxonomic Units (OTUs) as suggested by Mulder et al. et al. Tylolaimophorus spp. is known to be acidophilic Tylolaimophorus species might occur in the abandoned field (pH\u200a=\u200a5.7).Intra-feeding guild heterogeneity is further illustrated by the fungivorous nematodes. The family Diphtherophoridae harbors two genera, Diphtherophora  were respectively non-detectable or present in low amounts (late Autumn) in the acidic moder  is similar for the constituting genera, the ratio between these genera does not affect the accuracy of the results. However, some families such as Cephalobidae include genera with considerable body-size differences R2 for Cephalobidae was slightly lower in comparison to most other primer combinations  in numbers of individuals per 100 ml elutriated soil at different times in a former arable field and its adjacent pristine beech forest. Feeding guilds are given in capitals: B: bacterivore, F: fungivore, FP: facultative plant parasite, O: omnivore, P: predator. The weeks are defined as number of weeks after March 17.(DOC)Click here for additional data file."}
+{"text": "Pathways involved in DCIS stem and progenitor signalling are poorly understood yet are critical to understand DCIS biology and to develop new therapies. Notch and ErbB1/2 receptor signalling cross talk has been demonstrated in invasive breast cancer, but their role in DCIS stem and progenitor cells has not been investigated. We have utilised 2 DCIS cell lines, MCF10DCIS.com  and SUM225 (ErbB2-overexpressing) and 7 human primary DCIS samples were cultured in 3D matrigel and as mammospheres in the presence, absence or combination of the Notch inhibitor, DAPT, and ErbB1/2 inhibitors, lapatinib or gefitinib. Western blotting was applied to assess downstream signalling. In this study we demonstrate that DAPT reduced acini size and mammosphere formation in MCF10DCIS.com whereas there was no effect in SUM225. Lapatinb reduced acini size and mammosphere formation in SUM225, whereas mammosphere formation and Notch1 activity were increased in MCF10DCIS.com. Combined DAPT/lapatinib treatment was more effective at reducing acini size in both DCIS cell lines. Mammosphere formation in cell lines and human primary DCIS was reduced further by DAPT/lapatinib or DAPT/gefitinib regardless of ErbB2 receptor status. Our pre-clinical human models of DCIS demonstrate that Notch and ErbB1/2 both play a role in DCIS acini growth and stem cell activity. We report for the first time that cross talk between the two pathways in DCIS occurs regardless of ErbB2 receptor status and inhibition of Notch and ErbB1/2 was more efficacious than either alone. These data provide further understanding of DCIS biology and suggest treatment strategies combining Notch and ErbB1/2 inhibitors should be investigated regardless of ErbB2 receptor status. We investigated two DCIS cell lines, MCF10DCIS.com  and SUM225 (ErbB2 overexpressing), and 7 human primary DCIS samples taken from patients after surgery with ErbB2 positive or negative molecular subtypes. We demonstrate significant cross talk between Notch and ErbB receptors in cell lines and primary DCIS samples. CSC activity and acini formation in 3D matrigel of both cell lines and primary DCIS samples was reduced to a greater extent with combination treatment than with either inhibitor alone, regardless of ErbB2 receptor status.In the present study, we have used pre-clinical in vitro 3D recapitulated DCIS acini MCF10DCIS.com and SUM225 DCIS cell lines were seeded into matrigel culture with increasing doses of inhibitor. This allows the assessment of DCIS cells in a more in vivo like environment, facilitating basement membrane interactions that are not present in other in vitro culture systems. The number and size of the acini were measured after 21 days of culture. The number of acini did not change after treatment with either inhibitor however the size of DCIS acini was reduced by 25% in the MCF10DCIS.com cells at 10 \u00b5M DAPT (p\u22640.0001) and no reduction was seen in the SUM225 cell line (To investigate the effects of DAPT or lapatinib on ell line . Lapatinell line .in vivo like environment the effects are still observed on the bulk of the DCIS cells. To investigate the effects that these inhibitors may have on DCIS cancer stem/progenitor cell activity we have utilised the non-adherent mammosphere assay. DAPT (0.1\u201310 \u00b5M) caused a reduction in MCF10DCIS.com mammosphere formation efficiency (MFE) at 1 \u00b5M (p<0.03) and 5 \u00b5M (p<0.0003) compared to control but there was no significant effect on the SUM225 MFE at any concentration. In contrast to DAPT, lapatinib caused a marked decrease in MFE in the SUM225 cell line with a 39% reduction with the lowest dose of 0.25 \u00b5M (p\u200a=\u200a0.01). In the MCF10DCIS.com cell line lapatinib treatment cause an increase in MFE at all doses (0.25\u20132.5 \u00b5M)  .Changes in signalling within DCIS mammospheres were assessed on control and treated mammospheres after 7 days of non-adherent culture. MCF10DCIS.com mammospheres treated with DAPT showed a decrease in HES1 expression at 1 \u00b5M and 10 \u00b5M with an unexpected increase at 5 \u00b5M but no changes in Notch1 intracellular domain (NICD) (using a cleavage specific Notch 1 antibody), phospho-AKT or phospho-MAPK activity were observed at this time point. Lapatinib treatment on MCF10DCIS.com mammospheres did not alter levels of AKT or MAPK activity but levels of NICD were increased at the 0.5 \u00b5M and 2.5 \u00b5M dose . DAPT trThe concentration of DAPT and Lapatinib used within the combination experiments differed both between cell lines and the type of in vitro assay, matrigel/acini or mammosphere culture. Only concentrations causing \u226440% reduction in acini size or mammosphere formation were used in order to fully explore any further reduction with combination treatment. In MCF10DCIS.com cells, combined treatment caused a further reduction in acini size of 27% (p\u200a=\u200a0.023) and 50% (p<0.0001) compared to DAPT 10 \u00b5M (p<0.001) or 0.1 \u00b5M lapatinib (p\u200a=\u200a0.012) treatment alone respectively. Within this experiment addition of 0.1 \u00b5M lapatinib caused a significant reduction in acini formation which was not observed in The mammosphere assay revealed that the combination of DAPT 5 \u00b5M (p<0.0001) and lapatinib 0.5 \u00b5M (NSD) in the MCF10DCIS.coms was more effective at reducing MFE than either inhibitor alone, showing a further reduction of 58% (p\u200a=\u200a0.001) and 77% (p<0.0001) respectively . CombineWe validated the cell line data in human primary DCIS samples freshly isolated from patients after surgery. in vitro culture models of human DCIS to investigate signalling pathways that regulate DCIS CSC activity and acini growth in 3D matrigel culture. We use these DCIS models to establish that combined inhibition of both Notch and ErbB receptor pathways reduces CSC activity and acini growth in 3D matrigel culture regardless of ErbB2 status.We have established useful In the ErbB2 normal MCF10DCIS.com cell line, the Notch inhibitor, DAPT, caused a reduction in both acinar size and mammosphere formation  and 2A. The effect of the ErbB1/2 inhibitor lapatinib was also measured in both culture methods and, as expected, only the ErbB2 overexpressing SUM225 cell line showed a marked decrease in both acini size and mammosphere formation. Interestingly in the ErbB2 normal MCF10DCIS.com cell line, lapatinib treatment significantly increased mammosphere formation compared to control. Analysis of mammospheres at Day 7 showed that expression of the cleaved form of Notch1 (NICD) were elevated  which maHowever, our study demonstrates cross talk between Notch and ErbB2 in DCIS cell lines regardless of ErbB2 receptor status. The combination of DAPT and lapatinib showed an additive reduction in both size of acini and mammosphere formation in the MCF10DCIS.com and the SUM225 cells . Since tin vitro models of DCIS including human primary samples to investigate DCIS cell signalling. CSC activity and acini formation of both cell lines and primary DCIS samples was reduced to a greater extent with combination treatment than with either inhibitor alone, regardless of ErbB2 receptor status. These data provide further understanding signalling pathways involved in regulation of DCIS stem and progenitors. We conclude that treatment strategies combining both Notch and ErbB1/2 receptor inhibitors should be investigated in DCIS regardless of ErbB2 receptor status.Our results provide the first evidence that cross talk between ErbB1/2 and Notch pathways is present in DCIS regardless of ErbB2 receptor status. We demonstrate this using Human DCIS cell lines  SUM225 (ErbB-2 overexpressing) and MCF10DCIS.com  were grown in adherent culture in their relevant medium, MCF10DCIS.com cells were grown in advanced DMEM/F12, 5% (v/v) horse serum, L-glutamine 50 \u00b5g/ml all purchased from Gibco. The SUM225 cells were grown in Ham's F12 (Gibco), insulin 5 \u00b5g/ml, hydrocortisone 1 \u00b5g/ml, HEPES 10 mM and 5% (v/v) foetal calf serum. All cells were maintained in a humidified incubator at 37\u00b0C at an atmospheric pressure of 5% (v/v) carbon dioxide/air. The Notch inhibitor DAPT was purchased from Calbiochem, gefitinib was a gift from Astra Zeneca and lapatinib was a gift from GlaxoSmithKline: all were dissolved in 100% DMSO to a 10 mM stock solution.Women were included in the study if they had mammograms showing widespread microcalcification indicative of DCIS (n\u200a=\u200a7) and histopathological confirmation of the diagnosis of DCIS. All tissue samples were obtained following therapeutic DCIS surgery and were subsequently reviewed and graded by a consultant breast pathologist. All patients provided written consent and the approval to remove tissue from pathological samples was granted by the South Manchester Medical Research Ethics Committee (LREC 01/012).DCIS tissue was prepared as previously described 2 in appropriate polyHEMA (Poly (2-hydroxyethyl methacrylate) coated tissue culture plates or flasks (Corning). Mammosphere culture medium comprised DMEM-F12 media (Gibco) supplemented with B27 without vitamin A (Gibco) and Epidermal Growth Factor (EGF) 20 ng/ml (Sigma). Mammospheres were counted when their diameter was \u226560 \u00b5m. Mammosphere forming efficiency (MFE) was calculated as the percentage of MS formed relative to the original number of single cells seeded (Mean% MFE \u00b1 standard error [SEM])All experiments using cell lines or primary samples were seeded at 500 cells/cmTreatments were added to DCIS cell suspensions at day 0. Treatments included; gefitinib (an EGFR tyrosine kinase inhibitor), DAPT\u2013 IX  and lapatinib (a HER2/EGFR tyrosine kinase inhibitor) using DMSO control. MS were counted at day 5 or day 3 for the DCIS cell lines and primary samples respectively and expressed as percentage MS formation compared to a non-treated control.Single cell suspensions of DCIS cell lines were seeded at a density of 5000 cells/well in the appropriate adherent culture medium containing 2% growth factor-reduced matrigel into 8-well glass chamber slides containing 50 \u00b5l growth factor reduced matrigel (BD Bioscience). Inhibitors were added to the matrigel media from day 0, DAPT and Lapatinib were used alone and in combination as well as a DMSO control. The cells produced acini over a 21-day period, during which the growth medium (with or with our inhibitor/s) was replaced every 2\u20133 days. Acini were then counted and sized under a light microscope using an eyepiece graticule with crossed scales.Lysates from cells containing 50 \u00b5g of protein were fractionated by SDS-PAGE and transferred to Hybond nitrocellulose membrane (Amersham). The nitrocellulose was then blocked in Tris-buffered saline (TBS) containing 0.1% Tween-20 and 5% nonfat milk for 1 h at room temperature. The membrane was then incubated with primary antibody for 1 h at room temperature or 4\u00b0C overnight with gentle shaking. The membrane was then washed three times in TBS containing 0.1% Tween 20 and then incubated with horseradish peroxidase conjugated secondary antibody  for 1 h at room temperature. After washing, immunoreactive proteins were detected by enhanced chemiluminescence (Pierce). Primary antibodies for Western blotting were:- AKT  1\u22361000, Phospho AKT (Ser 473)  1\u22361000*, ERK  1\u22361000, pERK  1\u22361000*, Anti-human NOTCH 1 cleaved N terminal Cat#100-401-407 (Only the cleaved intracellular (activated) form (NICD) is detected), Rocklands) 1\u2236500*, Hes-1  1\u22361000, \u03b2-Actin (sigma), (*overnight incubation at 4\u00b0C). MacBiophotonics Image J (1.42l) was used to quantitate protein bands.Table S1Densitometry analysis of protein levels within (DOC)Click here for additional data file."}
+{"text": "Culex quinquefasciatus activity was higher and focused on the bed net roof when a human host was present, in colonized and wild populations. Both C. quinquefasciatus and Anopheles gambiae exhibited similar behavioural modes, with average flight velocities varying by less than 10%. The system offers considerable potential for investigations in vector biology and many other fields.Many vectors of malaria and other infections spend most of their adult life within human homes, the environment where they bloodfeed and rest, and where control has been most successful. Yet, knowledge of peri-domestic mosquito behaviour is limited, particularly how mosquitoes find and attack human hosts or how insecticides impact on behaviour. This is partly because technology for tracking mosquitoes in their natural habitats, traditional dwellings in disease-endemic countries, has never been available. We describe a sensing device that enables observation and recording of nocturnal mosquitoes attacking humans with or without a bed net, in the laboratory and in rural Africa. The device addresses requirements for sub-millimetre resolution over a 2.0 \u00d7 1.2 \u00d7 2.0 m volume while using minimum irradiance. Data processing strategies to extract individual mosquito trajectories and algorithms to describe behaviour during host/net interactions are introduced. Results from UK laboratory and Tanzanian field tests showed that  Worldwide, numerous vectors of malaria, dengue, yellow fever, filariasis, leishmaniasis and Chagas disease spend much of their adult life resting and bloodfeeding within human habitations. This is a vulnerable point in their life cycle, and targeting adult vectors in the home is an effective method of interrupting disease transmission. Knowledge of vector behaviour in and around human housing is often limited to generalities or simple endpoint events like locations and times of entering, arrival at the host, resting or exiting. A better understanding of vector movement within domestic dwellings and their interaction with control interventions such as bed nets could enable rational design of intervention tools, but technological challenges have hindered progress.Many existing diagnostics to quantify mosquito behaviour are based on assessing their response to stimuli, e.g. odours or insecticides, giving information on attraction or deterrent effect \u20135. The tAedes aegypti mosquitoes for 3 h [Imaging techniques have been used to obtain more detailed information on mosquito behaviour. Wind tunnel studies with transparent-walled test sections enable imaging with single or multiple cameras and hence two- or three-dimensional measurement of mosquito positions resolved in time can be obtained. Investigations of insecticide repellency, sensitivity to carbon dioxide, odour and heat stimuli have been conducted in both two ,8 and th for 3 h ,12, and  for 3 h  but thei for 3 h ,12 const for 3 h . The fli for 3 h ,14, are A significant advance towards the observation of natural behaviours in the field were studies of mosquito mating swarms using the setting sun as a back-light for a stereo camera pair ,16. IndiCulex quinquefasciatus, a vector and cosmotropical nuisance mosquito and Anopheles gambiae, a primary malaria vector in sub-Saharan Africa.The primary goal in developing the tracking system reported here was to investigate detailed aspects of host-seeking behaviour of mosquitoes at a human-baited bed net. The first biological findings from laboratory-based experiments have been reported , and her2.2.1.2 compared to a lens aperture of less than 100 mm2). A further drawback of conventional imaging is that increasing the depth of field by decreasing the aperture leads to further reductions in optical efficiency and concomitant worsening of the lateral resolution. Back-lit imaging offers the opportunity to resolve both optical efficiency and depth of field issues [Tracking mosquitoes as they fly within the space surrounding a bed net requires the imaging of an extended volume. Conventional diffuse imaging spreads the illumination over the target and captures the light scattered with a lens and camera. For metre-scale fields of view, this approach is optically inefficient as the scattering process intrinsically gives a loss by a factor of more than 10 000 : 1  sensitivity cameras were used to suit the illumination at 850 nm from the IR LEDs.2.2.2.maximum absolute difference. There is sufficient sensitivity and low image noise to detect the small intensity changes produced by a flying mosquito and the calculation is simple enough to run in real time and at high frame rates, although image capture is also triggered by other insects and by movements of the volunteer (human bait) or the bednet. The algorithm is implemented as a module within StreamPix 5 and user control of the threshold for image capture, is typically set between 4 and 10 grey levels. Initial observations revealed that periods of mosquito activity were interspersed with lengthy periods of inactivity when mosquitoes rested or were not present within the observable view. To mitigate the amount of data requiring processing, an algorithm for intelligent data capture was developed such that only images with moving mosquitoes present were recorded. The algorithm operates in real time by finding the absolute maximum per pixel greyscale difference between consecutive image frames, termed the 2.3.By definition, the imaging of mosquitoes over a large field of view results in images whereby the object of primary interest, the mosquito, is relatively small and with limited contrast given the imaging conditions , inset. 2.3.1.a,b), retaining the positive values only.The segmentation algorithm starts by finding the per pixel difference between successive frames a,b, reta2.3.2.\u2018Changed\u2019 regions in the image are associated with flying mosquitoes (or another moving object): thus the difference image is binarized by assigning \u20181\u2019 to those pixels above a user-defined threshold and \u20180\u2019 to those below. This threshold is estimated for each pair of images based on the signal-to-noise ratio (SNR) and a global minimum value is set to account for images where there are no moving objects while eliminating areas of noise due to uneven illumination. A first filtering process is performed at this stage, where any objects outside a predefined area range, 6\u2013400 pixels, are classified as \u2018noise\u2019 and removed.2.3.3.b). Hence, by identifying the human silhouette and net structure, any positions within a predefined distance, up to 15 pixels, can be removed. This process is applied only when necessary, by identifying the frame numbers where such movement is observed.Movement by the human volunteers or bednet varies in magnitude and may not be completely removed by the initial area-based filter. At the frame rates used, up to 50 fps, the \u2018changed\u2019 regions of the volunteer correspond to its contour b. Hence,2.3.4.An intensity-weighted centre of mass calculation is used to calculate the coordinates of the segmented objects corresponding to individual mosquitoes.2.3.5.To assess the performance of the algorithm, a set of artificial mosquito images were generated from fitted two-dimensional Gaussian intensity models. In simulations, pairs of frames were generated with increasing mosquito translation in the second image under the assumption that mosquito orientation does not change between a pair of images (20 ms). To assess algorithm performance and accumulate statistical data, mosquitoes of two sizes were generated (within the range observed in the recordings) and 100 Monte Carlo simulations randomly selecting the location of the mosquito in the first frame were performed. The root mean square (RMS) error in the mosquito centre positions were compared to the known mosquito centre from the simulation settings for each separation, and averaged across the different locations.2.4.x, y) image region and point in time. Since the segmentation algorithm is based on motion, the positions of stationary mosquitoes would not be detected. This was managed at the tracking stage and is similar to the issue of missing mosquito positions in individual or sequences of frames that can occur due to occlusions from the net or other objects. With reference to previous work on multi-view tracking it was identified by Wu et al. [The spatially and temporally resolved set of mosquito centre coordinates was formed into trajectories from which individual mosquito flying paths were determined. The tracking algorithm was written to handle both fast flights above the net, and trajectories where mosquitoes moved slowly across or rested on the bednet with the expectation that only a few mosquitoes are present in any . The assumption is that individual mosquito tracks show a greater level of continuity than any other mosquito's path. To avoid creating broken tracks as a result of such occlusions, during tracking, the search radius was set to be large enough to link tracks moving across narrow occluded areas (boundaries of the LLIN and the string supporting it). Furthermore, tracking parameters permitted gap closing over brief periods during which mosquitoes were not visible . In postj at each mosquito position ijp, delimit a search radius R within which the mosquito is likely to be found in the next frame j + 1. N is defined as the number of possible assignments for the ith mosquito in the j + 1 frame.(1)\u2003In the current frame iju by looking at the temporal consistency of mosquito displacements. Calculate the cost of each possible assignment by estimating their temporal coherence: take the M previous frames of the ith mosquito trajectory up to frame j and estimate ikT . Select the link with the best temporal smoothness, i.e. the one with the minimum ikT:ikT\u00a0is below a predefined threshold.(2)\u2003Determine the most likely displacement vector mate Tik , no. 10 (3)\u2003Keep the last known position of any unpaired mosquitoes for a predefined number of frames. This is to deal with resting mosquitoes that will eventually start moving or mosquito images that had become occluded by the bednet so that the trajectory can be resumed. If however, the mosquito cannot be re-assigned soon enough, the current trajectory is terminated and when movement resumes then a new trajectory is initiated.jt, update the trajectories of the current frame, so that these can be used for the estimation of the temporal coherence functions at the next frame, and so on.(4)\u2003After finding the assignments for all mosquitoes in the current frame ikT is below the predefined threshold then \u2018join\u2019 the trajectories.(5)\u2003After completing initial pairing for all frames, check for terminated trajectories, i.e. trajectories with ending points far from the edge of the field of view. Evaluate possible connections to \u2018initiated tracks\u2019, i.e.: trajectories with starting points far from the edge of the field of view, using the consistency check (2 above) and if (6)\u2003Validate trajectories by setting a minimum number of frames where an individual mosquito is required to be present and check for temporal consistency (smoothness) of the complete track. This avoids linking non-mosquito features that can sporadically appear due to noise.(7)\u2003Check for trajectory connections between the two parallel camera views: identify end and start points of trajectories within a specified distance of the common border between the two camera images. Use the consistency test from 2 above to identify trajectories that should be connected.A detailed description of the greedy algorithm developed to solve the tracking problem is given below, the notation is defined in 2.4.1.\u2014\u2003number of initial tracks (without reconnections);\u2014\u2003number of mosquito positions along a track; and\u2014\u2003number of tracks with long gaps where the track identity was retained (expressed as a percentage) and the average number of frames per gap.To assess the results of the tracking algorithm a number of performance metrics are defined below. The parameters estimated from the initial tracking (stages 1\u20134) are:ijT\u00a0is the total number of tracks and ijU\u00a0is the number of tracks that could not be connected, i.e. mainly those that terminated or were initiated at the bednet, then TF can be defined as:ijU, the more likely that a single trajectory was used to describe a mosquito path, and therefore preserving its identity in time.After checking for unconnected tracks (trajectories that terminated/started far from the edge of the field of view) and making connections where possible (stages 5\u20137), the final set of tracks is obtained. The Track Fragmentation (TF) metric quantifies how well the mosquito identity is maintained (adapted from ). If Tij2.5.(1)\u2003Swooping: flights where mosquitoes made no contact with the bed net or the host during the entire trajectory.(2)\u2003Visiting: tracks consisting of long periods of flight punctuated by infrequent contact (visits) with the net or host. Visits were characterized by at least one contact point, or sharp turn of 80\u00b0 or more, on the net or host surface. Where multiple contacts occurred, the minimum interval between them was 0.4 s and we assumed that the mosquito continued to fly before and after each contact.(3)\u2003Bouncing: tracks where the mosquito made repetitive contacts with the net or host, at intervals of less than 0.4 s. This category included periods of \u2018walking\u2019, where mosquitoes appeared to stop flying and stayed in contact with the substrate but without being static.\u22121. The latter condition was included to allow for missing positions within tracks. Mosquitoes were assumed to be in constant contact with the bed net or host.(4)\u2003Resting: tracks where mosquitoes were completely static, or the instantaneous speed of the mosquito was less than 1.33 mm sMosquito tracks were classified into four flight types, termed behavioural modes, quantified and distinguished by extent of net contact and track velocity, as defined by .(1)\u2003SwoModes 2\u20134 were not exclusive and a single trajectory potentially could display different modes at different times, e.g. visiting followed by bouncing and finally, resting.2.5.1.Bed net surfaces were identified by manually selecting the net corner points in an image and classifying each region as outside or inside the net. Activity was allocated to a region based on the coordinates of the mosquito, and whether the mosquito contacted (behaviour modes 2\u20134) or was swooping in front or behind of the net (behaviour mode 1).Contact points during flight were defined as sharp turning points that occurred at any net surface. Position vectors were estimated from consecutive points in a trajectory and a sharp turn was defined by the angle formed by adjacent vectors (x) and vertical (y) trajectory coordinates. In general, bounces can be defined by semi-periodic changes in the x- and y-positions; thus after removing the high-frequency and the low-frequency underlying components such that x- and y-coordinates of each track were centred around a zero mean (bandpass Butterworth filter with cut-off frequency of 1.5 and 15 Hz), bounces and therefore contacts, were characterized by finding the zero crossings between positive and negative peaks  and downwards (shades of red) movement [x- and y-coordinates are given in figure\u00a05b\u2013d, with the final number of net contacts derived from the combined set of zero crossings after validation by minimum and maximum temporal limits between contacts.However, during repetitive attacks, e.g. bouncing mode, not all net contacts are characterized by such sharp angles, and a second set of contacts was identified using variations in the horizontal . Tests were carried out on unfed adult females that had the opportunity to mate, 3\u20135 days post-eclosion, in a large (5.6 \u00d7 3.6 m in area 2.3 m high) dedicated insectary at LSTM [ at LSTM .2.6.2.C. quinquefasciatus were reared in insectaries at the National Institute for Medical Research (NIMR) from immature stages collected in local breeding sites, identified morphologically  and tested between 21.00 and 22.30 h.Field tests were carried out in an experimental hut at a rural location in Kayenze, near Mwanza, northern Tanzania. Adult 2.6.3.Bed nets were assembled from untreated polyester and hung with the top roof tilted on its long axis  and tail2.6.4.C. quinquefasciatus and A. gambiae respectively. In addition, three control tests (i.e. an untreated bednet with no human bait present) were also carried out with C. quinquefasciatus.Laboratory studies used 25 mosquitoes per test, in six and 10 tests for Mosquitoes were starved of sugar and water for 4\u20136 h before tests and introduced into the experimental room in a 220 ml paper cup suspended 2 m high on the wall, 1 h prior to testing, when the volunteer also entered the net and the room was shut to allow for acclimatization. A cord enabled the mosquitoes to be released from outside the test facility. At the end of 1 h of recording, mosquitoes in the room were collected with aspirators.2.6.5.Tests were carried out in the dark (insectary) and at night (field) with artificial lighting provided by the imaging system's IR LEDs alone. Two Norpix recording systems (hardware and software) were used, each with StreamPix software to provide live previews and control recording of up to two cameras. Enhanced NIR sensitivity Baumer HXC40NIR cameras offering 2048 \u00d7 2048 pixels and up to 180 fps were selected with full Camera Link interfaces. Each image capture PC, i7 3.4 GHz, 8 GB RAM, was equipped with 20 terabytes (TB) of storage, two Silicon Software interface cards to support the two Baumer cameras and running StreamPix 5 software for data capture and storage. The system was capable of recording 5.5 h of continuous data from the two cameras at 100 fps. At a capture rate of 50 fps, the system typically generated 1.4 TB data per hour.2.6.6.The tracking algorithms were implemented in MATLAB and consisted of three modules: an automated component that extracted mosquito positions from each frame; a partly-human-supervised component to verify the extracted positions and apply algorithms to remove noisy data (e.g. human/net movement) before automatically linking mosquito trajectories; a third module enabled track editing and automated procedures to reconnect broken trajectories. These trajectories were then further analysed for assignment to behavioural modes and to extract parameters (sections 2.5 and 2.5.1 and ).2.6.7.t-tests and generalized linear models with normal distribution were used to compare the velocity distributions between species, activity times, behavioural modes and net region preferences. When values were not normally distributed according to calculations of skewness and kurtosis, data were log transformed. For the velocity vector analysis, equal sample sizes were obtained by randomizing the selection for inclusion in calculations. The size of the smallest group was taken as the limit and the mean and standard deviation of the original and subsampled population compared to verify that the latter was representative of the original set. Given the positive skew of the datasets (Using SPSS Statistics 21 (IBM), independent sample datasets , data we3.3.1.3.1.1.a). Evaluation of and comparison with other camera lens apertures and Fresnel lens separations showed that with the current system, a 2 m separation between the lenses provided an optimal compromise between resolution, available camera lenses and the required measurement volume.These data demonstrate the ability of the set-up to resolve mosquito scale objects throughout a measurement volume of 1.0 \u00d7 1.2 \u00d7 2.0 m per camera. Medium-sized objects, representative of a typical mosquito abdomen 0.4\u20130.5 mm wide and 1.2\u20134 mm long, had the most consistent measurements (as indicated by the standard deviation). With an estimated pixel resolution of 0.5 mm in the measurement volume , the resulting geometric mosquito image was 4\u20138 pixels in size, but with diffraction and the limitations of the imaging system, became 10\u201315 pixels a. Evalua3.1.2.The simulations to quantify the performance of the mosquito segmentation and position measurement algorithms (\u00a72.3) showed two clear trends: the mosquito position error was larger for smaller inter-frame displacements, and there was a dependence on the size of the mosquito. The RMS mosquito position error reduced to a constant level at displacements of approximately 1.3 times the mosquito length, corresponding approximately to Rayleigh's resolution limit. The average position error for inter-frame displacements up to Rayleigh's limit was 0.5 mm (corresponding to 1 pixel), whereas the average overall displacement was 0.12 mm, approximately one-fourth of a pixel. An alternative algorithm to define the mosquito position was evaluated based on locating the peak intensity in the original image according to the location in the difference image (see \u00a72.3). While this approach reduced the displacement at which the position error approached a constant value by 75% and the positional uncertainty at Rayleigh's limit was halved, the algorithm was more susceptible to noise  and processing time was doubled. As the position error of the original algorithm applied to the difference image was predominantly in the direction of movement, the overall effect on the trajectory was low, and the original weighted centre of mass approach was preferred to reduce processing time. The automated segmentation process took approximately 13 s per second of recorded footage .3.1.3.R in \u00a72.4). The algorithm was set to wait up to 500 frames (10 s) for a mosquito to re-start moving and maintain its identity and the number of frames for the coherence calculation was set to 10 (M in \u00a72.4). Under these conditions, mosquito trajectories frequently had one or two potential assignments at each time step, which could increase to 8 when multiple mosquitoes were present. Merges and splits rarely occurred and were mainly observed on the bednet where either a mosquito was occluded by the bednet or resting. Initial analysis of the image sequence obtained showed that 50% of mosquito inter-frame displacements were greater than 10 pixels (5 mm) and 25% were above 22 pixels (11 mm). Thus, the search radius for the initial pairing process was set to 80 pixels , the average TF score was 1.4, that is, for every 10 trajectories, three would either terminate at the bednet or between the two fields of view. This value compares well with that reported for a similar metric in Ardekani et al.  in which3.2.p < 0.001) mosquito flight activity involved net contact, either as bouncing (60.5% of flight activity), visiting (29.7%) or resting (5.3%), compared with swooping (4.5%) where no net contact occurred. Tracked mosquito flight events are shown in the electronic supplementary material, video, and include trajectories classifiable in each of the four behavioural modes.The duration of individual flight events or tracks from all laboratory baited tests ranged from 0.38 to 272.2 s, with a mean track length of 23.5 s . The mean total activity of all 25 mosquitoes within each hour's test  was 354 \u00b1 122 min for an average of 1558 \u00b1 660 trajectories. Significantly more . The proportions of time spent in each behavioural mode also were different, with significantly more net contact occurring with a human bait  than without .Mosquito behaviour was markedly different in the absence of a human host, with a mean total activity of 9 \u00b1 2.5 min recorded for an average of 92 \u00b1 41 trajectories, significantly lower than when nets were baited  and baited nets . Comparing the average flight velocities in all behavioural modes in human-baited tests , with tests using unbaited nets , showed that although velocities were significantly different between each behavioural mode (p < 0.005), the presence of a bait had no significant effect on flight speed (p = 0.252).There was no difference in flight speed at unbaited nets (mean velocity 312 \u00b1 12 mm sa) allowed quantification of mosquito persistence levels or decay following intervention and was used by Parker et al. [figure\u00a08b) showed some mosquitoes accelerating rapidly down towards the net before bouncing at lower velocities across the roof (see tracks 1 and 2), as shown by the lighter colour of both red and blue.The behaviour of individual mosquito trajectories could be classified using the algorithm described in \u00a72.5. figure\u00a08r et al.  to demonA. gambiae [Quantification of mosquito velocity immediately before and after bednet contact showed that mosquitoes decelerated immediately prior to contact , indicat gambiae .Figure 3.3.We explored the potential of the tracking system to discriminate between these two mosquito species. Both are nocturnal bloodfeeders, commonly found biting humans simultaneously in Africa where they are disease vectors, and both are important model organisms for many disciplines.C. quinquefasciatus were significantly more active than A. gambiae with mean activity totals per test of 354 \u00b1 122 and 129 \u00b1 40 min, and average numbers of trajectories per test of 1558 \u00b1 660 and 544 \u00b1 188, respectively . We also compared the velocities of both species in each behavioural mode as shown in At human-baited bednets, p < 0.001, generalized linear model) though not all were in the same direction. Hence, in swooping flight, C. quinquefasicatus (mean velocity s.d. 362 \u00b1 148 mm s\u22121) flew faster than A. gambiae (342 \u00b1 155) while in visiting and bouncing modes, A. gambiae  were faster than C. quinquefasciatus (268 \u00b1 124 and 162 \u00b1 79 mm s\u22121).Differences between both species were statistically significant for all behavioural modes , the field hut image is seen to be slightly inferior, with illumination less uniform across the image. The uneven hut floor of locally sourced timber compromised precise alignment of the Fresnel lenses and camera resulting in darker areas in the images that in turn increased noise levels. The effects of this were manifest in the slightly poorer tracking algorithm performance statistics for the two field experiments , and that highest levels (36.3%) of mosquito activity occurred in the roof area above the lower torso. In fact, 68.3% of all activity occurred within the three net roof regions above the volunteer's head and chest. By contrast, approximately 1% of activity occurred in the two spatial regions at the side of the net . Again, mosquitoes showed a preference for the roof of the net above the volunteer's head and chest with 70.4% of activity occurring within these three regions and 47.5% above the lower torso, with 2.2% and 9.8% activity recorded in the two spatial regions at the side of the net.Analysis of field data also indicated activity to be non-randomly distributed across the net .Finally, we compared all the test results from field and laboratory populations of of tests . Interes4.The ability of a novel back-lit imaging system to image mosquitoes across an extended volume of 2.0 \u00d7 1.2 \u00d7 2.0 m is demonstrated. The imaging system is optically efficient, uses low power density illumination in a mosquito-blind region of the spectrum and performed well under very basic field conditions. Additionally, frame difference techniques enabled mosquitoes to be tracked during free flight above, in front of, behind or in contact with a human-baited bednet. The tracking algorithm employed a temporal coherence function in order to cope with background noise levels and movement of other objects, typical of experimental images. Previous tracking techniques based on correlation analysis used the spatial consistency of a group of moving particles; however, given the independent nature of mosquito behaviour and that the images obtained were integrated along the line of sight from a three-dimensional volume, assumptions about spatial coherence were no longer valid, hence the necessity of a new approach. Our complete tracking algorithm uses multiple passes of the data in order to connect tracks where suitable criteria are satisfied, and enables continuity of tracks across multiple camera views. The high frame rates helped minimize the likelihood of incorrect correspondences between mosquito images since the typical mosquito displacement between frames was smaller than the inter-mosquito spacing. The level of automation in the data processing enabled analysis of over 50 times the number of mosquito positions reported previously.For the first time, populations of important mosquito vectors can be tracked during nocturnal host-seeking for long time periods, under natural conditions in the field. Individual identities are maintained while a mosquito is within the field of view of either camera, enabling simultaneous tracking of multiple mosquitoes. Typically, approximately 1200 tracks were recorded from 25 mosquitoes over a continuous 1-h period with individual tracks up to 300 s in duration.C. quinquefasciatus activity, presumably in response to the host beneath, was focused at the bed net roof. In this respect, their behavioural responses were similar to those reported for anopheline mosquitoes [Examining key behavioural elements in the data presented, squitoes ,25 and wsquitoes . MoreoveA. gambiae [C. quinquefasciatus activity was significantly higher in the presence of a human host, particularly in bouncing and resting modes, concurring with hypotheses of mosquito host location behaviour [As with  gambiae , C. quinehaviour ,27, withC. quinquefasciatus and A. gambiae, but initial results suggested that potential exists to enable such discrimination in future. Calculations of image size in these tracks found C. quinquefasciatus to be approximately 17% larger than A. gambiae mosquitoes, and larger insect species generally fly faster [C. quinquefasciatus did show higher velocities during swooping mode, A. gambiae flew faster in the more tortuous bouncing mode, possibly facilitated by their smaller inertia. Comparison of flight velocities between the two species in each mode, showed up to 10% average overall variation. Efforts to identify reliable methods of discriminating these and other important mosquito genera will continue.This study did not attempt to use trajectory characteristics to distinguish between y faster . While CAlthough at a very early stage, we consider the system's value to vector control to be evident, while additional applications for many lines of basic or applied research are also possible. This tracking system has been used already to describe the detailed mode of action of bed nets , and cou"}
+{"text": "Anopheles gambiae responding to human-occupied bed nets in a novel large-scale system, we characterised key behaviours and events. Four behavioural modes with different levels of net contact were defined: swooping, visiting, bouncing and resting. Approximately 75% of all activity occurred at the bed net roof where multiple brief contacts were focussed above the occupant\u2019s torso. Total flight and net contact times were lower at LLINs than untreated nets but the essential character of the response was unaltered. LLINs did not repel mosquitoes but impacted rapidly: LLIN contact of less than 1\u2009minute per mosquito during the first ten minutes reduced subsequent activity; after thirty minutes, activity at LLINs was negligible. Velocity measurements showed that mosquitoes detected nets, including unbaited untreated nets, prior to contact. This is the most complete characterisation of mosquito-LLIN interactions to date, and reveals many aspects of LLIN mode of action, important for developing the next generation of LLINs.Long-lasting insecticidal bed nets (LLINs) protect humans from malaria transmission and are fundamental to malaria control worldwide, but little is known of how mosquitoes interact with nets. Elucidating LLIN mode of action is essential to maintain or improve efficacy, an urgent need as emerging insecticide resistance threatens their future. Tracking multiple free-flying  Many of the important mosquito vectors of malaria feed indoors at night, where and when most human malaria is transmitted in Africa135Anopheles spp. landed preferentially on the top surface of bed nets79101113161718Delivering the \u2018next generation\u2019 of LLINs or similar tools will require a thorough understanding of how LLINs function, yet remarkably little is known of the mode of action or of precisely how mosquitoes behave at the LLIN interface. Recent studies using \u2018sticky-nets\u2019 reported that host-seeking female e.g. the minimum duration of LLIN contact necessary to deliver an effective dosage is not known. Despite these phenomena being recognised for decades2021A further complication is the existence of what is termed \u2018contact-irritancy\u2019 or \u2018excito-repellency\u2019, whereby brief exposure to an insecticide can result in mosquitoes exhibiting avoidance behaviour, potentially before a lethal dose has been delivered13e.g. changes in sensitivity to repellents, attractants, or modified flight or resting behaviours). In the absence of definitions or quantifications of the basic behavioural events likely to be affected26Consequently, behavioural resistance to insecticides remains poorly understood and rarely reported in mosquitoes, though the risk of vector populations switching blood-feeding times, locations or host preferences in order to avoid LLINs is recognized and closely monitored today2324Ideally, characterisation of mosquito behaviour requires direct observation under conditions that are as \u2018natural\u2019 as possible. Informative studies to date have been limited to wind-tunnel or small-scale laboratory tests, potentially restricting mosquito flight. Frequently, tests use artificial or incomplete attractants such as human breath or limited body parts, carbon dioxide, single attractant chemicals or simple odour blends918293032Anopheles gambiae responding to human hosts within bed nets in a large experimental laboratory, and we show that human-baited LLINs operate by luring mosquitoes into multiple brief contacts with the net, almost entirely on the net roof, within minutes of commencement of host seeking, virtually eliminating all flight activity by 30\u2009minutes.Addressing many of the technical challenges that hindered progress to date, we have developed and constructed a novel system that enables tracking, recording and analysis of the flight paths of multiple individual mosquitoes over long periods in the dark at large volumes around the entire human host. In this first application of the system, we describe the flight and landing behaviour of Swooping: Tracks that did not contact the bed net.Visiting: Tracks where relatively long periods of flight were interspersed with infrequent contacts with the bed net. Contacts were characterized by sharp turns of 80\u00b0 or more in the trajectory and when multiple contacts occurred, the minimum interval between them was 0.4\u2009seconds .Bouncing: Tracks where the mosquito made multiple rapid contacts with the bed net surface, at intervals of less than 0.4\u2009seconds; includes events where the mosquito executed short flights between contacts, or maintained contact with the bed net surface without being static. The latter were brief pauses in movement lasting less than 0.75\u2009seconds and included \u2018walking\u2019 on and \u2018probing\u2019 the bed net.Resting: Mosquito tracks where insects were either completely static for at least 0.75\u2009seconds, or where the velocity of mosquito movement was less than 1.33\u2009mm/s ; assumed constant contact with the bed net surface. Dead mosquitoes were excluded by limiting resting events to a maximum of 300\u2009seconds. Notably, no dead mosquitoes were found on nets at the end of tests.In all treatments, mosquito activity was classified into four quantifiably distinct types of behaviours, termed \u2018modes\u2019 , definedp\u2009<\u20090.001) and the total duration of activity recorded for each test . Activity at LLINs  was significantly lower than at untreated nets (p\u2009<\u20090.001) but similar to unbaited nets .Activity at an untreated bed net was significantly lower in the absence of human bait, as measured by the mean number of flight tracks  compared to 58.1% on an unbaited net. In fact, 65.3% of the activity at a baited net involved frequent (bouncing) or continuous (resting) net contact, in contrast to 4.7% on the unbaited net. Moreover, the mean times spent in each mode involving contact  in the presence of human bait while swooping was not significantly different (p\u2009=\u20090.953). At LLINs, activity in all four behaviour modes was significantly lower than at untreated nets, particularly in the three modes with net contact where treated net activity fell to 27% or less than the untreated net values . However, a response to the host persisted despite the insecticide presence as evidenced by the values for bouncing and resting modes, which were significantly higher than at unbaited nets .Exploring this activity by behavioural mode  shows th contact  were sigp\u2009=\u20090.005) and LLINs , which were not significantly different from each other (p\u2009=\u20090.923).The instantaneous velocity of individual swooping flight tracks ranged from 83.9 to 985.8\u2009mm/s across all tests, with a mean velocity of 346.2\u2009mm/s . Mosquitoes flew slightly faster at baited untreated nets (355.8\u2009mm/s [340.1\u2013371.5]) than at unbaited nets , but not different between LLINs and baited untreated nets (p\u2009=\u20090.783).Track tortuosity was higher in both baited net groups than in the unbaited nets , though in baited LLINs marginally more net approaches started above the net than below .Simple analysis of the spatial location of flight path prior to arrival did not indicate any notable bias for low (below top net surface level) or high (above the net) spatial preferences. Adjusting for differences in the visible field of view between high and low areas, equal distribution would result in 36% of tracks starting in the high region. In unbaited and untreated tests, there was no preference  around the bed net was significantly different at each net type (p\u2009<\u20090.001). W\u2009<\u20090.001), compare\u2009<\u20090.001). In cont\u2009<\u20090.001).p\u2009<\u20090.001), with less activity occurring in regions 15 and 16 in front of the vertical net sides. In visiting mode, there was a significant interaction between net type and activity distribution : bouncing flight was higher in regions 2, 3 and 4  in untreated nets, whereas most bouncing activity at LLINs occurred in regions 1, 2, and 3  and resting (p\u2009=\u20090.001) modes  modes , there wi.e. tracks that accelerated on their last two points of flight before contact or where deceleration did not start until within 3\u2009mm of the net, and leg contact could not be excluded) were calculated as 1.7% [\u22122.0\u20135.3] at unbaited nets, 7.5% [5.6\u20139.4] at untreated nets and 7.6% [\u22120.1\u201315.3] at LLINs, and were not significantly different between treatments (p\u2009=\u20090.392). Hence, over 90% of mosquitoes decelerated prior to net contact, with deceleration starting at approximately 0.12\u2009seconds prior to landing, at a distance of 26\u201341\u2009mm from the net.The mean velocities of mosquitoes during final approach to the net surface, immediately prior to net contact, were determined for each test and compared between bed net types. In total, 896 tracks fitted the conditions for contact analysis. Of this subset, the mean percentages of net contacts classed as \u2018contacts without deceleration\u2019 (p\u2009=\u20090.010) and LLINs , which were not significantly different from each other (p\u2009=\u20090.708). In addition, unbaited arrival flight velocities (276.6\u2009mm/s [212.6\u2013340.7]) were significantly slower than those at untreated  and LLINs , which were not significantly different from each other (p\u2009=\u20090.175).However, the point at which mosquitoes started to decelerate  was signp\u2009<\u20090.001) and unbaited nets . However, contact time was significantly higher also on LLINs than on unbaited nets (p\u2009=\u20090.003). The longest contact time recorded for a single mosquito track was 37.4\u2009s on an unbaited net, 160.4\u2009s on an untreated net and 110.5\u2009s on an LLIN. Since it was not possible to measure the actual total contact time for individual mosquitoes, we determined plausible mean minimum and maximum contact time values ; LLINs\u2009=\u200917s (6\u201343)(p\u2009=\u20090.432). Comparing untreated baited nets with LLINs, there were no differences in the number  or the distribution of contacts on different net regions (p\u2009=\u20090.145), with a significant majority (p\u2009<\u20090.001) of first contacts on the net roof in both (p\u2009<\u20090.001) occurred in a significantly different pattern (i.e. near uniform distribution) on the net (p\u2009=\u20090.018); baited\u2009=\u20096s (1\u201333)(ectively). At unba\u2009=\u20090.018).These results indicate that LLINs did not repel mosquitoes to any significant level prior to net contact. Yet, while contact with LLINs was significantly lower than untreated nets over 60\u2009minutes , Table 1An. gambiae at an LLIN. On detection of a human host within a bed net (with or without insecticide), mosquitoes responded immediately in four distinct behaviour modes, with persistent attempts to reach the host resulting in multiple brief net contacts focussed on the net roof above the human torso. Behaviour at an LLIN retained the essential character of the response to untreated nets for the first ten minutes, during which time less than one minute of total contact was made with the LLIN. A rapid decay in all modes of activity resulted and after thirty minutes, mosquito activity was negligible and did not recover. Lag times to response and velocities and deceleration rates prior to net contact were similar in LLINs and untreated nets, demonstrating the absence of LLIN repellency. The results demonstrate that an LLIN is a highly efficient fast-acting baited insecticide trap.These results provide detailed insight into the behaviour of These results were obtained with an optical imaging and flight-tracking system allows remote tracking, recording and quantitative analysis of multiple mosquitoes simultaneously flying without restriction in large fields of view over long periods while they respond to a complete human host in complete darkness. For studies at this scale, the system offers a number of advantages over other approaches. Despite their undoubted value, existing tracking systems, including some three-dimensional (3D) systems, are restricted  in terms of temporal resolution and test arena size constraints, short recording durations (up to 15\u2009minutes), the low numbers of mosquitoes that can be observed simultaneously (1\u20134 mosquitoes per experiment) or the need to use isolated host cues such as heat or odour rather than complete human baits928353536373738\u00ae 2.0 is one of the most purchased and widely used LLINs in Sub-Saharan AfricaThe findings are novel and a significant contribution to our understanding of mosquito behaviour generally, and specifically how it is targeted by LLINs. Although the LLIN tested is only one of many types commercially available today, the Permanete.g. potentially obscured by the host, net seams or wrinkles, or during processing) we consider this to be an accurate measurement of LLIN contact duration.The immediate and rapid effect of the LLIN and the low level of net contact required to achieve that has never been reported. Less than one minute of contact within the first 10\u2009minutes reduced subsequent foraging such that all flight and host location activity was virtually eliminated by 30\u2009minutes. Whilst acknowledging that a limited number of net contacts may not have been captured by the tracking system . We are unaware of any appropriate studies on mosquitoes for comparison, but et al. unpublished). Though still at an early stage, already these findings significantly contribute to the evidence base required for improved vector control tools by identifying previously unrecognised vector behaviours that may be vulnerable to targeting via simple interventions, and mechanisms that identify potential routes for reducing quantities of insecticide used or for the use of previously unavailable insecticide classes. They also provide a base for further research on basic behavior and much-needed studies into behavioural mechanisms of insecticide resistance. Not least, the study provides a new platform for elucidation of LLIN function and evaluation of new LLINs6667Ongoing work will explore flight trajectories further and investigate responses in resistant malaria vector populations, other LLINs and other mosquito species. The tracking system has been deployed in rural locations in Africa where preliminary results indicate that these laboratory findings are representative of wild populations , were tested in a dedicated insectary at LSTM .Three to five day old unfed adult female (25 per experiment) \u00ae 2.0 , a WHOPES approved productThe LLINs used were Permaneti.e. no human bait) untreated net. Ten human volunteers were used, a sample size exceeding that used in previous studies investigating similar behaviours78Data were recorded and analysed from 23 laboratory tests (25 mosquitoes/test): 10 with an untreated net and 10 with an LLIN, each with 10 different human bait individuals; 3 tests used an unbaited (www.norpix.com) and data saved as .seq files.Mosquitoes were tracked using paired identical recording systems . A track could comprise up to three different behavioural modes  and where more than one mode occurred, the times spent in each mode were recorded separately.Segmentation and tracking algorithms were developed using bespoke software written in Matlab (Mathworks), to extract and interpret trajectory duration, time resolved velocity, distance travelled, tortuosity, and the number and duration of contacts with the bed net. Flight track segments were categorised in behavioural modes using existing quantification algorithms  and its first contact with the net, and the effect of net type were assessed with Kaplan Meier Survival Analysis.i.e. over the net: regions 12 and 13 e.g. track continuity was lost during movement between lenses or darker net regions or tracks could not be linked with confidence) and discarded; rigorously applying this rule eliminated 24% of tracks from analysis. A one-sample two-tailed t-test was used to compare the percentage of tracks making high approaches, with the expected value equal to 36% . Location of first net contact was assessed using the definitions of contact stated in relation to activity modes i.e. a sharp change in track direction, or frequent semi-periodic change.Analyses were applied only to activity recorded in the first ten minutes. The point where a track first appeared in the field of view was classed as either high , and tortuosity calculated as the ratio of actual distance travelled to the straight line distance between the two end points on the section; sub-section values were then averaged to provide track value. This method removed bias resulting from extreme meandering tracks that started and ended in close proximity. Although speed and tortuosity data were not normally distributed, results from GLM analysis of transformed data were unchanged, and the untransformed data are shown.To explore mosquito velocity during approach and landing at bed net surfaces, trajectories in which mosquitoes flew for at least one second prior to contacting the net were selected, and a 65-point section of each trajectory, from 1\u2009second before contact to 0.3\u2009seconds after contact was selected. Instantaneous velocities and rates of acceleration/ deceleration of these segments were calculated for each track point as described in the i.e. when leg contact could not be excluded) or that accelerated on their last two points of flight towards the net, were quantified for each repeat test. As our interest was in determining whether mosquitoes decelerated prior to contact, these events were classed as \u201ccontacts without deceleration\u201d and were excluded from further analysis. Remaining tracks were used to calculate a mean track distance between the point at which deceleration occurred and the net, for each of the 23 test replicates. Average instantaneous velocity at the deceleration was calculated for each test.With front legs extended during flightx\u2019 and/or \u2018y\u2019 co-ordinates were detected from zero crossings of a bandwidth-filtered position vs. time history . To avoid spurious connections between unrelated net-arrival and net-departure tracks, resting periods were limited to a maximum of 300\u2009seconds per event.Bed net contacts were identified as resting tracks, or by sharp changes in mosquito flight direction at the net surface, defined as minimum angle changes of 80\u00b0 in visiting mode . In bounTime spent in contact with the net was calculated from the sum of all contacts accrued through single visits or rests, and multiple bounces. Since tracking behaviour of individual mosquitoes over the course of any test was not possible, maximum and minimum values of net contact time per mosquito were estimated as follows: the maximum value was total contact divided by the maximum number of mosquitoes observed attacking the net simultaneously in each test; the minimum value assumed that all 25 mosquitoes responded simultaneously, and calculated each mosquito\u2019s activity as p\u2009=\u20090.523). Total activity, swooping, visiting, bouncing and resting were scaled by region area, giving values of seconds/mmThe field of view was divided into 16 regions, ten on the net surface and six in the surrounding space . A mosquk) in the equation t\u2009=\u2009time in minutes).Mosquito activity over the hour\u2019s test was grouped in to 12 five-minute intervals. Using Prism 6, these were fitted to an exponential decay equation to find the value of the decay constant  and Prism 6 (GraphPad). Random effects generalized linear models with normal probability distribution were used for analyses of activity time, behavioural modes, region preferences, velocity, tortuosity, percentage of tracks contacting the net without deceleration, distance from the net and velocity of track at deceleration point, and effects of net type. Where values were not normally distributed according to calculations of skewness and kurtosis, averages were calculated as geometric means. Generalized linear models with Poisson distribution were used to assess differences in numbers of tracks and Kaplan Meier survival tests to assess differences in lag between appearance and net contact. For analyses of rates of activity decay over time, activity . For allth May 2012).Methods were carried out in accordance with the approved guidelines. Informed consent was obtained from all participating human subjects. The study was approved by Liverpool School of Tropical Medicine Research Ethics Committee ."}
+{"text": "The impairment of autophagic and proteasomal cleansing together with changes in pigmentation has been documented in retinal pigment epithelial (RPE) cell degeneration. However, the function and co-operation of these mechanisms in melanosome-containing RPE cells is still unclear. We show that inhibition of proteasomal degradation with MG-132 or autophagy with bafilomycin A1 increased the accumulation of premelanosomes and autophagic structures in human embryonic stem cell (hESC)-derived RPE cells. Consequently, upregulation of the autophagy marker p62  was confirmed in Western blot and perinuclear staining. Interestingly, cells treated with the adenosine monophosphatedependent protein kinase activator, AICAR (5-Aminoimidazole-4-carboxamide ribonucleotide), decreased the proteasome inhibitor-induced accumulation of premelanosomes, increased the amount of autophagosomes and eradicated the protein expression of p62 and LC3 (microtubule-associated protein 1A/1B-light chain 3). These results revealed that autophagic machinery is functional in hESC-RPE cells and may regulate cellular pigmentation with proteasomes. The retinal pigment epithelial (RPE) cells, which are situated between the photoreceptor cells and choroid in the back of the eye, are vitally important for vision by maintaining the viability of photoreceptor cells . CentralN-retinylidene-N-retinylethanolamine) and oxidatively-damaged proteins accumulate and impair acidification of the lysosome, weakening its degradation capacity [Autophagy is essential for maintaining healthy cell homeostasis: the autophagic process begins with the formation of isolation membranes known as phagophores , which tcapacity ,10,11 ancapacity ,13. Failcapacity ,14 and lcapacity ,5. A deccapacity . RPE cell pigmentation mainly results from melanosomal melanin , which aRPE-like cells, expressing genes and proteins corresponding to the human RPE ,33,34, hOct3/4 marker of pluripotency and only a minute amount of eye specific lineage marker PAX6. All of the analyzed RPE-specific genes, namely MITF, Bestrophin and RPE65, were expressed by hESC-RPE cells , protein expression and localization with immunofluorescence labelling, confocal microscopy and evaluating cell morphology and pigmentation with brightfield phase contrast microscopy and Transmission Electron Microscopy (TEM). Reverse Transcription-Polymerase Chain Reaction gene expression analysis revealed that hESC-RPE cells did not express the PE cells a. The gePE cells . In addiPE cells b. In thePE cells c, it canPE cells d. The pa+-ATPase, and while preventing the acidification of lysosomes, it also inhibits fusion of lysosomes with autophagosomes and formation of autolysosomes [p < 0.01; p < 0.01). As expected, bafilomycin A1 treatment strongly increased the number of autophagosomes .Melanin has a broad absorbance spectrum, which can be used for melanin quantitation . In addiThe functionality of the autophagic machinery was examined by assessing the amount of autophagy marker proteins p62, LC3-II and the ratio of LC3\u2013II/I in Western blots of whole cell extracts. Conversion of the cytosolic form of LC3-I to the membrane-bound phosphatidylethanolamine (PE) lipidated LC3-II form indicates autophagic activity . The p62The fluorescently-tagged fusion proteins, green fluorescent protein (GFP)-mCherry-LC3A, pEGFP-LC3 and pDsRed2-hp62 plasmids (p), were analyzed with confocal microscopy after treatment with MG-132, AICAR, bafilomycin A1 alone or in combination. This pH-sensitive GFP-mCherry-LC3A vector emits green and red (yellow) fluorescence when at neutral pH , but emits only red fluorescence in acidic compartments  because the fluorescence of GFP is quenched by the low pH. Cells transfected with GFP-mCherry-LC3A and treated with MG-132 showed induced formation of strongly red positive aggregates d, which The second transfections with both pEGFP-LC3 and pDsRed2-hp62 resulted in faint cytoplasmic fluorescence, observed using confocal microscopy, indicating that transfection of hESC-RPE cells was successful . The MG-p < 0.001) and similarly after MG-132 + bafilomycin A1 (p = 0.002) treatment. MG-132 significantly (p < 0.001) increased pigmentation also when comparing bafilomycin A1 and MG-132 + bafilomycin A1 treated samples. Finally, the decrease of pigmentation after AICAR treatment (MG-132 vs. MG-132 + AICAR) was highly significant (p < 0.001). The lightness of microscopic images has been previously shown to be an objective and quantitative method to evaluate the degree of RPE cell pigmentation . TherefoIt is essential to verify that the used chemical treatments do not decrease cell viability or increase cell death. Here, it was assessed with a commercial viability assay. Microscopic observation revealed that the chemical treatments used in these experimental procedures altered the relative intensity of calcein-AM fluorescence compared to control: fluorescence was decreased in MG-132-treated samples, but increased in MG-132 + AICAR- and AICAR-treated samples . It shouOne of the most central characteristics of RPE cell phenotype is melanin pigmentation in lysosome-related organelles, called melanosomes . MelaninAutophagic processes have been assessed previously using the immortalized ARPE-19 RPE cell line ,5,49. NoIn this study, our observations revealed that autophagy cleanses melanosomes under proteasome inhibition. This was also seen here as increased calcein fluorescence in the live/dead assay. Moreover, inhibition of the basal autophagosome flux level by bafilomycin A1 induced melanogenesis in hESC-RPE cells, suggesting crosstalk of proteasomes and autophagosomes in the regulation of pigmentation in this cell type. When the autophagic process is impaired in ARPE-19 cells, they develop strong perinuclear aggregation, but weak pigmentation ,5. In co2 with hESC culture medium consisting of Knock-out Dulbecco\u2019s Modified Eagle Medium (KO-DMEM) supplemented with 20% Knock-Out Serum Replacement (KO-SR), 2 mM Glutamax-I, 0.1 mM 2-mercaptoethanol , 1% non-essential amino acids (NEAA), 50 U/mL penicillin/streptomycin  and 8 ng/mL human basic fibroblast growth factor (bFGF) . The culture medium was replenished 5\u00d7 a week, and undifferentiated colonies were manually passaged onto new feeder cells once a week. The pluripotent hESC line Regea08/017 was derived and characterized in our laboratory at the University of Tampere, Finland, as described previously . The hES2; Sigma-Aldrich) for enrichment of cell number. Undifferentiated hESCs were induced to differentiate into RPE cells in floating cell aggregates by lowering the KO-SR concentration to 15% and removing bFGF, as previously described . Floatin2 either on 24-well plates  or PET cell culture inserts  coated with collagen IV . The cells were further cultured for 80\u2013194 days . According to our standard procedure, the cultures were used for experiments when they have reached transepithelial electrical resistance (TEER) above 100 \u2126\u00b7cm2, but preferentially over 200 \u2126\u00b7cm2. The cell culture periods and number of replicates are presented in After 108\u2013322 days of culture, the pigmented areas were enzymatically dissociated with 1\u00d7 trypsin-EDTA and seeded at a density of 100,000 cells/cmd-ribofuranoside, Toronto Research Chemical, North York, ON, Canada, A611700), 50 nM bafilomycin A1 (Sigma-Aldrich) alone or in combination: 1 \u03bcM MG-132 + 50 nM bafilomycin A1 and 1 \u00b5M MG-132 + 2 mM AICAR , 2 mM AICAR  staining to detect the localization of RPE cell specific proteins as previously described . BrieflyIn order to analyze the gene expression of mature hESC-RPE cells, total RNA was extracted from hESC-RPE cells with a NucleoSpin XS-kit  according to the manufacturer\u2019s instructions. The RNA concentration and its quality were assessed using NanoDrop 1000 spectrophotometer . RNA (40 ng) was reverse-transcribed to complementary DNA using MultiScribe Reverse Transcriptase  according to the manufacturer\u2019s instructions in the presence of an RNase inhibitor. Complementary DNA (cDNA) was used as a template in a PCR reaction, which was carried out using 5 U/\u03bcL Taq DNA Polymerase  with 5 \u03bcM specific primers  examination, hESC-RPE cell samples were fixed with 2% glutaraldehyde  prepared in 0.1 M phosphate buffer for 2 h at RT followed by incubation in 0.1 M phosphate buffer overnight at room temperature. Thereafter, the samples were post-fixed with 1% osmium tetroxide  for 1 h at RT and dehydrated through a graded series of acetone : 70% acetone, 94% acetone and absolute acetone. The samples were then infiltrated in a 1:1 mixture of absolute acetone and epoxy resin (Ladd Research) for 1.5 h at RT, embedded in pure epoxy resin overnight at RT and polymerized for 48 h at 60 \u00b0C. Thin sections were stained with 1% uranyl acetate for 30 min and with 0.4% lead citrate  for 5 min. Samples were examined and imaged with the JEM-2100F transmission electron microscope . Identification of premelanosomes and melanosomes were done as shown previously .g for 17 min. After removal of supernatant, pigmented pellets were re-suspended in 100 \u00b5L of fresh M-PER buffer and absorbance was measured at 690 nm in clear 96-well plates by using EnVision multi-label reader . The RPE-choroid melanin isolated from porcine eyes was used as a standard [Melanin pigment in the cell samples lysed in M-PER  lysis buffer see  was pellstandard .The cell samples were washed with PBS (Lonza Group Ltd.), and cells were lysed in M-PER lysis buffer  according to the manufacturer\u2019s instructions 24 h after adding the chemical treatments. Whole cell extracts (25\u201330 \u03bcg of protein) were run in 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS\u2013PAGE) gels and thereafter wet-blotted to nitrocellulose membranes . The blocking of membranes was done in 3% skimmed milk powder in 0.3% Tween-20/PBS at room temperature for 1.5 h. Thereafter, the membranes were incubated with mouse monoclonal p62 antibody  diluted 1:1000 in 0.5% BSA in 0.3% Tween-20/PBS, rabbit polyclonal LC3 antibody  diluted 1:1000 in 5% BSA in 0.1% Tween-20/TBS  overnight at 4 \u00b0C, or mouse monoclonal \u03b1-tubulin antibody  diluted 1:8000 in 1% milk powder in 0.05% Tween-20/PBS for 1 h at RT. After washing 3\u00d7 for 5 min with 0.3% Tween-20/PBS (p62 antibody), 0.1% Tween-20/TBS (LC3 antibody) or 0.05% Tween-20/PBS , the membranes were incubated for 2 h at RT  with horseradish peroxidase-conjugated anti-rabbit IgG  or anti-mouse Imunoglobulin G (IgG) antibodies . The secondary antibodies were diluted 1:10,000 in 3% skimmed milk powder in 0.3% Tween-20/PBS for p62, 3% skimmed milk powder in 0.1% Tween-20/TBS for LC3 and 1% skimmed milk in 0.05% Tween-20/PBS for \u03b1-tubulin. Before detection, all membranes were washed as described earlier. Protein\u2013antibody complexes were detected with an enhanced chemiluminescent assay for horseradish peroxidase .2. Thereafter, cells were exposed to MG-132, AICAR and/or bafilomycin A1 for 3 h or 24 h, then mounted in Vectashield with DAPI (H-1200) and placed on ice. Samples were examined immediately with LSM 700 confocal microscope 63\u00d7 oil immersion similarly as described for immunofluorescence samples in Mature hESC-RPE cells with a cobblestone morphology were transfected with a tandem fluorescently tagged LC3 (GFP-mCherry-LC3A), which at neutral pH fluoresces yellow in autophagosomes. Acidification quenches the GFP signal, thus only the red fluorescence of mCherry is detected in autolysosomes . The tra2 with a mixture of 0.25 \u00b5M calcein-AM (green fluorescence) and 0.5 \u00b5M Ethidium homodimer-1  diluted in HBSS, either in the presence or absence of chemicals. Cells were imaged under a fluorescence microscope (Olympus IX) to detect the viable (green fluorescence) and dead cells (red fluorescence) with a 20\u00d7 long working distance objective. The same imaging acquisition settings were applied for all samples. The calcein-AM fluorescence intensity was quantified with Image J software from 5 separate 288 \u00d7 288 dpi areas (which contained 62\u201388 cells) from images of two separate experiments. The intensities were correlated to the untreated control. The number of dead cells (red fluorescence) was also calculated from 5 separate 288 \u00d7 288 dpi areas from images of two separate experiments.The effects of 1 \u03bcM MG-132, 50 nM bafilomycin A1, 2 mM AICAR or their combination treatments on cell viability were assessed using Live/Dead Viability/Cytotoxity kit for mammalian cells . Briefly, 23.5 h after commencing the chemical treatments, the cells were rinsed with HEPES-buffered salt solution . Thereafter, cells were incubated for 30 min at 37 \u00b0C and 5% COBioMediTech at University of Tampere has the approval of the National Authority for Medicolegal Affairs Finland to study human embryos (Diary number1426/32/300/05), and a supportive statement of the Ethical Committee of the Pirkanmaa Hospital District to derive, culture and differentiate hESC lines from surplus human embryos (R05116). No new lines were derived for this study. All methodological details were carried out in accordance with the approved guidelines.p-values < 0.05 were considered significant). The number of replicates in each experiment is indicated in the figure legends.The statistical significance of quantification of melanosomes, premelanosomes and autophagic vesicles, relative calcein-AM intensity and number of dead cells in the field of view and the degree of pigmentation analyzed from brightfield images were analyzed with PASW Statistics , using the two-tailed Mann\u2013Whitney U test. The data from Western blot experiments were subjected to one-way analysis of variance (ANOVA), followed by Tukey\u2019s test for multiple comparison (In this work, we showed how proteasomal inhibition increased the amount of highly pigmented melanosomal granules and the accumulation of p62 in hESC-RPE cells. Furthermore, the AMPK activator AICAR promoted cleansing of melanin granules, p62 and LC3-II during proteasome inhibition. These data indicate that autophagy machinery is functional in hESC-RPE cells and may have a role in the regulation of cellular pigmentation."}
+{"text": "Fyn is the cytoplasmic tyrosine kinase that has critical roles in many aspects of biological functions. In the central  Specifications TableValue of the data\u2022This data set is of value to the scientific community to need the information for the biological effect of a cytoplasmic tyrosine kinase.\u2022The data provide the valuable information for the role of a cytoplasmic tyrosine kinase in developing nervous systems.\u2022The data allow us to promote our understanding of how a cytoplasmic tyrosine kinase plays the role in the peripheral nervous system.1The data shared in this article provide immunohistochemical analyses of embryonic sciatic nerves  of Fyn knockout mice. The data also provide immunocytochemical analyses of Fyn knockout mouse peripheral neurons.22.1The tissue lysates from Fyn knockout mice 2.2Cytoplasmic tyrosine kinase Fyn knockout mice (Stock Number: 002385) were obtained from the Jackson Laboratory . Heterozygous offspring were mated with wild type C57BL/6JJms mice and the mutations were propagated in this strain for an additional 5 generations before it was crossed to produce experimental homozygotes. Genomic PCR was performed to identify respective knockout alleles according to the Jackson Laboratory\u05f3s standard protocol. Male mice were used for experiments when gender was distinguishable. Knockout mice are fertile under experimental breeding conditions and apparently normal.2.3The lysates from mouse sciatic nerve tissues (embryonic day 18) were denatured and then separated on sodium dodecyl sulfate-polyacrylamide gels. The electrophoretically separated proteins were transferred to PVDF membranes, blocked with Blocking One reagent , and immunoblotted first with primary antibodies and then with peroxidase-conjugated secondary antibodies. The bound antibodies were detected using Nacalai Tesque\u05f3s chemiluminescence reagent. Anti-Fyn and anti-actin (beta type) antibodies were from Atlas antibodies  and MBL , respectively. At least three experiments were carried out under each condition, and a representative bot is shown in the figure.2.4Mouse sciatic nerve tissues (embryonic day 18) were perfused first with PBS and then with PBS containing 4% paraformaldehyde 2.5Primary mouse DRG neurons, which were isolated from DRGs (embryonic day 12.5) as described previously"}
+{"text": "The proposed method composes of two main steps: bin-filling scheme and hole-filling strategy. For the bin-filling scheme, this study introduces two operators, including the median absolute deviation and the inter-quartile range absolute deviation, to calculate the invariant features of each voxel in the 3D ultrasound volume. And the best contribution range for each voxel is obtained by calculating the Euclidian distance between current voxel and the voxel with the minimum invariant features. Hence, the intensity of the filling vacant voxel can be obtained by weighted combination of the intensity distribution of pixels in the best contribution range. For the hole-filling strategy, three conditions, including the confidence term, the data term and the gradient term, are designed to calculate the weighting coefficient of the matching patch of the vacant voxel. While the matching patch is obtained by finding patches with the best similarity measure that defined by the three conditions in the whole 3D volume data.Compared with VNN, PNN, DW, FMM, BI and KR methods, the proposed Global Path Matching method can restore the 3D ultrasound volume with minimum difference.Experimental results on phantom and clinical data sets demonstrate the effectiveness and robustness of the proposed method for the reconstruction of ultrasound volume. Ultrasound, computer tomography (CT) and magnetic resonance (MR) are acknowledged to be the most widely used modern medical imaging techniques in clinical practice \u20133. CompaGenerally, there are many ultrasound reconstruction methods, which can be divided into three major categories: 3D probe system, mechanical scanning system and freehand scanning approaches . For theIn general, 3D reconstruction methods of freehand scanning images compose of three major classes , 15: forOn the contrary, the reverse method can be defined as iterative scanning and filling the vacant voxels around the 2D ultrasound slices in the 3D volume data. Generally, there are three major procedures for the reverse methods: first, the 3D ultrasound volume data is filled by the obtained 2D ultrasound slices according to their acquisition location and orientation. Second, each pixel of the ultrasound slice is scanned and the neighboring voxels in the 3D volume are filled according to a specified interpolation method. Third, each voxel of the 3D volume is traversed and the vacant voxels are filled by their neighboring voxels. For such class of method, the simplest way for interpolation is the pixel nearest neighbor (PNN) based methods \u201331, whicThe function based methods usually construct determined relationship between location and its intensity for the vacant voxel in the 3D volume data. Such method usually first interpolates 2D ultrasound slices into the 3D volume data according to their acquisition orientation. Then, the functional relationships between location and intensity distribution of the voxels are constructed according to the filled voxels in the volume data. By statistical analysis, the coefficients of the constructed function are estimated, which hence is utilized to calculate the intensity of the vacant voxels. The most widely used function for the interpolation is the radial basis function (RBF)  and RaylTo improve the reconstruction efficiency and accuracy, this paper proposes a novel Global Path Matching (GPM) method for the 3D reconstruction of freehand ultrasound images. The proposed method composes of two main steps: bin-filling scheme and hole-filling strategy. For the bin-filling scheme, the vacant voxels around each pixel of the 2D ultrasound image in the 3D volume is filled by weighted combination of its neighboring pixels that with eigenvalue less than a predefined threshold. It is commonly known that there are large amounts of random noise in the ultrasound image, and the existence of the noise may greatly interfere the 3D reconstruction accuracy. To improve the interpolation accuracy, this study introduces two operators, including the median absolute deviation (MAD) and the inter-quartile range absolute deviation (IQRAD) , to calcThe hole filling strategy is defined to fill the vacant voxels in the 3D ultrasound volume data through finding the best matching patch in the whole 3D ultrasound volume data. The vacant voxels in the 3D ultrasound volume are first marked through traverse the whole volume data, and the vacant region are labeled by calculating connecting relationship between neighboring vacant voxels. Then, three conditions, including the confidence term, the data term and the gradient term, are designed to calculate the weighting coefficient of the matching patch. More in detail, the confidence term represents the gray scale distribution, and the data term is utilized to represent contour information, while the gradient term is utilized to represent the intensity variation. This study assumes that the differences between the matched patches should be the minimum for all the three condition terms. Based on this assumption, the best matching patch for the vacant voxel is obtained by finding patches with identical combined matching conditions in the whole 3D volume data. Then, the intensity of the vacant voxel is replaced by voxels in the matching patch, for which the voxels in the patch are weighted contributed to the boundary voxels. Finally, the whole volume data is filled by iteratively repeating the above processing procedures. The merits of the designed 3D hole filling strategy method are as follows: (a) the filling patch of the vacant region is obtained by searching the best matching in the whole volume data, which hence can effectively improve the reconstruction accuracy. (b) As the hole filling is initiated from the boundary region with maximum weighting coefficients, hence, the filling process can achieve high reconstruction accuracy and effectively preserve the continuity of the texture information of the whole ultrasound volume data.In this paper, the ultrasound reconstruction is performed in two major stages, as can be seen in Fig.\u00a0The freehand 3D ultrasound imaging acquisition system consists of three main devices: a conventional 2D ultrasound scanner , an electromagnetic spatial sensing device , and a workstation with custom-designed software for data acquisition, volume reconstruction, and visualization. The receiver of the spatial sensing device is attached to the 4.5\u00a0MHz hand-held probe of the ultrasound scanner. The spatial information (location and orientation) between the receiver and transmitter is recorded and transferred from the Aurora system control unit to the workstation through a USB port.During data acquisition, spatial data and digitalized 2D ultrasound images are simultaneously recorded and collected. Since the devices for the collection of 2D ultrasound and spatial data are independent, the temporal delay between the two data streams cannot be avoided. Meanwhile, the spatial relationship between the ultrasound image plane and magnetic position sensor needs to be determined. The temporal and spatial relationships for the designed freehand 3D ultrasound imaging system are calibrated by the methods presented in , 37.Generally, there are three coordinates in the reconstruction system: the coordinate of the 3D ultrasound volume   and the The MAD is utilized to represent the intensity difference between current and its neighboring pixels in a predefined patch. Suppose there are N pixels surrounding the calculating pixel IQRAD represents the average intensity difference of pixel Hence, the IQRAD of the pixel It can be seen that MAD and IQRAD both utilize all pixels in the patch to calculate the property of It is obvious that different patch size may lead to different value of the combined response of It is obvious that the best contribution range depicts that the pixels in this range have the minimum intensity differences with the central pixel. Hence, the best contribution distance can be calculated as follows:Hence, the vacant voxel in the 3D ultrasound volume can be obtained by integrating the relative responses of each pixel in the best contribution range, and we have the following equation:Compared with the other interpolation method, the propose bin-filling method weighted combines the pixels in the best contribution range centered at current pixel, which guarantees that the interpolated voxel is most similar and has minimum variations to its neighboring pixels.After the bin-filling process, the 3D volume data is filled with the 2D ultrasound slices according to their imaging orientation and location. As the obtained ultrasound slices are not continuous, it is obvious that there are a lot of holes and empty voxels in the 3D volume data. The goal of the hole-filling stage is to fill the gaps using available information from its surrounding known voxels. Most of current methods usually utilized the neighboring voxels in the 3D ultrasound volume instead of the global information of the volume data \u201344. To oThe basic idea of the proposed hole filling method is that for any vacant voxel in the 3D volume data, the filling intensity of the voxel is obtained by searching a patch that is with the most similar intensity distribution around the vacant voxel in the whole volume data. First, for the vacant voxel, we construct a rectangular patch by setting the vacant voxel as the center. Then, priority weight of the filling is calculated for each voxel in the patch according to the vacant voxel number, isophotes of the center voxel and the gradient distribution of the patch. Second, the hole-filling is initiated from the voxel with maximum priority weights. The best matching patch to the patch centered at current voxel is iteratively scanned in the whole volume data by maximizing the similarity measure. Third, the vacant voxels of the current patch are customized by the corresponding voxels in the best matching patch. Then, the priority weight of the whole image is recalculated. The filling process repeats the above procedures until all the vacant voxels are assigned with intensity values.Let I denotes the given input image, For the ultrasound reconstruction method, it is obvious that different repairing order may lead to different repairing accuracy. Hence, the repairing order is the priority step to be determined before the proceed of the repairing process. As the proposed method searches the most similar patches in all the voxels filled with intensity values, there are three main aspects need to be taken into consideration for the design of repairing process: first, if there are more voxels filled with intensity values, the global searching procedure may obtain more accurate repairing accuracy. Hence, if a patch with more filled voxels, the filling priority of the patch will be higher than the other voxels. Second, the isophotes is usually taken to represent the continuousness and smoothness. Hence, to guarantee the continuity and smoothness of the ultrasound volume, the voxel with higher filling priority should rest on the isolux curve. Third, if the gradient of a voxel is larger than the others, the edge points can usually be identified. Hence, the patch with the larger summary of the gradient should be with higher priority. Based on the above analysis, three terms, including confident term The confident term The data term ychology \u201347. Let The gradient term So far, the repairing priority weight of the voxel Once the priority weights of all the vacant voxels are calculated, the hole filling process can be started at the patch For the vacant voxel with largest priority weight, the intensity utilized to fill the vacant voxel is obtained by finding patches with the largest intensity similarity in the whole ultrasound volume. And the similarity is defined by the inverse of the absolute intensity difference of the two comparing patches. Hence, we have the following equation:Once a vacant patch is filled with new pixel value, the distribution of the vacant region is changed. Hence, the priority weight of each vacant voxel in the whole ultrasound volume needs to be recalculated so as to find the best region that needs to be filled. For the proposed method, we only need to recalculate the priority weights of the neighboring voxels of the previous filled patch. Then, the filling process iteratively repeats until all the vacant voxels are filled. The pseudocode of the proposed algorithm can be found in Table\u00a0Compared with traditional ultrasound reconstruction method, the proposed method finds the best matching patch from the whole ultrasound volume, which can effectively prevent the over smoothing of the image. Moreover, the proposed method repairs the patch with more filled voxels and the patch with apparent gradient variations, which hence can obtain accurate reconstruction accuracy.To evaluate the performance of the proposed GPM method for the 3D reconstruction of freehand ultrasound, a series of experiments is designed and tested on phantom data and in vivo scanned ultrasound in clinical practice. The proposed method is compared with the up-to-date algorithms, including VNN , PNN 1414, DW 1, KR 21\u2013\u201321\u201323 anIn this study, three groups of data sets, including ultrasound volume generated from phantom data (data 1), in vivo data set (data 2), are employed for the experiments. The ultrasound volume of a simulation model is generated from a realistic brain phantom created from polyvinyl alcohol cryogel (PVA-C) by Sean Jy-Shyang Chen et al. . PVA-C hIn additional to the visual assessment, we measure the performance of the various reconstruction algorithms through computing the average intensity difference as defined as follows :17\\documThis part is designed to test the effectiveness of the proposed hole-filling algorithm by comparing with the up-to-date algorithms, including VNN, PNN, DW, FMM, KR and BI. The experiments utilize data set 2, and three predefined sizes of volumes, including two cubes (20\u00a0\u00d7\u00a020\u00a0\u00d7\u00a020 and 15\u00a0\u00d7\u00a050\u00a0\u00d7\u00a020) and a tetrahedron  is removed from the edge area of the abnormality in data set 2. Figure\u00a0O represents the computational complexity of the algorithm,T is the time for optimizing the parameters of Bezier curve. Table\u00a0The efficiency is crucial for the 3D freehand ultrasound reconstruction in clinical usage. To perform an objective evaluation of the computation time, let  in Ref. , 51).TabTable\u00a03D ultrasound volume reconstruction from B-model ultrasound slices can provide clear and intuitive images for tissues and lesions for the clinician, which has very important value in clinical practice. This paper proposed a novel global patch matching method for the reconstructing of 3D ultrasound volume from a series of free-hand B-model ultrasound slices. The proposed reconstruction method includes two main steps: bin-filling scheme and 3D hole-filling strategy. The bin-filling scheme is aimed to fill and interpolate the 3D volume data by the obtained ultrasound slices. To fully utilized the orientation information of each ultrasound slice and suppress the interference of the noise, we introduce the median absolute deviation the inter-quartile ranges absolute deviation to calculate the invariant property of each pixel of ultrasound image. Based on invariant response of the existing ultrasound images, the optimum contribution range for the overlapping range can be obtained. Then, the intensity of overlapping region can be obtained by weighted combination of the pixels within the best contribution ranges. The hole-filling strategy is designed to fill holes and gaps in the 3D volume data according to the texture and intensity distribution of the existing ultrasound voxels. For this method, the priority of the filling order of the vacant region is calculated by optimizing the confidence term, the data term and the gradient term. Then, hole-filling process starts from the voxel with the maximum priority weights. And the filling patch is obtained by finding the patch with maximum similarity measures in the whole volume data.The performance of the proposed algorithm is evaluated on both phantom data and in vivo ultrasound data sets. For these data sets, we randomly delete a series of predefined holes and a number of continuous ultrasound slices, as the grand truths of the ultrasound volumes are exactly known, the reconstruction accuracy of the algorithms can be effectively quantified. The proposed algorithm is compared with the other four up to date reconstruction methods, including VNN, PNN, DW, FMM, KR, BI. From the experiments of the filled hole and ultrasound reconstruction, it can be seen that there are apparent boundaries for the results of VNN and PNN methods. The results may stem from both the VNN and PNN methods that utilize nearest neighboring pixels for the interpolation of the hole region, and the interpolated region usually has the same intensity values. And the intensity distribution in the interpolated region presents homogeneous property, which hence leads to obvious boundaries between the filled hole and its neighboring region. Compared with VNN and PNN methods, there are no obvious boundaries for the filled and the neighboring regions for the DW and BI method. As the DW and BI method utilizes a considerable number of pixels for the interpolation, the filled region seems very fuzzy and the details cannot be clearly identified. The filled region of the FMM and KR method seems clearer than that of the DW method. It is because that the FMM and BI method constraint the interpolation sequence, which hence effectively improves the sharpness of the filled region. Compared with the other methods, it can be seen that the proposed GPM method not only effectively preserves the detail of the filling region, but also, the filled regions are naturally mixed with the neighboring pixels. There are no distinct boundaries for the filling regions. Experiments demonstrate that the proposed method is very effective and robust for reconstructing ultrasound images. Among all the comparing methods, the proposed GPM method can restore the 3D ultrasound volume with minimum difference.For the proposed GPM method, the overlapping pixel is determined by the neighboring pixels within the best contribution range, which hence can effectively utilize the neighboring similar pixels and maintain the smoothness of the interpolated voxels. And the vacant voxels are filled by searching the most similar patches in the whole volume data. Hence, the volume data is filled with high reconstruction accuracy and effectively preserves homogeneous distribution of the textures. For each vacant voxel, the proposed GPM method needs to search the best matching patch in the whole existing volume data, which hence is time consuming. The future study will be focused on GPU based accelerating of the reconstruction algorithm."}
+{"text": "Unplanned hospital readmissions are a quality and safety indicator. In Australian, 8% to 11.1% of unplanned readmissions occur \u22641\u00a0day of acute care discharge. The aim of this study was to explore the reasons for unplanned hospital readmissions \u22641\u00a0day of acute care discharge, and determine what proportion of such unplanned hospital readmissions were potentially preventable.A retrospective exploratory cohort design was used to conduct this two phase study. In Phase 1, organisational data from 170 readmissions \u22641\u00a0day and 1358 readmissions between 2 and 28\u00a0days were compared using the Cochran-Mantel-Haenszel test. Binary logistic regression was used to examine factors associated with unplanned readmission \u22641\u00a0day. In Phase 2, a medical record audit of 162 Phase 1 readmissions \u22641\u00a0day was conducted and descriptive statistics used to summarise the study data. Index discharges occurred between 1 August and 31 December 2015.more likely in paediatric patients (<\u20090.001); index discharges on weekends (p\u2009=\u20090.006), from short stay unit (SSU) (p\u2009<\u20090.001) or against health professional advice (p\u2009=\u20090.010); or when the readmission was for a Diagnosis Related Group (p\u2009<\u20090.001). The significant predictors of unplanned readmission \u22641\u00a0day were index discharge against advice or from SSU, and 1\u20135 hospital admissions in the 6\u00a0months preceding index admission.In Phase 1, unplanned readmissions \u22641\u00a0day were In Phase 2, 88.3% readmissions were unpreventable and 11.7% were preventable. The median patient age was 57\u00a0years and comorbidities were uncommon (3.1%). Most patients (94.4%) lived at home and with others (78.9%). Friday was the most common day of index discharge (17.3%) and Saturday was the most common day of unplanned readmission (19.1%). The majority (94.4%) of readmissions were via the emergency department: 58.5% were for a like diagnosis and pain was the most common reason for readmission.Advanced age, significant comorbidities and social isolation did not feature in patients with an unplanned readmission \u22641\u00a0day. One quarter of patients were discharged on a Friday or weekend, one quarter of readmissions occurred on a weekend, and pain was the most common reason for readmission raising issues about access to services and weekend discharge planning. In Australia, the demand for hospital care is increasing,  while avThere are no published studies focusing on unplanned hospital readmissions within the first days of discharge even though one in ten unplanned hospital readmissions occur within one day of discharge. Therefore, the aim of this study was to better understand the reasons for unplanned hospital readmissions within one day of acute care discharge, and determine what proportion of such unplanned hospital readmissions were potentially preventable.This study was conducted in two phases using retrospective exploratory cohort design. In Phase 1, organisational data from 1528 unplanned readmissions within 28\u00a0days of acute care discharge was used to compare all cause readmissions occurring within 1\u00a0day to readmissions between two and 28\u00a0days following acute care discharge. In Phase 2, a medical record audit of readmissions within one day of acute care discharge was conducted. The study was approved by the Eastern Health Human Research Ethics Committee (LR22/2017) and a waiver of consent was granted.2 and has Eastern Health has four acute care hospitals, three of which have emergency departments (EDs) and two of which have intensive care units (ICUs). Site A was an outer metropolitan hospital that provides emergency care, general medicine, surgery, midwifery, paediatrics and rehabilitation services. Site B was a tertiary referral centre providing all services except transplant surgery, neurosurgery and cardiothoracic surgery. Site C was a metropolitan hospital providing emergency care, general and specialist medicine, general and specialist surgery, critical care services and specialist adult mental health services, but no midwifery services. Site D was an outer metropolitan hospital providing medical, ambulatory and palliative care services. During 2014\u201315, there were 135,636 acute care admissions, 151,810 ED attendances and 31,083 operations performed at Eastern Health. [The study was conducted at Eastern Health, one of the largest health services in Victoria, Australia. Eastern Health serves a community a 750,000 people living across 2916\u00a0kmThere is some variability in the discharge process and discharge decision-making within the health service. In some units final authorisation for discharge is provided by consultant or registrar level medical staff and in other units, the Nurse Unit Manager authorise discharges. Discharge planning in some areas, for example, General Medicine, Rehabilitation Medicine, and Geriatric Medicine units is a highly structured, multi-disciplinary process. In other units, discharge decision-making can be less well defined, and is often principally a medical decision as distinct from a team decision. This difference reflects, in part, variability in the availability of allied health staff and the degree to which the patient journey is predictable.n\u2009=\u2009170) of readmissions occurred \u22641\u00a0day of acute care discharge: these patients were the sample for Phase 2. A re-admission was defined as a presentation resulting in admission to either a short stay unit (SSU) or inpatient ward.The sample for Phase 1 was 1528 unplanned readmissions \u226428\u00a0days in 1306 patients in whom the index discharge occurred between 1 August and 31 December 2015. Of these 1528 unplanned readmissions, 11.1%  and medical record review (Phase 2). In Phase 1, the following data were extracted from organisational databases: patient demographics, index admission characteristics, discharge planning, and reasons for readmission. For patients readmitted via the ED, triage category and ED LOS were also collected. International Classification of Diseases 10th revision Australian Modification (ICD-10-AM) codes  were useData were analysed using Statistical Package for Social Sciences (SPSS) Version 23.0.  DescriptThe determination of preventable readmission is subjective. A systematic review of 34 studies of avoidable readmissions showed that most studies used only one reviewer, relied on treating team and hospital factors, and gave little consideration to patient factors and social circumstances.  In PhaseReadmissions were classified by the auditors (DB and MJ) as clearly unpreventable; requires further review; or clearly preventable. Clearly unpreventable readmissions were readmissions for issues unrelated to the index admission, and clearly preventable readmissions were those related to the index admission where the patient had signs of clinical instability or complex care needs on the day of index discharge, or where there had been a failure of discharge planning. For example, pain was a common reason for unplanned readmission, so the criteria for an unpreventable readmission for pain were that the patient was discharged on analgesia, last pain score documented ranged from 0 to 5 out of 10 and the patient did not require analgesia stronger than that prescribed for discharge on day of discharge. If a patient required intravenous, subcutaneous or oral opioid analgesia on the day of discharge but was discharged with simple oral analgesics, the readmission for pain was considered preventable.The readmissions classified as requiring further review or clearly preventable were subject to a consensus process of further assessment of patient notes, vital signs, pathology and radiology reports, medication charts, social circumstances and discharge summary by three researchers . Preventability was assessed qualitatively by file review with a specific focus on any factors that could have contributed to the readmission and that could have been addressed in the previous admission including at time of discharge, for example, unresolved factors related to the original admission diagnosis, unstable comorbidities, or documented evidence of carer burden or lack of social supports.Of the 1528 unplanned readmission occurring within 28\u00a0days of acute care discharge, 170 (11.1%) occurred within one day. The relationship between index admission and readmission characteristics for those readmitted within one day were compared to those readmitted within 2\u201328\u00a0days , and the model correctly classified 88.9% of cases. When adjusted for age and site, the significant predictors of unplanned readmission within 1\u00a0day were index discharge against advice, index admission under short stay unit and 1\u20135 hospital admissions in the 6\u00a0months preceding the index admission , planned surgery (n\u2009=\u20093), iron infusion (n\u2009=\u20091), removal of nasal tamponade (n\u2009=\u20091), no available notes for readmission (n\u2009=\u20091), and readmission from Hospital in the Home (HITH)). The remaining 162 readmissions occurred in 160 patients: two patients had two discharges resulting in unplanned readmission \u22641\u00a0day during the period studied. After medical record review, there were 138 (85.2%) unpreventable readmissions, 5 (3.1%) readmissions that underwent further review and were deemed by the consensus panel to be unpreventable, and 19 readmissions (11.7%) that were confirmed as preventable by the consensus panel.Of the 170 discharges included in Phase 2, seven (4.1%) were excluded; planned admission for induction of labour  had a preferred language of English. Co-morbidities were present in 5 patients (3.1%). Of the 19 preventable readmissions, the median patient age was 68\u00a0years (IQR =44\u201382), 13 (68.5%) were female, 15 (78.9%) were adult medical patients, and only one patient had known comorbidities. Most patients with preventable readmissions within 1\u00a0day  had a preferred language of English and lived with others . The patient characteristics of all readmissions within 1\u00a0day and preventable readmissions within 1\u00a0day are presented in Table\u00a0When all readmissions within 1\u00a0day were examined, the median patient age was 57\u00a0years IQR\u2009=\u200932 to 77), 81 (50%) were male, 119 (73.5%) were adult medical patients, 24 (14.8%) were adult surgical patients, and the majority  of all index discharges. Only 1 discharge resulting in a preventable unplanned readmission within 1\u00a0day involved diagnostic uncertainty. Index admissions with unresolved primary problems included those in which the patient discharged themselves against medical advice, had planned definitive treatments but with current symptoms controlled , or those with no clear discharge diagnosis. The patient\u2019s primary problem was unresolved in 51 (31.5%) of all index admissions and 11 (57.9%) index admissions associated with a preventable unplanned readmission within 1\u00a0day. For the whole cohort, 126 (77.8%) index admissions occurred via the ED, 93 (76.2%) patients were triaged as requiring emergency care within 30\u00a0min, and the median ED length of stay was 5.3\u00a0h (IQR\u2009=\u20093.6 to 9.9\u00a0h). For patients whose readmission was preventable, 17 (89.5%) of index admissions were via the ED, 11 (57.9%) patients were triaged as requiring emergency care within 30\u00a0min, and the median ED length of stay was 5.3\u00a0h (IQR\u2009=\u20093.8 to 9.1\u00a0h).n\u2009=\u200955, 33.9%) had both ED attendance(s) and hospital admission(s) and 82 patients (50.6%) patients had neither an ED attendance nor a hospital admission. The median hospital length of stay for index admissions was 1\u00a0day (IQR\u2009=\u20091 to 3\u00a0days). Of the patients who had a preventable unplanned readmission, 11 (57.9%) patients had one or more ED attendances and 11 (57.9%) patients had one or more 1 hospital admissions. ED attendance(s) and hospital admission(s) occurred in 7 (36.8%) patients and 10 (52.6%) patients had neither an ED attendance nor a hospital admission. The median hospital length of stay for index admissions associated with a preventable unplanned readmission was 1\u00a0day.In the six months preceding the index admission, 69 (42.6%) patients had one or more ED attendances and 66 (40.7%) patients had one or more hospital admissions. One third of patients  and 43 (26.5%) discharges occurred on a weekend. In most instances, the patient went home  and to an environment where they lived with others . The majority of discharges resulted in a referral to outpatients  but in 37 (22.8%) discharges no formal discharge referrals were made.For all patients with an unplanned readmission within 1\u00a0day of acute care discharge, Friday was the most common day of discharge  and 7 (36.8%) discharges occurred on a weekend. Again, in most instances, the patient went home  and to a setting where they lived with others . An outpatients referral was made in almost half of these patients . The index discharge destination and referrals for all readmissions and preventable readmissions within 1\u00a0day of acute care discharge are presented in Table\u00a0For patients in whom the unplanned readmission was preventable, Sunday was the most common day of index discharge  and 45 (27.7%) readmissions occurred on a weekend. One third of readmissions  occurred overnight (2200\u20130759\u00a0h) and in two thirds of readmissions  the patient made the decision to return to hospital. The majority  of readmissions were via the ED and transport to hospital by ambulance occurred in 59 (40.7%) of readmissions. The majority of patients  were triaged as warranting emergency care within 30\u00a0min. The reason for readmission was for a like DRG in 95 (58.6%) readmissions, 141 (88.7%) readmissions were for a problem related to the index admission problem, and pain was the most common reason for readmission  and only 2 readmissions occurred on a weekend. One third of readmissions  occurred overnight (2200\u20130759\u00a0h) and in two thirds of readmissions , the patient made the decision to return to hospital. All (n\u2009=\u200919) preventable readmissions within 1\u00a0day were via the ED and ambulance transport occurred in 6 (31.6%) cases. Thirteen (68.4%) patients were triaged as warranting emergency care within 30\u00a0min. The reason for readmission was for a like DRG in 9 (47.4%) preventable readmissions, 18 (94.7%) readmissions were for a problem related to the index admission problem, and again pain was the most common reason for readmission  unplanned readmissions within 1\u00a0day, there was one or more MET activations during that admission and the median time to first MET call was 30\u00a0h (IQR\u2009=\u200912 to 107). There were one or more ICU admissions in 5 (3.1%) readmissions and the median time to first ICU admission was 7\u00a0h (IQR\u2009=\u20090 to 57). In three readmissions (1.9%), the patient died in hospital during that readmission. Two patients (10.6%) who experienced a preventable unplanned readmission \u22641\u00a0day had a MET all during that admission, and the median time to MET activation was 75\u00a0h. There were no ICU admissions or in-hospital deaths in the preventable readmission group. The median hospital length of stay during the readmission was 2\u00a0days (IQR\u2009=\u20091 to 4) for all patients readmitted within 1\u00a0day and 1\u00a0day (IQR\u2009=\u20091 to 4) for patients whose unplanned readmission was preventable.This study had four major findings. First, the major predictors of unplanned readmission \u22641\u00a0days were index discharge against advice, and index admission and discharge under the SSU. Second, advanced age, significant comorbidities and social isolation did not feature in patients who experienced unplanned readmission within 1\u00a0day nor do they seem to have an association with preventable unplanned readmissions, however, almost half the patients studied used healthcare services  in the six months preceding the index admission. Third, unplanned readmissions within 1\u00a0day were commonly associated with reason for index admission and pain was the most common reason for all unplanned readmissions and preventable readmissions within 1\u00a0day. Finally, the most common day of readmission was Saturday and just under one third of readmissions within 1\u00a0day occurred on the weekend.One quarter of index discharges resulting in an unplanned readmission within 1\u00a0day were from the SSU (27.8%) which may, in part, explain the short median hospital length of stay for index admissions of 1\u00a0day. The most common admitting ward for preventable readmissions was also SSU. These findings may in part be explained by the intent and nature of SSU care. The purpose of SSUs is to continue to provide care to ED patients who require a period of observation or therapy  thereforOne in ten unplanned hospital readmissions within 28\u00a0days of acute care discharge occurred within 1\u00a0day. This finding is consistent with other Australian studies that have shown the most likely day for unplanned hospital readmission was on the first day discharge and that 8\u20139% of unplanned readmissions occurred within 1\u00a0day. , 20 In oOur audit data showed that unplanned readmissions within 1\u00a0day occurred in middle aged patients (median\u2009=\u200957\u00a0years), most of whom lived at home (94.4%), preferred to speak English (90.7%) and were largely comorbidity free (97.5%). Patients in whom the unplanned readmission was judged as preventable were slightly older (median age\u2009=\u200968\u00a0years), more likely to be female (68.5%), commonly lived with others (78.9%) and only one patient had known comorbidities. These findings suggest that advanced age, significant comorbidities and social isolation do not appear to feature in our patients who experience unplanned readmission within 1\u00a0day nor do they seem to have an association with preventable unplanned readmissions. Although not focused specifically on unplanned readmissions \u22641\u00a0day, other studies of unplanned readmissions have also shown that both preventable and non-preventable unplanned readmissions tend to occur in middle-aged patients, most of whom were living independently without the need for support of activities of daily living and free of serious comorbidities.  The healThe reason for readmission was for a like DRG in two thirds of readmissions and 88.7% of readmissions were for a problem related to the reason index admission. Other studies report that 44% to 71% of patients are admitted for the same reason as their index admission. , 25 DiagOne quarter of all unplanned readmissions \u22641\u00a0day experienced a complication during their index admission (22.7%) however there was variability in the types of complications that occurred and no dominant complication theme. The incidence of clinical deterioration during index admission  was also low. There is evidence that clinical deterioration during index hospitalisation increase the risk of unplanned readmissions  however The most common day of index discharge was Friday which explains why Saturday was the most common day of unplanned readmission. Further, 26.5% of discharges occurred on a weekend again explaining why 27.7% of readmissions occurred on a weekend. These findings may reflect lack of access to alternative care providers, support services or health advice over the weekends. These findings are different to those of other Australian studies. In a study of readmissions to an Australian regional hospital, McLean  found thThere are a number of limitations that should be considered when interpreting the study findings. First, this work was retrospective and thus inherently reliant on medical record data. Therefore there may be patient and system factors that are not reflected in these data sources. The disparate results of low Charlson Comorbidity Scores and moderate degree of health service use in the 6\u00a0months preceding readmission, and reports that patient characteristics not captured in organisational or medical record data such as behaviours, that may influence readmission  add weigWhen adjusted for age and site, the significant predictors of unplanned readmission \u22641\u00a0days were index discharge against advice, and index admission under short stay unit. Preventable unplanned readmission \u22641\u00a0day are uncommon however one in eight unplanned readmissions \u22641\u00a0day were deemed preventable. Advanced age, significant comorbidities and social isolation do not appear to feature in our patients who experience unplanned readmission \u22641\u00a0day, irrespective of whether those readmissions were preventable or non-preventable so challenges the notion that unplanned readmissions occur in predominantly older people with significant comorbidities and low levels of social support. Pain was the most common reason for readmission therefore pain management strategies on discharge and early follow up of patients discharged with a painful condition should be an area for further investigation. SSU was the clinical area associated with the highest number of overall and preventable unplanned readmissions \u22641\u00a0day, which may in part be explained by the high levels of patient turnover, but admission and discharge criteria for SSU, and follow up of patients discharged home from SSU may warrant further review. One quarter of patients experiencing unplanned readmissions \u22641\u00a0day were discharged on a Friday or weekend, and one quarter of readmissions occurred on a weekend raising issues about access to services and weekend discharge planning. Understanding whether there is a difference in discharge processes and how patients access or reconnect with services on weekends compared to weekdays should be a focus of future work and may inform a more consistent approach to service delivery."}
+{"text": "Re) for injection ranging from approximately 189 to 677. Larger bolus surface areas were associated with faster injection speeds, lower viscosity of vitreous substitutes, and smaller difference in interfacial surface tensions. Boluses exhibited buoyancy when injected into standard S1000. The hydrodynamic properties of liquid vitreous substitutes influence the initial injected bolus dispersion profile and should be taken into account when simulating drug dispersion following intravitreal injection at a preclinical stage of development, to better inform formulations and performance.Intravitreal injections have become the cornerstone of retinal care and one of the most commonly performed procedures across all medical specialties. The impact of hydrodynamic forces of intravitreal solutions when injected into vitreous or vitreous substitutes has not been well described. While computational models do exist, they tend to underestimate the starting surface area of an injected bolus of a drug. Here, we report the dispersion profile of a dye bolus (50 \u00b5L) injected into different vitreous substitutes of varying viscosities, surface tensions, and volumetric densities. A novel 3D printed in vitro model of the vitreous cavity of the eye was designed to visualize the dispersion profile of solutions when injected into the following vitreous substitutes\u2014balanced salt solution (BSS), sodium hyaluronate (HA), and silicone oils (SO)\u2014using a 30G needle with a Reynolds number ( Intravitreal therapy (IVT) is one of the most frequently performed procedures across all medical and surgical specialties ,2. SinceIn older eyes, liquefaction of the vitreous (synchysis) occurs due to the dissociation of collagen and hyaluronan, particularly in the central area, where there is lower collagen content . Vitreoumax) can vary at different vitreous locations, depending on the injection site. The drug dose is also administered based on assumptions about the location of the injection and the shape of the injected bolus volume. The amount of injected fluid reflux from the needle can be altered by varying the methods of fluid injection into the vitreous through the pars plana [Drugs for IVT undergo preclinical and clinical development before marketing approval. While some guidelines exist, the exact details of needle depth, size, and angle, injection time (injection speed with outlet velocities) and other variables can significantly differ ,17. For rs plana . Drug rers plana . Expert rs plana .The prediction of drug distribution within the eye to avoid tissue toxicity and to determine the precise drug levels in target tissues has been a subject of modeling studies. Computational methods have been described to model drug transport following intravitreal injection from a point source ,25,26,27There has been limited consideration during preclinical studies on what the impact on dosing would be in patients with vitrectomized eyes. Vitrectomy is a surgical procedure where the vitreous is removed. People with diabetes who have suffered complications from retinal disorders tend to undergo vitrectomy . VitrectHere, we investigate the hydrodynamic effects, such as dynamic viscosity, surface tension, and volumetric density of simulated liquid vitreous and vitreous substitutes, which may influence the distribution profile of the initial bolus administered in IVT. We also examine clinically relevant injection rates and the depth of needle placement. These experimental data will inform preclinical computational modeling of IVT mixing, IVT formulation optimization, and excipient design. This study could also help inform vitreous substitute design and formulation.\u00ae Brilliant Blue G250  was used for visualization.Sodium hyaluronate  was obtained from Lifecore Biomedical . BSS was obtained from Sigma Aldrich . SO (S500 and S1000) was purchased from VWR International Ltd . CoomassieThe rheological properties of HA and SO were measured with a Bohlin Gemini HR Nano Rheometer rotational rheometer , whereas the rheological properties of water were measured using an m-VROC\u2122, viscometer/rheometer-on-a-chip . Surface tension was measured with a plate reader Delta-8 (Kibron) equipped with a multi-channel microtensiometer . A 3D printed vitreous cavity model was designed using Formlabs GmbH  and fabricated from clear resin  with a resolution of 0.05 mm.\u22121) at 25 \u00b0C. The viscosity of water was measured using an m-VROC\u2122 rheosense viscometer. The measuring cell was calibrated by flushing the cell through with deionized water to avoid any particle contamination from previous measurements. Viscosity was measured at ten different shear rates (0\u2013200 s\u22121) at 25 \u00b0C. Care was taken to ensure no air bubbles were present before each run. Samples measured with the m-VROC\u2122 rheosense viscometer (water) were filtered through a 0.22 \u00b5m microfilter before any measurements were taken.HA solutions of different concentrations (1.0\u20133.0 mg/mL) were used to simulate the viscosity and rheological behavior of human vitreous in the liquid phase. HA was weighed (1.0\u20133.0 mg) and dissolved in water (1.0 mL) and was allowed to stir at room temperature  for 10\u201315 min, until completely dissolved. The gel was allowed to cool at RT. A swollen gel sample was placed on the Peltier plate (diameter 20.0 mm) with a gap size of 0.4 mm and 0\u00b0 angle. Viscosity was measured at a range of shear rates  was conducted after calibration to monitor intra- and inter-channel variations, using a plate containing Milli Q water (50 \u03bcL) in each well. All obtained validation test data were within the vendor-specified surface tension range of 72.8 \u00b1 0.5 mN/m for Milli Q water.The microtensiometer was calibrated with Milli QA 3D printed model of the vitreous cavity was scaled to the average geometry of the adult human eye. The vitreous cavity volume was approximately 5.0 mL. The lens was 3.9 mm thick, with an anterior radius of 10.0 mm and a posterior radius of 6.0 mm. The model was fabricated from a clear resin to visualize dye dispersion within the cavity after injection. The 3D printed model  featured\u22125 cm2 s\u22121 in water at 25 \u00b0C [To minimize diffusion as a variable from experiments, images were recorded for a maximum of 5 s. Coomassie blue dye (50 \u03bcL) with a low diffusion coefficient of 2.8 \u00d7 10at 25 \u00b0C  was unifRe) is a dimensionless parameter used to characterize the ratio of inertial forces to viscous forces. Inertial forces are associated with convection and a characteristic time is L/U, where L is a characteristic length and U is the flow velocity. Viscous forces are defined by viscous diffusion and a characteristic time L2/v, where v is the kinematic viscosity (the ratio of dynamic (absolute) viscosity to density). The ratio of the characteristic times for viscous diffusion over convection leads to the definition of Re in Equation (1):The Reynolds number , \u03bd is the kinematic viscosity of water (1 \u00d7 10\u22126 m2/s), and U is the mean flow velocity inside the needle.In the case of this experiment injecting the dye bolus with a 30G needle, Re, the viscous forces are dominant and the flow results from equilibrium between the viscous friction forces and the pressure gradient. This flow generally occurs at very low speeds or very small systems and is called laminar. At high Re, inertial forces dominate flow and the momentum transport is mainly driven by convection. This flow is typically turbulent. When progressing from laminar to turbulent, the flow generally progresses through a laminar\u2013turbulent transition.For low Re values of 189 \u00b1 91 for all cases, whereas slow injections times (above 1 s) displayed Re values of 677 \u00b1 175. Images were recorded using a digital SLR camera (Canon EOS 7D) mounted with a 60 mm lens at 25 Hz, or every 40 ms. Front and side views of the injections were recorded and processed using MATLAB software .Fast injections times (below 1 s) displayed Image acquisition and processing steps are shown in Physical properties of vitreous substitutes, such as viscosity, interfacial surface tension, density, and buoyancy, influence the dispersion profile of the injected bolus. The dynamic viscosity of the vitreous changes with age. In older eyes, liquefaction of the vitreous occurs, particularly in the central area, where there is a lower collagen content. Vitreous liquefaction causes loss of viscoelastic behavior. Understanding the viscosity of the vitreous and its substitutes is important in predicting the dispersion and diffusion of IVT. The dynamic viscosity values of vitreous substitutes are shown in \u00ae), a surfactant that reduces the surface tension, thereby lowering the risk of protein aggregation. The surface tension of vitreous substitutes could impact the performance of IVT. The surface tension of the vitreous substitutes was characterized to understand its impact on the dispersion area of the injected dye bolus. The surface tensions of both HA and SO are shown in Surface tension is the tendency of liquid surfaces to reduce into the minimum surface area possible. Surface or interfacial tension is defined as a force per unit of length. Some anti-VEGF IVTs contain polysorbate 20  did not vary greatly between concentrations of 1.0\u20133.0 mg/mL, as shown in The fluid density of vitreous substitutes was measured to understand the impact it had on bolus buoyancy. The volumetric density ratio of HA with water  allowed us to predict the flow patterns of fluid flow within the needle. Indeed, fluid flow in a tube (or needle) is dominated by laminar flow at lower Re values (<2300), transitional flow (2300 < Re < 4000), and generally considered turbulent flow at higher Re values (>4000). After we defined and characterized the different physical properties of the vitreous substitutes , as well as the injection rate in terms of Re, we proceeded to study the effects of each of these parameters on the dispersion dynamics of the injected liquid immediately after injection.A range of needle gauges are used to administer IVT. Studies have shown that patients experience less pain and there is less vitreous loss when smaller sized needles are used . The Re  25\u201333G, . Re defiRe: 189 \u00b1 91), the dispersion of the Coomassie blue dye in HA (1.0\u20133.0 mg/mL) and SO (S500 and S1000) showed little dispersion and was locally suspended within the vitreous substitute immediately after injection  into vitreous substitutes in the 3D printed vitreal cavity model is summarized in njection . InjectiRe: 677 \u00b1 175), the injected Coomassie blue dye impacted the posterior part of the model, engulfing the dye along the walls of the model. Injection into lower concentrations of HA (1.0 mg/mL)  A and B d0 mg/mL) E and F. 2 and 72 mm2 from the front and side view respectively (Re: 677 \u00b1 175) and slow (Re: 189 \u00b1 91) injection rates to reproduce clinically relevant injection rates. These Re values correspond to the flow inside the needle. Additional Re can be calculated for the dye movement within the vitreous substitute (Rebolus) to quantify the effects of viscous and inertial forces. We considered the averaged velocity of displaced dye and the average length of the bolus. Averaged bolus velocity was calculated from the averaged bolus length  in time.The evolution of dye area in 1.0 mg/mL HA vitreous substitutes against time, reached a maximum area of 106 mmectively . This inRe of the bolus movement (Rebolus) through the vitreous substitutes was calculated from the dye area at serial time points. The velocity of the injected bolus was calculated from changes in the bolus length between two different time points. A schematic representation of the dye area dispersion in time is shown in The Rebolus for dye injected into the different HA and SO vitreous is shown in Rebolus = 4.8\u201310), the viscous forces dominated the transport of the dye, while at fast injection speeds, a maximum Rebolus of 104 was observed, indicating that viscous forces still dominated, albeit convection may also be playing a role, as shown by the engulfment in The averaged 2 at a slow injection rate to 171 mm2 at a fast injection rate. There was minimal difference between the dye areas in SO at fast and slow injection rates. At fast injection rates, satellite droplets were observed in SO, signifying the effects of interfacial surface tension in keeping the dye bolus spherical, countering the effects of dye stretching. These satellite droplets were not as well defined as large droplets, resulting in a slightly lower dye area in SO at a fast injection rate and a limitation of the processing technique.The summation of front and side view dye areas in different vitreous substitutes is shown in The dye surface area was considerably reduced with increasing HA concentrations at fast injection rates compared to slow injection rates. The interfacial surface tensions of HA (1.0\u20133.0 mg/mL) were similar, with a maximum difference of 10% . A maxim2 in HA (2.0 mg/mL), as compared to 60.2 mm2 in S500 (2 in HA (3.0 mg/mL), as compared to 58 mm2 in S1000 , resulted in the buoyancy of injected bolus rising up to the meniscus. The use of vitreous substitutes with densities lower than water, such as S500, settled at the bottom of the posterior pole of the vitreous cavity. We showed that when there is little difference in the air/fluid surface tension between the vitreous substitute and the injected liquid , a fast injection rate results in fluid engulfment, increasing the surface area and promoting both mixing and diffusion. The distribution of the injected bolus is driven by viscous forces and the initial fluid momentum stretching the bolus during the injection. At fast injection rates, a large difference in surface tension  between the air/vitreous substitute and air/water prevented the fluid from engulfing. This resulted in the shedding of droplets of different sizes, leading to smaller surface areas and therefore reducing the surface available for mixing and diffusion. Many of these parameters are affected by temperature. We conducted this study at RT, whereas the temperature is approximately 34 \u00b0C and 25 \u00b0C in vivo before and during vitrectomy, respectively . HoweverInjection into BSS resulted in the largest dye distribution area and fastest mixing, as expected. When the dye was injected into BSS, it impacted the cavity wall and heterogeneously formed spreading lamella in all directions. Our method using a vitreous cavity model demonstrates the importance of using relevant ocular globe and lens geometry on the dispersion of the injected solution inside the cavity. The bolus was localized at the posterior pole of the eye for all vitreous substitutes (except for BSS) at the end of the injection. The bolus did not reach the posterior wall of the model at slow injection rates and at fast injection rates for all SO and in the case of 3.0 mg/mL HA when the needle depth inside the vitreous cavity was reduced by 35%. The bolus impacted the vitreous cavity wall, creating larger engulfment in HA samples with lower concentrations at fast injection rates. The bolus exhibited buoyancy when the vitreous substitute was denser than the bolus solution or settled to the bottom of the cavity when the vitreous substitute was lighter.The simulation of intravitreal injections is complex. Although physiologic-based pharmacokinetic models are limited due to simplification and empiricism, they are still very important in the preclinical development of new IVT. Simple volumetric scaling of experimental results from one species to another is not always appropriate. Compartmental modeling using computational fluid dynamics using anatomically relevant models allows biodistribution predictions to be made based on boundary conditions, mass, flow pressure, and concentration applied to various tissue surfaces. However, many of these models may not consider initial injection rate, lens status, wall impact, and assume a spherical-shaped bolus of a specified starting surface area. In this study, we showed how the injection rate, viscosity, and surface tension influence the surface area of the injected bolus. In addition to these parameters, buoyancy affects the time evolution of the injected bolus. During the time of recording (maximum of 5 s), the Coomassie blue dye did not have time to start mixing with any vitreous substitutes, except in the case of BSS. Therefore, diffusion in our experiments was negligible during this time frame and the surface area reported reflects the combination of viscosity, convection, and surface tension of the initial injected bolus. The diffusivity of the bolus is also influenced by drug properties, such as particle size, polydispersity, and surface charge. Larger drug molecules have slower diffusivity due to entanglement or interaction with the biopolymeric component of the gel vitreous . IncreasTo the best of our knowledge, the distribution of the initial bolus of intravitreal solutions at clinically relevant speeds and volumes of injection into vitreous substitutes has not been previously described. An important strength of our experimental model is that it reflects the ocular globe, including the presence of a lens, which influenced fluid dynamics, particularly when dye was injected into BSS. The dye impacted the posterior surface of the lens and re-circulated into BSS. The lens status of patients receiving intravitreal injections may influence drug flow dynamics in an ageing liquefied vitreous or in post-vitrectomized eyes with BSS as a vitreous substitute.Following intravitreal injections, the intraocular pressure (IOP) is transiently raised because globe tissues exhibit elastic properties. Our model was fabricated from a hard resin and the non-pressurized cavity was not susceptible to an increased volume, thus removing any hydraulic pressure factor in our model. After delivery of the injection, the needle remained in place for the entire duration of image acquisition. It has been previously observed that once the needle is withdrawn, a portion of the injected material may flow away from the region of the injection track along the path created by the needle .A limitation of our study is that thermal convection across the posterior segment was not simulated in our model. However, this is unlikely to significantly affect the initial injected bolus surface area. Surface area calculations from 2D images work extremely well for spheres but 3D imaging would provide more accurate quantification of the bolus distribution. Despite using 2D imaging for the determination of the surface area of the bolus, it is apparent that computational models assuming a perfectly volumetric sphere bolus starting point underestimate the actual surface area of the injected bolus. Underestimating the starting point impacts the predicted surface area for drug molecule diffusion and drug clearance.Further work should aim to characterize the impact of protein, salts, ascorbic acid, and cross-linked collagen on the hydrodynamics of intravitreal injections at physiological temperatures. This will enable preclinical modeling of drug dispersion and mixing in vitrectomized and non-vitrectomized eyes. Such modeling, in conjunction with pharmacokinetic/pharmacodynamic (PK/PD) and in-vitro in-vivo correlation (IVIVC) studies could better inform drug dosing and regimens in different vitreous and lens statuses.Our study highlights key parameters and physical characteristics, which should be considered when designing or creating a vitreous substitute. Improved quantitative proteomic analyses of the vitreous through mass spectrometry-based methods have helped identify future therapeutic targets or agents to be added to vitreous substitutes. However, viscosity, volumetric density, and surface tension of the vitreous substitutes should also be considered. Properties influencing the convection of initial bolus and the diffusion of injected agents into novel vitreous substitutes should be simulated at a preclinical stage of development."}
