diff --git "a/deduped/dedup_0355.jsonl" "b/deduped/dedup_0355.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0355.jsonl"
@@ -0,0 +1,60 @@
+{"text": "Plasmodium genus that are under consideration as candidates for inclusion in transmission-blocking vaccines. Previous research using transgenic rodent malaria parasites lacking P25 and P28 has demonstrated that these proteins have multiple partially redundant functions during parasite infection of the mosquito vector, including an undefined role in ookinete traversal of the mosquito midgut epithelium, and it has been suggested that, unlike wild-type parasites, Dko P25/P28 parasites migrate across the midgut epithelium via an intercellular, rather than intracellular, route.P25 and P28 are related ookinete surface proteins highly conserved throughout the via an intracellular route similar to wild-type parasites and subsequently develops into oocysts.This paper presents an alternative interpretation for the previous observations of Dko P25/P28 parasites, based upon a recently published model of the route of ookinete invasion across the midgut epithelium. This model claims ookinete invasion is intracellular, with entry occurring through the lateral apical plasma membrane of midgut epithelial cells, and is associated with significant invagination of the midgut epithelium localised at the site of parasite penetration. Following this model, it is hypothesized that: (1) a sub-population of Dko P25/P28 ookinetes invaginate, but do not penetrate, the apical surface of the midgut epithelium and thus remain within the midgut lumen; and (2) another sub-population of Dko P25/P28 parasites successfully enters and migrates across the midgut epithelium These hypotheses are tested by showing how they can account for previously published observations and incorporate them into a coherent and consistent explanatory framework. Based upon these hypotheses, several quantitative predictions are made, which can be experimentally tested, about the relationship between the densities of invading Dko P25/P28 ookinetes in different regions of the midgut epithelium and the number of oocyst stage parasites to which these mutant ookinetes give rise.The recently published model of ookinete invasion implies that Dko P25/P28 parasites are greatly, although not completely, impaired in their ability to enter the midgut epithelium. Therefore, P25 and/or P28 have a novel, previously unrecognized, function in mediating ookinete entry into midgut epithelial cells, suggesting that one mode of action of transmission-blocking antibodies to these ookinete surface proteins is to inhibit this function. P25 and P28 are related major ookinete surface proteins under consideration as candidates for inclusion in transmission-blocking vaccines -4. ConsePlasmodium genus [P25 and P28 are structurally similar proteins, highly conserved throughout the um genus ,31,35-43um genus , putativum genus ,28,29, tum genus ,17-24. Pum genus -21,44,45Plasmodium berghei rodent malaria parasites lacking P25 and P28 demonstrated that these proteins have multiple and partially redundant functions during parasite infection of the mosquito vector [P. berghei parasites exhibit greatly reduced levels of oocyst infection compared to wild-type or Sko P25/P28 parasites, ookinetes lacking both P25 and P28 are still able to cross the midgut epithelium and establish oocyst infections [P. berghei ookinetes migrate intracellularly through the midgut epithelium causing significant damage to invaded midgut epithelial cells [via a solely intercellular route [Previous research using transgenic o vector ,27. Althal cells -48, whical cells -48, inclal cells ,45, protal cells ,45,48 anal cells ,49 and Sal cells . Furtheral cells ,45. Dko al cells ,45,48. Car route  suggestsin vivo support this model [P. berghei ookinetes [The route of ookinete migration across the midgut epithelium of the mosquito vector has long been controversial . The majis model . Accordiis model ,51,52. Sis model  and Figuis model ). Ookineokinetes ,55. Subsokinetes ,52,56, mP. berghei parasite infection of the mosquito vector are proposed. First, some Dko P25/P28 ookinetes invaginate, but are unable to penetrate, the apical surface of the midgut epithelium. Second, other Dko P25/P28 parasites are able to successfully enter and migrate across the midgut epithelium via an intracellular route, in a manner similar to wild-type parasites.Following the model of ookinete invasion of the midgut epithelium outlined above . If Dko P25/P28 ookinetes do migrate across the midgut epithelium via a solely intercellular route there is no known reason why these parasites should not also be melanized in the basal region of the midgut epithelium. Consequently, if solely intercellular migration does occur melanized parasites should be found that are not associated with any morphologically abnormal midgut epithelial cells.First, all melanized Dko P25/P28 parasites in the refractory via a solely intercellular route greatly exceeds the number of intracellular ookinetes [via a solely intercellular route, the number of oocysts should greatly exceed the number of ookinetes migrating via an intracellular route .Second, there should be a quantitative relationship between the density of Dko P25/P28 ookinetes associated with morphologically abnormal midgut epithelial cells and the number of oocysts that subsequently develop on the basal surface of the midgut epithelium. Specifically, the number of oocyst stage parasites should be equal to or less than the number of Dko P25/P28 ookinetes associated with morphologically abnormal midgut epithelial cells, as only ookinetes migrating intracellularly are predicted to become oocysts. The Dko P25/P28 ookinetes located between morphologically normal midgut epithelial cells are not expected to transform into oocysts, as these parasites do not enter, and hence cross, the midgut epithelium. The number of ookinetes apparently migrating okinetes . ConsequP. berghei parasites implies that there are two sub-populations of Dko P25/P28 ookinetes, neither of which migrate across the midgut epithelium via a solely intercellular route (Figure An. gambiae and do not give rise to oocyst parasite stages. These parasites remain surrounded by morphologically normal midgut epithelial cells, which do not exhibit the morphological abnormalities associated with parasites invading intracellularly [An. gambiae [The re-interpretation presented here of previously published work on Dko P25/P28 llularly . A seconllularly , GNBP [2llularly , NOS andllularly , undergo gambiae , and for gambiae . Accordi gambiae . HoweverP. berghei ookinetes is unknown. One explanation is that loss of P25 and/or P28 impedes, but does not entirely prevent, penetration of the apical plasma membrane of midgut epithelial cells. Consequently, the entry of Dko P25/P28 ookinetes into the midgut epithelium may be protracted, prolonging the period of exposure to the hostile environment of the midgut lumen, which results in the death of most parasites before completion of midgut epithelial cell penetration. This interpretation is consistent with the observation of lysed Dko P25/P28 parasites on the luminal side of the midgut epithelium [The reason for the existence of the two distinct sub-populations of Dko P25/P28 ithelium .In summary, the unified model of the route of ookinete invasion across the mosquito midgut epithelium suggests a novel, previously unrecognized, function for P25 and/or P28 in mediating ookinete entry into the midgut epithelium. Specifically, the interpretation presented implies that the loss of P25 and/or P28 greatly impairs, but does not entirely abolish, ookinete entry into midgut epithelial cells and probably has relatively little effect on the ability of ookinetes to traverse through the cytoplasm of midgut epithelial cells. A role for P28 in parasite entry into the midgut epithelium is suggested by the deposition of this molecule at the site of ookinete penetration into midgut epithelial cells ,45. ThisCTRP = circumsporozoite and thrombospondin-related anonymous protein-related protein; Dko P25/P28 = double knockout of P25 and P28; GNBP = gram-negative binding protein; MAOP = membrane-attack ookinete protein; NOS = nitric oxide synthase; Sko P25/P28 = single knockout of either P25 or P28; SRPN10 = serine protease inhibitor 10.LAB wrote the manuscript and prepared the figures. LRC revised the manuscript. Both authors read and approved the final version of the manuscript."}
+{"text": "Blind individuals often demonstrate enhanced nonvisual perceptual abilities. However, the neural substrate that underlies this improved performance remains to be fully understood. An earlier behavioral study demonstrated that some early-blind people localize sounds more accurately than sighted controls using monaural cues. In order to investigate the neural basis of these behavioral differences in humans, we carried out functional imaging studies using positron emission tomography and a speaker array that permitted pseudo-free-field presentations within the scanner. During binaural sound localization, a sighted control group showed decreased cerebral blood flow in the occipital lobe, which was not seen in early-blind individuals. During monaural sound localization (one ear plugged), the subgroup of early-blind subjects who were behaviorally superior at sound localization displayed two activation foci in the occipital cortex. This effect was not seen in blind persons who did not have superior monaural sound localization abilities, nor in sighted individuals. The degree of activation of one of these foci was strongly correlated with sound localization accuracy across the entire group of blind subjects. The results show that those blind persons who perform better than sighted persons recruit occipital areas to carry out auditory localization under monaural conditions. We therefore conclude that computations carried out in the occipital cortex specifically underlie the enhanced capacity to use monaural cues. Our findings shed light not only on intermodal compensatory mechanisms, but also on individual differences in these mechanisms and on inhibitory patterns that differ between sighted individuals and those deprived of vision early in life. Blind individuals who localize sound better than sighted subjects recruit visual cortical areas in the process Animals and humans deprived of vision have been shown to have enhanced nonvisual perceptual abilities. Indeed, many blind individuals are extremely efficient in tactile processing, including Braille reading; the talent manifested by some well-known blind musicians, singers, and even piano tuners is often in part attributed to the fact that they were blind since their youth. One may conclude that blind persons should be better in nonvisual tasks since they compensate for their lack of vision by focusing on their remaining modalities. Many studies have in fact shown that some early-blind human subjects outperform sighted persons in nonvisual tasks, such as speech perception ,2,3, unfAnimal studies provide some insight as to the neural substrates underlying such enhanced capacities (reviewed in ). For inSeveral studies using neuroimaging techniques have also established that posterior visual areas in blind individuals may be active during the performance of nonvisual tasks such as Braille reading ,22, memoLocalization of sound, a very important function for the blind, is one domain in which it is particularly useful to study the cross-modal interactions that may occur following visual deprivation. This task entails integration of binaural and monaural cues to derive spatial information. In accordance with the idea that nonvisual processing can be enhanced in the blind, a prior study demonstrated that a subset of early-blind subjects was more accurate than sighted controls (SIG) at localizing sound sources, specifically when using monaural cues . These fThus, in the present study, subjects were first studied in an anechoic chamber using binaural and monaural sound localization tasks. Depending on their performance at the monaural task, they were divided into three groups: (i) early-blind participants who could localize the sounds more accurately than control subjects (early blind with superior performance [EBSP]); (ii) early-blind participants who were unable to localize the sounds any more accurately than controls ; and (iii) SIG. The same localization task was next adapted so that it could be carried out within the positron emission tomography (PET) apparatus, using a speaker array which permitted pseudo-free-field presentations . Two conThe hypothesis tested was that blind persons showing supranormal performance do so because they recruit visual cortical areas to carry out the task. We therefore predicted that they would show activation in visual areas specifically during the MSL task, and not during the binaural or control tasks. The other blind group, which does not have enhanced MSL ability, should not show this activation pattern. We further hypothesized that the degree of visual cortical activity would be predictive of individual differences in the behavioral performance of the monaural task.30, 225 = 6.299, p < 0.01), localization being more accurate in the EBSP group, especially on the side of the obstructed ear. The performance of the EBNP did not differ from that of the SIG. These findings confirm the previous study of Lessard et al. [In the anechoic chamber experiments, only five of the 12 early-blind subjects could accurately localize the sounds monaurally, whereas most of the sighted subjects could not . In orde30,225 = 4.058, p < 0.01; see In contrast, all 19 subjects tested, whether sighted or early blind, could correctly localize sounds binaurally . DespiteDuring binaural localization of the sound, when compared to the control task , cerebraAnother finding from the binaural versus control task contrast was a small region of activation in the visual cortex  of the EBSP group, but not in the other two groups . FinallyOf greatest relevance to our hypotheses, during monaural stimulation (one ear plugged), as compared to control task, right-hemisphere striate and ventral extrastriate areas showed increased CBF only in the EBSP subset of blind subjects . For theWhile parietal and frontal activations were also seen in the three groups, temporal activations were not found for monaural stimulation, the EBNP group showing even some deactivation in temporal areas. The EBSP group also showed some activation in the right cerebellum  but two other significant foci were found in right dorsal extrastriate cortex , and striate cortex . Two of these foci are close to the ones identified in the analyses presented for MSL. These findings support the hypothesis that the visual cortex is directly involved in localizing a sound stimulus in the monaural condition.In order to assess whether occipital activations have a functional role in auditory localization, independent voxel-wise covariation analyses were carried out across the entire group of blind individuals. Irrespective of the group to which they had been assigned, the individual absolute error score was entered as a regressor in the analysis examining covariation with CBF change between overall accuracy at the localization tasks and activation across the entire brain volume, following the procedure outlined by Paus et al. . For MSLThe imaging results of this study support our hypothesis that blind persons recruit occipital areas in the context of auditory localization and, more importantly, the correlation observed with MSL performance strongly suggests that individual differences in reorganization of the occipital cortex have behavioral consequences. Hence, this relationship does not support the possibility that the recruitment is a nonspecific coactivation or a pathological response. Instead, these results suggest that visual cortex is specifically recruited to process subtle monaural cues more effectively.Functional activation of the visual cortex by nonvisual stimulation in the blind has already been shown in several previous studies. Activation of primary and secondary visual areas was observed during Braille reading and other tactile discrimination tasks in early-blind persons . This taOf greatest relevance for the present findings are the results of Weeks et al.  in whichIt is interesting to consider the function of the right occipital areas, which seem to be important for MSL. Monaural cues  are involved in the localization of sounds when one ear is obstructed, or in unilaterally deaf subjects . HoweverCross-modal plasticity may not necessarily be the only mechanism to explain the present results. Some studies have also shown intramodal plasticity in auditory cortex of the blind. For example, the tonotopic region of area A1 in blind persons seems to be enlarged compared to that of sighted subjects , presumaExperience-driven improvements in auditory localization can occur without necessarily invoking cross-modal recruitment. Indeed, some studies have shown that in MSL tasks, practice may lead to increased performance in the case of unilaterally deaf patients  or even Why do some blind persons and not others acquire superior monaural sound localization skills? It may be that these changes are entirely experience-driven. That is, some blind persons may have had more practice navigating or using auditory cues to explore their environments. On the other hand, the individual differences we observed in the degree of cross-modal plasticity could reflect innate factors that remain to be identified. An additional explanation may be that the blind persons who are not better than normal at sound localization may be superior in other nonvisual tasks, such as Braille reading or other somatosensory discrimination, because the visual cortex was preferentially recruited to carry out these tasks instead of auditory ones. If this is the case, it is possible that cross-modal plasticity is limited to a certain extent, such that recruitment of these areas by one modality inhibits recruitment by another. These speculations will have to be explored systematically in future studies.What is the nature of the mechanism implied in the processing of auditory stimuli by visual cortical areas? The specific areas of visual cortex recruited may provide a clue. The analyses yielded one peak in the right V1 area. V1 has already been shown to be activated in other studies examining Braille reading ,22,34, vThe parietal activation observed in all groups during BSL suggests that these areas are important when carrying out the task used in the present experiment see . This fiDuring BSL, the sighted control group (SIG) showed a deactivation in both extrastriate and striate areas of the occipital lobe, a phenomenon that was not observed in either subset of early-blind individuals. Many previous studies with sighted subjects have shown that following stimulation in one modality, cross-modal inhibition occurs in the unattended modalities ,64,65,66Deactivation of primary visual areas has also been seen in sighted subjects during a tactile discrimination task, whereas in blind subjects activation was shown in the same area . Within The present study establishes for the first time in certain early-blind persons a clear relationship between monaural sound localization performance and increased CBF in occipital areas. Indeed, some of the blind persons showed occipital activation that appeared to be functional, since this phenomenon was correlated with a supranormal performance in MSL. This finding suggests that visual deprivation from an early age could lead to important cross-modal plasticity and give blind persons an advantage in using spectral cues to carry out a crucial everyday task, sound localization. Moreover, we report that inhibitory patterns differ between early-blind and sighted individuals. Under binaural conditions, the SIG seemed to inhibit part of the occipital areas when localizing sounds, but this was not the case for either group of blind persons. This differential pattern may provide clues as to how different parts of the brain normally interact during unimodal stimulation, and further suggests that these interactions may be modified in the absence of a sensory modality.It may also be important in future studies to investigate whether blind persons can recruit visual areas in other auditory tasks, for example in a task in which spectral and level cues are relevant but in a nonspatial context. Along the same lines, a spatial discrimination task not requiring the explicit localization of the sounds may also be of interest. One can thus verify that this special competence of some blind persons can be generalized in different auditory contexts other than MSL. Indeed, it would be interesting to know whether this ability is related to more complex tasks such as navigation, obstacle detection, or analysis of sound flow, for example when the subject moves or objects move around the subject. Similarly, it may be pertinent to investigate whether special training or substitution devices, frequently described in the literature, not only improve the relevant behavior but also facilitate cross-modal plasticity.The participants were seven healthy sighted volunteers and 12 early-blind subjects who had lost their vision before puberty, most of them in the first few years of life see . In eachSubjects were asked to localize sounds binaurally or monaurally while they were seated in the anechoic room. The acoustic apparatus used to test sound localization, previously described in detail , consistThe stimuli were broadband noise bursts that lasted 30 ms . The sound pressure level (SPL) was maintained at 40 dB. A stimulus was delivered through a randomly selected loudspeaker and repeated five times for each position. A buzzer warned the subjects that a sound was about to be presented and that they should maintain a stable head position and fixate straight ahead. Compliance with all instructions was ascertained by an experimenter remaining in the chamber behind the subject. The response consisted of pointing with the dominant hand toward the apparent source of stimulation. Lines graduated in 1\u00b0 steps were drawn on the perimeter, and the response of the subject was recorded by the experimenter.For monaural testing, one ear was plugged with a combination of an ear plug (mean attenuation = 37.5 dB SPL) and a hearing protection muff (mean attenuation = 29 dB SPL). In order to compare the overall accuracy in localization between the subjects, the absolute error score was utilized in both the anechoic chamber and scanner experiments. This value is the average of the difference  between the correct position and the response for each trial. To allow combining of data from subjects with left or right ear plugged, the behavioral results were transformed such that the left side was arbitrarily assigned to correspond to the obstructed ear. Thus, in the behavioral data presented, negative angles on the abscissa correspond to the obstructed side, while positive angles correspond to the unobstructed side.In this part of the experiment, subjects were asked to localize sounds binaurally or monaurally while they were lying within the scanner. Monaural testing was carried out using the same ear attenuation procedure as used in the anechoic chamber. All conditions, localization tasks, and their specific control task, were part of a larger study. These conditions were counterbalanced across subjects for the order of scan conditions. Approximately half of the subjects within each group received the ear plug in the left and the other half in the right ear during the monaural part of the scanning session. Auditory stimuli were presented using a circular array of nine speakers, positioned 15\u00b0 apart from \u00b160\u00b0, and having a radius of 24 cm . The arrn = 6) wearing binaural earplugs and ear muffs could not localize any of the stimuli from the speakers. The control task consisted of pointing in alternation to the left and right , after hearing a stimulus pair presented always in the frontal (0\u00b0) position. Two control tasks were tested, one binaural and one monaural; in the monaural case the same ear was plugged as was used for the localization task for that individual. Thus, four conditions were tested in all subjects:BSL, binaural control task, MSL, and monaural control task.The stimuli were two broadband noise bursts that lasted 30 ms and were separated by a 0.5-s intrapair interval while the intertrial interval was 2.5 s. Each pair of stimuli was presented from a single speaker at 60 dB SPL, as measured at the center of the array. Each of the nine speakers was utilized 12 times in random order for a total of 108 trials for each condition. The behavioral tasks were started around 15 s before the beginning of data acquisition with the scanner. The response consisted of pointing with a joystick, placed at the subject's side, to the apparent source of stimulation. It was ascertained before the experiments that all subjects were familiar with the use of the joystick and with the task requirements. In a series of preliminary experiments, it was verified that subjects (2O15 water bolus method [http://www.mrc-cbu.cam.ac.uk/Imaging/). Statistical analysis was performed applying the method described by Worsley et al. [t value of 3.5 was used for significant changes in CBF during exploratory searches. However, a t value of 3.0 was used for a priori regions of interest, such as occipital areas.PET scans were obtained with a Siemens Exact HR+ tomograph  operating in three-dimensional acquisition mode. The distribution of CBF was measured during each 60-s scan using the Hs method . MRI scas method . Each mas method , resultiy et al. ; covariay et al. . A t valFigure S1Sagittal and coronal images contrasting BSL to the control task. All three groups showed increased CBF in the right inferior parietal lobe (as shown by the red arrows), consistent with other neuroimaging studies of auditory localization. X and Y coordinates refer to standardized stereotaxic space.(2.2 MB TIF).Click here for additional data file.Table S1(35 KB DOC).Click here for additional data file."}
+{"text": "Erick H. Turner  notes th"}
+{"text": "Saccharomyces cerevisiae where they organize the septum and link nuclear division with cell division. More recently septins have been found in animals where they are important in processes ranging from actin and microtubule organization to embryonic patterning and where defects in septins have been implicated in human disease. Previous studies suggested that many animal septins fell into independent evolutionary groups, confounding cross-kingdom comparison.Septins are cytoskeletal GTPase proteins first discovered in the fungus S. cerevisiae Cdc10p and human Sept9) and Group 2 (which includes S. cerevisiae Cdc3p and human Sept7) contain sequences from fungi and animals. Group 3 (which includes S. cerevisiae Cdc11p) and Group 4 (which includes S. cerevisiae Cdc12p) contain sequences from fungi and microsporidia. Group 5 (which includes Aspergillus nidulans AspE) contains sequences from filamentous fungi. We suggest a modified nomenclature based on these phylogenetic relationships. Comparative sequence alignments revealed septin derivatives of already known G1, G3 and G4 GTPase motifs, four new motifs from two to twelve amino acids long and six conserved single amino acid positions. One of these new motifs is septin-specific and several are group specific.In the current work, we identified 162 septins from fungi, microsporidia and animals and analyzed their phylogenetic relationships. There was support for five groups of septins with orthology between kingdoms. Group 1 (which includes Our studies provide an evolutionary history for this important family of proteins and a framework and consistent nomenclature for comparison of septin orthologs across kingdoms. Saccharomyces cerevisiae where they have been very well-characterized GxG (SceCdc3 204\u2013209) with each additional position conserved in 86%\u201393% of septins Table .In the G4 GTPase motif  N286 was often replaced by A, S, or G. K and D (SceCdc3 287 and 289) were found in 91% and 99% of septins, respectively. Perfect G4 consensus sequences were found in animal Group 1B and fungal Groups 2A and 4 and in fungi in Group 1A. Derived G4 motifs were found in fungal Groups 3 and 5 and in animal members of Group 1A and 2B. We also detected the pattern NxxPxI (SceCdc3 280\u2013285) immediately upstream of the established G4 motif, with each of the three conserved amino acids in 91%\u201398% of septins. A Prosite search using this extended G4 pattern as query identified other GTPases, so it is not septin-specific.S. cerevisiae septins Cdc3 and Cdc12 where they are required for septin association and function [S. cerevisiae septins and lacks the C-terminal coiled-coil. We analyzed all 162 septin sequences for predicted coiled-coil domains using the COILS [E. cuniculi has only a single Group 3 septin.The coiled-coil is a common structural motif that forms a super helix with heptad repeats and mediates protein-protein interactions ,37. It efunction . A C-terhe COILS  and Multhe COILS . Every mThe Weblogo program assigned bitscores to amino acids in the established G1, G3 and G4 GTPase motifs ranging from a low of 2.7 (SceCdc3 position 204) to a high of 4.3 (SceCdc3 position 126). By considering relative frequency and using positions with bitscores above 2.7, we identified four new septin motifs and designated them Sep1- 4 Table  and six In addition to the four septin motifs, we detected six positions that contained single consensus amino acids in 86%\u201394% of septins Table . One of Mammalian septins exhibit complex expression patterns and can produce a large number of splicing variants . The humGiardia lamblia. If this is considered a primitive septin, then a septin-like ancestor existed before the diplomonads arose. This septin-like ancestor was retained in the diplomonads, animals, fungi and microsporidia, but lost in plants. If the G. lamblia septin-like sequence is part of a separate GTPase family that shares some motifs with septins, then septins may have entered the common ancestor of animals, fungi and microsporidia via a horizontal gene transfer from bacteria, as proposed by Leipe [The origin of the septins in eukaryotes depends upon the interpretation of the septin-like sequence we found in by Leipe .Which ever origin is correct, our phylogenetic analysis suggests that septins might have evolved as follows Figure : The ancTo be considered septin motifs, we required that sequences be at least as conserved as the GTPase motifs. While this stringent cut-off undoubtedly eliminated moderately-conserved or clade-specific sequences, it guaranteed the significance of identified positions. Only one amino acid SceCdc3 117G) within the ten amino acid polybasic region previously shown to bind phosphoinositides  septins matching the respective consensus sequences  are predicted to have a C-terminal region containing a coiled-coil, a motif implicated in protein-protein interactions. Like Cdc10p, all Group 1A septins are missing the C-terminal region that contains the coiled-coil. Group 1B septins are all predicted to contain C-terminal coiled-coils. In elegant work, Versele and Thorner [S. cerevisiae Cdc3p and Cdc12p associate through their C-termini and that Cdc11p and Cdc12p associate independently of their C-termini. In our analysis all Group 2 (Cdc3p) and Group 4 (Cdc12p) septins were predicted to contain C-terminal coiled-coils, while 5 of 29 Group 3 (Cdc11p) septins were not predicted to contain C-terminal coiled-coils. This pattern of conservation suggests that C-terminal coiled-coil interactions might be important for the association of all Group 2 (Cdc3p) septins with Group 4 (Cdc12p) septins while interactions outside the C-terminus might be important for the association of all Group 2 with Group 3 septins. Animals lack Group 4 septins, but Group 1B septins likely play the same role in polymerization by interacting with Group 2 septins. Indeed, mammalian Sept6 (Group 1B) and Sept7 (Group 2B) have been shown to interact via their C-termini leading Versele and Thorner to suggest that the Sept6\u2013Sept7 complex is the animal counterpart of the Cdc3p-Cdc12p complex [In  Thorner  showed t complex . Group 5S. cerevisiae it has become increasingly clear that the septins are important in animals. Earlier work based on septins from only five species suggested that there were no clear orthologs between the septins in fungal systems and those in mammals [We analyzed 162 septins from microsporidia, fungi and animals. Septins were grouped into five classes, modified nomenclature based on these five classes was suggested and there was strong evidence for orthology between septins from different kingdoms. In addition to derivatives of already known G1, G3 and G4 GTPase motifs, four new motifs and six conserved single amino acid positions were identified. Though first discovered and best-studied in the yeast  mammals  confoundSaccharomyces cerevisiae septin protein Cdc3p (GenBank: gi|2507385) as the initial query sequence for PSI-BLAST searches against the non-redundant database (All non-redundant GenBank CDS translations+RefSeq Proteins+PDB+SwissProt+PIR+PRF) at NCBI [We used the 520-residue  at NCBI . PSI-BLAWe used CLUSTALX1.8 for protein multiple sequence alignment . DefaultSaccharomyces cerevisiae Myo2p (gi|6324902) was used as outgroup. We also used PhyML [We used MrBayes v3.1 for phylogenetic analysis . The amied PhyML  for maxiWe checked each sequence for domains with the Simple Modular Architecture Research Tool ,47. An NFP carried out the analysis and drafted the manuscript. RLM participated in the design of the study, helped in the analysis and helped to draft the manuscript. MM participated in the design of the study, helped in the data interpretation and helped to draft the manuscript and revise it critically. All authors read and approved the final manuscript.Septin Derived GTPase Motifs.Click here for file"}
+{"text": "A finite element model has been developed to predict in vivo micro motion between a modular acetabular cup and liner after cement less total hip arthroplasty. The purpose of this study is to experimentally validate the model. Six LVDT sensors were used to monitor the micromotion of the liner when subjected to loading conditions ranging from 250 N to 5000 N. Deformations at points of interest for both the experiment and FEM were compared. Results of the FEM with different coefficient of friction between the liner and the cup were investigated to correlate with the experimental results. Polyethylene wear particles generated from the acetabular liner of an acetabular cup are a cause of the osteolysis associated with acetabular cup failure. Wear generation comes from the articulation of the femoral head and the liner and from the articulation of the liner and the metal shell. Wear generated by micromotion at the liner metal shell interface, termed backside wear, is potentially more damaging because of the egress of the particles to the cup bone interface through the screw holes and the central fenestration in the metal shell. These particles then create an inflammatory reaction that can produce osteolysis of the bone, leading to degradation of the interface and eventual failure. The etiology of micromotion between the metal shell and polyethylene is multifactorial. Important factors include the contact stress , relativThe loading of the hip joint is cyclical and occurs during gait. Impact loading of the hip joint can also occur as a result of subluxation and relocation of the metallic ball in the polyethylene cup. Little work has been done on the effect of physiologic loads on micromotion at the cup liner interface. The load patterns are particularly complex during subluxation relocation because the initial contact at relocation may be eccentric creating a moment. The cylical pattern of loading associated with level gait, stair climbing and the impact from eccentric subluxation and relocation are virtually impossible to reproduce physically in the laboratory. To this end a finite element model has been created to investigate micromotion of the metal shell liner interface. The purpose of this experiment is to validate this model. The validation of the model quantifies micromotion of a loaded acetabular cup liner assembly with linear variable differential transducer (LVDT) sensors.Seven commercially available UHMWPE liners, 28 mm inner diameter and 54 mm outer diameter, were used. The experiment set-up is represented in Figure The acetabular cup was placed into the acetabular shell as recommended by the manufacturer. The acetabular cup was then placed into a custom made jig that held the cup rigidly.  were used during all the experiments. The first had only a polar fenestration and the second had polar fenestration and three screw holes. A sensor positioning plate containing six calibrated LVDT sensors  was rigidly attached to the jig. The LVDT sensors detect linear micromotion in the x, y and z direction. The metal tip of each LVDT sensor was set to zero position when it came in contact with the liner before any loading conditions were applied. Care was taken to locate the sensors' tips away from the liners' anti-rotation tabs. Three of the sensors contacted the liner perpendicularly to the outer flat surface, while the other three contacted the liner perpendicularly from the side  for loading. Load was applied to the acetabular components through a 28 mm, commercially available femoral head attached to the movable crosshead of the INSTRON machine. The femoral head was positioned in the acetabular liner and adjusted until a conforming contact was achieved without applying significant load. The readings on the sensors were still showing zero displacements. This served as the starting point for experimental measurements of load and micromotion.The loading characteristics of each trial were set with the INSTRON computer controller (Merlin 5500 Series). The loading characteristics applied to the liner  were specified. Each specimen (liner) was subjected to the loading profiles described in Table The LVDT sensors were connected through a Data Acquisition Card  to a laptop computer. Using data analysis software , a program was developed to transform the signals from the LVDT sensors into micromotion displacement values. The micromotion values from the LVDT sensors were synchronized with the loads applied with the INSTRON machine.The FEM was then used to generate values for micromotion at the points of attachment of the LVDT on the polyethylene liner. The comparison of results from the experimental and computational models allowed us to validate the finite element model of the modular acetabular component.Three-dimensional computer models of the modular prosthetic components  were developed using Pro/Engineer 2000i2 . Component dimensions used in the models were based on precise measurements taken from commercially available products  using hand instruments.The model was created with a polar fenestration. The same consideration was made to model the liner. Geometrical details without structural significance were omitted in order to import CAD models to the standard ANSYS format (IGES). All 3-D models were converted to IGES format (No-defeaturing option).A three dimensional 3595 elements FE model . The acetabular shell was fully constrained, assuming a rigid union between the acetabular shell and the acetabulum. The femoral head was constrained with respect to the rotational degrees of freedom. Perfect conformity between femoral head and liner as well as between liner and acetabular shell was assumed. Anti-rotation features such as the equatorial locking tabs provide the greatest restraint to keep the liner in the proper position within the shell . When loA similar loading profile to the one used in the experiment was created in ANSYS/LS-DYNA in order to validate the experimental results in terms of stability/micromotion of the liner. The load was applied at the center of the femoral head and varied from no load up to 1775 N applied linearly. The maximum load was based on previous studies in gait  where thPublished reports of the friction coefficient between the metal and polyethylene ranged from \u03bc = (0.083 to 0.2).  TheFigure As described previously, a loading profile, similar to the one in the experiment, was used in the FE model. According to the experimental set-up, the micromotion results corresponded to six specific points, where the sensors' tips came in contact with the liner. The corresponding points were identified in the FE model. Because the LVDT sensors only measure displacements along their longitudinal axes, those directions were identified with simple trigonometric calculation in the FE model through superposition of the experimental axes. The micromotions (displacements) were computed in the FE model of the nodes positioned at the reference points, along the identified direction.Figures In all the experimental data collected from the seven specimens the result obtained in the FE model, for both friction coefficients, are between the maximum and minimum values obtained in the experiment. This is a first check on the validity of the model and its analytical prediction. Considering the average values for the experiment results , the FE model with the lowest value of showed a closer fit and depicts a more realistic response. When modeling conformity it is important to note that the actual liner and cup do not possess such a characteristic, in fact there are gaps due to the geometrical difference of the two components. These clearances will make the friction between the liner and the cup less pronounced; hence a relaxed value in the FE model is more appropriate. Our validation supports such a scenario.This study highlights two main points. One the experiment provides an insight into the stability and micromotion of the liner/cup interface. Indeed it provides the means by which we can quantify the micromotion/load interface in relation to the liner and locking mechanism designs. Second these experiments along with the FE model becomes an important tool in identification of weak spots and areas where both stress and wear can be identified. The objective of this research while focused on several specimens the design of the locking mechanism of the liner with respect to the cup is the same. In future studies we intend to perform a much larger study where different locking mechanisms designs can be compared under different loads and moments.The current investigation has prompted us to suggest areas where we can improve both the FE model as well as learning further how the liners designs affect the results of micromotion and wear. These include: the conformity of the contact surfaces, geometry and tolerances of the CAD model, representation of the liner locking mechanism and material properties. Conformity allows distribution of load more along the equatorial surface of the load and might increase back wear when the material expand and slide along the surface at he interface of the cup/liner. The conformity might also play a significant role in load transfer to the cup and hence changing the micromotion condition at the cup/bone interface. The cup bone interface is a subject of another investigation currently being conducted at our Laboratory.The results of the validation show that the correlation of the micromotion data given by the FE model and the experimental data depend upon the position of each sensor. The sensors positioned along the flat surface of the liner recorded values that closely matched the model. Among those three sensors, the one positioned further to the axis of application of the load registered the best results. The other two sensors positioned in the flat surface of the liner (red and purple) matched closely the results only in the load ranges between 1500 N and 1750 N. Furthermore, the results obtained for the three sensors positioned perpendicularly to the flat surface of the liner are in the same range of the values obtained from the experiment. Therefore, it is clear that the sensors subjected to higher bulging/deformation showed a slight deviation from those in the FE model. These variations might be a consequence of the assumptions made in selection of polyethylene material. A more precise material model would certainly describe the bulging effects more accurately. For example a more accurate description of the material used in the model would be a piecewise linear isotropic plasticity material . This plAnother important assumption made in the model is the treatment of the liner's locking tabs. As describe earlier, the locking tabs were simulated constraining all the degrees of freedom of the nodes placed in the same position as the actual locking tabs. This assumption states that the nodes simulating the locking tabs were completely fixed (constrained) to the acetabular shell and may induce high stress concentration areas. In reality those tabs are designed to have significant gap around them when the liner is fully seated. Surely this factor might permit a more even stress distribution in the elements surrounding the constrained nodes of the locking tabs. This might result in a smaller peak stress values at the nodes.The last hypothesis considered in the present study is concerned with the conformity of the contact areas. Perfect conformity was assumed between liner's backside and acetabular shell inner-surface and between liner's front-side surface and femoral head. In the actual acetabular components certain gaps are allowed between contacting surfaces for both design and manufacturer tolerances. The stress distributions and micromotions achieved in the liner might be different if those gaps were considered and the results obtained might be closer than the one obtained in this study.The objective of the present study was to validate a FE model of modular acetabular prosthesis with data collected experimentally. The model is preliminary and gives a reasonable approximation of values of micromotion obtained experimentally. Further work is needed to enhance the model development and improve the accuracy of the model.E (Young Modulus): MPaKg (Kilogram): Unit of mass (SI)m (meter): Unit of Length (SI)MPa : Unit of Pressure (SI)N (Newton): Unit of Force (SI)min (minute): Unit of Time equal to 60 seconds.-3 meters.mm (millimeter): Unit of Length equal to one 10sec (Second): Unit of Time (SI)\u03bc (mu): Friction Coefficient (Unit-less)-6 meters\u03bcm (micron):Unit of Length equal to 103\u03c1 (rho): Symbol for density. Density units Kg/m\u03bd (nu): Poisson's ratrio (Unit-less)"}
+{"text": "During the last years, the implantation rate of dual chamber defibrillators (ICD) significantly increased worldwide. In 1999, the proportion of dual chamber ICD implants reached 30% in Europe and 50% in U.S.A.  aimed aOn the other hand, new indications for ICD implantation in primary prevention of sudden death and introduction of triple chamber ICDs capable of delivering cardiac resynchronization therapy are going to change very soon the whole approach to ICD selection. The MADIT-2 trial  demonstrCardiac resynchronization has been demonstrated to improve functional class, exercise tolerance and quality of life as well as to reduce hospitalisations due to worsening of heart failure ,37 in pa"}
+{"text": "Erick Turner appropriately points out the high levels of rigor applied during regulatory authorities' review of clinical trial data . However"}
+{"text": "We produced specula for laryngomicroscopy to observe blind spots in the operating field. Use of these specula has facilitated detailed observation of the lower surface of the false vocal folds, laryngeal ventricle, and subglottis, which were previously in blind spots. The specula are useful in the following ways: 1) clarifying blind spots for improved diagnosis and providing more accurate surgical margins; 2) observing the lower lips of the vocal folds in phonosurgery; and 3) Vaporizing with laser reflection. The specula are cheap and easy to use and are well worth considering for application to laryngomicroscopy."}
+{"text": "Schistosoma mansoni uses Biomphalaria glabrata as an intermediate host during its complex life cycle. In the snail, the parasite initially transforms from a miracidium into a mother sporocyst and during this process excretory-secretory products (ESPs) are released. Nitric oxide (NO) and its reactive intermediates play an important role in host defence responses against pathogens. This study therefore aimed to determine the effects of S. mansoni ESPs on NO production in defence cells (haemocytes) from schistosome-susceptible and schistosome-resistant B. glabrata strains. As S. mansoni ESPs have previously been shown to inhibit extracellular signal-regulated kinase (ERK) phosphorylation (activation) in haemocytes from susceptible, but not resistant, B. glabrata the regulation of NO output by ERK in these cells was also investigated.S. mansoni ESPs (20 \u03bcg/ml) over 5 h displayed an increase in NO production that was 3.3 times greater than that observed for unchallenged haemocytes; lower concentrations of ESPs (0.1\u201310 \u03bcg/ml) did not significantly increase NO output. In contrast, haemocytes from susceptible snails showed no significant change in NO output following challenge with ESPs at any concentration used (0.1\u201320 \u03bcg/ml). Western blotting revealed that U0126 (1 \u03bcM or 10 \u03bcM) blocked the phosphorylation (activation) status of ERK in haemocytes from both snail strains. Inhibition of ERK signalling by U0126 attenuated considerably intracellular NO production in haemocytes from both susceptible and resistant B. glabrata strains, identifying ERK as a key regulator of NO output in these cells.Haemocytes from resistant snails challenged with S. mansoni ESPs differentially influence intracellular NO levels in susceptible and resistant B. glabrata haemocytes, possibly through modulation of the ERK signalling pathway. Such effects might facilitate survival of S. mansoni in its intermediate host. Mytilus galloprovincialis, Lymnaea stagnalis and Biomphalaria glabrata defence cells (haemocytes); while nNOS has been found in L. stagnalis and Aplysia californica neurons [Nitric oxide (NO) is a highly reactive molecule produced by mammalian, invertebrate and plant cells. In mammals, NO functions as a neuronal messenger molecule, a vasodilator of smooth muscle, a regulator of cell proliferation and apoptosis, and a cytotoxic effector . NO is s neurons -11. To dSchistosoma mansoni and its molluscan intermediate host B. glabrata, from initial infection with miracidia to the development of mother sporocysts, subsequent daughter sporocysts, and finally the production and release of cercariae from the snail [Schistosoma mansoni excretory-secretory products (ESPs) generated during the miracidium to mother sporocyst transition are known to modulate a range of physiological functions in B. glabrata haemocytes [S. mansoni ESPs on haemocyte NO generation in snails has not been investigated. In the present study it is shown that haemocytes from schistosome-susceptible and schistosome-resistant strains of B. glabrata generate different levels of basal NO and that S. mansoni ESPs increase intracellular NO production in haemocytes from resistant snails only. Previous studies have shown that the extracellular signal-regulated kinase (ERK) signalling pathway plays an important role in controlling NO and hydrogen peroxide (H2O2) output in L. stagnalis haemocytes [S. mansoni ESPs (10 \u2013 20 \u03bcg/ml) have been found to inhibit ERK signalling in haemocytes from schistosome-susceptible, but not resistant, B. glabrata [B. glabrata strains.A number of complex interactions exist between he snail . Schistoemocytes ,14. To democytes ,15. Furtglabrata . In the P \u2264 0.01). After 5 h of ESP challenge, the increase in mean NO production (from 0 min) by haemocytes from resistant snails was 3.3 times that of saline-only controls . In contrast, mean NO output by haemocytes from susceptible snails decreased slightly when challenged with ESPs; although this difference was not statistically significant, a decrease was observed consistently from three biological replicates. Schistosoma mansoni ESPs (20 \u03bcg/ml) gave little or no auto-fluorescence over time, thus the presence of ESPs in the assay did not affect the fluorescence values. Interestingly, there was a considerable difference in the basal NO outputs produced over time between unchallenged haemocytes from resistant and susceptible snail strains, with haemocytes from susceptible snails producing 2.6 times more NO than haemocytes from resistant snails after 5 h of incubation   Fig. . ViabiliIn order to compensate for the fact that resistant snails generally have twice as many haemocytes compared with susceptible snails , an equaP \u2264 0.05) . As a general linear relationship between NO generation by haemocytes and time was observed during the first 2 h incubation in previous experiments  Fig. .B. glabrata haemocytes, cells were pre-incubated with U0126, a highly selective inhibitor of mitogen-activated protein kinase kinase (MEK1/2), the upstream kinase responsible for ERK phosphorylation (activation). This inhibitor has been used previously in studies with L. stagnalis haemocytes [P \u2264 0.05)  Fig. . Haemocy05) Fig. . The pre05) Fig. . Haemocy05) Fig. .S. mansoni ESPs' ability to attenuate ERK signalling in haemocytes from the susceptible B. glabrata strain, with no effect in those from the resistant strain [L. stagnalis haemocytes [The effect of ESPs on haemocyte NO production is strain specific; haemocytes from schistosome-resistant snails displayed significantly increased NO output after ESP challenge. Previous studies using the same snail strains have highlighted t strain . In the emocytes .Euprymna scolopes, the moth, Manduca sexta, the sea squirt, Ciona intestinalis and the snail L. stagnalis [et al., [E. coli, while haemocytes from the bivalve M. galloprovincialis were shown to generate superoxide and nitrites following exposure to phorbol myristate acetate (PMA), laminarin and during yeast cell phagocytosis [L. stagnalis or M. galloprovincialis haemocytes [Ruditapes decussates [A highly sensitive NO probe (DAF-FM diacetate) which detects intracellular NO was used in this investigation. This probe has been used previously in other invertebrate models including: the squid, tagnalis ,19-21. Itagnalis ,11. Fran[et al.,  identifiocytosis . Lipopolemocytes ,6, but dcussates .B. glabrata are known to play a crucial role in killing schistosome sporocysts [B. glabrata strains in their oxygen-dependent killing mechanisms [Schistosoma mansoni ESPs are known to affect the physiology of haemocytes; cell motility, phagocytosis of zymosan particles, and the production of reactive oxygen metabolites are differentially modulated in susceptible and resistant B. glabrata strains by S. mansoni ESPs [Oxygen-dependent killing mechanisms in molluscs such as orocysts ,25,26. Ichanisms . Schistooni ESPs -30.B. glabrata haemocytes from susceptible and resistant snail strains were found to be affected differentially by S. mansoni ESPs. Haemocytes from resistant snails had a significantly greater increase (3.3 times) in NO production than controls following 5 h ESP challenge, while haemocytes from susceptible snails were not significantly affected. Furthermore, basal levels of NO  were significantly different between the two snail strains, with haemocytes from susceptible snails producing relatively more NO over time. The reason for the basal NOS activity in extracted haemocytes is unknown; similar basal activities were also observed previously in extracted L. stagnalis haemocytes [B. glabrata strains maintain higher levels of intracellular superoxide and hydrogen peroxide when stimulated with S. mansoni ESPs and PMA, respectively, compared to susceptible strains [et al. [S. mansoni ESPs on hydrogen peroxide generation in haemocytes from resistant B. glabrata.In the present study, NO levels in  strains ,31. Hahn [et al.  reported [et al.  reportedM. galloprovincialis haemocytes by approximately 13-fold, an effect which was reduced in the presence of a protein kinase A (PKA) inhibitor [L. stagnalis haemocytes [B. glabrata haemocytes. The inhibitor also substantially attenuated ERK phosphorylation in haemocytes from both snail strains. This implies a role for ERK signalling in NO output through NOS regulation, similar to that reported in L. stagnalis haemocytes [B. glabrata haemocytes with PMA, galactose-conjugated BSA, or through the process of encapsulation and phagocytosis is also partially regulated by ERK signalling [Human recombinant interleukin-2 (IL-2), a known NO stimulant for mammalian macrophages, was found to enhance considerably NO production in nhibitor . Thus a emocytes . Here, iemocytes . Extracegnalling ,33.B. glabrata challenged with ESPs display significantly reduced ERK phosphorylation [et al. [B. glabrata haemocytes extracts, whereas two ERK isoforms are sometimes detected in L. stagnalis [Earlier work has shown that haemocytes from schistosome-susceptible rylation . In the  [et al. ; only ontagnalis . Moreovetagnalis . In addiin vivo. In the present in vitro study, schistosome-susceptible snail haemocytes have been shown to produce more intracellular NO under basal conditions than those of resistant snails . Why thsurvival ,35. Furtsurvival ,37.B. glabrata has revealed notable strain-dependent differences in the capacities of these cells to produce NO under basal conditions, and in the presence of S. mansoni ESPs. Haemocyte NO output appears to be regulated by the ERK signalling pathway, which might be important for the outcome of infection, particularly as S. mansoni differentially influences ERK activation in these defence cells [Investigation of NO generation by haemocytes from schistosome-susceptible and schistosome-resistant ce cells . AlthougB. glabrata strain resistant to S. mansoni (NHM3017), originally derived from BS90, and a B. glabrata strain susceptible to S. mansoni (NHM1742). All snails were maintained at 26\u00b0C with a 12 h: 12 h, light: dark cycle, and were fed fresh round lettuce twice-weekly. The life cycle of S. mansoni (Belo Horizonte strain) was maintained in albino CD1 mice; animal use received appropriate ethical approval.Snails used in this study included a In vitro transformation of S. mansoni miracidia into mother sporocysts and collection of S. mansoni ESPs have been described previously [S. mansoni-infected mice livers and spleens were isolated and placed in spring water (Evian). Hatched miracidia were then collected using a pipette and were washed in spring water and concentrated using a Stericup HV filter unit, with a 0.45 \u03bcm membrane . Approximately 60,000 miracidia were left to transform in 25 cm2 vented sterile tissue culture flasks  at 26\u00b0C for 36\u201340 h in sterile Chernin's balanced salt solution (CBSS) [g to remove any particulates. The supernatant was then concentrated approximately 10\u201320 times at 4\u00b0C, in Vivapore 10 ml concentrators  with a 7,500 molecular weight cut off. The protein concentration of the ESP preparation was then determined with the NanoOrange fluorescence-based protein assay kit  and a Fluorstar Optima microplate spectrofluorometer , using bovine serum albumin (BSA) as the protein standard. The ESP solution was aliquoted and stored at -20\u00b0C.eviously . Brieflyn (CBSS)  with gluB. glabrata using the head-foot retraction method, pooled, and diluted in CBSS (2 parts haemolymph: 1 part CBSS). Either 100 \u03bcl of diluted haemolymph (containing approximately 7.5 \u00d7 103 haemocytes in resistant samples or 4 \u00d7 103 cells in susceptible samples) or approximately 3 \u00d7 103 cells per well from each snail strain were used to create cell monolayers in the individual wells of 96 well culture plates . Estimation of cell numbers was performed using disposable haemocytometers . Haemocytes were left to adhere for 30 min at room temperature (RT), subsequently the haemolymph was removed and the cell monolayer washed twice with 250 \u03bcl CBSS. A fluorescent dye, 4-Amino-5-methylamino-2',7'-difluorofluorescein (DAF-FM) diacetate (Molecular Probes), which is highly sensitive to intracellular NO, was dissolved in dimethyl sulfoxide (DMSO) and added to the cell monolayer at 5 \u03bcM ) for 1 h in the dark at RT. Cells were then washed twice with 100 \u03bcl CBSS before being challenged with S. mansoni ESPs (0\u201320 \u03bcg/ml). These ESP concentrations were chosen as they are similar to those used in a previous study in which ESPs were shown to differentially module ERK signalling in haemocytes from the same snail strains [Haemolymph was extracted from  strains . The conThe ERK pathway inhibitor, U0126 , was dissolved in DMSO and used at a final concentration of 1 \u03bcM or 10 \u03bcM in CBSS ). This inhibitor has been used previously to block MEK1/2 phosphorylation (activation) in molluscan haemocytes ,16,18. Cin vitro culture in 96 well plates. Percentage cell death was calculated based on the uptake of 0.2% trypan blue. A commercially available CellTiter 96 AQueous One Solution Cell Proliferation Assay  was also used to monitor cell viability; the assay contains a tetrazolium compound that is bio-reduced by active cells into formazan. Cell monolayers were incubated in either 100 \u03bcl CBSS, or 100 \u03bcl ESP (20 \u03bcg/ml) in CBSS; 20 \u03bcl of CellTiter 96 AQueous One Solution reagent was pipetted into each well and left for 1 h before the absorbance (at 490 nm) was measured over 5 h.Extracted haemocytes (in the presence and absence of 20 \u03bcg/ml ESPs) were assessed for their viability after 3\u20135 h Diluted haemolymph 250 \u03bcl) (2 parts haemolymph: 1 part CBSS) was pipetted into individual wells of a 48 well flat bottom culture plate (Corning Costar) and haemocytes were left to adhere for 30 min at RT. The haemolymph was then removed and the cell monolayer washed twice with CBSS before U0126 was added to the wells at 1 \u03bcM, or 10 \u03bcM, for 20 min at RT. The medium was removed and 25 \u03bcl of boiling 1 \u00d7 SDS-PAGE sample buffer was added to the monolayers to solubilize haemocyte proteins. Samples were sonicated for 30 s and boiled for 5 min; once cooled, the samples were loaded onto discontinuous SDS-PAGE gels, containing 10% acrylamide in the resolving gel. A protein extract from a mammalian cell line (HC60) was also loaded onto the gel as a positive control. Separated proteins were then electrophoretically transferred onto a Hybond nitrocellulose membrane , which was blocked for 1 h at RT with 5% (w/v) non-fat dried milk in Tris-buffered saline (TBS) containing 0.1% (v/v) Tween-20 (TTBS). The membrane was incubated overnight at 4\u00b0C in anti-phospho-p44/42 (Thr202/Tyr204) MAPK primary antibody  BSA) and was subsequently washed three times in TTBS. This antibody has been used previously to detect molluscan phosphorylated (activated) ERK-like proteins [0 \u03bcl . Where appropriate, paired Student's t-test was used to calculate statistical significance at 2 h between samples.The authors declare that they have no competing interests.ZZ carried out the experimental work, interpreted and analysed the data and wrote the manuscript. AJW conceived the project, provided technical support and helped draft the manuscript. AJD conceived the project and provided significant support to the preparation of the manuscript. RSK conceived the project and critically revised the manuscript. DR conceived the project, critically revised the manuscript and gave the final approval of the version to be published. All authors read and approved the final manuscript."}
+{"text": "The current demographic transition will lead to increasing demands on health services. However, debate exists as to the role age plays relative to co-morbidity in terms of health services utilization. While age has been identified as a critical factor in health services utilization, health services utilization is not simply an outcome of ill health, nor is it an inevitable outcome of aging. Most data on health service utilization studies assess utilization at one point in time, and does not examine transitions in health service utilization. We sought to measure health services utilization and to investigate patterns in the transition of levels of utilization and outcomes associated with different levels of utilization.We conducted a population-based retrospective cohort study of all Ontario residents aged 65+ eligible for public healthcare coverage from January 1998-December 2006. The main outcome measure was total number of utilization events. The total is computed by summing, on a per annum basis, the number of family physician visits, specialist visits, Emergency Department visits, drug claims, lab claims, X-rays, CT scans, MRI scans, and inpatient admissions. Three categories of utilization were created: low, moderate, and high.There is heterogeneity in health services utilization across the late lifespan. Utilization increased consistently in the 9-year study period. The probability of remaining at the high utilization category when the person was in the high category the previous year was more than 0.70 for both males and females and for all age groups. Overall healthcare utilization increases more rapidly among the high users compared to the low users. There was negligible probability for moving from high to low utilization category. Probability of death increased exponentially as age increased. Older adults in the low utilization category had the lowest probability of death. The number of male nonagenarians increased more rapidly than female nonagenarians.There are measurable and identifiable differences in the patterns of health services utilization among older adults. This data will permit clinicians and policy makers to tailor interventions appropriate to the risk class of patients. There is a demographic transition occurring in the developed world. An aging population creates new demands on health services . Health Debate exists in the health services literature concerning the role age plays relative to co-morbid illness in terms of health services utilization. Is the primary explanation for increases of utilization seen in the late life course related to age or the worsening of health status and the accumulation of chronic diseases? Many studies have identified age as a critical factor in health services utilization, These studies have failed to emphasize or acknowledge that i) health services utilization is not simply an outcome of ill health and ii) health services utilization is not an inevitable outcome of aging . FactorsIt is critical to understand, at both the clinical and population level the determinants of the transition in health service utilization in the late life course. Transitions, in this study, refer to changes in the pattern of health service utilization over time, particularly in relation to the number of health service utilization events an individual experiences over a set period of time. It is likely that this is a dynamic process influenced by a large number of factors including changes in health status. Transitions in health services utilization can be understood as events in a dynamic system occurring with measurable probability. These probabilities may vary by the age and gender of the individual.Most studies on health service utilization in the late life course assess utilization at one point in time and hence do not capture the dynamics of transitions in utilization of health services. The existence of large administrative databases in the province of Ontario, including the healthcare records of more than 6 million residents age 65 and older, over a period of many years, provided the opportunity to conduct linked population-based studies by age and sex to study in detail healthcare utilization at the population level over time. This unique opportunity allows us to understand better the transitions in health service utilization while testing epidemiological methods that may result in clinically relevant tools.To the best of our knowledge, no previous study has measured the transition between levels of health service utilization among the population 65 years of age and older using population-based data. The objectives of this study are:1.) To describe trends in health service utilization by age and gender in the population of Ontario over the age of 65.2.) To measure the transition probability in the level of health service utilization for people 65 years and older for a nine year period, as well as the relationship of the transition probability to age and gender.3.) To measure trends over time for the transition probabilities for different age groups and genders.4.) To measure the association between the level of health service utilization and mortality.We conducted a population-based longitudinal cohort study to examine the health service utilization events over a 9-year period . All Ontario residents 65 years of age or older who were eligible for the Ontario Health Insurance Plan (OHIP) and who had at least one contact with healthcare system were included in the study. OHIP includes all fee-for-service physician claims. Doctors and patients enrolled in alternative payment plans, who are still in the minority, were not captured, nor were utilization events within other sectors of the Ontario health care system not covered by OHIP. . Services provided to patients without valid OHIP numbers and/or out-of-province patients were excluded from the analysis. If a person did not have any contact with the healthcare system for two consecutive years or if they were dead, he/she was excluded from the follow up after his/her last date of contact. Patient health card numbers were used to identify age and sex from the Ontario Registered Persons Database. Subjects were grouped by sex and 5-year age intervals.We quantified healthcare utilizations by adding the number of family physician (FP) or general practitioner (GP) visits, number of specialist (SP) visits, number of inpatient admissions, number of X-Ray, CT, and MRI tests ordered, number of emergency department (ED) visits, and number of drug claims over period of one year. This index number will be referred to as the number of events. This index measures the level of individual health care utilization.Four data sources were used to conduct the analysis: 1) Ontario Health Insurance Plan (OHIP) database, 2) Ontario Drug Benefit (ODB) prescription claims database, 3) Canadian Institute for Health Information (CIHI) database, and 4) Ontario Registered Persons Database (RPDB).The OHIP database covers all claims made by fee-for-service physicians, community-based laboratories, and radiological facilities paid by the Ontario Ministry of Health.The ODB prescription claims database contains information on outpatient prescription drug use and costs for all residents over 65 years of age in Ontario. Ontario residents may fill prescriptions at any pharmacy within the province. The CIHI discharge abstract database contains clinical administrative data relating to the health care services provided to patients by all hospital facilities in Ontario. The RPDB contains data on mortality.All the databases allow the linkage of individuals across each database through the use of a confidential, scrambled health card number. No personal identifiers are available with these administrative data.All OHIP fee codes were reviewed to identify consultations, examinations, and procedures. Office visits to FP/GP or specialists were based on the physician's specialty and visits located in the physician's office. For all physician types, multiple fee codes billed by the same physician on the same day were counted as one visit. Emergency room visits were extracted for the entire study population using an algorithm developed at the Institute for Clinical Evaluative Sciences (ICES). Fee codes were also used to identify X-rays and MRI and CT scans, limited to one scan per patient per day. All laboratory procedures or tests performed during our study period were also included in the analysis.The ODB prescription claims database was used to determine number of drug claims. Data from the CIHI were used to determine the number of inpatient admissions. Our measure of total utilization events was computed by summing all utilization events occurring during the study period .We used Cronbach's Alpha to examine the internal consistency within our measures. Generally, Cronbach's Alpha of size 0.7 and above is acceptable. Each person was followed for up to nine years and was classified in each year of follow up as a low user if the total number of events was lower than the first quartile (Q1), a moderate user if total number of events was less than the third quartile (Q3), and a high user otherwise. We did not change these groupings for different genders and age groups in order to keep the measures simple and consistent.Transition probabilities are the probability of moving from one utilization group to another within one year. Mortality probabilities are the probability of death within one year. We estimated the transition probabilities for each gender by age group by calculating the ratio of the number of transitions between utilization groups.The occurrence of events over time in medical studies can be described as a finite state stochastic process with states representing health status or level of health service utilization . PreviouAll analyses were done using SAS software version 9.1 . This study was approved by the Research Ethics Board of Sunnybrook Health Sciences Centre.The yearly (1998 to 2006) estimated Cronbach Alpha for number of FP/GP visits, SP visits, ER visits, inpatient admissions, drug claims, lab claims, X-rays, CT scans, and MRI scans ranged from 0.74 to 0.76 which confirms the internal consistency for the measure of total utilization events as an appropriate index.Table The classification cut points for the transition probability analysis  are given in Table The trends over time for the percent of female and male patients among different utilization categories for all age groups are given in Table Transition probabilities for males and females to move from one utilization category to another in the next year are presented in Table Males and females have approximately the same probability of staying in the moderate utilization category or moving to either the low or high utilization category when their present utilization category is moderate. Both males and females, regardless of their age, have a very low probability of moving to the low utilization category in the next year when their present utilization category is high. Males are more likely to move from the high to the moderate utilization category in one year than are females. Table The probability of remaining at the high category when the person is in the high category the previous year is more than 0.70 for both males and females, and for all age groups. However, the transition probabilities from the high category to the low or moderate category the next year are less than 0.02 and 0.29 respectively. The transition probabilities of moving from the moderate to the high category range from 0.13 to 0.26.We examined the trends of transition probabilities from the low user category to moderate and high users, from moderate to low and high users, and from high users to moderate and low users over a period of nine years (data not shown). The probability of moving from the low to the high category for both males and females increased over time for people age 79 and over, whilst the probability of moving from the low to the high category did not change over time for both genders age 65 to 79 years. The probability of moving from the low to the moderate utilization category was fairly flat over time for both genders. The probability of moving from the moderate to the high category for both genders age 65-85 was flat over time, while it increased over time for both genders age 85 and over. The probability of moving from the moderate to the low utilization category was flat over time for females, while it decreased for males. The probability of moving from the high to the low utilization category slightly decreased over time for both genders.Males who were in the high category had a higher probability of death compared to females who were in the high category for all age groups Figure . This diOur study, using population-level data, indicates significant heterogeneity in the level of health services utilization among older adults. Several important trends emerge over the 9 year period. The population of men aged 90 and over who had contacts with healthcare system grew faster than the population of women in the same age group. The population in the high utilization category increased more rapidly than those in the low utilization category. Our estimated transition probability models demonstrate that when a person moves to the high utilization category, it is almost impossible to transition back to the low utilization category. High users are more likely to stay in the high category than move to the moderate category. It is not clear what is driving this constant increase over time. Finally, those in the high utilization category have a higher probability of death the next year than moderate or low users.The magnitudes of the transition probabilities from the low and moderate utilization categories to the high category are substantial and indicate high demands on patients and their families, on professional health care providers, and on the health care system itself. The increase in health service utilization in older adults has been shown to be largely associated with poorer health outcomes .A large amount of utilization is associated with medications . As Nie Our results show that women have higher rates of health services utilization than men in all years and in all age groups. This is consistent with a previous study that concluded gender is an important predictor of medical care use before and after removing sex-specific utilization .Our data show that mortality is consistently higher in the high utilization groups of both genders, though with dramatic differences. Males in the moderate and low categories of health service utilization had a higher probability of death the next year than females in the moderate and low utilization category. However, males in the low utilization category surviving past 95 years of age demonstrated a significant drop in mortality probability. In a previous study looking at the risk of mortality among older adults over an 8-year period, the six most salient predictors of mortality were identified as the mean annual number of hospital episodes after baseline, age, female gender, non-kin social supports, body mass, and having a history of diabetes . In anotOur results also depict a disconcerting trend in the increase of utilization on an annual basis. The first and third quartiles showed 30% and 28% increases over the study period, indicating a progressive escalation of baseline utilization rates in these categories. This means that, on average in each year, the cut point for the low, moderate and high use categories crept upwards. However, it is unclear what benefit is conferred by steadily increased utilization. While the data do not permit commentary on the appropriateness of the increasing levels of utilization over time, they certainly point to scenarios of problematic sustainability, particularly in an era of cost containment and fiscal restraint. It is imperative that research into determining the appropriate level of utilization be conducted as well as more precise delineation of outcomes of care in advanced age.The reason for the increases in health service utilization over time is unclear. It is not likely a function of increased physicians supply, as Ontario has a chronic shortage of family physicians. The supply of family physicians has not kept pace with population increases. The most significant increases in utilization are associated with medication claims. Thus, it seems reasonable to hypothesize that changes in clinical practice guidelines may be implicated in the increase in utilization, as many medications require ongoing laboratory monitoring and follow up. This will be a topic for future research.While our data shows that health service utilization increases with age, there is also evidence of resiliency in the older population, in that it identifies a growing cohort surviving into the oldest age group who were more likely to have been low users of health care services initially. On the other hand, the data suggest significant challenges in sustainability. The combination of the increasing number of people age 65 and over, with increasing probabilities of moving into the high utilization category with age, and the unlikely chance of reducing healthcare services utilization indicates that healthcare utilizations may increase exponentially with attendant cost escalation. This emphasizes the overarching importance of prevention and health promotion in the years preceding age 65 and beyond. The healthier one is entering the later years, the less likely one will require health services.There are very few published peer-reviewed studies examining the association between age and healthcare service utilization using the transition probability matrix at a population level. The present study uses a very large sample with reliable administrative database linkages for a comprehensive array of indicators of health service utilization over a long duration. The use of administrative data provides significantly better predictions of death than variables obtained from interview data .There are several potential limitations with our study. The OHIP database includes only fee-for-service claims, therefore, doctors and patients enrolled in alternative payment plans, who are still in the minority, were not captured, nor were utilization events within other sectors of the Ontario health care system . Exclusion of these services leads to an underestimation of overall utilization of services. The Ontario Drug Benefit database includes only the prescriptions dispensed for residents of Ontario age 65 and over and thus will not capture over the counter medication usage. Thus the models no doubt underestimate total health service utilization. However, the model captures the majority of services provided under the universal health care insurance program in Ontario. As well, the models may underestimate the numbers of people in the higher utilization categories in the later years of the study. Rather than employing fixed cut points, we left the categorization of utilization levels vary by year. Had we used an absolute cut point, we would likely have had greater numbers in the higher utilization categories.Utilization variables which were used for categorizing the residents of Ontario into one of the low, moderate, or high utilization categories were not weighted to account for the fact that a visit to the emergency department or hospital admission may reflect a more serious illness than a visit to a family physician. Also, although this study assumes independence of date, patients often schedule multiple appointments on the same day so as to minimize the total number of trips. The number of utilizations for those residents who left the province for a period of less than two years is under-counted, which could inflate the probability of moving from the high utilization category to the moderate or low category and deflate the probability of moving from the low or moderate category to the high utilization category.Finally, the present study did not look at health service utilization of younger persons and that they too can be high users of health services.This pattern of findings highlights the need for a long-term strategy in aging with a focus on chronic disease management This is The authors declare that they have no competing interests.RU and RM conceived the study. RM and LW conducted the data analysis. All authors contributed to the interpretation of the data and all authors were involved in the preparation of the manuscript. All authors have read and approved the final manuscript version. RU is the principal investigator of the study and will serve as guarantor.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/10/306/prepub"}
+{"text": "When we perceive a visual object, we implicitly or explicitly associate it with an object category we know. Recent research has shown that the visual system can use local, informative image fragments of a given object, rather than the whole object, to classify it into a familiar category. We have previously reported, using human psychophysical studies, that when subjects learn new object categories using whole objects, they incidentally learn informative fragments, even when not required to do so. However, the neuronal mechanisms by which we acquire and use informative fragments, as well as category knowledge itself, have remained unclear. Here we describe the methods by which we adapted the relevant human psychophysical methods to awake, behaving monkeys and replicated key previous psychophysical results. This establishes awake, behaving monkeys as a useful system for future neurophysiological studies not only of informative fragments in particular, but also of object categorization and category learning in general. Visual object perception is inextricably linked to object categorization. When we recognize an object, we classify it, however implicitly, into a known category. Various object recognition tasks, including detection, identification, and discrimination, are all categorization tasks of one type or another Object categorization has been a challenging computational problem because it has not been clear how to handle the enormous range of image instances for a category . For example, an instance of \u201chuman face\u201d can be the image of any of an indefinite number of women, men, children, etc under a variety of viewing conditions . This raises the question of how to determine critical features for reliable categorization.per seAn important computational insight to emerge recently in this regard is that some features, or \u2018fragments\u2019, of the image can be objectively more informative about category membership than the image taken as a whole We have previously used human psychophysical studies to help understand how we learn and use informative fragments Here we report that we have adapted these behavioral paradigms to macaque monkeys, and that the human psychophysical results are essentially replicable in monkeys. This report presents the monkey behavioral results so as to be as closely comparable to the previous human psychophysical study In order to adapt our previous human psychophysical paradigm We created several dozen naturalistic object classes using the VP The monkeys were trained and tested using multiple subsets of these classes. Consistent with our previous human psychophysical study i.e., the more information it conveys).In Experiment 1, we used the three object classes, X, Y and Z, shown in Fragments in Experiment 2 were isolated in an identical fashion, except that the Main task was to distinguish class Z from class X (see vs. class Y (see inset). Note that at the start of the training, either animal performed at chance levels, indicating that the specific classes needed to be learned before the animals could classify the objects successfully. After several hundred trials, the performance of both animals was significantly above chance levels .The experiments consisted of training the monkeys using whole objects and then testing the animals using fragments, in both cases using a delayed same-different categorization task . Thus, the animals were able to categorize the objects based on each of the Main fragments by itself, consistent with the above hypothesis.The various fragments used in Experiment 1 are shown in p>0.05). That is, the animals were about equally likely to classify an object as belonging to class X or class Y on the basis of a given Control or IPControl fragment. Therefore, although all three types of fragments belonged to class X, only the Main fragments, which contained informative information about the class, were likely to be assigned to class X.Moreover, the animals were unable to perform the Main task above chance levels using any of the Control or IPControl fragments . These results are consistent with a scenario where the animals learned the fragments to asymptotic levels during training with whole objects, and therefore rewarding them during testing did not result in any further learning.One potential concern about the above results is that the animals may have learned the fragments during the testing itself, because they were rewarded for correct responses. If this is the case, one would expect that (a) the performance would be at or near chance levels at the beginning of testing, since the animals had not encountered the fragments before, and (b) the performance would improve during the course of testing, as the animals presumably learned the fragments based on feedback implicit in the rewards. An examination of the testing data showed that neither of the above scenarios was applicable to our data . The perrandom rewarding, provided the testing blocks were relatively short  and were interspersed with the \u2018refresher\u2019 training blocks when the animal was rewarded non-randomly (data not shown). However, we found that testing with the above non-random reward regimen is preferable, since it elicited highly stable performance even when the testing blocks were up to 1000 trials long (data not shown).We also found that similar stable, asymptotic performance during testing can be obtained with p>0.05; data not shown).We enlarged all the stimuli (including fragments and whole objects) corresponding to their intended eccentricity to help compensate for the progressive reduction in visual acuity with increasing eccentricity . This indicates, as expected from previous studies The green circles and red triangles in The present study is important in two main respects. First, it provides additional behavioral confirmation, in macaque monkeys, of our previous human psychophysical finding that informative fragments are learned during category learning. Second, it adapts the study of category learning and fragment-based categorization to macaque monkeys and makes it suitable for not only behavioral studies, but also future neurophysiological studies.We have previously offered a detailed explanation of the implications of fragment-based category learning per se and did not use fragments to access the internal representations of whole objects. It is also worth noting that the animals were able to perform the categorization task using relatively brief stimulus duration .Two previous human studies, Harel et al Our result that fragment-learning accompanies category learning is significant, because it straightforwardly links category learning with categorization, in that informative fragments play a role in both. To the extent that informative fragments have potential neural correlates at intermediate levels of visual processing cf., \u2018Greebles\u2019 Apart from the fact that the VP algorithm represents a novel method of creating object categories .Second, note that although we used digital embryos as the substrate for VP in the present study, any virtual object, biological or otherwise, real-world or otherwise, can be used as VP substrates, and the algorithm can be readily modified to simulate more complex phylogenetic processes  as well as long term studies  of neural mechanisms of category learning.Finally, if necessary, both within-class variants and between-class variants can be artificially selected to fit desired distributions. This means, on the one hand, that the categories can be generated based on, or independently of, an i.e., reward) regimen, eccentric stimulus presentation with central fixation, M-scaling, and delayed (rather than simultaneous) categorization. Of these, the latter three modifications were made with future neurophysiological studies in mind, where it is more likely than not that the recording locations will be parafoveal. When parafoveal viewing or neurophysiological recording is not contemplated, one or more of the modifications can be dispensed with as appropriate. Only the reward regimen needs to be necessarily different for monkeys.It is worth noting that all the key human psychophysical results were reproducible in monkeys despite the four major adaptations mentioned earlier: modifications in feedback . The images were stored as 8-bit, 256\u00d7256 pixel grayscale bitmaps.As input to VP, we used novel, naturalistic virtual 3-D objects called digital embryos All animal-related procedures used in this study were approved in advance by the Medical College of Georgia Institutional Animal Care and Uses Committee . All animal protocols fully conformed with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and with the recommendations of the Weatherall Report.Macaca mulatta; 8\u20139 kg) were used in this study. Prior to behavioral training, each animal was implanted with a custom-made titanium head-post using titanium cranial screws  and an acrylic cranial patch  using sterile surgical procedures. After the animals recovered from surgery, they were trained in the behavioral tasks described below.Surgical procedures were carried out essentially as described before We carried out several independent experiments using several independent subsets of the categories. As noted in the Experiments 1 and 2 were carried out using classes X, Y and Z shown in For this experiment, the \u2018Main\u2019 categorization task was defined as distinguishing objects of class X from objects of class Y. Twenty informative fragments supporting the Main task were isolated (\u2018Main\u2019 fragments). Each Main fragment was a small 50\u00d750 pixel (0.89\u00b0\u00d70.89\u00b0) sub-image of a class X object.The fragments were isolated using the same procedure as described in our previous human psychophysical experiments Visual similarity was evaluated using the correlation coefficient of pixel values. To detect small overlaps between fragments, the correlated fragments were also allowed to move with respect to each other. Candidate fragments with visual similarity above 0.8 were considered too similar to a previously selected fragment and were removed. This constraint reduced shape redundancy across the selected fragments.Main fragments are useful for performing the Main task. We therefore expected the animals to preferentially use these fragments during this task. To assess the degree of this preference, non-informative fragments need to be selected as a basis for comparison.A naive approach would be to select fragments as above, but with minimal, rather than maximal, MI. A disadvantage of this approach is that it tends to select visually uninteresting fragments. For example, image patches that are uniform or almost uniform in intensity have very low MI, so that several of these would typically be selected by the naive approach. Such fragments would indeed be uninformative, but for a trivial reason. To make the comparison fair, it is desirable to avoid selecting such fragments.As in the previous human psychophysical study We also isolated 20 additional fragments using an interest point detector (\u2018IPControl\u2019 fragments) from the aforementioned subset of 20 images. Interest point detectors select areas of an image that have significant visual content, such as corners or intersections Compared to Control fragments, IPControl fragments explore the set of uninformative fragments more fully, since the criterion for selection is based more directly on local visual content. By contrast, Control fragments are constrained to be informative for an auxiliary task (the Control task), and this criterion will certainly miss those visually interesting fragments which happen to be uninformative for the Control task. On the other hand, the IPControl fragments may be uninformative for a trivial reason. Interest point detector rules out the most trivial cases (such as patches of uniform intensity), but may still pass other uninteresting content . Control fragments do not run that risk since they are guaranteed to be informative for some other task (the Control task) and therefore are useful for categorization.To summarize, we selected a total of 60 fragments for Experiment 1. All of these are sub-images of the Main class objects. Out of these fragments, 20 are informative for the Main task, and 40 are uninformative.The goal of our experiments was to determine whether monkeys learn to use informative fragments in categorization. However, Experiment 1, described above, only involves a single categorization task (the Main task). To ensure the results are not specific to this particular combination of categories, it is desirable to evaluate performance on a different combination of categories. In Experiment 2, we used the same three object classes , but redefined their roles. To this end, the Main task was designated as distinguishing objects of class Z from objects of class X, and the Control task was designated as distinguishing class Z from class Y. We then selected 60 additional fragments using the procedure described above, but using the new class designations see .The same procedures as above were used to extract smaller, 20\u00d720 pixel (or 0.36\u00b0\u00d70.36\u00b0) fragments from a new trio of categories, L, M and N. The Main task was to distinguish class L from class M, and the Control task was to distinguish class L from class N.per se.Prior to learning any of the novel categories described in this report, the animals were fully trained in the categorization task itself using unrelated sets of categories. Thus, in each given experiment, the animals learned new categories using the previously learned task paradigm, and not the task paradigm The task consisted of delayed same-different categorization as shown in During each trial, the animal had to establish fixation within 200 ms of the fixation spot onset and maintain fixation within a \u00b10.5\u00b0 window until the fixation spot was turned off toward the end of the trial (see below). Two hundred milliseconds after the animal had established fixation, a sample stimulus was presented for 400 ms followed by a 400 ms delay, following which a test stimulus was presented for 400 ms. Following another 400 ms delay, the fixation spot was turned off, at which time the animal had to report whether or not the sample- and the test stimuli belonged to the same category by making a direct saccade to a designated target. The animal received a drop of liquid food reward for all and only the correct responses, and an audible beep for incorrect responses. The next trial started after a variable 1\u20134 s inter-trial interval.vs. non-matching trials occurred in the equal proportions in randomly interleaved order over the course of a block of trials.In a given experiment, monkeys were trained in the Main task appropriate for that experiment. For instance, in Experiment 1, the sample stimulus was drawn randomly from class X or class Y. The test stimulus was drawn randomly from class X for matching trials, and from class Y for non-matching trials. The matching i.e., at p<0.002 by binomial test) and the performance remained asymptotic (as determined by one-way ANOVA at p>0.05) for at least four consecutive blocks of 50 trials each. Depending on the classes, the animals learned the classes to this criterion within an hour . The reason is that all fragments used in a given experiment were evaluated only with respect to MI in the Main task, while the Control task played only an auxiliary role.The training procedure for Experiments 2 and 3 was identical to that for Experiment 1, except that the class designations were different, as described above.\u22121, where M is the cortical magnification factor, the stimulus becomes equally resolvable across the visual field. This scaling, referred to as M-scaling, is known to be the same for macaque monkeys as well as humans e.g., In all experiments, we enlarged the stimuli (without changing their pixel resolution) according to the stimulus eccentricity using the well-established M-scaling method The M-scaling method has small, known shortcomings Trials during the testing phase of the experiment were identical to the trials during the training phase, except as noted otherwise. During the testing phase, the sample- and the test stimuli were always a fragment and a whole object, respectively. As before, the animal had to report whether the two stimuli were drawn from the same class. The sample stimulus was generated by compositing the fragment of interest with a light gray occluder with a corresponding hole in it.The trials for the various Main-, Control-, and IPControl fragments were randomly interleaved. For each fragment, the performance of each animal was measured over four blocks of 60 trials each spread over two or more days.Data were analyzed using scripts custom-written in Matlab  or R (r-project.org). Only the data in which the animal maintained fixation throughout the required period were further analyzed. Since it was not feasible to test multiple subjects as in our previous human psychophysical studies, we instead averaged the test data over a larger number of repetitions  from each of the two animals."}
