diff --git "a/deduped/dedup_0290.jsonl" "b/deduped/dedup_0290.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0290.jsonl"
@@ -0,0 +1,38 @@
+{"text": "Mitotic exit and cytokinesis must be tightly coupled to nuclear division both in time and space in order to preserve genome stability and to ensure that daughter cells inherit the right set of chromosomes after cell division. This is achieved in budding yeast through control over a signal transduction cascade, the mitotic exit network (MEN), which is required for mitotic CDK inactivation in telophase and for cytokinesis. Current models of MEN activation emphasize on the bud as the place where most control is exerted. This review focuses on recent data that instead point to the mother cell as being the residence of key regulators of late mitotic events. S. cerevisiae (budding yeast) sets up the constriction between mother and daughter cell, called bud neck, already at the G1/S transition concomitant with bud emergence, thus choosing ahead of time the position where cytokinesis will take place. Therefore, it is essential that the spindle be correctly aligned with respect to the mother-bud axis before cytokinesis takes place. A surveillance mechanism called spindle position checkpoint is in charge of responding to spindle misalignment by delaying mitotic exit and cytokinesis, thus providing the time necessary to correct the defects [In polarized cells alignment of the mitotic spindle respective to the polarity axis is crucial for maintaining the correct ploidy from one generation to the next. Many cell types deal with this problem by building the cleavage furrow perpendicularly to the spindle and equidistant to the spindle poles ,2. In co defects .In all eukaryotes mitotic exit takes place when mitotic cyclin-dependent kinases (CDKs) are inactivated, a task that is usually fulfilled by cyclin proteolysis. Mitotic CDKs inactivation is in turn necessary for spindle disassembly, licensing of replication origins and cytokinesis. The protein phosphatase Cdc14 is key to this process in budding yeast, where it promotes mitotic exit by turning on cyclin proteolysis and by activating the cyclin B-CDK inhibitor Sic1 ,6. Cdc14nud1, lead to a telophase arrest [The MEN is a signal transduction cascade that includes several protein kinases, such as Cdc5 (polo-like kinase), Cdc15, Dbf2 and its associated activator Mob1  do not (our unpublished data). Thus, a formal proof that Tem1 is active when bound to GTP still awaits experimental support. So far, the best evidence for such a model comes from studies in fission yeast, where the GTP-bound form of Spg1 interacts far more efficiently with the effector kinase Cdc7 (the orthologue of budding Cdc15) than its GDP-bound form [Tem1 is a small Ras-like GTPase, supposedly active in the GTP-bound form. However, mutations expected to cause hyperactivation of Tem1, on the basis of their effects on Ras proteins , either und form .in vitro GAP activity on Tem1, but only in combination with Bfa1 [By analogy with other Ras-like GTPases, Tem1 was originally thought to be regulated by the activity of GTPase-activating proteins (GAPs), which decrease the amount of active GTP-bound form by stimulating GTP hydrolysis. On the other hand, guanine-nucleotide exchange factors (GEFs) would promote the conversion of GDP- into active GTP-bound state. Indeed, proteins that might fulfil these two functions have been found in budding yeast, where Bub2 has a domain similar to GAPs, whereas Lte1 has a putative Ras GEF domain, consistent with their role in Tem1 inhibition and activation, respectively ,11. Accoith Bfa1 ,19, whicith Bfa1 -22. Surpith Bfa1 ,19. Thisith Bfa1 . The obsith Bfa1 ,24,25, bith Bfa1 ,25,26. Iith Bfa1 . This maith Bfa1 .in vitro GAP activity towards Tem1 when combined with Bfa1, is perfectly checkpoint proficient. This implies that the Bub2-myc9/Bfa1 complex (and by extension wild-type Bub2/Bfa1) might inhibit Tem1 through an unanticipated mechanism that does not involve GTP hydrolysis and release [bub2R85A mutant to recruit Bfa1 at SPBs rather than to loss of GAP activity [hyd~0.1 min-1) and GTP dissociation rate (Kd~0.1 min-1) compared to other Ras-like GTPases [in vitro [in vivo by other players, especially at SPBs. Thus, whether inhibition of Tem1 by Bub2/Bfa1 is achieved by switches in nucleotide binding or by other mechanisms remains an open question.Recent data have challenged further the role of Bub2/Bfa1 GAP activity in Tem1 inhibition. In particular, a myc-tagged version of Bub2, which does not display  release . Conversactivity . It shou GTPases . Therefoin vitro ,19. So fd~0.1 min-1 at 13\u00b0C, while the off-rate at 30\u00b0C is too fast to be measured [LTE1, the putative GEF, is not lethal but simply confers cold-sensitivity for growth (unlike TEM1 deletion) is consistent with this idea [Among GTPases, Tem1 is peculiar in that it shows an intrinsically high rate of GDP dissociation (Kmeasured ). In addhis idea ,28. Recehis idea . One posBUB2 or BFA1 is sufficient to neutralize completely the spindle position checkpoint [The localization of Tem1 and its regulators is tightly controlled during the cell cycle Fig. . Tem1, weckpoint ,31-33, sHow might this be achieved? One mechanism that contributes to Bub2/Bfa1 inactivation is phosphorylation of both subunits by the polo kinase Cdc5 ,35, althThe current model for mitotic exit predicts that most of the regulation over mitotic exit takes place in the bud. Accordingly, the amount of Tem1 found on the bud-directed SPB roughly doubles during anaphase, when only small quantities of Tem1 can be found on the mother-bound SPB. However, Bub2/Bfa1 is also concentrated on the bud-directed SPB at the time the spindle passes through the bud neck; its levels drop dramatically only afterwards, in mid- to late-anaphase . If penelte1\u0394 cells, suggesting that yet another mechanism participates in Tem1 activation at the end of mitosis. Importantly, the disappearance of Bub2 from the mother-bound SPB at the onset of anaphase depends on its GAP activity. Indeed, the Bub2R85A mutant that lacks GAP activity remains constitutively at both SPBs despite being unable to recruit Bfa1, whereas myc-tagged Bub2 behaves similarly but does recruit Bfa1 [R85A would have no GAP activity towards any of its substrates, explaining its inability to recruit Bfa1 at SPB and to activate the checkpoint, whereas myc-tagged Bub2 could be deficient only in stimulating the GTPase activity of Tem1. Hence, Bub2/Bfa1's GAP activity on Tem1 might be involved in regulating its subcellular localization rather than in triggering the checkpoint.Recent data have highlighted an important role for the mother cell in controlling mitotic exit upon spindle mispositioning. This would seem quite logical in light of the fact that anaphase takes place within the mother cell when the spindle is not properly oriented ,37. In tuit Bfa1 . Thus, BDisappearance of Bub2 from the mother-bound SPB in anaphase depends also on a functional septin ring and on several protein kinases localized at the bud neck , consistS. pombe Dma1 [KIN4, deletion of DMA1 and DMA2 causes premature mitotic exit in the presence of misoriented spindles [DMA2, like that of KIN4, delays mitotic exit by anatgonizing Tem1 activation [The Kin4 kinase, which prevents Cdc14 release from the nucleolus in response to defects in spindle alignment by antagonizing MEN activation, has been recently implicated in regulating Bub2/Bfa1 activity ,41. Althmbe Dma1  and humambe Dma1 , which aspindles , but notspindles -42. Furttivation ,42. It wSo far, a definitive model for how yeast mitotic exit is controlled in response to spindle mispositioning has been hampered by the impossibility to monitor Tem1 activation individually at each subcellular location. Recruitment of the effector kinase Cdc15 to SPBs is assumed to be a good marker for Tem1 activation, but the timing of Cdc15 localization at each SPB is controversial ,30,45-47"}
+{"text": "Otp expression during development.The homeodomain transcription factor Orthopedia (Otp) is essential in restricting the fate of multiple classes of secreting neurons in the neuroendocrine hypothalamus of vertebrates. However, there is little information on the intercellular factors that regulate otp orthologues in zebrafish (otp1 and otp2) and explored otp1 in the context of the morphogenetic pathways that specify neuroectodermal regions. During forebrain development, otp1 is expressed in anterior groups of diencephalic cells, positioned in the preoptic area (PO)  and the posterior tuberculum (PT) . The latter structure is characterized by Tyrosine Hydroxylase (TH)-positive cells, suggesting a role for otp1 in the lineage restriction of catecholaminergic (CA) neurons. Disruptions of Hedgehog (HH) and Fibroblast Growth Factor (FGF) pathways point to the ability of SHH protein to trigger otp1 expression in PO presumptive neuroblasts, with the attenuating effect of Dzip1 and FGF8. In addition, our data disclose otp1 as a determinant of CA neurons in the PT, where otp1 activity is strictly dependent on Nodal signaling and it is not responsive to SHH and FGF.Here, we identified two otp1 transcription factor in cell states of the diencephalon anlage and early neuronal progenitors. Furthermore, our data indicate that morphogenetic mechanisms differentially regulate otp1 expression in alar and basal plates.In this study, we pinpoint the evolutionary importance of  Parkinson's disease and addiction) .-40.syu, nts Fig. , which agulation ,40. Inhiotp1 expression after shh microinjection was selectively observed in the optic placodes  interferes with the Nodal pathway causing massive defects in the rostral brain [otp1 expression in cyc mutant embryos with intermediate phenotypes  shows midline fusion of PO-specific otp1 expression; moreover, we noticed that the domain is decreased in size   mutant embryos. This phenotype is not caused by shh deficiency since otp1 expression in the posterior basal plate of the hypothalamus is not modulated by HH signaling, but could be determined by the absence of the prosencephalic ventral structures. This issue has been addressed overexpressing ndr2 and analyzing the effects on otp1 transcription in the PT area. Increase of Ndr2 function is shown to determine the expansion of the PT-specific otp1 domain  Fig. , pointinain Fig. , in accoberculum ,82.otp1. Because both otp1- and TH-positive neurons occur in the PT, we co-labelled this area. Interestingly, otp1 and TH partially overlap in a small clade of neuronal precursors  [otp1-positive neurons   show lesons Fig. . The hypion Fig. . Altogetotp1 expression and Nodal, SHH and FGF signaling cascades in the hypothalamus. The first piece of evidence demonstrates that Nodal, in concert with fgf8 and shh, mediates otp1 expression in the preoptic area  has been isolated by means of PCR from a 16\u201340 hour old zebrafish embryo cDNA library using degenerate primers ort1_fw (5'-CCNGCNCAGCTSAACGA-3') and ort2_rv (5'-CKYTTYTTCCAYTTNGC-3'), corresponding to PAQLNE and AKWKKR regions of the mouse Otp homeodomain, respectively. The first round of PCR has been carried out using the ort2_rv degenerate primer with the T3 library-vector specific primer. An aliquot of this reaction has been used as template with the ort1_fw and ort2_rv primers. The 150 bp cDNA band obtained encoded a partial homeodomain identical to the corresponding residues of the mouse Otp protein. Gene- and vector-specific primers were used on the same library to isolate the 5' and 3' ends of the otp1 mRNA.The zebrafish homologue of Bos taurus, Otp XM_604218; Gg, Gallus gallus, Otp AY651764; Cf, Canis familiaris, Otp XM_546055, Otx2 XM_547830; Pt, Pan troglodytes, XM_517691; Hs, Homo sapiens, Otp NM_032109, Otx2 NM021728; Mm, Mus musculus, Otp CAA71439; Rn, Rattus norvegicus, Otp XP_215445; Dr, Danio rerio, Otp1 AF071496, Otx1 NM131250, Otx5 NM_181331; Dm, Drosophila melanogaster, Otp NM_206187; Pd, Platynereis dumerilii, Otx AJ278856; Sp, Strongylocentrotus purpuratus, Otp XM_779506, Otx NM_214588; At, Achaearanea tepidariorum, Otd AB096074; Tc, Tribolium castaneum, Otd1 NM_001039424, Otd2 NM_001039437; Ci, Ciona intestinalis, Otp AB210618; Ef, Euscorpius flavicaudis, Otd AY738138; Xt, Xenopus tropicalis, Otx1 NM_203885; Sk, Saccoglossus kowalevskii, Otp AAP79292; Pv, Patella vulgata, Otp AF440099; Lv, Lytechinus variegatus, Otp AAR17090; Pl, Paracentrotus lividus, Otp O76971; Ht, Heliocidaris tuberculata, Otp AAS00592; He, Heliocidaris erythrogramma, Otp AAS00591; Ds, Drosophila subobscura, Antp X60995; Dv, Drosophila virilis, Antp AY333070; Am, Apis mellifera, Antp NM_001011571; Sc, Sacculina carcini, Antp AF393443; Pc, Podocoryne carnea, Tbx4/5 AJ581006.A total of 47 sequences, gathered from several EST and genomic databases, were aligned using the ClustalW algorithm  as impleDugesia japonica (Dj) Otp sequence was obtained directly from Umesono and co-workers [Hydra magnipapillata (Hm), Takifugu rubripes (Tr) and Tetraodon nigroviridis (Tn) Otp sequences were generated in the course of this study and are available from the authors. The alignment was manually refined and used as the basis for all tree reconstruction methods. Maximum parsimony (MP) analysis was carried out in PAUP* 4.0b10 (Windows version) [While -workers , Hydra mversion)  using thversion)  implemenversion)  using thversion) . Four Maversion)  was calcversion) . The besotp1 expression using the forward (zotpS: 5'-ATGCTCTCTCATGCCGACCT-3') and reverse (zotpRv: 5'-TCTGTTGGTTTTGCTGGCCG-3') primers spanning the cDNA region involved in alternative splicing. The products of the PCRs were loaded and resolved onto 2% agarose gels.Total RNAs from 15 samples corresponding to 10 different developmental stage embryos  and 3 adult organs  were purified, DNase treated, and reverse-transcribed. The cDNAs obtained were tested for the presence of in vitro labelled with digoxigenin or fluorescein (Roche). For double WISH and antibody labelling, WISH was performed first, then embryos were exposed to rat anti-Tyrosine Hydroxilase (TH) (Chemicon) and mouse anti-acetylated \u03b1-tubulin (Sigma). Embryos incubated with anti-TH were treated with biotinylated secondary antibody (Vector Laboratories).WISH hybridization was carried out according to Thisse and co-workers  on embryshh, ndr2, and fgf8 mRNAs were injected repeatedly (n > 3) at concentrations of 400, 200, and 200 pg per embryo, respectively. Injections were carried out on 1- to 2-cell stage embryos. To repress otp1 mRNA translation, an ATG-targeting morpholino was designed : 5'-CCAAGAGGTCGGCATGAGAGAGCAT-3'.Synthetic capped in silico cloning procedures, the molecular genetic and functional studies, and drafted the manuscript. AP and RT carried out some of the molecular genetic and functional studies. BDB participated to the identification of otp1 and preliminary expression analysis. NA carried out sequence alignments and evolutionary analysis. FC participated in the design and coordination of the study. All authors read and approved the final manuscript.LDG and PS designed the study, carried out the wet and"}
+{"text": "Purpose. The study was performed to assess the antitumour activity and toxicity of a 72-h continuous infusion ofsingle-agent etoposide as second-line treatment for patients with locally advanced or metastatic soft tissue sarcoma (STS),following reports of substantial activity using this schedule of etoposide administration as first-line treatment incombination with ifosfamide.            Patients/method. This was an open phase I/II trial performed at a single institution in             patients with metastatic or locallyadvanced STS who had failed first-line treatment with doxorubicin + ifosfamide combination chemotherapy or, lesscommonly, single-agent treatment with doxorubicin or ifosfamide. Etoposide was given as a continuous intravenousinfusion over 72 h. The starting dose level was200 mg m-2day-1 \u00d7 3 escalating in 10% steps in cohorts of three patientsuntil dose-limiting toxicity was encountered.            Results. Seventeen patients were treated, median age 47 years (range 26\u201371 years). No responses were seen in 16assessable patients despite etoposide levels in the cotoxic range. The steady-state plasma concentration exceeded8 \u03bcg ml\u22121 in all patients and in patients treated at \u2265 600 mg m \u22122 the mean steady-state level was 14.4 \u03bcg ml \u22121. Themedian event-free survival was 6 weeks  3.31\u20138.69) and the overall survival 16 weeks (95%CI 9.28\u201322.72). The maximum tolerated dose in this pretreated patient group was 200 mg mm-2day-1 \u00d7 3. The dose-limiting toxicity was myelosuppression.            Discussion. Etoposide given by 72-h infusion is inactive as second-line chemotherapy in STS.It is associated with significant toxicity when given in these doses, in this patient group."}
+{"text": "While many of the molecular mechanisms underlying these two pathways remain to be elucidated, it is generally accepted that their relative contribution to peroxisome formation may vary depending on the species, cell type and/or physiological status of the organism. One pertinent example of the apparent differences in the regulation of peroxisome biogenesis among evolutionarily diverse species is the involvement of the peroxin PEX16. In Yarrowia lipolytica, for instance, PEX16 is an intraperoxisomal peripheral membrane protein that participates in peroxisomal fission. By contrast, Human PEX16 is an integral membrane protein that is thought to function at the ER during the early stages of de novo peroxisome formation and also recruits peroxisomal membrane proteins directly to mature peroxisomes. Similarly, PEX16 in the plant Arabidopsis thaliana is speculated to be a PMP receptor at the ER and peroxisomes, and is also required for the formation of other ER-derived organelles, such as oil and protein bodies. Here we briefly review the current knowledge of Y. lipolytica, human and A. thaliana PEX16 in the context of our overall understanding of peroxisome biogenesis and the role of the ER in this process in these three divergent species.Peroxisomes are formed by two distinct pathways: the growth and fission of mature peroxisomes and  Peroxisomes are found in virtually all eukaryotic organisms and while they possess a somewhat simple architecture consisting of a nonhomogenous matrix enclosed by a single membrane, their metabolic functions are highly complex  in the matrix-facing leaflet of the P1\u2013P5 membranes Figure , therebyBesides its unique role in peroxisome division, YlPex16p is perhaps best known as one of the first PMPs experimentally shown to target indirectly to peroxisomes via the ER  is an integral membrane protein containing at least two transmembrane domains (TMDs) Figure  and a tode novo synthesis of peroxisomes seems to be as a receptor responsible for the integration of the peroxin PEX3 into the ER and, thus, possibly the subsequent insertion of other PEX3-dependent group I PMPs at the ER  to mature peroxisomes  mutant in Arabidopsis. Herein, SSE1 was re-annotated as PEX16 based on its sequence similarity to YlPex16p  those responsible for directing the protein from its sites of synthesis in the cytosol to the ER and (ii) those that direct it from the ER to peroxisomes (Karnik and Trelease, Y. lipolytica Pex16p (Guo et al., novo synthesis of peroxisomes [e.g., human PEX16 (Kim et al., S. cerevisiae, lack a PEX16 homolog (Kiel et al., lipolytica (Van Der Zand et al., S. cerevisiae, is that all of the PMPs in this yeast are inserted into the ER via the SEC61 complex (Van Der Zand et al., One of the key regulators of peroxisome biogenesis is PEX16, a peroxin that, depending on the organism, functions in remarkably diverse ways, including the control of peroxisome fission [e.g., The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "N-glycans of IgGs from guineafowl, peafowl, and turkey were confirmed by mass spectrometry (MS), MS/MS, and MSn analyses. In quail, the presence of Gal\u03b21-4Gal was confirmed by detecting the activities of UDP-galactose: \u03b2-galactoside \u03b21,4-galactosyltransferase ) in various tissues, and by detecting Gal\u03b21-4Gal by western blotting. In contrast, bamboo partridge, which is a close relative of chicken, did not show any detectable activities of \u03b24GalT or Gal\u03b21-4Gal on glycoproteins. Because quail, peafowl, turkey, chicken, and bamboo partridge belong to the same family, i.e., Phasianidae, expression of Gal\u03b21-4Gal was most likely differentiated within this family. Considering that Gal\u03b21-4Gal is also expressed in ostrich, emu, and pigeon, which are phylogenetically distant relatives within modern birds, Gal\u03b21-4Gal expression appears to be widely distributed among birds, but might have been abolished in the ancestors of chicken and bamboo partridge.The Gal\u03b21-4Gal epitope is rarely found in mammals, and the natural antibody against Gal\u03b21-4Gal is rich in human. In contrast, we have previously demonstrated the presence of Gal\u03b21-4Gal in pigeon and ostrich, and the absence of this epitope in chicken. Here, to further investigate the expression of this glycan among birds, egg white glycoproteins and egg yolk IgG from nine species of birds, namely, chicken, duck, emu, guineafowl, ostrich, peafowl, pigeon, quail, and turkey, were analyzed by western blot using an anti- antibody. The results indicated that some egg white glycoproteins from emu, ostrich, and quail, and heavy chains of IgG from all of the birds, except chicken and quail, were stained with the antibody. The presence of Gal\u03b21-4Gal on  Species-specific structures of glycans attached to glycoproteins or glycolipids are often found in nature. While well-conserved glycan structures among species are often crucial for the homeostasis of organisms that synthesizes them, the biological roles of species-specific glycans are not well understood. One of the hypothetical scenarios is that glycans are evolutionally differentiated to gain species-specific communication between self  and non-self , either for pathogenic or symbiotic relationships Although the presence of species-specific glycans are assumed to be important for the biological defense system, relatively little is known about the generation and distribution of glycan diversity in nature * , but absent in the other lineages of modern birds, namely, Ratitae  and Galloanserae  *Nomenclatures for avian classification are based on Sibley et al.We have previously revealed that birds possess different glycan profiles from those of mammals. One of the unique glycans in birds is the Gal\u03b11-4Gal epitope found on glycoproteins. When we analyzed egg white glycoproteins from 181 avian species, we showed that Gal\u03b11-4Gal on glycoproteins is present in a major lineage of avian species called NeoavesO-glycans of salivary gland mucin from Chinese swiftlet N-glycans of IgG from pigeon \u2021), which is responsible for the production of Gal\u03b21-4Gal epitope on N-glycans \u2021In this paper, GalTs are conveniently abbreviated as linkageGalT(acceptor substrate) to distinguish their acceptor substrate specificities each other, e.g., UDP-galactose: \u03b2-d-galactoside \u03b21,4-galactosyltransferase is designated as \u03b24GalT.) Based on these assays, we have found that Gal\u03b21-4Gal on glycoproteins was expressed not only in pigeon, but also in ostrich The other unique glycan in birds is the Gal\u03b21-4Gal epitope on glycoproteins, which was originally found in In this study, to further investigate the distribution of Gal\u03b21-4Gal in avian species, especially among close relatives to chicken, we first analyzed egg white glycoproteins and egg yolk IgGs, also called IgYs, from nine species of birds. The results suggest that Gal\u03b21-4Gal is expressed in a wider range of avian species than previously recognized, and that the ancestors of chicken and bamboo partridge might have lost the ability to produce Gal\u03b21-4Gal.1 mAb (mouse IgM) was from Gamma Biologicals . anti- mAb 68 (mouse IgG1) were prepared as described previously Adult female Japanese quail, and Chinese bamboo partridge, and eggs from duck and helmet guineafowl, were purchased from Saitama Experimental Animals Supply Co. Eggs from emu, ostrich, Indian peafowl, and wild turkey were purchased from a local farmer in the Ibaraki area. Eggs from chicken and Japanese quail were purchased from local grocery stores in the Kashiwa area. Anti-PProtein concentrations were measured by the BCA assay using the BCA Protein Assay Reagent Kit , or by the Bradford assay using Coomassie Plus Reagent (Pierce).N-terminal sequence analysis by Edman degradation, using the Applied Biosystems model 492HT Procise\u00ae Protein Sequencer. For matrix assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF-MS) analysis, an aliquot of each sample (0.5 \u00b5l) diluted with distilled water was mixed with 0.5 \u00b5l of 10 mg/ml sinapinic acid in 50% acetonitrile and 0.1% trifluoroacetic acid, and analyzed as described previously Lyophilized egg yolks (4 g) were dissolved with 100 ml of distilled water, and centrifuged to remove insoluble materials. Egg yolk IgG was isolated with the Eggcellent\u2122 Chicken IgY Purification Kit (Pierce), and further purified by gel-filtration using Superdex 200  at a flow rate of 2.5 ml/min, with PBS as the mobile phase. Fractions containing egg yolk IgG were collected and concentrated with an Amicon Ultra-15 10K . A portion of the glycoprotein was separated by SDS-PAGE and blotted onto polyvinylidene difluoride (PVDF) membranes for Ovomucoid was prepared as described previously Electrophoresis was performed under reducing conditions on a 12.5% SDS-polyacrylamide gel, using egg yolk IgG (1.5 \u00b5g/lane), egg white proteins (2.5 \u00b5g/lane), or tissue homogenates (20 \u00b5g of protein/lane). The separated proteins were transferred to PVDF membranes, followed by detection with Coomassie Brilliant Blue R-250 (CBB) or by antibody/lectin staining, as described previously N-glycosidase F or PNGase F) at 37\u00b0C for 16 h.Glycoproteins were dissolved with PBS containing 1% SDS and denatured by heating at 100\u00b0C for 3 min. After cooling to room temperature, the solution was diluted with nine volumes of PBS containing 0.5% Triton X-100, and was incubated with glycoamidase F -derivatized substrates A and B (N-Glycans were prepared as described previously 4HCO3 (pH 8.0) at 37\u00b0C overnight. After inactivating the enzymes at 100\u00b0C for 10 min, oligosaccharides were released with GAF-treatment in 50 mM NH4HCO3 (pH 8.0) at 37\u00b0C overnight. The N-glycans were digested with various exo-glycosidases under the following conditions: 2 mU of \u03b12,3-specific neuraminidase from Macrobdella decora  in 20 \u00b5l of 50 mM ammonium acetate buffer (pH 6.0), at 37\u00b0C for 24 h; 10 mU of \u03b1-galactosidase from green coffee bean  in 20 \u00b5l of 50 mM ammonium acetate buffer (pH 6.0), at 37\u00b0C for 48 h; and 3 mU of \u03b21,4-galactosidase from Streptococcus pneumoniae  in 20 \u00b5l of 50 mM ammonium acetate buffer (pH 6.0), at 37\u00b0C for 24 h.N-glycans, and subsequent MALDI-MS and MS/MS analyses on a MALDI TOF/TOF  were performed essentially as described previously n analyses were performed on an LTQ-Orbitrap XL hybrid FT mass spectrometer (Thermo Scientific). The permethylated glycans in 50% acetonitrile/5 mM sodium acetate were directly infused by static nanoESI. MSn data were each acquired over a period of time and signals were generally averaged from 10 microscans except those of the final MS4 stage, which were averaged from 60 microscans or more to give a good signal to noise ratio. The precursor ion isolation widths were set at 3, 5, and 5 mass units for MS2, MS3, and MS4 analysis, respectively, while a 30% normalized collision energy was applied throughout the sequential MSn analyses.Permethylation of the released Erythrina cristagalli agglutinin (ECA), which recognizes Gal\u03b21-4GlcNAc. This fact suggests that all species tested have the substrates for \u03b1/\u03b24GalTs in the cells that biosynthesize the glycoproteins. In contrast, egg white glycoproteins from all species except pigeon did not stain with anti-P1 mAb, which recognizes Gal\u03b11-4Gal\u03b21-4GlcNAc  mAb  mAb , N-glycaN-glycans from these IgGs were analyzed by MS and MS/MS analyses  assay and the \u03b24GalT(GlcNAc) assay were performed on tissues from quail and bamboo partridge by the same method described previously, using the 2-aminopyridine (PA)-derivatized -glycans  as accep-glycans , althoug-glycans . Even whThe results of antibody/lectin-staining for tissues from quail and bamboo partridge  were corBirds are one of the higher vertebrates that radiated in the Tertiary period (65\u20131.6 million years ago (mya)) together with mammals. However, the glycan aspects of birds might have been evolutionarily differentiated from those of mammals, after the ancestors of birds and mammals separated about 310 mya O-glycans from Chinese swiftlet N-glycans of IgG from pigeon Gal\u03b21-4Gal in birds was initially identified in Galloanserae is a smaller group of avians in terms of the number of species comparing to those of Neoaves. However, some of the species belonging to Galloanserae are very familiar. The chicken, for example, was domesticated more than 8,000 years ago Danio rerio), African clawed frog (Xenopus laevis), and Western clawed frog (X. (Silurana) tropicalis) Anolis carolinensis), a reptile. Although the presence of Gal\u03b21-4Gal epitope in the reptiles remains to be clarified, we confirmed the presence of Gal\u03b21-4Gal epitope in zebrafish and African clawed frog by the western blot analysis The presence or absence of Gal\u03b21-4Gal in pigeon, ostrich, quail, chicken, and bamboo partridge were correlated with the activities of \u03b24GalT detected in various tissues , 7 15]..5). MoreN-glycolylneuraminic acid (NeuGc) et al. (2007) reported that there is strong purifying selection for preserving the gene encoding \u03b13GalT in noncatarrhine mammals, and proposed that loss of the active \u03b13GalT gene in catarrhines became possible only after alternative and/or more beneficial glycosyltransferase activity evolved in the ancestors of catarrhines The expression of Gal\u03b21-4Gal among birds and the loss of expression in chicken are reminiscent of the species-specific expression of Gal\u03b11-3Gal N-glycans as acceptor substrates to detect activities of GalTs in this study. There may or may not be other \u03b24GalTs which act only for glycolipids.The absence of Gal\u03b21-4Gal can also provide some advantages in excluding foreign organisms that express this epitope. It is reported that the natural antibody against Gal\u03b21-4Gal is rich in human Finally, our findings are also useful to study pathogens of birds. The presence of unique glycan epitopes of avian species was not well focused on so far. One of the reasons is that the glycan aspects from chickens and humans are somehow similar, i.e., the absence of Gal\u03b11-4Gal, Gal\u03b21-4Gal, Gal\u03b11-3Gal"}
+{"text": "Hospital acquired infection (HAI) is a frequent and serious burden in Palestine. HAIs increase the morbidity and mortality rates and cause longer hospital stays and higher costs. Anesthetic equipments are potential vectors for HAIs and anesthiologists themselves may act as vectors for the transmission of such diseases. This is particularly important when performing invasive procedures and when there is a risk of contact with blood and other body fluids.This study was conducted to explore the attitudes of anesthesia residents and specialists towards infection control (IC) standards and training in Palestine.A multi-centre, cross-sectional, descriptive study, using a self-administered questionnaire, was conducted in January-March 2015. Participants\u2019 needs regarding IC training material and programs policies were examined using 48 items questionnaire. SPSS was used for data analysis.Fifty-seven anesthesia doctors from nine governmental and private hospitals in West Bank responded to our survey. Most participants were male (93%) of them 66.7% were residents, and 29.8% were specialists. 61.4% had a postgraduate degree . One third of the respondents reported the absence of an infection control program in their departments. Interestingly, only one quarter of participants had infection control training inside and/or outside the hospital. 67.3% reported no access to an IC manual while 46.4% do not know about the presence of IC manual. The majority (98.2%) has indicated that a qualified IC training is needed.IC teaching programs should be urgently introduced and implemented in the Palestinian training curriculum for anesthiologists and anesthesia doctors in training. Access to an up-to-date IC training manual should be addressed to provide access to the best knowledge and practices of IC standards.None declared."}
+{"text": "This study examines the relative technical efficiency of 12 hospitals in Eastern Ethiopia. Using six-year-round panel data for the period between 2007/08 and 2012/13, this study examines the technical efficiency, total factor productivity, and determinants of the technical inefficiency of hospitals. Data envelopment analysis (DEA) and DEA- based Malmquist productivity index used to estimate relative technical efficiency, scale efficiency, and total factor productivity index of hospitals. Tobit model used to examine the determinants of the technical inefficiency of hospitals. The DEA Variable Returns to Scale (VRS) estimate indicated that 6 (50%), 5 (42%), 3 (25%), 3 (25%), 4 (33%), and 3 (25%) of the hospitals were technically inefficient while 9 (75%), 9 (75%), 7 (58%), 7 (58%), 7 (58%) and 8 (67%) of hospitals were scale inefficient between 2007/08 and 2012/13, respectively. On average, Malmquist Total Factor Productivity (MTFP) of the hospitals decreased by 3.6% over the panel period. The Tobit model shows that teaching hospital is less efficiency than other hospitals. The Tobit regression model further shows that medical doctor to total staff ratio, the proportion of outpatient visit to inpatient days, and the proportion of inpatients treated per medical doctor were negatively related with technical inefficiency of hospitals. Hence, policy interventions that help utilize excess capacity of hospitals, increase doctor to other staff ratio, and standardize number of inpatients treated per doctor would contribute to the improvement of the technical efficiency of hospitals. The health care system of many countries in Sub-Saharan Africa including Ethiopia faces resource constraints to provide quality health services to the people. The shortage of health care resources may be related to poor economic performance, rapid population growth, and a decline in public spending. Moreover, in Sub-Saharan Africa, communicable, maternal, nutritional, and new borne diseases continue to dominate and putting stress on the already scarce health care resources of these countries .Hospitals consume a larger proportion of the total public health budget. Even though the percentage vary from country to country, hospitals in Sub-Saharan African countries consume a larger proportion of public health care resources. The situation in Ethiopia is like other Sub-Saharan countries. Hence, the efficiency of hospitals need to be given due attention as the budget they consume is enormous.It is recognized that improved efficiency is one of the main goals of health systems . Health Data Envelopment Analysis (DEA) has been used to analyze technical efficiency of hospitals in several Sub-Saharan African countries. Different studies have used different inputs and outputs to measure efficiency. For instance, studies conducted in Eritrea , BotswanIn the case of Ethiopia, few studies have been conducted to examine the efficiency of hospitals. A study by  examinedThis study was conducted on selected hospitals in eastern Ethiopia. The selected hospitals are from Eastern Hararghe (Oromia region), Harari region, Somali region, and Dire Dawa administration council. The included hospitals are both public and private. Panel data were collected from 12 hospitals for the period 2007/08 to 2012/13. The inputs include beds, health staff and drug supplies while the outputs include outpatient visits, inpatient days, and surgery.Data envelopment analysis (DEA) involves the use of linear programming methods to construct a non-parametric piece-wise surface (or frontier) over the data . DEA is The assumption of CRS may not be feasible due to the presence of imperfect competition, government regulations, and constraints on finance that force firms to run at suboptimal scale . For thiThe mathematical relationship between VRS and CRS efficiency measurements is given by mentclasspt{minimat is an output quantity index and Xt is an input quantity index. Each index represents accumulated growth from period 0 to period t.It is the measure of the relationship between the outputs of a hospital and the inputs used to produce those outputs. Productivity increase is manifested by rise in output per health worker hour and/or the use of more and/ or better health technology. In general, a productivity index is defined as the ratio of an output quantity index to an input quantity index, i.e. The DEA-based Malmquist Productivity Index (MPI) is often opted to study efficiency and productivity changes over a given period. The model is preferred for several reasons: it does not require information on the prices of inputs and outputs rather on quantities of inputs and outputs; imposition of functional form of production technology is not required; it easily accommodates multiple hospital inputs and outputs; and it can be broken down into the constituent sources of productivity change - i.e. efficiency changes and technological changes .Malmquist-DEA is applied to panel data to calculate indices of changes in Total Factor Productivity (TFP), technology, technical efficiency, and scale efficiency. The Malmquist Productivity Index (MPI) takes a value of more than one for productivity growth, a value of one for stagnation and a value of less than one for productivity decline. The output-oriented MPI is defined as the geometric mean of two periods\u2019 productivity indices, subsequently broken down into various sources of productivity change .The DEA model adopted is based on \u201321; and The efficiency score of decision-making units that employs multiple input and output is defined as:Following , if therWhere:th hospital;th hospital;The functional programming model of equation  can be cThus, the relative efficiency score of hospital p can be obtained by solving the following equation:The first constraint implies that all hospitals are on or below the frontiers while the second constraint implies that the weighted sum of inputs for the hospital equals one.To separate the technical and scale efficiency scores, variable returns to scale (VRS) model is considered. In variable returns to scale, the data are enveloped more closely than the CRS model. The main advantage of the VRS model is that it enables an inefficient firm to be relatively compared to efficient hospitals of the same size only. Therefore, the relative efficiency score of hospital p can be obtained by solving the following equation:Where:The DEA like Malmquist model is used to obtain the DEA efficiency scores of all the sample periods observations. The model applies for panel data and calculates indices of total factor productivity (TFP) change, technological change, technical efficiency change and scale efficiency change. The output based Malmquist productivity change index of  is speciWhere:If the value of equation  providesThe first term measures efficiency change while the second term measures technical change in the two periods. An improvement of efficiency occurs from period t to period t\u2009+\u20091 if the ratio is greater than 1 (one). The output-oriented DEA model was estimated for CRS DEA and VRS DEA models.The ultimate measure of output is an improvement in the quantity and quality of life. However, practical difficulties limit the use of outcomes approach . Hence, The DEA efficiency scores will be analyzed by regressing them against some characteristics of the hospitals to examine how these factors affect the (in) efficiency of hospitals. The censored Tobit model was used since the dependent variable is censored at zero from below. Like the studies of  and 25]25], in tThe model is specified in the following form:Where:ui\u2009~\u2009N ;Therefore, the empirical regression model is specified as:The variables in the model are defined as follows:INEFF: inefficiency scores.Size: The natural logarithm of numbers of bed is taken as a proxy to measure hospitals\u2019 size.BOR: It is the ratio number of inpatient days multiplied by 100 and divided by the available hospital beds multiplied by number of days in a year.Teachstat: It is teaching status dummy variable. It is 1 if it is teaching hospital and 0 other wise.Docstaff: This variable is measured by dividing the total number of medical doctors by the total staff of the hospital.Opinpdays: It is the outpatient visits as a proportion of inpatient days.Impdoc: It is the proportion of inpatients per medical doctor.\u03b10, \u03b21, \u03b22, \u03b23, \u03b24, \u03b25, and \u03b26, are coefficients to be estimated and \u03b5i is the random disturbance term.These variables used in the second stage . We converted the efficiency results into inefficiency score using equation eight (8). Thus, we used this inefficiency score as dependent variable and run it against the above defined independent variables. Some of the determinants of the hospital facility technical efficiency include average length of stay, outpatient visit as proportion of the inpatient days, bed occupancy rate, doctors to staff ratio, teaching status of the hospital, proportion of inpatients per medical doctor, and bed size , 26, 27)Regional bureaus of health collect data on inputs and outputs and other health related data. The study was conducted based on the data obtained from these bureaus of health of each respective region  in Eastern Ethiopia. The study used panel data of six year-round starting from 2007/08 to 2012/13 for each hospital. Having this panel data enables us analysis hospitals productivity changes overtime and allows us to control for unobserved heterogeneous characteristics of hospitals.All that is 12) hospitals in the Eastern Ethiopia are included in the study, except one for which the data was incomplete. The data collected covers the time between 2007/08 and 2012/13. Table\u00a02 hospitaTaking the average for the study period, Hiwot Fana hospital had the highest total staff which is 421  followed by Karamara, whereas ART had the lowest total staffs  followed by Yemariamwork hospital.Regarding the average yearly expenditure on salary, Dilchora hospital incurred the highest followed by Karamara hospital. The lowest expenditure on salary was incurred by Bisidimo. With respect to expenditure on drug, Bilal incurred the highest while Yimaj incurred the lowest. On the other hand, the average for yearly recurrent expenditure of the hospitals revealed that Dilchora hospital incurred the highest followed by Hiwot Fana. The lowest recorded was for Bisidimo followed by France.The average number of bed for the study period revealed that Hiwot Fana had the highest number of bed followed by Karamara and Jugal. The lowest recorded was for ART followed by Yemariamwork hospital.In this study, three major outputs of hospitals were considered for technical efficiency evaluation of hospitals. These three outputs were total yearly outpatient visit, total yearly inpatient days and total surgery performed in the respective hospitals. From Table\u00a0When we consider the total average yearly inpatient days, Dilchora had the highest average yearly inpatient days followed by Hiwot Fana and Karamara. The lowest was for ART followed by Yemariamwork and Bisidimo. About surgery, Dilchora had the highest total average yearly surgery followed by Jugal and Karamara. On the other hand, the lowest was recorded for ART followed by Yemariamwork and Police.Table\u00a0Overall, the public hospitals on average accounted for about 24,712, 999 and 16,431 outpatient visit, number of surgeries and inpatient days, respectively. Regarding inputs, on average over the sample period public hospitals accounted for about 123, 120 and 1,144,879 numbers of health staff, bed, and amount of birr of drug expenditure, respectively. From the above data, we can see that the share of the public in terms of average outputs and inputs is higher than the private hospitals except in drug expenditure.To separate the technical and scale efficiency in the health service production process which is often nonlinear, it is appropriate to assume output oriented variable returns to scale BCC model. Hence for this study we estimate the efficiency of hospitals assuming the variable returns to scale BCC model .Tables\u00a0On the other hand, 6 (50%) hospitals in the year 2007/08 and 7 (58.33%) of hospitals in the year 2008/09 registered a variable return to scale technical efficiency (VRSTE) score of 100%. Moreover, out of 12 hospitals, 3 hospitals (25%) in the year 2007/08 and 3 hospitals (25%) in the year 2008/09 were scale efficient. Regarding returns to scale, 3 (25%) of hospitals in the year 2007/08 and 3 (25%) of hospitals in the year 2008/09 manifested increasing returns to scale, respectively. Moreover, 6 (50%) and 6 (50%) of hospitals manifested decreasing returns to scale in the respective periods.Individual hospitals\u2019 technical and scale efficiency for the year 2009/10 and 2010/11 indicated that out of 12 hospitals, 5 (41.67%) registered a constant return to scale technical efficiency (CRSTE) score of 100%, whereas in the year 2010/11 again 5 (41.67%) hospitals registered a constant return to scale technical efficiency (CRSTE) score of 100%. Therefore, 7 (58.33%) of hospitals in the year 2009/10 and 7 (58.33%) of hospitals in the year 2010/11 were inefficient given the assumption of constant return to scale.On the other hand, 9 (75%) of hospitals in both periods registered a VRS technical efficiency score of 100%. Moreover, 5 hospitals (41.67%) were scale efficient in both periods. Regarding returns to scale, 2 (16.67%) of hospitals and 1 (8.33%) of hospitals manifested increasing returns to scale in the respective periods. However, 5 (41.67%) of hospitals and 6 (50%) of hospitals manifested decreasing returns to scale in the respective periods.Individual hospitals\u2019 technical and scale efficiency for the year 2011/12 and 2012/13 showed that out of 12 hospitals, 5 (41.67%) of the hospitals in 2011/12 and 4 (33.33%) in 2012/13 registered a constant return to scale technical efficiency (CRSTE) score of 100%, respectively. Therefore, given the assumption of constant return to scale in the year 2011/12 7 (58.33%), and in the year 2012/13, 8 (66.67%) of hospitals run inefficiently.On the other hand, 8 (66.7%) and 9 (75%) of hospitals in the respective periods registered a variable return to scale technical efficiency (VRSTE) score of 100%. Moreover, 5 (42%) and 4 (33%) of hospitals were scale efficient in respective periods. Regarding returns to scale, 1 (8.3%) of the hospitals in both periods manifested increasing returns to scale whereas 6 (50%) of the hospitals in 2011/12 and 7 (58%) in 2012/13 manifested decreasing returns to scale.The average scale efficiency score was 93%, 86%, 89%, 91%, 91%, 87% in the respective years between 2007/08 and 2012/13. The average VRSTE scores of hospitals in Eastern Ethiopia stood at 91, 89, 91, 83, 86 and 93% respectively.Table\u00a0The study analyzed the differences in productivity over time based on Malmquist Total Factor Productivity (MTFP) index taking the year 2007/08 as the technology reference  and the lowest was in 2010/11 (0.907).Table\u00a0On the other hand, 7 (58%) out of the 12 hospitals had Malmquist index score of less than one, indicating deterioration in productivity. Overtime productivity regression in Yimaj, Dilchora, Army and Bisidimo hospitals was due to deterioration in technical progress. However, productivity regression in the case of Police, ART and Hiwot Fana hospitals was due to decline in efficiency and technical progress.In Table\u00a0Scale efficiency change (SECH) is expressed as a value less than, equal to, or greater than one if a hospital scale of production contributes negatively, not at all, or positively, respectively, to productivity change . The scaFrance, Yimaj and Dilchora hospitals had a scale efficiency index value of one (1) meaning that those hospitals\u2019 scale of production did not contribute to MTFP change. On the other hand, the SECH score for 5 hospitals was less than one (1) indicating that the scale of production in Karamara, ART, Army, Police and Hiwot Fana hospitals contributed negatively to productivity change by 0.5, 7.3, 1.8, 0.3 and 9%, respectively. The average SECH score for the entire sample was 0.988 indicating that the scale of production on average reduced efficiency change by 1.2%.Ten hospitals (83%) registered technical change (TECH) of less than one indicating a decline in technical progress. The lack of technological progress in Karamara, Army, Jugal, Police, ART, Yimaj, Dilchora, Bisidimo, Bilal, and Hiwot Fana led to decrease in TFP  of 5.3, 3.8, 2.7, 2.3, 9.6, 2.8, 21.3, 2.2, 5.6 and 5.4%, respectively. France and Yemariamwork hospitals registered technical progress between the period t and t\u2009+\u20091 of 1.9 and 17.3%, respectively.In this study, we used random effect Tobit model. The panel data is for 6 periods running from 2007/08 to 2012/13. To analyze the determinants of inefficiency of hospitals, the technical efficiency score of hospitals was converted to inefficiency score of hospitals. Subsequently, the inefficiency score was used as a dependent variable and regressed against hypothesized determinants  using a censored Tobit model. Table\u00a0Teachstat) of the hospital is positively related with inefficiency score at 5% level of significance. This implies that being a teaching hospital reduces the expected efficiency score by 3.03.Teaching status  is negatively related with inefficiency and statistically significant at one (1) % level of significance. This implies that for a one unit increase in Dcstaff ; there is a 3.75 unit decrease in inefficiency score.The proportion of The coefficient for Opinpdays (outpatient visits to inpatient days ratio) has a negative sign that is consistent with our a priori expectation and significant at 10% level of significance. A one unit increase in the ratio of outpatient visit to inpatient days would lead to a decrease in hospital expected inefficiency score by 1.75.Impdoc  is negatively related to inefficiency score and statistically significant at one percent level of significance. It shows that the number of inpatients per medical doctor has negative relationship with inefficiency score. This implies that a one percent increase in the ratio of inpatient per doctor would drop the predicted value of inefficiency score by 3.25%.The coefficient of the The average Variable Returns to Scale Technical Efficiency (VRSTE) scores of hospitals in Eastern Ethiopia were 91, 89, 91, 83, 86 and 93% during the period, respectively. This finding implies that if run efficiently the hospitals could have produced 9, 11, 9, 17, 14 and 7% more output  for the same volume of inputs. The average VRSTE of hospitals in Eastern Ethiopia exhibit similarity with hospitals in Northern and Western Cape Provinces (82\u201382.8%) , KwazuluThe average scale efficiency scores were 93%, 86%, 89%, 91%, 91%, 87% in the respective years between 2007/08 and 2012/13. These average scale efficiency scores were within the range of those for Angola (81\u201389%) , Kenya ; regulation and legislation; partnerships and alliances with public, private, non-governmental organization and civil society: and inter-sectoral action to address determinants of health to improve the use of underutilized health services .It is also possible to provide access to universal health services through pooled pre-paid contribution collected based on ability to pay through the tax based funding . The othThe average MTFP of 0.964 for hospitals in eastern Ethiopia was comparable to those obtained in China inland of 0.985 , Greece Technical progress registered by hospitals may have been the result of applying better techniques with regard to both physical and human capital which allowed greater output with health system inputs held constant. This improvement could also have resulted from increases in motivation and/or skill of the health workforce.Technical progress (or regression) depends on different factors. These factors may include: the availability of appropriate health technology which require minimum skill with accompanying inputs and institutional changes. The existence of close cooperation of health policy makers and the hospital management is also essential. Moreover, it is also important to equip the relevant health workforce so that they will be able to use the new technology efficiently .Random effect Tobit model showed that teaching status of the hospital (Teachstat), medical doctor total staff ratio (Dcstaff), outpatient visits to inpatient days ratio (Opinpdays), and proportion of inpatients treated per medical doctor (impdoc) significantly determine the hospitals inefficiency in the study area.Teachstat) has hospital is positively effect on inefficiency score of the hospital implies that being a teaching hospital reduces the expected efficiency. This might be related to the focus that these teaching hospitals are given in terms of materials and other necessary inputs. These teaching hospitals offer specialized services that attract patients. The hospital that provides both health services and training are less efficient than other hospitals. This finding may explain that teaching hospitals are a place where knowledge, skills, and experience are obtained through practical training, learning, and demonstration in the hospital. Doing these learning and teaching alongside with provision of the health services may complicate and adds to inefficiency of the hospitals. This is may be because of teaching hospitals may not get focused on the activities as they care for both the academics and health services provision. Moreover, teaching hospitals care much the training, education, skills, that their staffs and students must acquire from the hospital.Accordingly, the fact that teaching status of the hospital (Dcstaff) negatively related to inefficiency implies that for an increase in ratio of medical doctors to the total staff there is a decrease in inefficiency score of hospitals. In the hospital, medical doctors are the staffs that have the highest level of education and training, and this may positively increase the efficiencies of the hospital. It may also be related to the spillover effect of the doctors to the other staffs. Additionally, this might be related to the improvement that might occur in facilitating service delivery associated with increasing of doctors as their quantity is few in developing country compared to the number of patient each serve. In contrast to this result, a study conducted in West Bengal in India by [The fact that the proportion of medical doctors to the total staff (India by  discoverThe negative relation between outpatient visits to inpatient day ratio (Opinpdays) and hospital inefficiency score indicates that an increase in the ratio of outpatient visit to inpatient days would lead to a decrease in hospital expected inefficiency score of hospitals. This result also agrees with the result obtained by  in the sImpdoc) is negatively related to inefficiency score of hospitals. This shows that the number of inpatients per medical doctor has negative relationship with inefficiency score. This implies that an increase in the ratio of inpatient per doctor would drop the predicted value of inefficiency score of hospitals. This finding may explain that there is a need to efficiently use available doctors and hospitals that provide health services. By doing so, efficiency and standard ratio of inpatients to the doctors can be maintained.The proportion of inpatients treated per medical doctor , 5 (42%), 3 (25%), 3 (25%), 4 (33%) and 3 (25%), while under a CRS assumption, 9 (75%), 9 (75%), 8 (67%), 7 (58%), 7 (58%) and 8 (67%) of the 12 hospitals were run inefficiently between 2007/08 and 2012/13. The results also indicate that 9 (75%), 9 (75%), 7 (58%), 7 (53%), 7 (58%) and 8 (67%) of the 12 hospitals were scale inefficient between 2007/08 and 2012/13. The estimate of the MTFP indicates that among the 12 hospitals, 7 (58%) experienced MTFP deterioration over the six years. The Tobit model indicates that teaching hospital is less efficient than other hospitals. The Tobit regression model further indicates that medical doctor to total staff ratio, the proportion of outpatient visit to inpatient days, and the proportion of inpatients treated per medical doctor were negatively related with technical inefficiency of hospitals.\u27a2 Hospitals should monitor their services delivery efficiency and need to identify inputs that are underutilized. This may help hospitals identify which input need to increase or decrease or transfer to other health services facilities so that the use of underutilized health sector services will be promoted.\u27a2 Hospitals should monitor their services delivery efficiency and need to identify output that fall short of targets. This may help hospitals identify which output/services need to increase or decrease so that they may deliver better services. In this regard, it is crucial to institutionalize efficiency monitoring of health facilities within health management information system. This can be implemented by either having section with in structure of each hospital that study the efficiency or regularly hiring study agent. By doing so hospitals may maintain their pure efficiency, scale efficiency and/or technical efficiency and thereby total factor productivity in delivering the service would increase.\u27a2 Policy interventions that increase utilization of underutilized hospital outpatient health services and reduce the average length of stay, increase doctor to other staff ratio and the number of inpatients treated per doctor would contribute to improve the technical efficiency of hospitals. This may be achieved by provision of the capacity building like training for the staff members of the hospitals on efficient resource utilization and service delivery. Increasing the health staffs that considers the population of the study area and standard of the health staff to patient ratio may help improve the efficiency of the hospitals. This can be achieved through hiring additional health staffs, and upgrading the capacity of the existing staffs through provision of on job training.Based on the findings, the following policy recommendations are forwarded. Further improvements can be made in the hospitals\u2019 efficiency by taking the following policy measures."}