+{"text": "Consuming whey protein supplements, along with physiotherapy and psychotherapy, have been recognised in sports performance. Whey protein supplements (WPS) is one of the commonly used supplements as ergogenic aids for athletes to enhance their muscle performance and recovery during sport-related injuries. The purpose of this systematic review is to investigate the effectiveness of WPS over the blood biochemistry mainly amino acids, creatinine kinase and myoglobin which influence performance and recovery among athletes.A comprehensive literature search was conducted to identify randomised control trials (RCTs) and non-RCTs that investigated the effectiveness of WPS on amino acids, creatinine kinase and myoglobin among athletes. Risk of Bias in Non-Randomised Studies of Interventions tool (ROBINS-I) and Cochrane Risk of Bias Assessment tool were used to rule out the quality of studies. Meta-analysis was performed using a random effect model with STATA version 14.2. The weighted mean difference was used to estimate the effectiveness of WPS against other supplements.essential amino acids level by 624.03\u2009nmol/L  and branched-chain amino acids level by 458.57\u2009nmol/L  compared to the control group (without WPS). Moreover, was observed to decrease myoglobin level by 11.74\u2009ng/ml  and creatine kinase level by 47.05\u2009U/L  compared to the control group.A total of 333,257 research articles were identified; of these, 15 records were included to proceed with the analysis. Meta-analysis has shown that WPS has significantly overall increased the level of The findings revealed that the clinical evidence supports the effectiveness of WPS as a positive ergogenic aid on athletes\u2019 amino acids, creatinine kinase and myoglobin.The online version of this article (10.1186/s13643-019-1039-z) contains supplementary material, which is available to authorized users. Athletes experience fatigue when they continuously undertake intensive physical training. Both muscular and mental fatigue assist to prevent the body from experiencing muscle damage and fracture injuries . In someIn addition to physiotherapy sessions, athletes consume medications and supplements to boost the recovery process and performance. Often, it happened that some supplements do not disclose the presence of some illegal substances which prohibited by doping agencies\u2014for example, anabolic androgenic steroids, diuretics and epinephrine\u2014which can jeopardise athletes\u2019 careers as they may face penalties or be removed from competitions . MoreoveThe World Anti-Doping Agency (WADA) is cautious in supplementation consumption among athletes. A WADA-accredited laboratory examined 600 nutritional supplements and found that approximately 15% (%) contained anabolic steroids, which was not disclosed on the bottle label, packaging or leaflets . One of A systematic review was conducted to investigate the effectiveness of WPS over the blood biochemistry mainly amino acids, creatinine kinase and myoglobin which influence performance and recovery among athletes. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) were used to perform the systematic search  A protocThe search strategy used the keyword of \u201cwhey*\u201d combined individually with \u201cathlete*\u201d, \u201cinjury*\u201d, \u201cmuscle*\u201d, \u201cperform*\u201d and \u201crecover*\u201d to find relevant articles from the databases . ThesaurProper care was taken to remove the error by resetting filters. For instance, the PubMed database has a filtering function for selected species of human or animal. When filtered on animal species\u2019 studies, studies examined on humans were found, as the WP could originate from cow\u2019s milk. Therefore, when filtered on human species only, studies categorised under the animal species that examined humans may have been omitted. Hence, the databases\u2019 filtering or customising functions were not used as the function would eliminate relevant articles.Comprehensive literature search was done across medical and health science database such as PubMed, EMBASE via Ovid, Scopus, Cochrane, Cumulative Index to Nursing and Allied Health Literature (CINAHL) via EBSCOhost, SPORTDiscus, Health & Medicine Database via ProQuest, Wiley Online Library, Web of Science, ScienceDirect, Taylor & Francis and SAGE. Manual searches in bibliographies of relevant review articles were also performed to identify any other paper that was not indexed in the selected databases. In addition, all the sport-related journals were individually searched for any potential paper that might meet the inclusion criteria.Inclusive studies design for the systematic review was randomised controlled trials (RCTs) and non-RCTs designs. No restriction was placed on language. The searched timeframe was from the inception of the databases until 31 January 2017. However, study designs on expert opinions, case reports/series, surveys, review articles, editorials, commercial advertisements, magazine articles, unpublished articles and theses were excluded.The population includes active athletes who experienced fatigue and had recovered and/or been hindered in their performance. Studies observed on retired athletes, mixed athletes with non-athletes, animals, cells and gels were excluded.The interventions include whey protein or supplements containing whey protein. The intervention can be found in the form of isolate, concentrate, hydrolysate, denature and protein bars.The comparators were carbohydrate supplements, protein-containing foods from animal sources , protein-containing vegetarian sources , vitamins , minerals  and placebos .The outcome of interest observed is the effect of WPS amino acids, creatinine kinase and myoglobin.The relevant articles were compiled, and duplicate articles were removed by using EndNote X7. Then, a screening was done on titles and abstracts of the relevant articles based on the inclusion and the exclusion criteria. After that, full-text articles of the screened articles were retrieved. However, in some cases where data was presented as conference abstracts or some additional clarification regarding the data was required, corresponding authors of the specific paper were contacted for further assistance. All the data extraction sheets were piloted, and extraction of all papers was performed by TMK and FCL individually. If there were any variations in the extractions, were resolved by the mutual consensus.General information The article study methods and characteristic (study design)Participants Intervention (dose and number times consumed)Comparators (dose and number times consumed)The extracted data was entered into Microsoft Excel 2016, namely General iThe outcome is the data obtained after the participants consumed the intervention or control on amino acids, creatinine kinase and myoglobin. Most of the data are located within the text of the articles and presented in tabular form or graphs. When data was in standard error or standard error mean, it was transformed into a standard deviation .The inclusive studies were assessed for risk of bias (RoB) by two reviewers independently. Both assessment results were compared and verified for accuracy. A Cochrane Risk of Bias tool criteria was used to assess the RCT studies . For nonMeta-analysis was performed using a random effect model with STATA version 14.2. The type of data for this analysis was continuous data, which contained mean, standard deviation and sample size . A randoI-squared (I2) for variation in WMD attributable to heterogeneity, Tau-squared to estimate between-study variance, and forest plot. WMD was preferred as outcome measurements in all studies were made on the same scale [I-square appeared to have more than 50% of heterogeneity, subgroup meta-analyses were conducted by activities or exercises instructed during the study and intervention duration (days). Funnel plots and Egger tests were also computed to examine publication bias.Two or more eligible studies for an outcome were required to generate weighted mean differences (WMD), 95%confidence intervals (CI), weight percentage, heterogeneity chi-squared, me scale . When thFor the identified articles, there were 333,257 records from the databases and 1773 records through a manual search. At the screening stage, there were 221,064 records after removing duplicates from the identified stage. After screening the titles and abstract, 169 records were brought to the next stage. Subsequently, 27 records were eligible, as 147 records were excluded given the reading availability of the full text of the articles. Of these 27 papers, 15 papers were found addressing the clinical parameters described in the objectives of this systematic review. The PRISMA flow of these stages is shown in Fig.\u00a0The descriptive study characteristics are presented in Table\u00a0A total of 13 RCT studies were assessed using the Cochrane RoB assessment  compared to the control groups, although high heterogeneity was detected  and all studies were favourable to the intervention group  compared to the control group, yet it has moderate\u2013high heterogeneity. Two studies were favourable to the control group: Naclerio et al.\u2014A [I2 value remained high and a standalone study  significantly lower in the intervention group than in the control group, although with high heterogeneity. Six studies were also favourable to the intervention group: the Gunnarsson et al. [p\u2009=\u20090.567).A total of thirteen studies involved WPS with creatinine kinase. Figure\u00a0n et al.  study can et al.  study can et al.  study can et al.  study can et al.  study isI2\u2009=\u20090%; CI\u2009=\u2009\u2212\u200915.42, 54.01) and the resistance exercise subgroup had low evidence and heterogeneity . However, the soccer, run, cycle and resistance subgroups have high heterogeneity of 95% and above in I2. On the other hand, the heterogeneity for the exercise resistance group was found to be 28.3%. In the intervention duration range , and the range of 41\u201360\u2009days was a stand-alone study  of the included studies were RCTs which many sources of bias had removed from the process . Two nonWhey protein supplements having high levels of serum amino acids of both EAA and BCAA are well known. Furthermore, the results of the meta-analyses illustrated robust evidence that athletes who consumed WPS had higher levels of serum amino acids than comparators. Essential amino acids of WPS were believed to retain and growth of muscle, while BCAA of WPS was believed to delay the onset of fatigue during prolonged endurance exercise \u201342. MoreIn addition, the myoglobin and creatinine kinase levels were lower in the intervention group which indicates that the consumption of WPS can reduce the muscle fatigue or muscle damage than the comparator groups. The release and elevation in myoglobin indicates the presence of muscle damage or inflammation after exercise . Thus, mCreatinine kinase appearing in the blood is considered as a marker of indirect muscle damage . The levBased on evidence and analyses, WPS is found to be effective in improving the serum levels of BCAA and EAA, and on other hand, WPS has shown a substantial effect on reducing myoglobin and creatinine kinase levels that are markers of preventing sports injuries, These result support the consumption of WPS for the athletes during the routine training and muscle injuries to augment the muscle performance and recovery process.However, there are two main concerns that researchers would like to highlight before any athlete and multidisciplinary team who manages athletes\u2019 health and performance should opt to use WPS; the first one is the higher level of heterogeneity across the compared studies. The subgroup analysis was performed which has shown some declined in heterogeneity for some specific groups. However, for some groups, higher heterogeneity was still there, which is one of the genuine concerns for the researchers while interpreting the results of this meta-analysis. Moreover, the difference in WPS formulation also might have affected the bioavailability and outcome among the studies, and this clinical aspect might have contributed to the heterogeneity in the current meta-analysis.Future directions for research and conducting research include larger sample sizes, the inclusion of both genders , ages, geographical, type of sport and categories of athletes. Interventions that are consumed before, during and/or after sports performances and recovery process also deserve further study, considering the effectiveness of improving athletes\u2019 sports performances and recovery. Additionally, follow-up studies could establish effectiveness for the relation between interventions and long-term performance recovery progress for athletes.Nonetheless, although WP is recognised as safe supplements for athletes , 48, conThe WADA guidelines and recommendations are updated annually and serve as a guide for consuming supplements during the supports and recovery process for athletes. Therefore, it is highly recommended for athletes, and the multidisciplinary team are well-informed and updated themselves on the guidelines and recommendations before using WPS or any supplements.In conclusion, the current meta-analysis shows the effectiveness of WPS over the blood biochemistry mainly amino acids, creatinine kinase and myoglobin which influence the performance and recovery among athletes and are promising. First of all, the quality of studies has delivered assurance in the validity and reliability of the clinical evidence, whereby most of all the studies were RCTs and, thus, many sources of biases have been omitted. Included studies examined the conditions as close to real life training and competition conditions as possible for athletes. Importantly, athletes need to check, maintain and control the dose as set out by WADA. Moreover, the positive impact of WPS on the essential biomarkers (myoglobin and creatine kinase) aids athletes by delaying or attenuating fatigue and reducing the risk of sports injuries while athletes are reaching beyond their potential aerobic threshold.Additional file 1:Risk of Bias. (XLSX 21 kb)Additional file 2:The Risk Of Bias In Non-randomized Studies \u2013 of Interventions (ROBINS-I) assessment tool. (DOCX 107 kb)Additional file 3:Meta-analysis output. (ZIP 162 kb)"}
+{"text": "Lipomas have often been associated with mtDNA mutations and were mainly observed in patients with mutation in mitochondrial tRNAlysine which is also the most frequent mutation associated with MERRF. Up to date, no systematic studies have been developed in order to assess the incidence of lipomas in large cohorts of mitochondrial patients.The aim of this study is to analyze the incidence and characteristics of lipomas among an Italian cohort of patients with mitochondrial diseases. A retrospective, database-based study  of patients with lipomas was performed. A total of 22 (1.7%) patients with lipomas have been identified among the 1,300 mitochondrial patients, enrolled in the Italian database. In about 18% multiple systemic lipomatosis (MSL) was the only clinical manifestation; 54% of patients showed a classical MERRF syndrome. Myopathy, alone or in association with other symptoms, was found in 27% of patients. Lactate was elevated in all the 12 patients in which was measured. Muscle biopsy was available in 18/22 patients: in all of them mitochondrial abnormalities were present. Eighty six percent had mutations in mtDNA coding for tRNA lysine. In most of patients, lipomas were localized along the cervical-cranial-thoracic region. In 68% of the patients were distributed symmetrically. Only two patients had lipomas in a single anatomical site (1 in right arm and 1 in gluteus maximum). MSL is often overlooked by clinicians in patients with mitochondrial diseases where the clinical picture could be dominated by a severe multi-systemic involvement. Our data confirmed that MSL is a rare sign of mitochondrial disease with a strong association between multiple lipomas and lysine tRNA mutations. MSL could be considered, even if rare, a red flag for mitochondrial disorders, even in patients with an apparently isolated MSL. Multiple systemic lipomatosis (MSL) is a rare disorder involving adipose tissue and characterized, clinically, by the development of non-encapsulated lipomas usually distributed in the cervical\u2013cranial\u2013thoracic region \u20133. SinceLipomatous masses often occur in the third/fourth decade of life. MSL is largely prevalent among males and it has been correlated with high alcohol intake , 5. LipoThe pathogenesis of lipoma formation is unclear but sporadic observations have linked MSL with mitochondrial dysfunction .In about 28% of MSL patients, mitochondrial alterations  were noted in muscle biopsies \u201312. In aThe pathogenesis of lipomas in MSL seems to be due to alteration of brown fat tissue growth regulation, this hypothesis is supported by the typical anatomic distribution of the masses and from results of morphological studies. Lipomatous masses are indeed located along the midline of the body, following the distribution of brown adipose tissue (BAT) present in newborns . BAT, coWhile mitochondrial function in patients with idiopathic MSL has been systematically studied , the preWe reviewed data of 1,300 patients reported in the database of the Nation-wide Italian Collaborative Network of Mitochondrial Diseases searching for the presence of lipomatosis as clinical feature. Aggregated data were using to evaluate: (1) incidence of lipomas among the population of Italian mitochondrial patients, (2) molecular defects present in patients with MSL, (3) clinical characteristics of lipomas , (4) clinical phenotypes of patients , (5) correlation between MSL and other biochemical markers.This was a retrospective study. The clinical features were extrapolated from the web-based database in which every item, considered relevant for mitochondrial disorders in a previous consensus phase among all involved centers, was evaluated according to the presence or not (\u201cyes or no\u201d).MSL severity has been graded considering the number of anatomical region involved and the symmetry. Data were expressed as mean \u00b1 Standard deviation (SD).The local ethical committees of all involved centers have approved the database establishment and its use for scientific purpose.All enrolled patients, in accordance with the ethical standards of the 1964 Declaration of Helsinki, have provided informed consent.t-test (for means) with alpha < 0.05.Linear correlation was calculated using Graph pad Prism 6 software, statistical comparisons were tested using Pearson r test (for correlations) and Student Among the 1,300 patients of the Italian registry, a total of 22 patients from 19 independent families with MSL have been identified, representing the 1.7% of all subjects of the database. Fourteen MSL patients were female (63%) and 8 males (37%). Age of onset was after the second decade in most of the patients with MSL apart from two sisters with encephalomyopathy with a very early onset in the first year of life. No differences have been observed between mean age at onset in male vs. female subjects .The majority of subjects with MSL showed a variety of signs and symptoms but only in four subjects (18%) it was an isolated manifestation in a mean follow-up period of about 15 years. About these four, two were relatives of affected individuals with other clinical manifestations whereas two were primarily investigated for a mitochondrial disorder because of lipomas. Twelve subjects (54.4%) had a diagnosis of MERRF syndrome; six patients (27%) had a clear myopathy with muscle wasting and weakness .In two subjects MSL was associated with CPEO. Two patients had cerebellar ataxia whereas peripheral neuropathy was observed in five individuals.Chronic high alcohol intake, diabetes, or dyslipidemia were not present in any of the individuals with MSL.Plasma lactate dosage was available in 12 subjects: it was elevated in all of them of whom 11 had high lactate level at rest  while only in one subject it was elevated after exercise.Muscle biopsy was performed in 18 subjects out of 22. RRF and COX negative fibers were reported in 15 out of 18 (83.2%), two patients had only RRF, and one (with cPEO) had only type II fiber atrophy and increased sub-sarcolemma rims at SDH staining. Dystrophic features were reported in two . Biochemical activities of the respiratory chain enzymes were assessed in 8 individuals; in 3 of them, a reduction of COX activity was reported, complex II+III were reduced in other 3 subjects, one individual had a reduction in complex I activity and another one multiple enzymes defects.Lys). Among them, 17 (77% of the MSL cohort) had the m.8344 A > G and two (9%) carried the m.8363G>A. Data on heteroplasmy levels (expressed as percentage of mutated over wild type mtDNA) were recorded in blood in 8 patients, in muscle in 7 and in urine sediment in 6. Mean mutation load was lower in blood (62.2 \u00b1 17.2), and slightly higher in muscle (88 \u00b1 6%) and urine sediment (69 \u00b1 26%).Genetic data showed that most of the patients with MSL  harbored point mutations in mitochondrial DNA (mtDNA) gene coding for lysine tRNA  as well as MFN2 have been sequenced but no causative mutations were detected.Lipomas were distributed symmetrically in 15 patients (68%) ; five suMSL was firstly described in the late Nineteenth century and since then, many studies investigated the clinical features and long-term follow-up of MSL patients . AlteratIn this study we investigate the prevalence and the characteristics of MSL in the Italian cohort of mitochondrial patients. Among the subjects enrolled in the registry, lipomas were reported in 22 (1.7%), confirming that MSL is a rare disorder even in this specific population. In contrast with literature data obtained in patients with MSL  we obserMSL can be the only clinical manifestation of a mitochondrial disorder (18% in this cohort). We observed a high association of myopathy , probably as part of a spectrum of the m.8344A>G severity.Lactic acid is increased in patients with defect of oxidative phosphorylation, and it is used as marker for mitochondrial diseases, even though it lacks of good specificity and sensitivity . InteresRegarding anatomical distribution, although lipomas were symmetric in the majority of the subjects, in one third of the subjects was not so. This observation, differs from the literature data , and sugred flag for mitochondrial disorders thus guiding the diagnosis. Moreover, our data warns to consider to pursue mitochondrial DNA analysis even in patients with isolated MSL since it can represent the only manifestation of a pathogenic mtDNA mutations. Comparing our results with published data from the literature, we identified some differences that can help to recognize patient with MSL who deserve mitochondrial disease investigation: mitochondrial MSL (1) is more frequent in women, with no history of alcohol abuse, (2) is often associated with muscle involvement and (3) can be asymmetric. The association of MSL and elevated lactate level strongly suggests a mitochondrial disorder.In conclusion, for the first time, this study focuses on a rare and poorly investigated manifestation of mitochondrial disease. In patients with mitochondrial diseases, MSL can be easily overlooked because other clinical picture usually dominate the clinical course. Our data have demonstrated that MSL is a rare sign of mitochondrial disease. Identification of MSL is however important because it could be considered, a Our cohort study presents the typical limitations of all retrospective studies, and probably underestimates the real prevalence of MSL in patients with mitochondrial diseases, being a sign that sometimes could be missed when not actively searched, especially if visceral. However, similar multicenter efforts are needed and strongly encouraged for rare disorders such as mitochondrial diseases, and may represent the basis for more rigorous longitudinal studies.OM had full access to all the data in the study and takes responsibility for the integrity of the data and accuracy of data analysis. OM, EB, AT, and MiM contributed to study design. OM, EB, CL, SS, GC, MaM, MF, GS, and MZ contributed to data collection. OM, EB, MiM, and AT drafted the manuscript. TM, GP, DR, EP, LB, LV, and DO provided clinical informations. EB performed statistical analysis. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Iodine, an essential nutrient, is the most important trace element in thyroid hormone synthesis and maintenance of thyroid function. This study investigated the iodine nutrition status in healthy Chinese adults and assessed the relationship between urinary iodine concentration (UIC) and thyroid hormone levels.A cross\u2010sectional, multicenter study was conducted between October 2017 and January 2018, with 1017 adults recruited from five cities in China. All subjects underwent thyroid ultrasonography, and only those with normal results were included in the study. UICs were measured by inductively coupled plasma mass spectroscopy and adjusted using urine creatinine levels. Thyroid hormone levels were measured using an automated immunoassay analyzer.P\u00a0=\u00a00.737). However, the adjusted UIC was significantly different between sexes (P\u00a0<\u00a00.001). The median UIC was higher than 100\u00a0\u00b5g/L. According to the World Health Organization criterion (100\u00a0\u00b5g/L), the total prevalence of iodine deficiency is 33.1% (n\u00a0=\u00a0271). The prevalence rates of iodine deficiency in our study were 33.2% and 32.9% in males and females, respectively, and had no difference between sexes and among cities (P\u00a0>\u00a00.05). Serum thyroid\u2010stimulating hormone (TSH) levels increased when UIC increased. The Kruskal\u2010Wallis test showed no significant differences in free triiodothyronine, free thyroxine, and TSH, with different levels of UIC .The median UIC and adjusted UIC were 134.0\u00a0\u00b5g/L and 114.2\u00a0\u00b5g/g, respectively. UIC was not significantly different between males and females (Chinese adults with normal thyroid structure have relatively sufficient iodine levels. These studies reported that the iodine status in China was sufficient or adequate and that excessive iodine intake led to increased prevalence of thyroid disease.Therefore, our study examined the iodine nutrition status in adults whose thyroid structure was normal, and the association between UIC and thyroid hormones, to provide reasonable suggestions to the government under the implementation of USI.22.1Resident of locality for >1\u00a0year;Age\u00a0\u2265\u00a018\u00a0years;Normal thyroid ultrasonography measurement.Analytical data used in this study were collected from five cities  during October 2017 to January 2018. Participant inclusion criteria were as follows:Had high fever in the past 15\u00a0days;Presence of serious systemic disease including cardiovascular, renal, gastrointestinal, pulmonary, or thyroid disease, or cancer;Took thyroid medication in the past 15\u00a0days;Was a hospital inpatient or seriously ill during the previous 4\u00a0weeks;Surgery in the past 6\u00a0months;Female participants, pregnant, breastfeeding, or within 1\u00a0year after childbirth;On a high\u2010iodine diet or consumed seafood including kelp, sea fish, crab, shrimp, and shellfish in the past 3\u00a0days.Participant exclusion criteria were as follows:A total of 1017 apparently healthy participants aged 18\u201082\u00a0years were enrolled in this study. This study was approved by the Ethics Committee of the Institute of Peking Union Medical College Hospital. All participants studied were informed in writing of the intended use of their samples, and each participant provided written consent.2.22). Blood pressure (BP) was measured three times after the participant rested quietly for at least 10 minutes, and the average of three measurements was used. Current smoking status was classified as a self\u2010reported response of \u201cyes\u201d to the question \u201cDo you smoke now?\u201d We also evaluated the UIC distribution between intake iodine salt and noniodine salt among 693 subjects who self\u2010reported a response to the question \u201cdo you consume iodine salt during breakfast, lunch, or dinner?\u201d All participants underwent thyroid ultrasonography examination performed by trained technicians.Data including demographic characteristics and medical history were collected from a representative sample of the study via a standard questionnaire. Body weight was measured on a calibrated beam scale, and height was measured in triplicate. Body mass index (BMI) was calculated as body weight divided by the square of the height  were performed before the analyses to monitor instrument precision. Measurements were performed according to the standard operation procedure. Instrument calibration and preventive maintenance were performed annually. We also participated in External Quality Assessments by the National Center for Clinical Laboratories and College of American Pathologists to guarantee the accuracy and reliability of results.Calibration and quality controls  and triglycerides (TG), and fasting blood glucose (FBG) were measured. Thyroid hormones including free triiodothyronine (FT3), FT4, and TSH were measured using Beckman DXI 800 chemiluminescent immunoassay. The reference range for FT3, FT4, and TSH were 2.5\u20103.9\u00a0pg/mL, 0.61\u20101.12\u00a0ng/dL, and 0.38\u20105.33 mIU/L respectively. The precision of FT3, FT4, and TSH measurements was assessed according to the Clinical Laboratory and Standard Institution EP\u201015A2 protocol. We previously used this method for measuring UIC. The results revealed that the inter\u2010run coefficients of variation (CVs) and total CVs for urine iodine were 3.5%\u20106.7% and 3.9%\u20106.7%, respectively. The intra\u2010 and interassay coefficient of variation for FT3, FT4, and TSH were 5.4%\u20108% and 5.8%\u20107.6%, 4.1%\u20107.6% and 1.7%\u20106.9%, and 2.4%\u20103.9% and 2.2%\u20103.7%, respectively, which meet the clinical values.All laboratories participating in the survey followed the same internal quality control program that was standardized by the Peking Union Medical College Hospital.2.4The iodine status of subjects was assessed by median UIC based on the World Health Organization (WHO) recommendations. According to iodine nutrition epidemiologic criteria of WHO, a population's median UIC of <100, 100\u2010199, 200\u2010299, and \u2265300\u00a0\u00b5g/L is each representative of insufficient, adequate, above requirements, and excessive iodine intake. In this study, UIC of enrolled subjects was classified by <100, 100\u2010299, and \u2265300\u00a0\u00b5g/L. Furthermore, the prevalence of iodine deficiency was defined as proportion of subjects with a UIC <100\u00a0\u00b5g/L. The UIC values were adjusted using urine creatinine.2.5t test or one\u2010way ANOVA, and skewed data were compared using the Mann\u2010Whitney U or Kruskal\u2010Wallis test. Group differences of categorical variables were compared using the chi\u2010square test. P\u00a0<\u00a00.05 was defined as statistically significant.SPSS 20.0  and Excel 2016 statistical software  were used for data analysis. Normally distributed data were presented as mean and standard deviation (SD), while skewed data were expressed as median (percentiles). Categorical variables were presented as a number (percentile). Group differences of normally distributed values were compared using the 33.12, 122\u00a0mm\u00a0Hg, and 76\u00a0mm\u00a0Hg, respectively. One\u2010way ANOVA showed that there were significant statistical differences in age, BMI, SBP, DBP, FBG, TG, TC, FT3, FT4, and TSH among different cities (P\u00a0<\u00a00.001).A total of 1017 adults from five cities were recruited for this study. Subsequently, 198 subjects lacking complete information or urine iodine measurements were excluded. Ultimately, 819 subjects with complete information and UIC and urine creatinine measurements who met the inclusion criteria were used in the final analysis. Baseline characteristics of study subjects are shown in Table 3.2P25, P75) were 134.0 (86.6\u2010201.4)\u00a0\u00b5g/L and 113.5 (73.7\u2010198.2)\u00a0\u00b5g/g, respectively. The Kolmogorov\u2010Smirnov\u2010Wallis test revealed that the distribution of UIC was skewed. The Kruskal\u2010Wallis test demonstrated that there were no significant differences in the UIC levels between the sexes (P\u00a0=\u00a00.737), but there were differences in the adjusted UIC between the sexes (P\u00a0<\u00a00.001). According to WHO criteria, prevalence of iodine deficiency, adequate iodine, and excessive iodine was 33.1% (n\u00a0=\u00a0271), 57.1% (n\u00a0=\u00a0468), and 9.8% (n\u00a0=\u00a080), respectively. The prevalence rates of iodine deficiency were 33.2% and 32.9%, in males and females, respectively, while the chi\u2010square test revealed no difference between sexes. The prevalence of iodine deficiency among Beijing, Guizhou, Xinjiang, Shandong, and Heilongjiang was 34.7%, 32.3%, 37.1%, 31.5%, and 29.1%, respectively, and showed no statistical differences (P\u00a0>\u00a00.05).The median UIC and adjusted UIC (3.3P\u00a0=\u00a00.005), and the 18\u201029 age\u2010group showed the highest median UIC. Additionally, the median UICs for all age\u2010groups were above that required for iodine. When urine creatinine was used to adjust the UIC, median adjusted UIC decreased while age increased in those younger than 49\u00a0years of age. The 50\u201059 age\u2010group showed the statistically highest median adjusted UIC (P\u00a0=\u00a00.027). Heilongjiang had a significantly higher median UIC and adjusted UIC than other cities, although the median UIC among cities did not show statistical difference.Table P\u00a0=\u00a00.034). Differences in the prevalence of iodine deficiency among cities exhibited no statistical significance as seen with the chi\u2010square test (P\u00a0=\u00a00.586).The prevalence of iodine deficiency of the 40\u201049 age\u2010group was significantly higher than other groups. The prevalence of iodine deficiency showed statistically significant change with age according to UIC (3.4P\u00a0>\u00a00.05). The serum FT4 levels did not show statistically and clinically significant changes with UIC (P\u00a0=\u00a00.108). The interquartile range (IQR) of FT3 and TSH increased with increasing UIC. Conversely, the IQR of FT4 decreased with increasing UIC.The median concentrations of FT3, FT4, and TSH in the subjects were 3.36\u00a0pg/mL, 0.91\u00a0ng/dL, and 1.95 mIU/L, respectively. Table 3.5P\u00a0=\u00a00.979). The median UIC of subjects who consumed iodine salt was higher than that in subjects who consumed non\u2010iodine salt . Furthermore, we investigated the correlation between UIC and other indicators. The correlations between UIC and indicators using Spearman correlation analysis are shown in Table P\u00a0<\u00a00.05).Among the enrolled subjects, 712 answered the question \u201cAre you smoking now?\u201d and the median UIC of these subjects was 137.8 \u00a0\u00b5g/L. Of these 712 participants, 84.3% (n\u00a0=\u00a0600) and 15.7% (n\u00a0=\u00a0112) were nonsmoking and smoking, respectively. Iodine deficiency occurred in 32.0% non smoking subjects and 30.4% smoking subjects. There was no difference in the median UIC between non smoking and smoking subjects (135.2\u00a0\u00b5g/L vs 142.9\u00a0\u00b5g/L, 4This cross\u2010sectional study includes the latest survey to date examining the iodine status, and the association between UIC and thyroid hormones, in adults with a normal thyroid ultrasound in China. Few studies have focused on the iodine status of a population with normal thyroid structure. We found that the median UIC was 134.0\u00a0\u00b5g/L, demonstrating that the iodine levels in Chinese adults were sufficient according to the WHO criteria. Notably, the prevalence of iodine status with a median UIC <100\u00a0\u00b5g/L was 33.1%.Because UIC is an indicator to estimate a population's iodine status, it might not be suitable for determining a subject's iodine status.The iodine nutrition status of the Chinese population has been suggested to be sufficient in several studies.In this study, the subgroups with a higher UIC were associated with a higher median serum TSH, but not with statistical significance, and a relationship between UIC and FT3 or FT4 levels was not evident. Due to the large interindividual variation in the ability of the thyroid to adapt, thyroid hormones, including FT3, FT4, and TSH, are not considered sensitive indicators of the population iodine status.This study demonstrated that the median UIC in smokers was higher than in nonsmokers, but not with statistical significance. Kang et al reported that active smokers had significantly lower iodine levels than passive smokers and nonsmokers.A strength of this study is that it is the latest study to report an association between UIC and its relationship with thyroid hormones in a Chinese population whose thyroid ultrasonography tests were normal. Additionally, we used urine creatinine adjusted UIC to evaluate the iodine status to ensure the appropriate evaluation of iodine nutritional status. This study still has several limitations. An important limitation is the lack of information on iodine intake via medications, or other sources. Lastly, we used UIC to assess the iodine status of a population. Spot urine sample UIC has been well documented as a suitable indicator for assessment of a population's iodine status. Therefore, currently it is the most suitable indicator to assess iodine status in a population\u2010based study.In conclusion, the iodine status of apparently healthy Chinese adults was found to be sufficient. However, salt iodization is still necessary to prevent iodine deficiency.The authors have no conflict of interests..DCW, SLY, HLL, SWX, QC, and LQ performed the experiments. DCW, SLY, YCY, and XQC analyzed the data. DCW, SLY, and HLL wrote the article. DCW, HLL, LQ, and YCY revised the article. DW and SY contributed equally to this article. All the authors have accepted responsibility for the entire contents of this article and approved its submission"}
+{"text": "Previous studies have documented mild to moderate iodine deficiency in pregnant and lactating women in Norway. This study focused on non-pregnant young women because their future children may be susceptible to the adverse effects of iodine deficiency. We assessed urinary iodine concentration (UIC), iodine intake from food and supplements, and iodine knowledge in 403 non-pregnant women, mainly students, aged 18\u201330 years. Iodine concentration was measured in spot urine samples analyzed by inductively coupled plasma mass spectrometry and iodine intake was calculated from a self-reported food frequency questionnaire. Knowledge about iodine was collected through the self-administered, paper-based questionnaire. Median (p25\u2013p75) UIC was 75 (42\u2013130) \u00b5g/L and 31% had UIC < 50 \u00b5g/L. Habitual iodine intake was 100 (69\u2013136) \u00b5g/day. In multiple regression models, supplemental iodine, use of thyroid medication, and iodine intake from food were positively associated with UIC, while vegetarian practice was negatively associated, explaining 16% of the variance. Approximately 40% of the young women had low iodine knowledge score and no differences were found between women in different study programs. Young women in Norway are mild to moderately iodine-deficient, and public health strategies are needed to improve and secure adequate iodine status. Iodine deficiency has substantial effects on growth and development and is the most common cause of preventable mental impairment worldwide ,2. Matern = 8). The data collection took place from September to December 2017 in eastern Norway, and from January to February, 2018 in western Norway. To be eligible for the study, participants had to be able to read and write Norwegian. Participants were asked to answer a questionnaire covering information about age, anthropometrics, demographics, health, study program, smoking habits, iodine knowledge, vegetarian dietary practice, and habitual intake of food intake and dietary supplement use. In addition, they were asked to provide a spot urine sample. The present study was conducted according to the guidelines in the Declaration of Helsinki and was approved by the Regional Committee for Medical and Health Research Ethics Norway (2015/1845).Convenience sampling was used to recruit 403 young non-pregnant women, aged 18\u201330 years, with no previous children, from two different geographical regions in Norway (eastern and western Norway). The invitation to participate in the study was given to university students attending lectures or classes. All young women interested in the project met with project workers and received information about the study purpose. Those willing to participate gave informed written consent. Young employees at the study sites who fulfilled the inclusion criteria were also allowed to participate . The urine samples were stored at <4 \u00b0C prior to handling. At the laboratory, the spot urine samples were stored at \u201380 \u00b0C pending analysis. Aliquots of 1.00 mL urine were transferred into 15-mL polypropylene (pp) centrifuge tubes  by means of a 100\u20135000 \u00b5L electronic pipette  and subsequently diluted ten times with an alkaline solution (BENT), containing 4% (w/V) 1-Butanol, 0.1% (w/V) H4EDTA, 2% (w/V) NH4OH, and 0.1% (w/V) Triton X-100. Reagents of analytical grade or better and deionized water (>18 M\u03a9) were used throughout. The quantification of iodine was performed by means of the Agilent 8800 Triple Quadrupole ICPMS  using oxygen reaction mode. Iodine was determined on mass 127. 129I was used for correction of non-spectral interferences. Certified reference materials (CRM) used for quality control were Trace Elements Urine L-1 (78 \u00b5g/L) and Trace Elements Urine L-2 (280 \u00b5g/L) from SeronormTM , and SRM 2670a Toxic Elements in freeze-dried urine from The National Institute of Standards and Technology  (88.2 \u00b5g/L). All the measured values of CRM were within the certified ranges. The same procedure was followed for blank samples as other samples, and all had values under the limit of detection  or limit of quantification . The detection and quantification limits were calculated at three and ten times the standard deviation (SD) of blank samples, respectively. Intermediate precision (within-laboratory reproducibility) was <4% [Participants provided a non-fasting (random) spot urine sample in a labelled 100 mL Vacuette was <4% . The NorThe questionnaire included specific questions about habitual and recent (last 24 h) use of dietary supplements and intake of milk and yoghurt. Furthermore, participants were asked to report their overall dietary profile according to four alternative answers specifying exclusion/inclusion of meat, milk, eggs, and fish (including products derived from these). The alternatives were: (1) ovo-lacto (OL) vegetarian, i.e., exclusion of meat and fish, but not eggs and milk; (2) ovo-lacto-pesco (OLP) vegetarian, i.e., exclusion of meat, but not fish, eggs and milk; (3) ovo-pesco (OP) vegetarians, i.e., exclusion of meat and milk, but not fish and eggs, and (4) vegans, i.e., exclusion of all animal products.The last page of the questionnaire was designed as a food frequency questionnaire asking the participants to report their habitual food intake by answering 32 questions about average intake during the last four weeks of selected food items/dishes. Of these, four questions assessed intake of milk, yoghurt, and cheese, four assessed intake of fish and fish dishes, and one assessed intake of eggs and egg dishes. The questions had seven answer alternatives, ranging from rarely/never to five times daily or more. The answers to the questions related to intake of milk, cheese, fish, and eggs were converted to daily amounts and multiplied with the iodine concentration for each food item/dish using values in the Norwegian Food Composition Table. We used recipes to derive the iodine concentrations in composite dishes containing milk, fish, and eggs and for averaging concentrations from different fish species. To account for iodine contributed by the remaining food items which assessed aggregated food items with low iodine concentrations , we added 30 \u00b5g/day to each estimated total intake. This approach was also used in previous studies ,14.For assessing the amount of iodine contributed by dietary supplements, participants were asked to report habitual as well as recent (last 24 h) use of all dietary supplements. Each supplement was to be reported by brand name and how many times weekly the supplement was taken. Using information provided by producers and labels, we calculated the daily amount of iodine contributed by iodine-containing supplements and added this to the calculated 24-h and iodine intake from food to obtain habitual iodine intake.The first part of the questionnaire included five questions on iodine knowledge. These questions were adopted from a questionnaire used in the UK  and adapWe examined iodine knowledge scores according to the study program of the participants, i.e., health sciences vs. other sciences, and across both groups. The following study programs were included in health sciences group: nutrition, public health nutrition, nursing, public health (nursing), midwifery, social nursing, physiotherapy, occupational therapy, and mental health work. Other sciences included: biotechnology, chemistry, environmental sciences, engineering, physics, teaching, psychology, and other. Due to lack of a validated cut-off for the iodine knowledge score, the score was categorized at the 66th percentile for the statistical analyses, which was decided prior the analyses. We also examined whether iodine knowledge was associated with iodine intake.In this study, we apply the epidemiological criteria\u2019s for assessment of iodine nutrition established by World Health Organization (WHO) . The recp < 0.2) were examined as independent variables. These were iodine intake from food, iodine supplement use, thyroid disorder, vegetarian diet, and smoking habits. Iodine knowledge score categorized at the 66th percentile  was used as dependent variables in logistic regression analyses. Variables with an association (p < 0.2) were examined as potential predictors of being in the highest 66th percentile (high iodine knowledge) and included in the initial multiple model. These were age, country of birth, study program, smoking habits, dry snuff habits, and thyroid disorder. Only variables with an association at p < 0.05 were kept in the model, using stepwise backwards selection conducted manually. Excluded variables were reintroduced one by one, to check for missed associations.Data were analyzed using IBM SPSS statistics version 23  and STATA 14 . Normally distributed data were presented as mean \u00b1SD and non-normally distributed data as median and 25th\u201375th percentile (p25\u2013p75). We used Mann Whitney U test or Kruskall Wallis to examine differences in continuous variables between groups and Spearman correlation to examine agreement between continuous variables. UIC was not normally distributed. Predictors of UIC were identified using median regression (quantile regression). Median regression is less sensitive to outliers than mean regression and non-transformed UIC can be used as the dependent variable. The beta coefficients represent the estimated change in the median UIC, conditional on the values of the independent variables . BackgroCharacteristics of the 403 participants and UIC by different characteristics are shown in p < 0.001).The median (95% CI) UIC in the whole group was 75  \u00b5g/L and 31% had UIC < 50 \u00b5g/L, of which 20% were vegetarians and 80% non-vegetarians. Vegetarian dietary practices were reported by 36 (9%) of the women. Of these, 8 included milk and eggs in their diets (OL vegetarians), 15 included milk, eggs and fish (OLP vegetarians), 4 included eggs and fish (OP vegetarians), and 9 were vegans. UIC was significantly lower in vegetarians  than in non-vegetarians, with a median (p25\u2013p75) UIC of 38 (25\u201355) \u00b5g/L in vegetarians and 80 (45\u2013130) \u00b5g/L in non-vegetarians . Quantile regression showed that vegetarian practice was associated with a reduction in median UIC of ~40 \u00b5g/L, while iodine supplement use increased the median UIC by ~70 \u00b5g/L. Other significant predictors for increased UIC were use of thyroid medication and iodine contributed by food  in all participants and 0.64  in iodine supplement users ( by food .Answers to the questions about iodine knowledge in the young women are shown in The iodine knowledge scores according to study program is presented in Attributes associated with being in the highest tertile of the iodine knowledge score are presented in p = 0.005), with median (p25\u2013p75) UIC of 83 (46\u2013130) \u00b5g/L and 59 (32\u2013110) \u00b5g/L, respectively. The habitual iodine intake was similar in the two knowledge score groups; the median (p25\u2013p75) iodine intake was 95 (68\u2013135) \u00b5g/day in the women below the 66th percentile and 104 (72\u2013137) \u00b5g/day in those in the upper 66th percentile.UIC was significantly higher in women in the two lowest tertiles (below the 66th percentile) of the knowledge score than in those in the upper 66th percentile , which explains the positive association between use of thyroid disease medication and UIC. This finding is similar to what we found for pregnant women .We found no difference in iodine status between students in the western and eastern region of Norway, as opposite to a recently published study , where rThe level of iodine knowledge among the young Norwegian women was low and there was no difference between health science students and student on other science programs. Low iodine knowledge has also been reported among women in Australia , the UK,Approximately 40% of the young women had low iodine knowledge scores, compared to 75% of pregnant women and 55% of lactating women, in a previous study in Norway . The seeThe strengths of this study include a relatively large sample size with participants from two different geographical regions of Norway, in addition to data both on iodine intake and urinary iodine. The major limitation is the sampling procedure, which did not ensure that the participants are representative of all young women in Norway. Spot urine samples for assessment of UIC reflect recent, short time iodine intake. There is large inter- and intra-individual variation in UIC caused by differences in iodine intake as well as by large variation in fluid intake, but spot urine UIC is the recommended method for assessment of iodine status in groups ,2. CalcuIn conclusion, the present study shows that young Norwegian women have insufficient iodine intake and mild to moderate iodine deficiency. Furthermore, iodine status was substantially lower across all types of vegetarianism compared to non-vegetarians. The questions regarding iodine knowledge demonstrated a low to medium level of awareness about the dietary iodine sources and about the importance of iodine. Maternal iodine status is of particular importance for fetal development, and thus the implications of young women having low urinary iodine concentration and low iodine intake is of special concern. Public health strategies are needed to improve and secure adequate iodine intake in this vulnerable group."}
+{"text": "Data collection also included general information from questionnaires. We examined associations between UIC (and use of iodine-containing supplements) and repeated measures of developmental outcomes using multivariable mixed models. The median UIC in pregnancy was 78 \u00b5g/L (IQR 46\u2013130), classified as insufficient iodine intake according to the WHO. Eighteen percent reported use of iodine-containing multisupplements. A UIC below ~100 was associated with reduced receptive (p = 0.025) and expressive language skills (p = 0.002), but not with reduced cognitive or fine- and gross motor skills. Maternal use of iodine-containing supplements was associated with lower gross motor skills , but not with the other outcome measures. In conclusion, an insufficient iodine intake in pregnancy, reflected in a UIC below ~100 \u00b5g/L, was associated with lower infant language skills up to 18 months. The use of iodine-containing supplements was not associated with beneficial effects.Inadequate iodine status affects the synthesis of the thyroid hormones and may impair brain development in fetal life. The aim of this study was to explore the association between maternal iodine status in pregnancy measured by urinary iodine concentration (UIC) and child neurodevelopment at age 6, 12 and 18 months in a population-based cohort. In total, 1036 families from nine locations in Norway were enrolled in the little in Norway cohort. The present study includes  Iodine deficiency (ID) is considered one of the most common nutritional disorders globally and is the world\u2019s largest single cause of preventable brain impairment . Infants3) and thyroxine (T4). Dietary iodine is rapidly absorbed and the thyroid gland is dependent on regular and adequate supply through the diet in order to produce these vital hormones [4 to maintain maternal euthyroidism and transfer thyroid hormones to the fetus, and because iodine needs to be transferred to the fetus for fetal thyroid hormone production. In addition, the renal iodine clearance increases during pregnancy [Iodine is an essential nutrient for the synthesis of the thyroid hormones triiodothyronine  showed inadequate iodine intake in pregnant Norwegian women and the authors suggested that sub-optimal iodine intake is a health concern in Norwegian pregnant women [n = 777) in the Oslo area [n = 197) in the Troms\u00f8 area [n = 954) in pregnancy [The World Health Organization (WHO) estimates that women in 21 European countries have inadequate iodine intake in pregnancy (defined as a median UIC < 150 \u00b5g/L), while only women in 10 countries are considered to have sufficient intake. No data are available in the remaining 23 countries . Howevernt women . Severalms\u00f8 area . Additioregnancy . FurtherThe LiN study is a population-based prospective cohort established to investigate pre- and postnatal risk factors influencing developmental plasticity from pregnancy to age 18 months. Pregnant women were enrolled at nine public health clinics for mothers and children across all four Norwegian health regions. The clinics were chosen after considering demographic characteristics and size of the population to include participants from both cities and rural districts with a wide distribution of socioeconomic conditions. From each site, one public health care nurse was trained as a research assistant. Enrolment started in September 2011 and ended October 2012. Midwives at the public health clinics approached pregnant women 16\u201326 weeks gestation with an invitation to participate; however, some women were asked as late as weeks 31\u201334. Data collection up to age 18 months ended in November 2014. Attrition analysis for the mothers in the LiN study is reported by Fredriksen et al. [Participation entailed donating a spot urine sample for analysis of UIC, responding to questionnaires during pregnancy, and meeting with a research assistant after delivery for assessment of child neurodevelopment at 6, 12 and 18 months. The spot urine sample could be collected at home or on site, and be taken at any time. Details regarding time of sampling has been described elsewhere . Data wen = 851; if missing, urine sample collected at the third meeting was used (n = 7)). Urinary iodine is regarded as a good population biomarker of iodine intake because more than 92% of ingested iodine is excreted in the urine within 24\u201348 h [Non-fasting spot-urine samples from the mothers were collected at the first  and the third  meeting with the research assistant at the public health clinic. The urine sample collected at the first meeting was preferably used in analysis  were used to assess the infants\u2019 developmental skills . Bayley-When recruited in pregnancy, participants completed a questionnaire onsite at their local public health clinic and a questionnaire at home including questions on age, pre-pregnancy weight and height, parity, education, marital status, use of iodine containing supplements, use of omega-3 supplements in pregnancy, and daily smoking in pregnancy . When inUrine was collected at each site and stored at \u221218 \u00b0C pending analysis. Prior to analysis, the urine samples were defrosted in a refrigerator. UIC was determined by inductively coupled plasma mass-spectrometry (ICP-MS) after dilution with 1% tetrametylammonium hydroxid (TMAH). Prior to the analysis the samples were filtrated using a sterile membrane filter (0.45 \u00b5m pore size) and transferred to tubes appropriate for the analysis by the Agilent 7500 for ICP-MS at Institute of Marine Research, Bergen, Norway. Samples were analysed against a urine calibration curve (standard addition curve) to measure the unknown iodine concentration (127I) in the collected urine samples. Accuracy was verified with certified reference material; Seronorm Trace Elements Urine , iodine content: 84 \u00b5g/L  and 304 \u00b5g/L (range: 260\u2013348 \u00b5g/L). In addition to UIC, I/Cr ratio and estimated 24 h UIE were determined. Determination of urinary creatinine concentration was analysed using the MAXMAT PL II multidisciplinary diagnostic platform with creatinine PAP kit .The trial complies with the Declaration of Helsinki and was commenced after approval by the Regional Committees for Medical and Health Research Ethics (2011/560 REK South-East). Written informed consent was obtained from the participants who could withdraw from the study at any time.Continuous variables are expressed as mean with SD for normally distributed data, as median with interquartile range (IQR) for non-normally distributed data, and categorical variables as numbers and percentages. ANOVA was used to compare numerical data and Pearson \u04fc2 to compare categorical data in n = 155 (18%)) were imputed by multiple imputation by chained equations in STATA, and 50 imputed datasets were generated for analyses. The imputation models included all variables included in the final analyses and was done separately for different exposures . More details about the imputation models are provided in Method S1.Missing data on pre pregnancy body mass index (BMI) . Potential time-varying effects were explored by testing interaction terms of exposure and time equal to zero. Outcome measures were standardized at each time point to obtain similar scales for the measurements. Since the mean and the variance at each time point by design were equal, generalized estimating equations were used to estimate the marginal effects, and an unstructured correlation matrix was specified to account for correlations between the repeated measurements. Results were reported as estimated mean across measurement occasions including 95% robust confidence intervals (CI). P-values for the overall associations of UIC and outcomes were calculated by testing all spline-coefficients equal to zero, and non-linearity by testing the second spline coefficient equal to zero.We adjusted for potential confounding factors including maternal age, pre -pregnancy BMI, maternal education, marital status, parity, smoking in pregnancy, and included child gender, an important determinant of the outcomes, to increase the precision of the estimates. The sensitivity analysis on iodine containing supplement use also included use of omega-3 supplements as a covariate.p < 0.05 was considered statistically significant. Statistical analyses of background characteristics were performed using Statistical Package for the Social Sciences (SPSS\u00ae Statistics Version 24). All remaining analyses were performed in STATA . The package postrcspline for STATA was used for graphing of the flexible models [Two-tailed e models .Mean gestational week for collection of urine sample used in the analyses was 23.7 \u00b1 4.9. The median UIC in pregnancy was 78 \u00b5g/L . In total, 676 (79%) women had a UIC of less than 150 \u00b5g/L and 242 (28%) women had a UIC of less than 50 \u00b5g/L . The agep < 0.001)  women reported use of an iodine-containing supplement during the last three months before the spot-UIC was collected in pregnancy. Of the supplement users, daily use was reported by 69%, 4\u20136 days per week by 13.5%, 1\u20133 times per week by 12.3%, and, 1\u20133 times per month by 5.2%. The median (IQR) dose of iodine supplementation was 175 (25) \u00b5g. Considering the individual intake frequency this gives a median estimated daily intake of 150 (50) \u00b5g iodine from supplements. UIC was higher in supplement users (median 92 \u00b5g/L) compared to non-supplement users (median 77 \u00b5g/L), < 0.001) . p < 0.001, a strong positive correlation between UIC (\u00b5g/L) and UIC~creatinine (\u00b5g/L), rs = 0.73, p < 0.001, and even stronger positive correlation between UIC~creatinine (\u00b5g/L) and UIC/creatinine (\u00b5g/g), rs = 0.93, p < 0.001.There was a positive correlation between UIC (\u00b5g/L) and UIC/creatinine (\u00b5g/g), rs = 0.54, p = 0.003) (Having a low UIC (\u00b5g/L) in pregnancy (lower than ~100 \u00b5g/L) was significantly associated with poorer skills in language domains (receptive and expressive) in infancy and toddlerhood, but not with poorer cognitive score or fine- and gross motor skills A\u2013E. The = 0.003) C.n = 117 participants with missing information on pre-pregnancy BMI, and it did not change the results (The associations with both language outcomes were also significant in the unadjusted analysis . There w results .p = 0.02 (Maternal use of iodine-containing supplements in pregnancy was associated with poorer gross motor skills, standardized beta = \u22120.18, 95% CI = \u22120.33, \u22120.03, p = 0.02 .The main finding of this study is that mild to moderate ID during pregnancy may adversely affect neurodevelopment in infancy and toddlerhood. The study population was sufficiently large to conclude that the median UIC indicates insufficient iodine intake in this population of pregnant women in Norway . This isWe found that an insufficient iodine intake in pregnancy, reflected in a UIC below ~100 \u00b5g/L, was associated with lower infant language skills up to 18 months. This accords with studies in older children and suggests that inadequate iodine intake in pregnancy has consequences already in early in life. In the ALSPAC study, Bath et al.  found thWhy we see an effect on language skills but not cognition is unclear, and further data are needed. A substantial body of research points to many interrelations between language development and cognition . It may The associations we explored in this study were similar, but no longer statistically significant when UIC was adjusted for creatinine. Creatinine adjustment is commonly used to remove variation in UIC due to hydration status. However, including creatinine in the estimation of the exposure variable might also introduce bias since creatinine excretion is not constant between individuals, but vary with e.g., age, BMI, muscle mass/fitness level, and gestational age . ConsequWe did not find evidence of a protective effect of iodine supplement use in pregnancy. On the contrary, maternal iodine supplement use was associated with lower infant gross motor skills. This finding may be due to chance since we did not control for multiple comparisons. Since only 18% of the participants reported use of iodine-containing supplements, there was limited power to detect differences between the groups. We assessed iodine supplement use over the past three months before the first UIC and it covered primarily the second trimester. Ideally, we should have had data from before pregnancy and in the first trimester. Consequently, it cannot be ruled out that iodine supplement use was initiated too late to counteract the detrimental impact of inadequate maternal iodine status in the most critical time of fetal brain development. Results from studies of iodine supplement use in pregnancy in areas of mild- to moderate ID show conflicting results, and more research is needed . Our finA major strength of this study is the relatively large study population with data on UIC, the repeated measures of individually administered assessment of infant neurodevelopmental outcomes, and the minimal loss to follow up. An important limitation to the study is the use of a single spot-UIC which is not regarded as a good measure of iodine status at an individual level and thus it limits the statistical power when exploring associations to outcomes ,42,43,44This study provides supporting evidence that mild to moderate ID in pregnancy impairs brain development and should be prevented. Reduced communication skills can influence the child\u2019s possibilities to obtain information about the environment and is an early predictor of later school performance and IQ . ConsequThis study provides further evidence for a potential negative impact of insufficient iodine status in pregnancy on child neurodevelopment. The results showed that the tipping point for adverse developmental outcomes was UIC ~100 \u00b5g/L. Furthermore, we found no indication of a protective effect of iodine-containing supplements used in pregnancy, however, RCTs are needed to elucidate the impact of iodine supplement use. Preventing mild- to moderate ID in pregnant women by securing adequate iodine status before conception is an optimal strategy, since use of iodine containing supplements in pregnancy may be too late to counteract the detrimental effects of inadequate iodine intake."}
+{"text": "Compared to the screening level values worldwide, the HC5 values in this study were higher for Cr(VI) and lower for Cr(III) to some extent. The results provide useful toxicity data for deriving national or local soil quality criteria for trivalent and hexavalent Cr.Chromium (Cr) is one of the most severe heavy metal contaminants in soil, and it seriously threatens ecosystems and human health through the food chain. It is fundamental to collect toxicity data of Cr before developing soil quality criteria/standards in order to efficiently prevent health risks. In this work, the short-term toxic effects of Cr(VI) and Cr(III) on the root growth of eleven terrestrial plants were investigated. The corresponding fifth percentile hazardous concentrations (HC Both oxidation states are excessively released into the environment due to a variety of industrial applications and anthropogenic activities, such as mining, metallurgy, tanneries, pigment-producing plants, fossil fuel combustion, and chemical fertilizers [psbA and psbO genes, which were responsible for electron transfer and oxygen evolution and directly influenced the photosynthesis and growth of young cocoa plants [Chromium (Cr) is one of the most common heavy metal contaminants in soil, sediments, and groundwater. It occurs in several oxidation states ranging from Crvalent Cr+ and hextilizers ,5,6,7,8.valent Cr+ and hextilizers . For exatilizers . Howevertilizers ,11,12,13a plants ,15.Heavy metal pollutants, such as Cr, have been paid considerable attention because of their toxicity, persistence and biological accumulation, which can generate a serious threat to ecosystems and human health through the food chain. Soil quality criteria are derived based on an upper-limit concentration that shows no undesirable or harmful effects ,17,18. Ip) [5 means a point estimation of the hazardous concentration for 5% of species or the 95% protection level [The species sensitivity distribution (SSD) method is widely used in ecological risk assessment and the development of soil quality criteria. The SSD analysis is based on the statistically cumulative probability distribution of toxicity data for multiple species ,24. One p) . For exaon level ,27. The Lolium Perenne can be ceased due to metal pollution  [Vegetables and wheats are an essential part of a healthy and balanced ecosystem, and their phytotoxicity tests are required for risk assessment and environmental monitoring. Phytotoxicity tests include the effects of a contaminant on seed germination, seedling (shoot and root) development, biomass production or other physiological functions ,29. It w and Cr) . As a re and Cr) . The aimThe soil sample was collected from Jixian, Tianjin city, without prehistory of Cr contamination. This region was originally developed from the parental material basalt (Alfisol). In the laboratory, samples were air-dried, sieved through a 5-mm mesh, homogenized using a scoop, and then stored in a glass bottle until their use. Basic soil properties were characterized using standard methods  and are 3\u00b76H2O and K2Cr2O7 (>99% purity) were used as Cr(III) and Cr(VI) sources.Analytical grade CrClBrassica rapa chinensis), tomato (Solanum lycopersicum), wheat (Triticum aestivum L.), chili (Capsicum annuum L.), eggplant (Solanum melongena L.), celery (Apium graveolens L.), chive (Allium schoenoprasum L.), lettuce (Lactuca sativa L.), cucumber (Cucumis sativus L.), radish (Raphanus sativus L.), and spinach (Spinacia oleracea L.). Among these plants, pakchoi cabbage, lettuce, spinach and chive are leafy vegetables, tomato, chili and eggplant are solanaceous vegetables, celery is a stem vegetable, and cucumber is a gourd vegetable. All plant seeds were purchased from the Chinese Academy of Agricultural Sciences (located in Tianjin city). Before planting, the plant seeds were pre-treated by sterilizing in 3% H2O2 for 20 min to prevent fungal contamination, washing with sterilized deionized water several times, and then drying softly with tissue (KIMTECH-Clark).Chromium toxicity tests were performed for 11 different crops, including: pakchoi cabbage  and Cr(VI) for test plants are presented in j = rank percentile; i = rank of the data point in the data set; n = total number of data points in the data set.Species sensitivity distribution (SSD) curves were constructed based on short-term toxicity data for 11 terrestrial species. The resulting data were ranked, and the rank percentiles were determined for each data point. Data points with the same concentration were recommended to be assigned separate, sequential ranks, rather than calculating tied ranks . Rank pe10, NOEC (no observed effect concentration), LOEC (lowest observed effect concentration) or MATC (maximum acceptable toxic concentration) were required and fitted to SSD curves. In this study, we determined the SSD curves by both the Slogistic and the Exponential model using software of Origin8.6. The distribution model was fitted to toxicity data points and evaluated with the adjusted coefficient of determination R2; the higher the R2, the better the goodness of fit.Toxicity data such as ECp < 0.05 as significant. EC values and their confidence intervals were calculated by a log concentration-logit effect regression model, as described previously [All statistical analyses were performed by SPSS20.0. Graphs were prepared using Origin8.6. The treatment means were compared using Duncan\u2019s multiple range test (DMRT) and taking eviously .10 and EC20 for pakchoi cabbage were lower than 0.65 mg/kg and 1.13 mg/kg, respectively. For spinach, 10 mg/kg of Cr(VI) led to around 60% root inhibition rate, then the inhibition rate fluctuated when the concentration of Cr(VI) increased further. Wheat had relatively lower sensitivity to Cr(VI) compared to leafy vegetables, and the EC10 and EC20 for wheat were 1.50 mg/kg and 2.25 mg/kg, respectively. By contrast, the solanaceous vegetables, such as chili, tomato and eggplant, showed less sensitivity to Cr(VI), and the root inhibition rate was linearly correlated to Cr(VI) concentration. For example, the Cr(VI) concentration which resulted in a 30% root inhibition rate was lower than 5 mg/kg for all three solanaceous vegetables, and the Cr(VI) concentration which led to a 50% root inhibition rate was around 10 mg/kg. The EC10 and EC20 for solanaceous vegetables ranged around 1.55\u20132.78 mg/kg and 2.61\u20133.71 mg/kg, respectively. Stem vegetables (celery) and gourd vegetables (cucumber) showed the least sensitivity to Cr(VI). The root inhibition rate for celery was not obvious at Cr(VI) concentrations lower than 10 mg/kg. Intrudingly, 10 mg/kg of Cr(VI) supply seemed to enhance the growth of cucumber root. The EC10 and EC20 for cucumber even exceeded 12.83 mg/kg and 16.62 mg/kg, respectively. The effect of Cr(VI) on the root growth of the above plants generally followed the order of pakchoi cabbage > lettuce > chive > wheat > tomato > radish > chili > eggplant > spinach > celery > cucumber. Leafy vegetables  might be the primary affected plants under Cr(VI) contamination, while the root growth of stem vegetables (celery) and gourd vegetables (cucumber) might be insensitive to Cr(VI) contamination.Short-term toxicity tests of Cr(VI) to eleven terrestrial plants indicated by root growth inhibition are shown in 10 and EC20 for pakchoi cabbage and chive ranged around 5.62\u201311.84 mg/kg and 24.21\u201336.56 mg/kg, respectively. By contrast, solanaceous vegetables were less sensitive to Cr(III) compared to other studied species. For example, eggplant was only sensitive to Cr(III) at concentrations lower than 100 mg/kg, and the root growth was less affected above 100 mg/kg of Cr(III). The EC10 and EC20 for eggplant were 16.78 mg/kg and 24.71 mg/kg, respectively. The root inhibition rate of tomato was linearly correlated to Cr(III) concentration, with 200 mg/kg of Cr(III) leading to 30% root inhibition and 500 mg/kg of Cr(III) leading to 50% root inhibition. Among the vegetables studied, the root growth of the gourd vegetable (cucumber) and the root vegetable (radish) showed the least sensitivity to Cr(III). For example, 500 mg/kg of Cr(III) supply led to less than 50% root growing inhibition for cucumber, and 500 mg/kg of Cr(III) supply only led to less than 30% root inhibition for radish. The EC10 and EC20 for radish were 189.10 mg/kg and 328.60 mg/kg, respectively. It is interesting that Cr(III) posed an insignificant impact on the growth of leafy vegetables such as spinach, with 500 mg/kg of Cr(III) supply leading to less than 30% root inhibition, and the EC10 and EC20 were as high as 113.10 mg/kg and 187.20 mg/kg, respectively. Wheat was also insensitive to Cr(III), with 1000 mg/kg of Cr(III) supply leading to less than 50% root inhibition. The effect of Cr(VI) on the root growth of the above plants generally followed the order of pakchoi cabbage > chive > eggplant > celery > tomato > lettuce > chili > cucumber > wheat > spinach> radish. The root growth of leafy vegetables  was easily affected by Cr(III) contamination, while root vegetables  endured high concentrations of Cr(III) contamination.As indicated by our experimental results, the root inhibition rate was positively correlated to Cr(III) concentration, as shown in 10 and SSD-EC20. From each SSD-ECx curve, HC5 and HC10 were numerically derived. The HC5 values based on the EC10 of the eleven plants were 0.60 mg/kg and 4.51 mg/kg for Cr(VI) and Cr(III), respectively. Furthermore, the HC10 values based on the eleven plants were 0.83 mg/kg and 16.98 mg/kg for Cr(VI) and Cr(III), respectively. The HC values for Cr(VI) were far less than Cr(III), indicating the higher toxicity of Cr(VI) to tested plants than Cr(III).The details of formulas and parameters for SSD curves based on the Slogistic and the Exponential model are shown in Irrespective of Cr valence, the root growth of leafy vegetables, such as pakchoi cabbage and chive, was easily affected by Cr contamination. By contrast, the root growth of stem vegetables  and root vegetables  was less affected by Cr contamination. Cr contaminants generally damaged the root architecture of plants by limiting water and nutrient uptake efficiency , and ind10 and EC20 than Cr(III) did  was 0.60 mg/kg, which was lower than that for Cr(III) (4.51 mg/kg), demonstrating that hexavalent Cr compounds were more hazardous than trivalent Cr compounds. It was reported that the uptake mechanisms of Cr(III) and Cr(VI) were quite different, Cr(VI) was immediately converted to Cr(III) in roots by Fe(III)-reductase enzymes [With respect to the Cr valence, the plant root growth was preferably impacted by Cr(VI) than Cr(III), since Cr(VI) produced lower ECIII) did . Accordi enzymes ,39,40, a enzymes ,40. Thus enzymes .Cr speciation and its bio-organism transfer were governed by soil physico-chemical properties and microbial activity. From the southeast coast to northwest inland in China, the major soil types cover red soil, brown soil and cinnamon soil, which are quite different in terms of pH, redox conditions, cation exchange capacity, biological and microbial conditions and co-existing competing cations. These soil types will differ significantly in Cr dynamic reactions and behaviors, including hydrolysis, oxidation, reduction and precipitation ,21, whic5 values of Cr(VI) based on the SSD-EC10 and HC10 of Cr(VI) based on SSD-EC10 in our experiments were higher than the screening level values in Japan, Canada and the United States [5 values of Cr(III) based on the SSD-EC10 and HC10 of Cr(III) based on SSD-EC10 were far less than the standard values of Cr in the other countries [10 was close to acute NOECs or the tested species may be too sensitive to Cr(III). Moreover, the difference in the HC5 values between China and other countries might be attributed to the distribution of different resident species [However, the Soil Environmental Quality Standards of China set the screening level values of Cr as 300 mg/kg for paddy fields and 200 mg/kg for dry land in the pH range of 6.5\u20137.5. These values are comparable to the values for the total Cr of Australia, the Netherlands and Thailand. A total of 200\u2013300 mg/kg of Cr(III) in soil might not poison terrestrial plants, but 200\u2013300 mg/kg of Cr(VI) exposure will pose a harmful impact on bio-organisms. Therefore, it is necessary to derive and formulate screening level values for different Cr oxidation states. d States ,32,44. Hountries ,47,48,49 species ,51. The Soil heavy metal pollution has become a severe global problem. In light of a nationwide soil quality and pollution survey launched between 2006 and 2010 in China, overall 16.1% of soil was polluted, of which 82.2% was inorganic pollution, and Cr exceeding rates were 1.1% . In orde5 values based on EC10 were 0.60 mg/kg for Cr(VI) and 4.51 mg/kg for Cr(III), and the HC10 values based on EC10 were 0.83 mg/kg for Cr(VI) and 16.98 mg/kg for Cr(III). Compared to the screening level values worldwide, the HC5 and HC10 values were higher for Cr(VI) and lower for Cr(III) to some extent. It is recommended that a scientific and practical soil quality standard should be developed to characterize the sensitive species and potential risk acceptors, considering chemical valence and species of target contaminants as well.The root inhibition rates of tested plants were positively correlated with either Cr(VI) or Cr(III) concentrations. Generally, leafy vegetables were the most sensitive plants to Cr contamination in soils, followed by solanaceous and stem vegetables. Gourd vegetables were the least sensitive plants. The HC"}
+{"text": "Serratia sp. and Arthrobacter sp. A mixture of the isolated strains at a ratio of 1:1 was more efficient for biotreatment of pyrene and Cr(VI) than either strain alone; the mixture effectively carried out bioremediation of contaminated water in a hydroponic system mainly through pyrene biodegradation and Cr(VI) reduction. Application of these isolates shows potential for practical microbial remediation of pyrene and Cr(VI) combined water pollution.Pyrene and chromium (Cr(VI)) are persistent pollutants and cause serious environmental problems because they are toxic to organisms and difficult to remediate. The toxicity of pyrene and Cr(VI) to three crops  was confirmed by the significant decrease in root and shoot biomass during growth in pyrene/Cr(VI) contaminated hydroponic solution. Two bacterial strains capable of simultaneous pyrene biodegradation and Cr(VI) reduction were isolated and identified as  PAHs can be easily produced through the incomplete combustion of organic carbon-based substances frequently used in industry, transportation and other anthropogenic activities3. Pyrene is a typical PAH because it is difficult to degrade and can be easily transformed into benzo[a]pyrene (BaP), which is highly carcinogenic. Chromium (Cr), a heavy metal, is a persistent environmental pollutant that is widely used in various kinds of factories, such as textile dyeing, electroplating and wood preservation4. Cr(VI) and Cr(III) are the two main valent forms, but Cr(VI) is highly teratogenic, mutagenic and carcinogenic which results from the generation of reactive oxygen species and non-biodegradability and high solubility, is far more toxic than Cr(III) and frequently exists in untreated industrial effluents5.Pyrene has four fused benzene rings and belongs to the family of polycyclic aromatic hydrocarbons (PAHs), which are ubiquitous environmental pollutants that pose a hazard to aquatic organisms6 showed that PAHs, including pyrene and phenanthrene, had different effects on the growth of emergent wetland plants in hydroponics and soils, increasing or decreasing the growth depending on the specific species and pollutant concentrations. Cr(VI) with a concentration range of 75\u2013100\u00a0\u03bcmol/L significantly decreased the root and shoot biomass of six peanut cultivars, which showed that Cr(VI) within this concentration range inhibited growth and was toxic to peanut7. Combined pollution generally has higher toxicity and is more difficult to deal with than either component alone because of the interaction between contaminants. For example, the joint toxicity of Cr(VI) and BaP had a significant antagonistic effect on the germination rate of Lolium perenne, although BaP in the concentration range of 1\u20134\u00a0mg/L accelerated the germination rate8. Thus, combined Cr(VI) and pyrene pollution was explored here, although some investigations of either component alone have been reported10.Cr(VI) and pyrene are frequently discharged to the environment successively or simultaneously because of their various production pathways; Cr(VI) and pyrene pollution has caused severe environmental problems and influenced the normal growth of different plant species. Zhang et al.12, or pyrene and other pollutants14. However, there has been limited research on Cr(VI) and pyrene combined pollution, apart from that of Wang15, which was focused on remediation of soil contaminated by Cr(VI) and pyrene using biochar alone or in combination with a bacterial consortium. There has been no published study on the bioremediation of water contaminated with combined Cr(VI) and pyrene to date. The aim of this study was to investigate biotreatment of Cr(VI) and pyrene combined water pollution by bacteria to decrease the toxicity of contaminated water on crops grown under hydroponic conditions, and optimize the application of inoculant bacteria for bioremediation of Cr(VI) and pyrene combined water pollution.There has been considerable research conducted on combined contaminants, such as Cr(VI) and phenanthrene or phenolSerratia (GenBank No. MK027123) and Arthrobacter sp. (GenBank No. MK027124), respectively.Bacterial strains were isolated that could grow in MM with pyrene and Cr(VI) and were tested for their ability to degrade pyrene and remove Cr(VI). Two strains, S41 and J122, which had such abilities, were selected for further analysis. 16S rRNA gene sequence analysis indicated that the two strains belonged to Although both stains were able to remove Cr(VI) and biodegrade pyrene simultaneously, they had different optimal conditions for growth and biodegradation/reduction Fig.\u00a0. Strain 9(33), was designed to determine the optimal temperature, pH and inoculation amount for the mixed inoculum. The highest efficiencies obtained were 48.43% removal of 30\u00a0mg/L Cr(VI) within 1\u00a0day, and 67.2% biodegradation of 50\u00a0mg/L pyrene over 7\u00a0days, which was obtained from the experimental combination A1B3C3, where A1 was temperature of 25\u00a0\u00b0C, B3 was pH 9.0, and C3 was inoculation amount of 15.0%  for 10\u00a0days when compared with the control without pyrene or Cr(VI); the shoot and root biomass decreased by 16.9\u201336.4% Fig.\u00a0. When thAfter 10\u00a0days, pyrene and Cr(VI) concentrations were very low in experimental group II, reaching 2.10\u2009\u00b1\u20090.60\u00a0mg/L and 1.30\u2009\u00b1\u20090.44\u00a0mg/L, respectively, while they were 15.81\u2009\u00b1\u20091.72\u00a0mg/L and 18.09\u2009\u00b1\u20090.76\u00a0mg/L, respectively, in group I. Shoot/root biomass of the control 2, that plants were cultivated in nutrient solution with only two bacteria, had no significant differences with that of the control 1 that plants were cultivated in nutrient solution without bacteria (p\u2009<\u20090.05) (Supplementary Table Serratia sp. was previous identified as an effective Cr(VI)-reducer17, and was also able to degrade PAHs, including pyrene18 and BaP19. Cr(VI)-reduction and pyrene-degradation ability have been found in the genus Arthrobacter20. Previous studies showed that Serratia and Arthrobacter sp. could only reduce Cr(VI) alone or degrade pyrene alone. In this work, strains of these two genera were capable of simultaneous Cr(VI) removal and pyrene degradation.22. Zong et al.7 showed that there were positive correlations between total Cr in peanuts and total root length, root surface area, and root volume, and that Cr(VI) at concentrations ranging from 75 to 100\u00a0\u00b5mol/L significantly decreased the root and shoot biomass of peanut. Cr(VI) is a powerful oxidizing agent that can pass through cell membranes and undergo subsequent intracellular reduction to reactive intermediates23. Plant species can take up PAHs primarily through roots and translocate them to various aerial parts; the pyrene concentration in maize roots increased over time, while that in maize shoots decreased24. Mixed contamination with Cr(VI) and BaP was demonstrated to be more toxic than that of BaP alone on seed germination of Lolium perenne. BaP alone (at 1\u20134\u00a0mg/L) could accelerate the germination rate, while the joint toxicity of Cr(VI) and BaP significantly inhibited the germination rate8. Here, the joint toxicity of 20\u00a0mg/L pyrene and 20\u00a0mg/L Cr(VI) decreased the shoot and root biomass of cotton, maize and soybean, which showed that exposure to Cr(VI) and pyrene might be involved in changes in plant physiology and transport capacities.Roots and shoots are important plant organs that can be negatively affected by contacting with heavy metals, such as Cr, cadmium and copper25 showed that major nutrients (nitrogen and phosphorus) and inorganic cations  were removed from a hydroponic system by a microbial consortium and microalgae, which they proposed was related to the potential of photosynthetic microbes for the treatment of waste nutrients. Other pathways and mechanisms, such as biosorption, biodegradation, and reduction, can be involved in pollutant removal. Pyrene catabolism is very difficult because of its complex four-ring structure. It has been hypothesized that most aromatic compounds are first converted to one of several di- or trihydroxylated substrates, such as catechol or proteocatechuate, whose aromatic ring can be enzymatically cleaved26. In bacteria, multiple genes of both catabolic and anabolic pathways are clustered together and co-regulated in operons, such as ben and pca cluster genes28, which are probably involved in pyrene biodegradation.The endophytic bacterium Serratia sp. PW7 successfully decreased pyrene accumulation and pyrene transportation from roots to shoots in wheat because of pyrene biodegradation by this strain18. Li et al.29 showed that Mycobacterium sp. strain A1-PYR degraded pyrene into metabolites that stimulated cell division of the green alga Selenastrum capricornutum; transcriptomic analysis showed that the bacterial pyrene metabolites substantially accelerated protein synthesis at the G1 phase of the algal cell cycle, which suggested a close relationship between bacterial pyrene transformation and the ecological effects of toxic contaminants. Cr(VI) reduction is usually the main pathway of Cr(VI) removal and detoxification process by direct or indirect mechanism30. In the direct mode, chromate reductases, such as ChrR, NfsA, and ChrT, are responsible for reducing Cr(VI) to Cr(III) in bacteria32, whereas reductants or oxidants detoxify Cr(VI) in indirect mechanism4. If Cr(VI) is reduced to Cr(III) extracellularly, this form of the metal is not readily transported into cells and so toxicity is not observed23. Microbes and plants sometimes become a symbiotic relationship which can help plants to become resistant to Cr(VI) toxicity. Bacillus subtilus MAI3 and PAW3 could produce antioxidants, also B. subtilus PAW3 generated substantial amounts of plant growth promoting substances, while they reduced Cr(VI)34. Both Cr(VI) reduction and improvement in cowpea or soybean growth were responsible for growth of plants under Cr(VI) stress. The two strains in this work had no such obvious influence on the growth of cotton, soybean and maize as demonstrated by the comparison of control 1 and control 2 in the hydroponic experiment. Because these crops were cultivated in nutrient solution in the control 1, while, cultured in nutrient solution with addition of the mixed strains in the control 2, and there is no significant difference of shoot/root biomass between the two groups. In the hydroponic culture of cotton, soybean and maize, the shoot and root biomass decreased when these crops were exposed to pyrene and Cr(VI), and then partly recovered because of decreased toxicity of pyrene and Cr(VI) because of pyrene biodegradation and Cr(VI) reduction by the mixed bacterial inoculant, not because of plant-growth-promoting function of the bacteria. The mixed inoculant showed potential for bioremediation of pyrene and Cr(VI). Due to toxicity of the pollutants and important use of crops, one of the future work will be that Cr(VI), pyrene and its transformed product benzo[a]pyrene (BaP) are further needed to detect in the plants tissues before use of the biomass in food and clothing etc., in order to prevent that probably Cr(VI) and/or BaP may have been translocated to the maize, soybean and cotton, and reach subsequently human beings.Microbial consortia can be responsible for removing certain substances from water. Lee et al.2SO4, 0.2\u00a0g MgSO4\u00b77H2O, 0.2\u00a0g CaCl2, 0.5\u00a0g NaH2PO4, 0.5\u00a0g K2HPO4, 0.2\u00a0g NaCl, and 0.01\u00a0g FeSO4 per liter, and the solid medium used to make agar plates was prepared as above with 1.5% agar powder. Knop solution was used as the nutrient solution to cultivate the crops35, and its composition was listed in Supplementary Table 2Cr2O7 and pyrene, were of at least analytical reagent grade. K2Cr2O7 solution with the concentration of 50\u00a0g/L was obtained via dissolving K2Cr2O7 in sterile water.Luria\u2013Bertani (LB) medium was composed of 10.0\u00a0g/L tryptone, 5.0\u00a0g/L yeast extract, and 10\u00a0g/L NaCl; the pH was adjusted to 7.0 with NaOH. Mineral salt medium (MM) consisted of 1.0\u00a0g (NH4)2Cr2O7 and 50\u00a0mg/L pyrene were purified several times by streaking to single colonies on selective plates. Genomic DNA was extracted from two isolated bacterial strains; bacterial universal primers (5\u2032-AGA GTT TGA TCC TGG TCA GAA CGC T-3\u2032 and 5\u2032-TAC GGC TAC CTT GTT ACG ACT TCA CCC C-3\u2032) were used as primers to amplify 16S rRNA gene fragments from the isolated genomic DNA as previously described36. The 16S rRNA gene sequences were determined and the strains were identified through comparison of their 16S rRNA gene sequences with known database sequences accessed through the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/).Bacteria were isolated from soil and water samples that were collected from sites near electroplating facilities, tannery factories, garages and petrol stations in Wenzhou, China. Strains that could grow on MM agar plates containing 10\u00a0mg/L K600) was 1.5. An aliquot (0.5\u00a0mL) of the original culture was inoculated into 50\u00a0mL MM medium containing 30\u00a0mg/L K2Cr2O7, 50\u00a0mg/L pyrene and 50\u00a0g/L glucose as the carbon source for initiation of the experiment. The culture was aerobically incubated at 30\u00a0\u00b0C with shaking at 160\u00a0rpm for 7\u00a0days to determine the ability of the isolate to simultaneously remove Cr(VI) and biodegrade pyrene. An aliquot (1.5\u00a0mL) of the culture medium was withdrawn on day 3 and used to measure the residual Cr(VI) with the 1,5-diphenylcarbazide method as previously described37. After 7\u00a0days, the residual pyrene was extracted from each mixture; the extracted pyrene was analyzed by high performance liquid chromatography  using a C18 Waters column (4.6\u00a0mm\u2009\u00d7\u2009150\u00a0mm) with a mobile phase of 90% methyl alcohol and 10% water at a flow rate of 1.0\u00a0mL/min37.Strains were grown in LB liquid medium overnight until the optical density at 600\u00a0nm  removal and pyrene degradation. Then the best ratio was selected based on the highest efficiency.39 because it is an efficient process when compared with traditional experimental design. Here, based on the results of single factor analysis (data not shown), the orthogonal experiment, L9(33), involving three factors, namely, the temperature, pH and inoculation amount, was designed to determine the optimal conditions for pollutant removal by the mixed strains , soybean (Glycine max (Linn.) Merr.) and maize (Zea mays ssp. mays L.) were used in this study. Seeds of each species were soaked in water for 24\u00a0h, and then pretreated with 30% H2O2 solution and rinsed with sterile water. Seeds that wrapped up by damp gauze were cultivated in petri dishes until their roots were about 2\u00a0cm long, and then the seeds without gauze were transferred and cultivated in damp sand. When the roots reached approximately 3\u00a0cm in length, the crops were transferred into the nutrient solution for the hydroponic experiment40. For each species, 30 seeds were cultivated, and almost all of them can grow roots, but their root lengths were a little different. Finally, 20 seeds of each species, having the roots with approximately 3\u00a0cm in length, were selected from that above 30 seeds, and used for the next hydroponic experiment.Cotton (600 of 1.5). Experimental group III was the control, which contained nutrient solution alone. Another control group (named control 2) that plants were cultivated in the nutrient solution with only mixed strains was prepared for comparison. Each group was prepared with five replicates.Three groups of experiments were designed as follows. Experimental group I contained nutrient solution with Cr(VI) and pyrene at final concentrations of 20\u00a0mg/L of each. Experimental group II contained nutrient solution with 20\u00a0mg/L Cr(VI) and 20\u00a0mg/L pyrene; the nutrient solution was also inoculated with the mixed strains at 15%  in the nutrient solutions were analyzed.All groups were placed into the same incubator for 10\u00a0days. The plants were cultured under daytime conditions of 30,000\u00a0lx at 30\u00a0\u00b0C for 13\u00a0h, and nighttime conditions without light exposure at 25\u00a0\u2103 for 11 hAll statistical tests were performed using SPSS 20.0 software (p\u2009<\u20090.05). One-way analysis of variation (ANOVA) and Duncan multiple comparison were used to determine significant differences of shoot and root biomass among different groups in hydroponics, and also show differences of Cr-removal/pyrene-degradation efficiencies of mixed strains with different ratios.Supplementary Information."}
+{"text": "Chromium (Cr) (VI) is a well-known toxin to all types of biological organisms. Over the past few decades, many investigators have employed numerous bioprocesses to neutralize the toxic effects of Cr(VI). One of the main process for its treatment is bioreduction into Cr(III). Key to this process is the ability of microbial enzymes, which facilitate the transfer of electrons into the high valence state of the metal that acts as an electron acceptor. Many underlying previous efforts have stressed on the use of different external organic and inorganic substances as electron donors to promote Cr(VI) reduction process by different microorganisms. The use of various redox mediators enabled electron transport facility for extracellular Cr(VI) reduction and accelerated the reaction. Also, many chemicals have employed diverse roles to improve the Cr(VI) reduction process in different microorganisms. The application of aforementioned materials at the contaminated systems has offered a variety of influence on Cr(VI) bioremediation by altering microbial community structures and functions and redox environment. The collective insights suggest that the knowledge of appropriate implementation of suitable nutrients can strongly inspire the Cr(VI) reduction rate and efficiency. However, a comprehensive information on such substances and their roles and biochemical pathways in different microorganisms remains elusive. In this regard, our review sheds light on the contributions of various chemicals as electron donors, redox mediators, cofactors, etc., on microbial Cr(VI) reduction for enhanced treatment practices. Chromium (Cr) is a pervasive toxin that inhabits almost every component of the environment including aerial, terrestrial, aquatic, and biological systems . The nea4\u2013, CrO42\u2013, or Cr2O72\u2013 after reacting with oxygen (2) availability, and the presence of organic matter and manganese oxides (MnO2) (The toxicity of Cr relies upon its oxidation states. Among commonly occurring states of Cr(0), Cr(III), and Cr(VI), the last species is viewed as more toxic than any other species . Cr(VI) h oxygen . The bios (MnO2) . Cr specs (MnO2) . Cr(VI) s (MnO2) . Furthers (MnO2) .Cr(VI) displays genotoxic, carcinogenic, teratogenic, and mutagenic effects along with epigenetic profile silencing . As per Removal of Cr(VI) from the environment is challenging. There are many methods such as ion exchange, electrochemical precipitation, solvent extraction, membrane separation, evaporation, foam separation, ultrafiltration, electrodialysis, cementation, biosorption, and reduction . HoweverSeveral different microorganisms have adopted various strategies to counter-effect the toxicity of Cr(VI). Among different methods, enzymatic reduction of Cr(VI) into Cr(III) by microorganisms is the best characterized mechanism for its bioremediation . All Cr. The cat2O2)  reduction activities can occur at extracellular, cell membrane, and intracellular locations in aerobic and anaerobic conditions . Extrace2O2) .The enzymatic reduction of Cr(VI) to Cr(III) can also yield variable concentrations of ROS, which may or may not involve in the formation of reactive intermediates . HoweverIn general, electron donors release electrons during cellular respiration accompanied by the release of energy. But such cellular reaction in microorganisms also enables biological treatment by providing electrons to Cr(VI) . Even suAlishewanella sp. possessed Arg13 and Gly113 residues for the cobinding of NAD(P)H and Cr(VI) (Gluconacetobacter hansenii (Gh-ChrR) induced structural rearrangement of active site during the binding of chromate anion and NADH. With this rearrangement, both species could bind simultaneously for efficient enzyme cycling, of which binding site otherwise overlapped with the electron donor (The most common electron donors for Cr(VI) reduction are organic molecules, although reports on inorganic matters as reducing equivalents also exist . Usuallyd Cr(VI) . Anotheron donor . Also, mPannonibacter phragmitetus LSSE-09 promoted Cr(VI) reduction more in presence of acetate, lactate, and pyruvate rather than glucose  in presence of lactate than many other electron donors. Metabolic analyses of strain BB elucidated that the presence of Cr(VI) upregulated pyruvate dehydrogenase and lactate dehydrogenase, and these dehydrogenases preferentially transferred the cellular electrons to extracellular Cr(VI) over other electron acceptors  removal was basically associated with the breakdown of carboxylic acids. However, lactate as an electron donor also causes a significant abiotic Cr(VI) reduction due to the formation of a lactate\u2013Cr(VI) complex or sodium lactate syrup that functions as a non-specific reductant  reduction  reduction in reports of  glucose . Anothercceptors . In anoton donor . Lactateon donor . Bill eteductant . Fungal eduction . Howevereduction . Nevertheduction . In an ieduction . The plaeduction . Occasioeduction . AerobicPseudomonas aeruginosa CCTCC AB91095 offered simultaneous removal of phenol and Cr(VI), where the degradation of the former compound supported Cr(VI) reduction (Brevibacterium casei employed azo dye acid orange 7 (AO7) as an electron donor for Cr(VI) reduction by coupling with dye decolorization under nutrient-limiting conditions  reduction is species-dependent, and the reduction rate in specific microorganisms also varies for different sources . The ele4) as dual electron donors involving microbial consortia of autohydrogenotrophic bacteria , CH4\u2013metabolizing microorganisms , and heterotrophic Cr(VI) reducers  promoted Cr(VI) reduction in different bioreactors (2) or CH4 as an individual electron donor also persists, but the capacity of removal is limited in different aspects (4-based membrane biofilm reactor (MBfR), metagenomics analysis showed that oxidation of CH4 by a sole anaerobic methanotroph, Candidatus \u201cMethanoperedens,\u201d in the biofilm was responsible for Cr(VI) reduction , Se(VI), and SO42\u2013 reduction (Thiobacillus or Ferrovibrio) could be utilized by Cr(VI) reducer . Another sulfur-based mixotrophic Cr(VI) reduction process involved autotrophic sulfur oxidation and heterotrophic chromate reducing bacteria such as Desulfovibrio and Desulfuromonas  and also facilitated the reduction of the reoxidized Cr(III)  promoted Cr(VI) reduction by Cr(VI) reducers  coupled with hydrogen-oxidizing bacteria  and CH4-oxidizing bacteria   reduction process . The outreactors , 2021. H aspects . In a CHeduction . Anothereduction . In otheuromonas . The cou Cr(III) . Recentlnosaeta) .Cellulomonas strain Lsc-8 in an MFC to reduce Cr(VI), and generated electricity simultaneously  might often impede with enhanced Cr(VI) reduction (Microbes are further known to utilize composite matters or combinations of donor compounds for Cr(VI) reduction . Abundananeously . Emulsifaneously . EVO beianeously . EVO hasaneously . Likewisaneously . Molasseaneously . Also, taneously . The pheaneously . Complexaneously . Possiblaneously . Also, teduction . But theeduction .Extracellular reduction may require some passage capacity for intracellular reducing equivalents to approach exterior Cr(VI). Such pathway raises the value of electron mediators (or electron shuttle) for reduction outside the cell . MediatoCellulomonas sp., Shewanella oneidensis, and Geobacter sulfurreducens (2 produced from hydrolysis and fermentation of carbohydrate and protein supplied electrons for reduction (5H5NO2), also accelerated the bioreduction process in presence of high Cr(VI) concentration by P. phragmitetus BB  reduction, where different EPS components such as polysaccharides, proteins, and humic substances exhibited dissimilar electron transfer rates  reduction belong to a diverse range of organic compounds of foreign origins and endogenous metabolism and can involve some heavy metals . Often oreducens . This asreducens . In anoteduction . Variouseduction . Anothertetus BB . Intereser rates . Furtherer rates . Simultaer rates . Some heproaches . Wang etEscherichia coli BL21, complying 98.5% Cr(VI) reduction, whereas the presence of \u03b1-AQS, 1,5-AQDS, AQDS, and 2,7-AQDS could enable only 21\u201334% metal reduction  reduction , where the outer membrane decaheme cyt c molecules, MtrC and OmcA, played major roles in the transfer of electrons to Cr(VI) on the cell surface using electron shuttles (Different mediator compounds have shown different electron transfer competence for Cr(VI) reduction . For exaeduction . AnotherS > AQDS . Even maS > AQDS . In diffS > AQDS . The suieduction . The eleeduction . In S. oshuttles .Mangrovibacter plantisponsor. Additionally, many previous MFCs have developed synthetic conductive polymers such as polypyrrole/9, 10-anthraquinone-2-sulfonic acid sodium salt, Si-carbide derived carbon cathode, rutile-modified polished graphite rod, etc., as insoluble redox mediators for improved concurrent Cr(VI) removal and bioelectricity production (Immobilization of redox mediators onto different substances for Cr(VI) reduction has also received attention for their better stability, reusability, and persistence. Moreover, lessening the toxic effects of mediator compounds on microbes by their immobilization is also evident . Lian etoduction . Table 3Amphibacillus sp. KSUCr3  reduction from 64.5 to 92.8% after addition of As(III) within 7 days of incubation  reduction by improving cell growth in some species , which accelerated Cr(VI) reduction  reduction by Pseudomonas brassicacearum LZ-4  reduction capacities. This was attributed to increased production of cyclic adenosine 3\u2032,5\u2032\u2212monophosphate (cAMP) and cAMP-receptor protein system, which enhanced the gene expression of c\u2212type cytochromes and flavins synthetic pathways for Cr(VI) reduction  reduction also exists. A variety of chemical affluences acquires diverse mechanisms to advance Cr(VI) reduction process. Even some electron donors and mediators have enhanced Cr(VI) reduction involving other procedures. For examples, heavy metals such as Cu(II), As(III), and Fe(III) that acted as shuttles to accelerate Cr(VI) reduction activity have also upgraded reduction performance by some other effects. Few bacteria recognized Cu as a protective agent for oxygen-sensitive chromate reductase in Cr(VI) reduction . This me. KSUCr3 . However. KSUCr3 . A membrre to Cu . Also, tolyticus . Likewisise 60 h . This incubation . In thiscubation . Howevercubation . Both Crcubation . Also, tcubation . Additioell wall . Amendmeentified . Even a entified . The stientified . The anientified . Another species . In a dieduction . NO3\u2013-N rum LZ-4 . In anotrum LZ-4 . Adenylaeduction . Similareduction . The enh2, Fe, Mn, nitrate, etc., which can variably shift the movement of electrons . Often local physicochemical characteristics present different challenges for the effectiveness of the reduction reaction. For example, reduction of Cr(VI) in contaminated environment can be influenced by the presence of different electron acceptors including Olectrons .Acidovorax in a batch bioreactor, and the intermediate microbial physiological constituents, VFAs, released from mineral bio-oxidation, could enable the shuttle of electrons to Cr(VI) involving a reducer like Geobacter. In an up-flow anaerobic sludge bed reactor, the population of genus Trichococcus greatly increased toward the operation period of Cr(VI) reduction using anaerobic sludge, which mainly attributed to fermentation of organic complexes to be available as electron donors, where genera like Desulfovibrio, Ochrobactrum, and Anaerovorax were the main Cr(VI) reducers (2) and CH4 produced in MEC can serve as electron donors for Cr(VI) bioreduction involving synergism of autohydrogenotrophic genus, CH4-metabolizing microorganisms and Cr(VI) reducers  reduction (Pseudomonas sp. (RPT) revealed enhancement of Cr(VI) reduction after biostimulation of neem (Azadirachta indica) oil cake (NOC), and the application of NOC further improved soil enzyme properties (reducers . Anaerobreducers . A largereducers . Additioreducers . The bioreducers . Elevatereducers . Yang eteduction . Treatmeoperties . Habituaoperties .In situ amendment of AQSD shifted dynamic state of non-equilibrium transformation of Cr toward accelerated Cr(VI) reduction and inhibited Cr(III) oxidation in contaminated soil , acetate, and propionate to complete mineralization by serving as electron donors for Cr(VI) reduction. In another study, amendment of organic matter followed by bioaugmentation with a consortium of actinobacteria greatly influenced the Cr(VI) reduction in soil  bioremediation.The perplexing task of removing Cr(VI) contamination from the environment has led to the development of various bioremediation approaches, particularly the proficient reduction strategies by microorganisms. However, the high efficiency of large-scale microbial Cr(VI) reduction can be limited by the availability of various chemical factors, mainly electron donors, mediators, and cofactors. The oxidation of many suitable chemicals (as electron donors) enables supply of electrons to Cr(VI) to facilitate enhanced reduction. The use of composite matters or combinations of chemical compounds as electron donors grants additional benefits for large- scale application, considering economic aspects. Presence of mediator molecules takes part in improvement of the dynamics of bioreaction. Moreover, several chemicals achieve merits for Cr(VI) bioreduction involving diverse roles other than electron donors and electron mediators. Very often the information on aforementioned chemicals supports their employment for in situ applications. Although aforementioned facilities for Cr(VI) bioreduction also exist in environment through natural attenuation at limited efficiencies, in-depth understanding of the governing procedures can device commercial exploitation of the processes for enhanced removal approaches. Therefore, there is a necessity for developing eco-biotechnological schemes that could use unexploited potential of the natural ecosystems for remediation of Cr(VI) contaminated environment. Several key points important to successful application of chemical additives for improved Cr(VI) bioreduction are as follows:Chemical-assisted microbially mediated Cr(VI) reduction is sustainable only when the chemical dosages are low. Otherwise, their high concentrations may cause secondary pollution, impede the ecofriendly approach, and lose prospect of preserving the natural resources particularly for \u2022Identification of novel microbial isolates with better reduction capacity from different environmental samples and their enhanced reducing activity under various chemical affluences are foreseen.\u2022New knowledge of diverse and specific reduction mechanisms involving chemical consolidation can be constructive in devising effective Cr(VI) treatment.\u2022The choices of appropriate chemical sources as electron donors, mediators, and cofactors for different microorganisms are important to be recognized.\u2022Identification of green chemicals for the stimulation of Cr(VI) bioreduction is highly desirable considering the sustainability of ecofunctioning.\u2022Employment of indigenous chemicals as the substitute for foreign substances may provide better compatibility for the treatment of the contaminated system.\u2022Employment of wastes generated from other industries may contribute as the cheap alternatives for the Cr(VI) reduction process.\u2022The electron-donating abilities of different electron donors from composite matters are subject too difficult to analyze, but such integration to biological Cr(VI) reduction for large-scale application and economical virtue states matter.\u2022The capacity of utilizing endogenous microbial metabolites for reduction process is also rational.\u2022Chemical integration of donor and mediator compounds often implicates a complex system for Cr(VI) reduction, involving various pathways and processes and multilevel interactions. Such phenomena are also needed to be addressed in-depth.\u2022The involvement and interaction of numerous compounds by microbial synergy in different intricate pathways have received little attention and therefore warrant further investigations.\u2022The regular monitoring of microbial growth and Cr(VI) reduction for the treatment of specific chemical utilized for the process is crucial. Moreover, the parameter of soil enzyme activities of the native microbial flora should also be analyzed to identify the various effects of chemical additives.\u2022The role of many chemicals on Cr(VI) bioreduction is poorly understood, and their characterization relies mainly on past studies. For the same, advanced \u201comics\u201d technology can add more sight on their specific involvements.\u2022Variously, genetic manipulation of certain genes of different bioreducers can also empower the microbial ability to exploit various chemical affluences for enhanced Cr(VI) removal.Both authors of this manuscript have made equal contributions to writing, formation of tables and diagrams, editing, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Klebsiella sp. via 16S rRNA sequencing. In Luria\u2013Bertani broth, the relative reduction level of Cr(VI) was 95%, but in tannery effluent, it was 63.08% after 72 h of incubation. The cell-free extract of SH-1 showed a 72.2% reduction of Cr(VI), which indicated a higher activity of Cr(VI) reducing enzyme than the control. Live and dead biomass of SH-1 adsorbed 51.25 mg and 29.03 mg Cr(VI) per gram of dry weight, respectively. Two adsorption isotherm models\u2014Langmuir and Freundlich\u2014were used for the illustration of Cr(VI) biosorption using SH-1 live biomass. Scanning electron microscopy (SEM) analysis showed an increased cell size of the treated biomass when compared to the controlled biomass, which supports the adsorption of reduced Cr on the biomass cell surface. Fourier-transform infrared analysis indicated that Cr(VI) had an effect on bacterial biomass, including quantitative and structural modifications. Moreover, the chickpea seed germination study showed beneficial environmental effects that suggest possible application of the isolate for the bioremediation of toxic Cr(VI).Chromium (Cr) (VI) has long been known as an environmental hazard that can be reduced from aqueous solutions through bioremediation by living cells. In this study, we investigated the efficiency of reduction and biosorption of Cr(VI) by chromate resistant bacteria isolated from tannery effluent. From 28 screened Cr(VI) resistant isolates, selected bacterial strain SH-1 was identified as  Wastewater from industrial applications contain potentially toxic metals and anonymous organics that cause alarming environmental pollution worldwide ,2. DespiThere are about 250 leather tanning industries at Hazaribagh and Hemayetpur in Dhaka city, the capital of Bangladesh, which discharge liquid and solid wastes into canals and rivers, thus increasing the amount of Cr in the surrounding water bodies ,6,7,8. HAs Cr(VI) is toxic and highly soluble in water, it can pass rapidly through cell membranes and eventually interact with proteins and nucleic acids . Thus, tAcinetobacter and Ochrobactrum [Arthrobacter [Serratia marcescens [Bacillus spp. [Cellulomonas spp. [Pseudomonas fluorescens LB300; Intrasporangium sp. Q5-1; Enterobacter cloacae; Bacillus sp. ES29; and E. coli [Therefore, it is of the utmost importance to treat these effluents they are discharged into the environment in order to reduce environmental pollution and the disease burden ,6. Numerobactrum ; Arthrobrobacter ; Serratircescens ; Bacillulus spp. ; Cellulonas spp. ; Pseudom E. coli ,33,34,35 E. coli  can reduThe application of microbes for bioremediation of heavy metals and other contaminants has been studied in other countries  but yet 2Cr2O7, NiCl2.6H2O, Pb(NO3)2, Co(NO3).6H2O, ZnCl2, CdCl2, and CuSO4.5H2O were obtained from Sigma-Aldrich . MnCl2 was purchased from Fisher Scientific . All stock solutions were stored in amber glass bottles in a dark environment. Chickpea seeds were obtained commercially from the retail market in the Dhaka city, Bangladesh.Chemicals and reagents used in this study were American Chemical Society (ACS) analytical grade unless stated otherwise. American Society for Testing and Materials (ASTM) type 1 deionized water (resistivity of 18.2 M\u2126-cm) was used for all experiments supplied from Ultrapure Water Purification Systems . Next, 1,5-diphenyl carbazide, NADH, KThe sampling site was selected based on the specific industrial area, where approximately 250 tannery industries were located [Tannery effluents from 14 tannery industries were taken in wide-mouth  sterilized bottles from the nearby drain, close to the discharging outlet, from October to November 2017. In total, 500 mL of an effluent sample was collected for isolation and characterization of Cr(VI) resistant and reducing bacteria. We followed standard methods for collecting, processing, and measuring chemical and physicochemical parameters . PhysicoVibrio cholerae was found to be sensitive (can tolerate up to 100 mg/L Cr(VI); g for 5 min, and supernatants were used to estimate remaining Cr(VI) concentration in the medium. Interestingly, SH-1 showed the highest rate (97%) of reduction (Vibrio cholerae). The primary screening for Cr(VI) resistant bacteria showed that the organism with higher resistance had a higher reduction capacity. This intriguing finding leads to studying the mechanism of the reduction and possible application for bioremediation.We screened for Cr(VI) resistance and reduced bacteria following the procedure shown in eduction d. After \u00ae SV Gel and a PCR clean-up system  and used for Sanger dideoxy sequencing. The sequencing was performed in 1st Base Laboratories  and the generated sequence was submitted to the Genbank/National Center for Biotechnology Information (NCBI) database. BLAST analysis was conducted to identify close phylogenetic relatives to identify isolated bacterium [The selected bacterial isolate was morphologically characterized, based on microscopic observation. Then, the bacterial genomic DNA was extracted according to the manufacturer\u2019s instruction using Maxwell 16 automated DNA extractor . The 16S rRNA was amplified by conventional Polymerase Chain Reaction (PCR) using a universal primer set for bacteria: 27F (5\u2032-AGATTTGATCMTGGCTCAG-3\u2032) and 1492R (5\u2032-TACGGYTACCTTGTT ACGACTT-3\u2032) . The ampacterium . Then, tacterium .Vibrio cholerae was used as a Cr(VI) sensitive organism (negative control). For each bacterial isolate, a 10 mL medium was taken in a sterilized falcon tube and inoculated with 20 \u00b5L of overnight grown inoculum. The cultures were incubated at 37 \u00b0C in a shaker at 120 rpm. An aliquot of culture was taken out at regular intervals from 0 h to 24 h. Absorbance was measured at 600 nm.The optimum temperature and pH for the growth of the isolate was determined according to the procedure described elsewhere . The effE. coli ATCC 25922 susceptible to all drugs were used for AST in each Vitek testing step for quality control. The 21 antibiotics tested included amikacin, amoxicillin/clavulanic acid, ampicillin, cefepime, cefixime, cefoperazone/Sulbactam, ceftazidime, ceftriaxone, cefuroxime, cefuroxime axetil, ciprofloxacin, colistin, ertapenem, gentamicin, imipenem, meropenem, nalidixic acid, nitrofurantoin, piperacillin, tigecycline, and trimethoprim/sulfamethoxazole. Minimum inhibitory concentration (MIC) of the isolate was interpreted as susceptible, moderate, or resistant based on CLSI guidance requirements. Isolate SH-1 was resistant only to ampicillin and sensitive to all other groups of antibiotics (Antibiotic susceptibility testing (AST) of the isolate was performed using the VITEK-2 system with VITEK 2 cards (AST-N280) for 19 antimicrobial agents according to the manufacturer\u2019s recommendations and two additional antimicrobial agents (cefixime and ceftazidime) were incorporated. Then the Vitek susceptibility results were concluded according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI). ibiotics .6+ > Pb2+ > Mn2+ > Ni2+, Cu2+, Co2+ > Zn2+, Cd2+  and increased the concentration (50 to 2000 mg/L) of the respective metals to determine the heavy metal resistance of bacterial isolate SH-1. Sterilized falcon tubes containing 10 mL LB medium with increasing concentration of respective metal ions were inoculated with 20 \u03bcL young bacterial cultures subsequently incubated in a rotary shaker incubator at 37 \u00b0C for 48 h. Then, droplets of 100 \u03bcL from respective test tubes were inoculated onto nutrient agar (NA) medium and incubated at 37 \u00b0C for 24 h. After this incubation period, the presence or absence of microbial growth concerning their heavy metal resistance ability was determined. The resistance pattern for heavy metals of the isolate was Cr2+, Cd2+ e. 2Cr2O7 was inoculated with 20 \u03bcL of the selected young bacterial suspension. Cultures were incubated at 37 \u00b0C with 120 rpm. Then, 1 mL of the culture was taken after 24, 48, and 72 h. It was then centrifuged at 11,000\u00d7 g for 5 min and the supernatant was analyzed for the residual Cr(VI) using the 1,5-diphenyl carbazide method [The ability of bacterial isolate SH-1 to reduce Cr(VI) was examined in a sterilized 125 mL Erlenmeyer conical flask. LB broth media (25 mL) with added Cr(VI) concentration of 100 mg/L as Ke method . To veriThe efficiency of the bacterial isolate to reduce Cr(VI) in LB broth, as well as in surface water containing Cr(VI), were tested according to the method described elsewhere . In thisV. cholerae) were grown in 10 mL LB broth for 48 h at 37 \u00b0C in a rotary shaker incubator with chromium (10 mg/L) and without chromium. Cell harvesting was performed by centrifugation at 11,000\u00d7 g for 5 min. Pellets were individually washed twice with 10 mM phosphate buffer (pH 7.2) and stored at \u221220 \u00b0C. Then, B-PER bacterial protein extraction reagent with lysozyme and DNase 1  were used for cell lysis on ice. The remaining lysates were centrifuged at 11,000\u00d7 g for 5 min at 4 \u00b0C and the supernatants were collected separately to use as a crude cell extract. From the crude extracts, protein concentrations were measured using the modified Lowry Protein Assay Kit . Chromate reductase activity of this soluble proteins was examined as described elsewhere [V. cholerae acted as a negative control. After 12 h of incubation at 37 \u00b0C, Cr(VI) reduction was assessed according to the 1,5 diphenyl carbazide method [The bacterial isolates  concentration using the 1,5 diphenyl carbazide method [The preparation of live and dead cell dried biomass was performed as described earlier ,45. A bae method . Q = capacity of Cr ion uptake (mg/g), V = adsorbate volume (L), iC = the initial concentration of Cr in solution before the sorption analysis (mg/L), fC = final concentration of Cr in solution after the sorption analysis (mg/L), and M = Dry weight of biosorbent (g). The 1,5-diphenyl carbazide method using a UV-vis Spectrophotometer , was used to determine the initial and final concentration of Cr(VI) following the procedure described elsewhere . The forAdsorption study with two of the most popular isotherm models\u2014Langmuir and Freundlich\u2014were carried out by mixing 10 mg of biosorbents with various concentrations of Cr(VI) ion solution ranging from 50 mg/L to 200 mg/L under the predetermined parameters above ,49,50,51The parameters of the Langmuir adsorption model were transformed into the following form:LR, and the separation factor are a dimensionless constant in Langmuir isotherm used to describe the adsorption nature of Cr(VI) [The equilibrium parameter, f Cr(VI) .(4)RL=1The Freundlich model is suitable for the heterogeneous surface of sorbents to define the adsorption characteristics : Qe = Kff indicates approximate adsorption capacity; Ksorption .1 (min\u22121) and K2 (g/mg min) = rate constants of the respective kinetic models qe = sorption capacities at equilibrium (mg/g) qt = sorption capacities at time t (mg/g).The kinetic study suggests the efficiency of the biosorbent and also explains the characteristics of the adsorption process for its effective application . A kinetSEM and energy dispersive X-Ray (EDX) analyses were conducted to analyze the effect of Cr(VI) on bacterial biomass morphology. The bacterial biomass was mixed with 10 mL volume of Cr(VI) solution (100 mg/L) at pH 2.0. After 6 h of absorption, pellets were separated and washed twice with double deionized water. Then, the pellets were dried with a critical point dryer (CPD) and platinum-coated ion sputter coater , and examined under a SEM (JEOL JSM-7610F) to observe the morphological changes in the bacterial biomass after biosorption. Bacterial dried biomass without subjected to Cr(VI) was used as the control. \u22121 [The functional groups on the cell surface responsible for the adsorption of chromium was identified by Fourier transform infrared spectrometric (FTIR) analysis. The bacterial biomass was mixed with 10 mL of Cr(VI) solution (100 mg/L) at pH 2.0. After 6 h of absorption, pellets were separated and washed twice with double deionized water. Then, the pellets were dried with air oven drier. Dried Cr(VI) treated biomass and untreated biomass were grounded with salts (KBr) separately by mortar and pestle. The resultant powder was converted into a 7 mm die set separation disc by manual pressing. The absorbance of the IR spectrum was recorded within 500 to 4000 cm\u22121  using a v/v) formaldehyde solution for 5 min. Seeds were then washed with double deionized water followed by placing in a petri dish containing filter-sterile pond water with different concentrations of Cr(VI)  and without Cr(VI) as the control. Seeds were set under 12/12 h light/dark cycle and temperature of around 25 \u00b0C during the day and around 18 \u00b0C during the night. The growth of seedlings was observed and measured after one week. For each group, three chickpea seeds were used and fungal contamination was avoided by immersing seeds into a 3% (To determine the Cr(VI) reducing effect, 50 mg/L of Cr(VI) were treated separately with the isolate SH-1 and dried SH-1 live biomass and then added into the seed germination plates described above. The filter-sterile pond water was used as a control, and pond water with 50 mg/L Cr(VI) was used as a negative control. Seeds were placed under the same conditions described above. Germination rate, as well as root and shoot length, were observed and measured after one week.t-test were used as statistical tools to validate the results, and to ensure data variability of data. Tukey\u2019s (post-hoc) test (p < 0.05) was performed to compare the mean values as described in the specific figure legends. All data in the figures and tables are expressed as mean \u00b1 standard deviation (SD).The Statistical Package for the Social Sciences (SPSS) and Microsoft Excel were used to analyze experimental data . All the experiments were run in triplicates unless otherwise stated. A one-way analysis of variance (ANOVA) and student\u2019s Klebsiella spp. (SH-1) with 98% genetic sequence similarity , pH 9.0 was found to be optimum for the growth of the isolate. The ability to grow in the presence of Cr(VI) was also determined, in which isolates SH-1 showed a similar growth curve as its control (without chromium). SH-1 showed greater growth efficiency in the presence of Cr(VI) as compared to the negative control b. Bacillus isolates [Alcaligens faecalis reduced only 70.0%, and Bacillus sp. (accession number FM208185.1) reduced only 73.41% of initial 100 mg/L Cr(VI) [This study revealed that the isolate has a very high chromium (Cr) resistance property. Therefore, we hypothesized that this isolate might have Cr reducing ability. Afterward, this hypothesis was tested by conducting a time-course study of Cr(VI) reduction in LB broth containing 100 mg/L of Cr(VI) at the optimum temperature (37 \u00b0C) and pH (9.0). It has been reported that the optimal Cr(VI) reduction capacity is directly associated with optimum pH (8.0) for the growth of isolates . In the L Cr(VI) ,56. We fL Cr(VI) . In addip < 0.05) in percentage reduction by the isolate compared to the indigenous organisms. Subsequently, in tannery effluents, SH-1 showed a 63.08% reduction after 72 h of incubation  without the addition of any nutrients. The reduction efficiency of the isolate was also compared with the indigenous microorganisms (used as the control) present in the water samples. After 72 h of incubation in pond water, SH-1 showed a 45% reduction, whereas the control showed only 13.52% reduction d. Therefcubation e. Howevecubation e. ThoughV. cholerae) failed to show chromate reduction. Therefore, reduction caused by Cr(VI) treated proteins were higher than the reduction of untreated proteins of the isolate . The soluble proteins from SH-1, both in the presence and absence of Cr(VI), could reduce Cr(VI), as indicated in  isolate . Because isolate . This stThe biosorption capacity of the dried bacterial biomass (SH-1 live and SH-1 dead) for the removal of Cr(VI) was found as a function of initial metal ion concentration, pH, and time.1 = \u22120.89 and r2 = \u22120.94, respectively), which were statistically significant (p < 0.01). The maximum chromium biosorption was found to be 33.28 mg/g of dried SH-1 live biomass at pH 2  is mainly dependent on the pH of the medium, where HCrO4\u2212 is the dominant form at low pH [As wastewater containing metal ions has different pH values, the biosorption study of Cr(VI) was performed at different pH. Initial pH values were set from 1 to 8 for 100 mg/L Cr(VI) solution. As illustrated in  at pH 2 a. Similat pH 2.0 ,60. Biost pH 2.0 . Again, t low pH . Therefot low pH ,63. Anott low pH ,64,65. Ot low pH .1 = 0.99 and r2 = 0.96, respectively), which were statistically significant (p < 0.01). The maximum biosorption capacity was found in the dried SH-1 live biomass at 200 mg/L. Similar trends were found in the biosorption study of the Pantoea sp. TEM18 biomass [The biosorption process was conducted with optimized pH (pH 2 for live and pH 1 for dead biomass) at different initial concentrations (20 mg/L to 200 mg/L). When the initial Cr(VI) concentration increased from 20 to 200 mg/L, the absorbing capacity also increased from 8.76 to 51.25 mg/g (dried SH-1 live) and 6.21 to 29.03 mg/g (dried SH-1 dead) biomass b. We obs biomass . The bio biomass , which i biomass .1 = 0.94 and r2 = 0.86, respectively), which were statistically significant (p < 0.01). Subsequently, after acquiring the equilibrium period at 120 min, no significant differences of Cr(VI) adsorption with time was observed, though the experiments were performed until 360 min. The biosorption equilibrium of Cr(VI) was modeled according to the two adsorption type isotherms (Langmuir and Freundlich).To illustrate the mathematical expression of the biosorption, Freundlich and Langmuir adsorption models were used for dried SH-1 live biomass only. The constants of both isotherms were assessed to compare the capacity of Cr(VI) biosorption by this biomass. o (maximum monolayer coverage capacity) and KL (Langmuir isotherm constant) were calculated from the slope and the intercept of the Langmuir plot of 1/Qe (Qe = amount of Cr(VI) adsorbed per gram of biomass at equilibrium) versus 1/Ce (Ce = the equilibrium concentration of Cr(VI))  for the Freundlich isotherm than the Langmuir adsorption model (R2 = 0.94) (n (n = adsorption intensity) was 1.30 (n > 1 indicates strong interactions between Cr(VI) and the biosorbents [The values of Q Cr(VI)) d. From t = 0.94) d,e. Thiswas 1.30 , where nsorbents .e and K1 were found from the plot of ln(qe\u2013qt) vs. t  and which suggests that the Cr biosorption data onto both biomass did not agree with the pseudo first order model  values > 0.99 for both of the live and dead biomass, respectively  vs. t . On the er model . On the ectively . These rThe SEM analysis reveals that the untreated bacterial biomass showed a smooth cell surface, whereas a rough surface, along with surface depression was observed in the Cr(VI) treated biomass a,b. The 2), bonded and non-bonded hydroxyl (O-H) groups, amide (-CONH-), carboxyl (-COOH), aromatic (C = C) ring, alkenes (C = C), aliphatic (-CH2) groups, etc.  in that region.FTIR spectroscopy analysis was carried out to obtain the characteristics of the functional groups and to identify the chemical bonds that played a significant role in the process of biosorption of hexavalent chromium. FTIR analysis of chromium exposed and unexposed biomass contained some absorption bands at different wavelengths, which indicate the presence of various functional groups such as an amine  was observed in Cr exposed biomass, which might be due to the overlapped stretching of amines and hydroxyl groups or due to the interaction of chromium ion with those functional groups [2) groups at 2925 cm\u22121 were unchanged, which indicates the asymmetric stretching of proteins, lipids, nucleic acids, and polysaccharides in the biomass cell wall [\u22121 for C-O stretching remained the same for both of the Cr exposed and unexposed biomass [\u22121, indicating the presence of amide and carboxyl groups and aromatic ring on the cell surface [\u22121, indicating the interaction of chromium in the cell surface. Therefore, FTIR analysis of Cr exposed bacterial biomass revealed that all the changes found were may be due to the interaction between organic functional groups  and chromium, chelating on the biomass cell surface [On the other hand, a modified vibrational broad band range from 3200 to 3600 cml groups ,69. In bell wall . The str biomass . For Cr  surface . In cont surface .1 = \u22120.74 and r2 = \u22120.91, respectively). It indicates that Cr(VI) affected the growth of shoots and roots of chickpea seeds, although Cr(VI) did not affect the rate of seed germination. Above 50 mg/L of Cr(VI), seedling growth was greatly hampered and no seedling was observed at 100 mg/L  could significantly inhibit the plant and seedling growth ,74. Ther100 mg/L a,b. A si100 mg/L c. In con100 mg/L d; while T. lixii CR700 and A. flavus CR500 revealed the successful detoxification of Cr(VI) [Alternatively, the mean shoot and root length of the seeds with Cr(VI) sample that was treated with SH-1 were 10.1 cm and 3.2 cm. Subsequently, the mean shoot and root length of Cr(VI) samples that were treated with dried SH-1 live biomass was 6.7 cm and 3.6 cm, respectively. These results indicate that 50 mg/L Cr(VI) treatment significantly reduces the growth of shoot and root . Of note, Cr(VI) sample that was treated with SH-1 significantly recovered 93% and 75% shoot and root length, respectively, as compared to the 50 mg/L Cr(VI) sample. Similarly, the SH-1 live biomass treated Cr(VI) sample also significantly recovered 89% and 77% shoot and root length, respectively, as compared to the 50 mg/L Cr(VI) c,d. Simif Cr(VI) ,75. ThisThe current study gives evidence that hexavalent chromium can be removed by SH-1 cells in LB broth, in tannery effluents, and in pond water. In addition, biosorption studies illustrated the effective sorption capacity of the dried SH-1 live biomass with a high recapture of Cr(VI) in a relatively short time comparing to our Cr(VI) removal process by SH-1 cells. To apply this process from lab to industry, further studies, including chemical modification of the biosorbents along with optimization of the biosorption parameters, might be needed . Moreove"}