+{"text": "Annular pancreas can present in adult life, usually when inflammation of the pancreatic ring causesduodenal stenosis. Although peptic ulcer is often associated with annular pancreas, an association withgastric carcinoma has not been previously described. Here we report a patient with annular pancreas,chronic alcoholic pancreatitis and gastric carcinoma, who was successfully treated by radical proximalpancreatoduodenectomy."}
+{"text": "To characterize the demographic and psychosocial problems of a group of blind people as a way of attracting more attention to and providing data that can improve the psychosocial care of the visually impaired.P value <0.05 was considered statistically significant.A cross-sectional descriptive study of a population of totally blind people in Ilorin, Nigeria using a self-report questionnaire (SRQ). The questionnaire was verbally administered by the study personnel in the local language. Simple frequency tables were obtained and the Chi-square test was performed to determine significant differences between variables. Sixty one blind patients consented to participate. Most participants were engaged in street begging for their livelihood. Most subjects desired a job change, signifying dissatisfaction with the present occupation. Up to 80% of the cohort was married and had spouses who were also blind in at least one eye. Approximately two-thirds had five or more children and majority lived with family members who were responsible for taking care of their personal hygiene, cooking and mobility. The majority developed blindness in childhood and 16% had a family history of blindness and 77% had never used conventional eye care, with corneal disease being the most frequent cause of blindness. Many feared that their children may also become blind. Thirty-one (51%) scored \u22655 on SRQ and were classified as probable cases of psychological disorder.Blindness in a majority of cases that started in childhood was probably preventable. Inaccessibility to or failure of the formal rehabilitation and social welfare systems may have caused this psychosocial dilemma. The high level of social and family interaction provides opportunity for organized preventive ophthalmology, community health care services and psychosocial care. Blindness is a major health burden globally, yet more prevalent in developing countries such as Nigeria where childhood infections and malnutrition are rife and eye care services are inadequate.23The current burden of blindness in Nigeria is estimated at 1 million blind adults and 3 million visually impaired people. Approximately two of every three blind people have an avoidable cause of blindness.4The global average prevalence of blindness is estimated at 0.7%, ranging from 0.3% in the developed countries to 1.4% in the developing countries.5Strikingly, blindness in Nigeria is three-times more prevalent in the dry Northern Sahel region than in the Southern Delta region. Blindness in Nigeria has also been associated with the level of illiteracy, which is higher in Northern Nigeria than in Southern Nigeria.4While cataract is the most common cause of blindness in Nigeria, accounting for more than one-third of the cases, glaucoma, corneal scarring and poor procedures for cataract surgery also contribute to the burden of blindness.4About 82% of the blind globally are 50 years of age or older,69Globally, there has been a concerted effort at tackling the burden of blindness, which is well articulated in \u201cVision 2020: Right to Sight.\u201d10Consistent with this strategy, there has been considerable focus on the identification and treatment of blinding diseases in Nigeria. However, a large group of pre-existing, irreversibly blind individuals are yearning for improved quality of care and regular care in Nigeria. The rehabilitation of this group remains a major challenge for the Nigerian society.The psychosocial care of the existing blind in Nigeria may not have received enough attention. Educational institutions to provide the blind with daily living skills are rare and generally not adequately equipped in terms of infrastructure and manpower.11413The frustration of the blind in Nigeria is palpable; they are disadvantaged in terms of education, vocational training, mobility and socioeconomic activities.13In Nigeria, begging and blindness are closely associated, with 70% of the 4,000 beggars in Lagos being blind.18Whereas the physical, psychological and socioeconomic distress of blindness is well recognized,151519This study is an attempt to characterize the demographic and psychosocial problems of a group of blind people in Nigeria as a way of attracting more attention to and providing information that can improve the psychosocial care of the visually impaired, generally.This was a cross-sectional descriptive study of a population of totally blind people in Ilorin, Nigeria, over a period of 2 months. The study population was composed of two groups: a group of blind people living in a suburban area of the town (SBC group) and another belonging to a blind people association in the town (BA group).The study was carried out in Ilorin, the capital city of Kwara state, one of the 36 states in Nigeria located in the North central zone of the country. Ilorin is inhabited predominantly by the Yorubas, one of the major ethnic groups in Nigeria. The Indigenes are predominantly Muslims. One of the groups resided in the suburban area of the city where the majority of indigenous people lived. This group lives communally in a separate area with a chief or head who oversees the day to day running of the community. The BA group lived in their homes within the town and had a regular meeting place, which made their investigation easy.The blind people were selected consecutively in the communities where they lived or gathered for their monthly meetings based on their willingness and consent to participate in the study.The sociodemographic data of the cohort and the characteristics in relation to blindness were collected using a semi-structured questionnaire designed by the authors. Additionally, the 20-item self-reporting questionnaire (SRQ-I) was used to assess the cohort for probable psychological disorder.A proforma questionnaire was designed to gather information relating to their personal data, marriage and children, nature of blindness, views on education for blind people, family support, requirement for lead or assistant, handling of money and daily living activities.The SRQ was constructed for use in the WHO study on strategies for extending mental health care.Pre-study visits were made to both groups to seek their participation in the study. For the SBC group, their chief was approached and we were given his assurance of cooperation in enlisting subjects. The BA group leader was approached in a similar manner. The BA group lived in the more urban or developed areas of the city. The cooperation of the SBC group was secured on the condition that data could only be collected in their homes and on Sundays, when they would be relaxing, and while a member of the association assisted in recruiting participants. Subjects in the BA group were interviewed at their meeting place after their regular meetings.Only those who gave their consent to participate were interviewed by the investigating team consisting of two of the authors and two trained research assistants who spoke Hausa language fluently. The questionnaire was read aloud to each of participants in the appropriate language.Ophthalmic examination was carried out by one of the authors  assisted by the research assistants. Firstly, attempts were made to assess visual acuity with Snellen chart. Secondly, further examination was performed to detect the cause of the visual loss. Anterior segments were examined with a loupe and, where the media allowed for it, the fundus was examined using a direct ophthalmoscope. Visual loss was categorized according to the WHO definition of visual impairment.23P-value <0.05 was considered statistically significant.Data analysis was conducted using EPI-info version 6 . Simple frequency tables were obtained and the chi-square test was performed to determine significant differences between variables. A There were 61 blind people who consented to be interviewed, 44 (72%) from the SBC group and 17 (28%) from the BA group. There were 54 (89%) males and seven (11%) females . The majThe mean duration of blindness was 25.90 \u00b1 16.37 years and the majority (72%) had been blind for 20 or more years; 62% developed blindness in childhood while 21% became blind in adult life. Also, 16% had a family history of blindness . SeveralIn economic terms, about half earned <250 naira/day, which is equivalent to approximately $1.50 in American currency . A largeThe BA group was younger, had fewer married subjects (21% versus 89%) and enjoyed more family support (86% versus 6%) . The BA The psychosocial dimension of blindness is not often properly addressed by eye specialists, especially in developing countries.19Small blind community formation, especially in northern Nigeria, is not uncommon. This study, for example, included an organized suburban community of blind people (SBC) and a blind people association (BA). These types of organizations give the blind opportunity to support one another, build a psychosocial front against stress, develop coping skills and engage in quality relationships, which may occasionally lead to marriage. It is also possible to deliver preventive and curative health care, especially ophthalmic care, in this kind of a setting. Even if these people are blind, their children, spouses and relatives who are not can enjoy preventive eye care. These blind people need be educated to the fact that their condition could have been prevented and that they should prevent occurrence in their children. Efforts must be made to reinforce good nutrition, immunization and basic eye hygiene to prevent blindness.The cause of blindness in this cohort was largely corneal disease rather than lenticular pathology. This is in contrast to global data, which indicate lenticular pathology as the most common cause of blindness followed by glaucoma.The preponderance of males with blindness compared with females in this study is in keeping with many previous Nigerian studies.5The majority of the blind in this study realized the importance of education and that it could give them a better future. This is suggested by the large number of respondents who reported that the blind should be educated and also had knowledge of institutions for education of the blind. It is however unfortunate that a majority had never been to these institutions or had any form of vocational training . It was Studies of marriage and family life among the blind report widely varying outcomes. Yet, they do suggest that they have difficulties getting married and running their families.Reports on independent daily living of the blind also vary greatly.4Family members involved in the care of the blind should be encouraged, with training and counselling directed at this group, to aid the rehabilitation process and mitigate psychosocial dysfunction.The prevalence of probable psychological morbidity in this study of 51% was high compared with 28% and 41% found in two studies using SRQ in mothers of sickle cell disease children and mothers experiencing family violence, respectively.25The large number who reported feeling happy despite blindness may be related to religious\u2013cultural factors, which tend to inhibit vocal or unrestricted expression of emotional distress.Approximately half of them entertained fears about the possibility of their children going blind . Those wThe hope of a cure in the presence of longstanding irreversible blindness also concurs with the strong religious background in this society. However, this may also indicate ignorance, which unscrupulous individuals may exploit, resulting in greater financial losses and/or psychological distress for the blind.Comparisons of the two groups in terms of demographic, socioeconomic and family structure and functioning were performed . The BA However, fewer subjects in the BA group were married compared with the SBC group, likely implying that the BA group probably found it more difficult finding a partner compared with the SBC group. The role of culture and tradition may also be critical as it is possible that marriage contracts in Southwest Nigeria, where the entire BA subjects come from, may be more stringent than those of the Northern region, where the SBC subjects come from.A drawback of this study is the small sample size of the cohort, which may not be indicative of the entire population of the blind in the country. In an effort to enlist a reasonable sample size, we used the leaders of each group to assist in the enrolment of subjects. The leaders would likely be more successful in encouraging members of their group to participate than a stranger (study personnel). Additionally, the subjectivity of the verbal questionnaires and the desire of some subjects to \u201cplease\u201d the study personnel may confound the outcomes of verbal questionnaires. The conversion of the questionnaire to a regional language may also lack some of the nuances of the original questionnaire that may reduce effectiveness. To somewhat mitigate these drawbacks, we used a validated, standardized questionnaire for portions of this study (SRQ). Furthermore, we used study personnel fluent in the local language to conduct the questionnaire. Lastly, we believe that the lack of visual cues (the study personnel\u2019s reaction) during questioning may actually lead to greater impartiality of the respondents.In this study, we found that the majority of the blind people were married with children, had longstanding blindness, no formal education or vocational training and therefore lived by street begging. They appeared to have a reasonable degree of social and family interaction and support; yet, there was a high rate of probable psychological dysfunction.Onset of blindness for the majority was probably in childhood, indicated by corneal disease being the most frequent cause of blindness and the large gap between mean duration of blindness and mean age of the cohort. This implicates inadequate community access to eye care services, which causes a high prevalence of blindness in those at the fringes of the socioeconomic sphere with little or no education and no job, which makes them very vulnerable.Our study underscores that blindness in a majority of the cases in this population of people was probably preventable. Formal rehabilitation was never undertaken by the majority. Most of the individuals considered begging as a means of survival but wished for other occupations. The blind require assistance in social rehabilitation, preventive ophthalmology, community health care and psychosocial care."}
+{"text": "Septins are an evolutionarily conserved family of genes that encode a P loop-based GTP-binding domain flanked by a polybasic domain and  a coiled-coil region. They have roles in cytokinesis, vesicle trafficking, polarity determination, and can form membrane diffusion barriers, as well as in microtubule and actin dynamics. Septins can form hetero-oligomeric complexes and possibly function as dynamic protein scaffolds. Recently, it has been shown that there are at least 13 human septin genes that exhibit extensive alternate splicing. There are complex patterns of human septin gene expression and recently it has been found that alterations in septin expression are seen in human diseases including neoplasia. This review summarises the essential properties of septins and outlines the accumulating evidence for their involvement in human neoplasia. Septins may belong to the class of cancer critical genes where alteration in expression profile  may underpin their role in neoplasia as opposed to specific mutational events. ScCdc3, ScCdc10, ScCdc11 and ScCdc12) localise to filamentous structures in the bud neck in Saccharomyces cerevisiae and were named septins by the laboratory of John Pringle. Much progress has been made in defining the range of functions of yeast septins and in the past 5 years their role in disease states, including cancer, has become apparent  have long N-terminal extensions, which have regions rich in proline residues.The nomenclature of mammalian septins has proven problematic but a uniform nomenclature has simplified a Babel-like array of terms , while others have restricted profiles, with, for example, SEPT3 only being found in the brain , and thus this change in transcript profile has a profound effect on the level of this SEPT9_v4 protein isoform.SEPT9 was linked to neoplasia by two other observations. SEPT4 (and named it Bradeion) by screening an expression library. While expression of these transcripts is generally restricted to the brain, in tumours ectopic expression is observed. Furthermore, ribozyme-mediated downregulation of these transcripts could inhibit growth and tumorigenesis of colorectal cancer in vivo and in vitro and might be a useful diagnostic target (SEPT4 transcript (and was previously named ARTS) could promote TGF beta-mediated apoptosis. It has been reported that the SEPT4 isoform encoded by this transcript binds to and can modulate the function of XIAP and thus promote apoptosis  might function as a tumour suppressor since expression is lost in most cases of childhood ALL , was shown to be required for cytokinesis and to bind actin and associate with focal adhesions. Recent data suggest that SEPT2 can have a role in chromosome congression and segregation and that altered expression of SEPT2 might promote abnormalities of these crucial processes, leading to disordered chromosomal dynamics, and underlie the development of aneuploidy (ras) promotes motility and perturbs the directionality of movement. These latter data are complemented by Golgi reorientation assays that suggest that SEPT9_v4 can alter cell polarity. This is perhaps not surprising given the role of septins in determining polarity in yeast (The role of septins in cytokinesis would lead to the notion that these proteins are involved in neoplasia by perturbing cell division in some way. While this idea deserves attention and is supported by the recent observations of in yeast  and FingA final aspect of septin function that may be relevant to neoplasia is their formation of complex hetero-oligomeric structures  and theiThe past 25 years have seen an explosion in our understanding of the molecular events underpinning neoplasia and more than 200 genes that are mutated in human cancers have been described (The septin family of genes exemplify some of these issues and indicate how complicated the next 25 years of cancer research might be. Without question, the septin family deserves more attention and recent data suggest intriguing connections with fields as diverse as polarity control, membrane dynamics and exocytosis, the cell cycle and motility and cell shape. The consideration of septin biology and its role in neoplasia will require new perspectives and approaches to the issues of protein levels and stoichiometry, the nature and distribution of protein complexes and will ultimately require a much higher resolution analysis and with new reagents and approaches. It is also conceivable that the manipulation of septin complexes in cells may provide new insights to therapeutic options. Finally, the study of septins in neoplasia and other diseases may illuminate the broader issues of septin function in mammalian cells."}
+{"text": "This review article is written so as to present the pathophysiology, the symptomatology and the ways of diagnosis and treatment of a rather rare aortic disease called Intra-Mural Haematoma (IMH). Intramural haematoma is a quite uncommon but potentially lethal aortic disease that can strike as a primary occurrence in hypertensive and atherosclerotic patients to whom there is spontaneous bleeding from vasa vasorum into the aortic wall (media) or less frequently, as the evolution of a penetrating atherosclerotic ulcer (PAU). IMH displays a typical of dissection progress, and could be considered as a precursor of classic aortic dissection. IMH enfeebles the aortic wall and may progress to either outward rupture of the aorta or inward disruption of the intima layer, which ultimately results in aortic dissection. Chest and back acute penetrating pain is the most commonly noticed symptom at patients with IMH. Apart from a transesophageal echocardiography (TEE), a tomographic imaging such as a chest computed tomography (CT), a magnetic resonance (MRI) and most lately a multy detector computed tomography (MDCT) can ensure a quick and accurate diagnosis of IMH. Similar to type A and B aortic dissection, surgery is indicated at patients with type-A IMH, as well as at patients with a persistent and/or recurrent pain. For any other patient (with type-B IMH without an incessant pain and/or without complications), medical treatment is suggested, as applied in the case of aortic dissection. The outcome of IMH in ascending aorta (type A) appears favourable after immediate (emergent or urgent) surgical intervention, but according to international bibliography patients with IMH of the descending aorta (type B) show similar mortality rates to those being subjected to conservative medical or surgical treatment. Endovascular surgery and stent-graft placement is currently indicated in type B IMH. Intramural haematoma (IMH) belongs to \"acute aortic syndrome\" followed by penetrating atherosclerotic ulcer (PAU) and the classical acute aortic dissection. It occurs as a bleeding into the aortic wall (media) without initial rupture of the intima and the classic flap formation. Despite IMH of the thoracic aorta being a disease of the aorta, its optimal initial treatment still remains a hot debatable issue. Aortic intramural haematoma can firstly appear to hypertensive and atherosclerotic patients who suffer an impulsive haemorrhage from vasa vasorum rupture into the media either spontaneously, or less commonly, as a result of PAU. Rarely does a thoracic trauma lead to IMH ,2. AccorThe common risk factors for cardiovascular diseases are to be held responsible in the pathogenesis of the IMH. Special circumstances, such as pregnancy as well as some congenital disorders should be taken into account. Arterial hypertension is the most frequent predisposing factor for IMH, present in 84% of the patient cohort and similarly to the 67% incidence, reported in a post mortem study of 161 cases of dissection . NeverthThe IMH is diagnosed in the same way as with acute aortic dissection. In reality, the clinical symptomatology of IMH may be virtually indistinguishable from that of acute dissection. Chest and back pain is reportedly as the most frequent clinical manifestation in patients with IMH . Chest pNatural history and predictors for progress and complications of IMH.There is some controversy concerning the natural history of acute IMH. It is known that IMH may either progress or regress in an extend way. ,23,38,39Initial medical treatment, endovascular surgery or classic, open surgery is the common treatment of IMH. In the algorithm proposed we can see the different therapeutic strategies used in the treatment of IMH. We should bear in mind that IMH as \"acute aortic syndrome\" is indicative of a dynamic process and imminent events, so we should place our attention on detailed diagnostic confirmation with subsequent treatment by either surgical repair or interventional stent-graft placement ,51. PersIMH is a rare but potentially lethal disease of the aorta. Nevertheless, pathogenesis and risk factors should be examined, in detail. Clinical manifestations, diagnosis, and management of acute aortic syndrome should be codified for rapid and accurate treatment. IMH of the aorta is a potentially lethal disorder with frequent conclusion to aortic rupture, dissection or aneurysm. Short term prognosis is extremely serious in IMH involving the ascending aorta, and surgical repair improves the outcome. IMH of the descending aorta, especially when confined to a short segment or without dilatation has a better outcome. Endovascular treatment is an alternative way of treatment in individual cases with acceptable results. Long term prognosis, may be more beneficial from chronic effective \u03b2 blockers regardless of surgical repair.The authors declare that they have no competing interests.All authors: 1. have made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data; 2. have been involved in drafting the manuscript or revisiting it critically for important intellectual content; 3. have given final approval of the version to be published."}
+{"text": "An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb) for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA (<10 kb) of known sequence.In a traditional electrophoresis mobility shift assay (EMSA) a AluI, BsuRI, TruI, etc), separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear) by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside with the full \"spectrum\" of initial restriction fragments of known size. Here the strategy is used for the identification of protein-binding regions in the 5' region of the rat p75 neurotrophin receptor (p75NTR) gene.We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb) fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (The developed strategy is based on a combination of traditional EMSA and denaturing PAGE for the identification of protein binding regions in long fragments of genomic DNA. The identification is straightforward and can be applied to shifted bands corresponding to stable DNA-protein complexes as well as unstable complexes, which undergo dissociation during electrophoresis. Electrophoretic mobility shift assay (EMSA), developed by Fried and Crothers , and GarPreviously, two similar high-throughput methods were developed for the identification of protein binding regions using a large population of fragments derived from DNAs  ranging in size from 3 kb to 4,700 kb ,11. ThesHere we describe an alternative and straightforward strategy which is based on a principle of the selection method, known as SELEX ,13 and u2HPO4, 2 mM KH2PO4, pH 7.4, 137 mM NaCl and 2.7 mM KCl) and lysed in ice-cold buffer containing 10 mM Tris-HCl (pH 8.0), 10 mM NaCl, 1 mM EDTA, 10 mM DTT, 10% glycerol 0.5% NP-40 supplemented with 1 mM PMSF and 1\u00d7 protease inhibitor cocktail  . Nuclei were pelleted by low speed centrifugation at 350 RCF for 3 min and proteins were extracted with the high salt buffer as described in dCTP at 37\u00b0C for 10 min. Then all unlabelled dNTPs were added to a final concentration of 0.1 mM for each and the reaction was continued for 25 min. Finally, the reaction was terminated by phenol extraction, 32P-labeled fragments were precipitated with 2.5 volumes of ethanol in the presence of 1.5 M NH4OAc and dissolved in TE at a concentration of 40 ng/\u03bcl.Fragments (400 ng of each fraction) were 3' end-labeled with 20 \u03bcCi of  has shown that certain purified restriction fragments do not produce mobility shifts if isolated at high temperature (50\u00b0C), i. e. using a step necessary for dissolving the gel slice (Fig. Nevertheless, our strategy has also some limitations. Firstly, the 3'-end labeling with 3'-5' exonuclease and polymerase activities of Klenow fragment, is relatively inefficient and produces labeled fragments with different specific activities . Also, fice Fig. . This isIn summary, the strategy developed here may be easily applied to any genomic fragment with known sequence for which protein binding regions are searched. Finally, selection of restriction enzymes with different recognition sequences may be used to expand the fragment coverage and to narrow down the location of protein binding sites.We have described a strategy for the detection of protein binding regions in long fragments of genomic DNA. Contrary to the previously described high throughput detection methods ,11, whicMS and KM designed the strategy, carried out EMSA and PAGE experiments and drafted the manuscript. KK participated in EMSA experiments. MM helped with coordination and revision. All authors read and approved the final manuscript."}
+{"text": "We described a 6 years follow-up of a spontaneous aortic intramural hematoma (IMH) with cardiovascular magnetic resonance (CMR) examination. Since multiple factors may play roles in the natural history of IMH, the patient experienced the course of progression, which included hematoma absorption, ulcer-like lesion, aneurysm and limited dissection. The initial and follow-up CMR examination included 3D CE MRA and non-enhanced \"bright blood\" pulse sequence. The inherent advantage of outstanding contrast with plain scan, which shorten the scan time and avoid potential risk of contrast agent, might make the fast gradient echo sequence as an alternative method when following stable IMH. Spontaneous aortic intramural hematoma (IMH), which first described in 1920 by Krukenberg as \"dissection without intimal tear\", results from the spontaneous rupture of the vasa vasorum of the aortic wall. IMH most frequently involves the ascending aorta (type A) or proximal descending aorta (type B). This condition presents clinically as severe chest pain radiating to the back, which is similar to aortic dissection (AD). Systemic hypertension is the leading risk factor for spontaneous IMH. Recent advances in imaging techniques have significantly improved the diagnostic accuracy and enhanced clinical understanding of IMH. The natural history of spontaneous IMH is different from classical AD and its time course of IMH can vary significantly, so early diagnosis and close follow-up is desirable. We describe a spontaneous IMH case followed for 6 years by cardiovascular magnetic resonance (CMR). The patient progressed through different stages, including hematoma absorption, ulcer-like lesion emergence, aneurysm enlargement and limited AD.A 65-year-old female with a long history of hypertension was referred to emergency room because of acute chest pain that persisted over one day. The echocardiogram showed a widening of the lumen of the ascending aorta. A thoracic aorta CMR examination  was performed for further evaluation. The imaging protocol included three-dimension contrast-enhanced magnetic resonance angiography  and true fast imaging steady-state precession (true FISP) MRI , 300 \u00d7 400 mm; matrix, 300 \u00d7 512; thickness, 6 mm). The true FISP images were acquired without cardiac gating. A stack of two-dimensional images were acquired in approximately 15~18 seconds. Each acquisition had 10 slices. Gadopentetate dimeglumine  was administrated intravenously followed by 20 ml saline flush.An eccentric non-enhanced low signal intensity lesion around the widened ascending 50 mm) and descending aorta were seen on the reconstructed 3D CE MRA and true FISP axial images. Aortic IMH (type A) combined with bilateral pleural effusion was documented Figure . The sym0 mm and There are controversial issues exist in indication of treatment of spontaneous IMH. Most studies currently recommend early surgery or interventional therapy for patients with proximal IMH and medical management for patients with distal IMH; this is similar to that of classical AD. However, others favor a conservative treatment, with initial medical management for all patients in a stable condition. Multiple factors may play roles in the natural history of spontaneous IMH, including blood pressure, vessel condition, hemodynamic changes, the wall thickness and diameter of the aorta, and even age and race ,2. MoizuBased on short-term (<30 days) follow-up, several studies have suggested that the natural history of IMH is a dynamic process which can result in reabsorption, classical AD, or aortic rupture. Granha et al  reportedAs a noninvasive imaging modality that does not require ionizing radiation, CMR has been preferred for the purposes of diagnosis and follow-up for IMH during the past decade . The 3D Thus, researchers have focused on non-enhanced fast CMR imaging sequences to address the scan time limitations. Pereles et al  evaluateIn conclusion, the inherent contrast features of the fast gradient echo sequence without the use of a contrast agent make it a potential alternative when following stable IMH.The authors declare that they have no competing interests.XA: Literature research, manuscript preparation and editing. ZZ: Case collection. ZF: Case collection. LZ: Manuscript preparation and editing. JY: Picture and word editing.All authors read and approved the final manuscript."}
+{"text": "The ability of small clonal fragments to establish and grow after disturbance is an important ecological advantage of clonal growth in plants and a major factor in the invasiveness of some introduced, clonal species. We hypothesized that orientation in the horizontal position  can increase the survival and growth of dispersed clonal fragments, and that this effect of orientation can be stronger when fragments are smaller and thus have fewer reserves to support initial growth.Alternanthera philoxeroides planted at angles of 0, 45 or 90\u00b0 away from the horizontal position, with either the distal or the proximal end of the fragment up and with either 1 or 3 cm of stolon left attached both distal and proximal to the ramet. As expected, survival and growth were greatest when fragments were positioned horizontally. Contrary to expectations, some of these effects of orientation were stronger when attached stolons were longer. Orientation had smaller effects than stolon length on the performance of fragments; survival of fragments was about 60% with shorter stolons and 90% with longer stolons.To test these hypotheses, we compared performance of single-node pieces of stolon fragments of Results supported the hypothesis that orientation can affect establishment of small clonal fragments, suggested that effects of orientation can be stronger in larger rather than smaller fragments, and indicated that orientation may have less effect on establishment than amount of stored resources. The ability of small clonal fragments to establish and grow after disturbance is an important ecological advantage of clonal growth in plants and a major factor in the invasiveness of some introduced, clonal species et al. (2010) recently showed that the survival and growth of ramets of Alternanthera philoxeroides increased with increasing length of attached stolons.One likely factor is the amount of stored resources contained in a fragment, and an important storage organ in some stoloniferous, clonal plants is the stolon Arundo donax) had a higher sprouting ability than fragments of vertical stems when both types of fragments were positioned horizontally In this study, we build upon that previous finding to ask whether the orientation of dispersed, single-node clonal fragments can also affect their survival and growth, and whether this depends upon the length of attached stolon internodes, through their function as storage organs. After disturbance and dispersal, such small clonal fragments might become positioned in orientations away from the horizontal, which is the typical orientation for growth. Departure from the horizontal position may induce asymmetric distribution of endogenous growth substances (e.g. auxins) in the new buds of fragments, and make them reorient toward the vertical due to gravity stimulation Alternanthera philoxeroides.We therefore hypothesized 1) that horizontal orientation can increase the survival and growth of small clonal fragments, and 2) that this effect of orientation will be less in fragments with greater length of attached stolons. We tested these hypotheses in a greenhouse experiment with the invasive, stoloniferous plant F\u200a=\u200a3.24; P<0.001). For each individual measure of size . In separate ANOVAs, effect of orientation interacted with effect of stolon length on two measures of size, number of leaves and length of new stolons . By every measure, fragments performed better when attached to longer stolons  Griseb., or alligator weed, is a perennial, stoloniferous herb in the Amaranthaceae. Native to the region of the Parana River in South America A. philoxeroides has been introduced to and become highly invasive in many other regions, including southern China A. philoxeroides rarely produces viable seeds A. philoxeroides in China A. philoxeroides can form dense mats and exclude native species Dispersal of clonal fragments has resulted in a rapid expansion of the geographical range of A. philoxeroides were collected from Jiangxi Province in southeast China in mid-April 2009 and propagated vegetatively for 7 months in an artificial pond in Beijing. On 11 October 2009, 980 clonal fragments, each consisting of one unrooted stolon node with two leaves and the proximal and distal stolon internodes, were severed from the stock plants for use in the experiment. Both proximal and distal internodes of each fragment were at least 4 cm long and all fragments were derived from the mature, plagiotropic stems of the A. philoxeroides plants.Plants of The experiment used a factorial design with five orientation treatments  and two stolon length treatments (2 and 6 cm). The orientation treatments combined departure from the horizontal position by 0, 45, or 90\u00b0 with upwards (45 and 90\u00b0) or downwards (\u221245 and \u221290\u00b0) direction of the distal portion of the stolon . We inclA. philoxeroides might be found on land in southern China. The node and leaves of each fragment were placed on the surface of the soil, which was then covered with a 1-cm-deep layer of vermiculite to help maintain soil moisture. To avoid potential photosynthesis by stolons and help isolate their effect on establishment of fragments via supply of stored resources, we wrapped the portions of stolons that were exposed to the light in tinfoil. Enough tap water was supplied to each container once a day to keep the soil moist. Seven containers were randomly assigned to each of the 10 treatment combinations; containers were treated as replicates.Fourteen fragments were randomly assigned to each of 70 plastic containers (37.7 cm long \u00d727.5 cm wide \u00d714.2 cm deep) filled with a 1\u22361 mixture of sand and peat, to mimic a typical soil on which The experiment started on 11 October 2009 and ended 9 weeks later on 11 December 2009. It was conducted in a heated greenhouse at Forest Science Co., Ltd., in Beijing Forestry University. The mean temperature in the greenhouse during the experiment was 15.3\u00b0C, as measured hourly by two Hygrochron temperature loggers .On 11\u201314 December 2009, we counted numbers of nodes and leaves on each fragment; measured leaf area  and length of new stolons; divided each fragment into roots, leaves, and new stolons; dried the portions at 70\u00b0C for 48 h; and weighed them. We did not include the stolon internodes left attached to fragments at the time of planting, because these stolon portions would necessarily differ in length and mass between stolon length treatments.P\u200a=\u200a0.05) were used to test for differences between each of the ten combinations of the orientation and stolon length treatments and between the five orientation treatments across stolon length treatments. Values of survival were transformed to the arcsine of the square root and values of leaf area to the square root before analysis to increase normality and reduce heterogeneity of variance. Analyses were conducted with SPSS 16.0 .For analyses, we first calculated the percent survival and the means for each of the measures of size of the surviving fragments in each container. To test effects of treatments on survival, we ran an ANOVA with orientation and initial stolon length as fixed effects. To test treatment effects on measures of growth, we ran a MANOVA with the same effects and with all of the five measures of growth as dependent variables. Separate ANOVAs of each measure, reported along with the MANOVA, were also conducted. Student-Newman-Keuls tests  that effects of orientation would be less when the length of attached stolon was greater.We predicted (1) that survival and final size of fragments of"}
+{"text": "Digital information flow within the intensive care unit (ICU) continues to grow, with advances in technology and computational biology. Recent developments in the integration and archiving of these data have resulted in new opportunities for data analysis and clinical feedback. New problems associated with ICU databases have also arisen. ICU data are high-dimensional, often sparse, asynchronous and irregularly sampled, as well as being non-stationary, noisy and subject to frequent exogenous perturbations by clinical staff. Relationships between different physiological parameters are usually nonlinear (except within restricted ranges), and the equipment used to measure the observables is often inherently error-prone and biased. The prior probabilities associated with an individual's genetics, pre-existing conditions, lifestyle and ongoing medical treatment all affect prediction and classification accuracy. In this paper, we describe some of the key problems and associated methods that hold promise for robust parameter extraction and data fusion for use in clinical decision support in the ICU. Intensive care provides one of the most challenging locales for both clinicians and engineers who try to support clinical activities. Intensive care unit (ICU) patients are often the sickest, frequently having several pathophysiological problems that must be managed simultaneously to avoid death or severe morbidity. Both physiological state and external interventions change frequently, demanding rapid analysis and quick, high-stakes decisions.Advances in the development of technology, computational signal processing and biological modelling have led to a growing interest in the archiving and use of extensive hospital\u2013medical databases. Although current clinical practice is centred on human expert assessment of the correlations between parameter values and symptoms, there is a growing awareness within medical communities that the enormous quantity and variety of data available cannot be effectively assimilated and processed without automated or semi-automated assistance. Automated systems have been in place in the ICU and the operating theatre (OR) for several decades, including automated arrhythmia analysis of the bedside electrocardiogram (ECG) and low (or high) oxygen saturation warnings from the photoplethysmograph (PPG). However, each device acts in an isolated fashion with no reference to related signals or an individual's prior medical information, such as genetics or medical history. Some patient-specific data are used in an ad hoc manner, such as body weight (for the adjustment of drug rates), allergies (to restrict medications) and age . However, automated use of such information is rare.In this paper, we outline a long-term approach to develop systematic bases for extracting information in order to provide assistance to clinicians faced with the enormous challenges of providing high-quality ICU care. We are currently collecting large datasets of actual patient experiences in the ICU, developing methods to analyse and abstract those data, retrieval systems to allow selection of events of interest, creating models that relate such data to patients' clinical conditions and pathophysiological status, and building both physiological and statistical models to enable sophisticated decision support systems that base alarms on an integrated view of the patient and that can assess or even suggest alternative courses of action. Although we frame these ideas within a wider context, here, we focus principally on the problems we have encountered and the solutions we have developed for collecting ICU patient data and extracting information that is useful for decision support.We have instituted a large-scale systematic collection of data about ICU patients  can be problematic when time is recorded by independent and unsynchronized clocks. At an even more basic level, it is necessary to match each recorded data stream with the correct patient among all those currently in the hospital, a problem that should be trivially easy to solve but is often complicated by instruments with poorly designed set-up procedures that are not always completed in the context of urgent care, human transcription errors , or by comparing multiple redundant measures of the same physiological parameters. For example, heart rate may be derived from the ECG, an invasive ABP line and the PPG. These issues are explored further in In order to provide information for medical experts (or automated decision support systems) to make choices concerning patient care, the wealth of available data must be reduced to a set of distinct concepts and features. Although many parameters are derived from patient data \u2018on the fly\u2019 and recorded for later review, trust metrics or signal quality measures associated with these parameters are rarely stored. Therefore, it is difficult to ascertain the credibility of a given parameter unless the original data from which the parameter was derived are available, either to visually verify the data or in order to derive independent quality metrics.Noise reduction algorithms often introduce misleading distortions in medical time-series data and, therefore, they should be applied only when the data are determined to be too noisy for a feature extraction algorithm to be applied accurately. However, it is often necessary to extract features and compare them with a population norm, or a patient's history, in order to determine whether significant amounts of noise are present. A method for simultaneously (or recursively) extracting features and estimating noise levels is, therefore, appropriate.In this section, we describe a generic approach to noise reduction and signal quality analysis, together with a data fusion framework that provides for a robust estimate of extracted physiological parameters that evolve over time.After appropriate formatting, storage and initial coding of data, perhaps the most important stage in data processing is the application of signal processing algorithms to deal with the noisy and transient nature of physiological signals. Even when the data are continuously available and the sampling rate is high enough, data can still be masked by periods of intense noise due to movement artefact. Strategies for detecting and (where possible) removing noise in physiological data depend on the nature of both the noise and the data source and typically include infinite impulse response filters, finite impulse response filters, principal component analysis PCA; , indepenoutlier is not a real event. In fact, it is the rare outliers that are often of interest in biomedical time-series data, since they indicate that the aim of managed stability for a patient may be unsuccessful and that changes in treatment are required.et al. demonstrated that the technique outperforms the best of previously described ECG filters on normal sinus rhythm ECGs, performance on arrhythmic data is unclear. In all likelihood, unless a pre-classification algorithm is employed, the model will have to be refitted to the data for moderate changes in morphology, and classified as abnormal or artefactual. It is also worth noting that, since the model is based upon a superposition of Gaussians, it is easily adapted to filtering and classification of other cardiovascular signals such as the blood pressure . Sometimes noise and artefact can be so high that it is best just to discard the section of data, effectively making an evenly sampled signal irregularly sampled.Often the sampling frequency is inherently uneven, particularly in the case of diagnostic data, which are ordered when an event or combination of observations indicate that a particular test is required. Missing data and irregular sampling are highly related concepts, although the former implies that useful data may exist between each sample point and may carry further information about the state of the patient (such as a significant change in a given variable). Some form of interpolation may, therefore, be useful in estimating the unobserved information. However, it may not be appropriate to guess the values of missing or hidden data, since any slight error might lead to an erroneous decision; there are cases when an estimate is useful. Furthermore, reporting the bounds of error in an estimate allows a clinician to make safe harbour decisions.For single-parameter time series, little more than a sample-and-hold approach (with a time-out) is generally used to fill in the missing data. This is generally a good approach for frequently sampled data from ICU patients who are usually managed for stability, and thus exhibit infrequent large changes in the value of a physiological parameter. However, the situations that are often more interesting and informative are the infrequent changes and resampling schemes are often used . However, these approaches introduce spurious low- and high-frequency noise and can be extremely sensitive to the number of missing data points or to the irregularity of the missing data  to form estimates of the intervening sample values such as min\u2013max interpolation , autoregWhen multiple sources of related information are available, it is possible to exploit the covariance of the data, such as when using PCA or imputation. However, such techniques again assume stationarity of the dynamics of the data , and they require that the missing data be missing at random or that an accurate model of how the missing data are distributed be known. Furthermore, these techniques are sensitive to outliers and non-removed errors. Since no accurate model exists of how missing or noisy data are distributed, the interpolation of missing ICU data is extremely difficult . , if we are looking for evidence of haemorrhage, we may not need to sample more frequently than once every 5 or 10\u200amin to capture the dynamics of the situation. The required sampling frequency is also related to the intrinsic dynamics of the parameter, so that heart rhythm, which can change over a few beats, is sampled rapidly (at 100\u200aHz or more), whereas blood creatinine  may change only over hours. Consequently, creatinine values are sampled much less frequently and can be reliably interpolated over several minutes, whereas heart rate estimates cannot. The effective Nyquist frequency for a particular parameter also depends on an individual's physiology and medical condition, and so it is difficult to be sure whether parameters are being undersampled. However, clinical teams tend to sample parameters more frequently when they believe a patient may be unstable with a rapidly changing  physiological condition. Therefore, the clinical team often notices signs or symptoms indicative of rapid changes and adjusts the sampling rate so that loss of important information does not occur.Since robust methods for dealing with missing data are not always available, it is sometimes more appropriate to define a signal quality measure for a given data stream, and simply ignore the segments of data that have a signal quality below a given value. However, metrics for signal quality are both signal and application specific. For example, noise above 20\u200aHz, which does not distort ABP estimates, can disturb ECG peak detection algorithms and cause heart rate variability algorithms to report incorrect values, while leaving heart rate estimation algorithms unaffected. Low-frequency noise (below 1\u200aHz), which only disturbs subtle features in the ECG such as the QT interval or ST segment, can cause significant errors in the estimate of the blood pressure. A general treatment of signal quality measures is therefore not possible. However, signal quality indices (SQIs) can generally be constructed by thresholding on known physiological limits such as the maximum field strength for the ECG, the maximum rate of change of the blood pressure or the distribution of energy in the frequency domain. However, it is the relationship between physiological parameters that provides the greatest opportunity to construct SQIs. For example, if heart beats are detected in several ECG and/or pulsatile waveforms within an expected period of time, all signals can be considered to be of reasonable quality.best guess of a parameter in the absence of good quality data. However, as we have already discussed, it is very difficult to make an accurate or useful guess of a missing parameter in non-stationary data, such as that found in the ICU, and a sample-and-hold approach is often used. Although this can be useful to a human attempting to observe the current state of the patient, this is an inappropriate solution for passing data to an automated or semi-automated algorithm.SQIs are generally calculated by bedside monitoring equipment but are rarely used by clinical teams or automated alert systems, since there is often an assumption that the monitor will provide either no information or a With current trends towards semi-automated analysis, it is important that SQIs are available for each datum and, if possible, be calibrated to provide a known error for a given value of the SQI. In this way, another algorithm can make informed choices concerning the validity of the datum for a given application, and derived estimates can be provided with accurate error bounds. In Frequently measured parameters (such as heart rate and blood pressure) are amenable to SQI analysis because there is usually an underlying rapidly sampled waveform from which the metrics can be derived. When the sampling rate of the data available drops to around 1\u200aHz or below, signal quality measures become problematic, since it is almost impossible to differentiate between a real physiological change and an artefact.Errors in less frequently sampled clinical data (such as blood tests) are more difficult to determine for two reasons. First, the sampling rate is low compared with how rapidly a variable can change.  Second, the relationship of a blood test to other signals is extremely complex, and testing the \u2018truth\u2019 of a measurement would require an extremely complex and accurate model of an individual's physiology. The general approach is that a clinician makes a hypothesis concerning the outcome of the test, based upon current monitored data and a medical history. If the prediction turns out to be accurate, then the belief in the result is high. Otherwise, a test may be reordered, particularly if subsequent data indicate that the test results are contradictory. This type of modelling is extremely complex and the reader is referred to et al. Exploitation of the covariance structure of the data is one method of data fusion, since a non-diagonal covariance matrix implies redundancy in the individual data streams. However, weighting different data streams can be difficult when the measurement units are different and the distributions of the data are different (and non-Gaussian). For instance, what blood pressure change (measured in mm\u200aHg) is equivalent to a 5 per cent drop in oxygen saturation? Townsend and Tarassenko et al. , 2002b aet al. When the data to be fused pertain to the same parameter, the data fusion is technically more straightforward, although it requires a method for arbitrating between conflicting estimates. In a recent work, we have extended the work of Tarassenko and Townsend  given by The KF is an optimal state estimation method for a stochastic signal that estimates the state of a discrete-time controlled process, K is inversely proportional to R, the measurement noise covariance, and represents how rapidly the KF will adapt to new observations. In a recent paper  and 1  inclusively. This modification has the effect of forcing a KF tracking algorithm to trust any given observation when the SQI, s, is high . When the SQI, s, is low, \u03b3 tends to infinity and the resultant large increase in R results in a low Kalman gain. Therefore, the KF no longer trusts the current observation to make a prediction, and relies on previous observations instead. This approach turns out to provide a low error, unbiased estimator for cardiovascular time series of heart rate and blood pressure, even in extremely high noise scenarios since noisy segments of data are automatically rejected.Note that et al. xk, of a physiological parameter by the inverse of the normalized innovation, \u03b7, for each channel. In the two-channel scenario , the weighted estimate of a parameter becomesx was separately given as a scalar heart rate or respiration rate. Furthermore, H was assumed to be unity and so the current state is approximately the same as the last state This KF approach also provides a robust framework for fusing multiple observations of the same parameter from different sensors. Tarassenko and Townsend  and the \u03bb for the sphygmomanometer cuff measurement could be set to 0.8 (to reflect an inherent 20% error in the reading).The trust factor This approach can also be thought of as a robust weighted interpolation scheme, with a sampling frequency of the combined set of observations. That is, the KF is updated at every observation, and every channel of data provides an estimate of the physiological parameter at a different time point. Therefore, the resultant time series has a sample point at each observation that is fit to a weighted sum of previous and current measurements.The signal quality-modified KF approach described above involves a scalar observation model with the simplest dynamical approach . Extensions that employ models of the dynamic evolution of the cardiovascular system, or vector KF formulations that employ models of how each signal is related to each of the other recorded signals, are likely to improve this method of tracking and noise rejection approach.et al. For example, However, considerable barriers remain, including modelling non-stationarities in the parameters and dealing with the underlying noise. Without good methods for rejecting (or unweighting) noise, no system of modelling, data fusion or missing information estimation is likely to work reliably. Signal quality measures should therefore be evaluated on large databases, and then calculated and stored for all possible signals in the ICU.One example of where we have applied the concepts of signal quality and data fusion is in the arena of false alarm (FA) suppression in the ICU. FAs in the ICU can lead to a disruption of care, impacting both the patient and the clinical staff. The resultant excessive noise pollution, desensitization to warnings and slowing of response times  can leadRecently, sN, derived from the ABP waveform to decide on the truth of the ECG arrhythmia alarm. . The threshold, sN, was expected to differ for each alarm type since abnormalities in the ECG will differ depending on rhythm and heart rate. Therefore, the annotated alarms were divided into two sets: a training set and a testing set. Each sN was then optimized , to determine the highest FA reduction rate, with the lowest TA suppression rate.Our recent analysis concerned the suppression of false life-threatening arrhythmia alarms issued by the bedside ECG monitor. Using two independent reviewers, we annotated 5386 alarms from a total of 447 adult patient records spanning 41\u200a301 hours of simultaneously acquired ECG and ABP. A third reviewer then checked each alarm to adjudicate discrepancies and check the overall quality of the alarms. The critical arrhythmia alarm types were selected to be (i) asystole, (ii) extreme bradycardia, (iii) extreme tachycardia, (iv) ventricular tachycardia (VTach), and (v) ventricular fibrillation. Annotation revealed the FA rates of these five alarm types to be 90.7, 29.3, 23.1, 46.6 and 79.6 per cent, respectively, with an average FA rate of 42.7 per cent. An algorithm to suppress these FAs was then developed, which used a signal quality measure, This approach provided an overall FA reduction rate for the five alarm categories above of (i) 93.5 per cent, (ii) 81.0 per cent, (iii) 63.7 per cent, (iv) 33.0 per cent, and (v) 58.2 per cent, with an overall suppression rate of 59.7 per cent. This equates to an equivalent FA rate of (i) 5.5 per cent, (ii) 5.5 per cent, (iii) 8.4 per cent, (iv) 30.8 per cent, and (v) 33.1 per cent, with an overall FA rate of 17.2 per cent. However, it should be noted that invasive arterial lines are not available for all patients in the ICU (only approx. two-thirds of the population), and so to provide this level of FA suppression for all life-threatening alarms would require an extension of the algorithm to use the oxygen saturation waveform. TA suppression rates were all zero except for VTach, indicating that VTach does not always manifest as an abnormal ABP waveform, and referencing back to the ECG is required. A full description of the method and results can be found in PhysioNet . However, combinations of parameters can provide a richer picture of the state or class of a patient. For example, a series of desaturations during the night followed by cessations in breathing are indicative of apnoea. The prior probability of placing the patient into a given class can be extremely important and a rich database of ICU data also provides the opportunity to extract information for such prior probabilities from alternative sources.The objective (or semi-objective) classification of ICU data requires a standardized lexicon or system of labelling. Although such systems exist for some signals (such as the ECG), many labels rely on subjective observations with high interobserver variability. Furthermore, for many medical diagnoses, there are no agreed definitions, and the divisions between categories are fuzzy. For example, more than 30 different definitions of acute renal failure have been used in the literature  acts as an umbrella lexicon for many of these subsystems . The codes are often associated with a qualifier . Although many of these codes are predefined in drop-down lists to enable rapid and accurate coding, some events necessarily require a new code. In this case, a free text string can be entered by the clinician to see a range of possible codes to select from. We found that spell checking, general abbreviation dictionaries and personalized abbreviation dictionaries were necessary to enable clinicians to find relevant codes in a timely manner.We have therefore developed open-source Much of the data about patients that are not directly measured by computerized instruments is available only in the form of unstructured natural language statements by clinicians. These data can be typed directly by a clinician or transcribed from dictation or handwritten notes. Unfortunately, manual data entry practices and conversion of data into electronic medical records are prone to error. One study  As reported in artificial intelligence complete\u2014it would require a program with true human-level intelligence. Of course, we are not anywhere near that in our technical abilities. Therefore, researchers have taken a range of approaches to the extraction problem. At one extreme are systems that use the best available computational linguistics methods to assign likely parts of speech and semantic categories to individual words, to parse the linguistic structure of the phrases, clauses, sentences and paragraphs that express information, and thus to do a deep analysis of the text. Our program takes a more minimalist approach, dividing the text using punctuation, conjunctions, numbers and a few verbs into phrases. Within these, it looks for the maximum length sub-phrase that matches a UMLS concept, without regard to the surrounding text. We have demonstrated that this approach works well when sensitivity is the overriding concern. It needs further enhancement when elimination of irrelevant concepts is important .If we could build a program that \u2018understands\u2019 natural language, then it would be relatively easy to pick out the concepts we want to recognize. However, the problem of understanding text is thought to be Over the last 5 years, we have encountered significant barriers to the analysis of data in the ICU. These include inaccuracies in time stamps, the sparseness or incompleteness of information , non-specific labelling , contradictory information (such as when two monitors disagree about a measurement) and simply incorrect information (such as FAs). To some extent, we have addressed many of these issues using data fusion techniques, model construction and automated coding. However, the issues described in this paper still present significant barriers to the use of ICU data for decision support, particularly with respect to the sparseness of the data and the non-specific labelling of clinical information in free text. Despite this, current trends in hospital information systems provide for an optimistic horizon, as increasing volumes of more frequent data are being captured automatically from monitors . Hospital information systems are also moving towards using universal lexicons. Furthermore, current trends towards open data storage formats and interchange protocols mean that open source tools we have developed are likely to be generally useful on a wide variety of data."}
+{"text": "The mean plane of the pyrazole ring forms dihedral angles of 9.11\u2005(12) and 39.65\u2005(11)\u00b0 with the phenyl rings. The O atoms deviate from the mean planes of the chromene and ace\u00adnaphthyl\u00adene ring systems by 0.194\u2005(15) and 0.079\u2005(15)\u2005\u00c5, respectively. In the crystal, molecules are linked via pairs of C\u2014H\u22efO inter\u00adactions,forming inversion dimers with an R22(12) ring motif.In the title compound, C \u00c5b = 12.7374 (5) \u00c5c = 13.2489 (5) \u00c5\u03b1 = 114.365 (2)\u00b0\u03b2 = 96.960 (2)\u00b0\u03b3 = 92.281 (2)\u00b0V = 1521.17 (11) \u00c53Z = 2K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 295 K0.30 \u00d7 0.25 \u00d7 0.20 mmBruker Kappa APEXII CCD diffractometerSADABS; Bruker, 2008Tmin = 0.975, Tmax = 0.983Absorption correction: multi-scan (32812 measured reflections9207 independent reflectionsI > 2\u03c3(I)5094 reflections with Rint = 0.036R[F2 > 2\u03c3(F2)] = 0.055wR(F2) = 0.166S = 1.019207 reflections424 parametersH-atom parameters constrainedmax = 0.46 e \u00c5\u22123\u0394\u03c1min = \u22120.32 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  global, I. DOI: Click here for additional data file.10.1107/S1600536813009562/rk2396Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The thia\u00adzole ring adopts an envelope conformation with the N atom as the flap, while the pyrrolidine ring has a twisted conformation on the N\u2014C bond involving the spiro C atom. The \u03b2 la\u00adctam ring makes dihedral angles of 39.74\u2005(15) and 16.21\u2005(16)\u00b0 with the mean planes of the thia\u00adzole and pyrrolidine rings, respectively. The thia\u00adzole ring mean plane makes dihedral angles of 23.79\u2005(13) and 70.88\u2005(13) \u00b0 with the pyrrolidine and cyclo\u00adpentane rings, respectively, while the pyrrolidine ring makes a dihedral angle of 85.63\u2005(13)\u00b0 with the cyclo\u00adpentane ring. The O atom attached to the \u03b2 la\u00adctam ring deviates from its mean plane by 0.040\u2005(2)\u2005\u00c5, while the O atom attached to the cyclo\u00adpentane ring deviates from its mean plane by 0.132\u2005(2)\u2005\u00c5. In the crystal, mol\u00adecules are linked by C\u2014H\u22efO hydrogen bonds, forming chains along [010], and C\u2014H\u22ef\u03c0 and \u03c0-\u03c0 inter\u00adactions [centroid-centroid distance = 3.6928\u2005(17)\u2005\u00c5].The mol\u00adecular conformation of the title compound, C \u00c5b = 14.3742 (7) \u00c5c = 11.6657 (6) \u00c5\u03b2 = 110.107 (3)\u00b0V = 1694.50 (14) \u00c53Z = 2K\u03b1 radiationMo \u22121\u03bc = 0.22 mmT = 293 K0.30 \u00d7 0.25 \u00d7 0.20 mmBruker SMART APEXII area-detector diffractometerSADABS; Bruker, 2008Tmin = 0.937, Tmax = 0.957Absorption correction: multi-scan (15747 measured reflections7910 independent reflectionsI > 2\u03c3(I)5429 reflections with Rint = 0.034R[F2 > 2\u03c3(F2)] = 0.045wR(F2) = 0.114S = 1.007910 reflections452 parameters1 restraintH-atom parameters constrainedmax = 0.24 e \u00c5\u22123\u0394\u03c1min = \u22120.28 e \u00c5\u22123\u0394\u03c1Absolute structure: Flack 1983, 3527 FrFlack parameter: \u22120.05 (5)APEX2  used to solve structure: SHELXS97  global, I. DOI: Click here for additional data file.10.1107/S1600536813009276/su2576Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The 1,3,2-dioxaborolane ring is almost planar (r.m.s. deviation = 0.035\u2005\u00c5), and the syn H and Me substituents at this ring are in an eclipsed conformation. The cyclo\u00adhexane and cyclo\u00adbutane rings adopt sofa and butterfly conformations, respectively. The B atom has a trigonal\u2013planar configuration (sum of the bond angles = 360.0\u00b0). The phenyl ring is practically coplanar with the 1,3,2-dioxaborolane ring [dihedral angle between the ring planes = 1.96\u2005(8)\u00b0]. The absolute structure was determined from the known configuration of (+)-pinanediol which was used in the synthesis. In the crystal, weak C\u2014H\u22ef\u03c0(Ph) inter\u00adactions occur.The mol\u00adecule of the title compound, C \u00c5b = 11.8566 (4) \u00c5c = 13.9580 (4) \u00c5V = 1406.27 (8) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.08 mmT = 100 K0.25 \u00d7 0.22 \u00d7 0.18 mmBruker APEXII CCD diffractometerSADABS; Sheldrick, 2003Tmin = 0.981, Tmax = 0.986Absorption correction: multi-scan (21778 measured reflections2905 independent reflectionsI > 2\u03c3(I)2717 reflections with Rint = 0.037R[F2 > 2\u03c3(F2)] = 0.034wR(F2) = 0.092S = 1.052905 reflections176 parametersH-atom parameters constrainedmax = 0.30 e \u00c5\u22123\u0394\u03c1min = \u22120.20 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXTL  global, I. DOI: Click here for additional data file.10.1107/S1600536812041712/fb2267Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "The three C atoms of a di\u00admeth\u00adoxy\u00adethane ring and dioxolane ring attached with two methyl groups are disordered over two sets of sites in 0.66\u2005(2):0.34\u2005(2) and 0.62\u2005(2):0.38\u2005(2) ratios, respectively. The major and minor components of the ace\u00adnaphthyl\u00adene ring are essentially planar . The major and minor components of the pyrrolidine ring adopt C-envelope conformations with C atoms displaced by 0.492\u2005(11) and 0.595\u2005(7)\u2005\u00c5 from the remaining ring atoms. One of the dioxolane rings is disordered with its major component in an envelope conformation [C displaced by 0.511\u2005(11)\u2005\u00c5] and the minor fraction is more or less planar with an r.m.s. deviation of 0.070\u2005\u00c5. The other dioxolane ring is in an envelope conformation, with a C atom displaced by 0.438\u2005(3)\u2005\u00c5 from the remainder of the ring atoms. The crystal packing features C\u2014H\u22efO inter\u00adactions, which generate C(9) chains.In the title mol\u00adecule, C \u00c5b = 18.5489 (13) \u00c5c = 8.9213 (8) \u00c5V = 2872.4 (4) \u00c53Z = 4K\u03b1 radiationMo \u22121\u03bc = 0.09 mmT = 293 K0.30 \u00d7 0.25 \u00d7 0.25 mmBruker Kappa APEXII CCD diffractometerSADABS; Bruker, 2008Tmin = 0.974, Tmax = 0.978Absorption correction: multi-scan (14399 measured reflections5184 independent reflectionsI > 2\u03c3(I)3771 reflections with Rint = 0.030R[F2 > 2\u03c3(F2)] = 0.039wR(F2) = 0.099S = 1.035184 reflections572 parameters332 restraintsH-atom parameters constrainedmax = 0.13 e \u00c5\u22123\u0394\u03c1min = \u22120.11 e \u00c5\u22123\u0394\u03c1APEX2  used to solve structure: SHELXS97  global, I. DOI: 10.1107/S1600536813024586/pv2644Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "Previous population-based studies have found that delusional-like experiences (DLEs) are prevalent in the community, and are associated with a wide range of mental health disorders. The aim of the study was to investigate mental health service use by people with DLEs.Subjects were drawn from the Australian National Survey of Mental Health and Wellbeing 2007 of 8 841community residents aged between 16 and 85 years. The Composite International Diagnostic Interview (CIDI) was used to identify DLEs. Service utilization was assessed using a module that elicited information about hospital admissions, consultations with various health professionals, and prescription medication use. This study focussed on service use for mental health problems. We used logistic regression to examine the association, adjusting for potential confounding factors.Of 8 773 included participants, 8.4% (n\u200a=\u200a776) positively endorsed one or more DLEs. With respect to consultations for mental health needs, individuals who endorsed DLEs were more likely to consult health professionals compared with those who did not endorse DLEs. Individuals with DLEs were also more likely to use prescription medicine. When we repeated the main analysis in a subgroup excluding any CIDI diagnosis of mental health disorders the results remained largely unchanged.DLEs are common in the general population, and individuals with DLEs have an increased rate of accessing services for their mental health needs. Individuals endorsing both DLEs and increased help-seeking may identify a group of vulnerable people who have increased risk of developing psychotic illnesses later in life. This needs closer scrutiny in longitudinal prospective studies. A systematic review of population-based studies found that hallucinations and delusional-like experiences (DLEs) are common among the general population with prevalence ranging between three and twenty percent help seeking behaviours, suggesting that PLEs in individuals seeking mental health care have a higher predictive value for future psychotic illness.Both DLEs and hallucinations have been branded as part of an extended phenotype of psychotic disorder or \u2018subclinical psychoses\u2019 which may exist along a continuum of symptom severity represented at its extremity by a skewed distribution of clinically diagnosable psychotic disorders To date outcomes of studies linking service use with DLEs and hallucinations have been inconsistent. Murphy et al. In Australia, access to health care is readily available and there are few barriers to help seeking. Usually, primary care physicians (GPs) decide the appropriate care pathway for a patient. Australian citizens can present to a GP with any health problem and their consultation is subsidised by the national health insurance scheme (Medicare). People with a mental health problem who consult their GP may then receive ongoing care by the GP We sought to investigate, and clarify further, the issues surrounding DLEs and service utilization for mental health needs in a large nationally representative population-based sample. This database had advantages compared to previous studies: larger sample size, population sampling, and wider range of professional and community supports surveyed. Furthermore, in addition to assessing consultations with various professionals, we examined use of both over-the-counter and prescription medications and hospital admissions. Based on the existing literature, we predicted that those who reported DLEs were more likely to utilise a broad range of health services for mental health related issues. Furthermore, we predicted that those with DLEs but without a diagnosable mental health problem would also be more likely to utilise health services for mental health related issues.Subjects were drawn from the Australian National Survey of Mental Health and Wellbeing 2007 (NSMHWB). Details of the methodology have been published elsewhere A modified version of the World Mental Health Survey Initiative of the Composite International Diagnostic Interview (WMH-CIDI 3.0) was used to generate lifetime DSM-IV based diagnoses of a wide range of common mental health disorders including anxiety disorders, depressive disorders, and alcohol or drug abuse/dependence. In keeping with our previous studies Have you ever seen a general practitioner about problems with your mental health?\u2019 or \u2018Have you ever seen a psychiatrist for problems with your mental health?\u2019 For this study we used lifetime use of services for mental health problems only, to remain consistent with outcome variables.Health service use was assessed using a module in the WMH-CIDI 3.0. This was a purpose-designed measure developed for use in the Australian context. It focussed on respondents\u2019 lifetime as well as 12 months use of services for mental and other health problems. This study focussed on service use for mental health problems. It elicited information about consultations with various health professionals, hospital admissions and prescription medication use. Health professionals included: GPs, psychiatrists, psychologists, other mental health professionals . Other health professionals include specialist doctors, other professionals providing general services and complementary/alternative therapists. The module included questions for lifetime service use such as \u2018Have you ever been admitted overnight or longer in hospital for problems with your mental health? \u2019; \u2018Did you ever get any prescription medication for problems with your mental health?\u2019).Similarly, data on hospital admissions and prescription medication use were also collected for mental health problems only, and for lifetime ever (\u2018Had been told at any time by a psychiatrist that they had schizophrenia\u2019) were excluded from the analyses (n\u200a=\u200a68), leaving a total of 8 773 subjects for this study.In keeping with our previous analyses reference group for all variables.For the main analyses, we examined the association between DLEs (i.e. at least one of the G screen or probe items endorsed), and service use including consultation with a general practitioner, psychiatrist, psychologist or any health professional for mental health problems. \u2018No contact\u2019 was used as the Based on previous research of factors associated with DLEs, in Model 1 we adjusted for sex and age at assessment subclinical symptoms only).To explore the findings under more restrictive conditions we repeated the main analyses in the subgroup who had no lifetime diagnosis of any CIDI-derived DSM-IV mental health disorders  positively endorsed one or more DLEs screen items . With reCompared with those who did not endorse DLEs, individuals with DLEs had approximately twice the odds of reporting lifetime use of prescription medication, hospitalisation and taking vitamins and herbal medication for their mental health needs in the previous fortnight . HoweverIn this national Australian survey, those participants who endorse DLEs were significantly more likely to have had contact with primary care physicians, psychologists and other health professionals for their mental health problems. After excluding individuals who had a lifetime CIDI diagnosis of any mental disorder, those who endorsed DLEs were still significantly more likely to have had contact with primary care physicians and psychologists.Given previous studies showing those with DLEs are more likely to experience a broad range of mental health problems Although people with DLEs are more likely to use prescription medications for their mental health needs than their non-DLEs counterparts, we were not able to determine what type of medications was prescribed. As DLEs are associated with anxiety, depression and psychological distress, we would expect higher usage of psychotropic medications.These results enrich our understanding of the clinical significance of DLEs. It has become increasingly apparent that DLEs are non-specific markers of poor health. Studies have shown that those with DLEs are more likely to have drug and alcohol problems never attended a health practitioner for management of a mental health problem. It is unclear from this study if these participants were distressed by their experiences but (a) had chosen to avoid health professionals, or (b) were seeking help but could not access any services (i.e. had an unmet need). Alternatively, individuals with DLEs may have been otherwise healthy and had no need for mental health care. Previous studies have shown that those with sub-clinical psychotic experiences have an increased risk of both psychotic and non- psychotic disorders It is worth noting that in spite of the increased risk of morbidity associated with DLEs The interpretation of this study has several caveats. The results are based on a cross-sectional sample, and thus we do not know the sequence of DLEs versus help-seeking behaviour. We used only three screen items to measure delusional experiences and there were no items for hallucinations although previous studies have shown that DLEs as measured by the CIDI are highly correlated with hallucinations In summary, our results indicate that individuals who had DLEs were more likely to seek help from health professionals for their mental health problems independently of any mental health disorders. It is now very apparent that there is a high level of morbidity associated with DLEs, which in turn leads to increased burden on health service providers. With the increased risk to both mental and physical health that people with DLEs experience, and the cost of the associated health care, there is an unambiguous need for studies to intervene with those who experience DLEs.Table S1CIDI Screen items for Psychosis .(DOCX)Click here for additional data file."}
