diff --git "a/deduped/dedup_0386.jsonl" "b/deduped/dedup_0386.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0386.jsonl"
@@ -0,0 +1,38 @@
+{"text": "Hack and Helmy's method for the histochemical identification of NAD(P)H nitroblue tetrazolium reductase activity was employed to pinpoint reductase activity in certain cells in the mouse. High activity was observed in the following: lower airway epithelium, liver (centrilobular zone), eyelid (meibomian and sebaceous glands), vulval gland and parotid gland . All of these cells had previously been identified as sites of binding of the reactive metabolites formed from the enzymic reduction of misonidazole (MISO) . It had previously been thought that MISO binding would only take place in significant amounts in hypoxic tissues (tumour and possibly liver) since in normoxic tissues oxygen should reverse the initial one electron enzymic reduction, thus preventing progressive reduction to reactive species. We suggest that the very high levels of reductase in the above listed, probably normoxic, tissues contribute significantly to the accumulation of bound reactive MISO metabolite(s)."}
+{"text": "Cerebrovascular manifestations are uncommon presentations of scorpion sting in the Indian subcontinent. A prospective study was carried out on 42 patients with scorpion sting in the intensive care unit (ICU) of the Institute of Medical Sciences, Banaras Hindu University, Varanasi-05, INDIA, during the period of May 2005 to October 2007. In all the patients detailed history, physical examination with a specific neurological examination and routine biochemical testing and fundus examination were done. Computerized tomography and magnetic resonance imaging were done in cases with neurological deficit. All these patients also underwent a complete hematological, rheumatologic and cardiovascular work-up for stroke. Cerebrovascular involvement was noted in three patients (7.15%). Hemorrhagic stroke was noted in two patients (4.77%) and thrombotic stroke was noted in one patient (2.39%). The mean time of presentation of neurological symptoms was 3 days. Contrary to world literature, there have been no reports of cranial nerve palsies or neuromuscular involvement in our series. Scorpion sting is an acute life-threatening, time-limiting medical emergency more commonly seen in villagers. Among thDuring the period of May 2005 to October 2007, a prospective study was done in patients with scorpion sting admitted to the intensive care unit of the Institute of Medical Sciences, Banaras Hindu University, Varanasi-05, INDIA. The diagnosis was based on positive history of scorpion sting, with scorpion being seen or killed by relatives or bystanders.In all the patients history, physical examination with a specific neurological examination and routine biochemical testing and fundus examination to specifically look for changes in the retinal vessels due to longstanding hypertension were done. Vitals were recorded on arrival and thereafter at one hourly interval. Electrocardiogram (ECG) was recorded to detect any evidence of scorpion sting induced myocarditis and to detect any evidence of left ventricular hypertrophy due to longstanding hypertension.Cases with neurological deficit were included in the further work-up. Computerized tomography and magnetic resonance imaging were done in cases with neurological deficit. All these patients also underwent a complete hematological work up in the form of complete blood count, hematocrit, peripheral smear, platelet count, coagulation profile, fibrin degradation products, serum homocysteine, rheumatological work-up of antinuclear antibody and cardiovascular work-up of lipid profile, transthoracic echocardiogram and carotid doppler. All these investigations were done at the time of admission.Out of the total of 42 patients with documented scorpion sting, focal neurological deficit was noted in three patients (7.15%). The commonest presentation of neurological deficit was hemiparesis, observed in all three cases. All the three patients were males. Their mean age was 35 years (range from 18 to 49 years). Hemorrhagic stroke was noted in two patients (4.77%) and thrombotic stroke was noted in one patient (2.39%). Among the patients with hemorrhagic stroke, one patient had an intraventricular hemorrhage, while one patient had hemorrhage in the putamen. The patient with thrombotic stroke had involvement of the middle cerebral artery (MCA) territory - due to disseminated intravascular coagulation (DIC). Patient with DIC producing a thrombotic stroke presented at 3 days after the scorpion sting, while patients with hemorrhagic stroke presented within 48 h of the scorpion sting. Patient with thrombotic stroke due to DIC had documented defibrination. All the three patients had a normal carotid doppler and a normal transthoracic echocardiogram with no evidence of left ventricular hypertrophy. All the patients with stroke had no evidence of myocarditis or pulmonary edema on clinical examination or echocardiogram. One patient with intralobar hemorrhage died on the fifth day of sting due to raised intracranial tension and coning. The other two patients did exceedingly well and recovered within a period of 3 months.Prazosin was initiated in all the three patients with scorpion sting. Patients with stroke, both thrombotic and hemorrhagic, were managed conservatively with prazosin and supportive measures.Scorpion venoms are species-specific complex mixtures of short neurotoxic proteins. Alpha-reet al. reported a case of scorpion sting induced multiple cerebral infarcts with optic neuropathy.[Our two patients with hemorrhagic stroke had an acute rise in blood pressure - of around 260/130 mm of Hg - at the time of admission due to autonomic storm, which would explain the hemorrhage inside the brain. By the use of carotid doppler, echocardiogram, electrocardiogram, lipid profile, we excluded patients with longstanding hypertension, which would have caused stroke in these patients. The other patient with thrombotic stroke due to DIC could be explained based on the toxin-induced alteration in the coagulation system inducing a defibrination syndrome. There hauropathy.There have been a number of limitations in our study as vasospasm could not be proved by angiography. Protein C, Protein S and antithrombin III estimation was not done in thrombotic stroke in view of the fact that the deficiency of Protein C, Protein S and anti thrombin III usually produce venous infarcts rather than arterial infarcts, as in our series. Transesophageal echocardiogram was not done in our cases, which would have picked up thrombus in the heart missed by transthoracic echocardiogram. But it would be a highly unlikely event to expect thrombus in a patient with a well-contracting myocardium with no evidence of hypertrophy or dilatation of heart chambers.Cerebrovascular manifestations were seen in three (7.15%) patients. Treatment with prazosin, if initiated early, may prevent many cerebrovascular manifestations of scorpion sting."}
+{"text": "Mycoplasma pneumoniae, Chlamydia pneumoniae, and adult rheumatic fever, which may be mistakenly called CFS. CFS patients were treated with valacyclovir (14.3 mg/kg q6h) for \u226512 months. Each patient improved, based upon the Functional Activity Appraisal: Energy Index Score Healthcare Worker Assessment (EIPS), which is a validated (FSS-9), item scale with high degree of internal consistency measured by Cronbach's alpha.A defined diagnostic panel differentiated patients who had been diagnosed with chronic fatigue syndrome (CFS), based upon Fukuda/Carruthers criteria. This diagnostic panel identified an Epstein-Barr virus (EBV) subset of patients (6), excluding for the first time other similar \u201cclinical\u201d conditions such as cytomegalovirus (CMV), human herpesvirus 6 (HHV6), babesiosis, ehrlichiosis, borreliosis, Antibody to EBV viral capsid antigen (VCA) IgM, EBV Diffuse Early Antigen EA(D), and neutralizing antibodies against EBV-encoded DNA polymerase and EBV-encoded dUTPase were assayed serially approximately every three months for 13\u201316 months from sera obtained from patients with CFS (6) and from sera obtained from twenty patients who had no history of CFS.Antibodies to EBV EA(D) and neutralizing antibodies against the encoded-proteins EBV DNA polymerase and deoxyuridine triphosphate nucleotidohydrolase (dUTPase) were present in the EBV subset CFS patients. Of the sera samples obtained from patients with CFS 93.9% were positive for EA(D), while 31.6% of the control patients were positive for EBV EA(D). Serum samples were positive for neutralizing antibodies against the EBV-encoded dUTPase  and DNA polymerase  in EBV subset CFS patients, but negative in sera of controls.There is prolonged elevated antibody level against the encoded proteins EBV dUTPase and EBV DNA polymerase in a subset of CFS patients, suggesting that this antibody panel could be used to identify these patients, if these preliminary findings are corroborated by studies with a larger number of EBV subset CFS patients. Borrelia burgdorferi, Anaplasma phagocytophilia, Babesia microti: Mycoplasma pneumoniae: Chlamydia pneumoniae infection or adult rheumatic fever. One hundred and six group A CFS patients were followed in this systematic review from this center (2001 \u2013 2007), and treated for \u226512 months with subset directed valacyclovir, for EBV subset, or valganciclovir, for HCMV and HHV6 subsets One major problem for investigators studying CFS is the heterogeneity of the population united by common life-altering symptoms without scientific laboratory confirmation. With Fukuda/Carruthers criteria and a systematic review of 142 chronic fatigue syndrome (CFS) patients An evidence-based test for the diagnosis of CFS remains elusive. Glaser, Williams and Lerner hypothesize CFS may be related to abortive lytic replication of EBV in the absence of a DNAemia, or IgM antibody to virus structural protein Valacyclovir and valganciclovir are phosphorylated to the triphosphate derivatives by virus encoded thymidine kinases/phosphotransferases as well as cellular enzymes, where they act as alternative substrates for the herpesviruses encoded DNA polymerases and inhibit viral DNA replication by preventing DNA chain elongation. Since valacyclovir and valganciclovir do not inhibit the synthesis of early herpesvirus proteins, thus inducing a type of abortive-lytic replication, we suggested that new herpesvirus host cell recruitment is interrupted in the CFS patients treated with valacyclovir/valganciclovir who recovered their health The EBV encoded early viral proteins, dUTPase and DNA polymerase are enzymes involved in EBV lytic DNA replication. We now report the significant repetitive presence of positive serum antibodies to the EBV encoded dUTPase and DNA polymerase in 6 Group A EBV subset CFS patients This study was approved by the Human Investigation Committee of William Beaumont Hospital. The requirement for consent was waived by the IRB/ethics committee because samples were archived and patient identification was not made.Borrelia burgdorferi Borrelia burgdorferi. CFS patients were receiving valacyclovir. CFS patients' numbers 1,2,3,4 and 6 had negative ELISA CMV IgG serum titers. CFS patient number 5's initial serum CMV IgG titer was 71. CMV IgM titers were negative in all patients The six CFS patients were identified as; Group A EBV subset (five patients), and Group B (one patient) who was co-infected with Blood samples were taken (6/28/11) from unknown persons having health related studies at a commercial laboratory. Age and sex of the comparison group were selected to be similar to the CFS group.The p18 peptide is a defined VCA-specific marker protein utilized in the ETI-EBV-M reverse assay . It consists of 56 amino acids of BFRF encoded VCA and contains immunodominant epitopes. The ETI-EBV-M reverse kit utilizes the enzyme-linked immunosorbent assay (ELISA) based on the antibody capture technique. The absorbance of the solution measured at 450nm is related to the concentration of IgM to EBV VCA present in the reaction solution The ETI-EA-G kit (DiaSorin) for quantitative detection of IgG antibodies to the EBV EBV-EA(D) was used. Diluted serum was incubated with recombinant EA(D) peptide bound to the solid surface of a micro titer well. The ETI-EA-G assay uses an EA(D) 47 KD recombinant polypeptide. The absorbance of the solution, measured at 450 nm is proportional to the concentration of IgG antibodies to EBV EA(D) present in the reaction solution ELISA testing for CMV IgG and CMV IgM was performed using ELISA kits from DiaSorin. The CMV IgG kit contains purified CMV strain AD-169 antigen-coated wells. The CMV IgM ELISA is a microcapture assay with wells coated with anti-human IgM antibody to the same strain AD-169. Sera were diluted 1\u223610 and incubated for one hour at 37\u00b0C. The wells were washed three times in washing buffer and bound HRP label was detected with 3,3\u2032 5.5 tetramethyl benzidine as substrate for 30 minutes in the dark, after which the color reaction was stopped by the addition of stop solution as recommended by the manufacturer's manual. The absorbance was measured at 450/650 nm using Biotech reader  6\u20138) were harvested, resuspended in 1 ml of extraction buffer  glycerol, lysed by sonication and centrifuged at 14,000\u00d7g for 5 min. The resulting supernatant was employed for the EBV-encoded DNA polymerase assay. Purified EBV-encode dUTPase was obtained as we have described Briefly, 5 \u00b5l of human serum were mixed with 5 \u00b5l of either purified EBV-encoded dUTPase (3\u20135 units of enzyme) or an extract from TPA/sodium butyrate induced Raji cells (for EBV-encoded DNA polymerase) for 30 min at room temperature prior to assaying for enzymatic activity. EBV-encoded DNA polymerase and dUTPase activity were determined as described previously control \u2013 Userum). Serum with neutralizing units greater than or equal to two standard deviations from the control were considered \u201cpositive\u201d for dUTPase or DNA polymerase neutralizing antibodies. Quantitative titers of antibody to EBV dUTPase and EBV DNA polymerase were assayed.For positive controls, assays were performed in the presence of human serum that lacks detectable antibody to the EBV encoded dUTPase and DNA polymerase; negative controls were also performed in the absence of the enzyme preparation. A unit of EBV-encoded dUTPase activity was defined as the amount of enzyme required to convert 1nmole of dUTPase to dUMP and pyropohosphate/min/ml of enzyme at 37 C The following tests were performed by LabCorp  on the 6 CFS patients  in order to determine if the subjects were co-infected with other infectious agents B. burgdorferi strain B31, resolved by polyacrylamide gel electrophoresis into individual antigen bands and then transferred to nitrocellulose strips for blotting.Antigen \u2013 whole-cell proteins were extracted from Babesia microti organisms and then fixed onto microscope slides. Upon interaction with human sera containing anti-Babesia antibodies and the appropriate conjugate, infected cells fluoresce.Method \u2013 IFA. Antigen \u2013 the substrate for the IFA was guinea pig or hamster erythrocytes infected with Method: IFA. Antigen: is either inactivated HGE or HME.Mycoplasma pneumoniae FH antigen.Method: EIA. Antigen: Method: Latex immunoturbidimetry. Human Antistreptolysin 0 antibodies agglutinate with latex particles coated with streptolysin 0 antigens. The precipate is determined turbidimetrically at 552 nm.Blood test results for EA(D), dUTPase, and DNA polymerase were scored as \u201cpositive\u201d or \u201cnegative\u201d. For each test, two comparisons were completed; 1) the CFS patient group's initial (baseline) test scores were compared to the control group's scores, and 2) the CFS patient group's last recorded test score  were compared to the control group's scores. No analysis was conducted for the VCA, IGM measure as all scores were negative.Fisher's exact test was used to compare the two groups. A Bonferroni adjustment for multiple statistical tests determined the appropriate alpha level for a two-tailed test to be p<0.01.Borrelia burgdorferi (patient no. 2). Initial EIPS values were 3.5 \u2013 5.0, meaning that patients could be out of bed only 3 to 4 hours a day, and required daily naps to complete each day. One CFS patient was able to struggle to complete a sedentary working day. This male member of the CFS group did not meet criteria for CFS at baseline . He struggled at baseline to maintain his sedentary working day, required a daytime nap, and could no longer do any exercise without marked syncope and worsening fatigue. One year later the final EIPS values were 7 \u2013 8, for the 5 Group A CFS patients, meaning that patients could now live normal lives. The single Group B CFS patient's final EIPS value increased from a baseline of 3.5 to 5, but this woman still met international criteria diagnosis of CFS The six patients (5 women) with CFS were EBV subset of CFS patients, with 5 patients in the Group A subset and one patient (#2) in Group B. CFS patients were 37 \u2013 59 years of age. Serum samples were taken at intervals during valacyclovir therapy from 3/5/02 to 11/14/03. There were 7 to 10 sera samples from each of the 6 CFS patients. Five of the 6 CFS patients were Group A (no co-infections); one patient had a co-infection with The mean age of the comparison group was 48.7 years (36 \u2013 59). Fifteen of 19 (78.9%) persons were women.VCA IgM titers were performed on 49 sera from CFS subjects, as well as the twenty comparison samples. All were negative. The presence of a positive serum EBV VCA IgM indicates lytic virus replication. Approximately 15% of EBV subset CFS patients have positive serum EBV VCA IgM titers Forty-nine EA(D) serum samples from patients with CFS were examined for antibodies against EA (D). All were positive except for three serum samples obtained from CFS patient number 6. Mean EBV, EA(D) titers (by patient) were: 54 (patient 1); 123 (patient 2); 63 (patient 3); 128 (patient 4); 49 (patient 5); and 27 (patient 6), negative < 20. EBV, EA(D) positive; mean cumulative antibody titers of the 6 patients was 74. Conversely, only 6 of the sera samples of the nineteen tested from the comparison group were positive (31.6%) for antibody against EA (D) with a cumulative mean of 22. The significance of difference in presence of encoded proteins EBV, EA (D) between EBV subset patients and controls according to first sera tests by Fisher's Exact test  is 0.0109, considered significant. There was a significant row and column association (p\u200a=\u200a0.01) for both the first and last CFS patient values of the series for the occurrence of the EBV, EA(D) when compared to the comparison group values. Therefore, the occurrence of EBV EA(D) serum antibody is a significant difference between EBV subset CFS and controls.Quantitative assays to determine the units of EBV-encoded dUTPase neutralized/ml of serum demonstrated a mean of 5 units neutralized/ml of serum from patients with CFS compared to 2 units neutralized/ml of serum from controls. Three of 10 (30%), CFS (patient 1); 5 of 7 (71.4%) CFS (patient 2); 3 of 10 (30%) CFS (patient 3); 8 of 10 (80%) CFS (patient 4); 3 of 8 (37.5%) CFS (patient 5); 1 of 7 (14%) CFS (patient 6) were positive for elevated serum antibody levels to EBV dUTPase. Twenty-three of the 52 (44%) serum samples were positive for neutralizing antibody against the EBV dUTPase.Fisher exact tests were done for first sera compared to that of the comparison group as well as for the last sera compared to the comparison/control group. The difference between the last CFS patient measure and the control group values did not quite achieve statistical significance (p\u200a=\u200a0.074). For the first EBV dUTPase assay, the p value is significant (p<0.01). .Quantitative assays to determine the units of EBV-encoded DNA polymerase neutralized/ml of serum demonstrated that a mean of 60 units neutralized/ml of serum from patients with CFS compared to 16 units neutralized/ml of serum from controls. Eight of 10 serum samples (80%) of CFS (patient 1); 4 of 7 (57.1%) CFS (patient 2); 7 of 10 (70%) CFS (patient 3); 9 of 10 (90%) CFS (patient 4); 7 of 8 (88%) CFS (patient 5); and 6 of 7 (85.7%) (patient 6) had antibody titers to EBV encoded DNA polymerase. Forty-one of the 52 (78.8%) CFS samples from CFS patients were positive for antibodies against the EBV-encoded DNA polymerase. For both the first and last recorded values, the differences for EBV DNA polymerase tests between CFS patients and controls are significant (p<0.01 for both comparisons). .As shown in The EBV, a DNA human tumor virus, encodes for six viral enzymes that are part of the early antigen (EA) complex. These proteins are synthesized prior to EBV DNA replication. Such proteins are classified as early proteins in vitro cell system that is fully permissive for EBV lytic infection. However, it is well documented that antibodies to various EBV encoded proteins, which are involved with lytic replication of the virus, are produced during EBV infections. Antibodies to EBV encoded proteins occur in patients with IM, Burkitt lymphoma (BL), NPC and CFS and the presence of these antibodies have clinical significance NPC patients may also make antibody to the EBV TK in vitro as demonstrated by its effect on the replication of PBMCS and the production of several different proinflammatory cytokines including IL-1\u03b2, TNF-\u03b1, IL-6, IL-8 and IL-10 It was proposed that one or more of the EBV early proteins, which are synthesized after the latent virus is reactivated, alone or in combination with other EBV-encoded (or other latent herpesvirus encoded) proteins could play a role in the pathophysiology of EBV-associated disease In this study we demonstrate that there is a statistically significant increase in antibody levels to EBV EA-D complex, EBV-encoded dUTPase and EBV-encoded DNA polymerase in repetitive longitudinal serum samples obtained from six CFS Group A EBV subset patients studied over a consecutive period of 13\u201316 months who were treated with valacyclovir when compared to a control group. Particularly antibodies to the EBV-encoded protein DNA polymerase here separate the EBV subset CFS patients from the comparison group patients. The CFS EBV subset patients identified in this study are a distinct laboratory based group whose identification was made possible for the first time by the development of a unique diagnostic panel, which selected the study patients. Other previous CFS studies did not have available this diagnostic panel In a double-blinded placebo-controlled study Fluge, et al We note that we"}
+{"text": "A modified BioBrick\u2122 assembly method was developed with higher fidelity than current protocols. The method utilizes a PCR reaction with a standard primer set to amplify the inserted part. Background colonies are reduced by a combination of dephosphorylation and digestion with DpnI restriction endonuclease to reduce vector and insert background respectively. The molar ratio of the insert to vector in the ligation was also optimized, with the accuracy of the transformed construct approaching 100%. The methods used for controlled modification of genetic material have experienced several major improvements since the initial development of recombinant DNA techniques in the early 1970s . While tThe original method used to perform \"bio-bricking\" is called the standard assembly method. In using this method, one part is designated the insert and is digested out of its plasmid using enzymes EcoRI and SpeI or XbaI and PstI . The othTo address many of these problems, the three antibiotic 3A) assembly method was developed . This meA assemblWe proposed and critically tested an alternate BioBrick assembly method called Amplified Insert Assembly to eliminate many of these problems. This method combines the functional simplicity of the standard assembly method with the ease and flexibility of 3A Assembly and is compatible with any BioBrick standard in which the restriction endonucleases are able to be heat inactivated. It is based on the original standard assembly method in that it uses a double ligation to insert one part, designated the \"insert\", adjacent to another part that remains in its plasmid, and thus is the designated \"vector\". The need for gel electrophoresis is eliminated because the insert is amplified from its original plasmid using high-fidelity PCR, and background transformation is eliminated by simple enzymatic treatments. Very small parts can also be assembled with ease because this PCR step adds sufficient length to allow purification using a DNA binding column. While these combined treatments eliminate the need for gel electrophoresis and enable the assembly of small parts, they also substantially decrease the required starting quantity of DNA, generally making use of the BioBrick repository more affordable and versatile.Several aspects of the amplified insert (AI) assembly protocol will be familiar to those using standard cloning techniques, as they are very similar to the processes involved in typical cloning of DNA . This neThe protocol for utilizing the AI assembly method is simple and fast. First, the plasmid DNA for both parts is purified from an overnight culture. The insert DNA is then amplified from its plasmid using 25 cycles of high-fidelity PCR. This amplification uses standard primers that anneal to all BioBrick plasmids and eliminate the need to order custom oligos for each assembly, as required by other PCR based assembly methods -22. WhilE. coli are positive for Dam methyltransferase which specifically methylates this GATC site [lacZ \u03b1 fragment [mRFP[The high accuracy of this assembly is enabled by the use of DpnI restriction endonuclease to eliminate insert background and Antarctic Phosphatase to eliminate vector background. This additional processing is an enzymatic substitute for the mechanical separation of gel electrophoresis, and can be performed concurrently to the restriction digest without requiring any additional time. DpnI restriction endonuclease is a frequent blunt cutter (recognition site GATC) but only cuts sites with a methylated adenine residue . Many clATC site , making fragment  and mRFPent [mRFP, allowinent [mRFP. As a coThe results of these tests are summarized in Table Based on these results shown in Table These results show that the amplified insert assembly method preserves the functional simplicity (and therefore accuracy) of the original standard assembly method while possessing several positive characteristics of 3A assembly, including the elimination of gel electrophoresis and the ability to assemble small parts. While the PCR step can sometimes add up to two hours to the total assembly time, the total time from cultures to plating is usually under six hours, and the hands-on time is only slightly increased when compared to 3A assembly. Furthermore, because this protocol allows the amplification of insert from a small amount of DNA, plasmid preps of common parts  can be kept as a stock and used repeatedly as insert template. If the PCR is performed in advance from a plasmid stock, the total time required for AI assembly is four hours. A comparison of the various BioBricking methods can be found in Table Because this procedure uses PCR to amplify the insert, there is an inherent risk of causing mutations in the part sequence. To mitigate this risk a few steps should always be taken: 1) a high fidelity polymerase should always be used; 2) the number of PCR cycles should be kept at or below 30; and 3) the final construct should always be sequenced to detect any mutations. It also occasionally happens that PCR can unexpectedly fail for a number of reasons, but because our reaction uses the same polymerase and primers for each assembly, the use of a standard 2\u00d7 stock can drastically reduce the user error involved in the amplification process. Despite these risks we have yet to observe a mutated plasmid in over 100 successful sequenced assemblies, and have found this method to be a quick, effective, and reliable way to perform all types of BioBrick assembly.E. coli strain DH5\u03b1 was grown in SOB liquid medium [http://partsregistry.org/Main_Page, and a list of the parts and plasmids used is provided in Table For all experiments d medium  suppleme\u00ae DNA Polymerase  and run according to the suppliers protocol (2011) in 1\u00d7 Thermopol Buffer (2 mM Mg2+) for 25 cycles @72\u00b0C). Primers VF2 (tgccacctgacgtctaagaa) and VR (attaccgcctttgagtgagc) were used that flank the restriction sites by approximately 125 bp and have a Tm of 60\u00b0C. PCR cleanups were performed using the E.Z.N.A. Cycle-Pure Kit .Parts were amplified via PCR using the high fidelity VentAll digests were performed in 50 \u03bcl volumes containing 1x NEBuffer 2  and either 0.5 pmol of purified PCR product or 0.25 pmol of purified plasmid. Twenty units of each enzyme were used for the digests, except for SpeI and Antarctic Phosphatase which were used in 10 unit and 5 unit quantities respectively. Digests were performed according to the following scheme:To place the insert part in 5' of the vector part. The vector was digested with EcoRI and XbaI for two hours (while the insert PCR was taking place) and then treated with Antarctic Phosphatase (supplemented with the specified buffer) for one hour while the purified insert was digested with DpnI, EcoRI, and SpeI;To place the insert 3'of the vector part. The vector was digested with SpeI and PstI for two hours (while the insert PCR was taking place) and then treated with Antarctic Phosphatase (supplemented with the specified buffer) for one hour while the insert was digested with DpnI, XbaI, and PstI.All digests were heat inactivated for 20 min at 80\u00b0C. All enzymes were purchased from New England BioLabs .Ligations were performed in 20 \u03bcl volumes using T4 Ligase  according to the manufacturers protocol (2011) for sticky ends. A total of 6 \u03bcl of unpurified digests was used for each ligation, with the molar ratios varied from 1:1 to 4:1 (insert:vector).\u00ae High-Fidelity DNA Polymerase . Phusion\u00ae was used here because it has high processivity (4 kb/minute), a higher fidelity than Vent\u00ae, and works well for large parts or, in this case, a 2.5 kb plasmid backbone. However, because of its high processivity Phusion\u00ae is not ideal for the amplification of small parts, which is why Vent\u00ae was used elsewhere. Primers which bind in the BioBrick sites and have a Tm of 61\u00b0C were used for 35 cycles according to the manufacturer's (2011) specifications. Constructs were purified using the E.Z.N.A. Cycle-Pure Kit and used immediately.The backbone of the plasmid pSB1C3 was amplified and linearized via PCR using Phusion0.25 pmol of DNA were used for all 50 \u03bcl digests. The prefix parts were digested with EcoRI and SpeI and the suffix parts were digested with XbaI and PstI. The linear construct plasmid was digested with EcoRI and PstI and also supplemented with DpnI and Antarctic Phosphatase to eliminate background as described above. During the phosphatase step, vector digests were supplemented with 6 \u03bcl of Antarctic Phosphatase buffer. All reactions were heat inactivated for 20 min at 80\u00b0C after three hours of digestion.2 \u03bcl of each digest  was added to the ligation mix as described above. The ligations were done in duplicate with one ligation being transformed in its unpurified state, while the other ligation was purified using an E.Z.N.A MicroElute Cycle-Pure Kit  and concentrated in a volume of 5 \u03bcl, which was used in its entirety to transform cells.7 cfu/\u03bcg DNA) and transformed using an Eppendorf 2510 electroporator  at 15,000 V/cm. Transformed cells were diluted into 900 \u03bcl prewarmed SOC medium [lacZ\u03b1 (without a promoter), as well as the mRFP driver were also tested to ensure that they did not produce a false positive for the X-gal screen.5 \u03bcl of ligation product was added to 100 \u03bcl DH5\u03b1 competent cells (1 \u00d7 10C medium  and let RBS: ribosome binding site; ORF: open reading frame; mRFP: monomeric red fluorescent protein; PCR: polymerase chain reaction; SOB super optimal broth; bp: base pairs.The authors declare that they have no competing interests.MAS conceived of and developed the idea of using amplified insert assembly for standard assembly of BioBrick parts. MAS and TLR designed the experiments and drafted the manuscript. Both authors read and approved the final manuscript.MAS is a Ph.D. candidate, graduate research assistant, and mentor for the Penn State iGEM team. TLR is a professor of agricultural and biological engineering and director of the Penn State Institutes of Energy and the Environment, a past-president and Fellow of the Institute of Biological Engineering, and also a mentor of the Penn State iGEM team.Gene Sequences. This file contains the gene sequences of the parts used as well as the final constructs created by assembly.Click here for file"}
+{"text": "Acid sphingomyelinase is involved in lipid signalling pathways and regulation of apoptosis by the generation of ceramide and plays an important role during the host response to infectious stimuli. It thus has the potential to be used as a novel diagnostic marker in the management of critically ill patients. The objective of our study was to evaluate acid sphingomyelinase serum activity (ASM) as a diagnostic and prognostic marker in a mixed intensive care unit population before, during, and after systemic inflammation.plus a significant procalcitonin [PCT] increase) were included. ASM was analysed on ICU admission, before (before)PCT, during (peakPCT) and after (low)PCT onset of SIRS. Patients undergoing elective surgery served as control (N\u200a=\u200a8). Receiver-operating characteristics curves were computed.40 patients admitted to the intensive care unit at risk for developing systemic inflammation (defined as systemic inflammatory response syndrome beforePCT was not different, but further increased at peakPCT in non-survivors and was significantly higher at lowPCT compared to survivors. Survivors exhibited decreased ASM at peakPCT and lowPCT. Receiver operating curve analysis on discrimination of ICU mortality showed an area under the curve of 0.79 for ASM at lowPCT.ASM significantly increased after surgery in the eight control patients. Patients from the intensive care unit had significantly higher ASM on admission than control patients after surgery. 19 out of 40 patients admitted to the intensive care unit developed systemic inflammation and 21 did not, with no differences in ASM between these two groups on admission. In patients with SIRS and PCT peak, ASM between admission and In summary, ASM was generally higher in patients admitted to the intensive care unit compared to patients undergoing uncomplicated surgery. ASM did not indicate onset of systemic inflammation. In contrast to PCT however, it remained high in non-surviving ICU patients after systemic inflammation. Despite advances in critical care, systemic inflammatory response syndrome (SIRS) and sepsis syndrome with subsequent multi-organ failure still contribute to overall mortality in critically ill patients, equalling the number of deaths caused by acute myocardial infarction At present, procalcitonin (PCT) is regarded as the best available laboratory tool for the diagnosis of infection and systemic inflammation in combination with clinical symptoms Activation of acid sphingomyelinase, a C-type phosphodiesterase leads to generation of ceramide from biological inert sphingomyelin derived from the cell membrane. Generation of ceramide at the outer leaflet of cell membranes induces changes in composition and spatial arrangement in terms of forming ceramide-enriched membrane lipid rafts, leading to receptor clustering and apoptosis signalling and modification of the cellular response to stress stimuli This single-center prospective cohort study was conducted in two surgical intensive care units of a tertiary medical center  with the approval of the local ethics committee of the Christian-Albrechts University Kiel, Germany. Written informed consent was obtained from each patient or the legal representative, respectively.plus an increase in PCT. This PCT peak was defined as a two-fold increase in PCT concentration compared to the value of the preceding day and exceeding a minimum of >2 ng/ml. Exclusion criteria were diseases associated with hyperprocalcitoninaemia like small-cell lung cancer or C-cell carcinoma and administration of PCT inducing agents (Anti-Thymocyte globulin or OKT3 antibodies). Events with PCT elevations following re-operation during the ICU stay and patients receiving ASM inhibiting medications  were also excluded beforePCT), III), the first day of new onset of SIRS and a PCT peak (peakPCT), and IV), on the first day when the PCT level was below 0.5 ng/ml or declined to a nadir with less than 30% of the peakPCT concentration (lowPCT).We prospectively included patients (age\u226518 years) who were admitted to the ICU and deemed to be at high risk for the development of systemic inflammation (ICU group). High risk criteria were defined as the following ICU admission diagnoses: extended surgery, polytrauma, respiratory insufficiency, and patients with an expected length of ICU stay >3 days. Patients were evaluated on a daily basis for new onset of systemic inflammatory response syndrome (SIRS) fulfilling two or more of the defined clinical criteria according to the ACCP/SCCM recommendations beforePCT until patients\u2019 discharge or death) were performed only in those patients with a PCT peak.Patients undergoing uncomplicated elective major abdominal surgery were used as a control group to assess the peri-operative kinetics of ASM. In these patients, ASM was also determined before surgery to determine the influence of the surgical trauma on ASM. Serum samples for the analysis of ASM were collected prospectively on a daily basis and stored at \u221220\u00b0Celsius. ASM on the day of ICU admission was analysed in all included patients but due to financial restraints consecutive measurements of ASM  Plasma was obtained and centrifuged at 3000 g for 5 minutes  and stored at \u221220\u00b0C until assayed. Analytical determination of ASM depended on detection of radio-labeled [14C]-Phosphorycholin that was generated by [14C]-sphingomyelin cleavage in aequimolar amounts to ceramide PCT measurements were performed using a commercially available immunoluminometric assay  according to the manufacturer\u2019s instructions via the automated Kryptor platform . The direct measuring range of the assay is from 0.02\u2013100 ng/ml, with automated dilution extending the upper range to 1.000 ng/ml. The functional assay sensitivity is 0.06 ng/ml, and the sample volume needed is 50 \u00b5l.P value below 0.05 was considered statistically significant. Statistical analyses were performed with SPSS 17.0  and Prism 5 .Means \u00b1 standard deviations (SD) or medians with interquartile ranges (IQR) are reported as appropriate. Differences in continuous variables between survivors and non-survivors were compared with the nonparametric Mann-Whitney test. Predictive values of serum ASM, PCT, CRP, WBC, body temperature and severity of illness measures regarding ICU mortality were evaluated. Discriminatory power (ability to distinguish between patients who die and those who survive) of laboratory tests and severity of illness scores were tested at all 3 time points to produce receiver operating characteristic (ROC) curves. The area under curve (AUC), with 95% confidence intervals (CI) and cut-offs for sensitivity and specificity were calculated in prediction of ICU mortality. A plus a PCT peak (one patient with two episodes). A study flow chart is given in P\u200a=\u200a0.8695). beforePCT was 0.46 ng/ml, increased markedly on peakPCT to 4.43 ng/ml and subsequently returned to nearly baseline values at lowPCT. ASM showed no statistical significant differences between these three time points. Also, there was no difference in ASM in these patients between ICU admission and beforePCT (P\u200a=\u200a0.8995). There were no significant changes in CRP, lactate levels and severity of illness measures , ASM increased only in non-survivors (by 34%), whereas in survivors a decline (by 10%) of ASM was detected even at peakPCT. ASM declined in all patients at lowPCT (91% vs. 79%), but remained significantly higher in non-survivors when compared to survivors  died during their ICU stay as opposed to 6 of the 21 patients without PCT peak who died (27.3%). With lowPCT, the areas under receiver operating curves (AUC) for ASM in prediction of ICU mortality were significantly different from 0.5  with a sensitivity of 40% and specificity of 90% at an optimal cut-off value of 2098 pMol/ml\u2022h, (likelihood ratio: 4). For CRP, the sensitivity was 60% and specificity 90% at an optimal cut-off value of 77.1 mg/L . ASM levels were also not significantly different between patients with or without systemic inflammation upon ICU admission. Thus, ASM may not be a marker to indicate inflammation at an earlier stage than PCT.To our best knowledge, only two clinical studies have yet evaluated the role of ASM in patients with systemic inflammation. In a retrospective study of 12 severely septic patients, Claus et al. were able to show that sphingolytic activity was significantly increased compared to 13 healthy volunteers and that a further increase during the clinical course was proportional to the severity of illness  and paralleled by fatal outcome In the control group, we observed a significant increase in median ASM after surgery parallel to a post-operative PCT and CRP increase. This increase reflects a \u201cpost-trauma\u201d effect that is most likely explained by a lysosomal release of ASM resulting from tissue damage during surgery. However, the pre-operative and median post-operative ASM levels in the control group were still significantly lower as compared to the ICU patients.lowPCT . Future studies on ASM kinetics may address this potential limitation choosing an even closer measurement interval. Lastly, the potential of using ASM as a prognostic marker after systemic inflammation in clinical practice warrants further improvement of the assay to become more widely available.Our study has some limitations which have to be mentioned. The main limitation is the low number of patients included and that it was conducted as a single center study. Therefore, our results should be interpreted with caution as there is a high likelihood of a type II error. However, this study should be regarded in the context of a single center, pilot study aiming to gain more insight into the clinical usefulness of ASM kinetics in the course of systemic inflammation. A further limitation is that we did not perform consecutive ASM measurements in the ICU patients without systemic inflammation. This was due to financial restraints of this pilot study. Measurements of ASM are not yet comparable with established laboratory for PCT or CRP that are easier and cheaper to conduct. It is also likely that the time interval at which ASM was measured did not accurately capture an early change in ASM kinetics  values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S2, Acid sphingomyelinase (pMol/ml*h) values for the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S3, C-reactive protein (mg/L) values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S4, Lactate (mMol/L) values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S5, Modified SOFA-Score (points) values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S6, SAPS-Score (points) values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S7, TISS-Score (points) values of the included patients, sorted by survivors and non-survivors. Time points were the day before the PCT peak (beforePCT), the day of the PCT peak (peakPCT) and again lowered PCT (lowPCT). Table S8, Acid sphingomyelinase activity, Procalcitonin (PCT), C-reactive protein (CRP), Lactate, modified SOFA-Score (mSofa), SAPS II Score and TISS Score of the included patients on the day of intensive care unit (ICU) admission. Table S9, Patients\u2019 characteristics and outcomes of the included patients. Table S10, Patients\u2019 characteristics and outcomes of included patients with systemic inflammatory response syndrome (SIRS) plus Procalcitonin (PCT) peak. Table S11, Patients\u2019 characteristics and outcomes of included patients without systemic inflammatory response syndrome (SIRS) plus Procalcitonin (PCT) peak.(PDF)Click here for additional data file."}
+{"text": "Mood and anxiety disorders are the most prevalent mental disorders. People with such disorders implement self-management strategies to reduce or prevent their symptoms and to optimize their health and well-being. Even though self-management strategies are known to be essential to recovery, few researchers have examined them. The aim of this study is to explore strategies used by people recovering from depressive, anxiety, and bipolar disorders by asking 50 of them to describe their own strategies. Strategies were classified according to dimensions of recovery: social, existential, functional, physical, and clinical. Within these themes, 60 distinct strategies were found to be used synergistically to promote personal recovery as well as symptom reduction. Findings highlight the diversity of strategies used by people, whether they have depressive, anxiety, or bipolar disorders. This study underscores the importance of supporting self-management in a way that respects individual experience. Mood and anxiety disorders are the most common mental disorders . The lifPeople living with one of these disorders must learn to live with their illnesses from day to day, particularly as bipolar disorder is a chronic illness, and anxiety and depressive disorders have a very high recurrence rate . To dealEven though self-management strategies are known to be essential to recovery, only a few researchers have examined strategies for fostering the recovery of people with a depressive disorder  or a bipWe can distinguish two types of recovery in mental health: clinical recovery and personal recovery . ClinicaTo our knowledge, To fill gaps left by prior research, the goals of this study were (a) to explore the variety of self-management strategies used by people to recover from a depressive, bipolar, or anxiety disorder and (b) to describe the strategies fostering recovery in each of the key recovery dimensions.N = 50) was recruited with assistance from community organizations, health and social services centers, and hospitals. For inclusion in the study, patients had (a) to be 18 years or older; (b) to have lived through or currently be experiencing a depressive, anxiety, or bipolar disorder; (c) to be in recovery or recovered; and (d) to live within a 60 km radius of Montr\u00e9al, Canada.The sample , and half of them were 46 to 55 years of age. A large majority of them (88.0%) were living with or had experienced more than one mental disorder . Despite this high level of comorbidity, when we considered only the dominant disorder of each participant, most were mainly living with or had experienced a depressive disorder (42%) or a bipolar disorder (40%). Most of the participants came from urban settings (80%) with an income level above the poverty line (78%).The final sample consisted of 24 men and 26 women. The participants averaged 47.3 years of age  and whether there were important differences between these three groups. Chi-square and Fisher tests were performed to verify whether the differences were significant.The research team took various measures to establish the validity of the study. First, to stay close to the participants\u2019 experiences, the interviews were not organized specifically around the dimensions of Then the data triangulation strategy was used, meaning that we took into account the points of view of different actors on the development of the coding table and data analysis . To begiTeam members had to reach a consensus on each new theme or sub-theme and each change made to the codes. This approach is frequently used in qualitative research and reduces the bias associated with data analysis . A conseFinally, new participants were interviewed until a point of data saturation was reached. In other words, data collection stopped when no more themes or sub-themes had to be added when analyzing the data from a new interview. This was important, as we wanted to explore the full diversity of self-management strategies rather than collect data only on the most obvious or frequent ones. Furthermore, it enhanced the trustworthiness of the data .Most of the participants mentioned strategies aimed at breaking their isolation and maintaining or developing satisfying social relationships. To this end, many sought support from family, friends, and people with a similar illness. This allowed them not only to receive support and develop new friendships but also to break their isolation. In this respect, one participant said, \u201cIt\u2019s so important to know that you aren\u2019t alone dealing with this kind of thing\u201d and \u201cThe presence of others with the same condition . . . allows us to feel less isolated.\u201d Some participants also said that they appreciated the comfort provided by the presence of an animal. One participant mentioned how the affection he received from his dog \u201cmade all the difference.\u201dI\u2019d say that the first thing is to make some changes in terms of the people you\u2019re spending time with. Because if you stay around people who make you suffer, you\u2019ll only continue to suffer. You need to break free of all that; sometimes you\u2019re better off alone than in bad company. I\u2019d also say that when we let go of relationships with people who aren\u2019t good for us, it makes room for people who are better for us.Several participants also became involved in social activities  to make new contacts or spend time with family and friends. For example, one participant said that playing badminton helped him recover, as it gave him opportunities to socialize with friends. Nevertheless, some participants made an effort to choose the people they socialized with, to find the kind of support they needed. Other participants ended relationships that they considered detrimental to their recovery. As one participant explained,Furthermore, certain participants implemented strategies focused on taking care of their families or friends. For example, one participant mentioned that he tried to spare his wife and children from his relapses, as he did not want them to \u201cpay a price for my mental health, which isn\u2019t always great.\u201d Other strategies included reassuring family and friends, serving as a role model, and thanking others for the support received. Some participants also said that serving others, whether informally or through volunteer work, helped their recovery. For example, one participant said that discussing her depression at conferences had helped her feeling good, as she believed that by sharing her knowledge, she can help other depressed people recover.Many participants reported using strategies to instill hope for recovery by having a positive outlook. To this end, some participants mentioned that they were inspired by persons who had already been through the recovery process. This included well-known public personalities, family members or friends, or people met at a conference, in a support group, or at a workshop. One participant explained that \u201cif things aren\u2019t going well today, there\u2019s still hope because others have been through difficult times too, and they found that the sun comes up again the next day.\u201dSome participants became more optimistic after having compared themselves with people whose problems were more severe . For example, one participant noticed that he felt better after having met people who appeared to be worse off than him. For some participants, it helped to compare themselves with how they felt before, seeing how things had improved. As one participant said, taking stock allowed her to see that \u201cthings were going much better\u201d and that she had \u201ccome a long way.\u201d Remembering times when one felt well was also mentioned as a good path to becoming more hopeful.Participants used other strategies to think more positively, such as trying to perceive their illness as an opportunity for personal growth. As one of them said, having a mental illness allowed her to rebuild her life and \u201cnot everyone has the luxury of being able to start rebuilding their life from the ground up.\u201d Others tried to appreciate the positive things in their lives, such as family and work relationships, to read encouraging thoughts, and to look at inspiring images. In this respect, one participant said that she had been able to fill two notebooks with quotes and excerpts from her readings. For her, \u201cthey are all messages to help me along the way.\u201d Some participants turned to spiritual beliefs, tried to keep their problems in perspective, maintained a sense of humor about themselves, or glossed over negative thoughts to keep hope alive.To develop a positive self-image, some participants tried to recognize and emphasize their strengths and achievements. To this end, some participants took the time to acknowledge everyday achievements, even small ones. Participants mentioned remembering their talents or recording them on paper to have a more positive perception of themselves. As noted by one participant, this strategy proved to be a big help, because it allowed her to \u201cclearly state my strengths\u201d and understand that \u201cnow I feel equipped, I have a toolbox that is all about me.\u201dCertain participants tried to recognize weaknesses as well as strengths. For example, one participant said that she was trying to stop \u201cbanging my head against the wall\u201d when she was unable to work for several hours straight. Other participants tried not to compare themselves with others or apologized for past mistakes. In this regard, one participant said, \u201cI have forgiven myself, I\u2019ve stopped feeling guilty, I\u2019m giving myself a chance.\u201dMany participants also talked about how it is important to accept their mental illness as a fact of life. As one explained, \u201cFirst you need to realize that you have a problem. If you don\u2019t, then you can\u2019t solve it.\u201d For many participants, this was a difficult step to take, as it required overcoming one\u2019s shame in having a mental disorder. To help themselves, some participants tried to make a distinction between their mental illness and their personality. As one participant said, \u201cThe day that I decided that I was no longer an illness and that I deserved respect, so many things changed; it was a great boost.\u201d Some participants tried to consider their mental illness at the same level as a physical illness, with both biological and genetic bases. As one participant said, \u201cYou aren\u2019t any sicker than a diabetic who needs to take insulin everyday. If you take antidepressants, you just take them; it has nothing to do with being crazy.\u201dTo find meaning, some participants also changed their beliefs about recovery. Considering recovery as a long process, or as a process with ups and downs, allowed some participants not to become discouraged in their most difficult moments. As one participant said, recovery \u201cis cyclical; it\u2019s a curve, a wave.\u201d Hence recovery is a mix of good times and more difficult periods.When I was in Grade 11, I was looking forward to college because I had found a program that I really liked, and that really became my rock. Because I had a goal, I saw myself in the program, I was really interested in it, so even if I wasn\u2019t feeling all that well, I wasn\u2019t necessarily thinking about suicide because I was still able to think a bit about my future.Having a project, a goal, or a dream also helped some participants find meaning and remain optimistic about the future. As one of them explained,Highlighting a process of empowerment, some participants mentioned how important it was to appreciate the key role that they played in their own recovery, and the efforts they needed to make to recover. As one participant said, recovery is a process that requires you to \u201cleave the beaten path\u201d and \u201cchallenge yourself.\u201d Similarly, another participant stated that \u201cFor me, the key thing is that I don\u2019t rely on a group, I don\u2019t rely on a drug, I don\u2019t rely on a therapist. My well-being truly comes from me.\u201d Participants also mentioned the importance of staying motivated and believing in themselves if they were to continue making the efforts needed to recover: \u201cEven if you feel sad or have no more energy, you should still have a desire to get better. Wanting to get better is very important.\u201dAnother strategy used by participants to take charge of their recovery was to be assertive about their needs and expectations. For this purpose, some had to learn to be more expressive. For example, one participant related how, after having told her co-worker that she felt she was treating her disrespectfully, she realized that \u201cIn the end, I have a right to say what I think, if something is wrong, even if I\u2019m talking to my doctor or to anyone else in my life. All my life I\u2019ve been afraid to speak up.\u201dAdopting a routine allowed some participants to reduce their symptoms. To this end, participants chose mostly activities that required them to follow a schedule, such as work or studies. For example, one participant said that work \u201ckeeps me active\u201d and \u201cforces me to be functional.\u201d Other participants preferred entering activities in their agenda and trying to follow the schedule they had adopted. Performing personal care tasks  on a daily basis was also mentioned.Focused on taking actions, most participants appeared to suffer less from their symptoms when they managed to relax or engage in an enjoyable activity. Many strategies were mentioned in this regard. First, engaging in a pleasant activity appeared to be an effective way to reduce symptoms. This included cultural, artistic, manual, or other activities. For example, one participant said that when she was anxious, she took a \u201clittle holiday,\u201d heading out to take some pictures, and this allowed her to lower her anxiety level for a while. Another participant said, \u201cEveryday I give myself at least a half hour . . . I never come straight home (after work); I\u2019ll stop for a coffee and do some reading. I\u2019ll decompress.\u201d Some participants explained that enjoying a recreational activity allowed them to concentrate on something agreeable and to momentarily forget their symptoms. One participant reported that when she was not feeling well, drawing, painting, and \u201canything that keeps my hands busy\u201d were good distractions.Some participants mentioned that they had found an activity in which they could use their skills. Work was often mentioned in this context. For example, one participant explained that his work fostered his recovery as he was \u201cextremely well known\u201d in his line of work, and it allowed him to use all his skills.Regularly setting small objectives is another strategy that allowed our participants to function well. For example, one participant recommended that anyone who wanted to recover should concentrate on \u201cconcrete steps, small steps that you can take to pull through.\u201d Assuming significant roles also helped many participants in their recovery. This included serving as a volunteer or focusing on work. One participant related that his activism gave him a \u201cdeeply pleasing\u201d and \u201cgratifying\u201d feeling, as he had the impression that \u201cit\u2019s good for everyone, for nature, for me,\u201d and that it was consistent with his most deeply held values. Similarly, for some participants, their role as a parent was the most important thing in their lives.Some participants stated that it is also important to respect their rhythm as they take action: take their time, trust themselves, and wait for the right moment. One participant chose to wait to \u201cbe 100% better\u201d before she returned to work, even if a physician did not have the same opinion. Another learned to pay attention to how she was feeling and adjusted her approach to work accordingly: \u201cIf one day I\u2019m not feeling well, I won\u2019t give myself a series of things to do if they can wait. I\u2019ll change my priorities, adjust things to how I\u2019m feeling at that time.\u201dMany of the strategies described by participants specifically concerned physical recovery. In particular, many developed or tried to maintain a healthy lifestyle. Often they spoke of engaging in a sporting activity. One participant reported that for him, physical activity\u2014whether high or low intensity\u2014served as a \u201cnatural antidepressant.\u201d Some participants also reduced their symptoms by adopting a good sleep schedule and eating well. As one participant noted, going to bed at a regular time and eating three meals a day reduced the risk of \u201cgoing from one extreme to another.\u201d Similarly, either reducing or stopping their consumption of stimulants , drugs, or alcohol helped some participants manage their symptoms. One participant stated that his consumption of drugs was the cause of his lingering depression. One participant with bipolar disorder found that she needed to stop consuming coffee when she was in a manic episode. Stopping smoking was also mentioned as a strategy.In addition to general health behaviors, several participants reported strategies focused on managing their energy, such as avoiding stressful situations, performing relaxation exercises , taking some time off , or working fewer hours.In terms of clinical strategies directly aiming at reducing symptoms, most participants noted the importance of seeking formal professional help. This professional assistance came from a physician, a psychologist, a social worker, a peer helper, a facilitator at a mental health workshop, or someone working at a help line. As one participant noted, by seeking \u201cpsychological help,\u201d people can \u201cwork on the things that are the real sources of their suffering\u201d and thereby reduce symptoms. Some participants mentioned that they sometimes needed to go to a hospital. Besides turning to traditional mental health resources, some participants also relied on alternative resources such as acupuncture, art therapy, lithotherapy, or luminotherapy to help them recover.Whether or not the participants were favorable to medication, most of them recognized this strategy as effective to reduce symptoms. One participant said that \u201cas soon as you\u2019ve received a drug, you\u2019re able to get some sleep, and that helps alleviate the anxiety.\u201d Another participant observed that the medication eliminated \u201cintense moments\u201d and allowed her to \u201csee clearly without being overwhelmed by a wave of emotion.\u201dMany participants also sought to better understand their mental disorder and the symptoms they were feeling. Some mentioned that they tried to find resources, attend conferences or workshops, or collect information on mental illness . For example, one participant mentioned that the various documents he had read on mental illness had helped him better recognize his symptoms.For some participants, thinking about the causes of their mental illness helped them reduce their symptoms. One participant spoke of the moment that she became aware that her illness was due in part to a difficult childhood: \u201cIt explained so many inconsistencies in my life. All of a sudden, this new awareness made everything feel easy. Nothing stressed me anymore.\u201dVarious strategies were also used to manage daily symptoms. One of the most often reported was analyzing and changing dysfunctional ways of thinking or behaving. For example, one participant explained that when she analyzed her \u201clittle internal conversations,\u201d she started by asking herself whether she was \u201cengaging in black-and-white thinking.\u201d If she was, then she tried to dedramatize the situation and adopt a more nuanced view, to avoid being overcome by negative emotions.Another strategy often reported by our participants was confronting one\u2019s fears and stepping back from related thoughts. By examining their fears, the participants found that they could gradually gain a different perspective and find solutions to reduce the impact on their emotions and behaviors. As one participant recounted, not confronting what makes you uncomfortable will, over the long term, generate more stress than facing up to them. Not avoiding conflictual situations was also an important strategy for some participants. As one said, it was important to deal with one\u2019s problems in order to no longer suffer the emotional consequences of certain difficult situations. Other strategies used by participants to gain some perspective over difficult situations included drafting a list of pros and cons, taking some time to reflect, not worrying about certain irritants, dedramatizing situations, and working to solve problems.For preventing relapse, many participants recognized the importance of paying attention to their moods and perceiving the early signs of a relapse. Some participants kept a mood journal, in which they regularly took notes on mood changes. This allowed them to prevent relapses or avoid having their condition deteriorate by implementing an appropriate strategy as soon as they became aware that their symptoms were becoming more intense. For example, one participant explained that when she felt that she was entering a depressive episode, she made an effort to sleep only 7 or 8 hours per night and take a nap during the day, to avoid sleeping 12 hours at a time. Similarly, some participants mentioned the need to stay vigilant throughout the recovery process and to continue to apply one\u2019s self-management strategies.p < .05). Strategies related to \u201cmanaging daily symptoms\u201d were more mentioned by people with anxiety disorders than by those with depressive disorder .Each overarching theme of self-management strategies was mentioned by a large proportion of participants from each diagnostic group. Only two significant differences emerged. Strategies related to \u201ccreating a routine\u201d were more mentioned by people with bipolar disorder than by those with anxiety disorders . In other words, the individual is able to maintain or regain a sense of functioning through actions that are meaningful to that person and others. This provides additional empirical support for person-centered care planning, based on functional and meaningful life goals .Regarding strategies fostering physical recovery, the study findings call attention to health behaviors  for managing the symptoms of depressive, anxiety, and bipolar disorders. This is especially important when one considers the comorbidities of physical illness in persons with mental illness  as well Clinical recovery encompasses a large variety of strategies. This includes well-known strategies, such as medication, illness education, cognitive restructuring, and professional support. The participants also used alternative medicines , which are receiving increased attention in recovery and positive psychology interventions .Taken together, the study\u2019s results represent a significant step forward scientifically for four main reasons. First, compared with prior studies, they offer a broader range of self-management strategies used by persons with depressive or bipolar disorders . Second,In describing their diverse self-management strategies, the participants demonstrated an ability to control and take charge of their own recovery, and they were aware of the importance of this involvement. In other words, they knew that the outcome would depend on the efforts that they were prepared to make.Health professionals should be sure to support the empowerment of persons in recovery, as suggested by recent studies e.g., . This imOf particular relevance is the fact that symptom self-management strategies  were not broadly reported more frequently than strategies targeting other dimensions of recovery. Professionals should thus support the self-management of symptoms while also paying attention to other personal issues involved in recovery. In this sense, Our research team is highly involved with mental health users and professionals in developing research and practice tools based on the self-management strategies reported by participants in the present study. We developed a research instrument measuring self-management see  intendedThe study has broader implications for future research. It could be interesting to examine the interrelationships between different self-management strategies used along the recovery journey. In this regard, the experiential changes of recovery are sometimes grouped in distinct phases, with movement from one phase to another indicating progress , in contrast with other strategy inventories that are almost exclusively focused on self-management of the clinical symptoms or their impact on the functioning level. This comprehensive view of self-management allowed us to establish similarities among the strategies used by persons with different psychiatric diagnostics\u2014depressive, anxiety, and bipolar disorders\u2014hence fostering the interest in a demedicalized approach centered on the experiences of persons in recovery."}
+{"text": "The evaluation of competence of Alzheimer\u2019s disease (AD) patients to assumepersonal or collective responsibilities and the resulting legal implications isa relevant issue.The aim of this study was to evaluate the attitudes of different medicalspecialists towards the disability of patients with Alzheimer\u2019s disease andpractitioners\u2019 competence to interfere with decision-making autonomy.Professionals from different areas  were interviewed by one of the authors, after beingpresented a fictitious clinical case which raised several topics,namely:[1] Critical judgment and capacity of the patientto take decisions related to daily activities;[2] The role of family physicians in nominatingtrustees and caregivers.Answers to the first question did not differ regarding degree of preservationof awareness but at least 25% stressed that the patient must be carefullylistened to, independent of caregiver or legal representative opinion. Therewere significant knowledge gaps in responses to the second question. Half ofthe physicians interviewed did not have adequate information about the legalaspects of caring for patients with Alzheimer\u2019s disease.Legal aspects is a topic that must be incorporated into professional trainingin order to improve attitudes toward the long-term management of patientswith dementia. This matter isregulated by specific laws with distinct characteristics for each country. 7The decision spectrum includes aspects from daily life, such as driving8 in a study thatstratified experts into two groups; groups with more, or less, disability-relatedexperience. The criteria were time (in years) of general experience, and theparticipants included psychiatrists, psychologists, social workers, career counselors,disability specialists, and other mental health professionals. The study showed asignificantly higher score in the experienced group compared to the less experiencedgroup on awareness, self-perception, and skills capacity.Discrepancies among professionals\u2019 competence regarding disability issues was reported byStrike et al.In many cases a specific health professional is assigned. However, under the Brazilianpublic health system, no specific attending professional is nominated and the dementiapatient could be referred to professionals of many different disciplines each withdifferent ways of handling mental distress or specific training for handling physicalskills. Thus, judgment of competency is unlikely to be the same for these differentphysicians. This is especially true in mild cognitive impairment, recently categorizedas AD, when there is no designated legal trustee to act as guardian for the patient.The aim of this study was to collect impressions from different specialists working inthe area of dementia patient care concerning the disabilities affecting patients\u2019competence and autonomy to take part in all daily living activities, and to ascertainpractitioners\u2019 awareness of the role of caregivers and trustees.Data was collected between May and September 2009 on the perspective of healthprofessionals from different specialist areas  identifying similar or distinct concepts and perspectivesabout a fictitious clinical case. The questionnaire was presented to 20 individuals,12 men and 8 women with between 1 and 45 years of medical practice in differentmedical specialties. Respondents were all blind to the opinions and conclusions ofthe other participants. Participation was individual to avoid the possibility ofinteraction between those taking part. The professionals were drawn from differentspecialties and were stratified as follows: 3 psychiatrists, 3 neurologists, 1neurosurgeon, 4 pediatricians, 3 gynecologists, 4 geriatric specialists, and 2pathologists.Relatives, including two married sons who live in another city, ask the doctorfor a medical report on the patient\u2019s disease and status. An unmarried daughter,who lives with the patient, is against the request and states that it isfinancially motivated.A 68-year-old woman, widowed two years earlier, lives with her single30-year-old daughter who works during the day and stays with her motherafter lunch on Saturdays and Sundays. During weekday evenings she supervisesand helps her mother with her personal hygiene. In the daughter\u2019s absence, a50-year-old lady living nearby is paid to help with hygiene, and providesmeals, and other help needed. For the last three years, the patient hasdemonstrated difficulty in performing activities such as handling of thecash dispensing machine (ATM) and the remote control. She can no longerrecall hours, days, and months, with constant errors in sequencing. Afterher husband\u2019s death two years previous, she began to have difficultydistinguishing objects and substances, for instance between salt and sugaror identifying pairs of socks and shoes, including size (trying to wear herdaughter\u2019s shoes). She routinely visits neighbors, and for the last year thepatient has not gone shopping in local supermarkets due to difficulties inmanaging money and mistakes in product choice. Complementary examinationincluding computed tomography (CT) and magnetic resonance image (MRI) showsnon-specific global atrophy without other findings.The caregiver reports that the patient does not adequately perform personalhygiene and does not accept help. The patient receives a pension and rentalincome from two properties. She often asks questions about her earnings andis unable to remember whether they have already been collected. In recentmonths, she has presented forgetfulness related to sequence of events,characterized by the doctor as episodic memory impairment. Once a month, herdaughter accompanies her to the bank to collect her income and pension.Since her husband\u2019s death, she consistently inquires whether Alzheimer\u2019sdisease affects her as it had affected one of her sisters who died 5 yearsearlier.The questions presented by the medicine student relate to a hypotheticalclinical case and basic issues pertinent to patients with AD. The questionswere as follows:[1] Views on critical judgment and the patient\u2019sability to make decisions related to their daily life andadministration of personal and shared property;[2] What should be the role of the physician inappointing caregivers and an attorney-in-fact?All interviewees received a full explanation about the study and gave theirinformed consent. The Medical Ethics Research Committee of Botucatu MedicalSchool - S\u00e3o Paulo State University, approved the study.Two psychiatrists ,two neurologists (both men with more than 10 years\u2019 experience), andone pediatrician (woman with more than 10 years\u2019 experience), whomake up 25% of those interviewed, believed that the patient requiredevaluation in a medical consultation to confirm the daughter\u2019s andcarer\u2019s reports.\u201cFirstly I see the need to evaluate the patient in a medicalconsultation to evaluate if the report is true\u201d\u201cAs economic interests are involved, a more careful evaluation isrequired\u201dThree pediatricians , one neurosurgeon , four geriatricians , one gynecologist , one neurologist , one psychiatrist , and one pathologist , who make up 60% of thoseinterviewed believed that the patient was incapable of makingdecisions and required full support.\u201cThis patient is incapable of making decisions and carrying out dailyactivities and requires someone to help her, preferably a familymember\u201dApproximately 80% of this group  supported the idea that the patient must bestimulated to perform her activities, albeit with help.\u201cThe patient must keep her autonomy, but without exceeding herlimits, which could generate a picture of stress\u201dTwenty percent of this group  believed this patient neededmultiprofessional help: occupational therapy, nursing, and arestructuring of her environment. Other resources could also beemployed: painting, handicrafts, etc.\u201cThe patient needs to be stimulated in activities that she getspleasure from: painting, drawing, working in clay\u201dOne pathologist and two gynecologists , who make up 15% of thoseinterviewed felt unable to give their opinion on this case forlack of knowledge on the subject.Practically 90% of those interviewed did not know the differencebetween carer and attorney-in-fact. Only two geriatricians  knew the difference.Those unaware of the difference were given an explanation of the differencebetween carer and attorney-in-fact and the question posed again.One gynecologist ,two psychiatrists , and three pediatricians , corresponding to 30% of thoseinterviewed, believed that it falls to the doctor to request a placeon the Medical Ethics Committee and recommend legal advice to definebetween caregiver and attorney-in-fact.Two male gynecologists (one with more and one with less than 10years\u2019 experience) and a female pathologist  corresponding to 15% of those interviewedbelieved that the doctor must advise the caregiver but not theattorney-in-fact.\u201cThe doctor does not have the right to interfere with theattorney-in-fact\u201dOne pediatrician , three neurologists, one neurosurgeon, one pathologist, fourgeriatricians, and one psychiatrist , corresponding to 55% of thoseinterviewed, considered that the physician needed to produce apathology and prognosis report, and to suggest the role of thecarer, with the legal system responsible for designating theattorney-in fact.\u201cI believe that the role of the doctor is to report in a clearmanner, based on clinical theory and after careful evaluation of thepatient, the patient\u2019s capacity for activities, reasoning, memory, andunderstanding\u201d.\u201cIt is up to the doctor to define the aim of integral patient care,based on clinical data and from the relationship/interaction with thepatient\u201d.\u201cThe doctor must recommend legal advice and maintain follow-up, butnot in designating the carer or attorney-in-fact\u201d.\u201cThey should suggest, with empathy, what is most suitable forimproving their patient\u2019s quality of life\u201d.9 The agingprocess in the Brazilian population, which affects 7.1% of elderlyBrazilians,10 is anincreasing public health concern and a pattern which constitutes a long-termtrend.11The increasing prevalence of AD makes increased longevity, one of the great triumphsof modern society, a threat of epidemic proportions for which we are still notprepared.In this study, physicians were presented with a hypothetical clinical case andquestioned on basic needs and the family physician\u2019s view on issues concerning legalaspects such as nominating caregivers and a legal representative(attorney-in-fact).\u201cThis patient is incapable of making decisions and performingdaily activities independently, she needs someone to help her, the relativebeing a good source of support\u201d, and \u201cThe patient needs tomaintain her autonomy, but without exceeding her own limits, which couldgenerate a picture of stress\u201d. Analysis of responses revealeddifficulties for the interviewees in discerning between autonomy and patientcompetence in performing activities and making decisions about their personal life.Importantly, 60% of those interviewed, independent of specialty and time in theprofession stated that the patient was incapable of performing all the activities,making decisions or having autonomy. Defanti et al. called attention to the factthat autonomy is based on capacities that could be lost or disturbed with diseaseprogression.4 A quarter ofthose interviewed expressed their concerns about interference from caregivers andrelatives on establishing prognosis. The statement is translated by deponents as therequirement for diagnosis to arise from careful examination of the patient and thento be presented before relatives, caregivers and attorney-in-fact.Most of those interviewed agreed that there is a major compromise in the patient\u2019scognitive abilities, at least with mild cognitive impairment. Some answers stressedthe patient\u2019s inability to make decisions and the need to receive help for allactivities - 7 involving all steps, and which must be followed in order tostart a process of nominating power of attorney.Diagnosis of a patient\u2019s loss of awareness and mental deficits leads to a criticalkey point - the decision to certify the patient for civil rights. The secondquestion exposed the inability of 90% of the participants to identify the differencebetween a caregiver and an attorney-in-fact. Health professionals need to have aclear understanding of the distinction that the caregiver is chosen by the familywith help from health professionals. But the attorney-in-fact is chosen by a judge,upon request by any individual judged capable, with permission to make the requestfrom the actual patient. The judgment may require medical and other evaluations.This possibility has to be explained to the family. In Brazil there is a law thatcan be assessed in the network at any time12 reporting only moderate agreementamong experts in detecting impairment to decision-making abilities.A point to reflect on is that participants with 10 or more years in practice fromareas less closely related to mental health believed that they did not havesufficient information to form an opinion. This highlights the need for additionalprovisions for all specialties. The hypothesis that some professionals are undermore pressure to give opinions on a patient\u2019s competence to assume responsibilitiesmust be taken into account. Nevertheless, there are studies13 Three of the specialists from areas not linked with mentalhealth believed that the assisting doctor must advise the carer, but withoutinforming the attorney-in-fact, i.e. the patient\u2019s legal representative, on allaspects including decisions regarding autonomy. The need to designate a trusteereveals and highlights the importance of providing the patient with the bestconditions of help and support, through greater autonomy and minimal dependence.Other authors draw attention to the fact that despite knowing who the caregiver is,many physicians are not well informed on the role and forms of interaction withthese professionals or relatives.14 Data obtained suggested that there were no starkdiscrepancies between the different medical groups with regard to psycho geriatriccare. However, the decision to request relatives to take actions which guarantee thepatient complete respect of their expressed wishes up to or before the onset of thedementia picture, or during disease evolution is not related to diagnosis ortherapeutic measures, but to an attitude toward maintaining the autonomy of theindividual with dementia. It is evident that there was no homogeneous perception ofthe associated situational constraints related to the needs of the social group towhich the patient belonged.Contrasting opinion is apparent among different physician specializations, althoughtime in practice represents an issue that can play a role in an area that calls fornon-technical knowledge but requires legal information. With this in mind we cite astudy where the diagnosis and therapeutic procedures of 94 generalpractitioners/interns and neurologists/psychiatrists, who dealt with psychogeriatric patients, were investigated by questionnaire.Another impression was a lack of knowledge on the national laws covering thecompetence to appoint power of attorney in cases of incompetence or functionalincapacity. Efforts to intensify campaigns to provide physicians who take care ofdemented patients with information on juridical aspects represents a positivemeasure to assure broader care for patients and their families.The results of this study highlight the need for more evidence-based decision-makingregarding treatment, care, and guidelines. Emphasis on legal aspects is a topic thatmust be incorporated into professional training for assessing attitudes towarddemented patients."}