+{"text": "Prompt Gamma Neutron Activation Analysis is a nuclear-based technique that can be used in explosives detection. It relies on bombarding unknown samples with neutrons emitted from a neutron source. These neutrons interact with the sample nuclei emitting the gamma spectrum with peaks at specific energies, which are considered a fingerprint for the sample composition. Analyzing these peaks heights will give information about the unknown sample material composition. Shielding the sample from gamma rays or neutrons will affect the gamma spectrum obtained to be analyzed, providing a false indication about the sample constituents, especially when the shield is unknown. Here we show how using deep neural networks can solve the shielding drawback associated with the prompt gamma neutron activation analysis technique in explosives detection. We found that the introduced end-to-end framework was capable of differentiating between explosive and non-explosive hydrocarbons with accuracy of 95% for the previously included explosives in the model development data set. It was also, capable of generalizing with accuracy 80% over the explosives which were not included in the model development data set. Our results show that coupling prompt gamma neutron activation analysis with deep neural networks has a good potential for high accuracy explosives detection regardless of the shield presence. Due to the recent technological advancements and intelligence of organized terrorist groups around the globe, they were capable of hacking lots of traditional explosives detection techniques. That being said, researchers have been working on alternative explosives detection systems that can outperform conventional methods relying on sniffing dogs and X-ray machines6. Hence, many researchers have been paying attention to alternative techniques in explosives detection. Most of the research was focusing on chemically detecting explosives such as using chemically modified multiplexed mode with nanoelectrical devices arrays as a method for super sensitive explosives identification and discrimination7. Others were capable of identifying dinitrotoluene at room temperature using a reduced graphene-based oxide gas sensor when modified with a peptide receptor8. Research effort demonstrated the capabilities of microporous polymer networks as easily and low-cost manufactural devices for explosives detection9. Appreciating the huge analytical power of machine learning in clustering, regressing, and classification of data, some research has been conducted in using various machine learning techniques in analyzing sensors\u2019 data for explosives detection in different environments. Some researchers worked on visualizing explosives by three-dimensional voxel radar using convolutional neural networks10. In addition, Deep learning was implemented in detecting explosives using handheld ground penetrating radar (GPR)11. Multilayer perceptron models (MLPs) from the artificial neural networks (ANNs) family of artificial intelligence was coupled with pulsed fast thermal neutron activation (PFTNA) technique for detecting explosives12. It also showed an accuracy of 97% in forecasting the presence of explosives and drugs when coupled with images obtained from thermal neutrons tomography13.Explosives detection4. In the past 20\u00a0years, lots of researchers focused on using those techniques in explosives detection for aviation security purposes14. Prompt gamma neutron activation analysis (PGNAA) was studied extensively due to its vast potential and applicability. PGNAA is a quantitative isotopic identification technique. A PGNAA system broadly consists of a neutrons source, unknown sample (target to be investigated), and a detector array15. When the target is bombarded with the neutron beam, neutrons interact with the target nuclei, emitting the gamma spectrum that includes peaks at certain energies3. These energies represent the fingerprints of the target isotopic composition. Analyzing the heights of the peaks emitted at each energy yields the quantitative information about the sample material composition16. One of the main advantages of PGNAA in explosives detection is that the irradiation and detection process occur simultaneously17. Hence, PGNAA showed extremely high efficiency in identifying explosives, along with reducing the time needed for luggage investigation in airports and on borders. This will reduce the delay time in the passengers' queue18. PGNAA has one major drawback, which is shielding the target to be investigated20. Once the target is shielded, whether the shield is for neutrons or gamma rays, the shield distorts the gamma spectrum read by the detectors, as illustrated in Fig.\u00a021. Using machine learning regressors and classifiers such as K-nearest neighbor (KNN) regressors and decision tree classifier to analyze the gamma spectra resulted in 92% accuracy in differentiating between explosive and non-explosive hydrocarbons22.Nuclear based techniques for explosives detection were introduced in 198626. In this article, we show how coupling deep neural networks with the PGNAA technique can significantly help to solve the shielding issue. This coupling will result in an end-to-end automated framework that will reduce the need for a skilled operator to analyze the gamma spectra read by the detectors array.The shielding issue was discussed in multiple studies. Some researchers focused on the shield thickness, and others focused on studying the neutron shield effect on the explosives detection capabilitiesIn this work, the proposed end-to-end framework consisted of four regressors feeding one classifier. The initial input was gamma energy peaks heights, and the output was whether the combination of those peaks represents a hydrocarbon explosive or not, as illustrated in Fig.\u00a028. For the data generation, we used a Monte Carlo based computational tool for radiation transport calculations (MCNP Code29) to mimic the neutron interactions with the samples and gamma spectra read by the detector array30. The simulated setup is replicating the Romasha experimental setup located in Frank Laboratory at the Joint Institute for Nuclear Research (JINR) as demonstrated in Fig.\u00a0331. The Romasha setup consisted of an ING-27 D-T neutron generator that generates 14.1\u00a0meV neutrons, six iron sheets collimator, and Ten BGO detectors located in a semicircle of 30\u00a0cm radius, as demonstrated in Fig.\u00a0231. The gamma rays emitted due to neutron interactions with the sample travel in different directions. Hence, using detectors array in PGNAA setups is a standard procedure for detecting the emitted gamma spectrum. We modeled the neutrons emitted from the D-T neutron generator as point isotropic source of 14.1\u00a0meV energy. Hence, changing the orientation of the investigated sample will not affect the resulting gamma spectrum. We used our previously developed and validated MCNP model with validation metrics listed in Supplementary Table 322. In the developed MCNP model that we used in the data generation process, we didn\u2019t consider the natural radioactivity background. Natural radioactivity on earth usually includes gamma radiation. The neutron background radiation is insignificant. Hence, it is usually neglected in the application design process. Regarding the gamma background radiation levels, it is a standard procedure for any setup that includes radiation detection, and the detectors are calibrated to remove the background gamma readings from the relevant energy channels. In our case, the relevant channels are listed in Supplementary Table 3), volume (Vol in cm3), and masses (M in g) are listed in Table 2O), borated light water (BW), polyethylene (Poly), borated polyethylene (BP), lead (Pb), iron (Fe), and steel, the generated data breakdown is listed in Supplementary Table 9 to 1012\u00a0n/cm2\u00a0s during the practical deployment will provide better results. Using a prescreening device such as the X-ray machines will reduce the total screening time by permitting the movement of suspicious baggage to another convoy, which leads to the D-T neutron generator detection system23. In practice assuming 10% of the baggage are suspicious and using a high-intensity neutron generator. This will reduce the time of the multibarrier screening process and ensure an efficient detection of both shielded and unshielded illicit materials. The presence of the X-ray prescreening device will also help to direct the neutron generator specific to locations in the parcel and reduce the time for the second screening process23.Due to the sensitivity of the research topic, we used synthesized data instead of experimental data. We used the PGNAA technique in acquiring information about the unknown hydrocarbon sample. Since the proposed framework is developed for differentiating between explosive and non-explosive hydrocarbons regardless of the shield presence. Hence, we focused on the gamma energy peaks representing hydrogen (H), carbon (C), nitrogen (N), and oxygen (O), as listed in Supplementary Table 12) as the quality metrics for the developed regressors, as listed in Table 2 score is a regression metric that evaluates the quality of fit, and it measures the percentage of the correctly predicted numerical values in comparison to the whole dataset. Although the oxygen weight fraction regressor had the highest test MAE, we considered the regressors responsible for predicting the H, and C elements weight fractions showed the worst and less bad quality metrics as they had the highest differences between training and test MAEs. This indicates a higher tendency to overfit the regression process. The reason behind this is the existence of light water, and polyethylene as shields within the data generated samples. The issue associated with these two particular shields is the existence of H and C within the shield material composition. Putting aside the fact that H and C are considered excellent neutron shields. Neutron interactions with H and C in those shields will also, add to gamma energy peaks\u2019 heights of H, and C read by the detectors array. This will not only distort the resulting gamma spectrum due to neutron shielding, but this will also provide misleading H, and C energy peaks\u2019 heights that do not represent H and C weight fractions in the investigated sample. Although O exists in light water, it is a neutron transparent element, and thus, it has a low probability of interaction with neutrons. That being said, the regressor predicting the O weight fractions showed regression quality metrics better than that of H and C regressors. On the other hand, the regressor responsible for the prediction of N weight fraction showed the least MSE, MAE, and the highest R2 scores. This was due to the absence of N in any of the investigated shields.A regressor is a method that generates a model capable of predicting the numerical dependent variable and minimize the error between the predicted value and the actual value for the whole range of the dependent variables and the whole space of the independent variables. We developed four deep neural network regressors to predict the weight fractions of H, C, N, and O in the investigated samples, respectively. The input for each regressor was the 11 gamma energy peak heights read by the ten detectors in the detector array. Hence, the total number of input features was 110 features. Outputs of the four regressors were the H, C, N, and O weight fractions, respectively. Training and test size represented 80% and 20% of each development data set from the data generated, respectively. Hence, we cross-validated each of the developed models across five folds. In each fold, training and test samples were chosen randomly. We used the mean squared error (MSE), mean absolute error (MAE), and the coefficient of determination . While the recall score is the ratio between the predicted true positive instances and the true number of positives that should have been scored . Finally, F1-score is the harmonic mean for precision and recall. Considering that precision and recall are negatively proportional for most of the models, the high harmonic mean implies a robust model that can predict the true positive, true negative, false positive and false negatives properly. We trained the classifier through feeding the regressed weight fraction values of H, C, N, and O rather than the original values to reduce the error propagation possibility. The developed classifiers showed 95% for all weighted mean quality metrics. Details of each developed classifier quality metrics are listed in Table In summary, we developed 11 pipelines, each pipeline consisted of four regressors to predict the weight fraction values of H, C, N, and O respectively and a classifier to determine whether the investigated sample was an explosive hydrocarbon or not. During the development of each pipeline, one of the 11 development data sets was chosen. Finally, we tested each pipeline twice, once on the development data set, and the other through the corresponding final test data set (data that has not been included in the model development data set neither in training or testing). As expected, testing the pipelines on the development data sets resulted in the same weighted mean accuracy, precision, recall, and F1 scores as that of the classifiers' development scores 95%). On the other hand, when we tested the pipelines on the final test data sets, classification quality metrics\u2019 weighted mean scores dropped to 80%, 79%, 85%, and 80% for the accuracy, precision, recall, and F1 scores respectively. These scores represent the pipeline capability of generalization over unknown explosives and non-explosives regardless of the shield existence or not. Detailed classification metrics scores for the development data set test, and the final test data set test are listed in Tables %. On theFrom the above discussion, we concluded that the developed end-to-end framework scored higher classification metrics for previously included explosives in the training process. Due to the nature of security problems, and since there is a finite number of explosives, it is possible to include all the known explosives in the regressors and classifiers training. However, some of the developed pipelines were capable of detecting 920\u00a0g of trinitro-azetidine (TNAZ) with accuracy of 84%, 800\u00a0g of nitroglycerin (NG) and 825\u00a0g of trinitrotoluene (TNT) with accuracy of 88%, 880\u00a0g of Picric acid, 865\u00a0g of trinitro-phenylmethyl nitramine (tetryl), and 795\u00a0g of urea nitrate (UN) with accuracy of 92%, and finally 885\u00a0g of pentaerythritol tetranitrate (PETN) with accuracy of 100%. The aforementioned explosives were not included in neither the training nor test of their corresponding development data sets. However, by testing the minimum detectable mass for the PETN across three cm of the studied shields. The pipeline was capable of detecting minimum mass of 708\u00a0g of PETN for the shields water, borated water, iron, lead, and boron. Also, it was capable of detecting 177, 354, and 531\u00a0g of PETN when shielded with three cm of borated polyethylene, polyethylene, and steel respectively. Thus, coupling deep neural networks with the PGNAA technique showed huge potential in overcoming the neutron and gamma shielding drawback of the PGNAA technique in explosives detection and security applications. We believe that including more massive data sets that include experimental data that includes more parameters can significantly improve the efficiency of the proposed pipeline in explosives detection. Future work may include studying actual luggage with various hydrocarbon compounds placed around the shielded sample (whether it was explosive or not). We used the polyethylene and borated polyethylene shields as they are considered neutron absorbers that can be used in shielding the investigated sample. They also provide insights about the ability to proceed with this work to investigate samples surrounded by items usually placed in ordinary luggage.Supplementary Tables."}
+{"text": "Drosophila notum, Drosophila wing, zebrafish pigmented cells, and zebrafish spinal cord, the differentiation pattern occurs at multiple-cell diameter distances. In this review, we discuss the evidence and characteristics of long-distance patterning mechanisms mediated by cellular protrusions. In the nervous system, cellular protrusions deliver the Notch ligand Delta at long range to prevent cells from differentiating in their vicinity. By temporal control of protrusive activity, this mechanism can pattern differentiation in both space and time.During brain development, the tissue pattern and specification are the foundation of neuronal circuit formation. Contact-mediated lateral inhibition is well known to play an important role in determining cell fate decisions in the nervous system by either regulating tissue boundary formation or the classical salt-and-pepper pattern of differentiation that results from direct neighboring cell contacts. In many systems, however, such as the  During morphogenesis, the differentiation of cells must be coordinated and patterned at both short (among immediate neighbors) and long range . Short-range signaling can be achieved, for example, by cell\u2013cell contact via ligands and receptors proteins inserted into cell membranes   cells use basal protrusions and filopodia to organize a mosaic pattern of differentiation spaced on average 4.6-cell diameters apart. In microchaete precursors, these cell extensions, visualized by CD8-GFP or Moe-GFP expression, appear as filopodia  leads to patterning that does not match in vivo observations  are specific to the type of protrusion and are also responsible for their formation . The speJC, PA, and REM wrote the manuscript and prepared the The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Supplemental Digital Content is available in the text. The impact of SARS-CoV-2 on neonates remains largely unknown in low- and middle-income countries (LMICs). We provide an epidemiologic and clinical report of SARS-CoV-2 infections in neonates hospitalized in Bangladesh.Outborn neonates admitted to Dhaka Shishu Hospital, a tertiary-care referral hospital, between 29 March and 1 July were screened for SARS-CoV-2. We reviewed clinical data, including chest radiograph and laboratory reports, and conducted SARS-CoV-2 genome sequencing. Patients were followed-up for 27\u201375 days. A subset of caregivers was also tested.Of 83 neonates tested, 26 were positive (median age 8 days). Most neonates were admitted with diagnosis unrelated to SARS-CoV-2: 11 presented with serious non-communicable diseases, 7 with early-onset sepsis, 5 with late-onset sepsis and 2 with pneumonia. In 3 of 5 chest radiograph, infiltrates and ground-glass or patchy opacities were noted. Two neonates developed metabolic acidosis, one developed disseminated intravascular coagulation. Most SARS-CoV-2 positive neonates were referred to government-designated COVID-19 hospitals, leading to gaps in treatment. Twenty-three neonates could be followed-up: 12 were healthy, 8 died and 3 were still seeking medical care. Of 9 caregivers tested, 8 were positive.SARS-CoV-2 may have serious adverse effects on children born in LMICs. The virus likely contributed directly to two deaths, but the remaining 6 neonates who died had serious comorbidities. Positive SARS-CoV-2 test results led to gaps in immediate clinical care for other morbidities, which likely contributed to adverse outcomes. This case series emphasizes the need to understand COVID-19 in neonates in LMICs and its indirect impacts. In addition, numerous reports describing COVID-19 in children are becoming available, but little is known about the clinical presentation and outcomes in children in South Asia. The evidence gap is even wider in case of neonates (<29 days old).The ongoing SARS-CoV-2 pandemic has led to over 25 million cases and caused at least 854,000 deaths worldwide as of August 31, 2020, 15% of which have been reported from South Asia.2 this evidence is equivocal and evolving as non-pharmaceutical interventions change .3 There is a lack of evidence relating to neonates specifically. The first case of neonatal SARS-CoV-2 infections was identified on February 2, 2020 in China.4 Since then, approximately 70 cases have been described, and symptoms ranged from mild to severe, and no deaths have been reported thus far.9 However, little is known about infection amongst neonates in South Asia, which already shares a disproportionately high burden of global neonatal morbidity and mortality.11 By August 31, 2020, there had been over 43 million infections and 77,000 deaths in South Asia, but only 2 sporadic reports on the impact of SARS-CoV-2 on neonates in this region had been published.12Although some studies suggest that children may be less vulnerable to SARS-CoV-2 infections than adults, with the exception of pediatric multisystem inflammatory syndrome,In this study, we report a series of 26 cases of SARS-CoV-2 infections in neonates who presented at Dhaka Shishu Hospital (DSH), the largest pediatric tertiary care, referral hospital in Bangladesh. We outline the hospital clinical records, chest radiograph, hematologic, biochemical and molecular tests, genome sequences and follow-up data for these cases. Our findings highlight the direct and indirect impact of SARS-CoV-2 infections on neonates in South Asia and provide a snapshot of the presentation of these cases.This observational prospective study was conducted in DSH, which provides primary to tertiary care to children and treats 37% of patients free of cost. This is the largest referral hospital for children in Bangladesh, and very sick children requiring immediate or intense care are referred to this hospital.Starting in March 2020, the government of Bangladesh established designated COVID-19 hospitals across the country, but for the duration of this study, DSH was not one of them. However, DSH continued to admit children requiring medical attention. Children with COVID-19 symptoms were admitted in an isolation ward till SARS-CoV-2 tests were conducted, and results were attained. In addition, children admitted at DSH, who required surgical procedures or ICU care, were also tested for SARS-CoV-2 for screening. Cases that tested positive were referred to a COVID-19 hospital.This study recruited neonates (0\u201328 days) who presented at DSH between 29 March and 1 July and tested positive for SARS-CoV-2. Between 9 June and 1 July, nasopharyngeal specimens were also collected from the immediate caregiver of these neonates.Nasopharyngeal specimens were collected by trained physicians or nurses using a COPAN FLOQswab , which was immediately transferred into a 15\u2009mL tube containing 1\u2009mL of 1X RNA shield .13 and is a government-designated testing center for COVID-19. RNA from all samples was extracted within 24\u201348 hours of collection and tested for the presence of SARS-CoV-2 using the TaqPath COVID-19 RT-PCR Kit .All tests were performed at the Child Health Research Foundation that runs 4 WHO sentinel laboratories, including the laboratory in DSH,14 were sequenced on an Illumina iSeq100 sequencer using 150-nucleotide paired-end sequencing. SARS-CoV-2 reads were recovered by mapping the raw reads against the reference sequence .16 Consensus sequences of the 9 SARS-CoV-2 genomes were uploaded on GISAID17 and subsequently analyzed using NextStrain (https://nextstrain.org/).18Viral RNA was extracted from nasopharyngeal specimens using the Quick-RNA/DNA Microprep Extraction Kit , and was converted to cDNA using ProtoScript II . Libraries prepared following the ARTIC pipeline,Demographic and clinical data were prospectively collected with a standardized form for 25 of 26 cases. The hospital file of the first identified SARS-CoV-2 neonatal case was misplaced, and therefore only partial data could be retrieved retrospectively through telephone interviews. Laboratory data for all cases were collected from the COVID-19 database of the laboratory. Outcomes of the positive cases were followed-up over telephone through July 28, 2020, upon consent, using structured questionnaires.All protocols were approved by the National Research Ethics Committee, Bangladesh Medical Research Council, and the ethical review board of the Bangladesh Institute of Child Health. Samples from suspected COVID-19 patients were collected for clinical care and diagnostic testing at the discretion of the attending healthcare providers.Between March 29, 2020 and July 01, 2020, nasopharyngeal swab specimens were tested for SARS-CoV-2 from 83 neonates with various medical presentations. Twenty-six neonates (31%) tested positive and 16 of 26 (62%) were boys. The median age of the positive cases was 8 days and 14 babies (53%) were in their first 5 days of life , 5 with late-onset neonatal sepsis (LONS), 2 with pneumonia and 11 with serious non-communicable diseases.The main clinical and biologic characteristics, treatments and outcomes of the 26 patients at hospital admission are summarized in Table http://links.lww.com/INF/E138) and died at the age of 6 days. Similarly, patient Ne08 had respiratory distress, required supplemental oxygen and showed signs of disseminated intravascular coagulation and eventually died on the sixth day of hospitalization, at the age of 8 days. Patients Ne12 and N14, who were admitted with neonatal jaundice, and Ne11 were referred to COVID-19 hospitals. Ne12 was lost to follow-up and Ne14 and Ne11 were doing well during follow-up. Ne07 and Ne13 were admitted with perinatal asphyxia and hypoxic-ischemic encephalopathy (HIE) stage 2 along with EONS. Chest radiograph of Ne07 showed patchy opacities in the right lower lobe suggesting pneumonia  emergency surgeries were performed soon after hospital admission before the SARS-CoV-2 test results were obtained. For postoperative care, they were referred to COVID-19 hospitals. All 3 children were reported to be doing well during follow-up. Three other cases that also required surgeries  were referred to COVID-19 hospitals immediately after SARS-CoV-2 test results were obtained. Ne01 died at another hospital at the age of 38 days; Ne10 had 1 surgery and was reported to be waiting for a second surgery during a telephone follow-up 40 days of testing positive; Ne15 was also still sick and seeking medical care.http://links.lww.com/INF/E138) and was referred to a COVID-19 designated hospital; however, the family did not seek care at any other hospital and the child died at home at the age of 25 days. Ne21 was also referred to a COVID-19 hospital after 4 days, and died at the age of 30 days.Ne06, admitted with anorectal malformation, died the day after admission due to sepsis. Ne18 and Ne21, both of whom were admitted due to congenital heart disease, developed signs of respiratory distress. Ne18 also developed LONS and metabolic acidosis , and 4 of them exhibited COVID-19 symptoms. Amongst the mothers who were not tested, 2 reported symptoms related to COVID-19.Twenty of the 26 families could be interviewed to determine potential exposure to SARS-CoV-2, and in total, 6 mothers reported experiencing COVID-19 related symptoms in the days before delivery. Immediate caregivers from 9 neonates (8 mothers and 1 grandmother) provided nasopharyngeal swab specimens during the time of specimen collection from the neonates; 8 of them tested positive for SARS-CoV-2 . These clustered with other Bangladeshi isolates in clades 20A, 20B and 20C , and no specific distinct cluster was seen for these cases. The residential locations of the cases were distributed across the country .Genome sequences were obtained from 9 neonatal cases that had cycle threshold value of less than 25 for 20 This is of specific concern to low- and middle-income countries (LMICs), where newborns are already the most vulnerable population, and several reports indicate the decline in essential care due to the pandemic.21There are emerging reports of SARS-CoV-2 infection in children and some studies have also indicated that COVID-19 in children may present with atypical symptoms.22 presentation of gastrointestinal symptoms have also been noted.5This study, to our knowledge, presents the largest case series of SARS-CoV-2 infections in neonates to date. We screened 83 babies admitted at a tertiary care pediatric hospital, and 26 (31%) tested positive for SARS-CoV-2 by RT-qPCR. We recorded a wide spectrum of presenting signs and symptoms. These included fever, respiratory distress, gastrointestinal symptoms and a range of non-communicable morbidities like perinatal asphyxia and HIE that are commonly reported as neonatal causes of hospitalization and deaths in this region. Three of the 5 chest radiographs available showed changes consistent with pneumonia. Previous publications on neonatal COVID-19 cases have identified fever, respiratory distress and ground-glass opacity in chest radiographs as the most common symptoms in neonates;11 and therefore it is difficult to determine the role of SARS-CoV-2 in death. However, it is clear that in both children and adults, severity of and mortality due to COVID-19 are amplified in patients with specific preexisting morbidities.24 This might also be the case in neonates, where SARS-CoV-2 infection might aggravate the health of already vulnerable children.Of the 8 babies who died, 6 had serious co-morbidities\u2014ruptured myelomeningocele, perinatal asphyxia and HIE stage 2 and congenital pneumonia, anorectal malformation, posterior urethral valve with bilateral hydroureteronephrosis, and congenital heart disease. These morbidities have been associated with high mortality in LMICs,27 Ne08 presented with respiratory distress and was diagnosed with EONS with disseminated intravascular coagulation, which has been reported in severe COVID-19 patients.28 Both the babies died before they reached the ninth day of life. These 2 cases provide evidence that SARS-CoV-2 infections may lead to systemic disease with adverse outcomes in neonates.In 2 patients who died, Ne08 and Ne09, SARS-CoV-2 infection was likely the key contributor. Ne09 was admitted with EONS and developed severe metabolic acidosis; chest radiograph showed bilateral ground-glass opacity. Both the bilateral ground-glass opacity and metabolic acidosis have been reported in severe COVID-19 patients.In addition to the direct impact of SARS-CoV-2 on neonates, this snapshot of vulnerable neonates born in LMICs in the midst of the COVID-19 pandemic and the loss of care or attention, depict the indirect impacts this virus can have on neonatal health. For example, the family of baby Ne10 is still waiting for a surgery, and baby Ne01 died at the age of only 38 days when the family was still waiting for a surgery. Such surgeries are routinely performed at DSH but due to the pandemic , cases had to be referred to general COVID-19 designated hospitals. Such delays in medical treatment are likely to have serious outcomes in the near future.To confirm the positive results seen in the RT-qPCR assays, SARS-CoV-2 genome sequences were obtained from 9 cases with high viral loads. Considering that the SARS-CoV-2 genomes belonged to different clades, and tests were conducted within 72 hours of admission in 19 (73%) cases, the virus was likely acquired before presentation at DSH, either in the household or at the hospital of birth. To further investigate potential sources of infections, we tested samples from 9 caregivers, 8 of whom tested positive. Of all 20 families interviewed, 6 mothers reported experiencing symptoms related to COVID-19 in the days before child delivery. While it was out of the scope of this study to further examine vertical or horizontal transmission from mother, this does suggest that neonatal infections are likely to increase if SARS-CoV-2 continues to spread in the population, and preventative policies need to be designed and instituted immediately to protect children from acquiring the infection in this critical period of their development.2The findings of this study should be considered within the context of several limitations. First, DSH does not have a maternity facility and hence neonates were only admitted here if they had serious conditions, biasing our findings towards the most severe outcomes. Our surveillance did not include asymptomatic SARS-CoV-2 positive neonates and their outcomes. Second, as also alluded to above, most of the babies that tested positive were referred to government-designated COVID-19 hospitals and this transfer led to a gap in their treatment that could have negatively impacted their outcome (4 babies died after leaving DSH). Third, due to reduced hospital capacity because of COVID-19, chest radiographs were only performed on 5 cases, and limited laboratory tests were conducted, inhibiting more nuanced understanding of the inflammatory state of the neonates. Finally, the study only followed up patients for 27\u201375 days after testing positive. It has been reported that children with exposure to SARS-CoV-2 can have serious long-term effects like multisystem inflammatory response months after the infection.Despite these limitations, this study has important lessons for the design of future studies looking at SARS-CoV-2 infections in children, specifically neonates. First, except for 2 cases that had typical COVID-19 symptoms, neonates presented with one or more comorbidities often seen in South Asia and other LMICs. Future studies should take this into consideration when designing their inclusion criteria to capture SARS-CoV-2 infections in this age group. The effects of COVID-19 may manifest or become apparent after other presenting comorbidities have been addressed. Second, half of SARS-CoV-2 infections were identified within the first 5 days of life indicating that patients should be screened very early to capture SARS-CoV-2 infections. Finally, while it is difficult to assign SARS-CoV-2 as the cause of death due to multiple comorbidities present in these cases, including several serious noninfectious clinical features, our study provides evidence that neonates with SARS-CoV-2 infections can be adversely affected, whether directly by the virus, or indirectly due to lack of optimal care as a result of a positive test. We recommend that policymakers take this into account and provide specific attention to neonates with SARS-CoV-2 infections when designing treatment policies for COVID-19 treatment.We thank the Directorate General Health Services, Government of Bangladesh, and the Institute of Epidemiology, Disease Control, and Research for giving us the opportunity to work as a COVID-19 response team. We thank all personnel at the Child Health Research Foundation involved in the COVID-19 diagnostic, clinical and follow-up teams, including Shumaiya Ferdaus, Shamsun Nahar, Humaira Shusmita, Rumana Khan, Tasmim Lipi, Shamima Tarafder, Asiya Akter, Fatema Akter Kona, Asifa Taslin Shipa, Shelly Akter, Christina Bain, Nasrin Sultana, Apurba Rajib Malaker, Sharmistha Goswami, Nikkon Sarker, Nahidul Islam, Md. Rasel Mahmud, Dipu Chandra Das, Rathindranath Kabiraj, Nusrat Alam, Shuborno Islam, Akibul Hassan Sazal, Zannatul Mauya, Jibon Hossain, Md. Reaz Hossain Khan, Ranjit Sarker, Anik Sarker, Sharif Hasan, Saif Islam, Rahul Mahmud, Jahid Hasan Sheetal, Md. Mizanur Rahman Masum, Solayman Sarker, Ashish Kumar Das, Md. Shohag Alom Bhuiya, Saikat Hossain Khan, Shimul Gain, Purno Biswas, Shanto Bormon, Md. Obaidullah Gain, Ishrat Zahan, Sharmin Jahan, Kanis Fatema, Shahina Tarafder, Khairun Nahar, Razia Sultana, Robi Das, Asifa Jahan Bithi, Sathi Akter, Md. Mahmudul Hasan, Md. Syed Fuad, Md. Imarot Hossain, Taniya Nasrin, Khursheda Afrin Khushi, Zarin Sultana, Sumi Parvin, Monalisa, Fauiya Khanam Luna, Masrufa Akhter, Lima Akter, Uttam Kumar Barui, Shamima Sultana, Md. Yeasin Ali and Md. Zahid Hossain Swapon. We thank our extremely efficient administration and data management team of Rubana Sultana Aflatun, Mahabub Alam, Rahat Fardush, Md Sharif Islam, Said Al Haque and Ruma Dutta. We are especially grateful to Arif M. Tanmoy, Zabed Ahmed, Md. Hasannuzaman for their intellectual guidance and Syed Muktadir al Sium and Afroza Akter Tanni for their technical assistance with sequencing. We thank the Chan Zuckerberg Biohub and the Chan Zuckerberg Initiative, specifically Joseph L. DeRisi, Cristina M. Tato, Vida Ahong, Manu Vanaerschot, Jack Kamm, Joshua Batson, Samantha Hao, Amy Kistler and Katrina Kalantar, for their intellectual support and guidance during genome sequencing and consensus genome building."}
+{"text": "Transplantation with a diabetic donor kidney may have some benefits compared to remaining on the waitlist for selected patients. However, we found that some kidney transplant recipients have ongoing donor-transmitted diabetic kidney disease (DT-DKD) despite fair blood sugar control. This study aimed to survey the incidence and clinical pattern of DT-DKD in kidney transplant recipients.We retrospectively reviewed the medical records of kidney transplantations in our hospital. We found 357 kidney transplantations from February 2006 to April 2018. Among these, 23 (6.4%) diabetic donor kidney transplantations were done in the study period.Among the 23 recipients, 6 (26.1%) displayed biopsy-proven DKD. Recipients with biopsy-proven DKD had longer dialysis vintage, higher proteinuria amount, lower last estimated glomerular filtration rate (eGFR), and a more rapid decline in the eGFR. The median fasting blood sugar level in the biopsy-proven DKD group was unexpectedly lower than the non-DKD group. Most of the pre-implantation frozen sections in biopsy-proven DKD group showed diabetic lesions worse than diabetic nephropathy (DN) class IIa. In the biopsy-proven DKD group, 5 recipients had no history of diabetes before or after transplantation. Among the 23 recipients, 5 (21.7%) were diagnosed with DT-DKD. Serial post-transplant biopsies showed the histological progression of allograft DN.To the best of our knowledge, this is the first study to report the phenomenon of ongoing DT-DKD in kidney transplant recipients with fair blood sugar control. The zero-time pre-transplant kidney biopsy may be an important examination before the allocation of diabetic donor kidneys. Further study is needed to elucidate the possible mechanism of ongoing DT-DKD in non-diabetic recipients with fair blood sugar control as well as the impaction of pre-implantation diabetic lesion on the graft outcome.The online version contains supplementary material available at 10.1186/s12882-020-02132-w. According a report by the United States Renal Data System, the incidence and prevalence of end-stage renal disease (ESRD) in Taiwan has persistently been one of the highest worldwide ; this haWe conducted a retrospective cohort study and reviewed the medical record of kidney transplantations at our centre between February 2006 and April 2018. A total of 357 kidney transplantations were performed in the study period. Among these, 23 (6.4%) diabetic donor kidney transplant recipients were included for data analysis  were examined. All of the allograft biopsies were examined using light microscopy, immunofluorescence studies, and electron microscopy. Silver methenamine, periodic acid-Schiff (PAS), and Masson trichrome stains were done for light microscopic examinations. IgG, IgA, IgM, C3, C4d, C1q, kappa light chains, lambda light chains, and simian virus 40 immunohistochemical stains were done for immunofluorescence studies. The test of anti-HLA antibodies using the Luminex\u00ae method is expensive and is not affordable to every patient in our cohort. Nine recipients underwent the anti-HLA antibody test in our cohort. We summarized the findings of post-transplant indication biopsies in the supplementary Table\u00a0n\u2009=\u20096) and non-DKD group . One recipient in the biopsy-proven DKD group had a history of diabetes before transplantation, and 4 in the non-DKD group had history of diabetes before transplantation. In the non-DKD group, 2 recipients were found to have post-transplant diabetes mellitus (PTDM). All the results of glycated hemoglobin (HbA1c) beyond 3\u2009months post-transplantation were included to calculate the HbA1c after transplantation. Besides, the fasting blood sugar levels after transplantation of all 23 recipients were included to draw the box and whisker plot for evaluating the blood sugar level distribution. The estimated glomerular filtration rate (eGFR) was calculated via the Modification of Diet in Renal Disease Study equation [2 by the Department of Health in Taiwan.Based on the clinical data and histopathologic results, the 23 diabetic donor kidney transplant recipients were divided into two groups: the biopsy-proven DKD group  for continuous variables according to their distribution, and as number (percentage) for categorical variables. The assessment of normality was conducted using the Kolmogorov-Smirnov test and Shapiro-Wilk test. Statistical analyses were performed using MedCalc for Windows, version 15.0 . Tests for statistical significance were conducted using the Mann-Whitney U test for continuous variables, and the Fisher\u2019s exact test or Chi-Squared Test for categorical variables. A 2, while the last eGFR was 37.7\u2009ml/min/1.73m2.There were 9 male and 14 female diabetic donor kidney transplant recipients with a median age of 44.2\u2009years. The median follow-up duration was 4.4\u2009years. The median baseline estimated glomerular filtration rate (eGFR) after kidney transplantation was 62.7\u2009ml/min/1.73mn\u2009=\u20096) and non-DKD group (n\u2009=\u200917). Table p\u2009=\u20090.005), higher proteinuria amount , lower last eGFR , and a more rapid decline in the eGFR . In the biopsy-proven DKD group, more recipients had dyslipidemia at the time of follow-up indication biopsy . One graft failure due to DKD was noted in the biopsy-proven DKD group.At last follow-up, 6 26.1%) of the 23 recipients displayed biopsy-proven DKD in the transplanted kidneys. Based on the clinical data and histopathologic results, the selected recipients were divided into two groups: the biopsy-proven DKD group (% of the p\u2009=\u20090.003). Other findings of zero-time pre-transplant kidney biopsies included moderate interstitial fibrosis and tubular atrophy (IFTA) 30% (1 frozen section in the non-DKD group), mild IFTA <\u200925% (3 frozen sections in the non-DKD group and 4 frozen sections in the biopsy-proven DKD group), mild arterionephrosclerosis (4 frozen sections in the non-DKD group and 4 frozen sections in the biopsy-proven DKD group), and acute tubular necrosis (1 frozen section in the biopsy-proven DKD group).Zero-time pre-transplant kidney biopsies were done in 11(47.8%) of the 23 kidney transplantations. Pre-implantation frozen sections were available in 4 and 7 cases in the biopsy-proven DKD group and the non-DKD group, respectively. All the 4 frozen sections in the biopsy-proven DKD group showed diabetic lesions worse than diabetic nephropathy (DN) class IIa lesion , as defined by the Renal Pathology Society . Howeverp\u2009<\u20090.0001; Fig. p\u2009<\u20090.0001; Fig. p\u2009<\u20090.0001; Fig. Fig.\u00a0In the biopsy-proven DKD group, 5 recipients had no history of diabetes before or after transplantation. Hence, 5 21.7%) of the 23 recipients were diagnosed with DT-DKD. Table\u00a01.7% of tTo the best of our knowledge, this is the first study to report the phenomenon of ongoing DT-DKD in non-diabetic kidney transplant recipients with fair blood sugar control. Few studies have previously evaluated the reversal of DN after transplantation into non-diabetic recipients. Abouna et al.  reportedRecently, Truong et al.  and KhanThe urine dipstick proteinuria or urinary protein creatinine ratio (UPCR) test may be a good screening test before pre-implantation biopsy. Truong et al.  and KhanIn our study, the median fasting blood sugar level in the biopsy-proven DKD group was unexpectedly lower than in the non-DKD group. This may be related to the poorer renal function in the DKD group. Chronic kidney disease (CKD) is a risk factor for low blood sugar level in patients with or without diabetes . There aSome limitations of this study should be acknowledged. We did not perform oral glucose tolerance test (OGTT) in these patients. Some patients could have had diabetes already but had normal fasting sugar or HbA1c. The retrospective nature of the study may have led to some unrecognized confounding factors to bias the findings. Besides, the case number in this study is small. Nevertheless, this study represents real-world conditions. Diabetic donor kidneys account for 6.4% of kidney transplantations in our hospital. This frequency is similar to that reported in studies  by Ahmad, Mohan, Cohen, and Truong, respectively \u20139, 14. OTo the best of our knowledge, this is the first study to report the phenomenon of ongoing DT-DKD in kidney transplant recipients with fair blood sugar control. The progression of graft diabetic lesions may be related to the severity of donor DN lesion. The zero-time pre-transplant kidney biopsy may be an important examination before the allocation of diabetic donor kidneys. Further study is needed to elucidate the possible mechanism of ongoing DT-DKD in non-diabetic recipients with fair blood sugar control, and the impaction of pre-implantation diabetic lesion on the graft outcome.Additional file 1."}
+{"text": "Background: Deep brain stimulation (DBS) is being used earlier than was previously the case in the disease progression in people with Parkinson\u2019s disease (PD). To explore preferences about the timing of DBS, we asked PD patients with DBS whether they would have preferred the implantation procedure to have occurred earlier after diagnosis. Methods: Twenty Michigan-based patients were interviewed about both their experiences with DBS as well as their attitudes regarding the possible earlier use of DBS. We used a structured interview, with both closed and open-ended questions. Interviews were transcribed verbatim and analyzed using a mixed-methods approach. Results: We found that the majority of our participants (72%) had high overall satisfaction with DBS in addressing motor symptoms (mean of 7.5/10) and quality of life (mean of 8.25/10). Participants were mixed about whether they would have undergone DBS earlier than they did, with five participants being unsure and the remaining nearly equally divided between yes and no. Conclusion: Patient attitudes on the early use of DBS were mixed. Our results suggest that while patients were grateful for improvements experienced with DBS, they would not necessarily have endorsed its implementation earlier in their disease progression. Larger studies are needed to further examine our findings. Most Parkinson\u2019s disease (PD) patients initially respond well to treatment with L-dopa and dopamine agonists but, after five to seven years, the therapeutic effect of medication declines ,2,3. As In the past, patients had to wait for several years after diagnosis to become a DBS candidate, as such the intervention was considered only for advanced PD and, in some cases, as a last resort treatment. However, over time, DBS has come to be regarded as a suitable treatment option earlier in the disease progression, once patients are no longer benefitting from medication , or for There have been a number of studies looking at PD patient attitudes and experiences with DBS as well as factors influencing the decision to undergo DBS ,13,14,15Regarding factors influencing the decision to undergo DBS, Haahr et al.  reportedFew studies have reported on attitudes on earlier use of DBS. A Swedish study by Sperens et al.  exploredAnother study  focused The current literature on patient attitudes and experiences regarding DBS for PD is far from comprehensive, with a majority of studies coming from European countries with health care systems and cultural backgrounds significantly different from the United States. Such differences likely influences patient attitudes and experiences. Moreover, the literature addressing the question of earlier DBS use generally is quite limited. The aim of this pilot study was to explore patients\u2019 attitudes regarding the timing of DBS to help inform a future national survey with a larger sample of PD patients.We conducted a pilot study in Michigan to explore the treatment experience of PD patients with DBS and their attitudes about earlier use of DBS.Using a convenience sample, we interviewed twenty PD patients with DBS between October 2017 and April 2018. Patients were recruited via flyers left both at the clinics of previously identified movement disorder neurologists working in a high DBS volume practice in Michigan as well as in the practice of one of the authors (CS). Additionally, we posted online advertisements on both the Parkinson\u2019s Association of West Michigan and on the Michigan State University Center for Ethics websites. All interested participants who had been diagnosed with PD and had undergone DBS were contacted via phone to explain the purpose of the interview and to schedule the interview. A consent form was e-mailed to all identified eligible participants prior to the interview.We used a structured interview format with closed and open-ended questions. Interview questions were based on prior research  and on dWe employed a mixed-methods approach. A mixed-methods approach employs both qualitative and quantitative methods for the collection, assessment, and analysis of data. This approach allowed us to compare participant responses to the closed questions and the open-ended ones, the later provided context and background for the closed question responses. Interviews were analyzed using a qualitative content analytic approach ,18,19. DPatient age at interview ranged from 53 to 71 years old. The duration of PD before surgery varied between 3 and 17 years and, at time of interview, patients had received DBS between 1 and 17 years .The majority of our participants were overall highly satisfied with DBS addressing both motor symptoms (mean of 7.6/10) and quality of life (mean of 8.4/10) .Patients who were very satisfied with DBS addressing motor symptoms mentioned that DBS had helped with their symptoms and facilitated enhanced mobility. One patient dissatisfied with DBS mentioned that he was not sure whether it was because DBS was not working or whether it was simply the result of disease progression. Those patients for whom DBS had failed to address their symptoms, suggested that it was a struggle accepting that nothing more could be done as programming changes had been exhausted.In terms of quality of life, one very satisfied patient mentioned \u201cI was about ready to give up in life\u201d (P20). Patients who were not very satisfied mentioned that DBS was helpful at the beginning but that it stopped benefiting them.n = 12) , their doctors , and prior communication with another DBS patient(s) . Less common sources of information and knowledge included a newsletter published by a Parkinson\u2019s patient society, information shared by a friend or family member, through their occupation or magazines. Many mentioned the benefits of having had previous contact with patients who had DBS as a way of clarifying expectations, but several respondents stated that this opportunity was not offered or facilitated by their clinicians. One participant asked the doctor about DBS after having read and watched programs about it.Patients accessed a variety of source material for information and knowledge acquisition including the Internet  and no (35%) . Level oFor patients who answered \u2018no\u2019, the majority still agreed that the timing was important. For example, one patient explained, \u201cYou think about the bumps in your head and you think about the stimulator in your chest and it\u2019s not like nothing, you know, it\u2019s something that makes you pause and think about, but still I think it\u2019s a good idea\u2014I don\u2019t regret having it. I, I would hate to get desperate for it\u201d (Patient 01). Among the responses of those patients who were unsure about earlier timing of DBS they explained that they were not emotionally ready, that they decided to pursue DBS only with declining medication effectiveness, and that they were unsure of earlier timing because of the involved risks. Another mentioned the ability to pay as an important consideration in making such a decision.n = 8/17) answered that they did not think earlier DBS would have any impact in those areas. One-third  answered that earlier DBS would have a positive impact on their social life and relationships, and the remainder were unsure.The most common concern mentioned was fear of surgery. Associated fears included (1) fear about the surgery itself with the concern that someone was going in to manipulate inside their brain, (2) fear about the possibility of something going wrong and being left more debilitated, and (3) fear about being awake during the surgery. Some participants were concerned about having their personality changed by DBS. This concern, however, was mitigated after speaking to their clinical team, hearing others\u2019 experiences, and weighing the risks and benefits. When asked about concerns related to personality change and DBS, one patient responded that she was not concerned with changes to her personality as a result of DBS because \u201cIt\u2019s the same thing with pills\u201d (Patient 01). Regarding DBS impact on patients\u2019 social life and relationships, almost half .Our results reflect previous contrasting findings from Sperens et al. , where mThe fact that almost an equal number of patients raised negative views regarding earlier use of DBS, or were unsure, is at odds with the recent findings in the literature that favor proposing DBS for patients even earlier ,30,31,32Mirroring findings in previous studies , one of Another important concern in the neuroethical literature is that of personality changes. Christen et al.  found thWhile other studies have mentioned as a concern the impact of DBS on patient\u2019s social relationships, our participants did not perceive DBS as having an impact on such relationships, and one patient expressed that it had been beneficial.This study has several limitations. First, our findings are not generalizable, since all participants in this study were non-Hispanic White/Caucasian residing in Mid-Michigan and are thus not representative of all possible DBS patients. Second, most of our participants were reasonably knowledgeable about the disease and had an overall high level of education. Third, at the time of the interviews, many were very active in the PD community, helping others garner information about both the disease and treatment modalities. Fourth, each participant answered the semi-structured interview questions based on their own experiences and attitudes, which provides context and richness to the data but makes analyzing comparisons between respondents difficult. Lastly, and most importantly, we were unable to assess other possible confounders such as PD severity/stages, PD clinical subtype, motor symptoms at the time of DBS, indication for DBS, DBS targets, and symptom response to DBS because this was an exploratory qualitative semi-structured interview study and we did not conduct a patient chart abstraction. Notwithstanding these limitations, this study is an important contribution to the examination of patients\u2019 reasons for or against the earlier use of DBS. More research is needed to examine patients\u2019 perceptions and attitudes about earlier use of DBS, and various factors shaping those perceptions.This qualitative study shows that, if earlier DBS initiation had been an available option, DBS patients are divided about whether they would have made a different decision. Our results suggest that while patients are grateful for improvements experienced with DBS, they did not endorse its implementation early in the disease progression. This is true even after adjusting for time with implant, age at surgery and satisfaction with DBS addressing motor symptoms. We also found that male patients are more likely to agree to having DBS earlier in the disease progression compared to female patients. The key reason for agreeing to earlier DBS was trust in their doctor\u2019s recommendation that DBS would be beneficial by possibly slowing disease progression. Reasons patients gave for not agreeing to earlier DBS were (1) they did not consider themselves ill enough, and (2) they felt that medications were still working for them.The main concerns expressed by our participants diverge from those most emphasized in the neuroethics DBS literature. More research with a larger sample is needed to better understand what factors might shape patients\u2019 willingness to support earlier DBS, and to examine their associated values and preferences regarding this treatment."}
+{"text": "Anti-estrogen therapy may be used as a palliative treatment option in high-grade serous ovarian carcinomas (HGSC). However, clinical implementation is limited as the use of estrogen receptor (ER) protein expression by immunohistochemistry remains insufficient in predicting therapy response. To determine the accuracy of ER protein expression as a marker for ER signaling pathway activity, we aimed to correlate ER protein expression to functional ER signaling pathway activity in HGSC.Immunohistochemical ER protein expression was visually scored using total percentages of stained tumor cells and histoscores. Subsequently, mRNA was extracted, and RT-qPCR analysis was performed. Functional ER pathway activity was assessed by a computational Bayesian model inferring ER signaling pathway activity from mRNA levels of ER-specific target genes.p\u2009=\u20090.473 and p\u2009=\u20090.606). Classification of HGSC into three groups based on ER histoscores 0\u2013100 (n\u2009=\u20096), 101\u2013200 (n\u2009=\u200915) and 201\u2013300 (n\u2009=\u20098) resulted in comparable mean ER signaling pathway activity among the groups (p\u2009=\u20090.356). Several samples in the higher ER histoscore groups had low ER signaling pathway activity, indicating that nuclear ER protein expression is not sufficient to describe transcriptional ER activation.Our analysis of 29 HGSCs shows that neither total percentage of ER protein expression, nor ER histoscores are significantly correlated to ER signaling pathway activity (respectively, Positive immunohistochemical ER staining is not always indicative of an active ER signaling pathway and is, therefore, a poor predictor of anti-estrogen response. Further research is needed to prove the predictive value of ER signaling pathway activity regarding anti-estrogen sensitivity in HGSC patients.The online version contains supplementary material available at 10.1007/s13402-021-00600-5. Anti-estrogen targeted therapy has been studied extensively in recurrent and metastatic ovarian carcinoma during the past decades . AlthougThe most studied marker for anti-estrogen therapy response is nuclear estrogen receptor-alpha (ER) protein expression by immunohistochemistry . The preIn the absence of an activating mutation, the substrate estradiol is required to activate the ER and initiate transcription of ER target genes . While iAs the ER signaling pathway is considered a potential target for therapy in a subset of HGSC, the most common histological subtype of ovarian cancer, reliable markers to identify this anti-estrogen sensitive subset are needed. In this study we investigate whether ER protein expression correlates to functional ER signaling pathway activity in advanced stage HGSC in the search for an alternative predictive biomarker for anti-estrogen therapy response.We retrospectively selected patients diagnosed with advanced stage HGSC in the Catharina Hospital Eindhoven, The Netherlands. To prevent any interference of cytotoxic or anti-estrogen therapy with ER signaling pathway activity measurements, patients were excluded if (1) formalin-fixed paraffin-embedded (FFPE) tumor samples were obtained after the start of chemotherapy, (2) patients had a medical history of any other malignancy prior to HGSC diagnosis, with the exception of basal cell skin carcinoma and (3) medical records stated recent use of oral contraceptives or hormone replacement therapy. We retrieved the following data from medical records: age and menopausal status at diagnosis, FIGO stage and tumor origin. In case medical records lacked information on menopausal status and age at diagnosis was insufficient to confirm postmenopausal status, endometrial sections were reviewed to determine menopausal status . Tumor h2O2  at room temperature.FFPE sections of\u00a04 \u03bcm were cut with a microtome and dried at 80\u00b0C in a convection oven for 20\u00a0min. Fully automated immunohistochemical staining for the detection of ER-alpha was performed on a BOND III stainer . Slides were incubated with rabbit monoclonal antibody (SP1)  for 30\u00a0min at 20\u00b0C after heat-induced epitope retrieval with ER-2  for 30\u00a0min at maximum 100\u00b0C. Detection of the primary antibody was performed using Bond Polymer Refine Detection , including two incubation steps of 8\u00a0min at 20\u00b0C. Positive cells were visualized after 10\u00a0min incubation with 3,3-diaminobenzidine/HTwo expert gynecological pathologists (SLB and MHFML-B) independently determined ER protein expression in the annotated tumor areas. The pathologists were blinded for each other\u2019s assessment and the results of the ER pathway activity model. ER protein expression was visually scored according to two methods. First, ER protein expression was estimated by the total percentage of positive stained tumor cell nuclei. Second, staining intensity was categorized in percentages of tumor cells with negative, weak, moderate or strong staining. Finally, ER histoscores were calculated using a weighted method from the sum of (1 x % weak cells)\u2009+\u2009(2 x % moderate cells)\u2009+\u2009(3 x % strong cells), deriving histoscores between 0 and 300 . Mean sc2 tumor surface. Total mRNA was extracted according to the manufacturer\u2019s protocol . mRNA concentrations were measured\u00a0using a Qubit\u00ae RNA HS Assay Kit and Qubit\u00ae Fluorometer . Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis was performed using\u00a0a SuperScript\u2122 III Platinum\u2122 One-Step qRT-PCR kit . OncoSignal PCR plates  were filled with one nanogram mRNA per well and processed\u00a0using a CFX96 Real-Time PCR Detection System . Sufficient mRNA input was confirmed by an internal quality control of reference genes.Consecutive FFPE sections of\u00a05 \u03bcm with identical annotated tumor areas were manually scraped for the collection of tumor tissue. Depending on total annotated tumor area, multiple sections were macro-dissected resulting in at least 20\u00a0mmFunctional ER signaling pathway activity was assessed using\u00a0an OncoSignal pathway assay , which is based on mRNA expression levels of ER-specific target genes and has been described in detail previously , 14. An p value was below 0.05. All statistical analyses were conducted using SPSS  and RStudio  was used for data visualization.Intra-class correlation coefficients were determined with a two-way mixed model to test the overall concordance between total percentage ER protein expression and ER histoscore assessments of both pathologists. Differences in mean ER signaling pathway activity between ER histoscore groups were tested\u00a0using a Kruskal-Wallis test. Spearman\u2019s rank-order correlation coefficient was used to assess correlations. Statistical testing results were considered significant if the In this study we included 29 patients diagnosed with advanced stage HGSC with a median age at diagnosis of 63\u00a0years range 31\u201385\u00a0years). Four patients were premenopausal at the time of diagnosis, one patient was considered perimenopausal and 23 patients were postmenopausal. For one patient we were unable to determine menopausal status as endometrial sections were unavailable for revision and age at diagnosis was insufficient to confirm postmenopausal status. Patients were diagnosed with FIGO stage IIIC (72%) or IV (28%) disease and tumor origin was defined as ovarian (83%), Fallopian tube (7%) and extra-ovarian (10%) . In these higher ER histoscore groups, we observed several HGSC samples with low ER signaling pathway activity, indicating that presence of nuclear ER is required, but not sufficient to prove a transcriptionally active ER signaling pathway.Functional ER signaling pathway activity was determined in the same 29 HGSC samples.\u00a0The mean ER signaling pathway activity was 12.09 (SD 6.40) (Table  p\u2009=\u20090.473) and ER histoscores  . The association between ER signaling pathway activity and menopausal status indicates that the biological availability of estradiol in premenopausal women may affect the tumor\u2019s sensitivity to hormones. Since in premenopausal women estradiol is constantly produced by the ovaries, the tumor\u2019s signaling pathway activity could become dependent on the paracrine and endocrine availability of estradiol. With increasing age, the depletion of ovarian follicles causes a steady decline in estradiol production by the ovary [In premenopausal HGSC (n\u2009=\u20094) we measured significant higher ER signaling pathway activity compared to postmenopausal HGSC n\u2009=\u200923) . In addition, the authors reported no correlation between ESR1 gene\u00a0product  levels, and ER signaling pathway activity (p\u2009=\u20090.510). Others studied ER signaling pathway activity in a cohort mainly consisting of endometrial cancer patients (n\u2009=\u200983) using the ER pathway activity model [p\u2009<\u20090.001). In line with our observations, a wide variation in ER signaling pathway activity was detected in the higher ER protein expression groups (11\u201350% and 51\u2013100%), indicating that positive ER protein expression in endometrial cancer also did not automatically imply transcriptional activation of the ER signaling pathway.Our findings are supported by a study\u00a0on ER signaling pathway activity in 130 ER positive breast cancer patients using the ER pathway activity model . In thisty model . Here, sBesides the limited number of\u00a0patients included, our study lacks anti-estrogen response data, as the included HGSC patients did not receive anti-estrogen therapy. Therefore, we were unable to study the predictive value of the ER pathway activity model regarding anti-estrogen response. However, in multiple cohort studies the model was able to select subsets of ER positive breast cancer patients with an active ER signaling pathway and\u00a0a significantly better response to anti-estrogen targeted therapy , 15, 16.Taken together, our\u00a0data indicate that ER protein expression\u00a0as detected by immunohistochemistry in HGSC not always translates into active ER signaling pathway activity based on mRNA levels of ER-specific target genes. Further investigation is necessary to confirm ER signaling pathway activity as a predictive marker for response to anti-estrogen therapy.ESM 1(DOCX 23\u00a0kb)"}
+{"text": "Hypertension is the leading cause of cardiovascular disease, particularly in low- and middle-income countries. Improved awareness of hypertension status can significantly increase early treatment, thereby reducing cardiovascular complications and premature death. This study aimed to report the prevalence of the awareness, treatment, and control of hypertension among the adult population in Burkina Faso.  We performed a secondary analysis of the first national population-based survey on common risk factors of noncommunicable diseases in Burkina Faso. It was a national representative cross-sectional survey among adults aged 25\u201364 years. Awareness of hypertension was defined by blood pressure \u2265140/90\u2009mmHg or a prior diagnosis by a health worker or the use of any antihypertensive drugs. A modified Poisson regression model using a generalized estimating equation was used to identify factors associated with awareness of hypertension. p = 0.019). The prevalence of awareness increased with increasing age and education level. Nearly one-third (29.3% (95% CI: 25.3%\u201333.6%)) of people with hypertension needed antihypertensive drug treatment.  A total of 4628 people with valid blood pressure measurements were considered. Of them, 828 had hypertension. Among people with hypertension, the prevalence of awareness was 17.5% (95% CI: 14.4%\u201321.1%), and 47.3% (95% CI: 37.6%\u201357.3%) of them had taken antihypertensive medications for their hypertension. One-third (35.5% (95% CI: 23.3%\u201349.9%)) of those who took medications had controlled hypertension. The prevalence of awareness was significantly higher among women (21.1% (95% CI: 16.4%\u201326.7%)) compared with men (13.8% (95% CI: 10.4%\u201317.9%)) ( There was a poor level of awareness, treatment, and control of hypertension among adults in Burkina Faso. Effective control strategies to increase the screening of hypertension in primary care and at the community level are necessary in Burkina Faso. Hypertension is the leading cause of cardiovascular diseases (CVDs) worldwide, with at least 22.3% of CVDs being attributable to hypertension . Nearly Hypertension is a silent and asymptomatic \u201ckiller,\u201d since there are no symptoms in the early stage of this condition. Severe complications  might occur before symptoms appear. Despite the widespread availability of antihypertensive medications, the burden of hypertension and its complications is rising . UnawareIn Burkina Faso, there is a high prevalence of hypertension, estimated to be 18.5% . Nationa2 with 20,870,060 habitants in 2019 [https://data.worldbank.org/indicator/SP.DYN.LE00.IN?locations=BF). The proportion of the population living in urban areas increased  from 12.7% in 1985 to 22.7% in 2006 [This research was a secondary analysis of the last national survey on CVD risk factors conducted in 2013 in Burkina Faso. Burkina Faso is located in the SSA region in West Africa, covering a surface area of 272,960\u2009km in 2019 . The cou in 2006 . The cou in 2006 , 17. TheThis unique national survey focused on common NCDs risk factors was carried out in 2013. It was a national and regional representative survey that used the World Health Organization (WHO) Stepwise approach and was a descriptive cross-sectional study including people aged 25\u201364 years, in which random sampling was performed. Cluster-stratified three-stage sampling was applied. In the first stage, 240 primary sampling unit enumeration areas (EAs) (or clusters) were randomly selected, proportionally to the number of households within each stratum (region and residence). The EA list provided from the fourth population and habitat census realized in Burkina Faso in 2006  was used as the EA sampling base. A fixed number  of the households were selected in each cluster after enumeration of the resident households. The Kish selection method was used to select a member of household to participate in the study. A total of 4800 persons were selected using the Kish approach, and from those, 4695 were interviewed; others declined to participate.The stepwise survey collected much information about NCD risk factors and oral health. All risk factors were collected using the standardized WHO stepwise approach. Data on sociodemographic variables and behavioral cardiovascular risk factors were collected through direct interviews with household participants. The metabolic risk factors were collected through physical and biological measurements. Blood pressure was collected and measured by an electronic device . The blood pressure was measured three times for each individual using the same device and by the same practitioner at the right arm after 15\u2009min intervals rest. The participants with a valid measurements of blood pressure were considered in our analysis. The measurement of blood pressure was well described by Soubeiga et al. . The meaOur analysis focused on hypertension, defined by blood pressure above or equal to 140\u2009mmHg for systolic pressure and/or 90\u2009mmHg for diastolic pressure or antihypertensive medication intake. The awareness of hypertension was measured during the survey by asking each participant the question, \u201cHave you ever been told by a doctor, nurse, or other healthcare worker that you have hypertension (high blood pressure)?\u201d . The awaBased on previous studies using the same data , 19, 20 Tobacco use was focused on current smoking. Alcohol consumption in this study corresponded to usual alcohol consumption within 30 days given by the question, \u201cHave you drunk an alcoholic drink in the last 30 days?\u201d Optimal fruit and legume consumption corresponded to at least five portions of fruit and/or legumes consumed a day. For physical activity, we computed this category using the WHO's analysis guidelines: the variable was categorized into three groups . Body mass index (BMI) was classified into four groups, as recommended by WHO . The raised blood glucose was defined by capillary glycaemia as above or equal to 6.1\u2009mmol/L. Based on the current guidelines, diabetes may be diagnosed based on plasma glucose criteria, either the fasting plasma glucose (FPG) value or the 2-h plasma glucose (2-h PG) value during a 75-g oral glucose tolerance test (OGTT), or A1C criteria . Impairep < 0.05) was considered.We first described the characteristics of the study population. We then evaluated the overall prevalence of awareness, included by sociodemographic and cardiovascular risk factors. For the treatment and control of hypertension, we reported the national prevalence without disaggregation by subgroups, since the numbers of treated and controlled hypertension cases were small. The chi-square test was used to check for differences in the prevalence of awareness by characteristics. A modified Poisson regression model using a generalized estimating equation (GEE) was implemented to derive the prevalence ratios (PRs) with robust variance while taking into account the clustering of observations. The univariate and multivariable GEE was applied to individual-level covariates using enumeration area identity as the clustering variable. PRs with 95% confidence intervals were calculated, and statistical significance at the 5% level . In urban areas, this figure was 34.1% (95% CI: 27.3\u201341.5), and for rural areas, it was 26.7% (95% CI: 21.9\u201331.2) (p=0.097). We noted that 13.9% (95% CI: 8.2\u201322.6) of the adults who were aware their hypertension had seen a traditional healer, and 11.6% (95% CI: 6.7\u201319.6) were taking herbal or traditional remedy.Among adults who were aware of their hypertension, 47.3% (95% CI: 37.6\u201357.3) reported antihypertensive medication prescribed by a doctor or other health worker. One-third (35.5% (95% CI: 23.3\u201349.9)) of those who took medication had controlled their hypertension. Nearly one-third (29.3% (95% CI: 25.3\u201333.6)) of people who were not aware of their hypertension needed antihypertensive drug treatment according to WHO guidelines for cardiovascular risk management. This proportion was 27.3% (95% CI: 21.9\u201333.3) for women and 31.1 (95% CI: 25.4\u201337.4) for men (This study provides the country-level representative prevalence of awareness of hypertension among the adult population in Burkina Faso, which is one of the lowest-income countries in the world with a high prevalence of hypertension and of other cardiovascular risk factors, as shown by the first STEPwise survey and its related published papers , 20, 28.The prevalence of awareness in our population was lower compared to the overall prevalence in SSA reported by Adeloye and Basquill  in a sysThis study reported that, after adjusting for sociodemographic variables and cardiovascular risk factors, the awareness of hypertension was higher among the elderly population, obese adults, and people with more education, which is in accordance with the research findings in the context of low-income countries. Many studies have reported a high prevalence of awareness of hypertension among elderly and obese people , 33, 34.This study reported that half of the participants aware of their hypertension did not take antihypertensive medication, and nearly two-thirds of them had not controlled their hypertension. This finding is consistent with studies conducted in many LIC contexts , 29, 33.The main limitation of this study was the measurement of blood pressure in a single visit, which might have overestimated the number of individuals with high blood pressure. The ambulatory monitoring of blood pressure is recognized to predict the risk for morbidity more accurately than a single measurement of blood pressure . The finThis study is the first nationally representative estimation of awareness of hypertension and its treatment and control in Burkina Faso. The findings suggest a lower prevalence of awareness, treatment, and control, as shown in many other previous studies in low-income countries. We also noted that the elderly, those with more education, and obese people had a higher prevalence of awareness of hypertension. This study shows a national picture of hypertension, before starting any efforts to manage NCDs in the country, which might offer an opportunity to better understand the impact of the national NCD program initiated in 2016 on the hypertension burden. While waiting for a new STEPwise survey in Burkina Faso, these findings might guide policymakers for effective management of hypertension in the country, which might start by better screening people with hypertension through real task sharing with nonphysicians or community health workers. Nevertheless, more studies should be needed to show the best way to improve awareness, treatment, and control of hypertension in the low resource setting, since hypertension is rising in such context and suggesting a future epidemic of hypertension-related complications like cardiovascular diseases."}
+{"text": "The growing burden of hypertension is emerging as one of the major healthcare challenges in low- and middle-income countries (LMICs), such as Nepal. Given that they are struggling to deliver adequate health services, some LMICs have significant gaps in the cascade of hypertension care . This results in uncontrolled hypertension, placing a high burden on both patients and healthcare providers.The objective of this study was to quantify the gaps in hypertension screening, awareness, treatment, and control in the Nepalese population.We used the data from a pooled sample of 9682 participants collected through two consecutive STEPwise approach to Surveillance (STEPS) surveys conducted in Nepal in 2013 and 2019. A multistage cluster sampling method was applied in the surveys, to select nationally representative samples of 15- to 69-year-old Nepalese individuals. Prevalence ratios were calculated using multivariable Poisson regression.Among the hypertensive participants, the prevalence of hypertension screening was 65.9% , the prevalence of hypertension awareness was 20% , the prevalence of hypertension treatment was 10.3% , and the prevalence of hypertension control was 3.8% . The unmet need of hypertension treatment and control was highest amongst the poorest individuals, the participants from Lumbini and Sudurpaschim provinces, those who received treatment in public hospitals, the uninsured, and those under the age of 30\u00a0years.The gaps in the cascade of hypertension care in Nepal are large. These gaps are particularly pronounced among the poor, persons living in Lumbini and Sudurpaschim provinces, those who sought treatment in public hospitals, those who did not have health insurance, and young people. National- and local-level public health interventions are needed to improve hypertension screening, awareness, treatment, and control in Nepal. According to recent estimates, hypertension is the biggest single contributor to death and disability globally, accounting for 10.4 million deaths a year in 2017 ,4. AmongThe increasing prevalence of hypertension is also a growing concern in Nepal. Surveys conducted in different parts of Nepal between 2011 and 2016 suggest that the prevalence of hypertension has increased over the past decade . A recenThe prevalence of hypertension screening, awareness, treatment, and control are low in LMICs, indicating gaps in the cascade of hypertension care . Among aGaps in the cascade of hypertension care are disproportionately distributed across different socio-demographic groups. Studies have shown that hypertension control is significantly lower in younger South Asian individuals as compared with other age groups . SimilarQuantifying the unmet need to provide care and understanding its distribution in each step of the care process is critical for the effective management of the disease. The cascade of care framework is commonly used to describe and track the sequential steps across the continuum of care in the treatment of infectious diseases, and particularly in the treatment of HIV, hepatitis C, and tuberculosis . In HIV Several studies have reported the prevalence of hypertension in Nepal, including the two recent Nepalese STEPwise approach to Surveillance (STEPS) surveys ,22,23. HWe analysed data from two STEPwise approach to Surveillance (STEPS) surveys conducted in Nepal in 2013 and 2019. Both were nationally representative surveys in which the multistage cluster sampling method was used to select a single individual with 15 to 69\u00a0years of age from each sampled household. STEPS 2013 collected data from 4200 respondents selected from 210 clusters between January and June 2013. STEPS 2019 collected data from 5593 individuals from 737 clusters between October 2018 and March 2019. The response rates were 98.6% in 2013 and 86.4% in 2019. Detailed information about the survey methodology for STEPS 2013  and STEPThe STEPS survey used the World Health Organization (WHO) NCD STEPS instrument, structured into STEP I, STEP II, and STEP III to measure the behavioural, anthropometric, and biological characteristics of the participants ,23. For The outcome variables were hypertension screening, awareness, treatment, and control, which are collectively defined as the cascade of hypertension care. To assess hypertension screening, the surveys asked if the individual participants had ever had their blood pressure measured by a doctor or another health worker. Participants were considered aware if they knew they had high blood pressure, which had to have been diagnosed by the doctor or another health worker. Hypertension treatment was defined as the use of any antihypertensive medication to lower blood pressure at the time of data collection. We considered that hypertension was controlled, if the participants had a systolic blood pressure below 140\u00a0mmHg and a diastolic blood pressure below 90\u00a0mmHg. The unmet need for the cascade of care was categorised as: unscreened, unaware, untreated, and uncontrolled hypertension. This need was assessed using the reciprocal values of screening, awareness, treatment, and control of hypertension, respectively.The systolic and diastolic blood pressure was measured using a digital, automated blood pressure monitor  with a medium-sized cuff. Before blood pressure measurements were taken, the survey data enumerators asked the participants to rest for 15\u00a0minutes, roll up their clothing over their arm, sit up straight and quietly, and keep their legs uncrossed. The enumerators recorded three systolic and diastolic blood pressure readings at five-minute intervals. We averaged the second and third readings to obtain the final blood pressure readings. Participants were considered as hypertensive, if they had systolic blood pressure \u2265 140 mm Hg and/or diastolic blood pressure \u2265 90 mm Hg or were taking anti-hypertensive medications as recommended by the Joint National Committee-VII .We used the pre-existing categories of age, gender, marital status, education, and occupation as defined by the survey. The 2019 survey was the first STEPS survey to record the household wealth index. This index was divided into quintiles, with the lowest quintile denoting the poorest subgroup. The 2019 survey was also the first one to collect data based on the new provincial system and data on health insurance.The surveys followed the WHO standard international guidelines to collect data on behavioural, clinical, and metabolic risk factors. A detailed description of the data collection methods used is available elsewhere ,23. Brie2 (as not overweight or obese), 25.0 to 29.9 kg/m2 (as overweight), and \u2265 30.0 kg/m2 (as obese) \u00a0=\u00a0\u22120.19), unaware (cin\u00a0=\u00a0\u22120.16), untreated (cin\u00a0=\u00a0\u22120.11), and uncontrolled (cin\u00a0=\u00a0\u22120.06) hypertension) \u2013 were the highest among the poorest Nepalese .Figure Of the participants receiving medication, around half (50.2%) had sought treatment in private health centres, 34.9% had visited public hospitals and primary healthcare centres, and 14.9% had received treatment from other intuitions, such as community health centres, Ayurveda hospitals , and pharmacies (i.e. chemist shops) . The hypThe probability of being screened was positively associated with the age, education level, and body mass index. Screening was more prevalent in the people with diabetes, those who did not consume alcoholic drinks, and those who ate more fruits .Table 3Age was positively associated with the hypertension awareness. More men than women were aware of their hypertension. Less physically active, overweight, and obese participants had a higher prevalence of awareness than others .p <\u00a00.021); Supplementary file 1). The treatment rate was significantly higher among obese and diabetic participants and those who did not consume alcoholic drinks  and Canada (66%) have the highest prevalence of hypertension control and are examples of countries that provide effective hypertension care . After iThe gaps in the cascade of hypertension care were inversely related to wealth. A higher prevalence of hypertension screening, awareness, treatment, and control was associated with higher wealth quintiles. The socio-economic inequalities in health and healthcare utilization are common in low- and middle-income countries . A studyOur study also found that the prevalence of hypertension treatment and control was significantly higher in people who had health insurance coverage. Previous studies showed that patients with health insurance are less likely to report barriers in accessing hypertension care  and achiAn age disparity in the cascade of hypertension care was prominent. Participants in the lower age group (< 30\u00a0years) were less likely to be screened, aware, treated, and have controlled blood pressure, results that are consistent with those of American studies that found that young adults had a 33% lower rate of being diagnosed  and a 44Except for alcohol consumption, other behavioural risk factors such as smoking, fruits and vegetable intake, and physical activity were not significantly associated with hypertension control. Those who did not drink alcohol were more likely to take medication and have controlled blood pressure. Participants with a higher BMI and those with diabetes were more likely to seek hypertension treatment than others. However, hypertension control was not associated with diabetes. Although most of the study variables were not significantly associated with hypertension control, it is important to note that all the participants who had controlled blood pressure had also been taking antihypertensive drugs. However, studies have shown that several barriers to hypertension treatment exist in Nepal that potentially impede the initiation of treatment and adherence and lead to uncontrolled blood pressure among hypertensive patients ,54. TherThis study had some limitations. The surveys were not primarily designed to assess gaps in the cascade of hypertension care. Therefore, this study lacked some potentially important explanatory variables, such as medication adherence. Furthermore, the findings on fruits and vegetable intake, physical activity, smoking, and alcohol consumption might have been influenced by the recall and social desirability biases, as the responses were collected via self-reports. In addition, the blood pressure was measured on a single occasion only, which may have resulted in a miscategorization of some participants. Similarly, the finding is limited to the quantitative assessment of the gaps. Further qualitative studies are required to gain a deeper understanding of the contextual factors (e.g. perceived barriers and facilitators) that are likely to be associated with the gaps in the cascade of hypertension care in Nepal.The main strength of the study is the representative nature of the data we used for the analysis. STEPS surveys follow the standard framework and methods of the WHO STEPwise Approach to Noncommunicable Disease Risk-Factor Surveillance to collect nationally representative data. Furthermore, this study represents an original contribution to the knowledge base in that it quantifies the gap in hypertension care and depicts its distribution across different population groups, particularly because a large variety of participant characteristics were taken into account.The gaps in the cascade of hypertension care in Nepal are large, and the rate of hypertension control is critically low. The gaps are particularly pronounced among the poor, those living in Lumbini and Sudurpaschim provinces, those who had sought treatment in primary healthcare centres and public hospitals, those who did not have health insurance, and young people. National- and local-level public health interventions are needed to improve hypertension screening, awareness, treatment, and control in Nepal. Mass screening that targets the most heavily affected areas and population groups, increasing access to quality care services at public primary healthcare centres and public hospitals, and applying behavioural interventions to address the barriers to hypertension treatment and control are recommended. Expanding the role of community health workers in supporting hypertension management and medication adherence could be a feasible strategy to help patients overcome barriers to hypertension treatment and control in the Nepalese context."}
+{"text": "Osteoarthritis (OA) is the most common chronic joint disease in the elderly population. Growing evidence indicates that a balance between autophagy and apoptosis in chondrocytes plays a key role in OA\u2019s cartilage degradation. Thus, drugs targeting the balance between apoptosis and autophagy are potential therapeutic approaches for OA treatment. In previous studies, we found that the activation of \u03b17 nicotinic acetylcholine receptors (\u03b17-nAChRs) alleviated monosodium iodoacetate (MIA)-induced joint degradation and osteoarthritis pain. To explore the potential functions of \u03b17-nAChRs in autophagy and apoptosis signaling in knee OA, we compared the expression of \u03b17-nAChRs in human knee articular cartilage tissues from normal humans and OA patients. We found that knee joint cartilage tissues of OA patients showed decreased \u03b17-nAChRs and an imbalance between autophagy and apoptosis. Next, we observed that \u03b17-nAChRs deficiency did not affect cartilage degradation in OA development but reversed the beneficial effects of nicotine on mechanical allodynia, cartilage degradation, and an MIA-induced switch from autophagy to apoptosis. Unlike in vivo studies, we found that primary chondrocytes from \u03b17-nAChRs knockout (KO) mice showed decreased LC3 levels under normal conditions and were more sensitive toward MIA-induced apoptosis. Finally, we found that \u03b17-nAChRs deficiency increased the phosphorylation of mTOR after MIA treatment, which can also be observed in OA patients\u2019 tissues. Thus, our findings not only confirmed that nicotine alleviated MIA-induced pain behavior and cartilage degradation via stimulating the \u03b17-nAChRs/mTOR signal pathway but found the potential role of \u03b17-nAChRs in mediating the balance between apoptosis and autophagy. OA is a leading cause of disability among older adults, affecting their physical health and mental health2. With the aging of modern society, OA is likely to cause increased morbidity and higher healthcare costs worldwide3.Osteoarthritis (OA), a chronic degenerative joint disease, is mainly characterized by cartilage degradation, subchondral bone sclerosis, synovial inflammation, and osteophyte formation. It most commonly affects weight-bearing and high-use joints, including those of the hip, knees, and hands4. Different studies have reported that the rate of apoptotic chondrocytes in OA cartilage ranges from <1% to ~20%6. Numerous empty lacunae and decreased chondrocyte numbers in the calcified cartilage layer were observed compared to those in other cartilage layers, indicating the relative contribution of chondrocyte apoptosis in pathogenesis OA7. Recently, autophagy, a cellular self-digestion process, has been intimately connected with chondrocyte apoptosis in OA8. In the aging process9 and OA mouse models10, the expression of autophagy proteins ULK1 (unc-51 like autophagy activating kinase 1) and Beclin-1 was decreased, accompanied by increased apoptosis. Furthermore, rapamycin-induced autophagy ameliorated cartilage degradation in OA-like lesions11 and mouse models12. These results suggest that drugs targeting the balance between apoptosis and autophagy may be potential therapeutic approaches for OA treatment.A balance between autophagy and apoptosis in chondrocytes plays a key role in the cartilage degradation of OA. Apoptosis is a physiological process of programmed cell death. It is regulated by many factors and is highly involved in the development and growth of the human body, homeostasis of the internal environment, and the aging process. Abnormal apoptotic processes can lead to various pathological conditions, including tumors, dysplasia, and various degenerative diseases13. A series of retrospective analyses of the association between smoking and OA points toward an important etiologic clue, indicating that some particular bioactive substances in tobacco help alleviate cartilage degradation associated with OA15. Nicotine, a key component in tobacco products, may serve as a potential therapeutic agent for OA via activating alpha-7 nicotinic acetylcholine receptors (\u03b17-nAChRs)18. \u03b17-nAChRs are recognized to have essential immunological anti-inflammatory roles in the human body in recent years22. We also found that \u03b17-nAChRs activation with nicotine alleviated monosodium iodoacetate (MIA)-induced joint degradation23 and OA pain18. However, little is known about the role of \u03b17-nAChRs in autophagy and apoptosis signaling in knee OA.A meta-analysis revealed an inverse association between cigarette smoking and the risk of knee OA in males, irrespective of study designIn the present study, using our previously established in vivo and in vitro models and an \u03b17-nAChR knockout (KO) mouse model, we investigated whether autophagy and apoptosis were involved in the progression of MIA-induced OA lesions and further observed whether \u03b17-nAChRs activation participated in coordinating autophagy and apoptosis signaling in OA progression.24 and Lynx1 (Ly6/Neurotoxin 1)25 was significantly decreased (P\u2009<\u20090.05) in OA patients, indicating the dysfunction of the nicotinic cholinergic system. As expected, the levels of pro-apoptotic protein Bax and cleaved caspase-3 were significantly increased (P\u2009<\u20090.01) in OA patients, while that of anti-apoptotic protein Bcl-2 was significantly reduced (P\u2009<\u20090.01)  Fig. . Also, t01) Fig. . These rP\u2009>\u20090.05). Consistent with the finding in immunohistochemistry, there was no difference in the cartilage degeneration score  than by treatment with MIA alone. Moreover, nicotine treatment increased Beclin-1+ cells by 247.5% and LC3+ cells by 191.5% than with MIA alone in WT mice but not in KO mice. Thus, these findings suggest that \u03b17-nAChRs may not be directly involved in MIA-induced OA development but mediate the effects of nicotine on the switch from autophagy to apoptosis.To determine the effects of \u03b17-nAChRs on MIA-induced chondrocyte apoptosis and autophagy in vivo, we counted the numbers of TUNEL. + Fig. , and LC3. + Fig.  cells inP\u2009<\u20090.01; Fig. P\u2009<\u20090.05; \u0394\u03a8m; Fig. P\u2009<\u20090.05; Fig. P\u2009<\u20090.01; Fig. P\u2009<\u20090.05; Fig. P\u2009<\u20090.05)  Fig. . As expe26. We next examined whether the mTOR signaling pathway contributes to the protective effects of \u03b17-nAChRs against MIA-induced switch from autophagy to apoptosis in chondrocytes. Compared to WT chondrocytes, the phosphorylation of mTOR was increased in KO chondrocytes after MIA treatment 32. Moreover, \u03b17-nAChR expression was shown to be related to Bax expression33. Thus, \u03b17-nAChRs in mitochondria outer membrane plays a critical role in the anti-apoptotic mechanisms of nicotine, but whether the plasma membrane \u03b17-nAChRs also involved in the anti-apoptotic effects need to be further studied.The aging of joints is characterized by the loss of progressive functional and physiological integrity caused by multiple factors, including genomic and epigenetic changes and cellular senescence34. For instance, p62 is a key factor in the selective autophagic degradation of many proteins and mitochondria. It can directly interact with some proteins and regulate the apoptosis signaling pathway35. Some studies have confirmed that the Bcl-2/Beclin-l complex, which determines whether a cell enters an apoptosis program or initiates an autophagy program, functions as a \u201ctrigger\u201d in the occurrence and development of apoptosis and autophagy. Beclin-l can be linked to Bcl-2 by its BH3 structural domain. When Beclin-1 is released from the Bcl-2 binding protein, autophagy is activated. Death-associated protein kinase phosphorylates Beclin-1 and JNK phosphorylates Bcl-236. In the present study, \u03b17-nAChR deficiency reduced the activation of autophagy signaling pathway by nicotine, as evidenced by the reversal of nicotine-induced regulation of Beclin-1, p62, and LC3-II in mouse primary chondrocytes. Interestingly, although no difference in the numbers of Beclin-1+ and LC3+ cells in vivo, LC3-II levels in KO chondrocytes were significantly lower than that in WT chondrocytes in vitro. Chondrocyte difference between in vivo and in vitro was also found in apoptosis37 and cartilage growth38. Recently, \u03b17-nAChRs deficient mice showed an impairment of the autophagic function via reducing the AMPK-mTOR-p70S6K signaling pathway39. Since we observed decreased levels of LC3 in KO chondrocytes, it is important to study further the role of \u03b17-nAChRs in autophagy signaling in knee OA.A growing number of studies have shown that, in OA, the reduction of critical autophagy regulators is accompanied by increased cell apoptosis, which can aggravate cartilage degradation. As a conserved protein degradation pathway in eukaryotic cells, autophagy can save and provide energy for cells by degrading proteins and residual organelles and can promote the degradation of apoptosis-related proteins, thereby reducing the cytotoxicity caused by these aggregated proteins40. We also found that phosphorylation of mTOR in tissues of OA patients was significantly increased compared with that in normal cartilage tissues. Furthermore, p-mTOR was increased in KO chondrocytes than in WT mouse chondrocytes after MIA treatment. Knockout (KO) of \u03b17-nAChRs also blocked the recovery of MIA-induced phosphorylation of mTOR by nicotine treatment in vivo and in vitro. Yang et al. found that in in vivo and in vitro studies, mTOR complex 1, downstream to p-ERN1, could not only suppress autophagy but also promote p-EIF2AK3\u2012mediated endoplasmic reticulum apoptosis26. Their results established that aberrant mechanical loading causes cartilage degeneration by activating, at least in part, the mTOR complex 1 signaling, which modulates autophagy and apoptosis in chondrocytes. Several experiments have demonstrated that inhibiting mTOR through pharmacological or genetic methods to enhance autophagy can prolong the lifespan of chondrocytes. Our working model shows that \u03b17-nAChRs switch from autophagy to apoptosis in OA cartilage degradation  at 4\u2009\u00b0C for 10\u2009min and stored at \u221270\u2009\u00b0C before use.Four human cartilage specimens were retrieved from patients who underwent total knee replacement surgery, while four control specimens were obtained from individuals who underwent traumatic amputation and having neither OA nor rheumatoid arthritis. All the specimens were obtained from the Department of Orthopedics, the First Affiliated Hospital of Nanjing Medical University. Informed consent was obtained from each participant, and the procedures were approved by the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University. Proteins were extracted by treating the samples with 1\u2009mL 4\u2009M guanidinium chloride containing 50\u2009mM sodium acetate, 10\u2009mM EDTA, and 0.1\u2009M hexanoic acid pH 5.8 at 4\u2009\u00b0C for 48\u2009h. Each extract was separated from the cartilage residue by centrifugation . \u03b17-nAChR KO mice  were purchased from the Jackson Laboratory . Wild-type (WT) C57BL/6\u2009J mice  were purchased from the Animal Core Facility of Nanjing Medical University . Mice were maintained in an animal facility under a standardized light-dark cycle and had free access to food and water. Both genotypes of mice were randomly divided into control, MIA, and MIA\u2009+\u2009Nic groups. Behavioral testing was performed during the light cycle.44. Briefly, under anesthesia using isoflurane inhalation, 0.3\u2009mg MIA in 10\u2009\u03bcL physiological sterile saline was administered in the right knee joint of each mouse. Sham operation was performed using a similar surgery but with a 10\u2009\u03bcL saline injection. Seven days before the MIA injection, mice in a nicotine-treated group received intraperitoneal (i.p) injections of a well-known \u03b17-nAChRs agonist nicotine  once daily. After the MIA injection, the mice were administered nicotine injections once daily for 3 weeks, while matched mice received an equal volume of saline. Nicotine was injected 30\u2009min before each MIA injection. Methyllycaconitine , used for nicotine antagonism studies, was injected 30\u2009min before nicotine administration18.OA was induced by a single intra\u2010articular injection of , as previously described18. Mice were habituated to the test environment for at least 3 days before baseline testing. Next, they were placed in boxes set on an elevated metal mesh floor and allowed to habituate for 30\u2009min before testing. Each hind paw\u2019s plantar surface was stimulated with a series of von Frey hairs with log-arithmetical increments in stiffness, applied perpendicularly to the plantar surface. Each mouse was tested three times, and the average threshold was measured. Mice were considered allodynic when they displayed a response to 0.4\u2009g of hair or less. Normal responses are within the range of 1\u20132\u2009g. All the staff involved in performing the behavioral tests and drug administration were blinded.Mechanical sensitivity was measured using the von Frey hair test . Calibrated von Frey hairs  were applied to the plantar surface of hind paw of mice until the fibers bent45.Mice were euthanized at 3 weeks after MIA administration, and the knee joints were fixed immediately in 4% paraformaldehyde, decalcified in 10% EDTA for 14 days at 4\u2009\u00b0C, and embedded in paraffin. Sagittal sections were cut at 4\u2009\u03bcm thickness and then examined by toluidine blue and hematoxylin-eosin staining, and immunohistochemistry. Cartilage degeneration in the sections was assessed by three independent investigators using three histological scoring systems 2 fields for each coded slide.Decalcified paraffin-embedded sections of knee joints were processed for TUNEL assays using an in situ cell death detection kit  following the manufacturer\u2019s instructions. Apoptotic cells were determined by counting the percentage of TUNEL\u2009+\u2009cells in five 0.24\u2009mmDecalcified paraffin-embedded sections were individually incubated with primary antibodies to Beclin-1  or LC3 , followed by incubation with the secondary antibodies and detected using a diaminobenzidine kit. All the sections were stained with hematoxylin as a nuclear stain. Beclin-1- or LC3-positive cells were counted using Image J software .3) were aseptically dissected from femoral head caps, and chondrocytes were obtained by incubation in 0.25% trypsin containing 0.02% EDTA for 15\u2009min followed by digestion with collagenase II  at 37\u2009\u00b0C for 6\u2009h. The cells were washed twice with phosphate-buffered saline (PBS) and cultured in DMEM/F-12  supplemented with 10% (v/v) FBS and 100 units/mL of penicillin  and streptomycin  at 37\u2009\u00b0C in a humidified atmosphere containing 5% CO2.Normal articular cartilage was obtained from WT and KO mice euthanized under anesthesia. After knee joint surgery, articular cartilage pieces . After fixation, the cells were stained with Hoechst 33342  for 20\u2009min and observed under a fluorescence microscope . Cells displaying highly-condensed and brightly-stained nuclei were regarded as apoptotic cells. The apoptotic index was defined as the ratio of apoptotic cell number to total cell number.Primary chondrocytes were seeded at 8\u2009\u00d7\u200910rpm for 5\u2009min. Next, the cells were washed twice with PBS, centrifuged at 1000\u2009rpm for 5\u2009min, and gently resuspended in 500\u2009\u03bcL binding buffer. After adding 5\u2009\u03bcL annexin V-FITC and propidium iodide solutions, the cells were incubated in the dark for 10\u2009min and analyzed by flow cytometry  according to the manufacturer\u2019s instructions.Apoptotic cells were quantified by flow cytometry using an Annexin V-FITC/PI Apoptosis Detection Kit . Primary chondrocytes were digested with trypsin without EDTA and centrifuged at 1000\u20096 cells/mL and 10\u2009\u03bcL of 200\u2009\u03bcM JC-1 dye  was added. The samples were incubated at 37\u2009\u00b0C in a humidified atmosphere containing 5% CO2 for 20\u2009min and then analyzed by flow cytometry .Chondrocyte mitochondrial membrane potential (\u0394\u03a8m) was measured using the MitoProbeTMJC-1 assay kit for flow cytometry . Primary cultured chondrocytes were treated as described above. Each sample was suspended in 1\u2009mL warm PBS at ~1\u2009\u00d7\u200910Proteins were denatured in SDS sample buffer, separated by 10% SDS-PAGE, and transferred to nitrocellulose membranes using a wet transfer unit. The membranes were washed with Tris-buffered saline containing Tween-20 (TBST), blocked with 5% (w/v) milk in TBST at room temperature for 1\u2009h, and incubated with primary antibodies overnight at 4\u2009\u00b0C. Antibodies to Bcl-2 (#2876), Bax (#2772), cleaved caspase-3 (#9664), caspase-3 (#9665), the mammalian target of rapamycin (mTOR) (#2972), the phosphorylation of mTOR (p-mTOR) (#2971), Beclin-1 (#3495), p62 (#5114), and LC3 (#12741) ; as well as antibodies to \u03b17-nAChRs , SLURP-1 , Lynx1 , and \u03b2-actin  were used. On the next day, the membranes were washed four times with TBST buffer and incubated with secondary antibody for 1\u2009h, followed by four washes with TBST. Signals were detected using an enhanced chemiluminescence kit . The blots were scanned using a gel imaging system , and intensities of the protein bands were measured using Image J software .23. All data are expressed as mean\u2009\u00b1\u2009SEM. Statistical analyses were performed using one- GraphPad Prism software . Human cartilage tissue protein data were normalized against \u03b2-actin, and differences calculated using Student\u2019s unpaired t test. Mechanical withdrawal threshold was assessed via two-way repeated-measures analysis of variance (ANOVA) with time and treatment as factors followed by Tukey\u2019s test. Other data were assessed with one-way or two-way ANOVA followed by Tukey\u2019s test. P\u2009<\u20090.05 was considered to be statistically significant.The sample size was chosen to ensure adequate power to detect a pre-specified effect size according to the previous reports"}
+{"text": "Grapholita molesta (Busck). The expression of individual gene members differed between the developmental stages and insect tissues. High expression was found in third/fourth-instar larvae and in the midgut and Malpighian tubules. The response patterns of the genes exhibited diverse response patterns to the three representative insecticides were diverse.Eight CYP6 family genes were identified in Grapholita molesta (Busck), a global pest of pome fruits. P450 genes with the exception of CYP6AN35, which was most highly expressed in adults, consistently showed high expression in third- or fourth-instar larvae. The analysis of different tissues of adults showed that most of these genes were predominantly expressed in the midgut, Malpighian tubules, and/or fat body. The expression of these eight CYP6 genes was differentially affected by three representative insecticides: malathion (organophosphate), deltamethrin (pyrethroid), and chlorantraniliprole (carbamate). All eight CYP6 genes responded to malathion treatment. Only three CYP6 genes were highly expressed in deltamethrin-treated individuals. Chlorantraniliprole treatment exerted weak effects on gene expression. Interestingly, CYP6AN35 was a highly expression level in the adult head and its expression was induced by all three insecticides. CYP6AN35 may be a key gene in the metabolism of insecticides. This study provides a fundamental understanding of the functions of the CYP6 gene family in insecticide metabolism in G. molesta.Cytochrome P450 (CYP) monooxygenases comprise a superfamily of proteins that detoxify xenobiotics and plant secondary metabolites in insects. The CYP6 family is unique to the class Insecta, and its members participate in the metabolism of exogenous substances. In this study, we sequenced and characterized the full-length cDNAs of eight CYP6 family genes from  Grapholita molesta (Busck) (Lepidoptera: Tortricidae) causes serious harm to horticultural crops such as pear and peach. Specifically, this pest affects the yield and quality of crops by drilling into fruits and sprouts [G. molesta has increased sharply and the damage to fruit trees has become increasingly severe [G. molesta has become resistant to the major modes of insecticides [The global fruit-borne pest  sprouts ,2,3. Duey severe ,5. The cy severe . In the cticides ,8,9, succticides .Drosophila melanogaster [Aedes aegypti [Bombyx mori [Cydia pomonella [Locusta migratoria suggested that the CYP6 family plays a key role in the susceptibility of this insect to both carbamates and pyrethroids [Helicoverpa armigera [Bemisia tabaci showed that CYP6CM1 is associated with the metabolism of the neonicotinoid class of insecticides [Many studies have shown that the resistance mechanisms include the increased metabolic detoxification of insecticides and target site insensitivity . Metabolnogaster , and 158 aegypti , Bombyx byx mori , and Cydomonella , respectomonella . Among tomonella ,20. The omonella . A studyethroids . By knocarmigera . Furthercticides .Pardosa pseudoannulata [Procecidochares utilis revealed many unigenes involved in detoxification, including 50 unigenes of putative CYPs (P450s) in this organism [G. molesta, which included 13 unigenes in the CYP6 family [G. molesta.Gene sequencing technology provides the opportunity to identify more P450 genes. For example, with this technology, 120 CYP genes were identified in annulata . Transcrorganism . We have6 family , the bio6 family . HoweverG. molesta in response to three representative insecticides  were determined using a regression equation what allowed the prediction of the target insecticide of these CYP genes. This approach provided a fundamental understanding of the functions of the CYP6 gene family in insecticide metabolism and thus, providing a theoretical basis for the exploration of new pest control management for G. molesta, such as novel and durable pesticides.In this study, eight CYP6 genes were identified through bioinformatics analysis, and their molecular structures were predicted. Their expression at different developmental stages and three tissue specificity were analyzed. In addition, the expression levels of CYP6 genes in G. molesta individuals sampled were obtained from Taigu, Shanxi Province, China, and originated from a population that had been reared indoors with an artificial diet without exposure to any insecticide for more than five years. The growth environment had a temperature of 26 \u00b1 1 \u00b0C, a photoperiod of 15:9 h (light:dark), a relative humidity of 60\u201380%, and a light intensity of 4800 lx [The sampled  4800 lx ,29. To eG. molesta individuals at different developmental stages, including three adults, five pupae, five fifth-instar larvae, five fourth-instar larvae, ten third-instar larvae, thirty second-instar larvae, fifty first-instar larvae, and a hundred eggs were collected, and three biological replicates were established. The head, foregut, midgut, hindgut, fat body, Malpighian tubules, spermary, and ovary were harvested from healthy adults of G. molesta within 24 h of emergence, with sixty adults comprising a replicate and three biological repetitions were established.G. molesta adults.RNA was extracted from the obtained samples and used as a template for reverse transcription to cDNA. Quantitative PCR (qPCR) was used to quantify the initial expression levels of different genes at different developmental stages and in different tissues of G. molesta [http://www.ncbi.nlm.nih.gov/orffinder, 25 January 2022) was employed to screen nucleic acid sequences with complete ORFs, and the sequences were submitted to the Cytochrome P450 International Nomenclature Committee for naming. NCBI BLASTp was used to align the protein sequences, and the ExPASy ProtParam tool  was used for the analysis of parameters such as protein molecular weight, amino acid composition, acid-based amino acid number, and total average hydrophilicity. Signal peptides were examined with the SignalP4.1 server . ProtScale  was applied for the prediction of protein hydrophobicity and AlphaFold2  was applied for the prediction and simulation of the protein tertiary structure. A MEGA 7.0 cluster analysis of amino acid sequences was performed, and forty-three P450 genes were chosen from B. mori. The neighbor-joining (NJ) method with 1000 bootstrap replicates was used to construct a phylogenetic tree in MEGA 7.0 [The nucleic acid sequences of eight CYP6 genes were obtained from the transcriptome of  molesta . ORFfindMEGA 7.0 .10 (1.33 \u03bcg mL\u22121), LC30 (2.02 \u03bcg mL\u22121), and LC50 (3.08 \u03bcg mL\u22121); deltamethrin, LC10 (1.04 \u03bcg mL\u22121), LC30 (5.98 \u03bcg mL\u22121), and LC50 (23.52 \u03bcg mL\u22121); and chlorantraniliprole, LC10 (32.36 \u03bcg mL\u22121), LC30 (66.07 \u03bcg mL\u22121), and LC50 (130.78 \u03bcg mL\u22121) [G. molesta. After 24 h, the surviving adults were quickly frozen in liquid nitrogen for subsequent analysis.Three insecticides including malathion, deltamethrin, and chlorantraniliprole were used and obtained from AccuStandard . Each insecticide was dissolved with acetone. Concentrations are: malathion, LC\u03bcg mL\u22121) . The insWe isolated total RNA from the adults using RNAiso Plus . The RNA concentration and purity were estimated by using a Nanodrop 2000 spectrophotometer  with 1 \u03bcL of a 50-fold dilution of the RNA. RNA integrity was detected by using 2\u20135 \u03bcL of each sample for agarose gel electrophoresis.\u03b2-actin of G. molesta was used as an internal reference gene [First-strand cDNA was synthesized by following the instructions for the Takara Reverse Transcriptase Kit . The reaction product was stored at \u221220 \u00b0C. nce gene . The qPC\u2212\u0394\u0394CT method [G. molesta exposed to different concentrations.After the reactions, the ABI 7500 software data were exported to Microsoft Excel  and analyzed using the 2T method  to deterp < 0.05 were performed to determine whether the normalized expression level of the eight CYP6 genes differed significantly among developmental stages, tissues, and insecticide treatments. SPSS 22.0 software  was used. All histograms were constructed using SigmaPlot 12.0 .One-way ANOVA followed by Tukey\u2019s honest significant difference (HSD) test at G. molesta  silencing results in worm death [G. molesta and the highest expression of CYP6B74 was found at the fourth-instar larvae. These genes may be involved in the metabolism of foreign substances because, third and fourth instars are the stages involving the large-scale feeding of G. molesta, which possibly require more enzymes to metabolize exogenous substances. In Bradysia odoriphaga, CYP3356A1 presented the highest expression level in fourth-instar larvae and is related to the metabolism of exogenous substances [CYP6AN35 and CYP6AB115, which are highly expressed in adults, may participate in the detection and metabolism of foreign substances. In L. migratoria, high expression levels of LmCYP6HQ1 were found in adults, through RNAi knockdown of LmCYP6HQ1, which suggested that the expression of genes enhances the locust\u2019s ability to detoxify insecticides [CYP6BQ23 in Meligethes aeneus is also significantly and highly overexpressed (\u223c900-fold) in adults of pyrethroid-resistant strains compared with susceptible strains, and is the primary mechanism conferring pyrethroid resistance [In rm death . The expbstances . CYP6AN3cticides . CYP6BQ2sistance .G. molesta, the expression intensity of CYP6 members was tissue specific. CYP6AN35 was most highly expressed in the head and may be related to the recognition and metabolism of toxics substances. In Plutella xylostella (Linnaeus), high expression of CYP4BN6 in the head of Tribolium castaneum has been suggested to be associated with insecticide susceptibility [CYP6AN35 exhibited higher levels to varying degrees in the Malpighian tubules and fat body. Similar results have been obtained in many other studies on P450s [CYP6AB56 is highly expressed in the fat body of Mamestra brassicae Linnaeus and RNA interference followed by a deltamethrin bioassay showed that it plays an important role in deltamethrin detoxification [G. molesta, CYP6 genes may be involved in metabolic detoxification. The diversity of the gene distribution in the insect body indicates that the genes may be involved in different metabolic activities [In tibility . Studiestibility . Among ton P450s . Most ofon P450s . In addion P450s . CYP6AB5fication . These ftivities ,54.CYP6AB112 was only highly expressed after chlorantraniliprole treatment, was uninfluenced by malathion, and was downregulated by deltamethrin. This result preliminary certifies that this gene may play roles in the chlorantraniliprole metabolism. Similar results have been reported for CYP6FD1 in L. migratoria, which was inhibited by deltamethrin treatment and no significant increase in mortality was found after RNAi knockdown [CYP6AB115 and CYP6AN35 expression increased after treatment with the three insecticides, and these two genes may play an important role in metabolic detoxification in G. molesta. The same result for B. odoriphaga CYP3356A1 revealed its association with the metabolism of three xenobiotics, imidacloprid, thiamethoxam, and beta-cypermethrin through RNAi [CYP6AB114 showed the same decreasing pattern in response to different insecticides after 24 h exposure. Treatment with different concentrations resulted in lower expression levels of this gene than those obtained with the control treatment, and this gene may thus play a role in the adaptive response to external stimuli. Decreased expression of P450 is a homeostatic or adaptive response, and suppressed in response to pathophysiological signals and various exogenous or endogenous compounds [CYP6AB116 and CYP6AB117 expression showed little change across the different concentrations of these three insecticides, which suggested little involvement of these genes in resistance to these chemicals. CYP6B74 expression was induced by malathion and deltamethrin, and may participate in the metabolism of these two insecticides. A study on the CYP6B family showed that CYP6B1 metabolizes organophosphorus diazinon, and CYP6B8 metabolizes both diazinon and the pyrethroid cypermethrin [CYP6BB2 upregulation can be observed in pyrethroid-resistant populations and is associated with pyrethroid resistance [Many results have demonstrated that CYPs participate in the insecticides\u2019 metabolism. To clarify which CYP genes are involved in the metabolism of insecticide, we investigated the effect of the three insecticides on CYP gene expression. Gene exposure to endogenous and exogenous substances was induced differently at different times. Zhang et al. found that the expression of many P450 genes reached the highest level at 24 h after induction . Our stunockdown . We alsoompounds . CYP6AB1rmethrin . CYP6BB2sistance .CYP6AN35 exhibited a special expression pattern in the head of G. molesta adults, and our results showed that the expression of this gene tended to be induced by three insecticides, which indicates that this gene might be a key gene for further exploration. For example, the upregulation of CYP6G1 confers resistance to DDT [CYP9AQ2 plays an important role in deltamethrin detoxification in L. migratoria [G. molesta and corroborated the finding that G. molesta cytochrome P450 responds by changing its expression in the face of pesticide stress. Our findings revealed the functional importance of cytochrome P450 genes in response to insecticide exposures, the detoxification of insecticides, the selection of insecticides for G. molesta control, and the evolution of insecticide resistance in G. molesta.e to DDT  and highgratoria . An analgratoria . Determigratoria . Our stuCYP6AN35 was found at a high expression level in the adult head and its expression was induced by all three insecticides. CYP6AN35 may be a key gene in the metabolism of insecticides.In this study, eight cytochrome P450 genes were identified and found to exhibit various expression levels at different developmental stages and in different tissues. Most of these eight genes were highly expressed in third- or fourth-instar larvae and were distributed in detoxification-related tissues, such as the midgut, Malpighian tubules, and/or fat body in adults. Interestingly,"}
+{"text": "Weissella was the dominant epiphytic bacteria of raw material in Ziyun and Weinning, while Lactobacillus was prevalent in Guanling. Lactobacillus dominated the ensiling process, and its abundance significantly increased with increasing fermentation time in the three groups. Lactobacillus was negatively correlated with pH of all silages (p < 0.05) and positively correlated with lactic acid, propionic acid and acetic acid (p < 0.05). Furthermore, the bacterial community was significantly correlated with environmental factors. Altitude had a highly positive correlation with the abundance of Stenotrophomonas, Chryseobacterium, and Massilia (p < 0.01), while precipitation was negatively correlated with these bacteria. The humidity and average temperature significantly influenced the Lactobacillus and Weissella abundances of fresh whole-plant maize. During the ensiling process, the silages from three regions had similar bacterial dynamic changes, and the Lactobacillus formed and maintained good fermentation characteristics in whole-plant maize silage.This study aimed to explore the changes in the microbial community on the silage material surface and during the ensiling process of whole-plant maize in different regions. Whole-plant maize silages were sampled in Ziyun, Guanling, and Weinning counties within warm and humid climate areas in southern China. Silages were sampled at 0, 2, 5, 10, 20, and 45 days during ensiling. The nutritional components, fermentation properties, and microbiomes were examined to evaluate the influence of sampling area and fermentation time on the quality of silage. The results showed that the pH values of all silages significantly decreased (<4.2 at ensiling day 2) during fermentation and all silages achieved satisfactory fermentation at 45 days. Butyric acid was not detected during ensiling, and the contents of acetic acid and ammonia nitrogen in the final silages were below 6 g/kg DM and 50 g/kg total nitrogen, respectively.  Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, and Weissella  , Guanling County (G) , and Weining County (W) . The monthly changes of temperature, precipitation and humidity in the three regions in 2019 are shown in 3-N) and organic acid contents. The pH, lactic acid (LA), acetic acid (AA), propionic acid (PA), butyric acid (BA), ammonia-N (AN), and total nitrogen (TN) concentrations were measured as previously established  and crude protein (CP) were measured according to previously published study . The WSCablished .The DNA extraction was operated using the HiPure Soil DNA extraction kit  according to the manufacturer\u2019s instructions. The 16S rDNA V5-V7 region of the ribosomal RNA gene were amplified by PCR  with primers 799F (AACMGGATTAGATACCCKG) and 1193R (ACGTCATCCCCACCTTCC) . AmplicoTag assembly was carried out using filtered reads according to the following principles: the overlap between paired-end reads should be more than 10-bp and have less than a 2% mismatch. The unique tags were obtained by removal of redundant tags using MOTHUR software . The effP < 0.05, and the data are expressed as the mean and the standard error of the mean (SEM).The statistical analyses of two-way ANOVA were performed using SPSS 20.0. Duncan\u2019s HSD test was employed to determine the differences in the treatment means, where significant differences were declared at P < 0.05), and the lowest DM content was 268.6 g/kg in the G group (P < 0.05). The content of DM in each group decreased with increasing fermentation time and was in the order of W > Z > G samples at any stage of fermentation. The content of CP in the Z and G groups was lower than that in the W group on days 5 and 10 (P < 0.05), while that in the Z group was lower than that in the G and W groups on day 45 (P < 0.05). The WSC content of each group decreased significantly throughout the fermentation process. The contents of NDF and ADF in the Z group were significantly higher than those in the other groups at any stage of fermentation, and they showed a similar decreasing trend with the extension of fermentation time. Moreover, the contents of NDF and ADF in the G group were lower than those in the other groups on day 45 (P < 0.05). The ensiling time (D) and treatment (T) significantly affected the chemical composition (P < 0.001). The results also showed a significant interaction between D and T for the contents of DM, WSC, NDF, and ADF (P < 0.001).The changes in nutritional components during different regions of ensiling are shown in P < 0.05), all of which were below 4.2. Moreover, the highest and lowest pH appeared in the G group and the W group on day 45 (P < 0.05), respectively. The LA content of each group increased significantly during fermentation, and the highest LA content was found in the W group on day 45 (P < 0.05). The contents of AA and PA in each group gradually increased with prolonged ensiling, and the contents in the Z group were lower than those in the other groups on day 45 (P < 0.05). The contents of BA were not detected in all silages. The contents of AN/TN in all groups were dramatically increased (P < 0.05) during fermentation, within lower than 5%. Moreover, pH, AA, LA, PA, and AN/TN were interactively influenced by treatment and ensiling days (p < 0.001).The bacterial alpha diversities of the silages were evaluated by the Chao1 and Shannon indexes . The bacLactobacillus, Weissella, and Acetobacter were the most dominant genera in all maize silages. Weissella and Lactobacillus were found in large amounts in the Z and W groups, while no obvious dominant bacteria were found in the G group of raw materials.The relative abundances of bacterial communities at the phylum and genus levels were presented in Lactobacillus and Weissella in the samples during the ensiling process. After ensiling, Lactobacillus was the dominant microbial genus, and its relative abundance exceeded 70%. The Lactobacillus abundance significantly increased with the extension of fermentation time, while those of Weissella and Acinetobacter significantly decreased or disappeared in the subsequent period. The relative abundance of Acetobacter in each group decreased with the process of ensiling. By 45 days, the relative abundance of Acetobacter in each group decreased to below 1%. In addition, Pantoea and Stenotrophomonas existed in the whole corn silage period of all three regions.All the groups were dominated by Firmicutes and Proteobacteria during ensiling at the phylum level. The Proteobacteria abundance decreased while that of Firmicutes increased rapidly and became the dominant phylum with increasing fermentation time. At the genus level, the most dominant bacterial genera were Lactobacillus (\u20130.73), Sphingomonas (\u20130.67), Stenotrophomonas (\u20130.74), Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium (\u20130.92), Chryseobacterium (\u20130.75), and Massilia (\u20130.71). Altitude was associated with increased abundance of Rahnella, Stenotrophomonas, Chryseobacterium, Massilia (p < 0.05), Serratia, and Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium (p < 0.01). The level of precipitation was associated with decreased abundance of Rahnella, Serratia (p < 0.01) and Stenotrophomonas, Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium, Chryseobacterium and Massilia (p < 0.05). Humidity was associated with increased abundance of Weissella, Lactobacillus, Stenotrophomonas, Chryseobacterium, Massilia (p < 0.05), and Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium (p < 0.001), while it was associated with decreased abundance of Escherichia\u2013Shigella (p < 0.05).The association analysis between bacterial abundance and environmental factors is shown in Lactobacillus (p < 0.01). The LA concentration was associated with increased abundance of Lactobacillus (p < 0.05), while it was negatively correlated with that of Pseudomonas and Massilia (p < 0.05). The contents of AA and PA were associated with increased abundance of Lactobacillus (p < 0.001), while AA concentration was negatively correlated with the abundance of Acetobacter and Pseudomonas (p < 0.01) and Pantonea (p < 0.05), PA concentration was associated with decreased abundance of Acetobacter, Pseudomonas and Lysinibacillus (p < 0.01) and Weissella, Gluconobacter, and Oceanobacillus (p < 0.05). Finally, the positive correlations have been observed between AN/TN concentrations and Lactobacillus (p < 0.01) and Herbaspirillum (p < 0.05), while AN/TN concentrations was associated with decreased abundance of Acetobacter, Rahnella, Pseudomonas, Lysinibacillus, and Pantoea (p < 0.05).The association analysis between bacterial abundance and fermentation indexes is shown in The expected DM content for good silage is 30\u223c35% . The DM The WSC content decreased significantly throughout the fermentation process, and the loss rate of each group reached 70%. As the substrate of silage fermentation, the WSC content will be decomposed by LAB to produce LA . The con2 in addition to LA , while the relative abundance of attached Lactobacillus was the lowest (2.75%). The temperature of the W group was the lowest (17.32\u00b0C), while the relative abundance of attached Lactobacillus was the highest (63.77%). Altitude and precipitation influence some microorganisms in silage, but they do not relate to the main bacteria in silage, such as Lactobacillus and Weissella. This shows that when silage enters a completely anaerobic environment, the influence of climate factors on the main microorganisms will become smaller. Lactobacillus and Weissella were correlated with temperature and humidity, and the most dominant bacterial genera were Lactobacillus and Weissella in the samples during the ensiling process. This result indicated that the main factors affecting the microbial diversity of silages were humidity and average temperature. Environmental factors affect the community of epiphytic bacteria on raw materials, which have a greater impact on the initial stage of silage fermentation  that affect the microbiome and influence the fermentation quality of silage . Usuallyanalysis  showed tentation . We specLactobacillus species mainly affect LA production (Lactobacillus was positively correlated with the LA content, which dominated the bacterial community in the fermentation process and had a negative correlation with pH in all silages. This result was consistent with the report of Pseudomonas is an undesirable bacterium that can survive in an anaerobic environment, and its production of biogenic amines leads to the decrease in protein content (Pseudomonas, indicating that the existence of Pseudomonas may contribute to the preservation of protein (Microorganisms affect silage quality through a series of metabolites. For example, oduction . In the  content . The AN/ protein . Other s protein .Weissella and Proteobacteria. Although the bacterial community varied during ensiling, Lactobacillus dominated the ensiling process. Lactobacillus had a negative correlation with pH in all silages and grew well under low pH conditions, produced LA during ensiling, and effectively influenced fermentation quality. Altitude and precipitation influenced some specific microorganisms in silage, but they did not affect the main bacteria in silages. The humidity and average temperature significantly influenced the abundances of Lactobacillus and Weissella of fresh whole-plant maize and had a greater impact on the whole fermentation process.All of the whole-plant maize silages had satisfactory fermentation quality. The bacterial community of fresh raw material was mainly composed of The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.JH and CC contributed to conception and design of the study. LL, SD, and CW performed the statistical analysis. YH wrote the manuscript and interpretation of data. All the authors read and contributed to the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "At 60 d, the pH value and the concentration of NH3-N in CK silage increased compared with 15 and 30 d, propionic acid and butyric acid (BA) were detected, and Garciella had the highest abundance in the bacterial community. Compared with CK silage, inoculation of YX significantly promoted lactic acid and acetic acid accumulation and reduced pH and BA formation, did not significantly reduce the concentration of NH3-N except at 60 d, and significantly promoted the abundance of Lactobacillus and decreased the abundance of Garciella and Anaerosporobacter, but did not significantly inhibit the growth of Enterobacter and Hafnia-Obesumbacterium. In conclusion, high-moisture alfalfa naturally ensiled is prone to rot. Adding YX can delay the process of silage spoilage by inhibiting the growth of undesirable microorganisms to a certain extent.The aim of this study was to gain deeper insights into the dynamics of fermentation parameters and the bacterial community during the ensiling of high-moisture alfalfa. A commercial lactic acid bacteria (YX) inoculant was used as an additive. After 15 and 30 days of ensiling, the control silage (CK) exhibited a high pH and a high concentration of ammoniacal nitrogen (NH Enterococcus faecium, and Pediococcus spp. have been proposed as effective stimulants to reinforce LA fermentation [Alfalfa is a perennial herbaceous legume. It is one of the most important legume forages in the world because of its good nutritional quality, high yield, and strong adaptability . As a soentation ,17. LAB It is widely known that the silage process involves a variety of microbial communities and biochemical reactions. The quality of silage depends largely on the microbial community and its dynamic succession and fermentation metabolites . A betteThe purpose of this study was to explore the dynamics of fermentation parameters and the bacterial community and the correlations among them in high-moisture naturally ensiled alfalfa, and to explore the effect of adding commercial LAB YX on the dynamic of fermentation parameters and the bacterial community. This will deepen understanding of the role of microorganisms in high-moisture alfalfa ensiling and provide more detailed information for alfalfa ensiling in a humid environment.\u22121 FM, respectively. To accurately trace the degradation of the organic acids before and after fermentation, laboratory vacuum-packed mini silos have been frequently used for alfalfa silage [6 cfu g\u22121 FM, and an equal volume of distilled water was sprayed onto the fresh alfalfa for the control group. The samples were ensiled for 15, 30, and 60 d at room temperature (25 \u00b0C).Fresh alfalfa was cultivated and harvested after rain at the early bloom stage in Zhengzhou, Henan Province, China . The material was wilted for about 24 h to obtain a DM content of 266.03 g/kg fresh matter (FM). The material was then chopped using a crop chopper into sections of approximately 1\u20132 cm in length. The pH, WSC, and high buffering capacity (BC) of fresh alfalfa were 6.06, 17.56 g/kg DM, and 460 mEq/kg DM, respectively. The epiphytic LAB, coliform bacteria, and aerobic bacteria in the fresh alfalfa were 4.65, 4.83, and 5.28 log10 cfu ga silage ,22,23. A3-N) level was determined using Berthelot colorimetry [2SO4, 0.6 mL min\u22121; temperature: 55 \u00b0C) [Immediately after the bags were opened, the subsamples (10 g) were blended with 90 mL of sterilized water. The pH was measured with an electrode pH meter . The ammoniacal nitrogen (NHorimetry . The con: 55 \u00b0C) . The DM : 55 \u00b0C) . The BC : 55 \u00b0C) . The neu: 55 \u00b0C) , using ag for 15 min at 4 \u00b0C to collect the microbial pellet for DNA extraction [TMXL . The NGS reads were assembled using FLASH (version 1.2.11) and low-quality reads were removed according to the QIIME quality control process (version 1.9.1). Sequence analyses were performed via Uparse software (v7.0.1001). A 97% similarity cutoff was used to define operational taxonomic units (OTUs).Subsamples (10 g) of each fresh or silage sample were shaken well with 90 mL of sterile phosphate buffer saline at 180 rpm for 1 h. The solution was filtered through four layers of medical gauze and the filtrates centrifuged at 8000\u00d7 traction . Total Dp < 0.05. The alpha diversities of samples, the Shannon index, and Chao richness estimator were determined using Mothur . Taxonomic classification at different levels was performed using the Ribosome Database Project  algorithm to classify the representative sequences of each OTU. Linear discriminant analysis effect size (LEfSe) analysis  was conducted to determine the differentially abundant taxonomies among different treatments by coupling one-way analysis of variance with a non-parametric factorial Wilcoxon sum-rank test for statistical significance using Python . Non-metric multidimensional scaling (NMDS) analysis and a Spearman correlation heatmap based on the Spearman correlation coefficients among the bacterial community and fermentation parameters were produced using R software (version 2.15.3).The data of fermentation parameters were statistically analyzed using the GLM procedure of IBM SPSS version 22.0 . Statistical differences in parameters among the days were determined in accordance with Duncan\u2019s multiple comparison test, and effects were considered significant when The derived variable regions of 16S rRNA gene sequence datasets were submitted to the NCBI under the BioProject accession number PRJNA720220.3-N concentration differed between 15 and 30 d, but increased (p < 0.05) greatly at 60 d compared with 30 d. The LA concentration and LA/AA peaked at 15 d, then declined, and were significantly (p < 0.05) lower at 60 d than at 30 d. The AA concentration significantly (p < 0.05) increased with longer ensiling time. The WSC concentration decreased rapidly during 15 d of ensiling, and then remained at 3.62 g/kg DM at 60 d. Both PA and BA were detected at 60 d, with concentrations of 29.73 and 37.13 g/kg DM, respectively.Changes in fermentation parameters in silages during ensiling with or without LAB are shown in 3-N concentration increased significantly (p < 0.05) from the beginning to 30 d and there was no significant (p > 0.05) change from 30 to 60 d. The LA concentration and LA/AA value rapidly increased up to 15 d and then decreased; the AA content significantly (p < 0.05) increased up to 30 d and then significantly (p < 0.05) decreased by 60 d. No BA was detected in YX silage.In the YX silage, the pH and WSC concentration gradually decreased with longer ensiling time; the NHp < 0.05) lower, and the LA and AA concentrations were significantly (p < 0.05) higher in all ensiling periods. At 60 d, the NH3-N concentration of YX silage was significantly (p < 0.05) lower than of CK silage at 60 d. The LA/AA of YX silage was significantly (p < 0.05) lower than of CK silage at 30 d, but significantly (p < 0.05) higher at 60 d.Compared with CK silage, the pH of YX silage was significantly (p < 0.05) at 60 d. Compared with CK silage, the YX silage had significantly higher DM content at 60 d, significantly lower ADL and cellulose content at each ensiling time, significantly lower NDF content at 15 and 60 d, significantly lower ADF content at 30 and 60 d, and significantly lower hemicellulose content at 15 d (p < 0.05).Changes in DM and structural carbohydrates in silages during ensiling with or without LAB are shown in p > 0.05) change in the richness of the bacterial community before and after ensiling, and the diversity of the bacterial community significantly (p < 0.05) decreased after ensiling (p > 0.05) change in bacterial community richness during ensiling; the diversity of the bacterial community was significantly lower at 60 d compared with 15 and 30 d. The richness of the bacterial community of YX silage was similar to that of CK silage. Compared with CK silage, the bacterial community diversity of YX silage was lower at 30 d (p < 0.05), but there was no significant difference between the two at 15 and 60 d.High-throughput analyses were used to detect the bacterial diversity of the alfalfa silages at 15, 30, and 60 d. The average number of reads per sample was 84,194, and the average number of effective data was 79,478. The effective rate of quality control was 94.48%. Using 97% identity, the sequences were clustered into 265 OTUs. The Chao and Shannon indexes were used to represent richness and diversity indices of the bacterial communities, respectively. There was no significant , Pseudomonas (16.67%), and Pantoea (7.09%) dominated the epiphytic bacterial community of alfalfa (Lactobacillus (1.35%), Weissella (0.74%), and Lactococcus (0.07%). After ensiling, completely different microbial community dynamics were observed in CK and YX silages. In the CK silage, after 15 d of ensiling, the dominant microbial genera were Enterobacter (29.68%), followed by Hafnia-Obesumbacterium (19.71%), Weissella (13.14%), Lelliottia (11.05%), and Lactococcus (9.46%); Enterobacter (37.00%) peaked at 30 d and was lower at 60 d. With increasing time of ensiling, the relative abundances of Hafnia-Obesumbacterium, Lelliottia, Weissella, and Lactococcus declined, and Garciella and Anaerosporobacter increased; Garciella became the dominant genus at 60 d, with relative abundance of 59.26%. In the YX silage, Lactobacillus increased continuously during the ensiling process, and peaked (64.76%) at 60 d; proportions of Enterobacter and Hafnia-Obesumbacterium decreased from 15 to 60 d; the relative abundance of Garciella reached 9.88% at 60 d.Genera  alfalfa B. A low Lactobacillus at each ensiling time and significantly higher abundance of Enterococcus at 60 d, but had significantly lower relative abundance of Weissella at each ensiling time, significantly lower abundance of Lactococcus and Lelliottia at 15 d, and significantly lower abundance of Garciella and Anaerosporobacter at 30 and 60 d .The LEfSe analysis was used to identify the taxa that most likely explained the differences in bacterial community structures between the CK and YX silages after 15, 30, and 60 d of ensiling . CompareWeissella and Glutamicibacter and negatively correlated with Lactobacillus (p < 0.05); LA was positively correlated with Lactobacillus and negatively correlated with Weissella, Glutamicibacter, and Enterobacter (3-N and two genera (p < 0.05), Klebsiella and Lelliottia (Garciella and Anaerosporobacter and negatively correlated with Lactobacillus and Enterococcus (p < 0.05); LA was positively correlated with Lelliottia and Pediococcus and negatively correlated with Anaerosporobacter (p < 0.05)  (Spearman\u2019s correlations were used to study the relationships among the top 10 most abundant genera and fermentation parameters . At 15 drobacter A. There lliottia A. At 60  < 0.05) B. NH3-N  < 0.05) B.5 cfu/g FM for optimum silage preservation [Generally, LAB is the main microbial inoculum affecting silage fermentation, because it can produce organic acids responsible for silage preservation; the LAB count must exceed 10ervation . In this3-N during the ensiling process. However, the pH of YX silage was significantly lower than that of CK silage at all silage stages, consistent with the results showing higher LA content of YX silage than of CK silage in all silage stages. The results showed that LAB as a silage additive accelerated the accumulation of LA and reduced the pH of the silage environment. Yang et al. also reported a similar effect of LAB as a silage additive, in which adding LAB in alfalfa silage accelerated the process of LA fermentation [Both pH and organic acids are important indicators to ensure silage quality. Previous studies reported that high moisture content was unfavorable for natural ensiling, leading to decreased organic acid concentration, increased pH, and a detrimental effect on the fermentation process for alfalfa silage ,31. In tentation . Althougentation . One posentation . In this3-N is generally considered to be the result of amino acid deamination and decarboxylation, which reduce the nutritional value of silage in the ensiling process [3-N concentration were much higher, as was LA and WSC consumption, and BA was also detected. This is consistent with the typical characteristics of Clostridia fermentation. Kung et al. reported that the effects of plant and microorganism proteolytic enzymes may be typical causes of NH3-N accumulation [3-N concentration of YX silage at 15 and 30 d was not significantly (p < 0.05) lower compared with CK silage. One of the reasons may be that most plant protein hydrolases in alfalfa silage showed high activities at pH 5.0\u20136.0 [p < 0.05) lower in CK than in YX silage at 60 d, and may be because BA fermentation was greater in CK than in YX silage, resulting in greater DM loss of CK silage\u2014a similar outcome was found by Liu [NH process . At 60 dmulation . The NH3 5.0\u20136.0 , and thed by Liu . In the d by Liu . A markeGarciella in CK silage and Lactobacillus in YX silage at 60 d.In this study, the diversity of the bacterial community of alfalfa silage was lower than that of fresh material, and may be due to the large increase in some bacteria with good adaptability to the conditions of ensiling. Similar trends were also reported by Zheng et al. . The ShaThe NMDS showed clear separation in bacterial community composition between fresh material and alfalfa silages . Ni et aMedicago [Among many factors that can affect the fermentation process of silage, the dominant microbial species often determine the silage quality . TherefoMedicago . Keshri Medicago .Lactobacillus, Lactococcus, and Weissella; among these, Lactobacillus plays a key role in silage fermentation. It can produce LA, reduce pH, reduce the relative abundance of undesirable bacteria, and often becomes a dominant genus in various high-quality silages [Lactobacillus in the natural silage group was very low during the whole silage period, and adding LAB of YX significantly (p < 0.05) increased the Lactobacillus abundance with longer silage time, consistent with the higher LA concentration and lower pH in YX than in CK silage, indicating that adding LAB of YX had a positive effect on fermentation quality. We speculate that the increased Lactobacillus is likely to be the LAB YX strain, but unfortunately, this study cannot accurately determine the proportion of LAB YX in Lactobacillus, because NGS, which was used in our study, can only classify and identify microorganisms to genus level [Lactococcus and Weissella are cocci-shaped LAB, and can initiate LA fermentation in the early stage of ensiling [Lactococcus and Weissella, and their relative abundances were much higher than those in the YX silage. This is possibly because Lactococcus and Weissella were early colonizers, and could grow faster under ensiling conditions. Yang also reported that Lactococcus and Weissella started LA fermentation and grew vigorously during the early stage of ensiling in untreated silage [Lactococcus and Weissella in YX silage could be outcompeted by Lactobacillus due to adding LAB of YX. Yang et al. made a similar report in which Lactobacillus outnumbered all other genera after inoculation with Lactobacillus plantarum [Enterobacter, Hafnia-Obesumbacterium, and Lelliottia exceeded 38.8% in both silage groups at 15 and 30 d. Compared with CK silage, adding LAB of YX did not significantly reduce the abundance of Enterobacter and Hafnia-Obesumbacterium, possibly due to a large number of Enterobacteriaceae on the surface of fresh alfalfa. Therefore, in practical application, it is better to consider the dose\u2013response and/or the inter-relationship between indigenous bacteria and the LAB YX added. Additionally, this was also related to the limitation of acid production ability of LAB of YX under conditions of high moisture content and low WSC; the weak inhibitory effect of LAB of YX on Enterobacteriaceae may also be another reason. Therefore, despite adding LAB of YX, Lactobacillus could not quickly become absolutely dominant in the community. Similar results were reported by Guo et al. in which Enterobacter was one of the two dominant bacteria after ensiling, especially in LAB-treated silage [Garciella is an anaerobic and thermophilic bacterial genus of the class Clostridia, and is undesirable in silage because it can lead to excessive protein degradation, DM loss, and BA production [Garciella can grow in the pH range of 5.5\u20139.0, and its optimum pH is 7.5. However, growth of Clostridia can be completely inhibited only for pH < 4.2 [Garciella became the dominant genus at 60 d, possibly due to the high moisture concentrations. Similarly, Zhang et al. found that with longer ensiling time, Garciella played a more important role in Clostridia fermentation, and that the presence of Garciella led to alfalfa being more difficult to ensile [Garciella is one of the dominant bacteria in Clostridia fermentation. Anaerosporobacter is similar to Garciella, and also belongs to class Clostridia [Anaerosporobacter may play the same role as Garciella in silage. Compared with CK silage, the abundance of Garciella and Anaerosporobacter was significantly (p < 0.05) lower after adding LAB of YX, consistent with the lower pH and NH3-N concentration and absence of BA in YX silage at 60 d.During ensiling, LAB play an important role in silage fermentation. In this study, fresh alfalfa had a high moisture content and low relative abundance of epiphytic LAB. Therefore, adding LAB was an effective way to improve quality of alfalfa silage. Different species and characteristics of LAB may affect the fermentation process . In this silages ,46. In tus level . Lactocoensiling . After td silage . Howeverlantarum . Enteroblantarum . Enteroblantarum . In our d silage . In our d silage ,51. Pahld silage . Garcieloduction . GarcielpH < 4.2 . ClostripH < 4.2 . In thiso ensile . Therefoostridia . It is s3-N. With longer ensiling time, the synthesis of NH3-N is also related to the activity of protease produced by some microorganisms [3-N differed for different periods. The NH3-N concentrations were significantly (p < 0.05) positively correlated with Lelliottia and Klebsiella at 15 d (both Enterobacteriaceae). It was reported that proteases produced by Enterobacteriaceae were related to synthesis of NH3-N [3-N of CK silage was significantly (p < 0.05) higher at 60 d, possibly because Garciella became the dominant bacteria in CK silage at that time, consistent with the significant (p < 0.05) positive correlation between Garciella and NH3-N at 60 d. The appearance of Clostridia was undesirable because they can use protein and WSC to produce BA and consequently affect silage quality due to the unpleasant odor of BA [p < 0.05) positive correlation of Garciella and Clostridium_sensu_stricto_18 with BA. Anaerosporobacter was also significantly (p < 0.05) positively correlated with NH3-N and BA, and may have similar effects to Garciella during ensiling. Weissella was significantly (p < 0.05) positively correlated with BA at 60 d, likely because BA was only detected at 60 d in CK silage and the relative abundance of Weissella was higher in CK than in YX silage. It was reported that the ability of Weissella for LA fermentation was lower than that of Lactobacillus [Lactobacillus was positively correlated with LA concentration and negatively correlated with pH, consistent with the general recognition that Lactobacillus is the main producer of LA and plays an important role in reducing pH during ensiling [A Spearman\u2019s correlation heatmap  was usedrganisms ,56. In tof NH3-N . Compareor of BA . A largebacillus , so CK sensiling ,46,58.The experimental results indicate that it is important to develop high-efficiency LAB additives with strong acid production ability and the ability to effectively inhibit the growth of Enterobacteriaceae, so as to improve the quality of alfalfa silage.Enterobacter, Hafnia-Obesumbacterium, Garciella, and Anaerosporobacter showed these to be the dominant genera. Adding LAB of YX delayed the rot process to a certain extent by lowering pH, promoting LA and AA accumulation, inhibiting BA formation, increasing the abundance of Lactobacillus, and decreasing the abundance of Garciella and Anaerosporobacter. However, the quality of silage with LAB of YX addition was still unsatisfactory, because the pH in silage was not reduced to a satisfactory value, and the growth of Enterobacter and Hafnia-Obesumbacterium could not be effectively inhibited. Thus, it is a focus to develop high-efficiency LAB additives with strong acid production ability and effective inhibition of the growth of Enterobacteriaceae in a future study.In conclusion, naturally ensiled alfalfa with high moisture content was prone to rot, and the relative abundance of"}