+{"text": "We also describe a newly developed and optimized fast real-time PCR assay that was used to detect dyskerin pseudouridylation activity invitro. The identification of new dyskerin inhibitors constitutes the first proof of principle that the pseudouridylation activity can be modulated by means of small molecule agents. Therefore, the presented results, obtained through the usage of computational tools and experimental validation, indicate an alternative therapeutic strategy to target ribosome biogenesis pathway.The product of the DKC1 gene, dyskerin, is required for both ribosome biogenesis and telomerase complex stabilization. Targeting these cellular processes has been explored for the development of drugs to selectively or preferentially kill cancer cells. Presently, intense research is conducted involving the identification of new biological targets whose modulation may simultaneously interfere with multiple cellular functions that are known to be hyper-activated by neoplastic transformations. Here, we report, for the first time, the computational identification of small molecules able to inhibit dyskerin catalytic activity. Different  One basic prerequisite for the development of antineoplastic therapeutics is represented by the identification of cellular processes that are selectively altered in cancer cells and that could be modulated by pharmacological actions on specific biological targets.Among a series of cellular processes, both ribosome production and telomerase functions are known to be hyper-activated by neoplastic transformation. On one side, the rate of ribosome biogenesis regulates cellular growth and proliferation, and cancer cells carry over an increased production of ribosomes to sustain the protein synthesis necessary for unbridled cell growth The product of DKC1 gene, dyskerin, is necessary for both processes of ribosome biogenesis and telomerase complex stabilization This is consistent with the need to support the increased production of ribosomes and the increased demand for telomerase function characterizing actively growing tumor cells.insilico, the Open National Cancer Institute database to select potential small molecule compounds interacting with the dyskerin catalytic site that was found particularly amenable for accommodating ligands The targeting of dyskerin is therefore expected to weaken both the production of ribosomes and the proper telomerase complex functioning impairing preferentially the growth of highly proliferating cancer cells. Based on these facts we envisioned to specifically targeting dyskerin catalytic function by means of small molecule inhibitors in order to preferentially target cancer cells. To this end we have generated a structural model of the full-length human dyskerin based on known crystal structures of yeast invitro. Among all compounds, we identified four agents capable of significantly inhibit dyskerin activity. This result represents the proof of principle indicating that dyskerin catalytic activity can be modulated pharmacologically by means of small molecule inhibitors.The effects of the selected compounds were tested with a newly developed and optimized fast real-time PCR assay detecting the dyskerin pseudouridylation activity saccharomyces cerevisiae (PDB ID: 3U28), which has a sequence identity of 73% with the human dyskerin sequence (pyrococcus furiosus (PDBID: 2EY4), which had a lower sequence alignment identity of 40% and therefore was not further considered The three-dimensional structure of the human dyskerin structure has not been solved yet. In order to pursue a structure-based identification of dyskerin inhibitors, we created a homology model of human dyskerin by using a template crystal structure from sequence  [16]. Thinsilico the open NCI compounds dataset of the CoCoCo databases Encouraged by this, and with the aim to identify new small molecule inhibitors targeting the human dyskerin catalytic site, we used the three-dimensional coordinates of the obtained homology model to set up a structure-based virtual screening approach. By means of molecular docking techniques, we screened invitro real-time PCR-based assay  tested in the in cell free assay. Obtained results indicate that endogenous 28S rRNA U4393/U4390 modification is inhibited by compound 1 (9) did not induce any change on the modification of the same sites in cells  involved in the denovo synthesis of pyrimidines nucleotides, DNA synthesis blocking and cellular replication 1, 5, 6 and 10 and the expression of DKC1 gene in human cancer cell lines  (Compound \u200a=\u200a0.03) . These rad-hoc molecules with improved enzymatic and biological effects. In respect to this, and with the purpose to rationalize at a molecular level the bioactivity of compounds 1, 5, 6 and 10, we performed a thoughtful structural analysis of the molecules and a summary of the interactions in the catalytic site that are responsible to ligand - dyskerin binding.The results presented in 1 is structurally different from compounds 5, 6 and 10 , the correct binding pose of 1 is expected to be the one shown in 5, 6 and 10, unveil a similar superimposition of the uracil ring  protocol was used with the human dyskerin model and the four active compounds. The IFD allows the movement of the residues in the binding site region leading to a more accurate prediction of binding modes. Compound 6 and 10  and the cil ring  that perthe R227 , that prthe R227 . Importa6 and 10 . Moreovend 10 , with a sequence alignment identity of the 73% A homology model was created starting from the human dyskerin protein sequence (Uniprot code: O60832), by excluding nuclear and nucleolar localization sequences, which are not related to the target pseudouridylation catalytic site We created the homology model of human dyskerin using the yeast template with MODELLER software  [43]. Thhttp://dtp.cancer.gov) compound dataset of the CoCoCo databases With the aim to discover new small molecule inhibitors targeting the human dyskerin catalytic site, the docking software Glide (version 5.7), was used to perform a high-throughput virtual screening of the open NCI ATCCCGAACCTGAACCGGCCAAGCGUUCAUAGCGACGCCCUAUAGUGAGUCGUAUUA(dTdC).The synthetic rRNA substrate 28S U4393/U4390 was designed to contain a 22 nucleotides long sequence of 28S rRNA with uridines U4393/U4390 and a 20 nucleotides long sequence at the 3\u2032 to specifically reverse-transcribe the rRNA substrate. The complete sequence is here reported: , and swollen for 15 min in 2 times the pellet volume of a hypoosmotic homogenization buffer . The cells were disrupted with 12 to 15 strokes of a tight-fitting pestle in a Dounce homogenizer. After a 10-min centrifugation at 1,000 g, the pellets (crude nuclei) were suspended in 0.5 ml of reconstitution buffer . The viscous solution was sonicated 6\u20138 times for 15 sec followed by 15-sec cooling periods in between until a great reduction of the viscosity occurred. The nuclear lysate was frozen in aliquots and stored at \u221280C.2), 8 pg of tRNA,160 U of RNasin (Promega) and approximately 80 fmol of rRNA substrate. Each compound was diluted in DMSO (Sigma-Aldrich) and 100 \u00b5M of each of them or DMSO (in the control samples) were added to the mixture. The mixture was incubated at 30\u00b0 and 4\u00b0C for 120 minutes unless differently indicated. The reaction was terminated on ice and RNA extracted with Tri- Reagent (Ambion) following the manufacturer\u2019s protocol.Pseudouridylation reaction was carried out as previously described (20) with some modifications. Particularly, the reaction was carried out in a final volume of 200 \u00b5l in order to obtain a sufficient amount of RNA to be used in the consequent passages. A 200 \u00b5l reaction contained 80 \u00b5l of MCF7 nuclear extract, 40 \u00b5l of 5X Reconstitution buffer  and 40 U of RNasin Plus RNase Inhibitor (Promega) were mixed and incubate at 50\u00b0 for 5 minutes in a thermocycler to stimulate the annealing of the specific reverse primer. During the second step, M-MLV Reverse Transcriptase Reaction Buffer (Promega), 200 U of M-MLV retrotranscriptase (Promega) and 10 \u00b5M dNTPs (Promega) were added to mixture and inserted in the thermocycler. The conditions of the reverse transcription were: 5 minutes at 4\u00b0C, 60 minutes at 37\u00b0C, 15 minutes at 70\u00b0C and 4\u00b0C forever.5\u2032-GAACCTGAACCGGCCAAG-3\u2032 and primerR 5\u2032-CTATAGGGCGTCGCTATGA-3\u2032. This set of primer permits the amplification of the specific retro transcribed RNA. For each sample three replicates were analyzed. The amount of 28S U4393/U4390 uridines pseudouridylated was calculated by the fold change 2\u2227DCt were DCt is the difference between the Ct medium of the samples treated with each molecule and the Ct medium of the positive control (the sample without the addition of inhibitors at 30\u00b0C). Real Time PCR for human TERC mRNA expression analysis was performed as previously described 5\u2032-TATCGAACGCTTCACGAATTTGC-3\u2032. The final results were determined by the 2\u2227\u2212\u0394\u0394Ct method.Real-time PCR analysis was performed in a Gene Amp 7000 Sequence Detection System (Applied Biosystems) using the Syber-green (Applied Biosystems) approach. The set of primers (IDT DNA) used were: primerF 2. MCF7 were grown in RPMI 1640 (Sigma-Aldrich) supplemented with 10% of fetal bovine serum ), 2 mM L-glutamine (Sigma-Aldrich)), 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Aldrich). Cells were treated with 100 \u00b5M of each compound or DMSO for 24, 48, 72 and 96 hour. For the dose/response curve cells were treated with 5, 10, 50 and 100 \u00b5M of compound 1 for 24, 48, 72 and 96 hours. We used the Alamar Blue assay (Invitrogen) to test the vitality of the cells after the treatment following the manufacturer\u2019s instruction. Stable MCF7 (shDKC1), and their relevant empty vector controls were generated as described previously Human breast cancer derived cell lines MCF7 (obtained from ATCC) were cultured in a monolayer at 37\u00b0C in a humidified atmosphere containing 5% CO1, 9 or DMSO for 24 hours. Two \u00b5g of RNA was modified with CMC as described above. The reverse transcription reaction was carried out using an oligonucleotide directed to a sequence adjacent to the same 28S RNA sequence included in the synthetic rRNA substrate used in the invitro assay: 5\u2032- ATTATGCTGAGTGATATCCCATCGAAGGATCAAAAAGCGA-3\u2032. The oligonucletide contained a linker sequence in its 5\u2032 allowing the specific amplification of the reverse transcribed templates. The reaction was made in two steps in a final 20 \u00b5l mixture. During the first step 100 ng of RNA, 0.2 \u00b5M specific reverse primer and 40 U of RNasin Plus RNase Inhibitor (Promega) were mixed and incubate at 50\u00b0C for 10 minutes to allow the annealing of the specific reverse primer. During the second step, M-MLV Reverse Transcriptase Reaction Buffer (Promega), 200 U of M-MLV retrotranscriptase (Promega) and 2 \u00b5M dNTPs (Promega) were added to mixture. Reverse transcription and Real-time PCR analysis was performed as described above, using the following PCR primers: primer F 5\u2032-GTGTCAGAAAAGTTACCACA-3\u2032; primer R: 5\u2032-ATTATGCTGAGTGATATCCC-3\u2032.MCF7 cells were treated with 1 \u00b5M, 10 \u00b5M and 100 \u00b5M of compound Mann-Whitney U or Fischer\u2019s exact tests were used, when appropriate, for the comparisons among groups. Values for p less than 0.05 were regarded as statistically significant.1 were retrieved from the PubChem database . The number of published studies where DKC1 gene is differentially expressed compared to the gene\u2019s overall mean expression level in the study was retrieved from the Gene Expression Atlas database .Activity and inactivity data of compound File S1Supporting Information.S1, Pseudouridylation assay on synthetic rRNA lacking E3/U68 binding sequences. Figure S1, Sequence alignment of human dyskerin and yeast cbf5 primary structures. Figure S2, Backbone RMSD fluctuation of the human dyskerin model presented and used for structure based virtual screening during 10 ns of molecular dynamics simulation. The higher fluctuation between 7\u20138.5 ns is due to the movement of the loop covering the pseudouridylation site. The protein remains folded for the complete simulation time demonstrating the good quality of the assembled human dyskerin model. Figure S3, Chemical structures of tested compounds for inhibition of pseudouridylation catalytic activity of human dyskerin. Figure S4, Real time RT-PCR assay used in the pseudouridylation assay selectively amplifies full length products (5\u2032 TAA TAC GAC TCT CTA TAG GGC GTC GCT ATG AAC GCT TGG CCG GTT CAG GTT CGG GAT 3\u2032), while predicted truncated products (5\u2032 TAA TAC GAC TCT CTA TAG GGC GTC GCT 3\u2032) originating from pseudouridylated templates are not amplified. Figure S5, Dose-Response curve of compound 1 on MCF7 cells. The experiment was performed treating the cells with DMSO (CTRL) or 5, 10, 50 and 100 \u00b5M of compound 1 for up to 96 hours. Alamar Blue assay was performed each 24 hours. Means and SDs from three independent experiments are represented. Figure S6, Effect of compound 1 on telomerase RNA component (TERC) expression. The experiment was performed treating the nuclear lysate with DMSO (CTRL) or 100 \u00b5M of compound 1 for 120 minutes in the reaction mixture. Histograms represent means and SDs from three independent experiments. The final results were determined by the 2\u2227\u2212\u0394\u0394Ct method. Differences between the groups are not significant. Figure S7, Effect of treatment with compound 9 on MCF7 endogenous U4393/U4390 rRNA pseudouridylation. Cells were treated with 1 \u00b5M, 10 \u00b5M and 100 \u00b5M of compound 9 or DMSO for 24 hours. The pseudouridylation reaction was carried out at 30\u00b0C. Histograms represent means and SEMs from three independent experiments. Differences between the groups are not significant. Figure S8, (A) Contour maps generated with the software SiteMap (http://www.schrodinger.com), thereby presenting hydrophobic (yellow regions), donor (blue regions) and acceptor (red regions) potentials. Contour maps represent the ideal region of the space where a corresponding ligand feature should be located in order to interact optimally with the human dyskerin catalytic site. (B) Molecular surface of the human dyskerin coloured by electrostatic potential. Blue regions represent positively charged residues while red regions negatively charged residues. Figure S9, (A) Comparative analysis of the available structures of related pseudouridine-synthase PUS1 and PUS10. On the left column, compound 1 complexes were minimized into the active site of PUS1 and PUS10 starting from the binding pose obtained by overlaying these structures with the human Dyskerin \u2013 compound 1 complex (Yellow lines indicate hydrogen bonds); On the right column, a ligand interaction diagram for each complex is presented . (B) Specific inhibitory effect of compound 1 on dyskerin activity. A different synthetic substrate RNA depleted of the sequences for snoRNAs U68 and E3 recognition and for U4390, but conserving U4393 was used in the in vitro assay developed. The experiment was performed treating the nuclear lysate with DMSO (CTRL) or 100 \u00b5M of compound 1 for 120 minutes in the reaction mixture. Histograms represent means and SEMs from three independent experiments. Correlations between the groups are not significant. Table S1, List of NCI human tumor cell lines with confirmed bioactivity of compound 1 and their relative expression profiles of human dyskerin classified as overexpressed, underexpressed or not differentially expressed. Data were collected as described in the materials and methods paragraph. Table S2, List of NCI human tumor cell lines with confirmed inactivity of compound 1 and their relative expression profiles of human dyskerin classified as overexpressed, underexpressed or not differentially expressed. Data were collected as described in the materials and methods paragraph.(PDF)Click here for additional data file."}
+{"text": "Clostridium perfringens septicemia in a patient presenting with a bleeding ulcer of a jejunal interposition.  We report a case of Clostridium perfringens septicemia. The postmortem examination revealed a diffuse spread of Clostridium perfringens to multiple organs.  An 81-year-old female patient was acutely admitted to our hospital due to hematemesis and melena. She had a history of metastatic gastrointestinal stromal tumor, for which she was receiving second line treatment with sunitinib. She had also undergone a Merendino procedure 4 years prior to presentation. The patient underwent emergency gastroscopy, which revealed a bleeding ulcer in the jejunal interposition. Despite initial endoscopic control of the bleeding and transfusion of blood products, the hemoglobin level continued to drop, and the patient was treated for an assumed hemolytic transfusion reaction. The patient died 3 days following admission, and the results of blood cultures later confirmed a Clostridium perfringens, as a potential cause of hemolysis. It also demonstrates the extent of organ involvement in a case of diffuse clostridial myonecrosis. This case is a reminder of the importance of considering septicemia, particularly in association with  Clostridium perfringens (C. perfringens) is an anaerobic, gram-positive bacillus which occurs naturally in the human gastrointestinal and urogenital tract. C. perfringens septicemia is a rare but often fatal condition which commonly originates in the uterus, colon, or biliary tract. Most cases report patients who are immunocompromised, with underlying malignant disease, diabetes mellitus, or prior abdominal and retroperitoneal surgery [ surgery \u20134.C. perfringens is known to release 4 toxins which are highly toxic and primarily responsible for disease pathogenesis. While the beta toxin is known to play a significant role in the pathogenesis of necrotizing enteritis, the alpha toxin is considered responsible for myonecrosis of infected tissues and is also capable of causing hemolysis. In this case, the alpha toxin splits lecithin to phosphocholine and diglyceride, causing impairment of the functional integrity of the red blood cell membrane [membrane , 6.C. perfringens is a lethal condition, with a mortality rate of 70\u2013100% without prompt diagnosis and therapy. The recommended treatment includes aggressive surgical debridement combined with high-dose antibiotics, commonly a combination of penicillin G with clindamycin [Septicemia associated with ndamycin \u20138. Some ndamycin , 10.An 81-year-old female patient presented to our emergency department with acute onset of hematemesis and melena. On admission, the patient appeared to have a poor general health condition and was hemodynamically compromised. Her initial laboratory exams revealed a hemoglobin concentration of 7.7\u2009mg/dl without leukocytosis or C-reactive protein (CRP) elevation. The patient had a history of a 6.5\u2009cm gastrointestinal stromal tumor (GIST) of the cardia, for which she initially received downsizing treatment with imatinib 400\u2009mg/d, followed by surgical resection of the gastroesophageal junction and reconstruction with a jejunal interposition (Merendino procedure) 4 years earlier . Histopa\u00ae, a prothrombin complex concentrate containing the coagulation factors II, VII, X, and IX.The patient was immediately transferred to our intensive care unit, where she was intubated and received two units of packed red blood cells (pRBCs). An emergency gastroscopy was carried out, which revealed active bleeding from a vessel stump in the jejunal interposition, corresponding to a Forrest stage I b upper gastrointestinal bleed. The bleeding was successfully stopped endoscopically by local injection of adrenaline and the application of polymer powder. A CT scan of the thorax and abdomen showed no signs of active bleeding or free abdominal fluid . The knoOn the second day after admission, a temporary improvement in the clinical condition of the patient was observed. It was possible to extubate the patient, who was hemodynamically stable with no signs of active bleeding. A phase of atrial fibrillation was cardioverted following treatment with a beta blocker, digoxin, and amiodarone. On the third day following her admission, the patient's condition deteriorated rapidly with the occurrence of fever, gross hematuria, and decreased oxygen saturation. A delayed hemolytic transfusion reaction was suspected, and positive Rh antibodies (anti-c antibody) were detected. Clinically as well as biochemically, the patient was suffering from a hemolysis with a decline of the hemoglobin concentration to 4.8\u2009mg/dl and an increase of lactate dehydrogenase (LDH) to 3842.0\u2009U/l. Given the lack of a septic focus, only a marginal increase in the inflammatory parameters, and pending blood culture results, no antibiotic treatment or surgical therapy was initiated. Due to imminent respiratory failure, the patient was reintubated. Vasopressors, atropine, and crystalloid solutions were administered to treat bradycardia and shock. However, the patient died on the same evening, following an unsuccessful cardiopulmonary resuscitation.C. perfringens and the detection of the alpha toxin gene by polymerase chain reaction, but without any traces of the beta toxin, enterotoxin, epsilon toxin, or iota toxin. The autopsy of the patient revealed a 6\u2009cm sized local recurrence of the GIST and multiple necrotic liver metastases. In addition, a diffuse spread of C. perfringens in multiple organs with advanced tissue lysis was histologically confirmed , and only 1 patient suffered from acute hemolysis [The majority of clinical data published on C. perfringens skin and soft tissue infection 8 years after liver transplantation [The reason why a natural inhabitant of the human bowel induces such a disastrous infection is still unclear. It appears that, in many cases, the patients are immunocompromised. In their literature review of 40 cases between 1990 and 2010, van Bunderen et al. reported an underlying hematological disorder in 22.5% of cases, a pancreatic or gastric cancer in 12.5%, and/or diabetes mellitus in 30.0% [C. perfringens infection is as unclear as the method of dissemination in the body. Law and Lee presumed a necrosis of the rectal cancer of their patient as the gate for systemic infection [C. perfringens due to emphysematous cholecystitis with subsequent cholestasis, cholangitis, and liver abscesses have also been described [C. perfringens dissemination in an immunocompromised patient. Two gastroscopies on day 1, which involved the endoscopic injection of adrenaline as well as air insufflation to increase the intraluminal pressure, may have contributed to the entry or spread of C. perfringens from the gastrointestinal lumen into the tissue. The presence of necrotic GIST metastases may have also facilitated further dissemination in the entire body. Nevertheless, bacterial entry through sources other than an ulcer cannot be excluded with certainty. In their case report, Severin et al. described a patient with C. perfringens-associated necrotizing enteritis, where no ulcers were found in postmortem examination [The trigger for the development of a nfection . Hemolysescribed . Rajendrescribed . In thismination . Furthermination . The susmination .\u201cThis is a disease that begins where other diseases end, with death .\u201dC. perfringens septicemia does not leave much time for the diagnosis to be thoroughly considered or ruled out. In our case, the misinterpretation of hemolysis as a transfusion reaction resulted in other differential diagnosis being disregarded. The lack of septic focus and the marginal increase in inflammatory parameters further supported this misinterpretation with the consequence of a missed antibiotic therapy. C. perfringens septicemia should always be considered as a potential cause for hemolysis."}
+{"text": "Myocarditis is a rare complication of therapy with mesalazine, a drug widely prescribed in the treatment of inflammatory bowel disease.We report a case of myocarditis occurring in a 49-year-old British man 10\u00a0days following initiation of mesalazine therapy for treatment of ulcerative colitis. He presented with troponin-positive chest pain, and the diagnosis of myocarditis was confirmed on the basis of cardiac magnetic resonance imaging, which showed subepicardial delayed gadolinium enhancement in the basal to middle inferior and inferolateral segments of the heart. The patient\u2019s symptoms and condition improved upon stopping mesalazine, and he made a full recovery.Mesalazine-induced myocarditis may be more common than first appreciated and is potentially fatal. Therefore, it is imperative that clinicians be aware of this potentially life-threatening adverse effect of mesalazine therapy and warn patients to seek urgent medical attention if cardiac symptoms arise. Mesalazine 5-ASA) is commonly prescribed as first-line medical therapy in the treatment of ulcerative colitis (UC) . It is o-ASA is cMyocarditis is a rare but recognized complication of 5-ASA therapy and can potentially evolve to cause cardiogenic shock and death . The etiA 49-year-old British man presented to our hospital with an acute flare of UC, describing a 2-week history of bloody diarrhea. He was initially prescribed both oral and topical 5-ASA therapy and responded well to therapy, reporting an improvement in his abdominal symptoms. However, 10\u00a0days after commencing 5-ASA therapy, he was readmitted with central chest pain, pleuritic in nature and associated with severe dyspnea. The patient\u2019s cardiovascular and respiratory examinations were unremarkable, and he was normotensive and apyrexial. His electrocardiogram demonstrated sinus tachycardia, and his cardiac enzymes were elevated, with a troponin T level of 146 ng/ML. He was treated for an acute coronary syndrome with dual-antiplatelet therapy, and an urgent inpatient angiogram was scheduled.The coronary angiogram revealed smooth, unobstructed coronary arteries, and no cause was identified to account for the patient\u2019s chest pain and troponin rise. Subsequently, cardiac magnetic resonance imaging (CMR) was performed, which showed subepicardial delayed gadolinium enhancement in the basal to middle inferior and inferolateral segments of the heart Fig.\u00a0, with maThe patient was treated conservatively with analgesia, and 5-ASA was promptly stopped. A working diagnosis of 5-ASA-induced myocarditis was supported by the gradual improvement in the patient\u2019s condition following cessation of the drug, and he was discharged to home 3\u00a0days later. Follow-up CMR was performed after 2\u00a0months, and this showed no myocardial edema as well as reduced gadolinium enhancement of the epicardium and myocardium. This scan was compatible with a resolving myocarditis episode, and the patient subsequently made a full recovery.Cardiac disease can be associated with IBD or can be a consequence of drug side effects, with over 100 cases of pericarditis and perimyocarditis reported in the literature . In factMyocarditis is a rare but potentially fatal adverse effect of 5-ASA therapy that usually occurs within 2\u20134 weeks of initiation of treatment . AlthougThe case of our patient illustrates that clinicians should be aware of this very rare but potentially life-threatening adverse effect of 5-ASA because this drug is widely prescribed for patients with IBD. It is vital to consider myocarditis in the differential diagnosis for chest pain in a patient taking 5-ASA because treatment is simply to discontinue the medication, which should improve symptoms rapidly within 24\u00a0h without leading to any permanent sequelae."}
+{"text": "Roofing is one of the most dangerous activities in the construction industry according to the US Bureau of Labor Statistics. Although injuries are manifold in this industry element, the vast majority of them occur as a result of falls from elevation , 2. Thes Roofing is one of the most dangerous activities in the construction industry. According to the Bureau of Labor Statistics, workers in the roofing industry are over three times more likely to experience fatal occupational injuries when compared to construction workers in general , 2. FallWithin the profession of roofing construction, researchers have found that residential roofers, roofers who work on residential structures, are more likely to experience fall injuries than commercial roofers, those roofers who work on commercial buildings and properties . ResidenIn order to reduce construction worker falls, Occupational Health and Safety Administration (OSHA) launched the nationwide Campaign to Prevent Falls in Construction (CPFC) on April 26, 2012. CPFC is developed from an initiative from OSHA Region 1 Area Office in Andover, MA, USA . OSHA anCampaign to Prevent Falls in Construction has three key messages: (1) working at heights should be planned so it is safe, (2) contractors must provide the proper equipment for working at heights and workers must use that equipment, and (3) workers need training in equipment use and how to work safely in the environment . In ordeThe hiring norms for the roofing industry are to obtain employees through temporary agencies, employee references, and parking lots, or other known locations where day-laborers wait for the opportunity to hire onto a job . Many ofThe campaign focuses on altering individual-based behaviors and as such, the CPFC intervention primarily applies the constructs of the Health Belief Model (HBM) and McGuire\u2019s Psychological Motives . The HBMPerceived susceptibility is defined as an individual\u2019s subjective perception of the risk of acquiring an illness or disease . CPFC utPerceived severity, an individual\u2019s feelings on the seriousness of contracting an illness or disease , is anotFinally, CPFC incorporates cues to action or the internal or external stimulus required to trigger the decision-making process that can lead to the acceptance of the recommended health intervention , 13. TheCampaign to Prevent Falls in Construction, however, neglects economic realities among roofers and focuses too strongly on personal responsibility. In other words, the campaign\u2019s emphasis on personal empowerment can be destructive in situations where the ultimate cause of the roofer\u2019s injury is circumstances beyond the workers\u2019 control. A review of campaign materials reveals that they focus on the individual\u2019s decision to use personal protective equipment in order to prevent the risk of falling, but the reality for many of these workers is that they do not have access to the equipment. Further, in many circumstances, the individuals have no control over those interventions other than to choose to work the job or not. The campaign fails to incorporate the influence of social norms and peer influences, as suggested by the social norms theory, on a roofer\u2019s overall decision to work a job . It is eIn preventive health behaviors, early studies showed that perceived susceptibility, benefits, and barriers were consistently associated with the desired health behavior  while peCampaign to Prevent Falls in Construction does not properly focus on the group most at risk: non-commercial, non-Caucasian individuals who are more often day-workers than full time employees . CPFC teSince posters and handout materials clearly indicate that they are from OSHA, a government agent, and, since the targeted audience most at risk is largely comprised of day-workers who may in fact be illegal aliens or hail from foreign cultures who distrust government agencies, the audience may be fearful of the recommendations . ResearcBecause OSHA is primarily a law enforcement entity, it has limited outreach capabilities . CPFC foThe CPFC attempts to make use of the social norms theory to redefine the operational norms of the construction industry by attempting to influence behavior by applying contagion theory and using positive role model examples to redefine what the social norms should be . They waIt is further recommended that the program provide materials that focus more toward the vulnerable population: Hispanic residential roofers. Materials, although available in Spanish, do not address the specific needs of the audience most at risk and the materials don\u2019t address the culture of construction that research indicates are the most vulnerable . CurrentIn the fiscal year of 2013, there have been no fatalities related to falls from roofs. Last year, there were eleven fall fatalities in the Andover district . CompliaKevin O\u2019Donnell, MS, MS Env. Eng., MS Construction Project Management, MPH former research assistant on the University of Massachusetts-Lowell Department of Work Environment\u2019s Construction Occupational Health Project with over 20 years of experience as a journeyman electrician, safety compliance officer, and site project manager in residential, commercial, and heavy industrial construction; familiar with the cultural mores, social norms, and practices in the construction industry; has written several unpublished works concerning economic impacts on construction safety and has conducted numerous focus and participatory research groups as well as academic lectures on ergonomics, safety, and operations in the construction industry.KO researched and wrote this piece.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Activation of NF-\u03baB mediated pro-inflammatory and caspase dependent signaling cascades were investigated by semi-quantitative RT-PCR and immunoblotting. Mangiferin was found to ameliorate cisplatin induced nephrotoxicity in vitro and in vivo by attenuating the induction of oxidative stress and upregulating Nrf-2 mediated pro-survival signaling cascades via the activation of PI3K. Additionally, mangiferin showed synergistic anticancer activity with cisplatin in cancer cell lines (MCF-7 and SKRC-45) and EAC cell induced solid tumor bearing experimental mice. The ameliorative effect of mangiferin is primarily attributed to its anti-oxidant and anti-inflammatory properties. It acts differentially in normal tissue cells and tumor cells by modulating different cell survival regulatory signaling molecules. For the first time, the study reveals a mechanistic basis of mangiferin action against cisplatin induced nephrotoxicity. Since Mangiferin shows synergistic anticancer activity with cisplatin, it can be considered as a promising drug candidate, to be used in combination with cisplatin.Occurrence of oxidative stress is the principal cause of acute kidney injury induced by cisplatin. Mangiferin, a naturally occurring antioxidant molecule, is found to ameliorate several oxidative stress mediated pathophysiological conditions including cancer. Cisplatin induced cytotoxicity was measured in NKE cells by MTT assay and microscopic analysis. Induction of oxidative stress and regulation of proapoptotic molecules were subsequently investigated by using different spectrophotometric analyses, FACS and immunocytochemistry. Induction of nephrotoxicity was determined by analyzing different serum biomarkers and histological parameters  Cisplatin was first identified as an inhibitor of cell cycle in 1965 and in due course of time its therapeutic efficacy has been studied widely  and in swiss albino mice. Our results showed that mangiferin can significantly inhibit the induction of oxidative stress by cisplatin in NKE cells and cellular death. Furthermore, histopathological examinations showed that in swiss albino mice, mangiferin attenuates the functional and structural damages in kidney, induced by cisplatin. Mangiferin is found to suppress both the elevation of intracellular ROS and activation of the several pro-inflammatory cytokines as well as NF-\u03baB. This molecule also diminished the renal cell apoptosis through the modulation of different apoptotic proteins, p53 and Nrf-2 related signaling cascades. Since mangiferin also possesses significant anticancer activity, we have also evaluated the anti-cancer effect of cisplatin in presence of mangiferin, both 2-DCFDA, JC-1 and FITC conjugated Annexin V apoptosis detection kit was purchased from Sigma-Aldrich Chemical Company . Dulbecco\u2019s Modified Eagle\u2019s Medium (DMEM), MEM and other chemicals like antibiotics, trypsin etc. was purchased from HIMEDIA . Fetal bovine serum (FBS) was bought from HyClone .Mangiferin, Cisplatin, HThe primers used for RT-PCR were purchased from IDT. The antibodies used were purchased from Abcam , Cell Signaling Technology , BioBharati Lifescience (India). 3--2,5-diphenyltetrazolium bromide (MTT) along with all other necessary chemicals and reagents were of analytical grade and purchased from the SISCO Research Laboratory, Mumbai, India.2. Confluent monolayers (80%) of NKE cells were subjected to exposure of cisplatin, mangiferin and other molecules as per the experimental design. LC50 dose of cisplatin on NKE cells was determined in this study and was used for all the experiments.The normal kidney epithelial (NKE) cell line was obtained from Cleveland Clinic Foundation, United States. This renal cell was derived from the uninvolved kidney tissue of a patient with renal cell carcinoma. The cells were immortalized by transduction of the human telomerase subunit. NKE cells were maintained in RPMI medium supplemented with 10% Fetal bovine serum (FBS) and antibiotics at 37\u00b0C in culture flasks with 5% CO4 cells per well in 100 \u03bcl serum supplemented culture media. After overnight incubation, the cells were exposed to cisplatin at a dose of 2, 5, 10, 15, 20, 25, 30, 40, and 50 \u03bcM in a serum free medium. The cells were incubated for 24 h and the media was replaced by 1X PBS containing MTT (0.5 mg/ml). Following an incubation period of 4 h, the MTT crystals (formazon) were dissolved in DMSO and the absorbance was taken using a spectrophotometer at 570 nm.Dose and time dependent toxicity of cisplatin on the NKE cells were quantified using MTT cell viability assay. The experiments were performed as described elsewhere . BrieflyTo determine time dependent cytotoxicity, the NKE cells were exposed to LC50 dose of cisplatin for varied durations  in cisplatin containing growth medium. After determining the appropriate dose and time for cisplatin exposure, mangiferin was tested to quantify its protective action. To perform this experiment, the cells were pretreated with mangiferin for 2 h at varied doses ranging from 5 to 30 \u03bcM followed by the exposure of cisplatin. Absorbance was subsequently measured at 570 nm.To further confirm the cytotoxicity and protective action of cisplatin and mangiferin respectively the cells were photographed after incubation of mangiferin and cisplatin at desired dose and time using bright field microscopy at 10X magnification.in vitro, was primarily quantified by the FACS analysis following the protocol as described elsewhere  prior to cisplatin exposure. The consequences of oxidative stress were further analyzed by estimating the level of lipid peroxidation and protein carbonylation using thiobarbituric acid (TBA) and 2,4-Dinitrophenylhydrazine (DNPH) respectively. The activity of major antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), glutathione S-transferase (GST), glutathione reductase (GR), glutathione peroxidase (GPx), were measured following the protocol described elsewhere (2O2. The reaction was continued for 10 min at 25\u00b0C. The absorbance of the solution was recorded at 240 nm. GST activity was determined by mixing 25 \u03bcg of protein with potassium dihydrogen phosphate (KH2PO4), ethylenediaminetetraacetic acid (EDTA), 1-chloro-2,4-dinitrobenzene (CDNB) and GSH. The temperature was maintained at 37\u00b0C and the absorbance was recorded at 340 nm for 5 min. GR activity was determined my mixing 50 \u03bcl of protein with KH2PO4, EDTA, 5,5\u2032-dithiobis(2-nitrobenzoic acid) (DTNB) and NADPH, GSSG and water. The change in absorbance of the reaction mixture was recorded at 412 nm at 37\u00b0C for 3 min. GPx activity was determined by mixing 50 \u03bcl of sample with KH2PO4, EDTA, NaN3, GR and GSH. The mixture was incubated for 10 min at 37\u00b0C and NADPH was added. The reaction was started with the addition of H2O2 and finally the change in the absorbance was recorded at 340 nm for 5 min. GSH content was determined by mixing the sample with DTNB and the absorbance was recorded at 412 nm. The GSSG content in the sample was determined by mixing the sample with N-ethylmaleimide (NEM) to prevent the formation of GSH from GSSG. The sample was then mixed with disodium hydrogen phosphate (Na2HPO4) and DTNB. Finally the absorbance was measured at 412 nm.To investigate the effect of cisplatin induced cytotoxicity in the intracellular ROS level, lsewhere . Brieflylsewhere . Reducedlsewhere . BrieflyTo investigate the effect of cisplatin induced cytotoxicity on the MMP, FACS analysis was performed by rhodamine 123 staining. Briefly, after complete drug exposure, the cells were stained with 5 mM rhodamine 123 dye for 30 min. Next, the cells were washed in 1X PBS and analyzed by BD FACS Calibur Flow Cytometry System at an excitation of 485 nm and emission of 530 and 590 nm . The chaNKE cells were cultured on glass coverslips and were subjected to cisplatin and mangiferin exposure as described above. The immunochemistry analysis was performed according to the protocol as described elsewhere . The celad libitum and standard diet. Pilot studies were performed to analyze the nephrotoxic potential of cisplatin and ameliorative efficacy of mangiferin in swiss albino mice. For this, different doses of cisplatin  and mangiferin  were used and after analyzing the experimental results, the nephrotoxic model was developed.Four weeks old male swiss albino mice were used for this study. The animals were obtained from Central Animal house and research facility of Bose Institute, Kolkata, India. All the animals were acclimatized for 2 weeks in an alternating 12 h light/dark cycles and provided with water Briefly, the experimental design for this study was as follows:Animals were divided into four groups .Group 1 (Control): Animals received vehicles (Olive oil used for mangiferin treatment) only.Group 2 (Mag treated): Animals received mangiferin orally at a dose of 20 mg/kg bw on alternative days for 21 days.Group 3 (Cis treated): Animals received cisplatin intraperitoneally at a dose of 10 mg/kg bw weekly once for 21 days.Group 4 (Cis + Mag treated): Animals received cisplatin interperitoneally at a dose of 10 mg/kg bw weekly once and mangiferin 20 mg/kg bw on alternative days for 21 days.At the end of the experimental procedure, the mice were fasted for 12 h and blood was rapidly collected by cardiac puncture. The kidneys were then carefully dissected out and directly snap frozen in liquid nitrogen and stored at -80\u00b0C.All the animal experiments were performed according to the guidelines of the Institutional Animal Ethical Committee (IAEC), Bose Institute, Kolkata [IAEC/BI/3(I) cert. /2010] and full details of the work plan with experimental animals were approved by IAEC as well as CPCSEA , Ministry of Environment and Forests, New Delhi, India (1796/PO/Ere/S/14/CPCSEA).For histopathological examinations, kidney tissues were isolated from different experimental animals and were fixed in formalin buffer (10%) and embedded in paraffin. Approximately 6 \u03bcm sections were made and mounted on glass slides. The slides were then stained by using hematoxylin and eosin. The slides were examined in a magnification of 400X under a light microscope.Estimation of BUN facilitates the assessment of acute kidney injury, indicating the renal health. Like BUN, serum creatinine is also another major indicator of the renal health. Creatinine is produced by metabolism in the muscle and is removed from the blood mainly by glomerular filtration. BUN and creatinine were quantified in blood serum, collected from each animal after the entire experimental protocol. The experiments were performed following the protocol as described in the kits  .To investigate the involvement of oxidative stress in the renal tissue following the cisplatin and mangiferin administration, intracellular ROS, lipid peroxidation and protein carbonylation were quantified according to the protocol as described earlier in the Section \u201cDetermination of the Involvement of Oxidative Stress.\u201dTo further confirm the occurrence of oxidative stress in the renal tissue due to cisplatin exposure and its amelioration by mangiferin administration, different intracellular antioxidant enzymes  were measured spectrophotometrically in the renal tissue homogenates of all the experimental animals. The experiments were performed according to the protocol as described earlier in the Section \u201cDetermination of the Involvement of Oxidative Stress\u201d .o-dianisidine. The reaction mixture was then incubated at 37\u00b0C for 10 min. Finally, the spectrophotometric absorbance was noted at 460 nm.The MPO activity was measured to evaluate the infiltration of neutrophils in the renal tissue due to cisplatin administration. The MPO activity in the tissue homogenate was measured according to the protocol as described elsewhere . Brieflyg for 10 min and the supernatant was further centrifuged at 10,000 \u00d7g for 10 min to obtain the mitochondrial pellet. The pellet was then washed in the isolation buffer with and without EGTA for twice followed by centrifugation as above. Finally, the mitochondrial protein fraction was stored in a buffer containing 10 mM Tris and 250 mM sucrose. The protein content was then quantified using the BCA reagent following the manufacturer\u2019s protocol  at 4\u00b0C. The homogenate was then centrifuged at 600 \u00d7protocol .The activity of NDH was measured spectrophotometrically according to the protocol as described elsewhere . BrieflyThe activity of SDH was measured spectrophotometrically according to the protocol as described elsewhere . BrieflyMitochondrial redox activity was spectrophotometrically measured using the MTT dye following the protocol as described earlier. Briefly, 100 \u03bcl of the mitochondrial samples were incubated with the MTT solution for 4 h at 37\u00b0C. The formazan crystals were then dissolved with DMSO and the O.D. reading was taken at 590 nm. It was expressed as percentage of the control group.Table 1).Total RNA was isolated from the mice renal samples using the TRIzol reagent, according to the standard protocol (Invitrogen). Following this, the RNA concentration was quantified spectrophotometrically. Two \u03bcg of RNA from each sample was converted to cDNA using cDNA synthesis kit, following which PCR was performed. The PCR products were then subjected to electrophoresis on 1.5% agarose gel  and MCF-7 (human breast cancer cells) cells were performed. The cells were exposed with both mangiferin and cisplatin simultaneously in a dose dependent manner. Cytotoxicity was then quantified using MTT cell viability assay and bright field microscopy [performed according to the protocol as described earlier in the Section \u201cDetermination of Dose and Time Dependent Effect of Cisplatin and Mangiferin in Renal Cells\u201d].To investigate the therapeutic efficacy of cisplatin in presence of mangiferin, different Figure 14A). For all the experimental animals, cisplatin was administered intraperitoneally and mangiferin orally. After the complete experimental period, the tumors were dissected out and the volumes were quantified using a Vernier caliper using the ellipsoid volume equation. Simultaneously tumor weights were also measured.Further, to determine the anti-tumor efficacy of cisplatin under mangiferin administered experimental animals, Ehrlich ascites carcinoma (EAC) solid tumor model in swiss albino mice were developed following the protocols as described elsewhere . EAC celp-value equal to or less than 0.05 were considered as statistically significant.Statistical analysis was performed using the Origin, version 8.0 software. The same software was used to determine the mean value of a given parameter among the various experimental groups by performing the one-way analysis of variance (ANOVA) with the Tukey test. All the experimental data were represented as the mean \u00b1 standard deviation (mean \u00b1 SD) or as percent activity compared to the control group. A Figure 1A). In a time dependent study, it was observed that after 24 h of cisplatin exposure, the cell viability was 50.05% (SD \u00b1 4%) over control cells . In mangiferin pretreated cells (2 h), 20 \u03bcM could effectively reverse the cytotoxic effect of cisplatin .MTT cell viability assay was performed to determine the cytotoxic effect of cisplatin on NKE cells. It was observed that at 25 \u03bcM concentration, the cell viability was 50.7% (SD \u00b1 4%) over control cells .The cytotoxic effect of cisplatin and protective action of mangiferin, as indicated in the MTT cell viability assay, was reconfirmed by using phase contrast microscopy. Exposure to 25 \u03bcM cisplatin for 24 h could effectively change the morphology of the cells. The magnitude of cellular damage is observed in a dose dependent manner. However, these alterations in the morphology of the cells were significantly attenuated in the 20 \u03bcM mangiferin pretreated cells .To quantitatively measure the induction of apoptosis in the NKE cells after cisplatin exposure, the cells were stained with annexin V after the treatment protocol. It was observed that in 25 \u03bcM cisplatin exposed group, 52% cells were annexin V positive. In this experiment tBHP was used as a positive control. On the contrary, in mangiferin pretreated cells the cytotoxic effect of cisplatin was significantly attenuated and only 19.5% of cells were found to be annexin V positive .The induction of apoptosis was further confirmed by performing fluorescent microscopy with DAPI. The presence of fragmented nuclear material was evident from the micrographs of cisplatin exposed cells (10 and 25 \u03bcM). This result clearly indicates the occurrence of apoptosis in the cisplatin exposed cells. However, mangiferin pretreatment was found to be effective in preventing the induction of apoptosis in the cisplatin exposed cells . Different biomarkers of oxidative stress, i.e., MDA and protein carbonyl contents were also measured in the renal cells, and it was found that cisplatin exposure significantly induced lipid peroxidation and protein carbonylation in the renal cells compared to the control cells . Moreover, cisplatin also dose dependently downregulated the activities of different antioxidant enzymes  and level of non-enzymatic cellular metabolites (GSH) in the renal cells . Further, the level of GSSG was increased dose dependently which led to a decreased GSH/GSSG ratio. For each parameter, mangiferin pretreatment was found to be effective in attenuating the induction of oxidative stress in the renal cells. The antioxidant effect of mangiferin was further validated by using 5 mM NAC. It was found that, like mangiferin, pretreatment of NAC can also attenuate the elevation of ROS and manifestation of oxidative stress in the renal cells.To investigate the role of oxidative stress in cisplatin induced renal cell injury, different oxidative stress related parameters were measured. It was found that cisplatin can dose dependently elevate the intracellular ROS level in the NKE cells (increase in the intensity of the green fluorescence), which is found to be attenuated by mangiferin pretreatment . In microscopic analysis with JC-1 dye, an increasing ratio of green fluorescence and red fluorescence confirmed the decrease in MMP . In both the experiments, it was found that 2 h pre-treatment of 20 \u03bcM mangiferin can significantly prevent the loss of MMP due to 25 \u03bcM cisplatin exposure for 24 h.To investigate the effect of cisplatin on mitochondrial dysfunction, MMP was measured in the renal cells by using FACS and fluorescent microscopy. FACS analysis with rhodamine 123 dye revealed a significant dose dependent decrease in MMP (decrease in green fluorescence) in cisplatin exposed cells . In another experiment, when the renal cells were pre-exposed to Z-VAD-FMK (a pan caspase inhibitor), a sharp decline was observed in the cytotoxic effect of cisplatin .To investigate the effect of cisplatin on the intracellular expression of cleaved caspase 3 in NKE cells, fluorescent microscopy was performed. It was found that cisplatin could significantly increase the expression of cleaved caspase 3 in NKE cells in a dose dependent manner. This led to apoptosis in the renal cells. Mangiferin pretreatment prior to cisplatin exposure was found to be effective in attenuating the expression of cleaved caspase 3 . Hence, 10 mg/kg bw was considered to be an optimum dose to induce nephrotoxicity.In experimental animals, cisplatin administration for 3 weeks with varied doses showed dose dependent toxicity as evident from the dose dependent increase of BUN and creatinine in the serum of the experimental animals. It was observed that the serum BUN and creatinine levels were maximum in the animals administered with 10 mg/kg bw cisplatin compared to the vehicle treated animals and other animals administered with cisplatin at lower doses (2 and 5 mg/kg bw) . Hence 20 mg/kg bw of mangiferin was used in the subsequent experiments.In a different set of experimental animals, it was found that mangiferin has a significant protective effect against cisplatin induced renal toxicity in a dose dependent manner. Estimation of serum BUN and creatinine level indicated that mangiferin exerts maximum protection at a dose of 20 mg and 40 mg/kg bw compared to the other doses (5 and 10 mg/kg bw) . In Figure 8B histopathological micrographs showed significant tubular damage in renal tissue of animals administered with cisplatin, compared to the control animals. In the micrographs, black arrows indicate the atrophy of a renal corpuscle and glomerulus, the red arrows indicate the degenerated proximal tubular cells and the green ones indicate the damaged distal tubular cells. At the end of the entire experiments, the body weight and kidney weight of animals were noted. The change of body weight in the cisplatin administered animals was significantly less compared to the control animals. The kidney index [(kidney weight/body weight)\u2217100] also showed a significantly decreased value in cisplatin administered animals compared to other experimental groups .In histopathological examination it was clearly observed that mangiferin administration at 20 mg/kg bw could significantly reduce the histopathological changes in the renal tissue induced by 10 mg/kg bw of cisplatin after a period of 3 weeks .As indicated in the pilot experiments, 20 mg/kg bw of mangiferin can significantly ameliorate the level of BUN and creatinine in the blood serum, which was increased due to cisplatin administration at a dose of 10 mg/kg bw weekly once for 3 weeks. It was observed that the BUN and creatinine levels in only cisplatin administered animals are 139.66 mg/dl (SD \u00b1 8.02) and 1.93 \u00b1 0.15 mg/dl respectively. In mangiferin administered cisplatin treated animals the levels of BUN and creatinine were significantly lowered to 47 mg/dl (SD \u00b1 6.91) and 1.06 mg/dl (SD \u00b1 0.09) respectively . It was also found that cisplatin administration could significantly induce lipid peroxidation and protein carbonylation . It has also downregulated the activity of different antioxidant enzymes   and cellular metabolites (reduced GSH)  compared to the control animals. The altered factors in the cisplatin administered animals were found to be under homeostasis in cisplatin and mangiferin co-exposed animals.FACS analysis revealed that cisplatin administration for 3 weeks could significantly increase the level of ROS in the renal tissue. Simultaneous administration of 20 mg/kg bw mangiferin was found to attenuate the increase of ROS in the experimental animals .Activity of two important mitochondrial enzymes (NDH and SDH) and mitochondrial redox activity were found to be downregulated in cisplatin administered animals compared to the control animals. 20 mg/kg bw mangiferin administration was found to be effective in restoring the activity of mitochondrial redox activity and the two mitochondrial enzymes . Myeloperoxidase activity was significantly increased in the cisplatin treated animals compared to the control animals. Several other proinflammatory cytokines  were also found to be elevated in the cisplatin administered animals. Mangiferin administration was found to restore the level of MPO and proinflammatory cytokines in cisplatin and mangiferin co-exposed animals .Cisplatin exposure significantly increased the level of NF-\u03baB in the nuclear fraction of the renal tissue of the cisplatin administered animals compared to control animals. Simultaneous administration of mangiferin was found to be effective in restoring the level of NF-\u03baB in the nuclear fraction . In mangiferin and cisplatin co-exposed animals, mangiferin was found to decrease the expression levels of different proteins mentioned above. In addition, mangiferin could significantly induce the expression level of Nrf-2 in the nuclear fraction and SOD-2 and HO-1 in cytosolic fraction of the renal tissue. In the upstream of Nrf-2, it was found that mangiferin pretreatment can significantly elevate the expression of p-PI3K . This result was further confirmed by using LY294002 (a potent inhibitor of PI3K) . Again, by MTT cell viability assay, it was further confirmed that PI3K inhibitor can significantly reverse the protective action of mangiferin .Administration of 10 mg/kg bw cisplatin weekly once for 3 weeks significantly altered the expression of Bax and Bcl2. This subsequently elevated the release of cytochrome C in cytosol. Increased expression of cleaved caspase 3, calpain and cleaved caspase 12 in the kidney tissue of the cisplatin administered animals was observed (of PI3K) . Pretreain vitro and in vivo experiments were carried out. It was observed that when mangiferin was pre-exposed to cancer cells (SKRC-45 and MCF-7) prior to cisplatin exposure, a synergistic cytotoxic effect was observed in microscopic studies  compared to the cells exposed to mangiferin and cisplatin exclusively. These observations were validated by using MTT cell viability assay. A significant decrease in the cell viability was observed in mangiferin and cisplatin co-exposed cells (34.5% in SKRC-45 cells and 28.04% in MCF-7 cells) compared to the cells exposed to mangiferin (63.56% in SKRC-45 cells and 67.42% in MCF-7 cells) and cisplatin (48.56% in SKRC-45 cells and 56.88% in MCF-7 cells) exclusively .To investigate the anticancer efficacy of cisplatin in presence of mangiferin, different in vivo experiment with xenograft tumor (EAC cells) bearing experimental animals , mangiferin and cisplatin showed anticancer effect by lowering the mean tumor volume and mean tumor mass compared to animals treated with mangiferin and cisplatin exclusively .In an In the present study it has been comprehensively demonstrated that (a) Cisplatin can cause severe nephrotoxicity in experimental animals at a dose of 10 mg/kg bw when administered weekly once for 3 weeks. (b) Cisplatin can elevate the level of intracellular ROS in the renal tissue and cause mitochondrial dysfunction. (c) Cisplatin can significantly upregulate different proinflammatory and proapoptotic signaling cascades in the renal tissue. (d) Simultaneous administration of 20 mg/kg bw of mangiferin in alternate days for 3 weeks can effectively ameliorate cisplatin induced organ dysfunction. (e) Mangiferin can upregulate different pro-survival molecules in cisplatin induced pathophysiological state. (f) Along with reno protective effects, mangiferin also exhibits synergistic anticancer activity with cisplatin.In the last decade, researchers around the globe have primarily focused on identifying novel bioactive molecules from the plant source as there are severe side effects of the chemically synthesized drugs . Amongstin vitro and in vivo and simultaneous administration of mangiferin was found to be effective in attenuating the deleterious effects of ROS by replenishing the level of GSH and other antioxidant enzymes.When a free radical is generated in the cellular metabolic process, it is very unstable and can readily react with intracellular biomolecules and can further give rise to other unstable reactive free radicals or a non-reactive stable molecule. Therefore, it is a chain reaction that starts inside a cell to generate free radicals. Under normal physiological conditions, a well-regulated cellular defense mechanism exists to metabolize the free radicals properly and to prevent the accumulation of free radicals in intracellular compartments. However, if there is an excessive generation of free radicals inside the cell, the intracellular enzymatic and non-enzymatic antioxidant machinery fail to metabolize them  properly. Hence free radicals get accumulated and lead to oxidative stress. Free radical scavengers are found to be very beneficial in such stressed conditions. In various oxidative stress mediated renal pathophysiology, it has been found that natural antioxidants are effective in restoring the cellular antioxidant defense mechanism . Previouin vitro and in vivo cytotoxicity model, it was observed that cisplatin could induce mitochondrial dysfunction and activate different pro-inflammatory cytokines. Our in vivo study indicates that cisplatin administration in the experimental animals caused nuclear translocation of NF-\u03baB. The RT-PCR results also indicated the upregulation of several proinflammatory cytokines viz., TNF-\u03b1, IL-1\u03b2, IL-6 and IL-10. Simultaneous administration of mangiferin was found to be effective in preventing the nuclear translocation of NF-\u03baB and attenuate the elevated expression of several pro-inflammatory cytokines elicited by cisplatin. It was also observed that cisplatin can effectively activate caspase dependent apoptotic pathway mediated by mitochondrial dysfunction and induction of ER stress. It was observed that mangiferin significantly restores the altered Bax/Bcl-2 ratio by attenuating the mitochondrial dysfunction and causing release of cytochrome C in the cytosol from the mitochondria. The immunoblot analyses in this study also indicated that cisplatin administration significantly upregulated the two chief regulators of ER stress, calpain and caspase 12 compared to the control animals. Reports suggest that calpain facilitate the cleavage of pro caspase 12 and gives rise to activated caspase 12 . This differential effect of mangiferin was also observed in two different secondary cell lines, SKRC-45 and MCF-7. SKRC-45 cells are the metastatic renal tubular cancer cells and MCF-7 is a well-known model to study breast cancer. The differential effect of mangiferin in renal and tumor tissue may be because of the varied nature of cells and structural organization of the two tissues .Overall the present study suggests that the polyphenolic bioactive natural compound mangiferin, which is abundantly found in the bark of the mango tree, is highly effective against cisplatin induced nephrotoxicity without affecting its (cisplatin) beneficial effect on the tumor tissue. Rather, simultaneous administration of mangiferin showed a synergistic anti-tumor activity with cisplatin. The prophylactic nature of mangiferin can be attributed to its antioxidant and anti-inflammatory properties. It can therefore be concluded that mangiferin can be considered as a promising drug candidate to be used in combination with cisplatin to ameliorate the nephrotoxic effects of cisplatin and obtain a synergistic anticancer activity.PS, SS, SD, and PCS were actively involved in designing the experiments. PS, SS, and SD performed the experiments. PS, SS, and PCS analyzed the data and prepared the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Professional support in pediatric and rehabilitation care environments has been recommended as a means to build youth competence in life skills during their transition to adulthood. Life skills are the essential psychosocial competencies and interpersonal skills needed to manage one\u2019s life. Residential immersive life skills (RILS) programs offer youth with physical disabilities enriched learning environments to acquire these skills. This study explored trajectories of personal growth in life skills and positive psychological outcomes among youth participating in a RILS program and related caregiver perspectives.The Independence Program is an intensive summer program housed in a college residence that provides realistic experiences of living away from home for small groups of youth between 17 and 21\u2009years of age who have congenital and/or acquired physical disabilities. Using a longitudinal case study and qualitative descriptive design, four youth and their parents/guardians participated in semi-structured interviews prior to, and then 1 month, and 3 to 4 months after the program. A conventional content analysis yielded chronological narratives for each youth and caregiver dyad of their experiences, perceptions and outcomes over time. These narratives were further summarized using a \u2018line of development\u2019 perspective to describe individual developmental trajectories of personal growth.Delivered by a multidisciplinary healthcare team, All four of the youth returned from the program with positive reports about the new life skills acquired and new behaviours they engaged in. These positive reports generally continued post-program, albeit with differing trajectories unique to each youth and varying levels of congruence with their caregivers\u2019 readiness to support, accommodate and facilitate these changes. Caregivers differed in their capacity to shift in their parenting role to support consolidation of youth life skill competencies following program participation.RILS programs can be transformative. Varied youth trajectories identified significant personal growth through enhanced self-determination, self-efficacy and self-advocacy. Congruence in youth and caregiver perceptions of post-program changes was an important transactional factor. Professional support addressing caregiver needs may be beneficial to facilitate developmentally appropriate shifts in parenting roles. This shift is central to a model of shared management whereby adolescents take on greater responsibility for their own care and life choices. Over the past two decades, there has been a significant shift in recognizing emerging adulthood as a distinct developmental period , 2. DuriWhile much of the available literature has focused on the developmental trajectories of typically developing youth during this period , 4, therProfessional support in pediatric and rehabilitation care environments has been recommended as a means to build youth competence in skills essential to personal growth during this period of emerging adulthood , 13, 14.Evaluative data on life skills programs for youth with disabilities are emerging. Broadly, investigations of life skills programs with varied levels of immersion have demonstrated positive outcomes , 16, 22.This compelling descriptor raises a number of interesting questions as a function of participation in a RILS program \u2013 most notably, what types of personal growth contribute to this experience? When are these changes happening and how are they experienced across individuals? And what roles do parents play in supporting or inhibiting consolidation, maintenance, and generalizability of these changes? To date, little research has sought to understand more richly how experientially-based RILS programs influence acquisition of life skills and positive psychological outcomes central to the period of emerging adulthood among youth with disabilities , 12. TheThis study reports on the qualitative arm of a prospective, mixed-method observational pilot study designed to assess the feasibility and utility of selected qualitative and quantitative methods prior to their application to a larger sample , 25. FeaTaking an exploratory approach, our aim was to begin to investigate trajectories of personal growth among youth participating in a RILS program and their caregivers\u2019 perspectives of changes that may (or may not) have occurred. For the purposes of this paper, personal growth was defined as the process of redefining oneself through maturation and self-directed change, resulting in enhanced self-determination, self-efficacy and self-advocacy competencies , 29. To The Independence Program (TIP) were approached about participation in the research. A target of 50% recruitment was set as three to five participants are recommended for a case study approach  to learn to be really independent \u2026 he\u2019s at the transition\u2019. Although Terra was the one who attended the TIP information session and collected the application form, she encouraged JP to take more responsibility as they completed the application: \u2018I said \u201cYou do it and then you learn how to answer\u201d\u2019. While Terra wanted JP to do tasks around the house, she described herself and her husband as overprotective and not comfortable helping him learn to cook, for example. At the same time, she expressed the desire for JP to \u2018do something by himself without me telling him what to do\u2019 and talked about the possibility of a future where JP would live in a college residence, away from home.JP\u2019s motivation to attend TIP was Other camps I\u2019ve been to, they helped me along the way. At TIP you do somewhat everything yourself\u2019. In contrast to Terra\u2019s statement during her pre-TIP interview that JP didn\u2019t like to go out on his own, JP reported enjoying the freedom and challenge offered at TIP whereby participants were encouraged to plan outings: \u2018Like for me I don\u2019t go out that much and it\u2019s fun to go out sometimes. And getting lost and finding a way back\u2019. He expressed enthusiasm for having tried things that were scary or challenging.In the post-TIP interview, JP spoke about the new level of independence that he experienced at TIP compared to other, non-immersive life skills programs he had previously taken part in. \u2018he hasn\u2019t done much \u2026 like chores around, he hasn\u2019t done anything\u2019; \u2018socialization, he hasn\u2019t really made that many friends yet\u2019; and \u2018he will still look at [me] for guidance\u2019. However, when JP did make bids for autonomy, Terra reported that she had responded supportively. In particular, she noted that JP had been self-advocating at school: \u2018He said \u201cI don\u2019t want to do [program]\u201d \u2026 so he went and spoke to the teacher and then he went to see the counsellor\u2019. In the past, she noted that JP would have asked her to contact his teacher. Terra\u2019s response was to encourage him to take even greater responsibility: \u2018I said \u201cYou go and speak to [teacher] \u2026 I\u2019m not doing anything. You are an adult now, go and speak to them. Find things yourself\u201d \u2026 Before, yes, I would speak up for him more, yeah. He would look at me for things\u2019. Despite these positive signs, 1 month post-TIP, Terra still expressed doubts about JP\u2019s capabilities, saying \u2018I\u2019m still looking at, what can JP exactly do?\u2019In talking about his life 1 month post-TIP, the main change that JP described was that he was now more talkative and sociable than previously. Terra, though, expressed disappointment in the lack of positive change that JP had shown since returning home, for example, \u2018all by myself, on time\u2019. Terra\u2019s impression of the change in JP by this point was considerably more positive. She said \u2018He\u2019s becoming much better now. He\u2019s independent\u2019 and provided examples from school and accessible transit booking. In addition to those specific tasks, she brought up his ability to problem solve when in the past he would have remained passive. \u2018He\u2019s able to look and say \u201cOh, that\u2019s the issue here, that\u2019s a problem I need to solve, I\u2019ll go to the teacher and I\u2019ll tell the teacher\u201d \u2026 [Before TIP] he would just sit there and wait\u2019. She ascribed the change in JP\u2019s self-efficacy to his experience at TIP: \u2018In TIP, I think with a lot of coaching, he felt more secure. He felt \u201cIf I can work at it, if I do what they teach me, I should be able to do it\u201d. He feels a little bit more confident \u2026 initially he didn\u2019t show it but for a few months, now he\u2019s been showing it\u2019.By the time of the follow-up interview 3 months after the program, JP\u2019s ability to self-advocate had increased substantially. He had decided for himself to make changes to the support that he received at school. He proudly stated that he was getting to classes \u2018I learned to be less of a mother hen \u2026 [not] to say \u201cJP did you do this? JP did you do that\u201d \u2026 I said \u201cOkay, when you\u2019re ready, just let me know, I\u2019m not telling you what to do\u201d\u2019.Her response to JP\u2019s increased independence grew increasingly more supportive and less protective across the three time-points. One month after the program, Terra talked about how, if JP wanted to make a hot drink after school, she would give JP the hot water because she and her husband were nervous allowing him to use the electric kettle. By 3 months post-program, he had begun using the kettle by himself. Terra identified her own role in helping JP build on his time at TIP, saying: \u2018JP\u2019s line of development can be described as an accelerating positive curve. In the beginning, changes reflected steady growth in mastery and consolidation of skills across the program to 1 month post. This was followed by a more dramatic increase from 1 to 3 months. During this latter window, his caregiver was increasingly more aware of her role, stepping back and affording him more opportunities for independence.to learn how to live on my own\u2019 before starting college and to have more confidence in himself. He was unsure what his experience at the program would be like and shared that the most challenging part would be \u2018being away from my parents\u2019. His father, Dustin, confirmed that he and Jacob\u2019s mother were the main instigators of Jacob\u2019s application to the program. Dustin\u2019s main desire was that Jacob would be exposed to \u2018real world\u2019 situations to \u2018see what he could do away from Mom and Dad\u2019. He hoped Jacob would benefit from the social exposure provided by the program and develop some self-advocacy skills. Specifically, he wanted Jacob to \u2018have different people look after him and be comfortable [with that]\u2019. Dustin was not optimistic, however: \u2018it all depends on, like, if he\u2019s around a core group of kids he likes, or just comfortable with, he\u2019ll excel. But \u2026 depending who\u2019s around, he might not. I don\u2019t really know\u2019.Jacob stated that his motivation for attending the program was \u2018I didn\u2019t want to come home. I liked [the program] \u2026 being on my own\u2019. He enjoyed \u2018getting to go out and do stuff that [I] wanted to do\u2019. He found that the program pushed him to try different things; even if it was something he didn\u2019t like to do or was unsure about, he often found that it was easier than he had expected. When asked about any changes since the program, Jacob mentioned feeling \u2018more positively about people and talking to them\u2019. Dustin confirmed that Jacob\u2019s communication skills had improved since the program, including with his immediate family.At the post-TIP interview, Jacob was very positive about his experience at TIP and identified greater independence and autonomy. \u2018life-changing experience\u2019 for Jacob, saying \u2018When Jacob came out, he came out whole, he came out bubbly \u2026 he just seemed to be an outgoing person\u2019. He was pleasantly surprised that his son had had good camaraderie with his roommates saying \u2018it was kind of borderline\u2019 whether he would: \u2018It didn\u2019t really surprise me, but it does surprise me\u2019. Dustin shared some of the higher-level skills that Jacob had built at TIP, like self-determination: \u2018[TIP] wasn\u2019t \u201cdo this, do that\u201d. It was just \u201coh, what do you want to do now?\u201d\u2019. He had a very positive impression of the skills that Jacob talked about having used during the program; perhaps as a result, Dustin said, \u2018I learned that he is capable of doing it, living on his own \u2026 I wouldn\u2019t have thought it a year ago\u2019. Following the program, Dustin facilitated Jacob\u2019s desire for increased independence. On a family vacation shortly after TIP, he said to Jacob: \u201c\u2018Okay, I\u2019m driving, you\u2019re guiding\u201d \u2026 If I was going to miss a turn, [I was] going to miss a turn \u2026 because he was guiding \u2026 It kind of put him more in the driver\u2019s seat so to speak\u2019.Dustin described the program as a \u2018if I have an issue I call it in instead of asking [my parents] \u2026 I called and did it all on my own\u2019. Dustin spontaneously mentioned that Jacob had handled the incident on his own, which \u2018would have been totally the opposite last year\u2019. Dustin\u2019s understanding of the meaning of \u2018independence\u2019 also changed as a result of Jacob\u2019s exposure to TIP. \u2018I was thinking [that to be independent] \u2026 you had to do everything yourself \u2026 .the way they explained it was that independence is, if you need help you ask for it.\u2019By the follow-up interview, the increases in Jacob\u2019s communication and social skills translated into increased self-efficacy and self-advocacy. Jacob gave an example of following up on a financial matter for himself: \u2018He knows he can do this so it\u2019s just, now let\u2019s move forward with life, get to college and so on\u2019. Dustin felt that Jacob was happier following the program: \u2018He doesn\u2019t give you the impression that he\u2019s depressed or anything like that\u2019; \u2018[he doesn\u2019t] look down or out or unhappy. You always feel like [he\u2019s] got life in [him]\u2019. Dustin was supportive of his son\u2019s new behaviours and said that he and his wife were now \u2018more comfortable with him being [at college] without us\u2019.Dustin\u2019s horizons for his son had broadened as a result of Jacob\u2019s increased self-efficacy post-TIP. \u2018Jacob demonstrated a positive linear trajectory via his experience at TIP and subsequent return home. Acknowledging Dustin\u2019s characterization of the experience as life changing, Jacob\u2019s line of development may be described as steady, increasing from the outset with his self-reported mastery and continuing in this path. Dustin enthusiastically embraced Jacob\u2019s new skills, providing significant opportunity and encouragement towards self-mastery.they may say \u201cYou\u2019re not ready for that\u201d but I say \u201cSure I am, I can do this and do that, I\u2019ll be fine!\u201d\u2019 She planned to use her attendance at TIP to convince her parents of her ability to live on her own. Beth was motivated \u2018to see what I\u2019m capable of\u2019 and identify her weaknesses as well as her strengths.In the pre-TIP interview, Beth spoke about plans for the future and living on her own in residence at a postsecondary institution. She contrasted her perception with how she thought her parents perceived her, saying \u2018either she will go there and she will learn skills to help her to be independent, or...the other outcome could be...recognize some of her real challenges\u2019. Where Beth believed her parents were too focused on her learning day-to-day tasks, like how to keep her room clean, Susie drew a connection between those day-to-day skills and the larger life skills needed for functioning in the world as an adult \u2018The truth is \u2026 it\u2019s the same life skill that you can keep your things organized and then you keep yourself organized\u2019.Susie also had a positive view of TIP and felt it would provide an opportunity for Beth to develop more accurate self-perceptions: \u2018I feel maybe I expect more from myself...I\u2019ve learned so much more about how I could do things for myself, I don\u2019t really expect people to do as much as I expected them to do before\u2019. Her sense of self-efficacy had increased, which led to increased willingness to try new things \u2018I think just being able to have the confidence to do things and be able to implement a plan\u2019. Part of Beth\u2019s increased self-efficacy arose from shifting her definition of independence towards interdependence as a result of the program: \u2018I\u2019m more aware now that you can get people\u2019s help and still be independent\u2019.During the post-TIP interview, Beth described a largely positive experience at the program, noting that it exceeded her expectations in providing a challenging and stimulating environment. While she experienced several major challenges and moments of anxiety, those moments turned into successes as she accomplished what she set out to do. After returning home, Beth said: \u2018sometimes I feel like my parents don\u2019t know the extent of what I did at TIP...I don\u2019t think they know what I was capable of\u2019. Beth regretted that she had not followed the advice of TIP staff to have a conversation with her parents as soon as she returned home. In contrast to Beth\u2019s view of her parents\u2019 limited awareness, Susie noted increased self-determination and self-advocacy post-TIP, which she described as \u2018a dramatic change in terms of the independence levels\u2019. In particular, Susie was impressed with the way Beth had taken responsibility for all of her college-related decisions, including dealing with disability services, choosing courses and buying her books. She attributed these changes to Beth\u2019s participation in TIP: \u2018I think if she didn\u2019t go to TIP she would have been content in the way we\u2019ve operated over all the years\u2019. Susie also acknowledged that her hopes for TIP had been more day-to-day, rather than focused on the higher order life skills: \u2018My expectation was that [after TIP] she would have been able to manage her room...I wasn\u2019t looking for the bigger things about, well, managing your own life\u2019.Returning home from the program, Beth felt that her parents weren\u2019t keeping up with the pace of her change: \u2018if I can do three weeks...I can just use those skills long term, right? For months and years...Now I know, yeah, I can handle living by myself\u2019. Susie was proud of the independence and self-determination that Beth showed, saying \u2018she has taken serious responsibility as regards, like managing her education and going to school and doing her homework and keeping on task and doing her social things\u2019.By the follow-up interview, both Beth\u2019s social participation and her horizons for the future had broadened. With increased confidence in navigation, she joined committees and attended meetings at her former treatment centre. The increased self-efficacy that she had developed expanded her ideas of where she might attend university to schools outside of her home city. The transferability of the skills she learned at TIP was central to this: \u2018I\u2019m out of the house a lot more than I\u2019m in the house and even now it\u2019s a weird adjustment for them because I went from always here to not\u2019. Despite this, Beth felt limited in her relationship with her family: \u2018I honestly feel like they don\u2019t think of me any different from a high school kid, you know? And that\u2019s rough, that\u2019s just hard\u2019. Susie encouraged Beth\u2019s independence by holding back on tasks that she would previously have done for her: \u2018I used to remind her every night before we\u2019d go to bed--okay please charge your [phone and tablet]....I don\u2019t do any of that now\u2019. This change in behaviour on Susie\u2019s part was encouraged by TIP program staff to foster a more \u2018typical teen\u2019 experience: \u2018the staff has really pushed me in terms of letting go and letting her be\u2019.Beth also described moving into a more typical young adult relationship with her parents: \u2018I see it more now as yes, she can be independent, and yes, she will get an education, yes, she will be able to find a job and she will be able to take care of herself. Like, I can see that more in reality now. [Before TIP] it was kind of like debatable. I, I wasn\u2019t sure\u2019.Overall, the program caused a shift towards optimism in Susie\u2019s view of Beth: \u2018Beth\u2019s line of development can be described as stepwise. Though moving in a positive direction, she experienced fluctuations during her initial TIP experience before stabilizing in an upward direction by program end. This positive trend continued in the first month post-TIP, followed by a steeper increase over the course of the remaining 3 to 4 month follow-up period. Susie\u2019s perspectives appeared to mirror Beth\u2019s trajectory with some significant shifts in the dynamics of their relationship arising.I\u2019m at that age now where I gotta start taking more responsibilities of my own things\u2019. He was proactive about the decision to participate and had attended the information session himself. Lucas felt that success would be \u2018to be the most independent as possible\u2019 but he had a realistic outlook, saying \u2018I know it won\u2019t happen overnight \u2026 but I just want to get that little bit more independent\u2019.In his pre-TIP interview, Lucas launched into his reasons for wanting to attend TIP before even being asked: \u2018a little test for [Lucas], to see how he can function without Mom and Dad\u2019. At home, Celeste was very closely involved with Lucas\u2019s self-care, whereas \u2018[at TIP] Mom won\u2019t be there to check how he\u2019s brushed his teeth or you know how he\u2019s dressed\u2019. Celeste wanted Lucas to become \u2018more aware of the stuff that\u2019s done for him\u2019. She was less vocal about him learning to do the tasks for himself, noting that she and her husband do not take Lucas to the grocery store or teach him to shop for meals because of time constraints. In sharp contrast with Lucas, Celeste\u2019s expectations for TIP were not high: \u2018I mean he\u2019s going to learn something, how can he learn it in less than three weeks?\u2019 She did not see Lucas as likely to thrive in the program setting \u2018I\u2019m worried for him. Lucas, he\u2019s got a lot of strength, but he also has a lot of needs \u2026 if he\u2019s asked to do something on his own, I don\u2019t know\u2019.Celeste hoped that TIP would be \u2018I\u2019m so glad I did it, you know? It taught me a lot of life skills, let alone about myself, right?\u2019 Describing how he felt before the program, Lucas shared: \u2018I was thinking the worst things possible [about how I would cope]\u2019 but afterwards noted that \u2018confidence is the biggest thing \u2026 if you have confidence and if you believe you can do anything, don\u2019t worry, you can\u2019. Reflecting on returning home, Lucas also said: \u2018I want to do more of the things on my own \u2026 I always chose what [leisure activities] I wanted to do but now I think I\u2019m ready \u2026 to take more of a lead in that role\u2019. However, Lucas contrasted the situation at TIP with home \u2018[At TIP] I could do everything at my own pace and didn\u2019t have to worry about deadlines \u2026 I wish I could do that more now, but \u2026 you\u2019re working against time\u2019.At the post-TIP interview, Lucas was enthusiastic about the impact of TIP: \u2018\u2018 \u2026 three weeks, of course is not long enough, right? But at least it got the wheels turning and made him think about his future and think about, you know, maybe I can live independently with attendant help\u2019; Celeste\u2019s response to Lucas seeking to take on more tasks was not entirely supportive. At the post-TIP interview, she said: \u2018He volunteered \u201cMom, do you want me to take the laundry out of the machine?\u201d That was cute \u2026 I thought that was cute\u2019. Rather than working to nurture his emerging skills, her perspective on independence was an all-or-none approach: \u2018 \u2026 what am I going to expect, miracles? He\u2019s going to cook my dinner? He\u2019s not\u2019. Though Lucas felt that he\u2019d learned a lot about his capacities from the program, when asked if she had noticed changes in Lucas, Celeste replied: \u2018I don\u2019t think so. I haven\u2019t noticed any change \u2026 I think I know him very well\u2019, further commenting, \u2018I\u2019m still doing everything I did before he left\u2019.In contrast to Lucas, Celeste was more reserved in her reflections on changes post-program. While she noted that he was more aware, I guess overall it was a good experience but \u2026 I just wanted to figure out better ways to do \u2026 a lot of these things in my daily life\u2019. While Lucas identified that TIP helped him begin \u2018 \u2026 to start the process to take more initiative on my own\u2019, he had not been able to incorporate all of the skills learned into his home life. Describing meal preparation, Lucas said \u2018by the end of [TIP] I was able to cook with an attendant\u2019s help, but \u2026 it\u2019s not realistic for me \u2026 how am I going to really put that into practice at home in my daily life?\u2019 Despite challenges in his home environment, Lucas felt he successfully met his goal of attending post-secondary school, sharing: \u2018I\u2019m happy about that I\u2019m \u2026 handling college \u2026 college in a good and positive manner\u2019.By the follow-up interview, Lucas\u2019 enthusiasm about his gains from TIP had faded somewhat: \u2018\u2026 which is a big help \u2026 and just the fact that he\u2019s going there independently...we\u2019re so proud of him\u2019. Celeste\u2019s reflections on Lucas\u2019 capabilities were sometimes mixed. She talked often about the burden of caring for Lucas and how he needed to learn to do things for himself. At the same time, she insisted that he was not capable of self-care, saying \u2018He cannot bathe himself. Cannot. He cannot get dressed independently\u2019 but later clarified, \u2018he\u2019s always done that, but you know, he doesn\u2019t do things correctly\u2019. These statements suggest that Celeste held a view of independence as one of physically doing all tasks without assistance: \u2018anything where he doesn\u2019t need my help, I consider him independent in that area\u2019 and holding these activities to high standards: \u2018Well, he started watching me do it, and making sure, you know, I \u2026 I went over the, you know, everything he has to do not to make a mistake.\u2019 In other areas where Lucas might have practiced his new skills by helping around the house, Celeste maintained that it was not possible because \u2018We\u2019re just too busy \u2026 when you\u2019re limited with time, things have to get done\u2019.In contrast, Celeste\u2019s enthusiasm for Lucas\u2019 skills was just beginning to grow, sharing that he was now making arrangements for transportation to school, gradually taking over from his parents: \u2018 Following TIP, Lucas was extremely positive, identifying many new skills and describing the program enthusiastically suggesting a fast rise. By the final interview, however, Lucas\u2019 earlier upward trajectory began to plateau and he was notably downbeat. His line of development could be described as somewhat S-shaped; a pattern influenced by Celeste\u2019s ambivalence towards his desire for greater independence and autonomy.These case studies were drawn from data gathered from a sample of youth and their caregivers, following a RILS program. The chronological narratives demonstrated personal growth in the form of broadened horizons, shifting views on independence and autonomy, and enhanced competence and confidence in life skills and activities of daily living among participants and their caregivers. All four of the youth returned from their time at TIP with positive reports of new skills learned and new behaviours they engaged in, aligning with previous studies of RILS programs , 16, 19.These positive reports generally continued post-program, albeit with differing trajectories unique to each youth and varying levels of congruence with their caregivers\u2019 readiness to support, accommodate and facilitate these changes. While JP, Jacob and Beth reported continued increases in their ability and willingness to make decisions for themselves, problem solve and cope with new situations as they arose, Lucas\u2019s positive attitude noticeably shifted over time, influenced by family dynamics and current circumstances. This observation brings to bear greater consideration of how a young person is situated within their home context and the dynamic processes taking place in response to challenging life experiences and/or situations.Application of a transactional framework is particularly apt for understanding processes during periods of transition such as emerging adulthood , 43. TheDifferences in caregiver perception of youth\u2019s competencies of newly acquired skills and willingness to facilitate their use emerged from the case studies. Where caregiver perceptions were congruent with youth self-perceptions, positive trajectories were noted with accelerating lines of development. Three of the four youth had caregivers who affirmed their nascent shifts in confidence and/or identity experienced early on and afforded continued opportunities to build on skills and behaviors acquired at TIP. Dustin, Terra and Susie all talked about making space for their youth to use their newly developed or strengthened skills. In the family trip example, Dustin facilitated Jacob\u2019s new found desire for self-determination, tasking him with the responsibility of navigation. Post-program, Terra actively encouraged JP to take on increased responsibility, even when she was nervous or uncomfortable with things JP wanted to do for himself. Likewise, Susie felt it was appropriate for her to take a step back and let Beth take control of her actions and decisions. As caregivers, Terra and Susie both talked about refraining from reminding youth of tasks that needed to be completed, thus relinquishing control or responsibility to the youth and enabling natural consequences. This reflects the universal need for a shift of caregivers from a \u2018manager\u2019 to a \u2018consultant\u2019 role as youth mature , 45.This qualitative longitudinal case study suggests that this shift is critical following youth experience with an intensive life skills program like TIP, to aid youth in skill consolidation, maintenance and generalizability. For some caregivers, the role change required for the young person to develop real independence and autonomy may feel uncomfortable (to the point of impossible) in the face of other, often pragmatic, constraints in life such as time and money. Caregivers\u2019 own readiness to provide \u201croom for more independence\u201d can also vary p.38) [ [8], andYouth were thus not the only benefactors of the accelerated learning environment and expertise of the multidisciplinary program staff. Initially, Susie had been focused on improving Beth\u2019s day-to-day living skills. Following encouragement from TIP staff, she was able to facilitate the new, higher-order life skills that Beth developed through attending the program, by affording different opportunities that encouraged self-reflection. Dustin also believed that he had himself gained a new perspective from staff at TIP. In Dustin\u2019s case, his understanding of the meaning of independence for his son shifted towards a model of \u2018interdependence\u2019, which allowed him to still provide Jacob with support, while acknowledging Jacob\u2019s actions as fundamentally self-determined. Susie\u2019s and Dustin\u2019s comments suggest that there may be significant value in providing additional \u2018formal\u2019 support to parents and other family members, to enable necessary shifts in caregiver-child relationships/roles and long-standing patterns of behavior following intensive life skills programs , 14, 45.The case study design afforded an in-depth look over time into youth and caregivers\u2019 perceptions (experiences and expectations) prior to, during and post TIP, contributing to an understanding of individual variability in trajectories of personal growth that youth may undergo. Of note, the TIP cohort from which we drew focused on youth with a limited range of physical disabilities that may be relatively less severe than youth in other RILS programs. While the detail provided in the narratives aims to enhance transferability of the findings to youth who share similar environmental contexts and personal characteristics, others may experience very different trajectories. Also, as the sample included only one male caregiver and one female youth, gender differences cannot be examined. Future exploration is warranted to examine differences in readiness for change across gendered caregiving roles, as well as priorities for growth among youth themselves .Taken together, these narratives affirm that youth who attend RILS programs have the opportunity to develop new skills and confidence away from home. These programs can alter a young person\u2019s developmental trajectory towards adult roles through \u2018transformative experiences\u2019 , 19, 46."}