+{"text": "When the meaning of key terms is incompatible in competing taxonomies, a revolution might occur in the field by which the established taxonomy is replaced with another. Since the key term \u201cimpact\u201d in scientometrics seems to undergo a taxonomic change, a revolution might be taking place at present: Impact is no longer defined as impact on science alone (measured by citations), but on all sectors of society . In this Short Communication, we outline that the current revolution in scientometrics does not only imply a broadening of the impact perspective, but also the devaluation of quality considerations in evaluative contexts. Impact might no longer be seen as a proxy for quality, but in its original sense: the simple resonance in some sectors of society. In recent years, one was generally interested in two measurements in evaluative scientometrics: (1) How productive was the researcher, research group, or institution in terms of the number of publications in the last few years? (2) Did these publications have high quality? The focus of evaluative scientometrics was especially directed at the quality of publications which was measured as a rule in terms of the number of citations.some publications were used but were either never cited or cited rarely;some publications were cited mainly or only through secondary sources;some publications were credited every time they were used.In the 1980s and 1990s, researchers in the area of scientometrics have investigated whether citations are really able to measure quality . For example, MacRoberts and MacRoberts , 2010 coTaken as a whole, their studies (and many other scientometric studies on this issue) do not support the assumption of evaluative bibliometrics that scientists only cite publications which had cognitively influenced them. Instead, many results gave support to the idea that giving credit to the cognitive influence by the research of other scientists is one motive besides other motives for citing.Another line of research in scientometrics (besides citing behavior studies) which investigated the relationship of quality and citations has correlated peer assessments with citation counts. The authors of these studies argued that peer assessments are the best possible way of measuring quality of research , two competing theories of citing behavior have been developed in past decades which are situated within broader social theories of science. The normative theory of citing behavior is based on Robert K. Merton\u2019s sociological theory of science Merton . This thThe relationship between citations and quality was the central question in studying citing behavior, correlating assessments by peers and citations, as well as developing theories of citation. The great interest of scientometricians over decades in this relationship points out that scientometricians were mostly interested in impact issues in these years, because citations are probably related to quality. In this Short Communication, we outline that current changes in impact measurements , does not only imply a broadening of the impact perspective, but also the devaluation of quality considerations in evaluative contexts. Impact of research might no longer be seen as a proxy for its quality, but in its original sense: the simple resonance in some sectors of society.Over the last few decades, a widely accepted taxonomy has been developed in scientometrics for the use of citation data . Here, taxonomy is defined as a roughly outlined scheme which is used by scientometricians for the purposes of their research and its application  Wray . In the Scientific revolutions are characterized by taxonomic changes in a mature research field Kuhn . When thScientific impact measurement is a part of broad impact measurement. Scientometricians know rather well what quality of research regarding science means, but the meaning of quality of research regarding other parts of society is not well known, although broad definitions for societal impact have been provided. For example, Wilsdon et al.  define shttps://support.google.com/trends/answer/4365533?hl=en). It is clearly visible that until 2007/2008 the interest in \u201cResearch impact\u201d and \u201cResearch quality\u201d was similar. However, in recent years research impact seems to draw much more interest than research quality.The results in Fig.\u00a0The taxonomic change  has consequences for the work of scientometricians. New data sources for measuring societal impact come into play  might reflect impact of publications in society, but are only loosely or not connected to quality of research Bornmann . WilsdonIn this Short Communication, we have outlined that the current revolution in scientometrics does not only imply a broadening of the impact perspective, but also the devaluation of quality considerations in evaluative contexts. Impact might no longer be seen as a proxy for quality, but in its original sense: the simple resonance in some sectors of society. This is an alarming development, because fraudulent research is definitely of low quality, but is expected to have great resonance if measured in terms of altmetrics. For example, Twitter is a well-known resonance medium for sensational events. Real-time visualizations of twitter messages (twitter stream tools) can show how negative events produce a great resonance in the community.In the development of advanced indicators for broad impact measurements, the quality of research should be taken into consideration. Only those indicators should be fostered and developed further on, which can also reflect the quality of research. In the context of societal impact measurements, quality should not be evaluated in an academic sense but in the context of its possible societal benefits. In other words, research should be accurately done, but does not have to be excellent in order to be useful in a certain sector of society. Indicators which might not only reflect societal impact, but also research quality (in a specific context) are citations of scholarly publications in clinical guidelines (Thelwall and Maflahi Subsequent to a revolutionary phase, in which the new taxonomy gains acceptance in a certain community, a phase of normal science follows in which corresponding methods and techniques are newly developed or established ones adapted. In scientometrics, the phase of normal science will face the experts with questions around the methods for the reliable and valid measurement of societal impact. The specific contribution of altmetrics to the measurement of societal impact will be clarified."}
+{"text": "Spatholobus suberectus Dunn (S. suberectus), which belongs to the Leguminosae, is an important medicinal plant in China. Owing to its long growth cycle and increased use in human medicine, wild resources of S. suberectus have decreased rapidly and may be on the verge of extinction. De novo assembly of the whole S. suberectus genome provides us a critical potential resource towards biosynthesis of the main bioactive components and seed development regulation mechanism of this plant. Utilizing several sequencing technologies such as Illumina HiSeq X Ten, single-molecule real-time sequencing, 10x Genomics, as well as new assembly techniques such as FALCON and chromatin interaction mapping (Hi-C), we assembled a chromosome-scale genome about 798\u2009Mb in size. In total, 748\u2009Mb (93.73%) of the contig sequences were anchored onto nine chromosomes with the longest scaffold being 103.57\u2009Mb. Further annotation analyses predicted 31,634 protein-coding genes, of which 93.9% have been functionally annotated. All data generated in this study is available in public databases.  Spatholobus suberectus Dunn is widely used as a food supplement in tea, wine, and soup as well as being one of the most important Chinese medicinal plants  species, was estimated to be 793\u2009Mb using 17-mer frequency distribution analysis with SOAPdenovo. In this study, we combined sequences generated on the Illumina, PacBio, and 10X Genomics GemCode platform as well as the new assembly technique FALCON to generate the first draft genome assembly of S. suberectus. The assembled genome is about 798\u2009Mb with scaffold and contig N50 sizes of 6.9\u2009Mb and 2.1\u2009Mb, respectively. The S. suberectus assembly was further refined using 233.19\u2009Gb Hi-C data: 748\u2009Mb (93.73%) of the contig sequences were anchored onto nine chromosomes, the scaffold N50 was improved to be 86.99\u2009Mb, and the longest scaffold was 103.57\u2009Mb.The genome size of S. suberectus genome (47.82%) was occupied by repetitive elements, the largest amount of which was long terminal repeat retrotransposons (17.32%). Combined with homology-based predictions, de novo predictions and transcriptome-based predictions, 31,634 protein-coding genes with an average transcript size of 1,097.55\u2009bp were predicted in the genome. In total, 93.9%  of protein-coding genes were successfully functionally annotated.Almost half of the S. suberectus samples from Nanning, Guangxi Zhuang Autonomous Region, China  were selected for genome sequencing. The samples were kept at the Guangxi Botanical Garden of Medicinal Plants for breeding and research purposes. Total genomic DNA was isolated from fresh young leaves of 8-year-old S. suberectus using the Plant DNA Kit (TIANGEN) according to the manufacturer\u2019s instructions.TM . The sheared DNA, with fragment sizes of 250\u2009bp and 450\u2009bp, was processed using the TrueSeq DNA PCR-Free LT Library Kit protocol. PCR products were purified (AMPure XP system) and library quality was assessed on an Agilent Bioanalyzer 2100 system. These PCR-Free libraries were sequenced with a HiSeq X Ten instrument as 150\u2009bp paired-end reads. In total, 77.73\u2009Gb of raw sequence data were generated (Table\u00a0The DNA was sheared by a Covaris\u00ae M220 focused-ultrasonicatorSheared DNA (40\u2009\u03bcg) was purified and concentrated with AMPure PB beads (PacBio) and further used for SMRTbell preparation according to the manufacturer\u2019s protocol  size selection system with a 15-kb cut-off). The libraries were then sequenced with a PacBio sequel instrument . A total of 11 SMRT Cells were used to yield 79.79-fold genome coverage of sequence data (Table\u00a015. Sample indexing and partition barcoded libraries were prepared using the Chromium Genome Reagent Kit (10x Genomics) according to the manufacturer\u2019s instructions. The barcode sequencing library was first quantified by Qubit2.0, insert size was checked using an Agilent2100, and finally quantified by qPCR. The 123.09\u2009Gb library was sequenced with 150\u2009bp paired-end reads on an Illumina HiSeq X Ten platform (Table\u00a0The linked read sequencing libraries were constructed on a 10X Genomics GemCode platform16. The effect rate (%)\u2009=\u2009Unique di-tigs/Total Reads Processed\u2009=\u20094,356,614/10,000,000\u2009=\u200943.57% . The heterozygosity of the S. suberectus genome is 0.74%.Quality-filtered reads from the Illumina platform were subjected to 17-mer frequency distribution analysis with SOAPdenovotus Fig.\u00a0. We plottus Fig.\u00a0. Based oDe novo assembly of the 63.27\u2009Gb PacBio single-molecule long reads from SMRT Sequencing was performed using FALCON (https://github.com/PacificBiosciences/FALCON/)18. In order to get enough corrected reads, the longest 60 subreads were first selected as seed reads to do error correction. Then error-corrected reads were aligned to each other and assembled into genomic contigs using FALCON with parameters length_cutoff_pr\u2009=\u20095000, max_diff\u2009=\u2009120, max_cov\u2009=\u2009130. The draft assembly was polished using the quiver algorithm. Pilon was used to perform error correction of p-contigs with 98.02X coverage of short paired-end reads generated from Illumina HiSeq Platforms19. The assembly consisted of 1,954 contigs, with a contig N50 length of 2.06\u2009Mb   with the barcoded sequencing reads.We used BWA-MEMThe assembly consisted of 1,146 scaffolds, with the scaffold N50 length improving to 6.9\u2009Mb  and contig N50 of 2.1\u2009Mb . The separations of Dovetail Hi-C read pairs mapped within draft scaffolds were analyzed by HiRise to produce a likelihood model for genomic distance between read pairs, and the model was used to identify and break putative misjoins, score prospective joins, and make joins above a threshold. After scaffolding, shotgun sequences were used to close gaps between contigs.The input S. suberectus assembly was further refined using 233.19\u2009Gb Hi-C data (Table\u00a0The 22 was employed to identify tandem repeats in the S. suberectus genome. RepeatMasker (http://www.repeatmasker.org) and RepeatProteinMasker23 were used against Repbase24 to identify known transposable element repeats. In addition, RepeatModeler (http://www.repeatmasker.org/RepeatModeler.html), RepeatScout (http://www.repeatmasker.org/)25, PILER (http://www.drive5.com/piler/)26, and LTR_Finder (http://tlife.fudan.edu.cn/ltr_finder)27 were utilized to identify de novo evolved repeats  was occupied by repetitive elements 28, but are similar to Lotus japonicus (18%)9. LTR/Copia repeats were the most abundant, making up 10.06% of the genome , Arabidopsis thaliana , Glycine max , Petunia axillaris , Solanum lycopersicum , and Oryza sativa  were used for homology-based predictions. First, query sequences were subjected to tblastn analysis with an Expect (E)-value cutoff of 1e-5. BLAST hits corresponding to reference proteins were concatenated by Solar software, and low-quality records were removed. The genomic sequence of each reference protein was extended upstream and downstream by 2,000\u2009bp to represent a protein-coding region. Gene structures contained in each protein region were predicted using GeneWise software34. For transcriptome-based predictions, RNA from five organs  was isolated and RNA-seq data were used for gene annotation, processed by TopHat and Cufflinks35. RNA-seq data were also assembled by Trinity36. PASA37 software (http://pasapipeline.github.io/) was then used to generate a full transcriptome-based genome annotation. The homology, de novo, and transcriptomic gene sets were merged to form a comprehensive and non-redundant reference gene set using EVidenceModeler38 software. Next, PASA37 was used to generate UTRs as suggested by the RNA-seq data.Genes in the ons Fig.\u00a0. For de Our analysis indicates that 31,634 protein-coding genes with an average transcript size of 1,097.55\u2009bp were predicted in the genome Fig.\u00a0.-05) against SwissProt39 and NR databases. Protein domains were annotated by searching against InterPro40 and Pfam database41, using InterProScan and HMMER (http://hmmer.janelia.org), respectively. The GO terms for genes were obtained from the corresponding InterPro or Pfam entry. The pathways in which the genes might be involved were assigned by BLAST against the KEGG database42 with the E-value cut-off of 1e-05.Functional annotation of the protein-coding genes was carried out using blastp , 70.8% , and 82.5%  of genes showed enrichment in InterPro, KEGG, and GO respectively. In total, 93.9%  of protein-coding genes were successfully annotated for conserved functional motifs or functional terms.43 software with default parameters. rRNA annotation was based on homology with rRNAs from several diverse higher plant species (not shown), using blastn with \u2018E-value\u2009=\u20091e-5\u2019. miRNA and snRNA genes were predicted by INFERNAL software44 using the Rfam database45.Annotation of tRNA was performed using tRNAscan-SEThe final results included 820 miRNA, 672 tRNA, 261 rRNA, and 550 snRNA with average lengths of 117.33, 75.32, 305.41 and 115.50\u2009bp respectively.46. The version described in this paper is version QUWT01000000. Raw read files are available at NCBI Sequence Read Archive47. All the annotation tables containing results of an analysis of the draft genome are available at figshare48.This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession QUWT0000000049 and an overall 97.29% mapping rate was found, suggesting that our assembly results contained comprehensive genomic information. Gene region completeness was evaluated by RNA-Seq data .To estimate the quality of genome assembly, short reads were mapped back to the consensus genome using BWAta Table\u00a0: of the 50: 240 of 248 (96.77%) conserved core eukaryotic genes from CEGMA were captured in our assembly, and 206 (83.06%) of these were complete , 1% were fragmented and only 2.6% were missing te Table\u00a0. Furtherng Table\u00a0. These dDownload metadata fileSupplementary Tables"}
+{"text": "We also found distinct and different changes in protein abundance (ratio \u2265 2) after short stimulation of cells with various stimuli, pointing to rapid and differentiated reaction pattern. IL8 stimulation resulted in increased protein abundance of 58 proteins (3% of proteome), whereas PMA induced changed protein abundance of 207 (10 % of proteome) and LPS of 46 proteins (2% of proteome). Enrichment analyses clearly showed fundamental differences between stimuli, with primary association of IL8 stimulation to processes in immune response, receptor signaling and signal transduction. Top enrichment for PMA on the other hand pointed to vesicle mediated transport and exocytosis. Stimulation with LPS did not result in any significant enrichment. Although we detected 43% overlap of enrichment categories for IL8 and PMA stimulation, indicating that activation of neutrophils with different stimuli partly induces some similar biological processes and pathways, hierarchical clustering showed clear differences in distribution and biological relevance of clusters between the chosen stimuli. Our studies provide novel information on the granulocyte proteome and offer insights into early, differentiated granulocyte reaction to stimuli, which contribute to a better understanding of molecular mechanisms involved in activation and recruitment of neutrophils, through inflammatory stimuli.The molecular mechanisms driving specific regulation of neutrophils are not completely understood to date. In order to characterize fundamental granulocyte features on protein level, we analyzed changes in proteome composition as reaction to stress from cell activation processes. For this purpose, we isolated primary granulocytes from equine whole blood through density gradient centrifugation followed by sodium chloride lysis and stimulated cells for 30 min with interleukin-8 (IL8) due to its role as a chemotactic factor for neutrophils. We additionally used phorbol 12-myristate 13-acetate (PMA) and lipopolysaccharide (LPS), which are primarily associated to neutrophil extracellular trap formation and release of reactive oxygen species. From mass spectrometry analysis, we identified a total of 2,032 proteins describing the whole granulocyte proteome, including 245 proteins (12% of identified proteome) newly associated to  Granulocytes have initially been labeled as short-lived, terminally differentiated cells, driving innate immune response through phagocytosis, degranulation, ROS release and, as described more recently, NETosis , 2. Howe2 and MgCl2; Gibco/ThermoFisher Scientific, Germany) and remaining erythrocytes were removed by sodium chloride lysis . Cells were washed  and resuspended in PBS with 0.2% Glucose. From each animal used in the experiment, we prepared aliquot portions of 6 \u00d7 105 cells/500 \u03bcl. These cell aliquots were separately stimulated with recombinant equine interleukin-8 , phorbol 12-myristate 13-acetate  and lipopolysaccharide  for 30 min in a CO2 incubator . Untreated medium control (mc) was incubated under the same conditions but without stimulating agent. After stimulation, each of the stimulated and mc aliquots was topped up to 1 ml with PBS with 0.2% Glucose and pelleted . All Samples were stored at \u221220\u00b0C. Shortly before mass spectrometry analysis, cells were thawed and lysed in urea buffer (8 M urea in 0.1 M Tris/HCl pH 8.5), and protein amount was determined with Bradford protein assay , which are at the student's disposal for supervised ultrasound- and health assessment training. Health status was assessed by standard clinical routine examinations. No experimental procedures were performed on these horses. Venous whole blood was collected in tubes supplemented with 25.000 I.U. heparin. After rough sedimentation of erythrocytes, PMN were isolated from plasma by density gradient centrifugation  using Ficoll-Paque PLUS separating solution . Cells were washed gently  in cold PBS  as previously described . Acidifihttp://www.ensembl.org) for peptide identification with Mascot (version 2.5.1). Search parameters used were 10 ppm peptide mass tolerance, 20 mmu fragment mass tolerance, one missed cleavage allowed, carbamidomethylation as fixed modification and methionine oxidation as well as deamidation of asparagine and glutamine as variable modifications. Mascot integrated decoy database search was set to a false discovery rate (FDR) of 1% when searching was performed on the concatenated mgf files with a percolator ion score cut-off of 13 and an appropriate significance threshold p. Identifications were re-imported into Progenesis QI and redundancies grouped following the rules of parsimony.Label-free quantitative analysis was performed using Progenesis QI software  as described , 19, withttp://bioinformatics.sdstate.edu/go60/  0.05, number of most significant terms to show 30. P-value for enrichment analysis was calculated via hypergeometric distribution, followed by correction using FDR. Venn diagram was made with open source tool: http://bioinformatics.psb.ugent.be/webtools/Venn/.Differential protein abundance was determined by comparison of the mean normalized peptide abundance from the extracted ion chromatograms. Proteins were considered differentially expressed at stimulating agent/mc ratio \u2265 2.0. Bioinformatic analysis was performed on human orthologs of gene names from differentially expressed equine proteins with open source software ShinyGO v0.60: du/go60/  with thein vivo protein expression repertoire of equine granulocytes so far  which have not been associated to the s so far . These pAfter stimulation with three different stimulating agents, we found distinct changes in granulocyte protein abundance compared to medium controls (ratio cut-off \u2265 2). In detail, cells stimulated with LPS showed higher expression levels of 46 proteins (2% of proteome), whereas PMA induced increased protein abundance of 207 proteins (10% of proteome). IL8 stimulation resulted in increased protein expression levels of 58 proteins (3% of proteome) . All of Figure 3, Table 3). The unique clusters for each stimulant, however, showed a clear difference in reaction of cells to stimuli: PMA stimulated innate immune cells reacted with processes involved in intracellular transportation processes, whereas IL8 stimulated cells showed involvement in signal transduction pathways .In order to understand the association of the differentially expressed proteins to biological processes and their known role in granulocyte activation pathways, we analyzed the data from the 15 proteins present in all groups  as well For more detailed analysis, we subsequently focused on proteins which were differentially abundant in either IL8 or PMA stimulated cells and therefore described as unique for respective stimulus. Hierarchical clustering of enrichment analysis data from unique proteins expressed after PMA stimulation pointed to primary involvement in vesicle-mediated and intracellular transport as well as exocytosis on the one and metabolic processes on the other hand , Table 2Knowledge about the molecular mechanisms involved in specific granulocyte activation and subsequent choice of pathways depending on different stressors is still incomplete to date. Moreover, in the past, granulocytes have frequently been underestimated in their ability to execute distinct heterogenic reactions rather than uniform response cascades to any, mainly pathogen-induced stimulus. The past decade has yielded more details on granulocyte heterogeneity and function, not only for processes in the innate immune system but also for regulatory involvement in adaptive immune responses , 21. Nevin vivo expression is lacking. With our studies, we could confirm actual in vivo expression of these proteins, associating them to primary granulocyte proteome in horses. We chose equine granulocytes to conduct our experiments, because the equine and human immune system share a wide range of similarities both in granulocyte-lymphocyte ratio, composition and function . PSMC6 is an ATP-dependent proteolytic complex responsible for ubiquitin-dependent protein degradation , which showed higher abundance unique to this stimulant .CD conceived and designed the experiments. RD and SH performed the experiments. RD, SH, MW, and CD analyzed the data. RD wrote the manuscript. All authors critically read the manuscript and approved the final version to be published.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Vamp8\u2212/\u2212 exhibit a mild pro-inflammatory state basally due to an altered mucus layer and increased encounters with microbial antigens. Microbial diversity shifts to a detrimental microbiota with an increase abundance of pathogenic and mucolytic bacteria. To alleviate the heavy microbial burden and inflammatory state basally, Vamp8\u2212/\u2212 skews towards tolerance. Despite this, Vamp8\u2212/\u2212 is highly susceptible to both chemical and infectious colitis demonstrating the fragility of the intestinal mucosa without proper mucus exocytosis mechanisms.The mucus layer is the first line of innate host defense in the gut that protects the epithelium by spatially separating commensal bacteria. MUC2 mucin is produced and stored by goblet cells that is constitutively exocytosed or hyper secreted upon sensing a threat. How coordinated mucus exocytosis maintains homeostasis in the intestinal epithelium and modulates the immunological landscape remains elusive. Here we describe how the vesicle SNARE protein VAMP8 coordinates mucin exocytosis from goblet cells.  VAMP8 is a secretory pathway protein implicated in mucus secretion. Here the authors describe alterations in intestinal immune state and microbiota composition, as well as increased susceptibility to experimental colitis in mice deficient for VAMP8. This biphasic dynamic mucus layer is extensively colonized by the host microbiota in the lumen, however generally retains sterility just above the epithelial cells3. The primary component of this mucus layer is MUC2, an extensively O-glycosylated molecule that forms polymeric sheets to attach organisms as a decoy for colonization and provides a food source for the microbiota5. Continual depletion of the mucus layer through peristaltic movement and degradation is opposed by constitutive secretion of mucin from intestinal goblet cells. In response to an invading threat or pathogen, goblet cells can also mount a robust burst of mucus secretion thwarting the intruder away from the epithelial layer6.Mucosal surfaces are routinely challenged with a myriad of insults ranging from benign to dangerous that do not always warrant an immune response if compartmentation is successful. Within the gastrointestinal mucosa, this is accomplished by spatially separating ingested food, noxious particles, and potentially pathogenic bacteria away from the single layer of epithelial cells by the mucus layer8. Logically microbial sensing through these germline encoded receptors appears an attractive mechanism for the host to decipher how imminent a threat is to the epithelial surface, where a thinner mucus layer delivering microbial-associated molecular patterns warrants a secretory response. Perturbation of these pathogen-recognition receptors (PRRs) leads to attenuated mucus release from goblet cells allowing for microbial interaction with the mucosal surface basally and thus exacerbating animal models of disease, such as chemical or infectious colitis9.Recently, toll-like receptors (TLRs) and inflammasomes have emerged as microbial sensors within goblet cells to initiate signal transduction pathways culminating to mucin releaseMuc2\u2212/\u2212 mice that display increased colonization of bacteria with the epithelial surface, increased susceptibility to colitis and development of colorectal cancer11. Lack of a mucus barrier in Muc2/\u2212\u2212 also leads to increased intestinal permeability and crypt hyperplasia12. Thus it is not surprising that Muc2\u2212/\u2212 mice show increased colonic colonization by pathogenic and commensal bacteria13. This ultimately leads to increased permeability, bacterial burden and exaggerated immune responses culminating in high disease activity in Muc2\u2212/\u2212 mice.The importance of the mucus layer in gastrointestinal physiology is best exemplified through abc SNARE complexes on the plasma membrane composed of SNAP and syntaxin affording membrane fusion and expulsion of vesicle content15. We have recently reported that the protozoan parasite Entamoeba histolytica induces the activation of the vesicle R-SNARE VAMP8 upon interaction within goblet cells and lack of Vamp8 leads to abrogated mucin release, increased parasitic adherence and an aggravated immune response following infection17. To fully characterize how mucin is released from intestinal goblet cells and the role coordinated mucin exocytosis plays in host physiology, we utilized Vamp8\u2212/\u2212 mice and interrogated alterations in the mucosal barrier. We build upon previous work that mucin exocytosis from goblet cells is VAMP8-dependent and perturbation of the SNARE machinery leads to morphological alterations in goblet cell structure and function. This leads to alterations in the microbiota and immune landscape skewing the mucosa to a tolerogenic phenotype to compensate for a dysfunctional barrier. Lack of mucin exocytosis increases susceptibility to chemical and infectious colitis highlighting the critical importance these mechanisms play in maintaining intestinal homeostasis.A likely candidate is SNARE-mediated exocytosis that facilitates vesicle\u2013plasma membrane fusion events given the abundance of mucin vesicles stored within goblet cells. In this model, R-SNAREs, predominantly VAMPs, present on vesicles complex with Q17, we sought to identify the participation and expression of other Vamp isoforms in goblet cells. To directly interrogate goblet cell transcripts in the colonic epithelium, we utilized Atoh1-eGFP mice that specifically express eGFP in goblet cells  was performed. Both Vamp8+/+ and Vamp8\u2212/\u2212 littermates were treated for 14 days every other day with 2.5\u2009mg/kg of either 1D11 monoclonal Tgf-\u03b2 or isotype IgG control. Flow cytometry analysis on colonic LPL revealed a significant decrease in Helios\u2212 iTregs in Vamp8\u2212/\u2212 mice following administration with 1D11  critical in dealing with pathogens and microbes28.Two mechanisms of mucin release have been proposed where goblet cells must constitutively release mucin to maintain the mucus layer and also respond to specific stimuli to execute inducible exocytosis. Our findings demonstrate that the terminal pathways culminating in mucin secretion in goblet cells is VAMP8-mediated SNARE exocytosis. By silencing VAMP8 in a human goblet cell line, we found constitutive release of mucin was severely impaired and other VAMP isoforms played a minimal role. This held true in 29. This can be best exemplified by our observation that goblet cells in Vamp8\u2212/\u2212 take on a pathological morphology and contain abnormal mucin granules. Further, ultrastructure anomalies were detected in Vamp8\u2212/\u2212 including the presence of intact mucin vesicles in the lumen and lack of apical epithelial cell integrity. In support of this, ex vivo intestinal explants from Vamp8\u2212/\u2212 monitored for TER in Ussing chambers deteriorated much faster than WT controls. Clearly proper secretion of mucin is required for the protective properties in mucin, which would explain why although mucus was occasionally observed in the lumen of Vamp8/\u2212\u2212 this does not result in a bona fide mucus barrier. Even though the mechanisms governing this alternative secretion are not addressed here, we propose granule extrusion as a possible cause where bloated goblet cells simply burst their content, including intact granules, into the lumen30. Recent work has described a specific subset of goblet cells termed sentinel goblet cells as sacrificing themselves upon reaching the top of the crypt8. It would be intriguing to investigate if animal models that are deficient for mucus secretion, such as VAMP8 commit greater numbers of goblet cells to this phenotype given this event appears to be TLR ligand dependent. One marked discrepancy between Vamp8\u2212/\u2212 intestinal organoids and in vivo results was mRNA expression of Muc2 that was downregulated in vivo and upregulated in organoids. This difference likely arises from the structure of organoids with a huge accumulation of dead/dying cells within the luminal compartment. Analogous in vivo to the apical surface of the crypt, goblet cells change their transcriptomic profile to produce high levels of mucin and these GC are functionally different from crypt GCs31. Due to the high turnover of dead and dying cells here, we believe that organoids upregulate mucin in organoids through some similar pathways by sensing the abundant dead cells within the luminal cavity. It would be interesting to assess if GC organoids mimic the sentinel goblet cell phenotype merely based on the culture conditions and structure of the 3D organoids.Given the susceptibility of goblet cells to ER stress due to MUC2 production, it would appear that improper mucin release has a grave outcomeVamp8\u2212/\u2212 was not observed32. Instead, subtle differences at the genus level were observed including the expansion of potential pathogens including Pasteurella, Helicobacter, and Escherichia. This appears to be consistent with several mouse models that contain barrier defects such as NOD2 and RIP233. Interestingly, a large proportion of bacterial species that were up regulated in Vamp8/\u2212\u2212 are also targeted by IgA and termed colitogenic including Erysipelotrichaceae, Ruminococcaceae, and Helicobacter34. Additionally, several species that are more abundant in Vamp8\u2212/\u2212 are linked to a pro-inflammatory signature including Erysipelotrichaceae that is positively correlated to TNF-\u03b1 levels and Coriobacteriaceae that is associated with Il-636. It seems plausible that in addition to a lack of a mucus layer in Vamp8\u2212/\u2212 littermates the increase susceptibility to Citrobacter infection could in part be attributed to a deleterious microbiota favoring a niche of proteobacteria, as observed in other infection models, where perturbation of the microbiota with antibiotics facilitates infection10.As commensal bacteria rely on mucus as food source, it was surprising that drastic differences in microbial communities in Vamp8/\u2212\u2212 barrier dysfunction was a colonic tolerogenic response. Not only did we observe an increase in the abundance of Tregs in the LPL of Vamp8/\u2212\u2212, but there was also a concurrent increase in tolerogenic cytokines Tgf-\u03b21 and Il-10. We suspect this is largely due to commensal bacteria as these effects were only observed in the colon that contains a high microbial burden and absent in the small intestine. While the majority of Il-10 was from Tregs in the LPL, epithelial cells contributed significant quantities of Tgf-\u03b21. Interestingly, Vamp8\u2212/\u2212 intestinal organoids that were grown in sterile conditions retained Tgf-\u03b21 production suggesting other mechanisms that are independent of microbiota are involved. While colonic organoids mimicked several hallmarks of in vivo epithelial cells, it should be noted that this model does not account for influences from the microbiota or immune and neuronal cells. Tgf-\u03b21 can stimulate tissue resident T cells to express FOXP3 and maintain a tolerogenic niche39. In the lung epithelium, Tgf-\u03b21 has been proposed to increase goblet cell abundance and promote mucus hypersecretion that could explain the greater goblet cell numbers in Vamp8\u2212/\u221240. While Il-10 has been reported to induce mucin production and rectify protein misfolding in intestinal goblet cells, Vamp8/\u2212\u2212 are unable to release mucin regardless of the agonist used41. This is exemplified by the potent non-specific mucin inducer, PMA, where goblet cells were still attenuated for mucin exocytosis. Il-10 has been shown to suppress fucosylation in intestinal epithelial cells (IEC) and indeed Vamp8/\u2212\u2212 mice displayed less fucosylation of mucin20. Future studies warrant investigation on how tolerogenic cytokines and lack of the exocytosis machinery modulate glycosylation or biosynthesis of mucins and how this affects the protective functions of the mucus layer.Perhaps the most unexpected result of Muc2/\u2212\u2212 is highly susceptible to infectious and chemical colitis, logically abrogating the mucus secretion machinery would produce a similar phenotype. While we did not observe rampant inflammation basally or spontaneous colitis in Vamp8/\u2212\u2212, slight perturbation of the barrier had catastrophic effects. While Muc2\u2212/\u2212 can restitute following DSS and eventually recover, Vamp8/\u2212\u2212 succumb to disease by day 942. This difference may be explained in the ability of Muc2\u2212/\u2212 mice to compensate by producing and secreting other Muc isoforms, predominately Muc6, that are not normally expressed in the colonic epithelium. In Vamp8\u2212/\u2212, the mechanisms governing mucin secretion are likely conserved between isoforms of mucin as no study has immunolocalized discreet mucin granules with differential cargo, for example Muc2+ versus Muc5ac+ granules. Taken together, our results demonstrate an absolute requirement for the R-SNARE VAMP8 in facilitating mucin secretion from intestinal goblet cells. In lieu of coordinated mucus exocytosis, Vamp8\u2212/\u2212 littermates failed to produce a functional mucus layer leading to increased microbial interaction with the epithelium. This defect led to a mild pro-inflammatory phenotype and skewed microbiota with greater abundance of unfavorable bacterial species. To circumvent barrier dysfunction, Vamp8\u2212/\u2212 elicited a bias mucosal immune responses skewing to a tolerogenic phenotype. Despite this, any perturbation in the barrier through infection or colitis exacerbated pathogenesis with catastrophic consequences for host physiology.Since 43. LS174T were cultured in EMEM supplemented with 10% FBS, 20\u2009mM HEPES with 100\u2009U/mL penicillin/streptomycin. LS174T were passaged with 0.25% trypsin/ EDTA (Thermo) once cells reached 90% confluence. For secretion experiments, LS174T were seeded in 24-well plates in triplicate at a density of 5\u2009\u00d7\u2009104 and cultured until a confluent monolayer44. Doxycycline inducible LS174T shRNA silenced for VAMP8 were routinely sorted for RFP expression to maintain a high knockdown population17. VAMP8KD were cultured in 2\u2009\u03bcg/mL doxycycline indefinitely to maintain knockdown given VAMP8 is a long-lived protein and non-induced cells harboring the lentiviral construct were used as WT controls. Media was replaced every 3 days and cells harvested with 0.25% Trypsin/EDTA (Invitrogen). For metabolic labeling of mucin, LS174T were seeded in 2-well dishes at 5\u2009\u00d7\u2009104 cells/well in triplicate and allowed to reach 90% confluence.Human adenocarcinoma colonic goblet cells, LS174T (ATCC-CL-188), were routinely passaged through nude mice to maintain a high mucin phenotypeVamp8+/+ and Vamp8\u2212/\u2212 littermates46. Colonic crypts were dissociated with gentle cell dissociation buffer (StemCell Technologies) and 100 crypts embedded in GFR\u2212 matrigel (BD) domes supplemented with L-WRN (ATCC CRL-3276)-conditioned media containing N2, B27, GlutaMax, SB202190, Nicotinamide, N-acetylcysteine, A83-01, and mEGF in advanced DMEM. Colonic organoids were fed every 2 days with passaging in TrypLE every 10 days. For all experiments, colonic organoids were grown for 7 days in fully conditioned media and then placed in L-WRN-conditioned media containing only N2, B27, Nicotinamide, and Glutamax for an additional 3 days. To skew colonic organoids to a goblet cell phenotype, 24\u2009h prior to each experiment organoids were treated with 5\u2009\u03bcM DAPT.Colonic intestinal organoids were derived from Vamp8+/+ and Vamp8\u2212/\u2212 littermates mice on a SV129 background were bred in house47. Vamp8\u2212/\u2212 mice were generated by targeted gene deletion using a vector containing the entire Vamp8 gene with the second exon (mapping to amino acids 2\u201354 of Vamp8) replaced with IRES-LacZ and neomycin-resistance gene driven by the Pgk promoter. The neo gene was subsequently floxed out with Cre recombinase in positive carriers. Mice were kept in sterilized, filter-top cages and were maintained under specific-pathogen-free conditions with food and water ad libitum. For DSS colitis experiments, mice were administered 2.5% DSS  in the drinking water for 5 days and animal welfare carefully monitored. For C. rodentium infections, either Streptomycin-resistant Citrobacter or Lux:Lux bioluminescent Citrobacter was grown overnight in LB and 100\u2009\u03bcL of overnight culture was administered by oral gavage to mice. Metabolic labeling of mucin in vivo was performed by injecting 20\u2009\u03bcCi of 3H-glucosamine (Perkin Elmer) for 6\u2009h48. Metabolically labeled mucin was then collected in the colonic luminal content by gentle scraping of the colon surface. Mucin was precipitated with 10% TCA, crude pellet suspended and adjusted to neutral pH. Preparations were resolved on a Sepharose 4B chromatography column with fractionation of 1\u2009mL fractions and subsequent scintillation counting.Six to eight-week-old g and supernatants quantified for protein content by BCA assay. Prior to analysis by SDS\u2013PAGE, Laemmli sample buffer containing 5% BME was added to samples (20\u2009\u03bcg/well) and boiled for 5\u2009min. Samples were resolved on 10% polyacrylamide gels, wet transferred to 0.2\u2009\u03bcm nitrocellulose and blocked with 5% skim milk. Primary antibodies diluted in PBS containing 0.1% Tween and 5% BSA were incubated overnight with blots at 4\u2009\u00b0C. Following extensive washing, blots were incubated at RT for 2\u2009h with secondary antibodies coupled to HRP and developed using ChemiLucent ECL detection (EMD Millipore) on film. Original unmodified scans of western blots are provided in the source data file. For quantification of cytokines and chemokines, intestinal biopsies were homogenized and sonicated in the lysis buffer listed above. Samples were normalized to 2\u2009mg/mL and analyzed by multiplexing laser bead assay using a mouse 31plex array (Eve Technologies).Following the assay, cells were washed three times with ice-cold PBS and lysed in a buffer composed of 20\u2009mM HEPES, 150\u2009mM NaCl, 1\u2009mM EDTA, 1% NP-40, 10\u2009\u03bcM E64, and a protease inhibitor cocktail (Roche). Samples were then cleared by centrifuging at 14,000\u00d76 cells/well LS174T were seeded on 5\u2009cm2 No. 1.5 glass coverslips for 24\u2009h and then fixed with 3.5% paraformadhyde followed by permeabilization with 0.35% triton. For in vivo studies, mice colons were fixed without flushing of luminal content with Carnoy\u2019s fixative, embedded in paraffin and sectioned at 5\u2009\u03bcm. For FISH staining, antigen retrieval was performed with proteinase K and Vamp8/Muc2 staining performed with citrate buffer. For FISH staining, slides were hybridized as previously described with the pan-bacteria probe EUB338 at 46\u2009\u00b0C10. Slides were then blocked with 5% normal donkey serum and incubated overnight with primary antibodies in a humidified chamber at 4\u2009\u00b0C. The following day, slides were washed with PBS containing 0.1% Tween and incubated at RT with fluorescent secondary antibodies, phalloidin, and DAPI (Life Technologies). Slides were mounted with Fluorosave reagent  and visualized on an Olympus FV1000 scanning confocal inverted microscope. Confocal analysis was performed in Fiji (ImageJ). For mucus thickness, quantification of the area between the apical surface of the epithelium and closest detectable EUB338+ bacteria were reported for multiple random areas within a micrograph. Fluorescence intensity was measured from several separate images and multiple ROIs within an image as indicated within the figure legends . Correlation was calculated in Fiji using the Coloc package and Pearson correlation reported for and the surface area of multiple ROIs per section. Each dot on the graphs represent one ROI. For histopathology, tissue sections were blindly scored for goblet cell depletion, mucosa thickening, inflammatory cell infiltrate, loss of architecture, ulcers, and abcess11. For electron microscopy, mice colons were fixed in 2.5% glutaraldehyde in 100\u2009mM phosphate buffer followed by 1% osmium tetroxide. Samples were then dehydrated through ethanol and either embedded in resin for TEM or critical point dried in HMDS for SEM. SEM images were acquired on a FEI XL30 at 30\u2009kV and TEM acquired on Hitachi H-7650 at 120\u2009kV.For in vitro studies, 1\u2009\u00d7\u200910For analysis of lamina propria lymphocytes (LPL) and IEC, small intestine (Peyer\u2019s patches dissected) or colon were washed extensively with PBS, flushed with PBS containing 1\u2009mM DTT and shaken at 37\u2009\u00b0C with HBSS containing 10\u2009mM EDTA to strip epithelial cells from the mucosa. LPL were liberated in RPMI containing 125 units/mL collagenase at 37\u2009\u00b0C for 1\u2009h. Following washing with FACS buffer (PBS\u2009+\u20092\u2009mM EDTA\u2009+\u20091%FCS) cell surface antigens were stained for 1\u2009h, washed twice with FACS buffer and analyzed. For intracellular staining of cytokines and transcription factors, isolated LPL were stimulated in complete RPMI containing 20\u2009ng/mL PMA, 100\u2009ng/mL Ionomycin with GolgiStop and GolgiPlug (BD) for 6\u2009h. Stimulated LPL were washed with FACS buffer, cell surface antigens stained and processed with FOXP3 fixation/permeabilization buffer kit according to the manufactures instructions. Cells were acquired on a BD Canto and data analyzed with FlowJo.49. Paired end reads of the V3 region of the 16S rRNA gene using bar coded Illumina sequencing with the modification that bar-codes are included in the forward primer50. Two hundred and fifty nucleotides paired-end sequencing were carried out on a MiSeq Illumina sequencer providing complete overlapping sequence reads of the V3. These overlaps were used for correcting poor quality base calls and increasing sequencing accuracy. 30\u201360,000 16s rRNA reads were generated per sample. The short-read library 16S rRNA gene sequencing pipeline sl1p was used51. All output data processing comparisons were based on OTU tables, map files, and phylogenies generated by sl1p v4.1 using the -p all -d all and -t all flags. All analyses were computed in R using phyloseq, ggplot2, and reshape2. Differential abundance analysis between groups was carried out using Bayesian estimation with R package BEST52.DNA extraction of fecal samples was carried out using a protocol that enhances DNA recovery from microbial communities with modifications to increase quantitative recovery of bacteria across different taxa Vamp8+/+ and Vamp8\u2212/\u2212 littermates were gavaged with 150\u2009\u03bcL of 80\u2009mg/mL 4\u2009kDa FITC-dextran  in PBS 4\u2009h prior to sacrifice. Mice were anaesthetized and blood was collected by cardiac punctures, which was added immediately to a final concentration of 3% acid\u2013citrate dextrose . Plasma was collected and fluorescence was quantified using a Wallace Victor (Perkin-Elmer Life Sciences) at excitation 485\u2009nm, emission 530\u2009nm for 0.1\u2009s. For ex vivo quantification of TER, Ussing chambers were used to whole mount colonic segments of Vamp8+/+ and Vamp8\u2212/\u2212 littermate tissues53. Once mounted, the tissues were bathed with Krebs buffer . The serosal Krebs buffer contained 10\u2009mmol/L glucose, and the mucosal Krebs buffer contained 10\u2009mmol/L mannitol. Buffers were aerated and mixed by using a gas lift system (5% CO2 and 95% O2). Tissue responses were measured by clamping the potential difference (PD) to 0\u2009mV by applying an Isc with a voltage-clamp apparatus . Isc was monitored throughout the experiment as the indicator of net active electrolyte transport across the tissue. After a 20-min equilibration period, the viability of the tissues was assessed by delivering an electrical field stimulation  with a dual-impedance stimulator (Harvard Apparatus). At the end of all experiments, forskolin (1\u2009\u03bcM) was applied to the serosa side of the tissues.2. cDNA preparation from 250\u2009ng of RNA was performed using qScript first-strand cDNA synthesis kit (Quanta). qPCR was performed using SYBR green on a StepOnePlus Real-time PCR machine (Applied Biosystems). The list of primers used in this study is in Supplementary Table Intestinal tissue was harvested in Trizol reagent (Thermo) and processed according to the manufactures instructions with the inclusion of RNA precipitation with LiClCitrobacter infection was performed by homogenizing tissue lysates in sterile PBS and normalizing protein content between samples. Serial dilutions were then plated on MacConkey agar and CFU enumerated the following day. For Citrobacter quantification, MacConkey agar plates contained 100\u2009\u03bcg/mL streptomycin. For whole body imaging of bioluminescent Citrobacter, animals were anaesthetized with 2% isofluorane carried in 2% O2, kept constant at 37\u2009\u00b0C via air circulation and imaged on their ventral side on days 3, 5, 7, 10, and 14 using an in vivo Xtreme 4MP imaging platform . The imaging protocol contained three steps: reflectance imaging (2\u2009s exposure time), bioluminescent imaging (10\u2009s exposure time) and an additional Xray imaging step (10\u2009s exposure time). Binning was kept constant at 4\u2009\u00d7\u20094. Images from the in vivo Xtreme were acquired and analyzed using Bruker molecular imaging software MI SE . Citrobacter-associated bioluminescence expression in the abdomen in Vamp8+/+ and Vamp8-/- littermates was quantified by measuring the mean bioluminescence (after background subtraction) in a constant region of interest (ROI), which was kept constant over the time period of imaging.Bacteria translocation during DSS and p\u2009<\u20090.05 was considered significant. For comparison between two groups Student\u2019s t-test was used. For quantification of confocal images a minimum of eight images were used per condition. Results presented in histograms are displayed as the mean with the standard error of the mean for error bars.Experiments presented are representative of at least three independent experiments. Statistical significance between two or more groups was assessed by one-way ANOVA where The Health Sciences Animal Care Committee from the University of Calgary, have examined the animal care and treatment protocol (AC14-0219) and approved the experimental procedures proposed and certifies with the applicant that the care and treatment of animals used was in accordance with the principles outlined in the most recent policies on the \u201cGuide to the Care and Use of Experimental Animals\u201d by The Canadian Council on Animal Care.Citrobacter (Statens Serum Institute). EUB338 was from Eqixon. Salmonella Typhimurium flagellin was from Invivogen. Tgf-\u03b2 neutralizing antibody was from BioXcell (Clone: 1D11).Unless otherwise specified, all reagents were from Sigma-Aldrich. The following antibodies were used: Munc18b (Proteintech); SNAP23, STX3, VAMP2 (SYSY); VAMP8 (R&D); MUC2 (Santa Cruz); Th17/Treg staining kit, CD45, CD11B, CD11C, F4/80, CD103, IA-IE (BD); CD326, LAP, Il-10, IL-6, P-STAT3 (eBioscience); Supplementary InformationSource Data"}
+{"text": "Microglia represent a specialized population of macrophages-like cells in the central nervous system (CNS) considered immune sentinels that are capable of orchestrating a potent inflammatory response. Microglia are also involved in synaptic organization, trophic neuronal support during development, phagocytosis of apoptotic cells in the developing brain, myelin turnover, control of neuronal excitability, phagocytic debris removal as well as brain protection and repair. Microglial response is pathology dependent and affects to immune, metabolic. In this review, we will shed light on microglial activation depending on the disease context and the influence of factors such as aging, environment or cell-to-cell interaction. Depending on the anatomical region, microglia account for 0.5\u201316.6% of the total cell population in the human brain  and 5\u201312We will review the role of microglia in neurodegenerative diseases such as Parkinson\u2019s disease, Alzheimer\u2019s disease and frontotemporal dementia (FTD), where microglial activation stands as one of the key components linked to the progression of the pathology and the symptoms severity.Microglial cells originate from the yolk sac and migrate into the central nervous system (CNS) during embryogenesis . Once inFor instance, in the basal ganglia, the expression of genes associated with a classical microglial profile such as branch dynamics and cytoskeletal regulation, inflammatory signaling, immune function and homeostasis, tend to be conserved across regions . In contThus, a phenotypic heterogeneity of microglia can be observed within an anatomical region Figure . MoreoveMicroglial phenotype regulation is mostly dependent on their interaction with molecules released by surrounding cells  through membrane-bound pattern recognition receptors (PRRs). These PRRs can be classified depending on their affinity for molecules associated to pathogens  or cellular damage  . HoweverTraditionally, macrophage and microglial activation has been classified in two different and opposite states: classic (M1) and alternative (M2). The M1 phenotype is considered a pro-inflammatory state, in which microglial cells produce and release ROS, nitrogen reactive species (NRS) and cytokines like tumor necrosis factor-\u03b1 (TNF-\u03b1), interleukin 1\u03b2 (IL-1\u03b2) or interleukin 12 (IL-12). On the other hand, the M2 microglial phenotype, is considered an anti-inflammatory state and is involved in the production and release of trophic factors, such as tumor growth factor-\u03b2 (TGF-\u03b2) and brain derived neurotrophic factor (BDNF) . NowadayRegarding expression pattern of microglial cells, Aging is considered the main risk factor for several neurodegenerative diseases and is accompanied by chronic altered inflammation involving changes in microglial morphology, phenotype and activity . In thisInterestingly, most neurological conditions occur in a region-specific manner and display differential regulatory mechanisms of gene expression . AnotherHippocampus is an essential learning and memory structure located bilaterally, deep in the temporal lobes of the gray matter . HippocaAging, is also affecting neuronal network in the hippocampus. For instance, older adults had poorer connectivity between with the posterior brain regions than young adults. On the contrary, older adults showed increased connectivity between the hippocampus and frontal regions . DiffereAll the factors before mentioned might predispose microglial activity for hippocampal-related brain diseases such as Alzheimer\u2019s disease, where microglial activation and neuroinflammation play a key role .Frontal lobes, including prefrontal cortex (PFC) and motor areas, encompass around 30% of the cortical surface of the human brain . They arRegarding microglial phenotype in healthy cortex, CD11b on microglia from cerebral cortex was repeatedly lower than from spinal cord, and CD40 was lower in cortex compared to cerebellum. On the other hand, CXCR3 was higher in the cortex compared to the cerebellum . As prevThe substantia nigra is a gray matter area caudal to the hippocampus with a particularly high microglial density , which iIn this structure, microglial cells present a proportion of 12%, which is a particular dense population . A key rThe number of microglial cells in the substantia nigra, the differential regulation of fractalkine and CD200 and the decrease of dopaminergic neurons are environmental factors that might modulate microglial activity. For instance, high microglial density, the reduction of CD200 receptor, or the decrease in dopaminergic population, can decrease the regulation of microglial cell by neurons. An environment with less microglial regulation, or overpopulated, might give rise to a reduction of trophic factors production or excessive inflammatory molecules production, which can be detrimental in the long run.Although AD is the most common form of dementia, caused by neuronal death , its patAging is a primary risk factor for AD  and AD cIt has been proposed that both functional and morphological changes of the hippocampus are associated with changes in microglial cell response during AD progression .As previously mentioned, PRRs bind to different DAMPs or PAMPs. For instance, A\u03b2 species can trigger an inflammatory response in microglial cells . AmyloidThe ApoE is a protein involved in the cell metabolism regulation and transportation of fatty acids. ApoE can be found in four different alleles. For instance, ApoE 4 allele increases the risk of AD threefold to eightfold, depending on the number of allele copies. ApoE has three common variants: ApoE 2, which is rare and may protect against AD; ApoE 3, which is common and seems to play a neutral role; and ApoE 4, which is a major risk allele for AD .53. APOE levels could influence tau pathology and tau-mediated neurodegeneration independently of amyloid-\u03b2. As a future approach, it would be interesting to target ApoE4 in order to reduce tau pathology in neurodegenerative diseases.Human ApoE has also been demonstrated to play a role in tau pathology and brain inflammationInnate immune system has been proved to be strongly involved in AD pathogenesis. Indeed, genetic findings provide strong evidence for a pivotal role of microglial activation in AD pathogenesis. These include a common variant of Transcription factor PU.1 (SPI1) for microglial development and function , which iTrem2 deletion seems to play a more neuroprotective role in the PS19 tau model  impair the proper function of microglia in terms of phagocytosis, inflammatory response, energy metabolism, plaque compaction and activation, affecting disease progression . Studiesau model  but becoau model . In regaAnother interesting gene linked to AD is the microglial chemokine receptor (Cx3cr1) involved in microglial migration and in neuron/microglial activity regulation . In tau Additional gene considered a risk for AD pathology, is CD33. CD33 is a transmembrane receptor mainly expressed by microglial cells in the brain that regulates innate immune response. Increased levels of this receptor have been correlated with an elevated risk of AD due to slower microglial phagocytosis and A\u03b2 clearance, leading to an increased in plaque deposition in AD mice brains .Additionally, PRR family TLRs has being linked to AD. TLR are a subfamily of PRRs, where most of them are expressed by microglia. TLRs-mediated signaling has been suggested to be both detrimental and beneficial depending on the receptor involved in the response J . Thus, tAnother major mediator in inflammation is the complement system, which evolved to protect the host against infection and plays an important role in microglia-mediated synaptic refinement during brain development. The complement system is involved in the innate immune response and its main role is clearing cellular debris, damage and apoptotic cells  by enhanMicroglia is also involved in synapses elimination, mainly those with less activity or from dysfunctional neurons, by a process called synaptic pruning . FurtherAnother key inflammatory molecule involved in AD is the nitric oxide synthase (NOS) . The proCytokines such as IL-12 have been linked to AD progression. For instance, the lack of IL-23 reduces AD pathology in APP/PS1 model , affectiTo summarize, innate immune activation and inflammatory response driven by microglial cells are currently rising up as one of the key research areas to understand AD pathology progression, as well as, to find new therapeutic targets to halt the progression of the pathology.Chronic or progressive loss of cortical and subcortical functions have been defined in FTD . This diCortical atrophy and synaptic loss have been also described in AD, the most common type of dementia . AD is cIn the last few years, several studies show that chronic microglial activation participates in the development and/or progression of neurodegenerative disorders, such as AD and FTLD [for review see ].in vivo PET imaging studies, showed an increased binding of 11-C-R-PK1195 microglial ligand in frontotemporal brain regions, suggesting that microglial activation could start at early stages of FTLD prior to anatomical changes   . This prPGRN) . PGRN prPGRN) . FurtherPGRN) . In FTLDPGRN) .TREM2-related mutations    have bee, W198X) ]. As welTo summarize, some evidences suggest that neuroinflammation could be a common process associated with neuronal damage and cognitive impairment, symptoms that dementia patient\u2019s exhibit. A better understanding of neuronal-glial  mechanisms involved in the cortical degeneration is a current challenge to identify specific targets that may prevent the development and/or the progression of cortical-related neuronal disorders.Parkinson\u2019s disease (PD) is a motor brain disorder characterized by motor impairment due to degeneration of dopaminergic neurons. Innate immune response in PD has been widely studied and compelling evidences demonstrated the role of neuroinflammatory response in the progression of PD . Other sThe main pathological feature of PD is the death of dopaminergic neurons in the SNpc . These nAnother important aspect of the biology of PD is the role of \u03b1-synuclein in the pathogenesis of the disease. It is known that \u03b1-synuclein can be present in different aggregation states, from monomers to small fibrils, being the main compound of the Lewy bodies. For instance, oligomers of \u03b1-synuclein are toxic for neurons .From the clinical point of view, we can explain the progression of the disease according to Braak\u2019s hypothesis, based on the spread of \u03b1-synuclein pathology and its effects over the time . The proAnother important structure involved in PD is the LC, which is a small brainstem nucleus located on the rostral side of the fourth ventricle in the CNS. It is also a major source of norepinephrine (NE) in CNS. NE was one of the first neurotransmitters to be identified by Swedish physiologist Ulf von Euler in 1945 . BesidesThe integrity of LC and the connectivity between this structure and the rest of the brain, are crucial to regulate a variety of responses throughout the CNS. Impairment of LC function has been suggested to contribute to many neurodegenerative diseases, such PD . BesidesAside from the degeneration of dopaminergic neurons in the SNpc and intraneuronal synuclein deposits, inflammation is a key component in PD. The concentration of microglia is particularly high in SNpc. The inflammatory response in PD is mainly carried out by microglial cells and to a minor extent by astrocytes . As we min vitro inhibition of NRS protects neurons in co-culture with lipopolysaccharide (LPS) activated microglial cells , 6-hydroxidopamine (6-OHDA) and LPS are the main PD mice models used, due to their ability to induce cell death and microglial activation . The linParkinson\u2019s disease mouse model based on LPS injections, is able to selectively induce dopaminergic cell death in the SNpc more efficiently than in the striatum . Removinin vivo models of \u03b1-synuclein overexpression showed microglial activation. In fact, overexpression of a mutant form of \u03b1-synuclein (A53T and A30P) induces microglial activation in a transgenic mouse model leading to early pro-inflammatory microglial activity  models, where the overexpression of \u03b1-synuclein increases motor impairment as well as dopaminergic degeneration in the SNpc. Furthermore, \u03b1-synuclein binding to TLR4 enhances microglial phagocytic capacity as well as the production of pro-inflammatory factors, such as TNF-\u03b1 . Indeed,The main pathways involved in the inflammatory process in PD are very similar to the one elicited in AD. C-Jun N-terminal Kinase (JNK), mitogen-activated protein kinase (MAPK) or nuclear factor \u03ba\u03b2 (NF\u03ba\u03b2) pathways are mainly involved in the inflammatory response in PD. For instance, MPTP mouse models trigger the activation of cyclooxygenase 2 (COX2) by JNK2 and JNK3 related to JNK pathways. Indeed, JNK2 and JNK3 deficiency reduces dopaminergic cell death . The actAltogether, the microglial activation and the consequent inflammatory response taken place in PD is a major component of the pathology, having a key role in the progression of the disease. However, the exact mechanism governing the activation of microglial cells and how is that affecting to the neuronal survival still remains unclear.in vivo through adrenergic receptors  PD-like rat model. TGF-\u03b21 action takes place by blocking Smad3 inhibitor SIS3 and caspase-3/9 activity . AnotherTo induce a shift in the microglial profile from anti- to pro-inflammatory state, would be another potential strategy to reduce the inflammatory response. For instance, IL-4 is an inflammatory molecule link to the \u201cM2-like\u201d phenotype in microglial cells. Recently, Kizil et al., demonstrated in 3D cultures amyloid-\u03b242 reduces neural stem cell (NSC) plasticity by inducing kynurenic acid (KYNA) production. IL-4 restores NSC proliferative and neurogenic ability by suppressing the KYNA-producing enzyme Kynurenine aminotransferase . Howeverex vivo. Recently, in 2017, Prokop\u2019s lab demonstrated that APP/PS1 mice lacking of immunoproteasome subunit 7 (LMP7) had a reduced inflammatory response (Over the last decade, it has been suggested the immunoproteasome as a valid target counteract the AD pathology in relation to microglial response and innate immune system. In 2012, response .Another therapeutic approach considered to counteract the progression of neurodegenerative disease is the use of peripheral macrophages. Recently, Microglial state-of-art in neurodegenerative disorders shed light on the key role of the inflammatory response and microglial activation in the progression of neuronal disorders such as AD, PD or FTD. To understand the complex cellular interplay, we need to unravel the main mechanism controlling microglial activation. Turns out, microglia activation profile seems to be region and context dependent in brain disorders. As discussed over the review, gray or white matter content, aging, microglial content, re-organization or neuronal network and neuronal loss differ between regions and might have a clear impact in microglial performance in brain-related diseases, such as PD or AD.Besides the role of the environment and cell interactions with microglial cells, another key factor driving specific microglial response is related to the expression and activation of different PRRs. The combination of different PRRs and the interaction with different ligands pictures the mosaic of potential microglial response. This heterogeneity represents a scientific challenge but also open the possibility to find new therapeutic targets to halt the progression of the different disorders.vice versa in later stages of the pathology.The discrepancies on the role of the anti- and pro-inflammatory cytokines demonstrate the complexity of the microglial regulation in the brain. Therefore, further research is needed to unravel the frame windows where the modulation of either pro- or anti-inflammatory cytokines suits the different stages of the pathologies. For instance, at the beginning of the pathology some degree of inflammatory response might be needed, so that, the anti-inflammatory response might be reduced and However, and despite of these differences, some similarities can be found in microglial activation linked to the inflammatory response elicited in the neurological disorders described in the review. The production and release of inflammatory mediators such as cytokines, ROS and RNS seem to be a common feature linked to microglial response, which is tightly related to neurological disorders where protein homeostasis is imbalanced, such as PD, AD and FTD. Besides the protein aggregation, microglial activation linked to neuronal dysfunction has been observed in the neurological disorders reviewed. Thus, protein aggregation and neuronal death might share some common mechanism governing microglial inflammatory response.Despite of the similarities described, the region-specific differences and microglial heterogeneity of the response, needs to be unraveled in order to fully understand disease-dependent microglial activation mechanisms to find new therapeutic targets Box .BOX 1-Single-cell analysis of microglial cells isolated from different brain areas and diseases at different time points.-To study the interplay between glial cells and neurons to identify new microglial regulatory mechanisms.-To develop new mouse models where microglial related risk factors along with disease related mutations are together to study the role of microglial cells.-Better understanding of inflammatory response dynamics, to differentiate different periods in the response.All authors provided sections of text covering their area of expertise and participated in the proofreading and discussion. AB-S organized and supervised the review with the active collaboration of the rest of the authors. SB wrote about FTLD, IJ-F wrote the introduction and made the figure, YY and AP wrote about Alzheimer\u2019s disease. MS and TD were involved in the writing process.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "NEDD8 and CULLIN-1, were significantly upregulated in inflamed arthritic synovia. Functionally, neddylation activation was crucial for synovitis of CIA, as the inhibition of neddylation by MLN4924 significantly suppressed synovial cell proliferation and inflammatory responses. Mechanistically, neddylation mediated inflammatory arthritis by regulating NF-\u03baB activation in fibroblast-like synovial cells (FLSs). Furthermore, TNF receptor-associated factor 6 (TRAF6) neddylation at Lys124 was essential for IL-17A-induced NF-\u03baB activation. Replacing the Lys-124 residue with Arg (K124R) resulted in significantly impaired conjugation of NEDD8 to TRAF6, as well as markedly attenuated IL-17A-induced NF-\u03baB activity. Therefore, the pathogenic role of neddylation in CIA as well as its mechanism of action demonstrated here provides a new insight into understanding the role of post-transcriptional modifications in the arthritis inflammatory response.Neddylation is a process similar to ubiquitination, and is critical in various inflammatory diseases; however, its importance in the pathogenesis of inflammatory arthritis is not well understood. Here, we investigated the role of neddylation in collagen-induced arthritis (CIA) and its clinical relevance. We showed that neddylation-related genes, including  The role of neddylatin in inflammatory arthritis is not well understood. Here we reveal that NEDD8 and CULLIN-1 are significantly upregulated in the synovium of patients with RA. Neddylation activation is crucial for the pathobiology of collagen-induced arthritis. Mechanistically, TRAF6 neddylation at Lys124 is essential for IL-17A-induced NF-\u03baB activation in synoviocytes. Rheumatoid arthritis (RA), an autoimmune and systemic inflammatory disorder characterized by chronic synovitis and cellular infiltration, often leads to bone erosion and cartilage destruction . SignifiPosttranslational modification by ubiquitin has been demonstrated to be a critical mechanism regulating the pathogenesis of inflammatory arthritis . The rol\u03b2-TrCP is important for the function of SCF\u03b2-TrCP in ubiquitination of IkB\u03b1 and NF-\u03baB precursor p105 [Cullin-RING E3 ligases (CRLs) are a class of ubiquitin ligases that control the proteasomal degradation of numerous target proteins, including I\u03baB . Except sor p105 , 13. Nedsor p105 . The welsor p105 , 16. Recsor p105 . Except sor p105 , the nedsor p105 , T cellssor p105 , myeloidsor p105 , macrophsor p105 , and endsor p105  during iGiven that CRLs play a key role in the etiology of inflammatory arthritis, and that their activity is also positively regulated by neddylation, here we investigated whether neddylation is involved in the pathogenesis of CIA. Our findings uncover a pathogenic role of neddylation in CIA and delineate a previously unknown mechanism involved in its process.NEDD8 and CULLIN-1 were notably increased in the synovium of patients with RA compared to that in patients with noninflamed OA  surgery for end-stage RA. Furthermore, synovial tissues isolated from six patients with noninflamed osteoarthritis (OA) who underwent TKA were used as control . RT-PCR  OA Fig.\u00a0. Moreove OA Fig.\u00a0. CollectNext, we investigated the pathogenic role of neddylation in the CIA model of RA. MLN4924 was used to attenuate neddylation in this model. As shown in Fig.\u00a0Since IL-17 plays a pathogenic role in the CIA model of RA , we nextHaving observed the role of neddylation in the development of CIA, we next sought to uncover the underlying mechanisms by which neddylation mediated synovitis. NF-\u03baB has been previously identified as a central mediator in the pathogenesis of inflammatory arthritis , and ourTRAF6 is a key adaptor downstream of the IL-17A pathway, and a previous study demonstrated that TRAF6 polyubiquitination was essential for NF-\u03baB activation . HoweverNEDD8 and CULLIN-1 were significantly upregulated in the synovium of patients with RA compared to that in patients with noninflamed OA. Our data demonstrated that activation of neddylation is crucial for the CIA response. Mechanistically, neddylation mediated inflammatory arthritis by regulating NF-\u03baB activation. Furthermore, TRAF6 neddylation at Lys124 was essential for IL-17A-induced NF-\u03baB activation in FLSs. Therefore, elucidating the pathogenic role of neddylation in CIA and its mechanism of action provides a new insight into the role of post-transcriptional modifications in innate immunity. These findings also offer potential therapeutic strategies for inflammatory arthritis, such as targeting neddylation activation.Ubiquitination has been previously identified as a critical process regulating the pathogenesis of inflammatory arthritis ; howeverUnderstanding the mechanisms that control responses to inflammation is important for developing effective therapies for inflammatory arthritis. NF-\u03baB is a transcriptional activator that plays a critical role in the pathogenesis of RA . With inBesides ubiquitination, a number of reports has demonstrated the essential role of neddylation in regulating NF-\u03baB activity. Studies have shown that neddylation exert critical functions in various inflammatory diseases such as atherogenesis , colitisAlthough the well-characterized substrates of NEDD8 modification are the cullin subunits of CRLs, non-cullin substrates of neddylation have also been recently identified for their roles in various signaling pathways. For instance, MYD88 neddylation negatively regulates MYD88-dependent NF-\u03baB signaling by antagonizing its ubiquitination . FurtherIn the present study, we found that TRAF6 neddylation was essential for IL-17A-induced NF-\u03baB activation. TRAF6 is one of seven closely related TRAF proteins, which are adapter proteins linking the TNF receptor superfamily to intracellular signaling transmission . FurtherSince IL-17 plays a critical role in the development of CIA , here weHowever, we would like to point out some potential limitations of our study. First, although our results revealed that TRAF6 neddylation was essential for IL-17A-induced NF-\u03baB activation, these results were mainly acquired based on in vitro experiments. Whether the same mechanisms are shared in vivo still need further investigations. Furthermore, it must be noted that the types of human arthritis most closely linked with IL-17 are spondyloarthritides , 35. TheIn conclusion, our study demonstrated that neddylation plays a pathogenic role in CIA. TRAF6 neddylation might mediate inflammatory arthritis responses by regulating NF-\u03baB activation. These findings provide new insight into understanding post-transcriptional modifications in innate immunity as well as offer potential therapeutic strategies for the treatment of inflammatory arthritis, such as targeting neddylation activation.Synovium tissues were obtained from 6 patients with noninflamed OA and 12 patients with RA who underwent total joint arthroplasty (TKA) surgery. All human sample acquisitions were approved by the ethical committee of Ruijin Hospital, SJTU School of Medicine, China, and performed in accordance with the Declaration of Helsinki Principles. All participants provided written informed consent, which was obtained before enrollment in the study.Eight-week-old male DBA/1 mice were purchased from Model Animal Research Center of Nanjing University. The animals that were randomly grouped were not performed in a blinded manner. The animals were housed with free access to water and rat diet in an airconditioned room with a 12-h light\u2013dark cycle, at 21\u221223\u2009\u00b0C and 60% relative humidity in the animal facility at Ruijin Hospital, Shanghai Jiaotong University (SJTU) School of Medicine, China. All animal experiments were performed according to the protocol approved by the SJTU Animal Care and Use Committee and in direct accordance with the Ministry of Science and Technology of the People\u2019s Republic of China on Animal Care guidelines. All surgeries were performed under anesthesia and all efforts were made to minimize suffering.Collagen-induced arthritis was performed according to previous report . BrieflyMRI performance and data analysis to evaluate the synovium volume in vivo were performed according to a previous report .Human specimens were taken with ethical approval of the Shanghai Ruijin Hospital review board. Synovium was obtained from the articular capsule of informed patients, who suffered from end-stage arthropathy (RA) undergoing TKA. As described previously , after wHEK293T cells were seeded in 24-well plates and transfected the following day by lipofectamine 2000 according to the manufacturer\u2019s instruction. Approximately 100\u2009ng of NF-\u03baB luciferase reporter plasmid and 10\u2009ng of Renilla luciferase reporter plasmid were transfected together with indicated expression plasmids. Luciferase activity was measured 24\u2009h after transfection with Dual Luciferase reporter assay system (Promega). Relative NF-\u03baB activity was calculated as firefly luminescence relative to Renilla luminescence.HEK293T cells were seeded in six-well plates and transfected the following day by Lipofectamine 2000 according to the manufacturer\u2019s instruction. Two micrograms of HA-tagged NeDD8 expression plasmid or/and 2\u2009\u03bcg of Flag-tagged WT TRAF6 or mutant TRAF6 expression plasmid were transfected. IP assay was performed 36\u2009h after transfection. Briefly, HEK293T cells were lysed in lysis buffer , 1% Triton X-100, 10% Glycerol and protease inhibitor cocktail) and the supernatant were incubated with anti-Flag antibody overnight at 4\u2009\u00b0C. Then the protein A\u2009+\u2009G beads were added to the supernatant incubating for another 2\u2009h. After extensive washing, the beads were boiled at 100\u2009\u00b0C for 10\u2009min.The paraffin-embedded tissues were used for the immunohistochemical analysis of NeDD8 and Cullin1 expression in the synovial tissue from patients and mice. Full-thickness specimens were processed for immunohistochemical analysis as previously described. Briefly, after the slides were incubated with blocking serum  for 60\u2009min, they were blotted and then overlaid with the primary antibody against Nedd8 and Cullin1 for 2\u2009h at room temperature, respectively. Subsequently, biotinylated secondary antibodies were added into the sections, followed by a peroxidase-labeled streptavidin-biotin staining technique .Human primary FLSs were seeded in 12-well plates. When cell confluence reaches 90%, cells were then scratched per well vertically with the P1000 pipette tip to make a scratch. Following washing twice with PBS, cells were treated with 100\u2009ng/ml IL-17A in the presence or absence of 100\u2009nM MLN4924. The same fields were photographed and the scratched area was calculated by Image-pro Plus 6.0.The paw/foot withdrawal threshold was effective to quantify the severity of affected paws pain in CIA . The micReal-time RT-PCR specific primers were used to evaluate gene expression. RNA analysis was done as previously reported . Real-tiThe culture medium supernatant was harvested and assayed for cytokine content using commercially available ELISA reagents for TNF-\u03b1 and IL-6 .t tests to determine significances between two groups. We did analyses of multiple groups by one- or two-way ANOVA with Bonferroni post-test of GraphPad prism version 6. For all statistical tests, we considered P value\u2009<\u20090.05 to be statistically significant.All data representative of three independent experiments are present as mean\u2009\u00b1\u2009SEM. We used two-tailed"}