+{"text": "This paper describes the calibration method for calculating parameters (position and orientation) of planar reflectors reshaping LiDAR\u2019s (light detection and ranging) field of view. The calibration method is based on the reflection equation used in the ICP (Iterative Closest Point) optimization. A novel calibration process as the multi-view data registration scheme is proposed; therefore, the poses of the measurement instrument and parameters of planar reflectors are calculated simultaneously. The final metric measurement is more accurate compared with parameters retrieved from the mechanical design. Therefore, it is evident that the calibration process is required for affordable solutions where the mechanical design can differ from the inaccurate assembly. It is shown that the accuracy is less than 20 cm for almost all measurements preserving long-range capabilities. The experiment is performed based on Livox Mid-40 LiDAR augmented with six planar reflectors. The ground-truth data were collected using Z + F IMAGER 5010 3D Terrestrial Laser Scanner. The calibration method is independent of mechanical design and does not require any fiducial markers on the mirrors. This work fulfils the gap between rotating and Solid-State LiDARs since the field of view can be reshaped by planar reflectors, and the proposed method can preserve the metric accuracy. Thus, such discussion concludes the findings. We prepared an open-source project and provided all the necessary data for reproducing the experiments. That includes: Complete open-source code, the mechanical design of reflector assembly and the dataset which was used in this paper. The following plane equation is considered:d is the distance from the origin to the plane. It satisfies the following condition with the intersection point in 3D space:The main assumption is that all LiDAR beams starts at origin is given .(8)PintThe direction Equation  and the With the measurement point Equation .(10)Pr=Finally, the measurement point expressed in the global coordinate system is given as .(11)Pg=For ground-truth data as a point cloud composed of points Equation .(12)x\u03b4yThe optimization process will not modify The angle information from a precise rotating table is used as the additional constraints. The rotation axis of the rotating table and the main optical axis of the calibrated system need to be as close together as possible. Ideally, it should be identical; however, a small discrepancy is acceptable. This geometrical discrepancy is represented by a homogenous transformation Equation  is transFinally, Equation , taking the point in tangent space to the manifold is a minimal representation (six degrees of freedom).the point in tangent space does not have any constraints and can be always exponentially mapped to a valid every valid every optimized Each of those homogenous transformations belongs to a special Euclidean group a et al. . PropertOptimization of all was used . For modwas used . A mirrowas used  Kd-tree with current calibration point clouds and Kd-trees are built in the global coordinate system.using Kd-tree, it searches for pairs of the nearest neighbourhood points that were reflected by a different mirror.every found nearest neighborhood point pair Equation .(15)rjkEvery found pair contributes a new residual. The number of those equations creates an optimization problem. The equation is  and is dThe optimization problem is solved using the Levenberg\u2013Marquardt algorithm until convergence using the Ceres solver.New, the found parameters are applied correctly according to its parametrization and the whole cycle is repeated.The calibration algorithm for single measurement station without ground-truth data (the simplest scenario):The calibration algorithm for multiple measurement stations uses the stations\u2019 poses Equation  can be aThe main assumption of the calibration process is the fact that ground-truth data are used only for validation purposes. The evaluation is based on quantitative and qualitative measures of the discrepancy between ground-truth and LiDAR data . The qualitative result is shown in To validate the proposed calibration method the system was tested in a known indoor environment. The environment was mapped with the geodetic measurement instrument Z + F Imager 5010 with accuracy much better than Livox Mid-40. These data are considered as ground truth. Two calibration scenarios were investigated: (1) Single measurement station without ground-truth data; (2) multiple measurement stations. We decided to not add ground-truth data to the optimization process to simulate operational conditions. Ground-truth data are used for qualitative and quantitative evaluation. The qualitative result of the calibration impact on improved 3D data accuracy is shown in For this reason, in future work, we will focus on filtering algorithms.The calibration process of planar reflectors reshaping LiDAR\u2019s field of view enables preserving accuracy and precision of the LiDAR to some extend. Based on our best knowledge such an investigation has not yet been discussed in the literature. We demonstrated by the experiment that the calibration process is required for affordable solutions where the mechanical design can differ from the inaccurate assembly. We use a state-of-the-art LiDAR Livox Mid-40 sensor as an object of investigation of the reshaping field of view with planar reflectors. Ground-truth data were collected with a precise Z + F IMAGER 5010 terrestrial laser scanning system. The calibration process incorporates the state-of-the-art reflection observation equation integrated with Iterative Closest Point optimization. We observed that adding planar reflectors slightly degrades the precision of the measurements; in particular, detected corners are slightly curved. This observation yields the conclusion that such a sensor will be rather useful for localization purposes than environmental mapping. Moreover, future autonomous mobile robots will require such calibration if their LiDAR FOV will be reshaped by planar reflectors.The impact of planar reflectors on another popular LIDAR (Velodyne VLP-16) was investigated in detail in the paper . In theiOur work contributes to omnidirectional perception based on 3D LiDAR sensor similarly to . The autThis paper describes the calibration process of planar reflectors reshaping LiDAR\u2019s field of view. The calibration method is based on the reflection equation used in the Iterative Closest Point optimization. The final metric measurement is more accurate compared with parameters retrieved from the mechanical design. The experiment is performed based on Livox Mid-40 LiDAR augmented with six planar reflectors. The ground-truth data were collected using Z + F IMAGER 5010 3D Terrestrial Laser Scanner. We show two scenarios: (1) Single measurement station without ground-truth data, (2) multiple measurement stations. It is documented by an experiment that the scenario of multiple measurement stations gives better qualitative and quantitative results compared with a single measurement station. However, the procedure requires greater effort in data acquisition. Moreover, this multi-view data registration scheme enables optimizing poses and parameters of planar reflectors simultaneously. It can be used for 3D map reconstruction. The calibration method is independent of mechanical design and does not require any fiducial markers on the mirrors. This work fulfills the gap between rotating and Solid-State LiDARs since the field of view can be reshaped by planar reflectors, and the proposed method can preserve the metric accuracy. There are many disadvantages of additional planar reflectors such as reducing the number of useful data and the negative impact on the sensor\u2019s range. We observed a decreased range of the Livox Mid-40 LiDAR, even down to 80 per cent. The important finding is the degradation of LiDAR\u2019s perception with a planar reflector. The degradation of sharp corners is evident. In contrast, an interesting fact is that the precision of the detection of the planar shape is rather similar; thus, an example planar target was detected with precision ("}
+{"text": "Skeletal muscles are composed of different myofiber types characterized by the\u00a0expression of myosin heavy chain isoforms, which can be affected by physical activity, aging, and pathological conditions. Here, we present a step-by-step high-throughput semi-automated approach for performing myofiber type quantification of entire human or mouse muscle tissue sections, including immunofluorescence staining, image acquisition, processing, and quantification.For complete details on the use and execution of this protocol, please refer to Abbassi-Daloii et\u00a0al. (2022).  \u2022Image acquisition and image processing of the entire muscle section\u2022High-throughput and semi-automated image quantification\u2022Training a pixel classifier to improve the myofiber segmentation\u2022Quantitative analysis to determine myofiber type composition Publisher\u2019s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics. Skeletal muscles are composed of different myofiber types characterized by the expression of myosin heavy chain isoforms, which can be affected by physical activity, aging, and pathological conditions. Here, we present a step-by-step high-throughput semi-automated approach for performing myofiber type quantification of entire human or mouse muscle tissue sections, including immunofluorescence staining, image acquisition, processing, and quantification. There is a growing interest in the community to assess myofiber typing using multiplex staininghttps://github.com/tabbassidaloii/ImageProcessing/tree/main/MyofiberTyping.This protocol has been implemented for human and mouse muscles. Here, we explain the protocol using human samples. Furthermore, we show examples from mouse muscles and highlight the necessary adaptations in the protocol that should be made to optimize the method for a different species. We provide all the image processing macros and Rscripts on GitHub: .Human muscle biopsies from healthy male subjects (aged 18\u201332) were used from a study detailed in Abbassi-Daloii et\u00a0alMouse muscle biopsies from eight-weeks-old male C57BL/6J wild-type mice were used from a\u00a0study detailed in Bindellini et\u00a0al.https://www.thermofisher.com/order/fluorescence-spectraviewer#!/). Examples of our possible choices to minimize spectral overlap are shown hereunder (Note: We imaged the entire section with an automated slide scanning microscope (Zeiss Axio Scan.Z1). To determine which fluorophores to use, one should consider the imaging specifications of the microscope that is being used.Myofiber types are recognized with monoclonal antibodies to the three most abundant MyHC isoforms in humans: MyHC1 (clone #BA-D5), MyHC2A (clone #SC-71) and MyHC2X (clone #6H1). In mouse, MyHC2X was replaced with MyHC2B (clone #BF-F3). We made conjugated antibodies, allowing the detection of three MyHC isoforms and laminin in one staining. Antibody conjugation of #BA-D5, #SC-71, and #BF-F3 to Alexa Fluor 350, 594, and 488 fluorophores, respectively, is carried out with the antibody labeling kit (ThermoFisher), see ereunder .Note: WeTesting the antibodies and determining the dilution factor is carried out on muscle cryosection using the immunofluorescence protocol detailed in section 1. Assessment of staining should be carried out with the same microscope that will be used for the entire experiment.Note: The myofiber staining has many incubations and washing steps. Therefore, if carried out manually, we recommend including a maximum of 12 slides in each experimental batch.Note: When there are multiple experimental batches, one should dilute the amount of antibodies required for the whole experiment in only one stock to avoid any variation. We advise testing diluted antibodies before running the large-scale experiment.Prepare the master mix of the conjugated antibodies by appropriate dilution factor for the entire sections in an experiment to avoid the batch effect.Timing: 20\u201330\u00a0min per muscle biopsyNote: For users unfamiliar with cryosectioning, we recommend reading the article by Ross et\u00a0al.,The purpose of this step is to cryosection muscle biopsies for immunofluorescence staining.1.Clean all the equipment with 70% alcohol.2.Adjust the chamber temperature and the object temperature to \u221220\u00b0C and \u221222\u00b0C, respectively.3.Place all the materials required for cutting  inside the cryostat chamber to equilibrate to the temperature.4.Install the anti-roll glass and a blade inside the cryostat chamber.5.Adjust the thickness .6.Transport the muscle biopsy in liquid nitrogen to the cryostat.7.Leave the biopsy inside the cryostat chamber to equilibrate to the temperature for 15\u201330\u00a0min.8.Put some Tissue-Tek (depending on the biopsy size) on the specimen holder and place the muscle biopsy in the Tissue-Tek (using tweezers).9.Place the specimen holder in the cryostat block when the muscle biopsy is completely fixed.10.Collect the cryosections onto the SuperFrost slide.Note: The tissue quality should be assessed by checking the first section under a normal bright-field microscope. Samples with extensive freezing damage should be excluded. In addition, since the purpose of this protocol is to perform myofiber typing for which cross-sections of myofibers are required, therefore you should examine if there are more cross-sections of myofibers rather than longitudinal sections of myofibers .12.Store the slides at \u221220\u00b0C prior to staining.Note: The slides can be stored at \u221220\u00b0C for several years.Here, we describe the procedure for collecting cryosections:Timing: A day and a half per experimental batchNote: For conducting immunofluorescence staining in multiple experimental batches samples across groups should be randomized in different batches using a single antibody master mix. The antibody master mix can be stored at 4 degrees for 1\u20132\u00a0weeks.This section describes immunofluorescence staining using antibodies for three myosin heavy chain\u00a0(MyHC) isoforms  and laminin. Our protocol for immunofluorescence staining with the antibody mix of MyHC isoforms and laminin was described.13.If slides were stored at \u221220\u00b0C, air dry them for 30\u00a0min at room temperature (RT). This incubation is important to limit detachment of the tissue during the incubations.14.Outline each cryosection with an immunopen about 2\u20133\u00a0mm from the tissue edge.Note: Do not draw the line too close to the muscle cryosections as it will introduce an artifact in the image processing step.15.Wash the cryosections in PBST in the staining box.16.Blocking.Here, we provide step-by-step directions for conducting this experiment:17.Wash the slides three consecutive times with a large volume of PBST, each time for 5\u00a0min.18.Primary antibody incubation.a.Rabbit anti-laminin,b.Note: The volume of the primary antibodies depends on the section area and you should make sure that the entire cryosection is covered with the antibodies.Mouse anti-6H1 detecting MyHC2X.Incubate sections with a mixture of the following primary antibodies for 2\u00a0h at RT:19.Wash the slides three consecutive times with an excessive volume of PBST, each time for 5\u00a0min.20.Secondary antibody incubation.a.Goat anti-rabbit-conjugated-Alexa Fluor\u00ae 750,b.Note: keep slides in the dark from step 21 onwards.Goat anti-mouse-conjugated-Alexa Fluor\u00ae 488.Incubate sections with a mixture of the following secondary antibodies for 1\u00a0h at RT:21.Wash the slides three consecutive times with an excessive volume of PBST, each time for 5\u00a0min.22.Conjugated MyHC antibody mix incubation.a.BA-D5-conjugated-Alexa Fluor\u00ae 350, detecting MyHC1,b.Note: Make sure that the sections don\u2019t dry out overnight. The slides can be carefully placed on wet tissue.SC-71-conjugated-Alexa Fluor\u00ae 594, detecting MyHC2A.Incubate the sections with a mixture of fluorescently conjugated monoclonal antibodies overnight at 4\u00b0C:23.Wash the slides three consecutive times with an excessive volume of PBST for 5\u00a0min.24.Wash the slides once with an excessive volume of PBS for 5\u00a0min.25.a.Cover the sections with ProLong\u2122 Gold antifade reagent.b.Note: Avoid any air bubbles on the sections as they will affect the image acquisition.Cover the slide with a cover slip.c.Fix the cover slip with nail polish.Mounting.26.Place the mounted sample on a flat, dry surface.27.Incubate for 24\u00a0h at room temperature in the dark.28.Store slides at 4\u00b0C prior to imaging.Incubate slides in PBST\u00a0+ 5% milk for 30\u00a0min.Timing: 10\u201315\u00a0min (per sample)Alternatives: Other microscopes with high capacity image acquisition equipped with four fluorescence channels can be used.Note: The imaging settings should be optimized on a test slide to specify the exposure time and intensity per fluorophore, as exposure time and focusing algorithm fade the fluorophore signal.Note: We recommend using the channel with the highest signal-to-noise ratio (in this dataset the MyHC2A conjugated-Alexa Fluor\u00ae 594 channel) to define the focus plane.Note: For each fluorophore/channel, the intensity and exposure time should be optimized to get the best signal-to-noise ratio, without bleaching the fluorophores.29.Make images with a 10\u00d7/0.45 Plan-Apochromat objective lens .Figure\u00a0330.a.Channel 1 : 335\u00a0nm\u2013383\u00a0nm excitation, 420\u00a0nm\u2013470\u00a0nm emission in combination with 385\u00a0nm LED excitation wavelengths;b.Channel 2 : 574\u00a0nm\u2013599\u00a0nm excitation, 612\u00a0nm\u2013682\u00a0nm emission in combination with 567\u00a0nm LED excitation wavelengths;c.Channel 3 : 450\u00a0nm\u2013490\u00a0nm excitation, 500\u00a0nm\u2013550\u00a0nm emission in combination with 475\u00a0nm LED excitation wavelengths;d.Channel 4 : 672\u00a0nm\u2013747\u00a0nm excitation, 765\u00a0nm\u2013855\u00a0nm emission in combination with 735\u00a0nm LED excitation wavelengths.Use single band filters for all channels:Note: The same image acquisition settings must be used for all slides over all batches.Note: When you perform the staining in multiple batches, the imaging should be also done in the same order and batches to keep the same duration between staining and imaging for all batches.Note: For each slide, the output is a Carl Zeiss Image format (CZI) dataset, which includes an image for each section.Here, we describe the imaging of the entire muscle sections using an Axio Scan.Z1 slidescanner  image capturing using ZEN 2 (blue edition) software (the v2.6 was used in this protocol).Timing: 1\u20132\u00a0min (per sample)Note: A video walkthrough of the image preprocessing and image processing steps described below can be found in 31.Calculating shading profile.If the acquired images exhibit a significant amount of shading A, this sa.i.This will produce a shading profile for each channel per slide.Calculate a shading profile using the \u2018Shading Reference From Tile Image\u2019 in ZEN Lite for each channel in each slide.b.Load all shading profiles for one specific channel into Fiji and combine them into a stack using the \u2018Images to stack\u2019 command.c.Using \u2018Z Project\u2019 with \u2018Projection type\u2019 set to \u2018Median\u2019, calculate the median shading profile for this channel.d.Repeat steps b-c for all channels.e.Use the median shading profiles for the shading correction using \u2018Shading Correction\u2019 in ZEN Lite. This can only be done one channel at a time .When these options do not give satisfactory results, it is possible to calculate \u2018averaged\u2019 shading profiles and use these for post-processing. When imaging with Axio Scan.Z1 slidescanner, this is achieved using ZEN Lite (v3.3 used for this protocol) and Fiji as below:32.Converting image format.a.Open Fiji.b.Run \u201c0.Convert_CZI_to_Tiff.ijm\u201d macro to convert the slidescanner datasets from CZI to multichannel 16-bit TIFF files using BioFormats.c.i.Running this macro, the images will be downsampled (4\u00d7) by averaging to improve the processing speed and reduce the required data storage.ii.Note: The effective pixel size will depend on the magnification of the acquisition. One should modify this to achieve a pixel size between 1 and 5\u00a0\u03bcm. It can be tuned by changing the scale parameter in \u201c0.Convert_CZI_to_Tiff.ijm\u201d macro (line 39). The amount of downscaling should be evaluated carefully by checking the output of the subsequent segmentation steps. If the segmentation quality is not sufficient, consider reducing the amount of downsampling.The effective pixel size is 2.6\u00a0\u03bcm after downsampling.Provide a directory with CZI datasets.d.i.X shows the image number in the CZI dataset (starting from zero).For each image in each CZI dataset, a tiff file that ends with \u201c_s[X]_merged\u201d will be saved in the input directory provided.Depending on the slide scanner used, this can be achieved in a multitude of ways. When using the Axio Scan.Z1 slidescanner the following procedure can be used in Fiji:Before the acquired images can be processed, the data needs to be curated, and some preprocessing might be required as explained below. The result of steps 32 and 33 should be a folder of multi-channel tiff files with a pixel size between 1 and 5\u00a0\u03bcm that can be imported by Fiji.Timing: 5\u201310\u00a0min (per sample)Note: A modular set of macros that process each step independently is created. All the macros are publicly available on GitHub: https://github.com/tabbassidaloii/ImageProcessing/tree/main/MyofiberTyping/Macros. In the steps below, we specify which macro should be used.Note: Macros save intermediate image files to facilitate debugging and rerunning certain steps when required.33.Generating tissue mask.Note: The aim of these manual corrections is to remove artifacts such as tissue folds, out-of-focus regions, scratches, and dirt objects.Note: The image processing steps below expect a folder that contains multichannel 16 bit tiff files that have a filename that ends with \u201c_merged.tif\u201d. These files should have an effective pixel size of approximately 2.6\u00a0\u03bcm.a.Open Fiji.b.Select Freehand Selection Tool.c.Run \u201c1.Tiff_to_Mask.ijm\u201d macro to generate a mask for each image.d.i.The first image will pop up with a mask generated automatically and a question box: \u201cIs the mask OK?\u201dii.Press the OK button, if the generated mask is accurate. Otherwise, the mask can be adjusted :\u00a0\u00a0Zoom in or zoom out on the area of interest by holding Ctrl and scrolling the mouse wheel.\u00a0\u00a0Hold Shift and Right Click on the area of the image that needed to be added to the mask;\u00a0\u00a0Hold Alt and Right Click on the area of the image that needed to be removed from the mask.Note: This manual process is the most time-consuming step in image processing.\u00a0\u00a0Press OK when the mask is accurate to go to the next image.Provide a directory with merged tiff images.e.For each image, a tiff file that ends with \u201c_Mask\u201d will be saved in the input directory provided.This step is a semi-automated process that uses an automated mask generation algorithm, followed by a manual step to check and correct the generated masks.34.Generating \u2018masked\u2019 copy of the laminin channel.Note: We typically use a gaussian blur of 4 pixels (sigma\u00a0= 4), but this can be tuned if the masks blur details too much .iii.Select multiple images (output of the previous step with \u201c_Lamin_Masked\u201d extension) that represent your dataset.iv.Click on \u201cOpen\u201d button.Input data.d.i.Select \u201c2. Feature Selection\u201d menu on the left.ii.Define features by clicking on \u201cSelect Features\u2026\u201d button as shown in Feature selection.e.i.Select \u201c3. Training\u201d menu on the left.ii.To train the classifier, define labels corresponding to two classes: \u2018myofiber boundary\u2019 and \u2018not myofiber boundary\u2019 .\u00a0\u00a0Zoom in on different areas to annotate the classes.\u00a0\u00a0Select one of the classes.\u00a0\u00a0Select the pen with the proper size to annotate the pixels which belong to the class selected.\u00a0\u00a0Select the other class and repeat step 3.\u00a0\u00a0Evaluate the classifier performance by clicking on \u201cLive Update\u201d button and selecting \u201cSegmentation\u201d option (from \u201cGroup Visibility\u201d).\u00a0\u00a0If required, improve the pixel annotation in each class.Note: Annotate pixels in multiple areas of each section representing the tissue characteristics.Note: Avoid overtraining the algorithm on a single section or area, as this will reduce the classifier performance across the whole dataset.Note: When the classifier works as you expect, we recommend continuing with image processing and evaluating the performance of the classifier based on the output of the next step.\u00a0\u00a0Train and evaluate the classifier on at least three different input images by selecting them from \u201cCurrent View\u201d.Training.f.i.Select \u201c4. Prediction Export\u201d from the menu on the left.ii.Define the export image settings by clicking on \u201cChoose Export Image Settings\u201d as shown in iii.Note: An example of an Ilastik classifier file can be found on GitHub  under the name of \u20183.Pixelclass_Lamin_Masked.ilp\u2019.Save the project.Prediction export.g.i.Use this classifier to process all images.\u00a0\u00a0Open Command Prompt.\u201c[Path to Ilastik]\\ilastik.exe\u201d --headless --project=\"[Path to classifier saved]\\3.pixelclass_lamin_masked.ilp\u201d [Path to image]\\\u2217_Lamin_Masked.tif\u00a0\u00a0Run the command below by providing paths required:\u00a0\u00a0For each image, a tiff file that ends with \u201cMasked_Probabilities\u201d will be saved in the image directory.Run classifier.In this step, to segment the myofibers, the masked laminin images will be fed into an 36.Laminin segmentation and myofiber region-of-interest (ROI) generation.a.Open Fiji.b.Run \u201c4.Segment_Lamin.ijm\u201d macro to segment and generate the ROIs for each image.c.Provide a directory with \u201cMasked_Probabilities\u201d tiff images.d.i.a tiff file (with \u201c_Segmentation\u201d extension) in the input directory provided.and,ii.an ROI file that ends with \u201c_ROI\u201d in the ROI subdirectory will be saved .For each image.In this step, laminin segmentation is used to generate the regions-of-interest (ROI)  for each image.37.Extracting the mean-fluorescence-intensity and ROI properties.Note: Macro, used in this step, adds an extra channel (channel 5) to show the results of the pixel-classification step. This \u2018classification\u2019 channel is the output of the pixel classification algorithm (step 36). The segmentation quality is evaluated using the \u201cMean gray value\u201d on the border (strip of 3-pixels around ROI) of each ROI. This measurement allows assessment of the myofiber \u2018segmentation certainty\u2019 by looking at the \u2018classification\u2019 channel, i.e., the certainty is\u00a0high when the pixel-classification is high for the \u2018myofiber boundary\u2019 class all around the myofiber and low in the interior of the myofiber.a.Open Fiji.b.Run \u201c5.Export_MFI_and_Laminin_Int_and_Distance.ijm\u201d macro for the laminin segmentation and generate the regions-of-interest (ROI)  for each image.c.Provide a directory with tiff images.d.i.a tab-delimited text file that ends with \u201c_MFI\u201d in the ROI subdirectory .ii.Note: The distance of each myofiber to the edge of the tissue .Note: All the steps detailed above can be executed by running two Windows Batch Files provided on GitHub: https://github.com/tabbassidaloii/ImageProcessing/tree/main/MyofiberTyping/Macros/BatchFiles.three jpeg images that end with \u201c_check[X]\u201d in the check subdirectory.For each image, a file and three images will be saved.In this step, the mean-fluorescence-intensities (MFIs), as well as other properties in ROIs in all\u00a0fluorescence channels, are extracted using the Fiji measurements: \u201cArea\u201d, \u201cMean gray value\u201d, \u201cStandard deviation\u201d, \u201cModal gray value\u201d, \u201cMin\u00a0& max gray value\u201d, \u201cShape descriptors\u201d, \u201cMedian\u201d.Image processing will be performed using Fiji and IlastikTiming: Half a day (depends on the dataset size)https://github.com/tabbassidaloii/ImageProcessing/blob/main/MyofiberTyping/Rscript/MyofiberTyping.Rmd. In the steps below, we specify which R code chunk in this R markdown file should be used.Note: The threshold used in the R markdown file is specific to one example dataset that was used in this protocol. The filtering threshold should be tuned for each dataset.38.Exclusion of non-myofiber ROIs.Note: Filtering out using a statistical value could result in removing true myofibers ROIs. However, due to the large myofiber ROIs, the dataset outcome is unaffected by small changes in percentile cutoff values.Note: We verify the thresholds applied by visualizing the filtered ROIs using \u201c6.Visual_Check_Filtering.ijm\u201d macro available on GitHub: https://github.com/tabbassidaloii/ImageProcessing/tree/main/MyofiberTyping/Macros. The visualization can be performed after each filtering step to justify the threshold. Here we only show an example of filtered myofibers after the last filtering step.a.Filtering based on segmentation certainty.Note: The measurements which are based on the \u201cMean gray value\u201d are: Mean, laminin intensity inside the object ; Mean_boundary, laminin intensity on the boundary (the larger the better); StdDev_boundary, standard deviation of laminin intensity on the boundary .i.Pool all the data from all the samples by running \u201creadDataset\u201d R code chunk.ii.Draw a density plot for each metric to define a filtering threshold by running \u201cFilt1_segmentationMetrics_denPlot\u201d R code chunk.iii.Define the threshold based on the density distribution and apply filtering for Mean and Mean_boundary by running \u201cFilt1_segmentationMetrics_filtering\u201d R chunk code.Note: In this example, filtering based on StdDev_boundary is not used, because the StdDev_boundary has been improved by filtering for two other metrics.Note: The filtering thresholds should be tuned for other input datasets. We recommend iteratively assessing the thresholds applied by visualizing the filtered ROIs.In our dataset, including 369073 ROIs, we excluded ROIs from the top and bottom 5th percentile .Note: InThe measurement in the \u2018classification\u2019 channel can be used to assess the segmentation certainty and filter out non-myofiber ROIs .Note: Thb.Filtering based on CSA (\u03bcm2).i.Draw a density plot to define a filtering threshold by running \u201cFilt2_CSA_denPlot\u201d R code chunk A.ii.Note: Include all ROIs including those that are filtered in the segmentation certainty filtering step.Note: Depending on the dataset characteristic, CSA could have a diverse distribution across sample groups. Therefore, when the distribution is not the same, the filtering based on CSA should be separately applied to each group. However, applying filtering separately may introduce a bias, therefore these decisions about the study design require careful consideration. This is an important consideration to preserve biological differences between sample groups. We show an example for CSA across different muscles, we notice that the mean CSA differed between muscles, therefore the CSA-based filtering was made per muscle group.Note: When the normal CSA range for a given sample group is known, filtering for CSA can be implemented by removing ROIs out of range.Note: Since there is a right-skewed distribution, one may use different thresholds for both sides of the distribution  and 1 (circle). This measure is used to filter out longitudinally sectioned myofibers and elongated ROIs that may represent multiple myofibers (mis-segmented ROIs).In image processing, the laminin segmentation is automated, which may include non-myofiber ROIs in the dataset. Therefore, the first step is to filter out the non-myofiber ROIs. We consider percentiles of \u2018segmentation certainty\u2019, CSA, and circularity values.39.Visualizing and justifying the thresholds.a.Save a tab-delimited text file (with \u201c_Filt\u201d extension) in the ROI subdirectory by running \u201csave_visualizationInput\u201d R chunk code.i.0: ROIs filtered based on segmentation certainty.ii.0.4: ROIs included after filtering based on laminin segmentation certainty.iii.0.7: ROIs included after filtering based on CSA.iv.1: ROIs included after filtering based on circularity.In each filtering step, the script adds a column with 0 and 1 values to the tab-delimited text file specifying which ROIs are included (1) or excluded (0). The script also adds an extra column with values between 0 and 1 to show the aggregated filtering results. These values will be used to give a distinct color to ROI excluded in each filtering step:b.Open Fiji.c.Run \u201c6.Visual_Check_Filtering.ijm\u201d macro to visualize the filtered ROIs.d.Provide directory with tiff images and ROI subdirectory.e.For each sample, a jpeg file that ends with \u201c_check4\u201d will be saved in the image directory 41.classification of myofiber types.a.Scaling and transformation.The MFI values for each of the three MyHC isoforms are scaled for each myofiber per sample (without centering) using \u201cScalingAndTransformation\u201d R chunk code.b.Clustering.,i.Note: The optimum bandwidth (h) is arbitrary and should be selected based on the dataset characteristic. We suggest using h values ranging from 0.01 to 0.05 to find the optimum value. In general, a lower value assigns myofibers to many small clusters, whereas a higher value would result in grouping the myofibers in larger clusters. We expect to have three to eight clusters as potentially biologically relevant.Cluster the myofibers by running \u201cclustering\u201d R chunk code.ii.Remove the cluster with a low proportion of myofibers .iii.Draw boxplots to visualize the myofibers clusters The protocol for data-driven myofiber classification is detailed in Raz et\u00a0al.42.Biological interpretation.In this step, one section per sample is selected for further analysis. We recommend selecting the section with the highest number of myofibers after all filtering steps considering the quality of the sections. We consider only samples with a minimum of one hundred myofibers for downstream analysis.Note: The expression of MyHC isoforms describes contraction capacity. Changes in myofiber type composition were reported in pathological and physiological conditions. A quantitative assessment of myofiber type composition can help in understanding disease progression,,,The proportion of myofibers in each cluster can be then calculated per sample and can be used to compare myofiber type composition.This protocol allows segmentation of the whole muscle section, quantification of the three main MyHC isoforms, and myofiber typing using a semi-automated pipeline. The main user interaction is to check and potentially correct automatically generated tissue masks to exclude tissue folds or\u00a0other potential artifacts from the analysis. Even though the pipeline is highly automated, each individual step can be inspected to provide additional insight and to alleviate any potential issues. The main outcome of the image processing steps is a text file with the mean fluorescent intensity of these isoforms as well as other properties of each individual segmented myofiber including cross-sectional area and circularity. The file also includes the measurement for the \u2018classification\u2019 channel allowing assessment of the myofiber \u2018segmentation certainty\u2019. In the myofiber type composition analysis steps, following the filtering of non-myofiber ROIs, the MFI of three MyHC is used to cluster myofibers and to calculate the myofiber type composition in each sample.In this protocol we show how to use text files to calculate and compare the myofiber type compositions between different sample groups in R. But other parameters  can also be used for further comparison and statistical analysis. In addition, the text file can be imported into any other data analysis software such as Python or Excel.The laminin segmentation is performed in an automated manner because manual segmentation is nearly undoable for whole tissue sections. Some mis-segmentation is unavoidable, but the majority of mis-segmentations are removed using the filter procedures described above.In addition, we only applied this protocol on human and mouse samples see , and oneThe authors are available for troubleshooting and advice.When applying a gaussian blur to reduce any possible artifacts due to this binary mask, some biological signals might be removed.In this protocol, we use a gaussian blur of 4 pixels (sigma\u00a0= 4), but if it removes too many details the sigma can be adjusted in the \u201c2.Masked_Lamin.ijm\u201d macro (line 46).After Immunostaining, there might be more staining artifacts on the edge of the tissue.We provide a measure showing the distance of each segmented myofiber to the edge of the tissue in the text output file. This measurement can be used to filter out myofibers with staining artifacts close to the tissue borders.https://github.com/tabbassidaloii/ImageProcessing/issues.Users can report any issues with running this protocol to l.m.voortman@lumc.nl).Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact Lenard M. Voortman (This study did not generate new unique reagents."}
+{"text": "To analyze the sensory profile of children with auditory sensory processing disorder according to the Child Sensory Profile 2 and to verify potential associations between central auditory processing and sensory processing.Sixty children from two public schools in the city of Jo\u00e3o Pessoa, state of Para\u00edba, were evaluated. All children had their cognitive skills tested and their socioeconomic and demographic information collected. The children\u2019s hearing, central auditory processing, and sensory processing were evaluated. SPSS Statistics version 25.0 was used for data analysis and the significant value adopted was 0.05. Descriptive analysis was performed using the central tendency method. The similarities among the test variables were measured by Student\u2019s t-test and Mann-Whitney U test. The effect size (ES) between the groups was measured by Cohen\u2019s d or Rosenthal\u2019s r coefficient.The average age of children with CAPD was 8.4 years, and their families had lower levels of income and education when compared to those without the disorder. Children with CAPD present more sensory differences than their peers with normative CAP. The Child Sensory Processing 2 results didn\u2019t show any statistic associations with central auditory processing, and the effect size was of moderate magnitude for the visual system.Children with CAPD have more sensory differences than their peers according to the normative results of the Child Sensory Profile 2. An association between sensory and central auditory processing was not observed, except for the visual system. In 2007, in the context of contributing with more studies addressing this topic, Miller et al. suggested using the term \u201csensory processing\u201d to rename the neurological functions of receiving, modulating, integrating, discriminating, and organizing sensory information received from the environment and the body itself regarding the different sensory systems. Interruption or inadequate functioning of any of these stages lead to sensory processing disorder (SPD), which can involve one or more sensory systems , causing children to experience difficulties in performing their daily activities,3.Occupational therapist Anna Jean Ayres coined the term \u201csensory integration\u201d, in the mid-fifties, after associating problems in sensory information processing in children regarded as clumsy with inadequate behavior or somewhat slower academic performance-4. Studies on sensory processing and its functions aim to observe how an individual responds to the environmental demands to understand the associated implications for human behavior.Each individual responds to sensory information differently, and the presence of SPD is characterized by an imbalance between the neurobiological condition of processing and environmental sensory stimuli that interferes with the child\u2019s occupational performance-8. However, the actual influence of sensory processing on central auditory processing (CAP) remains unknown.Studies addressing sound issues have focused on characterizing sensory processing and on learning the influence of SPD on children\u2019s functional performance. SPD has been found to influence sleep, motor coordination skills, behaviors of anxiety, food selectivity, and self-regulation, in addition to receptive and expressive language learning in autistic children, among others.CAP is a function of the central auditory nervous system (CANS) that is responsible for sound perception and interpretation. Auditory processing encompasses the following set of skills: localization and lateralization of sound, auditory discrimination, auditory pattern recognition, temporal aspects of hearing, auditory performance, gradual decrease in auditory performance with competitive acoustic signals and with degraded acoustic signals-12. Children with CAPD tend to experience academic difficulties and can be often characterized as distracted, forgetful, restless, talkative, and having difficulty with the concept of time,11; therefore, they tend to ignore relevant auditory information. In a dynamic environment, the CANS functionality in these children is ineffective, and task performance oscillates,10.Thus, inadequate functioning of the CANS suggests the existence of a Central Auditory Processing Disorder (CAPD). CAPD is a deficit in the neural processing of the auditory stimulus whose symptoms include hearing difficulty in an acoustically unfavorable environment, which can be associated with other alterations or cause language and/or learning alterations, among other comorbidities used electroencephalography to measure the evoked auditory potentials (N200 and P300) of 20 children with SPD and 71 with typical development aged between 5 and 10 years. The brain processing of auditory stimulus in the children with SPD proved significantly different from their counterparts. In addition, the children with SPD also presented lower amplitudes of P300, which generally occurs in children with developmental alterations.Despite the similarity in terms of the functional difficulties caused by both SPD and CAPD, little is known on the association between them. In a study conducted in 2011, Gavin et al.Despite this information, little is known on the actual associations between SP and CAP. Aiming to clarify such relation, our goal is to analyze the sensory profile of children with CAPD and verify potential associations between CAP and SP. Our hypothesis is that children with CAPD develop more SPD than their counterparts with normal CAP.This is an exploratory cross-sectional study that investigated the sensory profile of children with CAPD and the potential associations between AP and SP in a sample of 60 children aged between seven and 10 years and 11 months from two municipal public schools in Jo\u00e3o Pessoa, state of Para\u00edba. Our data are part of a more comprehensive project named \u201cCentral Auditory Processing, Sensory Processing, and Motor Coordination in Schoolchildren\u201d, approved by the Research Ethics Committee of the University of S\u00e3o Paulo Medical School \u2013 protocol 1.856.907.All participants were authorized by their parents or legal guardians by signing a Free and Informed Consent and formalized their acceptance by signing a Term of Consent.To be included in the study, the children had to meet the following criteria:nd to the 5th grade of elementary school;Study in the municipal school system, in one of the two public schools selected, and be regularly enrolled in classes from the 2Be aged between seven and 10 years and 11 months at the time of the evaluation;.Present a satisfactory cognitive level according to Raven's Colored Progressive Matrices (CPM) TestThe cases of children with genetic syndromes, congenital malformations, peripheral sensory deficiencies , cognitive delay according to the CPM, intellectual disability, and neurological disorders, were excluded from this study.All the selected children underwent the following assessments:Inspection of the external acoustic meatus for possible obstacles to the exam;Tonal audiometry aimed at selecting individuals with normal hearing acuity, i.e. hearing thresholds up to 20dB NA (ANSI 69) in the tonal audiometry and normal results considering the values established by Santos and Russo (1986) and Jerger (1970) in the vocal audiometry. Exam performed via airway at frequencies between 250 and 8000Hz;Immittance measures: consisting of (a) tympanometry and (b) acoustic reflex testing to assess middle ear function and the integrity of the stapedius muscle acoustic reflex. The inclusion criteria were: presence of type-A tympanometric curves and presence of ipsilateral acoustic reflexes for the frequencies of 500Hz, 1000Hz, and 2000Hz .Only the children whose hearing tests were within the normal range and whose acoustic meatus had no alteration were subjected to the auditory processing assessments. All children underwent cognitive screening and a CAP assessment divided into two groups: 1) CAPD  and 2) normal CAP . in the cognitive screening of the eligible children, based on the Table XXV \u2014 CPM Standards for Public Schools. In turn, the percentile was classified according to the Table of Result Interpretation, varying from I to V, intellectually superior and intellectually deficient, respectively. Our study included the children classified between levels I and III .Two volunteer psychologists applied Raven's CPMWe obtained the data corresponding to the socioeconomic variables  by applying a form elaborated specifically for this research and filled out by the children\u2019s parents or caregivers, which was used in the sample characterization.The following devices were used during the hearing and CAP tests: acoustic booth, otoscope (Mark II 2.5V), immittance meter (Flute Plus \u2013 Inventis), digital audiometer (AVS 500 \u2013 Vibrasound), iPod Shuffle/mp3 (Apple) with the recorded AP test tracks, PAC equipment (PA400 \u2013 Ac\u00fastica Orlandi), and headphones (TDH30). All equipment had been properly calibrated. to assess sound origin with normality reference of at least four hits; 2) Pediatric Speech Intelligibility (SPI) to assess background-figure of verbal sounds, using only the ipsilateral condition, signal/noise ratio of 0dB, -10dB, and -15dB \u2013 hits were scored when the ipsilateral competitive message was over 80%, 70%, and 60% of hits at the respective signal/noise ratios; 3) digit dichotic to verify binaural integration with normality criterion defined according to the child\u2019s age: for those aged between 7 and 8 years, RE \u2265 85% of hits and LE \u226582% of hits, and for those aged between 9 and 10 years, RE \u2265 95% of hits and LE \u226595% of hits; 4) Random Gap Detection (RGDT) to assess temporal resolution, with the average of the four sound frequencies, \u226410ms, defined as the normality criterion for the children aged 7 or older.We applied the following behavioral tests in the AP assessment: 1) sound localization test in five directionsAll hearing and CAP assessments were performed by three speech therapists specialized in AP and the children who failed in at least two of the behavior tests were classified with altered CAP., which is a revised edition of the Child Sensory Profile aimed at verifying children\u2019s sensory processing in everyday situations. The version used in this study was translated and adapted to the context of the Brazilian culture and is authorized by Pearson\u00ae; in addition, the main researcher was contacted.For the SP assessment, we used the Child Sensory Profile 2 (CSP2)The caregivers were asked to answer the questionnaire describing how each child responds to the different sensory stimuli throughout the day..The behaviors are divided in sensory systems and sensory-based behaviors, and each item presents answers in a multiple-choice format composed of a Likert scale varying from zero to five: not applicable, almost never, occasionally, half of the time, frequently, and almost always, respectivelyThe responses are categorized in three major groups: quadrants, sensory section, and behavioral section.Through the analysis of the quadrants, the CSP2 demonstrated how the children react to the different sensory stimuli in everyday life:Seeker (the child searches for sensory information in the environment);Avoider ;Sensor (the child perceives more sensory information in everyday life);Bystander (the child does not perceive sensory stimuli in everyday life).The sensory section in the questionnaire points to the sensory systems that potentially influence more the children\u2019s routine and is grouped according to the types of sensory systems .The behavioral section shows the influence of these different sensory stimuli\u2019s response standards on the children\u2019s behavior taking into consideration their behavioral, socioemotional, and attentional responses.The raw score of the test is generated from the sum of the values in the items of each group listed above and transferred to a classification board of results that categorize the sensory processing of the groups into five different standards according to the normal distribution curve presented in the test: much less than others (-2 SD), less than others (-1 SD), just like the majority of others, more than others (+1 SD), and much more than others (+2 SD).The CSP2 does not indicate whether the child has SPD, but it identifies children placed at the edges of the normality curve who may be facing difficulties in their occupational performance due to their sensory processing.The sensory profile of children with CAPD was characterized according to the table of normative results, where those whose raw score dropped within the interval of the standard deviations (\u2264 -1 SD and \u2265 +1 SD) in the normality curve were regarded as presenting a sensory difference.Although the CSP2 is not a diagnostic test, it corresponds to a revised and updated version of the questionnaire that identify the children at the edge of the Gauss curve who are likely to be facing difficulties in everyday life associated with SPD.The CSP2 was applied through an interview with the child\u2019s caregiver conducted by two occupational therapists, properly trained research assistants. To indicate the answers, the caregiver was handed a visual scale with different color intensities corresponding to the Likert scale, which varied from \u201calmost always\u201d to \u201calmost never.\u201d After listening to each item, the caregiver pointed with their finger to the color representing the behavior closest to the child\u2019s.We inserted and tabulated the data on Excel for subsequent transfer to the SSPS Statistics software, version 25.0. The statistical significance value adopted was 5% (p \u2264 0.05).We based the statistical analysis of the data on the sample of 60 individuals divided into two groups: the CAPD Group (n = 23) and the Normal CAP Group (n = 37). Sample characterization consisted of a descriptive analysis with central tendency measures.We tested the normality assumption and applied Student\u2019s t test (parametric) and Mann-Whitney\u2019s U test (non-parametric) to compare the groups regarding the measures of central tendency and dispersion of the scores in the sensory processing tests. The effect size of the difference between the groups was measured by calculating the d (Cohen) or r  coefficient.All children assessed were aged between 7 and 10 years and 11 months, while their parents or caregivers were aged 37.4 years old in average (SD = 12.5). Most of these families have an income per capita under R$ 364.40. According to the normative result of the CSP2 , childreFor the group of children with normal CAP, the sensory differences are present in 6 of the 13 results, as follows: in the quadrants, they appear for the seeker, avoider, and sensor; in the sensory section, for movement; and in the behavioral section, for the socioemotional and attention responses.According to the results presented in . Although the age difference between the groups was not statistically relevant, we found that older children tend to respond better to the CAP tests, as their CANS is more mature. Such finding is no different from the literature reports that demonstrate a positive influence of auditory neuromaturation on performance in PA behavioral tests.The average ages of the children with CAPD and normal CAP were similar to the findings of Vilela et al. found a different result with no age difference regarding the gap in the temporal resolution skill, which may have resulted from our different research choices. It is also possible that such AP skill matures at earlier ages.Barreira, Branco-Barreiro and SamelliAll children in the sample are students from public schools. Most of them come from economically disadvantaged families, whose income per capita is below half of a minimum wage; therefore, both the studied groups \u2013 normal CAP and CAPD \u2013 belong to an economically vulnerable population. No statistical difference was observed between the income variable and the CAP results in our study; however, such condition may have influenced the increase in the CAPD index in the studied sample. reported that the development of auditory skills is more damaged in children whose resources and stimuli are limited to the family environment. In general, these families lack interaction among its members, as many of them are too busy making the family\u2019s living and thus have little time left to play or read with their children.Souza and collaboratorsEven though all children in our sample come from public schools, the data collection procedure revealed that all parents from the families with better income (according to the answers to the socioeconomic and demographic questionnaire) are more participative and had better interaction with the evaluators, showing enhanced social and communication skills and more concern for the research as collaborators. found that low-income families are constituted of parents with low level of education who, in turn, have children with growth problems and developmental cognitive and language levels below normal. Such information corroborated our result describing that the children whose caregivers have an education level equal or below elementary are more likely to develop CAPD (OR = 2.16). CAPD prevalence in this group reached the expressive value of approximately 70%  acontece. Esse tipo de transtorno pode envolver um ou mais sistemas sensoriais  e como consequ\u00eancia a crian\u00e7a pode ter dificuldades no desempenho de suas atividades cotidianas,3.Integra\u00e7\u00e3o sensorial foi o termo cunhado pela terapeuta ocupacional Anna Jean Ayres, em meados da d\u00e9cada de 50, quando a ent\u00e3o cientista associou problemas de processamento da informa\u00e7\u00e3o sensorial em crian\u00e7as consideradas desastradas, com comportamento inadequado ou mais lentas em rela\u00e7\u00e3o ao aprendizado acad\u00eamico-4. Estudos sobre o processamento sensorial e suas fun\u00e7\u00f5es procuraram observar como o indiv\u00edduo responde as demandas do ambiente, na tentativa de compreender suas implica\u00e7\u00f5es para o comportamento humano.A maneira como cada indiv\u00edduo responde as informa\u00e7\u00f5es sensoriais \u00e9 diferente e o TPS est\u00e1 presente quando h\u00e1 um desequil\u00edbrio entre a condi\u00e7\u00e3o neurobiol\u00f3gica do processamento e est\u00edmulos sensoriais no ambiente que interferem na performance ocupacional da crian\u00e7a-8. Por\u00e9m, \u00e9 desconhecido at\u00e9 o momento de que maneira o processamento sensorial influencia o processamento auditivo central (PAC).Caracterizar o processamento sensorial e saber de que maneira o TPS repercute no desempenho funcional das crian\u00e7as tem sido objeto de estudos de alguns pesquisadores. J\u00e1 foi observado que o TPS influencia o sono, as habilidades de coordena\u00e7\u00e3o motora, os comportamentos de ansiedade, a seletividade alimentar, o desenvolvimento de comportamentos de autorregula\u00e7\u00e3o e de aprendizado de linguagem receptiva e expressiva em crian\u00e7as autistas, entre outras.O PAC \u00e9 uma fun\u00e7\u00e3o do sistema nervoso auditivo central (SNAC) respons\u00e1vel pela percep\u00e7\u00e3o e interpreta\u00e7\u00e3o sonora. O processamento auditivo envolve uma s\u00e9rie de habilidades que s\u00e3o: a localiza\u00e7\u00e3o e lateraliza\u00e7\u00e3o do som, a discrimina\u00e7\u00e3o auditiva, o reconhecimento do padr\u00e3o auditivo, os aspectos temporais da audi\u00e7\u00e3o, a performance auditiva, a diminui\u00e7\u00e3o gradual da performance auditiva com sinais ac\u00fasticos competitivos e com sinais ac\u00fasticos degradados-12. Cian\u00e7as com TPAC tendem a ter dificuldades escolares e podem muitas vezes serem caracterizadas como distra\u00eddas, esquecidas, inquietas, falantes e apresentar dificuldade com o conceito de tempo,11, por isso, elas tendem a ignorar informa\u00e7\u00f5es auditivas relevantes. Num ambiente din\u00e2mico, a funcionalidade do SNAC dessas crian\u00e7as \u00e9 ineficiente e h\u00e1 um desempenho vari\u00e1vel da tarefa,10.Logo, quando o SNAC n\u00e3o funciona de maneira adequada, pode-se sugerir a exist\u00eancia de um transtorno do processamento auditivo central (TPAC). O TPAC \u00e9 um d\u00e9ficit no processamento neural do est\u00edmulo auditivo e tem como um dos sintomas a dificuldade de ouvir em um ambiente acusticamente desfavor\u00e1vel, pode estar associado a outras altera\u00e7\u00f5es ou causar altera\u00e7\u00f5es de linguagem e/ou aprendizagem e outras comorbidades utilizaram a eletroencefalografia para medir os potenciais evocados auditivos (N200 e P300) de 20 crian\u00e7as com TPS e 71 com desenvolvimento normal com idades entre 5 e 10 anos. As crian\u00e7as com TPS demonstraram um processamento cerebral do est\u00edmulo auditivo significativamente diferente dos seus pares. As crian\u00e7as com TPS apresentaram menores amplitudes de P300, o que geralmente acontece com crian\u00e7as com altera\u00e7\u00f5es do desenvolvimento.Apesar das dificuldades funcionais ocasionadas pelo TPS e pelo TPAC serem semelhantes em alguns aspectos, pouco se sabe sobre a associa\u00e7\u00e3o entre ambos. Em um estudo realizado em 2011, Gavin et al.Embora haja esse dado, pouco se sabe sobre as associa\u00e7\u00f5es entre o PS e o PAC. Visando esclarecer essa rela\u00e7\u00e3o, o objetivo desse artigo \u00e9 analisar o perfil sensorial de crian\u00e7as com TPAC e verificar as poss\u00edveis associa\u00e7\u00f5es entre o PAC e o PS. A hip\u00f3tese \u00e9 que crian\u00e7as com TPAC tem mais TPS que seus pares com o PAC normal.Este \u00e9 um estudo explorat\u00f3rio de corte transversal que investigou o perfil sensorial de crian\u00e7as com TPAC e as poss\u00edveis associa\u00e7\u00f5es entre o PA e o PS em uma amostra de 60 crian\u00e7as entre sete e 10 anos e 11 meses de idade de duas escolas p\u00fablicas municipais de Jo\u00e3o Pessoa, PB. Os dados aqui apresentados s\u00e3o parte de um projeto maior intitulado \u201cProcessamento Auditivo Central, Processamento Sensorial e Coordena\u00e7\u00e3o Motora de Crian\u00e7as em Idade Escolar\u201d, aprovado pelo comit\u00ea de \u00e9tica em pesquisa da Faculdade de Medicina da Universidade de S\u00e3o Paulo sob o parecer 1.856.907.Todos os participantes da pesquisa foram autorizados pelos seus pais ou respons\u00e1veis atrav\u00e9s da assinatura do Termo de Consentimento Livre e Esclarecido e formalizaram seu aceite atrav\u00e9s de sua assinatura no Termo de Assentimento.Foram estabelecidos para o estudo os seguintes crit\u00e9rios de inclus\u00e3o:- Ser estudante da rede municipal de ensino de duas escolas p\u00fablicas de ... e estar regularmente matriculado nas turmas do 2\u00b0 ao 5\u00b0 ano do ensino fundamental;Ter entre sete e 10 anos e 11 meses de idade no momento da avalia\u00e7\u00e3o;.Apresentar n\u00edvel cognitivo satisfat\u00f3rio de acordo com o Teste de Matrizes Coloridas de Raven (Coloured Progressive Matrices - CPM)Crian\u00e7as com s\u00edndromes gen\u00e9ticas, malforma\u00e7\u00f5es cong\u00eanitas, defici\u00eancias sensoriais perif\u00e9ricas , com atraso cognitivo de acordo com o CPM, defici\u00eancia intelectual e dist\u00farbios neurol\u00f3gicos foram exclu\u00eddas da amostra.Todas as crian\u00e7as selecionadas para o estudo realizaram as seguintes avalia\u00e7\u00f5es:Inspe\u00e7\u00e3o do meato ac\u00fastico externo para verificar poss\u00edveis impedimentos \u00e0 realiza\u00e7\u00e3o do exame.Audiometria tonal: com o objetivo de selecionar os indiv\u00edduos com acuidade auditiva normal, ou seja, limiares de audibilidade at\u00e9 20dB NA (ANSI 69) na audiometria tonal e resultados normais considerando os valores estabelecidos por Santos e Russo (1986) e Jerger (1970) na audiometria vocal. Foi realizada por via a\u00e9rea, nas frequ\u00eancias de 250 a 8000Hz.Medidas de imitanciometria: compostas por (a) timpanometria e (b) pesquisa de reflexos ac\u00fasticos para avaliar a fun\u00e7\u00e3o da orelha m\u00e9dia e a integridade do reflexo ac\u00fastico do m\u00fasculo estap\u00e9dio. Foi adotado como crit\u00e9rio de inclus\u00e3o a presen\u00e7a de curvas timpanom\u00e9tricas do tipo A e presen\u00e7a dos reflexos ac\u00fasticos ipsilateral para as frequ\u00eancias de 500Hz, 1000Hz e 2000Hz .S\u00f3 realizaram as avalia\u00e7\u00f5es do processamento auditivo as crian\u00e7as cujos testes audiol\u00f3gicos estavam dentro da normalidade e o meato ac\u00fastico n\u00e3o apresentou qualquer altera\u00e7\u00e3o.Todas as crian\u00e7as foram submetidas a triagem cognitiva e a avalia\u00e7\u00e3o do PAC e dividida em dois grupos, 1) TPAC  e 2) PAC normal . que foi aplicado por duas psic\u00f3logas volunt\u00e1rias. Foi considerada como refer\u00eancia para o resultado a Tabela XXV \u2014 Normas do CPM para Escolas P\u00fablicas. O percentil, por sua vez, \u00e9 classificado pela tabela de Interpreta\u00e7\u00e3o dos Resultados, que varia de I a V, intelectualmente superior e intelectualmente deficiente, respectivamente. Foram inclu\u00eddas nesse estudo as crian\u00e7as classificadas entre os n\u00edveis I e III- .Para realizar a triagem cognitiva das crian\u00e7as eleg\u00edveis para o estudo foi utilizado o CPM de RavenOs dados correspondentes \u00e0s variaveis socioecon\u00f4micas  foram obtidos atrav\u00e9s da aplica\u00e7\u00e3o de um formul\u00e1rio elaborado para pesquisa, respondido pelos pais ou respons\u00e1veis pela crian\u00e7a e utitlizados para a caracteriza\u00e7\u00e3o da amostra.Para a realiza\u00e7\u00e3o dos testes audiol\u00f3gicos e de PAC foram utilizados os seguintes materias: a cabina ac\u00fastica, o otosc\u00f3pio , imitanci\u00f4metro (Flute Plus \u2013 Inventis), audi\u00f4metro digital (AVS 500- Vibrasom), iPod Shuffle/mp3 (Apple) com as faixas dos testes de PA gravadas, o equipamento do PAC (PA400 - Ac\u00fastica Orlandi) e fones auriculares (TDH30). Todos os aparelhos estavam devidamente calibrados., para avaliar a capacidade de origem do som, a refer\u00eancia de normalidade adotada foi de no m\u00ednimo quatro acertos; 2) Pediatric Speech Inteligibility (PSI), para avaliar a figura-fundo dos sons verbais, apenas a condi\u00e7\u00e3o ipsilateral foi utilizada, a rela\u00e7\u00e3o sinal/ru\u00eddo foi de 0dB, -10dB e -15dB e foi considerado acerto quando a mensagem competitiva ipsilateral foi maior de 80%, 70% e 60% de acertos nas respectivas rela\u00e7\u00f5es sinal/ru\u00eddo; 3) dic\u00f3tico de d\u00edgitos, para verificar a integra\u00e7\u00e3o binaural, o crit\u00e9rio de normalidade utilizado estava de acordo com a idade das crian\u00e7as do estudo, para crian\u00e7as de 7 a 8 anos \u2013 OD \u2265 85% de acertos e OE \u226582% de acertos, para as idade de 9 a 10 anos - OD \u2265 95% de acertos e OE \u226595% de acertos; 4) Random Gap Detection (RGDT), para avaliar a resolu\u00e7\u00e3o temporal, o crit\u00e9rio de normalidade utilizado para crian\u00e7as de sete anos ou mais para a m\u00e9dia das quatro frequ\u00eancias sonoras foi de \u226410ms.Os testes comportamentais utilizados para a avalia\u00e7\u00e3o do PA foram: 1) teste de localiza\u00e7\u00e3o sonora em cinco dire\u00e7\u00f5esAs avalia\u00e7\u00f5es audiol\u00f3gicas e de PAC foram realizadas por tr\u00eas fonoaudi\u00f3logas especialistas em PA e foram classificadas com PAC alterado as crian\u00e7as que apresentaram falha em pelo menos dois dos testes de comportamento.Child Sensory Profile 2 (CSP2). O CSP2 \u00e9 uma edi\u00e7\u00e3o revisada do Child Sensory Profile e tem como objetivo verificar o processamento sensorial da crian\u00e7a nas situa\u00e7\u00f5es do cotidiano. Nesse estudo foi utilizada sua vers\u00e3o traduzida e adaptada culturalmente para o Brasil, obtida a partir da autoriza\u00e7\u00e3o da Pearson\u00ae e contato direto com o pesquisador principal respos\u00e1vel pelo estudo.Para avaliar o PS foi utilizado o Trata-se de um question\u00e1rio aplicado aos respons\u00e1veis que registram a maneira como a crian\u00e7a responde aos diferentes est\u00edmulos sensoriais que ocorrem ao longo do dia..Os comportamentos est\u00e3o divididos por sistemas sensoriais e comportamentos de base sensorial e cada item apresenta uma possibilidade de resposta dentro de uma escala Likert que varia de zero a cinco, em que as op\u00e7\u00f5es s\u00e3o: n\u00e3o se aplica, quase nunca, ocasionalmente, metade das vezes, frequentemente e quase sempre, respectivamenteAs respostas s\u00e3o categorizadas em tr\u00eas grandes grupos, quadrantes, se\u00e7\u00e3o sensorial e se\u00e7\u00e3o comportamental.O CSP2 mostra atrav\u00e9s da an\u00e1lise da se\u00e7\u00e3o quadrantes, como as crian\u00e7as reagem aos diferentes est\u00edmulos sensoriais existentes no cotidiano:buscador (quando a crian\u00e7a procura informa\u00e7\u00f5es sensoriais no ambiente);evasivo (quando a crian\u00e7a evita ou n\u00e3o consegue lidar com os est\u00edmulos sensoriais do ambiente);sens\u00edvel (quando a crian\u00e7a percebe mais as informa\u00e7\u00f5es sensoriais do cotidiano);passivo (quando a crian\u00e7a n\u00e3o percebe os est\u00edmulos sensoriais existentes em sua rotina).A se\u00e7\u00e3o sensorial do question\u00e1rio aponta os poss\u00edveis sistemas sensoriais que exercem mais influ\u00eancia na rotina dessas crian\u00e7as e est\u00e1 agrupada de acordo com os tipos de sistemas sensoriais existentes .Na se\u00e7\u00e3o comportamental pode-se verificar o quanto esses padr\u00f5es de resposta diante dos diferentes est\u00edmulos sensoriais influenciam o comportamento da crian\u00e7a para as resposta de conduta, socioemocional e atencional.O escore bruto do teste \u00e9 feito a partir da somat\u00f3ria dos valores dos itens de cada grupo listado acima e transferido para o quadro de classifica\u00e7\u00e3o dos resultados que categoriza o processamento sensorial dos grupos em cinco diferentes padr\u00f5es de acordo com a curva de distribui\u00e7\u00e3o normal apresentada no teste: muito menos que os outros (-2 DP), menos que os outros (-1 DP), exatamente como os outros, mais que os outros (+1 DP) e muito mais que os outros (+2 DP).O CSP2 n\u00e3o diz se a crian\u00e7a tem ou n\u00e3o um TPS, mas ele sugere que crian\u00e7as nos extremos da curva de normalidade possam estar enfrentando dificuldades em seu desempenho ocupacional por consequ\u00eancia do seu processamento sensorial.As crian\u00e7as com TPAC tiveram seu perfil sensorial caracterizado de acordo com o quadro do resultado normativo do teste e aquelas cujo escore bruto ca\u00edram no intervalo dos desvios padr\u00e3o (\u2264 -1 DP e \u2265 +1 DP) da curva de normalidade foram categorizadas com diferen\u00e7a sensorial.Apesar do CSP2 n\u00e3o ser um teste diagn\u00f3stico, ele \u00e9 uma vers\u00e3o de question\u00e1rio revisada e atual, capaz de sugerir que crian\u00e7as que est\u00e3o no extremo da curva de Gauss podem estar enfrentando dificuldades no cotidiano que est\u00e3o associadas ao TPS.O CSP2 foi aplicado por meio de entrevista ao acompanhante da crian\u00e7a, por duas terapeutas ocupacionais, auxiliares de pesquisa, devidamente treinadas. Para a marca\u00e7\u00e3o das resposta, foi entregue ao respons\u00e1vel, uma escala visual com diferentes intensidades de cores, para identificar a escala likert, que variou do quase sempre ao quase nunca. Assim que cada item era lido para o respons\u00e1vel, ele indicava com o dedo a cor que representava o comportamento mais aproximado da crian\u00e7a.SPSS Statistics, vers\u00e3o 25.0. O valor de signific\u00e2ncia estat\u00edstica adotado foi igual a 5% .Os dados foram inseridos e tabulados no Excel e transportados para o software A an\u00e1lise estat\u00edstica dos dados do estudo foi realizada usando como base a amostra de 60 indiv\u00edduos organizados em dois grupos: Grupo TPAC (n = 23) e Grupo PAC Normal (n = 37). Para caracteriza\u00e7\u00e3o da amostra foi realizada uma an\u00e1lise descritiva com medidas de tend\u00eancia central.O pressuposto de normalidade foi testado. Para comparar os grupos em rela\u00e7\u00e3o \u00e0s medidas de tend\u00eancia central e de dispers\u00e3o das pontua\u00e7\u00f5es nos testes de processamento sensorial foram utilizados os testes t de Student (param\u00e9trico) e U de Mann-Whitney (n\u00e3o param\u00e9trico). O tamanho do efeito da diferen\u00e7a entre os grupos foi medido por meio do c\u00e1lculo dos coeficientes d (Cohen) ou r .Todas as crian\u00e7as avaliadas tinham idade entre 7 anos e 10 anos e 11 meses; seus respons\u00e1veis tinham uma m\u00e9dia de 37,4 anos de idade. A maioria dessas fam\u00edlias tem renda familiar per capita inferior a R$ 364,40. A A De acordo com o resultado normativo do CSP2 , crian\u00e7aPara o grupo de crian\u00e7as com PAC normal, as diferen\u00e7as sensoriais est\u00e3o presentes em 6 dos 13 resultados: na se\u00e7\u00e3o dos quadrantes as diferen\u00e7as apareceram para buscador, evasivo, sens\u00edvel; na se\u00e7\u00e3o sensorial para movimento; e, na se\u00e7\u00e3o comportamental a resposta socioemocional e atencional.De acordo com o resultado apresentado na . Embora as diferen\u00e7a de idade entre os grupos n\u00e3o tenha relev\u00e2ncia estat\u00edstica, observa-se que as crian\u00e7as mais velhas tendem a responder melhor aos testes de PAC, uma vez que o SNAC est\u00e1 mais amadurecido. Essa informa\u00e7\u00e3o n\u00e3o \u00e9 diferente do encontrado na literatura que mostra a influ\u00eancia positiva da neuromatura\u00e7\u00e3o auditiva no desempenho dos testes comportamentais do PA.As m\u00e9dias de idade das crian\u00e7as com TPAC e PAC normal foram semelhantes as m\u00e9dias do estudo de Vilela et al. encontraram um resultado diferente do apresentado e n\u00e3o observaram diferen\u00e7a de idade para detec\u00e7\u00e3o do gap na habilidade de resolu\u00e7\u00e3o temporal. Isso pode ser resultado do teste de escolha ter sido diferente do utilizado na presente pesquisa, como tamb\u00e9m pela possibilidade dessa habilidade do PA amadurecer em idades mais precoces.Barreira, Branco-Barreiro e Samelliper capita familiar foi inferior a meio sal\u00e1rio m\u00ednimo, logo, ambos os grupos estudados, PAC normal e TPAC, pertencem a uma popula\u00e7\u00e3o economicamente vulner\u00e1vel. N\u00e3o foi observada diferen\u00e7a estat\u00edstica entre a vari\u00e1vel renda e o resultado do PAC neste estudo, por\u00e9m essa pode ser uma condi\u00e7\u00e3o que influenciou o aumento no \u00edndice de TPAC na amostra estudada.Todas as crian\u00e7as da amostra s\u00e3o estudantes de escola p\u00fablica. A maioria delas vive em fam\u00edlias economicamente desfavorecidas, cuja renda  afirmam que crian\u00e7as que t\u00eam recursos e est\u00edmulos limitados no ambiente familiar t\u00eam mais preju\u00edzo no desenvolvimento de suas habilidades auditivas. S\u00e3o fam\u00edlias que geralmente s\u00e3o carentes em rela\u00e7\u00e3o a intera\u00e7\u00e3o com seus membros, pois muitos deles est\u00e3o tentando adquirir recursos para sobreviver, e, em sua maioria, t\u00eam pouca oportunidade de brincar ou ler para seus filhos.Souza e colaboradoresEmbora todas as crian\u00e7as da presente pesquisa sejam de escolas p\u00fablicas, uma observa\u00e7\u00e3o realizada durante o procedimento de coleta de dados foi que os pais das fam\u00edlias com melhor renda (de acordo com o respondido no question\u00e1rio socioecon\u00f4mico e demogr\u00e1fico) eram mais participativos e interagiam melhor com os avaliadores, mostrando melhores habilidades sociais e de comunica\u00e7\u00e3o, consequentemente, esses mesmos pais demonstraram mais preocupa\u00e7\u00e3o em colaborar com o presente estudo. verificaram que fam\u00edlias de baixa renda e com pais de baixo n\u00edvel de escolaridade t\u00eam crian\u00e7as com problemas de crescimento e n\u00edveis de desenvolvimento cognitivo e de linguagem abaixo da normalidade. Essa informa\u00e7\u00e3o corrobora com o resultado apresentado nesta pesquisa, em que crian\u00e7as cujos respons\u00e1veis tem escolaridade igual ou menor que o ensino fundamental t\u00eam mais chance de ter o TPAC  preval\u00eancia do TPAC nesse grupo chegou a um valor expressivo de aproximadamente 70% (, que diz que as crian\u00e7as cujos pais t\u00eam mais escolaridade apresentaram melhores resultados de desenvolvimento cognitivo e de linguagem, pois a quantidade e a qualidade dos est\u00edmulos auditivos e de linguagem oferecidos \u00e0s crian\u00e7as s\u00e3o maiores, o que permite a ela uma maior experi\u00eancia com a informa\u00e7\u00e3o auditiva. Esses pais tendem a iniciar comunica\u00e7\u00f5es espont\u00e2neas com seus filhos; em geral, eles conversam mais, leem mais, utilizam brincadeiras e jogos imagin\u00e1rios, al\u00e9m de terem um ambiente familiar mais organizado e com mais recursos.Em geral, \u00e9 na popula\u00e7\u00e3o de baixa renda que tamb\u00e9m est\u00e3o as fam\u00edlias com respons\u00e1veis de baixa escolaridade. Neves et al.ente 70% . A alta .Em rela\u00e7\u00e3o aos resultados do CSP2, a exist\u00eancia de um tamanho do efeito de magnitude moderada entre o PAC e PS visual mostra como as informa\u00e7\u00f5es sensoriais visuais e auditivas est\u00e3o associadas. Com isso, pode-se inferir que como a informa\u00e7\u00e3o auditiva que chega at\u00e9 essas crian\u00e7as n\u00e3o s\u00e3o precisas, elas utilizam a informa\u00e7\u00e3o visual como recurso complementar para a realiza\u00e7\u00e3o de suas tarefas no cotidiano; compreende-se por tarefa n\u00e3o s\u00f3 as acad\u00eamicas, mas as demais atividades de autocuidado e lazer. Isso pode acontecer porque as informa\u00e7\u00f5es sensoriais se interconectam atrav\u00e9s das estruturas neurol\u00f3gicas do SNC e dos coliculos, estrutura primariamente visual, que cont\u00e9m um mapa espacial auditivo com seus neur\u00f4nios de diferentes regi\u00f5es que respondem ao est\u00edmulo auditivoA .As diferen\u00e7as sensoriais dos sistemas visual, t\u00e1til, de movimento e sensorial oral encontradas nas crian\u00e7as com TPAC podem ser consequ\u00eancia da integra\u00e7\u00e3o multissensorial que acontece no SNAC, ou seja, quando essas falham, automaticamente os indiv\u00edduos recorrem aos demais sistemas sensoriais na tentativa de compensar a inefici\u00eancia da fun\u00e7\u00e3o auditiva confirma o construto te\u00f3rico do processamento sensorial em que afirma a necessidade da integra\u00e7\u00e3o das informa\u00e7\u00f5es para que um indiv\u00edduo tenha desempenho satisfat\u00f3rio na execu\u00e7\u00e3o de suas tarefas cotidianas.A partir desse resultado, pode-se confirmar a hip\u00f3tese de que crian\u00e7as com TPAC t\u00eam mais diferen\u00e7as sensoriais que seus pares. Uma possibilidade \u00e9 a forma como a integra\u00e7\u00e3o das informa\u00e7\u00f5es sensoriais ocorre, pois o sistema sensorial funciona como um todo, e falhas no processamento auditivo interferir\u00e3o na maneira como o indiv\u00edduo usa, interpreta ou reage aos demais est\u00edmulos sensoriais do ambiente. Um artigo recente publicado por Lane et al.De acordo com o CSP2, o comportamento das crian\u00e7as pode ser dividido em quadrantes, que \u00e9 a maneira como a crian\u00e7a se comporta diante das informa\u00e7\u00f5es sensoriais recebidas. No presente estudo, crian\u00e7as com TPAC tiveram diferen\u00e7a em dois quadrantes: buscador e sens\u00edvel. Isso quer dizer que essas crian\u00e7as buscam e s\u00e3o sens\u00edveis aos est\u00edmulos visuais, t\u00e1teis, de movimento e orais mais que a maioria das crian\u00e7as.A sensibilidade sensorial nas crian\u00e7as com TPAC \u00e9 ainda maior que naquelas com PAC normal . Isso poNo presente estudo, as crian\u00e7as com TPAC tamb\u00e9m apresentaram mais problemas sensoriais que as crian\u00e7as normais para o PAC, mas essas \u00faltimas tamb\u00e9m tiveram diferen\u00e7as sensoriais de acordo com o CSP2 . Essas d, podem interferir no desempenho, na frequ\u00eancia e na sensa\u00e7\u00e3o de prazer de uma atividade realizada. Problemas no PS tamb\u00e9m foram encontrados por Mimouni-Bloch na popula\u00e7\u00e3o de crian\u00e7as com TDAH, por\u00e9m nenhuma rela\u00e7\u00e3o foi feita com o TPAC.Esses comportamentos podem estar associados a um TPS. Essas crian\u00e7as tendem a apresentar mais dificuldade em desempenhar suas tarefas de vida di\u00e1ria, em especial as escolares. Os problemas de modula\u00e7\u00e3o sensorial, segundo Bar-Shalita, Vatine e ParushNas crian\u00e7as com PAC normal, 6 dos 13 resultados do CSP2 estavam alterados . Na se\u00e7\u00e3N\u00e3o foi observada diferen\u00e7a em crian\u00e7as com PAC normal e TPAC para o quadrante de buscador e sens\u00edvel, movimento e aten\u00e7\u00e3o. Isso pode ser explicado pela semelhan\u00e7a existente no ambiente que essas crian\u00e7as est\u00e3o inseridas. A maioria da popula\u00e7\u00e3o estudada reside em \u00e1rea de risco para viol\u00eancia urbana. S\u00e3o crian\u00e7as que est\u00e3o geralmente restritas ao espa\u00e7o de casa e da escola, e como suas casas geralmente s\u00e3o pequenas e as escolas n\u00e3o possuem parque, a necessidade de brincadeiras de movimento caracter\u00edsticas dessa idade muitas vezes n\u00e3o encontra espa\u00e7o e \u00e9 percebida como excessiva. verificou como os fatores ambientais podem influenciar o perfil sensorial de 97 lactentes frequentadores de creches em Vila Real, Portugal. Apesar da amostra ser diferente da apresentada no presente estudo, eles verificaram o quanto a escassez de est\u00edmulos de qualidade no ambiente pode interferir no processamento sensorial dos lactentes e viram que 11,3% e 22,7% tiveram processamento sensorial de risco e deficiente, respectivamente, de acordo com o Test of Sensory Function in Infants. O ambiente da creche esteve associado ao perfil sensorial do beb\u00ea, e o espa\u00e7o onde crian\u00e7as foram avaliadas \u00e9, segundo os autores, negligenciado em rela\u00e7\u00e3o \u00e0 quantidade e \u00e0 qualidade de brinquedos que permitem aos lactentes um desenvolvimento sens\u00f3rio-motor adequado.Um estudo realizado por Pedrosa, Ca\u00e7ola e CarvalhalSe levarmos em considera\u00e7\u00e3o as escolas que as crian\u00e7as deste estudo est\u00e3o inseridas, elas n\u00e3o diferem da situa\u00e7\u00e3o encontrada na creche do estudo supracitado. Ambos os ambientes n\u00e3o oferecem \u00e1rea externa com brinquedos que permitam \u00e0s crian\u00e7as, durante o recreio, realizar uma variedade de brincadeiras em espa\u00e7o apropriado. Embora a associa\u00e7\u00e3o estat\u00edstica entre o processamento sensorial e os dados socioecon\u00f4micos desse estudo n\u00e3o tenha sido verificada, as diferen\u00e7as sensoriais encontradas no CSP2 das crian\u00e7as com PAC normal podem estar associadas \u00e0 falta de oportunidade de est\u00edmulos ambientais adequados., que verificaram a associa\u00e7\u00e3o entre as condi\u00e7\u00f5es socioecon\u00f4micas e o perfil sensorial de crian\u00e7as do pr\u00e9-escolar de duas institui\u00e7\u00f5es de ensino de Porto Rico. A amostra estudada foi composta por 141 respons\u00e1veis pelas crian\u00e7as, que estavam divididas em dois grupos: 78 de um centro de estudo para crian\u00e7as de baixa renda, que recebe apoio do Departamento de Sa\u00fade e Servi\u00e7os Humanos dos Estados Unidos, e 63 respons\u00e1veis por crian\u00e7as de escolas privadas de n\u00edvel socioecon\u00f4mico mais alto. Todos responderam o Short Sensory Profile e um question\u00e1rio com informa\u00e7\u00f5es demogr\u00e1ficas. O resultado do estudo mostrou associa\u00e7\u00e3o entre a sensibilidade ao movimento e a busca sensorial com o n\u00edvel de educa\u00e7\u00e3o dos pais e a renda familiar. As crian\u00e7as cujos pais tinham mais escolaridade pontuaram mais nesses itens que as de pais com baixa escolaridade, ou seja, buscaram mais est\u00edmulos de movimento. Os pesquisadores tamb\u00e9m associaram o baixo n\u00edvel socioecon\u00f4mico a condi\u00e7\u00f5es de ambiente com menos recursos e estimula\u00e7\u00e3o.Resultado semelhante ao presente estudo foi encontrado por Rom\u00e1n-Oyola e ReynoldsApesar de realizar essa correla\u00e7\u00e3o, a popula\u00e7\u00e3o estudada difere da avaliada no presente estudo, principalmente em rela\u00e7\u00e3o aos aspectos socioculturais. Logo, sugere-se que novos estudos sejam feitos procurando tra\u00e7ar o perfil sensorial de crian\u00e7as cujas fam\u00edlias vivem em situa\u00e7\u00e3o socioecon\u00f4mica desfavorecida no nordeste do Brasil.Outra hip\u00f3tese para a busca por movimento no grupo de crian\u00e7as sem altera\u00e7\u00e3o pode ser o aspecto fisiol\u00f3gico no momento atual do desenvolvimento da crian\u00e7a, pois crian\u00e7as dessa faixa et\u00e1ria brincam e se movimentam. Isso n\u00e3o necessariamente \u00e9 um problema, muitas vezes \u00e9 um passatempo entre uma atividade e outra, mas aos olhos dos respons\u00e1veis esse comportamento pode incomodar, resultando em um falso positivo.. Nesse estudo, as crian\u00e7as foram acompanhadas por uma semana, diariamente, \u00e0 tarde, durante uma hora ap\u00f3s as aulas. O tempo de observa\u00e7\u00e3o das crian\u00e7as foi considerado suficiente quando o brincar livre e espont\u00e2neo aconteceu, mesmo na presen\u00e7a do pesquisador. As brincadeiras realizadas pelas crian\u00e7as envolveram atividades de motricidade grossa, sempre na companhia de um amigo, membro da fam\u00edlia ou adulto, com algum brinquedo ou objeto dispon\u00edvel utilizado de maneira simb\u00f3lica, e outras atividades, como assistir televis\u00e3o. Embora a regi\u00e3o que as crian\u00e7as residiam e brincavam tivesse quest\u00f5es que colocavam em risco sua seguran\u00e7a, elas eram criativas e utilizavam como recurso o que havia dispon\u00edvel no ambiente. Os pesquisadores tamb\u00e9m observaram que quando essas crian\u00e7as estavam transitando entre uma atividade e outra elas permaneciam em constante movimento. Esse resultado corrobora com a proposi\u00e7\u00e3o feita, de que mesmo nas crian\u00e7as com PAC normal a procura por brincadeiras de movimento pode ser um comportamento considerado normal para a idade.O comportamento do brincar de crian\u00e7as numa popula\u00e7\u00e3o de baixa renda de uma comunidade no interior da \u00c1frica do Sul foi avaliado por Bartie e colaboradoresA diferen\u00e7a sensorial encontrada nos quadrantes sens\u00edvel e evasivo das crian\u00e7as com PAC normal sugere que, como provavelmente essas crian\u00e7as n\u00e3o t\u00eam altera\u00e7\u00e3o da linguagem oral e/ou escrita, elas podem ter mais facilidade para reportar aos seus respons\u00e1veis a situa\u00e7\u00e3o de desconforto. Isso n\u00e3o acontece com as crian\u00e7as com TPAC, que muitas vezes t\u00eam dificuldade de transmitir a mensagem de forma clara. Essa \u00e9 apenas uma hip\u00f3tese com base no resultado encontrado, e mostra que muito ainda precisa ser explorado em rela\u00e7\u00e3o ao estudo do processamento sensorial.Apesar da relev\u00e2ncia dos resultados encontrados nesse estudo, ele apresenta limita\u00e7\u00f5es importantes:por ser um estudo pioneiro, ele foi realizado com uma amostra de conveni\u00eancia e pouco representativa da popula\u00e7\u00e3o;o n\u00edvel de escolaridade e renda da amostra estudada pode ter influenciado no resultado dos testes;a faixa et\u00e1ria das crian\u00e7as variou dos sete aos 10 anos e 11 meses e essa diferen\u00e7a de idade pode ter influenciado nos resultados das avalia\u00e7\u00f5es do PAC.A caracter\u00edstica do PS de crian\u00e7as com TPAC \u00e9 diferente quando comparada a popula\u00e7\u00e3o normativa do CSP2. Para os quadrantes a diferen\u00e7a apareceu em buscador e sens\u00edvel; na se\u00e7\u00e3o sensorial essa diferen\u00e7a apareceu para os sistemas visual, t\u00e1til, movimento e oral; e, na se\u00e7\u00e3o comportamental a conduta e resposta atencional mostrou diferen\u00e7a.Em rela\u00e7\u00e3o a associa\u00e7\u00e3o entre o PAC e PS, nenhum dos resultados do CSP2 mostrou signific\u00e2ncia estat\u00edstica entre as vari\u00e1veis, por\u00e9m o tamanho do efeito da diferen\u00e7a entre elas foi de magnitude moderada para o sistema visual.Apesar de n\u00e3o ser um objetivo do estudo, as caracter\u00edsticas socioecon\u00f4micas e demogr\u00e1ficas da popula\u00e7\u00e3o estudada pareceram ter influ\u00eancia nos resultados do PAC, o que sugere que tal rela\u00e7\u00e3o possa ser melhor explorada em estudos futuros."}
+{"text": "To characterize phonological processing of adolescents and to identify language skills and cognitive functions that influence their age group.83 typical adolescents aged from 11 to 16 years of age participated in the research. Phonological awareness tests, rapid automatic naming, neuropsychological assessment and reading were used. Descriptive analysis and linear regression were carried out with a 5% significance level.Regarding phonological processing, a lower performance was found in the phonemic segmentation task, longer times for object naming and performance as were expected for working memory of the age range. There was a reciprocal association between rapid naming of objects, letters and working memory, between rapid naming of letters and phonological awareness. Executive functions and attention influence working memory and phonological awareness. Semantic episodic verbal memory influenced working memory and reading, phonological awareness.The performance in phonological processing was influenced by linguistic and cognitive skills which suggests they are still improving in adolescents. It is important in the initial acquisition of reading and in the decoding of unknown regular words, as it allows for establishing a relationship between phoneme and grapheme.According to studies phonological awareness allows a person to consciously perceive and manipulate the sound information of words at various levels: intrasyllabic, syllabic and phonemic.Working memory on the other hand is responsible for retrieving orthographic and phonological data in the mental lexicon, while graphophonemic associations are performed. It participates in the learning of new words, syntactic analysis and reading and language comprehension. When information is accessed quickly and accurately in the mental lexicon, more cognitive and attentional resources will be available for reading.Rapid naming capability allows for quick access to information which is an important aspect for reading fluency, through the involvement of various cognitive resources,12. The appropriation and increase in reading and writing proficiency also drive and can explain the development of higher levels of phonological processing,12; however studies investigating the performance of phonological processing of adolescents as a response variable and explained by linguistic-cognitive skills are still scarce.Studies that have already investigated the interaction of linguistic and cognitive skills with phonological processing show a reciprocity relationshipThis study aims to characterize phonological processing of adolescents and identify language skills and cognitive functions that influence this age group.This study has an analytical observational cross-sectional design and was approved by the Research Ethics Committee of the Federal University of Minas Gerais 1,722.230. Adolescents and their guardians signed a consent form to participate in the study.The sample was non-probabilistic and based on convenience. Adolescents from two public secondary elementary schools in Belo Horizonte were invited to participate in the study and 110 adolescents showed interested in being part of the study sample. Those whose parents reported typical development in the anamnesis questionnaire were selected. The exclusion criterion adopted were any presence or evidence of neurological, psychiatric, cognitive and learning alterations, when reported during the filling out of the anamnesis questionnaire, incorrect hearing and visual alterations and the non-completion of the test. After analyzing the anamnesis questionnaires, four adolescents were excluded because of diagnoses of developmental disorders as reported by their parents. The initial sample consisted of 106 adolescents with typical development. During the research, 23 adolescents dropped out of the study and did not complete the assessments, therefore the final sample consisted of 83 adolescents of both sexes enrolled in schools normally from sixth to ninth grades. Normal students in elementary schools were selected and the sample age ranged from 11 to 16 years of age.Anamnesis questionnaire - prepared by the researchers with questions related to the adolescent's health history and development.,14: The test consists of syllabic and phonemic manipulation tasks. Studies show that linguistic and academic experiences present when entering school favor acquisitions at the syllabic level of phonological awareness, enabling good performance at this level in early school years, making it internalized in elementary school. Furthermore as phonemic awareness is more closely related to reading, it was decided to use only phonemic manipulation tasks, namely: segmentation, subtraction and inversion. Test stimuli were recorded to avoid interference.Phonological awareness test of the Battery for the Assessment of Written Language and its Disorders \u2013 BALESC: boards with visual stimuli letters and objects randomly arranged in ten columns and five lines were used.RAN automatic naming speed test \u2013 rapid automatized naming.: to assess attention, inverse counting and digit repetition tests were carried out. Memory was assessed using digit and word span tests, recognition, immediate and delayed recall, long-term semantic memory, short-term visual memory, and prospective memory. To assess oral language, naming, repetition, comprehension, inference processing and automatic language tasks were performed. Executive functions were assessed by solving oral problems and verbal fluency. According to the correction proposed by the authors of the instrument, the results of working memory, episodic-semantic verbal memory, attention and oral language were also presented in a qualitative way, classified as adequate or inadequate according to the standards referred to by the test.Brief Neuropsychological Assessment Instrument \u2013 NEUPSILIN was used, consisting of a text and ten literal and inferential questions. The instrument was designed to assess adolescents in secondary elementary school. The construction of the instrument involved several steps, including selection and analysis by expert judges and computational analysis, so that it met the criteria for linguistic assessment of adolescents.Textual reading fluency and comprehension test: The instrument proposed by Gentilini et al.Participants were evaluated in a quiet room at the school, in 30 minute sessions a day, with an average total of two hours. Firstly, the anamnesis questionnaire was sent to the parents, together with the terms of authorization to be able to participate in the study, which was later collected to assist in the selection of adolescents according to the inclusion and exclusion criteria.Afterwards the selected adolescents were submitted for testing as described above, following the rules as defined by previous research and published manuals. Only the reading assessment was applied collectively.The data was entered into an Excel\u00ae spreadsheet. In the descriptive analysis of qualitative variables, absolute and relative frequencies were used, while in the description of quantitative variables measures of position, central tendency and dispersion were used.To verify the effect of cognitive and linguistic variables on phonological processing, linear regression with robust standard errors was used for the covariance matrix of the estimated coefficients and the robust estimator HC (heteroskedasticity and consistent autocorrelation) was used to estimate the covariance matrix.For selection of variables, the Stepwise method (Forward and Backward) was used. Thus, using the Forward method, a univariate analysis was performed, which consisted of adjusting a linear regression with robust standard errors, for each of the variables separately. Variables with p-value less than 0.25 were selected for multivariate analysis. In the multivariate analysis, a model with all selected variables was adjusted, then the presence of multicollinearity between them was verified. For this purpose, the VIF (Variance Inflation Factor) statistic was used, and the variables with a VIF value greater than five were removed from the model. Then, the Backward method was carried out, a procedure used to remove in turn, the variable with the highest p-value which was repeated until only the significant variables remained in the model. For the Backward method, a significance level of 5% was adopted. Version 3.4.3 of the R software was used in the analyses.The variables reading fluency, text comprehension, episodic-semantic verbal memory attention, executive functions and oral language tasks were considered explanatory for the response variables: naming time in objects and letters, working memory and phonological awareness, which were also explanatory of the others in the regression analysis models.The measures of central tendency and dispersion of clinical variables were presented in Regarding the classification of the participants' performance in neuropsychological assessment tasks, it was found that 82.7% (n = 62) had adequate performance in working memory, 87.8% (n = 65) in attention, 65, 3% (n = 49) in episodic-semantic verbal memory and 85.3% (n = 64) in oral language tasks. Oral language was assessed through the tasks of naming, repetition, comprehension and processing of inferences and automatic language. The term \u201cappropriate oral language\u201d was used when the overall score was within the normal range determined by the test.The final multivariate regression model  showed tThe final multivariate regression model  showed tRegarding the final multivariate regression model for the classification of working memory performance , it was The results of the univariate and multivariate regression analysis for phonological awareness are shown in The final multivariate regression model showed that a one-second increase in time in letter naming reduces -0.37 points in the phonological awareness score; however for each unit that increases in the score of executive functions and attention, an increase in phonological awareness performance on average occurs of 0.87 and 0.37 respectively. show the importance of phonological processing in the initial learning of reading and writing in children. However, there are still gaps in knowledge about the performance of older people  in phonological processing and the factors that interfere with such performance. Thus, this study sought to characterize the phonological processing skills in adolescents and point out which cognitive and linguistic factors influence the development of these skills.Studies. No ceiling effect was found, as occurred in the present study, which suggests that the cognitive performance of adolescents is on its way to the peak of it's development.Regarding cognitive performance, the adolescents selected did not present linguistic or cognitive impairment, therefore they were considered typically developed adolescents. Their expected performance was adequate, as observed in the majority of the samples. In this study, adolescents showed a performance similar to that of young adults with a higher level of education in a previous survey. According to other studies, knowledge of letters and digits is quickly automated, which makes naming agile and reduces the time. As for the naming of colors and objects, studies show that concepts and semantic information are accessed prior to naming, in addition to stimuli having greater articulation extension and complexity, which increases the time taken to complete the test.Descriptive data for rapid naming showed that the shortest naming time was in letters and the longest naming time in objects, corroborating the data found in previous studies. It is known that an increase in age and school year expands working memory capacities, enabling the handling of a greater amount of information simultaneously,9.Regarding the performance of working memory, most participants, revealed typical development and being in the age group in which the expansion of working memory is found, presented adequate performance, according to the scores proposed in the NEUPSILIN test. In the phonemic segmentation test and a lower average of correct answers was found. The study did not carry out the phonemic inversion task.The adolescents' performance in phonological awareness was better in the consonant-vowel-consonant (CVC) subtraction task, followed by the consonant-consonant-vowel (CCV) inversion and subtraction tasks. In the phonemic segmentation task, they had the lowest average of correct answers, showing that this was the one with the highest degree of difficulty for the evaluated sample. Another study which evaluated elementary school students from 1st to 5th grades with phonemic segmentation and subtraction tasks, found better performance in the CVC and CCV subtraction tests, in which three studies with adolescents and adults were analyzed, there was a low number of correct answers in the segmentation task, even for people proficient in reading. According to the study in question, after reading development, there may be less need to analyze a word from its phonological structure, so there would be a decline in such ability due to disuse. The second hypothesis presented suggested that when acquiring reading proficiency people acquire other strategies, such as word analysis at the orthographic level. Finally, the study indicated that explicit training is necessary for the development of phonemic awareness. Naturally a person's attention is directed to larger sound structures, such as rhyme and alliteration, the perception of phonemes is developed with training. Therefore, individuals with little stimulation would have a lower level of phonemic awareness and this would not be a condition that would prevent the achievement of high levels of reading ability.In another study. There was no ceiling effect among adolescents, which suggests that this audience is in a phase of phonemic awareness improvement and that the difficulty in handling isolated phonemes persisted in the studied sample.It is also important to emphasize that phonemes are abstract units devoid of meaning. During phonemic segmentation an adolescent manipulates phonemes without the support of the acoustic information of the word and directs attention to its structural form, not its meaning. This increases the degree of difficulty of the task, justifying the low performance of adolescentsThe results of the linear regression analysis showed that phonological processing was influenced by linguistic skills and cognitive functions, in addition to mutual interference between phonological processing skills. It was found that working memory, time for naming letters and objects, phonological awareness and executive functions were more significant in explaining the adolescents' performance in phonological processing.Rapid object naming was influenced more by working memory and letter naming. The time for naming letters was influenced more by performance in phonological awareness and time for naming objects. Adolescents' performance in working memory and phonological awareness was better explained by executive functions.. All these processes work in harmony to provide agility and accuracy in all naming tasks, which suggests the influence of the performance of one naming task over another. In the sample the association between the times of naming objects and letters was found. People who require more time in naming non-alphanumeric stimuli tend to spend more time in naming alphanumeric stimuli, and the inverse relationship is also present.The rapid naming of visual stimuli demands the involvement of various attentional memory processes, perceptual, conceptual, lexical and articulatory processes. In addition to these facts, despite the fact that both activities are automatic, there is also the fact that the characteristic of naming letters is an automated process first in relation to naming objects. The naming of objects required more of the working memory resources so that the stimuli were retrieved and kept in an accessible form in memory while they were named, which was not significant in the naming of letters, which required less effort and performance of the mnemonic process,23.Object naming time was also influenced by working memory. So as the working memory score increases, the object naming time decreases. Due to the characteristics of the stimuli present in the RAN test, it was found that object naming has a semantic basis and greater phonological extension and complexity than letter naming, which has a phonological basis and less articulatory extension and complexity, the increase in the execution time of the naming test may reflect damage to mnemonic resources. There was a mutual influence between fast object naming and working memory.Conversely as the time taken to perform the naming task increases there is a tendency to reduce the working memory score, increasing the chances of performance being classified as inadequate for some adolescents. As the naming of objects requires working memory resources.Another relevant process for rapid naming was phonological awareness. It was found that the better the performance of adolescents in phonological awareness the better their agility in naming letters. In such a task, phonological manipulation is required throughout the test, so the handling of phonological representations with ease proved to be important to aid greater naming speedAccording to the results of the study, adolescents who performed the naming tasks in a shorter time showed better performance in other tasks. It is worth noting that their agility in performing tasks is a relevant factor for their cognitive and linguistic performance., were also significant in explaining the adolescents' performance in phonological awareness and working memory, contributing to elevated scores in such skills.The executive functions, responsible for regulating the information and behavior process, executive functions are relevant during phonemic manipulation tasks. The great importance of this ability is even more evident in studies of individuals with ADHD. According to the researchers, such individuals present alterations in language as a result of deficits in executive functions, leading to impairment in phonological processing. The authors saw that students with ADHD performed poorly in phonological awareness and working memory when compared to normal students. Therefore, the data from this study corroborates existing studies by demonstrating that executive functions are relevant for the execution of the phonological awareness task.Due to control of their actions. Good performance of executive functions is correlated positively with working memory. The results showed that among adolescents with good performance in executive function, there is a tendency to reduce the chances of being classified as having inadequate performance in working memory.Concerning the association of executive functions with working memory, this study used verbal fluency and problem solving tasks to assess executive functions. These tasks require the invocation and manipulation of information to be completed, and when relating words quickly or solving problems easily, there is less overload on the mnemonic system.Another cognitive function that influenced the performance of phonological processing was attention, which is necessary to focus on the relevant stimulus and inhibit distractors. Thus, the storage capacity depends on maintaining the focus on the necessary stimulus, which suggests a relationship between attention and memory. Among the adolescents evaluated in this study, attention was revealed as one of the determining factors for the performance of working memory.In agreement with this hypothesis, in another study researchers found that in the presence of altered attention, memory is also compromisedSeveral studies have investigated phonological processing in children; however there is a need to expand this research with adolescents in order to deepen our knowledge about these skills in this target audience and the variables that influence them, in order to collaborate with clinical practice and the selection and development of assessment instruments suitable for adolescents.The way in which this research sample was selected constituted a limitation for the generalization of the data. Although the sample is small, the data from this study may be reproduced in a larger sample, due to the low values of \u03b2 and standard error obtained in the analyses. It is suggested to continue studies with adolescents in order to further investigate those already carried out.This study showed that the clinicians should be aware of linguistic skills and cognitive functions that influence phonological processing, as they can impact the therapeutic processes.We concluded that for adolescents evaluated the automatic naming of letters was performed in a shorter time compared to the automatic naming of objects, and that there was a lower average of correct answers in the phonemic segmentation task. The phonological processing skills were related to each other. Executive functions and attention were more significant in explaining information sound processing skills, compared to reading and episodic-semantic verbal memory, which were less relevant. .O desenvolvimento da linguagem escrita \u00e9 influenciado, dentre outros fatores, pela capacidade de processar a l\u00edngua de forma autom\u00e1tica, a partir de suas informa\u00e7\u00f5es sonoras, denominada \u201cprocessamento fonol\u00f3gico\u201d ,3,4 para o sucesso da escrita e da leitura, tanto no n\u00edvel da decodifica\u00e7\u00e3o quanto da compreens\u00e3o.Diversos estudos apontam que as habilidades do processamento fonol\u00f3gico  s\u00e3o preditoras do desenvolvimento da linguagem escrita, devido \u00e0 relev\u00e2ncia para a capacidade de processar, reter e resgatar a informa\u00e7\u00e3o, em raz\u00e3o do aumento da idade, do vocabul\u00e1rio e das capacidades cognitivas, pois as informa\u00e7\u00f5es s\u00e3o acessadas com maior velocidade e precis\u00e3o e menor perda de dados ,9, consequentemente mais recursos cognitivos e atencionais estar\u00e3o dispon\u00edveis para a leitura, aspecto importante para a compreens\u00e3o de leitura,11.Espera-se que o desempenho no processamento fonol\u00f3gico se amplie na adolesc\u00eancia. \u00c9 importante na aquisi\u00e7\u00e3o inicial da leitura e na decodifica\u00e7\u00e3o de palavras regulares desconhecidas, na medida em que permite estabelecer a rela\u00e7\u00e3o entre fonema e grafema.De acordo com a literatura, a consci\u00eancia fonol\u00f3gica possibilita que o indiv\u00edduo perceba e manipule, de forma consciente, as informa\u00e7\u00f5es sonoras das palavras em v\u00e1rios n\u00edveis: intrassil\u00e1bico, sil\u00e1bico e fon\u00eamico.J\u00e1 a mem\u00f3ria operacional \u00e9 respons\u00e1vel por recuperar os dados ortogr\u00e1ficos e fonol\u00f3gicos no l\u00e9xico mental, enquanto \u00e9 realizada a associa\u00e7\u00e3o grafofon\u00eamica. Participa do aprendizado de palavras novas, da an\u00e1lise sint\u00e1tica e da compreens\u00e3o leitora e de linguagem. Quando as informa\u00e7\u00f5es s\u00e3o acessadas de forma r\u00e1pida e precisa no l\u00e9xico mental, mais recursos cognitivos e atencionais estar\u00e3o dispon\u00edveis para a leitura.A capacidade de nomea\u00e7\u00e3o r\u00e1pida permite o acesso r\u00e1pido \u00e0s informa\u00e7\u00f5es, aspecto importante para a flu\u00eancia de leitura, por meio do envolvimento de diversos recursos cognitivos,12. Assim a apropria\u00e7\u00e3o e o aumento na profici\u00eancia da leitura e da escrita tamb\u00e9m impulsionam e podem explicar o desenvolvimento do processamento fonol\u00f3gico para n\u00edveis mais elevados,12. No entanto, ainda s\u00e3o escassos os estudos que investigam o desempenho de adolescentes no processamento fonol\u00f3gico como vari\u00e1vel resposta e explicado pelas habilidades lingu\u00edstico-cognitivas.Os estudos que investigam a intera\u00e7\u00e3o das habilidades lingu\u00edsticas e cognitivas com o processamento fonol\u00f3gico mostram a rela\u00e7\u00e3o de reciprocidadeAssim, este estudo teve por objetivo caracterizar o processamento fonol\u00f3gico em adolescentes e identificar habilidades lingu\u00edsticas e fun\u00e7\u00f5es cognitivas que o influenciam nessa faixa et\u00e1ria.Este estudo, com delineamento transversal observacional anal\u00edtico, foi aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa da Universidade Federal de Minas Gerais sob o Parecer n\u00ba 1.722.230. Os adolescentes e seus respons\u00e1veis assinaram os termos de autoriza\u00e7\u00e3o para participar do estudo.A amostra foi n\u00e3o probabil\u00edstica, de conveni\u00eancia. Os adolescentes do Ensino Fundamental II de duas escolas p\u00fablicas de Belo Horizonte foram convidados para participar do estudo, sendo que 110 adolescentes apresentaram interesse em compor a amostra do estudo. Foram selecionados aqueles cujos pais relataram, no question\u00e1rio de anamnese, desenvolvimento t\u00edpico. Como crit\u00e9rio de exclus\u00e3o adotou-se a presen\u00e7a de altera\u00e7\u00f5es neurol\u00f3gicas, psiqui\u00e1tricas, cognitivas e de aprendizagem evidentes, relatadas durante a aplica\u00e7\u00e3o do question\u00e1rio de anamnese, altera\u00e7\u00f5es auditivas e visuais n\u00e3o corrigidas e a n\u00e3o conclus\u00e3o da testagem. Ap\u00f3s a an\u00e1lise dos question\u00e1rios de anamnese, foram exclu\u00eddos quatro adolescentes por apresentarem diagn\u00f3sticos dos transtornos do desenvolvimento referidos pelos pais. Assim, a amostra inicial foi composta por 106 adolescentes com desenvolvimento t\u00edpico. Ao longo da pesquisa, 23 adolescentes abandonaram o estudo e n\u00e3o conclu\u00edram as avalia\u00e7\u00f5es. Portanto, a amostra final foi composta por 83 adolescentes de ambos os sexos, regularmente matriculados do sexto ao nono ano. Como foram selecionados os adolescentes regulares nos anos escolares do Ensino Fundamental II, a faixa et\u00e1ria da amostra se situou de 11 a 16 anos.Question\u00e1rio de anamnese - elaborado pelas pesquisadoras com quest\u00f5es referentes ao hist\u00f3rico de sa\u00fade e do desenvolvimento do adolescente.,14: o teste \u00e9 composto por tarefas de manipula\u00e7\u00e3o sil\u00e1bica e fon\u00eamica. A literatura evidencia que as experi\u00eancias lingu\u00edsticas e acad\u00eamicas presentes ao ingressar na escola favorecem as aquisi\u00e7\u00f5es no n\u00edvel sil\u00e1bico da consci\u00eancia fonol\u00f3gica, possibilitando, nos anos escolares iniciais, bom desempenho em tal n\u00edvel, tornando-o internalizado no ensino fundamental. Al\u00e9m disso, como a consci\u00eancia fon\u00eamica apresenta maior rela\u00e7\u00e3o com a leitura, optou-se por utilizar somente as tarefas de manipula\u00e7\u00e3o fon\u00eamica, sendo elas: segmenta\u00e7\u00e3o, subtra\u00e7\u00e3o e invers\u00e3o. Os est\u00edmulos do teste foram gravados para evitar interfer\u00eancias.Teste de consci\u00eancia fonol\u00f3gica da Bateria de Avalia\u00e7\u00e3o da Linguagem Escrita e seus Dist\u00farbios \u2013 BALESCrapid automatized naming: foram utilizadas as pranchas com os est\u00edmulos visuais letras e objetos dispostos de forma aleat\u00f3ria em dez colunas e cinco linhas.Prova de velocidade de nomea\u00e7\u00e3o autom\u00e1tica RAN \u2013 : para avaliar aten\u00e7\u00e3o foram aplicadas as provas de contagem inversa e de repeti\u00e7\u00e3o de d\u00edgitos. A mem\u00f3ria foi avaliada por meio de provas de span de d\u00edgitos e de palavras, reconhecimento, evoca\u00e7\u00e3o imediata e tardia, mem\u00f3ria sem\u00e2ntica de longo prazo, mem\u00f3ria visual de curto prazo e mem\u00f3ria prospectiva. Para avaliar a linguagem oral, foram realizadas as tarefas de nomea\u00e7\u00e3o, repeti\u00e7\u00e3o, compreens\u00e3o, processamento de infer\u00eancias e de linguagem autom\u00e1tica. As fun\u00e7\u00f5es executivas foram avaliadas por meio da resolu\u00e7\u00e3o de problemas orais e de flu\u00eancia verbal. Conforme a corre\u00e7\u00e3o proposta pelos autores do instrumento, o resultado da mem\u00f3ria operacional, da mem\u00f3ria verbal epis\u00f3dica-sem\u00e2ntica, da aten\u00e7\u00e3o e da linguagem oral foram apresentados tamb\u00e9m de forma qualitativa, classificados como adequado ou inadequado segundo os padr\u00f5es referidos pelo teste.Instrumento de Avalia\u00e7\u00e3o Neuropsicol\u00f3gica Breve \u2013 NEUPSILIN, composto por um texto e dez quest\u00f5es literais e inferenciais. O instrumento foi elaborado para avaliar adolescentes do ensino fundamental II. A constru\u00e7\u00e3o do instrumento envolveu diversas etapas, dentre elas, a sele\u00e7\u00e3o e an\u00e1lise por ju\u00edzes especialistas e an\u00e1lise computacional, de forma que cumprisse os crit\u00e9rios para a avalia\u00e7\u00e3o lingu\u00edstica de adolescentes.Teste de flu\u00eancia e compreens\u00e3o de leitura textual: Foi utilizado o instrumento proposto por Gentilini et al.Os participantes foram avaliados em uma sala silenciosa, na pr\u00f3pria escola, em sess\u00f5es de 30 minutos por dia, com tempo m\u00e9dio total de duas horas. No primeiro momento foi enviado, aos pais, juntamente com os termos de autoriza\u00e7\u00e3o para participar do estudo, o question\u00e1rio de anamnese e recolhido posteriormente, para auxiliar na sele\u00e7\u00e3o dos adolescentes de acordo com crit\u00e9rios de inclus\u00e3o e exclus\u00e3o.Posteriormente, os adolescentes selecionados foram submetidos aos testes de descritos anteriormente, seguindo as normas de aplica\u00e7\u00f5es orientadas por seus autores nas pesquisas e manuais publicados. Somente a avalia\u00e7\u00e3o de leitura foi aplicada em coletivo.Os dados foram inseridos em planilha no Excel\u00ae. Na an\u00e1lise descritiva das vari\u00e1veis qualitativas, foram utilizadas as frequ\u00eancias absoluta e relativa, enquanto na descri\u00e7\u00e3o das vari\u00e1veis quantitativas foram utilizadas medidas de posi\u00e7\u00e3o, tend\u00eancia central e dispers\u00e3o.heteroskedasticity and autocorrelacion consistent) na estimativa da matriz de covari\u00e2ncia.Para verificar o efeito das vari\u00e1veis cognitivas e lingu\u00edsticas sobre o processamento fonol\u00f3gico, utilizou-se uma regress\u00e3o linear com erros padr\u00f5es robustos para a matriz de covari\u00e2ncia dos coeficientes estimados e o estimador robusto HC (Stepwise (Forward e Backward). Dessa forma, usando o m\u00e9todo Forward, foi feita uma an\u00e1lise univariada, que consistiu no ajuste de uma regress\u00e3o linear com erros padr\u00f5es robustos, para cada uma das vari\u00e1veis separadamente. As vari\u00e1veis com valor-p inferior a 0,25 foram selecionadas para a an\u00e1lise multivariada. Na an\u00e1lise multivariada, foi ajustado um modelo com todas as vari\u00e1veis selecionadas. Em seguida, verificou-se a presen\u00e7a de multicolinearidade entre elas. Para tanto, foi utilizada a estat\u00edstica VIF (Variance Inflation Factor), sendo que as vari\u00e1veis com VIF superior a cinco foram retiradas do modelo. Em seguida, foi aplicado o m\u00e9todo Backward, procedimento usado de retirar, por vez, a vari\u00e1vel de maior valor-p, o qual foi repetido at\u00e9 que restassem no modelo somente as vari\u00e1veis significativas. Para o m\u00e9todo Backward, foi adotado o n\u00edvel de signific\u00e2ncia de 5%. Foi utilizado o software R (vers\u00e3o 3.4.3) nas an\u00e1lises.Para a sele\u00e7\u00e3o de vari\u00e1veis, foi utilizado o m\u00e9todo As vari\u00e1veis flu\u00eancia leitora, compreens\u00e3o textual, aten\u00e7\u00e3o, mem\u00f3ria verbal epis\u00f3dico-sem\u00e2ntica, fun\u00e7\u00f5es executivas e tarefas de linguagem oral foram consideradas explicativas para as vari\u00e1veis respostas: tempo de nomea\u00e7\u00e3o em objetos e letras, mem\u00f3ria operacional e consci\u00eancia fonol\u00f3gica, que tamb\u00e9m foram explicativas umas das outras nos modelos da an\u00e1lise de regress\u00e3o.As medidas de tend\u00eancia central e de dispers\u00e3o das vari\u00e1veis cl\u00ednicas foram apresentadas nas n = 62) apresentaram desempenho adequado em mem\u00f3ria operacional, 87,8% (n = 65) em aten\u00e7\u00e3o, 65,3% (n = 49) em mem\u00f3ria verbal epis\u00f3dico-sem\u00e2ntica e 85,3% (n = 64) nas tarefas de linguagem oral. A linguagem oral foi avaliada por meio das tarefas de nomea\u00e7\u00e3o, repeti\u00e7\u00e3o, compreens\u00e3o e processamento de infer\u00eancias e de linguagem autom\u00e1tica. Assim, o termo \u201clinguagem oral adequada\u201d foi utilizado quando o escore geral estava dentro da faixa de normalidade determinada pelo teste.No que se refere \u00e0 classifica\u00e7\u00e3o do desempenho dos participantes nas tarefas da avalia\u00e7\u00e3o neuropsicol\u00f3gica, verificou-se que 82,7% . Dessa forma, foi necess\u00e1rio retirar a vari\u00e1vel compreens\u00e3o textual do modelo final.O modelo final da regress\u00e3o multivariada  apontou Em rela\u00e7\u00e3o ao modelo final de regress\u00e3o multivariada para a classifica\u00e7\u00e3o do desempenho na mem\u00f3ria operacional , observaOs resultados da an\u00e1lise de regress\u00e3o uni e multivariada para consci\u00eancia fonol\u00f3gica s\u00e3o apresentados na O modelo final da regress\u00e3o multivariada apontou que o aumento de um segundo no tempo na nomea\u00e7\u00e3o de letras reduz -0,37 pontos no escore de consci\u00eancia fonol\u00f3gica. No entanto, a cada uma unidade que aumenta no escore de fun\u00e7\u00f5es executivas e aten\u00e7\u00e3o ocorre em m\u00e9dia um acr\u00e9scimo de 0,87 e 0,37, respectivamente, no desempenho em consci\u00eancia fonol\u00f3gica. apresenta a import\u00e2ncia do processamento fonol\u00f3gico no aprendizado inicial da leitura e da escrita em crian\u00e7as. Por\u00e9m, ainda h\u00e1 lacunas no conhecimento sobre o desempenho de indiv\u00edduos mais velhos  no processamento fonol\u00f3gico e os fatores que interferem em tal desempenho. Assim, buscou-se neste estudo caracterizar as habilidades do processamento fonol\u00f3gico em adolescentes e apontar quais fatores cognitivos e lingu\u00edsticos influenciam o desenvolvimento dessas habilidades.A literatura. No entanto, n\u00e3o foi observado efeito de teto, como ocorreu no estudo em quest\u00e3o, o que sugere que o desempenho cognitivo dos adolescentes est\u00e1 a caminho do \u00e1pice do desenvolvimento.Em rela\u00e7\u00e3o ao desempenho cognitivo, os adolescentes selecionados n\u00e3o apresentavam queixas de altera\u00e7\u00f5es de linguagem ou cognitiva, portanto, eram considerados adolescentes com desenvolvimento t\u00edpico. Assim, esperava-se que o desempenho fosse adequado, como foi observado na maioria da amostra. Neste estudo, os adolescentes apresentaram desempenho semelhante ao dos adultos jovens com maior grau de escolaridade de pesquisa anterior. Segundo a literatura, o conhecimento de letras e d\u00edgitos \u00e9 automatizado rapidamente, o que confere agilidade na nomea\u00e7\u00e3o e na redu\u00e7\u00e3o do tempo gasto. Quanto \u00e0 nomea\u00e7\u00e3o de cores e objetos, os estudos mostram que os conceitos e as informa\u00e7\u00f5es sem\u00e2nticas s\u00e3o acessados anteriormente \u00e0 nomea\u00e7\u00e3o, al\u00e9m dos est\u00edmulos possu\u00edrem maior extens\u00e3o e complexidade articulat\u00f3ria, o que eleva o tempo gasto para concluir a prova.Os dados descritivos da nomea\u00e7\u00e3o r\u00e1pida mostraram que o menor tempo de nomea\u00e7\u00e3o foi em letras e o maior tempo de nomea\u00e7\u00e3o em objetos e corroborou os dados descritos em estudos anteriores. Sabe-se que o aumento da idade e do ano escolar amplia as capacidades da mem\u00f3ria operacional possibilitando a manipula\u00e7\u00e3o de maior quantidade de informa\u00e7\u00f5es simultaneamente,9.Em rela\u00e7\u00e3o ao desempenho em mem\u00f3ria operacional, a maioria dos participantes, por revelarem desenvolvimento t\u00edpico e estarem na faixa et\u00e1ria em que se observa a amplia\u00e7\u00e3o da mem\u00f3ria operacional, apresentaram desempenho adequado, de acordo com os escores propostos no teste NEUPSILIN. Na prova de segmenta\u00e7\u00e3o fon\u00eamica, encontrou-se menor m\u00e9dia de acertos. No estudo, n\u00e3o foi realizada a tarefa de invers\u00e3o fon\u00eamica.O desempenho dos adolescentes em consci\u00eancia fonol\u00f3gica foi melhor na tarefa de subtra\u00e7\u00e3o consoante-vogal-consoante (CVC), seguindo-se as tarefas de invers\u00e3o e subtra\u00e7\u00e3o consoante-consoante-vogal (CCV). Na tarefa de segmenta\u00e7\u00e3o fon\u00eamica, eles apresentaram a menor m\u00e9dia de acertos, demonstrando ser esta a de maior grau de dificuldade para a amostra avaliada. Em uma pesquisa, ao avaliar alunos do ensino fundamental, do 1\u00ba ao 5\u00ba ano com tarefas de segmenta\u00e7\u00e3o e subtra\u00e7\u00e3o fon\u00eamica, constatou melhor desempenho nas provas de subtra\u00e7\u00e3o CVC e CCV, em que foram analisadas tr\u00eas pesquisas com adolescentes e adultos, foi verificado n\u00famero baixo de acertos na tarefa de segmenta\u00e7\u00e3o, mesmo para indiv\u00edduos proficientes na leitura. De acordo com o estudo em quest\u00e3o, ap\u00f3s o desenvolvimento da leitura pode haver menor necessidade de analisar a palavra a partir da sua estrutura fonol\u00f3gica, assim ocorreria o decl\u00ednio em tal habilidade por desuso. A segunda hip\u00f3tese apresentada sugere que ao adquirir a profici\u00eancia na leitura, o indiv\u00edduo adquire outras estrat\u00e9gias, como a an\u00e1lise da palavra no n\u00edvel ortogr\u00e1fico. Por fim, o estudo indica que \u00e9 necess\u00e1rio o treinamento expl\u00edcito para o desenvolvimento da consci\u00eancia fon\u00eamica. Naturalmente a aten\u00e7\u00e3o do indiv\u00edduo \u00e9 direcionada para estruturas sonoras maiores, como a rima e a alitera\u00e7\u00e3o, a percep\u00e7\u00e3o de fonemas \u00e9 desenvolvida com treinamento. Portanto, indiv\u00edduos pouco estimulados apresentariam menor n\u00edvel de consci\u00eancia fon\u00eamica e essa n\u00e3o seria uma condi\u00e7\u00e3o que impediria o alcance de n\u00edveis elevados de leitura.Em outro estudo. N\u00e3o se observou efeito de teto entre os adolescentes, o que sugere que esse p\u00fablico est\u00e1 em fase de aprimoramento da consci\u00eancia fon\u00eamica e que a dificuldade na manipula\u00e7\u00e3o de fonemas isolados persistia na amostra estudada.\u00c9 importante destacar, tamb\u00e9m, que os fonemas s\u00e3o unidades abstratas destitu\u00eddas de significado. Durante a segmenta\u00e7\u00e3o fon\u00eamica, o adolescente manipula os fonemas sem o apoio da informa\u00e7\u00e3o ac\u00fastica da palavra e direciona a aten\u00e7\u00e3o para a sua forma estrutural, e n\u00e3o para o significado. Isso eleva o grau de dificuldade da tarefa, justificando o baixo desempenho dos adolescentesOs resultados da an\u00e1lise de regress\u00e3o linear apontaram que o processamento fonol\u00f3gico foi influenciado por habilidades lingu\u00edsticas e fun\u00e7\u00f5es cognitivas, al\u00e9m de haver interfer\u00eancia m\u00fatua entre as habilidades do processamento fonol\u00f3gico. Constatou-se que a mem\u00f3ria operacional, o tempo de nomea\u00e7\u00e3o de letras e objetos, a consci\u00eancia fonol\u00f3gica e as fun\u00e7\u00f5es executivas foram mais significativas para explicar o desempenho dos adolescentes no processamento fonol\u00f3gico.Assim, a nomea\u00e7\u00e3o r\u00e1pida de objetos foi mais influenciada pela mem\u00f3ria operacional e a nomea\u00e7\u00e3o de letras. J\u00e1 o tempo de nomea\u00e7\u00e3o de letras foi mais influenciado pelo desempenho em consci\u00eancia fonol\u00f3gica e tempo de nomea\u00e7\u00e3o de objetos. O desempenho dos adolescentes na mem\u00f3ria operacional e na consci\u00eancia fonol\u00f3gica foi mais bem explicado pelas fun\u00e7\u00f5es executivas.. Todos esses processos funcionam de forma harm\u00f4nica para conferir agilidade e precis\u00e3o em todas as tarefas de nomea\u00e7\u00e3o, o que sugere a influ\u00eancia do desempenho de uma tarefa de nomea\u00e7\u00e3o sobre a outra. Observou-se, na amostra a associa\u00e7\u00e3o entre os tempos de nomea\u00e7\u00e3o de objetos e letras. Assim, indiv\u00edduos que demandam maior tempo na nomea\u00e7\u00e3o de est\u00edmulos n\u00e3o alfanum\u00e9ricos tendem a apresentar maior tempo na nomea\u00e7\u00e3o de est\u00edmulos alfanum\u00e9ricos, sendo que a rela\u00e7\u00e3o inversa tamb\u00e9m est\u00e1 presente.A nomea\u00e7\u00e3o r\u00e1pida de est\u00edmulos visuais demanda o envolvimento de diversos processos atencionais, de mem\u00f3ria, perceptuais, conceituais, lexicais e articulat\u00f3rios. Al\u00e9m desses fatos, apesar de ambas as atividades serem autom\u00e1ticas, soma-se o de a caracter\u00edstica da nomea\u00e7\u00e3o de letras ser um processo automatizado primeiro em rela\u00e7\u00e3o \u00e0 nomea\u00e7\u00e3o de objetos. Assim, a nomea\u00e7\u00e3o de objetos exigiu mais dos recursos da mem\u00f3ria operacional para que os est\u00edmulos fossem resgatados e mantidos de forma acess\u00edvel na mem\u00f3ria enquanto eram nomeados, o que n\u00e3o se observou de forma significativa na nomea\u00e7\u00e3o de letras, que demandou menos esfor\u00e7os e atua\u00e7\u00e3o do processo mnem\u00f4nico,23.O tempo de nomea\u00e7\u00e3o de objetos tamb\u00e9m foi influenciado pela mem\u00f3ria operacional. Ent\u00e3o, \u00e0 medida que aumenta o escore da mem\u00f3ria operacional, o tempo de nomea\u00e7\u00e3o de objetos reduz. Devido \u00e0s caracter\u00edsticas dos est\u00edmulos presentes no teste RAN, apurou-se que a nomea\u00e7\u00e3o de objetos apresenta uma base sem\u00e2ntica e maior extens\u00e3o e complexidade fonol\u00f3gica do que a nomea\u00e7\u00e3o de letras, que apresenta base fonol\u00f3gica e menor extens\u00e3o e complexidade articulat\u00f3ria, o aumento no tempo de execu\u00e7\u00e3o da prova de nomea\u00e7\u00e3o pode ser reflexo de preju\u00edzos nos recursos mnem\u00f4nicos. Assim, verificou-se influ\u00eancia m\u00fatua entre nomea\u00e7\u00e3o r\u00e1pida de objetos e mem\u00f3ria operacional.De forma inversa, \u00e0 medida que aumenta o tempo de realiza\u00e7\u00e3o da tarefa de nomea\u00e7\u00e3o, tende-se a reduzir o escore de mem\u00f3ria operacional, aumentando as chances de o desempenho ser classificado como inadequado para alguns adolescentes. Como a nomea\u00e7\u00e3o de objetos necessita de recursos da mem\u00f3ria operacional.Outro processo relevante para a nomea\u00e7\u00e3o r\u00e1pida foi a consci\u00eancia fonol\u00f3gica. Observou-se nos adolescentes avaliados que, o melhor desempenho dos adolescentes em consci\u00eancia fonol\u00f3gica, contribuiu para a agilidade na nomea\u00e7\u00e3o de letras. Em tal tarefa a manipula\u00e7\u00e3o fonol\u00f3gica \u00e9 exigida durante toda a prova, por isso o manejo das representa\u00e7\u00f5es fonol\u00f3gicas com facilidade mostrou-se importante para conferir maior velocidade na nomea\u00e7\u00e3oDe acordo com os resultados do presente estudo, os adolescentes que executaram as tarefas de nomea\u00e7\u00e3o em menor tempo apresentaram melhor desempenho em outras tarefas. Assim, ressalta-se que a agilidade na execu\u00e7\u00e3o de tarefas \u00e9 um fator relevante para o desempenho cognitivo e lingu\u00edstico do indiv\u00edduo., tamb\u00e9m foram significativas para explicar o desempenho dos adolescentes na consci\u00eancia fonol\u00f3gica e na mem\u00f3ria operacional, contribuindo para elevar os escores de tais habilidades.As fun\u00e7\u00f5es executivas, respons\u00e1veis por regular o processo de informa\u00e7\u00e3o e comportamento, as fun\u00e7\u00f5es executivas mostram-se relevantes durante as tarefas de manipula\u00e7\u00e3o fon\u00eamica. A grande import\u00e2ncia desta habilidade fica ainda mais evidente em estudos com indiv\u00edduos com TDAH. Segundo os pesquisadores, tais indiv\u00edduos apresentam altera\u00e7\u00f5es em linguagem exatamente em decorr\u00eancia do d\u00e9ficit nas fun\u00e7\u00f5es executivas, levando ao preju\u00edzo no processamento fonol\u00f3gico. Os autores observaram que alunos com TDAH apresentam desempenho inferior em consci\u00eancia fonol\u00f3gica e mem\u00f3ria operacional quando comparados com alunos t\u00edpicos. Portanto, os dados do presente estudo corroboram a literatura ao apontar que as fun\u00e7\u00f5es executivas s\u00e3o relevantes para a execu\u00e7\u00e3o da tarefa de consci\u00eancia fonol\u00f3gica.Devido ao fato de controlarem as a\u00e7\u00f5es. Por isso, o bom desempenho das fun\u00e7\u00f5es executivas se correlaciona positivamente com a mem\u00f3ria operacional. Os resultados mostraram que dentre os adolescentes com bom desempenho em fun\u00e7\u00e3o executiva existe a tend\u00eancia de reduzir as chances de serem classificados com desempenho inadequado na mem\u00f3ria operacional.Quanto \u00e0 associa\u00e7\u00e3o das fun\u00e7\u00f5es executivas com a mem\u00f3ria operacional, no presente estudo foram utilizadas as tarefas de flu\u00eancia verbal e de resolu\u00e7\u00e3o de problemas para avaliar a fun\u00e7\u00e3o executiva. Essas tarefas demandam a evoca\u00e7\u00e3o e manipula\u00e7\u00e3o da informa\u00e7\u00e3o para serem conclu\u00eddas e ao relacionar palavras com agilidade ou resolver problemas com facilidade h\u00e1 menor sobrecarga no sistema mnem\u00f4nico.Outra fun\u00e7\u00e3o cognitiva que influenciou o desempenho do processamento fonol\u00f3gico foi a aten\u00e7\u00e3o, que se faz necess\u00e1ria para focar no est\u00edmulo relevante e inibir os distratores. Assim, a capacidade de armazenamento depende da manuten\u00e7\u00e3o do foco no est\u00edmulo necess\u00e1rio, o que sugere uma rela\u00e7\u00e3o entre a aten\u00e7\u00e3o e a mem\u00f3ria. Entre os adolescentes avaliados no presente estudo, a aten\u00e7\u00e3o revelou-se como um dos fatores determinantes para o desempenho da mem\u00f3ria operacionalEm concord\u00e2ncia com essa hip\u00f3tese, em outro estudo os pesquisadores verificaram que na presen\u00e7a de altera\u00e7\u00e3o na aten\u00e7\u00e3o a mem\u00f3ria tamb\u00e9m se apresenta comprometidaV\u00e1rios estudos investigam o processamento fonol\u00f3gico em crian\u00e7as. No entanto, h\u00e1 a necessidade de expandir as pesquisas com adolescentes, a fim de aprofundar os conhecimentos sobre essas habilidades nesse p\u00fablico-alvo e as vari\u00e1reis que as influenciam, de forma a colaborar para a pr\u00e1tica cl\u00ednica e a sele\u00e7\u00e3o e elabora\u00e7\u00e3o de instrumentos de avalia\u00e7\u00e3o adequados para adolescentes.\u03b2 e de erro-padr\u00e3o obtidos nas an\u00e1lises. Sugere-se a continua\u00e7\u00e3o de estudos com adolescentes a fim de aprofundar as investiga\u00e7\u00f5es realizadas.A forma de sele\u00e7\u00e3o da amostra desta pesquisa constituiu uma limita\u00e7\u00e3o para a generaliza\u00e7\u00e3o dos dados. No entanto, apesar da amostra ser pequena pode ocorrer dos dados desse estudo se reproduzirem em uma amostra maior, devido aos baixos valores de Este estudo mostrou que o cl\u00ednico deve estar atento \u00e0s habilidades lingu\u00edsticas e \u00e0s fun\u00e7\u00f5es cognitivas que influenciam o processamento fonol\u00f3gico, visto que podem impactar no processo terap\u00eautico.Pode-se concluir que, para os adolescentes avaliados, a nomea\u00e7\u00e3o autom\u00e1tica de letras foi realizada em menor tempo em rela\u00e7\u00e3o \u00e0 nomea\u00e7\u00e3o autom\u00e1tica de objetos e houve menor m\u00e9dia de acertos na tarefa de segmenta\u00e7\u00e3o fon\u00eamica. As habilidades do processamento fonol\u00f3gico se relacionaram entre si. As fun\u00e7\u00f5es executivas e a aten\u00e7\u00e3o foram mais significativas para explicar as habilidades do processamento sonoro da informa\u00e7\u00e3o, em compara\u00e7\u00e3o \u00e0 leitura e \u00e0 mem\u00f3ria verbal epis\u00f3dico-sem\u00e2ntica que se mostraram menos relevantes."}