+{"text": "Oryza sativa). The proteome reprogramming of plants treated with MeJA, wounding or MeJA+wounding has been in-depth analyzed by using a combination of high throughput profiling techniques and bioinformatics tools. Gene Ontology analysis identified protein classes as defense/immunity proteins, hydrolases and oxidoreductases differentially enriched by the three treatments, although with different amplitude. Remarkably, proteins involved in photosynthesis or oxidative stress were significantly affected upon wounding in MeJA-primed plants. Although these identified proteins had been previously shown to play a role in defense responses, our study revealed that they are specifically associated with MeJA-priming. Additionally, we also showed that at the phenotypic level MeJA protects plants from oxidative stress and photosynthetic damage induced by wounding. Taken together, our results add novel insight into the molecular actors and physiological mechanisms orchestrated by MeJA in enhancing rice plants defenses after wounding.The role of jasmonates in defense priming has been widely recognized. Priming is a physiological process by which a plant exposed to low doses of biotic or abiotic elicitors activates faster and/or stronger defense responses when subsequently challenged by a stress. In this work, we investigated the impact of MeJA-induced defense responses to mechanical wounding in rice ( Plants are exposed to a variety of external factors that unfavorably affect their growth and development, and are generally classified into biotic  and abiotic  stresses. Adaptation to these environmental stresses is essential for survival, growth and reproduction . Among tRecent evidences show that plants can be primed for more rapid and robust activation of defense response to biotic or abiotic stresses ,15. DefeArabidopsis thaliana as well as in many others monocots and dicot species  cyclase (UniPROT code: Q9SDJ2), encoded by  pathway . The Psb pathway . Taken t pathway . It is w2O2), the simplest peroxide recognized as ROS, plays important roles in several developmental and physiological processes When H2O2 accumulates in response to biotic and abiotic stresses, it is responsible of several phenomena, including stomatal closure and cell death [2O2 in wounded rice leaves and to verify if MeJA can affect wounding-dependent H2O2 production exerting a priming role. To this end, three-week-old rice leaves from M, P, W and P + W plants were incubated with 2\u2032,7\u2032-dichlorofluorescein diacetate  to detect the presence of H2O2. This compound exerts its function into the cytoplasm where is deacetylated by intracellular esterase and subsequently oxidized by H2O2 producing the green fluorescent dye dichlorofluorescein . A negative control is represented by leaves incubated with buffer only. Fluorescence was detected with a confocal microscope. The green fluorescence of the probe was revealed using a 488 filter whereas the auto-fluorescence of the chlorophyll was detected using a 563 nm filter. The experiment was performed three times independently and representative results are shown in It is widely recognized that biotic and abiotic stresses induce ROS production in plant cells. Under adverse conditions ROS may play two very different roles: activation of signaling leading to defense responses or exacerbating damage. In fact, ROS can have a deleterious effect on cells since they can modify biomolecules such as nucleic acids, proteins, and lipids leading to cell damage and death . At basall death . Our aim2O2 localized at the level of stomata and vascular tissue. Noteworthy, in P + W green fluorescence was not observed anymore, suggesting a beneficial effect of the hormone in protecting plants from oxidative damage. It has been shown that H2O2 participates as a pivotal signal messenger in response to wounding in several species, including rice [2O2 production during wounding [2O2 detected in stomata could depend on ABA-induced stomata closure, a phenomenon that exert a protection of leaves against further damage by subsequent threats [2O2 levels are usually high under stress conditions so its effect as strong toxic oxidant agent could lead to cell damage or cell death since the ROS scavenging is compromised [The negative control showed the red fluorescence due to the chlorophyll A. In paning rice . It is cwounding . The acc threats ,110. Add threats . Unfortupromised . These lChlorophyll fluorescence is a non-destructive method used to study plant photosynthetic performance in response to biotic and abiotic stresses  In this V/FM, as a plant stress indicator whose decline refers to a compromised photosynthetic performance [V/FM dropped to zero due to very low FM values comparable to F0  reaction centers or changes in PSII fraction due to modifications in thylakoid membrane structure and organization [Other studies already showed a reduced chlorophyll fluorescence in wounded leaves  after henization ,120.Our data suggests that MeJA treatment protects PSII reaction centers and maintain structural integrity of chloroplast, as already reported in salt stress conditions ,122. TheOryza sativa spp. Japonica cv. Carnaroli), supplied by Ente Nazionale Risi , were surface sterilized using 10% (v/v) H2O2 solution for 10 min. Seeds were washed with 70% (v/v) EtOH solution for 5 min, and soaked in water overnight. After incubation at 37 \u00b0C for 2 days on sterile water-imbibed filter paper, coleoptiles were transferred into alveolar trays and grown in hydroponic culture in Yoshida nutrient solution, in a growth chamber under the following conditions: 28\u00b0C, 14 h light / 23\u00b0C, 10 h dark, with 60% \u00b1 5% relative humidity.Rice seeds (v/v) TWEEN 20 solution to induce priming. Mock plants were sprayed with sterile water and 1% (v/v) Tween 20 solution only. Each plant was sprayed, making sure that droplets were uniformly distributed. Both mock and primed plants were wounded 24 h after MeJA treatment squeezing the leaves at the base and in the middle with a clamp and scraping the epidermal layer with carborundum in three different areas equally spaced over the length of the leaf. Leaf samples were harvested 48 hours-post-wounding (hpw) and homogenized by grinding with a pestle under continuous addition of liquid nitrogen.Three-week-old rice plants (3\u20134 leaves stage) were sprayed with 10 \u03bcM MeJA  and 1% .Samples were solubilized in 100 mM Tris-HCl, pH 8.5, containing 8 M urea and 7.5 mM DTT, and sonicated by using 2 min-cycles (6 times) at 40 KHz and 4\u00b0C. Samples were subsequently centrifuged at 45,000 rpm for 10 min at 4\u00b0C. Protein quantification was conducted by BCA assay  in triplicate. Disulfide bridges reduction was performed by 10 mM DTT for 45 min at 30\u00b0C. Alkylation was obtained by 50 mM 2-iodoacetamide for 20 min, under dark. Protein digestion was performed by treating the diluted samples with two proteases. LysC digestion  was carried out by using an enzyme to protein ratio of 1:100, with an incubation of 4 h at 37 \u00b0C. The resulting digestion mixture was treated with Trypsin  by using an enzyme to protein ratio of 1:50, incubating the samples overnight at 37 \u00b0C. Reactions were stopped by adding TFA to a final concentration of 0.5% and the mixture was desalted by RP-HPLC with a Zorbax column C18 eluted with a methanol gradient from 2 to 40% in 8 min, at a flow rate of 0.6 mL/min. Eluates were dried in Speed Vac Concentrator (Savant).Oryza sativa section of the Uniprot database (version 20150805). Enzyme specificity was set to trypsin with 2 missed cleavages. The mass tolerance window was fixed to 20 ppm for parent mass and to 0.5 Da for fragment ions. Carbamidomethylation of cysteine residues was set as fixed modification and methionine oxidation as variable modification. Proteins were filtered with a false discovery rate (FDR) \u2264 0.01. Data from different samples were compared using a T-test with a level of significance of 95% (p \u2264 0.05). For Gene Ontology analysis, data were analyzed by the PANTHER version 11.0 [http://string.embl.de/) has been carried out using STRING-10.5 server to predict the protein-protein interaction of priming targets [LC-MS/MS analyses were conducted with a LTQ-Orbitrap XL mass spectrometer  coupled online with a nano-HPLC Ultimate 3000  using a 10 cm pico-frit capillary column , 15 \u00b5m tip, New Objective) packed in-house with C18 material . Peptides were eluted with a linear gradient from 3 to 50% of acetonitrile containing 0.1% formic acid in 160 min at a flow rate of 250 nL/min. The capillary voltage was set at 1.2 kV and the source temperature at 200\u00b0C. For the analysis a full scan at 60,000 resolution on the Orbitrap was followed by MS-MS fragmentation scans on the four most intense ions acquired with collision-induced dissociation (CID) fragmentation in the linear trap (data-dependent acquisition - DDA). For each analysis, about 1 \u00b5g of protein extract was used. Protein identification and quantification was performed by the software MaxQuant . For eacion 11.0 . The PAN targets . STRING 2O2 production was revealed by the specific probe 2\u2032,7\u2032-dichlorofluorescein diacetate , which is rapidly oxidized to highly fluorescent dichlorofluorescein (DCF) in the presence of H2O2. Three-week-old rice plants were treated with MeJA or with sterile water (mock), as described above. Both mock and primed plants were wounded 24 h after MeJA treatment. For each treatment, two leaves from five plants were collected at 48 hpw Half number of leaves was incubated in a solution containing 20 mM DCFH2-DA in 10 mM Tris-HCl (pH 7.4) for 45 min under dark. The remaining half leaves was incubated in 10 mM Tris-HCl (pH 7.4) only, under the same conditions . After staining, leaves were washed three times in fresh buffer for 10 min and mounted on slides A LSM 710 confocal microscope  with Planneofluoar 40/1.30 objective, was used to detect the fluorescence. Two laser excitations lines were used . Data were managed using Image J software 1.46r (http://rsbweb.nih.gov/ij/) . The experiment was performed three times independently.ROS detection was performed as previously described . Briefly0), maximal fluorescence (FM) and maximum quantum efficiency of Photosystem II (FV/FM = FM \u2212 F0/FM) were measured in single leaves using an Imaging Pam M-series fluorimeter  [p < 0.05) were analyzed using a one-way analysis of variance (ANOVA) followed by Tukey post-hoc test. SigmaPlot was used for the analysis .Plants were dark-adapted for 30 min before chlorophyll fluorescence measurements. The minimal fluorescence (FGermany) . ImagingPriming encompasses accumulation of latent signaling components that are quickly activated when plants are exposed to a stress. Therefore, it is interesting to exploit comparative proteomic analysis in plants treated with chemical priming agents before they encounter stress conditions. Our results strengthen the awareness that LC-MS/MS-based proteomic approach is an exceptional analytical tool for a better understanding of plant defense molecular mechanisms and of the proteome reprogramming modulated by different treatments. Using this approach, we highlighted proteins involved in ROS signaling and photosynthesis that could cooperate in regulating priming-dependent defense responses. Some of the currently identified proteins had previously been shown to play a role in defense responses; however, our study revealed a role of MeJA-priming in protecting rice plants from mechanical damages. In the future, it would be interesting to further investigate the exact role of these proteins in priming phenomenon."}
+{"text": "The Cold Weather Plan (CWP) in England was introduced to prevent the adverse health effects of cold weather; however, its impact is currently unknown. This study characterizes cold-related mortality and fuel poverty at STP (Sustainability and Transformation Partnership) level, and assesses changes in cold risk since the introduction of the CWP. Time series regression was used to estimate mortality risk for up to 28 days following exposure. Area level fuel poverty was used to indicate mitigation against cold exposure and mapped alongside area level risk. We found STP variations in mortality risk, ranging from 1.74, 1.44\u20132.09 (relative risk (RR), 95% CI) in Somerset, to 1.19, 1.01\u20131.40 in Cambridge and Peterborough. Following the introduction of the CWP, national-level mortality risk declined significantly in those aged 0\u201364 , but increased significantly among those aged 75+  and for respiratory conditions . We show how spatial variation in cold mortality risk has increased since the introduction of the CWP, which may reflect differences in implementation of the plan. Combining risk with fuel poverty information identifies 14 STPs with the greatest need to address the cold effect, and that would gain most from enhanced CWP activity or additional intervention measures. Although significant gains were made in reducing cold-related health burdens throughout much of the last century , there iIn recognition of these impacts and recent severe winters, the Cold Weather Plan (CWP) for England was introduced in 2011 in order to prevent the harmful effects of cold weather, and to reduce the burden on health and social care systems . The CWPPrevious work has highlighted important regional differences in cold risk in England that are likely to be partly explained by differences in socio-economic factors, including fuel poverty rates . VariatiThis study characterizes the relationship between low ambient temperature and mortality in England for the most recent time-period, and assesses whether there have been any clear changes in risk in the years since the introduction of the CWP. The analysis is undertaken at both the national level and at the level of the 44 newly formed geographical units STPs (Sustainability and Transformation Partnerships). STPs are local partnerships between health services and local councils with an average population of 1.2 million, and are now considered central to delivering the transformation objectives detailed in the \u201cNHS Five Year Forward View\u201d . A King\u2019We compared the mortality risk associated with cold exposure in the periods before and after CWP implementation. We also examined area variations in mortality risk and levels of fuel poverty, and used these two indicators to highlight areas where risk is worse than the national median, and where the proportion of fuel poor households is higher than average. It is likely that such areas may not meet the need to prevent the harmful effects of cold weather on health and are thereby likely to have the most significant gains from intervention measures.STP daily mean temperatures were computed from the UK Meteorological Office hourly temperature data. This was done by identifying weather stations within each STP, and estimating a composite temperature series from stations that recorded data on at least 75% of days during the study period (2007\u20132015); missing data were imputed using a previously published methodology ,13. NatiOffice for National Statistics mortality data were also obtained for the same study period, and each record was assigned to the corresponding STP using postcode information. Cause specific mortality was defined for cardiovascular (ICD10 I00-I99) and respiratory (ICD J00-J99) conditions. National level mortality was grouped using the following age groups: 0\u201364, 65\u201374, 75+ years. The data were aggregated by date of death to create a time series of a daily death count for the study period.Fuel poverty statistics were used to indicate the extent of local area mitigation against the adverse effects of cold exposure. The fuel poverty indicator simultaneously measures the proportion of households whose fuel costs are above the national median, and whose residual income would fall below the poverty line after paying for their fuel consumption . The proThe analysis was restricted to winter months (November to March) when cold exposure is expected to have the highest effect on health. The analysis involved the following two stages:Time series, quasi-Poisson regression models were used to estimate temperature\u2013mortality associations during the study period, 2007\u20132015, and during the periods preceding and following CWP introduction, 2007\u20132010 and 2012\u20132015, respectively. These associations were reported as relative risks (RRs) between two threshold temperatures (first temperature percentile and maximum temperature). In the sensitivity analysis, we also estimated the relative risk of death using temperature values that are common to all STPs, by comparing the risk between 0 \u00b0C and 13 \u00b0C for every STP. These temperature values were selected based on the STPs\u2019 temperature distribution and indicate points of minimum (13 \u00b0C) and maximum mortality (0 \u00b0C). Further, the relative risk by disease and age-groups was estimated at an England level; this sub-group analysis was not possible at the level of STP due to small numbers.The analysis was conducted on R version 3.3.2 , using the dlnm (distributed lag non-linear model) package that simultaneously models the non-linear and delayed effects between temperature and mortality . The delThe models were adjusted for seasonal variation and long-time term trend by fitting a natural cubic spline on the day of year and time variables, respectively, an indicator for the day of the week. The argument \u201cgroup\u201d in the dlnm package was used to define groups of observations representing multiple and independent series based on winter months .To estimate the national and STP level relative risk (within a 95% CI), we used the threshold function within dlm (distributed lag linear model), and assumed that the cold effect on mortality was null above the cold threshold (highest temperature), and increased linearly below this threshold. We thereafter calculated the mortality burden attributable to cold temperature by applying a technique suggested for dlnm ; which gArcGIS software  was used to map the STP level mortality risk, the change in risk in comparison with the national median, and the proportion of households in fuel poverty in 2015. STPs with the greatest need to address cold-related mortality were identified as those with an unfavorable change in mortality risk (compared to the median STP), and with higher than the national average proportion of fuel poverty. Additionally, variation in risk between STPs was measured using the I-squared statistic . The average number of weather stations per STP was 20 and this ranged from 6 to 66 stations depending on the size of the STP. A figure showing the location and relative sizes of these STPs has been added in the supplementary material .There was a north-south disparity in daily mean temperatures, Cornwall and the Isles of Scilly STP had the highest median temperature (7.4 \u00b0C), and Northumberland, Tyne, and Wear STP the lowest (3.9 \u00b0C) . The daiAt a national level, cold risk was highest in the oldest age group 75+ years  and this significantly differed with risk at lower age groups;  and  for 0\u201364 years and 65\u201374 years, respectively. There was also a significant difference in cardiovascular  and respiratory mortality risk . Looking at the change in relative risk before and after CWP implementation showed a significant decline in mortality risk for those aged 0\u201364 years , but a significant increase in mortality risk in those aged 75+ years , and in respiratory conditions  .The difference in risk between the STP with the highest and lowest risk was also statistically significant  and  . Further2 = 72.1%), in comparison to the variation in risk in the earlier period (I2 = 56.2%). Heterogeneity tests show that the STP level cold risk varied more considerably in the late period  was significantly higher than the England level risk, despite milder winters. National level analysis found the highest risk in the oldest age group and for respiratory conditions. When comparing the national change in mortality risk before and after the CWP implementation, we observed a statistically significant drop in risk in the youngest age group and a statistically significant increase in the oldest group and in respiratory diseases. The heterogeneity test found variation in effect size by area increased considerably during the second. Lastly, combining area risk with fuel poverty statistics revealed 14 STPs where increase in risk surpassed the STP median increase and where fuel poverty was greater than the national average, suggesting that existing resources may not adequately address the adverse effects of cold exposures, particularly, in the identified 14 areas.One previous study on mortality effect of outdoor temperatures in England found the East of England region had a significantly higher mortality risk, although regional differences diminished after years with missing pollution data were excluded . AnotherOur study is the first to use STPs to demonstrate spatial variation in cold-related mortality. STPs geographies are large enough to enable the estimation of risk but small enough to discern spatial distribution at sub-regional levels. STPs have a role in strengthening prevention, early intervention, and integrating NHS and local authority services, making analysis at this level meaningful to local decision-makers. We found that STPs in the southern part of England had the highest mortality risk, despite the milder winters; this indicates that beyond environmental factors, social factors, such as differences in adaptation measures or in the implementation of public health interventions, may play a role in determining cold risk. Our evaluation of the impact of CWP on mortality risk found an incline in risk in over two-thirds of the STPs, although this was only significant in the Coast, Humber, and Vale STP. We found a significant decline in risk for the youngest age groups, which supports the evidence showing a decline in cold effect in the UK over the years (with the greatest decline in the youngest age group) . This maThe higher wintertime health burden in the UK compared to countries with colder climates suggests that impacts are preventable . The proMortality and morbidity from cold winters is predictable and largely preventable ; CWP wasIn this study, the extent of area variation in risk by STP increased in the period after CWP implementation, suggesting that it is possible that some of the mortality experienced in these areas maybe avoidable if CWPs were equally implemented across England. Government schemes that require local co-ordination, such as the CWP implementation or home energy efficiency interventions, may offer mitigation against the effects of cold exposure, but it unlikely that these initiatives are evenly adopted across the country. The success of public health interventions require collaboration between health, social care, and other departments such as environmental services. STPs in England are well-placed to integrate these services as part of their role in strengthening prevention and early intervention . The varIn absence of information on the local implementation, it is difficult to entirely attribute changes in risk to the CWP in England, which limits our understanding on the drivers of observed variations. Likewise, we were unable to obtain comprehensive data on housing energy efficiency. Following the recent Department for Energy and Climate Change (DECC\u2019s) strategy to improve housing energy efficiency standards to at least a Band C rating , we woulThis study benefited from access to STP data, enabling us to overcome the limitations associated with analysis at larger geographies such as masking small area variations. The analysis also benefited from having several years of data post the CWP implementation, enabling the comparison of risk before and after the intervention. Future research should examine the risk from exposure to indoor temperature, which may have a stronger association with health outcomes than outdoor temperatures ,29. SincPrevious studies on cold related mortality in England have found greater risk in the eldest , and theTo our knowledge, this is the first study in England to characterize cold-related mortality using the newly-formed Sustainability and Transformation Partnerships (STPs) geographies. We found STPs in the South West of England  had higher mortality risk during the study period (2007\u20132015), despite having milder winters. A comparison of mortality risk in the period before and after the introduction of the CWP showed variation in mortality risk by area increased considerably during the second period. The national level analysis found a significant decline in cold-related mortality risk post CWP implementation in the youngest age group (0\u201364 years), but a significant increase in risk in the eldest group (75+ years) and from respiratory diseases. Lastly, combining area risk with fuel poverty statistics highlighted 14 STPs where the existing resources may be adequately address the adverse effects of cold exposures, and would therefore benefit from more targeted measures of intervention."}
+{"text": "The effect of substantive doses of essential amino acids (EAA) on incretin and insulin production, and the impact of age upon this effect, is ill\u2010defined.A 15\u2010g oral EAA drink was administered to young  and older  healthy volunteers. Another group of younger volunteers  was given IV infusions to achieve equivalent plasma amino acids (AA) profiles. Plasma AA, insulin, glucagon\u2010like peptide\u20101 (GLP\u20101) and glucose\u2010dependent insulinotropic peptide (GIP) were quantified over 2\u00a0hours.\u22121 at 30\u00a0minutes following oral feeding compared to 22\u00a0\u00b1\u00a09\u00a0pmol\u00a0L\u22121 at 60\u00a0minutes following IV feeding (P: NS). EAA peaked at 3395\u00a0\u03bcmol\u00a0L\u22121 at 45\u00a0minutes during IV infusion compared to 2892\u00a0\u03bcmol\u00a0L\u22121 following oral intake . There was an 11% greater increase in insulin levels in the 120\u00a0minutes duration of the study in response to oral EAA as opposed to IV EAA. GIP increased following oral EAA . Age did not impact insulin or incretins production.In younger recruits, EAA\u2010induced rapid insulinaemia and aminoacidaemia with total amino acids(AA), EAA and\u00a0branched chain amino acids (BCAA) matched between oral and IV groups. Insulin peaked at 39\u00a0\u00b1\u00a029\u00a0pmol\u00a0LPostprandial rises in EAA levels lead to rapid insulinaemia which is higher with oral compared with IV EAA, that is attributed more to GIP and unaffected by age. This finding supports EAA, on their own or as part of high\u2010protein meal, as nutritive therapeutics in impaired glycaemia and ageing. Nonetheless, it has been shown that consumption of a mixture of oral amino acids (AA) stimulates GLP\u20101 and GIP secretion.Ageing of the gut and gut\u2010brain axis is a burgeoning area of research. Ageing is associated with reduced energy intake, protein malnutrition (in some instances) and impaired anabolic responsiveness to protein foodsIn the postabsorptive state, mobilization of NEAA  from skeletal muscle represent the main mechanism via which splanchnic tissues are provided with fuel at the expense of negative muscle protein balance.22.1https://clinicaltrials.gov/ (NCT02370745). A total of 25 healthy volunteers were recruited to participate. Seventeen healthy young males (18\u201030\u00a0years) and eight healthy older males (65\u201075\u00a0years) were recruited via local advertisement in the two sites of the study (University of Nottingham\u2014Derby\u2014UK and McMaster University\u2014Hamilton\u2014Canada). All volunteers gave informed consent. All participants had no history of diabetes, liver disease or gastrointestinal abnormalities. They were assigned to three groups. (a) Young oral (Y.O) group (Nottingham site): eight young aged to have oral EAA beverage. (b) Young intravenous (Y.IV) group (Hamilton site): nine young aged to have equivalent intravenous EAA. (c) Old oral (O.O) group (Nottingham site): eight older aged to have the same oral EAA beverage as the Y.O group. Please see Table The study was approved by The University of Nottingham Ethics Committee and Hamilton Integrated Research Ethics Board and was conducted in line with the Declaration of Helsinki and registered at t\u00a0=\u00a00\u00a0minute) and at 15, 30, 45, 60, 75, 90, 105 and 120\u00a0minutes post consumption of either 15\u00a0g of oral EAA solution (YO and OO groups) or following initiation of intravenous 15\u00a0g of equivalent EAA infusion (group Y.IV.). After baseline sampling, volunteers (YO and OO groups) were asked to consume a pre\u2010prepared oral EAA beverage. The solution was prepared the day before in 250\u00a0mL of aqueous solution, kept refrigerated overnight and warmed to room temperature in the morning of the study. The stability of the EAA components of the solution following overnight stay was tested beforehand. The composition of the EAA beverage was l\u2010histidine: 1.21\u00a0g; l\u2010isoleucine: 1.73\u00a0g; l\u2010leucine: 3.59\u00a0g; l\u2010lysine: 3.07\u00a0g; l\u2010methionine: 0.95\u00a0g; l\u2010phenylalanine: 0.91\u00a0g; l\u2010threonine: 1.13\u00a0g; l\u2010tryptophan: 0.48\u00a0g and l\u2010valine 1.86\u00a0g.\u22121 for 15\u00a0minutes after which the rate of infusion was increased to 289\u00a0mg\u00a0min\u22121. These rates were calculated aiming to deliver 13% of total EAA infusate in the first 15\u00a0minutes and 87% over the remaining 45\u00a0minutes guided by previous reports.2O to compensate for stomach distention. At the end of infusion (60\u00a0minutes), blood sampling continued every 15\u00a0minutes for another hour to complete a total of 120\u00a0minutes of sampling. At the end of the study, cannulae were removed and volunteers were offered a snack. They remained on site for monitoring as described above. See Figure All groups reported to the study sites following overnight fasting of 8\u201014\u00a0hours. An 18\u201020G cannula was inserted into the antecubital vein for blood sampling at baseline  and N\u2010tert\u2010Butyldimethylsilyl\u2010N\u2010methyltrifluoroacetamide (MTBSTFA) and heated to 90\u00b0C for 60\u00a0minutes. Samples were allowed to cool before transfer to autosampler vials. Glucose concentrations were determined similarly through the inclusion of an internal standard before the samples were de\u2010proteinized with ice\u2010cold ethanol and evaporated to dryness. Accurate analysis of glucose by GC\u2010MS is routine to our laboratories as final batch analyses. Samples were collected in sodium fluoride tubes, stored immediately on ice, centrifuged in small batches throughout the study, then aliquoted and stored at \u221280\u00b0C until analysis by GC\u2010MS.For measurement of AA concentrations, internal standards were added to plasma samples before the addition of urease solution and incubation at room temperature for 20\u00a0minutes. Samples were then de\u2010proteinized with ice\u2010cold ethanol for 20\u00a0minutes at 4\u00b0C, before centrifugation at 13\u00a0000\u00a02.2.2\u22121 and for GIP 1.4\u20101000\u00a0pg\u00a0mL\u22121, both shown to have a recovery of 103% from serum matrix. The analytes were insulin, C\u2010peptide, GIP total, GLP\u20101 total and glucagon. The incretin effect was calculated as the difference between insulin responses after oral and intravenous EAA stimulation, relative to the response seen after oral EAA ingestion.Commercial ELISA kits  were used to determine insulin and gut hormone concentrations. Blood samples for these analysis were collected in P800 tubes, that specifically stabilize GLP\u20101 and GIP upon collection. The kit was the Milliplex Map Kit\u2014Human metabolic hormone magnetic bead panel (Cat #HMHEMAG\u201034K) measured on a Luminex\u2010Magpix. This is commercially validated kit that has been certified to have a linear range for GLP\u20101 of 2.7\u20102000\u00a0mg\u00a0mL2.3The sample size was prospectively determined with a power of calculation and taking a population  variance of 15%  and CV of laboratory techniques also of 15% to detect differences in feeding modes with 80% confidence at the 5% significance level. The analysis was conducted using Prism 7 (GraphPad). Data are presented as mean\u00a0\u00b1\u00a0SD. Normality of distribution was tested using D'Agostino and Pearson Omnibus normality tests. Comparison between two measures made at times before and after feeding or same time point between two groups were made via repeated measures 2\u2010way ANOVA with Bonferroni post\u2010test analysis to determine significance. Change from baseline was calculated as the ratio between time point measurement and calculated average baseline value. The net incremental area under the response curve (AUC) was calculated for each individual separately and presented as a two\u2010group comparison.33.1P\u00a0<\u00a00.05) in both groups with exception of total AA in Y.O group, which started to become significantly higher at 30\u00a0minutes. Total AA reached a peak of 5170\u00a0\u00b1\u00a01654\u00a0\u03bcmol\u00a0L\u22121 (1\u2010fold rise from baseline) in Y.IV group compared to a peak of 4523\u00a0\u00b1\u00a0487\u00a0\u03bcmol\u00a0L\u22121 (0.9 fold rise) in Y.O group at 45\u00a0minutes (P: NS). EAA peaked at 3395\u00a0\u00b1\u00a01072\u00a0\u03bcmol\u00a0L\u22121 (2.3 fold rise from baseline) at 45\u00a0minutes during IV infusion compared to 2891\u00a0\u00b1\u00a0350\u00a0\u03bcmol\u00a0L\u22121 (2.1 fold rise from baseline) following oral intake (P: NS). BCAA reached a peak of 1678\u00a0\u00b1\u00a0401\u00a0\u03bcmol\u00a0L\u22121 (2.7\u2010fold rise from baseline) in Y.IV group compared to 1330\u00a0\u00b1\u00a0284\u00a0\u03bcmol\u00a0L\u22121 (2.6\u2010fold rise from baseline) in the Y.O group at 60\u00a0minutes (P: NS). Non\u2010essential amino acid (NEAA) concentrations remained unchanged from baseline in both groups throughout the 120\u2010minute duration of the study. Total AA concentrations returned to baseline at 120\u00a0minutes in Y.O group, as opposed to 105\u00a0minutes in the Y.IV group. Total EAA and BCAA were back to baseline at 105 and 120\u00a0minutes, respectively.For both Y.O and Y.IV groups, concentrations were matched with no significant difference between the two groups at baseline for total AA, EAA and branched\u2010chain amino acid . In comparison, insulin concentrations in Y.IV group peaked at 22\u00a0\u00b1\u00a09\u00a0pmol\u00a0L\u22121 at 60\u00a0minutes (0.4\u2010fold rise from baseline) and overall remained not different from baseline throughout the study. The difference in insulin rise between the two groups (the incretin effect) was 45% calculated as the difference between AUC for the first 60\u00a0minutes and was 11% calculated as AUC difference for the entire 120\u00a0minutes duration of the study. C\u2010peptide change at 30\u00a0minutes from baseline was 1.7\u00a0\u00b1\u00a00.7 folds (P\u00a0<\u00a00.5 vs baseline) in the Y.O group compared to 1.3\u00a0\u00b1\u00a00.8 folds change from baseline (P: NS against baseline) in the Y.IV group with no significant difference between the two groups at this time point. This rise corresponded to that seen in insulin concentrations. Glucagon concentrations rose from baseline peaking at 30\u00a0minutes following oral EAA intake  and at 60\u00a0minutes following IV EAA administration . In comparison, GLP\u20101 concentrations in the Y.IV group stayed unchanged through the 120\u2010minute duration of the study. No difference was observed between feeding types in GLP\u20101 concentrations. Total GIP concentrations rose significantly following oral consumption to peak at 30\u00a0minutes (1.6 fold rise from baseline) while remaining unchanged throughout the study in the Y.IV group. This rise was significantly different between the two groups  in the Y.O group \u2014Figure Following oral consumption of EAA beverage in the Y.O and O.O groups, AA profiles were similar between the two groups at all time points. At 15\u00a0minutes, total AA, EAA and BCAA were significantly elevated compared to baseline. Total AA, EAA and BCAA peaked at 60\u00a0minutes in both groups  with a slower return to baseline in the O.O group  was ~11% calculated as total AUC over 120\u00a0minutes. This effect is EAA\u2010related since no gluconeogenic source was infused in our study. It is also important to highlight the use of a dose (15\u00a0g EAA) relating to main meal protein consumption and thus any reported results could be easily extrapolated to translate clinically if an equivalent EAA beverage is provided instead. Finally, our studies have demonstrated that this effect of incretin hormone production (at least in response to EAA) does not appear to be affected by the process of physiological ageing.Incretin and insulin responses to protein are established.Stimulation of GIP but not GLP\u20101 by oral protein ingestion has been reported previously.Our results show that providing 15\u00a0g of EAA stimulates glucagon production, although the rise overall was not significantly different from baseline. Glucagon stimulation was previously reported following mixed AA and whey protein.The effect of incretin hormones on insulin production is crucial in alleviating postprandial hyperglycaemia in normal individuals. In individuals with type 2 diabetes where this effect is impaired,We acknowledge that the lack of cross\u2010over comparison could be a potential source for variability between the two young groups. We also acknowledge the fact that the physiological process of digestion and absorption is subject to both intra and inter\u2010individual variations and that a cross\u2010over design may have been more powerful. However, we think the well\u2010matched plasma appearance of EAA across the groups and the greater capture of biological variance are validatory and study strengths.We did not detect age\u2010related differences in gut hormone responses to EAA. This finding suggests that, despite adverse reports on ageing related gut physiology,5We have shown that EAA are able to induce rises in incretins and insulin hormones. There was a demonstrable differential effect of EAA on insulin production when given orally and matched with an intravenous equivalent. Our results also suggest that an EAA\u2010induced effect is delivered through hormonal rises likely related to GIP. Our results add to those from a series of studies previously proved that the \u201cincretin effect\u201d exists following consumption of glucose, mixed AA and lipid beverage. In particular relation to AA\u2010induced incretin hormone production, we suggest using EAA gives more accurate estimate in this regards. Our results suggest that the process of physiological ageing does not adversely affect EAA\u2010induced incretin hormone release. Hence , we predict that associated incretin effect in elderly population is likely to remain intact. Further research is needed to inform clinically or nutritionally meaningful intervention especially that could elucidate the mechanisms via which L and K cells sense EAA in the gut and EAA\u2010mediated hormones release in both youth and ageing.The authors declare no conflict of interest in relation to this manuscript.P.J.A, I.I, K.S, B.E.P, H.A conceptualized the study. H.A, T.S and S.H.M.G performed clinical studies. J.J.B performed sample and statistical analysis. H.A drafted the initial manuscript, which was then reviewed and edited by all authors. All authors contributed to interpretation of results and approved the final version of the manuscript.The study was performed according to the Declaration of Helsinki and was approved by The University of Nottingham Ethics Committee and Hamilton Integrated Research Ethics Board. All participants gave written informed consent following full explanation of the rationale for and conduct of the study, in addition to the procedures involved."}
+{"text": "The current version, SilencerDB 1.0, contains (1) 33 060 validated silencers from experimental methods, and (ii) 5 045 547 predicted silencers from state-of-the-art machine learning methods. The functionality of SilencerDB includes (a) standardized categorization of silencers in a tree-structured class hierarchy based on species, organ, tissue and cell line and (b) comprehensive annotations of silencers with the nearest gene and potential regulatory genes. SilencerDB, to the best of our knowledge, is the first comprehensive database at this scale dedicated to silencers, with reliable annotations and user-friendly interactive database features. We believe this database has the potential to enable advanced understanding of silencers in regulatory mechanisms and to empower researchers to devise diverse applications of silencers in disease development.Gene regulatory elements, including promoters, enhancers, silencers, etc., control transcriptional programs in a spatiotemporal manner. Though these elements are known to be able to induce either positive or negative transcriptional control, the community has been mostly studying enhancers which amplify transcription initiation, with less emphasis given to silencers which repress gene expression. To facilitate the study of silencers and the investigation of their potential roles in transcriptional control, we developed SilencerDB ( The current version of SilencerDB contains 33 060 validated silencers and 5 045 547 predicted silencers for 268 cell lines across eight species. Among the validated silencers, 32 707 were manually curated from high-throughput experiments  and 353 from low-throughput experiments . Predicted silencers are identified via the correlation-based model (https://github.com/xy-chen16/DeepSilencer). Each silencer entry in SilencerDB is annotated with extensive details including general silencer information and potential regulatory gene information  to ensure the unification of genomic locations of silencers. 2048 predicted silencers and five validated silencers whose genomic locations cannot be converted into the specific reference genome were omitted  and low-throughput methods (1.07%) Figure . PredictHome page , identification method, reference and corresponding PubMed ID, reference genome, genomic location, length, external link to UCSC and FASTA file. An embedded interactive and smooth genomics visualization tool, Biodalliance  to efficiently calculate openness scores of these silencers across 199 human cell lines. To check whether these silencers have higher openness scores in the K562 cell line than those in other 198 cell lines, we performed a one-sided Wilcoxon test for silencer openness scores in K562 and the remaining 198 cell lines and obtained 198 FDR P-values (Benjamini and Hochberg correction) respectively. Results, as shown in We next investigated cell line specificity of silencers by checking whether silencers validated in a cell line show a higher degree of chromatin accessibility (openness score) in the same cell line than in other cell lines. Taking validated silencers in human K562 cell line as an example, we first used OPENANNO (https://www.apache.org). The web-frontend interface uses Bootstrap v3.3.7 framework (https://getbootstrap.com/docs/3.3/) for display optimization. Plug-ins for the jQuery and JavaScript library, including DataTables v1.10.19 (https://datatables.net), Biodalliance v0.13.8 , and morris.js v0.5.0 (https://morrisjs.github.io/morris.js/index.html), are used to implement advanced tables, genome browser, and charts, respectively. The server-backend uses PHP v7.4.5 (http://www.php.net). All data is stored in a MySQL v8.0.20 (http://www.mysql.com) database. The current version supports most of mainstream web browsers, such as Google Chrome, Firefox, Opera, Microsoft Edge, Apple Safari, etc.The SilencerDB website is maintained on a Linux-based Apache web server (Although the study of transcriptional regulation is one of the most research-intensive topics in biology, only now we start to interpret the underlying logic of regulatory elements systematically, thanks to advancement in both experimental and computational techniques. Though regulatory elements are known to be able to induce either positive or negative transcriptional control , the comTherefore, to fulfil the gap, we developed SilencerDB which, to the best of our knowledge, is the first comprehensive database at this scale dedicated to silencers. With systematic data collection procedures, standardized datasets as well as a user-friendly web platform designed for research standards, we hope that SilencerDB can benefit biologists and data scientists to achieve better understanding of the role of silencers in regulatory mechanisms and empower them to construct more comprehensive gene regulatory networks by combining negative regulatory mechanisms of silencers with the positive ones of enhancers. Moreover, since GWAS-identified risk variants in non-coding regions of the genome exert phenotypic effects through perturbation of transcriptional gene promoters, enhancers and silencers etc., SilencerDB have the potential to give insights to a more complete interpretation of GWAS risk variants and aid in developing new approaches for disease prevention and treatment .After the first release of SilencerDB, one of our plans for the immediate future is to incorporate more comprehensive epigenomic annotations, such as different types of transcription factor binding, histone modification and chromatin accessibility annotation in different cell lines. In order to expedite the collection process and expand our dataset, we would also like to incorporate a web-based tracking and data entry system to carry out a bi-weekly PubMed search to identify silencer-related research. Other areas that the team hope to improve on include better visualization tools for silencer comparisons and speed-up for search queries.http://health.tsinghua.edu.cn/silencerdb/ or http://bioinfo.au.tsinghua.edu.cn/silencerdb/. In addition to various options for downloading data on the Download page, users can customize and download the filtered data on the Search page.Users can access any feature available in the database without the need to register or login. All data is freely accessible to the research community at gkaa839_Supplemental_FileClick here for additional data file."}
+{"text": "Parents reported preschooler\u2019s self-regulation difficulties  before (n = 268) and during the lockdown (n = 157) by a validated questionnaire. Results: Preschoolers showed a decrease in total PA , sleep efficiency , an increase in sedentary time  internalizing  and externalizing  problems. Preschoolers who met the World Health Organization recommendations for PA had lower internalizing scores than non-active peers . Conclusions: Our findings highlight the importance of meeting PA recommendations to reduce psychosocial difficulties during a lockdown situation.Background: A better understanding of the effects of the lockdown on lifestyle behaviors may help to guide the public health response to COVID-19 at a national level and to update the global strategy to respond COVID-19 pandemic. The aim of the study was to examine the effects of the COVID-19 lockdown on device-measured physical activity (PA), sedentary time, sleep and self-regulation; and to determine whether PA and sleep are related to self-regulation problems during the lockdown. Methods: PA, sedentary time and sleep were assessed using accelerometry in the week in which the Spanish national state of alarm was declared ( The coronavirus 2  is a severe acute respiratory syndrome that first emerged in late 2019. Countries have faced challenges with how to handle the crisis in different ways. Specifically, in March 2020, the Government of Spain declared a national state of alarm to curb the spread of the severe acute respiratory syndrome coronavirus 2 and established a mandatory home \u201clockdown\u201d from 14 March to 26 April. Accordingly, the coronavirus disease 2019 (COVID-19) pandemic disrupted life for all, with the closure of non-essential businesses and schools. For schoolchildren, this limited the opportunities for movement  and social life, disrupting daily schedules and routines. Many children and adolescents were temporarily deprived of institutional, educational environments, social contact with peers and, possibly, adequate cognitive, affective and physical stimuli for their age.Recent studies published about healthy lifestyles during confinement have shown adverse collateral effects of the COVID-19 lockdown on physical health . AnotherSeveral studies have reported serious changes in the mental health of children and adolescents during the COVID-19 quarantine . For exaRegarding sleep patterns, studies have shown inconclusive results in the youth population. Overall, the pandemic seems to significantly disturb normal sleep patterns and nightmares for children . The aboA better understanding of the effects of the lockdown on physical activity, sleep and mental health may help to develop suitable strategies as part of the COVID-19 pandemic responses. In this regard, the compulsory movement restriction meant the prohibition of the movement of children outside their home for many weeks in a row, with no certainty about potentially damaging consequences on their health and well-being. Therefore, the purpose of this study was two-fold: to examine the effects of the COVID-19 lockdown on physical activity, sedentary time, sleep and self-regulation in Spanish preschoolers; and to determine whether device-measured PA and sleep are related to self-regulation difficulties during lockdown.The present study was conducted in a cohort of preschoolers aged 4 to 6 years old from three schools in Pamplona (Spain). Data from baseline assessments (from September to December 2019) and from the second evaluation (from March to April 2020) were included in the study. The Ethics Committee of the Public University of Navarra approved the study protocol (PI-020/19). Before the enrollment in the study, all parents or legal guardians were informed about the purpose of the project and signed informed consent.Objectively measured physical activity, sedentary time, and sleep were collected using a wrist-worn GENEActiv tri-axial accelerometer attached to the preschooler\u2019s non-dominant wrist over six consecutive days . Raw datIn this study, the van Hees et al.  sleep alFor the present purpose, we have used data from 21 children (57.1% boys) who wore the accelerometers in the week in which the state of alarm was declared. For analyses, we used the three days prior to lockdown compared to the three days during the lockdown.We used the child self-regulation and behavior questionnaire (CSBQ), which evaluates subscales of cognitive self-regulation, behavioral self-regulation, and emotional self-regulation, as well as sociability, prosocial behavior, externalizing problems and internalizing problems. Each item requests the respondent to evaluate the general frequency of target behaviors on a scale from 1 (not true) to 5 (certainly true). All subscales contain at least 5 items and have been shown to be reliable in preschoolers . Followin = 268, first assessment) and during  the COVID-19 lockdown using an online questionnaire that included the CSBQ ). A test of normality of distribution and equality of variance between groups using the Shapiro\u2013Wilk test and Levene\u2019s test were used. All assumptions were met, and an analysis of covariance was employed to evaluate differences before and during the COVID-19 lockdown in physical activity , sedentary time, sleep (duration and efficiency), and self-regulation parameters . Also, we determined differences in self-regulation parameters according to compliance with the WHO recommendations of physical activity and sleep [p < 0.05 was considered statistically significant.The data are presented as means  or absolute and relative prevalence (nd sleep . These ap = 0.002) and in maternal education (p < 0.001).CI 17.1 to 83.3) and internalizing  and externalizing  problems  = \u221243.3 min per day, 95% confidence interval (CI) \u221268.1 to \u221218.5) and sleep efficiency , and an increase in sedentary time , but not for externalizing scores . Regarding sleep, there were no differences between preschoolers who met or not sleep recommendations .Preschoolers who met the recommendations for physical activity had lower internalizing scores than non-active peers  and increased sedentary time (MD = 50.2 min per day) during the lockdown. Previously published studies are in line with our findings, which found that children had different patterns of activity than what was seen before COVID-19. For example, changes in physical activity and sedentary behavior were reported by parents and legal guardians of children living in the U.S. using an online survey [Because children and adolescents were experiencing changes regarding their usual daily habits, it also appears reasonable to find different sleep patterns. However, the results of this issue are inconclusive. For example, a recent narrative meta-analysis suggested that the pandemic seems to significantly disturb normal sleep patterns and nightmares for children . The stuSelf-regulation is defined as psychological conduct that comprises a series of important competencies, such as the ability to control inner states or responses towards thoughts, attention, emotions or even performance . The preOur study also shows that preschoolers who met the recommendations for physical activity had lower internalizing scores than non-active peers. Therefore, we also highlight the importance of meeting physical activity recommendations in the early years, as it seems to influence aspects related to broad areas of mental health . This reAs far as we are aware, this is the first study to examine physical activity and sleep patterns of preschoolers using objective-measures with accelerometers during the COVID-19 lockdown. Despite efforts of objectively examining physical activity and sleep via actigraphy, there are a number of methodological issues that also need to be considered. A first limitation is that it is possible that changes in behavior outcomes occurred in the initial week of the lockdown, as there were serious alterations in daily life and families struggled to adapt to their new reality. However, because the lockdown continued for several weeks, it is possible that preschoolers returned to normalcy, including their routine of sleep and physical activity. Second, the small sample size with accelerometry data and a short time of track are other important limitations. Third, subjects at such age are dependent on parents\u2019 decisions regarding their lifestyle. Finally, the geographic/urban environment could influence physical activity and sleep patterns during the early years .In conclusion, recognizing these lifestyle and psychological well-being changes are critical because they may have a lasting impact on preschoolers\u2019 physical and mental health and may help guide future interventions, perhaps by physical activity promotion. Therefore, adopting healthy movement behaviors may help to mitigate the negative effects on preschool children of this pandemic and its lockdown."}
+{"text": "Despite significant potential for providing insight to private perceptions and behaviors, search engine data has yet to be utilized as a means of gauging the U.S. public\u2019s interest and understanding of mental health in the context of gun violence and politics. An analysis of Google Trends revealed that Mental health searches increased in volume starting in the beginning of the current decade. Notably, both \u201cmental health\u201d and \u201cgun(s)\u201d were searched with greater frequency the week after the mass shooting events occurred. Related searches after the event also observed a significant increase in interest in mental health and gun regulation, legal reform, mass shootings, and gun(s). Results suggest that the American public\u2019s perception of mental illness increasingly incorporates associations with themes of violence and politics, which becomes more apparent surrounding mass shooting events. Future studies are needed to determine implications for stigmatization of vulnerable groups, and possible relations to media coverage. The media has increased its coverage of mental health in recent years . ConcurrMental health is a critical public health concern, with 1 in 5 adults in the U.S. experiencing mental illness in a given year , and lifThere is reason to hypothesize the national discourse on mental health has shifted over the years. A recent investigation looked toward media portrayals of mental illness to gain a greater understanding of sources possibly impacting public perceptions. Using random sampling to extract 400 news stories from 1995 to 2014, McGinty and colleagues found that in the latter decade, stories were more likely to mention mass shootings by individuals with mental illness \u20138, 17\u201321https://trends.google.com/trends/?geo=US) provides a unique and valuable big data approach to examining public interest and perceptions . The data is publicly available : 280\u201390. \u202ahttps://doi.org/10.1080/17457289.2013.846346\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c.\u2014\u2014\u2014. 2014. \u201cInternet Search Data and Issue Salience: The Properties of Google Trends as a Measure of Issue Salience.\u201d Journal of Elections, Public Opinion and Parties 24 (1): 45\u201372. \u202ahttps://doi.org/10.1177/1532440012438889\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c\u202c.Reilly, Shauna, Sean Richey, and J. Benjamin Taylor. 2012. \u201cUsing Google Search Data for State Politics Research An Empirical Validity Test Using Roll-Off Data.\u201d State Politics & Policy Quarterly 12 (2): 146\u201359. \u202aThank you for the insightful suggestion. Firstly, the introduction has been edited to include these relevant investigations: \u201cCapturing searches as they occur in real time rather than asking participants to recall their interest over time also removes confounds related to recall bias. Google Trends has been increasingly used to predict influenza epidemics [2], determine the effect of race on presidential polling [3], and even quantify interest in birth control and abortion [4]. Thus, it may lend itself particularly well to gathering public opinion and interest on topics that would otherwise be sensitive and difficult to gauge [5-7].\u201d p. 52. A crucial take-away from these papers is that, when using Google Trends, the most appropriate model is a cross-sectional time series. In the case of this paper, the independent variable should be a fixed effect for the gun violence event which allows for a clean pre-post change estimation. As it stands now, this paper is descriptive\u2014which is fine\u2014but the use of Google Trends allows for so much deeper analysis. As for the mental health aspects, again, as this is merely descriptive with no large-scale content analysis for media agenda setting/framing/priming, I am not yet persuaded. I am just not sure I buy that gun violence events are driving searches for mental health. The t-tests are interesting, but cross-section time series are more appropriate. We agree that not accounting for each individual event as a fixed effect was a weakness of the prior version of the manuscript. We removed the analyses using t-tests to see whether search volumes changed before and after the events. In their place, we now use fixed effects panel regression using the Least Squares Dummy Variable (LSDV) approach [8] to examine searches before and after the events, accounting for each gun violence event as a fixed effect. An interaction of timepoint by whether the search occurred in the state where the gun violence event occurred was also analyzed, in line with reviewer 2 point 1\u2019s suggestion. We also used the fixed effects panel regression LSDV approach to analyze whether related searches of interest for our key words increased in proportion after the gun violence events. The methods and results have been updated accordingly: \u201c2.3c. Main effect analyses. Search terms were extracted for the week before the 15 events, and the week after the 15 events, for each of the 50 states and Washington D.C. The data extraction took place in July 2019. Before and after scores of relative search volume were extracted for key terms \u201d). A fixed effects panel regression using the Least Squares Dummy Variable (LSDV) approach was then conducted [8]. Searches from each state the week before and after the events were compared, with the 15 events accounted for as fixed effects. An interaction of state where the event occurred by timepoint was tested to see whether change in search volumes in the state the event occurred would be significantly different from change in search volumes in states where the event did not occur.\u201d p. 9\u201c2.3e. Related search terms for the week before and week after. Related searches for \u201cGun(s)\u201d and \u201cMental Health\u201d key words were extracted for the week before and the week after the 15 events. The week before was chosen as a comparison point prior to the event taking place. Each related search was dummy coded as \u201ctopic of interest\u201d or \u201cnot topic of interest.\u201d Percentage of topics of interest among total related searches were computed for the week before and after . A fixed effects panel regression using the LSDV approach (to account for events as fixed effects) was conducted to determine whether proportion of related search terms would increase after the event occurred.\u201d p. 10\u201c3.3. Keyword searches before and after mass shooting events. For the \u201cmental health\u201d key term, the model was significant, R = 0.30, R2 = 0.09, F = 0.892, p <0.001. Relative to the week before the event, there was a trend toward larger volume of \u201cmental health\u201d searches, b = 1.47, SE = 0.82, t = 1.80, p = 0.07. A main effect was not observed for whether the search occurred in the state the event occurred, b = -13.25, SE = 9.20, t = -1.44, p = 0.15. The interaction of event timepoint and search occurring in-state/out-of-state was not significant, b = 0.80, SE = 5.82, t = 0.14, p = 0.89.  The model of searches for the \u201cgun\u201d key term was likewise significant, R = 0.35, R2 = 0.12, F = 12.04, p <0.001. Relative to the week before the event, a larger volume of \u201cgun\u201d searches was observed the week after, b = 5.42, SE = 0.64, t = 8.45, p < 0.001. A significant main effect was not observed for whether the search occurred in the state the event occurred , and neither was an interaction . As expected, the model for searches for the \u201cguns\u201d key term was also significant, R = 0.33, R2 = 0.11, F = 10.70, p <0.001. Compared to the week before events occurred, a larger volume of \u201cguns\u201d searches was observed the following week, b = 4.80, SE = 0.79, t = 6.05, p < 0.001. As was the case for other key terms, a significant main effect was not observed for the search occurring in the state where the event occurred , nor was a significant interaction observed .\u201d p. 11\u201cThe model of related searches before and after the event for the \u201cmental health\u201d key term was significant, R = 0.25, R2 = 0.06, F = 4.04, p <0.001--related searches that pertained to law, politics/government, crime/violence, mass shootings, stigma, and guns significantly increased in proportion the week after the event, \u03b2 = 0.08, t = 2.44, p = 0.015. Likewise, the model of related searches for \u201cgun(s)\u201d key terms was significant, R = 0.28, R2 = 0.08, F = 12.39, p <0.001. The \u201cgun(s)\u201d related searches that pertained to law, politics/government, crime/violence, mass shootings, stigma, and mental health significantly increased in proportion the week after the event, \u03b2 = 0.22, t = 10.35, p < 0.001.\u201d p. 13\u201cSignificant differences in search volume were not found in the states where the shooting events occurred (relative to states in which the event did not occur); future investigations could instill more fine-grained approaches to inform the manners in which geography could interact with search volumes.\u201d p. 163. Looking at figure 1, I would argue that the increases in salience for mental health (thus increases in search volume) are occurring because mental health and issues surrounding it are becoming less stigmatized and more common in spaces where it simply was not discussed before. As a result, people may not have thought much about mental health issues before are now heading to their nearest computer and doing a quick Google search. In general, I think this paper has something to add to the conversations on gun violence and mental health attitudes. However, at present, there is more work to be done on this paper so it meets a higher evidentiary standard.The Reviewer offers a viable alternative explanation to the interpretation of our findings. The Reviewer suggests that it is possible that more searches are a result of less societal stigma against mental health and more open dialogs, and it is these conversations that are leading to increased searches. Although likely accounting for some of the findings, we feel that it is far more likely that our findings reflect response to mass shootings. Using the monthly data of search volumes for \u201cmental health\u201d over time, we ran analyses to see whether there would be an effect of shooting events while accounting for the effect of searches increasing over time. As expected and noted by the reviewer, there was an effect of time such that later months evidenced a larger volume of \u201cmental health\u201d searches, \u03b2 = 0.69, t = 10.01, p<0.001. However, we also observed a significant interaction of time by event, \u03b2 = 0.85, t = 4.17, p<0.001, such that accounting for the general increase in searches overtime, the observed increase in \u201cmental health\u201d searches was steeper during months in which shooting events occurred. These analyses suggest that mass shooting events could contribute to \u201cmental health\u201d search volumes, even when accounting for the general increase in \u201cmental health\u201d searches over time. Further, analyses presented in Reviewer 1 point 2 with regards to key term related searches show that \u201cmental health\u201d searches that pertained to law, politics/government, crime/violence, mass shootings, stigma, and guns significantly increased in proportion the week after shooting events. We would not have expected topics of related searches to increase in this manner if the effect of increased searches the week after events was accounted for by a general overall increase in mental health interest over the years . Nonetheless, we agree that the current investigation is preliminary, and many future studies will be needed to come to any definitive conclusions. To further address this point, we have also added to our Limitations section acknowledging that current results are preliminary, and further evidence is needed to strengthen the line of inquiry:\u201cAlthough our preliminary results suggest that greater numbers of searches after mass shootings, it is possible that in some circles inroads have been made to reduce stigma around mental health and that stigma reduction efforts have contributed to increased Google searching in an effort for people to learn more. More work at the individual level to understand what drives these searches would add an additional level of context and depth to this field of inquiry.\u201d p. 184. Very minor note: I find the use of past tense, passive voice distracting. I know several discipline-specific associations  now recommend using present tense, active voice. I think that would also help this paper. The manuscript underwent a critical read-through, and has been edited throughout to increase usage of active voice. Reviewer 21. You could exploit geographical variation. Media coverage and internet searches may be more intense in the state where the mass shooting took place. You could use state data to analyze whether searches of gun violence and mental health become more common in the state of the mass shooting right after the mass shooting with respect to other states. Technically, you could use something in the lines of a Difference-in-Difference estimation.We agree that this is an interesting and relevant question that we very much appreciated. As detailed in Reviewer 1 point 2, an interaction analysis was added to the new version of the manuscript. Although we agree that this was an idea worthy of pursuing, findings did not suggest a significant interaction of timepoint and the search occurring in-state/out of state. 2. In your methodology, you compare searches before and after the event. In order to take into account pre-existing trends in your current data, you could use something in the lines of an Event Study methodology. This is indeed a crucial consideration, and new analyses are detailed in Reviewer 1 points 2 and 3. 3. In the last section, you mention that the relationship between violence and mental health is a misconception. I think this constitutes an important justification for your research question. Hence, you could use it as part of your motivation in the introductory section. We appreciate the Reviewer\u2019s point and have edited the Introduction to highlight that the magnitude of the relation between mental health and violence is much smaller than is typically portrayed in the media. As a result of this point of emphasis, the Introduction now better motivates the rationale behind the study.\u201cStrikingly, there is strong evidence that media portrayals of topics related to mental health are likely to have an impact on individual attitudes toward mental illness [9-16]. For example, studies have found that increased depictions of untreated individuals diagnosed with mental illness can result in increased social distance from groups suffering from mental illness; this, in turn, has been found to lead to increased isolation of these individuals . Furthermore, stigmatizing attitudes toward mental illness have been linked to reduced support for policy supporting mental health [9].Understanding how public perception is impacted on an individual basis could thus be critical for gauging the societal effects of media coverage of mental health concerns. In the case of violence, it could be particularly impactful, given evidence that the link between violence and mental illness is reliable but often overestimated in magnitude [20], with population-wide studies having shown that only around 4% of violence in the U.S. can be attributed to individuals diagnosed with a psychiatric disorder [21].\u201d p. 4References1. Takeda F, Wakao T. Google search intensity and its relationship with returns and trading volume of Japanese stocks. Pacific-Basin Finance Journal. 2014;27:1-18.2. Ginsberg J, Mohebbi MH, Patel RS, Brammer L, Smolinski MS, Brilliant L. Detecting influenza epidemics using search engine query data. Nature. 2009;457(7232):1012.3. Stephens-Davidowitz S. The cost of racial animus on a black candidate: Evidence using Google search data. Journal of Public Economics. 2014;118:26-40.4. Kearney MS, Levine PB. Media influences on social outcomes: The impact of MTV's 16 and pregnant on teen childbearing. American Economic Review. 2015;105(12):3597-632.5. Mellon J. Where and when can we use Google Trends to measure issue salience? PS: Political Science & Politics. 2013;46(2):280-90.6. Mellon J. Internet search data and issue salience: The properties of Google Trends as a measure of issue salience. Journal of Elections, Public Opinion & Parties. 2014;24(1):45-72.7. Reilly S, Richey S, Taylor JB. Using Google search data for state politics research: An empirical validity test using roll-off data. State Politics & Policy Quarterly. 2012;12(2):146-59.8. Allison PD. Fixed effects regression models: SAGE publications; 2009.9. Barry CL, McGinty EE. Stigma and public support for parity and government spending on mental health: a 2013 national opinion survey. Psychiatric Services. 2014;65(10):1265-8.10. Barry CL, McGinty EE, Vernick JS, Webster DW. After Newtown\u2014public opinion on gun policy and mental illness. New England journal of medicine. 2013;368(12):1077-81.11. McGinty EE, Webster DW, Barry CL. Effects of news media messages about mass shootings on attitudes toward persons with serious mental illness and public support for gun control policies. American Journal of Psychiatry. 2013;170(5):494-501.12. Stuart H. Media portrayal of mental illness and its treatments. CNS drugs. 2006;20(2):99-106.13. Angermeyer MC, Matschinger H. The effect of violent attacks by schizophrenic persons on the attitude of the public towards the mentally ill. Social Science & Medicine. 1996;43(12):1721-8.14. Martin JK, Pescosolido BA, Tuch SA. Of fear and loathing: The role of'disturbing behavior,'labels, and causal attributions in shaping public attitudes toward people with mental illness. Journal of health and social behavior. 2000:208-23.15. Sieff E. Media frames of mental illnesses: The potential impact of negative frames. Journal of Mental Health. 2003;12(3):259-69.16. Thornton JA, Wahl OF. Impact of a newspaper article on attitudes toward mental illness. Journal of community psychology. 1996;24(1):17-25.17. McGinty EE, Goldman HH, Pescosolido B, Barry CL. Portraying mental illness and drug addiction as treatable health conditions: effects of a randomized experiment on stigma and discrimination. Social Science & Medicine. 2015;126:73-85.18. Lauber C, Nordt C, Falcato L, R\u00f6ssler W. Factors influencing social distance toward people with mental illness. Community mental health journal. 2004;40(3):265-74.19. Corrigan PW, Edwards AB, Green A, Diwan SL, Penn DL. Prejudice, social distance, and familiarity with mental illness. Schizophrenia bulletin. 2001;27(2):219-25.20. Glied S, Frank RG. Mental illness and violence: Lessons from the evidence. American journal of public health. 2014;104(2):e5-e6.21. Fazel S, Grann M. The population impact of severe mental illness on violent crime. American journal of psychiatry. 2006;163(8):1397-403.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 1 Jul 2020Using search engine data to gauge public interest in mental health, politics and violence in the context of mass shootingsPONE-D-20-02370R1Dear Dr. Vargas,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Luis M. Miller, Ph.D.Academic EditorPLOS ONEReviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0All of my concerns have been addressed. The authors explain their edits and thinking very clearly. I am persuaded by their arguments and think this paper is a contribution to several literatures.Reviewer #2:\u00a0I am overall satisfied with the authors' response to my comments. I just have one suggestion: it would be great if you wrote the equation you estimate in the paper.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0NoReviewer #2:\u00a0No"}
+{"text": "Pseudomonas aeruginosa rhamnolipid, and saponins from red and white quinoa varieties, on the enzymatic saccharification of steam-pretreated spruce were investigated. The used biosurfactants improved hydrolysis, and the best-performing one was escin, which led to cellulose conversions above 90%, decreased by around two-thirds lignin inhibition of Avicel hydrolysis, and improved hydrolysis of pretreated spruce by 24%. Red quinoa saponins (RQS) addition resulted in cellulose conversions above 80%, which was around 16% higher than without biosurfactants, and it was more effective than adding rhamnolipid or white quinoa saponins. Cellulose conversion improved with the increase in RQS addition up to 6 g/100 g biomass, but no significant changes were observed above that dosage. Although saponins are known to inhibit yeast growth, no inhibition of Saccharomyces cerevisiae fermentation of hydrolysates produced with RQS addition was detected. This study shows the potential of biosurfactants for enhancing the enzymatic hydrolysis of steam-pretreated softwood.The enzymatic hydrolysis of cellulose is inhibited by non-productive adsorption of cellulases to lignin, and that is particularly problematic with lignin-rich materials such as softwood. Although conventional surfactants alleviate non-productive adsorption, using biosurfactants in softwood hydrolysis has not been reported. In this study, the effects of four biosurfactants, namely horse-chestnut escin,  Picea abies), which is among the predominant tree species in Nordic forestry, and different varieties of pine, which is common both in boreal forests and in plantation forestry in the Southern Hemisphere. Softwood typically contains more lignin than hardwood or agricultural residues. The high lignin content greatly contributes to making softwood recalcitrant to bioconversion . Cellulase and \u03b2-glucosidase activities were determined by the filter paper method and the ectively . Microcrech wood .S. cerevisiae Ethanol Red  was used as the fermentative organism. Yeast precultures in Erlenmeyer flasks (100 mL) were obtained by cultivation in 25 mL of growth medium containing (in g/L) glucose (20), yeast extract (5), and Bacto Peptone (5). The cultivation was pursued for 16 h at 150 rpm and 28 \u00b0C in an Ecotron orbital incubator . The cells were separated by centrifugation at 9000 rpm and 20 \u00b0C for 10 min, washed with sterile deionized water, and then suspended in sodium chloride 0.9% (w/v) right before inoculation.w/w). The enzyme preparations Celluclast 1.5 L and Novozyme 188 were added at dosages corresponding to 15.4 FPU and 15.6 CBU per g cellulose. Rhamnolipid and escin were added at a ratio of 2 g per 100 g of Avicel  Avicel and 50 mg lignin were suspended in 50 mM citrate buffer (pH 5.0) in 2-mL Eppendorf tubes giving a final solids load of 5% DW (f Avicel . A referw/w). Saccharification reactions were performed using Celluclast 1.5 L and Novozyme 188 added in the same loadings and under the same conditions as described above (w/w); Glu, glucose mass in the hydrolysate, g; 1.111, coefficient considering water addition to anhydroglucose units during hydrolysis; CellPS, cellulose content in the pretreated solids, % (w/w); MassPS, mass of pretreated solids sample in the enzymatic hydrolysis assay, g.Five hundred mg (DW) pretreated solids were mixed with 50 mM citrate buffer (pH 5.0) in 15-mL Falcon tubes giving a final solids load of 5% DW (ed above . RL and w/w)) on cellulose conversion were evaluated using a Box\u2013Behnken factorial design  at different enzyme loadings  and loadings of pretreated solids  was evaluated in a study, where the other parameters were kept constant. The loads of solids and enzymes corresponded to the values of the central point of the above-described experiment.w/w), enzyme loading 7.5 FPU, and 7.5 CBU/g substrate, and RQS dosages of either 6, 8, or 10 g/100 g DW substrate. The hydrolysate was supplemented with the following nutrients (in g/L): yeast extract (5), NH4Cl (2), KH2PO4 (1), and MgSO4\u22197H2O (0.3). The synthetic medium contained (in g/L): glucose (20), yeast extract (5), and Bacto Peptone (5). The synthetic medium was supplemented with RQS in concentrations that were equivalent to the dosages used in the preparation of the hydrolysate medium. The pH of both media was adjusted to 5.0 with 10 M NaOH. The hydrolysate was filter-sterilized using Acrodisc syringe filters , while the synthetic medium was sterilized by autoclaving at 110 \u00b0C for 5 min. Eight mL of hydrolysate or 20 mL of synthetic medium in Erlenmeyer flasks were inoculated with 1 g/L of yeast cells, and the fermentations were carried out at 30 \u00b0C and 150 rpm for 72 h. Samples were taken after 4, 24, 48, and 72 h of fermentation. All fermentations were performed in triplicates.Fermentations of either the hydrolysate containing RQS added before enzymatic hydrolysis or synthetic medium with freshly added RQS were performed. The hydrolysate was produced using substrate loading 10% (2SO4 as mobile-phase (0.6 mL/min), was employed for separation. Saponin concentration was determined by a modification of the afrosimetric method [Q. saponaria bark saponins as calibration standard. The method is based on measuring the height of the foam column formed after successive shakings of a saponin suspension in 50 mM citrate buffer (pH 5.0) within two 15-min intervals. Total soluble protein was determined with the Bradford method using bovine serum albumin (BSA) as standard [The composition of the pretreated solids was analyzed by using two-step treatment with sulfuric acid according to the NREL protocol . The sugc method  using Q.standard . Non-adsOne-way analysis of variance (ANOVA) was applied for evaluating the statistical difference between the results of experiments with different biosurfactant dosages. After that, post hoc t-tests were performed to determine if the difference between specific dosages was statistically significant.https://www.ichemlabs.com/) was used for drawing chemical structures.The molecular editing software ChemDoodle 10.3.0 (S. cerevisiae. Red quinoa saponins deserve further attention as a saccharification enhancer due to their effectiveness, innocuity, low cost, and relative abundance as an agricultural by-product in quinoa-producing countries.The results of the current study showed that adding biosurfactants to enzymatic saccharification reactions reduces non-productive binding of cellulases to lignin and effectively enhances the hydrolytic conversion not only in artificial cellulose/lignin mixtures but also in steam-pretreated softwood. Saponins, both commercial escin and crude extracts from quinoa, were highly effective as enhancers of the enzymatic hydrolysis of cellulose contained in steam-pretreated spruce. Adding red quinoa saponins to the enzymatic hydrolysis of steam-pretreated spruce did not cause any inhibitory effects on the fermentation of the resulting hydrolysates using"}
+{"text": "In real-life situations, emotional information is often expressed through multiple sensory channels, with cross-talk between channels. Previous research has established that odor environments regulate the recognition of facial expressions. Therefore, this study combined event-related potentials (ERPs) with a facial emotion recognition task to investigate the effect of food odor context on the recognition of facial expressions and its time course. Fifty-four participants were asked to identify happy, fearful, and neutral faces in an odor context . Electroencephalography (EEG) was performed to extract event-related potentials (ERPs). Behaviorally, unpleasant food odors triggered faster recognition of facial expressions, especially fearful ones. ERP results found that in the early stage, unpleasant food odors within 80\u2013110 ms evoked a larger P100 amplitude than pleasant food odors and no odors, which showed that the unpleasant odor environment promoted the rapid processing of facial expressions. Next, the interaction between odor environment and facial expressions occurred during the middle stage, and the fearful expression evoked a smaller VPP  amplitude than the happy and neutral expressions when exposed to the unpleasant food odor environment. This result indicates that unpleasant odor environment consumed fewer cognitive resources when judging fearful expression, showing the promoting effect of mood coherence effect. These findings provided evidence for how people chose odor environments to facilitate the recognition of facial expressions, and highlighted the advantages of unpleasant food odors in communicating emotional information across the olfactory and visual pathways. For individuals with social attributes, emotional stimulation is one of the most important external signals. Emotion is a general and pervasive affective state , which iIn real-life situations, faces rarely are perceived as single entities and most likely appear within a situational context, which may have a strong impaction how they are perceived . PreviouThus previous research has established that emotional information affects visual processing through auditory channels. Olfactory channels can also transmit emotions, and their emotional information interacts with visual emotional information. Studies have shown that odors can be directly projected to emotion-related brain structures , which iThe studies described above focused on biological odors emitted by the body, which convey underlying information and are associated with the emotional state of the transmitter. Much less research has been done on environmental odors , which are the most common in life and affect the perceiver\u2019s visual perception of emotion. A few studies have shown that the arbitrary odor environment around people can affect the perception of facial expressions , b. SeubThe multi-sensory interaction of olfactory and visual channels is reflected in behavior, but the time-course and underlying mechanism for independent and dependent processing of the olfactory and visual emotional information remain poorly understood. Additional studies will be necessary to clarify the time-course and physiological mechanism of the interaction between olfactory and visual processing. We therefore used the three-stage theory of emotional processing  as the fTo sum up, existing studies have obtained behavioral and physiological evidence for the interaction of emotional information with that obtained through olfactory and visual channels. However, the conclusions drawn vary widely. The odor materials available focused on biological odors, and the negative face materials were mostly disgust expressions. However, some studies have shown that the context created by arbitrary surrounding odorants can affect the perception of facial expressions , b. MoreFifty-four participants  took part in the experiment. No subject reported any psychiatric or neurological disorder, nor did any subject report history of an acute nasal infection or allergy that might affect the sense of smell. All subjects had a normal sense of smell. All subjects were right-handed and had normal or corrected-to-normal visual acuity. All subjects were provided written informed consent and were compensated for their participation. The study was conducted according to the Declaration of Helsinki and approved by the ethics committee of the Shanghai University of Sport (102772019RT004).F = 2.642, p = 0.228, \u03b7p2 = 0.051]. Degree of arousal did not differ significantly among groups . Valence differed significantly among groups  (p < 0.001) and fear expressions (p < 0.001). Valence was greater for neutral expressions than for expressions of fear (p < 0.001). The mean identification rate reached >80%  were compiled by = 0.858] . Valencehed >80% . All imahed >80% . For thecis and trans, purchased from Sigma-Aldrich) was used as the pleasant food odor. Essential oil smelling of rotten fish  was used as the unpleasant food odor  and rotten fishy odor  differ significantly in terms of pleasantness (p < 0.001), but not in degree of arousal (p = 0.648). The degree of dilution was selected to achieve moderate odor intensity sufficient to ensure that the odor concentration remained relatively constant.We selected lemon odor, rotten fish odor and air odor as odor stimuli. Essential oil smelling of lemon . ERPs were recorded using a device manufactured by Brain Products (Germany). Electroencephalography (EEG) signals were collected using 64 conductive electrode caps positioned in accordance with the international 10\u201320 standard system. Silver/silver chloride electrodes were used. Horizontal and vertical EEGs were recorded. The horizontal EEG electrode was attached lateral to the right eye; the vertical EEG electrode was attached inferior to the left eye. EEG signals were digitalized at a sampling rate of 1000 Hz (band-pass filter: 0.05\u2013100 Hz). Electrode impedance was maintained below 10 k\u03a9. EEG data were analyzed with Brain-Vision Analyzer software.The experimental protocol had a factorial 3 \u00d7 3 mixed model design, with odor environment  as the between-subjects variable. The within-subject variable was facial expression . There are 19 people in the pleasant odor group , 17 people in the unpleasant odor group  and 18 people in the no odor group .All experiments were performed in the same laboratory, which had been properly ventilated prior to odor diffusing. And there was a time interval of at least 4 h between the end of one participant\u2019s test and the beginning of the next participant\u2019s test. During this time, the room was ventilated to ensure that the remaining odor from the previous test will not affect the subsequent experiment. Participants did not see the odor diffuser during the formal experiment.Participants were divided into three groups and randomly matched into different odor environments. At the beginning of the experiment, each participant was asked if they were aware of the odor in current environment through an instruction. And if they said they smell it, they would use a 7-point scale to rate the pleasantness, intensity, and arousal of the odor on a scale from 1 to 7, ranging from extremely unpleasant to extremely pleasant, from extremely weak to extremely strong, or from not at all arousing to extremely arousing.Participants sat comfortably in an armchair in front of a computer screen before pressing a button to begin the task. Each participant wore an electrode cap during ERP recording. Head movement was stabilized by a chin rest. The experimental task consisted of three blocks, and each block incorporated 60 trials, resulting in 180 trials in total. In every block, each face was randomly presented once, with a total of 60 faces. In the formal experiment, each face was repeated three times. Participants were shown a series of images of faces, one face at a time. Each facial stimulus indicated a fearful, happy, or neutral emotional state. During each trial, a centrally fixed plus sign was displayed on the screen for 500 ms. This presentation was followed by an empty screen, which remained for 400\u2013600 ms. A face was then displayed for 2000 ms . ParticiAfter completing the facial recognition tasks, subjects rated the odor in terms of pleasantness, intensity, and arousal with a 7-point scale. Before and after the facial recognition tasks, the subjects were asked to score the properties of the odor environment in order to compare their subjective feelings on the properties of the odor environment before and after the key pressing task, so as to ensure that there was no difference in the subjective feelings caused by the odor environment during the whole experiment.E-Prime 2.0 software was used to collect behavioral data, such as accuracy and reaction time for performance of a facial emotion recognition task in various odor environments. Data were imported into Excel for preprocessing. Data falling beyond three standard deviations of the mean were excluded. The SPSS 22.0  statistical software package was used to conduct two-way  repeated-measures analysis of variance (ANOVA). The scores of pleasantness, intensity, and arousal of three odor environments obtained before and after the experimental task were analyzed by the 3  \u00d7 2 (order: before and after) repeated-measures multivariate analysis of variance (MANOVA).The ERP data collected by Brain Product Recorder software were imported into Brain-Vision Analyzer 2.0 for offline processing and analysis. First, the data obtained with the reference electrode were converted. TP9 and TP10 were used as references to replace the original reference electrode (FCZ). Independent component analysis (ICA) was used to semi-automatically remove ocular artifacts. Next, we removed line noise with a 50 Hz notch filter. The data were filtered with a 30 Hz low-pass cutoff and a 0.5 Hz high-pass cutoff, respectively. Segmentation was performed according to the study protocol. With the target stimulus as the zero point, the time range for analysis was set to range from \u2212200 ms to +800 ms. A time window ranging from 200 to 0 ms before the stimulus was selected as the baseline for baseline correction. Data with amplitude greater than \u00b180 \u03bcV were automatically removed.P-value (two-tailed) < 0.05 was considered statistically significant. The Greenhouse\u2013Geisser method was used to correct p-values in the case of statistical significance that did not meet the Spherical test. The Bonferroni method was used to assess multiple comparisons.Inferential analyses were performed on mean amplitudes for distinct components that have been shown to be associated with the processing of facial expression e.g., . P100, NF = 155.476, p < 0.001, \u03b7p2 = 0.753]. Post hoc tests indicated that the pleasantness score of pleasant odor environment was greater than that of no odor environment (p < 0.001), and that of no odor environment was greater than that of unpleasant odor environment (p < 0.001). No main effect of order  was found, nor was there a significant interaction between order and odor environment . The results of intensity showed that none of the effects were significant. For the main effect of odor environment, F = 0.216, p = 0.806, \u03b7p2 < 0.01; for the main effect of order, F = 1.398, p = 0.240, \u03b7p2 < 0.05, and for the interaction, F = 0.144, p = 0.866, \u03b7p2 < 0.01. The results of arousal revealed no significant main effects of odor environment  or order , and no significant odor environment-order interaction . Accuracy was greater in an unpleasant odor environment, compared with a pleasant odor environment (p = 0.011) and a neutral odor environment (p = 0.029). There was no significant main effect of expression . The interaction between face and odor was not significant .We performed a 3 \u00d7 3 (odor \u00d7 expression) repeated-measures ANOVA to evaluate the accuracy of performance on facial emotion recognition tasks . The maiF = 4.027, p = 0.021, \u03b7p2 = 0.073]. Reaction time was shorter for happy faces, compared with neutral faces (p = 0.035). There was no significant difference between happy faces and fearful faces. The main effect of odor was significant . Reaction time was shorter for unpleasant odors, compared with pleasant odors (p = 0.006) and neutral odors (p = 0.003). The interaction between face and odor was significant . Simple effect analysis showed that, in an unpleasant odor environment, reaction time was faster for identification of fearful faces, compared with happy faces (p = 0.005). Reaction time was also faster for fearful faces, compared with neutral faces (p = 0.013).We performed a 3 \u00d7 3 (odor \u00d7 expression) repeated-measures ANOVA for reaction time on facial emotion recognition tasks . The maiA 3 \u00d7 3 repeated-measure ANOVA was performed to evaluate the mean amplitude of EEG components  induced by odors and facial expressions.F = 1.361, p = 0.260, \u03b7p2 = 0.026]. The main effect of odor was significant .The main effect of expression was not significant . The main effect of expression was not significant . The interaction between expression and odor was not significant .The main effect of odor did not reach statistical significance .The main effect of expression was significant , for the main effect of odor , or for the main effect of facial expression .None of the effects were significant for the interaction [This study aims to explore the influence of olfactory information on visual emotional perception, as well as the associated time course and underlying mechanism. We sought to determine whether olfactory emotional information, which is essential to our life and survival, can promote or inhibit our recognition of visual emotions, and to provide support for research on the multi-sensory crossover pattern. We obtained behavioral and physiological evidence that odor is a clue that can strongly affect human emotions. Odor not only causes the emotions conveyed by transmitters but also regulates people\u2019s visual emotional perception.The behavioral results of this study showed that the participants recognized fearful faces more quickly than other expressions when exposed to unpleasant odors. This finding was consistent with the findings of many studies. For example, in an odor environment that was consistent with the emotions expressed by a face , people recognized facial emotions faster and more accurately than they did under other odor-face conditions . Since hIn addition to this interaction between odor and facial expression, the behavioral results obtained also demonstrated an overall effect of odor on the processing of facial expression. Participants responded more quickly to faces in environments with unpleasant smells, regardless of the emotional content of the face. This finding was consistent with the view that emotional odors increase emotional arousal and thus affect overall performance , with unMeasurements of the VPP showed that happy and neutral faces produced larger VPP amplitudes than did fearful faces, starting 130 ms after the stimulus was administered. This result indicated that VPP component was more sensitive to happy and neutral faces in the middle stage of emotional information processing, reflecting the processing advantage of non-negative expressions. This finding was inconsistent with the results of a previous study, which demonstrated that the VPP component was more sensitive to negative emotional information . This coThe ERP results we observed showed that late LPP components did not adjust for facial expression. This was consistent with the results of The ERP results obtained demonstrated that the influence of odor environment on the processing of facial expression may be divided into two stages. During the first stage, odor has a nonspecific effect on the early stages (P100) of facial expression processing. In other words, regardless of the emotional content of a given facial expression, 80 to 110 ms after the appearance of a face, and unpleasant odor environment enhanced the overall recognition of facial expression, in comparison to an odor environment that was neutral or pleasant. This result was consistent with the findings of During the second stage, odor environment had a specific influence on the processing of facial expressions. This corresponded to the VPP during the middle stage of emotional processing : 130 ms In this study, the LPP component did not show any effect of odor. Examining this result in the context of previous research was complicated. Previous studies have shown that emotional odor had no effect on LPP . Other sThe odor environment was taken as an intergroup factor in our study. Each subject was randomly entered into an odor background, which controlled for the effect of learning across trials. Furthermore, we acknowledged that empirical ERP data did not allow researchers to draw accurate conclusions about the brain regions involved, and further research is needed to solve this problem. In future studies, besides making up for the shortcomings of the this study, functional magnetic resonance imaging technology may be used to explore cortical mechanisms, such as the connections between brain regions activated by specific combinations of stimuli. Not only that, different ages and cultures can influence people to make different behavioral and psychological reactions . Future In conclusion, both behavioral and physiological evidence suggested that food odor environment may regulate the recognition of facial expressions. Unpleasant food odor environment promoted the recognition of facial expressions and consumed fewer attention resources when judging fear expression, showing the promoting effect of mood coherence effect. Based on the ERP results obtained, the overall effect of odor environment on facial expression and the processing of facial expression appear to start during the early stage and middle stage of emotion recognition. First of all, exposure to an unpleasant odor within 80\u2013110 ms will enhance the recognition of facial expressions. Next, the VPP component during the middle stage showed that people will give more cognitive resources to pleasant and neutral faces, and the pre-processing of faces would be affected by odor environment, which began 130 ms after presentation of the face picture. At this point in processing, an unpleasant food odor symbolizing danger will enhance the perception of a fearful expression in response to danger. LPP did not show any effect of odor and facial expressions. The dynamic interaction between olfactory emotional information and facial expressions and the time-course of processing provide evidence for multi-sensory integration during processing. The highly adaptive response to unpleasant stimuli is evidence of olfactory-visual multimodal integration, which promotes appropriate behavior in the presence of danger.All datasets presented in this study are included in the article/The studies involving human participants were reviewed and approved by the ethics committee of the Shanghai University of Sport. The patients/participants provided their written informed consent to participate in this study.DL and XW conceived and designed the experiments, drafted and interpreted of the present study, and wrote the manuscript. DL and JJ performed the experiments and analyzed the data. All authors critically evaluated and revised the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "As a promising method to make digital STEM books in PDF accessible, a new assistive technology to convert inaccessible PDF into accessible digital books in some different-type formats are shown. E-born PDF is initially converted into text-based EPUB3, and then, it is converted into audio-embedded HTML5 with JavaScript (ChattyBook). In the conversion, various local languages can be chosen for reading out STEM contents. Although the PDF/UA standard is suggested as so-called \u201caccessible PDF\u201d, it is n\u00a0notation has been mainly treated. However, there are many dyslexic people in the print-disabled, who can read neither a Braille document nor texts in the\u00a0notation. A large number of the low vision or people who have lost their sight in not-younger days cannot, either.In most cases, when considering PDF accessibility, target disabled people are usually assumed as the blind, and the conversion of PDF into Braille or text files withAs a promising method to make digital STEM books in PDF accessible, here, we show a new assistive technology to convert inaccessible PDF into accessible digital books in some different-type formats. In the next section, we classify PDF into two categories, \u201cE-born PDF\u201d and \u201cimage PDF.