+{"text": "TaSTI family, which were named according to their distribution on group 2 and group 6 chromosomes. Interestingly, TaSTI-2 members were found to express higher as compared to TaSTI-6 members under heat stress conditions, with TaSTI-2A being one of the most heat-responsive member. Consistent with this, the heterologous expression of TaSTI-2A in Arabidopsis resulted in enhanced basal as well as acquired thermotolerance as revealed by the higher yield of the plants under stress conditions. Similarly in the case of rice, TaSTI-2A transgenics exhibited enhanced thermal tolerance. Moreover, we demonstrate that TaSTI-2A interacts with TaHSP90 not only in the nucleus but also in the ER and Golgi bodies, which has not been shown till now. Additionally, TaHSP70 was also found to interact with TaSTI-6D specifically in the cytosol. Thus, these data together suggested that the TaSTI family members might play different roles under heat stress conditions in order to fine-tune the heat stress response in plants.STI/HOP functions as a co-chaperone of HSP90 and HSP70 whose molecular function has largely been being restricted as an adaptor protein. However, its role in thermotolerance is not well explored. In this article, we have identified six members of the  Plants unlike animals cannot escape from unfavorable environmental conditions. Changes in ambient temperature become the most common form of stress encountered by plants. When the temperature reaches higher than that required for optimum growth, it leads to irreversible damage and is generally known as heat stress (HS) . At the The HSP90/70 organizing protein (HOP) is the co-chaperone that functions as an adaptor in HSP90 and HSP70 machinery . HOP, alC. elegans, the expression of STI1 was found to be induced by HS. Also, the mutants of STI1 in C. elegans showed a shorter life span and decreased fertility rate, thereby indicating its role in stress responses and in aging processes  and the Potato Virus Y proliferation in Nicotiana benthamiana and tobacco, respectively . These protein sequences were further used for Blast search against available T. aestivum genome (T. aestivum-Ensembl Genomes 41), and a total of six members were identified. One of the TaSTI members was previously identified in the lab from the HS cDNA library (GD189073), which was submitted to the NCBI database  cultivar PBW343 and C306 and Arabidopsis ecotype Col-0 were used in this study. Wheat seeds were surface-sterilized with 4% sodium hypochlorite for 20 min followed by five to six washes with autoclaved sterile water. After sterilization, seeds were grown on a cotton tray in a growth chamber  maintained at 22 \u00b1 1\u00b0C with a 16-h photoperiod. Arabidopsis plants were grown on half strength Murashige and Skoog (MS) media. For the stress treatment of wheat, 10-day-old seedlings were subjected to different abiotic stresses such as heat (42\u00b0C for 2 h), cold (4\u00b0C for 24 h), salt (200 mM for 24 h), and drought (200 mM mannitol for 24 h)  . Ten-dayActin was used as a housekeeping gene. Graphs were plotted using three biological and three technical replicates. The wheat expression database  values for all the STI members were downloaded from this database. TPM values were log-transformed (Log2X) in order to generate a heatmap using the gplots package and Rcolorbrewer package.Total RNA was isolated using the RNeasy plant mini kit  according to the manufacturer\u2019s instructions, including on-column DNaseI treatment to remove genomic DNA contamination. Two micrograms of the total RNA was used as a template to synthesize cDNA employing the High Capacity cDNA Archive kit  and mixed with 200 nM of each primer and SYBR Green PCR Master Mix (Applied Biosystems) for real-time PCR analysis, using the ABI Prism 7000 Sequence Detection System and Software (PE Applied Biosystems) according to the manufacturer\u2019s protocol. Relative fold change was calculated, and database  hosted aTaSTI members was extracted from the Ensembl database (T. aestivum-Ensembl Genomes 41). The cis-elements in promoters were subsequently searched using the PLACE and PlantCare database , the 2-kb upstream region of all the database .TaSTI1-2A and TaHSP90 were cloned into pENTR/D-TOPO vectors and further into pDEST-GADT7 and pDEST-GBKT7 vectors . The recombinant plasmids were transformed into the yeast strain AH109 harboring the ADE3 and HIS3 reporter genes. The reporter gene activity was confirmed by a viability test on a medium lacking histidine, leucine, and tryptophan (-HLW) along with 0.5 mM 3-AT .For the measurement of the interaction, the putative interactants, TaSTI-2A gene was cloned into a pYES2 vector between the EcoRI and HindIII sites. For the confirmation of complementation, the colonies obtained after transformation were dotted with increasing dilutions on \u2013U plates and kept inverted at 30\u00b0C (permissive temperature for growth of the yeast sti mutant) and 37\u00b0C (restrictive temperature for growth of yeast sti mutant) for 3 days for the growth of the yeast colonies.To check for complementation, the full-length TaSTI members were fused in frame with the C terminal of YFP. Onion epidermal cells were used for bombardment by using the PDS-1000 bombardment system  at a pressure of 1100 psi with gold particles coated with plasmid constructs . The amplified product was then cloned in an entry vector (pENTRTM/D-TOPO) and then in a destination vector pMDC32 under a CaMV35S promoter following the GatewayTM cloning strategy . The GV3101 strain of Agrobacterium tumefaciens harboring pMDC32-TaSTI-2A was used for transformation in A. thaliana through the floral dip method  seeds (variety PB1) were obtained from IARI. Seeds were surface-sterilized by using 0.1% HgCl2 (v/v) for 15 min and washed repeatedly with autoclaved sterile water, and then imbibed in water at 28\u00b0C for 16 h. Rice transgenics were generated using the protocol described by A. tumefaciens. These calli were washed after 3 days of co-cultivation and kept on a selection medium containing hygromycin. The positive calli were then transferred to a regeneration medium until plantlets were formed. These plantlets were transferred to rooting medium for 10 days and then on the rice growth medium.Rice  was done (Arabidopsis WT and overexpression transgenics were subjected to HS (42\u00b0C for 2 h) after which overnight staining of the plants was done by incubating them in NBT . The seedlings were washed with water on the next day and subjected to removal of chlorophyll by dipping them in bleaching solution . The plants were then visualized under a bright field light microscope (Leica), and pictures were taken for the comparison of ROS in transgenics and the WT Arabidopsis plants after heat stress treatment.In order to check the amount of reactive oxygen species (ROS) produced in response to HS in transgenic was done . For thiFor rice, 1-month-old plants were taken, and a similar protocol was followed for the comparison of ROS in rice WT and overexpression transgenic lines. NBT staining was done after giving them heat stress.Measurements of modulated chlorophyll fluorescence emission from the upper surface of the leaf were made using a pulse amplitude modulation fluorometer . Leaves of plants were dark-adapted for 20 min before measuring the induction of fluorescence. Measurements of the PSII function of maximum photosynthetic efficiency (Fv/Fm) was recorded in rosette leaves after stress treatments in at least 10 plants per line viz. WT and transgenics. The same protocol was followed with the rice transgenics.Two-week-old wild-type and transgenic plants were subjected to HS. For chlorophyll estimation, 100 mg of leaf tissue was taken in a tube containing 2.5 ml of DMSO. Tubes were incubated overnight for chlorophyll bleaching. Absorbance was taken at 645 nm and 663 nm in a UV\u2013Vis spectrophotometer , and chlorophyll content was estimated accordingly .For Membrane Stability Index (MSI) analysis, 2-week-old stressed and non-stressed seedlings were used. MSI was determined by measuring electrical conductivity with an EC-meter ; 100 mg of leaf tissue was dipped in 10 ml of double distilled water. The tubes were kept at 30\u00b0C for 30 min, and conductivity was measured (C1). The seedlings were then autoclaved for 15 min, and electrical conductivity was measured again (C2) in the supernatant. Cellular injury was determined accordingly .Arabidopsis plants were grown on half-strength MS medium in petri plates at 20\u00b0C with 16-h photoperiod in daily cycle. Two-week-old plants were subjected to HS at 42\u00b0C for 4 h and kept back to recovery. To check for acquired thermotolerance, 2-week-old plants were subjected to continuous heat stress at 30\u00b0C for its growth and development. Different yield parameters were checked by observing the seed weight, silique number, and silique length of three lines, respectively.TaSTI members had a similar organization of introns and exons. On the other hand, all the group 6 TaSTI members were found to have longer introns as compared to TaSTI-2 family members (TaSTI-6D was found to be the longest coding member (2498 bp), whereas TaSTI-2D was found to have the shortest coding sequence (2270 bp). These six STI members with complete coding sequences were used for further analysis.To identify the putative STI members in wheat genome, we searched the database with the known STI proteins as query. In total, we obtained six STI genes in wheat, which were mapped to group 2 and group 6 chromosomes. Therefore, the genes were named according to their chromosomal locations . These m members . TaSTI-6Aegilops tauschii. TaSTI-2A was observed to be close to Triticum turgidum STI. However, the TaSTI members that were present on group 6 chromosomes represented a different clade along with Triticum urartu. Thus, this suggested the divergent evolution of group 2 and group 6 members in wheat, and probably, these two loci of STI genes have existed from the beginning in the Triticeae lineage. Further, the multiple sequence alignment of the core STI domain revealed its conserved nature in most of the plants  tree based on a total of 22 STI members from different plants . All thee plants . Moreovebidopsis . Interesbidopsis . This incis-elements in the promoter region plays an important role in the regulation of gene expression and thus helps in responding to environmental conditions , and CCAATBOX1 elements was analyzed in the promoter regions. HSE forms an essential component of HSR as HSFs bind to these elements to enhance the expression of HSPs and other heat-responsive genes. Similarly, CCAATBOX1 has been known to contribute with HSE elements, and the STRE element has been reported to be involved in various stresses  under four different abiotic stresses such as heat, cold, salt, and drought conditions. Ten-day-old PBW343 seedlings were subjected to these abiotic stresses. As shown in TaSTI members, a concomitant increase in expression was observed with increasing temperatures, but their level decreased at 45\u00b0C. However, no specific pattern of expression could be observed in the case of group 6 TaSTI members. Since TaSTI-2A was one of the members, which showed highest induction under HS . The STI mutation in yeast causes mild growth defect at 37\u00b0C, which is the restrictive temperature for the growth of yeast  functions as the major regulators of the HSR as they regulate the expression of various small HSPs and other HSFs . Interesnditions . Apart fnditions . The expo the WT . InteresTaSTI-2A transgenic rice lines were generated using Agrobacterium-mediated transformation, and they were confirmed by PCR  in the ER . One of the TaSTI members was previously identified in the lab from the HS cDNA library (GD189073) which was submitted to the NCBI database (STI protein sequences of database .SM, SD, and HS contributed to experimental validation and PK gave the idea, concept, and facilities for the same. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "It is generally understood that the hydrogen permeability of Pd-Ag alloy membranes declines with decreasing temperature. However, recent studies have revealed that the hydrogen permeability of Pd-Ag alloy membranes inversely increases at a certain temperature range and reaches a peak. The peak behavior reflects the shape of pressure-composition isotherms (PCT curves). In order to elucidate the relationship between the reverse temperature dependence of hydrogen permeability and the PCT curves, the hydrogen permeability of pure Pd and Pd-X  alloy membranes were investigated. The pure Pd and Pd-5 mol%Ni alloy membranes, in which the \u03b1-\u03b1\u2019 phase transition occurs, exhibits more significant peak behaviors than Pd-5 mol%Ho, Pd-5 mol%Y, and Pd-23 mol%Ag alloy membranes, in which the \u03b1-\u03b1\u2019 phase transition is suppressed. Large differences in hydrogen solubility, at the hydrogen pressures above and below the plateau region or the inflection point, make the peak behaviors more significant. It is revealed that the peak temperature can be roughly predicted by the hydrogen pressure at the plateau regions or the inflection points in the PCT curves. Effective utilization of hydrogen energy is required to realize one of the sustainable development goals (SDGs) for 2030 adopted by the United Nations Summit, \u201cSDG 7 affordable and clean energy\u201d . The hydIn the present study, the reverse temperature dependence of hydrogen permeability for pure Pd and various Pd-based alloys, which contain elements to increase/decrease the hydrogen permeability of the Pd ,9,10, weP3/\u0394t) is the pressure change of the reserve tank per unit time, V is the volume of the reserve tank, R is the gas constant, T is the absolute temperature of the reserved tank, S is the effective area of the membrane for hydrogen permeation. A detailed explanation of the hydrogen permeation test is given elsewhere [J is the hydrogen flux through the sample foil, L is the thickness of the membrane, P1 and P2 are hydrogen pressures at the feed and permeation sides . Pure Pd foil was prepared . Pd-5 mol% Ho, Pd-5 mol% Y, and Pd-5 mol% Ni alloy foils were fabricated by melting of raw materials and subsequent cold-rolling process. The thickness of each foil was 25 \u03bcm, 99 \u03bcm, 114 \u03bcm, 193 \u03bcm, respectively. In view of the equilibrium phase diagram for Pd-Ho, Pd-Y, and Pd-Ni binary systems ,21,22, tlsewhere . HydrogeThe pressure\u2013composition isotherms (PCT curves) of pure Pd, Pd-5 mol% Ho, Pd-5 mol% Y, and Pd-5 mol% Ni were measured by a Sieverts\u2013type apparatus  in order to investigate the hydrogen solubility. A small piece of the sample was put into a cell for the PCT apparatus and then evacuated. Subsequently, it was heated up to approximately 500 \u00b0C, followed by introducing high purity hydrogen gas (approximately 5 MPa). The sample cell was cooled down to room temperature under the hydrogen atmosphere, and evacuated again. This activation process was repeated 4 times prior to the PCT measurements. After the activation process, the PCT curves were measured at 400 \u00b0C and 250 \u00b0C up to about 2 MPa.\u03d5) of pure Pd, Pd-5 mol%Ho alloy, Pd-5 mol% Y alloy and Pd-5 mol% Ni alloy membranes. For comparison, the hydrogen permeation coefficient of Pd-23 mol%Ag alloy membrane is also shown in the figure [e figure . The areTpeak). The hydrogen permeation coefficient at Tpeak is defined as the peak hydrogen permeation coefficient (\u03d5peak). In order to describe a height of the peak, the \u03d5peak is normalized by the local minimum of the hydrogen permeation coefficient (\u03d5lm), which is denoted as the normalized peak hydrogen permeation coefficient (\u03d5peak/\u03d5lm). The higher temperature at which the hydrogen permeation coefficient reaches \u03d5peak (Thigh) is quantified to calculate the difference between Thigh and Tpeak (Thigh \u2212 Tpeak) as an indicator of how much the operating temperature can be lowered while keeping the hydrogen permeability. From Tpeak) of the Pd-23 mol% Ag and Pd-5 mol% Ni alloy membranes were the highest (180 \u00b0C) and the lowest (45 \u00b0C) among the membranes investigated in the present study. The peak hydrogen permeation coefficient (\u03d5peak) of the Pd-5 mol% Y alloy membrane was the highest (3.49 \u00d7 10\u22128 mol H2\u00b7m\u22121\u00b7s\u22121\u00b7Pa\u22121/2) and roughly 3 times higher than that of the pure Pd membrane. The normalized peak hydrogen permeation coefficient (\u03d5peak/\u03d5lm) of the pure Pd was approximately 4.3, indicating that the hydrogen permeation coefficient increased by roughly 4 times by the peak behavior. \u03d5peak/\u03d5lm of the Pd-5 mol% Ni alloy membrane was the second highest. \u03d5peak/\u03d5lm of the Pd-5 mol% Ho, Pd-5 mol% Y, and Pd-23 mol% Ag alloy membranes were almost the same values around 1.1~1.4. The pure Pd membrane exhibited the largest temperature difference between Thigh and Tpeak (Thigh \u2212 Tpeak = 330 \u00b0C), indicating that the operating temperature can be lowered the most while maintaining the hydrogen permeability. Also in the case of Pd-5 mol% Y, Pd-5 mol% Ho, and Pd-23 mol% Ag alloy membranes, Thigh \u2212 Tpeak was still large (220~290 \u00b0C), and the hydrogen permeability at 400~450 \u00b0C could be obtained even at 160~180 \u00b0C. Although the peak temperature (Tpeak) of Pd-5 mol% Ni alloy membrane was the lowest (approximately 45 \u00b0C), the hydrogen permeation coefficient at the peak temperature (\u03d5peak) was the lowest and Thigh \u2212 Tpeak was the smallest. The values related to the peak behaviors are summarized in R is the gas constant, T is absolute temperature, B is the mobility of hydrogen atoms, c1 and c2 are the hydrogen concentrations at the feed and permeation sides, and P0 is the standard hydrogen pressure (101325 Pa). The integral term in Equation (3) is defined as the PCT factor (fPCT) because it can be evaluated with the PCT curves [In order to evaluate the hydrogen diffusivity and solubility quantitatively, the following consistent description of hydrogen permeation based on hydrogen chemical potential was applied .(3)J=RTT curves . P1 = 0.10 MPa and P2 = 0.01 MPa). The mobility of hydrogen atoms (B) was also quantified by combining the results of the hydrogen permeation tests with the PCT factors. The PCT factors and mobility of hydrogen atoms at 400 \u00b0C and 250 \u00b0C are shown in The PCT factors of pure Pd and Pd alloys were quantified as the hydrogen solubility using the PCT curves in P1 = 0.10 MPa and P2 = 0.01 MPa). As shown in dln(P/P0)/dc) is zero in the plateau region.cL and cH are the equilibrium hydrogen concentration in \u03b1 and \u03b1\u2019 phase, respectively, under \u03b1/\u03b1\u2019 two phase coexistence. fPCT) and hydrogen concentrations at the feed and permeation sides (c1 and c2) as a function of the inverse of temperature. The PCT factor increased almost linearly with decreasing temperature above 150 \u00b0C. The PCT factor at 150 \u00b0C was roughly 3 times higher than that at 400 \u00b0C. When the temperature was below 150 \u00b0C, the PCT factor increased drastically. The decrease in temperature of only 20 \u00b0C from 150 \u00b0C provided approximately 4 times higher PCT factor. It is obvious that the significant increase in the PCT factor was caused by the \u03b1-\u03b1\u2019 phase transition as the hydrogen concentration at the feed side increased drastically to approximately 0.5 (H/M) at 130 \u00b0C. When the \u03b1-\u03b1\u2019 phase transition occurs, the plateau region does not contribute to the increase in the PCT factor because the slope of the PCT curves (dln(P/P0)/dc) in the plateau region is zero. Therefore, the increase in the integral interval (c2~c1), due to the increase in c1, does not contribute much to the increase in the PCT factor. The significant increase in hydrogen concentration (c) included in the integral term rather caused the increase in the PCT factor. At 60 \u00b0C, the hydrogen concentration at the permeation side also increased drastically to approximately 0.5 (H/M), due to the \u03b1-\u03b1\u2019 phase transition, resulting in the gradual increase in the PCT factor. c) and wider integral interval than pure Pd in Equation (3). The PCT curves of the Pd-23 mol% Ag did not have the plateau region even at low temperatures but instead had an inflection point  was approximately 4 times higher than the local minimum value of the hydrogen permeation coefficient (\u03d5lm)  . The signt (\u03d5lm) . The hydnt (\u03d5lm) . Althougnt (\u03d5lm) , the incnt (\u03d5lm) , leadingnt (\u03d5lm) . \u03d5peak/\u03d5lm = 1.1) at higher peak temperature (Tpeak = 180 \u00b0C) (\u03d5peak/\u03d5lm = 1.1~1.4), and (2) higher peak temperature around 160~180 \u00b0C. The addition of Ag into Pd increased hydrogen solubility at high temperature and suppressed the \u03b1-\u03b1\u2019 phase transition b,c, whic 180 \u00b0C) . The add 180 \u00b0C) : (1) Rel\u03d5peak/\u03d5lm = 2.0) compared with the Pd-5 mol% Ho, Pd-5 mol% Y, and Pd-23 mol% Ag alloy membranes  depends strongly on whether \u03b1-\u03b1\u2019 phase transition occurs or not (Tc) of the \u03b1-\u03b1\u2019 phase transition decreases almost linearly with increasing Ag concentration in Pd and was estimated to be approximately 20 \u00b0C in the case of Pd-23 mol%Ag alloy [Since the alloying elements in Pd slightly affected the mobility of hydrogen atoms c,d, the s or not a. Figures or not a,b,d. Ths or not b, which Ag alloy , which i\u03d5peak/\u03d5lm) (\u03d5peak/\u03d5lm). The PCT factors of the Pd-5 mol%Ho, Pd-5 mol%Y, and Pd-23 mol%Ag alloys with high hydrogen solubility were higher than those of the pure Pd and Pd-5 mol%Ni alloy at higher temperatures than the peak temperature (Tpeak) (\u03d5lm and lower \u03d5peak/\u03d5lm. The peak temperature (Tpeak) is related to the plateau pressure or the hydrogen pressure at the inflection point of the PCT curve because the peak behaviors start from temperatures at which the plateau pressure or the inflection pressure is included in the pressure condition. Lower plateau pressure or hydrogen pressure at the inflection point causes the region or the point to be included in the pressure condition at higher temperatures  . Also, teak/\u03d5lm)  decrease (Tpeak) , resultieratures c, resulteratures a. \u03d5peak/\u03d5lm). Lower plateau pressure or hydrogen pressure at the inflection point increases the peak temperature (Tpeak). The relationship between the PCT curves and the peak behaviors of hydrogen permeability is schematically summarized in \u22121 [In order to make the peak behaviors more significant at lower temperatures, it is effective to increase both the plateau pressure and hydrogen solubility at \u03b1\u2019 phase. On the other hand, suppression of the \u03b1-\u03b1\u2019 phase transition is practically important because the \u03b1-\u03b1\u2019 phase transition declines the durability of the membrane by crystal lattice expansion . Therefo\u22121 ) d large\u22121 ). It is \u22121 . The lat\u22121 ) althoug2S, CO, CO2, and H2O may affect the peak behaviors. Therefore, the stability of the membrane under thermal cycling and the presence of impurity gases need to be investigated in the future. Even when the \u03b1-\u03b1\u2019 phase transition is suppressed, the peak behaviors are accompanied by a significant increase in hydrogen concentration at the feed side, which will lead to crystal lattice expansion. When the operation of the membranes is thermally cycled, there is a possibility to decline the durabilities due to the repeated lattice expansion and shrinkage. Also, in the present study, the peak behaviors under pure hydrogen gas atmosphere were investigated. However, the presence of impurity gases such as HAnother important finding is that the activation energy for hydrogen diffusion increases due to the \u03b1-\u03b1\u2019 phase transition . There aIn the present study, the reverse temperature dependence of hydrogen permeability through pure Pd and various Pd-based alloy membranes is investigated. The pure Pd membranes exhibites a significant and discontinuous peak behavior, which is caused by the \u03b1-\u03b1\u2019 phase transition. Although the activation energy for hydrogen diffusion increases by the \u03b1-\u03b1\u2019 phase transition, significant increment in the PCT factor is far superior to the decrement in the mobility of hydrogen atoms. The addition of Ho, Y, and Ag into Pd suppress the \u03b1-\u03b1\u2019 phase transition, resulting in moderate and continuous peak behaviors. The addition of Ni into Pd does not contribute to the suppression of the \u03b1-\u03b1\u2019 phase transition and generates a large peak at the lowest temperature. It is revealed that the peak behaviors can be roughly predicted by the PCT curves at a temperature higher than the peak temperature. Among the alloys investigated in the present study, the Pd-5 mol%Y exhibits the most preferred peak behaviors. The peak is not due to the \u03b1-\u03b1\u2019 phase transition and shows the highest peak hydrogen permeation coefficient."}
+{"text": "Marfan syndrome is an autosomal dominant connective tissue disorder with anomalies involving the musculoskeletal system, cardiovascular system, skin, eyes, and teeth. Patients with Marfan syndrome are especially prone to cardiovascular complications, which increases the risk multifold under general anesthesia. This is a case of a 37-year-old Marfan syndrome male patient with cardiac manifestations and his anesthesia course during emergency wound debridement. Marfan syndrome is an autosomal dominant hereditary connective tissue disease with an estimated prevalence of 1/5000 newborns, of which 25 to 30% are new mutations. Marfan syndrome impacts multiple systems like skeletal, ocular, and cardiovascular. Aortic dilation and dissection are the primary causes for mortality and morbidity in this group of patients .\u00a0Marfan syndrome is an inherited condition that affects several systems and structures. The clinical presentation and nature of the disorder vary from person to person, age, and gender. The symptomatic variations are also observed within the same family structure. Many individuals with Marfan syndrome may not have any of the characteristics and/or symptoms identified with Marfan syndrome. In certain instances, this disorder will not be recognized by the parents and may be asymptomatic . In thisUpon general inspection, the patient was taller and had a slim build, the lower portion of his body being stretched with respect to the upper half. He was 89 kg in weight and 6.4 inches in\u00a0height [The ocular conditions associated with our patient like V pattern strabismus, enophthalmos, and high myopia were observed as shown in Figure In addition, orthodontic care was needed and suggested to the patient because of his high arched palate and dental crowding, shifted midline along with open crossbite, which are also classic conditions seen in patients with Marfan syndrome, which makes him prone for an anticipated difficult airway . Hence aOur Marfan syndrome patient presented with a set of multiple cardiovascular complications which would be at very high risk when put under general anesthesia. Hence his forearm wound debridement surgery was then decided to be carried out by choosing ultrasound-guided in-plane supraclavicular brachial plexus nerve block ,9.Besides systemic complications, Marfan syndrome impacts the personality and quality of life of the affected person . The weaDue to high mortality and morbidity associated with aortic dissection, anesthetic management of patients with Marfan syndrome is a difficult situation . We explMarfan syndrome is one of the most prevalent hereditary connective tissue disorders and this case is considered attributable to a wide spectrum of coronary, musculoskeletal, and vascular anomalies arising in a single patient. With a blunt wound trauma in his forearm, wound debridement under ultrasound-guided in-plane supraclavicular brachial plexus nerve block could minimize fatal complications and makes it unique for discussion."}
+{"text": "In the current research, dissimilar friction stir welded (FSW) sheets of AA2198-AA7475 and AA2198-AA6013 were solution treated at 460\u2013580 \u00b0C for 1 h. Annealing at 580 \u00b0C led to complete degradation of both dissimilar weldments from the AA2198 side. According to the microstructure inspection, solution treatment triggered abnormal grain growth within the stir zone (SZ), and applying higher treatment temperatures enhanced the fraction of transformed grains. SEM analysis revealed that the pre-melting of grain boundaries (GBs) over 540 \u00b0C encouraged the diffusion of solute atoms to the GBs. The massive diffusion of Cu to the GBs led to the formation of Cu-rich eutectic phases in AA7475 and AA2198 and dense Cu-rich particles in AA6013. In the meantime, the diffusion of Mg and Zn to the GBs of AA7475 and Fe and Si to the GBs of AA6013 eventuated in the formation of coarse particles at the GBs which, in return, attenuated the bonding adhesion of the grains at SZ. The formation of remarkable Cu-rich phases in the pre-melted regions and significant contraction of the eutectic phase while cooling as well as the formation of particles at GBs resulted in intergranular failure of the joints from the AA2198 side of the SZ. Owing to desired characteristics such as high strength and corrosion resistance, aluminum alloys have found an extensive range of applications in the aerospace and automotive industries ,2. For iTunneling defects  and kiss2Zn arrangement. Zaman Khan et al. [2Zn particles settled in the GBs during FSW and subsequent PWHT of the alloys of AA7085 [Post-weld heat treatment (PWHT) is usually employed to restore a significant portion of the lost mechanical strength of the joints, and several studies have investigated the effect of PWHT on the performance of welded sheets ,17. Prevn et al.  and Niu n et al.  have alsn et al.  performef AA7085 , AA7075 f AA7085 , and AA7f AA7085 . Rather f AA7085 ,33.The FSW parameters and PWHT conditions were optimized for different dissimilar joints between the AA2XXX to the AA7XXX ,35 and AThe sheets used in the present study were 2-mm-thick AA2198-T6, AA7475-W, and AA6013-T4 sheets. The chemical composition of the employed alloys is listed in \u22121, and 830 rpm, respectively. The FSWed sheets were solution-treated at four different temperatures of 460, 500, 540, 560, and 580 \u00b0C for 1 h in a conventional furnace and eventually air-cooled at room temperature. To perform the microstructural analysis, the cross-section of samples perpendicular to the weld traverse line were sectioned and mechanically polished. To reveal the microstructure through the optical microscope (OM) and scanning electron microscopy (SEM), the as-polished surface of the specimens was chemically etched with Barker\u2019s solution for 10 s. Phase transformations at GBs as well as the failure surfaces of the treated samples were inspected by SEM.The tool had a shoulder diameter, pin diameter, and pin height of 13.45, 4.70, and 3.16 mm, respectively. In addition, the advance angle, travel speed, and rotational rate of the tool were 2\u00b0, 50 mm minVariation of grain morphology along the weld line of AA2198-AA7475 after solution treatment at different temperatures is demonstrated in As shown, in the as-weld sample, the stir zone surface and the underpin area, which were in direct contact with the shoulder and tool pin, had the finest grains. Upon treatment at 460 \u00b0C, grain growth onset occurred in these severely strained regions and continued toward the center of SZ. Due to the higher kinetic of annealing at 500 \u00b0C, most of the grains on the AA7475 side of the SZ were dissolved in the grown grains. However, solution treatments at 540 and 560 \u00b0C were so effective that apart from the complete dissolution of the fine grains in coarser ones, most of the elongated grains in BMs were also recrystallized. Nevertheless, the formation of some interfacial phases vulnerable to corrosive media at GBs of AA7475 resulted in obvious intergranular corrosion in AA7475 during etching. Furthermore, the creation of a distinct boundary/interface in the SZ of the AA7475-AA2198 joint can be attributed to the kissing bond and immiscibility of the BMs . AccordiAs can be seen in SEM micrographs of As mentioned, by annealing below 560 \u00b0C for 1 h some fine grains remained, and grain growth was not yet comprehensive. Nonetheless, SEM analysis of Increasing the annealing temperature over 540 \u00b0C facilitated the diffusion of atoms to GBs and enhanced the possibility of eutectic phase formation in AA7475-AA2198 specimens. Morphology and distribution of the eutectic phase from BM to SZ of AA7475 are presented in The phase evolutions in the BM, HAZ, and SZ of the AA6013 after annealing at 580 \u00b0C are exhibited in To find the origin of intergranular failure after annealing at 580 \u00b0C, occupied boundaries with migrated elements were analyzed by microscope and the results are presented in The failure surface of the AA7475-AA2198 from the TMAZ/SZ interface after annealing at 560 and 580 \u00b0C are presented in By solutionizing, ultrafine grains were the initiation sites for abnormal grain growth within the SZ and experienced the maximum growth during treatment at elevated temperatures. Applying higher temperatures increased the growth rate of the grains and resulted in the disappearance of a higher fraction of fine grains at the expense of coarser ones.Treatment over 540 \u00b0C resulted in pre-melting/wetting of the GBs, and this accelerated the diffusion of the solute atoms to the GBs by the provision of the preferred migration channels. Consequently, for the AA2198-AA6013 specimens, Cu, Fe, and Si, and additionally in the AA2198-AA7475 joints, Cu, Zn, and Mg, migrated to the GBs. The diffusion of Cu to the GBs of AA2198 and AA7475 was accompanied by the formation of a Cu-rich eutectic phase, while in AA6013 this led to the formation of Cu-rich brittle particles. However, the diffusion of Mg and Zn in AA7475 and the diffusion of Si and Fe in AA6013 led to the formation of coarse polygonal particles at GBs, particularly at triple junctions.After air-cooling of solutionizing over 560 \u00b0C, the formation of a remarkable Cu-rich eutectic phase in the pre-melted zones, particularly in AA2198, resulted in intergranular failure due to solidification shrinkage. The formation of Mg and Zn particles at the weld interface of the AA7475-AA2198 joints and Si and Fe particles around the welding interface of the AA6013-AA2198 joints contributed to the failure of the weldments.In the current study, the dissimilar joints of AA2198-AA7475 and AA2198-AA6013 underwent solution treatment at 460\u2013580 \u00b0C for 1 h. Thermal treatment over 560 \u00b0C resulted in the failure of both weld specimens from the AA2198 side. Performing a comparative microstructure evolution analysis resulted in the below achievements:"}
+{"text": "It is widely accepted that inflammation may contribute to cognitive impairment in patients with vascular dementia (VD). Our prior clinical researches have reported that acupuncture can alleviate cognitive function in VD, but the underlying mechanisms are still unclear. The purpose of this research was to explore whether acupuncture alleviates cognitive impairment by suppressing the microRNA-93- (miR-93-) mediated Toll-like receptor (TLR) signaling pathway, which triggers inflammatory responses in the central nervous system. \u03baB)), and inflammatory cytokines were subsequently detected. TLR4 colocalized with neurons, microglia, and astrocytes in the hippocampus was evaluated. Neuroinflammation and cognitive function were determined after intracerebroventricular injection of TLR4 antagonist TAK-242 or agonist lipopolysaccharide (LPS) with or without acupuncture.  VD was established by permanent bilateral common carotid artery occlusion in male Wistar rats. Three days after operation, the rats began daily treatment with acupuncture for two weeks. The levels of miR-93, Toll-like receptors (TLR2 and TLR4), intracellular signaling molecules (myeloid differentiation factor 88 (MyD88) and nuclear factor-kappa B (NF-\u03baB signaling pathway activation. The overexpression of TLR4 in microglia, but not in astrocytes and neurons, was reversed by acupuncture. Furthermore, intracerebroventricular injection of TAK-242 had similar effects to acupuncture on inflammation and cognitive function, while LPS injection abolished the beneficial effects of acupuncture.  We found that acupuncture notably repressed the expression of inflammatory cytokines in the hippocampus and plasma of VD rats. The expression of TLR4, but not TLR2, was markedly downregulated by acupuncture, accompanied by a decrease in miR-93 and MyD88/NF-\u03baB signaling pathway in experimental VD. Acupuncture serves as a promising alternative therapy and may be an underlying TLR4 inhibitor for the treatment of VD. Taken together, these findings provide evidence that acupuncture attenuates cognitive impairment associated with inflammation through inhibition of the miR-93-mediated TLR4/MyD88/NF- Vascular dementia (VD) is the second most common type of dementia, which accounts for about 17 million cases of dementia at an annual cost of up to $200 billion . Animal \u03baB), which eventually promotes the generation of inflammatory cytokines, such as interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-\u03b1) [Toll-like receptors (TLRs) are significant pattern recognition receptors of the innate immune system, which initiates inflammatory cascades by recognizing pathogen- and damaged-associated molecular patterns . Toll-li (TNF-\u03b1) . Belkhel (TNF-\u03b1)  indicate (TNF-\u03b1)  demonstr\u03baB signaling pathway [\u03baB signaling pathway [MicroRNAs (miRNAs) are a class of endogenous noncoding, single-stranded RNAs with 19\u201325 nucleotides that inhibit protein translation, degrade mRNA by combining with the 3\u2032-untranslated regions (UTRs) of messenger RNAs (mRNAs), or activate gene expression by directly targeting the promoter sequence \u201318. As a pathway . ConsequAcupuncture, a traditional Chinese medical therapy, has been used in many countries for the management of neurological diseases, such as rehabilitation after stroke and dementia , 27. OurMale Wistar rats (270\u2013320\u2009g), provided by the Vital River Laboratory , were maintained with temperature (25 \u00b1 2\u00b0C), humidity (60 \u00b1 5%), and light (12-h light/dark cycle) control with free access to water and food. All animal experiments were conducted after being approved by the Institutional Animal Care and Use Committee of the Beijing University of Chinese Medicine.As we previously described, the rat model of VD was established by permanent bilateral common carotid artery occlusion (2VO) , 31. RatThree days after surgery, the animals were treated with acupuncture without anesthesia, once a day for two weeks and one day off after six treatments. After cleaning the skin with 75% alcohol, sterilized disposable stainless steel needles  were inserted 4\u2009mm deep at the selected points. In the 2VO+Acu group, Baihui (GV20) and bilaterally Zusanli (ST36) acupoints were chosen as the acupuncture sites. In the 2VO+Non-acu group, the bilateral hypochondria, 10\u2009mm above the anterior superior, was chosen as the insertion site. Detailed acupoint locations and manipulations are shown in To determine the anti-inflammation effect of acupuncture, rats were randomly assigned to 4 groups: sham, 2VO, 2VO+Acu, and 2VO+Non-acu (6 rats per group). The release of inflammatory cytokines in the hippocampus and plasma was detected by enzyme-linked immunosorbent assay (ELISA) .\u03baB p65 were measured by Western blot. The activation of TLR4 in the hippocampus was detected by immunohistochemistry. The distribution of TLR4 colocalized with neurons, astrocytes, and microglia of the hippocampus was determined by immunofluorescence  were performed. Rats were randomly assigned to different test agent groups with or without acupuncture and vehicle control groups: sham, 2VO, 2VO+Acu, 2VO+TAK-242, and 2VO+DMSO; sham, 2VO, 2VO+Acu, 2VO+Acu+LPS, 2VO+Acu+Saline, and 2VO+LPS groups (12 rats per group). The cognitive function and proinflammatory cytokine levels were evaluated by the Morris water maze (MWM) test and ELISA, respectively .\u03bcg/10\u2009\u03bcl [\u03bcl [\u03bcl/min, and the needle was left for an additional 10\u2009min before withdrawal to prevent reflux. All the infusion procedures were conducted 30\u2009min before treatment every day.The TLR4 agonist LPS  was dissolved in sterile saline and was administered at 1\u2009\u03bcg/10\u2009\u03bcl  into the0\u2009\u03bcl [\u03bcl , 34. DruInfusion rats were anesthetized with pelltobarbitalum natricum and placed in a stereotaxic apparatus . A stainless-steel cannula was implanted unilaterally into the lateral ventricle . Finally, the cannula was fixed on the skull with dental cement. Following surgery, animals were housed individually and allowed to recover for 7 days.To assess spatial learning and memory, the MWM was used as described before . The cir\u03b1 with commercially available ELISA kits  according to the manufacturer instructions.Supernatants from the hippocampus and plasma homogenates were used for detecting the concentrations of IL-6 and TNF-\u03baB p65, p-NF-\u03baB p65, and \u03b2-actin (Supplement Table The protein concentrations in the hippocampus were determined by the Pierce BCA Protein Assay kit (Thermo Scientific). Samples were separated by 8-12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Applygen) and electrically transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% nonfat dried milk for 1\u2009h and incubated overnight at 4\u00b0C with primary antibodies directed against TLR2, TLR4, MyD88, NF-\u03bcm). Brain sections with antigen retrieved in citric acid were incubated with a primary antibody to TLR4  following the manufacturer instructions. Complementary DNA (cDNA) was synthesized with miRNA First Strand cDNA Synthesis Kit (Tailing Reaction) (Sangon Biotech) and RNA PCR kit . The miRNA and mRNA levels of genes of interest were analyzed by real-time PCR, which was performed with 2x SYBR master mix , using a Bio-Rad iCycler iQ5 . The PCR cycle was as follows: 95\u00b0C/30\u2009s, 40 cycles of 94\u00b0C/30\u2009s, 59\u00b0C/30\u2009s, and 72\u00b0C/1\u2009min, and the melt-curve analysis was performed following each experiment. U6 RNA included in the kit was used as an endogenous reference gene for normalizing the miR-93 gene expression. Gene mRNA levels were normalized to that of GAPDH. The results were calculated by the 2P values < 0.05 were considered statistically significant.Data were expressed as mean \u00b1 SEM. MWM data were analyzed using two-way repeated measure ANOVA. One-way ANOVA was conducted to compare the results of quantitative data of the Western blot, ELISA, PCR analysis, and immunohistochemistry with the SPSS 22.0 software . \u03b1. The results showed that IL-6 were increased after 2VO surgery (P < 0.001), while the increase was suppressed by acupuncture both in the hippocampus and plasma  , while acupuncture treatment could significantly reverse the overexpression of TNF-\u03b1 induced by 2VO operation (P < 0.05)  ; in contrast, rats in the 2VO+Acu group showed obviously reduced protein and mRNA levels of TLR4 in comparison to those in the 2VO group (P < 0.01); no significant difference was found between the 2VO and 2VO+Non-acu groups (P > 0.05)  , while decreased in the 2VO+Acu group (P < 0.05); there was no significant difference between the 2VO and 2VO+Non-acu groups (P > 0.05) , while acupuncture ameliorated the enhancement (P < 0.01)  , but there was no significant difference between the 2VO and 2VO+Acu groups (P > 0.05) , but the increase was inhibited by acupuncture (P < 0.05)  , but acupuncture treatment notably inhibited the overexpression of miR-93 (P < 0.05). Conversely, there was no significant difference between the 2VO group and the 2VO+Non-acu group (P > 0.05)   . To asse Figures , implyin\u03b1 in the hippocampus and plasma were significantly alleviated in 2VO+Acu group compared with the 2VO group (P < 0.05 or P < 0.01)        (Figures Given that the neuroprotective effects of acupuncture may be partly mediated by TLR4, we speculated that a TLR4 antagonist may have similar effects as acupuncture on attenuating inflammation and improving cognitive competence. The TLR4 agonist may mitigate the beneficial effects of acupuncture. The levels of IL-6 and TNF- Figures . Neverth Figures . Signifi Figures . To eval Figures . It is n Figures . However Figures . Applica Figures . Additio Figures .\u03baB signaling pathway were reversed by acupuncture. TLR4 antagonist TAK-242 had similar effects as acupuncture on inflammation and cognitive function, while TLR4 agonist LPS inhibited the beneficial effects of acupuncture.In the present study, we show that acupuncture reduced the levels of inflammatory cytokines in the hippocampus and plasma of VD rats. These beneficial effects were associated with the downregulation of TLR4, but not TLR2, in the hippocampus. The overexpressed TLR4 protein is colocalized with neurons and microglia in the hippocampus. Acupuncture downregulated TLR4 expression in microglia of the hippocampus, but not in neurons. Meanwhile, the overexpression and activation of the miR-93 and MyD88/NF-\u03b1 in the hippocampus and plasma. These results indicate that acupuncture exerts its protective effect on cognitive improvement through the inhibition of inflammation in the hippocampus.VD is characterized by a progressive worsening of memory and other cognitive functions resulting from cerebrovascular disorders . The mecTLRs are the primary regulators of the innate immune system and play an indispensable role in the inflammatory response caused by ischemic brain injury , 43. Our\u03baB signaling pathway. The NF-\u03baB pathway is the central mediator involved in immune and inflammatory responses. Once being activated, the NF-\u03baB p65 subunit translocates into the nucleus, triggering the production of inflammatory factors [\u03baB p65 [\u03baB signaling pathway in microglia [\u03baB p65 were markedly enhanced in 2VO rats, while acupuncture could evidently reduce their expressions. Our data imply that regulating the TLR4/MyD88/NF-\u03baB pathway in microglia may take part in the effect of acupuncture against neuroinflammation.TLR4 generally plays a key role in inflammatory response through the MyD88-dependent pathway . MyD88 i factors , 53. Lan [\u03baB p65 . Han et icroglia . In agre\u03baB p65 in rats' brain tissues, indicating that miR-93 can positively regulate the TLR4 signaling pathway [By regulating the expression of multiple genes and pathways, miRNAs play a pivotal role in the pathogenesis of many neuroinflammatory disorders . Further pathway . In lineTAK-242 is a specific antagonist of TLR4 , which iThere are several limitations in our study. First of all, considering that LPS and TAK-242 are recognized agonist and antagonist of TLR4, we did not further detect the expression of TLR4 after use. Secondly, this study provides evidence of association not causality since we did not directly verify the relationship between miR-93 and TLR4 in the hippocampus of 2VO rats. In the future, more studies can be carried out to explore the specific mechanism of TLR4 expression induced by miR-93 in VD.\u03baB signaling pathway (In summary, we demonstrated that acupuncture treatment alleviated inflammation in VD, which was probably related to the inhibition of the miR-93-mediated TLR4/MyD88/NF- pathway . In part"}
+{"text": "Coxiella (C.) burnetii are ruminants. They shed the pathogen through birth products, vaginal mucus, faeces and milk. A direct comparison of C. burnetii excretions between naturally infected sheep and goats was performed on the same farm to investigate species-specific differences. The animals were vaccinated with an inactivated C. burnetii phase I vaccine at the beginning of the study period for public health reasons. Vaginal and rectal swabs along with milk specimens were taken monthly during the lambing period and once again at the next lambing season. To estimate the environmental contamination of the animals\u2019 housings, nasal swabs from every animal were taken simultaneously. Moreover, dust samples from the windowsills and straw beddings were collected. All samples were examined by qPCR targeting the IS1111 gene and the MLVA/VNTR typing method was performed. Whole genome sequencing was applied to determine the number of IS1111 copies followed by a calculation of C. burnetii genome equivalents of each sample. The cattle-associated genotype C7 was detected containing 29 IS1111 copies. Overall, goats seem to shed more C. burnetii through vaginal mucus and in particular shed more and for longer via the rectal route than sheep. This is supported by the larger quantities of C. burnetii DNA detected in caprine nasal swabs and environmental samples compared to the ovine ones. Transmission of C. burnetii from cattle to small ruminants must also be considered. The main reservoir of  Coxiella burnetii is an intracellular bacterium with a high zoonotic potential causing serious health problems, like pneumonia and endocarditis in humans [C. burnetii is described for each ruminant species separately [C. burnetii through faeces [C. burnetii genotype are missing. n humans . Infecten humans ,3,4. Then humans ,6,7. Conn humans . For insn humans . In the n humans . Cattle n humans ,11. The parately ,3,4. In parately . In contparately . The maiparately . Cattle h faeces . Excretih faeces ,14. HoweC. burnetii phase I vaccine is licensed in several European countries for cattle and goats to prevent C. burnetii shedding [An inactivated shedding . In the shedding ,16,17. Ishedding . In infeshedding ,18,19. C. burnetii from small ruminants during a Q fever outbreak, their housings are highly contaminated with the pathogen and are a potential risk for humans conducting farm visits [C. burnetii in the air of barns [C.-burnetii-positive ruminant husbandries [C. burnetii DNA can be detected in environmental samples for years on farms after a Q fever outbreak [C. burnetii DNA fragments in the environment gives neither information about the current excretion status of the animals nor about the viability and infectivity of the pathogen.Due to the extensive excretion of m visits ,21. Air of barns . Furtherbandries . C. burnoutbreak . However1111 insertion sequence, coding for a transposase, contains between seven and 110 copies in C. burnetii genomes [C. burnetii quantity in samples is difficult to achieve with this multicopy insertion sequence. A quantitative PCR method with the target IS1111 has been used in combination with calibrated standards prepared from the Nine Mile RSA493 isolate to quantify the amount of genome equivalents (GE) per sample [C. burnetii, the numbers of IS1111 copies of an isolate could be extracted directly from the sequence data via bioinformatics analysis.The IS genomes ,25. Ther genomes . Howeverr sample ,25,26. AC. burnetii and the different approaches were recently summarized by Massung et al. [C. burnetii strains. Several genotypes could be characterized within the ruminant population across Europe [C. burnetii strains [In the past, different molecular techniques have been used to characterize g et al. . The mulg et al. ,27. The s Europe ,29,30,31s Europe ,33. This strains . Of note strains . C. burnetii in naturally infected sheep and goats was compared on the same farm for two successive lambing seasons. For that purpose, different sample matrices were taken from the small ruminants. Moreover, a novel approach was applied to estimate the environmental contamination of C. burnetii of the small ruminants\u2019 housings by testing nasal swabs of all sheep and goats [C. burnetii concentrations were based on the calculation of C. burnetii quantity by real time quantitative PCR and based on the IS1111 copies determined by whole genome sequencing. Furthermore, to examine the epidemiological background of the C. burnetii infection, MLVA/VNTR typing was performed from samples collected from sheep, goats and cattle. For public health reasons, all ruminants were vaccinated twice with an inactivated C. burnetii vaccine at the beginning of the study period.In the present study, the excretion of nd goats . To undeC. burnetii in his animals.The study included 37 sheep, 22 goats and five cattle kept on the same farm. Every ruminant species was housed in separate stables located side by side, and the animals of the different species never had direct contact either during the housing period nor on the pastures. The stocking densities in the sheep and goat barn were similar. It was always the same animals that were sampled with different kinds of sample matrices for two successive lambing seasons. No new livestock were brought onto the farm during the entire investigation period. Moreover, no biosecurity measures were implemented by the animal owner despite the detection of C. burnetii DNA. Additionally, 22 vaginal swabs from cattle were analyzed. Ten dust swabs from the windowsills and ten samples from the straw bedding were also taken from every ruminant housing. However, only nine straw bedding samples were taken from the cattle barn.In total, 182 vaginal swabs, 183 rectal and nasal swabs, respectively, as well as 92 milk specimens were analyzed from sheep. Furthermore, in each case 94 vaginal, rectal and nasal swabs and 37 milk specimens from goats were examined for 1111 element.The MLVA/VNTR typing revealed the cattle-associated C7 genotype in samples from all three ruminant species and the whole genome sequence analysis of one strain identified 29 copies of the ISC. burnetii GE/mL per swab was detected in seven different ewes. The concentration of C. burnetii detected with ovine vaginal swabs declined but only the decrease from February to March 2018 was significant (p < 0.05). At the next lambing season, only one ewe shed the pathogen (<2 log GE/mL) via the vaginal route. In five caprine vaginal swabs, C. burnetii amounts of \u02c36 log GE/mL from different does were determined in January 2018 and February 2018. The amount of the pathogen decreased from one sampling date to the next in 2018 but only the decline from February 2018 to March 2018 was significant (p < 0.05). At the next lambing season, three goats still shed C. burnetii through vaginal mucus (<3 log GE/mL). In the first two months, goats shed more C. burnetii through vaginal mucus than sheep (p < 0.05). The number of positive vaginal swabs was not significantly different between sheep and goats at any sampling date in 2018 but more goats than sheep shed the pathogen through vaginal mucus at the next lambing season (p < 0.05).The results of the vaginal swabs are shown in p < 0.05). Only two ewes shed the pathogen (<2 log GE/mL) via the rectal route in 2019. In goats, an amount of C. burnetii of \u02c36 log GE/mL was determined from rectal swabs from six different does at the first three sampling dates. Moreover, the quantity of C. burnetii from rectal swabs from goats stayed at a high level followed by a strong decline in April 2018 (p < 0.05). At the next lambing season, still more than half of the goats were shedding the pathogen via the rectal route. In 2018, goats shed more C. burnetii via the rectal route than sheep at any sampling date (p < 0.05). More C.-burnetii-positive rectal swabs were detected from goats than from sheep in April 2018 and February 2019 (p < 0.05). The outcomes of the rectal swabs are presented in C. burnetii through milk in February 2018 and March 2018 and no small ruminant shed the pathogen through milk at the next lambing season. The amount of detected C. burnetii in milk decreased (p < 0.05) from February 2018 to March 2018 in both species. There was no difference in the concentration of C. burnetii in milk and the numbers of shedders between sheep and goats at any sampling date.The results of the milk specimens are outlined in C. burnetii, whereas only one nasal swab from sheep was detected with such a large amount. The quantity of C. burnetii from ovine swabs decreased constantly from one sample date to the other (p < 0.05). Like sheep, the concentration of C. burnetii from caprine nasal swabs also declined continuously (p < 0.05). The number of positive nasal swabs was not significantly different between sheep and goats at any sampling date. Several nasal swabs from sheep and goats tested C. burnetii positive at the 2019 lambing season but the pathogen\u2019s concentration was less compared to the previous year. Nasal swabs from goats contained more C. burnetii than from sheep at any sampling date in 2018. The differences in January 2018, February 2018 and April 2018 were significant (p < 0.05).The outcomes of the nasal swabs are presented in C. burnetii from February to April via the rectal route than in the vaginal mucus (p < 0.05). In sheep, the quantity of C. burnetii shed via the vaginal and rectal routes was not significantly different at any sampling date in 2018. Finally, in the 2019 lambing season, the number of positive sheep and goats and the quantity of C. burnetii on the swabs and milk specimens were considerably less compared to the previous year. During the 2018 lambing period, goats shed more The five cattle were sampled on the same dates as the small ruminants. During the study period January until April 2018 two cows calved on the same day in March and vaginal swabs were taken nine days after calving. These samples contained between 1 log GE/mL and 6 log GE/mL. The other three cows were pregnant during that time. From January to March 2018 all cows had positive vaginal swabs (1 log < 6 log GE/mL), but all cows were tested negative in April 2018. In February 2019, only two non-pregnant cows were tested and both animals were negative. C. burnetii compared to samples from the sheep shed and cattle barn. Specifically, the samples from the cattle barn generally included the lowest quantity of the pathogen. Independently from the animal housings, specimens from the windowsills usually contained more C. burnetii than samples taken from the straw bedding. The concentration of C. burnetii in swabs from dust and straw bedding from the sheep and goat sheds decreased but stayed positive for C. burnetii DNA until the end of the study. The concentration of C. burnetii DNA in the dust and straw bedding from the cattle barn increased briefly in March 2018 after two cows shed C. burnetii during calving, but the rise in January 2019 cannot be explained by such an event. From April 2018 until April 2019 most of the samples from the straw bedding from the cattle barn tested negative for C. burnetii DNA.The results of the dust and straw bedding samples are shown in C. burnetii shedding between sheep and goats naturally infected with the same genotype of C. burnetii and kept indoors under the same conditions. The results were underlined by the estimation of C. burnetii contamination of the environment using the novel indirect approach of nasal swabs from the animals and direct measuring with swabs from straw beddings and dust from the windowsills. Furthermore, whole genome sequencing identified one strain with 29 copies of IS1111 elements. This result was used to estimate the quantity of C. burnetii genome equivalents for each collected sample. This approach has been not widely used yet. Most authors are using, for instance, a quantitative PCR with target sequence com1 or calibrated standards from C. burnetii strain Nine Mile RSA 493 isolate to estimate the amount of the pathogen [C. burnetii with results from other studies is hampered due to the different methods used. In general, the amount of excreted C. burnetii declined during the study period in both species. This is in accordance with previous studies and reflects the natural shedding behavior of C. burnetii in small ruminants [C. burnetii were compared between sheep, goats and cattle but without pathogen quantification [The present study focused on the differences in pathogen ,25,26. Tuminants ,37. In tfication . MoreoveC. burnetii confirming the assumption of super-spreaders within infected flocks [C. burnetii through vaginal mucus than sheep. Additionally, more goats than sheep shed the pathogen at the next lambing season. This could be the reason for the huge Q fever outbreak in the Netherlands from 2007 until 2011. Sheep played a minor role as a cause of human Q fever infection during that time, although the Dutch sheep population is larger than the goat population [C. burnetii into the environment. In contrast, synchronization and artificial insemination are less commonly used in the sheep industry and lambing periods are more expanded with less ewes lambing simultaneously and probably a smaller release of C. burnetii at the same time. Single animals shed large amounts of d flocks ,9. At thpulation ,38. Furtpulation . ConsequC. burnetii via the rectal route than sheep. Moreover, significantly more positive rectal swabs were detected from goats than from sheep indicating a longer period of excretion by goats. The amount of C. burnetii shed by the rectal route was higher than by the vaginal route in goats. These findings might also be the reason for the Dutch Q fever epidemic as mentioned above. Rectal excretion of C. burnetii in small ruminants was described by several authors [C. burnetii in faeces after the first goat aborted in the study group. Therefore, Roest et al. [C. burnetii only pass through the digestive tract leading to positive rectal swabs and faecal samples. In contrast, Arricau-Bouvery et al. [C. burnetii in caprine faeces after 25 days of subcutaneous infection and just before the goats aborted. In a recently published study, Sobotta et al. [C. burnetii. The intestinal epithelial cells allowed moderate invasion of the pathogen but there was little further propagation of bacterial numbers within these cells. This observation is in line with the findings from in vivo studies showing that cattle shed to a lower extent C. burnetii in faeces [C. burnetii. Manure from C.-burnetii-positive sheep and goat farms are a major source of human Q fever infections [C. burnetii than vaginal swabs in the present study. It is unlikely that this large amount of C. burnetii bacteria in the faeces can be explained alone by ingestion and passage through the gastro-intestinal tract (GIT). Specifically, the concentrations on the goats\u2019 rectal swabs in comparison with the vaginal shedding indicates an additional active multiplying of the bacterium in the GIT. This needs further clarification.In the present study, goats shed significantly more  authors ,17,21,40 authors  could not et al.  concludea et al.  infectedn faeces . The appfections ,11. MoreC. burnetii in milk. The quantity of C. burnetii was less compared to the amount in vaginal and rectal swabs. This is in accordance to other studies finding low burdens of the pathogen in milk compared to the other excretion routes [C. burnetii through milk. The collection of milk specimens from every small ruminant was not always possible during the entire study period because the sheep and goats are non-dairy breeds. There was no significant difference between sheep and goats regarding excretion of n routes ,3,21,42.C. burnetii [C. burnetii in the inhaled air of the sheep and goats. This approach does not need any technical support, and a consistent filtering of tidal air occurs through the nasal cavity of the animals, imitating the natural route of infection. The three ruminant species lived in different closed barns on the same farm. The estimated numbers of C. burnetii per swab were significantly larger in goats than in sheep. Therefore, we concluded that the goat shed is more heavily contaminated with C. burnetii compared to the sheep shed due to the greater caprine excretion rate. This finding is supported by the results of the dust and straw bedding swabs with the largest amount found in the goat barn during the entire study period.In the past, nasal swabs were not widely used to detect burnetii ,43. In tC. burnetii within a few weeks. In contrast, single cows are calving and shedding during the entire year. This could explain the smaller quantities of C. burnetii in the bovine environment compared to small ruminant farms which was also reported by Carri\u00e9 et al. [C. burnetii through the vaginal and rectal routes, whereas cows shed the pathogen through milk and less frequently through vaginal mucous and faeces [C.-burnetii-positive small ruminant husbandries than in positive cattle farms. Environmental samples stayed positive during the whole study period, despite straw bedding being removed but neither cleansing nor disinfection were applied. This is in line with other studies. C. burnetii DNA is detectable in animals\u2019 housings after an outbreak for several months [C. burnetii on infected farms is still doubtful. For that purpose, the intraperitoneal inoculation of BALB/c mice, or the housing of guinea pigs in the ruminant barns would be necessary, which is difficult to conduct due to ethical and technical reasons [C. burnetii in dust samples of up to two months after the last abortion has been reported [C. burnetii [C. burnetii at the beginning of the abortion wave and during the lambing period in 2018 when vaginal and rectal shedding was also the highest. Moreover, a short peak in bovine dust and straw bedding samples was observed in March 2018, detected nine days after two C.-burnetii-positive cows calved. Further long-term investigations are necessary to evaluate and standardize the application of surface swab samples as an economic monitoring tool for ruminant husbandries. This would include the establishment of reliable thresholds that would indicate an acute Q fever outbreak. Consequently, an active surveillance program for non-dairy ruminants could be implemented, which is absolutely necessary because of the missing application of bulk tank milk samples.It is important to bear in mind that a direct comparison of small ruminants and cattle is difficult to apply. Small ruminants have a dense lambing period, shedding large amounts of \u00e9 et al. . Furtherd faeces . Therefol months ,16,20. H reasons . A viabireported . The resburnetii . This isC. burnetii to other animal species [C. burnetii genotypes within the different ruminant species.We were able to identify the cattle-associated C7 genotype in vaginal swabs from sheep, goat and cattle on the same farm, although the three species did not share the same barn. The C7 genotype was so far only seen in a cattle herd also located in southern Germany . In the  species . The ideC.-burnetii-infected small ruminants led to contradictory results of C. burnetii shedding [C. burnetii has rather a long-term impact on the pathogen\u2019s excretion than preventing from shedding during an active outbreak [C. burnetii excretion between sheep and goats naturally infected with the same genotype of the pathogen and within an epidemiological unit in order to get deeper insights into the complexity of C. burnetii infection within different ruminant species. Hermans et al. [C. burnetii DNA was excreted in milk up to 9 days after vaccination. This has not been evaluated for other shedding routes, yet [C. burnetii DNA was not detected through any excretion route at any sampling date. The authors are aware of the limitations of this field study. Firstly, on the basis of the recommendation of the European Food Safety Authority (EFSA) , all rumshedding . Howeveroutbreak ,18,19. Toutbreak ,3,14,37.s et al.  reportedtes, yet . In the C. burnetii. However, this sampling technique has its limitations. The amount of absorbed secretions and pathogens on a swab is difficult to standardize and a quantitative comparison is therefore hampered. Consequently, the calculated C. burnetii genome equivalents of each swab in the present study is a rough assessment. This also applies for the dust and straw bedding samples. Therefore, the authors decided to forego the mention of C. burnetii concentration in absolute figures. Our intention was to standardize the sampling procedures as far as possible under field conditions and to use a sampling tool that can be easily and safely processed in the laboratory to reduce the infection risk for technicians. Therefore, we used the same dry viscose swab for all sampling matrices. Both the excretion of C. burnetii and environmental contamination decreased during the study period, which is consistent with previous findings [Sampling mucosal-like tissue from the vagina, rectum or nasal cavity with swabs is a simple method to obtain sample material for the detection of findings ,3,21,37.C. burnetii in the bovine environment and a comparison with the outcomes from the small ruminants is hampered.Unfortunately, in the next lambing season, only seven goats were left from 2018. This sample size is small and limits the explanatory power in 2019. Moreover, the number of cattle is small and the breeding and management conditions are different compared to the small ruminants. However, these differences reflect the common livestock situation in southern Germany. Therefore, the results of dust and straw bedding from the cattle barn just gives an indication about the quantity of C. burnetii in vaginal mucus and significantly more and for a longer period via the rectal route than sheep. This is supported by the greater environmental contamination with C. burnetii in the goat barn based on the results from the nasal swabs, windowsill and straw bedding samples. Moreover, dust swabs from the surfaces of stables can be a useful and affordable tool to detect C.-burnetii-positive livestock. Finally, a cattle-associated genotype can circulate within the ruminant population, leading to a high abortion rate in goats but causing no obvious clinical problems in sheep and cattle. Further research is necessary to confirm our observations. Specifically, the species-specific differences have to be investigated under controlled experimental conditions.Overall, goats seem to shed significantly more C. burnetii was diagnosed from aborted material (placenta and foetus) from a goat on a hobby farm. This farm included 22 goats (German Fawn Improved x Boer Goat), 37 sheep (Coburger Fox) and 5 cows . Every ruminant species was housed in separate stables and never had direct contact either during the housing nor pasture period. However, the stables were located side by side and the farmer used the same equipment. The lambing season in goats and sheep took place from 10th January 2018 until 12th February 2018 and from 16th January 2019 to 10th February 2019. From January 2018 until April 2018 and in February 2019 all small ruminants were professionally restrained and were sampled with dry sterile swabs consisting of a small viscose swab on a 9 cm polystyrene stick . The vaginal and rectal swabs were taken by introducing the swab for approximately 7 cm into the vagina or rectum. Then, the swab was turned lightly for 10 s. These samples were collected every three to four weeks to determine the quantity and duration of C. burnetii excretion. For the same purpose, sterile milk specimens were taken from each half of the udder but collected in one sterile tube . However, milk samples could not be collected from every animal at every single sample date because the animals were non-dairy breeds. Simultaneously, nasal swabs  were collected to estimate the environmental contamination of the sheep and goat sheds. The head of each restrained animal was held and a sterile swab was introduced for approximately 7 cm into the left nasal cavity. The nasal mucus was sampled by lightly turning the swab for approximately 10 s. In January 2018, Cattle were only sampled with vaginal swabs  as described for small ruminants. The difficult management conditions on the farm made it impossible for more types of samples to be taken . One positive bovine vaginal swab was included in the MLVA/VNTR typing method to identify the genotype. Calving took place at irregular times during the entire year, e.g., two cows calved at the same day in March 2018. 2 per livestock unit (LSU) for goats, 20.3 m2/LSU for sheep and 18.5 m2/LSU for cattle.It was always the same animals that were sampled with the above-described methods and no new animals were brought onto the farm during the entire study period. At the beginning of the study, the stocking densities in the stables were 23.2 mC. burnetii contamination of the animals\u2019 housings. For that purpose, the same dry sterile swab  was used as described for the above samples. The dry sterile swab was rolled over the same windowsill of each stable for 1 m to collect stable dust. Additionally, a second dry sterile swab was rolled over the straw bedding for 2 m in the middle of each stable. These environmental specimens were taken every three to four weeks from January 2018 until April 2018 and from November 2018 until April 2019. During the summer and autumn months (May until November 2018) sheep and goats were on separate pastures with no direct contact. The cattle were housed indoors and their barn was mucked out irregularly during the whole study period. At the beginning of May 2018, manure from the sheep and goat shed was removed. Cleansing and disinfection of the animals\u2019 housings were never performed. All swabs and milk samples were stored at \u221218 \u00b0C until laboratory examination. Dust and straw bedding samples were taken from each stable to estimate the C. burnetii phase I vaccine  three weeks apart in January and February 2018 to reduce the risk for the animal owner and local residents. During kidding season 2018, 17 of 22 goats aborted. One goat died at the end of March 2018. The farmer decided to sell most of the goats during summer 2018. Therefore, only seven animals were left by lambing season 2019. Furthermore, two ewes died during summer 2018; therefore, 35 ewes lambed in 2019. After the detection of C. burnetii in the goat flock, the farmer did not implement any biosecurity measures  when moving between sheds. Though he was informed about the risks for human and animal health.The farm is located in the middle of a small village with about 2000 residents. Hence, all ruminants on the farm were vaccinated twice with an inactivated This study was carried out in accordance with the German animal welfare legislation and the EU Directive 2010/63/EU for animal experiments. Procedures on animals in this study were licensed by the federal state government of Baden-Wuerttemberg under the registration number 35-9185.82/0351.C. burnetii-specific DNA fragments in the vaginal, rectal and nasal swabs were detected by amplificating the IS1111 elements with qPCR. Cycle Threshold (Ct) values \u2264 45 indicates as positive and Ct values > 45 as negative. The details of the used PCR method are published elsewhere [TMC. burnetii Absolute Quant Kit, Life Technologies GmbH, Darmstadt, Germany) targeting IS1111 as well. Both methods showed similar results . The limit of detection for both qPCRs is 1 genome equivalent (GE) per PCR evaluated with the Nine Mile genome containing 20 copies of IS1111 per GE. The dust and straw bedding samples were examined with the same commercially available qPCR . The manufacturer indicates Ct values \u2264 45 as positive and Ct values > 45 as negative. A plasmid DNA quantification standard (3 \u00d7 107 GE copies per mL) is included in the commercial qPCR kit. For the in-house qPCR, we used a plasmid DNA standard . The standard curves were calculated by the MxPro qPCR software version V 4.10 and the Agilent Aria qPCR software version V 1.7 , respectively. Subsequently, we could use these standard curves to estimate the amount of GE in different samples on the basis of the detected Ct value. The amounts of GE were reported as GE per mL due to the initial processing of the swabs in 1 mL phosphate-buffered saline (PBS) according to the qPCR test protocol. lsewhere . InitialDNA isolated from vaginal swabs from three sheep, two goats and one cattle were used to conduct the MLVA/VNTR typing method as previously described by Frangoulidis et al. . In brie\u00ae Ultra\u2122 II FS DNA Library Prep Kit for Illumina  according to the protocol for large fragment sizes > 550 bp but with a minimal fragmentation time of only 30 s. Afterwards, the library was sequenced on an Illumina MiSeq device using the MiSeq Reagent Kit v3 (2 \u00d7 300 bp). The sequenced reads were then de novo assembled using SPAdes [1111 elements, blastn of the BLAST + package [1111 insertion sequence against the assembled contigs. All contig ends aligning to the IS1111 insertion sequence were counted half; contigs fully covered by the insertion sequence were ignored. Consequently, with the known number of IS1111 copies it was possible to estimate the number of GE in each sample. Isolated DNA from one ovine vaginal swab was used for whole genome sequencing. This sample was also analyzed with the above-mentioned MLVA/VNTR typing method. The library for the sequencing was prepared using the NEBNextg SPAdes  version g SPAdes  in order package  was usedC. burnetii GE/mL was performed by the addition of 1 and base 10 logarithms. Therefore, values of 0 indicate negative samples. Statistical analyses take an alpha level of 0.05 as a basis. Normal distribution was assessed by the Shapiro\u2013Wilk test, Q-Q plots and histograms. The homogeneity of variance was assessed by Levene\u2019s test. Due to the assumption violation of parametric tests in several cases, non-parametric tests are reported. The symmetry of the distribution of differences for paired data was assessed by histograms and symmetry tests. Due to the non-symmetric distribution of differences in some cases, sign tests were performed instead of Wilcoxon signed rank sum tests. Not all comparisons conducted by Wilcoxon rank sum test showed an identical distribution in shape, visualized by histograms. Wilcoxon rank sum tests were conducted for analyses of differences in C. burnetii GE/mL concentration for each date in 2018 between species, respectively, for vaginal, rectal, milk and nasal swabs. Data of nasal swabs in March 2018 showed significantly different variances between species and is analyzed descriptively. p-values were adjusted by Bonferroni correction, respectively, in each specimen. These analyses were also conducted by Mood\u2019s Median tests showing similar results. Therefore, only results of Wilcoxon rank sum tests are reported.A transformation of the calculated quantities of 2-test with Yates correction if expected frequencies for each condition exceeded five, otherwise fisher\u2019s exact tests were calculated. These analyses were performed separately for each specimen, separately for April 2018 and February 2019 in vaginal, rectal and nasal data, respectively. Milk data were analyzed separately for February 2018 and March 2018. p-Values were adjusted with Bonferroni correction for each specimen.Differences in frequencies of positive and negative samples between species were analyzed by chiC. burnetii GE/mL concentration within a species for each date in 2018 between rectal and vaginal swabs were analyzed using sign tests with Bonferroni correction for each species, respectively.Differences in C. burnetii GE/mL concentration over dates of measurement in 2018, respectively, for each species separately for vaginal, rectal and nasal data were analyzed by Friedman tests. Sign tests with Bonferroni correction were used for further analyses after significant Friedman test results. Differences in milk specimens from February 2018 to March 2018 were examined by sign tests for each species.Changes in Due to a leak of variance and missing samples, data from February 2019 were excluded from several analyses. Furthermore, data from February 2019 represent a new lambing period. Therefore, these data cannot be included in chronological comparisons. All statistical analyses were performed by the statistical software R, Version 4.0 ."}