+{"text": "Apresentar a experi\u00eancia e os resultados do recadastramento da popula\u00e7\u00e3o residente em Foz do Igua\u00e7u, um munic\u00edpio de fronteira localizado no estado do Paran\u00e1, Brasil, para atender \u00e0s diretrizes da Pol\u00edtica de Aten\u00e7\u00e3o Prim\u00e1ria \u00e0 Sa\u00fade (APS) e ao seu novo modelo de financiamento pelo Programa Previne Brasil.status de posse da moradia, localiza\u00e7\u00e3o urbana ou rural, tipo de domic\u00edlio, material da constru\u00e7\u00e3o, disponibilidade de rede el\u00e9trica e de esgoto, abastecimento de \u00e1gua e destino do lixo) e informa\u00e7\u00f5es demogr\u00e1ficas e de sa\u00fade dos moradores.Utilizando uma estrat\u00e9gia de varredura (amostra de conveni\u00eancia) para coleta de dados, foram visitados 52 263 domic\u00edlios e realizadas 22 710 entrevistas de setembro a novembro de 2019. As entrevistas foram realizadas pessoalmente por 54 agentes comunit\u00e1rios de sa\u00fade. Foram coletados dados sobre o domic\u00edlio (O recadastramento revelou que os domic\u00edlios eram predominantemente casas pr\u00f3prias, em \u00e1rea urbana, bem edificados e servidos por energia el\u00e9trica, rede geral de \u00e1gua e coleta de lixo. Sobre a popula\u00e7\u00e3o recadastrada, 52,8% eram mulheres, 62,5% tinham idade de 15 a 59 anos e 60,0% se autodeclararam brancos. Entre os entrevistados com 15 anos ou mais, 90,0% tinham completado o ensino fundamental. A principal ocupa\u00e7\u00e3o foi \u201cassalariado com carteira de trabalho\u201d. Ainda, 18,6% dos entrevistados se autodeclararam hipertensos e 7,0%, diab\u00e9ticos.O recadastramento trouxe informa\u00e7\u00f5es relevantes para subsidiar o planejamento da APS, assim como iniciativas de assist\u00eancia social, trabalho e habita\u00e7\u00e3o; tamb\u00e9m foi fundamental para definir estrat\u00e9gias de aten\u00e7\u00e3o \u00e0 sa\u00fade nesse munic\u00edpio de fronteira durante a pandemia de COVID-19. Um dos grandes desafios da gest\u00e3o em sa\u00fade nos munic\u00edpios brasileiros \u00e9 a produ\u00e7\u00e3o de conhecimento com vistas a aprimorar processos de trabalho, proporcionar adequada aten\u00e7\u00e3o \u00e0 sa\u00fade para a popula\u00e7\u00e3o e contribuir para que o Sistema \u00danico de Sa\u00fade (SUS) seja equitativo, universal e integral nos \u00e2mbitos local, regional e nacional. O Minist\u00e9rio da Sa\u00fade  ressaltaQuando h\u00e1 necessidade de proposi\u00e7\u00e3o de a\u00e7\u00f5es espec\u00edficas, diante de cen\u00e1rios particularmente complexos, por vezes \u00e9 necess\u00e1rio um maior detalhamento sobre o perfil do usu\u00e1rio do sistema p\u00fablico de sa\u00fade. Esse \u00e9 o caso de Foz do Igua\u00e7u, munic\u00edpio localizado na tr\u00edplice fronteira Brasil, Argentina e Paraguai , caracteEm 2019, o governo federal instituiu o Programa Previne Brasil, que estabeleceu um novo modelo de financiamento para a APS no SUS  e a Secretaria Municipal de Sa\u00fade (SMSA). Entre os objetivos desse recadastramento, destacamse: atualizar e aprimorar os indicadores b\u00e1sicos de sa\u00fade do munic\u00edpio; ampliar a popula\u00e7\u00e3o cadastrada na ESF ; e obterNesse contexto, o presente artigo tem como objetivo apresentar a experi\u00eancia e os resultados do recadastramento da popula\u00e7\u00e3o residente em Foz do Igua\u00e7u para atender \u00e0s diretrizes da Pol\u00edtica de APS e ao novo modelo de financiamento pelo Programa Previne Brasil.Trata-se de estudo descritivo, tipo relato de experi\u00eancia, sobre a a\u00e7\u00e3o de recadastramento (Cadastre J\u00e1) da popula\u00e7\u00e3o de Foz do Igua\u00e7u no e-SUS. O recadastramento foi realizado pela SMSA em parceria com a OPAS nos meses de setembro a dezembro de 2019 . Foi reaO recadastramento foi realizado por meio de visitas a domic\u00edlios particulares e operacionalizado por meio de varredura simult\u00e2nea (amostra de conveni\u00eancia) dos cinco distritos sanit\u00e1rios de Foz do Igua\u00e7u . O recadastramento observou a organiza\u00e7\u00e3o territorial da APS do munic\u00edpio, com cinco n\u00edveis de hierarquia: distrito sanit\u00e1rio, \u00e1rea, micro\u00e1rea, quarteir\u00e3o e domic\u00edlio . Um levaA coleta por varredura n\u00e3o constitui uma amostra aleat\u00f3ria da popula\u00e7\u00e3o do munic\u00edpio. Ocorreram perdas correspondentes aos domic\u00edlios fechados visitados mais de duas vezes em per\u00edodos diferentes e \u00e0s recusas, quando expressas pessoalmente, ap\u00f3s visita ao domic\u00edlio e tentativa de entrevista. Com base no levantamento de im\u00f3veis realizado pelo CCZ, observou-se uma sobrerrepresenta\u00e7\u00e3o do distrito Nordeste e uma sub-representa\u00e7\u00e3o do distrito Oeste . No totapersonal digital assistant, PDA). Utilizou-se o aplicativo Epicollect 5 para a coleta e a gera\u00e7\u00e3o de banco de dados, no qual, previamente, haviam sido inseridos todos os dados de localiza\u00e7\u00e3o dos domic\u00edlios levantados pelo CCZ. Esses dados de localiza\u00e7\u00e3o referem-se \u00e0s numera\u00e7\u00f5es de \u00e1reas, micro\u00e1reas e quarteir\u00f5es, o que facilitou a organiza\u00e7\u00e3o do trabalho de campo.As entrevistas foram realizadas pessoalmente por 54 agentes comunit\u00e1rios de sa\u00fade (ACS) utilizando um assistente digital , localiza\u00e7\u00e3o , tipo de domic\u00edlio , material predominante , disponibilidade de rede el\u00e9trica, abastecimento de \u00e1gua , forma de escoamento do banheiro ou sanit\u00e1rio  e destino do lixo .No que se refere \u00e0s caracter\u00edsticas sociodemogr\u00e1ficas, foram levantadas para todos os moradores do domic\u00edlio as seguintes informa\u00e7\u00f5es: idade (em anos), sexo , ra\u00e7a/cor , escolaridade mais elevada , nacionalidade  e situa\u00e7\u00e3o no mercado de trabalho .As caracter\u00edsticas relacionadas \u00e0s condi\u00e7\u00f5es e situa\u00e7\u00f5es de sa\u00fade autorreferidas dos moradores dos domic\u00edlios visitados inclu\u00edram ter plano privado de sa\u00fade , estar gestante , estar acamado  e ter diagn\u00f3stico de hipertens\u00e3o  e diabetes .Todas as an\u00e1lises foram realizadas com os programas estat\u00edsticos SPSS 21 e RStudio (vers\u00e3o 1.2.1335).A experi\u00eancia da SMSA em parceria com a OPAS relatada neste artigo refere-se ao recadastramento da popula\u00e7\u00e3o adstrita pelas unidades b\u00e1sicas de sa\u00fade, atendendo \u00e0 Pol\u00edtica de APS. A visita aos domic\u00edlios e o levantamento de dados sobre os residentes fazem parte da rotina de servi\u00e7os dos ACS. O armazenamento e a organiza\u00e7\u00e3o dos dados coletados s\u00e3o de responsabilidade da SMSA, como ocorre com outros registros administrativos. Por se tratar de uso de base de dados com informa\u00e7\u00f5es agregadas, sem a possibilidade de identifica\u00e7\u00e3o individual, o estudo dispensa aprova\u00e7\u00e3o por comit\u00ea de \u00e9tica em pesquisa .O recadastramento evidenciou a caracter\u00edstica essencialmente urbana do munic\u00edpio de Foz do Igua\u00e7u, com 99,8% dos domic\u00edlios entrevistados localizados em \u00e1rea urbana . No que Com rela\u00e7\u00e3o ao tipo do im\u00f3vel, 96,6% eram casas, embora mere\u00e7a destaque a \u00e1rea central do munic\u00edpio (distrito Oeste), onde a verticaliza\u00e7\u00e3o das habita\u00e7\u00f5es foi mais frequente . Quanto ao material predominante, a edifica\u00e7\u00e3o era de boa qualidade em 95,4% dos domic\u00edlios entrevistados, sendo 90,4% de alvenaria com revestimento e 5,0% de madeira aparelhada (madeira lisa). Nos distritos Oeste e Sul, houve maior frequ\u00eancia do tipo de edifica\u00e7\u00e3o com madeira aparelhada . No distrito Sul, tamb\u00e9m os materiais que denotam precariedade da constru\u00e7\u00e3o tiveram maior frequ\u00eancia .No que se refere aos servi\u00e7os urbanos , mais deNa Com rela\u00e7\u00e3o a ra\u00e7a/cor, 60,0% da popula\u00e7\u00e3o residente se declararam brancos, 34,9% se declararam pardos e 4,5% se declararam pretos. As categorias de ra\u00e7a/cor ind\u00edgena e amarela apresentaram propor\u00e7\u00f5es inferiores a 1%. Chama a aten\u00e7\u00e3o a mais elevada propor\u00e7\u00e3o de residentes que se declararam de ra\u00e7a/cor branca ou amarela no distrito Oeste . O distrito Norte teve a maior propor\u00e7\u00e3o de residentes que se declararam como pardos  e o distrito Sul a maior propor\u00e7\u00e3o de residentes de ra\u00e7a/cor preta .Para a popula\u00e7\u00e3o com 15 anos ou mais , avaliouO recadastramento tamb\u00e9m levantou informa\u00e7\u00f5es sobre a nacionalidade e a naturalidade dos indiv\u00edduos. Verificou-se uma propor\u00e7\u00e3o de 96,7% de residentes brasileiros, 1,9% de estrangeiros e 1,4% de naturalizados. O distrito Oeste apresentou o maior percentual de popula\u00e7\u00e3o estrangeira residente . Dada a hist\u00f3ria recente de ocupa\u00e7\u00e3o do munic\u00edpio, a propor\u00e7\u00e3o de brasileiros n\u00e3o nativos em Foz do Igua\u00e7u \u00e9 elevada , variando de aproximadamente 53% nos distritos Oeste e Leste a 45,1% no Sul.Por fim, com base nos dados sobre a atividade econ\u00f4mica para a popula\u00e7\u00e3o com 15 anos ou mais de idade, foram calculados os indicadores taxa de atividade, taxa de ocupa\u00e7\u00e3o e taxa de desemprego. A taxa de atividade do munic\u00edpio \u00e9 de 62,8%. Essa participa\u00e7\u00e3o na atividade econ\u00f4mica varia segundo distritos. As taxas mais elevadas encontram-se nos distritos Nordeste e Leste, com 65,6% e 63,4%, respectivamente. Os demais distritos t\u00eam taxas de atividade em torno de 60%. Com rela\u00e7\u00e3o \u00e0 efetiva participa\u00e7\u00e3o no mercado de trabalho, observou-se que a taxa de desemprego (taxa de ocupa\u00e7\u00e3o \u00e9 o seu complemento) \u00e9 elevada  e varia segundo distrito. Nos distritos Oeste, Nordeste e Norte, as taxas de desemprego s\u00e3o muito elevadas, superiores a 16,0%. J\u00e1 nos distritos Leste e Sul, a taxa de desemprego foi de 13,1% e 13%, respectivamente. Vale ressaltar que, entre as pessoas que exerciam atividade econ\u00f4mica, a principal ocupa\u00e7\u00e3o era \u201cassalariado com carteira de trabalho\u201d . Em segundo lugar estava a posi\u00e7\u00e3o \u201caut\u00f4nomo sem previd\u00eancia social\u201d, com 26,4% dos ocupados. A distribui\u00e7\u00e3o foi semelhante em todos os distritos.No m\u00f3dulo sobre condi\u00e7\u00f5es e situa\u00e7\u00f5es de sa\u00fade autorreferidas, o recadastramento levantou os seguintes dados: possuir plano privado de sa\u00fade, estar gestante, ser hipertenso ou diab\u00e9tico e estar acamado .No que se refere a ter ou n\u00e3o plano de sa\u00fade privado, a Observa-se que 18,6% da popula\u00e7\u00e3o se autodeclararam hipertensos. Entre os distritos, essa propor\u00e7\u00e3o foi maior no Leste e Oeste  e menor no distrito Nordeste . Com rela\u00e7\u00e3o ao diabetes, aproximadamente 7% da popula\u00e7\u00e3o informaram ser diab\u00e9ticos. Mais uma vez, o distrito Nordeste apresentou o menor percentual .Durante o recadastramento, foram identificadas 523 gestantes, com idade variando de 14 a 45 anos. Ao relacionar o n\u00famero de gestantes com o n\u00famero de mulheres no per\u00edodo f\u00e9rtil (10 a 49 anos), observa-se que o n\u00famero de gestantes por 1 000 mulheres foi mais elevado nos distritos Nordeste e Sul, os distritos de renda mais baixa. Esse mesmo indicador foi muito menor no distrito Oeste.Para finalizar, entre a popula\u00e7\u00e3o residente recadastrada, foram identificados 265 indiv\u00edduos acamados, o que representa 4,0 pessoas acamadas por 1 000 habitantes no munic\u00edpio. Essa propor\u00e7\u00e3o variou entre 3,4/1 000 no distrito Sul a 4,9/1 000 e 5,5/1 000 no Norte e Oeste, respectivamente .O recadastramento da popula\u00e7\u00e3o residente no munic\u00edpio de Foz do Igua\u00e7u reuniu informa\u00e7\u00f5es de extrema relev\u00e2ncia para subsidiar o planejamento da APS e tamb\u00e9m de outras \u00e1reas, como assist\u00eancia social, trabalho e habita\u00e7\u00e3o. Em 3 meses de coleta de dados, foram visitados mais de 50 mil domic\u00edlios, com entrevistas realizadas em mais de 22 mil deles, totalizando pouco mais de 67 mil pessoas cadastradas. Foram levantados dados sobre condi\u00e7\u00f5es da moradia, perfis socioecon\u00f4mico e demogr\u00e1fico dos residentes e condi\u00e7\u00f5es e situa\u00e7\u00f5es de sa\u00fade autorreferidas.A op\u00e7\u00e3o pela estrat\u00e9gia de coleta de dados tipo varredura, ainda que n\u00e3o forne\u00e7a uma amostra aleat\u00f3ria, mostrou-se muito apropriada para o trabalho de recadastramento realizado pelos ACS. O trabalho de campo foi facilitado e os ACS puderam conhecer a popula\u00e7\u00e3o adstrita ao seu territ\u00f3rio, como preconiza a Portaria 2 436 de 2017 do Minist\u00e9rio da Sa\u00fade, que estabeleceu a revis\u00e3o das diretrizes para a Pol\u00edtica da APS .O esfor\u00e7o da Secretaria Municipal de Sa\u00fade na coleta de dados permitiu que os t\u00e9cnicos e os ACS se aproximassem da popula\u00e7\u00e3o e de sua realidade cotidiana. O recadastramento foi muito mais do que apenas um levantamento de dados: foi uma oportunidade para gestores e t\u00e9cnicos da administra\u00e7\u00e3o municipal conhecerem o territ\u00f3rio e as principais caracter\u00edsticas da popula\u00e7\u00e3o, contribuindo, assim, para aprimorar o planejamento das a\u00e7\u00f5es na \u00e1rea de sa\u00fade. Al\u00e9m disso, a experi\u00eancia aprimorou a capacita\u00e7\u00e3o dos ACS \u2014 um elo importante entre a equipe de sa\u00fade e a comunidade \u2014 ao mostrar a import\u00e2ncia da coleta de dados da popula\u00e7\u00e3o adstrita para a formula\u00e7\u00e3o de indicadores que subsidiem as a\u00e7\u00f5es e pol\u00edticas de sa\u00fade em n\u00edvel municipal .Com rela\u00e7\u00e3o \u00e0s taxas de cobertura e de sucesso de realiza\u00e7\u00e3o da entrevista, observou-se que, nos distritos de mais baixa renda , a resposta ao recadastramento foi mais elevada. Nessas localidades, havia um n\u00famero maior de equipes da ESF envolvidas e um n\u00famero menor de domic\u00edlios fechados durante o recadastramento. Nos distritos Norte e Oeste, de maior renda, as taxas de sucesso das entrevistas foram muito baixas. Esse cen\u00e1rio \u00e9 apoiado pela literatura, que evidencia maior cobertura da ESF em comunidades com menor n\u00edvel socioecon\u00f4mico e entraves de cadastro de segmentos mais abastados devido \u00e0s dificuldades na realiza\u00e7\u00e3o de visitas domiciliares . No distQuanto aos resultados do recadastramento, ficaram evidentes as desigualdades sociais entre os distritos. Entretanto, quanto \u00e0 distribui\u00e7\u00e3o et\u00e1ria, ficou claro que o processo de envelhecimento populacional ocorre de forma acelerada em todos os distritos; mesmo assim, ao analisar os valores populacionais absolutos, esses dados n\u00e3o apontaram nem um crescimento populacional expressivo no munic\u00edpio no per\u00edodo mais recente, nem tampouco uma redu\u00e7\u00e3o do n\u00famero de habitantes como sugerem as estimativas municipais do IBGE . Nesse sAl\u00e9m de trazer informa\u00e7\u00f5es para atualizar as estimativas do n\u00famero de habitantes do munic\u00edpio e levantar as caracter\u00edsticas demogr\u00e1ficas da popula\u00e7\u00e3o residente, o recadastramento produziu informa\u00e7\u00f5es epidemiol\u00f3gicas fundamentais para o melhor planejamento das a\u00e7\u00f5es da APS no munic\u00edpio. Um dado de grande relev\u00e2ncia refere-se \u00e0 baixa propor\u00e7\u00e3o daqueles que t\u00eam planos de sa\u00fade privados. Ficou claro que cerca de 80% da popula\u00e7\u00e3o do munic\u00edpio dependem exclusivamente dos servi\u00e7os p\u00fablicos de sa\u00fade oferecidos pelo munic\u00edpio, uma porcentagem maior do que a registrada para o estado do Paran\u00e1 , 16. ConUma limita\u00e7\u00e3o dos resultados do recadastramento est\u00e1 associada ao pr\u00f3prio processo de coleta de dados. N\u00e3o se trata de uma amostra aleat\u00f3ria, mas de registros administrativos, que apresentam taxas de cobertura diferentes segundo distritos sanit\u00e1rios. A coleta foi feita por servidores p\u00fablicos municipais  que tinham impedimentos legais para trabalhar fora do hor\u00e1rio comercial (das 8h ao meio-dia e das 13h \u00e0s 17h). Esse hor\u00e1rio de trabalho favoreceu a coleta de dados em \u00e1reas de menor poder aquisitivo, onde havia maior presen\u00e7a de indiv\u00edduos nos domic\u00edlios no momento das visitas (distritos Nordeste e Sul). Por outro lado, prejudicou o avan\u00e7o do recadastramento no centro comercial e administrativo do munic\u00edpio, com maior n\u00edvel socioecon\u00f4mico e maior n\u00famero de pr\u00e9dios (distrito Oeste). Desse modo, a infer\u00eancia estat\u00edstica para as caracter\u00edsticas demogr\u00e1ficas e epidemiol\u00f3gicas deve considerar os vieses no processo de coleta de dados. No entanto, dado o n\u00famero elevado de domic\u00edlios visitados e com entrevistas realizadas, o munic\u00edpio disp\u00f5e de uma base de dados atualizada sobre sua popula\u00e7\u00e3o residente, que deve ser utilizada no planejamento da APS.Como li\u00e7\u00f5es aprendidas relatadas pelos gestores municipais, destacamos o envolvimento dos ACS no processo de visita e coleta de dados, que foi fundamental para promover a qualifica\u00e7\u00e3o dos dados cadastrais da APS no munic\u00edpio, e a utiliza\u00e7\u00e3o dos dados para reorganizar os servi\u00e7os no atendimento da popula\u00e7\u00e3o residente e n\u00e3o residente no munic\u00edpio durante o momento pand\u00eamico. De fato, aprimorar os servi\u00e7os de sa\u00fade para o atendimento mais adequado e eficiente da popula\u00e7\u00e3o residente, como tamb\u00e9m da n\u00e3o residente, \u00e9 um desafio sempre presente para a gest\u00e3o municipal em munic\u00edpios fronteiri\u00e7os como Foz do Igua\u00e7u -20.Em conclus\u00e3o, a experi\u00eancia de recadastramento da popula\u00e7\u00e3o em Foz do Igua\u00e7u, como parte da rotina dos ACS, evidencia que a coleta peri\u00f3dica de dados pelos munic\u00edpios para atender \u00e0s normativas dos SIS pode e deve ser realizada. Como preconiza a Pol\u00edtica de APS, recomenda-se que essa experi\u00eancia seja reproduzida em outros munic\u00edpios brasileiros, em especial nos fronteiri\u00e7os.As opini\u00f5es expressas no manuscrito s\u00e3o de responsabilidade exclusiva dos autores e n\u00e3o refletem necessariamente a opini\u00e3o ou pol\u00edtica da RPSP/PAJPH ou da Organiza\u00e7\u00e3o Pan-Americana da Sa\u00fade (OPAS)."}
+{"text": "To investigate the influence of musical instrument practice on temporal auditory abilities and on the results of cortical potentials related to auditory events (P300) in a group of young musicians compared to individuals without experience in musical practice.This is a prospective cross-sectional observational study. In total, 34 individuals between 18 and 30 years old, of both sexes, took part and were divided in two groups: Group I (GI), composed of musicians (n=16), and Group II (GII), composed of non-musicians (n=18). All participants underwent behavioral evaluation of temporal auditory processing, composed of Duration Pattern Sequence Test (DPS), Pitch Pattern Sequence Test (PPS), Random Gap Detection Test (RGDT) and electrophysiological evaluation \u2013 Long Latency Auditory Evoked Potential \u2013 P300. GI also answered a specific questionnaire to characterize musical practice.We observed statistically significant differences with superior performance of GI compared with GII in all behavioral tests (p<0.001*). The groups\u2019 performance was similar regarding the latency and amplitude parameters analyzed from LLAEP-300 data (p>0.05).The findings show a positive influence of musical practice toward the improvement of auditory abilities of temporal ordering and resolution. All participants presented adequate cortical functioning of the central auditory nervous system, without significant differences between musicians and non-musicians when considering P300 amplitude and latency. Recent studies reinforce the evidence that music refines the auditory skills of practitioners given the requirements in musical perception and cognitive demand, contributing to the maturation and development of central auditory nervous system (SNAC) skills throughout life.Although the maturational process of SNAC is more evident in the first years of life, it is known that neuronal plasticity does not cease after this phase, and the brain has a great capacity for reorganization that can occur throughout life, influenced by environmental stimuli. Auditory stimulation is thus crucial to strengthen auditory pathways and cortical organization of acoustic representation of sounds, from the first years of life from adulthood to older age,5. Evidence shows that musicians who start their studies earlier and have been inserted longer in musical practice perform better in the synchrony of visual-motor tasks and better integrity of the white matter in the corpus callosum, connecting the premotor and motor cortices.Studies comparing musicians and non-musicians, based on objective methods and neuroimaging exams, demonstrate significant structural differences in cortical motor areas, such as the precentral gyrus, corpus callosum, Heschl\u2019s gyri and in the corticospinal system\u2019s white matter. Therefore, musical stimulation is an adequate practice for the development and stimulation of different abilities, such as sensory, motor and cognitive functions and central auditory processing (CAP) skills,7.Acoustic interpretation capacity of a signal is known to be improved by musical auditory training. Thus, music is considered a stimulus that favors neuroplasticity and reorganization of cortical maps; music also stimulates cognition and reasoning mechanisms since its practice requires mastery of abstract cognitive processes. Behavioral tests standardized by age exist and are applied in clinical practice in the behavioral evaluation of temporal auditory processing (TAP) skills, allowing the measurement of performance in temporal resolution (TR) and temporal ordering (TO) skills,10. However, studies on TAP and electrophysiological evaluation of hearing in individuals exposed to musical practice are scarce.Regarding CAP, we highlight the temporal auditory abilities related to the characteristics of duration, organization  and perception of pauses or spectral variations of sound, which are considered the basis for the perception of other auditory processing skills, such as sound localization, figure-ground and integration of acoustic informationThis study aimed to investigate the influence of musical instrument practice on the time auditory abilities and on the results of cortical potentials related to auditory events (P300) in a group of young musicians compared to a group of individuals without experience in musical practice.This study was developed at the Clinic School of Speech Therapy from State University of Centro-Oeste \u2013 UNICENTRO, Paran\u00e1, Brazil. This is a prospective, observational, analytical, cross-sectional and quantitative study approved by the Research Ethics Committee of UNICENTRO, under opinion no. 973,331. All participants over 18 years old signed the Informed Consent Form.Individuals aged 18 to 30 years, of both sexes, were selected based on the following inclusion criteria: normal hearing ; normal binaural integration mechanism (verified by the Dichotic Digits Test \u2013 DDT) and brainstem integrity (verified using the brainstem auditory evoked response test \u2013 ABR).The exclusion criteria considered individuals from both groups who reported diseases or syndromes that could damage the auditory system, even if progressive and late; with neurological alterations and/or who demonstrated difficulties in understanding the tasks to be performed in the study procedures; were exposed to high sound pressure levels by labor activities.After applying the inclusion and exclusion criteria, the participants were divided in two groups, matched by gender and age group:Group I (GI): participants with regular musical practice for at least two years until the date of data collection, without history of chronic otological alterations.Group II (GII): non-musician participants, without any previous musical practice without complaints and/or history of chronic auditory or otological alterations.Prior to the beginning of data collection, all participants answered an audiological anamnesis and the GI participants also answered an specific questionnaire, with questions regarding the time of musical practice, hours of weekly study and type of instrument. Next, the normality criteria adopted are briefly described regarding the previous procedures applied, following the inclusion criteria described before:, compatible speech recognition thresholds and speech recognition index above 92%. Regarding acoustic immittance testing, only individuals with peak complicity between -150 to +100 daPa, equivalent volume from 0.3 to 1.6 ml (curve type A) and acoustic reflex from 70 to 100 dB above the hearing threshold for pure tone, at frequencies from 500 to 4000 Hz, were included.Basic audiological evaluation: only participants who presented hearing thresholds lower than or equal to 20 dB were included, according to the World Health Organization criteria: applied in the binaural integration stage. Only individuals who presented a percentage of correct answers greater than or equal to 95% in each ear were included.Dichotic Digit Test (DDT), validated version for Portuguese language were used, with two records on each side to confirm the response, considering the absolute values and interpeak between waves I, III and V.Brainstem Auditory Evoked Response (ABR): The equipment used was the Contronic MASBE-ATC plus. The achievement and normality parameters described by Souza et al.After selection, the behavioral evaluation of Temporal Auditory Processing was performed in an acoustic booth, with Danplex DA65 audiometer and TDH 39 headphone duly calibrated, consisting of the following procedures:: applied monophonically at 40 dBNS (sensation level) of intensity based on the average of the tonal threshold of 500, 1000 and 2000 Hz frequencies and in two response modes in each ear: verbal description of the sequence heard (naming) and humming. For the naming stage, normality is considered with at least 76% and 83% of correct answers for the PPS and DPS, respectively.Pitch Pattern Sequence Test (PPS) and the Duration Pattern Sequence Test (DPS), Musiek versions: binaural presentation, at 50 dBNS, of pure tone pairs at 500, 1000, 2000 and 4000 Hz frequencies, with gap between the two tones that randomly increase or decrease in duration, ranging between 0, 2, 5, 10, 15, 20, 25, 30 and 40 milliseconds (ms) intervals. Individuals were instructed to answer with gestures if they heard one or two tones, that is, whether the gap\u2019s presence was noted. The threshold detection of the gap was calculated individually for each frequency tested, as well as the total test response, using the arithmetic mean of results in the four frequencies evaluated.Random Gap Detection Test (RGDT)tone burst stimulus, presented monophonically at 75dBNA, presentation speed 1.1 clicks per second, and 300 stimuli in total. The frequent stimulus was presented at 1000 Hz and the rare at 2000 Hz. Of the 300 stimuli presented, 15% to 20% referred to the rare stimulus and the remainder to the frequent stimulus. The high-pass filter was 1 Hz, the low-pass 30 Hz and the analysis window 500 ms, according to the Junqueira and Colaf\u00eamia protocol. The variable analyzed was the N1-P2-N2 latency interpeaks and P300 wave. The normality pattern for P300 wave latency was 225 to 365 ms, as proposed by McPherson, for the age group of 17 to 30 years.Finally, the participants were submitted to the Long Latency Auditory Evoked Potential (LLAEP-P300) study. The P300 was captured in a quiet room and electrically protected using the Contronic MASBE-ATC plus equipment. The participant\u2019s skin was cleaned with alcohol and abrasive paste, conductive gel was then applied and surface electrodes were placed, with active electrodes (Fz) and ground electrodes (Fpz) on the forehead, and reference electrodes in the right (M2) and left (M1) mastoids. The impedance values of the electrodes were verified and must be below 5 kOhms. Monophonic insertion and stimulation headphones were used. The parameters used in the P300 recording included the The statistical analysis used the software Statistical Package for the Social Science (SPSS) Version 17. Descriptive statistics, including mean, median and standard deviation to demonstrate the performance in the tests applied in each group, separately and by ear. The test for equality of two proportions verified the homogeneity of the groups in terms of gender and age and the Paired Student\u2019s t test compared the performance of the right and left ears in the auditory tests in each group separately. ANOVA compared the performance of GI to GII in the applied tests. Finally, Pearson\u2019s Correlation was performed to verify the relationship between musical practice and the results of behavioral and electrophysiological evaluation in GI. The significance level adopted in the analyses was 0.05 (5%) and all p-values considered statistically significant were marked with an asterisk (*).The sample consisted of 34 subjects, 16 participants (47.05%) from group I (GI), and 18 (52.95%) from group II (GII). GI consisted of 8 (50%) women and 8 (50%) men, the mean age was 21.2 years (\u00b13.1 years) and GII consisted of 8 women (44.40%) and 10 mean (55.60%), of the mean age was 21.5 years (\u00b12.8 years). The groups were considered homogeneous in terms of sex (p=0.746) and age (p=0.803).The collected data regarding the time and frequency of musical practice were compiled in Initially, we compared the performance of the right and left ears in each group separately following the Paired Student\u2019s t test and found statistically significant mean differences between the right and left ears in the PPS in GII (p=0.037*) and DPS in GI (p=0.020) and GII (p=0.017), as well as in wave I of the ABR in both groups (p<0.001)*. Thus, we decided to show the results referring to the comparison of the performance of the groups in the behavioral tests and in the P300 as a function of the right and left ears.Finally, Musical instrument practice requires refined auditory performance. Musicians need adequate perception of acoustic variations such as volume, duration, timbre and intensity. Thus, we discuss the influence of musical instrument practice on the improvement of temporal auditory abilities and the auditory pathway of the central nervous system (CNS).,18. The performance within the normal range of both groups indicates that individuals not exposed to musical practice can present some degree of musical perception, but not with the same precision when compared to musicians, since this perception may be directly related to the development and improvement of auditory abilities.Both groups presented mean values, per ear and response modality, within the normality standards for the age group. However, although the variation was within the normal range, GI presented statistically higher performance than GII in the stages of naming and humming in both ears (p<0.001*). These results corroborate other studies with similar methods, in which the performance of musicians was higher and more homogeneous than non-musicians. Therefore, exposure to music theory and auditory training are important factors for the good performance to recognize frequency and duration patterns.Tones are known to be recognized as music or melody, as they are composed of tones of different frequencies and durations in various time orders. The ability to recognize, identify and order acoustic patterns requires several perceptual and cognitive processes that involve the integration of both hemispheres. The left hemisphere is responsible for temporal ordering, linguistic qualification and sequencing of linguistic elements. The right one for the recognition of the acoustic contour and perception of pitch. Memory participates in these auditory processes as a necessary prerequisite for the proper functioning and storage of information during sound processing in the central auditory pathways, allowing the proper reproduction of the sound sequence heard, for example,21. We highlight that the temporal resolution ability is considered a prerequisite for the processes of reading and writing acquisition, speech perception and good performance as a speaker and listener, since it allows the recognition of speech sounds toward specific characteristics such as changes in duration, pauses and syllable speed.As for the better performance of the group of musicians in the temporal resolution ability, this data corroborates other studies in the literature that demonstrate a lower temporal resolution threshold in musicians, evaluated under different acoustic parameters. This difference is attributed to a higher processing speed provided by musical practice. Thus, GI\u2019s better performance in the behavioral tests compared to GII reinforces the idea that musical instrument practice can benefit individuals who present complaints or difficulties resulting from alterations in auditory processing.Temporal auditory processing and temporal ordering and resolution skills are thus relevant for speech intelligibility at two levels: suprasegmental (prosodic) and segmental (phonemic). At the segmental level, the speed and rhythm of the syllables influence the lexical and syntactic processing of the language and at a suprasegmental level, duration and gap clues influence the identification of the phoneme,20,21. The results of the present research reinforce the evidence that musical instrument training allows a better perception in the discrimination of temporal pattern sequences and in the ability to solve aspects related to time, since musical practice improves temporal ordering and resolution skills, improving the subject\u2019s auditory acuity.Exposure to external stimuli is known to influence processes related to neural plasticity, thus favoring a better performance in auditory abilities, especially toward time skills.Although behavioral findings show an improvement in the auditory abilities studied, the electrophysiological evaluation performed according to the p300 cognitive potential demonstrated findings within the normal range in both groups, without statistical differences and mean latency values better in GII when compared to GI . P300 la. A possible hypothesis for this data may be the fact that in the study cited the authors evaluated a larger sample, which made it possible to evidence behavioral changes from the electrophysiological data. In addition to a smaller sample in our study, it is also necessary to consider the wide range of normality established for the P300 wave. The normality interval established in the literature for P300 latency in the age group evaluated is quite large, ranging from 225 ms to 365 ms, as it considers the maturational process that occurs in the structures of the central auditory pathway as a whole. Therefore, this potential demonstrates a great variability for latency in the comparison between the subjects, in addition to their generating sites, as well as other parameters still being widely discussed in the literature, which may be influenced by numerous other factors present over the maturational course of each individual.Our findings differ from the initial hypothesis that the best behavioral performance of GI would also be demonstrated in electrophysiological results, as already described in a previous study, in which the authors observed a lower P300 wave latency in the group of musicians toward the group of non-musicians using stimulation without contralateral noise,27,28.Another aspect to be considered for the results is related to the use of the tone burst stimulus. Pure tones are often used clinically to obtain N1-P2-N2 complexes, an exogenous response obtained passively during stimulus presentation; and the P300 wave represents an endogenous response resulting from the cognitive demand required by the oddball paradigm. The tone burst stimulus is composed of acoustically simpler periodic sounds, containing a single frequency component with no variations over time that provides less information about neural function and auditory processing. Other stimuli can be used to obtain the P300 such as the speech stimulus, which has greater acoustic complexity. It is believed that the use of speech stimulus in the sample studied would allow a greater extent of brain regions to be evaluated due to the multiple generating sources in the brainOur behavioral data suggests that, when auditory processing skills are evaluated from a functional perspective, the performance of the group of musicians is superior, with more homogeneous results and emphasis the improvement of auditory skills by musical instrument practice. Therefore, we believe that the P300 performed with speech stimulus is better to evaluate the population of musicians.Finally, we observed that there was no statistically significant correlation between the time of musical instrument practice and the results obtained in the behavioral and electrophysiological tests (p>0.05) . This daAccording to the results discussed here, we emphasize the importance of the findings in behavioral evaluation, together with electrophysiological evaluation techniques following auditory evoked potentials. Music is a pleasurable activity and can be used to delineate therapeutic approaches for subjects who present deficit in auditory processing, as they can stimulate the patient in the therapeutic process. Once the benefit of musical practice toward auditory processing is verified, especially the time aspects, regardless of the weekly frequency and time of study, this practice should be valued and implemented as a habit in peoples\u2019 lives, either in schools or at home.Based on the findings, we conclude that the musicians presented statistically higher results to non-musicians in the behavioral tests of temporal resolution and ordering, demonstrating a positive influence of musical practice toward the improvement of temporal auditory abilities, regardless of the time and frequency of musical practice reported. Both groups presented normal performance in the Long Latency Auditory Evoked Potential - P300, and no significant intergroup differences were found. ,2.Atualmente h\u00e1 um maior conhecimento a respeito dos benef\u00edcios que a pr\u00e1tica musical traz para o desenvolvimento humano, conhecimento este que vem refletindo em um n\u00famero cada vez maior de pessoas que s\u00e3o incentivadas a estudar algum tipo de instrumento musical. Estudos recentes refor\u00e7am as evidencias de que a m\u00fasica propicia ao indiv\u00edduo habilidades auditivas mais refinadas em fun\u00e7\u00e3o do que exige em termos de percep\u00e7\u00e3o musical e demanda cognitiva, contribuindo, portanto, no processo de matura\u00e7\u00e3o e desenvolvimento de habilidades do sistema nervoso auditivo central (SNAC) ao longo de toda a vida.Apesar do processo maturacional do SNAC ser mais evidente nos primeiros anos de vida, sabe-se que a plasticidade neuronal n\u00e3o cessa ap\u00f3s essa fase, e o c\u00e9rebro possui uma grande capacidade de reorganiza\u00e7\u00e3o que pode ocorrer ao longo de toda a vida, influenciada pelos est\u00edmulos do meio ambiente. Portanto, entende-se que a estimula\u00e7\u00e3o auditiva \u00e9 crucial para o fortalecimento das vias auditivas e organiza\u00e7\u00e3o cortical da representa\u00e7\u00e3o ac\u00fastica dos sons, desde os primeiros anos de vida at\u00e9 a idade adulta e at\u00e9 mesmo idosaHeschl e na subst\u00e2ncia branca do sistema c\u00f3rtico-espinal,5. As evidencias mostram que m\u00fasicos que iniciam seus estudos mais cedo e est\u00e3o inseridos h\u00e1 mais tempo na pr\u00e1tica musical apresentam melhor desempenho na sincronia de tarefas viso-motoras e melhor integridade da subst\u00e2ncia branca no corpo caloso, conectando os c\u00f3rtex pr\u00e9-motor e motor.Estudos comparando m\u00fasicos e n\u00e3o m\u00fasicos, embasadas em m\u00e9todos objetivos e exames de neuroimagem, demonstram diferen\u00e7as estruturais significativas em \u00e1reas motoras corticais, como o giro pr\u00e9-central, corpo caloso, o giro de . Sendo assim, a estimula\u00e7\u00e3o musical \u00e9 apontada como uma pr\u00e1tica adequada para o desenvolvimento e estimula\u00e7\u00e3o de diferentes habilidades, tais como fun\u00e7\u00f5es sensoriais, motoras, cognitivas e as habilidades do processamento auditivo central (PAC),7.Sabe-se que a capacidade de interpreta\u00e7\u00e3o ac\u00fastica do sinal pode ser aprimorada pelo treinamento auditivo musical. Desta forma, a m\u00fasica \u00e9 considerada um est\u00edmulo que favorece a neuroplasticidade e reorganiza\u00e7\u00e3o de mapas corticais, estimulando tamb\u00e9m a cogni\u00e7\u00e3o, uma vez que a pr\u00e1tica musical requer o dom\u00ednio de processos cognitivos abstratos e estimula os mecanismos de racioc\u00ednio. Os testes comportamentais dispon\u00edveis e padronizados por faixa et\u00e1ria para serem aplicados na pr\u00e1tica cl\u00ednica na avalia\u00e7\u00e3o comportamental das habilidades do processamento auditivo temporal (PAT) possibilitam a mensura\u00e7\u00e3o do desempenho nas habilidades de resolu\u00e7\u00e3o temporal (RT) e ordena\u00e7\u00e3o temporal (OT),10 e h\u00e1 uma escassez de estudos envolvendo o processamento auditivo temporal e avalia\u00e7\u00e3o eletrofisiol\u00f3gica da audi\u00e7\u00e3o em indiv\u00edduos expostos a pr\u00e1tica musical.Especificamente em rela\u00e7\u00e3o ao PAC, destacam-se as habilidades auditivas temporais, relacionadas com as caracter\u00edsticas de dura\u00e7\u00e3o, organiza\u00e7\u00e3o  e percep\u00e7\u00e3o de pausas ou varia\u00e7\u00f5es espectrais do som, as quais s\u00e3o consideradas a base para a percep\u00e7\u00e3o das demais habilidades do processamento auditivo, tais como a localiza\u00e7\u00e3o sonora, figura-fundo e integra\u00e7\u00e3o de informa\u00e7\u00f5es ac\u00fasticasDiante disso, essa pesquisa teve como objetivo investigar a influ\u00eancia da pr\u00e1tica musical instrumental nas habilidades auditivas temporais e nos resultados de potenciais corticais relacionados a eventos auditivos (P300) em um grupo de jovens m\u00fasicos em compara\u00e7\u00e3o com um grupo de indiv\u00edduos sem experi\u00eancia pr\u00e1tica musical.O presente trabalho foi desenvolvido na Cl\u00ednica Escola de Fonoaudiologia da Universidade Estadual do Centro-Oeste \u2013 UNICENTRO, Paran\u00e1. Trata-se de um estudo prospectivo, observacional, anal\u00edtico, transversal e car\u00e1ter quantitativo, aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa da UNICENTRO, sob o parecer n\u00ba 973.331. Todos os participantes maiores de 18 anos assinaram o Termo de Consentimento Livre e Esclarecido.Foram selecionados indiv\u00edduos na faixa et\u00e1ria de 18 a 30 anos, de ambos os sexos, com base nos seguintes crit\u00e9rios de inclus\u00e3o: audi\u00e7\u00e3o normal ; mecanismo de integra\u00e7\u00e3o binaural normal (verificada pelo teste Dic\u00f3tico de D\u00edgitos -TDD) e integridade do tronco encef\u00e1lico .Foram exclu\u00eddos os indiv\u00edduos, de ambos os grupos, que apresentassem relato de doen\u00e7as ou s\u00edndromes que podem cursar com poss\u00edveis danos ao sistema auditivo, mesmo que progressivos e tardios; com altera\u00e7\u00f5es neurol\u00f3gicas e/ou que demonstrassem dificuldades de compreens\u00e3o das tarefas a serem executadas nos procedimentos do estudo; relato de exposi\u00e7\u00e3o a n\u00edveis de press\u00e3o sonora elevados por outras atividades ocupacionais.Aplicados os crit\u00e9rios de inclus\u00e3o e exclus\u00e3o, os participantes foram divididos em dois grupos, pareados por sexo e faixa et\u00e1ria:Grupo I (GI): participantes com pr\u00e1tica musical regular h\u00e1 pelo menos dois anos at\u00e9 a data da coleta de dados, sem hist\u00f3rico de altera\u00e7\u00f5es otol\u00f3gicas cr\u00f4nicas.Grupo II (GII): participantes n\u00e3o m\u00fasicos, sem qualquer pr\u00e1tica musical pr\u00e9via sem queixas e/ou hist\u00f3rico de altera\u00e7\u00f5es auditivas ou otol\u00f3gicas cr\u00f4nicas.Previamente ao in\u00edcio da coleta de dados, todos os participantes responderam a uma anamnese audiol\u00f3gica e os participantes do GI responderam ainda a um question\u00e1rio especifico, com perguntas referentes ao tempo de pr\u00e1tica musical, horas de estudo semanal e tipo de instrumento percutido. A seguir, ser\u00e3o brevemente descritos os crit\u00e9rios de normalidade adotados referente aos procedimentos pr\u00e9vios aplicados, seguindo os crit\u00e9rios de inclus\u00e3o descritos anteriormente:, limiares de reconhecimento de fala compat\u00edveis e \u00edndice de reconhecimento de fala acima de 92%. Com rela\u00e7\u00e3o as medidas de imit\u00e2ncia ac\u00fastica, foram inclu\u00eddos apenas os indiv\u00edduos com pico de m\u00e1xima compli\u00e2ncia entre -150 a +100daPa, volume equivalente de 0,3 a 1,6 ml (curva tipo A) e reflexo ac\u00fastico de 70 a 100dB acima do limiar de audibilidade para tom puro, nas frequ\u00eancias de 500 a 4000Hz.-Avalia\u00e7\u00e3o audiol\u00f3gica b\u00e1sica: foram inclu\u00eddos apenas participantes que apresentaram limiares auditivos menores ou iguais a 20dB, segundo crit\u00e9rio da Organiza\u00e7\u00e3o Mundial da Sa\u00fade: aplicado na etapa de integra\u00e7\u00e3o binaural. Foram inclu\u00eddos apenas os indiv\u00edduos que apresentaram porcentagem de acertos maior ou igual a 95% em cada orelha.-Teste Dic\u00f3tico de D\u00edgitos (TDD), vers\u00e3o validada para o Portugu\u00easContronic MASBE-ATC plus. Foram considerados os par\u00e2metros de realiza\u00e7\u00e3o e de normalidade descritos por Souza et al., a partir de dois registros de cada lado para confirmar a exist\u00eancia de resposta, considerando os valores absolutos e interpicos entre as ondas I, III e V.-Potencial Evocado Auditivo de Tronco Encef\u00e1lico (PEATE) \u2013 O equipamento utilizado foi o Ap\u00f3s sele\u00e7\u00e3o, a avalia\u00e7\u00e3o comportamental do Processamento Auditivo Temporal foi realizada em cabina ac\u00fastica, com audi\u00f4metro Danplex DA65 e fone TDAH 39 devidamente calibrados, sendo composta pelos seguintes procedimentos:Pitch Pattern Sequence Test) e Teste de Padr\u00e3o de Dura\u00e7\u00e3o (TPD - Duration Pattern Sequence Test) \u2013 vers\u00f5es Musiek: aplicados de forma monoaural a uma intensidade de 40dBNS (n\u00edvel de sensa\u00e7\u00e3o) a partir da m\u00e9dia dos limiares tonais das frequ\u00eancias de 500, 1000 e 2000 Hz e em duas modalidades de resposta em cada orelha: descri\u00e7\u00e3o verbal da sequ\u00eancia ouvida (nomea\u00e7\u00e3o) e murm\u00fario (humming). Como crit\u00e9rio de normalidade, com base na etapa de nomea\u00e7\u00e3o, considera-se m\u00ednimo de 76% de acertos para o TPF e m\u00ednimo de 83% de acertos para o TPD.Teste de Padr\u00e3o de Frequ\u00eancia (TPF \u2013 Randon Gap Detection Test): apresenta\u00e7\u00e3o binaural, a 50 dBNS, de pares de tons puros nas frequ\u00eancias de 500, 1000, 2000 e 4000 Hz, com intervalos (Gap) entre os dois tons que aumentam ou diminuem de dura\u00e7\u00e3o aleatoriamente, variando entre intervalos de 0, 2, 5, 10, 15, 20, 25, 30 e 40 milissegundos (ms). O indiv\u00edduo foi orientado a responder gestualmente se ouviu um ou dois tons, ou seja, se notou ou n\u00e3o a presen\u00e7a do gap. Calculou-se o limiar de detec\u00e7\u00e3o de gap individualmente para cada frequ\u00eancia testada, bem como a resposta total do teste, por meio da m\u00e9dia aritm\u00e9tica de resultados nas quatro frequ\u00eancias avaliadas.Teste de Detec\u00e7\u00e3o de Intervalo no Sil\u00eancio  e o terra (Fpz) na fronte, e os eletrodos de refer\u00eancia nas mast\u00f3ides direita (M2) e esquerda (M1). Os valores de imped\u00e2ncia dos eletrodos foram verificados, devendo situar-se abaixo de 5 kOhms. Foram utilizados fones de inser\u00e7\u00e3o e estimula\u00e7\u00e3o monoaural. Os par\u00e2metros utilizados no registro do P300 inclu\u00edram o est\u00edmulo \u201ctone burst\u201d, apresentado monoauralmente a 75dBNA, em velocidade de apresenta\u00e7\u00e3o de 1,1 cliques por segundo, sendo empregado um total de 300 est\u00edmulos. O est\u00edmulo frequente foi apresentado a 1000 Hz e o raro a 2000 Hz. Dos 300 est\u00edmulos apresentados, 15% a 20% referiam-se ao est\u00edmulo raro e o restante ao est\u00edmulo frequente. O filtro passa-alto foi de 1 Hz, o passa-baixo de 30 Hz e a janela de an\u00e1lise de 500 ms, segundo o protocolo de Junqueira e Colaf\u00eamina. A vari\u00e1vel analisada foi a lat\u00eancia dos interpicos N1-P2-N2 e onda P300. O padr\u00e3o de normalidade para a lat\u00eancia da onda P300 foi de 225 a 365ms, conforme proposto por McPherson, para faixa et\u00e1ria de 17 a 30 anos.Por fim, os participantes foram submetidos a pesquisa do Potencial Evocado Auditivo de Longa Lat\u00eancia (PEALL-P300). A capta\u00e7\u00e3o do P300 foi realizada em sala silenciosa e protegida eletricamente utilizando o equipamento Contronic software \u201cStatistical Package for the Social Science\u201d (SPSS) Vers\u00e3o 17. A estat\u00edstica descritiva, incluindo m\u00e9dia, mediana e desvio padr\u00e3o foi realizada para demonstrar o desempenho nos testes aplicados em cada grupo, separadamente e por orelha. O Teste de Igualdade de duas propor\u00e7\u00f5es verificou a homogeneidade dos grupos quanto ao sexo e idade e o teste T Student Pareado comparou o desempenho das orelhas direita e esquerda nos testes auditivos, em cada grupo separadamente. A ANOVA comparou o desempenho do GI em rela\u00e7\u00e3o ao GII nos testes aplicados. E por fim, a Correla\u00e7\u00e3o de Pearson foi realizada para verificar a rela\u00e7\u00e3o entre a pr\u00e1tica musical e os resultados da avalia\u00e7\u00e3o comportamental e eletrofisiol\u00f3gica, no GI. O n\u00edvel de signific\u00e2ncia adotado nas an\u00e1lises foi de 0,05 (5%) e todos os p-valores considerados estatisticamente significantes foram assinalados com asterisco (*).A an\u00e1lise estat\u00edstica foi realizada por meio do  e o GI foi constitu\u00eddo por 8 sujeitos do sexo feminino  e 10 sujeitos do sexo masculino  com idade m\u00e9dia de 21,5 anos . Os grupos foram considerados homog\u00eaneos quanto ao sexo  e idade .A amostra foi constitu\u00edda por 34 sujeitos, sendo 16 participantes  do grupo I (GI), e 18  do grupo II (GII). O GI foi constitu\u00eddo por 8 (50%) sujeitos do sexo feminino e 8 (50%) do sexo masculino com idade m\u00e9dia de 21,2 anos Os dados coletados referentes ao tempo e frequ\u00eancia da pr\u00e1tica musical foram compilados na T Student Pareado e foram encontradas diferen\u00e7as m\u00e9dias estatisticamente significantes entre a orelha direita e esquerda no TPF no GII  e TPD no GI  e GII , assim como na onda I do PEATE em ambos os grupos *. Desta forma, optou-se por apresentar os resultados referentes \u00e0 compara\u00e7\u00e3o do desempenho dos grupos nos testes comportamentais e tamb\u00e9m no P300 em fun\u00e7\u00e3o das orelhas direita e esquerda.Inicialmente, o desempenho das orelhas direita e esquerda foi comparado em cada grupo separadamente por meio do teste gap de todas as frequ\u00eancias avaliadas pelo RGDT e limiar m\u00e9dio final calculado.A A humming). Para esta an\u00e1lise, foram utilizados os dados agrupados demonstrado na Por fim, a A pr\u00e1tica musical instrumental requer um desempenho auditivo refinado. O m\u00fasico precisa ter uma adequada percep\u00e7\u00e3o das varia\u00e7\u00f5es ac\u00fasticas como altura, dura\u00e7\u00e3o, timbre e intensidade. Sendo assim, o presente trabalho discute a influ\u00eancia da pr\u00e1tica musical instrumental no aprimoramento das habilidades auditivas temporais e sob a via auditiva do sistema nervoso central (SNC).humming nas duas orelhas . Tais resultados corroboram com outros trabalhos com m\u00e9todos semelhantes em que o desempenho do grupo de m\u00fasicos foi superior e mais homog\u00eaneo em rela\u00e7\u00e3o ao grupo de n\u00e3o-m\u00fasicos,18. O desempenho dentro da normalidade de ambos os grupos indica que indiv\u00edduos n\u00e3o expostos a pratica musical podem ser capazes de apresentar algum grau de percep\u00e7\u00e3o musical, por\u00e9m n\u00e3o com a mesma precis\u00e3o quando comparado a m\u00fasicos, uma vez que essa percep\u00e7\u00e3o pode estar diretamente relacionada com o desenvolvimento e aprimoramento de habilidades auditivas.Nos testes comportamentais de ordena\u00e7\u00e3o temporal, ambos os grupos apresentaram valores m\u00e9dios, por orelha e por modalidade de resposta, dentro dos padr\u00f5es de normalidade para a faixa et\u00e1ria. Por\u00e9m observa-se que mesmo esta varia\u00e7\u00e3o estando dentro da normalidade, o GI apresentou desempenho estatisticamente superior em rela\u00e7\u00e3o ao GII nas etapas de nomea\u00e7\u00e3o e Pitch. Pode-se mencionar ainda a participa\u00e7\u00e3o da mem\u00f3ria nestes processos auditivos, como um pr\u00e9 requisito necess\u00e1rio para o adequado funcionamento e armazenamento das informa\u00e7\u00f5es ao longo do processamento do som nas vias auditivas centrais, permitindo, por exemplo, a reprodu\u00e7\u00e3o adequada da sequ\u00eancia sonora ouvida. Portanto, a exposi\u00e7\u00e3o \u00e0 teoria musical e ao treinamento auditivo s\u00e3o fatores importantes para o bom desempenho nessa tarefa de reconhecer padr\u00f5es de frequ\u00eancia e dura\u00e7\u00e3o.Sabe-se que os padr\u00f5es tonais s\u00e3o reconhecidos como m\u00fasica ou melodia, pois s\u00e3o compostos por tons de diferentes frequ\u00eancias e dura\u00e7\u00f5es em ordens temporais diversas. A habilidade de reconhecer, identificar e ordenar padr\u00f5es ac\u00fasticos requer v\u00e1rios processos perceptuais e cognitivos que envolvem a integra\u00e7\u00e3o de ambos os hemisf\u00e9rios. O hemisf\u00e9rio esquerdo \u00e9 respons\u00e1vel pela ordena\u00e7\u00e3o temporal, qualifica\u00e7\u00e3o lingu\u00edstica, sequencia\u00e7\u00e3o dos elementos lingu\u00edsticos e o hemisf\u00e9rio direito pelo reconhecimento do contorno ac\u00fastico e percep\u00e7\u00e3o do ,21. \u00c9 importante destacar que a habilidade de resolu\u00e7\u00e3o temporal \u00e9 considerada pr\u00e9-requisito, tanto para os processos de aquisi\u00e7\u00e3o da leitura e escrita, como para a percep\u00e7\u00e3o de fala e o bom desempenho enquanto falante e ouvinte, uma vez que possibilita o reconhecimento dos sons da fala em rela\u00e7\u00e3o a caracter\u00edsticas espec\u00edficas, tais como mudan\u00e7as na dura\u00e7\u00e3o, pausas e velocidade da s\u00edlaba.Quanto ao melhor desempenho do grupo de m\u00fasicos na habilidade de resolu\u00e7\u00e3o temporal, tal dado corrobora com outros estudos na literatura que demonstram menor limiar de resolu\u00e7\u00e3o temporal em m\u00fasicos, avaliado sob diferentes par\u00e2metros ac\u00fasticos, sendo esta diferen\u00e7a atribu\u00edda a uma maior velocidade de processamento proporcionada pela pr\u00e1tica musicalgap influenciam a identifica\u00e7\u00e3o do fonema. Sendo assim, a melhor performance nos testes comportamentais do GI em rela\u00e7\u00e3o ao GII refor\u00e7a a ideia de que a pr\u00e1tica musical instrumental pode ser ben\u00e9fica ao indiv\u00edduo que apresente queixas ou dificuldades decorrentes de altera\u00e7\u00f5es no processamento auditivo.Desta forma, as habilidades do processamento auditivo temporal, ordena\u00e7\u00e3o e resolu\u00e7\u00e3o temporal, s\u00e3o relevantes para a inteligibilidade da fala em dois n\u00edveis: em n\u00edvel suprassegmental (pros\u00f3dico) e segmental (fon\u00eamico). No n\u00edvel segmental, a velocidade e o ritmo das s\u00edlabas influenciam o processamento l\u00e9xico e sint\u00e1tico da linguagem e em um n\u00edvel suprassegmental, pistas de dura\u00e7\u00e3o e de ,20,21. Os resultados decorrentes da presente pesquisa refor\u00e7am as evid\u00eancias de que o treinamento musical instrumental possibilita uma melhor percep\u00e7\u00e3o na discrimina\u00e7\u00e3o de sequ\u00eancias de padr\u00f5es temporais e na capacidade de resolver aspectos relacionados ao tempo, visto que a pr\u00e1tica musical aprimora as habilidades de ordena\u00e7\u00e3o e resolu\u00e7\u00e3o temporal, possibilitando ao sujeito uma acuidade auditiva mais acurada.Sabe-se que a exposi\u00e7\u00e3o aos est\u00edmulos externos exerce influ\u00eancia sobre processos relacionados \u00e0 plasticidade neural, favorecendo, assim, um melhor desempenho nas habilidades auditivas, especialmente com rela\u00e7\u00e3o \u00e0s habilidades temporais.Apesar de os achados comportamentais evidenciarem um aprimoramento nas habilidades auditivas estudadas, a avalia\u00e7\u00e3o eletrofisiol\u00f3gica realizada por meio do potencial cognitivo P300 demonstrou achados dentro da normalidade em ambos os grupos, sem diferen\u00e7as estat\u00edsticas e valores m\u00e9dios da lat\u00eancia melhores no GII quando comparado ao GI . A lat\u00ean. Uma poss\u00edvel hip\u00f3tese para esse dado pode ser o fato de que no estudo citado os autores avaliaram uma amostra maior, o que possibilitou evidenciar as mudan\u00e7as comportamentais a partir do dado eletrofisiol\u00f3gico. Al\u00e9m de uma amostra mais reduzida em nosso estudo, \u00e9 necess\u00e1rio tamb\u00e9m considerar a ampla faixa de normalidade estabelecida para a onda P300. O intervalo de normalidade estabelecido na literatura para a lat\u00eancia do P300 na faixa et\u00e1ria avaliada \u00e9 bastante extenso, podendo variar de 225ms a 365ms, pois considera o processo maturacional que ocorre nas estruturas da via auditiva central como um todo. Portanto, esse potencial demonstra uma grande variabilidade para a lat\u00eancia na compara\u00e7\u00e3o entre os sujeitos, al\u00e9m de seus s\u00edtios geradores, bem como outros par\u00e2metros ainda serem amplamente discutidos na literatura, os quais podem sofrer influ\u00eancia de in\u00fameros outros fatores presentes ao longo do curso maturacional de cada indiv\u00edduo.Os nossos achados diferem da hip\u00f3tese inicial de que o melhor desempenho comportamental do GI tamb\u00e9m seria demonstrado em resultados eletrofisiol\u00f3gicos, assim como j\u00e1 descrito em estudo pr\u00e9vio, no qual os autores observaram m\u00e9dia de lat\u00eancia da onda P300 menor no grupo de m\u00fasicos em rela\u00e7\u00e3o ao grupo de n\u00e3o m\u00fasicos utilizando a estimula\u00e7\u00e3o sem ru\u00eddo contralateraltone burst\u201d. Os tons puros s\u00e3o mais frequentemente utilizados clinicamente para a obten\u00e7\u00e3o dos complexos N1-P2-N2, resposta ex\u00f3gena obtida de forma passiva durante a apresenta\u00e7\u00e3o do est\u00edmulo; e a onda P300 representa uma resposta end\u00f3gena resultante da demanda cognitiva exigida pelo paradigma oddball. O est\u00edmulo tone burst \u00e9 composto por sons peri\u00f3dicos acusticamente mais simples, contendo um \u00fanico componente de frequ\u00eancia, n\u00e3o havendo varia\u00e7\u00f5es ao longo do tempo, o que fornece menos informa\u00e7\u00f5es sobre a fun\u00e7\u00e3o neural e processamento auditivo. Outros est\u00edmulos podem ser utilizados para obten\u00e7\u00e3o do P300, como o est\u00edmulo de fala, o qual possui uma maior complexidade ac\u00fastica. Acredita-se que o uso do estimulo de fala na amostra estudada permitiria com que uma maior extens\u00e3o das regi\u00f5es cerebrais fosse avaliada devido \u00e0s m\u00faltiplas fontes geradoras no c\u00e9rebro,27,28.Um outro aspecto a ser considerado para os resultados encontrados, relaciona-se com o uso do est\u00edmulo \u201cEm nossos achados, o dado comportamental encontrado sugere que, quando as habilidades do processamento auditivo s\u00e3o avaliadas sob uma perspectiva funcional, o desempenho do grupo de m\u00fasicos \u00e9 superior, apresentando resultados mais homog\u00eaneos e ressaltando o aprimoramento das habilidades auditivas pela pr\u00e1tica musical instrumental. Portanto, acreditamos que o P300 realizado com est\u00edmulo de fala seja melhor para avaliar a popula\u00e7\u00e3o de m\u00fasicos.Por fim, foi poss\u00edvel observar que n\u00e3o houve correla\u00e7\u00e3o estatisticamente significante entre o tempo de pr\u00e1tica musical instrumental e os resultados obtidos nos testes comportamentais e eletrofisiol\u00f3gicos  . Este daDiante dos resultados aqui discutidos, ressalta-se a import\u00e2ncia dos achados da avalia\u00e7\u00e3o comportamental, aliados \u00e0s t\u00e9cnicas de avalia\u00e7\u00e3o eletrofisiol\u00f3gica por meio dos potenciais evocados auditivos. A m\u00fasica \u00e9 uma atividade prazerosa, podendo ser utilizada para delinear abordagens terap\u00eauticas para sujeitos que apresentem d\u00e9ficit no processamento auditivo, pois podem estimular o paciente no processo terap\u00eautico. Uma vez constatado o benef\u00edcio da pr\u00e1tica musical com rela\u00e7\u00e3o ao processamento auditivo, especialmente aos aspectos temporais, independente da frequ\u00eancia semanal e tempo de estudo, tal pr\u00e1tica deve ser valorizada e implementada como um h\u00e1bito na vida do sujeito, seja em escolas ou em casa.Com base nos achados, \u00e9 poss\u00edvel concluir que os m\u00fasicos apresentaram resultados estatisticamente superiores aos n\u00e3o m\u00fasicos nos testes comportamentais de resolu\u00e7\u00e3o e ordena\u00e7\u00e3o temporal, demonstrando influ\u00eancia positiva da pr\u00e1tica musical em rela\u00e7\u00e3o ao aprimoramento de habilidades auditivas temporais, independentemente do tempo e frequ\u00eancia de pr\u00e1tica musical relatados. Ambos os grupos apresentaram desempenho dentro da normalidade no potencial auditivo evocado de longa lat\u00eancia- P300, n\u00e3o tendo sido evidenciadas diferen\u00e7as significantes intergrupos."}
+{"text": "To analyze the impact of photobiomodulation combined with orofacial myofunctional therapy (OMT) on the oral health quality of life (OHQOL) of individuals with temporomandibular disorder, before and after the treatment.Blind, controlled, randomized clinical trial with 34 volunteers randomly distributed into two groups: G1, who received OMT combined with photobiomodulation, and G2, treated with OMT combined with inactive laser. The subjects were first assessed with a visual analog scale (VAS) to classify them according to the degree of orofacial pain and with the Oral Health Impact Profile \u2013 Short Form (OHIP-14) regarding the impact on the OHQOL. The resulting data were statistically analyzed. The significance level was set at 0.05 (95%).\u201cPhysical pain\u201d, \u201cpsychological discomfort\u201d, \u201cphysical disability\u201d, and \u201cpsychological disability\u201d were the aspects with the greatest impact on the OHQOL. The G1 subjects responded positively to their treatment, as well as G2 to theirs. There was a strong positive correlation between VAS and total OHIP-14 score in both groups after the treatment. However, the functional recovery in the control group individuals (G2) was the most perceived positive change in the OHQOL in comparison with the experimental group (G1).The people who received photobiomodulation combined with OMT perceived an improvement in the OHQOL, as well as those treated with placebo laser. There was a strong positive correlation in both groups in the improvement of the degree of pain and self-perception of the OHQOL. Hence, TMD is considered the main cause of nondental pain in the orofacial region. The pain manifests mostly in the TMJ region, face, head, neck, and ears, and when opening and closing the mandible. It is associated with limited mandible movements, joint noises, and difficulties speaking, chewing, and swallowing. Moreover, patients commonly report increased pain/discomfort when performing these functions.It manifests as various signs and symptoms. Pain is the main characteristic reported by subjects affected by this condition and it is sometimes the main reason why they seek treatment. Therefore, there are harmful consequences to these people\u2019s quality of life (QOL) and particularly to their oral health quality of life (OHQOL) \u2013 with greater impairments depending on the severity of the TMD.Thus, these problems have a direct and negative influence on the patients\u2019 physical and mental health, affecting their school, professional, and social activities, even causing affective and cognitive imbalance.This reinforces the awareness that TMD subjects need comprehensive clinical attention, as many aspects are involved. This is especially the case of the QOL, which is associated with the patients\u2019 subjective perception of their position in life, in the context of the values and culture in which they live and in relation to their goals, expectations, and concerns. Hence, investigating the degree of impairment of the QOL is highly important to the health professionals who treat them.In many cases, though, the patients\u2019 perceptions and feelings regarding oral health are ignored. Furthermore, few studies in the literature analyze the impact of the TMD painful conditions on the QOL, in contrast with the number of publications on TMD diagnosis, signs, and symptoms. One of them is the orofacial myofunctional therapy (OMT), which highlights the work of the speech-language-hearing therapist in the field of oral-motor function. Its purpose is to provide orofacial myofunctional stability by changing the muscle and functional patterns, thus easing their pain, adjusting mandibular movement amplitude, and consequently readjusting the speech, breathing, chewing, and swallowing functions.Given this context, various therapeutic approaches have been proposed to ease and treat the consequences of the TMD clinical conditions and provide more comfort to the patients,14.The use of low-level laser (LLL) or photobiomodulation in TMD has also been described and discussed in scientific research. It is characterized as a nonpharmaceutical, noninvasive, quick, and safe intervention, with favorable reactions in myogenic and joint pains, under the analgesic, anti-inflammatory, and biomodulator effects of the physiological cell functions, increase the mouth opening amplitude, and aid in the signs, symptoms, and functional recovery. On the other hand, some meta-analysis studies,18 demonstrate that groups submitted to active laser had their pain eased likewise the placebo groups, although the first one had better results in the subjects\u2019 functional status.Authors point out that these effects positively ease the pain further reinforce that combining treatments to control the pain and train the oral-motor functions suggests favorable TMD rehabilitation. Hence, the objective of this study was to analyze the impact on the OHQOL of subjects with TMD, before and after the photobiomodulation treatment combined with OMT, and verify possible correlations between the degree of orofacial pain and their self-perception of this impact.ResearchersUniversidade Federal da Para\u00edba , under report number 3.354.075, complying with the ethical principles of Resolution no. 466/2012, of the National Health Council .This is a therapeutic intervention study designed as a longitudinal, blind, controlled, randomized clinical trial. It was approved by the Research Ethics Committee of the Center for the Health Sciences at the The research was conducted at the Speech-Language-Hearing Teaching Clinic of UFPB, involving participants of both sexes. The sample comprised 34 volunteers who sought the speech-language-hearing services on their own initiative.; with time available to undergo the treatment; and who agreed to participate in the study by signing the informed consent form. Those who reported a history of neurological impairment; malformations, tumors, traumas, or surgeries on the head and neck region; use of dentures or orthodontic appliances; who had already been submitted to or were at the time undergoing speech-language-hearing therapy; or who were taking myorelaxant and/or anti-inflammatory drugs or had taken them for more than one year were excluded.Based on screenings, the eligibility criteria were as follows: subjects aged 18 to 59 years; with orofacial pain characterized as muscular TMD, according to the Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD), Axis IBesides these factors, criteria that contraindicate photobiomodulation were also considered, namely: pregnant women; photosensitive patients; subjects with glaucoma; with a pacemaker or another electronic implant; and/or infected tissue near the irradiation site.Before collecting the research data, the participants were randomly divided into groups in a simple draw. This random distribution formed G1 \u2013 Experimental Group, which received the OMT combined with photobiomodulation; and G2 \u2013Positive Control Group, which received OMT combined with inactive laser (placebo).The study participants were assessed before and after the period of therapeutic intervention, with the following procedures: Assessment of the impact on the OHQOL with the Oral Health Impact Profile \u2013 Short Form (OHIP-14) and of the degree of orofacial pain with a visual analog scale (VAS).. It was administered in an interview, considering the patients\u2019 subjective perception of their problem over the last 6 months.The OHQOL was analyzed with the OHIP-14 questionnaire, developed by Slade (1997), in its version already translated and validated in Brazilian Portuguese, their scores are respectively 0, 1, 2, 3, and 4 points. The score in each domain ranges from 0 to 8 points, and higher scores mean greater impairment. As for the total OHIP-14 score, the sum of the ordinal answers ranges from 0 to 56 points \u2013 meaning a greater negative impact on oral health.The instrument has 14 questions \u2013 two in each of its seven domains . Each question has five answer options: never, rarely, sometimes, recurrently, and always. Following the sum methodThe VAS was administered with a non-numbered 10-cm line. The left end meant they reported \u201cno pain\u201d and the right end, \u201cthe worst pain possible\u201d \u2013 i.e., the more the marking was made toward the left end, the better the classification of their degree of pain, whereas the more to the right, the worse this classification.The volunteers were informed of how to fill in the scale, and then they made the self-analysis of spontaneous pain, marking the point on the line that best represented the degree of pain they felt at the moment of the assessment. To analyze the result, the examiner used a ruler under the line to identify, from 0 to 10, the number they indicated and transcribed the result to the patient\u2019s clinical evolution form.The intervention consisted of weekly meetings, totaling 13 sessions. One session was used to assess them and administer the said instruments; another one was used exclusively to instruct them about their clinical conditions, harmful habits that trigger the pains, and how to ease them at home; 10 sessions were used for the therapy itself; and yet another one was used specifically for reassessment. Each speech-language-hearing visit lasted 45 minutes \u2013 30 minutes for the OMT and 15 and 12 minutes, respectively, in the first and second phase to apply the LLL. The team was made up of four calibrated researchers, trained in photobiomodulation and with 3-year experience in the necessary procedures. was the same for both groups. It consisted of strategies such as thermotherapy and massage therapy, with slow and deep massages to favor local blood circulation and ease the pain. It also used myotherapy, with isometric and isotonic exercises for specific muscle groups  to improve the flexibility, coordination, symmetry, and stability of the TMJ functional movements. Moreover, it trained their orofacial functions \u2013 i.e., using the masticatory function as exercise and training.The OMT speech therapy protocolThe active LLL corresponded to the bilateral application of aluminum/gallium arsenide (Al/GaAs) LLL with the Laser Pulse Line equipment, manufactured by IBRAMED. The protocol used was developed from discussions at the Center for Language Studies and Stomatognathic Functions . It consisted of the application on five sites of the TMJ region  and on the painful points of the masseter, temporal, sternocleidomastoid, and trapezius muscles, as reported by the individuals.2, to ease the painful condition; and the second phase (beginning at the sixth session), with doses of 4 J and fluence of 34 J/cm2, to biostimulate the functional gains furnished by the speech-language-hearing therapy. The inactive LLL was simulated, providing the placebo effect.The application used 830-nm wavelength (infrared) and irradiation with two different purposes in phases: the first phase (from the first to the fifth session), with doses of 6 J and fluence of 51 J/cmThe resulting data were tabulated and stored in a Microsoft Excel 2013 spreadsheet to be managed afterward. Both descriptive and inferential statistical analyses were made in the Statistical Package for the Social Sciences (SPSS) for Windows, version 21.0. In the descriptive analysis, approaching the qualitative variables, the absolute and relative (percentage) frequencies were applied; and, to address the quantitative variables, the mean and median were used as the measures of central tendency, and the standard deviation and quartiles 1 and 3 as the measures of variability.. The significance level in this study was set at 0.05 (95%).As for the inferential analysis, the Wilcoxon test was used to analyze the intragroup relationship of the quantitative and qualitative variables, and the Mann-Whitney test for that between the groups. The Spearman correlation test was used to verify the correlation between the quantitative data. The results of this test are presented in percentages and may have positive and negative values. The degree of correlation was considered weak when the resulting value was up to 0.3; moderate, when between 0.3 and 0.7; and strong, when above 0.7This study assessed and treated 34 individuals diagnosed with muscular TMD. In G1, there were 16 (84.2%) females and 3 (15.8%) males, with a mean age of 32.16\u00b18.60 years. In G2, there were 11 (73.3%) females and 4 (26.7%) males, with a mean age of 34.67\u00b113.05 years. The sample characterization, based on the subjective perception of the OHQOL before and after the treatment as indicated in each OHIP-14 question, is shown in It is observed that \u201cphysical pain\u201d, \u201cpsychological discomfort\u201d, \u201cphysical disability\u201d, and \u201cpsychological disability\u201d were the most reported aspects in the corresponding items in the questionnaire before the participants underwent the treatment.The \u201cphysical pain\u201d and \u201cpsychological discomfort\u201d were the most reported domains by both G1 and G2 volunteers. Under \u201cphysical pain\u201d, they reported discomfort eating because of the TMD, and under \u201cpsychological discomfort\u201d, they reported being self-conscious. Regarding \u201cphysical disability\u201d, G1 presented with the frequency of always having an unsatisfactory diet, as well as in \u201cpsychological disability\u201d, with a higher frequency of difficulties relaxing because of the TMD.In the post-treatment period, the answers improved in all the questions in both groups. However, \u201cfunctional limitation\u201d and \u201chandicap\u201d were the OHQOL aspects most referred to as having never been affected by the TMD.In \u201cfunctional limitation\u201d, neither G1 nor G2 subjects had any more problems pronouncing a word; likewise, they did not feel the taste of food getting worse. In \u201chandicap\u201d, the volunteers reported no longer feeling that life, in general, had grown worse; similarly, they no longer felt hindered from carrying out their daily activities.An improved relationship was verified in both the degree of orofacial pain (with the VAS) and the OHQOL  in both groups. Most domains in the questionnaire had this specific result, except for the \u201cfunctional limitation\u201d and \u201csocial disability\u201d in G1 and \u201cpsychological disability\u201d and \u201csocial disability\u201d in G2.In A correlation was observed between the VAS and total OHIP-14 score after the treatment in both G1 and G2, as shown in No correlation was found between the VAS and the OHIP-14 total score before the intervention, or between age and the VAS, and between age and the total OHIP-14 score before and after the treatment.. Hence, the professionals must know and understand the oral/orofacial health and disease conditions, considering how the consequences in this region have harmful effects on the person\u2019s overall well-being.Oral health is an essential part of the QOL of humans. This relationship is manifold and involves the physical, social, and psychological aspects. It is particularly the case of orofacial pain, which is more significant for these individuals than other systemic conditions, such as diabetes, hypertension, and ulcer. In this research, \u201cphysical pain\u201d, \u201cpsychological discomfort\u201d, \u201cphysical disability\u201d, and \u201cpsychological disability\u201d in the OHIP-14 were the most reported as \u201calways\u201d by the participants before the treatment.Having pain and discomfort is usually one of the most relevant positive and negative factors of the QOL assessed the influence of TMD on the subjective perception of OHQOL using the OHIP-14. They verified that \u201cphysical pain\u201d, \u201cpsychological discomfort\u201d, and \u201cpsychological disability\u201d were likewise the most reported domains by the sample investigated.This result was similar to another one published in the literature. Rodrigues and collaborators, the researchers found an association between the pain and the QOL in five out of the seven domains of the same protocol: \u201cpsychological discomfort\u201d, \u201cphysical disability\u201d, \u201cpsychological disability\u201d, \u201csocial disability\u201d, and \u201chandicap\u201d. Thus, these data make evident these patients\u2019 painful symptomatology, discomfort, and restrictions, with which they live in their daily activities when they do not have therapeutic care.In another more recent studyThe present study revealed a strong positive correlation after the treatment in the improved degree of pain and self-perception of OHQOL in both G1 and G2. There was also a relationship of these aspects between the subjects of each group. This demonstrated that the individuals treated with OMT combined with active laser had positive responses, likewise those who received an intervention without the laser. It also indicates that the lower the degree of pain, the less impact on the OHQOL was perceived., which also followed up and assessed the degree of pain with the VAS and the oral amplitude in people with the same disorder as those in this study. They were treated with OMT and photobiomodulation, using the same dosimetry parameters to apply LLL. The same improvement was perceived in those treated with OMT and active laser and with OMT and placebo laser.The diminished perception of pain in the two groups at the end of the treatment agrees with current research, the type of radiation applied, the tissue on which it is irradiated, and the immune status may influence the feedback of TMD patients when treated with photobiomodulation. Hence, these factors may explain the outcomes of using this treatment in the present study sample, as well as in the abovementioned current research. In both studies, the patients who had not been submitted to photobiomodulation also had the painful symptomatology diminished and the OHQOL improved.Factors like stress, time of disease progression, severe loss of the vertical TMJ dimension.No publication was found discussing the relationship between the self-perception of orofacial pain and the QOL in TMD patients submitted to the two said treatments. This highlights the importance of this paper to the scientific community, providing knowledge to the professionals who treat this population. Moreover, the fact that these study participants had their pain eased and their QOL proportionally restored demonstrates that they are directly related. Hence, they have effects not only on the body but also on the psychological status and social interaction. This was particularly verified in the present research, as seen in The OMT proved to be the treatment that most influenced the abovementioned findings. It aims at the functional recovery of the stomatognathic system, so the masticatory, swallowing, and speaking functions can be performed without pain, limitations, or risk of worsening the problem, and another piece of research identified a greater decrease in mastication difficulties in subjects treated with orofacial myofunctional exercises combined with placebo laser.Therefore, the finding that these subjects belonged to the group treated with placebo laser stands out. The perception of 100% functional recovery to pronounce a word or taste the foods may have been influenced by this effect. Positive functional results, such as in mandibular mobility, have also been seen. The patient\u2019s expectations, a good patient-therapist relationship, and the sensation of receiving a more complete treatment with laser technology may explain this possibility.This evidence exists because the placebo response is a neurobiological event, whose activity in cortical areas has been associated with pain inhibition and the affective and cognitive center. They demonstrated more expressive results when the sessions maintained the dose (3 J), unlike the criteria used in this research \u2013 which varied the doses, with 6 J from the first to the fifth session to ease the pain and 4 J beginning at the sixth session to biostimulate the functional gains obtained with the speech-language-hearing therapy.A piece of research was conducted with 11 women with muscular TMD, divided into two groups: An experimental group (EG), submitted to OMT combined with photobiomodulation, and a positive control group (CG), submitted to OMT combined with inactive photobiomodulation (placebo). The intervention was also made in 10 sessions, with 830-nm wavelength, furnishing a punctual dose of 3 J. Different from the findings in this study, the EG obtained increased measures of mandibular protrusion and opening movements and an improvement in the QOL assessment, its clinical effectiveness occurs in different parameters, doses, and methodological criteria in the studies. Thus, the effects of photobiomodulation to optimize speech-language-hearing therapy need further evidence.This led to the reflection that, although the LLL triggers different action mechanisms in the organism and is positively reported in the interventions with combined treatment of TMD patientsGiven the above, this research reinforced the speech-language-hearing therapists\u2019 follow-up of TMD patients with OMT, as they are the professionals responsible for this therapy, which is a reference in the field of oral-motor function. However, some limitations were identified in this study, such as the small sample size and the difference in the number of participants between the groups. This may have been one of the reasons why the research hypothesis was not answered \u2013 that people with muscular TMD submitted to photobiomodulation combined with OMT would have more gains in their QOL than those with the same characteristics submitted only to the OMT.Thus, the scientific debate using this resource in speech-language-hearing therapy must continue, exploring the analyses with larger samples to obtain scientific evidence and consolidate the knowledge of the effects of photobiomodulation on the QOL of people with TMD.The people with TMD treated with photobiomodulation combined with OMT perceived an improvement in their OHQOL, as well as those treated with placebo laser. There was a strong positive correlation in both groups in the improvement of the degree of pain and self-perception of OHQOL. American Academy of Orofacial Pain (AAOP) como uma s\u00e9rie de condi\u00e7\u00f5es cl\u00ednicas envolvendo os m\u00fasculos mastigat\u00f3rios, a articula\u00e7\u00e3o temporomandibular (ATM) e as estruturas do sistema estomatogn\u00e1tico associadas.A Disfun\u00e7\u00e3o Temporomandibular (DTM) \u00e9 conceituada pela . Por isso, a DTM \u00e9 considerada a maior causa de dor n\u00e3o dent\u00e1ria na regi\u00e3o orofacial. A dor pode ser manifestada na regi\u00e3o da ATM, face, cabe\u00e7a, pesco\u00e7o e ouvidos; durante a abertura e fechamento da mand\u00edbula; al\u00e9m de haver limita\u00e7\u00e3o nos movimentos mandibulares, ru\u00eddos articulares e dificuldades na fala, mastiga\u00e7\u00e3o e degluti\u00e7\u00e3o. Al\u00e9m disso, \u00e9 comum haver relatos do aumento da dor/desconforto durante as atividades destas fun\u00e7\u00f5es.\u00c9 evidenciada por diferentes sinais e sintomas, sendo a dor a principal caracter\u00edstica referida pelos sujeitos acometidos por essa afec\u00e7\u00e3o e em algumas vezes o maior motivo para se buscar tratamento. Sendo assim, ocorre repercuss\u00e3o na qualidade de vida (QV) dessas pessoas de forma danosa e, sobretudo, na qualidade de vida relacionada com a sa\u00fade oral (QVRSO) com maior comprometimento a depender da gravidade da DTM.Logo, h\u00e1 influ\u00eancia direta e negativa destes problemas sob a sa\u00fade f\u00edsica e mental dos pacientes, afetando suas atividades escolares, profissionais e sociais; levando at\u00e9 mesmo a um desequil\u00edbrio afetivo e cognitivo.Esse fato refor\u00e7a o saber de que o atendimento de indiv\u00edduos com DTM demanda um olhar cl\u00ednico ampliado por envolver diversos aspectos e, em especial a QV, pois est\u00e1 associada \u00e0 percep\u00e7\u00e3o subjetiva que os mesmos t\u00eam sobre sua posi\u00e7\u00e3o de vida; no contexto de valores e cultura nos quais eles vivem e em rela\u00e7\u00e3o a seus objetivos, expectativas e preocupa\u00e7\u00f5es \u2013 o que torna a investiga\u00e7\u00e3o do grau de comprometimento da QV muito importante para os profissionais de sa\u00fade que os tratam.Por\u00e9m, em muitos casos, al\u00e9m da percep\u00e7\u00e3o e os sentimentos de pacientes em rela\u00e7\u00e3o \u00e0 sa\u00fade oral serem ignorados, na literatura h\u00e1 poucos estudos que analisam o impacto das condi\u00e7\u00f5es dolorosas da DTM sobre a QV, quando comparados ao n\u00famero de publica\u00e7\u00f5es sobre diagn\u00f3stico, sinais e sintomas da DTM. Dentre elas, se destaca a atua\u00e7\u00e3o do fonoaudi\u00f3logo na \u00e1rea de motricidade orofacial, por meio da Terapia Miofuncional Orofacial (TMO). Esta tem por finalidade promover estabilidade miofuncional orofacial, ao modificar os padr\u00f5es musculares e funcionais, permitindo a redu\u00e7\u00e3o da dor; adequa\u00e7\u00e3o da amplitude de movimentos mandibulares; e consequentemente a readequa\u00e7\u00e3o das fun\u00e7\u00f5es de respira\u00e7\u00e3o, mastiga\u00e7\u00e3o, degluti\u00e7\u00e3o e fala.Diante desse contexto, s\u00e3o propostas diversas abordagens terap\u00eauticas para os quadros cl\u00ednicos de DTM que visam amenizar e tratar tais consequ\u00eancias, al\u00e9m de trazer mais conforto ao paciente,14.O uso do Laser de Baixa Intensidade (LBI) ou Fotobiomodula\u00e7\u00e3o nas DTMs tamb\u00e9m tem sido descrito e discutido nas pesquisas cient\u00edficas, por se caracterizar como uma interven\u00e7\u00e3o n\u00e3o farmac\u00eautica, n\u00e3o invasiva, r\u00e1pida e segura ao paciente devido a rea\u00e7\u00f5es favor\u00e1veis nas dores miog\u00eanicas e articulares, sob os efeitos analg\u00e9sicos, anti-inflamat\u00f3rio e biomodulador das fun\u00e7\u00f5es fisiol\u00f3gicas celulares; aumento da amplitude de abertura bucal; nos sinais e sintomas e recupera\u00e7\u00e3o funcional. No entanto, alguns estudos de meta-an\u00e1lises,18 demonstraram que os grupos com laser ativo tiveram redu\u00e7\u00e3o da dor semelhantes aos de grupos placebos, embora o primeiro apresentado resultados melhores no quadro funcional dos indiv\u00edduos.Autores apontam que estes efeitos se caracterizam como positivos na redu\u00e7\u00e3o da dor refor\u00e7am ainda que combina\u00e7\u00f5es de tratamentos para controle \u00e1lgico e treino das fun\u00e7\u00f5es motoras orofaciais s\u00e3o sugestivas e favor\u00e1veis na reabilita\u00e7\u00e3o das DTMs. Sendo assim, o objetivo deste estudo \u00e9 analisar o impacto na qualidade de vida relacionada \u00e0 sa\u00fade oral de indiv\u00edduos com disfun\u00e7\u00e3o temporomandibular, antes e ap\u00f3s o tratamento de fotobiomodula\u00e7\u00e3o associada a terapia miofuncional orofacial, bem como verificar poss\u00edvel correla\u00e7\u00e3o entre o grau de dor orofacial e a autopercep\u00e7\u00e3o desse impacto.PesquisadoresTrata-se de um estudo de interven\u00e7\u00e3o terap\u00eautica, longitudinal e do tipo ensaio cl\u00ednico randomizado, controlado e cego. Foi aprovado pelo Comit\u00ea de \u00c9tica e Pesquisa do Centro de Ci\u00eancias da Sa\u00fade da Universidade Federal da Para\u00edba, sob o parecer de n\u00famero 3.354.075, conforme os princ\u00edpios \u00e9ticos da Resolu\u00e7\u00e3o do Conselho Nacional de Sa\u00fade \u2013 CNS de n\u00ba 466/2012.A pesquisa foi realizada na Cl\u00ednica Escola de Fonoaudiologia da UFPB, envolvendo participantes de ambos os sexos e a amostra foi constitu\u00edda pelo total de 34 volunt\u00e1rios que buscaram os servi\u00e7os de Fonoaudiologia por livre demanda.Research Diagnostic Criteria for Temporomandibular Disorders \u2013 RDC/TMD \u2013 Eixo I; os que tivessem disponibilidade de hor\u00e1rio para a realiza\u00e7\u00e3o do tratamento e que concordassem participar do estudo assinando o Termo de Consentimento Livre e Esclarecido (TCLE). Foram exclu\u00eddos aqueles que referissem hist\u00f3rico de comprometimento neurol\u00f3gico; malforma\u00e7\u00f5es, tumores, traumas ou cirurgias na regi\u00e3o da face e pesco\u00e7o; uso de pr\u00f3tese dent\u00e1ria ou aparelho ortod\u00f4ntico; os que j\u00e1 tivessem realizado ou que estivessem em terapia fonoaudiol\u00f3gica; como tamb\u00e9m os que fizessem uso de medica\u00e7\u00e3o miorrelaxante e/ou anti-inflamat\u00f3ria ou que tenham o feito por mais de um ano.Por meio da realiza\u00e7\u00e3o de triagens, foram considerados como crit\u00e9rios de elegibilidade a idade entre 18 e 59 anos; os sujeitos que apresentassem dor orofacial caracterizada como DTM Muscular, de acordo com a aplica\u00e7\u00e3o do protocolo Al\u00e9m destes fatores, tamb\u00e9m foram considerados os crit\u00e9rios que contraindicam a realiza\u00e7\u00e3o da fotobiomodula\u00e7\u00e3o: pacientes gestantes; com fotos sensibilidade; com glaucoma; que tivessem marcapasso ou outro implante eletr\u00f4nico e/ou tecido infeccionado pr\u00f3ximo ao local da irradia\u00e7\u00e3o.A coleta dos dados da pesquisa foi precedida pela randomiza\u00e7\u00e3o dos participantes de modo simples em grupos, por meio de sorteio. Esta distribui\u00e7\u00e3o aleat\u00f3ria foi destinada aos grupos: G1 \u2013 Grupo Experimental que recebeu o tratamento de Terapia Miofuncional Orofacial (TMO) associada a fotobiomodula\u00e7\u00e3o; e o G2 \u2013 Grupo Controle Positivo, que recebeu a TMO associada ao laser inativo (placebo).Oral Health Impact Profile \u2013 Short form (OHIP-14) e tamb\u00e9m do grau da dor orofacial por meio da Escala Visual Anal\u00f3gica (EVA).Os integrantes do estudo passaram por uma avalia\u00e7\u00e3o antes e ap\u00f3s o per\u00edodo de interven\u00e7\u00e3o terap\u00eautica, realizando os seguintes procedimentos: Avalia\u00e7\u00e3o do impacto da qualidade de vida relacionada \u00e0 sa\u00fade oral (QVRSO) pelo question\u00e1rio Oral Health Impact Profile \u2013 Short form (OHIP-14) \u2013 desenvolvido por Slade (1997), em sua forma j\u00e1 traduzida e validada para o portugu\u00eas do Brasil. Foi aplicado em forma de entrevista, levando em conta a percep\u00e7\u00e3o subjetiva do paciente sobre o seu problema nos \u00faltimos seis meses.A qualidade de vida relacionada com a sa\u00fade oral foi analisada por meio do question\u00e1rio , estas s\u00e3o graduadas, respectivamente, como zero, um, dois, tr\u00eas e quatro pontos. A pontua\u00e7\u00e3o de cada um dos dom\u00ednios pode variar de 0 a 8 pontos, com maiores escores significando maior comprometimento. J\u00e1 para um escore total do OHIP-14, as respostas ordinais somadas podem variar de 0 a 56 pontos \u2013 significando maior impacto negativo na sa\u00fade oral.O instrumento possui 14 perguntas, sendo duas para cada um dos seus sete dom\u00ednios . Para cada quest\u00e3o, h\u00e1 cinco op\u00e7\u00f5es de respostas: nunca, raramente, \u00e0s vezes, repetidamente e sempre. Conforme o m\u00e9todo de adi\u00e7\u00e3oA EVA foi aplicada considerando uma linha n\u00e3o numerada de 10 cm. A extremidade do lado esquerdo significava afirmar \u201cnenhuma dor\u201d e a do lado direito a \u201cpior dor poss\u00edvel\u201d, ou seja, quanto mais essa marca\u00e7\u00e3o fosse pr\u00f3xima da extremidade esquerda, melhor seria a classifica\u00e7\u00e3o para o grau de dor e quanto mais perto da direita, pior seria esta classifica\u00e7\u00e3o.Os volunt\u00e1rios foram informados sobre o preenchimento da escala, e em seguida fizeram a autoan\u00e1lise da dor espont\u00e2nea, marcando um ponto na linha onde melhor representava o grau de sua dor no momento da avalia\u00e7\u00e3o. Para a an\u00e1lise do resultado, o avaliador usava uma r\u00e9gua sob a linha para identificar a numera\u00e7\u00e3o apontada entre 0 e 10 e transcrevia este resultado para a ficha de evolu\u00e7\u00e3o cl\u00ednica do paciente.A interven\u00e7\u00e3o consistiu em encontros semanais, com um total de 13 sess\u00f5es. Uma destinada para a avalia\u00e7\u00e3o e aplica\u00e7\u00e3o dos instrumentos citados; uma exclusiva para orienta\u00e7\u00f5es relacionadas a esclarecimentos das condi\u00e7\u00f5es cl\u00ednicas, h\u00e1bitos prejudiciais que desencadeiam as dores e instru\u00e7\u00f5es de como estas podiam ser aliviadas em casa; 10 sess\u00f5es para a terapia propriamente dita e uma outra espec\u00edfica para a reavalia\u00e7\u00e3o. Cada atendimento de fonoterapia teve dura\u00e7\u00e3o total de 45 minutos, sendo 30 minutos destinada \u00e0 TMO, bem como 15 e 12 minutos na 1\u00aa e 2\u00aa fase, respectivamente, para a aplica\u00e7\u00e3o do LBI. A equipe foi formada por 4 pesquisadores calibrados, com forma\u00e7\u00e3o em Fotobiomodula\u00e7\u00e3o, e com experi\u00eancia de 3 anos atuando nos procedimentos necess\u00e1rios. para a fonoterapia foi o mesmo para os dois grupos, compreendendo o uso de estrat\u00e9gias como a termoterapia e massoterapia com massagens lentas e profundas para favorecer a circula\u00e7\u00e3o sangu\u00ednea local e aliviar a dor; mioterapia \u2013 constituindo de exerc\u00edcios isom\u00e9tricos e isot\u00f4nicos para grupos musculares espec\u00edficos , visando a melhora da flexibilidade, coordena\u00e7\u00e3o, simetria e estabiliza\u00e7\u00e3o dos movimentos funcionais das ATMs; e tamb\u00e9m realizado o treino com as fun\u00e7\u00f5es orofaciais, ou seja, utilizando a fun\u00e7\u00e3o de mastiga\u00e7\u00e3o como exerc\u00edcio e treino.O protocolo da TMOA LBI ativa correspondeu \u00e0 aplica\u00e7\u00e3o bilateral do laser de baixa intensidade de Arsenieto de G\u00e1lio-Alum\u00ednio , equipamento Laser Pulse Line da marca IBRAMED. O protocolo adotado \u2013 elaborado a partir das discuss\u00f5es no N\u00facleo de Estudos em Linguagem e Fun\u00e7\u00f5es Estomatogn\u00e1ticas NELF, consistiu no modo de aplica\u00e7\u00e3o pontual, em cinco locais na regi\u00e3o da ATM: polo lateral; pontos superior, anterior, posterior e inferior da posi\u00e7\u00e3o condilar; e nos locais dolorosos dos m\u00fasculos masseter, temporal, esternocleidomast\u00f3ideo e trap\u00e9zio, relatados pelos indiv\u00edduos.2, com a finalidade de analgesia do quadro doloroso e a segunda (a partir da 6\u00aa sess\u00e3o) com a dosimetria de 4J e flu\u00eancia de 34 J/cm2, para bioestimular os ganhos funcionais promovidos pela terapia fonoaudiol\u00f3gica. J\u00e1 a LBI inativa ocorreu de forma simulada proporcionando o efeito placebo.Com comprimento de onda de 830 nm (infravermelho) e irradia\u00e7\u00e3o com dois objetivos distintos em fases: a primeira (1\u00aa \u00e0 5\u00aa sess\u00e3o) com dosimetria de 6J e flu\u00eancia de 51 J/cmMicrosoft Excel 2013 para serem gerenciados. Realizou-se an\u00e1lise estat\u00edstica tanto descritiva como inferencial utilizando o software Statistical Package for the Social Sciences (SPSS) for Windows, vers\u00e3o 21.0. Na descritiva, das vari\u00e1veis qualitativas, foram aplicadas as frequ\u00eancias absoluta e relativa ; e para as vari\u00e1veis quantitativas, usada a m\u00e9dia e mediana como medidas de tend\u00eancia central, bem como desvio padr\u00e3o e os quartis 25 e 75 como medidas de variabilidade.Os dados obtidos foram tabulados e armazenados em planilha do . Neste estudo foi adotado o n\u00edvel de signific\u00e2ncia de 0,05 (95%).J\u00e1 na inferencial, para analisar a rela\u00e7\u00e3o intragrupo das vari\u00e1veis quantitativas e qualitativas, utilizou-se o teste de Wilcoxon e, para a rela\u00e7\u00e3o entre os grupos, o teste de Mann-Whitney. Para verificar a correla\u00e7\u00e3o entre os dados quantitativos, foi aplicado o teste de Correla\u00e7\u00e3o de Spearman, o qual obt\u00e9m resultados em percentual e pode-se ter valores positivos e negativos. O grau de correla\u00e7\u00e3o foi considerado fraco quando o valor resultou at\u00e9 0,3; moderado entre 0,3 e 0,7 e forte quando encontrado valor acima de 0,7No presente estudo, foram avaliados e tratados 34 indiv\u00edduos com diagn\u00f3stico de DTM muscular, sendo no G1 16  do sexo feminino e 3  do sexo masculino, com m\u00e9dia de idade de 32,16\u00b18,60 anos. J\u00e1 no G2, 11  do sexo feminino e 4  do sexo masculino, com m\u00e9dia de idade de 34,67\u00b113,05 anos. A caracteriza\u00e7\u00e3o da amostra de acordo com a percep\u00e7\u00e3o subjetiva da qualidade de vida relacionada com a sa\u00fade oral pr\u00e9 e p\u00f3s tratamento, para cada quest\u00e3o do OHIP-14, est\u00e1 demonstrada na Observa-se que a \u201cdor f\u00edsica\u201d, \u201cdesconforto psicol\u00f3gico\u201d, \u201climita\u00e7\u00e3o f\u00edsica\u201d e \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d foram os aspectos do question\u00e1rio mais relatados pelas suas quest\u00f5es correspondentes antes dos participantes se submeterem ao tratamento.A \u201cdor f\u00edsica\u201d e \u201cdesconforto psicol\u00f3gico\u201d foram os dom\u00ednios mais frequentemente referidos pelos volunt\u00e1rios tanto em G1 quanto em G2. Na \u201cdor f\u00edsica\u201d, em rela\u00e7\u00e3o ao inc\u00f4modo em comer algum alimento por causa da DTM e em quanto ao \u201cdesconforto psicol\u00f3gico\u201d, para a sensa\u00e7\u00e3o de preocupa\u00e7\u00e3o. No que se refere \u00e0 \u201climita\u00e7\u00e3o f\u00edsica\u201d, o G1 foi quem apresentou a frequ\u00eancia de sempre ter preju\u00edzos na alimenta\u00e7\u00e3o, assim como no quesito \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d \u2013 com maior frequ\u00eancia em ter encontrado dificuldade para relaxar em decorr\u00eancia da DTM.No per\u00edodo p\u00f3s-tratamento, foi percebida melhora das respostas para todas as perguntas em ambos os grupos. Por\u00e9m, \u201climita\u00e7\u00e3o funcional\u201d e \u201cincapacidade\u201d foram os aspectos da qualidade vida relacionados com a sa\u00fade oral mais frequentemente respondidos como nunca afetados por influ\u00eancia da DTM.Em \u201climita\u00e7\u00e3o funcional\u201d, os sujeitos tanto em G1 quanto em G2 n\u00e3o mais tiveram problemas para falar alguma palavra; bem como n\u00e3o mais sentiram piora no sabor dos alimentos. Em \u201cincapacidade\u201d, os volunt\u00e1rios relataram n\u00e3o mais sentirem que a vida, em geral, piorou; da mesma maneira que n\u00e3o mais se sentiram impedidos de realizarem suas atividades di\u00e1rias.A Verifica-se que houve rela\u00e7\u00e3o da melhora tanto no grau da dor orofacial pela EVA, quanto para a QVRSO pelo escore total do OHIP-14 em ambos os grupos. A maioria dos respectivos dom\u00ednios do question\u00e1rio especificaram esses resultados, com exce\u00e7\u00e3o dos dom\u00ednios \u201climita\u00e7\u00e3o funcional\u201d e \u201climita\u00e7\u00e3o social\u201d entre o G1 e dos dom\u00ednios \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d e \u201climita\u00e7\u00e3o social\u201d entre o G2.J\u00e1 na Na N\u00e3o houve correla\u00e7\u00e3o entre EVA e escore total do OHIP-14 antes da interven\u00e7\u00e3o, como tamb\u00e9m entre idade e EVA; idade e escore total do OHIP-14 no pr\u00e9 e p\u00f3s tratamento.. Por isto, v\u00ea-se a import\u00e2ncia de os profissionais conhecerem e compreenderem as condi\u00e7\u00f5es de sa\u00fade e doen\u00e7a oral/orofacial \u2013 considerando os efeitos nocivos das repercuss\u00f5es nesta regi\u00e3o para o bem-estar global de uma pessoa.A sa\u00fade oral integra e \u00e9 essencial para a qualidade de vida dos seres humanos. Esta rela\u00e7\u00e3o se configura sob variadas formas envolvendo os aspectos f\u00edsico, social e psicol\u00f3gico. Em especial, a dor orofacial, que tem sido mais marcante para os indiv\u00edduos do que outras condi\u00e7\u00f5es sist\u00eamicas \u2013 como a diabetes, hipertens\u00e3o e \u00falcera. Nesta pesquisa, os itens \u201cdor f\u00edsica\u201d, \u201cdesconforto psicol\u00f3gico\u201d, \u201climita\u00e7\u00e3o f\u00edsica\u201d e \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d do OHIP-14 foram os mais sempre referidos pelos participantes antes de serem tratados.A ocorr\u00eancia de dor e desconforto costuma ser considerada como um dos fatores positivos e negativos mais relevantes para a qualidade de vida, ao avaliarem a influ\u00eancia da DTM na percep\u00e7\u00e3o subjetiva da QVRSO aplicando o OHIP-14, verificaram que os aspectos \u201cdor f\u00edsica\u201d, \u201cdesconforto psicol\u00f3gico\u201d e \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d tamb\u00e9m foram os mais frequentemente apontados pela amostra investigada.Este resultado foi semelhante a um publicado na literatura. Rodrigues e colaboradores, os pesquisadores encontraram associa\u00e7\u00e3o entre dor e qualidade de vida em 5 dos 7 dom\u00ednios do mesmo protocolo: \u201cdesconforto psicol\u00f3gico\u201d, \u201climita\u00e7\u00e3o f\u00edsica\u201d, \u201climita\u00e7\u00e3o psicol\u00f3gica\u201d, \u201climita\u00e7\u00e3o social\u201d e em \u201cincapacidade\u201d. Dessa forma, tais dados evidenciam a notoriedade de sintomatologia dolorosa, inc\u00f4modo e restri\u00e7\u00f5es que esses pacientes possuem e convivem em suas atividades cotidianas na aus\u00eancia de cuidados terap\u00eauticos.E, em um outro estudo mais recenteCom este estudo, foi poss\u00edvel constatar que ap\u00f3s o tratamento houve correla\u00e7\u00e3o positiva e forte de melhora para o grau da dor e autopercep\u00e7\u00e3o da QVRSO tanto em G1 quanto em G2; bem como rela\u00e7\u00e3o destes mesmos aspectos entre os sujeitos de cada grupo. Isto demonstrou que os indiv\u00edduos tratados com a TMO associada ao laser ativo apresentaram respostas positivas igualmente aos que receberam a interven\u00e7\u00e3o sem o laser, al\u00e9m de indicar tamb\u00e9m que quanto menor o grau da dor, menor foi o impacto percebido na QVRSO., que tamb\u00e9m acompanhou e avaliou o grau da dor pela EVA e a amplitude oral em pessoas portadoras da mesma disfun\u00e7\u00e3o que a deste estudo, tratando-as com TMO e fotobiomodula\u00e7\u00e3o \u2013 e sob os mesmos par\u00e2metros de dosimetria ao aplicar o laser de baixa intensidade. Houve igual percep\u00e7\u00e3o de melhora tanto nas pessoas tratadas com TMO e o laser ativo, quanto nas que receberam a TMO e o laser placebo.Quanto \u00e0 redu\u00e7\u00e3o da percep\u00e7\u00e3o da dor nos dois grupos ao fim do tratamento, foi vista concord\u00e2ncia com uma pesquisa atual, tipo de radia\u00e7\u00e3o aplicada, tecido que est\u00e1 sendo irradiado, como tamb\u00e9m as condi\u00e7\u00f5es imunol\u00f3gicas s\u00e3o poss\u00edveis aspectos que podem influenciar no feedback do paciente que possui DTM frente \u00e0 fotobiomodula\u00e7\u00e3o como tratamento. Logo, tais fatores podem explicar as repercuss\u00f5es do uso desse tratamento na amostra do presente trabalho, bem como na pesquisa recente citada acima, visto que os pacientes \u2013 em ambos estudos \u2013 que n\u00e3o foram submetidos \u00e0 fotobiomodula\u00e7\u00e3o tamb\u00e9m apresentaram diminui\u00e7\u00e3o da sintomatologia dolorosa e melhora da QVRSO.Fatores como estresse, tempo de progress\u00e3o da doen\u00e7a, perda severa da dimens\u00e3o vertical na ATM.N\u00e3o foram encontradas publica\u00e7\u00f5es que discutissem a rela\u00e7\u00e3o da autopercep\u00e7\u00e3o da dor orofacial e qualidade de vida em pacientes com DTM submetidos a ambos tratamentos mencionados \u2013 o que torna este trabalho importante para comunidade cient\u00edfica e de conhecimento aos profissionais que atendem esta popula\u00e7\u00e3o. Contudo, o fato de os participantes deste estudo terem sentido al\u00edvio da dor e, proporcionalmente, o restabelecimento da qualidade de vida, ratifica que ambos s\u00e3o diretamente relacionados, uma vez que os mesmos geram efeitos n\u00e3o s\u00f3 ao corpo, mas tamb\u00e9m ao estado psicol\u00f3gico e conviv\u00eancia social\u2013 o que p\u00f4de ser, especialmente, conferido tamb\u00e9m na presente pesquisa, como visto na A terapia miofuncional orofacial demonstrou ter sido o tratamento mais influente para os achados acima referidos. Ela tem por finalidade a recupera\u00e7\u00e3o funcional do sistema estomatogn\u00e1tico, de modo que as fun\u00e7\u00f5es de mastigar, deglutir e falar possam ser realizadas sem dor e limita\u00e7\u00f5es ou risco de agravar o problema, bem como em outra pesquisa que identificou maior redu\u00e7\u00e3o de dificuldade para mastigar nos sujeitos tratados com exerc\u00edcios miofuncionais orofaciais associados ao laser placebo.Portanto, merece destaque o achado de que estes sujeitos pertenciam ao grupo que recebeu o tratamento com laser placebo. A percep\u00e7\u00e3o de 100% de melhora funcional para falar alguma palavra e sentir o sabor dos alimentos pode ter tido influ\u00eancia deste efeito. Resultados positivos no quadro funcional dos indiv\u00edduos, como na mobilidade mandibular, tamb\u00e9m j\u00e1 foram vistos. A expectativa do paciente, um bom relacionamento entre paciente-terapeuta, associados com a sensa\u00e7\u00e3o de estar recebendo um tratamento mais completo pela presen\u00e7a tecnol\u00f3gica do laser podem justificar essa possibilidade.Estas evid\u00eancias existem porque a resposta ao placebo \u00e9 um evento neurobiol\u00f3gico \u2013 cuja atividade em \u00e1reas corticais tem sido associada com a inibi\u00e7\u00e3o da dor e centro afetivo e cognitivo. Demonstrando resultados mais expressivos quando as sess\u00f5es mantiveram a dose (3J), diferente do crit\u00e9rio utilizado nesta pesquisa que variou as doses com 6J da 1\u00aa a 5\u00aa sess\u00e3o, com a finalidade de analgesia do quadro doloroso, e a partir da 6\u00aa sess\u00e3o com a dose de 4J, para bioestimular os ganhos funcionais promovidos pela terapia fonoaudiol\u00f3gica.Diferente dos achados neste estudo, uma pesquisa realizada com 11 mulheres com DTM muscular, dividida em dois grupos, um experimental (GE) submetidas \u00e0 TMO associada \u00e0 fotobiomodula\u00e7\u00e3o, e outro Controle Positivo (GC), submetidas \u00e0 TMO associada \u00e0 fotobimodula\u00e7\u00e3o inativa (placebo), com a interven\u00e7\u00e3o sendo realizada tamb\u00e9m em 10 sess\u00f5es, com comprimento de onda 830 nm, fornecendo a dose pontual de 3J. O GE teve aumento nas medidas dos movimentos de abertura e de protrus\u00e3o mandibular, e evidenciou melhora na avalia\u00e7\u00e3o da QV, sua efic\u00e1cia cl\u00ednica apresenta-se em diferentes par\u00e2metros, doses e crit\u00e9rios metodol\u00f3gicos nos estudos. Dessa forma, os efeitos da fotobiomodula\u00e7\u00e3o na otimiza\u00e7\u00e3o da terapia fonoaudiol\u00f3gica ainda precisam ser mais evidenciados.Isto trouxe a reflex\u00e3o de que apesar do laser de baixa pot\u00eancia propor diversos mecanismos de a\u00e7\u00e3o no organismo e ser referido positivamente nas interven\u00e7\u00f5es com tratamentos associados de pacientes com DTMDiante do exposto, a realiza\u00e7\u00e3o dessa pesquisa permitiu fortalecer o trabalho desempenhado pelo fonoaudi\u00f3logo no acompanhamento de pacientes com DTM atrav\u00e9s da Terapia Miofuncional Orofacial, uma vez que ela \u00e9 de compet\u00eancia desse profissional e considerada a refer\u00eancia na \u00e1rea de Motricidade Orofacial. Por\u00e9m, algumas limita\u00e7\u00f5es neste estudo foram identificadas, como n\u00famero amostral pequeno e a diferen\u00e7a do n\u00famero de participantes entre os grupos \u2013 o que pode ter favorecido para que a hip\u00f3tese da pesquisa n\u00e3o tenha sido respondida, que pessoas com disfun\u00e7\u00e3o temporomandibular muscular submetidas a fotobiomodula\u00e7\u00e3o associada a TMO teriam mais ganhos na qualidade de vida do que as mulheres com as mesmas caracter\u00edsticas submetidas s\u00f3 a TMO.Sendo assim, sugere-se a continuidade das discuss\u00f5es cient\u00edficas com o uso desse recurso no campo da fonoaudiologia, explorando as an\u00e1lises com amostras maiores para que se obtenha evid\u00eancias cient\u00edficas e consolida\u00e7\u00e3o do conhecimento acerca dos efeitos da fotobiomodula\u00e7\u00e3o na qualidade de vida em pessoas com DTM.As pessoas com disfun\u00e7\u00e3o temporomandibular que receberam o tratamento de fotobiomodula\u00e7\u00e3o associada a terapia miofuncional orofacial perceberam melhora da qualidade de vida relacionada \u00e0 sa\u00fade oral, assim como as tratadas com o laser placebo. Houve correla\u00e7\u00e3o positiva e forte em ambos os grupos na melhora do grau da dor e autopercep\u00e7\u00e3o da QVRSO."}
+{"text": "To elaborate and validate a multiprofessional protocol to identify the risk of dysphagia in people with HIV at the time of hospitalization.After bibliographic review, the dysphagia screening protocol created was submitted to the analysis of HIV/ Aids expert judges and target audience in the application of this instrument to perform content validity. These evaluators could suggest changes to the protocol, judging clarity, pertinence, and comprehensiveness. The CVI 0.78 was used to confirm the validity of the results.The protocol was created including aspects related to oral and pharyngeal swallowing, and the final score was calculated based on the risks for clinical complications. The instrument presented CVI above 0.78 for all items in the two validation phases, as well as total CVI of 0.92.Based on the obtained data, it was possible to create and validate the screening protocol from the point of view of appearance and content, once it presented total CVI above the minimum value stipulated in the validation of the expert judges and the target public, obtaining an adequate result for the protocol. Therefore, we can consider the resolution instrument, with the capacity to fulfill what was proposed. According to the epidemiological bulletin, more than 650 thousand cases of AIDS in the first 30 years were reported in the SINAN  and can cause cognitive function disorders, leading to deficits in processes such as attention and memory, and dementia and motor symptoms.Virus infection results in a wide range of clinical manifestations, ranging from asymptomatic individuals to symptoms such as weakness, fever, weight loss, and prolonged diarrhea, candidiasis, neurotoxoplasmosis, among others. Because of these symptoms, we can infer that this individual can present from speech articulation disorders due to injuries to swallowing difficulties (dysphagia).Manifestations in the oropharyngeal region, with candidiasis as the most common cause, may present symptoms such as oral pain, bitter or sour taste in the mouth, or even esophagitis with odynophagia . Dysphagia is a disorder during this process, defined as a symptom, in which the change in swallowing is due to some underlying disease.Swallowing is a neuromuscular activity that transports food from the oral cavity to the stomach, involving the coordination of structures that participate in both swallowing and breathing, not allowing substances to enter the airwaysAlthough the swallowing phases are didactically divided into oral, pharyngeal, and esophageal phases, swallowing is a continuous process. Therefore, any commitment in just one of these phases can influence the others, leading to losses in the entire process.. Consequently, the functional performance of structures related to swallowing is affected, as swallowing is a function performed by effort. In addition to this hypotony, the oral microbiota of HIV-positive patients is different (they show an increase in yeasts of various species) from the oral microbiota of immunocompetent individuals. When associated with the patient's low immunity, it leads to the appearance of oral manifestations, which are closely related to significant impairments in the oral phase of swallowing.As HIV infection progresses in infected individuals, there may be a gradual reduction in lean body mass, which is associated with a reduction in the capacity of the musculoskeletal system to generate strength. These damages related to the oral phase of swallowing influence not only the ejection of the bolus but also the sequentially of the process. When there is esophageal involvement, this incidence rises to 59 to 79% of patients.In a literature review, we found a study that reports dysphagia symptoms in 47% of AIDS patientsMultiprofessional care is essential for individuals with dysphagia, considering that its consequences involve clinical aspects, in addition to possible impacts on the quality of life and on the social aspects of eating, leading to the individual's retraction and isolation.In the swallowing assessment, we need to know how some diseases, manifested in the individual with HIV, influence the swallowing function and its phases. The elaboration of protocols that guide the action of the multidisciplinary team aims to guarantee the quality of the service offered, defining the actions to be taken.. Early identification of the difficulty and early referral to the Speech-Language Pathologist aim to avoid episodes of bronchoaspiration and, consequently, reduce the length of hospital stay and the risks of infection, promoting a reduction in the costs of the health system and providing a better quality of life for these patients.In a previous study, there was a reduction in the incidence of aspiration pneumonia in hospitalized patients, based on the application of a formal dysphagia assessment protocolThis study aimed to create a multidisciplinary protocol to identify the risk of dysphagia in people living with HIV at the time of hospitalization. Also, it aimed to validate the protocol, with experts in the care of people living with HIV and with the multidisciplinary team, with ways to validate the agreement of the target audience.This is a descriptive study, with a quantitative approach, which aims to create a product and its validation to make it reliable and valid for its intended purpose.The instrument created in this study consists of a questionnaire validated and applied by several health professionals, specifically in patients diagnosed with HIV, aged at least 18 years old at the time of their hospitalization.The study was divided into two stages: the creation of the questionnaire and its content-based validation.The first stage included a literature review on the use of dysphagia screening protocols and questionnaire validation methods. This review allowed us to analyze the protocols already validated to adapt their questions and create a new specific protocol for people living with HIV.We performed advanced searches in the BVS and PUBMED databases. As for temporality, we included studies published between 1984 and 2015, using the descriptors \u201cacquired immunodeficiency syndrome\u201d, \u201cdeglutition disorders\u201d, \u201cprotocols\u201d, \u201ctriage\u201d and \u201cmass screening\u201d, as well as \u201cface validity\u201d, their combinations and their respective translations into Portuguese. Reviews and reference lists of all articles considered relevant were also consulted to include new articles. The search was performed using words found in titles, abstracts, and the body of the text.The authors of the work elaborated the protocol. They are researchers who have experience in dysphagia and experience with patients with HIV.At the end of this first stage, the protocol entitled: \u201cMultiprofessional Dysphagia Screening Protocol in HIV Patients\u201d (Appendix 1) was developed, which included aspects such as clinical risk criteria for oropharyngeal dysphagia and alterations in the oral and pharyngeal phase of swallowing.. It is important that this process is carried out by professionals from different areas and that they are experts in the theme of the study, valuing the different suggestions and opinions on the topic.In the second stage of the research, we used Face/Content Validation as it is a common method in the health areaFor this phase of content validation, the following guidelines were followed: choice of expert judges on the theme and their assessment of the individual items; the questionnaire as a whole and choice; and assessment of the target audience . All ratings were made using the Content Validity Index.. Therefore, for this study, we used seven judges from different areas of health, who met the following inclusion criteria: minimum master's course in their areas and at least three years of clinical experience in caring for patients with HIV.There is no consensus in the literature as to the ideal number of judges for the validation process, and the characteristics of the instrument should be taken into accountEach of these professionals invited to participate in the study received: an invitation letter with the objectives of the work, a screening protocol (Appendix 1), and a form for validation of appearance and content (Appendix 2). The protocol evaluation could be carried out in each evaluator's preferred location, with a period of fourteen days for returning the completed instrument.The chosen judges were instructed to evaluate each of the 16 items of the questionnaire created for the study following these criteria: clarity of the written language used, the relevance of the subject in question, and coverage of aspects related to the topic addressed. For all items evaluated, they could include suggestions. Data collection was carried out in the last semester of 2017.After evaluation and possible modification of the protocol by the experts, the material was judged by the target audience, that is, an evaluation regarding appearance, language, and applicability by professionals who will use this tool in individuals with HIV. It is an important moment for the study because we could verify the understanding of the population that will apply the protocol and analyze their suggestions. The appearance analysis stage aims to ascertain whether the material is understandable to the target population.. Among these professionals, different components of the health team were selected, aiming to ensure the multidisciplinary character of the developed protocol.We recommended choosing 30 to 40 people from the target population for evaluation in this stage of the studyThe sample of the target audience was given by convenience and consisted of 36 health professionals working in a university hospital, following some inclusion criteria: being 18 years old or older; having time available to participate voluntarily in the evaluation of the screening protocol, and having work or student relationship with the hospital under study.Again, we gave the following documents to everyone who agreed to participate in the research: a screening protocol (Appendix 1) and a form for validation of appearance and content (Appendix 2). We also requested to sign the Informed Consent Form - ICF.The audience approached was instructed to evaluate each of the 16 items of the multiprofessional dysphagia screening protocol with the same criteria of clarity of written language, relevance, and scope of the subject in question. The evaluation of the protocol was carried out in a place chosen by the participants, with a period of one day for returning the completed instrument.As well as the expert judges, we guided the target audience on how to fill out the questionnaire at different times, but it was done by the same individual, seeking to maintain equitable language and instruction, aiming to reduce possible distortions.. To calculate the CVI for each item of the questionnaire (CVI - I), the total number of judges who assigned a score of 3 or 4 on a four-point ordinal scale from \u201cirrelevant\u201d to \u201cextremely relevant\u201d divided by the total of judges who participated in the evaluation.The Content Validity Index \u2013 CVI is designed to assess the percentage of judges who agree on a given item. It is considered valid if, after analyzing the judges' answers, it obtains an approval rate above 78% (0.78).To assess the instrument (CVI \u2013 T), we used the average of the total number of items considered relevant by the judges, by the total number of items in the questionnaire. It was accepted for CVI approval \u2013 T above 90% (0.90)Assessments below these values, both for each item and the total value of the test, were reviewed and sent back to the same judges, aiming for all to reach the minimum reliability value.This stage is part of a broad instrument validation process. Thus, this phase covers the creation and acceptance of the questions used in the questionnaire by people who are experts on the theme and by health professionals who will apply the protocol in clinical practice. Only after this stage, we could use the instrument with individuals with HIV.This project was submitted and approved by the Research Ethics Committee of the Federal University of the State of Rio de Janeiro - UNIRIO on August 30, 2017, under opinion number 2,247,883.The ICF described all ethical aspects relevant to the research and participation in the study, which was signed after acceptance by the participants. Everyone was instructed about the privacy of the research data, guaranteeing that the information obtained could not be used for purposes other than those provided for in the project, and the possibility of refusing or interrupting their participation at any time, without any type of injury or penalty.-27 the authors' experience in formulating the division of items and scoring them.The study researchers developed the multi professional protocol for screening for dysphagia in HIV patients based on the content of articles in the literatureWe surveyed 21 articles, 3 in Portuguese and 18 in English. Sixteen of them had validated dysphagia assessment questionnaires, being only 11 with questions relevant to the study and 5 referring to validation methods. Based on these articles, we created the screening protocol considering aspects present in the dynamics of swallowing.. Therefore, all technical terms in the field of Speech-Language Pathology were replaced by synonyms that reached the meaning of the information.It was extremely important to transform the language of information located in scientific and specific literature into a language accessible to the target audienceThe texts were written using a simple and easy-to-read font style, Arial font size 10 for information and 12 for the title. Graphic elements were also used to communicate information visually, in such a way as to show a step-by-step screening capable of locating the main risk factors for dysphagia and referral to the trained professional, in addition to arrows highlighting key information during the application of the protocol.The screening protocol was divided into three parts:Patient profile: showing data such as identification of the individual, data from previous exams, time since diagnosis, use of antiretroviral medication, weight, complaints, past pathological history, and identification of the professional who is applying the questionnaire;Clinical risk criteria for dysphagia: indicating the presence of tracheostomy, need for oxygen support, difficulty in maintaining a level of alertness or adequate posture for eating, presence of lesions in the oral cavity, or complaints that represent a high risk for oropharyngeal dysphagia;Signs and symptoms: including 16 questions created for this study that may represent some difficulty in the oral and pharyngeal phase of swallowing, leading this individual to a greater risk of having dysphagia.It is important to emphasize that the completion of the protocol was interrupted when any item of clinical criteria was checked, as it places the individual at high risk for dysphagia, requiring early speech therapy assessment.The final form of the protocol was titled: \u201cMultiprofessional Protocol for the Screening of Dysphagia in HIV Patients\u201d and its first version was sent to the expert judges. For this analysis, we chose professionals from the areas of Speech-Language Therapy, Nursing, Nutrition, and Medicine who have agreed to participate in the research.We followed an ordinal scale for each question, consisting of: \u201cnot relevant\u201d (NR), \u201cnot very relevant\u201d (NVR), \u201cvery relevant\u201d (VR), and \u201chighly relevant\u201d (HR), which should be marked according to the criteria established above.In the first part of the validation, all judges returned the completed questionnaires within the deadline, which were analyzed quantitatively, observing the proportions of the agreement described in nd version of the protocol (Appendix 1) was sent to the expert judges so that they could judge the material, now modified, following the validation of appearance and content.After analysis and pertinent modifications, the 2After this second specific phase of validation by the judges, the quantitative analysis showed CVI \u2013 I above 0.78 for all modified items of the screening protocol. Thus, the protocol can be considered partially validated, since it obtained a CVI - T of 0.92, being able to start the third phase of validation, which consists of evaluating the target audience.The target audience for the evaluation of the protocol was composed of professionals from the area of Medicine and Nursing, and technicians, and university students from the courses, who worked in the first care of patients with the research profile, during their hospital admission. These professionals were instructed to complete the questionnaire following the same ordinal scale suggested above.After evaluating the target audience, we performed a new quantitative analysis of the questionnaire, evaluating the proportions of the agreement described in Thus, the protocol can be considered validated in its appearance and content, as it obtained a CVI \u2013 T of 0.92.From the articles selected for this study, we could create a multidisciplinary screening protocol, considering the main aspects related to the oral and pharyngeal phases of swallowing..The validation of this protocol took place through the analysis by expert judges in HIV/AIDS as well as by the target audience that will apply it. The construction of validated educational materials is important to standardize behavior in the patient care, and the participation of all professionals is essential because it allows the assessment of the agreement of expert judges and the target audience on each item of a questionnaire and on the instrument as a whole. This method is the beginning of a process that should encompass other types of validation and reliability.Face validation is a measure that assesses the degree to which respondents consider the construction and content of a test and its items as relevant to the context in which the instrument will be applied. This means of validation is considered an important phase in the adaptation of questionnaires. In the data analysis, the Content Validity Index was used.When there is agreement among most raters, it is considered a robust construction of the research protocol. In this process, the participants' suggestions regarding the replacement of terms and reformulation of information are analyzed, improving the materialThe experts for judging the instrument created in this study included professionals from the areas of Speech-Language Therapy, Nursing, Nutrition, and Medicine, with a minimum master's degree and at least three years of clinical experience in caring for patients with HIV. No official standard for the choice of judges was found in the literature.In the validation by expert judges, the results showed that 85.7% of the sample consisted of female individuals. Regarding the age group, influenced by the inclusion criteria of the study, an average of 44.1 years old and an SD of 11.67 was found.We chose experts from different areas of health given the multidisciplinary profile of the protocol, who work directly with the patient in clinical evaluations and therapy. All the invited professionals accepted to participate in the research. They were 3 speech-language therapists (42.8%), 2 nurses (28.6%), 1 physician (14.3%) and 1 nutritionist (14.3%). Regarding the length of academic training, most judges have up to 15 years (42.8%) of graduation.Due to the minimum degree used as an inclusion criterion, there is little percentage difference between participants with a master's degree (57.1%) and a doctorate (42.9%). In the field of work, most judges (85.7%) are dedicated both to teaching and clinical care. Regarding bibliographic production, 5 of the evaluators (71.4%) have articles published in journals.After a quantitative analysis of the judges' answers in the first phase, two items did not reach the CVI \u2013 I minimum of 0.78. They are: \u201c6 \u2013 Do you take a long time, or do you find it difficult to eat hard foods?\u201d (0.71) and \u201c16 \u2013 Does the food or drink go to the \u201cwrong place\u201d when you swallow?\u201d (0.71). The review of these items was carried out based on the qualitative analysis of the experts' suggestions.The item \u201cDo you take a long time, or do you find it difficult to eat hard foods?\u201d was modified according to the suggestion of one of the experts to replace the nomenclature used \u201chard foods\u201d with \u201csolids\u201d. We accepted the suggestion of another judge to use temporal words that indicate that the difficulty that the individual is experiencing is not before the disease but that it started to occur after his diagnosis.We accepted the suggestion to change the way of describing the difficulty of the item \u201cDoes the food or drink go to the \u201cwrong place\u201d when you swallow?\u201d, using then \u201cDo you choke often?\u201d, encompassing the frequency of this event occurs, so that it is considered a problem.In addition to these mandatory changes, a survey of all the suggestions presented was also carried out, although with CVI \u2013 I considered within the appropriate standard, enabling improvements in the protocol created, through the heterogeneity of experiences of the participating judges. Therefore, we changed the words to make the questions more comprehensive and clearer. The words were also added that make the questions more self-explanatory and that represent the temporality of the question.. This difficulty is also often found in objective assessments of patients with neurological disorders.We also highlight the analysis of item 4: \u201cIs it difficult to keep the food/liquid in the mouth? Does it escape or fall through the lips?\u201d, for which the 7 judges marked the option \u201chighly relevant\u201d. This can be explained because neurological changes enable a decrease in muscle tone, which consequently causes greater difficulty in oral control of the bolus and the possibility of delay in the pharyngeal sequence of swallowing, providing a greater chance of premature escape of this bolus, both anterior and posterior and, risk of bronchoaspirationAfter these changes, the protocol was again sent to the expert judges for the follow-up of appearance and content validation.In the quantitative analysis of the second phase of validation by the judges, with the modified protocol, a CVI \u2013 I above 0.78 was observed for all items, and a CVI \u2013 T of 0.92. Thus, it was possible to start the third phase of validation, with the assessment of the target audience..It is also important to note that the question \u201cDo you need to swallow several times to help the food go down from the throat?\u201d, during this second assessment, received the 7 \u201chighly relevant\u201d ratings. This can be justified due to the change in the way the question was rewritten, enabling greater accessibility of the vocabulary to the reality of the study population. We can be found in the specialized literature that the sensation of bolus in the throat is closely related to the difficulty of swallowing seen in objective exams, leading to a higher risk for oropharyngeal dysphagia.The next phase of validation is extremely important since the target audience of the research was composed of individuals who normally have the first contact with the patient and who, therefore, will be responsible for applying the instrument. This population must be able to understand the questions that the questionnaire includes, as well as to reproduce them for the study population. This is the time to analyze opinions and suggestions for the preparation of this material, and to verify how the material was understood by these people and identify what was not clearRegarding this target audience, the results showed that 86.1% of the sample consisted of female individuals. The age group average was 30.1 years old and had an SD of 7.17.We had the evaluation of 10 university students from the last periods of different courses in the health sciences (27.8%), 15 professionals with technical training (41.7%), and 7 physicians (19.4%), and 4 nurses (11.1%).After the quantitative analysis of this population, we observed that in the questions \u201c5 - Do you eat faster or slower than before the disease?\u201d, \u201c6 - Do you take a long time or find it difficult to eat solid foods after the disease?\u201d, \u201c7 - After you swallow, are there still food residues in your mouth?\u201d, \u201c8 - Do you feel that you have a lot of saliva in your mouth or drool frequently when you are awake?\u201d, \u201c9 - Do you feel pain when swallowing saliva, food, or liquids?\u201d, \u201c10 - Do you feel the food/liquid stuck in your throat?\u201d, \u201c12 - Did you start drinking liquids to help the food go down after the illness?\u201d, \u201c13 - Do you feel that your voice changes during or after the meal?\u201d and \u201c14 - Do you cough or clear your throat during a meal?