+{"text": "Ago2 and Dcr2 of western corn rootworm (WCR), Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae) and observed that knockdown of Ago2 and Dcr2 ameliorated the lethal effect induced by the dsRNA-mediated knockdown of an essential gene in WCR, thereby confirming the involvement of Ago2 and Dcr2 in the dsRNA pathway. In the current study, we identified and characterized additional members of the Argonaute and Dicer gene families, namely Ago1, Ago3, Aubergine, and Dcr1, in a previously developed WCR transcriptome. We also identified a Drosha homolog in the same transcriptome. We evaluated the impacts on WCR adult fitness associated with the dsRNA-mediated knockdown of Ago1, Ago2, Dcr1, Dcr2, and Drosha genes. Among these putative RNAi pathway genes, only the knockdown of Ago1 incurred significant fitness costs such as reduced survival and oviposition rate, as well as decreased egg viability. The present study, to our knowledge, represents the first report showing that Ago1 is critical to the survival of insect adults. Our findings suggest that Ago1 plays an essential role in broader life stages of an insect than previously thought. Importantly, since fitness costs were not observed, downregulation or loss of function of RNAi pathway genes such as Ago2 or Dcr2 may confer resistance to pest control measures that rely on the normal functions of these genes. However, the precise roles of these genes under field conditions  requires further investigation.RNA interference (RNAi) based approaches can potentially be used to control insect pests. These approaches may depend on the usage of microRNA (miRNA) or double stranded RNA (dsRNA) mediated gene knockdown, which likely involves proteins that regulate these pathways, such as Argonaute 1 (Ago1), Argonaute 2 (Ago2), Dicer 1 (Dcr1), Dicer 2 (Dcr2), and Drosha in insects. We previously performed functional characterization of  RNA interference (RNAi) can be broadly defined as regulation of gene expression directed by small non-coding RNA molecules . RNAi cae.g., Argonaute 3 and Aubergine/Piwi) bind to diverse piRNAs, silence and immobilize transposable elements in reproductive organs through either transcriptional suppression or the establishment of methylation patterns [Nuclear RNAi consists of the Piwi-interacting RNA (piRNA) pathway in which Piwi-like proteins  and microRNA (miRNA) silencing pathways \u201314. The Drosophila, two Argonaute proteins, Argonaute 1 (Ago1) and Argonaute 2 (Ago2), are involved in the miRNA and dsRNA pathways, respectively. Argonaute proteins are characterized by the presence of conserved PAZ (Piwi-Argonaute-Zwille) domain that is involved in dsRNA binding and PIWI (P-element induced wimpy testis) domain that possesses RNase activity [Ago1 and Ago2 transcripts are present in 67 and 94 of 100 surveyed transcriptomes, respectively [Argonaute proteins, initially identified in plants, were later found in some prokaryotes and ~65% of sequenced eukaryotic genomes including fission yeast, plants, invertebrate and vertebrate animals \u201323. In Dactivity . A studyectively .e.g., Caenorhabditis elegans) that utilize one Dicer protein for the production of both miRNAs and siRNAs, Drosophila uses Dicer 1 (Dcr1) and Dicer 2 (Dcr2) in the processing of miRNAs and siRNAs, respectively [Dcr1 and Dcr2 orthologs have been found in 66 and 80 of 100 investigated transcriptomes, respectively [Dicer proteins are also widely present in eukaryotic organisms such as plants, fungi, and animals , 26. Dicectively . In inseectively .Drosha transcripts have been found in 79 of 100 transcriptomes evaluated [Drosha proteins, while absent in plants, are widely distributed in animals from nematodes to humans , 26. In valuated . Drosha valuated .Drosophila, loss of Ago2 or Dcr2 abolishes dsRNA-mediated gene silencing, but does not strongly affect development or physiology [Ago1 mutations result in a multitude of defects, including impaired oocyte development, loss of germline stem cells in adults, defective neural development and lethality in embryos [Drosophila Dcr1 and Drosha mutants display impaired oocyte formation and reduced germline cell division as well, suggesting that Ago1 protein and its miRNA biogenesis partners are important for oogenesis and germline cell division in this model insect [In ysiology . In cont embryos \u201333. Drosl insect .Diabrotica virgifera virgifera LeConte, a major insect pest of corn in the United States. Western corn rootworm presents a particular challenge to manage due to its ability to evolve resistance to insecticides, including Bacillus thuringiensis toxins expressed by transgenic corn plants [i.e., EPA, FDA, and USDA) in the U.S. (https://www.epa.gov/pesticide-registration/epa-registers-innovative-tool-control-corn-rootworm) and have been recognized by an international organization that promotes the world-wide use of crop biotechnology .Gene silencing pathways involving siRNA and miRNA can potentially be exploited to control agricultural insect pests such as western corn rootworm (WCR), n plants \u201337. Alten plants \u201341. ReflAgo2 and Dcr2 reduced the effects caused by dsRNA-mediated silencing of critical pigmentation/tanning genes [Ago2 and Dcr2 genes resulted in reduced mortality as well as reduced vATPase A knockdown after subsequent exposure to lethal concentrations of vATPase A dsRNA [Ago2 or Dcr2 is impaired in WCR. However, it is unclear what effect downregulation of RNAi pathway genes such as Ago2 and Dcr2 may have on WCR fitness. It is also unknown whether WCR possesses other putative RNAi pathway genes such as Ago1, Dcr1, or Drosha, and whether knockdown of these genes would affect fitness.For an effective management of WCR using RNAi-based strategy, it is important to identify and characterize the components of the dsRNA and miRNA gene silencing pathways. A previous study showed that silencing of ng genes , suggest A dsRNA . These rArgonaute gene family members, including Ago1, Ago3, and Aubergine, in a WCR transcriptome. We also identified Dcr1 and Drosha transcripts in the same transcriptome. In addition, we evaluated the effects of gene knockdown of Ago1, Ago2, Dcr1, Dcr2, and Drosha on WCR adult fitness. We found that knockdown of Ago1, but not Ago2, Dcr1, Dcr2, or Drosha had significant fitness costs that were assessed by comparing the viability, oviposition, and egg hatch rates.In the current study, we identified the transcripts of additional Argonaute transcripts, tBLASTn searches, using the protein sequences of Ago1, Ago2, Ago3, Piwi, and Aubergine from D. melanogaster and Tribolium castaneum as queries, were performed on a WCR transcriptome that was assembled from pooled datasets from eggs, neonates, and the midguts of third instars [Argonaute transcript as query until no new transcripts were identified in each subfamily. Putative Dicer and Drosha transcripts were identified in a similar manner using the protein sequences of Dcr1, Dcr2, and Drosha of D. melanogaster and T. castaneum as queries.To identify putative WCR  instars , 45. IteArgonaute, Dicer, and Drosha transcripts were performed based on their homology with well-studied query sequences from D. melanogaster. These annotations were further verified by performing reciprocal BLASTp searches, using the deduced amino acid sequences of WCR Argonaute, Dicer, and Drosha transcripts, against databases from which query sequences were derived. For further validation, the deduced amino acid sequences of these transcripts were used to search the conserved domain database (CDD: http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) to ascertain whether they contain the canonical domains for each type of protein .The initial annotations of Argonautes, the deduced amino acid sequences of the PIWI domains of WCR Argonautes were aligned with those of corresponding homologs from D. melanogaster and T. castaneum using MAFFT 7.147 [Dicers and Drosha from WCR, D. melanogaster, and T. castaneum.For the phylogenetic analysis of FT 7.147  with theArgonautes, Dicers, and Drosha were deposited in GenBank and their available accession numbers are provided in The nucleotide and deduced amino acid sequences of WCR \u00ae-Micro kit  according to the manufacturer\u2019s instructions. cDNA was made using the cloned AMV first-strand cDNA synthesis kit  according to the manufacturer\u2019s instructions. One microgram of total RNA isolated from a pooled sample of WCR  was used in a 20-\u03bcl reverse transcription reaction containing the manufacturer\u2019s recommended ingredients including Oligo(dT)20 primers. The reaction was performed in a thin-walled tube using a thermocycler . The reaction was incubated at 50\u00b0C for 60 min, followed by incubation at 85\u00b0C for 5 min.RNA from different life stages of WCR was extracted using the RNAqueouscDNA for quantitative reverse transcriptase PCR (qRT-PCR) was made using high-capacity cDNA reverse transcription kits  according to the manufacturer\u2019s instructions. Five hundred nanograms of total RNA from individual WCR females was used in a 20-\u03bcl reaction containing all ingredients. The reaction was incubated at 25\u00b0C for 10 min, then 37\u00b0C for 120 min, and 85\u00b0C for 5 min. Forty \u03bcl of TE  was then added to the cDNA reaction (1: 3 dilution). cDNA synthesized by both methods was stored at -20\u00b0C until use.Ago1, Ago2, Dcr1, Dcr2, Drosha, and GFP genes that were later used for dsRNA synthesis. PCR products for WCR genes were amplified from 1 \u03bcl of cDNA prepared as described above. PCR products for GFP gene were amplified from 50 ng of pGLO plasmid . Bands of the expected size (~ 500 bp) were extracted and purified using a Gel Extraction kit  according to the manufacturer\u2019s protocol. Direct sequencing of the purified PCR products was performed at the Interdisciplinary Center for Biotechnology and Research at the University of Florida using the primers used for PCR amplification. dsRNAs were synthesized from 1 \u03bcg of purified PCR products (500 bp) using MEGAscript RNAi kit  according to the manufacturer\u2019s instructions. Sizes of purified dsRNAs were confirmed by gel electrophoresis on a 1% agarose gel containing 1X TBE buffer. Concentrations of purified dsRNAs were determined by spectrophotometry , and purified dsRNAs were stored in elution buffer at -20\u00b0C until further use.Primers with the T7 promoter sequence added at the 5\u2019 ends  were useNewly emerged, non-diapausing WCR adults (mixed sexes), purchased from Crop Characteristics Inc. , were provided with fresh sweet corn ears and allowed to mate for at least 4 days before bioassays. Western corn rootworm females (5\u20136 days old and in groups of 10) were transferred into 118 ml souffl\u00e9 cups and starved for 24 hrs. They (except water control WCR) were then fed with a total of 10 \u03bcg of dsRNA per WCR over a 12-day period . For the first 2 days of the 12-day period, the WCR females were provided with 83.3 \u03bcl of solution containing 300 ng dsRNA/\u03bcl in 20% sucrose (Sigma) each day. Water control females were provided with 83.3 \u03bcl of 20% sucrose solution. For the next 10 days of the 12-day period, WCR females were provided with five artificial diet plugs (~ 4 mm in diameter and 2 mm in height) each coated with 20 \u03bcl of dsRNA (100 ng/ \u03bcl) or water  every other day. The artificial diet was prepared as described previously .Ago1 and Ago2, females in each oviposition box were provided with 2 diet plugs treated (in the same manner as above) with water or dsRNA every other day. For the long-term (28 days) loss-of-function study of Ago2, a different cohort of WCR females underwent the initial 12 days of exposure to various dsRNA or control treatments in the same manner as in the short-term study. They were then allowed to oviposit for 7 days after being moved to oviposition boxes. During this 7 day-period, water- or dsRNA-treated diet plugs were provided every other day. After the initial 7-day period, females were transferred to new oviposition boxes every 7 days and water or dsRNA-treated diet plugs were provided only once a week for 3 weeks. Untreated diet was provided every other day during the last three weeks of the oviposition period.After the initial 12-day treatments, females (in groups of 5) were transferred to polystyrene oviposition boxes (7.5 cm \u00d7 5.5 cm \u00d7 5.5 cm)  and were evaluated for their fitness on short-term (4 days) or long-term (28 days) basis with 5 females in each oviposition box representing one biological replicate. For the short-term (4 days) loss-of-function studies of The fitness parameters measured during the loss-of-function studies included the survival and oviposition rates, and the hatch rate of the eggs. The fitness evaluation was performed using the design of a previous study . The oviAt the end of the short-term (or long-term) loss-of-function studies, the surviving WCR were counted and then removed from oviposition boxes, with one female  from each oviposition box processed for expression analyses by qRT-PCR.Dcr1, Dcr2, and Drosha was performed in the same manner as Ago1 and Ago2. On day 4 of the short-term study, the numbers of surviving WCR were recorded and one WCR from each oviposition box was collected for gene expression assay. The remaining WCR females were evaluated for another 24 days. The WCR females were pooled in groups of five, transferred into new oviposition boxes, and provided with water- or dsRNA-treated diet. They were moved to new oviposition boxes again on days 7 and 14 after the start of the 24-day assay and provided with water- or dsRNA-treated diet plugs on days 3, 10, and 18.The short-term loss-of-function study of Eggs deposited during the oviposition period were incubated in soil within the oviposition boxes for 10 days at 25\u00b0C in the dark before being removed from the soil by washing through a 60-mesh sieve. Harvested eggs were held in Petri dishes on moistened filter paper at 25\u00b0C, RH > 80%, in the dark. The Petri dishes were photographed and total eggs counted using the cell counter function of Image J software . The number of larvae hatching from each dish was recorded daily until no further hatching was observed.-\u03b4\u03b4CT method [\u03b2-actin [qRT-PCR analysis was performed in a similar manner as described previously . The seqT method  and was [\u03b2-actin , 51\u201353. p < 0.05) in manners similar to previous studies [t test.The means and standard errors of means (SEM) were analyzed by analysis of variance (ANOVA) , and means were separated using Tukey\u2019s HSD test .The transcriptomic hits of  queries . The preArgonautes was further validated by phylogenetic and domain structure analyses . Finally, they all have the canonical PIWI domains at their C termini.As shown in We further evaluated the presence of conserved residues that are important for PIWI domain functions in WCR Argonaute proteins. Four residues  in the conserved motif (Tyr-Xaa3-Lys-Xaa(9\u201311)-Gln-Xaa(21\u201333)-Lys) of the PIWI domain that are believed to be involved in binding to the 5\u2019 phosphate group of the first nucleotide of the guide RNA strand  are all Also illustrated in Dcr2, we identified a Dcr1 and a Drosha transcripts in the WCR transcriptome. A phylogenetic analysis shows that WCR Dcr1, Dcr2, and Drosha cluster with their respective orthologs from Drosophila and Tribolium , we next performed loss-of-function analyses on these putative RNAi pathway genes using an RNAi-based approach.Because we were interested in evaluating the possibility that WCR may develop resistance to dsRNA- or miRNA-based pest control measures through downregulating the expression of RNAi pathway components  in which different Argonautes participate are likely conserved among these species. That the phylogenetic tree of Dicers and Drosha of these insects also follows the phylogeny of these species lends further support to the notion that these pathways involving small, non-coding RNAs are conserved across species.In the current study, we identified five novel, putative members of the WCR RNAi pathway: se genes  that shoAgo1s show the highest degree of homology among different species. Similar observations have been made before. For example, studies of Argonautes from several vector mosquitos and drosophilid species showed that the Ago1s evolved at much lower rates than other Argonautes such as Ago2s [Ago1 conservation implies an evolutionary trend of purifying selection, probably due to the conserved mechanisms in the biological pathways  involving this Argonaute protein. This hypothesis is supported by the conservation of many miRNAs among drosophilids, mosquitoes, and humans [Among all Argonautes, as Ago2s , 59. Agod humans .Ago1 appear to support the idea that Ago1 plays essential roles in multiple biological pathways in WCR. Females with decreased Ago1 expression suffered a clear reduction in fitness, such as increased mortality and reduced oviposition in those females that survived. Hatching of eggs produced by these females also decreased. Importantly, these defects were observed in two separate WCR cohorts treated with two non-overlapping Ago1 dsRNAs . It is also possible that the essential role that Ago1 plays in adult survival may be WCR-specific.Interestingly, there have been only a few studies investigating the effects of c lethal . A studyl period . It is pl period  is due tAgo1 transcript was found in the head and the digestive systems of Drosophila adults (http://flybase.org). Another study found that human Ago1 bound directly to RNA polymerase II and the promoters of actively transcribed genes in cancer cells. Results from this latter study suggest that this protein may play a direct role in regulating the transcription of genes, some of which are important for cell growth and survival [Results from previous studies suggest that Ago1 may play, in adults of other animals, important roles other than those found in sexual organs. Some studies showed that survival . Taken te.g., miRNA) that WCR Ago1 is involved in. Similar to dsRNA-based approaches, miRNA-based measures also have the potential to be effective in controlling pest insects [Ago1, due to the high fitness cost associated with such action.Further studies are needed to reveal the details of pathways . Thus, it is possible that WCR Dcr1 may be difficult to knock down strongly using an RNAi-based method. If so, alternative approaches  may be needed for a definitive loss-of-function study of Dcr1, and possibly Drosha. Secondly, it is possible the effects on fitness induced by the downregulation of Dcr1 and Drosha may manifest beyond our experiment time period. However, this possibility appears unlikely, considering that the half-lives of Dicer and Drosha (of human) are both on the order of hours [e.g., covering the whole life span of WCR) may be needed to evaluate the effects on fitness caused by the knockdown of Dcr1 or Drosha.The lack of effects on fitness of WCR females that received osophila . It is iof hours , 70. At of hours . If WCR e.g., Aleochara curtula, a beetle) apparently lack Dcr1, but possess Dcr2 [Dcr1 and Dcr2 may be needed to completely impair the biogenesis of miRNAs. Finally, it is possible that our previous assumption may be incorrect and that Dcr1 and Drosha may be involved in pathways other than that participated by Ago1 in WCR. Therefore, knockdown of neither Dcr1 nor Drosha can phenocopy Ago1 knockdown.It is also possible that other proteins, such as Dcr2, may be involved in miRNA biogenesis in WCR. Dicer 2 has been shown to play a critical role in the dsRNA pathway in WCR and is postulated to be involved in the biogenesis of siRNA , 43. Howess Dcr2 . It is pAgo1, Ago2, Dcr1, Dcr2, and Drosha in WCR adults resulted in different fitness phenotypes. These results suggest that they likely play distinct physiological roles during the adult stage of this corn pest. Of the five genes examined in this study, only the knockdown of Ago1 resulted in adult mortality and reproductive defects, suggesting that this protein plays essential roles in multiple physiological pathways in WCR. The observations that Dcr1 and Drosha knockdowns in WCR did not phenocopy Ago1 knockdown raise the possibility that the roles these genes play may be different from those of Drosophila orthologs. Further studies are needed to reveal the pathways these genes are involved in and to investigate whether knockdown of these genes affect fitness in other life stages (e.g. larva).In summary, we showed that downregulation of S1 Table(DOCX)Click here for additional data file.S1 Fig(TXT)Click here for additional data file.S2 Fig(DOCX)Click here for additional data file.S3 Fig(DOCX)Click here for additional data file."}
+{"text": "Rana temporaria island populations inhabiting different types of pools in northern Sweden.Adaptive plasticity is essential for many species to cope with environmental heterogeneity. In particular, developmental plasticity allows organisms with complex life cycles to adaptively adjust the timing of ontogenetic switch points. Size at and time to metamorphosis are reliable fitness indicators in organisms with complex cycles. The physiological machinery of developmental plasticity commonly involves the activation of alternative neuroendocrine pathways, causing metabolic alterations. Nevertheless, we have still incomplete knowledge about how these mechanisms evolve under environments that select for differences in adaptive plasticity. In this study, we investigate the physiological mechanisms underlying divergent degrees of developmental plasticity across In a laboratory experiment we estimated developmental plasticity of amphibian larvae from six populations coming from three different island habitats: islands with only permanent pools, islands with only ephemeral pools, and islands with a mixture of both types of pools. We exposed larvae of each population to either constant water level or simulated pool drying, and estimated their physiological responses in terms of corticosterone levels, oxidative stress, and telomere length.We found that populations from islands with only temporary pools had a higher degree of developmental plasticity than those from the other two types of habitats. All populations increased their corticosterone levels to a similar extent when subjected to simulated pool drying, and therefore variation in secretion of this hormone does not explain the observed differences among populations. However, tadpoles from islands with temporary pools showed lower constitutive activities of catalase and glutathione reductase, and also showed overall shorter telomeres.The observed differences are indicative of physiological costs of increased developmental plasticity, suggesting that the potential for plasticity is constrained by its costs. Thus, high levels of responsiveness in the developmental rate of tadpoles have evolved in islands with pools at high but variable risk of desiccation. Moreover, the physiological alterations observed may have important consequences for both short-term odds of survival and long term effects on lifespan.The online version of this article (doi:10.1186/s12862-017-1004-1) contains supplementary material, which is available to authorized users. Developmental plasticity occurs when an environmental input induces a lasting alteration in an organism\u2019s phenotype. Developmental plasticity is generally a non-reversible process and can modulate acclimation capacity (reversible plasticity) in later developmental-stages . EvolutiEnvironmental heterogeneity affects the degree of adaptive developmental plasticity, as predicted by theory , 14 and Rana temporaria on the Swedish islands are a paradigmatic example of the relationship between environmental heterogeneity and degree of adaptive plasticity [R. temporaria populations. These studies have found signs of developmental canalization so that populations occupying islands with only ephemeral pools show overall faster developmental rates than populations from islands with permanent pools [Developmental plasticity is particularly critical for amphibians because they are typically species with low vagility and high philopatry to highly variable habitats . The majasticity . These pasticity  by frogsasticity . The islasticity . Over thnt pools  while alnt pools . Moreovent pools  accordinnt pools  found evnt pools . Faster nt pools . This isnt pools .R. temporaria populations exposed to divergent regimes of pool drying will show adaptive differences in developmental rate. These among-population differences in developmental plasticity would be explained by altered gene expression associated with adaptive changes in metabolic activity and rate of morphogenesis, which ultimately would involve divergent corticosterone and antioxidant levels.Developmental acceleration in amphibians is mediated by neuroendocrine pathways, especially by the hypothalamic pituitary adrenal axis (HPA) . The HPAHigh ROS production also results in DNA damage, of which telomere shortening is of great importance because of its association with life-history trade-offs and lifespan , 45. TelR. temporaria populations are associated with changes in corticosterone levels, oxidative stress, and telomere length. We expected highly plastic populations to increase their corticosterone levels to a greater extent in response to pond drying than less plastic populations. We also hypothesized that populations with high developmental plasticity may pay a cost of maintaining such plastic ability in terms of higher constitutive levels of corticosterone and oxidative stress, and likely shorter telomeres, compared with less plastic populations.Here we examine whether adaptive differences in developmental rate among Rana temporaria tadpoles from six islands located in the Gulf of Bothnia  in a 10\u00a0km section of the coastline. The size range of the islands is between 9 and 38\u00a0ha. Frogs breed in water filled pools created by rocky depression on these islands. The pools on the islands differ in their water permanence such that some have ephemeral pools, other permanent pools, and others have a mixture of permanent and ephemeral pools. There is no relationship between predator abundance and life history traits among pools on these islands [We studied the physiological consequences of adaptive divergence in developmental rate of  islands , and conOn 5 May 2014 we collected between 2 and 4 clutches from each of six islands. We separated the islands into three type of habitats according to their pool characteristics: two had only permanent pools , two only ephemeral pools  and two a mixture of permanent and ephemeral pools . Clutches were raised until Gosner stage 25  separateOne week after egg sampling tadpoles reached the free-feeding stage and started to swim actively (Gosner stage 25). At that time, 12 tadpoles per clutch (six tadpoles per treatment) for a total of 216 experimental units were individually transferred to 1\u00a0L containers filled with 750\u00a0mL of reconstituted soft water, where each tadpole was haphazardly assigned to an experimental treatment, i.e. constant water level or simulated pool drying. We renewed water every 4\u00a0days and tadpoles were fed ad libitum with lightly boiled spinach on each day of water change . ContainTadpoles at 42 Gosner were euthanized by immersion in a buffered solution of MS-222. A portion of muscle from the tadpoles\u2019 tail was removed with a surgical blade and preserved at \u221220\u00a0\u00b0C for telomere analyses. The rest of the tail was snap frozen in liquid nitrogen and preserved at \u221280\u00a0\u00b0C until corticosterone assays were conducted. The rest of the body was also snap frozen for oxidative stress assays.n\u00a0=\u00a08 assays in both cases). The intra-sample correlation coefficient was 0.97. Corticosterone concentration was calculated from the %B/B0 curve by using the 4PLC fitting routine and following the online tool from [Corticosterone content was determined in tails (50\u201360\u00a0mg) collected from tadpoles at 42 Gosner Stage. Tissue was homogenized with an Ultraturrax TP18/10  during 30\u00a0s and the hormone was extracted following an organic phase extraction with 1\u00a0mL ethyl acetate during 30\u00a0min at 4\u00a0\u00b0C and continuous shaking. Samples were then centrifuged at 5000\u00a0rpm during 15\u00a0min and a known volume of the supernatant was taken and evaporated in a speedVac. Dried elutes were re-suspended in a final volume of 120\u00a0\u03bcL of the assay buffer provided with the enzymoinmunoassay kit supplemented with ethanol  to aid the re-suspension of steroids. We assayed each sample in duplicate (50\u00a0\u03bcL per sample) for corticosterone determination through specific enzymoinmunoassays . The corticosterone antibody has low cross-reactivities to cortisol (0.38%), 11-desoxycorticosterone (12.3%), or progesterone (0.24%). The efficiency of the extraction was checked by spiking several aliquoted samples with 100\u00a0pg of exogenous corticosterone prior to extraction and comparing them to the non-spiked aliquotes. Recovery of exogenous corticosterone was never lower than 96%. The lowest point in the corticosterone standard curve was 2.29\u00a0pg/mL. To test for assay precision and variability, we determined the coefficient of variation (CV%) for intra- and inter-assay variation. Intra-assay variation was 8.74%. Inter-assay variation was 13.23% in the highest point of the standard curve and and 6.86% in the lowest point (ool from .t) and the ratio of oxidized to reduced glutathione (GSH/GSSG ratio). After evisceration, tadpoles were individually homogenized with a Miccra homogenizer (Miccra D-1) at 35,000\u00a0rpm in a buffered solution to inhibit proteolysis . We also quantified malondialdehyde (MDA) concentration, a product formed during lipid peroxidation, total glutathione . The ho:4; w:v; . The coe4) was used as an oxidizing agent that reacts with the catalase substrate hydrogen peroxide (H2O2) giving a red color that can be read at 480\u00a0nm 5\u00a0min after KMnO4 was added. We used commercial catalase  for standard curves preparation. The coefficient of variation between duplicated samples was on average 3.26%. The intra-sample correlation coefficient was 0.95. Glutathione peroxidase (GPX) activity was quantified following the protocol developed by [t) was determined following [n\u00a0=\u00a010 samples).Catalase (CAT) catalytic activity was indirectly quantified following . Accordiloped by . An exceloped by , and assloped by  by measuollowing . Homogent) value of each sample for each plate. Threshold is the basal level of fluorescence. Ct is defined as the number of cycles needed to detect a signal above the threshold. All samples were run in duplicate and relative telomere length was calculated following the formula [Genomic DNA for telomere measurements was isolated using a high-salt DNA extraction protocol on a portion of tail muscle. All determinations were made from muscle tissue to avoid confounding differences between tissues in telomere length , 70. Rel formula :\\documentelomere is the qPCR efficiency of telomere fragment; EGAPDH is the qPCR efficiency of the GAPDH fragment; \u0394Ct telomere is the Ct deviation of control \u2013 sample of the telomere (target gene) fragment; \u0394Ct GAPDH is the Ct deviation of control \u2013 sample of reference of GADPH (gene of reference) fragment. The coefficient of variation for duplicated samples was 0.65% on average for GAPDH assays and 1.36% for telomere assays. The intra-sample correlation coefficient was 0.90 and 0.86 for the telomere and GAPDH assays, respectively.where Ewater level (constant or simulated pool drying) and island habitat as fixed factors, and included clutch nested within island as random factors in the models. We used likelihood ratio tests to determine the significance of each predictor. Days to metamorphosis, corticosterone, GPX, GR, GSH, and telomere data were log-transformed to meet parametric assumptions. We estimated growth rate as log (body mass at 42 Gosner stage) \u2013 log (days to reach 42 Gosner stage). Intraclass correlation coefficients were calculated using \u201cICCest\u201d function .Statistical analyses were conducted in R, version 3.3.1 (R Development Core Team). We checked whether residuals followed normal distributions conducting Kolgomorov-Smirnov tests . We also tested for homoscedasticity using Barlett\u2019s tests with the function \u201cbartlett.test\u201d . We fitted linear and generalized mixed effect models using \u201clmer\u201d function for normal data and \u201cglmer\u201d for non-normal data . We used Survival was very high throughout the experiment (93.05%) and we found no significant differences between treatments, clutches, or island habitats.R. temporaria larvae  or in the interaction between island habitat and water level , but we did not find differences in length among island types  or in the interaction between island type and water level .Simulated pool-drying induced accelerated development in R. temporaria tadpoles, indicated by increased corticosterone levels by an average 25.48% . Levels of GSHt was unaltered by either island habitat or the island habitat by water level interaction . We found, however, a slight negative correlation between GSH/GSSG ratio and larval period .Relative telomere length and GSHRana temporaria populations in their ability to accelerate development in response to decreased water level in accordance with the predominant pool drying regimes. The studied populations have been estimated to experience a small degree of neutral genetic differentiation [Fst estimates could have been biased downwards due to high heterozygosity of the markers used [Rana temporaria populations. Selection for rapid larval development can result in canalized fast development and loss of plasticity [Reaction norms can evolve under selection in divergent environmental regimes if plasticity confers adaptive value to individuals developing alternative phenotypes, but also if costs of plasticity select for less plastic genotypes in less variable environments , 3, 17. ntiation , althougers used , 74 and ers used , 75. We asticity , 76. In asticity , and/or Rana populations showed lower constitutive levels of both CAT and GR enzymes than less plastic populations. CAT transforms hydrogen peroxide to water and oxygen whereas GR reduces glutathione disulfide to the sulfhydryl form of glutathione, both processes being essential in protecting cells from oxidative damage. Low enzymatic levels are associated with low production of ROS, but also with exhaustion of the enzymes as a result of oxidative stress via toxic substances or ROS production [The mechanisms underlying developmental acceleration in amphibians are well known, and rely on activation of the hypothalamic-pituitary-axis , 38. Thioduction \u201379. In aoduction  found anoduction , 80. Howoduction , 82.Rana populations from islands with only ephemeral pools suggest a high ROS production derived from intense metabolism, which is associated with the attrition of telomeres. Thus, based on our oxidative stress and telomere length determinations, we would expect accelerated development to bear the consequence of reduced lifespan and hence possibly reduced fitness. Among-population differences in telomere length have been associated to trans-generational effects of male age at reproduction due to a progressive elongation of telomeres in sperm with age [Telomere length varied among populations adapted to different pool-drying regimes by evolving different extents of developmental plasticity. This is a novel and intriguing finding and it may help to understand the implications of developmental plasticity to lifespan and fitness. Telomere shortening occurs after each cell replication so that telomeres usually shorten with age , 84. Howwith age \u201391. Analwith age . Parentawith age . In our Physiological differences among populations found in this study suggest that increased developmental plasticity may be associated with metabolic alterations that compromise the health and lifespan of individuals, as populations differed in antioxidant enzymes activity and length of terminal chromosomal regions. Reduced individual lifespan could have cascading demographic effects on population viability, although this remains to be explored.In sum, populations evolving in contrasting environments showed divergent levels of developmental plasticity and associated oxidative stress and telomere length variation, despite the slight neutral genetic differentiation previously described. These results emphasize the importance of including physiological measurements in the study of phenotypic plasticity, in order to be able to understand the underlying mechanisms of particular evolutionary and ecological processes.Additional file 1:Raw data obtained during the study and used in statistical analyses. (XLSX 114\u00a0kb)Additional file 2:Supplementary figures and corresponding legends. (PDF 501\u00a0kb)"}
+{"text": "Self-management is an important factor in maintaining and promoting mental health and recovery from mental health challenges. Thus, it is important to assess and support mental health self-management. In this study, we aimed to develop the Japanese version of the Mental Health Self-management Questionnaire (MHSQ-J), a scale to assess mental health self-management strategy, and clarify its psychometric properties among people with mental illness living in Japan.N\u2009=\u2009295), and 104 of the participants completed MHSQ-J again about two weeks later. Internal consistency was assessed with Cronbach\u2019s \u03b1, and test-retest reliability was confirmed by the intraclass correlation coefficient (ICC). Construct validity was assessed based on structural validity with confirmatory factor analysis (CFA) and exploratory factor analysis (EFA), and hypotheses testing. The Self-management Skill Scale, the University of Tokyo Health Sociology version of the Sense of Coherence Scale ver1.2, the Japanese version of Self-identified Stage of Recovery Part-B, the Japanese version of the Flourishing Scale, and the Japanese version of the WHO Disability Assessment Scale 2.0 were used for hypotheses testing.An anonymous self-administered survey including MHSQ-J was conducted for psychiatric outpatient users . EFA identified three factors , and the results suggested that the factor structure of the Japanese version of MHSQ was similar to the original 3-factor structure. Significant correlations were found with the hypotheses testing variables related to self-management and recovery, especially on the total score, the Empowerment subscale, and the Vitality subscale. Cronbach\u2019s \u03b1  and ICC  , Empowerment: .81, 95% CI , Vitality: .62, 95% CI , Total: .84, 95% CI ) indicated good reliability.The results show that MHSQ-J has acceptable reliability and validity to measure the use of self-management strategies for mental health among community living people with mental illness in Japan.The online version of this article (10.1186/s40359-019-0301-4) contains supplementary material, which is available to authorized users. Self-management is a subjective day-to-day approach including medical management, role management and emotional aspects of their condition, which is engaged to improve health conditions and maintain wellness . This seMental health guidelines and guidance have pointed out the importance of self-management to complement pharmacotherapy and psychotherapy in the treatment of mental illness \u20136. The rTo support the recovery of the people with mental health challenges, it is important to assess and support their self-management behavior as the outcome of their self-management. Behavior is all actions, not only those externally observable, but also inner actions like thoughts or recognitions. In the mental health area, most of the scales for measuring self-management are limited by the diagnosis or situation of use such as a psychiatric vocational rehabilitation service. Nowadays, much of the mental health welfare support services within a community are provided to users without the distinction of a diagnosis. Furthermore, a program style that doesn\u2019t require information regarding the diagnosis is not uncommon when the aim is to facilitate recovery. Thus, a trans-diagnostic scale that measures self-management behavior is needed to improve mental health support services in the community. The Patient Activation Measure 13 for Mental Health  measuresThe Mental Health Self-management Questionnaire (MHSQ)  was deveThe aim of this study is to develop a Japanese version of MHSQ (MHSQ-J) and to clarify its psychometric properties among people with mental illness living in Japan. To verify reliability and validity, internal consistency, test-retest reliability, structural validity, hypotheses testing and cross-cultural validity, these components are examined according to the COnsensus-based Standards for the selection of health Measurement Instruments (COSMIN) checklist , 17. We The study protocol was approved by the Ethical Committee of the Graduate School of Medicine/Faculty of Medicine, the University of Tokyo (11513). Aims, procedures, the voluntary nature of participation, anonymity, and privacy protection were explained using a Participant Information Sheet. In addition, participants were informed that refusal or suspension of participation would not cause any disadvantage. Participants gave their consent by responding to the questionnaire.This is a validation study for MHSQ-J, and its psychometric properties were validated according to the COSMIN checklist. An anonymous survey administered to people living in the community with mental illness was conducted from July to October in 2017. We recruited 295 outpatients from outpatient mental health clinic A (site A), B (site B), and the psychiatric mental health outpatient service C (site C) in a psychiatric hospital. All the facilities were in the Kanto region. Clinic A is in a commuter town, and clinic B is in an office building of a large city. Site C has over 600 beds, and is separate from an alcohol use disorder specialty outpatient facility.Inclusion criteria were: outpatients \u226520\u2009years old that understood Japanese. Outpatients who were regarded as having mental health instability by the professional staff working at the site were excluded. Mental health instability was considered in cases of the following: 1) Patients for whom answering this questionnaire would be an excessive burden and participation would be a hindrance to their treatment because of their symptoms or participation in a clinical trial; 2) the relationship with their doctor was not well established because it was a first doctor visit or had just started recently, or, being prone to problems from the past. At site A, as a first step, the doctor asked an eligible patient to participate in this study and to meet the researcher after the consultation. Subsequently, the researcher provided an explanation about this research to patients that agreed to meet us, and obtained consent for participation. At sites B and C, the researcher confirmed patient eligibility or the conditions which the specialists at the facility considered patients to be ineligible. The researcher asked patients about eligibility conditions  when necessary. If the patient was eligible, the researcher asked if they would agree to participate in this study. The researcher or facility staff explained the study to patients using a Participant Information Sheet.n\u2009=\u2009104).Test-retest reliability was tested among participants who agreed to receive the retest by mail   and the Engaging in desirable health behavior is a part of self-management behavior. Cognitive skills such as effective ways of thinking to achieve the behavior are related to health behavior . The Sel(2)Scales related to recoveryThe University of Tokyo Health Sociology version of the SOC scale (SOC-3-UTHS) ver.1.2 is a scale assessing Sense of Coherence (SOC). SOC is a concept that reflects the ability to cope with stress in Salutogenesis theory , 35. As Personal recovery, an important aspect of recovery from mental illness , was assThe Japanese version of the Flourishing Scale (FS-J) was used to measure psychological well-being as a state of increased personal recovery . FS-J isBecause self-management affects clinical recovery, such as through a reduction of symptoms or disability , the JapInformation regarding socio-demographic and clinical characteristics was collected, including age, sex, income, marital status, work status, educational background, cohabitants, diagnoses of psychiatric disorders, period from first visit to psychiatrist, an experience of hospitalization due to mental health problems, the use of mental health support services, frequency of visits with psychiatrists, and severities of depression and anxiety. The severities of depression and anxiety were assessed using the Japanese version of the Patient Health Questionnaire-9 (PHQ-9) \u201341 and tStatistical analysis was conducted for respondents who completely answered all items of MHSQ-J.Since there was no gold standard for assessing self-management strategy, validity was determined by assessing construct validity. Construct validity was confirmed by structural validity, cross-cultural validity, and hypotheses testing.According to the COSMIN checklist , confirmp\u2009<\u2009.05 were examined to confirm the suitability of the data for factor analysis. KMO was compared to adequacy of standards , Clinical: .75, 95% CI , Empowerment: .81, 95% CI , and Vitality: .62, 95% CI . Overall, the scores showed moderately good test-retest reliability. The ICC score of each item of the Vitality subscale were also examined. The scores were as follows, item 15: .32, 95% CI , item 16: .66, 95%CI , item 17: .58, 95% CI , and item 18: .65, 95% CI .This study aimed to develop and verify the reliability and validity of MHSQ-J. The results indicated adequate internal consistency, test-retest reliability, structural validity, and cross-cultural validity.Regarding structural validity, the result for the CFA using the original factorial structure showed almost acceptable factor loadings and a marginal goodness-of-fit index score. The result for the EFA was that the highest factor loadings of items 13 and 14 were for Vitality, although these items of the original MHSQ loaded in Empowerment. But it is reasonable to suppose that they belong to Empowerment as on the original scale, based on the size of the factor loadings. Therefore, it seems reasonable to consider the structure of MHSQ-J as similar to the original MHSQ among the participants in this study. The correlations between factors were moderate and positive between the Empowerment factor and the Vitality factor, but weak between the Clinical factor and the other two factors. This trend was similar to the original results , and the original author indicated that the Empowerment and the Vitality subscales of MHSQ might contain related sub-aspects which differ from the Clinical subscale [Concerning hypotheses testing, the scale related to self-management and recovery showed significant correlations with the total score, the Empowerment subscale, and the Vitality subscale of MHSQ-J in the hypothesized direction. On the other hand, the Clinical subscale showed no correlation with any scales used for hypotheses testing in this study. This seems consistent with the results for the Clinical subscales of the original MHSQ, which showed a significant correlation of smaller than .30 on the scales of symptoms and on the social participation scale . The oriIn this study, MHSQ-J showed good reliability in terms of reasonable Cronbach\u2019s \u03b1 coefficients and ICCs. The Cronbach\u2019s \u03b1 coefficients indicated excellent internal consistency in the total score, the Empowerment subscale, and the Validity subscale. The internal consistency of the Clinical subscale was acceptable, but relatively low. This result was consistent with the results for the original MHSQ  .The ICCs of the total score, the Clinical subscale, and the Empowerment subscale were satisfactory, and the ICC of the Vitality subscale was acceptable, but relatively low, especially for item 15.In addition, a ceiling effect on item 5 (the use of medicine), and a floor effect on items 4 and 18 , were seen in this study. Regarding the ceiling effect, most of the participants took medication frequently, because they were all outpatient users. Regarding the floor effect, the groups described in item 4 and the activity for relaxation described in item 18 are not familiar to all people in Japan with mental illness.This study has limited generalizability. Participants were limited to psychiatric outpatients. And the participants were also limited in terms of who could answer the questionnaire and their symptoms, such that cognitive function and concentration seemed to be high. We did not collect information about the diagnosis from the clinic. This was also a limitation of this study as we could not eliminate a participant that uses psychiatric or psychosomatic outpatient services without psychiatric illness.This is the first scale to measure the usage of mental health self-management strategies in Japan. In this study, the small difference between the original and the Japanese version of MHSQ in model fit and factor structure probably is based on cross-cultural differences and differences in the participants. Although we developed and analyzed this scale faithfully to the original scale, the results indicate the need to modify some items from a cross-cultural and trans-diagnostic point of view. The present study could not clarify the nature of each factor in MHSQ-J. To provide greater usefulness for MHSQ-J, and an understanding of self-management for mental health, further study is needed to more readily adapt services for people with mental illness living in the community in Japan, and to clarify which factors are more important at various points of treatment, or depending on symptoms.MHSQ-J is valid and it reliably measures the use of self-management strategies for mental health among people with mental illness living in a Japanese community.Additional file 1:Japanese version of Mental Health Self-management Questionnaire (MHSQ-J). (DOCX 33 kb)"}
+{"text": "The aim of this study was to analyze the binding interactions between a common antihypertensive drug (amlodipine besylate\u2014AML) and the widely distributed plant flavonoid quercetin (Q), in the presence of human serum albumin (HSA). Fluorescence analysis was implemented to investigate the effect of ligands on albumin intrinsic fluorescence and to define the binding and quenching properties. Further methods, such as circular dichroism and FT-IR, were used to obtain more details. The data show that both of these compounds bind to Sudlow\u2019s Site 1 on HSA and that there exists a competitive interaction between them. Q is able to displace AML from its binding site and the presence of AML makes it easier for Q to bind. AML binds with the lower affinity and if the binding site is already occupied by Q, it binds to the secondary binding site inside the same hydrophobic pocket of Sudlow\u2019s Site 1, with exactly the same affinity. Experimental data were complemented with molecular docking studies. The obtained results provide useful information about possible pharmacokinetic interactions upon simultaneous co-administration of the food/dietary supplement and the antihypertensive drug. Human serum albumin (HSA) is the most prevalent protein in human plasma, constituting ~60% of the total plasma protein content. Its structure and purpose have been studied in great detail and it offers a wide variety of applications in research as well as in clinical medicine .HSA and its ability to bind and transport a wide range of molecules  play a key role in drug distribution. The most well-known binding sites are Sudlow\u2019s Site 1 (located at subdomain IIA and containing a tryptophan residue) and Site 2 (located on subdomain IIIA) ,4.HSA in the presence of multiple ligands creates a complex system, where several molecules may or may not compete to bind to the same binding site. Since only the free fraction of the total amount of drug is responsible for the therapeutic effect, these competitive displacement interactions should be considered when administering multiple drugs .The novel aspect of pharmacokinetic interaction which has arisen in the recent years is the displacement of drugs from their binding sites by plant metabolites. Phenolic compounds like flavonoids or tannins naturally occur in all plant materials, whether their use is dietary (the daily intake of fresh fruit and vegetables) or medicinal . Several studies have explored these interactions between selected drugs and various plant polyphenols, such as warfarin with quercetin  and multS)-enantiomer binds to a higher extent than the (R)-enantiomer  and [(AML + HSA) + Q], respectively. The comparison of quenching curves in the binary and ternary systems provides general information concerning the change of affinity of one drug to serum albumin in the presence of another drug. In order to investigate if any displacement interaction was present, it was necessary to also observe the behavior of the firstly-added drug in ternary mixtures. 0 and F are the fluorescence intensities before and after a quencher addition, Kq is the Stern\u2013Volmer quenching constant, and [Q] is the quencher\u2019s concentration   as the variable reactant concentrations, [Ptotal]  as the fixed reactant concentration, and F/F0 as the experimentally observed value. The software creates a semilogarithmic plot of F/F0 vs [Lfree] (free ligand concentration) and determines the KD value by finding the halfway point in the sigmoid-shaped curve. Therefore we used a more simplistic approach by using the DynaFit software script. Data input consisted of [LD values for binary and ternary mixtures we can  using the following equation.From K\u03b8 = 1 mol/L. All \u0394G values for all systems were negative. Therefore, it can be inferred that the binding interaction of HSA with all systems is spontaneous and enthalpy driven. In which, R is the ideal gas constant, T the temperature, and the standard reference concentration cCircular dichroism spectroscopy is a valuable technique for detecting changes in the protein secondary and tertiary structure. In order to obtain an insight into the HSA structure, the far-UV (200\u2013260 nm) and the near-UV (250\u2013340 nm) CD spectra were recorded in the presence or absence of drugs in six molar ratios of ligands to protein (L/P)  for both binary and ternary systems. The far-UV CD spectrum of HSA showed two negative minima in the UV region at 208 nm and 222 nm, which is characteristic of the \u03b1-helical structure of the protein. The spectral profiles of the binary systems shown in 214. In the vice versa situation, preincubation with AML caused a small decrease of quercetin\u2019s Trp-range CD band and a small increase of Tyr-range CD band. The near-UV CD spectrum is a useful tool for observation of the protein tertiary structure. \u22121 (C=O stretching) and amide II band at 1540\u20131560 cm\u22121 (C\u2013N stretch coupled with N\u2013H bending mode), which are related to the protein secondary structure [The secondary structure of HSA and its dynamics can be effectively studied by Fourier transform infrared spectroscopy. All proteins, including HSA, possess the protein amide I band at 1650\u20131654 cmtructure . The cha214 for AML and Q, respectively. This supports our conclusions based on the CD spectra analysis. Subtle changes in the local environment of both ligands could be confirmed by deconvoluted band I analysis of all samples (spectra not shown), too. In short, three main bands  for free HSA are at 1651 cm\u22121 (random coil), 1660 cm\u22121 (\u03b1-helix), and 1667 cm\u22121 (\u03b2-turn); for the binary system Q + HSA we found bands at 1652 cm\u22121 (\u03b1-helix), 1648 cm\u22121 (random coil), and 1656 cm\u22121 (\u03b1-helix); for the binary system AML + HSA bands exist at 1660 cm\u22121 (\u03b1-helix), 1651 cm\u22121 (random coil), and 1667 cm\u22121 (\u03b2-turn); for the ternary system (Q + HSA) + AML we found bands at 1652 cm\u22121 (random coil), 1656 cm\u22121 (\u03b1-helix), and 1661 cm\u22121 (\u03b2-turn); and for the ternary system (AML + HSA) + Q we found bands at 1652 cm\u22121 (random coil), 1657 cm\u22121 (\u03b1-helix), and 1661 cm\u22121 (\u03b2-turn), respectively [That means binding AML or Q did not result in any major change in the secondary structure of HSA. However, amide II bands of most ligand + HSA samples are slightly downshifted. This suggests slightly different binding site near Trpectively . This co150, Glu153, Ser192, Lys195, Lys199, Trp214, Arg222, Leu238, His242, and Glu292. For Q, amino acids Tyr150, Ser192, Lys195, Lys199, Trp214, Arg222, Leu238, Leu260, and Ala291 define its placement on HSA. Both ligands (Q and AML) were separately docked and the same binding Site I was found. However, some difference in concrete position was discovered as shown by a superposition of best docking results a,b. The 199; the length of this hydrogen bond is 2.97 \u00c5 (222 (distance 3.46 \u00c5),- the carbonyl oxygen and the amino group of guanidine part of Arg199 (3.43 \u00c5), and- the hydroxyl group on the C-3 and the amino group of Lys192 (3.35 \u00c5)- the hydroxyl group on the C-4\u2032 and the hydroxyl group of SerDifferent positioning of both ligands in binding Site I is fixed by different hydrogen bonds: AML interacts through the oxygen (bearing an ethylamino group) with the amino group of Lyss 2.97 \u00c5 a. For Q,s 2.97 \u00c5 b betweenThese results support the interpretation of all our spectroscopic measurements.Our results demonstrate for the first time, to the best of our knowledge, the binding interactions between quercetin and amlodipine on human serum albumin. From the results shown above it can be concluded that both drugs bind to the same primary binding site localized inside the Sudlow\u2019s Site 1 on HSA and there exist a competitive interaction between them. Quercetin is binding with the higher affinity and is able to displace amlodipine from its binding site. Amlodipine binds with the lower affinity and if the binding site is already occupied by quercetin, it binds with the same affinity to the secondary binding site inside the same hydrophobic pocket of Sudlow\u2019s Site 1. The displacement of amlodipine by quercetin may elevate the concentration of the unbound amlodipine in the serum which might cause fluctuations in patient\u2019s blood pressure or elevated risk of adverse side effects. However, more studies, particularly in vivo monitoring of the free plasma levels of drugs, should be performed to evaluate the magnitude and severity of this interaction.These results help further the knowledge of binding interactions and are helpful for understanding the interactions between plant compounds and drugs. In concurrence with other studies mentioned in this work, the plant compound\u2013drug interactions are known to cause adverse side effects and therefore should be treated with similar caution as any other drug\u2013drug interaction.2HPO4 \u00d7 12 H2O and NaH2PO4 \u00d7 2 H2O . The HSA stock solutions were prepared by dissolving an appropriate amount in phosphate buffer. AML stock solutions were prepared by mixing an appropriate amount of the substance with phosphate buffer and then heating the mixture to approx. 60 \u00b0C until completely dissolved. Quercetin stock solutions were prepared by dissolving the substance in DMSO and then diluting in phosphate buffer to the required concentration. DMSO concentration in final mixtures did not exceed 1% (v/v). Milli-Q water was used for all the measurements.Human serum albumin , amlodipine besylate , quercetin , and dimethylsulfoxide  plant cell culture tested) were purchased from Sigma-Aldrich. Phosphate buffer  was prepared from NacorF and obsF are the corrected and observed fluorescence intensities, respectively. exA and emA are the absorbance values at excitation and emission wavelengths, respectively.Fluorescence spectra were measured in triplicates on a FluoroMax 4 spectrofluorimeter , equipped with a 1.0 cm path length quartz cell. The slit widths for the excitation and emission were 3.0 nm for all measurements. The temperatures used for the measurements were 298.15 K, 303.15 K, and 310.15 K, respectively. Samples were incubated for 2 min. Buffer background was subtracted from the raw spectra. Fluorescence intensities were corrected for the absorption of excitation light and reabsorption of emitted light to decrease the inner filter using the following relationship [D) and Gibbs free energy (\u0394G) for all studied systems. The 10 nm wide section around the fluorescence maximum was selected and the fluorescence intensity values were added up to minimize the influence of signal noise.Fluorescence spectral data after correction were used to calculate the dissociation constant  using a custom-written script.UV absorption spectra were performed on Infinite M200 Tecan  using Sarstedt TC Plate 96 Well, Standard, F. The temperature was 310.15 K. Plates were incubated for 2 min. Buffer background was subtracted from the raw spectra.The isothermal wavelength scan studies of HSA in the absence or the presence of Q and/or AML were carried out in triplicates using a Chirascan CD spectrophotometer equipped with a Peltier type temperature controller . The instrument was flushed with nitrogen with a flow rate of 5 L per minute, the path length was 1 mm, spectral bandwidth was set to 1 nm, the scan time per point to 5 s, and the temperature was set to 310.15 K. Buffer background was subtracted from the raw spectra.For the far-ultraviolet (far-UV) CD spectra (200\u2013260 nm) the HSA concentration was 1 \u03bcM. For the near-UV CD (250\u2013340 nm) spectra an HSA concentration of 15 \u03bcM was used. Six molar ratios of ligands to protein (L/P)  were investigated for both binary and ternary systems.MRE208 nm is the mean residue ellipticity value of the sample at the excitation wavelength of 208 nm, \u03b1-helixMRE is the standardized value for a protein with 100% content of \u03b1-helixes and is equal to 33,000, and \u03b2-sheetsMRE is the standardized value for a protein with 100% content of \u03b2-sheets and is equal to 4000.The far-UV spectral data were used to calculate the \u03b1-helix percentage using the following equation .\u03b1\u00a0helixThe near-UV spectral data were evaluated by an empiric method described by Zsila et al. ,32 The s\u00ae Ultra 0.5 mL using Hettich Universal 320 laboratory centrifuge. The filtrate was freeze-dried and used as a FT-IR sample.For this method, purified lyophilized crystallic samples were prepared. The concentrations of HSA and ligands for the FT-IR spectra analyses were 10 \u03bcM and 80 \u03bcM, respectively. The solutions were mixed and incubated for 15 min, then filtered through 30 kDa ultracentrifugation filters Amicon\u22121 and using 32 scans at 298 K. The number, position and width of component bands were estimated by performing a Fourier self-deconvolution to the protein infrared amide I band after subtraction of the free HSA spectrum from the sample ones using Omnic 9 software . The featureless original HSA spectrum between 2200 and 1800 cm\u22121 was the subtraction criterion.ATR-FT-IR spectra of all samples were recorded on a Nicolet 6700 FTIR spectrometer. All spectra were taken on a germanium crystal with a resolution of 4 cmhttp://bioinfo3d.cs.tau.ac.il/PatchDock/index.html) was used to dock . Best 10 docking solutions were evaluated for both ligands. Molecular graphics images were produced using the UCSF Chimera 1.13 package . Hydrogen bonds were calculated using this package using relax constraints of 0.4 \u00c5 and 20.0 degrees, respectively.Human serum albumin structure from the Protein Data Bank (PDB ID: 1E78A) was used for calculations. Quercetin and amlodipine structures were created in ChemSketch software  and converted from a *.mol file format to a *.pdb one by OpenBabel 2.3.2 and used without any optimization. To be in line with conditions in fluorescence and CD experiments (pH = 7.4) a corresponding protonized amlodipine molecule  was used for docking. A PatchDock web server ("}