+{"text": "Coxiella burnetii phase I vaccine. The antibody response was measured before vaccination by serum samples with two C. burnetii phase-specific ELISAs to characterize the disease status. Shedding was determined by vaginal swabs during three kidding seasons and monthly bulk tank milk (BTM) samples. Dust swabs from one windowsill of each barn and from the milking parlors were collected monthly to evaluate the indoor exposure. These samples were analyzed by qPCR. The phase-specific serology revealed an acute Q fever infection in herd A, whereas herds B and C had an ongoing and past infection, respectively. In all three herds, vaginal shedders were present during three kidding seasons. In total, 50%, 69%, and 15% of all collected BTM samples were C. burnetii positive in herds A, B, and C, respectively. Barn dust contained C. burnetii DNA in 71%, 45%, and 50% of examined swabs collected from farms A, B, and C, respectively. The largest number of C. burnetii positive samples was obtained from the milking parlor , indicating a high risk for humans to acquire Q fever during milking activity.Q fever outbreaks on three dairy goat farms (A\u2013C) were monitored after the animals had been vaccinated with an inactivated  Coxiella burnetii. The pathogen has a high tenacity, with resistance to desiccation, heat, UV light, and numerous disinfectants [C. burnetii on cattle health is still unknown and under debate [Q fever is a zoonotic disease caused by the obligate intracellular bacterium fectants ,2. The mfectants ,4. Reprofectants ,5,6. Ther debate , whereasr debate .C. burnetii when inhaling contaminated aerosols and dust. The median infectious dose (ID50) was estimated at 1.5 bacteria and indicates the high infectivity of C. burnetii via aerosols [C. burnetii positive dairy goat farms led to the world\u2019s largest Q fever epidemic, with more than 4000 reported human cases and an estimated number of about 40,000 infected individuals [C. burnetii is considered a sporadic route of transmission [C. burnetii seroprevalence of 3.1% was reported for humans in the United States [Humans become easily infected with aerosols . In the ividuals ,11. Furtividuals . In addismission ,13. Apprsmission . In the smission , and affsmission ,16. Serosmission . A C. bud States . In Austd States . These rC. burnetii is its antigenic phase variation, leading to phase I (PhI) and phase II (PhII), which correlates with lipopolysaccharide changes [A particular characteristic of  changes ,21. Thes changes ,23. Equa changes . The exc changes . Neverth changes .C. burnetii may circulate in goat herds for several years [C. burnetii phase I vaccine has been licensed for cattle and goats in several European countries [C. burnetii, but reduced the amount of pathogen excretion and may also lower the number of shedders [C. burnetii phase I vaccine in naturally pre-infected goats on pathogen excretion are missing. Such information is essential for veterinary health care officials and other decision-makers to assess the risk of C. burnetii transmission to humans after a Q fever outbreak.Without control measures, al years ,26,27. Tountries . This vaountries . Vaccinashedders ,31,32. HC. burnetii by PCR revealed a wide range of detection rates in several countries, such as 16% in Belgium [C. burnetii on ruminant farms [C. burnetii was detected in dust within two months after the last parturition [Bulk tank milk (BTM) samples have been successfully used to monitor the Q fever status of dairy goat herds ,34,35. A Belgium , and 16. Belgium . Howevernt farms ,39,40,41turition ,41,42. Dturition ,44, milkturition .C. burnetii phase I vaccine was given. The shedding of C. burnetii was analyzed by vaginal swabs and monthly BTM samples over a period of three kidding seasons. Dust samples from one windowsill of each barn and from the milking parlors were included in the investigation to evaluate the intensity and duration of C. burnetii contamination of goat facilities. Our clinical long term observations supplement existing statistical models [The present field investigation aimed to monitor three Q fever outbreaks on dairy goat farms after an inactivated l models  and willBrucella spp., Campylobacter fetus ssp. fetus, Chlamydia spp., C. burnetii, Listeria spp., and Salmonella spp. The only diagnosed pathogenic microorganism was C. burnetii . All goats were kept in one barn closed on all four sides with wooden walls. Ventilation occurred through the open front and back doors of the barn. The milking parlor was directly connected to the barn but separated by metal fences. The herd was managed semi-intensively under organic farming standards, with access to the pasture during the daytime annually from April until November. The whole dimension of the Q fever outbreak was recently described in detail by the authors [Dairy goat herd A was located in the German federal state of Schleswig-Holstein (northern Germany) and consisted of 360 does, which had suffered from endemic abortion with 24 aborting goats in January 2018. Later, several stillborn and weak kids were born up until the end of the kidding season in April 2018. Further details about kid losses during this period were not available. In early January 2018, an aborted fetus, including the placenta, was sent to the federal state laboratory of Schleswig-Holstein and examined for abortifacient agents, such as  authors .Brucella spp., Campylobacter spp., Chlamydia spp., C. burnetii, bluetongue virus, pestivirus and Schmallenberg virus. The only detected abortifacient pathogen was C. burnetii . The barn had three closed sides with wooden walls and one side with barn curtains. The goats had to enter and leave the milking parlor through a flap; therefore, the milking parlor was separated from the barn. On the organic farm, the goats were managed semi-intensively, and grazed during the daytime on pastures close to the barn from April until October each year.The animal stock of farm B consisted of 152 dairy goats and was located in the German federal state of North-Rhine Westphalia (western Germany). The kidding season took place from February to April 2018 and 20 goats showed reproductive disorders, such as abortion, stillborn, and weak kids at the end of the kidding season. Four aborted fetuses with placentas from two does were examined by the federal state laboratory of North Rhine-Westphalia to detect differential pathogens capable of causing abortion, such as C. burnetii, and all vaginal swabs tested positive  by the federal state laboratory of Lower Saxony (Germany). No other disease pathogens were investigated. Three sides of the barn were closed by barn curtains and the fourth side was a brick wall. The milking parlor was separated by a glass door from the barn. The intensively managed goats were mainly kept indoors, but had access to a concreted paddock, which was always accessible from April to November.Dairy goat herd C consisted of 85 dairy goats and was located in the German federal state of Bavaria (southern Germany). The main kidding season was in January 2018, but single animals still gave birth until March 2018. In February 2018, the first dead kids were born. In total, six goats gave birth to stillborn or weak kids. Q fever was considered as one cause of the disease, and vaginal swabs were collected from the twelve last kidding goats. The samples were analyzed by qPCR for the presence of All three farmers (A\u2013C) asked the Clinic for Swine and Small Ruminants at the University of Veterinary Medicine Hannover, Foundation, Hannover, Germany for help to combat the Q fever outbreak in their dairy goat herds.On farm A, the kidding season was ongoing at the first visit in January 2018, whereas in flock B, only single goats were still pregnant at the first farm visit in April 2018. The main kidding season of herd C had been completed two months earlier when the first measures had been implemented in April 2018.n = 24) from herd A in January 2018 were included, and animals from herd B (n = 48) and C (n = 35) were randomly selected in April 2018 for serum samples to be taken from the Vena jugularis . From these goats, vaginal swabs were also collected at the first farm visit by the authors (B.U.B. and M.G). During the kidding season in 2019 and 2020, the farmers were instructed to carefully collect vaginal swabs from goats within 48 h after parturition. Due to the risk of single \u2018super-shedders\u2019 [C. burnetii excretion to the greatest possible extent. Unfortunately, it was not possible to always sample the same goats during the study period because of difficulties in herd management on the farms.All aborting goats . In addition, monthly dust samples from the milking parlors and from one windowsill of each barn were collected, as described previously . BrieflyC. burnetii phase I vaccine  in accordance with the manufacturer\u2019s instructions. Goats in herds B and C were annually revaccinated and the female progeny received their primary vaccination four weeks before mating. Animals in herd A had already been boosted in September 2018 before the breeding season started. This also included the primary vaccination of the female offspring from 2018. Since 2019, only the young offspring were vaccinated twice before breeding but the multiparous goats were left untreated on farm A. This modified vaccination schedule was performed due to financial reasons. In addition, all farmers were urged to remove aborted fetuses and afterbirth from the straw beddings as soon as possible and to store these materials in containers until disposal through rendering plants. The animal facilities on all three farms were neither cleaned nor disinfected during the entire study period.All goat herds were vaccinated for the first time with an inactivated Farms A and B continuously milked approximately half of the herd after the Q fever outbreak in 2018. The remaining does were mated and dried-off around six weeks before kidding. Farm C bred the entire herd with a dry-off period of six weeks. Therefore, BTM samples were not always available from herd C.An overview of the timing of blood/vaginal swab sampling, kidding seasons, and vaccination in all three dairy goat herds is provided in Goat sera were examined with two phase-specific ELISAs  in accordance with the manufacturer\u2019s instructions and this process has recently been described . The tesCoxiella burnetii-specific DNA fragments in the vaginal swabs were detected by amplification of the IS1111 elements with qPCR. Cycle Quantification (Cq) values \u2264 45 were indicated as positive and Cq values >45 as negative values according to Frangoulidis and colleagues [TMC. burnetii Absolute Quant Kit, Thermo Fisher Scientific GmbH, Dreieich, Germany) targeting IS1111 as well. The manufacturer indicated Cq values \u2264 45 as positive.lleagues . The BTMt-Test or Mann\u2013Whitney-Test to compare the phase-specific IgG response within a goat herd. Results with p < 0.05 were considered to be significant.Serum values were checked for normal distribution by the Shapiro\u2013Wilk-Test, followed by a C. burnetii DNA and the number of positive vaginal swabs were considered.The vaginal swabs were evaluated using descriptive methods. Both the amount of The statistical software SAS  was used for all calculations.In goat herd A, the median level of IgG PhII antibodies was significantly higher than the IgG PhI antibodies . The phaC. burnetii in 2018, and half of the vaginal swabs contained large amounts of C. burnetii DNA (Cq \u2264 20). At the subsequent kidding seasons, goats still shed small quantities (Cq \u2265 33) of C. burnetii.All 24 examined goats from herd A shed C. burnetii positive at the initial sampling date (Cq \u2264 33). In 2019 and 2020, the number of vaginal shedders decreased, and vaginal swabs contained small amounts of C. burnetii DNA (Cq \u2265 37).In herd B, all vaginal swabs tested C. burnetii through the vaginal route in herd C. During the following kidding seasons, fewer does excreted small quantities of C. burnetii (Cq \u2265 36).In 2018, 25 of 35 goats shed small amounts (Cq \u2265 34) of C. burnetii DNA amount  on vaginal swabs are shown in Details of the number of vaginal shedders and C. burnetii in the dairy goat herds, pathogen DNA was continuously detected in BTM samples for 9 and 16 months in herds A and B, respectively. In the following months, C. burnetii was identified irregularly in the BTM. In contrast, BTM specimens from goat herd C tested C. burnetii positive at the beginning of the investigations and once again in August 2019  and 50% (15/30) positive outcomes. The number of positive dust samples was higher from the milking parlors; 91% , 72% , and 73% , respectively, compared to the windowsills from each of the barn. The C. burnetii burden from both sample locations showed an undulating development.Dust samples from the barns and milking parlors tested discontinuously at farms . On farmC. burnetii shedding small ruminants have caused small-scale human Q fever outbreaks [C. burnetii circulates in goat flocks for a certain time [In the past, utbreaks ,12 in Geutbreaks . Withoutain time ,26,48. Oain time ,49. In aC. burnetii excretion by half of the examined animals (Cq \u2264 20) in January 2018. In herd B, an ongoing infection was revealed with similar levels of both phase-specific IgGs, which coincides with the sampling time right after the kidding season, as the acute disease was already over. In contrast, the median of IgG Ph I antibodies was significantly higher compared to IgG Ph II in herd C, thus suggesting an infection in the past. This interpretation is supported by the fact that the samples were collected around two months after the main kidding season had been completed, and only 71% of vaginal swabs tested positive with a low C. burnetii amount (Cq \u2265 34). Our findings are consistent with outcomes from naturally or experimentally infected goats [C. burnetii positive goat herds into three different stages of infection was possible. Hence, the assays are helpful tools for evaluating the disease status in practice.The examination of goat sera with phase-specific ELISAs revealed different Q fever disease stages among all three dairy goat herds. According to the serological results with a dominance of IgG Ph II antibodies, the dairy goat herd A suffered from an acute Q fever outbreak. This is underlined by the high amount of ed goats ,23,24. CC. burnetii during the following kidding seasons [C. burnetii from infected dairy goat herds and emphasize the necessity for annual Q fever vaccination for at least six years, as claimed by simulation models [The reasons for the lack of control groups were already discussed in detail above. Therefore, we can only speculate about the effect of the vaccine on vaginal shedding. Nevertheless, taking into account that a considerable number of non-vaccinated goat herds still shed  seasons ,50, we s seasons ,29,30,31n models .C. burnetii DNA in BTM samples from herds A and B suggests intermittent milk shedders [C. burnetii, infected goats can also shed other zoonotic pathogens through milk, such as Toxoplasma gondii, Brucella melitensis, Listeria monocytogenes, and tick-borne encephalitis virus [The irregular detection of shedders , which hshedders ,53 and nis virus ,55,56,57is virus , it is nC. burnetii intermittently in milk, led to negative BTM samples [C. burnetii phase I vaccine caused positive milk samples by qPCR up until nine days after vaccination [Removing goats shedding  samples . However samples . In addicination . SheddinC. burnetii after the initial detection of the pathogen in 2018. The severe contamination is associated with the tremendous release of C. burnetii from aborting or kidding goats [C. burnetii from dust samples had an undulating development. Several factors affect the probability of detecting C. burnetii in animal facilities, such as sampling method and matrix, sampling location, used PCR method, activities during sampling, history of abortion, number of reproductive females, number of vaginal shedders, ventilation, and type of ruminant species [The dust from the barns and milking parlors of all three dairy goat farms contained considerable amounts Cq < 30) of 0 of C. bng goats ,38. Duri species ,45,60,61C. burnetii positive on all three dairy goat farms. Inhalable dust particles are raised during milking activity [C. burnetii [C. burnetii DNA from the surroundings provides no information about the viability of the pathogen. It is assumed that C. burnetii remains infectious in dust for up to two months after parturition [C. burnetii DNA amounts in the environment remains doubtful and needs further clarification. Additionally, the barns and the milking parlors were contaminated for more than two years on all three farms. This is in line with observations from other studies on small ruminant farms [Dust samples from the milking parlors were most frequently activity . Hence, burnetii ,44. Thisturition . Finallynt farms ,40. TherC. burnetii infection status make a direct comparison among the three dairy goat herds difficult and limit the interpretation of our longitudinal study. In addition, it must be taken into account that C. burnetii strains on the three farms might contain different numbers of IS1111 elements [The authors are aware of the limitations of the present field study. Differences in stock density, interior design of barns and milking parlors, ventilation, management, and vaccination strategies, as well as elements . TherefoC. burnetii phase I vaccine did not prevent vaginal shedding in naturally pre-infected dairy goats at two subsequent kidding seasons, and underlines the need for vaccinating C. burnetii positive dairy goat herds for at least six years [C. burnetii in dust samples from milking parlors emphasizes the threat during milking activities. In the future, routine methods to determine the infectiousness of low C. burnetii amounts in dust samples are urgently needed to assess the risk of infection for humans and animals. In addition, the sensitivity of dust swabs to identify C.burnetii positive livestock has to be evaluated. Altogether, our observations highlight the use of phase-specific serology and the molecular analysis of various sampling matrices to monitor the status and shedding of C. burnetii in goat herds. The generated data are extremely helpful for Q fever risk assessments and supports the One Health approach.Phase-specific serology enables the classification of the Q fever disease status of goat herds and supports the identification of acute cases, which are a serious hazard for humans. The inactivated ix years . The lon"}
+{"text": "To explore the value of MR-DWI and T1 mapping in predicting radiation-induced soft tissue fibrosis and its correlation with radiation inflammation.\u2460 a total of 30 C57BL/6 mice were randomly divided into a control group (Nor group), irradiation group (IR group) and irradiation plus glycyrrhetinic acid group (GA group). The IR group and GA group were treated with 6MV X-rays to irradiate the right hind limbs of mice for 30 Gy in a single shot. MRI examinations were performed before and on the 7th day after irradiation to measure the apparent diffusion coefficient (ADC) value and the longitudinal relaxation time (T1) value of the hind limb muscles of the mice. On the 90th day after irradiation, the hind limb contracture was measured, and the right hind limb muscle was taken for HE staining, masson staining, immunohistochemical staining and Western blot analysis to detect the expression of a-SMA and Fibronectin. \u2461 The other 30 mice were grouped randomly as above. On the 7th day after irradiation, the right hind limbs of the mice were examined by MRI to measure the ADC value and T1 value of the thigh muscles, and then the right hind thigh muscles were immediately sacrificed to detect IL-1\u03b2, IL-6, TNF-a and TGF-\u03b21 expression with ELISA.-3mm2/s, (1.48 \u00b1 0.07)\u00a0*10-3mm2/s and (1.36 \u00b1 0.13)*10-3mm2/s, respectively, by which the differences between the IR group and Nor group (P=0.008) and that between IR group and GA group (P=0.013) were statistically significant; T1 values \u200b\u200bwere (1369.7 \u00b1 62.7)ms, (1483.7 \u00b1 127.7)ms and (1304.1 \u00b1 82.3)ms, respectively, with which the differences in the T1 value between the IR group and Nor group (P=0.012) and between IR group and GA group (P<0.001) were also statistically significant. On the 90th day after irradiation, the contracture lengths of the right hind limbs of the three groups of mice were (0.00 \u00b1 0.07)cm, (2.08 \u00b1 0.32)cm, and (1.49 \u00b1 0.70) cm, respectively. There were statistically significant differences in the IR group compared with the Nor group (P<0.001) and the GA group (P=0.030). The ADC value  and T1 value  of the mice\u2019s hindlimbs on Day 7 after irradiation were correlated with the degree of contracture on Day 90 after irradiation; the ADC value  and T1 value  were positively correlated with the Masson staining results and with the expression of \u03b1-SMA and Fibronectin. While the ADC value was positively correlated with IL-6 , there was no obvious correlation with IL-1\u03b2, TNF-a and TGF-\u03b21; the T1 value was positively correlated with IL-1\u03b2 , IL-6  and TNF-a  but not significantly related to TGF-\u03b21 .On the 7th day after irradiation, the ADC values \u200b\u200bof right hind thigh muscles of mice in Nor group, IR group and GA group were (1.35 \u00b1 0.11)*10The MR-DWI and T1 mapping values on the 7th day after irradiation can reflect the early condition of tissue inflammation after the soft tissue is irradiated, and the values have a certain correlation with the degree of radiofibrosis of the soft tissue in the later period and may be used as an index to predict radiofibrosis. Cancer treatments mainly involve surgery, radiotherapy and chemotherapy. Nearly 70% of the patients with malignant tumors need to receive radiotherapy. While radiotherapy kills tumor cells, it also induces soft tissue damage. In the early stage of the injury, it is manifested as reversible acute dermatitis. Acute dermatitis after radiotherapy is the result of a combination of direct tissue damage and local inflammation. The rays cause increased vascular permeability and persistent leukocyte infiltration, leading to epidermal degeneration and dermal edema. At the same time, a large number of inflammatory factors  are released, promoting the development of dermatitis , 3.In recent years, with better technology developed, imaging parameters from CT and MRI have been reported to be effectively used in diagnosis, monitoring treatment response, and differential diagnosis of tumor recurrence or radiation injury . MagnetiThirty C57BL/6 SPF male mice aged 8 weeks were divided into three groups by the random number table method: the normal group (Nor group), the irradiation group (IR group) and the glycyrrhetinic acid  Fixation method: After all mice were anesthetized, they were fixed in a supine position on a tissue compensation material (plexiglass) with a thickness of 1.0\u00a0cm. The mice were placed in a row so that the right groin lines of the mice were kept in a line, with the right hind limbs positioned toward the inside and the rest of the bodies on the other side of the line. The limbs and tails were fixed on the glass plate with tape. The contralateral mice were positioned with the same fixing method, and thus the right hind limbs of the mice on both sides of the central line were opposite (see (2) Irradiation field size and positioning method: the field angle was 180\u00b0, the source skin distance (SSD) was 1m, and the irradiation site was on the right hind limb. The field size was 38cm\u00d76cm (see (3) Determination of irradiation dose: a linear accelerator (Clinac600C/D) was used to irradiate the right hind limbs of mice for a single irradiation of 30Gy with 6MV-X rays at a dose rate of 200cGy/min.MRI examination method: After the mice were anesthetized, two mice were placed in a prone position in parallel and in the same direction in a self-made container, with the tails at the bottom of the container, and then an appropriate amount of dental alginate printing film material  with water added and stirred into cream already was filled into the gap between the abdomens and hind limbs of the mice until it was flat at the highest point of the back of the mice. The alginate would solidify in 2\u20133 minutes. Then the other two mice could be placed in a prone position in turn on the back of the first two mice with the cream alginate material processed and filled in the same way as before. A total of five or six mice can be stacked see Figure 2MRI inspection coil model and parameters: a joint surface coil was adopted, and the parameters were set as follows. Diffusion weighted imaging (DWI) series: Diffusion gradient factor (b) =  s/mm2, echo time (TE) = 47 ms, repetition time (TR) = 4490 ms, number of excitations (Nex) = 1, Matrix 116\u00d7116, scanning field of view (FOV)=134mm\u00d7134mm; Longitudinal relaxation time quantitative (T1-Mapping) sequence: echo time (TE)=2.4ms, repetition time (TR)=6.64ms, The number of excitations (Nex)=1, the matrix (Matrix) is 26\u00d732, and the scanning field of view (FOV)=80mm\u00d780mm.The apparent diffusion coefficient (ADC) value and longitudinal relaxation time (T1) value of the upper segment of the thigh muscles on both sides of the hind limbs were measured three times, and the average value was taken see Figure 3In the acute phase of radiation dermatitis after irradiation on mice, the hair loss and skin inflammation of the right hind limbs of the mice were observed and scored.1 point for normal skin.1.5 points for Mild edema.2 points for Obvious edema accompanied by hair loss, hair loss area \u226425%.2.5 points for Depilation area>25%, but \u226475%, or accompanied by dry peeling.3 points for Dry peeling, depilation area>75%.3.5 points for Moist peeling, depilation area \u226425%.4 points for Moist peeling, depilation area> 25%, but \u2264 50%.4.5 points for Moist peeling, depilation area>50%, with a small amount of necrosis.5 points for Large areas of skin necrosis, visible subcutaneous tissue.The observation index of mouse soft tissue fibrosis (the degree of right hind limb contracture) is the difference between the length of the irradiated right hind limb and the normal left hind limb. The mouse was fixed on a specially designed quantitative standard ruler and kept parallel to the ruler. With the mouse\u2019s ankle joint position as the positioning center, the ankles of both legs were held and gently pulled down at the same time. When the corresponding resistance increases greatly, stretching stopped and the distance between the heel extension point of the right hind limb ankle joint and the heel position of the left hind limb ankle joint was measured and defined as the difference between the irradiated right hind limb and the normal left hind limb see Figure 4After the muscle tissue was taken out, it was fixed with 4% paraformaldehyde for 24\u00a0h, and the sections were embedded in conventional paraffin and dehydrated. The paraffin-embedded specimens were sliced \u200b\u200bcontinuously at a thickness of 4 \u03bcm and dried at 60\u00b0C. These slices were dewaxed twice with the xylene solution, for 30 minutes each time, and then immersed in ethanol of different concentrations before being placed in distilled water. HE and Masson staining were carried out following the kit instructions. In Masson staining, collagen fiber intensity bundles shown in blue were analyzed by Image J Program .Tissue samples from mice were homogenized in lysis buffer  supplemented with phosphatase inhibitors and protease inhibitor . The lysis product was centrifuged at 12000g for 3\u00a0min, and the supernatant was taken for protein quantification according to the manufacturer\u2019s instructions of the BCA quantification kit , and all the sample protein concentrations were adjusted to 2 mg/ml with lysis buffer. Mouse IL-1\u03b2, IL-6, TNF-a and TGF-\u03b21 levels in the extracts were measured according to the manufacturer\u2019s instructions, using specific ELISA kits  respectively. Three replicate wells were set up for each sample and the results were expressed in pg/mg.2O2 was used to block endogenous peroxidase for 10 minutes, followed by blocking with 5% bovine serum albumin (BSA) for 30 minutes. The sections were incubated with anti-\u03b1-SMA  and anti-Fibronectin  antibodies at 4\u00b0C overnight. The sections were washed with PBS buffer three times and placed with the secondary antibody coupled with horseradish peroxidase for 1\u00a0h at room temperature. DAB was then used to develop color. Finally, hematoxylin was employed for counterstaining. After dehydration and transparency, they were observed and picture taken under a microscope. Three random fields of view were taken for each sample, and the average optical density was calculated by Image J Program.Tissue sections with a thickness of 4\u03bcm were deparaffinized, rehydrated, and immersed in sodium citrate buffer to restore the antigen. Then, 3% HThe total protein was extracted with RIPA buffer, and the protein concentration was determined by using a BCA kit. After the protein samples were subjected to polyacrylamide gel electrophoresis, they were transferred to a polyvinylidene fluoride membrane, sealed with 5% skimmed milk powder at room temperature for 1\u00a0h, and then the primary antibody (1:1 000) was added separately, incubated overnight at 4\u00b0C. Then, the membrane was washed with TBST before secondary antibody (1: 2 000) was added and incubated at room temperature for 90\u00a0min, again washed with TBST, and developed with ECL luminescent solution. The imaging system was used to examine and the gray value of each histone band could be determined by Image J software. The relative protein expression level = target band Gray value/\u03b2-actin band gray value. There are three replicates for each protein sample.P<0.05 means the difference is statistically significant.Data were analyzed with SPSS 19.0 statistical software, and the normality test was further confirmed by the K-S method and double-checked by the Q-Q graphic method. The homogeneity of variance test was performed by the F test. When the samples were normally distributed and the variances were uniform, the three groups were compared by analysis of variance, and the two independent sample means were compared with t test. When the samples did not meet the above conditions, the three groups were compared with the Kruskal-Wallis nonparametric test, and the two groups were compared with t test or Mann-Whitney U rank sum test. Image-Pro Plus and Image J were used for analysis and statistics of IHC image and Western blot bands, and Graphpad Prism 6 software was used for drawing. P<0.0001, where the differences between the IR group and Nor group (P<0.0001) and the IR group and GA group (P=0.005) were statistically significant.Radiation dermatitis was observed in both the IR group and the GA group after irradiation, and the state of the IR group was significantly worse than that of the GA group see Figure 5P=0.146) or between IR group and GA group (P=0.402) pg/mg, (766.1 \u00b1 150.2)pg/mg and (569.7 \u00b1 97.6)pg/mg, respectively; those of IL-6 were (153.8 \u00b1 39.1)pg/mg, (261.9 \u00b1 45.8)pg/mg and (147.0 \u00b1 39.8)pg/mg, respectively; and those of TNF-a were (145.8 \u00b1 35.6)pg/mg, (192.8 \u00b1 45.5)pg/mg and (113.6 \u00b1 25.7)pg/mg, respectively. In the IR group compared with Nor group and GA group, the expressions of all the inflammatory factors were significantly increased. However, the expressions of TGF-\u03b21 in the Nor group, IR group and GA group were (1804.6 \u00b1 496.0) pg/mg, (2176.0 \u00b1 617.8) pg/mg and (1965.0 \u00b1 541.9) pg, respectively, and there were no significant differences between the IR group and Nor group (402) see Figure 6After 1.5 months of irradiation, it was observed that the right hind limbs of some mice in the IR group and the GA group began to develop contractures, but the state of the GA group was less serious than that of the IR group. The contractures were measured on the 90th day after irradiation see Figure 7P=0.031) and between the IR group and GA group (P=0.046)  see Figure 8P<0.001) and with the GA group (P=0.009), the differences in the IR group were statistically significant. When fibronectin was concerned, the average optical density values \u200b\u200bof fribronectin in the Nor group, IR group and GA group are 0.001 \u00b1 0.000, 0.013 \u00b1 0.007 and 0.004 \u00b1 0.003, respectively. The differences between the IR group and Nor group (P=0.011) and between the IR group and GA group (P=0.027) were statistically significant  and from the GA group (P=0.001). When fibronectin is concerned, the average optical density values of the ratio of the fibronectin gray value of the Nor group, IR group and GA group were 0.078 \u00b1 0.013, 1.521 \u00b1 0.376 and 0.269 \u00b1 0.226, respectively. There were statistically significant differences between the IR group and the Nor group (P<0.0001) and between the IR group and the GA group (P=0.0001).Western blot method was also used to detect the expression quantity of \u03b1-SMA and fibronectin in the thigh muscles of the right hind limbs of the three groups of mice. The expression of \u03b1-SMA and fibronectin in the Nor group was very low. Both the IR and GA groups showed different levels of expression, but the level of the GA group was significantly lower than that of the IR group. When \u03b1-SMA is concerned, the average optical density values of the ratio of \u03b1-SMA gray value of the Nor group, IR group and GA group to the gray value of respective internal reference \u03b2-actin (\u03b1-SMA/\u03b2-actin) \u200b\u200bwere 0.537 \u00b1 0.095, 1.271 \u00b1 0.236 and 0.666 \u00b1 0.157, respectively. The IR group was significantly different from the Nor group \u00d710-3mm2/s and (1.32 \u00b1 0.07)\u00d710-3mm2/s, and the T1 values were (1381.7 \u00b1 41.4) ms, (1388.9 \u00b1 69.2) ms and (1386.0 \u00b1 65.7) ms, respectively. There was no statistically significant difference among the three groups. On the 7th day after irradiation, the ADC values of the right hind limb muscles of the three groups of mice were (1.35 \u00b1 0.11)\u00d710-3mm2/s, (1.48\u00a0\u00b1 0.07)\u00d710-3mm2/s and (1.36 \u00b1 0.13)\u00d710-3mm2/s, with the ADC value of the IR group higher than that of the Nor group (P=0.008) and the GA group (P=0.013); and the T1 values of the right hind thigh muscles of the mice in the Nor group, IR group and GA group were (1369.7 \u00b1 62.7)ms, (1483.7 \u00b1 127.7)ms and (1304.1 \u00b1 82.3)ms, respectively, with a higher T1 value in the IR group, compared with that of Nor group (P=0.012) and with that of GA group (P<0.001).The ADC values of the right hind thigh muscles of the three groups of mice before irradiation were (1.31 \u00b1 0.07)\u00d710P=0.002), but there were no significant correlations between ADC and IL-1\u03b2 and between ADC and TNF-a. And T1 value is positively correlated with IL-1\u03b2 , IL-6  and TNF-a .On the 7th day after irradiation, the ADC value of the right hind limb muscles of the mice was positively correlated with IL-6  and T1 value  of the hindlimbs of the mice on the 7th day after irradiation were positively correlated with the degree of contracture on the 90th day after irradiation. The ADC value  and T1 value  were positively correlated with the Masson staining results. The was also a positive correlation between the ADC value , T1 value  and the immunohistochemical detected \u03b1-SMA and fibronectin expressions. The results of Western blot detection also showed that the ADC value , T1 value  and \u03b1- SMA and fibronectin protein expressions were positively correlated.The ADC value , computed tomography (CT), SPECT and PET radioisotope research, tumor-related facts, such as blood vessel contour, water content, degree of apoptosis, necrosis or metabolism, can be measured. Magnetic resonance diffusion-weighted imaging (MR-DWI) provides a quantitative parameter\u2014an apparent diffusion coefficient (ADC) which size depends on the viscosity of the molecule, the permeability of the cell membrane, the direction of the tissue and the cell structure that hinders the movement of water molecules , 13. DWICompared with ADC value, T1 mapping is a new magnetic resonance technique, a cardiac magnetic resonance (CMR) imaging technique, which can directly measure tissue T1 relaxation value , reflecting the edema of myocardial cells and the degree of fibrosis of interstitium, so as to evaluate local and diffuse myocardial lesions. Prolonged myocardial T1 values \u200b\u200boccur in most pathological conditions, including edema, as well as some chronic cardiac insufficiency and systemic diseases . There aThe results of this study found that functional MRI may be used as a noninvasive assessment of radiotherapy-induced soft tissue injury, but it needs to be verified in further clinical studies. We plan to apply the MR-DWI and T1 mapping sequence to patients with nasopharyngeal carcinoma to observe the relationship between the changes in the ADC value and T1 value of the neck soft tissue after irradiation and the degree of soft tissue fibrosis in the later stage in the hope of getting wider ground for applying the ADC value and T1 value to predict soft tissue fibrosis after radiotherapy.We found through a mouse model that ADC and T1 values are related to radiation dermatitis and also related to radiation fibrosis, which can be used as a non-invasive means to predict the severity of radiation-induced soft tissue fibrosis in the early stage of radiation therapy.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The animal study was reviewed and approved by Ethics Committee of Fujian Medical University.JH provided the idea of this research and designed the study. BX and LS irradiated mice. NK and ZX detected mice using MRI. XP and CW did HE and IHC. BX and ZW did ELISA and WB. JH, BX and ZW wrote the manuscript. BX did the statistical analysis. All authors contributed to the article and approved the submitted version.This study was funded by the Training project of young talents in the health system of Fujian Province (NO.2015-ZQN-ZD-19).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Providing rigorous quantitative tools to detect such an onset represents an important contribution from the scientific community to proactively support the political decision makers. In this paper, leveraging the quickest detection theory, we propose a mathematical model of the COVID-19 pandemic evolution and develop decision tools to rapidly detect the passage from a controlled regime to a critical one. A new sequential test\u2014referred to as MAST \u2014is presented, and demonstrated on publicly available COVID-19 infection data from different countries. Then, the performance of MAST is investigated for the second pandemic wave, showing an effective trade-off between average decision delay During the course of an epidemic, one of the most challenging tasks for authorities is to decide what kind of restrictive measures to introduce and when these should be enforced. In order to take informed decisions in a fully rational manner, the onset of a critical regime, characterized by an exponential growth of the contagion, must be identified  In March 2020, the exponential increase of individuals needing hospitalization in intensive care units, combined with the lack of effective cures and vaccines, pushed many governments to take extraordinary measures aimed at \u201cflattening the curve\u201d of infections4. The adopted measures included the limitation of mobility and social activities, closure of schools, universities, shops, factories, and so forth, up to the extreme act of national lockdowns. Evidence that such measures achieved a reduction of the rate of new infections are gradually appearing in the scientific literature7.With more than 57 million cases worldwide and over one and 1.36 million deaths as of November 20, 2020, the outbreak of coronavirus disease (COVID-19)11, restrictions should be taken only if and when it is strictly necessary. Managing the trade-off between these contrasting requirements is extremely challenging.These measures contributed to keep the spread of COVID-19 under control for some time, but we are now, in November 2020, experiencing the onset of a new exponential growth of confirmed cases, the \u201csecond wave,\u201d with severe risks for personal health and healthcare systems under severe stress. Governments and authorities are facing again the difficult task of deciding if and when new containment measures may be needed. In absence of limitations to mobility and social activities, the pandemic spreads exponentially in time, so that any delay in applying restrictions may lead to severe consequences. On the other hand, accounting for the social and economic impact of the possible countermeasures, already observed in the first half of 202014,\u00a0and specifically quickest detection schemes17 to propose a rigorous methodology aimed at identifying as quickly as possible the onset of an exponential growth of the pandemic evolution. The proposed procedure\u2014referred to as MAST \u2014is designed to minimize the average time to detect a change in regime17: from a situation in which the pandemic is under control . Then, referring to the red curve, one obtains the corresponding delay Combining the evidence shown in Fig.\u00a030 and updated regularly.The analysis in Figs.\u00a0A comparison of the MAST performance for 14 different nations is addressed in Fig.\u00a0entclass1pt{minima31. In signal processing language, this quantity is often referred to as signal-to-noise ratio32. To provide performance envelopes, we use the values The outer black curves labeled by entclass1pt{minimaentclass1pt{minimaentclass1pt{minimaLet us focus again on Italy, and set 34.It is clear that managing an unprecedented pandemic event is a huge and a multifaceted problem, which can only be addressed by taking into account many different perspectives. It is also clear that the decision when to take pandemic countermeasures depends on a large number of societal factors. The contribution of this article is limited to the analysis of the pandemic strictly from a quickest-detection viewpoint and, from this perspective, we obtain useful insights and quantitative analyses. One evidence, as just pointed out, is that critical regimes of many nations began dramatically earlier than when countermeasures were taken. In this sense, we believe that the proposed decision support tool would be a key component of a command and control (C2) system that anticipates, and possibly reacts as soon as possible, to threats. Such a C2 system would be useful for both national health security and armed forces in the context of Chemical, Biological, Radiological and Nuclear (CBRN) defenseAside from the above retrospective analysis, a major contribution of the MAST quickest detection tool developed in this paper consists of providing proactive decision support for detecting future waves of the COVID-19 outbreak, and the onset of future pandemics. In these cases, precise nation-dependent performance predictions, such as those given in Fig.\u00a0entclass1pt{minima35, such as the Savitzky-Golay filter36, would be more appropriate. Another possibility to handle outliers could be the application of Huber\u2019s robust statistic37.\u00a0 We leave such possible enhancements to future work.Figure\u00a0The quickest-detection tool developed can also be applied to different time-series, other than the sequence of growth rate of daily new positives 38, especially related to their higher fatality rate39, spreading velocity41, and the possibility that approved vaccines might be less effective against them44. The proposed quickest detection tool is useful also in the presence of variants of the coronavirus, which would affect the growth rate; indeed, variants were already present in the United Kingdom during the second wave, reported here in Fig.\u00a0Public opinion soundings suggest increased concern about new SARS-CoV-2 variantsand vice versa can be addressed by minor modifications to the MAST procedure46.The possibility of processing different sequences of data opens the way to the design of more sophisticated decision rules based on joint processing of multiple time-series. In addition, the MAST procedure can easily accommodate different definitions of critical regime. For instance, if a pandemic growth at rate 47.\u00a0 The mortality rate is used as the main indicator to evaluate the extent of underreporting and underdetection of COVID-19 cases47.\u00a0 However, in our context, the evaluation of underreporting cases would not be beneficial in terms of quickest detection, as it is provided by an estimation procedure that uses the same data processed by the quickest detection. As already mentioned, all the available data  could be used jointly and thus improve the detection capability and reliability of the approach.Special attention is given in the literature to the evaluation of underreporting and undertesting of COVID-19 cases30.\u00a0 We hope that in the near future the publicly available data can be: (i) more reliable so as to mitigate bias effects due to, e.g., false positives, contrasting multiple test outcomes for the same individual, markedly different contagion incidence in close geographical areas, etc.; and (ii) released with finer granularity so as to allow for analyses stratified by population age, comorbidity, etc. These aspects are also relevant for effective vaccination policies.An extended analysis of COVID-19 infection data from more countries than those covered in this paper is available on the webn, while 28.\u00a0 Referring for instance to Fig.\u00a0L weights). The smoothed sequence The observation model used in this paper can be formally obtained by replacing the constant growth rate mentclass2pt{minim48 reveals that The time-varying statistical mean entclass1pt{miniman elapses, we want to detect the passage from the controlled regime By observing the sequence unknown sequences.We assume that the 14,\u00a0a milestone of decision theory in scenarios where the statistical distributions of the data contain unknown parameters\u2014in our case, the sequences of mean values 18To detect the change of regime, we rely on the Generalized Likelihood Ratio Test (GLRT) approach49:32.In the presence of unknown and time-varying sequences complying with the constraints on shown in\u00a0\u20135), the, the\\docR is defined as reciprocal of the mean time between successive false alarms , where the false alarm is defined as a threshold crossing during the controlled regime . In this paper, the functions 32 for relatively small values of 16.\u00a0This allows us to extrapolate the behaviour of the two functions for values of The threshold entclass1pt{minimaSupplementary Information 1.Supplementary Information 2."}
+{"text": "Beyond microsurgical resection and radiation therapy, there are currently no established treatment alternatives for meningioma patients. In selected cases, peptide radio receptor therapy (PRRT) can be implemented. For this purpose, a radionuclide is bound to a substance targeting specific receptors in meningiomas. One of them is somatostatin receptor 2, which can be found in most meningiomas. However, other somatostatin receptors (SSTR) exist, but their expressions have only been described in small case series. In this study, we analyzed the expression of SSTR1, 2A, 3, 4, and 5 in a large cohort of meningiomas in order to enable further refinement of this innovative treatment option. Overall, 726 tumor samples were processed into tissue microarrays and stained for SSTR1, 2A, 3, 4, and 5 immunohistochemically. Microscopic evaluation was done with an established semiquantitative score regarding percentual quantification and staining intensity, and results were correlated with clinical data. There was a significant lower rate of SSTR1 expression in meningiomas of male patients. Older age was associated with higher expression of SSTR1, 2A, and 5 and lower scores for SSTR3 and 4. Tumors treated with radiotherapy before resection showed lower rates of SSTR1 and 5 expression, while recurrent meningiomas had lower SSTR1 scores. Tumor tissue from patients suffering from neurofibromatosis type 2 had lower expression scores for SSTR1, 2, and 5. For SSTR3 and 4, NF2 patients showed higher scores than sporadic tumors. Spinal meningiomas had higher scores for SSTR1, 4, and 5 compared tumor location of the skull base and convexity/falx. Overall, higher WHO grade was associated with lower SSTR scores. While all SSTRs were expressed, there are marked differences of SSTR expression between meningioma subgroups. This has the potential to drive the development of more selective PRRT substances with higher treatment efficacy.The online version contains supplementary material available at 10.1007/s10143-021-01552-y. Meningioma is the most common benign intracranial neoplasm. It represents 36% of all central nervous system tumors with only 1.3% showing malignant features . If a meSome studies have analyzed the distribution of somatostatin receptors in meningiomas, especially SSTR2A. However, the patient cohorts were small, mainly consisted of WHO grade I meningiomas, and the tumor grading in these studies deviates from the current WHO classification of central nervous system tumors in which CNS infiltration in meningiomas significantly influences the grading , 36, 38.Between January 2013 and March 2017, a total of 632 meningiomas were resected in the authors\u2019 institution. Additionally, 94 meningiomas of\u00a0WHO grade II and III as well as meningiomas from patients suffering from neurofibromatosis type 2 that were treated between July 2003 and March 2017 were included in order to have larger subgroups of these less common patients that are potential candidates for PRRT. Overall, paraffin-embedded tumor tissue samples of 726 meningiomas were available and suitable for tissue microarray construction. Furthermore, the following clinical data was collected: age, gender, histopathological diagnosis (2016 WHO classification), presence of NF2, prior radiotherapy, primary or recurrent tumor, and tumor location.All meningiomas were histopathologically graded using the 2016 WHO classification for central nervous system tumors . ProvideTo determine the expression of SSTR1\u20135 with regard to intensity and quantity, an intensity distribution score was applied as described by Barresi et al.  , while 31% were male (224/726). The mean age was 56.7\u00a0years ranging from 8.3 to 89.9\u00a0years. With 85%, the majority of cases were primary meningiomas (613/726), whereas 15% were surgically resected for tumor recurrence (113/726). Eight percent of cases received prior radiotherapy (61/726); 90% of these cases were recurrent meningiomas (55/61). Seventy-three tumors were resected from NF2 patients (10%). The majority of tumors were skull base meningiomas , while 39% were localized at the convexity or falx (282/726) and 10% along the spine (69/726). Details are displayed in Table n\u2009=\u200914, 4, and 10 cases, respectively) but more common for SSTR3 and 4 . The mean expression for SSTR1 and SSTR2A had the highest mean values , and the mean scores for SSTR3 and 4 were the lowest , while the mean expression score for SSTR5 was 4.8 . The age cutoffs determined by the CART analysis ranged from 34.5 to 72.5\u00a0years . While the expression of SSTR4 was generally low in meningiomas when compared to other SSTRs . For SSTR5, the differences were more pronounced with 5.7 for spinal meningiomas, while skull base and convexity/falx locations reached a mean score of 4.5 and 4.9 (p\u2009<\u20090.0001). The highest expression score for SSTR2A was seen for skull base meningiomas with 6.2 followed by convexity/falx and spinal location . Skull base meningiomas also reached the highest score for SSTR3 (2.2), while spinal and convexity/falx tumors had similar low mean scores . For details, see Table Somatostatin receptor expression scores varied between different tumor locations. Especially spinal meningiomas exhibited significantly higher expression scores for SSTR1, 4, and 5 and lower values for SSTR2A and 3, when compared to meningiomas of the skull base and the convexity/falx. This was most pronounced for SSTR1, where spinal meningiomas reached a mean score of 8.1, significantly higher compared to skull base and convexity/falx location  and SSTR5 , while expression of SSTR2A, 3, and 4 were similar to tumor tissue that did not receive radiotherapy. Recurrent meningiomas showed a significantly reduced expression for SSTR1 as well, when compared to primary meningiomas . For details, see Table Meningiomas that were treated with radiotherapy before resection had significant lower scores for SSTR1 . On the contrary, the analysis of SSTR3 and 4 expression showed higher mean scores in NF2 meningiomas. For details, see Table Some of the largest differences of SSTR expression were observed when comparing NF2 and sporadic meningioma tissue. The expression scores of SSTR1, 2A, and 5 were significantly lower in meningiomas of NF2 patients. The largest difference was seen in SSTR1 with NF2 tumors reaching a mean score of 4.6 compared to 6.7 of sporadic meningiomas . The expression of SSTR2A was similar for grades I and III meningiomas, while grade II tumors revealed a higher mean expression score (p\u2009=\u20090.0160). Immunohistochemical staining for SSTR5 was scored similar for grade I and II tumors, and lower values were seen for grade III meningiomas (p\u2009=\u20090.0003). For details, see Table Significant expression differences for WHO grades were seen for SSTR1, 2A, 4, and 5, while no differences were observed for SSTR3. For SSTR1 and 4, a gradual decrease of the mean expression score was seen between WHO grades I, II, and III , asterisk(*) presents statistically significant results (PNG 114 KB)Supplementary Fig. S2SSTR expression in primary and recurrent meningiomas , asterisk(*) presents statistically significant results (PNG 115 KB)Below is the link to the electronic supplementary material."}
+{"text": "Making morally sensitive decisions and evaluations pervade many human everyday activities. Philosophers, economists, psychologists and behavioural scientists researching such decision-making typically explore the principles, processes and predictors that constitute human moral decision-making. Crucially, very little research has explored the theoretical and methodological development  of utilitarian theories of moral decision-making. Accordingly, in this critical review article, we invite the reader on a moral journey from Jeremy Bentham\u2019s utilitarianism to the veil of ignorance reasoning, via a recent theoretical proposal emphasising utilitarian moral behaviour\u2014perspective-taking accessibility (PT accessibility). PT accessibility research revealed that providing participants with access to all situational perspectives in moral scenarios, eliminates (previously reported in the literature) inconsistency between their moral judgements and choices. Moreover, in contrast to any previous theoretical and methodological accounts, moral scenarios/tasks with full PT accessibility provide the participants with unbiased even odds (neither risk averse nor risk seeking) and impartiality. We conclude that the proposed by Martin et al. PT Accessibility  is necessary in order to measure humans\u2019 prosocial utilitarian behaviour and promote its societal benefits. Bentham coined this moral doctrine The Greatest Happiness Principle .In the opening sentences of the Introduction to the Principles of Morals and Legislation, Jeremy Bentham describes two sensations, pleasure and pain, and points to their central role in guiding human moral behaviour . AlthougMuch like other consequentialist theories, utilitarianism encompasses the logic of utility maximisation: the ends  justify the means. In other words, as long as the end goal maximises utility, then any potentially egregious act required in order to deliver the goal can be justified. However, there is an important distinction between utilitarianism and other moral consequentialist theories. For example, egoistic consequentialism is characterised by the maximisation of utility for self-interest, in the absence of the interest of others . AlternaSince Bentham\u2019s utilitarianism was originally a proposal for legislative purposes, he proposed that those people with the authority to make a decision should behave as impartial spectators . This differs once again from egoistic and altruistic consequentialism, since egoistic decisions are intended to directly benefit the decision-maker, and altruistic decisions can in some cases cause the decision-maker harm . Utilitaquantity. However, given that pleasures and pains are not easily quantifiable, Bentham suggested a method  to measure them based on 7 dimensions. The 7 dimensions included a pleasure or pain intensity, duration, certainty/uncertainty, proximity/remoteness, fecundity (the probability that it will be followed by a sensation of the same kind), purity (the probability that it will not be followed by a sensation of the opposite kind), and extent (the number of people the sensation extends to). Moreover, John Stuart Mill )In the field of moral decision making, there are two main approaches to understanding how humans process moral problems: (i) moral rationalists who believe that controlled moral reasoning guides human moral choices, and (ii) the moral intuitionists who argue that human moral choices are the result of automatic intuitive responses. According to the rationalist approaches to moral decision-making, controlled cognitive processing is a requirement when making moral decisions . ,35. 34,3Such intuitive responses could be the result of innate evolutionary mechanisms e.g., ,37), how, how37])or emotional intuition when tasked with making moral choices. Greene et al.\u2019s )In order to combat these limitations and confounds, Martin et al.  proposedFurthermore, in Martin and colleagues\u2019 PT accessibility tasks, participants were not primed to act selfishly and there was no incentive for them to do so, given the riskless design of the decision-making task. Martin et al.\u2019s  findingsPhilosophers, economists and psychologists have long debated the principles and application of utilitarian theory. Many modern moral psychologists have also examined the circumstances in which people display utilitarian behaviour, with a large focus on how internal processes such as emotional activations and working memory inform participants utilitarian (or non-utilitarian) responses to hypothetical moral dilemmas ,43,47. AIn this review we have focused on the latter and described recent research which presents participants with novel AV crash scenarios as a new way to measure utilitarian preferences ,60,77. T"}
+{"text": "A 12-year-old male patient was diagnosed with plaque psoriasis when he was 5 years old and has been in remission for about 7 years. The patient, who is in remission, has new lesions that have appeared in the last week. On dermatological examination, we observed multiple pustular lesions on an erythematous background on the upper extremities and the trunk . Biopsy The histopathological findings were consistent with GPP .Polymerase chain reaction (PCR) test was performed to screen for COVID-19 infection in the patient owing to the complaints of high fever and cough during follow-up. Since the test result was positive, the patient was transferred to the pediatric infectious diseases polyclinic.COVID-19 infection is a pandemic that has turned into a global problem. The number of dermatological diseases that are known to coexist with this infection has been increasing with the accumulation of cases.Coronaviruses (CoVs) are positively polarized, single-stranded, enveloped ribonucleic acid (RNA) viruses of the Coronaviridae family. Pustular psoriasis is a rare subtype of psoriasis. Although its etiopathogenesis is not clear, it is assumed that it appears in genetically vulnerable people through immunological and environmental factors. Recently, it is thought that psoriasis could be a new, genetic, autoimmune disease associated with interleukin (IL)-36 receptor mutationPregnancy, drug use, infections, and sudden discontinuation of irritating topical substances, and corticosteroids that are used in plaque-type psoriasis have been defined as triggering factors for GPPMany viruses that cause upper respiratory tract infections have been held responsible for psoriasisWe believe that the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) might also play a role in the etiopathogenesis of pustular psoriasis through the stimulation of various inflammatory cytokines, especially IL-36.Few cases of co-existence of pustular psoriasis and COVID-19 have been reported. This is the first report of a pediatric patient who developed pustular psoriasis due to COVID-19 infection."}