\u201d at least 1 participant considered each of these questions to be of little relevance, but there was no need to change, as most evaluators classified the items as quite or highly relevant. are often symptoms found in individuals with feeding difficulties.Slow oral transit time, difficulty in handling food, residues in the oral cavity, saliva stasis, odynophagia, feeling of stagnant food, wet voice, and coughAfter the validation stage by the target audience, we observed through the quantitative analysis that there was no need to modify the questionnaire, due to CVI - I values above 0.78 for all items and CVI - T of 0.92. Thus, the protocol can be validated in its appearance and content, complying with its purpose.We need further validation stages to be able to use the instrument in clinical practice.The multiprofessional dysphagia screening protocol in patients with HIV infection is a screening tool, which aims to identify early risk for difficulty in swallowing and interdiction of a possible pulmonary complication.This protocol can be considered validated from the point of view of appearance and content since it presented a total CVI of 0.92 in the expert judges' validation and a total CVI of 0.96 from the validation by the target audience. Thus, we verified a protocol CVI of 0.94. Therefore, we can consider the resolution instrument capable of fulfilling its proposals.Because of the suggestions and contributions of all participants during the validation process, the protocol was changed in its language and structure, making it more comprehensive and qualified for its use in the day-to-day of people who work with these patients covered in the research.The protocol has been validated in its content and appearance. Other studies are needed to verify its use, including large-scale experimental applications with coverage of different professionals and institutions  so that the instrument can be used in clinical practice. .A S\u00edndrome da Imunodefici\u00eancia Adquirida (SIDA-Aids) teve seus primeiros casos registrados nos Estados Unidos, Haiti e \u00c1frica Central no final da d\u00e9cada de 1970, sendo uma infec\u00e7\u00e3o causada pelo v\u00edrus da imunodefici\u00eancia humana, HIV, que afeta as c\u00e9lulas do sistema imunol\u00f3gico.Desde a descoberta dos primeiros casos dessa infec\u00e7\u00e3o at\u00e9 o final dos anos 1990, estima-se, segundo a Organiza\u00e7\u00e3o Mundial de Sa\u00fade (OMS), que cerca de 29,4 milh\u00f5es de pessoas tenham sido infectadas pelo HIV. De acordo com o boletim epidemiol\u00f3gico, nos primeiros 30 anos foram notificados no SINAN (Sistema de Informa\u00e7\u00e3o de Agravos de Notifica\u00e7\u00e3o) mais de 650 mil casos em que a Aids se manifestou.No Brasil, os primeiros casos s\u00f3 foram identificados na d\u00e9cada de 80, sendo, somente em 1983, estruturado o primeiro programa de controle da Aids no pa\u00eds. Na evolu\u00e7\u00e3o da infec\u00e7\u00e3o pelo HIV, o v\u00edrus entra no sistema nervoso central (SNC) podendo causar transtornos da fun\u00e7\u00e3o cognitiva, levando a d\u00e9ficits em processos como aten\u00e7\u00e3o e mem\u00f3ria, al\u00e9m de dem\u00eancia e sintomas motores.A infec\u00e7\u00e3o pelo v\u00edrus resulta em ampla varia\u00e7\u00e3o de manifesta\u00e7\u00f5es cl\u00ednicas, podendo encontrar desde indiv\u00edduos assintom\u00e1ticos, at\u00e9 sintomas como fraqueza, febre, emagrecimento e diarreia prolongada, candid\u00edase, neurotoxoplasmose, entre outros. Como consequ\u00eancia desses sintomas, podemos inferir que esse indiv\u00edduo pode apresentar desde transtornos na articula\u00e7\u00e3o da fala, devido \u00e0s les\u00f5es, at\u00e9 dificuldades de degluti\u00e7\u00e3o (disfagia).As manifesta\u00e7\u00f5es em regi\u00e3o orofar\u00edngea, sendo a candid\u00edase a causa mais comum, podem apresentar sintomas como dor oral, gosto amargo ou azedo na boca ou at\u00e9 esofagite com odinofagia (dor ao deglutir). A disfagia \u00e9 um dist\u00farbio durante esse processo, sendo definida como um sintoma, em que a altera\u00e7\u00e3o da degluti\u00e7\u00e3o \u00e9 decorrente de alguma doen\u00e7a base.Deglutir \u00e9 atividade neuromuscular que transporta o alimento da cavidade oral para o est\u00f4mago, envolvendo a coordena\u00e7\u00e3o de estruturas que participam tanto da degluti\u00e7\u00e3o quanto da respira\u00e7\u00e3o, n\u00e3o permitindo a entrada de subst\u00e2ncias nas vias respirat\u00f3riasEmbora as fases da degluti\u00e7\u00e3o sejam divididas didaticamente em fase oral, far\u00edngea e esof\u00e1gica, deglutir \u00e9 um processo cont\u00ednuo; por isso, qualquer comprometimento em apenas uma dessas fases pode influenciar nas demais, levando ao preju\u00edzo em todo o processo.. Consequentemente, o desempenho funcional das estruturas relacionadas \u00e0 degluti\u00e7\u00e3o \u00e9 afetado, j\u00e1 que a degluti\u00e7\u00e3o \u00e9 uma fun\u00e7\u00e3o exercida por esfor\u00e7o. Al\u00e9m dessa hipotonia, a microbiota bucal de pacientes HIV positivos \u00e9 diferente (apresentam aumento de leveduras de v\u00e1rias esp\u00e9cies) da microbiota bucal dos indiv\u00edduos imunocompetentes, o que, associado \u00e0 baixa imunidade do paciente, leva ao aparecimento de manifesta\u00e7\u00f5es bucais, que est\u00e3o intimamente relacionadas a comprometimentos significativos na fase oral da degluti\u00e7\u00e3o.\u00c0 medida que a infec\u00e7\u00e3o pelo HIV progride em indiv\u00edduos contaminados, pode ocorrer redu\u00e7\u00e3o gradativa na massa corporal magra que, por sua vez, associa-se \u00e0 redu\u00e7\u00e3o da capacidade do sistema musculoesquel\u00e9tico em gerar for\u00e7a. Esses preju\u00edzos relacionados \u00e0 fase oral da degluti\u00e7\u00e3o influenciam n\u00e3o s\u00f3 na eje\u00e7\u00e3o do bolo alimentar, mas tamb\u00e9m na sequencialidade do processo. Quando existe acometimento esof\u00e1gico, essa incid\u00eancia sobe para 59 a 79% dos pacientes.Em revis\u00e3o bibliogr\u00e1fica \u00e9 poss\u00edvel encontrar um estudo que relata sintomas de disfagia em 47% dos pacientes com AidsO cuidado multiprofissional \u00e9 imprescind\u00edvel para indiv\u00edduos com disfagia, levando-se em considera\u00e7\u00e3o que as consequ\u00eancias dessa dificuldade envolvem aspectos cl\u00ednicos, al\u00e9m de poss\u00edveis impactos na qualidade de vida e nos aspectos sociais da alimenta\u00e7\u00e3o, j\u00e1 que pode levar \u00e0 retra\u00e7\u00e3o e isolamento do indiv\u00edduo.Na avalia\u00e7\u00e3o da degluti\u00e7\u00e3o, torna-se necess\u00e1rio o conhecimento de como algumas doen\u00e7as, manifestadas no indiv\u00edduo portador de HIV, influenciam na fun\u00e7\u00e3o de degluti\u00e7\u00e3o e suas fases. A elabora\u00e7\u00e3o de protocolos que norteiem a a\u00e7\u00e3o da equipe multiprofissional visa garantir a qualidade do servi\u00e7o oferecido, al\u00e9m de defini\u00e7\u00e3o de condutas a serem tomadas.. A identifica\u00e7\u00e3o precoce da dificuldade e o encaminhamento antecipado para o Fonoaudi\u00f3logo visam evitar epis\u00f3dios de broncoaspira\u00e7\u00e3o e, consequentemente, reduzir o tempo de interna\u00e7\u00e3o hospitalar e os riscos de infec\u00e7\u00e3o, promovendo diminui\u00e7\u00e3o dos gastos do sistema de sa\u00fade e proporcionando melhor qualidade de vida para esses sujeitos.Em estudo pr\u00e9vio, observou-se uma redu\u00e7\u00e3o da incid\u00eancia de pneumonia aspirativa em pacientes hospitalizados, a partir da aplica\u00e7\u00e3o de protocolo formal de avalia\u00e7\u00e3o da disfagiaO presente estudo prop\u00f4s criar um protocolo multiprofissional para identifica\u00e7\u00e3o do risco de disfagia em pessoas que vivem com HIV no momento da interna\u00e7\u00e3o hospitalar. Al\u00e9m disso, tem o objetivo de validar o protocolo, junto a especialistas no atendimento de pessoas que vivem com HIV e junto \u00e0 equipe multiprofissional, com vias \u00e0 valida\u00e7\u00e3o de concord\u00e2ncia do p\u00fablico-alvo.Trata-se de estudo descritivo, com abordagem quantitativa, que visa \u00e0 cria\u00e7\u00e3o de um produto, bem como sua valida\u00e7\u00e3o, de modo a torn\u00e1-lo confi\u00e1vel e v\u00e1lido para o fim que se destina.O instrumento criado neste estudo consiste em um question\u00e1rio a ser validado e aplicado por diversos profissionais de sa\u00fade, especificamente em pacientes com diagn\u00f3stico de HIV, com idade m\u00ednima de 18 anos, no momento de sua interna\u00e7\u00e3o hospitalar.O estudo foi dividido em duas etapas: a cria\u00e7\u00e3o do question\u00e1rio e sua valida\u00e7\u00e3o baseada no conte\u00fado.A primeira etapa foi a realiza\u00e7\u00e3o de uma revis\u00e3o de literatura sobre o uso de protocolos de rastreio de disfagia e m\u00e9todos de valida\u00e7\u00e3o de question\u00e1rios. Esta revis\u00e3o permitiu analisar os protocolos j\u00e1 validados para adapta\u00e7\u00e3o de suas perguntas e cria\u00e7\u00e3o do novo protocolo espec\u00edfico para pessoas que vivem com HIV.Para essa revis\u00e3o de literatura, foram feitas buscas avan\u00e7adas nas bases de dados BVS e PUBMED. Quanto \u00e0 temporalidade, foram inclu\u00eddos estudos publicados entre 1984 e 2015, utilizando os descritores \u201cacquired immunodeficiency syndrome\u201d, \u201cdeglutition disorders\u201d, \u201cprotocols\u201d, \u201ctriage\u201d e \u201cmass screening\u201d, al\u00e9m de \u201cface validity\u201d, suas combina\u00e7\u00f5es e suas respectivas tradu\u00e7\u00f5es para a l\u00edngua portuguesa. Al\u00e9m disso, as revis\u00f5es e as listas de refer\u00eancias de todos os artigos considerados relevantes foram consultadas em busca de novos artigos para inclus\u00e3o. A busca foi realizada por meio de palavras encontradas nos t\u00edtulos, nos resumos e no corpo do texto.A elabora\u00e7\u00e3o do protocolo foi realizada pelos autores do trabalho, pesquisadores que apresentam experi\u00eancia na \u00e1rea de disfagia e viv\u00eancia com pacientes com HIV.Ao final desta primeira etapa foi desenvolvido o protocolo intitulado como: \u201cProtocolo Multiprofissional de Rastreio de Disfagia em Pacientes HIV\u201d (Ap\u00eandice 1), que contemplou aspectos como: crit\u00e9rios cl\u00ednicos de risco para disfagia orofar\u00edngea e altera\u00e7\u00f5es da fase oral e far\u00edngea da degluti\u00e7\u00e3o.. \u00c9 importante que esse processo seja feito por profissionais de diferentes \u00e1reas e que sejam realmente peritos na tem\u00e1tica do estudo, valorizando as diferentes sugest\u00f5es e opini\u00f5es sobre o tema.Ap\u00f3s essa fase, iniciou-se a segunda etapa da pesquisa, na qual foi utilizada a Valida\u00e7\u00e3o de Face/Conte\u00fado por ser um m\u00e9todo comum na \u00e1rea da sa\u00fadePara esta fase da valida\u00e7\u00e3o de conte\u00fado foram seguidas as seguintes orienta\u00e7\u00f5es: escolha dos ju\u00edzes especialistas no assunto e suas avalia\u00e7\u00f5es quanto aos itens individuais e do question\u00e1rio como um todo e escolha e avalia\u00e7\u00e3o do p\u00fablico-alvo (profissionais que aplicar\u00e3o o question\u00e1rio na pr\u00e1tica cl\u00ednica). Todas as avalia\u00e7\u00f5es foram feitas atrav\u00e9s do \u00cdndice de Validade de Conte\u00fado.. Sendo assim, para este estudo, foram utilizados sete ju\u00edzes de diferentes \u00e1reas da sa\u00fade, que contemplassem os seguintes crit\u00e9rios de inclus\u00e3o: curso m\u00ednimo de mestrado em suas \u00e1reas e pelo menos tr\u00eas anos de experi\u00eancia cl\u00ednica em cuidados com pacientes com HIV.Quanto ao n\u00famero ideal de ju\u00edzes para o processo de valida\u00e7\u00e3o, n\u00e3o h\u00e1 na literatura um consenso, devendo-se levar em conta as caracter\u00edsticas do instrumentoCada um desses profissionais convidados a participar do estudo recebeu: carta convite com os objetivos do trabalho, protocolo de rastreio (Ap\u00eandice 1) e formul\u00e1rio para valida\u00e7\u00e3o da apar\u00eancia e conte\u00fado (Ap\u00eandice 2). A avalia\u00e7\u00e3o do protocolo p\u00f4de ser realizada em local de prefer\u00eancia de cada avaliador, sendo estabelecido um prazo de quatorze dias para devolu\u00e7\u00e3o do instrumento preenchido.Os ju\u00edzes escolhidos foram orientados a avaliar cada um dos 16 itens do question\u00e1rio criado para o estudo, com rela\u00e7\u00e3o aos seguintes crit\u00e9rios: clareza da linguagem escrita utilizada, pertin\u00eancia do assunto em quest\u00e3o e abrang\u00eancia dos aspectos referentes ao tema abordado. Al\u00e9m disso, para todos os itens avaliados foi dada possibilidade de incluir sugest\u00f5es. A coleta de dados foi feita no \u00faltimo semestre de 2017.Ap\u00f3s avalia\u00e7\u00e3o e poss\u00edvel modifica\u00e7\u00e3o do protocolo pelos especialistas, houve o julgamento do material pelo p\u00fablico-alvo, ou seja, avalia\u00e7\u00e3o quanto \u00e0 apar\u00eancia, linguagem e aplicabilidade pelos profissionais que utilizar\u00e3o esta ferramenta em indiv\u00edduos com HIV. \u00c9 um momento importante para o estudo, visto que \u00e9 poss\u00edvel verificar a compreens\u00e3o da popula\u00e7\u00e3o que ir\u00e1 aplicar o protocolo, bem como analisar suas sugest\u00f5es. A etapa de an\u00e1lise de apar\u00eancia tem o objetivo de averiguar se o material \u00e9 compreens\u00edvel \u00e0 popula\u00e7\u00e3o \u00e0 qual se destina.. Dentre esses profissionais, foram selecionados diferentes componentes da equipe de sa\u00fade, visando garantir a caracter\u00edstica multiprofissional do protocolo desenvolvido.\u00c9 indicada a escolha de 30 a 40 pessoas da popula\u00e7\u00e3o alvo para avalia\u00e7\u00e3o desta etapa do estudoA amostra do p\u00fablico-alvo se deu por conveni\u00eancia e foi composta por 36 profissionais de sa\u00fade lotados em um hospital universit\u00e1rio, seguindo alguns crit\u00e9rios de inclus\u00e3o: ter idade igual ou superior a 18 anos; ter disponibilidade de tempo para participar de forma volunt\u00e1ria na avalia\u00e7\u00e3o do protocolo de rastreio e possuir v\u00ednculo de trabalho ou estudantil com o hospital em estudo.Novamente, para todos que aceitaram participar da pesquisa, foi entregue: protocolo de rastreio (Ap\u00eandice 1) e formul\u00e1rio para valida\u00e7\u00e3o da apar\u00eancia e conte\u00fado (Ap\u00eandice 2). Al\u00e9m disso, foi solicitada a assinatura do Termo de Consentimento Livre e Esclarecido - TCLE.O p\u00fablico abordado foi orientado a avaliar cada um dos 16 itens do protocolo de rastreio multiprofissional de disfagia, com rela\u00e7\u00e3o aos mesmos crit\u00e9rios de clareza da linguagem escrita, pertin\u00eancia e abrang\u00eancia do assunto em quest\u00e3o. A avalia\u00e7\u00e3o do protocolo foi realizada em local \u00e0 escolha dos participantes, sendo estabelecido prazo de um dia para devolu\u00e7\u00e3o do instrumento preenchido.Assim como os ju\u00edzes especialistas, o p\u00fablico-alvo recebeu as orienta\u00e7\u00f5es quanto ao preenchimento do question\u00e1rio em diferentes momentos, por\u00e9m feito pelo mesmo indiv\u00edduo, procurando manter linguagem e instru\u00e7\u00e3o de forma equ\u00e2nime, objetivando reduzir poss\u00edveis distor\u00e7\u00f5es.. Para se calcular o IVC para cada item do question\u00e1rio (IVC \u2013 I), foi dividido o n\u00famero total de ju\u00edzes que atribuiu escore de 3 ou 4 em uma escala ordinal de quatro pontos com signific\u00e2ncia de \u201cirrelevante\u201d a \u201cextremamente relevante\u201d pelo total de ju\u00edzes que participaram da avalia\u00e7\u00e3o.O \u00cdndice de Validade de Conte\u00fado \u2013 IVC \u00e9 destinado a avaliar a porcentagem de ju\u00edzes que est\u00e3o em concord\u00e2ncia sobre determinado item. \u00c9 considerado v\u00e1lido se, ap\u00f3s a an\u00e1lise das respostas dos ju\u00edzes, obtiver \u00edndice de aprova\u00e7\u00e3o acima de 78% .Para avaliar o instrumento como um todo (IVC \u2013 T), foi utilizada a m\u00e9dia do n\u00famero total de itens considerados como relevantes pelos ju\u00edzes, pelo n\u00famero total de itens no question\u00e1rio. Foi aceito para aprova\u00e7\u00e3o IVC \u2013 T acima de 90% As avalia\u00e7\u00f5es inferiores a estes valores, tanto para cada item quanto para o valor total do teste, foram revisadas e reenviadas aos mesmos ju\u00edzes, visando que todos alcan\u00e7assem o valor m\u00ednimo de confiabilidade.Essa etapa faz parte de um processo amplo de valida\u00e7\u00e3o do instrumento. Nesse sentido, essa fase abrange a cria\u00e7\u00e3o e a aceita\u00e7\u00e3o das perguntas utilizadas no question\u00e1rio por pessoas especialistas no assunto, bem como por profissionais da sa\u00fade que aplicar\u00e3o o protocolo na pr\u00e1tica cl\u00ednica. Somente ap\u00f3s essa etapa, ser\u00e1 poss\u00edvel utilizar o instrumento com os indiv\u00edduos portadores de HIV.O presente projeto foi submetido e aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa da Universidade Federal do Estado do Rio de Janeiro - UNIRIO em 30 de agosto de 2017, sob o parecer de n\u00famero 2.247.883.Todos os aspectos \u00e9ticos pertinentes \u00e0 pesquisa e \u00e0 participa\u00e7\u00e3o no estudo foram descritos no TCLE, que foi assinado ap\u00f3s aceita\u00e7\u00e3o dos participantes. Al\u00e9m disso, todos foram orientados sobre a privacidade dos dados da pesquisa, tamb\u00e9m da garantia de que as informa\u00e7\u00f5es obtidas n\u00e3o poderiam ser usadas para outros fins al\u00e9m dos previstos no projeto, e da possibilidade de recusar ou interromper sua participa\u00e7\u00e3o a qualquer momento, sem qualquer tipo de preju\u00edzo ou penaliza\u00e7\u00e3o.-27, al\u00e9m da experi\u00eancia dos autores para formula\u00e7\u00e3o da divis\u00e3o dos itens e pontua\u00e7\u00e3o atribu\u00edda a eles.O protocolo multiprofissional de rastreio de disfagia em pacientes HIV foi elaborado pelos pesquisadores do estudo com base no conte\u00fado de artigos presentes na literaturaForam levantados 21 artigos, sendo 3 em portugu\u00eas e 18 em ingl\u00eas. Desses, 16 possu\u00edam question\u00e1rios validados de avalia\u00e7\u00e3o de disfagia, sendo apenas 11 com perguntas pertinentes ao estudo e 5 referentes a m\u00e9todos de valida\u00e7\u00e3o. Com base nesses artigos, o protocolo de rastreio foi criado levando em considera\u00e7\u00e3o aspectos presentes na din\u00e2mica da degluti\u00e7\u00e3o.; por isso, todos os termos t\u00e9cnicos da \u00e1rea de Fonoaudiologia foram substitu\u00eddos por sin\u00f4nimos que alcan\u00e7assem o significado da informa\u00e7\u00e3o.Foi de suma import\u00e2ncia transformar a linguagem das informa\u00e7\u00f5es localizadas na literatura cient\u00edfica e espec\u00edfica em uma linguagem acess\u00edvel ao p\u00fablico-alvoArial tamanho 10 para as informa\u00e7\u00f5es e 12 para o t\u00edtulo. Al\u00e9m disso, foram utilizados elementos gr\u00e1ficos para comunicar informa\u00e7\u00f5es visualmente, de maneira que retratassem um passo a passo de triagem capaz de localizar os principais fatores de risco para disfagia e encaminhamento para o profissional capacitado, al\u00e9m de setas destacando informa\u00e7\u00f5es-chave durante a aplica\u00e7\u00e3o do protocolo.Os textos foram escritos utilizando-se estilo de letras simples e de f\u00e1cil leitura, fonte O protocolo de rastreio foi dividido em tr\u00eas partes:Perfil do paciente: apresenta dados como identifica\u00e7\u00e3o do sujeito, dados de exames anteriores, tempo de diagn\u00f3stico, uso de medica\u00e7\u00e3o antirretroviral, peso, queixas, hist\u00f3ria patol\u00f3gica pregressa e identifica\u00e7\u00e3o do profissional que est\u00e1 aplicando o question\u00e1rio;Crit\u00e9rios cl\u00ednicos de risco para disfagia: indica presen\u00e7a de traqueostomia, necessidade de suporte de oxig\u00eanio, dificuldade de manter n\u00edvel de alerta ou postura adequada para alimenta\u00e7\u00e3o, presen\u00e7a de les\u00f5es em cavidade oral ou queixas que representem um risco elevado para disfagia orofar\u00edngea;Sinais e sintomas: contempla 16 quest\u00f5es criadas para este estudo que podem representar alguma dificuldade na fase oral e far\u00edngea da degluti\u00e7\u00e3o, levando este indiv\u00edduo a um maior risco de apresentar disfagia.\u00c9 importante salientar que foi considerado ser interrompido o preenchimento do protocolo quando assinalado qualquer item de crit\u00e9rios cl\u00ednicos, j\u00e1 que leva o indiv\u00edduo a um alto risco para disfagia, sendo necess\u00e1ria avalia\u00e7\u00e3o fonoaudiol\u00f3gica precoce.A forma final do protocolo foi intitulada como: \u201cProtocolo Multiprofissional de Rastreio de Disfagia em Pacientes HIV\u201d e sua primeira vers\u00e3o foi enviada aos ju\u00edzes especialistas. Para essa an\u00e1lise, foram escolhidos profissionais da \u00e1rea de Fonoaudiologia, Enfermagem, Nutri\u00e7\u00e3o e Medicina que tenham aceitado participar da pesquisa.A Para cada quest\u00e3o, se seguia uma escala ordinal composta por: \u201cn\u00e3o relevante\u201d (NR), \u201cpouco relevante\u201d (PR), \u201cbastante relevante\u201d (BR) e \u201caltamente relevante\u201d (AR), que deveria ser assinalada conforme os crit\u00e9rios estabelecidos anteriormente.Na primeira parte da valida\u00e7\u00e3o, todos os ju\u00edzes devolveram os question\u00e1rios preenchidos dentro do prazo, os quais foram analisados quantitativamente, observando-se as propor\u00e7\u00f5es de concord\u00e2ncia descrita na Ap\u00f3s an\u00e1lise e modifica\u00e7\u00f5es pertinentes, o protocolo, em sua 2\u00aa vers\u00e3o (Ap\u00eandice 1), foi novamente enviado aos ju\u00edzes especialistas para que julgassem o material, agora modificado, dando seguimento \u00e0 valida\u00e7\u00e3o de apar\u00eancia e conte\u00fado.A Ap\u00f3s essa segunda fase espec\u00edfica de valida\u00e7\u00e3o pelos ju\u00edzes, a an\u00e1lise quantitativa mostrou IVC \u2013 I acima de 0,78 para todos os itens modificados do protocolo de rastreio. Sendo assim, pode-se considerar o protocolo parcialmente validado, j\u00e1 que obteve IVC \u2013 T de 0,92, estando apto para iniciar a terceira fase da valida\u00e7\u00e3o, que consiste na avalia\u00e7\u00e3o do p\u00fablico-alvo.O p\u00fablico-alvo para avalia\u00e7\u00e3o do protocolo foi composto por profissionais da \u00e1rea de Medicina e Enfermagem, al\u00e9m de T\u00e9cnicos e universit\u00e1rios dos cursos citados, que atuassem nos primeiros cuidados do paciente com perfil da pesquisa, durante sua admiss\u00e3o hospitalar. Esses profissionais foram orientados quanto ao preenchimento do question\u00e1rio seguindo a mesma escala ordinal sugerida anteriormente.A Ap\u00f3s a avalia\u00e7\u00e3o do p\u00fablico-alvo, foi feita nova an\u00e1lise quantitativa do question\u00e1rio, avaliando-se as propor\u00e7\u00f5es de concord\u00e2ncia descrita na Sendo assim, pode-se considerar o protocolo validado em sua apar\u00eancia e conte\u00fado, j\u00e1 que obteve IVC \u2013 T de 0,92.A partir dos artigos selecionados para este estudo, foi poss\u00edvel a cria\u00e7\u00e3o do protocolo de rastreio multiprofissional, considerando os principais aspectos relacionados \u00e0 fase oral e far\u00edngea da degluti\u00e7\u00e3o..A valida\u00e7\u00e3o deste protocolo se deu mediante a an\u00e1lise pelos ju\u00edzes especialistas em HIV/ Aids assim como pelo p\u00fablico-alvo que ir\u00e1 aplic\u00e1-lo. A constru\u00e7\u00e3o de materiais educativos validados \u00e9 importante para uniformizar as condutas no cuidado do paciente, sendo indispens\u00e1vel a participa\u00e7\u00e3o de todos os profissionais pois permite avaliar a concord\u00e2ncia de ju\u00edzes especialistas e p\u00fablico-alvo sobre cada item individualmente de um question\u00e1rio e tamb\u00e9m do instrumento como um todo. \u00c9 importante ressaltar que este m\u00e9todo \u00e9 o in\u00edcio de um processo que deve englobar outros tipos de valida\u00e7\u00f5es e confiabilidade.A valida\u00e7\u00e3o de faces \u00e9 uma medida que avalia o grau em que os entrevistados consideram a constru\u00e7\u00e3o e o conte\u00fado de um teste e seus itens como relevantes para o contexto no qual o instrumento ser\u00e1 aplicado. Este meio de valida\u00e7\u00e3o \u00e9 considerado fase importante na adapta\u00e7\u00e3o de question\u00e1rios. Na an\u00e1lise dos dados foi utilizado o \u00cdndice de Validade de Conte\u00fado.\u00c9 considerada uma constru\u00e7\u00e3o robusta do protocolo de pesquisa quando h\u00e1 concord\u00e2ncia entre a maioria dos avaliadores. Neste processo, s\u00e3o analisadas as sugest\u00f5es dos participantes quanto \u00e0 substitui\u00e7\u00e3o de termos e reformula\u00e7\u00e3o de informa\u00e7\u00f5es, visando o aperfei\u00e7oamento do materialOs especialistas para julgamento do instrumento criado neste estudo inclu\u00edam profissionais da \u00e1rea de Fonoaudiologia, Enfermagem, Nutri\u00e7\u00e3o e Medicina, com curso m\u00ednimo de mestrado e pelo menos tr\u00eas anos de experi\u00eancia cl\u00ednica em cuidados com pacientes com HIV. N\u00e3o foi encontrada na literatura nenhuma padroniza\u00e7\u00e3o oficial para escolha dos ju\u00edzes.Na valida\u00e7\u00e3o por ju\u00edzes especialistas, os resultados evidenciaram que 85,7% da amostra foi constitu\u00edda por indiv\u00edduos do g\u00eanero feminino. Com rela\u00e7\u00e3o \u00e0 faixa et\u00e1ria, influenciada pelos crit\u00e9rios de inclus\u00e3o do estudo, foi encontrada uma m\u00e9dia de 44,1 anos e DP de 11,67.Foram escolhidos peritos de diferentes \u00e1reas da sa\u00fade, visto o perfil multiprofissional do protocolo, que atuam diretamente com o paciente em avalia\u00e7\u00f5es cl\u00ednicas e terapia. Todos os convidados aceitaram participar da pesquisa, sendo 3 fonoaudi\u00f3logos , 2 enfermeiros , 1 m\u00e9dico  e 1 nutricionista . Com rela\u00e7\u00e3o ao tempo de forma\u00e7\u00e3o acad\u00eamica, percebe-se que a grande maioria dos ju\u00edzes possui at\u00e9 15 anos  de formado.Devido \u00e0 titula\u00e7\u00e3o m\u00ednima utilizada como crit\u00e9rio de inclus\u00e3o, observa-se pouca diferen\u00e7a percentual entre participantes com titula\u00e7\u00e3o de mestrado  e doutorado . No que diz respeito \u00e0 \u00e1rea de trabalho, a grande maioria dos ju\u00edzes  dedica-se tanto \u00e0 doc\u00eancia quanto \u00e0 assist\u00eancia cl\u00ednica. Em rela\u00e7\u00e3o \u00e0 produ\u00e7\u00e3o bibliogr\u00e1fica, 5 dos avaliadores  possuem artigos publicados em peri\u00f3dicos.Ap\u00f3s an\u00e1lise quantitativa das respostas dos ju\u00edzes na primeira fase, constata-se que dois itens n\u00e3o atingiram o IVC \u2013 I m\u00ednimo de 0,78. S\u00e3o eles: \u201c6 \u2013 Voc\u00ea demora ou tem dificuldade para comer alimentos duros?\u201d  e \u201c16 \u2013 A comida ou bebida vai para o \u201clugar errado\u201d quando voc\u00ea engole?\u201d . A revis\u00e3o desses itens foi feita a partir da an\u00e1lise qualitativa das sugest\u00f5es dos especialistas.O item \u201cVoc\u00ea demora ou tem dificuldade para comer alimentos duros?\u201d foi modificado de acordo com a sugest\u00e3o de uma das especialistas de substituir a nomenclatura utilizada \u201calimentos duros\u201d por \u201cs\u00f3lidos\u201d. Al\u00e9m disso, foi aceita a sugest\u00e3o de outro juiz de utilizar palavras temporais que indiquem que a dificuldade que o indiv\u00edduo est\u00e1 apresentando n\u00e3o \u00e9 pr\u00e9via \u00e0 doen\u00e7a, e sim que passou a ocorrer ap\u00f3s seu diagn\u00f3stico.J\u00e1 o item \u201cA comida ou bebida vai para o \u201clugar errado\u201d quando voc\u00ea engole?\u201d, foi acatada a sugest\u00e3o de alterar a forma de descrever esta dificuldade, sendo utilizada ent\u00e3o \u201cVoc\u00ea engasga frequentemente?\u201d, englobando a frequ\u00eancia que esse evento ocorre, para que assim seja considerado um problema.Al\u00e9m dessas altera\u00e7\u00f5es obrigat\u00f3rias, tamb\u00e9m foi realizado um levantamento de todas as sugest\u00f5es apresentadas, ainda que com IVC \u2013 I considerado dentro do padr\u00e3o adequado, possibilitando melhorias no protocolo criado, mediante a heterogeneidade de experi\u00eancias dos ju\u00edzes participantes. Sendo assim, foram alteradas palavras visando tornar as perguntas mais abrangentes e claras; tamb\u00e9m foram acrescentadas palavras que deixem as perguntas mais autoexplicativas e que representem a temporalidade que a pergunta visa abranger.. Al\u00e9m disso, essa dificuldade \u00e9 muito encontrada em avalia\u00e7\u00f5es objetivas de paciente com altera\u00e7\u00f5es neurol\u00f3gicas.Chama a aten\u00e7\u00e3o tamb\u00e9m a an\u00e1lise do item 4: \u201cH\u00e1 dificuldade de manter a comida/ l\u00edquido dentro da boca? Escapa ou cai pelos l\u00e1bios?\u201d, para o qual os 7 ju\u00edzes assinalaram a op\u00e7\u00e3o \u201caltamente relevante\u201d. Isso pode ser explicado devido ao fato de altera\u00e7\u00f5es neurol\u00f3gicas possibilitarem diminui\u00e7\u00e3o do t\u00f4nus muscular, que consequentemente causa uma maior dificuldade no controle oral do bolo alimentar e possibilidade de atraso na sequ\u00eancia far\u00edngea da degluti\u00e7\u00e3o, proporcionando uma maior chance de escape prematuro desse bolo tanto anterior como posterior e, consequentemente, risco de broncoaspira\u00e7\u00e3oAp\u00f3s as altera\u00e7\u00f5es realizadas, o protocolo foi novamente enviado aos ju\u00edzes especialistas para o seguimento da valida\u00e7\u00e3o de apar\u00eancia e conte\u00fado.Na an\u00e1lise quantitativa da segunda fase de valida\u00e7\u00e3o pelos ju\u00edzes, com o protocolo modificado, observou-se IVC \u2013 I acima de 0,78 para todos os itens, bem como IVC \u2013 T de 0,92. Sendo assim, foi poss\u00edvel iniciar a terceira fase da valida\u00e7\u00e3o, com a avalia\u00e7\u00e3o do p\u00fablico-alvo..\u00c9 importante observar tamb\u00e9m que a pergunta \u201cPrecisa engolir v\u00e1rias vezes para ajudar o alimento a descer da garganta?\u201d, durante essa segunda avalia\u00e7\u00e3o, recebeu as 7 avalia\u00e7\u00f5es \u201caltamente relevante\u201d. Essa marca\u00e7\u00e3o pode ser justificada devido \u00e0 altera\u00e7\u00e3o na forma como a pergunta foi reescrita, possibilitando maior acessibilidade do vocabul\u00e1rio \u00e0 realidade da popula\u00e7\u00e3o do estudo. Al\u00e9m disso, pode ser encontrado na literatura especializada que a sensa\u00e7\u00e3o de bolo na garganta tem grande rela\u00e7\u00e3o com a dificuldade de degluti\u00e7\u00e3o vista em exames objetivos, levando ao maior risco para disfagia orofar\u00edngea.A fase seguinte da valida\u00e7\u00e3o \u00e9 de extrema import\u00e2ncia, j\u00e1 que o p\u00fablico-alvo da pesquisa foi composto por indiv\u00edduos que normalmente t\u00eam o primeiro contato com o paciente e que, portanto, ser\u00e3o respons\u00e1veis por aplicar o instrumento. Essa popula\u00e7\u00e3o deve ser capaz de compreender as perguntas que o question\u00e1rio contempla, bem como de reproduzi-las para a popula\u00e7\u00e3o do estudo. Al\u00e9m disso, \u00e9 o momento de analisar opini\u00f5es e sugest\u00f5es para a elabora\u00e7\u00e3o deste material. Esse \u00e9 o momento de verificar como o material foi entendido por essas pessoas e identificar o que n\u00e3o ficou claroCom rela\u00e7\u00e3o a esse p\u00fablico-alvo, os resultados mostraram que 86,1% da amostra foi constitu\u00edda por indiv\u00edduos do g\u00eanero feminino. Com rela\u00e7\u00e3o \u00e0 faixa et\u00e1ria, foi identificada uma m\u00e9dia de 30,1 anos e DP de 7,17.Contou-se com a avalia\u00e7\u00e3o de 10 universit\u00e1rios dos \u00faltimos per\u00edodos de diferentes cursos das ci\u00eancias da sa\u00fade , 15 profissionais com forma\u00e7\u00e3o t\u00e9cnica , al\u00e9m de 7 m\u00e9dicos  e 4 enfermeiros .Feita a an\u00e1lise quantitativa dessa popula\u00e7\u00e3o, observa-se que nas perguntas \u201c5 - Voc\u00ea se alimenta de forma mais r\u00e1pida ou mais lenta que antes da doen\u00e7a?\u201d, \u201c6 \u2013 Voc\u00ea passou a demorar ou ter dificuldade para comer alimentos s\u00f3lidos depois da doen\u00e7a?\u201d, \u201c7 - Depois que voc\u00ea engole ainda ficam restos de alimento na boca?\u201d, \u201c8 - Voc\u00ea sente que tem muita saliva na boca ou baba com frequ\u00eancia quando est\u00e1 acordado?\u201d, \u201c9 - Voc\u00ea sente dor para engolir saliva, alimentos ou l\u00edquidos?\u201d, \u201c10 - Sente o alimento/ l\u00edquido preso na garganta?\u201d, \u201c12 - Passou a beber l\u00edquidos para ajudar a comida a descer depois da doen\u00e7a?\u201d, \u201c13 - Sente que sua voz muda durante ou depois da refei\u00e7\u00e3o?\u201d e \u201c14 - Voc\u00ea tosse ou pigarreia durante a refei\u00e7\u00e3o?\u201d pelo menos 1 participante considerou pouco relevante cada uma dessas quest\u00f5es, por\u00e9m n\u00e3o houve necessidade de altera\u00e7\u00e3o, j\u00e1 que a maioria dos avaliadores classificou os itens como bastante ou altamente relevantes., a que se referem as quest\u00f5es, s\u00e3o sintomas frequentemente encontrados em indiv\u00edduos com dificuldade de alimenta\u00e7\u00e3o.Al\u00e9m disso, o tempo de tr\u00e2nsito oral lento, dificuldade na manipula\u00e7\u00e3o do alimento, res\u00edduos em cavidade oral, estase de saliva, odinofagia, sensa\u00e7\u00e3o de alimento parado, voz molhada e tosseAp\u00f3s a etapa de valida\u00e7\u00e3o pelo p\u00fablico-alvo, observou-se atrav\u00e9s da an\u00e1lise quantitativa que n\u00e3o houve necessidade de modifica\u00e7\u00f5es do question\u00e1rio, devido aos valores de IVC \u2013 I acima de 0,78 para todos os itens e IVC \u2013 T de 0,92. Sendo assim, pode-se considerar o protocolo validado em sua apar\u00eancia e conte\u00fado, atendendo sua finalidade.Vale destacar que ainda s\u00e3o necess\u00e1rias outras etapas de valida\u00e7\u00e3o para que seja poss\u00edvel utilizar o instrumento na pr\u00e1tica cl\u00ednica.O protocolo de rastreio multiprofissional de disfagia em pacientes com infec\u00e7\u00e3o HIV \u00e9 um instrumento de triagem, que visa a identifica\u00e7\u00e3o precoce do risco para dificuldade de degluti\u00e7\u00e3o e interdi\u00e7\u00e3o de uma poss\u00edvel complica\u00e7\u00e3o pulmonar.Este protocolo pode ser considerado validado do ponto de vista de apar\u00eancia e conte\u00fado, uma vez que apresentou um IVC total de 0,92 na valida\u00e7\u00e3o dos ju\u00edzes especialistas e IVC total de 0,96 a partir da valida\u00e7\u00e3o pelo p\u00fablico-alvo, constatando-se, assim, um IVC do protocolo de 0,94. Sendo assim, podemos considerar o instrumento resolutivo, com capacidade de cumprir o que se prop\u00f5e.Diante das sugest\u00f5es e contribui\u00e7\u00f5es de todos os participantes durante o processo de valida\u00e7\u00e3o, o protocolo passou por modifica\u00e7\u00f5es de linguagem e estrutura\u00e7\u00e3o, tornando-o mais abrangente e qualificado para utiliza\u00e7\u00e3o no dia-a-dia das pessoas que atuam com esses pacientes abordados na pesquisa.\u00c9 importante ressaltar que o protocolo foi validado em seu conte\u00fado e apar\u00eancia. Outros estudos s\u00e3o necess\u00e1rios para verificar sua utiliza\u00e7\u00e3o, incluindo aplica\u00e7\u00e3o experimental em larga escala com abrang\u00eancia de diferentes profissionais e institui\u00e7\u00f5es  para que o instrumento possa ser utilizado na pr\u00e1tica cl\u00ednica."}
+{"text": "A cardiomiopatia hipertr\u00f3fica (CMH) pode causar obstru\u00e7\u00e3o da via de sa\u00edda do ventr\u00edculo esquerdo (VSVE) e ser respons\u00e1vel pelo surgimento de sintomas limitantes, como cansa\u00e7o f\u00edsico. Quando tais sintomas s\u00e3o refrat\u00e1rios ao tratamento farmacol\u00f3gico, os tratamentos alternativos intervencionistas podem ser \u00fateis, como a abla\u00e7\u00e3o septal por meio da infus\u00e3o de \u00e1lcool na art\u00e9ria coron\u00e1ria ou por meio da miectomia cir\u00fargica. Recentemente, o uso de cateter de radiofrequ\u00eancia (RF) para abla\u00e7\u00e3o do septo endoc\u00e1rdico guiado por mapeamento eletroanat\u00f4mico mostrou-se eficaz apesar da elevada incid\u00eancia de bloqueio atrioventricular total. Uma alternativa seria a aplica\u00e7\u00e3o de radiofrequ\u00eancia no ponto de in\u00edcio do gradiente septal guiada pelo ecocardiograma transesof\u00e1gico (ETE). O ecocardiograma \u00e9 um m\u00e9todo de imagem com elevada acur\u00e1cia para determina\u00e7\u00e3o da anatomia septal. Avaliar o efeito em longo prazo da abla\u00e7\u00e3o septal para al\u00edvio do gradiente ventr\u00edculo-arterial, utilizando o ETE para auxiliar no posicionamento do cateter na \u00e1rea de maior obstru\u00e7\u00e3o septal. Avaliar tamb\u00e9m os efeitos da abla\u00e7\u00e3o na classe funcional e par\u00e2metros ecocardiogr\u00e1ficos. Doze pacientes sintom\u00e1ticos com obstru\u00e7\u00e3o da VSVE, refrat\u00e1rios \u00e0 terapia farmacol\u00f3gica, foram submetidos \u00e0 abla\u00e7\u00e3o endoc\u00e1rdica septal com cateteres com ponta de 8 mm, cujo posicionamento foi orientado na regi\u00e3o de maior obstru\u00e7\u00e3o com aux\u00edlio do ETE. Foram realizadas aplica\u00e7\u00f5es de radiofrequ\u00eancia (RF) termocontrolada e escalonadas sobre a \u00e1rea alvo. Ap\u00f3s cada aplica\u00e7\u00e3o, o gradiente era reavaliado e nova aplica\u00e7\u00e3o era realizada de acordo com crit\u00e9rio cl\u00ednico. Foram avaliados os efeitos das aplica\u00e7\u00f5es de RF tanto para o gradiente em repouso como para o provocado por meio da manobra de Valsalva, e considerado o gradiente. As diferen\u00e7as foram significativas quando o valor de p foi menor ou igual a 0,05. Observou-se que a redu\u00e7\u00e3o da m\u00e9dia dos gradientes m\u00e1ximos obtidos foi de 96,8\u00b134,7 mmHg para 62,7\u00b125,4 mmHg ao final de tr\u00eas meses do procedimento . Ap\u00f3s um ano, a m\u00e9dia dos gradientes m\u00e1ximos obtidos foi de 36,1\u00b123,8 mmHg . O procedimento foi bem tolerado e n\u00e3o houve registro de bloqueio atrioventricular total e nem complica\u00e7\u00f5es graves. A abla\u00e7\u00e3o septal guiada pelo ETE foi eficaz e segura, com resultados mantidos durante o per\u00edodo de seguimento cl\u00ednico. \u00c9 uma op\u00e7\u00e3o razo\u00e1vel para o tratamento intervencionista da obstru\u00e7\u00e3o da VSVE em CMH. Essa abordagem parece ser mais segura, principalmente no que diz respeito ao comprometimento do sistema de condu\u00e7\u00e3o que trafega pelo septo.6A cardiomiopatia hipertr\u00f3fica obstrutiva (CMHO) \u00e9 uma doen\u00e7a de origem gen\u00e9tica que se manifesta por intensa hipertrofia mioc\u00e1rdica, al\u00e9m de fibrose de extens\u00e3o vari\u00e1vel. A obstru\u00e7\u00e3o da via de sa\u00edda do ventr\u00edculo esquerdo (VSVE) \u00e9 uma condi\u00e7\u00e3o anat\u00f4mica com um comportamento din\u00e2mico e pode causar sintomas, como limita\u00e7\u00e3o aos esfor\u00e7os, al\u00e9m de ser respons\u00e1vel por casos de morte s\u00fabita. O tratamento intervencionista proposto para essa condi\u00e7\u00e3o pode ser a alcooliza\u00e7\u00e3o de ramos septais da art\u00e9ria coron\u00e1ria ou a miectomia cir\u00fargica.7A miectomia cir\u00fargica traz consider\u00e1veis \u00edndices de morbidade e mortalidade, especialmente em cen\u00e1rios nos quais n\u00e3o h\u00e1 um centro de refer\u00eancia, com experi\u00eancia, que inclua pelo menos mais de dez cirurgias ao ano. Isso motivou o desenvolvimento de alternativas menos invasivas, como a alcooliza\u00e7\u00e3o septal.Apesar da menor morbidade p\u00f3s-operat\u00f3ria e a necessidade de unidades de p\u00f3s-operat\u00f3rio com menos estrutura, entusiastas da alcooliza\u00e7\u00e3o tamb\u00e9m se depararam com limita\u00e7\u00f5es significativas. A necessidade de anatomia coronariana favor\u00e1vel  e a imprevisibilidade da extens\u00e3o do dano mioc\u00e1rdico reduzem a aplicabilidade rotineira desta t\u00e9cnica.10 A abla\u00e7\u00e3o foi realizada em sala de eletrofisiologia ou hemodin\u00e2mica, com acesso ao septo interventricular por via a\u00f3rtica retr\u00f3grada ou via transeptal (e raramente com abordagem associada ao septo direito). Os cateteres utilizados em estudos pr\u00e9vios foram irrigados ou com ponta de 8mm em adultos. Os resultados foram variados, principalmente pelas t\u00e9cnicas utilizadas para abordagem do gradiente.11Estudos recentes demonstram que a aplica\u00e7\u00e3o localizada de RF por meio de cateter tem se mostrado eficaz devido ao melhor controle da extens\u00e3o da les\u00e3o e \u00e0 localiza\u00e7\u00e3o mais precisa do cateter na regi\u00e3o mais espessa do septo interventricular. Os cateteres utilizados foram os mesmos usados em eletrofisiologia invasiva para tratamento de arritmias ventriculares e atriais. Os investigadores utilizaram mapeamento eletroanat\u00f4mico intracavit\u00e1rio para determinar a regi\u00e3o septal a ser abordada, al\u00e9m do posicionamento do cateter, respectivamente, visando reduzir o risco de comprometimento do sistema de condu\u00e7\u00e3o.12Encontramos apenas um estudo de abla\u00e7\u00e3o por cateter de radiofrequ\u00eancia na popula\u00e7\u00e3o pedi\u00e1trica, utilizando mapeamento eletroanat\u00f4mico associado \u00e0 ecocardiografia tranesof\u00e1gica.A abla\u00e7\u00e3o por cateteres de radiofrequ\u00eancia permite facilidade de acesso da terapia a gradientes localizados em por\u00e7\u00f5es basais do ventr\u00edculo esquerdo, bem como a gradientes intraventriculares, portanto, n\u00e3o \u00e9 limitada por anatomia coronariana. O uso do ecocardiograma transesof\u00e1gico (ETE) permite a localiza\u00e7\u00e3o do ponto da obstru\u00e7\u00e3o em tempo real durante o procedimento.A abla\u00e7\u00e3o por cateter utilizando t\u00e9cnicas de eletrofisiologia com posicionamento do cateter terap\u00eautico com ponta de 8 mm, com o aux\u00edlio do ETE, \u00e9 um m\u00e9todo simples e que permite a localiza\u00e7\u00e3o precisa da \u00e1rea septal cr\u00edtica para estabelecer o gradiente ventr\u00edculo-a\u00f3rtico. Essas premissas devem tornar essa t\u00e9cnica mais simples, eficaz e segura para a redu\u00e7\u00e3o da obstru\u00e7\u00e3o da VSVE.Avaliar a seguran\u00e7a e a efic\u00e1cia da aplica\u00e7\u00e3o de RF no septo interventricular de pacientes com CMHO por meio de cateteres com ponta de 8 mm cujo posicionamento na \u00e1rea alvo fora guiado pelo ETE visando \u00e0 redu\u00e7\u00e3o de gradiente em VSVE.Avaliar a repercuss\u00e3o da abla\u00e7\u00e3o septal ventricular sobre a sintomatologia, baseada na classe funcional, al\u00e9m de efeitos sobre o eletrocardiograma e ecocardiograma transtor\u00e1cico antes e ap\u00f3s tr\u00eas meses e um ano do procedimento.13Como prova de conceito, optamos por realizar um procedimento piloto em uma paciente sintom\u00e1tica de 63 anos de idade com contraindica\u00e7\u00e3o para abordagem por hemodin\u00e2mica e risco cir\u00fargico elevado. A paciente (n\u00e3o inclu\u00edda nesta s\u00e9rie) apresentava gradiente residual m\u00e9dio ventricular p\u00f3s-miectomia cir\u00fargica. A mesma foi submetida \u00e0 abla\u00e7\u00e3o por cateter com sucesso na \u00e1rea alvo, com redu\u00e7\u00e3o de gradiente inicial de 100 mmHg para menos de 25 mmHg, resultado mantido ap\u00f3s 24 meses de seguimento. Foi utilizada abordagem transeptal, em princ\u00edpio, mas a via de acesso foi modificada para a via a\u00f3rtica retr\u00f3grada pela instabilidade do cateter e pela dificuldade em acessar o local proposto para abla\u00e7\u00e3o. A resson\u00e2ncia magn\u00e9tica de controle tr\u00eas meses ap\u00f3s a interven\u00e7\u00e3o identificou a les\u00e3o de radiofrequ\u00eancia, provocada com a utiliza\u00e7\u00e3o de cateteres, adjacente \u00e0 les\u00e3o causada durante o ato cir\u00fargico.Foram selecionados 12 pacientes com CMHO da Se\u00e7\u00e3o de Cardiomiopatias do Instituto Dante Pazzanese de Cardiologia, com sintomas refrat\u00e1rios ao tratamento farmacol\u00f3gico. A sele\u00e7\u00e3o dos 12 pacientes se deu por adequa\u00e7\u00e3o aos crit\u00e9rios de inclus\u00e3o e exclus\u00e3o e interesse em participa\u00e7\u00e3o no projeto de pesquisa, bem como disponibilidade para participa\u00e7\u00e3o nas consultas presenciais e exames subsequentes do protocolo. Todos foram submetidos aos seguintes exames: eletrocardiograma, ecodopplercardiograma transtor\u00e1cico, al\u00e9m de perfil sangu\u00edneo incluindo hemograma, glicemia de jejum, ureia, creatinina, coagulograma.Os crit\u00e9rios de inclus\u00e3o foram: indiv\u00edduos com cardiomiopatia hipertr\u00f3fica obstrutiva sintom\u00e1tica, com gradiente provocado pela manobra de Valsalva maior ou igual a 50 mmHg a despeito de tratamento medicamentoso (ou pacientes com gradiente acima de 30 mmHg com necessidade de uso concomitante de vasodilatadores); contraindica\u00e7\u00e3o m\u00e9dica para miectomia (risco cir\u00fargico elevado em discuss\u00e3o da equipe de cardiologia ou por op\u00e7\u00e3o do paciente); ou contraindica\u00e7\u00e3o para alcooliza\u00e7\u00e3o septal por par\u00e2metros t\u00e9cnicos. Foram exclu\u00eddos: portadores de marca-passo definitivo ou cardiodesfibriladores implant\u00e1veis, pois existe influ\u00eancia do modo de estimula\u00e7\u00e3o e dos par\u00e2metros no gradiente ventricular. Tamb\u00e9m dificultaria a mensura\u00e7\u00e3o da avalia\u00e7\u00e3o dos efeitos da abla\u00e7\u00e3o no sistema de condu\u00e7\u00e3o card\u00edaco, mascarando bloqueios atrioventriculares tardios. Al\u00e9m disso, foram exclu\u00eddas pessoas com fibrila\u00e7\u00e3o atrial, j\u00e1 que a mensura\u00e7\u00e3o do gradiente se torna pouco reprodut\u00edvel com a irregularidade da frequ\u00eancia card\u00edaca. J\u00e1 que as medidas seriam necess\u00e1rias para a decis\u00e3o de interromper a abla\u00e7\u00e3o ou continuar aplicando, optou-se por remover esta vari\u00e1vel na fase inicial do protocolo. Foram tamb\u00e9m exclu\u00eddos pacientes com infec\u00e7\u00e3o em atividade com hist\u00f3rico de arritmia ventricular complexa, ou com hist\u00f3rico de morte s\u00fabita recuperada pela prov\u00e1vel indica\u00e7\u00e3o de implante de cardiodesfibrilador ao longo do seguimento. O ecocardiograma transtor\u00e1cico em repouso foi realizado pela manh\u00e3, com os pacientes em uso de suas medica\u00e7\u00f5es habituais.A manobra de Valsalva foi realizada por examinador experiente, que explicou sua execu\u00e7\u00e3o detalhadamente aos pacientes. Os registros ecocardiogr\u00e1ficos foram obtidos durante toda a fase de esfor\u00e7o e relaxamento, e foram considerados os maiores valores de gradiente. A execu\u00e7\u00e3o correta da manobra foi definida pelo avaliador, por meio da redu\u00e7\u00e3o da pr\u00e9-carga, definida pela redu\u00e7\u00e3o da onda E do fluxo mitral em uma primeira tentativa. Somente quando o paciente estava executando adequadamente a manobra, em outro momento, era realizado o registro dos gradientes em via de sa\u00edda. N\u00e3o houve controle por meio de bar\u00f4metros / flux\u00f4metros.O protocolo e os termos de consentimento foram aprovados pelo Comit\u00ea de \u00c9tica em Pesquisa e est\u00e3o dispon\u00edveis na Plataforma Brasil Os procedimentos foram realizados em sala dedicada de eletrofisiologia, por eletrofisiologistas e cardiologistas com \u00e1rea de atua\u00e7\u00e3o em ecocardiografia, e com supervis\u00e3o de equipe de anestesiologia.As estrat\u00e9gias utilizadas por outros pesquisadores basearam-se na premissa de que o ponto mais espesso do septo era o mesmo onde se iniciava o gradiente. O gradiente, por sua vez, \u00e9 composto pelo movimento sist\u00f3lico anterior do folheto anterior da v\u00e1lvula mitral, movimento do m\u00fasculo papilar e septo. Esses dados anat\u00f4micos, ponto no qual se inicia o gradiente, podem ser observados com maior confiabilidade pelo ecocardiograma durante a abla\u00e7\u00e3o.14 observando-se as cavidades em m\u00faltiplas angula\u00e7\u00f5es  para avalia\u00e7\u00e3o anat\u00f4mica. A imagem ecocardiogr\u00e1fica permitiu a identifica\u00e7\u00e3o da ponta do cateter terap\u00eautico, que foi justaposta pelo eletrofisiologista \u00e0 regi\u00e3o septal, onde foi identificado o turbilhonamento de fluxo (Aliasing). O ecocardiograma, ent\u00e3o, foi utilizado para observar a dist\u00e2ncia entre o folheto anterior da v\u00e1lvula mitral e a estabilidade do contato com a regi\u00e3o de interesse.Todos os procedimentos foram realizados sob anestesia geral. Foram realizadas uma pun\u00e7\u00e3o em art\u00e9ria femoral direita com introdutor 8F para acesso \u00e0 regi\u00e3o septal do ventr\u00edculo esquerdo via a\u00f3rtica retr\u00f3grada; duas pun\u00e7\u00f5es em veia femoral direita com introdutor 6F para posicionamento de cateter quadripolar em septo direito; e identifica\u00e7\u00e3o do eletrograma de feixe de His, al\u00e9m de outro cateter quadripolar em ponta de ventr\u00edculo direito. Em seguida mensurou-se o gradiente ventr\u00edculo-a\u00f3rtico, assim como foi localizado o ponto de maior acelera\u00e7\u00e3o do fluxo com o ecocardiograma transesof\u00e1gico, caracterizando a \u00e1rea de maior obstru\u00e7\u00e3o. O ecocardiograma transesof\u00e1gico foi realizado sob anestesia geral, com imagens obtidas inicialmente em posi\u00e7\u00e3o esof\u00e1gica. Quando necess\u00e1rio, com avalia\u00e7\u00e3o de posi\u00e7\u00e3o em eixo curto, a sonda foi movimentada para a posi\u00e7\u00e3o transg\u00e1strica. O exame foi realizado de acordo com o protocolo da American Society of Echocardiography,oC), seguida de nova aferi\u00e7\u00e3o do gradiente por meio de cateter de hemodin\u00e2mica, al\u00e9m do aux\u00edlio do ecocardiograma. A cada aplica\u00e7\u00e3o que resultasse na redu\u00e7\u00e3o de pelo menos 25% do gradiente inicial foram adicionadas quatro novas aplica\u00e7\u00f5es em regi\u00f5es adjacentes, observando-se a dist\u00e2ncia de pelo menos 1 cm do eletrograma de feixe de His  ou EPtracer , o cateter quadripolar deflect\u00edvel foi posicionado em regi\u00e3o de feixe de His; da mesma forma, um cateter quadripolar foi colocado na regi\u00e3o apical do ventr\u00edculo direito, e um cateter terap\u00eautico bidirecional 8F com ponta de 8mm foi posicionado em ventr\u00edculo esquerdo por via retroa\u00f3rtica. O cateter terap\u00eautico foi impactado na regi\u00e3o septal de VE (conforme descrito anteriormente) no ponto de maior acelera\u00e7\u00e3o do fluxo sangu\u00edneo, local no qual foi aplicada radiofrequ\u00eancia por 120 segundos  por 24 horas, sendo encaminhados para enfermaria por 3 a 5 dias, com avalia\u00e7\u00e3o de troponina nas primeiras 48 horas. Realizou-se uma avalia\u00e7\u00e3o ecocardiogr\u00e1fica com 24 horas e no sexto dia de p\u00f3s-operat\u00f3rio (para identifica\u00e7\u00e3o de derrame peric\u00e1rdico ou trombos p\u00f3s-procedimento). Ap\u00f3s seis semanas, tr\u00eas meses, seis meses e 12 meses, o paciente foi reavaliado clinicamente. O ecocardiograma transtor\u00e1cico foi repetido no terceiro e no 12r .A distribui\u00e7\u00e3o das vari\u00e1veis cont\u00ednuas foi avaliada pelo teste de normalidade de Shapiro-Wilk, para an\u00e1lise comparativa dos tempos . Para as vari\u00e1veis com distribui\u00e7\u00e3o normal utilizou-se o teste T de Student pareado, e os resultados foram apresentados como m\u00e9dia e desvio-padr\u00e3o. Para aquelas com distribui\u00e7\u00e3o n\u00e3o normal utilizou-se o teste de Wilcoxon pareado, e os resultados foram apresentados como mediana e intervalo interquartil. Assim, somente a an\u00e1lise da espessura do septo ao final de 12 meses foi realizada com o teste de Wilcoxon. As demais vari\u00e1veis foram analisadas utilizando o Teste de Mann-Whitney. Em todas as conclus\u00f5es obtidas por meio das an\u00e1lises inferenciais o n\u00edvel de signific\u00e2ncia considerado foi \u03b1 = 5%. A classe funcional foi a \u00fanica vari\u00e1vel categ\u00f3rica analisada, e n\u00e3o foi utilizado teste estat\u00edstico para compara\u00e7\u00e3o pr\u00e9 e p\u00f3s-procedimento, visto que todos os indiv\u00edduos apresentaram melhora. O software utilizado para as an\u00e1lises estat\u00edsticas foi o RDezoito pacientes foram pr\u00e9-selecionados. Um deles foi exclu\u00eddo por ter menos de 18 anos; dois, por relato de fibrila\u00e7\u00e3o atrial parox\u00edstica ou presente no momento do procedimento; outros dois por sintomas possivelmente relacionados a outras causas que n\u00e3o o gradiente; e um indiv\u00edduo foi exclu\u00eddo com diagn\u00f3stico de amiloidose .Os 12 pacientes inclu\u00eddos correspondiam a nove mulheres e tr\u00eas homens. As caracter\u00edsticas cl\u00ednicas e ecocardiogr\u00e1ficas dessa popula\u00e7\u00e3o s\u00e3o apresentadas na A m\u00e9dia da dura\u00e7\u00e3o dos procedimentos foi de tr\u00eas horas. O posicionamento do cateter terap\u00eautico indicado pelo ecocardiografista correspondia \u00e0 regi\u00e3o de maior gradiente, conforme demonstrado na A m\u00e9dia dos gradientes m\u00e1ximos iniciais mensurada durante o procedimento foi de 89 mmHg . Ao seu t\u00e9rmino, a m\u00e9dia reduziu para 36,9 mmHg . Surgiram tr\u00eas casos de bloqueio de ramo esquerdo relacionados ao procedimento sem incremento do intervalo HV . N\u00e3o houve bloqueio atrioventricular transit\u00f3rio ou prolongamento do intervalo PR em nenhum dos casos. N\u00e3o houve derrame peric\u00e1rdico nem eventos emb\u00f3licos cerebrais cl\u00ednicos. Um paciente apresentou f\u00edstula arteriovenosa na regi\u00e3o inguinal direita, que teve que ser corrigida cirurgicamente. Durante a interna\u00e7\u00e3o, houve eleva\u00e7\u00e3o de dosagem s\u00e9rica de troponina em todos os pacientes. O valor m\u00e1ximo foi alcan\u00e7ado dentro das primeiras 12 horas e foi, em m\u00e9dia, de 7,15 ng/dL . O tempo m\u00e9dio de interna\u00e7\u00e3o hospitalar foi de 5,8 dias , por protocolo. Uma paciente ficou hospitalizada por 13 dias para avalia\u00e7\u00e3o de hematoma em regi\u00e3o inguinal esquerda, que posteriormente foi diagnosticado e tratado como f\u00edstula arteriovenosa .Houve redu\u00e7\u00e3o dos gradientes provocados e em repouso em todos os pacientes persistentes, durante todo o acompanhamento. Os dados relativos \u00e0 redu\u00e7\u00e3o dos gradientes provocados e em repouso s\u00e3o apresentados nas Observou-se que a redu\u00e7\u00e3o da m\u00e9dia dos gradientes m\u00e1ximos obtidos foi de 96,8\u00b134,7 mmHg para 62,7\u00b125,4 mmHg ao final de tr\u00eas meses do procedimento . Ap\u00f3s um ano, a m\u00e9dia dos gradientes m\u00e1ximos obtidos foi de 36,1\u00b123,8 mmHg .Ao todo, 75% dos pacientes declaravam classe funcional de NYHA III, e 25% reportavam classe funcional IV, previamente ao procedimento de abla\u00e7\u00e3o. Ao final de um ano de seguimento ap\u00f3s o procedimento, 66,7% estavam em classe funcional I, e 33,3% em classe funcional II .Em rela\u00e7\u00e3o a altera\u00e7\u00f5es eletrocardiogr\u00e1ficas, n\u00e3o houve mudan\u00e7as que justificassem alterar o tratamento, como bloqueios atrioventriculares ou supradesnivelamento de segmento ST. Os tr\u00eas pacientes que apresentaram altera\u00e7\u00e3o tiveram bloqueio de ramo esquerdo durante o procedimento, que persistiu ao longo do seguimento de um ano  \u00e9 utilizado como marcador de risco de morte s\u00fabita em calculadoras de progn\u00f3stico, como o modelo proposto em 2014 por Elliot et al. nas diretrizes da European Society of Cardiology.15 O modelo foi validado e posteriormente apresentado em congresso da mesma sociedade em 2017.16A obstru\u00e7\u00e3o da eje\u00e7\u00e3o do ventr\u00edculo esquerdo \u00e9 quantificada em mmHg, frequentemente por meio da ecocardiografia transtor\u00e1cica. A diferen\u00e7a de press\u00f5es observada antes e ap\u00f3s o ponto de obstru\u00e7\u00e3o \u00e9 chamada de gradiente, e o mesmo ocorre em at\u00e9 um ter\u00e7o dos pacientes com de cardiomiopatia hipertr\u00f3fica.18 O uso de manobra provocativa permite estimar com reprodutibilidade correta os gradientes m\u00e1ximos obtidos no esfor\u00e7o f\u00edsico, assim como minimizar o impacto da varia\u00e7\u00e3o di\u00e1ria do gradiente em situa\u00e7\u00f5es como desidrata\u00e7\u00e3o e seda\u00e7\u00e3o.19A forma de avalia\u00e7\u00e3o ecocardiogr\u00e1fica mais utilizada \u00e9 a mensura\u00e7\u00e3o do gradiente durante a realiza\u00e7\u00e3o da manobra de Valsalva. Alternativas menos utilizadas s\u00e3o compress\u00e3o abdominal pelo m\u00e9dico ecocardiografista, avalia\u00e7\u00e3o durante teste de esfor\u00e7o e provoca\u00e7\u00e3o farmacol\u00f3gica.20 Assim, dois ter\u00e7os dos nossos pacientes n\u00e3o utilizaram a associa\u00e7\u00e3o dessas classes farmacol\u00f3gicas, por terem atingido a FC alvo e pelo risco inerente ao uso dos mesmos. Conforme o disposto, a popula\u00e7\u00e3o amostral deste trabalho recebeu associa\u00e7\u00e3o medicamentosa apenas quando sua FC alvo estava acima de 60 bpm e quando houve tolerabilidade cl\u00ednica ao tratamento associado, o que ocorreu em cerca de um ter\u00e7o da casu\u00edstica. Assim, n\u00e3o houve redu\u00e7\u00e3o significativa das doses de medica\u00e7\u00f5es utilizadas ap\u00f3s o t\u00e9rmino de um ano de seguimento.O tratamento farmacol\u00f3gico com betabloqueadores e bloqueadores de canais de c\u00e1lcio \u00e9 a terapia inicial para controle de sintomas em pessoas com obstru\u00e7\u00e3o sintom\u00e1tica. Os \u00faltimos geralmente s\u00e3o reservados para pacientes refrat\u00e1rios aos betabloqueadores, ou em associa\u00e7\u00e3o, quando a frequ\u00eancia card\u00edaca (FC) alvo n\u00e3o foi atingida. Recomenda-se cautela com associa\u00e7\u00e3o de medicamentos bradicardizantes em pacientes com cardiomiopatia hipertr\u00f3fica, especialmente naqueles com gradientes de repouso acima de 80 mmHg e sinais de insufici\u00eancia card\u00edaca.4 em um estudo que abriu caminho para poucos outros desde ent\u00e3o. A morbidade e a mortalidade cir\u00fargica elevadas posicionam o procedimento realizado por RF guiada pelo ETE em um patamar de interven\u00e7\u00e3o minimamente invasiva. Al\u00e9m disso, essa t\u00e9cnica permite o seu emprego em pacientes mais jovens (<35anos) restri\u00e7\u00e3o relacionada \u00e0 alcooliza\u00e7\u00e3o septal. O procedimento por RF tamb\u00e9m independe da posi\u00e7\u00e3o de ramos de coron\u00e1rias septais, e torna a extens\u00e3o da les\u00e3o ap\u00f3s a abla\u00e7\u00e3o previs\u00edvel. Por outro lado, estima-se que a taxa de reinterven\u00e7\u00e3o ap\u00f3s alcooliza\u00e7\u00e3o septal seja pr\u00f3xima de 12% pela persist\u00eancia de gradiente residual sintom\u00e1tico.19 Os resultados obtidos com a abla\u00e7\u00e3o por cateter de RF na nossa amostra se assemelham aos de estudos anteriores, que utilizaram a mesma t\u00e9cnica quanto \u00e0 redu\u00e7\u00e3o do gradiente VSVE. A redu\u00e7\u00e3o variou de 59% a 85% em alguns deles.9O uso de abla\u00e7\u00e3o por RF foi relatado em 2011,O protocolo de abla\u00e7\u00e3o em nosso estudo foi intencionalmente minimalista. Utilizamos a abla\u00e7\u00e3o apenas do lado esquerdo, por meio da abordagem retr\u00f3grada a\u00f3rtica, guiada pela ETE. Dessa forma, seria facilmente reprodut\u00edvel em muitos laborat\u00f3rios. Optamos por guiar a abla\u00e7\u00e3o utilizando ecocardiografia com navega\u00e7\u00e3o por fluoroscopia, porque o gradiente m\u00e1ximo n\u00e3o se deve apenas ao septo mais espesso. Outras estruturas participam da obstru\u00e7\u00e3o, como o movimento anterior da v\u00e1lvula mitral e os m\u00fasculos papilares. O ETE tamb\u00e9m foi \u00fatil para identificar as cordoalhas da valva mitral, evitando-se sua les\u00e3o e prevenindo a insufici\u00eancia dessa v\u00e1lvula.8 Os cateteres terap\u00eauticos com ponta de 8 mm utilizados no nosso estudo n\u00e3o requerem irriga\u00e7\u00e3o para seu adequado funcionamento. Al\u00e9m disso, mesmo n\u00e3o sendo a nossa inten\u00e7\u00e3o, o uso de cateter n\u00e3o irrigado pode melhorar a rela\u00e7\u00e3o custo-benef\u00edcio quando comparado ao irrigado, e pode ser uma op\u00e7\u00e3o adequada para laborat\u00f3rios que n\u00e3o possuem mapeamento eletroanat\u00f4mico prontamente dispon\u00edvel.Os estudos iniciais que empregaram a RF para redu\u00e7\u00e3o do gradiente em CMHO utilizaram cateteres irrigados. Este tipo de cateter necessita de infus\u00e3o cont\u00ednua de soro fisiol\u00f3gico impulsionado por bomba de infus\u00e3o espec\u00edfica, com o fluxo aproximado de 1.000 ml/h durante a aplica\u00e7\u00e3o. O fluxo de infus\u00e3o \u00e9 reduzido durante o mapeamento , mas ainda neste momento o paciente recebe 120 ml/h. Em um artigo de revis\u00e3o, tr\u00eas pacientes apresentaram edema pulmonar ou congest\u00e3o ap\u00f3s o procedimento.10 ou a abla\u00e7\u00e3o percut\u00e2nea por RF septal intramioc\u00e1rdica por agulha \u00e9 realizada.11A redu\u00e7\u00e3o da classe funcional da NYHA foi o principal benef\u00edcio decorrente da redu\u00e7\u00e3o do gradiente ventr\u00edculo-arterial. Ao t\u00e9rmino de um ano, todos os pacientes que referiam sintomas compat\u00edveis com classe funcional III ou IV de NYHA relatavam melhora dos sintomas, e estes foram caracterizados com classe funcional I ou II. Isso permitiu que os pacientes melhorassem seu desempenho nas atividades nas atividades de rotina, resultado semelhante aos publicados anteriormente com outros protocolos. A melhora da classe funcional durante o per\u00edodo de observa\u00e7\u00e3o deste estudo  sugere uma modifica\u00e7\u00e3o permanente do estado funcional do septo ventricular esquerdo. Como a redu\u00e7\u00e3o da espessura septal n\u00e3o foi significativa, acreditamos que a cicatriza\u00e7\u00e3o do septo endoc\u00e1rdico esquerdo possa inibir o seu abaulamento em dire\u00e7\u00e3o \u00e0 VSVE. Acreditamos que a cicatriza\u00e7\u00e3o do septo submetido \u00e0 les\u00e3o por RF tenha inibido o abaulamento sist\u00f3lico em dire\u00e7\u00e3o \u00e0 VSVE, reduzindo, assim, o gradiente. Esse mecanismo seria diferente do dano endoc\u00e1rdico transmural, que ocorre quando a abla\u00e7\u00e3o septal alco\u00f3lica8e de at\u00e9 21% dos casos na s\u00e9rie de Lawentz et al.4 Em um estudo, o suporte do marca-passo agudo foi necess\u00e1rio em 17% dos pacientes ap\u00f3s o procedimento, mas o n\u00famero real pode estar subestimado, uma vez que o protocolo do estudo exigiu implante de cardioversor desfibrilador implant\u00e1vel (CDI) em todos os pacientes devido \u00e0 extensa abla\u00e7\u00e3o em ambos os lados do septo.5 Acreditamos que o protocolo menos agressivo, com um limiar mais baixo de interrup\u00e7\u00e3o da aplica\u00e7\u00e3o da energia de RF sobre o septo , associado a uma abla\u00e7\u00e3o guiada pelo ETE, pode ter desempenhado um papel importante na quest\u00e3o da seguran\u00e7a. Um estudo em crian\u00e7as com o diagn\u00f3stico utilizou ecocardiografia perioperat\u00f3ria para localiza\u00e7\u00e3o do ponto onde havia maior abaulamento do septo para aplica\u00e7\u00e3o de RF, utilizando cateteres terap\u00eauticos de ponta irrigada de 4 mm associados ao mapeamento eletroanatomico,12 enquanto outro utilizou tecnologia de integra\u00e7\u00e3o de imagem de ecocardiografia intracard\u00edaca associada ao mapeamento eletroanat\u00f4mico .21 Pela heterogeneidade de t\u00e9cnicas, n\u00e3o \u00e9 poss\u00edvel comparar as complica\u00e7\u00f5es dos procedimentos guiados por ETE, guiados apenas por mapeamento eletroanat\u00f4mico ou por uma combina\u00e7\u00e3o de ambos. A meta-an\u00e1lise de Poon et al. n\u00e3o foi capaz de estabelecer a correla\u00e7\u00e3o entre o uso da ecocardiografia e o sucesso ou complica\u00e7\u00f5es. No entanto, sugeriu um potencial benef\u00edcio do uso de ecocardiografia intracard\u00edaca associada ao mapeamento eletroanat\u00f4mico na localiza\u00e7\u00e3o do alvo da abla\u00e7\u00e3o.21 Essa observa\u00e7\u00e3o foi baseada na experi\u00eancia obtida no estudo de Cooper et al., que tamb\u00e9m foi coautor da meta-an\u00e1lise.21Ainda que se observe gradiente residual m\u00e1ximo provocado superior a 50 mmHg em dois casos da s\u00e9rie, consideramos que o protocolo inicial deve ser aprimorado, buscando melhores preditores de sucesso que possam ser observados ainda na cirurgia. O pequeno n\u00famero de casos desta s\u00e9rie inicial tamb\u00e9m teve como objetivo melhorar os sintomas e preservar a integridade da condu\u00e7\u00e3o el\u00e9trica, com abla\u00e7\u00e3o precisa. Talvez, em estudos futuros, uma abla\u00e7\u00e3o mais extensa possa conferir a mesma seguran\u00e7a com redu\u00e7\u00e3o maior dos gradientes em longo prazo. Ainda assim, o crit\u00e9rio para reinterven\u00e7\u00e3o somente seria atingido em um dos pacientes (gradientes superiores a 50 mmHg sintom\u00e1ticos apesar de tratamento cl\u00ednico).Quanto \u00e0 seguran\u00e7a da t\u00e9cnica aqui utilizada, n\u00e3o houve nenhum caso de bloqueio atrioventricular. O intervalo HV n\u00e3o se prolongou-se acima dos 60 ms, mesmo nos tr\u00eas pacientes que apresentaram dano ao ramo esquerdo do feixe de His. Por outro lado, com a abla\u00e7\u00e3o endoc\u00e1rdica por RF guiada pelo mapeamento eletroanat\u00f4mico, n\u00e3o houve relato de bloqueio atrioventricular em uma s\u00e9rie de casos17 A alcooliza\u00e7\u00e3o septal tamb\u00e9m esteve relacionada \u00e0 maior \u00e1rea de fibrose se comparada \u00e0 miectomia cir\u00fargica e elevada probabilidade de arritmias ventriculares no p\u00f3s-operat\u00f3rio19Ainda n\u00e3o existem estudos comparando alcooliza\u00e7\u00e3o septal com abla\u00e7\u00e3o por RF. Alguns registros sugerem que a incid\u00eancia de bloqueio atrioventricular total seja estimada em 10-15% dos pacientes submetidos \u00e0 alcooliza\u00e7\u00e3o septal, particularmente em pacientes com bloqueio de ramo esquerdo previamente ao procedimento. Al\u00e9m disso, algum grau de bloqueio atrioventricular transit\u00f3rio foi observado em cerca de 50% dos pacientes durante ou na primeira semana ap\u00f3s o procedimento.22 N\u00e3o houve complica\u00e7\u00f5es maiores no nosso grupo. Um paciente apresentou f\u00edstula arteriovenosa que necessitou de corre\u00e7\u00e3o cir\u00fargica nas primeiras duas semanas ap\u00f3s o procedimento.Uma meta-an\u00e1lise recente que incluiu 74 pacientes de seis estudos relatou dois tamponamentos que necessitaram de tratamento.sham study), uma vez que o al\u00edvio dos sintomas \u00e9 o objetivo final do tratamento. Um efeito placebo n\u00e3o pode ser afastado em um estudo de s\u00e9rie de casos como este. Pelo n\u00famero limitado de casos, n\u00e3o foi poss\u00edvel quantificar a probabilidade de surgimento de arritmias ventriculares complexas em seguimento mais longo (ainda que no per\u00edodo de um ano nenhum dos pacientes tenha apresentado justificativa para implante de cardiodesfibrilador ou marca-passo definitivo).Embora os resultados sejam encorajadores, este \u00e9 um estudo observacional com tempo de seguimento relativamente curto. Acreditamos que uma compara\u00e7\u00e3o de m\u00e9todos  seria ideal, mas o n\u00famero de pacientes submetidos a ambos os procedimentos deveria ser maior, idealmente randomizado e, por consequ\u00eancia, envolver m\u00faltiplos centros de pesquisa. Uma op\u00e7\u00e3o seria iniciar um estudo prospectivo randomizado, comparando-se um grupo interven\u00e7\u00e3o contra outro sem interven\u00e7\u00e3o  is a genetic condition that manifests itself through myocardial hypertrophy, besides fibrosis of variable extension. The obstruction of the left ventricular outflow tract (LVOT) is an anatomical condition with dynamic behavior, and can cause symptoms such as limitation to efforts, besides being responsible for cases of sudden death. The interventionist treatment proposed for this condition can be alcohol injection in the septal branches of the coronary artery or myectomy.7Myectomy has considerable morbidity and mortality rates, especially in scenarios in which there is no reference, experienced center that includes at least more than ten surgeries a year. This motivated the development of less invasive alternatives, such as septal alcoholization.Despite the lower postoperative morbidity and the need for postoperative units with less structure, advocates of alcoholization are also faced with significant limitations. The need for a favorable coronary anatomy  and the unpredictability of the extension of myocardial damage reduce the chances of applying this technique as a routine.10 The ablation was performed in an electrophysiology or hemodynamic room, with access to the interventricular septum through retrograde aortic or transseptal path (rarely with an approach associated with the right septum). The catheters used in previous studies were irrigated, or had an 8mm-tip in adults. The results ranged, especially because of the techniques used to approach the gradient.11Recent studies show that the RF applied locally through a catheter has been efficient due to the better control of the injury extension and to the more precise placement of the catheter in the thicker region of the interventricular septum. These catheters were the same ones used in invasive electrophysiology for the treatment of ventricular and atrial arrhythmia. The researchers used intracavitary electroanatomic mapping to establish the septal region to be approached, besides the position of the catheter, respectively, aiming at reducing the risk of affecting the conduction system.12We found only one study about RF catheter ablation in the pediatric population, using the electroanatomic mapping associated with transesophageal echocardiography.The RF catheter ablation allows the easy access of therapy to gradients located in the basal portions of the left ventricle, as well as to intraventricular gradients; therefore, it is not limited by coronary anatomy. The use of a transesophageal echocardiography (TEE) allows the real time location of the point of obstruction in real time during the procedure.Catheter ablation using electrophysiology techniques, by placing the therapeutic 8mm-tip catheter with the help of the TEE, is a simple method that allows the precise localization of the critical septal area to establish the ventricular-aortic gradient. These premises should make this technique simpler, more efficient and safer for the reduction of the LVOT obstruction.To assess the safety and efficacy of RF application in the interventricular septum of patients with OHCM through 8mm-tip catheters whose placement on the target area was guided by TEE, aiming at reducing the gradient in LVOF.To evaluate the repercussion of ventricular septal ablation on symptomatology, based on the functional class, besides the effects on electrocardiography and on the transthoracic echocardiogram before and three months and one year after the procedure.13As proof of concept, we chose to conduct a pilot procedure in a symptomatic 63-year old patient, who had contraindication for an approach by hemodynamics and high surgical risk. The patient (not included in this series) presented mean post-myectomy residual ventricular gradient. The individual underwent a successful catheter ablation in the target area, with reduction of the initial gradient from 100 mmHg to less than 25 mmHg, and this result was maintained after 24 months of follow-up. The transseptal approach was used at first, but the access path was changed to the retrograde aortic path due to the instability of the catheter and the difficulty to access the proposed site for ablation. A magnetic resonance for control three months after the intervention identified the RF injury, caused by the use of catheters, adjacent to the lesion caused during the surgery.Twelve patients with OHCM were selected from the Cardiomyopathy Section of Instituto Dante Pazzanese de Cardiologia, with refractory symptoms to the pharmacological treatment. The 12 patients were selected for being in accordance with the inclusion and exclusion criteria, and for being interested in participating in the study, as well as being available to attend appointments and subsequent examinations of the protocol. They were all submitted to the following examinations: electrocardiography (EKG), transthoracic echocardiogram with doppler, besides blood profile including blood count, fasting glycemia, urea, creatinine, coagulogram.The inclusion criteria were: individuals with symptomatic OHCM, whose gradient is provoked by a Valsalva maneuver higher than or equal to 50 mmHG, despite the treatment ; medical contraindication for myectomy ; or contraindication for septal alcoholization due to technical parameters. The excluded participants were: those with a definitive pacemaker or implantable cardioverter defibrillator, since they influence the mode of stimulation and the parameters in the ventricular gradient. It also would make it difficult to measure the effects of ablation in the heart conduction system, masking late atrioventricular blocks. Besides, we excluded individuals with atrial fibrillation, since the measurement of the gradient becomes little reproducible due to the irregularity of the heart rate (HR). Since the measurements would be necessary for the decision of interrupting ablation or continuing to apply it, the choice was to remove this variable in the initial stage of the protocol. Patients with ongoing infections and history of complex ventricular arrhythmia, or with a history of sudden death recovered due to the probable indication of an implantable cardioverter defibrillator during follow-up, were also excluded. The transthoracic echocardiography at rest was performed in the morning, and patients were on their usual medications.The Valsalva maneuver was performed by an experienced examiner, who explained its execution to the patients in detail. The echocardiographic records were obtained throughout the effort and relaxation stages, and were considered as the highest gradient values. The proper execution of the maneuver was defined by the evaluator, through the pre-load reduction, defined by the reduction of the mitral flow E-wave in the first attempt. Only when the patient was executing the maneuver properly, at another time, the gradients were recorded in the outflow. There was no control using barometers/flow meters.The protocol and consent forms were approved by the Research Ethics Committee and are available in Plataforma Brasil .The procedures were performed in a dedicated electrophysiology room, by electrophysiologists and cardiologists working with echocardiography, and with the supervision of the anesthesiology staff.The strategies used by other researchers were based on the premise that the thicker point of the septum was the same where the gradient began. The gradient, in turn, is composed of the systolic anterior movement of the anterior leaflet of the mitral valve, movement of the papillary movement and septum. These anatomic data, point in which the gradient begins, can be observed with more accuracy by the echocardiogram during the ablation.14by observing the cavities in several angles  for the anatomical evaluation. The echocardiographic image allowed to identify the tip of the therapeutic catheter, which was overlapped to the septal region by the electrophysiologist, when it was possible to identify the aliasing. The echocardiography was then used to observe the distance between the anterior leaflet of the mitral valve and the stability of the contact with the region of interest.All of the procedures were performed under general anesthesia. A right femoral artery puncture was performed with an 8F guiding catheter to access the septal region of the left ventricle via retrograde aorta; two right femoral vein punctures with a 6F guiding catheter were performed to place the quadripolar catheter in the right septum; and we identified the His axis electrogram, besides another quadripolar catheter tip in the right ventricle. Then we measured the ventricular-aortic gradient and located the point of highest acceleration of the flow with the transesophageal echocardiography, characterizing the area of larger obstruction. The transesophageal echocardiography was performed under general anesthesia, and the images were initially obtained in the esophageal position. When necessary, with the evaluation of the short axis position, the probe was moved to the transgastric position. The examination was performed according to the protocol of the American Society of Echocardiography,oC), followed by a new measurement of the gradient through a hemodynamic catheter, besides the assistance of the echocardiogram. To each application that resulted in the reduction of at least 25% of the initial gradient, four new applications were added to adjacent regions, observing the distance of at least 1 cm of the His axis electrogram  or EPtracer  polygraph, the deflectable quadripolar catheter was placed in the His axis region; likewise, a quadripolar catheter was placed on the apical region of the right ventricle, and a bidirectional 8F therapeutic catheter with an 8mm-tip was placed in the left ventricle through the retroaortic course. The therapeutic catheter was impacted on the septal region of the LF (as previously described), in the point of the highest acceleration of the blood flow, where the RF was applied for 120 seconds  for 24 hours, and were referred to the nursery for 3 to 5 days, with an assessment of troponin in the first 48 hours. Then, an echocardiography was performed 24 hours and six days after the procedure . After six weeks, three months, six months and 12 months, the patients were clinically reassessed. The transthoracic echocardiogram was repeated on the third and on the 12nd month.r .The distribution of the continuous variables was assessed by the Shapiro-Wilk normality test for the comparative analyses of periods . For the variables with normal distribution, the paired Student\u2019s t-test was used and the results were presented as mean and standard deviation. For those with non-normal distribution, the paired Wilcoxon test was used, and the results were presented as median and interquartile range. Thus, only the septal thickness analysis after 12 months was carried out with the Wilcoxon test. The other variables were analyzed using the Mann-Whitney test. In all of the conclusions obtained through the inferential analysis, the considered significance level was \u03b1 = 5%. The functional class was the only analyzed categorical variable, and we did not use a statistical test for the pre and post-procedure comparison, considering that all individuals improved. The software used for statistical analyses was the REighteen patients were pre-selected. One of them was excluded for being less than 18 year of age; two for reporting paroxysmal atrial fibrillation or at the time of the procedure; two others, for having symptoms that were possibly related to other causes other than the gradient; and one individual was excluded due to a diagnosis of amyloidosis .The 12 included patients corresponded to nine women and three men. The clinical and echocardiographic characteristics of this population are presented in The mean duration of the procedures was three hours. The placement of the therapeutic catheter indicated by the echocardiography professional corresponded to the region with the highest gradient, as demonstrated in The mean of initial maximum gradients measured during the procedure was 89 mmHg . At the end, this mean decreased to 36.9 mmHg (\u00b115.29). There were three cases of left bundle branch block related to the procedure, without the increment of the HV interval . There were no transient atrioventricular block nor prolongation of the PR interval in any of the cases. Likewise, there were no pericardial effusion nor clinical embolic brain events. One patient presented with arteriovenous fistula in the right inguinal region, which had to be surgically corrected. During hospitalization, all patients received an increased serum dose of troponin. The maximum value was reached in the first 12 hours, and was, in average, 7.15 ng/dL (\u00b14.36). The mean time of hospitalization was 5.8 days (\u00b12.7), per protocol. One patient was hospitalized for 13 days for the assessment of a hematoma in the left inguinal region, which was then diagnosed and treated as arteriovenous fistula .There was a reduction of the provoked and at rest gradients in all persistent patients during follow-up. The data regarding the reduction of provoked and at rest gradients are presented in It was observed that the reduction of the mean of maximum gradients was from 96.8\u00b134.7 mmHg to 62.7\u00b125.4 mmHg three months after the procedure (p=0.0036). Ap\u00f3s um ano, a m\u00e9dia dos gradientes m\u00e1ximos obtidos foi de 36,1\u00b123,8 mmHg .Overall, 75% of the patients declared being in NYHA functional classification III, and 25% reported functional classification IV before the ablation procedure. One year after the procedure, 66.7% were in functional classification I, and 33.3%, II .Regarding electrocardiographic changes, there were none that could justify a different treatment, such as atrioventricular blocks or ST segment depression. The three patients that presented with changes had left bundle branch block during the procedure, which persisted throughout the one-year follow-up period  is used as a marker for risk of sudden death in calculators of prognosis, such as the model proposed in 2014 by Elliot et al. in the guidelines of the European Society of Cardiology.15 The model was validated and then presented at a congress of the same society, in 2017.16The obstruction of the left ventricular ejection is quantified in mmHg, often through the transthoracic echocardiography. The difference of pressures observed before and after the point of obstruction is called a gradient, and the same occurs in up to one third of the patients with hypertrophic cardiomyopathy.18 The use of a provocative maneuver allows to estimate the proper reproducibility of maximum gradients obtained at physical effort, as well as to minimize the impact of the daily variation of the gradient in situations such as dehydration and sedation.19The most used form of echocardiographic evaluation is the measurement of the gradient during the Valsalva maneuver. Less used alternatives are abdominal compression by the echocardiography physician, evaluation during an exercise stress test and pharmacological induction.20 Therefore, two thirds of our patients did not use the association of these pharmacological classes, since they reached the target HR and due to the inherent risk of using them. As shown, the sample of this study was only submitted to drug association when the target HR was above 60 bpm, and when there was clinical tolerance towards the associated treatment, which occurred in about one third of the sample. Therefore, there was no significant reduction of medication doses used after the conclusion of the one-year follow-up period.The pharmacological treatment with betablockers and calcium channel blockers is the initial therapy to control symptoms in people with symptomatic obstruction. The later are usually indicated for patients who are refractory to betablockers, or in association, when the target HR is not reached. It is important to be careful about the association of bradycardizing drugs in patients with hypertrophic cardiomyopathy, especially those whose gradients at rest are higher than 80 mmHg, with signs of heart failure.4 in a study that made way to a few others since then. The high morbidity and mortality surgical rates established the procedure of TEE-guided RF as a minimally invasive intervention. Besides, this technique can be used in younger patients (<35 years), and such a restriction is related to the septal alcoholization. The RF procedure is not dependent on the position of septal coronary branches, and makes the extension of the post-ablation lesion predictable. On the other hand, it is estimated that the rate of reintervention after septal alcoholization is close to 12% due to the persistence of the symptomatic residual gradient.19 The results obtained with the RF catheter ablation in our sample are similar to those of previous studies, which used the same technique as to the reduction of the LVOF gradient. The reduction ranged from 59% to 85% in some of them.9The use of RF ablation was reported in 2011,The ablation protocol in our study was intentionally minimalist. We used ablation only on the left side, through the retrograde aortic approach, guided by TEE. Therefore, it would be easily reproducible in many laboratories. We chose to guide the ablation using echocardiography with fluoroscopy, because the maximum gradient is not only owed to the thicker septum. Other structures participate in the obstruction, such as the anterior movement of the mitral valve and papillary muscles. TEE was also useful to identify the mitral valve strand, thus preventing its lesion and failure.8 The therapeutic catheters with 8-mm tips used in our study do not require irrigation for functioning properly. Besides, even if it was not our intention, the use of a non-irrigated catheter can improve the cost-benefit relationship when compared to the irrigated one, so it can be a viable option for laboratories that do not have electroanatomic mapping promptly available.The initial studies that used RF to reduce the gradient in OHCM used irrigated catheters. This type of catheter requires a continuous infusion of physiological serum pumped by a specific infusion pump, and approximate flow of 1,000 ml/h during the application. The infusion flow is reduced during mapping , but even in this moment the patient receives 120 ml/h. In a review article, three patients presented with pulmonary edema or congestion after the procedure.10 or the needle percutaneous intramyocardial septal RF ablation are performed.11The reduction of the NYHA functional classification was the main benefit resulting from the reduction of the ventricular-arterial gradient. After one year, all patients who referred having symptoms compatible with NYHA functional classifications III or IV reported improvement in the performance of activities of daily living, and similar results were found in other studies. The improvement of the functional classification during the observation period of this study (until the end of the first year) suggests a permanent modification of the functional status of the left ventricular septum. Since the reduction of the septal thickness was not significant, we believe that the healing of the left septal endocardium may inhibit its bulging towards the LVOF. We believe that the healing of the septum submitted to the RF lesion has inhibited the systolic bulging towards the LVOF, thus reducing the gradient. This mechanism would be different from the endocardial, transmural damage, which occurs when the alcoholic septal ablation8and in up to 21% of the cases in the series by Lawentz et al.4 In a study, the support of the acute pacemaker was necessary in 17% of the patients after the procedure, but the real number can be underestimated, once the study protocol required an implantable cardioverter defibrillator (ICD) in all patients due to the extensive ablation in both sides of the septum.5 We believe that the less aggressive protocol, with a lower threshold for interrupting the application of RF energy on the septum , associated with TEE-guided ablation, may have played an important role in the matter of safety. A study with children with the diagnosis used perioperative echocardiography to locate the site with larger septal bulge to apply the RF, using therapeutic catheters with irrigated 4mm-tips associated with electroanatomic mapping,12 whereas another analysis used an intracardiac echocardiography image integration technology associated with electroanatomic mapping .21 Due to the heterogeneity of techniques, it is not possible to compare the complications of the TEE-guided procedures, those guided only by electroanatomic mapping, or by a combination of both. The meta-analysis by Poon et al. was not able to establish a correlation between the use of echocardiography and the rates of success or complications. However, it suggested a potential benefit of the use of intracardiac echocardiography associated with electroanatomic mapping in the localization of the target of the ablation.21 This observation was based on the experience obtained in the study by Cooper et al., who was also a co-author of the meta-analysis.21Even if we can observe a maximum residual provoked gradient higher than 50 mmHg in two cases of the series, we consider that the initial protocol should be improved, in search of better success predictors that can be observed still in surgery. The small number of cases in this initial series also aimed at improving the symptoms and preserving the integrity of the electric conduction, with precise ablation. Maybe, in future analyses, a more extensive ablation can provide the same safety and lead to a higher reduction of gradients in the long term. Still, the criterion for reintervention would only be reached in one of the patients .As to the safety of the technique used here, there were no cases of atrioventricular block. The HV interval was not prolonged for more than 60 ms, even in the three patients that presented damage in the left branch of the His axis. On the other hand, with the endocardial ablation by RF guided by electroanatomic mapping, there were no reports of atrioventricular block in a case series17 Septal alcoholization was also related to the larger area of fibrosis if compared to myectomy, and high changes of ventricular arrhythmias in the postoperative period.19There are no studies comparing septal alcoholization and RF ablation. Some records suggest that the incidence of complete atrioventricular block is estimated in 10-15% of the patients who undergo septal alcoholization, especially those with left bundle branch block before the procedure. Besides, some level of transient atrioventricular block was observed in about 50% of the patients during or one week after the procedure.22 There were no major complications in our group. One patient presented with arteriovenous fistula, which required surgical correction in the two weeks after the procedure.A recent meta-analysis that included 74 patients of six studies reported two cases of tamponade that required treatment.Even though the results are encouraging, this is an observational study, whose follow-up time is relatively short. We believe that a comparison between methods  would be ideal, but the number of patients submitted to both procedures should be higher, ideally randomized and, as a consequence, involving multiple research centers. An option would be to start a randomized prospective study and compare a group with intervention and another one without intervention (sham study), once the relief of symptoms is the final objective of the treatment. A placebo effect cannot be ruled out in a case series study such as this one. Due to the limited number of cases, it was not possible to quantify the probability of complex ventricular arrhythmias in the long term (even if none of the patients has presented a justification for an implantable cardioverter defibrillator or definitive pacemaker in a one-year period).TEE-guided RF endocardial ablation is an efficient procedure, safe in the long term, which reduces the gradient of LVOF and improves the functional level of patients with severe obstruction."}
+{"text": "The program was designed and reapplied with an interval of one week under the same conditions. The performance in each task was presented from central tendency and dispersion data and was conducted using the Intraclass Correlation Coefficient (ICC), based on the 95% confidence interval (CI).The analyses showed a positive and significant ICC (p<0.01) for the questionnaire and auditory tasks, except for auditory closure, in the right and left ears and figure-ground in the left ear. The questionnaire mean ICC was 0.742 and ranged from \u22120.012 to 0.698 for the auditory tasks.Based on mean results and upper limit of the CI, the findings showed agreement between moments, classified as good for the questionnaire and moderate to good for five of the seven auditory analyzed tasks (ICC>0.05 and <0.9). The results of the reliability study represent an important parameter for validating the program for the studied age group. These skills involve different auditory mechanisms, such as sound localization and lateralization, discrimination and recognition of auditory patterns, dichotic listening, listening in environments with competitive sounds or degraded acoustic signal.Central auditory processing (CAP) is related to the efficiency of auditory information perception by the central auditory nervous system (CANS) and the underlying neurobiological activity, constituting a group of specific skills that an individual must have to understand what is heard.To assess CAP abilities, it is important to understand the relationship between the CANS and the peripheral auditory nervous system (PANS). The PANS comprises the outer, middle, and inner ears and the auditory nerve. It is responsible for capturing and transmitting the auditory signals to the CANS, which will interpret the information. Then, these are distinct but interdependent processes. CAP assessment can be performed either through electrophysiological procedures or a battery of special behavioral tests, which identify the presence of central auditory processing disorder (CAPD), that is, a deficit in the neural processing of auditory stimuli and consequent impairment of the assessed auditory skills,3. In addition, alterations in auditory skills can affect a child\u2019s learning and development processes, due to an interdependence with higher cognitive functions, such as language, memory, and attention,5. CAPD in school-age children can coexist with other disorders, such as attention deficit hyperactivity disorder (ADHD), language development disorders, dyslexia, among others,7. However, specific signs of CAPD related to deficits along the auditory pathway can also occur in isolation, such as problems to understand speech in noisy environments, poor understanding in situations with increased speech rate, inability to discriminate similar words or sounds or conduct complex auditory commands. These complaints lead to issues that, in most cases, are seen in a low academic performance. Studies show an association between the presence of CAPD and specific learning disorders, mainly related to reading and writing processes and mathematical calculations, as well as phonological deficits and speech perception, including suprasegmental aspects of speech.Studies show peripheral auditory dysfunction\u2014with or without a history of secretory otitis media in early childhood\u2014can result in immature auditory pathways and central auditory skills. In recent years, the development of new screening test batteries for auditory skills has been the topic of studies-15 aiming to combine the countless possibilities of technology in health with procedures that fulfill the screening requirements, considering the easy access and application time, different auditory mechanisms, and interactive activities.Auditory screening, which includes procedures that evaluate both the peripheral and central segments, allows an early identification and immediate intervention of auditory alterations in this population, minimizing potential school losses. The program consists of auditory tasks and a self-perception questionnaire for children, parents, and teachers. In order to continue AudBility-related studies and contribute to program validation, this study aimed to investigate the test-retest reliability in a group of typically developing children aged six to seven years.Considering the above, sensitivity, specificity and reliability data must be studied to support the validation of new procedures. In this context, the \u201cAudBility\u201d battery was created in Brazil. It is an online playful and interactive program for screening auditory skills that has been studied and improvedThis is a cross-sectional, descriptive-analytical, quantitative reliability study approved by the Research Ethics Committee of the State University of Campinas (Unicamp) under approval n.\u00ba 1.561.422 and conducted in partnership with a public school. The parents and/or guardians of all children included in the study signed an informed consent form (ICF) and an assent form., invitation letters were sent to parents/guardians of male and female children, aged 6 to 8 years, native Portuguese speakers. Children with a confirmed diagnosis of peripheral hearing loss were excluded, as well as those with cognitive/neurological alterations that affected their neuropsychomotor or language development that were known to the pedagogical coordination or the child\u2019s teacher or included in school records \u2013 conditions that could affect the child\u2019s understanding of the tasks to be performed.First, as part of the study of normative data from AudBility, which includes our present investigationIn total, 203 invitation letters were sent. Of these, 157 (77%) agreed to participate. Three children did not meet the selection criteria and were excluded, totaling 154 children who underwent peripheral screening and AudBility procedures. Of all 154 children, 95 were 8 years old and had already been screened more than two months before, which did not allow the inclusion of 8-year-old children in the reliability analysis. In addition, this study included only children with proper school performance for the age group according to the teacher in charge, without retention or additional school tutoring, and who agreed to participate in the retest stage. Therefore, the final sample of this study consisted of 29 children aged 6 and 7 years, 16 (55.17%) female and 13 (44.83%) male children, mean age 6.68 years (\u00b10.54). Regarding the procedures, before applying the AudBility battery, meatoscopy was performed with a Heine otoscope and immittance measurements using Interacoustics MT10 to assess the middle ear conditions. Children who had excess cerumen were referred to removal service and later included for data collection. Children who presented altered results in immittance measurements, that is, type B or C tympanogram, and absence of ipsilateral acoustic reflex, were referred to complete audiological evaluation, otorhinolaryngological evaluation, and were excluded from data analysis.After immittance screening, the AudBility program was applied in a quiet room provided by the school, away from the other classrooms and schoolyard. During breaks and changes in school shifts, the application was interrupted by the researcher. The battery was applied with the help of a speech therapist with experience in the AudBility program, who was also one of the researchers of this study. A desktop computer connected to the internet and Panasonic RPHC720 noise-canceling over-ear headphones were used.AudBility consists of a self-perception questionnaire about auditory skills and auditory tasks. In addition, it has three modules describing the tasks, one for children aged 6 to 8 years; one for children aged 9 to 12, provided they are able to read; and one for children over 13 years old. This study analyzed data collected from the application of the module to 6- to 8-year-old children. In this module, the activities do not require the student to know how to read and have pictographic resources. \u2013 has 12 questions to be answered with the frequency of occurrence of everyday situations, with pictographic support for the child\u2019s answers and a 5-point Likert scale with the following options: always (1.0), often (2.0), sometimes (3.0), rarely (4.0), never (5.0). Every question is preceded by an example of situation to facilitate the child\u2019s understanding.The questionnaire assessing the self-perception of skills \u2013 an adapted version inserted in the programThe researcher read the explanation screen of the questionnaire from the program and, after ensuring the child understood it, he assisted in questionnaire application by reading the questions aloud and helping the child check the answer on the computer screen. At the end, the program computed the score for individual questions and calculated the total score, ranging from 12 to 60. For the auditory tasks, the program automatically calibrated the sound output and the headphones, with the computer volume mixer set to 50%. The researcher asked the child if that was a comfortable listening level. The volume could be adjusted as required.The screening protocol consisted of seven auditory tasks, as follows: sound localization, figure-ground, auditory closure, dichotic digits test, temporal resolution, and temporal ordering of frequency and duration. As the auditory closure and figure-ground tasks were analyzed by ear, there were nine analysis variables. The tasks were interactive and playful and were designed considering behavioral tests that are part of the diagnostic battery, but with different acoustic parameters and a reduced amount of stimuli in every task. Every task has an explanation and training screen. The task only started after confirming the child understood the activity and the researcher helped the child answer on the computer screen. At the end of task, the program displayed a screen congratulating the child with the percentage of correct answers and/or threshold obtained. This information is stored in the program and can be displayed with a summary of the child\u2019s performance in all the tasks and the questionnaire score . This screen also shows information about the total battery application time and time per task.One week after the program application, all 29 schoolchildren were invited to participate in the retest stage. In this stage, the same evaluator reapplied the procedures of the test stage, including meatoscopy, immittance measurements, and the AudBility program. The same conditions of the test stage were present in terms of material resources , parameters of stimulus intensity, and order of tasks, instructions for every task, and method of application/help with marking the results. The participants were equally motivated to show the same level of attention while performing the tasks in both moments of program application.For data analysis, the average performance for each of the nine variables after the application of the tasks was calculated using the percentage of correct answers or average threshold for the temporal resolution task. These data were presented as measurements of central tendency and dispersion, and as the mean score obtained in the self-perception questionnaire.. In the analysis, negative ICC values are interpreted as disagreement and positive values as agreement between the stages. Zero indicates absence of disagreement or agreement between the stages (chance). In the ICC analysis, the correlation level should be evaluated, considering not only the mean ICC but also the 95% confidence interval, based on the following classification: values below 0.5 indicate poor reliability, between 0.5 and 0.75 moderate reliability, between 0.75 and 0.9 good reliability, and values above 0.9 indicate excellent reliability.An intraclass correlation coefficient (ICC) was used to assess the agreement or disagreement between the test and retest stages, i.e., the degree of reliability, based on a mixed two-factor model of absolute agreement using single measurements.In a validation process, the reliability of the construct is related to the constancy, precision, and homogeneity of the results when the individual is evaluated more than once. It is, therefore, a highly important assessment for the significance of collected measurements. Different criteria are used in reliability studies, one of the most frequently used in the health area is the test-retest technique, in which the same measurement is applied twice to the same subjects and agreement is observed between the two moments. Ideally, retests, performed a few days or a few weeks after the test, should present similar results. The literature has studies assessing auditory processing with up to 60-day period between the two moments of analysis,21,22. In screening studies, the sample rate varies from at least 5% to 10% of the total screened sample,14. Our study attempted to respect this guidance, and reassessments were conducted one week later by the same evaluator, under the same evaluation conditions. Regarding the sample rate, considering all 154 children who underwent screening, the sample of 29 children (18.83%) was, therefore, a representative sample.This technique can be affected by environmental factors such as evaluators, sample characteristics, instrument type, and administration methods. Therefore, the steps should be applied under the same conditions and analyzed in a statistically coherent manner. In this previous study, the older age group with similar results reinforces the good performance of our sample, consisting of younger students. In addition, the mean score above 45 obtained in the questionnaire is also consistent with the expected performance described in a study conducted with the SAB questionnaire in its translated version, reinforcing the absence of risk for CAPD in the sample, even considering it was selected with the limitation of a criterion based on a qualitative analysis of the teacher and school records, without a formal school performance assessment.According to the descriptive data in . This variability of analyses does not favor direct comparisons between different findings, despite being a frequent topic in the field. Over the last decades, many studies have assessed reliability using test-retest methods, including development of screening batteries or auditory processing tests,19,24-27.Different statistical tests can be used in the test-retest analysis, including the intraclass correlation coefficient (ICC), which is frequently recommended in recent literature, allowing a true analysis of agreement between moments. Other correlation measurements are Pearson\u2019s correlation coefficient, Spearman\u2019s correlation coefficient, paired Student\u2019s t-test, and Wilcoxon\u2019s corresponding non-parametric test,28. The result also highlights the findings discussed in a previous study in which the same instrument effectively differentiated a group of students based on the variable of academic performance, emphasizing the importance of validation studies that include not only test-retest reliability but also a study of sensitivity and specificity with cutoff point for CAPD risk and occurrence, based on a correlation with diagnostic tests.Good test-retest reliability of the self-perception questionnaire studied here highlights the importance of including this type of instrument as a complementary assessment of auditory performance in auditory screening battery at school. Several authors emphasize this fact considering the questionnaire is a simple and reliable method, as long as it is designed according to adequate psychometric principles and validation data are available to demonstrate the functional impact of CAPD on daily life, from a qualitative point of view was assessed using test-retest reliability with 38 participants, with an average of 40 days between the two moments of analysis. The findings were considered unsatisfactory, with poor correlations in most battery tasks. Later, other researchers studied the SCAN-C, a version for children, and found improved scores in the second application, suggesting the effect of practice. Also, a revised version of the battery was applied to a sample of 680 schoolchildren; 145  were included in a test-retest analysis with a 1-week interval between applications, and low to moderate correlations were found, except for the figure-ground skill, data that agree with our findings. In another validation study that analyzed a screening battery named STAP \u2013 Screening Test for Auditory Processing, 141 schoolchildren were screened by the program and, of these, 50  underwent the retest stage with a two-month interval between assessments. Pearson\u2019s correlation coefficient showed statistically significant findings ranging from 0.82 to 0.93, suggesting good reliability.Despite the variability of studies with discrepant methods to obtain data and analyze the results, the findings regarding reliability of the auditory tasks are consistent with other studies. The first version of the SCAN-A (Test for Auditory Processing Disorders in Adolescents and Adults), a computer screening program that is similar to AudBility, the viability of program application to different age groups was studied together with test-retest analysis with 1-week interval between the moments of application, involving 5 auditory mechanisms evaluated . Using the Wilcoxon signed-rank test, the authors found the effect of practice with a better performance in the second application in three of the five mechanisms evaluated. They also found the same effect in three conventional tests from the behavioral evaluation battery of auditory processing, showing a correlation between screening and diagnostic procedures, but not in all of them.More recently, in an initial validation study for Feather Squadron,14,24,27. Therefore, the findings of our study indicate reliability of the program applied to this age group, contributing to its validation.Then, the different studies discussed here present batteries with minimal agreement or moderate correlation in most tasks that comprise the CAP screening protocols, although not all tests demonstrate this expected degree of correlation. When considering the description of the average performance of correct answers in the tasks, both for sound localization, whose agreement was low, and for auditory closure and figure-ground skills in the left ear, differences were observed between the moments, with improved performance in the retest when compared to the other tasks, with positive results and a higher degree of agreement, suggesting a possible effect of practice, although a paired statistical analysis of this difference was not performed. Even so, we may consider the hypothesis that such difference may explain disagreement between the moments for these tasks.Our findings did not demonstrate statistically significant results in the tasks of auditory closure in both ears and figure-ground in the left ear. Auditory closure is the ability to understand an incomplete or distorted sound message, which does not favor decoding phonemic aspects of a speech signal. Figure-ground skill consists in interpreting sentences in the presence of a competitive message. These are essential auditory skills for speech understanding, especially in the school environment.This discussion and analysis are relevant particularly for future studies that aim to use the AudBility battery in order to monitor the maturational development of auditory skills or as a monitoring instrument for CAPD rehabilitation in children. The authors emphasize the calculation of \u2018difference \u2013 D\u2019 that represents the degree of improvement or worsening between the moments must be considered and deducted to obtain the actual degree of improvement (or worsening) of the child over time, in a process of intervention or even for proper understanding of the instrument sensitivity for the measurement of neuromaturational development of auditory skills over timeSome factors must be discussed and may also support hypotheses regarding differences in performance between the evaluation moments, considering the tasks presenting low agreement. The fact that school performance was not evaluated with a validated formal instrument, but based on the teacher\u2019s report, justifies a more heterogeneous sample from the point of view of learning processes. Although limiting, this aspect does not make the reliability study unfeasible, since the analyses are comparative different moments of the same subject. Despite the above, this aspect does not seem to fully explain the discrepancies found, since the performance was better in the second application.. Although presenting typical development, the absence of formal assessments that include cognitive and language screening favors a more heterogeneous sample, a factor that can also explain the disagreement between the evaluation moments in some tasks. However, it is a school screening application, and an extensive evaluation protocol would make the proposal unfeasible. In addition to cognitive aspects, behavioral factors or intrinsic variability of each individual must be considered, such as sleep, tiredness, alertness, appetite, and degree of motivation to perform activities. From a methodological perspective, although the technical conditions of program application were the same in both moments, it was not possible to control all aspects mentioned above. The child was not necessarily evaluated at the same time as the school period and may be more or less tired from one week to the next, for example. From a motivational point of view, familiarity with the technological resource may be an additional factor of motivation and engagement when performing the activities, which may also have contributed to a better performance in the second evaluation.Another aspect to be discussed is the influence that CANS-independent cognitive mechanisms can have on the expected performance of an individual undergoing CAP assessment, such as memory and attentionFinally, in general the mean ICC obtained in tasks with a significant positive result is equivalent to a moderate degree of reliability, but when considering the analysis based on the confidence interval, this classification ranged from bad to good and produced uncertainty data from a statistical perspective. As discussed above, although in agreement with other validated screening batteries, this finding justifies the importance of further studies assessing a larger sample of schoolchildren in order to limit the confidence interval obtained and investigate the psychometric properties of the tasks for other age groups and other pediatric populations, which could provide a better understanding of the program validation for different populations.Considering the age group studied and the results found, AudBility showed good agreement in the questionnaire between the evaluation times; moderate agreement in the tasks of temporal ordering of frequency and duration, temporal resolution, figure-ground in the right ear, and dichotic digits test; and low agreement, although statistically significant, in the sound localization task. The findings from the reliability study represent an important parameter for AudBility validation. . As habilidades relacionam-se com diferentes mecanismos auditivos, tais como a localiza\u00e7\u00e3o e lateraliza\u00e7\u00e3o do som, discrimina\u00e7\u00e3o e reconhecimento de padr\u00f5es auditivos, escuta dic\u00f3tica, escuta em ambientes com sons competitivos ou sinal ac\u00fastico degradado.O processamento auditivo central (PAC) relaciona-se com a efici\u00eancia da percep\u00e7\u00e3o da informa\u00e7\u00e3o auditiva pelo sistema nervoso auditivo central (SNAC) e a atividade neurobiol\u00f3gica subjacente, sendo um conjunto de habilidades espec\u00edficas necess\u00e1rias para a compreens\u00e3o do que se escuta.Para avaliar as habilidades do PAC \u00e9 fundamental compreender a rela\u00e7\u00e3o entre o SNAC e sistema nervoso auditivo perif\u00e9rico (SNAP). O SNAP, constitu\u00eddo pelas orelhas externa, m\u00e9dia e interna e nervo auditivo, \u00e9 respons\u00e1vel por captar e transmitir os sinais auditivos para o SNAC, que ir\u00e1 interpretar a informa\u00e7\u00e3o, sendo, portanto, processos distintos, por\u00e9m interdependentes. A avalia\u00e7\u00e3o do PAC pode ser realizada tanto por meio de procedimentos eletrofisiol\u00f3gicos quanto por uma bateria de testes especiais comportamentais, possibilitando identificar a exist\u00eancia ou n\u00e3o de d\u00e9ficits no processamento neural dos est\u00edmulos auditivos e consequente comprometimento das habilidades auditivas avaliadas. Em caso de d\u00e9ficit, caracteriza-se o Transtorno do Processamento Auditivo Central (TPAC),3. Al\u00e9m disso, altera\u00e7\u00f5es nas habilidades auditivas podem interferir no processo de aprendizagem e desenvolvimento da crian\u00e7a, devido ao fato de haver interdepend\u00eancia com as fun\u00e7\u00f5es cognitivas superiores, tais como linguagem, mem\u00f3ria e aten\u00e7\u00e3o,5. A ocorr\u00eancia do TPAC na crian\u00e7a em idade escolar pode coexistir com outros transtornos, como o Transtorno de D\u00e9ficit de Aten\u00e7\u00e3o e Hiperatividade (TDAH), Transtornos do Desenvolvimento da Linguagem, Dislexia, entre outros,7. Entretanto, existem manifesta\u00e7\u00f5es espec\u00edficas ao TPAC relacionadas aos d\u00e9ficits ao longo da via auditiva e que podem ocorrer tamb\u00e9m isoladamente, como a dificuldade em compreender a fala em ambientes ruidosos, baixa compreens\u00e3o diante de situa\u00e7\u00f5es com velocidade de fala aumentada, dificuldades em discriminar palavras ou sons similares e/ou seguir comandos auditivos complexos. Essas queixas acarretam dificuldades que, na maioria dos casos, manifestam-se a partir de um baixo desempenho acad\u00eamico. Estudos demonstram associa\u00e7\u00e3o entre a presen\u00e7a do TPAC e transtornos espec\u00edficos de aprendizagem, principalmente relacionado aos processos de aquisi\u00e7\u00e3o da leitura e escrita e c\u00e1lculos matem\u00e1ticos, bem como d\u00e9ficits fonol\u00f3gicos e percep\u00e7\u00e3o da fala, incluindo aspectos suprassegmentais do discurso.Estudos apontam que a disfun\u00e7\u00e3o auditiva perif\u00e9rica, acompanhada ou n\u00e3o de hist\u00f3ria de otite m\u00e9dia secretora na primeira inf\u00e2ncia pode resultar em imaturidade no desenvolvimento de vias auditivas e habilidades auditivas centrais. Nos \u00faltimos anos, o desenvolvimento de novas baterias de triagem das habilidades auditivas t\u00eam sido objeto de pesquisas-15, as quais visam aliar as in\u00fameras possibilidades que o uso da tecnologia tem proporcionado na \u00e1rea da sa\u00fade com a necessidade de procedimentos que cumpram os requisitos necess\u00e1rios em uma triagem, considerando o f\u00e1cil acesso e tempo de aplica\u00e7\u00e3o, diferentes mecanismos auditivos e, ao mesmo tempo, atividades interativas.A realiza\u00e7\u00e3o da triagem auditiva, composta por procedimentos que avaliem tanto o segmento perif\u00e9rico quanto central, possibilita a identifica\u00e7\u00e3o precoce e interven\u00e7\u00e3o imediata de altera\u00e7\u00f5es auditivas nessa popula\u00e7\u00e3o, minimizando os poss\u00edveis preju\u00edzos escolaresonline, l\u00fadico e interativo de triagem das habilidades auditivas, que vem sendo estudado e aperfei\u00e7oado. O programa \u00e9 composto por tarefas auditivas e question\u00e1rio de autopercep\u00e7\u00e3o para crian\u00e7as, pais e professores. A fim de dar continuidade nos estudos do AudBility, e assim contribuir com a valida\u00e7\u00e3o, o presente estudo teve como objetivo investigar a confiabilidade teste-reteste em um grupo de crian\u00e7as com desenvolvimento t\u00edpico e idades entre seis e sete anos.A partir disso, destaca-se a necessidade de que dados de sensibilidade, especificidade e confiabilidade sejam estudados e disponibilizados, contribuindo para que novos procedimentos sejam validados. Nesse contexto, emergiu no cen\u00e1rio brasileiro a bateria de \u201cAudBility\u201d, um programa Trata-se de um estudo de confiabilidade descritivo-anal\u00edtico, quantitativo e de corte transversal, aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa da Universidade Estadual de Campinas (Unicamp) sob o parecer N\u00ba 1.561.422 e desenvolvido em parceria com uma Escola da Rede P\u00fablica Estadual de Ensino. Todas as crian\u00e7as inclu\u00eddas no estudo tiveram o Termo de Consentimento Livre e Esclarecido (TCLE) assinado pelos pais e/ou respons\u00e1veis e Termo de Assentimento assinado, foram enviadas cartas-convite aos pais/respons\u00e1veis das crian\u00e7as na faixa et\u00e1ria de seis a oito anos, do sexo masculino e feminino e falantes nativos do Portugu\u00eas. Para este envio, foram exclu\u00eddas crian\u00e7as com diagn\u00f3stico j\u00e1 confirmado de perda auditiva perif\u00e9rica, al\u00e9m de altera\u00e7\u00f5es cognitivas/neurol\u00f3gicas que afetassem o desenvolvimento neuropsicomotor ou de linguagem que fossem de conhecimento da coordena\u00e7\u00e3o pedag\u00f3gica, registros escolares e/ou professor da crian\u00e7a, condi\u00e7\u00f5es que poderiam impedir a compreens\u00e3o das tarefas a serem realizadas.Inicialmente, como parte do estudo de dados normativos do programa AudBility ao qual a presente pesquisa fez parteAo todo, foram enviadas 203 cartas-convite. Destas, 157 (77%) aceitaram participar. Tr\u00eas crian\u00e7as ainda foram exclu\u00eddas devido aos crit\u00e9rios de sele\u00e7\u00e3o apresentados, totalizando 154 crian\u00e7as que passaram pelos procedimentos de triagem perif\u00e9rica e AudBility. Das 154 crian\u00e7as, 95 eram da faixa et\u00e1ria de oito anos e j\u00e1 haviam realizado a triagem h\u00e1 mais de dois meses, o que inviabilizou a inclus\u00e3o desta idade na an\u00e1lise de confiabilidade. Al\u00e9m disso, para o presente estudo de confiabilidade, foram inclu\u00eddas apenas as crian\u00e7as com desempenho escolar adequado para a faixa et\u00e1ria de acordo com o professor respons\u00e1vel, incluindo aus\u00eancia de reten\u00e7\u00e3o ou refor\u00e7o escolar em per\u00edodo contraturno e que concordassem em participar da etapa de reteste. Sendo assim, a amostra final desta pesquisa foi constitu\u00edda por 29 crian\u00e7as na faixa et\u00e1ria de seis e sete anos, sendo 16  meninas e 13  meninos com m\u00e9dia de idade 6,68 anos . A Interacoustics MT10, a fim de verificar as condi\u00e7\u00f5es de orelha m\u00e9dia. As crian\u00e7as que apresentaram excesso de cerume foram encaminhadas para remo\u00e7\u00e3o e, posteriormente, reconvocadas para a coleta de dados. As crian\u00e7as que apresentaram resultados alterados na triagem imitanciom\u00e9trica, ou seja, curva timpanom\u00e9trica do tipo B ou C e aus\u00eancia de reflexos ac\u00fasticos ipsilaterais, foram encaminhadas para avalia\u00e7\u00e3o audiol\u00f3gica completa, avalia\u00e7\u00e3o otorrinolaringol\u00f3gica e exclu\u00eddas da an\u00e1lise de dados.Quanto aos procedimentos, previamente \u00e0 aplica\u00e7\u00e3o da bateria AudBility, foi realizada meatoscopia com otosc\u00f3pio da marca Hein e imitanciometria por meio do equipamento desktop conectado \u00e0 internet e fone de ouvido supra auricular com cancelamento de ru\u00eddo marca Panasonic modelo RPHC720.Ap\u00f3s a triagem imitanciom\u00e9trica, o programa AudBility foi aplicado em uma sala silenciosa disponibilizada pela escola, afastada das demais salas de aula e p\u00e1tio. Em momentos de intervalo e mudan\u00e7a de turnos escolares, a aplica\u00e7\u00e3o foi interrompida pelo pesquisador. A bateria foi aplicada com o aux\u00edlio de uma fonoaudi\u00f3loga com experi\u00eancia no programa AudBility, sendo tamb\u00e9m uma das pesquisadoras signat\u00e1rias desse estudo. Foi utilizado um computador O AudBility \u00e9 composto por um question\u00e1rio de autopercep\u00e7\u00e3o das habilidades auditivas e as tarefas auditivas. Al\u00e9m disso, apresenta tr\u00eas m\u00f3dulos et\u00e1rios de apresenta\u00e7\u00e3o das tarefas, sendo um direcionado para crian\u00e7as de seis a oito anos; o segundo direcionado para crian\u00e7as de nove a 12 anos desde que haja dom\u00ednio da leitura e o terceiro para usu\u00e1rios acima de 13 anos. Nessa pesquisa foram estudados os dados coletados a partir da aplica\u00e7\u00e3o do m\u00f3dulo espec\u00edfico para a faixa et\u00e1ria de seis a oito anos. Nesse m\u00f3dulo, as atividades n\u00e3o exigem o dom\u00ednio da leitura por parte do escolar e apresentam recursos pictogr\u00e1ficos. cont\u00e9m doze perguntas a serem respondidas com rela\u00e7\u00e3o a frequ\u00eancia com que a situa\u00e7\u00e3o ocorre no dia a dia, com apoio pictogr\u00e1fico para as op\u00e7\u00f5es de resposta da crian\u00e7a, e forma de pontua\u00e7\u00e3o baseada na escala Likert, sendo: Sempre  Frequente  Algumas vezes  Raramente  Nunca . Cada pergunta \u00e9 precedida por uma situa\u00e7\u00e3o-exemplo para facilitar a compreens\u00e3o. O pesquisador leu a tela de explica\u00e7\u00e3o do question\u00e1rio no programa e, ap\u00f3s garantir que a crian\u00e7a compreendeu, auxiliou na aplica\u00e7\u00e3o do question\u00e1rio lendo as perguntas em voz alta e auxiliando na marca\u00e7\u00e3o da resposta na tela do computador. Ao final, o programa computa o escore por quest\u00e3o e calcula o escore total, que pode variar de 12 a 60 pontos. A descri\u00e7\u00e3o das 12 perguntas encontra-se no O question\u00e1rio de autopercep\u00e7\u00e3o das habilidades- vers\u00e3o adaptada e inserida no programaPara as tarefas auditivas, o programa calibra automaticamente a sa\u00edda do som e fones, sendo que o mixador do volume do computador foi posicionado em 50% e a crian\u00e7a questionada se estava em um n\u00edvel confort\u00e1vel de audi\u00e7\u00e3o. Caso necess\u00e1rio, o volume poderia ser ajustado.O protocolo de triagem foi composto por sete tarefas auditivas, a saber: localiza\u00e7\u00e3o sonora, figura-fundo, fechamento auditivo, escuta dic\u00f3tica com d\u00edgitos, resolu\u00e7\u00e3o temporal e ordena\u00e7\u00e3o temporal de frequ\u00eancia e de dura\u00e7\u00e3o. Como as tarefas de fechamento auditivo e figura-fundo foram analisadas por orelha, foram nove vari\u00e1veis de an\u00e1lise. As tarefas s\u00e3o interativas e l\u00fadicas e foram elaboradas com base nos testes comportamentais que fazem parte da bateria diagn\u00f3stica, por\u00e9m diferentes par\u00e2metros ac\u00fasticos e em quantidade reduzida de est\u00edmulos em cada tarefa. O Para cada tarefa, h\u00e1 uma tela de explica\u00e7\u00e3o e treino da atividade. A tarefa s\u00f3 foi iniciada ap\u00f3s a garantia de que a crian\u00e7a compreendeu a atividade e o avaliador auxiliou a crian\u00e7a no momento da marca\u00e7\u00e3o da resposta na tela do computador. Ao final de cada tarefa, o programa apresenta uma tela parabenizando a crian\u00e7a pela execu\u00e7\u00e3o e com a porcentagem de acertos e/ou limiar obtido. Essas informa\u00e7\u00f5es tamb\u00e9m ficam armazenadas no programa e podem ser consultadas em uma tela com o resumo do desempenho da crian\u00e7a em todas as tarefas aplicadas, bem como escore do question\u00e1rio . Nessa tela h\u00e1 tamb\u00e9m a informa\u00e7\u00e3o do tempo total de aplica\u00e7\u00e3o da bateria e tempo por tarefa.Ap\u00f3s uma semana da aplica\u00e7\u00e3o do programa, os 29 escolares selecionados foram reconvocados para a etapa de RETESTE. Nessa etapa, o mesmo avaliador reaplicou os procedimentos da etapa teste, incluindo a meatoscopia, imitanciometria e o programa. Foram garantidas as mesmas condi\u00e7\u00f5es da etapa TESTE no que diz respeito aos recursos materiais , par\u00e2metros de intensidade de apresenta\u00e7\u00e3o dos est\u00edmulos e ordem das tarefas, instru\u00e7\u00f5es em cada tarefa e forma de aplica\u00e7\u00e3o/aux\u00edlio de marca\u00e7\u00e3o dos resultados. Nesse sentido, objetivou-se, na medida do poss\u00edvel, que os participantes fossem igualmente motivados e estivessem demonstrando o mesmo n\u00edvel de aten\u00e7\u00e3o para realiza\u00e7\u00e3o das tarefas, considerando ambos os momentos de aplica\u00e7\u00e3o.Para a an\u00e1lise de dados, o desempenho m\u00e9dio de cada uma das nove vari\u00e1veis obtidas a partir da aplica\u00e7\u00e3o das tarefas foi calculado com base no percentual de acertos obtido ou limiar m\u00e9dio para a tarefa de resolu\u00e7\u00e3o temporal. Esses dados foram apresentados a partir das medidas de tend\u00eancia central e dispers\u00e3o, assim como o escore m\u00e9dio obtido no question\u00e1rio de autopercep\u00e7\u00e3o.. Para an\u00e1lise, os valores negativos de CCI s\u00e3o interpretados como discord\u00e2ncia entre os momentos, valores positivos s\u00e3o interpretados como concord\u00e2ncia entre os momentos e valores nulos (zero) s\u00e3o interpretados como aus\u00eancia de discord\u00e2ncia ou concord\u00e2ncia entre os momentos (acaso). Na an\u00e1lise do CCI, recomenda-se ainda que seja avaliado o n\u00edvel de correla\u00e7\u00e3o, considerando n\u00e3o apenas o CCI m\u00e9dio mas tamb\u00e9m o intervalo de confian\u00e7a de 95% adotado, a partir da seguinte classifica\u00e7\u00e3o: valores abaixo de 0,5 sugerem confiabilidade ruim, valores entre 0,5 a 0,75 confiabilidade moderada, valores entre 0,75 a 0,9 confiabilidade boa, valores acima de 0,9 confiabilidade excelente.Para verificar a concord\u00e2ncia ou discord\u00e2ncia entre os momentos \u201cTESTE\u201d e\u201d RETESTE\u201d, ou seja, o grau de confiabilidade, foi realizado o C\u00e1lculo de Coeficiente intra-classe (CCI), com base em um modelo misto de dois fatores do tipo \u201cconcord\u00e2ncia absoluta\u201d a partir de medidas \u00fanicasA A .Em um processo de valida\u00e7\u00e3o, a confiabilidade do constructo est\u00e1 relacionada com a const\u00e2ncia, precis\u00e3o e homogeneidade dos resultados obtidos pelo m\u00e9todo quando o indiv\u00edduo \u00e9 avaliado mais de uma vez. Trata-se, portanto, de uma mensura\u00e7\u00e3o de extrema import\u00e2ncia para que as medidas coletadas tenham signific\u00e2ncia. Existem diferentes crit\u00e9rios para o estudo da confiabilidade, sendo que um dos mais conhecidos e utilizados na \u00e1rea da sa\u00fade diz respeito a t\u00e9cnica do teste-reteste, ou seja, quando a mesma medida \u00e9 aplicada duas vezes nos mesmos sujeitos e observa-se concord\u00e2ncia entre os dois momentos. O ideal \u00e9 que os retestes, realizados com diferen\u00e7a de alguns dias a semanas do teste, tenham resultados semelhantes, sendo que s\u00e3o descritos trabalhos na \u00e1rea do processamento auditivo com varia\u00e7\u00f5es de at\u00e9 60 dias entre os dois momentos de an\u00e1lise,21,22. Em estudos de triagem, a taxa amostral varia de no m\u00ednimo cinco a 10% da amostra total triada,14. No presente estudo, buscou-se respeitar tais preceitos, e as reavalia\u00e7\u00f5es ocorreram com uma semana de intervalo de tempo, foram realizadas pelo mesmo avaliador, sob as mesmas condi\u00e7\u00f5es de avalia\u00e7\u00e3o. Quanto a taxa amostral, considerando as 154 crian\u00e7as que passaram pela triagem, a amostra de 29 crian\u00e7as representou 18,33% sendo, portanto, representativa.O uso dessa t\u00e9cnica pode ser afetado por fatores ambientais como avaliadores, caracter\u00edsticas da amostra, tipo de instrumento e m\u00e9todos de administra\u00e7\u00e3o. Portanto, \u00e9 imprescind\u00edvel que as etapas sejam aplicadas sob as mesmas condi\u00e7\u00f5es e analisadas de forma estatisticamente coerente. No estudo citado, a faixa et\u00e1ria maior com resultado semelhante refor\u00e7a o bom desempenho da amostra aqui estudada, sendo constitu\u00edda por escolares mais novos. Al\u00e9m disso, a m\u00e9dia de escore obtida no question\u00e1rio acima de 45 pontos tamb\u00e9m condiz com o desempenho esperado apresentado em estudo realizado com o question\u00e1rio SAB em sua vers\u00e3o traduzida, refor\u00e7ando a aus\u00eancia do risco para a ocorr\u00eancia do TPAC na amostra, ainda que selecionada com a limita\u00e7\u00e3o de um crit\u00e9rio baseado na an\u00e1lise qualitativa do professor e registros escolares, n\u00e3o tendo sido feita uma avalia\u00e7\u00e3o formal do desempenho escolar.Ao observarmos os dados descritivos apresentados na Pearson, o Coeficiente de Correla\u00e7\u00e3o de Spearman, o teste T Student pareado ou o correspondente n\u00e3o param\u00e9trico de Wilcoxon. Essa variabilidade de an\u00e1lises dificulta a compara\u00e7\u00e3o direta entre os diferentes achados, apesar de ser um tema frequente na \u00e1rea. Ao longo das \u00faltimas d\u00e9cadas, muitos trabalhos buscaram estudar a confiabilidade a partir de estudos de teste e reteste, incluindo as pesquisas relacionadas ao desenvolvimento de baterias de triagem ou testes do processamento auditivo,19,24-27.Diferentes testes estat\u00edsticos podem ser utilizados para a an\u00e1lise de teste-reteste, sendo o Coeficiente de Correla\u00e7\u00e3o Intraclasse (CCI) um dos mais recomendados na literatura recente, por permitir de fato uma an\u00e1lise de concord\u00e2ncia entre os momentos, al\u00e9m de diferentes medidas de correla\u00e7\u00e3o tamb\u00e9m serem utilizadas, tais como a Correla\u00e7\u00e3o Simples de ,28. O resultado tamb\u00e9m refor\u00e7a os achados discutidos em publica\u00e7\u00e3o pr\u00e9via em que o mesmo instrumento se mostrou eficaz para diferenciar um grupo de escolares quanto a vari\u00e1vel do desempenho acad\u00eamico, al\u00e9m de ressaltar a necessidade das pesquisas de valida\u00e7\u00e3o, incluindo n\u00e3o somente a confiabilidade teste-reteste mas tamb\u00e9m o estudo da sensibilidade e especificidade quanto ao ponto de corte para o risco e ocorr\u00eancia do TPAC, a partir da correla\u00e7\u00e3o com testes diagn\u00f3sticos.A boa confiabilidade teste-reteste do question\u00e1rio de autopercep\u00e7\u00e3o aqui estudado refor\u00e7a a import\u00e2ncia da inclus\u00e3o desse tipo de instrumento como avalia\u00e7\u00e3o complementar ao desempenho auditivo, em uma bateria de triagem auditiva escolar. Diversos autores ressaltam essa import\u00e2ncia devido ao fato de o question\u00e1rio ser uma forma simples e confi\u00e1vel, desde que elaborado com base em princ\u00edpios psicom\u00e9tricos adequados e disponibilizados dados de valida\u00e7\u00e3o, de demonstrar o impacto funcional do TPAC na vida cotidiana, sob um ponto de vista qualitativo(Tests of Auditory Processing Disorders in adolescents and Adults), teve sua confiabilidade investigada a partir do teste e reteste em 38 participantes, com uma m\u00e9dia de 40 dias entre os dois momentos de an\u00e1lise e os achados foram discutidos como insatisfat\u00f3rios, tendo sido demonstradas fracas correla\u00e7\u00f5es na maioria das tarefas da bateria. Posteriormente, outros pesquisadores estudaram o SCAN-C, vers\u00e3o direcionada para crian\u00e7as e encontraram melhora dos escores na segunda aplica\u00e7\u00e3o, sugerindo o efeito da pr\u00e1tica. Ainda, uma vers\u00e3o revisada da bateria foi aplicada em uma amostra de 680 escolares, dos quais 145  foram inclu\u00eddos em uma an\u00e1lise teste e reteste com uma semana de intervalo entre as aplica\u00e7\u00f5es, tendo sido encontradas correla\u00e7\u00f5es baixas a moderadas, exceto para a habilidade de figura-fundo, dados que corroboram com nossos achados. J\u00e1 em outro estudo de valida\u00e7\u00e3o que analisou uma bateria de triagem denominada STAP \u2013 Screening Test for Auditory Processing, 141 escolares foram triados pelo programa e, desses, 50 escolares  passaram pela etapa de reteste com dois meses de diferen\u00e7a entre as avalia\u00e7\u00f5es, e o coeficiente de correla\u00e7\u00e3o de Pearson demonstrou achados estatisticamente significantes que variaram de 0,82 a 0,93, sugerindo boa confiabilidade.Apesar da variabilidade de estudos com discrep\u00e2ncias com rela\u00e7\u00e3o aos m\u00e9todos de obten\u00e7\u00e3o dos dados e de an\u00e1lise de resultados, \u00e9 poss\u00edvel afirmar que os achados encontrados quanto a confiabilidade das tarefas auditivas estudadas, est\u00e3o de acordo com outras pesquisas. A primeira vers\u00e3o da bateria SCAN-A Feather Squadron, a viabilidade de aplica\u00e7\u00e3o do programa em diferentes faixas et\u00e1rias foi estudada em conjunto com a an\u00e1lise de teste e reteste, realizada com uma semana de diferen\u00e7a entre os momentos de aplica\u00e7\u00e3o, envolvendo 5 mecanismos auditivos avaliados . Com base no teste dos postos sinalizados de Wilcoxon, os autores verificaram o efeito da pr\u00e1tica, a partir do melhor desempenho na segunda aplica\u00e7\u00e3o em tr\u00eas dos cinco mecanismos avaliados, bem como puderam verificar o mesmo efeito em tr\u00eas dos testes convencionais da bateria de avalia\u00e7\u00e3o comportamental do processamento auditivo, demonstrando correla\u00e7\u00e3o entre os procedimentos de triagem e diagn\u00f3stico, mas n\u00e3o em todos.Mais recentemente, em um estudo inicial de valida\u00e7\u00e3o de um programa computacional de triagem semelhante ao AudBility, denominado ,14,24,27. Sendo assim, pode-se considerar que os achados do presente estudo apontam para a confiabilidade do programa estudado nessa faixa et\u00e1ria, contribuindo para sua valida\u00e7\u00e3o.Sendo assim, os diferentes estudos discutidos apresentam baterias com o m\u00ednimo de concord\u00e2ncia ou correla\u00e7\u00e3o moderada na maioria de tarefas que comp\u00f5em protocolos de triagem do PAC, ainda que nem todos os testes demonstrem esse grau de correla\u00e7\u00e3o esperado. Ao olharmos a descri\u00e7\u00e3o do desempenho m\u00e9dio de acertos nas tarefas, tanto para localiza\u00e7\u00e3o sonora cuja concord\u00e2ncia foi baixa, quanto para as tarefas de fechamento e figura-fundo na orelha esquerda, \u00e9 poss\u00edvel observar diferen\u00e7as entre os momentos, com melhora do desempenho no reteste quando comparado com as demais tarefas com resultados positivos e com melhor grau de concord\u00e2ncia, sugerindo um poss\u00edvel efeito da pr\u00e1tica, ainda que uma an\u00e1lise estat\u00edstica pareada dessa diferen\u00e7a n\u00e3o tenha sido realizada. Ainda assim, \u00e9 poss\u00edvel considerar a hip\u00f3tese de que essa diferen\u00e7a pode ter justificado a n\u00e3o concord\u00e2ncia entre os momentos nessas tarefas.Nossos achados n\u00e3o demonstraram resultados estatisticamente significantes nas tarefas de fechamento auditivo em ambas as orelhas e figura-fundo na orelha esquerda. O fechamento auditivo \u00e9 a capacidade de compreens\u00e3o de uma mensagem sonora incompleta ou distorcida, o que causa dificuldade em decodificar aspectos fon\u00eamicos de um sinal de fala. J\u00e1 a habilidade de figura-fundo consiste na interpreta\u00e7\u00e3o de senten\u00e7as na presen\u00e7a de mensagem competitiva. Essas s\u00e3o habilidades auditivas fundamentais para a compreens\u00e3o de fala, especialmente quando se trata do ambiente escolar.Essa discuss\u00e3o e an\u00e1lise tornam-se relevantes, especialmente para futuros estudos que visem a aplica\u00e7\u00e3o da bateria AudBility com o objetivo de acompanhar o desenvolvimento maturacional das habilidades auditivas ou como instrumento de monitoramento da reabilita\u00e7\u00e3o do TPAC na crian\u00e7a. Autores ressaltam que o c\u00e1lculo chamado de \u201cdiferen\u00e7a \u2013 D\u201d que representa o grau de melhora ou piora entre os momentos deve ser considerado e descontado para se obter o real grau de melhora (ou piora) obtido pela crian\u00e7a ao longo do tempo em um processo de interven\u00e7\u00e3o ou at\u00e9 mesmo para a adequada compreens\u00e3o da sensibilidade do instrumento em mensurar o desenvolvimento neuromaturacional das habilidades auditivas ao longo do tempoAlguns fatores devem ser discutidos e podem tamb\u00e9m subsidiar o levantamento de hip\u00f3teses a respeito das diferen\u00e7as no desempenho entre os momentos, considerando as tarefas de baixa concord\u00e2ncia. O fato de o desempenho escolar n\u00e3o ter sido avaliado por meio de um instrumento formal validado, mas sim a partir do relato do professor, justifica uma amostra mais heterog\u00eanea do ponto de vista dos processos de aprendizagem. Ainda que limitante, esse aspecto n\u00e3o inviabiliza o estudo de confiabilidade, visto que as an\u00e1lises s\u00e3o comparativas do sujeito com ele mesmo. Apesar do exposto, esse aspecto parece n\u00e3o justificar totalmente as discrep\u00e2ncias encontradas, uma vez que o desempenho foi melhor no momento da segunda aplica\u00e7\u00e3o.. Ainda que dentro do desenvolvimento t\u00edpico, a aus\u00eancia de avalia\u00e7\u00f5es formais, incluindo tamb\u00e9m um screening cognitivo e de linguagem, favorece uma amostra mais heterog\u00eanea, fator que tamb\u00e9m pode ser considerado como parte da justificativa para a discord\u00e2ncia entre os momentos em algumas tarefas. Por\u00e9m, trata-se de uma aplica\u00e7\u00e3o de triagem escolar, e um protocolo extenso de avalia\u00e7\u00f5es inviabilizaria a proposta. Al\u00e9m dos aspectos cognitivos, n\u00e3o \u00e9 poss\u00edvel desconsiderar os fatores comportamentais ou de variabilidades intr\u00ednsecas de cada indiv\u00edduo, tais como sono, cansa\u00e7o, estado de alerta, fome e grau de motiva\u00e7\u00e3o para a realiza\u00e7\u00e3o das atividades. Do ponto de vista metodol\u00f3gico, ainda que garantidas as mesmas condi\u00e7\u00f5es t\u00e9cnicas de aplica\u00e7\u00e3o do programa nos dois momentos, n\u00e3o \u00e9 poss\u00edvel controlar todos os aspectos citados. N\u00e3o necessariamente a crian\u00e7a foi convocada no mesmo hor\u00e1rio daquele per\u00edodo escolar, podendo estar mais ou menos cansada entre uma semana e outra, por exemplo. Do ponto de vista motivacional, a familiaridade com o recurso tecnol\u00f3gico pode ser um fator a mais de motiva\u00e7\u00e3o e engajamento para a realiza\u00e7\u00e3o das atividades, fator que tamb\u00e9m pode ter contribu\u00eddo para o melhor desempenho no segundo momento.Outro aspecto a ser discutido \u00e9 a influ\u00eancia que mecanismos cognitivos que independem do SNAC podem exercer sob o desempenho esperado do indiv\u00edduo submetido a avalia\u00e7\u00e3o do PAC, tais como mem\u00f3ria e aten\u00e7\u00e3oPor fim, vale ressaltar que, de uma maneira geral, o CCI m\u00e9dio obtido nas tarefas com resultado positivo significante equivale a um grau de confiabilidade moderado, por\u00e9m ao considerarmos a an\u00e1lise baseada no intervalo de confian\u00e7a, essa classifica\u00e7\u00e3o variou de ruim a bom, sendo ainda um dado de incerteza do ponto de vista estat\u00edstico. Conforme discutido, ainda que em concord\u00e2ncia com outras baterias de triagem j\u00e1 validadas, esse achado justifica a necessidade de mais estudos, que avaliem uma amostra maior de escolares, de forma a estreitar o intervalo de confian\u00e7a obtido, al\u00e9m de investigar as propriedades psicom\u00e9tricas das tarefas em outras faixas et\u00e1rias e outras popula\u00e7\u00f5es pedi\u00e1tricas, o que poderia elucidar o comportamento do programa em rela\u00e7\u00e3o a esse aspecto da valida\u00e7\u00e3o em diferentes popula\u00e7\u00f5es.Considerando a faixa et\u00e1ria estudada e os resultados encontrados, o programa AudBility demonstrou boa concord\u00e2ncia para o question\u00e1rio entre os momentos aplicados, moderada concord\u00e2ncia para as tarefas de ordena\u00e7\u00e3o temporal de frequencia e dura\u00e7\u00e3o, resolu\u00e7\u00e3o temporal, figura fundo na orelha direita e escuta dic\u00f3tica com d\u00edgitos e baixa concord\u00e2ncia, ainda que estatisticamente significante, para a tarefa de localiza\u00e7\u00e3o sonora. Os achados do estudo de confiabilidade representam um par\u00e2metro importante de valida\u00e7\u00e3o do programa."}