+{"text": "Trace elements and potential toxic elements were analyzed in bovine livers submitted for autopsy in the Netherlands during the years 2007 to 2018. The age of each animal was recorded. In total, 1544 livers were analyzed for cadmium, cobalt, chromium, copper, iron, molybdenum, nickel, lead, selenium and zinc. Less than 2% of the liver samples were from veal calves. Young animals had significantly higher concentrations of iron and zinc in their livers compared to animals older than one year, while older animals had significantly higher levels of cadmium and molybdenum in their livers. Animals aged 1 to 2 years had the lowest copper and selenium levels. There was a tendency for lower chromium and nickel levels during the last years of the testing period, while copper showed an increase. Lead intoxication was only seen in the youngest group of cattle, while copper intoxication, defined as a liver copper of more than 1000 mg/kg dry matter, occurred in older animals, mainly in animals of 3 to 4 years old. This trend analysis of trace elements in bovine livers of cattle over time in recent years, and the relation of liver element concentrations with age of the animal, provides insight in the uptake and storage of these elements by cattle in The Netherlands. Possible reasons for observed trends and age-related patterns are discussed. Trace elements are essential for proper functioning of humans and animals, including cattle, and inadequate intake of these elements are deleterious to health and production potential . SeveralLiver is a major storage organ for trace elements and heavy metals, and element concentrations in the liver therefore reflect exposure levels . ElementIntake of minerals, and therefore storage of elements in liver tissue, can change over time because of changing feeding strategies and changes in the amounts and types of minerals used in feeding products. In addition, the uptake of elements from the environment (for example by ingestion of soil and grass) can change due to variation in weather, management practices and land use.The aim of this study was to investigate trends in liver concentrations of important trace elements and potentially toxic elements in bovine livers over time and age of the animal, that may be relevant to risks of deficiencies and toxicosis.A total of 1544 bovine livers from all regions of The Netherlands were examined post mortem during the years 2007\u20132018. Carcasses were sent to Animal Health Services by veterinarians to investigate the cause of death. During post mortem examination, about 500 gram of liver tissue was collected, homogenized and immediately frozen at \u221220\u00b0C. The livers were tested for cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), iron (Fe), molybdenum (Mo), nickel (Ni), lead (Pb), selenium (Se) and zinc (Zn). The age of each animal was registered, and the animals were classified into six age categories. The number of animals tested per age and per year is summarized in Element concentrations were determined with Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The method was briefly as follows: after thawing, at least 50 grams of liver was homogenized. Dry matter (dm) of the sample was determined by drying for 4 hours at 103\u00b0C. The dry matter content of the livers was, on average, 0.271 gram per gram (Standard error = 0.032 gram per gram). From each liver, a duplicate sample  was digested with 6 mL 65% nitric acid using a microwave oven  . After dissolving in 25 mL water and diluting with internal standards , the sample was analyzed with ICP-MS . The quantification was done after calibration with external standards . The duplicate results were averaged and corrected for dry matter content. All results were expressed in mg/kg dm. Results below the detection limit of the ICP-MS  were reported as 0.05 mg/kg dm.The toxicologically relevant levels of elements in bovine liver that were used for interpretation of results are listed in et al [Statistical analysis: Statistical analysis was done with Stata . Reference intervals were calculated using the \u2018non-parametric method\u2019 described by Geffre The median results for each age-group  can be seen in The results are shown in box-and-whisker-plots for each age group  in Cd  liver coCorrelations between the various elements are shown in Supporting information . There iThe data are also summarized based on years (2007\u20132018) .Chromium  decreaseAn analysis was made of fraction of livers containing a toxicologically relevant level of one or more elements by comparing two age groups: animals younger than one year and animals older than one year. The elements that were most often at concentrations associated with toxic effects were copper, zinc, iron and lead. The percentage of liver samples with copper, zinc and iron values above the toxicological threshold are shown in Toxicologically relevant copper levels in livers  were morThe increasing percentage of toxicologically relevant levels of copper was further analyzed. The group aged 2 years and older was split up into five sub-groups: 2\u20133 years, 4 years, 5 years, 6\u201310 years, and older than 10 years. The percentage of animals with liver copper concentrations above 600, 800 or 1000 mg/kg dm are shown in In this study, we evaluated the concentrations of different trace elements and heavy metals in the livers of cattle based on 6 age groups, and the time period from 2007\u20132018. Copper and selenium concentrations were correlated. Both elements are relatively low in local forage, and are typically supplemented by farmers and/or feed companies. Therefore, animals living outside on local forage and not supplemented with these trace elements are expected to be relatively low in both copper and selenium . Other pMost elements originate primarily from feed and not from drinking water. About 30% of the cattle in the Netherlands drink surface water. The surface water in the Netherlands is monitored . Elementet al [The transfer of selenium and copper from the mother to the fetus is well regulated \u201315. Calvet al  found thSelenium is mainly present in the selenium-containing enzyme glutathione peroxidase (GSH-Px) in red blood cells . SeleniuYoung animals have a greater need for iron and zinc compared to older animals , 20. ThiThe iron content of the liver drops immediately after birth due to a high demand for iron to replace fetal hemoglobin with normal hemoglobin . This maNickel is used as a catalyst for hydrogenation of fat  Click here for additional data file.S2 Table(DOCX)Click here for additional data file."}
+{"text": "The association of socioeconomic status with academic readiness and school achievement is well established. However, the specific contributions of cognitive and social aspects of self-regulation, and potential reciprocal relations between them in the prediction of school readiness and early school achievement have not previously been examined. This study examined mediational processes involving children's executive function (EF) skills at 58 months and Grade 1 (G1) and social competence in Kindergarten (K) and G1, as potential pathways by which early-life poverty-related risks influence Grade 2 (G2) math and reading achievement. Data came from the Family Life Project, which is a prospective longitudinal study of 1,292 children and families followed from birth in primarily low-income, non-urban counties in Pennsylvania (PA) and North Carolina (NC). Autoregressive cross-lagged mediation analyses indicated that EF at 58 months through EF at G1 mediated negative associations between cumulative risk exposure and academic skills, with this pathway mediating 36% of the total effect. Furthermore, social competence at K through EF at G1 mediated negative associations between early-life cumulative socioeconomic risk and academic skills, mediating 16% of the total effect. These findings provide evidence that poverty-related risks can influence school readiness and academic achievement via EF. Additionally, these results provide preliminary support for the premise that social competence through EF is a pathway by which cumulative poverty-related risk predicts early academic competence. Our findings are consistent with studies demonstrating developmental associations between EF and social competence. Furthermore, our findings are consistent with prekindergarten programs for children in poverty that emphasize both cognitive and social aspects of self-regulation. Decades of research have converged on the finding that growing up in poverty can negatively impact a child's academic abilities and achievement throughout the lifespan  and numeracy skills (counting)  and three low-income counties in Central Pennsylvania (PA). These regions were carefully chosen to be representative of the Black South (NC) and Appalachia (PA). Low-income families were oversampled in both NC and PA, and African American families were oversampled in NC. Complex sampling procedures were used for recruitment, and the authors refer the reader to previously published materials for full details regarding the study design and sampling plan  and Grade 1 (G1) school visits, via teacher completed questionnaires. Research assistants also visited children at their school in G2 and administered early academic achievement measures, including the Woodcock-Johnson III Tests of Achievement. Timepoints, measures, and age statistics for child EF, social competence, and academic outcome assessments are summarized in Table This study was reviewed and approved by the Institutional Review Board at Pennsylvania State University and the Office of Human Research Ethics at the University of North Carolina. Written informed consent was obtained from all adult participants and from the parents/legal guardians of all non-adult participants, in accordance with the Declaration of Helsinki. All participation was voluntary, with participants being informed prior to the study that they could remove their consent at any time.State of residence  was used as a covariate in all analyses to control for site differences in variables. Additional demographic covariates were included in all analyses. Specifically, covariates were primary caregiver's report of child sex  and child race  during the 2\u2013months home visit, and age of the infant at the K data collection point.All analyses also included levels of sensitive parenting as a covariate, to control for an indicator of positive social interactions with the primary caregiver during a free-play task. Parenting style was assessed during interactions between the primary caregiver and their infant during a 10 min semi-structured, free-play task during the 6-, 15-, 24-, and 36\u2013months home visits. Caregivers were given instructions to play with their infant using a standardized set of toys. Highly trained coders scored mother-infant interactions from video recordings. Videos were coded for levels of caregivers' sensitivity, intrusiveness, detachment, stimulation, positive regard, and negative regard  coding system   for these scales . Items were rated on a scale from \u201calmost never\u201d (one point) to \u201calmost always\u201d (six points) with higher ratings indicating higher social competence. This scale shows acceptable internal consistency (\u03b1 = 0.93). Finally, teachers completed the Peer Relationships Scale, comprised of six Likert-type items rated from \u201calmost never\u201d (zero points) to \u201calmost always\u201d (five points) . Negatively framed items  were reverse-scored to create a positively framed indicator of peer relationships.During the K and G1 school visits, teachers completed the SDQ, a 25\u2013item questionnaire for use with children aged 3-16 years old. Items were rated on a 3 point scale as not true (zero), somewhat true (one point), or certainly true (two points). The SDQ has five subscales , however the current study used only the Prosocial Behavior subscale. The Prosocial subscale measures the amount of prosocial characteristics displayed by a child , with higher scores representing higher levels of prosocial behaviors. A comprehensive review has been previously published, indicating that the teacher-completed SDQ has satisfactory internal consistency (\u03b1 = 0.70), as well as test-retest reliability  in reverse order . Children were allowed instructional and practice trials, which could be repeated up to three times, if needed. For the task, the list of words to be repeated increased with every successful trial over the course of six trials. The task concluded when the child made three consecutive errors, with their score being recorded as the highest number of words correctly recalled.For the Dimensional Change Card Sort task, children were asked to sort cards by two features, shape or color. In the first segment of the task, children were told to sort cards by either shape or color. In the second segment, children were told to sort cards by the other feature. In the third and final segments, trials were mixed such that children were told to sort 50 cards according to an audio cue played at the beginning of each trial identifying the feature by which they should sort. The percentage of correct responses during these mixed trials was used for the current study's purposes.Academic Outcomes was modeled as a latent variable of skills related to reading and math, which were evaluated during the G2 school visits via the Woodcock-Johnson III Tests of Achievement. The Woodcock-Johnson III Tests of Achievement is a norm-referenced battery of subtests used to measure scholastic aptitude, spoken language, and academic achievement  estimation was used to reduce bias in estimates related to missing data  , and EF at 36 months as covariates. Additionally, observed variables of family income-to-needs ratio, household density, neighborhood safety, maternal education, consistent partnership of a spouse or partner, maximum work hours of primary or secondary caregiver per week, and job prestige were used to compute a poverty-related Cumulative Risk index.Prior to addressing our primary research question, we evaluated our measurement model that included the following latent variables: Social Competence at K, Social Competence at G1, EF at 58 months and G1, and Academic Outcomes at G2. This measurement model fit the data well: CFI = 0.99; RMSEA = 0.030 ; SRMR = 0.027. Factor loadings of observed indicators on latent variables are reported in Table SE = 0.046, p < 0.001). Cumulative Risk also negatively predicted EF at 58 months  and G1 . Finally, Cumulative Risk negatively predicted Social Competence at K  and G1 .Before testing mediation, we also evaluated independent, direct associations with early-life Cumulative Risk predicting Social Competence in K and G1, EF at 58 months and G1, and academic outcomes in G2. As expected, Cumulative Risk negatively predicted Academic Outcomes ; SRMR = 0.041 Figure . All coeOur primary hypothesis was that EF (58 months) through Social Competence (G1), and Social Competence (K) through EF (G1) would demonstrate cross-lagged mediation of the relationship between early-life cumulative poverty-related risk exposure and academic abilities in Grade 2 (G2). To evaluate this hypothesis, we tested the indirect effects of Cumulative Risk (6\u201336 months) on Academic Outcomes at G2. Specifically, we tested indirect effects via serial pathways involving Social Competence (K and G1) and EF (58 months & G1). We also tested indirect paths between Cumulative Risk and Academic Outcomes through Social Competence and EF separately.Table This study aimed to extend existing literature regarding potential developmental processes by which growing up in poverty can influence school readiness and academic achievement. Environmental influences on the development of EF and social competence, and the importance of EF and social competence for school readiness are emerging areas of research. However, no prior studies have sought to bridge these areas of research by exploring autoregressive cross-lagged mediational pathways involving social competence and EF development as it relates to cumulative poverty-related risk and academic outcomes.through challenges in EF at G1. Importantly, our conservatively specified model allows for strong inference that social competence is meaningfully related to academic outcomes through EF at G1. Furthermore, our model demonstrated significant longitudinal mediation of the effect of cumulative risk on academic outcomes via EF at 58 months through EF at G1. However, our hypothesis was not fully supported, as the reciprocal pathway by which EF at K through social competence at G1 mediates the relationship between cumulative risk and academic outcomes was merely approaching significance.Here we tested the primary hypothesis that the development of EF and social competence reciprocally influence each other, such that EF through social competence (and vice versa) demonstrate cross-lagged mediation of poverty-related risk exposure and early academic abilities. Our findings provided partial support for this hypothesis, by revealing that social competence at K through EF at G1 significantly mediates the effect of poverty-related cumulative risk exposure on G2 academic outcomes. More specifically, challenges in social competence at K associated with poverty-related risks negatively impacted academic abilities related to math and literacy skills These results converge with a growing literature indicating the importance of EF development for promoting early academic competence Blair, . FurtherThus, our causal theory of relations between social competence and EF is based in prior empirical and theoretical work demonstrating that successful prosocial interactions require many tasks that rely on EFs, such as mentalizing another's ever-changing beliefs, expectations, and emotions, as well as maintaining focus, problem-solving and inhibitory control of inappropriate behaviors  is functionally involved in emerging EF abilities, with structural variations mediating the relationship between early-life stress and EF skills . Such design provides stronger evidence for causal order than cross-sectional designs. However, the current findings should be interpreted with the following limitations in mind. While exploring autoregressive cross-lagged mediation serves as an important first step for understanding potential complex processes and mechanisms underlying the relationship between cumulative risk and academic abilities, our analysis is based on correlative data. Human studies are fundamentally limited in the extent that they can establish causal mechanisms by which poverty-related adversity influences development (Perry et al., A major strength of this study was the use of a longitudinal prospective design, which allowed for a clearer definition of the relationship between cumulative poverty-related risk and the development of academic abilities in a large sample size (In conclusion, we have provided the first evidence regarding potential autoregressive cross-lagged mediational pathways by which social competence and EF skills may disrupt academic achievement in a high-risk low-income sample. Importantly, we have demonstrated this in real-world contexts and longitudinally across a substantial, ecologically important time in young children's lives. In sum, longitudinal alterations in EF abilities across the early academic years may be one pathway by which poverty-related stressors influence academic abilities. Additionally, altered social competence may further disrupt EF development across formative years of elementary school for at-risk children from low-income families. Such findings suggest that social and EF development may be intrinsically linked, and should always be considered together, which provide important implications. From a preventative perspective, our findings support early screening, and an expansion of early-life screening tools, for both prosocial and EF skills to identify at-risk individuals and foster early academic achievement. Importantly, both EF skills and social skills are malleable and rapidly developing in preschool years, making them feasible targets for preventative interventions to reduce socioecomonic inequality in academic achievement (Howes et al., This study was carried out in accordance with the recommendations of the Institutional Review Board at Pennsylvania State University and the Office of Human Research Ethics at the University of North Carolina with written informed consent from all subjects. All subjects gave written informed consent in accordance with the Declaration of Helsinki.RP, SB, and CB contributed to the conception and design of the study. RP performed statistical analyses and wrote the first draft of the manuscript. SB organized the database, performed statistical analyses, and wrote sections of the manuscript. All authors contributed to manuscript revision and read and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Peritoneal fibrosis is a severe complication arising from long-term peritoneal dialysis (PD). Tamoxifen (Tamo) has been clinically proven effective in a series of fibrotic diseases, such as PD-associated encapsulating peritoneal sclerosis (EPS), but the mechanisms underlying Tamoxifen\u2019s protective effects are yet to be defined. In the present study, C57BL/6 mice received intraperitoneal injections of either saline, 4.25% high glucose (HG) PD fluid (PDF) or PDF plus Tamoxifen each day for 30 days. Tamoxifen attenuated thickening of the peritoneum, and reversed PDF-induced peritoneal expression of E-cadherin, Vimentin, matrix metalloproteinase 9 (MMP9), Snail, and \u03b2-catenin. Mouse peritoneal mesothelial cells (mPMCs) were cultured in 4.25% glucose or 4.25% glucose plus Tamoxifen for 48 h. Tamoxifen inhibited epithelial-to-mesenchymal transition (EMT) as well as phosphorylation of glycogen synthase kinase-3\u03b2 (GSK-3\u03b2), nuclear \u03b2-catenin, and Snail induced by exposure to HG. TWS119 reversed the effects of Tamoxifen on \u03b2-catenin and Snail expression. In conclusion, Tamoxifen significantly attenuated EMT during peritoneal epithelial fibrosis, in part by inhibiting GSK-3\u03b2/\u03b2-catenin activation. Peritoneal dialysis (PD) is a cost-effective renal replacement therapy for end-stage renal disease (ESRD) . HoweverTamoxifen is a selective estrogen receptor modulator initially used for the treatment of breast cancer . It alsoThe experimental protocol was approved by the Ethics Committee for the Use of Experimental Animals in Zhejiang University (No. 2016-279) and was carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 80-23). Eight-week-old male C57BL/6 mice (weight: 23 \u00b1 2 g) were obtained from the Experimental Animal Center of Zhejiang Academy of Medical Sciences . Animals had free access to water and standard rodent chow and were maintained under a 12-h light/dark cycle .The 4.25% HG PDF was purchased from Baxter . Tamoxifen (Tamo) and TWS119 (TWS) were purchased from Selleckchem . Antibodies against \u03b2-catenin (8480), p-\u03b2-catenin (8814), GSK-3\u03b2 (12456), p-GSK-3\u03b2 (9323), E-cadherin (14472), and \u03b2-tubulin (15115) were purchased from Cell Signaling Technology . Antibodies against Vimentin (ab8978) and Snail (ab167609) were purchased from Abcam . Antibodies against fibronectin (15613), matrix metalloproteinase 9  and vascular endothelial growth factor  for immunoblotting were purchased from Proteintech . Antibodies against fibronectin (GB13091), MMP9 (GB13132), and cluster of differentiation 31  for histological staining were purchased from Servicebio .Fifteen male C57BL/6 mice were randomly divided into three groups. Control mice received a daily intraperitoneal injection of saline . Mice in the PDF and PDF + Tamo groups received equal volumes of PDF without or with Tamo (5 mg/kg/day), respectively. Peritoneal catheters were not implanted because they increased peritoneal fibrosis independent of PDF administration . Followi2 at 37\u00b0C. Subsequently, mPMCs were incubated in serum-free medium for 12 h and then cultured with normal glucose (NG) or 4.25% d-glucose (HG) with or without Tamo (10 nM) for 48 h, followed by evaluation of E-cadherin, Vimentin, and GSK-3\u03b2 expression. mPMCs were incubated for 12 h with NG, HG, or HG+Tamo in the absence or presence of TWS (1 \u03bcM) to inhibit GSK-3\u03b2 activity, followed by evaluation of \u03b2-catenin, p-\u03b2-catenin, and Snail expression [mPMCs were collected from non-anesthetized male C57BL/6 mice by needle aspiration for 5 min following intraperitoneal injection of 2 ml trypsin-EDTA . Freshly aspirated mPMCs were grown in DMEM/F12 with 10% FBS (Thermo Fisher) in 5% COPeritoneal tissue was fixed in formaldehyde, dehydrated in ethanol, clarified in xylene, embedded in paraffin, and sliced into 4-\u03bcm thick sections as described previously. The degree of peritoneal fibrosis was evaluated by Masson\u2019s trichrome staining as described previously . PhotomiParaffin sections were blocked with 5% normal goat serum at room temperature for 1 h, incubated with primary antibodies against Vimentin, fibronectin, or MMP9 at 4\u00b0C overnight, washed in 1\u00d7 PBS and incubated with the appropriate secondary antibody at room temperature for 30 min. Sections  were visualized and captured using light microscopy (Leica).Frozen sections and mPMCs were fixed with 4% paraformaldehyde for 10 min at room temperature. After washing, the samples were blocked with 5% normal goat serum for 1 h and then incubated with primary antibodies against Vimentin, CD31, GSK-3\u03b2, Snail, or \u03b2-catenin overnight at 4\u00b0C. Subsequently, the appropriate fluorescently labeled secondary antibodies were added and incubated for 30 min at room temperature. Nuclei were stained with Hoechst . Images  were captured using a Leica fluorescence microscope.Mouse tissues and mPMCs were homogenized in RIPA lysis buffer with protease and phosphatase inhibitors (CST). Proteins were separated by 10% SDS/PAGE and electrotransferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk and probed with primary antibodies against E-cadherin, Vimentin, MMP9, fibronectin, GSK-3\u03b2, p-GSK-3\u03b2, \u03b2-catenin, p-\u03b2-catenin, Snail, and \u03b2-tubulin (loading control), followed by appropriate labeled secondary antibodies. ECL reagent used for p-\u03b2-catenin was CST SignalFire\u2122 Plus ECL Reagent (12630), for all other proteins CST SignalFire\u2122 ECL Reagent (6883) was used. The membranes were scanned and band intensities were evaluated using Gel Doc XR (Bio-Rad).P<0.05 was considered statistically significant.All experiments were repeated three times and presented as mean \u00b1 S.D. Standard ANOVA with Bonferroni\u2019s post-test was used (GraphPad Prism 6.0). In peritoneal tissue of PDF treated mice, levels of Vimentin, fibronectin, and MMP9 were increased while E-cadherin was reduced  and\u00a02. Iin vivo PDF treatment and in vitro HG exposure induced similar effects upon levels of \u03b2-catenin and Vimentin compared with E-cadherin.Protein expression of total \u03b2-catenin was increased in PDF treated peritoneal tissue and HG exposed mPMCs, while the level of inactive p-\u03b2-catenin was decreased  and\u00a04. TAn obvious thickening of peritoneal interstitium with collagen accumulation was observed following repeated injections of HG PDF, as indicated by Masson\u2019s trichrome staining, and the degree of thickening was significantly lessened as a result of Tamoxifen treatment A. Co-trein vivo observations, significantly increased Vimentin and decreased E-cadherin was observed in HG-treated mPMCs, and this change was attenuated by treatment with Tamoxifen , casein kinase 1a (CK1a), and GSK-3\u03b2. GSK-3\u03b2 phosphorylation inhibits ubiquitylation activity of the destruction complex, resulting in accumulation of cytosolic \u03b2-catenin followed by migration into the nucleus ,27,28. Nand LEF1 ,30, promand LEF1  as well and LEF1 ,19. MMP9and LEF1 . Snail iand LEF1 . Cytoplaand LEF1 . Inhibitand LEF1 . We prevTamoxifen is used to treat a variety of fibrosis disorders . MultiplIn conclusion, Tamoxifen significantly attenuated HG dialysate-induced peritoneal fibrosis via inhibition of EMT progression in peritoneum, at least in part through inhibition of GSK-3\u03b2/\u03b2-catenin axis activation."}
+{"text": "Target-specific anticancer drugs are under rapid development. Little is known, however, about the risk of administering target-specific drugs to patients who have tumours with molecular alterations or other characteristics that can make the drug ineffective or even harmful. An increasing number of randomised clinical trials (RCTs) investigating target-specific anticancer drugs include subgroup analyses based on tumour characteristics. Such subgroup analyses have the potential to be more credible and influential than subgroup analyses based on traditional factors such as sex or tumour stage. In addition, they may more frequently lead to qualitative subgroup effects, that is, show benefit in one but harm in another subgroup of patients . If so, subgroup analyses based on tumour characteristics would be highly relevant for patient safety. The aim of this study is to systematically assess the frequency and characteristics of subgroup analyses based on tumour characteristics, the frequency of qualitative subgroup effects, their credibility, and the interpretations that investigators and guidelines developers report.We will perform a systematic survey of 433 RCTs testing the effect of target-specific anticancer drugs. Teams of methodologically trained investigators and oncologists will identify eligible studies, extract relevant data and assess the credibility of putative subgroup effects using a recently developed formal instrument. We will systematically assess how trial investigators interpret apparent subgroup effects based on tumour characteristics and the extent to which they influence subsequent practice guidelines. Our results will provide empirical data characterising an increasingly used type of subgroup analysis in cancer trials and its potential impact on precision medicine to predict benefit or harm.Formal ethical approval is not required for this study. We will disseminate the findings in a peer-reviewed and open-access journal publication. We will use rigorous methodology including a systematic search for oncology trials published in leading journals, duplicate data extraction by a team involving both experienced methodologists and oncologists, transparent documentation including the collection of verbatim quotes, and use of a formal instrument for assessing the credibility of claimed subgroup effects.The systematic survey will specifically address subgroup claims based on tumour characteristics, which become increasingly relevant for decision making in an era of precision medicine.Potential limitations include a small number of eligible subgroup claims based on tumour characteristics, suboptimal reporting of identified subgroup claims and lack of subgroup analysis plans.The increasing understanding of the biology of malignancies and the availability of new biotechnologies has led to a rapid development of anticancer drugs directed at molecular targets. The hope associated with a target-specific (or biomarker-driven) therapy is to maximise anticancer effects and minimise side effects. Prominent examples include BRAF inhibitors for melanoma,3Target-specific anticancer drugs are designed to directly inhibit tumour growth or enhance immunological antitumour response, by influencing a known\u2014or at least partly understood\u2014molecular mechanism. Typically, the targeted mechanism is complex and spans several steps starting with an interaction of the drug with the target molecule, followed by a signalling cascade, leading to endpoints relevant for tumour growth such as proliferation or apoptosis. Alterations of the molecules involved in this mechanism have the potential to modify the effect of the drug.Anticancer treatments typically have side effectsand are judged acceptable under the assumption that the benefits will outweigh the side effects. Molecular alterations of the tumor could affect this net benefit and render the drug useless or even harmful for certain patients.Investigators of randomised clinical trials (RCTs) increasingly use subgroup analyses to explore effect modifications by tumour characteristics. Those include subgroup analyses based on specific molecular alterations , and also more unspecific tumour characteristics such as measures of mutation burden , tumour grade, or histological subtype. A recent survey of cancer trials showed that 103 of 221 47%) oncology trials published between 2011 and 2013 reported subgroup analyses based on biomarkers.7% oncoloFor instance, an RCT in patients with colorectal cancer addressed the impact of panitumumab, a monoclonal EGFR antibody.Another RCT addressed afatinib, which also targets the EGFR pathway , in patiThese two examples suggest that target-specific agents may be highly beneficial in one but potentially harmful in another subgroup of patients. The authors of the two trials may have underemphasised the potential risk of giving target-specific drugs to the inferior subgroup. Rather than acknowledging the potential for serious harm, they concluded a \u2018lack of response\u2019In contrast, findings suggested by subgroup analyses have generally low credibility. The majority of claimed subgroup effects are not confirmed in subsequent researchSome have suggested that subgroup analyses based on tumour characteristics, compared with traditional subgroup analyses , might lead to more credible findings:6No empirical study is available that addresses subgroup effects based on tumour characteristics in target-specific anticancer therapy. Therefore, we will perform a systematic survey of RCTs to determine if the presented examples are isolated instances or a generalisable phenomenon.Specific study objectives areTo assess, in RCTs investigating target-specific anticancer drugs, the frequency ofsubgroup analyses based on tumour characteristics.claims about subgroup effects based on tumour characteristics made by trial investigators.qualitative subgroup effects based on tumour characteristics, that is, suggesting benefit in one and harm in another subgroup.To assess the credibility of claimed subgroup effects based on tumour characteristics.To assess, for claimed subgroup effects, how trial investigators or guideline developers interpreted the results  and how these interpretations relate to the credibility assessment .We will include publications of parallel-group RCTs that (1) enrol patients with a malignant disease; and (2) include a comparison to investigate the effect of a target-specific anticancer drug. We will use an inclusive definition of \u2018target-specific anticancer drug\u2019 and consider any drug with a defined mode of pharmacodynamic action, for example, tyrosine kinase inhibitors targeting specific proteins resulting from mutations, all monoclonal antibodies targeting specific proteins or antihormonal drugs Based on a sensitive search strategy that we developed together with a medical information specialist, we searched PubMed for eligible RCTs published since 2014 in the nine oncology and four general medical journals with the highest impact factor in the year 2016. We used free text and medical subject headings for terms related to cancer and combined them with journal indexations and a validated filter for RCTs10.1136/bmjopen-2019-034565.supp1Supplementary dataOur search identified 1119 potentially relevant abstracts of which we already acquired and screened the full texts. Of those, 433 proved eligible RCTs testing a target-specific anticancer therapy and reporting one or more subgroup analysis. Based on previous research,We will develop and standardise extraction forms with detailed explanations for each data point. Teams of two methodologically trained investigators will extract data from publications and associated protocols and resolve disagreements by discussion.We will extract the following information for each trial: population; interventions; primary outcome(s), the overall treatment effect including CIs; whether the trial reported any subgroup analyses  in the main paper, appendices or in secondary publications; number of effect modifiers  type of effect modifiers (categorised by oncologists into (1) tumour characteristics of interest defined as genetic alterations, grade, subtype, or other molecular or histological characteristics; (2) tumour characteristics not of interest such as staging, location, size, or other macroscopic or radiological characteristics; or (3) other effect modifiers such as age or sex), subgroup hypotheses , methods used for subgroup analyses , numerical results of subgroup analyses , and whether authors make no, a weak, a moderate or a strong claim of effect modification.et al.To assess the strength of reported subgroup claims, we will use predefined criteria developed by Sun To assess the credibility of claimed effect modification (based on tumour characteristics), we will apply a recently developed instrument for assessing the credibility of effect modification analyses (ICEMAN).Was the direction of the effect modification correctly hypothesised a priori?Was the effect modification supported by prior evidence?Does a test for interaction suggest that chance is an unlikely explanation of the apparent effect modification?Did the authors test only a small number of effect modifiers or consider the number in their statistical analysis?If the effect modifier is a continuous variable, were arbitrary cut-points avoided?The instrument provides four predefined responses for each question and an overall credibility rating on a continuous scale ranging from very low to high credibility. Teams of two methodologically trained investigators will independently apply ICEMAN to claimed subgroup effects based on tumour characteristics and resolve disagreements by discussion. Items 1, 2, 4 and potentially 5 require a study protocol for optimal assessment. Therefore, for each study reporting a claim, we will search for corresponding study protocols by screening references and trial registry entries.We will use descriptive statistics  to present trial characteristics, including the number and type of subgroup analyses reported per trial, number and strength of claims made, and whether a subgroup claim is qualitative. A qualitative subgroup claim means that (a) authors claim a subgroup difference plus (b) the point estimates suggest benefit in one harm in another subgroup. For all individual subgroup claims, we will present the type of effect modifier (tumour characteristics vs other), the numerical results, the credibility rating and the interpretations presented by primary study authors and/or guidelines. We will also create forest plots showing, for all claimed subgroup effects, point estimates and associated CIs within subgroups, differentiating MA-based and other subgroup effects. We will clearly indicate if a trial reports more than one subgroup claim.A key criterion for the credibility assessment is the result of an interaction test . We know from previous empirical studies that most trials reporting subgroup effects do not include the results of a test of interaction.Patients and/or the public were not involved in the design, or conduct, or reporting, or dissemination plans of this research.This study will provide insights into the effectiveness and safety of target-specific anticancer drugs\u2014in particular, in patients subgroups with potentially relevant tumour characteristics. Our study will clarify as yet unresolved issues of whether subgroup analyses based on tumour characteristics performed as part of RCT reports deliver useful results and whether trial investigators and guideline developers draw appropriate conclusions.Several previous studies have systematically assessed the credibility of subgroup effects,34 35We do not anticipate any serious feasibility problems. In previous empirical studies, investigators have successfully used similar methods, including systematic surveys of subgroup analyses in cancer trials,A limitation of quantitative results such as the frequency of subgroup claims based on tumour characteristics in cancer trials will be a high risk of reporting and publication bias. We will therefore make clear that our results will reflect what is reported and not necessarily how often authors consider those analyses. This potential limitation, however, will not weaken inferences made for individual RCTs. Another potential limitation is that, although we know from previous research that subgroup analyses based on biomarkers are included in almost half of oncology trials,In summary, this systematic survey of RCTs will address characteristics, frequency, credibility and impact of effect modification analysis based on tumour characteristics. If our findings support the alarming hypothesis that the risk of harm caused by target-based drugs might be systematically underemphasised, then our results will help to increase the awareness of the issue among patients, oncologists, trial investigators, journal editors, and guideline developers. The results may trigger a re-evaluation of existing trials, inform planning of future trials and influence how trial investigators and guideline developers interpret MA-based subgroup analyses in the context of target-specific anticancer therapy.Formal ethical approval is not required for this study that will be based on published information only. We will disseminate the findings in a peer-reviewed and open-access journal publication."}
+{"text": "It allows for a single identifier to convey the order and orientation of genome-level structure and we have successfully applied this typing to 433 of the most common bacterial species. In a focused analysis, we observed the presence of multiple structural genotypes in nine bacterial pathogens, underscoring the importance of routinely assessing this form of variation alongside traditional single-nucleotide polymorphism (SNP) typing.Rearrangements of large genome fragments occur in bacteria between repeat sequences and can impact on growth and gene expression. Homologous recombination resulting in inversion between indirect repeats and excision/translocation between direct repeats enables these structural changes. One form of rearrangement occurs around ribosomal operons, found in multiple copies across many bacteria, but identification of these rearrangements by sequencing requires reads of several thousand bases to span the ribosomal operons. With long-read sequencing aiding the routine generation of complete bacterial assemblies, we have developed  Subsets of these data were analysed in this manuscript and accession numbers are given in Table S2, available with the online version of this article.All data bundled with The authors confirm that all supporting data, code and protocols have been provided within the article or through supplementary data files.socru to universally type the order and orientation of bacterial genomes around these operons. The evidence presented here, that variation at the genome level was found in all nine of the pathogens we analysed in detail, provides strong impetus for genome structure to be routinely assessed alongside traditional measures of variation.Variation at the single-nucleotide level is a cornerstone of studies into bacterial evolution, but technologies such as long-read sequencing are now enabling us, at scale, to expand the scope to other forms of variation, such as whole-genome structure. We focused here upon inversions and translocations around repeat ribosomal operons because these operons are conserved across bacteria. We developed software called Enterobacter, Salmonella, Staphylococcus, Pseudomonas and Listeria .For all complete RefSeq genomes in a species, each unique pattern was given a unique genome structure (GS) identifier. This facilitates comparison of the overall structural variation in a population. A database for each species contains a tab delimited table of these patterns. The genome structure identifier takes the form GSX.Y (e.g. GS1.6), where X uniquely denotes the order of the fragments and Y denotes the orientation of the fragments . For circular genomes, the number of valid orders and orientations is determined by the number of genome fragments, which is explained in detail below. For socru, the ribosomal repeat sequences must be oriented in the forward direction from the origin of replication towards the terminus !]/2. As an example, Pseudomonas aeruginosa has four genome fragments, corresponding to three genome orders , where 0 indicates the same direction and 1 indicates reverse direction relative to the baseline. For example, socru with a new query genome, readouts from these checks provide an indication of the validity of the structure and hence also aid in spotting misassemblies , and where the reference sequence contained three or more rRNA operons. The databases are openly available on Github.com, which allows for community curation and enhancements.socru utilizes a database (prebundled or user provided) to identify the structural genotype. First the location of the rRNA genes is identified with Barrnap. Using blastn, the sequence similarity is calculated between the user provided assembly and the reference genome fragments. The blast results are filtered , and the match with the highest bit score is used to identify the fragment number and the orientation. The order and orientation of the fragments are looked up in the bundled database of GS numbers. Novel orders are given a GS number of 0, which the researcher can evaluate for biologically probability. The output consists of the input file name, the GS identifier, a red/amber/green quality indication of structure validity and genome structure pattern. Red denotes invalid structure, while amber indicates that the structure is valid but requires user confirmation of a novel genome order. Users are encouraged to add novel, valid structural assignments to the relevant socru species database. Green denotes assignment of a structural genotype matching one already present in the species database. The software requires less than 250\u2009MB of RAM to run and takes about 20\u2009s to process a single 5 Mbase assembly on a standard laptop. socru is available under the open source GNU GPL 3 licence from https://github.com/quadram-institute-bioscience/socru. The software is written in Python 3, validated using unit tests and packaged for Conda, Galaxy, Docker and Pip for easy installation.Given a FASTA file of a complete bacterial assembly, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, P. aeruginosa, and Enterobacter spp.) as well as Escherichia coli, Salmonella enterica and Listeria monocytogenes. Structural genotypes defining the order and orientation of genome fragments around ribosomal operons were assigned with socru based upon the comparison of each assembly to a species-specific baseline (Table S2) and the Methods section).We assessed structural variation in all available complete genomes for the ESKAPE pathogens  of all P. aeruginosa genomes harboured fragment 1 in the inverted orientation, designated GS1.1  displaying GS1.0. Conversely, in Enterobacter spp., E. faecium and A. baumannii, a lower frequency of GS1.0 was observed (63\u201372\u200a%). As the first complete sequenced reference genome for each species was used as the baseline for our structural genotyping, the low GS1.0 frequencies demonstrate empirically that \u2018first\u2019 genomes, though often an important laboratory strain or of clinical importance, are not always representative of the structure of the species as a whole.Where GS1.0 was the dominant structural genotype, its frequency varied appreciably between species . socru t species , with 98S. aureus, it has been noted that isolates may contain five or six ribosomal operons, with five copies being postulated as an adaptation to antibiotic pressure in a hospital environment [n=138, Table S2) one that is approximately 300\u2009bp away from the next operon, with no obvious genetic features in between. However, six-copy genomes are numerous in RefSeq , suggesting that there is some selective pressure to maintain a sixth copy.In ironment . Our datS. enterica harboured the greatest number of structural genotypes, we looked more closely at how these were distributed across the 726 available genomes. It was striking to note that a single serovar (S. Typhi) was responsible for over half of the observed structures, i.e. more than the rest of the species combined. Structural variation in S. Typhi, the causal agent of typhoid fever, has been associated with persistence in the human host [S. aureus [Since  aureus . Persist aureus , both ofn=1295) found that 6.76\u200a% (n=88) were biologically invalid and likely the result of misassemblies. As such, socru can also be used to identify large-scale misassemblies and therefore provide a useful quality control step in high-throughput bacterial assembly pipelines.In addition to the biological significance of structural variation, our study also highlights an important issue regarding the quality of some complete genome assemblies. Valid structures were assigned based upon certain rules governing operon direction and fragment inversion, excision and translocation  . Cases where fragments were missing or repeated, or operon directions violated the origin to terminus of replication order, were deemed possible misassemblies. An analysis of all the ESKAPE genomes (socru that have a) at least 3 ribsosomal operons and b) have at least 3 RefSeq genomes for a given species. https://www.ncbi.nlm.nih.gov/refseq/ accessed 2019-01-26. Accession numbers for 3042 complete RefSeq genomes of ESKAPE pathogens, E. coli, L. monocytogenes and S. enterica from https://www.ncbi.nlm.nih.gov/refseq/ are given in Table S2.Complete RefSeq genomes for bacterial species are bundled with Click here for additional data file.Click here for additional data file."}