+{"text": "Recent research in the aquaporin (AQP) field has identified a role for diverse AQPs in extracellular vesicles (EV). Though still in its infancy, there is a growing body of knowledge in the area; AQPs in EV have been suggested as biomarkers for disease, as drug targets and show potential as therapeutics. To advance further in this field, AQPs in EV must be better understood. Here we summarize current knowledge of the presence and function of AQPs in EV and hypothesise their roles in health and disease.  \u2022Extracellular vesicles (EV) deliver cargo from donor to recipient cells, modulating physiology\u2022Aquaporins (AQP) are components of EV in both healthy and diseased states and can be isolated from body fluids\u2022Potential functional roles of EV-bound AQP in donor and recipient cells and in EV themselves are discussed. The family's signature NPA  motif defines their selectivity to water and variations in this domain give rise to differential permeability profiles and subclasses of AQPs AQPs can also show different intracellular localisation; though they are primarily located in the plasma membrane, some are also expressed within intracellular vesicles and traffic to the plasma membrane in response to external stimuli including hormones, hypotonicity and hypoxia In vivo, AQPs predominantly form homotetramers, with each AQP monomer possessing a functional, water permeable, central pore http://microvesicles.org/) suggesting AQPs in EV may have diverse roles. Studies have shown differences in the cargo of exosomes compared with microvesicles derived from cells, exosomes are created by invagination into the cell and formation of the endosome and interaction with the endoplasmic reticulum, whereas microvesicles pinch directly off the plasma membrane. Differences in cargo include changes in the orientation of membrane proteins, where proteins in EV are \u2018intracellular side out\u2019 To date the mammalian AQPs 1, 2, 3, 4, 5, 7 and 9 have been found in association with EV , Table 31.12AQPs 1\u20137 and 11 have been isolated from mammalian kidneys and are well characterised in terms of structure, function, localisation within the kidney, nephron and in subcellular regions . Each reIt has been known for some time that kidney-derived AQPs are found in the urine of healthy patients AQP2 is currently the most well researched renal AQP; it has been identified in pathologies such as renal injury, diabetes, cancer and other renal disorders Studies that identify AQP2- uEV often show evidence that supports they are exosomes, generated via the endosomal pathway. They appear small, <100\u00a0nm in diameter Renal AQPs facilitate the clearance and reabsorption of water by the kidneys, balancing overall water and ion levels in response to blood plasma osmolality 2.1Acute Kidney Injury (AKI) is a rapid onset impairment of kidney function which often occurs following ischemic reperfusion, when the kidney's blood supply has been limited due to a blockage, physical injury or reduced blood flow and the kidney has become ischemic. The tissue is injured further upon restoration of the renal blood flow and reoxygenation. AKI is characterised by tissue damage, inflammation, defective urine concentrating ability and dehydration. AKI is difficult to diagnose in its early stages due to a lack of AKI-specific biomarkers 2.2Replacement of a defective kidney is sometimes the only option for treatment for severe disease or injury. The transplantation process faces complications of kidney injury and possible tissue rejection. Transplant patients must be closely monitored for kidney function. Following kidney transplantation patients suffer diuresis 2.3Diabetic Nephropathy (DN) is the gradual decline in renal function often seen in cases of both type 1 and 2 diabetes 2.4Many therapeutic drugs are nephrotoxic, causing tissue damage if used in high concentrations for long time periods. Abdeen et al. have shown that following treatment with the antibiotic gentamycin, kidney damage occurs and AQP2 uEV expression levels are altered, with increases or decreases seen at different timepoints 2.5Leishmania parasite and is associated with reduced renal function. Oliviera et al. have demonstrated reduced renal AQP2 uEV in patients with ACL alongside reduced urinary concentrating capacity. This study suggests reduced renal AQP2 expression in line with previous studies, showing a correlation between uEV AQP2 expression and renal AQP2 expression levels American cutaneous leishmaniasis (ACL) is caused by the 2.6In autosomal dominant polycystic kidney disease (ADPKD), renal cysts are formed. AQP1 expression was seen in within cysts and AQP1 expression decreased as ADPKD progressed and cyst size increased The majority of studies on AQPs in uEV focus on renal AQPs 1 and 2; this is likely due to their important roles in water reabsorption into the bloodstream and their localisation to the apical membrane where they interface directly with urine. Work that seeks to identify EV subclasses of uEV suggests that AQPs are mainly found within exosomes, produced through the endosomal pathway. Given that AQP are known to traffic from intracellular vesicle \u2018stores\u2019 to the plasma membrane to enable the necessary rapid responses to changes in tonicity There are many other renal AQPs yet to be identified in uEV. It is possible that there is selective loading of some AQPs to EV and this may be functionally significant. However, these AQPs may not be released in EV into urine, due to their subcellular localisations; in the kidney, AQP3 is localised to the basolateral membrane of principal cells in the collecting duct where it plays an important role in the concentration of urine Studies that seek to identify renal AQPs 3, 4, and 11 in uEV have been unsuccessful 3The Central Nervous System (CNS) comprises the brain and spinal cord. It is surrounded by cerebrospinal fluid and receives nutrients, oxygen and water from the blood via the blood brain barrier (BBB). CNS-derived EV (cnsEV) have been identified in cerebrospinal fluid and blood Complications of many CNS pathologies include secondary injury caused by inflammation and/or swelling as a result of rapid and excessive accumulation of water in CNS tissue (oedema). As the most abundant water channel in the CNS, AQP4 has been implicated as the channel responsible for the movement in water in these pathologies. CnsEV have also been identified in CNS pathologies including, viral infection Pathologies associated with CNS tissue injury are usually associated with oedema. There are a number of CNS pathologies that cause CNS tissue to become injured. APQ4 has been shown to play a leading role in CNS oedema formation and resolution, allowing rapid movement of water into and out of the CNS. AQP4 and EV have been implicated in a number of CNS injury related pathologies as discussed below.3.1During ischemic stroke, arterial blood supply is blocked and oxygen supply is compromised. This results in cell death and can cause brain damage and even death. Ischemic stroke is known to cause brain oedema. Manley et al. demonstrated that deletion of CNS AQP4 reduces brain oedema in mice following ischemic stroke when combined with water intoxication 3.2Traumatic brain injury (TBI) is either direct or indirect injury to the brain tissue and may result in a loss of BBB integrity, blood vessel damage, cell damage and death, inflammation and oedema Astrocytes that interface with blood vessels make up the BBB . When as3.3AQP4 expressing astrocytes, like other cells, are susceptible, to neoplastic change and the most common and malignant glial cancer is glioblastoma multiforme (GBM). Increased AQP4 expression has been seen in high grade tumours and a variety of roles suggested including water permeability 3.4Neuromyelitis optica spectrum disorders (NMOSD) is an autoimmune disease characterised by brain lesions. Patients often show autoimmunity to AQP4, producing antibodies (NMO-Ab) that bind to the AQP4 protein 3.5neuro-protective function associated with the transfer of amyloid beta to microglia. However, it is clear that not all EV function in a similar manner; whilst disaggregating beta amyloid, microglia release neurotoxic forms in EV; these microglia-derived EV promote a neurotoxic effect. EV are also known to be released from other cells of the neurovascular unit. Astrocytes release EV that contribute to glial cell death Alzheimer's disease is a form of dementia, characterised by \u03b2-amyloid plaques and tangles of the tau protein. It is well established that EV are released by cells of the CNS and it has been suggested that these EV contribute to both physiology and pathology within the CNS. EV have been reported within Alzheimer's disease, tau related pathology and dementia with Lewy bodies. Studies report that EV can transmit pathology, in support of a prion-like aetiology 3.6Stress induced exhaustion disorder (SED) is also known as clinical burnout. Patients suffering with this condition experience chronic fatigue and cognitive dysfunction. SED patients show symptoms similar to those with TBI such as long-term impairment of cognitive function and memory. Wallensten et al. have demonstrated that SED patients have increased levels of circulating astrocyte- derived AQP4 positive EV that those with depressive disorders such as major depressive disorder. AQP4-EV levels in SED patients correlate more closely with those previously seen in TBI patients 4Aquaporins 1\u201312 have been identified in the female reproductive system of mammals including the ovary , oviducts  fallopian tubes (AQP 3), uterus , cervix  and vaginal wall . Extracellular vesicles derived from the female reproductive system have been identified in oviducts, in uterine and vaginal fluids. It is also possible that EV could enter the blood stream via the vasculature of the reproductive system.Human fallopian tubes have been shown to contain EV Endometrial epithelial cell derived EV have been isolated from uterine fluid and characterised Exosomes derived from endometrial stem cells have been isolated from menstrual fluid. These exosomes have been shown to improve healing of injured liver tissue in mice Though AQPs have yet to be identified in EV derived from the mammalian female reproductive system, it is evident the AQP-containing cells are producing EV and that AQPs support functions important to successful reproduction. It is likely that AQPs will be present in microvesicles from these cells. Cells containing intravesicular AQPs may release AQPs in exosomes and AQPs from the plasma membrane may also be in exosomes via the endocytic pathway. AQPs are known to increase vesicle membrane stability, in the synthesis of exogenous exosomes in therapeutics AQPs may play an important role in increasing the stability of exosomes, optimising them for delivery.AQPs 1, 3 and 5 have been identified in human breast tissue Human breast milk (BM) has been shown to contain EV (BM-EV) that could have potential therapeutic effects against gastrointestinal disease such as necrotizing enterocolitis, a common and serious disease seen in new-born babies that cannot tolerate breastmilk and in those born prematurely where milk supply is not ready. It characterised by inflammation and death of cells in the large intestine Exogenous delivery of breast milk derived exosomes to new-borns who are unable to tolerate breast milk may be a preventative solution against the development of necrotizing enterocolitis To date protein composition studies characterising EV derived from the mammalian male reproductive system have not sought to identify the presence of AQPs 5AQP0 plays an important role in lens water permeability and osmotic regulation 6Lung EV have been identified in a number of pathologies. Tumour-derived lung exosomes have been identified as possible biomarkers for cancer AQP4 is also expressed in lung tissue and its expression increases in lung cancer. AQP4 has been shown to be present in fluid collected using this technique. Studies to date do not specify the origin of AQP4 though it may be possible to isolate lung EV using the lung lavage method 7Six AQPs have been identified in the digestive system where they play roles in absorption and secretion of water. AQP5 is expressed in salivary glands and is essential in the secretion of water into saliva. Saliva is rich in EV and is thought to be a potential diagnostic tool for a multitude of pathologies. Saliva is important in the digestion of food, lubrication, oral hygiene and taste. AQP5 has been identified in salivary EV secreted by parotid glands 8AQPs have been identified in red and white blood cells. Early descriptions of EV refer to \u2018platelet dust\u2019 as microparticles released from platelets were the first to be identified AQP1 is expressed in reticulocytes (RBCs) where it regulates volumetric changes in response to fluctuations in extracellular osmolality. AQP1 has been identified in exosomes released by maturing RBCs in isotonic environments whereas cells in hypertonic medium retain AQP1 in the plasma membrane 9When considering the roles of EV, the beneficial release of EV for host cells and/or the effects EV have upon recipient cells and their surrounding environment are typically primary considerations. EV are characterised based on their cargo, which can indicate the cell type from which EV are derived and may provide insight to their potential destination and/or function. EV AQP cargo are relevant to the host and recipient cells, but also play roles in EV integrity. Manipulation of the stability of EV may have profound effects on their function by, for example, supporting a longer half-life for the particle which may support more distant intercellular signalling. In cases where the EV may be propagating a detrimental effect such as enhanced inflammation, this may be an important factor in pathogenesis.Evidence suggests the components of EV are regulated and can be altered by the extracellular environment. EV release can increase or decrease in response to different stimuli and EV cargo and their concentrations can change. The presence of AQP in EV does not appear to be purely as a result of their presence in the plasma membrane. For example, AQP2 loading in uEV is reflective of urine concentration, where lower urine concentration is observed alongside an increase in AQP2 in uEV. AQP1 uEV levels do not increase in AQP1 in hypoosmolar urine though increased cellular expression is observed. The simplest interpretation of this is that AQP presence in EV is regulated beyond their presence in the plasma membrane. Also AQPs 1 and 2 are expressed in different parts of the nephron; AQP1 is expressed in the proximal tubule and AQP2 in the collecting duct. Suggesting more AQP2 is concentrated into uEV in the collecting duct than AQP1 in the proximal tubule.Overall, AQP EV are found in all body fluids. We suggest that the type and role of the fluid gives some indication of potential EV role and potential role of their cargo. Breast milk, for example, delivers nutrients and immunity to an infant and roles for EV in breast milk could be related to this. However, the EV carriage of proteins such as MFG-E8 will also support breast involution. Urine on the other hand is excreted and removes waste products, suggesting EV and their cargo are expected to be released from system.9.19.1.1Originally it was thought that the main purpose of EV release was one of \u2018waste disposal\u2019 to remove unwanted cellular components. Whilst there appears to be support for this notion, it has since been shown that there are other, more complex roles for EV. Nonetheless, the beneficial effects of AQP removal from the plasma membrane may be one explanation for their presence in EV . A prima9.1.2AQP influence membrane fluidity and dynamics. Increased membrane protein density reduces lipid packing, reducing plasma membrane lipid density. In addition, cells and vesicles that are more water permeable increasing membrane fluidity, which is important in cell motility 9.2EV carry cell cargo such as functional DNA, micro RNAs 9.2.1A major role for EV is intercellular communication. It has been shown that EV cargo are reflective of the state and health of the donor cell. EV and their cargo share information with recipient cells and in response, recipient cells are altered. Street et al. have shown that AQP proteins can be transported to neighbouring cells via EV and may be taken up and function in these cells 9.2.2One interesting aspect of EV is the ability to propagate a phenotype to neighbouring cells \u2013 a feature termed the \u2018bystander effect\u2019. This has been noted in cases where irradiated cells can transmit a radiation-damage phenotype to non-irradiated cells 9.2.3It is clear that EV can have profound impacts on immune function and inflammatory responses but, depending on the context and the cargo they carry, they can be pro- or anti- inflammatory 9.2.4It has been shown that the process of endocytosis of the plasma membrane and its release as exosomes can cause orientation switching of membrane proteins 9.39.3.1Upon release from the host cell, EV journey through fluid environments with differing osmolality to their host cell. These environments may be prone to extreme fluctuations in osmolality and EV must be able to adapt to these in order to maintain their integrity. AQP positive cells are able to regulate membrane integrity and we anticipate AQP will pay a similar role in EV, preventing rapid swelling or shrinkage in response to environmental changes, as seen for example in sperm cells 9.3.2Lenzini et al. observe that in order to travel through the extracellular environment, specifically the extracellular matrix, EV must be able to fit through spaces smaller than EV diameter. They hypothesise that EV must have the ability to deform as they have been found in locations distant from their origin 9.3.3Kelly et al. suggest there could be an important role for AQPs in the generation and release of vesicles, specifically for vesicle swelling which facilitates their fusion with the plasma membrane 10EV are well established to carry miRNA and that this can be important in the function of those EV. For example, the carriage of miRNA from EV derived from GBM, can drive macrophage  reprogramming as a result of miR-21 and others It has been shown that miR320a can reduce expression of AQP1 and 4, both in vitro and in vivo. More specifically though, miR-130a transcriptionally reduces the M1 isoform of AQP-4, a level of control that can be reversed with the use of anti-miR-130a 11Changes in AQP expression are seen in many pathologies. This includes both cellular and EV expression. Pathologies are varied and include cancers, tissue injury, ischemia, inflammatory disease. These differences in AQP expression can often be measured and can be used as biomarkers for disease. Clinical measurement of the cellular expression levels of AQPs can be invasive as sample collection may include tissue biopsy, CSF collection or blood sampling. In contrast, extraction of fluids containing EV are often less invasive, for example if EVs can be collected from saliva or urine. Further research into AQP concentration and function in EV could enhance clinical diagnostic procedures.12As AQPs have been implicated in various pathologies, they are considered important potential drug targets. To date, proposed inhibitors of AQPs have proved largely unsuccessful at clinical trial. As such a number of studies have sought to target AQPs using siRNAs in EV that target and alter AQP expression 13It has been shown that endogenous EV can have therapeutic effects on injured tissue in different organisms, promoting wound healing. As such, EV as therapeutics has become an exciting new area of research 14The study of EV is an exciting and still emerging area of research in intercellular communication. It is clear that EV have profound impacts on both inflammatory and repair responses and have important roles to play in health and disease, including those scenarios where AQPs also have an important role. Understanding the role of AQPs within extracellular vesicles is still in its infancy and further studies are needed to fully define the presence of AQPs as well as their function in these different scenarios. There is much work to be undertaken to fully understand this important interaction and especially to define the functional significance of AQPs within EVs in different locations as they journey from donor to recipient cell.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "The division of amyloid fibril particles through fragmentation is implicated in the progression of human neurodegenerative disorders such as Parkinson\u2019s disease. Fragmentation of amyloid fibrils plays a crucial role in the propagation of the amyloid state encoded in their three-dimensional structures and may have an important role in the spreading of potentially pathological properties and phenotypes in amyloid-associated diseases. However, despite the mechanistic importance of fibril fragmentation, the relative stabilities of different types or different polymorphs of amyloid fibrils toward fragmentation remain to be quantified. We have previously developed an approach to compare the relative stabilities of different types of amyloid fibrils toward fragmentation. In this study, we show that controlled sonication, a widely used method of mechanical perturbation for amyloid seed generation, can be used as a form of mechanical perturbation for rapid comparative assessment of the relative fragmentation stabilities of different amyloid fibril structures. This approach is applied to assess the relative fragmentation stabilities of amyloid formed in vitro from wild type (WT) \u03b1-synuclein and two familial mutant variants of \u03b1-synuclein (A30P and A53T) that generate morphologically different fibril structures. Our results demonstrate that the fibril fragmentation stabilities of these different \u03b1-synuclein fibril polymorphs are all highly length dependent but distinct, with both A30P and A53T \u03b1-synuclein fibrils displaying increased resistance towards sonication-induced fibril fragmentation compared with WT \u03b1-synuclein fibrils. These conclusions show that fragmentation stabilities of different amyloid fibril polymorph structures can be diverse and suggest that the approach we report here will be useful in comparing the relative stabilities of amyloid fibril types or fibril polymorphs toward fragmentation under different biological conditions. Amyloid fibrils are proteinaceous polymers characterized by their cross-\u03b2 core molecular structure. The non-covalent intermolecular forces within the cross-\u03b2 amyloid cores running parallel to the fibril axis, from the \u03b2-strands that are oriented perpendicularly to the fibril axis, stabilises the amyloid structure, making them strong and biochemically resilient assemblies ,2. The fSNCA) have been linked to familial PD [Several point-mutations in the \u03b1-synuclein gene  being ailial PD ,12 subseilial PD . Studiesilial PD ,12. Amyloid formation follows a nucleation-dependent polymerisation mechanism ,14, wherHere, we report a comparative analysis of the dynamic fragmentation stability of morphologically distinct fibrils formed in vitro from WT \u03b1-synuclein and two of its familiar single-point mutation variants . The relative resistance of the three types of \u03b1-synuclein amyloid fibrils toward fragmentation promoted by controlled sonication was determined. We find that the sonication-induced fragmentation of all three \u03b1-synuclein amyloid fibril types is length dependent, but their overall stability towards sonication-induced fragmentation is markedly different, confirming the possibility of differential fragmentation stabilities for different structural polymorphs of amyloid fibrils. Our results also show that A30P and A53T \u03b1-synuclein fibrils display more resilience towards fragmentation than their WT counterparts. These differences in fragmentation stability could be linked to the propensity of A30P and A53T to form fibril clusters, highlighting the surfaces properties of different fibril polymorphs as a key physicochemical property that may provide a link between the polymorphic structures of amyloid to their biological and pathological roles.E. coli cells were transformed with the pET23a plasmid containing the WT human \u03b1-synuclein sequence or its point-mutation variants. The cells were cultured in LB, supplemented with ampicillin sodium salt (100 \u03bcg/mL). After overnight incubation at 37 \u00b0C, the pellets were resuspended in LB with the same ampicillin concentration. IPTG was added to the culture when its OD600 reached about 0.6 to induce recombinant \u03b1-synuclein expression. After 4 h of incubation, cells were harvested by centrifugation and resuspended in 20 mL of lysis buffer  and complete protease inhibitor tablets were added to the cells in the spun down pellet. The cells were sonicated on ice and cell debris was then removed by centrifugation at 13,000 rpm for 30 min. The resulting supernatant was acidified to pH 3.5 using 1 M HCl and incubated on a tube roller at 4 \u00b0C for 30 min. The pH was then neutralised to 7.5 using NaOH on ice. The solution was subsequently treated with 30% (NH4)2SO4 and incubated at 4 \u00b0C for 20 min on a tube roller. The solution was then centrifuged at 13,000 rpm and the supernatant was treated with 50% (NH4)2SO4 and incubated at 4 \u00b0C on a tube roller for another 20 min. Further centrifugation at 13,000 rpm for 30 min was performed and the resulting pellet was dissolved in 20 mM Tris, pH 7.5, to a final volume of 2.5 mL for anion exchange chromatography with a HiTrapTM Q FF column as otherwise previously described [Recombinant human WT, A30P, and A53T \u03b1-synuclein proteins were produced and purified according to the method used by Cappai et al. , with thWT, A30P and A53T \u03b1-synuclein amyloid fibril samples were formed by buffer exchanging purified protein monomers into fibril-forming buffer  using a PD-10 column with Sephadex G-25 medium . Protein concentration was determined by absorbance at 280 nm, and the sample solutions were diluted to 50 \u03bcM monomer equivalent concentration with FFB. The samples were subsequently incubated at 37 \u00b0C in a shaking incubator with agitation set at 180 rpm for at least 14 days.Fragmentation of WT, A30P and A53T \u03b1-synuclein amyloid fibrils was carried out by sonication using a Qsonica Q125 20 kHz probe sonicator with a 2 mm probe and set at 20% amplitude (lowest possible amplitude setting). For each \u03b1-synuclein fibril sample, 400 \u03bcL of an initial sample  in a LoBind Eppendorf tube was placed on ice and pulse sonicated in 5 s intervals, with 5 s of rest between the pulses to counteract the heating of the solution. This was performed in multiple cycles to attain the required time duration in the sonication time-point sequence, yielding total durations of 5, 10, 20, 40, 80, 320 and 640 s of mechanical perturbation by sonication.https://github.com/mtournus/Fragmentation accessed on 23 August 2021). Briefly, assuming nucleation, elongation, and depolymerisation processes are negligible in their rates compared to fibril fragmentation during the sonication procedure, the \u03b3 parameter describing how the fragmentation rate constants depend on fibril length can be extracted by fitting the following equation to the time (t) dependence of average fibril lengths \u00b5.For samples sonicated 10 s or longer, used for quantitative analysis of the fragmentation reactions, after each sonication duration time point, the sonicated samples were immediately diluted into the FFB to a final concentration of 1 \u03bcM (WT), 5 \u03bcM (A30P) or 25 \u03bcM (A53T) to be immediately used for AFM imaging so that sufficient coverage of evenly dispersed and well-separated fibril particles could be obtained on images. For non-sonicated samples or samples sonicated for 5 s, only the A30P fibril sample was diluted to a final concentration of 25 \u03bcM, while WT and A53T \u03b1-synuclein fibril samples were used without further dilution for AFM imaging. Samples were prepared for AFM imaging by incubating a 20 \u03bcL fibril sample solution on a freshly cleaved mica surface for 5 min at room temperature. The mica surface was subsequently washed with 1 mL of stereo-filtered Milli-Q water (prepared using a Minisart Syringe Filter with 0.2 \u03bcm pores) to remove non-deposited fibrils. The sample on mica support was then gently dried with nitrogen flow. AFM imaging was carried out on a Bruker Multimode 8 scanning probe microscope with a Nanoscope V controller, using the ScanAsyst peak-force tapping imaging mode. Bruker ScanAsyst-Air probes  were used throughout. Images were captured at 10 \u00d7 10 \u03bcm or 4 \u00d7 4 \u03bcm scan sizes with a fixed pixel resolution of 2048 \u00d7 2048 pixels. The images were processed using the supplied software  to remove scanner tilt and bow. The images were then imported into MATLAB, where the length and height of individual fibril particles were measured. The fibril length and height distributions were obtained as previously described ,25. For st is the time point from which the best-fit pure fragmentation model is likely reliable in describing the experimentally observed length decay and C is a constant. The \u03b1 parameter describing the typical magnitude of the division rate constants was then calculated with \u03b3 obtained from Equation (1) using the following equation:In Equation (1), x is fibril length and f is the normalised length distribution at time t. The \u03b1 parameter was obtained by averaging the \u03b1 values obtained for each st > t time-points. The fragmentation rate constants for any fibril length are then B(x) = (\u03b1\u00b7x)\u03b3 s\u22121. Parameter standard errors were estimated by the Jackknife resampling method.In Equation (2), To investigate the impact of the disease-associated familiar point mutations A30P and A53T on the stability of \u03b1-synuclein amyloid towards fragmentation, WT, A30P, and A53T \u03b1-synuclein monomers were first assembled in vitro into amyloid fibrils under identical solution conditions at neutral pH (10 mM sodium phosphate buffer at pH 7.4). Under these solution conditions, twisted filaments morphologically typical for amyloid fibrils  were forAmyloid fibrils formed from \u03b1-synuclein sequences in vivo and in vitro can adopt a wide variety of different structures due to the phenomenon known as structural polymorphism . StructuThe dynamic stability of WT, A30P and A53T \u03b1-synuclein fibrils towards fragmentation was next probed by controlled sonication. We have previously employed stirring as the mechanical perturbation used to probe the relative fragmentation stability of different types of amyloid fibrils . ControlAs seen in Quantitative measurements of the length distributions and the height distributions of WT, A30P, and A53T \u03b1-synuclein fibril particles undergoing division by fragmentation promoted by controlled sonication and monitored by AFM  were nexx)-dependent division rate constants, B(x), as well as the parameters \u03b3 describing how the rate constants depend on fibril length, and \u03b1 describing the typical magnitude of the division rate constants, were directly extracted from the data. We first determined the \u03b3 value associated with the fragmentation of each of the \u03b1-synuclein fibril types  = (\u03b1\u00b7x)\u03b3 s\u22121 [B(x) for A30P and A53T \u03b1-synuclein fibrils are at least one order of magnitude smaller compared to WT fibrils for fibrils 100 nm in length (x) or shorter. For fibrils 20 nm in length or shorter, the differences in B(x) increased to more than two orders of magnitude. Thus, for fibrils between ~10 to ~1000 nm in length that were observed in the AFM experiments, A53T \u03b1-synuclein fibrils are most resistant to fragmentation followed by A30P and WT \u03b1-synuclein fibrils, which are least resistant to fragmentation \u03b3 s\u22121 ,27 for tFibril fragmentation is a crucial process in the life cycle of amyloid, as it enables the propagation of the amyloid state by generating small and active fibril seeds, which may be linked with the potential for toxicity  and cellTo evaluate the relative fragmentation stability of amyloid fibrils, we have previously developed an experimental approach that involves the fragmentation of pre-formed amyloid samples by mechanical perturbation in the form of stirring using magnetic stirrer bars . This meTo investigate whether different fibril polymorphs could display observable differences in their stabilities towards fibril fragmentation, we compared the relative mechanical fragmentation stability of WT \u03b1-synuclein fibrils with fibrils formed from A30P and A53T \u03b1-synuclein. Consistent with previous biophysical studies ,12, thesFibril fragmentation of amyloid fibrils in vivo is dependent on the catalytic activities of molecular chaperones in the cells ,39. At t"}
+{"text": "Populus euphratica Oliv. has a high tolerance for drought, salinity, and alkalinity. The main purpose of this study is to explore the effects of environments of different salinity intensities on endophytic community structure and the possible roles of endophytes in the tolerance of host plants. The characterization of endogenous bacteria in diversity has been investigated by using the Illumina high-throughput sequencing technique. The research showed that endophytic bacteria of P. euphratica in an extremely saline environment had low species diversity, especially in sap tissue. The dominant phyla in all groups were Proteobacteria, Actinobacteria, and Bacteroidetes. Notably, Firmicutes (relative abundance\u2009>5%) was a different dominant phylum in the samples from the high-saline environment compared with the relatively low-saline-environment group. The linear discriminant analysis effect size (LEfSe) analysis found that there were significant differences in different saline environments of Cytophagaceae (family), Rhodobacteraceae (family), and Rhodobacterales (order). These results indicated that the composition of the endogenous bacterial community was related to the growth environment of host plants. The predictive analysis of KEGG pathways and enzymes showed that the abundance of some enzymes and metabolic pathways of endophytes of P. euphratica increased with the increase of soil salinity, and most of the enzymes were related to energy metabolism and carbohydrate metabolism. These findings suggested that the endogenous bacteria of the host plant had different expression mechanisms under different degrees of stress, and this mechanism was very obvious in the distribution of endophytes, while the function of the endogenous bacteria needs to be further explored.IMPORTANCE Euphrates poplar (Populus euphratica Oliv.), as the only tree species that grows in the desert, has tenacious vitality with the characteristics of cold tolerance, drought tolerance, salt-alkali tolerance, and wind-sand resistance. P. euphratica has a long growth cycle and a high growth rate, which can break wind, fix sand, green the environment, and protect farmland, making it an important afforestation tree species in arid and semiarid areas. The area of P. euphratica in Xinjiang accounts for 91.1% of its area in China. Studying the endophytic bacteria of P. euphratica can give people a systematic understanding of it and the adaptability of the endogenous flora to the host and special environments. In this study, by analyzing the endophytic bacteria of P. euphratica in different saline-alkali regions of Xinjiang, it was found that the bacteria in different tissues of P. euphratica changed with the change of soil salinity. Especially in the sap tissue of P. euphratica under extremely high salinity, the diversity of endogenous bacteria was significantly lower than that in other tissues. These differential bacteria under different salinities were mostly related to the stress resistance of themselves and the host. Not only that, we also selected a strain of Bacillus with high stress resistance from the tissues of P. euphratica, which can survive under the extreme conditions of 10% NaCl and pH 11. We obtained a genome completion map of this strain, named it Bacillus haynesii P19 (GenBank accession no. PRJNA648288), and tried to use it for fermentation but in a different work, so as to develop it into a promising industrial fermentation chassis bacterium. Therefore, this study was of great significance for the understanding of endophytic bacteria in P. euphratica and the acquisition of extremophilic microbial resources. Salt-affected soils (SAS) are a global issue. Data from the Food and Agriculture Organization of the United Nations (FAO) indicates that greater than 424 million hectares of topsoil (0 to 30\u2009cm) and 833 million hectares of subsoil 30 to 100\u2009cm) are salt affected: 85% of salt-damaged topsoils are saline, 10% are sodic, and 5% are saline-sodic, while 62% of salt-affected subsoils are saline, 24% are sodic, and 14% are saline-sodic , as the only tree species that grows in the desert, has tenacious vitality with the characteristics of cold tolerance, drought tolerance, salt-alkali tolerance, and wind-sand resistance  values were 10.11 dS/m and 18.95 dS/m, respectively, while the pH values of soil samples DBC_8 and DBC_9 collected from the Darbancheng District were 7.13 and 7.09 and the ECe values were 3.69 dS/m and 6.58 dS/m, respectively  species, while the Shannon index is relative to OTU diversity. The results showed that the Shannon index and Chao index of the sap tissue of habitats . HoweverP. euphratica under different salinities, we constructed a Venn diagram to identify the number of OTUs presented in these groups , which was consistent with the results of alpha diversity analysis.For further investigation of the composition of endophytic bacteria in each tissue sample of e groups . Figure\u00a0bacteria . For thelinities , the sapP. euphratica (combining the species that account for less than 1% of the abundance in the sample as \u201cothers\u201d).Then, we clustered these OTUs at the phylum level with a 70% threshold. The results were presented by bar and pie charts. All OTUs were identified as 37 prokaryotic phyla. P. euphratica were mainly concentrated in 13 phyla including Proteobacteria, Bacteroidetes, Actinobacteria, Firmicutes, Chloroflexi, Deinococcus-Thermus, Verrucomicrobia, Gemmatimonadetes, Saccharibacteria, Planctomycetes, Cyanobacteria, Parcubacteria, and Acidobacteria. Among them, Proteobacteria was the most abundant phylum across all tissues, and the relative abundance ranged from 13.12% to 49.22%. Most of the Proteobacteria in nature are Gram-negative bacteria. They are widely distributed and are important mediators of the nitrogen, sulfur, and carbon cycle in the ecosystem , and tried to use it for fermentation but in a different work  results that the microbial community of ordingly . The sepiversity  and commiversity  and the iversity . This maP. euphratica was reduced under extremely high salinity, most of the surviving bacteria were associated with salinity tolerance. As shown in Nesterenkonia and Bogoriella, which were highly abundant under extremely high salinity, had been documented to be related to salt tolerance. Culturable bacteria such as Bacillus and Halomonas screened from the tissue of P. euphratica in the early stage of the laboratory work also had literature showing that they can improve the salt tolerance of plants as plant growth-promoting rhizobacteria . Chaudhary et al. isolated two novel psychrotolerant members of the family Cytophagaceae from Arctic soil  and Rhodobacterales (order). In previous studies, most Rhodobacterales originate from marine habitats but some originate from (hyper-)saline lakes or soil  effect size (LEfSe) method to analyze biomarkers. As shown in tic soil . Some recharides . Therefo or soil .P. euphratica. Some stress-resistant bacteria in P. euphratica can better help it resist the external stress environment. For example, the highly abundant Firmicutes of P. euphratica under high salinity can help it resist extreme conditions by producing endospores. The high-abundance Deinococcus-Thermus in tissues of P. euphratica with moderate salinity are not salt tolerant but are tolerant of drought, high temperature, and radiation. Some salt-tolerant or alkali-tolerant bacteria such as Nesterenkonia, Bogoriella, Alkalibacterium, Cellulomonas, and Cytophagaceae that exist in tissues of P. euphratica under extreme salinity will have potential application value if they can be used well.The above results suggested that different salinity will affect the composition of the endogenous microbial community of P. euphratica would change with the change of environmental salinity, we used the PICRUSt2 (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) tool to predict the function of endophytic bacteria of P. euphratica and compared the microbial metabolic functional abundances in different salinity groups.Since the endogenous bacterial community of P. euphratica changed with the change of soil salinity  and high-salinity LB liquid medium . It can be seen that under high pH and in a high-salt environment, Bacillus haynesii P19 took more time to adapt to the saline-alkali environment during the adaptation period, and when it reached the plateau period, the growth density of the bacteria was only slightly lower than that in the normal environment. Although Bacillus haynesii P19 could survive under the extreme condition of 10% NaCl and pH 11, its growth was poor, so it was not shown in Bacillus haynesii P19 had a high salt-alkali tolerance, we can try to use it as a chassis strain for research and industrial production.As mentioned above, we screened a salt-tolerant strain, P. euphratica in different saline environments. Although the habitats were different, the compositions and structures of endophytic bacterial communities were similar, mainly including Proteobacteria, Actinobacteria, Bacteroidetes, and Firmicutes.In this study, we report the endogenous bacterial community structure of P. euphratica in different saline environments and different tissues was varied; in particular, the Shannon index and Chao index of the sap of P. euphratica under extreme salinity were lower than those in other groups. At the phylum level, in the endophytes of P. euphratica, the high-abundance Firmicutes under high salinity can form endospores to resist extreme conditions. The high-abundance Deinococcus-Thermus under moderate salinity were drought tolerant but not saline tolerant. At the genus level, the dominant genera of sap of P. euphratica under extreme salinity were very different from those of other groups, almost all of which were related to saline-alkali tolerance. The LEfSe analysis suggested that the endogenous bacteria in P. euphratica were significantly varied at the different taxonomic levels, indicating that the different growth environments of P. euphratica can affect the abundance of its endogenous bacteria. These clades that showed the advantage of abundance in the groups under extreme and very strong salinities not only were resistant to salt-alkali stress but also had certain advantages in other aspects: for example, Cytophagaceae are the main degraders of cellulosic polysaccharides.We compared the differences of microorganisms in different salinities; alpha diversity showed that the endogenous bacterial diversity of P. euphratica, we found that the abundance of some enzymes and metabolic pathways of endophytes of P. euphratica increased with the increase of soil salinity. Most of the enzymes were related to energy metabolism and carbohydrate metabolism, such as the tricarboxylic acid cycle and glycolysis.By predicting the function of endophytic bacteria of Bacillus haynesii P19 screened from the tissue of P. euphratica can still grow well under the conditions of 60 g/L NaCl and pH 10. Under these conditions, in addition to the adaptation period and the time to reach the plateau phase of the strain being longer than those in the normal environment, the bacterial growth density in the plateau phase was only slightly lower than that in the normal environment. This indicated that Bacillus haynesii P19 has great potential to be developed as an industrial fermentation chassis bacterium.The saline-alkali-tolerant strain P. euphratica and compared the microbial divergences in different salinities. We found that different saline environments will affect the composition of the endogenous flora of P. euphratica. These findings may provide valuable information for understanding the relationship between the environment and endophytes of a plant. On the other hand, we found that the endophytes of P. euphratica may be involved in some of the metabolic pathways that tolerate salt stress. These provided evidence that the endogenous bacteria of the host plant had different expression mechanisms under different degrees of stress, and this mechanism was very obvious in the distribution of endophytes. However, due to the limitation of conditions, it was impossible to determine which specific metabolic pathways and physiological systems were regulated by the predicted microbial functions alone in a saline-alkali environment. Therefore, further exploration through metagenomics is needed in the future.Taken together, this study has systematically described the endogenous bacterial flora of P. euphratica xylem, three samples of P. euphratica sap, and two samples of rhizosphere soil from a P. euphratica forest  in Zephyr, Xinjiang, China , and collected four samples of P. euphratica xylem, three samples of P. euphratica sap, and two rhizosphere soil samples as controls from a P. euphratica forest  in Darbancheng, Xinjiang, China . To ensure the least damage to Populus euphratica, we used a scalpel to scrape 10 to 15 g of the lower xylem tissue and collected the sap from the incision of the tree trunk and soil samples at a depth of 5\u2009cm in the corresponding area. The above samples were collected in October 2019. Since the location of the sample collection was in the P. euphratica forest reserve, in order to prevent the destruction of P. euphratica vegetation, we had no way to use traditional methods to collect samples, such as the five-point method, so we could select only typical samples to collect.We collected four samples of When collecting each sample, three parallel samples were taken and mixed into one sample, which was stored in a 20- by 20-cm sterile zip-lock bag and placed in an incubator with an ice bag for transportation to the laboratory. Prior to DNA extraction, samples were stored at \u221280\u00b0C.+, Na+, Ca2+, and Mg2+) and anions , in which K+ and Na+ were determined by flame photometry, Ca2+ and Mg2+ were determined by EDTA complex metric titration, CO32\u2212 and HCO3\u2212 were determined by double indicator neutralization titration, Cl\u2212 was determined by silver nitrate titration, and SO42\u2212 was determined by EDTA indirect titration. The specific determination method of each indicator refers to Soil and Agricultural Chemistry Analysis  the soil samples; estimated soil parameters with a soil-to-water ratio of 1:5 (wt/vol); and used a conductivity meter  to measure the total amount of water-soluble salt. The pH of the soil was measured with a pH meter . Soil salt content (grams per kilogram) was calculated as the total mass fraction of cations  according to manufacturer protocols. Subsequently, DNA concentration and purity were determined with a NanoDrop 2000 UV-visible (UV-vis) spectrophotometer .ACTCCTACGGGAGGCAGCAG-3\u2032) and 806R (5\u2032-GGACTACHVGGGTWTCTAAT-3\u2032) with an ABI GeneAmp 9700 PCR thermocycler   .2O) were combined into a total volume of 20\u2009\u03bcL. The PCR amplifications were performed as follows: 95\u00b0C for 3 min, followed by 30 cycles of 95\u00b0C for 30 s, 55\u00b0C for 30 s, and 72\u00b0C for 45 s, and a final extension of 72\u00b0C for 10\u2009min. The PCR products (3\u2009\u03bcL) were detected using 2% agarose gels containing ethidium bromide, purified with the AxyPrep DNA gel extraction kit , and quantified using QuantiFluor-ST .PCRs were performed in triplicate as follows: 4\u2009\u03bcL of 5\u00d7\u2009FastPfu buffer, 2\u2009\u03bcL of 2.5\u2009mM deoxynucleoside triphosphates (dNTPs), 0.8\u2009\u03bcL of each primer (5\u2009\u03bcM), 0.4\u2009\u03bcL FastPfu polymerase, 0.2\u2009\u03bcL bovine serum albumin (BSA), 10\u2009ng template DNA, and double-distilled water (ddHPurified amplicons were pooled in equimolar amounts and paired-end sequenced (2\u2009\u00d7\u2009300) on an Illumina MiSeq platform  according to standard protocols of Majorbio Bio-Pharm Technology Co., Ltd. .The raw 16S rRNA gene sequencing reads were demultiplexed, quality filtered by Trimmomatic, and merged by FLASH with the indicated criteria. (i) The 300-bp reads were truncated at any site receiving an average quality score of <20 over a 50-bp sliding window, the truncated reads shorter than 50\u2009bp were discarded, and reads containing ambiguous characters were also discarded. (ii) Only overlapping sequences longer than 10\u2009bp were assembled according to their overlapped sequence. The maximum mismatch ratio of the overlapping region is 0.2. Reads that could not be assembled were discarded. (iii) Samples were distinguished according to the barcode and primers, and the sequence direction was adjusted; the barcode matching had to be exact, but a 2-nucleotide mismatch was allowed in primer matching.We used Uparse (version 7.1) to analyze the data of the 16S rRNA gene. The obtained sequences were denoised, unified, and aligned into OTUs using definitions of \u226597% sequence similarity. The taxonomy of each OTU representative sequence was analyzed by RDP  Classifier (v.2.11) against the 16S rRNA database (Silva SSU138) using the confidence threshold of 0.7.At the same time, Mothur (v.1.30.2) was used to calculate the alpha diversity (including Shannon and Chao indexes) to reflect the species richness and diversity in the samples. Principal-coordinate analysis (PCoA) was done in R using the ape package from the Bray-Curtis distance matrix to analyze the beta diversity to compare the community compositions of the tested samples. R language (version 3.3.1) was used to analyze the endophytic bacterial composition of the samples.http://huttenhower.sph.harvard.edu/galaxy/root?tool_id=lefse_upload), the nonparametric Kruskal-Wallis (KW) rank sum test was first used to detect the differences in species abundance between the two groups and obtain significantly different species. Then, the Wilcoxon rank sum test was used to test the difference and consistency of the different species in the subgroups between different groups. Finally, LDA was used to estimate the impact of these different species on the difference between groups.In the LEfSe software , and LB solid medium was prepared with 19 g/L agar powder added to liquid medium. Then, the bacteria after centrifugal cleaning were smeared on the glass slide, dried naturally, fixed on the scanning electron microscope (SEM) copper plate with liquid conductive glue on the back side up, sprayed with gold, and then placed on the SEM stage to collect images.Bacillus haynesii P19 has been deposited in GenBank under accession no. PRJNA648288.The sequence of"}
+{"text": "ClinicalTrials.gov ID: NCT04521621 and NCT04152863.Oncolytic virus immunotherapy is emerging as a novel therapeutic approach for cancer treatment. Immunotherapy clinical drug candidate V937 is currently in phase I/II clinical trials and consists of a proprietary formulation of Coxsackievirus A21 (CVA21), which specifically infects and lyses cells with overexpressed ICAM-1 receptors in a range of tumors. Mature Coxsackievirus virions, consisting of four structural virion proteins, (VPs) VP1, VP2, VP3, and VP4, and the RNA genome, are the only viral particles capable of being infectious. In addition to mature virions, empty procapsids with VPs, VP0, VP1, and VP3, and other virus particles are produced in V937 production cell culture. Viral protein VP0 is cleaved into VP2 and VP4 after RNA genome encapsidation to form mature virions. Clearance of viral particles containing VP0, and quantification of viral protein distribution are important in V937 downstream processing. Existing analytical methods for the characterization of viral proteins and particles may lack sensitivity or are low throughput. We developed a sensitive and robust reverse-phase ultra-performance chromatography method to separate, identify, and quantify all five CVA21 VPs. Quantification of virus capsid concentration and empty/full capsid ratio was achieved with good linearity, accuracy, and precision.  It has been studied in a range of tumors that upregulate cell surface receptor ICAM-1, including melanoma, bladder cancer, and breast cancer. In early clinical trials, V937 demonstrated viral targeted tumor cell death with promising clinical outcomes and acceptable safety profiles.3\u20135Oncolytic viruses that target specific cancer cell types have been developed as novel immunotherapy approaches. Oncolytic viruses that specifically target and destroy tumor cells and enhance the adaptive immune response are considered as therapeutic tools with great potential.CVA21 belongs to the genus enterovirus within the family Picornaviridae. Other viruses in the family Picornaviridae include Poliovirus and Rhinoviruses. Five capsid structural virion proteins (VPs) are generated from precursor polyprotein in Coxsackievirus morphogenesis. These VPs are originated from the P1 domain of the precursor polyprotein. A myristoylated (Myr) VP0-VP1-VP3 heterotrimeric promoter complex is initially formed. These Myr-VP0-VP1-VP3 protein complexes can be assembled into an empty procapsid through pentamer intermediates.6\u201310 Both empty and full capsids of Coxsackievirus appear in similar sizes with diameters of \u223c30\u2009nm.11Each empty capsid contains 12 pentamers or 60 copies of individual VP0, VP1, and VP3. When the virus genome RNA is encapsidated by the pentameric protein complexes, an intermediate provirion is formed first, but then converted to a full mature virion upon cleavage of VP0\u2013VP2 and VP4. Each full capsid will contain 60 copies of individual VP1, VP2, VP3, and VP4, plus a VPg-modified single-stranded RNA (7.4\u2009kb) genome .6\u201310 Bot12\u201314 Accurate and precise measurements of capsid concentrations and capsid empty/full ratio are required to define clinical dosage and product target profile. Conventionally, the virus capsid concentration and/or capsid empty/full ratio are measured using low-throughput techniques, such as analytical ultracentrifugation, Cryo-EM.15\u201317 Polymerase chain reaction techniques that measure the genome titer or immuno-binding assays, such as ELISA, have also been employed to assess oncolytic particles. These assays are highly variable and labor intensive.19Generally, mature, full virions are the only particles capable of eliciting oncolytic activity. The empty capsids may generate undesired immune response that could compromise oncolytic potency of the product. Characterization of virus VPs and quantitation of virus capsid titers or concentrations (capsids/mL or Cp/mL) are of great interest to the gene therapy and vaccine research and product development.21 Recently, analytical ion exchange chromatography/high performance liquid chromatography (HPLC) method for adeno-associated virus (AAV) has also been developed with success highly dependent on the consistency of the virus surface charges.23 For AAVs, size-exclusion chromatography (SEC) methods involving multiple in-line detectors were also reported recently,24\u201326 as well as capillary isoelectric focusing and native mass spectrometry.27\u201329 We have recently reported SEC methods coupled with in-line multiple detectors for the characterization of our V937 oncolytic Coxsackievirus and other vaccines,30 but there is no report that uses reverse-phase chromatography to quantify virus empty/full capsid ratio. Batch mode optical density (OD) measurements have been used to measure the product in bulk. In the OD measurements, the target virus is not separated from unwanted impurities and sample matrix. The batch OD measurements can easily encounter accuracy or/and precision issues, due to the heterogeneity nature of the virus products and lack of assay specificity.31 the total protein content is considered to remain constant for empty procapsid, provirion, and full mature virion. Therefore, the total capsid concentration of a virus sample can be deduced from measured total protein concentration, when compared with a virus standard of known capsid concentration. Furthermore, the moles of VP0 in an empty capsid is equal to the moles of VP2 or VP4 in a full capsid. Mature full capsids contain VP2 and VP4 without VP0, whereas empty provirion capsids contain VP0, but not VP2 and VP4. Based on the capsid's structural features, the VP0/(VP2+VP4) peak area ratio can be used to represent capsid empty/full ratio. Herein, we have developed a robust and sensitive reverse-phase ultra-performance chromatography (RP-UPLC) assay that can separate, identify, and quantify all five Coxsackievirus VPs  in a single run.Because VP2 and VP4 are cleaved from VP0 without losing any amino acid residue,Both VP0 and VP4 were observed as myristoylated proteins. Since the sum of total VPs is consistent for empty and full capsids, a pure empty or full capsid reference standard was not required for capsid (Cp) quantification. Virus samples with known capsid concentration are suitable for assay reference standards, even if they might be a mixture of empty and full capsids. This can be advantageous for early process development, when a pure empty or full capsid standard is not easily available. This assay has demonstrated good linearity, accuracy, and precision for quantification of capsid particle concentration and capsid empty/full ratio.Around 0.1% trifluoroacetic acid (TFA) HPLC water and 0.1% TFA acetonitrile were purchased from MilliporeSigma . Bovine serum albumin (BSA) standard ampules (2\u2009mg/mL) and dithiothreitol (DTT) were purchased from Thermo Fisher . BIOshell IgG C4 columns  were purchased from MilliporeSigma.Briefly, V937 drug substance (DS) was produced from infected MRC-5 (derived from ECACC 05072101) cell culture using a virus seed derived from a CVA21 Kuykendall prototype strain (ATCC VR-850). Lysates were harvested and clarified through depth filters and purified across an affinity chromatography and two polishing ion exchange chromatography steps to concentrate and clear residual impurities and procapsids. Purified V937 was exchanged into a stabilizing buffer and passed through a 0.2\u2009\u03bcm filter to generate the final DS. Empty procapsids and empty/full capsid mixtures were purified from an intermediate chromatography step. Three batches of Process 1 and Process 2 sample intermediates were generated using different process conditions and analyzed by the RP-UPLC method.The RP-UPLC was performed on a Waters ACQUITY UPLC system , including a quaternary (or binary) pump, sample manager, column component, fluorescence (FLR), and tunable UV or photodiode array detectors. The FLR was detected using excitation wavelength at 280\u2009nm and emission wavelength at 352\u2009nm. UV absorbance at 280\u2009nm (A280) and 220\u2009nm (A220) were also monitored. A BIOshell IgG C4 column  from MilliporeSigma was used at a column temperature maintained at 80\u00b0C.\u00b0C during analysis. V937 samples were injected directly without modifications, unless noted in the context. Chromatograms were processed with Waters Empower 3 software for peak integration. Signals from the FLR channel  were used for all quantification.The linear gradient elution  was formLC/MS experiments were performed on a Waters ACQUITY UPLC coupled with a Waters Xevo G2-XS Q-TOF (Quadrupole Time-of-Flight) mass spectrometer (Waters Corporation). The MilliporeSigma BIOshell IgG C4 column  was also used for LC/MS peak separation. LC/MS was run in a similar fashion as RP-UPLC  with modm/z range of 400\u20133,000. Data acquisition and analysis (deconvolution) were performed with Waters (MassLynx 4.1 software). Protein spectra were deconvoluted to obtain the observed intact protein masses. A uniform Gaussian model was used with width at half height of either 1 or 0.8.Mass spectra were obtained in positive mode by spraying the eluent into the mass spectrometer using an electrospray ionization source. The capillary, source cone, and extraction cone voltages were set at 3\u2009kV, 50\u2009V, and 80\u2009V, respectively. Nitrogen was used as a desolvation gas at a flow rate of 600\u2009L/h. The source and desolvation temperatures were set at 120\u00b0C and 400\u00b0C, respectively. The instrument was operated in Sensitivity mode and spectra were acquired in an 11 At the beginning of the method development, we sought to identify a column of large-pore beads that can accommodate the capsids and allow on-column capsid dissociation to individual VPs from the capsid and separation within the pores of stationary beads. After extensive column screenings, the MilliporeSigma BIOshell IgG C4 column  was selected from a collection of columns, such as Agilent AdvancedBio RP-mAb C4, Waters Protein BEH C4, YMC-Pack PROTEIN-RP, and Tosoh TSKGel Protein C4-300. This column offers better peak shape, resolution, and recovery than other columns that were screened, presumably due to the large pore size  of the column stationary phase that allows the virus capsid enter into the beads, and get disassembled inside the pore into each VPs for separation.The V937 DS virus capsids have a diameter of \u223c30\u2009nm.After initial success of separating VP1, VP2, VP3, and VP4 for V937 DS on an Agilent 1260 HPLC system, the method was optimized on a Waters UPLC system to improve separation efficiency  on the chromatogram, an intermediate process sample containing a mixture of empty and full capsids was generated. A distinct extra peak was detected between VP2 and VP3 in comparison to peaks from purified full capsid   led to t33 Peak resolutions between other VPs pairs were at least two- to four-fold better than the VP2/VP0 peak resolution.The second stage was the focus of UPLC method optimization. The second-stage gradient was arrived by gradually attenuating the gradient slope to achieve better peak resolution (Rs). The peak resolution between VP2 and VP0 was the main focus for method development, because of similar peak retention times due to their highly overlapped amino acid sequence and the FLR VP0/VP2 ratio was later selected to monitor capsid empty/full ratio in process development. The gradient optimization is shown in 11 column temperatures from 70\u00b0C to 85\u00b0C were selected for optimization. In all temperatures tested, good peak resolutions were observed . For the proteins with size ranging in such a narrow window, achieving good resolution using a size-based separation method can be challenging. Exploiting differences in protein hydrophobicity, the RP-UPLC method demonstrated good separation efficiency. Process impurities such as serum or host cell proteins would have different amino acid sequences from VPs. This would result in some hydrophobicity differences that can be explored for RP-UPLC separation. This was demonstrated by BSA protein separation from all VPs on the chromatogram in a capsid sample spiked with BSA  side chain . PreviouCoxsackievirus maturation involves a critical protease cleavage step that converts VP0\u2013VP2 and VP4. All matured full capsids have (VP2+VP4), but not VP0. VP2 and VP4 are absent from empty capsids, where VP0 is presented. The amino acid residues remain the same when VP0 is cleaved into (VP2+VP4). Since the VP UV and FLR peaks represent the amino acid sequence of the protein under the denatured conditions on the RP-UPLC, we can reasonably propose to use VP0/(VP2+VP4) peak ratio to measure capsid empty/full ratio. In the FLR detection channel, since VP4 is a much smaller protein without a tryptophan residue  when compared with a reference standard of known capsid concentration.R2\u2009>\u20090.999) has been observed for each VP and sum of all VPs (Linearity was first established using a V937 virus standard sample with known capsid concentration of 1.39E12 capsids/mL. A linear standard curve was generated using peak areas from the UPLC FLR channel versus the injected particle number. Good linearity (The particle concentration (/mL) of a virus sample can be calculated from Eq. (2):41 In this case, we analyzed our virus sample-A at five dilution levels  within the standard curve range. The capsid number per injection was calculated from total VP peak area by using the slope and intercept obtained from the standard curve (R2\u2009=\u20090.9999) against the dilution factor/corrected injection volume (injection volume/dilution factor), but also good linearity has been observed for each individual VP  calculated from Eq. (2) also showed good consistency across the dilutional levels with relative standard deviation (%RSD) <5% (A research sample (Sample-1) was analyzed on two systems for precision and repeatability, with triplicate injections on UPLC each time. The retention time of each VP in these samples are constant with %RSD <1% . The samAll of our V937 DSs are highly purified full capsids with <1% empty particles. Our standard has \u223c0.25% empty capsids with a capsid concentration of 1.39E12 (capsids/mL). To assess assay accuracy on both capsid concentration and empty/full ratio, a less purified research batch (Sample-B) with higher empty/full ratio was generated. This material has capsid concentration of 3.66E12 (capsids/mL) and 34.3% empty capsid within the sample (Each mixed sample was injected in triplicate on a RP-UPLC. The averaged peak areas of the three injections were used to calculate measured particle concentration and empty/full ratio from a standard curve (One critical application of this RP-UPLC assay is the quantification of empty/full capsid ratio for downstream process monitoring and optimization. In the process monitoring, VP0/VP2 FLR peak ratio is used to measure capsid empty/full ratio in the sample. Purification intermediate samples from three experiments in each of Process-1 and Process-2 were monitored. VP0/VP2 ratios were more than 20% for three experiments using Process-1, indicating undesired high empty content in the intermediates and a less optimal process. After further process optimization, VP0/VP2 was decreased to <4% for all three Process-2 experiments, indicating improved empty capsid clearance (Guided by the structural information of the virus and VPs, we developed a rapid and efficient RP-UPLC assay for characterization and quantitation of oncolytic Coxsackievirus capsids and VPs. Coupled with mass spectrometry, this method not only can identify each individual VPs, but also reveal the characteristic structural features of the VPs, such as the myristoyl adduction on VP0 and VP4. The fact that Coxsackievirus VPs are separated and identified for the first time on the chromatography can open doors for more biochemical and biophysical studies of the virus and its VPs. Reverse-phase chromatography is used for the first time to quantify a viral capsid empty/full ratio, a critical attribute that impacts the quality and clinical dosage of viral vectors and gene therapy products. Success of this structure-guided chromatography method development approach will stimulate the interest of using unique structural features of virus and viral vectors for future assay development.The use of FLR detection offers great sensitivity enhancement versus most current methods that use UV or/and refractive index for detection. In this assay, both virus capsid concentration and capsid empty/full ratio are quantified with good sensitivity, linearity, precision, and accuracy. This quantification strategy can be expanded to other viruses, such as poliovirus, human rhinovirus, and foot-and-mouth disease virus or engineered viral vectors with similar capsid structures."}
+{"text": "PROteolysis TArgeting Chimeras (PROTACs) technology is a new protein-degradation strategy that has emerged in recent years. It uses bifunctional small molecules to induce the ubiquitination and degradation of target proteins through the ubiquitin\u2013proteasome system. PROTACs can not only be used as potential clinical treatments for diseases such as cancer, immune disorders, viral infections, and neurodegenerative diseases, but also provide unique chemical knockdown tools for biological research in a catalytic, reversible, and rapid manner. In 2019, our group published a review article \u201cPROTACs: great opportunities for academia and industry\u201d in the journal, summarizing the representative compounds of PROTACs reported before the end of 2019. In the past 2 years, the entire field of protein degradation has experienced rapid development, including not only a large increase in the number of research papers on protein-degradation technology but also a rapid increase in the number of small-molecule degraders that have entered the clinical and will enter the clinical stage. In addition to PROTAC and molecular glue technology, other new degradation technologies are also developing rapidly. In this article, we mainly summarize and review the representative PROTACs of related targets published in 2020\u20132021 to present to researchers the exciting developments in the field of protein degradation. The problems that need to be solved in this field will also be briefly introduced. This is PROTAC\u2019s first clinical trial data and presents a milestone in the transformation of PROTAC technology into a new treatment strategy. As the first targeted estrogen-receptor-degrading agent to enter clinical trials, ARV-471 is another potential best-in-class drug that may bring hope to breast cancer patients. Besides the AR and ER targeting PROTAC molecules, more and more PROTAC degraders have entered the clinical trial stage in the past 2 years. For instance, the new targets of these PROTAC molecules include BCL-xL, IRAK4, STAT3, BTK, BRD9, MDM2, etc., among which most are the first-in-class targets. In addition to being used as possible clinical treatments, PROTAC is an efficient protein knockdown tool that can directly control protein levels without gene editing operations. It can be used as a useful supplement to existing genetic research tools and provide possible answers to many fundamental biological questions. With the in-depth understanding of the mechanism of PROTAC and its great potential in biological research and disease treatment, more and more researchers have begun to pay attention to this field, and more targets have been proven to be degradable by PROTAC molecules. In 2019, we wrote a review of PROTACs in this journal,6 summarizing that there were about 40 proteins that could be degraded at that time. According to the latest statistics in December 2021, the reported PROTAC targets have reached more than 130  degrader 471 Fig. .3\u20135 The 130 Fig. . The numIn the reported studies, researchers are more inclined to choose kinases as the targets of protein degradation. According to incomplete statistics, about 54 kinases can be degraded by different degraders based on the PROTAC technology, accounting for 45% of the total targets Fig. . The mai7 These kinases have been divided into nine categories based on their structure and function, namely, tyrosine kinases (RTKs), TKL kinases (TKLs), STE kinases (STEs), CAMK kinases (CAMKs), and AGC kinases (AGCs)), CMGC kinase group (CMGCs), atypical protein kinase group , CK1 kinase group, and other groups (others). According to the classification of the human kinase profile, we have marked the kinases that can be degraded as degradable kinases .Androgen receptor (AR) is a member of the nuclear hormone receptor superfamily, which plays a vital role in the maintenance of male secondary sexual characteristics and the development of the prostate. Androgen receptor disorder is the main cause of prostate cancer. Metastatic castration-resistant prostate cancer(mCRPC) remains incurable and lethal. A number of AR antagonists have been developed to treat advanced prostate cancer, such as 1  could effectively induce degradation of AR protein and effectively inhibit the growth of tumors in mice. This study demonstrated the possibility of developing an orally active AR degrader for the treatment of prostate cancer.In 2021, they used CRBN ligand to replace the VHL ligand and obtained the degrader 5  had a significant increase in the degradation activity of AR in LNCaP cells and VCaP cells with the DC50 of 0.1\u2009nM and 0.04\u2009nM, respectively, also it could effectively inhibit cell growth in those cell lines with the IC50 values of 1.5\u2009nM and 16.2\u2009nM, respectively. Moreover, it achieved excellent pharmacokinetics and 51% oral bioavailability in mice.In order to improve its degradation activity, they further optimized and reduced the molecule weight and obtained the degrader 21-SLF that can efficiently bind to DCAF11.21 So they synthesized an AR-targeting degrader 6  could induce the degradation of 90% AR protein at 10\u2009\u03bcM in LNCaP cells. These data indicated that the electrophilic PROTAC  combined with DCAF11 can promote the degradation of AR protein in human cells.In 2021, Cravatt group discovered that DCAF11 can be used as the E3 ligases for protein degradation, and reported the ligand TD-106 as an E3 ligase ligand, a novel CRBN ligand identified in their previous studies.22 Among all the AR degraders, the representative degrader 7  showed good liver microsomal stability and pharmacokinetic properties in vivo.Subsequently, Hwang group reported a new series of AR degraders for the treatment of metastatic castration-resistant prostate cancer. Primarily, they utilized 24 They tested the cell inhibition of these synthetic compounds in AR-positive VCaP cells at different concentrations, and the degrader 8  on AR protein depended on the action of proteasome, and the degradation effect was concentration and time dependent in LNCaP and VCaP cells. Also, it could inhibit the proliferation, migration, and invasion of prostate cancer cells.The degrader 12  induced degradation of AR-V7 and AR-FL were 0.37\u2009\u00b5M and 2\u2009\u00b5M, respectively. The degrader 12 (MTX-23) inhibited the proliferation of prostate cancer cells, and only induced apoptosis in androgen-responsive prostate cancer cells.AR-V7 is an AR variant with a truncated C-terminus. It has been confirmed that AR-V7 expression was induced by ADT and was associated with prostate cancer cell resistance. Recently, Kim group used the PROTAC technology to develop the degrader 13  had the best activity (32% degradation at 20\u2009\u00b5M) on reducing the level of AR protein in LNCaP cells.Also in 2021, Ke group developed the AR degrader 14  had the same affinity for BRAFWT and BRAFV600E. Downregulation of BRAFV600E induced by degrader 18 (P4B) suppressed the MEK/ERK kinase cascade in melanoma cells and impaired cell growth in culture. In addition, the degrader 18 (P4B) displayed effectively BRAFV600D and BRAFG466V mutant cells. These findings highlighted a new approach to modulating the functions of oncogenic BRAF mutants and provided a framework to treat BRAF-dependent human cancers.Similarly, in 2020, Sicheri group developed a series of novel PROTACs targeting BRAF based on different BRAF inhibitors and E3 ligands .19  could induce the degradation of BRAFV600E protein in a variety of cell lines but did not induce the degradation of BRAFWT protein. In SK-MEL-28 cells, the DC50 to BRAFV600E was 6.8\u2009nM and the Dmax exceeded 95%. It could not only induce the degradation of BRAFV600E, but also induce the degradation of a variety of BRAF mutants in a variety of cell lines, including BRAF-p61V600E, BRAFG469A, BRAFG466V, and so on. Subsequently, they tested the inhibitory effect of the degrader 19 (SJF-0628) on tumor cells. They found that in SK-MEL-28 cells (BRAFV600E) the EC50 of the degrader 19 (SJF-0628) was 37\u2009nM. In SK-MEL-239 C4 cells(BRAF-p61V600E), the EC50 was 218\u2009nM. In SK-MEL 246 cells (BRAFG469A), the EC50 was 45\u2009nM.Recently, Crews group developed a VHL-based degrader 42 The expression and activity of eEF2K in some tumor cells can affect the proliferation, migration, invasion, and other physiological processes46 But eEF2K shows different effects in different tumor cells. However, the eEF2K inhibitors have not achieved the expected effect in cancer treatment.eEF2K (eukaryotic elongation factor 2 kinase) is known as Calmodulin-dependent kinase III (CaM kinase III). eEF2K can phosphorylate its only intracellular substrate protein eEF2 and inhibit the peptide-chain extension stage during protein synthesis, and reduce the consumption of amino acids and energy so that the cell can survive under metabolic stress.A484954 and eEF2K protein, and obtained a series of degraders by linking it to different E3 ligase ligands.47 Western blotting experiments determined that the degrader 21 , one of the most aggressive cancers, is closely related to aberrant EGFR signaling.49 Although three generations of small-molecule EGFR inhibitors have been approved by FDA for the treatment of NSCLC patients, drug resistance resulting from continuously heterogeneous mutations (EGFRC797S) remains a problem that inhibitors cannot overcome.50EGFR, a member of the epidermal growth factor receptor (HER) family, is a glycoprotein belonging to tyrosine kinase-type receptor, which contains three regions: extracellular ligand-binding region, transmembrane region, and intracellular kinase region. As ligands, EGF and TGF\u03b1 can activate EGFR to cause dimerization and guide the phosphorylation of downstream proteins, including MAPK, AKT and JNK pathways. Studies have shown that EGFR is overexpressed and abnormally expressed in many solid tumors and is associated with cell proliferation, angiogenesis, tumor invasion and tumor metastasis.Gefitinib and different E3 ligands.51 The degrader 22  cells and H3255 (EGFRL858R) cells, both the degrader 22 (MS39) and degrader 23 (MS154) could efficiently induce the degradation of mutant EGFR proteins, with DC50 of 5.0\u2009nM, 3.3\u2009nM, and 11\u2009nM, 25\u2009nM, respectively. While EGFR could not be degraded in OVCAR8(WT) cells and H1299 (WT) cells, indicating that the degrader 22 (MS39) and degrader 23 (MS154) had selective degradation activity against mutant EGFR. In addition, degrader 22 (MS39) had sufficient in vivo PK properties and was suitable for in vivo efficacy studies.In 2019, Jin group designed a new class of EGFR PTOACs based on Osimertinib and lenalidomide was disclosed by Zhang group in 2020.52 The degrader 24  cells, HCC-827(EGFRDel19) cells, and H1957(EGFRL858R/T790M) cells, with IC50 of 413\u2009nM, 1.34\u2009\u00b5M, and 657\u2009nM, respectively. In addition, apoptosis and G0/G1 phase arrestation of PC9 cells was significantly induced by the degrader 24 unsurprisingly.At the same time, a new class of EGFR PROTACs based on  24 Fig.  could efGefitinib and VHL.53 They found that the degrader 25  cells with the DC50 values of 45.2 nM and 34.8\u2009nM, respectively.54 It was found that the apoptosis and the G1 phase arrestation of HCC-827 cells were significantly induced by the two degraders. In another work, they conjugated a purine-containing derivative which was discovered as a highly potent EGFR-TKI with lenalidomide and VHL ligand to obtained a PROTAC library.55 The most potent degrader 28  cells and H1975 (EGFRL858R/T790M) cells, respectively. The degrader 28 (P3) also showed significant antiproliferative activity on HCC-827 (EGFRe19d) cells and H1975 (EGFRL858R/T790M) cells with IC50 of 0.76\u2009nM and 203\u2009nM. In addition, it also induced cell apoptosis and arrested cell cycle.In 2020, Zhang group published two works on EGFR PROTACs. In the first work, they developed EGFR degraders based on an inhibitor with pyrido pyrimidine moiety, which was a fourth-generation EGFR-TKI that displayed potent inhibitory activity against EGFRL858R/T790M based on a novel selective EGFRL858R/T790M inhibitor XTF-262, which was more than 100 folds selectivity over the wild-type EGFR and a panel of 465 kinases.56 Four E3 ligases  were utilized for design of PROTACs. The promising degrader 29  cells with IC50 of 506\u2009nM.In 2020, Ding group also reported PROTACs targeting EGFR30  is a cap-binding protein that can specifically recognize the cap structure at the 5\u2019-end of mRNA.i4EG-BiP based on the crystal structure and proved that the inhibitor could inhibit the proliferation of cancer cells.61 Then they designed and synthesized a series of eIF4E degraders based on the binding mode of i4EG-BiP and eIF4E.62 Through the degradation activity test, it was found that the degrader 32 , Gaq-ER, and ER-X, which belong to the G-protein-coupled receptor family. They mediate rapid non-genotypic effects and perform indirect transcriptional regulatory functions through the second messenger system. The distribution of these two types of receptors is tissue and cell-specific and they are involved in the regulation of various functions such as reproduction, learning, memory, cognition, and so on.64 Approved endocrine therapies include aromatase inhibitors(AIs) such as Letrozole, selective ER modulators (SERMs) such as Tamoxifen, and selective ER degrader (SERDs) such as Fulvestrant. But the long-term use of SERMs is prone to lead to drug resistance and Fulvestrant is limited by poor solubility and low oral bioavailability.66 The emergence of PROTACs provides a new method for the development of drugs targeting ER\u03b1.It is well-known that the overexpression of estrogen receptor \u03b1(ER\u03b1) may lead to ER-positive breast cancer, which accounts for 70% of breast cancer.34  was the first degrader developed by Arvinas in 2018 and entered clinical studies for ER+/HER2\u2212, locally advanced or metastatic breast cancer. In December 2020, a phase I clinical study was completed and the results showed that the PROTAC 34 (ARV-471) induced degradation of ER potently with encouraging clinical efficacy and tolerability. Another two trials of 34 (ARV-471) were scheduled to start this year. With the advancement of 34 (ARV-471) research, PROTACs could not only provide tools for scientific research but also serve as an important approach for drug development.Since July 2021, Pfizer and Arvinas have been collaborating to advance the study of oral PROTAC 67 The optimized degrader 35  showed strong inhibitory activity, the IC50 values in MCF-7, cY537S, and cD538G cells were 0.8\u2009nM, 10.5\u2009nM, and 6.1\u2009nM, respectively. At the same time, the degrader 36 (ERD-148) could not only induce the degradation of wild-type ER\u03b1 but also showed strong degradation activity against Y537S and D538G mutant ER\u03b1.In 2019, Rae group reported a new ER degrader 69 In stage one, the ER\u03b1 ligands with a hydrazide functional group reacted with E3 ligase ligands with a terminal aldehyde group in DMSO solution to form a more than 100 compounds library. Then the ELISA screening was conducted without further purification. Among them, the degrader A3 was screened out with DC50 of 10\u2009nM and Dmax of 95%. Then they transformed the degrader A3 to a more stable degrader 37  and cell growth inhibition  in MCF-7.In 2020, Tang group developed a two-stage strategy for PROTACs screening.70 They screened 120 billion DNA-encoded molecules and found the best warhead to ER\u03b1, then they conjugated the warhead to many kinds of E3 ligase ligands by click reaction to obtain some novel PROTACs. They found the degrader 38  induced cytotoxicity and G2/M cell cycle arrest in MCF-7 breast cancer and human SKBR3 (ER\u03b1-ER\u03b2-GPER+) breast cancer cells but did not induce proliferation inhibition of MDA-MB-231 breast cancer cells.Salem group reported the degrader 75 However, when FGFR is mutated or overexpressed, it will cause excessive activation of the FGFR signaling pathway and induce normal cell canceration. There are FGFR aberrations in almost all the detected malignant tumors, such as urothelial carcinoma, bile duct carcinoma, breast carcinoma, endometrial carcinoma, squamous carcinoma and so on.78 A number of companies are engaged in the research and development of FGFRs inhibitors. Although 2 FGFR inhibitors have been approved, they are all multi-target inhibitors.80 The FGFR subtype-selective inhibitors are both in the clinical development stage.81FGFR (fibroblast growth factor receptor) belongs to the tyrosine receptor kinase (TRK) family in the human genome, including FGFR1, FGFR2, FGFR3, and FGFR4 subtypes. The signaling pathways mediated by FGFR are required for normal cell growth and differentiation, and they are involved in physiological processes, such as neovascularization, cell proliferation, and migration, regulation of organ development, and wound healing.BGJ398.82 Through binding affinity tests and protein-degradation experiments, it was found that the PROTACs based on BGJ398 could degrade TEL-FGFR2 in Ba/F3 cells, while the full-length FGFR2 was poorly degraded in Kato III cells. Therefore, they used VHL ligands to replace CRBN and found the degrader 41  showed highly selective degradation of FGFR1 and 2, as well as full-length FGFR2 or FGFR2 fusion proteins, despite retaining equivalent biochemical inhibition of all four FGFR isoform proteins. However, the degrader 41 (DGY-09-192) also had some limitations that need to be overcome. For example, the degrader 41 (DGY-09-192) showed no improvement in antiproliferative activity compared to the inhibitor BGJ398 and did not overcome BGJ398-induced point mutations in the FGFR protein.In 2021, Gray group synthesized several glutarimide-based CRBN-targeting degraders with various linkers based on FGFR inhibitor 83 The anti-apoptotic effect of IGF-1R can cause tumor cells to develop resistance to commonly used chemotherapy drugs or radiotherapy drugs. The protein encoded by the Src gene belongs to the Src family of kinases (SFKs), which consists of 9 members, namely Src, Lyn, Fyn, Lck, Hck, Fgr, Blk, Yrk, and Yes. Among them, Src is currently the most known member.84 It is a non-receptor tyrosine kinase, which is related to the survival and drug resistance of cancer cells. At present, studies have shown that the activation of Src is related to the drug resistance of IGF-1R inhibitors. Therefore, the dual inhibitory effect of IGF-1R and Src may be a feasible way to develop new antitumor drugs to overcome drug resistance.85Insulin-like growth factor 1 receptor (IGF-1R) is a membrane receptor tyrosine kinase. Overexpression of IGF-1R plays a key role in the proliferation, transformation, and survival of various cancer cells, such as breast cancer, lung cancer, prostate cancer, and so on.86 The ligands for the targeted protein included IGF-1R/Src dual-target inhibitors. During the screening process, it was found that the degraders 42  pyrimidine-2,4-diamine had IGF-1R/Src dual-target degradation activity. In MCF-7 and A549 cells, the obvious degradation of IGF-1R and Src could be observed at the concentration of 5\u2009\u00b5M. Although the degradation effect was poor, it showed obvious antiproliferative activity on MCF-7 and A549 cells, and the IC50 were 3.3\u2009\u00b5M, 2.7\u2009\u00b5M and 4.2\u2009\u00b5M, 7.6\u2009\u00b5M, respectively.In 2020, Lee group designed a variety of degraders based on different types of IGF-1R inhibitors and CRBN.88 It controls the pathways that regulate cell growth under normal conditions, when KRAS gene is mutated to be permanently activated, normal RAS protein can not be produced which leads to abnormal cell proliferation and cancerization. KRAS is one of the most frequently mutated oncogenes, high-frequency mutations and some low-frequency mutations can activate KRAS.89 KRAS has mutations in a variety of cancers, among which pancreatic cancer has a mutation rate of 90%, colon cancer and lung cancer  have mutation rates of 30\u201350% and 19%, and cholangiocarcinoma accounts for about 26%. Since the KRAS protein does not have a suitable binding pocket for small inhibitors, the development of small inhibitors targeting KRAS has not made a breakthrough for a long time. However, people have been paying attention to the G12C mutation and have developed some covalent inhibitors. There have been many KRASG12C inhibitors were in clinical researches, but the results also showed that some patients have already developed drug resistance.90 PROTACs which had the advantages of overcoming drug resistance and targeting undruggable targets provide a complementary approach to cancer treatment.KRAS is a mouse sarcoma virus oncogene. There are three ras genes related to human cancer: HRAS, KRAS, and NRAS, which are located on chromosomes 11, 12, and 1, respectively. Among them, KRAS has the greatest impact on cancer because it serves as a molecular switch which cycles between an inactive(GDP-bound \u201coff\u201d) state and an active (GTP-bound \u201con\u201d) state.G12C. They designed a large number of KRASG12C degraders based on ARS-1620 derivatives and different E3 ligase ligands.91 They found that degraders 44 -based assay in a high-throughput manner. But it was regrettable that these compounds only induced the degradation of an artificial GFP-KRASG12C fusion protein but not endogenous KARSG12C, which might be due to the inability of the lead degrader to effectively poly-ubiquitinate endogenous KRASG12C. However, the degrader 46 , MiaPaCa2 cells (IC50\u2009=\u20094.14\u2009\u00b5M) and MiaPaCa2(GILA) cells (IC50\u2009=\u20090.51\u2009\u00b5M). Nevertheless, they developed a series of critical assays for in vitro activity evaluation and laid the foundation for the emergence of subsequent KARS PROTACs.In 2020, Gray group also reported the PROTAC targeting KRASG12C degraders based on covalent KRAS inhibitor MRTX849 and VHL ligand.93 A variety of linkers were introduced at N-methyl moiety of the pyrrolidine to generate a PROTAC library. The degrader 47  in a variety of cells and found that it could