+{"text": "Performance was considered as a response variable in narrative discourse . After univariate analysis, Multiple Linear Regression models were constructed.Only general performance in the naming task was considered as a predictor of performance in oral narrative discourse. A direct association between the variables of narrative discourse and the naming of figures was present. We show the characteristics of adolescents' performance in the partial and complete retelling and in the answers to the questions by age, school year and sex.in the studied sample the participants (aged from two to seven years old) were able to understand and detail an oral narrative discourse similar to adults with a low educational level, consequently the MAC Battery narrative discourse test can be used to assess adolescents without any requirements for adaptation. Linguistic growth occurs during childhood, adolescence and adulthood and does not have any obvious completion point, therefore it is a dynamic and constantly expanding system.Adolescence is the period in which a young person develops from a child to an adult, ranging from ten to nineteen years of age. Linguistic competence in this age group is similar to that of adults. This skill is essential for the development of written narrative, for socio-emotional well-being and school performance. Oral narrative discourse is an essential linguistic skill in communicative ability during adolescence. In social and academic use narrative discourse must be developed and requires the ability to remember events, organize information, understand the epistemological and emotional perspectives of others, employ complex syntax and appropriate vocabulary to express oneself clearly and accurately.One of the skills of oral language is narrative discourse, which is defined as the linguistic ordering of temporally related events and actions. The lack of standardized tests with versions that are adapted and standardized for the adolescent population limits the achievement of objective data in the assessment of language of this age group.Knowledge is limited about the linguistic and cognitive abilities of adolescents who principally speak Brazilian Portuguese both in clinical practice and in specific studies, consequently assessment tools and intervention strategies are scarceA way to cater for the limited amount of assessment instruments specifically available for adolescents is to adapt validated and recognized tests for adults whose purpose is to assess linguistic and cognitive functions. Standardized instruments for the processing of oral narrative discourse of Brazilian Portuguese speaking adolescents were not found..The overall structure of the narrative is usually characterized by an initial configuration, complicating actions and resolution, which are hierarchically organized into three segments beginning, middle and end.Oral narrative ability can be assessed in two different ways, comprehension and production and is composed of macrostructure and microstructure levels. The macrostructure level relates to the components between sentences  while the microstructure refers to the construction within the sentence .A study carried out with bilingual children in the first and second years of school aimed to investigate the relationships between the micro and macro level domains of oral narratives within and between the English and Spanish languages through storytelling. The results showed that patterns of oral narrative development can be similar in both languages and a series of significant correlations within and between languages identified vocabulary as a significant predictor of macro-level speech scores in both languages. Studies suggest that the ability to make inferences contributes to language comprehension. The questions to assess narrative comprehension are literal, inferential and aim to obtain information about the ability to understand sentences, as well as to establish relationships between ideas central to the theme of the narrative.In the process of understanding an oral narrative, the ability to infer information that is not directly indicated in the story is influenced by the characteristics of the text, cognitive and contextual factors. A study carried out with 79 students aged between 7 and 12 years of age from the second to the fifth grades investigated the prosodic aspects of oral language and reading comprehension and it is suggested that age and education would be related to the ability of listening comprehension. Younger and less educated children would be more dependent on prosodic factors, whilst older and more educated children would have more developed cognitive skills, which would enable them to understand a text regardless of prosodic variation.Prosody is a relevant skill for processing the discursive structure, as it interacts and adds value to other language subsystems, such as syntax and semantics, facilitating language comprehension. Prosodic cues help to segment the speech flow into sentences, words and syllables, inform the syntactic structure and emphasize information aiding the understanding of the narrative discourse and the accomplishment of linguistic and mnemonic processing, among other underlying cognitive functions, it is a determining skill in an adolescent's school and social life. Adolescents can demonstrate great diversity in the use of complex syntax in oral narrative discourse.Oral narrative discourse reflects the level of cognitive development so does the progression of reading. Educational levels and socioeconomic background are associated with language ability in adolescence.The learning process of oral narratives and its constituent elements, is gradual as the central nervous system develops. Language problems in adolescence is an area of interest for healthcare and education professionals as these disorders negatively impact academic performance, participation in the social sphere and professional guidance. To characterize adolescent language problems requires a good understanding of the typical development of language skills of this age group.The mental organization in adolescents with language disorders is inadequate, resulting in problems with sequencing and structuring of a discourse, which compromises the ability to narrate events.Another study carried out with adolescents with an average age of 14 years old who had typical language development aimed to create a new narrative task and to try to determine whether it would cause greater syntactic complexity than a conversational task. This research addressed the need for appropriate tools to assess the ability of oral narrative with syntactic complexity in eighth grade students. The results verified that there were no statistically significant differences in the performance of oral narrative between boys and girls and the narrative task raised greater syntactic complexity than the conversational task. The aim of this study was to characterize the performance of adolescents, from the 6th to 9th grade of elementary school, in the production and understanding of an oral narrative discourse, as well as the influence of gender, school year, age, picture naming, general score of oral language and memory. In addition, we sought to verify whether the oral narrative discourse task of the Montreal Communication Assessment Battery \u2013 MAC Battery, validated and standardized for Brazilian Portuguese speaking adults can be used for the adolescent population without requiring any form of adaptation.The use of standardized language assessments makes it possible to measure linguistic characteristics and help to understand the acquisition process and contribute to the development of cognitive abilities and is also the basis for speech therapy intervention. The language of children and adults has been studied, but the transitional phase, I.e., that of adolescence is still relatively unexplored, especially the skills of oral narrative discourse. A better understanding of oral narrative discourse in adolescence can help to develop effective tools for intervention programs for this age groupThis is an analytical cross-sectional observational study, approved by the Research Ethics Committee of the Federal University of Minas Gerais number 1.722.230.Adolescents eligible to participate in the study and their parents were informed about the voluntary aspects of the study, its benefits and its stages they then signed a consent form.One hundred adolescents from two public schools in the same region of Belo Horizonte were included in the study. Participants did not have any previous diagnoses of learning disorders either sensory, neurological, cognitive or behavioral changes as confirmed by the schools coordinators and were native speakers of Brazilian Portuguese without any fluency in a second language. The schools already had a list of adolescents with neurodevelopmental disorders and from this list was possible to identify and exclude some of the participants. Adolescents identified by teachers and coordinators who had poor school performance were also excluded.The age group of the participants ranged from 11 to 16 years of age, with an average age of 12.9 years (SD=1.2) and 62% of the participants were female. During the data collection period, the adolescents attended elementary school in the following school years: 6th grade (n=34), 7th grade (n=23), 8th grade (n=25) and 9th grade (n=18)., Boston Naming Test (BNT) and oral language and memory tests of the Brief Neuropsychological Assessment Instrument (NEUPSILIN).The instruments used for this study were as follows, the oral narrative discourse test of the Montreal Communication Assessment Battery (MAC Battery). For usage and analysis, the procedures proposed by the authors of the tests in the instruction manual were followed. In the retelling tasks, the adolescents listened to a short text which they recounted in a summarized form and in their own words of what had just happened in the story, first in each paragraph . The cells corresponding to the total of essential information remembered (maximum score=18) and the total of present information remembered (maximum score=29) were registered. Then, the adolescent listened to the same story and were asked to recount the entire text . Deviant communicative behaviors were noted, such as: abundant personal observations, tangential discourse, non-respect to the timeline of events, omission of relationship markers, imprecise lexicon, imprecise references, addition of incorrect information and lack of fluency. Then the adolescent was asked to answer 12 questions about the story and, later given the option of changing the title of the story. Based on retelling tasks, answers to comprehension questions, and non-verbal language , it was verified whether the inference of the narrative was made, that is, the understanding of the moral of the story. The average time of application of the Oral Narrative Discourse task was 15 minutes.To assess the oral narrative discourse, the MAC Battery test was used, consisting of partial retelling of the story, paragraph by paragraph, full retelling of the story, tasks of giving a title and observation of inference processing The reading of the text for the task of retelling the story was standardized so that there was no difference in intonation and prosody that could interfere with the adolescent's understanding of the text. The text was recorded on a Sony WDC WD3200BEVT-75ZCT2 recorder by a theatrical actor with 12 years of experience.. The average time of application of the Boston Naming Test was 20 minutes.Picture naming ability was assessed using the BNT. The pictures were presented in the order of the test, allowing twenty seconds for each answer. If the participant answered incorrectly or not at all the examiner provided a phonemic cue. If the participant continued to answer incorrectly or not at all within twenty seconds a semantic suggestion related to the picture already indicated on the answer sheet was provided. The transcription of the answers given by the participants was registered in the test registration protocol. For analysis of the test, the score corresponding to the adolescent's answers was analyzed, namely: total correct answers without a cue, total answer with phonemic cues (correct and incorrect), total answer with semantic cues (correct and incorrect), general total of correct answers (spontaneous evocation + evocation with cues) was analyzed. The test presents normative values for the Brazilian Portuguese speaking population older than 12 years of age. The oral language subtest consists of naming, repetition, automatic language, comprehension, and inference processing tasks. One point was assigned for correct answers and zero for incorrect ones; for analysis, the general score corresponding to the adolescent's total score was added. Adolescent performance was classified as adequate and inadequate, considering the test reference. Adolescents' performance was recorded on a standard test answer sheet. On average the test lasted 7 minutes.The total score of the NEUPSILIN oral language subtest. Each test of the memory subtest was analyzed separately, consisting of tasks of working memory, episodic-semantic verbal memory, long-term semantic memory, and short-term visual memory. To analyze the results, a quantitative assessment of the adolescents' responses was made, corresponding to each task in the test. Student performance was classified as adequate and inadequate according to standardized test data. On average the test lasted 7 minutes.The participants also took the NEUPSILIN memory subtest global assessment of oral language and memory followed by the BNT and then the MAC Battery.Data collection was carried out between August 2016 and March 2017. The tests mentioned in this article were carried out separately, totaling three sessions with each participant. All assessments were carried out individually at the school, during lesson times in a room designated for this purpose, the application norms and standardized analyzes of the tests were carefully followed. The test sequence started with the NEUPSILINThe database was built using Excel and after consistency analysis, univariate descriptive analyzes were performed using the Statistical Software Package for Social Sciences (SPSS) version 19.0. Initially the Kolmogorov-Smirnov test was carried out to assess the normality of the continuous numerical variables and all of these showed a normal distribution. Descriptive analysis was performed by calculating frequencies and measures of central tendency and dispersion (average and standard deviation). Simple Student t tests were carried out to compare two independent means and Anova to compare three independent means and finally Pearson correlation to relate the two continuous numeric variables.For the analyses, the adolescents' performance in the comprehension and expression of oral discourse the response variable, and explanatory variables, gender, school year, age, total correct answers in the Boston Naming Test and global oral language score  and memory  in the NEUPSILIN test.Finally multiple linear regression models were built with narrative discourse as the outcome , and as explanatory variables all those that presented p value less than 0.20 in the univariate analysis. The backwards method was adopted, removing the variables with the highest p-value until the final adjusted model was obtained.The results section will be presented by topic. Initially, the results of descriptive, univariate, and multivariate analysis of the partial and full retelling will be presented. In the second topic the results of the association between the variables of the retelling task of the MAC Battery and the variables of the Boston Naming Test will be presented, followed by a specific topic for marks on the closed questions.Of the six types of deviant communicative behavior in the narrative discourse, the adolescents presented non timeline of events (21%), incorrect information (15%), inaccurate references (6%) and inaccurate lexicon (5%).Of a total of 18 pieces of essential information remembered the average of the adolescents' answers was 12.6 points and in 29 pieces of present information remembered the average was 16 points in the partial retelling of the story. Regarding the complete retelling of the story, in a total of 13 pieces of information remembered, the average of the adolescents' answers was 9.8 points. In the assessment of text comprehension, in a total of 12 questions, the average was 9.6 points .This study did not find any association between the performance of adolescents in the retellings of the narrative discourse test and the explanatory variables gender, education and adequacy in oral language, according to the results of univariate analyzes between performance in the narrative discourse test and the explanatory variables.The performance in the Boston Naming Test remained in the three multiple linear regression models. According to the final models an increase of 1 point in the total correct answers in naming increases 0.322 points in the total of essential information remembered in the partial retelling, 0.225 point in the total of present information remembered in the partial retelling, and 0.192 point in the total of ideas remembered in the full retelling.As the overall performance in the Boston Naming Test was the only variable predicting the performance of adolescents in retelling, it was decided to verify the association of all test variables with the narrative discourse. Pearson Correlation results are shown in According to multiple linear regression, increasing 1 point in total correct answers with a semantic cue reduces 0.399 points in total essential information remembered, in partial retelling, an increase of 1 point in the total number of incorrect answers with a phonemic cue reduces 0.248 points in the total of essential information remembered, in the partial retelling, 0.502 points in the total present information remembered in the partial retelling and 0.720 points in the total of ideas remembered in the full retelling, and an increase of 1 point in the total number of correct answers in the naming reduces 0.506 points in the total of ideas remembered in the full retelling.The result of the univariate analyzes between the total correct answers in the questions of the narrative discourse test and the explanatory variables are shown in . Most were able to infer the moral of the story and there was no difference in the performance of adolescents considering education levels and gender.This study verified the production and understanding of oral narrative discourse and associated factors of adolescents aged from 11 to 16 years of age from the 6th to 9th grades of public elementary schools. Picture naming was the only variable that predicted performance in oral narrative discourse tasks . In a qualitative analysis the adolescents were able to recount the story with adequate organization and planning in both a coherent and fluent manner. The performance was similar to that of young adults with a lower educational level (two to seven years of schooling). Naming, on the other hand, is an important skill for vocabulary building and involves a series of relatively distinct but interacting mental representations and cognitive processes, such as recognition of the visual stimulus as a familiar concept, access to the meaning of the visualized item, access to phonological structuring, and motor programming for oral production. Vocabulary and naming are closely related skills, as they mutually contribute to one another development and involve lexical access capacity and the quality of semantic representation in the lexicon,25. In general terms in this study, the adolescents who performed better in naming also performed better in retelling tasks . To express the content of a story, several linguistic skills interact, such as phonology, morphology, lexicon and grammatical processing. In research carried out with children, vocabulary and naming were identified as a significant predictor of oral discourse score. Thus, the results corroborate other studies, as among the skills that contribute to oral narrative we have naming, and for the expression of the narrative discourse, the ability of lexical and preserved access is necessary, being directly proportional skills.Vocabulary refers to the breadth and lexical diversity that one possess in relation to a language. It refers to the ability to understand terms and use them to acquire and convey meaning.The results of this study showed that the greater the difficulty in oral narrative discourse, the greater the difficulty in naming pictures, even after semantic and phonemic assistance. The total number of correct answers with semantic cues is inversely proportional to the total of essential information remembered in the partial retelling. Increasing the score of the total number of incorrect answers with phonemic cues reduces the score on the total of information  and on the total of ideas remembered in the complete retelling. Another study found that participants with a higher educational level performed better in naming with assistance and that phonemic cues benefited participants older than eight years of age in formal education. Studies show that less educated participants do not benefit from assistance to retrieve a name, demonstrating a lack of knowledge of the lexicon and this evolves as reading ability progresses. Environmental stimuli are also essential in formulating a coherent discourse. This study suggests that the difficulty in naming pictures with semantic and phonemic cues can be attributed to 1. lack of lexical knowledge, 2. graduation from the naming test with criteria of difficulty in another language, 3. lacking environmental stimulation, 4. reduction in reading habits, 5. level of education of adolescents, 6. restricted semantic memory and 7. infrequent words for adolescents.Regarding the production of oral narrative discourse studies state that to do this in a coherent way, the ability to retrieve information is required. For the retelling of a story, working memory is essential to maintain the theme, coherence and to retrieve information. A study carried out with children verified the association between working memory and oral narrative skills and the direct contribution of memory to the understanding of oral narrative. In the present study, there was no effect of memory in relation to the tasks of comprehension and production of narrative discourse in adolescents. The test used consisted of a short text, with only five short paragraphs and sought to assess the storage capacity of linguistic material. The MAC Battery test was designed for neurological patients, and the NEUPSILIN test aims to investigate the individual's neuropsychological performance in a simple and quick manner, in addition it does little to assess semantic memory and one can consider the possibility that the level of the tasks was easy for typically developed adolescents. Further studies are suggested to confirm this observation.During adolescence, memory development, and progress in deductive reasoning takes place. In another Brazilian study, carried out with children aged from six to twelve years of age, there were preliminary signs of a gradual improvement as children got older. It is worth noting that these studies compared the results between children and adolescents, covering a greater age difference. This study only tested adolescents and this factor may have led to a difference in the results compared to other studies that evaluated children and adolescents. Future studies comparing high school adolescents may show an influence of age and education.There was no influence of school year on the performance of either the partial or complete retelling, nor on the number of correct answers to the comprehension questions of the narrative discourse of the adolescents studied, however studies have shown that the influence of the school year is more significant in childhood. A Brazilian study evaluated the comprehension and production of oral narration of children aged from five to eleven years of age, showing that older children answered more questions correctly than younger children. This study didn\u2019t find a relationship between the general oral language score measured through the NEUPSILIN test tasks and the MAC Battery narrative discourse test score. It should be considered that, in general, the sample was not very heterogeneous in linguistic terms, as adolescents with alterations in language development were not included, consequently no associations were found between oral language and the test of narrative discourse. The associations may appear if we had of compared individuals with typical development and individuals with oral and written language disorders. Furthermore, the MAC Battery's narrative discourse task does not assess spontaneous discourse and only uses a narrative context. This data points to the need to think about and implement oral language assessments that present tasks of greater linguistic complexity. It also indicates the possibility of standardizing the assessment of spontaneous speech and analyzing the association of the general oral language score in a neuropsychological test and the relationship of oral narrative discourse in adolescents with typical development and in those with language disorders. Therefore, we suggested evaluating oral narrative through different tasks and contexts, such as the performance of spontaneous narrative discourse, without pictures, through a previously stipulated theme, according to life experience, using the same analysis criteria of the MAC Battery.Oral discourse is a complex activity that requires a network of language skills and adolescents must structure and process events linked through logical relationships. The elaboration of a spontaneous story demands more cognitive resources than the retelling after listening to the text. In another study carried out with typical development adolescents, there were no statistically significant difference between genders in the performance of oral narrative.There was no statistically significant correlation between gender in all tasks of the oral narrative discourse test, which corroborates other studies. A study that characterized the discursive aspects of adolescents in the 6th year of elementary school found a similar performance between boys and girls in both oral and written language, with an evolution of understanding, increased information processing and understanding. In this study when comparing the reference values of the MAC Battery, the adolescents performed close to that of young adults aged between 19-39 years of age in all oral narrative discourse tasks , added incorrect information (15%), inaccurate references (6%) and inaccurate lexicon (5%). In a qualitative analysis, the adolescents demonstrated deviant communicative behavior during the verbal production of the narrative discourse, such as: non-timeline of events, addition of incorrect information, imprecise references, and imprecise lexicon, but the percentages were all quite low. Research demonstrates that individuals with brain trauma, compared with a control group of patients without neurological damage, produce narratives with a greater number of errors in cohesion, coherence, vague speech, with errors in the organization of the linguistic micro and macrostructuresThe presence of deviant communicative behavior appears to be more common in the production of narrative discourse by individuals with brain damage and not in adolescents with typical language development. The presence of such behavior can be clinically indicative of language alterations, resulting from neurofunctional failures in the right hemisphere, and should be identified by clinical speech, language and hearing therapists in the evaluation of adolescents with language disorders.. In the studied sample, 64% of the adolescents created a title for the story, but not related to the moral of the story. However according to the test application rules adolescents were free to choose a title for the story, which did not necessarily have to be morally related. Most adolescents (77%) kept the original title and chose not to create an additional title. This result is in accordance with other studies and may indicate that the ability to make inferences from a text may be under development in this age group.A study was carried out with adolescents from public schools with the object of contributing to teaching practices, aimed at building inferences by adolescents between 12 and 19 years of age from elementary school. The results indicated that students had difficulty in making inferences, even reading simple texts, however this situation changed significantly during the course of the workshops. Processing is faster by adolescents with a greater development than in relation to children.The studied sample processed the inference only after listening to the text. In another study carried out with children from public and private schools, it was found that the groups benefited from the complete retelling, i.e., after the second listening. In a study carried out with adults with two to seven years of schooling the percentage of inference processing was 76% and those with more than eight years of schooling was 96%. Adolescents showed an intermediate performance between children from private schools and adults with more than eight years of schooling, with 77% of the inference processing, demonstrated through the understanding of the text's moral. Regarding the ability to make inferences when comparing adolescents with children from public schools and with adults, an evolution can be found, reinforcing the need for validated assessment instruments at this stage. This result corroborates other research that describes the adolescent in the transitional stage between childhood and adulthood, with evolution of deductive reasoning and figurative and abstract language. Other research has also shown that the comprehension of narrative in adolescents has not yet been completed and is in the process of maturation of the brain. Research describes that the use of language by adolescents is more refined compared to that used by children, adults on the other hand are more capable of making inferences than adolescents, because they have more developed worldly knowledge.In the process of adapting the MAC Battery narrative discourse to children, the percentage of inference processing in the public school was 46.7% and 75% in the private school,29. Consequently, if the narrative discourse tests were carried out with adolescents from private schools this may well generate different results.A limitation of this study was that it only presented data from adolescents from public schools and both national and international surveys show an association between linguistic performance and socioeconomic level. Future studies should verify the performance of students from private schools as well as adolescents from 15 to 17 years of age. It is also suggested that future studies of the analysis of spontaneous narrative should consider the effect of socioeconomic conditions, culture and age on oral narrative discourse skills.The task of the MAC Battery's narrative discourse seems adequate, even without any adaptations made for childrenThis study evaluated the skills of oral narrative speech of adolescents with typical development. The study was an exploratory one because no other studies were found that researched the language skills of Brazilian Portuguese speaking adolescents.Picture naming was the only variable predicting performance in the oral narrative discourse tasks, and adolescents who performed better in naming also performed better in retelling tasks.There was no statistically significant effect between narrative discourse and school year, age, memory, and overall oral language score. In general, adolescents showed a low percentage of deviant communicative behavior during the full retelling of the story in the MAC Battery, indicating that in this age group there is a decrease in the frequency of disruptions in the production of speech with the ability to recount the story in a coherent and fluent way.In the studied sample, the participants were able to understand and elaborate an oral narrative discourse in a similar way to adults with a lower educational level (from two to seven years) and the MAC Battery narrative discourse test can be used to assess adolescents without requiring any form of adaptation.Author contributions: SGA participated in the study design, data collection and analysis, and manuscript writing; EABC participated in the study design, overall supervision and review of the manuscript; LMA participated in the study design and review of the manuscript; VOMR participated in the study design, overall supervision and review of the manuscript. , com evolu\u00e7\u00e3o da linguagem abstrata, da compreens\u00e3o, do uso da linguagem. O crescimento lingu\u00edstico ocorre durante a inf\u00e2ncia, adolesc\u00eancia e na idade adulta, n\u00e3o tendo um ponto \u00f3bvio de conclus\u00e3o, sendo, portanto, um sistema din\u00e2mico e em constante amplia\u00e7\u00e3o.A adolesc\u00eancia \u00e9 considerada como a transi\u00e7\u00e3o no desenvolvimento entre a inf\u00e2ncia e a idade adulta, abrangendo dos onze aos vinte anos de idade. A compet\u00eancia lingu\u00edstica nesta faixa et\u00e1ria \u00e9 semelhante \u00e0 do adulto. Esta habilidade \u00e9 fundamental para o desenvolvimento da narrativa escrita, para o bem estar socioemocional e desempenho escolar. Dessa forma, o discurso narrativo oral \u00e9 uma habilidade lingu\u00edstica essencial na capacidade comunicativa durante a adolesc\u00eancia. No uso social e acad\u00eamico, o discurso narrativo deve ser competente e requer a capacidade de lembrar eventos, organizar informa\u00e7\u00f5es, entender as perspectivas epistemol\u00f3gicas e emocionais dos outros, empregar sintaxe complexa e vocabul\u00e1rio apropriado para expressar-se com clareza e precis\u00e3o.Uma das habilidades da linguagem oral \u00e9 o discurso narrativo, que se define como a ordena\u00e7\u00e3o lingu\u00edstica de eventos e a\u00e7\u00f5es relacionados temporalmente. A falta de testes padronizados com vers\u00f5es devidamente adaptadas e normatizadas \u00e0 popula\u00e7\u00e3o adolescente limita a obten\u00e7\u00e3o de dados objetivos na avalia\u00e7\u00e3o da linguagem nessa faixa et\u00e1ria.Observa-se tanto na pr\u00e1tica cl\u00ednica quanto na literatura espec\u00edfica, uma limita\u00e7\u00e3o de conhecimentos sobre as habilidades lingu\u00edsticas e cognitivas de adolescentes, principalmente falantes do portugu\u00eas brasileiro. Consequentemente, os instrumentos de avalia\u00e7\u00e3o e estrat\u00e9gias de interven\u00e7\u00e3o s\u00e3o escassosUm recurso encontrado para suprir a quantidade limitada de instrumentos de avalia\u00e7\u00e3o destinada ao p\u00fablico adolescente \u00e9 adaptar testes validados e reconhecidos para a popula\u00e7\u00e3o de adultos, os quais tenham como objetivos a avalia\u00e7\u00e3o das fun\u00e7\u00f5es lingu\u00edsticas e cognitivas. Com rela\u00e7\u00e3o ao processamento do discursivo narrativo oral em adolescentes falantes do portugu\u00eas brasileiro, n\u00e3o foram localizados instrumentos padronizados para tal finalidade cl\u00ednica..A estrutura global da narrativa geralmente \u00e9 caracterizada por uma configura\u00e7\u00e3o inicial, a\u00e7\u00f5es complicadoras e resolu\u00e7\u00e3o, que s\u00e3o hierarquicamente organizadas em torno de tr\u00eas segmentos: come\u00e7o, meio e fim.A capacidade narrativa oral pode ser avaliada em duas modalidades: compreens\u00e3o e produ\u00e7\u00e3o. \u00c9 composta por n\u00edveis de macroestrutura e microestrutura. A macroestrutura relaciona-se aos componentes entre as senten\u00e7as  enquanto a microestrutura refere-se \u00e0 constru\u00e7\u00e3o dentro da frase .Uma pesquisa realizada com crian\u00e7as bil\u00edngues do primeiro e segundo ano escolar teve como objetivo investigar as rela\u00e7\u00f5es entre os dom\u00ednios de n\u00edvel micro e macro de narrativas orais dentro e entre as l\u00ednguas inglesa e espanhola por meio do reconto de hist\u00f3rias. Os resultados evidenciaram que padr\u00f5es de desenvolvimento da narrativa oral podem ser semelhantes tanto na l\u00edngua inglesa como na espanhola e uma s\u00e9rie de correla\u00e7\u00f5es significativas dentro e entre l\u00ednguas identificaram o vocabul\u00e1rio como um preditor significativo de pontua\u00e7\u00e3o do discurso de n\u00edvel macro em ambas as l\u00ednguas. A literatura sugere que a habilidade de fazer infer\u00eancia contribui para compreens\u00e3o da linguagem. As perguntas para avalia\u00e7\u00e3o da compreens\u00e3o narrativa s\u00e3o de car\u00e1ter literal, inferencial e visam obter informa\u00e7\u00f5es sobre a capacidade de se compreender as senten\u00e7as, bem como realizar rela\u00e7\u00f5es entre ideias centrais ao tema da narrativa.Com rela\u00e7\u00e3o \u00e0 compreens\u00e3o da narrativa oral, a habilidade de inferir uma informa\u00e7\u00e3o que n\u00e3o \u00e9 indicada diretamente na hist\u00f3ria \u00e9 influenciada pelas caracter\u00edsticas do texto, por fatores cognitivos e contextuais. Estudo realizado com 79 alunos da segunda a quinta s\u00e9rie, na faixa et\u00e1ria de 7 a 12 anos, investigou os aspectos pros\u00f3dicos na compreens\u00e3o da linguagem oral e da leitura; sugere-se que idade e escolaridade estariam relacionadas \u00e0 capacidade de compreens\u00e3o da escuta. Crian\u00e7as mais novas e com menor n\u00edvel de escolaridade seriam mais dependentes dos aspectos pros\u00f3dicos, enquanto crian\u00e7as mais velhas e com maior escolaridade apresentariam habilidades cognitivas mais desenvolvidas, o que as capacitaria a compreender um texto independente da varia\u00e7\u00e3o pros\u00f3dica.J\u00e1 a pros\u00f3dica \u00e9 uma habilidade relevante para o processamento da estrutura discursiva, pois interage e adiciona valor a outros subsistemas de linguagem, como sintaxe e sem\u00e2ntica, facilitando a compreens\u00e3o da linguagem. As pistas pros\u00f3dicas ajudam a segmentar o fluxo de fala em frases, palavras e s\u00edlabas, informam a estrutura sint\u00e1tica e enfatizam informa\u00e7\u00f5es facilitando a compreens\u00e3o do discurso narrativo. Fruto do processamento lingu\u00edstico e mnem\u00f4nico entre outras fun\u00e7\u00f5es cognitivas subjacentes, \u00e9 uma habilidade determinante na vida escolar e social do adolescente. Os adolescentes podem demonstrar grande diversidade no uso de sintaxe complexa no discurso narrativo oral.O discurso narrativo oral reflete o n\u00edvel de desenvolvimento cognitivo, a progress\u00e3o da leitura. N\u00edveis de escolaridade e antecedentes socioecon\u00f4micos est\u00e3o associados \u00e0 habilidade lingu\u00edstica na adolesc\u00eancia.A narrativa oral, com seus elementos constituintes, \u00e9 aprendida de forma gradual, \u00e0 medida que ocorre a matura\u00e7\u00e3o do Sistema Nervoso Central. Problemas de linguagem na adolesc\u00eancia constituem uma \u00e1rea de interesse para profissionais da \u00e1rea da sa\u00fade e da educa\u00e7\u00e3o e impactam de forma negativa no desempenho acad\u00eamico, na participa\u00e7\u00e3o na esfera social e na orienta\u00e7\u00e3o profissional. Contudo, para caracterizar os problemas de linguagem do adolescente, \u00e9 necess\u00e1rio conhecer melhor sobre o desenvolvimento t\u00edpico das habilidades lingu\u00edsticas nessa faixa et\u00e1ria.Em adolescentes com transtorno na linguagem, a organiza\u00e7\u00e3o mental da informa\u00e7\u00e3o n\u00e3o \u00e9 adequada, observando-se problemas na sequencializa\u00e7\u00e3o e estrutura\u00e7\u00e3o do discurso, que compromete a capacidade de narrar eventos.Realizado em adolescentes com desenvolvimento t\u00edpico da linguagem, com idade m\u00e9dia de 14 anos, outro estudo tinha por objetivo criar uma nova tarefa narrativa e procurar determinar se provocaria maior complexidade sint\u00e1tica do que uma tarefa conversacional. Esta pesquisa abordou a necessidade de ferramentas apropriadas para avaliar a capacidade da narrativa oral com complexidade sint\u00e1tica de adolescentes estudantes da oitava s\u00e9rie. Os resultados verificaram que n\u00e3o houve diferen\u00e7as estat\u00edstica significativa no desempenho da narrativa oral entre meninos e meninas e a tarefa narrativa suscitou maior complexidade sint\u00e1tica do que a tarefa conversacional. Assim, o objetivo do presente estudo foi caracterizar o desempenho de adolescentes, do 6\u00ba ao 9\u00ba ano do ensino fundamental, na produ\u00e7\u00e3o e compreens\u00e3o do discurso narrativo oral, bem como a influ\u00eancia do sexo, ano escolar, idade, nomea\u00e7\u00e3o de figuras, escore geral de linguagem oral e mem\u00f3ria. Al\u00e9m disso, buscou-se verificar se a tarefa do discurso narrativo oral da Bateria Montreal de Avalia\u00e7\u00e3o da Comunica\u00e7\u00e3o \u2013 Bateria MAC, validada e normatizada para adultos falantes do portugu\u00eas brasileiro, pode ser usada para a popula\u00e7\u00e3o adolescente sem adapta\u00e7\u00f5es.A aplica\u00e7\u00e3o de avalia\u00e7\u00f5es de linguagem padronizadas possibilita mensurar as caracter\u00edsticas lingu\u00edsticas, auxilia na compreens\u00e3o do processo de aquisi\u00e7\u00e3o, contribui para o desenvolvimento das capacidades cognitivas, e \u00e9 base para a interven\u00e7\u00e3o fonoaudiol\u00f3gica. Estuda-se a linguagem de crian\u00e7as e adultos, mas a transi\u00e7\u00e3o, ou seja, a adolesc\u00eancia, ainda \u00e9 pouco explorada, principalmente as habilidades do discurso narrativo oral. Compreender melhor o discurso narrativo oral na adolesc\u00eancia pode guiar o desenvolvimento de ferramentas eficazes para programas de interven\u00e7\u00e3o nessa faixa et\u00e1riaTrata-se de estudo observacional anal\u00edtico transversal, aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa da Universidade Federal de Minas Gerais sob parecer n\u00ba1.722.230.Os adolescentes eleg\u00edveis a participa\u00e7\u00e3o no estudo e seus pais, foram esclarecidos quanto aos aspectos volunt\u00e1rios do estudo, seus benef\u00edcios, suas etapas e assinaram o Termo de Consentimento Livre e Esclarecido (TCLE) \u2013 pais e respons\u00e1veis) e Termo de Assentimento Livre Esclarecido (TALE).Foram inclu\u00eddos 100 adolescentes de duas escolas p\u00fablicas da mesma regi\u00e3o da cidade de Belo Horizonte. Os participantes n\u00e3o possu\u00edam diagn\u00f3sticos de transtornos de aprendizagem, altera\u00e7\u00f5es sensoriais, neurol\u00f3gicas, cognitivas ou comportamentais, de acordo com relatos dos coordenadores das escolas, e eram falantes nativos do portugu\u00eas brasileiro, sem flu\u00eancia em outro idioma. As escolas j\u00e1 possu\u00edam uma lista com os adolescentes com Transtornos do Neurodesenvolvimento e a partir desta foi poss\u00edvel realizar a exclus\u00e3o pr\u00e9via de alguns participantes. Os adolescentes referidos pelos professores e coordenadores com baixo desempenho escolar tamb\u00e9m n\u00e3o foram inclu\u00eddos.A faixa et\u00e1ria dos participantes variou de 11 a 16 anos de idade, com m\u00e9dia de 12,9 anos . Dos participantes 62% eram do g\u00eanero feminino. No per\u00edodo da coleta, os adolescentes cursavam o ensino fundamental nos seguintes anos escolares: 6\u00ba ano (n=34), 7\u00ba ano (n=23), 8\u00ba ano (n=25) e 9\u00ba ano (n=18)., Teste de Nomea\u00e7\u00e3o de Boston-TNB e testes de linguagem oral e mem\u00f3ria do Instrumento de Avalia\u00e7\u00e3o Neuropsicol\u00f3gica Breve (NEUPSILIN).Os instrumentos utilizados para a realiza\u00e7\u00e3o do estudo foram: prova do discurso narrativo oral da Bateria Montreal de Avalia\u00e7\u00e3o da Comunica\u00e7\u00e3o - Bateria MAC. Para aplica\u00e7\u00e3o e an\u00e1lise, foram utilizados os procedimentos propostos pelos autores do teste no manual de instru\u00e7\u00f5es. Nas tarefas de reconto, os adolescentes ouviram um texto curto e recontaram de modo resumido e com as pr\u00f3prias palavras o que acabara de acontecer na hist\u00f3ria, primeiro a cada par\u00e1grafo . Registrou-se as caselas correspondentes ao total de informa\u00e7\u00f5es essenciais lembradas (pontua\u00e7\u00e3o m\u00e1xima=18) e total de informa\u00e7\u00f5es presentes lembradas (pontua\u00e7\u00e3o m\u00e1xima=29). Em seguida, o adolescente escutava a mesma hist\u00f3ria e solicitou-se o reconto do mesmo texto por completo . Foram anotados os comportamentos comunicativos desviantes, como: observa\u00e7\u00f5es pessoais abundantes, discurso tangencial, n\u00e3o-respeito \u00e0 cronologia dos eventos, omiss\u00e3o de marcadores de rela\u00e7\u00e3o, l\u00e9xico impreciso, refer\u00eancias imprecisas, acr\u00e9scimo de informa\u00e7\u00f5es erradas e falta de flu\u00eancia. Em seguida, o adolescente respondia oralmente a 12 quest\u00f5es sobre a hist\u00f3ria e, depois, oferecia-se a op\u00e7\u00e3o de dar um novo t\u00edtulo para a hist\u00f3ria. Baseando-se nas tarefas de reconto, respostas \u00e0s perguntas de compreens\u00e3o, e na linguagem n\u00e3o verbal (como risos e coment\u00e1rios pessoais), verificou-se se a infer\u00eancia da narrativa foi feita, ou seja, a compreens\u00e3o da moral da hist\u00f3ria. O tempo m\u00e9dio de aplica\u00e7\u00e3o da tarefa do Discurso Narrativo Oral foi de 15 minutos.Para avalia\u00e7\u00e3o do discurso narrativo oral foi utilizada a tarefa da Bateria MAC, composta por reconto parcial da hist\u00f3ria, par\u00e1grafo por par\u00e1grafo, reconto integral da hist\u00f3ria, tarefa de dar t\u00edtulo e observa\u00e7\u00e3o de processamento de infer\u00eancia Para as tarefas de reconto da hist\u00f3ria, padronizou-se a leitura para que n\u00e3o houvesse diferen\u00e7a de entona\u00e7\u00e3o e pros\u00f3dia que pudesse vir a interferir na compreens\u00e3o do texto por parte do adolescente. Para isso, foi realizada grava\u00e7\u00e3o do texto do teste, por um ator com 12 anos de experi\u00eancia em teatro, utilizando-se o gravador Sony WDC WD3200BEVT- 75ZCT2.. O tempo m\u00e9dio de aplica\u00e7\u00e3o do Teste de Nomea\u00e7\u00e3o de Boston foi 20 minutos.A habilidade de nomear figuras foi avaliada por meio do TNB. As figuras foram apresentadas na ordem do teste, permitindo-se vinte segundos para a resposta. Se o adolescente produziu uma resposta incorreta ou nenhuma resposta, o examinador ofereceu uma pista fon\u00eamica. Se ap\u00f3s essa pista o sujeito continuou produzindo uma resposta incorreta ou nenhuma resposta dentro de vinte segundos, uma sugest\u00e3o sem\u00e2ntica relacionada \u00e0 imagem, j\u00e1 indicada na folha de resposta, foi fornecida. A transcri\u00e7\u00e3o das respostas dadas pelos sujeitos foi registrada no protocolo de registro do teste. Para an\u00e1lise do teste, foi realizado o escore correspondente \u00e0s respostas do adolescente, sendo essas: total de resposta corretas sem pista, total de resposta com pista fon\u00eamica (correta e incorreta), total de resposta com pista sem\u00e2ntica (correta e incorreta), total de respostas corretas geral (evoca\u00e7\u00e3o espont\u00e2nea + evoca\u00e7\u00e3o com pistas), que apresenta valores normativos para a popula\u00e7\u00e3o falante do portugu\u00eas brasileiro e com idade superior a 12 anos. O subteste de linguagem oral \u00e9 constitu\u00eddo por tarefas de nomea\u00e7\u00e3o, repeti\u00e7\u00e3o, linguagem autom\u00e1tica, compreens\u00e3o e processamento de infer\u00eancias. Atribuiu-se um ponto nas respostas corretas e zero nas incorretas; para an\u00e1lise somou-se o escore geral correspondente \u00e0 pontua\u00e7\u00e3o total do adolescente. O desempenho do adolescente foi classificado em adequado e inadequado, considerando-se a refer\u00eancia do teste. O desempenho dos adolescentes foi registrado na folha de resposta padr\u00e3o do teste. O tempo m\u00e9dio de aplica\u00e7\u00e3o foi de 7 minutos.Analisou-se o escore total do subteste de linguagem oral do NEUPSILIN. Analisou-se cada prova do subteste de mem\u00f3ria separadamente, composto por tarefas de: mem\u00f3ria de trabalho, mem\u00f3ria verbal epis\u00f3dico-sem\u00e2ntico, mem\u00f3ria sem\u00e2ntica de longo prazo e mem\u00f3ria visual de curto prazo. Para an\u00e1lise dos resultados, foi feita avalia\u00e7\u00e3o quantitativa das respostas dos adolescentes, correspondente a cada tarefa da prova. O desempenho do estudante foi classificado em adequado e inadequado de acordo com os dados padronizados no teste. O tempo m\u00e9dio de aplica\u00e7\u00e3o foi de 7 minutos.Tamb\u00e9m foi aplicado o subteste de mem\u00f3ria do NEUPSILINA coleta de dados foi realizada entre agosto de 2016 e mar\u00e7o de 2017. Os testes citados no presente artigo foram aplicados separadamente, totalizando tr\u00eas sess\u00f5es com cada adolescente. Todas as avalia\u00e7\u00f5es foram realizadas na pr\u00f3pria escola, de forma individual, no hor\u00e1rio em que os alunos frequentavam as aulas, em uma sala destinada para essa fun\u00e7\u00e3o; seguiu-se as normas de aplica\u00e7\u00e3o e an\u00e1lises padronizadas pelos testes.. Em seguida aplicou-se o TNB e a Bateria MAC.Iniciou-se com a avalia\u00e7\u00e3o global da linguagem oral e da mem\u00f3ria por meio do NEUPSILINO banco de dados foi constru\u00eddo com aux\u00edlio do Excel e ap\u00f3s a devida an\u00e1lise de consist\u00eancia foram realizadas an\u00e1lises descritivas univariadas utilizando o software Statistical Package for the Social Sciences (SPSS) 19.0. Inicialmente foi aplicado o teste Kolmogorov-Smirnov para avaliar normalidade das vari\u00e1veis num\u00e9ricas cont\u00ednuas e todas apresentaram distribui\u00e7\u00e3o normal. Efetuou-se an\u00e1lise descritiva por meio do c\u00e1lculo das frequ\u00eancias e medidas de tend\u00eancia central e de dispers\u00e3o (m\u00e9dia e desvio-padr\u00e3o). Foram aplicados os testes t de Student Simples para compara\u00e7\u00e3o entre duas m\u00e9dias independentes; Anova para comparar tr\u00eas m\u00e9dias independentes; e Correla\u00e7\u00e3o de Pearson para relacionar duas vari\u00e1veis num\u00e9ricas cont\u00ednuas.Para as an\u00e1lises, adotou-se como vari\u00e1vel resposta o desempenho dos adolescentes na compreens\u00e3o e express\u00e3o do discurso oral e como vari\u00e1veis explicativas: g\u00eanero, ano escolar, idade, total de respostas corretas no Teste de Nomea\u00e7\u00e3o de Boston e escore global da linguagem oral  e mem\u00f3ria  do teste NEUPSILIN.Por fim, foram constru\u00eddos modelos de regress\u00e3o linear m\u00faltipla, tendo como desfecho o discurso narrativo , e como vari\u00e1veis explicativas todas aquelas que apresentaram valor p menor que 0,20 na an\u00e1lise univariada. Adotou-se o m\u00e9todo backwards, com remo\u00e7\u00e3o das vari\u00e1veis com maior valor de p at\u00e9 se obter o modelo final ajustado.A se\u00e7\u00e3o de resultados ser\u00e1 apresentada em t\u00f3picos. Inicialmente ser\u00e3o apresentados os resultados das an\u00e1lises descritivas, univariadas e multivariadas do reconto parcial e integral. No segundo t\u00f3pico, ser\u00e3o apresentados os resultados da associa\u00e7\u00e3o entre as vari\u00e1veis da tarefa de reconto da Bateria MAC e as vari\u00e1veis do Teste de Nomea\u00e7\u00e3o de Boston. Em seguida um t\u00f3pico espec\u00edfico para o desempenho nas quest\u00f5es fechadas.A Dos seis tipos de comportamentos comunicativos desviantes no discurso narrativo, os adolescentes apresentaram n\u00e3o cronologia dos eventos (21% dos adolescentes), acr\u00e9scimo de informa\u00e7\u00f5es erradas (15%), refer\u00eancias imprecisas (6%) e l\u00e9xico impreciso (5%).Em um total de 18 informa\u00e7\u00f5es essenciais lembradas, a m\u00e9dia de respostas dos adolescentes foi de 12,6 pontos e em 29 informa\u00e7\u00f5es presentes lembradas, a m\u00e9dia foi de 16 pontos, no reconto parcial da hist\u00f3ria. Com rela\u00e7\u00e3o ao reconto integral da hist\u00f3ria, no total de 13 informa\u00e7\u00f5es lembradas, a m\u00e9dia de respostas dos adolescentes foi de 9,8 pontos. J\u00e1 na avalia\u00e7\u00e3o da compreens\u00e3o do texto, no total de 12 quest\u00f5es a m\u00e9dia foi de 9,6 pontos .Neste estudo n\u00e3o se observa associa\u00e7\u00e3o entre o desempenho dos adolescentes nos recontos da prova de discurso narrativo e as vari\u00e1veis explicativas sexo, escolaridade e adequa\u00e7\u00e3o na linguagem oral, segundo os resultados das an\u00e1lises univariadas entre o desempenho na prova de discurso e as vari\u00e1veis explicativas.A O desempenho no Teste de Nomea\u00e7\u00e3o de Boston permaneceu nos tr\u00eas modelos de regress\u00e3o linear m\u00faltipla. De acordo com os modelos finais: o aumento de 1 ponto no total de respostas corretas na nomea\u00e7\u00e3o aumenta 0,322 pontos no total de informa\u00e7\u00f5es essenciais lembradas no reconto parcial; 0,225 ponto no total de informa\u00e7\u00f5es presentes lembradas no reconto parcial; e 0,192 ponto no total de ideias lembradas no reconto integral.Como o desempenho geral no Teste de Nomea\u00e7\u00e3o de Boston foi a \u00fanica vari\u00e1vel preditora do desempenho dos adolescentes no reconto, optou-se por verificar a associa\u00e7\u00e3o de todas as vari\u00e1veis do teste com o discurso narrativo. Os resultados da Correla\u00e7\u00e3o de Pearson s\u00e3o apresentados na De acordo com a regress\u00e3o linear m\u00faltipla: o aumento de 1 ponto no total de respostas corretas com pista sem\u00e2ntica reduz 0,399 ponto no total de informa\u00e7\u00f5es essenciais lembradas no reconto parcial; o aumento de 1 ponto no total de respostas incorretas com pista fon\u00eamica, reduz 0,248 ponto no total de informa\u00e7\u00f5es essenciais lembradas no reconto parcial, 0,502 ponto no total de informa\u00e7\u00f5es presentes lembradas no reconto parcial e 0,720 ponto no total de ideias lembradas no reconto integral; e o aumento de 1 ponto no total de respostas corretas na nomea\u00e7\u00e3o reduz 0,506 ponto no total de ideias lembradas no reconto integral.Os resultados das an\u00e1lises univariadas entre o total de acertos nas quest\u00f5es da prova de discurso narrativo e as vari\u00e1veis explicativas s\u00e3o apresentados nas . A maioria foi capaz de inferir a moral da hist\u00f3ria e n\u00e3o houve diferen\u00e7a no desempenho dos adolescentes considerando os n\u00edveis de escolaridade e sexo.O presente estudo verificou o desempenho de adolescentes de 11 a 16 anos, do 6\u00ba ao 9\u00ba ano do ensino fundamental, de escola p\u00fablica, na produ\u00e7\u00e3o e compreens\u00e3o do discurso narrativo oral e os fatores associados. A nomea\u00e7\u00e3o de figuras foi \u00e0 \u00fanica vari\u00e1vel preditora do desempenho nas tarefas do discurso narrativo oral . Em an\u00e1lise qualitativa, os adolescentes foram capazes de recontar uma hist\u00f3ria com organiza\u00e7\u00e3o e planejamento adequados, de forma coerente e fluente. O desempenho foi semelhante ao de adultos jovens com menor escolaridade (dois a sete anos de estudo). J\u00e1 a nomea\u00e7\u00e3o \u00e9 uma habilidade importante para a constru\u00e7\u00e3o do vocabul\u00e1rio e envolve uma s\u00e9rie de representa\u00e7\u00f5es mentais e processos cognitivos relativamente distintos, mas em intera\u00e7\u00e3o, tais como: reconhecimento do est\u00edmulo visual como um conceito familiar, acesso ao significado do item visualizado, acesso \u00e0 estrutura\u00e7\u00e3o fonol\u00f3gica, e programa\u00e7\u00e3o motora para a produ\u00e7\u00e3o oral. O vocabul\u00e1rio e a nomea\u00e7\u00e3o s\u00e3o habilidades intimamente relacionadas, de forma que uma contribui para o desenvolvimento da outra mutuamente e envolvem a capacidade de acesso lexical e a qualidade da representa\u00e7\u00e3o sem\u00e2ntica no l\u00e9xico,25. Em linhas gerais, no presente estudo, os adolescentes que apresentaram melhor desempenho na nomea\u00e7\u00e3o tamb\u00e9m o apresentaram nas tarefas de reconto . Para expressar o conte\u00fado de uma hist\u00f3ria, interagem v\u00e1rias habilidades lingu\u00edsticas, como a fonologia, morfologia, l\u00e9xico e processamento gramatical. Em pesquisa realizada com crian\u00e7as, identificou-se o vocabul\u00e1rio e a nomea\u00e7\u00e3o como um preditor significativo de pontua\u00e7\u00e3o do discurso oral. Assim, os resultados corroboram a literatura, pois dentre as habilidades que contribuem para a narrativa oral temos a nomea\u00e7\u00e3o, e para express\u00e3o do discurso narrativo \u00e9 necess\u00e1ria a capacidade do acesso lexical e preservado, sendo habilidades diretamente proporcionais.O vocabul\u00e1rio diz respeito \u00e0 amplitude e \u00e0 diversidade lexical que se possui em rela\u00e7\u00e3o a uma l\u00edngua. Refere-se \u00e0 capacidade de compreender os termos e utiliz\u00e1-los para adquirir e transmitir significado.Os resultados do presente estudo demonstraram que quanto maior a dificuldade no discurso narrativo oral, maior a dificuldade na nomea\u00e7\u00e3o de figuras, mesmo ap\u00f3s as facilita\u00e7\u00f5es sem\u00e2nticas e fon\u00eamicas. O total de respostas corretas com pista sem\u00e2ntica \u00e9 inversamente proporcional ao total de informa\u00e7\u00f5es essenciais lembradas no reconto parcial. O aumento da pontua\u00e7\u00e3o no total de respostas incorretas com pista fon\u00eamica reduz a pontua\u00e7\u00e3o no total de informa\u00e7\u00f5es (essenciais e presentes) e no total de ideias lembradas no reconto integral. Outro estudo verificou que indiv\u00edduos com n\u00edvel educacional mais alto obtiveram melhor desempenho na nomea\u00e7\u00e3o com uso de facilita\u00e7\u00f5es e que pistas fon\u00eamicas beneficiaram os indiv\u00edduos com mais de oito anos de instru\u00e7\u00e3o formal. A literatura aponta que indiv\u00edduos menos escolarizados n\u00e3o se beneficiam de facilita\u00e7\u00f5es para recupera\u00e7\u00e3o do nome, evidenciando a falta de conhecimento do l\u00e9xico e esta evolui \u00e0 medida que ocorre progress\u00e3o da leitura. Os est\u00edmulos ambientais tamb\u00e9m s\u00e3o essenciais na formula\u00e7\u00e3o de um discurso coerente. O presente estudo sugere que a dificuldade na nomea\u00e7\u00e3o de figuras com pista sem\u00e2ntica e fon\u00eamica pode ser atribu\u00edda \u00e0: 1. falta do conhecimento lexical; 2. gradua\u00e7\u00e3o do teste de nomea\u00e7\u00e3o com crit\u00e9rios de dificuldade de outra l\u00edngua; 3. estimula\u00e7\u00e3o ambiental carente; 4. redu\u00e7\u00e3o do h\u00e1bito da leitura; 5. n\u00edvel de escolaridade dos adolescentes; 6. mem\u00f3ria sem\u00e2ntica restrita; e 7. palavras pouco frequentes para adolescentes.Com rela\u00e7\u00e3o \u00e0 produ\u00e7\u00e3o do discurso narrativo oral, a literatura descreve que para faz\u00ea-lo de forma coerente, \u00e9 necess\u00e1ria a habilidade de recupera\u00e7\u00e3o das informa\u00e7\u00f5es. Para o reconto da hist\u00f3ria, a mem\u00f3ria funcional \u00e9 essencial para manter o tema, a coer\u00eancia e para recuperar informa\u00e7\u00f5es. Estudo realizado com crian\u00e7as verificou a associa\u00e7\u00e3o entre mem\u00f3ria de trabalho e habilidades da narrativa oral e a contribui\u00e7\u00e3o direta da mem\u00f3ria para compreens\u00e3o da narrativa oral. No presente estudo n\u00e3o se observou efeito da mem\u00f3ria com rela\u00e7\u00e3o \u00e0s tarefas de compreens\u00e3o e produ\u00e7\u00e3o do discurso narrativo nos adolescentes. A prova utilizada \u00e9 composta por um texto curto, com apenas cinco pequenos par\u00e1grafos e busca avaliar a capacidade de armazenamento do material lingu\u00edstico. A Bateria MAC foi delineada para pacientes neurol\u00f3gicos, e o teste NEUPSILIN tem como prop\u00f3sito investigar de forma simples e r\u00e1pida o desempenho neuropsicol\u00f3gico do indiv\u00edduo, al\u00e9m disso, avalia pouco a mem\u00f3ria sem\u00e2ntica; pode-se considerar a possibilidade de as tarefas terem sido de n\u00edvel f\u00e1cil para adolescentes com desenvolvimento t\u00edpico. Sugerem-se novos estudos para confirma\u00e7\u00e3o dessa observa\u00e7\u00e3o.Na adolesc\u00eancia ocorre o desenvolvimento da mem\u00f3ria e progresso no racioc\u00ednio dedutivo. Em outro estudo brasileiro, realizado com crian\u00e7as de seis a doze anos, houve ind\u00edcios preliminares de melhora gradual com o avan\u00e7o da idade. Vale ressaltar que estas pesquisas compararam os resultados entre crian\u00e7as e adolescentes, abrangendo uma diferen\u00e7a maior de faixa et\u00e1ria. O presente estudo testou apenas adolescentes e este fator pode ter levado a diferen\u00e7a de resultados com rela\u00e7\u00e3o as demais pesquisas que avaliaram crian\u00e7as e adolescentes. Estudos futuros comparando com adolescentes do ensino m\u00e9dio poder\u00e3o apontar o efeito de idade e escolaridade.N\u00e3o foi observada, dentre os adolescentes estudados, influ\u00eancia do ano escolar no desempenho do reconto parcial e integral, nem nos acertos nas quest\u00f5es de compreens\u00e3o do discurso narrativo. No entanto, estudos comprovam que a influ\u00eancia do ano escolar \u00e9 mais significativa na inf\u00e2ncia. Estudo brasileiro avaliou a compreens\u00e3o e a produ\u00e7\u00e3o da narra\u00e7\u00e3o oral de crian\u00e7as de cinco a 11 anos e 11 meses, demostrando que as crian\u00e7as mais velhas apresentaram mais acertos do que as crian\u00e7as mais jovens. No presente estudo, n\u00e3o foi observada rela\u00e7\u00e3o entre a pontua\u00e7\u00e3o geral da linguagem oral medida por meio das tarefas do teste NEUPSILIN e o escore da prova do discurso narrativo da Bateria MAC. Deve-se considerar que de maneira geral, a amostra n\u00e3o era muito heterog\u00eanea em termos lingu\u00edsticos, pois n\u00e3o foram inclu\u00eddos os adolescentes com altera\u00e7\u00f5es no desenvolvimento da linguagem, assim n\u00e3o foram encontradas associa\u00e7\u00f5es entre a linguagem oral e a prova do discurso narrativo. A associa\u00e7\u00e3o pode aparecer quando estivermos comparando indiv\u00edduos com desenvolvimento t\u00edpico e indiv\u00edduos com transtornos da linguagem oral e escrita. Al\u00e9m disso, a tarefa do discurso narrativo da Bateria MAC n\u00e3o avalia o discurso espont\u00e2neo e utiliza apenas um contexto narrativo. Este dado aponta para a necessidade de se pensar e implementar avalia\u00e7\u00f5es de linguagem oral que apresentem maior complexidade lingu\u00edsticas nas tarefas. Indica tamb\u00e9m, a possibilidade de padroniza\u00e7\u00e3o de avalia\u00e7\u00e3o de fala espont\u00e2nea e an\u00e1lise da associa\u00e7\u00e3o do escore geral de linguagem oral em teste neuropsicol\u00f3gico e da rela\u00e7\u00e3o do discurso narrativo oral em adolescentes com desenvolvimento t\u00edpico e naqueles com transtorno de linguagem. Sendo assim, sugere-se a avalia\u00e7\u00e3o da narrativa oral por meio de tarefas e contextos diferenciados, como o desempenho do discurso narrativo espont\u00e2neo, sem figuras, mediante um tema previamente estipulado, de acordo com a experi\u00eancia de vida, utilizando os mesmos crit\u00e9rios de an\u00e1lise da Bateria MAC.O discurso \u00e9 uma atividade complexa que requer uma rede de habilidades lingu\u00edsticas; o adolescente deve estruturar e processar eventos interligados atrav\u00e9s de rela\u00e7\u00f5es l\u00f3gicas. A elabora\u00e7\u00e3o de uma hist\u00f3ria espont\u00e2nea demanda mais recursos cognitivos do que o reconto ap\u00f3s a escuta do texto. Em outro estudo realizado com adolescentes com desenvolvimento t\u00edpico, n\u00e3o houve diferen\u00e7a estatisticamente significativa entre os sexos no desempenho da narrativa oral.N\u00e3o se observou correla\u00e7\u00e3o estatisticamente significativa entre o sexo, em todas as tarefas do teste do discurso narrativo oral, o que corrobora a literatura; estudo que caracterizou os aspectos discursivos de adolescentes do 6\u00ba ano do ensino fundamental observou semelhan\u00e7a de desempenho entre meninos e meninas tanto na linguagem oral quanto na linguagem escrita, ocorrendo a evolu\u00e7\u00e3o da compreens\u00e3o, aumento do processamento da informa\u00e7\u00e3o e do entendimento. No presente estudo, quando comparado aos valores de refer\u00eancia da Bateria MAC, os adolescentes tiveram desempenho pr\u00f3ximo ao de adultos jovens de 19-39 anos em todas as provas do discurso narrativo oral , acr\u00e9scimo de informa\u00e7\u00f5es erradas (15%), refer\u00eancias imprecisas (6%) e l\u00e9xico impreciso (5%).. Assim, a presen\u00e7a de comportamentos comunicativos desviantes em adolescentes pode ser indicativa de altera\u00e7\u00f5es lingu\u00edsticas decorrentes de transtornos neurofuncionais.Em an\u00e1lise qualitativa, os adolescentes apresentaram comportamentos comunicativos desviantes durante as produ\u00e7\u00f5es verbais do discurso narrativo, como: n\u00e3o cronologia dos eventos, acr\u00e9scimo de informa\u00e7\u00f5es erradas, refer\u00eancias imprecisas, e l\u00e9xico impreciso, por\u00e9m todos estes em baixa porcentagem. A literatura demonstra que indiv\u00edduos com traumatismo cerebral, comparados com grupo controle de pacientes sem les\u00f5es neurol\u00f3gicas, produzem narrativas com maiores erros de coes\u00e3o, coer\u00eancia, discursos vagos, com erros na organiza\u00e7\u00e3o da micro e macroestrutura lingu\u00edsticaDessa forma, os comportamentos comunicativos desviantes parecem estar mais presentes na produ\u00e7\u00e3o do discurso narrativo em indiv\u00edduos com les\u00e3o cerebral e n\u00e3o em adolescentes com desenvolvimento t\u00edpico da linguagem. A presen\u00e7a de tais comportamentos pode ser indicativa cl\u00ednica de altera\u00e7\u00f5es na linguagem, decorrentes de falhas neurofuncionais no hemisf\u00e9rio direito, devendo ser observada pelos fonoaudi\u00f3logos cl\u00ednicos na avalia\u00e7\u00e3o de adolescentes com queixas de transtornos da linguagem..Um estudo foi realizado com adolescentes de escola p\u00fablica, com o objetivo de contribuir com as pr\u00e1ticas docentes direcionadas \u00e0 constru\u00e7\u00e3o de infer\u00eancias por parte de adolescentes do ensino fundamental com idades de 12 a 19 anos. Os resultados indicaram que os estudantes apresentaram dificuldade em fazer infer\u00eancia, mesmo a partir da leitura de textos simples, no entanto, essa situa\u00e7\u00e3o mudou significativamente no decorrer da aplica\u00e7\u00e3o das oficinas. A maioria dos adolescentes (77%) conservou o t\u00edtulo dado no primeiro momento, optando por n\u00e3o elaborar um segundo t\u00edtulo. Assim, este resultado est\u00e1 de acordo com a literatura e pode indicar que habilidade de fazer infer\u00eancias a partir de um texto, pode estar em desenvolvimento nessa faixa et\u00e1ria.Na amostra estudada, 64% dos adolescentes elaboraram t\u00edtulo para a hist\u00f3ria, mas n\u00e3o relacionado a moral da hist\u00f3ria. No entanto, de acordo com as normas de aplica\u00e7\u00e3o do teste, os adolescentes podiam escolher livremente um t\u00edtulo para a hist\u00f3ria e que n\u00e3o necessariamente deveria ter rela\u00e7\u00e3o com a moral. Assim, observa-se um processamento mais r\u00e1pido por parte dos adolescentes e um desenvolvimento maior com rela\u00e7\u00e3o as crian\u00e7as.Na amostra estudada, a infer\u00eancia foi processada ap\u00f3s uma \u00fanica escuta do texto. Em pesquisa realizada com crian\u00e7as de escola p\u00fablica e privada, constatou-se que os grupos se beneficiaram do reconto integral, ou seja, ap\u00f3s a segunda escuta. Em estudo realizado com adultos, o percentual do processamento da infer\u00eancia, com escolaridade de dois a sete anos foi de 76% e com mais de oito anos de escolaridade foi de 96%. Os adolescentes apresentaram um desempenho intermedi\u00e1rio entre crian\u00e7as de escola privada e adultos com mais de oito anos de estudo, com 77% do processamento da infer\u00eancia, demonstrado por meio da compreens\u00e3o da moral do texto. Assim, com rela\u00e7\u00e3o \u00e0 capacidade de fazer infer\u00eancias, quando se comparam adolescentes com crian\u00e7as de escola p\u00fablica e com adultos, observa-se uma evolu\u00e7\u00e3o, refor\u00e7ando a necessidade de instrumentos de avalia\u00e7\u00e3o validados nesta fase. Este resultado corrobora a literatura que descreve o adolescente em processo de transi\u00e7\u00e3o entre a inf\u00e2ncia e a fase adulta, com evolu\u00e7\u00e3o do racioc\u00ednio dedutivo e da linguagem figurada e abstrata. Outra pesquisa demonstrou que a compreens\u00e3o da narrativa em adolescente ainda n\u00e3o se completou e encontra-se em processo de matura\u00e7\u00e3o cerebral. A literatura descreve que o uso da linguagem pelo adolescente \u00e9 mais refinado em compara\u00e7\u00e3o ao uso pelas crian\u00e7as; j\u00e1 adultos possuem maior capacidade de fazer infer\u00eancias, com rela\u00e7\u00e3o aos adolescentes, por terem maior conhecimento de mundo.No processo de adapta\u00e7\u00e3o do discurso narrativo da Bateria MAC para crian\u00e7as, o percentual do processamento de infer\u00eancias, na escola p\u00fablica foi de 46,7% e na escola privada de 75%,29. Dessa forma, a aplica\u00e7\u00e3o de testes do discurso narrativo em adolescentes de escola privada poderia gerar resultados diferentes.Uma limita\u00e7\u00e3o do estudo \u00e9 apresentar apenas dados de adolescentes de escola p\u00fablica, visto que pesquisas nacionais e internacionais apontam associa\u00e7\u00e3o entre o desempenho lingu\u00edstico e o n\u00edvel socioecon\u00f4mico. Estudos futuros dever\u00e3o verificar o desempenho de estudantes de escola privada bem como o de adolescentes de 15 a 17 anos. Para estudos futuros, sugere-se a an\u00e1lise da narrativa espont\u00e2nea e a verifica\u00e7\u00e3o do efeito do n\u00edvel socioecon\u00f4mico, cultural, e de idade nas habilidades do discurso narrativo oral.A prova do discurso narrativo da Bateria MAC parece adequada, mesmo sem as adapta\u00e7\u00f5es realizadas para o p\u00fablico infantilAssim, por meio desse estudo verificou-se as habilidades do discurso narrativo oral em adolescentes com desenvolvimento t\u00edpico. Este estudo representa uma explora\u00e7\u00e3o inicial, visto que n\u00e3o foram encontrados estudos sobre essas habilidades lingu\u00edsticas em popula\u00e7\u00f5es compostas exclusivamente por adolescentes falantes do portugu\u00eas brasileiro.A nomea\u00e7\u00e3o de figuras foi a \u00fanica vari\u00e1vel preditora do desempenho nas tarefas do discurso narrativo oral, sendo que os adolescentes que apresentaram melhor desempenho na nomea\u00e7\u00e3o, tamb\u00e9m o apresentaram nas tarefas de reconto.N\u00e3o se observou efeito estatisticamente significativo entre o discurso narrativo e o ano escolar, idade, mem\u00f3ria e escore geral de linguagem oral. De maneira geral, os adolescentes apresentam baixa porcentagem de comportamentos comunicativos desviantes durante o reconto integral da hist\u00f3ria na Bateria MAC, indicando que nesta faixa et\u00e1ria ocorre a diminui\u00e7\u00e3o da frequ\u00eancia de rupturas na produ\u00e7\u00e3o do discurso com capacidade de reconto da hist\u00f3ria de forma coerente e fluente.Na amostra estudada, os indiv\u00edduos foram capazes de compreender e de elaborar um discurso narrativo oral de forma semelhante a adultos com menor n\u00edvel de escolaridade (de dois a sete anos). Dessa forma, a prova de discurso narrativo da Bateria MAC pode ser utilizada para a avalia\u00e7\u00e3o de adolescentes sem adapta\u00e7\u00f5es."}
+{"text": "To analyze the association between behavioral aspects and learning motivation according to age, sex, and grade in school in middle school students.Observational, analytical, and cross-sectional study with 11- to 14-year-old adolescents, who answered the participant characterization questionnaire, the Strengths and Difficulties Questionnaire \u2013 SDQ-Por, and the Learning Motivation Evaluation Scale \u2013 EMAPRE. Descriptive and bivariate statistical analyses were conducted.In the sample researched, there was a statistically significant association between the Strengths and Difficulties Questionnaire domains and the learning motivation goals. It demonstrated that the students with higher means and medians for higher quality motivations had normal results in the SDQ conduct problems, whereas those with a greater tendency to a more extrinsic motivation had an abnormal result in peer relationship problems. In the total classification, the sample students with higher mean and median for the learning goal (which refers to a greater academic commitment) had a normal result, whereas those more prone to the performance-avoidance goal had more abnormal results. The learning motivation did not vary according to age and grade in school, and the adolescents had a greater tendency to the learning goal than to the other two.The association between the behavioral aspects and the learning motivation in the sample assessed was present in the abnormal SDQ-Por scores in relation to the performance-avoidance goal, and in the normal SDQ-Por scores in relation to the learning goal. Hence, academic commitment requires effort, intact brain functions, and a social context that help students achieve good results and carry on the learning process. Studies point to learning motivation as one of the essential factors to favor learning. Other researchers related the learning motivation to the students\u2019 performance.Another point that stands out in this context is their motivation \u2013 i.e., the reason why students engage in tasks that have been proposed to them and encompasses the person\u2019s manner of thinking, self-view, objectives, and emotions. These issues greatly influence their reaction to academic tasks. Thus, motivation is classified into the \u201clearning goal\u201d, which refers to the student\u2019s willingness to face the challenges inherent to learning and intellectual growth and their persistence in academic activities; the \u201cperformance-approach goal\u201d, in which the student strives to show themselves competitive and stand out from the others; and the \u201cperformance-avoidance goal\u201d, which refers to avoiding mistakes so they will not appear to be incapable.Since motivation is a multidimensional and complex construct, some theories try to analyze it from different perspectives. The achievement goal theory, on which the presents study is based, outlines different types of motivation according to the \u201creasons for engagement\u201d. Other factors are intrinsic to the person, such as functional disabilities, hearing loss, and behavioral problems. All these difficulties require greater attention on their part to diminish the suffering that results from school failure and its consequences.Therefore, it is understandable that factors extrinsic to the person, such as the family environment and socioeconomic conditions, influence their development at school, possibly leading to school difficulties. The research demonstrates that externalizing behaviors and poor academic skills are closely associated. Possible deviant behaviors can be identified as early as kindergarten, signaling later school difficulties. Since learning difficulties are generally related to other comorbidities, the underlying difficulties can supposedly be found from what has been manifested \u2013 the behavior.A literature review pointed out the prevalence of learning difficulty associated with behavioral and emotional problems and other disorders, such as attention deficit, hyperactivity, and depression. In general, the student\u2019s externalizing behaviors exhibited at school are characterized as oppositional, aggressive, hyperactive, impulsive, defiant, and antisocial. On the other hand, some students have internalizing behaviors, manifested as dysphoria (depression), withdrawal, fear, and anxiety.The literature shows a relationship between poor school performance and clinically relevant emotional and/or behavioral symptoms, behavioral issues are mostly noticed by the parents and point to a causal factor of great interest to the speech-language-hearing sciences \u2013 the learning difficulties. In-depth knowledge of the behavioral factors associated with learning complaints helps reach a differential diagnosis of the school difficulties and learning disorders. It also helps prevent problems that originated in feelings related to the school environment, peer comparison, and the resulting feelings of inferiority, low self-esteem, and so forth. Moreover, since they are adolescents, it helps understand the factors that lead middle school students to be more engaged with school tasks and more committed to academic activities. This is highly important for teachers to identify better strategies to motivate them and make the school setting more pleasant to them.Hence, this study seeks to investigate students\u2019 behavioral complaints. According to the literatureThe objective of this study was to analyze the association between behavioral aspects and learning motivation according to age, sex, and grade in school in middle schoolers. Specifically, the objectives of the paper were to describe the students\u2019 behavioral capacities and difficulties and learning motivation, according to the domains: learning goal, performance-approach goal, and performance-avoidance goal, and verify the association of behavioral capacities and difficulties with learning motivation and their sex, age, and grade in school.This study was approved by the Research Ethics Committee under evaluation report no. 2.422.795. It has an observational, analytical, cross-sectional design, with a nonprobabilistic sample comprising 124 adolescents 11 to 14 years old, who attended middle school at a private institution.The inclusion criteria were as follows: 11- to 14-year-old students enrolled in middle school; who signed the informed assent form and whose parents/guardians signed the informed consent form; and who agreed to answer the questionnaires used in the study. Adolescents were excluded if they did not understand the instruments or had cognitive, neurological, or psychiatric impairments that prevented them from participating in the research.The data were collected from the questionnaires filled in by the students. They were both allowed not to answer any questions that made them feel uncomfortable and assured that the information would remain secret and be used only in this research., which has been used internationally and validated in Brazilian Portuguese, the Learning Motivation Assessment Scale , and a participant characterization questionnaire.The instruments used in the study were the Strength and Difficulties Questionnaire (SDQ-Por)The SDQ has 25 items, classified into five scales, involving emotional symptoms (five items); conduct problems (five items); hyperactivity/inattention (five items); peer relationship problems (five items), and prosocial behavior (five items). It was filled in by the students because the sample age range began at 11 years. The protocol defines the total difficulty score above 20 points as \u201cabnormal\u201d and the prosocial behavior score up to 4 points as \u201cabnormal\u201d. \u2013 the learning goal (12 items), the performance-approach goal (nine items), and the performance-avoidance goal (seven items) \u2013, totaling 28 items in which the students chose from the following answer options: \u201cI agree\u201d, \u201cI don\u2019t know\u201d, and \u201cI disagree\u201d.The EMAPRE, which assesses the learning motivation based on the achievement goal theory, is divided into three domains accepted by Brazilian researchersTwo response variables were used, namely: the students\u2019 capacities  and difficulties , based on the SDQ. The explanatory variables were the learning motivation, sex, age, and grade in school.Descriptive and bivariate statistical analyses were conducted with the frequency distribution of the categorical variables and the measures of central tendency and dispersion of the continuous variables. The association analyses were made with Pearson\u2019s chi-squared, Kruskal-Wallis, and Mann-Whitney tests, with the statistical significance level set at p \u2264 0.05. The data were entered, processed, and analyzed in the SPSS software, version 25.0.Most participants in the sample were females (54.0%), 11 years old (27.4%), in sixth grade (32.2%). As for motivation, the learning goal had a higher mean and median than the performance-approach and performance-avoidance goals .In the SDQ classification analysis , most students had a normal result in all scales  and 2 \u2013 The association analysis of the SDQ prosocial behavior and total score with the numerical variables sex, age, and grade in school did not find statistically significant results. However, the data indicate that the emotional symptoms and peer relationship problems were more present in females than males, according to the SDQ. Of the adolescents whose scores pointed to abnormal behavior, 66.7% were girls and 33.3%, boys in the emotional symptoms; and, in the peer relationship problems, 61.5% were girls .The association analysis between the SDQ scales, prosocial behavior, and total score and the EMAPRE revealed statistically significant results between conduct problems and the learning goal (p=0.013), with a higher mean and median for the normal result \u2013 i.e., most students with the learning goal had a normal result in conduct problems. There was also an association between peer relationship problems and the performance-avoidance goal p=0.002), with a higher mean for the abnormal result \u2013 i.e., in this sample, this goal is related to having more peer relationship problems. A statistically significant association was observed between the SDQ total classification and the learning goal (p=0.025), with a higher mean and median for the normal result; and with the performance-avoidance goal (p=0.012), with a higher mean and median for the abnormal result. There was an evident proportional relationship between the students\u2019 goal preferences and externalizing behaviors . Further, with a This study showed an association between the conduct problems and the learning goal. There were also relationships between peer relationship problems and the performance-avoidance goal; the learning goal and the SDQ total normal classification; and the performance-avoidance goal and SDQ total abnormal classification.. Other studies point out that, as students develop greater self-effectiveness, they also acquire greater emotional management skills, which optimizes their learning,16. Recent research mentions that healthy life habits greatly potentialize academic motivation. Nevertheless, the relationship between motivation and academic performance is not a determinant, making it evident that the pedagogical practices, although traditionally based on extrinsic motivation, greatly influence the students\u2019 willingness to do the school tasks.The greater tendency to the learning goal showed a greater inclination to an intrinsic motivation, which is associated in the literature with better academic performance and behavior less indicative of clinical anxiety. The teachers recognize such students as the ones that learn the most and have the highest academic self-knowledge and self-control indices in general. Another factor to consider has been observed in a study that points out how students internalize their teachers\u2019 beliefs regarding their academic performance. According to Hareli and Weiner, \u201cevery student is sensitive to other people\u2019s reactions, both the real and the potential ones, with consequences to their own judgments and behaviors \u201c. Hence, they certify that the students\u2019 self-perception is also influenced by the teachers\u2019 feedback. In their turn, they respond to their teachers\u2019 beliefs with their behavior, which may manifest as anger, withdrawal, or even greater exposure to the challenges, as seen in the attitude of those who mostly fit the learning goal. This demonstrates that this tendency is also shaped by the context to which each student belongs. A study conducted in a higher education setting observed that motivation is influenced by the environmental dynamics and the professors\u2019 manner of carrying out academic activities. This demonstrates that the students\u2019 greater freedom to ask their questions aloud, dialoguing with the groups and the professor, helped them be more successful in learning, leading them to be more involved in the tasks. Thus, when the students\u2019 autonomy is stimulated, along with other basic psychological needs, they also develop greater intrinsic motivation.The greatest tendency to the learning goal was an expected result since the sample did not present school complaints. This corroborates the literature, as a more positive and lasting motivation shows that behavioral issues may not only result from possible school difficulties but also precede them, in many cases,21. This data must be further investigated in samples with more sociodemographic diversification.Even though no statistically significant association was verified between the social behaviors and the sociodemographic data, the females\u2019 greater tendency to have emotional symptoms and peer relationship problems is compatible with the data indicated in the literature. Studies on the behavior patterns between the sexes point to more frequent emotional symptoms  in girls, whereas boys have more aggressive behaviors, with a greater tendency to hyperactivity, which reports that the learning goal is related to the intrinsic motivation \u2013 i.e., a positive behavior. This correlation is again made evident in the total classification of the association of the SDQ and EMAPRE, as more adolescents opted for the learning goal in the normal behavioral score. A piece of research compared students diagnosed with attention-deficit/hyperactivity disorder (ADHD) with children with typical development; it made evident the correlation between the disorder and the difficulties engaging in academic tasks. Hence, these students\u2019 behavior is compatible with extrinsic motivation.The association between the SDQ and EMAPRE revealed that the adolescents that tended more to the learning goal had fewer conduct problems \u2013 corroborating the literature that observed a tendency to the performance-avoidance goal associated with low academic interest, anxiety, and poorer school performance. This also corroborates recent research conducted at the Center for Attention, Learning, and Memory of the Cambridge University, United Kingdom, with a mixed sample of students with school difficulties, either having associated disorders or not. The study made an association between two scales, the SDQ and the RCADS-P , which assesses anxiety and depressive disorders in children. It verified that a large part of the sample had an abnormal behavior in the SDQ emotional symptoms (49%) and that the students with greater emotional symptoms and hyperactivity pointed to anxiety and depression problems. Another study investigated children and demonstrated a greater presence of behavioral comorbidities  in those with developmental disorders associated with school difficulties than in those with the diagnosis alone. These data highlight the importance of correlating, as in the present study, tests that encompass different factors involved in the learning process.The behavioral changes occur along with the performance-avoidance goal in its association with peer relationship problems and SDQ total classification. This result is compatible with a studyThe sample homogeneity in terms of socioeconomic data and cultural aspects can be considered a limitation of this study. The students attended a private school and thus do not represent the vast majority of the Brazilian reality.It must be emphasized that the advancements that have been attained help understand the associations between behavioral aspects and learning motivation, as few studies have such a triangulation, particularly using the EMAPRE and SDQ protocols and encompassing the age group presented here. Therefore, this evidence may contribute to the discussion on the topic on the part of health and education professionals who deal with students in their daily routine.Given the above, the study on the topic point to the integration of learning with emotional aspects, based on a multifactorial perspective. This aims to highlight a subjective and greatly important aspect in the teaching and learning processes, namely, learning motivation. Hence, this study has a role in the dialogue between the knowledge of the various fields, contributing to the discussion and broadening the understanding of the processes related to the learning situations.This research demonstrated the association between behavioral aspects and learning motivation in middle school adolescents, with the association between the SDQ-Por abnormal scores and the performance-avoidance goal, and between the SDQ-Por normal scores and the learning goal. There was a statistically significant association between conduct problems and the learning goal; between peer relationship problems and the performance-avoidance goal; between the learning goal and the SDQ total normal classification; and between the performance-avoidance goal and the SDQ total abnormal classification. The investigated sample had no statistically significant difference in the behavioral aspects and learning motivation according to age, sex, and grade in school.Therefore, understanding the relationship between behavioral aspects and learning motivation favors a multidisciplinary approach to adolescents, both in school and speech-language-hearing clinical practice, aiming at the well-being and better quality of life of the population studied. .No percurso acad\u00eamico, desde os anos iniciais da educa\u00e7\u00e3o b\u00e1sica ao ingresso no ensino superior, ocorre constante exposi\u00e7\u00e3o a conte\u00fados cient\u00edficos que fogem da viv\u00eancia e da realidade dos estudantes. De forma que o engajamento acad\u00eamico exige esfor\u00e7o e fun\u00e7\u00f5es cerebrais \u00edntegras, bem como um contexto social favor\u00e1vel para a obten\u00e7\u00e3o de bons resultados e a garantia da perman\u00eancia do estudante no processo de aprendizado. Estudos apontam a motiva\u00e7\u00e3o para aprender como um dos fatores essenciais de favorecimento da aprendizagem. Outros pesquisadores relacionaram a motiva\u00e7\u00e3o para aprender ao desempenho do estudante.Nesse contexto, deve ser destacada a motiva\u00e7\u00e3o do indiv\u00edduo, ou seja, o porqu\u00ea do estudante se engajar em alguma tarefa que lhe \u00e9 proposta e envolve a forma como o indiv\u00edduo pensa, a vis\u00e3o a respeito de si mesmo, os seus objetivos e emo\u00e7\u00f5es, quest\u00f5es que v\u00e3o ter grande influ\u00eancia em como o indiv\u00edduo reage frente \u00e0s tarefas acad\u00eamicas. Assim, a motiva\u00e7\u00e3o \u00e9 classificada em \u201cmeta aprender\u201d, que diz respeito ao desejo do aluno em enfrentar os desafios inerentes \u00e0 aprendizagem, ao crescimento intelectual, bem como \u00e0 persist\u00eancia nas atividades acad\u00eamicas, \u201cmeta performance aproxima\u00e7\u00e3o\u201d, na qual o aluno busca parecer competente e se destacar em rela\u00e7\u00e3o aos demais, e \u201cmeta performance evita\u00e7\u00e3o\u201d, que diz respeito a evitar erros, para n\u00e3o parecer incapaz.Sendo a motiva\u00e7\u00e3o um construto considerado multidimensional e complexo, algumas teorias tentam analis\u00e1-la a partir de diferentes perspectivas. A Teoria da Meta de Realiza\u00e7\u00e3o, na qual se fundamenta o presente estudo, tra\u00e7a diferentes tipos de motiva\u00e7\u00e3o a partir das \u201craz\u00f5es para o engajamento\u201d. Outros fatores s\u00e3o intr\u00ednsecos ao sujeito, como defici\u00eancias funcionais, perda auditiva, e problemas comportamentais. Todas essas dificuldades pressup\u00f5em maior aten\u00e7\u00e3o a estes indiv\u00edduos, para diminuir os sofrimentos decorrentes do fracasso escolar e suas consequ\u00eancias.Portanto, \u00e9 compreens\u00edvel que fatores extr\u00ednsecos ao indiv\u00edduo, como ambiente familiar e condi\u00e7\u00f5es socioecon\u00f4micas, influenciem no desenvolvimento do estudante no ambiente escolar, e possam desencadear dificuldades escolares. A pesquisa evidencia que os comportamentos externalizados e as habilidades acad\u00eamicas pobres est\u00e3o intimamente associados. Ainda na educa\u00e7\u00e3o infantil \u00e9 poss\u00edvel identificar de maneira precoce poss\u00edveis desvios de comportamento que sinalizam dificuldades escolares posteriores e uma vez que as dificuldades de aprendizado, em geral, est\u00e3o atreladas a outras comorbidades, entende-se ser poss\u00edvel encontrar as dificuldades de base, a partir do que \u00e9 exposto, o comportamento.Uma revis\u00e3o de literatura apontou que h\u00e1 preval\u00eancia da dificuldade de aprendizagem atrelada a problemas comportamentais e emocionais, bem como a outros transtornos, como d\u00e9ficit de aten\u00e7\u00e3o, hiperatividade e depress\u00e3o. Em geral, os comportamentos externalizados pelos alunos em ambientes escolares se destacam como opositivos, agressivos, hiperativos, impulsivos, desafiadores e manifesta\u00e7\u00e3o anti-social. Enquanto h\u00e1 quem apresente aspectos que ficam internalizados, que se evidenciam como: disforia (depress\u00e3o), retraimento, medo e ansiedade.A literatura apresenta rela\u00e7\u00e3o entre o baixo desempenho escolar e sintomas emocionais e/ou comportamentais em n\u00edveis considerados de relev\u00e2ncia cl\u00ednica, as quest\u00f5es comportamentais s\u00e3o mais percebidas pelos pais e apontam para um fator causal de grande interesse da fonoaudiologia, a dificuldade de aprendizagem. Aprofundar nos conhecimentos dos fatores comportamentais envolvidos com as queixas de aprendizagem permite realizar um diagn\u00f3stico diferencial quanto \u00e0s dificuldades escolares e aos transtornos de aprendizagem e contribuir para a preven\u00e7\u00e3o de problemas advindos dos sentimentos em rela\u00e7\u00e3o ao ambiente escolar, das compara\u00e7\u00f5es com os pares e consequente sentimento de inferioridade, da baixa autoestima, dentre outros. Al\u00e9m disso, uma vez que se trata do p\u00fablico adolescente, entender os fatores que contribuem para o engajamento nas propostas escolares e o comprometimento nas atividades acad\u00eamicas \u00e9 de fundamental import\u00e2ncia para que o professor saiba identificar melhores estrat\u00e9gias de motiva\u00e7\u00e3o a fim de tornar o ambiente escolar mais agrad\u00e1vel.O presente estudo prop\u00f5e, assim, investiga\u00e7\u00f5es a respeito das queixas comportamentais dos escolares. De acordo com a literaturaO presente estudo teve como objetivo analisar a associa\u00e7\u00e3o entre os aspectos comportamentais e a motiva\u00e7\u00e3o para aprender segundo idade, g\u00eanero e ano escolar em estudantes do Ensino Fundamental II. De maneira espec\u00edfica, os objetivos do trabalho foram descrever as capacidades e dificuldades comportamentais dos estudantes e a motiva\u00e7\u00e3o para aprender segundo os dom\u00ednios: meta aprender, meta performance-aproxima\u00e7\u00e3o e meta performance-evita\u00e7\u00e3o e verificar a associa\u00e7\u00e3o das capacidades e dificuldades comportamentais com a motiva\u00e7\u00e3o para aprender e os seus dom\u00ednios g\u00eanero, idade e ano escolar.O presente estudo foi aprovado pelo Comit\u00ea de \u00c9tica em Pesquisa sob parecer de n\u00famero 2.422.795 e apresenta delineamento observacional, anal\u00edtico e transversal com amostra n\u00e3o probabil\u00edstica composta por 124 adolescentes de 11 a 14 anos matriculados no ensino fundamental de uma escola de financiamento privado.Os crit\u00e9rios de inclus\u00e3o foram ser estudante matriculado no Ensino Fundamental II na faixa et\u00e1ria de 11 a 14 anos de idade, cujos respons\u00e1veis tenham assinado o Termo de Consentimento Livre e Esclarecido (TCLE), e os adolescentes que assinaram o Termo de Assentimento Livre e Esclarecido (TALE) e que aceitaram responder aos question\u00e1rios propostos. Foram exclu\u00eddos adolescentes que n\u00e3o compreenderam os instrumentos ou com altera\u00e7\u00f5es cognitivas, neurol\u00f3gicas ou psiqui\u00e1tricas que impedissem a realiza\u00e7\u00e3o da pesquisa.A coleta dos dados foi realizada por autopreenchimento dos estudantes, que foram informados que poderiam se recusar a responder alguma pergunta, caso se sentissem constrangidos, al\u00e9m de lhes ser assegurado o sigilo das informa\u00e7\u00f5es para uso exclusivo da pesquisa em quest\u00e3o.Strengths and Difficulties Questionnaire \u2013 SDQ, instrumento internacionalmente usado e validado para o portugu\u00eas brasileiro, a Escala de Avalia\u00e7\u00e3o da Motiva\u00e7\u00e3o para a Aprendizagem- EMAPRE e um question\u00e1rio de caracteriza\u00e7\u00e3o dos participantes.Os instrumentos utilizados para o estudo foram o Question\u00e1rio de Capacidades e Dificuldades \u2013 SDQ-Por \u2013 O SDQ \u00e9 composto por 25 itens, classificados em cinco subcategorias que envolvem: sintomas emocionais (cinco itens); problemas de comportamento (cinco itens); hiperatividade/desaten\u00e7\u00e3o (cinco itens); problemas de relacionamento com colegas (cinco itens) e comportamento pr\u00f3-social (cinco itens). O preenchimento foi realizado pelos pr\u00f3prios estudantes, uma vez que a amostra contou com a faixa et\u00e1ria acima de 11 anos de idade. O protocolo define o escore total de dificuldades acima de 20 pontos como \u201canormal\u201d e o escore do \u201cComportamento pr\u00f3-social\u201d at\u00e9 4 pontos como \u201canormal\u201d.: meta aprender (12 itens), meta performance-aproxima\u00e7\u00e3o (9 itens) e meta performance-evita\u00e7\u00e3o (7 itens); totalizando 28 itens em que o aluno respondia de acordo com as op\u00e7\u00f5es \u201cConcordo\u201d, \u201cN\u00e3o sei\u201d ou \u201cDiscordo\u201d.A Escala de Avalia\u00e7\u00e3o da Motiva\u00e7\u00e3o para a Aprendizagem \u2013 EMAPRE, que avalia a motiva\u00e7\u00e3o para aprender baseado na Teoria de Metas de Realiza\u00e7\u00e3o, sendo distribu\u00edda em tr\u00eas dom\u00ednios aceitos por pesquisadores brasileirosForam elencadas duas vari\u00e1veis respostas que foram as capacidades  e dificuldades  dos estudantes a partir do question\u00e1rio SDQ. As vari\u00e1veis explicativas foram a motiva\u00e7\u00e3o para aprender, o g\u00eanero, a idade e o ano escolar.Foram realizadas as an\u00e1lises estat\u00edsticas descritiva e bivariada com distribui\u00e7\u00e3o de frequ\u00eancia das vari\u00e1veis categ\u00f3ricas e das medidas de tend\u00eancia central e de dispers\u00e3o das vari\u00e1veis cont\u00ednuas. Para as an\u00e1lises de associa\u00e7\u00e3o foram utilizados os testes Qui-quadrado de Pearson, Kruskal-Wallis e Mann-Whitney, sendo considerados com signific\u00e2ncia estat\u00edstica as que apresentaram valor de p \u2264 0,05. Para entrada, processamento e an\u00e1lise dos dados foi utilizado o software SPSS, vers\u00e3o 25.0.Na amostra pesquisada, a maioria dos participantes pertencia ao g\u00eanero feminino , a maior parte possu\u00eda 11 anos de idade  e cursava o 6o ano escolar . Com rela\u00e7\u00e3o \u00e0s metas de motiva\u00e7\u00e3o para aprendizagem, a Meta Aprender apresentou maior m\u00e9dia e mediana se comparada \u00e0s Metas Performance-Aproxima\u00e7\u00e3o e Meta Performance-Evita\u00e7\u00e3o .Na an\u00e1lise de classifica\u00e7\u00e3o do question\u00e1rio SDQ, por escalas, comportamento pr\u00f3-social e classifica\u00e7\u00e3o total foi poss\u00edvel verificar que em todas as escalas a maioria dos estudantes apresentou resultado considerado normal  e 2, senEmbora a an\u00e1lise de associa\u00e7\u00e3o das escalas do comportamento pr\u00f3-social e escore total do question\u00e1rio SDQ com as vari\u00e1veis num\u00e9ricas \u201cg\u00eanero\u201d, \u201cidade\u201d e \u201cano escolar\u201d n\u00e3o tenha demonstrado resultados com signific\u00e2ncia estat\u00edstica, os dados indicaram que os sintomas emocionais e problemas de relacionamento com colegas tiveram maior express\u00e3o no g\u00eanero feminino, de acordo com o question\u00e1rio SDQ, se comparado ao g\u00eanero masculino. Dentre os adolescentes que obtiveram pontua\u00e7\u00f5es que apontaram para alguma anormalidade comportamental, 66,7% eram meninas para 33,3% dos meninos, nos crit\u00e9rios de sintomas emocionais. Nos problemas de relacionamento com colegas, dentro do grupo que pontuou para anormalidade, 61,5% eram meninas .outliers, valores discrepantes que fogem do padr\u00e3o da amostra, da \u201cMeta Performance Evita\u00e7\u00e3o\u201d dentro da normalidade, o que pressup\u00f5e que um comportamento positivo \u00e9 menos observado nos estudantes com prefer\u00eancia a esta meta de aprendizagem  com maior m\u00e9dia e mediana para o resultado normal, ou seja, a maior propor\u00e7\u00e3o de estudantes orientados para a Meta-aprender tiveram resultado normal na subescala de problemas de conduta. Verificou-se ainda associa\u00e7\u00e3o entre \u201cProblemas de relacionamento com colegas\u201d e \u201cMeta Performance Evita\u00e7\u00e3o\u201d p=0,002) com maior m\u00e9dia para o resultado anormal, indicando que esta meta est\u00e1 relacionada, nesta amostra, \u00e0 maior apresenta\u00e7\u00e3o de problemas de relacionamento com colegas. Pode-se observar, ainda, associa\u00e7\u00e3o estatisticamente significativa entre \u201cClassifica\u00e7\u00e3o total\u201d do SDQ com \u201cMeta Aprender\u201d , com maior m\u00e9dia e mediana para o resultado normal, e com \u201cMeta Performance Evita\u00e7\u00e3o\u201d , com maior m\u00e9dia e mediana para o resultado anormal. Ficou evidente uma rela\u00e7\u00e3o de propor\u00e7\u00e3o entre a prefer\u00eancia das metas e os comportamentos externalizados pelos estudantes . Pode-sendizagem  e 2. com maioO presente estudo demonstrou associa\u00e7\u00e3o entre os \u201cProblemas de conduta\u201d e \u201cMeta Aprender\u201d, rela\u00e7\u00e3o entre os \u201cProblemas de relacionamento com os pares\u201d e a \u201cMeta Performance evita\u00e7\u00e3o\u201d, bem como da \u201cMeta Aprender\u201d com \u201cClassifica\u00e7\u00e3o total\u201d do SDQ \u201cnormal\u201d e \u201cMeta performance evita\u00e7\u00e3o\u201d com \u201cClassifica\u00e7\u00e3o total\u201d do SDQ \u201canormal\u201d.. Outros estudos apontam que, \u00e0 medida que o estudante desenvolve maior autoefic\u00e1cia, possui maior capacidade de gest\u00e3o emocional, o que otimiza a sua aprendizagem,16. Pesquisa recente menciona os h\u00e1bitos de vida saud\u00e1veis como grandes potencializadores da motiva\u00e7\u00e3o acad\u00eamica. Apesar disso, a rela\u00e7\u00e3o entre motiva\u00e7\u00e3o e o desempenho acad\u00eamico n\u00e3o \u00e9 determinante, e isso evidencia que as pr\u00e1ticas pedag\u00f3gicas, apesar de tradicionalmente partirem da motiva\u00e7\u00e3o extr\u00ednseca, possuem uma grande influ\u00eancia sobre a vontade do aluno em cumprir com as tarefas escolares.A maior tend\u00eancia \u00e0 Meta Aprender demonstrou uma maior orienta\u00e7\u00e3o \u00e0 uma motiva\u00e7\u00e3o intr\u00ednseca, que \u00e9 associada na literatura com um melhor desempenho acad\u00eamico e comportamento com menor ind\u00edcio de ansiedade cl\u00ednica, sendo reconhecido pelos professores, como alunos que mais aprendem, com maiores \u00edndices de autoconhecimento acad\u00eamico e autocontrole em geral. Outro fator que deve ser levado em considera\u00e7\u00e3o \u00e9 o observado em um estudo que aponta como o estudante internaliza as cren\u00e7as dos professores para o seu desempenho acad\u00eamico. Segundo Hareli e Weiner, \"todo aluno \u00e9 sens\u00edvel \u00e0s rea\u00e7\u00f5es das outras pessoas, tanto reais como potenciais, com repercuss\u00f5es sobre seus pr\u00f3prios julgamentos e comportamentos\", atestando o fato de que a autopercep\u00e7\u00e3o do aluno \u00e9 tamb\u00e9m influenciada pelo feedback dos professores, e o estudante, por sua vez, responde \u00e0 esta cren\u00e7a do professor por meio do seu comportamento, seja de raiva, retraimento ou mesmo se expondo mais aos desafios como \u00e9 demonstrado nas atitudes daqueles que se encaixam na Meta Aprender de maneira majorit\u00e1ria. Isso demonstra que essa tend\u00eancia \u00e9 tamb\u00e9m moldada pelo contexto no qual o estudante est\u00e1 inserido. No contexto da educa\u00e7\u00e3o superior, um estudo permitiu observar que a motiva\u00e7\u00e3o \u00e9 influenciada pela din\u00e2mica ambiental e a forma como o professor conduz as atividades acad\u00eamicas. Isso evidencia que a maior liberdade de apresentar as d\u00favidas em voz alta, dialogando com o grupo e com o docente, contribuiu para que os estudantes vivessem situa\u00e7\u00f5es de sucesso frente \u00e0 aprendizagem, resultando no maior envolvimento nas tarefas, pois quando \u00e9 estimulada a autonomia do estudante, juntamente com outras necessidades psicol\u00f3gicas b\u00e1sicas, ocorre maior desenvolvimento da motiva\u00e7\u00e3o intr\u00ednseca.A maior tend\u00eancia \u00e0 Meta Aprender era um resultado esperado, uma vez que \u00e9 uma amostra sem queixas escolares, o que corrobora a literatura ao mostrar que a motiva\u00e7\u00e3o mais positiva e duradoura evidencia que quest\u00f5es comportamentais n\u00e3o s\u00f3 podem resultar de uma poss\u00edvel dificuldade escolar, como podem, em muitos casos, preceder \u00e0s dificuldades escolares,21. \u00c9 necess\u00e1rio maiores investiga\u00e7\u00f5es deste dado em uma amostra mais diversificada em termos sociodemogr\u00e1ficos.Apesar de n\u00e3o ter sido verificada associa\u00e7\u00e3o com signific\u00e2ncia estat\u00edstica entre os comportamentos sociais e os dados sociodemogr\u00e1ficos, a maior tend\u00eancia do g\u00eanero feminino em apresentar sintomas emocionais e problemas de relacionamento com colegas \u00e9 compat\u00edvel com os dados previstos na literatura. Estudos sobre os padr\u00f5es de comportamento entre os g\u00eaneros apontam uma maior frequ\u00eancia de sintomas emocionais, como dor de cabe\u00e7a, dor de barriga e enjoo, des\u00e2nimo, crises de choro, perda de confian\u00e7a, dentre outros, em meninas, enquanto nos meninos h\u00e1 uma maior presen\u00e7a de comportamentos mais agressivos, com maior tend\u00eancia \u00e0 hiperatividade, que menciona a Meta Aprender como relacionada \u00e0 motiva\u00e7\u00e3o intr\u00ednseca, que diz respeito a um comportamento positivo. Essa correla\u00e7\u00e3o \u00e9 novamente evidenciada na Classifica\u00e7\u00e3o Total da associa\u00e7\u00e3o dos testes SDQ e EMAPRE, em que h\u00e1 uma maior concentra\u00e7\u00e3o dos adolescentes que optaram pela Meta Aprender no escore comportamental dentro dos padr\u00f5es de normalidade. Em pesquisa que compara estudantes diagnosticados com Transtorno do D\u00e9ficit de Aten\u00e7\u00e3o e Hiperatividade (TDAH) com crian\u00e7as que possuem desenvolvimento t\u00edpico, ficou evidenciada a correla\u00e7\u00e3o do transtorno \u00e0 dificuldade de engajamento nas tarefas acad\u00eamicas, de forma que estes estudantes possuem comportamento compat\u00edvel com uma motiva\u00e7\u00e3o de car\u00e1ter extr\u00ednseco.A associa\u00e7\u00e3o do SDQ com o EMAPRE evidenciou que os adolescentes que apresentaram maior tend\u00eancia \u00e0 Meta Aprender apresentaram menos Problemas de Conduta, o que corrobora a literatura que observou uma tend\u00eancia \u00e0 Meta Performance-Evita\u00e7\u00e3o associada ao baixo interesse acad\u00eamico, ansiedade e desempenho escolar mais baixo. Isso tamb\u00e9m corrobora pesquisa recente realizada em um Centro de Aten\u00e7\u00e3o, Aprendizagem e Mem\u00f3ria vinculado \u00e0 Universidade de Cambridge, Reino Unido, com uma amostra mista de alunos com dificuldade escolares, que apresentavam transtornos associados ou n\u00e3o, em que foi realizada associa\u00e7\u00e3o entre duas escalas SDQ e RCADS-P , que avalia a ansiedade e os transtornos depressivos em crian\u00e7as, e verificou que grande parte da amostra apresentou comportamento anormal no SDQ para a escala de sintomas emocionais (49%) e que os alunos com maiores sintomas emocionais e hiperatividade apontaram para problemas de ansiedade e depress\u00e3o. Outro estudo que buscou investigar o p\u00fablico infantil evidenciou nas crian\u00e7as com transtornos de desenvolvimento associados \u00e0s dificuldades escolares, uma maior presen\u00e7a de comorbidades comportamentais, com a presen\u00e7a de baixa autoestima, maior dificuldade na intera\u00e7\u00e3o social e comportamento agressivo, se comparado a crian\u00e7as com diagn\u00f3stico isolado. Esses dados ressaltam a import\u00e2ncia da correla\u00e7\u00e3o de testes, como no presente estudo, que abarquem diferentes fatores envolvidos no processo de aprendizagem.A coocorr\u00eancia de altera\u00e7\u00f5es comportamentais com a Meta Performance-Evita\u00e7\u00e3o \u00e9 apresentada na associa\u00e7\u00e3o da Meta Performance Evita\u00e7\u00e3o com os problemas de relacionamento com os colegas e a Classifica\u00e7\u00e3o Total do SDQ. Este resultado \u00e9 compat\u00edvel com estudo\u00c9 poss\u00edvel considerar como limita\u00e7\u00e3o do estudo a homogeneidade da amostra com rela\u00e7\u00e3o aos dados socioecon\u00f4micos e aspectos culturais, pois trata-se de estudantes de uma escola de financiamento privado, que n\u00e3o representam a realidade massiva brasileira.Vale destacar que os avan\u00e7os alcan\u00e7ados possibilitam compreender as associa\u00e7\u00f5es entre aspectos comportamentais e motiva\u00e7\u00e3o para aprender, pois s\u00e3o escassos os estudos com tal triangula\u00e7\u00e3o e sobretudo com os protocolos EMAPRE e SDQ, abrangendo a faixa et\u00e1ria aqui apresentada. Desse modo, estas evid\u00eancias podem contribuir na discuss\u00e3o da tem\u00e1tica para profissionais da sa\u00fade e educa\u00e7\u00e3o que lidam com escolares em sua rotina di\u00e1ria.Como visto, o estudo da tem\u00e1tica aponta a integra\u00e7\u00e3o da aprendizagem com os aspectos emocionais baseado em uma perspectiva multifatorial buscando ressaltar um aspecto subjetivo e de grande import\u00e2ncia nos processos de ensino e aprendizagem, a motiva\u00e7\u00e3o para aprender. Deste modo, o presente estudo assume um papel no di\u00e1logo entre os saberes de diversas \u00e1reas, possibilita colaborar para a discuss\u00e3o e amplia\u00e7\u00e3o do entendimento dos processos relacionados \u00e0s situa\u00e7\u00f5es de aprendizagem.A presente pesquisa evidenciou que h\u00e1 associa\u00e7\u00e3o entre os aspectos comportamentais e a motiva\u00e7\u00e3o para aprender em adolescentes do Ensino Fundamental por meio da associa\u00e7\u00e3o entre os escores alterados do SDQ-Por e a Meta Performance Evita\u00e7\u00e3o e entre os escores normais do SDQ-Por e a Meta Aprender. Observou-se associa\u00e7\u00e3o com signific\u00e2ncia estat\u00edstica na associa\u00e7\u00e3o entre o dom\u00ednio \u201cProblemas de conduta\u201d e a \u201cMeta Aprender\u201d, o dom\u00ednio \u201cProblemas de relacionamento com os pares\u201d e a \u201cMeta Performance Evita\u00e7\u00e3o\u201d, bem como da \u201cMeta Aprender\u201d com \u201cClassifica\u00e7\u00e3o total\u201d do SDQ \u201cnormal\u201d e \u201cMeta Performance Evita\u00e7\u00e3o\u201d com \u201cClassifica\u00e7\u00e3o total\u201d do SDQ \u201canormal\u201d. A amostra investigada n\u00e3o demonstrou diferen\u00e7a com signific\u00e2ncia estat\u00edstica nos aspectos comportamentais e motiva\u00e7\u00e3o para aprender de acordo com a idade, g\u00eanero e ano escolar.Dessa forma, compreender a rela\u00e7\u00e3o entre os aspectos comportamentais e a motiva\u00e7\u00e3o para aprender favorecer\u00e1 uma abordagem multidisciplinar do adolescente, tanto na pr\u00e1tica escolar quanto na cl\u00ednica fonoaudiol\u00f3gica, com vistas ao bem-estar e a promo\u00e7\u00e3o de melhor qualidade de vida da popula\u00e7\u00e3o estudada."}
+{"text": "IKE training improved LVC  during 15\u2009W IKE exercise and increased functional capacity by 13% . The improvement in peak V\u0307O2 was independent of changes in Q\u0307c  and due primarily to increased a\u2010vO2 difference . IKE training improved vasodilation and functional capacity in patients with HFpEF. Exercise interventions aimed at increasing peripheral oxidative capacity may be effective therapeutic options for HFpEF patients.Patients with HFpEF experience severe exercise intolerance due in part to peripheral vascular and skeletal muscle impairments. Interventions targeting peripheral adaptations to exercise training may reverse vascular dysfunction, increase peripheral oxidative capacity, and improve functional capacity in HFpEF. Determine if 8\u2009weeks of isolated knee extension exercise (KE) training will reverse vascular dysfunction, peripheral oxygen utilization, and exercise capacity in patients with HFpEF. Nine HFpEF patients  performed graded IKE exercise  and maximal exercise testing (cycle ergometer) before and after IKE training . Femoral blood flow (ultrasound) and leg vascular conductance  were measured during graded IKE exercise. Peak pulmonary oxygen uptake (V\u0307O This study demonstrates residual vascular plasticity in patients with HFpEF. IKE training may be beneficial for patients with severe peripheral limitations to exercise capacity or dyspnea during traditional aerobic training.  Nine healthy, sedentary, senior controls were enrolled strictly to provide comparative baseline data. Controls completed a detailed medical history, examination, 12\u2010lead electrocardiogram, and stress exercise test with an echocardiogram to exclude coronary artery disease, valvular disease, and atrial flutter/fibrillation. Healthy control subjects were excluded if they had renal insufficiency and a history of nicotine use (past 10\u2009years).A total of 12 patients (>65\u2009years of age) with a clinical history of HF by Framingham criteria in addition to objective evidence for pulmonary congestion by chest radiograph or right heart catheterization and an ejection fraction >50% at the time of index hospitalization. Exclusion criteria included atrial fibrillation at the time of the study, recent (<1\u00a0year) myocardial infarction, prior coronary artery bypass graft, a history of surgical revascularization or multivessel percutaneous revascularization, stable angina, coronary artery disease with provocable ischemia, moderate to severe valvular heart disease, renal failure (creatinine >2.5\u00a0g/dl), chronic pulmonary disease, congenital heart disease, HF admission within the last 5\u00a0months, New York Heart Association HF class\u2009>\u2009III, and warfarin use. Three subjects were excluded due to vascular plaques that precluded ultrasound assessment of the common femoral artery (2.3Peak aerobic capacity and vascular function were assessed before and after 8\u2009weeks of isolated knee extension (IKE) exercise training Figure\u00a0. Subject2.42 at baseline. Each test was performed in a semi\u2010recumbent position on an electronically braked cycle ergometer with a pedal rate of ~60\u2009rpm (10\u201020\u2009W increments every 2\u00a0min). The first test was used to familiarize subjects with experimental maneuvers and to screen for provocable ischemia by baseline and postexercise echocardiogram. The second exercise test occurred >72\u2009h after the first test and consisted of two submaximal exercise bouts graded in intensity (SS1 and SS2) followed by a confirmatory graded maximal test. Following a minimum of 10\u00a0min of rest after submaximal exercise, peak exercise was assessed with the same incremental protocol as performed on Day 1. AV nodal blockers were withheld for 48\u2009h prior to testing but other antihypertensive medications were continued.Each subject performed two graded exercise tests to determine peak V\u0307O2 was defined as the highest oxygen uptake measured from at least a 30\u2009s Douglas bag collection. Q\u0307c was measured using a modified acetylene rebreathing technique that is validated, reproducible, and equivalent to invasive measures of Q\u0307c during maximal exercise  was calculated from the ratio between Q\u0307c and oxygen uptake using the Fick Equation  was monitored continuously via electrocardiogram , and blood pressure was measured using electrosphygmomanometry . Measurements of ventilatory gas exchange were made on a breath\u2010by\u2010breath basis using an infrared turbine flow meter  and mass spectrometry for rapid gas analysis via proprietary software. Breath\u2010by\u2010breath ventilatory gas exchange was verified at a steady state by the collection of expired gas in a Douglas bag for 1\u00a0min and analyzed by mass spectrometry. Steady\u2010state ventilatory volume was measured by use of a 120\u2009L Tissot spirometer . Peak V\u0307O2.5Leg blood flow was measured during rest, unloaded kicking (UL), 5, 10, and 15\u2009W with a kick rate of 40 per minute, and the seat back of the isolated knee ergometer set to 60\u00b0. Each exercise stage was 3\u00a0min in duration, and a ~5\u2010min rest period was provided between the 10 and 15\u2009W stage. Blood velocity and common femoral artery diameter were measured using Doppler ultrasonography  2\u20133\u00a0cm proximal to the bifurcation of the superficial and deep femoral arteries. Blood velocity was acquired with the sample volume centered within the vessel, optimized to span the vessel diameter without overlapping vessel walls, and set at an insonation angle of 60\u00b0. Blood velocity was determined by customized audio recording software that interfaced with the ultrasound to record forward and reverse Doppler frequencies continuously . Data normality was determined using Shapiro\u2013Wilk test.This study was powered to detect a 1.5\u2009ml/kg/min increase in peak V\u0307Op\u00a0<\u20090.05. Data are expressed in text as mean\u2009\u00b1\u00a0SD unless noted otherwise.The change in hemodynamics during the IKE protocol in control and HFpEF were compared using two\u2010way repeated measures ANOVA inclusive of group \u2009\u00d7\u2009stage . Pairwise comparisons were made within the stage using Tukey's test which corrects for multiple comparisons (Graphpad 9). Significance was set a priori at 3Subject characteristics are presented in Table\u00a03.1p\u00a0<\u20090.001) due to a blunted vasodilatory response  . After training, the blood pressure response during IKE was significantly lower across exercise intensities . Despite lower systemic blood pressure, leg blood flow was maintained or increased due to improved vasodilation   and showed no significant difference in absolute SS1 or SS2 V\u0307O2. The same submaximal workload was used for HFpEF patients pre and post IKE training. There was no consistent effect of IKE training on submaximal exercise hemodynamics in HFpEF  (Table\u00a0p\u00a0=\u00a00.001) , however, HFpEF patients had lower peak a\u2010vO2 difference  and an exaggerated rise in Q\u0307c relative to V\u0307O2  , absolute V\u0307O2  and relative V\u0307O2 . The improvement in peak functional capacity was due to a greater a\u2010vO2 difference  and was associated with a lower Q\u0307c/V\u0307O2 slope . There was no change in peak Q\u0307c after IKE training   restored the vasodilatory response to knee extension exercise, (2) increased aerobic capacity (cycle ergometry) by 13% (~1.5\u2009ml/kg/min), and (3) reduced the hyperdynamic cardiac output response to exercise. The increase in peak functional capacity was due exclusively to increased peripheral oxygen extraction with no change in peak Q\u03074.12 despite no change in indices of conduit arterial stiffness or function, which may be interpreted as a lack of vascular plasticity in HFpEF   onset of improvements in peak single\u2010leg work rate in response to IKE training observed in previous studies in HFrEF  did not fully translate to a diminished pressor response during submaximal cycling exercise (\u22123\u2009mmHg). This mirrors previous investigations showing the specificity of the heart rate and blood pressure training response to the type of exercise being performed  was lower after IKE training. Prior to IKE training HFpEF patients had an elevated Q\u0307c/V\u0307O2 slope, similar to what is observed in patients with skeletal muscle mitochondrial myopathies, where Q\u0307c increases disproportionately to metabolic demand , or some combination of these factors.IKE training also improved maximal aerobic capacity quantified as peak V\u0307O2  is in line with the magnitude observed in previous exercise interventions utilizing traditional and high\u2010intensity whole\u2010body exercise training . CMH was supported by the National Institute of Health (grant nos. F32HL137285 and K99HL153777).All data are available upon reasonable request. The authors have no competing interests. Experiments were performed at the Institute for Exercise and Environmental Medicine."}
+{"text": "Multivariable stepwise linear regression revealed significant positive correlations of age and A-FABP levels with cfPWV values. Serum A-FABP level is positively correlated with cfPWV values, and a high serum A-FABP level is associated with aortic stiffness in patients who have undergone CABG.Old age has been proven to be related to progressed arterial or aortic stiffness. Aortic stiffness is an independent predictor of all-cause and cardiovascular disease mortalities in patients who have undergone coronary artery bypass grafting (CABG) surgery. Higher serum concentrations of adipocyte fatty-acid-binding protein (A-FABP) could be considered a predictor of aortic stiffness in patients with hypertension or diabetes mellitus. This study aims to investigate the relationships between A-FABP and aortic stiffness in patients who have received CABG. A total of 84 CABG patients were enrolled in our study from September 2018 to May 2019. Serum A-FABP levels were determined using a commercial enzyme immunoassay. Carotid\u2013femoral pulse wave velocity (cfPWV) > 10 m/s was defined as aortic stiffness. Of the 84 CABG patients, 28 (33.3%) with aortic stiffness had a higher average age; exhibited higher rates of diabetes; and had higher serum creatinine, C-reactive protein, and A-FABP levels compared to controls. Multivariable logistic regression revealed that serum A-FABP levels (odds ratio (OR) = 1.068, 95% confidence interval (CI) 1.017\u20131.121,  Old age has been proven to be related to progressed arterial or aortic stiffness, which is attributed to luminal enlargement with wall thickening and a reduction in elastic properties, especially in large elastic arteries. Vascular aging is an independent risk factor for cardiovascular diseases, from atherosclerosis to target organ damage, including coronary artery disease, stroke, and heart failure .Aortic stiffness is an independent predictor of all-cause and cardiovascular disease mortalities, coronary events, and fatal stroke in patients who have undergone coronary artery bypass grafting (CABG) surgery . Recent Adipocyte fatty-acid-binding protein (A-FABP) is abundantly found in mature adipocytes, activated macrophages, and dendritic cells . It beloThis was a cross-sectional observational study, and participants were recruited from the cardiovascular surgery outpatient department in a single center of Hualien Tzu Chi Hospital, Hualien, Taiwan, between September 2018 and May 2019. A total of 84 participants with triple-vessel coronary artery disease (CAD) undergoing CABG were enrolled in our study. The group was composed of 64 males and 20 females, with ages ranging from 35 to 80 years. Of these participants, 80 received traditional CABG; the 4 remaining participants underwent off-pump CABG. This study was approved by The Research Ethics Committee, Hualien Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation (IRB107-120-A). Prior to the study, all participants provided written informed consent. Blood pressure (BP) was measured in the morning by trained staff using standard mercury sphygmomanometers with appropriate cuff sizes after sitting for at least 10 min. Systolic BP (SBP) and diastolic BP (DBP) were taken three times at 5 min intervals, and the data were averaged for analysis. Hypertension was diagnosed as SBP \u2265 140 mmHg and/or DBP \u2265 90 mmHg for patients who had received any anti-hypertensive medication in the previous two weeks. Type 2 DM was diagnosed if a patient\u2019s fasting plasma glucose \u2265 126 mg/dL or if they were using anti-diabetic therapy [g for 10 min. Serum levels of blood urea nitrogen (BUN), creatinine, fasting glucose, total cholesterol (TCH), triglycerides (TGs), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), albumin, total calcium, phosphorus, and C-reactive protein (CRP) were measured using an autoanalyzer . Serum A-FABP levels were measured using a commercially available enzyme immunoassay , and serum intact parathyroid hormone (iPTH) levels were measured by enzyme-linked immunosorbent assays  [After measuring height and body weight, body mass index (BMI) was calculated as post-HD body weight (kg) divided by height (m) squared. Approximately 5 mL blood samples of all participants were obtained after overnight fasting for about 8 h and immediately centrifuged at 3000 MA, USA) ,12,13. TR-timing reference. Pulse wave recordings were performed consecutively at two superficial artery sites . The carotid\u2013femoral distance was obtained by subtracting the distance from the carotid location to the suprasternal notch from the distance between the suprasternal and the femoral sites. Integral software was used to process each set of pulse waves and ECG data to calculate the mean time difference between R-wave and pulse wave on a beat-to-beat basis, with an average of 10 consecutive cardiac cycles. The cfPWV was calculated using the distance and mean time difference between the two recorded points. In this study, cfPWV values of > 10 m/s were defined as aortic stiffness, while values \u2264 10 m/s were regarded as the control group according to the ESH and ESC guidelines [Aortic stiffness was determined by measuring the cfPWV using a pressure applanation tonometry  as previously described ,11,12. Tidelines .t-test (two-tailed). Non-normally distributed variables are expressed as medians and interquartile ranges, and comparisons between patients were performed using the Mann\u2013Whitney U test. Categorical data were analyzed by the chi-square test, and they are presented as numbers and percentages. Variables that were significantly associated with aortic stiffness in patients undergoing CABG were tested for independence by multivariate logistic regression analysis. Due to the CABG operation duration, TG, fasting glucose, BUN, creatinine, iPTH, and A-FABP were not normally distributed; these parameters underwent logarithmic transformations with base 10 to achieve normality. Correlation between clinical variables and cfPWV values in CABG patients was evaluated using simple linear regression analysis, and variables that were significantly correlated with cfPWV values were tested for independence using multivariate forward stepwise regression analysis. A level of p < 0.05 was considered statistically significant.All statistical analyses were performed using Statistical Package for the Social Sciences (SPSS) version 19.0 . Continuous variables were tested for normal distribution by the Kolmogorov\u2013Smirnov test. Normally distributed variables are expressed as means \u00b1 standard deviation, and comparisons between patients were performed using Student\u2019s independent p < 0.001) and higher serum creatinine (p = 0.048), CRP (p = 0.034), and serum A-FABP levels (p < 0.001). Aortic stiffness did not differ statistically by sex, hypertension, or use of statin or fibrates; however, there were statistically significant differences in DM (p = 0.031) among CABG patients.The demographic, biochemical, and clinical characteristics of the 84 CABG patients with aortic stiffness or without aortic stiffness (control group) are summarized in p = 0.008) and age  were independent predictors of aortic stiffness in patients with CABG  showed that serum A-FABP level : 1.017\u20131.121, ith CABG .r = 0.300, p = 0.006), age , logarithmically transformed CRP level , and log-A-FABP level . Multivariable forward stepwise linear regression analysis of the factors significantly associated with the cfPWV values in 2 change = 0.090, p = 0.001) and log-A-FABP level .Simple linear regression analysis, presented in The results of our study reveal that DM, older age, and high serum CRP and high serum A-FABP levels were more common among patients undergoing CABG in the aortic stiffness group. Older age and serum A-FABP levels were positively correlated with cfPWV values in patients undergoing CABG. Multivariate logistic regression analysis identified age and serum A-FABP levels as independent predictors of aortic stiffness in patients undergoing CABG.Aortic stiffness is an independent predictor of cardiovascular events, and aging, inflammation, endothelial dysfunction, vascular calcification, and advanced glycation end-product accumulation are the mechanisms involved in the development of aortic stiffness ,17,18. AA-FABP plays a critical role in the development of atherosclerosis through coordinating macrophage cholesterol trafficking and inflammatory activity ,22. MiyoHowever, our study had several limitations. First, it was a retrospective, single-center study with a limited number of patients undergoing CABG. Second, the postoperative duration of monitoring A-FABP levels was not standardized. Third, the observational design of this study prevented us from drawing any conclusions about the mechanism of the observed statistical association between A-FABP and aortic stiffness. Larger studies are needed to confirm our findings.This study demonstrated that age and serum A-FABP levels were positively correlated with cfPWV values in patients undergoing CABG. Moreover, A-FABP levels and older age were independent risk factors associated with aortic stiffness in patients undergoing CABG."}