+{"text": "In the published article, there was an error in the affiliation of Jing Li. Instead of \u201cDepartment of Leisure and Sports Management, Cheng Shiu University, Kaohsiung, Taiwan,\u201d it should be \u201cDong Fureng Economic and Social Development School, Wuhan University, Wuhan, China.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Attachment of ubiquitin (Ub) to proteins is one of the most abundant and versatile of all posttranslational modifications and affects outcomes in essentially all physiological processes. RING E3 ligases target E2\u00a0Ub-conjugating enzymes to the substrate, resulting in its ubiquitination. However, the mechanism by which a ubiquitin chain is formed on the substrate remains elusive. Here we demonstrate how substrate binding can induce a specific RING topology that enables self-ubiquitination. By analyzing a catalytically trapped structure showing the initiation of TRIM21 RING-anchored ubiquitin chain elongation, and in combination with a kinetic study, we illuminate the chemical mechanism of ubiquitin conjugation. Moreover, biochemical and cellular experiments show that the topology found in the structure can be induced by substrate binding. Our results provide insights into ubiquitin chain formation on a structural, biochemical and cellular level with broad implications for targeted protein degradation. The mechanism by which RING E3-anchored ubiquitin chains are formed is not well understood. Here, the authors solve a crystal structure of the RING E3 enzyme TRIM21 trapped in the process of self-anchored chain elongation and provide biochemical and cellular insights into the mechanism of ubiquitin conjugation. Furthermore, such modifications can be combined resulting in highly specific signals that trigger dedicated processes. These modifications are achieved by a three-enzyme cascade. Ubiquitin is first activated by an E1 enzyme and charged onto the active site cysteine of an E2 Ub-conjugating enzyme. Then the E2~Ub and a third enzyme, an E3 ligase, ubiquitinate the substrate. Structural insights into the process of substrate ubiquitination are limited to the transfer of one ubiquitin2 or ubiquitin-like protein4. How specificity is achieved within the ubiquitination system remains largely elusive due to its extremely high level of complexity.Ubiquitin conjugation modifies cellular proteins with a highly versatile label and is used in virtually all physiological pathways. The huge variety of possible ubiquitination patterns includes modification with single ubiquitin molecules and/or up to eight different ubiquitin chain types1. The only E2 enzyme dedicated to K63-ubiquitination is Ube2N (Ubc13), which forms a heterodimer with either Ube2V2 (Mms2) or Ube2V1 (Uev1)7. Ube2V2 binds and orients the acceptor ubiquitin, thereby generating specificity for K63 linkage10. While Ube2N/Ube2V2 efficiently forms free K63-linked ubiquitin chains, substrate modification requires the presence of a priming ubiquitin for elongation11. Such a mechanism has been established for the RING  E3s TRIM21 and TRIM5\u03b113. With ~100 members in humans, the TRIM family contains the largest number of distinct RING E3s14. TRIM21 detects antibody-coated viruses by specifically recognizing the bound antibody. This activates its E3 ligase function, resulting in virus neutralization and innate immune activation via the NF-\u03baB pathway16. First, Ube2W attaches a priming ubiquitin to the TRIM21 N-terminus13. Next, TRIM21 specifically recruits Ube2N/Ube2V2 to produce a TRIM21-anchored K63-linked ubiquitin chain17. TRIM21 does not engage its target directly and forms the ubiquitin chain on its own N-terminus, resulting in degradation of itself, the antibody, and the substrate15. This mechanism can be repurposed by introduction of substrate-specific antibodies to the cytosol, resulting in targeted protein degradation by Trim-Away18. This is conceptually similar to proteolysis targeting chimeras (PROTACs), that bring substrate and E3 ligase together, resulting in substrate ubiquitination and degradation19.Ubiquitin chains that are linked via lysine 63 (K63) are involved in endocytosis, DNA damage, and the immune response10 and how Ube2N is specifically recruited by RING E3s17, it was not known how substrate-anchored ubiquitin chains are formed. Yet, anchored ubiquitin chains deliver highly specialized functions and phenotypes. We address this question by solving a structure trapped in the process of RING-anchored chain elongation. Together with a kinetic analysis, this reveals how chemical activation of the acceptor ubiquitin is achieved. It also reveals a specific topology of the RING domains that is necessary for formation of the self-anchored ubiquitin chain. Finally, we validate the importance of this arrangement biochemically and show that it results in targeted protein degradation in a physiological setting.In this work, we sought to understand how RING E3-anchored ubiquitin chains are formed. Although it is known how Ube2N/Ube2V2 specifically connects two ubiquitin molecules with a K63 linkage20. Therefore, we attempted to address substrate-bound ubiquitination with TRIM21 RING and its chain forming E2 heterodimer Ube2N/Ube2V2. In crystallization trials, we used N-terminally mono-ubiquitinated TRIM21 RING domain (UbG75/76A-TRIM211\u201385 or Ub-R), an isopeptide-linked, non-hydrolyzable ubiquitin-charged Ube2N conjugate (Ube2N~Ub) and Ube2V2. We solved the atomic structure of this complex at 2.2\u2009\u00c5 resolution, with one copy each of Ub-R, Ube2N~Ub and Ube2V2 in the asymmetric unit . Analyzing further interactions within the crystal lattice, we found that the TRIM21-linked ubiquitin made additional contacts to Ube2N/Ube2V2 of a symmetry-related complex , the TRIM RING itself is the substrate, after it has undergone N-terminal mono-ubiquitination upon interaction with the E2 enzyme Ube2Wtry Fig.\u00a0. The RINlex Fig.\u00a0. Our str\u03b6H3 group 4.8\u2009\u00c5 from the electrophilic carbonyl of the donor ubiquitin C-terminus  of this reaction should solely depend on the protonation state of its nucleophile, K63. Fitting the ubiquitination velocity of reactions carried out at different pHs to an equation assuming one titratable group revealed a pKa of 8.3 for Ube2N . We mutated D119 to either alanine or asparagine as neither can act as a base, but asparagine could still bind and orient K63. Both mutants increased the pKa to ~9 2.Interactions between ubiquitin and other proteins have been shown to depend on specific conformations of ubiquitin\u2019s \u03b224. Comparison with our previously determined TRIM21 R:Ube2N~Ub structure17 shows scarcely any difference between the donor ubiquitin C-termini and the Ube2N active site , which binds and orients the acceptor ubiquitin10. We gained additional insight into how Ube2V2 positions the acceptor ubiquitin by analyzing a Ube2N~Ub:Ube2V2 complex that we solved at 2.5\u2009\u00c5 resolution .Next, we sought to understand how RING-anchored ubiquitin chains are formed. In our crystal structure, one RING dimer is positioned so as to mediate the elongation of another mono-ubiquitinated RING in ns Figs.\u00a0 and 3a. ns Figs.\u00a0. The relns Figs.\u00a0. In our 30  domainsity Fig.\u00a0. Indeed,ity Fig.\u00a0. Importaity Fig.\u00a0. Since sity Fig.\u00a0. Thus, icis ubiquitination to become sterically possible. Using our Ub-R:Ube2N~Ub:Ube2V2 structure, we created models with increasing numbers of K63-linked ubiquitin chains conjugated to the TRIM21 RING domain. These models suggested that a chain of four ubiquitin molecules would be necessary and sufficient for self-ubiquitination in cis  has emerged as a promising new approach for targeted degradation of disease-causing proteins in patients41. Despite recent advances in the field, it remains unclear how RING E3 ligases achieve specific substrate ubiquitination and how a ubiquitin chain is formed after the priming ubiquitin has been transferred.Protein ubiquitination is one of the most abundant posttranslational modifications, affecting essentially all cellular events. A precise understanding of its underlying mechanisms, and how they achieve selectivity, is desirable for several reasons. First, malfunction in the ubiquitin system often manifests in severe diseaseHere, we provide a structural framework for understanding RING E3-anchored ubiquitin chain formation. We were able to capture a snapshot of this process in a crystal structure of Ub-R with the ubiquitin-charged heterodimeric E2 enzyme Ube2N~Ub/Ube2V2 Fig.\u00a0, showingtrans mechanism, where a RING dimer activates a Ube2N~Ub molecule, thereby acting as an E3 ligase. An additional mono-ubiquitinated RING acts as a substrate for ubiquitination and accepts the donor ubiquitin  ligase HOIP is regulated by its partner RBR HOIL, which mono-ubiquitinates all three LUBAC components HOIP, HOIL, and SHARPIN. These ubiquitin primers are then elongated in cis by HOIP, thereby outcompeting trans ubiquitination of substrates42. Thus, switching between cis and trans mechanisms of ubiquitination may be a regulatory system exploited by many different types of E3 ligases.Our data establishes that the RING-anchored K63-chain is first formed in a cis Fig.\u00a0. While u13. Loss of this K63-linked ubiquitin chain prevents virus neutralization, immune signaling, and Trim-Away17. Our GFP-Fc degradation experiment shows that only the TRIM21 construct (R-R-PS) that can form the catalytic RING topology under these conditions enables degradation , RIPLET55, and others, we propose that the mechanism presented here is thus likely to be found more widely within the realm of RING E3 ligases.The catalytic RING topology we describe is consistent with data showing that TRIM proteins can undergo higher-order assembly. In the case of TRIM5\u03b1d48 Fig.\u00a0. This poher Fig.\u00a0. To fulfher Fig.\u00a0. Since h4/3/2-TRIM21 constructs, a linear Ub3 sequence was codon optimized, ordered as synthetic DNA  and inserted into the UbG75/76A-TRIM21 construct. All constructs for mRNA production were cloned into pGEMHE vectors56. Constructs were cloned by Gibson Assembly and mutations were inserted by mutagenesis PCR. For mCherry-TRIM21\u2206RING-Box, TRIM21382\u20131428 was amplified by PCR and cut by EcoRI and NotI. A 743\u2009bp fragment carrying mCherry was cut by AgeI and EcoRI from V60  and both fragments were ligated into pGEMHE. Primers, a complete list of all plasmids used in this study, and the primary structure of all purified proteins and mRNA that was expressed in cells are given in Supplementary Data\u00a0Bacterial expression constructs: Ube2V2 and TRIM21 expression constructs, but full-length were cloned into pOP-TG vectors and full-length TRIM21 constructs into HLTV vectors. Ube2N constructs were cloned into pOP-TS, Ube1 into pET21, and ubiquitin into pET17b. Ube2D1 was cloned into pET28a. For cloning UbEscherichia coli BL21 DE3 cells. Ubiquitin and Ube1 were expressed in E. coli Rosetta 2 DE3 cells. All cells were grown in 2\u00d7TY media supplemented with 2\u2009mM MgSO4, 0.5% glucose and 100\u2009\u00b5g\u2009mL\u22121 ampicillin (and 35\u2009\u00b5g\u2009mL\u22121 chloramphenicol for expression is Rosetta 2 cells). Cells were induced at an OD600 of 0.7. For TRIM proteins, induction was performed with 0.5\u2009mM IPTG and 10\u2009\u00b5M ZnCl2, for ubiquitin and Ube1 with 0.2\u2009mM IPTG and for E2 enzymes with 0.5\u2009mM IPTG. After centrifugation, cells were resuspended in 50\u2009mM Tris pH 8.0, 150\u2009mM NaCl, 10\u2009\u00b5M ZnCl2, 1\u2009mM DTT, 20% Bugbuster (Novagen), and cOmplete protease inhibitors . Lysis was performed by sonication. TRIM proteins and Ube2V2 were expressed with N-terminal GST-tag and purified via glutathione sepharose resin  equilibrated in 50\u2009mM Tris pH 8.0, 150\u2009mM NaCl, and 1\u2009mM DTT. The tag was cleaved on beads overnight at 4\u2009\u00b0C. In case of ubiquitin-TRIM21 constructs, the eluate was supplemented with 10\u2009mM imidazole and run over 0.25\u2009mL of Ni-NTA beads to remove His-tagged TEV. Ube2N and Ube1 were expressed with an N-terminal His-tag and were purified via Ni-NTA resin. Proteins were eluted in 50\u2009mM Tris pH 8.0, 150\u2009mM NaCl, 1\u2009mM DTT, and 300\u2009mM imidazole. For Ube2N, TEV-cleavage of the His-tag was performed overnight by dialyzing the sample against 50\u2009mM Tris pH 8.0, 150\u2009mM NaCl, 1\u2009mM DTT, and 20\u2009mM imidazole. Afterward, His-tagged TEV protease was removed by Ni-NTA resin. The cleavage left an N-terminal tripeptide scar (GSH) on recombinantly expressed TRIM proteins, an N-terminal G scar on Ube2N and an N-terminal GSQEF scar on Ube2V2. Finally, size-exclusion chromatography was carried out on a HiLoad 26/60 Superdex 75 prep grade column  in 20\u2009mM Tris pH 8.0, 150\u2009mM NaCl, and 1\u2009mM DTT.Ubiquitin-TRIM21, TRIM21 RING (residues 1\u201385), Ube2N, and Ube2V2 constructs were expressed in E. coli BL21 DE3 cells. Cells in 2\u00d7TY were grown to an OD600 of 0.8 and induced with 0.5\u2009mM IPTG and 10\u2009\u00b5M ZnCl2. Cells were further incubated at 18\u2009\u00b0C, 220\u2009r.p.m. overnight. After centrifugation, cells were resuspended in 100\u2009mM Tris pH 8.0, 250\u2009mM NaCl, 10\u2009\u00b5M ZnCl2, 1\u2009mM DTT, 20% Bugbuster (Novagen), 20\u2009mM imidazole, and cOmplete protease inhibitors . Lysis was performed by sonication. His-affinity purification was performed as described above. Immediately afterward, the protein was applied to an S200 26/60 column  to remove soluble aggregates. After concentration determination, the His-Lipyol tag was cleaved using TEV protease overnight. Since full-length TRIM21 is unstable without tag, the protein was not further purified but used for assays.Full-length TRIM21 (Ub-R-B-CC-PS or Ub-R-R-B-CC-PS) were expressed as His-Lipoyl-fusion proteins in 57. After cell lysis by sonication  and 0.1\u2009mg\u2009mL\u22121 DNAse ), a total concentration of 0.5% percloric adic was added to the stirring lysate at 4\u2009\u00b0C. The (milky) lysate was incubated for another 30\u2009min on a stirrer at 4\u2009\u00b0C to complete precipitation. Next, the lysate was centrifuged  for 30\u2009min at 4\u2009\u00b0C. The supernatant was dialyzed overnight (3500 MWCO) against 3\u2009L 50\u2009mM sodium acetate (NaOAc) pH 4.5. Afterward, Ub was purified via cation exchange chromatography using a 20\u2009mL SP column  and using a NaCl gradient (0\u20131000\u2009mM NaCl in 50\u2009mM NaOAc pH 4.5). Finally, size-exclusion chromatography was carried out on a HiLoad 26/60 Superdex 75 prep grade column  in 20\u2009mM Tris pH 7.4.Ubiquitin purification was performed following the protocol established by the Pickart labAll proteins were flash frozen in small aliquots (30\u2013100\u2009\u00b5L) and stored at \u221280\u2009\u00b0C.C87K/K92A charging with WT ubiquitin was performed as normal E1-mediated charging, but in a high pH to ensure K87 deprotonation17. The isopeptide charging reaction was carried out in 50\u2009mM Tris pH 10.0, 150\u2009mM NaCl, 5\u2009mM MgCl2, 0.5\u2009mM TCEP, 3\u2009mM ATP, 0.8\u2009\u00b5M Ube1, 100\u2009\u00b5M Ube2N, and 130\u2009\u00b5M ubiquitin at 37\u2009\u00b0C for 4\u2009h. After conjugation, Ube2NC87K/K92A~Ub was purified by size-exclusion chromatography  that was equilibrated in 20\u2009mM Tris pH 8.0 and 150\u2009mM NaCl.Ube2N\u22121 of human UbG75/76A-TRIM211\u201385, Ube2NC87K/K92A~Ub, and Ube2V2 in 20\u2009mM Tris pH 8.0, 150\u2009mM NaCl, and 1\u2009mM DTT were subjected to sparse matric screening in sitting drops at 17\u2009\u00b0C (500\u2009nL protein was mixed with 500\u2009nL reservoir solution). Crystals were obtained in Morpheus II screen58 in 0.1\u2009M MOPSO/bis-tris pH 6.5, 12.5% (w/v) PEG 4\u2009K, 20% (v/v) 1,2,6-hexanetriol, and 0.03\u2009M of each Li, Na, and K.In total, 5\u2009mg\u2009mLC87K/K92A~Ub:Ube2V2 structure, 10\u2009mg\u2009mL\u22121 TRIM211\u201385, Ube2NC87K/K92A~Ub, Ube2V2, and Ub in 20\u2009mM Tris pH 8.0, 150\u2009mM NaCl, and 1\u2009mM DTT were subjected to sparse matrix screening in sitting drops at 17\u2009\u00b0C (200\u2009nL protein was mixed with 200\u2009nL reservoir solution). Crystals were obtained in the Morpheus III screen59 in 0.1\u2009M bicine/Trizma base pH 8.5, 12.5% (w/v) PEG 1000, 12.5% (w/v) PEG 3350, 12.5% (v/v) MPD, and 0.2% (w/v) of each anesthetic alkaloids . Crystals were flash frozen for data collection without the use of additional cryo-protectant.For the Ube2NG75/76A-TRIM21:1\u201385Ube2NC87K/K92A~Ub:Ube2V2, diffraction images were processed using XDS60 to 2.2\u2009\u00c5 resolution. The crystals belong to space group number 5 (C2) with each of the components present as a single copy in the asymmetric unit. Analysis of the raw data revealed moderate anisotropy in the data. The structure was solved by molecular replacement using PHASER-MR implemented in the Phenix suite61. Search models served TRIM21 RING and Ube2N from 6S53 (ref. 17), ubiquitin from 1UBQ62 and Ube2V2 from 1J74 (ref. 7). Model building and real-space refinement was carried out in coot63, and refinement was performed using phenix-refine64. The anisotropy in the data could be observed in parts of the map that were less well resolved. While all interfaces show clear high-resolution density, particularly parts of Ube2V2 (chain A) that were next to a solvent channel proved challenging to build. The structure is deposited in the Protein Data Bank under the accession code 7BBD.Data were collected at the Diamond Light Source beamline i03, equipped with an Eiger2 XE 16\u2009M detecter of a wavelength of 0.9762\u2009\u00c5. For UbC87K/K92A~Ub:Ube2V2, diffraction images were processed using XDS60 to 2.54\u2009\u00c5 resolution. The crystals belong to space group number 145 (P32) with each component present three times in the asymmetric unit, related by translational non-crystallographic symmetry. The structure was solved by PHASER-MR implemented in the Phenix suite61. Search models used were Ube2N from 6S53 (ref. 17), ubiquitin from 1UBQ62, and Ube2V2 from 1J74 (ref. 7). Model building and real-space refinement was carried out in coot63, and refinement was performed using phenix-refine64. The structure is deposited in the Protein Data Bank under the accession code 7BBF.For Ube2N2, and 0.5\u2009mM DTT. The reaction components were 2\u2009mM ATP, 0.25\u2009\u00b5M Ube1, 80\u2009\u00b5M ubiquitin, 0.5\u2009\u00b5M Ube2N/Ube2V2, or Ube2D1 together with the indicated concentration of E3. Samples were taken at the time points indicated and the reaction was stopped by addition of LDS sample buffer at 4\u2009\u00b0C. The samples were boiled at 90\u2009\u00b0C for 2\u2009min and resolved by LDS\u2013PAGE. Ubiquitin chains were detected in the western blot using an anti-Ub-HRP , TRIM21 by rabbit anti-TRIM21PRYSPRY D101D ST#9204 (1:1000), and Fc by goat anti-human IgG-Fc broad 5211\u20138004 (1:2000).Ubiquitin chain formation assays were performed in 50\u2009mM Tris pH 7.4, 150\u2009mM NaCl, 2.5\u2009mM MgClKa analysis. The experiment was performed in a pulse-chase format, where the first reaction generated Ube2N~His-Ub and was chased by Ub1\u201374. Under these conditions, Ub1\u201374 only acts as acceptor, as it cannot be charged onto the E1 enzyme. His-tagged ubiquitin on the other hand serves as donor. Although, theoretically His-Ub could also act as an acceptor, the high concentrations of Ub1\u201374 outcompete His-Ub as an acceptor. Initially, we determined the linear range of the reaction for all different constructs, so as to later measure only one point on this trajectory as a representative for the initial velocity (v0). For Michaelis\u2013Menten kinetics, we used the following length: WT, 3\u2009min; D119A, 100\u2009min; D119N, 30\u2009min; N123A, 3\u2009min; D124A. 3\u2009min, and for pKa measurements the following: WT, 40\u2009s; D119A, 5\u2009min; D119N, 60\u2009s; N123A, 40\u2009s; D124A, 40\u2009s.Kinetic measurements of di-ubiquitin formation were measured for Michaelis\u2013Menten and p2, 3\u2009mM ATP, 60\u2009\u00b5M His-ubiquitin, 1\u2009\u00b5M GST-Ube1 (Boston Biochem), and 40\u2009\u00b5M Ube2N. The reaction was incubated at 37\u2009\u00b0C for 12\u2009min and stored afterward at 4\u2009\u00b0C until use (within 1\u2009h).First, Ube2N charging was performed in 50\u2009mM Tris pH 7.0, 150\u2009mM NaCl, 20\u2009mM MgCl1\u201374 (0\u2013400\u2009\u00b5M), while for pKa determination in 50\u2009mM Tris and the indicated pH (7.0\u201310.5), 50\u2009mM NaCl, and 250\u2009mM Ub1\u201374. Apart from the buffer, the reaction mix contained 2.5\u2009\u00b5M Ube2V2. The reaction was initiated by addition of charging mix that was diluted 1 in 20, resulting in 2\u2009\u00b5M Ube2N in the reaction. The reaction was stopped by addition of 4\u00d7 LDS loading buffer. The samples were boiled at 90\u2009\u00b0C for 2\u2009min and resolved by LDS\u2013PAGE. Western blot was performed with anti-His antibody  via the LiCor system, leading to detection of the following species: His-Ub, His-Ub-Ub1\u201374, Ube2N~His-Ub, Ube2N~(His-Ub)2 (a side product of the charging reaction that shows ubiquitination rates similar to Ube2N~His-Ub), and E1-His-Ub. The concentration of His-Ub-Ub1\u201374 was determined by dividing the value for His-Ub-Ub1\u201374 by the sum of all bands detected and multiplying this by the total concentration of His-Ub in the reaction (3\u2009\u00b5M). Experiments were performed in technical triplicates. Michaelis\u2013Menten kinetics data were fit to Eq. , and S the substrate concentration. The curve was fit to determine kcat and KM. To determine the pKa, the data was fit to Eq.  mRNA was synthesized with T7 polymerase, using the HiScribe\u2122 T7 ARCA mRNA Kit (New England Biolabs) according to the manufacturer\u2019s instructions.For in vitro transcription of mRNA, constructs were cloned into pGEMHE vectors66 were cultured in DMEM medium  supplemented with 10% calf serum and penicillin\u2013streptomycin. RPE-1 cells (ATCC) were cultured in DMEM/F-12 medium  supplemented with 10% calf serum and penicillin\u2013streptomycin.NIH3T3-Caveolin-1-EGFP2 humidified atmosphere and regularly checked to be mycoplasma free. The sex of NIH3T3 cells is male. The sex of RPE-1 cells is female. Following electroporation, cells were grown in medium supplemented with 10% calf serum without antibiotics. For live imaging with the IncuCyte (Sartorius), cell culture medium was replaced with Fluorobrite  supplemented with 10% calf serum and GlutaMAX .All cells were grown at 37\u2009\u00b0C in a 5% CORPE-1 TRIM21 knockout cells were generated using the Alt-R CRISPR-Cas9 system from Integrated DNA technologies (IDT) with a custom-designed crRNA sequence (ATGCTCACAGGCTCCACGAA). Guide RNA in the form of crRNA-tracrRNA duplex was assembled with recombinant Cas9 protein (IDT #1081060) and electroporated into RPE-1 cells together with Alt-R Cas9 Electroporation Enhancer (IDT #1075915). Two days post electroporation, cells were plated one cell per well in 96-well plates and single-cell clones screened by western blotting for TRIM21 protein. A single clone was chosen that contained no detectable TRIM21 protein and confirmed TRIM21 knockout phenotype in a Trim-Away assay.For the proteasome inhibition experiments, MG132  was used at a final concentration of 25\u2009\u00b5M.5 RPE-1 TRIM21-knockout or NIH3T3-Caveolin-1-EGFP cells suspended in 10.5\u2009\u00b5l of resuspension buffer R were mixed with 2\u2009\u00b5L of the indicated mRNA in water. After electroporation, cells were transferred into antibiotic-free DMEM or DMEM/F-12 media supplemented with 10% FBS and left to incubate for 5\u2009h before cells were harvested. Typically, expression could be detected from 30\u2009min after electroporation and lasted for ~24\u2009h.To enable precise control of protein expression levels, constructs were expressed from in vitro transcribed mRNA. mRNA was delivered into cells by electroporation using the Neon Transfection system (Invitrogen). For each electroporation reaction, 8\u2009\u00d7\u2009105 NIH 3T3 Cav1-knock in cells66 suspended in 10.5\u2009\u00b5l of resuspension buffer R were mixed with the indicated amount of antibody mixture diluted in 2\u2009\u00b5L of PBS. mRNAs were added immediately prior to electroporation, to limit the degradation by potential RNAse activity. Cav1-GFP mRNA encoding Vhh-Fc (WT or PRYSPRY binding-deficient H433A mutant) and TRIM21 were electroporated. The cell mRNA mixtures were taken up into 10\u2009\u00b5L Neon electroporation pipette tips (Invitrogen) and electroporated using the following settings: 1400\u2009V, 20\u2009ms, 2 pulses (as described in refs. 67). Electroporated cells were transferred to antibiotic-free Fluorobright media supplemented with 10% FBS and left to incubate for 5\u2009h in an incubator before the cells were harvested for immunoblotting. GFP fluorescence measured using an Incucyte\u00ae (essenbioscience) and was normalized to the control (Vhh-FcH433A). Protein detection was performed using the following antibodies: Fc: goat anti-hIgG Fc broad 5211\u20138004 (1:2000); TRIM21: rabbit anti-TRIM21 D101D (ST#9204) (1:1000), Vinculin: rabbit anti-Vinculin EPR8185 ab 217171 ; and Caveolin-1: rabbit anti-Cav1 .For each electroporation reaction, 8\u2009\u00d7\u2009105 cells, as described above. Electroporated cells were transferred to antibiotic-free DMEM supplemented with 10% FBS. For western analysis only, cells were incubated for 5\u2009h in an incubator before harvest. For flow cytometry analysis, the half of the cells were taken and treated with 25\u2009\u00b5M MG132, while the other half were treated with DMSO. Then cells were incubated for 5\u2009h in an incubator before being harvested. Cells were fixed before being subjected to flow cytometry. The same antibodies were used as for Trim-Away (see above).For mEGFP-Fc degradation assay, 0.4\u2009\u00b5M mEGFP-Fc mRNA together with 1.2\u2009\u00b5M of the indicated TRIM21 mRNA were electroporated into 8\u2009\u00d7\u200910Cells were fixed prior to flow cytometry. For this, cells were resuspended in FACS fixative  and incubated at room temperature for 30\u2009min. Afterward, cells were centrifuged and resuspended in FACS buffer  and stored at 4\u2009\u00b0C, wrapped in aluminum foil until use. Flow cytometry was performed using an Eclipse (iCyt) A02-0058. Cells were measured using forward and side scattering to assess live cells. In addition, green fluorescence was measured. Live cells were selected based on forward and side scattering and only the median GFP fluorescence of live cells was used for further analysis  A02-0058. For cell imaging using the Incucyte, we used the default software Incucyte S3. For crystallography, we used XDS (Version 31. January 2019), Phenix 1.18.2_3874 and 1.14-3260 , and Coot 0.8.9 and 0.9.Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1Reporting Summary"}
+{"text": "Kidney transplantation is the treatment of choice for patients with end-stage renal disease (ESRD). It has been shown to improve quality of life as well as extending life of patients with ESRD as compared to renal replacement therapy  . Traditionally, patients undergo general endotracheal tube anesthesia for this surgery. During the COVID-19 pandemic, general anesthesia drugs and airway equipment were in short supply. Additionally, airway manipulation was avoided when possible due to concern for virus spread from aerosolizing procedures (i.e. intubation/extubation). In this case report, we review a 65-year-old female with an ESRD due to hypertension and diabetes that underwent deceased donor kidney transplant under spinal anesthesia. We will further discuss the benefits of spinal anesthesia in renal transplant operations. Anesthesia allows patients to undergo surgical or interventional procedures by producing absence of awareness or anxiety, analgesia, amnesia, and adequate muscle relaxation or immobility. There are multiple types of anesthesia consisting of general anesthesia, regional anesthesia , local anesthesia and monitored anesthetic care (sedation).General anesthesia is most used for major surgical procedures. It is induced with intravenous medications or medications inhaled through a mask. Once patients become unconscious, an endotracheal tube or a supraglottic airway  is placed. General anesthesia is maintained during surgery by intravenous medications or anesthesia gases.Spinal anesthesia is a form of regional anesthesia in which local anesthetic is placed into the subarachnoid space via a needle or catheter, which results in numbness to a large portion of the body, often T4 dermatome and below. This form of anesthesia can be utilized for lower abdominal, pelvic and lower extremity operations.A 65-year-old female with a history of insulin-dependent diabetes, hypertension, congestive heart failure, hypothyroidism and end-stage renal disease (ESRD) on hemodialysis presents for diseased donor kidney transplant. Her preoperative vitals were stable, and her starting hemoglobin was 12.1 grams/deciliter with a platelet count of 181\u00a0000. Her last dialysis session was the day before transplant. After proper inspection of the donor kidney, she was taken to the operating room for kidney transplant. She was given 1\u00a0mg of midazolam and 50 mcg of fentanyl for sedation prior to the procedure. A single shot spinal was performed utilizing a midline approach at the level between L2-3 with a 27-gage, pencil tip spinal needle. 1.8\u00a0mL of bupivacaine PF 0.75% was placed in the intrathecal space with a sensory block up to the T4 dermatome. The patient was given a low dose (20\u201360 mcg/kg/min) propofol infusion for sedation during the transplantation. The patient then underwent a kidney transplant through a right lower quadrant curvilinear incision utilizing standard transplant surgical technique. At the conclusion of the case, sedation was discontinued, and patient was taken to the recovery room.To this date, there is only one other case report on spinal anesthesia for kidney transplants . In the In conclusion, this case illustrates renal transplantation can successfully be done under spinal anesthesia. Further investigation assessing safety, pain control, and hospital course would be worthwhile."}
+{"text": "Freeride skiing is an activity that is, or at least can be, quite dangerous. Risk-taking in high-risk sports has usually been understood within a psychological framework. Building on Pierre Bourdieu's sociology, this article highlights the social dimension of risk-taking in freeride skiing by scrutinizing values within a freeride culture. A central question in this article is: what kind of actions are given recognition and credibility in freeride skiing? The findings show that there is a clear link between risk-taking and credibility and that risk-taking might be seen as a form of capital. However, risk-taking's link to recognition is not straightforward\u2014it is limited by the skiers' skill level. To further develop our understanding of the social dimension of risk-taking we use Michelle Lamont's theory of symbolic boundaries. By expanding the Bourdieusian understanding of social practice with Lamont's work, we gain insight into how risk-taking is socially regulated by social conventions within a subculture. This means that we in this article describe three social dimensions of risk-taking: (1) The link between risk-taking and recognition, (2) The limits of the risk-recognition nexus, and (3) The moral boundaries of risk-taking. Sunny and nice weather, untouched terrain, fresh powder. Maybe some cliffs to jump off. That is every freeride skier's dream. But with this dream comes risk. Risk of avalanches, falling off cliffs, sliding uncontrolled down a steep mountainside. Despite the risk, freeriding\u2014skiing outside the boundaries of resorts and in the mountains\u2014has become ever more popular, both internationally . Before we go deeper into methodological issues, it is important to also say that both authors have been, if not core members, at least avid freeride skiers with personal connections at the core of the Norwegian freeride culture. That means that we had a good understanding of the values of the freeride culture before we started the research. One could ask the question of whether this means that we had preconceived notions about the ski culture. That might be, but as this is a heavily theoretical, informed reading of our empirical data, we would suggest that our own initial understanding of the research data is not problematic. We will come back to that later.The seven informants recruited for this study all lived in a small town on the west coast of Norway that we have chosen to call \u201cWestfjord.\u201d Because of its proximity to alpine terrain, Westfjord has become a hub for freeride skiing in Norway. Since it has a university, it attracts a lot of students who are already into skiing. It also attracts mountain guides looking for work. All the informants have freeride skiing as their main interest. None of them were beginner freeride skiers, but their experience level still varied. Some had been active freeride skiers for more than 10 years, whereas others were relatively new to freeriding. Their ages varied from 18 to 45 years. It is important to note that even if some of them were new to freeriding they had all been skiing all of their lives. The informants were recruited by one of the authors through Messenger. This way the informants could see that the researcher also lived in Westfjord and that he was not a complete outsider to the ski community. The idea was that it would be easier for the informant to say yes to being part of the study. The informants were all skiers that we knew by reputation, but we did not know them personally.To gain insight into the skiers' own narratives of risk-taking, we used what Kvale and Brinkmann  call semThe analyses of the transcribed material were done by using the conceptual frameworks of Bourdieu and Lamont. This means that we do not advocate an epistemology of continuity. As Bourdieu argues  exists (\u2026) only in and through the reputation, recognition, faith, trust and reputation of other people, and it can no longer be preserved until [\u2026] it manages to maintain the belief that it exists\u201d , and then you need to land jumps from cliffs and ski continuously. It should also be a bit steep.\u201d So, besides the fact that the skiing should look aesthetically pleasing, it is also important that it contains jumps or drops from cliffs and that it happens in steep terrain. In other words, she connects risk and recognition, as she clearly means that \u201cgood skiing\u201d involves risk. However, all the informants mention that there is a big difference between skiing steep and doing huge drops near resorts and doing the same things in the mountains. The freerider and \u201csteep-skier\u201d \u201cH\u00e5vard\u201d describes that he thinks it is really impressive when skiers take their skills from the skiing resorts into the big mountains: \u201cI think it is impressive if somebody sends big drops and sticks them in the mountains. (\u2026) Like wow, 10 meters, scmack! Without doubting.\u201d The quote reveals that big mountain skiing has high status. It is also an example of the connection between risk and recognition. The same actions performed near a resort do not give the same credibility. This means that it is not just the actions or the skills in themselves that give status. The increased risk of being in big mountains, far from help if anything should happen, gives the actions more value. Further, the mountain guide \u201cEven\u201d says: \u201cIf you absolutely want to be a part of the steep skiing milieu, then you must be aware that you have to take the necessary risks.\u201d In Bourdieu's language, we could say that risk-taking in itself becomes a form of capital that gives the skier an opportunity to increase her or his status and thereby climb the hierarchy of the freeride community. Another mountain guide and professional skier \u201cKjetil\u201d tells us that the riders who are considered the best, the skiers at the top of the hierarchy, are there at least partly because they have the form of capital that is connected to risk-taking:Freeride competitions and ski movies are one thing; everyday reality might be another. The question is, then, do the same mechanisms\u2014the connection between risk and recognition\u2014also exist in settings that are more mundane? To get a sense of the hierarchies, and thereby the values, of the freeride ski culture in Westfjord, we simply asked our informants about who they saw as \u201cgood\u201d skiers and why. In others words, what kind of skiing is given recognition? When \u201cMie\u201d was asked what good skiing is, she responded: \u201c\u201cThe skilled skiers ohhh they are in a league of their own. It is clear that if you are going to get cred (\u2026) of course you have to do some things that are on the edge. If you are going into that community, then there is no point in just skiing ordinary things.\u201dTo us it seems clear that for freeriders in Westfjord risk and recognition are connected. This is in line with values in other high-risk sports such as BASE jumping and rock climbing  terrain becomes visible through Instagram. The freeride milieu is pretty small and everything becomes very visible, especially where the good riders have been. Then this is pursued by skiers at a lower level who should not be there and might not know what kind of terrain they are in, both when it comes to their own skills and avalanches.\u201dTwo important processes are going on in the quote above. First, it is clear that what the \u201cgood\u201d skiers are doing is dangerous and that is a part of what they are recognized for. Secondly, the quote reveals that gaining recognition for doing dangerous things is limited by skills. As seen in the quote, \u201cMie\u201d warns against beginners trying to ski the same lines as highly skilled riders. That probably means that riders who are lacking skills would not get recognition for doing the same line as the acknowledged riders. This resembles what Langseth and Salvesen  found inThis logic is seen when \u201cH\u00e5vard\u201d talks about how he meets \u201cfresh\u201d students every year in Westfjord who try to become core members of the freeride community:\u201cI think it is important that the community focus on the fact that people are skilled, make good decisions and let people hear it if they don't. Every year, somebody that doesn't have a clue tries to become something. They make mistakes in the mountains, they are loose cannons. You don't ask those to come along.\u201dIt is easy to think that you have to let them do what they want to and think for themselves what they are capable of. After all, it is not my job to determine their skill level.\u201d Still, this is something that is discussed between the core members of the subculture. As mentioned by Langseth and Salvesen  his risk assessment is completely different from ours. I do not think he takes a high risk (\u2026) because (others) are not as good as Killian.\u201d Here we see a clear contrast to the new, striving, students in Westfjord that are seen as \u201cloose cannons.\u201d We see that as long as a skier is seen as highly skilled, she or he is given cred for actions that otherwise would have been seen as foolhardy.As discussed above, it is clear that in order for a new student to enter the social hierarchy of freeride skiing, risk-capital is essential. But again, the quote also shows that there are limits to risk-taking as a form of capital. If you are considered a \u201cloose cannon\u201d it is likely that performing an action that in other cases would have conferred cred is discredited. To pinpoint exactly where the line between actions that give cred and actions that are deemed foolhardy sits is not easy. These are blurred boundaries. The freeride community, as with most lifestyle sports, is a community with a heavy individualistic ideology that probably makes it hard for the athletes to come up with clear-cut, concrete statements about these boundaries. Competition skier \u201cIda\u201d says \u201cSalvesen , when CaThe one who can ski everything and make it in a controlled manner, skiing steep, skiing at high speed (\u2026) and be able to choose good lines.\u201d Clearly, in H\u00e5vard's view, being a \u201cgood\u201d freerider is connected to competence and experience along with having control in different kinds of situations. Furthermore, H\u00e5vard describes that the \u201cgood\u201d skier not only possesses these qualities but is also willing to take a calculated risk: \"It often has something to do with risk management. That they have made a good assessment of their skills and risk (\u2026) so they end up with a good result.\u201d Here H\u00e5vard highlights a theme that is common to all the informants and follows the logic of the cred model, namely that risk-taking is legitimized by high competence and experience. This means, as previously mentioned, that the symbolic capital connected to risk-taking is regulated by others' thoughts about a rider's skill. However, what these skills are, what these boundaries consist of, remains unclear.In a similar manner, \u201cH\u00e5vard\u201d describes the \u201cgood\u201d freeride skier in a general way: \u201cEven if these boundaries are blurred, it is still clear that some actions involving risk give credibility while others are deemed foolhardy and still others are just passed in silence. But what kind of boundaries are these? In Bourdieu's understanding there would not be any boundaries to capital accumulation. Reading too many books wouldn't stop you from increasing your cultural capital. To get a better understanding of these boundaries, it is necessary to move beyond a purely Bourdieusian scheme. When skiers discredit some acts because they are seen as foolhardy, we would say that these are acts of moral judgement that limit the accumulation of the type of symbolic capital connected to risk. According to Lamont , moral b\u201cIda\u201d touches upon the morality of risk-taking when she talks about how some athletes at freeride ski competitions push themselves above their abilities:\u201cYou see them fall and roll and roll. And lying still when they stop (\u2026) it is incredibly disgusting (\u2026) It affects not only oneself but everyone who loves them. And it's incredibly uncomfortable and it puts so many others at risk.\u201dThere are some who do not manage to take that responsibility (\u2026) and they will make a fool out of themselves.\u201d The words \u201cresponsibility\u201d and \u201cfool\u201d are words that set these statements within an understanding of practice that has to do with morals. The use of the word \u201cresponsibility\u201d also shows that this is not just an individual endeavor and points toward the social limits of risk-taking. A few years back, there was an accident in Westfjord. In this accident, a male skier was taken in an avalanche while skiing a steep line. He was buried in the snow debris for hours before the alpine rescue group found him. He had skied alone and had not told anyone where he went. In the interview guide, we used this accident as a case that might reveal feelings and values about risk-taking among the informants. \u201cKjetil\u201d described his feelings about the accident:Putting others at risk seems to be part of the moral boundary. She points toward how others (families and friends) are or should be part of the considerations for a freeride athlete. In other words, the freeride skier has moral obligations that supersede the risk-recognition logic. This indicates that morality is an important factor in the distribution of recognition. Still, the morality of risk-taking is less tangible than the risk-recognition logic. But it is clear that we are in a moral landscape. \u201cH\u00e5vard\u201d talks about how it is necessary to take responsibility but that \u201c\u201cIt's clear that he (\u2026) made a fool out of himself (\u2026). It just had to go wrong (\u2026). It's personal decisions. I do not blame him for what he did. It's his own life. (\u2026) This is a person who is damn good at skiing, likes to take chances \u201cliving on the edge\u201d (\u2026). He dropped a cliff and landed on a minefield that took him.\u201dThe stupidest thing was that he went alone and did not inform anyone about the trip destination. Maybe he was super good at (reading) avalanches and maybe he was super good at skiing, but you never know (\u2026) it was stupid.\u201d As an outdoor teacher, \u201cLisa\u201d holds the skier's actions up against common norms of outdoor leisure in Norway: you should not travel alone in the mountains and you should always tell others where you go. The fact that the skier did not follow these common rules and norms of behavior resulted in a moral distance between him and other skiers. Six of all seven participating informants reacted as \u201cLisa\u201d did with negative moral associations when talking about the skier involved in the accident. The informants also linked the skier's actions to moral considerations about rescue personnel or close relatives. As a part of the rescue group, \u201cKjetil\u201d revealed ambiguous feelings about the accident:Again, we see that \u201cfool\u201d is used to describe the accident. And a \u201cfool\u201d is a word that is used to describe people who do not adhere to moral norms. The same tendency is seen in the descriptions from the local skier \u201cLisa:\u201d \u201c\u201cIt was crazy to start a rescue operation on grade 3 in a valley that is a large terrain trap. That's why I reacted. We had no control over the situation. It was (\u2026) not good.\u201dHere he describes how the rescue in his opinion was dangerous because the valley was not safe  and it was in his mind not rational to start the operation. The same understanding is seen when the mountain guide \u201cEven\u201d talks about the accident:\u201cPeople have to decide and make decisions about their own lives, but at some point it will affect others (\u2026) family and such, also with rescue personnel. I am open for a discussion about how far one can go. (\u2026) I want to live.\u201dStigmatization as an aspect of an established-outsider relationship is often associated with a specific type of collective fantasy evolved by the established group. It reflects and, at the same time, justifies the aversion-the prejudice-its members feel toward those of the outsider group\u201d (Elias and Scotson, moral blaming of the victim is not just something that is constructed from outside the culture, but also internally. As we have displayed above, in an accident, the discussion of what went wrong is transformed into a moral discussion on whether the skier in question had the right skills and therefore if she or he should have been skiing that specific line.As described earlier, the moral boundaries in relation to this skier are created on the basis of a moral judgement about common responsibilities and obligations to others. The fact that the skier was seen as putting other people at risk and the way relatives probably were emotionally affected afterwards created significant feelings and a certain ambivalence among the informants. This indicates a limit to recognition and what is seen as acceptable in the skiing community. According to Lamont , moral bAnother facet of the morality of risk-taking becomes evident when one of informants talked about an accident he was involved in while working as a guide:\u201cI think you will be judged. In positive or negative ways, but I think you will be judged. I have the impression that if you have been close to something, then you can\u2026 you should of course wish it had not happened. There is a lot\u2026eeh\u2026 some kind of shame is probably involved in it.\u201dThe use of the word \u201cshame\u201d is interesting. Since he was working as a guide when this happened, it has some different connotations than if it was just him taking risk. But it still points in the direction that taking too much risk is connected to shame. Shame is a complex social phenomenon, but it is always connected to moral norms in one way or another. In Langseth and Salvesen's  presentaThe main objective of this study has been to acquire an understanding of the mechanisms behind risk-taking in freeride skiing. Based on our analysis of freeride skiers in \u201cWestfjord,\u201d we found that there are three central dimensions that influence risk-taking.The first dimension establishes a relation between risk-taking and recognition. Often, the motivation for risk-taking is understood as individual ambitions. For some it is understood as genetic propensities that makes certain people take extended risks. Others see this as motivated by the \u201cthrills\u201d and \u201cflow\u201d that such actions entail. We do not say that these understandings are false, but our findings show that they are not the whole story. Building on a Bourdieusian framework, we show that risk-taking can be seen as a form of symbolic capital that can give the holder recognition and status. Risk-taking is thereby a social phenomenon. What the agents strive for, what they dream about doing, and what they actually do on their skis does then stem from being socialized into a subculture that holds certain values. The central point is that risk-taking is a value in freeride skiing. That means that the motivation for taking risks cannot be seen as \u201cintrinsic.\u201d The motivation stems from incorporating the values held in the freeride community. In other words, these values are from the outset extrinsic, but as skiers are socialized into this community the values become intrinsic. This creates a logic that is deeply embedded among freeride skiers and connects risk-taking and recognition.the second dimension of risk-taking shows that this logic has its limits. Building on Langseth and Salvesen's Cred-Zone model (Langseth and Salvesen, However, the third dimension of risk-taking. Here, we explore risk-taking and recognition by employing Michelle Lamont's concept of moral boundaries (Lamont, per se that are evaluated, but rather that not having the right amount of skill makes a skier break some moral boundaries. The freeride skier has moral obligations that go beyond the individual athlete\u2014the skier should, according to the informants, take friends, family, and rescue personnel into the equation when they undertake risky skiing. Failing to do so could lead to both a personal feeling of shame and criticism from the freeride community. We propose that these moral boundaries can be seen as social mechanisms that work to regulate the risk-recognition logic in the freeride community. These collective norms, we think, keep the number of accidents down. But at the same time we could also speculate that these moral boundaries and the feelings of shame that could be felt if these norms are broken could also make it hard to talk about and learn from accidents in hindsight.The limits of the risk-recognition logic are further explored in  Lamont, . FailingFirst, we wanted to highlight the complexity of voluntary risk-taking in extreme sports from a sociological understanding of group-level processes. Second, the article shows both the usefulness of a Bourdieusian framework for understanding social actions but also the need for an expansion of Bourdieu's understanding of social practice. Our analysis shows that the accumulation of symbolic capital is limited by a moral dimension\u2014a moral dimension that cannot be reduced to a form of symbolic capital, but that belongs to another dimension of sociality that is not well-described by Bourdieu himself. Thirdly, we hope that the three dimensions we propose will be used in future research in other research projects investigating risk-taking in sports and other activities.The contributions of this article are three-fold. The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by NSD. The patients/participants provided their written informed consent to participate in this study.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Traumatic peri-contusional penumbra represents crucial targets for therapeutic interventions after traumatic brain injury (TBI). Current resuscitative approaches may not adequately alleviate impaired cerebral microcirculation and, hence, compromise oxygen delivery to peri-contusional areas. Low-frequency oscillations in cerebral blood flow (CBF) may improve cerebral oxygenation in the setting of oxygen deprivation. However, no method has been reported to induce controllable oscillations in CBF and it hasn\u2019t been applied as a therapeutic strategy. Electrical stimulation of the trigeminal nerve (TNS) plays a pivotal role in modulating cerebrovascular tone and cerebral perfusion. We hypothesized that TNS can modulate CBF at the targeted frequency band via the trigemino-cerebrovascular network, and TNS-induced CBF oscillations would improve cerebral oxygenation in peri-contusional areas. In a rat model of TBI complicated by hemorrhagic shock, TNS-induced CBF oscillations conferred significant preservation of peri-contusional tissues leading to reduced lesion volume, attenuated hypoxic injury and neuroinflammation, increased eNOS expression, improved neurological recovery and better 10-day survival rate, despite not significantly increasing CBF as compared with those in immediate and delayed resuscitation animals. Our findings indicate that low-frequency CBF oscillations enhance cerebral oxygenation in peri-contusional areas, and play a more significant protective role than improvements in non-oscillatory cerebral perfusion or volume expansion alone. Despite advances in the management of TBI complicated by HS (TBI\u2009+\u2009HS), the current resuscitative approach to TBI\u2009+\u2009HS still entails immediate intravascular volume expansion, vasopressors, or oxygen supplementation6. However, these interventions do not adequately alleviate impaired cerebral microcirculation in peri-contusional areas following injury9, and hence provide limited neuroprotection and improving neurological outcomes. Given these challenges, an optimal resuscitative approach to TBI\u2009+\u2009HS remains elusive.Clinical outcomes after traumatic brain injury (TBI) are significantly worsened by concomitant hemorrhagic shock (HS) due to increased reduction of cerebral blood flow (CBF) leading to hypoxia, approximately doubling the mortality rate compared with TBI alone12. These early events are followed by hypoperfusion and compromise of the cerebral microvasculature resulting in capillary stasis, ischemia and hypoxic tissue damage. All of these detrimental effects are exacerbated by HS. In TBI, in addition to hypoperfusion, endothelial swelling and perivascular edema occur, which require oxygen to travel a longer distance before reaching the injured mitochondria14. Therefore, neuroprotective strategies targeting the cerebral microcirculatory bed in order to enhance cerebral microcirculation and, subsequently improve oxygen delivery to the injured brain tissue, are highly required.A major consequence of TBI is direct damage to the cerebral vasculature, leading to hemorrhage, CBF abnormalities, blood\u2013brain barrier (BBB) disruption, and edema16. While the precise mechanism of these oscillatory patterns is not well understood, it might be linked to multiple protective mechanisms for compromised cerebrovascular regulation and cerebral oxygenation. Studies in a human model of lower body negative pressure (LBNP) have shown that spontaneous low-frequency oscillations (0.04\u20130.15\u00a0Hz) in CBF are protective in a central hypovolemic state20. These studies suggest that such oscillations may represent an \u201con\u2013off\u201d feedback mechanism and provide a pump-like effect leading to improved tissue perfusion via temporary increases in the pressure gradient down the vascular tree. This hypothesis has been further supported by computational simulation, wherein low-frequency CBF oscillations supply higher amplitudes of localized oxygen delivery relative to oscillations at a higher frequency16. Furthermore, pulsatile blood flow can increase shear stress on the vessel endothelium which stimulates the release of nitric oxide and inhibits endothelin production, thus increasing oxygen delivery to brain tissue21. In this study, we therefore hypothesize that artificially induced low-frequency oscillation in CBF could improve cerebral perfusion and oxygenation in areas of brain that are damaged but not yet dead, and thereby improve overall functional outcomes following TBI\u2009+\u2009HS. However, based on our knowledge, no method has been reported to induce controllable oscillations in CBF.Several studies, from clinical findings to computational models, indicate significant effect of low-frequency oscillatory patterns of CBF to maintain tissue perfusion in the setting of oxygen deprivation24. Hence, electrical stimulation of the trigeminal nerve (TNS) plays a pivotal role in modulating cerebrovascular tone and cerebral perfusion under normal and pathological conditions28. We, therefore, further hypothesize that TNS can modulate CBF at the targeted frequency band via its rich network of connections to enhance cerebral macro- and microcirculation. To test this hypothesis, we established a model of severe TBI\u2009+\u2009HS using rats and explored the beneficial effects of TNS-induced low-frequency oscillations on CBF, lesion volume, hypoxic stress, endothelial nitric oxide synthase (eNOS), neuroinflammation, neurological function, and 10-day survival rate.The trigeminal nerve (CN V), the largest cranial nerve, innervates the majority of the cerebral vasculature including large arteries, arterioles, capillaries, pial vessels, and venous sinuses, as well as maintains associations with numerous vasoregulatory regions29.All experiments were approved by the Institutional Animal Care and Use Committee of the Feinstein Institutes for Medical Research and performed in accordance with the National Institutes of Health guidelines for the use of experimental animals. Rats (315\u2013390\u00a0g)  were housed in a temperature-controlled room (12\u00a0h light/dark cycle) and were allowed food and water ad libitum. Cages were lined with Enrich-o\u2019Cobs bedding . Prior to surgery, rats were housed in groups of three per cage, while they were housed singly after the surgery. Results are reported in accordance with ARRIVE  guidelines26. Immediately after CCI, 50\u2009\u00b1\u20092.8% of the blood volume was removed while maintaining the mean arterial blood pressure at 27\u2009\u00b1\u20092\u00a0mmHg for 35 minutes30. At the end of the induced hemorrhage, rats were treated with TNS induced oscillations at 0.1\u00a0Hz (unless otherwise specified) or left untreated for 60\u00a0min, followed by an infusion of intravenous fluid with 2\u00d7\u2009Lactated Ringer\u2019s solution for 60\u00a0min. After each surgery, rats were given subcutaneous buprenorphine (0.05\u20130.1\u00a0mg/kg) and returned to their home cages.In male Sprague\u2013Dawley rats, a controlled cortical impact (CCI) model was used to induce severe TBI immediately followed by pressure-controlled blood withdrawal to induce HS. Rats were anesthetized with constant aerosol isoflurane delivered in medical air , and were placed in a stereotaxic frame on a heating plate to maintain body temperature at 37.0\u2009\u00b1\u20090.2\u00a0\u00b0C. A 6\u00a0mm circular craniotomy was performed halfway between bregma and lambda in the parietal bone centered at 4\u00a0mm lateral from the sagittal suture. CCI was delivered over this craniotomized portion of the skull with an electromagnetic-based device set  using the following impact parameters: velocity: 6\u00a0m/s; depth of penetration: 3\u00a0mm; dwell time 100 msA total of 109 rats were entered into the study. Animals were randomly assigned to four groups: (1) Sham: received sham surgery and sham stimulation; (2) Delayed resuscitation (DR): received fluid resuscitation at 60\u00a0min after TBI\u2009+\u2009HS onset; (3) Immediate resuscitation (IR): received intravenous fluid (IVF) with 2\u00d7\u2009Lactated Ringer\u2019s solution immediately after TBI/HS onset; (4) Low frequency oscillation (LFO): received low-frequency CBF oscillations (0.1\u00a0Hz) induced by TNS for 60\u00a0min immediately after TBI/HS onset and followed by IVF resuscitation;. IR group represents the best systemic hemodynamic and cerebral perfusion without the above-mentioned low-frequency oscillations. All groups underwent the same surgery procedures including performing craniotomy and placing electrodes for TNS, but stimulation was only applied to the LFO groups. To make sure that the rats experienced a similar shock condition, we selected the rats for analysis through a combined assessment of blood gas and metabolic variables  at the TBI\u2009+\u2009HS onset. The blood was drawn from the femoral artery to measure the lactate, glucose, pH, and hemoglobin (Hgb) levels . Rats were sacrificed at either 5 or 24\u00a0h after induction of TBI\u2009+\u2009HS for sample collection.24. We have previously shown that electrodes inserted at this position can stimulate the infraorbital and anterior ethmoidal branches of the trigeminal nerve26. The stimulation parameters were calibrated to induce low-frequency oscillations of CBF in the frequency range of 0.05\u20130.4\u00a0Hz. Rectangular biphasic pulses were delivered with a frequency of 50\u00a0Hz, inter-pulse period of 20\u00a0ms, burst width of 5\u00a0s followed by a 5\u00a0s delay (unless otherwise specified) over 1\u00a0min by an electrical stimulator . We repeated this pattern every 10\u00a0min for a total stimulation period of 60\u00a0min.Bilateral bipolar electrodes  were inserted percutaneously between the inner border of the supraorbital ridges and the orbital contents to a depth of approximately 4 mmArterial blood pressure (BP) was continuously monitored and recorded for all the rats. A catheter placed in the left femoral artery was connected to a blood pressure transducer  for continuous recording of BP. Needle-type electrodes  were inserted subcutaneously to the hind and forelimbs bilaterally to continuously record the ECG. A laser Doppler probe to measure CBF was positioned over a 2\u00a0mm craniotomized portion of the frontal bone ipsilateral to the site of CCI. All data were digitized at 1\u00a0kHz with PowerLab digitizer .Brain samples were collected at 5\u00a0h or 24\u00a0h after TBI\u2009+\u2009HS. The left hemisphere was excised, rinsed of blood, homogenized with polytron in a homogenization buffer  and solicited for 10\u00a0s. Homogenates were centrifuged at 16,000\u00a0g for 20\u00a0min. TNF-\u03b1 and IL-6 were determined by using assay kits according to the manufacturer\u2019s instructions .mRNA was extracted from left hemispheres at 5\u00a0h or 24\u00a0h after TBI\u2009+\u2009HS using Trizol reagent . High capacity cDNA Reverse Transcription Kit  was used to synthesize cDNA from the isolated RNA. Primers for eNOS  and iNOS  were utilized. qPCR was performed on a 7500 Real-time PCR System  utilizing SYBR Green PCR Master Mix reagents . Rat GAPDH  was used as an endogenous control. The delta-delta calculation method was utilized to obtain fold change relative to controls.At 24\u00a0h after induction of polytrauma, the animals were deeply anesthetized with isoflurane, and transcardially perfused with cold phosphate-buffered saline (PBS), followed by cold 4% paraformaldehyde (PFA) in PBS as a fixative. The brains were removed and immersed in PFA overnight, then cryopreserved in gradient sucrose solutions from 10 to 20% for 48\u00a0h, embedded in a 1:3 mixture of 30% sucrose and Optimal Cutting Temperature Compound  and stored at\u2009\u2212\u200980\u00a0\u00b0C for future cryosectioning. The brains were serially cut into 14\u00a0\u00b5m thick coronal cryosections from caudal to rostral at 400\u00a0\u00b5m intervals using a cryostat , mounted on Superfrost Plus glass slides  and Polysine glass slides , and stored at\u2009\u2212\u200980\u00a0\u00b0C.To measure lesion volume, the serial brain sections were stained with hematoxylin and eosin Y (H&E), and digital images of the sections were acquired using a PathScan Enabler 5 . The lesion volume was calculated using ImageJ software  and was expressed as the percentage of total ipsilateral and contralateral cerebral hemisphere volume.For IF staining analysis, Polysine slides were washed with 1\u00d7\u2009tris-buffered saline (TBS) containing 0.05% Tween-20 (TBST), blocked with 5% goat serum  supplemented with 1% bovine serum albumin  for 1\u00a0h at room temperature and sequentially incubated with primary antibody, mouse anti-HIF-1\u03b1 antibody , at 4C overnight and its corresponding secondary antibody, Alexa Fluor 488 conjugated goat anti-mouse antibody , at room temperature for 1\u00a0h. The slides were then co-stained with the primary antibody, mouse anti-NeuN antibody , and its corresponding secondary antibody, Alexa Fluor 555 conjugated goat anti-mouse, at room temperature for 1\u00a0h. The primary antibodies were diluted in blocking solution. The wash step between incubation was 5\u00a0min\u2009\u00d7\u20094 times using 1\u00d7\u2009TBST. The slides were counterstained with DAPI  and mounted with Vectashield Antifade mounting medium  Staining slides were visualized and imaged with EVOS M7000 imaging system  using 20\u00d7\u2009objective and automate function of XY-stitching to obtain whole brain images.2. All quantitative analysis were performed by investigators blinded to the group allocation.ImageJ  was used to count the immunofluorescent positive cells. Post-processing of immunofluorescent images has been described elsewhere. In brief, for HIF-1\u03b1 positive cell count, green channel overlapped with DAPI channel were manually counted in the region of interest (ROI) in dimension of 517 by 388 \u00b5m31. Briefly, neurological function was graded based on motor score (0\u201310), which evaluated limb movement, ambulation, and reflexes; a sensory score (0\u20132), which evaluated response to visual and tactile stimuli and proprioception; and a balance score (0\u20136) which was determined by placing the rat upon a suspended wooden beam (2.0\u00a0cm\u2009\u00d7\u20094.0\u00a0cm\u2009\u00d7\u200960.0\u00a0cm) for up to 60\u00a0s. A maximum total score was18, with higher scores indicating poorer neurological function.Prior to the collection of samples at 24\u00a0h, neurological function and behavioral damage was quantified using the previously described modified neurological severity scale (mNSS)A 10-day survival study was conducted to determine if TNS-induced CBF oscillations improve survival in an animal model of TBI\u2009+\u2009HS. Following the experimental procedures described above, rats were returned to their cages and allowed food and water ad libitum. All surviving rats were sacrificed on day 10.d for Student\u2019s t-test. The CBF was analyzed using repeated measures ANOVA. The difference between multiple groups was analyzed by one-way ANOVA and post-hoc test. Student\u2019s t-test was used when only two groups were compared. All groups were analyzed for normality using the Shapiro-Wilkes method. P values of less than 0.05 were considered significant.All data are expressed as mean\u2009\u00b1\u2009standard deviation (SD) and analyzed by GraphPad Prism software. Survival analysis was performed by the Kaplan\u2013Meier method and compared by the log-rank test. Effect sizes were quantified using Cohen's The low-frequency oscillations in CBF 0.04\u20130.15\u00a0Hz) could be reliably generated by TNS using the stimulation parameters described in our methods. The oscillation frequency was mainly determined by stimulation duty cycle. As shown in Fig.