efficiently induce the degradation of KRASG12C protein in different cells. It also modulated downstream ERK signaling in homozygous and heterozygous KRAS-mutant cell lines.In 2020, Crews group also reported the first-in-class endogenous KRASG12C degraders based on KRas G12C-IN-3 and pomalidomide.94 They found the degrader 48  selectively induced the degradation of KRASG12C through the protein\u2013ubiquitin system, but could not induce the degradation of other KRAS mutants such as G13D. In addition, the degrader 48 (KP-14) exhibited effective antiproliferative activity and inhibited the formation of tumor colonies in NCI-H358 cells.Recently, Chen group designed and synthesized KRASLC-2, Lu group replaced its vinyl moiety to obtain a series of KRASG12C degraders.95 They found that degrader 49  was the first reversible covalent PROTAC that was capable of recruiting VHL-mediated proteasomal to induce the degradation of KRASG12C.Also, based on the structure of MAP kinase kinase or mitogen-activated protein kinase (MEK) is an important signal molecule in Ras\u2013RAF-ME- ERK pathway. MEK1 and MEK2 are two subtypes of the MEK family. MEK1 and MEK2 activate ERK in cell proliferation, apoptosis, cell differentiation and play an important role in tumorigenesis.PD0325901 and VHL. They found that the degrader 50  and 52 (MS934) in HT-29 cells and SK-MEL-28 cells were equivalent to the degrader 50 (MS432), but the CRBN-based degrader 53 (MS910) was significantly weaker than the degrader 50 (MS432).In 2020, they also developed the other MEK degraders based on Refametinib derivative and VHL.98 They found the degrader 54  could degrade GSPT1 and GSPT2 in a variety of cells.Schneider group designed and synthesized a MYC degrader based on the MYC-MAX dimerization inhibitor 104 p38\u03b1 is widely expressed in almost all cell types and attributed the main function in the p38 family. p38\u03b2 expressed at a lower level and may have redundant functions with p38\u03b1. The function of p38\u03b1 is highly dependent on cell type and environment. For example, during tumorigenesis, p38\u03b1 usually plays a tumor-suppressive role in normal epithelial cells, while in malignant cells p38\u03b1 tends to support tumor development.105 However, currently available p38\u03b1 inhibitors have not shown the expected efficacy in clinical trials.p38 mitogen-activated protein kinase (MAPK) family consists of p38\u03b1, p38\u03b2, p38\u03b3, and p38\u03b4.PH-797804 and thalidomide analogs.106 The degraders 56  and 57 (NR-7h) inhibited the p38\u03b1 signaling pathway induced by stress and cytokines, which provided a useful tool to investigate function and influence of the p38 MAPK pathway in diseases.In 2020, Nebreda declared their design and synthesis of a series of novel p38\u03b1/\u03b2 degraders based on an ATP competitive inhibitor of p38\u03b1/\u03b2 107 Subsequently, KRAS is released from PDE\u03b4 by releasing factor Arl2 and transported to the plasma membrane. Several KRAS-PDE\u03b4 inhibitors with potent affinity have been reported, such as Deltarasin, Deltazinone, and Deltasonamide.108 However, Arl2 induces the fast release of high-affinity inhibitors from PDE\u03b4 and finally reduces their antitumor efficacy.109KRAS is recognized as one of the targets of cancer treatment. However, no small-molecule drug targeting KRAS has been approved. PDE \u03b4 is a shuttling factor of RAS which can prevent KRAS binding to the endomembrane and promote its diffusion in the whole cell.Deltasonamide and thalidomide.110 The degrader 58 -mediated gene expression of enzymes involved in lipid metabolism, resulting in elevated levels of cholesterol precursors. It demonstrated that PDE\u03b4 function played a role in the enzymatic regulation of the mevalonate pathway.In 2019, Waldmann group reported the development of degraders based on PDE\u03b4 inhibitor  58 Fig.  could efDeltazinone and pomalidomide.111 The most promising degrader 59  belongs to protein tyrosine phosphatase family.60  could induce the rapid and efficient degradation of SHP2 protein in KYSE520 cells (DC50\u2009=\u20096.0\u2009nM) and MV4; 11 cells (DC50\u2009=\u20092.6\u2009nM), and was capable of reducing SHP2 protein levels by more than 95% in cancer cells. Compared to inhibitor SHP099, the degrader 60 (SHP2-D26) exhibited more than 30-folds of potent inhibition to cell growth in KYSE520 and MV4;11 cancer cell lines.In 2020, Wang group developed a SHP2 degrader 61  successfully induced the moderate degradation of SHP2 in HeLa cells with the Dmax about 40% at 500\u2009nM after 24\u2009h of treatment. At the same years, Zhou group developed another SHP2 degrader 62  effectively induced the degradation of SHP2 protein in a time and dose-dependent manner with a DC50 of 6.02\u2009nM in MV4;11 cells, and induced more than 90% SHP2 degradation at 500\u2009nM after 24\u2009h of treatment. Moreover, it exhibited significant cell proliferation inhibition in MV4;11 cells and induced apparent G1 phase arrest or apoptosis in a dose-dependent manner. Subsequently, another SHP2 degrader 63  exhibited highly selective SHP2 degradation with low concentration, suppressed MAPK signaling, and inhibited cancer cell growth.In 2020, Li group developed a novel SHP2 degrader 118 Thus, AKT is an attractive therapeutic target.The serine/threonine kinase AKT is a central component of the phosphoinositide 3-kinase (PI3K) signaling cascade and a key regulator of critical cellular processes, including proliferation, survival, and metabolism. Hyperactivation of AKT, due to gain-of-function mutations or amplification of oncogenes (receptor tyrosine kinases and PI3K) or inactivation of tumor suppressor genes , is one of the most common molecular perturbations in cancer and promotes malignant phenotypes associated with tumor initiation and progression.64  inhibited AKT1, AKT2, and AKT3 with the IC50 values of 2.0\u2009nM, 6.8\u2009nM, and 3.5\u2009nM, respectively, while the IC50 values of GCD-0068 were 5.0\u2009nM, 18.0\u2009nM, and 8.0\u2009nM, respectively. They found degrader 64 (INY-03-041) could induce the degradation of AKT1/2/3 in a dose-dependent manner and the maximal degradation activity was observed at 100\u2009nM to 250\u2009nM. Also they found degrader 64 (INY-03-041) had good antiproliferative activities in different cell lines, such as ZR-75-1 cells (GR50\u2009=\u200916\u2009nM). Besides, degrader 64 (INY-03-041) destabilized all the three AKT isoforms and reduced the downstream signaling effects even after degrader 64 (INY-03-041) was washed out. It suppressed cell proliferation more potently than GCD-0068, which indicated that it had potential therapeutic value for targeted degradation of AKT.In 2020, Toker group described a degrader GDC-0068, which they coupled with different VHL and pomalidomide ligands to obtain VHL-based AKT degrader 65  and 66 (MS170) showed AKT-degradation activities on BT474 cells with DC50 of 78\u2009nM and 32\u2009nM, respectively. They tested the inhibitory activity of the two degraders on different tumor cell lines, including BT474 cells, PC-3 cells and MDA-MB-468 cells. The results showed 65 (MS98) and 66 (MS170) both had inhibitory activity on these cell lines with GI50 were at the micromolar level. However, the degradation activities and growth inhibitory activities were both weaker than 64 (INY-03-041).In 2021, Jin group also designed the AKT degraders based on the structure of 122 So far, five ALK inhibitors, including Alectinib, Brigatinib, Ceritinib, Crizotinib, and Lorlatinib have been approved by the FDA for the treatment of ALK-positive NSCLC. Despite the initial response to these inhibitors, drug resistance was observed within 1\u20132 years in most patients partly due to acquired ALK-resistant mutations.124 Hence, novel therapeutic strategies are in demand to overcome drug resistance.Anaplastic lymphoma kinase (ALK) is a tyrosine kinase of the insulin receptor (IR) kinase subfamily. Fusion proteins of anaplastic lymphoma kinase (ALK) are emerging therapeutic targets for cancer and other human diseases, especially non-small cell lung cancer (NSCLC) and anaplastic large cell lymphoma(ALCL).125 The degrader 67  potently decreased the levels of ALK fusion proteins in a dose and time-dependent manner. And it specifically inhibited the proliferation of NCI-H2228 cells with IC50 of 4.8\u2009\u00b5M. In comparison with small-molecule PROTACs, the new multi-headed PROTAC promoted the formation of coacervates of POIs/multi-headed PROTAC/E3 ubiquitin ligases, and POI and E3 ubiquitin ligase interacted through multidirectional ligands and a flexible linker, thereby avoiding the need for complicated structure optimization of PROTACs.In 2019, the first multi-headed PROTAC was developed as a gold nanoparticle (GNP)-based drug delivery system for delivering PROTAC to target ALK.Ceritinib and pomalidomide.126 The degrader 68  and could decrease the level of ALK fusion protein in H3122 cells. Meanwhile, 68 (B3) showed better anticancer activity in vitro compared with Ceritinib in different cell lines and the antiproliferative activity to xenograft tumor model was acceptable. All the results demonstrated that the anticancer activities of 68 (B3) in vitro and in vivo were valuable for further investigation.In 2021, Li group also reported a new series of ALK degraders based on B3, Fig.  showed pCeritinib, Alectinib was also widely used in the design of ALK degraders. In 2020 and 2021, Jiang group reported several ALK degraders based on Alectinib and lenalidomide, such as 69  could also induce the degradation of ALKG1202R mutant protein in vitro so it had potential anti-proliferation activity of small cell lung cancer. Then they replaced the VHL ligand with pomalidomide on the basis of 72 (SIAIS117) and obtained the degrader 73  also had a strong inhibitory effect on the migration and invasion of a variety of tumor cells. Also, the kinase inhibition of 73 (SIAIS164018) was different from that of Brigatinib and it rearranged the kinase inhibition of Brigatinib.Also in 2020, Jiang group reported the ALK degrader 131 Inhibition of these BCL-2 family proteins with small molecules has been widely studied as a cancer treatment strategy, resulting in the discovery of ABT-263  and several selective Bcl-xl inhibitors as promising anticancer drug candidates.132 Although these inhibitors are useful for the treatment of certain hematological malignancies, such as CLL and AML, the on-target and dose-limiting thrombocytopenia induced by Bcl-xl inhibition has limited the clinical use of these inhibitors.133 Bcl-xl is mainly overexpressed in many solid tumor cells and leukemia cells, and its expression is highly correlated with resistance to cancer therapy. As one of the most important validated cancer targets without a safe and effective therapeutic, Bcl-xl needs more selective methods to inhibit its activity. E3 ligases are differentially expressed in tumor cells compared with normal tissues. Thus, a method that relies on PROTAC to induce protein degradation seems to perfectly overcome this problem.In the BCL-2 family, overexpression of anti-apoptotic proteins including BCL-2, Bcl-xl, and myeloid cell 1 is a key sign of cancer partly evading apoptosis. B-cell lymphoma extra large (Bcl-xl) is a well-validated cancer target.74  cells. Since VHL was poorly expressed in platelets, degrader 74 (DT2216) was more potent against various Bcl-xl-dependent leukemia and cancer cells but considerably less toxic to platelets than ABT-263 in vitro. In vivo, degrader 74 (DT2216), as a single drug or in combination with other chemotherapeutic drugs, can effectively inhibit the growth of several xenograft tumors without causing significant thrombocytopenia. These findings suggested that degrader 74 (DT2216) had greater clinical potential than ABT-263 or other Bcl-xl inhibitors.Zhou and Zheng group has been devoted to the development of high-efficiency Bcl-xl degraders. They used different Bcl-xl inhibitors and E3 ligands to design and synthesize a large number of different Bcl-xl degraders, and obtained some Bcl-xl degraders with good degradation activity. In 2019, Zhou and Zheng group reported the first selective Bcl-xl degrader DT2216 to obtain a series of degraders.135 In the degradation activity test, they found that the degrader 75  when the DC50 and Dmax were 46\u2009nM and 96.2%, respectively. More importantly, it could effectively clear senescent cells and rejuvenate tissue stem and progenitor cells in naturally aged mice without causing severe thrombocytopenia. With further improvements, Bcl-xl PROTACs have the potential to become a safer and more effective treatment than Bcl-xl inhibitors.Subsequently, they still used DT2216 and Bcl-xl protein, they connected the VHL ligand with ABT-263 from the methyl group of dimethylcyclohexene in ABT-263138 and finally found that the chiral compound 78  selectively induced Bcl-xl protein degradation in a dose and time-dependent manner in MOLT-4 cells but not in platelets. The DC50 was 50\u2009nM and the IC50 was 51\u2009nM. Subsequently, they confirmed that the platelet-toxic Bcl-xl/2 dual inhibitor ABT-263 can be converted into platelet-sparing pomalidomide-based Bcl-xl specific PROTAC without reduction in activity or selectivity.In the same year, they also developed a pomalidomide-based degrader 80 :PROTAC:Bcl-xl revealed the interaction between E3 ligase and target protein and PROTAC. The mode of action between the homologous part and the partner protein provided ideas for the subsequent design of protein\u2013protein interaction inhibitors and degraders.In addition to Zhou and Zheng group, Benowitz group also reported a degrader 80 Fig.  based onDT2216 and the binding mode of ABT-263 in Bcl-xl, which was linked the VHL to the methyl group of dimethylcyclohexene in ABT-263.141 They found 81 , but also degrade BCL-2 (DC50\u2009=\u200948\u2009nM) in 293T cells. It was the first dual-targeted degrader for Bcl-xl/BCL-2. In addition, they also found 81 (753b) exhibited more potent antitumor activity than DT2216 in Kasumi-1 cells, which was also superior to that of ABT-263.Then, Zhou and Zheng group obtained a series of degraders based on Through the comparative analysis of the degradation activity and inhibitory activity of these degraders, it was found that the degradation activities of the degraders were better, the inhibitory activities were better in most cells. But in some special cell lines, such as 293T and THP-1 cells, it was also reported that the degradation activities had no obvious influences with the inhibitory activities. The main reason may be that some cells were not sensitive to the changes of Bcl-xl protein.ABT-263 and A-1155463. In the selection of E3 ligases, CRBN and VHL were currently used, and other E3 ligases were not used in Bcl-xl degrades. Therefore, more Bcl-xl degraders based on different Bcl-xl inhibitors need to be developed.Finally, we compared the reported Bcl-xl degraders Table . It was c-ABL kinase domain in the oncogenic fusion protein BCR-ABL.142 When the ABL gene is translocated from chromosome 9 to the BCR gene on chromosome 22, BCR-ABL is generated. BCR-ABL activates downstream signaling pathways to cause CML cell proliferation disorder in patients.143 At present, three generations of BCR-ABL inhibitors have been approved for the clinical treatment of CML. As the first-generation ABL inhibitor, Imatinib becomes the paradigm for targeted cancer therapy. But the intolerance and drug resistance of Imatinib, especially for T315I, limits its clinical application. The second-generation  and third-generation (Ponatinib) ABL inhibitors provide multiple options for resistance patients. According to the difference between the inhibitors and the protein binding sites, ABL inhibitors also can be divided into five categories (type I\u2013V), among which type I (such as Dasatinib), type II (Imatinib and Ponatinib), and type IV (Asciminib) have been paied more attention. However, these inhibitors could not inhibit all resistant mutants; severe side effects also limit their clinical application.145 Therefore, it seems that the degradation of BCR-ABL may overcome these problems.Chronic myelogenous leukemia(CML) is most often caused by the lack of autoinhibition of the Dasatinib, but it only achieved the degradation of BCR-ABL at micromoles (>60% at 1\u2009\u00b5M), but could not overcome the common drug-resistant mutants, especially for T315I mutant.146 In 2019, Crews group designed and synthesized a series of VHL-based BCR-ABL degraders by using the allosteric GNF family compounds of BCR-ABL.147 They optimized the linker portion of the degraders to improve both potency and cell permeability, obtaining the lead degrader 82  demonstrated more than ten-folds increase in ability to induce BCL-ABL degradation, and improved pharmacokinetic properties and in vivo activity.In 2016, Crews group reported the first BCR-ABL PROTAC based on 149 These BCL-ABL degraders were designed and synthesized using four BCR-ABL inhibitors Imatinib, Dasatinib, Asciminib, and Ponatinib as target molecules. In this toolbox for inducing degradation of BCR-ABL from different binding pockets, the degraders designed on the other three BCR-ABL inhibitors all worked obviously well except the Imatinib-based degraders. Among them, three representative degraders, 84  could efficiently induce the degradation of wild-type and mutated BCR-ABL  in transfected HeLa cells without causing serious side effects. And it also exhibited better antiproliferative activity against T315I mutant BaF3 cell line, with EC50 of 28.5\u2009nM. Through the above studies, it could found that PROTACs designed based on the type I inhibitor Dasatinib, the type II inhibitor Bonatinib and the type IV inhibitor Asciminib can successfully induce the degradation of the BCR-ABL protein. The degradation activities of PROTACs designed based on Dasatinib were significantly better than that of other PROTACs, while the PROTACs designed based on type II inhibitor Imatinib could not induce the degradation of BCR-ABL protein under the concentration of 30\u2009\u00b5M. It indicated that the degraders based on type II inhibitors can be designed to induce the degradation of BCR-ABL protein, but it requires more careful consideration that the design of degraders based on Imatinib to induce the degradation of BCR-ABL. In summary, these PROTACs showed better selectivity and fewer adverse reactions than inhibitors, which indicated that PROTACs have great potential in overcoming the clinical resistance and safety issues of BCR-ABL.In 2021, Rao group developed some BCR-ABL degraders targeting all the three binding sites of BCR-ABL.T315I degraders based on a BCR-ABLT315I inhibitor GZD824.150 The degrader 87  induced the effective degradation of wild-type BCR-ABL with the DC50 value of 8.1\u2009nM in K562 cells, and several clinically relevant resistance-conferring mutations. Moreover, it achieved significant growth inhibition of the BCR-ABL+ leukemic cells in vitro, and induced substantial tumor regression in vivo against K562 xenograft tumors. Subsequently, Jiang group synthesized a series of CRBN-based degraders by conjugating Dasatinib to pomalidomide or lenalidomide.152 As an important example, a pomalidomide-based degrader 89 , with favorable pharmacokinetics, induced significant tumor regression against K562 xenograft tumors in vivo. In addition, they reported a highly efficient protocol to construct a new IMiD-based azide library through click reaction. The degraders 90  is a cytoplasmic non-receptor protein tyrosine kinase, which is a member of the focal adhesion complex family.158 The patent showed that they designed a large number of FAK degraders based on FAK inhibitor VS-4718 and different E3 ligase ligands. In the subsequent activity screening, they found that most of the compounds have good FAK-degradation activity. Among them, the degrader 94  which possessed a short and rigid linker generated a highly cooperative ternary complex by SPR and X-ray crystallography data. It induced the degradation of FAK with DC50 of 1.3\u2009nM in A549 cells and induced cell proliferation inhibition in A549, MCF-7 cells rather than BT474 cells. The levels of other proteins would also be affected when the concentration was increased to 100\u2009nM, such as CDK7, RPS6KA3, MET, and GAK. In addition, the degrader 95 (GSK-215) induced fast, effective, and durable FAK degradation in vivo in mouse liver.Recently, GSK has also developed a new type of potent and selective degrader 160 MDM2 is one of the key inhibitors of p53. It is highly expressed in a variety of tumors and plays an important role in the occurrence and development of tumors. Overexpression of MDM2 can downregulate the expression of p53, and inhibiting or degrading the MDM2 protein can block the MDM2\u2013p53 interaction and upregulate the expression of p53, thereby exerting antitumor activity.161 Therefore, the development of antitumor drugs targeting MDM2\u2013p53 has become one of the important methods to treat tumors. Although several MDM2\u2013p53 inhibitors have entered clinical trials, no drugs have been approved for clinical use.p53 is an important tumor suppressor which can promote the apoptosis of cancer cells and prevent the development of tumors. Nearly 50% of human cancers are related to the abnormal activity of p53. The interaction between p53 and MDM2 is the main factor affecting the biological activity of p53.MD-224. Based on the structure of MD-224, they designed and synthesized other MD-224 analogs in 2019. They found that the degrader 96  only induced moderate degradation of MDM2, but had very good degradation activity of GSPT1 with DC50 of 1.3\u2009nM. It could not activate wild-type p53, but it had good antiproliferative activity in a variety of cells. For example, in RS4;11 and HL-60 cells, its IC50 were 3.5\u2009nM and 8.3\u2009nM, respectively. Subsequently, they also tested the antiproliferative activity of the degrader 96 (MG-277) in MDA-MB-231 siMDM2 and MDA-MB-468 siMDM2 cell lines, which IC50 were 19.3\u2009nM and 19.8\u2009nM, respectively, indicating that the degrader 96 (MG-277) exerted antiproliferative activity not only through the MDM2-p53 pathway, but also played a related physiological role through the degradation of GSPT1.In 2018, Wang group reported the potent MDM2 degrader 163 During the screening process, they found that the degrader 97  induced the significant degradation of MDM2 and promoted the expression of P21 and PUMA proteins thereby inhibiting the proliferation of tumor cells and promoting the apoptosis of A549 cells. This was the first research on MDM2 degraders designed based on natural products, which provided ideas for the development of MDM2 degraders.In 2021, Wang group designed and synthesized a series of degraders based on ursolic acid(UA) and pomalidomide.1B, Fig.  had sign164 After extensive optimization based on antiproliferative activity and MDM2-degradation activity, the degrader 98  also induced the degradation of p53 with DC50 of 29\u2009nM. Further studies have shown that it was a molecular glue that induced the degradation of MDM2. At the same time, it could effectively induce the degradation of GSPT1 and showed strong proliferation inhibitory activity on cells. In RS4;11 cells, its inhibitory activity IC50 was 1.2\u2009nM.In 2021, Tang group reported a series of MDM2 ligands which were designed and synthesized based on the four-component Ugi reaction, and then synthesized MDM2 degraders based on these ligands.Nutlin-3 derivatives targeted degradation of MDM2.165 Since MDM2 was an E3 ligase, when MDM2 inhibitors were used as ligands, they could not only target MDM2, but also could combine with E3 ligase. The results showed that the degrader 99  was a compound with chiral centers, they purified enantiomer 100 . It was found enantiomer 100 (11a-1) showed strong antitumor activity in vivo in the A549 xenograft nude mouse model.Also in 2021, Sheng group reported the homo-PROTAC designed based on MDM2 inhibitor 166 FLT3 is expressed in most AML patients and exists 30% mutations. The mutations of FLT3 mainly include internal tandem duplication alteration(FLT3-ITD) and point mutations in the tyrosine kinase domain, accounting for 25% and 5%, respectively. Mutation or high expression of FLT3 may cause the continuous activation of the protein, leading to acute myeloid leukemia and acute lymphocytic leukemia.167 There are currently eight drugs that can act on FLT3 have been approved, but these drugs have poor selectivity and can cause gastrointestinal intolerance, long-term cytopenias, hand-foot syndrome and other side effects.168 In addition, the single drug has limited efficacy in AML patients with FLT3 mutations. So it is particularly important to use new technologies to develop treatment targeting FLT3 and mutations.FMS-like tyrosine kinase 3 (FLT3) is a type III receptor tyrosine kinase that regulates hematopoiesis. It is expressed on the surface of many hematopoietic cells and is essential for the normal development of hematopoietic stem cells and hematopoietic cells. After FLT3 binds to ligands, it will dimerize or autophosphorylate and activate JAK-STAT, PI3K, and MAPK signaling pathways, which can promote tumor cell proliferation and differentiation or inhibit tumor cell apoptosis.Dovitinib and FLT3.169 After screening in vitro antiproliferative activity, it was found that the degrader 101  could induce the degradation of FLT3 in BaF3-FLT3-ITD cells with DC50 of 76.7\u2009nM.Also in 2021, Chen group also reported the FLT3 degrader 171 Given the importance of the JAK-STAT pathway, blocking the function of JAK can silence the entire pathway, which has important implications for scientific research and disease treatment. Although several JAK kinase inhibitors have entered clinical research, they are usually difficult to achieve selectivity due to the high homology of JAK family proteins.172 Therefore, the rise of PROTACs technology provides a new strategy for the study of JAK proteins.Janus kinase (JAK) is a family of non-receptor tyrosine kinases, including JAK1, JAK2, JAK3, and Tyk2. Signal and activator of transcription (STAT), the substrate of JAK, dimerizes after being phosphorylated by JAK and then crosses the nuclear membrane into the nucleus to regulate the expression of related genes. JAK-STAT pathway is a major signal transduction mechanism of various cytokines and growth factors and has been implicated in a multitude of diseases from cancer to inflammatory diseases.173 They then tested the degradation activities of these degraders to endogenous JAK1 and JAK2 in THP-1 cells through automated western blotting. They found that the degraders 104\u2013109  is a member of the STAT family of transcription factors that replicates and transmits signals from cell surface receptors to the nucleus.114  in the cell culture media rapidly, with nearly 50% of conversion observed at 2 h and 90% of conversion at 24\u2009h. However, the degrader 114 (SD-91) exhibited excellent stability in the cell culture media and the in vivo dosing vehicle. The degrader 114 (SD-91) bound to STAT3 protein with a high affinity, and was more potent than SD-36 in inducing degradation of STAT3 in SU-DHL-1 and MOLM-16 lymphoma cells. A single administration of the degrader 114 (SD-91) could selectively and continuously reduce STAT3 in tumor tissues. Moreover, the degrader 114 (SD-91) achieved complete and long-lasting tumor regression in the MOLM-16 xenograft model in mice even with weekly administration. The degrader 114 (SD-91) represented a promising STAT3 degrader for the treatment of human cancers and other diseases related to STAT3 overactivation.In 2021, Wang group developed a new STAT3 degrader 179 More than 80% of cancer patients have inactivating mutations of APC or activating mutations of CTNNB1, leading to the messenger molecule \u03b2-catenin protein continuing to accumulate in cells, which eventually leads to the excessive activation of Wnt/\u03b2-catenin signal and the proliferation of cancer cells.180 As \u03b2-catenin is the central player of the canonical Wnt/\u03b2-catenin signaling and is frequently mutated in cancers, it is the most attractive target for cancer therapy.181 However, \u03b2-catenin has no enzymatic activity and small-molecule binding pockets, and has a large interaction interface with other proteins. Therefore, it is difficult for such small molecule inhibitors to completely inhibit the function of \u03b2-catenin.182 Thus, inducing the degradation of \u03b2-catenin is an ideal method for treating Wnt/\u03b2-catenin signal-related diseases.Among many signal pathways, the aberrant activation of Wnt/\u03b2-catenin signal is the most important for the occurrence and development of various cancer.xStAx was reported to impair Wnt/\u03b2-catenin signaling.183 Recently, \u03b2-catenin-targeting degrader 115  could effectively restrain tumor formation in BALB/C nude mice and potently inhibit the survival of colorectal cancer patient-derived organoids. In the future, it would be worthwhile to develop a \u03b2-catenin-targeting degrader with good pharmacodynamics for clinical therapies.Based on the Axin-derived peptide that binds to \u03b2-catenin, a stapled peptides 185 FOXM1 (forkhead box protein M1) is one of the key genes controlling cell proliferation and its abnormal activation is closely related to the proliferation and division of cancer cells. It is generally upregulated in laryngeal cancer, gastric cancer, ovarian cancer, etc.188 And tumor gene expression profiling analysis also confirmed that FOXM1 is one of the most frequently upregulated genes in human malignant tumors,189 so it has become an important target for drug development.The forkhead box superfamily is a class of transcription factors with a specific \u201cwinged helix structure\u201d DNA binding domain, including several families such as FOXA, FOXC, FOXM, FOXO, and FOXP.116  are divided into two categories: \u03b1 subtype and \u03b2 subtype. \u03b1 adrenergic receptor is a type of G-protein-coupled receptor, mainly including \u03b11A-AR degrader 117  was better than that of Prazosin (IC50\u2009=\u200911.72\u2009\u00b5M) in PC-3 cells. At last, they found compound 117 resulted in an inhibition in tumor growth when they conducted an in vivo study to examine its influence.In 2020, Li group developed the \u03b1117 Fig.  based on202 Most of them play important role in transcriptional regulation and chromatin remodeling and have been widely studied as a key target for the treatment of cancer.Lysine acetylation in histone tails has been associated with epigenetic. Bromodomian are highly conserved module which recognize acetylated lysine, it has been shown that 46 proteins contain 61 unique bromodomian so far.208 most of them showed good tumor suppression and partial compounds enter clinical studies successfully. Since the first degrader dBET1 was reported by Brander group in 2015,2 a number of PROTACs targeting BET proteins have been developed. However, due to the high homology of BET proteins, it is still difficult to achieve the selectivity of BET protein subtypes.The bromo and extral terminal domain family (BET) proteins, which include BRD2, BRD3, BRD4 and testis-specific BRDT, are the most widely studied class of bromodomain-containing proteins. In recent years, a large number of inhibitors targeting BET proteins have been reported,118  induced efficient and fast degradation in human acute leukemia cells tested in vitro and vivo, such as MV4-11, MOLM-13, and KG1. It exhibited potent anti-proliferation in these cells and more effectively suppresses c-Myc levels than inhibitor BI2536. Meanwhile, the degrader 118 (HBL-4) induced dramatically improved efficacy in the MV4-11 tumor xenograft model compared with BI2536, which may be a potential therapy for the treatment of acute leukemia and other types of tumors.Since Polo-like kinase 1(PLK1) and bromodomain 4(BRD4) are both attractive therapeutic targets in acute myeloid leukemia (AML), Lu group developed BRD4 and PLK1 degrader MZ1. Macrocyclization could restrict the molecule in its bioactive conformation to reduce the energetic penalty, which has been widely used as a strategy to develop drug selectivity. They synthesized the degrader 119 -BRD4 BD2.210 Compared with MZ1, the degrader 119 (MacPROTAC-1) showed similar degradation activity and inhibition of cell proliferation in BET-sensitive human prostate carcinoma 22RV1 cells, although the binding affinity to BRD4 decreased.In 2019, Ciulli group introduced macrocyclization into PROTACs based on the structure of reported BET degrader 120  intramolecularly engaged BD2 and BD1 to form a 1:1:1 ternary complex with VHL and BRD4 with prolonged residence time. Although the molecular weight of the trivalent degrader had increased, the degrader 121 (SM1) exhibited better cell permeability and the remarkably favorable PK profile.Recently, Ciulli group designed trivalent PROTACs consisting of a bivalent BET inhibitor and an E3 ligand tethered via a branched linker.JQ1, more and more BET inhibitors have been used in the design and synthesis of PROTACs. In 2019, Zhang group developed a new class of degrader based on a potent dihydroquinazolinone-based BRD4 inhibitor.213 Among them, the best degrader 122  was improved about seven-folds compared with ABBV-075. In 2021, the sulfonyl group of ABBV-075 was removed to connect with E3 by Yu group and led to the discovery of the degrader 124  group into the glutarimide nitrogen to generate the BRD4 degrader 127  group into N2, Fig. , which w127 Fig. , which i128 Fig.  could in129  was the most potent degrader with DC50 of 10.84\u2009\u03bcM and Dmax of 98% in SU-DHL-4 cells. Recently, Jin group synthesized the degrader 131 -JQ1.222 Interestingly, the degrader effectively induced the degradation of BRD4 and BRD3 protein levels, but did not have an influence on BRD2 protein and selectively induced the degradation of BRD4 short isoform over long isoform in MDA-MB-231 cells. The CRBN-based PROTACs are known to be inherently unstable, readily undergoing hydrolysis in body fluids, which significantly affects their cell efficacy. Recently, Rankovic group developed novel CRBN binders, phenyl glutarimide (PG) analogs, which retained high affinity for CRBN and displayed improved chemical stability.223 Based on this novel ligand, their group synthesized a novel BRD4 degrader 132  exhibited the most potent degradation efficacy with DC50 of 0.87\u2009nM in MV4-11 cells.It is well-known that more than 600 E3 ubiquitin ligases are encoded by the human genome, only a handful of E3 ligases could be used by PROTACs technology. BRD4 is a commonly used target for screening new E3 ligases for PROTACs. In 2019, Cravatt group has validated that the E3 ligase subunit DCAF16 supported targeted protein degradation by synthesizing degrader BD1L94V PROTAC based on a \u201cbump-and-hole\u201d approach.224 By using cells stably expressing the BRD4BD1L94V degron fused to EGFP systems, the corresponding degrader 133  displayed acceptable pharmacokinetics profiles, which made it suitable candidates for future in vivo studies. In recently, Ciulli group also developed a novel VHL-based degrader 134  not only formed a strong, cooperative ternary complex between VHL and the BromoTag-BRD2 but also completely induced the degradation of BromoTagged target proteins with low nanomolar potency. The degrader 134 (AGB1) exhibited exquisite selectivity over the native wild-type BET, which led it not cytotoxic in several cancer relevant cell lines. In summary, these two distinct methods provided a useful tool to study the effect and implications of rapid and highly selective degradation of a target protein.In 2021, Fischer group developed a series of novel CRBN-based BRD4135  could effectively induce the degradation of BRD4 and the Dmax was more than 99% in AR-positive prostate cancer cells. It had no degradation activity against other BRD subtype proteins. The degrader 137 (WWL0245) also showed good antiproliferative activity in BETi-sensitive cancer cells (including AR-positive prostate cancer cells) with an IC50 of 3\u2009nM in MV4-11 cells.Also in 2021, Jiang group reported the efficient construction of an IMiD-based azide compound library and applied this method to the development of BET protein degraders. The BET protein degraders JQ1 was used more frequently and others were used less. In the selection of E3 ligases, most of the currently used were CRBN and VHL, and some new E3 ligases have been mentioned in reports, such as DCAF15, DCAF16, etc. These cases were all in the development of new E3 ligases reportes. Therefore, more BRD degraders based on different BRD inhibitors need to be developed.Finally, we compared the reported BRD degraders Table . It was 227 However, inhibiting a single domain alone cannot completely eliminate the p300/CBP activity in the cell. Thus, it is necessary to inhibit multiple functional domains at the same time, or even completely deplete the protein to ablate the p300/CBP-mediated enhancer activity.228The paralogous chromatin regulators CREB-binding protein (CBP) and p300  maintain gene expression programs through chromatin lysine acetylation and transcription regulation, as well as the scaffold function mediated by multiple protein\u2013protein interaction domains. Several potency, selectivity, and drug-like properties of small-molecule inhibitors targeting these domains have been developed, which provided unique tools for exploring various p300/CBP functions of enhancers.138  induced the highly potent, selective, and rapid dual degradation of CBP and p300, which highlighted the capability of applying PROTAC technology to exceptionally large proteins(>300\u2009kDa). The degrader 138 (dCBP-1) had potent antiproliferative activity in multiple myeloma cells. Compared with the treatment of bromodomain and KAT domain inhibitors alone or in combination, it had enhanced effects on MYC gene expression programs, anti-proliferation, and chromatin structure in multiple myeloma. As an effective degrader of this unique acetyltransferase, degrader 138 (dCBP-1) was a useful tool to analyze the mechanisms of these factors coordinate enhancer activity in normal and cancer cells.In 2021, Ott group described the first CRBN-based p300/CBP degrader 230 Among them, ENL protein is essential for the development of acute myeloid leukemia(AML).231 When ENL is knocked out, it would induce anti-leukemia effect and inhibit the growth of leukemia in vivo and in vitro.The YEATS domain is a new type of histone acetylation \u201creader\u201d. The human genome encodes four YEATS domain-containing proteins, namely ENL, AF9, YEATS2, and GAS41.SR-0813 based on high-throughput screening technology. On the basis of SR-0813, they designed and synthesized a degrader 139  could induce degradation of ENL protein in a variety of cell lines, and it had the best activity in the MV4-11 cells with DC50 of 150\u2009nM.In 2021, Erb group discovered the highly effective ENL YEATS domain inhibitor 235 Class I HDAC is mainly located in the nucleus, and HDAC3 is also present in the cytoplasm. Class II can respond to different cell signal responses and shuttle between the nucleus and the cytoplasm. Class III is a completely different type as the atypical histone deacetylase family of other HDACs.237 Type IV is mainly located in the nucleus.Histone deacetylases (HDACs) which serve as \u201cepigenetic erasers\u201d play an important role in chromosome structural modification and gene expression regulation by catalyzing deacetylation of substrate proteins. They make histones bind tightly to negatively charged DNA by deacetylating them, which densify chromatin and inhibit gene transcription. Until now, 18 human HDACs have been identified and classified into four classes: Class I , class II , class III  and class IV (HDAC11).238 they linked pomalidomide to the benzene ring of NexA unlike NP8, which led to the discovery of HDAC6 degrader 140  exhibited comparably excellent degradation activity in MM.1S cells with the DC50 of 3.2\u2009nM. The two degraders extended from different directions of the inhibitor exerted the same degradation activity revealed the extremely large flexibility of the ternary complex.HDAC6, the only protein in the HDACs family that has two tandem domains, is mainly distributed in the cytoplasm. HADC6 deacetylates \u03b1-tubulin, HSP90, cortactin and interacts with many proteins such as dynein, ubiquitin, which make it participate in cancer progression, neurodegenerative diseases, and inflammatory disorders. Rao group has been working on developing PROTACs targeting HDAC6 since 2019,240 Among them, the degrader 141  was 1.94 nM in MM.1S cells. At the same time, it was found that the degrader 143  E3 ubiquitin ligase.244 However, effective degradation of HDAC1/6/8 could be observed in RPMI-8226 cells. What interesting was that the degradation effect of the degrader was not obvious when the cells were treated for 6 hours. However, the degradation effect on the three subtypes of HDAC was significantly enhanced when the treatment time was extended to 24 hours. The degrader 146 . Since tumor cells have a high demand for large amounts of NAD+, inhibiting NAMPT expression can significantly inhibit tumor cell proliferation. It has been confirmed that NAMPT is highly expressed in various malignant tumors such as breast cancer, prostate cancer, gastric cancer, thyroid cancer, colon cancer and hematological tumors.251 Therefore, NAMPT is considered as a drug target for antitumor therapy.252Nicotinamide phosphoribosyltransferase (NAMPT) is a cytokine that promotes B-cell maturation and inhibits neutrophil apoptosis.MS7 and NAAMPT, a series of PROTAC molecules were obtained by connecting MS7 with VHL ligands.253 Then it was found that 149  through the ubiquitin\u2013proteasome system, thereby in turn decreases the secretion of extracellular NAMPT (eNAMPT). At the same time, they also found that the inhibitor MS7 did not have the function of inhibiting tumor-infiltrating MDSCs, and the degrader could boost antitumor efficacy through this effect, so the degrader 149 (A7) exhibited stronger antiproliferative activity than the inhibitor MS7.Based on the binding mode of inhibitor A7, Fig.  was an e254 NSD is a nuclear receptor-binding SET domain protein (NSD) family, including three members of NSD1, NSD2  and NSD3 . NSD3 is a Lysine methyltransferase at position 36 of histone H3(H3K36), catalyzes the dimethylation of H3K36.255 NSD methyltransferases are mutated, amplified, and overexpressed in a variety of human cancers, including multiple myeloma, acute myeloid leukemia, acute lymphoblastic leukemia, breast cancer, prostate cancer, and lung cancer.256 Therefore, NSD is considered as a potential target for the development of novel anticancer drugs.Histone lysine methyltransferase catalyzes the transfer of methyl groups to specific lysine side chains at the ends of histones H3 and H4 to form histone methylation marks, thereby affecting gene transcription, DNA replication, and DNA repair. It plays an important role in maintaining chromatin stability and gene expression regulation. Representative lysine methylases include PRDM6, G9a, EZH2, DOT1L, NSD, and SUV420H1.BI-9321 is a reported NSD3 PWWP1 antagonist. By analyzing its binding mode with NSD3 protein, Wang group obtained a series of PROTAC molecules by connecting BI-9321 with different E3 ligase ligands and then screened the degradation activities of NSD3.257 They found that 150  was highly selective and had no degradation activity on other proteins. In addition, 150 (MS9715) could effectively inhibit the expression of NSD3 and cMyc-related genes, while the corresponding inhibitor BI-9321 did not have this function.258 It catalyzes methylation of H3K27. The trimethylation of H3K27 (H3K27me3) is a transcriptionally repressive epigenetic mark that regulates gene expression, and hyper-trimethylation of H3K27 can be observed in several types of tumors. EZH2 is the catalyst subunit of PRC2 and mutation will be happened in several cancers, such as DLBCL.259EPZ6438 is a selective EZH2 inhibitor approved for epithelioid sarcoma.260 In fact, EZH2 also mediates transcriptional activation independent of EZH2/PRC2 catalytic activity in some cancers.The polycomb repressive complex 2 (PRC2) is an epigenetic modulator of transcription, which is mainly constituted of four subunits: EZH1/2 (enhancer of the zeste homolog 1/2), EED (embryonic ectoderm development), SUZ12(suppressor of the zeste 12 protein homolog), and RbAp46/RbAp48 (retinoblastoma (Rb)-associated proteins 46/48).151  and EZH2 (DC50\u2009=\u20090.3\u2009\u00b5M) on HeLa cells.262 In summary, these data demonstrated that the degradation of the subunit of the PRC2 complex could cause the complex to lose its function, which was expected to be a method for PRC2-mediated cancer treatment.In 2019, Bloeche group reported an EED degrader 151 Fig.  by conju263 The degrader 153  showed significant inhibition on cell growth and induced cell death in TNBC cells in vitro and in vivo.In 2020, Jin group utilized a hydrophobic tag to link an EZH2 inhibitor to generate the degrader targeting EZH2.EPZ6438 and pomalidomide, Yu group developed the degrader 154  also displayed stronger anticancer abilities than EPZ6438 in WSU-DLCL-2 cells and SWI/SNF-mutant cancer cells.Based on a clinical EZH2 inhibitor E7, Fig.  which in155 .269The PRMT family is a group of enzymes that can modify the nitrogen atom of the arginine guanidine group with monomethyl and dimethyl groups. Nine members have been found in mammals. According to the different methylation products, PRMTs can be divided into type I and type II. Both type I and type II enzymes can catalyze the production of monomethylated modification. The difference is that type I can further catalyze the production of asymmetric dimethylarginine (aDMA), while type II catalyzes the formation of symmetric dimethylarginine (sDMA). PRMT5 is the first type II methyltransferase to be isolated as a JAK2 binding protein.156  induced the efficient degradation of PRMT5 in MCF-7 cells with the DC50 and Dmax value of 1.1\u2009\u00b5M and 74%, respectively. The antiproliferative activity of the degrader 156 (MS4322) (IC50\u2009=\u200918\u2009nM) was better than EPZ015666 (IC50\u2009=\u200930\u2009nM) in MV4-11 cells. Moreover, it was highly selective for PRMT5 by proteomic study and exhibited good plasma exposure in mice. So the degrader 156 (MS4322) was a valuable chemical tool for exploring the PRMT5 functions in disease.In 2020, Jin group developed a degrader 271 There are seven recognized members in the human sirtuin family: SIRT1-SIRT7, all of which have highly conserved NAD binding domains and catalytic functional domains. The sirtuin protein family can regulate the acetylation modification and ADP ribosyl modification of a variety of proteins. SIRT2 is mainly distributed in the cytoplasm and is particularly important for the growth and metabolism of tumor cells, which makes SIRT2 an attractive target for cancer treatment.272Sirtuins protein is a nicotinamide adenine dinucleotide (NAD+) dependent histone deacetylase.157  successfully induced the degradation of SHP2 at 0.5\u2009\u00b5M in MCF-7 cells, which led to simultaneous inhibition of its deacetylase and defatty-acylase activities in living cells.In 2020, Lin group developed a SIRT2 degrader 274 Numerous studies have identified WDR5 as a promising potential therapeutic target. Efforts on targeting the WIN or WBM binding site of WDR5 have led to discovery of several inhibitors that potently and selectively block PPIs between WDR5 and its binding partners.275 However, these WDR5 PPI inhibitors rely on receptor occupancy pharmacology and target only some but not all WDR5 oncogenic functions, exerting poor antiproliferative activity on tumor cells.276The chromatin-associated WD40 repeat domain protein 5(WDR5) acts as a functional subunit of the mixed lineage leukemia (MLL) histone methyltransferase complexes. WDR5 is critical for the methylation of histone H3 lysine 4 (H3K4) on chromatin catalyzed by the MLL1 complex and MLL1 complex-mediated regulations of gene transcription.OICR-9429 modified scaffold and pyrroloimidazole modified scaffold) and different E3 ligase ligands.277 In MV4-11 cells, OICR-9429 modified scaffold derived degrader 158  successfully resolve the structure of the VHL-MS33-WDR5 ternary complex. Based on the crystal structure, they modified the OICR-9429 ligand and shortened the linker to obtain a new WDR5 degrader 161  could quickly induce the degradation of WDR5 with DC50 of 3.7\u2009nM, which was about 70-folds higher than the degrader 160 (MS33). At the same time, they also resolved the structure of the VHL-MS67-WDR5 ternary complex. Subsequently, the antiproliferative activity of the degrader 161 (MS67) was tested on a variety of AML cells, which showed that it had good anti-proliferation activity. In addition, it inhibited the malignant growth of MLL-r AML cells in vitro and in vivo.In the same year, Jin group also reported the WDR5 degraders based on 279 Aurora A kinase is related to centrosome replication and mitotic exit. When Aurora A kinase is inhibited, it can effectively cause cell mitosis to arrest in the G2/M phase and quickly induce apoptosis.280 Aurora B kinase plays a role in coordinating the function of chromosomes and cytoskeleton in the cell cycle. When Aurora B kinase is inhibited, the cytoplasm of the cell cannot be divided and cell growth is arrested.281 Since both Aurora A and Aurora B kinases are related to tumorigenesis, Aurora kinase inhibitors have been extensively carried out in clinical researches on various diseases, such as lung cancer, breast cancer, esophageal cancer, colorectal cancer, acute myeloid leukemia and so on, but currently no drugs have been approved for clinical use.Aurora kinases are serine/threonine protein kinases that regulate centrosome and microtubule functions during mitosis. They are mainly divided into three subtypes: Aurora A, Aurora B, and Aurora C. Aurora A and Aurora B are essential for the cell cycle progression of most cell types and Aurora C mainly distributes in testis.162 ,282 which had a known binding mode and high binding affinity with Aurora A kinase and easy derivation. They found that degrader 162 (JB170) had strong binding ability and degradation activity to Aurora A kinase, its degradation activity was significantly better than that of other designed molecules, and it had a Dmax of 300\u2009nM and a DC50 of 28\u2009nM for Aurora A kinase. After MV4-11 cells were treated with degrader 162 (JB170) or alisertib, degrader 162 (JB170) reduced the level of Aurora A by 73%, which was 57% lower than alisertib. And among the 4259 proteins detectable in this experiment, no other proteins were downregulated, including Aurora B. Subsequently, they found that degrader 162 (JB170) only induced cell accumulation in S phase, which was different with alisertib that induced the G2/M phase arrest of cells. They speculated this may be due to the fact that degrader 162 (JB170) had regulated the non-enzymatic activity of Aurora A. In order to study the effect of degrader 162 (JB170) on the proliferation activity of cancer cells, they used degrader 162 (JB170) to treat MV4-11 cells. The MV4-11 cells were inhibited by 32% after 72\u2009h of treatment with 1\u2009\u00b5M of JB170. Similar results were observed in the colony formation assay using IMR5 cells.The Wolf group reported the first selective Aurora A degrader 163  in the MM.1S multiple myeloma cell line was significantly better than that of the inhibitor alisertib.Fischer group reported the second case of selective Aurora A degrader 164  was different from the result mediated by alisertib. At the same time, they also confirmed that in intermitotic cells, degrader 164 (PROTAC-D) mediated the degradation of Aurora A in the non-centrosome, but had no effect on the level of Aurora A in the centrosome.Lindon group reported the third Aurora A degrader 285 Cdc20 is a key mitotic factor, which controls the beginning of anaphase and the exit of mitosis. Moreover, Cdc20-APC/C plays a key role in cancer progression and drug resistance. Furthermore, Cdc20-APC/C cell processes beyond the cell cycle, including apoptosis, neurogenesis, stem cell expansion.286 Meanwhile, it has a strong connection between the aberrant upregulation of Cdc20 and various types of cancers. Cdc20 is a potential biomarker and an ideal target for cancer treatment.287The cell-division cycle protein 20 (Cdc20) is the substrate receptor of anaphase synthesis complex or cyclosome (APC/C). It coordinates late initiation and exit of mitosis through safety and time-dependent degradation.165  induced the degradation of Cdc20 resulted in significant inhibition of breast cancer cell proliferation and resensitization of paclitaxel-resistant cell lines. The degrader 165 (CP5V) played an important role in inhibiting the progression of breast tumors. In cultured cells and preclinical breast cancer models, it induced the degradation of Cdc20 to induce mitosis inhibition, thereby inhibiting cancer cell proliferation. As a result, it played an important role in inhibiting breast cancer tumor progression in vivo. CP5V-induced degradation of Cdc20 may be an effective treatment strategy for breast cancer anti-mitotic therapy.In 2019, Wan group described the first Cdc20 degrader 291 However, there are no available selective CDK2 inhibitors.293Inactivation of cyclin-dependent kinase 2(CDK2), which overcomes the differentiation arrest of acute myeloid leukemia(AML) cells, maybe a promising approach for the treatment of AML.AT-7519 as the CDK2 targeting ligand connected to CRBN ligand through different linkers to obtain a series of degraders.294 They found the degrader 166  showed good inhibitory activity against cell proliferation with IC50 of 0.84\u2009\u00b5M in PC-3 cells.In 2020, Chen group used 9A, Fig.  had a go167  induced the rapid and potent degradation of CDK2 in different cell lines without comparable degradation of other targets, and induced remarkable differentiation of AML cell lines and primary patient cells. These data clearly demonstrated the practicality and importance of PROTACs as alternative tools for verifying CDK2 protein functions.In 2021, Rao group developed a first-in-class CDK2 degrader 168  could selectively induce the degradation of CDK2 protein. The DC50 was about 100\u2009nM to CDK2 while no degradation activity for other subtypes of CDK protein. They also found that it could be used to prevent and treat cisplatin ototoxicity and excitotoxicity of kainic acid in zebrafish. It the first report that CDK2 degrader could be used to prevent and treat acquired hearing loss.Also in the same year, Zuo group reported the another CDK2 degrader TMX-2039 to obtain a compound TMX-3010 that increased the selectivity for CDK1/2/5, but still had a certain constant activity on CDK4/6 (IC50\u2009\u2248\u2009100\u2009nM).297TMX-3010 improved the selectivity to CDK1/2/5, possibly because the linker moiety significantly impaired the inhibitory activity on CDK4 and CDK6. Based on TMX-3010, they developed a selective degrader 169  selectively induced the degradation of CDK2 and CDK5 in a time and dose-dependent manner, while having no influence on other CDKs. Although CDK5 deletion did not cause growth defects in OVCAR8 cells, a more selective CDK2 degrader was in urgent need of development.In 2020, Gray group modified the structure of a pan-CDK inhibitor 298 Among CDKs, CDK4/6 play an important role in the cell cycle and are often overexpressed or overactivated in tumor samples.299 However, the current clinical use of CDK4/6 inhibitors have limited its application due to its drug resistance and off-target effects.300 So far, many selective and nonselective degraders of CDK4/6 have been reported.306 Here, we make a supplement to the CDK4/6 degraders reported in recent 2 years.CDK4 and CDK6 are a family of serine-threonine kinases that interact with cyclins to phosphorylate Rb, thereby regulating the G1/S transition of the cell cycle. Phosphorylation of Rb leads to the release of the transcription factor E2F to activate many transcription genes that are responsible for cell cycle progression.307 The results showed that the degradation of CDK6 was more effective than inhibition with the dual CDK4/6 inhibitor Palbociclib in suppressing Ph-positive ALL in mice, suggesting that the growth-promoting effects were CDK6 kinase-independent in Ph-positive ALL. The most effective degrader 170  showed good antitumor effects in Ph-positive ALL xenografts and it had a good safety window. However, it was fast metabolized in mice with a t1/2 of 1\u2009h, suggesting that further improvement in PK parameters was warranted.In 2021, Dominici group reported their work on the development of selective CDK6 degraders.308 The VHL-based degraders were either specific degradation for CDK6 or exhibited dual degradation for CDK4 and CDK6. The most representative degrader 171  protein phosphorylation in malignant melanoma cells. Moreover, it also remarkably induced cell cycle arrest and apoptosis of melanoma cells. However, the degrader 172 showed poor oral bioavailability. By adding a labile group to the degrader 172 they got the new degrader 173  are a class of Ser/Thr protein kinases that have key roles in cell cycle regulation or cell transcription.Nopyrazole and thalidomide. The degrader could potently induce 56% CDK9 to degrade at 10\u2009\u03bcM, which was not enough for tumor treatment.314 Recently, Natarajan group reported a similar degrader 174  induced the degradation of CDK9 in acute myeloid leukemia cells with DC50 of 7.6\u2009nM, which was superior to the reported CDK9 degraders. In addition, the degrader 175 (B03) strongly induced apoptosis and inhibited cell proliferation of MV4-11 cells (IC50\u2009=\u200925\u2009nM), which was better than the inhibitor BAY-1143572 (IC50\u2009=\u2009560\u2009nM). Moreover, the degrader 175 (B03) could induce the degradation of CDK9 in vivo. It was the lead degrader of further development and CDK9 degradation was a potentially valuable treatment strategy for acute myeloid leukemia.In 2021, Bian group reported a selective degrader 294 They found the degrader 176  could effectively and selectively induce degradation of CDK9 in a short period of time. In addition, mechanistic studies have shown that the degrader 176 (PROTAC 45) could effectively downregulate the downstream targets of CDK9 (such as MCL1 and MYC) at the transcriptional level. Pharmacodynamic studies have shown that the degrader 176 (PROTAC 45) could effectively induce tumor regression in a TNBC xenograft model. This was the first reported in vivo evaluation of the therapeutic activity of CDK9 degrader in the treatment of TNBC, which proved that CDK9 degradation therapy was a new method for the treatment of TNBC.Based on the previous results and through the analysis of the CDK9 ligands binding modes, Chen group also designed and developed a series of new CDK9 protein degraders in the same year.FN-1501 and CRBN ligand.317 The representative degrader 177  and CDK9 (DC50\u2009=\u200933\u2009nM) in PC-3 cells, and inhibited cell proliferation by effectively blocking the cell cycle in S and G2/M phases. The degradation of CDK2/9 by dual PROTAC may be a potentially effective therapeutic approach.In 2020, Chen group first developed a series of novel degraders for CDK2/9 degradation by connecting CDK9 inhibitor 177 Fig.  potently319 It is overexpressed in breast cancer, ovarian cancer, prostate cancer and other cancers, and is a valuable target for cancer valuable.318 Loss of CDK12 function by silencing and using selective covalent CDK12/13 inhibitor THZ531 leads to a decrease in DDR-associated genes transcription and increases sensitivity to PARP inhibitors and platinum chemotherapy. Thus, CDK12 inhibitors can be used in combination with DNA damaging agents for HR-deficient cancers.321 However, the development of CDK12 inhibitors is particularly challenging due to high sequence similarity with its close homolog CDK13.322CDK12 can phosphorylate RNA polymerase II to regulate transcription elongation, and it can also play a key role in RNA splicing, DNA-damage response (DDR) and the maintenance of genome stability.178  demonstrated strong inhibitory activity on CDK12 enzyme activity and effectively induced the degradation of CDK12 in a dose and time-dependent manner in Jurkat cells, while CDK13 protein levels were minimally affected. Moreover, it exhibited potent antiproliferative effects when used alone or in combination with the PARP Olaparib as well as used alone against cell lines that resistant to covalent CDK12 inhibitors. Interestingly, chronic exposure of degrader 178 (BSJ-4-116) to MOLT-4 cells and Jurkat cells resulted in acquired resistance phenotypes via mutations of Ile733Val and Gly739Ser on CDK12 which resulted in the weaken of degrader binding affinity.In 2021, Gray group developed a selective CDK12 degrader 179  could selectively induce the degradation of CDK12, while there is no degradation activity on CDK13 in different cell lines. And they also found that the degrader could lead to the degradation of cyclin K, and the degradation activity DC50 for CDK12 and cyclin K were 416 and 412\u2009nM, respectively. They also proved the degrader 179 (PP-C8) was highly selective to CDK12-cyclin K complex by quantitative proteomics. They have also shown that 179 (PP-C8) and PARP inhibitors exhibited good synergy in triple-negative breast cancer (TNBC).Then Zhu group synthesized a potent PROTAC 325 Cancer cells often have a deficient G1/S checkpoint which frequently via mutation of p53 to leave them reliant on the G2/M checkpoint to avoid mitotic catastrophe. Therefore, abrogation of the G2/M checkpoint by inhibiting Wee1 can sensitize tumors to DNA damaging therapies. In previous studies, Wee1 inhibitor AZD1775 has been discovered.326 However, it has obvious off-target and side effects, which limits its clinical application.Wee1 is a tyrosine kinase that regulates the G2/M cell cycle checkpoint by phosphorylating and inactivating CDK1 in response to extrinsic DNA damage and errors in DNA synthesis, thereby preventing mitotic entry.AZD1775 to pomalidomide.327 The degrader 180  and is the substrate receptor for the damaged DNA binding protein 1 (DDB1) and Cul4A.329 CRBN is also the direct target protein of thalidomide and immunomodulatory imide drugs (IMiDs) and is crucial for thalidomide teratogenicity.330 CRL4CRBN is a unique E3 ubiquitin ligase with substrate selectivity altered by ligands such as IMiDs.331 It can be efficiently recruited to a protein of interest (POI) when binding with IMiD-based proteolysis-targeting chimeras(PROTACs), leading to the protein ubiquitination and proteasomal degradation.332 As the primary IMiD target, CRBN is a protein of huge potential practice.333 CRBN degraders are considered to be useful tools to figure out the molecular mechanism of thalidomide analogs334.The cereblon (CRBN) is a subunit of the E3 ubiquitin ligase complex cullin-RING ligase 4 . Their work provided proof-of-concept for hijacking different E3 ligase to induce degradation of a particular one.335In 2019, Ciulli group reported their most active VHL-CRBN hetero-dimerizing degrader 183 Fig.  which in336 To develop VHL-CRBN hetero-dimerizing PROTACs they designed different linkers to connect pomalidomide with VH032. The linkers were designed to connect the amino group of pomalidomide and the terminal acetyl group of VH032. The most potent and selective degrader 184 .337Recently, Gray group developed six homo-PROTACs and six hetero-PROTACs adopting a similar strategy as the previous ones. By combining protein immunology and genomics analysis, they successfully screened out two effective hetero-PROTACs which could selectively induce the degradation of CRBN, which provids a reference for follow-up research. The degradation efficiency of degrader 340The 26S proteasome consists of a 20S core and a 19S regulatory subunit. hRpn13 is a component of the 19S subunit, which contains two functional domains, an N-terminal pleckstrin-like receptor for ubiquitin(Pru) domain and a C-terminal deubiquitinase adaptor (DEUBAD) domain.XL5 with better binding ability based on the reported structure of hRpn13 inhibitor RA190.341 On the basis of XL15, they used different E3 ligase ligands to connect with it to obtain a series of PROTAC molecules. They found that 187 , it only resulted in ubiquitination of hRpn13 protein without degradation.In 2021, Walters group screened an inhibitor 342 However, E3 ligases do not comprise deep and \u201cdruggable\u201d active sites for binding to small molecules. E3 ligase inhibition may be ineffective or fail to recapitulate genetic knockout or knockdown.343 New chemical modalities to target E3 ligases are therefore demanded.E3 ubiquitin ligases are emerging as attractive targets for small-molecule modulation and drug discovery and gaining importance as targets to small molecules, both for direct inhibition and to be hijacked to induce the degradation of non-native neo-substrates using bivalent compounds known as PROTACs.344 The most active degrader 188  would find wide use in investigating and dissecting the biological functions of pVHL.In 2017, Ciulli group described proof-of-concept of homo-PROTACs using diverse molecules composed of two instances of a ligand for the VHL E3 ligase.345ZFP91 is a newly discovered ubiquitin E3 ligase that is upregulated in prostate cancer, acute myeloid leukemia, and colon cancer tumors. It maintains the stability of NIK protein through K63-ubiquitinated NIK, thereby activating the NF-\u03baB signaling pathway and promoting the occurrence and development of tumors.189  resulted in inhibition of STAT3 signaling in pancreatic cancer cell lines without inducing proteasome-dependent degradation of STAT3.346 Proteomics analysis showed that it could induce the degradation of the E3 ubiquitinprotein ligase ZFP91 with DC50 values of 80\u2009nM in BxPC-3 cells. At the same time, it also showed a moderate antiproliferative activity, and the IC50 was about 0.9\u2009\u00b5M in MIA PaCa-2 cells and BxPC-3 cells.In 2021, Neamati group designed a ZFP91 degrader 347 In 2013, although the covalent inhibitor ibrutinib was approved for treating MCL and activated B-cell-like (ABC)-DLBCL by FDA, the patients developed resistance due to the missense BTK mutation of C481S.348 With the advent of PROTACs technology, there have been many noncovalent degraders which can degrade both the wild-type and ibrutinib-resistant C481S BTK effectively.353 The next stage may be aimed at improving druggability for a clinical study.As a key regulator in the B-cell receptor(BCR) signaling pathway, BTK is a non-receptor cytoplasmic tyrosine kinase and plays a key role in B-cell lymphomas.190  could inhibit the growth of the JeKo-1 cells and induce the degradation of BTK protein both in vitro and in vivo.In 2019, Lin group developed a new BTK degrader MT802 which was reported previously with potent degradation activity of BTK and poor pharmacokinetic properties. To develop an appropriate degrader for in vivo study, they modified the linker and E3 ligands while keeping their length constant. Fortunately, the degrader 191  and mutated BTK. In addition to having moderate membrane permeability and good plasma stability, the most potent degrader 192  could induce the degradation of CCR9 at 1\u2009nM, but the \u201chook effect\u201d also appeared as the concentration increased. This was the first PROTAC targeted the intracellular allosteric binding site of GPCRs and provided an unprecedented approach to modulate GPCR activity.Based on the binding mode of 365CD147 is a transmembrane glycoprotein, a member of the immunoglobulin superfamily. As a tumor-associated antigen, it is highly expressed in various tumors, including malignant melanoma (MM). As a pivotal role in tumor progression, including affecting tumor cell apoptosis, invasion and metastasis. Therefore, CD147 may provide a potential drug target for tumor diagnosis and treatment.Licartin has been used in clinical treatment of liver cancer, but the radioactive I130 contained in Licartin may have inconvenience and risk of radiation leakage in clinical application.366 Pseudolaric acid B (PAB), a recently reported natural product, was an antagonist of CD147, which could avoid the above-mentioned problems.367 So in 2020, Chen group reported the first CRBN-based CD147 degrader 200  and resistance to RA in cancer cells, while CRABP-II is suggested to be associated with nuclear transportation of RA.MeBS) and all-trans retinoic acid (ATRA) to induce the degradation of CRABP-I/II.373 Based on this work Naito group developed new class CRABPs degrader 201  as a ligand to replace the MeBS to recruit aryl hydrocarbon receptor(AhR) E3 ligase complexes in 2019.374 The degrader 201 (\u03b2-NF-ATRA) could effectively induce the degradation of CRABP-I/II in a dose and time-dependent manner in MCF-7 and IMR-32 cells, and induced AhR self-ubiquitylation and was degraded by the proteasome, which may cause the potential for synergistic anti-tumorigenic activity.In 2010, Hashimoto group developed the first cIAP1-based PROTAC by hijacking cIAP1-E3 ligase  is a ubiquitous, highly conserved and highly active protein in cells, which is more abundant in tumor cells than in normal cells. As a molecular chaperone, HSP90 assists different kinds of oncoproteins to fold, stabilize and mature.BIIB021 to the protein.378 Then they tested their degradation activity on HSP90 protein and proliferation inhibitory activity in MCF-7 and MDA-MB-231 cells, they found the degrader 202  could effectively inhibit the tumor proliferation in mice.Wu group designed and synthesized a series of PROTACs based on the binding mode of HSP90 inhibitor N-formyl-aminoylinosine. It acts on a variety of tryptophan substrates, including D-tryptophan, L-tryptophan, 5-hydroxytryptophan, tryptophan, serotonin, and so on.379 IDO1 plays a role in various pathophysiological processes, such as antibacterial, antitumor defense, neuropathology, immunomodulation, and antioxidant activity.380 Recently, a large number of reports have confirmed that IDO1 was overexpressed in a variety of cancers and plays an important role in cancer immune escape. Therefore, IDO1 has become one of the important targets in the field of tumor therapy. In fact, several highly effective and selective IDO1 inhibitors have entered the clinical development stage for the treatment of human cancer.381Indoleamine 2,3-dioxygenase 1 (IDO1) is a heme enzyme that catalyzes the first and rate-limiting steps of the decomposition of tryptophan into Epacadostat, and evaluated their degradation activity and anti-proliferation in HeLa cells.382 They found that the degrader 203  are members of the orphan nuclear receptor transcription factor superfamily and ligand-dependent transcription factors, including two subtypes of LXR-\u03b1 (NR1H3) and LXR-\u03b2 (NR1H2).GW3965 and different E3 ligase ligands through different connection methods and then found that the VH032-based degrader 204 , autoimmune diseases, cancers, infectious diseases(such as sepsis) and wound healing.388 Therefore, MIF can be used as a biomarker and target of these diseases.Macrophage migration inhibitory factor (MIF) is the first cytokine with the function of multiple inflammatory mediators. It is also an important endocrine hormone.389 Among them, the degrader 205  protected muscle cells and primary cardiomyocytes from DNA-damage-induced energy crisis and cell death. In summary, the degrader 206 (iRucaparib-AP6), by blocking both the catalytic and scaffolding functions of PARP1 without causing PARP1 trapping, provided an ideal approach for the treatment of cancers and other diseases caused by PARP1 hyperactivation.In 2019, Yu group reported their works on the development of PARP1 degraders.Olaparib and lenalidomide.395 The representative degrader 207  was fully exposed to plasma for more than 24 h and effectively induced PARP1 degradation in SW620 xenograft tumor tissues. Moreover, it exhibited durable tumor growth inhibition in mice when used as a single agent or in combination with cytotoxic agents.In 2020, Shen group developed several PARP1 degraders based on the combination of PARP1 inhibitor 207 Fig.  effectivRBM012042, can reverse IL-4 driven pro-tumor gene expression in macrophages. However, it is not clear what roles the non-enzymatic biomolecular recognition motifs play in PARP14-driven immunology and inflammation. However, the role of non-enzymatic functions of PARP14 in PARP14-driven immunity and inflammation is still unclear.397PARP14 is an interferon-stimulated gene that is overexpressed in a variety of tumors. By regulating IFN-\u03b3 and IL-4 signals, affects the polarization of pro-tumor macrophages and inhibits the antitumor inflammatory response. Catalytic inhibitors of PARP14, such as 209  could selectively induce the degradation of endogenous PARP14 with DC50 about 5\u2009nM in KYSE-270 cells, and have no effect on the total protein levels of other PARP enzymes. It also could induce a dose-dependent reduction of IL-10 levels in primary human macrophages.Kuntz group developed the first-in-class degrader 399 PD-L1 is a ligand of PD-1. The combination of PD-1 and PD-L1 initiates the programmed death of T cells and enables tumor cells to obtain immune escape. PD-L1 is upregulated in a variety of tumor cells and it binds to PD-1 on T cells, inhibits T-cell proliferation and activation, inactivates T cells, and finally induces immune escape.400Programmed death receptor (PD-1), also known as CD279, is an important immunosuppressive molecule. It regulates the immune system and promotes self-tolerance by downregulating the response of the immune system to human cells and by inhibiting the inflammatory activity of T cells.401 Most of the compounds exhibited excellent inhibitory activities against PD-1/PD-L1 interaction, especially the degrader 210  could moderately induce the degradation of PD-L1 in a lysosome-dependent manner, which may contribute to its immune effects. In 2021, Yang group reported another PD-L1 degrader 211  between the KD and PBD domains, which is closely related to the degradation of PLK1.Polo-Like Kinase 1 (PKL1) belongs to the polo-like kinase family, which is a type of serine/threonine kinase that is widely present in eukaryotic cells. The structure of PKL1 is highly conserved, with a kinase domain (KD) at the N-terminus and two conserved polo-box domains (PBD) at the C-terminus.118  induced the efficient degradation of BRD4 and PLK1 in MV4-11 cells with a DC50 of about 10\u201320\u2009nM and 5\u2009nM, respectively. Then they found the antiproliferative activity of the degrader 118 (HBL-4) (IC50\u2009=\u20094.48\u2009nM) was better than BI2536 (IC50\u2009=\u200988.5\u2009nM) in MV4-11 cells. At the same time, it induced dramatically improved efficacy in the MV4-11 tumor xenograft model compared with BI2536.In 2020, Lu group developed a dual degrader 406Retinoic acid receptors (RAR) belong to the nuclear receptor superfamily, including three subtypes of \u03b1, \u03b2, and \u03b3. RAR-\u03b2 is divided into \u03b21, \u03b22, \u03b23, \u03b24, and so on. RAR regulates the transcription of target genes by binding to their ligands, thereby exerting various biological effects. It plays an important role in mediating cell growth and apoptosis.212  proteins has been identified as a major source of quadruplex-resolving activity in cell lysates.410Nucleic acids with a four-stranded helix structure are called G-quadruplexes, which are a class of nucleic acid secondary structures with important regulatory functions and are believed to play an important role in gene expression and telomere maintenance.199  concentration of 1\u2009nM, and its degradation activity increased along with increasing degrader concentration. At the same time, the degrader also had obvious \u201chook effect\u201d. They also proved that the degradation of RHAU protein could be rapidly induced after using the degrader for 6\u2009h, and the degradation effect gradually increased with the prolongation of the incubation time.Phan group reported the novel degrader 412 The transcriptional activation of a variety of inflammatory cytokine genes and a variety of immune diseases are related to the activation of this pathway.413Receptor serine/threonine kinases are single-pass transmembrane protein receptors with serine/threonine protein kinase activity in the intracellular region. It mainly phosphorylates the serine or threonine in downstream signal proteins, transmits the extracellular signal into the cell, and then achieves a variety of biological functions by affecting gene transcription. Pattern recognition receptors NOD1 and NOD2 are located upstream of RIPK2 and regulate its activity.214  was better than other RIPK2 degraders. It exhibited low total systemic clearance in both rat and dog which afforded prolonged in vivo degradation of RIPK2 in vivo. In addition, it reduced endogenous RIPK2 in rats at low doses and extended PD that persists in the absence of detectable compound.In 2021, Harling group developed a highly potent and selective RIPK2 degrader 214 Fig.  based on415 SF3B subunit 1 (SF3B1) is one of the fundamental components of the multiprotein complex SF3B and is involved in 30 splice site recognition at intron\u2013exon junctions during RNA splicing. The SF3B1 gene is frequently mutated in tumors, such as myelodysplastic syndrome (20%) and chronic lymphocytic leukemia (15%). Because the functions of individual components of the spliceosome are largely unknown, SF3B1 inhibitors  are widely used to repress spliceosome-mediated alternative splicing and induce apoptosis in various tumor cells.416The spliceosome is a large protein-RNA complex that consists of five small nuclear RNAs (snRNAs) and a variety of associated proteins, such as splicing factor 3B (SF3B).215  selectively induced the degradation of SF3B1 and induced cellular apoptosis in a CRBN-dependent manner. In a Drosophila intestinal tumor model, the degrader 215 (PROTAC-O4I2) increased survival by interference with the maintenance and proliferation of stem cells. Thus, their results demonstrated that SF3B1 could be degraded by utilizing noninhibitory chemicals, which expanded the PROTAC target proteins.In 2021, Cheng group reported the SF3B1 degrader 418 SLCs are responsible for the absorption and transportation of several substances on cell membranes, including amino acids, nucleotides, sugars, inorganic ions, and drugs. Nearly 100 human SLCs that transport amino acids have been proposed, 60% of them have been confirmed to transport amino acids, and the rest are closely related to amino acid transporters known phylogenetically.419Among the membrane proteins that constitute about 27% of all proteins in the human genome, the solute carrier(SLC) family is the second largest membrane protein family in humans, and consists of more than 400 types of proteins divided into 52 families. In recent years, phylogenetic analysis has shown that 15 SLC families can be divided into four phylogenetic clusters, namely \u03b1, \u03b2, \u03b3, and \u03b4. The sequence analysis has shown that 24 SLC families belong to three PFAM clans, MFS, APC, and CPA/AT.216  was a first-class SLC PROTAC, which could induce the high-efficiency degradation of its homologous targeted SLC9A1, as well as the degradation of other SLC9 members, such as the transporters SLC9A2 and SLC9A4. The proliferation inhibitory activity of the degrader 216 (d9A-2) on KBM7 cells was consistent with the evidence of degradation in the cytotoxicity test. In addition, the degrader 216 (d9A-2) treatment resulted in a variety of cancer cell intracellular pH (pHi) restoration obstacles and toxicity.In 2020, Furga