+{"text": "IRS4-null ovarian tumor cells with phosphorylation-defective mutant, but not WT IRS4 delayed ovarian tumor cell proliferation both in vitro and in vivo. Overall, we revealed a kinase-substrate mode between FER and IRS4, and the pharmacological inhibition of FER kinase may be beneficial for ovarian cancer patients with PI3K-AKT hyperactivation.Tyrosine phosphorylation, orchestrated by tyrosine kinases and phosphatases, modulates a multi-layered signaling network in a time- and space-dependent manner. Dysregulation of this post-translational modification is inevitably associated with pathological diseases. Our previous work has demonstrated that non-receptor tyrosine kinase FER is upregulated in ovarian cancer, knocking down which attenuates metastatic phenotypes. However, due to the limited number of known substrates in the ovarian cancer context, the molecular basis for its pro-proliferation activity remains enigmatic. Here, we employed mass spectrometry and biochemical approaches to identify insulin receptor substrate 4 (IRS4) as a novel substrate of FER. FER engaged its kinase domain to associate with the PH and PTB domains of IRS4. Using a proximity-based tagging system in ovarian carcinoma-derived OVCAR-5 cells, we determined that FER-mediated phosphorylation of Tyr779 enables IRS4 to recruit PIK3R2/p85\u03b2, the regulatory subunit of PI3K, and activate the PI3K-AKT pathway. Rescuing  Ovarian cancer is the most devastating gynecological malignancy, with high morbidity and ranking fifth among all cancer-related mortality in women . PatientProtein tyrosine kinases represent a family of important enzymes for controlling cell proliferation, motility, survival, and differentiation, whose dysfunction has been closely related to the etiology of many major diseases, including cancer. Depending on the cellular localization, the family can be further divided into receptor tyrosine kinase, which resides in the plasma membrane, and non-receptor tyrosine kinase, which resides in cytosol. The feline sarcoma kinase FES and feline sarcoma-related kinase FER represent a unique family of non-receptor tyrosine kinases. They are characterized by distinguishable N-terminal phospholipid binding and a membrane targeting FER/CIP4 homology/Bin1/amphiphysin/RVS (F-BAR) domain, which are reported to function in cell proliferation, motility, cell-to-cell adhesion, and mediate signal transmission from cell surfaces to the cytoskeleton . NotablyIn addition to motility, FER expression has also been associated with proliferation of tumor cells . HoweverTo identify novel substrates for tyrosine kinase FER, tyrosine phosphorylated proteins in HEK293FT cells upon wild-type (WT) and a kinase-dead mutant (K591R) of FER transfection were enriched by the anti-pTyr antibody, 4G10. We observed that significant numbers of proteins could be modified by tyrosine phosphorylation in cells expressing FER-WT compared to FER-K591R . We exciIGF1R, a key tyrosine kinase receptor in regulating cancer cell survival, proliferation, and motility  involved in the interaction between IRS4 and FER, we employed different truncation forms of IRS4 with a Myc-tag, as indicated in To further pinpoint the key region involved in binding, we employed additional truncated versions of IRS4 with a YFP-tag . WhereasEscherichia coli  to display the 3D structures and label the charged amino acids (The pleckstrin homology (PH) domain is a functional domain present in a variety of signaling and cytoskeleton-related proteins . The polno acids . As expeno acids . Interesno acids . We consno acids .The previous work with IRS1 suggests that an NPXY motif might be expected as the PTB domain binding site . FER posCombining together, our data suggest that both PH and PTB domains of IRS4 participate in the association with the kinase domain of FER .We next investigated the molecular details in the tyrosine phosphorylation of IRS4 by FER kinase. The first question we wanted to address was the specificity of regulation. To this end, we overexpressed seven non-receptor tyrosine kinases in parallel and assessed the phosphorylation extent change of IRS4 post immunoprecipitation followed by anti-phosphotyrosine blotting analysis. As shown in To address whether IRS4 is a direct FER substrate, we expressed and purified Myc-tagged human IRS4 protein in HEK293FT cells, and set up in vitro kinase (IVK) assay with purified GST-tagged human FER tyrosine kinase domain (541\u2013822aa). The tyrosine phosphorylation level of IRS4 was increased in an FER kinase dosage-dependent manner . This reTo determine which region on IRS4 can be phosphorylated by FER, we overexpressed abovementioned Myc-tagged IRS4 truncation mutants in conjunction with FER in HEK293FT cells  and evalWe took two strategies to further pinpoint the tyrosine residue(s) that undergo phosphorylation in the presence of FER. By performing mass spectrometry analysis in duplicate, we observed three tyrosine sites, namely Y656, Y828, and Y921, whose phosphorylation were repeatedly detected in both datasets . Y847 waBy combining results from both mass spectrometry analysis and site-directed mutagenesis analysis, we generated a quintuple Tyr to Phe mutant of IRS4, including Y656, Y779, Y828, Y847, and Y921 (named \u20185YF\u2019 mutant hereafter). The tyrosine phosphorylation level of 5YF mutant by FER was profoundly diminished compared to each single mutant . These rPrevious studies from our lab have demonstrated the aberrantly high expression of FER kinase in ovarian cancer and its important role in promoting tumor cell metastasis both in vitro and in vivo . In thisNext, we stably expressed ectopic IRS4 into those ovarian carcinoma-derived cell lines with no IRS4 expression, such as HEY and OVCAR-8. The effect of overexpression was confirmed via immunoblotting against an anti-IRS4 antibody . NotablyIRS4 gene in those ovarian carcinoma-derived cell lines with high IRS4 expression, such as OVCAR-5 and OVCAR-3. Regrettably, after several attempts we couldn\u2019t get a single clone of IRS4 knockout (KO) OVCAR-3 cells, since this cell line prefers to grow in clusters and it cannot re-confluence after FACS procedure. Nevertheless, we successfully obtained two OVCAR-5 IRS4 KO cell lines with two distinct sgRNAs  double staining assay indicated that loss of IRS4 has minimal effect on OVCAR-5 cell survival . Further S phase . Consist-5 cells . Ectopicer cells . Given tstrategy . Consistardation , highligIRS4-KO cells (IRS4-KD cells (We explored further and compared the difference(s) in downstream signaling pathways upon IRS4 expression alteration. Interestingly, ectopic expression of IRS4 significantly elevated the level of phospho-AKT in HEY and OVCAR-8 cells . ConsistKO cells  and OVCAKD cells , indicatKD cells  and demoTo further address the importance of PI3K-AKT signaling pathway in regulating ovarian cancer cell growth, we performed a CTG-based compound library screening assay in OVCAR-5 WT ovarian cancer cells. This compound library contains 198 small molecule inhibitors targeting key node genes in cancer cell signaling transduction and metabolism. Thirty out of 198 compounds showed proliferation inhibition greater than 75% . Among tIRS4-KO cells  system to identify potential interacting proteins of phosphorylated IRS4 . PUP-IT 2 (fold change) as the x-axis and \u2013Log10  as the y-axis. We highlighted genes with p-value less than 0.05  = 1.30) and preferential IRS4-WT binding over IRS4-YF mutant, with fold change greater than 2.30 (Log2 (fold change) = \u20131.20). Among all detected proteins, the number of unique peptides of IRS4 ranked at the top  whose function is tumor suppressive, PIK3R2 plays a role as oncogene . Interestingly, IRS4 shows the highest mRNA transcript abundance in the ovaries, followed by the thyroid gland and endometrium  dataset  and plotted the overall survival curves for both the IRS4-high and the IRS4-low cohorts. The result demonstrated that a lower expression of IRS4 was correlated to longer overall survival in patients with ovarian cancer  are cytoplasmic adaptor proteins that participate in the signal transduction process of various receptor tyrosine kinases, including as insulin receptor (IR) and insulin-like growth factor 1 receptor . The IRSCombining mass spectrometry analysis with biochemical and biological approaches, we have revealed one of the IRS family members, IRS4, as a novel substrate of non-receptor tyrosine kinase FER. FER binds directly to IRS4  and phosSHP2-KO mice, Fawaz Haj and his colleagues were able to show that SHP2 is a negative regulator of hepatic insulin action, and its deletion enhances the activation of PI3K/AKT pathway downstream of the IR  were obtained from the cell bank of CAS (Shanghai). The cell lines have been tested to be free of mycoplasma contamination by stand PCR methods. Cells were cultured in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 10% fetal bovine serum (Cellgro), 100 units/ml penicillin, and 100 \u03bcg/ml streptomycin, and maintained at 37\u00b0C in 5% COBMS-536924 (S1012) were purchased from Selleck.PI3K inhibitor LY294002 (S1105), ERK pathway inhibitor U0126 (S1102), Anti-cancer Metabolism Compound Library (L5700), TAE684 (S1108), and IGF1R inhibitor Mammalian expression plasmids used in this study were as follows: pMSCV-FER , pEGFP-FER , FPC1-Myc-IRS4 , pEYFPC1-IRS4 , pUSE-SRC, pcDNA6-HCK, pHAGE-FYN, pcDNA3.1-LCK, pLPC-BRK, pWZL-BTK, pLV-FER, pcDNA3-IGF1R, PX330-IRS4-sgRNA-Cas9-GFP, PX330-FER-sgRNA-Cas9-GFP, pLKO.1 , pGEX-3X-FER (FER truncation mutants 1\u2013446 and 447\u2013822), pCDH-IRS1-FLAG, pCDH-PIK3R1-FLAG, pCMV3-PIK3R2, and PUP-IT-related plasmids (pTet3G-Bio-PupE-IRES-BFP and IRS4-PafA-IRES-puro-GFP). By using pEGFP-FER plasmid as template, we further constructed FER truncation mutants 1\u2013446, 447\u2013822, 447\u2013550, and 563\u2013822, as well as single or multiple mutants of E676R, D684R, and E740R in the kinase domain of FER. By using pLV-FER plasmid as template, we constructed FER QPVY motif (631-634aa) deletion mutants and Y634F mutant. By using FPC1-Myc-IRS4 as template, we further constructed IRS4 PH or PTB domain deletion mutants, IRS4 truncation mutants 1\u2013200, 200\u2013400, and 1\u2013400, as well as all Y to F mutants. Primers used in the construction of related FER and IRS4 mutants were uploaded in We followed manufacture protocol of Mirus  to perform transient transfection. Briefly, cells were plated in a six-well plate 24 hr prior to transfection. When cells reached ~75% confluence, we prepared Mirus:plasmid complexes in Opti-MEM I Reduced Serum Medium (Gibco) and added them into each well. Twenty-four hours later, cells were harvested and lysed for immunoblotting or immunoprecipitation assays.Cell line with gene stable expression was established by lentiviral infection, followed by GFP sorting or puromycin selection. In brief, lentivirus was generated in HEK293FT cells by co-transfecting gene-containing plasmids, deltaR8.2, and VSVG at a ratio of 3:2:1; 48\u201372 hr later, supernatants were collected and passed through 0.45 \u03bcm filters to remove cell debris. Cleared virus was then added to cells to be infected in the presence of polybrene. Infected cells were either sorted by GFP or selected by puromycin. The effectiveness of infection was confirmed by flow cytometry or immunoblotting with according antibody.E. coli BL21 (DE3). The cells were cultured at 37\u00b0C until the OD reached 0.6\u20130.8 and were induced with 0.3 mM isopropyl \u03b2-D-thiogalactoside in LB medium at 16\u00b0C overnight. Bacteria were lysed in lysis buffer  by high-pressure homogenizer. After centrifugation, the supernatant was incubated with GST beads at 4\u00b0C for 2 hr. After washing, GST-tagged proteins were eluted with 10 mM reduced glutathione. Protein concentration was measured using the Bradford assay. Protein purity was assessed by SDS-PAGE and Coomassie blue staining.GST-tagged FER (1-446) and GST-tagged FER (447-822) were expressed in Cells were lysed in lysis buffer  at 4\u00b0C for 15 min. Total protein concentration was determined by Bradford assay.For immunoblotting, cellular proteins were harvested, separated by SDS-PAGE, and transferred onto nitrocellulose membranes. Membranes were blocked in 2.5% BSA in TBST  for 1 hr at room temperature on a shaker and incubated with primary antibody at 4\u00b0C overnight. Proteins were detected with horseradish peroxidase-conjugated secondary antibodies (Jackson Laboratory) and ECL (Pierce).For immunoprecipitation, precleared cell extracts were incubated with the indicated antibody for 4 hr at 4\u00b0C with rotation followed by 1 hr of pull-down by 1:1 protein A/G agarose beads. Immunoprecipitates were washed with lysis buffer three times before electrophoresis.Streptavidin Magnetic Beads (NEB), EZview(TM) Red anti-c-Myc affinity gel (Sigma), protein A sepharose and protein G sepharose (GE).The primary antibodies used in this study were as follows: 4G10 (Millipore); Myc (9E10); FER, GRB2, IRS1, pY1000, Vinculin, FES, phospho- and total-ERK1/2, phospho-Ser473, phospho-Thr308 and total-AKT, phosphor-Tyr1234,1235 and total MET, phosphor-Tyr1131 and total-IGF1R ; phospho-p38 (Promega); total p38, pTyr1000 and GST (Santa Cruz Biotechnology); pY402 FER (Abcam); IRS4, Actin, Tubulin and FLAG (Sigma); GAPDH ; PIK3R2 (Invitrogen); GFP (Abmart). The beads used in this assay were as follows: 2) with purified GST-tagged human FER kinase . The reaction was initiated by the addition of 10 mM ATP and then carried out at room temperature for 1 hr. 5\u00d7 SDS loading buffer was added to terminate the reaction. The samples were then analyzed by immunoblotting analysis with anti-IRS4, anti-GST, and anti-pTyr antibodies.Human IRS4 protein was expressed and purified from HEK293FT cells with Myc-beads. The IVK assay was carried out in assay buffer  was used to evaluate the role of IRS4 in ovarian cancer cell proliferation. In brief, 1.5 \u00d7 10IRS4-KO cells were plated into six-well plates. When cells reached 80\u201390% confluence, they were harvested and washed with PBS. After the addition of 195 \u00b5l binding buffer, 5 \u00b5l FITC-labeled Annexin V and 10 \u00b5l PI were added and incubated for 10\u201320 min in the dark at room temperature. Cell apoptosis was immediately measured by flow cytometry analysis .Cell apoptosis quantification was performed by Annexin V-FITC/PI Apoptosis Detection kit . In brief, OVCAR-5 parental or IRS4-KO cells were seeded in six-well plates. When cells reached 80\u201390% confluence, they were harvested and washed with PBS. Cells were fixed in 70% ethanol at 4\u00b0C overnight and washed with PBS again. After the addition of 500 \u00b5l buffer supplemented with 10 \u00b5l RNase A (50\u00d7), cells were stained with 25 \u00b5l PI (20\u00d7) for 30 min at 37\u00b0C. Cell cycle was measured by flow cytometry analysis .Cell cycle analysis was performed by cell cycle and apoptosis analysis kit . Briefly, OVCAR-5 parental or IRS4 and FER KO ovarian cancer cell lines using CRISPR-Cas9 system, the CRISPR sgRNA database (http://crispr.mit.edu/) was applied to generate sgRNAs for each gene. The selected sgRNAs were then subcloned into PX330-Cas9-GFP plasmid, followed by transient transfection into ovarian cancer cell lines and FACS for GFP-positive single clone. The KO effect was confirmed by Western blotting analysis against relevant antibodies.To generate The sgRNAs used were:IRS4 sgRNA#1: 5\u2019-CCATCGCGAAGTATTCGTCT-3\u2019,IRS4 sgRNA#2: 5\u2019-TATAGGGTGATCACGCGCCG-3\u2019,FER sgRNA#4: 5\u2019-AGAGTTTGATACTTCCTTAC-3\u2019.The plasmid pLKO.1  was used as shRNA construct backbone. Lentiviral transduction-based shRNA delivery was performed as previously described . In brieThe shRNAs used were:IRS4 shRNA: 5\u2019- CCGGGCTGGTTTCAACCTGTTGCTACTCGAGTAGCAACAGGTTGAAACCAGCTTTTTG -3\u2019The experimental procedure was modified based on previous study . To geneTo further stably express IRS4 (WT)-PafA or IRS4 (YF)-PafA in iPup OVCAR-5 cells, we subcloned IRS4-WT or IRS4-YF into the PafA-IRES-puro-EGFP plasmid, respectively, and produced lentivirus to infect iPup OVACR5 cells for 48 hr. Cells were placed under puromycin selection  for generating iPup OVCAR-5 cell lines which stably express IRS4 (WT)-PafA or IRS4 (YF)-PafA, respectively.IRS4 (WT)-PafA or IRS4 (YF)-PafA expressed iPup OVCAR-5 cells were then grown in 10 cm dishes. We added doxycycline  and biotin  to the medium in advance, and induce expression in cells for 24 hr. Then, we harvested cells, and followed the protocol in Particularly in this study, we compared the binding protein differences between IRS4 (WT) and IRS4 (YF) in OVCAR-5 cells. To obtain reliable and quantitative measurement, each group of samples was triplicated. To analyze the different proteins bound to IRS4 (WT) or IRS4 (YF) in OVCAR-5 cells, we calculated the fold change of LFQ intensity and used the t-test to calculate the p-value. Fold change >2.3 and p-value < 0.05 would be regarded as differences and statistical significance. We used GraphPad Prism to draw the relevant volcano maps.For identification of phosphorylated tyrosine residues and interacting proteins by mass spectrometry, immunoprecipitates were prepared first as described above. Samples were subjected to SDS-PAGE gel, followed by in-gel trypsin digestion. In brief, gel bands were excised, washed, and dehydrated with 100% acetonitrile. Proteins inside the gel were reduced, alkylated, and finally digested with trypsin overnight at 37\u00b0C. The mixture of peptide fragments was extracted with 50% acetonitrile and 1% trifluoroacetic acid followed by 100% acetonitrile. Peptides were vacuum-dried and re-suspended for following mass spectrometry characterization. When samples were subjected to on-beads digestion, the beads in immunoprecipitation were digested with trypsin overnight at 37\u00b0C. After cleaning, peptides were vacuum-dried and re-suspended for following mass spectrometry characterization.Mass spectrometry analysis was performed at the Proteomics Facility in Shanghaitech University. An Easy-nLC 1000 system coupled to a Q Exactive HF (both from Thermo Scientific) was used to separate and analyze peptides. The raw data were processed and searched with MaxQuant 1.5.4.1 with MS tolerance of 4.5 ppm, and MS/MS tolerance of 20 ppm. The UniProt human protein database  and database for proteomics contaminants from MaxQuant were used for database search.6 OVCAR-5 IRS4-KO cells with ectopic expression of empty vector (n = 5), IRS4-WT (n = 4), or IRS4-5YF (n = 7), respectively, were suspended in 100 \u03bcl of 1:1 mixture with DMEM and growth factor-reduced Matrigel (BD Biosciences) and subcutaneously injected into NSG mice. In the second and third subcutaneous injection models, 1 \u00d7 106 IRS4-negative cells (HEY or OVCAR-8) with ectopic expression of empty vector (n = 7) or IRS4 , respectively, were suspended in 100 \u03bcl of 1:1 mixture with DMEM and growth factor-reduced Matrigel (BD Biosciences) and subcutaneously injected into NSG mice. Subcutaneous tumor growth was monitored periodically by measuring tumor volume  with calipers.All study protocols involving mice were approved by the Institutional Animal Care and Use Committee of the ShanghaiTech University and conducted in accordance with governmental regulations of China for the care and use of animals. In the first subcutaneous injection model, 1 \u00d7 10All human ovarian normal and tumor tissues were obtained from the Nanjing Maternity and Child Health Care Hospital in compliance with guidelines for informed consent approved by the Hospital\u2019s Internal Review Board committee (NFKSL-063). Paraffin-embedded tissues were sectioned and stained with H&E or specific immunohistochemical stains. Stained slides were digitally scanned using the Aperio ScanScope software. H score was used for statistical analysis and calculated as positive staining percentage multiplied by staining strength . Both poThe GraphPad Prism (v7.00) was used to perform all statistical analyses including standard Student\u2019s t-test or two-way ANOVA multiple comparisons. The sample-size estimation, number of replicates, data presentation, and type of statistical analyses were indicated for each experiment within figure legends. Data were shown as means \u00b1 SD or SEM. The following indications of significance were used throughout the manuscript and indicated for each experiment in the figure legends: ns = no significance, **p < 0.01, ***p < 0.001, ****p < 0.0001. This study was designed to examine the role of the FER/IRS4 pathway in ovarian cancer cells. The authors show that FER causes tyrosine phosphorylation of IRS4 and recruitment of PIK3R2 that subsequently causes activation of AKT. The data presented suggest that pharmacological targeting of FER/IRS4 may be beneficial for the treatment of ovarian cancer. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Decision letter after peer review:[Editors\u2019 note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The reviewers have opted to remain anonymous.Thank you for submitting your work entitled \"FER-mediated phosphorylation and PIK3R2 recruitment on IRS4 promotes AKT activation and tumorigenesis in ovarian cancer\" for consideration by eLife.Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife to return the manuscript to the authors under these circumstances.This is an interesting study that identified IRS4 as a mediator of FER signaling. However, a number of problems with thus study were identified by the reviewers. First, the study exhibits a reliance on the use of over-expression (rather than endogenous) protein analysis; second, the conclusions presented conflict with prior published work by the senior author (MET etc) and these conflicts are not explained; and third, the relevance of the conclusions to human cancer are not fully established. The specific issues noted by the reviewers are appended to this letter. It is clear that substantial revision of your manuscript will be required. It is the policy of Reviewer #1:This is an interesting paper that demonstrates a role for IRS4 as a target of Fer signaling that leads to PIK3R2 recruitment and Akt activation that may be relevant to ovarian cancer. This pathway is demonstrated to promote the growth of human ovarian cancer cells in in vitro and in a xenograft assay.The major novelty of this study is the demonstration that this pathway is independent of Met/Gab1, which was previously implicated in Fer-stimulated AKT activation. This is a surprising finding. Otherwise, the study appears to be a relatively standard biochemical analysis with minimal attention to cancer relevance.There are some problems with the study presented that need to be addressed.a) All the biochemical studies appear to rely on over-expressed proteins. The study would be improved by showing that the reported protein interactions are detected in assays using endogenous proteins.b) What is the evidence that IRS4 is a Fer substrate? The data presented seems to be limited to a correlation between Fer over-expression and knockout with IRS4 tyrosine phosphorylation in cultured cells. Is IRS4 phosphorylated by Fer in vitro?c) Some of the details of experimental procedures are unclear. For example, three different guide RNAs are described for Fer KO cells, yet only a single line of Fer KO cells appears to be presented. Which guide RNA was used? Similarly, three different guide RNAs are described for IRS4 KO lines and cell two lines were reported. Which guide RNAs were used?d) The tumors in the xenograft study appear to be large . The authors should confirm that tumors this large are acceptable to the institutional animal care and use committee.Reviewer #2:Summary:eLife is considered premature at this time.This study examines the mechanism by which the FER non-receptor tyrosine kinase contributes to ovarian carcinoma cell growth. Mass spectrometry was used to identify targets of the FER kinase and IRS4 was identified as one of the top candidates. As reported by the authors, high IRS4 expression correlates with worse outcomes in ovarian cancer patients, which emphasizes the significance of this study. Overall the data presented are clear and support a role for IRS4 in growth regulation. However, the data are limited to primarily one cell line and over-expression studies which diminishes the impact. Moreover, the novel mechanistic information gained regarding IRS4 function is limited. For these reasons, publication in 1) IRS4 belongs to the family of insulin receptor substrate proteins that have been best characterized for mediating signaling downstream of the insulin and insulin-like growth factor-1 (IGF-1) receptors to regulate organism metabolism and growth, respectively. IGF-1R was also identified as a target of FER in the mass-spec analysis. The authors do not address if the function of IRS4 is dependent upon this FER-mediated phosphorylation of IGF-1R. In addition, the IRS4 tyrosine mutations could also interfere with IGF-1R signaling to impact tumor growth, and this should be investigated to be able to attribute the IRS4-dependent effects to FER.2) In a previous study , ovarian carcinoma cells with or without expression of FER were injected subcutaneously in mice and differences in tumor growth were not observed. However, metastasis to the lungs was decreased. In the current study, tumor growth was suppressed when IRS4 expression was knocked out. This raises concern that the growth-promoting effects of IRS4 are independent of FER. This discrepancy needs to be addressed.3) All of the co-immunoprecipitation experiments are performed using over-expressed IRS4 and FER. The ability of endogenous proteins to interact should be assessed to validate this interaction.4) In previous studies, the authors identified the MET receptor as a target of FER and showed that it plays a role in the ligand-independent activation of the receptor to promote invasion and migration. In the current study, inhibition of MET does not inhibit AKT activation indicating that these are two discreet pathways. It would be informative to determine if there is a mutually exclusive expression of IRS4 and MET in human ovarian tumors.5) Throughout the manuscript, the authors state that FER-IRS4 promotes ovarian carcinoma proliferation. However, the assays show overall growth. The decrease in total cell numbers could reflect either proliferation or survival changes. Given the important role of PI3K-AKT signaling in survival, individual assays to assess the specific mechanism that contributes to growth should be performed.6) The majority of experiments were performed using only OVCAR5 cells, with the exception that knockdown of IRS4 in OVCAR3 cells also suppressed growth. This limited use of cells raises concern about the general conclusions about IRS4 function in ovarian cancer. Inclusion of experiments using human PDX models of ovarian cancer would strengthen the clinical significance of the conclusions of the study. In addition, it would be informative to express IRS4 in other negative cell lines to determine its impact on their function.Reviewer #3:This is an interesting paper investigating the role of IRS4 as a decisive adapter protein in the growth of some ovarian cancers that links the FER tyrosine kinase to the PI3K/AKT by binding to PIK3R2. Generally, I like the paper because it combines cell-based molecular studies with the function of IRS4 to promote tumor growth; however, as I was reading the paper there were certain questions arising, which might be considered by the authors:1. Regarding the interaction of FER with IRS4. The data suggest that the N-terminal region of IRS4 is important, which implicates the PH or PTB domain, whereas mutation of FER implicated the C-terminal part of the kinase for the interaction. Although the authors have all the tools, they leave this interaction question open for discussion. IRS PTB domains usually bind NPEpY motifs, which do not exist in FER; however, they discuss the possibility that a PGEpY motif plays this role. The authors should test this possibility. Is this site phosphorylated? It is also possible that the PH domain contributes to the interaction. PH domain in IRS tend to bind to negative peptide motifs. Do such motifs exist in FER and could that contribute to the binding specificity?2. Regarding specificity, does FER interact with IRS1 or IRS2? By using HEK cells, the authors bias their analysis toward IRS4 as some clones of this line only express IRS4. Functional interactions with IRS1 and IRS2 might implicate this signaling system in metabolic or normal growth regulation. The authors should test this possibility in the assay systems. Does overexpression of IRS1 or 2 block IRS4 action? Otherwise, I am left with the feeling that FER-IRS4 is very specific---which might be the wrong impression.3. Similar concerns arise for the specific role of PIK3R2 in the mechanism of Figure 6I. I would expect that IRS4 interacts with other PI3K regulatory isoforms. Are the results biased toward PIK3R2 owing to the selection of cells that over express this protein? If IRS4 does interact with other PIK regulatory isoforms, would such interactions also promote growth? Or would expression of the other isoforms suppress the formation of the FER/IRS4/PIK3R2 complex? I suspect they have the tools for this experiment.4. What about the comparison of signaling generated by FER/IRS4 compared against IGF1R/IRS4, especially since IGF1R has been implicated in these systems previously. It seems the authors have the perfect system to investigate whether FER/IRS4 is fundamentally different than IGF1R/IRS4 at the growth regulatory level. Is IGF1R activated in the test cell system?5. Immunostaining is of concern owing to the specificity of the IRS4 antibody. The authors should show that IRS4 antibody only recognizes IRS4 and not the other isoforms to validate their experiments in Figure 7.eLife. Your revised article has been evaluated by Jonathan Cooper (Senior Editor) and a Reviewing Editor.Thank you for resubmitting your work entitled \"FER-mediated phosphorylation and PIK3R2 recruitment on IRS4 promotes AKT activation and tumorigenesis in ovarian cancer\" for further consideration by This paper investigates the mechanism of cellular proliferation through FER (feline sarcoma-related kinase). The authors demonstrate that FER directly phosphorylates IRS4 (insulin receptor substrate 4) and that this tyrosine phosphorylation is important to create a binding site for recruiting the PI3K and activate the AKT cascade to promote proliferation. This can cause increased tumor burden in mice. This is important because ovarian cancer ranks 5th among all cancer related mortality in women.The conclusion that FER / IRS4 contributes to tumor burden  is generally consistent with the major conclusion that IRS4 signaling can exacerbate ovarian cancer burden. This is important; however, the relative contribution of IRS4 verses \"the other\" pathways is loosely established/discussed, especially as risk of death from ovarian cancer is still rather fatal in patients with low IRS4. The biochemical analysis is broadly consistent with the story, but several shortcomings weaken the experimental mechanism, which require attention by the authors.Specific Points1. The analysis of the interaction between IRS4 and FER is reasonably rigorous even though it relies largely upon overexpression of the relevant proteins; however, the analysis lacks identification of the binding sites in the PTK domain of FER that interact directly with the PH and PTB domains of IRS4. (lines 170- 84). Based upon previous work with IRS1, an NPXY motif might be expected as the PTB domain binding site. By contrast, a cluster of acid residues might be expected for the PH domain (See PMID 9813005). This should be established experimentally or at least discussed.2. Line 221 suggests that there are at least five tyrosine phosphorylation sites in IRS1; however, some other tyrosine phosphorylation sites appear to exist, and this should be mentioned at line 222 . How might these sites contribute?3. While the authors argue the PI3K-AKT-mTOR signaling pathway plays a critical role in controlling the proliferation of OVCAR-5 ovarian cancer cells, they do not clarify why the cells can grow without IRS4 and reduced AKT activity. Is the residual activity important or is there another pathway? Can the other pathway operate when IRS4 is not elevated in most other ovarian tumor cells .4. Although Tyr779 enhanced the recruitment of PIK3R2 and activation of the PI3K-AKT signaling pathway, is the sequence surrounding this site expected to be recognized by the SH2 domain? This point is important because PIK3R1 can complex with both WT and Y779F mutant of IRS4 which should have a similar motif specificity. These results suggest that an intermediate might be involved. There are many possibilities in the MS/MS list. Generally, the different contributions of PIK3R1 and PIK3R2 seem confusing and ignored by the authors.5. Inclusion of pAKT levels in Figure 5H would strengthen the conclusion that Y779-dependent recruitment of PIK3R2 to IRS4 is primarily responsible for activating AKT to drive growth.6. Tyrosine phosphorylation of IRS4 and the binding of PIK3R2 decreased upon FER-ko, but it seems substantial activity remains . Moreover, IGF1R inhibition failed to implicate the IGF1R as an alternative kinase, which is a reasonable alternative; however, perhaps IGF1 should have been added to the assay.7. At line 358\u2026. TAE684 is not a specific FER inhibitor, so the conclusion of the experiment, while consistent with the story, might be wrong.8. At line 378\u2026. It is hard to determine that the FER kinase mediated tyrosine phosphorylation of IRS4 plays a key function in controlling cell proliferation in ovarian cancer because the cells still grow, although slowly. It might be important to inactivate the other pathways to cause complete inhibition of growth, and then show that FER-> IRS4 can restore (rescue) tumor growth as demonstrated decades ago with 32D cells experiments (PMID: 8798677). The in vivo tumor growth experiments do show a contribution of FER Irs4 in tumor burden. Regardless, the absence of IRS4 slows but does not prevent tumor growth, so it is important to understand the alternative pathway(s), which also lead cause substantial patient death.9. Line 442-444: The role of SHP2 in IRS1 and IRS2 has not been clearly demonstrated to attenuate PI3K signaling. Thus, whether the lack of SHP2 in IRS4 exacerbates PI3K signaling could be deleted unless an appropriate reference is cited.10. Lines 450-452: The authors should estimate of the contribution of IRS4 signaling versus other pathways for tumor survival or burden in order to establish the therapeutic benefit for disruption of the FER-IRS4 pathway. Based on Figure 7E the improvement seems significant but small, so the other pathways must be rather robust. What are they?11. Lines 454-461: Can the authors tell us which of the MS/MS verified Tyr(P) sites reside in YXXM motifs to create potential PI3K binding sites. This might be achieved from clearer writing.12. Inclusion in the Discussion of how the current study differs from the previous knockout study of FER would clarify the discrepancies in the outcomes of the two studies. The authors provide this explanation in the response to reviewers and should include it in the Discussion.13. On Page 10, line 270, LY294002 is described as an AKT inhibitor. This is incorrect, LY294002 is a PI3K inhibitor. [Editors\u2019 note: The authors appealed the original decision. What follows is the authors\u2019 response to the first round of review.]This is an interesting study that identified IRS4 as a mediator of FER signaling. However, a number of problems with thus study were identified by the reviewers. First, the study exhibits a reliance on the use of over-expression (rather than endogenous) protein analysis; second, the conclusions presented conflict with prior published work by the senior author (MET etc) and these conflicts are not explained; and third, the relevance of the conclusions to human cancer are not fully established. The specific issues noted by the reviewers are appended to this letter. It is clear that substantial revision of your manuscript will be required. It is the policy of eLife to return the manuscript to the authors under these circumstances.Reviewer #1:This is an interesting paper that demonstrates a role for IRS4 as a target of Fer signaling that leads to PIK3R2 recruitment and Akt activation that may be relevant to ovarian cancer. This pathway is demonstrated to promote the growth of human ovarian cancer cells in in vitro and in a xenograft assay.The major novelty of this study is the demonstration that this pathway is independent of Met/Gab1, which was previously implicated in Fer-stimulated AKT activation. This is a surprising finding. Otherwise, the study appears to be a relatively standard biochemical analysis with minimal attention to cancer relevance.There are some problems with the study presented that need to be addressed.a) All the biochemical studies appear to rely on over-expressed proteins. The study would be improved by showing that the reported protein interactions are detected in assays using endogenous proteins.We thank the reviewer to point out this issue. To address this, we performed endogenous co-immunoprecipitation assay in OVCAR5 cell line, which has aberrantly high expression of both FER kinase (Ref 16) and IRS4 . Compared to anti-IgG control, the OVCAR5 cell lysates with anti-IRS4 or anti-FER antibody showed the interaction between FER and IRS4 at endogenous level .Meanwhile, we also performed co-immunoprecipitation assay in single clone-derived IRS4 knockout or FER knockout OVCAR5 cell lines, and observed endogenous binding between FER and IRS4 in parental OVCAR5 cells as well .These results demonstrate the physical interaction between FER and IRS4 at endogenous level in OVCAR5 ovarian cancer cells.b) What is the evidence that IRS4 is a Fer substrate? The data presented seems to be limited to a correlation between Fer over-expression and knockout with IRS4 tyrosine phosphorylation in cultured cells. Is IRS4 phosphorylated by Fer in vitro?Kinase (IVK) assay with purified GST-tagged human FER kinase . The tyrosine phosphorylation level of IRS4 was increased in a FER kinase dosage-dependent manner . This result demonstrates that IRS4 can be phosphorylated by FER in vitro and is a bona fide FER substrate.We thank the reviewer for this suggestion. To address this issue, we expressed and purified Myc-tagged human IRS4 protein in HEK293FT cells, and used this as potential substrate to perform in vitro c) Some of the details of experimental procedures are unclear. For example, three different guide RNAs are described for Fer KO cells, yet only a single line of Fer KO cells appears to be presented. Which guide RNA was used? Similarly, three different guide RNAs are described for IRS4 KO lines and cell two lines were reported. Which guide RNAs were used?We thank the reviewer to point out this confusion. We have clarified this missing information in our revised manuscript. For constructing FER KO cell line, guide RNA sgRNA#4 (5\u2019-AGAGTTTGATACTTCCTTAC-3\u2019) was used. For constructing IRS4 KO cell lines, guide RNAs sgRNA#1 (5\u2019-CCATCGCGAAGTATTCGTCT-3\u2019) and sgRNA#2 (5\u2019-TATAGGGTGATCACGCGCCG-3\u2019) were used (line 535-536).d) The tumors in the xenograft study appear to be large . The authors should confirm that tumors this large are acceptable to the institutional animal care and use committee.3.We thank the reviewer to point out this issue. We have confirmed with the institutional animal care and use committee in ShanghaiTech University. The tumor volume standard here is also less than 2,000 mm3. Therefore, we decided to acquire another data point three days later. However, at Day33, tumor volume of 3 mice from IRS4 WT rescue group exceeded 2,000 mm3. We euthanized all the mice right away.In our revised manuscript, we will illustrate tumor volume data till Day30, as shown in Figure 6H, line 382-392.Reviewer #2:Summary:This study examines the mechanism by which the FER non-receptor tyrosine kinase contributes to ovarian carcinoma cell growth. Mass spectrometry was used to identify targets of the FER kinase and IRS4 was identified as one of the top candidates. As reported by the authors, high IRS4 expression correlates with worse outcomes in ovarian cancer patients, which emphasizes the significance of this study. Overall the data presented are clear and support a role for IRS4 in growth regulation. However, the data are limited to primarily one cell line and over-expression studies which diminishes the impact. Moreover, the novel mechanistic information gained regarding IRS4 function is limited. For these reasons, publication in eLife is considered premature at this time.1) IRS4 belongs to the family of insulin receptor substrate proteins that have been best characterized for mediating signaling downstream of the insulin and insulin-like growth factor-1 (IGF-1) receptors to regulate organism metabolism and growth, respectively. IGF-1R was also identified as a target of FER in the mass-spec analysis. The authors do not address if the function of IRS4 is dependent upon this FER-mediated phosphorylation of IGF-1R. In addition, the IRS4 tyrosine mutations could also interfere with IGF-1R signaling to impact tumor growth, and this should be investigated to be able to attribute the IRS4-dependent effects to FER.We thank the reviewer to point out this issue. To address if the function of IRS4 is dependent upon FER-mediated phosphorylation of IGF-1R, we applied IGF-1R inhibitor BMS-536924 (S1012) to inhibit IGF-1R activity in OVCAR5 cell line. The efficiency of BMS-536924 was pretty good, as demonstrated by decreased levels of pY1131 IGF-1R. However, pharmacological inhibition of IGF-1R didn\u2019t decrease tyrosine phosphorylation of IRS4 or recruitment of PIK3R2 in OVCAR5 cells . In contrast, knockout of FER or treatment with FER inhibitor TAE684 (S1108) in OVCAR5 cells inhibited the phosphorylation of IRS4, as well as the recruitment of PIK3R2 .These results suggest that the phosphorylation and activation of IRS4 has the IGF1R-independent pathway which mediated by kinase FER.2) In a previous study , ovarian carcinoma cells with or without expression of FER were injected subcutaneously in mice and differences in tumor growth were not observed. However, metastasis to the lungs was decreased. In the current study, tumor growth was suppressed when IRS4 expression was knocked out. This raises concern that the growth-promoting effects of IRS4 are independent of FER. This discrepancy needs to be addressed.We thank the reviewer to point out this issue. In this current manuscript, we have provided both in vitro  and cell-based  biochemical assays to demonstrate the kinase-substrate regulatory mode between FER and IRS4. Further loss-of-function assay also suggest that FER-mediated tyrosine phosphorylation of IRS4 is important for PIK3R2 recruitment  and downstream AKT pathway activation , which is important for ovarian cancer cell proliferation ., the majority of in vivo assays was done with CAOV4 cells, which has no IRS4 expression at all. In this current manuscript, two cell lines we used in our phenotypic assays, OVCAR5 and OVCAR3, have high IRS4 expression. We think this key difference could explain the different functional output of FER in both experimental context: In the absence of IRS4, FER regulates ovarian cancer cell motility and invasiveness mainly through MET-GAB1-SHP2-ERK1/2 signaling pathway, with MET and GAB1 as its substrates; in IRS4-positive ovarian cancer cells, FER-mediated phosphorylation of Tyr779 enables IRS4 to recruit PIK3R2/p85\u03b2, the regulatory subunit of PI3K, and activate the PI3K-AKT pathway for proliferation (line 431-440).There is one determining factor should be taken into consideration for solving abovementioned discrepancy. In the previous paper 3) All of the co-immunoprecipitation experiments are performed using over-expressed IRS4 and FER. The ability of endogenous proteins to interact should be assessed to validate this interaction.We thank the reviewer to point out this issue. To address this, we performed endogenous co-immunoprecipitation assay in OVCAR5 cell line, which has aberrantly high expression of both FER kinase (Ref 16) and IRS4 . Compared to anti-IgG control, the OVCAR5 cell lysates with anti-IRS4 or anti-FER antibody showed the interaction between FER and IRS4 at endogenous level .Meanwhile, we also performed co-immunoprecipitation assay in single clone-derived IRS4 knockout or FER knockout OVCAR5 cell lines, and observed endogenous binding between FER and IRS4 in parental OVCAR5 cells as well .These results demonstrate the physical interaction between FER and IRS4 at endogenous level in OVCAR5 ovarian cancer cells.4) In previous studies, the authors identified the MET receptor as a target of FER and showed that it plays a role in the ligand-independent activation of the receptor to promote invasion and migration. In the current study, inhibition of MET does not inhibit AKT activation indicating that these are two discreet pathways. It would be informative to determine if there is a mutually exclusive expression of IRS4 and MET in human ovarian tumors.We thank the reviewer for this suggestion. To determine if there is a mutually exclusive expression of IRS4 and MET in human ovarian tumors, we performed (1) IHC analysis for both IRS4 and MET in ovarian tumor tissue samples; (2) TCGA RNA seq data analysis. We couldn\u2019t get significant P-value from either analysis. However, we did observe slight anti-correlation trend, as shown in 5) Throughout the manuscript, the authors state that FER-IRS4 promotes ovarian carcinoma proliferation. However, the assays show overall growth. The decrease in total cell numbers could reflect either proliferation or survival changes. Given the important role of PI3K-AKT signaling in survival, individual assays to assess the specific mechanism that contributes to growth should be performed.We thank the reviewer for this great suggestion. To address this issue, we first performed Annexin V-FITC and Propidium Iodide (PI) double staining assay in both WT and IRS4 KO cell lines. Results indicated that loss of IRS4 has minimal impact on ovarian cancer cell survival .We further performed cell cycle analysis in both WT and IRS4 KO cell lines with Propidium Iodide (PI) staining. Results indicated that loss of IRS4 significantly decreased the proportion of cells within S phase .Combining together, these results highly suggest that FER-IRS4 promotes ovarian carcinoma proliferation rather than survival.6) The majority of experiments were performed using only OVCAR5 cells, with the exception that knockdown of IRS4 in OVCAR3 cells also suppressed growth. This limited use of cells raises concern about the general conclusions about IRS4 function in ovarian cancer. Inclusion of experiments using human PDX models of ovarian cancer would strengthen the clinical significance of the conclusions of the study. In addition, it would be informative to express IRS4 in other negative cell lines to determine its impact on their function.We thank the reviewer for this great suggestion. To address this issue, we stably expressed IRS4 into two negative cell lines (HEY and OVCAR8) to further determine its impact on ovarian carcinoma proliferation. Our results suggested that stably expressed IRS4: (1) elevated AKT kinase activation ; (2) increased ovarian cancer cell proliferation in vitro ; (3) accelerated tumor growth in vivo .To be honest, human PDX model is challenging for our signaling transduction research-orientated lab. Hopefully the reviewer will be satisfied with the data we provide in two IRS4-negative cell lines.Reviewer #3:This is an interesting paper investigating the role of IRS4 as a decisive adapter protein in the growth of some ovarian cancers that links the FER tyrosine kinase to the PI3K/AKT by binding to PIK3R2. Generally, I like the paper because it combines cell-based molecular studies with the function of IRS4 to promote tumor growth; however, as I was reading the paper there were certain questions arising, which might be considered by the authors:1. Regarding the interaction of FER with IRS4. The data suggest that the N-terminal region of IRS4 is important, which implicates the PH or PTB domain, whereas mutation of FER implicated the C-terminal part of the kinase for the interaction. Although the authors have all the tools, they leave this interaction question open for discussion. IRS PTB domains usually bind NPEpY motifs, which do not exist in FER; however, they discuss the possibility that a PGEpY motif plays this role. The authors should test this possibility. Is this site phosphorylated? It is also possible that the PH domain contributes to the interaction. PH domain in IRS tend to bind to negative peptide motifs. Do such motifs exist in FER and could that contribute to the binding specificity?We thank the reviewer to give this great suggestion. In our previous manuscript, whereas the 335-400 and 401-1257 mutants demonstrated no binding affinity with FER, the 200-400 mutant maintained weak but substantial interaction with FER . The N-terminal mutant 1-334 showed strongest binding among all these truncated constructs . Compared to the 200-400 mutant, which only covers PTB domain, the N-terminal 1-334aa of IRS4 contains both PH and PTB domains. To solve this issue, we constructed the 1-400 (both PH and PTB domains), 1-200 (PH domain only) and 200-400 (PTB domain only) mutants of IRS4 to further narrow down the binding region on IRS4. However, all three mutants showed as strong binding affinity with FER as WT IRS4, suggesting both PH and PTB domains were involved . Meanwhile, we also constructed Myc-IRS4\u0394PH and IRS4\u0394PTB mutants to further dissect their individual roles in association with FER. Interestingly, deletion of PH or PTB domain has minimal effect on binding affinity with FER , suggesting disrupt either of these domains is not sufficient to collapse the protein complex. Together, these results indicated that both PH and PTB domains of IRS4 are participated in the association with the kinase FER.IRS4 PTB domains usually bind NPEpY motifs, which do not exist in FER; however, there is one PGEpY motif within FER protein sequence. We either mutated key tyrosine residue (Y492F) or deleted this motif completely (\u0394489-492), and compared IRS4-binding affinity of these mutants with wt FER. However, compared to FER WT, these FER mutants showed equivalent binding affinity with IRS4, as shown in Meanwhile, we constructed GFP-FER 447-822 (SH2+kinase domains), GFP-FER 447-550 (SH2 domain) and GFP-FER 563-822 (kinase domain) truncation mutants to further narrow down the binding region on FER kinase. Notably, FER kinase domain, but not SH2 domain, is involved in the interaction with IRS4 . Furthermore, FER kinase domain, but not SH2 domain, shows strong interaction with either PH domain (1-200aa) or PTB domain (200-400aa) of IRS4 . Together, these results indicated that both PH and PTB domains of IRS4 are participated in the association with the kinase domain of FER.To further narrow down the binding region on FER kinase domain, we have made the following predictions and verifications. The PH domain is a functional domain present in a variety of signaling and cytoskeleton-related proteins. The polarity of the PH domain suggests that the ligand may be negatively charged. In our previous conclusion, both PH and PTB domains of IRS4 are participated in the association with the kinase domain of FER. Then we planned to analyze the charge distribution on the surface of FER kinase domain.https://www.alphafold.ebi.ac.uk/). To analyze the charge distribution on the protein surface, UCSF Chimera v1.14 (https://www.cgl.ucsf.edu/chimera/) was used to display the 3D structures and label the charged amino acids. Figures were generated using UCSF Chimera v 1.14.The crystal structure of the target protein was obtained from the AlphaFold Protein Structure Database  mutants in the overexpressed system, respectively, to verify whether the mutations of negative amino acids in the FER kinase domain would affect their binding with IRS4. The results suggested that the single or multiple mutations of negative amino acids in the FER kinase domain failed to disrupt their interaction with WT IRS4 or 1-200 (PH) mutants of IRS4.Combining together, these results highly suggest both PH and PTB domains of IRS4 are participated in the association with the kinase domain of FER .2. Regarding specificity, does FER interact with IRS1 or IRS2? By using HEK cells, the authors bias their analysis toward IRS4 as some clones of this line only express IRS4. Functional interactions with IRS1 and IRS2 might implicate this signaling system in metabolic or normal growth regulation. The authors should test this possibility in the assay systems. Does overexpression of IRS1 or 2 block IRS4 action? Otherwise, I am left with the feeling that FER-IRS4 is very specific---which might be the wrong impression.We thank the reviewer to give this great suggestion. Actually, Masanori Iwanishi and his colleagues have showed interaction between IRS1 and FER at endogenous level in 3T3-L1 adipocytes . We also performed endogenous co-immunoprecipitation assay in OVCAR5 cell line. Compared to anti-IgG control, the OVCAR5 cell lysates with anti-FER antibody showed the interaction between FER and IRS1 at endogenous level .Then we constructed IRS1 and IRS4 plasmids, and expressed these constructs alone or in combination, as indicated, in HEK293 cells. We confirmed strong binding between IRS4 and FER. Notably, the binding affinity was not affected in the absence and/or presence of IRS1 .3. Similar concerns arise for the specific role of PIK3R2 in the mechanism of Figure 6I. I would expect that IRS4 interacts with other PI3K regulatory isoforms. Are the results biased toward PIK3R2 owing to the selection of cells that over express this protein? If IRS4 does interact with other PIK regulatory isoforms, would such interactions also promote growth? Or would expression of the other isoforms suppress the formation of the FER/IRS4/PIK3R2 complex? I suspect they have the tools for this experiment.We thank the reviewer to give this great suggestion. We first constructed PIK3R1 and PIK3R2 plasmids, and expressed these constructs alone or in combination, as indicated, in HEK293 cells. We confirmed interaction between IRS4 and PIK3R2. Notably, the binding affinity was not affected in the absence and/or presence of PIK3R1 . These data suggest that expression of the other isoforms of PI3K wouldn\u2019t suppress the formation of the IRS4-PIK3R2 complex.In our original manuscript, we showed that phoshphorylation of Tyr779 on IRS4 is important for PIK3R2 recruitment (figure 5B-5H). Next, we want to test whether IRS4 could recruit PIK3R1 through same mechanism. Interestingly, our data indicated that PIK3R1 could form complex with both WT and Y779F mutant of IRS4 with equivalent binding affinity . Therefore, both PIK3R1 and PIK3R2 can be recruited to IRS4, but with distinctive binding mechanism.Notably, PIK3R1/p85\u03b1 has a tumor-suppressor function, whereas PIK3R2/p85\u03b2 is an oncogene. Expression of\u00a0PIK3R2, encoding the p85\u03b2 regulatory subunit of PI3K, increases with advanced tumor stage in melanoma, breast, and squamous cell lung carcinoma. Its overexpression induces metastasis in mouse models, whereas preclinical deletion of\u00a0PIK3R2\u00a0triggers tumor regression and reduces invasion. Therefore, the abovementioned difference in binding mechanism with IRS4 may shed some light to decipher their opposite roles in tumorigenesis.4. What about the comparison of signaling generated by FER/IRS4 compared against IGF1R/IRS4, especially since IGF1R has been implicated in these systems previously. It seems the authors have the perfect system to investigate whether FER/IRS4 is fundamentally different than IGF1R/IRS4 at the growth regulatory level. Is IGF1R activated in the test cell system?We thank the reviewer to point out this issue. To address if the function of IRS4 is dependent upon FER-mediated phosphorylation of IGF-1R, we applied IGF-1R inhibitor BMS-536924 (S1012) to inhibit IGF-1R activity in OVCAR5 cell line. The efficiency of BMS-536924 was pretty good, as demonstrated by decreased levels of pY1131 IGF-1R. However, pharmacological inhibition of IGF-1R didn\u2019t decrease tyrosine phosphorylation of IRS4 or recruitment of PIK3R2 in OVCAR5 cells . In contrast, knockout of FER or treatment with FER inhibitor TAE684 (S1108) in OVCAR5 cells inhibited the phosphorylation of IRS4, as well as the recruitment of PIK3R2 .These results suggest that the phosphorylation and activation of IRS4 has the IGF1R-independent pathway which mediated by kinase FER.5. Immunostaining is of concern owing to the specificity of the IRS4 antibody. The authors should show that IRS4 antibody only recognizes IRS4 and not the other isoforms to validate their experiments in Figure 7.We thank the reviewer to point out this issue. In this current manuscript, we have adopted a xenograft mouse model with subcutaneous injection of OVCAR-5 IRS4-KO cells which was rescued with either an empty vector, or WT IRS4. Compared to mice injected with OVCAR-5 IRS4-KO cells rescued with WT IRS4, we observed significantly delayed tumor formation in mice injected with OVCAR-5 IRS4-KO cells with an empty vector .Most importantly, we collected 2 xenograft tumor sample derived from OVCAR-5 IRS4-KO cells rescued with an empty vector or WT IRS4, respectively, to further explore the specificity of IRS4 antibody by immunohistochemistry staining. The results showed that IRS4 antibody was quite specific for IRS4, since no signal was observed in xenograft tumor sample derived from IRS4-KO OVCAR5 cells rescued with an empty vector .In addition, we constructed FER, IRS4 and IRS1 plasmids, and expressed them in HEK293 cells. We then tested whether or not IRS4 antibody can only detect IRS4 protein. The result suggests that IRS4 antibody used in this manuscript is specific and couldn\u2019t recognize other IRS isoforms.Finally, we used ENDscript website (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi) to perform sequence alignments among IRS4, IRS1 and IRS2, as shown in [Editors\u2019 note: what follows is the authors\u2019 response to the second round of review.]This paper investigates the mechanism of cellular proliferation through FER (feline sarcoma-related kinase). The authors demonstrate that FER directly phosphorylates IRS4 (insulin receptor substrate 4) and that this tyrosine phosphorylation is important to create a binding site for recruiting the PI3K and activate the AKT cascade to promote proliferation. This can cause increased tumor burden in mice. This is important because ovarian cancer ranks 5th among all cancer related mortality in women.The conclusion that FER / IRS4 contributes to tumor burden  is generally consistent with the major conclusion that IRS4 signaling can exacerbate ovarian cancer burden. This is important; however, the relative contribution of IRS4 verses \"the other\" pathways is loosely established/discussed, especially as risk of death from ovarian cancer is still rather fatal in patients with low IRS4. The biochemical analysis is broadly consistent with the story, but several shortcomings weaken the experimental mechanism, which require attention by the authors.Specific Points1. The analysis of the interaction between IRS4 and FER is reasonably rigorous even though it relies largely upon overexpression of the relevant proteins; however, the analysis lacks identification of the binding sites in the PTK domain of FER that interact directly with the PH and PTB domains of IRS4. (lines 170- 84). Based upon previous work with IRS1, an NPXY motif might be expected as the PTB domain binding site. By contrast, a cluster of acid residues might be expected for the PH domain (See PMID 9813005). This should be established experimentally or at least discussed.We thank the reviewer for this great suggestion. The pleckstrin homology (PH) domain is a functional domain present in a variety of signaling and cytoskeleton-related proteins. The polarity of the PH domain suggests that the ligand may be negatively charged. In our previous conclusion, the PH domain of IRS4 also participates in the association with the kinase domain of FER. Then we planned to analyze the charge distribution on the surface of FER kinase domain.First, we obtain the crystal structure of the target protein from the AlphaFold Protein Structure Database . Then, we used UCSF Chimera v1.14 (https://www.cgl.ucsf.edu/chimera/) to display the 3D structures and label the charged amino acids. Figures were generated using UCSF Chimera v 1.14.As expected, the surface of the PH domain in IRS4 is mainly distributed with positive charges. Interestingly, there is a negative charge distribution on the surface of FER kinase domain, where E676, D684 and E740 are key amino acid residues. We constructed single or multiple mutants of these key amino acids of FER, and detected their interaction with IRS4 full-length or 1-200 (PH) mutants, respectively, to verify whether the mutations of negative amino acids in the FER kinase domain would affect their binding with IRS4. The results suggested that the single or multiple mutations of negative amino acids in the FER kinase domain failed to disrupt their interaction with WT IRS4 or 1-200 (PH) mutants of IRS4. These new data have been integrated as new Figure 2 \u2014figure supplement 3A-E, the Results section lines 181-206, The phosphotyrosine binding (PTB) domain recognizes phosphotyrosine-containing motifs for protein-protein interaction. Based upon previous work with IRS1, an NPXY motif might be expected as the PTB domain binding site (PMID: 7499194). However, FER possesses no NPXY motif but a QPVY motif within its kinase domain. To test the necessity of this motif in binding with IRS4, we took two strategies by either mutating the key tyrosine residue (Y634F) or deleting this motif (\u0394631-634) completely. However, compared to FER wt, these FER mutants showed an equivalent binding affinity with IRS4, as shown in new Figure 2 \u2014figure supplement 3F.Combining together, our current data suggest that both PH and PTB domains of IRS4 participate in the association with the kinase domain of FER .2. Line 221 suggests that there are at least five tyrosine phosphorylation sites in IRS1; however, some other tyrosine phosphorylation sites appear to exist, and this should be mentioned at line 222 . How might these sites contribute?We thank the reviewer for this great suggestion. In our revised manuscript, we have mentioned that some other tyrosine phosphorylation sites may still exist.To determine which region on IRS4 can be phosphorylated by FER, we overexpressed several Myc-tagged IRS4 truncation mutants in conjunction with FER in HEK293FT cells and demonstrated tyrosine residues between 700 and 1093 amino acids of IRS4 were potential substrate(s) for FER kinase. However, it also should not be ignored that the 1-550aa truncation mutant of IRS4 also possessed weak but detectable phosphorylation signals in the presence of FER kinase. As shown in 3. While the authors argue the PI3K-AKT-mTOR signaling pathway plays a critical role in controlling the proliferation of OVCAR-5 ovarian cancer cells, they do not clarify why the cells can grow without IRS4 and reduced AKT activity. Is the residual activity important or is there another pathway? Can the other pathway operate when IRS4 is not elevated in most other ovarian tumor cells .We thank the reviewer for pointing out this issue. By using RNA interference technology (RNAi), Eva Cuevas and her colleagues have shown that IRS-4 plays an important role in HepG2 proliferation/differentiation and exerts its actions through ERK and p70S6K activation in a Ras/Raf/MEK1/2- and PI3Kinase/AKT-independent manner and in a PKC-dependent way (J Hepatol. 2007 PMID: 17408801).Interestingly in our study, whereas there was a dramatic decrease of phospho-AKT signal upon IRS4 deletion, we also observed evident elevation in phospho-ERK level in O5 IRS4-KO cells , indicating a compensatory effect of ERK signaling pathway which may contribute to the survival and proliferative capacities of OVCAR-5 cancer cells.To test this hypothesis, we treated O5 WT cells with PI3K inhibitor LY294002 along with ERK inhibitor U0126, followed by CTG assay . The inhibition of both PI3K-AKT pathway and ERK pathway in O5 cells almost blocked cell growth completely. Therefore, in the absence of IRS4-mediated PI3K-AKT activation, OVCAR-5 ovarian cancer cells would upregulate ERK activity in a compensating manner, thereby enhancing survival and proliferative capacities. Our results highly suggested that targeting both PI3K-AKT and ERK pathways simultaneously will be an effective strategy to treat ovarian cancer. This new data has been integrated into the Results section lines 312-321.4. Although Tyr779 enhanced the recruitment of PIK3R2 and activation of the PI3K-AKT signaling pathway, is the sequence surrounding this site expected to be recognized by the SH2 domain? This point is important because PIK3R1 can complex with both WT and Y779F mutant of IRS4 which should have a similar motif specificity. These results suggest that an intermediate might be involved. There are many possibilities in the MS/MS list. Generally, the different contributions of PIK3R1 and PIK3R2 seem confusing and ignored by the authors.We thank the reviewer for pointing out this issue. There are 7 YXXM motifs on IRS4, which have been speculated as potential binding sites for the regulatory subunit of PI3K, including PIK3R1 and PIK3R2. Our results from mass spectrometry and site-directed mutagenesis analysis revealed 5 major tyrosine residues phosphorylated by FER kinase: Tyr-656, -779, -828, -847 and -921. Among them, Tyr-779, -828 and -921 reside in YXXM motifs to create potential PI3K binding sites.Therefore, the answer is \u201cYes\u201d that the sequence surrounding Tyr779 site is expected to be recognized by the SH2 domain of PI3K. Given the different outcomes of phos-Tyr779 in recruiting PIK3R2 and PIK3R1 onto IRS4, it is possible that an intermediate might be involved in differentiating the binding mechanisms of these two regulatory subunits of PI3K, as suggested by the reviewer. We will further digest the MS/MS list and test this hypothesis. What is also possible is that PIK3R1 and PIK3R2 may rely on different YXXM motifs for docking onto IRS4 and subsequent downstream signaling regulation. In this current study, we identified Tyr779 of IRS4 subjected to FER kinase-mediated phosphorylation. Furthermore, using a proximity-based tagging system, we determined that FER-mediated phosphorylation of Tyr779 enables IRS4 to recruit PIK3R2/p85\u03b2, the regulatory subunit of PI3K, and activate the PI3K-AKT pathway. The abovementioned two hypotheses definitely deserve more investigation as the continuous study of this project in the lab.5. Inclusion of pAKT levels in Figure 5H would strengthen the conclusion that Y779-dependent recruitment of PIK3R2 to IRS4 is primarily responsible for activating AKT to drive growth.We thank the reviewer for this great suggestion. In our revised manuscript, we have included pAKT levels in new Figure 5H.6. Tyrosine phosphorylation of IRS4 and the binding of PIK3R2 decreased upon FER-ko, but it seems substantial activity remains . Moreover, IGF1R inhibition failed to implicate the IGF1R as an alternative kinase, which is a reasonable alternative; however, perhaps IGF1 should have been added to the assay.We thank the reviewer for this great suggestion. In our manuscript, CRISPR-Cas9 mediated FER knockout in OVCAR-5 ovarian cancer cells or pharmacological inhibition of FER with TAE684 decreased tyrosine phosphorylation of IRS4 . IGF1R indeed phosphorylated IRS4 in the presence of ligand IGF1 . However, small molecular IGF-1R inhibitor BMS-536924 didn\u2019t decrease tyrosine phosphorylation of IRS4 in the absence of IGF1 , indicating FER-mediated phosphorylation and activation of IRS4 in an IGF1-independent manner. Moreover, IGF-1R phosphorylated IRS4 probably in a Tyr779-independent manner, since mutating Tyrosine 779 to Phenylalanine didn\u2019t decrease phosphorylation level of IRS4 mediated by IGF1R receptor tyrosine kinase . These new data have been integrated into the Results section lines 389-396.7. At line 358\u2026. TAE684 is not a specific FER inhibitor, so the conclusion of the experiment, while consistent with the story, might be wrong.We thank the reviewer for pointing out this issue. Due to the long-term lack of necessary attention of the importance of FER protein kinase, currently we not only know little about the activation mechanism and substrate of FER, but also the research and development of FER-specific inhibitors lags far behind other kinase proteins. Fortunately, Sabine Hellwig and his colleagues have identified TAE684 as a small molecule compound against FES tyrosine kinase (Cell Chem Bio. 2012 PMID: 22520759). Given that FES and FER kinase proteins belong to the same sub-family of non-receptor tyrosine kinases, we started to test whether TAE684 could be used as a small molecule kinase inhibitor against FER.50 reaching 8.8 nM .First, we measured FER kinase activity inhibition by TAE684. We overexpressed FER in HEK293FT cells, followed by TAE684 treatment. We used Tyr402 auto-phosphorylation signal as a readout for measurement of FER kinase inhibition. Results have shown that TAE684 can robustly inhibit the auto-phosphorylation of FER at Tyr402, with ICSecond, we collected ovarian cancer cell lysates from OVCAR-5, OVCAR-3, OVCAR-8, and HEY, as well as myeloid leukemia cell lysates from HL-60 (as positive control) to check the expression of FES kinase. The results clearly demonstrated that there is no FES expression in ovarian cancer cell lines used in this study .Third, along with RNAi analysis, Yiyan Zheng and his colleague have successfully used TAE684 as a small molecule kinase inhibitor against FER to further investigate the kinase function in cytoskeletal remodeling and potential ovarian cancer treatment . Similar to that study, we also performed both genetic and pharmacological research side-by-side to rule out potential off-target effect(s) of the kinase inhibitor. These new data have been integrated into the Results section lines 400-406.8. At line 378\u2026. It is hard to determine that the FER kinase mediated tyrosine phosphorylation of IRS4 plays a key function in controlling cell proliferation in ovarian cancer because the cells still grow, although slowly. It might be important to inactivate the other pathways to cause complete inhibition of growth, and then show that FER-> IRS4 can restore (rescue) tumor growth as demonstrated decades ago with 32D cells experiments (PMID: 8798677). The in vivo tumor growth experiments do show a contribution of FER Irs4 in tumor burden. Regardless, the absence of IRS4 slows but does not prevent tumor growth, so it is important to understand the alternative pathway(s), which also lead cause substantial patient death.We thank the reviewer for pointing out this issue. We have read through the reference recommended by the reviewer, and carefully planned another in vitro cell proliferation rescue experiment.In question 3, we found that in the absence of IRS4-mediated PI3K-AKT activation, OVCAR-5 ovarian cancer cells would upregulate ERK activity in a compensating manner, thereby enhancing survival and proliferative capacities. Pharmacological inhibition of both PI3K-AKT pathway and ERK pathway in OVCAR-5 cells almost blocked cell growth completely. Therefore, ERK pathway is the alternative pathway we are looking for.For this question, we first treated IRS4 knockout OVCAR-5 cells with ERK pathway inhibitor U0126, and observed profound inhibition in cell growth. Most importantly, re-expression of WT IRS4 in IRS4-KO cells exposed to U0126 treatment recovered the growth capacity to the same level as U0126 treatment alone, whereas 5YF mutant of IRS4 failed to rescue cell proliferation . This rescue experiment suggested that tyrosine phosphorylation of IRS4, executed by FER kinase and alternatively IGF-1R in the presence of ligand IGF-1, plays a significant role in controlling cell proliferation in ovarian cancer. Simultaneously targeting both PI3K-AKT and ERK pathways will be an effective strategy to treat ovarian cancer. This new data has been integrated into the Results section lines 423-428.9. Line 442-444: The role of SHP2 in IRS1 and IRS2 has not been clearly demonstrated to attenuate PI3K signaling. Thus, whether the lack of SHP2 in IRS4 exacerbates PI3K signaling could be deleted unless an appropriate reference is cited.We thank the reviewer for pointing out this issue and feel sorry for any unclarity in the original manuscript.In order to investigate the function of the two SHP2 binding COOH-terminal tyrosines of IRS1, Morris White and his colleagues replaced them with phenylalanine. This mutant form of IRS1 failed to bind SHP2, and exhibited increased tyrosine phosphorylation, phosphatidylinositol 3\u2032-kinase binding and activation of protein synthesis in response to insulin. These results clearly suggest that SHP2 attenuates the phosphorylation and downstream signal transmission of IRS1 and that the interaction of IRS1 and SHP2 is an important regulatory event which attenuates insulin metabolic responses .By using liver-specific SHP2 KO mice, Fawaz Haj and his colleagues were able to show that SHP2 is a negative regulator of hepatic insulin action, and its deletion enhances the activation of PI3K/AKT pathway downstream of the insulin receptor .However, no significant association was detected between IRS4 and SHP2 . John Hilkens and his colleagues have demonstrated that IRS4 expression in mammary epithelial cells induces constitutive PI3K/AKT pathway hyperactivation, insulin/IGF1-independent cell proliferation, anchorage-independent growth and in vivo tumorigenesis. The constitutive PI3K/AKT pathway hyperactivation by IRS4 is unique to the IRS family and the authors identified the lack of a SHP2-binding domain in IRS4 as the molecular basis of this feature .In our revised manuscript, we have rephrased the sentence and cited these references properly (Discussion section lines 494-504).10. Lines 450-452: The authors should estimate of the contribution of IRS4 signaling versus other pathways for tumor survival or burden in order to establish the therapeutic benefit for disruption of the FER-IRS4 pathway. Based on Figure 7E the improvement seems significant but small, so the other pathways must be rather robust. What are they?We thank the reviewer for this great suggestion. We analyzed clinical data from over 600 ovarian cancer patients (http://www.kmplot.com) and plotted the overall survival curves for both the IRS4-high and the IRS4-low cohorts. The majority of ovarian cancer patient samples that are collected and deposited into kmplot database are grouped in the advanced disease stage. That may partially explain the improvement seems significant but small based on IRS4 expression and signaling.In question 3, we found that in the absence of IRS4-mediated PI3K-AKT activation, OVCAR-5 ovarian cancer cells would upregulate ERK activity in a compensating manner, thereby enhancing survival and proliferative capacities. Pharmacological inhibition of both PI3K-AKT pathway and ERK pathway in OVCAR-5 cells almost blocked cell growth completely. Therefore, ERK pathway is the alternative pathway we are looking for.In question 8, we treated IRS4 knockout OVCAR-5 cells with ERK pathway inhibitor U0126, and observed profound inhibition in cell growth. Most importantly, re-expression of WT IRS4 in IRS4-KO cells exposed to U0126 treatment recovered the growth capacity to the same level as U0126 treatment alone, whereas 5YF mutant of IRS4 failed to rescue cell proliferation. This rescue experiment suggested that tyrosine phosphorylation of IRS4, executed by FER kinase and alternatively IGF-1R in the presence of ligand IGF-1, plays a significant role in controlling cell proliferation in ovarian cancer.Therefore, in sum, simultaneously targeting both IRS4-mediated PI3K-AKT and ERK pathways may deliver a more effective strategy to treat ovarian cancer (Discussion section lines 513-515).11. Lines 454-461: Can the authors tell us which of the MS/MS verified Tyr(P) sites reside in YXXM motifs to create potential PI3K binding sites. This might be achieved from clearer writing.We thank the reviewer for this great suggestion. There are 7 YXXM motifs on IRS4, which have been speculated as potential binding sites for the regulatory subunit of PI3K. Our results from mass spectrometry and site-directed mutagenesis analysis verified 3 Tyr(P) sites reside in YXXM motifs to create potential PI3K binding sites: Tyr-779, -828 and -921. This new information has been integrated into the Discussion section lines 517-525.12. Inclusion in the Discussion of how the current study differs from the previous knockout study of FER would clarify the discrepancies in the outcomes of the two studies. The authors provide this explanation in the response to reviewers and should include it in the Discussion.We thank the reviewer to point out this issue. In this current manuscript, we have provided both in vitro  and cell-based  biochemical assays to demonstrate the kinase-substrate regulatory mode between FER and IRS4. Further loss-of-function assay also suggests that FER-mediated tyrosine phosphorylation of IRS4 is important for PIK3R2 recruitment  and downstream AKT pathway activation , which is important for ovarian cancer cell proliferation .In a previous study , ovarian carcinoma cells with or without expression of FER were injected subcutaneously in mice, and differences in tumor growth were not observed. However, metastasis to the lungs was decreased. In the current study, tumor growth was suppressed when IRS4 expression was knocked out. There is one determining factor that should be taken into consideration for solving the abovementioned discrepancy.In the previous paper, the majority of in vivo assays were done with CAOV4 cells, which have no IRS4 expression at all. In this current manuscript, two cell lines we used in our phenotypic assays, OVCAR-5 and OVCAR-3, have high IRS4 expression. We think this key difference could explain the different functional output of FER in both experimental contexts: In the absence of IRS4, FER regulates ovarian cancer cell motility and invasiveness mainly through MET-GAB1-SHP2-ERK1/2 signaling pathway, with MET and GAB1 as its substrates; in IRS4-positive ovarian cancer cells, FER-mediated phosphorylation of Tyr779 enables IRS4 to recruit PIK3R2/p85\u03b2, the regulatory subunit of PI3K, and activate the PI3K-AKT pathway for proliferation. This new information has been integrated into the Discussion section lines 531-545.13. On Page 10, line 270, LY294002 is described as an AKT inhibitor. This is incorrect, LY294002 is a PI3K inhibitor.We thank the reviewer for pointing out this issue. Indeed, LY294002 is the first synthetic small molecule known to inhibit PI3K\u03b1/\u03b4/\u03b2 with IC50 of 0.5 \u03bcM/0.57 \u03bcM/0.97 \u03bcM, respectively, in cell-free assays. LY294002 inactivates AKT/PKB, thus inhibiting cell proliferation and inducing apoptosis. We have corrected all the mistakes in our revised manuscript."}
+{"text": "The difficulty in determining synovitis, tenosynovitis, or enthesitis by physical examination (PE) has limited the diagnostic capability of CASPAR for psoriatic arthritis (PsA). Therefore, we aimed to evaluate the diagnostic utility of CASPAR with the integration of ultrasound (US).Patients with a hint of PsA were enrolled. Besides routine PE for tender or swollen joints, enthesitis, and dactylitis, US was performed to evaluate peripheral joints, entheses, and tendons. The additional value of the US to the CASPAR criteria was analyzed.vs. 13.0%; 63.4% vs. 14.2%; 62.2% vs. 8.0%, p <0.01 for all). Logistic regression analysis showed that dactylitis , family history of PsO/PsA , nail involvement , new bone formation on X-ray , tenosynovitis on US , and enthesitis on US  were independent risk factors for PsA. By combining US tenosynovitis and/or enthesitis, the diagnostic utility of CASPAR criteria was improved, with superior specificity (91.4% vs. 84.0%) and similar sensitivity (95.7% vs. 94.5%). Replacing X-ray by US or adding US, the CASPAR criteria showed comparable sensitivity and specificity for PsA diagnosis. The diagnostic accuracy was 89.3% for CASPAR criteria based on PE, 93.6% for CASPAR added with US, and 93.3% for CASPAR with US replacing X-ray.A total of 326 consecutive patients with 164 PsA and 162 non-PsA were enrolled. A total of 162 non-PsA patients consisted of 58 cases of psoriasis (PsO), 27 osteoarthritis with PsO/family history of PsO, five fibromyalgia with PsO, 69 sero-negative rheumatoid arthritis, and three undifferentiated arthritis. Significantly higher frequencies of tenosynovitis and enthesitis on US and new bone formation on X-rays were found in PsA vs. non-PsA patients (59.1% The diagnostic utility of the CASPAR was improved by integrating tenosynovitis and/or enthesitis when using US. US provides additional value for PsA recognition. Psoriatic arthritis (PsA) is a chronic inflammatory disease, manifesting as peripheral arthritis, enthesitis, dactylitis, or spondylitis besides skin and nail psoriasis . PeripheIn recent years, ultrasound (US) has been recognized as a feasible, reliable, and non-radiative tool, and it has been widely used in assessing inflammatory arthritis. Some previous studies have also demonstrated that subclinical synovitis and enthesitis identified by US are common in PsA and even in some psoriasis (PsO) patients. On the other hand, overestimation of inflammatory articular disease also happens in practice due to osteoarthritis or fibromyalgia . TherefoAlthough the CASPAR criteria have been validated, CASPAR based on PE is not the \u201cgold standard.\u201d The final diagnosis of PsA is usually made by experienced rheumatologists after considering all the available evidence. In this study, we tried to explore the contribution of US on the basis of CASPAR criteria to the diagnosis of PsA.We conducted a cross-sectional study on patients with suspected PsA at Peking University First Hospital. The patients were enrolled from June 2019 to May 2021. In detail, patients with the following clinical features were included: 1. Presence of PsO/family history of PsO plus at least one of the following: (1) presence of tender and/or swollen joint on physical examination; (2) tender entheses on physical examination; (3) swollen digits with/without tender on physical examination and 2. The absence of PsO/family history of PsO, being seronegative, but physical examination revealed tender and/or swollen joints, or tender entheses, or swollen digits with/without tender. Those suspected PsA patients with axial involvement were excluded. The exclusion criteria were as follows: 1. use of disease-modifying antirheumatic drugs within 3 months before enrollment; and 2. steroid therapy  or non-steroidal anti-inflammatory drugs within 2 weeks before enrollment. The research protocol was approved by the Peking University First Hospital Institutional Review Board for clinical research and consent forms were obtained from all participants in compliance with the Helsinki Declaration.The demographics, including age, sex, family history of PsO, and body mass index (BMI), were recorded. The duration of arthralgia and/or enthesis pain was recorded. The following variables were collected and further calculated: swollen joint counts (SJC), tender joint counts (TJC) of 46 joints , global assessment of patients (0\u201310), and global assessment of physicians (0\u201310). Tenderness of 16 entheses  and dactylitis on 20 digits  were examined. Psoriasis was scored using the psoriasis area and severity index (PASI). Nail involvement was recorded. The following laboratory tests were recorded: erythrocyte sedimentation rate, C-reactive protein, rheumatoid factor (RF), and anti-cyclic citrullinated peptide (anti-CCP).US examination was performed by a rheumatologist (XRD) who was the ultrasound trainer endorsed by EULAR with over 10 years of experience in maneuvering US and was blinded to all clinical and laboratory findings. A total of 46 joints (same to TJC and SJC), 16 entheses (same to tenderness count), and 36 tendons  were scanned. The US protocol included transverse and longitudinal scans of the joints and enthesis. Each scan took at least 20\u00a0min, and the representative images were archived. The GE LOGIQ E9 US machine with linear ML 15\u20136 MHz or small-footprint linear array 18\u20138 MHz transducers was used in our study. The gray-scale and Doppler settings were as below: wall filter low, pulse repetition frequency (PRF) 1.0 kHz, and gain was adjusted to just below the level at which Doppler artifacts appeared beneath bone. The severity of synovitis was measured and graded using the 2001 Szkudlarek semi-quantitative method   who were blinded to the US findings.2 test was used for categorical data in the comparative analysis between groups. The analysis based on the receiver operating characteristic (ROC) curve was performed to determine the optimal cut-off value for the best combination of sensitivity and specificity. Logistic regression was used to predict the independent risk factors for the diagnosis of PsA. P-values <0.05 were considered as being significant. P-values <0.01 were considered as highly significant.All statistical analyses were performed using Statistical Package of Social Science  software v. 22.0.\u00a0A T-test or Mann\u2013Whitney U-test was used for measurement data, and \u03c7Three hundred and twenty-six patients were enrolled in the study. Clinically, 164 were diagnosed as PsA. A total of 162 non-PsA consisted of 58 PsO, 27 osteoarthritis with PsO/family history of PsO, five fibromyalgia with concomitant PsO, 69 sero-negative rheumatoid arthritis, and three undifferentiated arthritis.vs. 25.9%, p <0.01). The PASI score was higher in the PsA group than in the non-PsA group . More patients had clinical enthesitis, dactylitis, and nail involvement in the PsA group than in the non-PsA group . The presence of RF or anti-CCP was very low, with no statistical significance between the two groups.The demographics and clinical characteristics of patients with PsA and non-PsA are shown in p <0.05). The presence of tenosynovitis, enthesitis and bone erosion was significantly more in the PsA group than in the non-PsA group . Compared to the non-PsA group, a significantly higher proportion of patients in the PsA group had new bone formation on X-ray .Among US characteristics, synovitis was found in 59.8% of PsA patients and 46.3% of non-PsA patients (p <0.01), nail involvement , family history of PsO/PsA , new bone formation on X -ray  and tenosynovitis on US , enthesitis on US  were independent risk factors for predicting the diagnosis of PsA , and the cut-off total score of \u22654 was used to classify a patient as having PsA.vs. 84.0%) and similar sensitivity (95.7% vs. 94.5%) (p = 0.052), with better positive predictive value (91.8% vs. 85.6%) and comparable negative predictive value (95.5% vs. 93.8%).Compared to the original CASPAR criteria based on PE, the modified CASPAR criteria integrated with US findings showed better performance, with improved specificity (91.4% . 94.5%) Figure\u00a02vs. 95.7% and 90.1% vs. 91.4%) , with a positive predictive value of 90.8% and a negative predictive value of 96.1%.An X-ray is an invasive procedure and is incapable of disclosing inflammation. It is always ideal if an X-ray can be substituted by US. Therefore, we tried replacing X-rays in the CASPAR criteria with US. Unexpectedly, we found both the sensitivity and specificity were noninferior to CASPAR criteria with combined US (96.3% . 91.4%) Figure\u00a02p <0.01), and 0.933 .The ROC curve illustrated the diagnostic performance of two modified CASPAR criteria added with US, and substituting X-ray by US, as well as the original CASPAR criteria. The corresponding areas under the ROC curves (AUC) were 0.954 , 0.944  improves the diagnosis utility. Moreover, X-rays can be substituted with US, which is a valuable tool in assisting the diagnosis of PsA in clinical practice.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.This study was reviewed and approved by the Ethics Committee of Peking University First Hospital. The patients/participants provided their written informed consent to participate in this study.ZZ conceived of the study and critically revised the manuscript. YG had full access to all the data collection, analysis, interpretation, and drafted the manuscript. ZS, XZ, XD, and YW contributed to the data collection. All authors contributed to the article and approved the submitted version.This work was supported by the Interdisciplinary Clinical Research Project of the Peking University First Hospital (2021CR30), the Youth Clinical Research Project of the Peking University First Hospital (2019CR28), and the National Natural Science Foundation of China .The authors would like to thank all the patients and rheumatology nurses who contributed to our study. Patients or the public were not involved in the design, conduct, reporting, or dissemination plans of our research.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "ObjectiveAdvance care planning (ACP) is a process in which the patient and family discuss end-of-life care in advance with healthcare providers in case decisional ability declines. Due to the rapid deterioration of symptoms and isolation for treatment, it is not easy for COVID-19 patients to discuss their end-of-life care with families and medical staff. We conducted a questionnaire survey to assess the current situation of ACP practices in hospitalized COVID-19 patients.Materials and methodsMulticenter questionnaire surveys of hospitalized COVID-19 patients aged \u226560 years between January 2021 and August 2022 were conducted in two hospitals. The questionnaires assessed whether patients had discussed end-of-life medical treatment with their families and family physicians at the time of admission and their preferences for end-of-life medical treatments.ResultsA total of 109 patients aged 60-99 years (median 75.0 years) were enrolled. Only eight patients (7.3%) had practiced ACP at the time of admission. Age was a significant factor related to ACP practices (p=0.035). Although there was no significant difference between the ACP and non-ACP practiced groups for each end-of-life care, all eight patients in the ACP-practiced group were able to make decisions for all the end-of-life medical treatment, while 40 patients (33.0%) in the non-ACP-practiced group did not, showing a significant difference (p=0.026).ConclusionIn hospitalized COVID-19 patients, the rate of ACP practice was as low as 7.3%. Awareness of ACP practice is necessary, especially for elderly patients with underlying diseases. COVID-19 is an infectious disease caused by SARS-CoV-2. It first emerged in Wuhan City, Hubei Province, China, in December 2019 and rapidly spread worldwide. As of January 25th, 2023, it had infected 32,251,054 people and caused 66,297 deaths in Japan . AlthougQuestionnaire surveys were conducted for hospitalized COVID-19 patients aged 60 years or older. These were carried out at Nagasaki University Hospital, an academic medical center with 871 beds, and Izumikawa Hospital, Eiwakai Medical Corporation, a rural acute care hospital with 120 beds. The surveys occurred between January 4, 2021, and August 31, 2022. The attending doctors performed the questionnaire. We assessed whether the patients had discussed end-of-life medical treatment with their families and medical care providers at the time of admission by using the question sheet and evaluated their preferences for end-of-life medical treatment, such as cardiac massage, intratracheal intubation, tracheostomy, and parenteral nutrition. Similar questionnaires were also administered to the patients' key family members at the time of admission, either in person or by telephone. Only family members were interviewed when the attending physician determined that the patient could not make decisions regarding treatment due to cognitive function and medical conditions. We defined those who had discussed end-of-life medical care with both the family and family physician at the time of admission as practicing ACP. Patient information on age, sex, performance status (PS), decisional ability, Japanese definition of COVID-19 severity  at the tNext, we evaluated the association between various characteristics and ACP practice. These characteristics included sex, age, performance status (PS) on a scale of 0-2 and 3-4, decision-making ability, severity at the time of admission, and the location of prior residence (home or nursing home). We also considered underlying diseases that could affect COVID-19 severity, such as diabetes mellitus, chronic respiratory diseases , cardiovascular diseases , cerebrovascular diseases , malignancies, chronic liver diseases, chronic kidney diseases, and autoimmune diseases  . Wishes This study was approved by the Nagasaki University School of Medicine Research Ethics Committee . This study was a retrospective cohort study, so written informed consent was not obtained. However, after approval from the ethics committee of our institute, we have shown the document \"Disclosure of Information on Clinical Research\" on our homepage to give the subjects the opportunity to declare their will not to participate in this study.Statistical analysisSummaries of observations from categorical variables were provided as frequencies and continuous variables were presented as medians and interquartile ranges. Associations between variables were analyzed using Fisher's exact test or the Mann-Whitney test. Statistical analyses were performed using GraphPad Prism version 9.Patient characteristicsThe patient characteristics are listed in Table ResultsWe found that only eight patients (7.3%) had practiced ACP at the time of admission. Table Table In the present study, only 7.3% of hospitalized COVID-19 patients had practiced ACP effectively with their families and medical care providers. ACP was practiced in elderly patients; however, PS, decisional ability, hospitalization from home or nursing home, and underlying disease related to the severity of COVID-19 were not significantly associated with the rate of ACP practice. In this study, more patients in the ACP-practiced group were able to make decisions about end-of-life care at the time of admission, suggesting that advanced decision-making is essential.\u00a0ACP is often initiated with the onset of an underlying disease such as dementia  and repoA multicenter study in US nursing homes  reportedIn our survey, 7/8 of the patients in the ACP-practiced group and 36/101 in the non-ACP-practiced group did not want life-prolonging treatment.It may be difficult for patients to express their wishes after developing COVID-19, and isolation may prevent them from fully discussing end-of-life care with key family members and healthcare providers. Especially in elderly patients with underlying diseases associated with the severity of COVID-19, ACP should be initiated when they are in good health. Therefore, further large-scale surveys are needed."}
+{"text": "In many situations, the therapeutic efficacy of CAR T cells is limited due to immune suppression and poor persistence. Immunostimulatory fusion protein (IFP) constructs have been advanced as a tool to convert suppressive signals into stimulation and thus promote the persistence of T cells, but no universal IFP design has been established so far. We now took advantage of a PD-1-CD28 IFP as a clinically relevant structure to define key determinants of IFP activity.We compared different PD-1-CD28 IFP variants in a human leukemia model to assess the impact of distinctive design choices on CAR T cell performance in vitro and a xenograft mouse model.+ tumour cells in vitro and prolonged survival in vivo. Transmembrane or extracellular CD28 domains were found to be replaceable by corresponding PD-1 domains for in vivo efficacy.We observed that IFP constructs that putatively exceed the extracellular length of PD-1 induce T-cell response without CAR target recognition, rendering them unsuitable for tumour-specific therapy. IFP variants with physiological PD-1 length ameliorated CAR T cell effector function and proliferation in response to PD-L1PD-1-CD28 IFP constructs must mimic the physiological interaction of PD-1 with PD-L1 to retain selectivity and mediate CAR-conditional therapeutic activity. Adoptive transfer of chimeric antigen receptor (CAR) T cells has greatly impacted the field of anti-tumour immunotherapies . Anti-CDHowever, the application of anti-CD19-CAR T cells alone bears a significant risk of causing immune-related adverse events , 8, 9. BA known and elegant approach that has been applied to stem the disadvantages of systemic targeting of the PD-1-PD-L1 axis relies on the conversion of PD-1-mediated suppression into a CD28-mediated costimulatory signal by introducing immunostimulatory fusion protein (IFP) constructs into adoptively transferred cells. These fusion proteins combine the extracellular domain of PD-1 with the intracellular domain of CD28 and have been previously introduced by us and others \u201321. WithRecently, a novel IFP designed to convert an inhibitory CD200R stimulus into a CD28 costimulus demonstrated how tuning different IFP domains can drastically alter the therapeutic effects in a preclinical model of acute myeloid leukemia (AML) . For insscid Il2rgtm1WjI/SzJ) mice were purchased from Charles River  or Janvier . Animals were housed in specific pathogen-free facilities. All animal studies were approved by the local regulatory office on animal experimentation (Regierung von Oberbayern). In accordance with the animal experiment application, the health status of mice was checked at least three times per week. For ethical reasons and imposed by animal care regulations, endpoints of survival studies were defined as weight loss above 20% or other clinical signs suggestive of advanced leukemia in mice, namely irresponsiveness to stimuli, abnormal posture, and hind limb paralysis. These endpoints were registered by blinded observers and used as surrogate endpoints for survival and are used as such throughout the study.NSG (NOD.Cg-Prkdc2/sr). For treatment with adoptively transferred T cells, 107\u2009T cells were injected intravenously in 100\u2009\u00b5l PBS. Mice were allocated randomly to treatment groups by the blinded observer.Tumour cells were injected intravenously in 100\u2009\u00b5l PBS into the tail vein of mice. Tumour burden was measured through bio-luminescence signal using an IVIS Lumina X5 from Perkin-Elmer  at a frequency indicated in the figure legends. Mice were injected with 100\u2009\u00b5l of XenoLight D-Luciferin potassium salt,  10\u2009min prior to imaging according to the manufacturer\u2019s instructions. The Living Image Software 4.7.2 (Perkin-Elmer) was used for the analysis of acquired images. Luminescence is depicted as radiance , followed by blocking of Fc receptors with TruStain FcX . Cell surface proteins of human T cells were stained with the following antibodies: anti-c-myc  to determine CAR expression, anti-human CD279/PD-1 (EH12.2H7), anti-human CD3 (OKT3), anti-human CD8a (HIT8a), anti-human CD4 (OKT4), anti-human CD366/TIM-3 (F38-2E2), anti-human CD223/LAG-3 (11C3C65) and anti-human CD25 (M-A251), all from BioLegend. Cells were analyzed on a LSRFortessa flow cytometer  and data were analyzed with FlowJo software version 10.3.All DNA constructs were generated by overlap extension PCR and recombinant expression cloning into the retroviral pMP71 vector using standard molecular cloning protocols  as folloThe human Nalm-6-PD-L1 tumour cell line was generated as previously described from wildtype Nalm-6 cells by cloning the human PD-L1/CD274 gene into a retroviral pMP71 vector  and subsequent transduction and flow cytometry-assisted bulk sorting of positive cells . Tumour The proliferation of transduced T cells was measured at indicated time points after coculture with tumour cells using a flow cytometry-based CellTrace Violet Cell Proliferation Kit from Invitrogen  according to the manufacturer\u2019s protocol.T cells were incubated with Nalm-6 tumour cells at indicated effector-to-target ratios. Following 24 to 48\u2009h of coculture, the supernatant was removed to quantify the indicated\u00a0human cytokine\u00a0concentration by ELISA . Subsequently, the Bio-Glo Luciferase Assay System  was used according to the manufacturer\u2019s protocol to determine tumour cell lysis.Blinded confocal imaging and conjugate quantification were carried out as previously described . Cells wJurkat E6.1 (ECACC 88042803) tumour cells were retrovirally transduced with IFP constructs and bulk sorted for positive cells. The cells were then lysed with RIPA cell lysis buffer and centrifuged at 15,000\u2009g for 10\u2009min. The resulting supernatant was used for total protein estimation using the Bradford assay. After protein quantification, the samples were denatured using Laemmli buffer at 95\u2009\u00b0C for 5\u2009min. For reducing conditions, \u03b2-mercaptoethanol was added to the Laemmli buffer in a concentration of 1:10. The samples were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After separating the proteins, they were transferred from the gel to a polyvinylidene difluoride membrane using the wet transfer system. The membrane was blocked with 5% bovine serum albumin for 1\u2009h and probed with a primary antibody  overnight. On the next day, the membrane was washed three times with 1X TBST  for 10\u2009min each. Thereafter, the membrane was probed with a secondary antibody  for 1\u2009h and washed three times with 1X TBST for 10\u2009min each time. Following this procedure, the membrane was prepared for chemiluminescence detection.p\u2009<\u20090.05 was considered statistically significant and represented as *<0.05, **<0.01, and ***<0.001. No statistical methods were used to predetermine the sample size.Statistical analysis was performed with GraphPad Prism 9 software. Data are shown as mean and error bars represent standard deviation. Statistical analysis was performed as indicated in the figure legends; non-significant differences are not depicted in the figures. To determine the optimal prerequisites for the PD-1-CD28 IFP, we fused different variants of the extracellular domain of PD-1 to the intracellular domain of CD28, creating multiple variants in the protein length of the PD-1-CD28 IFP Fig.\u00a0. The firWe investigated additional IFP configurations by incorporating larger portions of the extracellular CD28 domain and added 39 (CTM\u2009+\u200939EC) and 41 (CTM\u2009+\u200941EC) amino acids, to respectively include a CD28 CAR spacer domain   as well To evaluate the expression of these different PD-1-CD28 IFP constructs, we transfected HEK293 cells with all six constructs and proved that they are capable of binding PD-L1 Fig.\u00a0. SimilarOur PD-1-CD28 IFP constructs yielded comparable transduction efficiencies among the different constructs in primary human T cells Fig.\u00a0. To crea+ tumour cells, we cocultured transduced T cells with either wild-type (WT) or PD-L1+ Nalm-6 tumour cells that bear an identical expression of CD19 . As intended by design, the IFP should depend on target antigen recognition of the anti-CD19 CAR and provide the additional CD28 stimulus to the T cell only upon exposure to PD-L1. Although all constructs were able to ameliorate CAR T cell effector function and proliferation in response to PD-L1+ tumour cells and showcase the potential of IFPs as a novel approach for interrupting the PD-1-PD-L1 axis, only PTM, CTM, and CTM\u039412EC IFPs complement the CAR without the adverse potential of inducing a CAR-independent T cell response.These results demonstrate that IFP constructs that exceed the physiological extracellular length  induce CAR-independent T cell activation Fig.\u00a0, prolife+ than with WT tumour cells, whereas PTM, CTM, and CTM\u039412EC constructs did not engage tumour cells in the absence of the CAR  demonstrated similar CAR-independent and PD-L1-induced activation, we selected CTM\u2009+\u200912EC as the shortest of these constructs for testing. Based on the in vitro experiments herein shown, the IFP constructs with physiological extracellular PD-1 length  enhanced T cell activation, proliferation, and cytolytic capabilities upon contact with PD-L1onstruct , and theonstruct , which clls Fig.\u00a0.+ Nalm-6 xenograft tumour model resistant to anti-CD19 CAR T cell therapy [scid Il2rgtm1WjI/SzJ (NSG) mice and treatment with transduced T cells followed three days later, while bioluminescence imaging was performed regularly to assess the tumour burden of mice  showed no difference in weight change, tumour burden, or survival compared to the untransduced group Fig.\u00a0, c, d, cPDCD1 gene on CAR T cells [PDCD1 knock-out approaches are elegant forms of local disruption currently being tested in clinical trials [Immune suppression is an essential tumour escape mechanism to CAR T cell therapy, which functionally leads to T cell exhaustion and disease progression . IFP con T cells  or using T cells . While t T cells . However T cells . PDCD1 kl trials . The clil trials , 45. Furl trials , whereasDNR constructs are the strategy that can most closely be compared to the concept of IFPs. A DNR will also specifically be present in adoptively transferred T cells, thus restricting the effect of inhibitory signals to T cells of known anti-tumour specificity. As DNR and IFP constructs are inserted in therapeutic T cells through genetic engineering, they could be integrated into genome regions with circumstantial reported risks of gene disruption . With seNotably, there has yet to be a consensus defining the best IFP structure for optimised synergy with the primary targeting receptor. Such a universal design would permit the rapid selection and implementation of IFPs for different inhibitory receptor families and likely accelerate its clinical implementation. Multiple IFP designs with different extracellular and intracellular portions have been tested in vitro and in vivo with varying degrees of efficiency. Examples include but are not limited to CTLA-4-CD28, PD-1-CD28, CD200R-CD28, CD40L-CD28, or Fas-4-1BB , 49\u201351. A different human PD-1-CD28 IFP with a full extracellular PD-1 domain similar to our CTM design was proposed by Ankri et al. and indicated that the cysteine-mediated dimerisation was not needed for PD-1-CD28 IFP function . In factRegarding the IFP constructs with physiological extracellular PD-1 length , we could confirm that they augment CAR T therapy by overcoming PD-1-mediated suppression, in vitro and in vivo \u201325, 52 wIn summary, our results demonstrate that human PD-1-based IFPs come with needs of their own: In our experiments, the addition of dimerisation-prone motifs did not increase the functionality of the IFP. We instead found that physiological extracellular PD-1 length was essential for its selective function and therapeutic application. It remains to be seen if this length requirement transfers to other IFP families and challenges previous models. As the race is still on to determine the optimal IFP design, bench-to-bedside translational studies must be aware of the effects that different structural choices might entail and adapt accordingly.Supplementary Figures"}
+{"text": "Data from DNA genotyping via a 96-SNP panel in a study of 25,015 clinical samples were utilized for quality control and tracking of sample identity in a clinical sequencing network. The study aimed to demonstrate the value of both the precise SNP tracking and the utility of the panel for predicting the sex-by-genotype of the participants, to identify possible sample mix-ups.Precise SNP tracking showed no sample swap errors within the clinical testing laboratories. In contrast, when comparing predicted sex-by-genotype to the provided sex on the test requisition, we identified 110 inconsistencies from 25,015 clinical samples (0.44%), that had occurred during sample collection or accessioning. The genetic sex predictions were confirmed using additional SNP sites in the sequencing data or high-density genotyping arrays. It was determined that discrepancies resulted from clerical errors, samples from transgender participants and stem cell or bone marrow transplant patients along with undetermined sample mix-ups. The implementation of next generation sequencing (NGS) technologies in clinical laboratories \u20133 typicaDNA-based methods for sample tracking include genotyping of short tandem repeats (STRs) or single nucleotide polymorphisms (SNPs) . STRs arTwo clinical laboratories harmonized methods for the program and utilThe BCM-HGSC-CL\u2019s 96-SNP panel replaced 19 of the original Fluidigm SNPtrace 96 sites to match genomic regions specifically targeted in eMERGE III. The remaining sites included 3 SNPs on Chromosome X and 3 on Chromosome Y. At the The HumanCoreExome v1\u20133 BeadChips containing 500K variant sites, including more than 12,900 located on the X chromosome, that are informative for genetic sex prediction, were utilized according to manufacturer\u2019s specifications. DNA sequencing for the eMERGE phase III program has been described previously.The BCM-HGSC-CL and LMM/Broad laboratories utilized the same analytical platform foundation, employing slightly different SNP sites for the assays, but generally similar workflows , to testAt the BCM-HGSC-CL, of the 14,515 samples processed, 73 samples with sex discrepancies were re-tested with the same 96-SNP panel. Identical results were obtained for 70 of the re-tested samples . For theNext, Illumina HumanCore Exome Arrays were utilized as an orthogonal high-density hybridization genotyping assay to further test 71 of the 73 samples with sex inconsistencies except two samples which had insufficient genomic DNA . HumanCoAt the Broad/LMM, the reported sex from the test requisition was compared with the genetic sex determined by both the Fludigm genotyping assay and the data from the eMERGE III sequencing panel. Of the 10,500 samples processed, 151 were initially either identified as discordant or had no sex determination. For 95 samples, the Fluidigm assay data could not return a sex determination, however the sequencing sex matched the reported sex for each and no further action was taken. For 19 of the remaining 56 samples, the sequencing and reported sex were concordant, but did not match the genotyping determined sex. Further review of these 19 samples showed that the genotyping assay calls were generally borderline or low confidence calls, suggesting sub-optimal performance of the single sex determining SNP as the reason for the data discrepancy, rather than either a sex reporting error at accession or sample mix-up in the testing laboratory. The remaining 37 samples had highly confident sex determination calls from both theSNP assay and the subsequent DNA sequencing that were concordant, but did not match the site reported sex .Internal tracking showed that none of the 110 confidently identified sex discrepant samples occur within the clinical DNA sequencing laboratories and that most errors were likely introduced prior to shipment of samples. Sampling sites identified handling errors from test requisitions, sample extraction, and sample handling procedures for 54 cases. Forty-six of these had information that was incorrectly or incompletely entered on the test requisitions and were resolved by examination of other records. In 6 other cases, it was determined that incorrect samples had been shipped from the sampling sites to the genome centers. Biological explanations for the discrepant tracking data were identified for an additional 12 cases. In 4 of these 12 cases, further examination of records revealed that the samples were provided by transgender participants. In addition, 8 sex discrepant samples were determined to be from individuals who had received stem cell or bone marrow transplants. Causes of the sample genetic vs. reported sex discrepancy are listed in Where possible, the information on test requisition forms was amended and correct clinical reports were issued for 45 cases processed at the BCM-HGSC-CL, or the incorrect samples were replaced and re-processed. Twelve cases sequenced at the BCM-HGSC-CL with sample-mix ups due to unknown causes were withdrawn from the study. Similarly, 32 unsolved cases sequenced at LMM/Broad were either withdrawn or remain under investigation.To identify sample swaps during the processing of 25,015 clinical samples in the NIH eMERGE III program, two clinical DNA sequencing laboratories first utilized a Fluidigm-based 96-SNP panel assay to track internal processes. These analyses indicated no sample swaps had occurred in the time interval between sample arrival at the testing laboratories and the delivery of the final DNA sequencing data. In contrast, when the test was expanded to predict the concordance between the self-reported sex of participants at the time of their initial enrollment, with a predicted sex-by-genotype, there were 110 discordant samples. A battery of follow-up tests indicated that these likely arose before the materials were received at the clinical DNA sequencing laboratories. The bases of the sample tracking errors at sample collection sites were determined in 66 of the 110 cases (60%), while leaving the remaining 44 cases unsolved and under investigation. Of these 66 resolved cases, the largest source for the initial discordance occurring in 54 cases (81%) arose from clerical or shipping errors (81%). The remaining 12 cases (18% of the 66 solved) had biological underpinnings that explained the discordant results, as 8 were due to stem cell/bone marrow transplants while 4 were from transgender individuals. Future sample collecting procedures should be modified to ensure that participants are invited to note these types of events at the time of collection, so that this information is available for quality control.The 96-SNP panel has proven value for precise sample tracking . In geneThis level of tracking error is unacceptable for ongoing clinical practice, but the study does not represent the levels that will be expected in further clinical programs. At least one laboratory declared their initial sample enrollments as \u2018research samples\u2019 and thus committed to later repeat assays under a fully compliant protocol, to verify any findings that may impact care. Others were able to quickly identify points of error and rectify their protocols to ensure faithful future sample handling. All sites committed to rechecking of records and reconciling actionable findings with orthogonal data, including family histories and biochemical tests, before returning results. The \u2018lessons learned\u2019 from these analyses ensure that a repeat of the same program would likely minimize any similar errors.While false positive rates are low for this application of SNP trace, false negative rates will be high. Here, the overall level of genetic and reported sex discordance of 0.44% is likely an underestimate of the true error rate in this study, as the misclassification of genetic sex from a random sample swap would be expected to result in incorrect, erroneous assignment, only 50% of the time. The true ratio may be skewed by factors introducing a sex-bias in the direction of misclassification. This could be caused by skewed phenotypes of individuals with sex chromosome anomalies or that gender obfuscation may be socially driven in an unequal manner, depending on the gender identity of the individual. Overall, the rate is likely higher than the 0.44% identified here, but not anticipated to be higher than twice that level."}
+{"text": "Arabidopsis, rice, and walnut, their roles in grapes remain unexplored. In this study, we isolated VvAGL12, a member of the grape MADS-box group, and investigated its impact on plant growth and biomass production. VvAGL12 was found to localize in the nucleus and exhibit expression in both vegetative and reproductive organs. We introduced VvAGL12 into Arabidopsis\u00a0thaliana ecotype Columbia-0 and an agl12 mutant. The resulting phenotypes in the agl12 mutant, complementary line, and overexpressed line underscored VvAGL12\u2019s ability to promote early flowering, augment plant growth, and enhance production. This was evident from the improved fresh weight, root length, plant height, and seed production, as well as the reduced flowering time. Subsequent transcriptome analysis revealed significant alterations in the expression of genes associated with cell-wall modification and flowering in the transgenic plants. In summary, the findings highlight VvAGL12\u2032s pivotal role in the regulation of flowering timing, overall plant growth, and development. This study offers valuable insights, serving as a reference for understanding the influence of the VvAGL12 gene in other plant species and addressing yield-related challenges.The MADS-box family, a substantial group of plant transcription factors, crucially regulates plant growth and development. Although the functions of AGL12-like subgroups have been elucidated in  C and MIKC* based on the presence or absence of keratin boxes. Among these, the MIKCC MADS-box factors have emerged as the most extensively researched, exhibiting a well-defined mechanism. MIKCC MADS-box factors can be classified into 12 subfamilies: AG-like, AGL2-like, AGL6-like, AGL12-like, AGL15-like, AGL17-like, DEF/GLO-like, FLC-like, GGM13-like, SQUA-like, STMADS11-like, and TM3-like [MADS-box transcription factors represent a crucial family of transcription factors within eukaryotes and have garnered extensive attention and research in the realms of plants, animals, and fungi. This family is characterized by a highly conserved DNA-binding domain and can be classified into two primary categories: Type I and Type II . AlthougMedicago truncatula relies on MtFULc to govern inflorescence development, working in coordination with MtTFL1 and MtPIM [GmFULa improves vegetative growth and boosts soybean yield by positively regulating sucrose synthases (SUSs) and sucrose transporters (SUTs), without altering flowering time or maturity [Brassica napus, the presence of Bna.AP.A02, an AP1 ortholog mutant, induces notable changes in flower morphology, plant architecture, and seed yield components within the oilseed rape plant [The MADS-box family has a significant influence on both plant and fungal systems . Its pivnd MtPIM . In soybmaturity . In Braspe plant . Beyond pe plant ,13,14.Arabidopsis thaliana, rice (Oryza sativa), and walnut (Juglans sp.). In Arabidopsis, AtAGL12 is associated with root meristem cell proliferation, flowering transition, and cell cycle regulation. Furthermore, AtAGL12 affects somatic embryo germination rates and root configurations in walnut [OsMADS26 exhibit stress-related phenotypes, including chlorosis, cell death, pigment accumulation, and growth defects in the roots and buds. Conversely, downregulation of OsMADS26 enhances resistance to pathogenic bacteria and drought stress [Functional attributes of the AGL12-like subgroup have only been documented in n walnut ,16,17. It stress . HoweverVitis vinifera) are globally significant, serving not only as a valuable economic commodity with high nutritional value but also as a renowned medicinal resource [AGL12 genes in rice, Arabidopsis, and walnut have been extensively characterized, the biological functions of AGL12 in grapes remain unreported and warrant further investigation. In this study, we isolated the AGL12-like gene (VvAGL12) from the \u201cPinot Noir\u201d variety of Vitis vinifera and conducted investigations into its potential roles in regulating flowering time, plant growth, and productivity in Arabidopsis. The findings revealed that VvAGL12 played a pivotal role as a key regulator influencing both vegetative and reproductive growth in plants through the expansion and elongation of cell walls in Arabidopsis. This study provides valuable insights into the biological functions and regulatory mechanisms of VvAGL12 in grapes.Grapes , mutant (agl12), complementary line (Vv12:cs), and overexpression line (Vv12:col). The Arabidopsis wild-type variety Columbia-0 (Col-0) was maintained in our lab, and the mutant variety was procured from the Arabidopsis Biological Resources Center (ABRC).In the experiment, four Arabidopsis were initiated on the MS medium. Once the seedlings reached the four-leaf stage, they were transplanted into a soil mixture consisting of nutrient soil and vermiculite at a 2:1 ratio. To promote Arabidopsis growth, environmental conditions were set in a culture room at 23 \u00b0C, maintaining an air humidity level of 70\u201380%, and employing a 16 h light/8 h dark photoperiod.Firstly, sterile cultivation and vernalization of Nicotiana benthamiana) were cultivated under conditions of 14 h of light and 10 h of dark, at a temperature of 25 \u00b0C and a relative humidity of 70%. These plants were incubated for approximately 4\u20135 weeks before the subcellular localization experiment was started.Tobacco plants . The homologous alignment of AGL12 sequences was conducted using the DNAMAN V6 software [The amino acid sequences of the AGL12 orthologs were retrieved from Phytozome13 . This resulted in the creation of an overexpression vector, pCAMBIA2301: 35S: VvAGL12, for Arabidopsis transformation. Concurrently, the target gene was ligated into the pCAMBIA1300: 35S: YFP vector to construct a recombinant vector, YFP:: VvAGL12, for subcellular localization experiments. The combined vectors were transformed into Escherichia coli for PCR validation and sequencing. Upon successful verification by PCR and sequencing, the recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101 for further investigation.To clone the Agrobacterium tumefaciens carrying the recombinant plasmids YFP:: VvAGL12 and YFP were used to infect epidermal cells on the abaxial surface of tobacco plant leaves. Following this, the tobacco plants underwent a 12 h period of darkness, followed by 2 d of incubation under light conditions. Subsequently, marked sections of the tobacco leaves were excised, and VvAGL12 subcellular localization was visualized using a laser confocal microscope .Arabidopsis (Col-0 and agl12 mutant). Subsequently, the transgenic seeds from the T0 generation were collected. Following kanamycin resistance screening and PCR verification, homozygous VvAGL12 Arabidopsis from the T3 generation was obtained for subsequent experiments.Precisely identified Agrobacterium tumefaciens carrying the pCAMBIA2301: 35S: VvAGL12 vector was employed to infect the inflorescences of agl12), complementary mutant (Vv12:cs), and overexpressed Arabidopsis (Vv12:col) strains were sown and cultivated on the MS medium. The primary root length of Arabidopsis was then observed and measured 7 d after planting. Concurrently, Arabidopsis seedlings with four developed leaves were transplanted into nutrient soil (vermiculite: organic soil = 2:1). The experiments were designed to be completely randomized. Various growth parameters including growth trajectory, bolting period, flowering period, rosette leaf count, and yield-related traits were monitored across different growth stages.Following disinfection and vernalization, seeds from the wild-type (Col-0), mutant . Following seed sterilization and vernalization, the Arabidopsis seeds were sown on the same MS medium. After a 10 d growth period, 10 whole plants were selected from each line for RNA extraction. The concentration and quality of RNA in the selected samples were assessed using an Agilent 2100 bioanalyzer [Arabidopsis Col-0 genome (www.Arabidopsis.org) in the TAIR10 database. Expression levels of each gene were represented as FPKM values. Differentially expressed genes (DEGs) were filtered using a false discovery rate (FDR) < 0.05 and a log2 (fold) > 1 threshold [analyzer . Subsequanalyzer . Raw reahreshold . To obtahreshold . SubsequVvAGL12 gene, various tissues, including young leaves, old leaves, tendrils, young fruits, inflorescences, stems, and root tissues, were sampled from the sequenced grape variety Pinot Noir under natural conditions. Subsequently, RNA was extracted from each tissue sample to analyze the specific expression levels of the VvAGL12 gene. All RT-qPCR reactions were performed in triplicates using an ABI StepOne circulator . Target gene expression values were normalized based on the expression of the reference gene actin for grapes [To elucidate the tissue-specific expression pattern of the r grapes .Arabidopsis seedlings wild-type (WT), mutant (agl12), and overexpressed line (VvAGL12:col), and cDNA was obtained using a reverse transcription kit as a template for the validation of the differential genes detected by RNA-Seq. The actin gene of Arabidopsis was used as an internal reference and was calculated using the 2\u2212\u0394\u0394CT method [To verify the differential genes detected by RNA-Seq, RNA was extracted from T method .p < 0.05 and ** p < 0.01). Graphical representations were generated using GraphPad Prism 8.All experiments were repeated three times, and data analyses were conducted using SPSS 22. Results were presented as mean \u00b1 standard error (SE). Data analysis involved one-way ANOVA, followed by Duncan\u2019s multiple range test to assess statistical significance  was generated and introduced into leaf cells. The YFP fluorescence signal was observed using a laser confocal microscope. The results revealed the predominant expression of the YFP:: VvAGL12 fusion protein within the nucleus A, indicaVvAGL12, a tissue expression pattern analysis was performed using qRT-PCR. As depicted in VvAGL12 exhibited elevated expression levels in young leaves and inflorescences, followed by detectable expression in small fruits and roots  were co-cultivated in MS dishes to observe their phenotypes  resulted in larger leaves and increased the overall plant size. As the plants initiated the development of flower buds, the height and biomass measurements further highlighted these differences. Specifically, Vv12:col exhibited greater plant height and biomass than wild-type plants, whereas the agl12 mutant displayed reduced plant height and biomass. Importantly, overexpression of VvAGL12 in the agl12 mutant successfully rescued these phenotypic differences . Conversely, the number of seeds in each silique of the agl12 mutant was approximately 14, which was significantly lower than that of the wild-type, and there were no significant differences between Vv12:cs and the wild-type. Additionally, VvAGL12 transgenic plants (Vv12:col) exhibited larger seeds than WT plants , mutant (agl12), and Vv12:col grown on MS medium   analysis was conducted. This analysis revealed enrichment in biological processes related to the \u201cresponse to environmental stimulus\u201d , \u201coxygen-containing compound\u201d, \u201ccell wall\u201d, \u201cexternal encapsulating structure\u201d, and \u201ccell periphery\u201d  A. Among e > 0.5) B. Furtheriphery\u201d C. Notable mutant D.AGL12 serves as a pivotal factor in cell proliferation, thereby influencing the root development of Arabidopsis thaliana [VvAGL12 remain unclear. VvAGL12 is a grape homolog of the Arabidopsis AGL12 gene, which belongs to the MADS-box transcription factor family and is expressed in both the vegetative and reproductive organs  collected samples from two-year-old \u201cKyoho\u201d (Vitis vinifera \u00d7 Vitis labrusca) and \u201cThompson Seedless\u201d (Vitis vinifera) seedlings, whereas our study utilized samples from four-year-old \u201cPinot Noir\u201d (Vitis vinifera) [VvAGL12 in plant growth and development, we isolated this gene from grapes, which exhibited substantial similarity to other MADS-box members in plants  . To elucn plants . In grapn plants A.Arabidopsis, overexpression of lavender AGAMOUS-like and SEPALLATA3-like genes has been found to accelerate flowering and alter leaf morphology [OsMADS25 has been identified as a regulator of root system development, influencing auxin signaling and nitrate accumulation [AtAGL12, a gene expressed in roots, leaves, and floral meristems. It plays a pivotal role in root development by governing the transition between cell proliferation and differentiation, stem cell proliferation, and flowering [OsMADS26, a member of the AGL12 group, exhibited diverse phenotypes in different genetic backgrounds [OsMADS26 in japonica \u201cDongjin\u201d resulted in significant defects in root and shoot growth, along with stress-related phenotypes such as chlorosis, cell death, and pigment accumulation [OsMADS26 plants displayed enhanced resistance to pathogens and improved drought tolerance with minimal effects on overall plant development [Numerous studies have explored the role of MADS-box genes in plant growth and development. For instance, in rphology . In ricemulation . Notablylowering ,17. Meankgrounds ,37. For mulation . HoweverArabidopsis, VvAGL12 was introduced into wild-type and agl12 mutant Arabidopsis plants. The generated transgenic Arabidopsis lines displayed varying levels of VvAGL12 overexpression  gene encodes an extracellular protein expressed in the epidermis that functions as an \u03b1-\u03b2 hydrolase necessary for normal cuticle formation. The bdg mutant plants exhibit dwarfism, abnormal leaves, collapsed cells, and reduced trichome numbers, highlighting the role of the cuticular layer of the cell wall in growth regulation [ECS1, F8L10.6, XTH25, PER33, PER42, APSE, and BDG2) in transgenic plants likely contributed to the enhanced growth observed in these plants.To elucidate the impact of  mutants A\u2013C. Furt mutants D. Previot growth . Ca2+ ioelopment ,46,47,48l growth . Peroxidl growth . In Arabt length . The BODgulation . In thisBBX7 represses FT and CO expression, whereas BBX24 enhances FT transcription [Arabidopsis, BBX14 interacts with CO within the nucleus and its expression curtails CO-mediated FT transcription, resulting in a delayed flowering phenotype upon overexpression and an early flowering phenotype upon down-regulation [BBX7, BBX14, and BBX27 expression, coupled with a marked up-regulation of BBX24 in transgenic plants  family plays a central role in governing light signaling and plant photomorphogenesis, thereby orchestrating various cellular and developmental processes in plants ,54. The gulation . This stc plants . Prior i mutants . Here, wVvAGL12 demonstrated its capacity to expedite early flowering, enhance plant growth, and bolster production by modulating the expression of genes associated with cell-wall formation and flowering in Arabidopsis. This finding holds significant implications for gaining deeper insights into the biological functions of VvAGL12 in grapes.In summary, VvAGL12 in Arabidopsis resulted in early flowering, enhanced plant growth, and increased production. Early flowering was associated with changes in the expression of flowering genes, whereas accelerated growth and seed production were linked to variations in cell proliferation genes. These results offer valuable insights into the role of VvAGL12 in the growth and development of horticultural crops.The constant expression of"}
+{"text": "Gastrointestinal cancers comprise over 25% of new cancer cases. Surgery is the primary curative treatment. Prehabilitation before surgery aims to optimize the patient\u2019s global condition to improve postoperative recovery. These programs usually include nutritional, physical activity, and/or psychological interventions. However, the benefits remain unclear. This review summarizes the latest evidence of preoperative prehabilitation on postoperative outcomes after gastrointestinal cancer surgery and discusses new potential therapeutic targets. Preoperative interventions, combining at least nutrition and physical activity, appear to improve physical performance, muscle strength, and quality of life in patients with esophagogastric and colorectal cancers. However, there was no benefit for postoperative complications, hospital length of stay, hospital readmissions, and mortality. Further studies are needed to confirm our findings, identify surgical cancer patients more likely to benefit from prehabilitation, harmonize interventions and integrate new therapeutic strategies.The advantages of prehabilitation in surgical oncology are unclear. This systematic review aims to (1) evaluate the latest evidence of preoperative prehabilitation interventions on postoperative outcomes after gastrointestinal (GI) cancer surgery and (2) discuss new potential therapeutic targets as part of prehabilitation. Randomized controlled trials published between January 2017 and August 2022 were identified through Medline. The population of interest was oncological patients undergoing GI surgery. Trials were considered if they evaluated prehabilitation interventions , alone or combined, on postoperative outcomes. Out of 1180 records initially identified, 15 studies were retained. Evidence for the benefits of unimodal interventions was limited. Preoperative multimodal programs, including nutrition and physical activity with or without psychological support, showed improvement in postoperative physical performance, muscle strength, and quality of life in patients with esophagogastric and colorectal cancers. However, there was no benefit for postoperative complications, hospital length of stay, hospital readmissions, and mortality. No trial evaluated the impact of fecal microbiota transplantation or oral ghrelin receptor agonists. Further studies are needed to confirm our findings, identify patients who are more likely to benefit from surgical prehabilitation, and harmonize interventions. Gastrointestinal (GI) cancers refer to malignancy of the GI tract. In incidence order, the five major GI cancers are colorectal, gastric, hepatic, esophageal, and pancreatic. They represent over 25% of total cancer incidence with an overall related mortality of 35%, i.e., 5.0 million new cases and 3.5 million deaths worldwide in 2020 ,2.There is a direct relationship between GI cancers and diet. The tumor itself and cancer treatments may induce various symptoms affecting nutritional intake, such as loss of appetite, dry mouth, taste and smell alterations, swallowing problems, abdominal pain, nausea, vomiting, diarrhea, constipation, and bowel obstruction . These sMalnutrition is defined by the Global Leadership Initiative on Malnutrition (GLIM) as an association between low body mass index (BMI), reduced muscle mass or unintentional weight loss, and reduced food intake/assimilation or inflammation . The conGiven the growing burden of GI cancers and cancer-associated malnutrition, there is a significant interest in optimizing surgical management. Indeed, surgery is currently the primary curative treatment for GI cancers. About 65% of colorectal cancer patients, 20% of gastric, hepatic, and esophageal cancer patients, and 10% of pancreatic cancer patients will undergo elective surgery at some point in their cancer pathway . In thisThis article aims to (1) review systematically the latest evidence of the effects of different preoperative prehabilitation interventions  on postoperative outcomes after GI cancer surgery and, (2) discuss new potential therapeutic targets as part of prehabilitation in patients with GI cancers.This systematic review followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) 2020 guidelines .Population: adults with a malignant GI cancer  scheduled for elective surgery.\u25cbNutrition: protein supplementation, oral nutritional supplements (ONS), enteral nutrition (EN), parenteral nutrition (PN);\u25cbPhysical activity: resistance, endurance, balance, flexibility exercises;\u25cbPro- or symbiotic supplementation;\u25cbFecal microbiota transplantation;\u25cbOral ghrelin receptor agonists.Intervention: preoperative prehabilitation intervention(s), alone or combined, for a minimum of 7 days:Comparison: comparison group of no intervention, placebo, or other preoperative prehabilitation intervention(s).Outcomes: postoperative muscle mass, muscle strength, physical performance, QoL, surgical and general postoperative complications, LOS, hospital readmission and/or mortality.Randomized controlled trials (RCTs) published in the last five years (between 1 January 2017 and 5 August 2022) were considered for inclusion if they met the following criteria:Observational studies, study protocols, and reviews not in the English language were excluded. Moreover, studies were excluded if RCTs included participants with no GI malignant disease and if the intervention was perioperative or postoperative only. In addition, nutritional advice alone, nutrient supplementation other than protein, micronutrient supplementation, prebiotics, alternative medicine, and inspiratory muscle training were not considered. Finally, RCTs were not retained if their outcomes did not meet those selected in this review or were assessed only preoperatively.The authors used the MEDLINE electronic database (Pubmed) to identify eligible articles. After discussion, the following filter was determined:  AND  AND  AND  AND  AND .The MEDLINE electronic database was last consulted on 5 August 2022.Two reviewers (J.M. and A.H.) independently screened the titles and abstracts of the eligible articles. If the inclusion criteria were met, the full texts were reviewed to evaluate final inclusion in the systematic review. At each step of the study selection process, any differences were reviewed by J.M. and A.H., and a consensus decision was reached.Among the included studies, the data extraction was equally divided between the two reviewers (J.M. and A.H.). The following data were collected from each retrieved article: main population characteristics , intervention , postoperative outcomes . The reviewers also recorded the methods used to assess outcomes, main results, and limitations.The risk of bias was assessed with Version 2 of the Cochrane risk-of-bias tool for randomized trials (RoB2) . Five doThe study selection process is presented in the flow diagram . The litThe Cochrane RoB2 was used to assess the risk of bias in RCTs included in the systematic review . The fivFive recent RCTs assessed the impact of preoperative nutritional interventions on postoperative outcomes in patients with GI cancers .p = 0.048).He et al. compared a 1-week EN intervention to dietary advice alone in patients with malignant gastric cancer . Most paTo summarize, a 1-week nutritional prehabilitation had no benefits on muscle mass, muscle strength, postoperative complications, LOS, and hospital readmission rates. Amino-acid supplementation before surgery, during at least 2 weeks, may reduce LOS after hepatectomy in patients with liver cancer.Three studies assessed the effects of physical activity interventions before surgery in patients with GI cancers .2) at the ventilatory anaerobic threshold (VAT) < 11 mL/kg/min) were included. Interestingly, prehabilitation significantly reduced 30-day overall postoperative complications compared to the control group . This benefit was associated with a 10% improvement in preoperative physical performance after the 3-week program in the intervention group . However, there was no significant difference between the two groups regarding postoperative complications, LOS, and readmissions within 30 and 90 days after surgery.Berkel et al. evaluated the impact of a 3-week preoperative supervised aerobic and resistance exercise program in colorectal cancer or premalignant colorectal lesions . PatientIn two smaller studies, the results were inconclusive regarding the benefits of a 2 to 6 weeks preoperative aerobic, resistance, and respiratory exercise intervention in patients with different types and stages of GI cancers ,35. The Although exercise before elective surgery could reduce postoperative complication rates, evidence for a positive impact of preoperative physical activity intervention on postoperative outcomes is limited.Probiotics or symbiotics interventions as part of prehabilitation in colorectal and hepatic cancer patients showed discordant findings .In patients with hepatic cancer, Roussel et al. found no significant difference in all postoperative complications and mortality after two weeks of oral probiotics versus placebo .p = 0.02) and a reduced median LOS .Polakowski et al. compared a 1-week symbiotic intervention versus a placebo in patients with colorectal cancer . They foThus, few RCTs investigated the impact of preoperative probiotics/symbiotics in GI cancer patients, and the benefits remain controversial.Two RCTs assessed a bimodal intervention combining nutrition and physical activity in patients with GI cancers undergoing surgery .In patients with pancreatic cancer and cholangiocarcinoma, Ausania et al. compared a prehabilitation program, including high-intensity aerobic training and nutritional supplementation, for at least one week prior to surgery versus the standard of care . They rep < 0.001 and 15.4 \u00b1 65.6 m vs. \u221281.8 \u00b1 87.0 m; p < 0.001). Moreover, 62% of patients experienced an improvement in preoperative physical performance after prehabilitation versus 4% in the control group (p < 0.001) and 52% postoperatively versus 6%, respectively (p < 0.001). No differences were reported between groups regarding postoperative complications, LOS, hospital readmissions, and mortality.In non-metastatic esophagogastric cancer patients, home-based moderate aerobic and resistance exercises combined with whey protein supplementation showed a significant improvement in physical performance compared to usual care . After tPrehabilitation programs combining nutrition and physical activity did not appear to affect postoperative complications, LOS, hospital readmissions, and mortality in pancreatic and esophagogastric cancer patients. However, prehabilitation may improve pre- and post-operative physical performance in patients with esophagogastric malignancies.The effects of preoperative multimodal programs, including nutritional, exercise, and psychological interventions, have been tested in patients with esophagogastric and colorectal cancers .p = 0.009). In addition, the global QoL score was better in prehabilitation subjects than controls after two weeks (p = 0.001), six weeks (p = 0.001) and six months (p = 0.003) post-surgery. Interestingly, the authors also demonstrated that prehabilitation was associated with better preservation of skeletal muscle index after neoadjuvant treatments , and VO2 peak . However, these outcomes were not assessed postoperatively.In patients with locally advanced esophagogastric cancer, a 15-week multimodal prehabilitation program helped maintain postoperative muscle strength and QoL . Before Carli et al. were interested in the impact of a 4-week aerobic, resistance, and flexibility training in addition to whey protein supplementation and personalized coping strategies . Frail p2 at VAT, with no difference between groups . Two months after surgery, the high-intensity interval training group had better physical fitness than the moderate-intensity interval training group .Finally, Minnella et al. compared two different exercise training protocols as part of a multimodal prehabilitation program . PatientMultimodal prehabilitation in patients with locally advanced esophagogastric or colorectal cancer could improve postoperative muscle strength, physical performance, and QoL. Nevertheless, recent RCTs failed to demonstrate its benefits on postoperative complications, LOS, hospital readmissions, and mortality.This systematic review synthesizes the results of RCTs on the impact of surgical prehabilitation on different postoperative outcomes in patients with GI cancers over the past five years. Study populations and intervention modalities were heterogeneous, and most RCTs were with some concerns or at high risk of bias. Thus, the results of our systematic review should be considered with caution. Evidence for the benefits of unimodal nutritional, physical activity, or probiotics/symbiotics interventions is limited and discordant. Multimodal programs, which combined nutrition and physical activity with or without psychological support, showed improvement in postoperative physical performance, muscle strength, and QoL in patients with esophagogastric and colorectal cancers. However, there was no benefit for postoperative complications, LOS, hospital readmissions, and mortality. Finally, no RCT evaluated the impact of fecal microbiota transplantation or oral ghrelin receptor agonists as preoperative interventions. This raises several questions regarding population, type of prehabilitation programs, and outcome assessments.Firstly, nutritional status was not systematically assessed before interventions, and screening tools were inconsistent. When the information was provided, only a few patients were at risk of malnutrition or malnourished. However, the European Society for Clinical Nutrition and Metabolism (ESPEN) recommends screening of malnutrition risk for all patients within 48 h after hospital admission. In addition, preoperative nutritional intervention is indicated for patients at high risk of malnutrition or malnourished ,44. A reCurrently, there is no clear consensus regarding the modalities of prehabilitation programs before GI cancer surgery. The high heterogeneity of interventions in this review illustrates this issue. Regarding nutrition, ERAS, and ESPEN guidelines suggests nutritional support for 7\u201314 days in patients not meeting preoperative energy needs ,53. DespPrehabilitation interventions are limited by the patient\u2019s context. A proven correlation exists between poor lifestyle habits and the most common GI cancers . Added tFusobacterium nucleatum is abundant in colorectal cancer patients with recurrence after chemotherapy and is associated with resistance to treatment [Atopobium vaginae, Selenomonas sputigena, and Faecalibacterium prausnitzii, have been identified as diagnostic biomarkers of malnutrition and poor prognosis in colorectal cancer [Clostridium butyricum may have great potential for improving the nutritional status of malnourished patients [Inconclusive results of RCTs evaluating surgical prehabilitation programs in GI cancers could also be explained by the multifactorial origin of malnutrition in cancer patients . Thereforeatment . Other ml cancer , whereaspatients . Concernpatients . Neverthpatients . Regardipatients . Finallypatients ,68,69. Dpatients ,25. Currpatients .Our systematic review presents several strengths. Two reviewers independently screened titles and abstracts of the eligible articles, and only RCTs were included. It provides the latest evidence on surgical prehabilitation in patients with GI cancers and integrates potential new therapeutic strategies. However, there are some limitations. Firstly, the population was heterogeneous across the different RCTs. All GI cancers, despite nutritional status, tumor stage and location, different resections, and surgical approaches, with or without preoperative neoadjuvant therapy, were considered. Secondly, a large variety of interventions and outcome assessment methods were included. Thirdly, there is a lack of data on patient adherence which may affect the effects of the interventions. Furthermore, RCTs generally compared an intervention group to a control group, receiving nutritional and/or physical activity advice . Consequently, the results might have been affected as the control group could be considered \u201cpartially prehabilitated\u201d. Finally, information about the postoperative nutritional and physical management of patients included in the different studies was sparsely reported.In the absence of consensus for prehabilitation in GI cancer surgery, we suggest considering the following parameters when designing and conducting future studies .Current evidence of the impact of unimodal prehabilitation on postoperative outcomes in GI cancer surgery remains unclear. However, postoperative physical performance, muscle strength, and QoL could be improved with surgical multimodal prehabilitation in patients with esophagogastric and colorectal cancers. Further studies are needed to confirm our findings, identify surgical cancer patients more likely to benefit from prehabilitation, harmonize interventions, and integrate new therapeutic strategies."
\ No newline at end of file