\u00a05\u00a0Hz coulCBF in the peri-contusional cortex was measured. TBI\u2009+\u2009HS significantly decreased the amplitude of CBF in peri-contusional brain tissues. Representative recordings in CBF for DR, IR and LFO animals are shown in Fig.\u00a0Lesion volume measurements were used to assess the extent of traumatic injury. Representative images of H&E stained brain coronal sections are shown in Fig.\u00a033. The hippocampus is highly vulnerable to hypoxic brain injury34. Although it is not often directly damaged by TBI, the hippocampus is subject to the propagation of secondary injury after TBI, and its injury causes long-term memory dysfunction and learning deficits35. After TBI\u2009+\u2009HS, brain sections labeled with HIF-1\u03b1 and neuronal nuclei (NeuN) demonstrated discrete areas of hypoxia and varying degrees of neuronal disruption  is a sensitive marker of hypoxic stress in neuronsTo investigate the effect of TNS-induced CBF oscillations on cerebrovascular endothelium, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to determine the levels of endothelial nitric oxide synthase (eNOS) and inducible nitric oxide synthase (iNOS). The RT-qPCR assay on the cortex which receives the main trigeminal afferents, showed a significant increase of the expression of the gene coding for eNOS, statistically significant for LFO animals when compared to the IR and DR animals. As shown in Fig.\u00a036. As shown in Fig.\u00a0TBI\u2009+\u2009HS initiates a cascade of inflammatory processes that serve to exacerbate the initial injury31. This includes the sensorimotor function, reflexes and behaviors. As shown in Fig.\u00a0Functional neurological deficits in animals were evaluated according to the modified Neurological Severity Scale (mNSS) at 24\u00a0h after TBI\u2009+\u2009HSA 10-day survival study was performed to assess the impact of induced CBF oscillations via TNS on animal mortality. At 24\u00a0h after TBI\u2009+\u2009HS, the survival rate of DR animals was 60% and further decreased to 40% at 10\u00a0days. In contrast, with TNS-induced CBF oscillation, the survival rate increased to 85% and 75%, at 24\u00a0h and 10\u00a0days, respectively. Immediate fluid resuscitation resulted in a 100% survival. This indicates that the induced low-frequency CBF oscillations confer survival benefits both acutely and also persisting at extended time points up to 10\u00a0days following TBI\u2009+\u2009HS compared to DR animals  delivered after TBI\u2009+\u2009HS play a more significant role than improving non-oscillatory cerebral perfusion, by mitigating secondary brain injury, attenuating brain hypoxic injury and neuroinflammation, protecting cerebrovascular endothelium in peri-contusional brain tissue, enhancing neurological recovery, and improving survival rate. To our knowledge, this is the first study where the TNS-induced low-frequency oscillations in CBF have been applied as a therapeutic strategy in TBI\u2009+\u2009HS.TBI is acquired from an external force, possibly resulting in devastating effects to both the cerebrovasculature and neighboring neuronal cells20. While the physiologic mechanisms that govern CBF oscillations remain unclear, studies have shown that oscillatory CBF modulates the release of vasoactive molecules important in maintaining cerebral perfusion via flow-mediated regulatory mechanisms40. Specifically, pulsatile blood flow can increase shear stress on the vessel endothelium which stimulates the release of nitric oxide and inhibits endothelin production, thus increasing oxygen delivery to brain tissue21. Furthermore, these oscillatory patterns represent an \u201con\u2013off\u201d feedback mechanism that serves to maintain tissue perfusion in the setting of oxygen deprivation with computational models suggesting that low frequency oscillatory flow is beneficial to tissue oxygenation16. It might be that brief, rhythmic increases in CBF during the oscillatory stimulus , likely due to the failure of fluid resuscitation alone to relieve the effects of the impaired micro-vasculature leading to inadequate microvascular perfusion and ultimately hypoxia after TBI\u2009+\u2009HS. In contrast, animals undergoing the low-frequency CBF oscillations delivered prior to fluid resuscitation, had significantly attenuated brain hypoxic injury, despite the lack of fluid resuscitation and delayed restoration of perfusion, suggesting an increase in the efficiency and efficacy of oxygen delivery as well as restoration of cerebral microvasculature perfusion.Spontaneous low-frequency oscillations 0.04\u20130.15\u00a0Hz) in CBF have been observed in individuals with delayed syncope after induced central hypovolemia and are thought to preserve cerebral perfusion5\u00a0Hz in C42. The cerebrovascular endothelium, as a vascular barrier contacting blood directly, is dysfunctional following TBI44. The endothelial nitric oxide (NO) generated in the cerebrovascular endothelium is one of the most important signaling molecules for CBF autoregulation and there are numerous studies that suggest it is neuroprotective after brain injury47. Its production mainly depends on endothelial nitric oxide synthase (eNOS) activity, therefore, eNOS activation in the cerebrovascular endothelium plays a significant role in maintaining CBF and oxygenation after TBI, preserving brain microcirculation, inhibiting platelet aggregation, leukocyte adhesion and migration49. Our results have shown that low-frequency CBF oscillation induced by TNS have upregulated mRNA expression of eNOS by 28% and 127% at 5\u00a0h and 24\u00a0h after TBI\u2009+\u2009HS respectively, while there was no significant change in both delayed and immediate resuscitation groups. This suggests that low-frequency CBF oscillations protected cerebral endothelial dysfunction in the peri-contusional areas from further injury that could be partially explained by oscillation-induced increase in vascular wall shear stress that plays a universal role in maintaining the integrity of the endothelium that lines the inner vascular wall52.Microvessel disruption plays a critical role in neuro-functional outcomes after TBI55. Recent studies from our lab30 and others have demonstrated that TNS can improve cerebral perfusion through the trigemino-cerebrovascular system. In the present study, we demonstrate that TNS-induced CBF oscillations at 0.1\u00a0Hz retains the improved CBF achieved after fluid resuscitation, leading to significantly improved neuronal function at 24\u00a0h after TBI\u2009+\u2009HS. The improved CBF that we observed in the animals that had received TNS-induced CBF oscillations is in agreement with previous reports of increased eNOS activity leading to improved CBF after TBI58. In addition, many reports have shown that iNOS inhibition strategies are neuro-functionally protective possibly by stabilizing macro- as well as microcirculation61. Our present results show that TNS-induced CBF oscillations also decreased iNOS expression. However, the exact mechanism of how CBF oscillations augment eNOS expression has not been elucidated. Further studies are necessary to explore this.Regulation of CBF is closely related to neurological function36. In this study, we show that brain tissue levels of TNF-\u03b1 and IL-6 in peri-contusional areas were dramatically increased in both DR and IR animals after TBI\u2009+\u2009HS. However, the TNS-induced low-frequency CBF oscillation group showed significantly decreased levels of both cytokines, when compared with the animals under similar (DR) or shorter (IR) periods of cerebral ischemia. Generally, it is thought that ischemia triggers the expression of proinflammatory cytokines, subsequently attracting leukocytes into ischemic sites via induction of intercellular adhesion molecule (ICAM)-mediated leukocyte and the adhesion of leukocytes to the luminal wall of microvessels63. Following adhesion, leukocytes migrate through the vessel wall into the brain parenchyma, triggering a major acute inflammatory response following brain injury68. We clearly demonstrate that TNS-induced low-frequency CBF oscillations significantly decreased iNOS expression, TNF-\u03b1 and IL-6 levels, and expression of ICAM1 in peri-contusional tissue (data not shown) despite ischemic conditions as compared to IR animals. These results indicate that the low-frequency CBF oscillations delivered after TBI\u2009+\u2009HS may not only protect the cerebrovascular endothelium by increasing eNOS expression, but also help to decrease capillary plugging and leukocyte adhesion in the peri-contusional brain tissue, where capillary stasis occurs and exaggerates these phenomena. Our results emphasize the importance of low frequency CBF oscillations beyond simply improving cerebral perfusion and oxygenation after TBI\u2009+\u2009HS.Besides brain ischemia and hypoxia, TBI\u2009+\u2009HS also induces inflammatory cascades which are one of the key drivers of worsening neurological outcomes20. These physiologic maneuvers take advantage of the body\u2019s autonomic reactivity during periods of relative hypotension to enhance the body\u2019s tolerance to hypotension; however, the physiologic response can be highly variable and inconsistent between individuals70. In other words, not all subjects have the same degree of spontaneous CBF oscillations and therefore are not equally capable of tolerating hypotensive injury. Furthermore, these approaches would be difficult to apply to patients with TBI\u2009+\u2009HS. To overcome this, we demonstrate here that specific calibration of TNS parameters can consistently generate low-frequency oscillations in CBF, as seen in subjects that exhibit high tolerance to central hypovolemia. TNS is well-suited to induce CBF oscillations due to its rich network supplying a large portion of extrinsic neural supply to the blood vessels of the brain as well as its connections to various brainstem regions known to intrinsically modulate the cerebral microvasculature26. Proximal to the Virchow-Robin space, the trigeminal nervous network, innervates the much of the cerebral vasculature73. The results described herein show that TNS not only generated the controllable CBF oscillations in the targeted low frequency range, but also gradually improved the overall CBF amplitude. Given this evidence, it is reasonable to apply TNS as a tool to induce low-frequency CBF oscillations as a treatment strategy for TBI\u2009+\u2009HS.Maneuvers such as body tilting and inspiratory resistance breathing have been used to elicit spontaneous CBF oscillations74. Additionally, there is evidence to suggest that isoflurane augments eNOS protein expression in animals75. Furthermore, most clinical investigations of the physiology of spontaneous CBF oscillations have been performed in conscious subjects20. While these limitations were minimized by sham, delayed and immediate resuscitation experimental groups, the low frequency oscillation treatment of awake animals may represent another avenue of research to limit the effects of general anesthesia. Second, it should be noted that we proved our hypothesis that induced low-frequency CBF oscillations alleviate impaired cerebral microcirculation in peri-contusional brain tissue by using indirect measurements such as lesion volume, HIF-1\u03b1 and eNOS expression, neuroinflammation, etc. It would have been ideal if the cerebral microcirculation were assessed directly using a capillary anemometer76 or in vivo two-photon laser scanning microscopy77 over the peri-contusional cortex. Third, most findings discussed herein represent outcomes at 5\u00a0h and 24\u00a0h after TBI\u2009+\u2009HS. However, long-term outcomes significantly influence behavior and higher cognitive function and have significant impact in the recovery from trauma79. Future work should investigate whether the neuroprotective effects of induced CBF oscillations persist long-term as well. Fourth, only male rats of the similar age (9\u201311\u00a0weeks) were studied. The outcomes from male and female rats should be compared to investigate the potential sex and age differences of the treatment for TBI outcomes81. Finally, we have only studied outcomes with CBF oscillations at 0.1\u00a0Hz. In the future, we plan to study the effect of CBF oscillations at different frequencies.This study has some limitations. First, animals were maintained under general anesthesia throughout the duration of the experiment. It is known that inhaled anesthetics, isoflurane in particular, exhibit neuroprotective properties that can confound our resultsIn conclusion, our results demonstrate that TNS-induced low-frequency CBF oscillations at 0.1\u00a0Hz play a more significant role in preserving peri-contusional brain tissue than improving non-oscillatory cerebral perfusion or volume expansion in an animal model of severe TBI\u2009+\u2009HS. Our findings provide novel insights into the neuroprotective strategies employing low-frequency oscillations in CBF in injured brains to improve cerebral microcirculation and oxygenation. Although the experimental results shown in this study are promising, further studies are needed to understand the effects of CBF oscillations with different frequencies and to evaluate their effects on other organs."}
+{"text": "In the era of precision medicine, novel targets have emerged on the surface of cancer cells, which have been exploited for the purpose of radioligand therapy. However, there have been variations in the way these receptors are expressed, especially in prostate cancers and neuroendocrine tumors. This variable expression of receptors across the grades of cancers led to the concept of \u2018target heterogeneity\u2019, which has not just impacted therapeutic decisions but also their outcomes. Radiopharmaceuticals targeting receptors need to be used when there are specific indicators\u2014either clinical, radiological, or at molecular level\u2014warranting their use. In addition, response to these radioligands can be assessed using different techniques, whereby we can prognosticate further outcomes. We shall also discuss, in this review, the conventional as well as novel approaches of detecting heterogeneity in prostate cancers and neuroendocrine tumors.Tumor or target heterogeneity (TH) implies presence of variable cellular populations having different genomic characteristics within the same tumor, or in different tumor sites of the same patient. The challenge is to identify this heterogeneity, as it has emerged as the most common cause of \u2018treatment resistance\u2019, to current therapeutic agents. We have focused our discussion on \u2018Prostate Cancer\u2019 and \u2018Neuroendocrine Tumors\u2019, and looked at the established methods for demonstrating heterogeneity, each with its advantages and drawbacks. Also, the available theranostic radiotracers targeting PSMA and somatostatin receptors combined with targeted systemic agents, have been described. Lu-177 labeled PSMA and DOTATATE are the \u2018standard of care\u2019 radionuclide therapeutic tracers for management of progressive treatment-resistant prostate cancer and NET. These approved therapies have shown reasonable benefit in treatment outcome, with improvement in quality of life parameters. Various biomarkers and predictors of response to radionuclide therapies targeting TH which are currently available and those which can be explored have been elaborated in details. Imaging-based features using artificial intelligence (AI) need to be developed to further predict the presence of TH. Also, novel theranostic tools binding to newer targets on surface of cancer cell should be explored to overcome the treatment resistance to current treatment regimens. At last gleams of light have come, and I am almost convinced that species are not immutable, C. Darwin . What Charles Darwin wrote to Joseph Dalton Hooker holds a great degree of significance in the management of cancer patients. The transformation of normal cells of human beings into a cancerous lesion takes place over the course of several years. During this process of carcinogenesis, these cells adapt continuously to the inherent instinct of survival in adverse situations. Not surprisingly, they behave like a different species, and by the time they metastasize, they possess diverse dissimilar characters, termed as tumor heterogeneity. The reasons for heterogeneity of tumor clones amongst patients and within metastases can be several, guided primarily through activated and deactivated genes and genomes, either due to intrinsic programming or through external therapeutic pressure. This had led to a paradigm shift in the management of cancers i.e., from blanket treatment with \u2018nonspecific\u2019 chemotherapy to exploring treatment options for targeting cancer cells specifically and tailored according to the need of a patient . Radioligand therapy (RLT) is one such promising treatment option, wherein therapeutic alpha, beta, or electron ray emitting radiopharmaceuticals bind to specific receptors or antigens on tumor cell surfaces, thereby producing direct tumoricidal action with minimal/manageable side effects and toxicity. The entire success of these therapies and their position in the current treatment algorithm of respective cancers depend on the principles of good patient selection, robust imaging biomarkers for response assessment, and its impact on quality of life parameters . LikewisThe biggest challenge in the treatment of cancers is the development of resistance to therapies. This ability of cancer to adapt to pharmacologic pressures can be described in terms of tumor evolution and stems from its intrinsic diversity or heterogeneity. Multi-region sequencing is one of the techniques to study tumor evolution, which involves parallel analysis of tissue derived from different regions of a single neoplastic mass, and from distinct metastatic lesions from the same patient . Clonal Tumor or target heterogeneity refers to the coexistence of cellular populations bearing different genetic or epigenetic alterations within the same lesion, or in different lesions of the same patient. Intratumor heterogeneity is characterized by its dynamic changes. Tumor initiation and progression are generated from stochastic to sequential mutations that contribute to subsequent clonal expansion and intratumor heterogeneity . TherefoAs the cancer transforms or evolves from a low grade to intermediate to high grade, the cell population undergoes transformation. This has been the most significant hallmark of cancers, which has led to development of grade-specific treatment strategies . Well-diAs the grade of cancer progresses, the approach needs to be changed, and it is not often that a treating physician recognizes this grade progression. Often, it is the imaging-based progression that detects this or an increase in circulating biomarkers, and further provides a target for re-biopsy, following which there is pathological and molecular evidence of heterogeneity as a possible explanation for disease worsening. In the context of PRRT, Ki-67 remains the strongest predictor of prognosis, as has been demonstrated in patients with NET G1 and low G2 (3\u201310%) range showing significantly improved PFS and OS compared to higher proliferating tumors. Several previous studies have been constructed based on Ki-67 cutoff thresholds and NET grade was used for its prognostic impact as stratification factor. This has also entered recommendations of treatment strategies in international guidelines, e.g., the guidelines of European Neuroendocrine Tumor Society (ENETS) and the North American Neuroendocrine Tumors Society (NANETS) are mostly centered around Ki-67 ,15. EvenBiomarkers include tools and technologies that can facilitate the diagnosis, cause, progression, or regression, prediction of treatment of disease or reflect tumor burden. In general, biological markers (biomarkers) are considered \u2018cellular, biochemical or molecular alterations that are measurable in biological media such as human tissues, cells, or fluids\u2019. The progress and challenges presented by these biomarkers assume a special relevance given the heterogeneity of the neoplasia and diverse anatomical and cellular origins. As a consequence, these tumors produce a wide range of measurable active and inactive products and reflect a broad spectrum of tumor biological behavior. In neuroendocrine tumors, plasma chromogranin A (CgA) is one of the most commonly evaluated biomarkers in patients with neuroendocrine tumors. The sensitivity is around 70 percent but highly variable depending on the used assays. The European Society for Medical Oncology (ESMO) and ENETS guidelines recommends complementing imaging procedures with plasma CgA measurement at baseline and for monitoring during treatment and follow-up of patients with GEP-NETs if elevated at baseline . The pro177Lu-PSMA trial, Hofman et al. [Even today, Krennings score has been used as a point of reference for selecting patients for PRRT . The NETn et al.  performen et al. . Thus, tSchmidkonz et al. , in a stLiquid biopsies, in which DNA sequencing can be performed on tumor components that are found circulating in the blood of cancer patients (including circulating tumor cells and cell-free circulating tumor DNA) have rapidly gained popularity in the past couple of years. These have given us a good opportunity to assess evolving tumor heterogeneity in real-time. These assays have proved to be highly sensitive and specific, with a high degree of concordance with tissue biopsy, they can identify both clonal and subclonal mutations, and they can detect resistance much earlier than radiographic imaging, which could permit earlier intervention, especially in lung cancer and hematolymphoid malignancies ,33. The The current Delphic consensus is that an accurate circulating biomarker that captures the biological activity of a NET and predicts its clinical behavior would provide an optimal method for the early detection of disease progression . The NETKd) in the subnanomolar to low nanomolar range. The ideal affinity for a radioligand depends on the expression level of the target receptor and should be at least 5- to 10-fold higher than the receptor expression (Bmax). High selectivity for its target is also required, preferably 100-fold less affinity for any other binding site which is expressed in the same level.A radioligand is made of two parts: a ligand, which can find cancer cells that have a particular surface molecule, and a radioisotope, which emits therapeutic radiation to kill these cells . The radMoreover, the target-dependent model of radioligand therapy is the basic mechanism of localization. However, it has been seen that not all patients show response to treatment in spite of having the required number of receptors for binding of radioligands. Cancer cells change their responsiveness to drugs by changing their interaction with the surroundings. Earlier studies focused mainly on the cancer cell itself rather than on the interactions between the cancer cells and their surroundings. However, the role of tumor microenvironment (TME) in tumor progression and drug efficacy has recently attracted much attention. TME is the earliest determinant of ligand binding, and if multiple factors within the cancer cell such as immune response, hypoxic factors, etc., are not conductive to action of the protein\u2013radionuclide complex, the further action is hampered, thereby affecting the therapeutic efficacy. Once the TME is favorable, the further course of action of radioligand is then determined by the physicochemical factors such as biological t1/2 and receptor density. This is a dynamic temporal process, as shown in In addition to the aforementioned factors, radioligand efficacy and toxicity also show a temporal relationship. Response of radioligand therapy is generally not dose dependent, is non-linear, and is delayed, sometimes manifesting itself 1\u20132 years after the last treatment cycle. On the other hand, the therapeutic pressure on the tumor biology is also non-linear. During treatment cycles, genetic alterations and the presence of different clones influences the degree of expression of targets, thereby directly influencing treatment efficacy.Radioligand therapy (RLT) focuses on targeting specific receptors on the surface of cancer cells. As a cancer progresses, there is an inherent heterogeneity that sets in and may lead to switching on and off of receptors. Selective receptor activation with changing tumor grade needs to be established objectively. This is possible with molecular imaging techniques; wherein receptor-specific radiopharmaceuticals provide us information about the degree of receptor expression. This receptor map can be further used as a guide for planning therapy using the same ligand which was used for imaging, by labeling it with a therapeutic radionuclide or, in some cases, targeted pharmacologic or chemotherapeutic agents can be used; this decision is based on the data supporting efficacy of therapy and toxicity profiles from the existing literature. Neuroendocrine tumors (NETs) include a heterogeneous group of malignancies arising in the diffuse neuroendocrine system and characterized by indolent growth. Complex interactions take place among the cellular components of the microenvironment of these tumors, and the recognition of the molecular mediators of their interplay and cross-talk is crucial to discovering novel therapeutic targets . This heRadioligand therapy (RLT) targeting the prostate-specific membrane antigen (PSMA) is an emerging treatment modality for advanced prostate cancer, but 50% of patients with PSMA-positive tumors experience treatment failure. In tumors with different levels of PSMA expression for varying fractions of PSMA positive cells, PSMA expression correlates with radioligand uptake and DNA damage and, thus, RLT efficacy . Intra- Theranostics is the concept of patient selection for targeted radionuclide therapy based on the imaging phenotype on a companion diagnostic scan. However, emergence of heterogeneity in receptor expression across tumor grades has posed an imminent challenge toward administration of treatments based on standard recommendations and guidelines. There is an \u2018unmet\u2019 need to assign and implement targeted biomarkers which cover the entire gamut of heterogeneity that is known in respective tumors. In addition, predictive biomarkers, algorithms, and tools are the need of the hour, considering the cost of treatment, high specificity, and toxicity profiles of the newer therapies. Although conventional biomarkers are still used in clinics, such as serum chromogranin, 5-HIAA and neuron-specific enolase for NET, and serum PSA for prostate cancer, these fall short when tumors with mixed cellular patterns are presented to outpatient departments. We would therefore prefer to illustrate the \u2018response predictors\u2019 based on the various modalities used to assess treatment response.Imaging has several major advantages in assessing tumor heterogeneity over random tissue sampling, especially in patients with multiple metastases. First, it allows a full 3D volume assessment of the tumor and the analysis of different metastases from a same organ or from different organs. Secondly, it allows a longitudinal analysis over time. Finally, imaging enables to assess heterogeneity between patients with similar tumors (interpatient heterogeneity) as well as heterogeneity between different tumors within individual patient (intertumor heterogeneity) and within each lesion (intratumor heterogeneity). The analysis of spatial variation in architecture and/or function by imaging can provide benefit over simple biomarkers commonly used such as tumor size and average density measurement.Due to their particular arterial supply, neuroendocrine liver metastases (NELM) are known to be hypervascular on arterial phase images and hypoattenuating on portal venous phase images in a majority of the patients (70\u201373%) ,51,52,53Vascular heterogeneity assessment is also a parameter of importance in selecting appropriate treatment of liver metastases. Indeed, intratumoral hypervascularization, defined as arterial contrast enhancement on imaging, has been shown to be a predictive factor of tumor response of hepatic intra-arterial therapy techniques such as transarterial chemoembolization (TACE) ,65. In aTumor cellularity heterogeneity can be assessed through imaging using diffusion weighted imaging (DWI) and the measured apparent diffusion coefficient (ADC), which can be performed quickly without need for the administration of contrast medium. Indeed, the diffusivity of water molecules is restricted in environments of high cellularity because this cellularity reduces the ratio of extracellular to intracellular space in a given area of tissue . Studies3 mm2/s was associated with a sensitivity of 100% and a specificity of 92% [On NETs, the addition of DWI sequences to morphological MRI revealed additional metastases and led to modifications of patient management. Adding DWI to standard liver MRI yielded additional findings for 45% of the patients with 1.78 times more new lesions, mainly infracentimetric; it induced a management change for 18% of the patients. DWI sequences added to whole-body MRI yielded additional findings for 71% of the patients, with 1.72 times more lesions, mainly infracentimetric, and induced a change in management for 19% of the patients [y of 92% .fast) and one representative of the tumor cellularity so-called slow apparent diffusion coefficient (Dslow). IVIM-DWI has been used for differentiation of high-grade pancreatic ductal adenocarcinoma [slow value and lower mean Dfast value in comparison to with pancreatic adenocarcinoma. Moreover, when Dslow and Dfast was combined, the specificity and sensitivity for differentiating high-grade pNENs from pancreatic adenocarcinoma were 77 and 100%, respectively. The translation of IVIM to clinical adoption requires DWI-MRI with shorter acquisition time, a consensus on the number and choice of b values and requirements for a sufficient signal-to-noise ratio level for accurate and reproducible post-processing.Another way to assess tumor cellularity in combination with tumor perfusion on MR imaging is the intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI). First described in 1986 by Le Bihan et al. in neurologic disorders, IVIM is based on the fact that blood flow in capillaries mimics a diffusion process and impact diffusion MRI measurements . Hence, arcinoma . It was Intratumor heterogeneity is near-ubiquitous in malignant tumors but varies between cancer and patients . QualitaOnly few papers have addressed the usefulness of texture analysis and radiomics in NETs. Most of them focused on tumor grade prediction in pNEN ,82,83,84Another well-known cause of heterogeneity of NENs is the tumor growth. Tumor growth is strongly correlated with the tumor proliferation index marker Ki-67, coming from the histopathological analysis of biopsy samples or surgical specimen, with low-Ki-67 tumors considered as slower-growing tumors compared to high-Ki-67 ones. However, this dichotomization between low-grade slow-growing and high-grade fast-growing tumors is not absolute since some histologic low-grade tumors may behave more like advanced progressive carcinomas. Moreover, grade 2 NEN tumors represent a very heterogeneous group of tumors with different growing profiles and aggressiveness potentials. Finally, tumors of different grades can be present in a NET patient at the same time. In addition to radionuclide imaging, conventional imaging has an important role in assessing tumor proliferation and potential heterogeneity between metastatic sites and between metastatic lesions.In the past, several studies in metastatic GEP tumors showed a significant correlation between the tumor slope, assessed by tumor size measurement on consecutive CT examinations, and the patient outcome ,87,88. IPatients with prostate cancer are a heterogeneous group with different morbidity and mortality rates. Even with therapy, a significant proportion of patients show biochemical failure and subsequent metastatic progression, suggesting that additional strategies for personalized disease management are urgently needed. Intratumor heterogeneity (ITH) is considered to be one of the most important drivers of progression and resistance to therapy . The hetThe applications for radiomics in prostate cancer ,97,98,99For NETs, MRI has been less frequently used for radiomics studies and has focused mainly on grading. In contrast to prostate cancer, MRI radiomics have been also applied to metastases and not only primary tumors. In general, radiomics offers a cost-effective, non-invasive, and high-throughput approach in the analysis of image data, especially on MRI, which can lead to improved tumor detection and personalized treatment.The current landscape of theranostics and precision medicine revolves around identifying \u2018targets\u2019 which can be harnessed for imaging as well as therapy; its earliest example being use of iodine-131 for imaging and treatment of differentiated thyroid cancer. In times to follow, with the development of peptides, these sophisticated targets were used for neuroendocrine tumors and prostate cancer. However, resistance to these regimes have forced us to look at the tumor \u2018territory\u2019 from a different perspective. There are multiple pathways at play, and the need of the hour is to have a multi-pronged approach to overcome resistance. As illustrated in Apart from utilizing the unique capability of PET tracers to map different receptors and metabolic/genetic pathways of tumors and their environment, there is also an urgent need for using state of the art tumor segmentation software for objectifying tumor heterogeneity. Khurshid et al. have shown the possibility of analyzing spatial heterogeneity of PSMA expression on mCRPC patients referred for Lu-177 PSMA therapy. A total of 328 bone, liver, and lymph node lesions from pretherapeutic PET/CT scans of 70 patients were analyzed using Interview Fusion Workstation . The authors evaluated 5 heterogeneity parameters including entropy, contrast, size variation, homogeneity, and COV. The results were compared with change in PSA after RLT. Although not remarkably high, an area under curve of 0.695/0.683 for entropy/homogeneity showed promise for pre therapy image-based parameters for predicting response to RLT . Similar"}
+{"text": "Following the publication of this article , concernIn the Fig 2A Frontal cortex Homer1 panel, there appears to be a horizontal discontinuity in the background above the bands in lanes 1 and 2, as well as horizontal and vertical discontinuities around the top band in lane 4.The band in the fourth lane of the Fig 2A Frontal cortex mGluR1 panel appears similar to the band in the first lane of the Fig 5A Frontal cortex mGluR1 panel.The bands in lanes 2 and 3 of the Fig 2A Hippocampus mGluR1 panel appear similar to the bands in the Fig 5A Hippocampus mGluR1 panel.The corresponding author disagrees with the concerns raised with Figs 2 and 5. Regarding the irregularities in the Fig 2A Homer 1 panel, the corresponding author suggests that the observed irregularities are likely the result of image artifacts or experimental artifacts such as reagent remnants or patches intrinsic to the membrane. Furthermore, the corresponding author stated that the mGluR1 panels presented in Figs 2A and 5A were obtained from separate blots.The corresponding author provided image data to support their published result in this  and othePLOS ONE Editors retract this article.The data and comments provided to PLOS did not resolve the concerns about the integrity and reliability of the reported data. In light of these issues, the HYW did not agree with the retraction and stands by the article\u2019s findings. KB, RP, SKG, MW, and EF either did not respond directly or could not be reached."}
+{"text": "P\u2009=\u20090.005) to discuss the impact of personal/genetic makeup on medication response with providers, and Black patients reported initiating such discussions much less frequently . Opportunities exist for enhanced communication with underrepresented patients around personalized care. Tailored communication strategies and development of support tools employed in diverse healthcare settings may facilitate pharmacogenomically guided medication treatment that equitably benefits minority patient populations.Within an institutional pharmacogenomics implementation program, we surveyed 463 outpatients completing preemptive pharmacogenomic testing whose genetic results were available to providers for guiding medication treatment. We compared views and experiences from self-reported White and Black patients, including education level as a covariate across analyses. Black patients were less confident about whether their providers made personalized treatment decisions, and overwhelmingly wanted a greater role for their genetic information in clinical care. Both groups similarly reported that providers asked their opinions regarding medication changes, but White patients were more likely (59% vs. 49%,  Pharmacogenomics uses an individual\u2019s unique genetic makeup to assess their potential response to medication treatment, and such tailoring of healthcare delivery is one aspect of modern personalized care. Patient sense of personalized care is a dimension included in existing doctor\u2013patient relationship measurement tools6. These and other patient-reported measures have been used to assess quality of care8, and they are increasingly becoming the focus of national health insurance programs like Medicare and Medicaid, which serve high-risk and vulnerable populations9. Pharmacogenomics has been shown to have a significant positive effect on patient perceptions of personalized care and other dimensions of the doctor\u2013patient relationship10. Evaluating patients\u2019 experiences with pharmacogenomics as a part of their medical care is critical to determining the clinical utility of genomic medicine.Pharmacogenomic testing is increasingly being incorporated into clinical care as a means to improve drug prescribing, reduce drug inefficacy, and avoid adverse drug events 11. Similar to other areas of care delivery, patients also expressed a desire for physicians to show personal attention by taking time to listen and discuss pharmacogenomic considerations with them11. Pharmacogenomic testing may change patient views about the role of genetics in their medical care, and these shifts in perceptions following genotyping might relate to aspects of the patient\u2013provider relationship. One study found that patients felt pharmacogenomic testing offered insights to their physicians on dosing12. Other studies demonstrated that patients\u2019 perceptions of receiving personalized care were higher after physicians used pharmacogenomics information to guide medication changes10 and that use of genomic information during prescribing increased patient\u2013provider communication alongside patient recall of medication changes made during clinical visits13. Patients also reported decreases in concerns about medications and experiencing greater confidence about taking medications following pharmacogenomics testing12.Patient views while receiving pharmacogenomically guided care demonstrate an understanding that pharmacogenomics can inform prescribing and help distinguish problematic prescriptions15. African Americans, who are at greater risk for experiencing health disparities17 have been largely underrepresented in pharmacogenomic studies18. Though less likely to be included and participate in pharmacogenomic implementation studies, African American, or Black, patients have focused more on the positive benefits of personalized medicine  than White patients19. A study found no differences between Whites and Blacks in their perceived benefits of personalized medicine, but, similar to other research, it showed variation between racial groups in concerns about the use of personalized medicine, with Blacks expressing greater concerns than Whites about privacy and discrimination based on the use of genetic information22. Communication is often overlooked when new approaches to personalized care are adopted. Monitoring the impact of emerging technologies on health communication within clinical care may be specifically relevant for improving pharmacogenomics care delivery to minority patients as evidence has shown that minorities, patients of poor health status, patients with less than a high-school education, and older patients rate their visits with physicians as less participatory17.Despite these seemingly positive implications, public willingness to participate in genetic testing to inform medical care and views about pharmacogenomics use in clinical settings varies across demographic groupsIn this study, we aimed to explore views and perceptions of care received among genotyped White and Black patients participating in a large institutional pharmacogenomic implementation program. We hypothesized that patients\u2019 attitudes and perceptions about pharmacogenomics with respect to their medical care would significantly differ based on self-reported race. We particularly focused on self-reported race to define the populations in our study as self-identified race is used to direct pharmacogenomic clinical guidelines as well as clinical decision-making more generally in healthcare settings. Our study provides the perspectives of African American patients enrolled in a pharmacogenomic implementation program, whose views to date have not been deeply considered within pharmacogenomics implementation studies. Our primary objective was to identify potential gaps in patient perspectives that might guide how to best tailor pharmacogenomics implementation into clinical care for African Americans at greater risk for health disparities.Patient characteristics are summarized in Table White and Black patients reported exceedingly high levels of satisfaction with health care providers participating in the pharmacogenomics clinical study with almost all (99%) patients from both self-reported racial groups indicating being very satisfied/somewhat satisfied with their clinical visits Table . More thP\u2009=\u20090.01). No significant differences between patients\u2019 responses about the use of \u201cpersonalized medicine\u201d remained when comparisons were performed between aggregate groups differentiated by educational attainment alone (high school or less/some college vs. college graduate/advanced degree) instead of race . Black respondents in the aggregate and across education levels indicated similarly high levels of agreement that their personal genetic information should play a greater role in their healthcare provider\u2019s treatment decisions (89% for high school or less/some college and 91% for college graduate/advanced degree). Such consistency in patient views was not observed across education levels for White respondents. White patients with higher educational attainment (college graduate/advanced degree) were less likely than those with high school or less/some college to agree that their personal genetic information should play a greater role in their healthcare provider\u2019s treatment decisions for them . This finding of the more highly educated patient population agreeing less frequently that their personal genetic information should play a greater role in their healthcare provider\u2019s treatment decisions was similarly reflected in additional comparisons performed between total groups differing by educational attainment alone (high school or less/some college vs. college graduate/advanced degree) instead of race . Survey respondents expressed varying degrees of participation in the decision-making process about medication changes made during clinical visits . Of the respondents that recalled a medication change, White and Black respondents significantly differed in reporting a discussion surrounding personalized medicine aspects of the medication decision with their healthcare provider. Black patients (49%) were significantly less likely than White patients (59%) to recall this discussion taking place, and Black patients were nearly three times more likely than White patients to be unsure whether they had this discussion with their providers . Although the majority of patients from both racial groups indicated that, if a personalized medication discussion occurred their provider initiated that conversation about individual factors in regard to medication changes, Black patients reported initiating these discussions much less frequently than White patients . Notably, not a single Black respondent with lower education attainment (high school or less/some college) reported initiating a discussion about personalized medicine with their provider. In subsequent analyses where survey responses were primarily stratified by educational attainment (high school or less/some college vs. college graduate/advanced degree) instead of race, racial differences persisted  on medication response with their provider, while Black patients reported initiating these discussions far less frequently. In fact, none of the self-reported lower educational attainment Black respondents in this study reported initiating such a discussion about personalized medicine with their provider.13. The need for\u2014and potential differential impact of\u2014such discussions considering a patient\u2019s race is a previously unappreciated aspect of this current work. Utilizing patient and physician \u201cpairs\u201d  was an important feature of our pharmacogenomics model, with the expectation that it would lead to joint patient\u2013provider decision-making, rather than the physician interpreting the information alone. Our results support this expected outcome as more than half of White and Black patients reported being asked their opinion about medication changes during clinical visits, with 40% reporting being asked their opinion and making the decision together with their provider.Together, our results suggest an opportunity for enhanced patient\u2013provider communication, especially for minority patients, around the role of genetic results during prescribing. This recapitulates findings from our own prior studies, which have demonstrated that the patient\u2013provider relationship is critical to communication about pharmacogenomics23 and even less equipped to adjust communication regarding pharmacogenomic information to underrepresented patient populations. As electronic patient portals evolve and patient access to that information technology expands, it is likely that patient demand will increase for using this communication medium to solicit consultation from providers about pharmacogenomics. Our results suggest that Black patients are currently not initiating these discussions with providers during health encounters. Further evaluation is needed to explain this lack of reported initiation and how those factors might bear upon pharmacogenomics implementation within underrepresented patient populations where these electronic tools are rapidly being incorporated into care delivery.Most genomic testing systems within US healthcare settings use provider-facing results portals  to report results, thus (appropriately) requiring that communication about pharmacogenomic test results flows from provider to patient. Our implementation model was the same in this study . This amplifies the provider\u2019s role as a pivotal gatekeeper of health information, especially pharmacogenomic risk information. Providers may be unprepared for the routine use of pharmacogenetic testing for clinical decision-making25. Our results similarly suggested that Black patients rarely initiated discussions regarding personalized medicine. Prior research also showed that racial minorities and patients with lower education lacked access to online patient portals or displayed limited use when they were available26. Few interventions exist that can simultaneously train patients to engage more fully in the healthcare process and give providers the skills needed to activate and promote patient engagement in the care dialogue17. These ideas illuminate the need for additional attention to developing racially and culturally sensitive tools to educate patients about genetic risks for suboptimal drug responses28.Given the significance of patient\u2013provider communication in influencing patient behaviors and outcomes, tailored communication strategies may need to be developed and employed which address Black patients\u2019 perceptions of receiving personalized treatments and help with the interpretation of pharmacogenomic information by providers for minorities and less educated patients. Prior studies evaluating patient engagement found that Blacks experience greater verbal passivity with physicians and lower levels of patient-centered communication compared to Whites and patients with higher educational attainment29. We recognize the differential role that education can serve as a more powerful determinant of health behaviors and outcomes for certain racial/ethnic groups than for others30. Education has also been associated with health literacy and understanding PGx test results32. Health literacy is defined by the Institute of Medicine (IOM) as the degree to which individuals can obtain, process, and understand the basic health information and services needed to make appropriate health decisions33. In our analysis, there was a larger representation of White patients with higher educational attainment (college graduate/advanced degree) compared to Black patients with a similar education level, replicating the education gradient frequently reported in the literature. Following stratification, we also observed a skewed distribution of gender across different education levels in both Black and White patient groups, illuminating the merit of further inquiry into the intersectionality of race and gender across educational backgrounds in influencing views and experiences with pharmacogenomics. The factors that make education influential in shaping health also intersect with race and gender, which influence social position. The intricacies of independent and/or interdependent contributions of these factors lack clarity and deserve to be actively pursued in future research.This study is unique in that successful recruitment of Black patients within our institutional PGx implementation program permitted the consideration of both race and education in our analysis, expanding upon the current literature often treating racial groups as monolithic34. While pharmacogenomic testing was provided as a part of the clinical study free of charge to patients and providers, education might influence various aspects of access to healthcare, care delivery, and health outcomes that could be reflected in perceptions of pharmacogenomics.In terms of thinking about whether personal genetic information should play a greater role in their provider\u2019s treatment decisions, education appeared to (inversely) impact responses most among White patients. Given that educational attainment, which was associated with self-reported White race, can reflect the availability of greater resources and training to process health information, our finding that the more highly educated patient population agreed less frequently that their personal genetic information should play a greater role in their healthcare could represent more confident perceptions among the better educated that their genetic information is already being incorporated to maximally benefit them. In contrast, Black respondents across education levels indicated similarly high levels of agreement with this desire, suggesting that receptivity to personalized prescribing may be more broadly distributed across the Black patient population. Numerous mechanisms have been proposed through which education may shape views and perceptions of pharmacogenomic care. Prior research incorporating both race and education treat educational attainment as a proxy of socioeconomic status (SES) because it largely determines occupational status and income27. Separately, though the absence of measures evaluating trust in providers/healthcare system among minority patients may be a limitation of some survey instruments, our survey instrument specifically measured trust, and our previous analyses of this cohort have reported that trust, defined as a patient\u2019s belief that the provider had his or her best interest in mind when making clinical decisions, was generally high among our genotyped respondents10. Patients were asked to complete each survey immediately following their clinical visit, but in some instances survey responses were returned following a period of time after the visit, increasing the potential for recall bias. Finally, the total number of participating providers in this study was just under 20, so it is possible that some outcomes were driven by provider effects. However, our analyses did not account for physician clustering. Though providers included in the study were actively interested in pharmacogenomics, baseline provider knowledge about pharmacogenomics was modest, replicating the characteristics of more than 10,000 general US physicians13. Providers\u2019 accessing GPS results was used as a proxy for disclosure. Since providers could elect to view and/or use pharmacogenomic results in their prescribing decisions, survey responses likely reflected authentic \u201cpatient\u2013provider pair\u201d interactions. The study design permitting inclusion of multiple surveys per patient over time for a more longitudinal view of patient experiences helped normalize any potential effect of prior knowledge.This study had limitations. Our survey analysis includes responses from patients participating in one institutional pharmacogenomics implementation program at The University of Chicago Medical Center (UCMC) from 2012 to 2017, which may limit generalizability. While some changes to practice patterns may have occurred over time, dramatic changes since 2017 are unlikely as uptake of pharmacogenomics into regular clinical practice remains in the early stages at most academic centers and is not yet available in most community practices. Furthermore, the diffusion of pharmacogenomics into the healthcare delivered to minority patients has been limited. The diversity of our study cohort may strengthen the applicability of findings to future implementation in outpatient clinical settings and is specifically relevant to communication and patient experiences as pharmacogenomics is implemented into clinical care. The 1200 Patients Project incorporated patients receiving care from multiple types of outpatient providers across therapeutic areas, and UCMC\u2019s location on the South Side of Chicago facilitated robust enrollment of Black patients to the clinical study, thus, to our knowledge, compiling one of the largest collections of first-hand accounts from Black patients of their views and experiences with pharmacogenomics implementation in the literature. Importantly, rather than utilizing survey measures to assess patient health literacy, we incorporated direct measures of educational status into the current study. The inclusion of direct measures assessing understanding of genetic test results is an area we are now exploring in other studies, before and after direct-to-patient delivery of pharmacogenomic test results35. Future work should evaluate how point-of-care resources like the GPS, traditionally used for clinical decision support, might be leveraged to better equip both patients and providers with information and strategies that improve communication on how genetic results might influence medication treatment and response. Vigilance around the experiences of medically underserved populations will facilitate timely updating of approaches to deliver pharmacogenomically guided care that helps close communication gaps and incorporates patient views and preferences.As pharmacogenomics becomes more integrated into clinical practice and its use more widespread, its adoption is likely to be driven by both patients\u2019 and providers\u2019 understanding and interest in pharmacogenomic applications38. Patients and physicians were recruited into the study as pairs. Seventeen providers participated in this study, representing a diverse set of specialties across medicine . Patients were then recruited to the 1200 Patients Project if they were receiving care from one of the participating physicians. Eligibility criteria were previously described38. The 1200 Patients Project recruited a racial/ethnic patient population that was approximately 60% White, 30% Black, and 10% Other39, reflecting the distribution of racial/ethnic populations in the greater Chicago city area40. While recruited patients were not given a formal education session on pharmacogenomics prior to survey completion, all patients received information describing the possible personalized care delivered in the study at the time of consent. These materials described personalized care as personal genetic information made available (with their permission) to their provider to enable specific medication treatment decisions for them, which aligns with our conceptualization of personalized care for the current study. Enrolled patients were genotyped across a broad panel of potentially actionable germline markers related to medication prescribing, with the pharmacogenomic information specific to each patient then shared with the patient\u2019s physician through an online clinical decision support tool, the Genomic Prescribing System (GPS)38. The GPS provides patient-specific pharmacogenomic information at the point-of-care, and the medications included in the GPS with actionable pharmacogenomic information have been previously reported36. Our prior findings from the 1200 Patients Project indicated that 34% of all medications on patients\u2019 active drug lists had associated pharmacogenomic results indicating genomically concordant medications (low-risk of toxicity and/or high chance for favorable response), genomically cautionary , or genomically unfavorable . A large majority (61%) of provider decisions to stop medications at clinic visits were influenced by pharmacogenomic recommendations. Relatedly, for new prescriptions, the decision to prescribe the chosen medication was affirmatively influenced by favorable pharmacogenomic information in half of all cases39.The 1200 Patients Project offered broad, preemptive pharmacogenomic testing to a diverse group of 1200 adults receiving outpatient subspecialty and primary care in order to assess the potential feasibility and utility of personalized medicine based on pharmacogenomics10. This study analyzed survey responses from self-reported White and Black patients enrolled within the 1200 Patients Project who completed genetic testing, were seen in follow-up, and experienced at least one clinical visit with a participating provider with access to the GPS clinical decision support tool during the study period from October 2012 to May 2017. Our final sample of survey responses included 463 participating patients: 332 patients who self-identified their race as White and 131 patients who self-identified their race as Black. A small number of patients (<12%) who identified as other races  were excluded from the present analysis.The study setting consisted of clinical visits to outpatient healthcare providers. Following clinical visits, patients were issued surveys for completion and return to the research team. Indicators for issuing a survey to a patient in the 1200 Patients Project following a clinical visit have been previously describedPatients enrolled in the 1200 Patients Project were given anonymous surveys to complete after clinical visits with participating providers. At each clinical visit, providers could access patient pharmacogenomic results via the GPS, but the decision to view and/or use genetic information in their prescribing was at the providers\u2019 discretion. Research staff independent of the providers gave surveys to patients after they saw their provider to complete before leaving clinic. If patients were unable to complete the surveys in the clinic, they were mailed the survey within a week of the patient\u2019s visit. Over 95% of the surveys included in this analysis were completed immediately post visit, in the clinic. Less than 5% of all surveys received were by mail reporting.10. Development and pre-testing of the instrument was performed with the University of Chicago Survey Lab and members of the University of Chicago Center for Health and the Social Sciences, and with input from additional external reviewers. Pre-testing of drafts of the instrument was then performed institutionally by members of the research team, with iteration until the final version was achieved. The final survey instrument has been previously published and data/findings from its use have been previously reported for other cohort analyses13. For the current study, we specifically focused on the survey items surrounding patient perceptions of pharmacogenomic care and views regarding the use of genetic information to guide medication treatment.The patient survey instrument was designed for evaluating five dimensions of the doctor\u2013patient relationship, including trust, privacy, empathy, medical decision-making, and personalized care, as previously described in detail13, so we predicted a similar impact could be reflected in patient perceptions of their numerous visits during the study. The median number of clinic visits was 2 across all patients, and those with more than 1 visit averaged a visit approximately every 8 months. Since provider visits triggered survey administration, these figures also indicate how far apart surveys were administered.Collectively, our final cohort of 463 White and Black patients completed 1055 surveys meeting this criteria , we did41. Frameworks developed to foster health equity incorporate these factors in order to integrate context and promote the equitable diffusion of innovations42. This study included education as a covariate and performed secondary analyses of primary race-based comparisons by educational attainment to further our understanding of the respective roles of race and education. After performing the primary race-comparison analyses, we re-performed the analyses stratified by educational attainment within each self-reported racial group. For these analyses, educational level was categorized in a binary fashion: (1) \u201clower educational attainment\u201d included patients reporting having completed high school or less, or some college; and (2) \u201chigher educational attainment\u201d included patients reporting being a college graduate or having an advanced degree. To further delineate the roles of race and education in our study, we also conducted sensitivity analyses of survey measures by also comparing results primarily by educational attainment, and, then, performing secondary analyses stratified by self-reported race within each educational attainment group (see online Supplement/Supplementary Information). Finally, as the GPS results were disclosed to patients at the discretion of the physician, we also assessed whether providers differentially accessed GPS results at health visits for Black and White patients within our final study sample.While multiple theories have been developed to explain the crystallization of views/attitudes about health that relate to individual health behaviors, we undertook this analysis with education as a key covariate because it reflects the availability of resources , the ability to process various types of information, and multiple socioeconomic indicators, including social and cultural factorsThe 1200 Patients Project was an IRB-approved clinical study open at The University of Chicago , and all participants signed written informed consent.Further information on research design is available in the Supplementary information.Reporting summary."}