\u201d In this paper, we give a new tool to convert E-born PDF into text-based EPUB3 (the latest release of an open-ebook-standard EPUB), and then, into audio-embedded HTML5 with JavaScript (\u201cChattyBook\u201d), so that the document content including math expressions is read out without a screen reader. In the conversion, various local languages can be chosen for reading out STEM contents., Adobe InDesign, etc. In those PDF, the information on each character/symbol such as its character code, font type, coordinates on a page is usually embedded. You can cut and paste text information from them. As far as a math expression is concerned, its structure cannot be maintained through cut-and-pasting, but actually, its accurate character information can be detected even in the math expression by making use of a PDF parser. Based on the information, we can analyze its structure without an OCR  process. We refer to such PDF as \u201cE-born PDF\u201d or simply, \u201cePDF\u201d.To make our task much clearer, we begin with discussing different types of PDF. Nowadays, a PDF file is commonly produced from a digital format such as a document in Microsoft Word,On the other hand, recently, image files are usually provided in PDF, which are made by scanning or copying. In principle, such PDF has no character information. Actually, many of them include not only images but also text information (a recognition result by OCR) in the background. However, it often includes a lot of recognition errors. Concerning a math part, you cannot use such background information to analyze the math structure since it usually consists of meaningless characters/symbols. We call them \u201cimage PDF\u201d.In some E-born PDF, to keep original layout in various display environment, characters/symbols are replaced with their scalable-vector (outline) images. In zooming-up, characters should be kept being fine, no matter how large they are magnified; however, the character information is not embedded in it. We call them \u201coutline PDF\u201d. Although they are actually E-born PDF, from the viewpoint of recognition processing, we classify them as a kind of image PDF.In this section, we discuss the conversion from E-born PDF into accessible EPUB3. There aThere are two types of accessible EPUB. One of them includes audio files of aloud-reading as media-overlay, and the other does not. We call them \u201caudio-embedded EPUB\u201d and \u201ctext-based EPUB,\u201d respectively.In Japan, \u201cthe Japanese Society for Rehabilitation of Persons with Disabilities\u201d has been providing print-disabled students with e-textbooks in multimedia DAISY  format, 4. TheyOn the other hand, a TTS engine seldom makes such mistakes in English-speaking countries, and text-based EPUB is mainstream. It is possible to adopt a workflow to produce text-based EPUB initially and then, to convert it into audio-embedded EPUB. Thus, as the first step, we have developed a tool to convert E-born PDF into text-based EPUB.As was pointed out, in E-born PDF, the structure of math formulas cannot be maintained through cut-and-pasting. However, even in their inside, the accurate information on each character/symbol such as its character code, font type, coordinates on a page is embedded.In the latest version of our OCR software for STEM, \u201cInftyReader\u201d, by makiOne of our remaining important tasks in STEM-document recognition is the segmentation of pages into figures/charts/diagrams/tables and main text areas (including math formulas). It is still difficult to realize the correct segmentation for a complicated-layout document. Analyzing the structure of tables including connected or multiple-line cells is also another remaining task. While simple tables are usually all right, InftyReader often fails at analyzing complicated-layout tables. Analyzing reading order of text areas is also difficult. As is well known, an order, in which text blocks are stored in the inside of PDF, is often different from the actual reading order. While analyzing the text order is not so difficult for a simple-layout PDF, recent school textbooks tend to have very complicated layout, and automatic text-order analysis is also a remaining important task.In the ICCHP conference, we will show a tentative method to treat those tasks effectively, for the present. We developed an interface for InftyReader to allow users to correct manually area segmentation and their attributes including the reading order before the EPUB conversion.Recently, multimedia DAISY is widely accepted as a standard of accessible e-books for various print-disabled people such as the blind, the dyslexic, etc. Accessible EPUB is essentially DAISY, Ver.4 that does not exist as a DAISY version. However, we must confess that there also remain some problems to deserve greater attention even now; that is, ordinary DAISY contents and players are not necessarily useful enough for the students with dyslexia. For instance, unlike visually disabled people, they usually do not use a screen reader, and a good TTS engine is not installed in their computers, either. Furthermore, their environment such as devices, OS, players, etc. is different from each other. You have to customize the DAISY contents frequently to meet each user\u2019s demands/environment.To make DAISY/accessible EPUB be more useful for all, we developed a Windows application named \u201cChattyBooks\u201d which converts DAISY/accessible-EPUB STEM content into audio-embedded HTML5 with JavaScript (ChattyBook). It consChattyBooks uses Microsoft Speech API, Ver.5 (SAPI5) as a TTS engine. If multiple SAPI5 voices are available, a user can choose any of them in the conversion. Even if the original accessible-EPUB is text-based, in ChattyBook, aloud-reading of the entire content including technical notations such as math expressions is embedded as mp3 audio files, and users can listen to it in a high-quality voice with text/math highlighting to aid their comprehension even if they do not have a good TTS engine for themselves. In addition, since it is just HTML5 with JavaScript, it can be played by any popular browsers. User need not to use any DAISY/EPUB player. Disabled users can access easily the contents with their own environment: Windows, Mac, iPad, iPhone, Android, Chrome book, etc.In the latest version of our accessible STEM-document editor, \u201cChattyInfty3,\u201d a new localization scheme has been compiled. It alloActually, several local-language groups/individuals have been working on developing their own language versions: Czech, French, German, Greek, Italian, Kannada, Spanish, Turkish and Vietnamese versions of ChattyInfty3, most of which have been done without our help. It shows that ChattyInfty3 is actually customizable for various local languages by making use of the localization scheme. We have recently improved InftyReader so that the localization scheme is also available in converting text-based EPUB into ChattyBook. Thus, if the necessary definition files were prepared, a user could produce an accessible STEM book in their own local language easily from E-born PDF.\u201cWhat way of aloud reading is appropriate to access math expressions\u201d depends on the user\u2019s characteristic; each one has their own needs. While there is no problem in reading out a simple math formula, concerning a complicated/long math expression, one should figure out what way is appropriate to make it easy to understand.In the conversion of text-based EPUB into ChattyBook, you can choose three types of aloud-reading for math formulas. \u201cPlain Reading\u201d is based on one which may be most widely used in English-speaking countries (the English version). It is natural, but a spoken mathematical expression is often ambiguous just only with speech. It is assumed that people with low vision and dyslexia use it. In \u201cSmooth Reading,\u201d minimum-necessary speech guides for blind users to grasp correctly the structure of a mathematical formula are added. \u201cDetailed Reading\u201d is assumed to be used when a blind user wants to know the mathematical-formula structure in the most detail.In addition, we have also implemented a function in the application to control a time interval between math symbols or poses before/after them to make math expressions become easier to understand. Using ChattyBook, we are now planning evaluation by various print-disabled people to see which way is better for them.The accessibility of school textbooks is probably most important in education. As was mentioned, in Japan, the Japanese Society for Rehabilitation of Persons with Disabilities has been providing print-disabled students with accessible e-textbooks in multimedia DAISY since 2008. They prHowever, concerning senior-high school or higher education, the number of textbook titles is too large, and the same service is almost impossible . Instead, we can expect that senior-high-school/university students could accept automatically produced textbooks in text-based EPUB. Even if a TTS engine would fail at reading out the content, they should be able to amend those errors mentally for themselves according to the context. If so, it might be possible for us to give a quick service of making a book accessible by automatically converting E-born PDF into text-based EPUB. To realize that, however, layout-analysis technologies should progress remarkably to treat complicated-layout textbooks. In Japan, the layout tends to become more and more complicated; a lot of icons, illustrations, balloons and others appear quite frequently even in high-school textbooks. The most promising approach to analyze such complicated-layout document is machine learning. To use the machine-learning technology effectively, we do need a large quantity of annotated data for the learning."}
+{"text": "There is an evidence gap about whether levels of engagement with public services such as schools and health care affect people across the lifespan. Data on missed patient appointments from a nationally representative sample of Scottish general practices (GP) (2013\u20132016) were probabilistically linked to secondary school pupil data. We tested whether school attendance, exclusions (2007\u20132011) or lower educational attainment (2007\u20132016) was associated with an increased risk of missing general practice appointments.School attendance data were classified into quartiles of possible days attended for years we had data. School exclusions were derived as a categorical variable of \u2018ever excluded\u2019. Attainment data were categorised via the Scottish Credit and Qualifications Framework (SCQF) level 3 or 6; a cumulative measure of attainment on leaving school. The associations between school attendance, exclusions and attainment and risk of missing medical appointments were investigated using negative binomial models, offset by number of GP appointments made and controlling for potential confounders.112,534 patients  had GP appointment and retrospective school attendance and exclusion data, and a subset of 66,967 also had attainment data available. Patients who had lower attendance, had been excluded from school or had lower educational attainment had an increased risk of missing GP appointments .This study provides the first evidence from a population-representative sample in a high-income country that increased numbers of missed appointments in health care are associated with reduced school attendance, higher levels of school exclusion and lower educational attainment. Insights into the epidemiology of missingness across public services can support future research, policy and practice that aim to improve healthcare, health outcomes and engagement in services. People can be missing from care at multiple times and in multiple settings across their life. However, little is known about how levels of engagement with public services such as schools and health care are intertwined. We know that poverty and socio-economic inequality are strong predictors of life chances and health outcomes \u20133. SchooHealth care systems themselves also play an important role in health outcomes \u20133. TheseHere, we test three hypotheses: (1) poor school attendance is predictive of poor health service attendance; (2) that being excluded from school is too; and  lower edData from Scotland allow these hypotheses to be tested because almost all of the population including children are registered with and receive health care from a GP practice. Scheduling appointments with a GP practice is under the control of patients (or their carers) whenever they seek care or are invited for a long-term conditions (LTC) review . GPs act as the gatekeeper for all secondary care services . Ninety-five percent of the Scottish population receive their school education in the public sector, with assessment overseen by a single examinations board. The GP data were collected by a National Health Service (NHS) approved Trusted Third Party using established data collection and data processing routes as described previously . The Scon = 824,374) of patient records from a nationally representative sample of Scottish general practices with codes extracted from clinically collected general practice data across Scotland over a 3-year period from September 2013 until September 2016. Requested data were extracted by the Trusted Third Party, anonymised and associated with a unique patient identifier in the National NHS Safehaven for analyses. Details of the data extraction are reported in previous publications [We used a large, retrospective sample n = 24,374 ofications , 11.zero missed appointments (0 over the 3 year period), low missed appointments (< 1 per year on average), medium missed appointments (1\u20132 per year on average) and high missed appointments (> 2 per year on average) [Patients were descriptively categorised into general practice (GP) attendance categories based on their average number of missed appointments over the three-year study period: average) . Categoraverage) , and subaverage) , health average)  and hospaverage) . HoweverPermissions were obtained to link GP data 2013\u20132016) to the annually recorded Scottish Pupil Census which are held by the Scottish Exchange of Educational Data (ScotXeD) and which record anonymised pupil level data from all Scottish local authority funded primary, secondary and special schools. School attendance and exclusions data were obtained from 2007 to 2011 and attainment data from 2007 to 2016. Linkage was conducted by the National Records Scotland (NRS) indexing team using established methods to match pupil identifiers probabilistically to the Community Health Index (CHI) database . Records to the aWe analysed data for all patients in our original GP data set for whom education data were available. Availability was largely age dependent as data could only be linked from 2007 onwards and a minority of patients did not undertake their education in Scotland. School attendance was analysed in quartiles of percentage of days attended at school over the whole study period, calculated from the mean of the ratio of actual attendances to possible attendances for each year to take account of children only attending school in some of the years. Exclusions were classified as a categorical variable of \u2018ever excluded\u2019 (yes or no).Attainment was recorded using the Scottish Credit and Qualifications Framework (SCQF) level 3 or 6. These are a cumulative measure of attainment derived on leaving school . SCQF leWe performed negative binomial regression modelling using attendance, exclusions and attainment variables as predictors to quantify their respective associations with the outcome variable, number of missed GP appointments. Rate ratios quantified the risk of missing GP appointments. All negative binomial models were adjusted for age, sex, Scottish Index of Multiple Deprivation (SIMD) and number of long-term health conditions. SIMD is the standard measure of socio-economic deprivation at the small area level (data zones) used in policy and research in Scotland. It includes measures relating to income, employment, education, health, access to services, crime and housing .Long-term conditions (LTC) were ascertained using patients\u2019 primary care Read codes (used by GP practices) to code health problems and prescribing data . LTC couThese models were offset for number of GP appointments scheduled in order to account for likely associations between numbers of scheduled and missed appointments.112,534/824,374 (14%) patients in the GP data set had school attendance and exclusions data and a smaller subset, 66,967 (8%) also had school-leaving attainment data available. Figure The demographic characteristics of this sample in relation to GP missed appointment classification are described in Table After processing , the finWe note that only 6% of the sample who had attainment data were aged 11\u201315 years, likely due to small numbers leaving school before age 16. Of the attainment data sample, 55% were female and socio-economic deprivation measures were evenly distributed. We observed that 41% of these patients had 1\u20133 long-term health conditions and 0.8% had four or more.After offsetting for number of GP appointments scheduled and adjusting for age, sex, SIMD and number of long-term health conditions, a single percentage of increased attendance (over the entire study period) reduces the chance of missing a GP appointment by 1% (95% CI 0.98\u20130.99).Given the skewed distribution, quartiles of attendance were used to illustrate the differences over a longer period of time in an educational setting. When analysed in this way, patients with the lowest level of school attendance were 49% more likely  to miss GP appointments compared with those in highest attendance quartile after adjusting for age, sex, SIMD, number of long-term conditions and number of GP appointments scheduled. This remained stable at RR 1.45 and 95% CI 1.40\u20131.50 and RR 1.47 and 95% CI 1.35\u20131.60 when comparing the highest attendance quartile with the third and second lowest quartiles respectively Fig. .Fig. 2APatients who had ever been excluded from school were also at increased risk of missing general practice appointments  after adjusting for age, sex, SIMD and number of long-term conditions.Compared to achieving SCQF 6, patients achieving SCQF3 when leaving school had 44%  increased risk of missing GP appointments after adjusting for age, sex, SIMD, number of long-term conditions and number of GP appointments scheduled.We have reported findings from a unique population-based dataset, linking general practice utilisation data with educational engagement and attainment. Poorer attendance at school was associated with high levels of missed GP appointments while being excluded from school was an equally strong predictor. Lower educational attainment on leaving school was also associated with a similarly increased risk of missing GP appointments.This study provides the first evidence from a population-representative sample in a high-income country that patterns of missingness in health care are also found in the school setting. School absenteeism, especially where attendance drops below 75%, may be predictive of future absenteeism in other settings. However, while missingness in health care is associated with lower educational attainment, the overlapping time intervals of the data mean any notion of causality should be treated with caution. The key interpretation of these results is that factors that influence or shape engagement in care for an important minority of patients are complex. Future interventions to reduce missingness in health care should be developed in a way that takes such complexity into account.In this study of 824,374 from patients across Scotland, 14% had school attendance data and 8% had attainment metrics available because data about attendance and attainment were only available for patients up to the age of 34. Therefore, our findings are restricted to younger patients, generally with low levels of morbidity. However, and more importantly, the data available was of a sufficient quality to be linked using probability matching (with an accuracy of 99%) whereby 95% of records were successfully matched .The role that the family may have in influencing health service and school engagement patterns and the complexity of what may underpin our findings cannot be inferred from the available data. Access to data that would allow us to link siblings and children to their parents was declined by the data permissions panel because our study methodology was considered exploratory. Further research could explore this from the perspective of health service, education and other services engagement that impact on the social determinants of health for individuals.Reviewing existing interventions to increase engagement in care across a range of sectors and translating these into novel settings is also worthy of further investigation. For example, electronic records, data sharing and risk identification may all have a role to play in identifying and responding to people who do not attend that are at high risk of adverse outcomes. Such approaches could be adopted both to develop interventions that reduce missingness in single sectors, such as primary care or school education, or across multiple social services.This study provides the first evidence from a population-representative sample in a high-income country that increased numbers of missed appointments in health care are associated with reduced school attendance, higher levels of school exclusion and lower educational attainment.Insights into the epidemiology of missingness across public services can help researchers, planners and those working within the health service when designing future research, policy and practice that aims to improve engagement with services. At the same time, recognising the complexity of factors underlying low engagement and the role that engagement has across multiple aspects of peoples\u2019 lives may be equally valuable when tackling health and associated social inequalities."}
+{"text": "Also, there was a significant difference between the length of stay (LOS) and the type of intervention , in which patients received a conservative type of management found to have a shorter length of stay (LOS) compared with the patients who underwent surgical intervention (p < 0.005). In Oman, the number of geriatric oncology cases remained stable over the 4 years. The incidence of geriatric neuro-oncology cases was higher in patients aged more than 75 years of age. Finally, the GCS score was affected by the type of tumor. The length of stay varies according to the treatment administered. Special care must be taken when dealing with geriatric neuro-oncological cases due to the high potential rate of mortality and morbidity among those group, and a more holistic approach is recommended as an essential need to evaluate the overall situation of those patients and manage them accordingly.Brain tumors are primary or metastatic malignancies of the central nervous system (CNS) with significant morbidity and mortality. The overall prevalence of cancer including brain cancer has increased by more than 10% according to the National Institute of cancer statistics. The average percent increase in primary brain tumor incidence for ages 75\u201379, 80\u201384, and 85 and older were 7%, 20.4%, and 23.4%, respectively. This manuscript describes a retrospective study of geriatric cases admitted to the Neurosurgical Department in Khoula Hospital (KH) and diagnosed with brain cancer from 1 January 2016 to 31 December 2019. Of the study cohort, 58.5% were more than 75 years of age. The male-to-female ratio was (1:1.1). Meningiomas are found to be the commonest tumor (52.8%) followed by glioblastoma (GBM) (18.9%). Most of the patients had a Glasgow coma scale (GCS) score of 14\u201315 on admission (69.9%). Patients diagnosed with a non-meningioma tumor had lower GCS score on admission compared to meningioma patients with statistical significance ( The most apparent explanation for the relationship between cancer and age is the time length of carcinogenesis . MoleculThis is a retrospective study conducted at KH located in Muscat, Sultanate of Oman. The study was approved by the Research Ethical Committee at Khoula Hospital/Ministry of Health . Medical records of 106 patients who are above the age of 65 and admitted to the neurosurgical ward and diagnosed with a brain tumor or brain malignancy, from the period of 1 January 2016 to 31 December 2019 were included. The study includes both Omani and non-Omani patients. Patients with the following features are excluded: non-elderly patient (below 65 years), patients diagnosed with a tumor before the age of 65, patients admitted to the neurosurgical department for reasons other than tumor or malignancy, outside the study period (from 1 January 2016 to 31 December 2019), and patients with missing or incomplete data.Data were obtained from the health information system  and included: patient demographics , presenting symptom, pre-operative medical conditions, post-operative complications, previous surgical history, preoperative and postoperative Glasgow coma scale (GCS), site of the tumor, type of tumor, radiological findings (magnetic resonance imaging (MRI), computed tomography (CT)) scans, indication for surgery, diagnosis, clinical outcome, length of hospital stay (LOS), length of intensive care unit admission, the treatment proposed. Data on treatment modality, including surgery or conservative, were collected. Then the information was classified into continuous and categorized variables and analyzed accordingly.p-value of \u22640.05 as the cut-off for significance. The numerical variables were summarized by their medians, means, and ranges, and the categorical variables were described by their counts and relative frequencies.The research database is analyzed and processed using the statistical package for the social sciences (SPSS) software (version 23). The categorized variables were cross-tabulated using frequency tables and pie charts or bar charts. Chi-square test was used to obtain the significance of the association between categorized variables, using a The male-to-female ratio was (1:1.1). Meningiomas were the most commonly found type of tumors (52.8%) followed by GBM (18.9%). Most of the patients were having a GCS score of 14\u201315 on admission (69.9%). 35.8% of the patients received antiepileptic medications, most commonly phenytoin, during hospitalization. The vast majority of the patients underwent surgical intervention (68.9%); 63.2% of the patients stayed in the hospital less than 15 days.p = 0.336). However, it illustrates a significant difference among GCS scale (above and below 8) among patients with different types of tumors (meningioma vs. non-meningioma) (p < 0.05).p = 0.939). Also, it demonstrates that there is a significant difference between LOS and the type of intervention . Patients with the conservative type of management were found to have a shorter LOS in the hospital compared with patients who underwent surgical intervention (p < 0.005).The incidence of CNS tumors increases with age, specifically, between the ages of 75 and 84. According to a study by Ramandeep S.Arora et al. the incidence of CNS tumor from the ages 25\u201384 is 14.57 per 100,000 person-years . MeningiThere were several limitations in this study. It was a retrospective, single-centered cross-sectional study over four years. Therefore, several confounding factors exist, such as the availability of diagnostic imaging facilities, advancement in modern medical technology, and improvement in the intensive care unit. Further studies in the future are recommended, keeping in mind the consideration of the current limitations. Follow-ups were not involved in this study.Aging is considered one of the major risk factors for brain tumors. Locally, no previous studies have investigated the prevalence of geriatric neuro-oncology. The commonest CNS tumor in KH was meningioma followed by GBM. The number of geriatric neuro-oncology cases remained stable over the four years. Finally, the GCS score was higher in meningioma patients. Furthermore, special care must be taken when dealing with geriatric neuro-oncological cases due to the high potential rate of mortality and morbidity among those group, and a more holistic approach is recommended as an essential need to evaluate the overall situation of those patients and manage them accordingly."}
+{"text": "Carers of people with frontotemporal dementia (FTD) experience greater challenges than carers of people with other dementias due to the younger age of onset and the challenging presentation of symptoms. The aim of the present study was to explore experiences of spousal carers of people with bvFTD, including those with the familial form of the disease (fFTD).Fourteen qualitative interviews were analysed using an inductive approach to Thematic Analysis to understand experiences of spousal carers of people with bvFTD including those with fFTD.Five main themes were identified including: a) The \u201cConstant Battle\u201d \u2013 A journey toward an FTD diagnosis, b) Shock, Relief and Fear \u2013 Challenges persist post diagnosis, c) The \u201cLife Altering\u201d impact \u2013 The loss of the spousal relationship and shifting roles, d) Adapting, Managing Symptoms and Receiving Carer Support, e) Lack of General Knowledge \u2013 Barriers to support.Healthcare professionals should be educated on the initial presentations of FTD, to enable carers and families receive timely diagnosis and appropriate support. Future research should investigate the impact of fFTD on carers and families, to explore positive or meaningful experiences in caring, as well as theory-driven research to identify helpful coping strategies for carers of people with FTD.The online version contains supplementary material available at 10.1186/s12877-022-02867-1. Frontotemporal dementia (FTD) is the second most common cause of dementia in people under the age of 65\u00a0years , and is C9orf72, MAPT and GRN  But it was it was so subtle, and it wasn't too odd.. All of the carers expressed having been through a challenging road to receiving a diagnosis for their spouses\u2019 bvFTD. Challenging stages along this journey included: noticing slow and subtle symptoms, misattributing symptoms to situational, psychological or relationship problems, and feeling isolated in the experience leading up to diagnosis. The excerpt below demonstrates the experience of noticing the initial symptoms of FTD as subtle and gradual changes in the personality and behaviour of her spouse.C14: Because when he first started behaving differently, I thought it was just a mid-life crisis or our marriage breaking down. So I was on the Internet, looking for \u2018mid-life crisis\u2019. When I thought he was just being difficult or awkward, and I'd ask him to do something, he wasn't listening when I was talking to him, and he wasn't taking my worries or concerns or feelings [into account]. Another carer outlined the process of trying to make sense of the initial changes she was observing with her husband\u2019s behaviour and attributing symptoms of aggression, impulsivity and loss of empathy to psychological or relationship difficulties in their marriage.C7: I felt like I was completely on my own in saying, \u201cit's not eccentricity. It's not him getting old. It's not stress\u201d[\u2026] So [before receiving the diagnosis] it was a constant battle with explaining for him what was going on. In an attempt to make sense of symptoms carers sought out information that could help them to understand their partner\u2019s unusual and at times distressing behavioural and personality changes. During this process, carers described feeling socially isolated when family, friends or professionals did not take concerns seriously.C7: He was diagnosed with bipolar, hypomanic, bipolar or something. [\u2026] See I'd Googled, as you do, and I thought he'd got Pick's disease. And I told the people at the memory clinic, \"I think it's this.\" And they said, \"It's not. He's passed his memory test.\" Barriers experienced in medical services included initial misdiagnoses of other physical or psychiatric conditions and various mental health conditions. Carers described feeling as though concerns were not taken seriously by medical professionals, and that they needed to \u201cbully\u201d (C2) or push for further testing to reach an appropriate diagnosis.C7 then recounted having to further justify seeking a new diagnosis by acquiring information about the condition to inform the dementia services clinic about FTD, and advocate for her spouse to receive further specialist diagnostic testing.C8: When he got the diagnosis, I wasn't happy, but I was relieved that I knew that there was something wrong with him and it wasn't my imagination. [\u2026] I kind of felt a bit naively, \"Oh, this will be all right. We'll deal with this. I'll just sit in front of the TV and he'll sit there quietly and we'll get on.\" But I didn't realize with this disease that he's got, it doesn't work like that. I didn't really know what was going to happen. Upon receipt of a FTD diagnosis, 12 carers reported experiencing mixed feelings of relief and fear about the future, and a continued sense of isolation, given the lack of support offered after receiving the diagnosis.C9: They have termed it, it's genetic and it's progressive. [\u2026] Everybody is slightly different. They've all got their own things, but they will get worse. It may become that he gets weaker or he may get violent [\u2026] I thought, \u2018oh this is going to be dreadful. I'm never going to cope with this.\u2019 After receiving the diagnosis, some carers described feeling a sense of relief that they now had a label that could explain their spouse\u2019s behaviour. Out of the 12 carers who spoke about their experience of receiving a diagnosis, all but one of the carers (C3) expressed having continued difficulty coping with the uncertainty regarding managing expectations of their spouse's future following diagnosis.C14: It's [not] like cancer. He had cancer... And when he was diagnosed with that he went in for a follow-up every three months. But with the FTD, he's never seen anybody since. And you are kind of left on your own. C14 expressed her surprise at the lack of resources received following diagnosis, by contrasting this with receiving a diagnosis of cancer,C7: The main challenge- it's- you go from a family unit with two parents and, you know, doing everything together, to a single parent, which is one thing. But then it's a single parent with a parent- because there's somebody there, but you've got responsibilities, plus you've got someone else to look out for. All 14 participants made reference to the many life-altering aspects of becoming a spousal carer for a person with bvFTD. Participants described having difficulty managing caring duties alongside increasing responsibilities in the household, shifting roles, addressing their family\u2019s future risk, and experiencing a deep sense of loss as a result of no longer feeling able to connect or communicate with their spouse.C1: I do get angry. It\u2019s lack of sleep really\u2026 With no sleep, with disruption in your sleep it\u2019s just very very hard... And I feel now that FTD has stolen my patience in a way, because of the situation. Carers additionally described the difficulties of managing responsibilities in the home and the emotional toll that their spouse's behavioural symptoms had on them. Eight carers described difficulties related to sleep as the most significant issue for them. Participants described feeling exhausted and having difficulties falling or staying asleep as a result of their spouse\u2019s inconsistent or interrupted sleeping behaviour. Carers described their own lack of sleep as the main contributor to frustration, lack of patience with their spouse and difficulty coping with caring responsibilities. Others reported that some of the care-recipients slept more than they used to, and this allowed them time for respite in the day, while one carer described oversleeping as an issue that interfered with her ability to share quality time with her spouse (C14).C3: If you think about it, you\u2019re managing somebody\u2019s life who\u2019s there with you, but you can\u2019t really have any discussion about it what-so-ever, because if you do, it\u2019s forgotten about in seconds and he doesn\u2019t understand the implications. [...] He doesn\u2019t have that emotional response really. So, there\u2019s no point discussing. One of the experiences described by spousal carers as the most difficult was the experience of loss, described by seven participants, who expressed having difficulty coming to terms with the reality that they could no longer connect or communicate with their spouse or life partner. This created a deep sense of loss (for example of empathy and memory), with carers likening it to losing a life partner along with their previously held hopes and expectations for their future together.C3: At first I felt really awful about almost taking over someone\u2019s life and saying what they could and couldn\u2019t do. But then I did it with children.... And I\u2019ve almost seen that I\u2019m doing that just to manage him now, because he can\u2019t make those decisions for himself. But of course he thinks he can, and that\u2019s always the problem..., I have to treat him, in a way, like he\u2019s a difficult child really. Four carers likened these difficulties in communicating and changing roles to that of caring for a child. However, they clarified this by stating that unlike children, their spouse had a diminishing capacity to learn and would become increasingly more dependent on them to meet their needs.C6: I have to be careful with her (my daughter), because she sees her dad and I know at the back of the mind she's looking at him and thinking, 'that could be me'. [\u2026] I don't tell her everything that he does, or I don't offload to her; I'm not going to because she's my baby and I want to make her better, and I can't. [\u2026] That's kind of hard. Carers of spouses diagnosed with the familial form of bvFTD (fFTD) described the impact of identifying a strong genetic link and the implications this holds for both the carer and the future of young family members. Carers expressed that they felt a deep sense of sadness, grief and fear when thinking about the genetic implications of the disease on their children, and feeling a sense of helplessness in their ability to support their children in the future, as exemplified in the excerpt below.C1: He (the consultant) thought I should tell my children right away, but I don\u2019t feel it\u2019s the right time at the moment. [...] They\u2019ve got a lot of stress in their lives at the moment, and I don\u2019t feel that\u2019s right. So I\u2019m holding onto that for a moment. [It\u2019s] difficult. Other carers of spouses with fFTD described the emotional challenge of coming to the decision to inform their families of the genetic link, trying to decide when their family would be \u2018ready\u2019 to receive news about their own risk of developing the disease.All carers in the study identified the importance of learning to adapt to the caring role, and trying to find ways of managing the challenging symptoms, particularly the behavioural symptoms of their spouse. Carers also expressed the value of receiving support to meet the specific needs of spousal carers of people with bvFTD.those who \u201chave it far more severely\u201d (C10), practising gratitude (C8 below), and implementing transferable skills from other caring roles they had previously occupied. Carers also expressed the helpfulness of planning for the future while also trying to focus on \u201cliving day to day\u201d (C12).C8: Now I realise that possessions don't mean anything [\u2026] You know, nobody, nothing can give you what you want back, which is your partner's health. So there's nothing out there that you need. So you then become just happy in your surroundings with what you've got, and just living that life now and making it the best for them that you can, .Eleven carers described the benefits of holding an adaptive and positive mind-set in coping with and adapting to the role of becoming a spousal carer. Carers expressed the usefulness of practising appreciation for the positive aspects of their life that were maintained despite the deteriorating illness of their spouse. Examples of ways that carers practised this positive perspective-taking included comparing their situation to a \u201cbubble of hope\u201d (C14) that came from participating in a trial treatment, which they believed might halt the deterioration of the illness for their spouse, or could offer hope for future generations.Carers of people with fFTD expressed C10: He was going to hang himself in the woods in the park [\u2026] And then [when we came back home] I wondered why he was nearly falling over. I realised it's because he was picking up alcohol and drinking [\u2026] And yes, I had to empty our house of alcohol and knives and everything. Behavioural symptoms described as challenging included lack of insight, apathy and compulsivity. These changes were described as confusing, sad, and difficult to manage in public or embarrassing at best. At their worst, they placed the person with bvFTD and others at increased risk of harm. Therefore, carers put in place strategies to manage challenging and risky behavioural symptoms. As C10 describes the experience of trying to manage these risks below:Other carers discussed applying other restrictions to reduce risk, which included withholding money to reduce the risk of being taken advantage of by others, or to reduce risk of compulsive spending (C3) or controlling access to food .C8: He started to dislike that son and then he started to dislike me. [\u2026] And then that was when the violence started. [\u2026] And I didn't let him in the house for a week. I just was so confused. I was so upset. [\u2026] He'd have this outburst and then a while later it was, we're all calm now [\u2026] And he never spoke about it. Other carers described a difficult experience of having to manage their spouses\u2019 risky behaviour toward others, including violence and aggression.C10: Here was that feeling of embarrassment for me as well, because he comes out and says odd things. And I don't like that. I'm a very quiet, private person, and things like this I find extremely hard. Yes, that's a bit hard- more than hard to accept. Another key difficulty for carers was managing their spouse\u2019s behavioural symptoms in public. Carers described needing to put a system of control in place, to monitor, supervise or limit their spouse\u2019s behaviour when in a public space as exemplified by C10 below.All of the carers acknowledged the value of acquiring knowledge about FTD, connecting with available resources to provide information, advice and carer support or respite. Thirteen carers described the value of obtaining information to educate themselves about the specific symptoms of bvFTD to help them manage expectations of disease progression, and provide helpful tips and resources to support them in their caring responsibilities. Carers did this by seeking out opportunities to learn about FTD from online sources, professionals and other carers.much more helpful\u201d than generic support, highlighting the necessity for services to accommodate for the specific needs of carers of people with FTD. These were understood to be different from those caring for people with more general forms of dementia. Six carers identified the importance and usefulness of accessing information and emotional support online.Eleven carers described the helpfulness of speaking with family, friends, other carers and professionals to gain an understanding of what to expect, and to normalise challenges faced in caring for a person with FTD. Others (e.g. C11) discussed that specialist FTD support was \u201cC1: I realised that being together 24/7 was a nightmare for both of us, and that I needed a break, but he needed a break away from me. [\u2026] I decided that I really wanted to go to [dementia charity choir] so I got a carer [\u2026] I go back to choir once a week, and a girl comes in to sit with him,Three participants expressed mixed feelings about the value of connecting with fellow FTD carers whilst acknowledging that there may be a time in the future when they would find attending carer support groups helpful. Whilst not all carers agreed on the value of using carer support groups, 13 carers identified carer respite as one of the most essential needs amongst spousal carers of people with FTD.Other carers described similar experiences of attending social activities run by dementia support charities, and described them as helpful in enabling them to continue to participate in activities and hobbies of interest while receiving support and respite from daily spousal caring. These connective spaces for carers provided an opportunity to spend time with others with a shared understanding of the carer\u2019s experience. For many, this formed an important part of the carer\u2019s social supportive network post-diagnosis.C10: I am grateful that I have got a lot of friends and people I knew, and the vast majority coming in now are people we know from the dementia cafes and charity things. .C8: I've used Admiral nurses [registered nurses who specialise in dementia]. I've used those quite a few times and they are lovely. They are so supportive and so understanding, because he's been very, very violent to my neighbours .Outside of informal social support and networking spaces, 10 carers highlighted the importance of attending medical follow-ups or receiving nursing support as a way of providing on-going support after diagnosis and during the care-recipients\u2019 lifespan.C1: We\u2019ve known for quite a long time, because his sister had it\u2026, Five of the nine participants caring for a spouse with fFTD expressed the value of having prior knowledge about dementia from their spouse\u2019s family. This knowledge, prior to diagnosis, was helpful in preparing them to manage expectations.The excerpts above highlight the needs of carers by identifying the ways in which they adapt to the new carer role, manage symptoms, and receive crucial support from healthcare services, specialist dementia support and FTD carer support spaces.However, despite carers being able to acknowledge key support that they found helpful, carers also identified significant barriers to accessing and receiving support necessary to help them in their roles as carers of a spouse with FTD. Twelve carers identified that the most significant barrier to receiving support was a lack of general knowledge about FTD, particularly amongst professional support services.C14: And with the support group for dementia, [husband] will walk in and he'll go, \"Yeah, I don't look anything like these people. For 12 carers this lack of awareness about FTD meant that carers often felt that there were limited resources suitable to meet their specific needs.C4: One of the problems I had when looking for respite for [husband] was that so many of the homes, you actually look and they all say, Oh yeah, we take people from the age of 65\u201d[\u2026] the thought of him at 55, being in a home where the next youngest person is 70. Carers commonly described the younger age of their partner and the unique presentation of FTD behavioural symptoms as barriers to receiving appropriate support,C6: I'm doing a course through the Alzheimer's Society [\u2026] There's no one else young and there's no one else with FTD. And it is becoming apparent over the weeks how different my situation is to their situation. For carers, advice and support received from more general dementia support often did not seem appropriate to meet their specific carer needs. C6 describes how she felt different, and unable to relate to others when attending a dementia carer support course.C4: Yeah, the thing is, I find support quite confusing [\u2026] I get to the stage where I ask, \u201cWell who are the people I see for this, and that?\u201d [\u2026] I am aware that there is a reasonable amount of support in [my area], but as I say, it\u2019s just knowing who to contact. Eight carers described having knowledge of an available service, but with barriers that interfered with their ability to access valuable services. Barriers included carers\u2019 lack of knowledge about available resources and limited available resources in their area.Carers experienced a general lack of awareness about FTD amongst healthcare services, which may be linked to their experience of having limited availability of specialist support to meet the unique needs of spousal carers of people with bvFTD.This is the first study to explore the experiences of spousal carers of people with bvFTD identifying support needs and barriers to meeting those needs. The findings highlight complex processes involved in receiving a diagnosis and adjusting to the role of spousal carer. This was impacted by the subtle onset of the condition, and further complicated by the challenging route to diagnosis and continued lack of support following diagnosis. Adjusting to the life altering, relationship changing and family impacts of becoming a carer to a person that is also a spouse was crucial in defining the spousal carer experience of bvFTD.and post-diagnostic stages on carers which echoes findings from Chow and colleagues [In line with previous literature  over hallleagues . This islleagues .Findings support existing literature emphasising that the receipt of diagnosis encompasses a difficult shift in the spousal relationship, which continues throughout the progression of FTD, and is characterised by a loss of communication, deep emotional connection, and companionship . These cNot previously reported in FTD carer literature this study explored the unique experiences of spousal carers of individuals with fFTD. This addressed the important implications of genetic disease on the family and included, issues surrounding testing and disclosure, parental feelings of helplessness regarding their ability to protect younger generations from developing FTD, and fearing for their family\u2019s future. Although carers described mixed feelings about testing and disclosure, they acknowledged that knowing about the condition prior to diagnosis was helpful in preparing to manage expectations of their future together, and facilitated a process of accepting the diagnosis and adjusting to the carer role. A systematic review by Crook et al. (2021) found that while no studies specifically assessed the experience of genetic testing in fFTD, the wider FTD literature suggests that the carers and relatives of those with FTD often carry the responsibilities of providing consent on behalf of the patient and notifying family of the test results .Carers developed ways of coping, some of which related to learning and implementing specific behavioural strategies, taking time for respite or shifting attitudes and perspectives towards their circumstances . For exaThe most important barrier reported by carers was the general lack of awareness about FTD, which impacts on diagnostic delays and support offered to carers. Participants expressed that they did not \u201cfit in\u201d amongst generic dementia support services, as they were insufficient in meeting the specific needs of spousal carers of people with bvFTD. Often due to younger age, familial and genetic implications and unique presentation of symptoms which dramatically impact on the spousal relationship and require specific behavioural and psychosocial coping skills on the part of the spousal carer. Therefore, findings emphasise a crucial need to educate healthcare professionals about FTD , and thenot a carer).The current study included more participants than other qualitative studies in the area of carer experiences of FTD , 20, andThe current study did not explore the impact on children living in the home during the early years of the disease, which may be of particular interest given that many carers report noticing symptoms up to twelve years before receiving a diagnosis, and acknowledge challenges in managing the responsibilities that come with a young family, alongside increasing responsibilities of caring. It will be important for research to further investigate the complex needs of young families with bvFTD, as well as explore the implications of the genetic condition on the family system.Guidance by the National Institute of Health and Care Excellence  recommenHealthcare professionals should be educated on the initial symptoms and presentations of FTD, so carers can address concerns, receive timely diagnosis and appropriate support. Families of people with FTD may benefit from receiving additional support in managing the genetic implications of the disease. Future research should investigate the needs of carers and families or people with fFTD, and would benefit from investigating positive or meaningful experiences in caring which may inform development of adaptive coping processes.Additional file1:\u00a0AppendixA.\u00a0Interview Schedule"}
+{"text": "Web-based mental health interventions offer a novel, accessible, and self-paced approach to care delivery to family carers . We coproduced COPe-support (Carers fOr People with Psychosis e-support), a psychoeducational intervention delivered via an enriched web-based learning environment with network support from professionals and peers. In addition to the rigorous investigation of the effectiveness of COPe-support on the well-being of carers and mental health outcomes, it is imperative to understand the experiences of using the web-based intervention by carers and its associated web-based implementation and facilitation strategies.This study aims to explore the experiences of carers and perceived acceptability of COPe-support and its different components, how carers found engagement with COPe-support affected their own well-being and caregiving, and the ideas of carers for improving COPe-support and its delivery to inform any future wider implementation.We conducted a qualitative study, individually interviewing 35 carers, following their use of COPe-support for 8 months through a web-based, randomized controlled trial across England. A semistructured guide with open-ended questions was used to explore the experiences of carers and perceived acceptability of the intervention and their ideas to improve the provision. All interviews were conducted remotely through mobile phones or internet communication media, audio recorded and transcribed verbatim. We used a thematic analysis framework to analyze the data.Three key themes were identified: remote, flexible, and personalized support; impacts on well-being and outlook on caregiving; and future implementation and integration with existing services. Overall, carers found COPe-support a flexible source of knowledge and support from professionals and peers that they could personalize to suit their own needs and convenience. Participants described gaining self-confidence, hope, and a sense of connectivity with others in a similar situation, which helped ameliorate isolation and perceived stigma. Most importantly, COPe-support promoted self-care among the carers themselves. Participants\u2019 experiences, use, and activity on COPe-support varied greatly and differed among carers of various ages and levels of computer literacy.Nearly all participants had a positive experience with COPe-support and supported its wider implementation as a beneficial adjunctive support resource for carers in the future. Any future scale-up of such an intervention needs to consider feedback from carers and suggestions for further improvement. These included having more graphics and audiovisual content materials, improving the navigation, and building in more interactional and customization options to suit various user styles, such as emoji reactions, live web-based chat, opting in and out of updates, and choosing the frequency of reminders. To ensure successful implementation, we should also consider factors pertinent to reaching more carers and integrating the web-based resources with other conventional services.International Standard Randomized Controlled Trial Number (ISRCTN) 89563420; https://www.isrctn.com/ISRCTN89563420RR2-10.1186/s12888-020-02528-w No face-to-face interviews were used, as all participants had joined the web-based trial of a web-based intervention, with no requirement for in-person contact. Author JS conducted all interviews. Informed written consent was obtained from each participant through the web-based study platform before the interview. At the beginning of each interview, we asked the participants to confirm their consent orally, including for the interview to be audio recorded. All interviews were audio recorded, apart from 3% (1/35) of the participants who opted for their interview recorded by written notes instead.The interviews followed a topic guide that was devised by the Project Reference Group members, including individuals with lived experiences of psychosis or caring for a loved one with psychosis, who had been involved in developing the intervention . In lineThe audio recordings were transcribed verbatim. Only transcribed anonymized textual materials were used for the analysis. The data were analyzed in 4 phases using thematic framework analysis , with thIn the first analysis phase, the authors  familiarized themselves with the data by rereading the transcripts and noting interesting aspects. In the second phase, 2 authors (S Gulshan and HS) coded all the data, and a third author (RB) coded 20% of the data independently. The data coded by the third author was selected based on user type and demographics, to ensure that all groups across the full sample were represented. Open (unrestricted) descriptive codes summarizing text segments were applied across the data set. The codes were discussed and reviewed by the authors through several iterations. In the third phase, initial themes and subthemes reflecting broad units of common ideas were formed by grouping relevant codes. These were compared by reviewing the entire data set as well as within individual cases. In the fourth and final phase, the authors  cross-referenced, discussed, and clearly defined the themes and subthemes and their interrelated links over several meetings. We used a combined inductive and deductive approach to coding and selecting themes throughout the analysis process . InitialThis study, as part of the overall RCT, was reviewed and approved by the South Central\u2014Oxford C Research Ethics Committee (reference: 18/SC/0104) and the Health Research Authority (reference: IRAS 240005). Before study participation, all participants were required to view and give consent on the web to the information provided in the participant information sheet.In total, 3 main themes were identified, with each theme divided into subthemes to comprehensively capture the phenomenon explored. The three main themes were as follows: (1) remote, flexible, and personalized support; (2) impacts on well-being and outlook on caregiving; and (3) future implementation and integration with existing services . A briefThis theme covered the experiences and perspectives of carers using COPe-support, with particular regard to navigation, safety, and usability. This theme incorporated 5 subthemes as follows.Carers mostly appreciated that they could choose and focus on specific content on COPe-support, suiting their own circumstances and needs. Several carers also valued the ability to choose their own pseudonyms. Although sharing a common caregiving role, carers recognized that they each have specific interests and needs based on their cared-for person\u2019s presentation, treatment, and a range of caregiving factors. For instance, for some carers, information and advice on getting through the benefits system could be a priority at the time, whereas others were after a summary of research evidence of a new treatment:Whereas the stuff from the website was quite helpful and we could tailor it to our own sort of thing. Yes, it was just nice.Aaron; male, partner, passive noncomplierSome carers discussed a preference for having a greater sense of independence and choice regarding communication in the forums. This included being able to opt in and out of updates and chose the frequency of reminders.Many carers appreciated the convenience of having the information and resources they needed in one place and being able to revisit information and access information at any time and place in day-to-day life. Carers particularly valued the flexibility of their use of COPe-support. This included having autonomy over their use and posting without having to adhere to engagement targets, as well as being able to pick out relevant information at their own pace. Several carers found revisiting and downloading the information for future reference particularly useful:Yes, I mean anything that was easier to download and keep for reference, I mean it\u2019s always good to have reference material.Ben_2; male, parent, active-moderate userCarers particularly appreciated having access to a range of professionals and found it fascinating to receive different perspectives from experts with various experiences and knowledge. Most carers also appreciated the convenience of expert knowledge on COPe-support. Several considered this novel and felt it addressed the lack of access to experts in existing services for loved ones. Carers valued the opportunity to ask specific questions at any time and received prompt and thought-out answers. A couple of carers noted that this was in contrast to their experiences of feeling rushed within appointments with professionals:I think looking back to seeing the doctors and the psychiatrists you feel a bit rushed and they haven\u2019t got time to think about it much but if it\u2019s sent as a question you feel someone has taken time to give you an in-depth answer.Abby; female, partner, active-high userBeing anonymous helped many carers feel more comfortable interacting on forums. Most carers felt that anonymity helped to protect the privacy of their loved one with psychosis and did not affect the community feel on COPe-support:Anonymization probably is quite important because if you are posing questions or comments about your experience as a carer, you inevitably have to talk about that person and they might not like you doing that.Maryam; female, parent, active-high userCarers particularly appreciated the ground rules  and forum moderation , providing reassurance that the forums comprised a safe environment. Some carers expressed appreciation and preference for professionals  over hypothetical carer moderation, providing the professional understood the needs of carers, to help increase the accuracy of information, dispel potentially misguided beliefs, and manage disagreements.Weekly emails tended to have a positive impact: carers felt they not only served as a reminder for the intervention but also that someone cared. Some carers described themselves as looking forward to or smiling at the emails. Overall, the carers shared a sense that COPe-support was safe and trustworthy, as reflected in the following:It\u2019s having a trusted site to look at and knowing that if you put anything on it it\u2019s a safe place.Abbie; female, parent, active-moderate userMixed experiences were shared regarding the usability of the COPe-support. Some carers felt confident owing to good computer literacy or previous experience with similar platforms, whereas others described barriers, such as age and poor computer literacy. Carers appreciated accessing COPe-support on different devices , with some finding devices with larger screens easier to navigate. Most carers described an adjustment period during which they initially struggled with navigating the interventions but adjusted and grew in confidence over time:I did start to get a bit more used to [navigating] after a while but to begin with I did find it complicated.Summer_1; female, parent, active-high userpowerful . A couple of active users were unaware of being particularly active and felt unsure of how many people read their posts. Most passive users were aware that they had not posted and found reading what others had to say useful and knowing the forums were there if needed comforting in itself:Many carers expressed awareness of different user types on COPe-support. Carers tended to distinguish between enthusiastic (active) users whose names frequently appeared within forums and other (passive) users who tended to observe. Some active users reported focusing on the peer and expert forums and felt these aspects in themselves made COPe-support I guess there are some people who are going to be very active on there and discuss things a lot and then there are going to be people who are very quiet on there...It doesn\u2019t mean to say that they\u2019re not taking it all in and getting something from it...I also regret slightly now that I wasn\u2019t a bit more active at the same time.Summer_2; female, parent, passive-moderate userThree subthemes represented the impacts on well-being and outlook on caregiving experienced from participating in COPe-support.Many caregivers felt that COPe-support provided comprehensive, relevant, and helpful information across various important topics. New carers found the information especially suitable for their first time learning about psychosis. For others with existing knowledge, the information supplemented the resources they had previously accessed. Although some felt COPe-support had enhanced their knowledge and skills enough to not require further support, others appreciated the signposting to other sources and local and national services to further support their loved ones:I\u2019ve got 99% certain I will either get signposted in the right direction or find what I want rather than Googling and going through different websites and trying to find the same information.Faye; female, parent, passive-moderate userSome carers felt that the information was quite generic, outdated, and repetitive. Moreover, some newer carers initially found the amount of information overwhelming, although they reported adjusting and learning over time:It\u2019s also a strength is the fact that once you are in the program you realize just how comprehensive and detailed it actually is and that this could be a bit daunting initially for people signing up.Eleanor; female, friend, active-high userMost carers felt that the tone of the experts was just right: not pressurizing or patronizing, yet empathetic, respectful, and comforting. Understandable language  was also used to explain complex information in an understandable way. However, several carers felt that the answers were sometimes generic or vague, although they appreciated that the experts were not aware of the full situation of their loved ones and still found the suggestions helpful. The information provided and knowledge gained subsequently empowered them to seek further conversations with mental health professionals caring for loved ones, as expressed by a participant:They\u2019ve not been able to provide really specific answers sometimes because obviously they don\u2019t know our situation but the fact of it is they\u2019ve been able to signpost or suggest something that you maybe hadn\u2019t thought of.Alexandra_3; female, parent, active-moderate userSome carers discussed the lack of preparation for caring roles and the ongoing self-doubt surrounding doing the right thing or supporting their loved one in a helpful way. These carers felt by gaining information, resources, and knowledge on COPe-support had better equipped them and also improved their self-confidence in their ability as carers:I\u2019m sure it\u2019s given me more confidence as a carer because I\u2019ve got more information and that also becomes a part of how I care for my daughter and talk to the family and others as well.Maryam; female, parent, active-high userOne significant benefit identified was a sense of belonging to a supportive peer community, without ever seeing or knowing one another. Many carers discussed feelings of loneliness and isolation experienced by them. Reading the resources and forums showed carers that others were experiencing similar and relatable difficulties, helping them feel less alienated, isolated, and detached:Sometimes when you are a carer you think you are alone. When you go to these groups or you do these things, you realise you are not. It makes a difference.Anna; female, parent, passive noncomplierCarers also reported feeling more connected and having a sense of solidarity and unity with others to proceed on the caring journey. Carers valued having a sense of community, group alliance, and connection, which naturally arose from sharing similar experiences and challenges and feeling mutually understood, something they often lacked in their own lives. This was made explicit by the following:Being able to see that people are getting some support and that it normalizes the issues that we don\u2019t talk about.Abbie; female, parent, active-moderate userMost carers valued being linked with other carers, especially new carers who felt shell-shocked and craved speaking to others in a nonjudgmental environment. Many carers appreciated the opportunity to learn from peers, including practical tips, advice, and awareness of differing carer experiences. Some also valued the opportunity to help other carers and the positive feelings that came with that:But in the main I found the whole thing quite helpful especially for the first month or so when I could see or read about everyone else\u2019s problems and some were similar to mine and some of the advice they gave if you know what I mean.Ben_1; male, parent, active-high userIn addition to creating a community and reducing loneliness, many carers noted that reading posts from other carers also helped normalize and validate their feelings and experiences. The intervention content and forums also helped to normalize concerns, fears, and often stigmatized psychosis-related topics that carers often found difficult to talk to people in their personal lives about. Such normalization and validation subsequently helped carers feel less overwhelmed:Yes, I think I found it really helpful as well because some of the ways that it was designed with the different subjects helped as well to make me think oh yes well this experience I\u2019m having is normal, which is like there was, how it was set up the program it had stigma.Eleanor; female, friend, active-high userlight, led to a feeling of hope:Some carers felt that the expert and peer support forums provided hope, particularly in instances where carers were able to provide lived accounts and reassurance of particular aspects and situations improving over time. Some carers especially valued reminders that their loved one is still their loved one and reflected that kind words provided In some respects, it made me feel a bit better because other people are going through not completely the same as me but very similar as me and they\u2019ve managed to get through it, etc.John; male, partner, passive-moderate userCarers recognized that the COPe-support was specifically designed for them. Some carers discussed how COPe-support not only provided support for the well-being of their loved ones but also their own. This included recognizing the importance of supporting their own needs, focusing on self-care, and fostering healthier routines, such as improving their diet, fitness, and sleep hygiene:It was just really, really helpful to learn how I can manage my well-being in terms of trying to support myself in terms of trying to help the person I\u2019m caring for...like I said it has made a really big difference to my well-being and my partner\u2019s well-being and it has been a lifeline.Edward; male, partner, passive moderate userI have actually changed my eating this last few months as a direct result of the site, so that\u2019s quite something.Alexandra_3; female, parent, active-moderate userEven the concept that COPe-support had been designed specifically for carers helped carers recognize their support needs were valid and acknowledged, reducing guilt associated with personal help-seeking. Some carers described how COPe-support had provided personal space and time to reflect on their personal journey as carers, get more in touch with their emotions, and listen to the reflections of others:Even just using the questionnaires at times were good for me because it made me sit and focus a little bit on where things were at...and actually think about how I was feeling.Alexandra_1; female, parent, passive noncomplierThe following subthemes reflect the perspectives of carers surrounding the future implementation of COPe-support and integration with existing services. This includes suggested improvements for COPe-support.Compared with face-to-face support for carers, the perspectives of COPe-support were mixed. Although some expressed a preference for traditional means of delivery, others preferred web-based platforms and ideally a blended approach. Barriers to face-to-face support, including geographic factors, family life, funding and time constraints, and the benefits of web-based delivery in minimizing these barriers were discussed by some carers. Other carers considered barriers to web-based interventions, including age and a desire to personally meet carers and be able to sit with others going through similar situations. This is expressed as follows:And I think that e-support is definitely a very, very useful, well it\u2019s a very good use of technology for people who have computers or phones and have the confidence to access stuff. You can\u2019t beat that one-to-one when you need it, you can\u2019t beat that.Faye; female, parent, passive-moderate useronly be a benefit. Some carers highlighted that participating in COPe-support addressed their concerns surrounding interventions for carers and motivated use of other services, such as face-to-face groups and courses for carers. Although some felt the support they had received through COPe-support was sufficient for their needs, others emphasized that COPe-support should serve as an adjunct to existing services rather than a replacement:Several carers commented that, given the funding restrictions on existing services, implementing COPe-support could It also encouraged me to join a carers and coping course...I think it\u2019s made me question why I would find it so hard...to sit in a group with other people and hear about what\u2019s been happening to them, so yes I\u2019m definitely looking forward to going to a six-week course at the end of this month.Summer_2; female, parent, passive-moderate userPerspectives on the length of time to access COPe-support were mixed. Some felt they had received access for just the right amount of time to remain engaged and gain optimal benefits as a carer. However, some desired a longer use time. Several carers highlighted that as caring can be a long and complex journey, it would be reassuring to be able to revisit information and know they would be able to use it and have instant access to support in the future if new challenges arise :People have different periods of crisis. You would not want to have the sense of support suddenly be taken away.Martin; male, parent, passive-moderate userTo allow for continuous access to carers\u2019 needs, some suggested being able to self-refer back into the intervention if necessary or have continual access and be able to opt out when they felt they had used it enough:It was very good, too good; hence I asked if I can enroll again...it was a lifeline for me...COPe-support came along and gave me all the help and support I\u2019ve ever wanted.Summer_1; female, parent, active-moderate userby chance and emphasized a need for greater advertisement to reach more carers if it was to be rolled out widely in the future. Several advertising and promotion routes have been suggested, including local authorities and social services, charities, general physician surgeries, existing services for carers and trust websites, noticeboards, and newsletters. Awareness among health and social care professionals was also noted as important, with potential screening for the well-being of carers and onward signposting to COPe-support recommended. Suggestions for ways to reach carers include the following:Some carers reflected on coming across COPe-support When you roll it out into various Trusts and it goes further that\u2019s where it needs to be as well. There are a number of options there.Mark; male, parent, passive noncomplierThey always ask at the GP surgery when you register or every so often they\u2019ll say are you caring for anyone and it could be quite helpful to maybe signpost it at that point.Aaron; male, partner, passive noncompliertoo much on the screen sometimes). To reduce confusion, fewer chunks of text and more graphics and visual aids or see more dropdown options were recommended:Many carers have proposed improvements for COPe-support. Some were about the way information was presented, which some found, at times, overwhelming and off-putting . Hence, a couple of carers recommended brief profiles with basic, yet nonidentifying, information  to provide advice and support, as well as seeking relatable content. However, when certain forum topics received a good number of posts, one common problem that arose was having to go forward and backward among pages and scrolling excessively to see forum comments. This was described by an active user as follows:I remember the format of the message threads when you had five or six interactions or replies on the same thread it becomes almost impossible to read on the phone because you have to scroll down and the indentation starts going to the right.Tony; male, partner, active-high userfrequently viewed and recently viewed buttons were recommended by some carers. Some would also like to be able to choose which posts on the forum to expand. Most found the instructions for navigating COPe-support clear, although some would have appreciated an opt-in for 1:1 guidance.Hence, for navigating the forums and the COPe-support content overall, Finally, to encourage engagement, some carers noted that they would have appreciated some additional prompting after periods of inactivity. Several passive users regretted not using the forums more and reported barriers to posting, including their busyness, mental state, difficulties expressing their feelings, worries surrounding sharing with unknown people, and experiencing hesitation and self-doubt. Some carers suggested having rolling discussion topics and implementing alternative options  to facilitate forum engagement:If that [thumbs up or other emojis for acknowledgement] feature had been available and I\u2019d seen a couple of thumbs up to the things I\u2019d posted I think that would have been great...And maybe that\u2019s a stepping stone as well they start by just a few reactions, emoji reactions and then it\u2019s small steps. They can do that the first time and then maybe the next time they will write a few words.Felix; male, stepparent, active-moderate userThis study aimed to explore the following: (1) carers' experiences and perceived acceptability of COpe-support and its different components; (2) how they found engagement with COPe-support affected their own well-being and caregiving; and (3) ideas of carers for improving COPe-support and its delivery to inform any future wider implementation. Notably, this qualitative study is one of the first to explore the experiences of carers of individuals with psychosis by using an entirely web-based psychoeducation and peer support intervention, coproduced by carers and people with experiential expertise. Experiences of participants were predominantly positive with COPe-support, and carers identified a range of benefits from using the intervention. Nonetheless, the carers highlighted some key areas of improvement. Overall, three themes were identified, each addressing one of the objectives of the study as follows: (1) remote, flexible, and personalized support; (2) impacts on well-being and outlook on caregiving; and (3) future implementation and integration with existing services.Overall, the subjective experiences of COPe-support among carers were positive. In addition to the web-based gains provided by COPe-support, such as improved accessibility, flexibility, and anonymity, participants also reported that the intervention was beneficial in providing access to a rich repertoire of credible information ,11,12 anNotably, our themes and subthemes should be recognized as a set of interconnected and interacting constructs to be considered in the overall design  and facilitation  of web-based interventions, such as COPe-support . For insMoreover, similar to earlier studies on web-based interventions with a forum component -23,33, wThe experience of participants seemed partly dependent on factors, such as their own demographic profile  and preferences for particular delivery formats and computer literacy as highlighted in previous studies ,26,40,41In any future rollout of COPe-support, it is imperative to consider the revision and refinement of the content as much as the facilitation of the minimally guided web-based intervention holistically to keep the participants engaged, to induce the anticipated impact . FurtherWe considered the sample of 35 carers interviewed for this study as a strength, as this contributed to a wide variation in user experience and use from carers with different relationships with individuals with psychosis and in different caregiving situations. Having multiple researchers to independently code and analyze the rich data led to unanimous results and increased the rigor and reflexivity of the study ,42. The This study had several limitations. Although we aimed to interview carers after completion of outcome data collection at 8 months, some carers had stopped using COPe-support earlier than the study duration and hence found it difficult to recall their experience with the intervention in detail. Although we strived to invite participants with low use and those from ethnic minority backgrounds for the interviews, such populations remained underrepresented  ,44. Our Overall, this qualitative interview study captured the experiences of carers of using the web-based intervention COPe-support. The variation in responses among active and passive users captured the carer\u2019s perception of COPe-support. Notably, support and engagement with peers and experts were appreciated for meeting and validating the needs of carers, and the importance of usability ease, personalization, convenience, and safety were discussed. Further work is required to develop COPe-support based on these suggestions and explore the steps for optimal implementation."}