group developed a SLC degrader 421 SMARCA4 plays a tumor suppressor effect in solid tumors, but in AML it is necessary to maintain the oncogenic transcription program and drive proliferation.422 It has been reported that the double allosteric inhibitor of SMARCA2/4 ATP enzyme activity effectively inhibited the proliferation of the SMARCA4 mutant xenograft model.423The ATP-dependent chromatin remodeling complex BAF/PBAF changes the position and composition of nucleosomes through slipping and elimination to achieve dynamic regulation of chromatin structure. About one-fifth of tumors occur are closely related to the complex somatic mutations. The studies have found that two ATPases in the complex SMARCA2/4 are potential cancer treatment targets.424 The degrader 217  could effectively induce the degradation of SMARCA2, SMARCA4, and PBRM1 in MV4-11 cells with the DC50 value of 6, 11, and 32\u2009nM, respectively.In 2019, Ciulli group developed a series of SMARCA2/4 degraders conjugated with a bromodomain ligand and VHL ligand.217 Fig.  successf219  could induce the degradation of SMARCA2 and SMARCA4 in HEK293 and HeLa cells, but it also showed a certain degradation activity to PBRM1.In 2021, Chinnaiyan group also linked the same bromodomain ligand with VHL and developed a degrader 426 SRC-1 is the first identified transcription coactivator that can promote the activity of various transcription factors (TF), such as estrogen receptor \u03b1, progesterone receptor and so on. As a coactivator, SRC-1 can not only promote the effect of transcription factor, but also promote the formation of protein complexes, so SRC-1 plays an important role in the organism.427 Studies have shown that the expression level of SRC-1 is low in normal physiological body, and it is abnormally activated and highly expressed in tumor cells. Therefore, SRC-1 is considered to be an oncogenic protein. Although corresponding inhibitors have been developed for SRC, most of them target SRC-1 and SRC-3. The inhibitors are lack selectivity to SRC-1 and are prone to cause side effects.428 Therefore, using PROTAC technology to induce degradation of SRC-1 protein has become a promising method.Steroid receptor coactivator (SRC) is a type of transcription coactivator, which usually contains three subtypes, namely SRC-1, SRC-2, and SRC-3.220  could induce degradation of SRC-1 protein at 10\u2009\u03bcM, while it could not induce degradation of SRC-1 protein in Colo205 cells with low CRBN expression. In addition, it did not induce degradation of SRC-3, indicating that it had good selectivity.In 2020, Lim group designed and synthesized the degrader l-ascorbic acid, ellagic acid, and tranexamic acid.430 However, most tyrosinase inhibitors have certain side effects. For example, hydroquinone is toxic to human cells and can cause skin irritation and bone marrow toxicity, l-ascorbic acid is easily sensitive to heat, ellagic acid is insoluble and has poor bioavailability.431 In addition, in order to produce an inhibitory effect, tyrosinase inhibitors need to constantly occupy the active site of the tyrosinase, but high doses can cause undesirable off-target effects and cause damage to the skin.432Tyrosinase is the main rate-limiting enzyme of melanin synthesis, and it plays an important role in skin protection and pigmentation. So far, almost all tyrosinase inhibitors are based on cheap and easily available mushroom tyrosinase (mTYR) obtained through in vitro screening, such as hydroquinone, arbutin, L-Dopa and pomalidomide.433 The degrader 221  on zebrafish to reduce the synthesis of zebrafish melanin, highlighting the potential for the treatment of tyrosinase-related diseases.In 2021, Tang group designed and synthesized a tyrosinase degrader based on Indomethacin is a non-steroidal anti-inflammatory drug (NSAID) with anti-inflammatory, analgesic, and antipyretic properties. Its pharmacological effects are not fully understood. It is not only related to the activities of cyclooxygenase 1 and 2, but also inhibit the biosynthesis of phospholipase A2 (PLA-2) and microsomal prostaglandin E synthase 2 (mPGES-2).434 Studies have shown that it had good activity against coronavirus infections, so it had great development potential in the field of anti-inflammatory and antiviral.435Indomethacin and VHL,436 it was found that the degrader 222  has infected more than 240 million individuals worldwide, and the death toll has exceeded 4.9 million and is still rising. Although some vaccines have been widely used to prevent COVID-19, due to the high mortality and the occurrence of mutations, the development of curable drugs has become more and more important. Although some drugs have entered the clinical trial stage, the therapeutic effect is still to be observed. So using new technologies to develop new treatments has become a strategy.Telaprevir-based PROTAC has been reported to be used for the degradation of HCV NS3/4A protease. The Mpro protein plays an important role in SARS-CoV-2, so PROTAC technology can be used to induce degradation of the Mpro protein so as to achieve the purpose of curing SARS-CoV-2. The applicability of PROTAC technology on SARS-CoV-2 has been discussed recently by different groups.Telaprevir could be used in the design of Mpro degraders. Subsequently, the degraders 224\u2013226  play important roles in inflammatory diseases like asthma and chronic obstructive pulmonary disease (COPD). Currently, eighteen HDAC isoenzymes, which can be divided into four classes, have been discovered. Among them, class I HDACs, containing HDAC1, 2, 3, and 8, are well-known for their importance in cell motility, immunoregulation, and proliferation.440 The degrader 227  had potent antiproliferative activity against cancer cells.In 2020, Dekker group reported the development of a novel PROTAC targeting HDAC3 by tethering the CRBN ligand pomalidomide and o-aminoanilide-based class I HDAC inhibitors.442 To date, several types of H-PGDS inhibitors have been developed as therapies for allergic and inflammatory responses. However, no HPGDS inhibitors have yet been approved into clinical studies.443 Therefore, the development of novel agents having other modes of action to modulate the activity of H-PGDS is required.Hematopoietic prostaglandin D synthase (HPGDS) is an attractive target for the treatment of a variety of diseases, including allergic diseases and Duchenne muscular dystrophy.229 (PROTAC(HPGDS)-1, Fig. TCF-007 with CRBN ligand pomalidomide.444 The degrader 229 (PROTAC(HPGDS)-1) effectively induced the selective degradation of H-PGDS protein and suppression of prostaglandin D2(PGD2) production. It was worth noting that the degrader 229 (PROTAC(HPGDS)-1) continued to inhibit the production of PGD2 after the removal of the drug, whereas the production of PGD2 was restored after the removal of TFC-007. In the same year, by using a docking simulation of the ternary complex of H-PGDS-PROTAC (H-PGDS)-1-cereblon, this group also successfully developed the degrader 230 (PROTAC(H-PGDS)-7, Fig. 445 The degrader 230 (PROTAC(H-PGDS)-7) exhibited potent and selective degradation of H-PGDS with DC50 value of 17.3\u2009pM after 6\u2009h treatment, and potent suppression of prostaglandin D2 production in KU812 cells. In addition, the degrader 230 (PROTAC(H-PGDS)-7) had better inhibition of inflammatory cytokines than TFC-007 in a Duchenne muscular dystrophy model using mdx mice with cardiac hypertrophy. Therefore, the degrader 230 (PROTAC(H-PGDS)-7) was expected to play a role in biological research and clinical treatment.In 2021, Demizu group reported the first H-PGDS degrader 449 Despite some advances in the study of IRAK1, IRAK1 remains a challenging target in the field of traditional small-molecule inhibitors, partly due to the lack of understanding of the structural domains primarily responsible for its scaffolding function.IRAK1, a class of serine-threonine protein kinases associated with IL-1R and TLR signaling, plays a key role in initiating the innate immune response against foreign pathogens. Upon activation, TLR or IL/1Rs dimerizes and allows its intracellular structural domain to recruit the myeloid differentiation primary response 88 (MyD88) adaptor protein. MyD88 molecules oligomerize through the N-terminal death domain (DD) and recruit IRAK containing the DD structural domain to form a macromolecular signaling complex called myddosome, which leads to the autophosphorylation and activation of IRAK4. Activated IRAK4 phosphorylates IRAK1 and/or IRAK2, followed by the complementation of TNFR-associated factor 6 (TRAF6) into the myddosome. Activated TRAF6 is then released into the cytoplasm, where it triggers activation of the I\u03baCB kinase (IKK)-nuclear factor-\u03baB (NF-KB) cascade and MAP kinase (MAPK) signaling pathways.JH-I-25 and VHL ligands.450 The most potent degrader 231  effectively blocked downstream signaling pathway of IRAK1, induced apoptosis, and displayed stronger antiproliferative effects compared to IRAK1 inhibitors, indicating that the scaffold function of IRAK1 played a key role in ABC DLBCL cell survival.In 2021, Dai group first reported a series of IRAK1-targeting PROTAC based on IRAK1 inhibitor 451 IRAK3 is believed to perform biological functions through a non-kinase-catalyzed scaffolding action.452 The expression of IRAK3 is mainly restricted to leukocytes, and it has been reported to inhibit pro-inflammatory signaling in innate leukocytes.453 Knockdown of IRAK3 in mice leads to reprogram of myeloid cells toward immune activation and promotes proliferation of effector T cells, which in turn helps to overcome immune suppression and enhance the host response to checkpoint inhibition.455 Since IRAK3 is a pseudokinase, it is unclear whether the molecule bound to IRAK3 has a functional role, and it is essential to employ some techniques to address this issue.IRAK3  is a class 1 pseudokinase member of the IRAK family.456 the degrader 232 -nuclear factor-kB (NF-kB) and the mitogen-activated protein kinase (MAPK) signaling pathways. Several reports have revealed an important role of IRAK4 in myddosome assembly in addition to its kinase catalytic function and its kinase backbone function, suggesting that overall inhibition or elimination of IRAK4 has a great potential to completely eliminate IL-1R/TLR assembly or the resulting signaling.458 Several investigators have begun to explore to use PROTACs to induce the degradation of IRAK4.Playing a key role in both toll-like receptors (TLRs) and interleukin-1 receptors (1L-1R) signaling pathways, IRAK4 has been identified as a potential drug target involved in the innate immune process and has attracted widespread interest as a novel modality for the treatment of inflammatory diseases and oncology.PF-06650833 to different E3 ligases.459 The VHL-based degrader 233  did not show additional potential benefit upon TLR7/8 stimulation in PBMCs compared to PF-06650833. And the inhibition of IL-6 and TNF-\u03b1 was also not observed in IL-1\u03b2 stimulated human dermal fibroblasts. Nevertheless, the possibility of targeting IRAK4 kinase allowed new therapeutic chances to treat autoimmune and oncological diseases.In 2019, Anderson group reported a series of PROTACs by incorporating IRAK4 ligand 460 These PROTACs showed moderate affinities to CRBN-DBB1 with binding affinity values ranging from 490 to 1080\u2009nM. Among all of the PROTACs, the degrader 234  and hydrophobic all-carbon chains.235 Fig.  induced 458 GSK-3\u03b2 controls the synthesis of glycogen to regulate the metabolism of glycogen, and affects the permeability of mitochondria and the releases of cytochrome C to regulate apoptosis. GSK-3\u03b2 also acts on activation of the transcription factors and functions in many biological processes including embryonic development, cell differentiation, and insulin response.459 GSK-3\u03b2 is abundant in brain and is associated with many neurodegenerative diseases and neurological disorders. Recently, GSK-3\u03b2 has been described as a tumor suppressor due to its ability to phosphorylate the pro-oncogenic moleculars that affect the cell cycle and DNA repair.460Glycogen synthase kinase 3 (GSK-3) belongs to a multifunctional serine/threonine protein kinase under the phosphotransferase family. There are two isomers of mammalian GSK-3, namely GSK-3\u03b1 and GSK-3\u03b2.461 The degrader 236  needed to rely on the intracellular UPS to induce GSK-3\u03b2 degradation. In addition, it protected against glutamate-induced cell death in HT-22 cells.The first GSK-3\u03b2 degrader was reported by Sun group in 2021.462 To date, a large number of disease-associated LRRK2 mutations have been identified and five mutations  are associated with PD pathogenesis. LRRK2 mutations, particularly the most common G2019S mutation, are observed in patients with autosomal dominant PD and apparently disseminated PD. Pathogenic mutations in the LRRK2 gene increase LRRK2 kinase activity, and LRRK2 kinase inhibitors are neuroprotective in preclinical models of Parkinson's disease. These findings make LRRK2 to be one of the important targets for the treatment of PD and targeting LRRK2 has become an effective treatment for PD.463PARK8 is one of the genes associated with Parkinson's disease (PD), which encodes leucine-rich repeat kinase 2 (LRRK2).464 Series of potential LRRK2 PROTACs were constructed based on the LRRK2 inhibitors PF-06447475 or GNE-7915 and CRBN ligand pomalidomide. For example, the degrader 237  and other neurodegenerative diseases.466 They designed and synthesized different degraders and tested their degradation activity in HEK293 TREX \u03b1-synuclein A53T cells. The experimental results showed that the degrader 238  and in vivo mice models (hTau-transgenic and 3xTg-AD). Most importantly, both single and multiple doses  of subcutaneous degrader 240 (C004019) significantly reduced tau levels in the brains of wild-type, hTau-transgenic, and 3xTg-AD mice with improved synaptic and cognitive function. Therefore, the degrader 240 (C004019) could be considered as a promising drug candidate in related diseases.In 2021, Wang group developed a novel tau protein degrader 470 When the extracellular structural domains of TRKs bind to their corresponding ligands, they will induce dimerization and activation of the intracellular kinase domains of TRKs thereby providing signals to downstream PI3K/AKT, RAF/MEK/ ERK, and phospholipase C gamma(PLC\u03b3).471 This ultimately leads to constitutive activation of the TRK pathway and promotes cell proliferation, survival, and malignant transformation.TRKs are receptor tyrosine kinases encoded by the NTRK1/2/3 genes and contain mainly three members(TRKA/B/C), which are associated with the development and function of neuronal tissues.GNF-8625 to CRBN ligand thalidomide.472 The degrader 241  and 242 (CG428) also induced degradation of wild-type TRKA with DC50 values of 1.26\u2009nM and 2.23\u2009nM in HEL cells. These two degraders exhibited more potent inhibition of cell growth than the TRK inhibitor GNF-8625. Further, they also exhibited good plasma exposure in mice. These results suggested that they were valuable chemical tools for investigating TRKA function.In 2020, Chen group reported a series of selective and potent TRKA degraders by conjugating a pan-TRK inhibitor 473 In addition, overexpression and aberrant activation of TRKC has been observed in a variety of human tumors. Aberrant activation of TRKC and TRKC fusion proteins significantly induces growth rate, epithelial\u2013mesenchymal transition(EMT), and oncogenic capacity through constitutive activation of the PI3K-AKT, RAS-MAP kinase (MAPK), and JAK2-STAT3 pathways.474TRKC, a member of the TRK family, is closely related to the development and function of neuronal tissues. The decrease in TRKC has been found in a variety of neurodegenerative diseases including AD, PD, and HD.IY-IY (Kd\u2009=\u2009112\u2009nM) and different E3 ligase ligands.475 pomalidomide-based degrader 243 .479 Cas protein can be divided into two classes (Classes 1 and 2) and six types (types I\u2013VI) based on their specific mechanisms of guiding RNA biogenesis and targeting interference.481 There are several most widely used examples such as Cas9 (type II), Cas12 (type V), and Cas13 (type VI).484 Although CRISPR-Cas system has become a powerful tool to manipulate the human genome for gene therapy, it may still cause some side effects owing to off-target edits.485Cas protein (CRISPR-associated protein) is a type of nuclease in the CRISPR  system, which plays an important role in the adaptive immune function of CRISPR system.FCPF proteins  by inserting a Phe-Cys-Pro-Phe(FCPF) amino acid sequence (known as the \u03c0-clamp system) into Cas proteins, which could be labeled by perfluoroaromatics carrying thefluorescein. Then they designed a perfluoroaromatics-based degrader 244  could induce the degradation of Cas9FCPF with IC50 of 167.2\u2009nM in HEK293T cells and 143.4\u2009nM in HeLa cells.486In 2021, Cheng group developed engineered Cas488 Statins competitively bind to the active site of the enzyme through its HMG-like part to prevent the production of mevalonate and downstream derivatives including cholesterol. However, statins may cause a compensatory increase in protein expression489 which limits the maximal effectiveness of the drug and provoking some side effects including skeletal muscle damage.491 With the development of PROTACs, a promising therapeutic approach to induce degradation of proteins of interests, it might be able to solve this problem by chemical knockdown instead of small-molecule inhibition.492HMG-CoA reductase (HMGCR) is an eight-channel transmembrane protein located in the endoplasmic reticulum (ER). It is the rate-limiting enzyme in the cholesterol biosynthetic pathway and a classical drug target of statins which can lower the cholesterol and preventing cardiovascular disease (CVD).493 They synthesized a class of PROTACs by linking Atorvastatin with CRBN ligands. The most potent and selective degrader 245  is a member of VEGFR family of receptor tyrosine kinases (RTK)501 They combined their novel potent angiogenesis inhibitors S7  and E3 ubiquitin ligases ligand (VH032) with different lengths of dicarboxylic acid. The most potent degrader targeting VEGFR2 were degrader 247  could specifically reduce the protein levels of VEGFR2 and normalize the abnormal vessels without significant cytotoxicity.In 2020, Zhang group designed several PROTACs based on the previously developed anti-angiogenesis agents.In the above space, we summarize the main progress in the PROTAC field in the past 2 years. Compared with traditional small-molecule inhibitors, although PROTACs have shown obvious advantages, they also have similar disadvantages as small-molecule inhibitors. First, because PROTAC is developed based on POI inhibitors, it still has a certain degree of off-target effect. Secondly, due to the large molecular weight of PROTAC, it has poor cell-membrane permeability and poor pharmacokinetic(PK) properties, which greatly reduces its biological and therapeutic effects. In addition, although some PROTACs can efficiently induce the degradation of target proteins, their biological effects are so weak that they do not have an effective effect on the disease. Finally, most proteins do not have corresponding small-molecule binders for designing PROTACs, such as most transcription factors, which play an important role in the occurrence and development of diseases. The inhibitors of transcription factors are few, resulting in there is no binder available when designing PROTACs targeting transcription factors. This greatly limits the application of PROTAC technology. Therefore, it is of great significance to integrate other drug design strategies into PROTAC technology to solve the above shortcomings.In order to solve the problems mentioned above, different types of PROTAC technologies have emerged in recent years, such as Antibody-PROTAC, Aptamer-PROTAC, Dual-target PROTAC, Folate-caged PROTAC, and Transcription factor-PROTACs, etc. Although these technologies are based on PROTACs, they all have advantages that are different from traditional PROTAC technologies. For example, Antibody-PROTAC can overcome the shortcomings of PROTACs off-target effect and weak tissue specificity, Aptamer-PROTAC can improve the cell-membrane permeability and pharmacokinetic(PK) properties of PROTACs. Although these new PROTAC-based technologies achieved degradation on very few proteins, they undoubtedly injected vitality into the development of PROTACs. So we will briefly introduce these new technologies.505 which result in their low bioavailability. Contrastly, the antibody-PROTAC conjugate technology can be used to overcome the potential delivery difficulties of PROTACs.Antibody-PROTAC is a new strategy to explore the combination of PROTAC and antibodies to assemble new Antibody-PROTAC conjugates. This technology can achieve the specific degradation of proteins in different cells and tissues, thereby optimizing the therapeutic window and maximizing the treatment window, reducing the side effects of broad-spectrum PROTAC and increasing its potential as a drug or chemical tool. What\u2019s more, although examples of intravenous (IV) and oral (PO) administration have been reported, most of the currently reported PROTACs are usually delivered to animals by subcutaneous (SC) or intraperitoneal (IP) administration routes,249  only induced the degradation of BRD4 protein in HER2-positive breast cancer cell lines (SK-BR-3 and BT474), but not in HER2-negative cells (MCF-7 and MDA-MB 231). Significant degradation of BRD4 protein was observed in HER2+ cells incubated with 50\u2009nM and 100\u2009nM conjugate 249 (Ab-PROTAC 3) for 4 hours, but not detected at any concentration in the HER2\u2212 cell lines. This study verified the concept of tissue-specific Ab-PROTAC inducing BRD4 protein degradation, overcoming the limitations and selectivity of PROTACs, and laying the foundation for the development of new type PROTAC.In 2020, Tate group reported a trastuzumab-PROTAC conjugate 250  and the BRD4 degrader developed by themselves. To avoid the aggregation problem caused by high lipophilicity of linker, they linked six BRD4 degraders to CLL1. After antibody-mediated delivery, the higher drug loading of these conjugates could increase the intracellular drug concentration. Afterward, the conjugate 250 (CLL1-5) showed significant antitumor activity in the HL-60 AML xenograft model. All of these results proved that the mechanism of the conjugate 250 (CLL1-5) was the degradation of BRD4 protein induced by PROTAC after antibody-mediated delivery. At the same time, they also reported another antibody-PROTAC conjugate 251  had the best effect on ER\u03b1 degradation, with a DC50 of 0.03\u2009\u00b5g/mL and a Dmax of 94%. By synthesizing different antibody-PROTAC conjugates and testing their degradation activities, they proved that the linker between the antibody and PROTAC could adjust the stability of the conjugate and regulate the efficiency of releasing the degrader in the cell.Researchers from Genentech have also developed a series of Ab-PROTAC conjugates based on different antibodies and BRD4 degraders. In 2020, they reported an antibody-PROTAC conjugate JQ1. On this basis, they used different linkers to connect the degraders to the antibodies to synthesize antibody-PROTAC conjugates. The antibodies they used included STEAP1 , CLL1, and HER2.509 It was found that in the PC-3-S1 cell line, the conjugate 252  in PC-3-S1 and HL-60 xenograft models and found that it achieved antigen-dependent antitumor activity in both prostate cancer and AML xenograft models.In 2021, they successively reported two types of antibody-PROTAC conjugates based on different BRD4 degraders and antibodies. First, they designed a series of BRD4 protein degraders based on 511 Aptamer is single-stranded nucleic acid with complex three-dimensional structures, which mainly include stems, loops, hairpins, and G4 polymers.512 They bind to target proteins with high specificity and affinity through special effects, including hydrogen bonding, van der Waals force, base stacking force and electrostatic effect.513 Due to special properties, aptamers are also called chemical antibodies by researchers. Compared with other targeting carriers, aptamers have the following advantages: (1) good tissue permeability, (2) good in vivo safety, (3) no obvious immunogenicity. They have been widely used in targeted therapy for human tumors.515In addition to antibody-PROTAC, Aptamer-PROTAC is also a new PROTAC technology that can improve water solubility, membrane permeability, and tumor targeting, which are typical disadvantages of traditional PROTACs.516 They used a disulfide bond to connect the effective BET (BRD4) degrader and the nucleoside-dependent aptamer AS to synthesize the APC 254  by combining the aptamer with the BET protein degrader.517 In the process of cancer treatment, tumor cells can easily obtain drug resistance by compensatory action or other signal pathways activation.518 Therefore, there are obvious limitations in drug treatment for a single target. In order to overcome the shortcomings, drug development for two or more targets has received more and more attention. Although \u201ccocktail therapy\u201d has achieved good clinical effects, long-term large doses and multiple use of different types of drugs have greatly reduced the compliance and quality of life of patients. Therefore, the development of single-drug-based dual-target drugs has become one of the strategies. The method is mainly to design a single molecule that combined two or more pharmacophores to target two or more antitumor targets at the same time. In the previous studies, there have been a large number of reports showing that the dual inhibitors based on this strategy can achieve good antitumor effects,521 and it has gradually become an alternative to combination therapy. The currently reported PROTACs are basically degraders designed based on only one protein. Although the one degrader can induce the degradation of different proteins,525 it is mostly caused by off-target effects of the protein ligands more than the rational design of multi-target degradation. Therefore, for two abnormal proteins in the same disease, it has become a way to treat the disease with a powerful degrader that is rationally designed based on two different ligands.In addition to using antibody-PROTAC and Aptamer-PROTAC to solve the targeting specificity and membrane permeability problems of PROTAC, how to improve the antitumor activity of PROTAC is also an urgent problem to be solved. But during the occurrence and development of cancer, there are usually many factors working together, including different kinds of kinases and growth factors, which can act independently or interfere with each other through signal networks.Gefitinib and the PARP inhibitor Olaparib to form star-shaped dual-target degraders,526 and then evaluated their degradation activities of the two proteins in H1299 cells. They found that the compound 255  in H1299 cells. Its IC50 was 19.92\u2009\u00b5M, which was between EGFR inhibitor Gefitinib (IC50\u2009=\u20096.56\u2009\u00b5M) and PARP inhibitor Olaparib (IC50\u2009=\u200935.93\u2009\u00b5M). The weaker antiproliferative activity of the compound 255 (DP-V-4) may be due to the larger molecular weight of the degrader, which leads to poor solubility and cell permeability.In 2021, Li group used the E3 ligase ligand and the EGFR inhibitor 534 Therefore, the use of folate-conjugating strategy in PROTACs technology (folate-caged PROTACs) to achieve the specific delivery of degraders to cancer cells has become a practical method. In this technology, folate releases active PROTAC by the action of cell endogenous hydrolase, and then the degrader induces the degradation of the target protein (POI). This strategy can eliminate the potential toxicity of degraders in normal tissues.Folate-caged PROTACs is another technology that can improve the targeting specificity of PROTACs. Its basic principle is similar to Antibody-PROTAC, which introduces folate groups into PROTAC molecules to achieve release in targeted cells and tissues. Since folate receptor \u03b1 (FOLR1) is low in normal tissues but is highly expressed in many human cancers, including multiple myelom (MM), lymphoma, and non-small cell lung cancer (NSCLC), folate-conjugating strategy is one of the commonly used drug delivery methods. This strategy has been widely and maturely used in tumor imaging and cancer-targeted drug delivery. At the same time, several FOLR1 targeted drugs have good antitumor effects and are currently in phase II/III clinical trials.535 Based on the reported BRD protein degrader ARV-771, they combined folate to the hydroxyl group of VHL via an ester bond to obtain folate-caged PROTAC 256  on BRD4 protein in different cell lines and found that it could introduce the degradation of BRD4 protein effectively, which was equivalent to the degrader ARV-771 in cells that highly express folate, when it also has shown similar antiproliferative activity as ARV-771. Meanwhile, as the expression of folate was less in normal cells, the degradation activity of BRD4 protein and antiproliferative activity were weaker than that of degrader ARV-771. Those experiments have proved that folate-caged PROTAC could exert high-efficiency degradation activity and anti-proliferation activity in tumor cells with high folate expression while its activity was weak in normal cells, which has achieved the purpose of targeting specific cells to generate degradation activity.In 2021, Wei and Jin group reported the first folate-caged PROTAC. To ensure that the design of folate-caged PROTAC was universally applicable, they introduced a folate group on the E3 ubiquitin ligase ligand.257  could efficiently induce the degradation of IKZF3, but its antiproliferative activity (IC50\u2009=\u20091.0\u2009\u00b5M) on MM.1S cells was weaker than that of pomalidomide (IC50\u2009=\u200958\u2009nM), which may be caused by the incomplete release of the molecular glue caged by folate in the cells.Subsequently, they reported the first case of folate-caged molecular glue In summary, they designed a universal folate-caged PROTAC design platform, through which they proved that the strategy could be applied to the protection and targeted delivery of PROTACs and molecular glues. This strategy could realize the selection of degraders for cancer cells and the safety for normal cells, and provide a reference method for avoiding the potential toxicity of protein degraders.537 In addition to normal regulatory functions, the cancer dependency map project (DepMap) also finds that TFs are also a class of essential proteins that maintain cancer cell proliferation and tumorigenesis, thus indicating that TFs are potential targets for tumor therapy.538 There are about 1600 TFs discovered and they can be divided into more than a dozen families according to their functions and structures. These TFs are different from traditional kinases as they do not have active pockets or allosteric regulatory site commonly found in kinases or other enzymes, so they are difficult to be targeted by small-molecule inhibitors.539 Among the reported TFs, only a few have small-molecule inhibitors, including NF-\u03baB,541 STAT3/5,544 MYC,546, and nuclear receptors AR548 and ER.549 Most other TFs cannot be effectively targeted by small-molecule inhibitors, so the development of TFs small-molecule inhibitors is extremely difficult.Transcription factors (TFs) are a class of proteins that are related to gene expression and regulation.Since TFs can bind to specific DNA sequences and regulate the transcription process, different DNA sequences can be used instead of small-molecule inhibitors to target TFs and regulate their biological functions in theory. At present, researchers have experimentally determined more than 600 DNA sequences that can specifically bind to human TFs, which provides great possibilities for the targeted regulation of TFs. Inspired by the PROTAC technology, researchers are thinking about whether the small-molecule ligands that target the protein in the PROTAC can be replaced with the corresponding DNA sequence, so that it can form a TF-PROTAC to target specific TFs and induce their degradation to regulate the level of specific TFs and biological functions.550 which linked DNA sequences to E3 ligase ligands via a copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reaction to selectively induce the degradation of the interested TFs  in HeLa cells, they found that dNF-\u03baB #15 and dNF-\u03baB #16 showed the best activity to induce the degradation of p65 and had good antiproliferative activity in tumor cells.In 2021, Wei group reported a platform named TF-PROTAC,TFs Fig. . They usE2F-ODN)552 that targeted E2F and modified it by azide to obtain N3-E2F-ODN. Then, the degradation activities of different VHL ligands to E2F were tested in HeLa cells, and it was found that dE2F #16 and dE2F #17 showed the best E2F degradation activity and also had good antiproliferative activity in tumor cells. This was the first report of the technology for targeted degradation of TFs. The experimental results have shown this platform is a universal technology for inducing the degradation of TFs and that it has overcome the shortcomings of traditional small-molecule inhibitors and thus provided a possible solution to target the undruggable TFs.Moreover, they used this technology to design a TF-PROTAC that induced the degradation of E2F. Similar to the above method, they selected a double-strand DNA, in which the sense chain was 5\u2032-CTAGATTTCCCGCG-3\u2032 and the antisense chain was 5\u2032-CTAGCGCGGAAAT-3\u2032 , virtual drug screening technology and DEL screening technology, etc. can help develop the corresponding ligands for the target protein and E3 ligase. Based on these screened ligands, it is necessary to develop efficient synthesis methods to quickly and effectively construct large-scale PROTAC molecular libraries characterized by skeletal diversity for high-throughput screening and optimization of molecular druggability. In terms of molecular design, the existing ternary complex structures of PROTAC molecule with POI and E3 ligase proteins are still very few. In the future, more complex information obtained by X-Ray or cryo-electron microscopy will help in better molecular design. In recent years, breakthroughs in the ability to predict the protein and related complex structure by alphafold2 may also contribute to the design of PROTACs. For molecular optimization, increasing the overall rigidity of the molecule and reducing the molecular weight can generally improve the drug-like properties of the hit compounds, such as oral bioavailability, ADME, etc.PROTAC molecular screening. The existing technical methods mainly rely on immunoblotting methods and proteomics methods, which are not only time-consuming, labor-intensive, low-efficiency, and high-cost. In recent years, screening technologies such as fluorescent tags and HiBiT have been gradually introduced. In the future, more new high-throughput and high-sensitivity methods are needed for rapid and accurate assessment.Evaluation of druggability. In addition to the conventional evaluation indicators such as solubility, in vitro and in vivo activity, toxicity, and other drug-like properties. The role of PROTAC is to catalyze the cycle, so traditional methods cannot accurately assess the properties of PROTAC\u2019s PK and PD. For PROTAC molecules, there is a great need to develop PK/PD models that are more consistent with protein degradation as a new drug modality.How to better understand the degradation activity or degradability, selectivity, possible off-target effects, and pharmacological effects of PROTAC molecules . And how to correspondingly achieve differentiation in clinical treatment.The second is about biological activity evaluation. This involves the screening of PROTAC molecules, evaluation of druggability, and pharmacological evaluation.None of these discussed questions currently have ready-made answers, but we believe that as more and more research progresses, the whole field will be greatly advanced. With the development of more biological, pharmacological, and clinical research, new evaluation methods and systems will gradually be set up to solve these problems. It is believed that in the future, more and more PROTAC molecules will not only be used as tools for basic biological research but will also enter the clinic to solve the actual needs of patients."}
+{"text": "Photosynthesis is one the most important biological processes on earth, producing life-giving oxygen, and is the basis for a large variety of plant products. Measurable properties of photosynthesis provide information about its biophysical state, and in turn, the physiological conditions of a photoautotrophic organism. For instance, the chlorophyll fluorescence intensity of an intact photosystem is not constant as in the case of a single fluorescent dye in solution but shows temporal changes related to the quantum yield of the photosystem. Commercial photosystem analyzers already use the fluorescence kinetics characteristics of photosystems to infer the viability of organisms under investigation. Here, we provide a novel approach based on an optical Fabry\u2013P\u00e9rot microcavity that enables the readout of photosynthetic properties and activity for an individual cyanobacterium. This approach offers a completely new dimension of information, which would normally be lost due to averaging in ensemble measurements obtained from a large population of bacteria. Due to the importance of this process, and with the hope of replicating this process in organic solar cells, it is compelling to understand this process in its entirety. Although there is much already known, there are still unexplained phenomena in the photosynthetic process. One example is the energy transfer in photosystem 2 (PS2) from the absorption of a photon in the peripheral pigments to the reaction center, where the energy is used to split water. It is still not conclusively understood why the efficiency of this process is as high as 99% and whether this is related to non-trivial quantum optical effects [Photosynthesis by cyanobacteria is one of the most important processes on earth. It was responsible for the oxygenation of the Earth about 2.4 billion years ago, which enabled the subsequent development of multicellular life forms . Even tofrom CO2  that enaThe study of photosynthetic organisms by chlorophyll fluorescence kinetics has become an effective method for detecting even small changes in the photosynthetic process . Among o2 detectors, to determine the quantum yield in vivo. In order to capture the true photosynthetic efficiency of PS2, the experimental setup was designed as to minimize and eliminate residual phycobilisome (PBS) and photosystem 1 (PS1) fluorescence signals [To enable the very detailed analysis of the Kautsky effect, and thus, the photosynthetic efficiency at the single cell level, living cyanobacteria were placed in an optical Fabry\u2013P\u00e9rot microcavity, as in our earlier work . There,  signals . Our expSynechocccus elongatus strain PCC 7942 (S. elongatus), a widely used model organism for photosynthetic research [V) after dark adaptation as a function of the irradiation time with actinic light (photosynthesis activating light)  see A. The Kat 440 nm , the cart 440 nm , the PBSt 440 nm , and thet 680 nm   was most efficient and guaranteed almost exclusive fluorescence of chlorophyll a  and introduce three important parameters: minimum fluorescence (F0), maximum fluorescence intensity (FM), and terminal fluorescence (FT) [0  oxidized. This state can be achieved by 15 min of dark adaptation of the cyanobacterial cells [0, the variable fluorescence (FV) rises to the maximum fluorescence FM, since there is a temporal delay between the first absorption of a photon after dark adaptation and the start of the carbon reduction cycle. During the rise from F0 to FM, the electron acceptor QA becomes increasingly reduced [2) cannot be re-oxidized fast enough and excess energy is released via fluorescence. Therefore, FV reflects the redox state of QA. FM is only achieved when the actinic light intensity completely saturates all photosystems. In this case, all PS2 reaction centers are assumed to be in a closed state, and all associated QA are completely reduced. If the actinic light is not saturating, the peak intensity does not reflect the maximum possible fluorescence of the system. Here, it is important to ensure that FM is reached after a few milliseconds. To prevent the delay of FM, the experiments were carried out in the presence of 3--1,1-dimethylurea (DCMU). DCMU blocks the plastoquinone binding site (QB) and thereby prevents electron transport from QA to QB [A sites become completely reduced after the onset of actinic light  . Almost  (FT) [0 D. Since F0-level . To relial cells . After t reduced  and an eQA to QB . Consequic light . This prthe same C.0 and FM:The analysis of the FFK enables us to obtain precise information about the intactness and efficiency of PS2 . A good maxPS2 is a measure of the efficiency with which the excitation energy from the internal antenna pigments is used for photochemical reactions in the open P680 reaction centers [maxPS2 reflects, to a good approximation, the maximum relative electron transport efficiency [maxPS2 of about 0.83 can be expected [maxPS2 in cyanobacteria is not as straightforward as in plants, since additional antenna proteins, such as PBS, interfere with the measurement, distort the result and are the main reason for lower \u03a6maxPS2 yields [maxPS2 of around 0.8 can also be expected for S. elongatus [The current photochemical efficiency or quantum yield of PS2 \u03a6 centers . Experimficiency . In mostexpected . However2 yields . After clongatus ,30. M), measured after the objective lens was put in place but before the cover slip was, on which the cyanobacterium was placed. Only about half of the bacterium was illuminated by the diffraction limited excitation spot. In addition, to resolve the sudden fluorescence increase (F0) in the time domain, highly sensitive and fast-responding detectors must be used . Due to the low photon emission rate  objective lens. The large NA ensures that a large fraction of the photons emitted by the excited bacterium can be collected. At a laser power of 1.28 nW, a single bacterial cell emitted statistically only 60 photons per millisecond at the fluorescence maximum  was precisely focused on one bacterium. The cross-section of a bacterium was approximated by a 1 \u00d7 2 \u03bcm ellipse. As a guide for the optimal light intensity for the following experiments, we used the standard setting for commercial chlorophyll fluorescence curve analysis devices of approx. 3000 \u03bcmol photons \u00b7 s\u22121 \u00b7 m\u22122 , which it-test, p = 0.343). This indicates that the difference in the quantum yield cannot be attributed to unequal irradiation conditions. Under these conditions, a change in the quantum yield could therefore only be caused by the nature of the surrounding electromagnetic field. In order to test the lower limitation of the FFK in a single cell, the quantum yield of chlorotic cyanobacteria was recorded. The chlorosis of the cyanobacteria was induced by nitrogen starvation, which induces the degradation of photosynthetic pigments, in particular, those of the PCBs, whilst the bulk of the photosystems stays intact [As shown in s intact . As showAn advantage of the single-bacterium experiment over the classical population approach is that also the distribution of the quantum yields can be analyzed statistically and individually. The possibility of determining the quantum yield of a single bacterium allows one to investigate extreme examples (outliers) in more detail. In a population experiment, small-scale differences of individual cells would be averaged. An example in which a single-bacterium approach is advantageous for FFK analysis is a situation where the photosynthetic light conditions vary on a small spatial scale, which is the case in an electromagnetic Fabry\u2013P\u00e9rot microcavity. Here, each cyanobacterium experiences a different optical field. Fabry\u2013P\u00e9rot microcavities consist of two semitransparent mirrors  with an optical path length allowing resonances in the visible spectral range. Since the upper mirror is curved, the mirror spacing varies depending on the spatial location, which is why the individual cyanobacteria experience different electromagnetic fields. For analysis in the microcavity, the cyanobacteria were embedded in a BG-11 agarose matrix to restrict spatial drift [p = 1.52 \u00d7 10\u22124) microcavity, and between free space and the resonant (p = 7.54 \u00d7 10\u22128) microcavity  are used to filter the detected signal. Confocal images of the fluorescence intensity are acquired by a single photon avalanche diode (SPAD) . The SPAD is coupled with a TCSPC unit  for the acquisition of time-correlated fluorescence traces. Spectra are acquired with a spectrometer  with a thermoelectrically cooled CCD camera . With widefield illumination, videos or images can be recorded in real time. The scanning stage, the SPAD, the laser diode and the TCSPC unit are controlled by SymphoTime\u00ae software 64 . Fluorescence spectra are acquired with the software Winspec\u00ae . This software controls the monochromator and the corresponding CCD camera. A home-built confocal scanning microscope was used for the measurements in this work compare . The exc2 layer (20 nm) served as a coating layer, since silver is very susceptible to oxidation and damage and is bactericidal [The mirror preparation was achieved by evaporating a 3 nm chromium layer on a glass cover slip to ensure that the following layers adhere well. Next, the reflective silver layer with a thickness of 30 or 60 nm\u2014for the lower and upper mirrors, respectively\u2014was vapor-deposited. A gold layer (5 nm) and an SiOericidal . The strS. elongatus was measured with a Li-Cor Li-189 radiometer from Heinz Walz GmbH . The laser power was measured with an Optical Power Meter Model 1830-C and a Sensor Model 818-SL, both from Newport Corporation . The light intensity for the cultivation for Synechococcus elongatus PCC 7492 was cultivated under photoautotrophic conditions under continuous light with an intensity of around 30 \u03bcmol photons \u00b7 s\u22121 \u00b7 m\u22122 . The cultivation was performed in 50 mL BG11 medium [3 in 100 mL Erlenmeyer flasks at 28 \u00b0C and continuous shaking (120\u2013130 rpm). 1 medium  supplemeS. elongatus cells in BG11 were harvested by centrifugation at room temperature , the supernatant was discarded, and the cell pellet was washed twice with 50 mL NaNO3-free BG11-medium (BG11-0). After that, the cultures were cultivated in BG11-0 at light intensities of 50\u201360 \u03bcmol photons \u00b7 s\u22121 \u00b7 m\u22122 for 1 day.Nitrogen-starved, chlorotic cells were obtained as previously described  with sliS. elongatus suspension was embedded in a low-melting agarose matrix -1,1-dimethylurea (DCMU) solution. Then, 20 \u03bcL of a ith BG11  medium)"}
+{"text": "This cohort study investigates whether different rates of medical student placement into graduate medical education exist by sex, race and ethnicity, and socioeconomic status from 2018 to 2021. In this study, we examine the likelihood of GME placement by race and ethnicity, sex, and socioeconomic status.Between 2005 and 2015, American Indian or Alaska Native, Asian, Black, and Hispanic medical graduates were less likely to transition into graduate medical education (GME) compared with their White peers.We conducted a retrospective cohort study of 2014 to 2015 and 2015 to 2016 medical school matriculants who applied to residency from 2018 to 2021 using the Association of American Medical Colleges GME Track Resident Survey data. Sex and racial and ethnic identity were self-reported, and included: American Indian or Alaska Native, Asian, Black or African American, Hawaiian Native or Pacific Islander, Hispanic, Multiracial, and Unknown or Other. Underrepresented in medicine (URIM) students are students who identified as American Indian or Alaska Native, Black or African American, Hispanic, or Hawaiian Native or Pacific Islander alone or in combination with other racial and ethnic identities. Students with low income were defined as recipients of state and/or federal financial assistance or whose parental income was within the lowest 2 quintiles of households.2 test, with 2-sided P\u2009<\u2009.05 indicating significance. Multivariate logistic regression was used to model the associations of intersectional sex, race and ethnicity, and low-income identities with GME placement, adjusting for US Medical Licensing Exam (USMLE) Step 2 scores. This study followed the STROBE reporting guideline and was deemed exempt by the Yale institutional review board. Statistical analyses were performed using Stata version 16.1 (StataCorp).We compared placement rates across sex, race and ethnicity, and income using \u03c7Among 37\u2009485 students who applied to residency, 6387 (17.0%) identified as URIM, 18\u2009193 (48.5%) were female, and 8423 (23.9%) had low income; 1741 (4.6%) were not placed in GME . Black oMultivariate logistic regression of sex\u2013racial and ethnic identity with income showed that both low\u2013 and non\u2013low-income URIM male students and low-income URIM female students had the highest rates of unsuccessful placement , C. In oWe found that American Indian or Alaska Native, Black, Hawaiian Native or Pacific Islander, and Hispanic students had the highest unsuccessful GME placement rates, particularly URIM men and low-income URIM students. Low-income status seemed to only influence placement rates for URIM students.3 which may limit hiring opportunities for low-income URIM students. The racial and ethnic disparity in GME placement rates is consistent with prior research from the business sector, where applicants from minoritized racial and ethnic groups are less likely than White applicants to receive a call back from potential employers despite similar qualifications.4These findings suggest that there may be potential bias in the GME placement process against Asian men and URIM students, especially URIM students with low income. Structural components of residency application, such as honor society membership, have shown class and racial and ethnic disparitiesOur study is limited in that GME placement rates may vary across disaggregated racial and ethnic groups and low numbers of American Indian, Alaska Native, Hawaiian Native, and Pacific Islander students, as well as environmental factors . Examining placement rates across school characteristics, disaggregated racial and ethnic identities, and other marginalized identities , is critical to understand disparities in GME placement.1 the lower initial placement rate for URIM students may represent a previously undescribed minority tax requiring some students to prolong their time to independent practice, limiting their lifetime earnings potential, and restricting physician workforce diversity. Along with prior studies,6 this study suggests that URIM students with low income, and Black men in particular, experience attrition at multiple points during training. Potential interventions could include linking equity metrics, such as GME placement, to undergraduate and graduate medical education to establish greater transparency and accountability for outcomes concerning workforce diversity, equity, and inclusion.Although most students place into GME after repeated attempts,"}
+{"text": "Immunoassay for detailed analysis of immune\u2212cancer intercellular interactions can achieve more promising diagnosis and treatment strategies for cancers including nasopharyngeal cancer (NPC). In this study, we report a microfluidic live\u2212cell immunoassay integrated with a microtopographic environment to meet the rising demand for monitoring intercellular interactions in different tumor microenvironments. The developed assay allows: (1) coculture of immune cells and cancer cells on tunable (flat or micrograting) substrates, (2) simultaneous detection of different cytokines in a wide working range of 5\u20135000 pg/mL, and (3) investigation of migration behaviors of mono- and co-cultured cells on flat/grating platforms for revealing the topography-induced intercellular and cytokine responses. Cytokine monitoring was achieved on-chip by implementing a sensitive and selective microbead-based sandwich assay with an antibody on microbeads, target cytokines, and the matching fluorescent-conjugated detection antibody in an array of active peristaltic mixer-assisted cytokine detection microchambers. Moreover, this immunoassay requires a low sample volume down to 0.5 \u03bcL and short assay time (30 min) for on-chip cytokine quantifications. We validated the biocompatibility of the co-culture strategy between immune cells and NPC cells and compared the different immunological states of undifferentiated THP-1 monocytic cells or PMA-differentiated THP-1 macrophages co-culturing with NP460 and NPC43 on topographical and planar substrates, respectively. Hence, the integrated microfluidic platform provides an efficient, broad-range and precise on-chip cytokine detection approach, eliminates the manual sampling procedures and allows on-chip continuous cytokine monitoring without perturbing intercellular microenvironments on different topographical ECM substrates, which has the potential of providing clinical significance in early immune diagnosis, personalized immunotherapy, and precision medicine. Nasopharyngeal carcinoma (NPC) is a major health problem for the Southeastern Asian and North African populations ,2,3, whiThe enzyme-linked immunosorbent assay (ELISA) is widely used as a \u201cgold standard\u201d method for cytokine quantifications, which rely on repeated time-consuming sample incubation and washing procedures and cannot be applied for in-situ, real-time and multiplex cytokine profiling. Over the past few decades, microfluidic-based immunoassays have been developed for rapid analysis of cytokine secretion in complex fluidic bio-samples due to the significant advantages of microfluidics in fluid flow controlling and ultra-low reagent consumption ,11,12,13Herein, we report a microfluidic immunoassay device by integrating the cell culture region with microtopographic substrates and our previously reported cytokine dynamics profiling scheme ,26 by imThe reported microfluidic device a consistThe layout of the microfluidic device was designed with Adobe Illustrator CS6 software. Plastic photomasks for each layer were printed by Newway Photomask, Inc. for fabricating the molds. The mold of parallel micro-gratings  was fabricated by deep reactive ion etching with an AZ50XT positive photoresist  as the sacrificial layer. On the other hand, molds of the control layer and the flow layer were also fabricated by photolithography of SU\u22128 photoresist  on planar silicon wafers. Microchannel patterns of the flow layer mold were fabricated with AZ50XT with a height of 20 \u03bcm, reflowed at 120 \u00b0C for 1 min, while the microchambers and the filtering microstructure around the cell culture region (height: 30 \u03bcm) of the mold were aligned with the microchannel patterns and fabricated with an SU-8 2010 photoresist . All the molds were then silanized by trichloro  silane  for 12 h to facilitate the release of the molded PDMS layers in the later procedures.Afterwards, PDMS pre-polymer was prepared by mixing the base and the curing agent with a weight ratio of 10:1. The microfluidic device with multiple PDMS layers were fabricated by replica molding of PDMS from the molds using the multiplayer soft lithography as described in 2 environment. Additionally, the macrophages were derived from THP\u22121 cells before experiments. THP\u22121 cells with a density of 1 \u00d7 106 cells/mL was treated with 50 ng/mL of phorbol 12-myristate 13-acetate [A human monocytic cell line  was cultured in a complete RPMI-1640 culture medium supplemented with 10% fetal bovine serum and 1% penicillin. An immortal human nasopharyngeal epithelial cell line (NP 460) and a nasopharyngeal carcinoma cell line (NPC 43) were developed and donated by the research team of S. W. Tsao, from cell extracts of nasopharyngeal cancer patients . NP 460 -acetate   conditions for cell culture , with p < 0.05 considered as statistically significant.All experiments were conducted with at least four independent experiments. The We have developed an integrated microfluidic immunoassay device, which can implement in-situ and multiplex monitoring of time-lapsed cytokine secretions in an extracellular matrix (ECM) protein-coated topologic environment. This device consists of three main components: a cell culture chamber with parallel microgratings, cytokine detection arrays (four rows and four columns) and an array of active peristaltic mixers a,b. The 2 to facilitate immune cells secreting cytokines in response to target cells. Simultaneously, the detection microbeads were loaded into the bypass channel aside the cytokine detection chamber by opening the corresponding control valves for defining the access from the \u2018Microbeads\u2019 inlet   into thes\u2019 inlet b to the s\u2019 inlet b.2 > 0.9 was observed between fluorescence intensity (488 nm) and molecular concentrations for each cytokine type. The limit of detection was calculated as ~5 pg/mL for both cytokines based on the concentration, giving a signal equal to the blank signal (Y0) plus three standard deviations of the blank (3\u03c3), or 4 pg/mL for TNF and 3 pg/mL for IL12p70 based on 3\u03c3/S, where S is the slope of the calibration curve.To obtain the calibration curves for the selected cytokines, different concentrations  of each cytokine were prepared by standard PBS dilution of the stocking cytokine solution (5 ng/mL). Linear regression with R5 cells/mL. For instance, a stained NPC43 pseudopod attaching on a micro-grating can be captured as shown in To verify cell viability in the culture chamber, we applied live/dead-cell staining  to the immune cells (THP-1 cells and differentiated macrophages) and nasopharyngeal cells (NP460 and NPC43) growing in the culture chamber at a cell density of 1 \u00d7 105 cells/mL and incubated for 8 h before the cytokine quantification. In brief, our results show that the unstimulated macrophages can secrete a measurable level of IL-12-p70 (65 pg/mL); whereas relatively larger portions of TNF can be contributed from macrophages (80 pg/mL) and NPC43 cells (62 pg/mL). Such measurements of the single cell-type cultures can determine the baselines of the cytokine levels for the immune-nasopharyngeal cell cocultures.Additionally, we have also measured the cytokine secretion levels (TNF and IL-12p70) of the single cell-type cultures as summarized in 5 cells/mL) and nasopharyngeal cells (1 \u00d7 105 cells/mL) were cocultured in the culture chamber, with either undifferentiated THP-1 cells or differentiated macrophages applied as the immune cells, and either EBV-positive nasopharyngeal carcinoma (NPC43) cells or EBV-negative nasopharyngeal (NP460) cells applied as the nasopharyngeal cells. Macrophage cells were differentiated from the THP-1 cells by PMA with a concentration of 50 ng/mL for 24 h before the measurements. The cytokine measurements of TNF and IL-12-p70 were performed prior to the culture and at 3, 4, 5, 6, 7 and 8 h of culture. The first three hours of culture could offer a stable environment for cell adaptation.In the measurements of the cytokine dynamics, immune cells . The TNF secretions of the cell cocultures on microgratings have an increment of ~20% on average, compared to the cells on flat surfaces, implicating an underlying mechanism related to the microtopographic factors a. NevertFor the IL-12p70 measurements, it is noteworthy that a distinct secretion profile of IL-12p70 was observed compared to that of TNF b. ThoughThese results reveal some insightful observations. Interestingly, the macrophage-NPC43 cocultures exhibit suppressed IL-12p70 expressions after 6 h of coculture, implicating an underlying related mechanism between macrophages and nasopharyngeal cancer cells. This agrees with previous clinical studies that nasopharyngeal carcinoma patients have a reduced level of IL-12p70 in their serum . This in2 cells/cm2 and each of the co-cultured cells at a density of 2.5 \u00d7 102 cells/cm2, followed by culturing the cells for 8 h and monitoring their migration under a microscope. Migration trajectories of NP460 and NPC43 cells growing on the planar/microgratings substrates  are shown in We further investigated the migration behaviors of NP460 and NPC43 single cell co-cultured with or without THP-1 derived macrophages on grating platforms. We seeded NP460/MPC43 cells at a density of 5 \u00d7 10Our results b furtherThere are several limitations in the current study. For instance, the effects of interference components such as cell debris in detection samples would be eliminated by integrating a porous membrane filter  for sampIn conclusion, we have reported a multifunctional microfluidic immunoassay by integrating microtopographic cell-culture substrates with a microbeads-based immunofluorescence assay that enables parallel detection of different immune biomarkers and intercellular behaviors in a rapid, sensitive, and easy-to-implement manner. The developed assay exhibits the advantages of the simultaneous investigation of different cytokines and cell migration behaviors on flat/grating ECM substrates, requiring a low-volume sample (0.5 \u03bcL) and short assay time (30 min) but a sensitive performance in a wide range of cytokine concentrations (5\u20135000 pg/mL). Secretions of TNF and IL-12p70 were successfully monitored throughout the co-culture period to evaluate the different immunological states of undifferentiated THP-1 monocytic cells or PMA-differentiated THP-1 macrophages co-cultured with immortal cells NP460/NPC43 on flat and micrograting surfaces. We believe that the reported immunoassay is a promising approach to allow continuous, broad-range and precise on-chip characterization of cytokine and intercellular interactions on different topographical substrates, and thus provides clinical significance for early tumor diagnosis and treatment."}
+{"text": "Natural menopause is an inevitable biological process with significant implications for women's health. However, the molecular mechanisms underlying menopause are not well understood. This study aimed to investigate the molecular and cellular changes occurring in the ovary before and after perimenopause.Single-cell sequencing data from the GTEx V8 cohort  and transcriptome sequencing data from ovarian tissue were analyzed. Seurat was used for single-cell sequencing data analysis, while harmony was employed for data integration. Cell differentiation trajectories were inferred using CytoTrace. CIBERSORTX assessed cell infiltration scores in ovarian tissue. WGCNA evaluated co-expression network characteristics in pre- and post-perimenopausal ovarian tissue. Functional enrichment analysis of co-expression modules was conducted using ClusterprofileR and Metascape. DESeq2 performed differential expression analysis. Master regulator analysis and signaling pathway activity analysis were carried out using MsViper and Progeny, respectively. Machine learning models were constructed using Orange3.We identified the differentiation trajectory of follicular cells in the ovary as ARID5B+ Granulosa -> JUN+ Granulosa -> KRT18+ Granulosa -> MT-CO2+ Granulosa -> GSTA1+ Granulosa -> HMGB1+ Granulosa. Genes driving Granulosa differentiation, including RBP1, TMSB10, SERPINE2, and TMSB4X, were enriched in ATP-dependent activity regulation pathways. Genes involved in maintaining the Granulosa state, such as DCN, ARID5B, EIF1, and HSP90AB1, were enriched in the response to unfolded protein and chaperone-mediated protein complex assembly pathways. Increased contents of terminally differentiated HMGB1+ Granulosa and GSTA1+ Granulosa were observed in the ovaries of individuals aged 50-69. Signaling pathway activity analysis indicated a gradual decrease in TGFb and MAPK pathway activity with menopause progression, while p53 pathway activity increased. Master regulator analysis revealed significant activation of transcription factors FOXR1, OTX2, MYBL2, HNF1A, and FOXN4 in the 30-39 age group, and GLI1, SMAD1, SMAD7, APP, and EGR1 in the 40-49 age group. Additionally, a diagnostic model based on 16 transcription factors (Logistic Regression L2) achieved reliable performance in determining ovarian status before and after perimenopause.This study provides insights into the molecular and cellular mechanisms underlying natural menopause in the ovary. The findings contribute to our understanding of perimenopausal changes and offer a foundation for health management strategies for women during this transition. Population aging is a definite trend of global population change . For womMenopause is generally referred to as perimenopausal syndrome, a group of syndromes in which women experience fluctuations or decreases in sex hormones around the time of menopause, mainly due to dysfunction of the autonomic nervous system, accompanied by neuropsychological symptoms , 6. NatuIn this study, we used the transcriptome database of female ovarian tissues from the GTEx V8 database , combineAll samples involved in this study were obtained from ovarian tissue samples in the GTEx V8 dataset. Clinical information for the samples is in Appendix. We screened out the age groups before and after perimenopause, and obtained 14 samples in the 30-39 age group, 37 samples in the 40-49 age group and 61 samples in the 50-59 age group. The single-cell sequencing data were derived from the GSE118127  cohort, Seurat4.1  was usedp-value measuring the confidence of the results for the deconvolution. Samples with P < 0.05 were included in a further study.We prepared and uploaded the mixture datasets of 112 ovary transcriptome sequencing data according to the instructions with CIBERSORTx , 23. TheWGCNA  was usedDESeq2  was usedMsviper  was usedPROGENy  is a resTranscription factor activity matrices inferred using viper were used to construct a three-category diagnostic model. Orange3  is used R 4.10 was used to perform statistical analyses. the R package ggpubr  was usedThe GSE118127 cohort contains single-cell sequencing data from 36 normal ovarian tissues. Through the Seurat standard process (SCTransform+harmony), 24 clusters were obtained  times, and screened 16 transcription factors with weights greater than 0.2 from them for subsequent model construction  using WGCNA. We found that the megena module associated with the 40-49 age group was significantly enriched in mv Endothelial cells and was mainly involved in the inflammation-related signaling pathway . It indicates the beginning of inflammatory apoptosis of the blood vessels of the ovaries at this age. The perimenopausal syndrome in women mainly occurs at this stage. In addition, we found that the salmon module associated with the 30-39 age group was significantly enriched in HMGB1+ Granulosa, mainly involved in the Cell Cycle signaling pathway. It suggests a rapid proliferation rate of HMGB1+ Granulosa in the 30-39 age group. This was not the case in other age groups. To gain insight into the process of gene expression regulation changes in the ovary before and after perimenopause, we first compared gene expression differences and differences in master regulators between the 40-49 age group and the 30-39 age group. We found that inflammation-related signaling pathways in the 30-39 age group were mainly activated in T cells, Monocytes and B cells, while the Cell cycle was mainly activated in HMGB1+ Granulosa. This result is consistent with our previous analysis . DilatedFinally, we constructed diagnostic models for determining ovarian status before and after perimenopause. We found 16 markers of transcription factor activity that could be used to diagnose ovarian status. We found that our Logistic Regression L2 model obtained a mean AUC=0.82, F1 = 0.66 in the training set . In the validation set, we obtained a mean AUC=0.84, F1 = 0.51. This model can be used to determine the ovarian status of women around perimenopause.This study has limitations. We attempted to define pre- and post-perimenopause in terms of age by dividing the sample into three groups. This stratification assumes a relationship between hormonal status and age, however there is still no well-established method for measuring hormonal status in humans . TherefoIn conclusion, we have used single-cell sequencing data from ovarian tissue and transcriptome sequencing data to deeply explore the cellular biology and molecular biology of the female ovary before and after perimenopause. These results will help us to better understand the molecular mechanisms underlying perimenopausal syndrome in human women and provide a theoretical basis for the development of perimenopausal care protocols. The results of these studies still need to be corroborated by more clinical data.The original contributions presented in the study are included in the article/QL: Methodology, Software, Validation, Formal analysis, Investigation, Writing-Original Draft, Data Curation, Supervision. ZY: Writing- Review and Editing, Visualization, Supervision, Methodology. FW: Writing- Review and Editing, Formal analysis, Investigation, Methodology. JW: Software, Validation. HL: Writing- Review and Editing, Formal analysis. HZ: Conceptualization, Project administration. ML: Visualization, Methodology. KL: Software, Validation. All authors contributed to the article and approved the submitted version."}