+{"text": "Assuming that the amount of Fe elusion is equal to that of PGMs/Mo substitution, the substitution efficiency is estimated to be 39.0% for Ru, 47.8% for Rh, 87% for Pd, and 17.1% for Mo6+. This implies that 0.13\u00a0g of Ru, 0.16\u00a0g of Rh, 0.30\u00a0g of Pd, and 0.107\u00a0g of Mo can be recovered by using 1\u00a0g PBNPs with a chemical form of KFe(III)[Fe(II)(CN)6].We have examined the uptake mechanisms of platinum-group-metals (PGMs) and molybdenum (Mo) ions into Prussian blue nanoparticles (PBNPs) in a nitric acid solution for 24-h sorption test, using inductively coupled plasma atomic emission spectroscopy, powder XRD, and UV\u2013Vis-NIR spectroscopy in combination with first-principles calculations, and revealed that the Ru Plutonium Uranium Redox EXtraction) method in order to re-use them as new fuels, the high-level radioactive liquid wastes (HLLW) are vitrified and geologically disposed3. In the vitrification processes, platinum-group metals  and molybdenum (Mo) cause serious problems: (1) PGMs tend to settle on the sidewall surface of a glass melter, giving rise to an inhomogeneous thermal distribution of the melter, and (2) Mo forms low-viscosity fluid compounds so-called \u201cyellow phase\u201d in the vitrified object5. These issues degrade the quality and stability of the vitrified objects due to heterogeneity, and increase both disposal spaces and costs in conjunction with additional vitrified rods produced by flushing the glass melter. Considering that Ru, Rh, and Pd with an amount of 2.09, 0.36, and 1.20\u00a0kg, respectively, are generated in 1 t of used nuclear fuels  for light-water reactors (those generated amounts will increase by 1.5\u20132 times for fast breeder reactors), it is useful to recover PGMs from HLLW not only for the disposal of N-wastes but also for the recycling of precious metals from our alternative perspective. It is, of course, noted that it takes few decades to reduce their radioactive levels below safety standard except 107Pd long-lifetime nuclide  that is planned to be deleted using an extinction process with fast neutrons. In a similar manner to PGMs, Mo is also used both as Mo-Cu alloys and MoS2 materials for electronic and car industries, respectively, and also used as an alternative material for tungsten (W) because of its lower price.Recovery of precious metals from both nuclear wastes (N-wastes) and electronic wastes (E-wastes) plays one of key roles in solving energy and environmental issues in order to maintain our sustainable developing society. For the former one (N-wastes), the spent nuclear fuel generated from the power plants are vitrified at the reprocessing plant. After separating uranium (U) and plutonium (Pu) from the spent fuels by using the PUREX 6. Although the precious elements are not uniformly dotted over the world in nature, the much amount of them has, however, been stored in E-wastes so far. For example, the amount of Au contained in 1 t of mobile phones is 300\u2013400\u00a0g, which is much higher by 10\u201380 times than that in 1 t of natural ore. The other elements have a similar situation to Au. Consequently, the recovery of those precious elements from E-wastes is much more effective and efficient when compared to their collections from natural ore.For the latter case (E-wastes), the abundance of precious metals  is much smaller by 108. Since MHCFs have a simple cubic lattice structure like a jungle gym  and trivalent (M3+) metal cations are cross-linked with each other via cyano-group anion (CN\u2013), and exhibit many fascinating features11, they have been extensively investigated from viewpoints of both scientific and industrial aspects18. Recently, PB (FeHCF) has been applied to remove radioactive cesium-134 (134Cs) and 137Cs elements from contaminated soils caused by Fukushima nuclear plant accident in 201123, because PB has the jungle-gym cubic structure with a 0.5\u00a0nm-interstitial site , which is one of metal hexacyanoferrates (MHCFs), as a sorbent2+ ion is incorporated into PBNPs by substitution with Fe2+ ion of the PB framework with maintaining the crystal structure before and after Pd sorption, and the substitution efficiency was estimated to be 87% per PB unit cell24. This implies that 0.30\u00a0g Pd can be recovered by using 1\u00a0g\u00a0PB with a chemical form of KFe(III)[Fe(II)(CN)6].More recently, we have investigated the uptake mechanism of Pd  ion into PB nanoparticles (PBNPs) in a nitric acid solution, and revealed that the PdIn the present study, we report here on the uptake characteristics of PBNPs for PGMs/Mo ions in a nitric acid solution as well as Pd ion. The uptake efficiency of PGMs/Mo into PBNPs and the elution efficiency of Fe from PBNPs were measured using inductively coupled plasma atomic emission spectroscopy (ICP-AES) before and after 24\u00a0h sorption test. We also examined changes in the structural and electronic properties of PBNPs before and after the sorption test, using powder x-ray diffraction (XRD) and ultraviolet\u2013visible-Near IR (UV\u2013vis-NIR) spectroscopy, in combination with first-principles calculations based on density functional theory. Furthermore, in order to understand the difference in the sorption efficiency among PGMs/Mo ions, we estimated the surface adsorption, diffusion, and substitution energies when PGMs/Mo ions are incorporated into PB unit cell, using the first-principles calculations.4[Fe(CN)6]\u00b73H2O, KANTO CHEMICAL) with Fe(III) nitrate \u00b79H2O, WAKO) in aqueous solution. PB precipitates thus formed were rinsed with ultrapure water after centrifugation (3000\u00a0rpm), which was performed for five times. Thereafter, PBNPs were dried at 75\u00a0\u00b0C for 12\u00a0h and thereafter kept in the vacuum desiccator for 3\u00a0h. We already confirmed the structural and physicochemical characteristics of PBNPs used in the present work elsewhere24.PBNPs were synthesized by mixing potassium hexacyanoferrate (II)  of PGMs/Mo ion in the supernatant liquid was measured before  and after  the test, using ICP-AES , in order to estimate the sorption efficiency, [/Cinitial\u2009\u00d7\u2009100%], of PGMs/Mo ions into PBNPs. We also measured the concentration of Fe ion in the supernatant liquid after the sorption test, and estimated the elution efficiency of Fe ion when compared to the initial amount of PBNPs. Details of sorption test conditions have been described elsewhere25.Sorption test of PGMs/Mo ion (1\u00a0mM) for PBNPs (500\u00a0mg) were carried out in 1.5\u00a0M nitric acid solution (10\u00a0mL) upon shaking for 24\u00a0h. Subsequently, the mixtures were centrifuged to separate the PBNPs from the solution, and the concentration (Powder XRD patterns and UV\u2013vis-NIR diffuse reflectance spectra of the pristine and PGMs/Mo-sorbed PBNPs were measured using Rigaku RINT2200 (Cu K\u03b1) and Shimazu UV-2600 spectrometer, respectively. The diffuse reflectance spectra thus obtained were converted to the corresponding absorption spectra in terms of the Kubelka\u2013Munk conversion equation.27, because the present method has been already confirmed to reproduce the experimental absorption spectra of Fe, Co, and Ni ferrocyanides quantitatively, using Fe(II)M(III)(CN\u2013)116\u2013  cluster model28. 0 The multiplet energy levels and absorption spectra were calculated using Fe2+Fe3+(CN\u2013)116\u2013, MFe3+(CN\u2013)116\u2013, and Fe2+M(CN\u2013)116\u2013 cluster models   calculations. Details of the CI calculation method were described elsewhere27. As the active space for the CI calculations, all the electronic configurations of the d\u2013d transitions for Fe and PGMs/Mo ions were explicitly treated. On the other hand, the electronic configurations for the charge transfer (CT) transitions from Fe2+/M to M were considered up to two electron excitations. The oscillator strength of the electric dipole transitions averaged over all directions was obtained using the general equation expressing the electric dipole transition. Theoretical absorption spectra were obtained by convolution of the oscillator strength replaced with a 0.30\u00a0eV full-width-at-half-maximum (FWHM) Gaussian function.Theoretical absorption spectra of the pristine and PGMs/Mo-sorbed PBs were obtained using the relativistic configuration interaction (CI) method34 and QUANTUM-ESPRESSO36 based on DFT38. We adopted the Vanderbilt-type ultrasoft pseudopotentials39 throughout all the present calculations. The exchange\u2013correlation potential was considered using the GGA (PBE)40. The cut-off energy of the plane wave was 550\u00a0eV, and the Brillouin zone was sampled on the 2\u2009\u00d7\u20092\u2009\u00d7\u20092 and 4\u2009\u00d7\u20094\u2009\u00d7\u20091 Monkhorst\u2013Pack grid41 for the unit cell and (100) surface models of PB, respectively.The surface adsorption, diffusion, and substitution energies of PGMs/Mo ions when incorporated into PBNPs were estimated using the CASTEP8Fe(II)8(CN)40 model  was evaluated using the following equation,The adsorption energy of PGMs/Mo ions on the (100) surface of PB were calculated using a Fe(III)see Fig.\u00a0 consisti42.Here, each term denotes the total energy of PGM/Mo-sorbed PBs, pristine PB, and PGMs/Mo themselves, respectively, which were calculated using CASTEP. The maximally-localized Wannier functions (MLWFs) of the C2p and N2p atomic orbitals (AOs) on the (100) surface of PB were obtained using Wannier90c site  method implemented in QUANTUM-ESPRESSO. A diffusion pathway for PGMs/Mo ions in the nanospace of PBNPs was considered to be a route from the center of the square made of the four Fe ions in the (100) plane to the same site of the adjacent (100) plane via the 4ES) of PGMs/Mo with Fe of PB was estimated for the unit cell model consisting of 60 atoms, which corresponds to 12.5% Fe ions substituted with PGMs/Mo ions. The ES was evaluated using the following equation,U method43, using CASTEP. The U value was set to be 7.0\u00a0eV for the high-spin (HS) state of Fe3+ (Ionic radius: 0.645\u00a0\u00c5 for six coordination number), 3.0\u00a0eV for the low-spin (LS) state of Fe2+ (Ionic radius: 0.61\u00a0\u00c5 for six coordination number), and 2.0\u00a0eV for the LS state of PGMs/Mo 46. All calculations in the present study were performed until the residual forces and stresses below 0.01\u00a0eV/\u00c5 and 0.02 GPa, respectively. A uniformed background charge, so called the Jellium model, was used to accommodate the non-neutral states.The substitution energy , 2.1\u00a0eV (intense), 3.1\u00a0eV (weak), and 5.0\u00a0eV (middle) originate from the charge-transfer (CT) transitions from Fe2+ to Fe3+, which correspond to peaks A, B, C, and D, respectively28. For Pd ion (right hand), the theoretical spectra of the Pd ion substituted with Fe2+ (c) well explain the experimental spectral change (red shift) when compared to the spectra of the Pd ion substituted with Fe3+ (d). This is consistent with the previous results obtained using CASTEP24. For Rh ion (right-middle hand), comparison in theoretical spectra between before (b) and after  Rh substitution indicates that spectra (d) obtained for Rh substituted with Fe3+ reasonably explain the experimental spectral change after Rh sorption test. Thus, it is suitable to be concluded that Rh ion is mainly substituted with Fe3+ ion. For Ru ion (left-middle hand), comparison in theoretical spectra between before (b) and after  Ru substitution indicates that spectra (d) obtained for Ru substituted with Fe3+ obviously explain the experimental spectral change after Ru sorption test, because no red-shift in spectra after Ru sorption test was observed experimentally. For Mo ion (left hand), since the experimental spectra changed toward both a lower and a higher energy region after Mo ion sorption, it is found from theoretical spectral changes before (b) and after  Mo substitution that Mo6+ ion is substituted with both Fe2+ and Fe3+ ions.Figure\u00a04+ and Rh3+ ions are substituted with Fe3+ ion, and Pd2+ ion is substituted with Fe2+ ion, whereas Mo6+ ion is substituted with both Fe2+ and Fe3+ ions.In summary, it is reasonably concluded from the results of Fig.\u00a024. Table 47 with a constant of 1.5, respectively. Here, the constant value means an area-weighted effective diameter along the direction of the diffraction vector. The results of Fig.\u00a050), whereas 10.21\u00a0\u00c5 for the PGM/Mo-sorbed PBNPs.Figure\u00a0entclass1pt{minimaentclass1pt{minimaentclass1pt{minima2+ ion (0.86\u00a0\u00c5)46 is larger than that of Fe2+ (0.61\u00a0\u00c5)46 and the substitution efficiency of Fe2+ with Pd2+ was 87.0% (Table 3+ ion (0.665\u00a0\u00c5)46 is larger than that of Fe3+ (0.645\u00a0\u00c5)46 to some extent, and also the substitution efficiency of Fe3+ with Rh3+ was 47.8%, thus the lattice constant was expanded effectively. On the contrary, for the Ru sorption, despite the ionic radius of Ru4+ ion (0.62\u00a0\u00c5)46 is smaller than that of Fe3+ (0.645\u00a0\u00c5) with 39.0% of the substitution efficiency of Fe3+ with Ru4+, the lattice was expanded in a similar manner to Pd ion sorption. This is presumably because the Coulomb repulsion between Ru4+ and Fe2+ is stronger than that between Fe3+ and Fe2+, resulting in the expansion of the lattice constant. In a similar manner for the Mo sorption, although the ionic radii of 0.59\u00a0\u00c5 for Mo6+ is smaller than that of Fe3+ (0.645\u00a0\u00c5) with 17.1% of the substitution efficiency of Fe2+/Fe3+ with Ru4+, a larger Coulomb repulsion between Mo6+ and Fe2+/Fe3+ stronger than that between Fe3+ and Fe2+ caused the expansion of the lattice constant, which is comparable to that for the PGMs. The reason why the lattice constant was expanded to be coincidently the same value after sorption of all PGMs/Mo ions is still unclear. It is necessary to be considered that the residual PGMs/Mo and Fe ions located in the nanospace of PB unit cell upon sorption play a role in expanding the lattice constant.For Pd ion sorption, since the ionic radius of Pd Fe2+ 0.6\u00a0\u00c546 and To discuss the elementary processes of PGMs/Mo when incorporated into PBNPs, we next examined (1) the adsorption energy of PGMs/Mo ions on the PB surface, (2) the diffusion energy of PGMs/Mo ions into the nanospace of PBNPs, and (3) the substitution energy of PGMs/Mo ions with Fe ion, using first-principles calculations based on DFT.Ead) of PGMs/Mo on the surface, and (c) the maximally-localized Wannier functions (MLWFs) of the C2p and N2p AOs for the CN group constructing the (100) surface. As shown in the side view of Fig.\u00a0\u2013 anion groups became stable energetically due to the attractive Coulomb interactions. The optimized structural coordination was summarized in Tables Ead on the (100) surface with respect to the PGM elements. Here, a lager positive value of Ead implies a more difficulty to be adsorbed on the surface. It is found that the Ead seems to increase non-linearly with the valence number of PGMs ions: Ead\u2009=\u20090\u00a0eV for Pd2+ ion, ca. 0.2\u00a0eV for Rh3+ ion, ca. 1.8\u00a0eV for Ru4+ ion, and ca. 3.2\u00a0eV for Mo6+. This is partly because the repulsive Coulomb interactions between the adsorbed PGMs/Mo ions and their surrounding Fe2+/Fe3+ ions become greater than the attractive ones between the adsorbed ions and their surrounding CN\u2013 groups as the valence number of the adsorbed PGM/Mo ions increases, and partly because the latter attractive interactions become greater to cause a large distortion of the lattice with increasing the valence number as well. In addition, as show in in Fig.\u00a0y and 2pz AOs of both C and N atoms are expanded within the (100) in-plane, the PGMs/Mo cations are easy to be trapped in the (100) in-plane. It is noted that the present study estimated the Ead in solid phase and in vacuum. For the practical HLLW system with metal ions in nitric acid solution, the metal ions are more easily transported to the PB surface via the solvent, and the electrostatic potential of the (100) surface should also be somewhat altered.We first discuss (1) the adsorption energy. Figure\u00a0c site is a saddle point for those metal ions. The reason behind the stabilization of the PGMs/Mo ions in the (100) in-plane is the same as for their surface adsorption. In addition, it can be said that the space of the 4c site (5\u00a0\u00c5) is too large for PGMs ions 45. Thus, the PGMs/Mo ions tend to be trapped at the (100) in-plane, where the substitution reaction between PGMs/Mo and Fe ions will take place.We next discuss (2) the diffusion of PGMs ions in the nanospace of PB unit cell, whose energy was calculated using the NEB method. Figure\u00a0ES) of PGMs/Mo ions with the Fe2+/Fe3+ ions of PB, which was estimated using the unit cell model containing 60 atoms  in Es between them. Although the results of Fig.\u00a03+ ion is substituted mainly with Fe3+ ion, Rh3+ ion would be substituted minorly with Fe2+ ion to some extent at temperatures around 353\u00a0K when applied to a practical HLLW containing the exothermic nuclides such as 137Cs and 90Sr. On the other hand, Mo6+ ion is preferable to be substituted with the Fe3+ site energetically, because the Coulomb repulsion between Mo6+ and the nearest surrounding Fe3+ ions for Mo6+ substitution with Fe2+ becomes much greater than that between Mo6+ and the nearest surrounding Fe2+ for Mo6+ substitution with Fe3+. However, comparison between the experimental and theoretical results  surface of PB, the diffusion in the nanospace of PB unit cell, and the substitution of PGMs ions with Fe ions. As summarized in Table 00 surfacThe findings in the present study provide us an important insight that these three processes mutually affect the sorption amount and the sorption efficiency, thus leading to develop a high-performance sorbent for recovery of rare metals not only from N-wastes but also from E-wastes.2+ and four Fe3+ atoms. Assuming that the amount of Fe elution is equal to that of PGMs/Mo substitution , the substitution efficiency was obtained to be 39.0% for Ru ion, 47.8% for Rh ion, 87.0% for Pd ion, and 17.1% (Fe2+ and Fe3+ for each) for Mo ion. This implies that 0.13\u00a0g of Ru, 0.16\u00a0g of Rh, 0.30\u00a0g of Pd, and 0.11\u00a0g of Mo can be recovered by using 1\u00a0g\u00a0PB with a chemical form of KFe(III)[Fe(II)(CN)6]. Furthermore, PBNPs were confirmed to exhibit several resistances against heat (up to 300\u00a0\u00b0C), nitric acid (up to 8\u00a0M), and \u03b3-ray radiation (up to 1000\u00a0kGy), thus indicating that PBNPs are practically used not only for disposal processes of N-wastes but also for recycle processes of E-wastes.As shown in Table 4+ and Pd2+ ions are incorporated into PBNPs by substitution with Fe3+ and Fe2+ ions of the PB framework, respectively, whereas the Rh3+ ion is incorporated into PBNPs by substitution mainly with Fe3+ and minorly with Fe2+ ion, and Mo6+ ion is incorporated into PBNPs by substitution with both Fe2+ and Fe3+ ions, with maintaining the crystal structure before and after the sorption test. Assuming that the amount of Fe elusion is equal to that of PGMs/Mo substitution, the substitution efficiency is estimated to be 39.0% for Ru, 47.8% for Rh, 87% for Pd, and 17.1% for Mo6+. This implies that 0.13\u00a0g of Ru, 0.16\u00a0g of Rh, 0.30\u00a0g of Pd, and 0.107\u00a0g of Mo can be recovered by using 1\u00a0g PBNPs with a chemical form of KFe(III)[Fe(II)(CN)6].We have examined the uptake mechanisms of platinum-group-metals (PGMs) and molybdenum (Mo) ions into PBNPs in a nitric acid solution for 24-h sorption test, using ICP-AES, powder XRD, and UV\u2013Vis-NIR spectroscopy in combination with first-principles calculations, and revealed that the RuSince PBNPs can be produced massively in liquid phase and exhibit nontoxic and stable up to 300\u00a0\u00b0C, they are well known to be used as pigments and paint color materials. Thus, the present findings demonstrate that PB  will be one of the hopeful candidates to develop the recycling of precious metals from N- and E-wastes when compared to conventional bio-based adsorbents/activated carbons.Supplementary Information."}
+{"text": "Selective outcome reporting and publication bias threaten the validity of systematic reviews and meta-analyses and can affect clinical decision-making. A rigorous method to evaluate the impact of this bias on the results of network meta-analyses of interventions is lacking. We present a tool to assess the Risk Of Bias due to Missing Evidence in Network meta-analysis (ROB-MEN).within-study assessment of bias) and the potential for unpublished studies (across-study assessment of bias). The second step combines the judgements about the risk of bias due to missing evidence in pairwise comparisons with (i) the contribution of direct comparisons to the network meta-analysis estimates, (ii) possible small-study effects evaluated by network meta-regression, and (iii) any bias from unobserved comparisons. Then, a level of \u201clow risk\u201d, \u201csome concerns\u201d, or \u201chigh risk\u201d for the bias due to missing evidence is assigned to each estimate, which is our tool\u2019s final output.ROB-MEN first evaluates the risk of bias due to missing evidence for each of the possible pairwise comparison that can be made between the interventions in the network. This step considers possible bias due to the presence of studies with unavailable results (We describe the methodology of ROB-MEN step-by-step using an illustrative example from a published NMA of non-diagnostic modalities for the detection of coronary artery disease in patients with low risk acute coronary syndrome. We also report a full application of the tool on a larger and more complex published network of 18 drugs from head-to-head studies for the acute treatment of adults with major depressive disorder.ROB-MEN is the first tool for evaluating the risk of bias due to missing evidence in network meta-analysis and applies to networks of all sizes and geometry. The use of ROB-MEN is facilitated by an R Shiny web application that produces the Pairwise Comparisons and ROB-MEN Table and is incorporated in the reporting bias domain of the CINeMA framework and software.The online version contains supplementary material available at 10.1186/s12916-021-02166-3. A challenging issue in evidence-based medicine is the bias introduced by the selective non-reporting of primary studies or results. Failure to report all findings can lead to results being missing from a meta-analysis. Either a whole study may remain unpublished, commonly referred to as \u2018publication bias\u2019, or specific results may not be reported in a publication, usually referred to as \u2018selective outcome reporting bias\u2019 or \u2018selective non-reporting of results\u2019.Several methods are available to investigate such bias in pairwise meta-analysis . These iNetwork meta-analysis extends pairwise meta-analysis to enable multiple treatments comparison by combining direct and indirect evidence within a network of randomised trials or other comparative studies. Several of the numerical approaches to evaluate bias developed for pairwise meta-analysis have been adapted to the network meta-analysis setting \u201315. StilTo address this gap, we developed the Risk Of Bias due to Missing Evidence in Network meta-analysis (ROB-MEN) tool, which incorporates qualitative and quantitative methods. We assume that investigators assembled studies into a coherent network according to a pre-specified protocol, checked the assumptions and deemed them plausible and used appropriate statistical methods to obtain relative treatment effects for pairs of interventions. Then, ROB-MEN can be used to assess the risk of bias due to missing evidence in each of the relative treatment effects estimated in network meta-analysis. We illustrate the ROB-MEN approach step by step using a network meta-analysis of non-invasive diagnostic tests for coronary artery disease . We alsoThe ROB-MEN tool was developed between April and November 2020 within the CINeMA framework to evaluate confidence in results from network meta-analysis , 19. TheWe outline the methodology using the example of a network of randomised controlled trials comparing non-invasive diagnostic strategies for the detection of coronary artery disease in patients presenting with symptoms suggestive of an acute coronary syndrome . The outp-values, small magnitudes of effect, or harmful effects. It can be due to two types of missing evidence, as described in the recently developed ROB-ME tool [within-study assessment of bias\u201d in the tool; (ii) studies that remain entirely unpublished and are not known to exist, referred to as \u201cacross-study assessment of bias\u201d  theIn network meta-analysis, estimates of treatment effects are derived by combining direct and indirect evidence. Direct evidence refers to evidence about pairs of treatments that have been directly compared within studies  facilitates the ROB-MEN process, including creating the two core tables, as described in Additional\u00a0file\u00a0Two tables that record the assessments for each pairwise comparison and each estimate are at the tool\u2019s core: the not observed among the included studies. The possible pairwise comparisons between the interventions involved in the network, that is, all combinations of two treatments, are organised into three groups:A.\u201cObserved for this outcome\u201d: the comparisons for which there is direct evidence contributing to the network meta-analysis for the current outcomeB.\u201cObserved for other outcomes\u201d: the pairwise comparisons for which there is direct evidence only for other outcomes in the systematic reviewC.\u201cUnobserved\u201d: the pairwise comparisons that have not been investigated in any of the identified studies in the systematic review.The assessment of bias due to missing evidence in all possible pairwise comparisons follows the ROB-ME tool for pairwise meta-analysis . Like ROThese groups constitute the rows of the Pairwise Comparisons Table for a specific outcome. Instructions for filling in the table are summarised in Additional\u00a0file\u00a0For each comparison, the first two columns report the total number of studies with results for the current outcome or any outcome, respectively. In brackets, we enter the total sample size by adding up all participants randomised in the studies investigating the specific comparison for that outcome. By definition, the unobserved comparisons will have zero in both columns. In contrast, those observed for other outcomes will have zero in the first column.The groups of comparisons are presented in Table\u00a0no bias detected or suspected bias favouring X for each comparison . For the unobserved comparisons, the assessment is not applicable , the overall judgement will consider qualitative assessments for both the within-study and the across-study assessment of bias. The assessment of selective outcome reporting bias (\u201cwithin-study assessment of bias\u201d) is likely to be the most valuable because its impact can be quantified more easily than that of publication bias (\u201cacross-study assessment of bias\u201d). The process of forming a final judgement for each pairwise comparison is illustrated in the flowchart in Additional\u00a0file\u00a0Since there was no within-study assessment of bias for the example of non-invasive diagnosis of coronary artery disease, the overall bias judgement will only consider the across-study assessment of bias. The final overall risk of bias judgements is reported in the Pairwise Comparison Table Table\u00a0.Once the assessments of overall bias for each pairwise comparison are complete, we integrate them in the assessment of risk of bias for each network estimate in the ROB-MEN Table. We organise the estimates into two groups, \u201cmixed/only direct\u201d and \u201conly indirect\u201d, depending on the type of evidence contributing to each estimate .The first step is to consider the contribution matrix of the network. The cells of this matrix provide the percentage contribution that each comparison with direct evidence (columns of the matrix) makes to the calculation of the corresponding network meta-analysis relative treatment effect (rows of the matrix) . AdditioIn the non-invasive diagnosis of coronary artery disease network meta-analysis, we considered the contribution from biased evidence as substantially in favour of one treatment if the relative difference between treatments was at least 15%. Among the mixed estimates, five of them have a clear separation of high contribution coming from biased evidence between the two treatments (e.g. CCTA vs SPECT-MPI). Among the indirect estimates, only three estimates showed such clear separation (e.g. CMR vs SPECT-MPI). The relevant bias judgements for this step are in column 3 of the ROB-MEN Table  as the covariate. This model generates an adjusted relative effect by extrapolating the regression line to the smallest observed variance (the \u2018largest\u2019 study) independently for each comparison. To assess the presence of small-study effects, we compare the obtained adjusted estimates with the original (unadjusted) estimates by looking at the overlap of their corresponding confidence (or credible) intervals. A lack of overlap between the two intervals  is an indication that effect estimates differ between smaller and larger studies. Note that this approach assumes there is no other explanation for the difference between the original, and the adjusted estimates, i.e. other covariates do not explain it. The evaluation of small-study effects is reported in the penultimate column of the ROB-MEN Table Table\u00a0, with leFor the example of non-invasive diagnostic modalities, we ran a network meta-regression model using the variance of the estimate (pooled variance for multi-arm studies) as a covariate to investigate small-study effects in the whole network. The adjusted estimates via extrapolation to the smallest observed variance are reported in column 6 of the ROB-MEN Table next to the original network meta-analysis summary effect  of 18 antidepressants . The outThere are 153 possible comparisons between the 18 drugs. Seventy compared the response to the antidepressant (group A) and 2  compared other outcomes (dropouts and remission). The remaining 82 possible comparisons were not covered in any of the studies   and for the comparisons in the group \u201cobserved for this outcome\u201d for which extra studies were identified that did not report the outcome of interest. We judged four of these to be potentially biased because the extra studies did not report the full results and were sponsored by the company manufacturing the drug favoured by the bias. We judged the other four comparisons as no bias detected: the unavailable results were unlikely to be missing due to non-significant p-values or the directions of the results and unlikely to affect the overall results. For example, selective outcome reporting bias was suspected for an additional study of fluoxetine versus paroxetine but unlikely to affect the synthesised results given its small sample size (21 participants) relative to the total sample size (1364 participants). We assigned all other comparisons observed for this outcome a level of no bias detected in this step. The within-study assessment of bias was not applicable to the 82 unobserved comparisons.We carried out the within-study assessment of bias due to missing evidence for the two comparisons in the \u201cobserved for other outcomes\u201d group .The across-study assessment of bias was carried out for all comparisons. We considered that bias, when suspected, would favour the newest drug, following the novel agent bias principle. The exceptions were comparisons where agomelatine, paroxetine, bupropion, and vortioxetine were the newest drug because the authors obtained all unpublished data from the manufacturers. This qualitative consideration took priority over findings from contour-enhanced funnel plots and tests for small-study effects for comparisons with at least 10 studies. Based on the findings from these statistical techniques, neither amitriptyline versus fluoxetine nor citalopram versus escitalopram would be judged at suspected bias. We nevertheless agreed our judgement from the across-study assessment of bias for both comparisons as suspected bias favouring the newest drug. The only ones judged with no bias detected were all comparisons involving agomelatine and vortioxetine, as well as other 12 comparisons involving other drugs. The judgements for all pairwise comparisons are reported in the last column of the Pairwise Comparisons Table  was at least 15 percentage points.The bias assessment for indirect evidence is only considered for the \u201conly indirect\u201d estimates and is copied from the last column of the Pairwise Comparison Table. This potential risk for \u201cmissing studies\u201d is particularly important for the indirect estimates because it drives the bias evaluation to a \u201chigh risk\u201d level in case there is also substantial contribution from direct evidence with suspected bias in the same direction.The last part of the risk of bias assessment for the network estimate involves running a network meta-regression model to evaluate the presence (or absence) of small-study effects. We run the model using the smallest observed variance as a covariate and assuming unrelated coefficients. All estimates and their adjusted counterpart were similar, and their credible intervals had a good level of overlap, providing no evidence of small-study effects.some concerns or low risk. In particular, none of the comparisons involving agomelatine, paroxetine, venlafaxine, or vortioxetine were at high risk of bias. All 153 network meta-analysis estimates with their relative ROB-MEN levels are reported in Table\u00a0Following the rules set out in Table\u00a0To our knowledge, ROB-MEN is the first tool for assessing the risk of bias due to missing evidence in network meta-analysis. ROB-MEN builds on an approach recently proposed for pairwise meta-analysis , 10 and Our examples demonstrate that the tool applies to different network meta-analyses, including very large and complex networks, for which assessing the risk of bias can be lengthy and labour-intensive. We developed an R Shiny web application  to facilROB-MEN is not applicable in situations where an intervention of interest is disconnected from the network. It was not designed to cover comparisons involving disconnected interventions. In case of disconnected networks, we recommend to evaluate each subnetwork separately. Like for any other evaluation of results\u2019 credibility in evidence synthesis, many of the judgements in the ROB-MEN process involve subjective decisions. Judging bias due to missing evidence is challenging, particularly for publication bias, as reviewers will often not know about unpublished studies. However, the subjectivity of our approach, specifically in the pairwise comparisons step, is shared by other approaches, as described in the Cochrane Handbook and ROB-ME tool , 10. AlsWe encourage the evidence-synthesis community to conduct studies of the reliability and reproducibility of the ROB-MEN tool. We recommend reviewers specify the criteria used and explain the reasoning behind the judgements to enhance transparency. We believe that ROB-MEN will help those performing network meta-analyses reach better-informed conclusions and enhance the toolbox of available methods for evaluating the credibility of network meta-analysis results.Additional file 1. Network graph, methods and forest plot for the network meta-analysis of non-invasive diagnostic modalities for the detection of coronary artery disease in patients with low risk acute coronary syndromes.Additional file 2. Instructions for filling in the Pairwise Comparisons Table.Additional file 3. Instructions for filling in the ROB-MEN Table.Additional file 4. Description of the judgements from the across-study assessment of bias for the example of non-invasive diagnostic modalities for detection of coronary artery disease in patients with low risk acute coronary syndromes.Additional file 5. Flow chart for assessing overall risk of bias due to missing evidence in pairwise comparisons.Additional file 6. Contribution matrix for the network of non-invasive diagnostic modalities for coronary artery disease in patients with low risk acute coronary syndrome.Additional file 7. Pairwise Comparisons Table for the network of 18 antidepressants.Additional file 8. ROB-MEN Table for the network of 18 antidepressants."}
+{"text": "Tumor tissue as well as regional lymph nodes are removed during curative surgery for early-stage non-small cell lung cancer (NSCLC). These tissues provide a unique snapshot of the immune cell composition at the time of surgery. We investigated the immune landscape in matched tumor tissue, tumor bearing (tb) and non-tumor bearing (ntb) N1 as well as N2 lymph nodes (LNs) in patients with NSCLC and its relation to survival.Internal hospital databases were screened for surgically treated NSCLC patients for whom tumor tissue, tbLNs as well as N1 and N2 ntbLNs were available. Clinical as well as demographic data were extracted from hospital records. Expression profiling of 770 immune-related genes was performed using the PanCancer IO 360 panel by NanoString Technologies.We identified 190 surgically treated patients of whom 16 fulfilled inclusion criteria and had sufficient archived tissue. The Tumor Immune Dysfunction and Exclusion (TIDE) score in N1 tumor-free lymph nodes was associated with OS. TIM-3 expression was inversely correlated with TIDE scores in affected LNs, N1 and N2 ntbLNs. Levels of CD8 expression were significantly higher in TIDE High compared to TIDE Low patients. TIM-3 and PD-L1 were selected for the final model for OS in multivariate regression in more than one tissue.Levels of immune cell exhaustion markers may indicate a dysfunctional immune status and are associated with survival after curative surgery in NSCLC. Lung cancer is the leading cause of cancer related deaths worldwide . Non-smaMany factors have been shown to impact postoperative survival in NSCLC, such as tumor stage, (neo)adjuvant treatment, extent of surgical resection, perioperative management, postoperative complications or body mass index \u20136. In adActivation and invasion of tumor-infiltrating lymphocytes (TiLs) has been shown to be a major determinant of response to checkpoint inhibitor treatment and disease-free as well as overall survival . HoweverVarious scoring metrics to quantify the extent of immune dysfunction in tumors have been developed in order to predict survival or response to checkpoint inhibitor treatment. Differences in their predictive value and included genes reflect the diversity of activation/exhaustion pathways as well as tissue-specific processes. Recently, algorithms such as the Tumor Immune Dysfunction and Exclusion (TIDE) were developed that can be applied to a variety of tissues . While iVarious drugs to prevent or revert T-cell exhaustion are currently under development, for example in the phase III COSTAR trial  in advanced NSCLC  or in the phase III RELATIVITY-047 trial  in metastatic melanoma .In this study we examined differences in the immune landscape in matched tumor tissue, affected and unaffected lymph nodes in patients with NSCLC with a focus on markers of immune cell exhaustion and their relation to patient survival.Patients were identified retrospectively from hospital records. We screened records for the following inclusion criteria: histologically-confirmed diagnosis of NSCLC , anatomical resection with curative intent, availability of FFPE-embedded tissue material and at least three years of follow-up. We also documented gender, age at diagnosis, survival, and tumor (stage and histology) and treatment details (type of surgery and (neo)adjuvant therapy). All patients were treated for NSCLC at the LMU Klinikum in Munich, Germany between 1999 and 2019.We obtained approval from the institutional ethics board (reference number: 12-16) and obtained informed consent from all participants. This study was conducted in accordance with the Declaration of Helsinki.We obtained FFPE-embedded tissues of primary tumor, tumor-bearing lymph nodes (tbLN), and N1 and N2 non-tumor-bearing lymph nodes (ntbLNs) from pathology archives. FFPE blocks containing tumor  were identified from pathology reports and reviewed by a senior pathologist based on hematoxylin and eosin stainings. Total RNA was extracted using RNEasy FFPE kits  according to manufacturer\u2019s instructions.We performed gene expression analysis of 770 genes using the nCounter PanCancer IO 360 panel run on a NanoString FLEX platform  . This panel is specifically designed to target genes involved in tumor microenvironment and immune evasion. The NanoString nCounter platform conducts gene expression analysis without amplification steps, therefore being well suited for analysis of potentially degraded RNA extracted from FFPE tissues. Analysis of results including normalization was performed using NanoString\u2019s proprietary nCounter Analysis software.https://cibersortx.stanford.edu/)  . This alhttp://tide.dfci.harvard.edu/). Negative TIDE score values represent the presence of immune evasion markers, whereas positive TIDE scores represent a lack of immune evasion. We categorized patients into TIDE High for patients with a positive TIDE score and TIDE Low for patients with a negative score. Since this analysis included different tissues from the same patient, we investigated whether TIDE scores were consistently positive or negative across tissues.The Tumor Immune Dysfunction and Exclusion (TIDE) score algorithm was originally developed to assess the immune status in tumor tissues to identify patients who may benefit from immunotherapy. We applied it to immune transcriptomics data from tumor, tbLNs, N1 ntbLNs and N2 ntLNs in order to determine whether the state of the immune system could predict postoperative survival in early-stage NSCLC even in the absence of immunotherapy. TIDE scores were calculated using a web-based tool with NSCLC as cancer type and no previous immunotherapy adjuvant therapy. Results are reported as Hazard Ratios (HR).We compared differences in the 22 cell populations obtained from CIBERSORTx between tumor, affected lymph nodes, N1 and N2 ntbLNs using within-subject ANOVAs.r between 0.5 and 0.7 and strong for an r above 0.7.Correlation between TIDE scores in the different tissues and immune cell exhaustion markers were analyzed using Pearson\u2019s correlation coefficient. Correlation coefficients were classified as moderate for an A threshold of \u03b1 \u2264 0.05 for significance was applied for all analyses. All analyses were performed in SPSS version 26.756 patients with a lung cancer diagnosis who underwent a surgical procedure between 1999 and 2019 were identified in internal hospital databases. Of these, 190 fulfilled all inclusion criteria , anatomical resection with curative intent and availability of FFPE-embedded tissue material. Most patients who did not meet inclusion criteria were excluded because they did not undergo anatomical resection with curative intent (such as mediastinoscopy or metastasectomy). Of the remaining 190 patients, sufficient tissue for tumor, tbLNs as well as ntb N1 and N2 LNs was available for 16 patients. The vast majority of the 190 patients were excluded because they did not have any tumor-bearing lymph nodes.The average age at diagnosis was 65.8 \u00b1 9.4 years and 6 (37.5%) of the patients were male. Median follow-up time was 48.5 \u00b1 38.8 months. Clinical characteristics for all 16 patients are displayed in Interestingly, while tumor TIDE scores were not significantly associated with OS, the TIDE scores measured in N1 ntbLNs were associated with OS . Additionally, there was a trend towards significance in N2 ntbLNs .No TIDE score in any single tissue was associated with PFS. All results are displayed in Of the 16 patients in this study, only four patients (25%) showed consistently positive or negative scores across all four tissues. Five patients (31%) showed discrepancies in one tissue and the remaining seven (44%) patients showed two positive and two negative scores.When comparing immune cell compositions of all four tissues between patients regardless of TIDE score, we found that M1 macrophages (p=0.02) and neutrophils (p=0.03) had a significantly higher relative abundance in tumor compared to all lymph nodes. In addition, na\u00efve B-cells (p=0.04) and memory B-cells (p=0.004) showed relative lower abundance in tumor tissue compared to lymph nodes. Relative abundances of all cell types are shown in We then compared patients with positive to patients with negative TIDE scores. CD8 cells were the only cell type with different abundances in patients with positive TIDE scores compared to patients with negative TIDE scores in more than one tissue, with a significantly higher level of CD8 cells in TIDE High patients Figure\u00a02Since a large part of the immunosuppressive environment is mediated through exhaustion of immune cells, we investigated levels of exhaustion markers and their association with TIDE scores, PFS and OS.We found TIM-3 to be inversely correlated with TIDE scores in affected LNs , N1 ntbLNs  and N2 ntbLNs  . This lack of immune suppression in regional lymph nodes points towards the fact that the immune system was able to retain at least some local control of the tumor. In this study, TIDE scores in N1 and N2 ntbLNs were a better indicator of survival than TIDE scores in the tumor. Since the patients in this study had early-stage NSCLC, it may be the case that their tumors had not yet developed the immunosuppressive environment that is typical of advanced tumors , 14. HigWe found markers of immune exhaustion to be negatively correlated with TIDE scores. Since negative TIDE scores indicate the presence of dysfunctional lymphocytes, this dysfunction may be cause by an increased expression of exhaustion markers. However, markers of immune exhaustion such as TIM-3 can be expressed on multiple cell types such as dendritic cells, natural killer (NK) cells or CD8+ T-cells. This diverse pattern can complicate interpretation of results of immune exhaustion marker expression. It was shown that TIM-3 is an important gatekeepers of inflammasome regulation and TIM-3 deletion in dendritic cells led to an increase of anti-tumor activity. However, deletion of TIM-3 on CD4 or CD8 T-cells did not produce the same effect . To contTIM-3 is a marker of activated and subsequently of terminally exhausted CD8 cells, dendritic cells, NK cells and others and prevents the formation of long-lived memory cells. While the exact mechanism of TIM-3 mediated signalling is currently unknown, binding to one of its multiple interaction partners leads to increased suppressor function and reduces macrophage activation . FurtherThis study highlights the role of the immune cell dysfunction in surgically treated early-stage NSCLC patients. By analyzing tumor as well as tissue from tumor-bearing lymph nodes as well as tumor-free N1 and N2 lymph nodes, we were able to identify unique immunosuppressive signatures associated with survival. A limitation of this study is tumor microenvironment and lymph node heterogeneity. There is no consensus about which location in the tumor is best assessed for immune transcriptomics. In addition, there is a potential for sampling bias because of the histological sections that were used in the analysis. Furthermore, since we did not perform single-cell transcriptomics, it was not possible to assign altered expression levels to a cell type of origin.To our knowledge, this is the first study to perform immune transcriptomics in tumor and tumor bearing and non-tumor bearing regional LNs in NSCLC. We showed that immune exhaustion markers are associated with survival in this early-stage surgically treated cohort. Future clinical trials of exhaustion inhibitors should include ntbLNs to help identify patients most likely to benefit from adjuvant approaches and more in-depth postsurgical follow-up.https://doi.org/10.6084/m9.figshare.18707639.The datasets presented in this study can be found in online repositories. The names of the repositories and accession numbers/links can be found below: GEO, NCBI: GSE197929; Figshare: The studies involving human participants were reviewed and approved by Ethics Committee of the Medical Faculty (LMU). The patients/participants provided their written informed consent to participate in this study.LS: Conceptualization, Methodology, Data curation, Formal analysis, Roles/Writing - original draft, Writing - review & editing JKo: Conceptualization, Methodology, Roles/Writing - original draft, Writing - review & editing JW: Formal analysis, Roles/Writing - original draft, Writing - review & editing JKu: Data curation, Writing - review & editing JN: Methodology, Writing - review & editing DK-G: Conceptualization, Writing - review & editing RK: Data curation CS: Conceptualization, Methodology, Writing - review & editing AJ: Conceptualization, Writing - review & editing JB: Conceptualization, Writing - review & editing AT: Conceptualization, Methodology, Funding acquisition, Roles/Writing - original draft, Writing - review & editing. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "To investigate cartilage tissue turnover in response to a supervised 12-week exercise-related joint loading training program followed by a 6-month period of unsupervised training in patients with knee osteoarthritis (OA). To study the difference in cartilage tissue turnover between high- and low-resistance training.Patients with knee OA were randomized into either high-intensity or low-intensity resistance supervised training (two sessions per week) for 3 months and unsupervised training for 6 months. Blood samples were collected before and after the supervised training period and after the follow-up period. Biomarkers huARGS, C2M, and PRO-C2, quantifying cartilage tissue turnover, were measured by ELISA. Changes in biomarker levels over time within and between groups were analyzed using linear mixed models with baseline values as covariates.p = 0.029) and at follow-up (p = 0.003).huARGS and C2M levels increased after training and at follow-up in both low- and high-intensity exercise groups. No changes were found in PRO-C2. The huARGS level in the high-intensity resistance training group increased significantly compared to the low-intensity resistance training group after resistance training (Cartilage tissue turnover and cartilage degradation appear to increase in response to a 3-month exercise-related joint loading training program and at 6-month follow-up, with no evident difference in type II collagen formation. Aggrecan remodeling increased more with high-intensity resistance training than with low-intensity exercise.These exploratory biomarker results, indicating more cartilage degeneration in the high-intensity group, in combination with no clinical outcome differences of the VIDEX study, may argue against high-intensity training. A major step forward in designing effective exercise therapy interventions for knee OA patients is to better understand the mechanisms why exercise therapy helps to alleviate OA symptoms, including a better understanding of the direct effect exercise therapy has on the cartilage turnover of the knee joint .A direct effect of exercise-related joint loading is believed to have a significant effect on cartilage turnover . This beAggrecan and type II collagen are the two most abundant extracellular matrix proteins of the cartilage. In healthy subjects, there is a delicate balance between the remodeling of these components ensuring cartilage tissue homeostasis. In OA, a hallmark of the disease is the degradation of cartilage due to increased proteolytic activity. This activity results in the release of specific extracellular degradation fragments. In the VIDEX study, the a disintegrin and metalloproteinase with a thrombospondin type 1 motif (ADAMTS) generated aggrecan marker huARGS was used to quantify aggrecan degradation. Formation and degradation of type II collagen were assessed with the biomarkers PRO-C2 and C2M, respectively. These three biomarkers have previously been measured in serum samples from clinical OA trials and have shown to reflect changes in cartilage tissue turnover \u201316. In tThe objective of this study was to investigate cartilage tissue turnover in patients with knee OA in response to a supervised 12-week exercise-related joint loading training program followed by a 6-month period of unsupervised gym training. A second objective was to study the difference in cartilage tissue turnover between HI and LI resistance training.This study represents a secondary analysis of the VIDEX trial  . The VIDOf the 177 patients included in the study, PRE-XT samples were not available for 4 persons. In addition, samples from a total of 13 patients were lost to follow-up and had neither POST-XT nor FU samples available. Furthermore, patients who failed to complete a minimum of 80% of the scheduled home training program during the 6 months between POST-XT and FU were excluded from the analysis. Thus, 145 patients were analyzed, hereunder 76 patients in the HI RT group and 69 patients in the LI RT group. The CONSORT diagram is shown in Fig. Three cartilage turnover biomarkers were measured in the serum: huARGS quantifies ADAMTS-mediated aggrecan degradation by targeting a neoepitope of the aggrecan G2 domain. C2M measures a matrix-metallo-proteinase (MMP) generated neoepitope of type II collagen indicative of collagen degradation. PRO-C2 measures type II collagen formation via targeting the type IIB N-terminal pro-peptide region. Human ARGS (huARGS) was assessed by a chemiluminescence sandwich ELISA , C2M wast-tests with Bonferroni adjustment or chi-square test as appropriate. For all analyses, biomarker data were log-transformed to obtain normal distributions. Differences in biomarker levels within and between HI and LI RT groups at POST-XT and FU were assessed using a linear mixed model with interaction between the two fixed effects intensity and time. Patient ID was included as a random effect and PRE-XT biomarker level as a covariate. Multiple pairwise comparisons were adjusted with Tukey\u2019s test. Statistical tests were performed in R version 4.1.0  and RStudio version 1.4.1106 . The results were plotted in GraphPad Prism version 9.1.2 .HI and LI RT groups were compared using The baseline characteristics of patients are summarized in Table p < 0.0001) and by 50% (p < 0.0001) at FU (Table p = 0.045) at POST-XT and 24% (p < 0.0001) at FU in the LI RT group. In the HI RT group, C2M levels were elevated at POST-XT by 27% (p < 0.0001) and by 42% (p < 0.0001) at FU. The C2M levels increased by 17% (p < 0.0001) at POST-XT and 54% (p < 0.0001) at FU in the LI RT group. For PRO-C2, no change in serum levels was observed from PRE-XT to FU within both groups.The changes in huARGS and C2M levels from PRE-XT to POST-XT and from PRE-XT to FU were used as outcomes in the applied mixed model analysis. Both huARGS and C2M levels increased from PRE-XT to FU. Within the HI RT group, huARGS levels increased POST-XT by 25% (p = 0.014) at POST-XT and an increase of 21% (p = 0.0014) at FU, compared to the LI RT group. Neither C2M nor PRO-C2 levels differed between the two training groups , Sprifermin, on human cartilage explants . A peak In the present study, we observed that the huARGS and C2M levels increased over time. Whether the change over time is a positive or a negative finding should be considered. It seems that high-intensity exercise has a stimulating effect on cartilage tissue turnover, but it is not clear whether these increased levels are part of a remodeling response or associated with net cartilage degradation. It is therefore difficult to draw conclusions, partly due to the design of this study in which a secondary analysis was performed in an RCT (the VIDEX study) . This RCIt is worth considering that there might not be a linear relationship between training intensity and efficacy but perhaps that exercise in OA patients functions by a goldilocks principle of a \u201cjust right\u201d amount. This range of beneficial exercise for OA patients may be defined by lower thresholds than for healthy subjects. Two longitudinal studies investigated the general recommendations of 10,000 steps/day or 150 min/week of moderate/vigorous activity and found that \u226510,000 steps/day was associated with degenerative effects and that the threshold for moderate/vigorous exercise needed for improving function was approximately half that recommended , 30. SimThe large number of patients and the longitudinal design of the VIDEX study provided a good opportunity to gain more insight into the change in biomarker levels as a result of knee joint loading through the exercises. However, there are several limitations of the study. The VIDEX randomized control trial did not include a control group which did not receive exercise therapy, and therefore, a comparison of the results to a group without exercise intervention was not possible. Furthermore, it will be important to better understand how biomarker response differs between OA patients and healthy controls subjected to a similar level of physical activity or exercise intervention. An important limitation is also that actual endpoints of structural damage are yet unknown. Biomarker levels are therefore difficult to interpret. It is also difficult to bridge the clinical relevance as it is not known whether increased degradation of aggrecan leads to net loss or whether it is a sign of remodeling and reinforcement of the cartilage. Therefore, future studies should also relate changes in biomarker levels with changes in the clinical parameters as a result of exercise, for example WOMAC functionality scores, knee pain severity, and performance tests.In conclusion, cartilage tissue turnover appears to increase in response to an exercise-related joint loading training program with no evident difference in type II collagen turnover between high- and low-intensity exercises. Only aggrecan remodeling was found to increase with high-intensity resistance training. Given the absence of a favorable effect on clinical signs and symptoms in high versus low exercise-treated patients, these exploratory results indicate that the combination of clinical findings of the VIDEX study  and the findings on the biomarker analyses (more cartilage degeneration in the high-intensity group) argue against high-intensity training in knee OA patients."}