+{"text": "Apathy, defined as a lack of motivation, is a prevalent and persistent behavioural and psychological symptom of dementia. Limited research suggests that apathy is associated with increased carer burden, but there are no studies investigating carers\u2019 subjective experiences of apathy. This study aimed to fill this gap and explore the lived experience of apathy in dementia from the perspectives of the people with dementia and their carers. This article reports on the carers\u2019 perspectives. Six dyads of people with dementia and carers participated in semi-structured interviews, which were analysed using interpretative phenomenological analysis. Three superordinate themes were identified: (1) achieving a balance of conflicting emotions\u2014the challenges of apathy led to feelings of guilt, acceptance, and frustration; (2) new roles imposed by caring, which involved taking on new responsibilities and promoting remaining interests of person with dementia; and (3) having a life of one\u2019s own\u2014coping with apathy by talking to others, and spending time away from the caring role. This study highlighted that carers are caught in a struggle between wanting to involve the person with dementia in decisions and finding that they cannot if they want to overcome the hurdle of apathy. Implications of this study suggest that a wider understanding of apathy at a societal level could lead to the provision of a helpful forum for carers to share their experiences. Apathy is characterised as a lack of motivation and decline of goal-directed behaviour compared to prior functioning . Within Traditionally, apathy is considered the result of neurodegenerative disorder  and disePrevious research into apathy in neurological conditions has taken a quantitative and neurobiological approach. There are benefits to this, such as the development of pharmacological therapies , but theThis article reports an interpretative phenomenological analysis (IPA) of accounts of carers on their understanding of apathy in the person they care for, and the impact of apathy on both of them. Being mindful that most studies exploring the lived experience in dementia have involved proxy interviews with carers to access the experience of the person with dementia , this stA qualitative IPA approach was used. This approach emphasises how psychological meanings can be pursued through detailed examination of the lived experience  to exploThe overall study aimed to recruit 12 participants, 6 people with dementia and 6 carers. The analytic approach uses IPA; thus, \u201cless is more\u201d , where tParticipants were recruited through engagement with local community dementia support groups, where a member of the research team spoke to group members about the study and invited interested people with dementia and carers to discuss further participation. Individuals who cared for a person with a diagnosis of dementia and were able to talk about their lived experience in English were eligible to participate. There were no restrictions on the type of dementia that the person with dementia had, the relationship between the carer and the person with dementia, or whether the carer or person with dementia explicitly self-identified as experiencing apathy.In-depth, semi-structured interviews were used. An interview schedule guided the interview, with prompts regarding the subjective interpretation of apathy, impact of behaviour, habits, hobbies, relationships, mood, and activities in daily living. Interviews with carers and with people with dementia were conducted simultaneously in separate rooms by J.Y. and W.B., respectively. Separating the interviews enabled both people with dementia and carers to speak candidly about their experiences, and avoid the other person intervening ,27. InteInterviews were analysed using IPA guidelines , focusinEach transcript was analysed individually, enabling the researcher to be open to new themes from each participant. After this process was completed for each transcript, a list of codes was collated to identify connections across the transcripts. Patterns in the codes across participants were explored, including commonalities and nuances within and between participants\u2019 data to identify superordinate and subordinate themes. Themes were refined through discussing, confirming, and challenging the content of the themes by the research team.listless, about not having too much interest in things\u201d, or a \u201clack of involvement or lack of enthusiasm to do something\u2026 lack of motivation\u201d. Carers drew upon particular examples to highlight how the person with dementia\u2019s apathy crept into the everyday experience; for example, by no longer having a preference over what to eat, or not motivating themselves to eat without prompting, and neglect of personal hygiene: \u201che just won\u2019t go in the shower or a bath\u201d. There were various interpretations from the carers about what caused the apathy; for example, Carer 4 felt that her spouse was apathetic towards making choices because he simply could not \u201cbe bothered to think\u201d and preferred someone else to make the effort to decide things on his behalf. Carer 3 recognised that her spouse \u201cprocrastinates when there is a change\u201d, suggesting that new activities where the comfort of routine to guide the person with dementia could not be relied upon, and therefore the actions came to a stop. Carer 5 reflected that her spouse \u201cdidn\u2019t want confrontation\u201d and therefore preferred not to tackle particular tasks, especially administrative responsibilities. Participants in this study acknowledged that the apathy had changed the person they care for, and continued to explore the impact that it had on them.The six carers were all spouses, one male and five females, and were all White British, with a mean age of 69.3 years (range 59\u201384). The analysis identified three superordinate themes: (1) balancing conflicting emotions; (2) new roles imposed by caring; and (3) having a life of one\u2019s own. The carers all recognised apathy in the person they cared for and described it as \u201cThe experience of apathy in the person with dementia created conflicting emotions for carers, because they had to negotiate between effectively tricking the person with dementia into a course of action, or allowing the apathy to persist, which was detrimental for both the person with dementia and the carer. Embarking on activities and outings enabled carers to maintain their support of the person with dementia through challenges and manage feelings of frustration regarding behavioural changes. Carers described strategies to manage apathy, which typically involved an element of deception and for which they felt guilty. Carers seemed caught between a rock and a hard place, where if they were open with the person with dementia about a potential course of action they would be refused, and no action would take place. If they deceived them, or were economical with the truth, they would both be able to enjoy and engage in activities, but this led to a feeling of guilt. Although carers felt strongly that the ends justified the means to create engaging opportunities for their spouses, the means created difficult emotional feelings. This was further complicated by a desire to include their spouses in decisions in the same way that they had throughout their lives together. Being able to accept the lack of involvement, or to ignore disinterest and refusals, required a sense of endurance. Negotiating this path was typically quite lonely for the carers, because their spouses often lacked insight regarding their apathy, or dementia more generally, and were unaware of the frustration that carers felt.Carer 2 explained that she found it easier to withhold information from her spouse to initiate activities or trips out that he would enjoy in order to avoid opportunities for him to decline, taking an approach where the ends justify the means even though it made her feel guilty. If he were unaware of the details, he would not question or feel concerned about the activity.\u201cAnd these days I tend not to tell him too much when we go somewhere, I find he enjoys it\u2026 I know if I asked him he would say no, I am not bothered.\u201da protection for him\u201d to ensure that he still engaged in activities. Being able to go out and do things benefitted them both:Carer 2\u2019s spouse enjoyed himself during each trip; therefore, the tactic of withholding details was concluded to be \u201c\u201cI know that if we go it\u2019s better for both of us, so I tend to not sort of supply too much information and just let it happen.\u201dit wouldn\u2019t make any difference really whether he knew\u201d) during the interview. Perhaps at the heart of the issue is that the carer realised the similarity between this and caring for a child, acknowledging that she had to almost trick him into doing things, and showing that their relationship as partners had changed as her spouse took on a more childlike role:Even with the benefits this particular strategy brought, it made the carer feel uncomfortable, suggested by her several justifications of the strategy . This ability to seek additional support enabled a sense of endurance and ability to cope, and provided time for carers to focus their efforts toward activities that benefitted them, or the person with dementia instead, but it came at the cost of acknowledging the apathy and letting it happen.Accepting that some tasks were beyond Carer 6\u2019s abilities, and accepting her spouse\u2019s loss of interest in them, enabled her to move forwards and outsource such tasks, for example, hiring a gardener  never done car insurance. He\u2019s always done that but now he can\u2019t do any of that. (So) I have to go on and I don\u2019t know. Now I kind of know what I\u2019m doing because I have to. \u2026 I say to him, look, you just leave it, you just leave it.\u201dThe role of organising household administration, such as car insurance, is often an activity undertaken by men in this age group. Therefore, the change in ownership of this role represents more than just an extra task to do, but rather a move beyond traditional gendered roles that have potentially defined the divisions of labour in relationships. It demonstrates a change in the relationship from a partnership where each partner is responsible for different but equal tasks to a more managerial role for the carer. The carer also expressed that over time she had continually adopted roles and responsibilities which were previously the responsibility of her spouse, meaning that she was required to constantly master important responsibilities to keep the household afloat. Despite how overwhelming this may be, the carer showed compassion and a sense of duty towards her spouse because she assured him to leave tasks to her, recognising his change in abilities.Although many of the carers felt that the people with dementia did not realise the extra tasks they were undertaking, Carer 6 reflected that her spouse did have an insight into her changing role and was very appreciative:\u201cBut when he is eating his dinner, he always says, that\u2019s lovely and he says things like, I\u2019m lucky to have you and you look after me and things like that.\u201dspark\u201d or \u201csparkle\u201d that could be elicited with the right circumstances or activities, but which became harder to generate as the apathy progressed.An important new role taken on by carers was that of a quasi-activities manager for their spouses, and most participants described the lengths they would take to overcome their spouses\u2019 apathy through engaging them in various interests. Carers described this in terms of a \u201c\u201cWell, he has sparks. Yeah, he has his things that do make him spark.\u201d(Carer 5):\u201cIt\u2019s gradually building up to a point\u2026 where he\u2019s not really interested in anything. \u2026 I did notice that, that the sparkle wasn\u2019t there that he used to have when we were going away and things like that.\u201d(Carer 3):spark\u201d as a rarity, and consequently she seemed to be always on the hunt for new activities to pique her spouse\u2019s interest . At the time of the interview, the person with dementia was keen on making walking sticks, but Carer 5 explained this would be a passing phase until he lost interest in that too , and she would need to find the next thing, such as \u201cjigsaws, and different things that we can do\u201d. It seemed harder and harder to identify things that would elicit a sense of enthusiasm each time, but carers felt compelled to continue the search. Carer 3 interpreted the sparkle in her spouse as a past version of her spouse, prior to the apathy, which represented the \u2018real him\u2019 somewhere deep inside, but was occluded by a layer of indifference. A \u201clittle light\u201d could be elicited if only the carers could find the right activity or interest, and this juxtaposed with the darkness of apathy to create a ray of hope. Therefore, any signs of this spark motivated the carer to put in the extra effort to preserve these interests. Carer 1 also described how he had tried to reignite his spouse\u2019s interest in reading by trying different types of books, but changes in her concentration made reading too difficult now. The carer persevered, however, and kept looking for similar activities and \u201cthings that could get her interest\u201d, and was delighted upon discovering something that would return her spark.Carer 5 described the \u201c\u201cWhich is why I\u2019m so pleased at the moment, \u2026 her doing word search, she does it all the time. You know, we buy them and there\u2019s one that comes through the mail\u2026 And there\u2019s a pile by her bedroom.\u201dThe efforts of the carer to constantly search for things that might generate an interest demonstrate a dedication beyond general care, but this kept the spark ablaze and ensured that they remained connected to the person underneath the apathy. Carer 6 also went above and beyond to create opportunities to elicit enthusiasm and enjoyment for her spouse; although a holiday within the United Kingdom would be convenient and less costly, she took her spouse to Disneyland in America because of his love of rides and theme parks.\u201cIt\u2019s (theme parks) one thing that he really loves. So, that\u2019s why we decided we\u2019d take him. It\u2019s like he hasn\u2019t got dementia when he was there. It was really good.\u201dDespite the knowledge that he would lose his memories of the holiday, the carer was unquestioningly prepared to spend time and money, and to navigate logistical challenges to see the spark in her spouse again. The lengths taken to achieve this were worth it for the carer, because knowing her spouse had had such a good time, and was present in that moment, could carry them through even after the memories had faded.Carers recognised that although their focus and role had shifted over time from that of an equal partner to the role of carer, taking care of themselves was an important strategy to cope with the challenges that apathy created.Pursuing hobbies and interests was difficult for some carers, but they recognised the need and value of making time for their own interests and enjoyment. Carer 4 reflected that she would remove herself from situations that her spouse\u2019s apathy had created, such as watching the same television programmes repeatedly, and this gave her the space to engage with her own hobbies.\u201cSo I tend now to just put myself in another room because he\u2019s just sitting there watching the same programmes over and over again, which does get me down\u201d.\u201cSometimes I feel quite motivated because I like sewing and I like knitting and I feel quite motivated.\u201dto be in a relaxed mood before I can start\u201d to benefit from her hobbies, and may have wanted to avoid associating feelings of stress with activities that provided relaxation and escape to preserve them as a relief from the caring role. Her spouse also sometimes made it difficult for her to engage in her hobbies by wanting to know where she was, and she wondered if \u201che\u2019s frightened to be on his own perhaps\u201d. Carer 1 described a similar situation where his spouse began \u201cfollowing me around the house almost, yes. To sort of make sure I\u2019m there, where I am.\u201d This made it hard for Carer 1 to find the time and space to undertake activities for themself.However, Carer 4 acknowledged that she needed \u201cCarers received different forms of support from others, which provided them with both an outlet for their feelings, and time away from the person with dementia. Carer 4 reflected that connecting with friends provided her with social interactions that no longer existed at home.\u201cLuckily I\u2019ve got some friends here so I\u2019ve got somebody to talk to. And get what\u2019s happening in their lives as well, not just (being in) my little bubble.\u201dbubble\u201d and engage with the wider world. Interacting with other carers in similar situations provided a forum to share experiences and learn from each other.For Carer 4, communication with her spouse was challenging throughout their marriage, and had become more difficult due to the apathy. Talking to others outside the household and hearing about their lives enabled Carer 4 to break out of her \u201c\u201cAnd it also helps when you go to places like Song Time; you\u2019re talking to the other carers. Also, I go to the Alzheimer\u2019s meeting once a month as well and again, you\u2019re talking to the other people and it just helps.\u201dThe various activities and groups benefitted the person with dementia, but also the carer as well; finding out about what the future might hold and sharing helpful strategies made her feel less alone and more confident.Carer 3 described how her children could act as a form of support:\u201cMy daughter will come round and say, go on bugger off and do what you want to do, I will sort him out don\u2019t worry and she does bless her.\u201dFamily members provided a break from caring to enable carers to spend time on their chosen activities. Support from close relatives gave the carer confidence because they are trusted and known individuals, rather than hiring someone unfamiliar to care instead. Further support came from formal sources such as clinical services sought by the carers to help with the emotional and stressful aspects of the role. Carer 6 revealed:\u201cI had to go for some counselling and I\u2019m on anti-depressants.\u201dCaring for someone with dementia can result in low mood and anxiety, and this is made more challenging with the added impact of apathy, and in some circumstances formalised support was necessary to be able to cope.This study aimed to explore the impact of apathy in dementia on carers and their understandings of how apathy manifested in the person for whom they care. The findings extend existing knowledge of this area by providing an insight into carers\u2019 lived experience, and demonstrate that apathy in dementia does impact carers. To the best of our knowledge, this is the first study exploring the lived experiences of carers in response to apathy in dementia. Carers described apathy as a change in behaviour, personality, and interest, specifically a lack of initiative in starting or completing daily activities. This included not participating in usual responsibilities around the house, such as household chores, and unwillingness to leave the house. The accounts of apathy were in line with previous descriptions of apathy as a loss of motivation in relation to previous level of functioning .Carers went to significant lengths to sustain hobbies and interests in their spouses and described this as keeping their \u201cspark\u201d ignited. The way the carers spoke about the spark implied that they knew it was still alight, somewhere deep within the person with dementia, and as long as they could keep finding things to fuel, the spark it would keep burning. The spark seemed to represent the essence of the person with dementia from before their apathy, or even before they had dementia, and represented an essential link between past and present that helped carers and their spouses maintain a connection.Previous studies suggest that neurological changes cause the lack of motivation ,5,6, butThe carers\u2019 efforts support our understanding that family carers are a vital determinant of positive outcomes for people with dementia . For insPrevious studies investigating the impact of apathy on carers of people with PPA and ALS ,13 used A recent systematic review  identifiThe different strategies and tactics employed by carers to overcome their spouses\u2019 apathy, such as taking them out without seeking their opinion, or withholding details about it, created a complex set of emotions. Although the ends apparently justified the means, because this was for the benefit of the person with dementia, carers felt guilty for misleading or withholding information from their spouse. Studies in the literature concerning guilt for carers of people with dementia show that guilt is strongly associated with carer burden, and is related to a loss of closeness in their relationship with the person with dementia . Our finCarers discussed their frustration at the frequent lack of insight in the person with dementia about their apathy. This tallied with Pfeifer et al. , highligThis is the first study to explore the lived experience of apathy in people with dementia from the perspective of their carers. The sample size was optimal for an IPA study , and intSome limitations must be acknowledged. Participant recruitment was limited to the local area to enable visits to local groups, and for ease of participants travelling to the university to participate. Organisers of local groups were gatekeepers to group members, and in some cases prevented access over concerns that members were becoming over-researched, and that the purpose of support groups is not to provide research participants.The participants with dementia had a limited range of diagnoses, which may not have encapsulated different types of dementia, because diverse types may impact carers in different ways. This was an IPA study; therefore, the focus of the approach was to capture the experience of each participant on an idiographic level  and we dSupport networks for carers are vital to help them cope with the emotional impact of apathy, find time for themselves, and share ideas about how to engage the person for whom they care. This support could come from family and friends, but external support such as carers groups are also particularly useful in enabling carers to share experiences and learning with each other, and consequently, awareness of local groups and events is important. Many carer groups have an online presence, and empowering carers to navigate the internet with confidence may enable a greater awareness of, and engagement with, such groups. There is also the potential for the development of community and residential care, specifically focused on apathy. Currently, general carer support exists in well-established community services, such as support groups , singingThere are a lack of services and therapeutic interventions within health and social care that focus on apathy management for either people with dementia or carers. Our study suggests that carers face initial difficulties in accepting changes in the person for whom they care related to apathy, but reflection and focusing on the bigger picture when deploying particular engagement strategies is helpful. Encouraging acceptance as a coping style could be advantageous in providing a positive adjustment to such challenges . TherefoDementia cafes were launched in the United Kingdom in the year 2000 to promote opportunities to connect with others and share experiences, receive formal support from experts, and learn from each other ,43. ThesFuture research must explore carers\u2019 perspectives of apathy in dementia in Black, Asian, and minority ethnic communities. Different communities and cultures may experience and manage apathy in different ways; for example, in cultures where an obligation for adult children to care for older family members, in line with the Asian value of filial piety , is the Through exploring the lived experience of carers for people with dementia who have apathy, this study found that apathy created conflicting emotions, led to carers taking on new roles and responsibilities, and that respite from the caring role can be achieved through pursuing activities of their own. Apathy in people with dementia can place emotional and physical demands upon carers, who find themselves employing a variety of strategies in order to engage the person for whom they care. Understanding the experience of carers provides opportunities to consider how apathy is conceptualised and discussed at a societal level, and how existing interventions may be utilised to alleviate carer burden. Supporting carers to understand the experience of person with dementia with apathy could help to minimise their sense of guilt and frustration, and increase a sense of acceptance."}
+{"text": "This is based on the volumetric measurement of released gas and an upgraded diffusion analysis program after high-pressure exposure. Three channel measurements of sorption content of gases emitted from polymers after decompression are simultaneously conducted, and then, the gas uptake/diffusivity as a function of exposed pressure are determined in nitrile butadiene rubber (NBR), ethylene propylene diene monomer (EPDM) rubbers, low-density polyethylene (LDPE) and high-density polyethylene (HDPE), which are used for gas sealing materials under high pressure. The pressure-dependent gas transport behaviors of the four gases are presented and compared. Gas sorption follows Henry\u2019s law up to 9\u00a0MPa, while pressure-dependent diffusion behavior is not observed below 6\u00a0MPa. The magnitude of the diffusivity of the four gases decreases in the order DHe\u2009>\u2009DH2\u2009>\u2009DAr\u2009>\u2009DN2 in all polymers, closely related to the kinetic diameter of the gas molecules. The dependence of gas species on solubility is in contrast to that on diffusivity. The linear correlation between logarithmic solubility and critical temperature of the gas molecule was newly observed.We demonstrate a simple experimental technology for characterizing the gas permeation properties of H Studying the permeability of gases through materials under different environmental conditions is crucial to understand if the corresponding material is adapted to the chosen gases. Specifically, gas selectivity and permeation characteristics such as solubility, diffusivity and permeability are important requirements for appropriate polymer membrane selection. There are diverse methods in which the permeation of a material can be measured. These methods include manometric methods8, constant-pressure methods7, gravimetric techniques9, magnetic suspension balance methods11, gas chromatography (GC)12 and numerical simulation14.Permeation is the penetration process of a permeant such as a liquid, gas, or vapor through the material membrane of a solid. Permeation comprises three processes: adsorption of the permeating species into the polymer, diffusion through the polymer membrane and desorption of the permeating species from the polymer surface. Permeation is important for many design applications, such as packaging, gas separation, analytical chemistry, polymer electrolytes, and biosensorsThe differential pressure method called as manometric method is tested following the ASTM D143 standard. The permeation parameters are determined by measuring both the permeation and diffusivity of a specimen plate placed between chamber with a feed and permeation sides via monitoring pressure versus elapsed time. However, important factors such as high vacuum circumstance before stating the measurement, a limited sample shape/dimension, leakage in measuring cell and outgassing from volatile specimen should be considered.GC is an advanced technique requiring the complicated process and pre-calibration for determining hydrogen permeability from individual GC peaks in electrical units of pA\u00a0s. This method can precisely quantify the amount of hydrogen uptake in even small amounts of specimen because of good resolution of 0.01\u00a0wt\u00a0ppm. However, the technique seems not be effective method.Gravimetric technique by electronic balances is very sensitive to environment of temperature and humidity because it detects small changes in electrical resistance, which is proportional to the acting deforming force following the principle of a Wheatstone bridge circuit. Thus, this measurement is a very sensitive technique depending on the effect of the offset of electronic balances and on the stability of the temperature/humidity in the laboratory. This method maintains traceability because the electronic balance can be calibrated by using standard weights traceable to national standards. Magnetic suspension balance method is utilized for in-situ measurement of specimen under high pressure. In summary, most methods are time-consuming processes with complicated processes and fine control.15 comparing the results obtained by VAT with those by different methods, such as gas chromatography by thermal desorption analysis, gravimetric measurement by electronic balance for same samples. The results are found to be consistent with each other. In addition, the developed technique reduces the uncertainty of permeation parameters by varying the temperature and pressure of the laboratory environment by compensating the variations. The advantage of the technique is also commonly applied for determination of various gas permeation parameters with simultaneous parallel measurements more than three specimens, regardless of gas species and shape/dimension of the specimen. The techniques were applied to nitrile butadiene rubber (NBR) and ethylene propylene diene monomer (EPDM) polymers, which are used for gas sealing materials. The use of specimens of high-density polyethylene (HDPE) as liner materials of a type IV tank in a fuel cell electric vehicle and low-density polyethylene (LDPE) as plastics was also included for experimental investigation.Therefore, effective and easy measurement is required to enhance the reliability of permeability characteristics. An effective technique in present work is to combine a volumetric measurement using a graduated cylinder and upgraded diffusion analysis program. We have confirmed the volumetric analysis technique (VAT) in previous researches2, He, N2 and Ar. The solubility and diffusivity in NBR, EPDM, LDPE and HDPE polymers could be correlated in terms of the kinetic diameter and critical temperature of the molecule in the gases employed. The uncertainty analysis against the measured data is carried out in order that the method could be applicable as a standard test for the permeation properties for various gases of polymers which is used as a gas sealing materials under the high pressure.The aim of this paper was to present precise data on the gas permeability characteristics of polymer materials. The solubility, diffusivity and permeability of the four polymers were investigated as a function of the exposed pressure and gas species such as H16. Heat treatment of the polymer is performed at 60\u00a0\u00b0C for 48\u00a0h to minimize outgassing from the rubber. For the volume dependence on the permeation parameter, NBR and EPDM specimens are used as following shapes/dimensions:The compositions and densities of the NBR and EPDM polymer specimens used in this study are already listed in previous literaturecylindrical NBR with a radius of 7.0\u00a0mm and thicknesses of 1.1\u00a0mm and 2.2\u00a0mmspherical NBR with a radius of 5.0\u00a0mmcylindrical EPDM with a radius of 7.0\u00a0mm and thicknesses of 1.4\u00a0mm and 2.5\u00a0mmspherical EPDM with a radius of 4.9\u00a0mmAdditionally, two types of polyethylene fabricated at King Plastic Corporation with advanced antimicrobial technology were employed in the experimental investigations. The physical and mechanical properties of LDPE and HDPE specimens are presented in Table LDPE rectangular plane sheet with a length of 15.0\u00a0mm, a width of 15.0\u00a0mm and thicknesses of 2.2\u00a0mm and 3.1\u00a0mmHDPE rectangular plane sheet with a length of 15.0\u00a0mm, width of 15.0\u00a0mm and thickness of 2.4\u00a0mmspherical HDPE with a radius of 4.8\u00a0mm2 gas exposure. N2 gas charging for 48\u00a0h is needed to attain the equilibrium state for N2 sorption, because of its slow diffusion. After exposure to gas, the valve was opened, and the gas in the chamber was released. After decompression, the elapsed time was recorded from the moment (t\u2009=\u20090) at which the high-pressure gas in the chamber was reduced to atmospheric pressure when the time was set to zero. Since the specimen was loaded in the graduated cylinder after decompression, it took approximately 5\u2009~\u200910\u00a0min to start the measurement. The gas content emitted for the inevitable time lag could be measured by offset determination.An SUS 316 chamber with an inner diameter of 50\u00a0mm and height of 90\u00a0mm was used for gas exposure to high pressure at room temperature and the specified pressure. The chamber was purged three times with the corresponding gas at 1\u2009~\u20093\u00a0MPa depending on the exposed pressure before gas exposure. We exposed the gas for 24\u00a0h to the specimen in the pressure range from 1.5 to 10\u00a0MPa. Gas charging for 24\u00a0h is sufficient to attain the equilibrium state for gas sorption, except for NFigure\u00a016.The pressures .mentclass2pt{minimP and T as follows for the three cylinders.The total number of moles  and andD\\do in Eqs.  based onThe gas emitted from the specimen lowers the water level, which exponentially decreases with increasing elapsed time. By the application of Eqs.  to 7), , 7), theDD\u201310\u00a0m2/s and 158.9\u00a0wt\u00a0ppm, respectively, at 6.0\u00a0Ma and 297\u00a0K. The emitted He content is saturated above 10,000\u00a0s, and total He uptake is taken by extrapolation to restore the missing content for lag time. Fast diffusivity is unexpectedly observed for He gas.Figure\u00a02 gas emitted from EPDM. The water level as a function of time is transformed to mass concentration. Figure\u00a0\u221e, obtained from the mass content determined using a diffusion analysis program. D and C\u221e are found to be 5.35\u2009\u00d7\u200910\u201311\u00a0m2/s and 3382\u00a0wt\u00a0ppm, respectively, at 8.4\u00a0MPa and 297\u00a0K. The emitted N2 content is saturated above 40,000\u00a0s, and total N2 uptake is also taken by extrapolation to restore the missing content for lag time. A relatively slow diffusivity is observed for N2 compared to He gas.Figure\u00a0\u221e, which are found to be 5.01\u2009\u00d7\u200910\u201311\u00a0m2/s and 6322\u00a0wt\u00a0ppm, respectively, at 8.6\u00a0MPa and 297\u00a0K. The emitted Ar content is saturated above 100,000\u00a0s, and total Ar uptake is taken by extrapolation to restore the missing content for lag time.Figure\u00a02 gas emitted from HDPE. The water level as a function of time is transformed to mass concentration. Figure\u00a0\u221e, which are found to be 3.48\u2009\u00d7\u200910\u201310\u00a0m2/s and 96.4\u00a0wt\u00a0ppm, respectively, at 10.8\u00a0MPa and 297\u00a0K. The emitted H2 content is saturated above 10,000\u00a0s, and total H2 uptake is taken by extrapolation to restore the missing content for lag time. The gas uptake and diffusivity of the four gases have characteristic properties.Figure\u00a0Figures  of Eqs.  to 7) b b\\docume20 up to 9\u00a0MPa in NBR, with a squared correlation coefficient R2\u00a0\u02c3\u00a00.990, as indicated by the black and blue lines of Fig.\u00a0All gas uptake follows Henry\u2019s law2\u00a0\u02c3\u00a00.991, as indicated by the black, blue and gray lines of Fig.\u00a02 diffusivity. This may be ascribed to bulk diffusion associated with the mean free path, normally observed for high-pressure gas diffusion. At pressures below 6\u00a0MPa in Fig.\u00a0All gas uptake follows Henry\u2019s law up to 9\u00a0MPa in EPDM, with R2\u00a0\u02c3\u00a00.994, as indicated by the black lines of Fig.\u00a0All gas uptake follows Henry\u2019s law up to 9\u00a0MPa in LDPE, with R2\u00a0\u02c3\u00a00.97, as indicated by the black and blue lines of Fig.\u00a0All gas uptake follows Henry\u2019s law up to 9\u00a0MPa in HDPE, with RS) is determined from the linear slope obtained in Figs. mg is the molar mass of gas used and d is the density of polymers. The permeability of four gases in the NBR, EPDM, LDPE and HDPE polymers is obtained from the solubility and the average diffusivity by using the relation P\u2009=\u2009DaveS. The permeation parameters for the four gases in NBR, EPDM, LDPE and HDPE are summarized and compared with those obtained by different methods in Table Meanwhile, the solubility  in GC is similar as volumetric method, although the principle/apparatus for measuring S and D is differ each other. However, the differential pressure method has different sequence for obtaining the permeation parameters as volumetric method. The S is finally determined as The value in parentheses is determined by the differential pressure method and thermal desorption analysis-GCThe uncertainty factor and relative expanded uncertainty of measurement for gas diffusion properties are represented in Table 2 content versus elapsed time and the least squared fit obtained using Eqs.  i i\\documeThe combined standard uncertainty is expressed as a root sum of squares of the uncertainty source. The relative expanded uncertainty is obtained by assuming a normal distribution and multiplying the combined standard uncertainty by a coverage factor of 2.1 at a 95% confidence level. The relative expanded uncertainty for solubility and diffusivity is not more than 10.3%.C\u221e and D are determined using a diffusion analysis program by the application of Eqs. (C\u221e) versus pressure by Eq.\u00a0. . C\u221e and e by Eq.\u00a0. The P oDHe\u2009>\u2009DH2\u2009>\u2009DAr\u2009>\u2009DN2 in all NBR, EPDM, LDPE and HDPE specimens. For diffusivity analysis, we focus on the effective molecule size of gas rather than the molar mass of gas. The size of the permeant molecule affects diffusivity. As the effective size of the molecule increases, the diffusivity decreases. As expected, we found a linear correlation between the logarithmic diffusivity and kinetic diameter of molecules in gas for NBR, EPDM, LDPE and HDPE, as indicated by the blue line on the left side of Fig.\u00a02, Ar and N2 molecules are 0.26\u00a0nm, 0.29\u00a0nm, 0.34\u00a0nm and 0.364\u00a0nm, respectively. Kinetic diameter is the size of the sphere of influence that can lead to a scattering event and is related to the mean free path of molecules in a gas23. As shown in Fig.\u00a02, Ar and N2 varied linearly versus the kinetic diameter of gases for all polymers and was in good agreement with previously reported results26.The difference in permeation parameters depending on gases was obviously found in NBR, EPDM, LDPE and HDPE. The magnitude of the diffusivity decreases in the order H2\u2009>\u2009SAr\u2009>\u2009SN2\u2009>\u2009SHe. The magnitude of the solubility in EPDM decreases in the order SAr\u2009>\u2009SH2\u2009>\u2009SN2\u2009>\u2009SHe. The magnitude of the solubility in LDPE decreases in the order SAr\u2009>\u2009SN2\u2009>\u2009SH2\u2009>\u2009SHe. The magnitude of the solubility in HDPE decreases in the order SAr\u2009>\u2009SH2\u2009>\u2009SN2\u2009>\u2009SHe.Meanwhile, Fig.\u00a027. Although there are factors related with gas permeation, the gas solubility is related with the critical temperature (Tc) as29.0 and K are constants. The critical temperature is a measure of condensation for gaseous molecules. As expected, it is observed that the logarithmic solubility increases nearly linearly with the increasing the critical temperature in Fig.\u00a02 gas deviation from linearity. The similar relationship was reported for polyvinylpyridine film29.It was reported that gas sorption content in polymeric membranes depends on the condensability-related to the critical temperature of gases, interaction between the polymer and gas molecules, crystallinity of the polymer, temperature and pressure2 for both LDPE/HDPE rather than both NBR/EPDM was found. In particular, the solubility of He gas in all polymers investigated in this work is smallest and is in contrast to the diffusivity magnitude. The fast diffusion and small solubility observed in He seem to be different behaviors, which is unlikely for other gases. The small solubility of He is attributed to its small condensability, known as 5.19 K30, which is the critical temperature of the He gas molecule. This value is smaller than the values of H2 and N2. However, the origin of the solubility difference will be clarified in future research.A linear correlation with relatively good R2, He, N2 and Ar for four polymers, with precise volumetric analysis measurements using a graduated cylinder and updated diffusion analysis program, which could be commonly applicable for various shaped-specimen. The technique simultaneously and parallel evaluates three sets of diffusion characteristics of gas by quantitatively analyzing the amount of gas released after high-pressure gas charging and subsequent decompression. Compensating the variation in temperature and pressure, the fluctuation obtained by varying the temperature and pressure of the laboratory environment was removed. The investigated results obtained for the polymers demonstrate that the permeation properties of H2 determined by the developed method are in good agreement with those determined by the differential pressure method and gas chromatography.We determined the permeation properties of various gases, HThe experimental investigation indicates that the gas content emitted from NBR, EPDM, LDPE and HDPE satisfied Henry\u2019s law up to a pressure of 9\u00a0MPa, which confirmed that the content was primarily proportional to the pressure. The solubilities and diffusivities in all specimens employed are identical, regardless of the sample shape and dimension. This is a general trend as expected.DHe\u2009>\u2009DH2\u2009>\u2009DAr\u2009>\u2009DN2 in four specimens. The different diffusivities depending on gas species are attributed to their different kinetic diameters, related to the mean free path of gas molecules. The linear relationship between logarithmic solubility and critical temperature of gas used are new observation. Especially, the small He gas solubility is attributed to the small critical temperature of the gas.Meanwhile, the diffusivity decreases in the order In conclusion, a technique for determining permeation with volumetric measurement by graduated cylinders could be effectively applied to automatically evaluate the transport properties of gases in polymers and other materials for cases requiring real-time and time-consuming measurements with small diffusion coefficients. This simple technique could be commonly applied to permeation evaluation for all kinds of gas, irrespective of sample size, shape and gas species."}
+{"text": "Microcystis aeruginosa at high risk for \u03b2-cyclocitral production. Moreover, the synchronicity of the production of \u03b2-cyclocitral and its precursor \u03b2-carotene at both population and single-cell levels was assessed. The results indicated that \u03b2-cyclocitral was the main odorous compound produced by M. aeruginosa cells. The intracellular concentration of \u03b2-cyclocitral (C\u03b2-cc) as well as its cellular quota (Q\u03b2-cc) increased synchronously in the log phase, along with the increase of cell density. However, they reached the maximum values of 415 \u03bcg/L and 10.7 fg/cell in the late stationary phase and early stationary phase, respectively. The early stage of the stationary phase is more important for \u03b2-cyclocitral monitoring, and the sharp increase in Q\u03b2-cc is valuable for anticipating the subsequent increase in C\u03b2-cc. The molar concentrations of \u03b2-cyclocitral and \u03b2-carotene showed a linear relationship, with an R2 value of 0.92, suggesting that the production of \u03b2-cyclocitral was linearly dependent on that of \u03b2-carotene, especially during the log phase. However, the increase in Q\u03b2-cc was slower than that in \u03b2-carotene during the stationary phase, suggesting that \u03b2-cyclocitral production turned to be carotene oxygenase-limited when the growth rate decreased. These results demonstrate that variations of \u03b2-cyclocitral production on a single-cell level during different bacterial growth phases should be given serious consideration when monitoring and controlling the production of odorous compounds by M. aeruginosa blooms.Bloom-forming cyanobacteria produce and release odorous compounds and pose threats to the biodiversity of aquatic ecosystem and to the drinking water supply. In this study, the concentrations of \u03b2-cyclocitral in different bacterial growth phases were investigated using GC\u2013MS to determine the growth stage of  Anabaena, Aphanizomenon, Microcystis, and Planktothrix, cause skin illness, liver cancer, and even death of human beings [Cyanobacteria blooms are notorious worldwide for interrupting the supply of water for drinking, irrigation, and sanitation ,2,3. Then beings . In 2011n beings , with con beings . The occn beings ,9,10, thn beings ,11.M. aeruginosa produces \u03b2-cyclocitral, a main odorous compound fouling algae-laden water with a sweet-tobacco and grape odor [M. aeruginosa is the oxidation product of \u03b2-carotene by either carotene oxygenase [1O2 induce a decrease in intracellular \u03b2-carotene and the release of \u03b2-cyclocitral [Daphnia [As the most widespread and health-threatening bloom-forming cyanobacteria species , M. aeruape odor , which cape odor . \u03b2-cycloxygenase  or reactxygenase . For thexygenase . For thelocitral ,17. It h[Daphnia . Moreove[Daphnia , which l[Daphnia .There have been previous studies that revealed the existence of \u03b2-cyclocitral in high concentrations in natural water bodies ,22,23,24M. aeruginosa in the lab [Q\u03b2-cc) ranged from 41 to 865 fg [2 = 0.96) was observed during all growth stages [Q\u03b2-cc) was independent of algal cell age during the stationary phase [The concentrations of \u03b2-cyclocitral and \u03b2-carotene were found to be correlated to the growth phase of  the lab . In a sto 865 fg . Additioh stages . Howeverry phase . It was ry phase ,28. HoweIn this study, the production of \u03b2-cyclocitral was detected during a complete cycle of growth and replication, and \u03b2-cyclocitral quota was calculated to characterize the production in different growth phases. Photosynthetic activity and pigments were also examined to understand the effects of energy supply and metabolic activity on the odor-producing process. In addition, the relationship between \u03b2-cyclocitral and its precursor \u03b2-carotene and the changing trend in the cellular quotas of \u03b2-cyclocitral and \u03b2-carotene were explored and discussed.5 cells/mL to 5.0 \u00d7 107 cells/mL on the 29th day of incubation, indicating a typical logarithmic growth period with a 356-time increase. During the log phase, the percentage of dead cells, represented by the Pmd value, remained below 6.6%, which confirmed healthy growth conditions for the cells. During the period from the 29th to the 99th day, cell density continuously increased, with a significant lower growth rate  and a late stage (57th\u201399th day). Cell density began to decrease after the 99th day and declined to 5.5 \u00d7 107 cells/mL on the 141st day. More importantly, most algal cells were broken with a sharp increase in the Pmd value, which increased to 79% on the 106th day and remained constant at approximately 70%. The death of algal cells markedly exceeded the proliferation of new ones, indicating the achievement of the decay phase from the 99th to 141st day. The lag phase was not obvious in this study, as the initially inoculated cells were in the logarithmic period.Variations of cell density, membrane integrity, and photosynthetic activity during culturing are shown in wth rate , and reaM. aeruginosa cells is shown in M. aeruginosa cells decreased significantly in the stationary phase , the intracellular concentration of \u03b2-cyclocitral increased to 317 \u03bcg/L on the 36th day and then decreased sharply to 104 \u03bcg/L on the 43rd day b. The exM. aeruginosa. It was also found that the dead cells would not be lysed within a short time and could still be detected by flow cytometry, and thus the Pmd value remained stable.In the late stage of the stationary phase (57th\u201399th day), the intracellular concentration of \u03b2-cyclocitral gradually increased and reached the highest value of 414 \u03bcg/L on the 92nd day. The extracellular concentration of \u03b2-cyclocitral experienced a rapid decrease, reached 2.64 \u03bcg/L on the 64th day, and then remained below 2 \u03bcg/L. During this period, the algae cells grew and multiplied using the nutrients released by the dead cells in the early stage of the stationary phase. Consequently, the intracellular concentration of \u03b2-cyclocitral increased again, while the extracellular concentration remained at a low level. This indicated that during the late stage of the stationary phase, no substantial abrupt cell death occurred, which prevented the release of large amounts of intracellular \u03b2-cyclocitral from Pmd value was maintained at about 69%, the intracellular \u03b2-cyclocitral concentration was drastically reduced.In the decay period, the intracellular concentration of \u03b2-cyclocitral decreased rapidly from 377 \u03bcg/L on the 99th day to 155 \u03bcg/L on the 106th day, which was followed by a continuous reduction. The intracellular concentration of \u03b2-cyclocitral was only 12.82 \u03bcg/L on day 141, while the extracellular concentration remained below 1 \u03bcg/L. Although the Q\u03b2-cc) was calculated by applying the Equation (2) given in Intracellular \u03b2-cyclocitral was produced entirely by cells with an intact membrane. The cellular production quota  on the 14th day. The concentration of \u03b2-carotene increased from an initial value of 17.2 \u03bcg/L to 776 \u03bcg/L (nearly 45 times higher) on the 14th day. Meanwhile, the intracellular concentration of \u03b2-cyclocitral also increased sharply from an initial value of 1.5 \u03bcg/L to 76.4 \u03bcg/L (nearly 50 times higher) on the 14th day. This indicated that \u03b2-cyclocitral had a similar increasing trend to cell growth.The density of membrane-intact cells increased from an initial value of 1.0 \u00d7 102 of 0.92 was obtained between the intracellular molar concentrations of \u03b2-cyclocitral and \u03b2-carotene. In addition, it can be seen in the figure that the molar ratio of \u03b2-cyclocitral to \u03b2-carotene was about 0.39, i.e., 1 mol \u03b2-carotene produced 0.39 mol \u03b2-cyclocitral. However, theoretically, 1 mol of \u03b2-carotene is completely transformed producing only \u03b2-cyclocitral or \u03b2-ionone, and 2 mol of \u03b2-cyclocitral or \u03b2-ionone can be obtained. In this study, 0.39 mol \u03b2-cyclocitral and 1.5 \u00d7 10\u22124 mol \u03b2-ionone  and \u03b2-carotene (Q\u03b2-Car) were calculated by applying the Equations (2) and (3), respectively given in Q\u03b2-Car and Q\u03b2-cc increased within the first several days, variations were unsynchronized. Q\u03b2-Car was low and stable within the first 2 days. Starting on day 3, Q\u03b2-Car rose rapidly, reached the maximum of 47.6 fg/cell on day 7, and then gradually decreased to 33.1 fg/cell on the 14th day. In contrast, Q\u03b2-cc increased rapidly from 1.5 fg/cell to 3.7 fg/cell within 3 days. Then, the rise became slow from day 3 to day 9, and the value finally reached the maximum of 4.3 fg/cell on day 9. Q\u03b2-cc then decreased to 3.3 fg/cell on day 14.The yield quotas of \u03b2-cyclocitral , as well as its cellular quota (Q\u03b2-cc), increased synchronously during the log phase. However, they reached the maximum values in the late stage and early stage of the stationary phase, respectively. The stationary phase is thus more dangerous for \u03b2-cyclocitral production and deserves closer monitoring. The sharp increase in Q\u03b2-cc in the early stationary phase is valuable for anticipating a subsequent increase in C\u03b2-cc. C\u03b2-cc was linearly correlated with the intracellular concentration of \u03b2-carotene (C\u03b2-Car); however, the increase in Q\u03b2-cc was unsynchronized with that of \u03b2-carotene, Q\u03b2-Car, suggesting that the production of \u03b2-cyclocitral was \u03b2-carotene-dependent in the log phase and carotene oxygenase-limited in the stationary phase.Variations of \u03b2-cyclocitral concentrations in different growth phases of the cyanobacteria M. aeruginosa (FACHB 905) was obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology  and cultured in BG-11 medium [5 cells/mL. Another 14-day-long experiment was conducted to verify the production of \u03b2-cyclocitral during the log phase and the early stage of the stationary phase. The relationships between odorous compounds and their precursors were also studied, and the initial density was set at 1.0 \u00d7 106 cells/mL.The tested alga 1 medium . CulturePmd) [2DCFDA, Sigma-Aldrich Corp., St. Louis, MO, USA) to the cells. All measurements were performed on the flow cytometer as described in a previous study [A flow cytometer  was employed to determine cell density, membrane integrity, and oxidative stress . The algPmd) . Intraceus study .M. aeruginosa cells was detected by a phytoplankton pulse-amplitude-modulated fluorometer  [The photosynthetic activity, \u2018Y\u2019 value, was used to characterize the efficiency of the photosynthetic system II (PS II) in microalgal cells . The phoGermany) .For the quantification of odorous compounds including \u03b2-cyclocitral and \u03b2-ionone, headspace solid-phase microextraction (HS-SPME) coupled with GC  and MS  was used . The det\u03b2-carotene concentration was quantified with a high-performance liquid chromatographer . For the determination of intracellular \u03b2-carotene concentration, a solid-phase extraction device was used after breaking the cells by liquid nitrogen freezing\u2013thawing and homogenizer  grinding . The detp value was 0.05. Except for cell density and cell membrane integrity, other flow cytometric indicators were analyzed by the normalization method and the partitioning method . Two-factor analysis of variance was conducted using SigmaStat 3.5, and the statistical ach zone ).C\u03b2-cc), the amount of \u03b2-cyclocitral produced per membrane-intact cell (Q\u03b2-cc), the amount of \u03b2-carotene produced per membrane-intact cell (Q\u03b2-Car), and the growth rate (GR) were calculated by the following equations.The intracellular concentration of \u03b2-cyclocitral ("}
+{"text": "SDHC) improves tumour cell growth in hypoxia-glucose, but reduces growth in normoxia, indicating a metabolic switch in OXPHOS gene function. Moreover, compared to normoxia-glucose, loss of genes involved in energy-consuming processes\u00a0that are energetically demanding, such as translation and actin polymerization, improve cell viability under both hypoxia-glucose and normoxia-galactose. Collectively, our study defines mitochondrial gene essentiality in tumour cells, highlighting that essentiality is dependent on the metabolic environment, and identifies routes for regulating tumour cell viability in hypoxia.Mitochondria are typically essential for the viability of eukaryotic cells, and utilize oxygen and nutrients (e.g. glucose) to perform key metabolic functions that maintain energetic homeostasis and support proliferation. Here we provide a comprehensive functional annotation of mitochondrial genes that are essential for the viability of a large panel (625) of tumour cell lines. We perform genome-wide CRISPR/Cas9 deletion screening in normoxia-glucose, hypoxia-glucose and normoxia-galactose conditions, and identify both unique and overlapping genes whose loss influences tumour cell viability under these different metabolic conditions. We discover that loss of certain oxidative phosphorylation (OXPHOS) genes (e.g.  Thomas, Ashcroft and colleagues use genome-wide CRISPR/Cas9 screening under tumour-relevant metabolic conditions to identify genes that are essential in cancer. Mitochondrial gene essentiality is highlighted, and routes for regulating tumour cell viability in hypoxia are identified. Mitochondrial function is essential for supporting tumour cell proliferation, through the generation of ATP via OXPHOS, and the synthesis of precursors for biomass accumulation, such as amino acids, lipids and nucleotides. Agents that target OXPHOS inhibit cell growth across a broad range of tumour cell types3, while inactivating mutations in mitochondrial genes have also been shown to influence tumour cell proliferation, both positively and negatively, depending on the gene and cell context5.Altered mitochondrial metabolism and function contribute to several pathologies, including cancer. Tumour microenvironmental conditions, such as hypoxia, and changes in nutrient availability can profoundly impact mitochondrial activity, providing metabolic adaptive responses that enable tumour cell survival and promote metastasis6. Thus, mitochondria are key determinants of cell and tissue oxygenation levels and have been shown to regulate the development of intracellular hypoxia8. Hypoxia is a characteristic feature of the tumour microenvironment, contributing to disease progression, and is associated with treatment resistance9 and poor prognosis in patients with solid malignancies10. Hypoxia also constitutes mitochondrial stress, as a reduction in oxygen availability limits the activity of the respiratory chain11. Metazoan cells have evolved several pathways that sense and respond to changes in oxygen levels, such as the hypoxia-inducible factor (HIF) pathway12, which allows them to adapt in order\u00a0to maintain cellular homoeostasis and survive1. Indeed, a reduction in oxygen availability has wide-ranging effects on multiple cellular functions, and our understanding of the genes and pathways that contribute to hypoxic adaptation continues to grow but is incomplete.Mitochondrial ATP synthesis and many other mitochondrial metabolic reactions rely on the intracellular availability of molecular oxygen, and it has been estimated that mitochondria account for >90% of cellular oxygen consumption15. Here, we performed genome-wide CRISPR/Cas9 deletion screening under different environmental conditions  to interrogate the dependency of tumour cells on nuclear-encoded mitochondrial genes  and non-mitochondrial genes for their survival when oxygen or glucose is abundant or limited. We provide, what we believe to be, the first comprehensive functional annotation of the nuclear-encoded mitochondrial genome, and classify functional modules of genes that are commonly essential across different tumour cell types. We show that proportionally, twice as many mitochondrial genes are common essential genes when compared to the genome as a whole.\u00a0Under hypoxia, loss of mitochondrial genes, including OXPHOS genes such as succinate dehydrogenase subunit C (SDHC), improves the growth of U2OS cells, as well as HeLa and MCF7 cells, and downregulated expression of OXPHOS proteins is an intrinsic response of tumour cells to hypoxia. Conversely, switching\u00a0the carbon fuel from glucose to galactose to drive mitochondrial respiration significantly increases the essentiality of certain mitochondrial genes for the survival and proliferation of tumour cells. In addition, we show that loss of genes involved in energy-consuming processes that are\u00a0energetically demanding, such as translation and cytoskeleton arrangement, improve the viability of tumour cells under either hypoxia or galactose. Our study provides a comprehensive survey of mitochondrial gene essentiality in tumour cells, which\u00a0shows that gene essentiality depends on the metabolic context, and highlights routes for tumour cell viability in hypoxia.The development of CRISPR/Cas9 gene-editing technology has facilitated the investigation of cellular responses to stimuli at a genome-wide scale16, but their role in tumour cell survival is less well understood. In order to better understand the essentiality of mitochondrial genes for the survival of tumour cells, first, we analysed the gene essentiality scores from the Broad Institute\u2019s Achilles Project18, which provides data on genome-wide CRISPR loss-of-function screens, covering 18,333 genes  in 625 genomically characterised cancer cell lines (as of 19Q3 data release)19. In this dataset, common essential genes are defined as a gene that, in a large, pan-cancer screen, ranks in the top X most depleting genes in at least 90% of cell lines. X is chosen empirically using the minimum of the distribution of gene ranks in their 90th percentile least depleting lines. We sorted the essentiality data for mitochondrial genes using the MitoCarta 2.0 database of genes encoding mitochondrial-localised proteins20, totalling 1137 of the 1158 MitoCarta 2.0 genes  , and carbonic acid metabolism (CA5A)  Fig.\u00a0. Our fun5A) Fig.\u00a0. Thus, t2) (hypoxia-glucose) and (iii) galactose media and normoxia . Notably, two previous independent studies from the same group have described genome-wide CRISPR/Cas9 screens\u2014the first in galactose which assessed dying cells14, and the second in hypoxia which assessed viable cells15. Both studies used a non-adherent immortalised chronic myelogenous leukaemic (CML) cell line,\u00a0K56215. Thus here, we perform the first genome-wide CRISPR/Cas9 deletion screen comparing these three different metabolic conditions in parallel, using the same screening methodology, and in triplicate. For our study, we selected human osteosarcoma U2OS-HRE-luc cells (referred to as U2OS) originally described by us in a high throughput primary screening context24. U2OS cell responses to hypoxia have been well characterised by our group previously24, and these cells carry no known mutations in the canonical hypoxia-responsive HIF pathway, unlike the CML K562 cell line used in the previous genome-wide CRISPR studies15. Moreover, the reduction of U2OS cell growth in hypoxia (1% O2) compared to normoxia, is relatively small  had significantly altered sgRNA abundances under hypoxia compared with normoxia  gene18 that\u00a0is predicted to lead to a truncated protein product lacking the C-terminal oxygen-dependent domain.Next, we compared sgRNA abundance in U2OS-Cas9 cells cultured for 5 days in hypoxia-glucose compared to cells cultured in normoxia-glucose Fig.\u00a0. First, IP3 Fig.\u00a0. Our datARPC2, FNBP1, CDC42) and centromere attachment to microtubules   enrichment of sgRNAs targeting non-mitochondrial genes involved in mRNA processing and regulation of the actin cytoskeleton Fig.\u00a0. Further8A) Fig.\u00a0. Both trSDHC, a subunit of respiratory complex II, and an enzyme of the tricarboxylic acid (TCA) cycle   and elongation factors  involved in RNA processing , and actin polymerisation   and two involved in the pentose phosphate shunt   Fig.\u00a0. Indeed,ose Fig.\u00a0. Metabolose Fig.\u00a0. A reduc15 and galactose media14 were used in genome-wide CRISPR/Cas9 screens to interrogate gene essentiality, but which used different methodologies from our study and different cells15. Several of the mitochondrial genes whose loss improved U2OS cell fitness in hypoxia have been classed as common essential genes by the Achilles Project and were significantly depleted in normoxia in our CRISPR/Cas9 deletion screen. The finding that mitochondrial  gene essentiality is context-dependent is a conclusion borne out by other gene deletion studies under different conditions, such as metabolic stress or drug treatments33. We confirmed the results of our screening data by silencing SDHC, and found that the growth of U2OS, MCF7, and HeLa cells was improved under hypoxia. However,\u00a0this effect was not observed in HCT116 cells, which have a basal OCR twice that of U2OS cells3, and whose growth we found\u00a0was most impaired by hypoxia  mitochondrial genes is context-specific, and that tumour-relevant microenvironmental conditions such as hypoxia or changes in nutrients (e.g. glucose), alters the dependency of tumour cells on mitochondrial genes for their survival and growth. Our findings corroborate those described in two independent studies in which hypoxia32. Cytoskeleton rearrangement is a similarly energetically demanding process: for example, actin polymerisation requires the hydrolysis of a molecule of ATP for every addition of an actin monomer30. Thus, the improvement in tumour cell viability through the loss of actin polymerisation genes, and other cytoskeleton arrangement genes, may also be due to the benefit this provides to bioenergetic homoeostasis. It will be interesting to investigate whether changes in ATP availability in hypoxia  stimulate signalling pathways that regulate cytoskeleton arrangement processes in a similar manner to protein translation.Interestingly, compared to normoxia, we identified that loss of several genes involved in mRNA processing and translation, as well as cytoskeleton regulation, improved the fitness of cells in both hypoxia and galactose. Protein translation is an energetically demanding process, and the downregulation of global\u00a0translation in hypoxia has been well characterised\u00a0and linked\u00a0to changes in intracellular ADP/ATP ratios15. However, this peroxisome observation from the CRISPR screen could only be verified in one cell line of four tested, and could not be verified or recapitulated in the K562 cells used for the screen15. This highlights that reproducibility and cell to cell variability is an important consideration when interpreting the results of genome-wide CRISPR screens of this type. Importantly, here, we sought to address this by comparing our results with the pan-cancer gene essentiality data provided by the Broad Institute\u2019s Achilles project. Although this comparison has limited applicability due to differences in methodology, conditions and analysis pipelines, we were able to show from our overrepresentation analyses that there was direct corroboration in our depleted gene list, and the common essential genes identified by the Achilles Project  and non-adherent (K562) cells.Our study did not find that peroxisome-related genes were essential for the survival of U2OS cells in hypoxia, which was described in a genome-wide CRISPR/Cas9 hypoxia screen using K562 cellsTogether, our study, to the best of our knowledge, provides novel observations regarding the contextual nature of mitochondrial and non-mitochondrial gene essentiality in tumour cells and also corroborates previous observations in other cell types. In addition, different genes and pathways have been identified that warrant further investigation for their utility as therapeutic targets for both normoxic and hypoxic tumour cells. Our study also cautions that the development of therapeutic agents that target certain cellular processes, such as mitochondrial metabolism or translation, must take into consideration that their efficacy will depend on microenvironmentally induced adaptations in tumour cells, such as those mediated by hypoxia.2, 5% CO2 and 94% N2 in a Don Whitley H35 workstation, without agitation.Human U2OS osteosarcoma, MCF7 breast carcinoma, HeLa cervical\u00a0cancer, and HCT116 colon carcinoma cell lines were all obtained from American Tissue Culture Collection (ATCC). All cell lines were maintained in Dulbecco\u2019s modified eagle medium  containing glucose (4.5\u2009g/L), and supplemented with 10% foetal calf serum , penicillin (100\u2009IU/mL), streptomycin (100\u2009\u03bcg/mL) and glutamine (6\u2009mM), all purchased from ThermoFisher Scientific. Cell lines used were authenticated, and routinely confirmed to be negative for any mycoplasma contamination. Hypoxia was achieved by incubating cells in 1% O24) were transduced with lentivirus prepared from the pKLV2-EF1a-Cas9Bsd-W plasmid in the presence of polybrene (8\u2009\u00b5g/mL)19. Following transduction, U2OS-Cas9 expressing cells were selected with blasticidin (20\u2009\u00b5g/mL), and Cas9 expression and activity were confirmed. Briefly, to assess the ability of the U2OS-Cas9 expressing cells to efficiently silence full-length gene expression, cells were transduced with a lentivirus produced from the Cas9 reporter vector, pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W which was a gift from Kosuke Yusa 36. This vector contains BFP and GFP expressing cassettes, as well as an sgRNA targeting GFP\u2014efficient Cas9 activity would therefore be expected to result in silencing of GFP signal. The ratio of BFP-only and GFP-BFP-double-positive cells was analysed on a BD LSRFortessa instrument (BD Biosciences), 3 days post lentiviral transduction. The data were subsequently analysed using FlowJo (BD Biosciences). Efficiently transduced U2OS-Cas9 cells showed high BFP expression but the loss of GFP signal, indicating that the majority of the U2OS-Cas9 cells expressed active Cas9.Human U2OS osteosarcoma cells , dissociated with 12\u2009mL of 0.5% trypsin\u2013EDTA (ThermoFisher #25300096), and resuspended in 18\u2009mL of media , per flask.Two days after CRISPR library transduction, cells were exposed to puromycin (2\u2009\u00b5g/mL) for at least 10 days, then the U2OS-Cas9 library cells were analysed on a BD LSRFortessa instrument (BD Biosciences) to confirm >90% BFP positivity. The U2OS-Cas9 library cells were then selected with puromycin for a further 4\u20135 days during expansion, and at least 20\u2009\u00d7\u2009106 cells were plated into triple flasks (15\u2009\u00d7\u2009106 cells per triple flask) in \u2018standard\u2019 DMEM, then incubated at 37\u2009\u00b0C/5% CO2/normoxia for 24\u2009h. After 24\u2009h, the \u2018standard\u2019 glucose-containing media was replaced with glucose-free galactose-containing media -galactose, 4\u2009mM l-glutamine, 1\u2009mM sodium pyruvate, and 10% FCS), in a subset of flasks, to pre-condition the cells. To begin the screen, for each experimental condition (described below), 21\u2009\u00d7\u2009106 U2OS-Cas9 library cells were transferred to 7 separate triple flasks (3\u2009\u00d7\u2009106 cells per triple flask) and left to adhere overnight under normal culturing conditions (37\u2009\u00b0C/5%\u00a0CO2/normoxia). The following day, the medium was replaced with fresh medium for each condition, and cells were placed in the desired atmospheric conditions (normoxia or hypoxia (1% O2)). Cells were grown for 5 days under the following experimental conditions: (1) cells grown in \u2018standard\u2019 glucose-containing medium in normoxia (normoxia-glucose), (2) cells grown in \u2018standard\u2019 glucose-containing medium in hypoxia at 1% O2 (hypoxia-glucose), and (3) cells grown in glucose-free galactose-containing medium in normoxia . No passaging of cells was carried out for the duration of the screen. Three independent repeat screens were performed, each of which assessed three conditions in parallel, normoxia-glucose, hypoxia-glucose, and normoxia-galactose  using 10\u2009\u03bcM concentrations of forward and reverse primers (below) following which PCR products were purified using spin columns before a second PCR reaction was carried out to incorporate indexing primers for each sample. DNA was purified using SPRI beads and submitted for Illumina sequencing.Genomic DNA extraction and Illumina sequencing of sgRNAs were conducted\u00a0as followsF primer: ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACAR primer: TCGGCATTCCTGCTGAACCGCTCTTCCGATCTCTAAAGCGCATGCTCCAGAhttps://sourceforge.net/projects/mageck/)25. As an initial quality control assessment, we compared the Control samples to the Plasmid library for essential depleted genes. We confirmed that the majority of depleted genes were those expressed at higher levels, with almost no depletion for non-expressed genes. Additionally, gene set enrichment analysis of genes based on their depletion scores confirmed that essential biological processes for cell survival were the most significantly depleted in\u00a0each condition. These included genes from spliceosome, ribosome, DNA replication and RNA polymerase families.Enrichment and depletion of guides and genes were analysed using Robust Ranked Aggregation in the MAGeCK statistical package (ver 0.5.6) by comparing read counts from the Treatment samples with those from the Control samples and using the \u2018--min-number-goodsgrna min_number\u2019 function to filter genes that have less than 2 \u2018good sgRNAs\u2019, or sgRNAs that fall below the -p threshold  from Abcam; rabbit polyclonal SDHA  from Cell Signaling\u00a0Technology; rabbit polyclonal UQCRC2  from Abcam; rabbit polyclonal COXIV  from Cell Signaling\u00a0Technology; rabbit polyclonal BNIP3  from Cambridge Biosciences; rabbit polyclonal SDHC  from Invitrogen; mouse monoclonal \u03b2-Actin  antibody from Abcam; donkey anti-rabbit  and anti-mouse  horseradish peroxidase (HRP)-linked secondary antibodies from VWR. Western blot signal intensity was measured per lane using ImageJ (NIH) analysis software. Sample protein band intensities were normalised to the load control protein \u03b2-Actin. Relative band intensities were calculated relative to the internal control sample.OCR was determined using a Seahorse XF96 Analyser (Seahorse Bioscience). Respiratory profiles were generated by serial treatment with optimised concentrations of oligomycin (1\u2009\u00b5g/mL), p-[trifluoromethoxy]-phenyl-hydrazone , and rotenone (500\u2009nM). Cell number normalisation was carried out post-respirometry using sulforhodamine B (SRB) staining of TCA fixed cells in the assay plate.For gene expression analysis and mitochondrial copy number methodology using QPCR, see\u00a0Cells were plated in appropriate tissue culture vessels and allowed to adhere overnight prior to siRNA transfection or compound treatment.Transfection complexes were made by combining 50\u2009nM siRNA (for siRNA sequences see Supplementary Table\u00a02) for 72\u2009h.Standard growth media was replaced with compound free DMEM containing either 25\u2009mM glucose or galactose, or containing 31.25\u2009nM rotenone. Cells were then incubated in normoxia or hypoxia  trichloroacetic acid (TCA) for 30\u2009min. TCA was washed with water, wells were allowed to air dry, and then an excess of 0.4% (w/v) SRB in 1% acetic acid was used to stain fixed cells for >10\u2009min. Excess SRB was washed off with 1%\u00a0(v/v) acetic acid solution. Bound SRB was resuspended in a suitable volume of 10\u2009mM Tris, and absorbance of the solution measured at 570\u2009nm.https://depmap.org/portal/download/)18. 19Q3 data release used throughout, covering 625 cell lines. Overrepresentation analyses were carried out at the Broad Institute analysis portal (http://software.broadinstitute.org/gsea/msigdb/annotate.jsp). FDR q-value set at 0.05.Common essential gene lists were accessed from the Broad Institute Cancer Dependency Map data portal (38. Proteins in the networks were grouped based on their STRING interactions using Markov clustering in the clusterMaker2 app (v 1.3.1)39, with additional manual curation. Clusters were functionally characterised using the stringApp to perform functional enrichment analysis, with the corresponding non-clustered network set as the background.Protein\u2013protein association networks were generated using the stringApp v 1.5.1 in Cytoscape v 3.8.0n), error bars and p values are described in each figure legend. All statistical analysis of data carried out in Microsoft Excel, apart from analysis of sgRNA sequencing data which was carried out in MAGeCK (version 0.5.5). For growth assays and QPCR, conditions were compared by two-tailed unpaired t tests. For comparison of sgRNA abundances, all genes were ranked for enrichment and depletion separately by the \u03b1-RRA method in MAGeCK25. Multiple comparison correction was applied using the Benjamini\u2013Hochberg method, following exclusion of genes with fewer than 2 \u2018good\u2019 targeting sgRNAs (p\u2009<\u20090.1), and an FDR threshold of 0.3 (30%) was applied.A number of replicates (Further information on research design is available in the\u00a0Peer Review FileSupplementary InformationDescription of Additional Supplementary FilesSupplementary DataReporting Summary"}
+{"text": "Event extraction technology is one of the important researches in the field of information extraction, which helps people accurately retrieve, find, classify, and summarize effective information from a large amount of information streams. This paper uses the neural network hybrid model to identify the trigger words and event categories of the legal domain knowledge graph events, extracts the events of interest from a large amount of free text, and displays them in a structured format. First, the original text is preprocessed, and then, the distributed semantic word vector is combined with the dependent syntactic structure and location attributes to create a semantic representation in the form of a vector. The combined deep learning model is used to extract activated words, the long-term memory loop neural network uses temporal semantics to extract deep features, and the convergent neural network completes the extraction of activated words and event categories. Finally, the experimental results show that the accuracy of event extraction of the neural network hybrid model designed in this paper has reached 77.1%, and the recall rate has reached 76.8%, which is greatly improved compared with the traditional model. In recent years, artificial intelligence, as a field of computer development, has gradually matured into technology and media. Since Google introduced the concept of \u201cknowledge graph\u201d in 2012, the scope of knowledge graph has now covered dozens of vertical fields such as law, finance, military, education, medical care, and technology, and it is expanding rapidly with a clear development trend. Extracting facts from the knowledge map of the legal field is the research focus of extracting legal information. Due to the high data integration capabilities of the knowledge graph, the information extraction methods, reasoning mechanism, and knowledge visualization research in the knowledge graph are difficult and easy to study in various vertical operating environments. In the legal industry, the knowledge graph can be displayed in two formats: graph and spectrum. Through the clarification and reasoning of related entities, link prediction can be realized; infer the knowledge points possessed or understood by the entity, compare the weight of the knowledge points and the difficulty of the knowledge points, and infer the degree and importance, weight ratio, and feedback control status.The knowledge graph refers to a collection of entities, concepts, and relationships between entities. Knowledge graph can be applied to various natural language processing technologies, and fact extraction technology plays a very important role in the construction of knowledge graph. For example, the loss of connection event news text of Malaysia Airlines MH370 uses event export technology to automatically export members and roles related to events such as show time, victims, and location. The rise of the knowledge graph is accompanied by the related concepts of machine learning technology in the field of artificial intelligence. The key is to collect a large amount of structured or unstructured data, analyze and model the data based on domain knowledge, and find the law from it through machine calculation. Machines can recognize and learn patterns. Create calculation rules for related data after formation. Nowadays, many integrated event extraction mechanisms have achieved good results on the problem of knowledge graph event extraction in the legal field. However, compared with other areas, compliance and recall rates are generally low, and there are still major problems and room for improvement. The domain scalability and portability of event extraction systems are not ideal. Most of the current studies are based on MUC or ACE and only focus on a specific field or a few types of events. The application of the system is limited by the field, and it cannot be easily and quickly transplanted or extended with the change of the field.The wavelet and neural network hybrid model (WNN model) shows better performance than the ANN model. In addition, the WNN model has been developed to predict the wave height of a single location where past wave height data can be obtained. In response to these problems, Oh and Suh combined empirical orthogonal function analysis and wavelet analysis with neural networks to develop a hybrid model (referred to as EOFWNN model). Past wave height data of multiple locations and past and future weather data of the surrounding area including the wave station are used as input data. However, their accuracy decreases as the lead time increases because they do not consider the relationship between wave height and meteorological variables . Lei et The innovation of this work realizes the complete process from initial data set to activation word extraction, checking and replacing original samples, and creating rule descriptions at the proposal level. The body performs preliminary feature extraction to obtain a vector matrix that the model can train. Using the cyclic neural network model of long-term memory and short-term memory, the time characteristics of sentences are trained from the positive and negative aspects of the output. Finally, the convergent neural network model is used to train the previously derived deep features to complete the classification, that is, to extract the activation words and event categories. In addition, this research uses a mixture of various neural network algorithms to make the research proceed successfully.The knowledge graph is a complex semantic network with many entities, which graphically displays the entities, the related attributes contained in the entities, and the relationships between the entities , 8. The The knowledge map in the legal field is quite different from the knowledge maps in other fields due to its unique nature , 12. In Modern information technology is promoting a major transformation of the judicial system. The \u201csmart court building\u201d focusing on artificial intelligence court applications, electronic litigation, and court big data is paralleled with judicial system reform. Artificial intelligence intelligently advances cases, predicts judgment results, and automatically generates judgments. This can be applied in the essay. The basic fact-based theories of court judgments are essentially compatible with the laws of artificial intelligence generation and can be used as the basis for deep neural network learning, word segmentation, and knowledge graph design, and front-end theories are added. The specific application path is the continuous implementation of hierarchical deconstruction based on essential facts, the deconstruction of the application of case knowledge at all levels of data, and the gradual implementation of the hierarchical implementation of legal experts. This provides machine learning to form a large-scale-labeled legal knowledge map.N + 1 layer of the neuron until the final output. The structure of artificial neural network is mainly composed of three elements: neurons, network topology, and network learning algorithm.Artificial neural network is a technical copy of biological neural network in a specific simplified sense. The corresponding learning algorithm simulates certain intelligent activities of the human brain and is technically copied to solve practical problems , 16. Arta1, a2 \u22ef ax, the connection weight is b1, b2 \u22ef bx, and the calculation formula of the neuron isSet the input data as R represents the current state of the neuron, a represents the output data, and c represents the bias.f is called the activation function, which can transform the output into a specified interval. It is a widely used nonlinear function, also known as the sigmoid function, which is defined asThe function The function is strictly monotonously increasing and continuously differentiable, with a value between 0 and 1.m nodes, which are connected to the hidden layer at the previous moment. The weight matrix connecting the hidden layer uses random data to prepare the hidden layer [The input layer and the hidden layer are fully connected. The hidden layer has en layer , 18.Rn at the nth node of the hidden layer, then:The forward propagation process of the input signal, inputXij is the activation function of the hidden layer, and tij is the bias vector of the hidden unit.Among them, En at the nth node of the hidden layer:Output si activation function, and \u03b3i is the bias vector of the output layer.Among them is the Rn at the mth node of the output layer:Enter Km at the mth node in the output layer:Output First, calculate the difference between the output value and the expected value from the output level, which is also called input error , 20, calEh for each sample h isThe quadratic error criterion function E of the system for H training samples isThe total error function According to the error step reduction method, the weight and offset compensation of each layer in the network are calculated in turn, and then, the weights and offsets of each neuron in the network are updated until the error is reduced to a certain extent or the maximum number of training times is reached.Convolutional neural network is a kind of feedforward neural network that includes convolutional computation and has deep structure and is one of the representative algorithms of deep learning. Convolutional neural network is a creative research result produced by referring to the structural principles of biological visual nervous system and improving artificial neural network. Compared with the multilayer feedforward neural network, the convolutional neural network has the advantages of fewer model parameters, simultaneous feature learning and classification, global optimization, and strong generalization ability. Now, it has become the current research hotspot in the field of computational neuroscience. The operation of the convolutional neural network can be regarded as the product operation of the convolution kernel and the input matrix. The convolution kernel moves on the input matrix to obtain the characteristic matrix sequence of the input vector. If multiple convolution kernels are selected, the input matrix can be obtained , 24.The convolutional neural network is used to select the important part of the feature information learned by the convolutional layer. Convolutional neural networks will have hundreds of millions of neuron connections, resulting in a huge amount of parameters. However, convolutional neural networks operate on local areas and share weights, which mean that the same weights will be applied to all inputs, which greatly reduce the parameters and increase the computing speed. The traditional feature engineering method is too much manual feature design. Convolutional neural networks rely less on the prior knowledge of the domain, and unlike traditional algorithms, they need to manually design complex features.Different from the convolutional neural network, the cyclic neural network uses the sentence sequence as the input to model the serialization of the sentence . RecurreThe recurrent neural network here uses a long- and short-term memory (LSTM) structure. The system is composed of two opposite cycles paralleled by the network, and then, the outputs of the two networks are spliced to obtain the deep features of the final sentence. Such a loop mechanism makes it possible for each node to get all the semantic features from the first word of the sentence to the current word, but such features are not sufficient for the judgment of event trigger words and event elements. To obtain a complete context features, it is also necessary to know that the words after the current word have an impact on the semantics of the current word , 28. In The network topology is composed of many basic neurons in the processing unit. These neurons are connected in a specific way to form a network structure, which is called a neural network topology. It usually consists of an input layer, a hidden layer, and an output layer. At present, there are mainly the following two network topological structures: the first is the forward network. The connections between neurons in this structure are simply from in to out. The structural connection of the feedback network is more complicated, and it can receive input or send to it. Other neurons output, so there is feedback.H and the position j of the previous candidate word are used as the input vector of the model. After the convolution and pooling of the model, a pair of context features is extracted, and finally, the softmax classifier is used for multiple classifications. If the classification result is a nonpiece label, the current candidate word is not a trigger word. The training process of the convolutional neural network includes convolution, pooling, and classification. Pooling, also known as downsampling, is essentially a reduction of the data. How to extract features from an array of pixels is actually what the convolutional neural network does [After the above steps, the deep features of the sentence are obtained. Each sentence in the corpus corresponds to a deep feature, and each word still corresponds to a feature vector, and the vector corresponds to a word. In the phase of trigger word extraction, the problem of trigger word recognition is regarded as a multiclassification task. There are nine event categories, plus a total of ten categories of nonevents, so the classification result has ten labels. The candidate trigger word dictionary of the language has been obtained above. The trigger word extraction process is to traverse each candidate trigger word of each sentence and then judge whether the current candidate word is the trigger word of the sentence. The training is based on the sentence, and the deep feature ork does , 30.When using a machine learning model for event extraction-related issues, the event features are usually extracted first. These features will help the model understand the text to a certain extent, but they are limited to the part of the sentence and cannot make full use of the syntax of the text. Structure, lack of grasp of the overall structure was sentence. Dependent syntactic structure analysis is a key task in natural language processing. It can identify and analyze the subject, predicate, object, definite, adverbial, and complement structures in a sentence and find the dependency of each component in the sentence. A dependency relationship corresponds to two words, a keyword and a dependent word. Only one part of each sentence is independent, and other words depend on another component, and each component is dominant and interdependent. Make the semantic association of the sentence get rid of the interference of the actual word position, and it is easier to be extracted. Therefore, the dependency syntactic structure is of great significance for the model to understand the semantics of the text and grasp the overall structure of the sentence.On top of this, there is the combination of two modes, as well as the addition of various derivative methods such as statistical methods and machine learning methods. There are also a large number of excellent systems for different fields. Different systems have their own preferences due to different concerns. Therefore, different syntax analyzers will also affect the extraction performance to a certain extent.A word vector refers to assigning a word to a space vector, using the vector to represent the word, and performing subsequent model calculations. The spatial distance of the word vector (such as Euclidean distance and cosine distance) can be used to judge whether the semantics of two words are close. The smaller the spatial distance corresponding to the word vector, the closer the semantics of the two words are. For each word to be tested, first summarize the corresponding word vector from the word vector table, and enter the input layer. The convolutional layer can capture the meaning of the birth level and compress it into the feature map.Trigger word extraction determines the number of events in the sentence, as well as the trigger word and event category of each event, and the event element extraction is based on the known trigger word, and the participating elements of each event and its corresponding role are carried out. Identify and constitute a complete biomedical event. This chapter completes the extraction of event elements, regards the detection of event elements as a relationship extraction problem, sequentially determines the relationship between the trigger word and each entity in the sentence and the trigger word, and determines whether the current word is an event element according to the corresponding relationship category and the role corresponding to the event element.In the element recognition stage, this article does not distinguish between event types. The candidate vocabulary of each sentence contains entities and trigger words at the same time. The candidate vocabulary is traversed, and the relationship with known trigger words is judged one by one. For simple events, there are only two types of subject relationship and no relationship, and the relationship pair can only be trigger word-entity; for complex events, there are subject relationship, target relationship, and no relationship, and the relationship pair may be trigger word-entity and words-trigger words. After identifying all the relationship pairs, according to the type and number of the relationship pairs of each trigger word, do not sort them into simple events, bound events, and complex events. Eventually, all types of events are merged to form a collection of events. In the process of element extraction, it is necessary to use the trigger word annotations obtained in the previous chapter and the layer features representing the original corpus and use the dynamic multipooling convolutional neural network model to extract the relationship pairs. The convolutional neural network model is the same as the structure used in the previous chapter, including the process of convolution, pooling, and classification, and the classification here is to determine the relationship between the trigger word that has been identified in the previous sentence and each word, and there are coexisting topics. There are three categories of relationship, target relationship, and irrelevance.As an important task in the field of natural language process (NLP), event extraction task has high application value. The more mature maximum entropy and conditional random field methods in the field of event extraction are used for event extraction. By selecting the optimal features, the accuracy of recognition is improved as much as possible, and this part of the work is used as the two comparison standards (benchmark system) for deep learning. Because the commonly used features contain less semantic information and the generalization ability is poor, this chapter introduces deep semantic features that improve the event extraction capabilities of traditional methods.Due to the unbalanced data rate distribution, the traditional event extraction method has a poor recall rate. The reason is that the number of exported body samples is very small over time, and the distribution of event types is extremely unbalanced. Few examples of event types and unbalanced variance often lead to errors when training machine learning models. If the learning model is not fully trained, it will cause more types of learning bias. This type of deviation usually leads to recall problems.This paper proposes an event type recognition method based on affinity, which aims to spread event information in related documents in the tested document, so as to improve the event search rate of the tested document. The distribution of events is also likely to be consistent, especially in documents describing related issues. Based on this, the event information displayed in the relevant document is used to supplement the export result of the document to be tested. In many cases, part of the basic export unit can be obtained. The parameter is set to the word vector dimension of 400 dimensions, the sequence length of the cyclic neural network is 32, the batch size is 256, the number of iterations is 100,000, the convolution kernel window size of the convolutional Bible network is 5, and the number of convolution kernels is 200. Iterate 10,000 times. The parameter estimates of the activation function of the hidden layer and the output layer are shown in This experiment uses the subsets WN11 and WN18 of Word Net. And Freebase's subset FB13 and FB15K data sets are dedicated data and structure of the knowledge graph. The data set includes one-to-one, one-to-many, many-to-one, and many-to-many entity relationship types. There are a total of 11 and 18 relationships in WN11 and WN18. One-to-one, one-to-many, and many-to-one relationships do not exist. There are 11 and 18 N-N types of relationships, respectively. There are a total of 13 entity relationships in FB13, of which there is one type of N-1 relationship and 12 types of N-N relationship. FB15K has a total of 1345 entity relationships. The relationship categories in the data set are shown in For these two data sets, this paper traverses all training tuples through 500 cycles. In terms of data parameter selection, the optimization selection criteria of related experiments in trans E are used for reference.Event extraction task is an important and challenging information extraction task, which aims to discover event trigger words and identify its event type. The existing traditional methods mostly use artificially designed feature sets, and these features are often extracted through text analysis and language knowledge. Generally speaking, features can be divided into two categories: lexical features and contextual features. Lexical features include part of speech and morphological features , which can capture the meaning and background knowledge of the word to be tested.The generalization ability of traditional feature engineering-based methods is not enough. In the case of insufficient training corpus, the model obtained by fully supervised learning is changed to other test sets, and the performance often drops significantly. Word embedding contains richer semantic information of words and has better generalization ability. The neural network model takes word vectors as input, does not require complicated process of feature engineering, and also reduces the problem of error transmission. The neural network model itself has a strong learning ability, and then using word vectors as input, the trained model will achieve better performance. The learning efficiency of the model and the accuracy of the output results are significantly improved.Randomly select 100 events as the training samples and test samples of the input and target vectors. The vector settings are shown in After many experiments, use existing network functions and training sample data to analyze the extraction results of sample events.The network performance test results of the neural network hybrid model are shown in From the figure, we can see that the prediction accuracy percentage of the maintained sample reaches 100%, and the network performance is good. At the same time, the prediction accuracy percentage of the training sample and the test sample is also maintained at a high level, indicating that the model prediction accuracy rate is relatively high.F1 values of 60.86% and 55.52%, respectively. When performing event recognition and classification, the performance of event recognition  does not increase with the increase in the number of random layers. When the hidden layer increases from layer 1 to layer 2, the F1 value of the event type category increases, but when the hidden layer increases from layer 2, the F1 value becomes smaller and smaller. The reason for the analysis may be that when the number of hidden layers is small, the more the number of layers, the stronger the learning or representation performance of the neural network; but when the number of layers increases, on the one hand, the more layers, the more parameters need to be trained. On the other hand, it is difficult for the backpropagation algorithm to pass the residual error to the previous hidden layer, which may cause underfitting of the model.The trend line of model training accuracy is shown in F value of the system are shown in The neural network hybrid model designed in this paper recognizes the event type at the same time when triggering word recognition. The neural network hybrid model regards trigger word recognition as a classification task, including defined nine event types and nonevents, a total of ten types. Experiments of the accuracy rate, recall rate, and F value is basically around 80, but the recognition effect of mixed events is poor. Later, the characteristics of the mixed events will be summarized to improve the recognition effect.It can be seen that the system has a good recognition effect on the trigger word extraction of simple events. The The results of comparison with traditional machine learning methods are shown in Comparing the method in this paper with the traditional method, under the same environmental conditions, it can be clearly seen that the accuracy of the model used in this paper has reached 77.1%, and the recall rate has reached 76.8%, which is a great improvement over the traditional model.This paper proposes a neural network hybrid model to extract events in the knowledge map of the legal field, which has certain progress in the in-depth mining of features. At the same time, combining the characteristics was legal field, formulating reasonable rules, optimizing the identification method, and realizing a complete legal field event extraction mechanism. In addition, this topic combines the advantages of convergence and iterative neural networks to propose a model for extracting events for common convergence and bidirectional iterative neural networks. Experimental results show that, compared with traditional methods, the hybrid neural network model provides significant performance improvements. Event extraction is a challenging research direction. In the extraction process, no complex event processing results in poor final recognition of complex events; in the postrule processing link, although parts of the results of recognition errors are filtered out, some trigger words or parts of the event elements are correctly recognized, but the element recognition is incomplete. In the event recognition stage of this article, a neural network is used to extract the relationship between the trigger word and the candidate word, and all the relationship pairs are derived at the same time, and then, simple and complex event creation is done. According to the type of relationship, finally, different types of events are used. Event definitions are used to exclude noncompliant events. Traditional event extraction also removes a large number of correctly derived activation words, but the event data is exported for free, which reduces the recall rate. Therefore, in order to improve the recognition results, it is also necessary to design more accurate rules. The neural network hybrid model used in this paper fully extracts the time and environmental characteristics of the body and obtains highly recognizable results. However, it cannot be used for complex events. From the results, the results of simple event recognition are much better than complex events, whether it is activation word recognition or event data recognition. Therefore, how to design the function of complex events is a problem that needs further research. In the subsequent research, we will continue to research and improve these problems to further improve the extraction effect."}