+{"text": "With the increasing deployment of autonomous taxis in different cities around the world, recent studies have stressed the importance of developing new methods, models and tools for intuitive human\u2013autonomous taxis interactions (HATIs). Street hailing is one example, where passengers would hail an autonomous taxi by simply waving a hand, exactly like they do for manned taxis. However, automated taxi street-hailing recognition has been explored to a very limited extent. In order to address this gap, in this paper, we propose a new method for the detection of taxi street hailing based on computer vision techniques. Our method is inspired by a quantitative study that we conducted with 50 experienced taxi drivers in the city of Tunis (Tunisia) in order to understand how they recognize street-hailing cases. Based on the interviews with taxi drivers, we distinguish between explicit and implicit street-hailing cases. Given a traffic scene, explicit street hailing is detected using three elements of visual information: the hailing gesture, the person\u2019s relative position to the road and the person\u2019s head orientation. Any person who is standing close to the road, looking towards the taxi and making a hailing gesture is automatically recognized as a taxi-hailing passenger. If some elements of the visual information are not detected, we use contextual information  in order to evaluate the existence of implicit street-hailing cases. For example, a person who is standing on the roadside in the heat, looking towards the taxi but not waving his hand is still considered a potential passenger. Hence, the new method that we propose integrates both visual and contextual information in a computer-vision pipeline that we designed to detect taxi street-hailing cases from video streams collected by capturing devices mounted on moving taxis. We tested our pipeline using a dataset that we collected with a taxi on the roads of Tunis. Considering both explicit and implicit hailing scenarios, our method yields satisfactory results in relatively realistic settings, with an accuracy of 80%, a precision of 84% and a recall of 84%. Despite the uncertainty regarding their ability to deal with all real-world challenges, autonomous vehicle (AV) technologies have been receiving a lot of interest from industry, governmental authorities and academia . AutonomThese research findings show that scientists from different disciplines need to join their efforts to propose human\u2013autonomous taxi interaction (HATI) models, frameworks and technologies that allow for developing efficient and intuitive solutions for the different service stages. In this paper, we address the case of one service stage that has been explored to a very limited extent, which is street hailing. The current state of the art reveals that only two works have studied taxi street hailing from an interaction perspective. The first work is the study of Anderson , a socioApart from the work proposed in , our revThe paper is structured as follows. In The state of the art on taxi street-hailing detection using computer vision techniques revealed the existence of only one work proposed by , which rSince its introduction by W. Myron in 1991 , gestureFrom a technological perspective, a lot of research work has been conducted on the recognition of body gestures from video data using computer-vision techniques. Skeleton-based recognition is one of the most widely used techniques , both foThe ability of autonomous vehicles to detect pedestrians\u2019 road-crossing intentions is crucial for their safety. Approaches of pedestrian intention detection can be categorized into two major categories. The first category formalizes intention detection as a trajectory prediction problem. The second category considers pedestrian intention as a binary decision problem.Several models and architectures have been developed and deployed, aiming at achieving a high-accuracy prediction of pedestrian intention using a binary classification approach. Unlike other methods, binary classification utilizes different tools and techniques depending on the data source and the data characteristics and features. For instance, the models based on RGB input use either 2D or 3D convolutions. In 2D convolution, a sliding filter is used along the height and width, and in 3D settings, the filter slides along the height, width and temporal depth. Using 2D convolutional networks, the information is propagated across time either via LSTMs or feature aggregation over time . For insOther methods that use the skeletal data extracted from the frames have been proposed. These methods directly operate on the skeleton of the pedestrians. The main advantage of these methods is that the data dimensions are significantly reduced. The yielded models are therefore less prone to overfitting . RecentlThe topic of recognizing taxi street hailing has been studied by sociologists in order to explore how taxi drivers perceive and culturally interact with their environment, including passengers . An inteBoth works stressed that passengers need to use explicit gestures in order to communicate their desire to ride a taxi to the drivers. The explicit gestures may vary according to the proximity between the passengers and the taxis, as well as according to the cultural background, but hand waving remains the most common hailing gesture. Nevertheless, in many real cases, and for different reasons, passengers may not be able to make explicit distinctive gestures. For example, a person who is standing on the curb of the street, holding bags in both hands and looking towards vehicles could be a potential taxi hailer. This could be confirmed by real-life observations of several cases, where vacant taxi drivers slow down after perceiving pedestrians standing/walking on the roadside, even though these pedestrians did not make any explicit hailing gestures. This is simply because taxi drivers consider these pedestrians to be potential street-hailing passengers, and they slow down to confirm or dispel their intuition. Consequently, there is a need to propose a method that can detect both explicit and implicit taxi street-hailing behavior from traffic scenes. For this purpose, we propose to combine both visual and contextual information in one computer-vision-based approach. To the best of our knowledge, the integration of visual and contextual information for the detection of both explicit and implicit street-hailing behavior has not been the main subject of any previous research work.One of the main concerns that motivated our work is how taxi drivers recognize a street hailing. To address this, we designed a survey that we used to interview a group of 50 experienced taxi drivers in the city of Tunis, the capital of Tunisia. Our initial results showed that, in general, taxi drivers use two types of information, visual and contextual information, respectively.The visual information refers to the aspects that a taxi driver can visually verify to recognize any explicit taxi street-hailing scene while he is cruising the road network. All taxi drivers agreed that an obvious street-hailing scene is composed of a person who is standing on the roadside, looking towards the taxi and waving with his/her hand. Consequently, we decomposed the visual information of a street-hailing scene into three elements: (1) the presence of the hailing gesture, (2) the position of the person relative to the road, and (3) the orientation of the person\u2019s head . The comIn case all three visual information elements are present, the scene is automatically interpreted as an explicit street-hailing case, and there is no need to check other types of information. However, if one of the three visual information elements is not detected, there is a need to evaluate other pieces of information  in order to evaluate the presence of street hailing. We collectively refer to these non-visual pieces of information as contextual information.Contextual information corresponds to a kind of external knowledge  that taxi drivers often use to recognize implicit street-hailing scenes, i.e., cases where passengers do not use explicit hailing gestures. In order to identify the list of potential contextual information elements, we started by reviewing related works that studied the strategies used by taxi drivers to search for potential passengers ,42,43,44Based on our survey, we concluded that taxi drivers recognize street hailing using both visual and contextual information according to a two-step reasoning process. In the first step, they evaluate the existence of the three elements of the visual information, i.e., the hailing gesture, the person\u2019s relative position to the road and the head orientation. If the three elements are present, an explicit street-hailing case is automatically detected, and there is no need to use further information. However, if one or more elements of the visual information is/are not confirmed, a second step is required, which consists of evaluating elements of contextual information to have better judgment. In case enough elements of contextual information are detected, an implicit street-hailing case is detected; otherwise, no street hailing is recognized.In this paper, we propose to implement a computer-vision-based pipeline for taxi street-hailing detection that mimics the two-step reasoning process used by taxi drivers. We believe that it is important to consider both explicit and implicit street-hailing cases. Explicit cases can be relatively well described using the three elements of information that we identified. Implicit cases are more challenging to detect, and we believe that the use of contextual information could be helpful. This could accommodate real situations, where passengers are not able to make explicit hailing gestures (for any reason) but still desire to hail a taxi. In the next section, we present our proposed computer-vision-based method for the detection of both explicit and implicit taxi street-hailing cases.In this section, we present the new method that we propose to recognize street-hailing cases from video sequences. The method comprises three stages. The first stage consists of detecting the objects of interest (persons and road segments) from the sequences. The second stage consists of detecting the visual information components presented in the previous section, i.e., the hailing gesture, the position of the detected person(s) relative to the road, and the orientation of the potential passengers\u2019 heads. The third stage consists of the integration of the contextual information, if needed, in order to have a final decision about whether street hailing is detected or not.The first stage consists of detecting the persons and the road segments from the video data, and is implemented as a neural network architecture  that takIn the following, we present each architectural choice of the proposed method TSP-RCNN and we explain how we adapt it to our requirements.Elharrous and his team  presenteThe proposed method is based on TSP-RCNN , which uAfter extracting the persons and road segments in the first stage, the second stage consists of extracting the person\u2019s position estimation, head direction, and hailing gesture detection from consecutive frames.In general, a person\u2019s relative position estimation is not trivial. However, after the extraction of the persons and road segments in the first stage, we can estimate if a detected person is located on the side of the road, on the road, or away from both.K be a set of n keypoints of a given person, where w and height h  of the detected road, where Let us consider The detected person isWe assume that a person who is looking for a taxi should be very close to the road. Consequently, we interpret a detected person as a potential street hailer if they are not very far from the road.K being the set of n keypoints of a given person defined in A, B and C respectively correspond to the left eye, right eye, and nose if detected, and otherwise to the right shoulder, the left shoulder, and head if detected.Let us consider the set The head direction is a vector t has any corresponding elements in the frame Let us recall that the input of our method is a video sequence composed of a set of frames. Hailing is a dynamic scene in which the same person is performing waving gestures over a consecutive set of frames. Consequently, before we detect the waving gesture, we need to track the identical person(s) over the sequence of frames using object-tracking techniques. In our method, we implemented object tracking by simply checking if a person To detect the hailing gesture, we analyzed multiple videos of a person performing hand-hailing movements. After running several hailing examples, we noticed that the following four key points can disguise the specific hand movement: shoulder, elbow, wrist, and hip.Let A, B, C, and D be the key points for the shoulder, elbow, wrist, and hip, which respectively correspond to key points numbers 2, 3, 4, and 8 in We define \u2013\u2013\u2013We define Finally, we proposed a key points angle approach defined as follows:Following this strategy, we then measure the two angles in each frame of a clip of a hailing person twice, one for his right hand and the other for his left hand.As we can see, the hailing movement is very clear after applying smoothness to the variation of the angles. In the left side of In this section, we explain how street-hailing cases are detected based on a scoring scheme that integrates the extracted visual information with the contextual information.(1)Elements of the explicit street hailing are evaluated first, and if they are all detected, a street-hailing case is recognized.(2)If one or more elements of the visual information is/are not detected, contextual information is used in order to evaluate the existence of implicit street hailing.As we explained in The decision flow is implemented using the following scoring scheme relying on two main components: visual and contextual information.Visual information:\u2013Hailing gesture is scored as \u2013The score of the standing position is \u2013The score of the head direction is The three components of the visual information are scored as follows:The variables \u2013Spatiotemporal information: \u2013Meteorological information: \u2013Event information: Contextual information:\u2013The maximum score is 100 points.\u2013If the visual information reaches \u2013Otherwise, the contextual information is used as a percentage of the difference between 100 and the visual information points, e.g., if the visual information is 60 points and the contextual information is 50 points, the score is The scoring system works as follows:We implemented the proposed method using the PyTorch deep learning library, OpenCV computer vision library, and Numpy. Python was selected because it is suitable for deep learning and computer vision tasks, is supported in multiple platforms and is capable of handling real-time computer vision tasks.For the training part, we used the Common Object in Context (COCO) dataset , a largeFor the test dataset, we opted to mix (1) the previously presented COCO dataset, excluding the part we used for the training, and (2) a set of images that we filmed by ourselves on the roads of Tunis city, Tunisia.We mounted a Go-Pro Hero 10 camera on the front glass of a probe taxi, on the passenger side facing the road and the sidewalk at the same time to capture pedestrians and roads, as shown in The data collection trips were tracked using a GPS-tracking mobile application, so all the collected video sequences are time- and GPS stamped b. The GPFinally, we filtered the collected data, and we selected only the best clips from the recorded videos. We obtained about 3 h of good-quality clips that we used as a test dataset. More data are being collected to build a complete dataset that can be used for training, validation, and testing.For the training parameters, we used the same training process for the proposed TSP-RCNN method since it is our base model.As mentioned in Unlike the multi-task end-to-end networks, e.g., HybridNets  and YOLOFollowing TSP-RCNN, we used AdamW to optimize the transformer, and SGD with a momentum of 0.9 to optimize the other parts with a 3\u00d7 scheduler.As evaluation metrics, we used the average precision (AP) and recall IoU (%) as primary metrics and FLOPs for the number of computations. All are provided by Detectron2.In order to evaluate the performance of the detection of objects of interest, we followed the same training protocol used in the TSP-RCNN model, which is described in , and we Accuracy: It measures the overall correctness of the model\u2019s predictions and is defined by the following:Precision: It measures the proportion of positive predictions that are correct, and is defined byRecall : It measures the proportion of actual positive cases that were correctly identified by the model. It is defined bySpecificity: It measures the proportion of actual negative cases that were correctly identified by the model. It is defined by the ratioTo evaluate the performance of our proposed method for street taxi-hailing detection, we calculated the accuracy, precision, recall and specificity metrics based on the calculated values of true positive (TP), true negative (TN), false positive (FP), and false negative (FN) rates, as follows:With respect to the results of this training process, we tackled only the accuracy of the bounding boxes at the end of the transformer encoder since we are using pre-trained head keypoints. As illustrated in Lastly, In our proposed architecture, we used an unsupervised method for the detection of street hailing, which does not require a training process. However, given that we used a dataset that we collected as a test set, we evaluated the performance of the overall street-hailing detection process (including both explicit and implicit) using true positive (TP), true negative (TN), false negative (FN) and false positive (FN) metrics. Once a street-hailing detection was carried out, we evaluated the ability of the proposed method to discern the type of hailing (explicit or implicit). In this case, we used only the false negative and true positive metrics since the existence of a street-hailing action was already confirmed. In the following examples, we depict four scenarios corresponding to explicit street hailing, implicit street hailing, no street hailing, and undetected street hailing, respectively. Each of these examples illustrates qualitatively the performance of the proposed method in various contexts.In These visualizations show a simultaneous peak a in the In the example illustrated in In the example illustrated in As we previously mentioned, taxi street hailing has been explored to a very limited extent in the state of the art. To the best of our knowledge, the only automated solution for taxi street-hailing recognition is the computer-vision-based approach proposed in  to detecIn this paper, we proposed a new method for street-hailing detection based on computer-vision techniques augmented with contextual information. Besides the originality of its deep-learning-based pipeline, our method allows for the detection of both explicit and implicit street-hailing scenes by the integration of visual and contextual information in a logic flow based on a defined scoring scheme. The design of the pipeline was inspired by the feedback collected from 50 experienced taxi drivers that we interviewed in order to understand the intuitive way of identifying prospect street-hailing passengers. We experimentally studied our proposed method using a dataset of urban road video scenes that we collected from a real taxi in the city of Tunis, Tunisia. The study showed that the proposed method achieves satisfactory results with respect to the detection of explicit and implicit street-hailing cases.Nevertheless, there is still room for future improvement. First, we are currently working on further developing the concept of context. A formal definition of the context is required in order to better model, represent and use contextual information for the detection of both explicit and implicit street-hailing behaviors. Second, the context is also fundamental for the implementation of a more extended street-hailing service stage as a social interaction between Robotaxis and passengers. As we mentioned earlier, hailing recognition is only one part of the hailing interaction, and there is a gap in the state-of-the-art of human\u2013autonomous taxi interaction (HATI) with respect to this aspect. Third, we are collecting more data in order to build a complete dataset dedicated to taxi street-hailing scenes in urban environments that we will use to test and improve the performance of our approach. The dataset will be used to automatically learn the weights of the parameters of the scoring scheme from the real data and shall also exhibit more complex hailing behaviors, as well as monitoring settings, such as different weather, lighting and crowd/traffic conditions."}
+{"text": "Institutional objection (IO) occurs when institutions providing health care claimobjector status and refuse to provide legally permissible health services suchas abortion. IO may be regulated by sources including law, ethical codes andpolicies . We conducted amixed-methods narrative review of the empirical evidence exploring IO toabortion provision globally, to inform areas for further research. MEDLINE(Ovid), Embase (Ovid), CINAHL (EBSCO), Global Health (CAB Abstracts),ScienceDirect and Scopus were searched in August 2021 using keywords including\u2018conscientious objection\u2019, \u2018faith-based organizations\u2019, \u2018religious hospitals\u2019and \u2018abortion\u2019. Eligible research focused on clinicians\u2019 attitudes andexperiences of IO to abortion. The 28 studies included in the review were fromnine countries: United States (19), Chile (2), Turkey (1), Argentina (1),Australia (1), Colombia (1), Ghana (1), Poland (1) and South Africa (1). Theanalysis demonstrated that IO was claimed in a range of countries, despitedifferent legislative and policy frameworks. There was strong evidence from theUnited States that clinicians in religious healthcare institutions were lesslikely to provide abortions and abortion referrals, and that training of futureabortion providers was negatively affected by IO. Qualitative evidence fromother countries showed that IO was claimed by secular as well as religiousinstitutions, and individual conscientious objection could be used as amechanism for imposing IO. Further research is needed to explore whether IO ismorally justified, how decisions are made to claim IO, and on what grounds.Finally, appropriate models for regulating IO are needed to ensure theprotection of women\u2019s access to abortion. Such models could be informed by thoseused to regulate IO in other contexts, such as voluntary assisted dying. For example, a hospital mayrefuse to provide abortions because it does not have adequate numbers of trainedstaff, or lacks the facilities required to provide the care safely.7 However, inthis article, we focus on hospitals holding an IO to providing abortionservices.Institutional objection (IO) occurs when institutions providing health care claimobjector status and refuse to provide legally-permissible care, such asabortion.9 Some philosophers argue thathospitals are physical buildings and therefore cannot be autonomous moralagents.9 They contend that recognizing institutional conscience erodesthe protection of the individual consciences of those employees whose moral stancediffers from the institution.9 In contrast, other philosophershave argued that corporations  can be morallyresponsible agents which have moral identities and consciences.11The claim that hospitals, rather than individuals, have and can exercise a conscienceis contested.2 Institutions delivering healthcare have general obligations to protect their patients from harm, to promote theirhealth and respect their autonomy.2 Thus, when pregnant peopleexperience complications that may chance or require termination of a pregnancy , objectinginstitutions have ethical obligations to explain all relevant clinical options(including those they do not offer) and, time-permitting, offer a transfer to anonobjecting institution.2 Further to this, when time does not permit a transfer, andwithholding emergency treatment would expose the patient to an excessive increasedrisk of harm, the institution has an obligation to offer the treatment.2 However,evidence suggests the management of these obligations varies in practice.13Even if institutions have an interest in protecting their moral integrity andidentity, this is subject to limits.14 There is also evidence of \u2018unwritten\u2019 policies regulatingIO to abortion, for example, hospital directors refusing to allow their staff toperform abortions.15 Ethical codes/directives also exist that have a regulatoryinfluence across multiple health institutions. For example, Catholic policies anddirectives often seek to ensure that health care is delivered in a manner whichaccords with the Catholic ethos including respect for unborn human life.17 This isreflected in the Ethical and Religious Directives for Catholic Health CareServices (ERD) which prohibits the provision of abortion on request inUS hospitals. It also bans health employees from taking \u2018direct action\u2019 against theembryo in ectopic pregnancy management.16 For pregnancy complications,a treatment that may endanger the foetus is only permitted when risks to the woman\u2019shealth or life are comparable to the risks posed to the foetus, and when harm to thefoetus is not the intended goal of the treatment.16Regulation of IO can take many forms. Regulation may include law which often hasstrong coercive force, but also comparatively weaker forms of regulation such aspolicies  and ethicalcodes/directives.18 Although the study showedwomen were less likely to expect an abortion for foetal indications from a Catholicthan a non-Catholic hospital, women in the lowest income group were less likely toidentify a hospital as Catholic.19 Another study, consisting ofa convenience sample of 236 reproductive-aged women, showed that participantsexpected obstetricians and gynaecologists (OBGYN) to provide family planningservices, including abortion, regardless of institutional affiliation.20 Together,these findings suggest that in the United States, IO is not widely understood orsupported by women.Research from the United States has shown that women generally do not necessarilyanticipate or support differences between Catholic and non-Catholic hospitals withrespect to the provision of reproductive services (including abortion andmiscarriage management). A nationally-representative survey of 2857 womendemonstrated that most women did not support allowing hospitals to restrictreproductive care on the basis of religion.21 The review included any typeof family planning service, management of miscarriage or ectopic pregnancy, andinfertility management. The authors concluded that little is known aboutreproductive health outcomes in Catholic facilities, which is particularlyconcerning given their prevalence in the US health system.Evidence about the impact of IO on patient outcomes is limited. A recent scopingreview examined reproductive health care provision and patient outcomes in Catholichealth facilities in the United States.22 have argued that the consequences of IO may be worse forabortion access than individual CO. They suggest IO may reduce the pool of abortionproviders because otherwise willing health practitioners are unable to provideabortions within some religious hospitals  due totheir institution\u2019s position. They also assert IO may result in women seekingabortions having to travel further and pay more for the procedure, furtherdisadvantaging those from marginalized populations. Women may also require morecomplex and risky abortion procedures at a later gestational stage if their accessis delayed.23 Furthermore,the training of future health providers may be limited if IO results in lessabortion training.22 While empirical research on individual CO isgrowing,25 IO has been less studied.22Fiala and ArthurTo date, a formal literature review of existing global empirical evidence on IO toabortion has not been conducted. This mixed-methods narrative review aims to fillthat gap by critically examining the empirical research about IO to abortion. Wesought to understand the following:In which countries is IO being claimed?Which types of hospitals claim IO?How are decisions made about claiming an IO?How is IO regulated in different countries?26 Given theauthorship team comprised international experts across women\u2019s health, healthsociology, ethics and law, such scope was warranted. In addition, the evidencefor IO was sparse (except in the United States), therefore more flexibility inthe literature searching was required.27We conducted a mixed-methods narrative review of qualitative, quantitative andmixed methods studies exploring IO to abortion. We chose a narrative rather thana systematic review because a narrative review is less methods-driven allowingmore scope for interpretation and critique of the evidence.Initial database searches of MEDLINE (Ovid), Embase (Ovid), CINAHL (EBSCO),Global Health (CAB Abstracts), ScienceDirect and Scopus were conducted in August2021 using keywords including \u2018conscientious objection\u2019, \u2018abortion\u2019 and\u2018termination\u2019. These searches identified many studies on conscientiousobjection; however, reference list searches of included references showed thatthe search was not identifying more detailed literature about IO. Thus, afurther database search was conducted, also in August 2021, using keywords suchas \u2018faith-based organizations\u2019, \u2018religious hospitals\u2019 and \u2018abortion\u2019. Forpragmatic reasons, the search was limited to English language articles only, andpublication from January 2000 to August 2021.Studies were selected for eligibility based on the inclusion and exclusioncriteria shown in The reference lists of included studies as well as relevant systematic orliterature reviews were also checked for eligible references.Following the selection of the included studies, study details  and legal context  were extracted and summarized. The studies were thencategorized according to country/region given the legal context of abortion andregulation of IO varied. The findings of individual studies and authors\u2019interpretations relevant to IO were then extracted and analysed using thematicanalysis. Where appropriate, methods were critiqued.After the removal of duplicates, database searches yielded a total of 1100references. After title and abstract screening, 68 articles remained forfull-text screening. Of those, 28 met the inclusion criteria. Included studieswere from nine countries: United States (19), Chile (2), Turkey (1), Argentina(1), Australia (1), Colombia (1), Ghana (1), Poland (1) and South Africa (1).Each of the studies is analysed below, grouped geographically.2831 Thestudies were conducted in the context of Catholic hospitals increasing theirmarket share of health services and concerns about how this may restrictaccess to reproductive health care.32 Using a mysterycaller approach, researchers (acting as patients) called 144 Catholic-ownedor Catholic-affiliated clinics in the United States and requestedappointments for birth control, tubal ligation and abortion. The resultsshowed only 2% of the clinics would offer an abortion for an unwantedpregnancy.29 A limitation of this study was that the personanswering the phone may not have been aware of the clinic\u2019s relevantpolicies.Many of the empirical studies about IO to abortion in the United Statesfocused on miscarriage management in Catholic hospitals.33 The same survey also demonstrated that 37% of OBGYNworking in religiously affiliated facilities had experienced conflict withthe institution about religiously-based policies. Conflicts were more commonin Catholic facilities than other faith-based institutions.34Another survey of a nationally-representative sample of 3000 primary carephysicians about pregnancy options, counselling and abortion referralsdemonstrated that working at a Catholic institution was significantlyassociated with lower odds of routine referral (OR 0.27 95% CI0.11\u20130.66).35 The survey response rate was 29%. An earlier surveyof 879 primary care physicians about their experiences with conflict aboutpatient care in religious institutions yielded a 52% response rate. Theresults showed that of the 43% who had worked in a religious institution,19% had experienced conflict related to religiously-basedpolicies.36 A national sample of 2125 maternal-foetal medicinesubspecialists were surveyed about barriers to dilation and evacuation(D&E) practice. The survey included both quantitative and qualitativecomponents and the response rate was 32%. Qualitative results showed someparticipants described religious institutional restrictions (such asinability to perform elective terminations) as a barrier to D&E.Quantitative results showed the biggest barrier reported by D&Eproviders (37%) was a negative culture comprising unsupportive staff orcolleagues, institutional restrictions and concerns for personalsafety.37In the United States, large cross-sectional surveys have been used toquantify the impact of IO on individual clinical practice. A cross-sectionalsurvey examining abortion provision was sent to a nationally representativesample of 1800 OBGYN with a high response rate of 66%. The results showedthat working primarily in a Catholic institution was associated with adecreased likelihood of abortion provision .3840 Examples ofrestrictions included being unable to use methotrexate , needing to ascertain and document the nonviability ofthe foetus before performing a medically indicated abortion, and beingunable to provide tubal ligation at the same time as managing ectopicpregnancy. Three studies also found that clinicians\u2019 miscarriage managementdecisions were delayed or impeded because they needed approval from thehospital\u2019s ethics committee.40 Catholic hospitals\u2019ethics committees are expected to abide by the ERD when helping cliniciansresolve ethical challenges.41Qualitative studies have provided in-depth data on the experiences ofclinicians working in institutions objecting to abortion. In multiplestudies, OBGYN and other physicians in Catholic hospitals perceived theywere unable to provide standard clinical management for pregnancycomplications due to mandated restrictions.42 Some providers inthese studies felt conflicted about transferring patients because it couldcause treatment delays,40 interrupt continuityof care12 or, in the case of referring patients with a wantedpregnancy to an abortion clinic, be perceived as an unnecessarypunishment.42 Direct referrals for abortions could be impeded bynurses or office staff refusing to facilitate the referral13 orthe prerequisite of getting the ethics committee\u2019s approval.12Some health practitioners who were unable to perform an abortion due to theirworkplace\u2019s IO referred or transferred the patient to a nonobjectinghospital where the procedure could be completed. Several qualitative studieshave explored issues associated with referral and/or transfer of patientsseeking abortions to nonreligious hospitals.43 Thesecounterintuitive results were explained by the authors who indicated thatreligiously affiliated hospitals were partnering with secular hospitals tomeet abortion training requirements, but noted that further research wasneeded. Programme directors were also asked about restrictions on abortiontraining within their institutions. Examples of restrictions included thoseimposed by restrictive hospital policies, law or resistance from nursingstaff. Directors in religiously affiliated institutions reported there weremore restrictions on abortion training than nonreligiously affiliatedinstitutions.44 A survey of 454programme directors and chief residents at US family medicine residencies(54% response rate) found religiously affiliated institutions weresignificantly less likely to offer routine abortion training(p\u2009=\u2009.041).45 In another study, 30programme leaders for OBGYN residency programmes at Catholic and otherreligious hospitals  were surveyedabout family planning training. The results showed Catholic hospitals weremore likely to report poor abortion training compared to other religioushospitals .46Surveys also showed many medical students47 and medical residencyprogramme directors46 in religiously affiliated institutions expressedconcern or dissatisfaction with training limitations. A qualitative study of31 OBGYN, who trained in religiously affiliated hospitals, reported thatmany participants perceived that religious policies had negatively impactedtheir training experiences and put limitations on the range of reproductivehealth services they could now provide.48Surveys have been used to investigate the implications of IO on futureabortion providers in the United States. A recent survey sampled all OBGYNresidency training programmes in the United States (79% response rate) andfound no difference in the availability of abortion training betweennonreligious and religiously affiliated institutions.49 As well as protectingindividual CO, Chile\u2019s abortion law also protected the right of privateinstitutions (including those receiving public funding) to claim objectorstatus.49 Public institutions were prohibited from claimingIO.49 The highest-ranking university and medical schoolin Chile, the Pontificia Universidad Cat\u00f3lica de Chile (a private Catholicuniversity), was the first institution to claim objector status promptingconcerns among its medical students.49 In an interview studyof 30 medical and midwifery faculty members, including 10 from religiousuniversities and 20 from secular universities, the data indicated that allof the religious faculty (and none of the secular faculty) supported theright to claim IO.49 Though this suggests support from religious facultyfor IO, the sample size was small and therefore may not reflect the views ofthe wider religious faculty. A cross-sectional survey of 333 medical andmidwifery students across four secular and three religious universities inSantiago demonstrated around 50% of students at religious universities and20% at secular universities supported IO.50 The authors statedthese findings suggested a mismatch between the administration of religiousinstitutions, which staunchly supported and claimed IO, and their students.They reported that Chile\u2019s Catholic universities were some of the mostprestigious in the country and thus attracted students irrespective of theirreligious views.50 While this study included students from a range ofuniversities, 77% of respondents attended secular universities. The authorsstated the underrepresentation of respondents from religious universitieslikely underrepresented views supportive of conscience-basedobjections.50In 2017, Chile moved from a complete ban on abortion to legally permittingthe procedure in restricted circumstances.51 Priorto liberalization, abortion was legally restricted and regulations issued bythe Argentine National Congress acknowledged that both private and publicinstitutions possessed a right to IO.52 In a cross-sectionalsurvey of sexual and reproductive health providers in Argentina\u2019s publichealth system, 38% of respondents (n\u2009=\u2009269) believed some of theircolleagues claimed objector status following mandates from their managers orheads of department.52 In the qualitativecomponent, 11 nonobjector heads of reproductive health programmes and healthdepartments in Argentina were interviewed about CO to abortion.52 Someof the participants perceived that \u2018hospital authorities  have used CO to establish an ideologicalapproach to sexual and reproductive health care in theirdepartments\u2019. For instance,one of the participants stated, \u2018In hospitals you find people saying \u201cthe CO[form] must be signed\u201d and those orders came from departmentheads\u2019. A limitation of this study was therecruitment of participants was largely through pro-choice networks, likelyoversampling abortion providers. However, the presence of IO as a problem inboth the survey and qualitative results strengthens these findings.The abortion laws in Argentina were liberalized in 2020.51 Even prior todecriminalization, institutions were prohibited by case law from objectingto abortion provision.53 In a 2016 study of COto abortion in Bogota, interviews with 13 key informants from all sides ofthe abortion debate reported that some religious hospitals were claiming IOdespite the legal prohibition from doing so.53 Furthermore, theauthors reported: \u2018A physician who worked in one of the implicatedinstitutions explained that she and her colleagues were asked to\u201cvoluntarily\u201d sign declarations of objection when they began their jobs atthe hospital\u2019. Given the key informants were not allclinicians ,their ability to provide direct experiences of IO may have been limited.However, the key informants may also have had a broader overview of systemicand policy issues than individual clinicians.Abortion in Colombia was decriminalized in 2022.Choice onTermination of Pregnancy Act 1996 (CTOPA).54 UnderCTOPA guidelines, Favier, Greenberg54 reported that CO wasrestricted to individual clinicians, and to the actual abortionprocedure.54 However, their case study, which includedinterviews with nine key informants  and a desk-basedliterature review,54 showed that public health facilities in rural orconservative regions became de facto institutional objectors when sufficientpractitioners refused to provide abortions.54 Similar to thestudies in Argentina and Bogota, the authors reported certain healthfacilities asked newly-employed staff to sign individual CO forms:54Interviewees described gaps between regulation and service delivery,with one interviewee reporting that certain facilities give all newhires a conscientious objection \u2018form letter\u2019 to sign, an approachat odds with the ostensible purpose of permitting an individualchoice with a deeply-felt rationale specific to eachobjector.In South Africa, abortion was decriminalized under the Several interviewees said that many facilities had become de factoinstitutional \u2018objectors\u2019, and that the [Department of Health]\u2018should actually go to the facility and reprimand the facilitymanager\u2019. However, one interviewee expressed doubt that the[Department of Health] had disciplinary purview over theserecalcitrant facilities, and others described little enforcement ofmeasures that did exist.Key informants also perceived there was a lack of government action againstfacilities claiming IO:This study had a small sample size but the similarities of their findings tostudies in other countries strengthen confidence in their results.55 Awoonor-Williams, Baffoe55 have reported thatabortion services were provided within regional and district public healthfacilities in Ghana\u2019s Eastern and Volta regions. Religiously affiliatedprivate hospitals were governed by protocols that discouraged access tohealth care that prevented conception and childbirth.55 Thequalitative interview and focus group study of 14 doctors and 20 midwivesfound that Catholic hospitals put additional restrictions on abortionprovision beyond those set out in law. Two midwives working at Catholichospitals reported that abortions were only performed to save a woman\u2019s lifeor in the case of foetal impairment, but not to protect a woman\u2019s physicalor mental health nor in cases of rape or incest.55 One of the strengthsof this study was that recruitment occurred via purposive sampling ofregional and district hospitals, rather than via pro-choice networks.Participation was voluntary; however, there may still have been someself-selection bias towards those with stronger pro- or anti-abortion views.The firsthand accounts of IO in religious hospitals suggested the practicedid occur; however, the findings cannot be generalized to other religioushospitals in Ghana.In Ghana, abortion is legally restricted and only lawful when it is necessaryto save a woman\u2019s life, for physical or mental health reasons, in caseswhere the pregnancy resulted from rape or incest, and in cases of foetalimpairment.56 An ethnographic study57 explored how anindividual CO clause, enshrined in the Medical Code of Ethics, served tofurther limit the narrow range of abortions available. The authors foundthat the clause contributed to a large scale denial of abortion whenhospital leaders who were against abortion declared the procedure would notbe conducted in their hospitals. In addition, employees holding opposingviews to management risked losing their jobs if they spoke out.57 In2003, a statement was issued by the Minister for Health clarifying that IOwas not permitted; however, the authors reported that no court action hadbeen instigated for violations of the individual CO clause. This rigorousstudy involved 19 months of fieldwork across Warsaw, Krakow and Gdansk,including participant-observation and interviews with 123 women, 26physicians specializing in OBGYN and six family planning instructors inWarsaw and Gdansk.In Poland, abortion is heavily restricted with the procedure only beingallowed when the woman\u2019s health is in danger or the pregnancy is a result ofrape or incest.58 Although the TurkishMinistry of Health claimed that all state hospitals with obstetrics andgynaecology services performed abortions, a mystery caller study in 2017found only 7.8% provided abortion without regard to reason.59 Thepercentage of state teaching hospitals providing abortion on request wasslightly higher at 15.5%. The author found that women in rural areas wereless likely to have access to abortion at state hospitals withoutrestriction than those in metropolitan areas. The author was also concernedabout the future of abortion provision in Turkey, given only a smallpercentage of state teaching hospitals engaged in abortion provision asprovided for by law.59In Turkey, abortion is legally available on request in the first 10 weeks ofpregnancy with no legal right to individual CO.58 However, the authorconcluded that IO at state hospitals in Istanbul was resulting in a de factoprivatization of abortion services, where inflated prices resulted in fewerwomen being able to afford the procedure.58 A strength of thisstudy was the mystery caller approach which may have provided a realisticinsight into the patient experience. However, a potential limitation of thismethod was that some of the hospital staff contacted may not have been fullyinformed about abortion procedures at the hospital.In the same study, O\u2019Neil found the percentage of state hospitals in Istanbulproviding abortion on request was higher than the overall country percentage(14% compared to 7.8%).60 However, as IO wasnot the focus of the study, these perceptions were not exploredin-depth.In Australia, the state of Victoria decriminalized abortion in 2008. InVictoria, individual CO to abortion is explicitly protected by law, but IOis not. In a qualitative interview study about individual CO protection with19 experts in abortion provision, some participants reported concernsreligious hospitals were claiming IO.Roe v. Wade is expected to significantly reduceabortion access in the United States, these findings suggest IO may furtherexacerbate local access issues.61 Studies from other partsof the world revealed that the use of IO was widespread and occurred at secularas well as religious institutions. Interestingly, the literature review did notfind any evidence of positive impacts of IO, such as the potential benefits ofprotecting an institution\u2019s moral integrity or identity. This finding maypossibly reflect a bias towards negative impacts in the empirical literature orthat there was insufficient evidence of positive impacts. Future empiricalresearch exploring the positive impacts of IO warrants further exploration.This review of the empirical research about IO to abortion raises importantphilosophical and practical questions. First, the findings demonstrated thathospitals across the world were claiming IO to refuse to provide abortions. Suchclaims were based on a contested premise that, like individuals, institutionscan be autonomous moral agents with moral responsibilities. The reviewidentified strong survey evidence from the United States that claims of IO ledto a reduced provision of abortions and abortion referrals in religioushospitals. Qualitative evidence also provided in-depth examples of how IOimpacts clinical practice, including restricting standard practice for pregnancycomplications and restricting referrals to other hospitals. Multiple studiesalso showed training of future abortion providers was impeded by IO. Given theoverturn of 5759 The moralgrounds on which IO was claimed in secular hospitals were not clear from thestudies. This lack of transparency was concerning given IO conflicts with theduty of state hospitals to provide publicly-funded, legally available healthservices.62 Also relevant to the adequacy of the decision-makingprocess was whether stakeholders should be involved in determining an IO. Biggs,Casas50 showed a lack of support from medical and midwiferystudents for universities to claim an IO. This raises the issue of whetherinstitutions should require the consent of those affected before claiming an IO.63 Thisleads to a broader question that if institutions can be moral agents, to whomare they morally responsible? Are they only responsible to the owners of theinstitution or to their stakeholders too?64 If the latter, thenarguably students (in the case of universities), employees and patients  should play a role in the decision-making process.Second, if IO is morally justifiable, a further concern was the adequacy of eachinstitution\u2019s moral decision-making process. This was particularly pertinent tothe review findings that some secular (including state) hospitals were claimingIO.2 Signing an individual CO form should signify thischoice, not the choice of their employer. Appropriate regulatory responses thatprevent the misuse of employees\u2019 individual CO as a mechanism for ensuring IOshould be explored.Third, the findings also revealed individual CO clauses could be misused toestablish de facto IO where IO was not explicitly given legal protection.Evidence from qualitative studies demonstrated some new hospital employees wereasked, and sometimes compelled, to sign forms claiming individual CO prior tocommencement. An individual\u2019s objection to abortion participation is onlyconscience-based if participating in the procedure is contrary to their coremoral beliefs, and their refusal to participate is based on thosebeliefs.Fourth, the barriers IO poses to provision and receipt of legal abortion carerequire further research. As stated earlier, research on the impact of IO onpatient outcomes is limited. In light of the barriers posed by IO, as shown inthis review, there is a need for further evidence about the impact of IO onpatients\u2019 access to abortion services.65 For example, if IO is permitted, objecting institutionscould be legally required to provide information about abortion, and facilitatereferral to a willing institution or provider.65Finally, the findings suggest appropriate regulatory responses from governmentsare needed to balance the moral integrity of institutions with the needs ofpatients and employees and other stakeholders with divergent moral views. Ouranalysis showed that regulation of IO varied across countries. For example, inColombia, there was case law expressly prohibiting IO, whereas in Chile,legislation protected IO but only for private institutions. In other countries,such as Australia, the law was silent, neither protecting nor prohibiting IO.More research is needed to ascertain the different forms of regulation of IOglobally and determine their impact. Moreover, regulatory guidance (no matterwhat form it takes) should clarify: (1) if IO may be claimed; (2) under whatconditions it can be claimed; and (3) how patients\u2019 right to access abortion canbe respected (and even facilitated) in light of IO. Legal options proposed tooptimize the regulation of IO for other ethically-sensitive issues, such asvoluntary assisted dying, may be useful for informing futureapproaches.In this mixed-methods narrative review, we interpreted the empiricalliterature on IO, provided insights on key messages, and identified areasfor future policy reform and further research. However, there were somelimitations. First, only English language studies were included. Second, asthe literature was screened by one author only, it is possible that someeligible studies were missed. Third, we relied on the description of IO lawsand policies as described by the individual study\u2019s authors, rather thansourcing the legislation or policies independently. This may have led tosome inaccuracies or a lack of uniformity in how the regulations weredescribed. Also, IO policies may have changed since an individual study werepublished. Finally, as this is not a systematic review, there is anincreased possibility of bias in the interpretation of the literature.However, as the authorship team has combined expertise across the range offields covered by this review ,potential bias was minimized by drawing on diverse perspectives.Even though the ability of hospitals to claim an IO is morally contested, this reviewdemonstrated that the practice occurred across a range of countries. Evidence fromthe United States demonstrated IO had a negative impact on clinicians providing andreferring for abortions, and also restricted the training of future abortionproviders. Outside of the United States, the findings showed IO was occurring atsecular as well as religious institutions, that the decision-making processesleading to IO were often unclear and that individual CO clauses were sometimesmisused to establish a de facto IO. Further research is needed on the moraljustification for IO, how decisions to claim IO are made, and the grounds forclaiming an IO. Appropriate regulatory responses are needed to ensure thatprotecting the moral integrity of institutions (by exempting them from abortionprovision) is balanced with the needs of patients, employees and other stakeholders who have divergent moral views. However, further researchis needed to establish the optimal regulatory model."}
+{"text": "Nonword repetition tests (NWRT) can be useful tools together with other assessment procedures for diagnosing a developmental learning disorder in bilingual children. Concerning typically developing children, however, the link between NWRT performance and language development is still unclear. The present study contributes to this discussion by investigating the link between language-dependent NWRT performance, language development, and language exposure.A total of 20 simultaneously bilingual Russian\u2013German children, aged 4\u20136 years, were tested with \u201cThe Russian language proficiency test for multilingual children (SRUK)\u201d and \u201cPatholinguistische Diagnostik bei Sprachentwicklungsst\u00f6rungen (PDSS)\u201d as well as language-specific nonwords for Russian and German.Most children scored within the mean range in SRUK. In PDSS they scored two standard deviations below the mean range in most of the subtests. NWRT in Russian significantly correlated with the NWRT in German and also positively correlated with both comprehension and production in Russian. In contrast, the German NWRT did not correlate with comprehension or with production in German. Moreover, the correlation between the German NWRT and the comprehension of grammatical structures in Russian was significant, and the correlations between the German NWRT and the two other Russian language development tests just failed to reach significance.High scores in both the Russian and the German NWRT offer evidence that the ability to repeat language-specific nonwords does not differ depending on language exposure. The aim to distinguish between typical and atypical language development based on NWRT can be reached only when NWRT and all possible influencing factors in typically developed children are analyzed. Today a\u00a0majority of children grow up multilingually, because of the many demographic changes. In Austria, German is the official language needed for the daily life and for education. Nevertheless, about 60% of children attending kindergarten in Vienna acquire another first language\u00a0L1) [ [1]. TheThus, it remains an open question whether the amount of language exposure influences not only the development of the stronger and weaker language but also performance in language-specific NWR.The aim of this study is to evaluate for the first time language acquisition in simultaneously bilingual children acquiring Russian and Austrian German in Vienna. Children\u2019s language proficiency in both Russian and German is evaluated and analyzed with regard to the impact of language exposure as well as with regard to the children\u2019s performance in language-specific NWRT.Is the higher exposure language the language in which the children\u2019s linguistic abilities are higher, and the lower exposure language the language in which the children\u2019s linguistic abilities are lower? Can this link be generalized to different linguistic abilities in the domains of speech comprehension and production?Is proficiency in language-specific NWRT of one language correlated with linguistic ability in the other language?Is proficiency in a\u00a0language-specific NWRT correlated with linguistic ability in the same language?Is proficiency in language-specific NWRT of one language correlated with proficiency in language-specific NWRT of the other language?Are some linguistic abilities stronger correlated with NWRT proficiency than others? In order to answer this question, results of production and comprehension will be correlated separately with the results of the NWRT.Specifically, the following research questions are analyzed:Twenty bilingual children, acquiring Russian and German, aged from 4\u20136\u00a0years were selected via a\u00a0Russian Facebook group. In these Facebook groups, members favor culture of their countries of origin. Inclusion criteria were that L1\u00a0Russian is the dominant language for the children at home (that is spoken to at least 60%). Both of the parents or at least one of them and additionally other caregivers and relatives speak Russian, and contact with L2\u00a0German started before the age of 25\u00a0months . The chiThe children were screened in both of their languages in order to evaluate their respective language proficiencies and to subsequently correlate these results to results of the language-specific nonword repetition tests.Regarding the evaluation of Russian, children were screened with \u201cThe Russian language proficiency test for multilingual children (SRUK)\u201d . This teRegarding the evaluation of German, children were screened with \u201cPatholinguistische Diagnostik bei Sprachentwicklungsst\u00f6rungen (PDSS)\u201d . This prNWR is influenced by phonetic and phonological development. Regarding the exclusion of children who do not have age adequate phonological abilities, the following screening procedure was performed: 5\u00a0words which were pronounced as part of the subtest active lexicon from SRUK  were traRegarding NWR in the respective languages, language-specific nonwords for Russian and German, developed by Mathieu et\u00a0al. , were usA\u00a0computer game (smartphone/tablet application) which was developed by the second author was used to elicit the nonword repetitions in a\u00a0playful way inspired by the software used by Mathieu et al. . In thisRussian nonwords  are showGerman nonwords  are showAll children  could be classified as having typical language development. As the aim of the NWRT was to measure the ability to repeat syllables, NWR abilities of the children were evaluated with tolerance. This means that phonetic errors and typical phonological processes are not counted. Consequently, the obtained raw scores per child could vary from\u00a00\u201328 . For a\u00a0p-values of all correlation tests were Bonferroni corrected in order to account for type\u00a01 errors, because of the multiple tests in which the variables of the NWRT were involved. In this case, the significance level of p\u202f>\u20090.05 was divided by\u00a03, i.e., the number of correlation tests performed within each set of correlation analysis, leading to a\u00a0corrected significance level of 0.05/3\u202f=\u20090.017.For statistical analyses, and thus, in order to answer research questions 2\u20135, one-sided correlation tests were performed in\u00a0R . The tesSociodemographic parameters show that 84.2% of mothers and 57.9% of fathers have a\u00a0university degree and 42.1% of the households has an income of more than 50,000\u202f\u20ac Table\u00a0.Table 3SA\u00a0descriptive analysis of the children\u2019s language proficiency in Russian and German shows that all children  could be classified as having a\u00a0typical language development Figs.\u00a0 and\u00a02.FiResults of the Russian language tests showed that most of the bilingual children scored within the mean range in all subtests. Only in the subtest comprehension of verbs did two children score two standard deviations below average. In the other subtests, none of the children received such low scores. In their L2\u00a0German, in contrast, most of the children scored two standard deviations below the mean range in most of the subtests. In German, only one child attained results in the average range or higher in all subtests. In their high exposure language Russian, the variation of test results between children was small, whereas in the low exposure language German the variation was large.Shapiro\u2013Wilk normality tests showed that all variables but two were normally distributed. The two variables production of Russian verbs and nouns, and the comprehension of Russian grammar did not show a\u00a0normal distribution. Thus, correlations involving one of these two not normally distributed variables were calculated with Spearman\u2019s \u03c1, whereas the other correlations were analyzed with Pearson\u2019s product moment correlation coefficient.p\u202f<\u20090.001. The higher children\u2019s scores were in the Russian NWRT, the higher their scores were also in the German NWRT.Results showed that the NWRT in Russian significantly correlates with the NWRT in German, r\u00a0(17)\u202f=\u20090.8, p\u202f<\u20090.001). Thus, the higher the children\u2019s scores were in NWR, the higher their scores were also in the comprehension of grammatical structures in Russian. This also holds for the comprehension of nouns and verbs: The higher the children\u2019s scores were in the Russian NWRT, the higher their scores were also in the comprehension of nouns and verbs in Russian. However, the correlation between the NWRT in Russian and the comprehension of nouns and verbs in Russian just failed significance, r\u00a0(17)\u202f=\u20090.46, p\u202f=\u20090.02. The correlation between the NWRT in Russian and the production of nouns and verbs in Russian was shown to be significant . This means that the higher children\u2019s scores in the Russian NWRT were, the higher their scores were in the production of nouns and verbs in Russian. In contrast, the NWRT in German did not correlate with language comprehension in German (with nouns and verbs: r\u00a0(17)\u202f=\u20090.2, p\u202f=\u20090.2, and with grammatical structures: r\u00a0(17)\u202f=\u20090.26, p\u202f=\u20090.14), nor with language production of nouns and verbs in German, r\u00a0(17)\u202f=\u20090.26, p\u202f=\u20090.14.The NWRT in Russian was shown to be positively correlated both with language comprehension  in Russian, and also with language production  in Russian. The correlation between the NWRT in Russian and the comprehension of grammatical structures in Russian was shown to be significant \u202f=\u20090.33, p\u202f=\u20090.09, and for the correlation with the production of verbs and nouns, Spearman\u2019s \u03c1\u202f=\u20090.35, p\u202f=\u20090.07).In addition, the positive correlation between the NWRT in Russian and the NWRT in German (see above) was investigated in more detail, insofar as the strength of the direct correlation between the German NWRT and the language development tests in Russian was analyzed. Results showed that the correlation between the NWRT in German and the comprehension of grammatical structures in Russian was significant, Spearman\u2019s \u03c1\u202f=\u20090.54, In the present study, language proficiency and its correlation with NWRT was tested in 20\u00a0bilingual children who were between\u00a04 and 6\u00a0years of age and who simultaneously acquired Russian and Austrian German. All of the bilingual children live in families representing a\u00a0higher social class of Russian migrants in Vienna. Their stronger language Russian is spoken from one or even both of the parents at home more often than German. The results of this study confirm that the language to which bilingual children are most often exposed evolves into their stronger language in terms of proficiency of language comprehension and production. Results of the Russian language tests showed that most of the bilingual children scored within the mean range. Only in the subtest comprehension of verbs were the scores of two children very conspicuous. In the other subtests, none of the children received such low scores. In their L2\u00a0German, in contrast, most of the children scored two standard deviations below the mean range in most of the subtests. The participants live in families who are members of a\u00a0Russian Facebook group and favor Russian language and culture. Many studies show that input plays an important role for language proficiency since it activates the innate structure of language in children . The chThe results of this study also suggest that language exposure influences which of the languages of typically developed simultaneously bilingual children evolves into their stronger or the weaker language, but that language exposure does not influence the performance in NWRT. However, concerning the correlation between language proficiency tests and NWRT, the results of this study suggest a\u00a0differentiation according to language exposure. Whereas NWRT correlates with language comprehension and production in Russian, i.e., in the language to which the children were most exposed, there is no correlation between NWRT and language comprehension and production (nouns and verbs) in German, namely in the language to which the children were less exposed. Moreover, in the children\u2019s stronger language Russian, language proficiency is linked to NWRT in both L1\u00a0Russian and L2\u00a0German, whereas language proficiency in their weaker language German is not linked to NWRT in either of the two languages.An explanation of this discrepancy in the correlation between language proficiency and NWRT in the results could be that Russian phonology and phonotactics are more complex than German phonology and phonotactics , suggesThe most important limitation of our study is the size of the group which characterizes it as a\u00a0pilot study. It focuses only on one pair of languages Russian and German. Even though the findings show that NWRT is not affected by language exposure, the authors did not differentiate between cumulative and current exposure and used a\u00a0cumulative measure of exposure . FurtherMany bilingual children are suspected to have a\u00a0developmental language disorder (DLD) because of their lower proficiency their second language (L2). Language evaluation in both languages is complicated by many facts like lack of normed language tests and different amount of exposure in the languages. The nonword repetition test (NWRT) is influenced by language-specific knowledge but does not draw directly on knowledge of vocabulary and grammar. Therefore, we recommend to use language-specific NWRT in bilingual children who are suspected to have DLD, but to interpret test results with caution. There are still many open questions regarding the influence of language exposure and phonological structure of different languages on NWRT performance."}
+{"text": "Equity of urban medical services affects human health and well-being in cities and is important in building \u2018just\u2019 cities. We carried out a quantitative analysis of the spatial accessibility of medical services considering the diverse demands of people of different ages, using outpatient appointment big data and refining the two-step floating catchment area (2SFCA) method. We used the traditional 2SFCA method to evaluate the overall spatial accessibility of medical services of 504 communities in Xiamen city, considering the total population and the supply of medical resources. Approximately half the communities had good access to medical services. The communities with high accessibility were mainly on Xiamen Island, and those with low accessibility were further from the central city. The refined 2SFCA method showed a more diverse and complex spatial distribution of accessibility to medical services. Overall, 209 communities had high accessibility to internal medicine services, 133 to surgery services, 50 to gynecology and obstetrics services, and 18 to pediatric services. The traditional method may over-evaluate or under-evaluate the accessibility of different types of medical services for most communities compared with the refined evaluation method. Our study can provide more precise information on urban medical service spatial accessibility to support just city development and design. The pursuit of a \u2018just\u2019 city is a vital part of the construction of a sustainable and resilient city, but equity considerations are still lacking in development decisions ,2. A \u2018juThe spatial accessibility of medical services is an important topic in research on the supply\u2013demand balance in medical services. \u2018Balance\u2019 means a spatial pattern of equity that matches the supply and demand between different study units. Spatial accessibility can be defined as the distance or time required to travel between the point of demand and the service providers. The spatial accessibility of medical services can reflect the resource distribution. Low spatial accessibility often means a shortage of medical service providers or social disparities for different areas or population groups; this should have more attention to when planning new medical service institutions. Therefore, the spatial accessibility of medical services plays a critical role in the planning and location of medical resources ,11,12,13Previous studies measuring the spatial accessibility of healthcare services have represented demand by the total population in each residential area and supply by the number of hospital beds or physicians, or the total amount of other services available ,25,26,27The situation is similar for supply indicators. Two hospitals with the same number of beds or physicians may use different configurations of medical services and departments. For example, some hospitals specialize in pediatric services which only serve children. Many departments can only serve specific populations. However, some previous studies have used the total number of inpatient beds to represent the supply of medical services. After obtaining the total number of potential patients in different communities, analyzing the demand of these patients for different types of medical services, and finally matching the differentiated demands from different demographic communities with different types of medical resource supply are thus necessary. Outpatient big data is a good choice for this because it is effectively the embodiment of medical service supply. Outpatient visits far outnumber inpatients stay for most medical institutions. For example, the number of outpatient visits to medical institutions in China was 7.74 billion in 2020, but there were only 0.23 billion stays. Most of the inpatients were transferred from the outpatients. The supply of outpatient resources also affects the behavior of patients, at least to some extent. For example, the type and content of outpatient resources can directly affect the patient\u2019s choice of a medical appointment. Outpatient big data also reflect the specific demands of patients. The patient\u2019s appointment and clinic data represent the patient\u2019s demand for medical service types and even reflect the patient\u2019s disease characteristics. Outpatient data may, therefore, better reflect the medical service supply of medical institutions. The use of outpatient big data is a useful supplement to research on accessibility calculation of single-use inpatient data and the data collection of medical service resource supply data and can therefore further expand previous related research. The differences in both supply and demand should therefore be considered for healthcare between different age groups when measuring the spatial accessibility of medical services.In this paper, we propose a quantitative evaluation method of the spatial accessibility of urban medical services by refining the two-step floating catchment area (2SFCA) method. Taking Xiamen City in China as a case study area, we try to integrate the demands of different age groups and the supply of different types of medical services to carry out a quantitative evaluation of the spatial accessibility of urban medical services using outpatient appointment big data collected from the online appointment platform to represent the supply of medical services. The spatial distribution of accessibility medical services is compared between the refined and traditional methods. Therefore, the study answers two research questions: (1) How can one quantitatively evaluate the spatial accessibility of urban medical services by considering the demands of different age groups and the supply of different types of medical services? (2) What are the differences in the evaluation of accessibility between the traditional and refined versions of 2SFCA? We hope that our study will provide more precise information on improving the spatial accessibility of urban medical services and support\u2019 just\u2019 city development and design.2. Xiamen includes the downtown area of Xiamen Island and the more suburban area of the mainland part of the city. It has six administrative districts, Siming and Huli on Xiamen Island and Haicang, Jimei, Tong\u2019an and Xiang\u2019an on the mainland. The city contains 51 towns and subdistricts with 504 communities. Approximately 45% of the total population is concentrated on the island, across just 157.98 km2 of land. As one of the four earliest Special Economic Zones in China, Xiamen has been experiencing rapid urbanization and development of the public health service since the 1980s. In the past three decades, the urbanization level of the city has increased from 35.0% in 1980 to 89.4% in 2020. The public service there has also experienced rapid development. The number of healthcare institutions increased from 336 in 1980 to 2171 in 2020, with an increase in the number of beds in healthcare institutions from 3222 in 1980 to 19,470 in 2020 and healthcare technicians from 3697 in 1980 to 38,540 in 2020. The total number of outpatient visits to hospitals and community healthcare centers was around 36 million in 2020 [Xiamen City is located on the southeastern coast of Fujian Province, China , covering a total land area of 1700.61 km in 2020 . There aThe two-step floating catchment area (2SFCA) method has been widely used to measure spatial accessibility ,23,24,25j, all the locations of demand (k) within a fixed threshold distance or travel time (d0) from supplier location j are searched, and the medical service demand in location k  is summed to obtain the total medical service demand (jD) for supplier location j. The total supply  is divided by the total demand in location j to give the supply-to-demand ratio (jR) for supplier location j:kjd is the distance or travel time from location k to j.Step 1: For each medical service supplier location i, all supplier locations (j) providing medical services within the threshold distance or travel time of location j are searched, and the supply-to-demand ratio is summed as the accessibility value of demand location i , young people (aged 15\u201344), middle-aged people (aged 45\u201364), and older people (aged \u2265 65). Different population groups\u2019 demands for different types of medical services were calculated using a healthcare survey. To match the demand for different medical services by different age groups, we classified the medical service supply into four types by the services available at each hospital: internal medicine, surgery, obstetrics and gynecology, and pediatric services. Surgical clinics include specialized departments, such as an orthopedics department and a hepatobiliary surgery department, where surgical resection and repair are the primary means of treatment. Internal medicine clinics include digestive medicine, neurology, and other departments that generally do not carry out open surgical treatment. Obstetrics and gynecology mainly focus on female reproductive organ diseases, physiological and pathological changes of pregnancy and childbirth, and women \u2018s health care. Pediatrics focuses on preventing and treating diseases that promote physiologically and psychologically healthy growth from fetus to adolescent children. The number of appointments for each type of outpatient service at each hospital was used to represent the supply size of the hospital for that service.i for outpatient services, i, j in community i, j in community i, and i.The total population may reflect the potential demand for medical services. However, the number of individuals with different conditions in the population provides a more accurate picture of the demand for medical services than simply the population. We used the number of patients to represent the demand size for different medical services in this study; we calculated the number of patients in each community over the relevant 2 weeks for the four types of medical services using the equation below:Fifth National Health Service Survey in China [China Health Statistics Yearbook [in China . The proYearbook .The calculation process for Equation (3) is shown in Qualified hospitals in China can be classified into three grades\u2014primary (the lowest grade), secondary and tertiary (the top grade)\u2014by their ability to provide medical services. According to the level of medical service provision and hardware, every grade can also be further divided into Level A (the top level), and Level B. Hospitals in China can therefore be classified into a three-grade, six-level system, with the highest level being Tertiary Level A hospitals .f(ijd)2 is the general form of the distance decay function, and g(ijd) is the Gaussian distance attenuation function used in this study within the search radius d0.We used the grades of hospitals to refine and calculate the 2FSCA. The method was refined and calculated as shown in Equation (4).f(ijd)1). Medical institutions at different levels offer reimbursement of medical expenses to residents with medical insurance, but the characteristics and reimbursement rates of medical institutions of different levels vary. Primary hospitals are community health service centers providing preventive healthcare and basic medical services. They tend to provide services mainly for the surrounding communities. The threshold travel time (d0) of this level of healthcare institution was set to 20 min. Secondary hospitals have more departments and medical services than primary hospitals. Therefore, the threshold travel time (d0) of this level was set to 30 min. Tertiary hospitals have the most departments and healthcare resources. They have a larger number of technical professionals and better medical equipment and resources to deal with a wider variety of diseases. Some of these hospitals even provide medical services to residents from outside Xiamen City; thus, the threshold travel time at this level was not limited to the study area.In the first step, we introduced the multi-level threshold distance or travel time to reflect the difference in service coverage of different grades of medical institutions . The appointment information included the appointment time, doctor\u2019s name and level, outpatient department name, hospital name, hospital address and hospital grade. We collected data on the community-scale permanent population and the age structure in 2019 from the Xiamen Municipal Bureau of Natural Resources and Planning (The data for 2 weeks of outpatient appointments (1\u201315 August 2018) at different hospital departments were collected from the Unified Appointment Platform for Outpatient Clinics of Xiamen City . Most outpatient visits occur in the daytime; thus, the computation of travel time was between 10 a.m. and 5 p.m. to eliminate the impact of morning and evening peak hours on travel time.Travel time to hospitals was computed using a route planning application programming interface, an approach that has also been used in other studies to provide more realistic travel times using real-time updated road network condition data . The rouUsing the traditional 2SFCA method, we first evaluated the spatial accessibility of medical services in each community of Xiamen city, considering the demand of the total population and supply of total medical resources. The results are shown in Compared with the refined evaluation of internal medicine services, the evaluation using the traditional 2SFCA method has over-evaluated the spatial accessibility of 167 communities , which were concentrated on Xiamen Island and the south of the Jimei District, Tong\u2019an District, and Xiang\u2019an District. Meanwhile, 53 communities (approximately one-tenth) were under-evaluated, which were in the north of the Xiang\u2019an District and the middle of the Haicang District .Compared with the refined evaluation for surgery services, the overall accessibility evaluation over-evaluated the spatial accessibility of 366 communities , most of which were concentrated in Xiamen Island, Xiang\u2019an District, and in the south of the Tong\u2019an District, Jimei District, and Haicang District. A total of 24 communities were under-evaluated, all in the west of Haicang District .Compared with the refined evaluation for gynecology and obstetrics services, the overall accessibility evaluation has over-evaluated the accessibility of 451 communities . Only 52 communities (about one-tenth) had consistent results from both methods. Those communities were distributed in the north of the Tong\u2019an district, in the south of Xiang\u2019an District, in the center of the Haicang District, and in the middle of Xiamen Island .Compared with the refined evaluation for pediatric services, the overall evaluation over-evaluated the accessibility of 433 communities . Only 70 communities (approximately 14%) had consistent results from the two methods. They were distributed in the north of the Tong\u2019an district, in the south of the Xiang\u2019an District, in the south of the Haicang District, and the middle of Xiamen Island .In an overall accessibility evaluation using the traditional 2SFCA method, the total number of hospital beds and total population are often used to represent medical supply and demand. The uneven distribution of accessibility to medical services was only related to the spatial distribution of overall healthcare resources and population density. However, this approach does not fully consider the supply of different types of medical services and the medical needs of different population groups. Our refined spatial accessibility evaluation method can consider the age structure of the population and different types of medical services. This approach integrated population structure, the prevalence of illness among residents, and the use of outpatient departments. It can, therefore, reflect the real demands for medical services in urban communities better. It can also explore the differences in service types and capacity of medical institutions better by integrating personnel information and outpatient big data for each department of each medical institution. In summary, the refined spatial accessibility evaluation of urban medical services can accurately depict the spatial patterns of the supply\u2013demand balance of different types of public medical services. This method can also integrate big data and other data sources. For example, the introduction of WebGIS route planning APIs (Applications Programming Interfaces), the multi-level threshold travel time, and the Gaussian decay function based on the hospital grades made our evaluation results more consistent with reality. Therefore, this refined method has great potential to provide more specific and detailed information to support better urban medical service development and design.Equity means fairness of rights, distribution and access. Maximizing the accessibility of urban public services provides an opportunity to support \u2018just\u2019 city construction. The refined method for evaluating accessibility can support the planning and optimization of healthcare resources at the departmental or personnel level, as well as by location and grade of the hospital towards \u2018just\u2019 city construction. For example, the spatial pattern of the pediatric services was obviously different from the other three types. More pediatric services were needed for most communities in Xiamen City, except in the south of the Haicang District. In contrast, most communities with low accessibility to gynecology and obstetrics services were located mainly in the south of the Haicang District. Therefore, this area needs more of these specific medical resources in the near future. From the demand side, the acceleration of population aging, the increase in chronic diseases, and the improvement of residents\u2018 health awareness have increased the demand for healthcare services. On the supply side, medical resources are insufficient and unevenly distributed, making it difficult to match supply with the rapidly growing demands for healthcare. In the future, as the demographic structure changes and the supply of medical services improves, according to a certain standard, e.g., the number of doctors per person proposed in policy documents  there may be an oversupply of medical services. When this happens, the oversupply of medical resources should be reflected by introducing corresponding parameters in the accessibility measures.There are imbalances in other types of urban public services, such as education, green space, commercial services, and healthcare. Inequality exists on different scales, both within the different city regions and between both cities and countries ,46. In dIn this study, only demographic differences within communities were included in the analysis of variations in demand for medical services. Future studies could consider more demographic characteristics, such as gender or income level, which may also influence the demand for different types of medical services. Second, outpatient appointments were used to represent the supply of different types of medical services. Future studies might integrate physician numbers and beds in different departments of each hospital. Third, different groups of people may use different transportation modes to access medical services. For example, differences in the characteristics of the population may lead to greater variations in travel patterns; older people are more likely to use public transport and less likely to drive than people of other ages , people Previous evaluations of the overall accessibility of healthcare services using the traditional 2SFCA method often used the total number of hospital beds and total population to represent medical supply and demand. However, this approach does not fully consider the supply of different types of medical services and the medical needs of different population groups. In this study, we propose a refined accessibility evaluation method based on the traditional 2SFCA method. The refined method integrates the age structure of the population and different types of medical services. Therefore, it brings together population structure, the prevalence of illness among residents and the use of outpatient departments. The traditional 2SFCA method was used to evaluate the overall accessibility of medical services of 504 communities of Xiamen City and found that approximately half of the communities had high accessibility to healthcare services. These communities were mainly concentrated on Xiamen Island. The refined 2SFCA method found more diversified and complex spatial distribution patterns of accessibility of medical services because of the spatial distribution of different age populations, healthcare resources and transport. The traditional method may therefore over-evaluate or under-evaluate the accessibility of different types of medical services across most communities. The refined 2SFCA method better reflects the real demand for medical services in urban communities and could also be used for other urban public resources to promote the construction of \u2018just\u2019 cities."
\ No newline at end of file