+{"text": "At the end of 2019, the SARS-CoV-2 virus was reported to be responsible for the cases of pneumonia that had begun to appear a few months earlier in the Wuhan province of China. This was a new strain of coronavirus that had not been previously identified in humans and caused the disease known as COVID-19. The worldwide spread of this virus was explosive: A few months later, in May 2020, 3.67 million people had been infected and more than 250,000 had died. Two years later, in May 2022, more than 522 million confirmed cases had been reported, with over six million deaths worldwide. In the first two and a half years of the pandemic, we have learned substantially more about this infection and how it interacts with the cardiovascular system [Many cardiovascular manifestations in COVID-19 have the early detection of myocardial injury in common, which is diagnosable by elevated cardiac troponin (cTn), a fundamental biomarker in cardiovascular research in the diagnosis and prognosis of patients with acute coronary syndrome. Approximately 10\u201320% of patients hospitalised for COVID-19 have evidence of myocardial injury . We knowDirect myocardial injury to cardiomyocytes by the virus itself is possible. However, cases of myocarditis in COVID-19 infection are rare , less syThe interpretation of a troponin elevation in patients with COVID-19 is a great challenge for the Emergency Department. On the one hand, it is always necessary to rule out an acute coronary syndrome (type 1 infarction) based on data from the clinical history and the electrocardiogram. However, type 1 infarctions are very rare in patients with COVID-19. Therefore, troponin elevation in these patients must be interpreted as acute ischemic myocardial injury (type 2 infarction) or non-ischemic myocardial injury. For the diagnosis of type 2 myocardial infarctions, it is necessary to investigate a clinical situation associated with an imbalance between the supply and consumption of oxygen by the myocardium. This situation is not uncommon in critically ill patients with a COVID-19 infection, who are often tachycardic, hypotensive, or hypoxemic . ProposeThe distinction between type 2 myocardial infarction and non-ischemic acute myocardial injury may not be clinically relevant. Both cases are associated with a similar and poor prognosis, which is fundamentally determined by the severity of the systemic respiratory involvement of infection by the SARS-CoV-2 virus. Furthermore, the detection of dynamic changes between two troponin determinations, regardless of the presence of myocardial damage Tn max > 99th), is also associated with a worse prognosis 9th, is a,10. The However, we do know that the short-term cardiovascular effects on the long-term consequences in COVID-19 patients are related to myocardial injuries detected in the acute phase ,13. It iThe evolution of different variants in the SARS-CoV-2 virus and the generalisation of vaccination guidelines in most Western countries may also change cardiovascular involvement in COVID-19 and, therefore, the presence of myocardial injury ,16. An iIn conclusion, myocardial injury in COVID-19 is frequent and is associated with a poor prognosis. Currently, we have many unanswered questions, which is why an intense research program is necessary for this area to better understand an infection that will accompany us in the coming years."}
+{"text": "Risk perceptions are key constructs in some theories of health behavior. A tripartite model of risk perception, the TRIRISK model, was developed to assess deliberative, affective, and experiential components of risk perception. The current paper attempts to replicate the factor structure of the TRIRISK measure for cancer and extend the structure to respiratory illness.Participants 18 or older were recruited using an address-based sample in New York State to participate in a Web-based survey. We employed the TRIRISK questionnaire with respect to cancer and respiratory illness. Confirmatory Factor Analyses were conducted in Mplus to validate the TRIRISK model in our sample. TRIRISK model fit across demographic and behavioral groups was tested using multiple-group models.Of the 704 people included in the analysis, the mean age of participants was 46.9, the majority reported being female (58.5%), and most were White (81.7%). For cancer and respiratory illness, items loaded on the respective constructs as expected. Overall, the TRIRISK model framework fits well across differing subgroups, suggesting that this is a valid model of risk perception to use in a general population sample.These results provide further evidence that the TRIRISK model is a good model to use for risk perceptions in tobacco control research. The TRIRISK model can be used to communicate risk to encourage positive health behaviors among most sociodemographic groups. Risk perceptions are key constructs in theories of health behavior wherein individuals make choices by weighing out the risks of consequences with benefits of the action  made by integrating deliberative and affective information  deliberative and 2) affective or experiential components . The measure had also only been examined for three chronic conditions. There are inconsistencies in the literature regarding how smokers perceive their risk, with research concluding over and underestimations. These inconsistencies may stem from the variations in how risk perceptions are measured. Limitations of current measures include that there has been a failure of studies to re-administer previously published multi-item measures and that the measures that are published are not uniform, are not consistent with recommendations, and have not been studied on susceptible populations  that examined the psychometric properties of this measure and extend it to a smoking-related disease. A recent UK study assessed the replicability of the TRIRISK model by CFA, explored the factor structure of risk perception in the UK sample by exploratory factor analysis (EFA), and assessed the associations of EFA-based factors with intentions to change behavior and subsequent behavior change . The study protocol was approved by the Roswell Park Institutional Review Board (I-567719).a priori as a specific condition, such as chronic obstructive pulmonary disease or asthma. Therefore, results should be interpreted relative to this general condition. Response options and scoring were performed as described in prior work , former cigarette users , and never cigarette users (participants who reported never using cigarettes).Participants also provided information on demographic characteristics. Demographic variables used in this analysis were dichotomized so that we could compare distributions with the Ferrer et al. paper  replicate the results of the Ferrer et al. paper ; 2) explore the TRIRISK model for respiratory illness; and 3) compare the model fit across different groups (demographic factors and tobacco use).Frequencies, T-tests, and non-parametric \u03c72 tests in SPSS  were used to compare the demographic and behavioral profile of participants in the current study to that of the participants in the Ferrer et al. sample.unmodified TRIRISK model against a single-factor model and two dual-factor models where affective and experiential risk perceptions were consolidated into a single factor, and deliberative and experiential risk perceptions were consolidated. Model fit was evaluated using multiple fit indices. Comparative fit index (CFI)\u2009>\u2009.95  and a standardized root mean square residual (SRMR)\u2009<\u2009.08 were indicative of good fit to the data  using Mplus version 8.6 (Muthen & Muthen). The first model run directly reproduced the original TRIRISK model . The reported percentages of males in our population were significantly lower compared to the study population in studies 1 and 2 in the Ferrer et al. paper (p\u2009<\u20090.0001). The percentage of our participants in both education groups were significantly different from the study population in studies 1 and 2 in the Ferrer et al. paper (p\u2009<\u20090.0001). Regarding race, the percentage of participants in our sample who were White was significantly higher than the frequencies found in studies 1 and 2 in Ferrer et al. paper (p\u2009<\u20090.0001).For both cancer and respiratory illness, the single factor models and the two dual factor structures led to a significant decrement in model fit when compared to the respective unmodified TRIRISK models. The fit indices of the final and original cancer model can be seen in The model fit indices of the final and original respiratory illness model can be seen in The modified versions of the TRIRISK model (with established reasonable fit) for both cancer and respiratory illness were used to run multiple group models for sex, race, education, and smoking status.sex, male and female ranges for the deliberative construct were 0.57-0.86 and 0.42-0.83; ranges for the affective construct were 0.80-0.97 and 0.84-0.97; and ranges for the experiential construct were 0.21-0.87 and 0.42-0.93. The standardized factor loading that was not substantial among the male group was for item 8. Examining the unconstrained model, this item was substantial for females but was not substantial for males. These results suggest that the factor loadings for the TRIRISK model across these groups may be different. For education, less than college and college plus respective ranges for the deliberative construct were 0.48-0.85 and 0.50-0.82; ranges for the affective construct were 0.76-0.93 and 0.86-0.97; and ranges for the experiential construct were 0.41-0.89 and 0.31-0.92. The standardized factor loading that was not substantial among the college plus group (<0.35) was for item 8. Examining the unconstrained model, this item was substantial for the less than college group but was not substantial for the college plus group. These results suggest that the factor loadings for the TRIRISK model across these groups may be different. Overall, the basic factor structure of the TRIRISK model was similar across sex and education, with item 8 loading a bit differently across the groups. For smoking status, respective current, former, and never ranges for the deliberative construct were \u22120.11-0.91, 0.57-0.89, and 0.51-0.82; ranges for the affective construct were 0.84-0.98, 0.83-0.95, and 0.80-0.96; and ranges for the experiential construct were 0.40-0.88, 0.38-0.94, and 0.33-0.91. For the deliberative construct, the standardized factor loading for item 5 was not substantial (<0.35) for current smokers but was for former and never smokers. For the experiential construct, item 8 was substantial for current and former smokers, but was not for never smokers. Overall, the factor structure for the TRIRISK model was similar, but some items (5 and 8) loaded differently. The nested test for race suggested no decrement in model fit, suggesting the magnitude of the factor loadings was similar across racial groups.Regarding the factor loadings of the final TRIRISK cancer model across the demographic and behavioral subgroups, \u03c72 nested model tests indicated that constraining the factor loadings for sex, education, and smoking status led to a significant decrement in model fit . These rsex model revealed a total \u03c72\u2009=\u2009947.65, where males contributed 389.37 to the \u03c72 while females contributed 558.28  loaded differently. The nested test for sex suggested no decrement in model fit, suggesting the magnitude of the factor loadings was similar across racial groups.Regarding the factor loadings of the final TRIRISK respiratory illness model across the demographic and behavioral subgroups, \u03c72 nested model tests indicated that constraining the factor loadings for race, education, and smoking status led to a significant decrement in model fit . These rsex model revealed a total \u03c72\u2009=\u20091013.12, where males contributed 463.01 to the \u03c72 while females contributed 550.11 . The latent factor correlations found here  were higher than those reported by Ferrer and colleagues (Ferrer et al., There are many strengths to our study, including a relatively large sample size drawn from the general population. In addition to replicating the TRIRISK model in cancer, it was extended to another disease, respiratory illness, providing additional conceptual validation of the framework. Lastly, our data collection methods included random address sampling and mail-based invitations, which helps in widening the population sampling frame. We also addressed a key limitation mentioned in the Ferrer et al. paper \u2013 their relatively low indices of goodness-of-fit, which limited their interpretation of the findings. In our sample, we obtained good model fit based on a 2-index criteria (Hu & Bentler, The limitations of our study include that the data collection occurred during the COVID-19 pandemic. This may have impacted how individuals responded to risk perception questions around respiratory illness. Furthermore, our questions did not include \u2018don\u2019t know\u2019 response options, as in the Ferrer et al. study, which may have been meaningful and could have affected our results. Although the data were correlational, this approach is appropriate because we were attempting to validate and explore the model in specific diseases. Furthermore, changing risk perceptions has been causally linked to behavior change in previous research (Ferrer et al., Overall, our sample somewhat provides additional empirical evidence in support of the TRIRISK model, replicating the factor structure for cancer risk perceptions. Our sample also extends the TRIRISK model to respiratory illness risk perceptions. Future research could look in further detail at the differences between the three factors in validated diseases and can examine individual characteristics (e.g. disease knowledge, numeracy, health motivation, socioeconomic status (Ferrer et al., Identifying and validating risk perception models are pivotal for informing policies and educational campaigns to demonstrate how health promotion practitioners and medical professionals should design risk communications and decision aids (Ferrer et al., Click here for additional data file."}
+{"text": "Ruminococcaceae family in such effects was also addressed. Resveratrol administration resulted in lowered liver weight and serum total and non-HDL cholesterol concentrations, as well as in increased serum HDL cholesterol levels. The administration of this polyphenol also prevented obesogenic diet-induced serum transaminase increases. In addition, histopathological analysis revealed that resveratrol administration ameliorated the dietary-induced liver steatosis and hepatic inflammation. Gut microbiota sequencing showed an inverse relationship between some bacteria from the Ruminococcaceae family and the screened hepatic markers, whereas in other cases the opposite relationship was also found. Interestingly, an interaction was found between UBA-1819 abundance and resveratrol induced liver weight decrease, suggesting that for this marker resveratrol induced effects were greater when the abundance of this bacteria was high, while no actions were found when UBA-1819 abundance was low.Gut microbiota dysbiosis has been described in several metabolic disruptions, such as non-alcoholic fatty liver disease (NAFLD). Administration of resveratrol has been claimed to elicit benefits against NAFLD along with modulating gut microbiota composition. This investigation aims to study the putative mediating role of gut microbiota in the potential hepato-protective effects of resveratrol in a diet-induced NAFLD rat model. The involvement of bacteria from the  Bacteroidetes, Clostridium, Prevotella, Eubacterium, Ruminococcus, Fusobacterium, Peptococcus, and Bifidobacterium as the most abundant genera [Gut microbiota is a complex community of microorganisms residing in the gastrointestinal tract that can reach concentrations of almost a trillion cells per gram and may weight up to 2 kg in a normal weight human being ,2. Despit genera . Of notet genera ,5. The it genera . In addit genera . Indeed,t genera .de novo lipogenesis, liver mitochondrial dysfunction or disturbed white adipose tissue lipolysis [de novo lipogenesis [In this context, non-alcoholic fatty liver disease (NAFLD) is a condition where gut microbiota impairment can be a potential mediating mechanism . Currentipolysis . Among togenesis .Regarding the role of gut microbiota on NAFLD, dysbiosis has been reported to result in a greater intestinal permeability, as well as an enhanced release of pro-inflammatory mediators to the bloodstream. These pro-inflammatory molecules may reach the liver, activate inflammatory pathways, and enhance the release of inflammatory cytokines . It is ntrans-stilbene) is a widely studied bioactive compound with proven effectiveness in NAFLD management [In this scenario, the administration or intake of natural bioactive compounds has long been proposed as a complementary/alternative therapeutic tool for treating metabolic diseases including NAFLD treatment. Indeed, effective conventional interventions  for NAFLD management , showed nagement ,19,20,21nagement . The lownagement , since onagement . Notewornagement . Indeed,nagement ,25.Ruminococcaceae family in such metabolic effects.The aim of the current investigation is to study the putative mediating role of gut microbiota in the potential hepato-protective effects of resveratrol in a diet-induced rat model of NAFLD, paying special attention to the eventual involvement of bacteria from the A total of 30 male six-week-old male Wistar Wistar RccHan rats  were used in this study. All the experimental procedures were performed according to the guidelines of the Ethical Committee of the University of the Basque Country (document reference CUEID CEBA/30/2010), in agreement with the European regulations .Animals were housed in polycarbonate metabolic cages  in a room with controlled temperature (22 \u00b0C) and a 12 h light/dark cycle. After a 6-day adaptation period, rats were randomly allocated into 3 experimental groups . The control group (C group) was fed a standard diet  and the remaining animals were fed a high-fat high-fructose diet  alone (HFHF group) or supplemented with resveratrol at a dose of 30 mg/kg bw/day (RSV group). Resveratrol was kindly supplied by Monteloeder , and daily incorporated into the powdered diets as previously reported . The rodg for 10 min, at 4 \u00b0C). Livers were dissected, weighed, and immediately frozen in liquid nitrogen. All samples were stored at \u221280 \u00b0C until analyses.Body weight and food intake were daily monitored. Serum was obtained by centrifugation of blood samples after clotting  and serum component was used for biochemical determinations. Commercial spectrophotometric kits were used to measure serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, following the supplier guidelines . Total and HDL-cholesterol serum levels were also analysed by spectrophotometry based commercial kits , whereas non-HDL cholesterol levels were estimated by subtracting HDL cholesterol levels to those of total cholesterol, as described elsewhere [Blood samples were centrifugated  housing the animals separately and inducing defecation with an abdominal massage. Samples were stored at \u221280 \u00b0C. The QIAamp DNA stool MiniKit was used to extract DNA from faecal samples following the manufacturer\u2019s instructions . Microbiota composition was assessed by amplifying the variable V3 and V4 regions of the bacterial 16S ribosomal RNA gene (16S rRNA) from the faecal DNA and sequenced with the Illumina MiSeq platform  as explained elsewhere .The Quantitative Insights Into Microbial Ecology program (QIIME2)  was usedp < 0.05 level.Statistical analyses were performed using SPSS 24.0 . Descriptive results are presented as mean \u00b1 SEM. Data were analysed by one-way ANOVA, followed by Newman\u2014Keuls post-hoc test. In the case of differences in alpha diversity, comparisons between groups were performed by Kruskal\u2013Wallis test. Beta diversity was calculated using Bray\u2014Curtis index and PERMANOVA test, depicted in a non-multidimensional dimension scale (NMDS). Significance was assessed at the p < 0.01), as well as a significantly greater final body weight (p < 0.01), compared to the control group (p < 0.05). Noteworthy, all these effects were found without apparent differences in food intake  was effectively reverted by resveratrol administration, reaching values comparable to those observed in the control group. Similarly, the reduction induced by the obesogenic diet in circulating HDL-cholesterol levels was significantly higher in the animals supplemented with resveratrol, although in this case the observed levels were still significantly higher than those found in the control animals . By contrast, no differences were found in this variable between the HFHF and the RSV30 group. In addition, the animals fed on this diet were also characterized by a greater relative abundance of Eubacterium corpostalonigenes specie, Fourneriella and UBA-1819. As far as resveratrol administration is concerned, the microbial composition of rats receiving the polyphenol was comparable to that observed in the non-supplemented high-fat high-fructose diet-fed animals  and liver histopathological markers (steatosis grade and liver inflammation). Moreover, Fourneriella and UBA-1819 were positively associated with liver damage since strong direct correlations were found between the relative abundances of these microbes and the aforementioned markers of liver damage and function . Then, potential interactions between Ruminococcaceae abundance and liver weight and serum transaminase levels were statistically tested (UBA-1819 abundance and liver weight (p = 0.006). In this regard, a higher UBA-1819 abundance was associated with a lower liver weight in animals fed the high-fat high-fructose diet and treated with resveratrol  is a research topic that has attracted a great deal of interest in the last few years ,35,36. SProteobacteria at the phylum level, higher abundance of Enterobacteriaceae and decreased abundance of Rikenellaceae and Ruminococcaceae at the family level, as well as increased abundance of Escherichia, Dorea and Peptoniphilus, and decreased abundance of Anaerosporobacter, Coprococcus, Eubacterium, Faecalibacterium and Prevotella at the genus level [Akkermansia muciniphila, as well as enhanced abundance of bacteria with pro-inflammatory potential [According to current investigations, a greater abundance of ethanol-producing bacterial species is common in individuals featuring NAFLD, resulting in increased circulating ethanol concentrations, which in turn may trigger pro-inflammatory pathways in the liver . Additious level ,40. Insuus level , is charotential ,43. In totential .Desulfovibrio, Lachnospiraceae_NK4A316_group and Alistipes, and increased the abundance in SCFA producing bacteria, such as Allobaculum, Bacteroides and Blautia [Ruminococcus genera [Some of the health benefits described for resveratrol administration may be attributable, at least in part, to specific effects in gut microbiota composition . Thus, i Blautia . Other ts genera . In our s genera . This aps genera .Ruminococcaceae family was found in the control group, the present study was devoted to gaining more insight into the relationship between changes in the bacteria family and the prevention of liver steatosis induced by resveratrol. Indeed, the greater abundances of Ruminococcaceae UCG-014 and UCG-005 observed in the faeces of the animals in the control group were significantly reduced by the high-fat high-fructose feeding pattern. In this line, the relationship of these bacteria with several metabolic disturbances, including NAFLD, has been highlighted in previous studies [Ruminococcaceae family, such as Ruminococcaceae UCG-005 or Ruminococcaceae UCG-014; whereas Fourneriella showed to be positively associated with liver damage. Interestingly, an interactive pattern was found when analysing the association between the aforementioned markers of liver status and the relative abundance of UBA-1819. In this case, the abundance of this bacteria seems to somehow modulate the response to resveratrol administration. According to our results, the animals featuring a higher relative abundance of UBA-1819 showed a greater response to the polyphenol administration than those featuring lower levels, as revealed by the lower organ weight found in these animals. This pattern could have been more evident with a higher number of animals in the experimental groups. In any case, the outcomes for UBA-1819 should be considered with attention since faecal levels of this microorganism may have a dual role on liver status, depending on gut abundance and therefore a potential interactive influence should be considered in the future.Considering that this is a complementary study to a previously published investigation  where a  studies ,49,50. IRuminococcaceae UCG-014 and UBA-1819, and that all of them were negatively correlated with body weight and fat content, glucose, and inflammation markers [The results achieved in the present study agree with those previously reported by other authors. Thus, a study exploring adipose tissue inflammation and gut microbiota interactions revealed that the administration of Polydextrose to obese mice (fed a high-fat diet) promoted the growth of microbes including  markers . The inv markers . In fact markers . Moreove markers . Similar markers  may also markers . TherefoRegarding the strengths and limitations of this study, it must be highlighted that the selected experimental design and model is appropriate to elucidate the potential of resveratrol for diet-induced NAFLD prevention. Indeed, the diet used to generate NAFLD proved to be effective, as revealed by biochemical and histologic analysis, and should be considered a proof of principle. Nevertheless, this study also holds some limitations. Firstly, since this is a preclinical study, the potential translation of the observed results/effects to humans is not guaranteed. Additionally, faecal samples collected at the beginning of the study would enable better characterization of each animal according to baseline individual microbiota signature. Indeed, such information would be of interest to better establish the influence of the abundance of certain microbes in the response of the animals to resveratrol administration. Finally, these results, in terms of potential implication of specific bacteria in resveratrol mediated effects, derives from statistical associations. Since such are not causal inferences, and type I and II errors cannot be ruled out neither, these data should be completed and corroborated.Ruminococcaceae family seems to be negatively associated with hepatic markers including liver weight, serum transaminase levels and hepatic steatosis and inflammation degree. In the case of liver weight, the abundance of UBA-1819 seems to have an interactive effect in resveratrol induced effects, which may differ depending on the faecal/gut occurrence of this bacteria.In conclusion, resveratrol administration effectively prevented high-fat high-fructose diet-induced NAFLD in a rodent model. In general, the abundance of bacteria from the Ruminococcaceae family with markers of liver status, while interestingly some markers showed a variable outcome depending on gut Ruminococcaceae content. Regarding resveratrol, Ruminococcaceae abundance elicit functional benefits of this polyphenol administration, which is of value when interpreting the putative interactive involvement of microbiota on resveratrol effects on NAFLD.Summing up, this investigation demonstrated a negative association among several gut microorganisms belonging to the"}
+{"text": "We investigated the autophagic response of rat M\u00fcller rMC-1 cells during a short-term high glucose challenge.rMC-1 cells were maintained in 5\u2009mM glucose (LG) or exposed to 25\u2009mM glucose (HG). Western blot analysis was used to evaluate the expression levels of markers of autophagy  and glial activation (AQP4), as well as the activation of TRAF2/JNK, ERK and AKT pathways. Autophagic flux assessment was performed using the autophagy inhibitor chloroquine. ROS levels were measured by flow cytometry using dichlorofluorescein diacetate. ERK involvement in autophagy induction was addressed using the ERK inhibitor FR180204. The effect of autophagy inhibition on cell viability was evaluated by SRB assay.Activation of autophagy was observed in the first 2\u20136\u2009h of HG exposure. This early autophagic response was transient, not accompanied by an increase in AQP4 or in the phospho-activation of JNK, a key mediator of cellular response to oxidative stress, and required ERK activity. Cells exposed to HG had a lower viability upon autophagy inhibition by chloroquine, as compared to those maintained in LG.A short-term HG challenge triggers in rMC-1 cells a process improving the ability to cope with stressful conditions, which involves ERK and an early and transient autophagy activation. Retinal M\u00fcller cells are the most widespread glial cells in the retina. They are mainly found in the inner nuclear layer but are able to reach all nervous layers of the retina . Under sAmong the consequences of exposure to a HG environment are reactive oxygen species (ROS) accumulation, and endoplasmic reticulum (ER) stress signaling pathway activation that could induce autophagy , 4. ThisThe rat retinal M\u00fcller cell line rMC-1 expresses both induced and basal markers found in primary M\u00fcller cell cultures and represents an important tool for studying the regulation of autophagy by glucose. Lopes de Faria et al. have investigated in this cell line the effect on autophagy of glucose concentrations that mimic diabetic conditions , in a time interval ranging between 24 and 72\u2009h. HG exposure increased the amount of autophagosomes but failed to degrade sequestosome 1 (p62), while treatment with the mTOR inhibitor rapamycin restored lysosomal proteolytic activity and reactivated the autophagic flux . Based oIn the present study we show that in rMC-1 cells HG induces an early and cytoprotective autophagic response that peaks in the first 6\u2009h of exposure, and that is followed by a later decline. Our findings, coupled with those reported above from other authors, indicate that in M\u00fcller cells HG triggers a non-linear response characterized by autophagic oscillations.2 in Dulbecco\u2019s Modified Eagle Medium , supplemented with 10% fetal bovine serum , 100\u2009U/ml of penicillin, 100\u2009\u03bcg/ml streptomycin (Sigma-Aldrich), and containing either 5\u2009mM (1\u2009g/l) glucose (LG) or 25\u2009mM (4.5\u2009g/l) glucose (HG). Mannitol (Sigma-Aldrich), added at a 20\u2009mM concentration to a medium containing 5\u2009mM glucose, was used\u2009to study the effect of osmolarity in cells exposed to HG. The ERK inhibitor FR180204  was used at 10\u2009\u03bcM and added 2\u2009h before cells were harvested for western blotting analysis. Autophagic flux was evaluated in cells maintained under LG or HG conditions for 6, 24 or 72\u2009h in the absence or presence of 20\u2009\u03bcM chloroquine diphosphate (CQ) , added 6\u2009h before cell harvesting.The immortalized rat retinal M\u00fcller cell line (rMC-1) was obtained from Kerafast  , and rouCells were lysed in RIPA buffer  supplemented with protease and phosphatase inhibitors (Sigma-Aldrich). Protein content was measured with the Pierce BCA Protein Assay kit . Western blot analysis was performed using the following primary antibodies: anti-TRAF2 , anti\u2010phospho\u2010JNK , anti-JNK , anti-phospho-ERK1/2 , anti-ERK1/2 , anti-phospho-AKT , anti-AKT , anti-LC3 , anti-p62/SQSTM1 , anti-AQP4 , anti-\u03b2-actin . Signals were detected using appropriate horseradish peroxidase conjugated secondary antibodies and the enhanced chemiluminescence system ECL LiteAblot Extend . Chemiluminescence signals were captured with a digital imaging equipment (ImageQuant LAS 4000 mini). Densitometric analysis of bands was performed using the NIH ImageJ software .2. Next, the cells were detached by trypsinization, washed three times with PBS and subjected to flow cytometric analysis  to measure the conversion of DCFH-DA to the fluorescent product dichlorofluorescein.Intracellular ROS levels were evaluated using dichlorofluorescein diacetate (DCFH-DA), as previously described . BrieflyCells were seeded, allowed to adhere overnight and then cultured in either LG or HG for 24\u2009h, in the presence or absence of CQ (1\u201325\u2009\u03bcM). Cell viability was then evaluated by the sulforhodamine B (SRB) assay, performed as previously described .t tests, with a significance threshold set at p\u2009<\u20090.05, using GraphPad Prism . All the experiments were repeated at least three times.Statistical analysis was performed by two\u2010tailed Student\u2019s The autophagy markers microtubule-associated protein 1A/1B-light chain 3 (LC3) and p62 were analyzed in rMC-1 cells, at different time points, during 72\u2009h of incubation with 25\u2009mM glucose (HG). A significant LC3-II accumulation, coupled with a reduction of p62 protein levels, was observed in the first 6\u2009h of treatment Fig. , suggestOne of the consequences of hyperglycemia is osmotic stress, which affects a wide variety of cell types, including retinal cells . MannitoWe also analyzed the expression of aquaporin 4 (AQP4) under HG stimulation. AQP4 plays a crucial role in the transport of water across plasma membranes. Indeed, water flux through AQP4 is involved in the rapid volume regulation of retinal M\u00fcller cells , and AQPIt is well known that ER stress plays an important role in DR . The strHG levels have been related to increased production of ROS . We thusIn turn, ROS are known to activate different signaling pathways, including the one mediated by protein kinase B (AKT) , 28, andOn the other hand, beside AKT, the extracellular signal regulated kinase (ERK) pathway is also activated by ROS through different mechanisms. For instance, ROS may induce activation of EGF and PDGF receptors as well as an increase of intracellular calcium which, in turn, mediate ERK activation .We thus investigated the involvement of ERK in the early response of rMC-1 cells to HG. Of note, this pathway is known to induce autophagy  and playNext, in order to provide evidence for the involvement of ERK in the early activation of autophagy, we evaluated the effect of the ERK inhibitor FR180204 on the induction of autophagy in rMC-1 cells exposed to HG for 6\u2009h Fig. . FR18020Finally, we analyzed the impact of autophagy inhibition on cell viability after 24\u2009h exposure to either LG or HG Fig. . As far A number of studies have investigated the effect of HG on autophagy in the rat retinal Muller cell line rMC-1. According to the reported results, autophagy is inhibited in the first 24\u201348\u2009h, and activated at later stages, i.e., after about 72\u2009h to 5 days of cells exposure to HG \u201312. Of nWith these premises, we investigated rMC-1 M\u00fcller cells autophagic activity in the first hours of HG exposure. Indeed, the early response to HG in terms of autophagy regulation had not been investigated so far to our knowledge. The results obtained and reported here demonstrate that HG actually induces an early autophagic response that peaks in the first 6\u2009h of exposure, and that is followed by a decline in the time frame between 12 and 72\u2009h from stimulation. These findings, coupled with those reported above, indicate that a biphasic induction of autophagy may actually occur in retinal M\u00fcller cells, in stress conditions associated with a HG environment.We further analyzed the contribution of different factors to this early autophagy response. The effect of medium hyperosmolarity was analyzed by replacing glucose with mannitol. Of note, the effect of hyperosmolarity on autophagy is a controversial issue, since both activation \u201343 and iNext, we investigated the possible activation of pathways known to play crucial roles in the stress response to HG. HG challenge did not increase AQP4, a marker of retinal M\u00fcller cells activation, nor it induced activation of JNK, a kinase that mediates cellular responses to oxidative stress . In addiActually, we observed a transient increase of ROS, starting after few minutes of HG exposure. However, beside their effect on oxidative stress and JNK activation, low levels of ROS are involved in the regulation of physiological processes via different signaling pathways . Among tAfter 1\u2009h of HG exposure, we also observed activation of AKT, a known autophagy inhibitor. Still, the AKT activation does not necessarily result in autophagy inhibition, the actual outcome depending on the balance between the activity of different signaling pathways, including the one mediated by ERK. In this respect, significant cross-talks have been found to occur between ERK and AKT pathways . MoreoveAn important finding in this scenario is that cells exposed to HG had a lower viability upon autophagy inhibition by CQ, as compared to those maintained in LG. Therefore, the HG-induced early autophagy appears to be required to prevent cell damage.In conclusion, a short-term HG challenge triggers in rMC-1 cells a process improving the ability to cope with stressful conditions, which involves ERK and autophagy. However, this early autophagy activation is followed by a decline at later time points, in agreement with previous reports . FurtherOverall, these results indicate that HG exposure may induce in rMC-1 cells a non-linear response characterized by oscillations in autophagic activity. In this respect, it has been recently reported that upon various types of stress stimuli, including serum and glucose starvation, glutamine deprivation, etc., different cells show autophagy oscillations. These fluctuations are characterized by an early autophagic peak, after about 6\u2009h from stimulation, and a later peak coupled with an intermittent drop in autophagic activity . The firWe previously reported that short-term intermittent exposure to HG triggers in rMC-1 cells an increase of markers of reactive gliosis . GlucoseFig. 1SFig. 2SSupplementary Figure Legends"}
+{"text": "Biclustering algorithm is an effective tool for processing gene expression datasets. There are two kinds of data matrices, binary data and non-binary data, which are processed by biclustering method. A binary matrix is usually converted from pre-processed gene expression data, which can effectively reduce the interference from noise and abnormal data, and is then processed using a biclustering algorithm. However, biclustering algorithms of dealing with binary data have a poor balance between running time and performance. In this paper, we propose a new biclustering algorithm called the Adjacency Difference Matrix Binary Biclustering algorithm (AMBB) for dealing with binary data to address the drawback. The AMBB algorithm constructs the adjacency matrix based on the adjacency difference values, and the submatrix obtained by continuously updating the adjacency difference matrix is called a bicluster. The adjacency matrix allows for clustering of gene that undergo similar reactions under different conditions into clusters, which is important for subsequent genes analysis. Meanwhile, experiments on synthetic and real datasets visually demonstrate that the AMBB algorithm has high practicability. First, the threshold Considering that the sizes of binary data matrix are not the same, the density of 1 is also different. In a synthetic binary data matrix, the 1\u2019density represents noise level. A threshold range is given to AMBB, and the algorithm is run once for each threshold, keeping the optimal bicluster obtained by this algorithm. When the AMBB algorithm runs all the thresholds, the one of them best is selected according to the number of biclusters. The threshold that obtained the largest number of biclusters is the optimal. To get the similar columns, the threshold of columns is initially set to In Fig.\u00a0Noteworthily, running ten times for each dataset, the Max-score represents maximum score and the Mean-score represents mean score. To summarize the selection of row thresholds, we simply enter a threshold range within which the AMBB algorithm finds the threshold that yields the maximum number of biclusters, and then uses this threshold as a benchmark to find the optimal parameter for the current data.The first step of the AMBB algorithm converts the gene expression data into a binary matrix. Data conversion using the preprocessing method proposed by the Bimax algorithm. A threshold is calculated based on the expression value of the gene in all samples. The calculation formula is The schematic diagram of the algorithm is shown in Fig.\u00a0Figure\u00a0Once the seeds are selected, the AMBB algorithm then constructs a row difference matrix and a column difference matrix. Figure\u00a0If the Method mentclass2pt{minimThe low time complexity is one of the characteristics of excellent biclustering algorithms. Given a matrix In this section, the performance of the AMBB algorithm is evaluated from two aspects. The first part illustrates AMBB method For the binary biclustering algorithm, the commonly used evaluation metric is the match score. The details of the method are described in . The MatSynthetic datasets are used to test the performance of AMBB. In addition, the results obtained by these two methods of AMBB are compared with the Bimax and BiBit algorithms. The synthetic dataset is divided into three sizes, namely 50*50, 100*100 and 200*200, where the density of 1\u2019s in these three synthetic datasets ranges from 5 to 50%, increasing by 5% each time. In contrast to the experiments with synthetic datasets in , in thisThe background matrix is a binary matrix, and an arbitrarily distributed value 1 indicates that the gene has important expression significance under this condition. Then we construct an all-1 matrix of size 10*10 as a bicluster. The placement rule is to allow implant in non-consecutive rows, but must be in contiguous columns. We implanted 5 biclusters in 50*50 binary background matrix and 10 biclusters in 100*100 and 200*200 binary matrix.Since the binary synthetic datasets are all similar, we experiment with the optimal parameters set by the BiBit algorithm, First, Fig.\u00a0Figure\u00a0Figure\u00a0From Fig.\u00a0We test the performance of four algorithms in overlapping biclusters. Figure\u00a0By analyzing the match scores of the four biclustering algorithms in above synthetic datasets, it can be concluded that the AMBB algorithm is able to obtain the shortest running time and has the best performance compared with other algorithms.To study the utility of the AMBB algorithm, a human gene expression dataset known as Pollen  and a moIn this experiment, we compared four algorithms, the AMBB algorithm, QUBIC algorithm, Plaid algorithm  and BimaIn this formula, There exists a comparison result for Proportion of Genes Number. The metric is calculated as shown below:analysis . Table 4In this paper, we propose a new binary biclustering algorithm for gene expression data. It uses the construction of a neighbor-joining difference matrix to obtain similar genes. This approach has better time complexity than compared algorithms, and also has high practical, which will be useful for subsequent analyses. Although the AMBB algorithm has two thresholds, the row difference threshold and the column difference threshold, at runtime for the row threshold we only give a range, and the algorithm will automatically select the optimal biclusters. For each iteration of column clustering, the column threshold is automatically increased by one until the value is"}
+{"text": "A fundamental problem in ecology is to understand how competition shapes biodiversity and species coexistence. Historically, one important approach for addressing this question has been to analyze consumer resource models using geometric arguments. This has led to broadly applicable principles such as Tilman\u2019s  I.One of the most striking features of natural ecosystems is the immense diversity of flora and fauna they support. Understanding the origin of this diversity is a fundamental question in ecology. A single ecosystem can contain thousands of species, all living in close proximity and interacting with each other and the abiotic environment. For this reason, theoretical models have played a major role in guiding empirical research, helping to interpret experiments, and shaping ecological intuitions \u20133.One major theoretical framework for understanding biodiversity is niche theory . Niche tresource . Within resource , 7.Consumer resource models (CRMs) have played a central role in the development of niche theory  6, 8, 9, 98, 9. Recently, there has been a renewed interest in consumer resource models from both the ecology and statistical physics communities. A number of works have analyzed these models using methods from statistical physics to understand the behavior of complex ecosystems with many species and resources \u201312. OtheHistorically, many of the central intuitions of niche theory have been developed using geometric arguments for analyzing CRMs , 30. Forndances) . Geometrndances) . Within Traditional geometric arguments for determining species coexistence primarily work in resource abundance space. In this work, we derive an alternative geometric representation of species coexistence and niche differentiation in CRMs using a convex polytope in the space of \u201cspecies consumption preferences.\u201d This geometric analysis extends previous work by foregrounding the central role played by niche differentiation in coexistence. It also allows us to enumerate all possible ecologically stable steady states, as well as all transitions between steady states due to changes in resource supply. For this reason, it represents an interesting new way of understanding the origin of biodiversity within the context of niche theory.II.A.To illustrate our ideas, we initially focus on MacArthur\u2019s consumer resource model (MCRM) , 8, 9. IThe MCRM consists of The dynamics of the MCRM are described by the following coupled ordinary differential equations:Generically, the principle of competitive exclusion implies that at most dy state  .CRM in K , 35, thequadrant . The posecologically uninvadable , then If we further require that the steady state be various ecosystems, and the dimensions of the intersections correspond dually to the number of coexisting species. The species that coexist in a particular ecosystem depend on the resource supply vector The arrangements of the intersections between the ZNGIs which fall in the intersection of all the closed half-spaces enumerate the possible coexisting species in Mathematica notebook illustrating this basic picture can be found on the corresponding GitHub repository  . HoweverTo formulate this new geometric picture we introduce \u201cscaled consumption vectors\u201d using the rescaled consumption vectors alone without explicit reference to steady-state resource abundances. In the main text, we limit ourselves to discussing the results and interpretations that follow from this observation and relegate technical details to This inversive relationship between the ZNGIs and the consumption vectors allows us to analyze many coexistence properties The central geometric object in our picture is a convex polytope formed by the scaled consumption preferences Each face of the PCH corresponds directly to a set of species that can coexist at steady state .A face of the PCH has vertices coexist. Transitions between different steady-state behaviors as the resource supply vector s varied  are capts varied  and 5.In These three properties of the PCH allow us to enumerate, using only species attributes, possible ecologically stable steady states and transitions between them as the supplied resources are varied. The information about steady-states and coexistence contained in the ZNGIs is exactly that contained in the PCH as they are dual objects. The chief advantage provided by this dual picture is that it provides intuition for coexistence and niche differentiation in terms of species traits. Additionally, the PCH construction lends itself well to computational geometry, especially in high dimensions as there are systematic and efficient algorithms for enumerating faces of a convex hull of a set of points . We now D.Each face of the PCH is in direct correspondence to a possible set of species that can coexist. This allows us to easily enumerate all possible ecologically stable steady states by listing all faces of the PCH and their neighbors. A simple example of this can be seen by comparing nditions . If reinMathematica notebooks. The left side of each panel in the figure shows the geometry in resource abundance space and the location of the supplied resource vector More generally, the faces of the PCH are arranged in a lattice by subset inclusion, so we can find all possible transitions between coexisting species by descending through the face lattice and enumerating the species whose scaled consumption vectors are the vertices of the faces. An example illustrating these transitions in a more complex ecosystem with E.The geometry of the PCH can also be used to ask and answer interesting ecological questions. For example, how does changing species traits such as consumer preferences, To illustrate this, we once again consider the simple ecosystem of Notice, initially the rescaled consumption vector for species 2, As we increase the fitness of species 2 by decreasing This simple example helps illustrate how the PCH can be used to gain an intuitive understanding of how introducing a fitter species can change ecological steady states and biodiversity. If the fitness of the invasive species is the same order of magnitude as those of existing species, then its introduction will not result in large scale extinction so long as it is sufficiently distinct from existing species and does not have some special advantage in its consumption preferences. Instead, the species will be able to carve out a distinct niche. However, as the magnitude of the rescaled consumer preference vector grows, there will be massive extinctions. The transitions between these two regimes can be encoded simply in the geometry of the PCH. Additionally, the relative orientation of faces on the PCH can be used to understand how similar communities are to each other and the degree of competition between species. Faces that are nearly parallel to each other indicate that the corresponding species are similar and will compete strongly and can survive in similar environments. While these results can also be derived without the PCH by using the infeasible region, the PCH provides many intuitions directly in terms of species\u2019 attributes. Finally, while here we have restricted our considerations to a low-dimensional setting with two resources, we expect new and interesting properties to emerge in high-dimensional settings with many resources since high-dimensional convex geometry is much more complex than its low-dimensional analog.F.In the previous section, we restricted our analysis to MacArthur\u2019s original consumer resource model. However, the basic geometric picture discussed above also holds for other popular variants of consumer resource models including the Tilman\u2019s consumer resource model (TCRM),es eCRM, ,(7)dRG.The geometric construction presented in the last section exploits that fact that the growth rate of a species  in Ref.  that forFor this more general nonlinear case, many properties of the relationship between the PCH and coexistence are preserved, but unlike in the linear case, the consumption vectors trations  to furthOne crucial difference is that in the nonlinear case not all faces present on a specific realization of the PCH (i.e. a PCH corresponding to a particular choice of parameters) necessarily represent realizable steady-states. This is because as In  species . In the H.We end by briefly commenting on some important limitations of our geometric construction. In general, we expect that our geometric construction is valid whenever we can use ideas from contemporary niche theory like ZGNIs and coexistence cones to describe the underlying ecology \u20133. The uAnother limitation of our construction is that it assumes that there are no hard geometric constraints on consumer-resource preferences. One prominent example of such hard constraints are metabolic tradeoffs that fix the consumer preference vectors to all have the same magnitude . Such coIII.In this work, we have introduced a new geometric framework for understanding niche theory based on the species consumer resource preferences. Our work complements existing geometric intuitions by emphasizing the important role played by consumer preferences in shaping species coexistence and niche differentiation. One appealing aspect of the work is that it works in trait space, something that is often easier to observe and measure than resource abundances . DespiteThe geometric picture developed here may extend to other contexts to provide new insights. In this manuscript, we have largely focused on small ecosystems with a few resources and species. It will be interesting to ask how this picture generalizes to large ecosystems where methods from random matrix theory and statistical physics can be used to make powerful predictions . Doing s"}
+{"text": "In the early stages of schizophrenia the person experiences feelings of strangeness about themselves, difficulty in making sense of things and difficulty in interacting with their environment. Based on this, self-disorder assessment instruments have been developed and empirical studies have been conducted to assess people at risk of developing a schizophrenia spectrum disorder. These studies show that self-disorders are found in pre-psychotic stages and that their manifestation can predict the transition to schizophrenia spectrum disorders.We present the case of a patient with multiple diagnoses and mainly dissociative symptoms who, after years of evolution, was diagnosed with schizophrenia.Bibliographic review including the latest articles in Pubmed about self-disorders and schizophrenia.We present the clinical case of a 51-year-old woman with a long history of follow-up in mental health consultations and with multiple hospital admissions to the psychiatric unit, with several diagnoses including: dissociative disorder, histrionic personality disorder, adaptive disorder unspecified psychotic disorder and, finally, schizophrenia. The patient during the first hospital admissions showed a clinical picture of intense anxiety, disorientation and claiming to be a different person. The patient related these episodes to stressors she had experienced, and they improved markedly after a short period of hospital admission. Later, psychotic symptoms appeared in the form of auditory and visual hallucinations and delusional ideation, mainly of harm, so that after several years of follow-up and study in mental health consultations and in the psychiatric day hospital, she was diagnosed with schizophrenia and treatment with antipsychotics was introduced, with a marked clinical improvement being observed.It is important to take into account this type of symptoms (self-disorders), as they allow the identification of individuals in the early stages of the disorder and create the opportunity for early therapeutic interventions.None Declared"}