+{"text": "Currently there are no biomarkers that are predictive of when patients with type-2 diabetes (T2D) will progress to more serious kidney disease i.e., diabetic nephropathy (DN). Biomarkers that could identify patients at risk of progression would allow earlier, more aggressive treatment intervention and management, reducing patient morbidity and mortality.Study participants  were recruited from the renal unit at Antrim Area Hospital, Antrim, UK; Whiteabbey Hospital Diabetic Clinic, Newtownabbey, UK; Ulster University (UU), Belfast, UK; and the University of the Third Age (U3A), Belfast, UK; between 2019 and 2020. Venous blood and urine were collected with a detailed clinical history for each study participant.In total, 13/25 (52.0%) biomarkers measured in urine and 25/34 (73.5%) biomarkers measured in serum were identified as significantly different between control, T2D and DN participants. DN patients, were older, smoked more, had higher systolic blood pressure and higher serum creatinine levels and lower eGFR function. Serum biomarkers significantly inversely correlated with eGFR.This pilot-study identified several serum biomarkers that could be used to predict progression of T2D to more serious kidney disease: namely, midkine, sTNFR1 and 2, H-FABP and Cystatin C. Our results warrant confirmation in a longitudinal study using a larger patient cohort. Almost all patients with diabetes will display some evidence of kidney disease , 2. HoweDN is a serious kidney-related complication of diabetes and is one of the leading causes of end-stage renal disease (ESRD) requiring extensive patient management . The aveAlmost 1 in 10 adults in the UK are affected by CKD, costing the NHS over \u00a31.5 billion/year . SimilarCurrently, diabetic patients are routinely monitored by measuring urinary protein (proteinuria) and serum creatinine . HoweverProteinuria is usually divided into three categories: transient or intermittent, orthostatic and persistent. Transient proteinuria is the most commonly reported form of proteinuria. Elevated proteinuria levels reflect the extent of the damage to the glomeruli whereas serum creatinine is used to calculate the estimated glomerular filtration rate (eGFR) . AlbuminClinical risk factors for DN progression include age, BMI, smoking status, glycated haemoglobin (HbA1c), elevated systolic blood pressure, diabetic retinopathy, high-density lipoprotein, triglyceride, increased urinary albumin excretion and declining eGFR \u201319. PatiIn mouse models for both Type I and T2D, a ketogenic diet has been shown to potentially reverse DN, when assessed by albumin:creatinine ratios and expression of stress-induced genes. Thus, there are mechanism(s) for kidney repair that suggest that DN is potentially reversible. As such, this evidence highlights why it is so important to frequently screen for kidney disease progression. Thus, if clinicians could stratify which diabetic patients are likely to progress to more serious kidney disease e.g. DN , more agSubclinical inflammation and oxidative stress have been implicated in the pathogenesis of DN . FurtherFortunately, not all diabetic patients will develop kidney disease. However, identifying patients who are at risk is challenging and current biomarkers do not always precede declining renal function . To dateRecently we identified a panel of biomarkers that predicted renal damage in patients undergoing cardiac surgery and orthopaedic surgery , 28. UsiStudy participants  were recruited between 2019 and 2020 from Whiteabbey Hospital Diabetic Clinic, Belfast, UK; the renal unit at Antrim Area Hospital, Antrim, UK; Ulster University (UU), Belfast, UK; and the University of the Third Age (U3A), Belfast, UK. Study participants were asked to complete a questionnaire to obtain information on their medical history and lifestyle/behaviours . Anthropometric details were also recorded for each patient to include height (cm), weight (kg) and blood pressure (mmHg). Blood pressure measurements were taken immediately following completion of the recruitment questionnaire. Estimated glomerular filtration rate and HbA1c were also recorded. Exclusion criteria included participants <18 years of age with autoimmune disease or who had been diagnosed with a condition or illness that could impact kidney function e.g., hepatitis B or C, polycystic kidney disease and/or stones. The study was approved by Ulster University School of Biomedical Sciences Filter Committee and University Research Governance and the Northern Health and Social Care Trust. Formal written informed consent was obtained from all participants and samples were collected in an outpatient setting. Participants received detailed information on the proposed study and were also invited to ask questions. The study was conducted according to the Standards for Reporting Diagnostic Accuracy (STARD) guidelines to facilitate interstudy comparison .Venous blood (10\u00a0ml) and urine (10\u00a0ml) (where possible) was collected from all DN patients. Venous blood (20\u00a0ml) and urine (10\u00a0ml) samples were obtained from all other study participants. Blood samples were stored at room temperature for 30 to 60 minutes to allow clot formation. Vacutainers were centrifuged at 1300\u00a0g for 10 minutes at 4\u00b0C and the serum was carefully decanted and aliquoted into prelabelled cryovials and stored at -80\u00b0C until analysis. The urine was aliquoted into prelabelled cryovials and stored at -80\u00b0C until time of analysis.Aution sticks (10AE) were used for dipstick urinalysis and were interpreted using a PocketChem analyzer from Arkray Inc., Japan, according to manufacturer\u2019s instructions.595nm. Total urinary protein (mg/ml) was determined from a BSA calibration chart (1 to 5 mg/ml).Total urinary protein levels (mg/ml) were determined, in duplicate, by Bradford assay  using a stock solution of BSA (Sigma) as standard (2 mg/ml). Patient urine samples (10 \u03bcl/patient), after centrifugation , were mixed with Bradford reagent (1\u00a0ml) and allowed to stand for 5 minutes. The samples were read at room temperature on a Hitachi Spectrophotometer (Model No. U-2800) at a wavelength of AUrine osmolality (mOsm) was determined, in duplicate, for each study participant using a L\u04e7ser Micro-osmometer according to manufacturer\u2019s instructions .Biochip Array Technology (BAT) was used by Randox Clinical Laboratory Services (RCLS), Randox Science Park, Antrim, Northern Ireland, UK for the simultaneous detection of multiple biomarkers from a serum and/or urine patient sample  for the The following biomarkers were measured in serum; transferrin (0.08 g/l), microalbumin (5.11 mg/l), heart-type fatty acid-binding protein (H-FABP) (2.94 ng/ml), cystatin C (0.4 mg/l), albumin (3.2 g/l), total antioxidant status (TAS) (0.21 mmol/l), urea (0.51 mmol/l) and creatinine (11.4 \u03bcmol/l) using the Imola analyzer , according to the manufacturer\u2019s instructions. HDL cholesterol (HDL) (0.189 mmol/l), LDL cholesterol (LDL) (0.189 mmol/l), total cholesterol (0.865 mmol/l), triglycerides (22.9 mg/dl) and creatinine (311 \u03bcmol/l) were measured on a Daytona analyzer . Insulin (2.78 pmol/l) was measured using a Cobas e801 analyzer . Microalbumin and creatinine were also measured in urine.Urine and serum midkine concentrations were measured using a commercial ELISA from LyraMid, Sydney, Australia, according to the manufacturer\u2019s instructions.Statistical analysis was undertaken using R . Data beParticipant demographics, anthropometric measurements, clinical information, medications, and participant behaviours are described in There were significantly more males in the T2D and DN groups; DN subjects were significantly older, T2D and DN subjects had significantly higher systolic blood pressure; and there were more smokers in the T2D and DN groups. As such, there were more T2D and DN patients prescribed medications for hypertension and cholesterol reduction. In addition, DN participants had the highest incidence of retinopathy, cardiovascular disease, prostatic hyperplasia, and kidney stones.Urinary glucose, pH and protein levels were significantly different across groups   is clinically important so that aggressive treatments can be introduced to prevent irreversible damage to the kidney. This pilot study investigated both serum- and urine-based biomarkers to identify a potential biomarker or biomarker combination(s) with practicable clinical utility. Progression of kidney disease, in this pilot study, was based on declining eGFR function and increasing serum creatinine levels.In total, 34 serum biomarkers were investigated; 25/34 (73.5%) were significantly different across patient groups  Table\u00a02 In total, 25 urine biomarkers were investigated; 13/25 (52.0%) were significantly different across patient groups  Table\u00a03 The AUROC for each of the biomarkers that differentiated control from T2D, and T2D from DN subjects, are described in Urine and serum sTNFR1, sTNFR2 and midkine exhibited the same pattern observed for H-FABP Figure\u00a02Serum biomarker correlations with eGFR for T2D vs. DN participants, demonstrated that only serum biomarkers, as expected, correlated with eGFR Figure\u00a03Diabetic nephropathy is a serious progressive pathology that requires immediate medical intervention. However, identifying diabetic patients that will progress to DN remains challenging as the underlying pathophysiology of the disease is unclear. Furthermore, albuminuria and decreased kidney function (eGFR), standard end points that are employed clinically to diagnose DN, only identify the disease once established. Currently, there are no biomarkers that can predict progression in T2D to DN. Biomarkers that could help identify which patients are at risk of progression would allow clinicians to implement early and aggressive treatment management. Furthermore, biomarkers that are predictive would also allow monitoring of therapeutic intervention and effectiveness of treatment regimens.In this pilot study, we compared the expression of 34 biomarkers in serum and 25 in urine, known to be involved in renal disease Figure\u00a03mid-gestation, hence the name midkine. Midkine is restricted mainly to certain tissues in the normal adult. However, it is strongly induced during oncogenesis, inflammation, and tissue repair . Midkine is a non-glycosylated protein, composed of two domains held by disulphide bridges. Midkine is a developmentally important retinoic acid-responsive gene product strongly induced during e repair , 33.in vivo, midkine is immediately induced in the proximal tubules, leading to the up-regulation of macrophage inflammatory protein-2 (MIP-2) for neutrophils and monocyte chemotactic protein (MCP-1) for macrophages  that have been shown to be promising new biomarkers for detection of renal injury . H-FABP Elevated serum L-FABP has been shown to positively correlate with obesity and insulin resistance . TherefoCST3 gene. Cystatin C is a biomarker of kidney function and for predicting new-onset or deteriorating cardiovascular disease  model discrimination, (b) model calibration and, (c) risk reclassification . TherefoThe main limitations of the study include (1) the small sample number of participants in each group, which in turn limited evaluating the biomarkers by gender, (2) the number of DN urine samples that were available for analysis, (3) and no staging information for DN patients. However, despite the limitations of this pilot study, the results warrant further investigation. Novel biomarkers that could be used for stratifying risk of progression of T2D to DN offer significant clinical utility and decreased morbidity and mortality for the patient. Furthermore, identifying patients at risk of progression allow better use of hospital resources.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Ulster University School of Biomedical Sciences Filter Committee and University Research Governance and the Northern Health and Social Care Trust. The patients/participants provided their written informed consent to participate in this study.Concept and study design \u2013 DC, SB, FJ, SBr, MJK, JVL, PF, TM, and MWR; Statistical analysis \u2013 CH, JW, and MWR; Manuscript preparation \u2013 JW, MJK, JVL, PF, and MWR; Sample collection and processing \u2013 CH, SB, FJ, AS, and MWR; Manuscript review \u2013 CH, DC, SBr, SB, FJ, AS, JW, MJK, JVL, PF, TM, and MWR. All authors contributed to the article and approved the submitted version.This study was funded by the Randox Laboratories Ltd \u2013 Ulster University Industrial Ph.D. Academy.The authors declare that this study received funding from Randox Laboratories Ltd as part of the Randox Laboratories Ltd \u2013 Ulster University PhD Academy Studentship. Randox had the following involvement in the study: analysis of patient samples, statistical analysis, supervision of the project, preparation of the manuscript, and the decision to publish.SBr, JW, MJK, JVL, and MWR are employees of Randox Laboratories Ltd. but hold no shares in the company. PF is the managing director and owner of Randox Laboratories Ltd. A patent has been filed to protect the biomarker combination disclosed in the manuscript.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Currently, immunotherapy is widely used in the treatment of various stages of non-small cell lung cancer. According to clinical experience and results of previous studies, immunotherapy as neoadjuvant therapy seems to exhibit better efficacy against early resectable non-small cell lung cancer as compared to advanced lung cancer, which is often defined as unresectable non-small cell lung cancer. However, this observation has not been established in clinical studies. This systematic review aimed to evaluate the efficacy of immunotherapy in early and late lung cancer, wherein objective response rate (ORR) and disease control rate (DCR) were used as evaluation indexes. The present study also evaluated the safety of immunotherapy in early and late lung cancer, wherein the rate of treatment-related adverse reactions (TRAEs) was used as an indicator.Electronica databases, including PubMed, Cochrane Library, Embase, and other databases, were searched to identify relevant studies. Besides this, all the available reviews, abstracts, and meeting reports from the main international lung cancer meetings were searched manually. ORR, DCR, and TRAEs were extracted as the primary outcomes.A total of 52 randomized controlled trials involving 13,660 patients were shortlisted. It was observed that immunotherapy alone significantly improved DCR in early lung cancer in comparison to advanced lung cancer. Importantly, the improvement in ORR was not to the same extent as reported in the case of advanced lung cancer. The combination of immunotherapy with other therapies, especially immunochemotherapy, significantly improved ORR and DCR in early lung cancer. In terms of safety, immunotherapy either alone or in combination with other therapies exhibited a better safety profile in early lung cancer than in advanced lung cancer.Altogether, the benefits of immunotherapy in early lung cancer appeared to be better than those observed in advanced lung cancer, especially with the regard to the regimen of immunotherapy in combination with chemotherapy. In terms of safety, both immunotherapy alone and its combination with chemotherapy were found to be safer in early lung cancer as compared to advanced lung cancer.The online version contains supplementary material available at 10.1186/s12916-022-02580-1. Lung cancer is still among the most common cancer types reported worldwide. In fact, it is the most common cause of cancer-related deaths . ImportaCurrently, immunotherapy is widely used for the treatment of various stages of NSCLC. Previous clinical studies confirmed the efficacy of immunotherapy in advanced NSCLC , 15, 16.Clinical cases and existing clinical research data showed that immunotherapy as a new adjuvant treatment incurred better curative effects in the case of resectable lung cancer as compared to late lung cancer. However, none of the currently available studies have established whether the application of immunotherapy in the early resection of lung cancer is beneficial or its application in advanced unresectable lung cancer.In the present study, ORR and DCR were used as evaluation indexes/indices to assess the efficacy of immunotherapy in early and late lung cancer, while the rate of adverse reactions was used as an indicator to evaluate the safety of immunotherapy in early and late lung cancer.We searched all RCTs related to NSCLC from the PubMed, Embase, Cochrane Library, and other databases from inception until November 2021, with no start data limit, applied. In addition, we also conducted a manual search for all available reviews, abstracts, and meeting reports from the main international lung cancer meetings. The search keywords included \u201cnon-small cell lung cancer,\u201d \u201cearly lung cancer,\u201d \u201cearly stage of lung cancer,\u201d \u201cadvanced lung cancer,\u201d \u201cimmunotherapy,\u201d \u201cPD-1 inhibitor,\u201d \u201cPD-L1 inhibitor,\u201d \u201cprogrammed cell death-ligand 1,\u201d \u201cCTLA-4 inhibitor,\u201d \u201ccytotoxic T-lymphocyte antigen-4 inhibitor,\u201d and others  only early non-small lung cancer patients or advanced non-small lung cancer patients; (II) papers involving an immunotherapy cohort and either immunotherapy alone cohort or immunotherapy combined with other therapies cohort; (III) papers that reported the outcomes included more than one of the following: ORR, DCR, and TRAEs; and (IV) papers that included all RCTs and multicenter single-arm studies. Case-control studies, retrospective studies, cohort studies, case reports, meta-analyses, and systematic reviews were excluded.The authors independently reviewed and evaluated the title, abstract, full text, and supplementary materials of the included studies and extracted all the data. All extracted data were tabulated including the country clinical trial number, publication date, first author, intervention, and the number of participants in each intervention group. In addition, data on the complete response (CR), partial response (PR), stable disease (SD), ORR, DCR, and TRAEs were also included. The risk ratio (RR) and the corresponding 95% CIs for ORR and DCR were also extracted. Items not reported in the included studies were represented by NR (not reported).We applied The Cochrane Collaboration's Risk of Bias tool to evaluate the quality of the included articles. The evaluation factors included randomness, double-blindness, the integrity of the outcome data, and bias in selective reporting, among others. The risk of bias was assessed with reference to the following criteria: low risk, high risk, and ambiguous risk. Two authors independently completed the quality evaluation of the extraction of the review data for the included studies. Finally, the controversial portion was resolved through active discussion .\u03c72 test and I2 statistics to evaluate the statistical heterogeneity of the included studies. A fixed-effects model was selected to count the pooled estimate when the p-value for \u03c72 >\u20090.1 and I2 was <\u200950%. Otherwise, a random-effects model was applied to combine the studies. At I2 statistic >\u200950% or P-value for \u03c72 < 0.1, the values were considered to be statistically significant for heterogeneity [ORR and DCR were considered as the primary endpoints in this systematic review. A Bayesian approach was accordingly adopted. ORR and DCR were treated as dichotomous variables; therefore, risk ratios (RRs) were applied to present these parameters. We applied the ogeneity . SubgrouP-values were two-sided and considered to be statistically significant, except for P < 0.05.Stata v15.1  was applied to perform all statistical analyses. The present study initially identified a total of 4747 studies. Among these, 925 studies were excluded due to duplication. Finally, a total of 52 studies were included, following a screening of abstracts and full texts according to the selection criteria. The research selection process followed in the present study is shown in Additional file Altogether, a total of 52 studies were included in the present study. Among these, 43 studies focused on advanced lung cancer, while nine studies focused on early-stage lung cancer. Among the studies related to advanced lung cancer, 27 studies reported the use of immunotherapy alone, whereas 19 studies reported the use of immunotherapy in combination with other treatment strategies. Among these 19 studies on combined therapy, 13 studies explored its combination with chemotherapy, three studies reported immunodouble-drug usage, one study reported a combination of double immunotherapy with chemotherapy, and two studies reported a combination of immunotherapy with chemoradiotherapy. In the case of studies involving early-stage lung cancer, five studies reported immunotherapy alone and five studies reported a combination of immunotherapy with other treatment strategies. For the studies reporting application of immunotherapy combined with other treatment strategies, four studies reported its combination with chemotherapy, while one study reported application of immunodouble-drug.The pooled RR for ORR was recorded to be 0.36 0.14\u20130.57) and 0.40 (0.36\u20130.45) in the case of early-stage lung cancer  in early-stage lung cancer  in early-stage lung cancer  in early-stage lung cancer  in early-stage lung cancer Fig.  and 0.72\u20130.96 in In the immunotherapy alone cohort, immunomonotherapy significantly improved DCR in early-stage lung cancer as compared to advanced lung cancer. The pooled RR for DCR in early-stage lung cancer was recorded to be 0.88 (0.80\u20130.96) Fig.  and 0.65In the case of the cohort for a combination of immunotherapy with other therapies, pooled RR for DCR in early-stage lung cancer was 0.91 (0.79\u20131.02) Fig. , whereasIn the case of the cohort for a combination of immunotherapy with chemotherapy, pooled OR for DCR was recorded to be 0.91 (0.79\u20131.02) in early-stage lung cancer Fig.  and 0.84In the case of immunotherapy alone cohort and cohort for a combination of immunotherapy with chemotherapy, the TRAEs and TRAEs of grade 3 or higher were reported to be significantly reduced by the effect of immunotherapy in early-stage lung cancer, when compared with advanced lung cancer.The pooled TRAEs for patients with early-stage lung cancer was 72%, while the pooled TRAEs for grade \u2265\u20093 were 28%. In comparison to this, the pooled TRAEs for patients with advanced lung cancer were 80% and the pooled TRAEs for grade \u2265\u20093 were 41%.For the immunotherapy alone cohort, TRAEs of grade 3 or higher were recorded to be 28% for patients with early-stage lung cancer and advanced lung cancer. The TRAEs and TRAEs of grade 3 or higher for patients with advanced lung cancer were 74% and 28%, respectively.In the case of the cohort for a combination of immunotherapy with chemotherapy, the TRAEs and TRAEs of grade 3 or higher for patients with early-stage lung cancer were 93% and 47%, respectively. The TRAEs and TRAEs of grade 3 or higher for patients with advanced lung cancer were 94% and 68%, respectively.Recent clinical studies, including Camel-sq, RATIONALE 304 , and RATAccording to ORR data for the present analysis, immunotherapy combined with other treatments, especially chemotherapy, appeared to be better in early-stage lung cancer than advanced lung cancer, while immunotherapy alone appeared to be better in advanced lung cancer. In terms of DCR, both immunotherapy alone and immunochemotherapy combined with chemotherapy exhibited better efficacy in early-stage lung cancer than in late lung cancer. In terms of safety, both immunotherapy alone and a combination of immunotherapy with chemotherapy exhibited better safety in early-stage lung cancer than late lung cancer.Altogether, the current systematic review suggested that immunotherapy, especially in combination with chemotherapy, improved disease response rates in early-stage lung cancer as compared to advanced lung cancer. Besides this, it also exhibited a higher/better safety profile.Many previous clinical and preclinical evidence suggested that high tumor load incurs a negative impact on anticancer immunity , 48. A rIn addition to this, a growing body of clinical evidence supported the synergistic effects of the combination of ICIs with chemotherapy , which iThe present study was associated with certain limitations. The current meta-analysis was dependent on published results instead of individual patient data. Moreover, enough clinical studies are not available on immunotherapy for early lung cancer. In particular, only three clinical studies reported DCR for a combination of immunotherapy with other therapies for early-stage lung cancer, which included two studies on the combination of immunotherapy with chemotherapy and only one study on dual immunotherapy. In the view of a limited number of clinical studies on early-stage lung cancer that reported DCR data for the combination of immunotherapy with other therapies, the related results must be interpreted with caution.The findings of the present review highlighted that the benefits of immunotherapy were higher in early-stage lung cancer as compared to advanced lung cancer, especially for the combination of immunotherapy and chemotherapy. Additionally, the safety of immunotherapy, whether alone or in combination with chemotherapy, was recorded to be higher in early-stage lung cancer than in advanced lung cancer.The results of the study recommended the application of immunotherapy, especially in combination with chemotherapy, for the improvement of survival in patients with early-stage lung cancer. These conclusions of the study need to be confirmed in the future.Additional file 1: Fig. S1. A selection flowchart for the searched articles. Fig. S2. Forest plots presenting pooled ORR risk ratio analysis in early-stage lung cancer for the cohort of immunotherapy combined with chemotherapy. Fig. S3. Forest plots presenting pooled ORR risk ratio analysis in advanced lung cancer for the cohort of immunotherapy combined with chemotherapy. Fig. S4. Forest plots presenting pooled DCR risk ratio analysis in advanced lung cancer for the cohort of immunotherapy combined with chemotherapy."}
+{"text": "Medical displays are fundamental in today's healthcare since they provide the link between digitally stored data and the human clinician, and it is thus important that the transfer of information is as effective and reliable as possible. Contrast perception in viewed images is complex due to the nature of the human visual system, and the luminance distribution in the viewed scene plays a major role. Standards and guidelines concerning medical displays are important as they set a baseline image quality. However, as the number of imaging applications as well as display technology has evolved rapidly during the past decades, there may be possible uses not foreseen in the current guidelines. Bright screens may perform as good in bright rooms as less bright displays do in dark rooms, but current guidelines are likely to favor dark rooms due to historical reasons. The purpose of this study was to determine the limits of contrast perception in three very different lighting conditions and relate the outcome to guideline recommendations.2 with luminance ratios of 250, 85, and 62, respectively. Although the luminance ratios, black levels, and white levels were different, they all covered the same number of just noticeable differences (JNDs). By using a two\u2010alternative forced\u2010choice method, contrast thresholds were determined at dark, mid\u2010gray, and bright pixel values for all luminance settings using bar patterns with two different spatial frequencies. In total, 18 contrast thresholds were determined by each of the 10 observers.Three different display luminance settings were studied, 1\u2013250, 6\u2013500, and 12\u2013750\u00a0cd/m2 at the dark pixel value.The contrast thresholds for the low\u2010frequency patterns were close to 0.5 JNDs and there were no systematic differences between the three luminance conditions at any of the pixel values. The high\u2010frequency patterns required almost 10 times higher contrast where the highest contrast threshold (worst visibility) was obtained for the luminance setting 1\u2013250\u00a0cd/mThe differences between the three luminance conditions were mostly minor, which indicate that display settings with low luminance ratios and high minimum luminance levels can be used without compromising displayed image contrast. The number of JNDs enclosed by the luminance range of a display is a reliable metric for global perceived contrast. Luminance ratios are limited regarding the ability to detect low contrast objects when there are large differences in luminance, although they can still be used within a relatively small range of luminance levels. Low luminance levels may cause a loss of visibility, especially for fine details, and should be avoided. The display is the link that translates digital pixel values into visible light perceivable by the human visual system (HVS). Standardized display properties ensure adequate quality of rendered medical images. There are numerous standards and guidelines that specify display requirements like, for example, display size, resolution, homogeneity, noise, and temporal performance.The first displays to be used in medical imaging had a low maximum luminance and a high reflectance.For medical applications, the most commonly used requirement for display input to luminance output characteristics is the grayscale standard display function (GSDF) in Dicom part 14.2; maximum luminance 350\u00a0cd/m2; luminance ratio 350.2, 582 JNDs can be achieved with a maximum luminance of 578\u00a0cd/m2 while a luminance ratio of 350 would require the maximum luminance to be 1400\u00a0cd/m2, which is well above the specifications of most diagnostic displays. Even in a very bright environment, a high\u2010end medical display would be possible to use with a luminance range of 6\u2013700\u00a0cd/m2. In this case, the JND range is still 582 but the luminance ratio is only 117.The luminance ratio functions reasonably well in dark environments, but a display with a high minimum luminance requires the maximum luminance to exceed unrealistic levels if the specified luminance ratio is also high. In this case, the number of JNDs is probably a better requirement than the luminance range for specifying display contrast since it accounts for the nonlinear nature of the HVS. As an example  can be fulfilled. However, if the assumption of equal perceived contrast for displays with equal JND ranges is valid, the actual image quality can be just as good in bright rooms as in dark rooms. Today, higher requirements (diagnostic displays) are impossible to meet in bright rooms due to the luminance ratio requirement that forces the maximum luminance to unrealistic levels. For the end users in bright locations, there are no guidelines on how to best use their displays. For a more comprehensive theoretical study concerning luminance ranges and possible strategies for maintaining stable image contrast in bright rooms, please see another recently published paper by Sund.Replacing luminance ratios with JND ranges would not only allow standardized display properties in environments that cannot be dimmed, but it would also be possible to use much brighter reading rooms in general. Both AAPM Report 270 and ACR\u2010AAPM\u2010SIIM recommend that the minimum luminance is not too low to avoid the mesopic region of the HVS.The purpose of this study was to determine the limits of contrast perception in three very different lighting conditions and relate the outcome to guideline recommendations. A human observer study will determine the related contrast thresholds using a two\u2010alternative forced\u2010choice (2AFC) method.22.1Lmin: Minimum luminance output from a display (cd/m2).Lmax: Maximum luminance output from a display (cd/m2).E: Room illuminance measured at the display surface when the display is off (lx).Rd: Display diffuse reflection coefficient (cd/m2/lx).Lamb: Reflected luminance from the display (cd/m2). [Lamb\u00a0=\u00a0E \u00d7 Rd]L\u2032min: Minimum luminance output from a display including reflected light (cd/m2). [L\u2032min\u00a0=\u00a0Lmin + Lamb]Also referred to as \u201cBlack level.\u201dL\u2032max: Maximum luminance output from a display including reflected light (cd/m2). [L\u2032max\u00a0=\u00a0Lmax + Lamb]Also referred to as \u201cWhite level.\u201dr\u2032: Display luminance ratio. [r\u2032\u00a0=\u00a0L\u2032max/L\u2032min]2.2A high\u2010end medical display  utilizing a display board capable of 10\u2010bit rendering  was placed in a small room without windows where the walls and ceiling were painted in a matte black color and the gaps in the door framing were covered with black plastic sheets. The ambient light sources consisted of three Philips Hue color ambience E27 lights  positioned close to the ceiling, directly above the observer. The display luminance output was measured using an LS\u2010100 telescopic luminance meter . All display calibrations and observer performance studies were made using the same software developed in\u2010house by the author. During all luminance measurements, conditions such as display brightness, display mode, internal look\u2010up\u2010tables (LUTs), graphic board LUTs, and room lights properties were always recorded. The ambient light was also measured using the illuminance meter in the bezel of the display. Illuminance at screen center was measured using a Hagner Universal photometer model S2 .2.3L\u2032min to L\u2032max according to Dicom part 14 using the specified test pattern and 256 measurement points. Calibrations were stored in the display internal LUT and the LUT on the display board was linear. For each luminance setting, the maximum luminance of the uncalibrated display was adjusted to be somewhat higher than Lmax when calibrated. By keeping the maximum luminance of the uncalibrated display only slightly higher than when calibrated, the loss of luminance resolution caused by a partially used LUT was minimized.Three different luminance and illuminance settings were used as shown in Table\u00a02.4The test image used  were to be displayed at different luminance levels, it was crucial to measure the display luminance response at the highest possible luminance resolution. An 8\u2010bit display covering 533 JNDs has a luminance resolution of 2.1 JNDs per pixel value change while a 10\u2010bit display has 0.5. Since even a 10\u2010bit display would be insufficient, any of the three colored subpixels could deviate by one pixel value from the other two, thereby increasing the number of (near) gray levels to 7162 (0.074 JND per subpixel change).Since the distances between subsequent luminance values were irregular, the software searched for the best possible test pattern with a given luminance and contrast, within given tolerances (\u00b15% for luminance and \u00b10.01 JND for contrast). The requirement for a good bar pattern was that the higher and lower luminance levels were equally spaced from a center luminance level. This center luminance level was then used for the homogenous area in which the bar pattern was positioned. By using this method, any difference in bar pattern average luminance from the luminance in the surrounding homogenous area was too small to be detectable.2.6For each of the three luminance settings, contrast thresholds were determined for bar patterns at three pixel values: 50 (dark), 500 (mid\u2010gray), and 950 (bright). Two different bar pattern spatial frequencies were also used, one with 8 pixels per period (4 high + 4 low) and one with 2 pixels per period (1 high + 1 low). In total, 18 contrast thresholds were determined for each observer using a 2AFC technique together with an adaptive method in what is referred to as a run.There are many possible methods to determine contrast thresholds.p\u2010value related to two contrast thresholds, indicating the probability that the two thresholds were equal, was determined by the position of zero within the difference distribution. If zero splits the distribution exactly in the middle, there is (on average) no difference resulting in a p\u2010value of 1. If zero splits the distribution with 2.5% of all values on one side and 97.5% on the other side, the p\u2010value is 0.05.Each contrast threshold mean value was calculated by averaging the individual contrast thresholds for the ten observers. Confidence intervals and paired difference tests were calculated using bootstrapping.318 contrast thresholds were determined by each of the 10 observers in a total of 180 2AFC runs. The result from one of the runs is shown in Figure\u00a0p\u2010values indicating the probability that two contrast thresholds are equal are shown in Table\u00a0The average contrast thresholds for the ten observers are shown in Figure\u00a0The contrast thresholds for the low\u2010frequency patterns were close to 0.5 JNDs for all luminance settings and pixel values, while the contrast thresholds for the high\u2010frequency patterns were almost 10 times higher.p\u2010values) when determining very low\u2010contrast thresholds is addressed in the discussion. For the high\u2010frequency patterns, no significant differences could be found between the three luminance settings at the mid\u2010gray and bright pixel values. However, at the dark pixel values, the contrast threshold for 1\u2013250\u00a0cd/m2 was significantly higher than for 12\u2013750\u00a0cd/m2. The contrast threshold for 1\u2013250 was also significantly higher at dark pixel values than at mid\u2010gray and bright pixel values. For the other high\u2010frequency pattern luminance settings, there were no significant differences between any of the pixel values.The GSDF is based on the visibility of test patterns with a frequency corresponding to the lower frequency used in this study. For this frequency, the contrast thresholds at all three pixel values were, with a few exceptions, almost the same and thereby close to perceptually linear. Although there were some statistically significant differences, they were not systematic. The issue of possible systematic errors  is important to reduce luminance quantization effects. The minimum requirements for these parameters are probably task dependent and outside the scope of this paper.Consensus for the past 30 years has been to use a relatively low black level and a high luminance ratio, which is also the recommendations in most guidelines in the field of medical display. The historical reason behind these recommendations is that they provided an easily implementable solution for the two major problems of contemporary displays\u2014high reflectance and low maximum luminance. Today, modern displays are very bright and use antireflective technology and are therefore much less problematic. Although the current recommendations still fulfill their purpose of excluding scenarios with poor image quality, they are also somewhat blunt, and exclude other scenarios with adequate or possibly even superior image quality. There is a possibility that some of the excluded scenarios will show increased image quality compared to the ones included, especially when the luminance increases to levels where the HVS perform better.2 and a luminance ratio of 62 may seem unlikely to be used in a clinical environment, but when using a display with a reflection coefficient of 0.005\u00a0cd/m2/lx in an operating room with 2000\u00a0lx, this is close to reality. Another problem occurs with surgical light that has a central illuminance of 40\u00a0000\u2013160\u00a0000 lx. To avoid adaptation problems, both the room illuminance and display luminance should be deliberately high. As the results from this study show, common diagnostic displays could very well be used under such conditions without compromising perceived contrast in any part of the image, if properly calibrated according to room illumination.A display with a black level of 12\u00a0cd/mAccording to the visual model published by Barten,The rapid improvement in display technology with less reflective surfaces and higher light output has enabled the use of medical displays in bright environments with adequate image quality. Replacing the luminance ratio requirement with JND range would allow consistent image presentation for a wider range of operating conditions, including bright rooms. The possibility to use brighter displays in brighter rooms is not only of interest when dimming the lights is not feasible. Since the HVS is likely to perform better with more light, and humans in general tend to dislike working in dimly lit rooms, maybe it is time for radiologists to replace dark reading rooms with brighter locations. If the room illumination is constant and the display is calibrated accordingly, the perceived contrast will be as good, or possibly better, as in dark rooms.5The number of JNDs enclosed by the luminance range of a display is a reliable metric for global perceived contrast. Luminance ratios are limited regarding the ability to detect low\u2010contrast objects, since they do not take the properties of the HVS into account, although they can still be used within a relatively small range of low luminance levels. If the JND range requirements of a display are met, and the display is calibrated correctly according to ambient illumination, low luminance ratios and high black levels are possible to use without compromising image contrast.The author received no specific funding for this work.The author has no relevant conflicts of interest to disclose."}
+{"text": "Introduction: Malignant solitary fibrous tumours of the pleura (mSFTP) are extremely rare diseases  with unpredictable behaviour. Surgery remains the standard of care for these tumours; however, estimating patient prognosis and planning follow-up remain challenging. Several risk stratification models have been proposed, but a classification with diagnostic and prognostic potential has not been well standardised yet. The aim of this study was to analyse the clinicopathological data of mSFTP to investigate their prognostic features and to compare the performance of three risk stratification models proposed in the literature. Methods: Observational retrospective cohort study on all proven cases of mSFTP surgically resected with radical intent between 2000 and 2019 in a single centre. Demographic, surgical and pathological data were examined. All patients were risk-stratified by using three prediction models: modified Demicco, De Perrot and Tapias. Overall survival (OS) and disease-free survival (DFS) were analysed. Results: There were 21 men and 13 women . Twenty-one patients (62%) were symptomatic. The median follow-up was 111 months . The 5-year OS and DFS were 81.2% and 77.4%, respectively. Nine patients (26.5%) experimented recurrences. At univariate analysis, the presence of necrosis (p = 0.019), nuclear atypia (p = 0.006), dimension greater than 11.5 cm  (p = 0.037) and relapse/disease progression (p = 0.001) were independent prognostic factor of worse OS. The administration of adjuvant treatment was a protective independent factor for survival (p = 0.001). Radicality of resection (p = 0.005); tumour dimension (p = 0.013), presence of necrosis (p = 0.041) and nuclear atypia (p = 0.007) and pleural pattern (p = 0.011) were independent prognostic factors of worse DFS. Analysing the three risk stratification models, the Tapias score was revealed as the best index to predict both OS (p = 0.002) and DFS (p = 0.047) in patients with mSFTP. Conclusions: Using the risk stratification model proposed by Tapias, patients with the highest risk of recurrence could be identified at the time of surgery to establish a more frequent imaging surveillance and longer follow-up. The role of adjuvant treatment in mSFTP therapy has not been established yet, but further analysis on patients with a high risk of recurrence, stratified according to risk models, along with biomolecular panels may tailor future post-surgical therapies. Solitary fibrous tumours are rare slow-growing mesenchymal neoplasms that can occur in many anatomical sites, most commonly the pleura .During the years, they have been named in different ways, according to their origin and clinical course. Changes in their nomenclature have resulted in nothing but add more confusion to the description of their already difficult clinical and pathological patterns. Once their origin was established in the mesenchymal layer, a clearer path was outlined, setting the term \u201csolitary fibrous tumours of the pleura\u201d (SFTP) ,3.They can occur at any age, but most frequently in the sixth and seventh decades, and mostly present a favourable prognosis .In fact, less than 5% of all pleural tumours have a malignant behaviour. It is important to assess their pathological state in order to prevent an adverse outcome, such as the development of local recurrence or metastatic disease [According to the World Health Organization Classification of Tumours of the Pleura published in 2020, SFTP have been considered distinctive variants of existing tumour types, along with myxoid dermatofibrosarcoma protuberans (DFSP), DFSP with myoid differentiation, plaque-like DFSP, fat-forming (lipomatous), giant cell-rich SFT, epithelioid inflammatory myofibroblastic sarcoma and epithelioid myxofibrosarcoma. SFTP have been classified into three main groups: benign, which include the intermediate/locally aggressive category, NOS (not otherwise specified), which include the intermediate/rarely metastasizing category, and malignant ,7. A relSFTP have the potential to be difficult to treat and to predict. For this reason, during the years, there have been many attempts to understand the natural history of this disease.Risk stratification models have been introduced in order to prevent and anticipate the possibility of recurrence. The principal characteristics of the proposed risk models are summarized in De Perrot et al. created a classification system based on four stages, indicating the growth pattern of the tumour (pedunculated or sessile) and the presence of malignancy, indicated by the presence of high cellularity with crowding and overlapping of the nuclei, cellular pleomorphism, high mitotic count (more than 4 per 10 high-power fields), necrosis or stromal/vascular invasion .Tapias et al. developed a risk stratification model based on a combination of common clinical and histologic features of resected SFTPs, including pleural origin, morphology, size, hypercellularity, presence of necrosis or haemorrhage and number of mitoses, dividing the patients in groups at low and high risk of developing recurrences .Demicco developed in its revised form a stratification model based on age, tumour dimension, number of mitoses and presence of necrosis (added later on in the revised form), thus dividing the patients in three main groups, at low, moderate and high risk of developing metastasis .In our study, these risk stratification models were compared in terms of OS and DFS, after clinicopathological data analysis. The clinical medical records of all patients with malignant solitary fibrous tumours of the pleura, who were referred from January 2000 to December 2019 to our department  were prospectively collected and retrospectively reviewed. All patients underwent surgery with radical intent. Patients <18 years of age, affect by sarcoma or other malignancies were excluded.The diagnosis of mSFTP was obtained by imaging modalities (ultrasound and/or computed tomography) and percutaneous or endobronchial biopsy.The malignancy criteria were stated according to England\u2019s criteria, summarized in Details concerning baseline demographic features, clinical presentations, comorbidities and pathological features were collected.All patients had a cardiac and respiratory assessment before surgery.The primary aim of the study was to analyse the clinicopathological data of mSFTP to investigate their prognostic features and to compare the performance of three risk stratification models proposed in the literature, based on histopathological and macroscopic features. The patients were retrospectively restaged according to following three prediction models: modified Demicco, De Perrot and Tapias. Overall survival (OS) and disease-free survival (DFS) were analysed. All patients were followed up at 1, 3 and 6 months after surgery with a clinical interview and a chest radiography/CT scan. Referral to medical or radiation oncologist was decided case by case in a multidisciplinary tumour board setting.All patients signed an informed consent for the surgery and for the inclusion of their clinical data in the database. This study is a retrospective analysis of standard surgical procedures and was conducted in accordance with the Declaration of Helsinki. Institutional review board approval was not necessary, as stated by local law.Baseline variables are described with percentages for categorical ones and mean and standard deviation (SD) for continuous ones.p < 0.05 as statistically significant.Statistical analysis of surgical outcomes  was performed. Statistical analysis of the long-term outcomes OS and DFS was performed. The Kaplan\u2013Meier method was used to estimate the cumulative survival. COX proportional hazard regression was used for univariate and multivariate analyses. We considered values of Overall survival was defined as the time from treatment to death, regardless of disease recurrence. Disease-free survival was defined as the time from diagnosis to the recurrence of the tumour or death.Statistical analysis was conducted using SPSS statistic software .The study included 21 men and 13 women who were histologically diagnosed with malignant SFTP according to England\u2019s criteria. The median age was 67, ranging from 23 to 83 years.Twenty-one patients (62%) were symptomatic: eight (23.5%) had dry cough, six (17.6%) experienced chest pain, six (17.6%) suffered from dyspnoea, and one (2.9%) had persistent fever with pleural effusion.As it is described in Surgical radicality was obtained in most of the cases (91.2%), yet R1 was found in two patients (5.9%), and R2 in one patient (2.9%).Data regarding the tumour characteristics were collected and later applied to the risk stratification models. The median diameter of the lesions was 11.5 cm .SFTP originated mainly from the visceral pleura (82.4%) rather than from the parietal pleura (11.8%). Two patients showed inverted (intrapulmonary) SFTP (5.9%).The majority presented a non-pedunculated growth pattern (67.6%). Twenty-three patients (67.6%) showed a mitotic count/10 HPF (High-Power Fields) greater than 4. In twenty-eight cases (82.4%), necrosis or haemorrhagic areas were present. Hypercellularity was shown in twenty-three patients (67.6%).Bcl2 positivity was found in 26 patients (76.4%), CD34 positivity in 28 patients (82.3%), and STAT6 positivity in 32 patients (94.1%) .Vimentin and cytokeratin (AE1-3) were found in four (11.7%) and two (5.8%) patients respectively.The patients were retrospectively restaged according to three prediction models: modified Demicco, De Perrot and Tapias, as showed in The median follow-up was 111 months, ranging from 12 to 258 months. The 5-year OS was 81.2%, and the 5-year DFS was 77.4%. Recurrences were found in nine patients (26.5%).p = 0.019), nuclear atypia (p = 0.006), dimension greater than 11.5 cm  (p = 0.037), high Ki67 expression (p = 0.018) and relapse/disease progression (p = 0.001) were associated with a worse OS. The administration of adjuvant treatment was a protective factor for survival (p = 0.001). The Kaplan\u2013Meier curves for OS according to the tumours\u2019 characteristics are reported in In univariate analysis, the presence of necrosis , tumour dimension (p = 0.013), presence of necrosis (p = 0.041), nuclear atypia (p = 0.007), high expression of Ki67 (p = 0.012) and pleural pattern (p = 0.011) were associated with worse DFS. In multivariate analysis, only surgical radicality was confirmed as an independent prognostic factor of worse DFS  and DFS (p = 0.047) in patients with mSFTP.  was revealed as the best index to predict both OS , which leads to an excessive ectopic secretion of insulin-like growth factor 2 (IGF2) by the tumour. Laboratory blood analyses show increased IGF2 levels and low insulin and peptide C levels ,18.Those patients who present with bilateral articular pain, swelling, rigidity, joint stiffness and digital clubbing are most likely to be affected by Pierre\u2013Marie\u2013Bamberger syndrome (PMBS), a rare syndrome yet more common than DPS ,20.In our study, twenty-one patients (62%) were symptomatic. However, the presence of symptoms seemed not to be related to OS or DFS. It is highly crucial to make the right differential diagnosis for SFTP and all those masses that share common features in terms of anatomical, histopathological and clinical findings.More precisely, intrapulmonary fibrous tumours must be differentiated, especially, from squamous cell carcinomas, sarcomas, carcinoids and malignant mesotheliomas, for the right clinical and therapeutical choice .For example, Leucotere et al. presented three cases of a morphological mSFTP with unexpected strong cytokeratin expression, which is usually present in sarcomas and mesotheliomas .The macroscopic appearance of these tumours is highly connected to their malignancy index, as large dimensions lead to a higher chance of tumoral cells presence .In our study, the median maximum diameter of the lesions was 11.5 cm (range 5\u201329 cm), confirming this general agreement. Indeed, a tumour dimension >11.5 cm appeared as an independent prognostic factor of worse OS and DSF.The histological presentation of these tumours lays the foundation for a possible prognostic risk model stratification. Macroscopic features include a well circumscribed, almost completely encapsulated tumour, hard in consistency, with a clean, whitish cut surface, necrotic areas within and sometimes a vorticoid appearance, alternating with myxoid areas. The microscopic appearance is typically characterized by a \u201cpatternless pattern\u201d, with the proliferation of elongated or ovoid cells with varying amounts of connective tissue, alternating patterns of fibrosis, hypercellularity and hypocellularity, a collagenous stroma, and typical \u201cstaghorn\u201d-shaped (hemangiopericytoma-like or HPC-like) blood vessels .In our series, necrosis or haemorrhagic areas were present in 28 patients (82.4%), and 23 patients (67.6%) showed a mitotic count/10 HPF greater than 4. Hypercellularity was shown in twenty-three patients (67.6%). Necrosis and nuclear atypia were confirmed as independent prognostic factors of both OS and DFS in our study.A strong diagnostic impact is provided by immunohistochemistry. SFTP are pathophysiologically characterized by a translocation leading to the fusion of the NGFI-binding protein 2 (NAB2) gene to the transcription activator gene 6 (STAT6). The expression of CD34, CD99 and BCL-2 genes is common in SFTP, yet not specific. For example, CD34 is found in only 5\u201310% of SFTP, mainly in malignant and dedifferentiated tumours ,25.Interestingly, a high proportion of our cases expressed CD34 (82.3%). Moreover, Bcl2 positivity was detected in 76.4% and STAT6 positivity in 94.1% of our cohort.Cytokeratins, ALDH1 and GRIA2 are markers that are usually expressed as well, but have a fluctuating behavior .Even the negativity of the expression of some genes such as EMA, H-caldesmon, desmin, CD31, S100 is used for diagnosis, especially to differentiate SFTP from other soft tissue tumours .The presence of vimentin and cytokeratin (AE1-3) was also found in 11.7% and 5.8% of the patients, respectively.Ki67 is a well-known aggressiveness index and, if its expression results to be 10% or greater, it is significantly associated with tumour recurrence . A high Whether by VATS or open, the aim of surgery is to obtain complete resection margins. If R0 is not achieved, the surgical intervention cannot be considered a radical treatment. Sometimes, even if R0 is obtained, recurrence is possible in patients with both malignant and benign variants . Althougp = 0.005), but not of OS (p = 0.912), as expected, since OS does not include recurrence in its timeframe.Complete resection margins were achieved in 31 patients (91.2%) in our series. Radicality of resection resulted to be an independent prognostic factor of worse DFS (Based on the above-mentioned characteristics, prognostic risk models aim to predict the pathological behaviour of SFTP.Analysing the three risk stratification models applied to our cohort, we believe that the Tapias score is the best index to predict both OS and DFS in patients with mSFTP.SFTPs are prognostically challenging tumours with unpredictable behavior. The cornerstone of mSFTP treatment remains radical surgery, with negative resection margins as the most important prognostic factor. At present, a global consensus on the treatment of mSFTPs is missing, and randomized clinical trials are mandatory to define the role of systemic therapies for these rare disease entities. A multidisciplinary tumour board assessment is also crucial to define the correct management of these malignancies.Our findings suggest that using the risk stratification model proposed by Tapias, patients with the highest risk of recurrence could be identified at the time of surgery to establish a more aggressive treatment strategy, frequent imaging surveillance and longer follow-up.The role of adjuvant treatment for mSFTP has not been established yet, but further analysis on patients with a high risk of recurrence, stratified according to risk models, along with biomolecular panels may tailor future post-surgical therapies.The most important limitation of the present study is its retrospective nature, with a small number of included cases. Moreover, the limited number of recurrence and metastases restricts the significance of the multivariate analysis for DFS; yet our results match those of other large datasets on mSFPT.mSFTP are rare tumours; thus, the limited number of patients statistically reduces the chance of obtaining solid results. However, due to the homogeneity of our cohort and its direct relation to the intrinsic characteristics of the tumour and the absence of similar large groups previously analysed in the literature, the outcomes of this study can be considered reliable."}
+{"text": "This research aimed to show the possible impact of natural antioxidants on epoxidized natural rubber (ENR) and poly(lactic acid) (PLA) green composites. Thus, the ENR/PLA blends were prepared with the addition of three selected phytochemicals . Obtained materials were submitted for solar aging. The analysis of the samples\u2019 features revealed that catechin hydrate is a natural substance that may delay the degradation of ENR/PLA blends under the abovementioned conditions. The blend loaded with catechin hydrate presented stable color parameters (dE < 3 a.u.), the highest aging coefficient (K = 0.38 a.u.) and the lowest carbonyl index based on FT-IR data (CI = 1.56) from among all specimens. What is more, this specimen prolonged the oxidation induction time in comparison with the reference samples. Gathered data prove the efficiency of catechin hydrate as an anti-aging additive. Additionally, it was found that a specimen loaded with flavone changed its color parameters significantly after solar aging (dE = 14.83 a.u.) so that it would be used as an aging indicator. Eventually, presented eco-friendly ENR-based compositions may be applied in polymer technology where materials presenting specific properties are desirable. Composite materials based on biopolymers are appreciated for their eco-friendly character. Such materials can consist of bio-based elastomers and biodegradable thermoplastics. Moreover, they can be modified by adding natural antioxidants to them to obtain materials that are more resistant to aging processes. Flavonoids, which belong to the group of phenols and polyphenols, are especially significant antioxidants as they present antiradical activity and inhibit oxidation processes. The activity of phytochemicals depends on their chemical structure, e.g., the number of hydroxyl groups in a molecule.Epoxidized natural rubber/poly(lactic acid) (ENR/PLA) blends are reported to be one of the most interesting composite materials ,2,3,4. ONatural antioxidants can be defined as naturally occurring molecules diversely present in living organisms. They feature several biological effects\u2014antibacterial, anti-aging, antiviral, anti-inflammatory and anticancer activities . What isn) for PLA/resveratrol systems were less distinct compared to the reductions of \u03b5 and Mn for neat PLA. After 30 h of irradiation, the Mn of neat PLA was lowered by circa 60%, while PLA/resveratrol specimens retained approximately 75% of their original molar mass. Furthermore, after about 60 h of irradiation, neat PLA specimens were unfit to be tested in terms of mechanical properties (they were too brittle to be handled) whereas PLA/resveratrol samples retained approximately 30% of their initial \u03b5.Agustin-Salazar et al.  introducS. aureus adhesion in Tryptose Broth medium after 24 h in comparison to neat PLA.Other interesting research concerned using \u03b1-tocopherol (vitamin E) as an adequate processing stabilizer against the thermo-oxidative degradation that occurs, e.g., during the processing of poly(lactic acid) for food packaging ,28,29. IFurthermore, natural antioxidants can be used as aging indicators. L\u00f3pez-Rubio et al.  proposedIn this work, the influence of adding three different phenolic compounds to ENR/PLA composites was scrutinized. These substances were: eugenol, catechin hydrate and flavone. These chemical compounds were selected due to their different molecular composition in terms of the number of hydroxyl groups in the particle. Catechin hydrate and eugenol have five and one hydroxyl groups, respectively. Flavone has not any hydroxyl groups in its composition, but as it belongs to the group of flavonoids it should potentially present antioxidant activity.Escherichia coli increased from 0 mm to 6.8 mm).Recently, these compounds have been studied regarding their use in polymer technology. Sabaa et al.  proved tThe ENR-based materials described in this paper also included in their composition hydroxypropyl methylcellulose (HPMC), which acted as an immobilizer of added antioxidants. Apart from cellulose derivatives, there are several other substances used in polymer technology as immobilizers. Sahiner et al.  immobiliThe aim of this study was to obtain ENR/PLA blends with natural antioxidants\u2014eugenol, catechin hydrate, flavone\u2014and an immobilizer of natural additives in the form of HPMC and analyze the influence of these additives on materials features compared to samples without these antioxidants.The manufactured specimens were subjected to a solar-aging process and the effects of selected additives on the several properties of ENR/PLA blends have been studied. This research contributes to extending the knowledge about incorporating natural antioxidants into polymer matrices and broadening this branch of science. Selected natural antioxidants presented in this paper had not previously been used as additives for ENR/PLA blends. Compositions of created materials and studying the impact of additives on retarding the degradation processes of polymer matrix under conditions of solar aging are scientific novelties of this research. What is more, ecological HPMC used as an immobilizer of antioxidants has the potential to improve its dispersal in a biocomposite and, as a result, may enhance its antioxidative activity during the aging process. Considering the chemical structures of eugenol, catechin hydrate and flavone, these natural substances may act as pro-ecological additives for polymeric materials able to improve their physico\u2013mechanical properties.Natural phenolic compounds can indicate a composite\u2019s color change after aging. Hence, determining changes that occurred regarding visual features of studied specimens can be classed as very assistant data. According to the color change index (dE) presented in Moreover, the activity of an antioxidant is contingent on its chemical structure. The presence of hydroxyl moieties inhibits the aging process. Catechin hydrate has five hydroxyl groups in its structure\u2014more than flavone and eugenol. Therefore, the ENR\u2013CAT composite presented a lower change of color than composites including two other natural antioxidants. It can be assumed that the single -OH group present in eugenol structure and the distinguishing characteristic of flavone compound (carbonyl group and conjugated double bonds systems) do not present sufficient antioxidative activity in order to stabilize the materials during accelerated aging.Hue angle parameters are presented in Conducted measurements concerning optical properties of studied materials assisted in measuring the color stability during the aging process. The effectivity of stabilization induced by adding natural additives to the polymer matrix could be evaluated. As a result of the aging process, the oxidation of materials occurs, which leads to samples yellowing or browning. It is the evidence of carbonyl groups being created. Hence, it can be noted that ENR\u2013EUG, ENR\u2013PLA, and ENR\u2013FLA samples were the least stable in terms of color change. These samples presented the most significant color change towards a yellow taint after solar aging, which can indicate occurring degradation. This deterioration of the polymer surface implies intense interaction of the specimen with solar radiation. Compounds present in the specimen decomposed in some degree and as a result the color became brighter\u2014other wavelengths of the light were absorbed. On the other hand, ENR\u2013CEL and ENR\u2013CAT samples did not present a visible change in color. Individual parameters describing their color stayed almost unchanged in comparison with other samples. It confirms their color stability and limitations in the matter of carbonyl moieties creation. A hydrogen atom from a hydroxyl group  can be transferred to the free radical, which results in inhibiting the oxidation mechanism of the polymer. Hence, the change of color is little.The static mechanical tests were carried out to characterize the tensile strength (TS) and elongation at break (Eb) of the analyzed ENR-based compositions . The aimThe most significant decrease in TS value can be perceived for the ENR\u2013PLA sample. It fell from (4.28 \u00b1 0.52) MPa to (1.42 \u00b1 0.05) MPa. Parenthetically, this material presented the highest value of TS before aging out of all studied materials. At the other end of the spectrum, the lowest values of TS were presented by the ENR\u2013CEL sample. Its TS was (1.87 \u00b1 0.06) MPa before aging and (0.98 \u00b1 0.12) MPa after aging. It should be highlighted that ENR\u2013FLA showed the lowest decrease of TS after aging in comparison with other blends  MPa to (2.01 \u00b1 0.05) MPa). It means that using flavone as an additive caused higher aging stability of the material. It can be assumed that this phenomenon is a result of sufficient cross-linking density occurring between the flavone and the polymer matrix initiated with the solar-aging process. Considering the concurrent drop in elongation at the break of the ENR\u2013FLA sample, it can be assumed that the composite became stiffer and lost its flexibility to some extent. It can be explained by the chemical interaction that appeared between flavone particles and the polymer matrix. Similar findings were related to other antioxidant substances such as quercetin or green tea extract ,40,41. WRegarding the results of tests considering elongation at break, again all Eb values of individual samples decreased after aging. ENR\u2013PLA showed the finest findings out of all studied materials. Its Eb was (683 \u00b1 37)% before aging and (196 \u00b1 19)% after aging. The biggest decrease in Eb values was presented by the ENR\u2013FLA sample. Its Eb after aging was 5.4 times lower than before aging (fell from (368 \u00b1 62)% to (68 \u00b1 6)%).Three different aging coefficients were calculated. K refers to TS and Eb, K1 refers only to TS and K2 refers only to Eb. In general, the analysis of K values revealed that prepared compositions do not present high aging stability as their K aging coefficients are much lower than 1.00 a.u. What is more, ENR/PLA had the lowest K (0.10 a.u.) and it was the only specimen that did not contain cellulose fibers. It suggests that adding cellulose fibers to ENR-based blends has an impact on mechanical properties of material when it is submitted to solar aging. The highest K value (0.38 a.u.) was presented by the ENR/CAT composite. It was caused by a good antioxidant activity of catechin hydrate as it has five hydroxyl groups in its structure. Potential crosslinks created under the aging process in ENR matrix by catechin hydrate might be the reason for mechanical properties\u2019 improvement as well.To sum up the discussion of mechanical properties, it should be noted that TS, Eb and K results correlate with each other. The most thought-provoking is the performance of the ENR\u2013FLA specimen concerning its unique TS value after aging but very low Eb after aging as well.In terms of aging impact on mechanical properties, the ENR\u2013CAT sample seems to be the most stable. It presented the highest values of K and K2 coefficients from among all specimens. It could be a result of catechin\u2019s antioxidative activity and its potential crosslinking with the polymer matrix. These data correlate with the change of color measurement, which also suggested suitable resistance of the ENR\u2013CAT sample to solar aging.Additionally, it should be highlighted that the ENR\u2013EUG sample has potential to be used in the packaging industry despite a very intensive smell of pure eugenol. This smell is significantly reduced as a result of material processing. Eventually, it was verified via organoleptic analysis that aged samples had lost their smell and there is not any contraindication to usage in the packaging industry.Performed thermogravimetric analysis (TGA) enabled the examination of the thermal stability of prepared compositions. 2% and T5% values of studied specimens differed up to 70 \u00b0C and 69 \u00b0C, respectively, which suggests their different thermal stability. Concerning only materials with natural additives, the ENR\u2013CAT sample presented the finest stability, similar to the case of mechanical properties. Possibly, catechin hydrate cross-linked with cellulose particles, so it was more resistant to thermal degradation. On the other hand, the ENR\u2013FLA material presented the worst thermal properties. It correlates with its relatively high value of -color-change parameter after aging.Overall, the ENR\u2013CEL was the most thermally stable among all specimens. Its thermal decomposition occurred in three steps. In opposition to this material, other samples have degraded in four steps. The T\u22121 (O-H group) in the case of every specimen. This signal was more intense after an aging process, which can be explained by the presence of adsorbed water, the formation of unstable hydroperoxides and alcohols, as a result of the oxidation process of the materials [\u22121  characteristic for, e.g., PLA [\u22121, was corresponding to oxirane groups present in ENR-50. Polymers\u2019 aging can be also indicated by the higher intensity of this peak. It should be highlighted that this peak was more intense in ENR\u2013PLA and stayed almost unchanged in the case of ENR\u2013CAT, which confirms once again the antioxidative activity of the catechin hydrate that stabilized the material.FT-IR spectra were examined in order to study the chemical structure of the composites\u2019 surfaces and analyze changes that appeared during the solar-aging procedure . Severalaterials . Subsequn ENR-50 ). Aging l groups . However3 groups ,46. Duri.g., PLA . As therBased on infrared spectroscopy, the carbonyl index (CI) was calculated for each specimen to analyze more precisely changes that occurred during solar aging and conclude the extent of polymer degradation . The degThe least rise was calculated for the ENR\u2013CAT specimen (from 0.80 to 1.56). It indicates the lowest degree of degradation of this sample among other studied specimens and, as in the case of mechanical properties and color-change measurements, confirms the suitable level of catechin\u2019s antioxidative activity.On the other hand, the ENR\u2013PLA material presented the biggest rise in CI (from 0.80 to 4.20). The reason for that is the absence of any antioxidant in this sample that could limit the advance of occurring degradation. The change of its CI is connected with the deterioration of mechanical properties, which was aforementioned in The carbonyl index of the ENR\u2013FLA specimen rose from 0.60 to 4.00. In conjunction with the change of color parameter equal to 14.83 a.u., it also suggests the oxidation of polymer\u2019s surface that occurred as a result of solar aging.2. The polar part of SFE was lower than 5 mJ/m2 for all materials. Aging processes caused changes in SFE values\u2014total SFE and its polar part increased. What is more, the biggest change in SFE values could be observed for samples without natural additives\u2014it means that ENR\u2013CEL and ENR\u2013PLA degraded faster than other specimens.To analyze the impact of solar aging on the samples\u2019 surface properties, contact angle values for three measuring liquids  were used to calculate the surface free energy (SFE) of studied composites . Both diThe ENR\u2013CAT sample presented distinct properties compared with other specimens. Its total SFE value remained almost unaltered after aging. It happened because adding catechin hydrate to ENR stabilized the material and protected the surface from degradation. In connection with FT-IR spectroscopy results described in this paper and elsewhere , there iTo better understand changes concerning the surface properties, optical microscopy measurements were performed . As it cWith the aim of checking the thermal stabilization degree of prepared samples, the oxidation induction time (OIT) values were measured. In order to analyze the antioxidative activity of catechin hydrate, an experiment investigating the electrooxidation process of this flavonoid was presented by Masek et al. . The desThe UV-Vis spectroscopy showed changes in composites\u2019 structures after adding natural additives to basic compositions . FirstlyEscherichia coli were used in order to examine the antibacterial activity of the polymer\u2019s surface . Eugenol (98%), (+)-catechin hydrate (\u226598% (HPLC), powder) and flavone were supplied by Sigma-Aldrich . The curing agent-dicumyl peroxide peroxide), 98% of purity, was purchased from Merck .The studied composites were prepared using 50% epoxidized natural rubber  (ENR-50)), polylactide (PLA) (IngeoTM Biopolymer 4043D) from Nature Works  and powdered cellulose , chroma (Cab) and hue angle (hab) values were counted for unaged and aged compositions according to Equations (1)\u2013(4):A Spectrophotometer UV-VIS CM-36001  based on the PN-EN ISO 105-J01 standard was used to measure the color of the studied specimens. To describe colors, the CIE-Lab system was used . Therefore, color difference (\u0394E), whiteness index (WElongation at break (Eb) and tensile strength (TS) were measured on the basis of the ISO 37 standards. A Zwick-Roell 1435 device  was used to that end. Dumbbell-shaped specimens were formed to carry out tests . The speed of the samples\u2019 stretch was 500 mm/min. Next, aging coefficients were calculated. The calculations were based on the Equations (5a)\u2013(5c):3/min. Studied specimens were located in alumina vessels.The measurement was conducted with the use of a Mettler Toledo TGA/DSC 1 STARe System equipped with a Gas Controller GC10 . The test was performed with a heating rate of 20 \u00b0C/min in a temperature range of 25\u20131000 \u00b0C and air flow of 50 cm\u22121 range .The measurements of Fourier-transform infrared spectroscopy (FT-IR) were performed with the use of a Thermo Fisher Scientific Nicolet 6700 FT-IR spectrometer supplied with a diamond Smart Orbit ATR sampling device . The absorbance spectra were measured within the 4000\u2013400 cmCarbonyl Index was calculated according to Equation (6):Calculations of surface free energy were based on contact angle measurements for ethylene glycol, 1,4-diiodomethane and distilled water (droplet of the volume approximately 1 \u03bcL). An OCA 15EC goniometer by DataPhysics Instruments GmbH  supplied with dosing system (0.01\u20131 mL The Braun DS-D 1000 SF syringe) was used. SFE was calculated with the Owens\u2013Wendt\u2013Rabel\u2013Kaelble (OWRK) method.Optical microscopy measurements were performed with the use of an OPTA-TECH LAB-40 optical microscope and Capture V2.0 software. The specimens were observed with 50\u00d7 magnification.Oxidative induction time (OIT) parameter was obtained from a Mettler Toledo DSC  apparatus to evaluate an extent of thermal stabilization. Three OIT times were specified: onset, peak and endset. Isothermal condtions were kept. Samples with a weigth of 5\u20137 mg were heated from the room temperature to 220 \u00b0C under an air atmosphere. The measurement lasted 100 min.A UV-Vis spectrophotometer  was used to record the spectra of samples at wavelengths of 190\u20131100 nm.2 at 100% lamp power intensity.An Atlas SC 340 MHG Solar Simulator climate chamber  provided with a 2500 W MHG lamp was employed in order to conduct the solar-aging process. A unique range of solar radiation is given by a special rare-earth halogen lamp. The samples were aged for 200 h at a temperature of T = 70 \u00b0C with the radiation intensity equal to 1200 W/mEscherichia coli bacteria viability after having contact with the surface of studied materials was examined. Firstly, 20 \u03bcL of bacteria suspension was put on a surface of a sample. Then it was incubated at 37 \u00b0C for 60 min. After this time, the applied suspension was collected from the surface and subjected to the procedure of staining with the \u201cViability/Cytotoxicity Assay kit for Bacteria Live and Dead Cells\u201d staining kit . After incubation with fluorescent dyes, the percentage of live and dead bacteria was measured using the flow cytometry technique. BD CSampler software was used to evaluate the obtained results. Two control trials were made\u2014positive (dead cells of microorganisms subjected to the activity of 98% ethanol) and negative (unmodified suspension of microorganisms). Three measurements for every material were made, and this cycle was repeated three times.The degree of The obtained results present the influence of natural additives on physico\u2013chemical properties of the ENR-50-based composites under conditions of solar aging. Selected natural antioxidants  were used as potential stabilizers for polymers.It should be highlighted that among all samples, the ENR-based composite with flavone presented the highest color change after aging, visible to the human eye (dE = 14.83 a.u.). It indicates the possibility of using this natural additive as a -color-aging indicator in active packaging. On the other hand, the aging process had low impact on the ENR\u2013CAT color parameters (dE < 3 a.u.), which suggests its suitable resistance to degradation.Static mechanical tests revealed that as a result of solar-aging conditions, all studied samples presented worse mechanical properties than before aging. Selected antioxidants only prevented more significant changes in TS and Eb values. Moreover, because of the solar aging, the elongation at break values of all samples were more affected than tensile strength values. It is clearly shown by the results of the ENR\u2013FLA sample that became stiff and lost much of its flexibility. The ENR\u2013CAT was marked by the highest value of aging coefficient out of all specimens (K = 0.38 a.u.) and presented enhanced mechanical properties in comparison with the reference sample ENR\u2013CEL. The presence of catechin hydrate considerably slowed down the advance of a composite\u2019s degradation. Materials presented in this paper can be applied in solutions that require on a long-term basis stable tensile-strength parameters, but invariable elongation at break values are not essential.It is noteworthy that the ENR\u2013CAT was characterized by the lowest carbonyl index value after aging (CI = 1.56) and the highest value of oxidation induction time  out of studied materials. It could be caused by the fact that catechin hydrate includes five hydroxyl groups in its chemical structure that participate in the mechanism of oxidation.Additionally, studied antioxidants did not improve the thermal properties of polymeric material\u2014the ENR\u2013CEL sample was the most thermally stable. What is more, the presence of natural additives lowered antibacterial activity of studied materials in comparison with the ENR\u2013CEL and ENR\u2013PLA reference samples.Results presented in this paper provide valuable information concerning the antioxidative activity of selected natural additives. The analysis of their impact on the polymer matrix under conditions of solar aging broadens the studies concerning polymers. In particular, the material containing catechin hydrate was marked by desired properties in the context of aging processes. The antioxidative activity of catechin hydrate is worth being submitted to further investigation.Finally, studied composites seem to be eco-friendly as they were made with natural substances. These additives have potential to be used in the packaging industry where there is a need for materials that can stabilize polymer materials or act as aging indicators."}
+{"text": "Allium cepa Aggregatum group. The term shallot is also used for diploid and triploid viviparous onions, known as Allium \u00d7 proliferum (Moench) Schrad and Allium \u00d7 cornutum Clementi ex Vis., respectively. In this study, we compared the dry matter, pyruvic acid content, sugar content, flavonoid content, antioxidant capacity and mineral composition of 34 shallot accessions falling into three shallot species . Shallot accessions belonging to the A.\u00d7 cornutum and A. \u00d7 proliferum groups are characterized by high dry matter content (around 25%), of which a little less than 50% is formed of inulin-type sugars, polysaccharides, considered an excellent prebiotic with beneficial effects on human health. On the other hand, accessions belonging to the A. cepa Aggregatum group have lower dry matter content and, as a result, lower pungency (measured as pyruvic acid content), making them more suitable for fresh consumption by a broader range of consumers, but, at the same time, abundant in phenolic compounds, especially quercetin and isorhamnetin glycosides. We also observed a greater biodiversity among accessions within the A. cepa Aggregatum group in all the analyzed physico-chemical parameters compared to the other shallot groups. The investigated shallot accessions have an excellent in vitro antioxidant capacity, as well as excellent nutritional properties.Shallots are a perennial plant from the Alliaceae family, classified with the common onion under the name of the  Allium cepa L.) are often consumed cooked in warm dishes and even raw in salads [Alliums are widely cultivated around the world and are consumed either as vegetables or as a condiment due to their distinctive aroma and health benefits. Onions yl-L-cysteine sulfoxides into volatile and non-volatile organosulfur compounds upon tissue damage .Polysaccharides are abundant in several Allium species, such as garlic and shallots, but less so in common onions . The polAlliaceae family, formerly considered a separate species  but now classified within the common onion group under the name A. cepa Aggregatum [Shallots are a perennial plant from the gregatum .Allium \u00d7 proliferum (Moench) Schrad (A. \u00d7 proliferum) and Allium \u00d7 cornutum Clementi ex Vis., respectively [A. cepa Aggregatum group is the most cultivated shallot species in Europe and, based on their morphological traits, can be categorized into two subgroups: one has narrow, pear-shaped bulbs , making it distinguishable from the other, which has rounder bulbs (Potato onion type\u2014PO) [A. cepa Aggregatum group is responsible for the occurrence of many intermediate types of varying bulb size, shape, and number of clusters [In Croatia, the term shallot is used for diploid and triploid viviparous onions, also known as ectively . The A. type\u2014PO) ,17. The clusters .Two main factors influence the phytochemical composition of any plant species: the genetic material  and the A. cepa Aggregatum SH and PO subgroups, as well as the A. \u00d7 cornutum and A. \u00d7 proliferum groups, using multivariate statistical analysis. We build upon our previous work [A. cepa Aggregatum SH and PO subgroups.The aim of this study is to provide a comprehensive phytochemical and nutritional characterization of shallot accessions from the ex-situ collection of the Institute of Agriculture and Tourism, Pore\u010d, Croatia, over two harvest years, with an emphasis on the differentiation of the ous work  by increous work , where s\u22121 before planting, and 45 kg ha\u22121 N was applied (urea source) at the beginning of March each year. The shallots were harvested at the begging of July, when 50% of the pseudo stems were bent over and left to cure under shade for a month.In the years 2018 and 2019, 34 shallot accessions belonging to the ex situ collection of the Institute of Agriculture and Tourism were planted at the Institute\u2019s experimental farm. The procedure was described by Perkovi\u0107 et al. . BrieflyThe fresh bulbs were frozen at \u221280 \u00b0C, freeze-dried  and finely milled to 0.2 mm  prior to the extraction process.g for 5 min  and the supernatants were filtered through a 0.22 \u00b5m nylon filter into an HPLC vial. The samples were stored at \u221280 \u00b0C until the time of analysis. The methanolic extracts were used to determine the total antioxidant capacity, total phenolic content, as well as the sugar and flavonoid profile.The ultrasound-assisted extraction of sugars and phenolic compounds was performed by sonicating 75 mg of the freeze-dried tissue in 1,5 mL of 80% aqueous methanol for 30 min . Afterwards, the extracts were left to macerate on an orbital shaker  at 150 rpm at 20 \u00b0C for 3.5 h. The extracts were centrifuged at 15,000\u00d7 The dry matter was determined by hot air drying  at 105 \u00b0C until a consistent weight was obtained in three replications.2 = 0.9998, recovery: 100.4 \u00b1 0.2%), sucrose , glucose  and fructose .The analysis of the inulin, sucrose, fructose and sucrose content was carried out using an HPLC system, consisting of a solvent delivery unit , an autosampler , a column oven  and a refractive index detector . Chromatographic separation was achieved by injecting 10 \u00b5L of the sample into a 300 \u00d7 8 mm calcium ion exchange column of a 9 \u00b5m particle size , held at 80 \u00b0C using deionized water as the mobile phase . The retention times and peak areas of the investigated sugars were compared to the analytical standards for identification and quantification. Linear calibration curves were obtained with serial dilutions of 0.25, 0.50, 1.00, 2.50, 5.00, 7.50 and 10.00 g/L of inulin , quercetin-3-glucoside , quercetin-4\u2032-glucoside  and quercetin-3,4\u2032-diglucoside  standards. Quercetin-7,4\u2032-diglucoside and isorhamnetin-3,4\u2032-diglucoside were quantified using the calibration curve of quercetin-3,4\u2032-diglucoside, while isorhamnetin-4\u2032-glucoside was quantified using the calibration curve of isorhamnetin-3-glucoside .The analysis of the flavonoid profile was performed using an HPLC system consisting of two solvent delivery units , an autosampler , a thermostated column compartment  and a photo diode array detector . The reversed-phase separation of the targeted compounds was achieved by injecting 5 \u00b5L of the sample extract into a C18, 2.1 mm \u00d7 150 mm, 2.7 \u00b5m core-shell column , held at 37 \u00b0C, using a linear binary gradient elution of mobile phase A (water/0.1% formic acid) and mobile phase B (acetonitrile/0.1% formic acid) at 0.35 mL/minute, for 0 min to 2 min: 95%A; 2 min to 20 min: 95%A to 50%A; 20 min to 21 min: 50%A to 5%A; 21 min to 23 min: 5%A; 23 min to 24 min: 5%A to 95%A; and 24 min to 30 min: 95%A. Additionally, the identification of the target compounds was performed by comparing the retention times and characteristic parent/product ions to the analytical standards  using an LC-ESI-QqQ, which consisted of two solvent delivery units , an autosampler , a thermostated column compartment  and a QqQ mass spectrometer . The reversed-phase separation was performed by injecting 1 \u00b5L of the sample extract into a C18, 2.1 mm \u00d7 150 mm, 2.7 \u00b5m core-shell column , held at 37 \u00b0C, using a linear binary gradient elution of mobile phase A (water/0.1% formic acid) and mobile phase B (acetonitrile/0.1% formic acid) at 0.35 mL/minute, for 0 min to 0.75 min: 98%A; 0.75 min to 15 min: 98%A to 50%A; 15 min to 15.1 min: 50%A to 0%A; 15.1 min to 20 min: 0%A; 20 min to 20.1 min: 0%A to 98%A; and 20.1 min to 25 min: 98%A. Quercetin-7,4\u2032-diglucoside and isorhamnetin-4\u2032-glucoside were tentatively identified by LC-ESI-QqQ, using the characteristic parent/product ions obtained by the fragmentation of the quercetin-3,4\u2032-glucoside and isorhamnetin-3-glucoside analytical standards, respectively, while isorhamnetin-3,4\u2032-diglucoside was identified using published parent/product ions from the literature sources [2 = 0.9999, recovery: 102.0 \u00b1 2.9%) and expressed as mg GAEQ/g DW.The total phenolic content (TPC) was evaluated using the Folin-Ciocalteu assay . BrieflyThe total antioxidant activity was evaluated using the FRAP assay  and the 2+ calibration curve  and expressed as \u00b5mol Fe2+/g DW. DPPH radical scavenging ability values were calculated against a standard curve of Trolox  and expressed as \u00b5mol TEQ/g DW, respectively.FRAP values were calculated against an Feg for 5 min and the supernatant was filtered through a 0.22 \u00b5m nylon filter into an HPLC vial. The samples were analyzed immediately after extraction. The pyruvic acid content was determined by HPLC, consisting of a solvent delivery unit , an autosampler  and a UV/Vis detector . The chromatographic separation was achieved by injecting 10 \u00b5L of the sample into an aqueous C18, 4.6 mm \u00d7 250 mm column of a 3 \u00b5m particle size , held at 35 \u00b0C, with the isocratic elution of the mobile phase  at 0.7 mL/minute. The pyruvic acid was identified and quantified against its analytical standard with a linear calibration curve, obtained with serial dilutions of 0.20, 0.40, 0.60, 0.80 and 1.00 g/L of pyruvic acid .Pyruvic acid was extracted by macerating 75 mg of freeze-dried plant tissue in 1.5 mL of deionized water at 25 \u00b0C for 30 min. The extract was centrifuged at 15,000\u00d7 3 and 2 mL of 30% H2O2, transferred to a polyethylene 25 mL volumetric flask and filled to the mark with ultrapure water. The samples were stored at 4 \u00b0C until the time of analysis. The method accuracy evaluation was carried out using four certified reference materials from the WEPAL dried plant material program . The operating parameters were as follows: 1.20 kW of RF power, 10.0 L min\u22121 of plasma flow rate, 0.6 L min\u22121 of auxiliary gas flow rate and 0.7 L min\u22121 of carrier flow rate. The sample solutions were introduced into the plasma using a nebulizer and a cyclonic spray chamber. Argon  was used to form the plasma. Elemental analytical lines were determined and quantitation was achieved by plotting linear calibration curves with spectral and background corrections of single element standards , using serial dilutions of Ca (1 mg/L to 100 mg/L), K (1 mg/L to 100 mg/L), P (1 mg/L to 100 mg/L), S (0.1 mg/L to 5 mg/L), Mg (1 mg/L to 100 mg/L), Al (0.1 mg/L to 5 mg/L), B (0.1 mg/L to 5 mg/L), Cu (0.1 mg/L to 5 mg/L), Fe (0.1 mg/L to 5 mg/L), Li (0.1 mg/L to 5 mg/L), Mn (0.1 mg/L to 5 mg/L), Mo (0.1 mg/L to 5 mg/L), Na (1 mg/L to 100 mg/L) and Zn (0.1 mg/L to 5 mg/L).The determination of the macro- and micro-elements  was carried out with inductively coupled plasma\u2013optical emission spectroscopy (ICP-OES), with both axial and radial viewing  after microwave-assisted digestion . Briefly, 200 mg of the freeze-dried sample was digested with 6 mL of concentrated HNOp \u2264 0.05, and the homogenous group means were compared using Tukey\u2019s post hoc test.All analyses conducted in this study were performed in three biological repetitions. The obtained data were analyzed by analysis of variance (ANOVA) and Partial Least Square Discriminant Analysis (PLS-DA) using Statistica 13.4 . Significant differences were determined at a value of The main application of PLS regression is the prediction of dependent variables based on information on the independent variables, while reducing the dimensionality of the dataset in the form of new components . Unlike A. \u00d7 cornutum species in 2018, while in 2019 this species had a comparable dry matter content to the A. \u00d7 proliferum species from both harvest years. The PO and SH types of the A. cepa Aggregatum group had comparable dry matter contents in the harvest year 2018, while in the harvest 2019 the dry matter was significantly lower in both subgroups.Significant effects of the harvest year, the species and their interactions were observed in the content of dry matter, pyruvic acid, inulin, sucrose, glucose and fructose in the shallot bulbs . The higA. \u00d7 cornutum and A. \u00d7 proliferum species had comparable dry matter content, ranging from 26.4% in IPT211 to 24.5% in IPT245. Accessions from the A. cepa Aggregatum group had significantly lower dry matter content and ranged from 18.2% in IPT217 to 12.1% in IPT241.All accessions belonging to the A. cepa Aggregatum PO type had significantly lower pyruvic acid content compared to the other species, albeit that this depended on the harvest year and the specific accession. The pyruvic acid content was significantly higher in the harvest year 2019  compared to the harvest year 2018  in all species, except in A. \u00d7 proliferum, where a higher pyruvic acid content was observed in 2018 (35.5 mmol/kg DW) compared to 2019 (19.2 mmol/kg DW).Overall, the A. \u00d7 cornutum species (39.5 mmol/kg DW), followed by accession IPT210 from the A. \u00d7 proliferum species (33 mmol/kg DW), and the lowest content was observed in accession IPT243 (16.4 mmol/kg DW), belonging to the A. cepa Aggregatum PO type.The highest pyruvic acid content was observed in accession IPT021, belonging to the A. \u00d7 cornutum and A. \u00d7 proliferum in 2019 , with lower values in 2018 , compared to the A. cepa Aggregatum SH and PO types. On the other hand, the inulin content was comparable between the harvest years for the A. cepa Aggregatum PO type . The lowest inulin content was recorded in the A. cepa Aggregatum SH type from the harvest year 2019 (18.7 g/100 g DW), with higher inulin values in the harvest year 2018 (26.4 g/100 g DW).A higher inulin content was observed in the A. \u00d7 cornutum and A. \u00d7 proliferum species. Accessions IPT241, IPT230, IPT245, IPT242, IPT239, IPT240, IPT228, IPT237, IPT238, IPT231, IPT243, IPT234, IPT233, IPT244, IPT232, IPT236 and IPT229 represented the lower range group of accessions, where the inulin content ranged from 17.1 g/100 g DW in IPT241 to 30.0 g/100 g DW in IPT229, belonging to the A. cepa Aggregatum SH and PO types, respectively. The mid-range group of accessions was represented by IPT235, IPT176, IPT226, IPT225, IPT216, IPT217, IPT218 and IPT208 from the A. cepa Aggregatum PO type, where the inulin content ranged from 30.1 g/100 g DW in IPT235 to 39.2 g/100 g DW in IPT208.The inulin content was divided into three groups among all the investigated accessions, where the high-range group was represented by accessions IPT023, IPT214, IPT021, IPT212, IPT213, IPT210, IPT022, IPT215 and IPT211 (ranging from 42.4 g/100 g DW in IPT023 to 51.1 g/100 g DW in IPT211), belonging to the A. cepa Aggregatum PO  and SH  types compared to the A. \u00d7 cornutum  and A. \u00d7 proliferum . Among individual accessions, the highest sucrose content was observed in IPT225 (5.68 g/100 g DW) and the lowest in IPT215 (1.49 g/100 g DW).Significant differences were observed in the sucrose content between harvest years, where higher values were observed in the harvest year 2019 compared to the harvest year 2018 in all investigated species and types. In both growing years, a significantly higher sucrose content was found in the A. cepa Aggregatum PO and SH types from the harvest year 2019 had significantly higher glucose and fructose contents compared to the same types from the harvest year 2018 and the A. \u00d7 cornutum and the A. \u00d7 proliferum groups from both harvest years (except for the glucose content in A.\u00d7 proliferum from the harvest year 2019). Both glucose and fructose were found to be most abundant in accession IPT230, while the least amount of glucose and fructose was observed in accessions IPT215 and IPT211, respectively.The A. \u00d7 proliferum from both harvest years, the A. \u00d7 cornutum and A. cepa Aggregatum SH type, both from the harvest year 2019, with the A. cepa Aggregatum SH from the harvest year 2018 and PO from the harvest year 2019 being very close. The least amount of quercetin-7,4\u2032-diglucoside was detected in A. \u00d7 cornutum and A. cepa Aggregatum PO, both from the harvest year 2018. The highest quercetin-7,4\u2032-diglucoside content was observed in IPT023 and the lowest in IPT243.Phenolic compound content and antioxidant activity were affected by the growing year , accessions and their interaction . The queA. cepa Aggregatum SH type had the highest quercetin-3,4\u2032-diglucoside content, followed by the A. \u00d7 proliferum and A. \u00d7 cornutum species, while A. cepa Aggregatum PO had the lowest one. In the harvest year 2019, the A. \u00d7 cornutum had the highest quercetin-3,4\u2032-diglucoside content, while the accessions belonging to the other species and types were significantly lower.Quercetin-3,4\u2032-diglucoside was the second most abundant flavonoid in the investigated shallot accessions. In the harvest year 2018, the A. \u00d7 proliferum, IPT021, IPT022 and IPT215 from the A. \u00d7 cornutum, and IPT241 from the A. cepa Aggregatum SH type, ranging from 119.9 \u00b1 17.4 mg/100 g DW in IPT023 to 143.2 \u00b1 17.5 mg/100 g DW in IPT241.Regardless of the harvest year, the highest quercetin-3,4\u2032-diglucoside content was observed in accessions IPT023 from the A. \u00d7 cornutum and A. cepa Aggregatum PO type compared to the harvest year 2018, while its content did not differ between harvest years in the A. cepa Aggregatum SH type and A. \u00d7 proliferum. The A. cepa Aggregatum group (both the PO and SH types) had a higher isorhamnetin-3,4\u2032-diglucoside content compared to the A. \u00d7 cornutum and A. \u00d7 proliferum. The highest isorhamnetin-3,4\u2032-diglucoside content was observed in IPT 237 from the A. cep Aggregatum PO type, while the lowest content was detected in accession IPT211, belonging to A. \u00d7 cornutum.The isorhamnetin 3,4\u2032-diglucoside content was found to be higher in the harvest year 2019 in the A. cepa Aggregatum PO type, where a higher content was observed in the harvest year 2019 compared to harvest year 2018. On average, the A. cepa Aggregatum SH type had the highest quercetin-3-glucoside content, while the lowest content was detected in the A. \u00d7 cornutum species. Regarding the individual accessions, the highest quercetin-3-glucoside content was detected in IPT241 (A. cepa Aggregatum SH type) and the lowest in IPT 211 (A. \u00d7 cornutum).The quercetin-3-glucoside content did not differ between harvest years, except in the A. cepa Aggregatum SH type) to 56.1 mg/100 g DW in IPT210 (A. \u00d7 proliferum). A higher quercetin-4\u2032-glucoside content was observed in the harvest year 2018 in the A. cepa Aggregatum SH and PO types compared to the harvest year 2018. The opposite effect was observed for the A. \u00d7 cornutum, while there was no significant difference between harvest years in the A. \u00d7 proliferum species. On average, the highest quercetin-4\u2032-glucoside content was observed in the A. cepa Aggregatum SH type, followed by the A. \u00d7 cornutum species, the A. cepa Aggregatum PO type and, finally, the A. \u00d7 proliferum species.The most abundant flavonoid in all shallot accessions was quercetin-4\u2032-glucoside, and it ranged from 287.9 mg/100 g DW in IPT241  to 5.0 mg/100 g DW in accession IPT210 (A. \u00d7 proliferum).The isorhamnetin-4\u2032-glucoside was found to be higher in content in the A. cepa Aggregatum SH type) to 5.16 mg/100 g DW in IPT211 (A. \u00d7 cornutum). On average, the highest quercetin content was observed in the A. cepa Aggregatum SH type in the harvest year 2018, followed by the harvest year 2019. There were no significant differences in the quercetin content between other shallot accessions from both harvest years.The quercetin content ranged from 36.15 mg/100 g DW in accession IPT241 , but the differences between harvest years were significant for all elements except for P, where significant differences between harvest years were observed only for the A. cepa Aggregatum SH type , the A. \u00d7 proliferum (Moench) Schrad (2n = 2x = 16) and the A. \u00d7 cornutum Clementi ex Vis. (2n = 3x = 24). In our previous work, we studied 13 shallot landraces from the Croatian coastline for their morphological, biochemical and nutritional diversity [A. cepa Aggregatum were identified, the A. cepa Aggregatum PO type and the A. cepa Aggregatum SH type. The A. cepa Aggregatum SH type is characterized by an ovate bulb shape and yellow skin color, compared to the broad oval shape and light violet skin color of bulbs of the PO type [The genetic diversity of shallots in Croatia was studied by Puizina , with aliversity . The mosiversity . Additio PO type . In this PO type .A. cepa Aggregatum group and species A. \u00d7 cornutum and A. \u00d7 proliferum. The higher dry matter content in the species A. \u00d7 cornutum and A. \u00d7 proliferum was evident in both harvest years, while there was no difference between the A. cepa Aggregatum SH and PO types. The obtained values for the A. cepa Aggregatum group\u2019s dry matter content were in line with reported values (between 12.6% and 18.9%) from the literature sources [A. cepa varieties and reported values between 7.4% and 21.5%. The impact of the dry matter on fresh bulb storage is crucial in determining the bulb shelf-life, since higher dry matter content increases the longevity of the product [The dry matter content was deemed to be the most important parameter for the differentiation between the  sources ,32,33. S sources  investig product .A. cepa Aggregatum accessions having lower inulin content compared to the A. \u00d7 cornutum and A. \u00d7 proliferum accessions. Inulin is a fructan, which consists of the main unit \u03b2-(2\u21921) fructofuranosil and one \u03b1-glycopiranose (1\u21922) terminal unit with a degree of polymerization between 2 to 70, whereas inulin molecules with the degree of polymerization of 2\u201310 are called fructooligosaccharides [A. cepa varieties and reported a range from 4.02% to 45.8% DW of fructans, 13.7% to 21.4% DW of fructose, 4.7% to 26.38% DW of glucose and 2.7% to 13.6% DW of sucrose. Moongngarm et al. [A. cepa Aggregatum was examined, and reported that the bulbs of A. cepa Aggregatum contained 33.2% inulin, 6.46% FOS, 11.4% sucrose, 2.91% glucose and 1.57% fructose [The most abundant saccharide in shallot bulbs was inulin, with the charides . Inulin charides ,38, a nocharides  investigfructose ,40,41.A. \u00d7 proliferum, where the opposite occurred. On average, A. \u00d7 cornutum, A. \u00d7 proliferum and the A. cepa Aggregatum SH type had comparable pungency levels on a dry weight basis. Unlike the dry matter or sugar content, which were comparable among accessions from the same species, the pyruvic acid content range was very broad among the studied accessions and widely overlapped between species. However, if the lower dry matter content is taken into account, we can conclude that both A. cepa Aggregatum types are lower in pungency compared to the A. \u00d7 cornutum and A. \u00d7 proliferum. Soinien et al. [Shallots are known and consumed as food and as a condiment due to their pungent flavor. The flavor is produced by the hydrolysis of S-alk(en)yl-L-cysteine sulfoxides and catalyzed by the enzyme alliinase upon tissue damage . Pyruvicn et al.  reportedA. cepa Aggregatum PO and SH types fall within the extremely mild category (from 2 to 4 \u00b5mol pyruvic acid/g fresh weight), whereas the A. \u00d7 cornutum and A. \u00d7 proliferum groups are considered as having mild to intermediate pungency (up to 10 \u00b5mol pyruvic acid/g fresh weight).Jadczak et al.  studied A. \u00d7 cornutum and A. \u00d7 proliferum compared to the A. cepa Aggregatum group. In our current study, we introduced considerably more shallot accessions, especially from the A. cepa Aggregatum group (both PO and SH subgroups), and monitored the TPC and antioxidant capacity over two harvest years. According to our previous work [Allium \u00d7 cornutum landrace and reported values of 240.01 mg/100 g DW and 159.86 mg/100 g DW for quercetin-3,4\u2032-diglucoside and quercetin-4\u2032-glucoside, respectively. Soininen et al. [A. cepa Aggregatum bulbs, from 133.5 to 845.0 mg/kg fresh weight in A. \u00d7 cornutum bulbs, and of 213.2 mg/kg fresh weight in A. \u00d7 proliferum [A. cepa Aggregatum, from 142.6 to 213.5 mg/kg fresh weight in A. \u00d7 cornutum, and of 124.4 mg/kg fresh weight in A. \u00d7 proliferum [A. cepa Aggregatum PO and SH types contained significantly more isorhamnetin glucosides based on dry weight compared to the A. \u00d7 cornutum and A. \u00d7 proliferum species. The main difference between the A. cepa Aggregatum PO and SH types was the flavonoid content, whereby every flavonoid was more abundant in the SH type compared to the PO type, except for isorhamnetin-3,4\u2032-glucoside. The difference was also obvious in the antioxidant capacity assays, whereby the SH type consistently exhibited higher antioxidant capacity values.Shallots are abundant in phenolic compounds, especially flavonoids, which are responsible for their antioxidant capacity . The obtous work , as wellous work ,46,50, tous work  studied oliferum . In the oliferum . The resThe antioxidant capacities of individual flavonoid molecules have been extensively studied. Zhao et al.  showed hA. \u00d7 cornutum and A. \u00d7 proliferum groups were largely consistent, while greater diversity was observed in the accessions within both the A. cepa Aggregatum SH and PO types. This may be due to the genetic variability in the larger A. cepa Aggregatum group compared to the other investigated shallot groups. On the other hand, this variation may be affected by the immobilization of specific minerals in soil, as in the case of Cu, whose uptake by plants depends on the extent of the root\u2019s interception with copper-enriched zones, and the physical properties of the soil, such as the presence of Fe and Mn oxides [A. cepa Aggregatum SH type had higher concentrations of all macro-elements  as well as several micro-elements  based on dry weight compared to the other shallots. Building on our previous study [Averaged over two harvest years, the macro-element  content in accessions belonging to the n oxides . Neverthus study , we expaus study , as wellus study . From a us study .2+ ion is still active, free radicals are formed in the immediate vicinity of the metal-flavonoid complex and are scavenged immediately, in which case the flavonoid has a double synergistic action, making it an extremely powerful antioxidant [2+-quercetin complex has a significantly higher antioxidant activity in the CRAC assay compared to quercetin alone, probably due to the existence of two chelating sites on the quercetin molecule, which promote electron displacement onto the substituents. The combination of the abundance of both the Cu and Fe transition metals, together with high concentrations of quercetin-derived flavonoids, places shallots in a unique position as a potential antioxidant superfood.Beside antioxidant activity, such as radical scavenging, flavonoids possess a strong chelating ability for transition metals, such as Cu and Fe. It is assumed that, if the Feioxidant . Among fioxidant . Furtherioxidant  demonstrioxidant  demonstrA. \u00d7 cornutum and and A. \u00d7 proliferum groups are characterized by their high dry matter content (around 25%), of which a little less than 50% is formed of inulin-type sugars, polysaccharides, considered an excellent prebiotic with beneficial effects on human health. On the other hand, accessions belonging to the A. cepa Aggregatum types have a lower dry matter content and, as a result, lower pungency (measured as the pyruvic acid content), making them more suitable for fresh consumption by a broader range of consumers, but, at the same time, they are abundant in phenolic compounds, especially in quercetin and isorhamnetin glycosides. We also observed greater biodiversity among the accessions within the A. cepa Aggregatum group in all the analyzed parameters compared to the other shallot groups. The investigated shallot accessions have an excellent in vitro antioxidant capacity, as well as excellent nutritional properties.Shallot accessions belonging to the"}
+{"text": "This study evaluated the prophylactic effect of localized biomimetic minocycline and systemic amoxicillin on immediate implant placement at infected extraction sites. Twelve mongrels with six implants each were randomly assigned to five groups: uninfected negative control (Group N); infected with oral complex bacteria (Group P); infected and treated with amoxicillin one hour before implant placement (Group A); infected and treated with minocycline during implant placement (Group B); and infected and treated with amoxicillin one hour before implant placement and with minocycline during implant placement (Group C). Radiographic bone level, gingival index (GI), probing depth (PD), papillary bleeding index (PBI), and removal torque (RT) were recorded. There was no significant difference between Groups A, B, and C for bone loss. Group A showed the highest RT, the lowest PBI, and significantly lower GI and PD values than Group P. Group B exhibited significantly higher RT value than Group N and significantly smaller PD value than Group P at 6 w postoperatively. Localized minocycline could improve implant success by reducing bone loss and increasing RT and systemic amoxicillin could maintain the stability of the peri-implant soft tissue. However, combined use of these two antibiotics did not augment the prophylactic effect.  Immediate implant placement after tooth extraction offers the advantages of esthetics, maintenance of alveolar bone, shortened treatment time, and prevention of second surgical intervention . HoweverSeveral studies have focused on placing implants immediately in infected sockets. Antibiotic prophylaxis is one of the methods to increase the implant success rate and prevent early implant failure . The choAs a semi-synthetic tetracycline derivative, minocycline is primarily used to treat rheumatoid arthritis and chronic respiratory diseases . Minocyc(1)Group N\u2014two uninfected mongrels.(2)Group P\u2014two mongrels infected with oral bacterial culture.(3)Group A\u2014two mongrels infected with oral bacterial culture and treated with amoxicillin orally administered 1 h before implant placement.(4)Group B\u2014two mongrels infected with oral bacteria culture and treated with minocycline locally administered during implant placement.(5)Group C\u2014two mongrels infected with oral bacteria culture and treated with amoxicillin orally administered 1 h before implant placement and with minocycline locally administered during implant placement.All procedures were conducted with the approval of the Animal Research Committee (Cronex-IACUC 202101011). Twelve mongrels were selected and tested. Each mongrel had 6 sockets for implants. All mongrels were randomly assigned to one of the following five groups.A total of 0.5 g of minocycline hydrochloride with HEC-glycerin microsphere carrier .A total of 500 mg of amoxicillin hydrate 1 h before implant placement via the oral route . The dosage of amoxicillin was administered according to a previous study conducted with mongrels .Each group was assigned to receive the following treatments:Mongrels within 1 to 1.5 years old and weighing 30 to 35 kg were randomly assigned. Calculus samples from mongrel dogs  were obtained and cultured in tryptic soy broth growth media for anaerobic bacterial culture. Subculture was performed, and the cultured bacteria were transplanted to each experimental group thrice .For the first infection, performed 2 m before surgery, six premolars  from the mandible of mongrels were hemisected with a saw and carefully extracted using dental forceps. Debridement and curettage of the socket were not performed. Full-thickness flaps were elevated, and a bone defect was created by a twist drill with a diameter of 2.2 mm in the apical area of the extraction socket. A total of 0.05 cc of cultured bacterial liquid was applied to the defect site. After applying A-Oss , a xenograft material, a collagen membrane  was placed to isolate the socket, and a healing period of 1 m was provided.For the second infection, a defect was created by trephine bur with a diameter of 3.7 mm, and 0.05 cc of the cultured bacterial solution was applied to the defect site. After applying the autogenous bone obtained using a trephine bur, a collagen membrane was placed, and a healing period of 1 m was provided. For the third infection performed on the day of surgery, 0.05 cc of the cultured bacterial solution was applied to the drilled site after gingival incision and applying a guide drill, a 2.2 mm diameter drill, a 3.0 mm diameter drill, and an F3.5 taper drill in sequence . The implant  was placed, a healing abutment was connected, and wound was closed.For the non-infected group, extraction was performed 2 m before surgery. Debridement and curettage of the socket were not performed. Drilling, placement of bone graft and collagen membrane, and implant insertion were performed at the same intervals as in the infected group.The implants placed in each group were evaluated radiographically using a portable X-ray machine  under anesthesia. The marginal bone level change was recorded on the day of placement and every 4 w, 6 w, 8 w, 10 w, and 12 w.The mongrels were sacrificed by euthanasia 12 w after implant placement, and the mandibles with implants were collected. After 12 w of implant placement in each group, a digital torque gauge was used to measure the removal torque value.The GI was evaluated every 4 w, 6 w, 8 w, 10 w, and 12 w after implant placement according to the criteria described in At 4 w, 6 w, 8 w, 10 w, and 12 w, 6 sites around the implant abutment  were assessed by probing, and the average measurement was classified according to the criteria in The PBI was assessed by probing the implant abutment every 4 w, 6 w, 8 w, 10 w, and 12 w and classified according to the criteria in p < 0.05). All statistical analyses were performed using IBM SPSS, version 25.0 .Intergroup analyses were performed using analysis of variance (ANOVA) for repeated measures to verify the effects of localized biomimetic minocycline and systemic amoxicillin on immediate implant placement. After ANOVA showed statistical significance, post hoc Dunnett or Friedman tests were conducted to determine pairwise comparison differences (p = 0.054). Regarding the changes of bone level according to time, Group A showed significantly less bone resorption than Group C at 6 w postoperatively (p < 0.05). However, there was no significant difference in Group N, A, B, and C after 6 w.Compared to the Group N, Group P showed a significantly more bone resorption . Group AIn group A, B, and C, RT values in Group A increased to 155.9 \u00b1 18.6, followed by 125.3 \u00b1 35.8 of Group B and Group C showed the lowest RT value of 94.7 \u00b1 15.0 at 12 w postoperatively .p > 0.05). However, there were significant differences of Group C in comparison to Group N (p < 0.05) and Group A (p < 0.05), respectively. There was no significant difference between Group A and B  (p < 0.05).In post-hoc analysis, Group A exhibited a lower GI value than Group P at 4 w postoperatively ( < 0.05) . At postp = 0.042), Group B (p = 0.024), and Group C (p < 0.05) respectively.  (p < 0.01), however, Group C demonstrated the deepest PD at 12 w postoperatively (p < 0.01).At 4 w postoperatively, Group A exhibited the smallest PD ( < 0.01) . Also, ip = 0.003) and Group B (p = 0.004), respectively   .Various animal models have been used to study the mechanism and stages of periodontitis  and the After tooth extraction, horizontal bone loss of 5\u20137 mm and vertical bone loss of 2\u20134.5 mm occur around the extraction socket during 6 to 12 m postoperatively . And theAs use of prophylactic antibiotics to prevent infection becomes popular, ongoing debate has arisen regarding the rationale for the timing and dosage protocol of prophylaxis. Especially, evaluating the efficacy of shorter antibiotic regimens compared to extended regimens in preventing early implant failures is important, considering the increasing risk of antibiotic resistance associated with prolonged systemic antibiotic administrations . TherefoThe localized delivery system is proven to be more effective, as it allows antibiotics to be delivered directly into the gingival sulcus around tooth/implant and maintained in higher concentrations . AntibioFor localized transportation of minocycline, soluble carriers exhibited unsatisfactory drug delivery in deeper periodontal pockets, while non-soluble carriers require an additional procedure for removal . In our In this study, marginal bone resorption around the implant, as an indicator of implant success, was evaluated using periapical radiographs. Minocycline administration in the infected socket during implant surgery could prevent peri-implant marginal bone loss. However, this did not show a distinct synergistic action with systemic antibiotic prophylaxis using amoxicillin before implant surgery. RT is also a direct indicator of the level of implant osseointegration . AccordiPrevotella and Fusobacterium, to amoxicillin [PD is an essential measurement to evaluate the health of periodontium. While Group B exhibited a significantly smaller PD than Group P at 6 w postoperatively, Group A showed the smallest PD at 4 w postoperatively. At 10 w postoperatively, PD increased in all groups except Group A and particularly, Group C showed the deepest PD at 12 w postoperatively. Amoxicillin was more effective in preventing the deepening of periodontal pockets than minocycline. In addition, both amoxicillin and minocycline reduced the PBI, however, only the effect of amoxicillin was significant. This might be explained by the high susceptibility of anaerobic pathogens associated with peri-implant disease, such as xicillin ,37.In this study, systemic prophylaxis with amoxicillin was used for immediate implant placement in infected extraction socket. Amoxicillin exhibited significant efficacy in preventing bone loss and proved to be the most effective in inhibiting infection in peri-implant soft tissue. Localized usage of minocycline was effective in implant longevity, especially by preventing bone loss around the implant. However, minocycline alone showed limited benefits in preventing infection of peri-implant soft tissue. Administration of systemic amoxicillin and localized minocycline reduced the prophylactic effect, possibly due to their antagonism. The limit of this study is that even though multiple bacteria injections were performed with the application of bone graft material and collagen membrane to induce the infected extraction socket, this method might not precisely imitate the intricate biology of infected extraction sockets in human. Nonetheless, we anticipate our study can contribute to the advancement of prophylactic antibiotic protocol for immediate implant placement, particularly in the infected extraction socket. Further researches are required to evaluate the feasibility of topical biomimetic minocycline to improve the success rate of implants immediately placed in infected sockets as an alternative to routine amoxicillin prophylaxis.Systemic administration of amoxicillin before the implant placement in infected extraction sockets improved the implant success by preventing bone loss around the implant and by reducing inflammation of the peri-implant soft tissue.Localized application of biomimetic minocycline reduced radiographic bone loss and increased RT.Combined use of systemic amoxicillin and localized minocycline showed no augmented prophylactic effect, possibly due to their antagonistic interaction."}
+{"text": "The clinical requirement for a good esthetic result for immediate implant placement is the absence of dehiscence in the anterior facial alveolar bone. In the presence of dehiscence, it is recommended to use a connective tissue graft in addition to immediate implant placement or to change to early implant placement. However, the literature focusing on dehiscence is scarce, and the influence of different placement times and combined use of connective tissue graft on postoperative esthetics in cases with dehiscence is unclear. Therefore, we quantitatively evaluated the pre-extraction dehiscence morphology and postoperative changes in the facial tissue of implants in three groups: immediate implant placement (Group I), immediate implant placement with connective tissue graft (Group IC), and early implant placement (Group E). To this end, 52 implants were obtained . A wider dehiscence increases the risk of soft tissue regression, which was one reason for choosing early implant placement. A combination of immediate implant placement and connective tissue graft, or early implant placement, tended to result in less soft tissue regression due to the thicker postoperative facial soft tissue volume. Esthetic implant treatment requires high survival rates and quality esthetic results. Therefore, the timing of implant placement after tooth extraction should be carefully selected. In implant treatment, the appropriate timing of implant placement after extraction in an esthetic single tooth has long been debated . In 2004Immediate implant placement into extraction sockets is defined as \u201cType 1\u201d implant placement;When the objective is the soft tissue coverage of the extraction socket, then a healing period of 4\u20138 weeks is observed before implant placement, which is defined as \u201cType 2\u201d implant placement;When the socket is allowed to heal to have a partial bone fill of the socket, typically 12\u201316 weeks, this is defined as \u201cType 3\u201d implant placement;When the extraction is fully healed after 16 weeks or more, the implant placement procedure is defined as \u201cType 4\u201d.In 2008, immediate (Type 1), early (Types 2 and 3), and delayed (Type 4) implant placement protocols presented a comparable survival rate of >95% :(a):(a)24]: .The accuracy of the CBCT superimposition was verified by measuring the positional relationship of the IMs on the superimposed jaw models in three dimensions. The measurement items were the distance between the IM platform centers (Base (mm)), the distance between the IM tips (Apex (mm)), and the angle between the IM long axes (Angle (\u00b0)) . Then, 1The CBCT data of T0 were extracted, and the facial alveolar bone morphology before extraction was measured on the diagnostic imaging software . All meaThe sites under study were measured on the obtained axial section with respect to the platform level. The measurement sites were the facial alveolar bone dehiscence width (T0DW) on the acquired axial section and the facial alveolar bone dehiscence height (T0DH), the amount of exposure height (T0EH) of the implant body, and the gap width of the tooth root (T0Gap) starting from the most facial side of the IM on the cross-section. All measurements are in millimeters.Intraexaminer and interexaminer reliability rates in measuring preoperative facial alveolar bone morphology were determined using the interclass correlation coefficient (ICC). One examiner randomly selected 10 patients (10 implants) from the subject patients. Three-dimensional jawbone models of T0 and T1 were created, and both were superimposed on diagnostic imaging software.Using the superimposition of the 3D jawbone model, the IM was displayed on the CBCT data of T0 at the same position as the actually placed implant body.T0DW, T0DH, T0EH, and T0GAP were measured on each cross-section. The interval between the first measurement and the second measurement was one week. The intraexaminer reliability was calculated by setting the measurement cross-section and measuring the facial alveolar bone morphology twice before surgery. Similarly, 2 examiners randomly selected 10 implants from the target patients, set the cross-section for measurement, and performed the preoperative measurement of facial alveolar bone morphology once and separately. Both ICCs were high , and it In each group, CBCT data at T1 and T2 were extracted, and the postoperative facial tissue of the implant body was measured on diagnostic imaging software. The thickness (BW) and height (BH) of the facial hard tissue of the implant and the thickness (GW) and height (GH) of the facial soft tissue of the implant were measured at T1 and T2, respectively, based on the platform level in the cross-sectional view . The harIntra- and interexaminer reliability rates in measuring facial tissue morphology of postoperative implants were determined according to ICC. Both ICCs were high , and it One examiner measured each item of the pre-extraction facial alveolar bone morphology and the facial tissue of the implants of the three groups with different placement times and compared each item among the three groups.p-value of 0.017 to determine statistical significance.For statistical analysis, the Kruskal\u2013Wallis test was used to compare the mean values between the three groups, and the Mann\u2013Whitney U test with Bonferroni correction was used for multiple comparisons of items that showed differences. All analyses were conducted with SPSS using a The 52 implants were classified into three groups according to implant placement: Group I had 20 implants, Group IC had 16 implants, and Group E had 16 implants. p-value = 0.003). No other results showed significant differences among the groups .In the facial hard tissue of the postoperative implants, \u0394BH was significantly greater in Group I than in Group IC and Group E. Other results were not significantly different among the groups .T1GW and T2GW were significantly greater in the facial soft tissues of the postoperative implants in Group IC and Group E than in Group I. \u0394GH was significantly lower in Group IC and Group E than in Group I. Other results showed no significant differences among the groups . It has been reported that the thickness of the facial soft tissue of postoperative implants affects the amount of soft tissue regression . TherefoPre-extraction facial alveolar bone morphology was evaluated using superimposition of pre- and postextraction CBCT image data. The quantitative evaluation of CBCT image data is well known in implant treatment, and its accuracy and reproducibility have not been problematic . HoweverAmong the dehiscence morphology of the facial alveolar bone before extraction, the width of the dehiscence morphology was significantly larger in Group E than in Group I and Group IC. Based on the scatter plots of dehiscence width and depth, there was a tendency toward the selection of early implant placement when the width of the dehiscence exceeded 3\u20134 mm . When there is a large dehiscence in the facial alveolar bone where the implant is placed, the probability of postoperative soft tissue regression is reported to be high when immediate implant placement is applied . Among GIn this study, osteogenesis was combined in all cases extracted. Bio-Oss is a heterogeneous bone composed of bovine bone, with high porosity  and exceSoft tissue measurements include intraoral photographs taken with a digital camera  and usinThe postoperative facial tissue morphology of Group I, Group IC, and Group E were compared. The thickness of the facial soft tissue was significantly greater in Group I than in Group IC and Group E at the time of superstructure placement and approximately one year after superstructure placement. Bone loss and soft tissue regression were significantly lower in Group IC and Group E than in Group I . It has The advantages of early implant placement are that if the facial alveolar bone is thin before extraction, the soft tissue volume is increased by waiting for soft tissue healing after extraction , and theThese results suggest that the combination of immediate implant placement and connective tissue grafting or early implant placement in esthetic areas with pre-extraction dehiscence may reduce the amount of soft tissue regression. Postoperative soft tissue regression was less than 1 mm in Group I, with dehiscence less than 3 mm wide . The resFinally, in this study, patients were divided into three groups according to treatment technique. Although there were no significant differences in baseline data such as sex ratio, age, or tooth type, the presence of confounding by these factors or unknown factors cannot be ruled out. To prevent these confounding effects, the number of subjects should be increased and further statistical analyses should be conducted in the future.It was found that immediate implant placement might have good esthetic results if the dehiscence was less than 3 mm wide. If the dehiscence was wider than 3\u20134 mm, there was a tendency to avoid immediate implant placement.In cases with dehiscence, thicker labial soft tissues could be obtained by combining immediate implant placement and connective tissue grafting or by waiting for the soft tissues to heal after tooth extraction in early implant placement. This result suggests that the amount of soft tissue regression can be reduced.We evaluated the pre-extraction dehiscence morphology and postoperative facial tissue morphology of implants with immediate and early placement in esthetic areas where there was a pre-extraction dehiscence morphology in the facial alveolar bone, and we drew the following conclusions:"}
+{"text": "The aim of the study was to describe the relationship between success in junior and senior categories in sprint events. An observational and longitudinal analysis was carried out using rankings of the Royal Spanish Athletics Federation database. We analysed 547 sprinters (238 women and 309 men) from their U14 to senior stage who ranked in top-20 on at least one occasion during the period 2004 to 2021. The first entry in top-20 occurred mostly in U14 , and the frequency was progressively lower: 26.7% (146) in U16; 20.8% (114) in U18; 5.1% (28) in U20; 2% (11) in U23; and 0.9% (5) in the senior category. A similar tendency was observed in male and female athletes. Only 3.8% (9) of top-20 U14 athletes reached the senior elite stage, increasing this percentage in subsequent categories: 7.4% (15) in U16; 10.6% (24) in U18; 20.9% (32) in U20, and 31.4% (32) from U23 to the senior category. Data from female athletes showed higher maintenance of top-20 status from early categories to senior age. We conclude that even though the first entry into the national top-20 in sprint events occurs early in most cases, success in these initial stages is not a prerequisite for reaching top-20 positions in the senior category. The athletes\u00b4 pathway to elite performance can involve years of deliberate practice , and it A correct selection model provides us with the necessary information to establish realistic developmental goals and expectations according to the needs of athletes . Some auNowadays, small performance transfer between junior and senior categories has been observed in team sports such as rugby, football and volleyball , and in In the same way, in athletics, this transition rate is scarce. In middle- and long-distance runners, only 39% of the finalist athletes in the world junior world championship in 2002 (World Athletics U20 or WJC) maintained the elite status in subsequent years as senior athletes . BezugloAt a national level, In summary, the existing research shows to a greater or lesser extent that early-stage success is not a prerequisite for future success as an elite athlete and, therefore, the transition rate from junior to senior is low. However, most of the current research in this field has analysed the transition rate only from U18 to the senior category , or fromBearing this in mind, this study aimed to quantify the transition rate of success from junior (from U14 to U23) to senior categories in sprint events in Spain.We analysed 547 sprint athletes (238 women and 309 men) ranked in top-20 at any grade on at least one occasion during the period 2004 to 2021.An observational and longitudinal analysis was conducted to investigate the relationship between junior and senior success .https://www.rfea.es/web/estadisticas/ranking.asp, (access date: 07 February 2022) collecting the best personal times of the different athletics competitions from the U14 to the senior category in Spain since the 2004/2005 season divided by sex, type (indoor or outdoor events), season, category and specific event, including both manual and electronic times and both legal and illegal wind. The athlete's name, ranking, mark, date of birth, and category, among other data of all athletes that competing in Spain each season, were collected. Due to the open-data source employed for data collection, the local Ethics Committee approval was not required.The data were acquired from the public database of the Royal Spanish Athletics Federation (RFEA), All data from the 2004/2005 season to 2021 for all categories was downloaded in Microsoft Excel spreadsheets for 100 m, 200 m and 400 m athletes . We removed from the database those results obtained with illegal wind (+2 m/s) and athletes of other nationalities, and selected athletes that entered at any time the top-20 at any stage. We selected athletes born between 1993 and 1996 because we could collect rankings for these athletes from their first year in U14 until they remained at least for three years as senior athletes (23 to 25 years), leaving a final sample of 547 athletes. Previous studies have identified this age range as the age of peak performance for sprint athletes at the national level . Each atData are presented as relative and absolute frequencies . To analyse the frequency in each category, and the transition rate in subsequent categories: \u201ctop-20\u201d; \u201c21 to 50\u201d or \u201cNot ranked\u201d, contingency tables were used. All calculations were performed with SPSS 28.0.The first entry in top-20 occurred mostly in U14  , and theA secondary analysis of the progression from junior categories with their subsequent categories is shown in The aim of this study was to analyse the transition rate from junior to senior categories. Data analysis from 547 Spanish sprint athletes showed that: 1) first entry in the top-20 position occurred mainly at early ages ; 2) the The first entry into the top-20 occurred mainly between 12\u201313 years of age (42.8%), and only one out of three (33.6%) did so after 15 years of age. We understand that at junior ages, training specialization is not one of the principal factors of high performance. At this age, entering the top-20 status is influenced by growth, maturation, development  and relaAgain, the transition rate from U23 to the senior category reached only 31.4%, being the other major wall in the sporting career. To the authors\u2019 knowledge, no studies so far have analysed transition rates from U23 to the senior category. Previous research in athletics analysed transition rates from U18 or U20 to the senior category , 2021, bth percentile or higher) between U14 and the senior category , outcomes of this research are limited to some extent. One of the limitations was the time restriction of the data available in the national ranking. Since it is only available from 2004\u201305, to include the entire sporting career of the athletes, from the first available category (U14) to the senior category, we were forced to restrict the sample to athletes born between 1993 and 1996. Second, when an athlete was not listed, we could not determine whether he had dropped out of the sport, had not competed at a sufficient level, or had moved to another athletic discipline. We only analysed sprint performances, thus changes in the athletic discipline  could have affected our outcomes. However, we assume that the sample size allows us to offer a good framework for studying the progression of sprint athletes in Spain.Given the results obtained, we conclude that even though the first entry into the national top-20 in sprint events occurs early in most cases, success in these initial stages is not a prerequisite for reaching privileged positions (top-20) in the senior category, the hardest steps to overcome being from U14 to U16, and from U23 to senior categories.As a practical implication of this study, we would advise parents and/or coaches to avoid early specialization, remembering that success in junior categories is not related to success in the senior category. It is important for the sport governing bodies to create a solid sport system that provides adherence to practice, developing the foundations for a future specialised learning and training."}
+{"text": "High in reliability, multi in function, and strong in tracking and detecting, active phased array antennas have been widely applied in radar systems. Heat dissipation is a major technological barrier preventing the realization of next-generation high-performance phased array antennas. As a result of the advancement of miniaturization and the integration of microelectronics technology, the study and development of embedded direct cooling or heat dissipation has significantly enhanced the heat dissipation effect. In this paper, a novel swept-back fishnet-embedded microchannel topology (SBFEMCT) is designed, and various microchannel models with different fishnet runner mesh density ratios and different fishnet runner layers are established to characterize the chip Tmax, runner Pmax, and Vmax and analyze the thermal effect of SBFEMCT under these two operating conditions. The Pmax is reduced to 72.37% and 57.12% of the original at mesh density ratios of 0.5, 0.25, and 0.125, respectively. The maximum temperature reduction figures are average with little change in maximum velocity and a small increase in maximum pressure drop across the number of fishnet runner layers from 0 to 4. This paper provides a study of the latest embedded thermal dissipation from the dimension of a single chip to provide a certain degree of new ideas and references for solving the thermal technology bottleneck of next-generation high-performance phased array antennas. Active Phased Array Technology enables radars to have high performance and high survivability while reducing the cost of radar development, so active phased array radar antennas are widely used in satellite imaging, aircraft early warning, battlefield reconnaissance, ground air defence, and other fields . Active Microchannels, which are small channels etched or fabricated on a substrate, are one of the existing emerging technologies for electronics cooling. These emerging techniques for electronics cooling include heat pipes, microchannels, spray cooling, phase change material (PCM)-based cooling, thermoelectric cooling, free cooling, liquid immersion cooling, and 3D stacked architectures with interlayer microchannel cooling. These emerging techniques for electronics cooling offer innovative solutions to address the challenges posed by the use of microchannels, and by high heat-generating electronic devices. Microchannels work by providing a large surface area for heat exchange to enhance heat transfer . MicrochIn addition, incompressible thermo-fluids are also widely used. Incompressible thermo-fluid refers to a fluid that is considered to be incompressible and exhibits thermodynamic properties. Incompressible fluids are those in which the density remains constant regardless of changes in pressure. This assumption is valid for many practical engineering applications involving liquids, such as water or oil, where the density changes are negligible. However, some important difficulties were previously encountered in solving incompressible flows using pressure correction schemes, and artificial compressibility methods were developed. The artificial compressibility method helps in solving the continuity equation by introducing an artificial compressibility term into the equations. This term allows the continuity and momentum equations to be coupled, enabling the use of time-marching methods. By adding artificial compressibility, the convergence process can be improved without affecting the results. The study  proposedEmbedded cooling is described in the previous work  as a thiRemco van Erp ,15 propoTherefore, this paper proposes a novel swept-back fishnet-embedded microchannel topology (SBFEMCT), which differs from the truncated microchannel in that the rectangular break point and fins are changed into a diamond lattice to increase the effective contact area and to a certain extent strengthen the disturbance structure in the middle of the microchannel to disturb the fluid boundary layer and weaken the disturbance structure on both sides of the flow channel. This further improves the heat transfer performance and effectively lowers the maximum pressure drop. In this paper, the latest embedded heat dissipation technology is investigated from the dimension of a single chip to provide new ideas and references to solve the next generation of high-performance phased array antenna heat dissipation technology bottlenecks.This design has been conceived because the highest temperature of the chip wafer when the chip is operating is on the central axis, and the high-temperature range in the centre is larger than on the sides, while the temperature on the sides of the chip wafer is slightly lower . TherefoFor example, this can be achieved by adding a pin-fin structure at the bottom of the runner or adding a flow disturbance structure at the side to disturb the fluid boundary layer ,20, or pThe study  investig3], which is approximately 330 [W/cm3] in the experiment. The heat flux density can be calculated as about 50 [W/cm2], and the maximum wafer temperature is obtained as 51.67 \u00b0C, which both meet the operating temperature requirements of the chip , which is approximately 330 [W/cm3] in the experiment. In the post-processor CFD-Post the heat source, i.e., the heat-generating chip, is selected individually to display its temperature cloud, and the maximum wafer temperature is obtained as 51.67 \u00b0C, which meets the operating temperature requirements of the chip.The appropriate heat flux value of the heat source is determined by a simulation experiment in a runnerless model. The size of the heat source chip is set to 3.5 mm \u00d7 2.2 mm \u00d7 0.2 mm. The operating temperature range is known to be 0 \u00b0C\u201370 \u00b0C for commercial chips and \u221240 \u00b0C to \u201385 \u00b0C for industrial chips. The heat flux of the chip is set to 0.5 [W]/Volume(chip)[cmThe SBFEMCT is constructed and its heat dissipation effect is analyzed. The flow rate is 1.0 m/s and the chip size and its heat flux values are the same as in the no-flow channel model. The model is shown in The solved temperature field of the chip is shown in 3]. The pressure outlet was set to a relative static pressure of 0. The surfaces of both the substrate and the solder layer were set to adiabatic wall surfaces. The inlet temperature was set to 20 and the inlet flow rate was set from 0.2 m/s to 2.6 m/s to analyze the effect of flow rate on the heat dissipation effect of the chip embedded. The maximum chip temperature, maximum air pressure in the flow channel, and maximum flow rate at different flow rates were obtained as shown in The coolant used in the model was aqueous, and the thermal performance of the model was analyzed by varying the inlet velocity value of the coolant. After meshing, the finite element model was obtained and Fluent was started according to the previous procedure, setting the heat flux of the chip to that of the no-fluid model, approximately 330 [W/cmAs the table shows, the maximum temperature of the chip gradually decreases as the velocity increases, and the maximum atmospheric pressure and maximum flow rate in the flow channel also increase. The temperature drops rapidly with velocity in the early stages, and then the maximum chip temperature tends to level off when the velocity is greater than 1.8 m/s. This shows that the model can achieve a certain cooling effect by changing the flow rate of the coolant when the velocity is small, and the effect of speed on the cooling effect of the chip is not significant when the flow rate is large.As the flow channel is symmetrical, the mesh density ratio of the mesh flow channel is defined as the inverse of the number of lattices in the top left-hand diagonal row of the mesh flow channel. For example, in the model in To study the effect of the mesh density ratio on the heat dissipation effect of the chip inside the mesh flow channel part of the model, four sets of flow channels with different mesh density ratios were designed without major changes to the overall shape of the mesh flow channel and with the same width of the mesh flow channel. Namely, a mesh size of 0.9 \u00d7 0.9 with a density of 0.5, a mesh size of 0.4 \u00d7 0.4 with a density of 0.25, a mesh size of 0.15 \u00d7 0.15 with a density of 0.125, as shown in It can be seen from Due to the high alignment of the rhombic lattice, the mesh has a high degree of ductility throughout the flow channel. Specifically, the mesh can be extended or contracted in the longitudinal direction with the same number of longitudinal straight runners, grid density ratio, and mesh width.Since the runner is symmetrical from left to right as a whole, the number of fishnet runner layers is defined in this paper as the number of rhombuses beyond the fourth straight runner from the centre to the left. As in the model in To investigate the effect of the ratio of the fishnet-like flow channel compared to the overall flow channel in the model on the chip\u2019s heat dissipation, four sets of flow channels with different numbers of fishnet-like flow channel layers were designed, which are the flow channels with 0, 1, 2, and 3 fishnet-like flow channel layers, as shown in In the analysis of the effect on cooling in this section, the distribution of the fishnet runners in all four models follows one principle\u2014the upper third of the splitting point on the seam line in the fishnet runner is placed in the centre of the entire runner. This is used to ensure that the highest temperatures, in and around the centre of the chip, are disturbed more so that the temperature in this area is better brought out and a cooling effect is achieved. The flow and heat transfer characteristics were simulated at an inlet velocity of 1.0 and the parameters obtained are shown in It can be seen from Traditional microchannel structures usually follow one of two types; one is a flat microchannel type and the other is S-shaped. Therefore, the microchannel part of the SBFEMCT was changed to a flat microchannel and an S-shaped microchannel, respectively, to demonstrate the effectivity of the novel swept-back fishnet-embedded microchannel. These two models were created in Design Modeler, the same boundary conditions as SBFEMCT were set in Fluent, and then the temperature field of the whole model was obtained through thermal analysis, and the temperature results are shown in As shown in This paper proposes a novel swept-back fishnet-embedded microchannel topology (SBFEMCT) from the dimension of a single chip based on the truncated microchannel structure in the previous work . The feaReducing the mesh density ratio effectively reduces the pressure drop and flow velocity in the flow channel. As the mesh density ratio decreases from 0.5 to 0.25, the Pmax decreases from 7817 to 5657, the latter being 72.37% of the former; and the Vmax increases from 1.353 to 1.587, the latter being 117.0% of the former. As the mesh density ratio decreases from 0.25 to 0.125, the Pmax decreases from 5657 to 3231, the latter being 57.12% of the former; and the Vmax increases from 1.587 to 2.482, the latter being 156.4% of the former.The reduction of the grid density ratio allows a fast and effective reduction of the maximum pressure drop and a small increase of the maximum flow rate with arguably almost no effect on the maximum temperature. This can be applied to solve the problem of high pressure drop and high velocity when there is an equal requirement for maximum temperature.Increasing the number of layers of the mesh flow channel results in a general reduction in the maximum temperature, little change in the maximum velocity, and a small increase in the maximum pressure drop. The Pmax increases by approximately 300 Pa for each additional layer of the mesh flow channel.From all the temperature clouds modelled, it can clearly be seen that the highest temperature is in the chip region, which is about 21 \u00b0C, and the temperature decreases along the chip boundary in all directions, because the chip is the only heat source in the model. The fluid flows from the inlet of the microchannel, which is at an environmental temperature of 20 \u00b0C and goes underneath the chip, bringing out a certain amount of heat, thus the temperature in the area around the outlet of the microchannel is higher than that in the area around the inlet of the microchannel. In general, the temperatures are roughly symmetrical along the longitudinal centre axis.In comparison to the model with breakpoints + fins in Section 3.1.3 of the study , the SBFThe research in this paper is still at the simulation and analysis stage and has not yet entered the processing experiment stage. As embedded cooling is the direct pumping of the cooling mass into the chip for heat dissipation, embedded cooling has a higher heat dissipation efficiency and at the same time places more demanding requirements on the microfabrication process and packaging capabilities.The chip\u2019s heat source is a large number of high-electron mobility transistors, which in this paper is simplified to a uniform heat-generating square. In later work, this can be modelled in detail, closer to the actual operating conditions, and its engineering significance will be greater. Accordingly, the thermal structure will need to be designed separately and may be less versatile.The thermal structures in this paper can all be further analyzed and optimized. For example, the widths of the runner entrances and exits can be refined, the widths of the fishnet-like runners can be refined, and the number of flat microchannels in the entrance and exit sections can be refined.All the research carried out in this paper does not involve knowledge of circuits, microelectronics, etc., for the time being. Based on the success of the research in this paper, further work can be carried out on:"}
+{"text": "Aegilopscomosa Smith in Sibthorp et Smith, 1806 is diploid grass with MM genome constitution occurring mainly in Greece. Two morphologically distinct subspecies \u2013 Ae.c.comosa Chennaveeraiah, 1960 and Ae.c.heldreichii (Holzmann ex Boissier) Eig, 1929 are discriminated within Ae.comosa, however, genetic and karyotypic bases of their divergence are not fully understood. We used Fluorescence in situ hybridization (FISH) with repetitive DNA probes and electrophoretic analysis of gliadins to characterize the genome and karyotype of Ae.comosa to assess the level of their genetic diversity and uncover mechanisms leading to radiation of subspecies. We show that two subspecies differ in size and morphology of chromosomes 3M and 6M, which can be due to reciprocal translocation. Subspecies also differ in the amount and distribution of microsatellite and satellite DNA sequences, the number and position of minor NORs, especially on 3M and 6M, and gliadin spectra mainly in the a-zone. Frequent occurrence of hybrids can be caused by open pollination, which, along with genetic heterogeneity of accessions and, probably, the lack of geographic or genetic barrier between the subspecies, may contribute to extremely broad intraspecific variation of GAAn and gliadin patterns in Ae.comosa, which are usually not observed in endemic plant species. Aegilopscomosa Smith ex Sibthorp et Smith, 1806 is annual diploid grass (2n=2x=14) with the MM genome constitution, which grows mainly in coastal and inland Greece, rarely \u2013 in coastal regions of Albania and Former Yugoslavia  Eig, 1929 thereafter heldreichii (Ae.comosa and Ae.heldreichii (Boissier) Holzmann 1884  with Ae.uniaristata Visiani, 1852, P. Comopyrum Zhukovsky, 1928. These species however are genetically distinct and carry different types of nuclear and cytoplasmic genomes \u2013 M and N, respectively : Ae.crassa Boissier, 1846 (DDMM), Ae.columnaris Zhukovsky, 1928 (UUMM), Ae.neglecta Requien ex Bertoloni, 1834 (UUMM), Ae.biuncialis Visiani, 1842 (UUMM), and Ae.geniculata Roth, 1787 (UUMM). Recent studies, however, did not confirm the presence of the M-genome in Ae.crassa, Ae.columnaris and Ae.neglecta  belong to protein fraction prolamines, which is characterized by high glutamine and proline amino acid content and by specific molecular structure   appear to be relatively cheap, but informative markers for polymorphism analysis. Gliadins (perties) . Electroperties) . So far,on wheat , and onl species . On the Aegilops  and extrAegilopscomosa possesses a number of agronomically valuable traits such as pest and disease resistance  in order to characterize polymorphism and reveal mechanisms leading to divergence of subspecies.The aim of our study was a comparative analysis of Ae.comosa including 20 accessions of comosa and 16 accessions of heldreichii collected from different regions of Greece and Turkey , St.-Petersburg, Russia, andLeibniz Institute of Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germanywere used in our study  is characterized by longest spike with black color.Thus, spikes of subsp. n absent . AccessiFISH analysis. Microsatellite probes were labeled with either 6-FAM  or Cy3/TAMRA  from the 5\u2019-end. Oligo-18S was designed based on conservative region of the 18S rRNA gene. Melting temperature and potential secondary structures were calculated using OligoCalc , oligo-pSc119.2 were synthesized in Evrogen ; GAA10-FAM, pTa-71-2 (pTa71), oligo-pTa-794 (5SrDNA), oligo-k566 were synthesized in Syntol ; ACT10, GAA10-Cy3, oligo-pAs1-1 (pAs1), oligo-pTa-713, oligo-pTa-535 were synthesized in the Laboratory of Biological Microchips at the Engelhardt Institute of Molecular Biology, Moscow, Russia.Fifteen oligo-probes were used in ligoCalc . Names a6-FAM GTT0, GAA10 The seeds are germinated on moist filter paper in Petri dishes at 24 \u00b0C. The seedlings with ~0.5 cm roots are transferred into 1.25 mM solution of hydroxyurea for 18 h, washed thoroughly with distilled water and grown in Petri dishes with distilled water for 5 h, as described in . The roox objective using black and white digital camera Axiocam HRm using a software AxioVision, release 4.8. The images are processed using Adobe Photoshop, version 7.0.Metaphase cells are prepared by squashing, coverslips are removed after freezing in liquid nitrogen, and slides are kept in 96% ethanol at -20 \u00b0C. Fluorescence in situ hybridization is carried out according to previously published protocol . The sliEP) in polyacrylamide gel (PAAG) according to the previously published protocol  of Ae.comosa have similar karyotype structures, which include metacentric, submetacentric and subacrocentric chromosomes  chromosomes  on the chromosome 6M. Accessions from this group belong predominantly to subsp. comosa and we designate this combination of satellite chromosomes as \u201ccomosa-like\u201d. Groups III and IV include representatives of both subspecies. Group III shows altered morphology of both SAT chromosome pairs, whereas Group IV contains just one pair of SAT chromosomes \u2013 1M , and all K-3806 genotypes (heldreichii). All these genotypes are characterized by heteromorphic pair of 6M chromosomes: one homolog carries large, while the second \u2013 much smaller satellite on the long arms , oligo-pTa-794 (5S rDNA), and oligo-18S (thereafter o-18S). Comparion of labeling patterns obtained using pTa71 and o-18S probes reveals intrinstic feature. The pTa71 visualizes all minor and major rDNA loci  and K-3806 (heldreichii) the signals on 6M are significantly smaller compared to 1M  most comosa carry two minor pericentromeric o-18S sites in the opposite arms of chromosome 1M, while heldreichi possesses signal only in the long arm; (3) minor pericentromeric rDNA site on chromosome 4M is usually located in the long arm of comosa, but in the short arm of 4Mh of heldreichii; (4) most comosa accessions possess two weak intercalary pTa71 sites in the long arm of 2M, and only one distal site is present in heldreichii.The pTa71 probe produces distinct signals in subtelomeric regions of short arms of 2M, 3M, and 5M chromosomes (minor NORs) in all accessions of both Ae.comosa accessions. The signal on 1M is much larger than that on 5M and arrears distally to NOR. The signal on 5M is very faint, especially in heldreichii, and occurs in the middle of short arm n sites, most of which with low or moderate intensity. Hybridization signals in heldreichii appear predominantly in subtelomeric and pericentromeric chromosome regions, rarer interstitially  and identify a similar translocation in K-4873 (heldreichii) accession  than 3Mh of heldreichii (metacentric), due to the loss of a distal part of the long arm. The short arm of 3M (comosa) carries two prominent, often fused GAAn clusters in a proximal part and several smaller sites in the distal and, rarer, in the proximal third of the long arm. A slightly deviant hybridization pattern of 3M in K-3857 (comosa) can be caused by large pericentric inversion  to medium or even small .Most obvious differences between the subspecies show chromosomes 3M and 3Mh Fig. , which dion Fig. . Chromoscomosa accessions, K-3857, AE 1376 and AE 1377 from Greece exhibit most deviant GAAn patterns , 5M and 7M (pericentromeric regions) Ae.comosa  show the unique pTa-713 patterns on 3M chromosome consisting of clear signal in the terminus of short arm and fuzzy signal in a distal part of the long arm  .Thus, sixteen of 20 accessions of heldreichii accessions show characteristic labeling pattern of chromosome 6Mh, which carries clear pTa713 signal in the short arm, either adjacent to secondary constriction (8 of 13 accessions) or in the middle of satellite (2 accessions), and two signals in the proximal half of the long arm   or terminal + distal parts of 7ML (mainly heldreichii) of all studied accessions of Ae.comosa  carry small pSc119.2 site in the terminus of 3MhL  and K-1601 (heldreichii) \u2013 in subtelomeric region of the 7M short arm , and K-3914 (heldreichii). All chromosomes except 4M possess medium to small hybridization sites located in interstitial and more frequently in distal and subtelomeric chromosome regions. Hybridization with pSc119.2 and pAs1 probes confirms the translocation 1M-6M in comosa accession K-3309  is heterozygous in labeling pattern of oligo-45 on 5Mh chromosome, whereas AE 1377 (comosa) \u2013 of 6M chromosome , which however exhibits also several comosa-specific karyotype features.All Ae.comosa was also assessed using electrophoretic analysis of gliadins in 13 comosa and 13 heldreichii accessions. Comparison of gliadin profiles of all 26 accessions reveals an extremely broad intraspecific variation of Ae.comosa: each accession shows the unique profile. Spectra of comosa accessions are usually more \u201cenriched in components\u201d compared to heldreichii accessions  are very poor, whereas several heldreichii accessions exhibit rich spectra .Genetic variability of ons Fig. . This trcomosa), K-1601 and K-2432 (heldreichii)). The broadest variation of gliadin patterns is detected in K-1601. We identified six variants of electrophoretic spectra among eight individual grains taken from four spikes; they differ in position of polypeptide bands in \u03b3- and \u03c9-zones  \u2013 for heldreichii. The spectrum 3a contains bands present on 2a and 3b and probably represents a hybrid between these two genotypes. Similarly, the spectrum 1a may correspond to hybrid between 1b and 3b  is characterized by spectra highly enriched with gliadin components, which differ significantly from other Ae.comosa in the number, position and size of protein bands. This genotype can represent a hybrid of Ae.comosa with unknown 4\u00d7 wheat species.Several accessions analyzed in this study are genetically homogeneous and consist of genotypes with identical spectra . Other accessions are found to be heterogeneous and show two or even more gliadin profiles : AE 1259, AE 1260 \u2013 comosa; (3): K-3308 \u2013 comosa, K-4498 \u2013 heldreichii; (4): AE 1257 \u2013 comosa, K-3806, K-3914 \u2013 heldreichii; (5): K-1601, K-2272, K-2432, K-4873 \u2013 heldreichii; (6): AE-1377, AE-1376 \u2013 comosa.Comparison of gliadin patterns of different accessions of nts Fig. . Such coons Fig. : (1): K-comosa accessions. Families 4 and 6 and partially Family 5 having relatively poor spectra are mainly composed by heldrechii accessions. Although both accessions from Family 6 have been assigned to subspecies comosa, their gliadin spectra share more common features with the spectra of heldrechii accessions AE 783, K-669, K-3804, K-3811, and K-3897 than with those of comosa. Each of the five abovementioned heldrechii accessions show unique gliadin profile, which cannot be assigned to either one of the families due to dissimilarities in position and intensity of polypeptide bands on electrophoretic spectra. High ratio of heldrechii accessions with the unique gliadin spectra is an indicative of higher variability of this subspecies compared to subspecies comosa.Families include accessions mainly from one subspecies. Thus, Families 1 and 2, which exhibited the richest spectra, consist of predominantly Ae.comosa significantly vary depending on markers used for their assessment. Thus, FISH with GAAn probe and gliadin electrophoresis uncover an extremely broad polymorphism of this species. High effectiveness of these markers for the analysis of intra- and interspecific diversity, evaluation of population structure, for characterization of individual genotypes has been proved in many publications . We used these eight probes for verification of the M-genome chromosome classification and for the assessment of intraspecific diversity of Ae.comosa.Although labeling patterns of GAAEcoRI-BamHI fragment (X-7841.1). This oligo-probe proves to be effective for the analysis of wheat and Aegilops species, however it fails to detect NORs in most other plant taxa, including, for example, barley, oat, or Erantus (Ranunculaceae) (Aegilopstauschii), which will be applicable for many plant species. Nucleotide sequence of a newly designed oligo-18S is homologous to highly conservative region of 18S rDNA gene of Aegilops, Triticum, Hordeum, Musa, and Iris  . Owing tgment X-741.1. Thigment X-741.1. Thigment X-741.1. ThiAe.comosa chromosome classification have been built on different principles. In early studies, the authors followed the rules of cytological nomenclature: chromosomes are arranged according to decreasing length and arm ratio  and oligo-44. This is because the 5S rDNA loci in Triticum Linneaus, 1753 and Aegilops occur only on group 1 and 5 chromosomes  T.Durand, 1888 and Thinopyrum species. The CL241 probe, another homolog of oligo-44 isolated from Ae.crassa genome, was also mapped to all group 5 chromosomes of Ae.tauschii , tetraploid and hexaploid Ae.crassa  in the morphology of SAT chromosomes observed in our study and reported previously  and K-4873 (heldreichii) accessions using FISH with rDNA, pTa-713, and GAAn probes.Interestingly, all les Fig. . Consideeviously  is causen patterns also allow discrimination of Ae.comosa subspecies indicating that their divergence was accompanied by amplification/ elimination and re-distribution of microsatellite repeats. These results however contradict the observations of Z. n labeling patterns. These authors, however, did not provide complete karyotypes of accessions used in their analyses, which does not permit the direct comparison of our data.Peculiarities of C-banding / GAAn pacomosa from heldreichii accessions using FISH markers. Most Ae.comosa chromosomes show rather conservative patterns, while diagnostic sites appear mainly on 3M or 6M. Different repeats are often accumulated in a single cluster. Such complex cluster, composed of 45S rDNA, pTa-713, pTa-k566, oligo-42, and, rarely, GAAn appears in a proximal third of the long arm of 3M (comosa) , which contains small cluster consisting of oligo-42 and oligo-45 in the short arm. Clear signals of pTa-713, oligo-44 and oligo-45 probes are detected on chromosome 6Mh of heldreichii, but they are lacking in 6M of Ae.comosa. Although pAs1 probe cannot reliably discriminate comosa from heldreichii, pSc119.2-labeling pattern of 7M shows differences between the subspecies, although with few exceptions. Thus, two comosa accessions \u2013 AE 1377 and K-3809, carry two pSc119.2 sites on 7ML, which is typical for heldreichii. These accessions however are deviant and share karyotypic features of both subspecies. Cytogenetic analysis reveals that some grains of K-3809 represent hybrids of Ae.comosa with unknown tetraploid wheat, which can explain a deviant gliadin profile of this accession, and one genotype possessing heteromorphic chromosome 5M is probably a derivative of comosa\u00d7heldreichii cross.Differences between the subspecies are most clearly detected using a combination of pTa-k566 and oligo-45 probes; the pTa-713 also shows subspecies-specific patterns. These three probes prove to be best choice for the precise discrimination of Ae.comosa is supported by other studies  shows the highest heterogeneity: each of the seven genotypes examined by FISH and 5/8 genotypes analyzed by gliadin electrophoresis show unique patterns. Karyotypic features of some K-1601 genotypes correspond to heldreichii subspecies, while other share similarities with comosa. A similar trend is uncovered by gliadin analysis. Both FISH and gliadin electrophoresis identify many heterozygotes in K-1601, which may represent recent hybrids, including hybrids between the subspecies. It should be mentioned, however, that no variation in spike morphology  or comosa (K-3857) parent. In contrast to K-1601 or K-3809, these three accessions are cytogenetically stable and genetically uniform. Most likely, they emerged via comosa\u00d7heldreichii hybridization long time ago, and hybrid forms become stabilized over generations. Based on these facts we suggest that hybridization, including hybridization between subspecies, plays an important role in broadening genome diversity of this grass. It can be facilitated by following factors:Three accessions, AE 1376, AE 1377 and K-3857 assigned to subspecies comosa andheldreichii often grow together in mix stands  planned and performed the experiments, analyzed data, wrote the first draft of the manuscript; KV: make chromosomal preparations and participates in"}
+{"text": "Lyme disease and its treatment implications have become an ever-increasing area of concern within the United States\u00a0related to the markedly increased prevalence of infection within the last two decades. The presentation, pathophysiology, and epidemiology of Lyme disease have been well studied, and thus treatments for this disease are widely available. While the treatment of its early and late stages is relatively simple with 10-14 day and four-week courses of doxycycline, respectively, the main problem rests in the understanding of the etiology and pathology of post-treatment Lyme disease syndrome (PTLDS). With the time of symptoms onsetting approximately six months after treatment and potentially lasting indefinitely, this syndrome's effect on patients' quality of life could be devastating. Searching on PubMed, Google Scholar, MEDLINE, and ScienceDirect\u00a0using keywords including Lyme disease, PTLDS, doxycycline, erythema migrans, azlocillin, and treatment, the authors have tried to make clear the different aspects. The authors have reviewed and discussed clinical studies of Lyme disease and its treatments/potential therapeutics as well as PTLDS and its sparse treatments/potential therapeutics. Borrelia, Lyme disease can be caused by different strains depending on geographical location. Borrelia burgdorferi is found in the western hemisphere, and B. afzelii and B. garinii, in addition to B. burgdorferi, can be found in Europe and Asia [B. burgdorferi often causes arthritic symptoms while B. afzelii and B. garinii commonly cause skin and neurological manifestations [B. mayonii, was discovered as rarely appearing in the upper Midwest and is not known to exist in Europe [Ixodes species of ticks, which acquire the spirochete from smaller animals such as birds and mice by taking a blood meal to molt. From this point, the ticks utilize the blood meal to transition from larva to nymph or nymph to adult tick. If the bacteria survive this developmental stage, they can remain in the nymph or adult tick stage and be transferred in the next blood meal, which can commonly involve\u00a0deer and humans [Lyme disease is one of the most prevalent vector-borne diseases in the United States . Originaand Asia . B. burgstations . Commonlstations . Europeastations . Furthern Europe . The sped humans .Approximately 476,000 people are treated for Lyme disease each year in the United States . Since 2MethodsThis was a narrative review. The sources for this review are as follows: searching on PubMed, Google Scholar, MEDLINE, and ScienceDirect\u00a0using keywords including Lyme disease, PTLDS, doxycycline, erythema migrans, azlocillin, and treatment.Lyme disease pathophysiology/epidemiology/presentationPathophysiologyIxodes ricinus [Borrelia burgdorferi [Borrelia burgdorferi can transmit it through their saliva into the next blood meal, which can include humans. Once these bacteria breach the skin's physical barrier, they use the tick\u2019s saliva and surface proteins to avoid the immune system by modulating host activities, including coagulation, fibrinolysis, and the immune response [Lyme disease is a vector-borne illness caused by the acquisition of bacteria in the host through a deer tick bite. Primarily found in North America and Europe, the dominant vector is the tick  ricinus . These tgdorferi . The majgdorferi . When thgdorferi .\u00a0Furtherresponse . After iresponse .\u00a0One papresponse .EpidemiologyLyme disease is primarily found in pediatric populations in ages five to 15\u00a0years and adult populations aged 45-55 years . The disPresentationLyme disease\u2019s clinical manifestations can be divided into three stages. The first stage tends to involve flu-like symptoms and a localized\u00a0growing rash, referred to as erythema migrans . The secDiagnosticsB. burgdorferi [Since the initial emergence of Lyme disease, there has been substantial progress made in proper identification and diagnosis. A positive serological diagnosis can be made in each of the stages of the disease.\u00a0However, due to different levels of circulating antibodies in patients at separate timelines of the disease, the probability of a positive serological test varies depending on disease progression. Circulating antibodies are generally detectable during the first two stages .\u00a0The curgdorferi .\u00a0These tgdorferi . This prgdorferi .There is some slight variation in what level of antibody binding is considered positive, so it is imperative that labs follow the CDC guidelines on immunoblot interpretation . SpecifiPost-treatment Lyme disease syndrome pathogenesisB. burgdorferi infection; however, it is possible that there may be active pathology that occurs after the initial clearance of the organism. Since the typical causative agent, B. burgdorferi,\u00a0does not produce exotoxins, one theory suggests that the acute symptoms of PTLDS are due to both the innate and adaptive immune systems working to clear lingering bacteria [B. burgdorferi and its antigens could remain pathogenic even after adequate antibiotic treatment [One of the most concerning aspects of Lyme disease is the presence of symptoms after treatment. This trait is characteristic of an\u00a0aptly named post-treatment Lyme disease syndrome (PTLDS). The Infectious Diseases Society of America participated in a panel meeting in 2006 for formal recognition of the ambiguity of the definition of PTLDS and suggested that a future agreed-upon definition should include empirical evidence\u00a0. AlthougCurrent treatment for early Lyme disease and post-treatment Lyme disease syndromePer guidelines from the CDC, erythema migrans rash is treated with doxycycline 100 mg twice per day orally for 10-14 days, amoxicillin 500 mg three times daily for 14 days, or cefuroxime 500 mg twice a day orally for 14 days . These fThe effectiveness of doxycycline, in Lyme disease treatment, was supported in a study with 607 patients, 93% of which were treated with courses of doxycycline in 11, 11-15, and 16-day regimens. Treatment failure was found in less than 1% of patients, more than half of which were found to have symptoms suggesting reinfection . HoweverPTLDS\u00a0has proven to be more difficult to remediate as the specific nature of its pathology and etiology is poorly understood. Many patients experience symptoms that include fatigue, pain, arthralgia, and neurocognitive involvement . There iBorrelia burgdorferi. Due to the lack of a definitive standard of treatment for PTLDS outside of supportive care, these studies are imperative in improving our ability to set a better standard of care [While potential therapeutics for PTLDS are currently being investigated, several contraindicated therapeutics have been thoroughly reviewed and are recommended to be avoided by institutions such as the CDC. The risk of infection or electrolyte imbalances in patients\u00a0with PTLDS treated with oral or intravenous (IV) antibiotics was more prevalent than in those not on antibiotic therapy . Another of care . With cuLyme disease potential therapeutics and prevention optionsVaccination DevelopmentsA previous vaccine, LYMErix, was originally on the market from 1998 to 2002 in which the lipoprotein OspA was targeted with antibodies ,36. ThesSome methods of antibiotics tend to work as discussed before; however, with 10-20% of people later presenting with PTLDS\u00a0and the incidence rate steadily increasing, preventative measures and treatments are necessary to prevent long-term effects . While LFurthermore, studies have been conducted in recent years to discuss the willingness of people to receive a safe Lyme disease vaccine. Recent data of 3313 respondents from northeastern parts of the United States, including Connecticut, Maryland, Minnesota, and New York, showed that 64% of participants were willing to receive a potential vaccine. In contrast, 30% were uncertain and 7% were unwilling . ImportaPharmacologic DevelopmentsBorrelia infection [Borrelia as the cause of PTLDS is true. Azlocillin\u2019s current trials in mice studies show curative potential and at least a possible step in the right direction for treatment [While the development of a new vaccine and current antibiotics for Lyme disease exist, the prevalence of PTLDS has continued to fester without any treatment for the ambiguous pathology of the disease. Due to the limited understanding of the underlying etiology of PTLDS, current and developing treatments for this condition are centered on preventative\u00a0rather than curative measures. One theory, mentioned earlier, suggests that PTLDS can arise from persistent and drug-tolerant nfection . Promisinfection .\u00a0Howevernfection . Unfortunfection . As a rereatment .B. burgdorferi infection, the current trials only saw this result in mice, so any future use in humans will need extensive testing and research. On the other hand, hygromycin A has been shown to work as a bait for mice and could serve as a method to start lowering the levels of Lyme disease in nature [To answer the problem of wide-ranged antibiotics, a new drug, hygromycin A, has been found to kill spirochetes selectively . While tn nature . Moreoven nature . While tClinical Studies of Lyme Disease TreatmentsBorrelia burgdorferi infections. While the exact cause of PTLDS is unknown, current research postulates that antimicrobial-resistant Borrelia burgdorferi infections may be integral in its pathophysiology [One challenging aspect of treating Lyme disease is the emergence of antimicrobial-resistant ysiology ,49.B. burgdorferi forms drug-tolerant \"persister cells\" when treated with traditional antibiotic therapy and infections by these drug-tolerant forms cannot be eradicated by ceftriaxone and doxycycline [B. burgdorferi. The combination of azlocillin and cefotaxime can effectively kill doxycycline-tolerant B. burgdorferi. Additionally, the authors found that azlocillin has shown significant efficacy in treating B. burgdorferi in mice through in vivo testing. The authors concluded that more in-depth research is necessary to evaluate the potential use of azlocillin in treating Lyme disease and its associated disorders.Several in vitro studies have demonstrated that ycycline -52. In aycycline  demonstrIxodes scapularis tick from the skin; this study found that the postexposure doxycycline administration was 87% effective in preventing the development of Lyme disease [Ixodes ricinus tick bite; this study found the efficacy rate of doxycycline was 67% [In 2020, Wormser et al.  describe disease . Another was 67% . Through was 67% . Another was 67% . Study pKundalini yoga has also been examined as a potential treatment for PTLDS; yoga has been shown to alleviate fatigue, pain, sleep disturbance, and cognitive impairment . AdditioIn 2022, Murray et al.  conducteBorrelia strains that cause Lyme disease. OspA is a lipoprotein located on the outer membrane of B. burgdorferi, and antibodies against this lipoprotein can kill the organism in the midgut of the Ixodes tick before transmission occurs. The previously available vaccine, LYMErix, also targeted this lipoprotein but was only effective against one strain of Borrelia. They designed the vaccine by fusing OspA to the N-terminus of Helicobacter pylori ferritin and was tested in a mouse model. Ixodes tick-fed mice that received the vaccine demonstrated immunity from both B. burgdorferi and the response was sustained for more than six months. The clinical studies related to the treatment of Lyme disease are outlined in Table Investigation into vaccines for the prevention of Lyme disease has become more prominent in recent years. LYMErix is a vaccine for Lyme disease that was developed in the 1990s and was found to reduce infections in vaccinated adults by 80%. However, it was discontinued by the manufacturer due to the low use of the vaccine by the general population . BecauseB. burgdorferi, autoimmune attacks, remaining peptidoglycans, and central sensitization. Despite the array of theories, more in-depth research is certainly required in each area to help find a suitable treatment for PTLDS.The growing prevalence and exposure to Lyme disease have created an increased necessity for newer treatments and medicines to combat the rise in cases. Furthermore, since the rise in Lyme disease is paired with difficulty in diagnosis, long-term complications have also increased. As a result, the need for clear and concise treatment options and methods has become more important as well as an emphasis on research for new medications. The consensus shows that current treatments, including the use of antibiotics such as doxycycline, cefuroxime, and others, are the most clear-cut choices. However, with PTLDS affecting up to 20% of those with Lyme disease, more options are needed to prevent Lyme disease or treat PTLDS to help patients. The most promising options include actively developing vaccinations such as VLA15 and antibiotics such as hygromycin A and azlocillin, which are being investigated for safety and efficacy.\u00a0Moreover, each of these options allows researchers to explore better options for Lyme disease treatment and also more insight into the true root cause of PTLDS. The current literature suggests the prevention of Lyme disease symptoms and infection to prevent PTLDS, and more research and investigation are required to find direct treatments and causes for PTLDS. Currently, no treatment option exists that will directly treat PTLDS, and the first step appears to be discovering the pathology of the disease. While certain theories exist, the leading hypotheses pertain to lingering or drug-resistant Additionally, the creation of Lyme disease-specific treatments and procedures is in the works. Still, more research directed to this field is essential to combat the growing number of cases and the severity of PTLDS or any other lingering symptoms. Currently, studies on PTLDS are lacking and more research is required to meet the growing demand for treatment. Lyme disease, which was primarily centralized in the northeast on the coast, has expanded to affect more inland areas, including expansion into the Midwest. Current treatment includes antibiotics such as doxycycline, cefuroxime, and amoxicillin, as well as any relevant supportive treatment. Goals of developing treatment hope to prevent or treat Lyme disease effectively to stop the development of PTLDS. Current PTLDS treatment is mostly supportive with a need for more research into direct treatments. New ongoing developments include the VLA15 vaccine and new antibiotics such as hygromycin A and azlocillin."
\ No newline at end of file