+{"text": "All patients received four sessions with 3\u00a0weeks interval. The acne scars significantly improved in both sides of face in both groups. According to quartile grading scale and patient satisfaction; the therapeutic response was significantly higher in PRF group than PRP either alone or combined with needling. The combination with needling increases efficacy of PRF and PRP. Fluid PRF is highly effective, safe and simple procedure that can be used instead of PRP in the treatment of acne scars.Platelet-rich fibrin (PRF), a second-generation platelet concentrate, was developed for the purpose of overcoming the limitations of Platelet-rich plasma (PRP). PRF can produce a higher cumulative release of growth factors than PRP. Also, this release is slow and prolonged, making it ideal for tissue regeneration and growth stimulation. This study was conducted to evaluate the efficacy of fluid PRF either alone or combined with needling versus PRP in the treatment of atrophic acne scars. A comparative study including 30 patients with atrophic acne scars who were divided into two equal groups. Group I included 15 patients in which the left side of the face was treated with intradermal injection of PRP while the right side was treated with combined needling with PRP. Group II included15 patients in which the left side of the face was treated with intradermal injection of fluid PRF while the right side was treated with combined needling with fluid PRF Platelet-rich plasma (PRP), the first-generation platelet concentrate, has been used in the treatment of various diseases in different specialties like dermatology, orthopedics, and dentistry. PRP contains high level of growth factors which have marked growth potential and induce faster healing , so it bOther limitation of PRP is the rapid release of growth factors of PRP on activation. Approximately 95% of these factors are released shortly after activation with calcium chloride. These limitations led to the need of development of platelet concentrates without anticoagulant .Platelet-rich fibrin (PRF), the second-generation platelet concentrate, was developed for the purpose of removing anticoagulants for fear of hypersensitivity reaction and for better release of growth factors. A rapid and short centrifugation procedure is needed for separation of blood layers before clotting. A fibrin matrix is formed in the platelet-rich layer entrapping platelets and leukocytes in it. This matrix makes the release of growth factors slow and prolonged comparing with PRP .There are different preparations of PRF such as; Leukocyte-rich PRF (l-PRF), the platelets and WBCs are entrapped in the fibrin clot.The second preparation is Advanced PRF (A-PRF) that is associated with higher release of growth factors , 6. InjeFluid PRF was investigated histologically; leukocytes (mostly lymphocytes) and platelets were found to be dispersed uniformly throughout the tested specimen, in contrast to PRF clots, where cells were distributed unevenly. The three-dimensional fibrin created in fluid PRF, together with growth factors; provide a controlled release system of growth factors throughout the healing process , 9.The migration of fibroblasts is significantly more in fluid PRF than PRP. Fluid PRF is associated with significantly more cell proliferation and more elevation in fibronectin mRNA, collagen 1, and TGF-beta levels leading to greater induction of collagen synthesis .The treatment of acne scar by skin micro-needling combined with PRP is more effective than skin micro-needling alone. The growth factors induced by both treatment modalities have a synergistic action which improves and accelerates wound healing .This stuThirty adult patients presented by atrophic acne scars of different severities were collected from the outpatient clinic of Dermatology at Z.U. Hospital after their acceptance to participate in this study. This study was approved by Z.U. Institutional Review Board (Z.U.IRB) IRB#: 5602-17-2-2020. Patients presented with history of keloid formation, immunosuppression, bleeding disorders, thrombocytopenia, Platelet dysfunction, patients with active skin or systemic disease and pregnancy were excluded from the study.All patients were subjected to thorough history taking and dermatological examination to assess the type of scars, icepick, boxcar or rolling type, and the scar severity according to Goodman and Baron's qualitative global scarring grading system . All pat2 were added to PRP to be activated.10\u00a0ml of blood was drawn from every participant. Firstly, PRP and platelet-poor plasma (PPP) were separated from the RBC portion by centrifugation whole blood mixed with anticoagulant (EDTA) at 900\u00a0rpm for 5\u00a0min, and then second centrifugation was done at 2000\u00a0rpm for 15\u00a0min to separate PRP from platelet-poor plasma. About 2\u00a0mL of PRP was collected and 10% CaClPRF was produced by single spin centrifugation of 10\u00a0ml of venous blood collected in plain glass tube without anticoagulant at 700\u00a0rpm for 3\u00a0min. The upper layer, yellow to orange colored fluid, was collected as fluid PRF. Approximately, 1\u00a0ml Fluid PRF can be separated from 10\u00a0ml blood.Left side of face was treated by intradermal injection of PRP (group1) or fluid PRF in (group 2). 0.1\u00a0mL of PRP or fluid PRF was injected intradermally into the atrophic scars with 1.5 to 2\u00a0cm interval using insulin syringe followed by gentle massaging of the treated area.For the treatment of right side of face in both groups: we used Derma electric-pen, (220v) and needle cartridge with 12 needles . Needle length was adjusted at 2.5\u00a0mm and speed level 4 (blue color). PRP or fluid PRF were applied topically over the areas affected by acne scars followed by needling by moving dermapen in the four directions, vertically, horizontally, diagonally right and left, over the affected areas without pressing.The treatment started immediately after separation of PRF to avoid clot formation. All patients were instructed to apply topical antibiotic and sunscreen after each session. Any side effects were recorded every session.45\u00a0min before the session, local anesthetic cream containing mixture of lidocaine and prilocaine was applied to the whole face. The whole face was sterilized by alcohol before starting the treatment.All patients received four treatment sessions with 3\u00a0weeks interval followed by one month follow-up period.Goodman and Baron's global scarring grading system (GSGS): by comparing its values before the start of treatment and 4\u00a0weeks after the last session.Quartile grading scale: the improvement was classified into: excellent if improvement\u2009>\u200975%; very good improvement 50\u201374%; good 25\u201349% and poor improvement\u2009<\u200925%.Patient\u2019s satisfaction: the patients assessed their degree of improvement as poor, good, very good and excellent. All patients were also asked to rate their pain on a scale of 0 to 10. 0 means no pain and 10 means the worst pain.The therapeutic response was assessed byAll data were collected, tabulated and statistically analyzed using .Before treatment there was no significant difference in acne scar severity in both sides of face of both groups according to GSGS.Regarding PRP Group It included 13 female and 2 males their age ranged from (18\u201333) years (mean age 24.53\u2009\u00b1\u20094.81\u00a0years). 93.3% of patients had positive family history of post-acne scar. Most of patients belonged to skin type IV (60%). Ice pick scar was the most common type of scars (73.3%) followed by rolling scar (66.7%). After treatment the severity of acne scar significantly improved in both sides of the face. The improvement was significantly higher in the right side treated by combined PRP and needling than left side treated by PRP alone according to quartile grading scale and patient satisfaction.PRF Group included 11 female and 4 males their ages ranged from (22\u201338) years (mean age 26.67\u2009\u00b1\u20094.76\u00a0years). 66.7% of patients had positive family history of post-acne scar. Most of patients belonged to skin type IV (73.3%). Rolling scar was the commonest scar (86.7%) followed by Icepick scar (46.7%). After treatment the severity of acne scar significantly improved in both sides of the face. The improvement was significantly higher in the right side treated by combined PRF and needling than left side treated by PRF alone according to quartile grading scale and GSGS .The side effects in both groups were mild and tolerated with no significant difference between all groups. Facial skin appeared more erythematous and edematous in the side treated by combined treatment, but in all cases redness and edema disappeared with in 2\u20133\u00a0days after the sessions. Post-inflammatory hyperpigmentation was observed in 20% of sides treated by combined needling with PRP. Secondary bacterial infection occurred after first session in one patient of PRF group who improved after treatment by systemic antibiotic. Pain score was higher with combined treatment; however, the difference between both sides of face was not statistically significant and it was well tolerated by all patients (p\u2009>\u20090.05).There was no significant relationship between therapeutic response and the age, sex, skin type and type of scars in both groups  and the term liquid or fluid PRF for Injectable PRF and Concentrate PRF. Leukocytes and platelets were found to be distributed uniformly throughout the histologically analyzed specimen of fluid PRF unlike in solid PRF, where the cells were unevenly distributed. The three-dimensional fibrin presents in fluid PRF forms a controlled release system of growth factors. This property makes fluid PRF a good alternative to PRF clot especially in the treatment of large surface areas \u201310.Skin needling acts by creating micro-skin injuries to stimulate collagen remodeling and enhance new collagen and elastin formation, associated with improvement in the vascularization in the upper dermis. This effect leads to reduction in fine wrinkles, scarring with improvement in the skin laxity , 16.Skin needling has been used in the treatment of acne scar either alone or combined with other treatments like PRP. The autologous growth factors in PRP and PRF work in synergism with growth factors created by skin needling to improve the collagen remodeling and wound healing. It was found that the growth factors in PRP were released almost totally in first 15\u00a0min of injection, requiring more number of sessions at frequent intervals , 16\u201318.This study was conducted to evaluate the efficacy and safety of fluid PRF either alone or combined with needling versus PRP in treatment of atrophic post-acne scars.All patients of both groups showed significant improvement in acne scars in both sides of face. The improvement was better in the side treated by combined needling with PRP or PRF than side treated by PRP or PRF alone. According to the quartile grading scale and patient satisfaction; the improvement in PRF group either alone or combined with needling was significantly higher than PRP group. We noticed more improvement in skin texture and skin laxity in PRF group compared to PRP group. The improvement was noticed earlier in PRF group than PRP group especially in side treated by intradermal injection of fluid PRF that had filling and lifting effect which was remarkable from the second day of injection and maintained up to 2\u00a0weeks after injection. This effect may explain the earlier response in PRF group by raising the scar deficit before the effect of stimulating growth factors to take place.As regard side effects; the difference between both groups was not significant. Facial skin appeared more erythematous and edematous in the side treated by combined treatment, but in all cases redness and edema disappeared with in 2\u20133\u00a0days after the sessions. Similar side effects were reported in previous studies \u201320. PostIn accordance with our results different study had reported improvement in acne scar by PRP \u201320.On thPRF has been used in the treatment of different diseases in dentistry, and orthopedics. Wang et al.  approvedThis study showed promising findings regarding the efficacy and safety of fluid PRF, a simple, safe, rapid and cost-effective procedure, in the treatment of atrophic acne scar; however, there is still a need for further controlled trials on PRF either alone or combined with different treatment modalities to confirm the ability of PRF to substitute PRP in the treatment of different skin diseases."}
+{"text": "Microwave annealing (MWA) technology, as a promising solution for addressing these challenges, has gained significant attraction due to its unique advantages. In this article, the effects of microwave annealing (MWA) treatment on the sensing behaviors of Extended-Gate Field-Effect Transistors (EGFETs) utilizing HfO2 as a sensing film have been investigated for the first time. Various power levels of MWA treatment (1750 W/2100 W/2450 W) were selected to explore the optimal processing conditions. A thorough physical analysis was conducted to characterize the surface of the MWA-treated HfO2 sensing thin film using techniques such as X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). Our findings reveal that MWA treatment effectively increased the surface sites (Ns) in the HfO2 sensing thin film, consequently leading to an increase in the pH sensitivity of EGFETs to 59.6 mV/pH, as well as a reduction in hysteresis and an enhancement in long-term stability. These results suggest that MWA offers a straightforward, energy-efficient method to enhance overall HfO2 sensing film performance in EGFETs, offering insights for HfO2 applications and broader microelectronics challenges.Recently, certain challenges have persisted in PH sensor applications, especially when employing hafnium oxide (HfO Since tsolution ,13,14,152, Si3N4, Al2O3, IGZO, and Ta2O5, are presented with relatively high sensitivity. However, these materials come with their own set of challenges. For example, SiO2 and Si3N4-gated ISFETs [2O3 layer [2O5 [2) has attracted much attention due to its exceptional sensitivity and stability [Sensitive materials have become the focal point of recent advancements in pH sensing technology, emphasizing miniaturization, affordability, convenience, and real-time sensing. In addition, the sensitivity  and corrd ISFETs ,19 exhibO3 layer ,21,22 teO3 layer ,24 demonyer [2O5 ,25 displtability ,27,28.However, several instability phenomena arising from defects in the sensing film, such as charge traps, buried points, and slow reactions, hinder the application of EGFETs. Therefore, it is necessary to fabricate high-quality films with minimal defects to serve as sensing thin films. The commonly accepted sensing mechanism of a pH sensor could be explained with the site dissociation model, referring to the chemical reaction between free hydrogen ions in the electrolyte and amphoteric groups on the surface of the sensing thin film. Among these surface treatment methods, microwave annealing (MWA) treatment holds unique advantages, including reduced heat impact, as well as instantaneous and uniform heating. The ability of MWA to provide rapid and even heating holds significant promise, especially in the context of treating PH-sensitive films, offering a more controlled and precise treatment process.2 sensing layers were investigated, where their response was examined through a series of experiments with various MWA treatment powers. These evaluations were carried out using an EGFET structure, with the HfO2 sensing layers being fabricated using atomic layer deposition (ALD). Notably, MWA treatment yielded significant improvements in sensing performance, particularly in enhancing the pH sensitivity to 59.6 mV/pH, close to the Nernst limit. The linearity of sensitivity exceeds 99.9%. MWA also improved long-term stability, with sensitivity only dropping to 5% during tests up to 20 days. Furthermore, a monotonical relationship between increased sensitivity and MWA treatment power was established. The annealing power of 2450 W was identified as optimal, delivering markedly improved pH sensitivity and long-term stability. The above results indicate that microwave annealing is an effective method to improve the sensing ability of HfO2-EGFET pH sensors. The researchers used X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM) to analyze the surface composition and morphology of HfO2 to explain the mechanism of MWA treatment. Our findings indicate that the increase in surface roughness following annealing may be the underlying reason for the enhanced pH response.In this article, the pH sensing characteristics of HfO+-doped Si substrate to investigate the pH-sensing properties of ALD-HfO2 films. As shown in 2 layer was deposited by ALD on a p+-doped Si wafer after performing RCA cleaning. Hf (NCH3C2H5)4 (TEMAH) was selected as the precursor and H2O was selected as an oxidant for the HfO2 thin films in an ALD reactor (BENEQ: TFS-200). The reactor chamber was evacuated by a vacuum pump to a base pressure of approximately 2 \u00d7 10\u22122 Pa at 300 \u00b0C. High purity N2 (99.999%) was introduced into the ALD chamber as both the carrier and purge gas during the film growth. An HfO2 sensing structure with a thickness of 8 nm was fabricated. After deposition, the samples were annealed using MWA in an N2 ambient (purity = 99.999%) for 600 s in power ranges of 1750 W, 2100 W, and 2450 W. Next, we used a 2% HF solution to etch the edges of the hafnium oxide in order to connect the silicon wafer to the epitaxial printed circuit board (PCB). In this study, EGFET structures were fabricated on pThe MWA treatment-sensing structure was pasted on the golden pad of the printed circuit board (PCB) with conductive tapes, and the golden pad and metal pins were connected by aluminum lines. A dispenser  was used to coat the surface of the sensing structure with epoxy resin adhesive along a custom elliptical path to provide a liquid pool with height. Poly (methyl methacrylate) (PMMA) was used to provide a closed induction chamber for the liquid reaction by pressing on a heightened epoxy resin. Finally, metal pins were used to connect the sensing structure to a commercial n-channel power MOSFET  gate, as shown in 2 -EGFET pH sensors. In the steady-state measurement, the source-drain voltage (Vds) was kept at 0.1 V and a reference voltage (VM) was swept one cycle from 0 V to 5 V at 0.01 V intervals; this was applied to the Ag/AgCl reference electrode. The source-drain current (Ids) was measured. In the real-time measurement conditions, the device was operated in the liner region by setting the reference voltage VM to 3.8 V. The schematic diagram of the entire experiment is shown in ds was measured as the pH in the loop changed from pH 4 to pH 10 and back. Each pH-stabilizing fluid flow was controlled for 25 s by means of a solenoid valve, and the pH was changed after a constant 30 s. The sensing behaviors such as sensitivity, hysteresis, and stability of the devices were continuously monitored over 20 days. The surface condition of the material was analyzed by XPS and AFM. The surface content was analyzed by a Kratos AXIS Ultra DLD XPS  using an Al Ka X-ray source (1486.6 eV). The Bruker Dimension Icon AFM  was used to determine the surface morphology of the thin films over a scan area of 5 \u00d7 5 \u00b5m2.The I2 surface by measuring the water contact angle, both before and after MWA. 2 films. Contact angles of 60.6 \u00b1 0.2\u00b0, 52.9 \u00b1 0.3\u00b0, 50.2 \u00b1 0.1\u00b0, and 41.2 \u00b1 0.1\u00b0 were measured, showing a slight enhancement in the hydrophobic character of the HfO2 corresponding to a MWA of 0 W, 1750 W, 2100 W, and 2450 W, respectively. After treating the HfO2 surface with MWA, the contact angles exhibited a significant decrease of 32%. As previously reported by Braik et al. [2 highly hydrophilic. A wettability study was used to characterize the HfOk et al. ,28, this2 films. For comparison, 2 films with the 0 W, 1750 W, 2100 W, and 2450 W conditions, respectively. The HfO2 films exhibited a columnar microstructure. Notably, under the 2450 W condition, the columnar grain size was found to be larger compared to the conditions at 0 W, 1750 W, and 2100 W. Additionally, the root mean square (Rq) roughness values for the films, corresponding to microwave-assisted (MWA) powers of 0 W, 1750 W, 2100 W, and 2450 W, were measured at 0.674 nm, 0.865 nm, 1.10 nm, and 1.18 nm, respectively. As the MWA power increased, the surface roughness of the HfO2 film gradually increased. The 2450 W condition showed the roughest surface. From the above-mentioned results, we assumed that the improvement in roughness of the film occurred as the MWA power increased. Actually, the surface morphologies are relevant to the increase in Ns. The observed transition of the film microstructures from a homogeneous surface to a rough surface may be ascribed to the greater quantity of -OH groups in the HfO2 film to transform its structure, as shown in In our experiment, an AFM image was used to investigate the surface morphologies of the HfO2 films after MWA at three different powers were examined using XPS. 2 films performed at the three MWA powers, respectively. The O 1s peak is de-convoluted into two components: one at 529.8 eV, corresponding to the Hf-OH bonds, and the other at 532.1 eV, corresponding to the Hf-O-Hf bonds. Apart from the film morphology and structure, the chemical compositions of the HfO2 films. It can be seen that the area of the Hf-OH shows a growing trend with the increase in MWA power. The \u2013OH groups near the surface acted as buried sites resulting in hysteresis, so hysteresis increased with the increase in the \u2013OH groups after the MWA treatment [2 films with multiplet splitting are shown in reatment . The red2-EGFET pH sensors over different MWA power treatments. As shown in t) is positively correlated with pH, reflecting that the surface potential of the sensing film increases with the hydrogen ion concentration. The threshold voltage of the EGFETs was defined as Vt when Ids reached 1 \u00d7 10\u22127 A, and the sensitivity was obtained by linearly fitting the Vt with different pH values, as shown in the right diagram of 2-EGFET pH sensor will gradually increase.According to past articles, the sensitivity of EGFTE can be expressed as: k refers to the Boltzmann\u2019s constant, T refers to the absolute temperature, q refers to the elementary, int\u03b2 refers to the intrinsic buffer capacity, and diC refers to the differential capacitance. It can be seen that the pH sensitivity at a fixed temperature is influenced by buffer capacity int\u03b2 and differential capacitance diC. This article focuses on the buffering ability int\u03b2 to buffer small pH changes on the surface of the sensing thin film, which depends entirely on the intrinsic properties of the sensing material such as the surface site number Ns and the equilibrium constants of Ka and Kb. int\u03b2 can be expresses as:2, the reaction constant and the dissociation constant associated with the acid\u2013base equilibrium are definite values that can be set to a constant value = 16 \u03bcF/cm2, in order for the sensitivity of the ISFET device to increase with the increase in the surface site density Ns. When the surface amphiphilic group reacts with H+, the surface sites exist in the form of Hf-O, Hf-OH2+, and Hf-OH, and the number of surface sites Ns is the sum of these three sites. Based on In Equation (1), 2-EGFET pH sensor\u2019s sensing behaviours, it was tested in real-time in this experiment by cycling the buffer solution from pH 10 to pH 4, and back. During this process, we maintained a constant gate bias voltage (VM) of MOSFET at 3.8 V to ensure the device works in the linear region. The shift of the threshold voltage (VM \u2212 Vt) was calculated using the formula VM \u2212 Vt = Ids/gm, where gm represents the transconductance. The phenomenon of hysteresis is that VM \u2212 Vt is not consistent for the same pH during multiple cycles of the test. Here, the hysteresis width (\u25b3Vt) is defined as the difference in VM \u2212 Vt between the pH 7 of the neighboring loops (as shown in To acquire further understanding of the HfOTo investigate the long-term stability of MWA-treated devices, sensing behaviours of multiple sets of devices were continuously evaluated over a 20-day duration. The comparisons of sensitivity and hysteresis characteristics over the 20-day period are shown in 2 sensing films have been studied. The investigation focused on how MWA treatment influenced the sensing performance of HfO2 sensing film-based EGFETs. The AFM and XPS results reveal that the HfO2 sensing film exhibits increased surface roughness and a higher concentration of OH-related atomic groups on the surface. As a result, the EGFET demonstrates excellent sensing performance, including a notably high sensitivity up to 59.6 mV/pH and long-term stability with a fluctuation of less than 5% over a 20-day period.The effects of MWA treatment on the sensing behaviours of EGFETs utilizing HfO"}
+{"text": "Water is considered integral for the stabilization andfunctionof proteins, which has recently attracted significant attention. However,the microscopic aspects of water ranging up to the second hydrationshell, including strongly and weakly bound water at the sub-nanometerscale, are not yet well understood. Here, we combined terahertz spectroscopy,thermal measurements, and infrared spectroscopy to clarify how thestrongly and weakly bound hydration water changes upon protein denaturation.With denaturation, that is, the exposure of hydrophobic groups inwater and entanglement of hydrophilic groups, the number of stronglybound hydration water decreased, while the number of weakly boundhydration water increased. Even though the constraint of water dueto hydrophobic hydration is weak, it extends to the second hydrationshell as it is caused by the strengthening of hydrogen bonds betweenwater molecules, which is likely the key microscopic mechanism forthe destabilization of the native state due to hydration. However, many of its fundamental physicalproperties remain unclear. Hydration is one of the most importantissues in solving the relationship between (bio)materials and water.A hydration water layer is formed in the region surrounding a dispersedsolute, and many studies have been conducted on the hydration statesof materials dispersed in water.14 Numerous proteins exhibit theirfunctions by folding into specific structures in their native state.However, they can also be denatured by heat and acid treatments, whichleads to the unfolding of the structures and exposes their hydrophobicgroups to water.19 It is important to understand the mechanisms that maintain the foldedstructure in the native state, from the viewpoints of both life sciencesand materials sciences. From the perspective of thermodynamics, ithas been shown that the Gibbs energy of the protein solution is stronglyaffected by hydration water.26 The difference in the Gibbs energy between the native and denaturedstates of proteins without water is much larger than that in aqueoussolutions. This indicates that hydration water destabilizes the foldedstructure of the proteins. The energetic balance between the nativeand denatured states should be discussed, considering not only thedifferences in the higher-order structure of the polypeptide chainsbut also the differences in hydration between these states. Recently,it has been revealed that entropy in terms of the state of water islarger in the native state Crambin solution (\u2212T\u0394S \u2248 500 kJ/mol) than in the denaturedstate, while the entropy of protein itself favors the unfolded denaturedstate.26 Hydration water is also knownto cause cold denaturation.28Protein stability is one of the most important issuesrelated tohydration and is an active research subject.34 Model proteins such as bovine serum albumin (BSA), which is usedin this paper, have been used to show that some water molecules aredirectly bound at various sites and that weakly bound water existsover long distances in the native state.32 This long-range hydration layerfluctuates, and a collective hydrogen-bond network reconstructs overa wide time range of 1\u2013200 ps depending on the surface siteof the protein. The dynamics of this time range are thought to stronglycorrelate with protein structuring and chemical properties.34 This long-range hydration is likely relatedto protein denaturation. Some hydrophobic groups are exposed to waterdue to protein denaturation, and change in the state of the surroundingwater is suggested.37 However, the details of this change are unclear . The microscopic mechanismunderlying the role of water on protein stability against denaturationand how it relates to the macroscopic thermodynamics of hydrationare not well understood. Integrated information on hydration changesupon denaturation at the microscopic scale, that is, how the structure,dynamics, and number of hydration water change with denaturation,is thus required to understand protein stabilization mechanisms indetail.Thermodynamicsfor the hydration states of proteins under denaturation has been widely studied. However, wedo not fully understand the microscopic changes of hydration waterunder denaturation, although the microscopic aspect of the hydrationstate has been widely investigated only in the native state.39 nuclear magnetic resonance (NMR) spectroscopy,40 neutron scattering,41 dielectricrelaxation spectroscopy,42 terahertz spectroscopy,47 and infraredspectroscopy.44 However, because the physical quantities observed by these methodsare essentially different, whether the observed hydration water isthe same and the relationship between the physical quantities is unclear.Therefore, basic information such as the number of hydration watervaries widely between reports, making it difficult to obtain a completepicture.Along with protein stabilization, studying the hydrationof solutesat the microscopic scale has faced numerous other problems. One isthat the relationship between the information obtained using variousmethods to observe hydration is unclear. Hydration can be observedby focusing on various physical properties using methods such as thermalmeasurements,48 however, theexact definition of each remains unclear. In addition, in some cases,the acceleration of water mobility by hydration has been reported.50Another problem derived from the lack of standardizationof theobserved information is that the definition of the phenomenon of hydrationis vague. In the simplest definition, hydration water can be definedas a water molecule whose motion is bound through interactions suchas hydrogen bonds and electrostatic interaction with a solute. However,since the degree of water binding varies with the surface functionalgroups of the protein and its distance from the surface, the numberof hydration water varies greatly depending on what degree of bindingis considered hydration water. It has been proposed that stronglybound water exists on the surface of the solute (mainly in the firsthydration shell), whereas weakly bound water exists outside of it(mainly in the second hydration shell);The challenges related to solving the above problems haveled tothe question, \u201cWhat is hydration?\u201d To answer this, itis necessary to observe the hydration of a unique sample using variousmethods and integrate the observed information to understand the relationshipbetween each physical quantity. To clarify the relationship betweenthe information obtained from these various methods, it is valuableto compare not only the identified numbers of hydration water butalso the responses to external stimuli, such as temperature changes.That is, heat-induced protein denaturation is one of the best researchtopics.51 which is one of the most important methods used in this study. Thedynamics of water molecules or their clusters can be observed in theterahertz frequency range.47 As described below, the hydrationstate can be determined by the changes in the motion of moleculardynamics.57 For example, the application of terahertz spectroscopy to the phospholipidbilayer shows a hydration layer with bound motions of 4\u20135 layers(\u223c28 water molecules per phospholipid molecule) on the membranesurface.53 In contrast, NMR and neutronscattering observations of water motion in the slower frequency rangehave estimated only a single hydration layer on the surface (approximatelysix molecules per phospholipid molecule).59 This implies that only strongly bound water is observed as hydrationwater in the latter, whereas the hydration in the former includesweakly affected water molecules. This was also confirmed for proteins,where hydration over several layers was observed by THz spectroscopy.60 When using these methods, hydrationwater is defined as water whose molecular mobility, such as diffusion,is altered by the solute. However, thermal measurements and infraredspectroscopy, which are the methods used in this study, have completelydifferent definitions of hydration. In thermal measurements, the waterthat does not freeze on cooling (unfreezable water or nonfreezingwater) is quantified.39 This layer is thought to be strongly influenced by the surface.When using infrared (IR) spectroscopy, the hydration state is definedby the frequency change of the OH stretching vibration. Water moleculeswhose hydrogen bonds are strengthened because of the solute affectionare usually regarded as hydration water using this method.60 The relationships between the molecular dynamics, antifreeze behavior,and OH vibrations of water are not well understood.For an integrated understanding of hydration, it isessential toobserve the weakly bound hydration water, which has rarely been observed,and understand its relationship with the state of the strongly boundhydration water, mainly in the first hydration shell. For this purpose,we used terahertz (THz) spectroscopy,In thisstudy, we used complementary methods to integrate microscopicinformation relating to the hydration of proteins and investigatechanges in the state of water during the denaturation of proteinsand the underlying causes. THz spectroscopy, infrared spectroscopy,and thermal measurements were used to observe the changes in the hydrationstate of BSA upon denaturation by heating. Importantly, we found thatthe response of the hydration information to denaturation was completelydifferent depending on the observation method, indicating that thestrongly and weakly bound hydration water had different responsesto the denaturation. These results help to elucidate the energeticbalance between native and denatured proteins, including the contributionof hydration water.Supporting Information). The volume fraction of BSA in solution was obtainedfrom the density and then used for THz spectroscopy analysis.BSA wasused as the model protein without further purification. BSA was mixedwith ultrapure water  at 13 wt %. Thesolution was clear and homogeneous. The density of the BSA solutionwas measured using a density meter  for temperatures< 40 \u00b0C, and for temperatures > 40 \u00b0C, extrapolationwas utilized  was usedas the infrared (IR) light source. The optical length of one of thesplit IR lights was changed using a delay stage. The emission anddetection of the THz waves were performed using dipole photoconductiveantennas . After narrowing the THzwave to several millimeters in diameter with a hyperhemispheric lens,it was focused on the sample position using plastic lenses, and lock-indetection was then performed. The entire system, including the fiberlaser, was purged with dry air .At the sample position, we applied an attenuated total reflection(ATR) setup to accurately determine the complex dielectric functionof aqueous solutions using a Dove prism made of silicon (refractiveindex of 3.4). The design of the ATR prism was the same as previouslydescribed.61 At the prism surface, the polarizationof the THz wave was set to p-polarized to detect even a small changein the dielectric constant induced by the hydration effect of thesolute. The penetration depth of the evanescent field of the THz wavewas \u223c20 \u03bcm. The temperature of the ATR sample cell wascontrolled using a Peltier device with proportional-integral-derivative(PID) control . With our setup,the complex dielectric constants could be precisely determined withhigh reliability in the 0.3\u20132.5 THz regions. The measurementsof pure water were repeated six times at the same temperature. Themeasurements of BSA solution were repeated six times (<60 \u00b0C)or four times (>60 \u00b0C). For the fitting analysis, the averageddata and its standard deviations were used.THz spectroscopywas performed using custom-made terahertz time-domain spectroscopy(THz-TDS) equipment.39 that freezesat a much lower temperature than 0 \u00b0C. Only \u201cunfreezablewater (nonfreezing water)\u201d that does not freeze by cooling39 was measurable with this method.To investigate the number of unfreezable water, the following temperaturecycle was employed with a ramp rate of 2 \u00b0C/min: (1) cooled fromroom temperature (21\u201323 \u00b0C) down to \u221225 \u00b0C,(2) heated from \u221225 \u00b0C up to an arbitrary temperature T0, (3) cooled from T0 to \u221225 \u00b0C, and (4) heated from \u221225 \u00b0C to T0. From the thermal anomaly corresponding tothe melting of water during cycles (2) and (4), the number of unfreezablewater was determined. The measurements were repeated four times atthe same conditions, and their averages and standard deviations wereused for the analysis.Differential scanningcalorimetry (DSC) was performed using commercial equipment . The temperature of the equipment was calibrated usingindium (156.6 \u00b0C) and pure water (0 \u00b0C), and the heat flowwas calibrated using the melting enthalpy of frozen pure water. Thetemperature range was \u221275 to 85 \u00b0C. First, we confirmedwhether there was no thermal anomaly between \u221275 and 0 \u00b0C,as these would indicate that the sample did not include the so-called\u201cintermediate water\u201dFourier-transforminfrared (FTIR) spectroscopy was conducted using commercial equipment with an ATR setup . The temperaturewas controlled between 35 and 75 \u00b0C using a heater attachment. A total of 5 \u03bcL of sample solutionwas dropped onto the ATR prism. The number of accumulations was setto 64, and the averaged spectra were used for analysis. The fittingerror was used for the error bars in the ratio of three componentsof OH bands.Circular dichroic (CD)spectra were measured between 190 and 250 nm using commercial equipment. The temperature was controlled using a Peltier device. For the CD spectrum measurements, a 13 wt % BSAsolution was diluted 10,000 times. The optical length of the quartzcell was 1 cm. The number of accumulations was set to 3, and the averagedspectra were used for analysis.222/\u00b0, the\u03b1-helix fraction fH in BSA was calculatedusing the following equations62l is the optical path length (1 cm), m is the molar concentration of BSA (=2.05 \u00d7 10\u20137 mol/L), and A is the number of aminoacid residues in BSA (583). The results for fH presented in 63 and the results of this study are in agreement. Therefore, we definedthe denaturation temperature as the temperature at which the \u03b1-helixcontent becomes 41% (the midpoint between 66 and 16%). By linear fittingbetween 45 and 85 \u00b0C, the temperature at which an \u03b1-helixcontent of 41% was reached was determined to be \u223c59 \u00b0C.The results of circular dichroism(CD) spectra and DSC measurements for the denaturation behavior ofBSA are shown in 63 and the denatured state is maintained. Fromthese results, the denaturation temperature of BSA in pure water wasdetermined to be \u223c60 \u00b0C.47 The most significantcontribution comes from the slow relaxation mode of the collectiverotational relaxation of water, which peaks at \u223c0.02 THz. Theintensity of this relaxation is so large that it is still observedin the THz frequency band. The increase in the spectrum with increasingtemperature is attributed to the fact that slow relaxation becomesfaster, and the spectrum shifts to a higher frequency.46 In addition, a collisional relaxation mode of water exists at \u223c1THz (fast relaxation), corresponding to an isolated water moleculethat is transiently broken off from the hydrogen-bonding network.Furthermore, intermolecular bending and stretching vibrational modesexist at \u223c4 and 6 THz, respectively. As the intensity of thebending mode is very weak,47 it can beignored for this investigation. The absorption by the protein in thisfrequency range is also weak enough to be ignored.64 In this study, we discuss the changes in the hydration state owingto slow relaxation. When water molecules are bound by a solute, theslow relaxation of the bound water shifts to the lower frequency sideand is not observed in the THz range.52 Only the relaxation of the residual bulk-like water is observed.Here, hydration water is defined as water whose slow relaxation dynamicsare not observed in the THz frequency band. Thus, the number of hydrationwater is determined by the degree of reduction in the intensity ofthe slow relaxation mode. Indeed, if we compare pure water and BSAsolution, we can see that the intensity of the BSA solution is smallerthan that of pure water. 49c is the volume fractionof water in the system, and its value at each temperature was obtainedfrom the density measurement of the BSA solution, as shown in Table S1. The first term in parentheses refersto slow relaxation, the second term is fast relaxation, and the thirdterm is intermolecular stretching vibration. \u0394\u03b51 and \u0394\u03b52 are the strengths of the slow andfast relaxations, respectively. \u03c41 and \u03c42 are the relaxation times of their respective modes. As, \u03c9s, and \u03b3s are the amplitude, resonant angular frequency, and damping constant,respectively, of the intermolecular stretching vibration mode. Forfitting to pure water, \u0394\u03b51 and \u0394\u03b52 were set as free parameters, whereas the other parameterswere fixed as previously reported.46 Weconfirmed that the obtained \u0394\u03b51 and \u0394\u03b52, which dominantly affect the calculation of the hydrationnumber, were in good agreement with previously reported results.46 To fit the BSA solution results, only \u0394\u03b51 was used as a free parameter. \u0394\u03b52 wasfixed at 2.37, which was the value obtained by fitting the BSA solutionresult at 25 \u00b0C without fixing \u0394\u03b51 and\u0394\u03b52. The other parameters were fixed at thesame values as those of pure water. The parameters obtained by fittingare shown in the Supporting Information for pure water and BSA solutions (Tables S2 and S3). As shown in Figure S2,\u0394\u03b51 linearly decreased with the temperaturefor pure water, whereas it showed a relatively large gap of approximately55\u201360 \u00b0C for the BSA solution.THzspectroscopy was utilized to investigate the hydration state of BSA,and the results are shown in g1 = 2.9 for slow relaxation and g2 = 1.0 for fast relaxation) for these modes6553Thus, we calculated the hydration number boundto BSA proteinsusing the following formula considering Kirkwood\u2019s correlationfactor .60 The calculated number of hydration watermolecules gradually decreased with temperature in the native statebelow 60 \u00b0C. This behavior indicates that native BSA is dehydratedwith temperature, probably because of the activation of water dynamics.The calculated hydration number clearly shows a jump to a larger valueat 60 \u00b0C, that is, by the denaturation of BSA, which is consistentwith the reported results.37 It is expectedthat the bound water molecules around the exposed hydrophobic groupsof the protein are newly observed as hydration water, which may bebecause of the hydrophobic hydration water.36 A greater number of hydration water at a partially hydrophobic surfacethan at a hydrophilic surface has also been reported for phospholipidbilayers.5739 The thermal anomalies due to the melting of ice before(1st heating) and after (2nd heating) heating to 75 \u00b0C are shownin T0, is shown in The hydrationof solutes has been widely investigated using thermal measurementsand has predominantly focused on unfreezable water. T0 is assumed to be the unfreezable water after heating to T0. In contrast to the change in the hydrationnumber evaluated by THz spectroscopy, the number of unfreezable watermolecules decreased with denaturation at 60 \u00b0C. When T0 < 60 \u00b0C, the protein may refold tosome extent after cooling to 0 \u00b0C.63 In this case, the number cannot represent the exact number of unfreezablewater molecules at T0, and it may representonly the number at 0 \u00b0C in the native state. However, when T0 > 60 \u00b0C, the proteins rarely showrefolding.63 This indicates that the numberof unfreezablewater in the denatured state is less than the number at 0 \u00b0C.In other words, there is no doubt that the number of unfreezable wateris smaller in the denatured state.We calculated the number of unfreezable water moleculesper BSAas shown in As addressed in the introductionsection, the hydration water observedby THz spectroscopy and unfreezable water measured by DSC is completelydifferent. THz spectroscopy detects hydration by the change in thewater molecular dynamics in the ps timescale and evaluates hydrationwater, including both the strongly and weakly bound water . In contrast, unfreezable wateris likely to only include strongly bound water. Indeed, below thedenaturation temperature, the number of hydration water observed byTHz spectroscopy was larger than that of unfreezable water. Therefore,it is unsurprising that the changes in the numbers due to denaturationare completely different. The origin of this contrasting behaviorwill be discussed later.\u20131 depending onthe strength of the hydrogen bond.44 Whenthe OH group does not have (or only has very weak) hydrogen bondswith other molecules and exhibits almost free vibration, the vibrationmode exists at 3590 cm\u20131. The vibration mode wasat 3295 cm\u20131 for the strongly hydrogen-bonded OHgroup. In this case, the water molecule had nearly four hydrogen bondswith the other molecules. When the strength of the hydrogen bond isintermediate, and the number of hydrogen bonds per water moleculeis 2\u20133, the band shifted to 3460 cm\u20131. Thesethree vibrations coexisted in pure water: The strong hydrogen bondis \u223c80%, the intermediate hydrogen bond is \u223c15%, andthe weak (or no) hydrogen bond is \u223c5%. In this study, we investigatedthe change in the fraction of these three vibrations by changing thetemperature of the BSA solution. Compared to THz spectroscopy and DSC, IR spectroscopy provides moremicroscopic information about hydration, that is, the hydrogen bondsbetween water molecules. It is known that the OH stretching vibrationmode exists at 3000\u20133500 cmIn this investigation, we employed threemethods to evaluate thehydration state of BSA and its changes upon denaturation. As shownin 67 However, THz spectroscopyresults indicated 2200\u20133300 bound water molecules at the surfacewhen the number of strongly and weakly bound water was added. Theextra 200\u20131300 hydration water molecules likely exist, mainlyin the second hydration shell. Furthermore, a previous NMR study reportedthat BSA contained \u223c30 strongly bound water molecules and \u223c3000weakly bound water molecules.29 The totalnumber of strongly and weakly bound water was comparable between THz-TDSand NMR. The strongly bound water observed by NMR seems to be waterthat is directly bonded to functional groups,30 which moves very slowly, whereas the unfreezable water observedby DSC is likely to be water that is not directly bonded but whosemovement is highly constrained through hydrogen bonds and electrostaticinteractions. The number of weakly bound water molecules measuredby THz spectroscopy decreases with temperature, and this is probablybecause of thermal activation, which is consistent with the resultsof IR spectroscopy, indicating a decrease in strong hydrogen bonds.First,we discuss the hydration state of native BSA. In the nativestate, proteins generally form folded structures due to the chemicalbonds between the polar groups in a protein, which helps avoid exposingthe hydrophobic part to water. Hydration thus mainly occurs on thehydrophilic surface of BSA. The DSC results indicate that the stronglybound water, mainly in the first hydration shell, is \u223c2000water molecules per BSA molecule, corresponding to an average of twowater layers at the surface.55 This is also consistentwith the hydration states of the phospholipid bilayers; a more hydrophobicsurface has more weakly bound water than a more hydrophilic surface.57 This result is likely related to hydrophobic hydration.56 There are smaller number of weakly bound water in the native statethan in the denatured state, which is consistent with the fact thatmany water molecules around an intrinsically disordered protein, whichis mostly composed of hydrophilic polar groups, is strongly boundwater.68 It is also possible that the polargroups in the protein that bind to each other in the native stateare exposed to water in the denatured state, and that weakly boundwater is detected around the exposed polar groups. With denaturation,the unfolded chains of the proteins become entangled with each other,and the protein solution forms a gel state.19 It is expected that the hydrophilic part that is exposed to waterin the native state entangles with each other in places and that thepart that interacts with water decreases. Thus, the number of stronglybound water was decreased because of denaturation. The FTIR resultsprovided additional information. Upon denaturation, the strong hydrogenbonds of water were found to increase when compared to pure water,whereas the intermediate and weak hydrogen bonds decreased. This responsewas consistent with the THz spectroscopy results. That is, the stronghydrogen bonds increase, accompanied by an increase in the numberof weakly bound water, indicating that the hydrogen bond in weaklybound water is stronger than that in pure water. The binding of waterto each other by the hydrogen bonds is likely the cause of many weaklybound waters in the denatured state. The change in the hydrogen bondoccurs at a slightly lower temperature (55 \u00b0C) than the changein the number of weakly bound water (60 \u00b0C), implying that anincrease in the hydrogen bond antecedes the increase in the numberof weakly bound water. It is noticed that the number of hydrationwater was implied to decrease upon pH-change-induced denaturationof a protein by THz spectroscopy,69 whichis a contrasting trend to the present study. It is possible that thebalance of polar and nonpolar groups in the protein was drasticallychanged by pH change, in contrast to the present study.The responses of hydration to the denaturation of BSA are characteristicdepending on the measurement methods. While the number of stronglybound water measured by DSC decreased with denaturation, the numberof weakly bound water measured by THz spectroscopy increased. Thisindicates that the number of weakly bound water largely increases,accompanied by the denaturation of BSA. Considering that the foldingstructure is collapsed, and the inner core of the protein is exposedto water by denaturation, it is expected from the THz spectroscopyresults that the newly hydrated hydrophobic part will mainly contributeto weakly bound water, which is in agreement with previous experimentsand simulation results.26 The partial enthalpy of hydration water is reported to be lowerin the denatured state, which is the main cause of the relative destabilizationof the native state of proteins. The entropy of water molecules isreduced by the denaturation. These thermodynamics have indicated thatmore water molecules are bound in the denatured state than in thenative state, which is consistent with the THz spectroscopy resultin the present study. Further, the present results imply that thedecreased partial enthalpy of water is due to the increase in thestronger hydrogen bonds in the denatured state. Islam et al. experimentallyreported that an increase in the hydrophobic residues at the surfaceof the protein leads to the stabilization of the protein through adecrease in the enthalpy of hydration water.70 Barnes also reported that more hydrophobic sites on the proteinsurface were hydrated, with slower diffusion of water.71 Sumi and Imamura reported by simulation thatwater drives the exposure of the hydrophobic groups of proteins, whichis a critical factor for the destabilization of native state proteins.72 It has also been shown that the absorption ofthe THz wave is reduced as water molecules enter into the hydrophobicpockets of the protein, indicating that the hydrophobic part of theprotein restricts the water dynamics.73 The present results are consistent with the findings of these reports;that is, the exposure of hydrophobic groups to water by denaturationincreases the hydration water molecules with strong hydrogen bonds,leading to a decrease in the enthalpy in the denatured state. Thisincrease in the number of hydration water is not explained by stronglybound water, indicating that weakly bound water plays a crucial rolein the energy balance of the proteins. Because the layer of weaklybound water extends for several layers from the surface of the protein,it is suggested that water within the long range (as much as 1 nm)affects the stability of the protein.Theseresults are related to the thermodynamics of hydration waterreported in the literature.49 which is consistent with the simulation study.74 The osmolytes change the dynamics of weaklybound water, which controls protein stability. This is consistentwith the results of this investigation, as the states of weakly boundwater were found to affect stability. How osmolytes alter weakly boundwater on the protein surface is an interesting question that requiresfurther research. Based on the present results, THz spectroscopy isexpected to be a powerful tool for measuring weakly bound water withhigh-level accuracy.The present findings arestrongly related to the effects of osmolytes on protein stability. Recently, using THzspectroscopy, we reported that the effects of osmolytes on proteinstability were dominated by a water-mediated indirect interactionrather than a direct interaction with osmolytes,55 However, there seems to be a correlation with weakly bound waterin terms of hydrogen-bond strength. In other words, weakly bound wateris thought to be caused by strong hydrogen bonds between water molecules.Based on the above discussion, the increase in the number of weaklybound water is due to the exposure of the hydrophobic groups to water.In other words, hydrogen bonds between water molecules around hydrophobicgroups become stronger, resulting in weakly bound water. This is ingood agreement with the picture of hydrophobic hydration that haslong been proposed but is still a matter of dispute,56 i.e., the formation of \u201diceberg\u201d structuresaround hydrophobic functional groups.75 These resultsindicate that it is very important to understand the mobility andhydrogen-bonding structures of weakly and strongly bound water toaccurately understand the hydration state of a material.Finally, we discuss the relationship betweenthe hydration informationobserved using various methods. In this study, we conducted THz spectroscopy,thermal measurements, and IR spectroscopy to measure weakly boundwater, strongly bound water, and hydrogen-bond strength, respectively.The results show that the behaviors of weakly bound water and stronglybound water are independent. This is because strongly bound wateris mostly present around hydrophilic groups, while weakly bound wateris also common around hydrophobic groups.39 For example, here, we suggestthat the control of the weakly bound hydration water is a key factorin the design of protein stabilizers, which may be valuable for foodscience. In other examples, the interactions between synthetic polymersand biomolecules, such as proteins, are closely related to the weaklybound hydration water (intermediate water), and its control is importantfor creating biomaterials for medical devices.39 Ithas also been reported that the lubrication of materials in waterdepends on the hydration state at the sub-nanometer scale.8 The present findings and methodology are importantas we move forward with research on these applications, as they suggestthat the design of the exposed hydrophobic groups is the key to controllingthe hydration state, including the weakly bound hydration water atthe sub-nanometer scale. As numerous unknowns regarding the stateof the weakly bound hydration water in the second hydration shellat the sub-nanometer scale still exist, future detailed studies throughexperiments, theory, and simulations are expected to greatly advanceour understanding of the physical properties of various materialsin water and thus further the development of new industrial materials.Theresults of this study will contribute to applied sciences,as it has recently been highlighted that controlling the water stateis important for the development of smart (bio)materials.72 However, the entanglement of hydrophilic groups upon denaturationmay reduce the number of sites where water can bind strongly, reducingthe strongly bound hydration water. We could reveal that hydrationinformation by each methodology does not necessarily change in thesame way by external stimuli, and the integration of various typesof information is important for universal understanding.In this study, we observed the changesin the hydration state ofproteins upon denaturation using three measurement techniques thatprovide different information on hydration: THz spectroscopy, thermalmeasurement, and infrared spectroscopy. THz spectroscopy providesthe combined hydration number of strongly bound water and weakly boundwater, whereas thermal measurements only provide information regardingunfreezable water, that is, strongly bound water. These observationsshow completely different changes with denaturation. The number ofstrongly bound hydration water decreased with denaturation, whilethe number of weakly bound hydration water increased. When the resultsof IR spectroscopy were used, it was found that the strength of thehydrogen bonds among the weakly bound water became stronger, suggestingthat the strengthening of the hydrogen bonds between water moleculesreduces the overall motion of the water molecules. These results indicatethat when the hydrophobic groups in the protein are exposed to waterupon denaturation, more weakly bound water is created around them.This is thought to be caused by stronger hydrogen bonds between watermolecules rather than between water and hydrophobic chains, whichis likely related to hydrophobic hydration (iceberg-like formation).This result provides microscopic information on protein stabilitythat has been explained thermodynamically, that is, that hydrationrelatively destabilizes the native state. The present results mayalso be related to the microscopic mechanism of recent reports thatproteins become more stable as their hydrophobic surfaces increase."
\ No newline at end of file